U.S. patent application number 10/831778 was filed with the patent office on 2004-11-25 for immunostimulatory nucleic acids for the treatment of asthma and allergy.
Invention is credited to Bratzler, Robert L., Fouron, Yves, Petersen, Deanna M..
Application Number | 20040235774 10/831778 |
Document ID | / |
Family ID | 26875890 |
Filed Date | 2004-11-25 |
United States Patent
Application |
20040235774 |
Kind Code |
A1 |
Bratzler, Robert L. ; et
al. |
November 25, 2004 |
Immunostimulatory nucleic acids for the treatment of asthma and
allergy
Abstract
The invention involves administration of an immunostimulatory
nucleic acid alone or in combination with an asthma/allergy
medicament for the treatment or prevention of asthma and allergy in
subjects. The combination of drugs are administered in synergistic
amounts or in various dosages or at various time schedules. The
invention also relates to kits and compositions concerning the
combination of drugs.
Inventors: |
Bratzler, Robert L.;
(Concord, MA) ; Petersen, Deanna M.; (Newton,
MA) ; Fouron, Yves; (Marlboro, MA) |
Correspondence
Address: |
Helen C. Lockhart, Ph.D.
Wolf, Greenfield & Sacks, P.C.
600 Atlantic Avenue
Boston
MA
02210
US
|
Family ID: |
26875890 |
Appl. No.: |
10/831778 |
Filed: |
April 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10831778 |
Apr 23, 2004 |
|
|
|
09776479 |
Feb 2, 2001 |
|
|
|
60179991 |
Feb 3, 2000 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C12N 2320/31 20130101;
C12N 2310/315 20130101; A61K 31/557 20130101; A61K 31/7105
20130101; A61K 31/55 20130101; A61K 31/675 20130101; A61K 31/473
20130101; C12N 15/117 20130101; A61K 31/495 20130101; C12N 2310/17
20130101; A61K 31/138 20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Claims
We claim:
1-36. (Canceled)
37. A method of suppressing a symptom of an allergic response in a
subject, the method comprising: administering to the subject a
first dose of an immunostimulatory nucleic acid; and administering
to the subject a second dose of an immunostimulatory nucleic acid,
wherein the immunostimulatory nucleic acid comprises a nucleotide
sequence comprising 5'-CG-3', and wherein the second dose is
administered from about 1 day to about 8 weeks after the first
dose.
38. The method of claim 37, wherein the second dose is administered
from about 1 day to about 7 days after the first dose.
39. The method of claim 37, wherein the second dose is administered
from about 1 week to about 2 weeks after the first dose.
40. The method of claim 37, wherein the second dose is administered
from about 2 weeks to about 4 weeks after the first dose.
41. The method of claim 37, wherein the first dose is
co-administered with an antigen.
42. The method of claim 37, wherein the second dose is
co-administered with an antigen.
43. The method of claim 37, wherein the first dose and second dose
are co-administered with an antigen.
44. The method of claim 37, wherein the subject is a human.
45. The method of claim 37, wherein the first and the second doses
are administered by inhalation.
46. A method for maintaining suppression of a Th2 immune response
in a subject, the method comprising: administering to a subject a
first dose of an immunostimulatory nucleic acid; and administering
to the subject a second dose of an immunostimulatory nucleic acid,
wherein the immunostimulatory nucleic acid comprises a nucleotide
sequence comprising 5'-CG-3', and wherein the second dose is
administered from about 1 day to about 8 weeks after the first
dose.
47. The method of claim 46, wherein the second dose is administered
from about 1 day to about 7 days after the first dose.
48. The method of claim 46, wherein the second dose is administered
from about 1 week to about 2 weeks after the first dose.
49. The method of claim 46, wherein the second dose is administered
from about 2 weeks to about 4 weeks after the first dose.
50. The method of claim 46, wherein the subject is a human.
51. The method of claim 46, wherein the first and the second doses
are administered by inhalation.
52. A method for maintaining stimulation of a Th1 immune response
in a subject, the method comprising: administering to a subject a
first dose of an immunostimulatory nucleic acid; and administering
to the subject a second dose of an immunostimulatory nucleic acid,
wherein the immunostimulatory nucleic acid comprises a nucleotide
sequence comprising 5'-CG-3', and wherein the second dose is
administered from about 1 day to about 8 weeks after the first
dose.
53. The method of claim 52, wherein the second dose is administered
from about 1 day to about 7 days after the first dose.
54. The method of claim 52, wherein the second dose is administered
from about 1 week to about 2 weeks after the first dose.
55. The method of claim 52, wherein the second dose is administered
from about 2 weeks to about 4 weeks after the first dose.
56. The method of claim 52, wherein the subject is a human.
Description
PRIORITY OF THE INVENTION
[0001] This application claims priority under Title 35 .sctn.
119(e), of U.S. Provisional Application No. 60/179,991, filed Feb.
3, 2000, entitled IMMUNOSTIMULATORY NUCLEIC ACIDS FOR THE TREATMENT
OF ASTHMA AND ALLERGY, the entire contents of which are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Asthma is a chronic inflammatory disease effecting 14-15
million persons in the U.S. alone. Symptoms of asthma include
recurrent episodes of wheezing, breathlessness, and chest
tightness, and coughing, resulting from airflow obstruction. Airway
inflammation associated with asthma can be detected through
observation of a number of physiological changes, such as,
denudation of airway epithelium, collagen deposition beneath
basement membrane, edema, mast cell activation, inflammatory cell
infiltration, including neutrophils, eosinophils, and lymphocytes.
As a result of the airway inflammation, asthma patients often
experience airway hyper-responsiveness, airflow limitation,
respiratory symptoms, and disease chronicity. Airflow limitations
include acute bronchoconstriction, airway edema, mucous plug
formation, and airway remodeling, features which often lead to
bronchial obstruction. In some cases of asthma, subbasement
membrane fibrosis may occur, leading to persistent abnormalities in
lung function.
[0003] Research over the past several years has revealed that
asthma likely results from complex interactions among inflammatory
cells, mediators, and other cells and tissues resident in the
airway. Mast cells, eosinophils, epithelial cells, macrophage, and
activated T-cells all play an important role in the inflammatory
process associated with asthma (Djukanovic et al., Am. Rev. Respir.
Dis; 142:434-457; 1990). It is believed that these cells can
influence airway function through secretion of preformed and newly
synthesized mediators which can act directly or indirectly on the
local tissue. It has also been recognized that subpopulations of
T-lymphocytes (TH-2) play an important role in regulating allergic
inflammation in the airway by releasing selective cytokines and
establishing disease chronicity (Robinson, et al. N. Engl. J. Med.;
326:298-304; 1992).
[0004] Asthma is a complex disorder which arises at different
stages in development and can be classified based on the degree of
symptoms of acute, subacute or chronic. An acute inflammatory
response is associated with an early recruitment of cells into the
airway. The subacute inflammatory response involves the recruitment
of cells as well as the activation of resident cells causing a more
persistent pattern of inflammation. Chronic inflammatory response
is characterized by a persistent level of cell damage and an
ongoing repair process, which may result in permanent abnormalities
in the airway.
[0005] Medications for the treatment of asthma are generally
separated into two categories, quick-relief medications and
long-term control medications. Asthma patients take the long-Jo
term control medications on a daily basis to achieve and maintain
control of persistent asthma. Long-term control medications include
anti-inflammatory agents such as corticosteroids, chromolyn sodium
and medacromil; long-acting bronchodilators, such as long-acting
.beta..sub.2-agonists and methylxanthines; and leukotriene
modifiers. The quick-relief medications include short-acting
.beta..sub.2 agonists, anti-cholinergics, and systemic
corticosteroids. There are many side effects associated with each
of these drugs and none of the drugs alone or in combination is
capable of preventing or completely treating asthma.
[0006] Allergy is a disease associated with the production of
antibodies from a particular class of immunoglobulin, IgE, against
allergens. The development of an IgE-mediated response to common
aeroallergens is also a factor which indicates predisposition
towards the development of asthma. If an allergen encounters a
specific IgE which is bound to an Fc IgE receptor on the surface of
a basophil (circulating in the blood) or mast cell (dispersed
throughout solid tissue), the cell becomes activated, resulting in
the production and release of mediators such as histamine,
scrotonin, and lipid mediators. Allergic diseases include but are
not limited to rhinitis (hay fever) asthma, urticaria and atopic
dermatitis.
[0007] Conventional methods for treating or preventing allergy have
involved the use of anti-histamines or desensitization therapies.
Anti-histamines and other drugs which block the effects of chemical
mediators of the allergic reaction help to regulate the severity of
the allergic symptoms but do not prevent the allergic reaction and
have no effect on subsequent allergic responses. Desensitization
therapies are performed by giving small doses of an allergen,
usually by injection under the skin, in order to induce an IgG-type
response against the allergen. The presence of IgG antibody helps
to neutralize the production of mediators resulting from the
induction of IgE antibodies, it is believed. Initially, the subject
is treated with a very low dose of the allergen to avoid inducing a
severe reaction and the dose is slowly increased. This type of
therapy is dangerous because the subject is actually administered
the compounds which cause the allergic response and severe allergic
reactions can result.
SUMMARY OF THE INVENTION
[0008] Improved methods and products for the prevention and/or
treatment of asthma and allergy are provided according to the
invention. The invention is based, in some aspects, on the finding
that when immunostimulatory nucleic acid molecules are used in
conjunction with medicaments for the treatment of asthma and
allergy, some unexpected and improved results are observed. For
instance, the efficacy of the combination of immunostimulatory
nucleic acids and asthma and allergy medicaments is profoundly
improved over the use of each of the medicaments alone. The results
are surprising in part because the drugs act through different
mechanisms and would not necessarily be expected to improve the
efficacy of one another in a synergistic manner.
[0009] In some aspects, the invention is a method for preventing or
treating asthma or allergy by administering a synergistic
combination of an immunostimulatory nucleic acid and an
asthma/allergy medicament, wherein the combination is administered
in an effective amount for synergistically reducing the immune or
inflammatory response caused by a mediator of asthma or allergy. It
was surprisingly discovered according to the invention that the
combination of the immunostimulatory nucleic acid and the
asthma/allergy medicament worked synergistically to reduce the
immune or inflammatory response initiated when a mediator of asthma
or allergy is encountered.
[0010] In other aspects, the invention is a method for altering the
dosage of the asthma/allergy medicament that is required to treat a
subject suffering from asthma or allergy. The invention in one
aspect is a method for increasing the dose of an asthma/allergy
medicament without inducing the level of side effects ordinarily
observed with that dose of an asthma/allergy medicament. The method
is accomplished by administering to a subject suffering from asthma
or allergy or at risk of developing asthma or allergy, an
asthma/allergy medicament in a dose which would ordinarily induce
side effects, administering an immunostimulatory nucleic acid to
the subject, wherein administration of the immunostimulatory
nucleic acid prevents the side effects associated with the high
dose of the asthma/allergy medicament. The method provides a basis
for administering higher therapeutic doses of an asthma/allergy
medicament to a subject in order to prevent or reduce the symptoms
associated with an asthmatic or an allergic response more
sufficiently than a lower dose. It is not desirable to administer
such high doses alone, in the absence of the immunostimulatory
nucleic acid, because of the side effects resulting from the high
dose.
[0011] In another aspect, the invention includes a method for
decreasing the dose of an asthma/allergy medicament by
administering to a subject having asthma or allergy or at risk of
developing asthma or allergy an asthma/allergy medicament in a
sub-therapeutic dosage and an immunostimulatory nucleic acid,
wherein the combination of the sub-therapeutic dose of the
asthma/allergy medicament and the immunostimulatory nucleic acid
produce a therapeutic result in the prevention or treatment of
asthma or allergy in the subject. The method allows a lower dose of
the asthma/allergy medicament to be used. This provides several
advantages, including lower costs associated with using less drugs
and less chances of inducing side effects resulting from the
medications by using lower doses.
[0012] According to other aspects, the invention involves methods
for treating or preventing asthma and/or allergy by administering
an immunostimulatory nucleic acid and an asthma/allergy medicament
in different dosing schedules. In one aspect, the invention is a
method for preventing or treating asthma or allergy by
administering to a subject an effective amount of an
immunostimulatory nucleic acid in an effective amount for producing
the immune response and subsequently administering to the subject
an asthma/allergy medicament. In other aspects, the invention is a
method for preventing or treating asthma or allergy by
administering to a subject an allergy/asthma medicament in an
effective amount for providing some symptomatic relief and
subsequently administering an immunostimulatory nucleic acid to the
subject. In some embodiments, the immunostimulatory nucleic acid is
administered in an effective amount for redirecting the immune
response from a Th2 to a Th1 immune response. In some embodiments,
the immunostimulatory nucleic acid is administered consistently
over a period of time, such as, for instance, in a sustained
release vehicle.
[0013] In another aspect of the invention is a method for treating
asthma or allergy by administering to a subject having asthma or
allergy or at risk of developing asthma or allergy an
immunostimulatory nucleic acid and an asthma/allergy medicament,
wherein the immunostimulatory nucleic acid is administered
systemically and the asthma/allergy medicament is administered
locally. In yet another aspect, the immunostimulatory nucleic acid
is administered locally and the asthma/allergy medicament is
administered systemically.
[0014] According to yet another aspect of the invention, a method
for treating or preventing asthma/allergy is provided. The method
is accomplished by administering to a subject having asthma or
allergy or at risk of developing asthma or allergy, an
immunostimulatory nucleic acid and an asthma/allergy medicament on
a routine schedule. In some embodiments, the routine schedule is a
daily, weekly, monthly, or quarterly administration of the
medicaments. In other embodiments, the immunostimulatory nucleic
acid and/or the asthma/allergy medicament is administered in two or
more doses.
[0015] The immunostimulatory nucleic acid can be administered on a
recurring basis, such as daily, weekly, or monthly in one or more
doses. Alternatively, it can be administered on a non-regular basis
e.g. whenever symptoms being. In yet other embodiments, the
asthma/allergy medicament is a quick relief asthma/allergy
medicament and in other embodiments it is a long-lasting
asthma/allergy medicament.
[0016] According to yet another aspect of the invention, methods
for treating or preventing asthma or allergy using specific
immunostimulatory nucleic acid molecules are provided. The method
in one aspect involves a method for preventing or treating asthma
or allergy by administering to a subject suffering from asthma or
allergy or at risk of developing asthma or allergy, an
immunostimulatory nucleic acid having a sequence selected from the
group consisting of SEQ ID NO: 1 through to SEQ ID NO: 1093 and
administering to the subject an asthma/allergy medicament.
[0017] In yet another aspect of the invention, a method for
preventing or treating asthma or allergy utilizing different routes
of administration is provided. In one aspect, the method involves
the step of administering toga subject having asthma or allergy or
at risk of developing asthma or allergy, an immunostimulatory
nucleic acid, wherein the immunostimulatory is administered
systemically and wherein the asthma/allergy medicament is
administered locally. In a related embodiment, the
immunostimulatory nucleic acid molecule may be administered locally
and the asthma/allergy medicament is administered systemically. In
still other embodiments, the immunostimulatory nucleic acid and the
asthma/allergy medicament are administered by the same route (i.e.,
both delivered locally or both delivered systemically), and
optionally at the same time.
[0018] The invention according to another aspect is a method of
preventing or treating asthma or allergy by administering a poly-G
nucleic acid, in an effective amount for treating or preventing
asthma or allergy. In some embodiments the poly-G nucleic acid is
administered alone and in other embodiments the poly-G nucleic acid
is administered in conjunction with an asthma/allergy medicament.
The poly-G nucleic acid in preferred embodiments comprises one of
the following formulas: 5' X.sub.1X.sub.2GGGX.sub.3X.sub.43',
wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides, 5'
GGGNGGG 3' or 5' GGGNGGGNGGG 3', wherein N represents between 0 and
20 nucleotides. In some embodiments at least one of X.sub.3 and
X.sub.4 are a G and in other embodiments both of X.sub.3 and
X.sub.4 are a G. Accordingly, in some embodiments, the poly-G
nucleic acid may comprise a sequence of 5'
X.sub.1X.sub.2GGGGX.sub.43'. In still other embodiments, the poly-G
nucleic acid is one which is rich in G (e.g., six out of seven
bases are G, or six out of eight bases are G).
[0019] The poly-G may be free of unmethylated CG dinucleotides, or
may include at least one unmethylated CG dinucleotide.
[0020] The poly G nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276,
282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733,
768, 795, 796, 914-925, 928-931, 933-936, and 938. In other
embodiments the poly G nucleic acid includes a sequence selected
from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148,
173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475,
519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662,
725, 767, 825, is 856, 857, 876, 892, 909, 926, 927, 932, and
937.
[0021] The invention provides, in yet another aspect, a method for
treating or preventing asthma or allergy in a hypo-responsive
subject. The method involves administering to a hypo-responsive
subject having asthma or allergy or at risk of developing asthma or
allergy an immunostimulatory nucleic acid. In one embodiment, the
method further comprises administering to the hypo-responsive
subject an asthma/allergy medicament. If the asthma/allergy
medicament is not administered to the hypo-responsive subject, then
the immunostimulatory nucleic acid is administered in an amount to
treat or prevent the asthma or allergy. If the asthma/allergy
medicament is administered to the hypo-responsive subject, then the
immunostimulatory nucleic acid and the asthma/allergy medicament
are administered in an effective amount to treat or prevent the
asthma or allergy. In this latter instance, the amount of the
immunostimulatory nucleic acid and the amount of the asthma/allergy
medicament may be insufficient (i.e., ineffective) in treating or
preventing the asthma or allergy if administered alone. In other
words, in some embodiments, the immunostimulatory nucleic acid may
be administered to the hypo-responsive subject in a sub-therapeutic
amount. Similarly, the asthma/allergy medicament may also be
administered in a sub-therapeutic amount. However, the combination
of the immunostimulatory nucleic acid and the asthma/allergy
medicament allows for lower doses of one or both in order to treat
or prevent the asthma or allergy. The immunostimulatory nucleic
acid may be administered concurrently with the asthma/allergy
medicament, but need not be.
[0022] The hypo-responsive subject may be one who is
hypo-responsive to an asthma/allergy medicament. In one embodiment,
the hypo-responsive subject is selected from the group consisting
of a subject who is refractory to an asthma/allergy medicament, a
subject who is a non-responder to an asthma/allergy medicament, an
elderly subject and a neonatal subject.
[0023] According to yet another aspect of the invention, a method
is provided for preventing asthma or allergy in a subject at risk
of developing asthma or allergy which involves administering to a
subject at risk of developing asthma or allergy an effective amount
of an immunostimulatory nucleic acid substantially prior to an
asthmatic or an allergic event.
[0024] In one embodiment, the immunostimulatory nucleic acid is
administered at least three months, at least two months, at least
one month, or at least 20 days prior to the asthmatic or allergic
event. In another embodiment, the immunostimulatory nucleic acid is
administered at least two weeks prior to the asthmatic or allergic
event. In yet another embodiment, the immunostimulatory nucleic
acid is administered at least 10 days, at least 5 days or at least
2 days prior to the asthmatic or allergic event.
[0025] In one embodiment, the asthmatic or allergic event is
selected from the group consisting of an asthma attack, seasonal
allergic rhinitis, and perennial allergic rhinitis.
[0026] In one embodiment, the immunostimulatory nucleic acid is
administered in a routine schedule. In a related embodiment, the
routine schedule is selected from the group consisting of a daily
routine, a weekly routine, a bi-weekly routine, a monthly routine,
and a bi-monthly routine.
[0027] In a further aspect, the invention provides another method
for decreasing a dose of an asthma/allergy medicament. The method
involves administering to a subject at risk of developing asthma or
allergy, substantially prior to an asthmatic or allergic event, an
immunostimulatory nucleic acid in an amount to decrease an
effective amount of an asthma/allergy medicament subsequently
administered to the subject in order to treat the asthma or
allergy.
[0028] In one embodiment, the immunostimulatory nucleic acid is
administered at least three months, at least two months, at least
one month or at least 20 days prior to the asthmatic or allergic
event. In another embodiment, the immunostimulatory nucleic acid is
administered at least two weeks, at least 10 days, at least one
week, at least 5 days or at least 2 days prior to the asthmatic or
allergic event.
[0029] In one embodiment, the asthmatic or allergic event is
selected from the group consisting of an asthma attack, seasonal
allergic rhinitis, and perennial allergic rhinitis.
[0030] In one embodiment, the immunostimulatory nucleic acid is
administered in a routine schedule. The routine schedule may be
selected from the group consisting of a daily routine, a weekly
routine, a bi-weekly routine, a monthly routine, and a bimonthly
routine.
[0031] The method may further comprise administering to the subject
the asthma/allergy medicament subsequent to the administration of
the immunostimulatory nucleic acid. In one embodiment, the
asthma/allergy medicament is administered immediately prior to,
concurrently with, or following the asthmatic or allergic event.
The method may further comprise administering the immunostimulatory
nucleic acid concurrently with or following the asthmatic or
allergic event. In one embodiment, the immunostimulatory nucleic
acid is administered concurrently with the asthma/allergy
medicament. In one embodiment, the asthma/allergy medicament is
administered in a sub-therapeutic dose.
[0032] In these and other aspects of the invention, the
immunostimulatory nucleic acids have a number of attributes. The
immunostimulatory nucleic acids may have a modified backbone. In
some embodiments, the modified backbone is a phosphate modified
backbone, and in related embodiments, the phosphate modified
backbone is a phosphorothioate backbone. In certain embodiments,
the immunostimulatory nucleic acid is a CpG nucleic acid, in other
embodiments, the immunostimulatory nucleic acid is a T-rich nucleic
acid, while in still other embodiments, the immunostimulatory
nucleic acid is a poly-G nucleic acid. Preferably, the T-rich and
poly-G nucleic acids are also CpG nucleic acids. In still other
embodiments, the immunostimulatory nucleic acid comprises a poly-G
motif (e.g., 5' GGGG 3') and a palindrome. Preferably, the
immunostimulatory nucleic acid comprises two poly-G motifs, one 5'
and one 3' to a centrally located palindrome sequence. Even more
preferably, the backbone of these latter immunostimulatory nucleic
acids is chimeric (i.e., it is partially, but riot completely,
composed of phosphorothioate linkages). In some embodiments, a
plurality of immunostimulatory nucleic acids is administered,
wherein the plurality comprises CpG nucleic acids and T-rich
nucleic acids, or CpG nucleic acids and poly-G nucleic acids, or
T-rich nucleic acids and poly-G nucleic acids.
[0033] In these and other aspects of the invention, the
asthma/allergy medicaments have a number of attributes. In some
embodiments, the asthma/allergy medicament is an asthma medicament,
while in still other embodiments, the asthma/allergy medicament is
an allergy medicament.
[0034] In some embodiments, the asthma/allergy medicament is
selected from the group consisting of a steroid and an
immunomodulator. In certain embodiments, the steroid may be
selected from the group consisting of beclomethasone, fluticasone,
tramcinolone, budesonide, and budesonide. In certain embodiments,
the immunomodulator may be selected from the group consisting of an
anti-inflammatory agent, a leukotriene antagonist, an IL-4 mutein,
a soluble IL-4 receptor, an immunosuppressant, anti-IL-4 antibody,
an IL-4 antagonist, an anti-IL-5 antibody, a soluble IL-13
receptor-Fc fusion protein, an anti-IL-9 antibody, a CCR3
antagonist, a CCR5 antagonist, a VLA-4 inhibitor, and a
downregulator of IgE. The downregulator of IgE may be an anti-Ig
antibody or a fragment thereof, but need not be so limited. The
immunosuppressant may be a tolerizing peptide vaccine, but need not
be so limited.
[0035] In some embodiments, the asthma/allergy medicament is a
medicament selected from the group consisting of a PDE-4 inhibitor,
a bronchodilator/beta-2 agonist, a K+ channel opener, a VLA-4
antagonist, a neurokin antagonist, a TXA2 synthesis inhibitor,
Xanthanine, an arachidonic acid antagonist, a 5 lipoxygenase
inhibitor, a thromboxin A2 receptor antagonist, a thromboxane A2
antagonist, an inhibitor of 5-lipox activation-protein, and a
protease inhibitor. In certain embodiments, the
bronchodilator/beta-2 agonist may be selected from the group
consisting of salmeterol, salbutamol, terbutaline,
D2522/formoterol, fenoterol and orciprenaline.
[0036] In some embodiments, the asthma/allergy medicament is a
medicament selected from the group consisting of an anti-histamine
and a prostaglandin inducer. In certain embodiments, the
anti-histamine is selected from the group consisting of loratidine,
cetirizine, buclizine, ceterizine analogues, fexofenadine,
terfenadine, desloratadine, norastemizole, epinastine, ebastine,
ebastine, astemizole, levocabastine, azelastine, tranilast,
terfenadine, mizolastine, betatastine, CS 560 and HSR 609. The
prostaglandin inducer may-be S-5751, but is not so limited.
[0037] In still other embodiments, the asthma/allergy medicament is
a prostaglandin inhibitor in the form of a cyclooxygenase-2 (COX-2)
inhibitor. The COX-2 inhibitor may be selected from the group
consisting of celecoxib, rofecoxib, NS-398, 1-745,337, meloxicam,
nimesulide, SC236, and C-phycocyanin.
[0038] A composition comprising a poly-G nucleic acid in an aerosol
formulation is provided according to other aspects of the
invention.
[0039] A kit is provided according to another aspect of the
invention. The kit in one aspect includes a sustained-release
vehicle containing an immunostimulatory nucleic acid and at least
one container housing an asthma/allergy medicament, and
instructions for timing of administration of the immunostimulatory
nucleic acid and the asthma/allergy medicament. In another aspect,
the kit includes containers for multiple administrations of
immunostimulatory nucleic acid and/or multiple administrations of
immunostimulatory nucleic acid and at least one container housing
an asthma/allergy medicament.
[0040] A composition is provided according to another aspect of the
invention. The composition includes an immunostimulatory nucleic
acid and an asthma/allergy medicament, formulated in a
pharmaceutically-acceptable carrier and in an effective amount for
preventing or treating an immune response associated with exposure
to a mediator of asthma or allergy.
[0041] Formulations of poly-G nucleic acids are also encompassed by
the invention. For instance the invention includes a pharmaceutical
composition of a poly-G nucleic acid in an aerosol formulation.
[0042] The immunostimulatory nucleic acid may be any of the
immunostimulatory nucleic acids described above, and may have any
of the attributes of the immunostimulatory nucleic acids described
above which are useful in other aspects of the invention.
[0043] The asthma/allergy medicament may be any of the asthma
medicaments-or allergy medicaments described above which are useful
in other aspects of the invention.
[0044] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The invention relates to methods and products for the
treatment of asthma/allergy using a combination of
immunostimulatory nucleic acids and asthma/allergy medicaments. The
compositions can be administered in higher doses without as many
side effects as are ordinarily achieved at those dosage levels or
in lower doses with higher efficacy than is ordinarily achieved
with those doses. The compositions can also be administered
on-fixed schedules or in different temporal relationships to one
another. The various combinations have many advantages over the
prior art methods of treating asthma and allergy.
[0046] One method for treating or preventing asthma or allergy
includes the step of administering a synergistic combination of an
immunostimulatory nucleic acid and an asthma/allergy medicament in
an effective amount to treat or prevent the asthma or allergy.
[0047] An "immunostimulatory nucleic acid" as used herein is any
nucleic acid containing an immunostimulatory motif or backbone that
induces a Th1 immune response and/or suppresses a Th2 immune
response. Immunostimulatory motifs include, but are not limited to,
CpG motifs, poly-G motifs, and T-rich motifs. Immunostimulatory
backbones include, but are not limited to, phosphate modified
backbones, such as phosphorothioate backbones. Immunostimulatory
nucleic acids have been described extensively in the prior art and
a brief summary of these nucleic acids is presented below.
[0048] The immunostimulatory nucleic acids when combined with the
asthma/allergy medicaments have many advantages over each
composition alone for the treatment of asthma so and allergy. The
immunostimulatory nucleic acid functions in some aspects by
simultaneously suppressing Th2-type immune responses (IL-4, IgE
production, histamine release) that can result in airway
inflammation and bronchial spasm, and/or inducing Th1-type immune
responses (IFN-.gamma. and IL-12 production) that promote harmless
antibody and cellular responses. This creates an environment inside
the body that safely and effectively prevents hypersensitive
reactions from occurring, thereby eliminating symptoms.
[0049] The immunostimulatory nucleic acids eliminate/reduce
bronchial hyperreactivity, bronchoconstriction, bronchial
obstruction, airway inflammation and atopy (which improves asthma
control, normalizes lung function, prevents irreversible airway
injury); and may also inhibit acute response to exercise, cold dry
air, and SO.sub.2. The nucleic acids provide long-lasting effects,
thus reducing dosing regimes, improving compliance and maintenance
therapy, reducing emergency situations; and improving quality of
life. These compounds are also useful because they provide early
anti-infective activity, which leads to decreasing infectious
episodes, which further reduces hyperreactive immune responses.
This is especially true in subjects like children or
immuno-compromised subjects. Furthermore, use of the
immunostimulatory nucleic acids reduces/eliminates use of inhalers,
which can exacerbate hypersensitive reactions by providing simpler
and safer delivery and by allowing less drugs to be used.
[0050] Immunostimulatory nucleic acids stimulate the immune system
to prevent or treat allergy and/or asthma. The strong yet balanced,
cellular and humoral immune-responses that result from the nucleic
acid's stimulation reflect the body's own natural defense system
against invading allergens and initiators.
[0051] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acids include
vectors, e.g., plasmids as well as oligonucleotides. Nucleic acid
molecules can be obtained from existing nucleic acid sources (e.g.
genomic or cDNA), but are preferably synthetic (e.g. produced by
oligonucleotide synthesis).
[0052] Exemplary immunostimulatory nucleic acids as those described
herein as well as various control nucleic acids include but are-not
limited to those presented in Table 1.
1TABLE 1 SEQ ID NO: ODN SEQUENCE BACKBONE 1 tctcccagcgtgcgccat s 2
ataatccagcttgaaccaag s 3 ataatcgacgttcaagcaag s 4
taccgcgtgcgaccctct s 5 ggggagggt s 6 ggggagggg s 7 ggtgaggtg s 8
tccatgtzgttcctgatgct o 9 gctaccttagzgtga o 10 tccatgazgttcctgatgct
o 11 tccatgacgttcztgatgct o 12 gctagazgttagtgt o 13
agctccatggtgctcactg s 14 ccacgtcgaccctcaggcga s 15
gcacatcgtcccgcagccga s 16 gtcactcgtggtacctcga s 17
gttggatacaggccagactttgttg o 18 gattcaacttgcgatcatcttaggc o 19
accatggacgaactgtttcccctc s 20 accatggacgagctgtttcccctc s 21
accatggacgacctgtttcccctc s 22 accatggacgtactgtttcccctc s 23
accatggacggtctgtttcccctc s 24 accatggacgttctgtttcccctc s 25
ccactaacatctgctgctccacaag o 26 acttctcatagtccctttggtccag o 27
tccatgagcttcctgagtct o 28 gaggaaggigiggaigacgt o 29
gtgaaticgttcicgggict o 30 aaaaaa s 31 cccccc s 32 ctgtca s 33
tcgtag s 34 tcgtgg s 35 cgtcgt s 36 tccatgtcggtcctgagtct sos 37
tccatgccggtcctgagtct sos 38 tccatgacggtcctgagtct sos 39
tccatgacggtcctgagtct sos 40 tccatgtcgatcctgagtct sos 41
tccatgtcgctcctgagtct sos 42 tccatgtcgttcctgagtct sos 43
tccatgacgttcctgagtct sos 44 tccataacgttcctgagtct sos 45
tccatgacgtccctgagtct sos 46 tccatcacgtgcctgagtct sos 47
tccatgctggtcctgagtct sos 48 tccatgtzggtcctgagtct sos 49
ccgcttcctccagatgagctcatgggttt- ctccaccaag o 50
cttggtggagaaacccatgagctcatctggaggaagcgg o 51 ccccaaagggatgagaagtt o
52 agatagcaaatcggctgacg o 53 ggttcacgtgctcatggctg o 54
tctcccagcgtgcgccat s 55 tctcccagcgtgcgccat s 56 taccgcgtgcgaccctct
s 57 ataatccagcttgaaacaag s 58 ataatcgacgttcaagcaag s 59
tccatgattttcctgatttt o 60 ttgtttttttgtttttttgttttt s 61
ttttttttgtttttttgttttt o 62 tgctgcttttgtgcttttgtgctt s 63
tgctgcttgtgcttttgtgctt o 64 gcattcatcaggcgggcaagaat o 65
taccgagcttcgacgagatttca o 66 gcatgacgttgagct s 67 cacgttgaggggcat s
68 ctgctgagactggag s 69 tccatgacgttcctgacgtt s 70 gcatgagcttgagctga
o 71 tcagcgtgcgcc s 72 atgacgttcctgacgtt s 73 ttttggggttttggggtttt
s 74 tctaggctttttaggcttcc s 75 tgcattttttaggccaccat s 76
tctcccagcgtgcgtgcgccat s 77 tctcccagcgggcgcat s 78
tctcccagcgagcgccat s 79 tctcccagcgcgcgccat s 80 ggggtgacgttcagggggg
sos 81 ggggtcaagcgtgcgccatggggg sos 82 ggggtgtcgttcagggggg sos 83
tccatgtcgttcctgtcgtt s 84 tccatagcgttcctagcgtt s 85
tcgtcgctgtctccgcttctt s 86 gcatgacgttgagct sos 87
tctcccagcgtgcgccatat sos 88 tccatgazgttcctgazgtt s 89
gcatgazgttgagct o 90 tccagcgtgcgccata sos 91 tctcccagcgtgcgccat o
92 tccatgagcttcctgagtct o 93 gcatgtcgttgagct sos 94
tcctgacgttcctgacgtt s 95 gcatgatgttgagct o 96 gcatttcgaggagct o 97
gcatgtagctgagct o 98 tccaggacgttcctagttct o 99 tccaggagcttcctagttct
o 100 tccaggatgttcctagttct o 101 tccagtctaggcctagttct o 102
tccagttcgagcctagttct o 103 gcatggcgttgagct sos 104 gcatagcgttgagct
sos 105 gcattgcgttgagct sos 106 gcttgcgttgcgttt sos 107
tctcccagcgttgcgccatat sos 108 tctcccagcgtgagttatat sos 109
tctccctgcgtgcgccatat sos 110 tctgcgtgcgtgcgccatat 505 111
tctcctagcgtgcgccatat sos 112 tctcccagcgtgcgcctttt sos 113
gctandcghhagc o 114 tcctgacgttccc o 115 ggaagacgttaga o 116
tcctgacgttaga o 117 tcagaccagctggtcgggtgttcctga o 118
tcaggaacacccgaccagctggt- ctga o 119 gctagtcgatagc o 120
gctagtcgctagc o 121 gcttgacgtctagc o 122 gcttgacgtttagc o 123
gcttgacgtcaagc o 124 gctagacgtttagc o 125 tccatgacattcctgatgct o
126 gctagacgtctagc o 127 ggctatgtcgttcctagcc o 128
ggctatgtcgatcctagcc o 129 ctcatgggtttctccaccaag o 130
cttggtggagaaacccatgag o 131 tccatgacgttcatagttct o 132
ccgcttcctccagatgagctcatg o 133 catgagctcatctggaggaagcgg o 134
ccagatgagctcatgggtttctcc o 135 ggagaaacccatgagctcatctgg o 136
agcatcaggaacgacatgga o 137 tccatgacgttcctgacgtt rna 138
gcgcgcgcgcgcgcgcgcg o 139 ccggccggccggccggccgg o 140
ttccaatcagccccacccgctctggccccaccctcaccctcca o 141
tggagggtgagggtggggccagagcgggtggggctgattggaa o 142
tcaaatgtgggattttcccatgagtct o 143 agactcatgggaaaatcccacat- ttga o
144 tgccaagtgctgagtcactaataaaga o 145 tctttattagtgactcagcacttggca o
146 tgcaggaagtccgggttttccccaacccccc o 147
ggggggttggggaaaacccggacttcctgca o 148
ggggactttccgctggggactttccagggggactttcc sos 149
tccatgacgttcctctccatgacgttcctctccatgacgttaatc o 150
gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga o 151
ataatagagcttcaagcaag s 152 tccatgacgttcctgacgtt s 153
tccatgacgttcctgacgtt sos 154 tccaggactttcctcaggtt s 155
tcttgcgatgctaaaggacgtcacattgca- caatcttaataaggt o 156
accttattaagattgtgcaatgtgacgtcctttagc- atcgcaaga o 157
tcctgacgttcctggcggtcctgtcgct o 158 tcctgtcgctcctgtcgct o 159
tcctgacgttgaagt o 160 tcctgtcgttgaagt o 161 tcctggcgttgaagt o 162
tcctgccgttgaagt o 163 tccttacgttgaagt o 164 tcctaacgttgaagt o 165
tcctcacgttgaagt o 166 tcctgacgatgaagt o 167 tcctgacgctgaagt o 168
tcctgacggtgaagt o 169 tcctgacgtagaagt o 170 tcctgacgtcgaagt o 171
tcctgacgtggaagt o 172 tcctgagcttgaagt o 173 gggggacgttggggg o 174
tcctgacgttccttc o 175 tctcccagcgagcgagcgccat s 176
tcctgacgttcccctggcggtcccctgtcgct o 177 tcctgtcgctcctgtcgctcctgtcgct
o 178 tcctggcggggaagt o 179 tcatgazgttgaagt o 180 tcztgacgttgaagt o
181 tcctagcgttgaagt o 182 tccagacgttgaagt o 183 tcctgacggggaagt o
184 tcctggcggtgaagt o 185 ggctccggggagggaatttttgtctat o 186
atagacaaaaattccatccccggagcc o 187 tccatgagcttccttgagtct rna 188
tcgtcgctgtctccgcttctt so 189 tcgtcgctgtctccgcttctt s20 190
tcgagacattgcacaatcatctg o 191 cagattgtgcaatgtctcga o 192
tccatgtcgttcctgatgcg o 193 gcgatgtcgttcctgatgct o 194
gcgatgtcgttcctgatgcg o 195 tccatgtcgttccgcgcgcg o 196
tccatgtcgttcctgccgct o 197 tccatgtcgttcctgtagct o 198
gcggcgggcggcgcgcgccc o 199 atcaggaacgtcatgggaagc o 200
tccatgagcttcctgagtct p-ethoxy 201 tcaacgtt p-ethoxy 202 tcaagctt
p-ethoxy 203 tcctgtcgttcctgtcgtt s 204 tccatgtcgtttttgtcgtt s 205
tcctgtcgttccttgtcgtt s 206 tccttgtcgttcctgtcgtt s 207
btccattccatgacgttcctgatgcttcca os 208 tcctgtcgttttttgtcgtt s 209
tcgtcgctgtctccgcttctt s 210 tcgtcgctgtctgcccttctt s 211
tcgtcgctgttgtcgtttctt s 212 tcctgtcgttcctgtcgttggaacgacagg o 213
tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 214
ggggtctgtcgttttgggggg sos 215 ggggtctgtgcttttgggggg sos 216
tccggccgttgaagt o 217 tccggacggtgaagt o 218 tcccgccgttgaagt o 219
tccagaaggtgaagt o 220 tcccgacggtgaagt o 221 tccagagcttgaagt o 222
tccatgtzgttcctgtzgtt s 223 tccatgacgttcctgacgtt sos 224
ggggttgacgttttgggggg sos 225 tccaggacttctctcaggtt s 226
tttttttttttttttttttt s 227 tccatgccgttcctgccgtt s 228
tccatggcgggcctggcggg s 229 tccatgacgttcctgccgtt s 230
tccatgacgttcctggcggg s 231 tccatgacgttcctgcgttt s 232
tccatgacggtcctgacggt s 233 tccatgcgtgcgtgcgtttt s 234
tccatgcgttgcgttgcgtt s 235 btccattccattctaggcctgagtcttccat os 236
tccatagcgttcctagcgtt o 237 tccatgtcgttcctgtcgtt o 238
tccatagcgatcctagcgat o 239 tccattgcgttccttgcgtt o 240
tccatagcggtcctagcggt o 241 tccatgattttcctgcagttcctgatttt 242
tccatgacgttcctgcagttcctgacgtt s 243 ggcggcggcggcggcggcgg o 244
tccacgacgttttcgacgtt s 245 tcgtcgttgtcgttgtcgtt s 246
tcgtcgttttgtcgttttgtcgtt s 247 tcgtcgttgtcgttttgtcgtt s 248
gcgtgcgttgtcgttgtcgtt s 249 czggczggczgggczccgg o 250
gcggcgggcggcgcgcgccc s 251 agicccgigaacgiattcac o 252
tgtcgtttgtcgtttgtcgtt s 253 tgtcgttgtcgttgtcgttgtcgtt s 254
tgtcgttgtcgttgtcgttgtcgtt s 255 tcgtcgtcgtcgtt s 256 tgtcgttgtcgtt
s 257 cccccccccccccccccccc s 258 tctagcgtttttagcgttcc sos 259
tgcatcccccaggccaccat s 260 tcgtcgtcgtcgtcgtcgtcgtt sos 261
tcgtcgttgtcgttgtcgtt sos 262 tcgtcgttttgtcgttttgtcgtt sos 263
tcgtcgttgtcgttttgtcgtt sos 264
ggggagggaggaacttcttaaaattcccccagaatgttt o 265
aaacattctgggggaattttaagaagttcctccctcccc o 266
atgtttacttcttaaaattcccccagaatgttt o 267
aaacattctgggggaattttaagaagtaaacat o 268
atgtttactagacaaaattcccccagaatgttt o 269
aaacattctgggggaattttgtctagtaaacat o 270 aaaattgacgttttaaaaaa sos
271 ccccttgacgttttcccccc sos 272 ttttcgttgtttttgtcgtt 273
tcgtcgttttgtcgttttgtcgtt sos 274 ctgcagcctgggac o 275
acccgtcgtaattatagtaaaaccc o 276 ggtacctgtggggacattgtg o 277
agcaccgaacgtgagagg o 278 tccatgccgttcctgccgtt o 279
tccatgacggtcctgacggt o 280 tccatgccggtcctgccggt o 281
tccatgcgcgtcctgcgcgt o 282 ctggtctttctggtttttttctgg s 283
tcaggggtggggggaacctt sos 284 tacatgazgttcctagttct o 285
tccatgatgttcctagttct o 286 cccgaagtcatttcctcttaacctgg o 287
ccaggttaagaggaaatgacttcggg o 288 tcctggzggggaagt o 289
gzggzgggzggzgzgzgccc x 290 tccatgtgcttcctgatgct o 291
tccatgtccttcctgatgct 292 tccatgtcgttcctagttct 293
tccaagtagttcctagttct o 294 tccatgtagttcctagttct o 295
tcccgcgcgttccgcgcgtt s 296 tcctggcggtcctggcggtt s 297
tcctggaggggaagt o 298 tcctgggggggaagt o 299 tcctggtggggaagt o 300
tcgtcgttttgtcgttttgtcgtt o 301 ctggtctttctggtttttttctgg o 302
tccatgacgttcctgacgtt o 303 tccaggacttctctcaggtt sos 304
tzgtzgttttgtzgttttgtzgtt o 305 btcgtcgttttgtcgttttgtcgttt- tttt os
306 gctatgacgttccaaggg s 307 tcaacgtt s 308 tccaggactttcctcaggtt o
309 ctctctgtaggcccgcttgg s 310 ctttccgttggacccctggg s 311
gtccgggccaggccaaagtc s 312 gtgcgcgcgagcccgaaatc s 313
tccatgaigttcctgaigtt s 314 aatagtcgccataacaaaac o 315
aatagtcgccatggcggggc o 316 btttttccatgtcgttcctgatgcttttt os 317
tcctgtcgttgaagtttttt o 318 gctagctttagagctttagagctt o 319
tgctgcttcccccccccccc o 320 tcgacgttcccccccccccc o 321
tcgtcgttcccccccccccc o 322 tcgtcgttcccccccccccc o 323
tcgccgttcccccccccccc o 324 tcgtcgatcccccccccccc o 325
tcctgacgttgaagt s 326 tcctgccgttgaagt s 327 tcctgacggtgaagt s 328
tcctgagcttgaagt s 329 tcctggcggggaagt s 330 aaaatctgtgcttttaaaaaa
sos 331 gatccagtcacagtgacctggcagaatctggat o 332
gatccagattctgccaggtcactgtgactggat o 333
gatccagtcacagtgactcagcagaatctggat o 334
gatccagattctgctgagtcactgtgactggat o 335 tcgtcgttccccccczcccc o 336
tzgtggttccccccaccccc o 337 tzgtcgttcccccccccccc o 338
tcgtzgttcccccacccccc o 339 tcgtcgctccaccccccccc o 340
tcgtcggtcccccccccccc o 341 tcggcgttcccccccccccc o 342
ggccttttcccccccccccc o 343 tcgtcgttttgacgttttgtcgtt s 344
tcgtcgttttgacgttttgacgtt s 345 ccgtcgttcccccccccccc o 346
gcgtcgttcccccccccccc o 347 tcgtcattcccccccccccc o 348
acgtcgttcccccccccccc o 349 ctgtcgttcccccccccccc o 350
btttttcgtcgttcccccccccccc os 351 tcgtcgttccccccccccccb o 352
tcgtcgttttgtcgttttgtcgttb o 353 tccagttccttcctcagtct o 354
tzgtcgttttgtcgttttgtcgtt o 355 tcctggaggggaagt s 356
tcctgaaaaggaagt s 357 tcgtcgttccccccccc s 358
tzgtzgttttgtzgttttgtzgtt s 359 ggggtcaagcttgagggggg sos 360
tgctgcttcccccccccccc s 361 tcgtcgtcgtcgtt s2 362 tcgtcgtcgtagtt s20
363 tcgtcgtcgtcgtt os2 364 tcaacgttga s 365 tcaacgtt s 366
atagttttccatttttttac 367 aatagtcgccatcgcgcgac o 368
aatagtcgccatcccgggac o 369 aatagtcgccatcccccccc o 370
tgctgcttttgtgcttttgtgctt o 371 ctgtgctttctgtgtttttctgtg s 372
ctaatctttctaatttttttctaa s 373 tcgtcgttggtgtcgttggtgtcgtt s 374
tcgtcgttggttgtcgttttggtt s 375 accatggacgagctgtttcccctc 376
tcgtcgttttgcgtgcgttt s 377 ctgtaagtgagcttggagag 378
gagaacgctggaccttcc 379 cgggcgactcagtctatcgg 380
gttctcagataaagcggaaccagcaacagacacagaa 381
ttctgtgtctgttgctggttccgctttatctgagaac 382 cagacacagaagcccgatagacg
383 agacagacacgaaacgaccg 384 gtctgtcccatgatctcgaa 385
gctggccagcttacctcccg 386 ggggcctctatacaacctggg 387
ggggtccctgagactgcc 388 gagaacgctggaccttccat 389
tccatgtcggtcctgatgct 390 ctcttgcgacctggaaggta
391 aggtacagccaggactacga 392 accatggacgacctgtttcccctc 393
accatggattacctttttcccctt 394 atggaaggtccagcgttctc o 395
agcatcaggaccgacatgga o 396 ctctccaagctcacttacag 397
tccctgagactgccccacctt 398 gccaccaaaacttgtccatg 399
gtccatggcgtgcgggatga 400 cctctatacaacctgggac 401
cgggcgactcagtctatcgg 402 gcgctaccggtagcctgagt 403
cgactgccgaacaggatatcggtga- tcagcactgg 404
ccagtgctgatcaccgatatcctgttcggcagtcg 405 ccaggttgtatagaggc 406
tctcccagcgtacgccat s 407 tctcccagcgtgcgtttt s 408
tctcccgacgtgcgccat s 409 tctcccgtcgtgcgccat s 410
ataatcgtcgttcaagcaag s 411 tcgtcgttttgtcgttttgtcgt s2 412
tcgtcgttttgtcgttttgtcgtt s2 413 tcgtcgttttgtcgttttgtcgtt s2 414
tcntcgtnttntcgtnttntcgtn s 415 tctcccagcgtcgccat s 416
tctcccatcgtcgccat s 417 ataatcgtgcgttcaagaaag s 418
ataatcgacgttcccccccc s 419 tctatcgacgttcaagcaag s 420 tcc tga cgg
gg agt s 421 tccatgacgttcctgatcc 422 tccatgacgttcctgatcc 423
tccatgacgttcctgatcc 424 tcc tgg cgt gga agt s 425
tccatgacgttcctgatcc 426 tcgtcgctgttgtcgtttctt s 427
agcagctttagagctttagagctt s 428 cccccccccccccccccccccccc s 429
tcgtcgttttgtcgttttgtcgttttgtcgtt s 430 tcgtcgttttttgtcgttttttgtcgtt
s 431 tcgtcgtttttttttttttt s 432 tttttcaacgttgatttttt sos 433
tttttttttttttttttttttttt s 434 ggggtcgtcgttttgggggg 435
tcgtcgttttgtcgttttgggggg 436 tcgtcgctgtctccgcttcttcttgcc s 437
tcgtcgctgtctccg s 438 ctgtaagtgagcttggagag 439 gagaacgctggaccttccat
440 ccaggttgtatagaggc 441 gctagacgttagcgtga 442
ggagctcttcgaacgccata 443 tctccatgatggttttatcg 444
aaggtggggcagtctcaggga 445 atcggaggactggcgcgccg 446
ttaggacaaggtctagggtg 447 accacaacgagaggaacgca 448
ggcagtgcaggctcaccggg 449 gaaccttccatgctgtt 450 gctagacgttagcgtga
451 gcttggagggcctgtaagtg 452 gtagccttccta 453 cggtagccttccta 454
cacggtagccttccta 455 agcacggtagccttccta 456 gaacgctggaccttccat 457
gaccttccat 458 tggaccttccat 459 gctggaccttccat 460 acgctggaccttccat
461 taagctctgtcaacgccagg 462 gagaacgctggaccttccatgt 463
tccatgtcggtcctgatgct 464 ttcatgccttgcaaaatggcg 465
tgctagctgtgcctgtacct 466 agcatcaggaccgacatgga 467
gaccttccatgtcggtcctgat 468 acaaccacgagaacgggaac 469
gaaccttccatgctgttccg 470 caatcaatctgaggagaccc 471
tcagctctggtactttttca 472 tggttacggtctgtcccatg 473
gtctatcggaggactggcgc 474 cattttacgggcgggcgggc 475
gaggggaccattttacgggc 476 tgtccagccgaggggaccat 477
cgggcttacggcggatgctg 478 tggaccttctatgtcggtcc 479
tgtcccatgtttttagaagc 480 gtggttacggtcgtgcccat 481
cctccaaatgaaagaccccc 482 ttgtactctccatgatggtt 483
ttccatgctgttccggctgg 484 gaccttctatgtcggtcctg 485
gagaccgctcgaccttcgat 486 ttgccccatattttagaaac 487
ttgaaactgaggtgggac 488 ctatcggaggactggcgcgcc 489
cttggagggcctcccggcgg 490 gctgaaccttccatgctgtt 491
tagaaacagcattcttcttttagggcagcaca 492 agatggttctcagataaagcggaa 493
ttccgctttatctgagaaccatct 494 gtcccaggttgtatagaggctgc 495
gcgccagtcctccgatagac 496 atcggaggactggcgcgccg 497
ggtctgtcccatatttttag 498 tttttcaacgttgagggggg sos 499
tttttcaagcgttgatttttt sos 500 ggggtcaacgttgatttttt sos 501
ggggttttcaacgttttgagggggg sos 502 ggttacggtctgtcccatat 503
ctgtcccatatttttagaca 504 accatcctgaggccattcgg 505
cgtctatcgggcttctgtgtctg 506 ggccatcccacattgaaagtt 507
ccaaatatcggtggtcaagcac 508 gtgcttgaccaccgatatttgg 509
gtgctgatcaccgatatcctgttcgg 510 ggccaactttcaatgtgggatggcctc 511
ttccgccgaatggcctcaggatggtac 512 tatagtccctgagactgccccacct-
tctcaacaacc 513 gcagcctctatacaacctgggacggga 514
ctatcggaggactggcgcgccg 515 tatcggaggactggcgcgccg 516
gatcggaggactggcgcgccg 517 ccgaacaggatatcggtgatcagcac 518
ttttggggtcaacgttgagggggg 519 ggggtcaacgttgagggggg sos 520
cgcgcgcgcgcgcgcgcgcg s 521 ggggcatgacgttcgggggg ss 522
ggggcatgacgttcaaaaaa s 523 ggggcatgagcttcgggggg s 524
ggggcatgacgttcgggggg sos 525 aaaacatgacgttcaaaaaa sos 526
aaaacatgacgttcgggggg sos 527 ggggcatgacgttcaaaaaa sos 528
accatggacgatctgtttcccctc s 529 gccatggacgaactgttccccctc s 530
cccccccccccccccccccc sos 531 gggggggggggggggggggg sos 532
gctgtaaaatgaatcggccg sos 533 ttcgggcggactcctccatt sos 534
tatgccgcgcccggacttat sos 535 ggggtaatcgatcagggggg sos 536
tttgagaacgctggaccttc sos 537 gatcgctgatctaatgctcg sos 538
gtcggtcctgatgctgttcc sos 539 tcgtcgtcagttcgctgtcg sos 540
ctggaccttccatgtcgg sos 541 gctcgttcagcgcgtct sos 542
ctggaccttccatgtc sos 543 cactgtccttcgtcga sos 544
cgctggaccttccatgtcgg sos 545 gctgagctcatgccgtctgc sos 546
aacgctggaccttccatgtc sos 547 tgcatgccgtacacagctct sos 548
ccttccatgtcggtcctgat sos 549 tactcttcggatcccttgcg Sos 550
ttccatgtcggtcctgat sos 551 ctgattgctctctcgtga sos 552
ggcgttattcctgactcgcc o 553 cctacgttgtatgcgcccagct o 554
ggggtaatcgatgagggggg o 555 ttcgggcggactcctccatt o 556
tttttttttttttttttttt o 557 gggggttttttttttggggg o 558
tttttggggggggggttttt o 559 ggggggggggggggggggt o 560
aaaaaaaaaaaaaaaaaaaa o 561 cccccaaaaaaaaaaccccc o 562
aaaaaccccccccccaaaaa o 563 tttgaattcaggactggtgaggttgag o 564
tttgaatcctcagcggtctccag- tggc o 565
aattctctatcggggcttctgtgtctgttgctggttccgctttat o 566
ctagataaagcggaaccagcaacagacacagaagccccgatagag o 567
ttttctagagaggtgcacaatgctctgg o 568 tttgaattccgtgtacagaagcgagaagc o
569 tttgcggccgctagacttaacctgagagata o 570
tttgggcccacgagagacagagacacttc o 571 tttgggcccgcttctcgcttctgtacacg o
572 gagaacgctggaccttccat s 573 tccatgtcggtcctgatgct s 574 ctgtcg s
575 tcgtga s 576 cgtcga s 577 agtgct s 578 ctgtcg o 579 agtgct o
580 cgtcga o 581 tcgtga o 582 gagaacgctccagcttcgat o 583
gctagacgtaagcgtga o 584 gagaacgctcgaccttccat o 585
gagaacgctggacctatccat o 586 gctagaggttagcgtga o 587
gagaacgctggacttccat o 588 tcacgctaacgtctagc o 589
bgctagacgttagcgtga o 590 atggaaggtcgagcgttctc o 591
gagaacgctggaccttcgat o 592 gagaacgatggaccttccat o 593
gagaacgctggatccat o 594 gagaacgctccagcactgat o 595
tccatgtcggtcctgctgat o 596 atgtcctcggtcctgatgct o 597
gagaacgctccaccttccat o 598 gagaacgctggaccttcgta o 599
batggaaggtccagcgttctc o 600 tcctga o 601 tcaacgtt o 602 aacgtt o
603 aacgttga o 604 tcacgctaacctctagc o 605 gagaacgctggaccttgcat o
606 gctggaccttccat o 607 gagaacgctggacctcatccat o 608
gagaacgctggacgctcatccat o 609 aacgttgaggggcat o 610 atgcccctcaacgtt
o 611 tcaacgttga o 612 gctggaccttccat o 613 caacgtt o 614
acaacgttga o 615 tcacgt o 616 tcaagctt o 617 tcgtca o 618 aggatatc
o 619 tagacgtc o 620 gacgtcat o 621 ccatcgat o 622 atcgatgt o 623
atgcatgt o 624 ccatgcat o 625 agcgctga o 626 tcagcgct o 627
ccttcgat o 628 gtgccggggtctccgggc s 629 gctgtggggcggctcctg s 630
btcaacgtt o 631 ftcaacgtt o 632 faacgttga o 633 tcaacgt s 634
aacgttg s 635 cgacga o 636 tcaacgtt o 637 tcgga o 638 agaacgtt o
639 tcatcgat o 640 taaacgtt s 641 ccaacgtt s 642 gctcga s 643
cgacgt s 644 cgtcgt s 645 acgtgt s 646 cgttcg s 647
gagcaagctggaccttccat s 648 cgcgta s 649 cgtacg s 650 tcaccggt s 651
caagagatgctaacaatgca s 652 acccatcaatagctctgtgc s 653 ccatcgat o
654 tcgacgtc o 655 ctagcgct o 656 taagcgct o 657 tcgcgaattcgcg o
658 atggaaggtccagcgttct o 659 actggacgttagcgtga o 660
cgcctggggctggtctgg o 661 gtgtcggggtctccgggc o 662
gtgccggggtctccgggc o 663 cgccgtcgcggcggttgg o 664
gaagttcacgttgaggggcat o 665 atctggtgagggcaagctatg s 666
gttgaaacccgagaacatcat s 667 gcaacgtt o 668 gtaacgtt o 669 cgaacgtt
o 670 gaaacgtt o 671 caaacgtt o 672 ctaacgtt o 673 ggaacgtt o 674
tgaacgtt o 675 acaacgtt o 676 ttaacgtt o 677 aaaacgtt o 678
ataacgtt o 679 aacgttct o 680 tccgatcg o 681 tccgtacg o 682
gctagacgctagcgtga o 683 gagaacgctggacctcatcatccat o 684
gagaacgctagaccttctat o 685 actagacgttagtgtga o 686
cacaccttggtcaatgtcacgt o 687 tctccatcctatggttttatcg o 688
cgctggaccttccat o 689 caccaccttggtcaatgtcacgt o 690
gctagacgttagctgga o 691 agtgcgattgcagatcg o 692
ttttcgttttgtggttttgtggtt 693 ttttcgtttgtcgttttgtcgtt 694
tttttgttttgtggttttgtggtt 695 accgcatggattctaggcca s 696
gctagacgttagcgt o 697 aacgctggaccttccat o 698 tcaazgtt o 699
ccttcgat o 700 actagacgttagtgtga s 701 gctagaggttagcgtga s 702
atggactctccagcgttctc o 703 atcgactctcgagcgttctc o 704 gctagacgttagc
o 705 gctagacgt o 706 agtgcgattcgagatcg o 707 tcagzgct o 708
ctgattgctctctcgtga o 709 tzaacgtt o 710 gagaazgctggaccttccat o 711
gctagacgttaggctga o 712 gctacttagcgtga o 713 gctaccttagcgtga o 714
atcgacttcgagcgttctc o 715 atgcactctgcagcgttctc o 716
agtgactctccagcgttctc o 717 gccagatgttagctgga o 718
atcgactcgagcgttctc o 719 atcgatcgagcgttctc o 720
bgagaacgctcgaccttcgat o 721 gctagacgttagctgga sos 722
atcgactctcgagcgttctc sos 723 tagacgttagcgtga o 724
cgactctcgagcgttctc o 725 ggggtcgaccttggagggggg sos 726
gctaacgttagcgtga o 727 cgtcgtcgt o 728 gagaacgctggaczttccat o 729
atcgacctacgtgcgttztc o 730 atzgacctacgtgcgttctc o 731
gctagazgttagagt o 732 atcgactctcgagzgttctc o 733
ggggtaatgcatcagggggg sos 734 ggctgtattcctgactgccc s 735
ccatgctaacctctaga o 736 gctagatgttagcgtga o 737 cgtaccttacggtga o
738 tccatgctggtcctgatgct o 739 atcgactctctcgagcgttctc o 740
gctagagcttagcgtga o 741 atcgactctcgagtgttctc o 742
aacgctcgaccttcgat o 743 ctcaacgctggaccttccat o 744
atcgacctacgtgcgttctc o 745 gagaatgctggaccttccat o 746
tcacgctaacctctgac o 747 bgagaacgctccagcactgat o 748
bgagcaagctggaccttccat o 749 cgctagaggttagcgtga o 750
gctagatgttaacgt o 751 atggaaggtccacgttctc o 752 gctagatgttagcgt o
753 gctagacgttagtgt o 754 tccatgacggtcctgatgct o 755
tccatggcggtcctgatgct o 756 gctagacgatagcgt o 757 gctagtcgatagcgt o
758 tccatgacgttcctgatgct o 759 tccatgtcgttcctgatgct o 760
gctagacgttagzgt o 761 gctaggcgttagcgt o 762 tccatgtzggtcctgatgct o
763 tccatgtcggtzctgatgct o 764 atzgactctzgagzgttctc o 765
atggaaggtccagtgttctc o 766 gcatgacgttgagct o 767
ggggtcaacgttgagggggg s 768 ggggtcaagtctgagggggg sos 769
cgcgcgcgcgcgcgcgcgcg o 770 cccccccccccccccccccccccccccc s 771
ccccccccccccccccccccccccccccccccccc s 772 tccatgtcgctcctgatcct o
773 gctaaacgttagcgt o 774 tccatgtcgatcctgatgct o 775
tccatgccggtcctgatgct o 776 aaaatcaacgttgaaaaaaa sos 777
tccataacgttcctgatgct o 778 tggaggtcccaccgagatcggag o 779
cgtcgtcgtcgtcgtcgtcgt s 780 ctgctgctgctgctgctgctg s 781
gagaacgctccgaccttcgat s 782 gctagatgttagcgt s 783 gcatgacgttgagct s
784 tcaatgctgaf o 785 tcaacgttgaf o 786 tcaacgttgab o 787
gcaatattgcb o 788 gcaatattgcf o 789 agttgcaact o 790 tcttcgaa o 791
tcaacgtc o 792 ccatgtcggtcctgatgct o 793 gtttttatataatttggg o 794
tttttgtttgtcgttttgtcgtt o 795 ttggggggggtt s 796 ggggttgggggtt s
797 ggtggtgtaggttttgg o 798 bgagaazgctcgaccttcgat o 799
tcaacgttaacgttaacgtt o 800 bgagcaagztggaccttccat o 801
bgagaazgctccagcactgat o 802 tcaazgttgax o 803 gzaatattgcx o 804
tgctgcttttgtcgttttgtgctt o 805 ctgcgttagcaatttaactgtg o 806
tccatgacgttcctgatgct s 807 tgcatgccgtgcatccgtacacagctct s 808
tgcatgccgtacacagctct s 809 tgcatcagctct s 810 tgcgctct s 811
cccccccccccccccccccc s 812 cccccccccccc s 813 cccccccc s 814
tgcatcagctct sos 815 tgcatgccgtacacagctct o 816
gagcaagctggaccttccat s 817 tcaacgttaacgttaacgttaacgttaacg- tt s 818
gagaacgctcgaccttcgat s 819
gtccccatttcccagaggaggaaat o 820 ctagcggctgacgtcatcaagctag o 821
ctagcttgatgacgtcagccgctag o 822 cggctgacgtcatcaa s 823 ctgacgtg o
824 ctgacgtcat o 825 attcgatcggggcggggcgag o 826
ctcgccccgccccgatcgaat o 827 gactgacgtcagcgt o 828
ctagcggctgacgtcataaagctagc s 829 ctagctttatgacgtcagccgctagc s 830
ctagcggctgagctcataaagcta- gc s 831 ctagtggctgacgtcatcaagctag s 832
tccaccacgtggtctatgct s 833 gggaatgaaagattttattataag o 834
tctaaaaaccatctattattaaccct o 835 agctcaacgtcatgc o 836
ttaacggtggtagcggtattggtc o 837 ttaagaccaataccgctaccaccg o 838
gatctagtgatgagtcagccggatc o 839 gatccggctgactcatcactagatc o 840
tccaagacgttcctgatgct o 841 tccatgacgtccctgatgct o 842
tccaccacgtggctgatgct o 843 ccacgtggacctctagc o 844
tcagaccacgtggtcgggtgttcctga o 845 tcaggaacacccgaccacgtggt- ctga o
846 catttccacgatttccca o 847 ttcctctctgcaagagaat o 848
tgtatctctctgaaggact o 849 ataaagcgaaactagcagcagtttc o 850
gaaactgctgctagtttcgctttat o 851 tgcccaaagaggaaaatttgtttca- tacag o
852 ctgtatgaaacaaattttactctttgggca o 853 ttagggttagggttagggtt ss
854 tccatgagcttcctgatgct ss 855 aaaacatgacgttcaaaaaa ss 856
aaaacatgacgttcgggggg ss 857 ggggcatgagcttcgggggg sos 858
ctaggctgacgtcatcaagctagt o 859 tctgacgtcatctgacgttggctgacgtct o 860
ggaattagtaatagatatagaagtt o 861 tttaccttttataaacataactaaa- acaaa o
862 gcgtttttttttgcg s 863 atatctaatcaaaacattaacaaa o 864
tctatcccaggtggttcctgttag o 865 btccatgacgttcctgatgct o 866
btccatgagcttcctgatgct o 867 tttttttttttttf o 868 tttttttttttttf so
869 ctagcttgatgagctcagccgctag o 870 ttcagttgtcttggtgcttagctaa o 871
tccatgagcttcctgagtct s 872 ctagcggctgacgtcatcaatctag o 873
tgctagctgtgcctgtacct s 874 atgctaaaggacgtcacattgca o 875
tgcaatgtgacgtcctttagcat o 876 gtaggggactttccgagctcgagatcctatg o 877
cataggatctcgagctcggaaagtcccctac o 878 ctgtcaggaactgcaggtaagg o 879
cataacataggaatatttactcctcgc o 880 ctccagctccaagaaaggacg o 881
gaagtttctggtaagtcttcg o 882 tgctgcttttgtgcttttgtgctt s 883
tcgtcgttttgtggttttgtggtt s 884 tcgtcgtttgtcgttttgtcgtt s 885
tcctgacgttcggcgcgcgccc s 886 tgctgcttttgtgcttttgtgctt 887
tccatgagcttcctgagctt s 888 tcgtcgtttcgtcgttttgacgtt s 889
tcgtcgtttgcgtgcgtttcgtcgtt s 890 tcgcgtgcgttttgtcgttttgacgtt s 891
ttcgtcgttttgtcgttttgtcg- tt s 892 tcctgacggggaagt s 893
tcctggcgtggaagt s 894 tcctggcggtgaagt s 895 tcctggcgttgaagt s 896
tcctgacgtggaagt s 897 gcgacgttcggcgcgcgccc s 898
gcgacgggcggcgcgcgccc s 899 gcggcgtgcggcgcgcgccc s 900
gcggcggtcggcgcgcgccc s 901 gcgacggtcggcgcgcgccc s 902
gcggcgttcggcgcgcgccc s 903 gcgacgtgcggcgcgcgccc s 904
tcgtcgctgtctccg s 905 tgtgggggttttggttttgg s 906
aggggaggggaggggagggg s 907 tgtgtgtgtgtgtgtgtgtgt s 908
ctctctctctctctctctctct chimeric 909 ggggtcgacgtcgagggggg s 910
atatatatatatatatatatat s 911 ttttttttttttttttttttttttttt s 912
ttttttttttttttttttttt s 913 tttttttttttttttttt s 914
gctagaggggagggt 915 gctagatgttagggg 916 gcatgagggggagct 917
atggaaggtccagggggctc 918 atggactctggagggggctc 919
atggaaggtccaaggggctc 920 gagaaggggggaccttggat 921
gagaaggggggaccttccat 922 gagaaggggccagcactgat 923
tccatgtggggcctgatgct 924 tccatgaggggcctgatgct 925
tccatgtggggcctgctgat 926 atggactctccggggttctc 927
atggaaggtccggggttctc 928 atggactctggaggggtctc 929
atggaggctccatggggctc 930 atggactctggggggttctc 931
tccatgtgggtggggatgct 932 tccatgcgggtggggatgct 933
tccatgggggtcctgatgct 934 tccatggggtccctgatgct 935
tccatggggtgcctgatgct 936 tccatggggttcctgatgct 937
tccatcgggggcctgatgct 938 gctagagggagtgt 939 tttttttttttttttttt s
940 gmggtcaacgttgagggmggg s 941 ggggagttcgttgaggggggg s 942
tcgtcgtttccccccccccc s 943 ttggggggttttttttttttttttt s 944
tttaaattttaaaatttaaaata s 945 ttggtttttttggtttttttttgg s 946
tttcccttttccccttttcccctc s 947 ggggtcatcgatgagggggg s sos 948
tccatgacgttcctgacgtt 949 tccatgacgttcctgacgtt 950
tccatgacgttcctgacgtt 951 tccatgacgttcctgacgtt 952
tccatgacgttcctgacgtt 953 tccatgacgttcctgacgtt 954
tccatgacgttcctgacgtt 955 tccatgacgttcctgacgtt 956
tccatgacgttcctgacgtt 957 tccatgacgttcctgacgtt 958
tccatgacgttcctgacgtt 959 gggggacgatcgtcggggg sos 960
gggggtcgtacgacgggggg sos 961 tttttttttttttttttttttttt po 962
aaaaaaaaaaaaaaaaaaaaaaaa po 963 cccccccccccccccccccccccc po 964
tcgtcgttttgtcgttttgtcgtt 965 tcgtcgttttgtcgttttgtcgtt 966
tcgtcgttttgtcgttttgtcgtt 967 tcgtcgttttgtcgttttgtcgtt 968
ggggtcaacgttgagggggg 969 ggggtcaacgttgagggggg 970
ggggtcaagcttgagggggg 971 tgctgcttcccccccccccc 972
ggggacgtcgacgtgggggg sos 973 ggggtcgtcgacgagggggg sos 974
ggggtcgacgtacgtcgagggggg sos 975 ggggaccggtaccggtgggggg sos 976
gggtcgacgtcgagggggg sos 977 ggggtcgacgtogaggggg sos 978
ggggaacgttaacgttgggggg sos 979 ggggtcaccggtgagggggg sos 980
ggggtcgttcgaacgagggggg sos 981 ggggacgttcgaacgtgggggg sos 982
tcaactttga s 983 tcaagcttga s 984 tcacgatcgtga s 985 tcagcatgctga s
986 gggggagcatgctggggggg sos 987 gggggggggggggggggggg sos 988
gggggacgatatcgtcgggggg sos 989 gggggacgacgtcgtcgggggg sos 990
gggggacgagctcgtcgggggg sos 991 gggggacgtacgtcgggggg sos 992
tcaacgtt 993 tccataccggtcctgatgct 994 tccataccggtcctaccggt s 995
gggggacgatcgttgggggg sos 996 ggggaacgatcgtcgggggg sos 997 ggg ggg
acg atc gtc ggg ggg sos 998 ggg gga cga tcg tcg ggg ggg sos 999 aaa
gac gtt aaa po 1000 aaagagcttaaa po 1001 aaagazgttaaa po 1002
aaattcggaaaa po 1003 gggggtcatcgatgagggggg sos 1004
gggggtcaacgttgagggggg sos 1005 atgtagcttaataacaaagc po 1006
ggatcccttgagttacttct po 1007 ccattccacttctgattacc po 1008
tatgtattatcatgtagata po 1009 agcctacgtattcaccctcc po 1010
ttcctgcaactactattgta po 1011 atagaaggccctacaccagt po 1012
ttacaccggtctatggaggt po 1013 ctaaccagatcaagtctagg po 1014
cctagacttgatctggttag po 1015 tataagcctcgtccgacatg po 1016
catgtcggacgaggcttata po 1017 tggtggtggggagtaagctc po 1018
gagctactcccccaccacca po 1019 gccttcgatcttcgttggga po 1020
tggacttctctttgccgtct po 1021 atgctgtagcccagcgataa po 1022
accgaatcagcggaaagtga po 1023 tccatgacgttcctgacgtt 1024
ggagaaacccatgagctcatctgg 1025 accacagaccagcaggcaga 1026
gagcgtgaactgcgcgaaga 1027 tcggtacccttgcagcggtt 1028
ctggagccctagccaaggat 1029 gcgactccatcaccagcgat 1030
cctgaagtaagaaccagatgt 1031 ctgtgttatctgacatacacc 1032
aattagccttaggtgattggg 1033 acatctggttcttacttcagg 1034
ataagtcatattttgggaactac 1035 cccaatcacctaaggctaatt 1036
ggggtcgtcgacgagggggg sos 1037 ggggtcgttcgaacgagggggg sos 1038
ggggacgttcgaacgtgggggg sos 1039 tcctggcggggaagt s 1040
ggggaacgacgtcgttgggggg sos 1041 ggggaacgtacgtcgggggg sos 1042
ggggaacgtacgtacgttgggggg sos 1043 ggggtcaccggtgagggggg sos 1044
ggggtcgacgtacgtcgagggggg sos 1045 ggggaccggtaccggtgggggg sos 1046
gggtcgacgtcgagggggg sos 1047 ggggtcgacgtcgagggg sos 1048
ggggaacgttaacgttgggggg sos 1049 ggggacgtcgacgtggggg sos 1050
gcactcttcgaagctacagccggcagcctctgat 1051
cggctcttccatgaggtctttgctaatcttgg 1052
cggctcttccatgaaagtctttggacgatgtgagc 1053 tcctgcaggttaagt s 1054
gggggtcgttcgttgggggg sos 1055 gggggatgattgttgggggg sos 1056
gggggazgatzgttgggggg sos 1057 gggggagctagcttgggggg sos 1058
ggttcttttggtccttgtct s 1059 ggttcttttggtcctcgtct s 1060
ggttcttttggtccttatct s 1061 ggttcttggtttccttgtct s 1062
tggtcttttggtccttgtct s 1063 ggttcaaatggtccttgtct s 1064
gggtcttttgggccttgtct s 1065 tccaggacttctctcaggtttttt s 1066
tccaaaacttctctcaaatt s 1067 tactacttttatacttttatactt s 1068
tgtgtgtgtgtgtgtgtgtgtgtg s 1069 ttgttgttgttgtttgttgttgttg s 1070
ggctccggggagggaatttttgtctat s 1071 gggacgatcgtcggggggg sos 1072
gggtcgtcgacgaggggggg sos 1073 ggtcgtcgacgaggggggg sos 1074
gggtcgtcgtcgtggggggg sos 1075 ggggacgatcgtcggggggg sos 1076
ggggacgtcgtcgtgggggg sos 1077 ggggtcgacgtcgacgtcgaggggggg sos 1078
ggggaaccgcggttggggggg sos 1079 ggggacgacgtcgtggggggg sos 1080
tcgtcgtcgtcgtcgtggggggg sos 1081 tcctgccggggaagt s 1082
tcctgcaggggaagt s 1083 tcctgaaggggaagt s 1084 tcctggcgggcaagt s
1085 tcctggcgggtaagt s 1086 tcctggcgggaaagt s 1087 tccgggcggggaagt
s 1088 tcggggcggggaagt s 1089 tcccggcggggaagt s 1090
gggggacgttggggg s 1091 ggggttttttttttgggggg sos 1092
ggggccccccccccgggggg sos 1093 ggggttgttgttgttgggggg sos
[0053] In some embodiments, the immunostimulatory nucleic acid is a
CpG nucleic acid. CpG sequences, while relatively rare in human DNA
are commonly found in the DNA of infectious organisms such as
bacteria. The human immune system has apparently evolved to
recognize CpG sequences as an early warning sign of infection and
to initiate an immediate and powerful immune response against
invading pathogens without causing adverse reactions frequently
seen with other immune stimulatory agents. Thus CpG containing
nucleic acids, relying on this innate immune defense mechanism can
utilize a unique and natural pathway for immune therapy. The
effects of CpG nucleic acids on immune modulation have been
described extensively in published patent applications, such as PCT
US95/01570), PCT/US97/19791, PCT/US98/03678; PCT/US98/10408;
PCT/US98/04703; PCT/US99/07335; and PCT/US99/09863. The entire
contents of each of these patent applications is hereby
incorporated by reference.
[0054] A CpG nucleic acid is a nucleic acid which includes at least
one unmethylated CpG dinucleotide. A nucleic acid containing at
least one unmethylated CpG dinucleotide is a nucleic acid molecule
which contains an unmethylated cytosine in a cytosine-guanine
dinucleotide sequence (i.e. "CpG DNA" or DNA containing a 5'
cytosine followed by 3' guanosine and linked by a phosphate bond)
and activates the immune system. The CpG nucleic acids can be
double-stranded or single-stranded. Generally, double-stranded
molecules are more stable in vivo, while single-stranded molecules
have increased immune activity. Thus in some aspects of the
invention it is preferred that the nucleic acid be single stranded
and in other aspects it is preferred that the nucleic acid be
double stranded. The terms CpG nucleic acid or CpG oligonucleotide
as used herein refer to an immunostimulatory CpG nucleic acid or a
nucleic acid unless otherwise indicated. The entire
immunostimulatory nucleic acid can be unmethylated or portions may
be unmethylated but at least the C of the 5' CG 3' must be
unmethylated.
[0055] In one preferred embodiment the invention provides an
immunostimulatory nucleic acid which is a CpG nucleic acid
represented by at least the formula:
5'X.sub.1X.sub.2CGX.sub.3X.sub.43'
[0056] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In one embodiment X.sub.2 is adenine, guanine,
cytosine, or thymine. In another embodiment X.sub.3 is cytosine,
guanine, adenine, or thymine. In other embodiments X.sub.2 is
adenine, guanine, or thymine and X.sub.3 is cytosine, adenine, or
thymine.
[0057] In another embodiment the immunostimulatory nucleic acid is
an isolated CpG nucleic acid represented by at least the
formula:
5'N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.23'
[0058] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides and N is any nucleotide and N.sub.1 and N.sub.2 are
nucleic acid sequences composed of from about 0-25 N's each. In one
embodiment X.sub.1X.sub.2 are nucleotides selected from the group
consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA,
TpT, and TpG; and X.sub.3X.sub.4 are nucleotides selected from the
group consisting of: TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA,
ApA, and CpA. Preferably X.sub.1X.sub.2 are GpA or GpT and
X.sub.3X.sub.4 are TpT. In other embodiments X.sub.1 or X.sub.2 or
both are purines and X.sub.3 or X.sub.4 or both are pyrimidines or
X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or both are
pyrimidines. In another preferred embodiment X.sub.1X.sub.2 are
nucleotides selected from the group consisting of: TpA, ApA, ApC,
ApG, and GpG. In yet another embodiment X.sub.3X.sub.4 are
nucleotides selected from the group consisting of: TpT, TpA, TpG,
ApA, ApG, ApC, and CpA. X.sub.1X.sub.2 in another embodiment are
nucleotides selected from the group consisting of: TpT, TpG, ApT,
GpC, CpC, CpT, TpC, GpT and CpG.
[0059] In another preferred embodiment the immunostimulatory
nucleic acid has the sequence
5'TCN.sub.1TX.sub.1X.sub.2CGX.sub.3X.sub.43'. The immunostimulatory
nucleic acids of the invention in some embodiments include
X.sub.1X.sub.2 selected from the group consisting of GpT, GpG, GpA
and ApA and X.sub.3X.sub.4 is selected from the group consisting of
TpT, CpT and TpC.
[0060] In other embodiments, the CpG oligonucleotide has a sequence
selected from the group consisting of SEQ ID NO: 1, 3, 4, 14-16,
18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87,
90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133; 136-141,
146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214,
216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275,
277-281, 286-287, 292, 295-296, 300, 302, 1305-307, 309-312,
314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365,
367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404,
406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450,
453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488,
489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541,
543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611,
613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706,
708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761,
763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799,
804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859,
862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0061] For facilitating uptake into cells, the immunostimulatory
nucleic acids are preferably in the range of 6 to 100 bases in
length. However, nucleic acids of any size greater than 6
nucleotides (even many kb long) are capable of inducing an immune
response according to the invention if sufficient immunostimulatory
motifs are present. Preferably the immunostimulatory nucleic acid
is in the range of between 8 and 100 and in some embodiments
between 8 and 50 or 8 and 30 nucleotides in size.
[0062] "Palindromic sequence" shall mean an inverted repeat (i.e. a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double-stranded structures. In one embodiment
the CpG nucleic acid contains a palindromic sequence. A palindromic
sequence used in this context refers to a palindrome in which the
CpG is part of the palindrome, and preferably is the center of the
palindrome. In another embodiment the CpG nucleic acid is free of a
palindrome. An immunostimulatory nucleic acid that is free of a
palindrome is one in which the CpG dinucleotide is not part of a
palindrome. Such an oligonucleotide may include a palindrome in
which the CpG is not the center of the palindrome.
[0063] The CpG nucleic acid sequences of the invention are those
broadly described above as well as disclosed in PCT Published
Patent Applications PCT/US95/01570 and PCT/US97/19791 claiming
priority to U.S. Ser. Nos. 08/386,063 and 08/960,774, filed on Feb.
7, 1995 and Oct. 30, 1997 respectively.
[0064] The immunostimulatory nucleic acids of the invention also
include nucleic acids having T-rich motifs. It was recently
discovered by Dr. Arthur Krieg that T-rich nucleic acids were
immunostimulatory. It was presented by Dr. Krieg at the
International Workshop on "Immunobiology of Bacterial CpG-DNA" held
in Upper Bavaria on Sep. 26-29, 1999 that poly-T nucleic acids of
24 bases in length are immunostimulatory, whereas the same length
poly-C oligonucleotide is non-stimulatory. These concepts are also
described and claimed in US Provisional Patent Application No.
60/156,113 filed on Sep. 25, 1999, which is hereby incorporated by
reference.
[0065] Poly-G containing nucleic acids are also immunostimulatory.
PCT published patent application number WO 00/14217, which claims
priority to German Patent Application No. 98 11 6652.3, filed on
Sep. 3, 1998 describes poly-G-containing oligonucleotides and their
uses. A variety of other references, including Pisetsky and Reich,
1993 Mol. Biol. Reports, 18:217-221; Krieger and Herz, 1994, Ann.
Rev. Biochem., 63:601-637; Macaya et al., 1993, PNAS, 90:3745-3749;
Wyatt et al., 1994, PNAS, 91:1356-1360; Rando and Hogan, 1998, In
Applied Antisense Oligonucleotide Technology, ed. Krieg and Stein,
p. 335-352; and Kimura et al., 1994, J. Biochem. 116, 991-994 also
describe the immunostimulatory properties of poly-G nucleic acids.
Poly-G-containing nucleotides are useful for treating and
preventing bacterial and viral infections.
[0066] In some aspects of the invention the poly-G containing
nucleic acids are administered alone for the treatment of asthma
and allergy. It was previously suggested in the prior art that
poly-G rich oligonucleotides inhibit the production of IFN-.delta.
by compounds such as CpG oligonucleotides, concanavalin A,
bacterial DNA, or the combination of PMA and the calcium ionophore
A 23187 (Halperin and Pisetsky, 1995, Immunopharmacol., 29:47-52,
as well as block the downstream effects of IFN-.delta.. For
instance, Ramanathan et al., 1994, Transplantation, 57:612-615, has
shown that a poly-G oligonucleotide inhibits the binding of
IFN-.delta. to its receptor, which prevents the normal enhancement
of MHC Class 1 and ICAM-1 in response to IFN-.delta.. Poly-G
oligonucleotides were also found to be able to inhibit the
secretion of IFN-.delta. from lymphocytes (Halperin and Pisetsky,
1995, Immunopharmacol., 29:47-52). It was surprisingly, discovered
according to the invention that when poly-G nucleic acids are
administered in vivo, they are useful for treating or preventing
allergy or asthma. Thus, in this aspect of the invention, poly-G
nucleic acids are administered alone or optionally with other
asthma/allergy medicaments for the treatment of allergy and/or
asthma.
[0067] Poly-G nucleic acids preferably are nucleic acids having the
following formulas:
5'X.sub.1X.sub.2GGGX.sub.3X.sub.43'
[0068] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In preferred embodiments at least one of X.sub.3 and
X.sub.4 are a G. In other embodiments both of X.sub.3 and X.sub.4
are a G. In yet other embodiments the preferred formula is 5'
GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents between 0 and
20 nucleotides. In other embodiments the poly-G nucleic acid is
free of unmethylated CG dinucleotides, while in other embodiments
the poly-G nucleic acid includes at least one unmethylated CG
dinucleotide.
[0069] The poly G nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276,
282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733,
768, 795, 796, 914-925, 928-931, 933-936, and 938. In other
embodiments, the poly G nucleic acid includes a sequence selected
from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148,
173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475,
519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662,
725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937. In
some embodiments, the entire backbone of the poly-G nucleic acid is
phosphorothioate.
[0070] In related embodiments, the invention also contemplates the
use of immunostimulatory nucleic acids that comprise one and
preferably two poly-G motifs, even more preferably flanking a
palindrome. Such immunostimulatory nucleic acids preferably have a
chimeric backbone (i.e., their backbone is comprised of both
phosphodiester and phosphorothioate linkages). Even more
preferably, the phosphorothioate linkages in these latter
immunostimulatory nucleic acids are located at the 5' and 3' ends
of the nucleic acid. Examples of suitable palindromes include, but
are not limited to AACGTT; AAGCTT; AGCGCT; TCGA; TTCGAA; ACGT;
GACGTC; and CACGTG.
[0071] Nucleic acids having modified-backbones, such as
phosphorothioate backbones, fall within the class of
immunostimulatory nucleic acids. U.S. Pat. Nos. 5,723,335 and
5,663,153 issued to Hutcherson, et al. and related PCT publication
WO95/26204 describe immune stimulation using phosphorothioate
oligonucleotide analogues. These patents describe the ability of
the phosphorothioate backbone to stimulate an immune response in a
non-sequence specific manner.
[0072] The backbone characteristics of the nucleic acids listed in
Table 1 are also shown. Some of the designations in the Table are
as follows: o or po=phosphodiester, s=phosphorothioate,
sos=chimeric.
[0073] In the case when the immunostimulatory nucleic acid is
administered in conjunction with a nucleic acid vector, it is
preferred that the backbone of the immunostimulatory nucleic acid
be a chimeric combination of phosphodiester and phosphorothioate
(or other phosphate modification). The cell may have a problem
taking up a plasmid vector in the presence of completely
phosphorothioate oligonucleotide. Thus when both a vector and an
oligonucleotide are delivered to a subject, it is preferred that
the oligonucleotide have a chimeric backbone or have a
phosphorothioate backbone but that the plasmid is associated with a
vehicle that delivers it directly into the cell, thus avoiding the
need for cellular uptake. Such vehicles are known in the art and
include, for example, liposomes and gene guns.
[0074] For use in the instant invention, the immunostimulatory
nucleic acids can be synthesized de novo using any of a number of
procedures well known in the art. Such compounds are referred to as
"synthetic nucleic acids." For example, the b-cyanoethyl
phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., Tet.
Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et
al., Tet. Let. 27:4051-4054, 1986; Froehler et al., Nucl. Acid.
Res. 14:5399-5407, 1986; Garegg et al., Tet. Let. 27:4055-4058,
1986, Gaffney et al., Tet. Let. 29:2619-2622, 1988). These
chemistries can be performed by a variety of automated
oligonucleotide synthesizers available in the market. These nucleic
acids are referred to as synthetic nucleic acids. Alternatively,
immunostimulatory nucleic acids can be produced on a large scale in
plasmids, (see Sambrook, T., et al., "Molecular Cloning: A
Laboratory Manual", Cold Spring Harbor laboratory Press, New York,
1989) and separated into smaller pieces or administered whole.
Nucleic acids can be prepared from existing nucleic acid sequences
(e.g., genomic or cDNA) using known techniques, such as those
employing restriction enzymes, exonucleases or endonucleases.
Nucleic acids prepared in this manner are referred to as isolated
nucleic acids. The term "immunostimulatory nucleic acid"
encompasses both synthetic and isolated immunostimulatory nucleic
acids.
[0075] For use in vivo, nucleic acids are preferably: relatively
resistant to degradation (e.g., are stabilized). A "stabilized
nucleic acid molecule" shall mean a nucleic acid molecule that is
relatively resistant to in vivo degradation (e.g. via an exo- or
endo-nuclease). Stabilization can be a function of length or
secondary structure. Immunostimulatory nucleic acids that are tens
to hundreds of kbs long are relatively resistant to in vivo
degradation. For shorter immunostimulatory nucleic acids, secondary
structure can stabilize and increase their effect. For example, if
the 3' end of a nucleic acid has self-complementarity to an
upstream region, so that it can fold back and form a sort of stem
loop structure, then the o nucleic acid becomes stabilized and
therefore exhibits more activity.
[0076] Alternatively, nucleic acid stabilization-can be
accomplished via backbone modifications. Preferred stabilized
nucleic acids of the instant invention have a modified backbone. It
has been demonstrated that modification of the nucleic acid
backbone provides enhanced activity of the immunostimulatory
nucleic acids when administered in vivo. One type of modified
backbone is a phosphate backbone modification. Immunostimulatory
nucleic acids, including at least two phosphorothioate linkages at
the 5' end of the oligonucleotide and multiple phosphorothioate
linkages at the 3' end, preferably 5, can in some circumstances
provide maximal activity and protect the nucleic acid from
degradation by intracellular exo- and endo-nucleases. Other
phosphate modified nucleic acids include phosphodiester modified
nucleic acids, combinations of phosphodiester and phosphorothioate
nucleic acids, methylphosphonate, methylphosphorothioate,
phosphorodithioate, and combinations thereof. Each of these
combinations in CpG nucleic acids and their particular effects on
immune cells is discussed in more detail in PCT Published Patent
Applications PCT/US95/01570 and PCT/US97/19791, the entire contents
of which are hereby incorporated by reference. Although Applicants
are not bound by the theory, it is believed that these phosphate
modified nucleic acids may show more stimulatory activity due to
enhanced nuclease resistance, increased cellular uptake, increased
protein binding, and/or altered intracellular localization.
[0077] Modified backbones such as phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters, (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990;
Goodchild; J., Bioconjugate Chem. 1:165, 1990).
[0078] Both phosphorothioate and phosphodiester nucleic acids
containing immunostimulatory motifs are active in immune cells.
However, based on the concentration needed to induce
immunostimulatory nucleic acid specific effects, the nuclease
resistant phosphorothioate backbone immunostimulatory nucleic acids
are more potent (2 .mu.g/ml for the phosphorothioate vs. a total of
90 .mu.g/ml for phosphodiester).
[0079] Another type of modified backbone, useful according to the
invention, is a peptide nucleic acid. The backbone is composed of
aminoethylglycine and supports bases which provide the
DNA-character. The backbone does not include any phosphate and thus
may optionally have no net charge. The lack of charge allows for
stronger DNA-DNA binding because the charge repulsion between the
two strands does not exist. Additionally, because the backbone has
an extra methylene group, the oligonucleotides are enzyme/protease
resistant. Peptide nucleic acids can-be purchased from various
commercial sources, e.g., Perkin Elmer, C. A. or synthesized de
novo.
[0080] Another class of backbone modifications include
2'-O-methylribonucleosides (2'-Ome). These types of substitutions
are described extensively in the prior art and in particular with
respect to their immunostimulating properties in Zhao et al.,
Bioorganic and Medicinal Chemistry Letters, 1999, 9:24:3453. Zhao
et al. describes methods of preparing 2'-Ome modifications to
nucleic acids.
[0081] The nucleic acid molecules of the invention may include
naturally-occurring or synthetic purine or pyrimidine heterocyclic
bases as well as modified backbones. Purine or pyrimidine
heterocyclic bases include, but are not limited to, adenine,
guanine, cytosine, thymidine, uracil, and inosine. Other
representative heterocyclic bases are disclosed in U.S. Pat. No.
3,687,808, issued to Merigan, et al. The term purine or pyrimidine
or bases are used herein to refer to both naturally-occurring or
synthetic purines, pyrimidines or bases.
[0082] Other stabilized nucleic acids include: nonionic DNA
analogs, such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acids which contain diol, such
as tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
[0083] The immunostimulatory nucleic acids having backbone
modifications useful according to the invention in some embodiments
are S- or R-chiral immunostimulatory nucleic acids. An "S chiral
immunostimulatory nucleic acid" as used herein is an
immunostimulatory nucleic acid wherein at least two nucleotides
have a backbone modification forming a chiral center and wherein a
plurality of the chiral centers have S chirality. An "R chiral
immunostimulatory nucleic acid" as used herein is an
immunostimulatory nucleic acid wherein at least two nucleotides
have a backbone modification forming a chiral center and wherein a
plurality of the chiral centers have R chirality. The backbone
modification may be any type of modification that-forms a chiral
center. The modifications include but are not-limited to
phosphorothioate, methylphosphonate, methylphosphorothioate,
phosphorodithioate, 2'-Ome and combinations thereof.
[0084] The chiral immunostimulatory nucleic acids must have at
least two nucleotides within the nucleic acid that have a backbone
modification. All or less than all of the nucleotides in the
nucleic acid, however, may have a modified backbone. Of the
nucleotides having a modified backbone (referred to as chiral
centers), a plurality have a single chirality, S or R. A
"plurality" as used herein within the context of modified backbones
refers to an amount greater than 50%. Thus, less than all of the
chiral centers may have S or R chirality as long as a plurality of
the chiral centers have S or R chirality. In some embodiments at
least 55%, 60%, 65%, 70%, 75%, 80,%, 85%, 90%, 95%, or 100% of the
chiral-centers have S or R chirality. In other embodiments at
least-55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the
nucleotides have backbone modifications.
[0085] The S- and R-chiral immunostimulatory nucleic acids may be
prepared by any method known in the art for producing chirally pure
oligonucleotides. The Stec et al reference teaches methods for
producing stereopure phosphorothioate oligodeoxynucleotides using
an oxathiaphospholane. (Stec, W. J., et al., 1995, J. Am. Chem.
Soc., 117:12019). Other methods for making chirally pure
oligonucleotides have been described by companies such as ISIS
Pharmaceuticals. US patents have also described these methods. For
instance U.S. Pat. Nos. 5,883,237; 5,837,856; 5,599,797; 5,512,668;
5,856,465; 5,359,052; 5,506,212; 5,521,302; and 5,212,295, each of
which is hereby incorporated by reference in its entirety, disclose
methods for generating stereopure oligonucleotides.
[0086] The immunostimulatory nucleic acids are useful for treating
or preventing allergy or asthma in a subject. A "subject" shall
mean a human or vertebrate mammal including but not limited to a
dog, cat, horse, cow, pig, sheep, goat, or primate, e.g.,
monkey.
[0087] The immunostimulatory nucleic acids are useful in some
aspects of the invention as a prophylactic for the treatment of a
subject at risk of developing an allergy or asthma where the
exposure of the subject to an allergen or predisposition to asthma
is known or suspected. A "subject at risk" of developing allergy or
asthma as used herein is a subject who has any risk of exposure to
an allergen or a risk of developing asthma, i.e. someone who has
suffered from an asthmatic attack previously or has a
predisposition to asthmatic attacks. For instance, a subject at
risk may be a subject who is planning to travel to an area where a
particular type of allergen or asthmatic initiator is found or it
may even be any subject living in an area where an allergen has
been identified. If the subject develops allergic responses to a
particular antigen and the subject may be exposed to the antigen,
i.e., during pollen season, then that subject is at risk of
exposure to the antigen. A subject at risk of developing an allergy
or asthma includes those subjects that have been identified as
having an allergy or asthma but that don't have the active disease
during the treatment of the invention as well as subjects that are
considered to be at risk of developing these diseases because of
genetic or environmental factors.
[0088] In addition to the use of the immunostimulatory nucleic acid
and the asthma/allergy medicament for prophylactic treatment, the
invention also encompasses the use of the combination of drugs for
the treatment of a subject having an allergy or asthma. A "subject
having an allergy" is a subject that has an allergic reaction in
response to an allergen. An "allergy" refers to acquired
hypersensitivity to a substance (allergen).
[0089] The allergic reaction in man and animals has been
extensively studied and the basic immune mechanisms involved are
well known. Allergic conditions or diseases in humans include but
are not limited to eczema, allergic rhinitis or coryza, hay fever,
conjunctivitis, bronchial or allergic asthma, urticaria (hives) and
food allergies; atopic dermatitis; anaphylaxis; drug allergy;
angioedema; and allergic conjunctivitis. Allergic diseases in dogs,
include but are not limited to seasonal dermatitis; perennial
dermatitis; rhinitis: conjunctivitis; allergic asthma; and drug
reactions. Allergic diseases in cats include but are not limited to
dermatitis and respiratory disorders; and food allergens. Allergic
diseases in horses include but are not limited to respiratory
disorders such as "heaves" and dermatitis. Allergic diseases in
non-human primates include but are not limited to allergic asthma
and allergic dermatitis.
[0090] The generic name for molecules that cause an allergic
reaction is allergen. There are numerous species of allergens. The
allergic reaction occurs when tissue-sensitizing immunoglobulin of
the IgE type reacts with foreign allergen. The IgE antibody is
bound to mast cells and/or basophils, and these specialized cells
release chemical mediators (vasoactive amines) of the allergic
reaction when stimulated to do so by allergens bridging the ends of
the antibody molecule. Histamine, platelet activating factor,
arachidonic acid metabolites, and serotonin are among the best
known mediators of allergic reactions in man. Histamine and the
other vasoactive amines are normally stored in mast cells and
basophil leukocytes. The mast cells are dispersed throughout animal
tissue and the basophils circulate within the vascular system.
These cells manufacture and store histamine within the cell unless
the specialized sequence of events involving IgE binding occurs to
trigger its release.
[0091] The symptoms of the allergic reaction vary, depending on the
location within the body where the IgE reacts with the antigen. If
the reaction occurs along the respiratory epithelium the symptoms
are sneezing, coughing and asthmatic reactions. If the
interaction-occurs in the digestive tract, as in the case of food
allergies, abdominal pain and diarrhea are common. Systematic
reactions, for example following a bee sting, can be severe and
often life threatening.
[0092] Delayed type hypersensitivity, also known as type IV allergy
reaction is an allergic so reaction characterized by a delay period
of at least 12 hours from invasion of the antigen into the allergic
subject until appearance of the inflammatory or immune reaction.
The T lymphocytes (sensitized T lymphocytes) of individuals in an
allergic condition react with the antigen, triggering the T
lymphocytes to release lymphokines (macrophage migration inhibitory
factor (MIF), macrophage activating factor (MAF), mitogenic factor
(MF), skin-reactive factor (SRF), chemotactic factor,
neovascularization-accelerating factor, etc.), which function as
inflammation mediators, and the biological activity of these
lymphokines, together with the direct and indirect effects of
locally appearing lymphocytes and other inflammatory immune cells,
give rise to the type IV allergy reaction. Delayed allergy
reactions include tuberculin type reaction, homograft rejection
reaction, cell-dependent type protective reaction, contact
dermatitis hypersensitivity reaction, and the like, which are known
to be most strongly suppressed by steroidal agents. Consequently,
steroidal agents are effective against diseases which are caused by
delayed allergy reactions. Long-term use of steroidal agents at
concentrations currently being used can, however, lead to the
serious side-effect known as steroid dependence. The methods of the
invention solve some of these problems, by providing for lower and
fewer doses to be administered.
[0093] Immediate hypersensitivity (or anaphylactic response) is a
form of allergic reaction which develops very quickly, i.e. within
seconds or minutes of exposure of the patient to the causative
allergen, and it is mediated by IgE antibodies made by B
lymphocytes. In nonallergic patients, there is no IgE antibody of
clinical relevance; but, in a person suffering with allergic
diseases, IgE antibody mediates immediate hypersensitivity by
sensitizing mast cells which are abundant in the skin, lymphoid
organs, in the membranes of the eye, nose and mouth, and in the
respiratory tract and intestines.
[0094] Mast cells have surface receptors for IgE, and the IgE
antibodies in allergy-suffering patients become bound to them. As
discussed briefly above, when the bound IgE is subsequently
contacted by the appropriate allergen, the mast cell is caused to
degranulate and to release various substances called bioactive
mediators, such as histamine, into the surrounding tissue. It is
the biologic activity of these substances which is responsible for
the clinical symptoms typical of immediate hypersensitivity;
namely, contraction of smooth muscle in the airways or the
intestine, the dilation of small blood vessels and the increase in
their permeability to water and plasma proteins, the secretion of
thick sticky mucus, and in the skin, redness, swelling and the
stimulation of nerve endings that results in itching or pain.
[0095] Many allergies are caused by IgE antibody generation against
harmless allergens. The cytokines that are induced by
administration of immunostimulatory nucleic acids are predominantly
of a class called "Th1" (examples are IL-12 and IFN-.gamma.).
Cytokine production by helper CD4.sup.+(and also in CD8.sup.+) T
cells frequently fall into one of two phenotypes, Th1 and Th2, in
both murine and human systems (Romagnani, 1991, Immunol Today 12:
256-257, Mosmann, 1989, Annu-Rev Immunol, 7: 145-173). Th1 cells
produce interleukin 2 (IL-2), tumor necrosis factor (TNF.alpha.)
and interferon gamma (IFN.gamma.) and they are responsible
primarily for cell-mediated immunity such as delayed type
hypersensitivity. Th2 cells produce interleukins, IL-4, IL-5, IL-6,
IL-9, IL-10 and IL-13 and are primarily involved in providing
optimal help for humoral immune responses such as IgE and IgG4
antibody isotype switching (Mosmann, 1989, Annu Rev Immunol, 7:
145-173).
[0096] The types of antibodies associated with a Th1 response are
generally more protective because they have high neutralization and
opsonization capabilities. Th2 responses involve predominately
antibodies and these have less protective effect against infection
and some Th2 isotypes (e.g., IgE) are associated with allergy.
Strongly polarized. Th1 and Th2 responses not only play different
roles in protection, they can promote different immunopathological
reactions. Th1-type responses are involved organ specific
autoimmunity-such as experimental autoimmune uveoretinitis (Dubeyet
al, 1991, Eur Cytokine Network 2: 147-152), experimental autoimmune
encephalitis (EAE) (Beraud et al, 1991, Cell Immunol 133: 379-389)
and insulin dependent diabetes mellitus (Hahnet al, 1987, Eur. J.
Immunol. 18: 2037-2042), in contact dermatitis (Kapsenberg et al,
Immunol Today 12: 392-395), and in some chronic inflammatory
disorders. In contrast Th2-type responses are responsible for
triggering allergic atopic disorders (against common environmental
allergens) such as allergic asthma (Walker et al, 1992, Am Rev Resp
Dis 148: 109-115) and atopic dermatitis (van der Heijden et al,
1991, J Invest Derm 97: 389-394), are thought to exacerbate
infection with tissue-dwelling protozoa such as helminths
(Finkelman et al, 1991, Immunoparasitol Today 12: A62-66) and
Leishmania major (Caceres-Dittmar et al, 1993, Clin Exp Immunol 91:
500-505), are preferentially induced in certain primary
immunodeficiencies such as hyper-IgE syndrome (Del Prete et al,
1989, J Clin Invest 84: 1830-1835) and Omenn's syndrome (Schandene
et al, 1993, Eur J Immunol 23: 56-60), and are associated with
reduced ability to suppress HIV replication (Barker et al, 1-995,
Proc Soc Nat Acad Sci USA 92: 11135-11139).
[0097] Thus, in general, it appears that allergic diseases are
mediated by Th2 type immune responses. Based on the ability of the
immunostimulatory nucleic acid to shift the immune response in a
subject from a Th2 (which is associated with production of IgE
antibodies and allergy and asthma) to a Th1 response (which is
protective against allergic and asthmatic reactions), an effective
dose for inducing an immune response of a immunostimulatory nucleic
acid can be administered to a subject to treat or prevent an
allergy or asthma.
[0098] Th2 cytokines, especially IL-4 and IL-5 are elevated in the
airways of asthmatic, subjects. These cytokines promote important
aspects of the asthmatic inflammatory response, including IgE
isotype switching, eosinophil chemotaxis and activation, and mast
cell growth. Th1 cytokines, especially IFN-g and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines. Thus, the immunostimulatory nucleic acid has significant
therapeutic utility in the treatment of allergic conditions and
asthma.
[0099] An "allergen" as used herein is a molecule capable of
provoking an immune response characterized by production of IgE.
Thus, in the context of this invention, the term allergen means a
specific type of antigen which can trigger an allergic response
which is mediated by IgE antibody. The method and preparations of
this invention extend to a broad class of such allergens and
fragments of allergens or haptens acting as allergens. Allergens
include but are not limited to Environmental Aeroallergens; plant
pollens such as Ragweed/hayfever (affects 10% of pop., 25 million
ppl); Weed pollen allergens; Grass pollen allergens (grasses affect
10% of pop., 25 million ppl); Johnson grass; Tree pollen allergens;
Ryegrass; House dust mite allergens (affects 6% of pop., 15 million
ppl); Storage mite allergens; Japanese cedar pollen/hay fever
(affects 10% of pop. In Japan, 13 million ppl); Mold spore
allergens; Animal allergens (cat (affects 2% of pop., 5 million
ppl), dog, guinea pig, hamster, gerbil, rat, mouse); Food Allergens
(e.g., Crustaceans; nuts, such-as peanuts; citrus fruits); Insect
Allergens (Other than mites, listed above); Venoms: (Hymenoptera,
yellow jacket, honey bee, wasp, hornet, fire ant); Other
environmental insect allergens from cockroaches, fleas, mosquitoes,
etc.; Bacteria such as streptococcal antigens; Parasites such as
Ascaris antigen; Viral Antigens; Fungal spores; Drug Allergens;
Antibiotics; penicillins and related compounds; other antibiotics;
Whole Proteins such-as hormones (insulin), enzymes (Streptokinase);
all drugs and their metabolites capable of acting as incomplete
antigens or haptens; Industrial Chemicals and metabolites capable
of acting as haptens and stimulating the immune system (Examples
are the acid anhydrides (such as trimellitic anhydride) and the
isocyanates (such as toluene diisocyanate)); Occupational Allergens
such as flour (ie. Baker's asthma), castor bean, coffee bean, and
industrial chemicals described above; flea allergens; and human
proteins in non-human animals.
[0100] Allergens include but are not limited to cells, cell
extracts, proteins, polypeptides, peptides, polysaccharides,
polysaccharide conjugates, peptide and non-peptide mimics of
polysaccharides and other molecules, small molecules, lipids,
glycolipids, and carbohydrates. Many allergens, however, are
protein or polypeptide in nature, as proteins and polypeptides are
generally more antigenic than carbohydrates or fats.
[0101] Examples of specific natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria(Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); -Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris aruindinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sor-ghum
halepensis); and Bromus (e.g. Bromus inermis).
[0102] A "subject having asthma" is a subject that has a disorder
of the respiratory system characterized by inflammation, narrowing
of the airways and increased reactivity of the airways to inhaled
agents. Asthma is frequently, although not exclusively associated
with atopic or allergic symptoms. An "initiator" as used herein
refers to a composition or environmental condition which triggers
asthma. Initiators include, but are not limited to, allergens, cold
temperatures, exercise, viral infections, SO.sub.2.
[0103] In another aspect the invention provides methods for
treating or preventing asthma or allergy in a hypo-responsive
subject. As used herein, a hypo-responsive subject is one who has
previously failed to respond to a treatment directed at treating or
preventing asthma or allergy or one who is at risk of not
responding to such a treatment. The treatment directed at treating
or preventing asthma or allergy may began asthma/allergy
medicarnent, in which case the hypo-responsive subject is one who
is hypo-responsive to an asthma/allergy medicament.
[0104] Other subjects who are hypo-responsive include those who are
refractory to an asthma/allergy medicament. As used herein, the
term "refractory" means resistant or failure to yield to treatment.
Such subjects may be those who never responded to an asthma/allergy
medicament (i.e., subjects who are non-responders), or
alternatively, they may be those who at one time responded to an
asthma/allergy medicament, but have since that time have become
refractory to the medicament. In some embodiments, the subject is
one who is refractory to a subset of medicaments. A subset of
medicaments is at least one medicament. In some embodiments, a
subset refers to 2, 3, 4, 5, 6, 7, 8, 9, or 10 medicaments.
[0105] In other embodiments, hypo-responsive subjects are elderly
subjects, regardless of whether they have or have not previously
responded to a treatment directed at treating or preventing asthma
or allergy. Elderly subjects, even those who have previously
responded to such treatment, are considered to be at risk of not
responding to a future administration of this treatment. Similarly,
neonatal subjects are also considered to be at risk of not
responding to treatment directed at treating or preventing asthma
or allergy.
[0106] In some embodiments, an immunostimulatory nucleic acid is
administered to the hypo-responsive subject without the further
administration of an asthma/allergy medicament. In yet other
embodiments, an asthma/allergy medicament is administered to the
hypo-responsive subject, in which case it may be administered
substantially simultaneously (i.e., concurrently) with, or
following the administration of the immunostimulatory nucleic
acid.
[0107] An "asthma/allergy medicament" as used herein is a
composition of matter which reduces the symptoms, inhibits the
asthmatic or allergic reaction, or prevents the development of an
allergic or asthmatic reaction. Various types of medicaments for
the treatment of asthma and allergy are described in the Guidelines
For The Diagnosis and Management of Asthma, Expert Panel Report 2,
NIH Publication No. 97/4051, Jul. 19, 1997, the entire contents of
which are incorporated herein by reference. The summary of the
medicaments as described in the NIH publication is presented
below.
[0108] In most embodiments the asthma/allergy medicament is useful
to some degree for treating both asthma and allergy. Some
asthma/allergy medicaments are preferably used in combination with
the immunostimulatory nucleic acids to treat asthma. These are
referred to as asthma medicaments. Asthma medicaments include, but
are not limited PDE-4 inhibitors, bronchodilator/beta-2 agonists,
K+ channel openers, VLA-4 antagonists, neurokin antagonists, TXA2
synthesis inhibitors, xanthanines, arachidonic acid antagonists, 5
lipoxygenase inhibitors, thromboxin A2 receptor antagonists,
thromboxane A2 antagonists, inhibitor of 5-lipox activation
proteins, and protease inhibitors.
[0109] Bronchodilator/beta-2 agonists are a class of compounds
which cause bronchodilation or smooth muscle relaxation.
Bronchodilator/beta-2-agonis- ts include, but are not limited to,
salmeterol, salbutamol, albuterol, terbutaline, D2522/formoterol,
fenoterol, bitolterol, pirbuerol methylxanthines and orciprenaline.
Long-acting .beta..sub.2-agonists and bronchodilators-are compounds
which are used for long-term prevention of symptoms in addition to
the anti-inflammatory therapies. They function by causing
bronchodilation, or smooth muscle relaxation, following adenylate
cyclase activation and increase in cyclic AMP producing functional
antagonism of bronchoconstriction. These compounds also inhibit
mast cell mediator release, decrease vascular permeability and
increase mucociliary clearance. Long-acting .beta..sub.2 agonists
include, but are not limited to, salmeterol and albuterol. These
compounds are usually used in combination with corticosteroids and
generally are not used without any inflammatory therapy. They have
been associated with side effects such as tachycardia, skeletal
muscle tremor, hypokalemia, and prolongation of QTc interval in
overdose.
[0110] Methylxanthines, including for instance theophylline, have
been used for long-term control and prevention of symptoms. These
compounds cause bronchodilation resulting from phosphodiesterase
inhibition and likely adenosine antagorni. It is also believed that
these compounds may effect eosinrophilic infiltration into
bronchial mucosa and decrease T-lymphocyte numbers in the
epithelium. Dose-related acute toxicities are a particular problem
with these types of compounds. As a result, routine serum
concentration must be monitored in order to account for the
toxicity and narrow therapeutic range arising from individual
differences in metabolic clearance. Side effects include
tachycardia, nausea and vomiting, tachyarrhythmias, central nervous
system stimulation, headache, seizures, hematemesis, hyperglycemia
and hypokalemia. Short-acting .beta..sub.2 agonists/bronchodilators
relax airway smooth muscle, causing the increase in air flow. These
types of compounds are a preferred drug for the treatment of acute
asthmatic systems. Previously, short-acting .beta..sub.2 agonists
had been prescribed on a regularly-scheduled basis in order to
improve overall asthma symptoms. Later reports, however, suggested
that regular use of this class of drugs produced significant
diminution in asthma control and pulmonary function (Sears, et al.
Lancet; 336:1391-6, 1990). Other studies showed that regular use of
some types of .beta..sub.2 agonists produced no harmful effects
over a four-month period but also produced no demonstrable effects
(Drazen, et al., N. Eng. J. Med., 335:841-7, 1996). As a result of
these studies, the daily use of short-acting .beta.2 agonists is
not generally recommended. Short-acting .beta..sub.2 agonists
include, but are not limited to, albuterol, bitolterol, pirbuterol,
and terbutaline. Some of the adverse effects associated with the
mastration of short-acting .beta..sub.2 agonists include
tachycardia, skeletal muscle tremor, hypokalemia, increased lactic
acid, headache, and hyperglycemia.
[0111] Other asthma/allergy medicaments are preferably used in
combination with the imminostimulatory nucleic acids to treat
allergy. These are referred to as allergy medicaments. Allergy
medicaments include, but are not limited to, anti-histamines,
steroids, and prostaglandin inducers. Anti-histamines are compounds
which counteract histamine released by mast cells or basophils.
These compounds are well known in the art and commonly used for the
treatment of allergy. Anti-histamines include, but are not limited
to, loratidine, cetirizine, buclizine, ceterizine analogues,
fexofenadine, terfenadine, desloratadine, norastemizole,
epinastine, ebastine, ebastine, astemizole, levocabastine,
azelastine, tranilast, terfenadine, mizolastine, betatastine, CS
560, and HSR 609. Prostaglandin inducers are compounds which induce
prostaglandin activity. Prostaglandins function by regulating
smooth muscle relaxation. Prostaglandin inducers include, but are
not limited to, S-5751.
[0112] The asthma/allergy medicaments useful in combination with
the immunostimulatory nucleic acids also include steroids and
immunomodulators.
[0113] The steroids include, but are not limited to,
beclomethasone, fluticasone, tramcinolone, budesonide,
corticosteroids and budesonide. The combination of
immunostimulatory nucleic acids and steroids are particularly well
suited to the treatment of young subjects (e.g., children). To
date, the use of steroids in children has been limited by the
observation that some steroid treatments have been reportedly
associated with growth retardation. Thus, according to the present
invention, the immunostimulatory nucleic acids can be used in
combination with growth retarding steroids, and can thereby provide
a "steroid sparing effect." The combination of the two agents can
result in lower required doses of steroids.
[0114] Corticosteroids are used long-term to prevent development of
the symptoms, and suppress, control, and reverse inflammation
arising from an initiator. Some corticosteroids can be administered
by inhalation and others are administered systemically. The
corticosteroids that are inhaled have an anti-inflammatory function
by blocking late-reaction allergen and reducing airway
hyper-responsiveness. These drugs also inhibit cytokine production,
adhesion protein activation, and inflammatory cell migration and
activation.
[0115] Corticosteroids include, but are not limited to,
beclomethasome dipropionate, budesonide, flunisolide, fluticaosone,
propionate, and triamcinoone acetonide. Although dexamethasone is a
corticosteroid having anti-inflammatory action, it is not regularly
used for the treatment of asthma/allergy in an inhaled form because
it is highly absorbed, it has long-term suppressive side effects at
an effective dose. Dexamethasone, however, can be used according to
the invention for the treating of asthma/allergy because when
administered in combination with immunostimulatory nucleic acids it
can be administered at a low dose to reduce the side effects.
Additionally, the immunostimulatory nucleic acid can be
administered to reduce the side effects of dexamethasone at higher
concentrations. Some of the side effects associated with
corticosteroid include cough, dysphonia, oral thrush (candidiasis),
and in higher doses, systemic-effects, such as adrenal suppression,
osteoporosis, growth suppression, skin thinning and easy bruising.
(Barnes & Peterson, Am. Rev. Respir. Dis.; 148:S1-S26, 1993;
and Kamada et al., Am. J. Respir. Crit. Care Med.; 153:1739-48,
1996)
[0116] Systemic corticosteroids include, but are not limited to,
methylprednisolone,
[0117] prednisolone and prednisone. Cortosteroids are used
generally for moderate to severe exacerbations to prevent the
progression, reverse inflammation and speed recovery. These
anti-inflammatory compounds include, but are hot limited to,
methylprednisolone, prednisolone, and prednisone. Cortosteroids are
associated with reversible abnormalities in glucose metabolism,
increased appetite, fluid retention, weight gain, mood alteration,
hypertension, peptic ulcer, and rarely asceptic necrosis of femur.
These compounds are useful for short-term (3-10 days) prevention of
the inflammatory reaction in inadequately-controlled persistent
asthma. They also function in a long-term prevention of symptoms in
severe persistent asthma to suppress and control- and actually
reverse inflammation. The side effects associated with systemic
corticosteroids are even greater than those associated with inhaled
corticosteroids. Side effects include, for instance, reversible
abnormalities in glucose metabolism, increased appetite, fluid
retention, weight gain, mood alteration, hypertension, peptic ulcer
and asceptic necrosis of femur, which are associated with
short-term use. Some side effects associated with longer term use
include adrenal axis suppression, growth suppression, dermal
thinning, hypertension, diabetes, Cushing's syndrome, cataracts,
muscle weakness, and in rare instances, impaired immune function.
It is recommended that these types of compounds be used at their
lowest effective dose (guidelines for the diagnosis and management
of asthma; expert panel report to; NIH Publication No. 97-4051;
July 1997). The inhaled corticosteroids are believed to function by
blocking late reaction to allergen and reducing airway
hyper-responsiveness. Their also believed to reverse
.beta..sub.2-receptor downregulation and to inhibit microvascular
leakage.
[0118] The immunomodulators include, but are not limited to, the
group consisting of anti-inflammatory agents, leukotriene
antagonists, IL-4 muteins, soluble IL-4 receptors,
immunosuppressants (such as tolerizing peptide vaccine), anti-IL-4
antibodies, IL-4 antagonists, anti-IL-5 antibodies, soluble IL-13
receptor-Fc fusion proteins, anti-IL-9 antibodies, CCR3
antagonists, CCR5 antagonists, VLA-4 inhibitors, and, and
downregulators of IgE.
[0119] Leukotriene modifiers are often used for long-term control
and prevention of symptoms in mild persistent asthma. Leukotriene
modifiers function as leukotriene receptor antagonists by
selectively competing for LTD-4 and LTE-4 receptors. These
compounds include, but are not limited to, zafirlukast tablets and
zileuton tablets. Zileuton tablets function as 5-lipoxygenase
inhibitors. These drugs have been associated with the elevation of
liver enzymes and some cases of reversible hepatitis and
hyperbilirubinemia. Leukotrienes are biochemical mediators that are
released from mast cells, eosinophils, and basophils that cause
contraction of airway smooth muscle and increase vascular
permeability, mucous secretions and activate inflammatory cells in
the airways of patients with asthma.
[0120] Other immunomodulators include neuropeptides that have been
shown, to have immunomodulating properties. Functional studies have
shown that substance P, for instance, can influence lymphocyte
function by specific receptor mediated mechanisms. Substance P also
has been shown to modulate distinct immediate hypersensitivity
responses by stimulating the generation of arachidonic acid-derived
mediators from mucosal mast cells. J. McGillies, et al., Substance
P and Immunoregulation, Fed. Proc. 46:196-9 (1987). Substance P is
a neuropeptide first identified in 1931 by Von Euler and Gaddum. An
unidentified depressor substance in certain tissue extracts, J.
Physiol. (London) 72:74-87 (1931). Its amino acid sequence,
Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH.sub.2 (Sequence Id.
No. 1) was reported by Chang et al. in 1971. Amino acid sequence of
substance P, Nature (London) New Biol. 232:86-87 (1971). The
immunoregulatory activity of fragments of substance P has been
studied by Siemion, et al. Immunoregulatory Activity of Substance P
Fragments, Molec. Immunol. 27:887-890 (1990).
[0121] Another class of compounds is the down-regulators of IgE.
These compounds include peptides or other molecules with the
ability to bind to the IgE receptor and thereby prevent binding of
antigen-specific IgE. Another type of downregulator of IgE is a
monoclonal antibody directed against the IgE receptor-binding
region of the human IgE molecule. Thus, one type of downregulator
of IgE is an anti-IgE antibody or antibody fragment. Anti-IgE is
being developed by Genentech. One of skill in the art could prepare
functionally active antibody fragments of binding peptides which
have the same function. Other types of IgE downregulators are
polypeptides capable of blocking the binding of the IgE antibody to
the Fc receptors on the cell surfaces and displacing IgE from
binding sites upon which IgE is already bound.
[0122] One problem associated with downregulators of IgE is that
many molecules don't have a binding strength to the receptor
corresponding to the very strong interaction between the native IgE
molecule and its receptor. The molecules having this strength tend
to bind irreversibly to the receptor. However, such substances are
relatively toxic since they can bind covalently and block other
structurally similar molecules in the body. Of interest in this
context is that the alpha chain of the IgE receptor belongs to a
larger gene family where i.e. several of the different IgG Fc
receptors are contained. These receptors are absolutely essential
for the defense of the body against i.e. bacterial infections.
Molecules activated for covalent binding are, furthermore, often
relatively unstable and therefore they probably have to be
administered several times a day and then in relatively high
concentrations in order to make it possible to block completely the
continuously renewing pool of IgE receptors on mast cells and
basophilic leukocytes.
[0123] These types of asthma/allergy medicaments are sometimes
classified as long-term control medications or quick-relief
medications. Long-term control medications include compounds such
as corticosteroids (also referred to as glucocorticoids),
methylprednisolone, prednisolone, prednisone, cromolyn sodium,
nedocromil, long-acting .beta..sub.2-agonists, methylxanthines, and
leukotriene modifiers. Quick relief medications are useful for
providing quick relief of symptoms arising from allergic or
asthmatic responses. Quick relief medications include short-acting
.beta..sub.2 agonists, anticholinergics and systemic
corticosteroids.
[0124] Chromolyn sodium and medocromil are used as long-term
control medications for preventing primarily asthma symptoms
arising from exercise or allergic symptoms arising from allergens.
These compounds are believed to block early and late reactions to
allergens by interfering with chloride channel function. They also
stabilize mast cell membranes and inhibit activation and release of
mediators from eosinophils and epithelial cells. A four to six week
period of administration is generally required to achieve a maximum
benefit.
[0125] Anticholinergics are generally used for the relief of acute
bronchospasm. These compounds are believed to function by
competitive inhibition of muscarinic cholinergic receptors.
Anticholinergics include, but are not limited to, ipratrapoium
bromide. These compounds reverse only cholinerigically-mediated
bronchospasm and do not modify any reaction to antigen. Side
effects include drying of the mouth and respiratory secretions,
increased wheezing in some individuals, blurred vision if sprayed
in the eyes.
[0126] In addition to standard asthma/allergy medicaments other
methods for treating asthma/allergy have been used either alone or
in combination with established medicaments. One preferred, but
frequently impossible, method of relieving allergies is allergen or
initiator avoidance. Another method currently used for treating
allergic disease involves the injection of increasing doses of
allergen to induce tolerance to the allergen and to prevent further
allergic reactions.
[0127] Allergen injection therapy (allergen immunotherapy) is known
to reduce the severity of allergic rhinitis. This treatment has
been theorized to involve the production of a different form of
antibody, a protective antibody which is termed a "blocking
antibody". Cooke, R A et al., Serologic Evidence of Immunity with
Coexisting Sensitization in a Type of Human Allergy, Exp. Med.
62-733 (1935). Other attempts to treat allergy involve modifying
the allergen chemically so that its ability to cause an immune
response in the patient is unchanged, while its ability to cause an
allergic reaction is substantially altered.
[0128] These methods, however, can take several years to be
effective and are associated with the risk of side effects such as
anaphylactic shock. The use of an immunostimulatory nucleic acid
and asthma/allergy medicament in combination with an allergen
avoids many of the side effects etc.
[0129] Commonly used allergy and asthma drugs which are currently
in development or on the market are shown in Tables 1 and 2
respectively.
2TABLE 1 Allergy Drugs in Development or on the Market BRAND NAME
MARKETER (GENERIC NAME) MECHANISM Schering- Claritin + Claritin D
(loratidine) Anti-histamine Plough Vancenase (beclomethasone)
Steroid UCB Reactine (cetirizine)(US) Anti-histamine Zyrtec
(cetirizine)(ex US) Longifene (buclizine) Anti-histamine UCB 28754
(ceterizine alalogue) Anti-histamine Glaxo Beconase (beclomethasone
Steroid Flonase (fluticasone) Steroid Aventis Allegra
(fexofenadine) Anti-histamine Seldane (terfenadine) Anti-histamine
Pfizer Reactine (cetirizine) (US) Anti-histamine Zyrtec/Reactine
(cetirizine)(ex US) (both licensed from UCB) Sepracor Allegra
(fexofenadine) Anti-histamine Desloratadine (lic to Schering-
Anti-histamine Plough) Cetirizine (-) (lic to UCB) Anti-histamine
Norastemizole (option to J&J not Anti-histamine exercised,
10-17-99) B. Ingelheim Alesion (epinastine) Anti-histamine Aventis
Kestin (ebastine) (US) Anti-histamine Bastel (ebastine) (Eu/Ger)
Nasacort (tramcinolone) Steroid Johnson & Hismanol (astemizole)
Anti-histamine Johnson Livostin/Livocarb (levocabastine)
Anti-histamine AstraZeneca Rhinocort (budesonide) (Astra) Steroid
Merck Rhinocort (budesonide) Steroid Eisai Azeptin (azelastine)
Anti-histamine Kissei Rizaben (tranilast) Anti-histamine Shionogi
Triludan (terfenadine). Anti-histamine S-5751 Prostaglandin inducer
Schwarz Zolim (mizolastine) Anti-histamine Daiichi Zyrtec
(cetirizine) Anti-histamine Tanabe Talion/TAU-284 (betatastine)
Anti-histamine Seiyaku Sankyo** CS 560 (Hypersensitizaion Other
therapy for cedar pollen allergy) Asta Medica Azelastine-MDPI
(azelastine) Anti-histamine BASF HSR 609 Anti-histamine SR Pharma
SRL 172 Immunomodulation Peptide Allergy vaccine (allergy
(hayfever, Downregulates Therapeutics anaphylaxis, atopic asthma)
specific IgE Tolerizing peptide vaccine (rye Immuno- grass peptide
(T cell epitope)) suppressant Coley CpG DNA Immunomodulation
Pharmaceutical Group Genetech Anti-IgE Down-regulator of IgE SR
Pharma SRL 172 Immunomodulation
[0130]
3TABLE 2 Asthma Drugs in Development or on the Market MARKETER
BRAND NAME (GENERIC NAME) MECHANISM Glaxo Serevent (salmeterol)
Bronchodilator/beta-2 agonist Flovent (fluticasone) Steroid
Flixotide (fluticasone) Becotide (betamethasone) Steroid Ventolin
(salbutamol) Bronchodilator/beta-2 agonist Seretide (salmeterol +
fluticasone) Beta agonist + steroid GW215864 Steroid, hydolysable
GW250495 Steroid, hydolysable GW328267 Adenosine A2 agonist
AstraZeneca Bambec (bambuterol) (Astra) Pulmicort (budesonide)
(Astra) Steroid Bricanyl Turbuhaler (terbutaline) (Astra)
Bronchodilator/beta-2 agonist Accolate (zafirlukast) (Zeneca)
Leukotriene antagonist Slo- Phyllin (theophylline) Inspiryl
(salbutamol) (Astra) Bronchodilator/beta-2 agonist Oxis Turbuhaler
(D2522/formoterol) Bronchodilator/beta-2 agonist Symbicort
(pulmicort-oxis combination) Steroid Roflepanide (Astra) Steroid
Bronica (seratrodast) TXA2 synthesis inhibitor ZD 4407 (Zeneca) 5
lipoxygenase inhibitor B. Ingelheim Atrovent (ipratropium)
Bronchodilator/anti- cholinergic Berodual (ipratropium + fenoterol)
Bronchodilator/anti- cholinergic Berotec (fenoterol)
Bronchodilator/beta-2 agonist Alupent (orciprenaline)
Bronchodilator/beta-2 agonist Ventilat (oxitropium)
Bronchodilator/anti- cholinergic Spiropent (clenbuterol)
Bronchodilator/beta-2 agonist Inhacort (flunisolide) Steroid
BI679/tiotropium bromide RPR 106541 Steroid BIIX 1 Potassium
channel BIIL284 LTB-4 antagonist Schering- Proventil (salbutamol)
Bronchodilator/beta-2 agonist Plough Vanceril (beclomethasone)
Steroid Mometasone furoate Steroid Theo-Dur (theophylline (w/Astra)
Uni-Dur (theophylline) Asmanex (mometasone) Steroid CDP 835 (lic
from Celltech) Anti-IL-5 Mab RPR Intal (disodium cromoglycate)
Anti-inflammatory (Aventis) Intal/Aarane (disodium cromoglycate)
Tilade (nedocromil sodium) Anti-inflammatory Azmacort
(triamcinolone acetonide) Steroid RP 73401 PDE-4 inhibitor Novartis
Zaditen (ketotifen) Anti-inflammatory Azmacort (triamcinolone)
Steroid Foradil (formoterol) (lic fromYamanouchi)
Bronchodilator/beta-2 agonist E25 Anti-IgE KCO 912 K+ channel
opener Merck Singulair (montelukast) Leukotriene antagonist
Pulmicort Turbuhaler (budesonide) Steroid Slo-Phyllin
(theophylline) Symbicort (Pulmicort-Oxis combination) Steroid Oxis
Turbuhaler (D2522/formoterol) Bronchodilator/beta-2 agonist
Roflepanide Steroid VLA-4 antagonist (lic from Biogen) VLA-4
antagonist ONO Onon (pranlukast) Leukotriene antagonist Vega
(ozagrel) TXA2 synthesis inhibitor Fujisawa Intal (chromoglycate)
Anti-inflammatory FK 888 Neurokin antagonist Forest Labs Aerobid
(flunisolide) Steroid IVAX Ventolin (salbutamol)
Bronchodilator/beta-2 agonist Becotide (beclomethasone
Easi-Breathe) Steroid Serevent (salmeterol) Bronchodilator/beta-2
agonist Flixotide (fluticasone) Steroid Budesonide Dry Powder
Inhaler Steroid Salbutamol Dry Powder Inhaler Bronchodilator/beta-2
agonist Alza Volmax (salbutamol) Bronchodilator/beta-2 agonist
Altana Euphyllin (theophylline) Xanthanine Ciclesonide Arachidonic
acid antagonist BY 217 PDE 4 inhibitor BY 9010N (ciclesonide)
Steroid (nasal) Tanabe Flucort (fluocinolone acetonide Steroid
Seiyaku Kissei Domenan (ozagrel) TXA2 synthesis inhibitor Abbott
Zyflo (zileuton) (4X/day dosing, not competitive w/ 5 lipoxygenase
inhibitor Singulair or Accolate, no further interest in this area)
Asta Medica Aerobec (beclomethasone dipropionate) (w/3M) Allergodil
(azelastine) Allergospasmin (sodium cromoglycate reproterol)
Bronchospasmin (reproterol) Salbulair (salbutamol sulphate) (w/3M)
TriNasal (triamcinolone) Steroid Formoterol-MDPI Beta 2
adrenoceptor agonist Budesonide-MDPI UCB Atenos/Respecal
(tulobuerol) Bronchodilator/beta-2 agonist Recordati Theodur
(theophylline) Xanthine Medeva Clickhalers Asmasal, Asmabec
(salbutamol Steroid beclomethasone diproprionate, dry inhaler)
Eisai E 6123 PAF receptor antagonist Sankyo Zaditen (ketotifen)
Anti-inflammatory CS 615 Leukotriene antagonist Shionogi Anboxan/S
1452 (domitroban) Thromboxin A2 receptor antagonist Yamanouchi YM
976 PDE 4 inhibitor YM 158 Leukotriene D4/thromboxan 2 dual
antagonist 3M Pharma Exirel (pirbuterol) Hoechst Autoinhalers (3M
albuterol projects) Bronchodilator/beta-2 agonist (Aventis)
SmithKline Ariflo PDE-4 inhibitor Beecham SB 240563 Anti-IL5 MAb
(humanized) SB 240683 Anti-IL4 Mab IDEC 151/clenoliximab Anti-CD4
MAb, primatised Roche Anti-IgE(GNE)/CGO51901 Down-regulator of IgE
Sepracor Fomoterol (R,R) Beta 2 adrenoceptor agonist Xopenex
(levalbuterol) Bet 2 adrenoceptor agonist Bayer BAY U 3405
(ramatroban) Thromboxane A2 antagonist BAY 16-9996 (once monthly
dosing) IL4 mutein BAY 19-8004 PDE-4 inhibitor SR Pharma SRL 172
Immunomodulation Immunex Nuvance Soluble IL-4 receptor
(immunomodulator) Biogen Anti-VLA-4 Immunosuppressant Vanguard VML
530 Inhibitor of 5-lipox activation protein Recordati Respix
(zafirlukast) Leukotriene antagonist Genentech Anti-IgE MAb
Down-regulator of IgE Warner CI-1018 PDE 4 inhibitor Lambert
Celltech/ CDP 835/SCH 55700 (anti-IL-5) (lic to Schering- IL-5
antagonist Mab Chiroscience Plough) D 4418 (w/Schering-Plough) PDE
4 inhibitor CDP 840 (Celltech) PDE 4 inhibitor AHP Pda-641 (asthma
steroid replacement) Peptide RAPID Technology Platform Protease
inhibitors Therapeutics Coley CpG DNA Immunomodulation
Pharmaceutical Group
[0131] In some cases the subject is exposed to an allergen in
addition to being treated with the immunostimulatory nucleic acid
and the asthma/allergy medicament. In this case the subject is said
to be exposed to the allergen. As used herein, the term "exposed
to" refers to either the active step of contacting the subject with
an allergen or the passive exposure of the subject to the allergen
in vivo. Methods for the active exposure of a subject to an
allergen are well-known in the art. In general, an allergen is
administered directly to the subject by any means such as
intravenous, intramuscular, oral, transdermal, mucosal, intranasal,
intratracheal, or subcutaneous administration. The allergen can
be-administered systemically or locally. Methods for administering
the allergen and the immunostimulatory nucleic acid/asthma/allergy
medicament are described in more detail below. A subject is
passively exposed to an allergen if an allergen becomes available
for exposure to the immune cells in the body. A subject may be
passively exposed to an allergen, for instance, by entry of an
allergen into the body when the allergen is present in the
environment surrounding the subject, i.e. pollen.
[0132] The methods in which a subject is passively exposed to an
allergen can be particularly dependent on timing of administration
of the immunostimulatory nucleic acid and the asthma/allergy
medicament. For instance, in a subject at risk of developing an
allergic or asthmatic response, the subject may be administered the
immunostimulatory-nucleic acid and the asthma/allergy medicament on
a regular basis when that risk is greatest, i.e., during pollen
allergy season. Additionally the immunostimulatory nucleic acid and
the asthma/allergy medicament may be administered to travelers
before they travel to a destination where they are at risk of
exposure to a particular allergen.
[0133] As used herein, the term "prevent", "prevented", or
"preventing" when used with respect to the treatment of an allergic
or asthmatic disorder refers to a prophylactic treatment which
increases the resistance of a subject to an allergen or initiator
or, in other words, decreases the likelihood that the subject will
develop an allergic or asthmatic response to the allergen or
initiator as well as a treatment after the allergic or asthmatic
disorder has begun in order to fight the allergy/asthma, e.g.,
reduce or eliminate it altogether or prevent it from becoming
worse.
[0134] The term "substantially purified" as used herein refers to a
molecular species which is substantially free of other proteins,
lipids, carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify allergenic
polypeptides using standard techniques for protein purification.
The substantially pure polypeptide will often yield a single major
band on a non-reducing polyacrylamide gel. In the case of partially
glycosylated polypeptides or those that have several start codons,
there may be several bands on a non-reducing polyacrylamide gel,
but these will form a distinctive pattern for that polypeptide. The
purity of the allergenic polypeptide can also be determined by
amino-terminal amino acid sequence analysis.
[0135] The allergen and/or polypeptide asthma/allergy medicament
may be in the form of a polypeptide when administered to the
subject or it may be encoded by a nucleic acid vector. If the
nucleic acid vector is administered to the subject the protein is
expressed in vivo. Minor modifications of the primary amino acid
sequences of polypeptide allergens may also result in a polypeptide
which has substantially equivalent allergenic activity as compared
to the unmodified counterpart polypeptide. Such modifications may
be deliberate, as by site-directed mutagenesis, or may be
spontaneous.
[0136] The nucleic acid encoding the allergen or asthma/allergy
medicament is operatively linked to a gene expression sequence
which directs the expression of the protein within a eukaryotic
cell. The "gene expression sequence" is any regulatory-nucleotide
sequence, such as a promoter sequence or promoter-enhancer
combination, which facilitates the efficient transcription and
translation of the protein which it is operatively linked. The gene
expression sequence may, for example, be a mammalian or viral
promoter, such as a constitutive or inducible promoter.
Constitutive mammalian promoters include, but are not limited to,
the promoters for the following genes: hypoxanthine phosphoribosyl
transferase-(HPTR), adenosine deaminase, pyruvate kinase, b-actin
promoter and other constitutive promoters. Exemplary viral
promoters which function constitutively in eukaryotic cells
include, for example, promoters from the cytomegalovirus (CMV),
simian virus (e.g., SY40), papilloma virus, adenovirus, human
immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus,
the long terminal repeats (LTR) of Moloney leukemia virus and other
retroviruses, and the thymidine kinase promoter of herpes simplex
virus. Other constitutive promoters are known to those of ordinary
skill in the art. The promoters useful as gene expression sequences
of the invention also include inducible promoters. Inducible
promoters are expressed in the presence of an inducing agent. For
example, the metallothionein promoter is induced to promote
transcription and translation in the presence of certain metal
ions. Other inducible promoters are known to those of ordinary
skill in the art.
[0137] In general, the gene expression sequence shall include, as
necessary, 5' non-transcribing and 5' non-translating sequences
involved with the initiation of transcription and translation,
respectively, such as a TATA box, capping sequence, CAAT sequence,
and the like. Especially, such 5' non-transcribing sequences will
include a promoter region which includes a promoter sequence for
transcriptional control of the operably joined antigen nucleic
acid. The gene expression sequences optionally include enhancer
sequences or upstream activator sequences as desired.
[0138] As used herein, the nucleic acid sequence encoding the
protein and the gene expression sequence are said to be "operably
linked" when they are covalently linked in such a way as to place
the expression or transcription and/or translation of the antigen
coding sequence under the influence or control of the gene
expression sequence. Two DNA sequences are said to be operably
linked if induction of a promoter in the 5' gene expression
sequence results in the transcription of the gene sequence and if
the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the antigen sequence, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a gene expression sequence would be operably linked
to a; specific nucleic acid sequence if the gene expression
sequence were capable of effecting transcription of that nucleic
acid sequence such that the resulting transcript is translated into
the desired-protein or polypeptide.
[0139] The immunostimulatory nucleic acids may also be delivered to
the subject in the form of a plasmid vector. In some embodiments,
one plasmid vector could include both the immunostimulatory nucleic
acid and a nucleic acid encoding a protein asthma/allergy
medicament and/or an allergen. In other embodiments, separate
plasmids could be used. In yet other embodiments, no plasmids could
be used.
[0140] The compositions of the invention-may be delivered to the
immune system or other target cells alone or in association with a
vector. In its broadest sense, a "vector" is any vehicle capable of
facilitating the transfer of the compositions to the target cells.
The vector generally transports the nucleic acid to the immune
cells with reduced degradation relative to the extent of
degradation that would result in the absence of the vector.
[0141] In general, the vectors useful in the invention are divided
into two classes: biological vectors and chemical/physical vectors.
Biological vectors and chemical/physical vectors are useful for
delivery/uptake of nucleic acids, asthma/allergy medicaments,
and/or allergens to/by a target cell.
[0142] Biological vectors include, but are not limited to,
plasmids, phagemids, viruses, other vehicles derived from viral or
bacterial sources that have been manipulated by the insertion or
incorporation of nucleic acid sequences, and free nucleic acid
fragments which can be attached to nucleic acid sequences. Viral
vectors are a preferred type of biological vector and include, but
are not limited to, nucleic acid sequences from the following
viruses: retroviruses, such as: Moloney murine leukemia-virus;
Harvey murine sarcoma virus; murine mammary tumor virus; Rous
sarcoma virus; adenovirus; adeno-associated virus; SV40-type
viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses;
herpes viruses; vaccinia viruses; polio viruses; and RNA viruses
such as any retrovirus. One can readily employ other viral vectors
not named but known in the art.
[0143] Preferred viral vectors are based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with a nucleic acid of interest. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. Retroviruses have been
approved for human gene therapy trials. In general, the
retroviruses are replication-deficient (i.e., capable of directing
synthesis of the desired proteins, but incapable of manufacturing
an infectious particle). Such genetically altered retroviral
expression vectors have general utility for the high-efficiency
transduction of genes in vivo. Standard protocols for producing
replication-deficient retroviruses (including the steps of
incorporation of exogenous genetic material into a plasmid,
transfection of a packaging cell lined with plasmid, production of
recombinant retroviruses by the packaging cell line, collection of
viral particles from tissue culture media, and infection of the
target cells with viral particles) are provided in Kriegler, M.,
"Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman
Co., New-York (1990) and Murry, E. J. Ed. "Methods in Molecular
Biology," vol. 7, Humana Press, Inc., Cliffton, N.J. (1991).
[0144] Another preferred virus for certain applications is the
adeno-associated virus, a double-stranded DNA virus. The
adeno-associated virus can be engineered to be
replication-deficient and is capable of infecting a wide range of
cell types and species. It further has advantages, such as heat and
lipid solvent stability; high transduction frequencies in cells of
diverse lineages; and lack of superinfection inhibition thus
allowing multiple series of transductions. Reportedly, the
adeno-associated virus can integrate into human insertional
mutagenesis and variability of inserted gene expression. In
addition, wild-type adeno-associated virus infections have been
followed in tissue culture for greater than 100 passages in the
absence of selective pressure, implying that the adeno-associated
virus genomic integration is a relatively stable event. The
adeno-associated virus can also function in an extrachromosomal
fashion.
[0145] Other biological vectors include plasmid vectors. Plasmid
vectors have been extensively described in the art and are
well-known to those of skill in the art. See e.g., Sambrook et al.,
"Molecular Cloning: A Laboratory Manual," Second Edition, Cold
Spring Harbor Laboratory Press, 1989. In the last few years,
plasmid vectors have been found to be particularly advantageous for
delivering genes to cells in vivo because of their inability to
replicate within and integrate into a host genome. These plasmids,
however, having a promoter compatible with the host cell, can
express a peptide from a gene operatively encoded within the
plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19,
pRC/CMV, SV40, and pBlueScript. Other plasmids are well-known to
those of ordinary skill in the art. Additionally, plasmids may be
custom designed using restriction enzymes and ligation reactions to
remove and add specific fragments of DNA.
[0146] It has recently been discovered that gene carrying plasmids
can be delivered to the immune system using bacteria. Modified
forms of bacteria such as Salmonella can be transfected with the
plasmid and used as delivery vehicles. The bacterial delivery
vehicles can be administered to a host subject orally or by other
administration means. The bacteria deliver the plasmid to immune
cells, e.g. B cells, dendritic cells, likely by passing through the
gut barrier. High levels of immune protection have been established
using this methodology. Such methods of delivery are useful for the
aspects of the invention utilizing systemic delivery of allergen,
immunostimulatory nucleic acid and/or other therapeutic agent.
[0147] In addition to the biological vectors, chemical/physical
vectors may be used to deliver a nucleic acid, asthma/allergy
medicament, and/or allergen to a target cell and facilitate uptake
thereby. As used herein, a "chemical/physical vector" refers to a
natural or synthetic molecule, other than those derived from
bacteriological or viral sources, capable of delivering the nucleic
acid, asthma/allergy medicament, and/or allergen to a cell.
[0148] A preferred chemical/physical vector of the invention is a
colloidal dispersion system. Colloidal dispersion systems include
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes. A preferred colloidal system of the,
invention is a liposome. Liposomes are artificial membrane vessels
which are useful as a delivery vector in vivo or in vitro. It has
been shown that large unilamellar vessels (LUV), which range in
size from 0.2-4.0 .mu.m can encapsulate large macromolecules. RNA,
DNA, and intact virions can be encapsulated within the aqueous
interior and be delivered to cells in a biologically active form
(Fraley, et al., Trends Biochem. Sci., (1981) 6:77).
[0149] Liposomes may be targeted to a particular tissue by coupling
the liposome to a specific ligand such as a monoclonal antibody,
sugar, glycolipid, or protein. Ligands which may be useful for
targeting a liposome to an immune cell include, but are not limited
to: intact or fragments of molecules which interact with immune
cell specific receptors and molecules, such as antibodies, which
interact with the cell surface markers of immune cells. Such
ligands may easily be identified by binding assays well known to
those of skill in the art. Additionally, the vector may be coupled
to a nuclear targeting peptide, which will direct the vector to the
nucleus of the host cell.
[0150] Lipid formulations for transfection are commercially
available from QIAGEN, for example, as EFFECTENE.TM. (a
non-liposomal lipid with a special DNA condensing enhancer) and
SUPERFECT.TM. (a novel acting dendrimeric technology).
[0151] Liposomes are commercially available from Gibco BRL, for
example, as LIPOFECTIN.TM. and LIPOFECTACE.TM., which are formed of
cationic lipids such as N-[1-(2, 3 dioleyloxy)-propyl]-N,N,
N-trimethylammonium chloride (DOTMA) and dimethyl
dioctadecylammonium bromide (DDAB). Methods for making liposomes
are well known in the art and have been described in many
publications. Liposomes also have been reviewed by Gregoriadis, G.
in Trends in Biotechnology, (1985) 3:235-241.
[0152] In one embodiment, the vehicle is a biocompatible
microparticle or implant that is suitable for implantation or
administration to the mammalian recipient. Exemplary bioerodible
implants that are useful in accordance with this method are
described in PCT International application no. PCT/US/03307
(Publication No. WO95/24929, entitled "Polymeric Gene Delivery
System". PCT/US/0307 describes a biocompatible, preferably
biodegradable polymeric matrix for containing an exogenous gene
under the control of an appropriate promoter. The polymeric matrix
can be used to achieve sustained release of the exogenous gene in
the patient.
[0153] The polymeric matrix preferably is in the form of a
microparticle-such as a microsphere (wherein the a nucleic acid,
asthma/allergy medicament, and/or allergen is dispersed throughout
a solid polymeric matrix) or a microcapsule (wherein the a nucleic
acid, asthma/allergy medicament, and/or allergen is stored in the
core of a polymeric shell). Other forms of the polymeric matrix for
containing the a nucleic acid, asthma/allergy medicament, and/or
allergen include films, coatings, gels, implants, and stents. The
size and composition of the polymeric matrix device is selected to
result in favorable release kinetics in the tissue into which the
matrix is introduced. The size of the polymeric matrix further is
selected according to the method of delivery which is to be used,
typically injection into a tissue or administration of a suspension
by aerosol into the nasal and/or pulmonary areas. Preferably when
an aerosol route is used the polymeric matrix and the nucleic acid,
asthma/allergy medicament, and/or allergen are encompassed in a
surfactant vehicle. The polymeric matrix composition can be
selected to have both favorable degradation rates and also to be
formed of a material which is bioadhesive, to further increase the
effectiveness of transfer when the matrix is administered to a
nasal and/or pulmonary surface that has sustained an injury. The
matrix composition also can be selected not to degrade, but rather,
to release by diffusion over an extended period of time.
[0154] In another embodiment the chemical/physical vector is a
biocompatible microsphere that is suitable for delivery, such as
oral or mucosal delivery. Such microspheres are disclosed in
Chickering et al., Biotech. And Bioeng., (1996) 52:96-101 and
Mathiowitz et al., Nature, (1997) 386:410-414 and PCT Patent
Application WO97/03702.
[0155] Both non-biodegradable and biodegradable polymeric matrices
can be-used to deliver the nucleic acid, asthma/allergy medicament,
and/or allergen to the subject. Biodegradable matrices are
preferred. Such polymers may be natural or synthetic polymers. The
polymer is selected based on the period of time over which release
is desired, generally in the order of a few hours to a year or
longer. Typically, release over a period ranging from between a few
hours and three to twelve months is most desirable. The polymer
optionally is in the form of a hydrogel that can absorb up to about
90% of its weight in water and further, optionally is cross-linked
with multi-valent ions or other polymers.
[0156] Bioadhesive polymers of particular interest include
bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and
J. A. Hubell in Macromolecules, (1993) 26:581-587, the teachings of
which are incorporated herein, polyhyaluronic acids, casein,
gelatin, glutin, polyanhydrides, polyacrylic acid, alginate,
chitosan, poly(methyl methacrylates), poly(ethyl methacrylates),
poly(butylmethacrylate), poly(isobutyl methacrylate),
poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl
methacrylate), poly(phenyl methacrylate), poly(methyl acrylate),
poly(isopropyl acrylate), poly(isobutyl acrylate), and
poly(octadecyl acrylate).
[0157] Compaction agents also can be used alone, or in combination
with, a biological or chemical/physical vector. A "compaction
agent", as used herein, refers to an agent, such as a histone, that
neutralizes the negative charges on the nucleic acid and thereby
permits compaction of the nucleic acid into a fine granule.
Compaction of the nucleic acid facilitates the uptake of the
nucleic acid by the target cell. The compaction agents can be used
alone, i.e., to deliver a nucleic acid in a form that is more
efficiently taken up by the cell or, more preferably, in
combination with one or more of the above-described vectors.
[0158] Other exemplary compositions that can be used to facilitate
uptake by a target cell of the nucleic acid, asthma/allergy
medicament, and/or allergen include calcium phosphate and other
chemical mediators of intracellular transport, microinjection
compositions, electroporation and homologous recombination
compositions (e.g., for integrating a nucleic acid into a
preselected location within the target cell chromosome).
[0159] The immunostimulatory nucleic acid and/or the asthma/allergy
medicament the antigen and/or other therapeutics may be
administered alone (e.g. in saline or buffer) or using any delivery
vectors known in the art. For instance the following delivery
vehicles have been described: Cochleates (Gould-Fogerite et al.,
1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997);
ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998,
Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et
al., 1989, 1992, de-Haan 1995a, 1995b); Live bacterial vectors
(e.g., Salmonella, Escherichia coli, Bacillus calmatte-guerin,
Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998,
Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998);
Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex)
(Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al.,
1998, Flexner et al., 1988, Morrow et al., 1999), Microspheres
(Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore
et al., 1995, O'Hagan et al., 1994, Eldridge et al., A989); Nucleic
acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et
al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g.
carboxymethylcellulose, chitosan) (Hamajima et al., 1998,
Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998);
Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996,
1997); Sodium Fluoride (Hashi et al., 1998); Transgenic plants
(Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995);
Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al.,
1998); Virus-like particles (Jiang et al., 1999, Leibi et al.,
1998).
[0160] The immunostimulatory nucleic acid and asthma/allergy
medicament can be combined with other therapeutic agents such as
adjuvants to enhance immune responses even further. The
immunostimulatory nucleic acid, asthma/allergy medicament and other
therapeutic agent may be administered simultaneously or
sequentially. When the other therapeutic agents are administered
simultaneously they can be administered in the same or separate
formulations, but are administered at the same time. The other
therapeutic agents are administered sequentially with one another
and with the immunostimulatory nucleic acid and asthma/allergy
medicament, when the administration of the other therapeutic agents
and the immunostimulatory-nucleic acid and asthma/allergy
medicament is temporally separated. The separation in time between
the administration of these compounds may be a matter of minutes or
it may be longer. Other therapeutic agents include but are not
limited to non-nucleic acid adjuvants, cytokines, antibodies,
antigens, etc.
[0161] A "non-nucleic acid adjuvant" is any molecule or compound
except for the immunostimulatory nucleic acids described herein
which can stimulate the humoral and/or cellular immune response.
Non-nucleic acid adjuvants include, for instance, adjuvants that
create a depo effect, immune stimulating adjuvants, adjuvants that
create a depo effect and stimulate the immune system and mucosal
adjuvants.
[0162] An "adjuvant that creates a depo effect" as used herein is
an adjuvant that causes an antigen or allergen to be slowly
released in the body, thus prolonging the exposure of immune cells
to the antigen or allergen. This Class of adjuvants includes but is
not limited to alum (e.g., aluminum hydroxide, aluminum phosphate);
or emulsion-based formulations including mineral oil, non-mineral
oil, water-in-oil or oil-in-water-in oil emulsion, oil-in-water
emulsions such as Seppic ISA series of Montanide adjuvants (e.g.,
Montanide ISA 720, AirLiquide, Paris, France); MF-59 (a
squalene-in-water emulsion stabilized with Span 85 and Tween 80;
Chiron Corporation, Emeryville, Calif.; and PROVAX (an oil-in-water
emulsion containing a stabilizing detergent and a micelle-forming
agent; IDEC, Pharmaceuticals Corporation, San Diego, Calif.).
[0163] An "immune stimulating adjuvant" is an adjuvant that causes
activation of a cell of the immune system. It may, for instance,
cause an immune cell to produce and secrete cytokines. This class
of adjuvants includes but is not limited to saponins purified from
the bark of the Q. saponaria tree, such as QS21 (a glycolipid that
elutes in the 21.sup.st peak with HPLC fractionation; Aquila
Biopharmaceuticals, Inc., Worcester, Mass.);
poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus
Research Institute, USA); derivatives of lipopolysaccharides such
as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) andthreonyl-muramyl
dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related
to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania
elongation factor (a purified Leishmania protein; Corixa
Corporation, Seattle, Wash.).
[0164] "Adjuvants that create a depo effect and stimulate the
immune system" are those compounds which have both of the
above-identified functions. This class of adjuvants includes but is
not limited to ISCOMS (Immunostimulating complexes which contain
mixed saponins, lipids and form virus-sized particles with pores
that can hold antigen; CSL, Melbourne, Australia); SB-AS2
(SmithKline Beecham adjuvant system #2 which is an oil-in-water
emulsion containing MPL and QS21: SmithKline Beecham Biologicals
[SBB], Rixensart, Belgium); SB-AS4 (SmithKline Beecham adjuvant
system #4 which contains alum and MPL; SBB, Belgium); non-ionic
block copolymers that form micelles such as CRL 1005 (these contain
a linear chain of hydrophobic polyoxpropylene flanked by chains of
polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant
Formulation (SAF, an oil-in-water emulsion containing Tween 80 and
a nonionic block copolymer; Syntex Chemicals, Inc., Boulder,
Colo.).
[0165] A "non-nucleic acid mucosal adjuvant" as used herein is an
adjuvant-other than an immunostimulatory nucleic acid that is
capable of inducing a mucosal immune response in a subject when
administered to a mucosal surface in conjunction with an antigen or
allergen. Mucosal adjuvants include but are not limited to
Bacterial toxins: e.g., Cholera toxin (CT), CT derivatives
including but not limited to CT B subunit (CTB) (Wu et al., 1998,
Tochikubo et al., 1998); CTD53 (Val to Asp) (Fontana et al., 1995);
CTK97 (Val to Lys) (Fontana et al., 1995); CTK104 (Tyr to Lys)
(Fontana et al., 1995); CTD53/K63 (Val to Asp, Ser to Lys) (Fontana
et al., 1995); CTH54 (Arg to His) (Fontana et al., 1995);
CTN.sub.1O.sub.7 (His to Asn) (Fontana et al., 1995); CTE1 14 (Ser
to Glu) (Fontana et al., 1995); CTE1 12K (Glu to Lys) (Yamamoto et
al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al., 1997a, 1997b);
CTS106 (Pro to Lys) (Douce et al., 1997, Fontana et al. 1995); and
CTK63 (Ser to Lys) (Douce et al., 1997, Fontana et al., 1995),
Zonula occludens toxin, zot, Escherichia coli heat-labile
enterotoxin, Labile Toxin (LT), LT derivatives including but not
limited to LT B subunit (LTB) (Verweij et al., 1998); LT7K (Arg to
Lys) (Komase et al., 1998, Douce et al., 1995); LT61F (Ser to Phe)
(Komase et al., 1998); LT1 12K (Glu to Lys) (Komase et al., 1998);
LT118E (Gly to Glu) (Komase et al., 1998); LT146E (Arg to Glu)
(Komase et al., 1998); LT192G (Arg to Gly) (Komase et al., 1998);
LTK63 (Ser to Lys) (Marchetti et al., 1998, Douce et al., 1997,
1998, Di Tommaso et al., 1996); and LTR72 (Ala to Arg) (Giuliani et
al., 1998), Pertussis toxin, PT. (Lycke et al., 1992, Spangler B D,
1992, Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et
al., 1995) including PT-9K/129G (Roberts et al., 1995, Cropley et
al., 1995); Toxin derivatives (see below) (Holmgren et al., 1993,
Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements,
1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL)
(Sasaki et al. 1998, Vancott et al., 1998; Muramyl Dipeptide (MDP)
derivatives (Fukushima et al., 1996, Ogawa et al., 1989, Michalek
et al., 1983, Morisaki et al., 1983); Bacterial outer membrane
proteins (e.g., outer surface protein A (OspA) lipoprotein of
Borrelia burgdorferi, outer membrane protine of Neisseria
meningitidis)(Marinaro et al., 1999, Van de Verg et al., 1996);
Oil-in-water emulsions (e.g., MF59) (Barchfield et al., 1999,
Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka et
al., 1998, 1999); and Saponins (e.g., QS21) Aquila
Biopharmaceuticals, Inc., Worster, Mass.) (Sasaki et al., 1998,
MacNeal-et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants
(e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an
oil-in-water emulsion containing a stabilizing detergent and a
micell-forming agent; IDEC Pharmaceuticals Corporation, San Diego,
Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc.,
Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP
polymer; Virus Research Institute, USA) and Leishmania elongation
factor (Corixa Corporation, Seattle, Wash.).
[0166] Immune responses can also be induced or augmented by the
co-administration or co-linear expression of cytokines (Bueler
& Mulligan, 1996; Chow et al., 1997; Geissler et. al., 1997;
Iwasaki et al., 1997; Kim et al., 1997) or B-7 co-stimulatory
molecules (Iwasaki et al., 1997; Tsuji et al., 1997) with the
immunostimulatory nucleic acids and asthma/allergy medicaments. The
cytokines can be administered directly with immunostimulatory
nucleic acids or may be administered in the form of a nucleic acid
vector that encodes the cytokine, such that the cytokine can be
expressed in vivo. In one embodiment, the cytokine is administered
in the form of a plasmid expression vector. The term "cytokine" is
used as a generic name for a diverse group of soluble proteins and
peptides which act as humoral regulators at nano- to picomolar
concentrations and which, either under normal- or pathological
conditions, modulate the functional activities of individual cells
and tissues. These proteins also mediate interactions between cells
directly and regulate processes taking place in the extracellular
environment. Examples of cytokines include, but are not limited to
IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15,
IL-18-granulocyte-macrophage colony stimulating factor (GM-CSF);
granulocyte colony stimulating factor (GCSF), interferon-.gamma.
(.gamma.-IFN), IFN-a, tumor necrosis factor (TNF), TGF-.beta.,
FLT-3 ligand, and CD40 ligand. Cytokines play a role in directing
the T cell response. Helper (CD4+) T cells orchestrate the immune
response of mammals through production of soluble factors that-act
on other immune system cells, including other T cells. Most mature
CD4+ T helper cells express one of two cytokine profiles: Th1 or
Th2. In some embodiments it is preferred that the cytokine be a Th1
cytokine.
[0167] The term "effective amount" of an immunostimulatory nucleic
acid and an asthma/allergy medicament refers to the amount
necessary or sufficient to realize a desired biologic effect. For
example, an effective amount of an immunostimulatory nucleic acid
and an asthma/allergy medicament for treating or preventing asthma
or preventing is that amount necessary, to prevent the development
of IgE in response to an allergen or initiator upon exposure to the
allergen or initiator is that amount necessary to cause the shift
from Th2 to Th1 response in response to an allergen or
initiator.
[0168] Combined with the teachings provided herein, by choosing
among the various active compounds and weighing factors such as
potency, relative bioavailability, patient body weight, severity of
adverse side-effects and preferred mode of administration, an
effective prophylactic or therapeutic treatment regimen can be
planned which does not cause substantial toxicity and yet is
entirely effective to treat the particular subject. The effective
amount for any particular application can vary depending on such
factors as the disease or condition being treated, the particular
immunostimulatory nucleic acid or asthma/allergy medicament being
administered (e.g. the type of nucleic acid, i.e. a CpG nucleic
acid, the number of unmethylated CpG motifs or their location in
the nucleic acid, the degree of modification of the backbone to the
oligonucleotide the type of medicament), the size of the subject,
or the severity of the disease or condition. One of ordinary skill
in the art can empirically determine the effective amount of a
particular-immunostimulatory nucleic acid and/or asthma/allergy
medicament and/or other therapeutic agent without necessitating
undue experimentation.
[0169] Depending upon the aspect of the invention, the
immunostimulatory nucleic acid and asthma/allergy medicament may be
administered in a: synergistic amount effective to treat or prevent
asthma or allergy. A synergistic amount is that amount which
produces a physiological response that is greater than the sum of
the individual effects of either the immunostimulatory nucleic acid
or the asthma/allergy medicament alone. For instance, in some
embodiments of the invention, the physiological effect is a
reduction in IgE levels. A synergistic amount is that amount which
produces a reduction in IgE that is greater than the sum of the IgE
reduced by either the immunostimulatory nucleic acid or the
asthma/allergy medicament alone. In other embodiments, the
physiological result is a shift from Th2 cytokines, such as IL-4
and Il-5, to Th1 cytokines, such as IFN-.gamma. and IL-12. The
synergistic amount in this case is that-amount which produces the
shift to a Th1 cytokine that is greater than the sum of the shift
produced by either the immunostimulatory nucleic acid or the
asthma/allergy medicament alone. In other embodiments the
physiological result is a decrease in eosinophilia,
hyperreactivity, or lung function.
[0170] In some embodiments of the invention, the immunostimulatory
nucleic acid is administered in an effective amount for preventing
bacterial or viral infection. Immunostimulatory nucleic acids are
known to be useful for preventing bacterial and viral infections.
Bacterial and viral infections exacerbate and/or induce allergy
and/or asthma. In this aspect of the invention, the
immunostimulatory nucleic acid is administered to the subject in an
amount effective to prevent bacterial and viral infection and the
asthma/allergy medicament is administered to the subject when
symptoms of allergy or asthma appear. Thus, the immunostimulatory
nucleic acid is administered to the subject and then the
asthma/allergy medicament is subsequently administered to the
subject or they are administered together at the same time. This
method is particularly useful in subjects such as children and
immunocompromised subjects, or elderly subjects, who are
particularly susceptible to bacterial or viral disease.
[0171] In aspects of the invention directed at treating subjects in
anticipation of an asthmatic or allergic event or season (e.g., in
anticipation of the hay-fever season), the subjects may be
administered an immunostimulatory nucleic acid in an effective
amount for preventing the asthma or allergy. In related embodiments
of this method, an asthma/allergy medicament is also administered
to the subject. In these latter instances, the amount of the
immunostimulatory nucleic acid administered may be that amount
necessary to reduce the effective dose of the asthma/allergy
medicament which is required to treat or prevent the asthma or
allergy.
[0172] Thus, in these embodiments, the immunostimulatory nucleic
acid potentiates the effect of the asthma/allergy medicament. The
ability to potentiate the effect of an asthma/allergy medicament is
useful since it allows for a reduction in the administered dose of
an asthma/allergy medicament with the same or better therapeutic
result. As an example, if the dose of the medicament is lowered,
then so too are the side-effects of the medicament such as, for
example, drowsiness, nervousness, dizziness or, in some instances,
sleeplessness. Similarly, the administration of a lowered dose of
the asthma/allergy medicament may make the medicament more
compatible with the administration of other medicaments such as
those which are currently not simultaneously prescribed or
administered with asthma or allergy medicaments. In some instances,
these include certain medicaments which are prescribed for
depression, psychiatric or emotional conditions or Parkinson's
disease and which contain monoamine oxidase inhibitor (MAOI).
Similarly, the ability to potentiate the effect of the
asthma/allergy medicament, thereby leading to a decreased effective
dose, is useful for treating a wide range of subjects who have
previously been contraindicated for such treatment, including
subjects with heart disease or diabetes, subjects who have
difficulty in urinating due to prostate gland enlargement, and
subjects who are pregnant or who are nursing (i.e.,
breast-feeding). Thus, the invention provides a method for
administering to a subject a dose of an asthma/allergy medicament
which if administered alone, or if administered without previous
administration of an immunostimulatory nucleic acid to the same
subject, would be ineffective (and would be considered
sub-therapeutic).
[0173] Subject doses of the compounds described herein typically
range from about 0.1 .mu.g to 10,000 mg, more typically from about
1 .mu.g/day to 8000 mg, and most typically from about 10 .mu.g to
100 .mu.g. Stated in terms of subject body weight, typical dosages
range from about 0.1 .mu.g to 20 mg/kg/day, more typically from
about 1 to 0.10 mg/kg/day, and most typically from about 1 to 5
mg/kg/day.
[0174] In some instances, a sub-therapeutic dosage of the
immunostimulatory nucleic acid and the asthma/allergy medicament
are used. It has been discovered according to the invention, that
when the two classes of drugs are used together, they can be
administered in sub-therapeutic doses and still produce a desirable
therapeutic-result, a "sub-therapeutic dose" as used herein refers
to a dosage which is less than that dosage which would produce a
therapeutic result in the subject, if administered alone. Thus, the
sub-therapeutic dose of an asthma/allergy medicament is one which
would not produce the desired therapeutic result in the subject.
Therapeutic doses of asthma/allergy medicaments are well known in
the field of medicine for the treatment of asthma and allergy.
These dosages have been extensively described in references such as
Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as
many other medical references relied upon by the medical profession
as guidance for the treatment of asthma and allergy. Therapeutic
dosages of immunostimulatory nucleic acids, have also been
described in the art and methods for identifying therapeutic
dosages in subjects are described in more detail above.
[0175] In other aspects, the method of the invention involves
administering a high dose of an asthma/allergy medicament to a
subject, without inducing side effects. Ordinarily, when an
asthma/allergy medicament is administered in a high dose, a variety
of side effects can occur. (Discussed in more detail above, as well
as in the medical literature). As a result of these side effects,
the asthma/allergy medicament is not administered in such high
doses, no matter what therapeutic benefits are derived. It was
discovered, according to the invention, that such high doses of
asthma/allergy medicaments which ordinarily induce side effects can
be administered without inducing the side effects as long as the
subject also receives an immunostimulatory nucleic acid. The type
and extent of the side effects ordinarily induced by the
asthma/allergy medicament will depend on the particular
asthma/allergy medicament used.
[0176] In other embodiments of the invention, the immunostimulatory
nucleic acid is administered on a routine schedule. The
asthma/allergy medicament may also be administered on a routine
schedule, but alternatively, may be administered as symptoms arise.
A "routine schedule" as used herein, refers to a predetermined
designated period of time. The routine schedule may encompass
periods of time which are identical or which differ in length, as
long as the schedule is predetermined. For instance, the routine
schedule may involve administration of the immunostimulatory
nucleic acid on a daily basis, every two days, every three days,
every four days, every five days, every six days, a weekly basis, a
bi-weekly basis, a monthly basis, a bimonthly basis or any set
number of days or weeks there-between, every two months, three
months, four months, five months, six months, seven months, eight
months, nine months, ten months, eleven months, twelve months, etc.
Alternatively, the predetermined routine schedule may involve
administration of the immunostimulatory nucleic acid on a daily
basis for the first week, followed by a monthly basis for several
months, and then every three months after that. Any particular
combination would be covered by the routine schedule as long as it
is determined ahead of time that the appropriate schedule involves
administration on a certain day.
[0177] In some aspects of the invention, the immunostimulatory
nucleic acid is administered to the subject in anticipation of an
asthmatic or allergic event in order to prevent an asthmatic or
allergic event. The asthmatic or allergic event may be, but need
not be limited to, an asthma attack, seasonal allergic rhinitis
(e.g., hay-fever, pollen, ragweed hypersensitivity) or perennial
allergic rhinitis (e.g., hypersensitivity to allergens such as
those described herein)., In some instances, the immunostimulatory
nucleic acid is administered substantially prior to, an asthmatic
or an allergic event. As used herein, "substantially prior" means
at least six months, at least five months, at least four months, at
least three months, at least two months, at least one month, at
least three weeks, at least two weeks, at least one week, at least
5 days, or at least 2 days prior to the asthmatic or allergic
event.
[0178] Similarly, the asthma/allergy medicament may be administered
immediately-prior to the asthmatic or allergic event (e.g., within
48 hours, within 24 hours, within 12 hours, within 6 hours, within
4 hours, within 3 hours, within 2 hours, within 1 hour, within 30
minutes or within 10 minutes of an asthmatic or allergic event),
substantially simultaneously with the asthmatic or allergic event
(e.g., during the time the subject is in contact with the allergen
or is experiencing the asthma or allergy symptoms) or following the
asthmatic or allergic event.
[0179] In some embodiments, the immunostimulatory nucleic acid and
the asthma/allergy medicament are both administered to a subject.
The timing of administration of both may vary. In some embodiments,
it is preferred that the asthma/allergy medicament be administered
subsequent to the administration of the immunostimulatory nucleic
acid. In some embodiments, the immunostimulatory nucleic acid is
administered to the subject prior to as well as either
substantially simultaneously with or following the administration
of the asthma/allergy medicament. The administration of the
immunostimulatory nucleic acid and the asthma/allergy medicament
may also be mutually exclusive of each other so that at any given
time during the treatment period, only one of these agents is
active in the subject. Alternatively, and preferably in some
instances, the administration of the two agents overlaps such that
both agents are active in the subject at the same time.
[0180] In some embodiments, the immunostimulatory nucleic acid is
administered on a weekly or biweekly basis and the asthma/allergy
medicament is administered more frequently (e.g., on a daily
basis). However, if the dose of immunostimulatory nucleic acid is
reduced sufficiently, it is possible that the immunostimulatory
nucleic acid is administered as frequently as the asthma/allergy
medicament, albeit at a reduced dose.
[0181] In other aspects, the invention relates to kits that are
useful in the treatment of asthma and/or allergy. One kit of the
invention includes a sustained release vehicle containing an
immunostimulatory nucleic acid and a container housing an
asthma/allergy medicament and instructions for timing of
administration of the immunostimulatory nucleic acid in the
asthma/allergy medicament. A sustained release vehicle is used
herein in accordance with its prior art meaning of any device which
slowly releases the immunostimulatory nucleic acid.
[0182] Such systems can avoid repeated administrations of the
compounds, increasing convenience to the subject and the physician.
Many types of release delivery systems are available and known to
those of ordinary skill in the art. They include polymer base
systems such as poly(lactide-glycolide), copolyoxalates,
polycaprolactones, polyesteramides, polyorthoesters,
polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the
foregoing polymers containing drugs are described in, for example,
U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer
systems that are: lipids including sterols such as cholesterol,
cholesterol esters and fatty acids or neutral fats such as mono-di-
and tri-glycerides; hydrogel release systems; sylastic systems;
peptide based systems; wax coatings; compressed tablets using
conventional binders and excipients; partially fused implants; and
the like. Specific examples include, but are not limited to: (a)
erosional systems in which an agent of the invention is contained
in a form within a matrix such as those described in U.S. U.S. Pat.
Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional
systems in which an active component permeates at a controlled rate
from a polymer such as described in U.S. Pat. Nos. 3,854,480,
5,133,974 and 5,407,686. In addition, pump-based hardware delivery
systems can be used, some of which are adapted for
implantation.
[0183] The asthma/allergy medicament is housed in at least one
container. The container may be a single container housing all of
the asthma/allergy medicament together or it may be multiple
containers or chambers housing individual dosages of the
asthma/allergy medicament, such as a blister pack. The kit also has
instructions for timing of administration of the asthma/allergy
medicament. The instructions would direct the subject having
asthma/allergy or at risk of asthma/allergy to take the
asthma/allergy medicament at the appropriate time. For instance,
the appropriate time for delivery of the medicament may be as the
symptoms occur. Alternatively, the appropriate time for
administration of the medicament may be on a routine schedule such
as monthly or yearly.
[0184] Another kit of the invention includes at least one container
housing an immunostimulatory nucleic acid and at least one
container housing an asthma/allergy medicament and instructions for
administering the compositions ineffective amounts for inducing a
synergistic immune response in the subject. The immunostimulatory
nucleic acid and asthma/allergy medicament may be housed in single
containers or in separate compartments or containers, such as
single dose compartments. The instructions in the kit direct the
subject to take the immunostimulatory nucleic acid and the
asthma/allergy medicament in amounts which will produce a
synergistic immune response. The drugs may be administered
simultaneously or separately as long as they are administered close
enough in time to produce a synergistic response.
[0185] In other aspects of the invention, a composition is
provided. The composition-includes an immunostimulatory nucleic and
an asthma/allergy medicament formulated in a
pharmaceutically-acceptable carrier and present in the composition
in an effective amount for preventing or treating an immune or
inflammatory response associated with exposure to a mediator of
asthma or allergy. The effective amount for preventing or treating
an immune or inflammatory response is that amount which prevents,
inhibits completely or partially the induction of the immune or
inflammatory response or prevents an increase in the immune or
inflammatory response associated with asthma or allergy. An immune
or inflammatory response associated with asthma or allergy includes
an induction in IgE, an increase in Th2 cytokines, etc. A mediator
of asthma or allergy includes asthma initiators and allergens. An
example of a composition is one which comprises an
immunostimulatory nucleic acid, such as a CpG nucleic acid, and an
asthma/allergy medicament, such as an anti-IgE agent (e.g., an
anti-IgE antibody or antibody fragment). Such a composition can be
administered to a subject on a routine basis such as monthly,
bimonthly, or quarterly.
[0186] For any compound described herein a therapeutically
effective amount can be initially determined from cell culture
assays. For instance the effective amount of immunostimulatory
nucleic acid useful for inducing B cell activation can be-assessed
using the in vitro assays with respect to stimulation index in
comparison to known immunostimulatory acids. The stimulation index
can be used to determine an effective amount of the particular
oligonucleotide for the particular subject, and the dosage can be
adjusted upwards or downwards to achieve the desired levels in the
subject. Therapeutically effective amounts can also be determined
from animal models. A therapeutically effective dose can also be
determined from human data for immunostimulatory nucleic acids
which have been tested in humans (human clinical trials have been
initiated) and for compounds which are known to exhibit similar
pharmacological activities, such as other adjuvants, e.g., LT and
other antigens for vaccination purposes. The applied dose can be
adjusted based on the relative bioavailability and potency of the
administered compound. Adjusting the dose to achieve maximal
efficacy based on the methods described above and other methods as
are well-known in the art is well within the capabilities of the
ordinarily skilled artisan. Most of the asthma/allergy medicaments
have been identified. These amounts can be adjusted when they are
combined with immuno-stimulatory nucleic acids by routine
experimentation.
[0187] The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0188] Asthma/allergy medicaments and immunostimulatory nucleic
acids can be administered by any ordinary route for administering
medications. Preferably, they are inhaled, ingested or administered
by local routes (such as nasal drops) or by systemic routes.
Systemic routes include oral and parenteral. Inhaled medications
are preferred in some embodiments because of the direct delivery to
the lung, the site of inflammation, primarily in asthmatic
patients. Several types of metered dose inhalers are regularly used
for administration by inhalation. These types of devices include
metered dose inhalers (MDI), breath-actuated MDI, dry powder
inhaler (DPI), spacer/holding chambers in combination with MDI, and
nebulizers. As used herein, delivery to the nasal passages or the
lungs via nasal drops or inhalation are referred to as local
administration. Although it is possible that delivery to the lung
(e.g., via inhalation) can eventually result in systemic delivery
of the agent, the administration is still considered "local" in the
sense that the majority of the agent is initially presented to the
lung tissue or the nasal passages, prior to any secondary systemic
effects. In some preferred embodiments, the immunostimulatory
nucleic acid is administered locally, such as for example by nasal
drops or inhalation.
[0189] For use in therapy, an effective amount of the
immunostimulatory nucleic acid can be administered to a subject by
any mode that delivers the nucleic acid to the desired surface,
e.g., mucosal, systemic. "Administering" the pharmaceutical
composition of the present invention may be accomplished by any
means known to the skilled artisan. Preferred routes of
administration include but are not limited to oral, parenteral,
intramuscular, intranasal, intratracheal, inhalation, ocular,
vaginal, and rectal.
[0190] For oral administration, the compounds (i.e.,
immunostimulatory nucleic acids, asthma/allergy medicament, other
therapeutic agent) can be formulated readily by combining the
active compound(s) with pharmaceutically acceptable carriers well
known in the art. Such carriers enable the compounds of the
invention to be formulated as-tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a subject to be treated. Pharmaceutical preparations
for oral use can be obtained as solid excipient, optionally
grinding a resulting mixture, and processing the mixture of
granules, after adding suitable auxiliaries, if desired, to obtain
tablets or dragee cores. Suitable excipients are, in particular,
fillers such as sugars, including, lactose, sucrose, mannitol, or
sorbitol; cellulose preparations such as, for example, maize
starch, wheat starch, rice starch, potato starch, gelatin, gum
tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers for neutralizing
internal acid conditions or may be administered without any
carriers.
[0191] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0192] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols.
[0193] In addition, stabilizers may be added. Microspheres
formulated for oral administration may also be used. Such
microspheres have been well defined in the art. All formulations
for oral administration should be in dosages suitable for such
administration.
[0194] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0195] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch. Techniques for
preparing aerosol delivery systems are well known to those of skill
in the art. Generally, such systems should utilize components which
will not significantly impair the biological properties of the
therapeutic, such as the immunostimulatory capacity of the nucleic
acids (see, for example, Sciarra and Cutie, "Aerosols," in
Remington's Pharmaceutical Sciences, 18th edition, 1990, pp
1694-1712; incorporated by reference). Those of skill in the art
can readily determine the various parameters and conditions for
producing aerosols without resort to undue experimentation.
[0196] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0197] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic so solvents or vehicles include fatty oils such as
sesame oil, or synthetic fatty acid: esters, such as ethyl oleate
or triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0198] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0199] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0200] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
[0201] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0202] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated; coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer, Science 249:1527-1533, 1990, which is incorporated herein
by reference.
[0203] The immunostimulatory nucleic acids and asthma/allergy
medicament may be administered per se (neat) or in the form of a
pharmaceutically acceptable salt. When used in medicine the salts
should be pharmaceutically acceptable, but non-pharmaceutically
acceptable salts may conveniently be used to prepare
pharmaceutically acceptable salts thereof. Such salts include, but
are not limited to, those prepared from the following acids:
hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic,
acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane
sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and
benzene sulphonic. Also, such salts can be prepared as alkaline
metal or alkaline earth salts, such as sodium, potassium or calcium
salts of the carboxylic acid group.
[0204] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0205] The pharmaceutical compositions of the invention contain an
effective amount of an immunostimulatory nucleic acid and
optionally asthma/allergy medicament and/or other therapeutic
agents optionally included in a pharmaceutically-acceptable
carrier. The term "pharmaceutically-acceptable carrier" means one
or more compatible solid or liquid filler, dilutants or
encapsulating substances which are suitable for administration to a
human or other vertebrate animal. The term "carrier" denotes an
organic or inorganic ingredient, natural or synthetic, with which
the active ingredient is combined to facilitate the application.
The components of the pharmaceutical compositions also are capable
of being commingled with the compounds of the present invention,
and with each other, in a manner such that there is no interaction
which would substantially impair the desired pharmaceutical
efficiency.
[0206] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
[0207] All references, patents and patent publications that are
recited in this application are incorporated in their entirety
herein by reference.
Sequence CWU 1
1
1093 1 18 DNA Artificial Sequence Synthetic Sequence 1 tctcccagcg
tgcgccat 18 2 20 DNA Artificial Sequence Synthetic Sequence 2
ataatccagc ttgaaccaag 20 3 20 DNA Artificial Sequence Synthetic
Sequence 3 ataatcgacg ttcaagcaag 20 4 18 DNA Artificial Sequence
Synthetic Sequence 4 taccgcgtgc gaccctct 18 5 9 DNA Artificial
Sequence Synthetic Sequence 5 ggggagggt 9 6 9 DNA Artificial
Sequence Synthetic Sequence 6 ggggagggg 9 7 9 DNA Artificial
Sequence Synthetic Sequence 7 ggtgaggtg 9 8 20 DNA Artificial
Sequence modified_base (8)...(8) m5c 8 tccatgtngt tcctgatgct 20 9
15 DNA Artificial Sequence modified_base (11)...(11) m5c 9
gctaccttag ngtga 15 10 20 DNA Artificial Sequence modified_base
(8)...(8) m5c 10 tccatgangt tcctgatgct 20 11 20 DNA Artificial
Sequence modified_base (13)...(13) m5c 11 tccatgacgt tcntgatgct 20
12 15 DNA Artificial Sequence modified_base (7)...(7) m5c 12
gctagangtt agtgt 15 13 19 DNA Artificial Sequence Synthetic
Sequence 13 agctccatgg tgctcactg 19 14 20 DNA Artificial Sequence
Synthetic Sequence 14 ccacgtcgac cctcaggcga 20 15 20 DNA Artificial
Sequence Synthetic Sequence 15 gcacatcgtc ccgcagccga 20 16 19 DNA
Artificial Sequence Synthetic Sequence 16 gtcactcgtg gtacctcga 19
17 25 DNA Artificial Sequence Synthetic Sequence 17 gttggataca
ggccagactt tgttg 25 18 25 DNA Artificial Sequence Synthetic
Sequence 18 gattcaactt gcgctcatct taggc 25 19 24 DNA Artificial
Sequence Synthetic Sequence 19 accatggacg aactgtttcc cctc 24 20 24
DNA Artificial Sequence Synthetic Sequence 20 accatggacg agctgtttcc
cctc 24 21 24 DNA Artificial Sequence Synthetic Sequence 21
accatggacg acctgtttcc cctc 24 22 24 DNA Artificial Sequence
Synthetic Sequence 22 accatggacg tactgtttcc cctc 24 23 24 DNA
Artificial Sequence Synthetic Sequence 23 accatggacg gtctgtttcc
cctc 24 24 24 DNA Artificial Sequence Synthetic Sequence 24
accatggacg ttctgtttcc cctc 24 25 25 DNA Artificial Sequence
Synthetic Sequence 25 ccactcacat ctgctgctcc acaag 25 26 25 DNA
Artificial Sequence Synthetic Sequence 26 acttctcata gtccctttgg
tccag 25 27 20 DNA Artificial Sequence Synthetic Sequence 27
tccatgagct tcctgagtct 20 28 20 DNA Artificial Sequence Synthetic
Sequence 28 gaggaaggng nggangacgt 20 29 20 DNA Artificial Sequence
Synthetic Sequence 29 gtgaatncgt tcncgggnct 20 30 6 DNA Artificial
Sequence Synthetic Sequence 30 aaaaaa 6 31 6 DNA Artificial
Sequence Synthetic Sequence 31 cccccc 6 32 6 DNA Artificial
Sequence Synthetic Sequence 32 ctgtca 6 33 6 DNA Artificial
Sequence Synthetic Sequence 33 tcgtag 6 34 6 DNA Artificial
Sequence Synthetic Sequence 34 tcgtgg 6 35 6 DNA Artificial
Sequence Synthetic Sequence 35 cgtcgt 6 36 20 DNA Artificial
Sequence Synthetic Sequence 36 tccatgtcgg tcctgagtct 20 37 20 DNA
Artificial Sequence Synthetic Sequence 37 tccatgccgg tcctgagtct 20
38 20 DNA Artificial Sequence Synthetic Sequence 38 tccatgacgg
tcctgagtct 20 39 20 DNA Artificial Sequence Synthetic Sequence 39
tccatgacgg tcctgagtct 20 40 20 DNA Artificial Sequence Synthetic
Sequence 40 tccatgtcga tcctgagtct 20 41 20 DNA Artificial Sequence
Synthetic Sequence 41 tccatgtcgc tcctgagtct 20 42 20 DNA Artificial
Sequence Synthetic Sequence 42 tccatgtcgt tcctgagtct 20 43 20 DNA
Artificial Sequence Synthetic Sequence 43 tccatgacgt tcctgagtct 20
44 20 DNA Artificial Sequence Synthetic Sequence 44 tccataacgt
tcctgagtct 20 45 20 DNA Artificial Sequence Synthetic Sequence 45
tccatgacgt ccctgagtct 20 46 20 DNA Artificial Sequence Synthetic
Sequence 46 tccatcacgt gcctgagtct 20 47 20 DNA Artificial Sequence
Synthetic Sequence 47 tccatgctgg tcctgagtct 20 48 20 DNA Artificial
Sequence modified_base (8)...(8) m5c 48 tccatgtngg tcctgagtct 20 49
39 DNA Artificial Sequence Synthetic Sequence 49 ccgcttcctc
cagatgagct catgggtttc tccaccaag 39 50 39 DNA Artificial Sequence
Synthetic Sequence 50 cttggtggag aaacccatga gctcatctgg aggaagcgg 39
51 20 DNA Artificial Sequence Synthetic Sequence 51 ccccaaaggg
atgagaagtt 20 52 20 DNA Artificial Sequence Synthetic Sequence 52
agatagcaaa tcggctgacg 20 53 20 DNA Artificial Sequence Synthetic
Sequence 53 ggttcacgtg ctcatggctg 20 54 18 DNA Artificial Sequence
Synthetic Sequence 54 tctcccagcg tgcgccat 18 55 18 DNA Artificial
Sequence Synthetic Sequence 55 tctcccagcg tgcgccat 18 56 18 DNA
Artificial Sequence Synthetic Sequence 56 taccgcgtgc gaccctct 18 57
20 DNA Artificial Sequence Synthetic Sequence 57 ataatccagc
ttgaaccaag 20 58 20 DNA Artificial Sequence Synthetic Sequence 58
ataatcgacg ttcaagcaag 20 59 20 DNA Artificial Sequence Synthetic
Sequence 59 tccatgattt tcctgatttt 20 60 24 DNA Artificial Sequence
Synthetic Sequence 60 ttgttttttt gtttttttgt tttt 24 61 22 DNA
Artificial Sequence Synthetic Sequence 61 ttttttttgt ttttttgttt tt
22 62 24 DNA Artificial Sequence Synthetic Sequence 62 tgctgctttt
gtgcttttgt gctt 24 63 22 DNA Artificial Sequence Synthetic Sequence
63 tgctgcttgt gcttttgtgc tt 22 64 23 DNA Artificial Sequence
Synthetic Sequence 64 gcattcatca ggcgggcaag aat 23 65 23 DNA
Artificial Sequence Synthetic Sequence 65 taccgagctt cgacgagatt tca
23 66 15 DNA Artificial Sequence Synthetic Sequence 66 gcatgacgtt
gagct 15 67 15 DNA Artificial Sequence Synthetic Sequence 67
cacgttgagg ggcat 15 68 15 DNA Artificial Sequence Synthetic
Sequence 68 ctgctgagac tggag 15 69 20 DNA Artificial Sequence
Synthetic Sequence 69 tccatgacgt tcctgacgtt 20 70 17 DNA Artificial
Sequence Synthetic Sequence 70 gcatgagctt gagctga 17 71 12 DNA
Artificial Sequence Synthetic Sequence 71 tcagcgtgcg cc 12 72 17
DNA Artificial Sequence Synthetic Sequence 72 atgacgttcc tgacgtt 17
73 20 DNA Artificial Sequence Synthetic Sequence 73 ttttggggtt
ttggggtttt 20 74 20 DNA Artificial Sequence Synthetic Sequence 74
tctaggcttt ttaggcttcc 20 75 20 DNA Artificial Sequence Synthetic
Sequence 75 tgcatttttt aggccaccat 20 76 22 DNA Artificial Sequence
Synthetic Sequence 76 tctcccagcg tgcgtgcgcc at 22 77 17 DNA
Artificial Sequence Synthetic Sequence 77 tctcccagcg ggcgcat 17 78
18 DNA Artificial Sequence Synthetic Sequence 78 tctcccagcg
agcgccat 18 79 18 DNA Artificial Sequence Synthetic Sequence 79
tctcccagcg cgcgccat 18 80 19 DNA Artificial Sequence Synthetic
Sequence 80 ggggtgacgt tcagggggg 19 81 24 DNA Artificial Sequence
Synthetic Sequence 81 ggggtccagc gtgcgccatg gggg 24 82 19 DNA
Artificial Sequence Synthetic Sequence 82 ggggtgtcgt tcagggggg 19
83 20 DNA Artificial Sequence Synthetic Sequence 83 tccatgtcgt
tcctgtcgtt 20 84 20 DNA Artificial Sequence Synthetic Sequence 84
tccatagcgt tcctagcgtt 20 85 21 DNA Artificial Sequence Synthetic
Sequence 85 tcgtcgctgt ctccgcttct t 21 86 15 DNA Artificial
Sequence Synthetic Sequence 86 gcatgacgtt gagct 15 87 20 DNA
Artificial Sequence Synthetic Sequence 87 tctcccagcg tgcgccatat 20
88 20 DNA Artificial Sequence modified_base (8)...(8) m5c 88
tccatgangt tcctgangtt 20 89 15 DNA Artificial Sequence
modified_base (7)...(7) m5c 89 gcatgangtt gagct 15 90 16 DNA
Artificial Sequence Synthetic Sequence 90 tccagcgtgc gccata 16 91
18 DNA Artificial Sequence Synthetic Sequence 91 tctcccagcg
tgcgccat 18 92 20 DNA Artificial Sequence Synthetic Sequence 92
tccatgagct tcctgagtct 20 93 15 DNA Artificial Sequence Synthetic
Sequence 93 gcatgtcgtt gagct 15 94 19 DNA Artificial Sequence
Synthetic Sequence 94 tcctgacgtt cctgacgtt 19 95 15 DNA Artificial
Sequence Synthetic Sequence 95 gcatgatgtt gagct 15 96 15 DNA
Artificial Sequence Synthetic Sequence 96 gcatttcgag gagct 15 97 15
DNA Artificial Sequence Synthetic Sequence 97 gcatgtagct gagct 15
98 20 DNA Artificial Sequence Synthetic Sequence 98 tccaggacgt
tcctagttct 20 99 20 DNA Artificial Sequence Synthetic Sequence 99
tccaggagct tcctagttct 20 100 20 DNA Artificial Sequence Synthetic
Sequence 100 tccaggatgt tcctagttct 20 101 20 DNA Artificial
Sequence Synthetic Sequence 101 tccagtctag gcctagttct 20 102 20 DNA
Artificial Sequence Synthetic Sequence 102 tccagttcga gcctagttct 20
103 15 DNA Artificial Sequence Synthetic Sequence 103 gcatggcgtt
gagct 15 104 15 DNA Artificial Sequence Synthetic Sequence 104
gcatagcgtt gagct 15 105 15 DNA Artificial Sequence Synthetic
Sequence 105 gcattgcgtt gagct 15 106 15 DNA Artificial Sequence
Synthetic Sequence 106 gcttgcgttg cgttt 15 107 21 DNA Artificial
Sequence Synthetic Sequence 107 tctcccagcg ttgcgccata t 21 108 20
DNA Artificial Sequence Synthetic Sequence 108 tctcccagcg
tgcgttatat 20 109 20 DNA Artificial Sequence Synthetic Sequence 109
tctccctgcg tgcgccatat 20 110 20 DNA Artificial Sequence Synthetic
Sequence 110 tctgcgtgcg tgcgccatat 20 111 20 DNA Artificial
Sequence Synthetic Sequence 111 tctcctagcg tgcgccatat 20 112 20 DNA
Artificial Sequence Synthetic Sequence 112 tctcccagcg tgcgcctttt 20
113 13 DNA Artificial Sequence Synthetic Sequence 113 gctandcghh
agc 13 114 13 DNA Artificial Sequence Synthetic Sequence 114
tcctgacgtt ccc 13 115 13 DNA Artificial Sequence Synthetic Sequence
115 ggaagacgtt aga 13 116 13 DNA Artificial Sequence Synthetic
Sequence 116 tcctgacgtt aga 13 117 27 DNA Artificial Sequence
Synthetic Sequence 117 tcagaccagc tggtcgggtg ttcctga 27 118 27 DNA
Artificial Sequence Synthetic Sequence 118 tcaggaacac ccgaccagct
ggtctga 27 119 13 DNA Artificial Sequence Synthetic Sequence 119
gctagtcgat agc 13 120 13 DNA Artificial Sequence Synthetic Sequence
120 gctagtcgct agc 13 121 14 DNA Artificial Sequence Synthetic
Sequence 121 gcttgacgtc tagc 14 122 14 DNA Artificial Sequence
Synthetic Sequence 122 gcttgacgtt tagc 14 123 14 DNA Artificial
Sequence Synthetic Sequence 123 gcttgacgtc aagc 14 124 14 DNA
Artificial Sequence Synthetic Sequence 124 gctagacgtt tagc 14 125
20 DNA Artificial Sequence Synthetic Sequence 125 tccatgacat
tcctgatgct 20 126 14 DNA Artificial Sequence Synthetic Sequence 126
gctagacgtc tagc 14 127 19 DNA Artificial Sequence Synthetic
Sequence 127 ggctatgtcg ttcctagcc 19 128 19 DNA Artificial Sequence
Synthetic Sequence 128 ggctatgtcg atcctagcc 19 129 21 DNA
Artificial Sequence Synthetic Sequence 129 ctcatgggtt tctccaccaa g
21 130 21 DNA Artificial Sequence Synthetic Sequence 130 cttggtggag
aaacccatga g 21 131 20 DNA Artificial Sequence Synthetic Sequence
131 tccatgacgt tcctagttct 20 132 24 DNA Artificial Sequence
Synthetic Sequence 132 ccgcttcctc cagatgagct catg 24 133 24 DNA
Artificial Sequence Synthetic Sequence 133 catgagctca tctggaggaa
gcgg 24 134 24 DNA Artificial Sequence Synthetic Sequence 134
ccagatgagc tcatgggttt ctcc 24 135 24 DNA Artificial Sequence
Synthetic Sequence 135 ggagaaaccc atgagctcat ctgg 24 136 20 DNA
Artificial Sequence Synthetic Sequence 136 agcatcagga acgacatgga 20
137 20 DNA Artificial Sequence Synthetic Sequence 137 tccatgacgt
tcctgacgtt 20 138 19 DNA Artificial Sequence Synthetic Sequence 138
gcgcgcgcgc gcgcgcgcg 19 139 20 DNA Artificial Sequence Synthetic
Sequence 139 ccggccggcc ggccggccgg 20 140 43 DNA Artificial
Sequence Synthetic Sequence 140 ttccaatcag ccccacccgc tctggcccca
ccctcaccct cca 43 141 43 DNA Artificial Sequence Synthetic Sequence
141 tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 142 27 DNA
Artificial Sequence Synthetic Sequence 142 tcaaatgtgg gattttccca
tgagtct 27 143 27 DNA Artificial Sequence Synthetic Sequence 143
agactcatgg gaaaatccca catttga
27 144 27 DNA Artificial Sequence Synthetic Sequence 144 tgccaagtgc
tgagtcacta ataaaga 27 145 27 DNA Artificial Sequence Synthetic
Sequence 145 tctttattag tgactcagca cttggca 27 146 31 DNA Artificial
Sequence Synthetic Sequence 146 tgcaggaagt ccgggttttc cccaaccccc c
31 147 31 DNA Artificial Sequence Synthetic Sequence 147 ggggggttgg
ggaaaacccg gacttcctgc a 31 148 38 DNA Artificial Sequence Synthetic
Sequence 148 ggggactttc cgctggggac tttccagggg gactttcc 38 149 45
DNA Artificial Sequence Synthetic Sequence 149 tccatgacgt
tcctctccat gacgttcctc tccatgacgt tcctc 45 150 45 DNA Artificial
Sequence Synthetic Sequence 150 gaggaacgtc atggagagga acgtcatgga
gaggaacgtc atgga 45 151 20 DNA Artificial Sequence Synthetic
Sequence 151 ataatagagc ttcaagcaag 20 152 20 DNA Artificial
Sequence Synthetic Sequence 152 tccatgacgt tcctgacgtt 20 153 20 DNA
Artificial Sequence Synthetic Sequence 153 tccatgacgt tcctgacgtt 20
154 20 DNA Artificial Sequence Synthetic Sequence 154 tccaggactt
tcctcaggtt 20 155 45 DNA Artificial Sequence Synthetic Sequence 155
tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45 156 45 DNA
Artificial Sequence Synthetic Sequence 156 accttattaa gattgtgcaa
tgtgacgtcc tttagcatcg caaga 45 157 28 DNA Artificial Sequence
Synthetic Sequence 157 tcctgacgtt cctggcggtc ctgtcgct 28 158 19 DNA
Artificial Sequence Synthetic Sequence 158 tcctgtcgct cctgtcgct 19
159 15 DNA Artificial Sequence Synthetic Sequence 159 tcctgacgtt
gaagt 15 160 15 DNA Artificial Sequence Synthetic Sequence 160
tcctgtcgtt gaagt 15 161 15 DNA Artificial Sequence Synthetic
Sequence 161 tcctggcgtt gaagt 15 162 15 DNA Artificial Sequence
Synthetic Sequence 162 tcctgccgtt gaagt 15 163 15 DNA Artificial
Sequence Synthetic Sequence 163 tccttacgtt gaagt 15 164 15 DNA
Artificial Sequence Synthetic Sequence 164 tcctaacgtt gaagt 15 165
15 DNA Artificial Sequence Synthetic Sequence 165 tcctcacgtt gaagt
15 166 15 DNA Artificial Sequence Synthetic Sequence 166 tcctgacgat
gaagt 15 167 15 DNA Artificial Sequence Synthetic Sequence 167
tcctgacgct gaagt 15 168 15 DNA Artificial Sequence Synthetic
Sequence 168 tcctgacggt gaagt 15 169 15 DNA Artificial Sequence
Synthetic Sequence 169 tcctgacgta gaagt 15 170 15 DNA Artificial
Sequence Synthetic Sequence 170 tcctgacgtc gaagt 15 171 15 DNA
Artificial Sequence Synthetic Sequence 171 tcctgacgtg gaagt 15 172
15 DNA Artificial Sequence Synthetic Sequence 172 tcctgagctt gaagt
15 173 15 DNA Artificial Sequence Synthetic Sequence 173 gggggacgtt
ggggg 15 174 15 DNA Artificial Sequence Synthetic Sequence 174
tcctgacgtt ccttc 15 175 22 DNA Artificial Sequence Synthetic
Sequence 175 tctcccagcg agcgagcgcc at 22 176 32 DNA Artificial
Sequence Synthetic Sequence 176 tcctgacgtt cccctggcgg tcccctgtcg ct
32 177 28 DNA Artificial Sequence Synthetic Sequence 177 tcctgtcgct
cctgtcgctc ctgtcgct 28 178 15 DNA Artificial Sequence Synthetic
Sequence 178 tcctggcggg gaagt 15 179 15 DNA Artificial Sequence
modified_base (7)...(7) m5c 179 tcctgangtt gaagt 15 180 15 DNA
Artificial Sequence modified_base (3)...(3) m5c 180 tcntgacgtt
gaagt 15 181 15 DNA Artificial Sequence Synthetic Sequence 181
tcctagcgtt gaagt 15 182 15 DNA Artificial Sequence Synthetic
Sequence 182 tccagacgtt gaagt 15 183 15 DNA Artificial Sequence
Synthetic Sequence 183 tcctgacggg gaagt 15 184 15 DNA Artificial
Sequence Synthetic Sequence 184 tcctggcggt gaagt 15 185 27 DNA
Artificial Sequence Synthetic Sequence 185 ggctccgggg agggaatttt
tgtctat 27 186 27 DNA Artificial Sequence Synthetic Sequence 186
atagacaaaa attccctccc cggagcc 27 187 21 DNA Artificial Sequence
Synthetic Sequence 187 tccatgagct tccttgagtc t 21 188 21 DNA
Artificial Sequence Synthetic Sequence 188 tcgtcgctgt ctccgcttct t
21 189 21 DNA Artificial Sequence Synthetic Sequence 189 tcgtcgctgt
ctccgcttct t 21 190 23 DNA Artificial Sequence Synthetic Sequence
190 tcgagacatt gcacaatcat ctg 23 191 20 DNA Artificial Sequence
Synthetic Sequence 191 cagattgtgc aatgtctcga 20 192 20 DNA
Artificial Sequence Synthetic Sequence 192 tccatgtcgt tcctgatgcg 20
193 20 DNA Artificial Sequence Synthetic Sequence 193 gcgatgtcgt
tcctgatgct 20 194 20 DNA Artificial Sequence Synthetic Sequence 194
gcgatgtcgt tcctgatgcg 20 195 20 DNA Artificial Sequence Synthetic
Sequence 195 tccatgtcgt tccgcgcgcg 20 196 20 DNA Artificial
Sequence Synthetic Sequence 196 tccatgtcgt tcctgccgct 20 197 20 DNA
Artificial Sequence Synthetic Sequence 197 tccatgtcgt tcctgtagct 20
198 20 DNA Artificial Sequence Synthetic Sequence 198 gcggcgggcg
gcgcgcgccc 20 199 21 DNA Artificial Sequence Synthetic Sequence 199
atcaggaacg tcatgggaag c 21 200 20 DNA Artificial Sequence Synthetic
Sequence 200 tccatgagct tcctgagtct 20 201 8 DNA Artificial Sequence
Synthetic Sequence 201 tcaacgtt 8 202 8 DNA Artificial Sequence
Synthetic Sequence 202 tcaagctt 8 203 19 DNA Artificial Sequence
Synthetic Sequence 203 tcctgtcgtt cctgtcgtt 19 204 20 DNA
Artificial Sequence Synthetic Sequence 204 tccatgtcgt ttttgtcgtt 20
205 20 DNA Artificial Sequence Synthetic Sequence 205 tcctgtcgtt
ccttgtcgtt 20 206 20 DNA Artificial Sequence Synthetic Sequence 206
tccttgtcgt tcctgtcgtt 20 207 29 DNA Artificial Sequence
misc_feature (1)...(3) Conjugated to biotin moiety. 207 tccattccat
gacgttcctg atgcttcca 29 208 20 DNA Artificial Sequence Synthetic
Sequence 208 tcctgtcgtt ttttgtcgtt 20 209 21 DNA Artificial
Sequence Synthetic Sequence 209 tcgtcgctgt ctccgcttct t 21 210 21
DNA Artificial Sequence Synthetic Sequence 210 tcgtcgctgt
ctgcccttct t 21 211 21 DNA Artificial Sequence Synthetic Sequence
211 tcgtcgctgt tgtcgtttct t 21 212 30 DNA Artificial Sequence
Synthetic Sequence 212 tcctgtcgtt cctgtcgttg gaacgacagg 30 213 40
DNA Artificial Sequence Synthetic Sequence 213 tcctgtcgtt
cctgtcgttt caacgtcagg aacgacagga 40 214 21 DNA Artificial Sequence
Synthetic Sequence 214 ggggtctgtc gttttggggg g 21 215 21 DNA
Artificial Sequence Synthetic Sequence 215 ggggtctgtg cttttggggg g
21 216 15 DNA Artificial Sequence Synthetic Sequence 216 tccggccgtt
gaagt 15 217 15 DNA Artificial Sequence Synthetic Sequence 217
tccggacggt gaagt 15 218 15 DNA Artificial Sequence Synthetic
Sequence 218 tcccgccgtt gaagt 15 219 15 DNA Artificial Sequence
Synthetic Sequence 219 tccagacggt gaagt 15 220 15 DNA Artificial
Sequence Synthetic Sequence 220 tcccgacggt gaagt 15 221 15 DNA
Artificial Sequence Synthetic Sequence 221 tccagagctt gaagt 15 222
20 DNA Artificial Sequence modified_base (8)...(8) m5c 222
tccatgtngt tcctgtngtt 20 223 20 DNA Artificial Sequence Synthetic
Sequence 223 tccatgacgt tcctgacgtt 20 224 20 DNA Artificial
Sequence Synthetic Sequence 224 ggggttgacg ttttgggggg 20 225 20 DNA
Artificial Sequence Synthetic Sequence 225 tccaggactt ctctcaggtt 20
226 20 DNA Artificial Sequence Synthetic Sequence 226 tttttttttt
tttttttttt 20 227 20 DNA Artificial Sequence Synthetic Sequence 227
tccatgccgt tcctgccgtt 20 228 20 DNA Artificial Sequence Synthetic
Sequence 228 tccatggcgg gcctggcggg 20 229 20 DNA Artificial
Sequence Synthetic Sequence 229 tccatgacgt tcctgccgtt 20 230 20 DNA
Artificial Sequence Synthetic Sequence 230 tccatgacgt tcctggcggg 20
231 20 DNA Artificial Sequence Synthetic Sequence 231 tccatgacgt
tcctgcgttt 20 232 20 DNA Artificial Sequence Synthetic Sequence 232
tccatgacgg tcctgacggt 20 233 20 DNA Artificial Sequence Synthetic
Sequence 233 tccatgcgtg cgtgcgtttt 20 234 20 DNA Artificial
Sequence Synthetic Sequence 234 tccatgcgtt gcgttgcgtt 20 235 30 DNA
Artificial Sequence misc_feature (1)...(3) Conjugated to biotin
moiety. 235 tccattccat tctaggcctg agtcttccat 30 236 20 DNA
Artificial Sequence Synthetic Sequence 236 tccatagcgt tcctagcgtt 20
237 20 DNA Artificial Sequence Synthetic Sequence 237 tccatgtcgt
tcctgtcgtt 20 238 20 DNA Artificial Sequence Synthetic Sequence 238
tccatagcga tcctagcgat 20 239 20 DNA Artificial Sequence Synthetic
Sequence 239 tccattgcgt tccttgcgtt 20 240 20 DNA Artificial
Sequence Synthetic Sequence 240 tccatagcgg tcctagcggt 20 241 29 DNA
Artificial Sequence Synthetic Sequence 241 tccatgattt tcctgcagtt
cctgatttt 29 242 29 DNA Artificial Sequence Synthetic Sequence 242
tccatgacgt tcctgcagtt cctgacgtt 29 243 20 DNA Artificial Sequence
Synthetic Sequence 243 ggcggcggcg gcggcggcgg 20 244 20 DNA
Artificial Sequence Synthetic Sequence 244 tccacgacgt tttcgacgtt 20
245 20 DNA Artificial Sequence Synthetic Sequence 245 tcgtcgttgt
cgttgtcgtt 20 246 24 DNA Artificial Sequence Synthetic Sequence 246
tcgtcgtttt gtcgttttgt cgtt 24 247 22 DNA Artificial Sequence
Synthetic Sequence 247 tcgtcgttgt cgttttgtcg tt 22 248 21 DNA
Artificial Sequence Synthetic Sequence 248 gcgtgcgttg tcgttgtcgt t
21 249 19 DNA Artificial Sequence Synthetic Sequence 249 cnggcnggcn
gggcnccgg 19 250 20 DNA Artificial Sequence Synthetic Sequence 250
gcggcgggcg gcgcgcgccc 20 251 20 DNA Artificial Sequence Synthetic
Sequence 251 agncccgnga acgnattcac 20 252 21 DNA Artificial
Sequence Synthetic Sequence 252 tgtcgtttgt cgtttgtcgt t 21 253 25
DNA Artificial Sequence Synthetic Sequence 253 tgtcgttgtc
gttgtcgttg tcgtt 25 254 25 DNA Artificial Sequence Synthetic
Sequence 254 tgtcgttgtc gttgtcgttg tcgtt 25 255 14 DNA Artificial
Sequence Synthetic Sequence 255 tcgtcgtcgt cgtt 14 256 13 DNA
Artificial Sequence Synthetic Sequence 256 tgtcgttgtc gtt 13 257 20
DNA Artificial Sequence Synthetic Sequence 257 cccccccccc
cccccccccc 20 258 20 DNA Artificial Sequence Synthetic Sequence 258
tctagcgttt ttagcgttcc 20 259 20 DNA Artificial Sequence Synthetic
Sequence 259 tgcatccccc aggccaccat 20 260 23 DNA Artificial
Sequence Synthetic Sequence 260 tcgtcgtcgt cgtcgtcgtc gtt 23 261 20
DNA Artificial Sequence Synthetic Sequence 261 tcgtcgttgt
cgttgtcgtt 20 262 24 DNA Artificial Sequence Synthetic Sequence 262
tcgtcgtttt gtcgttttgt cgtt 24 263 22 DNA Artificial Sequence
Synthetic Sequence 263 tcgtcgttgt cgttttgtcg tt 22 264 39 DNA
Artificial Sequence Synthetic Sequence 264 ggggagggag gaacttctta
aaattccccc agaatgttt 39 265 39 DNA Artificial Sequence Synthetic
Sequence 265 aaacattctg ggggaatttt aagaagttcc tccctcccc 39 266 33
DNA Artificial Sequence Synthetic Sequence 266 atgtttactt
cttaaaattc ccccagaatg ttt 33 267 33 DNA Artificial Sequence
Synthetic Sequence 267 aaacattctg ggggaatttt aagaagtaaa cat 33 268
33 DNA Artificial Sequence Synthetic Sequence 268 atgtttacta
gacaaaattc ccccagaatg ttt 33 269 33 DNA Artificial Sequence
Synthetic Sequence 269 aaacattctg ggggaatttt gtctagtaaa cat 33 270
20 DNA Artificial Sequence Synthetic Sequence 270 aaaattgacg
ttttaaaaaa 20 271 20 DNA Artificial Sequence Synthetic Sequence 271
ccccttgacg ttttcccccc 20 272 20 DNA Artificial Sequence Synthetic
Sequence 272 ttttcgttgt ttttgtcgtt 20 273 24 DNA Artificial
Sequence Synthetic Sequence 273 tcgtcgtttt gtcgttttgt cgtt 24 274
14 DNA Artificial Sequence Synthetic Sequence 274 ctgcagcctg ggac
14 275 25 DNA Artificial Sequence Synthetic Sequence 275 acccgtcgta
attatagtaa aaccc 25 276 21 DNA Artificial Sequence Synthetic
Sequence 276 ggtacctgtg gggacattgt g 21 277 18 DNA Artificial
Sequence Synthetic Sequence 277 agcaccgaac gtgagagg 18 278 20 DNA
Artificial Sequence Synthetic Sequence 278 tccatgccgt tcctgccgtt 20
279 20 DNA Artificial Sequence Synthetic Sequence 279 tccatgacgg
tcctgacggt 20 280 20 DNA Artificial Sequence Synthetic Sequence 280
tccatgccgg tcctgccggt 20 281 20 DNA Artificial Sequence Synthetic
Sequence 281 tccatgcgcg tcctgcgcgt 20 282 24 DNA Artificial
Sequence Synthetic Sequence 282 ctggtctttc tggttttttt ctgg 24 283
20 DNA Artificial Sequence Synthetic Sequence 283 tcaggggtgg
ggggaacctt 20 284 20 DNA Artificial Sequence modified_base
(8)...(8) m5c 284 tccatgangt tcctagttct 20 285 20 DNA Artificial
Sequence Synthetic Sequence 285
tccatgatgt tcctagttct 20 286 26 DNA Artificial Sequence Synthetic
Sequence 286 cccgaagtca tttcctctta acctgg 26 287 26 DNA Artificial
Sequence Synthetic Sequence 287 ccaggttaag aggaaatgac ttcggg 26 288
15 DNA Artificial Sequence modified_base (7)...(7) m5c 288
tcctggnggg gaagt 15 289 20 DNA Artificial Sequence modified_base
(2)...(2) m5c 289 gnggngggng gngngngccc 20 290 20 DNA Artificial
Sequence Synthetic Sequence 290 tccatgtgct tcctgatgct 20 291 20 DNA
Artificial Sequence Synthetic Sequence 291 tccatgtcct tcctgatgct 20
292 20 DNA Artificial Sequence Synthetic Sequence 292 tccatgtcgt
tcctagttct 20 293 20 DNA Artificial Sequence Synthetic Sequence 293
tccaagtagt tcctagttct 20 294 20 DNA Artificial Sequence Synthetic
Sequence 294 tccatgtagt tcctagttct 20 295 20 DNA Artificial
Sequence Synthetic Sequence 295 tcccgcgcgt tccgcgcgtt 20 296 20 DNA
Artificial Sequence Synthetic Sequence 296 tcctggcggt cctggcggtt 20
297 15 DNA Artificial Sequence Synthetic Sequence 297 tcctggaggg
gaagt 15 298 15 DNA Artificial Sequence Synthetic Sequence 298
tcctgggggg gaagt 15 299 15 DNA Artificial Sequence Synthetic
Sequence 299 tcctggtggg gaagt 15 300 24 DNA Artificial Sequence
Synthetic Sequence 300 tcgtcgtttt gtcgttttgt cgtt 24 301 24 DNA
Artificial Sequence Synthetic Sequence 301 ctggtctttc tggttttttt
ctgg 24 302 20 DNA Artificial Sequence Synthetic Sequence 302
tccatgacgt tcctgacgtt 20 303 20 DNA Artificial Sequence Synthetic
Sequence 303 tccaggactt ctctcaggtt 20 304 24 DNA Artificial
Sequence Synthetic Sequence 304 tngtngtttt gtngttttgt ngtt 24 305
29 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to
biotin moiety. 305 tcgtcgtttt gtcgttttgt cgttttttt 29 306 18 DNA
Artificial Sequence Synthetic Sequence 306 gctatgacgt tccaaggg 18
307 8 DNA Artificial Sequence Synthetic Sequence 307 tcaacgtt 8 308
20 DNA Artificial Sequence Synthetic Sequence 308 tccaggactt
tcctcaggtt 20 309 20 DNA Artificial Sequence Synthetic Sequence 309
ctctctgtag gcccgcttgg 20 310 20 DNA Artificial Sequence Synthetic
Sequence 310 ctttccgttg gacccctggg 20 311 20 DNA Artificial
Sequence Synthetic Sequence 311 gtccgggcca ggccaaagtc 20 312 20 DNA
Artificial Sequence Synthetic Sequence 312 gtgcgcgcga gcccgaaatc 20
313 20 DNA Artificial Sequence modified_base (8)...(8) I 313
tccatgangt tcctgangtt 20 314 20 DNA Artificial Sequence Synthetic
Sequence 314 aatagtcgcc ataacaaaac 20 315 20 DNA Artificial
Sequence Synthetic Sequence 315 aatagtcgcc atggcggggc 20 316 28 DNA
Artificial Sequence misc_difference (1)...(3) Biotin moiety
attached at 5' end of sequence. 316 tttttccatg tcgttcctga tgcttttt
28 317 20 DNA Artificial Sequence Synthetic Sequence 317 tcctgtcgtt
gaagtttttt 20 318 24 DNA Artificial Sequence Synthetic Sequence 318
gctagcttta gagctttaga gctt 24 319 20 DNA Artificial Sequence
Synthetic Sequence 319 tgctgcttcc cccccccccc 20 320 20 DNA
Artificial Sequence Synthetic Sequence 320 tcgacgttcc cccccccccc 20
321 20 DNA Artificial Sequence Synthetic Sequence 321 tcgtcgttcc
cccccccccc 20 322 20 DNA Artificial Sequence Synthetic Sequence 322
tcgtcgttcc cccccccccc 20 323 20 DNA Artificial Sequence Synthetic
Sequence 323 tcgccgttcc cccccccccc 20 324 20 DNA Artificial
Sequence Synthetic Sequence 324 tcgtcgatcc cccccccccc 20 325 15 DNA
Artificial Sequence Synthetic Sequence 325 tcctgacgtt gaagt 15 326
15 DNA Artificial Sequence Synthetic Sequence 326 tcctgccgtt gaagt
15 327 15 DNA Artificial Sequence Synthetic Sequence 327 tcctgacggt
gaagt 15 328 15 DNA Artificial Sequence Synthetic Sequence 328
tcctgagctt gaagt 15 329 15 DNA Artificial Sequence Synthetic
Sequence 329 tcctggcggg gaagt 15 330 21 DNA Artificial Sequence
Synthetic Sequence 330 aaaatctgtg cttttaaaaa a 21 331 33 DNA
Artificial Sequence Synthetic Sequence 331 gatccagtca cagtgacctg
gcagaatctg gat 33 332 33 DNA Artificial Sequence Synthetic Sequence
332 gatccagatt ctgccaggtc actgtgactg gat 33 333 33 DNA Artificial
Sequence Synthetic Sequence 333 gatccagtca cagtgactca gcagaatctg
gat 33 334 33 DNA Artificial Sequence Synthetic Sequence 334
gatccagatt ctgctgagtc actgtgactg gat 33 335 20 DNA Artificial
Sequence modified_base (16)...(16) m5c 335 tcgtcgttcc cccccncccc 20
336 20 DNA Artificial Sequence modified_base (2)...(2) m5c 336
tngtngttcc cccccccccc 20 337 20 DNA Artificial Sequence
modified_base (2)...(2) m5c 337 tngtcgttcc cccccccccc 20 338 20 DNA
Artificial Sequence modified_base (5)...(5) m5c 338 tcgtngttcc
cccccccccc 20 339 20 DNA Artificial Sequence Synthetic Sequence 339
tcgtcgctcc cccccccccc 20 340 20 DNA Artificial Sequence Synthetic
Sequence 340 tcgtcggtcc cccccccccc 20 341 20 DNA Artificial
Sequence Synthetic Sequence 341 tcggcgttcc cccccccccc 20 342 20 DNA
Artificial Sequence Synthetic Sequence 342 ggccttttcc cccccccccc 20
343 24 DNA Artificial Sequence Synthetic Sequence 343 tcgtcgtttt
gacgttttgt cgtt 24 344 24 DNA Artificial Sequence Synthetic
Sequence 344 tcgtcgtttt gacgttttga cgtt 24 345 20 DNA Artificial
Sequence Synthetic Sequence 345 ccgtcgttcc cccccccccc 20 346 20 DNA
Artificial Sequence Synthetic Sequence 346 gcgtcgttcc cccccccccc 20
347 20 DNA Artificial Sequence Synthetic Sequence 347 tcgtcattcc
cccccccccc 20 348 20 DNA Artificial Sequence Synthetic Sequence 348
acgtcgttcc cccccccccc 20 349 20 DNA Artificial Sequence Synthetic
Sequence 349 ctgtcgttcc cccccccccc 20 350 24 DNA Artificial
Sequence misc_feature (1)...(3) Biotin moiety attached at 5' end of
sequence. 350 tttttcgtcg ttcccccccc cccc 24 351 20 DNA Artificial
Sequence misc_feature (18)...(20) Biotin moiety attached at 3' end
of sequence. 351 tcgtcgttcc cccccccccc 20 352 24 DNA Artificial
Sequence misc_feature (22)...(24) Biotin moiety attached at 3' end
of sequence. 352 tcgtcgtttt gtcgttttgt cgtt 24 353 20 DNA
Artificial Sequence Synthetic Sequence 353 tccagttcct tcctcagtct 20
354 24 DNA Artificial Sequence modified_base (2)...(2) m5c 354
tngtcgtttt gtcgttttgt cgtt 24 355 15 DNA Artificial Sequence
Synthetic Sequence 355 tcctggaggg gaagt 15 356 15 DNA Artificial
Sequence Synthetic Sequence 356 tcctgaaaag gaagt 15 357 17 DNA
Artificial Sequence Synthetic Sequence 357 tcgtcgttcc ccccccc 17
358 24 DNA Artificial Sequence Synthetic Sequence 358 tngtngtttt
gtngttttgt ngtt 24 359 20 DNA Artificial Sequence Synthetic
Sequence 359 ggggtcaagc ttgagggggg 20 360 20 DNA Artificial
Sequence Synthetic Sequence 360 tgctgcttcc cccccccccc 20 361 14 DNA
Artificial Sequence Synthetic Sequence 361 tcgtcgtcgt cgtt 14 362
14 DNA Artificial Sequence Synthetic Sequence 362 tcgtcgtcgt cgtt
14 363 14 DNA Artificial Sequence Synthetic Sequence 363 tcgtcgtcgt
cgtt 14 364 10 DNA Artificial Sequence Synthetic Sequence 364
tcaacgttga 10 365 8 DNA Artificial Sequence Synthetic Sequence 365
tcaacgtt 8 366 20 DNA Artificial Sequence Synthetic Sequence 366
atagttttcc atttttttac 20 367 20 DNA Artificial Sequence Synthetic
Sequence 367 aatagtcgcc atcgcgcgac 20 368 20 DNA Artificial
Sequence Synthetic Sequence 368 aatagtcgcc atcccgggac 20 369 20 DNA
Artificial Sequence Synthetic Sequence 369 aatagtcgcc atcccccccc 20
370 24 DNA Artificial Sequence Synthetic Sequence 370 tgctgctttt
gtgcttttgt gctt 24 371 24 DNA Artificial Sequence Synthetic
Sequence 371 ctgtgctttc tgtgtttttc tgtg 24 372 24 DNA Artificial
Sequence Synthetic Sequence 372 ctaatctttc taattttttt ctaa 24 373
26 DNA Artificial Sequence Synthetic Sequence 373 tcgtcgttgg
tgtcgttggt gtcgtt 26 374 24 DNA Artificial Sequence Synthetic
Sequence 374 tcgtcgttgg ttgtcgtttt ggtt 24 375 24 DNA Artificial
Sequence Synthetic Sequence 375 accatggacg agctgtttcc cctc 24 376
20 DNA Artificial Sequence Synthetic Sequence 376 tcgtcgtttt
gcgtgcgttt 20 377 20 DNA Artificial Sequence Synthetic Sequence 377
ctgtaagtga gcttggagag 20 378 18 DNA Artificial Sequence Synthetic
Sequence 378 gagaacgctg gaccttcc 18 379 20 DNA Artificial Sequence
Synthetic Sequence 379 cgggcgactc agtctatcgg 20 380 37 DNA
Artificial Sequence Synthetic Sequence 380 gttctcagat aaagcggaac
cagcaacaga cacagaa 37 381 37 DNA Artificial Sequence Synthetic
Sequence 381 ttctgtgtct gttgctggtt ccgctttatc tgagaac 37 382 23 DNA
Artificial Sequence Synthetic Sequence 382 cagacacaga agcccgatag
acg 23 383 20 DNA Artificial Sequence Synthetic Sequence 383
agacagacac gaaacgaccg 20 384 20 DNA Artificial Sequence Synthetic
Sequence 384 gtctgtccca tgatctcgaa 20 385 20 DNA Artificial
Sequence Synthetic Sequence 385 gctggccagc ttacctcccg 20 386 21 DNA
Artificial Sequence Synthetic Sequence 386 ggggcctcta tacaacctgg g
21 387 18 DNA Artificial Sequence Synthetic Sequence 387 ggggtccctg
agactgcc 18 388 20 DNA Artificial Sequence Synthetic Sequence 388
gagaacgctg gaccttccat 20 389 20 DNA Artificial Sequence Synthetic
Sequence 389 tccatgtcgg tcctgatgct 20 390 20 DNA Artificial
Sequence Synthetic Sequence 390 ctcttgcgac ctggaaggta 20 391 20 DNA
Artificial Sequence Synthetic Sequence 391 aggtacagcc aggactacga 20
392 24 DNA Artificial Sequence Synthetic Sequence 392 accatggacg
acctgtttcc cctc 24 393 24 DNA Artificial Sequence Synthetic
Sequence 393 accatggatt acctttttcc cctt 24 394 20 DNA Artificial
Sequence Synthetic Sequence 394 atggaaggtc cagcgttctc 20 395 20 DNA
Artificial Sequence Synthetic Sequence 395 agcatcagga ccgacatgga 20
396 20 DNA Artificial Sequence Synthetic Sequence 396 ctctccaagc
tcacttacag 20 397 21 DNA Artificial Sequence Synthetic Sequence 397
tccctgagac tgccccacct t 21 398 20 DNA Artificial Sequence Synthetic
Sequence 398 gccaccaaaa cttgtccatg 20 399 20 DNA Artificial
Sequence Synthetic Sequence 399 gtccatggcg tgcgggatga 20 400 19 DNA
Artificial Sequence Synthetic Sequence 400 cctctataca acctgggac 19
401 20 DNA Artificial Sequence Synthetic Sequence 401 cgggcgactc
agtctatcgg 20 402 20 DNA Artificial Sequence Synthetic Sequence 402
gcgctaccgg tagcctgagt 20 403 35 DNA Artificial Sequence Synthetic
Sequence 403 cgactgccga acaggatatc ggtgatcagc actgg 35 404 35 DNA
Artificial Sequence Synthetic Sequence 404 ccagtgctga tcaccgatat
cctgttcggc agtcg 35 405 17 DNA Artificial Sequence Synthetic
Sequence 405 ccaggttgta tagaggc 17 406 18 DNA Artificial Sequence
Synthetic Sequence 406 tctcccagcg tacgccat 18 407 18 DNA Artificial
Sequence Synthetic Sequence 407 tctcccagcg tgcgtttt 18 408 18 DNA
Artificial Sequence Synthetic Sequence 408 tctcccgacg tgcgccat 18
409 18 DNA Artificial Sequence Synthetic Sequence 409 tctcccgtcg
tgcgccat 18 410 20 DNA Artificial Sequence Synthetic Sequence 410
ataatcgtcg ttcaagcaag 20 411 23 DNA Artificial Sequence Synthetic
Sequence 411 tcgtcgtttt gtcgttttgt cgt 23 412 24 DNA Artificial
Sequence Synthetic Sequence 412 tcgtcgtttt gtcgttttgt cgtt 24 413
24 DNA Artificial Sequence Synthetic Sequence 413 tcgtcgtttt
gtcgttttgt cgtt 24 414 24 DNA Artificial Sequence misc_difference
(3)...(3) n is a or c or g or t/u 414 tcntcgtntt ntcgtnttnt cgtn 24
415 17 DNA Artificial Sequence Synthetic Sequence 415 tctcccagcg
tcgccat 17 416 17 DNA Artificial Sequence Synthetic Sequence 416
tctcccatcg tcgccat 17 417 21 DNA Artificial Sequence Synthetic
Sequence 417 ataatcgtgc gttcaagaaa g 21 418 20 DNA Artificial
Sequence Synthetic Sequence 418 ataatcgacg ttcccccccc 20 419 20 DNA
Artificial Sequence Synthetic Sequence 419 tctatcgacg ttcaagcaag 20
420 14 DNA Artificial Sequence Synthetic Sequence 420 tcctgacggg
gagt 14 421 19 DNA Artificial Sequence Synthetic Sequence 421
tccatgacgt tcctgatcc 19 422 19 DNA Artificial Sequence Synthetic
Sequence 422 tccatgacgt tcctgatcc 19 423 19 DNA Artificial Sequence
Synthetic Sequence 423 tccatgacgt tcctgatcc 19 424 15 DNA
Artificial Sequence Synthetic Sequence 424 tcctggcgtg gaagt 15 425
19 DNA Artificial Sequence
Synthetic Sequence 425 tccatgacgt tcctgatcc 19 426 21 DNA
Artificial Sequence Synthetic Sequence 426 tcgtcgctgt tgtcgtttct t
21 427 24 DNA Artificial Sequence Synthetic Sequence 427 agcagcttta
gagctttaga gctt 24 428 24 DNA Artificial Sequence Synthetic
Sequence 428 cccccccccc cccccccccc cccc 24 429 32 DNA Artificial
Sequence Synthetic Sequence 429 tcgtcgtttt gtcgttttgt cgttttgtcg tt
32 430 28 DNA Artificial Sequence Synthetic Sequence 430 tcgtcgtttt
ttgtcgtttt ttgtcgtt 28 431 20 DNA Artificial Sequence Synthetic
Sequence 431 tcgtcgtttt tttttttttt 20 432 20 DNA Artificial
Sequence Synthetic Sequence 432 tttttcaacg ttgatttttt 20 433 24 DNA
Artificial Sequence Synthetic Sequence 433 tttttttttt tttttttttt
tttt 24 434 20 DNA Artificial Sequence Synthetic Sequence 434
ggggtcgtcg ttttgggggg 20 435 24 DNA Artificial Sequence Synthetic
Sequence 435 tcgtcgtttt gtcgttttgg gggg 24 436 27 DNA Artificial
Sequence Synthetic Sequence 436 tcgtcgctgt ctccgcttct tcttgcc 27
437 15 DNA Artificial Sequence Synthetic Sequence 437 tcgtcgctgt
ctccg 15 438 20 DNA Artificial Sequence Synthetic Sequence 438
ctgtaagtga gcttggagag 20 439 20 DNA Artificial Sequence Synthetic
Sequence 439 gagaacgctg gaccttccat 20 440 17 DNA Artificial
Sequence Synthetic Sequence 440 ccaggttgta tagaggc 17 441 17 DNA
Artificial Sequence Synthetic Sequence 441 gctagacgtt agcgtga 17
442 20 DNA Artificial Sequence Synthetic Sequence 442 ggagctcttc
gaacgccata 20 443 20 DNA Artificial Sequence Synthetic Sequence 443
tctccatgat ggttttatcg 20 444 21 DNA Artificial Sequence Synthetic
Sequence 444 aaggtggggc agtctcaggg a 21 445 20 DNA Artificial
Sequence Synthetic Sequence 445 atcggaggac tggcgcgccg 20 446 20 DNA
Artificial Sequence Synthetic Sequence 446 ttaggacaag gtctagggtg 20
447 20 DNA Artificial Sequence Synthetic Sequence 447 accacaacga
gaggaacgca 20 448 20 DNA Artificial Sequence Synthetic Sequence 448
ggcagtgcag gctcaccggg 20 449 17 DNA Artificial Sequence Synthetic
Sequence 449 gaaccttcca tgctgtt 17 450 17 DNA Artificial Sequence
Synthetic Sequence 450 gctagacgtt agcgtga 17 451 20 DNA Artificial
Sequence Synthetic Sequence 451 gcttggaggg cctgtaagtg 20 452 12 DNA
Artificial Sequence Synthetic Sequence 452 gtagccttcc ta 12 453 14
DNA Artificial Sequence Synthetic Sequence 453 cggtagcctt ccta 14
454 16 DNA Artificial Sequence Synthetic Sequence 454 cacggtagcc
ttccta 16 455 18 DNA Artificial Sequence Synthetic Sequence 455
agcacggtag ccttccta 18 456 18 DNA Artificial Sequence Synthetic
Sequence 456 gaacgctgga ccttccat 18 457 10 DNA Artificial Sequence
Synthetic Sequence 457 gaccttccat 10 458 12 DNA Artificial Sequence
Synthetic Sequence 458 tggaccttcc at 12 459 14 DNA Artificial
Sequence Synthetic Sequence 459 gctggacctt ccat 14 460 16 DNA
Artificial Sequence Synthetic Sequence 460 acgctggacc ttccat 16 461
20 DNA Artificial Sequence Synthetic Sequence 461 taagctctgt
caacgccagg 20 462 22 DNA Artificial Sequence Synthetic Sequence 462
gagaacgctg gaccttccat gt 22 463 20 DNA Artificial Sequence
Synthetic Sequence 463 tccatgtcgg tcctgatgct 20 464 21 DNA
Artificial Sequence Synthetic Sequence 464 ttcatgcctt gcaaaatggc g
21 465 20 DNA Artificial Sequence Synthetic Sequence 465 tgctagctgt
gcctgtacct 20 466 20 DNA Artificial Sequence Synthetic Sequence 466
agcatcagga ccgacatgga 20 467 22 DNA Artificial Sequence Synthetic
Sequence 467 gaccttccat gtcggtcctg at 22 468 20 DNA Artificial
Sequence Synthetic Sequence 468 acaaccacga gaacgggaac 20 469 20 DNA
Artificial Sequence Synthetic Sequence 469 gaaccttcca tgctgttccg 20
470 20 DNA Artificial Sequence Synthetic Sequence 470 caatcaatct
gaggagaccc 20 471 20 DNA Artificial Sequence Synthetic Sequence 471
tcagctctgg tactttttca 20 472 20 DNA Artificial Sequence Synthetic
Sequence 472 tggttacggt ctgtcccatg 20 473 20 DNA Artificial
Sequence Synthetic Sequence 473 gtctatcgga ggactggcgc 20 474 20 DNA
Artificial Sequence Synthetic Sequence 474 cattttacgg gcgggcgggc 20
475 20 DNA Artificial Sequence Synthetic Sequence 475 gaggggacca
ttttacgggc 20 476 20 DNA Artificial Sequence Synthetic Sequence 476
tgtccagccg aggggaccat 20 477 20 DNA Artificial Sequence Synthetic
Sequence 477 cgggcttacg gcggatgctg 20 478 20 DNA Artificial
Sequence Synthetic Sequence 478 tggaccttct atgtcggtcc 20 479 20 DNA
Artificial Sequence Synthetic Sequence 479 tgtcccatgt ttttagaagc 20
480 20 DNA Artificial Sequence Synthetic Sequence 480 gtggttacgg
tcgtgcccat 20 481 20 DNA Artificial Sequence Synthetic Sequence 481
cctccaaatg aaagaccccc 20 482 20 DNA Artificial Sequence Synthetic
Sequence 482 ttgtactctc catgatggtt 20 483 20 DNA Artificial
Sequence Synthetic Sequence 483 ttccatgctg ttccggctgg 20 484 20 DNA
Artificial Sequence Synthetic Sequence 484 gaccttctat gtcggtcctg 20
485 20 DNA Artificial Sequence Synthetic Sequence 485 gagaccgctc
gaccttcgat 20 486 20 DNA Artificial Sequence Synthetic Sequence 486
ttgccccata ttttagaaac 20 487 18 DNA Artificial Sequence Synthetic
Sequence 487 ttgaaactga ggtgggac 18 488 21 DNA Artificial Sequence
Synthetic Sequence 488 ctatcggagg actggcgcgc c 21 489 20 DNA
Artificial Sequence Synthetic Sequence 489 cttggagggc ctcccggcgg 20
490 20 DNA Artificial Sequence Synthetic Sequence 490 gctgaacctt
ccatgctgtt 20 491 32 DNA Artificial Sequence Synthetic Sequence 491
tagaaacagc attcttcttt tagggcagca ca 32 492 24 DNA Artificial
Sequence Synthetic Sequence 492 agatggttct cagataaagc ggaa 24 493
24 DNA Artificial Sequence Synthetic Sequence 493 ttccgcttta
tctgagaacc atct 24 494 23 DNA Artificial Sequence Synthetic
Sequence 494 gtcccaggtt gtatagaggc tgc 23 495 20 DNA Artificial
Sequence Synthetic Sequence 495 gcgccagtcc tccgatagac 20 496 20 DNA
Artificial Sequence Synthetic Sequence 496 atcggaggac tggcgcgccg 20
497 20 DNA Artificial Sequence Synthetic Sequence 497 ggtctgtccc
atatttttag 20 498 20 DNA Artificial Sequence Synthetic Sequence 498
tttttcaacg ttgagggggg 20 499 21 DNA Artificial Sequence Synthetic
Sequence 499 tttttcaagc gttgattttt t 21 500 20 DNA Artificial
Sequence Synthetic Sequence 500 ggggtcaacg ttgatttttt 20 501 25 DNA
Artificial Sequence Synthetic Sequence 501 ggggttttca acgttttgag
ggggg 25 502 20 DNA Artificial Sequence Synthetic Sequence 502
ggttacggtc tgtcccatat 20 503 20 DNA Artificial Sequence Synthetic
Sequence 503 ctgtcccata tttttagaca 20 504 20 DNA Artificial
Sequence Synthetic Sequence 504 accatcctga ggccattcgg 20 505 23 DNA
Artificial Sequence Synthetic Sequence 505 cgtctatcgg gcttctgtgt
ctg 23 506 21 DNA Artificial Sequence Synthetic Sequence 506
ggccatccca cattgaaagt t 21 507 22 DNA Artificial Sequence Synthetic
Sequence 507 ccaaatatcg gtggtcaagc ac 22 508 22 DNA Artificial
Sequence Synthetic Sequence 508 gtgcttgacc accgatattt gg 22 509 26
DNA Artificial Sequence Synthetic Sequence 509 gtgctgatca
ccgatatcct gttcgg 26 510 27 DNA Artificial Sequence Synthetic
Sequence 510 ggccaacttt caatgtggga tggcctc 27 511 27 DNA Artificial
Sequence Synthetic Sequence 511 ttccgccgaa tggcctcagg atggtac 27
512 36 DNA Artificial Sequence Synthetic Sequence 512 tatagtccct
gagactgccc caccttctca acaacc 36 513 27 DNA Artificial Sequence
Synthetic Sequence 513 gcagcctcta tacaacctgg gacggga 27 514 22 DNA
Artificial Sequence Synthetic Sequence 514 ctatcggagg actggcgcgc cg
22 515 21 DNA Artificial Sequence Synthetic Sequence 515 tatcggagga
ctggcgcgcc g 21 516 21 DNA Artificial Sequence Synthetic Sequence
516 gatcggagga ctggcgcgcc g 21 517 26 DNA Artificial Sequence
Synthetic Sequence 517 ccgaacagga tatcggtgat cagcac 26 518 24 DNA
Artificial Sequence Synthetic Sequence 518 ttttggggtc aacgttgagg
gggg 24 519 20 DNA Artificial Sequence Synthetic Sequence 519
ggggtcaacg ttgagggggg 20 520 20 DNA Artificial Sequence Synthetic
Sequence 520 cgcgcgcgcg cgcgcgcgcg 20 521 20 DNA Artificial
Sequence Synthetic Sequence 521 ggggcatgac gttcgggggg 20 522 20 DNA
Artificial Sequence Synthetic Sequence 522 ggggcatgac gttcaaaaaa 20
523 20 DNA Artificial Sequence Synthetic Sequence 523 ggggcatgag
cttcgggggg 20 524 20 DNA Artificial Sequence Synthetic Sequence 524
ggggcatgac gttcgggggg 20 525 20 DNA Artificial Sequence Synthetic
Sequence 525 aaaacatgac gttcaaaaaa 20 526 20 DNA Artificial
Sequence Synthetic Sequence 526 aaaacatgac gttcgggggg 20 527 20 DNA
Artificial Sequence Synthetic Sequence 527 ggggcatgac gttcaaaaaa 20
528 24 DNA Artificial Sequence Synthetic Sequence 528 accatggacg
atctgtttcc cctc 24 529 24 DNA Artificial Sequence Synthetic
Sequence 529 gccatggacg aactgttccc cctc 24 530 20 DNA Artificial
Sequence Synthetic Sequence 530 cccccccccc cccccccccc 20 531 20 DNA
Artificial Sequence Synthetic Sequence 531 gggggggggg gggggggggg 20
532 20 DNA Artificial Sequence Synthetic Sequence 532 gctgtaaaat
gaatcggccg 20 533 20 DNA Artificial Sequence Synthetic Sequence 533
ttcgggcgga ctcctccatt 20 534 20 DNA Artificial Sequence Synthetic
Sequence 534 tatgccgcgc ccggacttat 20 535 20 DNA Artificial
Sequence Synthetic Sequence 535 ggggtaatcg atcagggggg 20 536 20 DNA
Artificial Sequence Synthetic Sequence 536 tttgagaacg ctggaccttc 20
537 20 DNA Artificial Sequence Synthetic Sequence 537 gatcgctgat
ctaatgctcg 20 538 20 DNA Artificial Sequence Synthetic Sequence 538
gtcggtcctg atgctgttcc 20 539 20 DNA Artificial Sequence Synthetic
Sequence 539 tcgtcgtcag ttcgctgtcg 20 540 18 DNA Artificial
Sequence Synthetic Sequence 540 ctggaccttc catgtcgg 18 541 17 DNA
Artificial Sequence Synthetic Sequence 541 gctcgttcag cgcgtct 17
542 16 DNA Artificial Sequence Synthetic Sequence 542 ctggaccttc
catgtc 16 543 16 DNA Artificial Sequence Synthetic Sequence 543
cactgtcctt cgtcga 16 544 20 DNA Artificial Sequence Synthetic
Sequence 544 cgctggacct tccatgtcgg 20 545 20 DNA Artificial
Sequence Synthetic Sequence 545 gctgagctca tgccgtctgc 20 546 20 DNA
Artificial Sequence Synthetic Sequence 546 aacgctggac cttccatgtc 20
547 20 DNA Artificial Sequence Synthetic Sequence 547 tgcatgccgt
acacagctct 20 548 20 DNA Artificial Sequence Synthetic Sequence 548
ccttccatgt cggtcctgat 20 549 20 DNA Artificial Sequence Synthetic
Sequence 549 tactcttcgg atcccttgcg 20 550 18 DNA Artificial
Sequence Synthetic Sequence 550 ttccatgtcg gtcctgat 18 551 18 DNA
Artificial Sequence Synthetic Sequence 551 ctgattgctc tctcgtga 18
552 20 DNA Artificial Sequence Synthetic Sequence 552 ggcgttattc
ctgactcgcc 20 553 22 DNA Artificial Sequence Synthetic Sequence 553
cctacgttgt atgcgcccag ct 22 554 20 DNA Artificial Sequence
Synthetic Sequence 554 ggggtaatcg atgagggggg 20 555 20 DNA
Artificial Sequence Synthetic Sequence 555 ttcgggcgga ctcctccatt 20
556 20 DNA Artificial Sequence Synthetic Sequence 556 tttttttttt
tttttttttt 20 557 20 DNA Artificial Sequence Synthetic Sequence 557
gggggttttt tttttggggg 20 558 20 DNA Artificial Sequence Synthetic
Sequence 558 tttttggggg gggggttttt 20 559 19 DNA Artificial
Sequence Synthetic Sequence 559 gggggggggg ggggggggt 19 560 20 DNA
Artificial Sequence Synthetic Sequence 560 aaaaaaaaaa aaaaaaaaaa 20
561 20 DNA Artificial Sequence Synthetic Sequence 561 cccccaaaaa
aaaaaccccc 20 562 20 DNA Artificial Sequence Synthetic Sequence 562
aaaaaccccc cccccaaaaa 20 563 27 DNA Artificial Sequence Synthetic
Sequence 563 tttgaattca ggactggtga ggttgag 27 564 27 DNA Artificial
Sequence Synthetic Sequence 564 tttgaatcct cagcggtctc cagtggc 27
565 45 DNA Artificial Sequence Synthetic Sequence 565 aattctctat
cggggcttct gtgtctgttg ctggttccgc tttat 45 566 45 DNA Artificial
Sequence Synthetic Sequence 566 ctagataaag cggaaccagc aacagacaca
gaagccccga tagag 45 567 28 DNA Artificial Sequence Synthetic
Sequence 567 ttttctagag aggtgcacaa tgctctgg 28 568 29 DNA
Artificial Sequence Synthetic Sequence
568 tttgaattcc gtgtacagaa gcgagaagc 29 569 31 DNA Artificial
Sequence Synthetic Sequence 569 tttgcggccg ctagacttaa cctgagagat a
31 570 29 DNA Artificial Sequence Synthetic Sequence 570 tttgggccca
cgagagacag agacacttc 29 571 29 DNA Artificial Sequence Synthetic
Sequence 571 tttgggcccg cttctcgctt ctgtacacg 29 572 20 DNA
Artificial Sequence Synthetic Sequence 572 gagaacgctg gaccttccat 20
573 20 DNA Artificial Sequence Synthetic Sequence 573 tccatgtcgg
tcctgatgct 20 574 6 DNA Artificial Sequence Synthetic Sequence 574
ctgtcg 6 575 6 DNA Artificial Sequence Synthetic Sequence 575
tcgtga 6 576 6 DNA Artificial Sequence Synthetic Sequence 576
cgtcga 6 577 6 DNA Artificial Sequence Synthetic Sequence 577
agtgct 6 578 6 DNA Artificial Sequence Synthetic Sequence 578
ctgtcg 6 579 6 DNA Artificial Sequence Synthetic Sequence 579
agtgct 6 580 6 DNA Artificial Sequence Synthetic Sequence 580
cgtcga 6 581 6 DNA Artificial Sequence Synthetic Sequence 581
tcgtga 6 582 20 DNA Artificial Sequence Synthetic Sequence 582
gagaacgctc cagcttcgat 20 583 17 DNA Artificial Sequence Synthetic
Sequence 583 gctagacgta agcgtga 17 584 20 DNA Artificial Sequence
Synthetic Sequence 584 gagaacgctc gaccttccat 20 585 21 DNA
Artificial Sequence Synthetic Sequence 585 gagaacgctg gacctatcca t
21 586 17 DNA Artificial Sequence Synthetic Sequence 586 gctagaggtt
agcgtga 17 587 19 DNA Artificial Sequence Synthetic Sequence 587
gagaacgctg gacttccat 19 588 17 DNA Artificial Sequence Synthetic
Sequence 588 tcacgctaac gtctagc 17 589 17 DNA Artificial Sequence
misc_feature (1)...(3) Conjugated to biotin moiety. 589 gctagacgtt
agcgtga 17 590 20 DNA Artificial Sequence Synthetic Sequence 590
atggaaggtc gagcgttctc 20 591 20 DNA Artificial Sequence Synthetic
Sequence 591 gagaacgctg gaccttcgat 20 592 20 DNA Artificial
Sequence Synthetic Sequence 592 gagaacgatg gaccttccat 20 593 17 DNA
Artificial Sequence Synthetic Sequence 593 gagaacgctg gatccat 17
594 20 DNA Artificial Sequence Synthetic Sequence 594 gagaacgctc
cagcactgat 20 595 20 DNA Artificial Sequence Synthetic Sequence 595
tccatgtcgg tcctgctgat 20 596 20 DNA Artificial Sequence Synthetic
Sequence 596 atgtcctcgg tcctgatgct 20 597 20 DNA Artificial
Sequence Synthetic Sequence 597 gagaacgctc caccttccat 20 598 20 DNA
Artificial Sequence Synthetic Sequence 598 gagaacgctg gaccttcgta 20
599 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to
biotin moiety. 599 atggaaggtc cagcgttctc 20 600 6 DNA Artificial
Sequence Synthetic Sequence 600 tcctga 6 601 8 DNA Artificial
Sequence Synthetic Sequence 601 tcaacgtt 8 602 6 DNA Artificial
Sequence Synthetic Sequence 602 aacgtt 6 603 8 DNA Artificial
Sequence Synthetic Sequence 603 aacgttga 8 604 17 DNA Artificial
Sequence Synthetic Sequence 604 tcacgctaac ctctagc 17 605 20 DNA
Artificial Sequence Synthetic Sequence 605 gagaacgctg gaccttgcat 20
606 14 DNA Artificial Sequence Synthetic Sequence 606 gctggacctt
ccat 14 607 22 DNA Artificial Sequence Synthetic Sequence 607
gagaacgctg gacctcatcc at 22 608 23 DNA Artificial Sequence
Synthetic Sequence 608 gagaacgctg gacgctcatc cat 23 609 15 DNA
Artificial Sequence Synthetic Sequence 609 aacgttgagg ggcat 15 610
15 DNA Artificial Sequence Synthetic Sequence 610 atgcccctca acgtt
15 611 10 DNA Artificial Sequence Synthetic Sequence 611 tcaacgttga
10 612 14 DNA Artificial Sequence Synthetic Sequence 612 gctggacctt
ccat 14 613 7 DNA Artificial Sequence Synthetic Sequence 613
caacgtt 7 614 10 DNA Artificial Sequence Synthetic Sequence 614
acaacgttga 10 615 6 DNA Artificial Sequence Synthetic Sequence 615
tcacgt 6 616 8 DNA Artificial Sequence Synthetic Sequence 616
tcaagctt 8 617 6 DNA Artificial Sequence Synthetic Sequence 617
tcgtca 6 618 8 DNA Artificial Sequence Synthetic Sequence 618
aggatatc 8 619 8 DNA Artificial Sequence Synthetic Sequence 619
tagacgtc 8 620 8 DNA Artificial Sequence Synthetic Sequence 620
gacgtcat 8 621 8 DNA Artificial Sequence Synthetic Sequence 621
ccatcgat 8 622 8 DNA Artificial Sequence Synthetic Sequence 622
atcgatgt 8 623 8 DNA Artificial Sequence Synthetic Sequence 623
atgcatgt 8 624 8 DNA Artificial Sequence Synthetic Sequence 624
ccatgcat 8 625 8 DNA Artificial Sequence Synthetic Sequence 625
agcgctga 8 626 8 DNA Artificial Sequence Synthetic Sequence 626
tcagcgct 8 627 8 DNA Artificial Sequence Synthetic Sequence 627
ccttcgat 8 628 18 DNA Artificial Sequence Synthetic Sequence 628
gtgccggggt ctccgggc 18 629 18 DNA Artificial Sequence Synthetic
Sequence 629 gctgtggggc ggctcctg 18 630 8 DNA Artificial Sequence
misc_feature (1)...(3) Conjugated to biotin moiety. 630 tcaacgtt 8
631 8 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to
FITC moiety. 631 tcaacgtt 8 632 8 DNA Artificial Sequence
misc_feature (1)...(3) Conjugated to FITC moiety. 632 aacgttga 8
633 7 DNA Artificial Sequence Synthetic Sequence 633 tcaacgt 7 634
7 DNA Artificial Sequence Synthetic Sequence 634 aacgttg 7 635 6
DNA Artificial Sequence Synthetic Sequence 635 cgacga 6 636 8 DNA
Artificial Sequence Synthetic Sequence 636 tcaacgtt 8 637 5 DNA
Artificial Sequence Synthetic Sequence 637 tcgga 5 638 8 DNA
Artificial Sequence Synthetic Sequence 638 agaacgtt 8 639 8 DNA
Artificial Sequence Synthetic Sequence 639 tcatcgat 8 640 8 DNA
Artificial Sequence Synthetic Sequence 640 taaacgtt 8 641 8 DNA
Artificial Sequence Synthetic Sequence 641 ccaacgtt 8 642 6 DNA
Artificial Sequence Synthetic Sequence 642 gctcga 6 643 6 DNA
Artificial Sequence Synthetic Sequence 643 cgacgt 6 644 6 DNA
Artificial Sequence Synthetic Sequence 644 cgtcgt 6 645 6 DNA
Artificial Sequence Synthetic Sequence 645 acgtgt 6 646 6 DNA
Artificial Sequence Synthetic Sequence 646 cgttcg 6 647 20 DNA
Artificial Sequence Synthetic Sequence 647 gagcaagctg gaccttccat 20
648 6 DNA Artificial Sequence Synthetic Sequence 648 cgcgta 6 649 6
DNA Artificial Sequence Synthetic Sequence 649 cgtacg 6 650 8 DNA
Artificial Sequence Synthetic Sequence 650 tcaccggt 8 651 20 DNA
Artificial Sequence Synthetic Sequence 651 caagagatgc taacaatgca 20
652 20 DNA Artificial Sequence Synthetic Sequence 652 acccatcaat
agctctgtgc 20 653 8 DNA Artificial Sequence Synthetic Sequence 653
ccatcgat 8 654 8 DNA Artificial Sequence Synthetic Sequence 654
tcgacgtc 8 655 8 DNA Artificial Sequence Synthetic Sequence 655
ctagcgct 8 656 8 DNA Artificial Sequence Synthetic Sequence 656
taagcgct 8 657 13 DNA Artificial Sequence Synthetic Sequence 657
tcgcgaattc gcg 13 658 19 DNA Artificial Sequence Synthetic Sequence
658 atggaaggtc cagcgttct 19 659 17 DNA Artificial Sequence
Synthetic Sequence 659 actggacgtt agcgtga 17 660 18 DNA Artificial
Sequence Synthetic Sequence 660 cgcctggggc tggtctgg 18 661 18 DNA
Artificial Sequence Synthetic Sequence 661 gtgtcggggt ctccgggc 18
662 18 DNA Artificial Sequence Synthetic Sequence 662 gtgccggggt
ctccgggc 18 663 18 DNA Artificial Sequence Synthetic Sequence 663
cgccgtcgcg gcggttgg 18 664 21 DNA Artificial Sequence Synthetic
Sequence 664 gaagttcacg ttgaggggca t 21 665 21 DNA Artificial
Sequence Synthetic Sequence 665 atctggtgag ggcaagctat g 21 666 21
DNA Artificial Sequence Synthetic Sequence 666 gttgaaaccc
gagaacatca t 21 667 8 DNA Artificial Sequence Synthetic Sequence
667 gcaacgtt 8 668 8 DNA Artificial Sequence Synthetic Sequence 668
gtaacgtt 8 669 8 DNA Artificial Sequence Synthetic Sequence 669
cgaacgtt 8 670 8 DNA Artificial Sequence Synthetic Sequence 670
gaaacgtt 8 671 8 DNA Artificial Sequence Synthetic Sequence 671
caaacgtt 8 672 8 DNA Artificial Sequence Synthetic Sequence 672
ctaacgtt 8 673 8 DNA Artificial Sequence Synthetic Sequence 673
ggaacgtt 8 674 8 DNA Artificial Sequence Synthetic Sequence 674
tgaacgtt 8 675 8 DNA Artificial Sequence Synthetic Sequence 675
acaacgtt 8 676 8 DNA Artificial Sequence Synthetic Sequence 676
ttaacgtt 8 677 8 DNA Artificial Sequence Synthetic Sequence 677
aaaacgtt 8 678 8 DNA Artificial Sequence Synthetic Sequence 678
ataacgtt 8 679 8 DNA Artificial Sequence Synthetic Sequence 679
aacgttct 8 680 8 DNA Artificial Sequence Synthetic Sequence 680
tccgatcg 8 681 8 DNA Artificial Sequence Synthetic Sequence 681
tccgtacg 8 682 17 DNA Artificial Sequence Synthetic Sequence 682
gctagacgct agcgtga 17 683 25 DNA Artificial Sequence Synthetic
Sequence 683 gagaacgctg gacctcatca tccat 25 684 20 DNA Artificial
Sequence Synthetic Sequence 684 gagaacgcta gaccttctat 20 685 17 DNA
Artificial Sequence Synthetic Sequence 685 actagacgtt agtgtga 17
686 22 DNA Artificial Sequence Synthetic Sequence 686 cacaccttgg
tcaatgtcac gt 22 687 22 DNA Artificial Sequence Synthetic Sequence
687 tctccatcct atggttttat cg 22 688 15 DNA Artificial Sequence
Synthetic Sequence 688 cgctggacct tccat 15 689 23 DNA Artificial
Sequence Synthetic Sequence 689 caccaccttg gtcaatgtca cgt 23 690 17
DNA Artificial Sequence Synthetic Sequence 690 gctagacgtt agctgga
17 691 17 DNA Artificial Sequence Synthetic Sequence 691 agtgcgattg
cagatcg 17 692 24 DNA Artificial Sequence Synthetic Sequence 692
ttttcgtttt gtggttttgt ggtt 24 693 23 DNA Artificial Sequence
Synthetic Sequence 693 ttttcgtttg tcgttttgtc gtt 23 694 24 DNA
Artificial Sequence Synthetic Sequence 694 tttttgtttt gtggttttgt
ggtt 24 695 20 DNA Artificial Sequence Synthetic Sequence 695
accgcatgga ttctaggcca 20 696 15 DNA Artificial Sequence Synthetic
Sequence 696 gctagacgtt agcgt 15 697 17 DNA Artificial Sequence
Synthetic Sequence 697 aacgctggac cttccat 17 698 8 DNA Artificial
Sequence modified_base (5)...(5) m5c 698 tcaangtt 8 699 8 DNA
Artificial Sequence Synthetic Sequence 699 ccttcgat 8 700 17 DNA
Artificial Sequence Synthetic Sequence 700 actagacgtt agtgtga 17
701 17 DNA Artificial Sequence Synthetic Sequence 701 gctagaggtt
agcgtga 17 702 20 DNA Artificial Sequence Synthetic Sequence 702
atggactctc cagcgttctc 20 703 20 DNA Artificial Sequence Synthetic
Sequence 703 atcgactctc gagcgttctc 20 704 13 DNA Artificial
Sequence Synthetic Sequence 704 gctagacgtt agc 13 705 9 DNA
Artificial Sequence Synthetic Sequence 705 gctagacgt 9 706 17 DNA
Artificial Sequence Synthetic Sequence 706 agtgcgattc gagatcg 17
707 8 DNA Artificial Sequence modified_base (5)...(5) m5c 707
tcagngct 8 708 18 DNA Artificial Sequence Synthetic Sequence 708
ctgattgctc tctcgtga 18 709 8 DNA Artificial Sequence modified_base
(2)...(2) m5c 709 tnaacgtt 8 710 20 DNA
Artificial Sequence modified_base (6)...(6) m5c 710 gagaangctg
gaccttccat 20 711 17 DNA Artificial Sequence Synthetic Sequence 711
gctagacgtt aggctga 17 712 14 DNA Artificial Sequence Synthetic
Sequence 712 gctacttagc gtga 14 713 15 DNA Artificial Sequence
Synthetic Sequence 713 gctaccttag cgtga 15 714 19 DNA Artificial
Sequence Synthetic Sequence 714 atcgacttcg agcgttctc 19 715 20 DNA
Artificial Sequence Synthetic Sequence 715 atgcactctg cagcgttctc 20
716 20 DNA Artificial Sequence Synthetic Sequence 716 agtgactctc
cagcgttctc 20 717 17 DNA Artificial Sequence Synthetic Sequence 717
gccagatgtt agctgga 17 718 18 DNA Artificial Sequence Synthetic
Sequence 718 atcgactcga gcgttctc 18 719 17 DNA Artificial Sequence
Synthetic Sequence 719 atcgatcgag cgttctc 17 720 20 DNA Artificial
Sequence misc_feature (1)...(3) Conjugated to biotin moiety. 720
gagaacgctc gaccttcgat 20 721 17 DNA Artificial Sequence Synthetic
Sequence 721 gctagacgtt agctgga 17 722 20 DNA Artificial Sequence
Synthetic Sequence 722 atcgactctc gagcgttctc 20 723 15 DNA
Artificial Sequence Synthetic Sequence 723 tagacgttag cgtga 15 724
18 DNA Artificial Sequence Synthetic Sequence 724 cgactctcga
gcgttctc 18 725 21 DNA Artificial Sequence Synthetic Sequence 725
ggggtcgacc ttggaggggg g 21 726 16 DNA Artificial Sequence Synthetic
Sequence 726 gctaacgtta gcgtga 16 727 9 DNA Artificial Sequence
Synthetic Sequence 727 cgtcgtcgt 9 728 20 DNA Artificial Sequence
modified_base (14)...(14) m5c 728 gagaacgctg gacnttccat 20 729 20
DNA Artificial Sequence modified_base (18)...(18) m5c 729
atcgacctac gtgcgttntc 20 730 20 DNA Artificial Sequence
modified_base (3)...(3) m5c 730 atngacctac gtgcgttctc 20 731 15 DNA
Artificial Sequence modified_base (7)...(7) m5c 731 gctagangtt
agcgt 15 732 20 DNA Artificial Sequence modified_base (14)...(14)
m5c 732 atcgactctc gagngttctc 20 733 20 DNA Artificial Sequence
Synthetic Sequence 733 ggggtaatgc atcagggggg 20 734 20 DNA
Artificial Sequence Synthetic Sequence 734 ggctgtattc ctgactgccc 20
735 17 DNA Artificial Sequence Synthetic Sequence 735 ccatgctaac
ctctagc 17 736 17 DNA Artificial Sequence Synthetic Sequence 736
gctagatgtt agcgtga 17 737 15 DNA Artificial Sequence Synthetic
Sequence 737 cgtaccttac ggtga 15 738 20 DNA Artificial Sequence
Synthetic Sequence 738 tccatgctgg tcctgatgct 20 739 22 DNA
Artificial Sequence Synthetic Sequence 739 atcgactctc tcgagcgttc tc
22 740 17 DNA Artificial Sequence Synthetic Sequence 740 gctagagctt
agcgtga 17 741 20 DNA Artificial Sequence Synthetic Sequence 741
atcgactctc gagtgttctc 20 742 17 DNA Artificial Sequence Synthetic
Sequence 742 aacgctcgac cttcgat 17 743 20 DNA Artificial Sequence
Synthetic Sequence 743 ctcaacgctg gaccttccat 20 744 20 DNA
Artificial Sequence Synthetic Sequence 744 atcgacctac gtgcgttctc 20
745 20 DNA Artificial Sequence Synthetic Sequence 745 gagaatgctg
gaccttccat 20 746 17 DNA Artificial Sequence Synthetic Sequence 746
tcacgctaac ctctgac 17 747 20 DNA Artificial Sequence misc_feature
(1)...(3) Conjugated to biotin moiety. 747 gagaacgctc cagcactgat 20
748 20 DNA Artificial Sequence misc_feature (1)...(3) Biotin moiety
attached at 5' end of sequence. 748 gagcaagctg gaccttccat 20 749 18
DNA Artificial Sequence Synthetic Sequence 749 cgctagaggt tagcgtga
18 750 15 DNA Artificial Sequence Synthetic Sequence 750 gctagatgtt
aacgt 15 751 19 DNA Artificial Sequence Synthetic Sequence 751
atggaaggtc cacgttctc 19 752 15 DNA Artificial Sequence Synthetic
Sequence 752 gctagatgtt agcgt 15 753 15 DNA Artificial Sequence
Synthetic Sequence 753 gctagacgtt agtgt 15 754 20 DNA Artificial
Sequence Synthetic Sequence 754 tccatgacgg tcctgatgct 20 755 20 DNA
Artificial Sequence Synthetic Sequence 755 tccatggcgg tcctgatgct 20
756 15 DNA Artificial Sequence Synthetic Sequence 756 gctagacgat
agcgt 15 757 15 DNA Artificial Sequence Synthetic Sequence 757
gctagtcgat agcgt 15 758 20 DNA Artificial Sequence Synthetic
Sequence 758 tccatgacgt tcctgatgct 20 759 20 DNA Artificial
Sequence Synthetic Sequence 759 tccatgtcgt tcctgatgct 20 760 15 DNA
Artificial Sequence modified_base (13)...(13) m5c 760 gctagacgtt
agngt 15 761 15 DNA Artificial Sequence Synthetic Sequence 761
gctaggcgtt agcgt 15 762 20 DNA Artificial Sequence modified_base
(8)...(8) m5c 762 tccatgtngg tcctgatgct 20 763 20 DNA Artificial
Sequence modified_base (12)...(12) m5c 763 tccatgtcgg tnctgatgct 20
764 20 DNA Artificial Sequence Synthetic Sequence 764 atngactctn
gagngttctc 20 765 20 DNA Artificial Sequence Synthetic Sequence 765
atggaaggtc cagtgttctc 20 766 15 DNA Artificial Sequence Synthetic
Sequence 766 gcatgacgtt gagct 15 767 20 DNA Artificial Sequence
Synthetic Sequence 767 ggggtcaacg ttgagggggg 20 768 20 DNA
Artificial Sequence Synthetic Sequence 768 ggggtcaagt ctgagggggg 20
769 20 DNA Artificial Sequence Synthetic Sequence 769 cgcgcgcgcg
cgcgcgcgcg 20 770 28 DNA Artificial Sequence Synthetic Sequence 770
cccccccccc cccccccccc cccccccc 28 771 35 DNA Artificial Sequence
Synthetic Sequence 771 cccccccccc cccccccccc cccccccccc ccccc 35
772 20 DNA Artificial Sequence Synthetic Sequence 772 tccatgtcgc
tcctgatcct 20 773 15 DNA Artificial Sequence Synthetic Sequence 773
gctaaacgtt agcgt 15 774 20 DNA Artificial Sequence Synthetic
Sequence 774 tccatgtcga tcctgatgct 20 775 20 DNA Artificial
Sequence Synthetic Sequence 775 tccatgccgg tcctgatgct 20 776 20 DNA
Artificial Sequence Synthetic Sequence 776 aaaatcaacg ttgaaaaaaa 20
777 20 DNA Artificial Sequence Synthetic Sequence 777 tccataacgt
tcctgatgct 20 778 23 DNA Artificial Sequence Synthetic Sequence 778
tggaggtccc accgagatcg gag 23 779 21 DNA Artificial Sequence
Synthetic Sequence 779 cgtcgtcgtc gtcgtcgtcg t 21 780 21 DNA
Artificial Sequence Synthetic Sequence 780 ctgctgctgc tgctgctgct g
21 781 21 DNA Artificial Sequence Synthetic Sequence 781 gagaacgctc
cgaccttcga t 21 782 15 DNA Artificial Sequence Synthetic Sequence
782 gctagatgtt agcgt 15 783 15 DNA Artificial Sequence Synthetic
Sequence 783 gcatgacgtt gagct 15 784 10 DNA Artificial Sequence
misc_feature (8)...(10) Conjugated to FITC moiety. 784 tcaatgctga
10 785 10 DNA Artificial Sequence misc_feature (8)...(10)
Conjugated to FITC moiety. 785 tcaacgttga 10 786 10 DNA Artificial
Sequence misc_feature (8)...(10) Conjugated to biotin moiety. 786
tcaacgttga 10 787 10 DNA Artificial Sequence misc_feature
(8)...(10) Conjugated to biotin moiety. 787 gcaatattgc 10 788 10
DNA Artificial Sequence misc_feature (8)...(10) Conjugated to FITC
moiety. 788 gcaatattgc 10 789 10 DNA Artificial Sequence Synthetic
Sequence 789 agttgcaact 10 790 8 DNA Artificial Sequence Synthetic
Sequence 790 tcttcgaa 8 791 8 DNA Artificial Sequence Synthetic
Sequence 791 tcaacgtc 8 792 19 DNA Artificial Sequence Synthetic
Sequence 792 ccatgtcggt cctgatgct 19 793 18 DNA Artificial Sequence
Synthetic Sequence 793 gtttttatat aatttggg 18 794 23 DNA Artificial
Sequence Synthetic Sequence 794 tttttgtttg tcgttttgtc gtt 23 795 12
DNA Artificial Sequence Synthetic Sequence 795 ttgggggggg tt 12 796
13 DNA Artificial Sequence Synthetic Sequence 796 ggggttgggg gtt 13
797 17 DNA Artificial Sequence Synthetic Sequence 797 ggtggtgtag
gttttgg 17 798 20 DNA Artificial Sequence misc_feature (1)...(3)
Conjugated to biotin moiety. 798 gagaangctc gaccttcgat 20 799 20
DNA Artificial Sequence Synthetic Sequence 799 tcaacgttaa
cgttaacgtt 20 800 20 DNA Artificial Sequence misc_feature (1)...(3)
Conjugated to biotin moiety. 800 gagcaagntg gaccttccat 20 801 20
DNA Artificial Sequence misc_feature (1)...(3) Conjugated to biotin
moiety. 801 gagaangctc cagcactgat 20 802 10 DNA Artificial Sequence
modified_base (5)...(5) m5c 802 tcaangttga 10 803 10 DNA Artificial
Sequence modified_base (2)...(2) m5c 803 gnaatattgc 10 804 24 DNA
Artificial Sequence Synthetic Sequence 804 tgctgctttt gtcgttttgt
gctt 24 805 22 DNA Artificial Sequence Synthetic Sequence 805
ctgcgttagc aatttaactg tg 22 806 20 DNA Artificial Sequence
Synthetic Sequence 806 tccatgacgt tcctgatgct 20 807 28 DNA
Artificial Sequence Synthetic Sequence 807 tgcatgccgt gcatccgtac
acagctct 28 808 20 DNA Artificial Sequence Synthetic Sequence 808
tgcatgccgt acacagctct 20 809 12 DNA Artificial Sequence Synthetic
Sequence 809 tgcatcagct ct 12 810 8 DNA Artificial Sequence
Synthetic Sequence 810 tgcgctct 8 811 20 DNA Artificial Sequence
Synthetic Sequence 811 cccccccccc cccccccccc 20 812 12 DNA
Artificial Sequence Synthetic Sequence 812 cccccccccc cc 12 813 8
DNA Artificial Sequence Synthetic Sequence 813 cccccccc 8 814 12
DNA Artificial Sequence Synthetic Sequence 814 tgcatcagct ct 12 815
20 DNA Artificial Sequence Synthetic Sequence 815 tgcatgccgt
acacagctct 20 816 20 DNA Artificial Sequence Synthetic Sequence 816
gagcaagctg gaccttccat 20 817 32 DNA Artificial Sequence Synthetic
Sequence 817 tcaacgttaa cgttaacgtt aacgttaacg tt 32 818 20 DNA
Artificial Sequence Synthetic Sequence 818 gagaacgctc gaccttcgat 20
819 25 DNA Artificial Sequence Synthetic Sequence 819 gtccccattt
cccagaggag gaaat 25 820 25 DNA Artificial Sequence Synthetic
Sequence 820 ctagcggctg acgtcatcaa gctag 25 821 25 DNA Artificial
Sequence Synthetic Sequence 821 ctagcttgat gacgtcagcc gctag 25 822
16 DNA Artificial Sequence Synthetic Sequence 822 cggctgacgt catcaa
16 823 8 DNA Artificial Sequence Synthetic Sequence 823 ctgacgtg 8
824 10 DNA Artificial Sequence Synthetic Sequence 824 ctgacgtcat 10
825 21 DNA Artificial Sequence Synthetic Sequence 825 attcgatcgg
ggcggggcga g 21 826 21 DNA Artificial Sequence Synthetic Sequence
826 ctcgccccgc cccgatcgaa t 21 827 15 DNA Artificial Sequence
Synthetic Sequence 827 gactgacgtc agcgt 15 828 26 DNA Artificial
Sequence Synthetic Sequence 828 ctagcggctg acgtcataaa gctagc 26 829
26 DNA Artificial Sequence Synthetic Sequence 829 ctagctttat
gacgtcagcc gctagc 26 830 26 DNA Artificial Sequence Synthetic
Sequence 830 ctagcggctg agctcataaa gctagc 26 831 25 DNA Artificial
Sequence Synthetic Sequence 831 ctagtggctg acgtcatcaa gctag 25 832
20 DNA Artificial Sequence Synthetic Sequence 832 tccaccacgt
ggtctatgct 20 833 24 DNA Artificial Sequence Synthetic Sequence 833
gggaatgaaa gattttatta taag 24 834 26 DNA Artificial Sequence
Synthetic Sequence 834 tctaaaaacc atctattctt aaccct 26 835 15 DNA
Artificial Sequence Synthetic Sequence 835 agctcaacgt catgc 15 836
24 DNA Artificial Sequence Synthetic Sequence 836 ttaacggtgg
tagcggtatt ggtc 24 837 24 DNA Artificial Sequence Synthetic
Sequence 837 ttaagaccaa taccgctacc accg 24 838 25 DNA Artificial
Sequence Synthetic Sequence 838 gatctagtga tgagtcagcc ggatc 25 839
25 DNA Artificial Sequence Synthetic Sequence 839 gatccggctg
actcatcact agatc 25 840 20 DNA Artificial Sequence Synthetic
Sequence 840 tccaagacgt tcctgatgct 20 841 20 DNA Artificial
Sequence Synthetic Sequence 841 tccatgacgt ccctgatgct 20 842 20 DNA
Artificial Sequence Synthetic Sequence 842 tccaccacgt ggctgatgct 20
843 17 DNA Artificial Sequence Synthetic Sequence 843 ccacgtggac
ctctagc 17 844 27 DNA Artificial Sequence Synthetic Sequence 844
tcagaccacg tggtcgggtg ttcctga 27 845 27 DNA Artificial Sequence
Synthetic Sequence 845 tcaggaacac ccgaccacgt ggtctga 27 846 18 DNA
Artificial Sequence Synthetic Sequence 846 catttccacg atttccca 18
847 19 DNA Artificial Sequence Synthetic Sequence 847 ttcctctctg
caagagact 19 848 19 DNA Artificial Sequence Synthetic Sequence
848 tgtatctctc tgaaggact 19 849 25 DNA Artificial Sequence
Synthetic Sequence 849 ataaagcgaa actagcagca gtttc 25 850 25 DNA
Artificial Sequence Synthetic Sequence 850 gaaactgctg ctagtttcgc
tttat 25 851 30 DNA Artificial Sequence Synthetic Sequence 851
tgcccaaaga ggaaaatttg tttcatacag 30 852 30 DNA Artificial Sequence
Synthetic Sequence 852 ctgtatgaaa caaattttcc tctttgggca 30 853 20
DNA Artificial Sequence Synthetic Sequence 853 ttagggttag
ggttagggtt 20 854 20 DNA Artificial Sequence Synthetic Sequence 854
tccatgagct tcctgatgct 20 855 20 DNA Artificial Sequence Synthetic
Sequence 855 aaaacatgac gttcaaaaaa 20 856 20 DNA Artificial
Sequence Synthetic Sequence 856 aaaacatgac gttcgggggg 20 857 20 DNA
Artificial Sequence Synthetic Sequence 857 ggggcatgag cttcgggggg 20
858 24 DNA Artificial Sequence Synthetic Sequence 858 ctaggctgac
gtcatcaagc tagt 24 859 30 DNA Artificial Sequence Synthetic
Sequence 859 tctgacgtca tctgacgttg gctgacgtct 30 860 25 DNA
Artificial Sequence Synthetic Sequence 860 ggaattagta atagatatag
aagtt 25 861 30 DNA Artificial Sequence Synthetic Sequence 861
tttacctttt ataaacataa ctaaaacaaa 30 862 15 DNA Artificial Sequence
Synthetic Sequence 862 gcgttttttt ttgcg 15 863 24 DNA Artificial
Sequence Synthetic Sequence 863 atatctaatc aaaacattaa caaa 24 864
24 DNA Artificial Sequence Synthetic Sequence 864 tctatcccag
gtggttcctg ttag 24 865 20 DNA Artificial Sequence misc_feature
(1)...(3) Conjugated to biotin moiety. 865 tccatgacgt tcctgatgct 20
866 20 DNA Artificial Sequence misc_feature (1)...(3) Conjugated to
biotin moiety. 866 tccatgagct tcctgatgct 20 867 13 DNA Artificial
Sequence misc_feature (11)...(13) Conjugated to FITC moiety. 867
tttttttttt ttt 13 868 13 DNA Artificial Sequence misc_feature
(11)...(13) Conjugated to biotin moiety. 868 tttttttttt ttt 13 869
25 DNA Artificial Sequence Synthetic Sequence 869 ctagcttgat
gagctcagcc gctag 25 870 25 DNA Artificial Sequence Synthetic
Sequence 870 ttcagttgtc ttgctgctta gctaa 25 871 20 DNA Artificial
Sequence Synthetic Sequence 871 tccatgagct tcctgagtct 20 872 25 DNA
Artificial Sequence Synthetic Sequence 872 ctagcggctg acgtcatcaa
tctag 25 873 20 DNA Artificial Sequence Synthetic Sequence 873
tgctagctgt gcctgtacct 20 874 23 DNA Artificial Sequence Synthetic
Sequence 874 atgctaaagg acgtcacatt gca 23 875 23 DNA Artificial
Sequence Synthetic Sequence 875 tgcaatgtga cgtcctttag cat 23 876 31
DNA Artificial Sequence Synthetic Sequence 876 gtaggggact
ttccgagctc gagatcctat g 31 877 31 DNA Artificial Sequence Synthetic
Sequence 877 cataggatct cgagctcgga aagtccccta c 31 878 22 DNA
Artificial Sequence Synthetic Sequence 878 ctgtcaggaa ctgcaggtaa gg
22 879 27 DNA Artificial Sequence Synthetic Sequence 879 cataacatag
gaatatttac tcctcgc 27 880 21 DNA Artificial Sequence Synthetic
Sequence 880 ctccagctcc aagaaaggac g 21 881 21 DNA Artificial
Sequence Synthetic Sequence 881 gaagtttctg gtaagtcttc g 21 882 24
DNA Artificial Sequence Synthetic Sequence 882 tgctgctttt
gtgcttttgt gctt 24 883 24 DNA Artificial Sequence Synthetic
Sequence 883 tcgtcgtttt gtggttttgt ggtt 24 884 23 DNA Artificial
Sequence Synthetic Sequence 884 tcgtcgtttg tcgttttgtc gtt 23 885 22
DNA Artificial Sequence Synthetic Sequence 885 tcctgacgtt
cggcgcgcgc cc 22 886 24 DNA Artificial Sequence Synthetic Sequence
886 tgctgctttt gtgcttttgt gctt 24 887 20 DNA Artificial Sequence
Synthetic Sequence 887 tccatgagct tcctgagctt 20 888 24 DNA
Artificial Sequence Synthetic Sequence 888 tcgtcgtttc gtcgttttga
cgtt 24 889 26 DNA Artificial Sequence Synthetic Sequence 889
tcgtcgtttg cgtgcgtttc gtcgtt 26 890 27 DNA Artificial Sequence
Synthetic Sequence 890 tcgcgtgcgt tttgtcgttt tgacgtt 27 891 25 DNA
Artificial Sequence Synthetic Sequence 891 ttcgtcgttt tgtcgttttg
tcgtt 25 892 15 DNA Artificial Sequence Synthetic Sequence 892
tcctgacggg gaagt 15 893 15 DNA Artificial Sequence Synthetic
Sequence 893 tcctggcgtg gaagt 15 894 15 DNA Artificial Sequence
Synthetic Sequence 894 tcctggcggt gaagt 15 895 15 DNA Artificial
Sequence Synthetic Sequence 895 tcctggcgtt gaagt 15 896 15 DNA
Artificial Sequence Synthetic Sequence 896 tcctgacgtg gaagt 15 897
20 DNA Artificial Sequence Synthetic Sequence 897 gcgacgttcg
gcgcgcgccc 20 898 20 DNA Artificial Sequence Synthetic Sequence 898
gcgacgggcg gcgcgcgccc 20 899 20 DNA Artificial Sequence Synthetic
Sequence 899 gcggcgtgcg gcgcgcgccc 20 900 20 DNA Artificial
Sequence Synthetic Sequence 900 gcggcggtcg gcgcgcgccc 20 901 20 DNA
Artificial Sequence Synthetic Sequence 901 gcgacggtcg gcgcgcgccc 20
902 20 DNA Artificial Sequence Synthetic Sequence 902 gcggcgttcg
gcgcgcgccc 20 903 20 DNA Artificial Sequence Synthetic Sequence 903
gcgacgtgcg gcgcgcgccc 20 904 15 DNA Artificial Sequence Synthetic
Sequence 904 tcgtcgctgt ctccg 15 905 20 DNA Artificial Sequence
Synthetic Sequence 905 tgtgggggtt ttggttttgg 20 906 20 DNA
Artificial Sequence Synthetic Sequence 906 aggggagggg aggggagggg 20
907 21 DNA Artificial Sequence Synthetic Sequence 907 tgtgtgtgtg
tgtgtgtgtg t 21 908 22 DNA Artificial Sequence Synthetic Sequence
908 ctctctctct ctctctctct ct 22 909 20 DNA Artificial Sequence
Synthetic Sequence 909 ggggtcgacg tcgagggggg 20 910 22 DNA
Artificial Sequence Synthetic Sequence 910 atatatatat atatatatat at
22 911 27 DNA Artificial Sequence Synthetic Sequence 911 tttttttttt
tttttttttt ttttttt 27 912 21 DNA Artificial Sequence Synthetic
Sequence 912 tttttttttt tttttttttt t 21 913 18 DNA Artificial
Sequence Synthetic Sequence 913 tttttttttt tttttttt 18 914 15 DNA
Artificial Sequence Synthetic Sequence 914 gctagagggg agggt 15 915
15 DNA Artificial Sequence Synthetic Sequence 915 gctagatgtt agggg
15 916 15 DNA Artificial Sequence Synthetic Sequence 916 gcatgagggg
gagct 15 917 20 DNA Artificial Sequence Synthetic Sequence 917
atggaaggtc cagggggctc 20 918 20 DNA Artificial Sequence Synthetic
Sequence 918 atggactctg gagggggctc 20 919 20 DNA Artificial
Sequence Synthetic Sequence 919 atggaaggtc caaggggctc 20 920 20 DNA
Artificial Sequence Synthetic Sequence 920 gagaaggggg gaccttggat 20
921 20 DNA Artificial Sequence Synthetic Sequence 921 gagaaggggg
gaccttccat 20 922 20 DNA Artificial Sequence Synthetic Sequence 922
gagaaggggc cagcactgat 20 923 20 DNA Artificial Sequence Synthetic
Sequence 923 tccatgtggg gcctgatgct 20 924 20 DNA Artificial
Sequence Synthetic Sequence 924 tccatgaggg gcctgatgct 20 925 20 DNA
Artificial Sequence Synthetic Sequence 925 tccatgtggg gcctgctgat 20
926 20 DNA Artificial Sequence Synthetic Sequence 926 atggactctc
cggggttctc 20 927 20 DNA Artificial Sequence Synthetic Sequence 927
atggaaggtc cggggttctc 20 928 20 DNA Artificial Sequence Synthetic
Sequence 928 atggactctg gaggggtctc 20 929 20 DNA Artificial
Sequence Synthetic Sequence 929 atggaggctc catggggctc 20 930 20 DNA
Artificial Sequence Synthetic Sequence 930 atggactctg gggggttctc 20
931 20 DNA Artificial Sequence Synthetic Sequence 931 tccatgtggg
tggggatgct 20 932 20 DNA Artificial Sequence Synthetic Sequence 932
tccatgcggg tggggatgct 20 933 20 DNA Artificial Sequence Synthetic
Sequence 933 tccatggggg tcctgatgct 20 934 20 DNA Artificial
Sequence Synthetic Sequence 934 tccatggggt ccctgatgct 20 935 20 DNA
Artificial Sequence Synthetic Sequence 935 tccatggggt gcctgatgct 20
936 20 DNA Artificial Sequence Synthetic Sequence 936 tccatggggt
tcctgatgct 20 937 20 DNA Artificial Sequence Synthetic Sequence 937
tccatcgggg gcctgatgct 20 938 14 DNA Artificial Sequence Synthetic
Sequence 938 gctagaggga gtgt 14 939 18 DNA Artificial Sequence
Synthetic Sequence 939 tttttttttt tttttttt 18 940 21 DNA Artificial
Sequence misc_difference (2)...(2) m is a or c 940 gmggtcaacg
ttgagggmgg g 21 941 21 DNA Artificial Sequence Synthetic Sequence
941 ggggagttcg ttgagggggg g 21 942 20 DNA Artificial Sequence
Synthetic Sequence 942 tcgtcgtttc cccccccccc 20 943 25 DNA
Artificial Sequence Synthetic Sequence 943 ttggggggtt tttttttttt
ttttt 25 944 23 DNA Artificial Sequence Synthetic Sequence 944
tttaaatttt aaaatttaaa ata 23 945 24 DNA Artificial Sequence
Synthetic Sequence 945 ttggtttttt tggttttttt ttgg 24 946 24 DNA
Artificial Sequence Synthetic Sequence 946 tttccctttt ccccttttcc
cctc 24 947 21 DNA Artificial Sequence misc_difference (21)...(21)
s is g or c 947 ggggtcatcg atgagggggg s 21 948 20 DNA Artificial
Sequence Synthetic Sequence 948 tccatgacgt tcctgacgtt 20 949 20 DNA
Artificial Sequence Synthetic Sequence 949 tccatgacgt tcctgacgtt 20
950 20 DNA Artificial Sequence Synthetic Sequence 950 tccatgacgt
tcctgacgtt 20 951 20 DNA Artificial Sequence Synthetic Sequence 951
tccatgacgt tcctgacgtt 20 952 20 DNA Artificial Sequence Synthetic
Sequence 952 tccatgacgt tcctgacgtt 20 953 20 DNA Artificial
Sequence Synthetic Sequence 953 tccatgacgt tcctgacgtt 20 954 20 DNA
Artificial Sequence Synthetic Sequence 954 tccatgacgt tcctgacgtt 20
955 20 DNA Artificial Sequence Synthetic Sequence 955 tccatgacgt
tcctgacgtt 20 956 20 DNA Artificial Sequence Synthetic Sequence 956
tccatgacgt tcctgacgtt 20 957 20 DNA Artificial Sequence Synthetic
Sequence 957 tccatgacgt tcctgacgtt 20 958 20 DNA Artificial
Sequence Synthetic Sequence 958 tccatgacgt tcctgacgtt 20 959 19 DNA
Artificial Sequence Synthetic Sequence 959 gggggacgat cgtcggggg 19
960 20 DNA Artificial Sequence Synthetic Sequence 960 gggggtcgta
cgacgggggg 20 961 24 DNA Artificial Sequence Synthetic Sequence 961
tttttttttt tttttttttt tttt 24 962 24 DNA Artificial Sequence
Synthetic Sequence 962 aaaaaaaaaa aaaaaaaaaa aaaa 24 963 24 DNA
Artificial Sequence Synthetic Sequence 963 cccccccccc cccccccccc
cccc 24 964 24 DNA Artificial Sequence Synthetic Sequence 964
tcgtcgtttt gtcgttttgt cgtt 24 965 24 DNA Artificial Sequence
Synthetic Sequence 965 tcgtcgtttt gtcgttttgt cgtt 24 966 24 DNA
Artificial Sequence Synthetic Sequence 966 tcgtcgtttt gtcgttttgt
cgtt 24 967 24 DNA Artificial Sequence Synthetic Sequence 967
tcgtcgtttt gtcgttttgt cgtt 24 968 20 DNA Artificial Sequence
Synthetic Sequence 968 ggggtcaacg ttgagggggg 20 969 20 DNA
Artificial Sequence Synthetic Sequence 969 ggggtcaacg ttgagggggg 20
970 20 DNA Artificial Sequence Synthetic Sequence 970 ggggtcaagc
ttgagggggg 20 971 20 DNA Artificial Sequence Synthetic Sequence 971
tgctgcttcc cccccccccc 20 972 20 DNA Artificial Sequence Synthetic
Sequence 972 ggggacgtcg acgtgggggg 20 973 20 DNA Artificial
Sequence Synthetic Sequence 973 ggggtcgtcg acgagggggg 20 974 24 DNA
Artificial Sequence Synthetic Sequence 974 ggggtcgacg tacgtcgagg
gggg 24 975 22 DNA Artificial Sequence Synthetic Sequence 975
ggggaccggt accggtgggg gg 22 976 19 DNA Artificial Sequence
Synthetic Sequence 976 gggtcgacgt cgagggggg 19 977 19 DNA
Artificial Sequence Synthetic Sequence 977 ggggtcgacg tcgaggggg 19
978 22 DNA Artificial Sequence Synthetic Sequence 978 ggggaacgtt
aacgttgggg gg 22 979 20 DNA Artificial Sequence Synthetic Sequence
979 ggggtcaccg gtgagggggg 20 980 22 DNA Artificial Sequence
Synthetic Sequence 980 ggggtcgttc gaacgagggg gg 22 981 22 DNA
Artificial Sequence Synthetic Sequence 981 ggggacgttc gaacgtgggg gg
22 982 10 DNA Artificial Sequence Synthetic Sequence 982 tcaactttga
10 983 10 DNA Artificial Sequence Synthetic Sequence 983 tcaagcttga
10 984 12 DNA Artificial Sequence Synthetic Sequence 984 tcacgatcgt
ga 12 985 12 DNA Artificial Sequence Synthetic Sequence 985
tcagcatgct ga 12 986 20 DNA Artificial Sequence Synthetic Sequence
986 gggggagcat gctggggggg 20 987 20 DNA Artificial Sequence
Synthetic Sequence 987 gggggggggg gggggggggg 20 988 22 DNA
Artificial Sequence Synthetic Sequence 988 gggggacgat atcgtcgggg gg
22 989 22 DNA Artificial Sequence Synthetic Sequence 989 gggggacgac
gtcgtcgggg gg 22 990 22 DNA Artificial Sequence
Synthetic Sequence 990 gggggacgag ctcgtcgggg gg 22 991 20 DNA
Artificial Sequence Synthetic Sequence 991 gggggacgta cgtcgggggg 20
992 8 DNA Artificial Sequence Synthetic Sequence 992 tcaacgtt 8 993
20 DNA Artificial Sequence Synthetic Sequence 993 tccataccgg
tcctgatgct 20 994 20 DNA Artificial Sequence Synthetic Sequence 994
tccataccgg tcctaccggt 20 995 20 DNA Artificial Sequence Synthetic
Sequence 995 gggggacgat cgttgggggg 20 996 20 DNA Artificial
Sequence Synthetic Sequence 996 ggggaacgat cgtcgggggg 20 997 21 DNA
Artificial Sequence Synthetic Sequence 997 ggggggacga tcgtcggggg g
21 998 21 DNA Artificial Sequence Synthetic Sequence 998 gggggacgat
cgtcgggggg g 21 999 12 DNA Artificial Sequence Synthetic Sequence
999 aaagacgtta aa 12 1000 12 DNA Artificial Sequence Synthetic
Sequence 1000 aaagagctta aa 12 1001 12 DNA Artificial Sequence
modified_base (6)...(6) m5c 1001 aaagangtta aa 12 1002 12 DNA
Artificial Sequence Synthetic Sequence 1002 aaattcggaa aa 12 1003
21 DNA Artificial Sequence Synthetic Sequence 1003 gggggtcatc
gatgaggggg g 21 1004 21 DNA Artificial Sequence Synthetic Sequence
1004 gggggtcaac gttgaggggg g 21 1005 20 DNA Artificial Sequence
Synthetic Sequence 1005 atgtagctta ataacaaagc 20 1006 20 DNA
Artificial Sequence Synthetic Sequence 1006 ggatcccttg agttacttct
20 1007 20 DNA Artificial Sequence Synthetic Sequence 1007
ccattccact tctgattacc 20 1008 20 DNA Artificial Sequence Synthetic
Sequence 1008 tatgtattat catgtagata 20 1009 20 DNA Artificial
Sequence Synthetic Sequence 1009 agcctacgta ttcaccctcc 20 1010 20
DNA Artificial Sequence Synthetic Sequence 1010 ttcctgcaac
tactattgta 20 1011 20 DNA Artificial Sequence Synthetic Sequence
1011 atagaaggcc ctacaccagt 20 1012 20 DNA Artificial Sequence
Synthetic Sequence 1012 ttacaccggt ctatggaggt 20 1013 20 DNA
Artificial Sequence Synthetic Sequence 1013 ctaaccagat caagtctagg
20 1014 20 DNA Artificial Sequence Synthetic Sequence 1014
cctagacttg atctggttag 20 1015 20 DNA Artificial Sequence Synthetic
Sequence 1015 tataagcctc gtccgacatg 20 1016 20 DNA Artificial
Sequence Synthetic Sequence 1016 catgtcggac gaggcttata 20 1017 20
DNA Artificial Sequence Synthetic Sequence 1017 tggtggtggg
gagtaagctc 20 1018 20 DNA Artificial Sequence Synthetic Sequence
1018 gagctactcc cccaccacca 20 1019 20 DNA Artificial Sequence
Synthetic Sequence 1019 gccttcgatc ttcgttggga 20 1020 20 DNA
Artificial Sequence Synthetic Sequence 1020 tggacttctc tttgccgtct
20 1021 20 DNA Artificial Sequence Synthetic Sequence 1021
atgctgtagc ccagcgataa 20 1022 20 DNA Artificial Sequence Synthetic
Sequence 1022 accgaatcag cggaaagtga 20 1023 20 DNA Artificial
Sequence Synthetic Sequence 1023 tccatgacgt tcctgacgtt 20 1024 24
DNA Artificial Sequence Synthetic Sequence 1024 ggagaaaccc
atgagctcat ctgg 24 1025 20 DNA Artificial Sequence Synthetic
Sequence 1025 accacagacc agcaggcaga 20 1026 20 DNA Artificial
Sequence Synthetic Sequence 1026 gagcgtgaac tgcgcgaaga 20 1027 20
DNA Artificial Sequence Synthetic Sequence 1027 tcggtaccct
tgcagcggtt 20 1028 20 DNA Artificial Sequence Synthetic Sequence
1028 ctggagccct agccaaggat 20 1029 20 DNA Artificial Sequence
Synthetic Sequence 1029 gcgactccat caccagcgat 20 1030 21 DNA
Artificial Sequence Synthetic Sequence 1030 cctgaagtaa gaaccagatg t
21 1031 21 DNA Artificial Sequence Synthetic Sequence 1031
ctgtgttatc tgacatacac c 21 1032 21 DNA Artificial Sequence
Synthetic Sequence 1032 aattagcctt aggtgattgg g 21 1033 21 DNA
Artificial Sequence Synthetic Sequence 1033 acatctggtt cttacttcag g
21 1034 23 DNA Artificial Sequence Synthetic Sequence 1034
ataagtcata ttttgggaac tac 23 1035 21 DNA Artificial Sequence
Synthetic Sequence 1035 cccaatcacc taaggctaat t 21 1036 20 DNA
Artificial Sequence Synthetic Sequence 1036 ggggtcgtcg acgagggggg
20 1037 22 DNA Artificial Sequence Synthetic Sequence 1037
ggggtcgttc gaacgagggg gg 22 1038 22 DNA Artificial Sequence
Synthetic Sequence 1038 ggggacgttc gaacgtgggg gg 22 1039 15 DNA
Artificial Sequence modified_base (9)...(9) n is 5-methylcytosine.
1039 tcctggcgng gaagt 15 1040 22 DNA Artificial Sequence Synthetic
Sequence 1040 ggggaacgac gtcgttgggg gg 22 1041 20 DNA Artificial
Sequence Synthetic Sequence 1041 ggggaacgta cgtcgggggg 20 1042 24
DNA Artificial Sequence Synthetic Sequence 1042 ggggaacgta
cgtacgttgg gggg 24 1043 20 DNA Artificial Sequence Synthetic
Sequence 1043 ggggtcaccg gtgagggggg 20 1044 24 DNA Artificial
Sequence Synthetic Sequence 1044 ggggtcgacg tacgtcgagg gggg 24 1045
22 DNA Artificial Sequence Synthetic Sequence 1045 ggggaccggt
accggtgggg gg 22 1046 19 DNA Artificial Sequence Synthetic Sequence
1046 gggtcgacgt cgagggggg 19 1047 18 DNA Artificial Sequence
Synthetic Sequence 1047 ggggtcgacg tcgagggg 18 1048 22 DNA
Artificial Sequence Synthetic Sequence 1048 ggggaacgtt aacgttgggg
gg 22 1049 19 DNA Artificial Sequence Synthetic Sequence 1049
ggggacgtcg acgtggggg 19 1050 34 DNA Artificial Sequence Synthetic
Sequence 1050 gcactcttcg aagctacagc cggcagcctc tgat 34 1051 32 DNA
Artificial Sequence Synthetic Sequence 1051 cggctcttcc atgaggtctt
tgctaatctt gg 32 1052 35 DNA Artificial Sequence Synthetic Sequence
1052 cggctcttcc atgaaagtct ttggacgatg tgagc 35 1053 15 DNA
Artificial Sequence Synthetic Sequence 1053 tcctgcaggt taagt 15
1054 20 DNA Artificial Sequence Synthetic Sequence 1054 gggggtcgtt
cgttgggggg 20 1055 20 DNA Artificial Sequence Synthetic Sequence
1055 gggggatgat tgttgggggg 20 1056 20 DNA Artificial Sequence
modified_base (7)...(7) m5c 1056 gggggangat ngttgggggg 20 1057 20
DNA Artificial Sequence Synthetic Sequence 1057 gggggagcta
gcttgggggg 20 1058 20 DNA Artificial Sequence Synthetic Sequence
1058 ggttcttttg gtccttgtct 20 1059 20 DNA Artificial Sequence
Synthetic Sequence 1059 ggttcttttg gtcctcgtct 20 1060 20 DNA
Artificial Sequence Synthetic Sequence 1060 ggttcttttg gtccttatct
20 1061 20 DNA Artificial Sequence Synthetic Sequence 1061
ggttcttggt ttccttgtct 20 1062 20 DNA Artificial Sequence Synthetic
Sequence 1062 tggtcttttg gtccttgtct 20 1063 20 DNA Artificial
Sequence Synthetic Sequence 1063 ggttcaaatg gtccttgtct 20 1064 20
DNA Artificial Sequence Synthetic Sequence 1064 gggtcttttg
ggccttgtct 20 1065 24 DNA Artificial Sequence Synthetic Sequence
1065 tccaggactt ctctcaggtt tttt 24 1066 20 DNA Artificial Sequence
Synthetic Sequence 1066 tccaaaactt ctctcaaatt 20 1067 24 DNA
Artificial Sequence Synthetic Sequence 1067 tactactttt atacttttat
actt 24 1068 24 DNA Artificial Sequence Synthetic Sequence 1068
tgtgtgtgtg tgtgtgtgtg tgtg 24 1069 25 DNA Artificial Sequence
Synthetic Sequence 1069 ttgttgttgt tgtttgttgt tgttg 25 1070 27 DNA
Artificial Sequence Synthetic Sequence 1070 ggctccgggg agggaatttt
tgtctat 27 1071 19 DNA Artificial Sequence Synthetic Sequence 1071
gggacgatcg tcggggggg 19 1072 20 DNA Artificial Sequence Synthetic
Sequence 1072 gggtcgtcga cgaggggggg 20 1073 19 DNA Artificial
Sequence Synthetic Sequence 1073 ggtcgtcgac gaggggggg 19 1074 20
DNA Artificial Sequence Synthetic Sequence 1074 gggtcgtcgt
cgtggggggg 20 1075 20 DNA Artificial Sequence Synthetic Sequence
1075 ggggacgatc gtcggggggg 20 1076 20 DNA Artificial Sequence
Synthetic Sequence 1076 ggggacgtcg tcgtgggggg 20 1077 27 DNA
Artificial Sequence Synthetic Sequence 1077 ggggtcgacg tcgacgtcga
ggggggg 27 1078 21 DNA Artificial Sequence Synthetic Sequence 1078
ggggaaccgc ggttgggggg g 21 1079 21 DNA Artificial Sequence
Synthetic Sequence 1079 ggggacgacg tcgtgggggg g 21 1080 23 DNA
Artificial Sequence Synthetic Sequence 1080 tcgtcgtcgt cgtcgtgggg
ggg 23 1081 15 DNA Artificial Sequence Synthetic Sequence 1081
tcctgccggg gaagt 15 1082 15 DNA Artificial Sequence Synthetic
Sequence 1082 tcctgcaggg gaagt 15 1083 15 DNA Artificial Sequence
Synthetic Sequence 1083 tcctgaaggg gaagt 15 1084 15 DNA Artificial
Sequence Synthetic Sequence 1084 tcctggcggg caagt 15 1085 15 DNA
Artificial Sequence Synthetic Sequence 1085 tcctggcggg taagt 15
1086 15 DNA Artificial Sequence Synthetic Sequence 1086 tcctggcggg
aaagt 15 1087 15 DNA Artificial Sequence Synthetic Sequence 1087
tccgggcggg gaagt 15 1088 15 DNA Artificial Sequence Synthetic
Sequence 1088 tcggggcggg gaagt 15 1089 15 DNA Artificial Sequence
Synthetic Sequence 1089 tcccggcggg gaagt 15 1090 15 DNA Artificial
Sequence Synthetic Sequence 1090 gggggacgtt ggggg 15 1091 20 DNA
Artificial Sequence Synthetic Sequence 1091 ggggtttttt ttttgggggg
20 1092 20 DNA Artificial Sequence Synthetic Sequence 1092
ggggcccccc ccccgggggg 20 1093 21 DNA Artificial Sequence Synthetic
Sequence 1093 ggggttgttg ttgttggggg g 21
* * * * *