U.S. patent application number 10/888449 was filed with the patent office on 2005-03-03 for immunostimulatory nucleic acid molecules.
This patent application is currently assigned to The University of Iowa Research Foundation. Invention is credited to Kline, Joel, Klinman, Dennis, Krieg, Arthur M., Steinberg, Alfred D..
Application Number | 20050049215 10/888449 |
Document ID | / |
Family ID | 24968901 |
Filed Date | 2005-03-03 |
United States Patent
Application |
20050049215 |
Kind Code |
A1 |
Krieg, Arthur M. ; et
al. |
March 3, 2005 |
Immunostimulatory nucleic acid molecules
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and
therapeutic utilities based on their ability to stimulate an immune
response and to redirect a Th2 response to a Th1 response in a
subject are disclosed. Methods for treating atopic diseases,
including atopic dermatitis, are disclosed.
Inventors: |
Krieg, Arthur M.;
(Wellesley, MA) ; Kline, Joel; (Iowa City, IA)
; Klinman, Dennis; (Potomac, MD) ; Steinberg,
Alfred D.; (Potomac, MD) |
Correspondence
Address: |
Helen C. Lockhart
Wolf, Greenfield & Sacks, P.C.
600 Atlantic Avenue
Boston
MA
02210
US
|
Assignee: |
The University of Iowa Research
Foundation
Iowa City
IA
Coley Pharmaceutical Group, Inc.
Wellesley
MA
United States of America, as represented by the Secretary,
Department of Health & Human Services
Bethesda
MD
|
Family ID: |
24968901 |
Appl. No.: |
10/888449 |
Filed: |
July 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10888449 |
Jul 9, 2004 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
6207646 |
|
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
6194388 |
|
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
08276358 |
Jul 15, 1994 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 1/04 20180101; A61P
43/00 20180101; C12N 15/117 20130101; A61P 31/10 20180101; A61P
37/04 20180101; A61P 37/08 20180101; A61K 31/00 20130101; A61K
31/711 20130101; A61P 17/06 20180101; Y02A 50/30 20180101; A61P
1/00 20180101; A61K 39/39 20130101; A61K 31/7125 20130101; A61P
31/12 20180101; C07H 21/00 20130101; C12Q 1/68 20130101; C12N
2310/315 20130101; A61P 37/02 20180101; A61P 37/06 20180101; A61P
7/00 20180101; A61P 19/02 20180101; C12N 2310/17 20130101; A61P
1/02 20180101; A61P 11/06 20180101; A61K 2039/55561 20130101; A61P
17/00 20180101; A61P 31/04 20180101; A61P 35/00 20180101; A61K
31/7048 20130101; A61P 1/16 20180101; A61P 33/00 20180101; A61K
39/00 20130101; A61P 31/00 20180101; A61K 31/4706 20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Goverment Interests
[0002] The work resulting in this invention was supported in part
by National Institute of Health Grant No. R29-AR42556-01. The U.S.
Government may therefore be entitled to certain rights in the
invention.
Claims
1-18. (Cancelled)
19. A method of stimulating interferon-alpha in a subject
comprising administering to a subject an immunostimulatory
oligonucleotide/delivery complex, said delivery complex comprising
a oligonucleotide linked to a biodegradable delivery complex,
wherein the oligonucleotide comprises the sequence 5'-C, G-3', in
an amount sufficient to increase interferon-alpha in the
subject.
20. The method of claim 19, wherein said complex is
antigen-free.
21. The method of claim 19, wherein said complex further comprises
an antigen.
22. The method of claim 19, wherein said delivery complex is a
liquid phase microcarrier.
23. The method of claim 19, wherein said immunostimulatory
oligonucleotide is covalently linked to said delivery complex.
24. The method of claim 19, wherein said immunostimulatory
oligonucleotide is non-covalently linked to said delivery
complex.
25. The method of claim 19, wherein said immunostimulatory
oligonucleotide comprises a phosphate backbone modification.
26. The method of claim 25, wherein said phosphate backbone
modification is a phosphorothioate.
27. The method of claim 19, wherein the immunostimulatory
oligonucleotide is 8 to 40 nucleotides in length and comprises:
5'X.sub.1X.sub.2CGX.sub.3- X.sub.43', wherein C and G are
unmethylated and X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides.
28. The method of claim 27, wherein the immunostimulatory
oligonucleotide does not include a GCG trinucleotide at a 5' and/or
3' terminal.
29. The method of claim 19 wherein the immunostimulatory
oligonucleotide does not contain a
5'X.sub.1X.sub.2CGX.sub.3X.sub.43' palindrome.
30. The method of claim 27 wherein the immunostimulatory
oligonucleotide does not contain a
5'X.sub.1X.sub.2CGX.sub.3X.sub.43' palindrome.
31. The method of claim 19, wherein said oligonucleotide comprises
the sequence 5'-T, C, G-3'.
32. The method of claim 19, wherein the individual has a viral
infection.
33. The method of claim 19, wherein said delivery complex is less
than 10 .mu.m in size.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of co-pending U.S. patent
application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a
continuation-in-part of U.S. patent application Ser. No.
08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No.
6,194,388, which is a continuation-in-part of U.S. patent
application Ser. No. 08/276,358, filed Jul. 15, 1994, now
abandoned.
BACKGROUND OF THE INVENTION
[0003] DNA binds to cell membranes and is internalized In the
1970's, several investigators reported the binding of high
molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke,
and D. A. Goldstein. 1971. "Membrane-associated DNA in the
cytoplasm of diploid human lymphocytes". Proc. Natl. Acad. Sci. USA
68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B.
Rosenberg. 1975. "Cell-surface-associated nucleic acid in
tumorigenic cells made visible with platinum-pyrimidine complexes
by electron microscopy". Proc. Natl. Acad. Sci. USA 72:928). In
1985, Bennett et al. presented the first evidence that DNA binding
to lymphocytes is similar to a ligand receptor interaction: binding
is saturable, competitive, and leads to DNA endocytosis and
degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and
M. M. Merritt. 1985. "DNA binding to human leukocytes. Evidence for
a receptor-mediated association, internalization, and degradation
of DNA". J. Clin. Invest. 76:2182). Like DNA,
oligodeoxyribonucleotides (ODNs) are able to enter cells in a
saturable, sequence independent, and temperature and energy
dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen.
1991. "Cellular uptake of antisense oligodeoxynucleotides".
Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R.
L. Juliano. 1992. "Pharmaceutical aspects of the biological
stability and membrane transport characteristics of antisense
oligonucleotides". In: Gene Regulation: Biology of Antisense RNA
and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd.
New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J.
Herrera, and A. M. Krieg., 1994. "Stage specific oligonucleotide
uptake in murine bone marrow B cell precursors". Blood, 84:3660).
No receptor for DNA or ODN uptake has yet been cloned, and it is
not yet clear whether ODN binding and cell uptake occurs through
the same or a different mechanism from that of high molecular
weight DNA.
[0004] Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen LPS had
dramatically enhanced ODN uptake in the B cell population, while
spleen cells treated with the T cell mitogen Con A showed enhanced
ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling,
M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg.
1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is
heterogeneous and inducible". Antisense Research and Development
1:161).
[0005] Immune Effects of Nucleic Acids
[0006] Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly
(I,C) which is a potent inducer of IFN production as well as a
macrophage activator and inducer of NK activity (Talmadge, J. E.,
J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E.
Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985.
"Immunomodulatory effects in mice of polyinosinic-polycytidylic
acid complexed with poly-L-lysine and carboxymethylcellulose".
Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley,
and J. E. Talmadge. 1985. "Immunomodulation of natural killer
activity by polyribonucleotides". J. Biol. Resp. Mod. 4:512; Krown,
S. E. 1986. "Interferons and interferon inducers in cancer
treatment". Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C.
Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J.
Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt,
and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid
complexed with poly-L-lysine and carboxymethylcellulose in
combination with interleukin-2 in patients with cancer: clinical
and immunological effects". Canc. Res. 52:3005). It appears that
this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN
induction and associated changes in splenic leukocyte
distribution". J. Immunol. 150:3713). This activation was specific
for the ribose sugar since deoxyribose was ineffective. Its potent
in vitro antitumor activity led to several clinical trials using
poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose
(to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985.
cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S.
E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited
supra). Unfortunately, toxic side effects have thus far prevented
poly (I,C) from becoming a useful therapeutic agent.
[0007] Guanine ribonucleotides substituted at the C8 position with
either a bromine or a thiol group are B cell mitogens and may
replace "B cell differentiation factors" (Feldbush, T. L., and Z.
K. Ballas. 1985. "Lymphokine-like activity of 8-mercaptoguanosine:
induction of T and B cell differentiation". J. Immunol. 134:3204;
and Goodman, M. G. 1986. "Mechanism of synergy between T cell
signals and C8-substituted guanine nucleosides in humoral immunity:
B lymphotropic cytokines induce responsiveness to
8-mercaptoguanosine". J. Immunol. 136:3335). 8-mercaptoguanosine
and 8-bromoguanosine also can substitute for the cytokine
requirement for the generation of MHC restricted CTL (Feldbush, T.
L., 1985. cited supra), augment murine NK activity (Koo, G. C., M.
E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988.
"Activation of murine natural killer cells and macrophages by
8-bromoguanosine". J. Immunol. 140:3249), and synergize with IL-2
in inducing murine LAK generation (Thompson, R. A., and Z. K.
Ballas. 1990. "Lymphokine-activated killer (LAK) cells. V.
8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation". J.
Immunol. 145:3524). The NK and LAK augmenting activities of these
C8-substituted guanosines appear to be due to their induction of
IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5'
triphosphorylated thymidine produced by a mycobacterium was found
to be mitogenic for a subset of human .gamma..delta. T cells
(Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M.
Bonneville, and J. -J. Foumie. 1994. "Stimulation of human
.gamma..delta. T cells by nonpeptidic mycobacterial ligands"
Science 264:267). This report indicated the possibility that the
immune system may have evolved ways to preferentially respond to
microbial nucleic acids.
[0008] Several observations suggest that certain DNA structures may
also have the potential to activate lymphocytes. For example, Bell
et al. reported that nucleosomal protein-DNA complexes (but not
naked DNA) in spleen cell supernatants caused B cell proliferation
and immunoglobulin secretion (Bell, D. A., B. Morrison, and P.
VandenBygaart. 1990. "Immunogenic DNA-related factors". J. Clin.
Invest. 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina et al. have recently
reported that 260 to 800 bp fragments of poly (dG).multidot.(dC)
and poly (dG.multidot.dC) were mitogenic for B cells (Messina, J.
P., G. S. Gilkeson, and D. S. Pisetsky. 1993. "The influence of DNA
structure on the in vitro stimulation of murine lymphocytes by
natural and synthetic polynucleotide antigens". Cell. Immunol.
147:148). Tokunaga, et al. have reported that dG.multidot.dC
induces IFN-.gamma. and NK activity (Tokunaga, S. Yamamoto, and K.
Namba. 1988. "A synthetic single-stranded DNA, poly(dG,dC), induces
interferon-.alpha./.beta. and -.gamma., augments natural killer
activity, and suppresses tumor growth" Jpn. J Cancer Res. 79:682).
Aside from such artificial homopolymer sequences, Pisetsky et al.
reported that pure mammalian DNA has no detectable immune effects,
but that DNA from certain bacteria induces B cell activation and
immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S.
Pisetsky. 1991. "Stimulation of in vitro murine lymphocyte
proliferation by bacterial DNA". J. Immunol. 147:1759). Assuming
that these data did not result from some unusual contaminant, these
studies suggested that a particular structure or other
characteristic of bacterial DNA renders it capable of triggering B
cell activation. Investigations of mycobacterial DNA sequences have
demonstrated that ODN which contain certain palindrome sequences
can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E.
Kuramoto, O. Yano, and T. Tokunaga. 1992. "Unique palindromic
sequences in synthetic oligonucleotides are required to induce INF
and augment INF-mediated natural killer activity". J. Immunol.
148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S.
Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992.
"Oligonucleotide sequences required for natural killer cell
activation". Jpn. J. Cancer Res. 83:1128).
[0009] Several phosphorothioate modified ODN have been reported to
induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C.
Chu, and W. E. Paul. 1992. "An antisense oligonucleotide
complementary to a sequence in I.gamma.2b increases .gamma.2b
germline transcripts, stimulates B cell DNA synthesis, and inhibits
immunoglobulin secretion". J. Exp. Med. 175:597; Branda, R. F., A.
L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. "Immune
stimulation by an antisense oligomer complementary to the rev gene
of HIV-1". Biochem. Pharmacol. 45:2037; McIntyre, K. W., K.
Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D.
Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense
phosphorothioate oligonucleotide directed to the initiation codon
of transcription factor NF.kappa.B T65 causes sequence-specific
immune stimulation". Antisense Res. Develop. 3:309; and Pisetsky,
D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte
proliferation by a phosphorothioate oligonucleotide with antisense
activity for herpes simplex virus". Life Sciences 54:101). These
reports do not suggest a common structural motif or sequence
element in these ODN that might explain their effects.
[0010] The CREB/ATF Family of Transcription Factors and Their Role
in Replication
[0011] The cAMP response element binding protein (CREB) and
activating transcription factor (ATF) or CREB/ATF family of
transcription factors is a ubiquitously expressed class of
transcription factors of which 11 members have so far been cloned
(reviewed in de Groot, R. P., and P. Sassone-Corsi: "Hormonal
control of gene expression: Multiplicity and versatility of cyclic
adenosine 3',5'-monophosphate-responsive nuclear regulators". Mol.
Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson:
"Transcriptional regulation by CREB and its relatives". Biochim.
Biophys. Acta 1174:221, 1993.). They all belong to the basic
region/leucine zipper (bZip) class of proteins. All cells appear to
express one or more CREB/ATF proteins, but the members expressed
and the regulation of mRNA splicing appear to be tissue-specific.
Differential splicing of activation domains can determine whether a
particular CREB/ATF protein will be a transcriptional inhibitor or
activator. Many CREB/ATF proteins activate viral transcription, but
some splicing variants which lack the activation domain are
inhibitory. CREB/ATF proteins can bind DNA as homo- or
hetero-dimers through the cAMP response element, the CRE, the
consensus form of which is the umethylated sequence TGACGTC
(binding is abolished if the CpG is methylated) (Iguchi-Ariga, S.
M. M., and W. Schaffner: "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation". Genes &
Develop. 3:612, 1989.).
[0012] The transcriptional activity of the CRE is increased during
B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein:
"Induction of CREB activity via the surface Ig receptor of B
cells". J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to
regulate the expression of multiple genes through the CRE including
immunologically important genes such as fos, jun B, Rb-1, IL-6,
IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E.
Auron: "Transcription factors NF-IL6 and CREB recognize a common
essential site in the human prointerleukin 1.beta. gene". Mol.
Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel,
M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA
inhibition of tumor growth induced by c-Ha-ras oncogene in nude
mice". Cancer Res. 53:577, 1993), IFN-.beta. (Du, W., and T.
Maniatis: "An ATF/CREB binding site protein is required for virus
induction of the human interferon B gene". Proc. Natl. Acad. Sci.
USA 89:2150, 1992), TGF-.beta.1 (Asiedu, C. K., L. Scott, R. K.
Assoian, M. Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to
contiguous sites downstream of the human TGF-B1 gene". Biochim.
Biophys. Acta 1219:55, 1994.), TGF-.beta.2, class II MHC (Cox, P.
M., and C. R. Goding: "An ATF/CREB binding motif is required for
aberrant constitutive expression of the MHC class II DRa promoter
and activation by SV40 T-antigen". Nucl. Acids Res. 20:4881,
1992.), E-selectin, GM-CSF, CD-8.alpha., the germline Ig.alpha.
constant region gene, the TCR V.beta. gene, and the proliferating
cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J.
Orten, S. H. Hinrichs, and M. B. Prystowsky: "Promoter activity of
the proliferating-cell nuclear antigen gene is associated with
inducible CRE-binding proteins in interleukin 2-stimulated T
lymphocytes". Mol. Cell. Biol. 14:4233, 1994.). In addition to
activation through the cAMP pathway, CREB can also mediate
transcriptional responses to changes in intracellular Ca.sup.++
concentration (Sheng, M., G. McFadden, and M. E. Greenberg:
"Membrane depolarization and calcium induce c-fos transcription via
phosphorylation of transcription factor CREB". Neuron 4:571,
1990).
[0013] The role of protein-protein interactions in transcriptional
activation by CREB/ATF proteins appears to be extremely important.
There are several published studies reporting direct or indirect
interactions between NF.kappa.B proteins and CREB/ATF proteins
(Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell,
et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene
8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB
through the cyclic AMP pathway requires protein kinase A (PKA),
which phosphorylates CREB.sup.341 on ser.sup.133 and allows it to
bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R.
Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G.
Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear
protein CBP is a coactivator for the transcription factor CREB".
Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X.
Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy:
"Activation of cAMP and mitogen responsive genes relies on a common
nuclear factor". Nature 370:226, 1994.). CBP in turn interacts with
the basal transcription factor TFIIB causing increased
transcription. CREB also has been reported to interact with dTAFII
110, a TATA binding protein-associated factor whose binding may
regulate transcription (Ferreri, K., G. Gill, and M. Montminy: "The
cAMP-regulated transcription factor CREB interacts with a component
of the TFIID complex". Proc. Natl. Acad. Sci. USA 91:1210, 1994.).
In addition to these interactions, CREB/ATF proteins can
specifically bind multiple other nuclear factors (Hoeffler, J. P.,
J. W. Lustbader, and C. -Y. Chen: "Identification of multiple
nuclear factors that interact with cyclic adenosine
3',5'-monophosphate response element-binding protein and activating
transcription factor-2 by protein-protein interactions". Mol.
Endocrinol. 5:256, 1991) but the biologic significance of most of
these interactions is unknown. CREB is normally thought to bind DNA
either as a homodimer or as a heterodimer with several other
proteins. Surprisingly, CREB monomers constitutively activate
transcription (Krajewski, W., and K. A. W. Lee: "A monomeric
derivative of the cellular transcription factor CREB functions as a
constitutive activator". Mol. Cell. Biol. 14:7204, 1994.).
[0014] Aside from their critical role in regulating cellular
transcription, it has recently been shown that CREB/ATF proteins
are subverted by some infectious viruses and retroviruses, which
require them for viral replication. For example, the
cytomegalovirus immediate early promoter, one of the strongest
known mammalian promoters, contains eleven copies of the CRE which
are essential for promoter function (Chang, Y. -N., S. Crawford, J.
Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: "The
palindromic series I repeats in the simian cytomegalovirus major
immediate-early promoter behave as both strong basal enhancers and
cyclic AMP response elements". J. Virol. 64:264, 1990). At least
some of the transcriptional activating effects of the adenovirus
E1A protein, which induces many promoters, are due to its binding
to the DNA binding domain of the CREB/ATF protein, ATF-2, which
mediates E1A inducible transcription activation (Liu, F., and M. R.
Green: "Promoter targeting by adenovirus E1a through interaction
with different cellular DNA-binding domains". Nature 368:520,
1994). It has also been suggested that E1A binds to the
CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M.
Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated
CBP belong to a conserved family of coactivators". Cell 77:799,
1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which
causes human T cell leukemia and tropical spastic paresis, also
requires CREB/ATF proteins for replication. In this case, the
retrovirus produces a protein, Tax, oligonucleotides do not include
a GCG trinucleotide sequence at or near the 5' and/or 3' terminals
and/or the consensus mitogenic CpG motif is not a palindrome.
Prolonged immunostimulation can be obtained using stabilized
oligonucleotides, particularly phosphorothioate stabilized
oligonucleotides.
[0015] In a second aspect, the invention features useful therapies,
which are based on the immunostimulatory activity of the nucleic
acid molecules. For example, the immunostimulatory nucleic acid
molecules can be used to treat, prevent or ameliorate an immune
system deficiency (e.g., a tumor or cancer or a viral, fungal,
bacterial or parasitic infection in a subject). In addition,
immunostimulatory nucleic acid molecules can be administered to
stimulate a subject's response to a vaccine.
[0016] Further, by redirecting a subject's immune response from Th2
to Th1, the instant claimed nucleic acid molecules can be
administered to treat or prevent the symptoms of asthma. In
addition, the instant claimed nucleic acid molecules can be
administered in conjunction with a particular allergen to a subject
as a type of desensitization therapy to treat or prevent the
occurrence of an allergic reaction.
[0017] Further, the ability of immunostimulatory nucleic acid
molecules to induce leukemic cells to enter the cell cycle supports
the use of immunostimulatory nucleic acid molecules in treating
leukemia by increasing the sensitivity of chronic leukemia cells
and then administering conventional ablative chemotherapy, or
combining the immunostimulatory nucleic acid molecules with another
immunotherapy.
[0018] Other features and advantages of the invention will become
more apparent from the following detailed description and
claims.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1A-C are graphs plotting dose-dependent IL-6 production
in response to various DNA sequences in T cell depleted spleen cell
cultures. A. E. coli DNA (.circle-solid.) and calf thymus DNA
(.box-solid.) sequences and LPS (at 10.times. the concentration of
E. coli and calf thymus DNA) (.diamond-solid.). B. Control
phosphodiester oligodeoxynucleotide (ODN)
.sup.5'ATGGAAGGTCCAGTGTTCTC.sup.3' (SEQ ID NO:1) (.box-solid.) and
two phosphodiester CpG ODN.sup.5'ATCGACCTACGTGCGT- TCTC.sup.3' (SEQ
ID NO:2) (.diamond-solid.) and .sup.5'TCCATAACGTTCCTGATGC- T.sup.3'
(SEQ ID NO:3) (.circle-solid.). C. Control phosphorothioate
ODN.sup.5'GCTAGATGTTAGCGT.sup.3' (SEQ ID NO:4) (.box-solid.) and
two phosphorothioate CpG ODN.sup.5'GAGAACGTCGACCTTCGAT.sup.3' (SEQ
ID NO:5) (.diamond-solid.) and .sup.5'GCATGACGTTGAGCT.sup.3' (SEQ
ID NO:6) (.circle-solid.). Data present the mean.+-.standard
deviation of triplicates.
[0020] FIG. 2 is a graph plotting IL-6 production induced by CpG
DNA in vivo as determined 1-8 hrs after injection. Data represent
the mean from duplicate analyses of sera from two mice. BALB/c mice
(two mice/group) were injected iv. with 100 ill of PBS
(.quadrature.) or 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.zeta.) or non-CpG
phosphorothioate ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8)
(.diamond-solid.).
[0021] FIG. 3 is an autoradiograph showing IL-6 mRNA expression as
determined by reverse transcription polymerase chain reaction in
liver, spleen, and thymus at various time periods after in vivo
stimulation of BALB/c mice (two mice/group) injected iv with 100
.mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG phosphorothioate
ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8).
[0022] FIG. 4A is a graph plotting dose-dependent inhibition of
CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2
mice were stimulated with CpG ODN.sup.5'TCCAAGACGTTCCTGATGCT.sup.3'
(SEQ ID NO:9) in the presence of the indicated concentrations of
neutralizing anti-IL-6 (.diamond-solid.) or isotype control Ab
(.circle-solid.) and IgM levels in culture supernatants determined
by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect
on IgM secretion (.box-solid.).
[0023] FIG. 4B is a graph plotting the stimulation index of
CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN
5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.diamond-solid.) or
anti-IL-6 antibody only (.box-solid.). Data present the
mean.+-.standard deviation of triplicates.
[0024] FIG. 5 is a bar graph plotting chloramphenicol
acetyltransferase (CAT) activity in WEHI-231 cells transfected with
a promoter-less CAT construct (pCAT), positive control plasmid
(RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8) phosphorothioate ODN at the
indicated concentrations. Data present the mean of triplicates.
[0025] FIG. 6 is a schematic overview of the immune effects of the
immunostimulatory unmethylated CpG containing nucleic acids, which
can directly activate both B cells and monocytic cells (including
macrophages and dendritic cells) as shown. The immunostimulatory
oligonucleotides do not directly activate purified NK cells, but
render them competent to respond to IL-12 with a marked increase in
their IFN-.gamma. production. By inducing IL-12 production and the
subsequent increased IFN-.gamma. secretion by NK cells, the
immunostimulatory nucleic acids promote a Th1 type immune response.
No direct activation of proliferation of cytokine secretion by
highly purified T cells has been found. However, the induction of
Th1 cytokine secretion by the immunostimulatory oligonucleotides
promotes the development of a cytotoxic lymphocyte response.
[0026] FIG. 7 is an autoradiograph showing NF.kappa.B mRNA
induction in monocytes treated with E. coli (EC) DNA (containing
unmethylated CpG motifs), control (CT) DNA (containing no
unmethylated CpG motifs) and lipopolysaccharide (LPS) at various
measured times, 15 and 30 minutes after contact.
[0027] FIG. 8A shows the results from a flow cytometry study using
mouse B cells with the dihydrorhodamine 123 dye to determine levels
of reactive oxygen species. The dye only sample in Panel A of the
figure shows the background level of cells positive for the dye at
28.6%. This level of reactive oxygen species was greatly increased
to 80% in the cells treated for 20 minutes with PMA and ionomycin,
a positive control (Panel B). The cells treated with the CpG oligo
(TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the
level of reactive oxygen species such that more than 50% of the
cells became positive (Panel D). However, cells treated with an
oligonucleotide with the identical sequence except that the CpGs
were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show
this significant increase in the level of reactive oxygen species
(Panel E).
[0028] FIG. 8B shows the results from a flow cytometry study using
mouse B cells in the presence of chloroquine with the
dihydrorhodamine 123 dye to determine levels of reactive oxygen
species. Chloroquine slightly lowers the background level of
reactive oxygen species in the cells such that the untreated cells
in Panel A have only 4.3% that are positive. Chloroquine completely
abolishes the induction of reactive oxygen species in the cells
treated with CpG DNA (Panel B) but does not reduce the level of
reactive oxygen species in the cells treated with PMA and ionomycin
(Panel E).
[0029] FIG. 9 is a graph plotting lung lavage cell count over time.
The graph shows that when the mice are initially injected with
Schistosoma mansoni eggs "egg", which induces a Th2 immune
response, and subsequently inhale Schistosoma mansoni egg antigen
"SEA" (open circle), many inflammatory cells are present in the
lungs. However, when the mice are initially given CpG oligo (SEQ ID
NO:10) along with egg, the
Sequence CWU 1
1
56 1 20 DNA Artificial Sequence Synthetic oligonucleotide 1
atggaaggtc cagtgttctc 20 2 20 DNA Artificial Sequence Synthetic
oligonucleotide 2 atcgacctac gtgcgttctc 20 3 20 DNA Artificial
Sequence Synthetic oligonucleotide 3 tccataacgt tcctgatgct 20 4 15
DNA Artificial Sequence Synthetic oligonucleotide 4 gctagatgtt
agcgt 15 5 19 DNA Artificial Sequence Synthetic oligonucleotide 5
gagaacgtcg accttcgat 19 6 15 DNA Artificial Sequence Synthetic
oligonucleotide 6 gcatgacgtt gagct 15 7 20 DNA Artificial Sequence
Synthetic oligonucleotide 7 tccatgacgt tcctgatgct 20 8 20 DNA
Artificial Sequence Synthetic oligonucleotide 8 tccatgagct
tcctgagtct 20 9 20 DNA Artificial Sequence Synthetic
oligonucleotide 9 tccaagacgt tcctgatgct 20 10 20 DNA Artificial
Sequence Synthetic oligonucleotide 10 tccatgacgt tcctgacgtt 20 11
21 DNA Artificial Sequence Synthetic oligonucleotide 11 tccatgagct
tcctgagtgc t 21 12 20 DNA Artificial Sequence Synthetic
oligonucleotide 12 ggggtcaacg ttgagggggg 20 13 15 DNA Artificial
Sequence Synthetic oligonucleotide 13 gctagacgtt agcgt 15 14 15 DNA
Artificial Sequence Synthetic oligonucleotide 14 gctagacgtt agcgt
15 15 15 DNA Artificial Sequence Synthetic oligonucleotide 15
gctagacgtt agcgt 15 16 15 DNA Artificial Sequence Synthetic
oligonucleotide 16 gcatgacgtt gagct 15 17 20 DNA Artificial
Sequence Synthetic oligonucleotide 17 atggaaggtc cagcgttctc 20 18
20 DNA Artificial Sequence Synthetic oligonucleotide 18 atcgactctc
gagcgttctc 20 19 20 DNA Artificial Sequence Synthetic
oligonucleotide 19 atcgactctc gagcgttctc 20 20 20 DNA Artificial
Sequence Synthetic oligonucleotide 20 atcgactctc gagcgttctc 20 21
20 DNA Artificial Sequence Synthetic oligonucleotide 21 atcgactctc
gagcgttctc 20 22 20 DNA Artificial Sequence Synthetic
oligonucleotide 22 atggaaggtc caacgttctc 20 23 20 DNA Artificial
Sequence Synthetic oligonucleotide 23 gagaacgctg gaccttccat 20 24
20 DNA Artificial Sequence Synthetic oligonucleotide 24 gagaacgctc
gaccttccat 20 25 20 DNA Artificial Sequence Synthetic
oligonucleotide 25 gagaacgctc gaccttcgat 20 26 20 DNA Artificial
Sequence Synthetic oligonucleotide 26 gagcaagctg gaccttccat 20 27
20 DNA Artificial Sequence Synthetic oligonucleotide 27 gagaacgctg
gaccttccat 20 28 20 DNA Artificial Sequence Synthetic
oligonucleotide 28 gagaacgctg gaccttccat 20 29 20 DNA Artificial
Sequence Synthetic oligonucleotide 29 gagaacgatg gaccttccat 20 30
20 DNA Artificial Sequence Synthetic oligonucleotide 30 gagaacgctc
cagcactgat 20 31 20 DNA Artificial Sequence Synthetic
oligonucleotide 31 tccatgtcgg tcctgatgct 20 32 20 DNA Artificial
Sequence Synthetic oligonucleotide 32 tccatgctgg tcctgatgct 20 33
20 DNA Artificial Sequence Synthetic oligonucleotide 33 tccatgtcgg
tcctgatgct 20 34 20 DNA Artificial Sequence Synthetic
oligonucleotide 34 tccatgtcgg tcctgatgct 20 35 20 DNA Artificial
Sequence Synthetic oligonucleotide 35 tccatgacgt tcctgatgct 20 36
20 DNA Artificial Sequence Synthetic oligonucleotide 36 tccatgtcgg
tcctgctgat 20 37 20 DNA Artificial Sequence Synthetic
oligonucleotide 37 tccatgtcgg tcctgatgct 20 38 20 DNA Artificial
Sequence Synthetic oligonucleotide 38 tccatgccgg tcctgatgct 20 39
20 DNA Artificial Sequence Synthetic oligonucleotide 39 tccatggcgg
tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic
oligonucleotide 40 tccatgacgg tcctgatgct 20 41 20 DNA Artificial
Sequence Synthetic oligonucleotide 41 tccatgtcga tcctgatgct 20 42
20 DNA Artificial Sequence Synthetic oligonucleotide 42 tccatgtcgc
tcctgatgct 20 43 20 DNA Artificial Sequence Synthetic
oligonucleotide 43 tccatgtcgt tcctgatgct 20 44 20 DNA Artificial
Sequence Synthetic oligonucleotide 44 tccatgacgt tcctgatgct 20 45
20 DNA Artificial Sequence Synthetic oligonucleotide 45 tccataacgt
tcctgatgct 20 46 20 DNA Artificial Sequence Synthetic
oligonucleotide 46 tccatgacgt ccctgatgct 20 47 20 DNA Artificial
Sequence Synthetic oligonucleotide 47 tccatcacgt gcctgatgct 20 48
15 DNA Artificial Sequence Synthetic oligonucleotide 48 gcatgacgtt
gagct 15 49 15 DNA Artificial Sequence Synthetic oligonucleotide 49
gctagatgtt agcgt 15 50 20 DNA Artificial Sequence Synthetic
oligonucleotide 50 ggggtcaagt ctgagggggg 20 51 15 DNA Artificial
Sequence Synthetic oligonucleotide 51 gctagacgtt agtgt 15 52 15 DNA
Artificial Sequence Synthetic oligonucleotide 52 gctagacctt agtgt
15 53 20 DNA Artificial Sequence Synthetic oligonucleotide 53
tccatgtcgt tcctgatgct 20 54 20 DNA Artificial Sequence Synthetic
oligonucleotide 54 tccatgacgt tcctgatgct 20 55 18 DNA Artificial
Sequence Synthetic oligonucleotide 55 tctcccagcg tgcgccat 18 56 18
DNA Artificial Sequence Synthetic oligonucleotide 56 catttccacg
atttccca 18
* * * * *