U.S. patent application number 10/894655 was filed with the patent office on 2005-03-10 for pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination.
This patent application is currently assigned to Coley Pharmaceutical GmbH. Invention is credited to Heeg, Klaus, Lipford, Grayson, Wagner, Hermann.
Application Number | 20050054601 10/894655 |
Document ID | / |
Family ID | 8226397 |
Filed Date | 2005-03-10 |
United States Patent
Application |
20050054601 |
Kind Code |
A1 |
Wagner, Hermann ; et
al. |
March 10, 2005 |
Pharmaceutical composition comprising a polynucleotide and
optionally an antigen especially for vaccination
Abstract
The present invention relates to pharmaceutical compositions
comprising at least one fragment of a polynucleotide, preferably at
least one antigen, and optionally a pharmaceutically acceptable
carrier and/or diluent. In accordance with the present invention
was found that the introduction of the pharmaceutical composition
into vertebrates will achieve regulation of growth, induction of
cellular transcription and translation, protein synthesis, protein
expression or protein secretion. The pharmaceutical compositions
are useful in vaccination protocols but also in any other
therapeutic situation in which immunomodulation is of benefit, such
as sub-optimal immune responses, reaction to pathogens, tolerance
or autoimmunity.
Inventors: |
Wagner, Hermann; (Eching,
DE) ; Lipford, Grayson; (Watertown, MA) ;
Heeg, Klaus; (Marburg-Michelbach, DE) |
Correspondence
Address: |
Alan W. Steele
Wolf, Greenfield & Sacks, P.C.
600 Atlantic Avenue
Boston
MA
02210
US
|
Assignee: |
Coley Pharmaceutical GmbH
Langenfeld
DE
|
Family ID: |
8226397 |
Appl. No.: |
10/894655 |
Filed: |
July 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10894655 |
Jul 16, 2004 |
|
|
|
09355254 |
Feb 22, 2000 |
|
|
|
09355254 |
Feb 22, 2000 |
|
|
|
PCT/EP98/00367 |
Jan 23, 1998 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 37/00 20180101;
A61P 37/04 20180101; A61K 39/39 20130101; A61K 2039/55561 20130101;
Y02A 50/41 20180101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 23, 1997 |
EP |
97101019.4 |
Claims
1-23. (Canceled).
24. An immunomodulatory composition, comprising (a) an
oligonucleotide 5-7 nucleotides long comprising a sequence of a
binding site for a transcription factor or a part thereof, and (b)
a pharmaceutically acceptable carrier chosen from liposomes and
emulsions.
25. The composition of claim 24, wherein the oligonucleotide is
seven nucleotides long.
26. The composition of claim 24, wherein the oligonucleotide is six
nucleotides long.
27. The composition of claim 24, wherein the oligonucleotide is
five nucleotides long.
28. The composition of claim 24, wherein the oligonucleotide
comprises a sequence 5'-Pu-Pu-CpG-Py-Py-3', wherein Pu means purine
and is chosen from adenine (A) and guanine (G) and wherein Py means
pyrimidine and is chosen from cytosine (C), thymine (T), and
uracil.
29. The composition of claim 24, wherein the oligonucleotide
comprises a sequence 5'-Pu-Pu-CpG-Py-C-3', wherein Pu means purine
and is chosen from adenine (A) and guanine (G) and wherein Py means
pyrimidine and is chosen from cytosine (C), thymine (T), and
uracil.
30. The composition of claim 24, wherein the oligonucleotide
comprises a sequence GACGTC.
31. The composition of claim 24, wherein the oligonucleotide
comprises at least one phosphorothioate linkage.
32. The composition of claim 24, further comprising an antigen.
33. The composition of claim 24, wherein said composition does not
comprise an antigen.
34. A method of modulating an immune response in a patient,
comprising administering to a patient a composition of any one of
claims 24-32 in a suitable dose to modulate an immune response in
the patient.
35. The method of claim 34, wherein the immune response is an
immune response of the acquired immune system.
36. The method of claim 34, wherein the immune response is an
immune response of the innate immune system.
37. The method of claim 34, wherein the suitable dose to modulate
the immune response in the patient shifts an immune response to a
Th1-type reactivity.
38. The method of claim 34, wherein the immune response is
IgE-mediated allergy.
39. The method of claim 34, wherein the patient is receiving a
vaccine.
40. The method of claim 39, wherein the vaccine comprises an
antigen chosen from viral, bacterial, parasitic, transplantation,
and tumor antigens.
41. The method of claim 34, wherein the patient suffers from
cancer.
42. The method of claim 34, wherein the patient suffers from an
infection.
43. A method of treating a patient suffering from an infection,
comprising administering to a patient suffering from an infection a
suitable dose of a composition of any one of claims 24-32 to treat
the patient.
44. The method of claim 43, wherein the infection is chosen from
Leishmaniasis, Toxoplasmosis, and Mycobacteriosis.
Description
[0001] The present invention relates to pharmaceutical compositions
comprising at least one fragment of a polynucleotide, preferably at
least one antigen, and optionally a pharmaceutically acceptable
carrier and/or diluent. In accordance with the present invention
was found that the introduction of the pharmaceutical composition
into vertebrates will achieve regulation of growth, induction of
cellular transcription and translation, protein synthesis, protein
expression or protein secretion. The pharmaceutical compositions
are useful in vaccination protocols but also in any other
therapeutic situation in which immunomodulation is of benefit, such
as sub-optimal immune responses, reaction to pathogens, tolerance
or autoimmunity.
[0002] It is known that cells of the immune system are exported
from the bone marrow and undergo a series of differentiation events
which confer upon them the capacity to recognize and control
foreign pathogens and cancer cells by discriminating between self
versus non-self. These differentiation and education events are
tightly controlled by cell surface receptor engagement via
intracellular signal transduction and the milieu of autocrine,
paracrine and endocrine soluble ligands, typically referred to as
cytokines. Cell to cell interaction occurs in discrete locations
such as the thymus, spleen or lymph nodes but also in the
periphery. The system thus balances receptor and cytokine input
signals to regulate cellular proliferation, differentiation and
maturation of immune effector cells [Paul, Cell, 57:521 (1989)].
Through outside intervention the immune system can be manipulated,
namely enhanced, e.g. by vaccination or cytokine therapies, or
suppressed, e.g. by drug intervention or cytokine therapies.
[0003] The immune system of vertebrates consists of several
interacting components. The best characterized and most important
parts are the humoral and cellular (cytolytic) branches. Humoral
immunity involves antibodies, proteins which are secreted into the
body fluids and which directly recognize an antigen. The cellular
system, in contrast, relies on special cells which recognize and
kill other cells which are producing foreign antigens. This basic
functional division reflects two different strategies of the immune
defense. Humoral immunity is mainly directed at antigens which are
exogenous to the host's somatic cells or on the surface of cells
whereas the cellular system responds to antigens which are actively
synthesized within cells or derived from phagocytosed exogenous
antigens.
[0004] Antibody molecules, the effectors of humoral immunity, are
secreted by special B lymphoid cells, B cells, in response to
antigen, co-receptor stimulation and cytokines. Antibodies can bind
to and inactivate antigen directly (neutralizing antibodies) or
activate other cells of the immune system to destroy the antigen
depending on isotype; IgM, IgG1, etc. Isotype class switching in B
cells is controlled, inter alia, by cytokine milieu. Abnormalities
in antigen response, co-receptor engagement or cytokine milieu can
lead to suboptimal immune responses, tolerance or autoimmunity.
[0005] Cellular immune recognition is mediated by a special class
of lymphoid cells, the T cells. These cells do not recognize whole
antigens but instead respond to degraded peptide fragments thereof
which appear on the surface of the antigen presenting cells bound
to surface proteins called major histocompatibility complex (MHC)
molecules. Two subgroups of T cells exist: the CD4 T cells
recognize peptide fragments bound to MHC class II molecules while
CD8 T cells recognize peptide fragments bound to MHC class I
molecules. CD8 T cells include the population of cytotoxic T cells
(CTL) able to specifically lyse antigen presenting cells.
Essentially all nucleated cells have class I molecules. It is
believed that proteins produced within the cell are continually
degraded to peptides as part of normal cellular metabolism. These
fragments are bound to the MHC molecules and are transported to the
cell surface. Thus, the cellular immune system is constantly
monitoring the spectra of proteins produced in all cells in the
body and is poised to eliminate any cells producing foreign
antigens or abnormal self antigens. CD4 T cells recognize mainly
exogenous antigens that were taken up by antigen processing cells
wherein the antigen is degraded and appears as a peptide fragment
on class II MHC molecules. The effector function of CD4 cells is
primarily regulation of immune responses by release of cytokines.
According to the cytokine profiles secreted, two subclasses of CD4
cells have been defined, the TH1 and TH2 cells. It is believed that
in various infections and allergic and autoimmune diseases the type
of the CD4 T cell subclass activated (TH1 vs. TH2) critically
influences the outcome of the immune response.
[0006] Vaccination is the process of preparing a human or an animal
to respond to an antigen. Vaccination is more complex than immune
recognition and involves not only B cells and cytotoxic T cells but
other types of lymphoid cells as well. During vaccination, cells
which recognize the antigen (B cells or T cells) are clonally
expanded. In addition, the population of ancillary cells (helper T
cells which provide co-receptor and cytokine stimulation) specific
for the antigen also increase. Vaccination also involves
specialized antigen presenting cells which can process the antigen
and display it in a form which can stimulate one of the two
pathways (macrophages and dendritic cells).
[0007] A foreign antigen is introduced into a human or an animal
where it activates specific B cells by binding to surface
immunoglobulins. It is also taken up by antigen processing cells,
wherein it is degraded, and appears in fragments on the surface of
these cells bound to Class II MHC molecules. Peptides bound to
class II molecules are capable of stimulating the helper class of T
cells (CD4 T cells). Both helper T cells and activated B cells are
required to produce active humoral immunization. Cellular immunity
is stimulated by a similar mechanism but entry into the MHC I
presentation pathway of antigen presenting cells is typically by
intracellular pathogen replication and not achieved by injection of
protein antigen only.
[0008] Standard vaccination schemes nearly always produce a humoral
immune response. The humoral system protects a vaccinated
individual from subsequent challenge from a pathogen and can
prevent the spread of an intracellular infection if the pathogen
goes through an extracellular phase during its life cycle; however,
it can do relatively little to eliminate intracellular pathogens.
Cytotoxic immunity complements the humoral system by eliminating
the infected cells and cancer cells. Thus, effective vaccination
should advantageously activate both types of immunity.
[0009] A cytotoxic T cell response is necessary to remove
intracellular pathogens such as viruses as well as malignant cells.
It has proven difficult to present an exogenously administered
antigen in adequate concentrations in conjunction with Class I
molecules to assure an adequate response. This has severely
hindered the development of vaccines against tumor-specific
antigens (e.g., on breast or colon cancer cells), and against
weakly immunogenic viral proteins (e.g., HIV, Herpes, non-A, non-B
hepatitis, CMV and EBV). It would be desirable to provide a
cellular immune response alone in immunizing against agents such as
viruses for which antibodies have been shown to enhance
infectivity. It would also be useful to provide such a response
against both chronic and latent viral infections and against
malignant cells.
[0010] Directed and elevated immune responses to antigens can be
achieved by the use of adjuvants and/or delivery vehicles. The term
"immune adjuvant" refers to compounds which when administered to an
individual or tested in vitro, increase the immune response to an
antigen. Some antigens are weakly immunogenic when administered
alone or are toxic at the concentration which evokes immune
responses. An immune adjuvant may enhance the immune response of
the individual to the antigen by making the antigen more
immunogenic. The adjuvant effect may also lower the dose of antigen
necessary to achieve an immune response by enhancing presentation,
influence the cytokine milieu or alter co-receptor expression on
antigen presenting cells.
[0011] Recently, it has been demonstrated that oligonucleotides and
oligonucleotide derivatives may have a significant impact on
certain biological processes. Thus, it has been shown that
phosphorothioate oligonucleotides may have an influence on the
regulation of gene expression [Bielinska et al., Science, vol. 250
(1990), p. 997-250]. Krieg et al. [Nature, vol. 374 (1995), p.
546-549] report that bacterial DNA may trigger direct B cell
activation. They disclose that bacterial DNA and synthetic
oligodeoxynucleotides containing unmethylated CpG dinucleotides
induce murine B cells to proliferate and secrete immunoglobulin in
vitro and in vivo. Yet, the system developed by Krieg et al. has
not proven successful in every instance to trigger, modulate or
enhance an immune response that is beneficial to the patient. In
some instances, the system developed by Krieg even showed adverse
effects. Thus, the technical problem underlying the present
invention was to provide a means that is effectively and
beneficially applicable in a wide variety of situations where
stimulation, modulation or triggering of an immunological reaction
is desired.
[0012] The solution to said technical problem is activated by
providing the embodiments characterized in the claims.
[0013] Accordingly, the present invention relates to a
pharmaceutical composition comprising at least one fragment of a
polynucleotide and at least one antigen and, optionally, a
pharmaceutically acceptable carrier and/or diluent.
[0014] The term "polynucleotide" in the sense of the present
invention comprises all types of polynucleotides as well as
derivatives thereof, e.g. RNA, PNA or DNA whereby, however, DNA
polynucleotides are preferred. The term "fragment of a
polynucleotide", as used in accordance with the present invention,
may relate to a fragment generated from a polynucleotide or to a
nucleic acid molecule that is shorter than a polynucleotide, such
as an oligonucleotide which may be of synthetic origin.
[0015] The term "antigen" in the sense of the present invention
means a molecule that can elicit an immune response. The immune
response may be either humoral, i.e. antibody-mediated, or
cellular, i.e. cell-mediated. An antigen that evokes an immune
response is commonly referred to as immunogen. Generally only
foreign or "non-self" molecules are immunogenic. It should be
understood, however, that in the sense of the present invention,
the term antigen comprises also certain "self" molecules such as
tumor cells, tumor markers or self antigens in autoimmunity. Those
compounds may not be foreign to the host to be treated, but may be
comprised under the term antigen, since sometimes an immune
response to self molecules is desired. In that case exogenous
addition of antigen to the pharmaceutical composition may not be
required. The fragment of the polynucleotide as well as the antigen
may be of natural, synthetic or semisynthetic origin. Particularly,
in the case that the antigen is of natural origin, it may be
processed prior to administration.
[0016] Usually the larger and more complex a molecule is, the more
immunogenic sites it will have. A single antigen may contain many
epitopes which are specific areas of the molecule with a
three-dimensional configuration that induces an immune response.
Complex molecules, such as large proteins composed of many
different amino acids contain more epitopes than a comparatively
simple polysaccharide composed of two or three monosaccharide
repeats. The immune response to a given antigen can vary greatly
among species and individuals within a species due to immune
regulation genes. The pharmaceutical compositions of the present
invention comprise therefore specific polynucleotides which provoke
a suitable immune response.
[0017] It is preferred that the fragment of the polynucleotide as
used in the present invention comprises the sequence of a binding
site for transcription factors or parts thereof or that the
sequence of the polynucleotide is complementary to said binding
site for transcription factors or a part thereof.
[0018] The expression of individual genes is a rather complex
process. These processes are mediated by several specific
regulatory DNA regions found in the promotor regions of almost all
genes. These regulatory sequences are frequently referred to as
response elements. They are binding sites for sequence-specific DNA
binding proteins which are called transcription factors. Some
transcription factors are general purpose factors (basal
transcription factors) required for transcription of all genes
while others act on specific genes or classes of genes by binding
in a sequence-specific manner to response elements and other
sequence motives within the corresponding gene promotors. The
expression of many of these transcription factors is
developmentally and also tissue-specifically controlled and is
itself subject to the action of other transcription factors and
other accessory proteins such as nuclear receptors. Binding sites
for transcription factors are often clustered and a variety of
transcription factors have been found to form complexes with others
or to compete with others for binding to overlapping DNA-binding
motives. Several structural motives have been found within those
regions of transcription factor proteins recognizing and contacting
DNA. Within each of these structural motives there are often
families of related proteins that recognize similar DNA sequences
and are conserved throughout the eukaryotic kingdom.
[0019] In the course of the present invention it has been
surprisingly found that bacterial sequences as described in the
prior art may cause severe side effects such as lethal shock. It
has been found, however, that other DNA sequences may have a
beneficial effect on mammals and may therefore be used for the
preparation of pharmaceutical compositions having a beneficial
effect on the immune system. Thus, selection and identification of
such beneficial DNA sequences may be effected on the basis of the
teachings of the present invention.
[0020] The present invention also relates to a pharmaceutical
composition comprising
[0021] (a) a polynucleotide or an oligonucleotide comprising the
sequence of a binding site for transcription factors or a part
thereof or a polynucleotide or an oligonucleotide comprising a
sequence which is complementary to said binding site for
transcription factors or a part thereof; and optionally
[0022] (b) a pharmaceutically acceptable carrier and/or
diluent.
[0023] In the course of the present invention it has been found
that polynucleotides are preferred which have a sequence
corresponding to the binding site of transcription factors or which
are complementary thereto. Generally it is sufficient that at least
a part of said binding site is contained within the
polynucleotides. This embodiment of the invention is advantageously
employed in conjunction with the above cited "self" molecules.
[0024] Advantageously, the pharmaceutical compositions of the
present invention comprise inexpensive, stable and safe immune
adjuvants and immunomodulatory substances for human and animal
prophylactic and therapeutic use.
[0025] As has been stated above, the present invention relates to a
pharmaceutical composition comprising at least one of the
aforementioned regulatory sequences or antigens, either alone or in
combination, and optionally a pharmaceutically acceptable carrier
or excipient. Examples of suitable pharmaceutical carriers are well
known in the art and include phosphate buffered saline solutions,
water, emulsions, such as oil/water emulsions, various types of
wetting agents, sterile solutions etc. Compositions comprising such
carriers can be formulated by well known conventional methods.
These pharmaceutical compositions can be administered to the
subject at a suitable dose. Administration of the suitable
compositions may be effected by different ways, e.g., by
intravenous, intraperitoneal, subcutaneous, intramuscular, topical
or intradermal administration. The dosage regimen will be
determined by the attending physician and other clinical factors.
As is well known in the medical arts, dosages for any one patient
depends upon many factors, including the patient's size, body
surface area, age, the particular compound to be administered, sex,
time and route of administration, general health, and other drugs
being administered concurrently. Generally, the regimen as a
regular administration of the pharmaceutical composition should be
in the range of 1 .mu.g to 10 mg units per day. If the regimen is a
continuous infusion, it should also be in the range of 1 .mu.g to
10 mg units per kilogram of body weight per minute, respectively.
Progress can be monitored by periodic assessment. Dosages will vary
but a preferred dosage for intravenous administration of DNA is
from approximately 10.sup.8 to 10.sup.22 copies of the DNA
molecule. The compositions of the invention may be administered
locally or systemically. Administration will generally be
parenterally, e.g., intravenously; DNA may also be administered
directly to the target site, e.g., by biolistic delivery to an
internal or external target site or by catheter to a site in an
artery.
[0026] Advantageously, in the pharmaceutical compositions of the
present invention liposomes can serve as carriers for the direction
of antigen to antigen presenting cells. It has been demonstrated
that liposomes can serve to heighten some humoral immune responses
and to provide for exogeneously administered antigen a vehicle for
entry into the MHC class I presentation pathway thus allowing the
stimulation of cytotoxic T cells.
[0027] It is envisaged by the present invention that the various
DNA oligonucleotides and/or polynucleotides or fragments thereof
are administered either alone or in any combination using standard
vectors and/or gene delivery systems, and optionally together with
an appropriate compound, and/or together with a pharmaceutically
acceptable carrier or excipient. Subsequent to administration, said
DNA oligonucleotides and/or polynucleotides may be stably
integrated into the genome of the mammal. On the other hand, viral
vectors may be used which are specific for certain cells or tissues
and persist therein. Suitable pharmaceutical carriers and
excipients are well known in the art. The pharmaceutical
compositions prepared according to the invention can be used for
the prevention or treatment or delaying of different kinds of
diseases, which are related to the expression or overexpression of
genes.
[0028] Furthermore, it is possible-to use a pharmaceutical
composition of the invention which comprises DNA oligonucleotide in
gene therapy. Suitable gene delivery systems may include liposomes,
receptor-mediated delivery systems, naked DNA, and viral vectors
such as herpes viruses, retroviruses, adenoviruses, and
adeno-associated viruses, among others. Delivery of nucleic acids
to a specific site in the body for gene therapy or antisense
therapy may also be accomplished using a biolistic delivery system,
such as that described by Williams (Proc. Natl. Acad. Sci. USA 88
(1991), 2726-2729).
[0029] Standard methods for transfecting cells with recombinant DNA
are well known to those skilled in the art of molecular biology,
see, e.g., WO 94/29469. Gene therapy and antisense therapy to
diseases mentioned in accordance with the invention may be carried
out by directly administering the DNA oligonucleotide to a patient
or by transfecting cells with the DNA oligonucleotide ex vivo and
infusing the transfected cells into the patient. Furthermore,
research pertaining to gene transfer into cells of the germ line is
one of the fastest growing fields in reproductive biology. Gene
therapy, which is based on introducing therapeutic genes into cells
by ex-vivo or in-vivo techniques is one of the most important
applications of gene transfer. Suitable vectors and methods for
in-vitro or in-vivo gene therapy are described in the literature
and are known to the person skilled in the art; see, e.g.,
WO94/29469, WO 97/00957 or Schaper (Current Opinion in
Biotechnology 7 (1996), 635-640) and references cited therein. The
DNA molecules and vectors comprised in the pharmaceutical
composition of the invention may be designed for direct
introduction or for introduction via liposomes, or viral vectors
(e.g. adenoviral, retroviral) containing said recombinant DNA
molecule into the cell. Preferably, said cell is a germ line cell,
embryonic cell, or egg cell or derived therefrom. The
pharmaceutical compositions according to the invention can be used
for the treatment of diseases hitherto unknown as being related to
susceptible to cytokine presence or concentration. An embryonic
cell can be for example an embryonic stem cell as described in,
e.g., Nagy, Proc. Natl. Acad. Sci. 90 (1993) 8424-8428.
[0030] In a preferred embodiment of the present invention the
oligbnucleotide or polynucleotide is a DNA oligonucleotide. DNA
oligonucleotides as used in the present invention are preferably
short fragments of a DNA having about 100, preferably five to about
40 and most preferably 15 to about 25 nucleotides.
[0031] The DNA polynucleotide fragments which are preferably
oligomers provide when applied in relatively low quantities in the
range of 0.1 to 10 .mu.g the effect of an immune adjuvant and
immunomodulatory substance together with low toxicity and low side
effects. For example can a combination of a suitable DNA oligomer
and tumor cells or specific tumor markers induce tumor regression.
The invention also relates to corresponding uses.
[0032] In a preferred embodiment of the present invention the DNA
oligonucleotide is single-stranded or double-stranded, whereby
single-stranded DNA is especially preferred.
[0033] In a further preferred embodiment of the present invention,
said sequences of binding sites for transcription factors are
binding sites of transcription factors of cytokines.
[0034] In another preferred embodiment of the present invention,
the polynucleotide contained in said pharmaceutical composition
comprises the sequence 5'PuPuCGPyC or a non-toxic derivative
thereof wherein Pu means purine and comprises adenine and guanine
and Py has the meaning of pyrimidine and comprises cytosine,
thymine and uracil and wherein A means adenine, C means cytosine
and G means guanine. Non-toxicity of said derivatives can be
effected according to conventional protocols.
[0035] Those preferred sequences of the present invention differ
slightly but biologically significantly from the CpG motives as
disclosed in the prior art.
[0036] It is furthermore preferred that in the pharmaceutical
composition of the invention, said binding site is or is derived
from a eukaryotic binding site.
[0037] The term "derived from" is intended to mean in accordance
with this invention that one or more nucleotides from a naturally
occurring binding site are changed. Said change can be effected
according to conventional protocols such as mutagenesis
protocols.
[0038] It is particularly preferred that said eukaryotic binding
site is a binding site for a cytokine.
[0039] As regards the part of said binding site for said
transcription factor or its complementary sequence, it is preferred
that said part is a motif or a complementary sequence thereof.
Motives of transcription factors are well known in the art and need
not be discussed here any further.
[0040] It is furthermore particularly advantageous that said part
comprises at least 7 nucleotides. Whereas this length of said part
(and, of course, of the complete oligonucleotide as well) has been
particularly advantageous, it may also comprise significantly more
than 7 nucleotides.
[0041] It is preferred that the polynucleotide comprises at least
one phosphorothioate linkage.
[0042] In the preferred phosphorothioate derivatives of the
polynucleotides at least one oxygen atom of the phosphate backbone
of the polynucleotide is replaced by a sulphur atom. Those
compounds are more stable against degradation.
[0043] It is also possible to add to the pharmaceutical composition
of the present invention further classical adjuvants which are
known to the person skilled in the art. Examples may be
preparations from the cell walls of bacteria. The pharmaceutical
compositions of the present invention advantageously comprise also
additives, otherwise known as pharmaceutically acceptable carriers
and/or diluents known to the person skilled in the art depending on
the administrative way e.g. oral, parenteral or rectal.
[0044] It is possible to use in accordance with the present
invention a wide variety of antigens. Preferred antigens are
selected from the group comprising peptides, polypeptides,
steroides and tumor cells.
[0045] Further examples for preferred antigens may be killed intact
bacteria, toxoides (i.e. toxines that are still immunogenic but are
rendered biologically inactive by treatment with a chemical, heat
or mutation), subunit vaccines in which only the non-toxic portion
of the molecule is used or life-attenuated vaccines in which a
viral or bacterial strain is rendered non-pathogenic (e.g. by
passaging the virus in cell culture or deletion of bacterial
genes), but is still able to multiply to a limited degree thereby
eliciting protective immune response in the absence of disease
symptoms.
[0046] Since the pharmaceutical composition of the present
invention can also be used for the treatment and/or prophylaxis of
such diseases which are not caused by foreign organisms the antigen
may be also an antigen of the own body like a tumor antigen. For
the treatment of autoimmune diseases or in order to positively
influence the tolerance it may also be effective to use antigens
derived from the body to be treated. In that cases it may not be
required to add the antigen to the pharmaceutical composition since
the antigen is already present in the host.
[0047] In the accomplishment of the foregoing objectives of the
invention, vaccine formulations are made which induce both humoral
and cellular immune responses to antigen using preferably sequences
with non-toxic embodiments of the motif 5'Pu-Pu-CpG-Py-Py-3'. Some
sequences, especially with the motif 5'Pu-Pu-CpG-Py-Py-3' can be
toxic and lethal. It is therefore another aspect of the invention
to modify these sequences in such a way that immune adjuvant
activity is maintained but toxicity is eliminated. In addition, DNA
sequences are described which do not follow this motif but serve as
immune adjuvant and immune response modifiers. A common aspect of
the invention is that sequences from eukaryotic promoters are used.
ssDNA sequences containing palindromic and non-palindromic
transcription response elements, that is sequences recognized by
transcription factors (proteins which regulate gene transcription)
serve also as immune adjuvant or immune response modifiers in
accordance with the invention. These sequences are capable of
modulating lymphocyte cell surface markers and cytokine release in
vitro and in vivo. In yet another aspect of the invention, the
methods of treatment are pharmaceutical compositions and
appropriate utilized therapeutic approaches for treating immune
system tolerance and control of tumor.
[0048] The teaching of the present invention can be used for
modulating the immune response to antigen by using certain DNA
oligomers. The particular DNA depends on the desired outcome. Its
sequence can be determined by the person skilled in the art without
further ado on the basis of the teachings of the present invention.
The invention works in vitro and in vivo in warm blooded
animals.
[0049] A common aspect of the invention is to use the
polynucleotide fragment and, in particular, certain DNA
oligonucleotides to specifically influence the regulation and
signalling machinery of eukaryotic cells. In particular, growth,
induction of cellular transcription and translation, protein
synthesis or protein secretion can be modified by DNA
oligonucleotides. In addition, response patterns of eukaryotic
cells towards exogenous stimuli are subject of modification.
Modification of the response the eukaryotic cell is controlled by
the sequence of the oligonucleotide, i.e. is sequence-specific. The
invention gives a rule how active DNA oligonucleotides can be
selected. For example, by simply modifying known transcription
factor binding sites, e.g., by mutagenesis techniques and testing
the modified sequences by, for example, conventional protocols or
protocols described in this specification, said active
oligonucleotides can be identified. Accordingly, active DNA
oligonucleotides are derived from DNA-sequences able to be bound by
transcription factors. These sequences can be identified from
eukaryotic promotors.
[0050] The invention concerns also the use of specific
oligonucleotides or polynucleotide fragments as defined herein
above which are preferably DNA for the preparation of a
pharmaceutical composition which have the effect to interfere, to
modulate and to regulate responses of the innate and acquired
immune system. Those include enhancement of immune responses
(including vaccination), modulation of immune responses and
suppression of immune responses.
[0051] Use of DNA oligomeres to enhance the reactivity of immune
cells to viral, bacterial and parasitic antigens is another object
of the invention. Enhancement includes induction of immunological
memory, cytotoxic T cells, cytokine release and augmentation of
innate immunity (phagocytosis, cytokine release and cytolytic
function). In particular, DNA oligomers can be used as an adjuvant
for T- and B-cell vaccination. Enhancement further includes
induction of reactivity against weak or tumor antigens. The use of
DNA oligonucleotides to break tolerance in anergic T and B cells
e.g. against tumor antigens is a further object of the invention.
This incorporates the use of DNA oligonucleotides as adjuvants in
vaccination against tumor-defined antigens and immunostimulatory
substances in an ongoing immune response against tumors.
[0052] Use of DNA oligos to modulate responses of the acquired
immune system is also an aspect of the present invention. Desired
immune responses can be stimulated while adverse effects can be
suppressed by DNA oligonucleotides. DNA oligonucleotides can shift
an immune response to a TH1-type or a TH2-type of reactivity. This
effect modulates the response during parasitic infections
(Leishmaniasis, Toxoplasmosis, or Mycobacteriosis). In addition,
the use of DNA oligonucleotides to direct a B cell immune response
towards certain classes of immunoglobulins, thus bypassing and
overcoming the adverse Ig-dependent diseases like Ig-E-mediated
allergy is also an aspect of the present invention.
[0053] Use of DNA oligos to suppress immune reactions of the innate
and acquired immune system is also an aspect of the present
invention. DNA oligonucleotides can be used to suppress B- and
T-cell responses towards transplantation antigens and thus induce
transplantation tolerance. DNA oligonucleotides can further be used
to suppress ongoing or manifested immune responses as it is the
case during T- and B-cell dependent autoimmune diseases.
[0054] The pharmaceutical preparations of the present invention
preferably comprise polynucleotides applied together with antigen
either in free form or entrapped in liposomes. The science of
forming liposomes is now well developed. Liposomes are unilamellar
or multilamellar vesicles having a membrane portion formed of
lipophilic material and an interior aqueous portion. The aqueous
portion is used in the present invention to contain the antigen
and, probably, protein material to be delivered to the antigen
presenting cell. Conventional methods can be used to prepare
liposomes. They are taken up by macrophages and dendritic cells in
vivo and are thus particularly effective for delivery of antigen to
these cells.
[0055] Liposomes may be manufactured by a rehydration entrapment
method. Preferably the liposomes are prepared as follows. 18.0 mg
phosphatidylcholine; 2.0 mg phosphatidylglycerol and 5.0 mg
cholesterol, at a 2:0.2:1 ratio, are suspended in 5.0 ml chloroform
in a 100 ml round bottom flask. The mixture is rotary evaporated
under reduced pressure until a thin lipid film forms on the flask
wall. Residual chloroform is removed by vacuum desiccation. 3 mg of
ovalbumin is solubilized in 1.0 ml of PBS.
[0056] This solution is slowly added to the dried lipid and
hand-shaken until the lipids are resuspended. The crude protein
liposome mixture is allowed to equilibrate for 30 min at room
temperature, transferred to a microfuge tube and centrifuged at
6,000 rpm for 5 min in an Eppendorf microfuge. The mixture is then
filter-extruded through a 0.2 .mu.g Anotop10.RTM. syringe mount
filter. To this mixture 10 nmol oligomer is added per 100
.mu.l.
[0057] The pharmaceutical composition of the invention may
advantageously be tested in mice. In such experiments mice were
usually immunized by way of the hind footpad with 50 .mu.l per foot
of peptide liposome preparation. After four days, the draining
popliteal lymph nodes (LN) were removed and a single-cell
suspension was prepared. The cells were cultured for four days in
the presence of IL-2 and a chromium release assay was performed
utilizing the syngenic target cell EL-4 or the cell line EG-7 which
is transfected with the gene for ovalbumin and thus presents
ovalbumin peptides as antigen (FIG. 1). In some experiments EL-4
pulsed with the MHC class I (Kb) restricted ovalbumin peptide
SIINFEKL was used as the target for kill.
[0058] The present invention also comprises methods of immunizing
patients against a variety of diseases and conditions that have
been referred to herein above or of treating patients suffering
from one of the above referenced conditions or diseases.
Formulations, routes of administration and doses have been
identified herein above in connection with the discussion of the
pharmaceutical compositions of the invention.
[0059] Finally, the invention relates to a method comprising
[0060] (a) testing a nucleic acid molecule comprising a putative
binding site of a transcription factor for toxicity;
[0061] (b) modifying the nucleic acid sequence of said putative
binding site comprised in said nucleic acid molecule which has
proven toxic in step (a); and
[0062] (c) repeating steps (a) and (b) one ore more times until a
non-toxic nucleic acid molecule has been identified.
[0063] Isolation of nucleic acid molecules to be tested, testing
procedures as well as modification procedures for the nucleic acid
sequences are well known in the art and had been described in the
present specification, respectively.
[0064] An oligonucleotide that has been identified to be beneficial
in accordance with the invention is IL-12p40
AGCTATGACGTTCCAAGG.
[0065] The figures show:
FIG. 1: Cytolytic T cell Induction In Vivo With Different ssDNA
Adjuvants
[0066] Mice were injected with the antigen ovalbumin entrapped in
liposomes using the indicated adjuvant. T cells were harvested from
the mice and tested for the specific recognition of the antigen.
The assay indicated a strong activation of the cellular immune
system due to the adjuvant. AP-1, Stat-5/6, SIE, c/Myb, Stat3,
Stat4, Stat5, SP-1, C/EBP, IL-13, Stat1, CRE, Erg and IRF-1 are
binding sites for transcription factors.
FIG. 2: A Summary of Cytolytic T Cell Assay
[0067] Different sequences were tested. In vivo induced CTL were
tested for specific antigen recognition. Data are expressed as
lytic units.
[0068] A lytic unit is arbitrarily defined as the number of
lymphocytes required to yield 30% specific lysis. The number is the
lytic units per 10.sup.6 effector cells. Lytic units are a way to
compare cytolytic T cell populations.
FIG. 3: Antibody Production By ssDNA Adjuvants Post Injection
[0069] Endpoint antibody titer assay: Mice were injected with the
antigen ovalbumin entrapped in liposomes using either no adjuvant
or a TRE (transcription regulatory elements) adjuvant. The mice
were boosted once.
[0070] The assay indicates a strong adjuvant effect for the
enhancement of antibody production in response to injected antigen.
The adjuvant-assisted increase in response is particularly strong
for IgG2a and IgG2b. Of note is the differential induction of
antibody isotype dependent on the adjuvant used indicating
differential cytokine release.
FIG. 4: Cytokine Induction In Vivo With Transcription Response
Element ssDNA Adjuvant CRE
[0071] The cytokine release pattern is induced by the transcription
response element CRE. Mice were injected with the ssDNA and at the
indicated time serum was sampled and cytokine release measured.
FIG. 5: Phenotype Changes (IL-2 Receptor Expression) of B And T
Cells In Vivo With Different Transcription Tesponse Element ssDNA
Adjuvants
[0072] Analysis of a relevant cell surface marker after treatment
with ssDNA. The IL-2 receptor binds and transduces a proliferation
signal from IL-2 to cells of the immune system. The TRE sequences
vary in their simulatory capacity for inducing IL-2 receptor
expression. Some TRE are inhibitory indicating a potential use for
negative immunmodulation.
FIG. 6: Tumor Regression And Control With ssDNA. ssDNA induces
regression of prexistant tumor.
[0073] Mice were injected with tumorigenic numbers of a syngenic
tumor cell. Four days after the challenge the mice were treated
with ssDNA alone or ssDNA plus a subtumorigenic number of tumor
cells, which served as an antigen source. The progression of tumor
growth was significantly controlled. Five mice were included per
group.
FIG. 7: Course of Infection With L. major In ODN-Treated Mice
[0074] BALB/c mice were injected with 2.times.10.sup.6 L. major
promastigotes into the right hind footpad. Oligonucleotide (ODN)
(10 nmol) was given as treatment 2 h before and 10 h after
infection. The mean percent increase (.+-.SD of the footpad
thickness is given (three mice per group). Closed symbols indicate
the ODN-treated groups and the open circle the non-ODN-treated
control group. ODN treatments are: closed circle, 1720; closed
diamond, AP-1; closed triangle, 1668; closed square; IL-12-p40.
[0075] The examples illustrate the invention.
EXAMPLE 1
[0076] Bacterially derived sequences can be used as an adjuvant for
cytolytic T cell activation in vivo.
[0077] Three sequences containing the sequence motif of
5'Pu-Pu-CpG-Py-Py-3' are described in the literature for having
immunostimulating properties. One sequence is derived from the
ampicillin resistance gene of E. coli, here termed AMP
(TCATTGGAAAACGTTCTTCGGGGC). The second sequence is derived from a
BCG gene and is termed BCG-A4A (ACCGATGACGTCGCCGGTGACGGCACCACG).
The third is a synthetic sequence claimed to be a prototype of
bacterial CpG sequences, referred to by Krieg et.al. as 1668
(TCCATGACGTTCCTGATGCT). These sequences were synthesized to include
a phosphorothioate linkage to reduce destruction by DNase. These
oligomers served as an adjuvant in combination with ovalbumin to
induce a cytolytic T cell response.
EXAMPLE 2
[0078] Bacterial CpG containing sequences may be toxic.
[0079] We observed that the above-described oligomers could be
highly toxic in vivo for mice sensitive to TNF-.alpha.. The 1668
oligomer was previously described by Krieg and co-workers for its
ability to induce murine B cell proliferation, induce IL-6 release
from B cells and induce IFN-.gamma. release from B cells and induce
IFN-.gamma. release from NK1.1 cells. We found in addition that
1668 and AMP were highly lethal in mice sensitized to the effects
of TNF-.alpha. (Table 1). However, under certain circumstances
these sequences may be useful therapeutically. One could foresee
the use of these sequences once the risk is properly assessed.
1TABLE 1 Death due to lethal shock 1668 + D-gal 5/5 1668 + LPS 3/3
AMP + LPS 2/3 Control 0/3 Ratio = mice killed/mice injected
[0080] For lethal shock, Balb/c mice were injected
intraperitoneally with 10 nmol 1668 in 200 .mu.l PBS plus 20 mg
D-galactosamine in 200 .mu.l PBS. Alternatively mice were injected
intravenously with 10 nmol 1668, AMP or PBS followed at four hours
with 50 .mu.g LPS.
EXAMPLE 3
[0081] Use of eukaryotic transcription regulatory elements or
sequence manipulation prevents toxic shock symptoms.
[0082] Due to toxicity, the need is established for the discovery
of non-toxic sequences for safe human and animal use. Since
toxicity is at issue when developing vaccine adjuvants and
therapeutics, we were interested to develop oligomers that
circumvented toxicity but retained immunostimulatory properties. We
screened eukaryotic sequences displaying the absence of lethality
but maintaining immunostimulatory qualities. One such sequence was
the cyclic AMP response element (CRE) which is the consensus
binding site for the transcription factors CREB/ATF as well as the
AP-1 family, sequence (GATTGCCTGACGTCAGAGAG) [Roesler, W. J. et
al., J. Biol. Chem. 263, 9063-9066 (1988)]. Table 2 demonstrates
the loss of lethality of the CRE sequence. To further evaluate the
sequence specificity of these effects we made sequence exchanges
between CRE and 1668. An exchange of only two nucleotides between
CRE and 1668 resulted in a loss of lethality (Table 2).
2TABLE 2 Sequences of oligomers and death due to lethal shock a
1668 TCCATGACGTTCCTGATGCT 5 CRE ATTGCCTGACGTCAGAGAGC 6 1668-CA
TCCATGACGTCACTGATGCT 7 CRE-TC ATTGCCTGACGTTCGAGAGC b 1668 5/5 CRE
0/5 1668-CA 0/3 CRE-TC 3/3
[0083] Lethality was determinined as in example 2. The 1668
sequence fortuitously contains a combination of transcription
response elements, namely the transcription factor binding sites
(TGACGTTCC). This element represents the binding site for HSVIP04
(ATF), HSINS04 (CREB half site), CAMV35SR03 (HBP-la yeast) or
ADE422 (AP-1) in combination with an HSIL606 site which is a
repressor site (sequence analysis from EMBL database Heidelberg).
This sequence can be found in the 5' non-coding regions (promoters)
of several eukaryotic cytokine genes including human IL-13 promoter
and II-12 p40 intron 1. The CRE sequence contains all the response
elements cited above except for HSIL606 and it contains the full
CRE pallindromic sequence (TGACGTCA). In accordances with the
invention, the CRE sequence did not induce death and changes in the
1668 eliminate toxicity.
[0084] TNF-.alpha. release is a hallmark of lethal toxic shock
[Tracey, K. J. et al., Science 234, 470474 (1986), Tracey, K. J. et
al., Nature 330, 662-664 (1987)]. An exchange of only two
nucleotides between CRE and 1668 resulted in a loss of macrophage
induced TNF-.alpha. release activity. The sequence of the
corresponding oligonucleotide is given in Table 2. The reported
6-mer active core sequence of 1668 contains the CpG flanked by two
5' purines and two 3' pyrimidines. The exchange of CA for TC does
not affect this motif, however, TNF-.alpha. release was severely
diminished. Thus, the broader core 8-mer sequence or the
transcription response element and not the surrounding sequence
environment was responsible for these effects. In accordance with
the invention, when utilizing macrophage derived TNF-.alpha.
release as a marker, the information comprised in the prior art
5'Pu-Pu-CpG-Py-Py-3' motif alone was not satisfactory for
predicting oligomer activity or toxicity. Additionally, in contrast
to 1668, CRE did not induce IL-6 release in vivo or from the ANA-1
cell line in vitro.
EXAMPLE 4
[0085] ssDNA containing transcription response elements (TRE) serve
as adjuvant for antibody production.
[0086] In accordance with the invention, eukaryotic transcription
response elements relevant to the immune system serve as immune
adjuvant. To test the adjuvant qualities of different sequences we
injected mice with either free ovalbumin plus oligomer or liposome
encapsulated ovalbumin plus oligomer. The mice were boosted at day
14 and after one week ovalbumin specific endpoint antibody titers
were determined in an isotype specific ELISA.
[0087] FIG. 3 shows that different sequences strongly potentiated
the antibody response and induced class switching toward IgG1,
IgG2a and IgG2b.
[0088] Liposomes containing ovalbumin were prepared as described
above. For antibody induction, 300 .mu.g ovalbumin in PBS or
liposomes containing ovalbumin were injected +/- 10 nmol oligomer
in the hind footpads of C57/B6 mice. A boost of the like inoculum
was given after two weeks and one week later blood was extracted
for serum antibody titering.
EXAMPLE 5
[0089] ssDNA containing transcription response elements serve as
adjuvant for cellular immunity.
[0090] We have described the use of liposomes in combination with
Quil A or QS-21 to induce cytolytic T cells (CTL) to either soluble
antigen or peptides [Lipford, G. B., Wagner, H. & Heeg, K.,
Vaccine 12, 73-80 (1994), Lipford, G. B. et al., J. Immunol. 150,
1212-1222 (1993)]. Liposome entrapped antigen alone was an
ineffective inducer of CTL activity, but with the addition of
immunostimulatory saponins the inoculum became effective. To test
the in vivo T cell immunomodulatory potential of oligomers we
utilized this vehicle to demonstrate primary activation of CTL.
FIG. 1 shows a substantial primary CTL response induced by an
inoculum of ovalbumin liposomes plus ssDNA matching transcription
response elements. The lytic units value interpolated from these
curves was approximately 500 L.U. as compared to <20 L.U. for
ovalbumin liposomes only (Table 3). CTL memory, an important
quality for vaccine protection, could also be demonstrated with
these inocula. If mice were rested for two weeks after the first
injection and reinjected with the same inoculum, CRE recalled CTL
displaying lytic units measured at approximately 1500 L.U. (Table
3). Additional, when the inoculum was formulated with the
immunodominant Kb restricted ovalbumin peptide SIINFEKL, the
oligomers induced a specific primary CTL response. Thus, oligomers
serve as a strong in vivo stimulus resulting in T cell activation
and the proliferation of antigen specific CTL effectors. The
inoculum can contain protein or peptide as the target antigen.
3TABLE 3 Cytolytic T cell response induced by oligomer in lytic
units CRE PBS Primary CTL 526 L.U. <20 L.U. Secondary CTL 1555
L.U. <20 L.U.
[0091] Several other sequences have been determined to have
immunomodulatory effects. Table 4 list tested eukaryotic
transcription response elements (TRE), which are preferably used in
the present invention.
4TABLE 4 Sequences of eukaryotic TRE tested 8 CRE
GATTGCCTGACGTCAGAGAG 9 IL-13 GGAATGACGTTCCCTGTG 11 AR-1
GCTTGATGACTCAGCCGGAA 12 SR1 TCGATCGGGGCGGGGCGAGC 13 C/EBP
TGCAGATTGCGCAATCTGCA 14 EGR AGCGGGGGCGAGCGGGGGCG 15 GAS/ISRE
TACTTTCAGTTTCATATTACTCTA 16 SIE GTCCATTTCCCGTAAATCTT 17 STAT1
TATGCATATTCCTGTAAGTG 18 STAT3 GATCCTTCTGGGAATTCCTA 19 STAT4
CTGATTTCCCCGAAATGATG 20 STAT5 AGATTTCTAGGAATTCAATC 21 STAT5/6
GTATTTTCCCAGAAAAGGAAC 22 IRF-1 AAGCGAAAATGAAATTGACT 23 c-Myb
CAGGCATAACGGTTCCGTAG 24 NFkB ATATAGGGGAAATTTCCAGC 25 HSINF
CAAAAAAATTTCCAGTCCTT 26 HSIL-6 ATGTTTTCCTGCGTTGCCAG 27 CRENFkB
CTCTGACGTCAGGGGAAATTTCCAGC
[0092] The relative strength of the various transcription response
elements for adjuvant potential for CTL induction can be seen in
FIG. 2. EXAMPLE 6
[0093] ssDNA containing transcription response elements induce
cytokine release in vivo.
[0094] Mice were injected with formulations containing different
oligomers plus liposome or liposomes containing 300 .mu.g
ovalbumin. Serum was collected at various times and analyzed for
serum cytokine levels by specific ELISA.
[0095] In addition T cells produce IL-2 in response to ssDNA. It
was found that cytokine release patterns are sequence dependent and
thus the eukaryotic transcription response element used influences
the cytokine release outcome and thus the biological effects. This
aspect of the invention is highly relevant, because cytokine
release patterns can be influenced by different transcription
response elements. ssDNA can be used to induce cytokine release in
vivo to produce a desired outcome. This outcome could be to produce
immune enhancement or immune suppression.
[0096] ssDNA containing transcription response elements can break
tolerance in T cells. It can be demonstrated that T cells induced
to become tolerant (that is non-response to antigen signals) in
vivo by SEB injection break tolerance if ssDNA is injected up to
seven days post tolerance induction. This finding has relevance for
the development of specific modulations for desired biological
outcome. It can be foreseen that ssDNA can be used to elevate the
immune response of immunocompromised patients.
EXAMPLE 7a:
[0097] ssDNA containing transcription response elements induce
co-receptor and surface receptor change on B and T cells. This
finding has relevance for the development of specific modulations
for desired biological outcome.
[0098] Mouse spleen cells were harvested and cultured 24 hours in
the presence of the list eukaryotic TRE. Cell surface markers were
measured on T or B cell by FACS analysis.
[0099] Some of the transcription response elements have a positive
effect and some have a negative effect. Both types of results are
of potential medical use. If immune enhancement is desired a
sequence inducing a given cell surface marker would be of use. If
immune suppression is desired a sequence suppressing a given cell
surface marker would be of use. Further guidance on such selection
is provided in Example 7b.
EXAMPLE 7b
[0100] ssDNA containing transcription response elements induce (a)
expressiori of co-stimulatory molecules B7.1, B7.2 and CD40, (b)
production of the cytokine IL-12, IL-6 and TNF-.alpha. on murine
dendritic cells. These events (termed maturation and activation)
are associated with the acquisition of professional antigen
presenting activity to naive T cells.
[0101] Immature murine dendritic cells were grown from bone marrow
cells in GM-CSF conditioned medium according to published
protocols. At day 8 to 11 of culture, non-adherent cells were
either MHC class 11 negative, or intermediate (termed immature DC)
or high (termed mature DC). FACS.RTM. sorting of MHC class II
intermediate of high cells revealed DC-like morphology. Bacterial
DNA or ssDNA containing transcription response elements strongly
upregulated CD80 (B7.1) CD86 (B7.2) CD40 and MHC class II molecules
on immature DC, as measured by FACS analysis. In addition, i.s.
(immune stimulating) DNA containing transcription response element
triggered production of high concentrations of IL-12, TNF-.alpha.
and IL-6. Finally, the i.s. DNA matured/activated DC (derived from
sorted MHC class 11 intermediate cells) expressed professional APC
function as assayed in an allogenic "mixed lymphocyte reaction" and
in primary T cell cultures stimulated with the superantigen
"staphylococcal enterotoxin B" (SEB). It is known that SEB does not
require processing but requires professional APC for presentation
to naive V.beta.8 T cells. Conversion, as induced by ssDNA, of
immature DC into professional APC explains the powerful adjuvant
effect of ssDNA containing transcription response elements in in
vivo on humoral and T cell response to poorly immunogenic antigens
used for vaccination.
EXAMPLE 8
[0102] ssDNA containing transcription response elements can induce
tumor control or regression.
[0103] FIG. 6 demonstrates that mice challenged with tumor cells
progress rapidly to display measurable subcutaneous tumors. These
tumors are lethal. If ssDNA is injected four days post challenge
the tumor regress or show retarded rates of growth. In addition if
cells are provided as antigen the same observation is made.
EXAMPLE 9
[0104] Course of infection with L. major in ODN-treated mice.
[0105] BALB/c mice were injected with 2.times.10.sup.6 L. major
promastigotes into the right hind footpad. Oligonucleotide (ODN)
(10 nmol) was given as treatment 2 h before and 10 h after
infection. The mean percent increase (.+-.SD of the footpad
thickness is given (three mice per group). Closed symbols indicate
the ODN-treated groups and the open circle the non-ODN-treated
control group. ODN treatments are: closed circle, 1720; closed
diamond, AP-1; closed triangle, 1668; closed square; IL-12-p40.
Sequence CWU 1
1
27 1 8 PRT Artificial sequence Synthetic oligopeptide 1 Ser Ile Ile
Asn Phe Glu Lys Leu 1 5 2 18 DNA Artificial sequence Synthetic
oligonucleotide 2 agctatgacg ttccaagg 18 3 24 DNA Artificial
sequence Synthetic oligonucleotide 3 tcattggaaa acgttcttcg gggc 24
4 30 DNA Artificial sequence Synthetic oligonucleotide 4 accgatgacg
tcgccggtga cggcaccacg 30 5 20 DNA Artificial sequence Synthetic
oligonucleotide 5 tccatgacgt tcctgatgct 20 6 20 DNA Artificial
sequence Synthetic oligonucleotide 6 gattgcctga cgtcagagag 20 7 20
DNA Artificial sequence Synthetic oligonucleotide 7 attgcctgac
gtcagagagc 20 8 20 DNA Artificial sequence Synthetic
oligonucleotide 8 tccatgacgt cactgatgct 20 9 20 DNA Artificial
sequence Synthetic oligonucleotide 9 attgcctgac gttcgagagc 20 10 18
DNA Artificial sequence Synthetic oligonucleotide 10 ggaatgacgt
tccctgtg 18 11 20 DNA Artificial sequence Synthetic oligonucleotide
11 gcttgatgac tcagccggaa 20 12 20 DNA Artificial sequence Synthetic
oligonucleotide 12 tcgatcgggg cggggcgagc 20 13 20 DNA Artificial
sequence Synthetic oligonucleotide 13 tgcagattgc gcaatctgca 20 14
20 DNA Artificial sequence Synthetic oligonucleotide 14 agcgggggcg
agcgggggcg 20 15 24 DNA Artificial sequence Synthetic
oligonucleotide 15 tactttcagt ttcatattac tcta 24 16 20 DNA
Artificial sequence Synthetic oligonucleotide 16 gtccatttcc
cgtaaatctt 20 17 20 DNA Artificial sequence Synthetic
oligonucleotide 17 tatgcatatt cctgtaagtg 20 18 20 DNA Artificial
sequence Synthetic oligonucleotide 18 gatccttctg ggaattccta 20 19
20 DNA Artificial sequence Synthetic oligonucleotide 19 ctgatttccc
cgaaatgatg 20 20 20 DNA Artificial sequence Synthetic
oligonucleotide 20 agatttctag gaattcaatc 20 21 20 DNA Artificial
sequence Synthetic oligonucleotide 21 gtatttccca gaaaaggaac 20 22
20 DNA Artificial sequence Synthetic oligonucleotide 22 aagcgaaaat
gaaattgact 20 23 20 DNA Artificial sequence Synthetic
oligonucleotide 23 caggcataac ggttccgtag 20 24 20 DNA Artificial
sequence Synthetic oligonucleotide 24 atatagggga aatttccagc 20 25
20 DNA Artificial sequence Synthetic oligonucleotide 25 caaaaaaatt
tccagtcctt 20 26 20 DNA Artificial sequence Synthetic
oligonucleotide 26 atgttttcct gcgttgccag 20 27 26 DNA Artificial
sequence Synthetic oligonucleotide 27 ctctgacgtc aggggaaatt tccagc
26
* * * * *