U.S. patent application number 10/831775 was filed with the patent office on 2005-02-24 for use of nucleic acids containing unmethylated cpg dinucleotide as an adjuvant.
This patent application is currently assigned to Coley Pharmaceutical GmbH. Invention is credited to Davis, Heather L., Krieg, Arthur M., Schorr, Joachim.
Application Number | 20050043529 10/831775 |
Document ID | / |
Family ID | 26717020 |
Filed Date | 2005-02-24 |
United States Patent
Application |
20050043529 |
Kind Code |
A1 |
Davis, Heather L. ; et
al. |
February 24, 2005 |
Use of nucleic acids containing unmethylated CpG dinucleotide as an
adjuvant
Abstract
The present invention relates generally to adjuvants, and in
particular to methods and products utilizing a synergistic
combination of immunostimulatory oligonucleotides having at least
one unmethylated CpG dinucleotide (CpG ODN) and a non-nucleic acid
adjuvant. Such combinations of adjuvants may be used with an
antigen or alone. The present invention also relates to methods and
products utilizing immunostimulatory oligonucleotides having at
least one unmethylated CpG dinucleotide (CpG ODN) for induction of
cellular immunity in infants.
Inventors: |
Davis, Heather L.; (Ottawa,
CA) ; Schorr, Joachim; (Hilden, DE) ; Krieg,
Arthur M.; (Wellesley, MA) |
Correspondence
Address: |
Helen C. Lockhart
Wolf, Greenfield & Sacks, P.C.
Federal Reserve Plaza
600 Atlantic Avenue
Boston
MA
02210
US
|
Assignee: |
Coley Pharmaceutical GmbH
Langenfeld
IA
University of Iowa Research Foundation
Iowa City
CPG Immunopharmaceuticals GMBH
Hilden
Ottawa Health Research Institute
Ottawa
|
Family ID: |
26717020 |
Appl. No.: |
10/831775 |
Filed: |
April 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10831775 |
Apr 23, 2004 |
|
|
|
10023909 |
Dec 18, 2001 |
|
|
|
10023909 |
Dec 18, 2001 |
|
|
|
09325193 |
Jun 3, 1999 |
|
|
|
6406705 |
|
|
|
|
09325193 |
Jun 3, 1999 |
|
|
|
09154614 |
Sep 16, 1998 |
|
|
|
09154614 |
Sep 16, 1998 |
|
|
|
PCT/US98/04703 |
Mar 10, 1998 |
|
|
|
60040376 |
Mar 10, 1997 |
|
|
|
Current U.S.
Class: |
536/23.72 ;
424/278.1; 424/283.1; 536/23.1; 536/24.5 |
Current CPC
Class: |
A61K 2039/57 20130101;
A61K 2039/55572 20130101; A61K 2039/523 20130101; A61K 2039/5555
20130101; Y02A 50/30 20180101; A61K 2039/55505 20130101; A61K
2039/55566 20130101; Y02A 50/41 20180101; A61K 39/12 20130101; A61K
2039/55561 20130101; C12N 2730/10134 20130101; A61K 2039/53
20130101; A61K 39/292 20130101; A61K 39/39 20130101 |
Class at
Publication: |
536/023.72 ;
424/278.1; 424/283.1; 536/023.1; 536/024.5 |
International
Class: |
C07H 021/04; A61K
031/70; A61K 045/00; A61K 047/44; C07H 021/02; A01N 043/04; A61K
047/00 |
Claims
1-98. (Canceled).
99. A method for maintaining suppression of a Th2 immune response
in a subject, the method comprising: administering to a subject a
first dose of an immunostimulatory nucleic acid; and administering
to the subject a second dose of an immunostimulatory nucleic acid,
wherein the immunostimulatory nucleic acid comprises a nucleotide
sequence comprising 5'-CG-3', and wherein the second dose is
administered from about 10 days to about 8 weeks after the first
dose.
100. The method of claim 99, wherein the second dose is
administered about 4 weeks after the first dose.
101. The method of claim 99, wherein the subject is a human.
102. The method of claim 99, wherein the first and the second doses
are administered by inhalation.
103. A method for maintaining stimulation of a Th1 immune response
in a subject, the method comprising: administering to a subject a
first dose of an immunostimulatory nucleic acid; and administering
to the subject a second dose of an immunostimulatory nucleic acid,
wherein the immunostimulatory nucleic acid comprises a nucleotide
sequence comprising 5'-CG-3', and wherein the second dose is
administered from about 10 days to about 8 weeks after the first
dose.
104. The method of claim 103, wherein the second dose is
administered about 4 weeks after the first dose.
105. The method of claim 103, wherein the subject is a human.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 09/325,193, filed on Jun. 3, 1999, and now pending, which
is a continuation in part of U.S. patent application Ser. No.
09/154,614 filed on Sep. 16, 1998, abandoned, which is a National
Stage filing of PCT/US98/04703, filed on Mar. 10, 1998, claiming
priority to U.S. Provisional Patent Application 60/040,376, filed
Mar. 10, 1997, now abandoned.
FIELD OF THE INVENTION
[0002] The present invention relates generally to adjuvants, and in
particular to methods and products utilizing a synergistic
combination of oligonucleotides having at least one unmethylated
CpG dinucleotide (CpG ODN) and a non-nucleic acid adjuvant.
BACKGROUND OF THE INVENTION
[0003] Bacterial DNA, but not vertebrate DNA, has direct
immunostimulatory effects on peripheral blood mononuclear cells
(PBMC) in vitro (Krieg et al., 1995). This lymphocyte activation is
due to unmethylated CpG dinucleotides, which are present at the
expected frequency in bacterial DNA (1/16), but are
under-represented (CpG suppression, 1/50 to 1/60) and methylated in
vertebrate DNA. Activation may also be triggered by addition of
synthetic oligodeoxynucleotides (ODN) that contain an unmethylated
CpG dinucleotide in a particular sequence context. It appears
likely that the rapid immune activation in response to CpG DNA may
have evolved as one component of the innate immune defense
mechanisms that recognize structural patterns specific to microbial
molecules.
[0004] CpG-DNA induces proliferation of almost all (>95%) B
cells and increases immunoglobulin (Ig) secretion. This B cell
activation by CpG DNA is T cell independent and antigen
non-specific. However, B cell activation by low concentrations of
CpG DNA has strong synergy with signals delivered through the B
cell antigen receptor for both B cell proliferation and Ig
secretion (Krieg et al., 1995). This strong synergy between the B
cell signaling pathways triggered through the B cell antigen
receptor and by CpG DNA promotes antigen specific immune responses.
In addition to its direct effects on B cells, CpG DNA also directly
activates monocytes, macrophages, and dendritic cells to secrete a
variety of cytokines, including high levels of IL-12 (Klinman et
al., 1996; Halpern et al., 1996; Cowdery et al., 1996). These
cytokines stimulate natural killer (NK) cells to secrete
gamma-interferon (IFN-.gamma.-) and have increased lytic activity
(Klinman et al., 1996, supra; Cowdery et al., 1996, supra; Yamamoto
et al., 1992; Ballas et al., 1996). Overall, CpG DNA induces a Th1
like pattern of cytokine production dominated by IL-12 and
IFN-.gamma. with little secretion of Th2 cytokines (Klinman et al.,
1996).
[0005] Hepatitis B virus (HBV) poses a serious world-wide health
problem. The current HBV vaccines are subunit vaccines containing
particles of HBV envelope protein(s) which include several B and T
cell epitopes known collectively as HBV surface antigen (HBsAg).
The HBsAg particles may be purified from the plasma of chronically
infected individuals or more commonly are produced as recombinant
proteins. These vaccines induce antibodies against HBsAg
(anti-HBs), which confer protection if present in titers of at
least 10 milli-International Units per milliliter (mIU/ml) (Ellis,
1993). The current subunit vaccines which contain alum (a Th2
adjuvant), are safe and generally efficacious. They, however, fail
to meet all current vaccination needs. For example, early
vaccination of infants born to chronically infected mothers, as
well as others in endemic areas, drastically reduces the rate of
infection, but a significant proportion of these babies will still
become chronically infected themselves (Lee et al., 1989; Chen et
al., 1996). This could possibly be reduced if high titers of
anti-HBs antibodies could be induced earlier and if there were
HBV-specific CTL. In addition, there are certain individuals who
fail to respond (non-responders) or do not attain protective levels
of immunity (hypo-responders). Finally, there is an urgent need for
an effective treatment for the estimated 350 million chronic
carriers of HBV and a therapeutic vaccine could meet this need.
SUMMARY OF THE INVENTION
[0006] The present invention relates to methods and products for
inducing an immune response. The invention is useful in one aspect
as a method of inducing an antigen specific immune response in a
subject. The method includes the steps of administering to the
subject in order to induce an antigen specific immune response an
antigen and a combination of adjuvants, wherein the combination of
adjuvants includes at least one oligonucleotide containing at least
one unmethylated CpG dinucleotide and at least one non-nucleic acid
adjuvant, and wherein the combination of adjuvants is administered
in an effective-amount for inducing a synergistic adjuvant
response. In one embodiment the subject is an infant.
[0007] The CpG oligonucleotide and the non-nucleic acid adjuvant
may be administered with any or all of the administrations of
antigen. For instance the combination of adjuvants may be
administered with a priming dose of antigen. In another embodiment
the combination of adjuvants is administered with a boost dose of
antigen. In some embodiments the subject is administered a priming
dose of antigen and oligonucleotide containing at least one.
unmethylated CpG dinucleotide before the boost dose. In yet other
embodiments the subject is administered a boost dose of antigen and
oligonucleotide containing at least one unmethylated CpG
dinucleotide after the priming dose.
[0008] The antigen may be any type of antigen known in the art. For
example, the antigen may be selected from the group consisting of
peptides, polypeptides, cells, cell extracts, polysaccharides,
polysaccharide conjugates, lipids, glycolipids and carbohydrates.
Antigens may be given in a crude, purified or recombinant form and
polypeptide/peptide antigens, including peptide mimics of
polysaccharides, may also be encoded within nucleic acids. Antigens
may be derived from an infectious pathogen such as a virus,
bacterium, fungus or parasite, or the antigen may be a tumor
antigen, or the antigen may be an allergen.
[0009] According to another aspect of the invention a method of
inducing a Th1 immune response in a subject is provided. The method
includes the step of administering to the subject in order to
induce a Th1 immune response a combination of adjuvants, wherein
the combination of adjuvants includes at least one oligonucleotide
containing at least one unmethylated CpG dinucleotide and at least
one non-nucleic acid adjuvant, and wherein the combination of
adjuvants is administered in an effective amount for inducing a Th1
immune response. In one embodiment the combination of adjuvants is
administered simultaneously. In another embodiment the combination
of adjuvants is administered sequentially. In some embodiments the
combination of adjuvants is administered in an effective amount for
inducing a synergistic Th1 immune response. In another aspect, the
same method is performed but the subject is an infant and the Th1
response can be induced using CpG DNA alone, or CpG DNA in
combination with a non-nucleic acid adjuvant at the same or
different site, at the same or different time.
[0010] The invention in other aspects is a composition of a
synergistic combination of adjuvants. The composition includes an
effective amount for inducing a synergistic adjuvant response of a
combination of adjuvants, wherein the combination of adjuvants
includes at least one oligonucleotide containing at least one
unmethylated CpG dinucleotide and at least one non-nucleic acid
adjuvant. The composition may also include at least one antigen,
which may be selected from the group consisting of peptides,
polypeptides, cells, cell extracts, polysaccharides, polysaccharide
conjugates, lipids, glycolipids and carbohydrates. Antigens may be
given in a crude, purified or recombinant form and
polypeptide/peptide antigens, including peptide mimics of
polysaccharides, may also be encoded within nucleic acids. Antigens
may be derived from an infectious pathogen such as a virus,
bacterium, fungus or parasite, or the antigen may be a tumor
antigen, or the antigen may be an allergen.
[0011] According to other aspects the invention includes a method
for immunizing an infant. The method involves the step of
administering to an infant an antigen and an oligonucleotide
containing at least one unmethylated CpG dinucleotide and at least
one non-nucleic acid adjuvant in an effective amount for inducing
cell mediated immunity or Th1-like responses in the infant. The
method may also involve the step of administering at least one
non-nucleic acid adjuvant.
[0012] The CpG oligonucleotide may be administered with any or all
of the administrations of antigen. For instance the CpG
oligonucleotide or the combination of adjuvants may be administered
with a priming dose of antigen. In another embodiment the CpG
oligonucleotide or the combination of adjuvants is administered
with a boost dose of antigen. In some embodiments the subject is
administered a priming dose of antigen and oligonucleotide
containing at least one unmethylated CpG dinucleotide before the
boost dose. In yet other embodiments the subject is administered a
boost dose of antigen and oligonucleotide containing at least one
unmethylated CpG dinucleotide after the priming dose.
[0013] The invention in other aspects includes a method of inducing
a stronger Th1 immune response in a subject being treated with a
non-nucleic acid adjuvant. The method involves the steps of
administering to a subject receiving an antigen and at least one
non-nucleic acid adjuvant and at least one oligonucleotide
containing at least one unmethylated CpG dinucleotide in order to
induce a stronger Th1 immune response than either the adjuvant or
oligonucleotide produces alone.
[0014] The invention in other aspects include a method of inducing
a non-antigen-specific Th1-type immune response, including Th1
cytokines such as IL-12 and IFN-.gamma., for temporary protection
against various pathogens including viruses, bacteria, parasites
and fungi. The method involves the steps of administering to a
subject at least one non-nucleic acid adjuvant and at least one
oligonucleotide containing at least one unmethylated CpG
dinucleotide in order to induce a Th1 innate immune response. For
longer term protection, these adjuvants may be administered more
than once. In another embodiment, CpG DNA may be used alone at one
or more of the administrations.
[0015] In each of the above described embodiments a CpG
oligonucleotide is used as an adjuvant. The oligonucleotide in one
embodiment contains at least one unmethylated CpG dinucleotide
having a sequence including at least the following formula:
5'X.sub.1 X.sub.2CGX.sub.3 X.sub.4 3'
[0016] wherein C and G are unmethylated, wherein X.sub.1X.sub.2 and
X.sub.3X.sub.4 are nucleotides. In one embodiment the 5'X.sub.1
X.sub.2CGX.sub.3 X.sub.4 3' sequence is a non-palindromic
sequence.
[0017] The oligonucleotide may be modified. For instance, in some
embodiments at least one nucleotide has a phosphate backbone
modification. The phosphate backbone modification may be a
phosphorothioate or phosphorodithioate modification. In some
embodiments the phosphate backbone modification occurs on the 5'
side of the oligonucleotide or the 3' side of the
oligonucleotide.
[0018] The oligonucleotide may be any size. Preferably the
oligonucleotide has 8 to 100 nucleotides. In other embodiments the
oligonucleotide is 8 to 40 nucleotides in length.
[0019] In some embodiments X.sub.1X.sub.2 are nucleotides selected
from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT,
CpA, CpG, TpA, TpT, and TpG; and X.sub.3X.sub.4 are nucleotides
selected from the group consisting of: TpT, CpT, ApT, TpG, ApG,
CpG, TpC, ApC, CpC, TpA, ApA, and CpA. Preferably X.sub.1X.sub.2
are GpA or GpT and X.sub.3X.sub.4 are TpT. In other preferred
embodiments X.sub.1 or X.sub.2 or both are purines and X.sub.3 or
X.sub.4 or both are pyrimidines or X.sub.1X.sub.2 are GpA and
X.sub.3 or X.sub.4 or both are pyrimidines. In one embodiment
X.sub.2 is a T and X.sub.3 is a pyrimidine. The oligonucleotide may
be isolated or synthetic.
[0020] The invention also includes the use of a non-nucleic acid
adjuvant in some aspects. The non-nucleic acid adjuvant in some
embodiments is an adjuvant that creates a depo effect, an immune
stimulating adjuvant, or an adjuvant that creates a depo effect and
stimulates the immune system. Preferably the adjuvant that creates
a depo effect is selected from the group consisting of alum (e.g.,
aluminum hydroxide, aluminum phosphate) emulsion based formulations
including mineral oil, non-mineral oil, water-in-oil or
oil-in-water emulsions, such as the Seppic ISA series of Montanide
adjuvants; MF-59; and PROVAX. In some embodiments the immune
stimulating adjuvant is selected from the group consiting of
saponins purified from the bark of the Q. saponaria tree, such as
QS21; poly[di(carboxylatophenoxy)phosphazene (PCPP) derivatives of
lipopolysaccharides such as monophosphorlyl lipid (MPL), muramyl
dipeptide (MDP) and threonyl muramyl dipeptide (tMDP); OM-174; and
Leishmania elongation factor. In one embodiment the adjuvant that
creates a depo effect and stimulates the immune system is selected
from the group consiting of ISCOMS; SB-AS2; SB-AS4; non-ionic block
copolymers that form micelles such as CRL 1005; and Syntex Adjuvant
Formulation.
[0021] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 has two graphs illustrating humoral and cytotoxic
T-lymphocyte (CTL) responses in adult BALB/c mice immunized with 1
.mu.g recombinant HBsAg protein alone, adsorbed onto alum (25 mg
Al.sup.3+/mg HBsAg), with 100 .mu.g of immunostimulatory CpG ODN
1826, or with both alum and CpG ODN. Left panel: Each point
represents the group mean (n=10) for titers of anti-HBs (total IgG)
as determined in triplicate by end-point dilution ELISA assay.
End-point titers were defined as the highest plasma dilution that
resulted in an absorbance value (OD 450) two times greater than
that of control non-immune plasma with a cut-off value of 0.05.
Right panel: Each point represents the mean % specific lysis at the
indicated effector: target (E:T) cell ratio in a chromium release
assay with HBsAg-expressing cells as targets.
[0023] FIG. 2 is a graph illustrating humoral responses in adult
BALB/c mice immunized with 1 .mu.g recombinant HBsAg protein, with
or without alum, and with 0, 0.1, 1, 10, 100 or 500 .mu.g of CpG
ODN 1826 added. Each point represents the group mean (n=10) for
anti-HBs titers (total IgG) as determined by end-point dilution
ELISA assay.
[0024] FIG. 3 is a graph illustrating humoral responses in adult
BALB/c mice immunized with 1 .mu.g recombinant HBsAg protein, with
or without alum, and with one of several different oligonucleotides
(ODN, 10 .mu.g). The ODN were made with a natural phosphodiester
backbone (O), synthetic phosphorothioate backbone (S) or a chimeric
of phosphodiester center regions and phosphorothioate ends (SOS).
Most of the ODN contained 1-3 CpG motifs but some of the ODN were
non-CpG controls (1911, 1982, 2041). Each point represents the
group mean (n=5) for anti-HBs titers (total IgG) as determined by
end-point dilution ELISA assay.
[0025] FIG. 4 is a graph of CTL responses in adult BALB/c mice
immunized with 1 .mu.g recombinant HBsAg protein with alum (25 mg
Al.sup.3+/mg HBs/Ag), with 10 .mu.g of CpG ODN 1826, or with both
alum and CpG ODN. Some animals were boosted with the same or a
different formulation after 8 weeks. Each point represents the
group mean (n=5) for % specific lysis of HBsAg-expressing target
cell at various effector:target (E:T) cell ratios.
[0026] FIG. 5 is a graph of humoral responses in BALB/c mice
immunized with HBsAg (1 .mu.g) without adjuvant or with various
adjuvants alone or in combination. The adjuvants were: alum (25 mg
Al.sup.3+/mg HBs/Ag), with CpG DNA (10 .mu.g CpG ODN 1826),
monophosphoryl lipid A (MPL, 50 .mu.g) and Freund's complete
adjuvant (mixed 1:1 v/v with HBsAg solution). Each point represents
the group mean (n=10) for anti-HBS titers (total IgG) as determined
by end-point dilution ELISA assay 4 weeks after immunization.
[0027] FIG. 6 is a bar graph depicting the amount of total IgG
(end-point ELISA titer) produced at 4 weeks in BALB/c mice
immunized with 1 .mu.g of HBsAg with or without CpG and/or IFA
(mineral oil mixed 1:1 v/v) or CFA (complete Freund's adjuvant
mixed 1:1 v/v). The numbers above each bar indicate the IgG2a:IgG1
ratio, with a number in excess of 1 indicating a more Th1-like
response.
[0028] FIG. 7 is a bar graph depicting the amount of total IgG
produced at 4 weeks in BALB/c mice immunized with 1 .mu.g of HBsAg
with or without CpG and/or MPL (monophosphoryl lipid A, 50 .mu.g)
or alum. The numbers above each bar indicate the IgG2a:IgG1 ratio,
with a number in excess of 1 indicating a more Th1-like
response.
[0029] FIG. 8 is a graph of the percent of young BALB/c mice that
seroconverted (end-point dilution titer >100) after immunization
at <1, 3, 7 or 14 days of age. Mice were immunized with 10 .mu.g
HBsAg-expressing DNA vaccine (pCMV-S), or with recombinant HBsAg (1
.mu.g) with alum (25 mg Al3+/mg HBsAg), CpG ODN 1826 (10 .mu.g) or
both alum and CpG ODN. Each point represents the proportion of mice
responding, the numbers above the bars show the number of
responding over the total number immunized.
[0030] FIG. 9 has two graphs illustrating humoral and cytotoxic
T-lymphocyte (CTL) responses in BALB/c mice immunized at 7 days of
age with a DNA vaccine (1 .mu.g pCMV-S), or with 1 .mu.g
recombinant HBsAg protein alone, adsorbed onto alum (25 mg
Al.sup.3+/mg HBsAg), with 100 .mu.g of immunostimulatory CpG ODN
1826, or with both alum and CpG ODN. Upper panel: Each point
represents the group mean of animals that seroconverted (see FIG. 8
for numbers of animals) for titers of anti-HBs (total IgG) as
determined in triplicate by end-point dilution ELISA assay.
End-point titers were defined as the highest plasma dilution that
resulted in an absorbance value (OD 450) two times greater than
that of control non-immune plasma with a cut-off value of 0.05.
Lower panel: Each point represents the mean % specific lysis at the
indicated effector: target (E:T) cell ratio in a chromium release
assay with HBsAg-expressing cells as targets.
[0031] FIG. 10 is a bar graph illustrating humoral responses in
neonatal BALB/c mice at 8 weeks after immunization (at 7 days of
age) with 1 .mu.g recombinant HBsAg protein with alum (25 mg
Al.sup.3+/mg HBsAg), with 10 .mu.g of CpG ODN 1826, or with both
alum and CpG ODN. Each point represents the group mean (see FIG. 8
for numbers of animals) for anti-HBs titers (IgG1 and IgG2a
isotypes) as determined by end-point dilution ELISA assay. IgG1
antibodies indicate a Th2-biased response whereas IgG2a antibodies
are indicative of a Th1-type response.
[0032] FIG. 11 is a graph of humoral responses in juvenile
Cynomolgus monkeys immunized with Engerix-B vaccine (10 .mu.g
recombinant HBsAg protein with alum, SmithKline Beecham
biologicals, Rixensart, BE) or with Engerix-B plus 500 .mu.g of CpG
ODN 1968. Each point represents the group mean (n=5) for anti-HBs
titers in milli-International units/ml (mIU/ml). A titer of 10
mIU/ml is considered protective in humans.
[0033] FIG. 12 is a bar graph depicting titers of antibodies
against HBsAg (anti-HBs) in milliInternational Units per millilitre
(mIU/ml) in orangutans immunized with 10 .mu.g HBsAg with alum
(like the HBV commercial vaccine), CpG oligonucleotides (CpG ODN
2006, 1 mg) or both alum and CpG ODN. The numbers above the bars
show the number of animals with seroconversion (upper numbers,
>1 mIU/ml) or with seroprotection (lower numbers, >10 mIU/ml)
over the total number of animals immunized. A titer of 10 mIU/ml is
considered sufficient to protect humans and great apes against
infection.
DETAILED DESCRIPTION OF THE INVENTION
[0034] The invention in one aspect is based on the discovery that
formulations containing combinations of immunostimulatory CpG
oligonucleotides and non-nucleic acid adjuvants synergistically
enhance immune responses to a given antigen. Different non-nucleic
acid adjuvants used in combination in the prior art have different
affects on immune system activation. Some combinations of adjuvants
produce an antigen-specific response that is no better than the
best of the individual components and some combinations even
produce lower antigen specific responses than with the individual
adjuvants used alone. In Gordon et al., for instance, when humans
were immunized with C terminal recombinant malaria circumsporozite
antigen with alum alone or alum in combination with monophosphoryl
lipid A (MPL), the subjects receiving alum alone developed higher
antigen specific antibodies at several time points than subjects
receiving the combination of adjuvants.
[0035] It has been discovered according to the invention that the
combination of immunostimulatory CpG oligonucleotides and alum, MPL
and other adjuvants results in a synergistic immune response.
Compared with the recombinant hepatitis B surface antigen (HBsAg)
protein vaccine alone, addition of alum increases the level of
antibodies in mice against HBsAg (anti-HBs) about 7-fold whereas
addition of CpG ODN increases them 32-fold. When CpG ODN and alum
are used together, a 500-1000 times higher level of anti-HBs was
observed, indicating a strong synergistic response. Additionally,
it was found according to the invention that immunization with
HBsAg and alum resulted in a strong Th2-type response with almost
all IgG being of the IgG1 isotype. CpG ODN induced a high
proportion of IgG2a, indicative of a Th1-type response, even in the
presence of alum. Furthermore, it was discovered according to the
invention that in very young mice (7 day old), immune responses
were induced by HBsAg with alum and CpG ODN but not with alum or
CpG ODN alone. The antibodies produced with CpG ODN were
predominantly of the IgG2a isotype, indicating a strong Th1-type
response. This is remarkable considering the strong Th2 bias of the
neonatal immune system and the known difficulty in inducing Th1
responses at such a young age. Th1 responses are preferable in some
instances since they are associated with IgG2a antibodies that have
better neutralization and opsonization capabilities than Th2-type
antibodies. As well, Th1 responses are associated with cytotoxic T
lymphocytes (CTL) that can attack and kill virus-infected cells.
Indeed, CpG ODN, alone or in combination with alum induced good CTL
activity in both adult and neonatal mice. These studies demonstrate
that the addition of CpG ODN to protein or DNA vaccines in
combination with other adjuvants is a valid new adjuvant approach
to improve efficacy.
[0036] Thus in one aspect the invention is a method of inducing an
antigen specific immune response in a subject. The method includes
the step of administering to the subject in order to induce an
antigen specific immune response an antigen and a combination of
adjuvants, wherein the combination of adjuvants includes at least
one oligonucleotide containing at least one unmethylated CpG
dinucleotide and at least one non-nucleic acid adjuvant, and
wherein the combination of adjuvants is administered in an
effective amount for inducing a synergistic adjuvant response.
[0037] The synergistic combination of adjuvants is particularly
useful as a prophylactic vaccine for the treatment of a subject at
risk of developing an infection with an infectious organism or a
cancer in which a specific cancer antigen has been identified or an
allergy where the allergen is known. The combination of adjuvants
can also be given without the antigen or allergen for shorter term
protection against infection, allergy or cancer, and in this case
repeated doses will allow longer term protection. A "subject at
risk" as used herein is a subject who has any risk of exposure to
an infection causing pathogen or a cancer or an allergen or a risk
of developing cancer. For instance, a subject at risk may be a
subject who is planning to travel to an area where a particular
type of infectious agent is found or it may be a subject who
through lifestyle or medical procedures is exposed to bodily fluids
which may contain infectious organisms or even any subject living
in an area that an infectious organism or an allergen has been
identified. Subjects at risk of developing infection also include
general populations to which a medical agency recommends
vaccination with a particular infectious organism antigen. If the
antigen is an allergen and the subject develops allergic responses
to that particular antigen and the subject is exposed to the
antigen, i.e., during pollen season, then that subject is at risk
of exposure to the antigen.
[0038] There is a need for a prophylactic vaccine that can induce
protective immunity against many infectious pathogens more quickly
and with fewer doses than traditional vaccines can provide. For
instance, fewer than 20% of healthy individuals attain protective
levels of anti-hepatitis B (HB) antibodies (10 mIU/ml) after a
single dose of subunit hepatitis B Vaccine (HBV) vaccine and only
60-70% reach this level after two doses. Thus, three doses (usually
given at 0, 1 and 6 months) are required to seroconvert >90% of
vaccinated individuals. The three dose regime is frequently not
completed owing to poor patient compliance, and in endemic areas,
protective levels may not be induced quickly enough. The methods of
the invention are particularly useful as prophylactic treatments
because they induce higher levels of antibodies than can be
achieved with traditional vaccines and can be administered as fewer
total doses.
[0039] Additionally between 5 and 10% of individuals are
non-responders or hypo-responders to the subunit HBsAg vaccine.
This may be MHC-restricted (Kruskall et al., 1992) and is thought
to result from a failure to recognize T-helper epitopes. In certain
immunocompromised individuals (e.g., kidney dialysis patients,
alcoholics) the rate of non-response can approach 50%. As set forth
in the Examples below, alum plus CpG ODN gave higher anti-HBs
titers than alum alone in a strain of mice which has MHC-restricted
hypo-responsiveness to HBsAg, thought to result in a failure to
recognize T-helper epitopes. CpG ODN also overcame non-response in
mice genetically incapable of providing T-help owing to an absence
of class II MHC. Similar results were obtained in orangutans at
risk of becoming infected with hepatitis B. It was found that
orangutans are hyporesponders to the classical alum-adjuvanted
vaccine with less than 10% achieving seroprotection after 2 doses,
but that nearly 100% of animals responded with use of CpG
oligonucleotides alone or combined with alum. The synergistic
response was evident because antibody titers were much higher with
CpG ODN plus alum than with CpG ODN alone or alum alone and were
more than additive. These results support the proposition that CpG
ODN drives the T cell independent activation of B cells. Thus in
addition to providing a more effective and easier vaccination
protocol the synergistic combination of adjuvants can be used to
reduce the percentage of non-responders and hypo-responders.
[0040] A subject at risk of developing a cancer is one who is who
has a high probability of developing cancer. These subjects
include, for instance, subjects having a genetic abnormality, the
presence of which has been demonstrated to have a correlative
relation to a higher likelihood of developing a cancer and subjects
exposed to cancer causing agents such as tobacco, asbestos, or
other chemical toxins, or a subject who has previously been treated
for cancer and is in apparent remission. When a subject at risk of
developing a cancer is treated with an antigen specific for the
type of cancer to which the subject is at risk of developing and an
adjuvant and a CpG oligonucleotide the subject may be able to kill
of the cancer cells as they develop. If a tumor begins to form in
the subject, the subject will develop a specific immune response
against the tumor antigen.
[0041] In addition to the use of the combination of adjuvants for
prophylactic treatment, the invention also encompasses the use of
the combination for the immunotherapeutic treatment of a subject
having an infection, an allergy or a cancer. A "subject having an
infection" is a subject that has been exposed to an infectious
pathogen and has acute or chronic detectable levels of the pathogen
in the body. The combination of adjuvants can be used with an
antigen to mount an antigen specific immune response that is
capable of reducing the level of or eradicating the infectious
pathogen. An infectious disease, as used herein, is a disease
arising from the presence of a foreign microorganism in the
body.
[0042] Many types of infectious pathogens do not have any effective
treatments and chronic presence of the pathogen can result in
significant damage. For instance, the HBV virus is itself
non-pathogenic but with chronic infection the partially developed
immune response causes inflammatory changes that eventually leads
to cirrhosis and increased risk of hepatocellular carcinoma. An
estimated one million people die each year from HBV-related liver
disease. Persistent HBV infection of the liver results when acute
infection fails to launch an appropriate immune response to clear
the virus. Such chronic carriers have circulating HBsAg "e" soluble
form of the HBV core antigen (HBeAg) without specific immunity. It
is thought that the absence of HBV-specific T-cells, including CTL
may contribute to the establishment and maintenance of the chronic
carrier state. Indeed, many previously infected individuals, even
years after clinical and serological recovery, have traces of HBV
in their blood and HBV-specific CTL that express activation markers
indicative of recent contact with antigen (Rehermann et al., 1996).
These results suggest that sterilizing immunity may not occur after
HBV infection and that chronic activation of HBV-specific CD4+ and
CD8+ T-cells is responsible for keeping the virus under
control.
[0043] There is currently no cure for the HBV chronic infection.
Interferon is used currently but this cures only 10-20% of treated
individuals (Niederau et al., 1996). Anti-viral drugs e.g.,
lamivudine) can reduce circulating virus to undetectable levels,
however these return to pretreatment levels if the drug is stopped.
Each of these types of treatment is also expensive and has certain
undesirable side-effects. Thus the synergistic combination of
adjuvants which induces potent Th1 responses, including CTL, is
useful for treating a subject having an infection such as HBV.
[0044] A "subject having an allergy" is a subject that has or is at
risk of developing an allergic reaction in response to an allergen.
An "allergy" refers to acquired hypersensitivity to a substance
(allergen). Allergic conditions include but are not limited to
eczema, allergic rhinitis or coryza, conjunctivitis, hay fever,
bronchial asthma, urticaria (hives) and food allergies, and other
atopic conditions.
[0045] Currently, allergic diseases are generally treated either
symptomatically with antihistimines for example or
immunotherapeutically by the injection of small doses of antigen
followed by subsequent increasing dosage of antigen. Symptomatic
treatment offers only temporary relief. Immunotherapy is believed
to induce tolerance to the allergen to prevent further allergic
reactions. This approach, however, takes several years to be
effective and is associated with the risk of side effects such as
anaphylactic response. The methods of the invention avoid these
problems.
[0046] Allergies are generally caused by IgE antibody generation
against harmless allergens. The cytokines that are induced by
unmethylated CpG oligonucleotides are predominantly of a class
called "Th1" which includes IL-12 and IFN-.gamma.. In contrast, Th2
immune response are associated with the production of IL-4, IL-5
and IL-10. Th1 responses include both cell-mediated responses
(including cytotoxic T-cells) and antibodies, whereas Th2 responses
are associated only with antibodies. The antibodies with a Th1
response are of isotypes (e.g. IgG2a) that have better neutralizing
and opsonizing capabilities than those of Th2 isotypes (e.g. IgE
that mediates allergic responses). In general, it appears that
allergic diseases are mediated by Th2 type immune responses and
protective immune responses by Th1 immune response although
exaggerated Th1 responses may be also associated with autoimmune
diseases.
[0047] Th2 cytokines, especially IL-4 and IL-5 are elevated in the
airways of asthmatic subjects. These cytokines promote important
aspects of the asthmatic inflammatory response, including IgE
isotype switching, eosinophil chemotaxis and activation and mast
cell growth. Th1 cytokines, especially IFN-.gamma. and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines. "Asthma" refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
[0048] Based on the ability of the CpG oligonucleotides to shift
the immune response in a subject from a Th2 (which is associated
with production of IgE antibodies and allergy) to a Th1 response
(which is protective against allergic reactions), an effective dose
of a CpG oligonucleotide can be administered to a subject to treat
or prevent an allergy.
[0049] Since Th1 responses are even more potent with CpG DNA
combined with non-nucleic acid adjuvants, the combination of
adjuvants of the present invention will have significant
therapeutic utility in the treatment of allergic conditions such as
asthma. Such combinations of adjuvants could be used alone or in
combination with allergens.
[0050] A "subject having a cancer" is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g. small cell and non-small cell); melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer;
prostate cancer; rectal cancer; sarcomas; skin cancer; testicular
cancer; thyroid cancer; and renal cancer, as well as other
carcinomas and sarcomas.
[0051] A "subject" shall mean a human or vertebrate animal
including but not limited to a dog, cat, horse, cow, pig, sheep,
goat, chicken, primate, (e.g., monkey), fish (aquaculture species
e.g. salmon, trout and other salmonids), rat, and mouse.
[0052] The subject is administered a combination of adjuvants,
wherein the combination of adjuvants includes at least one
oligonucleotide containing at least one unmethylated CpG
dinucleotide and at least one non-nucleic acid adjuvant. An
oligonucleotide containing at least one unmethylated C pG
dinucleotide is a nucleic acid molecule which contains an
unmethylated cytosine-guanine dinucleotide sequence (i.e. "CpG DNA"
or DNA containing a 5' cytosine followed by 3' guanosine and linked
by a phosphate bond) and activates the immune system. The CpG
oligonucleotides can be double-stranded or single-stranded.
Generally, double-stranded molecules are more stable in vivo, while
single-stranded molecules have increased immune activity. The CpG
oligonucleotides or combination of adjuvants can be used with or
without antigen.
[0053] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acid molecules can
be obtained from existing nucleic acid sources (e.g. genomic or
cDNA), but are preferably synthetic (e.g. produced by
oligonucleotide synthesis). The entire CpG oligonucleotide can be
unmethylated or portions may be unmethylated but at least the C of
the 5.degree. CG 3' must be unmethylated.
[0054] In one preferred embodiment the invention provides a CpG
oligonucleotide represented by at least the formula:
5'N.sub.1X.sub.1CGX.sub.2N.sub.23'
[0055] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1 is adenine, guanine, or thymine; X.sub.2 is cytosine,
adenine, or thymine; N is any nucleotide and N.sub.1 and N.sub.2
are nucleic acid sequences composed of from about 0-25 N's
each.
[0056] In another embodiment the invention provides an isolated CpG
oligonucleotide represented by at least the formula:
5'N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.23'
[0057] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1X.sub.2 are nucleotides selected from the group consisting
of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG;
and X.sub.3X.sub.4 are nucleotides selected from the group
consisting of: TpT, CpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA,
ApA, and CpA; N is any nucleotide and N.sub.1 and N.sub.2 are
nucleic acid sequences composed of from about 0-25 N's each.
Preferably X.sub.1X.sub.2 are GpA or GpT and X.sub.3X.sub.4 are
TpT. In other preferred embodiments X.sub.1 or X.sub.2 or both are
purines and X.sub.3 or X.sub.4 or both are pyrimidines or
X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or both are
pyrimidines. In a preferred embodiment N.sub.1 and N.sub.2 of the
nucleic acid do not contain a CCGG or CGCG quadmer or more than one
CCG or CGG trimer. The effect of a a CCGG or CGCG quadmer or more
than one CCG or CGG trimer depends in part on the status of the
oligonucleotide backbone. For instance, if the oligonucleotide has
a phosphodiester backbone or a chimeric backbone the inclusion of
these sequences in the oligonucleotide will only have minimal if
any affect on the biological activity of the oligonucleotide. If
the backbone is completely phosphorothioate or significantly
phosphorothioate then the inclusion of these sequences may have
more influence on the biological activity or the kinetics of the
biological activity. In another preferred embodiment the CpG
oligonucleotide has the sequence
5'TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub- .43'.
[0058] Preferably the CpG oligonucleotides of the invention include
X.sub.1X.sub.2 selected from the group consisting of GpT, GpG, GpA
and ApA and X.sub.3X.sub.4 is selected from the group consisting of
TpT, CpT and GpT. For facilitating uptake into cells, CpG
containing oligonucleotides are preferably in the range of 8 to 30
bases in length. However, nucleic acids of any size greater than 8
nucleotides (even many kb long) are capable of inducing an immune
response according to the invention if sufficient immunostimulatory
motifs are present, since larger nucleic acids are degraded into
oligonucleotides inside of cells. Preferred synthetic
oligonucleotides do not include a CCGG or CGCG quadmer or more than
one CCG or CGG trimer at or near the 5' and/or 3' terminals.
Stabilized oligonucleotides, where the oligonucleotide incorporates
a phosphate backbone modification, as discussed in more detail
below are also preferred. The modification may be, for example, a
phosphorothioate or phosphorodithioate modification. Preferably,
the phosphate backbone modification occurs at the 5' end of the
nucleic acid for example, at the first two nucleotides of the 5'
end of the oligonucleotide. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid. Alternatively the oligonucleotide may be completely or
partially modified.
[0059] Preferably the CpG oligonucleotide is in the range of
between 8 and 100 and more preferably between 8 and 30 nucleotides
in size. Alternatively, CpG oligonucleotides can be produced on a
large scale in plasmids. These may be administered in plasmid form
or alternatively they can be degraded into oligonucleotides.
[0060] The CpG oligonucleotide and immunopotentiating cytokine may
be directly administered to the subject or may be administered in
conjunction with a nucleic acid delivery complex. A "nucleic
acid/cytokine delivery complex" shall mean a nucleic acid molecule
and/or cytokine associated with (e.g. ionically or covalently bound
to; or encapsulated within) a targeting means (e.g. a molecule that
results in higher affinity binding to target cell (e.g. dendritic
cell surfaces and/or increased cellular uptake by target cells).
Examples of nucleic acid/cytokine delivery complexes include
nucleic acids/cytokines associated with: a sterol (e.g.
cholesterol), a lipid (e.g. a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g. a ligand
recognized by target cell specific receptor). Preferred complexes
should be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex should be cleavable under appropriate conditions within
the cell so that the nucleic acid/cytokine is released in a
functional form.
[0061] "Palindromic sequence" shall mean an inverted repeat (i.e. a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double-stranded structures. In one embodiment
the CpG oligonucleotide contains a palindromic sequence. A
palindromic sequence used in this context refers to a palindrome in
which the CpG is part of the palindrome, and preferably is the
center of the palindrome. In another embodiment the CpG
oligonucleotide is free of a palindrome. A CpG oligonucleotide that
is free of a palindrome is one in which the CpG dinucleotide is not
part of a palindrome. Such an oligonucleotide may include a
palindrome in which the CpG is not part of the palindrome.
[0062] A "stabilized nucleic acid molecule" shall mean a nucleic
acid molecule that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease). Stabilization can be a
function of length or secondary structure. Unmethylated CpG
oligonucleotides that are tens to hundreds of kbs long are
relatively resistant to in vivo degradation, particularly when in a
double-stranded closed-circular form (i.e., a plamid). For shorter
CpG oligonucleotides, secondary structure can stabilize and
increase their effect. For example, if the 3' end of an
oligonucleotide has self-complementarity to an upstream region, so
that it can fold back and form a sort of stem loop structure, then
the oligonucleotide becomes stabilized and therefore exhibits more
activity.
[0063] Preferred stabilized oligonucleotides of the instant
invention have a modified backbone. It has been demonstrated that
modification of the oligonucleotide backbone provides enhanced
activity of the CpG oligonucleotides when administered in vivo. CpG
constructs, including at least two phosphorothioate linkages at the
5' end of the oligonucleotide in multiple phosphorothioate linkages
at the 3' end, preferably 5, provides maximal activity and
protected the oligonucleotide from degradation by intracellular
exo- and endo-nucleases. Other modified oligonucleotides include
phosphodiester modified oligonucleotide, combinations of
phosphodiester and phosphorothioate oligonucleotide,
methylphosphonate, methylphosphorothioate, phosphorodithioate, and
combinations thereof. Each of these combinations and their
particular effects on immune cells is discussed in more detail in
copending PCT Published Patent Applications claiming priority to
U.S. Ser. Nos. 08/738,652 and 08/960,774, filed on Oct. 30, 1996
and Oct. 30, 1997 respectively, the entire contents of which is
hereby incorporated by reference. It is believed that these
modified oligonucleotides may show more stimulatory activity due to
enhanced nuclease resistance, increased cellular uptake, increased
protein binding, and/or altered intracellular localization.
[0064] Both phosphorothioate and phosphodiester oligonucleotides
containing CpG motifs are active in immune cells. However, based on
the concentration needed to induce CpG specific effects, the
nuclease resistant phosphorothioate backbone CpG oligonucleotides
are more potent (2 .mu.g/ml for the phosphorothioate vs. a total of
90 .mu.g/ml for phosphodiester).
[0065] Other stabilized oligonucleotides include: nonionic DNA
analogs, such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Oligonucleotides which contain diol,
such as tetraethyleneglycol or hexaethyleneglycol, at either or
both termini have also been shown to be substantially resistant to
nuclease degradation.
[0066] The nucleic acid sequences of the invention which are useful
as adjuvants are those broadly described above and disclosed in PCT
Published Patent Applications claiming priority to U.S. Ser. Nos.
08/738,652 and 08/960,774, filed on Oct. 30, 1996 and Oct. 30, 1997
respectively. Exemplary sequences include but are not limited to
those immunostimulatory sequences shown in Table 1.
[0067] The stimulation index of a particular immunostimulatory CpG
DNA can be tested in various immune cell assays. Preferably, the
stimulation index of the CpG oligonucleotide with regard to B cell
proliferation is at least about 5, preferably at least about 10,
more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with 20 .mu.M of
oligonucleotide for 20 h at 37.degree. C. and has been pulsed with
1 .mu.Ci of .sup.3H uridine; and harvested and counted 4 h later as
described in detail in copending PCT Published Patent Applications
claiming priority to U.S. Ser. Nos. 08/738,652 and 08/960,774,
filed on Oct. 30, 1996 and Oct. 30, 1997 respectively. For use in
vivo, for example, it is important that the CpG oligonucleotide and
adjuvant be capable of effectively inducing activation of Ig
expressing B cells. Oligonucleotides which can accomplish this
include, for example, but are not limited to those oligonucleotides
described in PCT Published Patent Applications claiming priority to
U.S. Ser. Nos. 08/738,652 and 08/960,774, filed on Oct. 30, 1996
and Oct. 30, 1997 respectively.
[0068] The oligonucleotide containing at least one unmethylated CpG
is used in combination with a non-nucleic acid adjuvant and an
antigen to activate the immune response. A "non-nucleic acid
adjuvant" is any molecule or compound except for the CpG
oligonucleotides described herein which can stimulate, the humoral
and/or cellular immune response. Non-nucleic acid adjuvants
include, for instance, adjuvants that create a depo effect, immune
stimulating adjuvants, and adjuvants that create a depo effect and
stimulate the immune system. In infants, the oligonucleotide
containing at least one unmethylated CpG is used alone or in
combination with a non-nucleic acid adjuvant and an antigen to
activate a cellular immune response.
[0069] An "adjuvant that creates a depo effect" as used herein is
an adjuvant that causes the antigen to be slowly released in the
body, thus prolonging the exposure of immune cells to the antigen.
This class of adjuvants includes but is not limited to alum (e.g.,
aluminum hydroxide, aluminum phosphate); or emulsion-based
formulations including mineral oil, non-mineral oil, water-in-oil
or oil-in-water-in oil emulsion, oil-in-water emulsions such as
Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720,
AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing
a stabilizing detergent and a micelle-forming agent; IDEC,
Pharmaceuticals Corporation, San Diego, Calif.).
[0070] An "immune stimulating adjuvant" is an adjuvant that causes
activation of a cell of the immune system. It may, for instance,
cause an immune cell to produce and secrete cytokines. This class
of adjuvants includes but is not limited to saponins purified from
the bark of the Q. saponaria tree, such as QS21 (a glycolipid that
elutes in the 21.sup.st peak with HPLC fractionation; Aquila
Biopharmaceuticals, Inc., Worcester, Mass.);
poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus
Research Institute, USA); derivatives of lipopolysaccharides such
as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) andthreonyl-muramyl
dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related
to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania
elongation factor (a purified Leishmania protein; Corixa
Corporation, Seattle, Wash.).
[0071] "Adjuvants that create a depo effect and stimulate the
immune system" are those compounds which have both of the above-
identified functions. This class of adjuvants includes but is not
limited to ISCOMS (Immunostimulating complexes which contain mixed
saponins, lipids and form virus-sized particles with pores that can
hold antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline
Beecham adjuvant system #2 which is an oil-in-water emulsion
containing MPL and QS21: SmithKline Beecham Biologicals [SBB],
Rixensart, Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4
which contains alum and MPL; SBB, Belgium); non-ionic block
copolymers that form micelles such as CRL 1005 (these contain a
linear chain of hydrophobic polyoxpropylene flanked by chains of
polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant
Formulation (SAF, an oil-in-water emulsion containing Tween 80 and
a nonionic block copolymer; Syntex Chemicals, Inc., Boulder,
Colo.).
[0072] When the CpG oligonucleotide containing at least one
unmethylated CpG is administered in conjunction with another
adjuvant, the CpG oligonucleotide can be administered before,
after, and/or simultaneously with the other adjuvant. For instance,
the combination of adjuvants may be administered with a priming
dose of antigen. Either or both of the adjuvants may then be
administered with the boost dose. Alternatively, the combination of
adjuvants may be administered with a boost dose of antigen. Either
or both of the adjuvants may then be administered with the prime
dose. A "prime dose" is the first dose of antigen administered to
the subject. In the case of a subject that has an infection the
prime dose may be the initial exposure of the subject to the
infectious microbe and thus the combination of adjuvants is
administered to the subject with the boost dose. A "boost dose" is
a second or third, etc., dose of antigen administered to a subject
that has already been exposed to the antigen. In some cases the
prime dose administered with the combination of adjuvants is so
effective that a boost dose is not required to protect a subject at
risk of infection from being infected. In cases where the
combination of adjuvants is given without antigen, with repeated
administrations, CpG oligonucleotides or one of the components in
the combination may be given alone for one or more of the
administrations.
[0073] The CpG oligonucleotide containing at least one unmethylated
CpG can have an additional efficacy (e.g., antisense) in addition
to its ability to enhance antigen-specific immune responses.
[0074] An "antigen" as used herein is a molecule capable of
provoking an immune response. Antigens include but are not limited
to peptides, polypeptides, cells, cell extracts, polysaccharides,
polysaccharide conjugates, lipids, glycoliopids and carbohydrates.
Antigens may be given in a crude, purified or recombinant form and
polypeptide/peptide antigens, including peptide mimics of
polysaccharides, may also be encoded within nucleic. The term
antigen broadly includes any type of molecule which is recognized
by a host immune system as being foreign. Antigens include but are
not limited to cancer antigens, microbial antigens, and
allergens.
[0075] A "cancer antigen" as used herein is a compound, such as a
peptide, associated with a tumor or cancer cell surface and which
is capable of provoking an immune response when expressed on the
surface of an antigen presenting cell in the context of an MHC
molecule. Cancer antigens can be prepared from cancer cells either
by preparing crude extracts of cancer cells, for example, as
described in Cohen, et al., 1994, Cancer Research, 54:1055, by
partially purifying the antigens, by recombinant technology, or by
de novo synthesis of known antigens. Cancer antigens include
antigens that are recombinately an immunogenic portion of or a
whole tumor or cancer. Such antigens can be isolated or prepared
recombinatly or by any other means known in the art.
[0076] A "microbial antigen" as used herein is an antigen of a
microorganism and includes but is not limited to infectious virus,
infectious bacteria, infectious parasites and infectious fungi.
Such antigens include the intact microorganism as well as natural
isolates and fragments or derivatives thereof and also synthetic
compounds which are identical to or similar to natural
microorganism antigens and induce an immune response specific for
that microorganism. A compound is similar to a natural
microorganism antigen if it induces an immune response (humoral
and/or cellular) to a natural microorganism antigen. Most such
antigens are used routinely in the art and are well known to those
of ordinary skill in the art. Another example is a peptide mimic of
a polysaccharide antigen.
[0077] Examples of infectious virus that have been found in humans
include but are not limited to: Retroviridae (e.g. human
immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadndviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxviridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and
related viruses, and astroviruses).
[0078] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to: Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leplospira, Rickettsia,
and Actinomyces israelli.
[0079] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Examples of infectious parasites include Plasmodium such as
Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and
Plasmodium vivax. Other infectious organisms (i.e. protists)
include Toxoplasma gondii.
[0080] Other medically relevant microorganisms have been descried
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0081] Although many of the microbial antigens described above
relate to human disorders, the invention is also useful for
treating other nonhuman vertebrates. Nonhuman vertebrates are also
capable of developing infections which can be prevented or treated
with the synergistic combination of adjuvants disclosed herein. For
instance, in addition to the treatment of infectious human
diseases, the methods of the invention are useful for treating
infections of animals.
[0082] As used herein, the term "treat", "treated", or "treating"
when used with respect to an infectious disease refers to a
prophylactic treatment which increases the resistance of a subject
(a subject at risk of infection) to infection with a pathogen or,
in other words, decreases the likelihood that the subject will
become infected with the pathogen, as well as a treatment after the
subject (a subject who: has been infected) has become infected in
order to fight the infection, e.g., reduce or eliminate the
infection or prevent it from becoming worse. Many vaccines for the
treatment of non-human vertebrates are disclosed in Bennett, K.
Compendium of Veterinary Products, 3rd ed. North American
Compendiums, Inc., 1995.
[0083] As discussed above, antigens include infectious microbes
such as virus, bacteria, parasites and fungi and fragments thereof,
derived from natural sources or synthetically. Infectious virus of
both human and non-human vertebrates, include retroviruses, RNA
viruses and DNA viruses. This group of retroviruses includes both
simple retroviruses and complex retroviruses. The simple
retroviruses include the subgroups of B-type retroviruses, C-type
retroviruses and D-type retroviruses. An example of a B-type
retrovirus is mouse mammary tumor virus (MMTV). The C-type
retroviruses include subgroups C-type group A (including Rous
sarcoma virus (RSV), avian leukemia virus (ALV), and avian
myeloblastosis virus (AMV)) and C-type group B (including murine
leukemia virus (MLV), feline leukemia virus (FeLV), murine sarcoma
virus (MSV), gibbon ape leukemia virus (GALV), spleen necrosis
virus (SNV), reticuloendotheliosis virus (RV) and simian sarcoma
virus (SSV)). The D-type retroviruses include Mason-Pfizer monkey
virus (MPMV) and simian retrovirus type 1 (SRV-1). The complex
retroviruses include the subgroups of lentiviruses, T-cell leukemia
viruses and the foamy viruses. Lentiviruses include HIV-1, but also
include HIV-2, SIV, Visna virus, feline immunodeficiency virus
(FIV), and equine infectious anemia virus (EIAV). The T-cell
leukemia viruses include HTLV-1, HTLV-II, simian T-cell leukemia
virus (STLV), and bovine leukemia virus (BLV). The foamy viruses
include human foamy virus (HFV), simian foamy virus (SFV) and
bovine foamy virus (BFV).
[0084] Examples of other RNA viruses that are antigens in
vertebrate animals include, but are not limited to, the following:
members of the family Reoviridae, including the genus Orthoreovirus
(multiple scrotypes of both mammalian and avian retroviruses), the
genus Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo
virus, African horse sickness virus, and Colorado Tick Fever
virus), the genus Rotavirus (human rotavirus, Nebraska calf
diarrhea virus, murine rotavirus, simian rotavirus, bovine or ovine
rotavirus, avian rotavirus); the family Picornaviridae, including
the genus Enterovirus (poliovirus, Coxsackie virus A and B, enteric
cytopathic human orphan (ECHO) viruses, hepatitis A virus, Simian
enteroviruses, Murine encephalomyelitis (ME) viruses, Poliovirus
muris, Bovine enteroviruses, Porcine enteroviruses, the genus
Cardiovirus (Encephalomyocarditis virus (EMC), Mengovirus), the
genus Rhinovirus (Human rhinoviruses including at least 113
subtypes; other rhinoviruses), the genus Apthovirus (Foot and Mouth
disease (FMDV); the family Calciviridae, including Vesicular
exanthema of swine virus, San Miguel sea lion virus, Feline
picornavirus and Norwalk virus; the family Togaviridae, including
the genus Alphavirus (Eastern equine encephalitis virus, Semliki
forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong
virus, Ross river virus, Venezuelan equine encephalitis virus,
Western equine encephalitis virus), the genus Flavirius (Mosquito
borne yellow fever virus, Dengue virus, Japanese encephalitis
virus, St. Louis encephalitis virus, Murray Valley encephalitis
virus, West Nile virus, Kunjin virus, Central European tick borne
virus, Far Eastern tick borne virus, Kyasanur forest virus, Louping
III virus, Powassan virus, Omsk hemorrhagic fever virus), the genus
Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease
virus, Hog cholera virus, Border disease virus); the family
Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related
viruses, California encephalitis group viruses), the genus
Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever
virus), the genus Nairovirus (Crimean-Congo hemorrhagic fever
virus, Nairobi sheep disease virus), and the genus Uukuvirus
(Uukuniemi and related viruses); the family Orthomyxoviridae,
including the genus Influenza virus (Influenza virus type A, many
human subtypes); Swine influenza virus, and Avian and Equine
Influenza viruses; influenza type B (many human subtypes), and
influenza type C (possible separate genus); the family
paramyxoviridae, including the genus Paramyxovirus (Parainfluenza
virus type 1, Sendai virus, Hemadsorption virus, Parainfluenza
viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the
genus Morbillivirus (Measles virus, subacute sclerosing
panencephalitis virus, distemper virus, Rinderpest virus), the
genus Pneumovirus (respiratory syncytial virus (RSV), Bovine
respiratory syncytial virus and Pneumonia virus of mice); forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavirius (Mosquito borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine Influenza viruses;
influenza type B (many human subtypes), and influenza type C
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus
of mice); the family Rhabdoviridae, including the genus
Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park virus),
the genus Lyssavirus (Rabies virus), fish Rhabdoviruses, and two
probable Rhabdoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Mouse Hepatitis virus,
Human enteric corona virus, and Feline infectious peritonitis
(Feline coronavirus).
[0085] Illustrative DNA viruses that are antigens in vertebrate
animals include, but are not limited to: the family Poxviridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox,
goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Iridoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine, monkeys and rodents); the
gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A,B,C,D,E and ungrouped; simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses; the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
as Lymphotrophic papilloma virus); the family Parvoviridae
including the genus Adeno-associated viruses, the genus Parvovirus
(Feline panleukopenia virus, bovine parvovirus, canine parvovirus,
Aleutian mink disease virus, etc). Finally, DNA viruses may include
viruses which do not fit into the above families such as Kuru and
Creutzfeldt-Jacob disease viruses and chronic infectious
neuropathic agents (CHINA virus).
[0086] Each of the foregoing lists is illustrative, and is not
intended to be limiting.
[0087] In addition to the use of the combination of CpG
oligonucleotides and non-nucleic acid adjuvants to induce an
antigen specific immune response in humans, the methods of the
preferred embodiments are particularly well suited for treatment of
birds such as hens, chickens, turkeys, ducks, geese, quail, and
pheasant. Birds are prime targets for many types of infections.
[0088] Hatching birds are exposed to pathogenic microorganisms
shortly after birth. Although these birds are initially protected
against pathogens by maternal derived antibodies, this protection
is only temporary, and the bird's own immature immune system must
begin to protect the bird against the pathogens. It is often
desirable to prevent infection in young birds when they are most
susceptible. It is also desirable to prevent against infection in
older birds, especially when the birds are housed in closed
quarters, leading to the rapid spread of disease. Thus, it is
desirable to administer the CpG oligonucleotide and the non-nucleic
acid adjuvant of the invention to birds to enhance an
antigen-specific immune response when antigen is present. The CpG
oligonucleotide and the non-nucleic acid adjuvant of the invention
could also be administered to birds without antigen to protect
against infection of a wide variety of pathogens.
[0089] An example of a common infection in chickens is chicken
infectious anemia virus (CIAV). CIAV was first isolated in Japan in
1979 during an investigation of a Marek's disease vaccination break
(Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV
has been detected in commercial poultry in all major poultry
producing countries (van Bulow et al., 1991, pp. 690-699) in
Diseases of Poultry, 9th edition, Iowa State University Press).
[0090] CIAV infection results in a clinical disease, characterized
by anemia, hemorrhage and immunosuppression, in young susceptible
chickens. Atrophy of the thymus and of the bone marrow and
consistent lesions of CIAV-infected chickens are also
characteristic of CIAV infection. Lymphocyte depletion in the
thymus, and occasionally in the bursa of Fabricius, results in
immunosuppression and increased susceptibility to secondary viral,
bacterial, or fungal infections which then complicate the course of
the disease. The immunosuppression may cause aggravated disease
after infection with one or more of Marek's disease virus (MDV),
infectious bursal disease virus, reticuloendotheliosis virus,
adenovirus, or reovirus. It has been reported that pathogenesis of
MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In Proceedings
of the 38th Western Poultry Diseases Conference, Tempe, Ariz.).
Further, it has been reported that CIAV aggravates the signs of
infectious bursal disease (Rosenberger et al., 1989, Avian Dis.
33:707-713). Chickens develop an age resistance to experimentally
induced disease due to CAA. This is essentially complete by the age
of 2 weeks, but older birds are still susceptible to infection
(Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24,
202-209, 1980). However, if chickens are dually infected with CAA
and an immunosuppressive agent (IBDV, MDV etc.) age resistance
against the disease is delayed (Yuasa, N. et al., 1979 and 1980
supra; Bulow von V. et al., J. Veterinary Medicine 33, 93-116,
1986). Characteristics of CIAV that may potentiate disease
transmission include high resistance to environmental inactivation
and some common disinfectants. The economic impact of CIAV
infection on the poultry industry is clear from the fact that 10%
to 30% of infected birds in disease outbreaks die.
[0091] Vaccination of birds, like other vertebrate animals can be
performed at any age. Normally, vaccinations are performed at up to
12 weeks of age for a live microorganism and between 14-18 weeks
for an inactivated microorganism or other type of vaccine. For in
ovo vaccination, vaccination can be performed in the last quarter
of embryo development. The vaccine may be administered
subcutaneously, by spray, orally, intraocularly, intratracheally,
nasally, in ovo or by other methods described herein. Thus, the CpG
oligonucleotide and non-nucleic acid adjuvant of the invention can
be administered to birds and other non-human vertebrates using
routine vaccination schedules and the antigen is administered after
an appropriate time period as described herein.
[0092] Cattle and livestock are also susceptible to infection.
Disease which affect these animals can produce severe economic
losses, especially amongst cattle. The methods of the invention can
be used to protect against infection in livestock, such as cows,
horses, pigs, sheep, and goats. The CpG oligonucleotide and the
non-nucleic acid adjuvant of the invention could also be
administered with antigen for antigen-specific protection of long
duration or without antigen for short term protection against a
wide variety of diseases, including shipping fever.
[0093] Cows can be infected by bovine viruses. Bovine viral
diarrhea virus (BVDV) is a small enveloped positive-stranded RNA
virus and is classified, along with hog cholera virus (HOCV) and
sheep border disease virus (BDV), in the pestivirus genus.
Although, Pestiviruses were previously classified in the
Togaviridae family, some studies have suggested their
reclassification within the Flaviviridae family along with the
flavivirus and hepatitis C virus (HCV) groups (Francki, et al.,
1991).
[0094] BVDV, which is an important pathogen of cattle can be
distinguished, based on cell culture analysis, into cytopathogenic
(CP) and noncytopathogenic (NCP) biotypes. The NCP biotype is more
widespread although both biotypes can be found in cattle. If a
pregnant cow becomes infected with an NCP strain, the cow can give
birth to a persistently infected and specifically immunotolerant
calf that will spread virus during its lifetime. The persistently
infected cattle can succumb to mucosal disease and both biotypes
can then be isolated from the animal. Clinical manifestations can
include abortion, teratogenesis, and respiratory problems, mucosal
disease and mild diarrhea. In addition, severe thrombocytopenia,
associated with herd epidemics, that may result in the death of the
animal has been described and strains associated with this disease
seem more virulent than the classical BVDVs.
[0095] Equine herpesviruses (EHV) comprise a group of antigenically
distinct biological agents which cause a variety of infections in
horses ranging from subclinical to fatal disease. These include
Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen in horses.
EHV-1 is associated with epidemics of abortion, respiratory tract
disease, and central nervous system disorders. Primary infection of
upper respiratory tract of young horses results in a febrile
illness which lasts for 8 to 10 days. Immunologically experienced
mares may be reinfected via the respiratory tract without disease
becoming apparent, so that abortion usually occurs without warning.
The neurological syndrome is associated with respiratory disease or
abortion and can affect animals of either sex at any age, leading
to incoordination, weakness and posterior paralysis (Telford, E. A.
R. et al., Virology 189, 304-316, 1992). Other EHV's include EHV-2,
or equine cytomegalovirus, EHV-3, equine coital exanthema virus,
and EHV-4, previously classified as EHV-1 subtype 2.
[0096] Sheep and goats can be infected by a variety of dangerous
microorganisms including visna-maedi.
[0097] Primates such as monkeys, apes and macaques can be infected
by simian immunodeficiency virus. Inactivated cell-virus and
cell-free whole simian immunodeficiency vaccines have been reported
to afford protection in macaques (Stott et al. (1990) Lancet
36:1538-1541; Desrosiers et al. PNAS USA (1989) 86:6353-6357;
Murphey-Corb et al. (1989) Science 246:1293-1297; and Carlson et
al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). A recombinant
HIV gp120 vaccine has been reported to afford protection in
chimpanzees (Berman et al. (1990) Nature 345:622-625).
[0098] Cats, both domestic and wild, are susceptible to infection
with a variety of microorganisms. For instance, feline infectious
peritonitis is a disease which occurs in both domestic and wild
cats, such as lions, leopards, cheetahs, and jaguars. When it is
desirable to prevent infection with this and other types of
pathogenic organisms in cats, the methods of the invention can be
used to vaccinate cats to prevent them against infection.
[0099] Domestic cats may become infected with several retroviruses,
including but not limited to feline leukemia virus (FeLV), feline
sarcoma virus (FeSV), endogenous type C oncornavirus (RD-114), and
feline syncytia-forming virus (FeSFV). Of these, FeLV is the most
significant pathogen, causing diverse symptoms, including
lymphoreticular and myeloid neoplasms, anemias, immune mediated
disorders, and an immunodeficiency syndrome which is similar to
human acquired immune deficiency syndrome (AIDS). Recently, a
particular replication-defective FeLV mutant, designated FeLV-AIDS,
has been more particularly associated with immunosuppressive
properties.
[0100] The discovery of feline T-lymphotropic lentivirus (also
referred to as feline immunodeficiency) was first reported in
Pedersen et al. (1987) Science 235:790-793. Characteristics of FIV
have been reported in Yamamoto et al. (1988) Leukemia, December
Supplement 2:204S-215S; Yamamoto et al. (1988) Am. J. Vet. Res.
49:1246-1258; and Ackley et al. (1990) J. Virol. 64:5652-5655.
Cloning and sequence analysis of FIV have been reported in Olmsted
et al. (1989) Proc. Natl. Acad. Sci. USA 86:2448-2452 and
86:4355-4360.
[0101] Feline infectious peritonitis (FIP) is a sporadic disease
occurring unpredictably in domestic and wild Felidae. While FIP is
primarily a disease of domestic cats, it has been diagnosed in
lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller
wild cats that have been afflicted with FIP include the lynx and
caracal, sand cat, and pallas cat. In domestic cats, the disease
occurs predominantly in young animals, although cats of all ages
are susceptible. A peak incidence occurs between 6 and 12 months of
age. A decline in incidence is noted from 5 to 13 years of age,
followed by an increased incidence in cats 14 to 15 years old.
[0102] Viral, bacterial and parasitic diseases in fin-fish,
shellfish or other aquatic life forms pose a serious problem for
the aquaculture industry. Owing to the high density of animals in
the hatchery tanks or enclosed marine farming areas, infectious
diseases may eradicate a large proportion of the stock in, for
example, a fin-fish, shellfish, or other aquatic life forms
facility. Prevention of disease is a more desired remedy to these
threats to fish than intervention once the disease is in progress.
Vaccination of fish is the only preventative method which may offer
long-term protection through immunity. Fish are currently protected
against a variety of bacterial infections with whole killed
vaccines with oli adjuvants, but there is only one licensed vaccine
for fish against a viral disease. Nucleic acid based vaccinations
are described in U.S. Pat. No. 5,780,448 issued to Davis and these
have been shown to be protective against at least two different
viral diseases.
[0103] The fish immune system has many features similar to the
mammalian immune system, such as the presence of B cells, T cells,
lymphokines, complement, and immunoglobulins. Fish have lymphocyte
subclasses with roles that appear similar in many respects to those
of the B and T cells of mammals. Vaccines can be administered
orally or by immersion or injection.
[0104] Aquaculture species include but are not limited to fin-fish,
shellfish, and other aquatic animals. Fin-fish include all
vertebrate fish, which may be bony or cartilaginous fish, such as,
for example, salmonids, carp, catfish, yellowtail, seabream, and
seabass. Salmonids are a family of fin-fish which include trout
(including rainbow trout), salmon, and Arctic char. Examples of
shellfish include, but are not limited to, clams, lobster, shrimp,
crab, and oysters. Other cultured aquatic animals include, but are
not limited to eels, squid, and octopi.
[0105] Polypeptides of viral aquaculture pathogens include but are
not limited to glycoprotein (G) or nucleoprotein (N) of viral
hemorrhagic septicemia virus (VHSV); G or N proteins of infectious
hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural
proteins of infectious pancreatic necrosis virus (IPNV); G protein
of spring viremia of carp (SVC); and a membrane-associated protein,
tegumin or capsid protein or glycoprotein of channel catfish virus
(CCV).
[0106] Polypeptides of bacterial pathogens include but are not
limited to an iron-regulated outer membrane protein, (IROMP), an
outer membrane protein (OMP), and an A-protein of Aeromonis
salmonicida which causes furunculosis, p57 protein of Renibacterium
salmoninarum which causes bacterial kidney disease (BKD), major
surface associated antigen (msa), a surface expressed cytotoxin
(mpr), a surface expressed hemolysin (ish), and a flagellar antigen
of Yersiniosis; an extracellular protein (ECP), an iron-regulated
outer membrane protein (IROMP), and a structural protein of
Pasteurellosis; an OMP and a flagellar protein of Vibrosis
anguillarum and V. ordalii; a flagellar protein, an OMP
protein,aroA, and purA of Edwardsiellosis ictaluri and E. tarda;
and surface antigen of Ichthyophthirius; and a structural and
regulatory protein of Cytophaga columnari; and a structural and
regulatory protein of Rickettsia.
[0107] Polypeptides of a parasitic pathogen include but are not
limited to the surface antigens of Ichthyophthirius.
[0108] An "allergen" refers to a substance (antigen) that can
induce an allergic or asthmatic response in a susceptible subject.
The list of allergens is enormous and can include pollens, insect
venoms, animal dander dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parielaria (e.g. Parielaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notalum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis).
[0109] In some aspects of the invention the antigen is a
polypeptide. Minor modifications of the primary amino acid
sequences of polypeptide antigens may also result in a polypeptide
which has substantially equivalent antigenic activity as compared
to the unmodified counterpart polypeptide. Such modifications may
be deliberate, as by site-directed mutagenesis, or may be
spontaneous. All of the polypeptides produced by these
modifications are included herein as long as antigenicity still
exists. The polypeptide may be, for example, a viral polypeptide.
One non-limiting example of an antigen useful according to the
invention is the hepatitis B surface antigen. Experiments using
this antigen are described in the Examples below.
[0110] The term "substantially purified" as used herein refers to a
polypeptide which is substantially free of other proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify viral or bacterial
polypeptides using standard techniques for protein purification.
The substantially pure polypeptide will often yield a single major
band on a non-reducing polyacrylamide gel. In the case of partially
glycosylated polypeptides or those that have several start codons,
there may be several bands on a non-reducing polyacrylamide gel,
but these will form a distinctive pattern for that polypeptide. The
purity of the viral or bacterial polypeptide can also be determined
by amino-terminal amino acid sequence analysis.
[0111] The invention also utilizes polynucleotides encoding the
antigenic polypeptides. It is envisioned that the antigen may be
delivered to the subject in a nucleic acid molecule which encodes
for the antigen such that the antigen must be expressed in vivo.
The nucleic acid encoding the antigen is operatively linked to a
gene expression sequence which directs the expression of the
antigen nucleic acid within a eukaryotic cell. The "gene expression
sequence" is any regulatory nucleotide sequence, such as a promoter
sequence or. promoter-enhancer combination, which facilitates the
efficient transcription and translation of the antigen nucleic acid
to which it is operatively linked. The gene expression sequence
may, for example, be a mammalian or viral promoter, such as a
constitutive or inducible promoter. Constitutive mammalian
promoters include, but are not limited to, the promoters for the
following genes: hypoxanthine phosphoribosyl transferase (HPTR),
adenosine deaminase, pyruvate kinase, $-actin promoter, muscle
creatine kinase promoter, human elongation factor promoter and
other constitutive promoters. Exemplary viral promoters which
function constitutively in eukaryotic cells include, for example,
promoters from the simian virus (e.g., SV40), papilloma virus,
adenovirus, human immunodeficiency virus (HIV), rous sarcoma virus,
cytomegalovirus (CMV), Rous sarcoma virus (RSV), hepatitis B virus
(HBV), the long terminal repeats (LTR) of Moloney leukemia virus
and other retroviruses, and the thymidine kinase promoter of herpes
simplex virus. Other constitutive promoters are known to those of
ordinary skill in the art. The promoters useful as gene expression
sequences of the invention also include inducible promoters.
Inducible promoters are expressed in the presence of an inducing
agent. For example, the metallothionein promoter is induced to
promote transcription and translation in the presence of certain
metal ions. Other inducible promoters are known to those of
ordinary skill in the art.
[0112] In general, the gene expression sequence shall include, as
necessary, 5' non-transcribing and 5' non-translating sequences
involved with the initiation of transcription and translation,
respectively, such as a TATA box, capping sequence, CAAT sequence,
and the like. Especially, such 5' non-transcribing sequences will
include a promoter region which includes a promoter sequence for
transcriptional control of the operably joined antigen nucleic
acid. The gene expression sequences optionally include enhancer
sequences or upstream activator sequences as desired.
[0113] The antigen nucleic acid is operatively linked to the gene
expression sequence. As used herein, the antigen nucleic acid
sequence and the gene expression sequence are said to be "operably
linked" when they are covalently linked in such a way as to place
the expression or transcription and/or translation of the antigen
coding sequence under the influence or control of the gene
expression sequence. Two DNA sequences are said to be operably
linked if induction of a promoter in the 5' gene expression
sequence results in the transcription of the antigen sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the antigen sequence, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a gene expression sequence would be operably linked
to an antigen nucleic acid sequence if the gene expression sequence
were capable of effecting transcription of that antigen nucleic
acid sequence such that the resulting transcript is translated into
the desired protein or polypeptide.
[0114] The antigen nucleic acid sequence may encode a protein,
polypeptide, peptide, or peptide mimic of a polysaccharide. It may
also cncode more than one antigenic component as a fusion
construct. More than one antigen-encoding sequence may be included
in the same plasmid vector and these may be linked to the same or
different gene expression sequences.
[0115] The antigen nucleic acid of the invention may be delivered
to the immune system alone or in association with a vector. In its
broadest sense, a "vector" is any vehicle capable of facilitating
the transfer of the antigen nucleic acid to the cells of the immune
system and preferably APCs so that the antigen can be expressed and
presented on the surface of an APC. Preferably, the vector
transports the nucleic acid to the immune cells with reduced
degradation relative to the extent of degradation that would result
in the absence of the vector. The vector optionally includes the
above-described gene expression sequence to enhance expression of
tne antigen nucleic acid in APCs. In general, the vectors useful in
the invention include, but are not limited to, plasmids, phagemids,
viruses, other vehicles derived from viral or bacterial sources
that have been manipulated by the insertion or incorporation of the
antigen nucleic acid sequences. Viral vectors are a preferred type
of vector and include, but are not limited to nucleic acid
sequences from the following viruses: retrovirus, such as moloney
murine leukemia virus, harvey murine sarcoma virus, murine mammary
tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated
virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses;
papilloma viruses; herpes virus; vaccinia virus; polio virus; and
RNA virus such as a retrovirus. One can readily employ other
vectors not named but known to the art.
[0116] Preferred viral vectors are based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with the gene of interest. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. Retroviruses have been
approved for human gene therapy trials. Most useful are those
retroviruses that are replication-deficient (i.e., capable of
directing synthesis of the desired proteins, but incapable of
manufacturing an infectious particle). Such genetically altered
retroviral expression vectors have general utility for the
high-efficiency transduction of genes in vivo. Standard protocols
for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a
plasmid, transfection of a packaging cell lined with plasmid,
production of recombinant retroviruses by the packaging cell line,
collection of viral particles from tissue culture media, and
infection of the target cells with viral particles) are provided in
Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual",
W.H. Freeman C.O., New York (1990) and Murry, E. J. Ed. "Methods in
Molecular Biology", vol. 7, Humana Press, Inc., Cliffton, N.J.
(1991).
[0117] Preferred virus for certain applications are the adeno-virus
and adeno-associated virus which are double-stranded DNA viruses
that have already been approved for human use in gene therapy and
immunotherapy trials. The adeno-associated virus can be engineered
to be replication-deficient and is capable of infecting a wide
range of cell types and species. It further has advantages such as,
heat and lipid solvent stability; high transduction frequencies in
cells of diverse lineages, including hemopoietic cells; and lack of
superinfection inhibition thus allowing multiple series of
transductions. Reportedly, the aueno-associated virus can integrate
into human cellular DNA in a site-specific manner, thereby
minimizing the possibility of insertional mutagenesis and
variability of inserted gene expression characteristic of
retroviral infection. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than
100 passages in the absence of selective pressure, implying that
the adeno-associated virus genomic integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
[0118] Other vectors include plasmid vectors. Plasmid vectors have
been extensively described in the art and are well-known to those
of skill in the art. See e.g., Sanbrook et al., "Molecular Cloning:
A Laboratory Manual", Second Edition, Cold Spring Harbor Laboratory
Press, 1989. In the last few years, plasmid vectors have been used
as DNA vaccines for delivering antigen-encoding genes to cells in
vivo. They are particularly advantageous for this because they do
not have the same safety concerns as with many of the viral
vectors. These plasmids, however, having a promoter compatible with
the host cell, can express a peptide from a gene operatively
encoded within the plasmid. Some commonly used plasmids include
pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other
plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction
enzymes and ligation reactions to remove and add specific fragments
of DNA. Plasmids such as those used for DNA vaccines may be
delivered by a variety of parenteral, mucosal and topical routes.
For example the plasmid DNA can be injected by intramuscular,
intradermal, subcutaneous or other routes. It may also be
administered by intranasal sprays or drops, rectal suppository and
orally. It may also be administered into the epidermis or a mucosal
surface using a gene-gun. The plasmids may be given in an aqueous
solution, dried onto gold particles or in association with another
DNA delivery system including but not limited to liposomes,
dendrimers, cochleate and microencapsulation.
[0119] It has recently been discovered that gene carrying plasmids
can be delivered to the immune system using bacteria. Modified
forms of bacteria such as Salmonella can be transfected with the
plasmid and used as delivery vehicles. The bacterial delivery
vehicles can be administered to a host subject orally or by other
administration means. The bacteria deliver the plasmid to immune
cells, e.g. dendritic cells, probably by passing through the gut
barrier. High levels of immune protection have been established
using this methodology.
[0120] In other aspects the invention includes a method for
immunizing an infant by administering to an infant an antigen and
an oligonucleotide containing at least one unmethylated CpG
dinucleotide in an effective amount for inducing cell mediated
immunity in the infant. In some embodiments the infant is also
administered at least one non-nucleic acid adjuvant, as described
above. Cell mediated immunity, as used herein, refers to an immune
response which involves an antigen specific T cell reaction. The
presence of cell mediated immunity can be determined directly by
the induction of Th1 cytokines (e.g., IFN-.gamma., IL-12) and
antigen-specific cytotoxic T-cell lymphocytes (CTL). The presence
of cell mediated immunity is also indicated indirectly by the
isotype of antigen-specific antibodies that are induced (e.g.
IgG2a>>IgG1 in mice). Thus, if Th1 cytokines or CTL or
TH1-like antibodies are induced, cell mediated immunity is induced
according to the invention. As discussed above, Th1 cytokines
include but are not limited to IL-12 and IFN-.gamma..
[0121] Neonates (newborn) and infants (which include humans three
months of age and referred to hereinafter as infants) born in HBV
endemic areas require particularly rapid induction of strong
HBV-specific immunity owing to the high rate of chronicity
resulting from infection at a young age. Without immunoprophylaxis,
70-90% of infants born to mothers positive for both HBsAg and the
"e" antigen (HBeAg) become infected and almost all of these become
chronic carriers (Stevens et al., 1987). Even when vaccinated with
a four dose regime of the HBV subunit vaccine commencing on the day
of birth, 20% of such infants became chronically infected and this
was reduced to only 15% if they were also given HBV-specific
immunoglobulin (Chen et al., 1996). HBV chronicity results in
10-15% of individuals infected as adolescents or adults, but 90-95%
for those infected (either vertically or horizontally) as infants.
CpG oligonucleotides may be used, according to the invention, to
reduce this further owing to a more rapid appearance and higher
titers of anti-HBs antibodies and the induction of HBV-specific
CTL, which could help clear virus from the liver of babies infected
in utero, and which likely account for most of the failures with
infant vaccination.
[0122] The invention further provides a method of modulating the
level of a cytokine. The term "modulate" envisions the suppression
of expression of a particular cytokine when lower levels are
desired, or augmentation of the expression of a particular cytokine
when higher levels are desired. Modulation of a particular cytokine
can occur locally or systemically. CpG oligonucleotides can
directly activate macrophages and dendritic cells to secrete
cytokines. No direct activation of proliferation or cytokine
secretion by highly purified T cells has been found, although they
are induced to secrete cytokines by cytokines secreted from
macrophages and may be costimulated through the T cell Receptor.
Cytokine profiles determine T cell regulatory and effector
functions in immune responses. In general, Th1-type cytokines are
induced, thus the immunostimulatory nucleic acids promote a Th1
type antigen-specific immune response including cytotoxic
T-cells.
[0123] Cytokines also play a role in direciing the T cell response.
Helper (CD4.sup.+) T cells orchestrate the immune response of
mammals through production of soluble factors that act on other
immune system cells, including B and other T cells. Most mature
CD4.sup.+ T helper cells express one of two cytokine profiles: Th1
or Th2. Th1 cells secrete IL-2, IL-3, IFN-.gamma., GM-CSF and high
levels of TNF-.alpha.. Th2 cells express IL-3, IL-4, IL-5, IL-6,
IL-9, IL-10, IL-13, GM-CSF and low levels of TNF-.alpha.. The Th1
subset promotes both cell-mediated immunity, and humoral immunity
that is characterized by immunoglobulin class switching to
IgG.sub.2a in mice. Th1 responses may also be associated with
delayed-type hypersensitivity and autoimmune disease. The Th2
subset induces primarily humoral immunity and induce class
switching to IgG.sub.1 and IgE. The antibody isotypes associated
with Th1 responses generally have good neutralizing and opsonizing
capabilities whereas those associated with Th2 responses are
associated more with allergic responses.
[0124] Several factors have been shown to influence commitment to
Th1 or Th2 profiles. The best characterized regulators are
cytokines. IL-12 and IFN-.gamma. are positive Th1 and negative Th2
regulators. IL-12 promotes IFN-.gamma. production, and IFN-.gamma.
provides positive feedback for IL-12. IL-4 and IL-10 appear to be
required for the establishment of the Th2 cytokine profile and to
down-regulate Th1 cytokine production; the effects of IL-4 are in
some cases dominant over those of IL-12; IL-13 was shown to inhibit
expression of inflammatory cytokines, including IL-12 and
TNF-.alpha. by LPS-induced monocytes, in a way similar to IL-4. The
IL-12 p40 homodimer binds to the IL-12 receptor and may antagonizes
IL-12 biological activity; thus it blocks the pro-Th1 effects of
IL-12 in some animals.
[0125] In other aspects the invention includes a method of inducing
a Th1 immune response in a subject by administering to the subject
a combination of adjuvants in an effective amount for inducing a
Th1 immune response. The combination of adjuvants includes at least
one oligonucleotide containing at least one unmethylated CpG
dinucleotide and at least one non-nucleic acid adjuvant. It was not
previously known that when CpG was combined with a non-nucleic acid
adjuvant, as described above, that the combination would produce an
immune response with a Th1 profile to an extent that the individual
adjuvants could not produce alone. Preferably the extent of the Th
profile produced by the combination of adjuvants is synergistic.
Another aspect of the invention is to induce a Th response by using
CPG with a non-nucleic acid adjuvant that by itself induces a Th2
response.
[0126] As described above a Th2 profile is characterized by
production of IL-4 and IL-10. Non-nucleic acid adjuvants that
induce Th2 or weak Th1 responses include but are not limited to
alum, saponins, oil-in-water and other emulsion formulations and
SB-As4. Adjuvants that induce Th1 responses include but are not
limited to MPL, MDP, ISCOMS, IL-12, IFN-.gamma., and SB-AS2. When
the CpG oligonucleotide is administered with a non-nucleic acid
adjuvant the combination of adjuvants causes a commitment to a Th1
profile, that neither the adjuvant nor the CpG oligonucleotide is
capable of producing on its own. Furthermore, if the non-nucleic
acid adjuvant on its own induces a Th2 response, the addition of
CpG oligonucleotide can overcome this Th2 bias and induce a Th1
response that may be even more Th1-like than with CpG alone.
[0127] The combination of adjuvants may be administered
simultaneously or sequentially. When the adjuvants are administered
simultaneously they can be administered in the same or separate
formulations, and in the latter case at the same or separate sites,
but are administered at the same time. The adjuvants are
administered sequentially, when the administration of the at least
two adjuvants is temporally separated. The separation in time
between the administration of the two adjuvants may be a matter of
minutes or it may be longer. The separation in time is less than 14
days, and more preferably less than 7 days, and most preferably
less than 1 day. The separation in time may also be with one
adjuvant at prime and one at boost, or one at prime and the
combination at boost, or the combination at prime and one at
boost.
[0128] For use in the instant invention, the nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the b-cyanoethyl phosphoramidite method
(Beaucage, S. L., and Caruthers, M. H., Tet. Let. 22:1859, 1981);
nucleoside H-phosphonate method (Garegg et al., Tet. Let.
27:4051-4054, 1986; Froehler et al., Nucl. Acid. Res. 14:5399 5407,
1986,; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney et al.,
Tet. Let. 29:2619-2622, 1988). These chemistries can be performed
by a variety of automated oligonucleotide synthesizers available in
the market. Alternatively, CpG dinucleotides can be produced on a
large scale in plasmids, (see Sambrook, T., et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor laboratory Press,
New York, 1989) which after being administered to a subject are
degraded into oligonucleotides. Such plasmids may also encode other
genes to be expressed such as an antigen-encoding gene in the case
of a DNA vaccine. Oligonucleotides can be prepared from existing
nucleic acid sequences (e.g., genomic or cDNA) using known
techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
[0129] For use in vivo, nucleic acids are preferably relatively
resistant to degradation (e.g., via endo-and exo-nucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications. A preferred stabilized nucleic acid has at least a
partial phosphorothioate modified backbone. Phosphorothioates may
be synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl-and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990;
Goodchild, J., Bioconjugate Chem. 1:165, 1990).
[0130] For administration in vivo, nucleic acids may be associated
with a molecule that results in higher affinity binding to target
cell (e.g., B-cell, monocytic cell and natural killer (NK) cell)
surfaces and/or increased cellular uptake by target cells to form a
"nucleic acid delivery complex." Nucleic acids can be ionically or
covalently associated with appropriate molecules using techniques
which are well known in the art. A variety of coupling or
cross-linking agents can be used, e.g., protein A, carbodiimide,
and N-succinimidyl-3-(2-pyridyldithi- o) propionate (SPDP). Nucleic
acids can alternatively be encapsulated in liposomes or virosomes
using well-known techniques.
[0131] Nucleic acids containing an appropriate unmethylated CpG can
be effective in any mammal, preferably a human. Different nucleic
acids containing an unmethylated CpG can cause optimal immune
stimulation depending on the mammalian species. Thus an
oligonucleotide causing optimal stimulation in humans may not cause
optimal stimulation in a mouse and vice versa. One of skill in the
art can identify the optimal oligonucleotides useful for a
particular mammalian species of interest using routine assays
described herein and/or known in the art.
[0132] The CpG ODN of the invention stimulate cytokine production
(e.g., IL-6, IL-12, IFN-.gamma., TNF-.alpha. and GM-CSF) and B-cell
proliferation in PBMC's taken from a subject such as a human.
Specific, but nonlimiting examples of such sequences include those
presented in Table 1 below:
1TABLE 1 sequences GCTAGACGTTAGCGT; (SEQ ID NO: 1) GCTAGATGTTAGCGT;
(SEQ ID NO: 2) GCTAGACGTTAGCGT; (SEQ ID NO: 3) GCTAGACGTTAGCGT;
(SEQ ID NO: 4) GCATGACGTTGAGCT; (SEQ ID NO: 5)
ATGGAAGGTCCAGCGTTCTC; (SEQ ID NO: 6) ATCGACTCTCGAGCGTTCTC; (SEQ ID
NO: 7) ATCGACTCTCGAGCGTTCTC; (SEQ ID NO: 8) ATCGACTCTCGAGCGTTCTC;
(SEQ ID NO: 9) ATGGAAGGTCCAACGTTCTC; (SEQ ID NO: 10)
GAGAACGCTGGACCTTCCAT; (SEQ ID NO: 11) GAGAACGCTCGACCTTCCAT; (SEQ ID
NO: 12) GAGAACGCTCGACCTTCGAT; (SEQ ID NO: 13) GAGAACGCTGGACCTTCCAT;
(SEQ ID NO: 14) GAGAACGATGGACCTTCCAT; (SEQ ID NO: 15)
GAGAACGCTCCAGCACTGAT; (SEQ ID NO: 16) TCCATGTCGGTCCTGATGCT; (SEQ ID
NO: 17) TCCATGTCGGTCCTGATGCT; (SEQ ID NO: 18) TCCATGACGTTCCTGATGCT;
(SEQ ID NO: 19) TCCATGTCGGTCCTGCTGAT; (SEQ ID NO: 20) TCAACGTT;
(SEQ ID NO: 21) TCAGCGCT; (SEQ ID NO: 22) TCATCGAT; (SEQ ID NO: 23)
TCTTCGAA; (SEQ ID NO: 24) CAACGTT; (SEQ ID NO: 25) CCAACGTT; (SEQ
ID NO: 26) AACGTTCT; (SEQ ID NO: 27) TCAACGTC; (SEQ ID NO: 28)
ATGGACTCTCCAGCGTTCTC; (SEQ ID NO: 29) ATGGAAGGTCCAACGTTCTC; (SEQ ID
NO: 30) ATCGACTCTCGAGCGTTCTC; (SEQ ID NO: 31) ATGGAGGCTCCATCGTTCTC;
(SEQ ID NO: 32) ATCGACTCTCGAGCGTTCTC; (SEQ ID NO: 33)
ATCGACTCTCGAGCGTTCTC; (SEQ ID NO: 34) TCCATGTCGGTCCTGATGCT; (SEQ ID
NO: 35) TCCATGCCGGTCCTGATGCT; (SEQ ID NO: 36) TCCATGGCGGTCCTGATGCT;
(SEQ ID NO: 37) TCCATGACGGTCCTGATGCT; (SEQ ID NO: 38)
TCCATGTCGATCCTGATGCT; (SEQ ID NO: 39) TCCATGTCGCTCCTGATGCT; (SEQ ID
NO: 40) TCCATGTCGTCCCTGATGCT; (SEQ ID NO: 41) TCCATGACGTGCCTGATGCT;
(SEQ ID NO: 42) TCCATAACGTTCCTGATGCT; (SEQ ID NO: 43)
TCCATGACGTCCCTGATGCT; (SEQ ID NO: 44) TCCATCACGTGCCTGATGCT; (SEQ ID
NO: 45) GGGGTCAACGTTGACGGGG; (SEQ ID NO: 46) GGGGTCAGTCGTGACGGGG;
(SEQ ID NO: 47) GCTAGACGTTAGTGT; (SEQ ID NO: 48)
TCCATGTCGTTCCTGATGCT; (SEQ ID NO: 49) ACCATGGACGATCTGTTTCCCCTC;
(SEQ ID NO: 50) TCTCCCAGCGTGCGCCAT; (SEQ ID NO: 51)
ACCATGGACGAACTGTTTCCCCTC; (SEQ ID NO: 52) ACCATGGACGAGCTGTTTCCCCTC;
(SEQ ID NO: 53) ACCATGGACGACCTGTTTCCCCTC; (SEQ ID NO: 54)
ACCATGGACGTACTGTTTCCCCTC; (SEQ ID NO: 55) ACCATGGACGGTCTGTTTCCCCTC;
(SEQ ID NO: 56) ACCATGGACGTTCTGTTTCCCCTC; (SEQ ID NO: 57)
CACGTTGAGGGGCAT; (SEQ ID NO: 58) TCAGCGTGCGCC; (SEQ ID NO: 59)
ATGACGTTCCTGACGTT; (SEQ ID NO: 60) TCTCCCAGCGGGCGCAT; (SEQ ID NO:
61) TCCATGTCGTTCCTGTCGTT; (SEQ ID NO: 62) TCCATAGCGTTCCTAGCGTT;
(SEQ ID NO: 63) TCGTCGCTGTCTCCCCTTCTT; (SEQ ID NO: 64)
TCCTGACGTTCCTGACGTT; (SEQ ID NO: 65) TCCTGTCGTTCCTGTCGTT; (SEQ ID
NO: 66) TCCATGTCGTTTTTGTCGTT; (SEQ ID NO: 67) TCCTGTCGTTCCTTGTCGTT;
(SEQ ID NO: 68) TCCTTGTCGTTCCTGTCGTT; (SEQ ID NO: 69)
TCCTGTCGTTTTTTGTCGTT; (SEQ ID NO: 70) TCGTCGCTGTCTGCCCTTCTT; (SEQ
ID NO: 71) TCGTCGCTGTTGTCGTTTCTT; (SEQ ID NO: 72)
TCCATGCGTGCGTGCGTTTT; (SEQ ID NO: 73) TCCATGCGTTGCGTTGCGTT; (SEQ ID
NO: 74) TCCACGACGTTTTCGACGTT; (SEQ ID NO: 75) TCGTCGTTGTCGTTGTCGTT;
(SEQ ID NO: 76) TCGTCGTTTTGTCGTTTTGTCGTT; (SEQ ID NO: 77)
TCGTCGTTGTCGTTTTGTCGTT; (SEQ ID NO: 78) GCGTGCGTTGTCGTTGTCGTT; (SEQ
ID NO: 79) TGTCGTTTGTCGTTTGTCGTT; (SEQ ID NO: 80)
TGTCGTTGTCGTTGTCGTTGTCGTT; (SEQ ID NO: 81) TGTCGTTGTCGTTGTCGTT;
(SEQ ID NO: 82) TCGTCGTCGTCGTT; (SEQ ID NO: 83) TGTCGTTGTCGTT; (SEQ
ID NO: 84) TCCATAGCGTTCCTAGCGTT; (SEQ ID NO: 85)
TCCATGACGTTCCTGACGTT; (SEQ ID NO: 86) GTCGYT; (SEQ ID NO: 87)
TGTCGYT; (SEQ ID NO: 88) AGCTATGACGTTCCAAGG; (SEQ ID NO: 89)
TCCATGACGTTCCTGACGTT; (SEQ ID NO: 90) ATCGACTCTCGAACGTTCTC; (SEQ ID
NO: 91) TCCATGTCGGTCCTGACGCA; (SEQ ID NO: 92) TCTTCGAT; (SEQ ID NO:
93) ATAGGAGGTCCAACGTTCTC; (SEQ ID NO: 94) GTCGTT (SEQ ID NO: 95)
GTCGTC (SEQ ID NO: 96) TGTCGTT (SEQ ID NO: 97) TGTCGCT (SEQ ID NO:
98)
[0133] Preferred CpG ODN can effect at least about 500 pg/ml of
TNF-.alpha., 15 pg/ml IFN-.gamma., 70 pg/ml of GM-CSF 275 pg/ml of
IL-6, 200 pg/ml IL-12, depending on the therapeutic indication.
These cytokines can be measured by assays well known in the art.
The oligonucleotides listed above or other preferred CpG ODN can
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30%, more preferably at least about 35%, and most
preferably at least about 40% 2C11 cell specific lysis, in assays
well known in the art.
[0134] The term "effective amount" of a CpG oligonucleotide refers
to the amount necessary or sufficient to realize a desired biologic
effect. For example, an effective amount of an oligonucleotide
containing at least one unmethylated CpG and a non-nucleic acid
adjuvant for treating an infectious disorder is that amount
necessary to cause the development of an antigen specific immune
response upon exposure to the microbe, thus causing a reduction in
the amount of microbe within the subject and preferably to the
eradication of the microbe. The effective amount for any particular
application can vary depending on such factors as the disease or
condition being treated, the particular CpG oligonucleotide being
administered (e.g. the number of unmethylated CpG motifs or their
location in the nucleic acid), the size of the subject, or the
severity of the disease or condition. One of ordinary skill in the
art can empirically determine the effective amount of a particular
adjuvant and antigen without necessitating undue
experimentation.
[0135] The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0136] For use in therapy, an effective amount of the adjuvant
combination can be administered to a subject by any mode allowing
the oligonucleotide to be taken up by the appropriate target cells.
"Administering" the pharmaceutical composition of the present
invention may be accomplished by any means known to the skilled
artisan. Preferred routes of administration include but are not
limited to oral, transdermal (e.g. via a patch), parenteral
injection (subcutaneous, intradermal, intravenous, parenteral,
intraperitoneal, intrathecal, etc.), or mucosal intranasal,
intratracheal, inhalation, and intrarectal, intravaginal etc). An
injection may be in a bolus or a continuous infusion.
[0137] For example the pharmaceutical compositions according to the
invention are often administered by intramuscular or intradermal
injection, or other parenteral means, or by biolistic
"gene-gun"application to the epidermis. They may also be
administered by intranasal application, inhalation, topically,
intravenously, orally, or as implants, and even rectal or vaginal
use is possible. Suitable liquid or solid pharmaceutical
preparation forms are, for example, aqueous or saline solutions for
injection or inhalation, microencapsulated, encochleated, coated
onto microscopic gold particles, contained in liposomes, nebulized,
aerosols, pellets for implantation into the skin, or dried onto a
sharp object to be scratched into the skin. The pharmaceutical
compositions also include granules, powders, tablets, coated
tablets, (micro)capsules, suppositories, syrups, emulsions,
suspensions, creams, drops or preparations with protracted release
of active compounds, in whose preparation excipients and additives
and/or auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of present methods for drug delivery,
see Langer, Science 249:1527-1533, 1990, which is incorporated
herein by reference.
[0138] The pharmaceutical compositions are preferably prepared and
administered in dose units. Liquid dose units are vials or ampoules
for injection or other parenteral administration. Solid dose units
are tablets, capsules and suppositories. For treatment of a
patient, depending on activity of the compound, manner of
administration, purpose of the immunization (i.e., prophylactic or
therapeutic), nature and severity of the disorder, age and body
weight of the patient, different doses may be necessary. The
administration of a given dose can be carried out both by single
administration in the form of an individual dose unit or else
several smaller dose units. Multiple administration of doses at
specific intervals of weeks or months apart is usual for boosting
the antigen-specific responses.
[0139] The adjuvants and antigens may be administered per se (neat)
or in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0140] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0:25% w/v) and
thimerosal (0.004-0.02% w/v).
[0141] The pharmaceutical compositions of the invention contain an
effective amount of a combination of adjuvants and antigens
optionally included in a pharmaceutically-acceptable carrier. The
term "pharmaceutically-acceptable carrier" means one or more
compatible solid or liquid filler, dilutants or encapsulating
substances which are suitable for administration to a human or
other vertebrate animal. The term "carrier" denotes an organic or
inorganic ingredient, natural or synthetic, with which the active
ingredient is combined to facilitate the application. The
components of the pharmaceutical compositions also are capable of
being comingled with the compounds of the present invention, and
with each other, in a manner such that there is no interaction
which would substantially impair the desired pharmaceutical
efficiency.
[0142] Compositions suitable for parenteral administration
conveniently comprise sterile aqueous preparations, which can be
isotonic with the blood of the recipient. Among the acceptable
vehicles and solvents are water, Ringer's solution, phosphate
buffered saline and isotonic sodium chloride solution. In addition,
sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose any bland fixed mineral or
non-mineral oil may be employed including synthetic
mono-ordi-glycerides. In addition, fatty acids such as oleic acid
find use in the preparation of injectables. Carrier formulations
suitable for subcutaneous, intramuscular, intraperitoneal,
intravenous, etc. administrations may be found in Remington's
Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.
[0143] The adjuvants or antigens useful in the invention may be
delivered in mixtures of more than two adjuvants or antigens. A
mixture may consist of several adjuvants in addition to the
synergistic combination of adjuvants or several antigens.
[0144] A variety of administration routes are available. The
particular mode selected will depend, of course, upon the
particular adjuvants or antigen selected, the age and general
health status of the subject, the particular condition being
treated and the dosage required for therapeutic efficacy. The
methods of this invention, generally speaking, may be practiced
using any mode of administration that is medically acceptable,
meaning any mode that produces effective levels of an immune
response without causing clinically unacceptable adverse effects.
Preferred modes of administration are discussed above.
[0145] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
compounds into association with a carrier which constitutes one or
more accessory ingredients. In general, the compositions are
prepared by uniformly and intimately bringing the compounds into
association with a liquid carrier, a finely divided solid carrier,
or both, and then, if necessary, shaping the product.
[0146] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compounds, increasing
convenience to the subject and the physician. Many types of release
delivery systems are available and known to those of ordinary skill
in the art. They include polymer base systems such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides. Microcapsules of the foregoing polymers containing
drugs are described in, for example, U.S. Pat. No. 5,075,109.
Delivery systems also include non-polymer systems that are: lipids
including sterols such as cholesterol, cholesterol esters and fatty
acids or neutral fats such as mono-di-and tri-glycerides; hydrogel
release systems; sylastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix such as those described in U.S. Pat. Nos.
4,452,775,4,675,189, and 5,736,152, and (b) diffusional systems in
which an active component permeates at a controlled rate from a
polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974
and 5,407,686. In addition, pump-based hardware delivery systems
can be used, some of which are adapted for implantation.
[0147] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
[0148] The use of CpG ODN as an adjuvant alone or in combination
with other adjuvants was evaluated. The hepatitis B virus surface
antigen (HBsAg) given as a recombinant protein or expressed in vivo
from a DNA vaccine was used as an exemplary model system in the
Examples set forth below.
[0149] Materials and Methods
[0150] Animals
[0151] Experiments on adult mice were carried out using female
BALB/c mice (Charles River, Montreal, QC) at 6-8 weeks of age.
[0152] Newborn mice were obtained through breeding male and female
BALB/c mice (Charles River) in the Loeb animal facility (Loeb
Health Research Institute, The Ottawa Hospital, Ottawa, ON).
Pregnant females were monitored daily to ensure accurate recording
of the date of birth. Both male and female neonates were used for
immunization.
[0153] Cynomolgus monkeys (1.5-3 kg) were housed at the Primate
Research Center, Bogor, Indonesia.
[0154] Orantutans (5-20kg) were housed at Wanariset Station for the
Orangutan Reintroduction Program of the Indonesian government,
Balikpapan, Kalimantan.
[0155] HBsAg Subunit Vaccination of Mice
[0156] The subunit vaccine consisted of HBsAg (ay subtype) which
had been produced as a recombinant protein in yeast cells (Medix
Biotech #ABH0905). This was diluted in saline for use without
adjuvant. HBsAg was also formulated with alum and/or CpG ODN as
adjuvant. HBsAg protein was mixed with aluminum hydroxide
(Alhydrogel 85, [Al.sub.2O.sub.3], Superfos Biosector, Vedbaek,
Denmark) in the same ratio of 25 mg Al.sup.3+ per mg protein as
used in the commercial vaccines (i.e., 2.5 l 2% Al.sub.2O.sub.3 per
.mu.g HBsAg). The protein and alum were mixed with a vortex and
then left on ice for at least 30 minutes prior to use to allow the
protein to adsorb onto the Al.sub.2O.sub.3. This solution was mixed
again immediately prior to injection by drawing up into the syringe
3-5 times.
[0157] For groups treated with CpG ODN, an appropriate volume of
synthetic oligodeoxynucleotide (ODN #1826) of the sequence
TCCATGACGTTCCTGACGTT (SEQ ID NO. 86) synthesized with a
phosphorothioate backbone (Oligos Etc. & Oligo Therapeutics,
Wilsonville, Oreg.) was added alone or with alum to HBsAg on the
day of injection. Adult mice received a single intramuscular (IM)
injection into the left tibialis anterior (TA) muscle of 1 or 2 ug
HBsAg, without or with adjuvant (alum and/or CpG ODN), in 50 l
vehicle. When CpG DNA was added, each animal received a total of 1,
10, 100 or 500 .mu.g ODN. Newborn mice were immunized within 24
hours of birth or 7 days after birth by bilateral injection of a
total of 1 .mu.g HBsAg into the posterior thigh muscles (2.times.10
l @ 0.05 mg/ml). All injections were carried out with a 0.3 ml
insulin syringe which has a fused 29G needle (Becton Dickenson,
Franklin Lakes, N.J.). For injection of adults, the needle was
fitted with a collar of polyethylene (PE) tubing to limit
penetration of the needle to about 3 mm. All intramuscular
injections were carried out through the skin (shaved for adults)
and under general anesthesia (Halothane, Halocarbon Laboratories,
River Edge, N.J.).
[0158] HBsAg Subunit Vaccination of Monkeys
[0159] Monkeys were immunized by IM injection into the anterior
thigh muscle of Engerix-B.RTM. (SmithKline Beecham Biologicals,
Rixensart, BE) which comprises HBsAg (ay subtype, 20 .mu.g/ml)
adsorbed to alum (25 mg Al3+/mg HbsAg). Each monkey received an
injection of 0.5 ml containing 10 .mu.g HbsAg. For some monkeys,
500 .mu.g CpG ODN 1968 (TCGTCGCTGTTGTCGTTTCTT) (SEQ ID NO 72) was
added to the vaccine formulation.
[0160] HBsAg Subunit Vaccination of Orangutans
[0161] Orangutans were immunized by IM injection into the anterior
thigh muscle of HBsAg *ay subtype, 20 .mu.g/ml) combined with alum
(25 mg Al3+/mg HBsAg), combined with CpG. CpG ODN 2006
(TCGTCGTTTTGTCGTTTTGTCGTT- ) (SEQ ID NO 77) was added to the
vaccine formulation. Each orangutan received an injection of 1.0 ml
containing 20 .mu.g HBsAg with alum (500 .mu.g), CpG
oligonucleotide (1 mg) or both adjuvants.
[0162] Experimental Groups
[0163] Comparison of CpG ODN and Non-Nucleic Acid Adjuvants with
HBsAg Subunit Vaccine
[0164] Twelve groups of adult BALB/c mice (n=10) were injected with
1 .mu.g HBsAg (i) alone, (ii) mixed with alum, (iii, iv, v, vi,
vii) mixed with 0.1, 1, 10, 100 or 500 .mu.g CpG ODN, or (viii, ix,
x, xi, xii) mixed with both alum and 0.1, 1, 10, 100 or 500 .mu.g
CpG ODN. These mice were bled at 1, 2, 4 and 8 weeks after
immunization and the plasma was assayed for anti-HBs. At the end of
the study the mice were killed and their spleens removed for assay
of CTL activity.
[0165] Other groups of mice (n=5) were immunized with HBsAg (1
.mu.g) alone, with alum (25 .mu.g Al3+), with one of several
different CpG and non-CpG control oligonucleotides of different
backbones (10 .mu.g), or with both alum and an oligonucleotide.
[0166] Other groups of mice (n=5) were immunized as above (except
only the 10 .mu.g dose of CpG ODN was used) and boosted with the
identical or a different formulation at 8 weeks, then spleens were
removed 2 weeks later for evaluation of CTL activity.
[0167] Other groups of mice were immunized with HBsAg (1 .mu.g) and
one of the following non-nucleic acid adjuvants alone or in
combination with CpG ODN (10 .mu.g): monophosphoryl lipid A (MPL,
50 .mu.g, Ribi); Freund's Complete Adjuvant (CFA; 1:1 v/v);
Freund's Incomplete Adjuvant (IFA; 1:1 v/v).
[0168] Immunization of Neonates with Subunit or DNA Vaccine
[0169] Groups of newborn and young BALB/c mice (n=10) aged <24
hours, 3, 7 or 14 days were injected with (i, ii, iii) a total of 1
.mu.g HBsAg with alum, with CpG ODN 1826 (10 .mu.g) or with both
alum and CpG ODN, or with (iv) an HBsAg-expressing DNA vaccine
(1-.mu.g pCMV-S). Plasma was obtained at 4, 8, 12 and 16 weeks for
assay of anti-HBs as total IgG and IgG subtypes (IgG1 and IgG2a).
At the end of the study the mice were killed and their spleens
removed for assay of CTL activity.
[0170] Immunization of Cynomolgus Monkeys with HBsAg and Alum or
Alum+CpG ODN
[0171] Two groups of juvenile Cynomolgus monkeys (n=5) were
immunized at 0 and 10 weeks with 0.5 ml Engerix-B (HBsAg at 20
mg/ml adsorbed to alum, 25 mg Al3+/mg HBsAg) to which had been
added saline (0.1 ml) or CpG ODN 2006 (500 .mu.g in 0.1 ml, SEQ
#77). Monkeys were bled at 2, 8, 10, 12 and 14 weeks and plasma was
evaluated for anti-HBs titers (mIU/ml).
[0172] Immunization of Orangutans with HBsAg and Alum or CpG ODN or
Alum+CpG ODN
[0173] Three groups of juvenile orangutans were immunized IM at 0
and 4 weeks with 1 ml of vaccine containing HBsAg (10 .mu.g) plus
(i) alum (25 mg Al3+/mg HBsAg)(n=13), (ii) CpG ODN 2006 (SEQ# 77)
(m=24) or (iii) alum plus CpG ODN (n=14). Animals were bled at 4.8
and 12 weeks and plasma was evaluated for anti-HBs titers
(mIU/ml).
[0174] Evaluation of Humoral Response to HbsAg
[0175] Mice: Heparinized blood was collected by retrobulbar
puncture of lightly anaesthetized mice as described elsewhere
(Michel et al., 1995). Plasma was recovered by centrifugation (7
min @ 13,000 rpm). Antibodies specific to HBsAg in plasma were
detected and quantified by end-point dilution ELISA assay (in
triplicate) on individual samples. Ten-fold serial dilutions of
plasma were first added to 96-well microtiter plates with a solid
phase consisting of plasma-derived HBsAg particles (100 l/well of
HBsAg ay subtype at 1 g/ml, coated overnight at RT) and incubated
for 1 hr at 37 C. The bound antibodies were then detected by
incubation for 1 hr at 37C with HRP-conjugated goat anti-mouse IgG,
IgM, IgG1 or IgG2a (1:4000 in PBS-Tween, 10% FCS; 100 l/well,
Southern Biotechnology Inc., Birmingham, Ala.), followed by
incubation with OPD solution (100 l/well, Sigma, St. Louis, Mo.)
for 30 minutes at RT in the dark. The reaction was stopped by the
addition of sulfuric acid (50 l of 4N H.sub.2SO.sub.4). End-point
titers were defined as the highest plasma dilution that resulted in
an absorbance value (OD 450) two times greater than that of
non-immune plasma
Sequence CWU 1
1
98 1 15 DNA Artificial Sequence Synthetic Oligonucleotide 1
gctagacgtt agcgt 15 2 15 DNA Artificial Sequence Synthetic
Oligonucleotide 2 gctagatgtt agcgt 15 3 15 DNA Artificial Sequence
Synthetic Oligonucleotide 3 gctagacgtt agcgt 15 4 15 DNA Artificial
Sequence Synthetic Oligonucleotide 4 gctagacgtt agcgt 15 5 15 DNA
Artificial Sequence Synthetic Oligonucleotide 5 gcatgacgtt gagct 15
6 20 DNA Artificial Sequence Synthetic Oligonucleotide 6 atggaaggtc
cagcgttctc 20 7 20 DNA Artificial Sequence Synthetic
Oligonucleotide 7 atcgactctc gagcgttctc 20 8 20 DNA Artificial
Sequence Synthetic Oligonucleotide 8 atcgactctc gagcgttctc 20 9 20
DNA Artificial Sequence Synthetic Oligonucleotide 9 atcgactctc
gagcgttctc 20 10 20 DNA Artificial Sequence Synthetic
Oligonucleotide 10 atggaaggtc caacgttctc 20 11 20 DNA Artificial
Sequence Synthetic Oligonucleotide 11 gagaacgctg gaccttccat 20 12
20 DNA Artificial Sequence Synthetic Oligonucleotide 12 gagaacgctc
gaccttccat 20 13 20 DNA Artificial Sequence Synthetic
Oligonucleotide 13 gagaacgctc gaccttcgat 20 14 20 DNA Artificial
Sequence Synthetic Oligonucleotide 14 gagaacgctg gaccttccat 20 15
20 DNA Artificial Sequence Synthetic Oligonucleotide 15 gagaacgatg
gaccttccat 20 16 20 DNA Artificial Sequence Synthetic
Oligonucleotide 16 gagaacgctc cagcactgat 20 17 20 DNA Artificial
Sequence Synthetic Oligonucleotide 17 tccatgtcgg tcctgatgct 20 18
20 DNA Artificial Sequence Synthetic Oligonucleotide 18 tccatgtcgg
tcctgatgct 20 19 20 DNA Artificial Sequence Synthetic
Oligonucleotide 19 tccatgacgt tcctgatgct 20 20 20 DNA Artificial
Sequence Synthetic Oligonucleotide 20 tccatgtcgg tcctgctgat 20 21 8
DNA Artificial Sequence Synthetic Oligonucleotide 21 tcaacgtt 8 22
8 DNA Artificial Sequence Synthetic Oligonucleotide 22 tcagcgct 8
23 8 DNA Artificial Sequence Synthetic Oligonucleotide 23 tcatcgat
8 24 8 DNA Artificial Sequence Synthetic Oligonucleotide 24
tcttcgaa 8 25 7 DNA Artificial Sequence Synthetic Oligonucleotide
25 caacgtt 7 26 8 DNA Artificial Sequence Synthetic Oligonucleotide
26 ccaacgtt 8 27 8 DNA Artificial Sequence Synthetic
Oligonucleotide 27 aacgttct 8 28 8 DNA Artificial Sequence
Synthetic Oligonucleotide 28 tcaacgtc 8 29 20 DNA Artificial
Sequence Synthetic Oligonucleotide 29 atggactctc cagcgttctc 20 30
20 DNA Artificial Sequence Synthetic Oligonucleotide 30 atggaaggtc
caacgttctc 20 31 20 DNA Artificial Sequence Synthetic
Oligonucleotide 31 atcgactctc gagcgttctc 20 32 20 DNA Artificial
Sequence Synthetic Oligonucleotide 32 atggaggctc catcgttctc 20 33
20 DNA Artificial Sequence Synthetic Oligonucleotide 33 atcgactctc
gagcgttctc 20 34 20 DNA Artificial Sequence Synthetic
Oligonucleotide 34 atcgactctc gagcgttctc 20 35 20 DNA Artificial
Sequence Synthetic Oligonucleotide 35 tccatgtcgg tcctgatgct 20 36
20 DNA Artificial Sequence Synthetic Oligonucleotide 36 tccatgccgg
tcctgatgct 20 37 20 DNA Artificial Sequence Synthetic
Oligonucleotide 37 tccatggcgg tcctgatgct 20 38 20 DNA Artificial
Sequence Synthetic Oligonucleotide 38 tccatgacgg tcctgatgct 20 39
20 DNA Artificial Sequence Synthetic Oligonucleotide 39 tccatgtcga
tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic
Oligonucleotide 40 tccatgtcgc tcctgatgct 20 41 20 DNA Artificial
Sequence Synthetic Oligonucleotide 41 tccatgtcgt ccctgatgct 20 42
20 DNA Artificial Sequence Synthetic Oligonucleotide 42 tccatgacgt
gcctgatgct 20 43 20 DNA Artificial Sequence Synthetic
Oligonucleotide 43 tccataacgt tcctgatgct 20 44 20 DNA Artificial
Sequence Synthetic Oligonucleotide 44 tccatgacgt ccctgatgct 20 45
20 DNA Artificial Sequence Synthetic Oligonucleotide 45 tccatcacgt
gcctgatgct 20 46 19 DNA Artificial Sequence Synthetic
Oligonucleotide 46 ggggtcaacg ttgacgggg 19 47 19 DNA Artificial
Sequence Synthetic Oligonucleotide 47 ggggtcagtc gtgacgggg 19 48 15
DNA Artificial Sequence Synthetic Oligonucleotide 48 gctagacgtt
agtgt 15 49 20 DNA Artificial Sequence Synthetic Oligonucleotide 49
tccatgtcgt tcctgatgct 20 50 24 DNA Artificial Sequence Synthetic
Oligonucleotide 50 accatggacg atctgtttcc cctc 24 51 18 DNA
Artificial Sequence Synthetic Oligonucleotide 51 tctcccagcg
tgcgccat 18 52 24 DNA Artificial Sequence Synthetic Oligonucleotide
52 accatggacg aactgtttcc cctc 24 53 24 DNA Artificial Sequence
Synthetic Oligonucleotide 53 accatggacg agctgtttcc cctc 24 54 24
DNA Artificial Sequence Synthetic Oligonucleotide 54 accatggacg
acctgtttcc cctc 24 55 24 DNA Artificial Sequence Synthetic
Oligonucleotide 55 accatggacg tactgtttcc cctc 24 56 24 DNA
Artificial Sequence Synthetic Oligonucleotide 56 accatggacg
gtctgtttcc cctc 24 57 24 DNA Artificial Sequence Synthetic
Oligonucleotide 57 accatggacg ttctgtttcc cctc 24 58 15 DNA
Artificial Sequence Synthetic Oligonucleotide 58 cacgttgagg ggcat
15 59 12 DNA Artificial Sequence Synthetic Oligonucleotide 59
tcagcgtgcg cc 12 60 17 DNA Artificial Sequence Synthetic
Oligonucleotide 60 atgacgttcc tgacgtt 17 61 17 DNA Artificial
Sequence Synthetic Oligonucleotide 61 tctcccagcg ggcgcat 17 62 20
DNA Artificial Sequence Synthetic Oligonucleotide 62 tccatgtcgt
tcctgtcgtt 20 63 20 DNA Artificial Sequence Synthetic
Oligonucleotide 63 tccatagcgt tcctagcgtt 20 64 21 DNA Artificial
Sequence Synthetic Oligonucleotide 64 tcgtcgctgt ctccccttct t 21 65
19 DNA Artificial Sequence Synthetic Oligonucleotide 65 tcctgacgtt
cctgacgtt 19 66 19 DNA Artificial Sequence Synthetic
Oligonucleotide 66 tcctgtcgtt cctgtcgtt 19 67 20 DNA Artificial
Sequence Synthetic Oligonucleotide 67 tccatgtcgt ttttgtcgtt 20 68
20 DNA Artificial Sequence Synthetic Oligonucleotide 68 tcctgtcgtt
ccttgtcgtt 20 69 20 DNA Artificial Sequence Synthetic
Oligonucleotide 69 tccttgtcgt tcctgtcgtt 20 70 20 DNA Artificial
Sequence Synthetic Oligonucleotide 70 tcctgtcgtt ttttgtcgtt 20 71
21 DNA Artificial Sequence Synthetic Oligonucleotide 71 tcgtcgctgt
ctgcccttct t 21 72 21 DNA Artificial Sequence Synthetic
Oligonucleotide 72 tcgtcgctgt tgtcgtttct t 21 73 20 DNA Artificial
Sequence Synthetic Oligonucleotide 73 tccatgcgtg cgtgcgtttt 20 74
20 DNA Artificial Sequence Synthetic Oligonucleotide 74 tccatgcgtt
gcgttgcgtt 20 75 20 DNA Artificial Sequence Synthetic
Oligonucleotide 75 tccacgacgt tttcgacgtt 20 76 20 DNA Artificial
Sequence Synthetic Oligonucleotide 76 tcgtcgttgt cgttgtcgtt 20 77
24 DNA Artificial Sequence Synthetic Oligonucleotide 77 tcgtcgtttt
gtcgttttgt cgtt 24 78 22 DNA Artificial Sequence Synthetic
Oligonucleotide 78 tcgtcgttgt cgttttgtcg tt 22 79 21 DNA Artificial
Sequence Synthetic Oligonucleotide 79 gcgtgcgttg tcgttgtcgt t 21 80
21 DNA Artificial Sequence Synthetic Oligonucleotide 80 tgtcgtttgt
cgtttgtcgt t 21 81 25 DNA Artificial Sequence Synthetic
Oligonucleotide 81 tgtcgttgtc gttgtcgttg tcgtt 25 82 19 DNA
Artificial Sequence Synthetic Oligonucleotide 82 tgtcgttgtc
gttgtcgtt 19 83 14 DNA Artificial Sequence Synthetic
Oligonucleotide 83 tcgtcgtcgt cgtt 14 84 13 DNA Artificial Sequence
Synthetic Oligonucleotide 84 tgtcgttgtc gtt 13 85 20 DNA Artificial
Sequence Synthetic Oligonucleotide 85 tccatagcgt tcctagcgtt 20 86
20 DNA Artificial Sequence Synthetic Oligonucleotide 86 tccatgacgt
tcctgacgtt 20 87 6 DNA Artificial Sequence Synthetic
Oligonucleotide 87 gtcgyt 6 88 7 DNA Artificial Sequence Synthetic
Oligonucleotide 88 tgtcgyt 7 89 18 DNA Artificial Sequence
Synthetic Oligonucleotide 89 agctatgacg ttccaagg 8 90 20 DNA
Artificial Sequence Synthetic Oligonucleotide 90 tccatgacgt
tcctgacgtt 20 91 20 DNA Artificial Sequence Synthetic
Oligonucleotide 91 atcgactctc gaacgttctc 20 92 20 DNA Artificial
Sequence Synthetic Oligonucleotide 92 tccatgtcgg tcctgacgca 20 93 8
DNA Artificial Sequence Synthetic Oligonucleotide 93 tcttcgat 8 94
20 DNA Artificial Sequence Synthetic Oligonucleotide 94 ataggaggtc
caacgttctc 20 95 6 DNA Artificial Sequence Synthetic
Oligonucleotide 95 gtcgtt 6 96 6 DNA Artificial Sequence Synthetic
Oligonucleotide 96 gtcgtc 6 97 7 DNA Artificial Sequence Synthetic
Oligonucleotide 97 tgtcgtt 7 98 7 DNA Artificial Sequence Synthetic
Oligonucleotide 98 tgtcgct 7
* * * * *