U.S. patent application number 11/110189 was filed with the patent office on 2005-09-08 for methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines.
This patent application is currently assigned to University of Iowa Research Foundation. Invention is credited to Krieg, Arthur M., Weiner, George.
Application Number | 20050197314 11/110189 |
Document ID | / |
Family ID | 22159244 |
Filed Date | 2005-09-08 |
United States Patent
Application |
20050197314 |
Kind Code |
A1 |
Krieg, Arthur M. ; et
al. |
September 8, 2005 |
Methods and products for stimulating the immune system using
immunotherapeutic oligonucleotides and cytokines
Abstract
The present invention relates to synergistic combinations of
immunostimulatory CpG oligonucleotides and immunopotentiating
cytokines. In particular, the invention relates to methods of
stimulating an immune response using the synergistic combination of
compounds and products related thereto.
Inventors: |
Krieg, Arthur M.; (Iowa
City, IA) ; Weiner, George; (Iowa City, IA) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2211
US
|
Assignee: |
University of Iowa Research
Foundation
Iowa City
IA
|
Family ID: |
22159244 |
Appl. No.: |
11/110189 |
Filed: |
April 19, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11110189 |
Apr 19, 2005 |
|
|
|
09824468 |
Apr 2, 2001 |
|
|
|
09824468 |
Apr 2, 2001 |
|
|
|
09286098 |
Apr 2, 1999 |
|
|
|
6218371 |
|
|
|
|
60080729 |
Apr 3, 1998 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61K 39/0011 20130101;
A61K 39/39 20130101; A61K 2039/55561 20130101; A61K 2039/55522
20130101; A61K 2039/55538 20130101; A61P 15/18 20180101; A61P 15/00
20180101; A61P 35/00 20180101; A61P 15/16 20180101; A61K 2039/55527
20130101; A61P 43/00 20180101; A61P 31/12 20180101; A61P 35/02
20180101; A61P 37/08 20180101; A61P 31/04 20180101; A61P 31/00
20180101; A61P 31/10 20180101; A61P 37/04 20180101; A61K 39/0011
20130101; A61K 2300/00 20130101; A61K 39/39 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Claims
We claim:
1-20. (canceled)
21. A method for stimulating an immune response in a subject,
comprising: administering to a subject exposed to an antigen an
effective amount for inducing a synergistic antigen specific immune
response of a Flt3 ligand, and an immunostimulatory CpG
oligonucleotide having a sequence including at least the following
formula:
15 5' X.sub.1CGX.sub.2 3'
wherein the oligonucleotide is 8 to 100 nucleotides long, wherein C
is unmethylated and wherein X.sub.1 and X.sub.2 are nucleotides,
whereby an antigen is optionally additionally administered, and
wherein the antigen and the CpG oligonucleotide are not
conjugated.
22. The method of claim 21, wherein the Flt3 ligand and the antigen
are fused to form an antigen-Flt3 ligand fusion protein.
23. The method of claim 21, wherein the antigen is selected from
the group consisting of a tumor antigen, a microbial antigen, and
an allergen.
24. The method of claim 23, wherein the antigen is a tumor
antigen.
25. The method of claim 21, wherein the antigen is administered to
the subject in conjunction with the immunostimulatory CpG
oligonucleotide and the Flt3 ligand.
26. The method of claim 21, wherein the subject is passively
exposed to the antigen.
27. The method of claim 21, wherein the subject has a neoplastic
disorder.
28. The method of claim 21, wherein the subject has a viral
infection.
29. The method of claim 21, wherein the subject is a non-human
animal.
30. The method of claim 29, wherein the non-human animal is a
vertebrate animal selected from the group consisting of a dog, a
cat, a horse, a cow, a pig, a sheep, a goat, a chicken, and a
primate.
31. A composition, comprising: an effective amount, for
synergistically activating a dendritic cell, of an
immunostimulatory CpG oligonucleotide having a sequence including
at least the following formula:
16 5' X.sub.1CGX.sub.2 3'
wherein the oligonucleotide is 8 to 100 nucleotides long, wherein C
is unmethylated and wherein X.sub.1 and X.sub.2 are nucleotides;
and a Flt3 ligand.
32. The composition of claim 31, further comprising an antigen and
wherein the antigen and the CpG oligonucleotide are not
conjugated.
33. The composition of claim 33, wherein the antigen is selected
from the group consisting of a cancer antigen, a microbial antigen,
and an allergen.
34. A method for activating a dendritic cell, comprising:
contacting a dendritic cell exposed to an antigen with an effective
amount for synergistically activating a dendritic cell of a Flt3
ligand, and an immunostimulatory CpG oligonucleotide having a
sequence including at least the following formula:
5'X.sub.1CGX.sub.2 3'wherein the oligonucleotide is 8 to 100
nucleotides long, wherein C is unmethylated and wherein X.sub.1 and
X.sub.2 are nucleotides, whereby an antigen is optionally
additionally administered, and wherein the antigen and the CpG
oligonucleotide are not conjugated.
35. The method of claim 34, wherein the antigen is a tumor
antigen.
36. A method for treating a subject having a neoplastic disorder,
comprising: administering to the tumor of a subject having a
neoplastic disorder a Flt3 ligand, and an immunostimulatory CpG
oligonucleotide having a sequence including at least the following
formula:
17 5' X.sub.1CGX.sub.2 3'
wherein the oligonucleotide is 8 to 100 nucleotides long, wherein C
is unmethylated and wherein X.sub.1 and X.sub.2 are nucleotides, in
an amount effective for synergistically increasing survival time of
the subject with respect to a subject administered the
immunostimulatory CpG oligonucleotide or the Flt3 ligand alone.
37. The method of claim 36, wherein the tumor is selected from the
group consisting of a lymphoma and a tumor of the brain, lung,
ovary, breast, prostate, colon, and skin.
38. The method of claim 36, wherein the immunostimulatory CpG
oligonucleotide and the Flt3 ligand are injected directly into the
tumor.
39. The method of claim 36, wherein the subject is a non-human
animal.
40. The method of claim 39, wherein the non-human animal is a
vertebrate animal selected from the group consisting of a dog, a
cat, a horse, a cow, a pig, a sheep, a goat, a chicken, and a
primate.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to synergistic combinations of
immunostimulatory CpG oligonucleotides and immunopotenitiating
cytokines. In particular, the invention relates to methods of
stimulating an immune response using the synergistic combination of
compounds and products related thereto.
BACKGROUND OF THE INVENTION
[0002] The theory of immune surveillance is that a prime function
of the immune system is to detect and eliminate neoplastic cells
before a tumor forms. A basic principle of this theory is that
cancer cells are antigenically different from normal cells and thus
elicit immune reactions that are similar to those that cause
rejection of immunologically incompatible allografts. Studies have
confirmed that tumor cells differ, either qualitatively or
quantitatively, in their expression of antigens. For example,
"tumor-specific antigens" are antigens that are specifically
associated with tumor cells but not normal cells. Examples of tumor
specific antigens are viral antigens in tumors induced by DNA or
RNA viruses. "Tumor-associated" antigens are present in both tumor
cells and normal cells but are present in a different quantity or a
different form in tumor cells. Examples of such antigens are
oncofetal antigens (e.g., caricnoembryonic antigen),
differentiation antigens (e.g., T and Tn antigens), and oncogene
products (e.g., HER/neu).
[0003] Different types of cells that can kill tumor targets in
vitro and in vivo have been identified: natural killer cells (NK
cells), cytolytic T lymphocytes (CTLs), lymphokine-activated killer
cells (LAKs), and activated macrophages. NK cells can kill tumor
cells without having been previously sensitized to specific
antigens, and the activity does not require the presence of class I
antigens encoded by the major histocompatibility complex (MHC) on
target cells. NK cells are thought to participate in the control of
nascent tumors and in the control of metastatic growth. In contrast
to NK cells, CTLs can kill tumor cells only after they have been
sensitized to tumor antigens and when the target antigens is
expressed on the tumor cells that also express MHC class 1. CTLs
are thought to be effector cells in the rejection of transplanted
tumors and of tumors caused by DNA viruses. LAK cells are a subset
of null lymphocytes distinct from the NK and CTL populations.
Activated macrophages can kill tumor cells in a manner that is not
antigen dependent nor MHC restricted bnce activated. Activated
macrophages are through to decrease the growth rate of the tumors
they infiltrate. In vitro assays have identified other immune
mechanisms such as antibody-dependent, cell-mediated cytotoxic
reactions and lysis by antibody plus complement. However, these
immune effector mechanisms are thought to be less important in vivo
than the function of NK, CTLs, LAK, and macrophages in vivo (for
review see Piessens, W. F., and David, J., "Tumor Immunology", In:
Scientific American Medicine, Vol. 2, Scientific American Books,
N.Y., pp. 1-13, 1996.
[0004] One of the most complex phenomenon in cancer immunology
relates to the failure of the immune system to eliminate tumors. In
the 1970's, Hewitt articulated the notion that most tumors did not
express any tumor-specific or neoantigens and, thus, could not be
recognized as "foreign" by the immune system. Indeed, virtually no
tumor cell surface antigens recognized by antibodies were found to
be tumor specific, and furthermore, most spontaneous murine tumors
were considered "poorly immunogenic" as defined by their failure to
be eliminated when transferred into syngeneic hosts (Hewitt, et
al., Br. J. Cancer, 33:241-259, 1976). However, these same tumors
could be rendered "immunogenic" by mutagenesis (Van Pel and Boon,
Proc. Natl. Acad. Sci. USA, 79:4718-4722, 1982) when new antigens
were expressed on the tumor cells surface. It is possible that the
immune system fails to eliminate tumors not because neoantigens are
absent, but rather because in vivo the response to antigens is
inadequate. Therefore, a method for enhancing immunogenicity of the
tumor cells by potentiating the host's immune response to the tumor
cells would provide a key advance in immunotherapy.
[0005] The goal of immunotherapy is to augment a patient's immune
response to an established tumor. One method of immunotherapy
includes the use of adjuvants. Adjuvant substances derived from
microorganisms, such as bacillus Calmette-Guerin, heighten the
immune response and enhance resistance to tumors in animals.
Although bacillus Calmette-Guerin has been tested in many clinical
trials, the results have been inconclusive, and the value of this
type of bacterial adjuvant therapy remains uncertain (Piessens and
David, 1996, supra).
[0006] A number of bacterial products, such as lipopolysaccharide,
are known to stimulate mammalian immune responses. Recently,
bacterial DNA itself has been reported to be one such molecule
(e.g., Krieg, A. M., et al., 1995, Nature 374:546-9). One of the
major differences between bacterial DNA, which has potent
immunostimulator effects, and vertebrate DNA, which does not, is
that bacterial DNA contains a higher frequency of unmethylated CpC
dinucleotides than does vertebrate DNA. Select synthetic
oligodeoxynucleotides (ODN) containing unmethylated CpG motifs (CpG
ODN) have been shown to have an immunologic effects and can induce
activation of B cells, NK cells and antigen-presenting cells (APCs)
such as monocytes and macrophages (Krieg, A. M., et al., supra). It
can also enhance production of cytokines known to participate in
the development of an active immune response, including tumor
necrosis factor-.alpha., IL-12 and IL-6 (e.g., Klinman D. M., et
al., Proc. Natl. Acad. Sci. USA, 93:2879-83, 1996).
[0007] The binding of DNA to cells has been shown to be similar to
a ligand receptor interaction: binding is saturable, competitive,
and leads to, DNA endocytosis and degradation into oligonucleotides
(Benne, R. M., et al., J. Clin. Invest. 0.76:2182, 1995). Like DNA,
oligodeoxyribonucleotides are able to enter cells in a process
which is sequence, temperature, and energy independent (Jaroszewski
and Cohen, Ad. Drug. Del. Rev. 6:235, 1991). Lymphocyte
oligodeoxyribonucleotide uptake has been shown to be regulated by
cell activation (Krieg, A. M., et al., Antisense Research and
Development 1:161, 1991).
[0008] GM-CSF is known to regulate cell proliferation under basal
and stress conditions, and is known to activate the tumoricidal
activity of macrophages. Some studies indicate that simultaneous
treatment with GM-CSF and standard induction chemotherapy may
improve the efficacy of chemotherapy (Estey, E. H., Blood 83:2015,
1994). The major benefit of colony stimulating factors, such as
GM-CSF, has been postulated to be their use in the treatment
pancytopenia, one of the complications of chemotherapy (Piessens
and David, 1996, supra).
SUMMARY OF THE INVENTION
[0009] The present invention relates to methods and products for
inducing a synergistic immune response using a combination of a CpG
oligonucleotide and a cytokine. In one aspect the invention is a
method for stimulating an immune response in a subject. The method
includes the steps of administering to a subject exposed to an
antigen an effective amount for inducing a synergistic antigen
specific immune response of an immunopotentiating cytokine and an
immunostimulatory CpG oligonucleotide having a sequence including
at least the following formula:
1 5' X.sub.1CGX.sub.2 3'
[0010] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides.
[0011] The cytokine may, for instance be GM-CSF, IL-3, IL-5, IL-12,
or interferon-.gamma.. The immunopotentiating cytokine may also be
an antigen-cytokine fusion protein. In a preferred embodiment the
antigen-cytokine fusion protein is an antigen-GM-CSF fusion
protein.
[0012] The antigen may be any type of antigen known in the art. In
one embodiment the antigen is a selected from the group consisting
of a tumor antigen, a microbial antigen, and an allergen.
Preferably the antigen is a tumor antigen. In this embodiment the
subject may have a neoplastic disorder. In other embodiments the
antigen is a viral antigen and the subject has or is at risk of
having a viral infection.
[0013] In some embodiments the antigen is administered to the
subject in conjunction with the immunostimulatory CpG
oligonucleotide and the immunopotentiating cytokine. In other
embodiments the subject is passively exposed to the antigen.
[0014] In other aspects the invention is a composition of an
effective amount for synergistically activating a dendritic cell of
an immunostimulatory CpG oligonucleotide having a sequence
including at least the following formula:
2 5' X.sub.1CGX.sub.2 3'
[0015] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides; and a cytokine selected from the group consisting
of GM-CSF, IL-4, TNF.alpha., Flt3 ligand, and IL-3. Preferably the
cytokine is GM-CSF.
[0016] The composition may also include an antigen. In some
embodiments the antigen is selected from the group consisting of a
cancer antigen, a microbial antigen, and an allergen.
[0017] A method for activating a dendritic cell is provided
according to another aspect of the invention. The method includes
the step of contacting a dendritic cell exposed to an antigen with
an effective amount for synergistically activating a dendritic cell
of an immunopotentiating cytokine and an immunostimulatory CpG
oligonucleotide having a sequence including at least the following
formula:
3 5' X.sub.1CGX.sub.2 3'
[0018] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides.
[0019] The cytokine may, for instance be GM-CSF, IL-3, IL-5, IL-12,
or interferon-.gamma.. The immunopotentiating cytokine may also be
an antigen-cytokine fusion protein. In a preferred embodiment the
antigen-cytokine fusion protein is an antigen-GM-CSF fusion
protein.
[0020] The antigen may be any type of antigen known in the art. In
one embodiment the antigen is a selected from the group consisting
of a tumor antigen, a microbial antigen, and an allergen.
Preferably the antigen is a tumor antigen. In this embodiment the
subject may have a neoplastic disorder. In other embodiments the
antigen is a viral antigen and the subject has or is at risk of
having a viral infection.
[0021] According to another aspect the invention is a method for
treating a subject having a neoplastic disorder. The method
includes the step of administering to the tumor of a subject having
a neoplastic disorder an immunopotentiating cytokine and an
immunostimulatory CpG oligonucleotide having a sequence including
at least the following formula:
4 5' X.sub.1CGX.sub.2 3'
[0022] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides, in an amount effective for synergistically
increasing survival time of the subject with respect to a subject
administered the immunostimulatory CpG oligonucleotide or the
immunopotentiating cytokine alone.
[0023] Preferably the tumor is selected from the group consisting
of a tumor of the brain, lung, ovary, breast, prostate, colon,
skin, and blood. In one embodiment the immunostimulatory CpG
oligonucleotide and the immunopotentiating cytokine are injected
directly into the tumor.
[0024] A contraceptive method is provided in another aspect of the
invention. The method involves the step of administering to a
subject an antigen, an immunopotentiating cytokine and an
immunostimulatory CpG oligonucleotide having a sequence including
at least the following formula:
5 5' X.sub.1CGX.sub.2 3'
[0025] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides, wherein the antigen is an antigen selected from
the group consisting of a gonadal cell antigen and an antigen from
a cytokine or hormone required for the maintenance of a gonadal
cell.
[0026] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 is a graph showing the production of anti-Id IgG
following immunization using a combination of CpG ODN and soluble
GM-CSF. Mice were immunized with 50 .mu.g of Id-KLH as a single
subcutaneous dose mixed in aqueous solution with GM-CSF, CpG ODN or
both. Blood was obtained weekly, and serum was evaluated for the
presence of anti-Id IgG by ELISA. Normal mouse serum supplemented
with a known concentration of monoclonal anti-Id was used as a
standard. Three mice were included in each group.
[0028] FIG. 2 is a graph showing that immunization using a
combination of Id/GM-CSF fusion protein and CpG ODN enhances
production of antigen-specific IgG. Mice were immunized with 50
.mu.g of Id/GM-CSF as a single subcutaneous dose with or without
CpG ODN. Blood was obtained weekly, and serum was evaluated for the
presence of anti-Id IgG by ELISA. Normal mouse serum supplemented
with a known concentration of monoclonal anti-Id was used as a
standard. Three mice were included in each group.
[0029] FIG. 3 is a graph showing that immunization using repeated
immunizations with a combination of Id/GM-CSF fusion protein and
CpG ODN induces high levels of antigen-specific IgG. Mice were
immunized with 50 .mu.g of Id/GM-CSF as a subcutaneous dose with or
without CpG ODN on week 0 and again on week 2. Blood was obtained
weekly, and serum was evaluated for the presence of anti-Id IgG by
ELISA. Normal mouse serum supplemented with a known concentration
of monoclonal anti-Id was used as a standard. Three mice were
included in each group.
[0030] FIG. 4 is a bar graph showing that CpG ODN enhances
production of antigen specific antibody of IgG.sub.2a isotype. Mice
were immunized with a single dose using various combinations of
Id-KLH, GM-CSF, Id/GM-CSF fusion protein, and CpG ODN. Serum was
obtained 4 weeks after a single immunization. Anti-Id IgG.sub.1 and
IgG.sub.2a was determined by ELISA. Three mice were included in
each group.
[0031] FIG. 5 is a survival curve showing that CpG ODN enhances the
protective effect of Id/GM-CSF protection against tumor growth.
Mice were immunized with a single injection of Id/GM-CSF and/or CpG
ODN and challenged with tumor 3 days later. Survival was followed
for 100 days. All mice that were alive after 51 days remained
tumor-free for the entire observation period. Twenty mice were
included in each group.
[0032] FIG. 6 is a bar graph showing the expression of MHC class I,
MHC class II, CD80, and CD86 after pulsing of bone marrow-derived
dendritic cells with Id/GM-CSF and/or CpG ODN.
[0033] FIG. 7 is a bar graph illustrating that CpG ODN enhances
production IL-12 by dendritic cells pulsed with Id-KLH or
Id/GM-CSF. Bone marrow derived dendritic cells were pulsed with
antigen with and without CpG ODN for 18 hours, and production of
IL-12 and IL-6 determined by ELISA. CpG ODN markedly enhanced
production of IL-12 by dendritic cells, particularly those pulsed
with the Id/GM-CSF fusion protein.
[0034] FIG. 8 shows FACS charts demonstrating that ICAM-1 and MHC
II expression of dendritic cells in response to GM-CSF and CpG.
Dendritic precursor cells were incubated for 48 hours in the
presence of GM-CSF (800 U/ml) and 2006 (CpG phosphorothioate; 6
.mu.g/ml).
[0035] Expression of ICAM-1 (CD54) and MHC II was examined by flow
cytometry (2500 viable cells are counted in each sample).
[0036] FIG. 9 is several graphs depicting induction of
co-stimulatory molecule expression on dendritic cells by CpG.
Dendritic precursor cells were incubated for 48 hours in the
presence of GM-CSF (800 U/ml) and oligonucleotides (2006: CpG
phosphorothioate, 6 .mu.g/ml) as indicated. Expression of CD54
(ICAM-1) (panel A), CD86 (B7-2) (panel B) and CD40 (panel C) was
quantified by flow cytometry (MFI, mean fluorescence intensity).
The combination of GM-CSF and 2006 shows synergy for increasing the
expression of CD86 and CD40, while the effect on CD54 was additive.
Results represent the mean of 5 independent experiments (CD54 and
CD86) and 4 experiments (CD40). Statistical significance of the
increase compared to the cell only sample is indicated by *
(p<0.05). Statistical evaluation is performed by the unpaired
t-test, error bars indicate SEM.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The invention relates to methods and products for
stimulating an immune response in a subject. It was discovered
according to the invention that synergistic responses to
combinations of immunopotentiating compounds could be achieved.
These synergistic effects were observed in vitro, in vivo and ex
vivo. A synergistic increase in survival rate was even observed in
animals having an established tumor. The method is performed by
administering to the subject who has been exposed to an antigen an
effective amount for inducing a synergistic antigen specific immune
response of an immunopotentiating cytokine and an immunostimulatory
CpG oligonucleotide.
[0038] The finding is based on the discovery that when an
immunostimulatory CpG oligonucleotide is administered to a subject
in combination with an immunopotentiating cytokine the resultant
immune response is synergistic. Both CpG oligonucleotides and
immunopotentiating cytokines have the ability to produce immune
responses on their own when administered to a subject. When the
combination of the two is administered together, however, the
quantity and type of immune response shifts. For instance, when the
CpG oligonucleotide and immunopotentiating cytokine are
administered in conjunction with an antigen using repeat
immunizations, as shown in FIG. 3, a synergistic induction in
antigen specific IgG is observed. Additionally, when CpG and GM-CSF
are administered together an antibody response develops that
includes both IgG2a (indicative of a Th1 immune response) and IgG1
(indicative of a Th2 immune response) whereas when GM-CSF is
administered alone IgG2a antibodies are undetectable or low
depending on the strain of the animal.
[0039] Amazingly, the combination of a CpG oligonucleotide and
immunopotentiating cytokine has a dramatic effect on the survival
rate of animals injected with a tumor, even when administered
several days after tumor inoculation. The finding was remarkable
because it demonstrated that the combination of drugs was able to
eliminate an established tumor. Typical prior art immunization
strategies generally are performed prior to inoculation to prevent
the establishment of a tumor. When mice were injected with a tumor
and not provided with any subsequent tumor therapy the survival
rate was 0%. Mice treated with CpG oligonucleotide alone or GM-CSF
and antigen had survival rates of 0 and 30% respectively. The
combination of CpG oligonucleotide and GM-CSF produced a dramatic
survival rate of 70%. This finding has serious implications for the
treatment of established tumors as well as for the prevention of
tumor development.
[0040] The invention in one aspect is a method for stimulating an
immune response in a subject. The method is performed by
administering to the subject who has been exposed to an antigen an
effective amount for inducing a synergistic antigen specific immune
response of an immunopotentiating cytokine and an immunostimulatory
CpG oligonucleotide. The immunostimulatory CpG oligonucleotide has
a sequence including at least the following formula:
6 5' X.sub.1CGX.sub.2 3'
[0041] wherein the oligonucleotide includes at least 8 nucleotides
wherein C and G are unmethylated and wherein X.sub.1 and X.sub.2
are nucleotides.
[0042] An "antigen" as used herein is a molecule capable of
provoking an immune response. Antigens include but are not limited
to cells, cell extracts, polysaccharides, polysaccharide
conjugates, lipids, glycolipids, carbohydrate, peptides, proteins,
viruses, and viral extracts. The term antigen broadly includes any
type of molecule which is recognized by a host immune system as
being foreign. Antigens include but are not limited to cancer
antigens, microbial antigens, and allergens.
[0043] The methods of the invention are useful for treating cancer
by stimulating an antigen specific immune response against a cancer
antigen. A "cancer antigen" as used herein is a compound, such as a
peptide, associated with a tumor or cancer cell surface and which
is capable of provoking an immune response when expressed on the
surface of an antigen presenting cell in the context of an MHC
molecule. Cancer antigens can be prepared from cancer cells either
by preparing crude extracts of cancer cells, for example, as
described in Cohen, et al., 1994, Cancer Research, 54:1055, by
partially purifying the antigens, by recombinant technology, or by
de novo synthesis of known antigens. Cancer antigens include
antigens that are immunogenic portions of or are a whole tumor or
cancer. Such antigens can be isolated or prepared recombinately or
by any other means known in the art. Cancers or tumors include but
are not limited to biliary tract cancer; brain cancer; breast
cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial
cancer; esophageal cancer; gastric cancer; intraepithelial
neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell
and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian
cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas;
skin cancer; testicular cancer; thyroid cancer; and renal cancer,
as well as other carcinomas and sarcomas.
[0044] Tumors are antigenic and can be sensitive to immunological
destruction. The term "tumor" is usually equated with neoplasm,
which literally means "new growth" and is used interchangeably with
"cancer." A "neoplastic disorder" is any disorder associated with
cell proliferation, specifically with a neoplasm. A "neoplasm" is
an abnormal mass of tissue that persists and proliferates after
withdrawal of the carcinogenic factor that initiated its
appearance. There are two types of neoplasms, benign and malignant.
Nearly all benign tumors are encapsulated and are noninvasive; in
contrast, malignant tumors are almost never encapsulated but invade
adjacent tissue by infiltrative destructive growth. This
infiltrative growth can be followed by tumor cells implanting at
sites discontinuous with the original tumor. The method of the
invention can be used to treat neoplastic disorders in humans,
including but not limited to: sarcoma, carcinoma, fibroma,
lymphoma, melanoma, neuroblastoma, retinoblastoma, and glioma as
well as each of the other tumors described herein.
[0045] The invention can also be used to treat cancer and tumors in
non human subjects. Cancer is one of the leading causes of death in
companion animals (i.e., cats and dogs). Cancer usually strikes
older animals which, in the case of house pets, have become
integrated into the family. Forty-five % of dogs older than 10
years of age, are likely to succomb to the disease. The most common
treatment options include surgery, chemotherapy and radiation
therapy. Others treatment modalities which have been used with some
success are laser therapy, cryotherapy, hyperthermia and
immunotherapy. The choice of treatment depends on type of cancer
and degree of dissemination. Unless the malignant growth is
confined to a discrete area in the body, it is difficult to remove
only malignant tissue without also affecting normal cells.
[0046] Malignant disorders commonly diagnosed in dogs and cats
include but are not limited to lymphosarcoma, osteosarcoma, mammary
tumors, mastocytoma, brain tumor, melanoma, adenosquamous
carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar
adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma,
neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma,
Wilms tumor, Burkitt's lymphoma, microglioma, neuroblastoma,
osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
rhabdomyosarcoma. Other neoplasias in dogs include genital squamous
cell carcinoma, transmissable veneral tumor, testicular tumor,
seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma,
chloroma (granulocytic sarcoma), corneal papilloma, corneal
squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma,
basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma,
oral papilloniatosis, hemangioendothelioma and cystadenoma.
Additional malignancies diagnosed in cats include follicular
lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary
squamous cell carcinoma. The ferret, an ever-more popular house pet
is known to develop insulinoma, lymphoma, sarcoma, neuroma,
pancreatic islet cell tumor, gastric MALT lymphoma and gastric
adenocarcinoma.
[0047] Neoplasias affecting agricultural livestock include
leukemia, hemangiopericytoma and bovine ocular neoplasia (in
cattle); preputial fibrosarcoma, ulcerative squamous cell
carcinoma, preputial carcinoma, connective tissue neoplasia and
mastocytoma (in horses); hepatocellular carcinoma (in swine);
lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma,
lymphoma, Rous sarcoma, reticulendotheliosis, fibrosarcoma,
nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian
species); retinoblastoma, hepatic neoplasia, lymphosarcoma
(lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder
sarcoma (in fish), caseous lumphadenitis (CLA): chronic,
infectious, contagious disease of sheep and goats caused by the
bacterium Corynebacterium pseudotuberculosis, and contagious lung
tumor of sheep caused by jaagsiekte.
[0048] CpG oligonucleotide can be useful in activating B cells, NK
cells, and antigen-presenting cells, such as monocytes and
macrophages. CpG oligonucleotide enhances antibody dependent
cellular cytotoxicity and can be used as an adjuvant in conjunction
with tumor antigen to protect against a tumor challenge
(Wooldridge, J. E., et al., 1987, supra; Weiner, G. J., et al.,
Proc Natl Acad Sci USA 94:10833-10837, 1997). This invention is
based on the finding that CpG oligonucleotide and an
immunopotentiating cytokine act synergistically in order to produce
an immune response against a tumor, such that the effect of CpG
oligonucleotide and the immunopotentiating agent is greater than
the sum of the individual effects of either CPG oligonucleotide or
the immunopotentiating agent.
[0049] In the method of the invention, CpG oligonucleotide are used
with an immunopotentiating cytokine. "Immunopotentiating cytokines"
are those molecules and compounds which stimulate the humoral
and/or cellular immune response. The term "cytokine" is used as a
generic name for a diverse group of soluble proteins and peptides
which act as humoral regulators at nano- to picomolar
concentrations and which, either under normal or pathological
conditions, modulate the functional activities of individual cells
and tissues. These proteins also mediate interactions between cells
directly and regulate processes taking place in the extracellular
environment. Examples of cytokines include, but are not limited to
IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15,
granulocyte-macrophage colony stimulating factor (G-MCSF),
granulocyte colony stimulating factor (GCSF), interferon-.gamma.
(.gamma.-INF), tumor necrosis factor (TNF), TGF-.beta., FLT-3
ligand, and CD40 ligand.
[0050] FLT3 ligand is a class of compounds described in EP0627487A2
and WO94/28391. A human FLT3 ligand cDNA was deposited with the
American Tissue Type Culture Collection, Rockville, Md., and
assigned accession number ATCC 69382. Interleukins (Ils) have been
described extensively in the art, e.g., Mosley, et al., 1989, Cell,
59:335, Idzerda, et al., 1990, J Exp. Med., 171:861. GM-CSF is
commercially available as sargramostine, leukine (Immunex).
[0051] Cytokines play a role in directing the T cell response.
Helper (CD4+) T cells orchestrate the immune response of mammals
through production of soluble factors that act on other immune
system cells, including other T cells. Most mature CD4+ T helper
cells express one of two cytokine profiles: Th1 or Th2. Th1 cells
express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low
levels of TNF-.alpha.. The TH1 subset promotes delayed-type
hypersensitivity, cell-mediated immunity, and immunoglobulin class
switching to IgG.sub.2a. The Th2 subset induces humoral immunity by
activating B cells, promoting antibody production, and inducing
class switching to IgG.sub.1 and IgE.
[0052] Tumors can express "tumor-specific antigens" which are
antigens that can potentially stimulate apparently tumor-specific
immune responses. These antigens can be encoded by normal genes and
fall into several categories (1) normally silent genes, (2)
differentiation antigens (3) embryonic and fetal antigens, and (4)
clonal antigens, which are expressed only on a few normal cells
such as the cells from which the tumor originated. Tumor-specific
antigens can be encoded by mutant cellular genes, such as oncogenes
(e.g., activated ras oncogene), suppressor genes (e.g., mutant
p53), fusion proteins resulting from internal deletions or
chromosomal translocations. Tumor-specific antigens can also be
encoded by viral genes, such as RNA or DNA tumor viruses.
[0053] In the treatment of lymphoma, the idiotype of the secreted
immunoglobulin serves as a highly specific tumor associated
antigen. By "idiotype" is meant the collection of V-region
determinants specific to a specific antibody or a limited set of
antibodies. In one embodiment, the immunopotentiating cytokine is a
protein (a fusion protein) consisting of a specific antigen
idiotype secreted by a lymphoma fused to the immunopotentiating
cytokine. Methods of producing antigen-cytokine fusion proteins are
well known in the art (e.g., Tao, M. H., Levy, R., Nature
362:755-758, 1993). In one embodiment, the fusion protein is an
antigen-GM-CSF fusion protein.
[0054] The methods of the invention are also useful for treating
infectious diseases. An infectious disease, as used herein, is a
disease arising from the presence of a foreign microorganism in the
body. CpG and immunopotentiating cytokine are used to stimulate an
antigen specific immune response which can activate a T or B cell
response against an antigen of the microorganism. The methods are
accomplished in the same way as described above for the tumor
except that the antigen is specific for a microorganism using a
microbial antigen. A "microbial antigen" as used herein is an
antigen of a microorganism and includes but is not limited to
infectious virus, infectious bacteria, and infectious fungi. Such
antigens include the intact microorganism as well as natural
isolates and fragments or derivatives thereof and also synthetic
compounds which are identical to or similar to natural
microorganism antigens and induce an immune response specific for
that microorganism. A compound is similar to a natural
microorganism antigen if it induces an immune response (humoral
and/or cellular) to a natural microorganism antigen. Such antigens
are used routinely in the art and are well known to those of
ordinary skill in the art.
[0055] Examples of infectious virus that have been found in humans
include but are not limited to: Retroviridae (e.g. human
immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxyiridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and
related viruses, and astroviruses).
[0056] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to: Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M avium, M intracellulare, M. kansaii, M. gordonae),
Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter vp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
and Actinomyces israelli.
[0057] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
such as Plasmodium falciparum, Plasmodium malariae, Plasmodium
ovale, and Plasmodium vivax and Toxoplasma gondii.
[0058] Other medically relevant microorganisms have been descried
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0059] The methods of the invention are also useful for treating
allergic diseases. The methods are accomplished in the same way as
described above for the tumor immunotherapy and treatment of
infectious diseases except that the antigen is specific for an
allergen. Currently, allergic diseases are generally treated by the
injection of small doses of antigen followed by subsequent
increasing dosage of antigen. It is believed that this procedure.
produces a memory immune response to prevent further allergic
reactions. These methods, however, are associated with the risk of
side effects such as an allergic response. The methods of the
invention avoid these problems.
[0060] An "allergen" refers to a substance (antigen) that can
induce an allergic or asthmatic response in a susceptible subject.
The list of allergens is enormous and can include pollens, insect
venoms, animal dander dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cuprevsus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis).
[0061] An "allergy" refers to acquired hypersensitivity to a
substance (allergen). Allergic conditions include but are not
limited to eczema, allergic rhinitis or coryza, hay fever,
bronchial asthma, urticaria (hives) and food allergies, and other
atopic conditions. A subject having an allergic reaction is a
subject that has or is at risk of developing an allergy.
[0062] Allergies are generally caused by IgE antibody generation
against harmless allergens. The cytokines that are induced by
unmethylated CpG oligonucleotides are predominantly of a class
called "Th1" which is most marked by a cellular immune response and
is associated with IL-12 and IFN-.gamma. and production of IgG2a
antibody. The other major type of immune response is termed as Th2
immune response, which is associated with more of an IgG1 antibody
immune response and with the production of IL-4, IL-5 and IL-10. In
general, it appears that allergic diseases are mediated by Th2 type
immune responses and autoimmune diseases by Th1 immune response.
Based on the ability of the combination of CpG oligonucleotides and
immunopotentiating cytokine to shift the immune response in a
subject from a Th2 (which is associated with production of IgE
antibodies and allergy and is produced in response to GM-CSF alone)
to a Th1 response (which is protective against allergic reactions),
an effective dose of a CpG oligonucleotide and immunopotentiating
cytokine can be administered to a subject to treat or prevent an
allergy.
[0063] CpG oligonucleotides combined with immunopotentiating
cytokines may also have significant therapeutic utility in the
treatment of asthma. Th2 cytokines, especially IL-4 and IL-5 are
elevated in the airways of asthmatic subjects. These cytokines
promote important aspects of the asthmatic inflammatory response,
including IgE isotope switching, eosinophil chemotaxis and
activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines. "Asthma" refers to a disorder of the
respiratory system characterized by inflammation, narrowing of the
airways and increased reactivity of the airways to inhaled agents.
Asthma is frequently, although not exclusively associated with
atopic or allergic symptoms.
[0064] As described in co-pending patent application U.S. Ser. No.
08/960,774, oligonucleotides containing an unmethylated CpG motif
(i.e. TCCATGACGTTCCTGACGTT; SEQ ID NO: 93), but not a control
oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO: 103) prevented
the development of an inflammatory cellular infiltrate and
eosinophilia in a murine model of asthma. Furthermore, the
suppression of eosinophilic inflammation was associated with a
suppression of Th2 response and induction of a Th1 response.
[0065] A "subject" shall mean a human or vertebrate animal
including but not limited to a dog, cat, horse, cow, pig, sheep,
goat, chicken, primate, e.g., monkey, fish (aquaculture species),
e.g. salmon, rat, and mouse.
[0066] Although many of the disorders described above relate to
human disorders, the invention is also useful for treating other
nonhuman vertebrates. Nonhuman vertebrates are also capable of
developing cancer, infections, allergies, and asthma. For instance,
in addition to the treatment of infectious human diseases, the
methods of the invention are useful for treating infections of
animals.
[0067] As used herein, the term "treat", "treated", or "treating"
when used with respect to an infectious disease refers to a
prophylactic treatment which increases the resistance of a subject
to infection with a pathogen or, in other words, decreases the
likelihood that the subject will become infected with the pathogen
as well as a treatment after the subject has become infected in
order to fight the infection, e.g., reduce or eliminate the
infection or prevent it from becoming worse. Many vaccines for the
treatment of non-human vertebrates are disclosed in Bennett, K.
Compendium of Veterinary Products, 3rd ed. North American
Compendiums, Inc., 1995.
[0068] Thus the present invention contemplates the use of CpG
oligonucleotides and immunopotentiating cytokines to induce an
antigen specific immune response in human and non-human animals. As
discussed above, antigens include infectious microbes such as
virus, bacteria and fungi and fragments thereof, derived from
natural sources or synthetically. Infectious virus of both human
and non-human vertebrates, include retroviruses, RNA viruses and
DNA viruses. This group of retroviruses includes both simple
retroviruses and complex retroviruses. The simple retroviruses
include the subgroups of B-type retroviruses, C-type retroviruses
and D-type retroviruses. An example of a B-type retrovirus is mouse
mammary tumor virus (MMTV). The C-type retroviruses include
subgroups C-type group A (including Rous sarcoma virus (RSV), avian
leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and
C-type group B (including murine leukemia virus (MLV), feline
leukemia virus (FeLV), murine sarcoma virus (MSV), gibbon ape
leukemia virus (GALV), spleen necrosis virus (SNV),
reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)).
The D-type retroviruses include Mason-Pfizer monkey virus (MPMV)
and simian retrovirus type 1 (SRV-1). The complex retroviruses
include the subgroups of lentiviruses, T-cell leukemia viruses and
the foamy viruses. Lentiviruses include HIV-1, but also include
HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and
equine infectious anemia virus (EIAV). The T-cell leukemia viruses
include HTLV-1, HTLV-II, simian T-cell leukemia virus (STLV), and
bovine leukemia virus (BLV). The foamy viruses include human foamy
virus (HFV), simian foamy virus (SFV) and bovine foamy virus
(BFV).
[0069] Examples of other RNA viruses that are antigens in
vertebrate animals include, but are not limited to, the following:
members of the family Reoviridae, including the genus Orthoreovirus
(multiple serotypes of both mammalian and avian retroviruses), the
genus Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo
virus, African horse sickness virus, and Colorado Tick Fever
virus), the genus Rotavirus (human rotavirus, Nebraska calf
diarrhea virus, murine rotavirus, simian rotavirus, bovine or ovine
rotavirus, avian rotavirus); the family Picornaviridae, including
the genus Enterovirus (poliovirus, Coxsackie virus A and B, enteric
cytopathic human orphan (ECHO) viruses, hepatitis A virus, Simian
enteroviruses, Murine encephalomyelitis (ME) viruses, Poliovirus
muris, Bovine enteroviruses, Porcine enteroviruses, the genus
Cardiovirus (Encephalomyocarditis virus (EMC), Mengovirus), the
genus Rhinovirus (Human rhinoviruses including at least 113
subtypes; other rhinoviruses), the genus Apthovirus (Foot and Mouth
disease (FMDV); the family Calciviridae, including Vesicular
exanthema of swine virus, San Miguel sea lion virus, Feline
picornavirus and Norwalk virus; the family Togaviridae, including
the genus Alphavirus (Eastern equine encephalitis virus, Semliki
forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong
virus, Ross river virus, Venezuelan equine encephalitis virus,
Western equine encephalitis virus), the genus Flavirius (Mosquito
borne yellow fever virus, Dengue virus, Japanese encephalitis
virus, St. Louis encephalitis virus, Murray Valley encephalitis
virus, West Nile virus, Kunjin virus, Central European tick borne
virus, Far Eastern tick borne virus, Kyasanur forest virus, Louping
III virus, Powassan virus, Omsk hemorrhagic fever virus), the genus
Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease
virus, Hog cholera virus, Border disease virus); the family
Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related
viruses, California encephalitis group viruses), the genus
Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever
virus), the genus Nairovirus (Crimean-Congo hemorrhagic fever
virus, Nairobi sheep disease virus), and the genus Uukuvirus
(Uukuniemi and related viruses); the family Orthomyxoviridae,
including the genus Influenza virus (Influenza virus type A, many
human subtypes); Swine influenza virus, and Avian and Equine
Influenza viruses; influenza type B (many human subtypes), and
influenza type C (possible separate genus); the family
paramyxoviridae, including the genus Paramyxovirus (Parainfluenza
virus type 1, Sendai virus, Hemadsorption virus, Parainfluenza
viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the
genus Morbillivirus (Measles virus, subacute sclerosing
panencephalitis virus, distemper virus, Rinderpest virus), the
genus Pneumovirus (respiratory syncytial virus (RSV), Bovine
respiratory syncytial virus and Pneumonia virus of mice); forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavirius (Mosquito borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine Influenza viruses;
influenza type B (many human subtypes), and influenza type C
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus
of mice); the family Rhabdoviridae, including the genus
Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park virus),
the genus Lyssavirus (Rabies virus), fish Rhabdoviruses, and two
probable Rhabdoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Mouse Hepatitis virus,
Human enteric corona virus, and Feline infectious peritonitis
(Feline coronavirus).
[0070] Illustrative DNA viruses that are antigens in vertebrate
animals include, but are not limited to: the family Poxyiridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus. Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox,
goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Iridoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine, monkeys and rodents); the
gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A,B,C,D,E and ungrouped; simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses; the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
as Lymphotrophic papilloma virus); the family Parvoviridae
including the genus Adeno-associated viruses, the genus Parvovirus
(Feline panleukopenia virus, bovine parvovirus, canine parvovirus,
Aleutian mink disease virus, etc). Finally, DNA viruses may include
viruses which do not fit into the above families such as Kuru and
Creutzfeldt-Jacob disease viruses and chronic infectious
neuropathic agents (CHINA virus).
[0071] Each of the foregoing lists is illustrative, and is not
intended to be limiting.
[0072] In addition to the use of the combination of CpG
oligonucleotides and immunopotentiating cytokines to induce an
antigen specific immune response in humans, the methods of the
preferred embodiments are particularly well suited for treatment of
birds such as hens, chickens, turkeys, ducks, geese, quail, and
pheasant. Birds are prime targets for many types of infections.
[0073] Hatching birds are exposed to pathogenic microorganisms
shortly after birth. Although these birds are initially protected
against pathogens by maternal derived antibodies, this protection
is only temporary, and the bird's own immature immune system must
begin to protect the bird against the pathogens. It is often
desirable to prevent infection in young birds when they are most
susceptible. It is also desirable to prevent against infection in
older birds, especially when the birds are housed in closed
quarters, leading to the rapid spread of disease. Thus, it is
desirable to administer the CpG oligonucleotide and the
immunopotentiating cytokine of the invention to birds to enhance an
antigen-specific immune response when antigen is present.
[0074] An example of a common infection in chickens is chicken
infectious anemia virus (CIAV). CIAV was first isolated in Japan in
1979 during an investigation of a Marek's disease vaccination break
(Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV
has been detected in commercial poultry in all major poultry
producing countries (van Bulow et al., 1991, pp. 690-699) in
Diseases of Poultry, 9th edition, Iowa State University Press).
[0075] CIAV infection results in a clinical disease, characterized
by anemia, hemorrhage and immunosuppression, in young susceptible
chickens. Atrophy of the thymus and of the bone marrow and
consistent lesions of CIAV-infected chickens are also
characteristic of CIAV infection. Lymphocyte depletion in the
thymus, and occasionally in the bursa of Fabricius, results in
immunosuppression and increased susceptibility to secondary viral,
bacterial, or fungal infections which then complicate the course of
the disease. The immunosuppression may cause aggravated disease
after infection with one or more of Marek's disease virus (MDV),
infectious bursal disease virus, reticuloendotheliosis virus,
adenovirus, or reovirus. It has been reported that pathogenesis of
MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In Proceedings
of the 38th Western Poultry Diseases Conference, Tempe, Ariz.).
Further, it has been reported that CIAV aggravates the signs of
infectious bursal disease (Rosenberger et al., 1989, Avian Dis.
33:707-713). Chickens develop an age resistance to experimentally
induced disease due to CAA. This is essentially complete by the age
of 2 weeks, but older birds are still susceptible to infection
(Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24,
202-209, 1980). However, if chickens are dually infected with CAA
and an immunosuppressive agent (IBDV, MDV etc.) age resistance
against the disease is delayed (Yuasa, N. et al., 1979 and 1980
supra; Bulow von V. et al., J. Veterinary Medicine 33, 93-116,
1986). Characteristics of CIAV that may potentiate disease
transmission include high resistance to environmental inactivation
and some common disinfectants. The economic impact of CIAV
infection on the poultry industry is clear from the fact that 10%
to 30% of infected birds in disease outbreaks die.
[0076] Vaccination of birds, like other vertebrate animals can be
performed at any age. Normally, vaccinations are performed at up to
12 weeks of age for a live microorganism and between 14-18 weeks
for an inactivated microorganism or other type of vaccine. For in
ovo vaccination, vaccination can be performed in the last quarter
of embryo development. The vaccine may be administered
subcutaneously, by spray, orally, intraocularly, intratracheally,
nasally, in ovo or by other methods described herein. Thus, the CpG
oligonucleotide and immunopotentiating cytokine of the invention
can be administered to birds and other non-human vertebrates using
routine vaccination schedules and the antigen is administered after
an appropriate time period as described herein.
[0077] Cattle and livestock are also susceptible to infection.
Disease which affect these animals can produce severe economic
losses, especially amongst cattle. The methods of the invention can
be used to protect against infection in livestock, such as cows,
horses, pigs, sheep, and goats.
[0078] Cows can be infected by bovine viruses. Bovine viral
diarrhea virus (BVDV) is a small enveloped positive-stranded RNA
virus and is classified, along with hog cholera virus (HOCV) and
sheep border disease virus (BDV), in the pestivirus genus.
Although, Pestiviruses were previously classified in the
Togaviridae family, some studies have suggested their
reclassification within the Flaviviridae family along with the
flavivirus and hepatitis C virus (HCV) groups (Francki, et al.,
1991).
[0079] BVDV, which is an important pathogen of cattle can be
distinguished, based on cell culture analysis, into cytopathogenic
(CP) and noncytopathogenic (NCP) biotypes. The NCP biotype is more
widespread although both biotypes can be found in cattle. If a
pregnant cow becomes infected with an NCP strain, the cow can give
birth to a persistently infected and specifically immunotolerant
calf that will spread virus during its lifetime. The persistently
infected cattle can succumb to mucosal disease and both biotypes
can then be isolated from the animal. Clinical manifestations can
include abortion, teratogenesis, and respiratory problems, mucosal
disease and mild diarrhea. In addition, severe thrombocytopenia,
associated with herd epidemics, that may result in the death of the
animal has been described and strains associated with this disease
seem more virulent than the classical BVDVs.
[0080] Equine herpesviruses (EHV) comprise a group of antigenically
distinct biological agents which cause a variety of infections in
horses ranging from subclinical to fatal disease. These include
Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen in horses.
EHV-1 is associated with epidemics of abortion, respiratory tract
disease, and central nervous system disorders. Primary infection of
upper respiratory tract of young horses results in a febrile
illness which lasts for 8 to 10 days. Immunologically experienced
mares may be reinfected via the respiratory tract without disease
becoming apparent, so that abortion usually occurs without warning.
The neurological syndrome is associated with respiratory disease or
abortion and can affect animals of either sex at any age, leading
to incoordination, weakness and posterior paralysis (Telford, E. A.
R. et al., Virology 189, 304-316, 1992). Other EHV's include EHV-2,
or equine cytomegalovirus, EHV-3, equine coital exanthema virus,
and EHV-4, previously classified as EHV-1 subtype 2.
[0081] Sheep and goats can be infected by a variety of dangerous
microorganisms including visna-maedi.
[0082] Primates such as monkeys, apes and macaques can be infected
by simian immunodeficiency virus. Inactivated cell-virus and
cell-free whole simian immunodeficiency vaccines have been reported
to afford protection in macaques (Stott et al. (1990) Lancet
36:1538-1541; Desrosiers et al. PNAS USA (1989) 86:6353-6357;
Murphey-Corb et al. (1989) Science 246:1293-1297; and Carlson et
al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). A recombinant
HIV gp120 vaccine has been reported to afford protection in
chimpanzees (Berman et al. (1990) Nature 345:622-625).
[0083] Cats, both domestic and wild, are susceptible to infection
with a variety of microorganisms. For instance, feline infectious
peritonitis is a disease which occurs in both domestic and wild
cats, such as lions, leopards, cheetahs, and jaguars. When it is
desirable to prevent infection with this and other types of
pathogenic organisms in cats, the methods of the invention can be
used to vaccinate cats to prevent them against infection.
[0084] Domestic cats may become infected with several retroviruses,
including but not limited to feline leukemia virus (FeLV), feline
sarcoma virus (FeSV), endogenous type C oncornavirus (RD-114), and
feline syncytia-forming virus (FeSFV). Of these, FeLV is the most
significant pathogen, causing diverse symptoms, including
lymphoreticular and myeloid neoplasms, anemias, immune mediated
disorders, and an immunodeficiency syndrome which is similar to
human acquired immune deficiency syndrome (AIDS). Recently, a
particular replication-defective FeLV mutant, designated FeLV-AIDS,
has been more particularly associated with immunosuppressive
properties.
[0085] The discovery of feline T-lymphotropic lentivirus (also
referred to as feline immunodeficiency) was first reported in
Pedersen et al. (1987) Science 235:790-793. Characteristics of FIV
have been reported in Yamamoto et al. (1988) Leukemia, December
Supplement 2:204S-215S; Yamamoto et al. (1988) Am. J. Vet. Res.
49:1246-1258; and Ackley et al. (1990) J. Virol. 64:5652-5655.
Cloning and sequence analysis of FIV have been reported in Olmsted
ct al. (1989) Proc. Natl. Acad. Sci. USA 86:2448-2452 and
86:4355-4360.
[0086] Feline infectious peritonitis (FIP) is a sporadic disease
occurring unpredictably in domestic and wild Felidae. While FIP is
primarily a disease of domestic cats, it has been diagnosed in
lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller
wild cats that have been afflicted with FIP include the lynx and
caracal, sand cat, and pallas cat. In domestic cats, the disease
occurs predominantly in young animals, although cats of all ages
are susceptible. A peak incidence occurs between 6 and 12 months of
age. A decline in incidence is noted from 5 to 13 years of age,
followed by an increased incidence in cats 14 to 15 years old.
[0087] Viral and bacterial diseases in fin-fish, shellfish or other
aquatic life forms pose a serious problem for the aquaculture
industry. Owing to the high density of animals in the hatchery
tanks or enclosed marine farming areas, infectious diseases may
eradicate a large proportion of the stock in, for example, a
fin-fish, shellfish, or other aquatic life forms facility.
Prevention of disease is a more desired remedy to these threats to
fish than intervention once the disease is in progress. Vaccination
of fish is the only preventative method which may offer long-term
protection through immunity. Nucleic acid based vaccinations are
described in U.S. Pat. No. 5,780,448 issued to Davis.
[0088] The fish immune system has many features similar to the
mammalian immune system, such as the presence of B cells, T cells,
lymphokines, complement, and immunoglobulins. Fish have lymphocyte
subclasses with roles that appear similar in many respects to those
of the B and T cells of mammals. Vaccines can be administered
orally or by immersion or injection.
[0089] Aquaculture species include but are not limited to fin-fish,
shellfish, and other aquatic animals. Fin-fish include all
vertebrate fish, which may be bony or cartilaginous fish, such as,
for example, salmonids, carp, catfish, yellowtail, seabream, and
seabass. Salmonids are a family of fin-fish which include trout
(including rainbow trout), salmon, and Arctic char. Examples of
shellfish include, but are not limited to, clams, lobster, shrimp,
crab, and oysters. Other cultured aquatic animals include, but are
not limited to eels, squid, and octopi.
[0090] Polypeptides of viral aquaculture pathogens include but are
not limited to glycoprotein (G) or nucleoprotein (N) of viral
hemorrhagic septicemia virus (VHSV); G or N proteins of infectious
hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural
proteins of infectious pancreatic necrosis virus (IPNV); G protein
of spring viremia of carp (SVC); and a membrane-associated protein,
tegumin or capsid protein or glycoprotein of channel catfish virus
(CCV).
[0091] Polypeptides of bacterial pathogens include but are not
limited to an iron-regulated outer membrane protein, (IROMP), an
outer membrane protein (OMP), and an A-protein of Aeromonis
salmonicida which causes furunculosis, p57 protein of Renibacterium
salmoninarum which causes bacterial kidney disease (BKD), major
surface associated antigen (msa), a surface expressed cytotoxin
(mpr), a surface expressed hemolysin (ish), and a flagellar antigen
of Yersiniosis; an extracellular protein (ECP), an iron-regulated
outer membrane protein (IROMP), and a structural protein of
Pasteurellosis; an OMP and a flagellar protein of Vibrosis
anguillarum and V. ordalii; a flagellar protein, an OMP protein,
aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and
surface antigen of Ichthyophthirius; and a structural and
regulatory protein of Cytophaga columnari; and a structural and
regulatory protein of Rickettsia.
[0092] Polypeptides of a parasitic pathogen include but are not
limited to the surface antigens of Ichthyophthirius.
[0093] The subject is exposed to the antigen. As used herein, the
term "exposed to" refers to either the active step of contacting
the subject with an antigen or the passive exposure of the subject
to the antigen in vivo. Methods for the active exposure of a
subject to an antigen are well-known in the art. In general, an
antigen is administered directly to the subject by any means such
as intravenous, intramuscular, oral, transdermal, mucosal,
intranasal, intratracheal, or subcutaneous administration. The
antigen can be administered systemically or locally. Methods for
administering the antigen and the CpG and immunopotentiating
cytokine are described in more detail below. A subject is passively
exposed to an antigen if an antigen becomes available for exposure
to the immune cells in the body. A subject may be passively exposed
to an antigen, for instance, by entry of a foreign pathogen into
the body or by the development of a tumor cell expressing a foreign
antigen on its surface. When a subject is passively exposed to an
antigen it is preferred that the CpG oligonucleotide is an
oligonucleotide of 8-100 nucleotides in length and/or has a
phosphate modified backbone.
[0094] The methods in which a subject is passively exposed to an
antigen can be particularly dependent on timing of CpG
oligonucleotide and immunopotentiating cytokine administration. For
instance, in a subject at risk of developing a cancer or an
infectious disease or an allergic or asthmatic response, the
subject may be administered the CpG oligonucleotide and
immunopotentiating cytokine on a regular basis when that risk is
greatest, i.e., during allergy season or after exposure to a cancer
causing agent. Additionally the CpG oligonucleotide and
immunopotentiating cytokine may be administered to travelers before
they travel to foreign lands where they are at risk of exposure to
infectious agents. Likewise the CpG oligonucleotide and
immunopotentiating cytokine may be administered to soldiers or
civilians at risk of exposure to biowarfare to induce a systemic
immune response to the antigen when and if the subject is exposed
to it.
[0095] A subject at risk of developing a cancer can also be treated
according to the methods of the invention, by passive or active
exposure to antigen following CpG and immunopotentiating cytokine.
A subject at risk of developing a cancer is one who is who has a
high probability of developing cancer. These subjects include, for
instance, subjects having a genetic abnormality, the presence of
which has been demonstrated to have a correlative relation to a
higher likelihood of developing a cancer and subjects exposed to
cancer causing agents such as tobacco, asbestos, or other chemical
toxins. When a subject at risk of developing a cancer is treated
with CpG and immunopotentiating cytokine on a regular basis, such
as monthly, the subject will be able to recognize and produce an
antigen specific immune response. If a tumor begins to form in the
subject, the subject will develop a specific immune response
against one or more of the tumor antigens. This aspect of the
invention is particularly advantageous when the antigen to which
the subject will be exposed is unknown. For instance, in soldiers
at risk of exposure to biowarfare, it is generally not known what
biological weapon to which the soldier might be exposed.
[0096] The antigen may be delivered to the immune system of a
subject alone or with a carrier. For instance, colloidal dispersion
systems may be used to deliver antigen to the subject. As used
herein, a "colloidal dispersion system" refers to a natural or
synthetic molecule, other than those derived from bacteriological
or viral sources, capable of delivering to and releasing the
antigen in a subject. Colloidal dispersion systems include
macromolecular complexes, nanocapsules, microspheres, beads, and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes. A preferred colloidal system of the
invention is a liposome. Liposomes are artificial membrane vessels
which are useful as a delivery vector in vivo or in vitro. It has
been shown that large unilamellar vessels (LUV), which range in
size from 0.2-4.0.mu. can encapsulate large macromolecules within
the aqueous interior and these macromolecules can be delivered to
cells in a biologically active form (Fraley, et al., Trends
Biochem. Sci., 6:77 (1981)).
[0097] Lipid formulations for transfection are commercially
available from QIAGEN, for example as EFFECTENE.TM. (a
non-liposomal lipid with a special DNA condensing enhancer) and
SUPER-FECT.TM. (a novel acting dendrimeric technology) as well as
Gibco BRL, for example, as LIPOFECTIN.TM. and LIPOFECTACE.TM.,
which are formed of cationic lipids such as N-[1-(2, 3
dioleyloxy)-propyl]-N,N, N-trimethylammonium chloride (DOTMA) and
dimethyl dioctadecylammonium bromide (DDAB). Methods for making
liposomes are well known in the art and have been described in many
publications. Liposomes were described in a review article by
Gregoriadis, G., Trends in Biotechnology 3:235-241 (1985), which is
hereby incorporated by reference.
[0098] It is envisioned that the antigen may be delivered to the
subject in a nucleic acid molecule which encodes for the antigen
such that the antigen must be expressed in vivo. In these
embodiments of the invention the nucleic acids molecule may also
include a CpG dinucleotide within the sequence of the nucleic acid.
But in this case the nucleic acid molecule does not take the place
of the CpG oligonucleotide. The antigen must be administered in
conjunction with a CpG oligonucleotide that is separate from the
nucleic acid molecule. The nucleic acid encoding the antigen is
operatively linked to a gene expression sequence which directs the
expression of the antigen nucleic acid within a cukaryotic cell.
The "gene expression sequence" is any regulatory nucleotide
sequence, such as a promoter sequence or promoter-enhancer
combination, which facilitates the efficient transcription and
translation of the antigen nucleic acid to which it is operatively
linked. The gene expression sequence may, for example, be a
mammalian or viral promoter, such as a constitutive or inducible
promoter. Constitutive mammalian promoters include, but are not
limited to, the promoters for the following genes: hypoxanthine
phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate
kinase, .beta.-actin promoter and other constitutive promoters.
Exemplary viral promoters which function constitutively in
eukaryotic cells include, for example, promoters from the simian
virus, papilloma virus, adenovirus, human immunodeficiency virus
(HIV), rous sarcoma virus, cytomegalovirus, the long terminal
repeats (LTR) of moloney leukemia virus and other retroviruses, and
the thymidine kinase promoter of herpes simplex virus. Other
constitutive promoters are known to those of ordinary skill in the
art. The promoters useful as gene expression sequences of the
invention also include inducible promoters. Inducible promoters are
expressed in the presence of an inducing agent. For example, the
metallothionein promoter is induced to promote transcription and
translation in the presence of certain metal ions. Other inducible
promoters are known to those of ordinary skill in the art.
[0099] In general, the gene expression sequence shall include, as
necessary, 5' non-transcribing and 5' non-translating sequences
involved with the initiation of transcription and translation,
respectively, such as a TATA box, capping sequence, CAAT sequence,
and the like. Especially, such 5' non-transcribing sequences will
include a promoter region which includes a promoter sequence for
transcriptional control of the operably joined antigen nucleic
acid. The gene expression sequences optionally include enhancer
sequences or upstream activator sequences as desired.
[0100] The antigen nucleic acid is operatively linked to the gene
expression sequence. As used herein, the antigen nucleic acid
sequence and the gene expression sequence are said to be "operably
linked" when they are covalently linked in such a way as to place
the expression or transcription and/or translation of the antigen
coding sequence under the influence or control of the gene
expression sequence. Two DNA sequences are said to be operably
linked if induction of a promoter in the 5' gene expression
sequence results in the transcription of the antigen sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the antigen sequence, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a gene expression sequence would be operably linked
to an antigen nucleic acid sequence if the gene expression sequence
were capable of effecting transcription of that antigen nucleic
acid sequence such that the resulting transcript is translated into
the desired protein or polypeptide.
[0101] The antigen nucleic acid of the invention may be delivered
to the immune system alone or in association with a vector. In its
broadest sense, a "vector" is any vehicle capable of facilitating
the transfer of the antigen nucleic acid to the cells of the immune
system and preferably APCs so that the antigen can be expressed and
presented on the surface of an APC. Preferably, the vector
transports the nucleic acid to the immune cells with reduced
degradation relative to the extent of degradation that would result
in the absence of the vector. The vector optionally includes the
above-described gene expression sequence to enhance expression of
the antigen nucleic acid in APCs. In general, the vectors useful in
the invention include, but are not limited to, plasmids, phagemids,
viruses, other vehicles derived from viral or bacterial sources
that have been manipulated by the insertion or incorporation of the
antigen nucleic acid sequences. Viral vectors are a preferred type
of vector and include, but are not limited to nucleic acid
sequences from the following viruses: retrovirus, such as moloney
murine leukemia virus, harvey murine sarcoma virus, murine mammary
tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated
virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses;
papilloma viruses; herpes virus; vaccinia virus; polio virus; and
RNA virus such as a retrovirus. One can readily employ other
vectors not named but known to the art.
[0102] Preferred viral vectors are based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with the gene of interest. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. Retroviruses have been
approved for human gene therapy trials. Most useful are those
retroviruses that are replication-deficient (i.e., capable of
directing synthesis of the desired proteins, but incapable of
manufacturing an infectious particle). Such genetically altered
retroviral expression vectors have general utility for the
high-efficiency transduction of genes in vivo. Standard protocols
for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a
plasmid, transfection of a packaging cell lined with plasmid,
production of recombinant retroviruses by the packaging cell line,
collection of viral particles from tissue culture media, and
infection of the target cells with viral particles) are provided in
Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual,"
W.H. Freeman C.O., N.Y.(1990) and Murry, E. J. Ed. "Methods in
Molecular Biology," vol. 7, Humana Press, Inc., Cliffton,
N.J.(1991).
[0103] A preferred virus for certain applications is the
adeno-associated virus, a double-stranded DNA virus. The
adeno-associated virus can be engineered to be
replication-deficient and is capable of infecting a wide range of
cell types and species. It further has advantages such as, heat and
lipid solvent stability; high transduction frequencies in cells of
diverse lineages, including hemopoietic cells; and lack of
superinfection inhibition thus allowing multiple series of
transductions. Reportedly, the adeno-associated virus can integrate
into human cellular DNA in a site-specific manner, thereby
minimizing the possibility of insertional mutagenesis and
variability of inserted gene expression characteristic of
retroviral infection. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than
100 passages in the absence of selective pressure, implying that
the adeno-associated virus genomic integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
[0104] Other vectors include plasmid vectors. Plasmid vectors have
been extensively described in the art and are well-known to those
of skill in the art. See e.g., Sambrook et al., "Molecular Cloning:
A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory
Press, 1989. In the last few years, plasmid vectors have been found
to be particularly advantageous for delivering genes to cells in
vivo because of their inability to replicate within and integrate
into a host genome. These plasmids, however, having a promoter
compatible with the host cell, can express a peptide from a gene
operatively encoded within the plasmid. Some commonly used plasmids
include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other
plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction
enzymes and ligation reactions to remove and add specific fragments
of DNA.
[0105] It has recently been discovered that gene carrying plasmids
can be delivered to the immune system using bacteria. Modified
forms of bacteria such as Salmonella can be transfected with the
plasmid and used as delivery vehicles. The bacterial delivery
vehicles can be administered to a host subject orally or by other
administration means. The bacteria deliver the plasmid to immune
cells, e.g. dendritic cells, probably by passing through the gut
barrier. High levels of immune protection have been established
using this methodology.
[0106] Thus, the invention contemplates scheduled administration of
CpG oligonucleotides and immunopotentiating cytokine. The
oligonucleotides may be administered to a subject on a weekly or
monthly basis. When a subject is at risk of exposure to an antigen
or antigens the CpG and immunopotentiating cytokine may be
administered on a regular basis to recognize the antigen
immediately upon exposure and produce an antigen specific immune
response. A subject at risk of exposure to an antigen is any
subject who has a high probability of being exposed to an antigen
and of developing an immune response to the antigen. If the antigen
is an allergen and the subject develops allergic responses to that
particular antigen and the subject is exposed to the antigen, i.e.,
during pollen season, then that subject is at risk of exposure to
the antigen.
[0107] The CpG oligonucleotides of the invention are nucleic acid
molecules which contain an unmethylated cytosine-guanine
dinucleotide sequence (i.e. "CpG DNA" or DNA containing a 5'
cytosine followed by 3' guanosine and linked by a phosphate bond)
and activate the immune system. The CpG oligonucleotides can be
double-stranded or single-stranded. Generally, double-stranded
molecules are more stable in vivo, while single-stranded molecules
have increased immune activity.
[0108] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acid molecules can
be obtained from existing nucleic acid sources (e.g. genomic or
cDNA), but are preferably synthetic (e.g. produced by
oligonucleotide synthesis). The entire CpG "oligonucleotide can be
unmethylated or portions may be unmethylated but at least the C of
the 5'.CG 3' must be unmethylated.
[0109] In one preferred embodiment the invention provides a CpG
oligonucleotide represented by at least the formula:
7 5'N.sub.1X.sub.1CGX.sub.2N.sub.23'
[0110] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1 is adenine, guanine, or thymine; X.sub.2 is cytosine,
adenine, or thymine; N is any nucleotide and N.sub.1 and N.sub.2
are nucleic acid sequences composed of from about 0-25 N's
each.
[0111] In another embodiment the invention provides an isolated CpG
oligonucleotide represented by at least the formula:
8 5'N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.23'
[0112] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1X.sub.2 is selected from the group consisting of GpT, GpA,
ApA, GpG and ApT; X.sub.3X.sub.4 is selected from the group
consisting of TpT, CpT, TpC, CpC, and ApT; N is any nucleotide and
N.sub.1 and N.sub.2 are nucleic acid sequences composed of from
about 0-25 N's each. In a preferred embodiment N.sub.1 and N.sub.2
of the nucleic acid do not contain a CCGG quadmer or more than one
CCG or CGG trimer. In another preferred embodiment the CpG
oligonucleotide has the sequence
5'TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub.43'.
[0113] Preferably the CpG oligonucleotides of the invention include
X.sub.1X.sub.2 selected from the group consisting of GpT, GpG, GpA
and ApA and X.sub.3X.sub.4 is selected from the group consisting of
TpT, CpT and GpT. For facilitating uptake into cells, CpG
containing oligonucleotides are preferably in the range of 8 to 30
bases in length. However, nucleic acids of any size greater than 8
nucleotides (even many kb long) are capable of inducing an immune
response according to the invention if sufficient immunostimulatory
motifs are present, since larger nucleic acids are degraded into
oligonucleotides inside of cells. Preferred synthetic
oligonucleotides do not include a CCGG quadmer or more than one CCG
or CGG trimer at or near the 5' and/or 3' terminals. Stabilized
oligonucleotides, where the oligonucleotide incorporates a
phosphate backbone modification, as discussed in more detail below
are also preferred. The modification may be, for example, a
phosphorothioate or phosphorodithioate modification. Preferably,
the phosphate backbone modification occurs at the 5' end of the
nucleic acid for example, at the first two nucleotides of the 5'
end of the oligonucleotide. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid. Alternatively the oligonucleotide may be completely or
partially modified.
[0114] Preferably the CpG oligonucleotide is in the range of
between 8 and 100 and more preferably between 8 and 30 nucleotides
in size. Alternatively, CpG oligonucleotides can be produced on a
large scale in plasmids and degraded into oligonucleotides.
[0115] The CpG oligonucleotide and immunopotentiating cytokine may
be directly administered to the subject or may be administered in
conjunction with a nucleic acid delivery complex. A "nucleic
acid/cytokine delivery complex" shall mean a nucleic acid molecule
and/or cytokine associated with (e.g. ionically or covalently bound
to; or encapsulated within) a targeting means (e.g. a molecule that
results in higher affinity binding to target cell (e.g. dendritic
cell surfaces and/or increased cellular uptake by target cells).
Examples of nucleic acid/cytokine delivery complexes include
nucleic acids/cytokines associated with: a sterol (e.g.
cholesterol), a lipid (e.g. a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g. a ligand
recognized by target cell specific receptor). Preferred complexes
should be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex should be cleavable under appropriate conditions within
the cell so that the nucleic acid/cytokine is released in a
functional form.
[0116] "Palindromic sequence" shall mean an inverted repeat (i.e. a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double-stranded structures. In one embodiment
the CpG oligonucleotide contains a palindromic sequence. A
palindromic sequence used in this context refers to a palindrome in
which the CpG is part of the palindrome, and preferably is the
center of the palindrome. In another embodiment the CpG
oligonucleotide is free of a palindrome. A CpG oligonucleotide that
is free of a palindrome is one in which the CpG dinucleotide is not
part of a palindrome. Such an oligonucleotide may include a
palindrome in which the CpG is not part of the palindrome.
[0117] A "stabilized nucleic acid molecule" shall mean a nucleic
acid molecule that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease). Stabilization can be a
function of length or secondary structure. Unmethylated CpG
oligonucleotides that are tens to hundreds of kbs long are
relatively resistant to in vivo degradation. For shorter CpG
oligonucleotides, secondary structure can stabilize and increase
their effect. For example, if the 3' end of an oligonucleotide has
self-complementarity to an upstream region, so that it can fold
back and form a sort of stem loop structure, then the
oligonucleotide becomes stabilized and therefore exhibits more
activity.
[0118] Preferred stabilized oligonucleotides of the instant
invention have a modified backbone. It has been demonstrated that
modification of the oligonucleotide backbone provides enhanced
activity of the CpG oligonucleotides when administered in vivo. CpG
constructs, including at least two phosphorothioate linkages at the
5' end of the oligonucleotide in multiple phosphorothioate linkages
at the 3' end, preferably 5, provides maximal activity and
protected the oligonucleotide from degradation by intracellular
exo- and endo-nucleases. Other modified oligonucleotides include
phosphodiester modified oligonucleotide, combinations of
phosphodiester and phosphorothioate oligonucleotide,
methylphosphonate, methylphosphorothioate, phosphorodithioate, and
combinations thereof. Each of these combinations and their
particular effects on immune cells is discussed in more detail in
copending PCT Published Patent Applications claiming priority to
U.S. Ser. Nos. 08/738,652 and 08/960,774, filed on Oct. 30, 1996
and Oct. 30, 1997 respectively, the entire contents of which is
hereby incorporated by reference. It is believed that these
modified oligonucleotides may show more stimulatory activity due to
enhanced nuclease resistance, increased cellular uptake, increased
protein binding, and/or altered intracellular localization.
[0119] Both phosphorothioate and phosphodiester oligonucleotides
containing CpG motifs are active in APCs such as dendritic cells.
However, based on the concentration needed to induce CpG specific
effects, the nuclease resistant phosphorothioate backbone CpG
oligonucleotides are more potent (2 .mu.g/ml for the
phosphorothioate vs. a total of 90 .mu.g/ml for
phosphodiester).
[0120] Other stabilized oligonucleotides include: nonionic DNA
analogs, such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Oligonucleotides which contain diol,
such as tetraethyleneglycol or hexaethyleneglycol, at either or
both termini have also been shown to be substantially resistant to
nuclease degradation.
[0121] The nucleic acid sequences of the invention which are useful
for inducing immune remodeling are those broadly described above
and dislcosed in PCT Published Patent Applications claiming
priority to U.S. Ser. Nos. 08/738,652 and 08/960,774, filed on Oct.
30, 1996 and Oct. 30, 1997 respectively. Exemplary sequences
include but are not limited to those immunostimulatory sequences
shown in Table 1 as well as
9 TCCATGTCGCTCCTGATGCT, (SEQ ID NO: 47) TCCATGTCGTTCCTGATGCT, (SEQ
ID NO: 48) TCGTCGTTTTGTCGTTTTGTCGTT, (SEQ ID NO: 53)
TCGTCGTTGTCGTTGTCGTT; (SEQ ID NO: 89) TCGTCGTTTTGTCGTTTTGTCGTT,
(SEQ ID NO: 90) TCGTCGTTGTCGTTTTGTCGTT, (SEQ ID NO: 91)
GCGTGCGTTGTCGTTGTCGTT, (SEQ ID NO: 92) TGTCGTTTGTCGTTTGTCGTT, (SEQ
ID NO: 94) TGTCGTTGTCGTTGTGGTT (SEQ ID NO: 96) TCGTCGTCGTCGTT, (SEQ
ID NO: 97) TCCTGTCGTTCCTTGTCGTT, (SEQ ID NO: 79)
TCCTGTCGTTTTTTGTCGTT, (SEQ ID NO: 81) TCGTCGCTGTCTGCCCTTCTT, (SEQ
ID NO: 82) TCGTCGCTGTTGTCGTTTCTT, (SEQ ID NO: 83)
TCGTCGTTTTGTCGTTTTGTCGTT, (SEQ ID NO: 90) TCGTCGTTGTCGTTTTGTCGTT
(SEQ ID NO: 91) TGTCGTTGTCGTTGTCGTT, (SEQ ID NO: 96)
TCCATGACGTTCCTGACGTT, (SEQ ID NO: 100) GTCG(T/C)T (SEQ ID NO: 101)
and TGTCG(T/C)T. (SEQ ID NO: 102)
[0122] The stimulation index of a particular immunostimulatory CpG
DNA can be tested in various immune cell assays. Preferably, the
stimulation index of the immunostimulatory CpG DNA with regard to B
cell proliferation is at least about 5, preferably at least about
10, more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with 20 .mu.M of
oligonucleotide for 20 h at 37.degree. C. and has been pulsed with
1 .mu.Ci of .sup.3H uridine; and harvested and counted 4 h later as
described in detail in copending PCT Patent Application U.S. Ser.
No. 08/960,774. For use in vivo, for example, to treat an immune
system deficiency by stimulating a cell-mediated (local) immune
response in a subject, it is important that the immunostimulatory
CpG DNA be capable of effectively inducing cytokine secretion by
APCs such as dendritic cells.
[0123] Preferred immunostimulatory CpG nucleic acids should effect
at least about 500 pg/ml of TNF-.alpha., 15 pg/ml IFN-.gamma., 70
pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on
the therapeutic indication, as determined by the assays described
in the Examples. Other preferred immunostimulatory CpG DNAs should
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30, more preferably at least about 35 and most
preferably at least about 40% 2C11 cell specific lysis. When
administered in conjunction with an immunopotentiating cytokine the
amounts of both the CpG oligonucleotide and the cytokine required
to produce a desired immune response will be less.
[0124] Preferably, the stimulation index of the CpG oligonucleotide
with regard to B cell proliferation is at least about 5, preferably
at least about 10, more preferably at least about 15 and most
preferably at least about 20 as determined by incorporation of
.sup.3H uridine in a murine B cell culture, which has been
contacted with 20 .mu.M of oligonucleotide for 20 h at 37.degree.
C. and has been pulsed with 1 .mu.Ci of .sup.3H uridine; and
harvested and counted 4 h later as described in detail in copending
PCT Published Patent Applications claiming priority to U.S. Ser.
Nos. 08/738,652 and 08/960,774, filed on Oct. 30, 1996 and Oct. 30,
1997 respectively. For use in vivo, for example, it is important
that the CpG oligonucleotide and cytokine be capable of effectively
inducing activation of APC's such as dendritic cells.
Oligonucleotides which can accomplish this are, for example, those
oligonucleotides described in PCT Published Patent Applications
claiming priority to U.S. Ser. Nos. 08/738,652 and 08/960,774,
filed on Oct. 30, 1996 and Oct. 30, 1997 respectively.
[0125] CpG oligonucleotides and immunopotentiating cytokines can be
administered to a subject alone prior to the administration of an
antigen. The oligonucleotides and cytokines can also be
administered to a subject in conjunction with an antigen to provide
an immediate antigen specific response. A second antigen which may
be the same or different from the first antigen may then be
administered to the subject at some time point after the
administration of CpG and immunopotentiating cytokine in the
presence or absence of additional CpG and cytokine. The term "in
conjunction with" refers to the administration of the CpG
oligonucleotide and immunopotentiating cytokine slightly before or
slightly after or at the same time as the antigen. The terms
slightly before and slightly after refer to a time period of 24
hours and preferably 12 hours. The CpG and cytokine are
administered in conjunction with one another and thus may also be
administered together or separately.
[0126] When the CpG oligonucleotide and immunopotentiating cytokine
are administered in conjunction with a first antigen the first
antigen will determine the specificity of the immediate immune
response. The CpG oligonucleotide and immunopotentiating cytokine
act as an effective "danger signal" and cause the immune system to
respond vigorously to new antigens in the area. This mode of action
presumably results primarily from the stimulatory local effects of
CpG oligonucleotide and immunopotentiating cytokine on dendritic
cells and other "professional" antigen presenting cells, as well as
from the co-stimulatory effects on B cells. This effect occurs
immediately upon the administration of the CpG oligonucleotide.
[0127] For use in therapy, an effective amount of an appropriate
CpG oligonucleotide and immunopotentiating cytokine alone or
formulated as a nucleic acid/cytokine delivery complex can be
administered to a subject by any mode allowing the oligonucleotide
to be taken up by the appropriate target cells (e.g. dendritic
cells). Preferred routes of administration include but are not
limited to oral, transdermal (e.g. via a patch), injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.), intranasal, intratracheal, and mucosal. An
injection may be in a bolus or a continuous infusion.
[0128] The term "effective amount" of a CpG oligonucleotide refers
to the amount necessary or sufficient to realize a desired biologic
effect. For example, an effective amount of an oligonucleotide
containing at least one unmethylated CpG for treating an immune
system deficiency could be that amount necessary to cause
activation of the immune system, resulting in the development of an
antigen specific immune response upon exposure to antigen. An
effective amount as used herein is an amount that produces a
synergistic immune response. A synergistic amount is that amount
which produces an immune response against a specific antigen that
is greater than the sum of the individual effects of either the CpG
or the cytokine alone.
[0129] The effective amount for any particular application can vary
depending on such factors as the disease or condition being
treated, the particular CpG-oligonucleotide/cytokine being
administered (e.g. the number of unmethylated CpG motifs or their
location in the nucleic acid), the size of the subject, or the
severity of the disease or condition. One of ordinary skill in the
art can empirically determine the effective amount of a particular
oligonucleotide/cytokine without necessitating undue
experimentation.
[0130] Another use for CpG oligonucleotide in combination with an
immunopotentiating cytokine is the production of a contraceptive
method for use in a subject. In this particular embodiment, the
subject is preferably mammalian, and preferably nonhuman. The
testes and ovaries are "immune privileged," that is they are
separated anatomically from the immune system. In addition, cells
in the testes and the ovaries can express fas ligand, which induces
apoptosis in activated T cells. The physical separation and the
expression of fas ligand both prevent an immune response against
the cells in the testes and ovaries. The CpG oligonucleotide used
in conjunction with an immunopotentiating cytokine can be used to
eliminate or substantially reduce the cells in the testes and the
ovaries by breaking the immune privilege of these cells, thereby
providing a contraceptive means. CpG oligonucleotide can be used in
conjunction with an immunopotentiating cytokine to break the immune
privilege of the cells of the testes and ovaries.
[0131] The method is accomplished by administering to a subject an
antigen, an immunopotentiating cytokine and an immunostimulatory
CpG oligonucleotide, wherein the antigen is: an antigen selected
from the group consisting of a gonadal cell antigen and an antigen
from a cytokine or hormone required for the maintenance of a
gonadal cell. A "gonadal cell antigen" as used herein is an antigen
on the surface of a gonadal cell, e.g., testis or ovary cell. Such
antigens are well known to those of skill in the art. Antigens from
a cytokine or hormone required for the maintenance of a gonadal
cell are also well known in the art. These antigens will cause an
immune response against the cytokine or hormone thus causing a loss
of gonadal cells.
[0132] The CpG oligonucleotides are used in one aspect of the
invention to induce activation of immune cells and preferably APCs.
An APC has its ordinary meaning in the art and includes, for
instance, dendritic cells such as immature dendritic cells and
precursor and progenitor dendritic cells, as well as mature
dendritic cells which are capable of taking up and expressing
antigen. Such a population of APC or dendritic cells is referred to
as a primed population of APCs or dendritic cells.
[0133] Dendritic cells form the link between the innate and the
acquired immune system by presenting antigens as well as through
their expression of pattern recognition receptors which detect
microbial molecules like LPS in their local environment. The
combination of immunopotentiating cytokine and CpG oligonucleotide
showed induction of Th1 specific antibody when immunopotentiating
cytokine alone only produced Th2 specific antibody. Since dendritic
cells form the link between the innate and the acquired immune
system the ability to activate dendritic cells with CpG and
immunopotentiating cytokine supports the use of combination
CpG-immunopotentiating cytokine based strategies for immunotherapy
against disorders such as cancer and allergic or infectious
diseases. The combination of CpG and immunopotentiating cytokine
shows synergistic activation of dendritic cells.
[0134] The invention relates in one aspect to methods and products
for activating dendritic cells for in vitro, ex vivo and in vivo
purposes. It was demonstrated according to the invention that the
combination of immunopotentiating cytokine and CpG oligonucleotide
is a potent activator of dendritic cells. Dendritic cells are
believed to be essential for the initiation of primary immune
responses in immune cells in vivo. It was discovered, according to
the invention, that CpG oligonucleotides and immunopotentiating
cytokine were capable of activating dendritic cells to initiate
primary immune responses in T cells, similar to an adjuvant. It was
also discovered that when the combination of the CpG
oligonucleotide and immunopotentiating cytokine is used to activate
dendritic cells the production of predominantly IgG2a and less IgG1
is induced, indicating its propensity to augment the development of
Th1 immune responses in vivo. These findings demonstrate the potent
adjuvant activity of CpG and provide the basis for the use of CpG
oligonucleotides as immunotherapeutics in the treatment of
disorders such as cancer, infectious diseases, and allergy. In one
aspect, the invention is a method for activating a dendritic cell
by contacting the dendritic cell which is exposed to an antigen
with an effective amount for synergistically activating a dendritic
cell of an immunopotentiating cytokine and an immunostimulatory CpG
oligonucleotide.
[0135] Dendritic cells efficiently internalize, process, and
present soluble specific antigen to which it is exposed. The
process of internalizing and presenting antigen causes rapid
upregulation of the expression of major histocompatibility complex
(MHC) and costimulatory molecules, the production of cytokines, and
migration toward lymphatic organs where they are believed to be
involved in the activation of T cells.
[0136] One specific use for the combination of CpG oligonucleotide
and immunopotentiating cytokine of the invention is to activate
dendritic cells for the purpose of enhancing a specific immune
response against cancer antigens. The immune response may be
enhanced using ex vivo or in vivo techniques. An "ex vivo" method
as used herein is a method which involves isolation of a dendritic
cell from a subject, manipulation of the cell outside of the body,
and reimplantation of the manipulated cell into a subject. The ex
vivo procedure may be used on autologous or heterologous cells, but
is preferably used on autologous cells. In preferred embodiments,
the dendritic cells are isolated from peripheral blood or bone
marrow, but may be isolated from any source of dendritic cells.
When the ex vivo procedure is performed to specifically produce
dendritic cells active against a specific cancer or other type of
antigen, the dendritic cells may be exposed to the antigen in
addition to the CpG and immunopotentiating cytokine. In other cases
the dendritic cell may have already been exposed to antigen but may
not be expressing the antigen on the surface efficiently.
Alternatively the dendritic cell may be exposed to the
immunopotentiating cytokine and exposed to the antigen, by either
direct contact or exposure in the body and then the dendritic cell
is returned to the body followed by administration of CpG directly
to the subject, either systemically or locally. Activation will
dramatically increase antigen processing. The activated dendritic
cell then presents the cancer antigen on its surface. When returned
to the subject, the activated dendritic cell expressing the cancer
antigen activates T cells in vivo which are specific for the cancer
antigen. Ex vivo manipulation of dendritic cells for the purposes
of cancer immunotherapy have been described in several references
in the art, including Engleman, E. G., 1997, Cytotechnology, 25:1;
Van Schooten, W., et al., 1997, Molecular Medicine Today, June,
255; Steinman, R. M., 1996, Experimental Hematology, 24, 849; and
Gluckman, J. C., 1997, Cytokines, Cellular and Molecular Therapy,
3:187. The ex vivo activation of dendritic cells of the invention
may be performed by routine ex vivo manipulation steps known in the
art, but with the use of CpG and immunopotentiating cytokine as the
activator.
[0137] The dendritic cells may also be contacted with CpG and
immunopotentiating cytokine using in vivo methods. In order to
accomplish this, CpG and immunopotentiating cytokine are
administered directly to a subject in need of immunotherapy. The
CpG and immunopotentiating cytokine may be administered in
combination with an antigen or may be administered alone. In some
embodiments, it is preferred that the CpG and immunopotentiating
cytokine be administered in the local region of the tumor, which
can be accomplished in any way known in the art, e.g., direct
injection into the tumor, with implants that release the drug
combination, etc.
[0138] Dendritic cells useful according to the invention may be
isolated from any source as long as the cell is capable of being
activated by CpG and cytokine to produce an active antigen
expressing dendritic cell. Several in vivo sources of immature
dendritic cells may be used according to the methods of the
invention. For instance bone marrow dendritic cells and peripheral
blood dendritic cells are both excellent sources of immature
dendritic cells that are activated by CpG and cytokine. Other
sources may easily be determined by those of skill in the art
without requiring undue experimentation, by for instance, isolating
a primary source of dendritic cells and testing activation by CpG
in vitro. The invention also encompasses the use of any immature
dendritic cells maintained in culture as a cell line as long as the
cell is capable of being activated by CpG and cytokine. Such cell
types may be routinely identified using standard assays known in
the art.
[0139] Peripheral blood dendritic cells isolated by immunomagnetic
cell sorting, which are activated by CpG and cytokine, represent a
more physiologic cell population of dendritic cells than monocyte
derived dendritic cells. Immature dendritic cells comprise
approximately 1 -3% of the cells in the bone marrow and
approximately 10-100 fold less in the peripheral blood. Peripheral
blood cells can be collected using devices well-known in the art,
e.g., haemonetics model v. 50 apheresis device (Haemonetics,
Braintree, Mass.). Red blood cells and neutrophils are removed from
the blood by centrifugation. The mononuclear cells located at the
interface are isolated. Methods for isolating CD4+ dendritic cells
from peripheral blood have been described O'Doherty U, et al. J Exp
Med 1993; 178: 1067-1076. In the presence of GM-CSF alone these
cells differentiate to dendritic cells with characteristic cellular
processes within two days. Differentiation is accompanied by an
increase in cell size, granularity and MHC II expression, which can
be easily followed using flow cytometry. Freshly isolated dendritic
cells cultured in the absence of GM-CSF rapidly undergo apoptosis.
Strikingly, in the presence of CpG oligonucleotides without
addition of GM-CSF, both cell survival and differentiation is
markedly improved compared to GM-CSF. In the presence of CpG,
dendritic cells form cell clusters which when examined by
ultrastructural techniques such as electron microscopy revealed
characteristic dense multilamellar intracytoplasmic bodies and
multi-vesicular structures, which were not present in dendritic
cells incubated with GM-CSF. Scanning electron microscopy showed
long veil and sheet-like processes thought to be used for
intercellular interactions, and an irregular cell shape. In
contrast, cells incubated with GM-CSF were round-shaped and had
only minor cellular processes. In addition to promoting survival
and differentiation of dendritic cells, a single addition of CpG
oligonucleotide led to activation as represented by upregulation of
the co-stimulatory molecules ICAM-1 (CD54), B7-2 (CD86) and CD40.
The combination of CpG oligonucleotide and GM-CSF enhanced the
expression of CD86 and CD40 synergistically, proving that
activation is not due to CpG-induced GM-CSF.
[0140] Method for Making Immunostimulatory Nucleic Acids
[0141] For use in the instant invention, nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the b-cyanoethyl phosphoramidite method
(S. L. Beaucage and M. H. Caruthers, 1981, Tet. Let. 22:1859);
nucleoside H-phosphonate method (Garegg, et al., 1986, Tet. Let.
27:4051-4051; Froehler, et al., 1986, Nucl. Acid. Res.
14:5399-5407; Garegg, et al., 1986, Tet. Let. 27:4055-4058,
Gaffney, et al., 1988), Tet. Let. 29:2619-2622. These chemistries
can be performed by a variety of automated oligonucleotide
synthesizers available in the market. Alternatively,
oligonucleotides can be prepared from existing nucleic acid
sequences (e.g. genomic or cDNA) using known techniques, such as
those employing restriction enzymes, exonucleases or
endonucleases.
[0142] For use in vivo, nucleic acids are preferably relatively
resistant to degradation (e.g. via endo- and exo-nucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications as discussed above. A preferred stabilized nucleic
acid can be accomplished via phosphate backbone modifications. A
preferred stabilized nucleic acid has at least a partial
phosphorothioate modified backbone. Phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made for example as described in U.S.
Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged
oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243
and European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., 1990, Chem Rev. 90:544;
Goodchild, J., 1990, Bioconjugate Chem. 1: 165). 2'-O-methyl
nucleic acids with CpG motifs also cause immune activation, as do
ethoxy-modified CpG nucleic acids. In fact, no backbone
modifications have been found that completely abolish the CpG
effect, although it is greatly reduced by replacing the C with a
5-methyl C.
[0143] For administration in vivo, nucleic acids and cytokines may
be associated with a molecule that results in higher affinity
binding to target cell (e.g. dendritic cell) surfaces and/or
increased cellular uptake by target cells to form a "nucleic
acid/cytokine delivery complex" as discussed above. Nucleic acids
can be ionically, or covalently associated with appropriate
molecules using techniques which are well known in the art. A
variety of coupling or crosslinking agents can be used, for example
protein A, carbodiimide, and N-succinimidyl-3-(2-pyridy- ldithio)
propionate (SPDP). Nucleic acids can alternatively be encapsulated
in liposomes or virosomes using well-known techniques.
[0144] The compositions of the invention, including activated
dendritic cells, isolated CpG nucleic acid molecules, cytokines,
and mixtures thereof are administered in pharmaceutically
acceptable compositions. When administered, the compositions of the
invention are applied in pharmaceutically-acceptable amounts. Such
preparations may routinely contain salt, buffering agents,
preservatives, compatible carriers, and optionally other
therapeutic agents. When used in medicine, the salts should be
pharmaceutically acceptable, but non-pharmaceutically acceptable
salts may conveniently be used to prepare
pharmaceutically-acceptable salts thereof and are not excluded from
the scope of the invention. Such pharmacologically and
pharmaceutically-acceptable salts include, but are not limited to,
those prepared from the following acids: hydrochloric, hydrobromic,
sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric,
formic, malonic, succinic, and the like. Also,
pharmaceutically-acceptable salts can be prepared as alkaline metal
or alkaline earth salts, such as sodium, potassium or calcium
salts. As used herein, a composition of a CpG oligonucleotide
and/or an immunopotentiating cytokine means the compounds described
above as well as salts thereof.
[0145] The compositions of the invention may be combined,
optionally, with a pharmaceutically-acceptable carrier. The term
"pharmaceutically-accepta- ble carrier" as used herein means one or
more compatible solid or liquid filler, diluents or encapsulating
substances which are suitable for administration into a human or
other animal. The term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being co-mingled
with the molecules of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficacy.
[0146] The pharmaceutical compositions may contain suitable
buffering agents, including: acetic acid in a salt; citric acid in
a salt; boric acid in a salt; and phosphoric acid in a salt.
[0147] The pharmaceutical compositions also may contain,
optionally, suitable preservatives, such as: benzalkonium chloride;
chlorobutanol; parabens and thimerosal.
[0148] Compositions suitable for parenteral administration
conveniently comprise a sterile aqueous preparation of the
compositions of the invention, which is preferably isotonic with
the blood of the recipient. This aqueous preparation may be
formulated according to known methods using suitable dispersing or
wetting agents and suspending agents. The sterile injectable
preparation also may be a sterile injectable solution or suspension
in a non-toxic parenterally-acceptable diluent or solvent, for
example, as a solution in 1,3-butane diol. Among the acceptable
vehicles and solvents that may be employed are water, Ringer's
solution, and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose any bland fixed oil may be
employed including synthetic mono- or di-glycerides. In addition,
fatty acids such as oleic acid may be used in the preparation of
injectables. Carrier formulation suitable for oral, subcutaneous,
intravenous, intramuscular, etc. administrations can be found in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa.
[0149] A variety of administration routes are available. The
particular mode selected will depend of course, upon the particular
composition selected, the severity of the condition being treated
and the dosage required for therapeutic efficacy. The methods of
the invention, generally speaking, may be practiced using any mode
of administration that is medically acceptable, meaning any mode
that produces effective levels of the active compounds without
causing clinically unacceptable adverse effects. Such modes of
administration include oral, rectal, topical, nasal, interdermal,
or parenteral routes. The term "parenteral" includes subcutaneous,
intravenous, intramuscular, or infusion. Intravenous or
intramuscular routes are not particularly suitable for long-term
therapy and prophylaxis. They could, however, be preferred in
emergency situations. Oral administration will be preferred for
prophylactic treatment because of the convenience to the patient as
well as the dosing schedule.
[0150] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well-known in
the art of pharmacy. All methods include the step of bringing the
compositions of the invention into association with a carrier which
constitutes one or more accessory ingredients. In general, the
compositions are prepared by uniformly and intimately bringing the
compositions of the invention into association with a liquid
carrier, a finely divided solid carrier, or both, and then, if
necessary, shaping the product.
[0151] Compositions suitable for oral administration may be
presented as discrete units, such as capsules, tablets, lozenges,
each containing a predetermined amount of the compositions of the
invention. Other compositions include suspensions in aqueous
liquids or non-aqueous liquids such as a syrup, elixir or an
emulsion.
[0152] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compositions of the invention
described above, increasing convenience to the subject and the
physician. Many types of release delivery systems are available and
known to those of ordinary skill in the art. They include polymer
base systems such as poly(lactide-glycolide), copolyoxalates,
polycaprolactones, polyesteramides, polyorthoesters,
polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the
foregoing polymers containing drugs are described in, for example,
U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer
systems that are: lipids including sterols such as cholesterol,
cholesterol esters and fatty acids or neutral fats such as mono-
di- and tri-glycerides; hydrogel release systems; sylastic systems;
peptide based systems; wax coatings; compressed tablets using
conventional binders and excipients; partially fused implants; and
the like. Specific examples include, but are not limited to: (a)
erosional systems in which the compositions of the invention is
contained in a form within a matrix such as those described in U.S.
Pat. Nos. 4,452,775, 4,667,014, 4,748,034 and 5,239,660 and (b)
difusional systems in which an active component permeates at a
controlled rate from a polymer such is described in U.S. Pat. Nos.
3,832,253, and 3,854,480. In addition, pump-based hardware delivery
systems can be used, some of which are adapted for
implantation.
[0153] Use of a long-term sustained release implant may be
particularly suitable for treatment of chronic conditions.
Long-term release, are used herein, means that the implant is
constructed and arranged to delivery therapeutic levels of the
active ingredient for at least 30 days, and preferably 60 days.
Long-term sustained release implants are well-known to those of
ordinary skill in the art and include some of the release systems
described above.
EXAMPLES
EXAMPLE 1
Materials and Methods
[0154] Tumor Model and Tumor Antigens: The 38C13 murine B cell
lymphoma model has been used extensively in studies of
antibody-based therapy and active immunization of lymphoma (Kwak,
L. W., et al., Proc Natl Acad Sci USA 93:10972-7, 1996). The
idiotype (Id) of the 38C13 surface IgM serves as a highly specific
tumor-associated antigen (Bergman, Y., and Haimovich, J., Eur
Immunol 7:413-7, 1977). Id was obtained from the supernatant of a
cell line that secretes 38C13 IgM as described (Eshhar, Z., et al.,
J Immunol 122:2430, 1979), and purified by protein a affinity
chromatography. Purified Id was conjugated to keyhole limpet
hemocyanin (KLH) using glutaraldehyde and used as the immunogen.
The cell line that produces 38C13 Id/murine GM-CSF fusion protein
was kindly provided by Dr. Ronald Levy. This cell line was cultured
in a hollow fiber reactor (Unisyn Technologies, Hopkinton, Mass.),
and fusion protein obtained by protein a affinity chromatography.
The fusion protein consists of the 38C13 Id heavy and light chain
variable regions, the human IgG.sub.1 heavy and light chain
constant regions, and murine GM-CSF sequences (Tao, M. H., and
Levy, R., Nature 362:755-758, 1993). Bifunctional reactivity was
confirmed by ELISA prior to use. Plates were coated with anti-Id,
serial dilutions of fusion protein added, and the presence of bound
GM-CSF moieties assessed by probing with anti-GM-CSF antibodies.
38C 13 Id/human GM-CSF fusion protein was obtained in a similar
manner and used as a control.
[0155] Immunization: Two phosphorothioate CpG oligonucleotides were
purchased commercially and produced under GMP conditions (Oligos
Etc., Wilsonville, Oreg.). Both oligonucleotide sequences had
similar effects in all assays. CpG oligonucleotide 1758 was used
unless stated otherwise. Oligonucleotide 1758 had the sequence
10 TCTCCCAGCGTGCGCCAT (SEQ ID NO:104)
[0156] and oligonucleotide 1826 had the sequence
11 TCCATGACGTTCCTGACGTT (SEQ ID NO:3)
[0157] Both CpG oligonucleotide were unmethylated. No detectable
endotoxin was present in either CpG oligonucleotide by LAL assay.
Prior studies demonstrated non-immunostimulatory oligonucleotide
had little adjuvant effect (Weiner, G. J., et al., Proc Natl Acad
Sci USA 94:10833-10837, 1997), therefore non-immunostimulatory
oligonucleotide were not included in the current studies. Murine
GM-CSF for in vitro production of dendritic cells it was purchased
commercially (PeproTech, Rocky Hill, N.J.). GM-CSF for in vivo
studies was kindly supplied by Immunex (Seattle, Wash.).
[0158] Female C3H/HeN mice, obtained from Harlan-Sprague-Dawley,
were housed in the University of Iowa Animal Care Unit and used at
6-9 weeks of age. Each mouse was immunized subcutaneously with
indicated antigen and adjuvant in a total volume of 200 .mu.l using
PBS as a vehicle.
[0159] ELISA Determination of Anti-Id Levels: Serum was obtained by
retroorbital puncture from mice following inhalation anesthesia
with metophane. Microtiter plates were coated with 5 .mu.g/ml 38C13
IgM or irrelevant IgM overnight. IgM-coated plates were blocked
with 5% milk, and serial dilutions of serum were added. Serum from
naive mice to which a known concentration of monoclonal anti-Id was
added served as a standard. Plates were washed, and heavy
chain-specific goat anti-mouse IgG, IgG.sub.1, or IgG.sub.2a
(Southern Biotechnology Associates, Birmingham, Ala.) added
following by the colorimetric substrate p-nitrophenylphosphate.
Plates were evaluated using a microplate reader. Test curves were
compared with standard curves to determine the concentration of
anti-Id. Values were considered valid only if the standard curves
and the sample curves had the same shape. Reactivity of serum with
a control, irrelevant murine IgM was evaluated in parallel and was
negative in all assays, confirming the immune response was not due
to development of an isotypic response.
[0160] In Vivo Survival Studies: Three days after a single
subcutaneous immunization using the indicated antigen and adjuvant,
mice were inoculated i.p. with 1,000 viable 38C13 cells. Cells were
growing in log phase for at least 4 days prior to inoculation. Mice
that developed tumor displayed inguinal and abdominal masses,
ascites, and cachexia. All mice that developed tumor died. Survival
was determined, and significance with respect to time to death was
assessed using Cox regression analysis. For statistical purposes,
survival of 60 days was assigned for mice that remained tumor free.
All such mice remained tumor free indefinitely, and were monitored
for a minimum of 100 days.
[0161] Dendritic cell production and stimulation: Dendritic cells
were obtained using a modification of the approach previously
described (Zitvogel, L., et al., J Ex Med 183:87-97, 1996;
Mayordomo, J. I., et al., Nature Medicine 1:1297-302, 1995).
Briefly, bone marrow cells were obtained by flushing the femurs and
tibias of naive 6-8 week old C3H/HeN mice. Red blood cells were
lysed and T-cells removed by complement-mediated lysis using a
mixture of anti-CD3 (145.2C11), anti-CD4 (GK1.5) and anti-CD8
(53.6.7) antibodies. B-cells were then removed by panning using a
flask coated with anti-B220. Remaining cells were allowed to adhere
overnight. Nonadherent cells were cultured in media supplemented
with 1000 U/ml GM-CSF and 1000 U/ml muIL-4 (PeproTech, Rocky Hill,
N.J.) at a concentration of 1.25.times.10.sup.5 cells/ml. Media was
changed after 4 days, and dendritic cells harvested 7 days after
bone marrow harvest. Dendritic cell phenotype and morphology were
confirmed by flow cytometric analysis and scanning electron
microscopy. Dendritic cells were washed, counted, and
1.times.10.sup.5 were cultured for 18 hours in a total volume of
200 .mu.l with antigen at a final concentration of 100 .mu.g/ml and
CpG oligonucleotide at a final concentration of 50 .mu.g/ml. For
measurement of cytokine levels, all samples were run in
quadruplicate. Supernatant was harvested and assayed by ELISA for
the presence of IL-6 and IL-12 as described (Klinman, D. M., et
al., Proc Natl Acad Sci USA 93:2879-83, 1996; Yi, A. K., et al., J
Immunol 156:558-64, 1996).
EXAMPLE 2
CpG Oligonucleotide Enhances Development of an Antibody response to
Id-KLH immunization when using GM-CSF as an Adjuvant
[0162] CpG oligonucleotide is known to induce production by APCs of
a number of cytokines including GM-CSF (Krieg, A. M., Trends in
Microbiology 4:73-6, 1996). In order to determine if the addition
of CpG oligonucleotide to GM-CSF would further enhance the immune
response mice were immunized with a single subcutaneous injection
of 50 .mu.g of Id-KLH in PBS mixed in aqueous solution with 50
.mu.g of CpG oligonucleotide, 10 .mu.g of GM-CSF, or a combination
of CpG oligonucleotide and GM-CSF. Serum was obtained weekly and
evaluated by ELISA for the presence of antigen-specific IgG
(anti-Id IgG). As illustrated in FIG. 1, mice immunized using both
CpG oligonucleotide and GM-CSF developed the highest levels of
anti-Id IgG. The effect of these two adjuvants appeared to be
additive.
[0163] The combination of GM-CSF and CpG oligonucleotide could
therefore enhance a number of different steps in the induction of
the immune response with GM-CSF increasing antigen uptake while CpG
oligonucleotide enhances the downstream response including
production of cytokines involved in effector cell activation. In
addition, CpG oligonucleotide contributes by synergistically
promoting B-cell activation through the antigen receptor, and so
preferentially activating antigen-specific B-cells (Krieg, A. M.,
et al, Nature 374:546-9, 1995). The data presented above indicate
immunization strategies involving the combination of GM-CSF and CpG
oligonucleotide are particularly effective. CpG oligonucleotide and
soluble GM-CSF were only additive in their ability to induce
anti-IdIgG after immunization with Id-KLH which may have been due
to the short half life of murine GM-CSF (Kedar, E., et al., J
Immunotherapy 20:180-93, 1997).
EXAMPLE 3
CpG Oligonucleotide enhances production of anti-Id Antibodies
following immunization with Id/GM-CSF fusion Protein
[0164] The Id/GM-CSF fusion protein consisting of the 38C13
variable regions, human IgG constant regions, and murine GM-CSF
(Id/GM-CSF) has been shown to be an excellent immunogen (Tao, M.
H., and Levy, R., Nature 362:755-758, 1993). In order to evaluate
if CpG oligonucleotide can further enhance the specific antibody
response induced by Id/GM-CSF, mice were immunized with Id-KLH or
Id/GM-CSF with and without CpG oligonucleotide as an adjuvant.
Serum was obtained weekly and anti-Id IgG levels determined. No
toxicity was observed in any mice. As illustrated in FIG. 2, CpG
oligonucleotide enhanced production of anti-Id antibodies in
response to Id/GM-CSF.
[0165] In a separate experiment, mice were immunized on day 0 and
boosted on day 14 with the same antigen and adjuvant. The
combination of Id/GM-CSF and CpG oligonucleotide induced remarkably
high levels of anti-Id IgG after two immunizations (FIG. 3). Serum
obtained 1 week after the final immunization contained over 2.5
mg/ml anti-Id IgG. A fusion protein consisting of 38C13 Id and
human GM-CSF (Id/human GM-CSF) was included as a control since
human GM-CSF is not active in the murine system. Id/human GM-CSF
was identical to Id/GM-CSF, except the murine GM-CSF sequences were
replaced with human GM-CSF sequences levels of anti-Id produced
after immunization using Id/human GM-CSF with or without CpG
oligonucleotide were significantly lower than those seen following
Id/GM-CSF and similar to those seen with Id-KLH, demonstrating that
biologically active GM-CSF was important for the observed
effects.
EXAMPLE 4
CpG Oligonucleotide Enhances Production of Antigen specific
antibody of IgG.sub.2, isotype
[0166] Enhanced production of IgG.sub.1 reflects a Th2 response,
whereas predominant IgG.sub.2a production indicates a Th1 response
(Stevens, T. L., et al., Nature 334:255-8, 1988). Moreover, murine
IgG.sub.2a is more effective than murine IgG at mediating
antibody-dependent cellular cytotoxicity, and monoclonal IgG.sub.2a
works better than monoclonal IgG with the identical variable region
as a set of therapeutic antibodies for treating tumors in mice
(Karninski, M. S., J Immunol 136:1123-1130, 1986). An isotype was
performed analysis on anti-Id IgG, and the presence of anti-Id
IgG.sub.1 and IgG.sub.2a was assessed following immunization (FIG.
4). Immunization included various combinations of Id-KLH or
Id/GM-CSF with GM-CSF or CpG oligonucleotide. Serum was sampled 4
weeks after a single immunization. CpG oligonucleotide induced
enhanced production of anti-Id IgG.sub.2a compared with that seen
under the corresponding conditions without CpG oligonucleotide.
Similar IgG.sub.1/IgG.sub.2a ratios were seen at other time
points.
EXAMPLE 5
Immunization Using CpG Oligonucleotide and ID/GM-CSF Fusion Protein
Further Protection of Mice from Tumor Growth
[0167] In order to evaluate whether CpG oligonucleotide can also
serve as an effective adjuvant with Id/GM-CSF immunization, mice
were challenged with tumor three days after a single immunization
with Id/GM-CSF with or without CpG oligonucleotide. Immunization
using this schedule was only minimally effective with Id-KLH. CpG
oligonucleotide 1758 and CpG oligonucleotide 1826 were equally
effective at prolonging survival when used alone or in combination
with Id/GM-CSF. The data illustrated in FIG. 5 represents the
combined results of mice treated with CpG oligonucleotide 1758 and
CpG oligonucleotide 1826. All unimmunized mice, and mice treated
with CpG oligonucleotide without antigen, developed tumor and died
within 50 days. Thirty percent of mice immunized with I/GM-CSF
alone remained disease free, whereas 70% of the group immunized
with Id/GM-CSF and CpG oligonucleotide remained disease free. Mice
immunized with Id/GM-CSF and CpG oligonucleotide had survival that
was statistically superior to that seen with no immunization or
treatment with CpG oligonucleotide alone (P<0.001). The
difference between those immunized with Id/GM-CSF alone versus
those immunized with CpG oligonucleotide plus Id/GM-CSF approached
statistical significance (P-0.072).
[0168] In these studies and in the studies of Example 5, remarkable
levels of anti-Id IgG were achieved after repeated immunization
with Id/GM-CSF and CpG oligonucleotide. CpG oligonucleotide shifted
the response to a IgG.sub.sa under all conditions studied including
immunization with soluble GM-CSF and the Id/GM-CSF fusion protein,
suggesting an enhanced Th1 response. Immunization using this
approach translated into protection from tumor growth only 3 days
after immunization wtih Id/GM-CSF and CpG oligonucleotide. This is
the most effective protection reported to date in this extensively
studied model.
EXAMPLE 6
CpG Oligonucleotide Effects on Dendritic Cell Phenotype
[0169] The synergistic effects of CpG oligonucleotide and GM-CSF
suggested the possibility that these agents together may enhance
expression of costimulatory molecules or MHC by APCs. The
expression of these molecules by bone-marrow derived dendritic
cells was evaluated. Flow cytometric analysis of dendritic cells
pulsed with Id/GM-CSF and/or CpG oligonucleotide demonstrated a
modest increase in expression of class I and class II MHC in
response to the combination of Id/GM-CSF and CpG oligonucleotide.
Baseline expression of CD80 and CD86 expression was high, and was
not altered extensively by Id/GM-CSF or CpG oligonucleotide (FIG.
6).
EXAMPLE 7
CpG Oligonucleotide Enhances Production of IL-12 by dendritic cells
pulsed with Id/GM-CSF
[0170] The enhanced Th1 response to antigen could be explained by
the ability of CpG oligonucleotide to enhance production of IL-12
by APCs such as dendritic cells. The production of IL-12 by
bone-marrow derived dendritic cells that were pulsed with antigen,
including Id/GM-CSF, was assessed in the presence of CpG
oligonucleotide. As illustrated in FIG. 7, pulsing of dendritic
cells with CpG oligonucleotide increased production of IL-12,
particularly when cells were also pulsed with Id/GM-CSF. IL-6
production by dendritic cells was also increased by the addition
CpG oligonucleotide to Id/GM-CS, although the effect was less
pronounced than for IL-12. The impact of GM-CSF alone on dendritic
cell production of cytokines was not studied since these cells were
generated using GM-CSF. The markedly enhanced production of IL-12
by dendritic cells induced by CpG oligonucleotide may at least in
part explain the enhanced Th 1 response.
EXAMPLE 8
Identification of Phosphorothioate Oligonucleotide that Induce
Human IL-12 Secretion
[0171] The ability of a CpG oligonucleotide to induce IL-12
secretion is a good measure of its adjuvant potential, especially
in terms of its ability to induce a Th1 immune response, which is
highly dependent on IL-12. Therefore, the ability of a panel of
phosphorothioate oligonucleotide to induce IL-12 secretion from
human PBMC in vitro (Table 1) was examined. These experiments
showed that in some human PBMC, most CpG oligonucleotide could
induce IL-12 secretion (e.g., expt. 1). However, other donors
responded to just a few CpG oligonucleotide (e.g., expt. 2).
Oligonucleotide 2006 was a consistent inducer of IL12 secretion
from most subjects (Table 2).
12TABLE 2 Induction of human IL-12 secretion by Phosphorothioate
CpG oligonucleotide IL-12 (pg/ml) ODN.sub.1 sequence (5'-3') expt.
1 expt. 2 None 0 0 1962 TCCTGTCGTTCCTTGTCGTT (SEQ. ID NO: 79) 19 0
1965 TCCTGTCGTTTTTTGTCGTT (SEQ. ID NO: 81) 36 0 1967
TCGTCGCTGTCTGCCCTTCTT (SEQ. ID NO: 82) 41 0 1968
TCGTCGCTGTTGTCGTTTCTT (SEQ. ID NO: 83) 24 0 2005
TCGTCGTTGTCGTTGTCGTT (SEQ. ID NO: 89) 25 0 2006
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 90) 29 15 2014
TGTCGTTGTCGTTGTCGTT (SEQ. ID NO: 96) 28 0 2015 TCGTCGTCGTCGTT (SEQ
ID NO: 97) 14 0 2016 TGTCGTTGTCGTT (SEQ. ID NO: 98) 3 0
EXAMPLE 9
CpG and GM-CSF synergistically increase co-stimulatory molecules on
DC
[0172] Methods
[0173] Detection of endotoxin The activity of LPS is standardized
by the FDA using the limulus amebocyte lysate (LAL) assay (EU/ml).
The lower detection limit of the LAL-assay in our hands was 0.03
EU/ml (LAL-assay BioWhittaker, Walkersville, Md.). The LPS sample
used in our studies (from salmonella typhimurium, Sigma Chemical
Co., St. Louis, Mo.) had an activity of 4.35 ng/EU. No endotoxin
could be detected in the oligonucleotides (<0.075 EU/mg).
[0174] Results
[0175] Differentiation of DC by the criteria of morphology and MHC
II expression is not sufficient for the induction of a specific
immune response by DC. Functional activation of DC requires by the
expression of co-stimulatory molecules. We examined the effect of
CpG on the expression of the intercellular adhesion molecule-1
(ICAM-1, CD54), and the co-stimulatory surface molecules B7-2
(CD86) and CD40. First, we were interested if an enhanced
expression of MHC II on DC (differentiation) was correlated to
activation reflected by CD54 expression. No positive correlation
could be found confirming that differentiation is not necessarily
associated with activation of DC (FIG. 8). The expression of the
co-stimulatory molecules CD54 (FIG. 9, panel A), CD86 (FIG. 9,
panel B) and CD40 (FIG. 9, panel C) was quantified in flow
cytometry by the mean fluorescence intensity (MFI) of viable DC. In
all experiments, CpG was superior to GMCSF in enhancing expression
of co-stimulatory molecules. Compared to the cells only sample, the
CpG oligonucleotide 2006 enhanced the expression of CD54 (25.0+-5.7
vs. 7.0+-1.8; p=0.02, n=5), CD 86 (3.9+-0.8 vs. 1.6+-0.3; p=0.01;
n=5) and CD40 (3.5+-1.0 vs. 0.9+-0.1; p=0.04, n=4). The combination
of GMCSF and 2006 showed an additive effect for CD54 (38.5+-7.9;
p=0.03; n=5), and enhanced the expression of CD86 and CD40
synergistically (CD86: 7.0+-1.6; p=0.01; n=5; CD40: 8.5+-1.0;
p<0.01; n=4).
[0176] Specificity was tested using 2117 (methylated version of
2006) and 2078 (GpC version of 2080). The the non-CpG
oligonucleotide 2117 showed no synergistic enhancement of CD40
expression when combined with GMCSF. An assay was performed on
primary dendritic cells in which dendritic cells are cultured with
the indicated compounds (under the conditions described above).
Then we measured the surface expression of Cd86 or CD40 on the
dendritic cells, and it's ability to drive T cell proliferation in
a allogeneic mixed lymphocyte reaction (indicated as the % of T
cells in the culture that proliferate in response to the dendritic
cells activation). The results are shown in Table 3.
13 TABLE 3 CD86 CD40 T cell Compound (5 Exp) (4 Exp.) proliferation
GM-CSF 1.9 2.5 13.3 CpG 3.9 3.5 19.7 CpG + GM-CSF 7.0 8.5 25.6
[0177]
14TABLE 1 sequences GCTAGACGTTAGCGT (SEQ ID NO: 1) GCTAGATGTTAGCGT
(SEQ ID NO: 2) GCTAGAZGTTAGCGT (SEQ ID NO: 3) GCTAGACGTTAGZGT (SEQ
ID NO: 4) GCATGACGTTGAGCT (SEQ ID NO: 5) ATGGAAGGTCCAGCGTTCTC (SEQ
ID NO: 6) ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 7) ATZGACTCTZGAGZGTTCTC
(SEQ ID NO: 8) ATZGACTCTCGAGCGTTCTC (SEQ ID NO: 9)
ATCGACTCTCGAGCGTTZTC (SEQ ID NO: 10) ATCGACTCTCGAACGTTCTC (SEQ ID
NO: 11) GAGAACGCTGGACCTTCCAT (SEQ ID NO: 12) GAGAACGCTCGACCTTCCAT
(SEQ ID NO: 13) GAGAACGCTCGACCTTCGAT (SEQ ID NO: 14)
GAGCAAGCTGGACCTTCCAT (SEQ ID NO: 15) GAGCAZGCTGGACCTTCCAT (SEQ ID
NO: 16) GAGAACGCTGGACZTTCCAT (SEQ ID NO: 17) GAGAACGATGGACCTTCCAT
(SEQ ID NO: 18) GAGAACGCTCCAGCACTGAT (SEQ ID NO: 19)
CCATGTCGGTCCTGATGCT (SEQ ID NO: 20) TCCATGCTGGTCCTGATGCT (SEQ ID
NO: 21) TCCATGTZGGTCCTGATGCT (SEQ ID NO: 22) TCCATGTCGGTZCTGATGCT
(SEQ ID NO: 23) TCCATGACGTTCCTGATGCT (SEQ ID NO: 24)
TCCATGTCGGTCCTGACGCA (SEQ ID NO: 25) TCAACGTT (SEQ ID NO: 26)
TCAAGCTT (SEQ ID NO: 27) TCAGCGCT (SEQ ID NO: 28) TCTTCGAT (SEQ ID
NO: 29) TCTTCGAA (SEQ ID NO: 30) CAACGTT (SEQ ID NO: 31) CCAACGTT
(SEQ ID NO: 32) CAACGTTCT (SEQ ID NO: 33) TCAACGTC (SEQ ID NO: 34)
ATGGACTCTCCAGCGTTCTC (SEQ ID NO: 35) ATAGGAGGTCCAACGTTCTC (SEQ ID
NO: 36) ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 37) ATGGAGGCTCCATCGTTCTC
(SEQ ID NO: 38) ATZGGAGTCTZGAGZGTTCTC (SEQ ID NO: 39)
ATCGACTCTCGAGZGTTCTC (SEQ ID NO: 40) GCATGACGTTGAGCT3' (SEQ ID NO:
41) TCCATGTCGGTCCTGATGCT SEQ ID NO: 42 TCCATGCCGGTCCTGATGCT SEQ ID
NO: 43 TCCATGGCGGTCCTGATGCT SEQ ID NO: 44 TCCATGACGGTCCTGATGCT SEQ
ID NO: 45 TCCATGTCGATCCTGATGCT SEQ ID NO: 46 TCCATGTCGCTCCTGATGCT
SEQ ID NO: 47 TCCATGTCGTTCCTGATGCT SEQ ID NO: 48
TCCATAACGTTCCTGATGCT SEQ ID NO: 49 TCCATGACGTCCCTGATGCT SEQ ID NO:
50 TCCATCACGTGCCTGATGCT SEQ ID NO: 51 GGGGTCAACGTTGACGGGG (SEQ ID
NO:52) GGGGTCAGTCGTGACGGGG (SEQ ID NO:53) GCTAGACGTTAGTGT (SEQ ID
NO: 54) GCTAGAZGTTAGTGT (SEQ ID NO: 55) TCCATGTCGTTCCTGATGCT (SEQ
ID NO: 56) TCCATGTZGTTCCTGATGCT (SEQ ID NO: 57)
ACCATGGACGATCTGTTTCCCCTC (SEQ ID NO: 58) TCTCCCAGCGTGCGCCAT (SEQ ID
NO: 59) TACCGCGTGCGACCCTCT (SEQ ID NO: 60) ACCATGGACGAACTGTTTCCCCTC
(SEQ ID NO: 61) ACCATGGACGAGCTGTTTCCCCTC (SEQ ID NO: 62)
ACCATGGACGACCTGTTTCCCCTC (SEQ ID NO: 63) ACCATGGACGTACTGTTTCCCCTC
(SEQ ID NO: 64) ACCATGGACGGTCTGTTTCCCCTC (SEQ ID NO: 65)
ACCATGGACGTTCTGTTTCCCCTC (SEQ ID NO: 66) CACGTTGAGGGGCAT (SEQ ID
NO: 67) CTGCTGAGACTGGAG (SEQ ID NO: 68) TCAGCGTGCGCC (SEQ ID NO:
69) ATGACGTTCCTGACGTT (SEQ ID NO: 70) TCTGCCAGCGGGCGCAT (SEQ ID NO:
71) TCTCCCAGCGCGCGCCAT (SEQ ID NO: 72) TCCATGTCGTTCCTGTCGTT (SEQ ID
NO: 73) TCCATAGCGTTCCTAGCGTT (SEQ ID NO: 74) TCGTCGCTGTCTCCGCTTCTT
(SEQ ID NO: 75) TCCTGACGTTCCTGACGTT (SEQ ID NO: 76)
TCCTGTCGTTCCTGTCGTT (SEQ ID NO: 77) TCCATGTCGTTTTTGTCGTT (SEQ ID
NO: 78) TCCTGTCGTTCCTTGYCGTT (SEQ ID NO: 79) TCCTTGTCGTTCCTGTCGTT
(SEQ ID NO: 80) TCCTGTCGTTTTTTGTCGTT (SEQ ID NO: 81)
TCGTCGCTGTCTGCCCTTCTT (SEQ ID NO: 82) TCGTCGCTGTTGTCGTTTCTT (SEQ ID
NO: 83) TCCATGTZGTTCCTGTZGTT (SEQ ID NO: 84) TCCAGGACTTCTCTCAGGTT
(SEQ ID NO: 85) TCCATGCGTGCGTGCGTTTT (SEQ ID NO: 86)
TCCATGCGTTGCGTTGCGTT (SEQ ID NO: 87) TCCACGACGTTTTCGACGTT (SEQ ID
NO: 88) TCGTCGTTGTCGTTGTCGTT (SEQ ID NO: 89)
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 90) TCGTCGTTGTCGTTTTGTCGTT
(SEQ ID NO: 91) GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO: 92)
GCGGCGGGCGGCGCGCGCCC (SEQ ID NO: 93) TGTCGTTTGTCGTTTGTCGTT (SEQ ID
NO: 94) TGTCGTTGTCGTGTCGTTGTCGTT (SEQ ID NO: 95)
TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 96) TCGTCGTCGTCGTT (SEQ ID NO: 97)
TGTCGTTGTCGTT (SEQ ID NO: 98) TCCATAGCGTTCCTAGCGTT (SEQ ID NO: 99)
TCCATGACGTTCCTGACGTT (SEQ ID NO: 100) GTCG(T/C)T (SEQ ID NO: 101)
TGTCG(T/C)T (SEQ ID NO: 102) TCCATGAGCTTCCTGAGTCT (SEQ ID NO: 103)
TCTCCCAGCGTGCGCCAT (SEQ ID NO: 104) TCCATGACGTTCCTGACGTT (SEQ ID
NO: 105)
[0178] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
[0179] All references, patents and patent publications that are
recited in this application are incorporated in their entirety
herein by reference.
Sequence CWU 1
1
105 1 15 DNA Artificial Sequence Synthetic Sequence 1 gctagacgtt
agcgt 15 2 15 DNA Artificial Sequence Synthetic Sequence 2
gctagatgtt agcgt 15 3 15 DNA Artificial Sequence modified_base
(7)...(7) m5c 3 gctagacgtt agcgt 15 4 15 DNA Artificial Sequence
Synthetic Sequence 4 gctagacgtt agcgt 15 5 15 DNA Artificial
Sequence Synthetic Sequence 5 gcatgacgtt gagct 15 6 20 DNA
Artificial Sequence Synthetic Sequence 6 atggaaggtc cagcgttctc 20 7
20 DNA SArtificial Sequence Synthetic Sequence 7 atcgactctc
gagcgttctc 20 8 20 DNA Artificial Sequence Synthetic Sequence 8
atcgactctc gagcgttctc 20 9 20 DNA Artificial Sequence Synthetic
Sequence 9 atcgactctc gagcgttctc 20 10 20 DNA Artificial Sequence
Synthetic Sequence 10 atcgactctc gagcgttctc 20 11 20 DNA Artificial
Sequence Synthetic Sequence 11 atcgactctc gaacgttctc 20 12 20 DNA
Artificial Sequence Synthetic Sequence 12 gagaacgctg gaccttccat 20
13 20 DNA Artificial Sequence Synthetic Sequence 13 gagaacgctc
gaccttccat 20 14 20 DNA Artificial Sequence Synthetic Sequence 14
gagaacgctc gaccttcgat 20 15 20 DNA Artificial Sequence Synthetic
Sequence 15 gagcaagctg gaccttccat 20 16 20 DNA Artificial Sequence
Synthetic Sequence 16 gagcacgctg gaccttccat 20 17 20 DNA Artificial
Sequence Synthetic Sequence 17 gagaacgctg gaccttccat 20 18 20 DNA
Artificial Sequence Synthetic Sequence 18 gagaacgatg gaccttccat 20
19 20 DNA Artificial Sequence Synthetic Sequence 19 gagaacgctc
cagcactgat 20 20 19 DNA Artificial Sequence Synthetic Sequence 20
ccatgtcggt cctgatgct 19 21 20 DNA Artificial Sequence Synthetic
Sequence 21 tccatgctgg tcctgatgct 20 22 20 DNA Artificial Sequence
Synthetic Sequence 22 tccatgtcgg tcctgatgct 20 23 20 DNA Artificial
Sequence Synthetic Sequence 23 tccatgtcgg tcctgatgct 20 24 20 DNA
Artificial Sequence Synthetic Sequence 24 tccatgacgt tcctgatgct 20
25 20 DNA Artificial Sequence Synthetic Sequence 25 tccatgtcgg
tcctgacgca 20 26 8 DNA Artificial Sequence Synthetic Sequence 26
tcaacgtt 8 27 8 DNA Artificial Sequence Synthetic Sequence 27
tcaagctt 8 28 8 DNA Artificial Sequence Synthetic Sequence 28
tcagcgct 8 29 8 DNA Artificial Sequence Synthetic Sequence 29
tcttcgat 8 30 8 DNA Artificial Sequence Synthetic Sequence 30
tcttcgaa 8 31 7 DNA Artificial Sequence Synthetic Sequence 31
caacgtt 7 32 8 DNA Artificial Sequence Synthetic Sequence 32
ccaacgtt 8 33 9 DNA Artificial Sequence Synthetic Sequence 33
caacgttct 9 34 8 DNA Artificial Sequence Synthetic Sequence 34
tcaacgtc 8 35 20 DNA Artificial Sequence Synthetic Sequence 35
atggactctc cagcgttctc 20 36 20 DNA Artificial Sequence Synthetic
Sequence 36 ataggaggtc caacgttctc 20 37 20 DNA Artificial Sequence
Synthetic Sequence 37 atcgactctc gagcgttctc 20 38 20 DNA Artificial
Sequence Synthetic Sequence 38 atggaggctc catcgttctc 20 39 21 DNA
Artificial Sequence Synthetic Sequence 39 atcggactct cgagcgttct c
21 40 20 DNA Artificial Sequence Synthetic Sequence 40 atcgactctc
gagcgttctc 20 41 15 DNA Artificial Sequence Synthetic Sequence 41
gcatgacgtt gagct 15 42 20 DNA Artificial Sequence Synthetic
Sequence 42 tccatgtcgg tcctgatgct 20 43 20 DNA Artificial Sequence
Synthetic Sequence 43 tccatgccgg tcctgatgct 20 44 20 DNA Artificial
Sequence Synthetic Sequence 44 tccatggcgg tcctgatgct 20 45 20 DNA
Artificial Sequence Synthetic Sequence 45 tccatgacgg tcctgatgct 20
46 20 DNA Artificial Sequence Synthetic Sequence 46 tccatgtcga
tcctgatgct 20 47 20 DNA Artificial Sequence Synthetic Sequence 47
tccatgtcgc tcctgatgct 20 48 20 DNA Artificial Sequence Synthetic
Sequence 48 tccatgtcgt tcctgatgct 20 49 20 DNA Artificial Sequence
Synthetic Sequence 49 tccataacgt tcctgatgct 20 50 20 DNA Artificial
Sequence Synthetic Sequence 50 tccatgacgt ccctgatgct 20 51 20 DNA
Artificial Sequence Synthetic Sequence 51 tccatcacgt gcctgatgct 20
52 19 DNA Artificial Sequence Synthetic Sequence 52 ggggtcaacg
ttgacgggg 19 53 19 DNA Artificial Sequence Synthetic Sequence 53
ggggtcagtc gtgacgggg 19 54 15 DNA Artificial Sequence Synthetic
Sequence 54 gctagacgtt agtgt 15 55 15 DNA Artificial Sequence
Synthetic Sequence 55 gctagacgtt agtgt 15 56 20 DNA Artificial
Sequence Synthetic Sequence 56 tccatgtcgt tcctgatgct 20 57 20 DNA
Artificial Sequence Synthetic Sequence 57 tccatgtcgt tcctgatgct 20
58 24 DNA Artificial Sequence Synthetic Sequence 58 accatggacg
atctgtttcc cctc 24 59 18 DNA Artificial Sequence Synthetic Sequence
59 tctcccagcg tgcgccat 18 60 18 DNA Artificial Sequence Synthetic
Sequence 60 taccgcgtgc gaccctct 18 61 24 DNA Artificial Sequence
Synthetic Sequence 61 accatggacg aactgtttcc cctc 24 62 24 DNA
Artificial Sequence Synthetic Sequence 62 accatggacg agctgtttcc
cctc 24 63 24 DNA Artificial Sequence Synthetic Sequence 63
accatggacg acctgtttcc cctc 24 64 24 DNA Artificial Sequence
Synthetic Sequence 64 accatggacg tactgtttcc cctc 24 65 24 DNA
Artificial Sequence Synthetic Sequence 65 accatggacg gtctgtttcc
cctc 24 66 24 DNA Artificial Sequence Synthetic Sequence 66
accatggacg ttctgtttcc cctc 24 67 15 DNA Artificial Sequence
Synthetic Sequence 67 cacgttgagg ggcat 15 68 15 DNA Artificial
Sequence Synthetic Sequence 68 ctgctgagac tggag 15 69 12 DNA
Artificial Sequence Synthetic Sequence 69 tcagcgtgcg cc 12 70 17
DNA Artificial Sequence Synthetic Sequence 70 atgacgttcc tgacgtt 17
71 17 DNA Artificial Sequence Synthetic Sequence 71 tctcccagcg
ggcgcat 17 72 18 DNA Artificial Sequence Synthetic Sequence 72
tctcccagcg cgcgccat 18 73 20 DNA Artificial Sequence Synthetic
Sequence 73 tccatgtcgt tcctgtcgtt 20 74 20 DNA Artificial Sequence
Synthetic Sequence 74 tccatagcgt tcctagcgtt 20 75 21 DNA Artificial
Sequence Synthetic Sequence 75 tcgtcgctgt ctccgcttct t 21 76 19 DNA
Artificial Sequence Synthetic Sequence 76 tcctgacgtt cctgacgtt 19
77 19 DNA Artificial Sequence Synthetic Sequence 77 tcctgtcgtt
cctgtcgtt 19 78 20 DNA Artificial Sequence Synthetic Sequence 78
tccatgtcgt ttttgtcgtt 20 79 20 DNA Artificial Sequence Synthetic
Sequence 79 tcctgtcgtt ccttgtcgtt 20 80 20 DNA Artificial Sequence
Synthetic Sequence 80 tccttgtcgt tcctgtcgtt 20 81 20 DNA Artificial
Sequence Synthetic Sequence 81 tcctgtcgtt ttttgtcgtt 20 82 21 DNA
Artificial Sequence Synthetic Sequence 82 tcgtcgctgt ctgcccttct t
21 83 21 DNA Artificial Sequence Synthetic Sequence 83 tcgtcgctgt
tgtcgtttct t 21 84 20 DNA Artificial Sequence Synthetic Sequence 84
tccatgtcgt tcctgtcgtt 20 85 20 DNA Artificial Sequence Synthetic
Sequence 85 tccaggactt ctctcaggtt 20 86 20 DNA Artificial Sequence
Synthetic Sequence 86 tccatgcgtg cgtgcgtttt 20 87 20 DNA Artificial
Sequence Synthetic Sequence 87 tccatgcgtt gcgttgcgtt 20 88 20 DNA
Artificial Sequence Synthetic Sequence 88 tccacgacgt tttcgacgtt 20
89 20 DNA Artificial Sequence Synthetic Sequence 89 tcgtcgttgt
cgttgtcgtt 20 90 24 DNA Artificial Sequence Synthetic Sequence 90
tcgtcgtttt gtcgttttgt cgtt 24 91 22 DNA Artificial Sequence
Synthetic Sequence 91 tcgtcgttgt cgttttgtcg tt 22 92 21 DNA
Artificial Sequence Synthetic Sequence 92 gcgtgcgttg tcgttgtcgt t
21 93 20 DNA Artificial Sequence Synthetic Sequence 93 gcggcgggcg
gcgcgcgccc 20 94 21 DNA Artificial Sequence Synthetic Sequence 94
tgtcgtttgt cgtttgtcgt t 21 95 25 DNA Artificial Sequence Synthetic
Sequence 95 tgtcgttgtc gttgtcgttg tcgtt 25 96 19 DNA Artificial
Sequence Synthetic Sequence 96 tgtcgttgtc gttgtcgtt 19 97 14 DNA
Artificial Sequence Synthetic Sequence 97 tcgtcgtcgt cgtt 14 98 13
DNA Artificial Sequence Synthetic Sequence 98 tgtcgttgtc gtt 13 99
20 DNA Artificial Sequence Synthetic Sequence 99 tccatagcgt
tcctagcgtt 20 100 20 DNA Artificial Sequence Synthetic Sequence 100
tccatgacgt tcctgacgtt 20 101 6 DNA Artificial Sequence Synthetic
Sequence 101 gtcgyt 6 102 7 DNA Artificial Sequence Synthetic
Sequence 102 tgtcgyt 7 103 20 DNA Artificial Sequence Synthetic
Sequence 103 tccatgagct tcctgagtct 20 104 18 DNA Artificial
Sequence Synthetic Sequence 104 tctcccagcg tgcgccat 18 105 20 DNA
Artificial Sequence Synthetic Sequence 105 tccatgacgt tcctgacgtt
20
* * * * *