U.S. patent number 8,008,266 [Application Number 10/719,493] was granted by the patent office on 2011-08-30 for methods of treating cancer using immunostimulatory oligonucleotides.
This patent grant is currently assigned to Coley Pharmaceutical Group, Inc., N/A, The United States of America as represented by the Department of Health and Human Services, University of Iowa Foundation. Invention is credited to Dennis Klinman, Arthur M. Krieg, Alfred D. Steinberg.
United States Patent |
8,008,266 |
Krieg , et al. |
August 30, 2011 |
Methods of treating cancer using immunostimulatory
oligonucleotides
Abstract
Nucleic acid sequences containing unmethylated CpG dinucleotides
that modulate an immune response including stimulating a Th1
pattern of immune activation, cytokine production, NK lytic
activity, and B cell proliferation are disclosed. The sequences are
also useful as a synthetic adjuvant.
Inventors: |
Krieg; Arthur M. (Wellesley,
MA), Steinberg; Alfred D. (Potomac, MD), Klinman;
Dennis (Potomac, MD) |
Assignee: |
University of Iowa Foundation
(Iowa City, IA)
The United States of America as represented by the Department of
Health and Human Services (Washington, DC)
N/A (New York, NY)
Coley Pharmaceutical Group, Inc. (N/A)
|
Family
ID: |
46255850 |
Appl.
No.: |
10/719,493 |
Filed: |
November 21, 2003 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20040087538 A1 |
May 6, 2004 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
09337619 |
Jun 21, 1999 |
6653292 |
|
|
|
08960774 |
Oct 30, 1997 |
6239116 |
|
|
|
08738652 |
Oct 30, 1996 |
6207646 |
|
|
|
08386063 |
Feb 7, 1995 |
6194388 |
|
|
|
08276358 |
Jul 15, 1994 |
|
|
|
|
Current U.S.
Class: |
514/44R; 435/455;
435/320.1; 536/24.5; 536/24.1; 435/325; 536/23.1; 435/69.1 |
Current CPC
Class: |
C07H
21/00 (20130101); A61P 37/02 (20180101); A61P
1/02 (20180101); A61K 31/4706 (20130101); A61P
37/04 (20180101); A61P 37/06 (20180101); A61P
19/02 (20180101); A61P 35/00 (20180101); C12Q
1/68 (20130101); A61K 31/711 (20130101); A61P
31/04 (20180101); A61P 1/04 (20180101); A61P
37/08 (20180101); A61P 43/00 (20180101); A61P
31/12 (20180101); C12N 15/117 (20130101); A61P
1/00 (20180101); A61P 33/00 (20180101); A61K
39/00 (20130101); A61P 11/06 (20180101); A61K
31/7125 (20130101); A61K 39/39 (20130101); A61K
31/7048 (20130101); A61P 17/06 (20180101); A61K
31/00 (20130101); C12N 2310/17 (20130101); C12N
2310/315 (20130101); A61K 2039/55561 (20130101) |
Current International
Class: |
C12N
15/11 (20060101); A61K 48/00 (20060101); C12N
5/00 (20060101); C12P 21/06 (20060101); C07H
21/04 (20060101); C07H 21/02 (20060101); C12N
15/00 (20060101) |
Field of
Search: |
;514/44 ;536/23.1
;530/387.1,387.3,388.22,388.8
;424/130.1,136.1,142.1,143.1,155.1 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
0468520 |
|
Jan 1992 |
|
EP |
|
0302758 81 |
|
Mar 1994 |
|
EP |
|
WO 91/12811 |
|
Sep 1991 |
|
WO |
|
WO 92/03456 |
|
Mar 1992 |
|
WO |
|
WO 92/18522 |
|
Oct 1992 |
|
WO |
|
WO 92/21353 |
|
Dec 1992 |
|
WO |
|
WO 94/19945 |
|
Sep 1994 |
|
WO |
|
WO 95/05853 |
|
Mar 1995 |
|
WO |
|
WO 95/17507 |
|
Jun 1995 |
|
WO |
|
WO 95/26204 |
|
Oct 1995 |
|
WO |
|
WO 96/02555 |
|
Feb 1996 |
|
WO |
|
WO 96/02560 |
|
Feb 1996 |
|
WO |
|
WO 96/35782 |
|
Nov 1996 |
|
WO |
|
WO 97/28259 |
|
Aug 1997 |
|
WO |
|
WO 98/55495 |
|
Mar 1998 |
|
WO |
|
WO 98/14210 |
|
Apr 1998 |
|
WO |
|
WO 98/18810 |
|
May 1998 |
|
WO |
|
WO 98/32462 |
|
Jul 1998 |
|
WO |
|
WO 98/37919 |
|
Sep 1998 |
|
WO |
|
WO 98/40100 |
|
Sep 1998 |
|
WO |
|
WO 98/52581 |
|
Nov 1998 |
|
WO |
|
WO 98/55495 |
|
Dec 1998 |
|
WO |
|
WO 99/11275 |
|
Mar 1999 |
|
WO |
|
WO 99/56755 |
|
Nov 1999 |
|
WO |
|
WO 99/62923 |
|
Dec 1999 |
|
WO |
|
WO 00/06588 |
|
Feb 2000 |
|
WO |
|
WO 00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/20039 |
|
Apr 2000 |
|
WO |
|
WO 00/21556 |
|
Apr 2000 |
|
WO |
|
WO 00/62787 |
|
Oct 2000 |
|
WO |
|
WO 00/67023 |
|
Nov 2000 |
|
WO |
|
WO 01/02007 |
|
Jan 2001 |
|
WO |
|
WO 01/12223 |
|
Feb 2001 |
|
WO |
|
WO 01/12804 |
|
Feb 2001 |
|
WO |
|
WO 01/55341 |
|
Aug 2001 |
|
WO |
|
WO 01/68077 |
|
Sep 2001 |
|
WO |
|
WO 01/68078 |
|
Sep 2001 |
|
WO |
|
WO 01/68103 |
|
Sep 2001 |
|
WO |
|
WO 01/68116 |
|
Sep 2001 |
|
WO |
|
WO 01/68117 |
|
Sep 2001 |
|
WO |
|
WO 2004/007743 |
|
Jan 2004 |
|
WO |
|
WO 2004/026888 |
|
Apr 2004 |
|
WO |
|
WO 2004/094671 |
|
Nov 2004 |
|
WO |
|
WO 2008/030455 |
|
Mar 2008 |
|
WO |
|
WO 2008/033432 |
|
Mar 2008 |
|
WO |
|
WO 2008/039538 |
|
Apr 2008 |
|
WO |
|
WO 2008/068638 |
|
Jun 2008 |
|
WO |
|
WO 2008/139262 |
|
Nov 2008 |
|
WO |
|
Other References
Agarwal et al. (Trends in Mol. Med., 2002; 8:114-121). cited by
examiner .
Crooke et al. (Therapeutic application of Nucleotides, R.G. Landers
Co., Austin, TX, 1995, Chapter 5, pp. 63-84). cited by examiner
.
Peterson et al. (Eur. J. Cancer. 2004; 40: 837-844). cited by
examiner .
Schuh (Toxicologic Pathology. 2004; 32 (Suppl. 1): 53-66). cited by
examiner .
Bibby (Eur. J. Cancer. Apr. 2004; 40 (6): 852-857). cited by
examiner .
Wang et al. (Exp. Opin. Biol. Ther. 2001; 1 (2): 277-290). cited by
examiner .
Kelland (Eur. J. Cancer. Apr. 2004; 40 (6): 827-836). cited by
examiner .
Saijo et al. (Cancer Sci. Oct. 2004; 95 (10): 772-776). cited by
examiner .
Zips et al. 2005. New Anticancer Agents: In Vitro and In Vivo
Evaluation. In Vivo 19:1-8. cited by examiner .
Weiner J. Leukocyte Biology, 68(4):455-463, 2000. cited by examiner
.
Krieg et al. Nature, 374:546-549, 1995. cited by examiner .
Ballas et al. The Journal of Immunology, 167:4878-4886, 2001. cited
by examiner .
Agrawal et al. TRENDS in Molecular Medicine, 2002, 8/3:114-120.
cited by examiner .
MSNBC News Services. Mixed results on new cancer drug. 2000. cited
by examiner .
Forni, Lollini, Musiani, and Colombo. Immunoprevention of Cancer:
Is the time ripe? Cancer Research, 2000. vol. 60, pp. 2571-2575.
cited by examiner .
Gura. Systems for identifying new drugs are often faulty. Science,
1997. vol. 278, pp. 10-41-1042. cited by examiner .
Sun, S. et al., "Mitogenicity of DNA from Different Organisms for
Murine B Cells", The Journal of Immunology, 1997, pp. 3119-3125,
The American Association of Immunologists. cited by other .
Anitescu et al., Interleukin-10 functions in vitro and in vivo to
inhibit bacterial DNA-induced secretion of interleukin-12. J
Interferon Cytokine Res. Dec. 1997;17(12):781-8. cited by other
.
Chace et al., Bacterial DNA-induced NK cell IFN-gamma production is
dependent on macrophage secretion of IL-12. Clin Immunol
Immunopathol. Aug. 1997;84(2):185-93. cited by other .
Cohen, Selective anti-gene therapy for cancer: principles and
prospects. Tohoku J Exp Med. Oct. 1992;168(2):351-9. cited by other
.
Friedberg et al., Combination immunotherapy with a CpG
oligonucleotide (1018 ISS) and rituximab in patients with
non-Hodgkin lymphoma: increased interferon-alpha/beta-inducible
gene expression, without significant toxicity. Blood. Jan. 15,
2005;105(2):489-95. Epub Sep. 9, 2004. cited by other .
Higaki et al., Mechanisms involved in the inhibition of growth of a
human B lymphoma cell line, B104, by anti-MHC class II antibodies.
Immunol Cell Biol. Jun. 1994;72(3):205-14. cited by other .
Hinkula et al., Recognition of prominent viral epitopes induced by
immunization with human immunodeficiency virus type I regulatory
genes. J Virol. Jul. 1997;71(7):5528-39. cited by other .
Krieg et al., Lymphocyte activation mediated by
oligodeoxynucleotides or DNA containing novel un-methylated CpG
motifs. American College of Rheumatology 58.sup.th National
Scientific Meeting. Minneapolis, Minnesota, Oct. 22, 1994.
Abstracts. Arthritis Rheum. Sep. 1994;37(9 Suppl). cited by other
.
Krieg et al., Bacterial DNA or oligonucleotides containing CpG
motifs protect mice from lethal L. monocytogenes challenge. 1996
Meeting on Molecular Approaches to the Control of Infectious
Diseases. Cold Spring Harbor Laboratory, Sep. 9-13, 1996:116. cited
by other .
Krieg et al., Infection. In: McGraw Hill Book. 1996:242-3. cited by
other .
Krieg et al., Lymphocyte activation by CpG dinucleotide motifs in
prokaryotic DNA. Trends Microbiol. Feb. 1996;4(2):73-6. cited by
other .
Krieg, Therapeutic potential of Toll-like receptor 9 activation.
Nat Rev Drug Discov. Jun. 2006;5(6):471-84. cited by other .
Kuramoto et al., Induction of T-cell-mediated immunity against
MethA fibrosarcoma by intratumoral injections of a bacillus
Calmette-Guerin nucleic acid fraction. Cancer Immunol Immunother.
1992;34(5):283-8. cited by other .
Leibson et al., Role of gamma-interferon in antibody-producing
responses. Nature. Jun. 28-Jul. 4, 1984;309(5971):799-801. cited by
other .
Liu et al., CpG ODN is an effective adjuvant in immunization with
tumor antigen. J Invest Med. Sep. 7, 1997;45(7):333A. cited by
other .
Loke et al., Delivery of c-myc antisense phosphorothioate
oligodeoxynucleotides to hematopoietic cells in culture by liposome
fusion: specific reduction in c-myc protein expression correlates
with inhibition of cell growth and DNA synthesis. Curr Top
Microbiol Immunol. 1988;141:282-9. cited by other .
Macfarlane et al., Unmethylated CpG-containing
oligodeoxynucleotides inhibit apoptosis in WEHI 231 B lymphocytes
induced by several agents: evidence for blockade of apoptosis at a
distal signalling step. Immunology. Aug. 1997;91(4):586-93. cited
by other .
Maltese et al., Sequence context of antisense RelA/NF-kappa B
phosphorothioates determines specificity. Nucleic Acids Res. Apr.
11, 1995;23(7):1146-51. cited by other .
Mui et al., Immune stimulation by a CpG-containing
oligodeoxynucleotide is enhanced when encapsulated and delivered in
lipid particles. J Pharmacol Exp Ther. Sep. 2001;298(3):1185-92.
cited by other .
Ochiai et al., Studies on lymphocyte subsets of regional lymph
nodes after endoscopic injection of biological response modifiers
in gastric cancer patients. Int J Immunotherapy. 1986;11(4):259-65.
cited by other .
Perlaky et al., Growth inhibition of human tumor cell lines by
antisense oligonucleotides designed to inhibit p120 expression.
Anticancer Drug Des. Feb. 1993;8(I):3-14. cited by other .
Ratajczak et al., In vivo treatment of human leukemia in a scid
mouse model with c-myb antisense oligodeoxynucleotides. Proc Natl
Acad Sci U S A. Dec. 15, 1992;89(24):11823-7. cited by other .
Sonehara et al., Hexamer palindromic oligonucleotides with 5'-CG-3'
motif(s) induce production of interferon. J Interferon Cytokine
Res. Oct. 1996;16(10):799-803. cited by other .
Sparwasser et al., Bacterial DNA causes septic shock. Nature. Mar.
27, 1997;386(6623):336-7. cited by other .
Stein et al., Problems in interpretation of data derived from in
vitro and in vivo use of antisense oligodeoxynucleotides. Antisense
Res Dev. 1994 Summer;4(2):67-9. cited by other .
Stein et al., Non-antisense effects of oligodeoxynucleotides.
Antisense Technology. 1997; ch11: 241-64. cited by other .
Takatsuki et al., Interleukin 6 perfusion stimulates reconstitution
of the immune and hematopoietic systems after 5-fluorouracil
treatment. Cancer Res. May 15, 1990;50(10):2885-90. cited by other
.
Tokunaga et al Jpn. J. Infect. Dis 52, 1-11, 1999. cited by other
.
Weigel et al., CpG oligodeoxynucleotides potentiate the antitumor
effects of chemotherapy or tumor resection in an orthotopic murine
model of rhabdomyosarcoma. Clin Cancer Res. Aug. 1,
2003;9(8):3105-14. cited by other .
Weiner et al., The immunobiology and clinical potential of
immunostimulatory CpG oligodeoxynucleotides. J Leukoc Biol. Oct.
2000;68(4):455-63. cited by other .
Weiner et al., Immunostimulatory oligodeoxynucleotides containing
the CpG motif are effective as immune adjuvants in tumor antigen
immunization. Proc Natl Acad Sci U S A. Sep. 30,
1997;94(20):10833-7. cited by other .
Weiner et al., Immunostimulatory CpG oligodeoxynucleotide is
effective as an adjuvant in inducing production of anti-idiotype
antibody and is synergistic with GMCSF. Blood. Nov. 15,
1996;88(10):Suppl. 1 pt. 1. Abstract #348. cited by other .
Yamamoto, Cytokine production inducing action of oligo DNA. Rinsho
Meneki. 1997; 29(9): 1178-84. Japanese. cited by other .
Zhao et al., Pattern and kinetics of cytokine production following
administration of phosphorothioate oligonucleotides in mice.
Antisense Nucleic Acid Drug Dev. Oct. 1997;7(5):495- 502. cited by
other .
Patent Interference No. 105,171. Iowa Preliminary Motion 3 (for
judgment based on failure to comply with 35 U.S.C. 135(b)).
(Electronically filed, unsigned). Jun. 7, 2004. cited by other
.
Patent Interference No. 105,171. Iowa Preliminary Motion 4 (for
judgment of no interference in fact). (Electronically filed,
unsigned). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Iowa Preliminary Motion 5 (for
judgment based on lack of enablement). (Electronically filed,
unsigned). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Iowa Preliminary Motion 6 (for
judgment based on lack of adequate written description).
(Electronically filed, unsigned). Jun. 7, 2004. cited by other
.
Patent Interference No. 105,171. Iowa Preliminary Motion 7 (motion
to redefine interference to designate claims as not corresponding
to the Count). (Electronically filed, unsigned). Jun. 7, 2004.
cited by other .
Patent Interference No. 105,171. Iowa Preliminary Motion 8
(contingent motion to redefine the Count). (Electronically filed,
unsigned). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Iowa Preliminary Motion 9 (motion
for benefit of earlier application). (Electronically filed,
unsigned). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Iowa Preliminary Motion 10
(contingent motion to redefine the interference by adding a
continuation application). (Electronically filed, unsigned). Jul.
2, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 3 (to Iowa Preliminary Motion 3 for judgment
under 35 USC 135(b)). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 4 (to Iowa Preliminary Motion 4 for judgment
of no interference in fact). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 5 (to Iowa Preliminary Motion 5 for judgment
that UC's claim is not enabled). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 6 (to Iowa Preliminary Motion 6 for judgment
based on lack of adequate written description). Sep. 9, 2004. cited
by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 7 (to Iowa Preliminary Motion 7 to redefine
the interference). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 8 (to Iowa Preliminary Motion 8 to redefine
the Count). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Response 9 (to Iowa Contingent Motion 9 for benefit).
Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 10 (to Iowa Contingent Motion 10 to redefine
the interference). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Opposition 11 (to Iowa Contingent Motion 11 to
suppress). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Iowa Reply 3 (in support of Iowa
Preliminary Motion 3 for judgment under 35 U.S.C. .sctn.135(b))
(Electronically filed, unsigned). Oct. 15, 2004. cited by other
.
Patent Interference No. 105,171. Iowa Reply 4 (in support of Iowa
Preliminary Motion for judgment of no interference in fact)
(Electronically filed, unsigned). Oct. 15, 2004. cited by other
.
Patent Interference No. 105,171. Iowa Reply 5 (in support of Iowa
Preliminary Motion 5 for judgment that UC's claim 205 is not
enabled) (Electronically filed, unsigned). Oct. 15, 2004. cited by
other .
Patent Interference No. 105,171. Iowa Reply 6 (in support of Iowa
Preliminary Motion 6 for judgment based on lack of adequate written
description) (Electronically filed, unsigned). Oct. 15, 2004. cited
by other .
Patent Interference No. 105,171. Iowa Reply 7 (in support of Iowa
Preliminary Motion 7 to redefine the interference) (Electronically
filed, unsigned). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Iowa Reply 8 (in support of Iowa
Preliminary Motion 8 to redefine the count) (Electronically filed,
unsigned). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Iowa Reply 10 (in support of Iowa
Preliminary Motion 10 to redefine the interference) (Electronically
filed, unsigned). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Iowa Reply 11 (in support of Iowa
Miscellaneous Motion to suppress). (Electronically filed,
unsigned). Oct. 18, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Statement. Jun. 7, 2004. cited by other
.
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion I (to designate additional claims of
Iowa patent as corresponding to the Count). Jun. 7, 2004. cited by
other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion 2 (for judgment based on lack of
written description support and introducing new matter). Jun. 7,
2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion 3 (for judgment based on
anticipation). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion 4 (for judgment based on
obviousness). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion 5 (for judgment based on
anticipation). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Preliminary Motion 6 (for judgment based on inequitable
conduct). Jun. 7, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Contingent Preliminary Motion 7 (for benefit of an
earlier application under 37 CFR 1.633(j)). Jul. 2, 2004. cited by
other .
Patent Interference No. 105,171. Regents of the University of
California Contingent Preliminary Motion 8 (to add additional
claims under 37 CFR 1.633(c)(2) and (i)). Jul. 2, 2004. cited by
other .
Amended Claims for U.S. Appl. No. 09/265,191, filed Mar. 10, 1999.
cited by other .
Patent Interference No. 105,171. Iowa Opposition 1 (opposition to
motion to designate additional claims as corresponding to the
Count) (Electronically filed, unsigned). Sep. 9, 2004. cited by
other .
Patent Interference No. 105,171. Iowa Opposition 2 (opposition to
motion for judgment based on lack of written description support
and introducing new matter) (Electronically filed, unsigned). Sep.
9, 2004. cited by other .
Patent Interference No. 105,171. Iowa Opposition 3 (opposition to
motion for judgment based on anticipation) (Electronically filed,
unsigned). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Iowa Opposition 4 (opposition to
motion for judgment based on obviousness) (Electronically filed,
unsigned). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Iowa Opposition 5 (opposition to
motion for judgment based on anticipation) (Electronically filed,
unsigned). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Iowa Opposition 6 (opposition to
motion for judgment based on inequitable conduct) (Electronically
filed, unsigned). Sep. 9, 2004. cited by other .
Patent Interference No. 105,171. Iowa Opposition 7 (opposition to
motion for benefit of an earlier application under 7 CFR 1.633(j))
(Electronically filed, unsigned). Sep. 9, 2004. cited by other
.
Patent Interference No. 105,171. Iowa Opposition 8 (opposition to
motion to add additional claims under 37 CFR 1.633 (2) and (i))
(Electronically filed, unsigned). Sep. 9, 2004. cited by other
.
Patent Interference No. 105,171. Regents of the University of
California Reply 1 (to Iowa's opposition to UC's motion to
designate Iowa claims as corresponding to the Count). Oct. 15,
2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 2 (to Iowa's opposition to UC Preliminary Motion 2
for Judgment). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 3 (to Iowa's Opposition to UC Preliminary Motion 3
for Judgment). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 4 (to Iowa's Opposition to UC Preliminary Motion 4
for Judgment). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 5 (to Iowa's Opposition to UC Preliminary Motion 5
for Judgment). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 6 (to Iowa's opposition to UC Preliminary Motion 6
for judgment). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 7 (to Iowa's Opposition to UC Preliminary Motion 7
for Benefit). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Regents of the University of
California Reply 8 (to Iowa's Opposition to UC Preliminary Motion 8
to add additional claims). Oct. 15, 2004. cited by other .
Patent Interference No. 105,171. Decision on Motion under 37 CFR
.sctn.41.125. Mar. 10, 2005. cited by other .
Patent Interference No. 105,171. Judgment and Order. Mar. 10, 2005.
cited by other .
Patent Interference No. 105,171. Regents of the University of
California. Brief of Appellant. Jul. 5, 2005. cited by other .
Patent Interference No. 105,171. University of Iowa and Coley
Pharmaceutical Group, Inc. Brief of Appellees. Aug. 17, 2005. cited
by other .
Patent Interference No. 105,171. Regents of the University of
California. Reply Brief of Appellant. Sep. 6, 2005. cited by other
.
Patent Interference No. 105,171. Regents of the University of
California. Decision of CAFC. Jul. 17, 2006. cited by other .
Patent Interference No. 105,526. Krieg Substantive Motion 1 (for
unpatentability based on interference estoppel). (Electronically
filed, unsigned). cited by other .
Patent Interference No. 105,526.. Krieg Substantive Motion 2 (for
judgment based on inadequate written description and/or
enablement). (Electronically filed, unsigned). Jun. 18, 2007. cited
by other .
Patent Interference No. 105,526. Krieg Contingent Responsive Motion
(to add new claims 104 and 105). (Electronically filed, unsigned).
Jul. 25, 2007. cited by other .
Patent Interference No. 105,526. Krieg Substantive Motion 3 (for
judgment based on prior art). (Electronically filed, unsigned).
Jun. 18, 2007. cited by other .
Patent Interference No. 105,526. Raz Motion 1 (Unpatentability of
Krieg Claims under 35 U.S.C. .sctn. 112, First Paragraph).
(Electronically filed, unsigned). Jun. 18, 2007. cited by other
.
Patent Interference No. 105,526. Raz Motion 2 (Raising a Threshold
Issue of No Interference-in-Fact). (Electronically filed,
unsigned). Jun. 18, 2007. cited by other .
Patent Interference No. 105,526.. Raz Motion 3 (Krieg's Claims are
Unpatentable Over Prior Art Under 35 U.S.C. .sctn. 102(b))
(Electronically filed, unsigned). Jun. 18, 2007. cited by other
.
Patent Interference No. 105,526. Raz Motion 4 (to Designate Krieg
Claims 46 and 82-84 as Corresponding to Count 1). (Electronically
filed, unsigned). Jun. 18, 2007. cited by other .
Patent Interference No. 105,526. Raz Responsive Miscellaneous
Motion 5 (To revive the Raz Parent Application) (Electronically
filed, unsigned) Jul. 25, 2007. cited by other .
Patent Interference No. 105,526. Raz Contingent Responsive Motion 6
(to Add a New Claim 58) (Electronically filed, unsigned) Jul. 25,
2007. cited by other .
Patent Interference No. 105,526. Krieg Opposition 1 (Opposition to
Motion for Lack of Enablement and Written Description)
(Electronically filed, unsigned) Sep. 10, 2007. cited by other
.
Patent Interference No. 105,526. Krieg Opposition 2 (to Raz Motion
2) (Electronically filed, unsigned) Sep. 10, 2007. cited by other
.
Patent Interference No. 105,526. Krieg Opposition 3 (To Raz Motion
3) (Electronically filed, unsiged) Sep. 10, 2007. cited by other
.
Patent Interference No. 105,526. Krieg Opposition 4 (Opposition to
Motion for Designating Claims 46 and 82-84 as Corresponding to the
Court) (Electronically filed, unsigned) Sep. 10, 2007. cited by
other .
Patent Interference No. 105,526. Krieg Opposition 6 (Opposition to
Raz Contingent Responsive Motion 6) (Electronically filed,
unsigned) Sep. 10, 2007. cited by other .
Patent Interference No. 105,526. Raz Opposition 1 (Opposing Krieg
Substantive Motion 1) (Electronically filed, unsigned) Sep. 10,
2007. cited by other .
Patent Interference No. 105,526. Raz Opposition 2 (Opposing Krieg
Substantive Motion 2) (Electronically filed, unsigned) Sep. 10,
2007. cited by other .
Patent Interference No. 105,526. Raz Opposition 4 (Opposing Krieg
Contingent Responsive Motion to Add New Claims 104 and 105)
(Electronically filed, unsigned) Sep. 10, 2007. cited by other
.
Patent Interference No. 105,526. Krieg Reply 1 (Reply to Raz
opposition 1) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Krieg Reply 2 (Reply to Raz
opposition 2) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Krieg Reply 4 (Reply to Raz
opposition 4) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 1 (Reply to Krieg
opposition 1) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 2 (Reply to Krieg
opposition 2) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 3 (Reply to Krieg
opposition 3) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 4 (Reply to Krieg
opposition 4) Oct. 5, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 6 (Reply to Krieg
opposition 6) Oct. 5, 2007. cited by other .
Press Release, Jan. 2007, "Coley Pharmaceutical Group Updates
Hepatitis C Drug Development Strategy". cited by other .
Press Release, Jun. 2007, "Coley Pharmaceutical Group Announces
Pfizer's Discontinuation of Clinical Trials for PF-3512676 Combined
with Cytotoxic Chemotherapy in Advanced Non Small Cell Lung
Cancer". cited by other .
Bayever et al., Systemic administration of a phosphorothioate
oligonucleotide with a sequence complementary to p53 for acute
myelogenous leukemia and myelodysplastic syndrome: initial results
of a phase I trial. Antisense Res Dev. 1993 Winter;3(4):383-90.
cited by other .
Brunda, Interleukin-12. J Leukoc Biol. Feb. 1994;55(2):280-8.
Review. cited by other .
Deboer et al., Induction of urinary interleukin-1 (IL-1), IL-2,
IL-6, and tumour necrosis factor during intravesical immunotherapy
with bacillus Calmette-Guerin in superficial bladder cancer. Cancer
Immunol Immunother. 1992;34(5):306-12. cited by other .
Frost et al., MTP-PE in liposomes as a biological response modifier
in the treatment of cancer: current status. Biotherapy.
1992;4(3):199-204. Review. cited by other .
Gu et al., Experimental studies on the immune regulation of
fibroblast cell mediated interleukin-6 gene therapy. J Med Col.
PLA. 1994; 9(1):50-4. cited by other .
Hayashi, A., Interferon-.gamma. as a Marker for the Effective
Cancer Immunotherapy with BCG-Cell Wall Skeleton. Proc Jap Acad.
Dec. 12, 1994; 70(10):205-209. cited by other .
Krieg, A.M., Toll-like receptor 9 (TLR9) agonists in the treatment
of cancer. Oncogene. Jan. 7, 2008;27(2):161-7. Review. cited by
other .
Magliani et al., New immunotherapeutic strategies to control
vaginal candidiasis. Trends Mol Med. Mar. 2002;8(3):121-6. Review.
cited by other .
McDonald et al., Defective cytostatic activity of pulmonary
alveolar macrophages in primary lung cancer. Chest. Oct.
1990;98(4):881-5. cited by other .
Muhlhauser et al., VEGFI65 expressed by a replication-deficient
recombinant adenovirus vector induces angiogenesis in vivo. Circ
Res. Dec. 1995;77(6):1077-86. cited by other .
Porgador et al., Interleukin 6 gene transfection into Lewis lung
carcinoma tumor cells suppresses the malignant phenotype and
confers immunotherapeutic competence against parental metastatic
cells. Cancer Res. Jul. 1992 1;52(13):3679-86. cited by other .
Tanaka et al., an antisense oligonucleotide complementary to a
sequence in I gamma 2b increases gamma 2b germline transcripts,
stimulates B cell DNA synthesis, and inhibits immunoglobulin
secretion. J Exp Med. Feb. 1, 1992;175(2):597-607. cited by other
.
Trinchieri et al., Interleukin-12: a cytokine produced by
antigen-presenting cells with immunoregulatory functions in the
generation of T-helper cells type 1 and cytotoxic lymphocytes.
Blood. Dec. 15, 1994;84(12):4008-27. Review. cited by other .
Vicari et al., Development of targeted toll-like receptor agonists
for cancer therapy. PPO Focus. 2007; 1(2):1-15. cited by other
.
Bodey et al., Failure of cancer vaccines: the significant
limitations of this approach to immunotherapy. Anticancer Res.
Jul.-Aug. 2000;20(4):2665-76. Review. cited by other .
Boussiotis et al., B7 but not intercellular adhesion molecule-1
costimulation prevents the induction of human alloantigen-specific
tolerance. J Exp Med. Nov. 1, 1993;178(5):1753-63. cited by other
.
Branda et al., B-cell proliferation and differentiation in common
variable immunodeficiency patients produced by an antisense
oligomer to the rev gene of HIV-1. Clin Immunol Immunopathol. May
1996;79(2):115-21. cited by other .
Chatterjee et al., Idiotypic antibody immunotherapy of cancer.
Cancer Immunol Immunother. Feb. 1994;38(2):75-82. Review. cited by
other .
Goodchild et al., Conjugates of oligonucleotides and modified
oligonucleotides: a review of their synthesis and properties.
Bioconjug Chem. May-Jun. 1990;1(3):165-87. cited by other .
Heeg et al., CpG DNA as a Th1 trigger. Int Arch Allergy Immunol.
Feb. 2000;121(2):87-97. cited by other .
Kim et al., TLR9 agonist immunomodulator treatment of cutaneous
T-cell lymphomas (CTCL) with CPG7909. Blood. Nov. 16,
2004;104(11):Abstract #743. cited by other .
Krieg, Antiinfective applications of toll-like receptor 9 agonists.
Proc Am Thorac Soc. Jul. 2007;4(3):289-94. cited by other .
Krieg, Development of TLR9 agonists for cancer therapy. J Clin
Invest. May 2007;117(5):1184- 94. cited by other .
Krieg, Toll-like receptor 9 (TLR9) agonists in the treatment of
cancer. Oncogene. Jan. 7, 2008;27(2):161-7. Review. cited by other
.
Lagranderie et al., Oral immunization with recombinant BCG induces
cellular and humoral immune responses against the foreign antigen.
Vaccine. Oct. 1993;11(13):1283-90. Abstract only. cited by other
.
Legendre et al., Delivery of plasmid DNA into mammalian cell lines
using pH-sensitive liposomes: comparison with cationic liposomes.
Pharm Res. Oct. 1992;9(10):1235-42. cited by other .
Li et al., Effective induction of CD8+ T-cell response using CpG
oligodeoxynucleotides and HER-2/neu-derived peptide co-encapsulated
in liposomes. Vaccine. Jul. 4, 2003;21(23):3319-29. cited by other
.
Li et al., Lymphoma immunotherapy with CpG oligodeoxynucleotides
requires TLR9 either in the host or in the tumor itself. J Immunol.
Aug. 15, 2007;179(4):2493-500. cited by other .
Readett et al., PF-3512676 (CPG7909) a Toll-like receptor 9
agonist--status of development for non-small cell lung cancer
(NSCLC). Abstract PD3-1-6. Pfizer. Aug. 24, 2007. Poster. cited by
other .
Tokunaga et al., Antitumor activity of deoxyribonucleic acid
fraction from Mycobacterium bovis BCG. I. Isolation,
physicochemical characterization, and antitumor activity. J Natl
Cancer Inst. Apr. 1984;72(4):955-62. cited by other .
Vicari et al., Development of targeted toll-like receptor agonists
for cancer therapy. PPO Focus. 2007; 1(2):1-15. cited by other
.
Vicari et al., Paclitaxel reduces regulatory T cell numbers and
inhibitory function and enhances the anti-tumor effects of the TLR9
agonist PF-3512676 in the mouse. Cancer Immunol Immunother. Apr.
2009;58(4):615-28. Epub Sep. 19, 2008. cited by other .
Patent Interference No. 105,526. Krieg Miscellaneous Motion 5 (To
exclude exhibits 2066, 2070, 2071, 2072, 2073, 2074, 2075, 2076 and
2078) Oct. 9, 2007. cited by other .
Patent Interference No. 105,526. Raz Opposition 5 (Opposing Krieg
Miscellaneous Motion 5) Oct. 25, 2007. cited by other .
Patent Interference No. 105,526. Raz Miscellaneous Motion 7 (To
exclude evidence) Oct. 19, 2007. cited by other .
Patent Interference No. 105,526. Krieg Opposition 7 (To Raz
Miscellaneous Motion 7) Oct. 25, 2007. cited by other .
Patent Interference No. 105,526. Krieg Reply 5 (Reply to Raz
opposition 5) Oct. 30, 2007. cited by other .
Patent Interference No. 105,526. Raz Reply 7 (Reply to Krieg
opposition 7) Oct. 30, 2007. cited by other .
Patent Interference No. 105,526. Order--Bd.R. 104. Conference Call.
Paper 211. Sep. 30, 2008. cited by other .
Patent Interference No. 105,526. Memorandum Opinion and Order
(Decision on Motions) Dec. 1, 2008. cited by other .
Patent Interference No. 105,526. Judgment on Preliminary Motions
under 37 C.F.R .sctn.41.127 Dec. 1, 2008. cited by other .
Patent Interference No. 105,674. Declaration under 37 C.F.R.
.sctn.41.203(b) Dec. 1, 2008. cited by other .
Patent Interference No. 105,674. Krieg Designation of Real Party in
Interest. Dec. 15, 2008. cited by other .
Patent Interference No. 105,674. Paper 19. Order-Bd.R. 104(c).
Conference Call. Jan. 16, 2009. cited by other .
Patent Interference No. 105,674. Raz Observations (regarding
evidence to support certain proposed motions. Jan. 27, 2009. cited
by other .
Murad et al., CPG-7909 (PF-3512676, ProMune): toll-like receptor-9
agonist in cancer therapy. Expert Opin Biol Ther. Aug.
2007;7(8):1257-66. cited by other .
Agrawal et al., Pharmacokinetics, biodistribution, and stability of
oligodeoxynucleotide phosphorothioates in mice. Proc Natl Acad Sci
U S A. Sep. 1, 1991;88(17):7595-9. cited by other .
Agrawal et al., Pharmacokinetics of antisense oligonucleotides.
Clin Pharmacokinet. Jan. 1995;28(1):7-16. cited by other .
Agrawal et al., Antisense oligonucleotides: towards clinical
trials. Trends in Biotechnology. 1996;14:376-87. cited by other
.
Brody et al., In situ vaccination with a TLR9 agonist induces
systemic lymphoma regression: a phase I/II study. J Clin Oncol.
Oct. 1, 2010;28(28):4324-32. Epub Aug. 9, 2010. cited by other
.
Flieger, Testing drugs in people--FDA special issue on drug
development. FDA Consumer Special Report. Jan. 1995. 7 pages. Last
accessed online on Nov. 14, 2005 at
http://www.fda.gov/fdac/special/newdrug/testing.html. cited by
other .
Hofmann et al., Phase 1 evaluation of intralesionally injected
TLR9-agonist PF-3512676 in patients with basal cell carcinoma or
metastatic melanoma. J Immunother. Jun. 2008;31(5):520-7. cited by
other .
Kim et al., TLR9 Agonist Immunomodulator Treatment of Cutaneous
T-Cell Lymphoma (CTCL) with CPG7909. Blood (ASH Annual Meeting
Abstracts). Nov. 2004;104(11):Abstract #743. cited by other .
Leonard et al., Phase I trial of toll-like receptor 9 agonist
PF-3512676 with and following rituximab in patients with recurrent
indolent and aggressive non Hodgkin's lymphoma. Clin Cancer Res.
Oct. 15, 2007;13(20):6168-74. cited by other .
Link et al., Oligodeoxynucleotide CpG 7909 delivered as intravenous
infusion demonstrates immunologic modulation in patients with
previously treated non-Hodgkin lymphoma. J Immunother. Sep.-Oct.
2006;29(5):558-68. cited by other .
Manegold et al., Randomized phase II trial of a toll-like receptor
9 agonist oligodeoxynucleotide, PF-3512676, in combination with
first-line taxane plus platinum chemotherapy for advanced-stage
non-small-cell lung cancer. J Clin Oncol. Aug. 2008.
20;26(24):3979-86. cited by other .
Pashenkov et al., Phase II trial of a toll-like receptor
9-activating oligonucleotide in patients with metastatic melanoma.
J Clin Oncol. Dec. 20, 2006;24(36):5716-24. cited by other .
Speiser et al., Rapid and strong human CD8+ T cell responses to
vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909. J
Clin Invest. Mar. 2005;115(3):739-46. cited by other .
Tokunga et al., How BCG Led to the Discovery of Immunostimulatory
DNA. Jpn J Infect Dis. 1999;52:1-11. cited by other .
Vlassov et al., In Vivo pharmocokinetics of oligonucleotides
following administration by different routes. CRC Press, Inc.
Chapter 5. 1995:71-83. cited by other .
Patent Interference No. 105,526. Paper 217. Raz Notice of Filing of
a Notice of Appeal (Appeal to the Court of Appeals for the Federal
Circuit). Jan. 27, 2009. cited by other .
Patent Interference No. 105,526. Paper 218. Raz Notice of
Withdrawal of Appeal. May 15, 2009. cited by other .
Patent Interference No. 105,674. Paper No. 6 Raz Notice of Real
Party in Interest. Dec. 12, 2008. cited by other .
Patent Interference No. 105,674. Paper No. 15. Order--Bd.R. 104(c)
Summary of 12.23.2008 Conference Call. cited by other .
Patent Interference No. 105,674. Paper No. 23. Raz Miscellaneous
Motion 1 (to revive the Raz parent application). Jan. 27, 2009.
cited by other .
Patent Interference No. 105,674. Paper No. 25. Order--Bd.R. 104(c)
(Raz v. Krieg) Summary of Conference Call on Feb. 4, 2009. cited by
other .
Patent Interference No. 105,674. Paper No. 29. Joint Submission
Pursuant to Order Dated Jan. 16, 2009. Mar. 11, 2009. cited by
other .
Patent Interference No. 105,674. Paper No. 32. Raz Abandonment of
Contest. May 15, 2009. cited by other .
Patent Interference No. 105,674. Paper No. 33. Judgment--Bd.R.127.
May 20, 2009. cited by other .
Adya N et al., Expansion of CREB's DNA recognition specificity by
Tax results from interaction with Ala-Ala-Arg at positions 282-284
near the conserved DNA-binding domain of CREB. Proc Nall Acad Sci
USA 91(12):5642-6, Jun. 7, 1994. cited by other .
Aggarwal, S.K. et al., "Cell-Surface-Associated Nucleic Acid in
Tumorigenic Cells Made Visible with Platinum-Complexes by Electron
Microscopy", Proc. Nat. Acad. Sci. USA, Mar. 1975, pp. 928-932,
vol. 72, No. 3. cited by other .
Angier, N., Microbe DNA Seen as Alien by Immune System, New York
Times, Apr. 11, 1995. cited by other .
Azad RF et al., Antiviral Activity of a Phosphorothioate
Oligonucleotide Complementary to RNA of the Human Cytomegalovirus
Major Immediate-Early Region. Antimicrobial Agents and
Chemotherapy, 37:1945-1954, Sep. 1993. cited by other .
Azuma, Biochemical and Immunological Studies on Cellular Components
of Tubercle Bacilli, Kekkaku, vol. 69, 9:45-55, 1992. cited by
other .
Ballas ZK et al., Induction of NK activity in murine and human
cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J
Immunol 157(5):1840-5, 1996. cited by other .
Bayever, E., Systemic Administration of a Phosphorothioate
Oligonucleotide with a Sequence Complementary to p53 for Acute
Myelogenous leukemia and Myelodysplastic Syndrome: Initial Results
of a Phase I Trial, Antisense Res. & Dev. (1993), 3:383-390.
cited by other .
Bennett RM et al., DNA binding to human leukocytes. Evidence for a
receptor-mediated association, internalization, and degradation of
DNA. J Clin Invest 76(6):2182-90, 1985. cited by other .
Berg DJ et al., Interleukin-10 is a central regulator of the
response to LPS in murine models of endotoxic shock and the
Shwartzman reaction but not endotoxin tolerance. J. Clin Invest
96(5):2339-47, 1995. cited by other .
Blanchard DK et al., Interferon-gamma induction by
lipopolysaccharide: dependence on interleukin 2 and macrophages. J
lmmunol 136(3):963-70, 1986. cited by other .
Boggs RT et al., Characterization and modulation of immune
stimulation by modified oligonucleotides. Antisense Nucleic Acid
Drug Dev 7(5):461-71, Oct. 1997. cited by other .
Branda RF et al., Amplification of antibody production by
phosphorothioate oligodeoxynucleotides. J. Lab Clin Med
128(3):329-38, Sep. 1996. cited by other .
Branda et al., Immune Stimulation by an Antisense Oligomer
Complementary to the rev gene of HIV-1. Biochemical Pharmacology,
vol. 45, 10:2037-2043, 1993. cited by other .
Briskin M et al., Lipopolysaccharide-unresponsive mutant pre-B-cell
lines blocked in NF-kappa B activation. Mol Cell Biol 10(1):422-5,
Jan. 1990. cited by other .
Chace, J. et al., Regulation of Differentiation in CD5+ and
Conventional B Cells, Clinical Immunology and Immunopathology,
(1993), 68:3:327-332. cited by other .
Chang YN et al., The palindromic series I repeats in the simian
cytomegalovirus major immediate-early promoter behave as both
strong basal enhancers and cyclic AMP response elements. J Virol
64(9:264-77, Jan. 1990. cited by other .
Chu RS et al., CpG oligodeoxynucleotides act as adjuvants that
switch on T helper 1 (Th1) immunity. J Exp Med 186(10):1623-31,
Nov. 17, 1997. cited by other .
Cossum, P., et al., "Pharmacokinetics of a .sup.14 C-Labeled
Phosphorothioate Oligonucleotide, ISIS 2105, after Intradermal
Administration to Rats", The Journal of Pharmacology and
Experimental Therapeutics, 269:1:89-94, (1993). cited by other
.
Cowdery JS et al., Bacterial DNA induces NK cells to produce
IFN-gamma in vivo and increases the toxicity of
lipopolysaccharides. J Immunol. 156(12):4570-5, Jun. 15, 1996.
cited by other .
Crosby et al., the Early Responses Gene FGFI-C Encodes a Zinc
Finger Transcriptional Activator and is a Member of the GCGGGGGCG
(GSG) Element-Binding Protein Family. Mol. Cell. Biol.,
2:3835-3841, 1991. cited by other .
Crystal, Transfer of Genes to Humans: Early Lessons and Obstacles
to Success. Science, vol. 270, pp. 404-410, 1995. cited by other
.
D'Andrea A et al., Interleukin 10 (IL-10) inhibits human lymphocyte
interferon gamma-production by suppressing natural killer cell
stimulatory factor/IL-12 synthesis in accessory cells. J Exp Med
178(3):1041-8, 1993. cited by other .
Doe, B., et al., "Induction of cytotoxic T lymphocytes by
intramuscular immunization with plasmid DNA is faciliated by bone
marrow-derived cells", Proc. Natl. Acad. Sci., 93:8578-8583,
(1996). cited by other .
Englisch et al., Chemically Modified Oligonucleotides as Probes and
Inhibitors, Angew. Chem. Int. Ed. Engl., 30:613-629, 1991. cited by
other .
Erb KJ et al., Infection of mice with Mycobacterium bovis-Bacillus
Calmette-Guerin (BCG) suppresses allergen-induced airway
eosinophilia. J Exp Med 187(4):561 -9, Feb. 16, 1998. cited by
other .
Etlinjer, Carrier sequence selection--one key to successful
vaccines, Immunology Today, vol. 13, 2:52-55, 1992. cited by other
.
Fox RI, Mechanism of action of hydroxychloroquine as an
antirheumatic drug. Chemical Abstracts, 120:15, Abstract No. 182630
(Apr. 29, 1994). cited by other .
Gately, M., et al., "Interleukin-12: A Recently Discovered Cytokine
with potential for Enhancing Cell-Mediated Immune Responses to
Tumors", Cancer Investigation, 11:4:500-506, (1993). cited by other
.
Gura, T., Antisense Has Growing Pains. Science (1995), 270:575-576.
cited by other .
Hadden J et al., Immunostimulants. TIPS, (1993), 141:169-174. cited
by other .
Hadden J et al., Immunopharmacology, JAMA, (1992) 268:20:2964-2969.
cited by other .
Halpern MD et al., Bacterial DNA induces murine interferon-gamma
production by stimulation of interleukin-12 and tumor necrosis
factor-alpha. Cell Immunol 167(1):72-8, 1996. cited by other .
Hamblin, T., et al., "Ex Vivo Acitivation and Retransfusion of
White Blood Cells", Curr Stud Hematol Blood Transf. ,57:249-266,
(1990). cited by other .
Hartmann, G., et al., "CpG DNA: A potent signal for growth,
activation, and maturation of human dendritic cells", Proc. Natl.
Acad. Set., 96:9305-9310, (1999). cited by other .
Hatzfeld J., Release of Early Human Hematopoietic Progenitors from
Quiescence by Antisense Transforming Growth Factor .beta.1 or Rb
Oligonucleotides, J. Exp. Med., (1991) 174:925-929. cited by other
.
Highfield PE, Sepsis: the More, the Murkier. Biotechnology, 12:828,
Aug. 12, 1994. cited by other .
Hoeffler JP et al., Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions. Mol Endocrinol 5(2):256-66, Feb.
1991. cited by other .
Iguchi-Arig SM and Shaffner W, CpG methylation of the
cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes
specific factor binding as well as transcriptional activation.
Genes Dev 3(5):612-9, May 1989. cited by other .
Iverson, P., et al., "Pharmacokinetics of an Antisense
Phosphorothioate Oligodeoxynucleotide against reve from Human
Immunodeficiency Virus Type I in the Adult male Rate Following
Single Injections and Continuous Infusion", Antisense Research and
Development, (1994), 4:43-52. cited by other .
Ishikawa R et al., IFN induction and associated changes in splenic
leukocyte distribution. J Immunol 150(9):3713-27, May 1, 1993.
cited by other .
Jakway JP et al., Growth regulation of the B lymphoma cell line
WEHI-23l by anti-immunoglobulin, lipopolysaccharide, and other
bacterial products. J Immunol 137(7):2225-31, Oct. 1, 1986. cited
by other .
Jaroszewski JW and Cohen JS, Cellular uptake of antisense
oligonucleotides. Adv Drug Delivery Rev 6(3):235-50, 1991. cited by
other .
Kataoka, T., et al. "Immunotherapeutid potential in Guinea-Pig
Tumor Model of Deoxyribonucleic Acid From Mycobacterium Bovix BCG
Complexed with Poly-L-Lysine and Carboxy-Methylcellulose", Jpn J.
Med. Sci. Biol. 43:171-182, (1990). cited by other .
Kataoka, T. et al., "Antitumor Activity of Synthetic
Oligonucleotides with Sequences from cDNA Encoding Proteins of
Mycobacterium bovis BCG", Jpn. J. Cancer Res., Mar. 1992, pp.
244-247, vol. 83. cited by other .
Kimura Y et al., Binding of Oligoguanylate to Scavenger Receptors
Is Required for Oligonucleotides to Augment NK Cell Activity and
Induce IFN, J. Biochem., vol. 116, 5:991-994, 1994. cited by other
.
Kline JN et al., CpG motif oligonucleotides are effective in
prevention of eosinophilic inflammation in a murine model of
asthma. J Invest Med 44(7):380A, 1996. cited by other .
Kline JN et al., Immune redirection by CpG oligonucleotides.
Conversion of a Th2 response to a Th1 response in a murine model of
asthma. J Invest Med 45(3):282A, 1997. cited by other .
Kline JN et al., CpG oligonucleotides can reverse as well as
prevent Th2-mediated inflammation in a murine model of asthma. J
Invest Med 45(7):298A, 1997. cited by other .
Klinman DM et al., CpG motifs present in bacteria DNA rapidly
induce lymphocytes to secrete interleukin 6, interleukin 12, and
interferon gamma. Proc Natl Acad Sci USA 93(7):2879-83, 1996. cited
by other .
Klinman, D.M. et al., "Contribution of CpG Motifs to the
Immunogenicity of DNA Vaccines", J. of Immunol., 1997, pp.
3635-3639, vol. 158, No. 8, The American Association of
Immunologists. cited by other .
Kolitz, J., et al., "The Immunotherapy of Human Cancer with
Interleukin 2: Present Status and Future Directions", Cancer
Investigation, 9:5:529-542, (1991). cited by other .
Krieg AM, An innate immune defense mechanism based on the
recognition of CpG motifs in microbial DNA. J Lab Clin Med
128(2):128-33, 1996. cited by other .
Krieg AM et al., Uptake of oligodeoxyribonucleotides by lymphoid
cells is heterogeneous and inducible. Antisense Res Dev
1(2):161-71, Summer 1991. cited by other .
Krieg AM et al., Oligodeoxynucleotide modifications determine the
magnitude of B cell stimulation by CpG motifs. Antisense Nucleic
Acid Drug Dev 6(2):I33-9, Summer 1996. cited by other .
Krieg AM et al., "Modification of antisense phosphodiester
oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular
association and improves efficacy", Proc. Natl. Acad. Sci., (1993),
90:1048-1052. cited by other .
Krieg AM et al., "CpG DNA: A Pathogenic Factor in Systemic Lupus
Erythematosus?", Journal of Clinical Immunology, (1995)
15:6:284-292. cited by other .
Krieg AM et al, Phosphorothioate Oligodeoxynucleotides: Antisense
or Anti-Protein?, Antisense Research and Development, (1995),
5:241. cited by other .
Krieg AM et al., "Leukocyte Stimulation by Oligodeoxynucleotides",
Applied Antisense Oligonucleotide Technology, (1998), 431-448.
cited by other .
Krieg AM et al., CpG motifs in bacterial DNA trigger direct B-cell
activation. Nature 374:546-9, 1995. cited by other .
Krieg AM et al, "The role of CpG dinuleotides in DNA vaccines",
Trends in Microbiology, vol. 6, pp. 23-27, Jan. 1998. cited by
other .
Kuramoto et al., Oligonucleotide Sequences Required for Natural
Killer Cell Activation, Jpn. J. Cancer Res., 83:1128-1131, Nov.
1992. cited by other .
Kuramoto et al., "In Situ Infiltration of Natural Killer-Like Cell
slnduced by Intradermal Injection of the Nucleic Injection of the
Nucleic Acid Fraction from BCG", Microbiol. Immunol.,
33:11:929-940, (1989). cited by other .
Kuramoto, E., et al., "Changes of host cell infiltration into meth
a fibrosarcoma tumor during the course of regression induced by
injections of a BCG nucleic acid fraction", Int. I.
Immunopharmacol. 14:5:773-782, (1992). cited by other .
Lacour, J., et al., Clinical Trials Using Polyadenylic-Polyuridylic
Acid as an Adjuvant to Surgery in Treating Different Human Tumors,
J of Biological Response Modifiers, 4:538-543, (1985). cited by
other .
Leonard et al., Conformation of Guanine 8-Oxoadenine Base Pairs in
the Crystal Structure of d(CGCGAATT(08A)GCG). Biochemistry,
31(36):8415-8420, 1992. cited by other .
Lipford, G.B. et al., "CpG-containing synthetic oligonucleotides
promote B and cytotoxic T cell responses to protein antigen: a new
class of vaccine adjuvants", Eur. J. Immunol., 1997, pp. 2340-2344,
vol. 27. cited by other .
Lipford, G.B. et al, "Bacterial DNA as immune cell activator",
Inst. of Med. Microb., Immunol. and Hygiene, 1998, pp. 496-500,
Elsevier Science. cited by other .
Macfarlane DE and Manzel L, Antagonism of immunostimulatory
CpG-oligodeoxynucleotides by quinacrine, chloroquine, and
structurally related compounds. J Immunol 160(3):1122-31, Feb. 1,
1998. cited by other .
Mastrangelo et al. Seminars in Oncology. vol. 23, 1:4-21, 1996.
cited by other .
Mashiba, H., et al., "In Vitro Augmentation of Natural Killer
Activity of Peripheral Bllod Cells From Cancer Patients by a DNA
Fraction From Mycobacterium bovis BCG", Jpn J. Med. Sci. Biol.,
41:197-202, (1988). cited by other .
Matson S and Krieg AM, Nonspecific suppression of [3H]thymidine
incorporation by "control" oligonucleotides. Antisense Res Dev
2(4):325-30, Winter 1992. cited by other .
McIntyre KW et al., A sense phosphorothioate oligonucleotide
directed to the initiation codon of transcription factor NF-kappa B
p65 causes sequence-specific immune stimulation. Antisense Res Dev
3(4):309-22, Winter 1993. cited by other .
Messina et al., The Influence of DNA Structure on the in vitro
Stimulation of Murine Lymphocytes by Natural and Synthetic
Polynucleotide Antigens. Cellular Immunology, 147:148-157, 1993.
cited by other .
Messina et al., Stimulation of in vitro Murine Lymphocyte
Proliferation by Bacterial DNA. J. Immunol., vol. 147, 6:1759-1764,
Sep. 15, 1991. cited by other .
Mojcik, C., et al., "Administration of a Phosphorothioate
Oligonucleotide Antisense Murine Endogenous Retroviral MCF env
Causes Immune Effect in vivo in a Sequence-Specific Manner",
Clinical Immunology and Immunopathology, (1993), 67:2:130-136.
cited by other .
Morahan, P., et al., "Comparative Analysis of Modulators of
Nonspecific Resistance Against Microbial Infections",
Immunopharmacology of Infectious Diseases: Vaccine Adjuvants and
Modulators of Non-Specific Resistance, 313-324, (1987). cited by
other .
Mottram et al., A novel CDC2-related protein kinase from leishmania
mexicana LminCRK1 is post-translationally regulated during the life
cycle. J. Biol. Chem. 268:28, 21044-21052 (Oct. 1993). cited by
other .
New England BIOLABS 1988-1989 Catalog. cited by other .
Nyce JW and Metzger WJ, DNA antisense therapy for asthma in an
animal model. Nature 385:721-725, Feb. 20, 1997. cited by other
.
Pisetsky, D., "Stimulation of in vitro proliferation of murine
lymphocytes by synthetic oligodeoxynucleotides", Molecular Biology
Repairs, (1993) 18:217-221. cited by other .
Pisetsky et al., Stimulation of Murine Lymphocyte Proliferation by
a Phosphorothioate Oligonucleotide with Antisense Activity for
Herpes Simplex Virus. Life Science, vol. 54, pp. 101-107 (1994).
cited by other .
Pisetsky, The Immunological Properties of DNA, The Journal of
Immunology, pp. 421-423 (1996). cited by other .
Pisetsky, Immunological Consequences of Nucleic Acid Therapy,
Antisense Research and Development, 5:219-225 (1995). cited by
other .
Raz E et al., Preferential induction of a Th1 immune response and
inhibition of specific IgE antibody formation by plasmid DNA
immunization. Proc Natl Acad Sci USA 93(10):5141-5, May 14, 1996.
cited by other .
Reisfeld, R., et al., "Monoclonal Antibodies in Cancer Therapy",
Clinics in Laboratory Medicine, 12:2:201-216, (1992). cited by
other .
Rosenberg, S., et al., "Immunotherapy of Cancer by Systemic
Administration of Lymphoid Cells Plus Interleukin-2", Journal of
Biological Response Modifiers, 3:501-511, (1984)-. cited by other
.
Rosenberg, S., et al., "Observations on the systemic administration
of autologous lymphokine-activated killer cells and recombinant
interleukins-2 to patients with metastatic cancer", The New England
Journal of Medicine, 113:23:1485-1492, (1985). cited by other .
Roman M et al., Immunostimulatory DNA sequences function as T
helper-I -promoting adjuvants. Nat Med 3(8):849-54, Aug. 1997.
cited by other .
Sato et al., Immunostimulatory DNA Sequences Necessary for
Effective Intradermal Gene Immunization, Science, vol. 273, pp.
352-354, 1996. cited by other .
Schwartz DA et al., Endotoxin responsiveness and grain dust-induced
inflammation in the lower respiratory tract. Am J Physiol 267(5 Pt
1):L609-17, 1994. cited by other .
Schwartz DA et al., The role of endotoxin in grain dust-induced
lung disease. Am J Respir Crit Care Med 152(2):603-8, 1995. cited
by other .
Schwartz DA et al., CpG motifs in bacterial DNA cause inflammation
in the lower respiratory tract. J Clin Invest 100(1):68-73, Jul. 1,
1997. cited by other .
Shimada, S., et al., "In Vivo Augmentatio of Natural Killer Cell
Activity With A Deoxyribonucleic Acid Fraction of BCG", Jpn J.
Cancer Res., 77:808-816, (1986). cited by other .
Shimada, S., et al., "Antitumor Acitivity of the DNA Fraction from
Mycobacterium bovis BCG. II> Effects on Various Syngeneic Mouse
Tumors", JNCI, 74:3:681-688, (1985). cited by other .
Shirakawa T et al., the inverse association between tuberculin
responses and atopic disorder. Science 275(5296):77-9, Jan. 3,
1997. cited by other .
Sparwasser T et al., Macrophages sense pathogens via DNA motifs:
induction of tumor necrosis factor-alpha-mediated shock. Eur J
Immunol 27(7):1671-9, Jul. 1997. cited by other .
Stein Ca et al., Oligonucleotides as inhibitors of gene expression:
a review. Cancer Research, 48:2659-2668, 1988. cited by other .
Stevenson, H., et al., "The Treatment of Cancer with Activated
Cytotoxic Leukocyte Subsets", Artif Organs, 12:2:128136, 1988.
cited by other .
Stull et al., Antigene, Ribozyme, and Aptamer Nucleic Acid Drugs:
Progress and Prospects, Pharmaceutical Res., vol. 12, 4:465-483,
1995. cited by other .
Subramanian et al., Theoretical Considerations on the "Spine of
Hydration" in the Minor Groove of d(CGCGAATTCGCG) d(GCGCTTAAGCGC):
Monte Carlo Computer Simulation. Proc. Nat'l. Acad. Sci. USA,
85:1836-1840, 1988. cited by other .
Tanaka T et al., An antisense Oligonucleotide complementary to a
sequence in IG2b increases G2b germline transcripts stimulates B
cell DNA synthesis and inhibits immunoglobulin secretion. J. Exp.
Med, 175:597-607, 1992. cited by other .
Threadgill, D.S. et al., "Mitogenic synthetic polynucleotides
suppress the antibody response to a bacterial polysaccharide",
Vaccine, 1998, pp. 76-82, vol. 16, No. I, Elsevier Science Ltd.
cited by other .
Thorne PS., Experimental grain dust atmospheres generated by wet
and dry aerosolization techniques. Am J Ind Med 25(1):109-12, 1994.
cited by other .
Tokunaga T et al., Synthetic Oligonucleotides with Particular Base
Sequences form the cDNA Encoding Proteins of Myobacterium bovis BCG
Induce Interferons and Activate Natural Killer Cells, Microbiol.
Immunol., vol. 36, 1:55-66, 1992. cited by other .
Tokunaga et al., A Synthetic Single-Stranded DNA, Ply (dG, dC),
Induces Interferon .alpha./.beta. and -.gamma., Augments Natural
Killer Activity and Suppresses Tumor Growth. Jpn. J. Cancer Res.,
79:682-686, Jun. 1988. cited by other .
Topalian, S., et al., "Expansion of human tumor infiltrating
lymphocytes for use in immunotherapy trials", J of Immunological
Methods, 102:127-141, (1987). cited by other .
Torpey III, D., et al., Effects of Adoptive Immunotherapy with
Autologous CD8+ t Lymphocytes on Immunologic Parameters: Lymphocyte
Subsets and Cytotoxic Activity, Clinical Immunology and
Immunopathology, 68:3:263-272, (1993). cited by other .
Uhlmann et al., Antisense Oligonucleotides: A New Therapeutic
Principle. Chemical Reviews, 90:543-584, 1990. cited by other .
Vogels, M., et al., "Use of Immune Modulators in nonspecific
Therapy of Bacterial Infections", Antimicrobial Agents and
Chemotherapy, 36:1:1-5, (1992). cited by other .
Wagner RW, Gene inhibition using antisense oligodeoxynucleotides.
Nature, 372:L333-335, 1994. cited by other .
Wallace et al., Oligonucleotide probes for the screening of
recombinant DNA libraries. Methods in Enzymology, 152:432-442
(1987). cited by other .
Weiss R., Upping the Antisense Ante: Scientists bet on profits from
reverse genetics. Science, 139:108-109, 1991. cited by other .
Whalen R, DNA Vaccines for Emerging Infection Diseases: What If?,
Emerging Infectious Disease, vol. 2, 3:168-175, 1996. cited by
other .
Wooldridge, J., et al., "Immunostimulatory Oligodeoxynucleotides
Containing CpG Motifs Enhance the Efficacy of Monoclonal Antibody
Therapy of Lymhoma", Blood, 89:8:2994-2998, (1997). cited by other
.
Wiltrout, R.H., et al., "Immunomodulation of Natural Killer
Activity by Polyribonucleotides", Journal of Biological Response
Modifiers, 1985, pp. 512-517, vol. 4, No. 5, New Raven Press, NY.
cited by other .
Wooldridge, J.E. et al., "Select Unmethylated CpG
Oligodeoxynucleotides Improve Antibody Dependent Cellular
Cytotoxicity in Vitro of Both Murine and Human B Cell Lymphomas",
Blood, Dec. 1995, p. 2877, Abstract, vol. 86. cited by other .
Wooldridge, J.E. et al., "Select unmethylated CpG
oligodeoxynucleotide improve antibody dependent cellular
cytotoxicity in vitro and in vivo", Proceedings of the American
Association for Cancer Research #3253, Mar. 1996, p. 477, Abstract,
vol. 37. cited by other .
Wu GY et al., Receptor-mediated gene delivery and expression in
vivo. J. Biol. Chem., 263:14621-14624, 1988. cited by other .
Wu-Pong S., Oligonucleotides: Opportunities for Drug Therapy and
Research. Pharmaceutical Technology, 18:102-114, 1994. cited by
other .
Yamamoto S et al., DNA from bacteria, but not from vertebrates,
induces interferons, activates natural killer cells and inhibits
tumor growth. Microbiol Immunol 36(9):983-97, 1992. cited by other
.
Yamamoto S et al., In vitro augmentation of natural killer cell
activity and production of interferon-alpha/beta and-gamma with
deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn J
Cancer Res 79:866-73, Jul. 1988. cited by other .
Yamamoto S., Mode of Action of Oligonucleotide Fraction Extracted
from Mycobacterium bovis BCG, Kekkaku, vol. 69, 9:29-32, 1994.
cited by other .
Yamamoto S et al., Unique Palindromic Sequences in Synthetic
Oligonucleotides are Required to Induce INF and Augment
INF-Mediated Natural Killer Activity. J. Immunol., vol. 148,
12:4072-4076, Jun. 15, 1992. cited by other .
Yamamoto T et al., Ability of Oligonucleotides with Certain
Palindromes to Induce Interferon Production and Augment Natural
Killer Cell Activity is Associated with Their Base Length.
Antisense Res. and Devel., 4:119-123, 1994. cited by other .
Yamamoto et al., Lipofection of Synthetic Oligodeoxyribonucleotide
Having a Palindromic Sequence AACGTT to Murine Splenocytes Enhances
Interferon Production and Natural Killer Activity. Microbiol.
Immunol., vol. 38, 10:831-836, 1994. cited by other .
Yamamoto T et al., Synthetic Oligonucleotides with Certain
Palindromes Stimulate Interferon Production of Human Peripheral
Blood Lymphocytes in vitro. Jpn. J. Cancer Res., 85:775-779, 1994.
cited by other .
Yi, Ae-Kyung et al., IFN-.gamma. Promotes IL-6 and IgM Secretion in
Response to CpG Motifs in Bacterial DNA and Oligonucleotides, The
Journal of Immunology, pp. 558-564 (1996). cited by other .
Yi, Ae-Kyung et al., Rapid Immune Activation by CpG Motifs in
Bacterial DNA, The Journal of Immunology, pp. 5394-5402 (1996).
cited by other .
Zhao Q et al., Stage-specific oligonucleotide uptake in murine bone
marrow B-cell precursors. Blood 84(11):3660-6, Dec. 1, 1994. cited
by other .
Zhao Q et al., Comparison of cellular binding and uptake of
antisense phosphodiester, phosphorothioate, and mixed
phosphorothioate and methylphosphonate oligonucleotides. Antisense
Res Dev 3(1):53-66, Spring 1993. cited by other.
|
Primary Examiner: Gussow; Anne M.
Attorney, Agent or Firm: Wolf, Greenfield & Sacks, P.C.
Benson; Gregg C.
Government Interests
GOVERNMENT
The work resulting in this invention was supported in part by
National Institute of Health Grant No. R29-AR42556-01. The U.S.
Government has certain rights in the invention.
Parent Case Text
RELATED APPLICATION
This application is a continuation of U.S. Ser. No. 09/337,619,
filed Jun. 21, 1999, which is a divisional of U.S. Ser. No.
08/960,774, filed Oct. 30, 1997, now issued as U.S. Pat. No.
6,239,116B1 on May 29, 2001, which is a continuation-in-part of
U.S. Ser. No. 08/738,652, filed Oct. 30, 1996, now issued as U.S.
Pat. No. 6,207,646B1 on Mar. 27, 2001, which is a
continuation-in-part of U.S. patent application Ser. No.
08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No.
6,194,388B1 on Feb. 27, 2001, which is a continuation-in-part of
U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994
which is now abandoned, each of which are incorporated herein by
reference in their entirety.
Claims
We claim:
1. A method for treating cancer, comprising: administering to a
human subject an effective amount for treating cancer of a CpG
immunostimulatory oligonucleotide having at least one unmethylated
CpG dinucleotide, wherein at least one nucleotide of the stabilized
CpG immunostimulatory oligonucleotide has a phosphate backbone
modification and wherein the oligonucleotide is 8 to 100
nucleotides in length, wherein the phosphate backbone modification
is a phosphorothioate modification, further comprising
administering an antigen.
2. The method of claim 1, further comprising administering a
chemotherapeutic agent.
3. The method of claim 1, further comprising administering a cancer
immunotherapeutic agent.
4. The method of claim 1, wherein the cancer is brain cancer.
5. The method of claim 1, wherein the cancer is lung cancer.
6. The method of claim 1, wherein the cancer is ovarian cancer.
7. The method of claim 1, wherein the cancer is breast cancer.
8. The method of claim 1, wherein the cancer is prostate
cancer.
9. The method of claim 1, wherein the cancer is colon cancer.
10. The method of claim 1, wherein the cancer is leukemia.
11. The method of claim 1, wherein the cancer is carcinoma.
12. The method of claim 1, wherein the cancer is sarcoma.
13. The method of claim 1, wherein the CpG immunostimulatory
oligonucleotide comprises: 5'X.sub.1X.sub.2CGX.sub.3X.sub.43'
wherein X.sub.1X.sub.2 and X.sub.3X.sub.4 are nucleotides.
14. The method of claim 13, wherein X.sub.3X.sub.4 are nucleotides
selected from the group consisting of: TpT, and TpC.
15. The method of claim 13, wherein X.sub.1X.sub.2 are GpA and
X.sub.3X.sub.4 are TpT.
16. The method of claim 13, wherein X.sub.1X.sub.2 are both purines
and X.sub.3X.sub.4 are both pyrimidines.
17. The method of claim 13, wherein X.sub.1X.sub.2 are GpA and
X.sub.3X.sub.4 are both pyrimidines.
18. The method of claim 13, wherein the oligonucleotide is 8 to 40
nucleotides in length.
19. The method of claim 13, wherein 5' X.sub.1 X.sub.2CGX.sub.3
X.sub.43' is not palindromic.
20. The method of claim 1, wherein the CpG immunostimulatory
oligonucleotide includes at least two CpG motifs.
21. The method of claim 20, wherein at least one of the at least
two CpG motifs is not palindromic.
22. The method of claim 1, wherein the oligonucleotide is
administered prior to a chemotherapy.
23. The method of claim 1, wherein the oligonucleotide is
administered subcutaneously.
24. A method for treating non small cell lung carcinoma (NSCLC) in
a human subject, comprising administering to a human subject having
NSCLC an effective amount to treat NSCLC of an immunostimulatory
oligonucleotide that includes at least one unmethylated CpG
dinucleotide, wherein the immunostimulatory oligonucleotide
includes a phosphate backbone modification and, wherein the
oligonucleotide is 8 to 100 nucleotides in length, wherein the
phosphate backbone modification is a phosphorothioate modification,
further comprising administering an antigen.
25. The method of claim 24, further comprising administering a
chemotherapeutic agent.
26. The method of claim 24, further comprising administering an
immunotherapeutic agent.
27. The method of claim 24, wherein the oligonucleotide is 8 to 40
nucleotides in length.
28. The method of claim 24, wherein the CpG immunostimulatory
oligonucleotide includes at least two CpG motifs.
29. The method of claim 28, wherein at least one of the at least
two CpG motifs is not palindromic.
30. The method of claim 24, wherein the oligonucleotide is
administered subcutaneously.
Description
FIELD OF THE INVENTION
The present invention relates generally to oligonucleotides and
more specifically to oligonucleotides which have a sequence
including at least one unmethylated CpG dinucleotide which are
immunostimulatory.
BACKGROUND OF THE INVENTION
In the 1970s, several investigators reported the binding of high
molecular weight DNA to cell membranes (Lerner, R. A., et al. 1971.
"Membrane-associated DNA in the cytoplasm of diploid human
lymphocytes." Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K.,
R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975.
"Cell-surface-associated nucleic acid in tumorigenic cells made
visible with platinum-pyrimidine complexes by electron microscopy."
Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al.
presented the first evidence that DNA binding to lymphocytes is
similar to a ligand receptor interaction: binding is saturable,
competitive, and leads to DNA endocytosis and degradation into
oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt,
1985. "J. Clin. Invest. 76:2182). Like DNA,
oligodeoxyribonucleotides (ODNs) are able to enter cells in a
saturable, sequence independent, and temperature and energy
dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen.
1991. "Cellular uptake of antisense oligodeoxynucleotides."
Advanced Drug Deliver Reviews 6:235; Akhtar, S., Y. Shoji, and R.
L. Juliano. 1992. "Pharmaceutical aspects of the biological
stability and membrane transport characteristics of antisense
oligonucleotides." In: Gene Regulation: Biology of Antisense RNA
and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd.
New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J.
Herrera, and A. M. Krieg. 1994. "Stage specific oligonucleotide
uptake in murine bone marrow B cell precursors." Blood 84:3660). No
receptor for DNA or ODN uptake has yet been cloned, and it is not
yet clear whether ODN binding and cell uptake occurs through the
same or a different mechanism from that of high molecular weight
DNA.
Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen LPS had
dramatically enhanced ODN uptake in the B cell population, while
spleen cells treated with the T cell mitogen Con A showed enhanced
ODN uptake by T but not B cells (Krieg, A. M., F. Ginelig-Meyling,
M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg.
1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is
heterogeneous and inducible." Antisense Research and Development
1:161).
Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly
(I,C) which is a potent inducer of IFN production as well as
macrophage activator and inducer of NK activity (Talmadge, J. E.,
J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E.
Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985.
"Immunomodulatory effects in mice of polyinosinic-polycytidylic
acid complexed with poly-L-lysine and carboxymethylcellulose."
Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley,
and J. E. Talnadge. 1985. "Immunomodulation of natural killer
activity by polyribonucleotides." J. Biol. Respn. Mod. 4:512;
Krown, S. E. 1986. "Interferons and interferon inducers in cancer
treatment." Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C.
Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J.
Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt,
and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid
complexed with poly-L-lysine and carboxymethylcellulose in
combination with interleukin-2 in patients with cancer: clinical
and immunological effects." Canc. Res. 52:3005). It appears that
this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN
inducation and associated changes in splenic leukocyte
distribution". J. Immunol. 150:3713). This activation was specific
for the robose sugar since deoxyribose was ineffective. Its potent
in vitro antitumor activity led to several clinical trials using
poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose
(to reduce degradation by RNAse) Talmadge, J. E., et al., 1985.
cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S.
E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited
supra). Unfortunately, toxic side effects have thus far prevented
poly (I,C) from becoming a useful therapeutic agent.
Guanine ribonucleotides substituted at the C8 position with either
a bromine or a thiol group are B cell mitogens and may replace "B
cell differentiation factors" (Feldbush, T. L., and Z. K., Ballas.
1985. "Lymphokine-like activity of 8-mercaptoguanosine: induction
of T and B cell differentiation." J. Immunol. 134:3204; and
Goodman, M. G. 1986. "Mechanism of synergy between T cell signals
and C8-substituted guanine nucleosides in humoral immunity: B
lymphotropic cytokines induce responsiveness to
8-mercaptoguanosine." J. Immunol. 136:3335). 8-mercaptoguanosine
and 8-bromoguanosine also can substitute for the cytokine
requirement for the generation of MHC restricted CTL (Feldbush, T.
L., 1985. cited supra), augment murine NK activity (Koo, G. C., M.
E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988.
"Activation of murine natural killer cells and macrophages by
8bromoguanosine." J. Immunol. 140:3249), and synergize with IL-2 in
inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas.
1990. "Lymphokine-activated killer (LAK) cells. V.
8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation." J.
Immunol. 145:3524). The NK and LAK augmenting activities of these
C8-substituted guanosines appear to be due to their induction of
IFN (Thompson, R. A., et al. 1990. cited supra0. Recently, a 5'
triphosphorylated thymidine produced by a mycobacterium was found
to be mitogenic for a subset of human .gamma..delta. T cells
(Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M.
Bonneville, and J.-J. Fournie. 1994. "Stimulation of human
.gamma..delta. T cells by nonpeptidic mycobacterial ligands."
Science 264:267). This report indicated the possibility that the
immune system may have evolved ways to preferentially respond to
microbial nucleic acids.
Several observations suggest that certain DNA structures may also
have the potential to activate lymphocytes. For example, Bell et
al. reported that nucleosoinal protein-DNA complexes (but not naked
DNA) in spleen cell supernatants caused B cell proliferation and
immunoglobulin secretion (Bell, D. A., B. Morrison, and P.
VandenBygaart. 1990. "Immunogenic DNA-related factors." J. Clin.
Invest. 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina et al. have recently
reported that 260 to 800 bp fragments of poly (dG).cndot.(dC) and
poly (dG.cndot.dC) were mitogenic for B cells (Messina, J. P., G.
S. Gilkeson, and D. S. Piesetsky. 1993. "The influence of DNA
structure on the in vitro stimulation of murine lymphocytes by
natural and synthetic polynucleotide antigens." Cell. Immunol.
147:148). Tokunaga, et al. have reported that dG.cndot.dC induces
.gamma.-IFN and NK activity (Tokunaga, S. Yamamoto, and K. Nama.
1988. "A synthetic single-stranded DNA, poly(dG, dC), induces
interferon-.alpha./.beta. and -.gamma., augments natural killer
activity, and suppresses tumor growth." Jpn. J. Cancer Res.
79:682). Aside from such artificial homopolymer sequences, Pisetsky
et al. reported that pure mammalian DNA has no detectable immune
effects, but that DNA from certain bacteria induces B cell
activation and immunoglobulin secretion (Messina, J. P., G. S.
Gilkeson, and D. S. Pisetsky. 1991. "Stimulation of in vitro murine
lymphocyte proliferation by bacterial DNA." J. Immunol. 147:1759).
Assuming that these data did not result from some unusual
contaminant, these studies suggested that a particular structure or
other characteristic of bacterial DNA renders it capable of
triggering B cell activation. Investigations of mycobacterial DNA
sequences have demonstrated that ODN which contain certain
palindrome sequences can activate NK cells (Yamamoto, S., T.
Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992.
"Unique palindromic sequences in synthetic oligonucleotides are
required to induce INF and augment INF-mediated natural killer
activity." J. Immunol. 148:4072; Kuramoto, E., 0. Yano, Y. Kimura,
M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T.
Tokunaga. 1992. "Oligonucleotide sequences required for natural
killer cell activation." Jpn. J. Cancer Res. 83:1128).
Several phosphorothioate modified ODN have been reported to induce
in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and
W. E. Paul. 1992. "An antisense oligonucleotide complementary to a
sequence in I.gamma.2b increases .gamma.2b germline transcripts,
stimulates B cell DNA synthesis, and inhibits immunoglobulin
secretion." J. Exp. Med. 175:597; Mcintyre, K. W., K.
Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D.
Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense
phosphorothioate oligonucleotide directed to the initiation codon
of transcription factor NF-.kappa.B T65 causes sequence-specific
immune stimulation." Antisense Res. Develop. 3:309; and Pisetsky,
D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte
proliferation by a phosphorothioate oligonucleotide with antisense
activity for herpes simplex virus." Life Sciences 54:101). These
reports do not suggest a common structural motif or sequence
element in these ODN that might explain their effects.
The cAMP response element binding protein (CREB) and activating
transcription factor (ATF) or CREB/ATF family of transcription
factors is a ubiquitously expressed class of transcription factors
of which 11 members have so far been cloned (reviewed on de Groot,
R. P., and P. Sassone-Corsi: "Hormonal control of gene expression:
Multiplicity and versatility of cyclic adenosine
3',5'-monophosphate-responsive nuclear regulators." Mol. Endocrin.
7:145, 1993; Lee, K. A. W., and N. Masson: "Transcriptional
regulation by CREB and its relatives." Biochim. Biophys. Acta
1174:221, 1993). They all belong to the basic region/leucine zipper
(bZip) class of proteins. All cells appear to express one or more
CREB/ATF proteins, but the members expressed and the regulation of
mRNA splicing appear to be tissue-specific. Differential splicing
of activation domains can determine whether a particular CREB/ATF
protein will be a transcriptional inhibitor or activator. Many
CREB/ATF proteins activate viral transcription, but some splicing
variants which lack the activation domain are inhibitory. CREB/ATF
proteins can bind DNA as homo- or hetero-dimers through the cAMP
response element, the CRE, the consensus form of which is the
unmethylated sequence TGACGTC (SEQ. ID. No. 103) (binding is
abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W.
Schaffner: "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA (SEQ. ID. No. 104) abolishes
specific factor binding as well as transcriptional activation."
Genese & Develop. 3:612, 1989.
The transcriptional activity of the CRE is increased during B cell
activation (Xie. H., T. C. Chiles, and T. L. Rothstein: "Induction
of CREB activity via the surface Ig receptor of B cells." J.
Immunol. 151:880, 1993). CREB/ATF proteins appear to regulate the
expression of multiple genes through the CRE including
immunologically important genes such as fos, jun B, Rb-1, IL-6,
IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E.
Auron: "Transcription factors NF-IL6 and CREB recognize a common
essential site in the human prointerleukin 1.beta. gene." Mol.
Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel,
M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA
inhibition of tumor growth induced by c-Ha-ras oncogene in nude
mice." Cancer Res. 53:577, 1993), IFN- (Du, W., and T. Maniatis:
"An ATF/CREB binding site protein is required for virus induction
of the human interferon .beta. gene." Proc. Natl. Acad. Sci. USA
89:2150, 1992), TGF-1 (Asiedu, C. K., L. Scott, R. K. Assoian, M.
Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to contiguous
sites downstream of the human TGF-.beta.1 gene." Biochim. Biophys.
Acta 1219:55, 1994), TGF-2, class II MHC (Cox, P. M., and C. R.
Goding: "An ATF/CREB binding motif is required for aberrant
constitutive expression of the MHC class II DR.alpha. promoter and
activation by SV40 T-antigen." Nucl. Acids Res. 20:4881, 1992),
E-selectin, GM-CSF, CD-8, the germline Ig constant region gene, the
TCR V gene, and the proliferating cell nuclear antigen (Huang, D.,
P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B.
Prystowsky: "Promoter activity of the proliferating-cell nuclear
antigen gene is associated with inducible CRE-binding proteins in
interleukin 2-stimulated T lymphocytes." Mol. Cell. Biol. 14:4233,
1994). In addition to activation through the cAMP pathway, CREB can
also mediate transcriptional responses to changes in intracellular
Ca.sup.++ concentration (Sheng, M., G. McFadden, and M. E.
Greenberg: "Membrane depolarization and calcium induce c-fos
transcription via phosphorylation of transcription factor CREB."
Neuron 4:571, 1990).
The role of protein-protein interactions in transcriptional
activation by CREB/ATF proteins appears to be extremely important.
There are several published studies reporting direct or indirect
interactions between NFKB proteins and CREB/ATF proteins (Whitley,
et al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al.,
(1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189;
and Du, et al., (1993) Cell 74:887. Activation of CREB through the
cyclic AMP pathway requires protein kinase A (PKA), which
phosphorylates CREB.sup.341 on ser.sup.133 and allows it to bind to
a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J.
C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G.
E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear protein CBP is
a coactivator for the transcription factor CREB." Nature 370:223,
1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Sinea,
M. Karin, J. Feramisco, and M. Montminy: "Activation of cAMP and
mitogen responsive genes relies on a common nuclear factor." Nature
370:226, 1994). CBP in turn interacts with the basal transcription
factor TFIIB causing increased transcription. CREB also has been
reported to interact with dTAFII 110, a TATA binding
protein-associated factor whose binding may regulate transcription
(Ferreri, K., G. Gill, and M. Montminy: "The cAMP-regulated
transcription factor CREB interacts with a component of the TFIID
complex." Proc. Natl. Acad. Sci. USA 91:1210, 1994). In addition to
these interactions, CREB/ATF proteins can specifically bind
multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbadfer,
and C.-Y. Chen: "Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions." Mol. Endocrinol. 5:256, 1991) but
the biologic significance of most of these interactions is unknown.
CREB is normally thought to bind DNA either as a homodimer or as a
heterodimer with several other proteins. Surprisingly, CREB
monomers constitutively activate transcription (Krajewski, W., and
K. A. W. Lee: "A monomeric derivative of the cellular transcription
factor CREB functions as a constitutive activator." Mol. Cell.
Biol. 14:7204, 1994).
Aside from their critical role in regulating cellular
transcription, it has recently been shown that CREB/ATF proteins
are subverted by some infectious viruses and retroviruses, which
require them for viral replication. For example, the
cytomegalovirus immediate early promoter, one of the strongest
known mammalian promoters, contains eleven copies of the CRE which
are essential for promoter function (Chang, Y.-N., S. Crawford, J.
Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: "The
palindromic series 1 repeats in the simian cytomegalovirus major
immediate-early promoter behave as both strong basal enhancers and
cyclic AMP response elements." J. Virol. 64:264, 1990). At least
some of the transcriptional activating effects of the adenovirus
E1A protein, which induces many promoters, are due to its binding
to the DNA binding domain of the CREB/ATF protein, ATF-2, which
mediates E1A inducible transcription activation (Liu, F., and M. R.
Green: "Promoter targeting by adenovirus E1A through interaction
with different cellular DNA-binding domains." Nature 368:520,
1994). It has also been suggested that E1A binds to the
CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M.
Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated
CBP belong to a conserved family of coactivators." Cell 77:799,
1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which
causes human T cell leukemia and tropical spastic paresis, also
requires CREB/ATF proteins for replication. In this case, the
retrovirus produces a protein, Tax, which binds to CREB/ATF
proteins and redirects them from their normal cellular binding
sites to different DNA sequences (flanked by G- and G-rich
sequences) present within the HTLV transcriptional enhancer
(Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R.
Cullen, I. M. Boros, and C.-Z. Giam: "In vitro selection of DNA
elements highly responsive to the human T-cell lymphotropic virus
type 1 transcriptional activator, Tax." Mol. Cell. Biol. 14:456,
1994; Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giam:
"Expansion of CREB's DNA recognition specificity by Tax results
from interaction with Ala-Ala-Arg at positions 282-284 near the
conserved DNA-binding domain of CREB." Proc. Natl. Acad. Sci. USA
91:5642, 1994).
SUMMARY OF THE INVENTION
The present invention is based on the finding that certain nucleic
acids containing unmethylated cytosine-guanine (CpG) dinucleotides
activate lymphocytes in a subject and redirect a subject's immune
response from a Th2 to a Th1 (e.g., by inducing monocytic cells and
other cells to produce Th1 cytokines, including IL-12, IFN-.gamma.
and GM-CSF). Based on this finding, the invention features, in one
aspect, novel immunostimulatory nucleic acid compositions.
In one embodiment, the invention provides an isolated
immunostimulatory nucleic acid sequence containing a CpG motif
represented by the formula: 5'N.sub.1X.sub.1CGX.sub.2N.sub.2 3'
wherein at least one nucleotide separates consecutive CpGs; X.sub.1
is adenine, guanine, or thymine; X.sub.2 is cytosine or thymine; N
is any nucleotide and N.sub.1+N.sub.2 is from about 0-26 bases with
the proviso that N.sub.1 and N.sub.2 do not contain a CCGG quadmer
or more than one CCG or CGG trimer; and the nucleic acid sequence
is from about 8-30 bases in length.
In another embodiment, the invention provides an isolated
immunostimulatory nucleic acid sequence contains a CpG motif
represented by the formula:
5'N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2 3' wherein at least
one nucleotide separates consecutive CpGs; X.sub.1X.sub.2 is
selected from the group consisting of GpT, GpG, GpA, ApT and ApA;
X.sub.3 X.sub.4 is selected from the group consisting of TpT or
CpT; N is any nucleotide and N.sub.1+N.sub.2 is from about 0-26
bases with the proviso that N.sub.1 and N.sub.2 do not contain a
CCGG quadmer or more than one CCG or CGG trimer; and the nucleic
acid sequence is from about 8-30 bases in length.
In another embodiment, the invention provides a method of
stimulating immune activation by administering the nucleic acid
sequences of the invention to a subject, preferably a human. In a
preferred embodiment, the immune activation effects predominantly a
Th1 pattern of immune activation.
In another embodiment, the nucleic acid sequences of the invention
stimulate cytokine production. In particular, cytokines such as
IL-6, IL-12, IFN-.gamma., TNF-.alpha. and GM-CSF are produced via
stimulation of the immune system using the nucleic acid sequences
described herein. In another aspect, the nucleic acid sequences of
the invention stimulate the lytic activity of natural killer cells
(NK) and the proliferation of B cells.
In another embodiment, the nucleic acid sequences of the invention
are useful as an artificial adjuvant for use during antibody
generation in a mammal such as a mouse or a human.
In another embodiment, autoimmune disorders are treated by
inhibiting a subject's response to CpG mediated leukocyte
activation. The invention provides administration of inhibitors of
endosomal acidification such as bafilomycin a, chloroquine, and
monensin to ameliorate autoimmune disorders. In particular,
systemic lupus erythematosus is treated in this manner.
The nucleic acid sequences of the invention can also be used to
treat, prevent or ameliorate other disorders (e.g., a tumor or
cancer or a viral, fungal, bacterial or parasitic infection). In
addition, the nucleic acid sequences can be administered to
stimulate a subject's response to a vaccine. Furthermore, by
redirecting a subject's immune response from Th2 to Th1, the
claimed nucleic acid sequences can be used to treat or prevent an
asthmatic disorder. In addition, the claimed nucleic acid molecules
can be administered to a subject in conjunction with a particular
allergen as a type of desensitization therapy to treat or prevent
the occurrence of an allergic reaction associated with an asthmatic
disorder.
Further, the ability of the nucleic acid sequences of the invention
described herein to induce leukemic cells to enter the cell cycle
supports their use in treating leukemia by increasing the
sensitivity of chronic leukemia cells followed by conventional
ablative chemotherapy, or by combining the nucleic acid sequences
with other immunotherapies.
Other features and advantages of the invention will become more
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE FIGURES
FIGS. 1A-C are graphs plotting dose-dependent IL-6 production in
response to various DNA sequences in T cell depleted spleen cell
cultures.
FIG. A1. E. coli DNA (.circle-solid.) and calf thymus DNA
(.box-solid.) sequences and LPS (at 10.times. the concentration of
E. coli and calf thymus DNA) (.diamond-solid.).
FIG. 1B. Control phosphodiester oligodeoxynucleotide (ODN) 5'
ATGGAAGGTCCAGTGTTCTC 3' (SEQ ID NO: 114) (.box-solid.) and two
phosphodiester CpG ODN 5' ATCGACCTACGTGCGTTCTC 3' (SEQ ID NO: 2)
(.diamond-solid.) and 5' TCCATAACGTTCCTGATGCT 3' (SEQ ID NO: 3)
(.circle-solid.).
FIG. 1C. Control phosphorothioate ODN 5' GCTAGATGTTAGCGT 3' (SEQ ID
NO: 4) (.box-solid.) and two phosphorothioate CpG ODN 5'
GAGAACGTCGACCTTCGAT 3' (SEQ ID NO: 5) (.diamond-solid.) and 5'
GCATGACGTTGAGCT 3' (SEQ ID NO: 6) (.circle-solid.). Data present
the mean .+-.standard deviation of triplicates.
FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in
vivo as determined 1-8 hrs after injection. Data represent the mean
from duplicate analyses of sera from two mice. BALB/c mice (two
mice/group) were injected iv. with 100 .mu.l of PBS (.quadrature.)
of 200 .mu.g of CpG phosphorothioate ODN 5'TCCATGACGTTCCTGATGCT 3'
(SEQ ID NO: 7) (.box-solid.) or non-CpG phosphorothioate ODN 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8 (.diamond-solid.).
FIG. 3 is an autoradiograph showing IL-6 mRNA expression as
determined by reverse transcription polymerase chain reaction in
liver, spleen, and thymus at various time periods after in vivo
stimulation of BALB/c mice (two mice/group) injected iv with 100
.mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7) or non-CpG phosphorothioate
ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8).
FIG. 4A is a graph plotting dose-dependent inhibition of
CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2
mice were stimulated with CpG ODN 5' TCCAAGACGTTCCTGATGCT 3' (SEQ
ID NO: 9) in the presence of the indicated concentrations of
neutralizing anti-IL-6 (.diamond-solid.) or isotype control Ab
(.circle-solid.) and IgM levels in culture supernatants determined
by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect
on IgM secretion (.box-solid.).
FIG. 4B is a graph plotting the stimulation index of CpG-induced
splenic B cells cultured with anti-L-6 and CpG S-ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7)(.diamond-solid.) or
anti-IL-6 antibody only (.box-solid.). Data present the mean .+-.
standard deviation of triplicates.
FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase
(CAT) activity in WEHI-231 cells transfected with a promoter-less
CAT construct (pCAT), positive control plasmid (RSV), or IL-6
promoter-CAT construct alone or cultured with CpG 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7) or non-CpG 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8) phosphorothioate ODN at the
indicated concentrations. Data present the mean of triplicates.
FIG. 6 is a schematic overview of the immune effects of the
immunostimulatory unmethylated CpG containing nucleic acids, which
can directly activate both B cells and monocytic cells (including
macrophages and dendritic cells) as shown. The immunostimulatory
oligonucleotides do not directly activate purified NK cells, but
render them competent to respond to IL-12 with a marked increase in
their IFN-.gamma. secretion by NK cells, the immunostimulatory
nucleic acids promote a Th1 type immune response. No direct
activation of proliferation of cytokine secretion by highly
purified T cells has been found. However, the induction of Th1
cytokine secretion by the immunostimulatory oligonucleotides
promotes the development of a cytotoxic lymphocyte response.
FIG. 7 is an autoradiograph showing NF.kappa.B mRNA induction in
monocytes treated with E. coli (EC) DNA (containing unmethylated
CpG motifs), control (CT) DNA (containing no unmethylated CpG
motifs) and lipopolysaccharide (LPS) at various measured times, 15
and 30 minutes after contact.
FIG. 8A shows the results from a flow cytometry study using mouse B
cells with the dihydrorhodamine 123 dye to determine levels of
reactive oxygen species. The dye only sample in Panel A of the
figure shows the background level of cells positive for the dye at
28.6%. This level of reactive oxygen species was greatly increased
to 80% in the cells treated for 20 minutes with PMA and ionomycin,
a positive control (Panel B). The cells treated with the CpG oligo
(TCCATGACGTTCCTGACGTT SEQ ID NO: 10) also showed an increase in the
level of reactive oxygen species such that more than 50% of the
cells became positive (Panel D). However, cells treated with an
oligonucleotide that lacked a CpG motif (TCCATGAGCTTCCTGAGTCT SEQ
ID NO: 8) did not show this significant increase in the level of
reactive oxygen species (Panel E).
FIG. 8B shows the results from a flow cytometry study using mouse B
cells in the presence of chloroquine with the dihydrorhodamine 123
dye to determine levels of reactive oxygen species. Chloroquine
slightly lowers the background level of reactive oxygen species in
the cells such that the untreated cells in Panel A have only 4.3%
that are positive. Chloroquine completely abolishes the induction
of reactive oxygen species in the cells treated with CpG DNA (Panel
B) but does not reduce the level of reactive oxygen species in the
cells treated with PMA and ionomycin (Panel E).
FIG. 9 is a graph plotting lung lavage cell count over time. The
graph shows that when the mice are initially injected with
Schistosoma mansoni eggs "egg", which induces a Th2 immune
response, and subsequently inhale Schistosoma mansoni egg antigen
"SEA" (open circle), many inflammatory cells are present in the
lungs. However, when the mice are initially given CpG oligo (SEQ ID
NO: 10) along with egg, the inflammatory cells in the lung are not
increased by subsequent inhalation of SEA (open triangles).
FIG. 10 is a graph plotting lung lavage eosinophil count over time.
Again, the graph shows that when the mice are initially injected
with egg and subsequently inhale SEA (open circle), many
eosinophils are present in the lungs. However, when the mice are
initially given CpG oligo (SEQ ID NO: 10) along with egg, the
inflammatory cells in the lung are not increased by subsequent
inhalation of the SEA (open triangles).
FIG. 11 is a bar graph plotting the effect on the percentage of
macrophage, lymphocyte, neutrophil and eosinophil cells induced by
exposure to saline alone; egg, then SEA; egg and SEQ ID NO: 10,
then SEA; and egg and control oligo (SEQ ID NO: 8), then SEA. When
the mice are treated with the control oligo at the time of the
initial exposure to the egg, there is little effect on the
subsequent influx of eosinophils into the lungs after inhalation of
SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop
an acute inflammatory response in the lungs. However, giving a CpG
oligo along with the eggs at the time of initial antigen exposure
on days 0 and 7 almost completely abolishes the increase in
eosinophils when the mice inhale the egg antigen on day 14.
FIG. 12 is a bar graph plotting eosinophil count in response to
injection of various amounts of the protective oligo SEQ ID NO:
10.
FIG. 13 is a graph plotting interleukin 4 (IL-4) production (pg/ml)
in mice over time in response to injection of egg, then SEA (open
diamond); egg and SEQ ID NO: 10, then SEA (open circle); or saline,
then saline (open square). The graph shows that the resultant
inflammatory response correlates with the levels of the Th2
cytokine IL-4 in the lung.
FIG. 14 is a bar graph plotting interleukin 12 (IL-12) production
(pg/ml) in mice over time in response to injection of saline; egg,
then SEA; or SEQ ID NO. 10 and egg, then SEA. The graph shows that
administration of an oligonucleotide containing an unmethylated CpG
motif can actually redirect the cytokine response of the lung to
production of IL-12, indicating a Th1 type of immune response.
FIG. 15 is a bar graph plotting interferon gamma (IFN-.gamma.)
production (pg/ml) in mice over time in response to injection of
saline; egg, then saline; or SEQ ID NO: 10 and egg, then SEA. The
graph shows that administration of an oligonucleotide containing an
unmethylated CpG motif can also redirect the cytokine response of
the lung to production of IFN-.gamma., indicating a Th1 type of
immune response.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
As used herein, the following terms and phrases shall have the
meanings set forth below:
An "allergen" refers to a substance that can induce an allergic
asthmatic response in a susceptible subject. The list of allergens
is enormous and can include pollens, insect venoms, animal dander
dust, fungal spores and drugs (e.g., penicillin). Examples of
natural, animal and plant allergens include proteins specific to
the following genuses: Canine (Canis familiaris); Dermatophagoides
(e.g., Dermatophagoides farinae); Felis (Felis domesticus);
Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium perenne or
Lolium multifloruni); Cryptomeria (Cryptomeria japonica);
Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa);
Betula (Betula verrucosa); Quercus (quercus alba); Olea (Olea
europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago
lanceolata); Parietaria (e.g., Parietaria officinalis or Parietaria
judaica); Blattella (e.g., Blattella germanica), Apis (e.g., Apis
multiflorum); Cupressus (e.g., Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g., Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g., Thuya orientalis), Chamaecyparis (e.g.,
Chamaecyparis obtusa); Periplaneta (e.g., Periplaneta americana);
Agropyron (e.g., Agropyron repens); Secale (e.g., Secale cereale);
Triticum (e.g., Triticum aestivum); Dactylis (e.g., Dactylis
glomerata); Festuca (e.g., Festuca elatior); Poa (e.g., Poa
pratensis or Poa compressa); Avena (e.g., Avena saliva); Holcus
(e.g., Holcus lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum);
Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis (e.g.,
Agrostis alba); Phleiun (e.g., Phleum pratense); Phalaris (e.g.,
Phalaris arundinacea), Paspalum (e.g., Paspalum notatum); Sorghum
(e.g., Sorghum halepensis) and Bronils (e.g., Bromus inermis).
An "allergy" refers to acquired hypersensitivity to a substance
(allergen). Allergic conditions include eczema, allergic rhinitis
or coryza, hay fever, bronchial asthma, urticaria (hives) and food
allergies, and other atopic conditions.
"Asthma" refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
An "immune system deficiency" shall mean a disease or disorder in
which the subject's immune system is not functioning in normal
capacity or in which it would be useful to boost a subject's immune
response for example to eliminate a tumor or cancer (e.g., tumors
of the brain, lung (e.g., small cell and non-small cells), ovary,
breast, prostate, colon, as well as other carcinomas and sarcomas)
or an infection in a subject.
Examples of infectious virus include: Retroviridae (e.g., human
immunodeficiency viruses, such as HIV-1, also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g., strains that cause gastroenteritis);
Togaviridae (e.g., equine encephalitis viruses, rubella viruses);
Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow
fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae
(e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae
(e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses);
Arena viridae (hemorrhagic fever virus); Reoviridae (e.g.,
reoviruses, orbiviruses and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herperviridae (herpes simplex virus (HSV) 1
and 2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxyiridae (variola virsues, vaccinia viruses, pox
viruses); and Iridoviridae (e.g., African swine fever virus); and
unclassified viruses (e.g., the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitides (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1--internally transmitted; class
2--parenterally transmitted (i.e., Hepatitis C); Norwalk and
related viruses, and astroviruses).
Examples of infectious bacteria include: Helicobacter pyloris,
Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps
(e.g., M. tuberculosis, M. avium, M. Intracellulare, M. kansaii, M.
gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter erogenes,
Klebsiella pneuomiae, Pasturella multicoda, Bacteroides sp.,
Fusobacterium nucleatum, Sreptobacillus moniliformis, Treponema
pallidium, Treponema pertenue, Leptospira, and Actinomeyces
israelli.
Examples of infectious fungi include: Cryptococcus neoformans,
Histoplasma capsulatum, Coccidioides immitis, Blastomyces
dermatitidis, Chlamydia trachomatis, Candida albicans. Other
infectious organisms (i.e., protists) include: Plasmodium
falciparumand Toxoplasma gondii.
An "immunostimulatory nucleic acid molecule" refers to a nucleic
acid molecule, which contains an unmethylated cytosine, guanine
dinucleotide sequence (i.e., "CpG DNA" or DNA containing a cytosine
followed by guanosine and linked by a phosphate bond) and
stimulates (e.g., has a motogenic effect on, or induces or
increases cytokine expression by) a vertebrate lymphocyte. An
immunostimulatory nucleic acid molecule can be double-stranded or
single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity.
In one preferred embodiment, the invention provides an isolated
immunostimulatory nucleic acid sequence containing a CpG motif
represented by the formula: 5 'N.sub.1X.sub.1CGX.sub.2N.sub.23'
wherein at least one nucleotide separates consecutive CpGs; X.sub.1
is adenine, guanine, or thymine; X.sub.2 is cytosine or thymine; N
is any nucleotide and N.sub.1+N.sub.2 is from about 0-26 bases with
the proviso that N.sub.1 and N.sub.2 do not contain a CCGG quadmer
or more than one CCG or CGG trimer; and the nucleic acid sequence
is from about 8-30 bases in length.
In another embodiment the invention provides an isolated
immunostimulatory nucleic acid sequence contains a CpG motif
represented by the formula: 5
'N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.23' wherein at least
one nucleotide separates consecutive CpGs; X.sub.1X.sub.2 is
selected from the group consisting of GpT, GpG, GpA, ApT and ApA;
X.sub.3 X.sub.4 is selected from the group consisting of TpT or
CpT; N is any nucleotide and N.sub.1+N.sub.2 is from about 0-26
bases with the proviso that N.sub.1 and N.sub.2 do not contain a
CCGG quadmer or more than one CCG or CGG trimer; and the nucleic
acid sequence is from about 8-30 bases in length.
Preferably, the immunostimulatory nucleic acid sequences of the
invention include X.sub.1X.sub.2 selected from the group consisting
of GpT, GpG, GpA and ApA and X.sub.3X.sub.4 is selected from the
group consisting of TpT, CpT and GpT (see for example, Table 5).
For facilitating uptake into cells, CpG containing
immunostimulatory nucleic acid molecules are preferably in the
range of 8 to 30 bases in length. However, nucleic acids of any
size (even many kb long) are immunostimulatory if sufficient
immunostimulatory motifs are present, since such larger nucleic
acids are degraded into oligonucleotides inside of cells. Preferred
synthetic oligonucleotides do not include a CGG quadmer or more
than one CCG or CGG trimer at or near the 5' and/or 3' terminals
and/or the consensus mitogenic CpG motif is not a palindrome.
Prolonged immunostimulation can be obtained using stabilized
oligonucleotides, where the oligonucleotide incorporates a
phosphate backbone modification. For example, the modification is a
phosphorothioate or phosphorodithioate modification. More
particularly, the phosphate backbone modification occurs at the 5'
end of the nucleic acid for example, at the first two nucleotides
of the 5' end of the nucleic acid. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid.
Preferably the immunostimulatory CpG DNA is in the range of between
8 to 30 bases in size when it is an oligonucleotide. Alternatively,
CpG dinucleotides can be produced on a large scale in plasmids,
which after being administered to a subject are degraded into
oligonucleotides. Preferred immunostimulatory nucleic acid
molecules (e.g., for use in increasing the effectiveness of a
vaccine or to treat an immune system deficiency by stimulating an
antibody (i.e., humoral) response in a subject) have a relatively
high stimulation index with regard to B cell, monocyte and/or
natural killer cell responses (e.g., cytokine, proliferative, lytic
or other responses).
The nucleic acid sequences of the invention stimulate cytokine
production in a subject for example. Cytokines include but are not
limited to IL-6, IL-12, IFN-.gamma., TNF-.alpha. and GM-CSF.
Exemplary sequences include: TCCATGTCGCTCCTGATGCT (SEQ ID NO: 37),
TCCATGTCGTTCCTGATGCT (SEQ ID NO: 38), and TCGTCGTTTTGTCGTTTTGTCGTT
(SEQ ID NO: 46).
The nucleic acid sequences of the invention are also useful for
stimulating natural killer cell (NK) lytic activity in a subject
such as a human. Specific, but non-limiting examples of such
sequences include: TCGTCGTTGTCGTTGTCGTT (SEQ ID NO: 47),
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 46), TCGTCGTTGTCGTTTTGTCGTT
(SEQ ID NO: 49), GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO: 56),
TGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 48), TGTCGTTGTCGTTGTCGTT (SEQ ID
NO: 50) and TCGTCGTCGTCGTT (SEQ ID NO: 51).
The nucleic acid sequences of the invention are useful for
stimulating B cell proliferation in a subject such as a human.
Specific, but non-limiting examples of such sequences include:
TCCTGTCGTTCCTTGTCGTT (SEQ ID NO: 52), TCCTGTCGTTTTTTGTCGTT (SEQ ID
NO: 53), TCGTCGCTGTCTGCCCTTCTT (SEQ ID NO: 54),
TCGTCGCTGTTGTCGTTTCTT (SEQ ID NO: 55), TCGTCGTTTTGTCGTTTTGTCGTT
(SEQ ID NO: 46), TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO: 49) and
TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 50).
In another aspect, the nucleic acid sequences of the invention are
useful as an adjuvant for use during antibody production in a
mammal. Specific, but non-limiting examples of such sequences
include: TCCATGACGTTCCTGACGTT (SEQ ID NO: 10), GTCGTT (SEQ. ID. NO:
57), GTCGCT (SEQ. ID. NO. 58), TGTCGCT (SEQ. ID. NO: 101) and
TGTCGTT (SEQ. ID. NO: 102). Furthermore, the claimed nucleic acid
sequences can be administered to treat or prevent the symptoms of
an asthmatic disorder by redirecting a subject's immune response
from Th2 to Th1. An exemplary sequence includes
TCCATGACGTTCCTGACGTT (SEQ ID NO: 10).
The stimulation index of a particular immunostimulatory CpG DNA can
be tested in various immune cell assays. Preferably, the
stimulation index of the immunostimulatory CpG DNA with regard to
B-cell proliferation is at least about 5, preferably at least about
10, more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with a 20 .mu.M of
ODN for 20 h at 37.degree. C. and has peen pulsed with 1 .mu.Ci of
.sup.3H uridine; and harvested and counted 4 h later as described
in detail in Example 1. For use in vivo, for example to treat an
immune system deficiency by stimulating a cell-mediated (local)
immune response in a subject, it is important that the
immunostimulatory CpG DNA be capable of effectively inducing
cytokine secretion by monocytic cells and/or Natural Killer (NK)
cell lytic activity.
Preferred immunostimulatory CpG nucleic acids should effect at
least about 500 pg/ml of TNF-.alpha., 15 pg/ml IFN-.gamma., 70
pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on
the therapeutic indication, as determined by the assays described
in Example 12. Other preferred immunostimulatory CpG DNAs should
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30, more preferably at least about 35 and most
preferably at least about 40% 2C11 cell specific lysis as
determined by the assay described in detail in Example 4.
A "nucleic acid" or "DNA" means multiple nucleotides (i.e.,
molecules comprising a sugar (e.g., ribose or deoxyribose) linked
to a phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g., adenine (A) or guanine
(G)). As used herein, the term refers to ribonucleotides as well as
oligodeoxyribonucleotides. The term shall also include
polynucleotides (i.e., a polynucleotide minus the phosphate) and
any other organic base containing polymer. Nucleic acid molecules
can be obtained from existing nucleic acid sources (e.g. genomic or
cDNA), but are preferably synthetic (e.g., produced by
oligonucleotide synthesis).
A "nucleic acid delivery complex" shall mean a nucleic acid
molecule associated with (e.g., ionically or covalently bound to;
or encapsulated within) a targeting means (e.g., a molecule that
results in higher affinity binding to target cell (e.g., B-cell and
natural killer (NK) cell) surfaces and/or increased cellular uptake
by target cells). Examples of nucleic acid delivery complexes
include nucleic acids associated with: a sterol (e.g., a ligand
recognized by target cell specific receptor). Preferred complexes
must be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex should be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
"Palindromic sequences" shall mean an inverted repeat (i.e., a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double stranded structures.
A "stabilized nucleic acid molecule" shall mean a nucleic acid
molecule that is relatively resistant to in vivo degradation (e.g.,
via an exo- or endo-nuclease). Stabilization can be a function of
length or secondary structure. Unmethylated CpG containing nucleic
acid molecules that are tens to hundreds of kbs long are relatively
resistant to in vivo degradation. For shorter immunostimulatory
nucleic acid molecules, secondary structure can stabilize and
increase their effect. For example, if the 3' end of a nucleic acid
molecule has self-complementarily to an upstream region, so that it
can fold back and form a sort of stem loop structure, then the
nucleic acid molecule becomes stabilized and therefore exhibits
more activity.
Preferred stabilized nucleic acid molecules of the instant
invention have a modified backbone. For use in immune stimulation,
especially preferred stabilized nucleic acid molecules are
phosphorothioate (i.e., at least one of the phosphate oxygens of
the nucleic acid molecules is replaced by sulfur) or
phosphorodithioate modified nucleic acid molecules. More
particularly, the phosphate backbone modification occurs at the 5'
end of the nucleic acid for example, at the first two nucleotides
of the 5' end of the nucleic acid. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid. In addition to stabilizing nucleic acid molecules, as
reported further herein, phosphorothioate-modified nucleic acid
molecules (including phosphorodithioate-modified) can increase the
extent of immune stimulation of the nucleic acid molecule, which
contains an unmethylated CpG dinucleotide as shown herein.
International Patent Application Publication Number WO 95/26204
entitled "Immune Stimulation By Phosphorothioate Oligonucleotide
Analogs" also reports on the non-sequence specific
immunostimulatory effect of phosphorothioate modified
oligonucleotides. As reported herein, unmethylated CpG containing
nucleic acid molecules having a phosphorothioate backbone have been
found to preferentially activate B-cell activity, while
unmethylated CpG containing nucleic acid molecules having a
phosphodiester backbone have been found to preferentially activate
monocytic (macrophages, dendritic cells and monocytes) and NK
cells. Phosphorothioate CpG oligonucleotides with preferred human
motifs are also strong activators of monocytic and NK cells.
Other stabilized nucleic acid molecules include: nonionic DNA
analogs, such as alkyl- and aryl-phosphonates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acid molecules which contain a
diol, such as tetraethylenglycol or hexaethyleneglycol, at either
or both termini have also been shown to be substantially resistant
to nuclease degradation.
A "subject" shall mean a human or vertebrate animal including a
dog, cat, horse, cow, pig, sheep, goat, chicken, monkey, rat, and
mouse.
As used herein, the term "vector" refers to a nucleic acid molecule
capable of transporting another nucleic acid to which it has been
linked. Preferred vectors are those capable of autonomous
replication and expression of nucleic acids to which they are
linked (e.g., an episome). Vectors capable of directing the
expression of genes to which they are operatively linked are
referred to herein as "expression vectors." In general, expression
vectors of utility in recombinant DNA techniques are often in the
form of "plasmids" which refer generally to circular double
stranded DNA loops which, in their vector form, are not bound to
the chromosome. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
Certain Unmethylated CpG Containing Nucleic Acids Have B Cell
Stimulatory Activity As Shown In vitro and In vivo
In the course of investigating the lymphocyte stimulatory effects
of two antisense oligonucleotides specific for endogenous
retroviral sequences, using protocols described in the attached
Examples 1 and 2, it was surprisingly found that two out of
twenty-four "controls" (including various scrambled, sense, and
mismatch controls for a panel of "antisense" ODN) also mediated B
cell activation and IgM secretion, while the other "controls" had
no effect.
Two observations suggested that the mechanism of this B cell
activation by the "control" ODN may not involve antisense effects
I) comparison of vertebrate DNA sequences listed in GenBank showed
no greater homology than that seen with non-stimulatory ODN and 2)
the two controls showed no hybridization to Northern blots with 10
.mu.g of spleen poly A+ RNA. Resynthesis of these ODN on a
different synthesizer or extensive purification by polyacrylainide
gel electrophoresis or high pressure liquid chromatography gave
identical stimulation, eliminating the possibility of an impurity.
Similar stimulation was seen using B cells from C3H/HeJ mice,
eliminating the possibility that lipopolysaccharide (LPS)
contamination could account for the results.
The fact that two "control" ODN caused B cell activation similar to
that of the two "antisense" ODN raised the possibility that all
four ODN were stimulating B cells through some non-antisense
mechanism involving a sequence motif that was absent in all of the
other nonstimulatory control ODN. In comparing these sequences, it
was discovered that all of the four stimulatory ODN contained CpG
dinucleotides that were in a different sequence context from the
nonstimulatory control.
To determine whether the CpG motif present in the stimulatory ODN
was responsible for the observed stimulation, over 300 ODN ranging
in length from 5 to 42 bases that contained methylated,
unmethylated, or no CpG dinucleotides in various sequence contexts
were synthesized. These ODNs, including the two original "controls"
(ODN 1 and 2) and two originally synthesized as "antisense" (ODN 3D
and 3M; Krieg, A. M. J. Immunol. 143:2448 (1989)), were then
examined for in vitro effects on spleen cells (representative
sequences are listed in Table I). Several ODN that contained CpG
dinucleotides induced B cell activation and IgM secretion; the
magnitude of this stimulation typically could be increased by
adding more CpG dinucleotides (Table 1; compare ODN 2 to 2a or 3D
to 3Da and 3 Db). Stimulation did not appear to result from an
antisense mechanism or impurity. ODN caused no detectable
proliferation of .gamma..delta. or other T cell populations.
Mitogenic ODN sequences uniformly became nonstimulatory if the CpG
dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D to 3Dc;
3M to 3Ma; and 4 to 4a) or if the cytosine of the CpG dinucleotide
was replaced by 5-methylcytosine (Table 1; ODN 1b, 2b, 3Dd, and 3
Mb). Partial methylation of CpG motifs caused a partial loss of
stimulatory effect (compare 2a to 2c, Table 1). In contrast,
methylation of other cytosines did not reduce ODN activity (ODN 1c,
2d, 3De and 3Mc). These data confirmed that CpG motif is the
essential element present in ODN that activate B cells.
In the course of these studies, it became clear that the bases
flanking the CpG dinucleotide played an important role in
determining the murine B cell activation induced by an ODN. The
optimal stimulatory motif was determined to consist of a CpG
flanked by two 5' purines (preferably a GpA dinucleotide) and two
3' pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of
ODN to bring the CpG motif closer to this ideal improved the motif
reduced stimulation (e.g., Table 1, compare ODN 3D to 3Df; 4 to 4b,
4c and 4d). On the other hand, mutations outside the CpG motif did
not reduce stimulation (e.g., Table I, compare ODN to 1d; 3D to
3Dg; 3M to 3Me). For activation of human cells, the best flanking
bases are slightly different (See Table 5)).
Of those tested, ODNs shorter than 8 bases were non-stimulatory
(e.g., Table 1, ODN 4e). Among the forty-eight 8 base ODN tested, a
highly stimulatory sequence was identified as TCAACGTT (SEQ. ID.
NO: 90) (ODN4) which contains the self complementary "palindrome"
AACGTT (SEQ. ID. NO: 105). In further optimizing this motif, it was
found that ODN containing Gs at both ends showed increased
stimulation, particularly if the ODN were rendered nuclease
resistant by phosphorothioate modification of the terminal
internucleotide linkages. ODN 1585 (GGGGTCAACGTTGAGGGGGG (SEQ ID
NO: 12)), in which the first two and last five internucleotide
linkages are phosphorothioate modified caused an average 25.4 fold
increase in mouse spleen cell proliferation compared to an average
3.2 fold increase in proliferation included by ODN 1638, which has
the same sequence as ODN 1585 except that the 10 Gs at the two ends
are replaced by 10 As. The effect of the G-rich ends is cis;
addition of an ODN with poly G ends but no CpG motif to cells along
with 1638 gave no increased proliferation. For nucleic acid
molecules longer than 8 base pairs, non-palindromic motifs
containing an unmethylated CpG were found to be more
immunostimulatory.
TABLE-US-00001 TABLE 1 Oligonucleotide Stimulation of Mouse B Cells
Stimulation Index' CpG ODN Sequence (5' to 3').dagger. .sup.3H IgM
Production 1 (SEQ ID NO:89) GCTAGACGTTAGCGT 6.1 .+-. 0.8 17.9 .+-.
3.6 1a (SEQ. ID NO:4) ......T........ 1.2 .+-. 0.2 1.7 .+-. 0.5 1b
(SEQ ID NO:13) ......Z........ 1.2 .+-. 0.1 1.8 .+-. 0.0 1c (SEQ ID
NO:14) ............Z.. 10.3 .+-. 4.4 9.5 .+-. 1.8 1d (SEQ ID NO:16)
..AT......GAGC. 13.0 .+-. 2.3 18.3 .+-. 7.5 2 (SEQ ID NO:1)
ATGGAAGGTCCAGCGTTCTC 2.9 .+-. 0.2 13.6 .+-. 2.0 2a (SEQ ID NO:15)
..C..CTC..G......... 7.7 .+-. 0.8 24.2 .+-. 3.2 2b (SEQ ID NO:16)
..Z..CTC.ZG..Z...... 1.6 .+-. 0.5 2.8 .+-. 2.2 2c (SEQ ID NO:17)
..Z..CTC..G......... 3.1 .+-. 0.6 7.3 .+-. 1.4 2d (SEQ ID NO:18)
..C..CTC..G......Z.. 7.4 .+-. 1.4 27.7 .+-. 5.4 2e (SEQ ID NO:19)
............A....... 5.6 .+-. 2.0 ND 3D (SEQ ID NO:20)
GAGAACGCTGGACCTTCCAT 4.9 .+-. 0.5 19.9 .+-. 3.6 3Da (SEQ ID NO:21)
.........C.......... 6.6 .+-. 1.5 33.9 .+-. 6.8 3Db (SEQ ID NO:22)
.........C.......G.. 10.1 .+-. 2.8 25.4 .+-. 0.8 3Dc (SEQ ID NO:23)
...C.A.............. 1.0 .+-. 0.1 1.2 .+-. 0.5 3Dd (SEQ ID NO:24)
.....Z.............. 1.2 .+-. 0.2 1.0 .+-. 0.4 3De (SEQ ID NO:25)
.............Z...... 4.4 .+-. 1.2 18.8 .+-. 4.4 3Df (SEQ ID NO:26)
.......A............ 1.6 .+-. 0.1 7.7 .+-. 0.4 3Dg (SEQ ID NO:27)
.........CC.G.ACTG.. 6.1 .+-. 1.5 18.6 .+-. 1.5 3M (SEQ ID NO:28)
TCCATGTCGGTCCTGATGCT 4.1 .+-. 0.2 23.2 .+-. 4.9 3Ma (SEQ ID NO:29)
......CT............ 0.9 .+-. 0.1 1.8 .+-. 0.5 3Mb (SEQ ID NO:30)
.......Z............ 1.3 .+-. 0.3 1.5 .+-. 0.6 3Mc (SEQ ID NO:31)
...........Z........ 5.4 .+-. 1.5 8.5 .+-. 2.6 3Md (SEQ ID NO:37)
......A..T.......... 17.2 .+-. 9.4 ND 3Me (SEQ ID NO:32)
...............C..A. 3.6 .+-. 0.2 14.2 .+-. 5.2 4 (SEQ ID NO:90)
TCAACGTT 6.1 .+-. 1.4 19.2 .+-. 5.2 4a (SEQ ID NO:91) ....GC.. 1.1
.+-. 0.2 1.5 .+-. 1.1 4b (SEQ ID NO:92) ...GCGC. 4.5 .+-. 0.2 9.6
.+-. 3.4 4c (SEQ ID NO:93) ...TCGA. 2.7 .+-. 1.0 ND 4d (SEQ ID
NO:94) ..TT..AA 1.3 .+-. 0.2 ND 4e (SEQ ID NO:106) -....... 1.3
.+-. 0.2 1.1 .+-. 0.5 4f (SEQ ID NO:95) C....... 3.9 .+-. 1.4 ND 4g
(SEQ ID NO:107) --......CT 1.4 .+-. 0.3 ND 4h (SEQ ID NO:96)
.......C 1.2 .+-. 0.2 ND LPS 7.8 .+-. 2.5 4.8 .+-. 1.0 Stimulation
indexes are the means and std. dev. derived from at least 3
separate experiments, and are compared to wells cultured with no
added ODN. ND = not done. CpG dinucleotides are underlined. Dots
indicate identity; dashes indicate deletions. Z = 5 methyl
cytosine.
Other octamer ODN containing a 6 base palindrome with a TpC
dinucleotide at the 5' end were also active (e.g., Table 1, ODN 4b,
4c). Other dinucleotides at the 5' end gave reduced stimulation
(e.g., ODN 4f, all sixteen possible dinucleotides were tested). The
presence of a 3' dinucleotide was insufficient to compensate for
the lack of a 5' dinucleotide (e.g., Table 1, ODN 4g). Disruption
of the palindrome eliminated stimulation in octamer ODN (e.g.,
Table 1, ODN 4h), but palindromes were not required in longer
ODN.
The kinetics of lymphocyte activation were investigated using mouse
spleen cells. When the cells were pulsed at the same time as ODN
addition and harvested just four hours later, there was already a
two-fold increase in .sup.3H uridine incorporation. Stimulation
peaked at 12-48 hours and then decreased. After 24 hours, no intact
ODN were detected, perhaps accounting for the subsequent fall in
stimulation when purified B cells with or without anti-IgM (at a
submitogenic dose) were cultured with CpG ODN, proliferation was
found to synergistically increase about 10-fold by the two mitogens
in combination after 48 hours. The magnitude of stimulation was
concentration dependent and consistently exceeded that of LPS under
optimal conditions for both. Oligonucleotides containing a nuclease
resistant phosphorothioate backbone were approximately two hundred
times mor potent than unmodified oligonucleotides.
Cell cycle analysis was used to determine the proportion of B cells
activated by CpG-ODN. CpG-ODN induced cycling in more than 95% of B
cells. Splenic B lymphocytes sorted by flow cytometry into
CD23-(marginal zone) and CD23+(follicular) subpopulations were
equally responsive to ODN-induced stimulation, as were both resting
and activated populations of B cells isolated by fractionation over
Percoll gradients. These studies demonstrated that CpG-ODN induced
essentially all B cells to enter the cell cycle.
Immunostimulatory Nucleic Acid Molecules Block Murine B Cell
Apoptosis
Certain B cell lines, such as WEHI-231, are induced to undergo
growth arrest and/or apoptosis in response to crosslinking of their
antigen receptor by anti-IgM (Jakway, J. P. et al., "Growth
regulation of the B lymphoma cell line WEHI-231 by
anti-immunoglobulin, lipopolysaccharide and other bacterial
products" J. Immunol. 137: 2225 (1986); Tsubata, T., J. Wu and T.
Honjo: B-cell apoptosis induced yb antigen receptor crosslinking is
blocked by a T-cell signal through CD40." Nature 365: 645 (1993)).
WEHI-231 cells are rescued from this growth arrest by certain
stimuli such as LPS and by the CD40 ligand. ODN containing the CpG
motif were also found to protect WEHI-231 from anti-IgM induced
growth arrest, indicating that accessory cell populations are not
required for the effect. Subsequent work indicates that CpG ODN
induce Bcl-x and myc expression, which may account for the
protection from apoptosis. Also, CpG nucleic acids have been found
to block apoptosis in human cells. This inhibition of apoptosis is
important, since it should enhance and prolong immune activation by
CpG DNA.
Identification of the Optimal CpG Motif for Induction of Murine
IL-6 and IgM Secretion and B Cell Proliferation.
To evaluate whether the optimal B cell stimulatory CpG motif was
identical with the optimal CpG motif for IL-6 secretion, a panel of
ODN in which the bases flanking the CpG dinucleotide were
progressively substituted was studied. This ODN panel was analyzed
for effects on B cell proliferation, Ig production, and IL-6
secretion, using both splenic B cells and CH12.LX cells. As shown
in Table 2, the optimal stimulatory motif contains an unmethylated
CpG flanked by two 5' purines and two 3' pyrimidines. Generally a
mutation of either 5' purines to C were especially deleterious, but
changes in 5' purines to T or 3' pyrimidines to purines had less
marked effects. Based on analyses of these and scores of other ODN,
it was determined that the optimal CpG motif for induction of IL-6
secretion is TGACGTT (SEQ. ID. NO: 108), which is identical with
the optimal mitogenic and IgM-inducing CpG motif (Table 2). This
motif was more stimulatory than any of the palindrome containing
sequences studied (1639, 1707 and 1708).
Induction of Murine Cytokine Secretion by CpG Motifs in Bacterial
DNA or Oligonucleotides.
As described in Example 9, the amount of IL-6 secreted by spleen
cells after CpG DNA stimulation was measured by ELISA. T cell
depleted spleen cell cultures rather than whole spleen cells were
used for in vitro studies following preliminary studies showing
that T cells contribute little or nothing to the IL-6 produced by
CpG DNA-stimulated spleen cells. As shown in Table 3, IL-6
production was markedly increased in cells cultured with E. coli
DNA but not in cells cultured with calf thymus DNA. To confirm that
the increased IL-6 production observed with E. coli DNA was not de
to contamination by other bacterial products, the DNA was digested
with DNAse prior to analysis. DNAse pretreatment abolished IL-6
production induced by E. coli DNA (Table 3). In addition, spleen
cells from LPS-nonresponsive C2H/HeJ mouse produced similar levels
of IL-6 in response to bacterial DNA. To analyze whether the IL-6
secretion induced by E. coli DNA was mediated by the unmethylated
CpG dinucleotides in bacterial DNA, methylated E. coli DNA and a
panel of synthetic ODN were examined. As shown in Table 3, CpG ODN
significantly induced IL-6 secretion (ODN 5a, 5b, 5c) while CpG
methylated E. coli DNA, or ODN containing methylated CpG (ODN 5f)
or no CpG (ODN 5d) did not. Changes at sites other than CpG
dinucleotides (ODN 5b) or methylation of other cytosines (ODN 5g)
did not reduce the effect of CpG ODN. Methylation of a single CpG
in an ODN with three CpGs resulted in a partial reduction in the
stimulation (compare ODN 5c to 5e; Table 3).
TABLE-US-00002 TABLE 3 Induction of Murine IL-6 secretion by CpG
motifs in bacterial DNA or oligonucleotides Treatment IL-6 (pg/ml)
calf thymus DNA .ltoreq.10 calf thymus DNA + DNase .ltoreq.10 E.
coli DNA 1169.5 .+-. 94.1 E. coli DNA + DNase .ltoreq.10 CpG
methylated E. coli DNA .ltoreq.10 LPS 280.1 .+-. 17.1 Media (no
DNA) .ltoreq.10 ODN5a SEQ. ID. No:115 TGGACTCTCCAGCGTTCTC 1096.4
.+-. 372.0 5b SEQ. ID. No:19 .....AGG....A....... 1124.5 .+-. 126.2
5c SEQ. ID. No:15 ..C.......G......... 1783.0 .+-. 189.5 5d SEQ.
ID. No:124 .... AGG..C..T...... .ltoreq.10 5e SEQ. ID. No:116
..C.......G..Z...... 851.1 .+-. 114.4 5f SEQ. ID. No:16
..Z......ZG..Z...... .ltoreq.10 5g SEQ. ID. No:18
..C.......G......Z.. 1862.3 + 87.26 T cell depleted spleen cells
from DBA/2 mice were stimulated with phosphodiester modified
oligonucleotides (O-ODN) (20 .mu.M), calf thymus DNA (50 .mu.g/ml)
or E. coli DNA (50 .mu.g/ml) with or without enzyme treatment, or
LPS (10 .mu.g/ml) for 24 hr. Data represent the mean (pg/ml) .+-.
SD of triplicates. CpG dinucleotides are underlined and dots
indicate identity. Z indicates 5-methylcytosine.
CpG Motifs can be used as an Artificial Adjuvant.
Nonspecific simulators of the immune response are known as
adjuvants. The use of adjuvants is essential to induce a strong
antibody response to soluble antigens (Harlow and Lan, Antibodies:
A Laboratory manual, Cold Spring Harbor, N.Y. Current Edition;
hereby incorporated by reference). The overall effect of adjuvants
is dramatic and their importance cannot be overemphasized. The
action of an adjuvant allows much smaller doses of antigen to be
used and generates antibody responses that are more persistent. The
nonspecific activation of the immune response often can spell the
difference between success and failure in obtaining an immune
response. Adjuvants should be used for first injections unless
there is some very specific reason to avoid this. Most adjuvants
incorporate two components. One component is designed to protect
the antigen from rapid catabolism (e.g., liposomes or synthetic
surfactants (Hunter et al. 1981)). Liposomes are only effective
when the immunogen is incorporated into the outer lipid layer;
entrapped molecules are not seen by the immune system. The other
component is a substance that will stimulate the immune response
nonspecifically. These substances act by raising the level of
lymphokines. Lymphokines stimulate the activity of
antigen-processing cells directly and cause a local inflammatory
reaction at the site of injection. Early work relied entirely on
heat-killed bacteria (Dienes 1936) or lipopolysaccharide (LPS)
(Johnson et al. 1956). LPS is reasonably toxic, and, through
analysis of its structural components, most of its properties as an
adjuvant have been shown to be in a portion known as lipid A. Lipid
A is available in a number of synthetic and natural forms that are
much less toxic than LPS, but still retains most of the better
adjuvant properties of parental LPS molecule. Lipid A compounds are
often delivered using liposomes.
Recently an intense drive to find potent adjuvants with more
acceptable side effects has led to the production of new synthetic
adjuvants. The present invention provides the sequence 1826
TCCATGACGTTCCTGACGTT (SEQ ID NO: 10), which is an adjuvant
including CpG containing nucleic acids. The sequence is a strong
immune activating sequence and is a superb adjuvant, with efficacy
comparable or superior to complete Freund's, but without apparent
toxicity.
Titration of Induction of Murine IL-6 Secretion by CpG motifs
Bacterial DNA and CpG ODN induced IL-6 production in T cell
depleted murine spleen cells in a dose-dependent manner, but
vertebrate DNA and non-CpG ODN did not (FIG. 1). IL-6 production
plateaued at approximately 50 .mu.g/ml of bacterial DNA or 40 .mu.M
of CpG O-ODN. The maximum levels of IL-6 induced by bacterial DNA
and CpG ODN were 1-1.5 ng/ml and 2-4 ng/ml respectively. These
levels were significantly greater than those seen-after stimulation
by LPS (0.35 ng/ml) (FIG. 1A). To evaluate whether CpG ODN with a
nuclease-resistant DNA backbone would also induce IL-6 production,
S-ODN were added to T cell depleted murine spleen cells. CpG S-ODN
also induced IL-6 production in a dose-dependent manner to
approximately the same level as CpG O-ODN while non-CpG S-ODN
failed to induce IL-6 (FIG. 1C). CpG S-ODN at a concentration of
0.05 .mu.M could induce maximal IL-6 production in these cells.
This result indicated that the nuclease-resistant DNA backbone
modification retains the sequence specific ability of CpG DNA to
induce IL-6 secretion and that CpG S-ODN are more than 80-fold more
potent than CpG O-ODN in this assay system. Induction of Murine
IL-6 secretion by CpG DNA In vivo
To evaluate the ability of bacterial DNA and CpG S-ODN to induce
IL-6 secretion in vivo, BALB/c mice were injected iv. with 100
.mu.g of E. coli DNA, calf thymus DNA, or CpG or non-stimulatory
S-ODN and bled 2 hr after stimulation. The level of IL-6 in the
sera from the E. coli DNA injected group was approximately 13 ng/ml
while IL-6 was not detected in the sera from calf thymus DNA or PBS
injected groups (Table 4). CpG S-ODN also induced IL-6 secretion in
vivo. The IL-6 level in the sera from CpG S-ODN injected groups was
approximately 20 ng/ml. In contrast, IL-6 was not detected in the
sera from non-stimulatory S-ODN stimulated group (Table 4).
TABLE-US-00003 TABLE 4 Secretion of Murine IL-6 induced by CpG DNA
stimulation in vivo. Stimulant IL-6 (pg/ml) PBS <50 E. coli DNA
13858 .+-. 3143 Calf Thymus DNA <50 CpG S-ODN 20715 .+-. 606
(5'GCATGACGTTGAGCT3') (SEQ. ID. No:48) non-CpG S-ODN <50
(5'GCTAGATGTTAGCGT3') (SEQ. ID. No:49) Mice (2 mice/group) were
i.v. injected with 100 .mu.l of PBS, 200 .mu.g of E. coli DNA or
calf thymus DNA, or 500 .mu.g of CpG S-ODN or non-CpG control
S-ODN. Mice were bled 2 hr. after injection and 1:10 dilution of
each serum was analyzed by IL-6 ELISA. Sensitivity limit of IL-6
ELISA was 5 pg/ml. Sequences of the CpG S-ODN is
5'GCATGACGTTGAGCT3' (SEQ. ID. No:6) and of the non-stimulatory
S-ODN is 5'GCTAGATGTTAGCGT3' (SEQ. ID. No:4). Note that although
there is a CpG in sequence 48, it is too close to the 3' end to
effect stimulation, as explained herein. Data represent mean .+-.
SD of duplicates. The experiment was done at least twice with
similar results.
Kinetics of Murine IL-6 Secretion after Stimulation by CpG Motifs
In vivo
To evaluate the kinetics of induction of IL-6 secretion by CpG DNA
n vivo, BALB/c mice were injected iv. with CpG or control non-CpG
S-ODN. Serum IL-6 levels were significantly increased within 1 hr
and peaked at 2 hr to a level of approximately 9 ng/ml in the CpG
S-ODN injected group (FIG. 2). IL-6 protein in sera rapidly
decreased after 4 hr and returned to basal level by 12 hr after
stimulation. In contrast to CpG DNA stimulated groups, no
significant increase of IL-6 was observed in the sera from the
non-stimulatory S-ODN or PBS injected groups (FIG. 2).
Tissue Distribution and Kinetics of IL-6, mRNA Expression Induced
by CpG Motifs In vivo
As shown in FIG. 2, the level of serum IL-6 increased rapidly after
CpG DNA stimulation. To investigate the possible tissue origin of
this serum IL-6, and the kinetics of IL-6 gene expression in vivo
after CpG DNA stimulation, BALB/c mice were injected iv with CpG or
non-CpG S-ODN and RNA was extracted from liver, spleen, thymus, and
bone marrow at various time points after stimulation. As shown in
FIG. 3A, the level of IL-6 mRNA in liver, spleen, and thymus was
increased within 30 min. after injection of CpG S-ODN. The liver
IL-6 mRNA peaked at 2 hr post-injection and rapidly decreased and
reached basal level 8 hr after stimulation (FIG. 3A). Splenic IL-6
mRNA peaked at 2 hr after stimulation and then gradually decreased
(FIG. 3A). Thymus IL-6 mRNA peaked at 1 hr post-injection and then
gradually decreased (FIG. 3A). IL-6 mRNA was significantly
increased in bone marrow within 1 hr after CpG S-ODN injection but
then returned to basal level. In response to CpG S-ODN, liver,
spleen and thymus showed more substantial increases in IL-6 mRNA
expression than the bone marrow.
Patterns of Murine Cytokine Expression Induced by CpG DNA
In vivo or in whole spleen cells, no significant increase in the
protein levels of the following interleukins: IL-2, IL-3, IL-4,
IL-5, or IL-10 was detected within the first six hours (Klinman, D.
M. et al., (1996) Proc. Natl. Acad. Sci. USA 93:2879-2883).
However, the level of TNF-.alpha. is increased within 30 minutes
and the level of IL-6 increased strikingly within 2 hours in the
serum of mice injected with CpG ODN. Increased expression of IL-12
and interferon gamma (IFN-.gamma.) mRNA by spleen cells was also
detected within the first two hours. dots indicate
TABLE-US-00004 TABLE 5 Induction of human PBMC cytokine secrtetion
by CpG oligos ODN Sequence (5'-3') IL-6.sup.1 TNF-.alpha..sup.1
IFN-.gamma..sup.1 GM-CSF IL-12 512 TCCATGTCGGTCCTGATGCT 500 140
15.6 70 250 SEQ ID NO:28 1637 ......C............ 550 16 7.8 15.6
35 SEQ ID NO:29 1615 ......G............. 600 145 7.8 45 250 SEQ ID
NO:101 1614 ......A............. 550 31 0 50 250 SEQ ID NO:102 1636
.........A.......... 325 250 35 40 0 SEQ ID NO:103 1634
.........C.......... 300 400 40 85 200 SEQ ID NO:104 1619
.........T.......... 275 450 200 80 >500 SEQ ID NO:105 1618
......A..T.......... 300 60 15.6 15.6 62 SEQ ID NO:7 1639
.....AA..T.......... 625 220 15.6 40 60 SEQ ID NO:3 1707
......A..TC......... 300 70 17 0 0 SEQ ID NO:88 1708
.....CA..TG......... 270 10 17 0 0 SEQ ID NO:106 identity; CpG
dinucleotides are underlined .sup.1measured by ELISA using
Quantikine kits from R & D Systems (pg/ml) Data are presented
as the level of cytokine above that in wells with no added
oligodeoxynucleotide.
CpG DNA Induces Cytokine Secretion by Human PBMC Specifically
Monocytes
The same panels of ODN used for studying mouse cytokine expression
were used to determine whether human cells also are induced by CpG
motifs to express cytokine (or proliferate), and to identify the
CpG motif(s) responsible. Oligonucleotide 1619 (GTCGTT; residues of
6-11 of SEQ. ID. NO: 105) was the best inducer of TNF-.alpha. and
IFN-.gamma. secretion, and was closely followed by a nearly
identical motif in oligonucleotide 1634 (GTCGCT; residues 6-11 of
SEQ. ID. NO: 104) (Table 5). The motifs in oligodeoxynucleotides
1637 and 1614 (GCCGGT; residues 6-11 of SEQ. ID. NO: 29) and
(GACGGT; residues 6-11 of SEQ. ID. NO: 102) led to strong IL-6
secretion with relatively little induction of other cytokines.
Thus, it appears that human lymphocytes, like murine lymphocytes,
secrete cytokines differentially in response to CpG dinucleotides,
depending on the surrounding bases. Moreover, the motifs that
stimulate murine cells best differ from those that are most
effective with human cells. Certain CpG oligodeoxynucleotides are
poor at activating human cells (oligodeoxynucleotides 1707, 1708,
which contain the palindrome forming sequences GACGTC residues 6-11
of SEQ. ID. NO: 88 and CACGTG residues 6-11 of SEQ. ID. NO: 106,
respectively).
The cells responding to the DNA appear to be monocytes, since the
cytokine secretion is abolished by treatment of the cells with
L-leucyl-L-leucine methyl ester (L-LME), which is selectively toxic
to monocytes (but also to cytotoxic T lymphocytes and NK cells),
and does not affect B cell Ig secretion (Table 6). The cells
surviving L-LME treatment had >95% viability by trypan blue
exclusion, indicating that the lack of a cytokine response among
these cells did not simply reflect a nonspecific death of all cell
types. Cytokine secretion in response to E. coli (EC) DNA requires
unmethylated CpG motifs, since it is abolished by methylation of
the EC DNA (next to the bottom row, Table 6). LPS contamination of
the DNA cannot explain the results since the level of contamination
was identical in the native and methylated DNA, and since addition
of twice the highest amount of contaminating LPS had no effect (not
shown).
TABLE-US-00005 TABLE 6 CpG DNA induces cytokine secretion by human
PBMC TNF-.alpha. IL-6 IFN-.gamma. RANTES DNA (pg/ml).sup.1 (pg/ml)
(pg/ml) (pg/ml) EC DNA (50 .mu./ml) 900 12,000 700 1560 EC DNA (5
.mu./ml) 850 11,000 400 750 EC DNA (0.5 .mu./ml) 500 ND 200 0 EC
DNA (0.05 .mu./ml) 62.5 10,000 15.6 0 EC DNA (50 .mu./ml) +
L-LME.sup.2 0 ND ND ND EC DNA (10 .mu./ml) Methyl.sup.3 0 5 ND ND
CT DNA (50 .mu./ml) 0 600 0 0 .sup.1Levels of all cytokines were
determined by ELISA using Quantikine fits from R&D Systems as
described in the previous table. Results are representative using
PBMC from different donors. .sup.2Cells were pretreated for 15 min.
with L-leucyl-L-leucine methyl ester (M-LME) to determine whether
the dytokine production under these conditions was from monocytes
(or other L-LME-sensitive cells). .sup.3EC DNA was methylated using
2 U/.mu.g DNA of CpG methylase (New England Biolabs) according to
the manufacturer's directions, and methylation confirmed by
digestion with Hpa-II and Msp-I. As a negative control, samples
were included containing twice the maximal amount of LPS contained
in the highest concentration of EC DNA which failed to induce
detectable cytokine production under these experimental
conditions.
The loss of cytokine production in the PBMC treated with L-LME
suggested that monocytes may be responsible for cytokine production
in response to CpG DNA. To test this hypothesis more directly, the
effects of CpG DNA on highly purified human monocytes and
macrophages was tested. As hypothesized, CpG DNA directly activated
production of the cytokines IL-6, GM-CSF, and TNF-.alpha. by human
macrophages, whereas non-CpG DNA did not (Table 7).
TABLE-US-00006 TABLE 7 CpG DNA induces cytokine expression in
purified human macrophages IL-6 (pg/ml) GM-CSF (pg/ml) TNF-.alpha.
(pg/ml) Cells alone 0 0 0 CT DNA (50 .mu.g/ml) 0 0 0 EC DNA (50
.mu.g/ml) 2000 15.6 1000
Biological Role of IL-6 in Inducing Murine IgM Production in
Response to CpG Motifs
The kinetic studies described above revealed that induction of IL-6
secretion, which occurs within 1 hr post CpG stimulation, precedes
IgM secretion. Since the optimal CpG motif for ODN inducing
secretion of IL-6 is the same as that for IgM (Table 2), whether
the CpG motifs independently induce IgM and IL-6 production or
whether the IgM production is dependent on prior IL-6 secretion was
examined. The addition of neutralizing anti-IL-6 antibodies
inhibited in vitro IgM production mediated by CpG ODN in a
dose-dependent manner but a control antibody did not (FIG. 4A). In
contrast, anti-IL-6 addition did not affect either the basal level
or the CpG-induced B cell proliferation (FIG. 4B).
Increased Transcriptional Activity of the IL-6 Promoter in Response
to CpG DNA
The increased level of IL-6 mRNA and protein after CpG DNA
stimulation could result from transcriptional or
post-transcriptional regulation. To determine if the
transcriptional activity of the IL-6 promoter was unregulated in B
cells cultured with CpG ODN, a murine B cell line, WEHI-231, which
produces IL-6 in response to CpG DNA, was transfected with an IL-6
promoter-CAT construct (pIL-6/CAT) (Pottrats, S. T. et al.,
17B-estradiol) inhibits expression of human
interleukin-6-promoter-reporter constructs by a receptor-dependent
mechanism. J. Clin. Invest. 93:944). CAT assays were performed
after stimulation with various concentrations of CpG or non-CpG
ODN. As shown in FIG. 5, CpG ODN induced increased CAT activity in
dose-dependent manner while non-CPG ODN failed to induce CAT
activity. This confirms that CpG induces the transcriptional
activity of the IL-6 promoter.
Dependence of B Cell Activation by CpG ODN on the Number of 5' and
3' Phosphorothioate Internucleotide Linkages
To determine whether partial sulfur modification of the ODN
backbone would be sufficient to enhance B cell activation, the
effects of a series of ODN with the same sequence, but with
differing numbers of S internucleotide linkages at the 5' end of
ODN were required to provide optimal protection of the ODN from
degradation by intracellular exo- and endo-nucleases. Only chimeric
ODN containing two 5' phosphorothioate-modified linkages, and a
variable number of 3' modified linkages were therefore
examined.
The lymphocyte stimulating effects of these ODN were tested at
three concentrations (3.3, 10, and 30 .mu.M) by measuring the total
levels of RNA synthesis (by .sup.3H uridine incorporation) or DNA
synthesis (by .sup.3H thymidine incorporation) in treated spleen
cell cultures (Example 10). O-ODN (0/0 phosphorothioate
modifications) bearing a CpG motif caused no spleen cell
stimulation unless added to the cultures at concentrations of at
least 10 .mu.M (Example 10). However, when this sequence was
modified with two S linkages at the 5' end and at least three S
linkages at the 3' end, significant stimulation was seen at a dose
of 3.3 .mu.M. At this low dose, the level of stimulation showed a
progressive increase as the number of 3' modified bases was
increased, until this reached or exceeded six, at which point the
stimulation index began to decline. In general, the optimal number
of 3' S linkages for spleen cell stimulation was five. Of all three
concentrations tested in these experiments, the S-ODN was less
stimulatory than the optimal chimeric compounds.
Dependent of GpG-mediated Lymphocyte Activation on the Type of
Backbone Modification
Phosphorothioate modified ODN (S-ODN) are far more nuclease
resistant than phosphodiester modified ODN (O-ODN). Thus, the
increased immune stimulation caused by S-ODN and S-O-ODN (i.e.,
chimeric phosphorothioate ODN in which the central linkages are
phosphodiester, but the two 5' and five 3' linkages are
phosphorothioate modified) compared to O-ODN may result from the
nuclease resistance of the former. To determine the role of ODN
nuclease resistance in immune stimulation by CpG ODN, the
stimulatory effects of chimeric ODN in which the 5' and 3' ends
were rendered nuclease resistant with either methylphosphonate
(MP-), methylphosphorothioate (MPS-), phosphorothioate (S-), or
phosphorodithioate (S.sub.2-) internucleotide linkages were tested
(Example 10). These studies showed that despite their nuclease
resistance, MP-O-ODN were actually less immune stimulatory than
O-ODN. However, combining the MP and S modifications by replacing
both nonbridging O molecules with 5' and 3' MPS internucleotide
linkages restored immune stimulation to a slightly higher level
than that triggered by O-ODN.
S-O-ODN were far more stimulatory than O-ODN, and were even more
stimulatory than S-ODN, at least at concentrations above 3.3 .mu.M.
At concentrations below 3 .mu.M, the S-ODN with the 3M sequence was
more potent than the corresponding S-O-ODN, while the S-ODN with
the 3D sequence was less potent than the corresponding S-O-ODN
(Example 10). In comparing the stimulatory CpG motifs of these two
sequences, it was noted that the 3D sequence is a perfect match for
the stimulatory motif in that the CpG is flanked by two 5' purines
and two 3' pyrimidines. However, the bases immediately flanking the
CpG in ODN 3D are not optimal; it has a 5' pyrimidine and a 3'
purine. Based on further testing, it was found that the sequence
requirement for immune stimulation is more stringent for S-ODN than
for S-O- or O-ODN. S-ODN with poor matches to the optimal CpG motif
cause little or no lymphocyte activation (e.g., Sequence 3D).
However, S-ODN with good matches to the motif, most critically at
the positions immediately flanking the CpG, are more potent than
the corresponding S-O-ODN (e.g., Sequence 3M, Sequences 4 and 6),
even though at higher concentrations (greater than 3 .mu.M) the
peak effect from the S-O-ODN is greater (Example 10).
S.sub.2O-ODN were remarkably stimulatory, and caused substantially
greater lymphocyte activation than the corresponding S-ODN or
S-O-ODN at every tested concentration.
The increased B cell stimulation seen with CpG ODN bearing S or
S.sub.2 substitutions could result from any or all of the following
effects: nuclease resistance, increased cellular uptake, increased
protein binding, and altered intracellular localization. However,
nuclease resistance cannot be the only explanation, since the
MP-O-ODN were actually less stimulatory than the O-ODN with CpG
motifs. Prior studies have shown that ODN uptake by lymphocytes is
markedly affected by the backbone chemistry (Zhao, et al. (1993)
Comparison of cellular binding and uptake of antisense
phosphodiester, phosphorothioate, and mixed phosphorothioate and
methylphosphonate oligonucleotides. (Antisense Research and
Development 3, 53-66; Zhao et al., (1994) Stage specific
oligonucleotide uptake in murine bone marrow B cell precursors.
Blood 84, 3660-3666). The highest cell membrane binding and uptake
was seen with S-ODN, followed by S-O-ODN, O-ODN, and MP-ODN. This
differential uptake correlates with the degree of immune
stimulation.
Unmethylated CpG Containing Oligos Have NK Cell Stimulatory
Activity
Experiments were conducted to determine whether CpG containing
oligonucleotides stimulated the activity of natural killer (NK)
cells in addition to B cells. As shown in Table 8, a marked
induction of NK activity among spleen cells cultured with CpG ODN 1
and 3Dd was observed. In contrast, there was relatively on
induction in effectors that had been treated with non-CpG control
ODN.
TABLE-US-00007 TABLE 8 Induction Of NK Activity By CpG
Oligodeoxynucleotides (ODN) % YAC-1 Spe- % 2C11 Spe- cific Lysis*
cific Lysis Effector: Target Effector: Target ODN 50:1 100:1 50:1
100:1 None -1.1 -1.4 15.3 16.6 I (SEQ ID NO:13) 16.1 24.5 38.7 47.2
3Dd (SEQ ID NO:27) 17.1 27.0 37.0 40.0 Non-CpG ODN -1.6 -1.7 14.8
15.4
Induction of NK Activity by DNA Containing CpG Motifs, but not by
non-CpG DNA.
Bacterial DNA cultured for 18 hrs at 37.degree. C. and then assayed
for killing of K562 (human) or Yac-1 (mouse) target cells induced
NK lytic activity in both mouse spleen cells depleted of B cells
and human PBMC, but vertebrate DNA may be a consequence of its
increased level of unmethylated CpG dinucleotides, the activating
properties of more than 50 synthetic ODN containing unmethylated,
methylated, or no CpG dinucleotides was tested. The results,
summarized in Table 9, demonstrate that synthetic ODN can stimulate
significant NK activity, as long as they contain at least one
unmethylated CpG dinucleotide. No difference was observed in the
stimulatory effects of ODN in which the CpG was within a palindrome
(such as ODN 1585, which contains the palindrome AACGTT; SEQ. ID.
NO: 105) from those ODN without palindromes (such as 1613 ro 1619),
with the caveat that optimal stimulation was generally seem with
ODN in which the CpG was flanked by two 5' purines or a 5' GpT
dinucleotide and two 3' pyrimidines. Kinetic experiments
demonstrated that NK activity peaked around 18 hrs. after addition
of the ODN. The data indicates that the murine NK response is
dependent on the prior activation of monocytes by CpG DNA, leading
to the production of IL-12, TNF-.alpha., and IFN-.alpha./.beta.
(Example 11).
TABLE-US-00008 TABLE 9 Induction of NK Activity by DNA Containing
CpG Motifs but not by Non-CpG DNA LU/10.sup.6 DNA or Cytokine Added
Mouse Cells Human Cells Expt. 1 None 0.00 0.00 IL-2 16.68 15.82 E.
Coli. DNA 7.23 5.05 Calf thymus DNA 0.00 0.00 Expt. 2 None 0.00
3.28 1585 ggGGTCAACGTTGAGggggg (SEQ ID No.12) 7.38 17.98 1629
-------gtc------- (SEQ ID No.41) 0.00 4.4 Expt. 3 None 0.00 1613
GCTAGACGTTAGTGT (SEQ ID No.42) 5.22 1769 -------Z------- (SEQ ID
No.52) 0.02 ND 1619 TCCATGTCGTTCCTGATGCT (SEQ ID No.38) 3.35 1765
-------Z------- (SEQ ID No.44) 0.11 CpG dinucleotides in ODN
sequences are indicated by underlying; Z indicates methylcytosine.
Lower case letters indicate nuclease resistant phosphorothioate
modified internucleotide linkages which, in titration experiments,
were more than 20 times as potent as non-modified ODN, depending on
the flanking bases. Poly G ends (g) were used in some ODN, because
they significantly increase the level of ODN uptake.
From all of these studies, a more complete understanding of the
immune effects of CpG DNA has been developed, which is summarized
in FIG. 6.
Immune activation by CpG motifs may depend on bases flanking the
CpG, and the number of spacing of the CpGs present within an ODN.
Although a single CpG in an ideal base context can be a very strong
and useful immune activator, superior effects can be seen with ODN
containing several CpGs with the appropriate spacing and flanking
bases. For activation of murine B cells, the optimal CpG motif is
TGACGTT (SEQ. ID. NO: 108); residues 11-17 of Seq. ID. No 70.
The following studies where conducted to identify optimal ODN
sequences for stimulation of human cells by examining the effects
of changing the number, spacing, and flanking bases of CpG
dinucleotides.
Identification of Phosphorothioate ODN with Optimal CpG Motifs for
Activation of Human NK Cells.
To have clinical utility, ODN must be administered to a subject in
a form that protects them against nuclease degradation. Methods to
accomplish this with phosphodiester ODN are well known in the art
and include encapsulation in lipids or delivery systems such as
nanoparticles. This protection can also be achieved using chemical
substitutions to the DNA such as modified DNA backbones including
those in which the internucleotide linkages are nuclease resistant.
Some modifications may confer additional desirable properties such
as increasing cellular uptake. For example, the phosphodiester
linkage can be modified via replacement of one of the nonbridging
oxygen atoms with a sulfur, which constitutes phosphorothioate DNA.
Phosphorothioate ODN have enhanced cellular uptake (Krieg et al.,
Antisense Res. Dev. 6:133, 1996.) and improved B cell stimulation
if they also have a CpG motif. Since NK activation correlates
strongly with in vivo adjuvant effects, the identification of
phosphorothioate ODN that will activate human NK cells is very
important.
The effects of different phosphorothioate ODNs--containing CpG
dinucleotides in various base contexts--on human NK activation
(Table 10) were examined. ODN 1840, which contained 2 copies of the
TGTCGTT (SEQ. ID. NO: 102) residues 14-20 of SEQ. ID. NO: 47 motif,
had significant NK lytic activity (Table 10). To further identify
additional ODNs optimal for NK activation, approximately one
hundred ODN containing different numbers and spacing of CpG motifs,
were tested with ODN1982 serving as a control. The results are
shown in Table 11.
Effective ODNs began with a TC or TG at the 5' end, however, this
requirement was not mandatory. ODNs with internal CpG motifs (e.g.,
ODN 1840) are generally less potent stimulators than those in which
a GTCGCT (SEQ. ID. NO: 58) motif immediately follows the 5' TC
(e.g., ODN 1967 and 1968). ODN 1968, which has a second GTCGTT
(SEQ. ID. NO: 57) motif in its 3' half, was consistently more
stimulatory than ODN 1967, which lacks this second motif. ODN 1967,
however, was slightly more potent than ODN 1968 in experiments 1
and 3, but not in experiment 2. ODN 2005, which has a third GTCGTT
(SEQ. ID. NO: 57) motif, inducing slightly higher NK activity on
average than 1968. However, ODN 2006, in which the spacing between
the GTCGTT (SEQ. ID. NO: 57) motifs was increased by the addition
of two Ts between each motif, was superior to ODN 2005 and to ODN
2007, in which only one of the motifs had the additional of the
spacing two Ts. The minimal acceptable spacing between CpG motifs
is one nucleotide as long as the ODN has two pyrimidines
(preferably T) at the 3' end (e.g., ODN 2015). Surprisingly,
joining two GTCGTT (SEQ. ID. NO: 57) motifs end to end with a 5' T
also created a reasonably strong inducer of NK activity (e.g., ODN
2016). The choice of thymine (T) separating consecutive CpG
dinucleotides is not absolute, since ODN 2002 induced appreciable
NK activation despite the fact that adenine (A) separated its CpGs
(i.e., CGACGTT; SEQ. ID. NO: 113). It should also be noted that
ODNs containing no CpG (e.g., ODN 1982), runs of CpGs, or CpGs in
bad sequence contents (e.g., ODN 2010) had no stimulatory effect on
NK activation.
TABLE-US-00009 TABLE 10 ODN induction of NK Lytic Activity (LU)
SEQ. ID. ODN Sequence (5'-3') LU NO. Cells alone 0.01 -- 1754
ACCATGGACGATCTGTTTCCCCTC 0.02 59 1758 TCTCCCAGCGTGCGCCAT 0.05 45
1761 TACCGCGTGCGACCCTCT 0.05 60 1776 ACCATGGACGAACTGTTTCCCCTC 0.03
61 1777 ACCATGGACGAGCTGTTTCCCCTC 0.05 62 1778
ACCATGGACGACCTGTTTCCCCTC 0.01 63 1779 ACCATGGACGTACTGTTTCCCCTC 0.02
64 1780 ACCATGGACGGTCTGTTTCCCCTC 0.29 65 1781
ACCATGGACGTTCTGTTTCCCCTC 0.38 66 1823 GCATGACGTTGAGCT 0.08 6 1824
CACGTTGAGGGGCAT 0.01 67 1825 CTGCTGAGACTGGAG 0.01 68 1828
TCAGCGTGCGCC 0.01 69 1829 ATGACGTTCCTGACGTT 0.42 70 1830.sup.2
RANDOM SEQUENCE 0.25 1834 TCTCCCAGCGGGCGCAT 0.00 71 1836
TCTCCCAGCGCGCGCCAT 0.46 72 1840 TCCATGTCGTTCCTGTCGTT 2.70 73 1841
TCCATAGCGTTCCTAGCGTT 1.45 74 1842 TCGTCGCTGTCTCCGCTTCTT 0.06 75
1851 TCCTGACGTTCCTGACGTT 2.32 76 .sup.1Lytic units (LU) were
measured as described (8). Briefly, PBMC were collected from normal
donors and spun over Ficoll, then cultured with or without the
indicated ODN (which were added to cultures at 6 .mu.g/ml) for 24
hr. Then their ability to lyse .sup.51Cr-labeled K562 cells was
determined. The results shown are typical of those obtained with
several different normal human donors. .sup.2This oligo mixture
contained a random selection of all 4 bases at each position.
TABLE-US-00010 TABLE 11 Induction of NK LU by Phosphorothioate CpG
ODN with Good Motifs SEQ. ODN.sup.1 Sequence ID NO. expt. 1 expt. 2
expt. 3 Cells alone 0.00 1.26 0.46 1840 TCCATGTCGTTCCTGTCGTT 73
2.33 ND ND 1960 TCCTGTCGTTCCTGTCGTT 77 ND 0.48 8.99 1961
TCCATGTCGTTTTTGTCGTT 78 4.03 1.23 5.08 1962 TCCTGTCGTTCCTTGTCGTT 52
ND 1.60 5.74 1963 TCCTTGTCGTTCCTGTCGTT 79 3.42 ND ND 1965
TCCTGTCGTTTTTTGTCGTT 53 0.46 0.42 3.48 1966 TCGTCGCTGTCTCCGCTTCTT
75 2.62 ND ND 1967 TCGTCGCTGTCTGCCCTTCTT 54 5.82 1.64 8.32 1968
TCGTCGCTGTTGTCGTTTCTT 55 3.77 5.26 6.12 1979.sup.2
TCCATGTZGTTCCTGTZGTT 1.32 ND ND 1982 TCCAGGACTTCTCTCAGGTT 79 0.05
ND 0.98 1990 TCCATGCGTGCGTGCGTTTT 80 2.10 ND ND 1991
TCCATGCGTTGCGTTGCGTT 81 0.89 ND ND 2002 TCCACGACGTTTTCGACGTT 82
4.02 1.31 9.79 2005 TCGTCGTTGTCGTTGTCGTT 47 ND 4.22 12.75 2006
TCGTCGTTTTGTCGTTTTGTCGTT 56 ND 6.17 12.82 2007
TCGTCGTTGTCGTTTTGTCGTT 49 ND 2.68 9.66 2008 GCGTGCGTTGTCGTTGTCGTT
56 ND 1.37 8.15 2010 GCGGCGGGCGGCGCGCGCCC 83 ND 0.01 0.05 2012
TGTCGTTTGTCGTTTGTCGTT 48 ND 2.02 11.61 2013
TGTCGTTGTCGTTGTCGTTGTCGTT 84 ND 0.56 5.22 2014 TGTCGTTGTCGTTGTCGTT
60 ND 5.74 10.89 2015 TCGTCGTCGTCGTT 51 ND 4.53 10.13 2016
TGTCGTTGTCGTT 95 ND 6.54 8.06 .sup.1PBMC essentially as described
herein. Results are representative of 6 separate experiments; each
experiment represents a different donor. .sup.2This is the
methylated version of ODN 1840; Z = 5-methyl cytosine LU is lytic
units; ND = not done; CpG dinucleotides are underlined for
clarity.
Identification of Phosphorothioate ODN with Optimal CpG Motifs for
Activation of Human B Cell Proliferation.
The ability of a CpG ODN to induce B cell proliferation is a good
measure of its adjuvant potential. Indeed, ODN with strong adjuvant
effects generally also induce B cell proliferation. To determine
whether the optimal CpG ODN for inducing B cell proliferation are
the same as those for inducing NK cell activity, similar panels of
ODN (Table 12) were tested. The most consistent stimulation
appeared with ODN 2006 (Table 12).
TABLE-US-00011 TABLE 12 Induction of Human B Cell Proliferation by
Phosphorothioate CpG ODN Stimulation Index.sup.1 DN Sequence
(5'-3') SEQ. ID. NO. expt. 1 expt. 2 expt. 3 expt. 4 expt. 5 1840
TCCATGTCGTTCCTGTCGTT 73 4 ND ND ND ND 1841 TCCATAGCGTTCCTAGCGTT 74
3 ND ND ND ND 1960 TCCTGTCGTTCCTGTCGTT 77 ND 2.0 2.0 3.6 ND 1961
TCCATGTCGTTTTTGTCGTT 78 2 3.9 1.9 3.7 ND 1962 TCCTGTCGTTCCTTGTCGTT
52 ND 3.8 1.9 3.9 5.4 1963 TCCTTGTCGTTCCTGTCGTT 79 3 ND ND ND ND
1965 TCCTGTCGTTTTTTGTCGTT 53 4 3.7 2.4 4.7 6.0 1967
TCGTCGCTGTCTGCCCTTCTT 54 ND 4.4 2.0 4.5 5.0 1968
TCGTCGCTGTTGTCGTTTCTT 55 ND 4.0 2.0 4.9 8.7 1982
TCCAGGACTTCTCTCAGGTT 79 3 1.8 1.3 3.1 3.2 2002 TCCACGACGTTTTCGACGTT
86 ND 2.7 1.4 4.4 ND 2005 TCGTCGTTGTCGTTGTCGTT 47 5 3.2 1.2 3.0 7.9
2006 TCGTCGTTTTGTCGTTTTGTCGTT 46 4 4.5 2.2 5.8 8.3 2007
TCGTCGTTGTCGTTTTGTCGTT 49 3 4.0 4.2 4.1 ND 2008
GCGTGCGTTGTCGTTGTCGTT 56 ND 3.0 2.4 1.6 ND 2010
GCGGCGGGCGGCGCGCGCCC 83 ND 1.6 1.9 3.2 ND 2012
TGTCGTTTGTCGTTTGTCGTT 48 2 2.8 0 3.2 ND 2013
TGTCGTTGTCGTTGTCGTTGTCGTT 84 3 2.3 3.1 2.8 ND 2014
TGTCGTTGTCGTTGTCGTT 50 3 2.5 4.0 3.2 6.7 2015 TCGTCGTCGTCGTT 51 5
1.8 2.6 4.5 9.4 2016 TGTCGTTGTCGTT 85 ND 1.1 1.7 2.7 7.3
.sup.1Cells = human spleen cells stored at -70.degree. C. after
surgical harvest or PBMC collected from normal donors and spun over
Ficoll. Cells were cultured in 96 well U-bottom microtiter plates
with or without the indicated ODN (which were added to cultures at
6 .mu.ml). N = 12 experiments. Cells were cultured for 4-7 days,
pulsed with 1 .mu.Ci of .sup.3H thymidine for 18 hr. before harvest
and scintillation counting. Stimulation index = the ratio of cpm in
wells without ODN to that in wells that had been stimulated
throughout the culture period with the indicated ODN (there were no
further additions of ODN after the cultures were set up). ND = not
done.
Identification of Phosphorothioate ODN that Induce Human IL-12
Secretion
The ability of a CpG ODN to induce IL-12 secretion is a good
measure of its adjuvant potential, especially in terms of its
ability to induce a Th1 immune response, which is highly dependent
on IL-12. Therefore, the ability of a panel of phosphorothioate ODN
to induce OIL-12 secretion from human PBMC in vitro (Table 13) was
examined. These experiments showed that in some human PBMC, most
CpG ODN could induce IL-12 secretion (e.g., expt. 1). However,
other donors responded to just a few CpG ODN (E.g., expt. 2). ODN
2006 was a consistent inducer of IL12 secretion from most subjects
(Table 13).
TABLE-US-00012 TABLE 13 Induction of Human IL-2 Secretion by
Phosphorothioate CpG ODN IL-12 (pg/ml) SEQ ID expt. expt. ODN1
Sequence (5'-3') NO. 1 2 Cells 0 0 alone 1962 TCCTGTCGTTCCTTGTCGTT
52 19 0 1965 TCCTGTCGTTTTTTGTCGTT 53 36 0 1967
TCGTCGCTGTCTGCCCTTCTT 54 41 0 1968 TCGTCGCTGTTGTCGTTTCTT 55 24 0
2005 TCGTCGTTGTCGTTGTCGTT 47 25 0 2006 TCGTCGTTTTGTCGTTTTGTCGTT 46
29 15 2014 TGTCGTTGTCGTTGTCGTT 50 28 0 2015 TCGTCGTCGTCGTT 51 14 0
2016 TGTCGTTGTCGTT 85 3 0 .sup.1PBMC were collected from normal
donors and spun over Ficoll, then cultured at 10.sup.6 cells/wel in
96 with microliter plates with or without the indicated ODN which
were added to culutures at .mu.g/ml. Supernatants were collected at
24 hr. and tested for IL-12 levels by ELISA as described methods. A
standard curver was run in each experiment, which represents a
different donor.
Identification of B cell and Monocyte/NK Cell-Specific
Oligonucleotides
As shown in FIG. 6, CpG DNA can directly activate highly purified B
cells and monocytic cells. There are many similarities in the
mechanism through which CpG DNA activates these cell types. For
example, both require NFkB activation as explained further
below.
In further studies of different immune effects of CpG DNA, it was
found that there is more than one type of CpG motif. Specifically,
olio 1668, with the best mouse B cell motif, is a strong inducer of
both B cell and natural killer (NK) cell activation, while olio
1758 is a weak B cell activator, but still induces excellent NK
responses (Table 14).
TABLE-US-00013 TABLE 14 Different CpG Motifs Stimulate Optimal
Murine B Cell and NK Activation B Cell NK ODN.sup.1 Sequence
Activation Activation.sup.2 1668 TCCATGACGTTCCTGATGCT 42,849 2.52
(SEQ.ID.NO:7) 1758 TCTCCCAGCGTGCGCCAT 1,747 6.66 (SEQ.ID.NO.45)
NONE 367 0.00 CpG diuncleotides are underlined; oligonucleotides
are synthesized with photphorothioate modified backbones to improve
their nuclease resistance. .sup.1Measured by .sup.3H thymidine
incorporation after 48 hr. culture with oligodeoxynucleotides at a
200 nM concentration as described in Example 1. .sup.2Measured in
lytic units.
Teleological Basis of Immunostimulatory Nucleic Acids
Vertebrate DNA is highly methylated and CpG dinucleotides are under
represented. However, the stimulatory CpG motif is common in
microbial genomic DNA, but quite rare in vertebrate DNA. In
addition, bacterial DNA has been reported to induce B cell
proliferation and immunoglobulin (Ig) production, while mammalian
DNA does not (Messina, J. P. et al., J. Immunol. 147:1759 (1991)).
Experiments further described in Example 3, in which methylation of
bacterial DNA with CpG methylase was found to abolish mitogenicity,
demonstrates that the difference in CpG status is the cause of B
cell stimulation by bacterial DNA. This data supports the following
conclusion: that unmethylated CpG dinucleotides present within
bacterial DNA are responsible for the stimulatory effects of
bacterial DNA.
Teleologically, it appears likely that lymphocyte activation by the
CpG motif represents an immune defense mechanism that can thereby
distinguish bacterial from host DNA. Host DNA, which would commonly
be present in many anatomic regions and areas of inflammation due
to apoptosis (cell death), would generally induce little or mo
lymphocyte activation due to CpG suppression and methylation.
However, the presence of bacterial DNA containing unmethylated CpG
motifs can cause lymphocyte activation precisely in infected
anatomic regions, where it is beneficial. This novel activation
pathway provides a rapid alternative to T cell dependent antigen
specific B cell activation. Since the CpG pathway synergizes with B
cell activation through the antigen receptor, B cells bearing
antigen receptor specific for bacterial antigens would receive on e
activation signal through cell membrane Ig and a second signal from
bacterial DNA, and would therefore tend to be preferentially
activated. The interrelationship of this pathway with other
pathways of B cell activation provide a physiologic mechanism
employing a polyclonal antigen to induce antigen-specific
responses.
However, it is likely that B cell activation would not be totally
nonspecific. B cells bearing antigen receptors specific for
bacterial products could receive one activation signal through cell
membrane Ig, and a second from bacterial DNA, thereby more
vigorously triggering antigen specific immune responses. As with
other immune defense mechanisms, the response to bacterial DNA
could have undesirable consequences in some settings. For example,
autoimmune responses to self antigens would also tend to be
preferentially triggered by bacterial infections, since
autoantigens could also provide a second activation signal to
autoreactive B cells triggered by bacterial DNA. Indeed the
induction of autoimmunity by bacterial infections is a common
clinical observance. For example, the autoimmune disease systemic
lupus erythematosus, which is: i) characterized by the production
of anti-DNA antibodies; ii) induced by drugs which inhibit DNA
methyltransferase (Cornaccia, E. J. et al., J. Clin. Invest. 92:38
(1993)); and iii) associated with reduced DNA methylation
(Richardson, B., L. et al., Arth. Rheum 35:647 (1992)), is likely
triggered at least in part by activation of DNA-specific B cells
through stimulatory signals provided by CpG motifs, as well as by
binding of bacterial DNA to antigen receptors.
Further, sepsis, which is characterized by high morbidity and
mortality due to massive and nonspecific activation of the immune
system may be initiated by bacterial DNA and other products
released from dying bacteria that reach concentrations sufficient
to directly activate many lymphocytes. Further evidence of the role
of CpG DNA in the sepsis syndrome is described in Cowdery, J., et.
al., (1996) the Journal of Immunology 156:4570-4575.
Unlike antigens that trigger B cells through their surface Ig
receptor, CpG-ODN did not induce any detectable Ca.sup.2+ flux,
changes in protein tyrosine phosphorylation, or IP 3 generation.
Flow cytometry with FITC-conjugated ODN with or without a CpG motif
was performed as described in Zhao, Q et al., (Antisense Research
and Development 3:53-66 (1993)), and showed equivalent membrane
binding, cellular uptake, efflux, and intracellular localization.
This suggests that there may not be cell membrane proteins specific
for CpG ODN. Rather than acting through the cell membrane, that
data suggests that unmethylated CpG containing oligonucleotides
require cell uptake for activity: ODN covalently linked to a solid
Teflon support were nonstimulatory, as were biotinylated ODN
immobilized on either avidin beads or avidin coated petri dishes.
CpG ODN conjugated to either FITC or biotin retained full mitogenic
properties, indicated no stearic hindrance.
Recent data indicate the involvement of the transcription factor
NFkB as a direct or indirect mediator of the CpG effect. For
example, within 15 minutes of treating B cells or monocytes with
CpG DNA, the level of NFkB binding activity is increased (FIG. 7).
However, it is not increased by DNA that does not contain CpG
motifs. In addition, it was found that two different inhibitors of
NFkB activation, PDTC and gliotoxin, completely block the
lymphocyte stimulation by CpG DNA as measured by B cell
proliferation or monocytic cell cytokine secretion, suggesting that
NFkB activation is required for both cell types.
There are several possible mechanisms through which NFkB can be
activated. These include through activation of various protein
kinases, or through the generation of reactive oxygen species. No
evidence for protein kinase activation induced immediately after
CpG DNA treatment of B cells or monocytic cells have been found,
and inhibitors of protein kinase A, protein kinase C, and protein
tyrosine kinases had no effects on the CpG induced activation. k
However, CpG DNA causes a rapid induction of the production of
reactive oxygen species in both B cells and monocytic cells, as
detected by the sensitive fluorescent dye dihydrorhodamine 123 as
described in Royall, J. A., and Ischiropoulos, H. (Archives of
Biochemistry and Biophysics 302:348-355 (1993)). Moreover,
inhibitors of the generation of these reactive oxygen species
completely block the induction of NFkB and the later induction of
cell proliferation and cytokine secretion by CpG DNA.
Work backwards, the next question was how CpG DNA leads to the
generation of reactive oxygen species so quickly. Previous studies
by the inventors demonstrated that oligonucleotides and plasmid or
bacterial DNA are taken up by cells into endosomes. These endosomes
rapidly become acidified inside the cell. To determine whether this
acidification step may be important in the mechanism through which
CpG DNA activates reactive oxygen species, the acidification step
was blocked with specific inhibitors of endosome acidification
including chloroquine, monensin, and bafilomycin, which work
through different mechanisms. FIG. 8A shows the results from a flow
cytometry study using mouse B cells with the dihydrorhodamine 123
dye to determine levels of reactive oxygen species. The dye only
sample in Panel A of the figure shows the background level of cells
positive for the dye at 28.6%. as expected, this level of reactive
oxygen species was greatly increased to 80% in the cells treated
for 20 minutes with PMA and ionomycin, a positive control (Panel
B). The cells treated with the CpG oligo also showed an increase in
the level of reactive oxygen species such that more than 50% of the
cells became positive (Panel D). However, cells treated with an
oligonucleotide with the identical sequence except that the CpG was
switched did not show this significant increase in the level of
reactive oxygen species (Panel E).
In the presence of chloroquine, the results are very different
(FIG. 8B). Chloroquine slightly lowers the background level of
reactive oxygen species in the cells such that the untreated cells
in Panel A have only 4.3% that are positive. Chloroquine completely
abolishes the induction of reactive oxygen species in the cells
treated with CpG DNA (Panel B) but does not reduce the level of
reactive oxygen species in the cells treated with PMA and ionomycin
(Panel E). This demonstrates that unlike the PMA plus ionomycin,
the generation of reactive oxygen species following treatment of B
cells with CpG DNA requires that the DNA undergo an acidification
step in the endosomes. This is a completely novel mechanism of
leukocyte activation. Chloroquine, monensin, and bafilomycin also
appear to block the activation of NFkB by CpG DNA as well as the
subsequent proliferation and induction of cytokine secretion.
Chronic Immune Activation by CpG DNA and Autoimmune Disorders
B cell activation by CpG DNA synergizes with signals through the B
cell receptor. This raises the possibility that DNA-specific B
cells may be activated by the concurrent binding of bacterial DNA
to their antigen receptor, and by the co-stimulatory CpG-mediated
signals. In addition, CpG DNA induces B cells to become resistant
to apoptosis, a mechanism thought to be important for preventing
immune responses to self antigens, such as DNA. Indeed, exposure to
bDNA can trigger anti-DNA Ab production. Given this potential
ability of CpG DNA to promote autoimmunity, it is therefore
noteworthy that patients with the autoimmune disease systemic lupus
erythematosus have persistently elevated levels of circulating
plasma DNA which is enriched in hypomethylated CpGs. These findings
suggest a possible role for chronic immune activation by CpG DNA in
lupus etiopathogenesis.
A class of medications effective in the treatment of lupus is
antimalarial drugs, such as chloroquine. While the therapeutic
mechanism of these drugs has been unclear, they are known to
inhibit endosomal acidification. Leukocyte activation by CpG DNA is
not medicated through binding to a cell surface receptor, but
requires cell uptake, which occurs via adsorptive endocytosis into
an acidified chloroquine-sensitive intracellular compartment. This
suggested the hypothesis that leukocyte activation by CpG DNA may
occur in association with acidified endosomes, and might even be pH
dependent. To test this hypothesis specific inhibitors of DNA
acidification were applied to determine whether B cells or
monocytes could respond to CpG DNA if endosomal acidification was
prevented.
The earliest leukocyte activation event that was detected in
response to CpG DNA is the production of reactive oxygen species
(ROS), which is induced within five minutes in primary spleen cells
and both B and monocyte cell lines. Inhibitors of endosomal
acidification including chloroquine, bafilomycin A, and monensin,
which have different mechanisms of action, blocked the CpG-induced
generation of ROS, but had no effect on ROS generation mediated by
PMA, or ligation of CD40 or IgM. These studies show that ROS
generation is a common event in leukocyte activation through
diverse pathways. This ROS generation is generally independent of
endosomal acidification, which is required only for the ROS
response to CpG DNA. ROS generation in response to CpG is not
inhibited by the NF.kappa.B inhibitor gliotoxin, confirming that it
is not secondary to NF.kappa.B activation.
To determine whether endosomal acidification of CpG DNA was also
required for its other immune stimulatory effects were performed.
Both LPS and CpG DNA induce similar rapid NF.kappa.B activation,
increases in proto-oncogene mRNA levels, and cytokine secretion.
Activation of NF.kappa.B by DNA depended on CpG motifs since it was
not induced by bDNA treated with CpG methylase, nor by ODN in which
bases were switched to disrupt the CpGs. Supershift experiments
using specific antibodies indicated that the activated NF.kappa.B
complexes included the p50 and p65 components. Not unexpectedly,
NF.kappa.B activation in LPS- or CpG-treated cells was accompanied
by the degradation of I.kappa.B.alpha. and I.kappa.B.beta..
However, inhibitors of endosomal acidification selectively blocked
all of the CpG-induced but none of the LPS-induced cellular
activation events. The very low concentration of chloroquine
(<10 .mu.M) that has been determined to inhibit CpG-mediated
leukocyte activation is noteworthy since it is well below that
required for antimalarial activity and other reported immune
effects (e.g., 100-1000 .mu.M). These experiments support the role
of a pH-dependent signaling mechanism in mediating the stimulatory
effects of CpG DNA.
TABLE-US-00014 TABLE 15 Specific blockade of CpG-induced
TNF-.alpha. and IL-12 expression by inhibitors of endosomal
acidification or NF.kappa.B activation Inhibitors: Bafilomycin
Chloroquine Monensin NAC TPCK Gliotoxin Bisgliotoxin Medium (250
nM) (2.5 .mu.g/ml) (10 .mu.M) (50 mM) (50 .mu.M) (0.1 .mu.g/ml)
(0.1 .mu.g/ml) activators TNF-.alpha. IL-12 TNF-.alpha. IL-12
TNF-.alpha. IL-12 TNF-.alph- a. IL-12 TNF-.alpha. TNF-.alpha.
TNF-.alpha. TNF-.alpha. Medium 37 147 46 102 27 20 22 73 10 24 17
41 CpG 455 17,114 71 116 28 6 49 777 54 23 31 441 ODN LPS 901
22,485 1370 4051 1025 12418 491 4796 417 46 178 1120 Table 15
legend IL-12 and TNF-.alpha. assays: The murine monocyte cell line
J774 (1 .times. 10.sup.5 cells/ml for IL-12 or 1 .times. 10.sup.6
cells/ml for TNF-.alpha.), were cultured with or without the
indicated inhibitors at the concentrations shown for 2 hr and then
stimulated with the CpG oligodeoxynucleotide (ODN) 1826
(TCCATGACGTTCCTGACGTT SEQ IDNO: 10) at 2 .mu.M or LPS (10 .mu.g/ml)
for 4 hr (TNF-.alpha.) or 24 hr (IL-12) at which time the
supernatant was harvested. ELISA for IL-12 or TNF-.alpha. (pg/ml)
was performed on the supernatants essentially as described (A. K.
Krieg, A. -K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R.
Teasdale, G. Koretzky and D. Klinman, Nature374, 546 (1995); Yi, A.
-K., D. M. Klinman, T. L. Martin, S. Matson and A. M. Krieg, J.
Immunol., 157, 5394 5402 (1996); Krieg, A. M., J. Lab. Clin. Med.,
128, 128 133 (1996). Cells cultured with ODN that lacked CpG motifs
did not induce cytokine secretion. Similar specific inhibition of
CpG responses was seen with IL-6 assays,and in experiments using
primary spleen cells or the B cell lines CH 12.LX and WEHI-231.2.5
.mu.g/ml of chloroquine is equivalent to <5 .mu.M. Other
inhibitors of NF-.kappa.B activation including PDTC and calpain
inhibitors I and II gave similar results to the inhibitors shown.
The results shown are representative of those obtained in ten
different experiments.
Excessive immune activation by CpG motifs may contribute to the
pathogenesis of the autoimmune disease systemic lupus
erythematosus, which is associated with elevated levels of
circulating hypomethylated CpG DNA. Chloroquine and related
antimalarial compounds are effective therapeutic agents for the
treatment of systemic lupus erythematosus and some other autoimmune
diseases, although their mechanism of action has been obscure. Our
demonstration of the ability of extremely low concentrations of
chloroquine to specifically inhibit CpG-mediated leukocyte
activation suggests a possible new mechanism for its beneficial
effect. It is noteworthy that lupus recurrences frequently are
thought to be triggered by microbial infection. Levels of bDNA
present in infected tissues can be sufficient to induce a local
inflammatory response. Together with the likely role of CpG DNA as
a mediator of the sepsis syndrome and other diseases our studies
suggest possible new therapeutic applications for the antimalarial
drugs that act as inhibitors of endosomal acidification.
CpG-induced ROS generation could be an incidental consequence of
cell activation, or a signal that mediates this activation. The ROS
scavenger N-acetyl-L-cysteine (NAC) blocks CpG-induced NF.kappa.B
activation, cytokine production, and B cell proliferation,
suggesting a casual role for ROS generation in these pathways.
These data are compatible with previous evidence supporting a role
for ROS in the activation of NF.kappa.B. WEHI-231 B cells
(5.times.10.sup.5 cells/ml) were precultured for 30 minutes with or
without chloroquine (5 .mu.g/ml [<10 .mu.M]) or gliotoxin (0.2
.mu.g/ml). Cell aliquots were then cultured as above for 10 minutes
in RPMI medium with or without a CpG ODN (1826) or non-CpG ODN
(1911) at 1 .mu.M or phorbol myristate acetate (PMA) plus ionomycin
(iono). Cells were then stained with dihydrorhodamine-123 and
analyzed for intracellular ROS production by flow cytometry as
described (A. K. Krieg, A.-K. Yi, S. Matson, T. J. Waldschmidt, G.
A. Bishop, R. Teasdale, G. Koretzky and D. Klinman, Nature 374, 546
(1995); Yi, A.-K., D. M. Klinman, T. L. Martin, S. Matson and A. M.
Krieg, J. Immunol., 157, 5394-5402 (1996); Krieg, A. M, J. Lab.
Clin. Med., 128, 128-133 (1996)). J 1774 cells, a monocytic line,
showed similar pH-dependent CpG induced ROS responses. In contrast,
CpG DNA did not induce the generation of extracellular ROS, nor any
detectable neutrophil ROS. The concentrations of chloroquine (and
those used with the other inhibitors of endosomal acidification)
prevented acidification of the internalized CpG DNA using
fluorescein conjugated ODN as described by Tonkinson, et al.,
(Nucl. Acids Res. 22, 4268 (1994); A. M. Krieg, In: Delivery
Strategies for Antisense Oligonucleotide Therapeutics. Editor, S.
Akhtar, CRC Press, Inc., pp. 177(1995)). At higher concentrations
than those required to inhibit endosomal acidification, nonspecific
inhibitory effects were observed. Each experiment was performed at
least three times with similar results.
While NF.kappa.B is known to be an important regulator of gene
expression, it's role in the transcriptional response to CpG DNA
was uncertain. To determine whether this NF.kappa.B activation was
required for the CpG mediated induction of gene expression cells
were activated with CpG DNA in the presence or absence of
pyrrolidine dithiocarbamate (PDTC), an inhibitor of I.kappa.B
phosphorylation. These inhibitors of NF.kappa.B activation
completely blocked the CpG-induced expression of protooncogene and
cytokine mRNA and protein, demonstrating the essential role of
NF.kappa.B as a mediator of these events. None of the inhibitors
reduced cell viability under the experimental conditions used in
these studies. A J774, a murine monocyte cell line, was cultured in
the presence of calf thymus (CT), E. Coli (EC), or methylated E.
Coli (mEC) DNA (methylated with CpG methylase as.sup.described) at
5 .mu.g/ml or a CpG oligodeoxynucleotide (ODN 1826; Table 15) or a
non-CpG ODN (ODN 1745; TCCATGAGCTTCCTGAGTCT, SEQ. ID. NO: 8) at
0.75 .mu.M for 1 hr, following which the cells were lysed and
nuclear extracts prepared. A double stranded ODN containing a
consensus NF.kappa.B site was 5' radiolabeled and used as a probe
for EMSA essentially as described (J. D. Dignam, R. M. Lebovitz and
R. G. Roeder, Nucleic Acids Res. 11, 1475 (1983); M. Briskin, M.
Damore, R. Law, G. Lee, P. W. Kincade, C. H. Sibley, M. Kuehl and
R. Wall, Mol. Cell. Biol. 10, 422 (1990)). The position of the
p50/p65 heterodimer was determined by supershifting with specific
Ab to p65 and p50 (Santa Cruz Biotechnology, Santa Cruz, Calif.).
Chloroquine inhibition of CpG-induced but not LPS-induced
NF.kappa.B activation was established using J774 cells. The cells
were precultured for 2 hr in the presence or absence of chloroquine
(20 .mu.g/ml) and then stimulated as above for 1 hr with either EC
DNA, CpG ODN, non-CpG ODN or LPS (1 .mu.g/ml). Similar chloroquine
sensitive CpG-induced activation of NF.kappa.B was seen in a B cell
line, WEHI-231 and primary spleen cells. These experiments were
performed three times over a range of chloroquine concentrations
form 2.5 to 20 .mu.g/ml with similar results.
It was also established that CpG-stimulated mRNA expression
requires endosomal acidification and NF.kappa.B activation in B
cells and monocytes. J774 cells (2.times.10.sup.6 cells/ml) were
cultured for 2 hr in the presence or absence of chloroquine (2.5
.mu.g/ml [<5 .mu.M]) or N-tosyl-L-phenylalanine chlorometryl
ketone (TPCK: 50 .mu.M), a serine/threonine protease inhibitor that
prevents I.kappa.B proteolysis and thus blocks NF.kappa.B
activation. Cells were then stimulated with the addition of E. Coli
DNA (EC: 50 .mu.g/ml), calf thymus DNA (CT: 50 .mu.g/ml), LPS (10
.mu.g/ml), CpG ODN (1826; 1 .mu.M), or control non CpG ODN (1911; 1
.mu.M) for 3 hr. WEHI-231 B cells (5.times.10.sup.5 cells/ml) were
cultured in the presence or absence of gliotoxin (0.1 .mu.g/ml) or
bisgliotoxin (0.1 .mu.g/ml) for 2 hrs and then stimulated with a
CpG ODN (1826), or control non-CpG ODN (1911; TCCAGGACTTTCCTCAGGTT,
SEQ. ID. NO.97) at 0.5 .mu.M for 8 hr. In both cases, cells were
harvested and RNA was prepared using RNAzol following the
manufacturer's protocol. Multi-probe RNASE protection assay was
performed as described (A.-K. Yi, P. Hornbeck, D. E. Lafrenz and A.
M. Krieg, J Immunol., 157, 4918-4925 (1996). Comparable amounts of
RNA were loaded into each lane by using ribosomal mRNA as a loading
control (L32). These experiments were performed three times with
similar results.
The results indicate that leukocytes respond to CpG DNA through a
novel pathway involving the pH-dependent generation of
intracellular ROS. The pH dependent step may be the transport or
processing of the CpG DNA, the ROS generation, or some other event.
ROS are widely thought to be second messengers in signaling
pathways in diverse cell types, but have not previously been shown
to mediate a stimulatory signal in B cells.
Presumably, there is a protein in or near the endosomes that
specifically recognizes DNA containing CpG motifs and leads to the
generation of reactive oxygen species. To detect any protein in the
cell cytoplasm that may specifically bind CpG DNA, electrophoretic
mobility shift assays (EMSA) were used with 5' radioactively
labeled oligonucleotides with or without CpG motifs. A band was
found that appears to represent a protein binding specifically to
single stranded oligonucleotides that have CpG motifs, but not to
oligonucleotides that lack CpG motifs or to oligonucleotides in
which the CpG motif has been methylated. This binding activity is
blocked if excess of oligonucleotides that contain the NF.kappa.B
binding site was added. This suggests that an NF.kappa.B or related
protein is a component of a protein or protein complex that binds
the stimulatory CpG oligonucleotides.
No activation of CREB/ATF proteins was found at time points where
NF.kappa.B was strongly activated. These data therefore do not
provide proof the NF.kappa.B proteins actually bind to the CpG
nucleic acids, but rather that the proteins are required in some
way for the CpG activity. It is possible that a CREB/ATF or related
protein may interact in some way with NF.kappa.B proteins or other
proteins thus explaining the remarkable similarity in the binding
motifs for CREB proteins and the optimal CpG motif. It remains
possible that the oligos bind to a CREB/ATF or related protein, and
that this leads to NF.kappa.B activation.
Alternatively, it is very possible that the CpG nucleic acids may
bind to one of the TRAF proteins that bind to the cytoplasmic
region of CD40 and mediate NF.kappa.B activation when CD40 is
cross-linked. Examples of such TRAF proteins include TRAF-2 and
TRAF-5.
Method for Making Immunostimulatory Nucleic Acids
For use in the instant invention, nucleic acids can be synthesized
de novo using any of a number of procedures well known in the art.
For example, the b-cyanoethyl phosphoramidite method (S. L.
Beaucage and M. H. Caruthers, (1981) Tet. Let. 22:1859); nucleoside
H-phosphonate method (Garegg et al., (1986) Tet. Let. 27:4051-4054;
Froehler et al., (1986) Nucl. Acid. Res 14:5399-5407; Garegg eg
al., (1986) Tet. Let. 27:4055-4058, Gaffney et al., (1988) Tet.
Let. 29:2619-2622). These chemistries can be performed by a variety
of automated oligonucleotide synthesizers available in the market.
Alternatively, oligonucleotides can be prepared from existing
nucleic acid sequences (e.g. genomic or cDNA) using known
techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
For use in vivo, nucleic acids are preferably relatively resistant
to degradation (e.g. via endo- and exo-nucleases). Secondary
structures, such as stem loops, can stabilize nucleic acids against
degradation. Alternatively, nucleic acid stabilization can be
accomplished via phosphate backbone modifications. A preferred
stabilized nucleic acid has at least a partial phosphorothioate
modified backbone. Phosphorothioates may be synthesized using
automated techniques employing either phosphoramidate or
H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made
e.g. as described in U.S. Pat. No. 4,469,863; and
alkylphosphotriesters (in which the charged oxygen moiety is
alkylated as described in U.S. Pat. No. 5,023,243 and European
Patent No. 092,574) can be prepared by automated solid phase
synthesis using commercially available reagents. Methods for making
other DNA backbone modifications and substitutions have been
described (Uhlmann, E. And Peyman, A. (1990) Chem. Rev. 90:544;
Goodchild, J. (I 990) Bioconjugate Chem. 1: 165). 2'-O-methyl
nucleic acids with CpG motifs also cause immune activation, as do
ethoxy-modified CpG nucleic acids. In fact, no backbone
modifications have been found that completely abolish the CpG
effect, although it is greatly reduced by replacing the C with a
5-methyl C.
For administration in vivo, nucleic acids may be associated with a
molecule that results in higher affinity binding to target cell
(e.g. B-cell, monocytic cell and natural killer (NK) cell) surfaces
and/or increased cellular uptake by target cells to form a "nucleic
acid delivery complex". Nucleic acids can be ionically, or
covalently associated with appropriate molecules using techniques
which are well known in the art. A variety of coupling or
crosslinking agents can be sued e.g. Protein A, carbodiimide, and
N-succinimidyl-3-(2-pyridyidithio) propionate (SPDP). Nucleic acids
can alternatively be encapsulated in liposomes or virosomes using
well-known techniques.
Therapeutic Uses of Immunostimulatory Nucleic Acid Molecules
Based on their immunostimulatory properties, nucleic acid molecules
containing at least one unmethylated CpG dinucleotide can be
administered to a subject in vivo to treat an "immune system
deficiency". Alternatively, nucleic acid molecules containing at
least one unmethylated CpG dinucleotide can be contacted with
lymphocytes (e.g. B cells, monocytic cells or NK cells) obtained
from a subject having an immune system deficiency ex vivo and
activated lymphocytes can then be re-implanted in the subject.
As reported herein, in response to unmethylated CpG containing
nucleic acid molecules, an increased number of spleen cells secrete
IL-6, IL-12, IFN.gamma., IFN-.alpha., IFN-.beta., IL-1, IL-3,
IL-10, TNF-.alpha., TNF-.beta., GM-CSF, RANTES, and probably
others. The increased IL-6 expression was found to occur in B
cells, CD4.sup.+T cells and monocytic cells.
Immunostimulatory nucleic acid molecules can also be administered
to a subject in conjunction with a vaccine to boost a subject's
immune system and thereby effect a better response from the
vaccine. Preferably the immunostimulatory nucleic acid molecule is
administered slightly before or at the same time as the vaccine. A
conventional adjuvant may optionally be administered in conjunction
with the vaccine, which is minimally comprised of an antigen, as
the conventional adjuvant may further improve the vaccination by
enhancing antigen absorption.
When the vaccine is a DNA vaccine at least two components determine
its efficacy. First, the antigen encoded by the vaccine determines
the specificity of the immune response. Second, if the backbone of
the plasmid contains CpG motifs, its functions as an adjuvant for
the vaccine. Thus, CpG DNA acts as an effective "danger signal" and
causes the immune system to respond vigorously to new antigens in
the area. This mode of action presumably results primarily from the
stimulatory local effects of CpG DNA on dendritic cells and other
"professional" antigen presenting cells, as well as from the
co-stimulatory effects on B cells.
Immunostimulatory oligonucleotides and unmethylated CpG containing
vaccines, which directly activate lymphocytes and co-stimulate an
antigen-specific response, are fundamentally different from
conventional adjuvants (e.g. aluminum precipates), which are inert
when injected alone and are thought to work through absorbing the
antigen and thereby presenting it more effectively to immune cells.
Further conventional adjuvants only work for certain antigens, only
induce an antibody (humoral) immune response (Th2), and are very
poor at inducing cellular immune responses (Th1). For many
pathogens, the humoral response contributes little to protection,
and can even be detrimental.
In addition, an immunostimulatory oligonucleotide can be
administered prior to along with or after administration of a
chemotherapy or immunotherapy to increase the responsiveness of the
malignant cells to subsequent chemotherapy or immunotherapy or to
speed the recovery of the bone marrow through induction of
restorative cytokines such as GM-CSF. CpG nucleic acids also
increase natural killer cell lytic activity and antibody dependent
cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may
likewise be beneficial in cancer immunotherapy, alone or in
conjunction with other treatments.
Another use of the described immunostimulatory nucleic acid
molecules is in desensitization therapy for allergies, which are
generally caused by IgE antibody generation against harmless
allergens. The cytokines that are induced by unmethylated CpG
nucleic acids are predominantly of a class called "Th1" which is
most marked; by a cellular immune response and is associated with
Il-12 and IFN-.gamma.. The other major type of immune response is
termed a Th2 immune response, which is associated with more of an
antibody immune response and with the production of IL-4, Il-5 and
IL-10. In general, it appears that allergic diseases are mediated
by Th2 type immune responses and autoimmune diseases by Th1 immune
response. Based on the ability of the immunostimulatory nucleic
acid molecules to shift the immune response in a subject from a Th2
(which is associated with production of IgE antibodies and allergy)
to a Th1 response (which is protective against allergic reactions),
an effective dose of an immunostimulatory nucleic acid (or a vector
containing a nucleic acid) alone or in conjunction with an allergen
can be administered to a subject to treat or prevent an
allergy.
Nucleic acids containing unmethylated CpG motifs may also have
significant therapeutic utility in the treatment of asthma. Th2
cytokines, especially IL-4 and IL-5 are elevated in the airways of
asthmatic subjects. These cytokines promote important aspects of
the asthmatic inflammatory response, including IgE isotype
switching, eosinophil chemotaxis and activation and mast cell
growth. Th1 cytokines, especially IFN-.gamma. and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines.
As described in detail in the following Example 12,
oligonucleotides containing an unmethylated CpG motif (I, e,.
TCCATGACGTTCCTGACGTT; SEQ ID NO. 10) but not a control
oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO. 8) prevented the
development of an inflammatory cellular infiltrate and eosinophilia
in a murine model of asthma. Furthermore, the suppression of
eosinophilic inflammation was associated with a suppression of a
Th2 response and induction of a Th1 response.
For use in therapy, an effective amount of an appropriate
immunostimulatory nucleic acid molecule alone or formulated as a
delivery complex can be administered to a subject by any mode
allowing the oligonucleotide to be taken up by the appropriate
target cells (e.g., B-cells and monocytic cells). Preferred routes
of administration include oral and transdermal (e.g., via a patch).
Examples of other routes of administration include injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.). The injection can be in a bolus or a continuous
infusion.
A nucleic acid alone or as a nucleic acid delivery complex can be
administered in conjunction with a pharmaceutically acceptable
carrier. As used herein, the phrase "pharmaceutically acceptable
carrier" is intended to include substances that can be
coadministered with a nucleic acid or a nucleic acid delivery
complex and allows the nucleic acid to perform its indicated
function. Examples of such carriers include solutions, solvents,
dispersion media, delay agents, emulsions and the like. The use of
such media for pharmaceutically active substances are well known in
the art. Any other conventional carrier suitable for use with the
nucleic acids falls within the scope of the instant invention.
The term "effective amount" of a nucleic acid molecule refers to
the amount necessary or sufficient to realize a desired biologic
effect. For example, an effective amount of a nucleic acid
containing at least one unmethylated CpG for treating an immune
system deficiency could be that amount necessary to eliminate a
tumor, cancer, or bacterial, viral or fungal infection. An
effective amount for use as a vaccine adjuvant could be the amount
useful for boosting a subjects immune response to a vaccine. An
"effective amount" for treating asthma can be that amount; useful
for redirecting a Th2 type of immune response that is associated
with asthma to a Th1 type of response. The effective amount for any
particular application can vary depending on such factors as the
disease or condition being treated, the particular nucleic acid
being administered (e.g. the number of unmethylated CpG motifs or
their location in the nucleic acid), the size of the subject, or
the severity of the disease or condition. One of ordinary skill in
the art can empirically determine the effective amount of a
particular oligonucleotide without necessitating undue
experimentation.
The present invention is further illustrated by the following
Examples, which in no way should be construed as further limiting.
The entire contents of all of the references (including literature
references, issued patents, published patent applications, and
co-pending patent applications) cited throughout this application
are hereby expressly incorporated by reference.
EXAMPLES
Example 1
Effects of ODNs on B Cell Total RNA Synthesis and Cell Cycle
B cells were purified from spleens obtained from 6-12 week old
specific pathogen free DBA/2 or BXSB mice (bred in the University
of Iowa animal care facility; no substantial strain differences
were noted) that were depleted of T cells with anti-Thy-1.2 and
complement and centrifugation over lymphocyte M(Cedarlane
Laboratories, Hornby, Ontario, Canada) ("B cells"). B cells
contained fewer than 1% CD4.sup.+ or CD8.sup.+ cells.
8.times.10.sup.4B cells were dispensed in triplicate into 96 well
microtiter plates in 100 .mu.l RPMI containing 10% FBS (heat
inactivated to 65.degree. C. for 30 min.), 50 .mu.M
2-mercaptoethanol, 100 U/ml penicillin, 100 ug/ml streptomycin, and
2 mM L-glutamate. 20 .mu.M ODN were added at the start of culture
for 20 h at 37.degree. C., cells pulsed with 1 .mu.Ci of .sup.3H
uridine, and harvested and counted 4 hr later. Ig secreting B cells
were enumerated using the ALISA spot assay after culture of whole
spleen cells with ODN at 20 .mu.M for 48 hr. Data, reported in
Table 1, represents the stimulation index compared to cell cultured
without ODN. .sup.3H thymidine incorporation assays showed similar
results, but with some nonspecific inhibition by thymidine released
from degraded ODN (Matson. S and A. M. Krieg (1992) Nonspecific
suppression of .sup.3H-thymidine incorporation by control
oligonucleotides. Antisense Research and Development 2:325).
Example 2
Effects of ODN on Production of IgM from B Cells
Single cell suspensions form the spleens of freshly killed mice
were treated with anti-Thyl, anti-CD4, and anti-CD8 and complement
by the method of Leibson et al., J. Exp. Med. 154:1681 (1981)).
Resting B cells (<02% T cell contamination) were isolated from
the 63-70% band of a discontinuous Percoll gradient by the
procedure of DeFranco et al, J. Exp. Med. 155:1523 (1982). These
were cultured as described above in 30 .mu.g/ml LPS for 48 hr. The
number of B cells actively secreting IgM was maximal at this time
point, as determined by ELIspot assay (Klinman, D. M. et al. J.
Immunol 144.506 (1990)). In that assay, B cells were incubated for
6 hrs on anti-Ig coated microtiter plates. The Ig they produced
(>99% IgM) was detected using phosphatase-labeled anti-Ig
(Southern Biotechnology Associated, Birmingham, Ala.). The
antibodies produced by individual B cells were visualized by
addition of BCIP (Sigma Chemical Co., St. Louis Mo.) which forms an
insoluble blue precipitate in the presence of phosphatase. The
dilution of cells producing 20-40 spots/well was used to determine
the total number of antibody-secreting B cells/sample. All assays
were performed in triplicate (data reported in Table 1). In some
experiments, culture supernatants were assayed for IgM by ELISA,
and showed similar increased in response to CpG-ODN.
Example 3
B cell Stimulation by Bacterial DNA
DBA/2 B cells were cultured with no DNA or 50 .mu.g/ml of
a(Micrococcus lysodeikticus; b) NZB/N mouse spleen; and c) NSF/N
mouse spleen genomic DNAs for 48 hours, then pulsed with .sup.3H
thymidine for 4 hours prior to cell harvest. Duplicate DNA samples
were digested with DNASE I for 30 minutes at 37.degree. C. prior to
addition to cell cultures. E coli DNA also induced an 8.8 fold
increase in the number of IgM secreting B cells by 48 hours using
the ELISAspot assay.
DBA/2 B cells were cultured with either no additive, 50 .mu.g/ml
LPS or the ODN 1; 1a; 4; or 4a at 20 .mu.M. Cells were cultured and
harvested at 4, 8, 24 and 48 hours. BXSB cells were cultured as in
Example 1 with 5, 10, 20, 40 or 80 .mu.M of ODN 1; 1a; 4; or 4a or
LPS. In this experiment, wells with no ODN had 3833 cpm. Each
experiment was performed at least three times with similar results.
Standard deviations of the triplicate wells were <5%.
Example 4
Effects of ODN on Natural Killer (NK) Activity
10.times.10.sup.6 C57BL/6 spleen cells were cultured in two ml RPMI
(supplemented as described for Example 1) with or without 40 .mu.M
CpG or non-CpG ODN for forty-eight hours. Cells were washed, and
then used as effector cells in a short term .sup.51Cr release assay
with YAC-1 and 2C11, two NK sensitive target cell lines (Ballas, Z.
K. et al. (1993) j. IMMUNOL. 150:17). Effector cells were added at
various concentrations to 10.sup.4 51Cr-labeled target cells in
V-bottom microtiter plates in 0.2 ml, and incubated in 5% CO.sub.2
for 4 hr. At 37.degree. C. Plates were then centrifuged, and an
aliquot of the supernatant counted for radioactivity. Percent
specific lysis was determined by calculating the ratio of the
.sup.51Cr released in the presence of effector cells minus the
.sup.51Cr released when the target cells are cultured alone, over
the total counts released after cell lysis in 2% acetic acid minus
the .sup.51Cr cpm released when the cells are cultured alone.
Example 5
In vivo Studies with CpG Phosphorothioate ODN
Mice were weighted and injected IP with 0.25 ml of sterile PBS or
the indicated phosphorothioate ODN dissolved in PBS. Twenty four
hours later, spleen cells were harvested, washed, and stained for
flow cytometry using phycoerythrin conjugated 6B2 to gate on B
cells in conjunction with biotin conjugated anti Ly-6A/E or
anti-Ia.sup.d (Pharmingen, San Diego, Calif.) or anti-Bla-1 (Hardy,
R. R. et al., J. Exp. Med 159:1169 (1984). Two mice were studied
for each condition and analyzed individually.
Example 6
Titration of Phosphorothioate ODN for B Cell Stimulation
B cells were cultured with phosphorothioate ODN with the sequence
of control ODN 1a or the CpG ODN 1d and 3Db and then either pulsed
after 20 hr with .sup.3H uridine or after 44 hr with .sup.3H
thymidine before harvesting and determining cpm.
Example 7
Rescue of B Cells From Apoptosis
WEHI-231 cells (5.times.10.sup.4/well) were cultured for 1 hr. at
37.degree. C. in the presence or absence of LPS or the control ODN
1a or the CpG ODN 1d and 3Db before addition of anti-IgM (1
.mu./ml). Cells were cultured for a further 20 hr. Before a 4 hr.
Pulse with 2 .mu.Ci/well .sup.3H thymidine. In this experiment,
cells with no ODN or anti-IgM gave 90.4.times.10.sup.3 cpm of
.sup.3H thymidine incorporation by addition of anti-IgM. The
phosphodiester ODN shown in Table 1 gave similar protection, though
some nonspecific suppression due to ODN degradation. Each
experiment was repeated at least 3 times with similar results.
Example 8
In vivo Induction of Murine IL-6
DBA/2 female mice (2 mos. old) were injected IP with 500 g CpG or
control phosphorothioate ODN. At various time points after
injection, the mice were bled. Two mice were studied for each time
point. IL-6 was measured by ELISA, and IL-6 concentration was
calculated by comparison to a standard curve generate using
recombinant IL-6. The sensitivity of the assay was 10 pg/ml. Levels
were undetectable after 8 hrs.
Example 9
Systemic Induction of Murine IL-6 Transcription
Mice and cell lines. DBA/2, BALB/c, and C3H/HeJ mice at 5-10 wk of
age were used as a source of lymphocytes. All mice were obtained
from The Jackson Laboratory (Bar Harbor, Me.), and bred and
maintained under specific pathogen-free conditions in the
University of Iowa Animal Care Unit. The mouse B cell line CH12.LX
was kindly provided by Dr. G. Bishop (University of Iowa, Iowa
City).
Cell preparation. Mice were killed by cervical dislocation. Single
cell suspensions were prepared aseptically from the spleens from
mice. T cell depleted mouse splenocytes were prepared by using
anti-Thy-1.2 and complement and centrifugation over lymphocyte M
(Cedarlane Laboratories, Hornby, Ontario, Canada) as described
(Krieg, A. M. et al., (1989) A role for endogenous retroviral
sequences in the regulation of lymphocyte activation. J. Immunol
143:2448).
ODN and DNA. Phosphodiester oligonucleotides (O-ODN) and the
backbone modified phosphorothioate oligonucleotides (S-ODN) were
obtained from the DNA Core facility at the University of Iowa or
from Operon Technologies (Alameda, Calif.). E. Coli DNA (Strain B)
and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All
DNA and ODN were purified by extraction with
phenol:chloroform:isoamyl alcohol (25:24: 1) and/or ethanol
precipitation. E. Coli and calf thymus DNA were single stranded
prior to use by boiling for 10 min. followed by cooling on ice for
5 min. For some experiments, E. Coli and calf thymus DNA were
digested with DNase 1(2 U/.mu.g of DNA) at 37.degree. C. for 2 hr
in 1.times.SSC with 5 mM MgC12. To methylate the cytosine in CpG
dinucleotide in E. Coli DNA, E. Coli DNA was treated with CpG
methylase (M. SssI; 2 U/.mu.g of DNA) in NEBuffer 2 supplemented
with 160 .mu.M S-adenosyl methionine and incubated overnight at
37.degree. C. Methylated DNA was purified as above. Efficiency of
methylation was confirmed by Hpa II digestion followed by analysis
by gel electrophoresis. All enzymes were purchased from New England
Biolabs (Beverly, Mass.). LPS level in ODN was less than 12.5 ng/mg
and E. Coli and calf thymus DNA contained less than 2.5 ng of
LPS/mg of DNA by Limulus assay.
Cell Culture. All cells were cultured at 37.degree. C. in a 5%
CO.sub.2 humidifier incubator maintained in RPMI-1640 supplemented
with 10% (v/v) heat inactivated fetal calf serum (FCS), 1.5 mM
L-glutamine, 50 .mu.g/ml), CpG or non-CpG phosphodiester ODN
(O-ODN) (20 .mu.M), phosphorothioate ODN (S-ODN) (0.5 .mu.M), or E.
coli or calf thymus DNA (50 .mu.g/ml) at 37.degree. C. for 24 hr.
(for IL-6 production) or 5 days (for IgM production).
Concentrations of stimulants were chosen based on preliminary
studies with titrations. In some cases, cells were treated with CpG
O-ODN along with various concentrations (1-10 .mu.g/ml) of
neutralizing rat IgG1 antibody against murine IL-6 (hybridoma
MP5-20F3) or control rat IgG1 mAB to E. Coli b-galactosidase
(hybridoma GL 113; ATCC, Rockville, Md.) (20) for 5 days. At the
end of incubation, culture supernatant fractions were analyzed by
ELISA as below.
In vivo induction of IL-6 and IgM. BALB/c mice were injected
intravenously (iv) with PBS, calf thymus DNA (200 .mu.g/100 .mu.l
PBS/mouse), E. coli DNA (2001 g/100 .mu.l PBS/mouse), or CpG or
non-CpG S-ODN (200 .mu.g/100 .mu.l PBS/mouse). Mice (two/group)
were bled by retroorbital puncture and sacrificed by cervical
dislocation at various time points. Liver, spleen, thymus, and bone
marrow were removed by RNA was prepared from those organs using
RNAzol B (Tel-Test, Friendswood, Tex.) according to the
manufactures protocol.
ELISA. Flat-bottomed Immun 1 plates (Dynatech Laboratories, Inc.,
Chantilly, Va.) were coated with 100 .mu.l/well of anti-mouse IL-6
mAb (MP5-20F3) (2 .mu.g/ml) or anti-mouse IgM .mu.-chain specific
(5 .mu.g/ml; Sigma, St. Louis, Mo.) in carbonate-bicarbonate, pH
9.6 buffer (15 nM Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3) overnight at
4.degree. C. The plates were then washed with TPBS (0.5 mM
MgCl.sub.206H.sub.2O, 2.68 mM KCl, 1.47 mM KH.sub.2PO.sub.4, 0.14 M
NaCl, 6.6 mM K.sub.2HPO.sub.4, 0.5% Tween 20) and blocked with 10%
FCS and TPBS for 2 hr at room temperature and then washed again.
Culture supernatants, mouse sera, recombinant mouse IL-6
(Pharmigen, San Diego, Calif.) or purified mouse IgM (Calbiochem,
San Diego, Calif.) were appropriately diluted in 10% FCS and
incubated in triplicate wells for 6 hr at room temperature. The
plates were washed and 100 .mu.l/well of biotinylated rat
anti-mouse IL-6 monoclonal antibodies (MP5-32C 11, Pharmingen, San
Diego, Calif.) (1 .mu.g/ml in 10% FCS) or biotinylated anti-mouse
Ig (Sigma, St. Louis, Mo.) were added and incubated for 45 min. at
room temperature following washes with TPBS. Horseradish peroxidase
(HRP) conjugated avidin (Bio-rad Laboratories, Hercules, Calif.) at
1:4000 dilution in 10% FCS (100 .mu.l/well) was added and incubated
at room temperature for 30 min. The plates were washed and
developed with o-phenylenediamine dihydrochloride (OPD; Sigma, St.
Louis Mo.) 0.05 M phosphate-citrate buffer, pH 5.0, for 30 min. The
reaction was stopped with 0.67 N H.sub.2SO.sub.4 and plates were
read on a microplate reader (Cambridge Technology, Inc., Watertown,
Mass.) at 490-600 nm. The results are shown in FIGS. 1 and 2.
RT-PCR A sense primer, an antisense primer, and an internal
oligonucleotide probe for IL-6 were synthesized using published
sequences (Montgomery, R. A. and M. S. Dallman (1991), Analysis for
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554). cDNA synthesis
and IL-6 PCR was done essentially as described by Montgomery and
Dallman (Montgomery, R. A. And M. S. Dallman (1991), Analysis of
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554) using RT-PCR
reagents from Perkin-Elmer Corp. (Hayward, Calif.). Samples were
analyzed after 30 cycles of amplification by gel electrophoresis
followed by unblot analysis (stoye, J. P. et al., (1991) DNA
hybridization in dried gels with fragmented probes: an improvement
over blotting techniques, Techniques3:123). Briefly, the gel was
hybridized at room temperature for 30 min. in denaturation buffer
(0.05 M NaOH, 1.5M NaCl) followed by incubation for 30 min. In
renaturation buffer (1.5 M NaCl, 1 M Tris, pH 8) and a 30 min. Wash
in double distilled water. The gel was dried and prehybridized at
47.degree. C. for 2 hr. Hybridization buffer (5.times.SSPE, 0.1%
SDS) containing 10 .mu.g/ml denatured salmon sperm DNA. The gel was
hybridized with 2.times.10.sup.6 cpm/ml g-[.sup.32 P] ATP
end-labeled internal oligonucleotide probe for IL-6
(5'CATTTCCACGATTTCCCA3') SEQ ID. NO: 118) overnight at 47.degree.
C., washed 4 times (2.times.SSC, 0.2% SDS) at room temperature and
autoradiographed. The results are shown in FIG. 3.
Cell Proliferation assay. DBA/2 mice spleen B cells
(5.times.10.sup.4 cells/100 .mu.l/well) were treated with media,
CpG or non-CpG S-ODN (0.5 .mu.M) or O-ODN (20 .mu.M) for 24 hr at
37.degree. C. Cells were pulsed for the last four hr. With either
[.sup.3H] Thymidine or [.sup.3H] Uridine (1 .mu.Ci/well). Amounts
of [.sup.3H] incorporated were measured using Liquid Scintillation
Analyzer (Packard Instrument Co., Downers Grove, Ill.).
Transfections and CAT assays. WEHI-231 cells (10.sup.7 cells) were
electroporated with 20 .mu.g of control or human IL-6 promoter-CAT
construct (kindly provided by S. Manolagas, Univ. of Arkansas)
(Pottratz, S. T. Et al., (1994) 17B-estradiol inhibits expression
of human interleukin-6 promotor-reporter constructs by a
receptor-dependent mechanism. J. Clin. Invest. 93:944) at 250 mV
and 960 .mu.F. Cells were stimulated with various concentrations of
CpG or non-CpG ODN after electroporation. Chloramphenicol
acetyltransferase (CAT) activity was measured by a solution assay
(Seed, B. and J. Y. Sheen (1988) A single phase-extraction assay
for chloramphenicol acetyl transferase activity. Gene 76:271) 16
hr. after transfection. The results are presented in FIG. 5.
Example 10
Oligodeoxynucleotide Modifications Determine the Magnitude of B
Cell Stimulation by CpG Motifs
ODN were synthesized on an Applied Biosystems Inc. (Foster City,
Calif.) model 380A, 380B, or 394 DNA synthesizer using standard
procedures (Beacage and Caruthers (1981) Deoxynucleoside
phosphoramidites--A new class of key intermediates for
deoxypolynucleotide synthesis. Tetrahedon Letters 22, 1859-1862.).
Phosphodiester ODN were synthesized using standard beta-cyanoethyl
phosphoramidite chemistry. Phosphorothioate linkages were
introduced by oxidizing the phosphite linkage with elemental sulfur
instead of the standard iodine oxidation. The four common
nucleoside phosphoramidites were purchased from Applied Biosystems.
All phosphodiester and thioate containing ODN were protected by
treatment with concentrated ammonia at 55.degree. C. for 12 hours.
The ODN were purified by gel exclusion chromatography and
lyophilized to dryness prior to use. Phosphorodithioate linkages
were introduced by using deoxynucleoside S-(b-benzoylmercaptoethyl)
pyrrolidino thiophosphoramidites (Wiesler, W. T. et al., (1993) In
Methods in Molecular Biology: Protocols for Oligonucleotides and
Analogs-Synthesis and Properties, Agrawal, S. (Ed.), Humana Press,
191-206.). Dithioate containing ODN were deprotected by treatment
with concentrated ammonia at 55.degree. C. for 12 hours followed by
reverse phase HPLC purification.
In order to synthesize oligomers containing methylphosphonothioates
or methylphosphonates as well as phosphodiesters at any desired
internucleotide linkage, two different synthetic cycles were used.
The major synthetic differences in two cycles are the coupling
reagent where dialkylaminomethylnucleoside phosphines are used and
the oxidation reagents in the case of methylphosphonothioates. In
order to synthesize either derivative, the condensation time has
been increased for the dialkylaminomethylnucleoside phosphines due
to the slower kinetics of coupling (Jager and Engels, (1984)
Synthesis of deoxynucleoside methylphosphonates via a
phosphonamidite approach. Tetrahedron Letters 24, 1437-1440). After
the coupling step has been completed, the methylphosphnodiester is
treated with the sulfurizing reagent (5% elemental sulfur, 100
millimolar N,N-diamethylaminopyridine in carbon
disulfide/pyridine/triethylamine), four consecutive times for 450
seconds each to produce methylphosphonothioates. To produce
methylphosphonate linkages, the methylphosphinodiester is treated
with standard oxidizing reagent (0.1 M iodine in
tetrahydrofuran/2,6-lutidine/water).
The silica gel bound oligomer was treated with distilled
pyridine/concentrated ammonia, 1:1, (v/v) for four days at 4
degrees centigrade. The supernatant was dried in vacuo, dissolved
in water and chromatographed on a G50/50 Sephadex column.
As used herein, O-ODN refers to ODN which are phosphodiester; S-ODN
are completely phosphorothioate modified; S-O=ODN are chimeric ODN
in which the central linkages are phosphodiester, but the two 5'
and five 3' linkages are phosphorothioate modified; 2.sub.2-O-ODN
are chimeric ODN in which the central linkages are phosphodiester,
but the two 5' and five 3' linkages are phosphorodithioate
modified; and MP-O-ODN are chimeric ODN in which the central
linkages are phosphodiester, but the two 5' and five 3' linkages
are methylphosphonate modified. The ODN sequences studied (with CpG
dinucleotides indicated by underlining) include:
TABLE-US-00015 3D (5'' GAGAACGCTGGACCTTCCAT); (SEQ. ID. NO. 20) 3M
(5' TCCATGTCGGTCCTGATGCT); (SEQ. ID. NO. 28) 5 (5'
GGCGTTATTCCTGACTCGCC); and (SEQ. ID. NO. 99) 6 (5'
CCTACGTTGTATGCGCCCAGCT). (SEQ. ID NO. 100)
These sequences are representative of literally hundreds of CpG and
non-CpG ODN that have been tested in the course of these
studies.
Mice. DBA/2, or BXSB mice obtained from The Jackson Laboratory (Bar
Harbor, Me.), and maintained under specific pathogen-free
conditions were used as a source of lymphocytes at 5-10 wk of age
with essentially identical results.
Cell proliferation assay. For cell proliferation assays, mouse
spleen cells (5.times.10.sup.4 cells/100 .mu.l/well) were cultured
at 37.degree. C. in a 5% CO.sub.2 humidified incubator in RPMI-1640
supplemented with 10% (v/v) heat inactivated fetal calf serum
(heated to 65.degree. C. for experiments with O-ODN, or 56.degree.
C. for experiments using only modified ODN), 1.5 .mu.M L-glutamine,
50 .mu.M 2-mercaptoethanol, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin for 24 hr or 48 hr as indicated. 1 .mu.Ci of .sup.3H
uridine or thymidine (as indicated) was added to each well, and the
cells harvested after an additional 4 hours of culture. Filters
were counted by scintillation counting. Standard deviations of the
triplicate wells were <5%. The results are presented in FIGS.
6-8.
Example 11
Induction of NK Activity
Phosphodiester ODN were purchased form Operon Technologies
(Alameda, Calif.). Phosphorothioate ODN were purchased from the DNA
core facility, University of Iowa, or from The Midland Certified
Reagent Company (Midland Tex.). E. coli (strain B) DNA and calf
thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and
ODN were purified by extraction with phenol:chloroform:isoamyl
alcohol (25:24:1) and/or ethanol precipitation. The LPS level in
ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA
contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
Virus-free, 4-6 week old, DBA/2, C57BL/6 (B6) and congenitally
thymic BALB/C mice were obtained on contract through the Veterans
Affairs from the National Cancer Institute (Bethesda, Md.). C57BL/6
SCID mice were bred in t eh SPF barrier facility at the University
of Iowa Animal Care Unit.
Human peripheral monucluclear blood leukocytes (PBMC) were obtained
as previously described (Ballas, Z. K. et al., (1990) J. Allergy
Clin. Immunol. 85:453; Ballas, Z. K. And W. Rasmussen (1990) J.
Immunol. 145:1039; Ballas, Z. K. and W. Rasmussen (1993) J.
Immunol. 150;17). Human or murine cells were cultured at
5.times.10.sup.6/well, at 37.degree. C. in a 5% CO.sub.2 humidified
atmosphere in 24-well plates (Ballas, Z. K. Et al., (1990) J.
Allergy Clin. Immunol. 85:453; Ballas, Z. K. And W. Rasmussen
(1990) J. Immunol 145:1039; and Ballas, Z. K. and W. Rasmussen
(1193) J. Immunol, 150:17), with medium alone or with CpG or
non-CpG ODN at the indicated concentrations, or with E. coli or
calf thymus (50 .mu.g/ml) at 37.degree. C. for 24 hr. All cultures
were harvested at 18 hr. and the cells were used as effectors in a
standard 4 hr. .sup.51Cr-release assay against K562 (human) or
YAC-1 (mouse) target cells as previously described. For calculation
of lytic units (LU), 1 LU was defined as the number of cells needed
to effect 30% specific lysis. Where indicated, neutralizing
antibodies against IFN-.beta. (Lee Biomolecular, San Diego, Calif.)
or IL-12 (C15.1, C15.6, C17.8, and C17.15; provided by Dr. Giorgio
Trinchieri, The Winstar Institute, Philadelphia, Pa.) or their
isotype controls were added at the initiation of cultures to a
concentration of 10 .mu.g/ml. For anti-IL-12 additional, 10 .mu.g
of each of the 4 MAB (or isotype controls) were added
simultaneously. Recombinant human IL-2 was used at a concentration
of 100 U/ml.
Example 12
Prevention of the Development of an Inflammatory Cellular
Infiltrate and Eosinophilia in a Murine Model of Asthma
6-8 week old C56BL/6 mice (from The Jackson Laboratory, Bar Harbor,
Me.) were immunized with 5,000 Schistosoma mansoni eggs by
intraperitoneal (i.p.) injection on days 0 and 7. Schistosoma
mansoni eggs contain an antigen (Schistosoma mansoni egg antigen
(SEA)) that induces a Th2 immune response (e.g. production of IgE
antibody). IgE antibody production is known to be an important
cause of asthma.
The immunized mice were then treated with oligonucleotides (30
.mu.g in 200 .mu.l saline by i.p. injection), which either
contained an unmethylated CpG motif (i.e., TCCATGACGTTCCTGACGTT;
SEQ ID NO.10) or did not (i.e., control, TCCATGAGCTTCCTGAGTCT; SEQ
ID NO. 8). Soluble SeEA (10 .mu.g in 25 .mu.l of saline) was
administered by intranasal instillation on days 14 and 21. Saline
was used as a control.
Mice were sacrificed at various times after airway challenge. Whole
lung lavage was performed to harvest airway and alveolar
inflammatory cells. Cytokine levels were measured from lavage fluid
by ELISA. RNA was isolated from whole lung for Northern analysis
and RT-PCR studies using CsC1 gradients. Lungs were inflated and
perfused with 4% paraformaldehyde for histologic examination.
FIG. 9 shows that when the mice are initially injected with the
eggs i.p., and then inhale the egg antigen (open circle), many
inflammatory cells are present in the lungs. However, when the mice
are initially given a nucleic acid containing an unmethylated CpG
motif along with the eggs, the inflammatory cells in the lung are
not increased by subsequent inhalation of the egg antigen (open
triangles).
FIG. 10 shows that the same results are obtained only when
eosinophils present in the lung lavage are measured. Eosinophils
are the type of inflammatory cell most closely associated with
asthma.
FIG. 11 shows that when the mice are treated with a control oligo
at the time of the initial exposure to the egg, there is little
effect on the subsequent influx of eosinophils into the lungs after
inhalation of SEA. Thus, when mice inhale the eggs on days 14 or
21, they develop an acute inflammatory response in the lungs.
However, giving a CpG oligo along with the eggs at the time of
initial antigen exposure on days 0 and 7 almost completely
abolishes the increase in eosinophils when the mice inhale the egg
antigen on day 14.
FIG. 12 shows that very low doses of oligonucleotide (<10 .mu.g)
can give this protection.
FIG. 13 shows that the resultant inflammatory response correlates
with the levels of the Th2 cytokine IL-4 in the lung.
FIG. 14 shows that administration of an oligonucleotide containing
an unmethylated CpG motif can actually redirect the cytokine
response of the lung to production of IL-12, indicating the Th1
type of immune response.
FIG. 15 shows that administration of an oligonucleotide containing
an unmethylated CpG motif can also redirect the cytokine response
of the lung to production of IFN-.gamma., indicating a Th1 type of
immune response.
Example 13
CpG Oligonucleotides Induce Human PBMC to Secrete Cytokines.
Human PBMC were prepared from whole blood by standard
centrifugation over Ficoll hypaque. Cells (5.times.10.sup.5/ml)
were cultured in 10% autologous serum in 95 well microtiter plates
with CpG or control oligodeoxynucleotides (24 .mu.g/ml for
phosphodiester oligonucleotides; 6 g/ml for nuclease resistant
phosphorothioate oligonucleotides) for 4 hr in the case of
TNF-.alpha. or 24 hr. For the other cytokines before supernatant
harvest and assay, measured by ELISA using Quantikine kits or
reagents from R&D Systems (pg/ml) or cytokine ELISA kits from
Biosource (for IL-12 assay). Assays were performed as per the
manufacturer's instructions. Data are presented in Table 6 as the
level of cytokine above that in wells with no added
oligodeoxynucleotide.
Those skilled in the art will recognize, or be able to ascertain
using no more than routine experimentation, many equivalents of the
specific embodiments of the invention described herein. Such
equivalents are intended to be encompassed by the following
claims.
SEQUENCE LISTINGS
1
123120DNAArtificial SequenceSynthetic Oligonucleotide 1atggaaggtc
cagcgttctc 20220DNAArtificial SequenceSynthetic Oligonucleotide
2atcgacctac gtgcgttctc 20320DNAArtificial SequenceSynthetic
Oligonucleotide 3tccataacgt tcctgatgct 20415DNAArtificial
SequenceSynthetic Oligonucleotide 4gctagatgtt agcgt
15519DNAArtificial SequenceSynthetic Oligonucleotide 5gagaacgtcg
accttcgat 19615DNAArtificial SequenceSynthetic Oligonucleotide
6gcatgacgtt gagct 15720DNAArtificial SequenceSynthetic
Oligonucleotide 7tccatgacgt tcctgatgct 20820DNAArtificial
SequenceSynthetic Oligonucleotide 8tccatgagct tcctgagtct
20920DNAArtificial SequenceSynthetic Oligonucleotide 9tccaagacgt
tcctgatgct 201020DNAArtificial SequenceSynthetic Oligonucleotide
10tccatgacgt tcctgacgtt 201121DNAArtificial SequenceSynthetic
Oligonucleotide 11tccatgagct tcctgagtgc t 211220DNAArtificial
SequenceSynthetic Oligonucleotide 12ggggtcaacg ttgagggggg
201315DNAArtificial SequenceSynthetic Oligonucleotide 13gctagangtt
agcgt 151415DNAArtificial SequenceSynthetic Oligonucleotide
14gctagacgtt agngt 151520DNAArtificial SequenceSynthetic
Oligonucleotide 15atcgactctc gagcgttctc 201620DNAArtificial
SequenceSynthetic Oligonucleotide 16atngactctn gagngttctc
201720DNAArtificial SequenceSynthetic Oligonucleotide 17atngactctc
gagcgttctc 201820DNAArtificial SequenceSynthetic Oligonucleotide
18atcgactctc gagcgttntc 201920DNAArtificial SequenceSynthetic
Oligonucleotide 19atggaaggtc caacgttctc 202020DNAArtificial
SequenceSynthetic Oligonucleotide 20gagaacgctg gaccttccat
202120DNAArtificial SequenceSynthetic Oligonucleotide 21gagaacgctc
gaccttccat 202220DNAArtificial SequenceSynthetic Oligonucleotide
22gagaacgctc gaccttcgat 202320DNAArtificial SequenceSynthetic
Oligonucleotide 23gagcaagctg gaccttccat 202420DNAArtificial
SequenceSynthetic Oligonucleotide 24gagaangctg gaccttccat
202520DNAArtificial SequenceSynthetic Oligonucleotide 25gagaacgctg
gacnttccat 202620DNAArtificial SequenceSynthetic Oligonucleotide
26gagaacgatg gaccttccat 202720DNAArtificial SequenceSynthetic
Oligonucleotide 27gagaacgctc cagcactgat 202820DNAArtificial
SequenceSynthetic Oligonucleotide 28tccatgtcgg tcctgatgct
202920DNAArtificial SequenceSynthetic Oligonucleotide 29tccatgctgg
tcctgatgct 203020DNAArtificial SequenceSynthetic Oligonucleotide
30tccatgtngg tcctgatgct 203120DNAArtificial SequenceSynthetic
Oligonucleotide 31tccatgtcgg tnctgatgct 203220DNAArtificial
SequenceSynthetic Oligonucleotide 32tccatgtcgg tcctgctgat
203320DNAArtificial SequenceSynthetic Oligonucleotide 33tccatgccgg
tcctgatgct 203420DNAArtificial SequenceSynthetic Oligonucleotide
34tccatggcgg tcctgatgct 203520DNAArtificial SequenceSynthetic
Oligonucleotide 35tccatgacgg tcctgatgct 203620DNAArtificial
SequenceSynthetic Oligonucleotide 36tccatgtcga tcctgatgct
203720DNAArtificial SequenceSynthetic Oligonucleotide 37tccatgtcgc
tcctgatgct 203820DNAArtificial SequenceSynthetic Oligonucleotide
38tccatgtcgt tcctgatgct 203920DNAArtificial SequenceSynthetic
Oligonucleotide 39tccatgacgt ccctgatgct 204020DNAArtificial
SequenceSynthetic Oligonucleotide 40tccatcacgt gcctgatgct
204119DNAArtificial SequenceSynthetic Oligonucleotide 41ggggtcagtc
ttgacgggg 194215DNAArtificial SequenceSynthetic Oligonucleotide
42gctagacgtt agtgt 154315DNAArtificial SequenceSynthetic
Oligonucleotide 43gctagacntt agtgt 154420DNAArtificial
SequenceSynthetic Oligonucleotide 44tccatgtngt tcctgatgct
204518DNAArtificial SequenceSynthetic Oligonucleotide 45tctcccagcg
tgcgccat 184624DNAArtificial SequenceSynthetic Oligonucleotide
46tcgtcgtttt gtcgttttgt cgtt 244720DNAArtificial SequenceSynthetic
Oligonucleotide 47tcgtcgttgt cgttgtcgtt 204821DNAArtificial
SequenceSynthetic Oligonucleotide 48tgtcgtttgt cgtttgtcgt t
214922DNAArtificial SequenceSynthetic Oligonucleotide 49tcgtcgttgt
cgttttgtcg tt 225019DNAArtificial SequenceSynthetic Oligonucleotide
50tgtcgttgtc gttgtcgtt 195114DNAArtificial SequenceSynthetic
Oligonucleotide 51tcgtcgtcgt cgtt 145220DNAArtificial
SequenceSynthetic Oligonucleotide 52tcctgtcgtt ccttgtcgtt
205320DNAArtificial SequenceSynthetic Oligonucleotide 53tcctgtcgtt
ttttgtcgtt 205421DNAArtificial SequenceSynthetic Oligonucleotide
54tcgtcgctgt ctgcccttct t 215521DNAArtificial SequenceSynthetic
Oligonucleotide 55tcgtcgctgt tgtcgtttct t 215621DNAArtificial
SequenceSynthetic Oligonucleotide 56gcgtgcgttg tcgttgtcgt t
21576DNAArtificial SequenceSynthetic Oligonucleotide 57gtcgtt
6586DNAArtificial SequenceSynthetic Oligonucleotide 58gtcgct
65924DNAArtificial SequenceSynthetic Oligonucleotide 59accatggacg
atctgtttcc cctc 246018DNAArtificial SequenceSynthetic
Oligonucleotide 60taccgcgtgc gaccctct 186124DNAArtificial
SequenceSynthetic Oligonucleotide 61accatggacg aactgtttcc cctc
246224DNAArtificial SequenceSynthetic Oligonucleotide 62accatggacg
agctgtttcc cctc 246324DNAArtificial SequenceSynthetic
Oligonucleotide 63accatggacg acctgtttcc cctc 246424DNAArtificial
SequenceSynthetic Oligonucleotide 64accatggacg tactgtttcc cctc
246524DNAArtificial SequenceSynthetic Oligonucleotide 65accatggacg
gtctgtttcc cctc 246624DNAArtificial SequenceSynthetic
Oligonucleotide 66accatggacg ttctgtttcc cctc 246715DNAArtificial
SequenceSynthetic Oligonucleotide 67cacgttgagg ggcat
156815DNAArtificial SequenceSynthetic Oligonucleotide 68ctgctgagac
tggag 156912DNAArtificial SequenceSynthetic Oligonucleotide
69tcagcgtgcg cc 127017DNAArtificial SequenceSynthetic
Oligonucleotide 70atgacgttcc tgacgtt 177117DNAArtificial
SequenceSynthetic Oligonucleotide 71tctcccagcg ggcgcat
177218DNAArtificial SequenceSynthetic Oligonucleotide 72tctcccagcg
cgcgccat 187320DNAArtificial SequenceSynthetic Oligonucleotide
73tccatgtcgt tcctgtcgtt 207420DNAArtificial SequenceSynthetic
Oligonucleotide 74tccatagcgt tcctagcgtt 207521DNAArtificial
SequenceSynthetic Oligonucleotide 75tcgtcgctgt ctccgcttct t
217619DNAArtificial SequenceSynthetic Oligonucleotide 76tcctgacgtt
cctgacgtt 197719DNAArtificial SequenceSynthetic Oligonucleotide
77tcctgtcgtt cctgtcgtt 197820DNAArtificial SequenceSynthetic
Oligonucleotide 78tccatgtcgt ttttgtcgtt 207920DNAArtificial
SequenceSynthetic Oligonucleotide 79tccaggactt ctctcaggtt
208020DNAArtificial SequenceSynthetic Oligonucleotide 80tccatgcgtg
cgtgcgtttt 208120DNAArtificial SequenceSynthetic Oligonucleotide
81tccatgcgtt gcgttgcgtt 208220DNAArtificial SequenceSynthetic
Oligonucleotide 82tccacgacgt tttcgacgtt 208320DNAArtificial
SequenceSynthetic Oligonucleotide 83gcggcgggcg gcgcgcgccc
208425DNAArtificial SequenceSynthetic Oligonucleotide 84tgtcgttgtc
gttgtcgttg tcgtt 258513DNAArtificial SequenceSynthetic
Oligonucleotide 85tgtcgttgtc gtt 138620DNAArtificial
SequenceSynthetic Oligonucleotide 86tccacgacgt tttcgacgtt
208720DNAArtificial SequenceSynthetic Oligonucleotide 87tccatgacga
tcctgatgct 208820DNAArtificial SequenceSynthetic Oligonucleotide
88tccatgacgc tcctgatgct 208915DNAArtificial SequenceSynthetic
Oligonucleotide 89gctagacgtt agcgt 15908DNAArtificial
SequenceSynthetic Oligonucleotide 90tcaacgtt 8918DNAArtificial
SequenceSynthetic Oligonucleotide 91tcaagctt 8928DNAArtificial
SequenceSynthetic Oligonucleotide 92tcagcgct 8938DNAArtificial
SequenceSynthetic Oligonucleotide 93tcatcgat 8948DNAArtificial
SequenceSynthetic Oligonucleotide 94tcttcgaa 8958DNAArtificial
SequenceSynthetic Oligonucleotide 95ccaacgtt 8968DNAArtificial
SequenceSynthetic Oligonucleotide 96tcaacgtc 89720DNAArtificial
SequenceSynthetic Oligonucleotide 97tccaggactt tcctcaggtt
209820DNAArtificial SequenceSynthetic Oligonucleotide 98ttcaggactt
tcctcaggtt 209920DNAArtificial SequenceSynthetic Oligonucleotide
99ggcgttattc ctgactcgcc 2010022DNAArtificial SequenceSynthetic
Oligonucleotide 100cctacgttgt atgcgcccag ct 221017DNAArtificial
SequenceSynthetic Oligonucleotide 101tgtcgct 71027DNAArtificial
SequenceSynthetic Oligonucleotide 102tgtcgtt 71037DNAArtificial
SequenceSynthetic Oligonucleotide 103tgacgtc 71048DNAArtificial
SequenceSynthetic Oligonucleotide 104tgacgtca 81056DNAArtificial
SequenceSynthetic Oligonucleotide 105aacgtt 61067DNAArtificial
SequenceSynthetic Oligonucleotide 106caacgtt 71078DNAArtificial
SequenceSynthetic Oligonucleotide 107aacgttct 81087DNAArtificial
SequenceSynthetic Oligonucleotide 108tgacgtt 71096DNAArtificial
SequenceSynthetic Oligonucleotide 109gccggt 61106DNAArtificial
SequenceSynthetic Oligonucleotide 110gacggt 61116DNAArtificial
SequenceSynthetic Oligonucleotide 111gacgtc 61126DNAArtificial
SequenceSynthetic Oligonucleotide 112cacgtg 61137DNAArtificial
SequenceSynthetic Oligonucleotide 113cgacgtt 711420DNAArtificial
SequenceSynthetic Oligonucleotide 114atggaaggtc cagtgttctc
2011520DNAArtificial SequenceSynthetic Oligonucleotide
115atggactctc cagcgttctc 2011620DNAArtificial SequenceSynthetic
Oligonucleotide 116atcgactctc gagngttctc 2011715DNAArtificial
SequenceSynthetic Oligonucleotide 117gctagangtt agtgt
1511818DNAArtificial SequenceSynthetic Oligonucleotide
118catttccacg atttccca 1811921DNAArtificial SequenceSynthetic
Oligonucleotide 119tcgtcgctgt ctgcccttct t 2112021DNAArtificial
SequenceSynthetic Oligonucleotide 120tcgtcgctgt tgtcgtttct t
2112120DNAArtificial SequenceSynthetic Oligonucleotide
121tccttgtcgt tcctgtcgtt 2012220DNAArtificial SequenceSynthetic
Oligonucleotide 122tccatgtngt tcctgtngtt 2012323DNAArtificial
SequenceSynthetic Oligonucleotide 123tcgtcgtttt gtcgttttgt cgt
23
* * * * *
References