U.S. patent application number 11/071836 was filed with the patent office on 2005-08-18 for immunostimulatory nucleic acid molecules.
This patent application is currently assigned to The University of Iowa Research Foundation. Invention is credited to Krieg, Arthur M..
Application Number | 20050182017 11/071836 |
Document ID | / |
Family ID | 42104324 |
Filed Date | 2005-08-18 |
United States Patent
Application |
20050182017 |
Kind Code |
A1 |
Krieg, Arthur M. |
August 18, 2005 |
Immunostimulatory nucleic acid molecules
Abstract
Nucleic acid sequences containing unmethylated CpG dinucleotides
that modulate an immune response including stimulating a Th1
pattern of immune activation, cytokine production, NK lytic
activity, and B cell proliferation are disclosed. The sequences are
also useful as a synthetic adjuvant.
Inventors: |
Krieg, Arthur M.;
(Wellesley, MA) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2211
US
|
Assignee: |
The University of Iowa Research
Foundation
Iowa City
IA
|
Family ID: |
42104324 |
Appl. No.: |
11/071836 |
Filed: |
March 3, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11071836 |
Mar 3, 2005 |
|
|
|
10619279 |
Jul 14, 2003 |
|
|
|
10619279 |
Jul 14, 2003 |
|
|
|
09337893 |
Jun 21, 1999 |
|
|
|
09337893 |
Jun 21, 1999 |
|
|
|
08960774 |
Oct 30, 1997 |
|
|
|
6239116 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.5 |
Current CPC
Class: |
A61P 37/02 20180101;
C12N 2310/315 20130101; A61K 31/00 20130101; A61P 31/12 20180101;
A61K 31/7125 20130101; A61K 39/39 20130101; A61P 19/02 20180101;
A61P 1/00 20180101; A61P 11/06 20180101; A61P 17/06 20180101; A61P
31/00 20180101; A61P 35/00 20180101; A61P 31/04 20180101; C07H
21/00 20130101; C12N 2310/17 20130101; C12Q 1/68 20130101; A61P
37/06 20180101; A61K 31/7048 20130101; A61K 31/4706 20130101; A61P
37/08 20180101; A61K 2039/55561 20130101; A61P 43/00 20180101; A61P
37/04 20180101; A61P 33/00 20180101; A61P 1/04 20180101; C12N
15/117 20130101; A61K 39/00 20130101; A61P 1/02 20180101; A61K
31/711 20130101; C07H 21/04 20130101 |
Class at
Publication: |
514/044 ;
536/023.5 |
International
Class: |
A61K 048/00; C07H
021/04 |
Goverment Interests
[0002] The work resulting in this invention was supported in part
by National Institute of Health Grant No. R29-AR42556-01. The U.S.
Government may have rights in the invention.
Claims
We claim:
1-41. (canceled)
42. An oligonucleotide comprising TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID
No. 46).
43. The oligonucleotide of claim 42, wherein at least one
nucleotide has a phosphate backbone modification.
44. The oligonucleotide of claim 42, wherein the oligonucleotide
has less than or equal to 100 nucleotides.
45. The oligonucleotide of claim 42, wherein the oligonucleotide
has a sequence consisting of TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No.
46).
46. The oligonucleotide of claim 43, wherein the phosphate backbone
modification is a phosphorothioate or phosphorodithioate
modification.
47. A method for stimulating an immune response, comprising
administering to a subject the oligonucleotide of claim 42 in an
effective amount to stimulate an immune response.
48. The method of claim 47, wherein the subject has or is at risk
of developing cancer.
49. The method of claim 47, wherein the subject has or is at risk
of developing infectious disease.
50. A method for stimulating an immune response, comprising
administering to a subject the oligonucleotide of claim 45 in an
effective amount to stimulate an immune response.
51. The method of claim 50, wherein the subject has or is at risk
of developing cancer.
52. The method of claim 50, wherein the subject has or is at risk
of developing infectious disease.
Description
RELATED APPLICATION
[0001] This application is a continuation of co-pending U.S. patent
application Ser. No. 10/619,279 filed on Jul. 14, 2003 and now
pending, which is a continuation of U.S. patent application Ser.
No. 09/337,893, filed Jun. 21, 1999, which is a divisional of U.S.
patent application Ser. No. 08/960,774, filed Oct. 30, 1997, now
issued as U.S. Pat. No. 6,239,116, each of which are incorporated
herein by reference in their entirety.
FIELD OF THE INVENTION
[0003] The present invention relates generally to oligonucleotides
and more specifically to oligonucleotides which have a sequence
including at least one unmethylated CpG dinucleotide which are
immunostimulatory.
BACKGROUND OF THE INVENTION
[0004] In the 1970s, several investigators reported the binding of
high molecular weight DNA to cell membranes (Lerner, R. A., et al.
1971. "Membrane-associated DNA in the cytoplasm of diploid human
lymphocytes." Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K.,
R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975.
"Cell-surface-associated nucleic acid in tumorigenic cells made
visible with platinum-pyrimidine complexes by electron microscopy."
Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al.
presented the first evidence that DNA binding to lymphocytes is
similar to a ligand receptor interaction: binding is saturable,
competitive, and leads to DNA endocytosis and degradation into
oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt,
1985. "J. Clin. Invest. 76:2182). Like DNA,
oligodeoxyribonucleotides (ODNS) are able to enter cells in a
saturable, sequence independent, and temperature and energy
dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen.
1991. "Cellular uptake of antisense oligodeoxynucleotides."
Advanced Drug Deliver Reviews 6:235; Akhtar, S., Y. Shoji, and R.
L. Juliano. 1992. "Pharmaceutical aspects of the biological
stability and membrane transport characteristics of antisense
oligonucleotides." In: Gene Regulation: Biology of Antisense RNA
and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd.
New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J.
Herrera, and A. M. Krieg. 1994. "Stage specific oligonucleotide
uptake in murine bone marrow B cell precursors." Blood 84:3660). No
receptor for DNA or ODN uptake has yet been cloned, and it is not
yet clear whether ODN binding and cell uptake occurs through the
same or a different mechanism from that of high molecular weight
DNA.
[0005] Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen LPS had
dramatically enhanced ODN uptake in the B cell population, while
spleen cells treated with the T cell mitogen Con A showed enhanced
ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling,
M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg.
1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is
heterogeneous and inducible." Antisense Research and Development
1:161).
[0006] Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly
(I,C) which is a potent inducer of IFN production as well as
macrophage activator and inducer of NK activity (Talmadge, J. E.,
J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E.
Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985.
"Immunomodulatory effects in mice of polyinosinic-polycytidylic
acid complexed with poly-L-lysine and carboxymethylcellulose."
Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley,
and J. E. Talmadge. 1985. "Immunomodulation of natural killer
activity by polyribonucleotides." J. Biol. Respn. Mod. 4:512;
Krown, S. E. 1986. "Interferons and interferon inducers in cancer
treatment." Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C.
Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J.
Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt,
and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid
complexed with poly-L-lysine and carboxymethylcellulose in
combination with interleukin-2 in patients with cancer: clinical
and immunological effects." Canc. Res. 52:3005). It appears that
this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN
inducation and associated changes in splenic leukocyte
distribution". J. Immunol. 150:3713). This activation was specific
for the robose sugar since deoxyribose was ineffective. Its potent
in vitro antitumor activity led to several clinical trials using
poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose
(to reduce degradation by RNAse) Talmadge, J. E., et al., 1985.
cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S.
E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited
supra). Unfortunately, toxic side effects have thus far prevented
poly (I,C) from becoming a useful therapeutic agent.
[0007] Guanine ribonucleotides substituted at the C8 position with
either a bromine or a thiol group are B cell mitogens and may
replace "B cell differentiation factors" (Feldbush, T. L., and Z.
K., Ballas. 1985. "Lymphokine-like activity of 8-mercaptoguanosine:
induction of T and B cell differentiation." J. Immunol. 134:3204;
and Goodman, M. G. 1986. "Mechanism of synergy between T cell
signals and C8-substituted guanine nucleosides in humoral immunity:
B lymphotropic cytokines induce responsiveness to
8-mercaptoguanosine." J. Immunol. 136:3335). 8-mercaptoguanosine
and 8-bromoguanosine also can substitute for the cytokine
requirement for the generation of MHC restricted CTL (Feldbush, T.
L., 1985. cited supra), augment murine NK activity (Koo, G. C., M.
E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988.
"Activation of murine natural killer cells and macrophages by
8-bromoguanosine." J. Immunol. 140:3249), and synergize with IL-2
in inducing murine LAK generation (Thompson, R. A., and Z. K.
Ballas. 1990. "Lymphokine-activated killer (LAK) cells. V.
8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation." J.
Immunol. 145:3524). The NK and LAK augmenting activities of these
C8-substituted guanosines appear to be due to their induction of
IFN (Thompson, R. A., et al. 1990. cited supra0. Recently, a 5'
triphosphorylated thymidine produced by a mycobacterium was found
to be mitogenic for a subset of human .gamma..delta. T cells
(Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M.
Bonneville, and J.-J. Foumie. 1994. "Stimulation of human
.gamma..delta. T cells by nonpeptidic mycobacterial ligands."
Science 264:267). This report indicated the possibility that the
immune system may have evolved ways to preferentially respond to
microbial nucleic acids.
[0008] Several observations suggest that certain DNA structures may
also have the potential to activate lymphocytes. For example, Bell
et al. reported that nucleosomal protein-DNA complexes (but not
naked DNA) in spleen cell supernatants caused B cell proliferation
and immunoglobulin secretion (Bell, D. A., B. Morrison, and P.
VandenBygaart. 1990. "Immunogenic DNA-related factors." J. Clin.
Invest. 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina et al. have recently
reported that 260 to 800 bp fragments of poly (dG).multidot.(dC)
and poly (dG.multidot.dC) were mitogenic for B cells (Messina, J.
P., G. S. Gilkeson, and D. S. Piesetsky. 1993. "The influence of
DNA structure on the in vitro stimulation of murine lymphocytes by
natural and synthetic polynucleotide antigens." Cell. Immunol.
147:148). Tokunaga, et al. have reported that dG.dC induces
.gamma.-IFN and NK activity (Tokunaga, S. Yamamoto, and K. Nama.
1988. "A synthetic single-stranded DNA, poly(dG, dC), induces
interferon-.alpha./.beta. and -.gamma., augments natural killer
activity, and suppresses tumor growth." Jpn. J. Cancer Res.
79:682). Aside from such artificial homopolymer sequences, Pisetsky
et al. reported that pure mammalian DNA has no detectable immune
effects, but that DNA from certain bacteria induces B cell
activation and immunoglobulin secretion (Messina, J. P., G. S.
Gilkeson, and D. S. Pisetsky. 1991. "Stimulation of in vitro murine
lymphocyte proliferation by bacterial DNA." J. Immunol. 147:1759).
Assuming that these data did not result from some unusual
contaminant, these studies suggested that a particular structure or
other characteristic of bacterial DNA renders it capable of
triggering B cell activation. Investigations of mycobacterial DNA
sequences have demonstrated that ODN which contain certain
palindrome sequences can activate NK cells (Yamamoto, S., T.
Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992.
"Unique palindromic sequences in synthetic oligonucleotides are
required to induce INF and augment INF-mediated natural killer
activity." J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura,
M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T.
Tokunaga. 1992. "Oligonucleotide sequences required for natural
killer cell activation." Jpn. J. Cancer Res. 83:1128).
[0009] Several phosphorothioate modified ODN have been reported to
induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C.
Chu, and W. E. Paul. 1992. "An antisense oligonucleotide
complementary to a sequence in I.gamma.2b increases .gamma.2b
germline transcripts, stimulates B cell DNA synthesis, and inhibits
immunoglobulin secretion." J. Exp. Med. 175:597; McIntyre, K. W.,
K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D.
Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense
phosphorothioate oligonucleotide directed to the initiation codon
of transcription factor NF-.kappa.B T65 causes sequence-specific
immune stimulation." Antisense Res. Develop. 3:309; and Pisetsky,
D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte
proliferation by a phosphorothioate oligonucleotide with antisense
activity for herpes simplex virus." Life Sciences 54:101). These
reports do not suggest a common structural motif or sequence
element in these ODN that might explain their effects.
[0010] The cAMP response element binding protein (CREB) and
activating transcription factor (ATF) or CREB/ATF family of
transcription factors is a ubiquitously expressed class of
transcription factors of which 11 members have so far been cloned
(reviewed on de Groot, R. P., and P. Sassone-Corsi: "Hormonal
control of gene expression: Multiplicity and versatility of cyclic
adenosine 3',5'-monophosphate-responsive nuclear regulators." Mol.
Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson:
"Transcriptional regulation by CREB and its relatives." Biochim.
Biophys. Acta 1174:221, 1993). They all belong to the basic
region/leucine zipper (bZip) class of proteins. All cells appear to
express one or more CREB/ATF proteins, but the members expressed
and the regulation of mRNA splicing appear to be tissue-specific.
Differential splicing of activation domains can determine whether a
particular CREB/ATF protein will be a transcriptional inhibitor or
activator. Many CREB/ATF proteins activate viral transcription, but
some splicing variants which lack the activation domain are
inhibitory. CREB/ATF proteins can bind DNA as homo- or
hetero-dimers through the cAMP response element, the CRE, the
consensus form of which is the unmethylated sequence TGACGTC (SEQ.
ID. No. 103) (binding is abolished if the CpG is methylated)
(Iguchi-Ariga, S. M. M., and W. Schaffner: "CpG methylation of the
cAMP-responsive enhancer/promoter sequence TGACGTCA (SEQ. ID.
No.104) abolishes specific factor binding as well as
transcriptional activation." Genese & Develop. 3:612, 1989.
[0011] The transcriptional activity of the CRE is increased during
B cell activation (Xie. H., T. C. Chiles, and T. L. Rothstein:
"Induction of CREB activity via the surface Ig receptor of B
cells." J. Immunol. 151:880, 1993). CREB/ATF proteins appear to
regulate the expression of multiple genes through the CRE including
immunologically important genes such as fos, jun B, Rb-1, IL-6,
IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E.
Auron: "Transcription factors NF-IL6 and CREB recognize a common
essential site in the human prointerleukin 1.beta. gene." Mol.
Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel,
M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA
inhibition of tumor growth induced by c-Ha-ras oncogene in nude
mice." Cancer Res. 53:577, 1993), IFN-- (Du, W., and T. Maniatis:
"An ATF/CREB binding site protein is required for virus induction
of the human interferon .beta. gene." Proc. Natl. Acad. Sci. USA
89:2150, 1992), TGF-1 (Asiedu, C. K., L. Scott, R. K. Assoian, M.
Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to contiguous
sites downstream of the human TGF-.beta.1 gene." Biochim. Biophys.
Acta 1219:55, 1994), TGF-2, class II MHC (Cox, P. M., and C. R.
Goding: "An ATF/CREB binding motif is required for aberrant
constitutive expression of the MHC class II DR.alpha. promoter and
activation by SV40 T-antigen." Nucl. Acids Res. 20:4881, 1992),
E-selectin, GM-CSF, CD-8, the germline Ig constant region gene, the
TCR V gene, and the proliferating cell nuclear antigen (Huang, D.,
P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B.
Prystowsky: "Promoter activity of the proliferating-cell nuclear
antigen gene is associated with inducible CRE-binding proteins in
interleukin 2-stimulated T lymphocytes." Mol. Cell. Biol. 14:4233,
1994). In addition to activation through the cAMP pathway, CREB can
also mediate transcriptional responses to changes in intracellular
Ca.sup.++ concentration (Sheng, M., G. McFadden, and M. E.
Greenberg: "Membrane depolarization and calcium induce c-fos
transcription via phosphorylation of transcription factor CREB."
Neuron 4:571, 1990).
[0012] The role of protein-protein interactions in transcriptional
activation by CREB/ATF proteins appears to be extremely important.
There are several published studies reporting direct or indirect
interactions between NFKB proteins and CREB/ATF proteins (Whitley,
et al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al.,
(1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189;
and Du, et al., (1993) Cell 74:887. Activation of CREB through the
cyclic AMP pathway requires protein kinase A (PKA), which
phosphorylates CREB.sup.341 on ser.sup.133 and allows it to bind to
a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J.
C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G.
E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear protein CBP is
a coactivator for the transcription factor CREB." Nature 370:223,
1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea,
M. Karin, J. Feramisco, and M. Montminy: "Activation of cAMP and
mitogen responsive genes relies on a common nuclear factor." Nature
370:226, 1994). CBP in turn interacts with the basal transcription
factor TFIIB causing increased transcription. CREB also has been
reported to interact with dTAFII 110, a TATA binding
protein-associated factor whose binding may regulate transcription
(Ferreri, K., G. Gill, and M. Montminy: "The cAMP-regulated
transcription factor CREB interacts with a component of the TFIID
complex." Proc. Natl. Acad. Sci. USA 91:1210, 1994). In addition to
these interactions, CREB/ATF proteins can specifically bind
multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbadfer,
and C.-Y. Chen: "Identification of multiple nuclear factors that
interact with cyclic adenosine 3',5'-monophosphate response
element-binding protein and activating transcription factor-2 by
protein-protein interactions." Mol. Endocrinol. 5:256, 1991) but
the biologic significance of most of these interactions is unknown.
CREB is normally thought to bind DNA either as a homodimer or as a
heterodimer with several other proteins. Surprisingly, CREB
monomers constitutively activate transcription (Krajewski, W., and
K. A. W. Lee: "A monomeric derivative of the cellular transcription
factor CREB functions as a constitutive activator." Mol. Cell.
Biol. 14:7204, 1994).
[0013] Aside from their critical role in regulating cellular
transcription, it has recently been shown that CREB/ATF proteins
are subverted by some infectious viruses and retroviruses, which
require them for viral replication. For example, the
cytomegalovirus immediate early promoter, one of the strongest
known mammalian promoters, contains eleven copies of the CRE which
are essential for promoter function (Chang, Y.-N., S. Crawford, J.
Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: "The
palindromic series I repeats in the simian cytomegalovirus major
immediate-early promoter behave as both strong basal enhancers and
cyclic AMP response elements." J. Virol. 64:264, 1990). At least
some of the transcriptional activating effects of the adenovirus
E1A protein, which induces many promoters, are due to its binding
to the DNA binding domain of the CREB/ATF protein, ATF-2, which
mediates E1A inducible transcription activation (Liu, F., and M. R.
Green: "Promoter targeting by adenovirus E1A through interaction
with different cellular DNA-binding domains." Nature 368:520,
1994). It has also been suggested that E1A binds to the
CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M.
Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated
CBP belong to a conserved family of coactivators." Cell 77:799,
1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which
causes human T cell leukemia and tropical spastic paresis, also
requires CREB/ATF proteins for replication. In this case, the
retrovirus produces a protein, Tax, which binds to CREB/ATF
proteins and redirects them from their normal cellular binding
sites to different DNA sequences (flanked by G- and G-rich
sequences) present within the HTLV transcriptional enhancer
(Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R.
Cullen, I. M. Boros, and C.-Z. Giam: "In vitro selection of DNA
elements highly responsive to the human T-cell lymphotropic virus
type I transcriptional activator, Tax." Mol. Cell. Biol. 14:456,
1994; Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giam:
"Expansion of CREB's DNA recognition specificity by Tax results
from interaction with Ala-Ala-Arg at positions 282-284 near the
conserved DNA-binding domain of CREB." Proc. Natl. Acad. Sci. USA
91:5642, 1994).
SUMMARY OF THE INVENTION
[0014] The present invention is based on the finding that certain
nucleic acids containing unmethylated cytosine-guanine (CpG)
dinucleotides activate lymphocytes in a subject and redirect a
subject's immune response from a Th2 to a Th1 (e.g., by inducing
monocytic cells and other cells to produce Th1 cytokines, including
IL-12, IFN-.gamma. and GM-CSF). Based on this finding, the
invention features, in one aspect, novel immunostimulatory nucleic
acid compositions.
[0015] In one embodiment, the invention provides an isolated
immunostimulatory nucleic acid sequence containing a CpG motif
represented by the formula:
5' N.sub.1X.sub.1CGX.sub.2N.sub.2 3'
[0016] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1 is adenine, guanine, or thymine; X.sub.2 is cytosine or
thymine; N is any nucleotide and N.sub.1+N.sub.2 is from about 0-26
bases with the proviso that N.sub.1 and N.sub.2 do not contain a
CCGG quadmer or more than one CCG or CGG trimer; and the nucleic
acid sequence is from about 8-30 bases in length.
[0017] In another embodiment, the invention provides an isolated
immunostimulatory nucleic acid sequence contains a CpG motif
represented by the formula:
5' N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2 3'
[0018] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1X.sub.2 is selected from the group consisting of GpT, GpG,
GpA, ApT and ApA; X.sub.3X.sub.4 is selected from the group
consisting of TpT or CpT; N is any nucleotide and N.sub.1+N.sub.2
is from about 0-26 bases with the proviso that N.sub.1 and N.sub.2
do not contain a CCGG quadmer or more than one CCG or CGG trimer;
and the nucleic acid sequence is from about 8-30 bases in
length.
[0019] In another embodiment, the invention provides a method of
stimulating immune activation by administering the nucleic acid
sequences of the invention to a subject, preferably a human. In a
preferred embodiment, the immune activation effects predominantly a
Th1 pattern of immune activation.
[0020] In another embodiment, the nucleic acid sequences of the
invention stimulate cytokine production. In particular, cytokines
such as IL-6, IL-12, IFN-.gamma., TNF-.alpha. and GM-CSF are
produced via stimulation of the immune system using the nucleic
acid sequences described herein. In another aspect, the nucleic
acid sequences of the invention stimulate the lytic activity of
natural killer cells (NK) and the proliferation of B cells.
[0021] In another embodiment, the nucleic acid sequences of the
invention are useful as an artificial adjuvant for use during
antibody generation in a mammal such as a mouse or a human.
[0022] In another embodiment, autoimmune disorders are treated by
inhibiting a subject's response to CpG mediated leukocyte
activation. The invention provides administration of inhibitors of
endosomal acidification such as bafilomycin a, chloroquine, and
monensin to ameliorate autoimmune disorders. In particular,
systemic lupus erythematosus is treated in this manner.
[0023] The nucleic acid sequences of the invention can also be used
to treat, prevent or ameliorate other disorders (e.g., a tumor or
cancer or a viral, fungal, bacterial or parasitic infection). In
addition, the nucleic acid sequences can be administered to
stimulate a subject's response to a vaccine. Furthermore, by
redirecting a subject's immune response from Th2 to Th1, the
claimed nucleic acid sequences can be used to treat or prevent an
asthmatic disorder. In addition, the claimed nucleic acid molecules
can be administered to a subject in conjunction with a particular
allergen as a type of desensitization therapy to treat or prevent
the occurrence of an allergic reaction associated with an asthmatic
disorder.
[0024] Further, the ability of the nucleic acid sequences of the
invention described herein to induce leukemic cells to enter the
cell cycle supports their use in treating leukemia by increasing
the sensitivity of chronic leukemia cells followed by conventional
ablative chemotherapy, or by combining the nucleic acid sequences
with other immunotherapies.
[0025] Other features and advantages of the invention will become
more apparent from the following detailed description and
claims.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1A-C are graphs plotting dose-dependent IL-6 production
in response to various DNA sequences in T cell depleted spleen cell
cultures.
[0027] Figure A 1. E. coli DNA (.circle-solid.) and calf thymus DNA
(.box-solid.) sequences and LPS (at 10.times. the concentration of
E. coli and calf thymus DNA) (.diamond-solid.).
[0028] FIG. 1B. Control phosphodiester oligodeoxynucleotide (ODN)
5' ATGGAAGGTCCAGTGTTCTC 3' (SEQ ID NO: 114) (.box-solid.) and two
phosphodiester CpG ODN 5' ATCGACCTACGTGCGTTCTC 3' (SEQ ID NO: 2)
(.diamond-solid.) and 5' TCCATAACGTTCCTGATGCT 3' (SEQ ID NO: 3)
(.circle-solid.).
[0029] FIG. 1C. Control phosphorothioate ODN 5' GCTAGATGTTAGCGT 3'
(SEQ ID NO: 4) (.box-solid.) and two phosphorothioate CpG ODN 5'
GAGAACGTCGACCTTCGAT 3' (SEQ ID NO: 5) (.diamond-solid.) and 5'
GCATGACGTTGAGCT 3' (SEQ ID NO: 6) (.circle-solid.). Data present
the mean.+-.standard deviation of triplicates.
[0030] FIG. 2 is a graph plotting IL-6 production induced by CpG
DNA in vivo as determined 1-8 hrs after injection. Data represent
the mean from duplicate analyses of sera from two mice. BALB/c mice
(two mice/group) were injected iv. with 100 .mu.l of PBS (O) of 200
.mu.g of CpG phosphorothioate ODN 5'TCCATGACGTTCCTGATGCT 3' (SEQ ID
NO: 7) (.box-solid.) or non-CpG phosphorothioate ODN 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8 (.diamond-solid.).
[0031] FIG. 3 is an autoradiograph showing IL-6 mRNA expression as
determined by reverse transcription polymerase chain reaction in
liver, spleen, and thymus at various time periods after in vivo
stimulation of BALB/c mice (two mice/group) injected iv with 100
.mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7) or non-CpG phosphorothioate
ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8).
[0032] FIG. 4A is a graph plotting dose-dependent inhibition of
CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2
mice were stimulated with CpG ODN 5' TCCAAGACGTTCCTGATGCT 3' (SEQ
ID NO: 9) in the presence of the indicated concentrations of
neutralizing anti-IL-6 (.diamond-solid.) or isotype control Ab
(.circle-solid.) and IgM levels in culture supernatants determined
by ELISA. In the absence of CpG ODN, the anti IL-6 Ab had no effect
on IgM secretion (.box-solid.).
[0033] FIG. 4B is a graph plotting the stimulation index of
CpG-induced splenic B cells cultured with anti-L-6 and CpG S-ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7) (.diamond-solid.) or
anti-IL-6 antibody only (.box-solid.). Data present the
mean.+-.standard deviation of triplicates.
[0034] FIG. 5 is a bar graph plotting chloramphenicol
acetyltransferase (CAT) activity in WEH1-231 cells transfected with
a promoter-less CAT construct (pCAT), positive control plasmid
(RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO: 7) or non-CpG 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO: 8) phosphorothioate ODN at the
indicated concentrations. Data present the mean of triplicates.
[0035] FIG. 6 is a schematic overview of the immune effects of the
immunostimulatory unmethylated CpG containing nucleic acids, which
can directly activate both B cells and monocytic cells (including
macrophages and dendritic cells) as shown. The immunostimulatory
oligonucleotides do not directly activate purified NK cells, but
render them competent to respond to L-12 with a marked increase in
their IFN-1 secretion by NK cells, the immunostimulatory nucleic
acids promote a Th1 type immune response. No direct activation of
proliferation of cytokine secretion by highly purified T cells has
been found. However, the induction of Th1 cytokine secretion by the
immunostimulatory oligonucleotides promotes the development of a
cytotoxic lymphocyte response.
[0036] FIG. 7 is an autoradiograph showing NFKB mRNA induction in
monocytes treated with E. coli (EC) DNA (containing unmethylated
CpG motifs), control (CT) DNA (containing no unmethylated CpG
motifs) and lipopolysaccharide (LPS) at various measured times, 15
and 30 minutes after contact.
[0037] FIG. 8A shows the results from a flow cytometry study using
mouse B cells with the dihydrorhodamine 123 dye to determine levels
of reactive oxygen species. The dye only sample in Panel A of the
figure shows the background level of cells positive for the dye at
28.6%. This level of reactive oxygen species was greatly increased
to 80% in the cells treated for 20 minutes with PMA and ionomycin,
a positive control (Panel B). The cells treated with the CpG oligo
(TCCATGACGTTCCTGACGTT SEQ ID NO: 10) also showed an increase in the
level of reactive oxygen species such that more than 50% of the
cells became positive (Panel D). However, cells treated with an
oligonucleotide that lacked a CpG motif (TCCATGAGCTTCCTGAGTCT SEQ
ID NO: 8) did not show this significant increase in the level of
reactive oxygen species (Panel E).
[0038] FIG. 8B shows the results from a flow cytometry study using
mouse B cells in the presence of chloroquine with the
dihydrorbodamine 123 dye to determine levels of reactive oxygen
species. Chloroquine slightly lowers the background level of
reactive oxygen species in the cells such that the untreated cells
in Panel A have only 4.3% that are positive. Chloroquine completely
abolishes the induction of reactive oxygen species in the cells
treated with CpG DNA (Panel B) but does not reduce the level of
reactive oxygen species in the cells treated with PMA and ionomycin
(Panel E).
[0039] FIG. 9 is a graph plotting lung lavage cell count over time.
The graph shows that when the mice are initially injected with
Schistosoma mansoni eggs "egg", which induces a Th2 immune
response, and subsequently inhale Schistosoma mansoni egg antigen
"SEA" (open circle), many inflammatory cells are present in the
lungs. However, when the mice are initially given CpG oligo (SEQ ID
NO: 10) along with egg, the inflammatory cells in the lung are not
increased by subsequent inhalation of SEA (open triangles).
[0040] FIG. 10 is a graph plotting lung lavage eosinophil count
over time. Again, the graph shows that when the mice are initially
injected with egg and subsequently inhale SEA (open circle), many
eosinophils are present in the lungs. However, when the mice are
initially given CpG oligo (SEQ ID NO: 10) along with egg, the
inflammatory cells in the lung are not increased by subsequent
inhalation of the SEA (open triangles).
[0041] FIG. 11 is a bar graph plotting the effect on the percentage
of macrophage, lymphocyte, neutrophil and eosinophil cells induced
by exposure to saline alone; egg, then SEA; egg and SEQ ID NO: 10,
then SEA; and egg and control oligo (SEQ ID NO: 8), then SEA. When
the mice are treated with the control oligo at the time of the
initial exposure to the egg, there is little effect on the
subsequent influx of eosinophils into the lungs after inhalation of
SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop
an acute inflammatory response in the lungs. However, giving a CpG
oligo along with the eggs at the time of initial antigen exposure
on days 0 and 7 almost completely abolishes the increase in
eosinophils when the mice inhale the egg antigen on day 14.
[0042] FIG. 12 is a bar graph plotting eosinophil count in response
to injection of various amounts of the protective oligo SEQ ID NO:
10.
[0043] FIG. 13 is a graph plotting interleukin 4 (IL-4) production
(pg/ml) in mice over time in response to injection of egg, then SEA
(open diamond); egg and SEQ ID NO: 10, then SEA (open circle); or
saline, then saline (open square). The graph shows that the
resultant inflammatory response correlates with the levels of the
Th2 cytokine IL-4 in the lung.
[0044] FIG. 14 is a bar graph plotting interleukin 12 (IL-12)
production (pg/ml) in mice over time in response to injection of
saline; egg, then SEA; or SEQ ID NO. 10 and egg, then SEA. The
graph shows that administration of an oligonucleotide containing an
unmethylated CpG motif can actually redirect the cytokine response
of the lung to production of IL-12, indicating a Th1 type of immune
response.
[0045] FIG. 15 is a bar graph plotting interferon gamma
(IFN-.gamma.) production (pg/ml) in mice over time in response to
injection of saline; egg, then saline; or SEQ ID NO: 10 and egg,
then SEA. The graph shows that administration of an oligonucleotide
containing an unmethylated CpG motif can also redirect the cytokine
response of the lung to production of IFN-.gamma., indicating a Th1
type of immune response.
DETAILED DESCRIPTION OF THE INVENTION
[0046] Definitions
[0047] As used herein, the following terms and phrases shall have
the meanings set forth below:
[0048] An "allergen" refers to a substance that can induce an
allergic asthmatic response in a susceptible subject. The list of
allergens is enormous and can include pollens, insect venoms,
animal dander dust, fungal spores and drugs (e.g., penicillin).
Examples of natural, animal and plant allergens include proteins
specific to the following genuses: Canine (Canis familiaris);
Dermatophagoides (e.g., Dermatophagoides farinae); Felis (Felis
domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium
perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica);
Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa);
Betula (Betula verrucosa); Quercus (quercus alba); Olea (Olea
europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago
lanceolata); Parietaria (e.g., Parietaria officinalis or Parietaria
judaica); Blattella (e.g., Blattella germanica); Apis (e.g., Apis
multiflorum); Cupressus (e.g., Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g., Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g., Thuya orientalis), Chamaecyparis (e.g.,
Chamaecyparis obtusa); Periplaneta (e.g., Periplaneta americana);
Agropyron (e.g., Agropyron repens); Secale (e.g., Secale cereale);
Triticum (e.g., Triticum aestivum); Dactylis (e.g., Dactylis
glomerata); Festuca (e.g., Festuca elatior); Poa (e.g.,
Poapratensis or Poa compressa); Avena (e.g., Avena sativa); Holcus
(e.g., Holcus lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum);
Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis (e.g.,
Agrostis alba); Phleum (e.g., Phleum pratense); Phalaris (e.g.,
Phalaris arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum
(e.g., Sorghum halepensis) and Bromus (e.g., Bromus inermis).
[0049] An "allergy" refers to acquired hypersensitivity to a
substance (allergen). Allergic conditions include eczema, allergic
rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives)
and food allergies, and other atopic conditions.
[0050] "Asthma" refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
[0051] An "immune system deficiency" shall mean a disease or
disorder in which the subject's immune system is not functioning in
normal capacity or in which it would be useful to boost a subject's
immune response for example to eliminate a tumor or cancer (e.g.,
tumors of the brain, lung (e.g., small cell and non-small cells),
ovary, breast, prostate, colon, as well as other carcinomas and
sarcomas) or an infection in a subject.
[0052] Examples of infectious virus include: Retroviridae (e.g.,
human immunodeficiency viruses, such as HIV-1, also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g., strains that cause gastroenteritis);
Togaviridae (e.g., equine encephalitis viruses, rubella viruses);
Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow
fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae
(e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae
(e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses);
Arena viridae (hemorrhagic fever virus); Reoviridae (e.g.,
reoviruses, orbiviruses and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herperviridae (herpes simplex virus (HSV) 1
and 2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxyiridae (variola virsues, vaccinia viruses, pox
viruses); and Iridoviridae (e.g., African swine fever virus); and
unclassified viruses (e.g., the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitides (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1-internally transmitted; class
2-parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0053] Examples of infectious bacteria include: Helicobacter
pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria
sps (e.g., M. tuberculosis, M. avium, M. Intracellulare, M.
kansaii, M. gordonae), Staphylococcus aureus, Neisseria
gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes,
Streptococcus pyogenes (Group A Streptococcus), Streptococcus
agalactiae (Group B Streptococcus), Streptococcus (viridans group),
Streptococcus faecalis, Streptococcus bovis, Streptococcus
(anaerobic sps.), Streptococcus pneumoniae, pathogenic
Campylobacter sp., Enterococcus sp., Haemophilus influenzae,
Bacillus antracis, corynebacterium diphtheriae, corynebacterium
sp., Erysipelothrix rhusiopathiae, Clostridium perfringers,
Clostridium tetani, Enterobacter erogenes, Klebsiella pneuomiae,
Pasturella multicoda, Bacteroides sp., Fusobacterium nucleatum,
Sreptobacillus moniliformis, Treponema pallidium, Treponema
pertenue, Leptospira, and Actinomeyces israelli.
[0054] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
falciparum and Toxoplasma gondii.
[0055] An "immunostimulatory nucleic acid molecule" refers to a
nucleic acid molecule, which contains an unmethylated cytosine,
guanine dinucleotide sequence (i.e., "CpG DNA" or DNA containing a
cytosine followed by guanosine and linked by a phosphate bond) and
stimulates (e.g., has a motogenic effect on, or induces or
increases cytokine expression by) a vertebrate lymphocyte. An
immunostimulatory nucleic acid molecule can be double-stranded or
single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity.
[0056] In one preferred embodiment, the invention provides an
isolated immunostimulatory nucleic acid sequence containing a CpG
motif represented by the formula:
5' N.sub.1X.sub.1CGX.sub.2N.sub.2 3'
[0057] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1 is adenine, guanine, or thymine; X.sub.2 is cytosine or
thymine; N is any nucleotide and N.sub.1+N.sub.2 is from about 0-26
bases with the proviso that N.sub.1 and N.sub.2 do not contain a
CCGG quadmer or more than one CCG or CGG trimer; and the nucleic
acid sequence is from about 8-30 bases in length.
[0058] In another embodiment the invention provides an isolated
immunostimulatory nucleic acid sequence contains a CpG motif
represented by the formula:
5' N.sub.1X.sub.1X.sub.2CGX.sub.3X.sub.4N.sub.2 3'
[0059] wherein at least one nucleotide separates consecutive CpGs;
X.sub.1X.sub.2 is selected from the group consisting of GpT, GpG,
GpA, ApT and ApA; X.sub.3.times.4 is selected from the group
consisting of TpT or CpT; N is any nucleotide and N.sub.1+N.sub.2
is from about 0-26 bases with the proviso that N.sub.1 and N.sub.2
do not contain a CCGG quadmer or more than one CCG or CGG trimer;
and the nucleic acid sequence is from about 8-30 bases in
length.
[0060] Preferably, the immunostimulatory nucleic acid sequences of
the invention include X.sub.1X.sub.2 selected from the group
consisting of GpT, GpG, GpA and ApA and X.sub.3X.sub.4 is selected
from the group consisting of TpT, CpT and GpT (see for example,
Table 5). For facilitating uptake into cells, CpG containing
immunostimulatory nucleic acid molecules are preferably in the
range of 8 to 30 bases in length. However, nucleic acids of any
size (even many kb long) are immunostimulatory if sufficient
immunostimulatory motifs are present, since such larger nucleic
acids are degraded into oligonucleotides inside of cells. Preferred
synthetic oligonucleotides do not include a CGG quadmer or more
than one CCG or CGG trimer at or near the 5' and/or 3' terminals
and/or the consensus mitogenic CpG motif is not a palindrome.
Prolonged immunostimulation can be obtained using stabilized
oligonucleotides, where the oligonucleotide incorporates a
phosphate backbone modification. For example, the modification is a
phosphorothioate or phosphorodithioate modification. More
particularly, the phosphate backbone modification occurs at the 5'
end of the nucleic acid for example, at the first two nucleotides
of the 5' end of the nucleic acid. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid.
[0061] Preferably the immunostimulatory CpG DNA is in the range of
between 8 to 30 bases in size when it is an oligonucleotide.
Alternatively, CpG dinucleotides can be produced on a large scale
in plasmids, which after being administered to a subject are
degraded into oligonucleotides. Preferred immunostimulatory nucleic
acid molecules (e.g., for use in increasing the effectiveness of a
vaccine or to treat an immune system deficiency by stimulating an
antibody (i.e., humoral) response in a subject) have a relatively
high stimulation index with regard to B cell, monocyte and/or
natural killer cell responses (e.g., cytokine, proliferative, lytic
or other responses).
[0062] The nucleic acid sequences of the invention stimulate
cytokine production in a subject for example. Cytokines include but
are not limited to IL-6, IL-12, IFN-.gamma., TNF-.alpha. and
GM-CSF. Exemplary sequences include: TCCATGTCGCTCCTGATGCT (SEQ ID
NO: 37), TCCATGTCGTTCCTGATGCT (SEQ ID NO: 38), and
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 46).
[0063] The nucleic acid sequences of the invention are also useful
for stimulating natural killer cell (NK) lytic activity in a
subject such as a human. Specific, but non-limiting examples of
such sequences include: TCGTCGTTGTCGTTGTCGTT (SEQ ID NO: 47),
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 46), TCGTCGTTGTCGTTTTGTCGTT
(SEQ ID NO: 49), GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO: 56),
TGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 48), TGTCGTTGTCGTTGTCGTT (SEQ ID
NO: 50) and TCGTCGTCGTCGTT (SEQ ID NO: 51).
[0064] The nucleic acid sequences of the invention are useful for
stimulating B cell proliferation in a subject such as a human.
Specific, but non-limiting examples of such sequences include:
TCCTGTCGTTCCTTGTCGTT (SEQ ID NO: 52), TCCTGTCGTTTTTTGTCGTT (SEQ ID
NO: 53), TCGTCGCTGTCTGCCCTTCTT (SEQ ID NO: 54),
TCGTCGCTGTTGTCGTTTCTT (SEQ ID NO: 55), TCGTCGTTTTGTCGTTTTGTCGTT
(SEQ ID NO: 46), TCGTCGTTGTCGTTTTTGTCGTT (SEQ ID NO: 49) and
TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 50).
[0065] In another aspect, the nucleic acid sequences of the
invention are useful as an adjuvant for use during antibody
production in a mammal. Specific, but non-limiting examples of such
sequences include: TCCATGACGTTCCTGACGTT (SEQ ID NO: 10), GTCGTT
(SEQ. ID. NO: 57), GTCGCT (SEQ. ID. NO. 58), TGTCGCT (SEQ. ID. NO:
101) and TGTCGTT (SEQ. ID. NO: 102). Furthermore, the claimed
nucleic acid sequences can be administered to treat or prevent the
symptoms of an asthmatic disorder by redirecting a subject's immune
response from Th2 to Th1. An exemplary sequence includes
TCCATGACGTTCCTGACGTT (SEQ ID NO: 10).
[0066] The stimulation index of a particular immunostimulatory CpG
DNA can be tested in various immune cell assays. Preferably, the
stimulation index of the immunostimulatory CpG DNA with regard to
B-cell proliferation is at least about 5, preferably at least about
10, more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with a 20 .mu.M of
ODN for 20 h at 37.degree. C. and has peen pulsed with 1 .mu.Ci of
.sup.3H uridine; and harvested and counted 4 h later as described
in detail in Example 1. For use in vivo, for example to treat an
immune system deficiency by stimulating a cell-mediated (local)
immune response in a subject, it is important that the
immunostimulatory CpG DNA be capable of effectively inducing
cytokine secretion by monocytic cells and/or Natural Killer (NK)
cell lytic activity.
[0067] Preferred immunostimulatory CpG nucleic acids should effect
at least about 500 pg/ml of TNF-.alpha., 15 pg/ml IFN-.gamma., 70
pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on
the therapeutic indication, as determined by the assays described
in Example 12. Other preferred immunostimulatory CpG DNAs should
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30, more preferably at least about 35 and most
preferably at least about 40% 2C11 cell specific lysis as
determined by the assay described in detail in Example 4.
[0068] A "nucleic acid" or "DNA" means multiple nucleotides (i.e.,
molecules comprising a sugar (e.g., ribose or deoxyribose) linked
to a phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g., adenine (A) or guanine
(G)). As used herein, the term refers to ribonucleotides as well as
oligodeoxyribonucleotides. The term shall also include
polynucleotides (i.e., a polynucleotide minus the phosphate) and
any other organic base containing polymer. Nucleic acid molecules
can be obtained from existing nucleic acid sources (e.g., genomic
or cDNA), but are preferably synthetic (e.g., produced by
oligonucleotide synthesis).
[0069] A "nucleic acid delivery complex" shall mean a nucleic acid
molecule associated with (e.g., ionically or covalently bound to;
or encapsulated within) a targeting means (e.g., a molecule that
results in higher affinity binding to target cell (e.g., B-cell and
natural killer (NK) cell) surfaces and/or increased cellular uptake
by target cells). Examples of nucleic acid delivery complexes
include nucleic acids associated with: a sterol (e.g., a ligand
recognized by target cell specific receptor). Preferred complexes
must be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex should be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
[0070] "Palindromic sequences" shall mean an inverted repeat (i.e.,
a sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double stranded structures.
[0071] A "stabilized nucleic acid molecule" shall mean a nucleic
acid molecule that is relatively resistant to in vivo degradation
(e.g., via an exo- or endo-nuclease). Stabilization can be a
function of length or secondary structure. Unmethylated CpG
containing nucleic acid molecules that are tens to hundreds of kbs
long are relatively resistant to in vivo degradation. For shorter
immunostimulatory nucleic acid molecules, secondary structure can
stabilize and increase their effect. For example, if the 3' end of
a nucleic acid molecule has self-complementarily to an upstream
region, so that it can fold back and form a sort of stem loop
structure, then the nucleic acid molecule becomes stabilized and
therefore exhibits more activity.
[0072] Preferred stabilized nucleic acid molecules of the instant
invention have a modified backbone. For use in immune stimulation,
especially preferred stabilized nucleic acid molecules are
phosphorothioate (i.e., at least one of the phosphate oxygens of
the nucleic acid molecules is replaced by sulfur) or
phosphorodithioate modified nucleic acid molecules. More
particularly, the phosphate backbone modification occurs at the 5'
end of the nucleic acid for example, at the first two nucleotides
of the 5' end of the nucleic acid. Further, the phosphate backbone
modification may occur at the 3' end of the nucleic acid for
example, at the last five nucleotides of the 3' end of the nucleic
acid. In addition to stabilizing nucleic acid molecules, as
reported further herein, phosphorothioate-modified nucleic acid
molecules (including phosphorodithioate-modified) can increase the
extent of immune stimulation of the nucleic acid molecule, which
contains an unmethylated CpG dinucleotide as shown herein.
International Patent Application Publication Number WO 95/26204
entitled "Immune Stimulation By Phosphorothioate Oligonucleotide
Analogs" also reports on the non-sequence specific
immunostimulatory effect of phosphorothioate modified
oligonucleotides. As reported herein, unmethylated CpG containing
nucleic acid molecules having a phosphorothioate backbone have been
found to preferentially activate B-cell activity, while
unmethylated CpG containing nucleic acid molecules having a
phosphodiester backbone have been found to preferentially activate
monocytic (macrophages, dendritic cells and monocytes) and NK
cells. Phosphorothioate CpG oligonucleotides with preferred human
motifs are also strong activators of monocytic and NK cells.
[0073] Other stabilized nucleic acid molecules include: nonionic
DNA analogs, such as alkyl- and aryl-phosphonates (in which the
charged phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acid molecules which contain a
diol, such as tetraethylenglycol or hexaethyleneglycol, at either
or both termini have also been shown to be substantially resistant
to nuclease degradation.
[0074] A "subject" shall mean a human or vertebrate animal
including a dog, cat, horse, cow, pig, sheep, goat, chicken,
monkey, rat, and mouse.
[0075] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. Preferred vectors are those capable of autonomous
replication and expression of nucleic acids to which they are
linked (e.g., an episome). Vectors capable of directing the
expression of genes to which they are operatively linked are
referred to herein as "expression vectors." In general, expression
vectors of utility in recombinant DNA techniques are often in the
form of "plasmids" which refer generally to circular double
stranded DNA loops which, in their vector form, are not bound to
the chromosome. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
[0076] Certain Unmethylated CpG Containing Nucleic Acids Have B
Cell Stimulatory Activity as Shown In Vitro and In Vivo
[0077] In the course of investigating the lymphocyte stimulatory
effects of two antisense oligonucleotides specific for endogenous
retroviral sequences, using protocols described in the attached
Examples 1 and 2, it was surprisingly found that two out of
twenty-four "controls" (including various scrambled, sense, and
mismatch controls for a panel of "antisense" ODN) also mediated B
cell activation and IgM secretion, while the other "controls" had
no effect.
[0078] Two observations suggested that the mechanism of this B cell
activation by the "control" ODN may not involve antisense effects
1) comparison of vertebrate DNA sequences listed in GenBank showed
no greater homology than that seen with non-stimulatory ODN and 2)
the two controls showed no hybridization to Northern blots with 10
.mu.g of spleen poly A+RNA. Resynthesis of these ODN on a different
synthesizer or extensive purification by polyacrylamide gel
electrophoresis or high pressure liquid chromatography gave
identical stimulation, eliminating the possibility of an impurity.
Similar stimulation was seen using B cells from C3H/HeJ mice,
eliminating the possibility that lipopolysaccharide (LPS)
contamination could account for the results.
[0079] The fact that two "control" ODN caused B cell activation
similar to that of the two "antisense" ODN raised the possibility
that all four ODN were stimulating B cells through some
non-antisense mechanism involving a sequence motif that was absent
in all of the other nonstimulatory control ODN. In comparing these
sequences, it was discovered that all of the four stimulatory ODN
contained CpG dinucleotides that were in a different sequence
context from the nonstimulatory control.
[0080] To determine whether the CpG motif present in the
stimulatory ODN was responsible for the observed stimulation, over
300 ODN ranging in length from 5 to 42 bases that contained
methylated, unmethylated, or no CpG dinucleotides in various
sequence contexts were synthesized. These ODNs, including the two
original "controls" (ODN 1 and 2) and two originally synthesized as
"antisense" (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448
(1989)), were then examined for in vitro effects on spleen cells
(representative sequences are listed in Table 1). Several ODN that
contained CpG dinucleotides induced B cell activation and IgM
secretion; the magnitude of this stimulation typically could be
increased by adding more CpG dinucleotides (Table 1; compare ODN 2
to 2a or 3D to 3Da and 3 Db). Stimulation did not appear to result
from an antisense mechanism or impurity. ODN caused no detectable
proliferation of .gamma..delta. or other T cell populations.
[0081] Mitogenic ODN sequences uniformly became nonstimulatory if
the CpG dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D
to 3Dc; 3M to 3Ma; and 4 to 4a) or if the cytosine of the CpG
dinucleotide was replaced by 5-methylcytosine (Table 1; ODN 1b, 2b,
3Dd, and 3 Mb). Partial methylation of CpG motifs caused a partial
loss of stimulatory effect (compare 2a to 2c, Table 1). In
contrast, methylation of other cytosines did not reduce ODN
activity (ODN 1c, 2d, 3De and 3Mc). These data confirmed that CpG
motif is the essential element present in ODN that activate B
cells.
[0082] In the course of these studies, it became clear that the
bases flanking the CpG dinucleotide played an important role in
determining the murine B cell activation induced by an ODN. The
optimal stimulatory motif was determined to consist of a CpG
flanked by two 5' purines (preferably a GpA dinucleotide) and two
3' pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of
ODN to bring the CpG motif closer to this ideal improved
stimulation (e.g., Table 1, compare ODN 2 to 2e; 3M to 3Md) while
mutations that disturbed the motif reduced stimulation (e.g., Table
1, compare ODN 3D to 3Df, 4 to 4b, 4c and 4d). On the other hand,
mutations outside the CpG motif did not reduce stimulation (e.g.,
Table 1, compare ODN to 1d; 3D to 3Dg; 3M to 3Me). For activation
of human cells, the best flanking bases are slightly different (See
Table 5)).
[0083] Of those tested, ODNs shorter than 8 bases were
non-stimulatory (e.g., Table 1, ODN 4e). Among the forty-eight 8
base ODN tested, a highly stimulatory sequence was identified as
TCAACGTT (SEQ. ID. NO: 90) (ODN4) which contains the self
complementary "palindrome" AACGTT (SEQ. ID. NO: 105). In further
optimizing this motif, it was found that ODN containing Gs at both
ends showed increased stimulation, particularly if the ODN were
rendered nuclease resistant by phosphorothioate modification of the
terminal internucleotide linkages. ODN 1585 (GGGGTCAACGTTGAGGGGGG
(SEQ ID NO: 12)), in which the first two and last five
internucleotide linkages are phosphorothioate modified caused an
average 25.4 fold increase in mouse spleen cell proliferation
compared to an average 3.2 fold increase in proliferation included
by ODN 1638, which has the same sequence as ODN 1585 except that
the 10 Gs at the two ends are replaced by 10 As. The effect of the
G-rich ends is cis; addition of an ODN with poly G ends but no CpG
motif to cells along with 1638 gave no increased proliferation. For
nucleic acid molecules longer than 8 base pairs, non-palindromic
motifs containing an unmethylated CpG were found to be more
immunostimulatory.
1TABLE 1 Oligonucleotide Stimulation of Mouse B Cells Stimulation
Index' CpG ODN Sequence (5' to 3') .dagger. .sup.3H Uridine IgM
Production 1 (SEQ ID NO:89) GCTAGACGTTAGCGT 6.1 .+-. 0.8 17.9 .+-.
3.6 1a (SEQ. ID NO:4) ......T........ 1.2 .+-. 0.2 1.7 .+-. 0.5 1b
(SEQ ID NO:13) ......Z........ 1.2 .+-. 0.1 1.8 .+-. 0.0 1c (SEQ ID
NO:14) ............Z.. 10.3 .+-. 4.4 9.5 .+-. 1.8 1d (SEQ ID NO:16)
..AT......GAGC. 13.0 .+-. 2.3 18.3 .+-. 7.5 2 (SEQ ID NO:1)
ATGGAAGGTCCAGCGTTCTC 2.9 .+-. 0.2 13.6 .+-. 2.0 2a (SEQ ID NO:15)
..C..CTC..G......... 7.7 .+-. 0.8 24.2 .+-. 3.2 2b (SEQ ID NO:16)
..Z..CTC.ZG..Z...... 1.6 .+-. 0.5 2.8 .+-. 2.2 2c (SEQ ID NO:17)
..Z..CTC..G......... 3.1 .+-. 0.6 7.3 .+-. 1.4 2d (SEQ ID NO:18)
..C..CTC..G......Z.. 7.4 .+-. 1.4 27.7 .+-. 5.4 2e (SEQ ID NO:19)
............A....... 5.6 .+-. 2.0 ND 3D (SEQ ID NO:20)
GAGAACGCTGGACCTTCCAT 4.9 .+-. 0.5 19.9 .+-. 3.6 3Da (SEQ ID NO:21)
.........C.......... 6.6 .+-. 1.5 33.9 .+-. 6.8 3Db (SEQ ID NO:22)
.........C.......G.. 10.1 .+-. 2.8 25.4 .+-. 0.8 3Dc (SEQ ID NO:23)
...C.A.............. 1.0 .+-. 0.1 1.2 .+-. 0.5 3Dd (SEQ ID NO:24)
.....Z.............. 1.2 .+-. 0.2 1.0 .+-. 0.4 3De (SEQ ID NO:25)
.............Z...... 4.4 .+-. 1.2 18.8 .+-. 4.4 3Df (SEQ ID NO:26)
.......A............ 1.6 .+-. 0.1 7.7 .+-. 0.4 3Dg (SEQ ID NO:27)
.........CC.G.ACTG.. 6.1 .+-. 1.5 18.6 .+-. 1.5 3M (SEQ ID NO:28)
TCCATGTCGGTCCTGATGCT 4.1 .+-. 0.2 23.2 .+-. 4.9 3Ma (SEQ ID NO:29)
......CT............ 0.9 .+-. 0.1 1.8 .+-. 0.5 3Mb (SEQ ID NO:30)
.......Z............ 1.3 .+-. 0.3 1.5 .+-. 0.6 3Mc (SEQ ID NO:31)
...........Z........ 5.4 .+-. 1.5 8.5 .+-. 2.6 3Md (SEQ ID NO:37)
......A..T.......... 17.2 .+-. 9.4 ND 3Me (SEQ ID NO:32)
...............C..A. 3.6 .+-. 0.2 14.2 .+-. 5.2 4 (SEQ ID NO:90)
TCAACGTT 6.1 .+-. 1.4 19.2 .+-. 5.2 4a (SEQ ID NO:91) ....GC.. 1.1
.+-. 0.2 1.5 .+-. 1.1 4b (SEQ ID NO:92) ...GCGC. 4.5 .+-. 0.2 9.6
.+-. 3.4 4c (SEQ ID NO:93) ...TCGA. 2.7 .+-. 1.0 ND 4d (SEQ ID
NO:94) ..TT..AA 1.3 .+-. 0.2 ND 4e (SEQ ID NO:106) -....... 1.3
.+-. 0.2 1.1 .+-. 0.5 4f (SEQ ID NO:95) C....... 3.9 .+-. 1.4 ND 4g
(SEQ ID NO:117) --......CT 1.4 .+-. 0.3 ND 4h (SEQ ID NO:96)
.......C 1.2 .+-. 0.2 ND LPS 7.8 .+-. 2.5 4.8 .+-. 1.0 Stimulation
indexes are the means and std. dev. derived from at least 3
separate experiments, and are compared to wells cultured with no
added ODN. ND = not done. CpG dinucleotides are underlined. Dots
indicate identity; dashes indicate deletions. Z = 5 methyl
cytosine.
[0084]
2TABLE 2 Identification of the optimal CpG motif for Murine IL-6
production and B cell activation. IL-6 (pg/ml).sup.a ODN SEQUENCE
(5'-3') CH12.LX SPLENIC B CELL SI.sup.b IgM (ng/ml).sup.c 512 (SEQ
ID No:28) TCCATGTCGGTCCTGATGCT 300 .+-. 106 627 .+-. 43 5.8 .+-.
0.3 7315 .+-. 1324 1637 (SEQ ID No:33) ......C............. 136
.+-. 27 46 .+-. 6 1.7 .+-. 0.2 770 .+-. 72 1615 (SEQ ID No:34)
......G............. 1201 .+-. 155 850 .+-. 202 3.7 .+-. 0.3 3212
.+-. 617 1614 (SEQ ID No:35) ......A............. 1533 .+-. 321
1812 .+-. 103 10.8 .+-. 0.6 7558 .+-. 414 1636 (SEQ ID No:36)
.........A.......... 1181 .+-. 76 947 .+-. 132 5.4 .+-. 0.4 3983
.+-. 485 1634 (SEQ ID No:37) .........C.......... 1049 .+-. 223
1671 .+-. 175 9.2 .+-. 0.9 6256 .+-. 261 1619 (SEQ ID No:38)
.........T.......... 1555 .+-. 304 2908 .+-. 129 12.5 .+-. 1.0 8243
.+-. 698 1618 (SEQ ID No:7) ......A..T.......... 2109 .+-. 291 2596
.+-. 166 12.9 .+-. 0.7 10425 .+-. 674 1639 (SEQ ID No:3)
.....AA..T.......... 1827 .+-. 83 2012 .+-. 132 11.5 .+-. 0.4 9489
.+-. 103 1707 (SEQ ID No:39) ......A..TC......... ND 1147 .+-. 175
4.0 .+-. 0.2 3534 .+-. 217 1708 (SEQ ID No:40 .....CA..TG.........
ND 59 .+-. 3 1.5 .+-. 0.1+ 466 .+-. 109 Dots indicate identity; CpG
dinucleotides are underlined; ND = not done .sup.aThe experiment
was done at least three times with similar results. The level of
IL-6 of unstimulated control cultures of both CH12.LX and splenic B
cells was .ltoreq.10 pg/ml. The IgM level of unstimulated culture
was 547 .+-. 82 ng/ml. CpG dinucleotides are underlined and dots
indicate identity. Cells were stimulated with 20 .mu.M of various
CpG O-ODN. Data present the mean .+-. SD of triplicates.
.sup.b[.sup.3H] Uridine uptake was indicated as a fold increase
(SI: stimulation index) from unstimulated control (2322.67 .+-.
213.68 cpm). .sup.cMeasured by ELISA.
[0085] Other octamer ODN containing a 6 base palindrome with a TpC
dinucleotide at the 5' end were also active (e.g., Table 1, ODN 4b,
4c). Other dinucleotides at the 5' end gave reduced stimulation
(e.g., ODN 4f; all sixteen possible dinucleotides were tested). The
presence of a 3' dinucleotide was insufficient to compensate for
the lack of a 5' dinucleotide (e.g., Table 1, ODN 4g). Disruption
of the palindrome eliminated stimulation in octamer ODN (e.g.,
Table 1, ODN 4h), but palindromes were not required in longer
ODN.
[0086] The kinetics of lymphocyte activation were investigated
using mouse spleen cells. When the cells were pulsed at the same
time as ODN addition and harvested just four hours later, there was
already a two-fold increase in .sup.3H uridine incorporation.
Stimulation peaked at 12-48 hours and then decreased. After 24
hours, no intact ODN were detected, perhaps accounting for the
subsequent fall in stimulation when purified B cells with or
without anti-IgM (at a submitogenic dose) were cultured with CpG
ODN, proliferation was found to synergistically increase about
10-fold by the two mitogens in combination after 48 hours. The
magnitude of stimulation was concentration dependent and
consistently exceeded that of LPS under optimal conditions for
both. Oligonucleotides containing a nuclease resistant
phosphorothioate backbone were approximately two hundred times more
potent than unmodified oligonucleotides.
[0087] Cell cycle analysis was used to determine the proportion of
B cells activated by CpG-ODN. CpG-ODN induced cycling in more than
95% of B cells. Splenic B lymphocytes sorted by flow cytometry into
CD23- (marginal zone) and CD23+ (follicular) subpopulations were
equally responsive to ODN- induced stimulation, as were both
resting and activated populations of B cells isolated by
fractionation over Percoll gradients. These studies demonstrated
that CpG-ODN induced essentially all B cells to enter the cell
cycle.
[0088] Immunostimulatory Nucleic Acid Molecules Block Murine B Cell
Apoptosis
[0089] Certain B cell lines, such as WEHI-231, are induced to
undergo growth arrest and/or apoptosis in response to crosslinking
of their antigen receptor by anti-IgM (Jakway, J. P. et al.,
"Growth regulation of the B lymphoma cell line WEHI-231 by
anti-immunoglobulin, lipopolysaccharide and other bacterial
products" J. Immunol. 137: 2225 (1986); Tsubata, T., J. Wu and T.
Honjo: B-cell apoptosis induced yb antigen receptor crosslinking is
blocked by a T-cell signal through CD40." Nature 365: 645 (1993)).
WEHI-231 cells are rescued from this growth arrest by certain
stimuli such as LPS and by the CD40 ligand. ODN containing the CpG
motif were also found to protect WEHI-231 from anti-IgM induced
growth arrest, indicating that accessory cell populations are not
required for the effect. Subsequent work indicates that CpG ODN
induce Bcl-x and myc expression, which may account for the
protection from apoptosis. Also, CpG nucleic acids have been found
to block apoptosis in human cells. This inhibition of apoptosis is
important, since it should enhance and prolong immune activation by
CpG DNA.
[0090] Identification of the Optimal CpG Motif for Induction of
Murine IL-6 and IgM Secretion and B Cell Proliferation.
[0091] To evaluate whether the optimal B cell stimulatory CpG motif
was identical with the optimal CpG motif for IL-6 secretion, a
panel of ODN in which the bases flanking the CpG dinucleotide were
progressively substituted was studied. This ODN panel was analyzed
for effects on B cell proliferation, Ig production, and IL-6
secretion, using both splenic B cells and CH12.LX cells. As shown
in Table 2, the optimal stimulatory motif contains an unmethylated
CpG flanked by two 5' purines and two 3' pyrimidines. Generally a
mutation of either 5' purines to C were especially deleterious, but
changes in 5' purines to T or 3' pyrimidines to purines had less
marked effects. Based on analyses of these and scores of other ODN,
it was determined that the optimal CpG motif for induction of IL-6
secretion is TGACGTT (SEQ. ID. NO: 108), which is identical with
the optimal mitogenic and IgM-inducing CpG motif (Table 2). This
motif was more stimulatory than any of the palindrome containing
sequences studied (1639, 1707 and 1708).
[0092] Induction of Murine Cytokine Secretion by CpG Motifs in
Bacterial DNA or Oligonucleotides.
[0093] As described in Example 9, the amount of IL-6 secreted by
spleen cells after CpG DNA stimulation was measured by ELISA. T
cell depleted spleen cell cultures rather than whole spleen cells
were used for in vitro studies following preliminary studies
showing that T cells contribute little or nothing to the 1L-6
produced by CpG DNA-stimulated spleen cells. As shown in Table 3,
IL-6 production was markedly increased in cells cultured with E.
coli DNA but not in cells cultured with calf thymus DNA. To confirm
that the increased IL-6 production observed with E. coli DNA was
not de to contamination by other bacterial products, the DNA was
digested with DNAse prior to analysis. DNAse pretreatment abolished
IL-6 production induced by E. coli DNA (Table 3). In addition,
spleen cells from LPS-nonresponsive C2H/HeJ mouse produced similar
levels of IL-6 in response to bacterial DNA. To analyze whether the
IL-6 secretion induced by E. coli DNA was mediated by the
unmethylated CpG dinucleotides in bacterial DNA, methylated E. coli
DNA and a panel of synthetic ODN were examined. As shown in Table
3, CpG ODN significantly induced IL-6 secretion (ODN 5a, 5b, 5c)
while CpG methylated E. coli DNA, or ODN containing methylated CpG
(ODN 5f) or no CpG (ODN 5d) did not. Changes at sites other than
CpG dinucleotides (ODN 5b) or methylation of other cytosines (ODN
5g) did not reduce the effect of CpG ODN. Methylation of a single
CpG in an ODN with three CpGs resulted in a partial reduction in
the stimulation (compare ODN 5c to 5e; Table 3).
3TABLE 3 Induction of Murine IL-6 secretion by CpG motifs in
bacterial DNA or oligonucleotides Treatment IL-6 (pg/mL) calf
thymus DNA <10 calf thymus DNA + DNase <10 E. coli DNA 1169.5
.+-. 94.1 E. coli DNA + DNase <10 CpG methylated E. coli DNA
<10 LPS 280.1 .+-. 17.1 Media (no DNA) <10 ODN 5a SEQ. ID.
No:115 TGGACTCTCCAGCGTTCTC 1096.4 .+-. 372.0 5b SEQ. ID. No:19
.....AGG....A....... 1124.5 .+-. 126.2 5c SEQ. ID. No:15
..C.......G......... 1783.0 .+-. 189.5 5d SEQ. ID. No:114 ....
AGG..C..T...... <10 5e SEQ. ID. No:116 ..C.......G..Z......
851.1 .+-. 114.4 5f SEQ. ID. No:16 ..Z......ZG..Z...... <10 5g
SEQ. ID. No:18 ..C.......G......Z.. 1862.3 + 87.26 T cell depleted
spleen cells from DBA/2 mice were stimulated with phosphodiester
modified oligonucleotides (O-ODN) (20 .mu.M), calf thymus DNA (50
.mu.g/ml) or E. coli DNA (50 .mu./ml) with or without enzyme
treatment, or LPS (10 .mu.g/ml) for 24 hr. Data represent the mean
(pg/mL) .+-. SD of triplicates. CpG dinucleotides are underlined
and dots indicate identity. Z indicates 5-methylcytosine.
[0094] CpG Motifs can be Used as an Artificial Adjuvant.
[0095] Nonspecific simulators of the immune response are known as
adjuvants. The use of adjuvants is essential to induce a strong
antibody response to soluble antigens (Harlow and Lan, Antibodies:
A Laboratory manual, Cold Spring Harbor, N.Y. Current Edition;
hereby incorporated by reference). The overall effect of adjuvants
is dramatic and their importance cannot be overemphasized. The
action of an adjuvant allows much smaller doses of antigen to be
used and generates antibody responses that are more persistent. The
nonspecific activation of the immune response often can spell the
difference between success and failure in obtaining an immune
response. Adjuvants should be used for first injections unless
there is some very specific reason to avoid this. Most adjuvants
incorporate two components. One component is designed to protect
the antigen from rapid catabolism (e.g., liposomes or synthetic
surfactants (Hunter et al. 1981)). Liposomes are only effective
when the immunogen is incorporated into the outer lipid layer;
entrapped molecules are not seen by the immune system. The other
component is a substance that will stimulate the immune response
nonspecifically. These substances act by raising the level of
lymphokines. Lymphokines stimulate the activity of
antigen-processing cells directly and cause a local inflammatory
reaction at the site of injection. Early work relied entirely on
heat-killed bacteria (Dienes 1936) or lipopolysaccharide (LPS)
(Johnson et al. 1956). LPS is reasonably toxic, and, through
analysis of its structural components, most of its properties as an
adjuvant have been shown to be in a portion known as lipid A. Lipid
A is available in a number of synthetic and natural forms that are
much less toxic than LPS, but still retains most of the better
adjuvant properties of parental LPS molecule. Lipid A compounds are
often delivered using liposomes.
[0096] Recently an intense drive to find potent adjuvants with more
acceptable side effects has led to the production of new synthetic
adjuvants. The present invention provides the sequence 1826
TCCATGACGTTCCTGACGTT (SEQ ID NO: 10), which is an adjuvant
including CpG containing nucleic acids. The sequence is a strong
immune activating sequence and is a superb adjuvant, with efficacy
comparable or superior to complete Freund's, but without apparent
toxicity.
[0097] Titration of Induction of Murine IL-6 Secretion by CpG
Motifs
[0098] Bacterial DNA and CpG ODN induced IL-6 production in T cell
depleted murine spleen cells in a dose-dependent manner, but
vertebrate DNA and non-CpG ODN did not (FIG. 1). IL-6 production
plateaued at approximately 50 .mu.g/ml of bacterial DNA or 40 .mu.M
of CpG O-ODN. The maximum levels of IL-6 induced by bacterial DNA
and CpG ODN were 1-1.5 ng/ml and 2-4 ng/ml respectively. These
levels were significantly greater than those seen-after stimulation
by LPS (0.35 ng/ml) (FIG. 1A). To evaluate whether CpG ODN with a
nuclease-resistant DNA backbone would also induce IL-6 production,
S-ODN were added to T cell depleted murine spleen cells. CpG S-ODN
also induced IL-6 production in a dose-dependent manner to
approximately the same level as CpG O-ODN while non-CpG S-ODN
failed to induce 1L-6 (FIG. 1C). CpG S-ODN at a concentration of
0.05 .mu.M could induce maximal IL-6 production in these cells.
This result indicated that the nuclease-resistant DNA backbone
modification retains the sequence specific ability of CpG DNA to
induce IL-6 secretion and that CpG S-ODN are more than 80-fold more
potent than CpG O-ODN in this assay system.
[0099] Induction of Murine IL-6 Secretion by CpG DNA In Vivo
[0100] To evaluate the ability of bacterial DNA and CpG S-ODN to
induce Il-6 secretion in vivo, BALB/c mice were injected iv. with
100 .mu.g of E. coli DNA, calf thymus DNA, or CpG or
non-stimulatory S-ODN and bled 2 hr after stimulation. The level of
IL-6 in the sera from the E. coli DNA injected group was
approximately 13 ng/ml while IL-6 was not detected in the sera from
calf thymus DNA or PBS injected groups (Table 4). CpG S-ODN also
induced IL-6 secretion in vivo. The IL-6 level in the sera from CpG
S-ODN injected groups was approximately 20 ng/ml. In contrast, IL-6
was not detected in the sera from non-stimulatory S-ODN stimulated
group (Table 4).
4TABLE 4 Secretion of Murine IL-6 induced by CpG DNA stimulation in
vivo. Stimulant IL-6 (pg/ml) PBS <50 E. coli DNA 13858 .+-. 3143
Calf Thymus DNA <50 CpG S-ODN 20715 .+-. 606 non-CpG S-ODN
<50 Mice (2 mice/group) were i.v. injected with 100 .mu.l of
PBS, 200 .mu.g of E. coli DNA or calfthymus DNA, or 500 .mu.g of
CpG S-ODN or non-CpG control S-ODN. Mice were bled 2 hr. after
injection and 1:10 dilution of each serum was analyzed by IL-6
ELISA. Sensitivity limit of IL-6 ELISA was 5 pg/ml. Sequences of
the CpG S-ODN is 5'GCATGACGTTGAGCT3' (SEQ. # ID. No: 6) and of the
non-stimulatory S-ODN is 5'GCTAGATGTTAGCGT3' (SEQ. ID. No: 4). Note
that although there is a CpG in sequence 48, it is too close to the
3' end to effect stimulation, as explained herein. Data represent
mean .+-. SD of duplicates. The experiment was done at least twice
with similar results.
[0101] Kinetics of Murine IL-6 Secretion after Stimulation by CpG
Motifs in Vivo
[0102] To evaluate the kinetics of induction of IL-6 secretion by
CpG DNA n vivo, BALB/c mice were injected iv. with CpG or control
non-CpG S-ODN. Serum IL-6 levels were significantly increased
within 1 hr and peaked at 2 hr to a level of approximately 9 ng/ml
in the CpG S-ODN injected group (FIG. 2). Il-6 protein in sera
rapidly decreased after 4 hr and returned to basal level by 12 hr
after stimulation. In contrast to CpG DNA stimulated groups, no
significant increase of IL-6 was observed in the sera from the
non-stimulatory S-ODN or PBS injected groups (FIG. 2).
[0103] Tissue Distribution and Kinetics of IL-6, mRNA Expression
Induced by CpG Motifs In Vivo
[0104] As shown in FIG. 2, the level of serum L-6 increased rapidly
after CpG DNA stimulation. To investigate the possible tissue
origin of this serum IL-6, and the kinetics of IL-6 gene expression
in vivo after CpG DNA stimulation, BALB/c mice were injected iv
with CpG or non-CpG S-ODN and RNA was extracted from liver, spleen,
thymus, and bone marrow at various time points after stimulation.
As shown in FIG. 3A, the level of IL-6 mRNA in liver, spleen, and
thymus was increased within 30 min. after injection of CpG S-ODN.
The liver IL-6 mRNA peaked at 2 hr post-injection and rapidly
decreased and reached basal level 8 hr after stimulation (FIG. 3A).
Splenic IL-6 mRNA peaked at 2 hr after stimulation and then
gradually decreased (FIG. 3A). Thymus IL-6 mRNA peaked at 1 hr
post-injection and then gradually decreased (FIG. 3A). IL-6 mRNA
was significantly increased in bone marrow within 1 hr after CpG
S-ODN injection but then returned to basal level. In response to
CpG S-ODN, liver, spleen and thymus showed more substantial
increases in IL-6 mRNA expression than the bone marrow.
[0105] Patterns of Murine Cytokine Expression Induced by CpG
DNA
[0106] In vivo or in whole spleen cells, no significant increase in
the protein levels of the following interleukins: IL-2, IL-3, IL-4,
IL-5, or IL-10 was detected within the first six hours (Klinman, D.
M. et al., (1996) Proc. Natl. Acad. Sci. USA 93:2879-2883).
However, the level of TNF-.alpha. is increased within 30 minutes
and the level of IL-6 increased strikingly within 2 hours in the
serum of mice injected with CpG ODN. Increased expression of L-12
and interferon gamma (IFN-.gamma.) mRNA by spleen cells was also
detected within the first two hours. dots indicate
5TABLE 5 Induction of human PBMC cytokine secrtetion by CpG oligos
ODN Sequence (5'-3') IL-6.sup.1 TNF-.alpha..sup.1 IFN-.gamma..sup.1
GM-CSF IL-12 512 TCCATGTCGGTCCTGATGCT 500 140 15.6 70 250 SEQ ID
NO:28 1637 ......C............. 550 16 7.8 15.6 35 SEQ ID NO:33
1615 ......G............. 600 145 7.8 45 250 SEQ ID NO:34 1614
......A............. 550 31 0 50 250 SEQ ID NO:35 1636
.........A.......... 325 250 35 40 0 SEQ ID NO:36 1634
.........C.......... 300 400 40 85 200 SEQ ID NO:37 1619
.........T.......... 275 450 200 80 >500 SEQ ID NO:38 1618
......A..T.......... 300 60 15.6 15.6 62 SEQ ID NO:7 1639
.....AA..T.......... 625 220 15.6 40 60 SEQ ID NO:3 1707
......A..TC......... 300 70 17 0 0 SEQ ID NO:39 1708
.....CA..TG......... 270 10 17 0 0 SEQ ID NO:40 identity; CpG
dinucleotides are underlined .sup.1measured by ELISA using
Quantikine kits from R&D Systems (pg/ml) Data are presented as
the level of cytokine above that in wells with no added
oligodeoxynucleotide.
[0107] CpG DNA Induces Cytokine Secretion by Human PBMC,
Specifically Monocytes
[0108] The same panels of ODN used for studying mouse cytokine
expression were used to determine whether human cells also are
induced by CpG motifs to express cytokine (or proliferate), and to
identify the CpG motif(s) responsible. Oligonucleotide 1619
(GTCGTT; residues of 6-11 of SEQ. ID. NO: 105) was the best inducer
of TNF-.alpha. and IFN-.gamma. secretion, and was closely followed
by a nearly identical motif in oligonucleotide 1634 (GTCGCT;
residues 6-11 of SEQ. ID. NO: 104) (Table 5). The motifs in
oligodeoxynucleotides 1637 and 1614 (GCCGGT; residues 6-11 of SEQ.
ID. NO: 29) and (GACGGT; residues 6-11 of SEQ. ID. NO: 102) led to
strong IL-6 secretion with relatively little induction of other
cytokines. Thus, it appears that human lymphocytes, like murine
lymphocytes, secrete cytokines differentially in response to CpG
dinucleotides, depending on the surrounding bases. Moreover, the
motifs that stimulate murine cells best differ from those that are
most effective with human cells. Certain CpG oligodeoxynucleotides
are poor at activating human cells (oligodeoxynucleotides 1707,
1708, which contain the palindrome forming sequences GACGTC
residues 6-11 of SEQ. ID. NO: 88 and CACGTG residues 6-11 of SEQ.
ID. NO: 106, respectively).
[0109] The cells responding to the DNA appear to be monocytes,
since the cytokine secretion is abolished by treatment of the cells
with L-leucyl-L-leucine methyl ester (L-LME), which is selectively
toxic to monocytes (but also to cytotoxic T lymphocytes and NK
cells), and does not affect B cell Ig secretion (Table 6). The
cells surviving L-LME treatment had >95% viability by trypan
blue exclusion, indicating that the lack of a cytokine response
among these cells did not simply reflect a nonspecific death of all
cell types. Cytokine secretion in response to E. coli (EC) DNA
requires unmethylated CpG motifs, since it is abolished by
methylation of the EC DNA (next to the bottom row, Table 6). LPS
contamination of the DNA cannot explain the results since the level
of contamination was identical in the native and methylated DNA,
and since addition of twice the highest amount of contaminating LPS
had no effect (not shown).
6TABLE 6 CpG DNA induces cytokine secretion by human PBMC TNF- IL-6
IFN-.gamma. RANTES DNA .alpha.(pg/ml).sup.1 (pg/ml) (pg/ml) (pg/ml)
EC DNA (50 .mu.g/ml) 900 12,000 700 1560 EC DNA (5 .mu.g/ml) 850
11,000 400 750 EC DNA (0.5 .mu.g/ml) 500 ND 200 0 EC DNA (0.05
.mu.g/ml) 62.5 10,000 15.6 0 EC DNA (50 .mu.g/ml) + 0 ND ND ND
L-LME.sup.2 EC DNA (10 .mu.g/ml) Methyl.sup.3 0 5 ND ND CT DNA (50
.mu.g/ml) 0 600 0 0 .sup.1Levels of all cytokines were determined
by ELISA using Quantikine fits from R&D Systems as described in
the previous table. Results are representative using PBMC from
different donors. .sup.2Cells were pretreated for 15 min. with
L-leucyl-L-leucine methyl ester (M-LME) to determine whether the
dytokine production under these conditions was from monocytes (or
other L-LME-sensitive cells). .sup.3EC DNA was methylated using 2
U/.mu.g DNA of CpG methylase (New England Biolabs) according to the
manufacturer's directions, and methylation confirmed by digestion
with Hpa-II and Msp-I. # As a negative control, samples were
included containing twice the maximal amount of LPS contained in
the highest concentration of EC DNA which failed to induce
detectable cytokine production under these experimental
conditions.
[0110] The loss of cytokine production in the PBMC treated with
L-LME suggested that monocytes may be responsible for cytokine
production in response to CpG DNA. To test this hypothesis more
directly, the effects of CpG DNA on highly purified human monocytes
and macrophages was tested. As hypothesized, CpG DNA directly
activated production of the cytokines IL-6, GM-CSF, and TNF-.alpha.
by human macrophages, whereas non-CpG DNA did not (Table 7).
7TABLE 7 CpG DNA induces cytokine expression in purified human
macrophages IL-6 (pg/ml) GM-CSF (pg/ml) TNF-.alpha. (pg/ml) Cells
alone 0 0 0 CT DNA (50 .mu.g/ml) 0 0 0 EC DNA (50 .mu.g/ml) 2000
15.6 1000
[0111] Biological Role of IL-6 in Inducing Murine IgM Production in
Response to CpG Motifs
[0112] The kinetic studies described above revealed that induction
of IL-6 secretion, which occurs within 1 hr post CpG stimulation,
precedes IgM secretion. Since the optimal CpG motif for ODN
inducing secretion of IL-6 is the same as that for IgM (Table 2),
whether the CpG motifs independently induce IgM and IL-6 production
or whether the IgM production is dependent on prior IL-6 secretion
was examined. The addition of neutralizing anti-IL-6 antibodies
inhibited in vitro IgM production mediated by CpG ODN in a
dose-dependent manner but a control antibody did not (FIG. 4A). In
contrast, anti-IL-6 addition did not affect either the basal level
or the CpG-induced B cell proliferation (FIG. 4B).
[0113] Increased Transcriptional Activity of the IL-6 promoter in
response to CpG DNA
[0114] The increased level of IL-6 mRNA and protein after CpG DNA
stimulation could result from transcriptional or
post-transcriptional regulation. To determine if the
transcriptional activity of the IL-6 promoter was unregulated in B
cells cultured with CpG ODN, a murine B cell line, WEHI-231, which
produces IL-6 in response to CpG DNA, was transfected with an IL-6
promoter-CAT construct (pIL-6/CAT) (Pottrats, S. T. et al.,
17B-estradiol) inhibits expression of human
interleukin-6-promoter-reporter constructs by a receptor-dependent
mechanism. J. Clin. Invest. 93:944). CAT assays were performed
after stimulation with various concentrations of CpG or non-CpG
ODN. As shown in FIG. 5, CpG ODN induced increased CAT activity in
dose-dependent manner while non-CPG ODN failed to induce CAT
activity. This confirms that CpG induces the transcriptional
activity of the IL-6 promoter.
[0115] Dependence of B Cell Activation by CpG ODN on the Number of
5' and 3'Phosphorothioate Internucleotide Linkages
[0116] To determine whether partial sulfur modification of the ODN
backbone would be sufficient to enhance B cell activation, the
effects of a series of ODN with the same sequence, but with
differing numbers of S internucleotide linkages at the 5' end of
ODN were required to provide optimal protection of the ODN from
degradation by intracellular exo- and endo-nucleases. Only chimeric
ODN containing two 5' phosphorothioate-modified linkages, and a
variable number of 3' modified linkages were therefore
examined.
[0117] The lymphocyte stimulating effects of these ODN were tested
at three concentrations (3.3, 10, and 30 .mu.M) by measuring the
total levels of RNA synthesis (by .sup.3H uridine incorporation) or
DNA synthesis (by .sup.3H thymidine incorporation) in treated
spleen cell cultures (Example 10). O-ODN (0/0 phosphorothioate
modifications) bearing a CpG motif caused no spleen cell
stimulation unless added to the cultures at concentrations of at
least 10 .mu.M (Example 10). However, when this sequence was
modified with two S linkages at the 5' end and at least three S
linkages at the 3' end, significant stimulation was seen at a dose
of 3.3 .mu.M. At this low dose, the level of stimulation showed a
progressive increase as the number of 3' modified bases was
increased, until this reached or exceeded six, at which point the
stimulation index began to decline. In general, the optimal number
of 3' S linkages for spleen cell stimulation was five. Of all three
concentrations tested in these experiments, the S-ODN was less
stimulatory than the optimal chimeric compounds.
[0118] Dependent of GpG-Mediated Lymphocyte Activation on the Type
of Backbone Modification
[0119] Phosphorothioate modified ODN (S-ODN) are far more nuclease
resistant than phosphodiester modified ODN (O-ODN). Thus, the
increased immune stimulation caused by S-ODN and S-O-ODN (i.e.,
chimeric phosphorothioate ODN in which the central linkages are
phosphodiester, but the two 5' and five 3' linkages are
phosphorothioate modified) compared to O-ODN may result from the
nuclease resistance of the former. To determine the role of ODN
nuclease resistance in immune stimulation by CpG ODN, the
stimulatory effects of chimeric ODN in which the 5' and 3' ends
were rendered nuclease resistant with either methylphosphonate
(MP-), methylphosphorothioate (MPS-), phosphorothioate (S-), or
phosphorodithioate (S.sub.2-) internucleotide linkages were tested
(Example 10). These studies showed that despite their nuclease
resistance, MP-O-ODN were actually less immune stimulatory than
O-ODN. However, combining the MP and S modifications by replacing
both nonbridging O molecules with 5' and 3' MPS internucleotide
linkages restored immune stimulation to a slightly higher level
than that triggered by O-ODN.
[0120] S-O-ODN were far more stimulatory than O-ODN, and were even
more stimulatory than S-ODN, at least at concentrations above 3.3
.mu.M. At concentrations below 3 .mu.M, the S-ODN with the 3M
sequence was more potent than the corresponding S-O-ODN, while the
S-ODN with the 3D sequence was less potent than the corresponding
S-O-ODN (Example 10). In comparing the stimulatory CpG motifs of
these two sequences, it was noted that the 3D sequence is a perfect
match for the stimulatory motif in that the CpG is flanked by two
5' purines and two 3' pyrimidines. However, the bases immediately
flanking the CpG in ODN 3D are not optimal; it has a 5' pyrimidine
and a 3' purine. Based on further testing, it was found that the
sequence requirement for immune stimulation is more stringent for
S-ODN than for S-O- or O-ODN. S-ODN with poor matches to the
optimal CpG motif cause little or no lymphocyte activation (e.g.,
Sequence 3D). However, S-ODN with good matches to the motif, most
critically at the positions immediately flanking the CpG, are more
potent than the corresponding S-O-ODN (e.g., Sequence 3M, Sequences
4 and 6), even though at higher concentrations (greater than 3
.mu.M) the peak effect from the S-O-ODN is greater (Example
10).
[0121] S.sub.2-O-ODN were remarkably stimulatory, and caused
substantially greater lymphocyte activation than the corresponding
S-ODN or S-O-ODN at every tested concentration.
[0122] The increased B cell stimulation seen with CpG ODN bearing S
or S.sub.2 substitutions could result from any or all of the
following effects: nuclease resistance, increased cellular uptake,
increased protein binding, and altered intracellular localization.
However, nuclease resistance cannot be the only explanation, since
the MP-O-ODN were actually less stimulatory than the O-ODN with CpG
motifs. Prior studies have shown that ODN uptake by lymphocytes is
markedly affected by the backbone chemistry (Zhao, et al. (1993)
Comparison of cellular binding and uptake of antisense
phosphodiester, phosphorothioate, and mixed phosphorothioate and
methylphosphonate oligonucleotides. (Antisense Research and
Development 3, 53-66; Zhao et al., (1994) Stage specific
oligonucleotide uptake in murine bone marrow B cell precursors.
Blood 84, 3660-3666). The highest cell membrane binding and uptake
was seen with S-ODN, followed by S-O-ODN, O-ODN, and MP-ODN. This
differential uptake correlates with the degree of immune
stimulation.
[0123] Unmethylated CpG Containing Oligos Have NK Cell Stimulatory
Activity
[0124] Experiments were conducted to determine whether CpG
containing oligonucleotides stimulated the activity of natural
killer (NK) cells in addition to B cells. As shown in Table 8, a
marked induction of NK activity among spleen cells cultured with
CpG ODN 1 and 3Dd was observed. In contrast, there was relatively
on induction in effectors that had been treated with non-CpG
control ODN.
8TABLE 8 Induction Of NK Activity By CpG Oligodeoxynucleotides
(ODN) % YAC-1 % 2C11 Specific Lysis* Specific Lysis Effector:Target
Effector:Target ODN 50:1 100:1 50:1 100:1 None -1.1 -1.4 15.3 16.6
1 (SEQ ID NO: 89) 16.1 24.5 38.7 47.2 3Dd (SEQ ID NO: 24) 17.1 27.0
37.0 40.0 Non-CpG ODN -1.6 -1.7 14.8 15.4
[0125] Induction of NK Activity by DNA Containing CpG Motifs, but
Not by Non-CpG DNA.
[0126] Bacterial DNA cultured for 18 hrs at 37.degree. C. and then
assayed for killing of K562 (human) or Yac-1 (mouse) target cells
induced NK lytic activity in both mouse spleen cells depleted of B
cells and human PBMC, but vertebrate DNA may be a consequence of
its increased level of unmethylated CpG dinucleotides, the
activating properties of more than 50 synthetic ODN containing
unmethylated, methylated, or no CpG dinucleotides was tested. The
results, summarized in Table 9, demonstrate that synthetic ODN can
stimulate significant NK activity, as long as they contain at least
one unmethylated CpG dinucleotide. No difference was observed in
the stimulatory effects of ODN in which the CpG was within a
palindrome (such as ODN 1585, which contains the palindrome AACGTT;
SEQ. ID. NO: 105) from those ODN without palindromes (such as 1613
ro 1619), with the caveat that optimal stimulation was generally
seem with ODN in which the CpG was flanked by two 5' purines or a
5' GpT dinucleotide and two 3' pyrimidines. Kinetic experiments
demonstrated that NK activity peaked around 18 hrs. after addition
of the ODN. The data indicates that the murine NK response is
dependent on the prior activation of monocytes by CpG DNA, leading
to the production of IL-12, TNF-.alpha., and IFN-.alpha./.beta.
(Example 11).
9TABLE 9 Induction of NK Activity by DNA Containing CpG Motifs but
not by Non-CpG DNA LU/10.sup.6 DNA or Cytokine Added Mouse Cells
Human Cells Expt. 1 None 0.00 0.00 IL-2 16.68 15.82 E.Coli. DNA
7.23 5.05 Calf thymus DNA 0.00 0.00 Expt. 2 None 0.00 3.28 1585
ggGGTCAACGTTGAGggggg (SEQ ID No.12) 7.38 17.98 1629
-------gtc------ (SEQ ID No.41) 0.00 4.4 Expt. 3 None 0.00 1613
GCTAGACGTTAGTGT (SEQ ID No.42) 5.22 1769 -------Z------ (SEQ ID
No.117) 0.02 ND 1619 TCCATGTCGTTCCTGATGCT (SEQ ID No.38) 3.35 1765
-------Z---------- (SEQ ID No.44) 0.11 CpG dinucleotides in ODN
sequences are indicated by underlying; Z indicates methylcytosine.
Lower case letters indicate nuclease resistant phosphorothioate
modified internucleotide linkages which, in titration experiments,
were more than 20 times as potent as non-modified ODN, depending on
the flanking bases. Poly G ends (g) were used in some ODN, because
they significantly increase the level of ODN uptake.
[0127] From all of these studies, a more complete understanding of
the immune effects of CpG DNA has been developed, which is
summarized in FIG. 6.
[0128] Immune activation by CpG motifs may depend on bases flanking
the CpG, and the number of spacing of the CpGs present within an
ODN. Although a single CpG in an ideal base context can be a very
strong and useful immune activator, superior effects can be seen
with ODN containing several CpGs with the appropriate spacing and
flanking bases. For activation of murine B cells, the optimal CpG
motif is TGACGTT (SEQ. ID. NO: 108); residues 11-17 of Seq. ID. No
70.
[0129] The following studies where conducted to identify optimal
ODN sequences for stimulation of human cells by examining the
effects of changing the number, spacing, and flanking bases of CpG
dinucleotides.
[0130] Identification of Phosphorothioate ODN with Optimal CpG
Motifs for Activation of Human NK Cells.
[0131] To have clinical utility, ODN must be administered to a
subject in a form that protects them against nuclease degradation.
Methods to accomplish this with phosphodiester ODN are well known
in the art and include encapsulation in lipids or delivery systems
such as nanoparticles. This protection can also be achieved using
chemical substitutions to the DNA such as modified DNA backbones
including those in which the internucleotide linkages are nuclease
resistant. Some modifications may confer additional desirable
properties such as increasing cellular uptake. For example, the
phosphodiester linkage can be modified via replacement of one of
the nonbridging oxygen atoms with a sulfur, which constitutes
phosphorothioate DNA. Phosphorothioate ODN have enhanced cellular
uptake (Krieg et al., Antisense Res. Dev. 6:133, 1996.) and
improved B cell stimulation if they also have a CpG motif. Since NK
activation correlates strongly with in vivo adjuvant effects, the
identification of phosphorothioate ODN that will activate human NK
cells is very important.
[0132] The effects of different phosphorothioate ODNs--containing
CpG dinucleotides in various base contexts--on human NK activation
(Table 10) were examined. ODN 1840, which contained 2 copies of the
TGTCGTT (SEQ. ID. NO: 102) residues 14-20 of SEQ. ID. NO: 47 motif,
had significant NK lytic activity (Table 10). To further identify
additional ODNs optimal for NK activation, approximately one
hundred ODN containing different numbers and spacing of CpG motifs,
were tested with ODN1982 serving as a control. The results are
shown in Table 11.
[0133] Effective ODNs began with a TC or TG at the 5' end, however,
this requirement was not mandatory. ODNs with internal CpG motifs
(e.g., ODN 1840) are generally less potent stimulators than those
in which a GTCGCT (SEQ. ID. NO: 58) motif immediately follows the
5' TC (e.g., ODN 1967 and 1968). ODN 1968, which has a second
GTCGTT (SEQ. ID. NO: 57) motif in its 3' half, was consistently
more stimulatory than ODN 1967, which lacks this second motif. ODN
1967, however, was slightly more potent than ODN 1968 in
experiments 1 and 3, but not in experiment 2. ODN 2005, which has a
third GTCGTT (SEQ. ID. NO: 57) motif, inducing slightly higher NK
activity on average than 1968. However, ODN 2006, in which the
spacing between the GTCGTT (SEQ. ID. NO: 57) motifs was increased
by the addition of two Ts between each motif, was superior to ODN
2005 and to ODN 2007, in which only one of the motifs had the
additional of the spacing two Ts. The minimal acceptable spacing
between CpG motifs is one nucleotide as long as the ODN has two
pyrimidines (preferably T) at the 3' end (e.g., ODN 2015).
Surprisingly, joining two GTCGTT (SEQ. ID. NO: 57) motifs end to
end with a 5' T also created a reasonably strong inducer of NK
activity (e.g., ODN 2016). The choice of thymine (T) separating
consecutive CpG dinucleotides is not absolute, since ODN 2002
induced appreciable NK activation despite the fact that adenine (A)
separated its CpGs (i.e., CGACGTT; SEQ. ID. NO: 113). It should
also be noted that ODNs containing no CpG (e.g., ODN 1982), runs of
CpGs, or CpGs in bad sequence contents (e.g., ODN 2010) had no
stimulatory effect on NK activation.
10TABLE 10 ODN induction of NK Lytic Activity (LU) SEQ. ID. ODN
Sequence (5'-3') LU NO. Cells 0.01 -- alone 1754
ACCATGGACGATCTGTTTCCCCT- C 0.02 59 1758 TCTCCCAGCGTGCGCCAT 0.05 45
1761 TACCGCGTGCGACCCTCT 0.05 60 1776 ACCATGGACGAACTGTTTCCCCTC 0.03
61 1777 ACCATGGACGAGCTGTTTCCCCTC 0.05 62 1778
ACCATGGACGACCTGTTTCCCCTC 0.01 63 1779 ACCATGGACGTACTGTTTCCCCTC 0.02
64 1780 ACCATGGACGGTCTGTTTCCCCTC 0.29 65 1781
ACCATGGACGTTCTGTTTCCCCTC 0.38 66 1823 GCATGACGTTGAGCT 0.08 6 1824
CACGTTGAGGGGCAT 0.01 67 1825 CTGCTGAGACTGGAG 0.01 68 1828
TCAGCGTGCGCC 0.01 69 1829 ATGACGTTCCTGACGTT 0.42 70 1830.sup.2
RANDOM SEQUENCE 0.25 1834 TCTCCCAGCGGGCGCAT 0.00 71 1836
TCTCCCAGCGCGCGCCAT 0.46 72 1840 TCCATGTCGTTCCTGTCGTT 2.70 73 1841
TCCATAGCGTTCCTAGCGTT 1.45 74 1842 TCGTCGCTGTCTCCGCTTCTT 0.06 75
1851 TCCTGACGTTCCTGACGTT 2.32 76 .sup.1Lytic units (LU) were
measured as described (8). Briefly, PBMC were collected from normal
donors and spun over Ficoll, then cultured with or without the
indicated ODN (which were added to cultures at 6 .mu.g/ml) for 24
hr. Then their ability to lyse .sup.51Cr-labeled K562 cells was
determined. The results shown are typical of those obtained with
several different normal human donors. .sup.2This oligo mixture
contained a random selection of all 4 bases at each position.
[0134]
11TABLE 11 Induction of NK LU by Phosphorothioate CpG ODN with Good
Motifs SEQ. expt. expt. expt. ODN.sup.1 Sequence ID NO. 1 2 3 Cells
0.00 1.26 0.46 alone 1840 TCCATGTCGTTCCTGTCGTT 73 2.33 ND ND 1960
TCCTGTCGTTCCTGTCGTT 77 ND 0.48 8.99 1961 TCCATGTCGTTTTTGTCGTT 78
4.03 1.23 5.08 1962 TCCTGTCGTTCCTTGTCGTT 52 ND 1.60 5.74 1963
TCCTTGTCGTTCCTGTCGTT 121 3.42 ND ND 1965 TCCTGTCGTTTTTTGTCGTT 53
0.46 0.42 3.48 1966 TCGTCGCTGTCTCCGCTTCTT 75 2.62 ND ND 1967
TCGTCGCTGTCTGCCCTTCTT 54 5.82 1.64 8.32 1968 TCGTCGCTGTTGTCGTTTCTT
55 3.77 5.26 6.12 1979.sup.2 TCCATGTZGTTCCTGTZGTT 122 1.32 ND ND
1982 TCCAGGACTTCTCTCAGGTT 79 0.05 ND 0.98 1990 TCCATGCGTGCGTGCGTTTT
80 2.10 ND ND 1991 TCCATGCGTTGCGTTGCGTT 81 0.89 ND ND 2002
TCCACGACGTTTTCGACGTT 82 4.02 1.31 9.79 2005 TCGTCGTTGTCGTTGTCGTT 47
ND 4.22 12.75 2006 TCGTCGTTTTGTCGTTTTGTCGTT 123 ND 6.17 12.82 2007
TCGTCGTTGTCGTTTTGTCGTT 49 ND 2.68 9.66 2008 GCGTGCGTTGTCGTTGTCGTT
56 ND 1.37 8.15 2010 GCGGCGGGCGGCGCGCGCCC 83 ND 0.01 0.05 2012
TGTCGTTTGTCGTTTGTCGTT 48 ND 2.02 11.61 2013
TGTCGTTGTCGTTGTCGTTGTCGTT 84 ND 0.56 5.22 2014 TGTCGTTGTCGTTGTCGTT
50 ND 5.74 10.89 2015 TCGTCGTCGTCGTT 51 ND 4.53 10.13 2016
TGTCGTTGTCGTT 85 ND 6.54 8.06 .sup.1PBMC essentially as described
herein. Results are representative of 6 separate experiments; each
experiment represents a different donor. .sup.2This is the
methylated version of ODN 1840; Z = 5-methyl cytosine LU is lytic
units; ND = not done; CpG dinucleotides are underlined for
clarity.
[0135] Identification of Phosphorothioate ODN with Optimal CpG
Motifs for Activation of Human B Cell Proliferation.
[0136] The ability of a CpG ODN to induce B cell proliferation is a
good measure of its adjuvant potential. Indeed, ODN with strong
adjuvant effects generally also induce B cell proliferation. To
determine whether the optimal CpG ODN for inducing B cell
proliferation are the same as those for inducing NK cell activity,
similar panels of ODN (Table 12) were tested. The most consistent
stimulation appeared with ODN 2006 (Table 12).
12TABLE 12 UZ,2/43 Induction of Human B Cell Proliferation by
Phosphorothioate CpG ODN Stimulation Index.sup.1 SEQ. ID. expt.
expt. expt. expt. expt. DN Sequence (5'-3') NO. 1 2 3 4 5 1840
TCCATGTCGTTCCTGTCGTT 73 4 ND ND ND ND 1841 TCCATAGCGTTCCTAGCGTT 74
3 ND ND ND ND 1960 TCCTGTCGTTCCTGTCGTT 77 ND 2.0 2.0 3.6 ND 1961
TCCATGTCGTTTTTGTCGTT 78 2 3.9 1.9 3.7 ND 1962 TCCTGTCGTTCCTTGTCGTT
52 ND 3.8 1.9 3.9 5.4 1963 TCCTTGTCGTTCCTGTCGTT 121 3 ND ND ND ND
1965 TCCTGTCGTTTTTTGTCGTT 53 4 3.7 2.4 4.7 6.0 1967
TCGTCGCTGTCTGCCCTTCTT 54 ND 4.4 2.0 4.5 5.0 1968
TCGTCGCTGTTGTCGTTTCTT 55 ND 4.0 2.0 4.9 8.7 1982
TCCAGGACTTCTCTCAGGTT 79 3 1.8 1.3 3.1 3.2 2002 TCCACGACGTTTTCGACGTT
86 ND 2.7 1.4 4.4 ND 2005 TCGTCGTTGTCGTTGTCGTT 47 5 3.2 1.2 3.0 7.9
2006 TCGTCGTTTTGTCGTTTTGTCGTT 46 4 4.5 2.2 5.8 8.3 2007
TCGTCGTTGTCGTTTTGTCGTT 49 3 4.0 4.2 4.1 ND 2008
GCGTGCGTTGTCGTTGTCGTT 56 ND 3.0 2.4 1.6 ND 2010
GCGGCGGGCGGCGCGCGCCC 83 ND 1.6 1.9 3.2 ND 2012
TGTCGTTTGTCGTTTGTCGTT 48 2 2.8 0 3.2 ND 2013
TGTCGTTGTCGTTGTCGTTGTCGTT 84 3 2.3 3.1 2.8 ND 2014
TGTCGTTGTCGTTGTCGTT 50 3 2.5 4.0 3.2 6.7 2015 TCGTCGTCGTCGTT 51 5
1.8 2.6 4.5 9.4 2016 TGTCGTTGTCGTT 85 ND 1.1 1.7 2.7 7.3
.sup.1Cells = human spleen cells stored at -70.degree. C. after
surgical harvest or PBMC collected from normal donors and spun over
Ficoll. Cells were cultured in 96 well U-bottom microtiter plates
with or without the indicated ODN (which were added to cultures at
6 .mu.ml). N = 12 experiments. Cells were cultured for 4-7 days,
pulsed with 1 .mu.Ci of .sup.3H thymidine for 18 hr. before harvest
and scintillation counting. Stimulation index = the ratio of cpm in
wells # without ODN to that in wells that had been stimulated
throughout the culture period with the indicated ODN (there were no
further additions of ODN after the cultures were set up). ND = not
done.
[0137] Identification of Phosphorothioate ODN that Induce Human
IL-12 Secretion
[0138] The ability of a CpG ODN to induce IL-12 secretion is a good
measure of its adjuvant potential, especially in terms of its
ability to induce a Th1 immune response, which is highly dependent
on IL-12. Therefore, the ability of a panel of phosphorothioate ODN
to induce 0IL-12 secretion from human PBMC in vitro (Table 13) was
examined. These experiments showed that in some human PBMC, most
CpG ODN could induce IL-12 secretion (e.g., expt. 1). However,
other donors responded to just a few CpG ODN (E.g., expt. 2). ODN
2006 was a consistent inducer of IL12 secretion from most subjects
(Table 13).
13TABLE 13 Induction of Human IL-2 Secretion by Phosphorothioate
CpG ODN SEQ. IL-12 (pg/ml) ID expt. expt. ODN.sup.1 Sequence
(5'-3') NO. 1 2 Cells 0 0 alone 1962 TCCTGTCGTTCCTTGTCGTT 52 19 0
1965 TCCTGTCGTTTTTTGTCGTT 53 36 0 1967 TCGTCGCTGTCTGCCCTTCTT 54 41
0 1968 TCGTCGCTGTTGTCGTTTCTT 55 24 0 2005 TCGTCGTTGTCGTTGTCGTT 47
25 0 2006 TCGTCGTTTTGTCGTTTTGTCGTT 46 29 15 2014
TGTCGTTGTCGTTGTCGTT 50 28 0 2015 TCGTCGTCGTCGTT 51 14 0 2016
TGTCGTTGTCGTT 85 3 0 .sup.1PBMC were collected from normal donors
and spun over Ficoll, then cultured at 10.sup.6 cells/wel in 96
with microliter plates with or without the indicated ODN which were
added to culutures at .mu.g/ml. Supernatants were collected at 24
hr. and tested for IL-12 levels by ELISA as described methods. A
standard curver was run in each experiment, which represents a
different donor.
[0139] Identification of B Cell and Monocyte/NK Cell-Specific
Oligonucleotides
[0140] As shown in FIG. 6, CpG DNA can directly activate highly
purified B cells and monocytic cells. There are many similarities
in the mechanism through which CpG DNA activates these cell types.
For example, both require NFKB activation as explained further
below.
[0141] In further studies of different immune effects of CpG DNA,
it was found that there is more than one type of CpG motif.
Specifically, olio 1668, with the best mouse B cell motif, is a
strong inducer of both B cell and natural killer (NK) cell
activation, while olio 1758 is a weak B cell activator, but still
induces excellent NK responses (Table 14).
14TABLE 14 Different CpG Motifs Stimulate Optimal Murine B Cell and
NK Activation B Cell NK ODN Sequence Activation Activation.sup.2
1668 TCCATGACGTTCCTGATGCT 42,849 2.52 (SEQ.ID.NO:7) 1758
TCTCCCAGCGTGCGCCAT 1,747 6.66 (SEQ.ID.NO.45) NONE 367 0.00 CpG
diuncleotides are underlined; oligonucleotides are synthesized with
photphorothioate modified backbones to improve their nuclease
resistance. .sup.1Measured by .sup.3H thymidine incorporation after
48 hr. culture with oligodeoxynucleotides at a 200 nM concentration
as described in Example 1. .sup.2Measured in lytic units.
[0142] Teleological Basis of Immunostimulatory Nucleic Acids
[0143] Vertebrate DNA is highly methylated and CpG dinucleotides
are under represented. However, the stimulatory CpG motif is common
in microbial genomic DNA, but quite rare in vertebrate DNA. In
addition, bacterial DNA has been reported to induce B cell
proliferation and immunoglobulin (Ig) production, while mammalian
DNA does not (Messina, J. P. et al., J. Immunol. 147:1759 (1991)).
Experiments further described in Example 3, in which methylation of
bacterial DNA with CpG methylase was found to abolish mitogenicity,
demonstrates that the difference in CpG status is the cause of B
cell stimulation by bacterial DNA. This data supports the following
conclusion: that unmethylated CpG dinucleotides present within
bacterial DNA are responsible for the stimulatory effects of
bacterial DNA.
[0144] Teleologically, it appears likely that lymphocyte activation
by the CpG motif represents an immune defense mechanism that can
thereby distinguish bacterial from host DNA. Host DNA, which would
commonly be present in many anatomic regions and areas of
inflammation due to apoptosis (cell death), would generally induce
little or mo lymphocyte activation due to CpG suppression and
methylation. However, the presence of bacterial DNA containing
unmethylated CpG motifs can cause lymphocyte activation precisely
in infected anatomic regions, where it is beneficial. This novel
activation pathway provides a rapid alternative to T cell dependent
antigen specific B cell activation. Since the CpG pathway
synergizes with B cell activation through the antigen receptor, B
cells bearing antigen receptor specific for bacterial antigens
would receive on e activation signal through cell membrane Ig and a
second signal from bacterial DNA, and would therefore tend to be
preferentially activated. The interrelationship of this pathway
with other pathways of B cell activation provide a physiologic
mechanism employing a polyclonal antigen to induce antigen-specific
responses.
[0145] However, it is likely that B cell activation would not be
totally nonspecific. B cells bearing antigen receptors specific for
bacterial products could receive one activation signal through cell
membrane Ig, and a second from bacterial DNA, thereby more
vigorously triggering antigen specific immune responses. As with
other immune defense mechanisms, the response to bacterial DNA
could have undesirable consequences in some settings. For example,
autoimmune responses to self antigens would also tend to be
preferentially triggered by bacterial infections, since
autoantigens could also provide a second activation signal to
autoreactive B cells triggered by bacterial DNA. Indeed the
induction of autoimmunity by bacterial infections is a common
clinical observance. For example, the autoimmune disease systemic
lupus erythematosus, which is: i) characterized by the production
of anti-DNA antibodies; ii) induced by drugs which inhibit DNA
methyltransferase (Comaccia, E. J. et al., J. Clin. Invest. 92:38
(1993)); and iii) associated with reduced DNA methylation
(Richardson, B., L. et al., Arth. Rheum 35:647 (1992)), is likely
triggered at least in part by activation of DNA-specific B cells
through stimulatory signals provided by CpG motifs, as well as by
binding of bacterial DNA to antigen receptors.
[0146] Further, sepsis, which is characterized by high morbidity
and mortality due to massive and nonspecific activation of the
immune system may be initiated by bacterial DNA and other products
released from dying bacteria that reach concentrations sufficient
to directly activate many lymphocytes. Further evidence of the role
of CpG DNA in the sepsis syndrome is described in Cowdery, J., et.
al., (1996) the Journal of Immunology 156:4570-4575.
[0147] Unlike antigens that trigger B cells through their surface
Ig receptor, CpG-ODN did not induce any detectable Ca.sup.2+ flux,
changes in protein tyrosine phosphorylation, or IP 3 generation.
Flow cytometry with FITC-conjugated ODN with or without a CpG motif
was performed as described in Zhao, Q et al., (Antisense Research
and Development 3:53-66 (1993)), and showed equivalent membrane
binding, cellular uptake, efflux, and intracellular localization.
This suggests that there may not be cell membrane proteins specific
for CpG ODN. Rather than acting through the cell membrane, that
data suggests that unmethylated CpG containing oligonucleotides
require cell uptake for activity: ODN covalently linked to a solid
Teflon support were nonstimulatory, as were biotinylated ODN
immobilized on either avidin beads or avidin coated petri dishes.
CpG ODN conjugated to either FITC or biotin retained full mitogenic
properties, indicated no stearic hindrance.
[0148] Recent data indicate the involvement of the transcription
factor NFKB as a direct or indirect mediator of the CpG effect. For
example, within 15 minutes of treating B cells or monocytes with
CpG DNA, the level of NFkB binding activity is increased (FIG. 7).
However, it is not increased by DNA that does not contain CpG
motifs. In addition, it was found that two different inhibitors of
NFkB activation, PDTC and gliotoxin, completely block the
lymphocyte stimulation by CpG DNA as measured by B cell
proliferation or monocytic cell cytokine secretion, suggesting that
NFKB activation is required for both cell types.
[0149] There are several possible mechanisms through which NFKB can
be activated. These include through activation of various protein
kinases, or through the generation of reactive oxygen species. No
evidence for protein kinase activation induced immediately after
CpG DNA treatment of B cells or monocytic cells have been found,
and inhibitors of protein kinase A, protein kinase C, and protein
tyrosine kinases had no effects on the CpG induced activation. k
However, CpG DNA causes a rapid induction of the production of
reactive oxygen species in both B cells and monocytic cells, as
detected by the sensitive fluorescent dye dihydrorhodamine 123 as
described in Royall, J. A., and Ischiropoulos, H. (Archives of
Biochemistry and Biophysics 302:348-355 (1993)). Moreover,
inhibitors of the generation of these reactive oxygen species
completely block the induction of NFKB and the later induction of
cell proliferation and cytokine secretion by CpG DNA.
[0150] Work backwards, the next question was how CpG DNA leads to
the generation of reactive oxygen species so quickly. Previous
studies by the inventors demonstrated that oligonucleotides and
plasmid or bacterial DNA are taken up by cells into endosomes.
These endosomes rapidly become acidified inside the cell. To
determine whether this acidification step may be important in the
mechanism through which CpG DNA activates reactive oxygen species,
the acidification step was blocked with specific inhibitors of
endosome acidification including chloroquine, monensin, and
bafilomycin, which work through different mechanisms. FIG. 8A shows
the results from a flow cytometry study using mouse B cells with
the dihydrorhodamine 123 dye to determine levels of reactive oxygen
species. The dye only sample in Panel A of the figure shows the
background level of cells positive for the dye at 28.6%. as
expected, this level of reactive oxygen species was greatly
increased to 80% in the cells treated for 20 minutes with PMA and
ionomycin, a positive control (Panel B). The cells treated with the
CpG oligo also showed an increase in the level of reactive oxygen
species such that more than 50% of the cells became positive (Panel
D). However, cells treated with an oligonucleotide with the
identical sequence except that the CpG was switched did not show
this significant increase in the level of reactive oxygen species
(Panel E).
[0151] In the presence of chloroquine, the results are very
different (FIG. 8B). Chloroquine slightly lowers the background
level of reactive oxygen species in the cells such that the
untreated cells in Panel A have only 4.3% that are positive.
Chloroquine completely abolishes the induction of reactive oxygen
species in the cells treated with CpG DNA (Panel B) but does not
reduce the level of reactive oxygen species in the cells treated
with PMA and ionomycin (Panel E). This demonstrates that unlike the
PMA plus ionomycin, the generation of reactive oxygen species
following treatment of B cells with CpG DNA requires that the DNA
undergo an acidification step in the endosomes. This is a
completely novel mechanism of leukocyte activation. Chloroquine,
monensin, and bafilomycin also appear to block the activation of
NFkB by CpG DNA as well as the subsequent proliferation and
induction of cytokine secretion.
[0152] Chronic Immune Activation by CpG DNA and Autoimmune
Disorders
[0153] B cell activation by CpG DNA synergizes with signals through
the B cell receptor. This raises the possibility that DNA-specific
B cells may be activated by the concurrent binding of bacterial DNA
to their antigen receptor, and by the co-stimulatory CpG-mediated
signals. In addition, CpG DNA induces B cells to become resistant
to apoptosis, a mechanism thought to be important for preventing
immune responses to self antigens, such as DNA. Indeed, exposure to
bDNA can trigger anti-DNA Ab production. Given this potential
ability of CpG DNA to promote autoimmunity, it is therefore
noteworthy that patients with the autoimmune disease systemic lupus
erythematosus have persistently elevated levels of circulating
plasma DNA which is enriched in hypomethylated CpGs. These findings
suggest a possible role for chronic immune activation by CpG DNA in
lupus etiopathogenesis.
[0154] A class of medications effective in the treatment of lupus
is antimalarial drugs, such as chloroquine. While the therapeutic
mechanism of these drugs has been unclear, they are known to
inhibit endosomal acidification. Leukocyte activation by CpG DNA is
not medicated through binding to a cell surface receptor, but
requires cell uptake, which occurs via adsorptive endocytosis into
an acidified chloroquine-sensitive intracellular compartment. This
suggested the hypothesis that leukocyte activation by CpG DNA may
occur in association with acidified endosomes, and might even be pH
dependent. To test this hypothesis specific inhibitors of DNA
acidification were applied to determine whether B cells or
monocytes could respond to CpG DNA if endosomal acidification was
prevented.
[0155] The earliest leukocyte activation event that was detected in
response to CpG DNA is the production of reactive oxygen species
(ROS), which is induced within five minutes in primary spleen cells
and both B and monocyte cell lines. Inhibitors of endosomal
acidification including chloroquine, bafilomycin A, and monensin,
which have different mechanisms of action, blocked the CpG-induced
generation of ROS, but had no effect on ROS generation mediated by
PMA, or ligation of CD40 or IgM. These studies show that ROS
generation is a common event in leukocyte activation through
diverse pathways. This ROS generation is generally independent of
endosomal acidification, which is required only for the ROS
response to CpG DNA. ROS generation in response to CpG is not
inhibited by the NFKB inhibitor gliotoxin, confirming that it is
not secondary to NFKB activation.
[0156] To determine whether endosomal acidification of CpG DNA was
also required for its other immune stimulatory effects were
performed. Both LPS and CpG DNA induce similar rapid NF.kappa.B
activation, increases in proto-oncogene mRNA levels, and cytokine
secretion. Activation of NF.kappa.B by DNA depended on CpG motifs
since it was not induced by bDNA treated with CpG methylase, nor by
ODN in which bases were switched to disrupt the CpGs. Supershift
experiments using specific antibodies indicated that the activated
NF.kappa.B complexes included the p50 and p65 components. Not
unexpectedly, NF.kappa.B activation in LPS- or CpG-treated cells
was accompanied by the degradation of I.kappa.B.alpha. and
I.kappa.B.beta.. However, inhibitors of endosomal acidification
selectively blocked all of the CpG-induced but none of the
LPS-induced cellular activation events. The very low concentration
of chloroquine (<10 .mu.M) that has been determined to inhibit
CpG-mediated leukocyte activation is noteworthy since it is well
below that required for antimalarial activity and other reported
immune effects (e.g., 100-1000 .mu.M). These experiments support
the role of a pH-dependent signaling mechanism in mediating the
stimulatory effects of CpG DNA.
15TABLE 15 Specific blockade of CpG-induced TNF-.alpha. and IL-12
expression by inhibitors of endosomal acidification or NF.kappa.B
activation Inhibitors: Glio- Bisglio- Bafilomycin Chloroquine
Monensin NAC TPCK toxin toxin Medium (250 nM) (2.5 .mu.g/ml) (10
.mu.M) (50 mM) (50 .mu.M) (0.1 .mu.g/ml) (0.1 .mu.g/ml) activators
TNF-.alpha. IL-12 TNF-.alpha. IL-12 TNF-.alpha. IL-12 TNF-.alpha.
IL-12 TNF-.alpha. TNF-.alpha. TNF-.alpha. TNF-.alpha. Medium 37 147
46 102 27 20 22 73 10 24 17 41 CpG 455 17,114 71 116 28 6 49 777 54
23 31 441 ODN LPS 901 22,485 1370 4051 1025 12418 491 4796 417 46
178 1120 Table 15 legend IL-12 and TNF-.alpha. assays: The murine
monocyte cell line J774 (1 .times. 10.sup.5 cells/ml for IL-12 or 1
.times. 10.sup.6 cells/ml for TNF-.alpha.), were cultured with or
without the indicated inhibitors at the concentrations shown for 2
hr and then stimulated with the CpG oligodeoxynucleotide (ODN) 1826
(TCCATGACGTTCCTGACGTT SEQ ID NO: 10) at 2 .mu.M or LPS (10
.mu.g/ml) for 4 hr (TNF-.alpha.) or 24 hr (IL-12) at which time the
supernatant was # harvested. ELISA for IL-12 or TNF-.alpha. (pg/ml)
was performed on the supernatants essentially as described (A. K.
Krieg, A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R.
Teasdale, G. Koretzky and D. Klinman, Nature 374, 546 (1995); Yi,
A.-K., D. M. Klinman, T. L. Martin, S. Matson and A. M. Krieg, J.
Immunol., 157, 5394-5402 (1996); Krieg, A. M., J. Lab. Clin. Med.,
128, 128-133 (1996). Cells cultured with ODN that lacked CpG #
motifs did not induce cytokine secretion. Similar specific
inhibition of CpG responses was seen with IL-6 assays, and in
experiments using primary spleen cells or the B cell lines CH12.LX
and WEHI-231.2.5 .mu.g/ml of chloroquine is equivalent to <5
.mu.M. Other inhibitors of NF-.kappa.B activation including PDTC
and calpain inhibitors I and II gave similar results to the
inhibitors shown. The results shown are representative of those
obtained in ten # different experiments.
[0157] Excessive immune activation by CpG motifs may contribute to
the pathogenesis of the autoimmune disease systemic lupus
erythematosus, which is associated with elevated levels of
circulating hypomethylated CpG DNA. Chloroquine and related
antimalarial compounds are effective therapeutic agents for the
treatment of systemic lupus erythematosus and some other autoimmune
diseases, although their mechanism of action has been obscure. Our
demonstration of the ability of extremely low concentrations of
chloroquine to specifically inhibit CpG-mediated leukocyte
activation suggests a possible new mechanism for its beneficial
effect. It is noteworthy that lupus recurrences frequently are
thought to be triggered by microbial infection. Levels of bDNA
present in infected tissues can be sufficient to induce a local
inflammatory response. Together with the likely role of CpG DNA as
a mediator of the sepsis syndrome and other diseases our studies
suggest possible new therapeutic applications for the antimalarial
drugs that act as inhibitors of endosomal acidification.
[0158] CpG-induced ROS generation could be an incidental
consequence of cell activation, or a signal that mediates this
activation. The ROS scavenger N-acetyl-L-cysteine (NAC) blocks
CpG-induced NFKB activation, cytokine production, and B cell
proliferation, suggesting a casual role for ROS generation in these
pathways. These data are compatible with previous evidence
supporting a role for ROS in the activation of NF.kappa.B. WEHI-231
B cells (5.times.10.sup.5 cells/ml) were precultured for 30 minutes
with or without chloroquine (5 .mu.g/ml [<10 .mu.M]) or
gliotoxin (0.2 .mu.g/ml). Cell aliquots were then cultured as above
for 10 minutes in RPMI medium with or without a CpG ODN (1826) or
non-CpG ODN (1911) at 1 .mu.M or phorbol myristate acetate (PMA)
plus ionomycin (iono). Cells were then stained with
dihydrorhodamine-123 and analyzed for intracellular ROS production
by flow cytometry as described (A. K. Krieg, A.-K. Yi, S. Matson,
T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. Koretzky and D.
Klinman, Nature 374, 546 (1995); Yi, A.-K., D. M. Klinman, T. L.
Martin, S. Matson and A. M. Krieg, J. Immunol., 157, 5394-5402
(1996); Krieg, A. M, J. Lab. Clin. Med., 128, 128-133 (1996)).
J1774 cells, a monocytic line, showed similar pH-dependent CpG
induced ROS responses. In contrast, CpG DNA did not induce the
generation of extracellular ROS, nor any detectable neutrophil ROS.
The concentrations of chloroquine (and those used with the other
inhibitors of endosomal acidification) prevented acidification of
the internalized CpG DNA using fluorescein conjugated ODN as
described by Tonkinson, et al., (Nucl. Acids Res. 22, 4268 (1994);
A. M. Krieg, In: Delivery Strategies for Antisense Oligonucleotide
Therapeutics. Editor, S. Akhtar, CRC Press, Inc., pp. 177(1995)).
At higher concentrations than those required to inhibit endosomal
acidification, nonspecific inhibitory effects were observed. Each
experiment was performed at least three times with similar
results.
[0159] While NF.kappa.B is known to be an important regulator of
gene expression, it's role in the transcriptional response to CpG
DNA was uncertain. To determine whether this NF.kappa.B activation
was required for the CpG mediated induction of gene expression
cells were activated with CpG DNA in the presence or absence of
pyrrolidine dithiocarbamate (PDTC), an inhibitor of IKB
phosphorylation. These inhibitors of NFKB activation completely
blocked the CpG-induced expression of protooncogene and cytokine
mRNA and protein, demonstrating the essential role of NFKB as a
mediator of these events. None of the inhibitors reduced cell
viability under the experimental conditions used in these studies.
A J774, a murine monocyte cell line, was cultured in the presence
of calf thymus (CT), E. Coli (EC), or methylated E. Coli (mEC) DNA
(methylated with CpG methylase as described) at 5 .mu.g/ml or a CpG
oligodeoxynucleotide (ODN 1826; Table 15) or a non-CpG ODN (ODN
1745; TCCATGAGCTTCCTGAGTCT, SEQ. ID. NO: 8) at 0.75 .mu.M for 1 hr,
following which the cells were lysed and nuclear extracts prepared.
A double stranded ODN containing a consensus NF.kappa.B site was 5'
radiolabeled and used as a probe for EMSA essentially as described
(J. D. Dignam, R. M. Lebovitz and R. G. Roeder, Nucleic Acids Res.
11, 1475 (1983); M. Briskin, M. Damore, R. Law, G. Lee, P. W.
Kincade, C. H. Sibley, M. Kuehl and R. Wall, Mol. Cell. Biol. 10,
422 (1990)). The position of the p50/p65 heterodimer was determined
by supershifting with specific Ab to p65 and p50 (Santa Cruz
Biotechnology, Santa Cruz, Calif.). Chloroquine inhibition of
CpG-induced but not LPS-induced NFKB activation was established
using J774 cells. The cells were precultured for 2 hr in the
presence or absence of chloroquine (20 .mu.g/ml) and then
stimulated as above for 1 hr with either EC DNA, CpG ODN, non-CpG
ODN or LPS (1 .mu.g/ml). Similar chloroquine sensitive CpG-induced
activation of NFKB was seen in a B cell line, WEHI-231 and primary
spleen cells. These experiments were performed three times over a
range of chloroquine concentrations form 2.5 to 20 .mu.g/ml with
similar results.
[0160] It was also established that CpG-stimulated mRNA expression
requires endosomal acidification and NF.kappa.B activation in B
cells and monocytes. J774 cells (2.times.10.sup.6 cells/ml) were
cultured for 2 hr in the presence or absence of chloroquine (2.5
.mu.g/ml [<5 .mu.M]) or N-tosyl-L-phenylalanine chlorometryl
ketone (TPCK: 50 .mu.M), a serine/threonine protease inhibitor that
prevents I.kappa.B proteolysis and thus blocks NF.kappa.B
activation. Cells were then stimulated with the addition of E. Coli
DNA (EC: 50 pg/ml), calf thymus DNA (CT: 50 .mu.g/ml), LPS (10
.mu.g/ml), CpG ODN (1826; 1 .mu.M), or control non CpG ODN (1911; 1
.mu.M) for 3 hr. WEHI-231 B cells (5.times.10.sup.5 cells/ml) were
cultured in the presence or absence of gliotoxin (0.1 .mu.g/ml) or
bisgliotoxin (0.1 .mu.g/ml) for 2 hrs and then stimulated with a
CpG ODN (1826), or control non-CpG ODN (1911; TCCAGGACTTTCCTCAGGTT,
SEQ. ID. NO.97) at 0.5 .mu.M for 8 hr. In both cases, cells were
harvested and RNA was prepared using RNAzol following the
manufacturer's protocol. Multi-probe RNASE protection assay was
performed as described (A.-K. Yi, P. Hornbeck, D. E. Lafrenz and A.
M. Krieg, J Immunol., 157,4918-4925 (1996). Comparable amounts of
RNA were loaded into each lane by using ribosomal mRNA as a loading
control (L32). These experiments were performed three times with
similar results.
[0161] The results indicate that leukocytes respond to CpG DNA
through a novel pathway involving the pH-dependent generation of
intracellular ROS. The pH dependent step may be the transport or
processing of the CpG DNA, the ROS generation, or some other event.
ROS are widely thought to be second messengers in signaling
pathways in diverse cell types, but have not previously been shown
to mediate a stimulatory signal in B cells.
[0162] Presumably, there is a protein in or near the endosomes that
specifically recognizes DNA containing CpG motifs and leads to the
generation of reactive oxygen species. To detect any protein in the
cell cytoplasm that may specifically bind CpG DNA, electrophoretic
mobility shift assays (EMSA) were used with 5' radioactively
labeled oligonucleotides with or without CpG motifs. A band was
found that appears to represent a protein binding specifically to
single stranded oligonucleotides that have CpG motifs, but not to
oligonucleotides that lack CpG motifs or to oligonucleotides in
which the CpG motif has been methylated. This binding activity is
blocked if excess of oligonucleotides that contain the NF.kappa.B
binding site was added. This suggests that an NF.kappa.B or related
protein is a component of a protein or protein complex that binds
the stimulatory CpG oligonucleotides.
[0163] No activation of CREB/ATF proteins was found at time points
where NF.kappa.B was strongly activated. These data therefore do
not provide proof the NF.kappa.B proteins actually bind to the CpG
nucleic acids, but rather that the proteins are required in some
way for the CpG activity. It is possible that a CREB/ATF or related
protein may interact in some way with NF.kappa.B proteins or other
proteins thus explaining the remarkable similarity in the binding
motifs for CREB proteins and the optimal CpG motif. It remains
possible that the oligos bind to a CREB/ATF or related protein, and
that this leads to NFKB activation.
[0164] Alternatively, it is very possible that the CpG nucleic
acids may bind to one of the TRAF proteins that bind to the
cytoplasmic region of CD40 and mediate NFKB activation when CD40 is
cross-linked. Examples of such TRAF proteins include TRAF-2 and
TRAF-5.
[0165] Method for Making Immunostimulatory Nucleic Acids
[0166] For use in the instant invention, nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the b-cyanoethyl phosphoramidite method
(S. L. Beaucage and M. H. Caruthers, (1981) Tet. Let. 22:1859);
nucleoside H-phosphonate method (Garegg et al., (1986) Tet. Let.
27:4051-4054; Froehler et al., (1986) Nucl. Acid. Res 14:5399-5407;
Garegg eg al., (1986) Tet. Let. 27:4055-4058, Gaffhey et al.,
(1988) Tet. Let. 29:2619-2622). These chemistries can be performed
by a variety of automated oligonucleotide synthesizers available in
the market. Alternatively, oligonucleotides can be prepared from
existing nucleic acid sequences (e.g. genomic or cDNA) using known
techniques, such as those employing restriction enzymes,
exonucleases or endonucleases.
[0167] For use in vivo, nucleic acids are preferably relatively
resistant to degradation (e.g. via endo- and exo-nucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications. A preferred stabilized nucleic acid has at least a
partial phosphorothioate modified backbone. Phosphorothioates may
be synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made e.g. as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. And Peyman, A. (1990) Chem. Rev. 90:544;
Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2'-O-methyl nucleic
acids with CpG motifs also cause immune activation, as do
ethoxy-modified CpG nucleic acids. In fact, no backbone
modifications have been found that completely abolish the CpG
effect, although it is greatly reduced by replacing the C with a
5-methyl C.
[0168] For administration in vivo, nucleic acids may be associated
with a molecule that results in higher affinity binding to target
cell (e.g. B-cell, monocytic cell and natural killer (NK) cell)
surfaces and/or increased cellular uptake by target cells to form a
"nucleic acid delivery complex". Nucleic acids can be ionically, or
covalently associated with appropriate molecules using techniques
which are well known in the art. A variety of coupling or
crosslinking agents can be sued e.g. Protein A, carbodiimide, and
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Nucleic acids
can alternatively be encapsulated in liposomes or virosomes using
well-known techniques.
[0169] Therapeutic Uses of Immunostimulatory Nucleic Acid
Molecules
[0170] Based on their immunostimulatory properties, nucleic acid
molecules containing at least one unmethylated CpG dinucleotide can
be administered to a subject in vivo to treat an "immune system
deficiency". Alternatively, nucleic acid molecules containing at
least one unmethylated CpG dinucleotide can be contacted with
lymphocytes (e.g. B cells, monocytic cells or NK cells) obtained
from a subject having an immune system deficiency ex vivo and
activated lymphocytes can then be re-implanted in the subject.
[0171] As reported herein, in response to unmethylated CpG
containing nucleic acid molecules, an increased number of spleen
cells secrete IL-6, IL-12, IFN.gamma., IFN-.alpha., IFN-.beta.,
IL-1, IL-3, IL-10, TNF-.alpha., TNF-.beta., GM-CSF, RANTES, and
probably others. The increased IL-6 expression was found to occur
in B cells, CD4.sup.+T cells and monocytic cells.
[0172] Immunostimulatory nucleic acid molecules can also be
administered to a subject in conjunction with a vaccine to boost a
subject's immune system and thereby effect a better response from
the vaccine. Preferably the immunostimulatory nucleic acid molecule
is administered slightly before or at the same time as the vaccine.
A conventional adjuvant may optionally be administered in
conjunction with the vaccine, which is minimally comprised of an
antigen, as the conventional adjuvant may further improve the
vaccination by enhancing antigen absorption.
[0173] When the vaccine is a DNA vaccine at least two components
determine its efficacy. First, the antigen encoded by the vaccine
determines the specificity of the immune response. Second, if the
backbone of the plasmid contains CpG motifs, its functions as an
adjuvant for the vaccine. Thus, CpG DNA acts as an effective
"danger signal" and causes the immune system to respond vigorously
to new antigens in the area. This mode of action presumably results
primarily from the stimulatory local effects of CpG DNA on
dendritic cells and other "professional" antigen presenting cells,
as well as from the co-stimulatory effects on B cells.
[0174] Immunostimulatory oligonucleotides and unmethylated CpG
containing vaccines, which directly activate lymphocytes and
co-stimulate an antigen-specific response, are fundamentally
different from conventional adjuvants (e.g. aluminum precipates),
which are inert when injected alone and are thought to work through
absorbing the antigen and thereby presenting it more effectively to
immune cells. Further conventional adjuvants only work for certain
antigens, only induce an antibody (humoral) immune response (Th2),
and are very poor at inducing cellular immune responses (Th1). For
many pathogens, the humoral response contributes little to
protection, and can even be detrimental.
[0175] In addition, an immunostimulatory oligonucleotide can be
administered prior to along with or after administration of a
chemotherapy or immunotherapy to increase the responsiveness of the
malignant cells to subsequent chemotherapy or immunotherapy or to
speed the recovery of the bone marrow through induction of
restorative cytokines such as GM-CSF. CpG nucleic acids also
increase natural killer cell lytic activity and antibody dependent
cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may
likewise be beneficial in cancer immunotherapy, alone or in
conjunction with other treatments.
[0176] Another use of the described immunostimulatory nucleic acid
molecules is in desensitization therapy for allergies, which are
generally caused by IgE antibody generation against harmless
allergens. The cytokines that are induced by unmethylated CpG
nucleic acids are predominantly of a class called "Th1" which is
most marked; by a cellular immune response and is associated with
Il-12 and IFN-.gamma.. The other major type of immune response is
termed a Th2 immune response, which is associated with more of an
antibody immune response and with the production of IL-4, Il-5 and
IL-10. In general, it appears that allergic diseases are mediated
by Th2 type immune responses and autoimmune diseases by Th1 immune
response. Based on the ability of the immunostimulatory nucleic
acid molecules to shift the immune response in a subject from a Th2
(which is associated with production of IgE antibodies and allergy)
to a Th1 response (which is protective against allergic reactions),
an effective dose of an immunostimulatory nucleic acid (or a vector
containing a nucleic acid) alone or in conjunction with an allergen
can be administered to a subject to treat or prevent an
allergy.
[0177] Nucleic acids containing unmethylated CpG motifs may also
have significant therapeutic utility in the treatment of asthma.
Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways
of asthmatic subjects. These cytokines promote important aspects of
the asthmatic inflammatory response, including IgE isotype
switching, eosinophil chemotaxis and activation and mast cell
growth. Th1 cytokines, especially IFN-.gamma. and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines.
[0178] As described in detail in the following Example 12,
oligonucleotides containing an unmethylated CpG motif (I,e,.
TCCATGACGTTCCTGACGTT; SEQ ID NO. 10) but not a control
oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO. 8) prevented the
development of an inflammatory cellular infiltrate and eosinophilia
in a murine model of asthma. Furthermore, the suppression of
eosinophilic inflammation was associated with a suppression of a
Th2 response and induction of a Th1 response.
[0179] For use in therapy, an effective amount of an appropriate
immunostimulatory nucleic acid molecule alone or formulated as a
delivery complex can be administered to a subject by any mode
allowing the oligonucleotide to be taken up by the appropriate
target cells (e.g., B-cells and monocytic cells). Preferred routes
of administration include oral and transdermal (e.g., via a patch).
Examples of other routes of administration include injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.). The injection can be in a bolus or a continuous
infusion.
[0180] A nucleic acid alone or as a nucleic acid delivery complex
can be administered in conjunction with a pharmaceutically
acceptable carrier. As used herein, the phrase "pharmaceutically
acceptable carrier" is intended to include substances that can be
coadministered with a nucleic acid or a nucleic acid delivery
complex and allows the nucleic acid to perform its indicated
function. Examples of such carriers include solutions, solvents,
dispersion media, delay agents, emulsions and the like. The use of
such media for pharmaceutically active substances are well known in
the art. Any other conventional carrier suitable for use with the
nucleic acids falls within the scope of the instant invention.
[0181] The term "effective amount" of a nucleic acid molecule
refers to the amount necessary or sufficient to realize a desired
biologic effect. For example, an effective amount of a nucleic acid
containing at least one unmethylated CpG for treating an immune
system deficiency could be that amount necessary to eliminate a
tumor, cancer, or bacterial, viral or fungal infection. An
effective amount for use as a vaccine adjuvant could be the amount
useful for boosting a subjects immune response to a vaccine. An
"effective amount" for treating asthma can be that amount; useful
for redirecting a Th2 type of immune response that is associated
with asthma to a Th1 type of response. The effective amount for any
particular application can vary depending on such factors as the
disease or condition being treated, the particular nucleic acid
being administered (e.g. the number of unmethylated CpG motifs or
their location in the nucleic acid), the size of the subject, or
the severity of the disease or condition. One of ordinary skill in
the art can empirically determine the effective amount of a
particular oligonucleotide without necessitating undue
experimentation.
[0182] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Example 1
Effects of ODNs on B Cell Total RNA Synthesis and Cell Cycle
[0183] B cells were purified from spleens obtained from 6-12 week
old specific pathogen free DBA/2 or BXSB mice (bred in the
University of Iowa animal care facility; no substantial strain
differences were noted) that were depleted of T cells with
anti-Thy-1.2 and complement and centrifugation over lymphocyte M
(Cedarlane Laboratories, Hornby, Ontario, Canada) ("B cells"). B
cells contained fewer than 1% CD4.sup.+ or CD8.sup.+ cells.
8.times.10.sup.4B cells were dispensed in triplicate into 96 well
microtiter plates in 100 .mu.l RPMI containing 10% FBS (heat
inactivated to 65.degree. C. for 30 min.), 50 .mu.M
2-mercaptoethanol, 100 U/ml penicillin, 100 ug/ml streptomycin, and
2 mM L-glutamate. 20 .mu.M ODN were added at the start of culture
for 20 h at 37.degree. C., cells pulsed with 1 .mu.Ci of .sup.3H
uridine, and harvested and counted 4 hr later. Ig secreting B cells
were enumerated using the ALISA spot assay after culture of whole
spleen cells with ODN at 20 .mu.M for 48 hr. Data, reported in
Table 1, represents the stimulation index compared to cell cultured
without ODN. .sup.3H thymidine incorporation assays showed similar
results, but with some nonspecific inhibition by thymidine released
from degraded ODN (Matson. S and A. M. Krieg (1992) Nonspecific
suppression of .sup.3H-thymidine incorporation by control
oligonucleotides. Antisense Research and Development 2:325).
Example 2
Effects of ODN on Production of IgM from B Cells
[0184] Single cell suspensions form the spleens of freshly killed
mice were treated with anti-Thy1, anti-CD4, and anti-CD8 and
complement by the method of Leibson et al., J. Exp. Med 154:1681
(1981)). Resting B cells (<02% T cell contamination) were
isolated from the 63-70% band of a discontinuous Percoll gradient
by the procedure of DeFranco et al, J. Exp. Med 155:1523 (1982).
These were cultured as described above in 30 .mu.g/ml LPS for 48
hr. The number of B cells actively secreting IgM was maximal at
this time point, as determined by ELIspot assay (Klinman, D. M. et
al. J. Immunol 144:506 (1990)). In that assay, B cells were
incubated for 6 hrs on anti-Ig coated microtiter plates. The Ig
they produced (>99% IgM) was detected using phosphatase-labeled
anti-Ig (Southern Biotechnology Associated, Birmingham, Ala.). The
antibodies produced by individual B cells were visualized by
addition of BCIP (Sigma Chemical Co., St. Louis Mo.) which forms an
insoluble blue precipitate in the presence of phosphatase. The
dilution of cells producing 20-40 spots/well was used to determine
the total number of antibody-secreting B cells/sample. All assays
were performed in triplicate (data reported in Table 1). In some
experiments, culture supernatants were assayed for IgM by ELISA,
and showed similar increased in response to CpG-ODN.
Example 3
B Cell Stimulation by Bacterial DNA
[0185] DBA/2 B cells were cultured with no DNA or 50 .mu.g/ml of a
(Micrococcus lysodeikticus; b) NZB/N mouse spleen; and c) NSF/N
mouse spleen genomic DNAs for 48 hours, then pulsed with .sup.3H
thymidine for 4 hours prior to cell harvest. Duplicate DNA samples
were digested with DNASE I for 30 minutes at 37.degree. C. prior to
addition to cell cultures. E coli DNA also induced an 8.8 fold
increase in the number of IgM secreting B cells by 48 hours using
the ELISAspot assay.
[0186] DBA/2 B cells were cultured with either no additive, 50
.mu.g/ml LPS or the ODN 1; 1a; 4; or 4a at 20 uM. Cells were
cultured and harvested at 4, 8, 24 and 48 hours. BXSB cells were
cultured as in Example 1 with 5, 10, 20, 40 or 80 .mu.M of ODN 1;
1a; 4; or 4a or LPS. In this experiment, wells with no ODN had 3833
cpm. Each experiment was performed at least three times with
similar results. Standard deviations of the triplicate wells were
<5%.
Example 4
Effects of ODN on Natural Killer (NK) Activity
[0187] 10.times.10.sup.6 C57BL/6 spleen cells were cultured in two
ml RPMI (supplemented as described for Example 1) with or without
40 .mu.M CpG or non-CpG ODN for forty-eight hours. Cells were
washed, and then used as effector cells in a short term .sup.51Cr
release assay with YAC-1 and 2C11, two NK sensitive target cell
lines (Ballas, Z. K. et al. (1993) j. IMMUNOL. 150:17). Effector
cells were added at various concentrations to 10.sup.4 51Cr-labeled
target cells in V-bottom microtiter plates in 0.2 ml, and incubated
in 5% CO.sub.2 for 4 hr. At 37.degree. C. Plates were then
centrifuged, and an aliquot of the supernatant counted for
radioactivity. Percent specific lysis was determined by calculating
the ratio of the .sup.51Cr released in the presence of effector
cells minus the .sup.51Cr released when the target cells are
cultured alone, over the total counts released after cell lysis in
2% acetic acid minus the .sup.51Cr cpm released when the cells are
cultured alone.
Example 5
In Vivo Studies with CpG Phosphorothioate ODN
[0188] Mice were weighted and injected IP with 0.25 ml of sterile
PBS or the indicated phosphorothioate ODN dissolved in PBS. Twenty
four hours later, spleen cells were harvested, washed, and stained
for flow cytometry using phycoerythrin conjugated 6B2 to gate on B
cells in conjunction with biotin conjugated anti Ly-6A/E or
anti-Ia.sup.d (Pharmingen, San Diego, Calif.) or anti-Bla-1 (Hardy,
R. R. et al., J. Exp. Med 159:1169 (1984). Two mice were studied
for each condition and analyzed individually.
Example 6
Titration of Phosphorothioate ODN for B Cell Stimulation
[0189] B cells were cultured with phosphorothioate ODN with the
sequence of control ODN 1a or the CpG ODN 1d and 3 Db and then
either pulsed after 20 hr with .sup.3H uridine or after 44 hr with
.sup.3H thymidine before harvesting and determining cpm.
Example 7
Rescue of B Cells from Apoptosis
[0190] WEHI-231 cells (5.times.10.sup.4/well) were cultured for 1
hr. at 37.degree. C. in the presence or absence of LPS or the
control ODN 1a or the CpG ODN 1d and 3 Db before addition of
anti-IgM (1 .mu./ml). Cells were cultured for a further 20 hr.
Before a 4 hr. Pulse with 2 .mu.Ci/well .sup.3H thymidine. In this
experiment, cells with no ODN or anti-IgM gave 90.4.times.10.sup.3
cpm of .sup.3H thymidine incorporation by addition of anti-IgM. The
phosphodiester ODN shown in Table 1 gave similar protection, though
some nonspecific suppression due to ODN degradation. Each
experiment was repeated at least 3 times with similar results.
Example 8
In Vivo Induction of Murine IL-6
[0191] DBA/2 female mice (2 mos. old) were injected IP with 500 g
CpG or control phosphorothioate ODN. At various time points after
injection, the mice were bled. Two mice were studied for each time
point. IL-6 was measured by ELISA, and IL6 concentration was
calculated by comparison to a standard curve generate using
recombinant IL-6. The sensitivity of the assay was 10 pg/ml. Levels
were undetectable after 8 hrs.
Example 9
Systemic Induction of Murine IL-6 Transcription
[0192] Mice and cell lines. DBA/2, BALB/c, and C3H/HeJ mice at 5-10
wk of age were used as a source of lymphocytes. All mice were
obtained from The Jackson Laboratory (Bar Harbor, Me.), and bred
and maintained under specific pathogen-free conditions in the
University of Iowa Animal Care Unit. The mouse B cell line CH12.LX
was kindly provided by Dr. G. Bishop (University of Iowa, Iowa
City).
[0193] Cell preparation. Mice were killed by cervical dislocation.
Single cell suspensions were prepared aseptically from the spleens
from mice. T cell depleted mouse splenocytes were prepared by using
anti-Thy-1.2 and complement and centrifugation over lymphocyte M
(Cedarlane Laboratories, Hornby, Ontario, Canada) as described
(Krieg, A. M. et al., (1989) A role for endogenous retroviral
sequences in the regulation of lymphocyte activation. J. Immunol
143:2448).
[0194] ODN and DNA. Phosphodiester oligonucleotides (O-ODN) and the
backbone modified phosphorothioate oligonucleotides (S-ODN) were
obtained from the DNA Core facility at the University of Iowa or
from Operon Technologies (Alameda, Calif.). E. Coli DNA (Strain B)
and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All
DNA and ODN were purified by extraction with
phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol
precipitation. E. Coli and calf thymus DNA were single stranded
prior to use by boiling for 10 min. followed by cooling on ice for
5 min. For some experiments, E. Coli and calf thymus DNA were
digested with DNase 1 (2 U/.mu.g of DNA) at 37.degree. C. for 2 hr
in 1.times.SSC with 5 mM MgC12. To methylate the cytosine in CpG
dinucleotide in E. Coli DNA, E. Coli DNA was treated with CpG
methylase (M. SssI, 2 U/.mu.g of DNA) in NEBuffer 2 supplemented
with 160 .mu.M S-adenosyl methionine and incubated overnight at
37.degree. C. Methylated DNA was purified as above. Efficiency of
methylation was confirmed by Hpa II digestion followed by analysis
by gel electrophoresis. All enzymes were purchased from New England
Biolabs (Beverly, Mass.). LPS level in ODN was less than 12.5 ng/mg
and E. Coli and calf thymus DNA contained less than 2.5 ng of
LPS/mg of DNA by Limulus assay.
[0195] Cell Culture. All cells were cultured at 37.degree. C. in a
5% CO.sub.2 humidifier incubator maintained in RPMI-1640
supplemented with 10% (v/v) heat inactivated fetal calf serum
(FCS), 1.5 mM L-glutamine, 50 .mu.g/ml), CpG or non-CpG
phosphodiester ODN (O-ODN) (20 .mu.M), phosphorothioate ODN (S-ODN)
(0.5 .mu.M), or E. coli or calf thymus DNA (50 .mu.g/ml) at
37.degree. C. for 24 hr. (for IL-6 production) or 5 days (for IgM
production). Concentrations of stimulants were chosen based on
preliminary studies with titrations. In some cases, cells were
treated with CpG O-ODN along with various concentrations (1-10
.mu.g/ml) of neutralizing rat IgG1 antibody against murine IL-6
(hybridoma MP5-20F3) or control rat IgG1 mAB to E. Coli
b-galactosidase (hybridoma GL 113; ATCC, Rockville, Md.) (20) for 5
days. At the end of incubation, culture supernatant fractions were
analyzed by ELISA as below.
[0196] In vivo induction of IL-6 and IgM BALB/c mice were injected
intravenously (iv) with PBS, calf thymus DNA (200 .mu.g/100 .mu.l
PBS/mouse), E. coli DNA (200 .mu.g/100 .mu.l PBS/mouse), or CpG or
non-CpG S-ODN (200 .mu.g/100 .mu.l PBS/mouse). Mice (two/group)
were bled by retroorbital puncture and sacrificed by cervical
dislocation at various time points. Liver, spleen, thymus, and bone
marrow were removed by RNA was prepared from those organs using
RNAzol B (Tel-Test, Friendswood, Tex.) according to the
manufactures protocol.
[0197] ELISA. Flat-bottomed Immun 1 plates (Dynatech Laboratories,
Inc., Chantilly, Va.) were coated with 100 .mu.l/well of anti-mouse
IL-6 mAb (MP5-20F3) (2 .mu.g/ml) or anti-mouse IgM u-chain specific
(5 .mu.g/ml; Sigma, St. Louis, Mo.) in carbonate-bicarbonate, pH
9.6 buffer (15 nM Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3) overnight at
4.degree. C. The plates were then washed with TPBS (0.5 mM
MgCl.sub.2O6H.sub.2O, 2.68 mM KCl, 1.47 mM KH.sub.2PO.sub.4, 0.14 M
NaCl, 6.6 mM K.sub.2HPO.sub.4, 0.5% Tween 20) and blocked with 10%
FCS and TPBS for 2 hr at room temperature and then washed again.
Culture supernatants, mouse sera, recombinant mouse IL-6
(Pharmigen, San Diego, Calif.) or purified mouse IgM (Calbiochem,
San Diego, Calif.) were appropriately diluted in 10% FCS and
incubated in triplicate wells for 6 hr at room temperature. The
plates were washed and 100 .mu.l/well of biotinylated rat
anti-mouse IL-6 monoclonal antibodies (MP5-32C11, Pharmingen, San
Diego, Calif.) (1 .mu.g/ml in 10% FCS) or biotinylated anti-mouse
Ig (Sigma, St. Louis, Mo.) were added and incubated for 45 min. at
room temperature following washes with TPBS. Horseradish peroxidase
(HRP) conjugated avidin (Bio-rad Laboratories, Hercules, Calif.) at
1:4000 dilution in 10% FCS (100 .mu.l/well) was added and incubated
at room temperature for 30 min. The plates were washed and
developed with o-phenylenediamine dihydrochloride (OPD; Sigma, St
Louis Mo.) 0.05 M phosphate-citrate buffer, pH 5.0, for 30 min. The
reaction was stopped with 0.67 N H.sub.2SO.sub.4 and plates were
read on a microplate reader (Cambridge Technology, Inc., Watertown,
Mass.) at 490-600 nm. The results are shown in FIGS. 1 and 2.
[0198] RT-PCR A sense primer, an antisense primer, and an internal
oligonucleotide probe for IL-6 were synthesized using published
sequences (Montgomery, R. A. and M. S. Dallman (1991), Analysis for
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554). cDNA synthesis
and IL-6 PCR was done essentially as described by Montgomery and
Dallman (Montgomery, R. A. And M. S. Dallman (1991), Analysis of
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554) using RT-PCR
reagents from Perkin-Elmer Corp. (Hayward, Calif.). Samples were
analyzed after 30 cycles of amplification by gel electrophoresis
followed by unblot analysis (stoye, J. P. et al., (1991) DNA
hybridization in dried gels with fragmented probes: an improvement
over blotting techniques, Techniques 3:123). Briefly, the gel was
hybridized at room temperature for 30 min. in denaturation buffer
(0.05 M NaOH, 1.5M NaCl) followed by incubation for 30 min. In
renaturation buffer (1.5 M NaCl, 1 M Tris, pH 8) and a 30 min. Wash
in double distilled water. The gel was dried and prehybridized at
47.degree. C. for 2 hr. Hybridization buffer (5.times.SSPE, 0.1%
SDS) containing 10 .mu.g/ml denatured salmon sperm DNA. The gel was
hybridized with 2.times.10.sup.6 cpm/ml g-[.sup.32 P] ATP
end-labeled internal oligonucleotide probe for IL-6
(5'CATTTCCACGATTTCCCA3') SEQ ID. NO: 118) overnight at 47.degree.
C., washed 4 times (2.times.SSC, 0.2% SDS) at room temperature and
autoradiographed. The results are shown in FIG. 3.
[0199] Cell Proliferation assay. DBA/2 mice spleen B cells
(5.times.10.sup.4 cells/100 .mu.l/well) were treated with media,
CpG or non-CpG S-ODN (0.5 .mu.M) or O-ODN (20 .mu.M) for 24 hr at
37.degree. C. Cells were pulsed for the last four hr. With either
[.sup.3H] Thymidine or [.sup.3H] Uridine (1 .mu.Ci/well). Amounts
of [.sup.3H] incorporated were measured using Liquid Scintillation
Analyzer (Packard Instrument Co., Downers Grove, Ill.).
[0200] Transfections and CAT assays. WEHI-231 cells (10.sup.7
cells) were electroporated with 20 .mu.g of control or human IL-6
promoter-CAT construct (kindly provided by S. Manolagas, Univ. of
Arkansas) (Pottratz, S. T. Et al., (1994) 17B-estradiol inhibits
expression of human interleukin-6 promotor-reporter constructs by a
receptor-dependent mechanism. J. Clin. Invest. 93:944) at 250 mV
and 960 .mu.F. Cells were stimulated with various concentrations of
CpG or non-CpG ODN after electroporation. Chloramphenicol
acetyltransferase (CAT) activity was measured by a solution assay
(Seed, B. and J. Y. Sheen (1988) A single phase-extraction assay
for chloramphenicol acetyl transferase activity. Gene 76:271) 16
hr. after transfection. The results are presented in FIG. 5.
Example 10
Oligodeoxynucleotide Modifications Determine the Magnitude of B
Cell Stimulation by CpG Motifs
[0201] ODN were synthesized on an Applied Biosystems Inc. (Foster
City, Calif.) model 380A, 380B, or 394 DNA synthesizer using
standard procedures (Beacage and Caruthers (1981) Deoxynucleoside
phosphoramidites--A new class of key intermediates for
deoxypolynucleotide synthesis. Tetrahedon Letters 22, 1859-1862.).
Phosphodiester ODN were synthesized using standard beta-cyanoethyl
phosphoramidite chemistry. Phosphorothioate linkages were
introduced by oxidizing the phosphite linkage with elemental sulfur
instead of the standard iodine oxidation. The four common
nucleoside phosphoramidites were purchased from Applied Biosystems.
All phosphodiester and thioate containing ODN were protected by
treatment with concentrated ammonia at 55.degree. C. for 12 hours.
The ODN were purified by gel exclusion chromatography and
lyophilized to dryness prior to use. Phosphorodithioate linkages
were introduced by using deoxynucleoside S-(b-benzoylmercaptoethyl)
pyrrolidino thiophosphoramidites (Wiesler, W. T. et al.,(1993) In
Methods in Molecular Biology: Protocols for Oligonucleotides and
Analogs-Synthesis and Properties, Agrawal, S. (Ed.), Humana Press,
191-206.). Dithioate containing ODN were deprotected by treatment
with concentrated ammonia at 55.degree. C. for 12 hours followed by
reverse phase HPLC purification.
[0202] In order to synthesize oligomers containing
methylphosphonothioates or methylphosphonates as well as
phosphodiesters at any desired internucleotide linkage, two
different synthetic cycles were used. The major synthetic
differences in two cycles are the coupling reagent where
dialkylaminomethylnucleoside phosphines are used and the oxidation
reagents in the case of methylphosphonothioates. In order to
synthesize either derivative, the condensation time has been
increased for the dialkylaminomethylnucleoside phosphines due to
the slower kinetics of coupling (Jager and Engels, (1984) Synthesis
of deoxynucleoside methylphosphonates via a phosphonamidite
approach. Tetrahedron Letters 24, 1437-1440). After the coupling
step has been completed, the methylphosphnodiester is treated with
the sulfurizing reagent (5% elemental sulfur, 100 millimolar
N,N-diamethylaminopyridine in carbon
disulfide/pyridine/triethylamine), four consecutive times for 450
seconds each to produce methylphosphonothioates. To produce
methylphosphonate linkages, the methylphosphinodiester is treated
with standard oxidizing reagent (0.1 M iodine in
tetrahydrofuran/2,6-lutidine/water).
[0203] The silica gel bound oligomer was treated with distilled
pyridine/concentrated ammonia, 1:1, (v/v) for four days at 4
degrees centigrade. The supernatant was dried in vacuo, dissolved
in water and chromatographed on a G50/50 Sephadex column.
[0204] As used herein, O-ODN refers to ODN which are
phosphodiester; S-ODN are completely phosphorothioate modified;
S-O=ODN are chimeric ODN in which the central linkages are
phosphodiester, but the two 5' and five 3' linkages are
phosphorothioate modified; 2.sub.2-O-ODN are chimeric ODN in which
the central linkages are phosphodiester, but the two 5' and five 3'
linkages are phosphorodithioate modified; and MP-O-ODN are chimeric
ODN in which the central linkages are phosphodiester, but the two
5' and five 3' linkages are methylphosphonate modified. The ODN
sequences studied (with CpG dinucleotides indicated by underlining)
include:
16 3D (5" GAGAACGCTGGACCTTCCAT),; (SEQ. ID. NO. 20) 3M (5'
TCCATGTCGGTCCTGATGCT),; (SEQ. ID. NO. 28) 5 (5'
GGCGTTATTCCTGACTCGCC),; (SEQ. ID. NO. 99) and 6 (5'
CCTACGTTGTATGCGCCCAGCT),. (SEQ. ID NO. 100)
[0205] These sequences are representative of literally hundreds of
CpG and non-CpG ODN that have been tested in the course of these
studies.
[0206] Mice. DBA/2, or BXSB mice obtained from The Jackson
Laboratory (Bar Harbor, Me.), and maintained under specific
pathogen-free conditions were used as a source of lymphocytes at
5-10 wk of age with essentially identical results.
[0207] Cell proliferation assay. For cell proliferation assays,
mouse spleen cells (5.times.10.sup.4 cells/100 .mu.l/well) were
cultured at 37.degree. C. in a 5% CO.sub.2 humidified incubator in
RPMI-1640 supplemented with 10% (v/v) heat inactivated fetal calf
serum (heated to 65.degree. C. for experiments with O-ODN, or
56.degree. C. for experiments using only modified ODN), 1.5 .mu.M
L-glutamine, 50 .mu.M 2-mercaptoethanol, 100 U/ml penicillin and
100 .mu.g/ml streptomycin for 24 hr or 48 hr as indicated. 1 .mu.Ci
of .sup.3H uridine or thymidine (as indicated) was added to each
well, and the cells harvested after an additional 4 hours of
culture. Filters were counted by scintillation counting. Standard
deviations of the triplicate wells were <5%. The results are
presented in FIGS. 6-8.
Example 11
Induction of NK Activity
[0208] Phosphodiester ODN were purchased form Operon Technologies
(Alameda, Calif.). Phosphorothioate ODN were purchased from the DNA
core facility, University of Iowa, or from The Midland Certified
Reagent Company (Midland Tex.). E. coli (strain B) DNA and calf
thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and
ODN were purified by extraction with phenol:chloroform:isoamyl
alcohol (25:24:1) and/or ethanol precipitation. The LPS level in
ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA
contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
[0209] Virus-free, 4-6 week old, DBA/2, C57BL/6 (B6) and
congenitally thymic BALB/C mice were obtained on contract through
the Veterans Affairs from the National Cancer Institute (Bethesda,
Md.). C57BL/6 SCID mice were bred in t eh SPF barrier facility at
the University of Iowa Animal Care Unit.
[0210] Human peripheral monucluclear blood leukocytes (PBMC) were
obtained as previously described (Ballas, Z. K. et al., (1990) J.
Allergy Clin. Immunol. 85:453; Ballas, Z. K. And W. Rasmussen
(1990) J. Immunol. 145:1039; Ballas, Z. K. and W. Rasmussen (1993)
J. Immunol. 150; 17). Human or murine cells were cultured at
5.times.10.sup.6/well, at 37.degree. C. in a 5% CO.sub.2 humidified
atmosphere in 24-well plates (Ballas, Z. K. Et al., (1990) J.
Allergy Clin. Immunol. 85:453; Ballas, Z. K. And W. Rasmussen
(1990) J. Immunol 145:1039; and Ballas, Z. K. and W. Rasmussen
(1193) J. Immunol, 150:17), with medium alone or with CpG or
non-CpG ODN at the indicated concentrations, or with E. coli or
calf thymus (50 .mu.g/ml) at 37.degree. C. for 24 hr. All cultures
were harvested at 18 hr. and the cells were used as effectors in a
standard 4 hr. .sup.51Cr-release assay against K562 (human) or
YAC-1 (mouse) target cells as previously described. For calculation
of lytic units (LU), 1 LU was defined as the number of cells needed
to effect 30% specific lysis. Where indicated, neutralizing
antibodies against IFN-.beta. (Lee Biomolecular, San Diego, Calif.)
or IL-12 (C15.1, C15.6, C17.8, and C17.15; provided by Dr. Giorgio
Trinchieri, The Winstar Institute, Philadelphia, Pa.) or their
isotype controls were added at the initiation of cultures to a
concentration of 10 .mu.g/ml. For anti-IL-12 additional, 10 .mu.g
of each of the 4 MAB (or isotype controls) were added
simultaneously. Recombinant human IL-2 was used at a concentration
of 100 U/ml.
Example 12
Prevention of the Development of an Inflammatory Cellular
Infiltrate and Eosinophilia in a Murine Model of Asthma
[0211] 6-8 week old C56BL/6 mice (from The Jackson Laboratory, Bar
Harbor, Me.) were immunized with 5,000 Schistosoma mansoni eggs by
intraperitoneal (i.p.) injection on days 0 and 7. Schistosoma
mansoni eggs contain an antigen (Schistosoma mansoni egg antigen
(SEA)) that induces a Th2 immune response (e.g. production of IgE
antibody). IgE antibody production is known to be an important
cause of asthma.
[0212] The immunized mice were then treated with oligonucleotides
(30 .mu.g in 200 .mu.l saline by i.p. injection), which either
contained an unmethylated CpG motif (i.e., TCCATGACGTTCCTGACGTT;
SEQ ID NO. 10) or did not (i.e., control, TCCATGAGCTTCCTGAGTCT; SEQ
ID NO. 8). Soluble SeEA (10 .mu.g in 25 .mu.l of saline) was
administered by intranasal instillation on days 14 and 21. Saline
was used as a control.
[0213] Mice were sacrificed at various times after airway
challenge. Whole lung lavage was performed to harvest airway and
alveolar inflammatory cells. Cytokine levels were measured from
lavage fluid by ELISA. RNA was isolated from whole lung for
Northern analysis and RT-PCR studies using CsC1 gradients. Lungs
were inflated and perfused with 4% paraformaldehyde for histologic
examination.
[0214] FIG. 9 shows that when the mice are initially injected with
the eggs i.p., and then inhale the egg antigen (open circle), many
inflammatory cells are present in the lungs. However, when the mice
are initially given a nucleic acid containing an unmethylated CpG
motif along with the eggs, the inflammatory cells in the lung are
not increased by subsequent inhalation of the egg antigen (open
triangles).
[0215] FIG. 10 shows that the same results are obtained only when
eosinophils present in the lung lavage are measured. Eosinophils
are the type of inflammatory cell most closely associated with
asthma.
[0216] FIG. 11 shows that when the mice are treated with a control
oligo at the time of the initial exposure to the egg, there is
little effect on the subsequent influx of eosinophils into the
lungs after inhalation of SEA. Thus, when mice inhale the eggs on
days 14 or 21, they develop an acute inflammatory response in the
lungs. However, giving a CpG oligo along with the eggs at the time
of initial antigen exposure on days 0 and 7 almost completely
abolishes the increase in eosinophils when the mice inhale the egg
antigen on day 14.
[0217] FIG. 12 shows that very low doses of oligonucleotide (<10
.mu.g) can give this protection.
[0218] FIG. 13 shows that the resultant inflammatory response
correlates with the levels of the Th2 cytokine IL-4 in the
lung.
[0219] FIG. 14 shows that administration of an oligonucleotide
containing an unmethylated CpG motif can actually redirect the
cytokine response of the lung to production of IL-12, indicating
the Th1 type of immune response.
[0220] FIG. 15 shows that administration of an oligonucleotide
containing an unmethylated CpG motif can also redirect the cytokine
response of the lung to production of IFN-.gamma., indicating a Th1
type of immune response.
Example 13
CpG Oligonucleotides Induce Human PBMC to Secrete Cytokines
[0221] Human PBMC were prepared from whole blood by standard
centrifugation over Ficoll hypaque. Cells (5.times.10.sup.5/ml)
were cultured in 10% autologous serum in 95 well microtiter plates
with CpG or control oligodeoxynucleotides (24 .mu.g/ml for
phosphodiester oligonucleotides; 6 g/ml for nuclease resistant
phosphorothioate oligonucleotides) for 4 hr in the case of
TNF-.alpha. or 24 hr. For the other cytokines before supernatant
harvest and assay, measured by ELISA using Quantikine kits or
reagents from R&D Systems (pg/ml) or cytokine ELISA kits
fromBiosource (for IL-12 assay). Assays were performed as per the
manufacturer's instructions. Data are presented in Table 6 as the
level of cytokine above that in wells with no added
oligodeoxynucleotide.
[0222] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
123 1 20 DNA Artificial Sequence Synthetic Oligonucleotide 1
atggaaggtc cagcgttctc 20 2 20 DNA Artificial Sequence Synthetic
Oligonucleotide 2 atcgacctac gtgcgttctc 20 3 20 DNA Artificial
Sequence Synthetic Oligonucleotide 3 tccataacgt tcctgatgct 20 4 15
DNA Artificial Sequence Synthetic Oligonucleotide 4 gctagatgtt
agcgt 15 5 19 DNA Artificial Sequence Synthetic Oligonucleotide 5
gagaacgtcg accttcgat 19 6 15 DNA Artificial Sequence Synthetic
Oligonucleotide 6 gcatgacgtt gagct 15 7 20 DNA Artificial Sequence
Synthetic Oligonucleotide 7 tccatgacgt tcctgatgct 20 8 20 DNA
Artificial Sequence Synthetic Oligonucleotide 8 tccatgagct
tcctgagtct 20 9 20 DNA Artificial Sequence Synthetic
Oligonucleotide 9 tccaagacgt tcctgatgct 20 10 20 DNA Artificial
Sequence Synthetic Oligonucleotide 10 tccatgacgt tcctgacgtt 20 11
21 DNA Artificial Sequence Synthetic Oligonucleotide 11 tccatgagct
tcctgagtgc t 21 12 20 DNA Artificial Sequence Synthetic
Oligonucleotide 12 ggggtcaacg ttgagggggg 20 13 15 DNA Artificial
Sequence Synthetic Oligonucleotide 13 gctagangtt agcgt 15 14 15 DNA
Artificial Sequence Synthetic Oligonucleotide 14 gctagacgtt agngt
15 15 20 DNA Artificial Sequence Synthetic Oligonucleotide 15
atcgactctc gagcgttctc 20 16 20 DNA Artificial Sequence Synthetic
Oligonucleotide 16 atngactctn gagngttctc 20 17 20 DNA Artificial
Sequence Synthetic Oligonucleotide 17 atngactctc gagcgttctc 20 18
20 DNA Artificial Sequence Synthetic Oligonucleotide 18 atcgactctc
gagcgttntc 20 19 20 DNA Artificial Sequence Synthetic
Oligonucleotide 19 atggaaggtc caacgttctc 20 20 20 DNA Artificial
Sequence Synthetic Oligonucleotide 20 gagaacgctg gaccttccat 20 21
20 DNA Artificial Sequence Synthetic Oligonucleotide 21 gagaacgctc
gaccttccat 20 22 20 DNA Artificial Sequence Synthetic
Oligonucleotide 22 gagaacgctc gaccttcgat 20 23 20 DNA Artificial
Sequence Synthetic Oligonucleotide 23 gagcaagctg gaccttccat 20 24
20 DNA Artificial Sequence Synthetic Oligonucleotide 24 gagaangctg
gaccttccat 20 25 20 DNA Artificial Sequence Synthetic
Oligonucleotide 25 gagaacgctg gacnttccat 20 26 20 DNA Artificial
Sequence Synthetic Oligonucleotide 26 gagaacgatg gaccttccat 20 27
20 DNA Artificial Sequence Synthetic Oligonucleotide 27 gagaacgctc
cagcactgat 20 28 20 DNA Artificial Sequence Synthetic
Oligonucleotide 28 tccatgtcgg tcctgatgct 20 29 20 DNA Artificial
Sequence Synthetic Oligonucleotide 29 tccatgctgg tcctgatgct 20 30
20 DNA Artificial Sequence Synthetic Oligonucleotide 30 tccatgtngg
tcctgatgct 20 31 20 DNA Artificial Sequence Synthetic
Oligonucleotide 31 tccatgtcgg tnctgatgct 20 32 20 DNA Artificial
Sequence Synthetic Oligonucleotide 32 tccatgtcgg tcctgctgat 20 33
20 DNA Artificial Sequence Synthetic Oligonucleotide 33 tccatgccgg
tcctgatgct 20 34 20 DNA Artificial Sequence Synthetic
Oligonucleotide 34 tccatggcgg tcctgatgct 20 35 20 DNA Artificial
Sequence Synthetic Oligonucleotide 35 tccatgacgg tcctgatgct 20 36
20 DNA Artificial Sequence Synthetic Oligonucleotide 36 tccatgtcga
tcctgatgct 20 37 20 DNA Artificial Sequence Synthetic
Oligonucleotide 37 tccatgtcgc tcctgatgct 20 38 20 DNA Artificial
Sequence Synthetic Oligonucleotide 38 tccatgtcgt tcctgatgct 20 39
20 DNA Artificial Sequence Synthetic Oligonucleotide 39 tccatgacgt
ccctgatgct 20 40 20 DNA Artificial Sequence Synthetic
Oligonucleotide 40 tccatcacgt gcctgatgct 20 41 19 DNA Artificial
Sequence Synthetic Oligonucleotide 41 ggggtcagtc ttgacgggg 19 42 15
DNA Artificial Sequence Synthetic Oligonucleotide 42 gctagacgtt
agtgt 15 43 15 DNA Artificial Sequence Synthetic Oligonucleotide 43
gctagacntt agtgt 15 44 20 DNA Artificial Sequence Synthetic
Oligonucleotide 44 tccatgtngt tcctgatgct 20 45 18 DNA Artificial
Sequence Synthetic Oligonucleotide 45 tctcccagcg tgcgccat 18 46 24
DNA Artificial Sequence Synthetic Oligonucleotide 46 tcgtcgtttt
gtcgttttgt cgtt 24 47 20 DNA Artificial Sequence Synthetic
Oligonucleotide 47 tcgtcgttgt cgttgtcgtt 20 48 21 DNA Artificial
Sequence Synthetic Oligonucleotide 48 tgtcgtttgt cgtttgtcgt t 21 49
22 DNA Artificial Sequence Synthetic Oligonucleotide 49 tcgtcgttgt
cgttttgtcg tt 22 50 19 DNA Artificial Sequence Synthetic
Oligonucleotide 50 tgtcgttgtc gttgtcgtt 19 51 14 DNA Artificial
Sequence Synthetic Oligonucleotide 51 tcgtcgtcgt cgtt 14 52 20 DNA
Artificial Sequence Synthetic Oligonucleotide 52 tcctgtcgtt
ccttgtcgtt 20 53 20 DNA Artificial Sequence Synthetic
Oligonucleotide 53 tcctgtcgtt ttttgtcgtt 20 54 21 DNA Artificial
Sequence Synthetic Oligonucleotide 54 tcgtcgctgt ctgcccttct t 21 55
21 DNA Artificial Sequence Synthetic Oligonucleotide 55 tcgtcgctgt
tgtcgtttct t 21 56 21 DNA Artificial Sequence Synthetic
Oligonucleotide 56 gcgtgcgttg tcgttgtcgt t 21 57 6 DNA Artificial
Sequence Synthetic Oligonucleotide 57 gtcgtt 6 58 6 DNA Artificial
Sequence Synthetic Oligonucleotide 58 gtcgct 6 59 24 DNA Artificial
Sequence Synthetic Oligonucleotide 59 accatggacg atctgtttcc cctc 24
60 18 DNA Artificial Sequence Synthetic Oligonucleotide 60
taccgcgtgc gaccctct 18 61 24 DNA Artificial Sequence Synthetic
Oligonucleotide 61 accatggacg aactgtttcc cctc 24 62 24 DNA
Artificial Sequence Synthetic Oligonucleotide 62 accatggacg
agctgtttcc cctc 24 63 24 DNA Artificial Sequence Synthetic
Oligonucleotide 63 accatggacg acctgtttcc cctc 24 64 24 DNA
Artificial Sequence Synthetic Oligonucleotide 64 accatggacg
tactgtttcc cctc 24 65 24 DNA Artificial Sequence Synthetic
Oligonucleotide 65 accatggacg gtctgtttcc cctc 24 66 24 DNA
Artificial Sequence Synthetic Oligonucleotide 66 accatggacg
ttctgtttcc cctc 24 67 15 DNA Artificial Sequence Synthetic
Oligonucleotide 67 cacgttgagg ggcat 15 68 15 DNA Artificial
Sequence Synthetic Oligonucleotide 68 ctgctgagac tggag 15 69 12 DNA
Artificial Sequence Synthetic Oligonucleotide 69 tcagcgtgcg cc 12
70 17 DNA Artificial Sequence Synthetic Oligonucleotide 70
atgacgttcc tgacgtt 17 71 17 DNA Artificial Sequence Synthetic
Oligonucleotide 71 tctcccagcg ggcgcat 17 72 18 DNA Artificial
Sequence Synthetic Oligonucleotide 72 tctcccagcg cgcgccat 18 73 20
DNA Artificial Sequence Synthetic Oligonucleotide 73 tccatgtcgt
tcctgtcgtt 20 74 20 DNA Artificial Sequence Synthetic
Oligonucleotide 74 tccatagcgt tcctagcgtt 20 75 21 DNA Artificial
Sequence Synthetic Oligonucleotide 75 tcgtcgctgt ctccgcttct t 21 76
19 DNA Artificial Sequence Synthetic Oligonucleotide 76 tcctgacgtt
cctgacgtt 19 77 19 DNA Artificial Sequence Synthetic
Oligonucleotide 77 tcctgtcgtt cctgtcgtt 19 78 20 DNA Artificial
Sequence Synthetic Oligonucleotide 78 tccatgtcgt ttttgtcgtt 20 79
20 DNA Artificial Sequence Synthetic Oligonucleotide 79 tccaggactt
ctctcaggtt 20 80 20 DNA Artificial Sequence Synthetic
Oligonucleotide 80 tccatgcgtg cgtgcgtttt 20 81 20 DNA Artificial
Sequence Synthetic Oligonucleotide 81 tccatgcgtt gcgttgcgtt 20 82
20 DNA Artificial Sequence Synthetic Oligonucleotide 82 tccacgacgt
tttcgacgtt 20 83 20 DNA Artificial Sequence Synthetic
Oligonucleotide 83 gcggcgggcg gcgcgcgccc 20 84 25 DNA Artificial
Sequence Synthetic Oligonucleotide 84 tgtcgttgtc gttgtcgttg tcgtt
25 85 13 DNA Artificial Sequence Synthetic Oligonucleotide 85
tgtcgttgtc gtt 13 86 20 DNA Artificial Sequence Synthetic
Oligonucleotide 86 tccacgacgt tttcgacgtt 20 87 20 DNA Artificial
Sequence Synthetic Oligonucleotide 87 tccatgacga tcctgatgct 20 88
20 DNA Artificial Sequence Synthetic Oligonucleotide 88 tccatgacgc
tcctgatgct 20 89 15 DNA Artificial Sequence Synthetic
Oligonucleotide 89 gctagacgtt agcgt 15 90 8 DNA Artificial Sequence
Synthetic Oligonucleotide 90 tcaacgtt 8 91 8 DNA Artificial
Sequence Synthetic Oligonucleotide 91 tcaagctt 8 92 8 DNA
Artificial Sequence Synthetic Oligonucleotide 92 tcagcgct 8 93 8
DNA Artificial Sequence Synthetic Oligonucleotide 93 tcatcgat 8 94
8 DNA Artificial Sequence Synthetic Oligonucleotide 94 tcttcgaa 8
95 8 DNA Artificial Sequence Synthetic Oligonucleotide 95 ccaacgtt
8 96 8 DNA Artificial Sequence Synthetic Oligonucleotide 96
tcaacgtc 8 97 20 DNA Artificial Sequence Synthetic Oligonucleotide
97 tccaggactt tcctcaggtt 20 98 20 DNA Artificial Sequence Synthetic
Oligonucleotide 98 ttcaggactt tcctcaggtt 20 99 20 DNA Artificial
Sequence Synthetic Oligonucleotide 99 ggcgttattc ctgactcgcc 20 100
22 DNA Artificial Sequence Synthetic Oligonucleotide 100 cctacgttgt
atgcgcccag ct 22 101 7 DNA Artificial Sequence Synthetic
Oligonucleotide 101 tgtcgct 7 102 7 DNA Artificial Sequence
Synthetic Oligonucleotide 102 tgtcgtt 7 103 7 DNA Artificial
Sequence Synthetic Oligonucleotide 103 tgacgtc 7 104 8 DNA
Artificial Sequence Synthetic Oligonucleotide 104 tgacgtca 8 105 6
DNA Artificial Sequence Synthetic Oligonucleotide 105 aacgtt 6 106
7 DNA Artificial Sequence Synthetic Oligonucleotide 106 caacgtt 7
107 8 DNA Artificial Sequence Synthetic Oligonucleotide 107
aacgttct 8 108 7 DNA Artificial Sequence Synthetic Oligonucleotide
108 tgacgtt 7 109 6 DNA Artificial Sequence Synthetic
Oligonucleotide 109 gccggt 6 110 6 DNA Artificial Sequence
Synthetic Oligonucleotide 110 gacggt 6 111 6 DNA Artificial
Sequence Synthetic Oligonucleotide 111 gacgtc 6 112 6 DNA
Artificial Sequence Synthetic Oligonucleotide 112 cacgtg 6 113 7
DNA Artificial Sequence Synthetic Oligonucleotide 113 cgacgtt 7 114
20 DNA Artificial Sequence Synthetic Oligonucleotide 114 atggaaggtc
cagtgttctc 20 115 20 DNA Artificial Sequence Synthetic
Oligonucleotide 115 atggactctc cagcgttctc 20 116 20 DNA Artificial
Sequence Synthetic Oligonucleotide 116 atcgactctc gagngttctc 20 117
15 DNA Artificial Sequence Synthetic Oligonucleotide 117 gctagangtt
agtgt 15 118 18 DNA Artificial Sequence Synthetic Oligonucleotide
118 catttccacg atttccca 18 119 21 DNA Artificial Sequence Synthetic
Oligonucleotide 119 tcgtcgctgt ctgcccttct t 21 120 21 DNA
Artificial Sequence Synthetic Oligonucleotide 120 tcgtcgctgt
tgtcgtttct t 21 121 20 DNA Artificial Sequence Synthetic
Oligonucleotide 121 tccttgtcgt tcctgtcgtt 20 122 20 DNA Artificial
Sequence Synthetic Oligonucleotide 122 tccatgtngt tcctgtngtt 20 123
23 DNA Artificial Sequence Synthetic Oligonucleotide 123 tcgtcgtttt
gtcgttttgt cgt 23
* * * * *