U.S. patent application number 10/847642 was filed with the patent office on 2005-01-06 for immunostimulatory nucleic acid molecules.
This patent application is currently assigned to The University of Iowa Research Foundation. Invention is credited to Kline, Joel, Klinman, Dennis, Krieg, Arthur M., Steinberg, Alfred D..
Application Number | 20050004061 10/847642 |
Document ID | / |
Family ID | 24968901 |
Filed Date | 2005-01-06 |
United States Patent
Application |
20050004061 |
Kind Code |
A1 |
Krieg, Arthur M. ; et
al. |
January 6, 2005 |
Immunostimulatory nucleic acid molecules
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and
therapeutic utilities based on their ability to stimulate an immune
response and to redirect a Th2 response to a Th1 response in a
subject are disclosed. Methods for treating atopic diseases,
including atopic dermatitis, are disclosed.
Inventors: |
Krieg, Arthur M.;
(Wellesley, MA) ; Kline, Joel; (Iowa City, IA)
; Klinman, Dennis; (Potomac, MD) ; Steinberg,
Alfred D.; (Potomac, MD) |
Correspondence
Address: |
Helen C. Lockhart
Wolf, Greenfield & Sacks, P.C.
600 Atlantic Avenue
Boston
MA
02210
US
|
Assignee: |
The University of Iowa Research
Foundation
Iowa City
IA
Coley Pharmaceutical Group, Inc.
Wellesley
MA
United States of America, as represented by the Secretary,
Department of Health & Human Services
Bethesda
MD
|
Family ID: |
24968901 |
Appl. No.: |
10/847642 |
Filed: |
May 17, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10847642 |
May 17, 2004 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
6207646 |
|
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
6194388 |
|
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
08276358 |
Jul 15, 1994 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61P 1/16 20180101; A61P
31/10 20180101; Y02A 50/466 20180101; A61K 39/00 20130101; C12N
2310/17 20130101; A61P 43/00 20180101; A61P 35/00 20180101; C12N
2310/315 20130101; A61P 33/00 20180101; A61K 2039/55561 20130101;
A61P 37/08 20180101; A61P 37/06 20180101; C07H 21/00 20130101; Y02A
50/412 20180101; A61K 31/7125 20130101; A61K 31/4706 20130101; Y02A
50/54 20180101; A61P 11/06 20180101; C12N 15/117 20130101; A61P
17/00 20180101; A61P 37/02 20180101; A61P 1/04 20180101; A61P 7/00
20180101; A61K 39/39 20130101; A61P 17/06 20180101; A61K 31/00
20130101; A61P 31/00 20180101; A61P 19/02 20180101; A61P 1/00
20180101; C12Q 1/68 20130101; Y02A 50/464 20180101; A61P 31/04
20180101; A61P 31/12 20180101; A61P 1/02 20180101; A61K 31/7048
20130101; A61K 31/711 20130101; A61P 37/04 20180101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Goverment Interests
[0002] The work resulting in this invention was supported in part
by National Institute of Health Grant No. R29-AR42556-01. The U.S.
Government may therefore be entitled to certain rights in the
invention.
Claims
1-18. (Canceled)
19. A method for preventing or suppressing antigen-stimulated,
eosinophilic inflammation in an antigen-exposed subject comprising
administering to the subject an isolated immunostimulatory
oligonucleotide comprising X1X2CGX3X4, wherein C and G are
unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the
immunostimulatory oligonucleotide is between 6 and 100 bases in
length, in an amount to suppress a Th2 immune response, whereby
eosinophilic inflammation is prevented or suppressed.
20. The method of claim 19, wherein the immunostimulatory
oligonucleotide includes a nucleotide sequence consisting of
5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.
21. The method of claim 20, wherein the nucleotide sequence
consists of AACGTT.
22. The method of claim 19, wherein the immunostimulatory
oligonucleotide comprises a nucleotide sequence selected from the
group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT,
GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
23. The method of claim 19, wherein the subject has asthma,
allergic rhinitis, eczema, hay fever or urticaria.
24. The method of claim 19, wherein the eosinophilic inflammation
occurs in a tissue affected by asthma, allergic rhinitis, eczema,
hay fever or urticaria.
25. The method of claim 19, wherein the eosinophilic inflammation
is in the lung.
26. The method of claim 25, wherein the subject has asthma.
27. The method of claim 19, wherein the immunostimulatory
oligonucleotide is 8-100 bases in length.
28. The method of claim 19, wherein the immunostimulatory
oligonucleotide is 8-40 bases in length.
29. A method for boosting an immune response of a subject
comprising administering to the subject an isolated
immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C
and G are unmethylated and X1, X2, X3 and X4 are nucleotides and
wherein the immunostimulatory oligonucleotide is between 6 and 100
bases in length, and wherein an increase in activation of the
subject's lymphocytes or NK cells indicates that the subject's
immune response has been boosted.
30. The method of claim 29, wherein the activation of the subject's
lymphocytes or NK cells is lymphocyte proliferation.
31. The method of claim 29, wherein the activation of the subject's
lymphocytes or NK cells is IgM secretion.
32. The method of claim 29, wherein the activation of the subject's
lymphocytes or NK cells is increased expression of IL-12 and
IFN-gamma.
33. The method of claim 29, wherein the subject has an immune
system deficiency.
34. The method of claim 33, wherein the immune system deficiency is
an infection.
35. The method of claim 34, wherein the infection is a bacterial,
viral, fungal or parasitic infection.
36. The method of claim 33, wherein the immune system deficiency is
a bacterial infection by bacteria having bacterial antigens and
wherein the increase in lymphocyte or NK activation is activated B
cell with antigen receptors specific for the bacterial
antigens.
37. The method of claim 33, wherein the immune system deficiency is
cancer.
38. The method of claim 30, wherein the immunostimulatory
oligonucleotide is 8-100 bases in length.
39. The method of claim 30, wherein the immunostimulatory
oligonucleotide is 8-40 bases in length.
40. The method of claim 29, wherein the immunostimulatory
oligonucleotide is administered in conjunction with a vaccine.
41. The method of claim 29, wherein the immunostimulatory
oligonucleotide is not administered in conjunction with a
vaccine.
42. The method of claim 29, wherein the immunostimulatory
oligonucleotide includes a nucleotide sequence consisting of
5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.
43. The method of claim 42, wherein the nucleotide sequence
consists of AACGTT.
44. The method of claim 29, wherein the immunostimulatory
oligonucleotide comprises a nucleotide sequence selected from the
group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT,
GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
45. The method of claim 29, wherein the subject has asthma,
allergic rhinitis, eczema, hay fever or urticaria.
46. The method of claim 29, wherein the immune response occurs in a
tissue affected by eczema, allergic rhinitis, hay fever or
urticaria.
47. The method of claim 29, wherein the immune response occurs in
the lung.
48. The method of claim 45, wherein the subject has asthma and the
subject develops a Th1 immune response to an allergen.
49. The method of claim 29, wherein the subject has a viral or a
parasitic infection and the immune response to the infection is
boosted.
50. The method of claim 49, wherein the infection is a viral
infection.
51. A method for shifting the immune response of a subject to an
antigen toward a Th1 immune response comprising administering to
the subject an isolated immunostimulatory oligonucleotide
comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2,
X3 and X4 are nucleotides and wherein the immunostimulatory
oligonucleotide is between 6 and 100 bases in length, wherein
detection of a Th1 type immune response by the subject indicates
that the shift to the Th1 immune response has been achieved.
52. The method of claim 51, wherein the shift to the Th1 immune
response is further associated with suppression of a Th2 immune
response.
53. The method of claim 51, wherein the immunostimulatory
oligonucleotide includes a nucleotide sequence consisting of
5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.
54. The method of claim 53, wherein the nucleotide sequence
consists of AACGTT.
55. The method of claim 51, wherein the immunostimulatory
oligonucleotide comprises a nucleotide sequence selected from the
group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT,
GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
56. The method of claim 51, wherein the subject has asthma,
allergic rhinitis, eczema, hay fever or urticaria, and the shift to
the Th1 immune response prevents or suppresses eosinophilic
inflammation in the subject.
57. The method of claim 56, wherein the eosinophilic inflammation
is in a tissue affected by asthma, allergic rhinitis, eczema, hay
fever or urticaria
58. The method of claim 56, wherein the eosinophilic inflammation
is in the lung.
59. The method of claim 51, wherein the subject has asthma and the
shift to the Th1 immune response prevents or suppresses eosinophil
infiltration into the lung of the subject.
60. The method of claim 51, wherein the subject has a viral or
parasitic infection and the shift to the Th1 immune response boosts
the immune response to the infection.
61. The method of claim 60, wherein the infection is a viral
infection.
62. The method of claim 19, wherein the desired result is measured
by detecting in a sample containing lymphocyte obtained from the
immunostimulatory oligonucleotide treated subject: (1) a lower
level of IL-4 in the immunostimulatory oligonucleotide treated
subject as compared to an antigen-challenged control; or (2) a
higher level of IL-12-and/or IFN gamma in the immunostimulatory
oligonucleotide treated subject as compared to an
antigen-challenged control.
63. The method of claim 19, wherein prevention or suppression of
eosinophilic inflammation is measured by detecting lower levels of
eosinophils in an inflammatory infiltrate in the lung in an
immunostimulatory oligonucleotide treated subject as compared to an
antigen-challenged control.
64. The method of claim 51, wherein the immunostimulatory
oligonucleotide is 8-100 bases in length.
65. The method of claim 51, wherein the immunostimulatory
oligonucleotide is 8-40 bases in length.
66. The method of claim 51, wherein the immunostimulatory
oligonucleotide is administered in conjunction with a vaccine.
67. The method of claim 51, wherein the immunostimulatory
oligonucleotide is not administered in conjunction with a
vaccine.
68. A method for preventing or reducing antigen-stimulated,
granulocyte-mediated inflammation in a tissue of an
antigen-sensitized subject comprising administering an isolated
immunostimulatory oligonucleotide to the subject, wherein a
reduction in, or the absence of, a Th2 type immune response
measured in the subject, or a reduction in, or the absence of,
other clinical signs of inflammation in the subject after antigen
challenge, indicates that the desired prevention or reduction in
granulocyte-mediated inflammation has been achieved.
69. The method of claim 68, wherein the immunostimulatory
oligonucleotide includes a hexameric nucleotide sequence consisting
of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.
70. The method of claim 69, wherein the hexameric nucleotide
sequence consists of AACGTT.
71. The method of claim 68, wherein the immunostimulatory
oligonucleotide comprises a hexameric nucleotide sequence selected
from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT,
GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and
AACGGT.
72. The method of claim 68, wherein the subject is suffering from
an condition induced by the sensitizing antigen selected from the
group of inflammatory conditions consisting of asthma, allergic
rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous
basophil hypersensitivity.
73. The method of claim 68, wherein the inflammation is in skin or
mucosa.
74. The method of claim 73, wherein the inflammation is in a
respiratory tissue.
75. The method of claim 68, wherein the subject is suffering from
asthma.
76. The method of claim 68, wherein the desired result is measured
by detecting in a sample containing lymphocytes obtained from the
immunostimulatory oligonucleotide treated subject: (1) a lower
level of IL-4 in the immunostimulatory oligonucleotide treated
subject as compared to an antigen-challenged control; or (2) a
higher level of IL-12 and/or IFN gamma in the immunostimulatory
oligonucleotide treated subject as compared to an
antigen-challenged control.
77. A method for boosting the immune responsiveness of a subject to
a sensitizing antigen without immunization of the subject by the
sensitizing antigen comprising administering an isolated
immunostimulatory oligonucleotide to the subject, wherein an
increase in the magnitude of the subject's immune response to the
sensitizing antigen indicates that the desired boost to the
subject's immune responsiveness has been achieved.
78. The method of claim 77, wherein the immunostimulatory
oligonucleotide includes a hexameric nucleotide sequence consisting
of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.
79. The method of claim 78, wherein the hexameric nucleotide
sequence consists of AACGTT.
80. The method of claim 77, wherein the immunostimulatory
oligonucleotide includes a hexameric nucleotide sequence is
selected from the group of sequences consisting of GTCGTT, GTCGCT,
GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT,
AACGCT and AACGGT.
81. The method of claim 77, wherein the subject is suffering from
an inflammatory condition induced by the sensitizing antigen
selected from the group of inflammatory conditions consisting of
asthma, allergic rhinitis, atopic dermatitis, allergic
conjunctivitis and cutaneous basophil hypersensitivity.
82. The method of claim 81, wherein the immune response is in skin
or mucosa.
83. The method of claim 82, wherein the immune response is in
respiratory tissue.
84. The method of claim 83, wherein the subject is suffering from
asthma and the subject's immune responsiveness to a respiratory
allergen is boosted.
85. The method of claim 77, wherein the antigen is presented by a
pathogen and the subject's immune responsiveness to an
intracellular infection by the pathogen is boosted.
86. The method of claim 85, wherein the pathogen is a virus.
87. A method for shifting the immune response of a subject to a
sensitizing antigen toward a Th1 phenotype comprising administering
an isolated immunostimulatory oligonucleotide to the subject,
wherein detection of a Th1 type immune response by the subject
indicates that the desired shift to the Th1 phenotype has been
achieved.
88. The method of claim 87, wherein the immunostimulatory
oligonucleotide includes a hexameric nucleotide sequence consisting
of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.
89. The method of claim 88, wherein the hexameric nucleotide
sequence consists of AACGTT.
90. The method of claim 87, wherein the immunostimulatory
oligonucleotide includes a hexameric nucleotide sequence is
selected from the group consisting of GTCGTT, GTCGCT, GTCGGT,
GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and
AACGGT.
91. The method of claim 87, wherein the subject is suffering from
an inflammatory condition induced by the sensitizing antigen
selected from the group of inflammatory conditions consisting of
asthma, allergic rhinitis, atopic dermatitis, allergic
conjunctivitis and cutaneous basophil hypersensitivity, and the
shift to the Th1 phenotype reduces granulocyte-mediated
inflammation in the affected tissue.
92. The method of claim 91, wherein the affected tissue is skin or
mucosa.
93. The method of claim 92, wherein the affected tissue is
respiratory tissue.
94. The method of claim 93, wherein the subject is suffering from
asthma and the shift to the Th1 phenotype reduces eosinophil
infiltration of the lung.
95. The method of claim 87, wherein the subject is suffering from
an intracellular infection by a pathogen and the shift to the Th1
phenotype strengthens the subject's immune response to the
pathogen.
96. The method of claim 91, wherein the pathogen is a virus.
97. The method of claim 87, wherein the desired result is measured
by detecting in a sample containing lymphocytes obtained from the
immunostimulatory oligonucleotide treated subject: (1) a lower
level of IL-4 in the immunostimulatory oligonucleotide treated
subject as compared to an antigen-challenged control; or (2) a
higher level of IL-12 and/or IFN gamma in the immunostimulatory
oligonucleotide treated subject as compared to an
antigen-challenged control.
98. The method of claim 68, wherein reduction or suppression of
inflammation is measured by assaying inflammatory infiltrate from
the subject for a reduction in granulocyte counts in inflammatory
infiltrate of an affected subject tissue as measured in an antigen
challenged subject before and after ISS-ODN administration or
detection of lower levels of granulocyte counts in an ISS-ODN
treated subject as compared to an antigen-challenged control
99. The method of claim 48, wherein the allergen is pollen, animal
dander or dust.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of co-pending U.S. patent
application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a
continuation-in-part of U.S. patent application Ser. No.
08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No.
6,194,388, which is a continuation-in-part of U.S. patent
application Ser. No. 08/276,358, filed Jul. 15, 1994, now
abandoned.
BACKGROUND OF THE INVENTION
[0003] DNA Binds To Cell Membranes And Is Internalized
[0004] In the 1970's, several investigators reported the binding of
high molecular weight DNA to cell membranes (Lerner, R. A., W.
Meinke, and D. A. Goldstein. 1971. "Membrane-associated DNA in the
cytoplasm of diploid human lymphocytes". Proc. Natl. Acad. Sci. USA
68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B.
Rosenberg. 1975. "Cell-surface-associated nucleic acid in
tumorigenic cells made visible with platinum-pyrimidine complexes
by electron microscopy". Proc. Natl. Acad. Sci. USA 72:928). In
1985, Bennett et al. presented the first evidence that DNA binding
to lymphocytes is similar to a ligand receptor interaction: binding
is saturable, competitive, and leads to DNA endocytosis and
degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and
M. M. Merritt. 1985. "DNA binding to human leukocytes. Evidence for
a receptor-mediated association, internalization, and degradation
of DNA". J. Clin. Invest. 76:2182). Like DNA,
oligodeoxyribonucleotides (ODNs) are able to enter cells in a
saturable, sequence independent, and temperature and energy
dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen.
1991. "Cellular uptake of antisense oligodeoxynucleotides".
Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R.
L. Juliano. 1992. "Pharmaceutical aspects of the biological
stability and membrane transport characteristics of antisense
oligonucleotides". In: Gene Regulation: Biology of Antisense RNA
and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd.
New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J.
Herrera, and A. M. Krieg., 1994. "Stage specific oligonucleotide
uptake in murine bone marrow B cell precursors". Blood, 84:3660).
No receptor for DNA or ODN uptake has yet been cloned, and it is
not yet clear whether ODN binding and cell uptake occurs through
the same or a different mechanism from that of high molecular
weight DNA.
[0005] Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen LPS had
dramatically enhanced ODN uptake in the B cell population, while
spleen cells treated with the T cell mitogen Con A showed enhanced
ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling,
M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg.
1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is
heterogeneous and inducible". Antisense Research and Development
1:161).
[0006] Immune Effects Of Nucleic Acids
[0007] Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly
(I,C) which is a potent inducer of IFN production as well as a
macrophage activator and inducer of NK activity (Talmadge, J. E.,
J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E.
Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985.
"Immunomodulatory effects in mice of polyinosinic-polycytidylic
acid complexed with poly-L-lysine and carboxymethylcellulose".
Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley,
and J. E. Talmadge. 1985. "Immunomodulation of natural killer
activity by polyribonucleotides". J. Biol. Resp. Mod. 4:512; Krown,
S. E. 1986. "Interferons and interferon inducers in cancer
treatment". Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C.
Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J.
Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt,
and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid
complexed with poly-L-lysine and carboxymethylcellulose in
combination with interleukin-2 in patients with cancer: clinical
and immunological effects". Canc. Res. 52:3005). It appears that
this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN
induction and associated changes in splenic leukocyte
distribution". J. Immunol. 150:3713). This activation was specific
for the ribose sugar since deoxyribose was ineffective. Its potent
in vitro antitumor activity led to several clinical trials using
poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose
(to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985.
cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S.
E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited
supra). Unfortunately, toxic side effects have thus far prevented
poly (I,C) from becoming a useful therapeutic agent.
[0008] Guanine ribonucleotides substituted at the C8 position with
either a bromine or a thiol group are B cell mitogens and may
replace "B cell differentiation factors" (Feldbush, T. L., and Z.
K. Ballas. 1985. "Lymphokine-like activity of 8-mercaptoguanosine:
induction of T and B cell differentiation". J. Immunol. 134:3204;
and Goodman, M. G. 1986. "Mechanism of synergy between T cell
signals and C8-substituted guanine nucleosides in humoral immunity:
B lymphotropic cytokines induce responsiveness to
8-mercaptoguanosine". J. Immunol. 136:3335). 8-mercaptoguanosine
and 8-bromoguanosine also can substitute for the cytokine
requirement for the generation of MHC restricted CTL (Feldbush, T.
L., 1985. cited supra), augment murine NK activity (Koo, G. C., M.
E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988.
"Activation of murine natural killer cells and macrophages by
8-bromoguanosine". J. Immunol. 140:3249), and synergize with IL-2
in inducing murine LAK generation (Thompson, R. A., and Z. K.
Ballas. 1990. "Lymphokine-activated killer (LAK) cells. V.
8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation". J.
Immunol. 145:3524). The NK and LAK augmenting activities of these
C8-substituted guanosines appear to be due to their induction of
IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5'
triphosphorylated thymidine produced by a mycobacterium was found
to be mitogenic for a subset of human .gamma..delta. T cells
(Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M.
Bonneville, and J. -J. Foumie. 1994. "Stimulation of human
.gamma..delta. T cells by nonpeptidic mycobacterial ligands"
Science 264:267). This report indicated the possibility that the
immune system may have evolved ways to preferentially respond to
microbial nucleic acids.
[0009] Several observations suggest that certain DNA structures may
also have the potential to activate lymphocytes. For example, Bell
et al. reported that nucleosomal protein-DNA complexes (but not
naked DNA) in spleen cell supernatants caused B cell proliferation
and immunoglobulin secretion (Bell, D. A., B. Morrison, and P.
VandenBygaart. 1990. "Immunogenic DNA-related factors". J. Clin.
Invest. 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina et al. have recently
reported that 260 to 800 bp fragments of poly
(dG).circle-solid.(dC) and poly (dG.circle-solid. dC) were
mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S.
Pisetsky. 1993. "The influence of DNA structure on the in vitro
stimulation of murine lymphocytes by natural and synthetic
polynucleotide antigens". Cell. Immunol.147:148). Tokunaga, et al.
have reported that dG.circle-solid.dC induces IFN-.gamma. and NK
activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. "A synthetic
single-stranded DNA, poly(dG,dC), induces interferon-.alpha./.beta.
and -.gamma., augments natural killer activity, and suppresses
tumor growth" Jpn. J. Cancer Res. 79:682). Aside from such
artificial homopolymer sequences, Pisetsky et al. reported that
pure mammalian DNA has no detectable immune effects, but that DNA
from certain bacteria induces B cell activation and immunoglobulin
secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky.
1991. "Stimulation of in vitro murine lymphocyte proliferation by
bacterial DNA". J. Immunol. 147:1759). Assuming that these data did
not result from some unusual contaminant, these studies suggested
that a particular structure or other characteristic of bacterial
DNA renders it capable of triggering B cell activation.
Investigations of mycobacterial DNA sequences have demonstrated
that ODN which contain certain palindrome sequences can activate NK
cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano,
and T. Tokunaga. 1992. "Unique palindromic sequences in synthetic
oligonucleotides are required to induce INF and augment
INF-mediated natural killer activity". J. Immunol. 148:4072;
Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto,
T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. "Oligonucleotide
sequences required for natural killer cell activation". Jpn. J.
Cancer Res. 83:1128).
[0010] Several phosphorothioate modified ODN have been reported to
induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C.
Chu, and W. E. Paul. 1992. "An antisense oligonucleotide
complementary to a sequence in I.gamma.2b increases .gamma.2b
germline transcripts, stimulates B cell DNA synthesis, and inhibits
immunoglobulin secretion". J. Exp. Med. 175:597; Branda, R. F., A.
L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. "Immune
stimulation by an antisense oligomer complementary to the rev gene
of HIV-1". Biochem. Pharmacol. 45:2037; McIntyre, K. W., K.
Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D.
Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense
phosphorothioate oligonucleotide directed to the initiation codon
of transcription factor NF.kappa.B T65 causes sequence-specific
immune stimulation". Antisense Res. Develop. 3:309; and Pisetsky,
D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte
proliferation by a phosphorothioate oligonucleotide with antisense
activity for herpes simplex virus". Life Sciences 54:101). These
reports do not suggest a common structural motif or sequence
element in these ODN that might explain their effects.
[0011] The CREB/ATF Family Of Transcription Factors And Their Role
In Replication
[0012] The cAMP response element binding protein (CREB) and
activating transcription factor (ATF) or CREB/ATF family of
transcription factors is a ubiquitously expressed class of
transcription factors of which 11 members have so far been cloned
(reviewed in de Groot, R. P., and P. Sassone-Corsi: "Hormonal
control of gene expression: Multiplicity and versatility of cyclic
adenosine 3',5'-monophosphate-responsive nuclear regulators". Mol.
Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson:
"Transcriptional regulation by CREB and its relatives". Biochim.
Biophys. Acta 1174:221, 1993.). They all belong to the basic
region/leucine zipper (bZip) class of proteins. All cells appear to
express one or more CREB/ATF proteins, but the members expressed
and the regulation of mRNA splicing appear to be tissue-specific.
Differential splicing of activation domains can determine whether a
particular CREB/ATF protein will be a transcriptional inhibitor or
activator. Many CREB/ATF proteins activate viral transcription, but
some splicing variants which lack the activation domain are
inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero-
dimers through the cAMP response element, the CRE, the consensus
form of which is the unmethylated sequence TGACGTC (binding is
abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W.
Schaffner: "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation". Genes &
Develop. 3:612, 1989.).
[0013] The transcriptional activity of the CRE is increased during
B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein:
"Induction of CREB activity via the surface Ig receptor of B
cells". J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to
regulate the expression of multiple genes through the CRE including
immunologically important genes such as fos, jun B, Rb-1, IL-6,
IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E.
Auron: "Transcription factors NF-IL6 and CREB recognize a common
essential site in the human prointerleukin 1.beta. gene". Mol.
Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel,
M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA
inhibition of tumor growth induced by c-Ha-ras oncogene in nude
mice". Cancer Res. 53:577, 1993), IFN-.beta. (Du, W., and T.
Maniatis: "An ATF/CREB binding site protein is required for virus
induction of the human interferon B gene". Proc. Natl. Acad. Sci.
USA 89:2150, 1992), TGF-.beta.1 (Asiedu, C. K., L. Scott, R. K.
Assoian, M. Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to
contiguous sites downstream of the human TGF-B1 gene". Biochim.
Biophys. Acta 1219:55, 1994.), TGF-.beta.2, class II MHC (Cox, P.
M., and C. R. Goding: "An ATF/CREB binding motif is required for
aberrant constitutive expression of the MHC class II DRa promoter
and activation by SV40 T-antigen". Nucl. Acids Res. 20:4881,
1992.), E-selectin, GM-CSF, CD-8.alpha., the germline Iga constant
region gene, the TCR V.beta. gene, and the proliferating cell
nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S.
H. Hinrichs, and M. B. Prystowsky: "Promoter activity of the
proliferating-cell nuclear antigen gene is associated with
inducible CRE-binding proteins in interleukin 2-stimulated T
lymphocytes". Mol. Cell. Biol. 14:4233, 1994.). In addition to
activation through the cAMP pathway, CREB can also mediate
transcriptional responses to changes in intracellular Ca.sup.++
concentration (Sheng, M., G. McFadden, and M. E. Greenberg:
"Membrane depolarization and calcium induce c-fos transcription via
phosphorylation of transcription factor CREB". Neuron 4:571,
1990).
[0014] The role of protein-protein interactions in transcriptional
activation by CREB/ATF proteins appears to be extremely important.
There are several published studies reporting direct or indirect
interactions between NFKB proteins and CREB/ATF proteins (Whitley,
et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al.,
(1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189;
and Du, et al., (1993) Cell 74:887. Activation of CREB through the
cyclic AMP pathway requires protein kinase A (PKA), which
phosphorylates CREB.sup.341 on ser.sup.133 and allows it to bind to
a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J.
C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G.
E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear protein CBP is
a coactivator for the transcription factor CREB". Nature 370:223,
1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea,
M. Karin, J. Feramisco, and M. Montminy: "Activation of cAMP and
mitogen responsive genes relies on a common nuclear factor". Nature
370:226, 1994.). CBP in turn interacts with the basal transcription
factor TFIIB causing increased transcription. CREB also has been
reported to interact with dTAFII 110, a TATA binding
protein-associated factor whose binding may regulate transcription
(Ferreri, K., G. Gill, and M. Montminy: "The cAMP-regulated
transcription factor CREB interacts with a component of the TFIID
complex". Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition
to these interactions, CREB/ATF proteins can specifically bind
multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader,
and C. -Y. Chen: "Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions". Mol. Endocrinol. 5:256, 1991) but
the biologic significance of most of these interactions is unknown.
CREB is normally thought to bind DNA either as a homodimer or as a
heterodimer with several other proteins. Surprisingly, CREB
monomers constitutively activate transcription (Krajewski, W., and
K. A. W. Lee: "A monomeric derivative of the cellular transcription
factor CREB functions as a constitutive activator". Mol. Cell.
Biol. 14:7204, 1994.).
[0015] Aside from their critical role in regulating cellular
transcription, it has recently been shown that CREB/ATF proteins
are subverted by some infectious viruses and retroviruses, which
require them for viral replication. For example, the
cytomegalovirus immediate early promoter, one of the strongest
known mammalian promoters, contains eleven copies of the CRE which
are essential for promoter function (Chang, Y. -N., S. Crawford, J.
Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: "The
palindromic series I repeats in the simian cytomegalovirus major
immediate-early promoter behave as both strong basal enhancers and
cyclic AMP response elements". J. Virol. 64:264, 1990). At least
some of the transcriptional activating effects of the adenovirus
E1A protein, which induces many promoters, are due to its binding
to the DNA binding domain of the CREB/ATF protein, ATF-2, which
mediates EIA inducible transcription activation (Liu, F., and M. R.
Green: "Promoter targeting by adenovirus E1a through interaction
with different cellular DNA-binding domains". Nature 368:520,
1994). It has also been suggested that E1A binds to the
CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M.
Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated
CBP belong to a conserved family of coactivators". Cell 77:799,
1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which
causes human T cell leukemia and tropical spastic paresis, also
requires CREB/ATF proteins for replication. In this case, the
retrovirus produces a protein, Tax, which binds to CREB/ATF
proteins and redirects them from their normal cellular binding
sites to different DNA sequences (flanked by G- and C-rich
sequences) present within the HTLV transcriptional enhancer
(Paca-Uccaralertkun, S., L. -J. Zhao, N. Adya, J. V. Cross, B. R.
Cullen, I. M. Boros, and C. -Z. Giam: "In vitro selection of DNA
elements highly responsive to the human T-cell lymphotropic virus
type I transcriptional activator, Tax". Mol. Cell. Biol. 14:456,
1994; Adya, N., L. -J. Zhao, W. Huang, I. Boros, and C. -Z. Giam:
"Expansion of CREB's DNA recognition specificity by Tax results
from interaction with Ala-Ala-Arg at positions 282-284 near the
conserved DNA-binding domain of CREB". Proc. Natl. Acad. Sci. USA
91:5642, 1994).
SUMMARY OF THE INVENTION
[0016] The instant invention is based on the finding that certain
nucleic acids containing unmethylated cytosine-guanine (CpG)
dinucleotides activate lymphocytes in a subject and redirect a
subject's immune response from a Th2 to a Th1 (e.g. by inducing
monocytic cells and other cells to produce Th1 cytokines, including
IL-12, IFN-.gamma. and GM-CSF). Based on this finding, the
invention features, in one aspect, novel immunostimulatory nucleic
acid compositions.
[0017] In a preferred embodiment, the immunostimulatory nucleic
acid contains a consensus mitogenic CpG motif represented by the
formula:
1 5' X1CGX2 3'
[0018] wherein X.sub.1 is selected from the group consisting of A,G
and T; and X.sub.2 is C or T.
[0019] In a particularly preferred embodiment an immunostimulatory
nucleic acid molecule contains a consensus mitogenic CpG motif
represented by the formula:
2 5' X1X2CGX3X4 3'
[0020] wherein C and G are unmethylated; and X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are nucleotides.
[0021] Enhanced immunostimulatory activity of human cells occurs
where X.sub.1X.sub.2 is selected from the group consisting of GpT,
GpG, GpA and ApA and/or X.sub.3X.sub.4 is selected from the group
consisting of TpT, CpT and GpT (Table 5). For facilitating uptake
into cells, CpG containing immunostimulatory nucleic acid molecules
are preferably in the range of 8 to 40 base pairs in size. However,
nucleic acids of any size (even many kb long) are immunostimulatory
if sufficient immunostimulatory motifs are present, since such
larger nucleic acids are degraded into oligonucleotides inside of
cells. Preferred synthetic oligonucleotides do not include a GCG
trinucleotide sequence at or near the 5' and/or 3' terminals and/or
the consensus mitogenic CpG motif is not a palindrome. Prolonged
immunostimulation can be obtained using stabilized
oligonucleotides, particularly phosphorothioate stabilized
oligonucleotides.
[0022] In a second aspect, the invention features useful therapies,
which are based on the immunostimulatory activity of the nucleic
acid molecules. For example, the immunostimulatory nucleic acid
molecules can be used to treat, prevent or ameliorate an immune
system deficiency (e.g., a tumor or cancer or a viral, fungal,
bacterial or parasitic infection in a subject). In addition,
immunostimulatory nucleic acid molecules can be administered to
stimulate a subject's response to a vaccine.
[0023] Further, by redirecting a subject's immune response from Th2
to Th1, the instant claimed nucleic acid molecules can be
administered to treat or prevent the symptoms of asthma. In
addition, the instant claimed nucleic acid molecules can be
administered in conjunction with a particular allergen to a subject
as a type of desensitization therapy to treat or prevent the
occurrence of an allergic reaction.
[0024] Further, the ability of immunostimulatory nucleic acid
molecules to induce leukemic cells to enter the cell cycle supports
the use of immunostimulatory nucleic acid molecules in treating
leukemia by increasing the sensitivity of chronic leukemia cells
and then administering conventional ablative chemotherapy, or
combining the immunostimulatory nucleic acid molecules with another
immunotherapy.
[0025] Other features and advantages of the invention will become
more apparent from the following detailed description and
claims.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1A-C are graphs plotting dose-dependent IL-6 production
in response to various DNA sequences in T cell depleted spleen cell
cultures. A. E. coli DNA (.circle-solid.) and calf thymus DNA
(.box-solid.) sequences and LPS (at 10.times. the concentration of
E. coli and calf thymus DNA) (.diamond-solid.). B. Control
phosphodiester oligodeoxynucleotide (ODN)
.sup.5'ATGGAAGGTCCAGTGTTCTC.sup.3' (SEQ ID NO: 1) (.box-solid.) and
two phosphodiester CpG ODN .sup.5'ATCGACCTACGTGCGTTC- TC.sup.3'
(SEQ ID NO:2) (.diamond-solid.) and .sup.5'TCCATAACGTTCCTGATGCT.-
sup.3' (SEQ ID NO:3) (.circle-solid.). C. Control phosphorothioate
ODN .sup.5'GCTAGATGTTAGCGT.sup.3' (SEQ ID NO:4) (.box-solid.) and
two phosphorothioate CpG ODN .sup.5'GAGAACGTCGACCTTCGAT.sup.3' (SEQ
ID NO:5) (.diamond-solid.) and .sup.5'GCATGACGTTGAGCT.sup.3' (SEQ
ID NO:6) (.circle-solid.). Data present the mean.+-.standard
deviation of triplicates.
[0027] FIG. 2 is a graph plotting IL-6 production induced by CpG
DNA in vivo as determined 1-8 hrs after injection. Data represent
the mean from duplicate analyses of sera from two mice. BALB/c mice
(two mice/group) were injected iv. with 100 .mu.l of PBS
(.quadrature.) or 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.box-solid.) or non-CpG
phosphorothioate ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8)
(.diamond-solid.).
[0028] FIG. 3 is an autoradiograph showing IL-6 mRNA expression as
determined by reverse transcription polymerase chain reaction in
liver, spleen, and thymus at various time periods after in vivo
stimulation of BALB/c mice (two mice/group) injected iv with 100
.mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG phosphorothioate
ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8).
[0029] FIG. 4A is a graph plotting dose-dependent inhibition of
CpG-induced IgM production by anti-L-6. Splenic B-cells from DBA/2
mice were stimulated with CpG ODN
.sup.5'TCCAAGACGTTCCTGATGCT.sup.3' (SEQ ID NO:9) in the presence of
the indicated concentrations of neutralizing anti-IL-6
(.diamond-solid.) or isotype control Ab (.circle-solid.) and IgM
levels in culture supernatants determined by ELISA. In the absence
of CpG ODN, the anti-L-6 Ab had no effect on IgM secretion
(.box-solid.).
[0030] FIG. 4B is a graph plotting the stimulation index of
CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN
5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.diamond-solid.) or anti-
L-6 antibody only (.box-solid.). Data present the mean.+-.standard
deviation of triplicates.
[0031] FIG. 5 is a bar graph plotting chloramphenicol
acetyltransferase (CAT) activity in WEHI-231 cells transfected with
a promoter-less CAT construct (pCAT), positive control plasmid
(RSV), or L-6 promoter-CAT construct alone or cultured with CpG 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8) phosphorothioate ODN at the
indicated concentrations. Data present the mean of triplicates.
[0032] FIG. 6 is a schematic overview of the immune effects of the
immunostimulatory unmethylated CpG containing nucleic acids, which
can directly activate both B cells and monocytic cells (including
macrophages and dendritic cells) as shown. The immunostimulatory
oligonucleotides do not directly activate purified NK cells, but
render them competent to respond to IL-12 with a marked increase in
their IFN-.gamma.
Sequence CWU 1
1
56 1 20 DNA Artificial Sequence Synthetic oligonucleotide 1
atggaaggtc cagtgttctc 20 2 20 DNA Artificial Sequence Synthetic
oligonucleotide 2 atcgacctac gtgcgttctc 20 3 20 DNA Artificial
Sequence Synthetic oligonucleotide 3 tccataacgt tcctgatgct 20 4 15
DNA Artificial Sequence Synthetic oligonucleotide 4 gctagatgtt
agcgt 15 5 19 DNA Artificial Sequence Synthetic oligonucleotide 5
gagaacgtcg accttcgat 19 6 15 DNA Artificial Sequence Synthetic
oligonucleotide 6 gcatgacgtt gagct 15 7 20 DNA Artificial Sequence
Synthetic oligonucleotide 7 tccatgacgt tcctgatgct 20 8 20 DNA
Artificial Sequence Synthetic oligonucleotide 8 tccatgagct
tcctgagtct 20 9 20 DNA Artificial Sequence Synthetic
oligonucleotide 9 tccaagacgt tcctgatgct 20 10 20 DNA Artificial
Sequence Synthetic oligonucleotide 10 tccatgacgt tcctgacgtt 20 11
21 DNA Artificial Sequence Synthetic oligonucleotide 11 tccatgagct
tcctgagtgc t 21 12 20 DNA Artificial Sequence Synthetic
oligonucleotide 12 ggggtcaacg ttgagggggg 20 13 15 DNA Artificial
Sequence Synthetic oligonucleotide 13 gctagacgtt agcgt 15 14 15 DNA
Artificial Sequence Synthetic oligonucleotide 14 gctagacgtt agcgt
15 15 15 DNA Artificial Sequence Synthetic oligonucleotide 15
gctagacgtt agcgt 15 16 15 DNA Artificial Sequence Synthetic
oligonucleotide 16 gcatgacgtt gagct 15 17 20 DNA Artificial
Sequence Synthetic oligonucleotide 17 atggaaggtc cagcgttctc 20 18
20 DNA Artificial Sequence Synthetic oligonucleotide 18 atcgactctc
gagcgttctc 20 19 20 DNA Artificial Sequence Synthetic
oligonucleotide 19 atcgactctc gagcgttctc 20 20 20 DNA Artificial
Sequence Synthetic oligonucleotide 20 atcgactctc gagcgttctc 20 21
20 DNA Artificial Sequence Synthetic oligonucleotide 21 atcgactctc
gagcgttctc 20 22 20 DNA Artificial Sequence Synthetic
oligonucleotide 22 atggaaggtc caacgttctc 20 23 20 DNA Artificial
Sequence Synthetic oligonucleotide 23 gagaacgctg gaccttccat 20 24
20 DNA Artificial Sequence Synthetic oligonucleotide 24 gagaacgctc
gaccttccat 20 25 20 DNA Artificial Sequence Synthetic
oligonucleotide 25 gagaacgctc gaccttcgat 20 26 20 DNA Artificial
Sequence Synthetic oligonucleotide 26 gagcaagctg gaccttccat 20 27
20 DNA Artificial Sequence Synthetic oligonucleotide 27 gagaacgctg
gaccttccat 20 28 20 DNA Artificial Sequence Synthetic
oligonucleotide 28 gagaacgctg gaccttccat 20 29 20 DNA Artificial
Sequence Synthetic oligonucleotide 29 gagaacgatg gaccttccat 20 30
20 DNA Artificial Sequence Synthetic oligonucleotide 30 gagaacgctc
cagcactgat 20 31 20 DNA Artificial Sequence Synthetic
oligonucleotide 31 tccatgtcgg tcctgatgct 20 32 20 DNA Artificial
Sequence Synthetic oligonucleotide 32 tccatgctgg tcctgatgct 20 33
20 DNA Artificial Sequence Synthetic oligonucleotide 33 tccatgtcgg
tcctgatgct 20 34 20 DNA Artificial Sequence Synthetic
oligonucleotide 34 tccatgtcgg tcctgatgct 20 35 20 DNA Artificial
Sequence Synthetic oligonucleotide 35 tccatgacgt tcctgatgct 20 36
20 DNA Artificial Sequence Synthetic oligonucleotide 36 tccatgtcgg
tcctgctgat 20 37 20 DNA Artificial Sequence Synthetic
oligonucleotide 37 tccatgtcgg tcctgatgct 20 38 20 DNA Artificial
Sequence Synthetic oligonucleotide 38 tccatgccgg tcctgatgct 20 39
20 DNA Artificial Sequence Synthetic oligonucleotide 39 tccatggcgg
tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic
oligonucleotide 40 tccatgacgg tcctgatgct 20 41 20 DNA Artificial
Sequence Synthetic oligonucleotide 41 tccatgtcga tcctgatgct 20 42
20 DNA Artificial Sequence Synthetic oligonucleotide 42 tccatgtcgc
tcctgatgct 20 43 20 DNA Artificial Sequence Synthetic
oligonucleotide 43 tccatgtcgt tcctgatgct 20 44 20 DNA Artificial
Sequence Synthetic oligonucleotide 44 tccatgacgt tcctgatgct 20 45
20 DNA Artificial Sequence Synthetic oligonucleotide 45 tccataacgt
tcctgatgct 20 46 20 DNA Artificial Sequence Synthetic
oligonucleotide 46 tccatgacgt ccctgatgct 20 47 20 DNA Artificial
Sequence Synthetic oligonucleotide 47 tccatcacgt gcctgatgct 20 48
15 DNA Artificial Sequence Synthetic oligonucleotide 48 gcatgacgtt
gagct 15 49 15 DNA Artificial Sequence Synthetic oligonucleotide 49
gctagatgtt agcgt 15 50 20 DNA Artificial Sequence Synthetic
oligonucleotide 50 ggggtcaagt ctgagggggg 20 51 15 DNA Artificial
Sequence Synthetic oligonucleotide 51 gctagacgtt agtgt 15 52 15 DNA
Artificial Sequence Synthetic oligonucleotide 52 gctagacctt agtgt
15 53 20 DNA Artificial Sequence Synthetic oligonucleotide 53
tccatgtcgt tcctgatgct 20 54 20 DNA Artificial Sequence Synthetic
oligonucleotide 54 tccatgacgt tcctgatgct 20 55 18 DNA Artificial
Sequence Synthetic oligonucleotide 55 tctcccagcg tgcgccat 18 56 18
DNA Artificial Sequence Synthetic oligonucleotide 56 catttccacg
atttccca 18
* * * * *