Immunostimulatory nucleic acid molecules Krieg, Arthur M. ; et al. [The University of Iowa Research Foundation]

Immunostimulatory nucleic acid molecules

Krieg, Arthur M. ; et al.

Patent Application Summary

U.S. patent application number 10/847642 was filed with the patent office on 2005-01-06 for immunostimulatory nucleic acid molecules. This patent application is currently assigned to The University of Iowa Research Foundation. Invention is credited to Kline, Joel, Klinman, Dennis, Krieg, Arthur M., Steinberg, Alfred D..

Application Number	20050004061 10/847642
Document ID	/
Family ID	24968901
Filed Date	2005-01-06

United States Patent Application	20050004061
Kind Code	A1
Krieg, Arthur M. ; et al.	January 6, 2005

Immunostimulatory nucleic acid molecules

Abstract

Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

Inventors:	Krieg, Arthur M.; (Wellesley, MA) ; Kline, Joel; (Iowa City, IA) ; Klinman, Dennis; (Potomac, MD) ; Steinberg, Alfred D.; (Potomac, MD)
Correspondence Address:	Helen C. Lockhart Wolf, Greenfield & Sacks, P.C. 600 Atlantic Avenue Boston MA 02210 US
Assignee:	The University of Iowa Research Foundation Iowa City IA Coley Pharmaceutical Group, Inc. Wellesley MA United States of America, as represented by the Secretary, Department of Health & Human Services Bethesda MD
Family ID:	24968901
Appl. No.:	10/847642
Filed:	May 17, 2004

Related U.S. Patent Documents


Application Number	Filing Date	Patent Number
10847642	May 17, 2004
09818918	Mar 27, 2001
09818918	Mar 27, 2001
08738652	Oct 30, 1996
6207646
08738652	Oct 30, 1996
08386063	Feb 7, 1995
6194388
08386063	Feb 7, 1995
08276358	Jul 15, 1994

Current U.S. Class:	514/44R
Current CPC Class:	A61P 31/10 20180101; A61P 35/00 20180101; C12Q 1/68 20130101; A61P 37/08 20180101; A61P 37/02 20180101; Y02A 50/30 20180101; A61P 7/00 20180101; A61P 1/00 20180101; A61K 31/7048 20130101; A61K 39/00 20130101; A61K 31/7125 20130101; A61P 1/16 20180101; A61P 37/04 20180101; A61P 1/02 20180101; C12N 2310/17 20130101; C12N 2310/315 20130101; A61P 17/00 20180101; A61P 17/06 20180101; A61K 31/4706 20130101; A61P 1/04 20180101; C07H 21/00 20130101; A61K 39/39 20130101; A61K 2039/55561 20130101; A61P 31/04 20180101; C12N 15/117 20130101; A61P 31/00 20180101; A61K 31/711 20130101; A61P 19/02 20180101; A61P 33/00 20180101; A61P 37/06 20180101; A61P 43/00 20180101; A61P 11/06 20180101; A61K 31/00 20130101; A61P 31/12 20180101
Class at Publication:	514/044
International Class:	A61K 048/00

Goverment Interests

[0002] The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.

Claims

1-18. (Canceled)

19. A method for preventing or suppressing antigen-stimulated, eosinophilic inflammation in an antigen-exposed subject comprising administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length, in an amount to suppress a Th2 immune response, whereby eosinophilic inflammation is prevented or suppressed.

20. The method of claim 19, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.

21. The method of claim 20, wherein the nucleotide sequence consists of AACGTT.

22. The method of claim 19, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

23. The method of claim 19, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria.

24. The method of claim 19, wherein the eosinophilic inflammation occurs in a tissue affected by asthma, allergic rhinitis, eczema, hay fever or urticaria.

25. The method of claim 19, wherein the eosinophilic inflammation is in the lung.

26. The method of claim 25, wherein the subject has asthma.

27. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.

28. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.

29. A method for boosting an immune response of a subject comprising administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length, and wherein an increase in activation of the subject's lymphocytes or NK cells indicates that the subject's immune response has been boosted.

30. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is lymphocyte proliferation.

31. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is IgM secretion.

32. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is increased expression of IL-12 and IFN-gamma.

33. The method of claim 29, wherein the subject has an immune system deficiency.

34. The method of claim 33, wherein the immune system deficiency is an infection.

35. The method of claim 34, wherein the infection is a bacterial, viral, fungal or parasitic infection.

36. The method of claim 33, wherein the immune system deficiency is a bacterial infection by bacteria having bacterial antigens and wherein the increase in lymphocyte or NK activation is activated B cell with antigen receptors specific for the bacterial antigens.

37. The method of claim 33, wherein the immune system deficiency is cancer.

38. The method of claim 30, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.

39. The method of claim 30, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.

40. The method of claim 29, wherein the immunostimulatory oligonucleotide is administered in conjunction with a vaccine.

41. The method of claim 29, wherein the immunostimulatory oligonucleotide is not administered in conjunction with a vaccine.

42. The method of claim 29, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.

43. The method of claim 42, wherein the nucleotide sequence consists of AACGTT.

44. The method of claim 29, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

45. The method of claim 29, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria.

46. The method of claim 29, wherein the immune response occurs in a tissue affected by eczema, allergic rhinitis, hay fever or urticaria.

47. The method of claim 29, wherein the immune response occurs in the lung.

48. The method of claim 45, wherein the subject has asthma and the subject develops a Th1 immune response to an allergen.

49. The method of claim 29, wherein the subject has a viral or a parasitic infection and the immune response to the infection is boosted.

50. The method of claim 49, wherein the infection is a viral infection.

51. A method for shifting the immune response of a subject to an antigen toward a Th1 immune response comprising administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length, wherein detection of a Th1 type immune response by the subject indicates that the shift to the Th1 immune response has been achieved.

52. The method of claim 51, wherein the shift to the Th1 immune response is further associated with suppression of a Th2 immune response.

53. The method of claim 51, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5'-purine-purine-CG-pyrimidi- ne-pyrimidine-3'.

54. The method of claim 53, wherein the nucleotide sequence consists of AACGTT.

55. The method of claim 51, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

56. The method of claim 51, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria, and the shift to the Th1 immune response prevents or suppresses eosinophilic inflammation in the subject.

57. The method of claim 56, wherein the eosinophilic inflammation is in a tissue affected by asthma, allergic rhinitis, eczema, hay fever or urticaria

58. The method of claim 56, wherein the eosinophilic inflammation is in the lung.

59. The method of claim 51, wherein the subject has asthma and the shift to the Th1 immune response prevents or suppresses eosinophil infiltration into the lung of the subject.

60. The method of claim 51, wherein the subject has a viral or parasitic infection and the shift to the Th1 immune response boosts the immune response to the infection.

61. The method of claim 60, wherein the infection is a viral infection.

62. The method of claim 19, wherein the desired result is measured by detecting in a sample containing lymphocyte obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12-and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.

63. The method of claim 19, wherein prevention or suppression of eosinophilic inflammation is measured by detecting lower levels of eosinophils in an inflammatory infiltrate in the lung in an immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.

64. The method of claim 51, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.

65. The method of claim 51, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.

66. The method of claim 51, wherein the immunostimulatory oligonucleotide is administered in conjunction with a vaccine.

67. The method of claim 51, wherein the immunostimulatory oligonucleotide is not administered in conjunction with a vaccine.

68. A method for preventing or reducing antigen-stimulated, granulocyte-mediated inflammation in a tissue of an antigen-sensitized subject comprising administering an isolated immunostimulatory oligonucleotide to the subject, wherein a reduction in, or the absence of, a Th2 type immune response measured in the subject, or a reduction in, or the absence of, other clinical signs of inflammation in the subject after antigen challenge, indicates that the desired prevention or reduction in granulocyte-mediated inflammation has been achieved.

69. The method of claim 68, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.

70. The method of claim 69, wherein the hexameric nucleotide sequence consists of AACGTT.

71. The method of claim 68, wherein the immunostimulatory oligonucleotide comprises a hexameric nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

72. The method of claim 68, wherein the subject is suffering from an condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity.

73. The method of claim 68, wherein the inflammation is in skin or mucosa.

74. The method of claim 73, wherein the inflammation is in a respiratory tissue.

75. The method of claim 68, wherein the subject is suffering from asthma.

76. The method of claim 68, wherein the desired result is measured by detecting in a sample containing lymphocytes obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12 and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.

77. A method for boosting the immune responsiveness of a subject to a sensitizing antigen without immunization of the subject by the sensitizing antigen comprising administering an isolated immunostimulatory oligonucleotide to the subject, wherein an increase in the magnitude of the subject's immune response to the sensitizing antigen indicates that the desired boost to the subject's immune responsiveness has been achieved.

78. The method of claim 77, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.

79. The method of claim 78, wherein the hexameric nucleotide sequence consists of AACGTT.

80. The method of claim 77, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence is selected from the group of sequences consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

81. The method of claim 77, wherein the subject is suffering from an inflammatory condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity.

82. The method of claim 81, wherein the immune response is in skin or mucosa.

83. The method of claim 82, wherein the immune response is in respiratory tissue.

84. The method of claim 83, wherein the subject is suffering from asthma and the subject's immune responsiveness to a respiratory allergen is boosted.

85. The method of claim 77, wherein the antigen is presented by a pathogen and the subject's immune responsiveness to an intracellular infection by the pathogen is boosted.

86. The method of claim 85, wherein the pathogen is a virus.

87. A method for shifting the immune response of a subject to a sensitizing antigen toward a Th1 phenotype comprising administering an isolated immunostimulatory oligonucleotide to the subject, wherein detection of a Th1 type immune response by the subject indicates that the desired shift to the Th1 phenotype has been achieved.

88. The method of claim 87, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5'-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3'.

89. The method of claim 88, wherein the hexameric nucleotide sequence consists of AACGTT.

90. The method of claim 87, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence is selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.

91. The method of claim 87, wherein the subject is suffering from an inflammatory condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity, and the shift to the Th1 phenotype reduces granulocyte-mediated inflammation in the affected tissue.

92. The method of claim 91, wherein the affected tissue is skin or mucosa.

93. The method of claim 92, wherein the affected tissue is respiratory tissue.

94. The method of claim 93, wherein the subject is suffering from asthma and the shift to the Th1 phenotype reduces eosinophil infiltration of the lung.

95. The method of claim 87, wherein the subject is suffering from an intracellular infection by a pathogen and the shift to the Th1 phenotype strengthens the subject's immune response to the pathogen.

96. The method of claim 91, wherein the pathogen is a virus.

97. The method of claim 87, wherein the desired result is measured by detecting in a sample containing lymphocytes obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12 and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.

98. The method of claim 68, wherein reduction or suppression of inflammation is measured by assaying inflammatory infiltrate from the subject for a reduction in granulocyte counts in inflammatory infiltrate of an affected subject tissue as measured in an antigen challenged subject before and after ISS-ODN administration or detection of lower levels of granulocyte counts in an ISS-ODN treated subject as compared to an antigen-challenged control

99. The method of claim 48, wherein the allergen is pollen, animal dander or dust.

Description

RELATED APPLICATIONS

[0001] This application is a divisional of co-pending U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a continuation-in-part of U.S. patent application Ser. No. 08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No. 6,194,388, which is a continuation-in-part of U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994, now abandoned.

BACKGROUND OF THE INVENTION

[0003] DNA Binds To Cell Membranes And Is Internalized

[0004] In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. "Membrane-associated DNA in the cytoplasm of diploid human lymphocytes". Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. "Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy". Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. "DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA". J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. "Cellular uptake of antisense oligodeoxynucleotides". Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. "Pharmaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides". In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. "Stage specific oligonucleotide uptake in murine bone marrow B cell precursors". Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.

[0005] Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible". Antisense Research and Development 1:161).

[0006] Immune Effects Of Nucleic Acids

[0007] Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. "Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose". Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. "Immunomodulation of natural killer activity by polyribonucleotides". J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. "Interferons and interferon inducers in cancer treatment". Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects". Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN induction and associated changes in splenic leukocyte distribution". J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.

[0008] Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace "B cell differentiation factors" (Feldbush, T. L., and Z. K. Ballas. 1985. "Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation". J. Immunol. 134:3204; and Goodman, M. G. 1986. "Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine". J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. "Activation of murine natural killer cells and macrophages by 8-bromoguanosine". J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. "Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation". J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5' triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human .gamma..delta. T cells (Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J. -J. Foumie. 1994. "Stimulation of human .gamma..delta. T cells by nonpeptidic mycobacterial ligands" Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.

[0009] Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. "Immunogenic DNA-related factors". J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG).circle-solid.(dC) and poly (dG.circle-solid. dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. "The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens". Cell. Immunol.147:148). Tokunaga, et al. have reported that dG.circle-solid.dC induces IFN-.gamma. and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. "A synthetic single-stranded DNA, poly(dG,dC), induces interferon-.alpha./.beta. and -.gamma., augments natural killer activity, and suppresses tumor growth" Jpn. J. Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. "Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA". J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. "Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity". J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. "Oligonucleotide sequences required for natural killer cell activation". Jpn. J. Cancer Res. 83:1128).

[0010] Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. "An antisense oligonucleotide complementary to a sequence in I.gamma.2b increases .gamma.2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion". J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. "Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1". Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NF.kappa.B T65 causes sequence-specific immune stimulation". Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus". Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.

[0011] The CREB/ATF Family Of Transcription Factors And Their Role In Replication

[0012] The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: "Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3',5'-monophosphate-responsive nuclear regulators". Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: "Transcriptional regulation by CREB and its relatives". Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero- dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: "CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation". Genes & Develop. 3:612, 1989.).

[0013] The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: "Induction of CREB activity via the surface Ig receptor of B cells". J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: "Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1.beta. gene". Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice". Cancer Res. 53:577, 1993), IFN-.beta. (Du, W., and T. Maniatis: "An ATF/CREB binding site protein is required for virus induction of the human interferon B gene". Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-.beta.1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene". Biochim. Biophys. Acta 1219:55, 1994.), TGF-.beta.2, class II MHC (Cox, P. M., and C. R. Goding: "An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen". Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8.alpha., the germline Iga constant region gene, the TCR V.beta. gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: "Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes". Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca.sup.++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: "Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB". Neuron 4:571, 1990).

[0014] The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFKB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB.sup.341 on ser.sup.133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear protein CBP is a coactivator for the transcription factor CREB". Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: "Activation of cAMP and mitogen responsive genes relies on a common nuclear factor". Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: "The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex". Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C. -Y. Chen: "Identification of multiple nuclear factors that interact with cyclic adenosine 3',5'-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions". Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: "A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator". Mol. Cell. Biol. 14:7204, 1994.).

[0015] Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y. -N., S. Crawford, J. Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: "The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements". J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates EIA inducible transcription activation (Liu, F., and M. R. Green: "Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains". Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators". Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the HTLV transcriptional enhancer (Paca-Uccaralertkun, S., L. -J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. Boros, and C. -Z. Giam: "In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax". Mol. Cell. Biol. 14:456, 1994; Adya, N., L. -J. Zhao, W. Huang, I. Boros, and C. -Z. Giam: "Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB". Proc. Natl. Acad. Sci. USA 91:5642, 1994).

SUMMARY OF THE INVENTION

[0016] The instant invention is based on the finding that certain nucleic acids containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes in a subject and redirect a subject's immune response from a Th2 to a Th1 (e.g. by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN-.gamma. and GM-CSF). Based on this finding, the invention features, in one aspect, novel immunostimulatory nucleic acid compositions.

[0017] In a preferred embodiment, the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula:

1 5' X1CGX2 3'

[0018] wherein X.sub.1 is selected from the group consisting of A,G and T; and X.sub.2 is C or T.

[0019] In a particularly preferred embodiment an immunostimulatory nucleic acid molecule contains a consensus mitogenic CpG motif represented by the formula:

2 5' X1X2CGX3X4 3'

[0020] wherein C and G are unmethylated; and X.sub.1, X.sub.2, X.sub.3 and X.sub.4 are nucleotides.

[0021] Enhanced immunostimulatory activity of human cells occurs where X.sub.1X.sub.2 is selected from the group consisting of GpT, GpG, GpA and ApA and/or X.sub.3X.sub.4 is selected from the group consisting of TpT, CpT and GpT (Table 5). For facilitating uptake into cells, CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 40 base pairs in size. However, nucleic acids of any size (even many kb long) are immunostimulatory if sufficient immunostimulatory motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides do not include a GCG trinucleotide sequence at or near the 5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.

[0022] In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.

[0023] Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.

[0024] Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.

[0025] Other features and advantages of the invention will become more apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE FIGURES

[0026] FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (.circle-solid.) and calf thymus DNA (.box-solid.) sequences and LPS (at 10.times. the concentration of E. coli and calf thymus DNA) (.diamond-solid.). B. Control phosphodiester oligodeoxynucleotide (ODN) .sup.5'ATGGAAGGTCCAGTGTTCTC.sup.3' (SEQ ID NO: 1) (.box-solid.) and two phosphodiester CpG ODN .sup.5'ATCGACCTACGTGCGTTC- TC.sup.3' (SEQ ID NO:2) (.diamond-solid.) and .sup.5'TCCATAACGTTCCTGATGCT.- sup.3' (SEQ ID NO:3) (.circle-solid.). C. Control phosphorothioate ODN .sup.5'GCTAGATGTTAGCGT.sup.3' (SEQ ID NO:4) (.box-solid.) and two phosphorothioate CpG ODN .sup.5'GAGAACGTCGACCTTCGAT.sup.3' (SEQ ID NO:5) (.diamond-solid.) and .sup.5'GCATGACGTTGAGCT.sup.3' (SEQ ID NO:6) (.circle-solid.). Data present the mean.+-.standard deviation of triplicates.

[0027] FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 .mu.l of PBS (.quadrature.) or 200 .mu.g of CpG phosphorothioate ODN 5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.box-solid.) or non-CpG phosphorothioate ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8) (.diamond-solid.).

[0028] FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 .mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8).

[0029] FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-L-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN .sup.5'TCCAAGACGTTCCTGATGCT.sup.3' (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (.diamond-solid.) or isotype control Ab (.circle-solid.) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-L-6 Ab had no effect on IgM secretion (.box-solid.).

[0030] FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.diamond-solid.) or anti- L-6 antibody only (.box-solid.). Data present the mean.+-.standard deviation of triplicates.

[0031] FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or L-6 promoter-CAT construct alone or cultured with CpG 5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.

[0032] FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-.gamma.

Sequence CWU 1

1

56 1 20 DNA Artificial Sequence Synthetic oligonucleotide 1 atggaaggtc cagtgttctc 20 2 20 DNA Artificial Sequence Synthetic oligonucleotide 2 atcgacctac gtgcgttctc 20 3 20 DNA Artificial Sequence Synthetic oligonucleotide 3 tccataacgt tcctgatgct 20 4 15 DNA Artificial Sequence Synthetic oligonucleotide 4 gctagatgtt agcgt 15 5 19 DNA Artificial Sequence Synthetic oligonucleotide 5 gagaacgtcg accttcgat 19 6 15 DNA Artificial Sequence Synthetic oligonucleotide 6 gcatgacgtt gagct 15 7 20 DNA Artificial Sequence Synthetic oligonucleotide 7 tccatgacgt tcctgatgct 20 8 20 DNA Artificial Sequence Synthetic oligonucleotide 8 tccatgagct tcctgagtct 20 9 20 DNA Artificial Sequence Synthetic oligonucleotide 9 tccaagacgt tcctgatgct 20 10 20 DNA Artificial Sequence Synthetic oligonucleotide 10 tccatgacgt tcctgacgtt 20 11 21 DNA Artificial Sequence Synthetic oligonucleotide 11 tccatgagct tcctgagtgc t 21 12 20 DNA Artificial Sequence Synthetic oligonucleotide 12 ggggtcaacg ttgagggggg 20 13 15 DNA Artificial Sequence Synthetic oligonucleotide 13 gctagacgtt agcgt 15 14 15 DNA Artificial Sequence Synthetic oligonucleotide 14 gctagacgtt agcgt 15 15 15 DNA Artificial Sequence Synthetic oligonucleotide 15 gctagacgtt agcgt 15 16 15 DNA Artificial Sequence Synthetic oligonucleotide 16 gcatgacgtt gagct 15 17 20 DNA Artificial Sequence Synthetic oligonucleotide 17 atggaaggtc cagcgttctc 20 18 20 DNA Artificial Sequence Synthetic oligonucleotide 18 atcgactctc gagcgttctc 20 19 20 DNA Artificial Sequence Synthetic oligonucleotide 19 atcgactctc gagcgttctc 20 20 20 DNA Artificial Sequence Synthetic oligonucleotide 20 atcgactctc gagcgttctc 20 21 20 DNA Artificial Sequence Synthetic oligonucleotide 21 atcgactctc gagcgttctc 20 22 20 DNA Artificial Sequence Synthetic oligonucleotide 22 atggaaggtc caacgttctc 20 23 20 DNA Artificial Sequence Synthetic oligonucleotide 23 gagaacgctg gaccttccat 20 24 20 DNA Artificial Sequence Synthetic oligonucleotide 24 gagaacgctc gaccttccat 20 25 20 DNA Artificial Sequence Synthetic oligonucleotide 25 gagaacgctc gaccttcgat 20 26 20 DNA Artificial Sequence Synthetic oligonucleotide 26 gagcaagctg gaccttccat 20 27 20 DNA Artificial Sequence Synthetic oligonucleotide 27 gagaacgctg gaccttccat 20 28 20 DNA Artificial Sequence Synthetic oligonucleotide 28 gagaacgctg gaccttccat 20 29 20 DNA Artificial Sequence Synthetic oligonucleotide 29 gagaacgatg gaccttccat 20 30 20 DNA Artificial Sequence Synthetic oligonucleotide 30 gagaacgctc cagcactgat 20 31 20 DNA Artificial Sequence Synthetic oligonucleotide 31 tccatgtcgg tcctgatgct 20 32 20 DNA Artificial Sequence Synthetic oligonucleotide 32 tccatgctgg tcctgatgct 20 33 20 DNA Artificial Sequence Synthetic oligonucleotide 33 tccatgtcgg tcctgatgct 20 34 20 DNA Artificial Sequence Synthetic oligonucleotide 34 tccatgtcgg tcctgatgct 20 35 20 DNA Artificial Sequence Synthetic oligonucleotide 35 tccatgacgt tcctgatgct 20 36 20 DNA Artificial Sequence Synthetic oligonucleotide 36 tccatgtcgg tcctgctgat 20 37 20 DNA Artificial Sequence Synthetic oligonucleotide 37 tccatgtcgg tcctgatgct 20 38 20 DNA Artificial Sequence Synthetic oligonucleotide 38 tccatgccgg tcctgatgct 20 39 20 DNA Artificial Sequence Synthetic oligonucleotide 39 tccatggcgg tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic oligonucleotide 40 tccatgacgg tcctgatgct 20 41 20 DNA Artificial Sequence Synthetic oligonucleotide 41 tccatgtcga tcctgatgct 20 42 20 DNA Artificial Sequence Synthetic oligonucleotide 42 tccatgtcgc tcctgatgct 20 43 20 DNA Artificial Sequence Synthetic oligonucleotide 43 tccatgtcgt tcctgatgct 20 44 20 DNA Artificial Sequence Synthetic oligonucleotide 44 tccatgacgt tcctgatgct 20 45 20 DNA Artificial Sequence Synthetic oligonucleotide 45 tccataacgt tcctgatgct 20 46 20 DNA Artificial Sequence Synthetic oligonucleotide 46 tccatgacgt ccctgatgct 20 47 20 DNA Artificial Sequence Synthetic oligonucleotide 47 tccatcacgt gcctgatgct 20 48 15 DNA Artificial Sequence Synthetic oligonucleotide 48 gcatgacgtt gagct 15 49 15 DNA Artificial Sequence Synthetic oligonucleotide 49 gctagatgtt agcgt 15 50 20 DNA Artificial Sequence Synthetic oligonucleotide 50 ggggtcaagt ctgagggggg 20 51 15 DNA Artificial Sequence Synthetic oligonucleotide 51 gctagacgtt agtgt 15 52 15 DNA Artificial Sequence Synthetic oligonucleotide 52 gctagacctt agtgt 15 53 20 DNA Artificial Sequence Synthetic oligonucleotide 53 tccatgtcgt tcctgatgct 20 54 20 DNA Artificial Sequence Synthetic oligonucleotide 54 tccatgacgt tcctgatgct 20 55 18 DNA Artificial Sequence Synthetic oligonucleotide 55 tctcccagcg tgcgccat 18 56 18 DNA Artificial Sequence Synthetic oligonucleotide 56 catttccacg atttccca 18

* * * * *