U.S. patent application number 10/435656 was filed with the patent office on 2005-12-15 for immunostimulatory nucleic acid molecules.
This patent application is currently assigned to University of Iowa Research Foundation. Invention is credited to Klinman, Dennis, Krieg, Arthur M., Steinberg, Alfred D..
Application Number | 20050277604 10/435656 |
Document ID | / |
Family ID | 24968901 |
Filed Date | 2005-12-15 |
United States Patent
Application |
20050277604 |
Kind Code |
A1 |
Krieg, Arthur M. ; et
al. |
December 15, 2005 |
Immunostimulatory nucleic acid molecules
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and
therapeutic utilities based on their ability to stimulate an immune
response and to redirect a Th2 response to a Th1 response in a
subject are disclosed. Methods for treating atopic diseases,
including atopic dermatitis, are disclosed.
Inventors: |
Krieg, Arthur M.;
(Wellesley, MA) ; Klinman, Dennis; (Potomac,
MD) ; Steinberg, Alfred D.; (Potomac, MD) |
Correspondence
Address: |
Helen C. Lockhart
Wolf, Greenfield & Sacks, P.C.
Federal Reserve Plaza
600 Atlantic Avenue
Boston
MA
02210
US
|
Assignee: |
University of Iowa Research
Foundation
214 Technology Innovation Center, Oakdale Research
Campus
Iowa City
IA
52242
The U.S.A., as represented by the Secretary, Department of
Health and Human Services
FDA/CBER, Building 19A, 3D10
Bethesda
MD
20892
Coley Pharmaceutical Group, Inc.
93 Worcester Street, Suite 101
Wellesley
MA
02481
|
Family ID: |
24968901 |
Appl. No.: |
10/435656 |
Filed: |
May 9, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10435656 |
May 9, 2003 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
09818918 |
Mar 27, 2001 |
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
6207646 |
|
|
|
|
08738652 |
Oct 30, 1996 |
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
6194388 |
|
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
08276358 |
Jul 15, 1994 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61K 31/4706 20130101;
A61P 37/08 20180101; A61P 17/00 20180101; A61P 1/00 20180101; A61P
31/00 20180101; A61P 31/04 20180101; A61P 37/02 20180101; Y02A
50/30 20180101; A61P 31/10 20180101; C12N 2310/17 20130101; A61P
33/00 20180101; A61P 35/00 20180101; A61P 37/06 20180101; A61K
39/00 20130101; A61K 39/39 20130101; A61P 1/16 20180101; A61K
31/711 20130101; C12Q 1/68 20130101; A61P 17/06 20180101; A61K
31/7125 20130101; A61P 7/00 20180101; A61P 43/00 20180101; C07H
21/00 20130101; A61K 2039/55561 20130101; A61P 1/04 20180101; A61P
11/06 20180101; C12N 2310/315 20130101; A61K 31/7048 20130101; C12N
15/117 20130101; A61P 37/04 20180101; A61K 31/00 20130101; A61P
19/02 20180101; A61P 31/12 20180101; A61P 1/02 20180101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Goverment Interests
[0002] The work resulting in this invention was supported in part
by National Institute of Health Grant No. R29-AR42556-01. The U.S.
Government may therefore be entitled to certain rights in the
invention.
Claims
1-18. (canceled)
19. An immunomodulatory polynucleotide/microcarrier (IMP/MC)
complex, comprising: a polynucleotide comprising an
immunostimulatory sequence (ISS) linked to a nonbiodegradable
microcarrier (MC), wherein the ISS comprises the sequence 5'-C,
G-3', with the proviso that if the MC is gold, latex or magnetic,
the linkage is other than by biotin/avidin.
20. The IMP/MC complex of claim 19, wherein said polynucleotide is
covalently linked to said microcarrier.
21. The IMP/MC complex of claim 19, wherein said polynucleotide is
non-covalently linked to said microcarrier.
22. The IMP/MC complex of claim 19, wherein said microcarrier is a
liquid phase microcarrier.
23. The IMP/MC complex of claim 19, wherein said complex is
antigen-free.
24. The IMP/MC complex of claim 19, wherein the ISS comprises the
sequence 5'-T, C, G-3'.
25. The IMP/MC complex of claim 19, wherein the ISS comprises the
sequence 5'-purine, purine, C, G, pyrimidine, pyrimidine, C,
G-3'.
26-56. (canceled)
57. An immunostimulatory nucleic acid/delivery complex comprising:
a nucleic acid comprising an immunostimulatory nucleic acid linked
to a nucleic acid delivery complex, wherein the immunostimulatory
nucleic acid comprises the sequence 5.degree. C., G 3'.
58. The complex of claim 57, wherein the immunostimulatory nucleic
acid is covalently linked to the nucleic acid delivery complex.
59. The complex of claim 57, wherein the immunostimulatory nucleic
acid is non-covalently linked to the nucleic acid delivery
complex.
60-78. (canceled)
79. The IMP/MC complex of claim 19, wherein said polynucleotide
comprises a phosphate backbone modification.
80. The IMP/MC complex of claim 79, wherein said phosphate backbone
modification is a phosphorothioate.
81-88. (canceled)
89. An immunomodulatory polynucleotide/microcarrier (IMP/MC)
complex, comprising: a polynucleotide linked to a silica
microcarrier (MC), wherein the polynucleotide is 2-100 nucleotides
in length and comprises the sequence 5'-X.sub.1
X.sub.2CGX.sub.3X.sub.4-3', wherein X.sub.1, X.sub.2, X.sub.3 and
X.sub.4 are nucleotides.
90. The IMP/MC complex of claim 89, wherein said polynucleotide
comprises a phosphate backbone modification.
91. The IMP/MC complex of claim 90, wherein said phosphate backbone
modification is a phosphorothioate.
92. The IMP/MC complex of claim 89, wherein said polynucleotide
comprises the sequence 5' purine, purine, C, G, pyrimidine,
pyrimidine 3'.
93. A composition comprising the IMP/MC complex of claim 19 and a
pharmaceutically acceptable excipient.
94. The composition of claim 93 wherein the composition is antigen
free.
95-96. (canceled)
95-96. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a divisional of co-pending U.S. patent
application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a
continuation-in-part of U.S. patent application Ser. No.
08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No.
6,194,388, which is a continuation-in-part of U.S. patent
application Ser. No. 08/276,358, filed Jul. 15, 1994, now
abandoned.
BACKGROUND OF THE INVENTION
[0003] DNA Binds to Cell Membranes and is Internalized
[0004] In the 1970's, several investigators reported the binding of
high molecular weight DNA to cell membranes (Lerner, R. A., W.
Meinke, and D. A. Goldstein. 1971. "Membrane-associated DNA in the
cytoplasm of diploid human lymphocytes". Proc. Natl. Acad. Sci. USA
68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B.
Rosenberg. 1975. "Cell-surface-associated nucleic acid in
tumorigenic cells made visible with platinum-pyrimidine complexes
by electron microscopy". Proc. Nail. Acad. Sci. USA 72:928). In
1985, Bennett et al. presented the first evidence that DNA binding
to lymphocytes is similar to a ligand receptor interaction: binding
is saturable, competitive, and leads to DNA endocytosis and
degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and
M. M. Merritt. 1985. "DNA binding to human leukocytes. Evidence for
a receptor-mediated association, internalization, and degradation
of DNA". J. Clin. Invest. 76:2182). Like DNA,
oligodeoxyribonucleotides (ODNs) are able to enter cells in a
saturable, sequence independent, and temperature and energy
dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen.
1991. "Cellular uptake of antisense oligodeoxynucleotides".
Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R.
L. Juliano. 1992. "Pharmaceutical aspects of the biological
stability and membrane transport characteristics of antisense
oligonucleotides". In: Gene Regulation: Biology of Antisense RNA
and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd.
New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J.
Herrera, and A. M. Krieg., 1994. "Stage specific oligonucleotide
uptake in murine bone marrow B cell precursors". Blood, 84:3660).
No receptor for DNA or ODN uptake has yet been cloned, and it is
not yet clear whether ODN binding and cell uptake occurs through
the same or a different mechanism from that of high molecular
weight DNA.
[0005] Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen LPS had
dramatically enhanced ODN uptake in the B cell population, while
spleen cells treated with the T cell mitogen Con A showed enhanced
ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling,
M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg.
1991. "Uptake of oligodeoxyribonucleotides by lymphoid cells is
heterogeneous and inducible". Antisense Research and Development
1:161).
[0006] Immune Effects of Nucleic Acids
[0007] Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly
(I,C) which is a potent inducer of IFN production as well as a
macrophage activator and inducer of NK activity (Talmadge, J. E.,
J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E.
Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985.
"Immunomodulatory effects in mice of polyinosinic-polycytidylic
acid complexed with poly-L-lysine and carboxymethylcellulose".
Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley,
and J. E. Talmadge. 1985. "Immunomodulation of natural killer
activity by polyribonucleotides". J. Biol. Resp. Mod 4:512; Krown,
S. E. 1986. "Interferons and interferon inducers in cancer
treatment". Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C.
Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J.
Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt,
and S. P. Creekmore. 1992. "Polyinosinic-polycytidylic acid
complexed with poly-L-lysine and carboxymethylcellulose in
combination with interleukin-2 in patients with cancer: clinical
and immunological effects". Canc. Res. 52:3005). It appears that
this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron. 1993. "IFN
induction and associated changes in splenic leukocyte
distribution". J. Immunol. 150:3713). This activation was specific
for the ribose sugar since deoxyribose was ineffective. Its potent
in vitro antitumor activity led to several clinical trials using
poly (I,C) complexed with poly-L-lysine and carboxyinethylcellulose
(to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985.
cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S.
E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited
supra). Unfortunately, toxic side effects have thus far prevented
poly (I,C) from becoming a useful therapeutic agent.
[0008] Guanine ribonucleotides substituted at the C8 position with
either a bromine or a thiol group are B cell mitogens and may
replace "B cell differentiation factors" (Feldbush, T. L., and Z.
K. Ballas. 1985. "Lymphokine-like activity of 8-mercaptoguanosine:
induction of T and B cell differentiation". J. Immunol. 134:3204;
and Goodman, M. G. 1986. "Mechanism of synergy between T cell
signals and C8-substituted guanine nucleosides in humoral immunity:
B lymphotropic cytokines induce responsiveness to
8-mercaptoguanosine". J. Immunol. 136:3335). 8-mercaptoguanosine
and 8-bromoguanosine also can substitute for the cytokine
requirement for the generation of MHC restricted CTL (Feldbush, T.
L., 1985. cited supra), augment murine NK activity (Koo, G. C., M.
E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988.
"Activation of murine natural killer cells and macrophages by
8-bromoguanosine". J. Immunol. 140:3249), and synergize with IL-2
in inducing murine LAK generation (Thompson, R. A., and Z. K.
Ballas. 1990. "Lymphokine-activated killer (LAK) cells. V.
8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation". J.
Immunol. 145:3524). The NK and LAK augmenting activities of these
C8-substituted guanosines appear to be due to their induction of
IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5'
triphosphorylated thymidine produced by a mycobacterium was found
to be mitogenic for a subset of human .gamma..delta. T cells
(Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M.
Bonneville, and J.-J. Fournie. 1994. "Stimulation of human
.gamma..delta. T cells by nonpeptidic mycobacterial ligands"
Science 264:267). This report indicated the possibility that the
immune system may have evolved ways to preferentially respond to
microbial nucleic acids.
[0009] Several observations suggest that certain DNA structures may
also have the potential to activate lymphocytes. For example, Bell
et al. reported that nucleosomal protein-DNA complexes (but not
naked DNA) in spleen cell supernatants caused B cell proliferation
and immunoglobulin secretion (Bell, D. A., B. Morrison, and P.
VandenBygaart. 1990. "Immunogenic DNA-related factors". J. Clin.
Invest. 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina et al. have recently
reported that 260 to 800 bp fragments of poly (dG).cndot.(dC) and
poly (dG.cndot.dC) were mitogenic for B cells (Messina, J. P., G.
S. Gilkeson, and D. S. Pisetsky. 1993. "The influence of DNA
structure on the in vitro stimulation of murine lymphocytes by
natural and synthetic polynucleotide antigens". Cell. Immunol.
147:148). Tokunaga, et al. have reported that dG.cndot.dC induces
IFN-.gamma. and NK activity (Tokunaga, S. Yamamoto, and K. Namba.
1988. "A synthetic single-stranded DNA, poly(dG,dC), induces
interferon-.alpha./.beta., and -.gamma., augments natural killer
activity, and suppresses tumor growth" Jpn. J. Cancer Res. 79:682).
Aside from such artificial homopolymer sequences, Pisetsky et al.
reported that pure mammalian DNA has no detectable immune effects,
but that DNA from certain bacteria induces B cell activation and
immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S.
Pisetsky. 1991. "Stimulation of in vitro murine lymphocyte
proliferation by bacterial DNA". J. Immunol. 147:1759). Assuming
that these data did not result from some unusual contaminant, these
studies suggested that a particular structure or other
characteristic of bacterial DNA renders it capable of triggering B
cell activation. Investigations of mycobacterial DNA sequences have
demonstrated that ODN which contain certain palindrome sequences
can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E.
Kuramoto, O. Yano, and T. Tokunaga 1992. "Unique palindromic
sequences in synthetic oligonucleotides are required to induce INF
and augment INF-mediated natural killer activity". J. Immunol.
148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S.
Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992.
"Oligonucleotide sequences required for natural killer cell
activation". Jpn. J. Cancer Res. 83:1128).
[0010] Several phosphorothioate modified ODN have been reported to
induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C.
Chu, and W. E. Paul. 1992. "An antisense oligonucleotide
complementary to a sequence in I.gamma.2b increases .gamma.2b
germline transcripts, stimulates B cell DNA synthesis, and inhibits
immunoglobulin secretion". J. Exp. Med. 175:597; Branda, R. F., A.
L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. "Immune
stimulation by an antisense oligomer complementary to the rev gene
of HIV-I". Biochem. Pharmacol. 45:2037; McIntyre, K. W., K.
Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D.
Larigan, K. T. Landreth, and R. Narayanan. 1993. "A sense
phosphorothioate oligonucleotide directed to the initiation codon
of transcription factor NF.kappa.B T65 causes sequence-specific
immune stimulation". Antisense Res. Develop. 3:309; and Pisetsky,
D. S., and C. F. Reich. 1993. "Stimulation of murine lymphocyte
proliferation by a phosphorothioate oligonucleotide with antisense
activity for herpes simplex virus". Life Sciences 54: 101). These
reports do not suggest a common structural motif or sequence
element in these ODN that might explain their effects.
[0011] The CREB/ATF Family of Transcription Factors and Their Role
in Replication
[0012] The Camp Response Element Binding Protein (CREB) and
Activating transcription factor (ATF) or CREB/ATF family of
transcription factors is a ubiquitously expressed class of
transcription factors of which 11 members have so far been cloned
(reviewed in de Groot, R. P., and P. Sassone-Corsi: "Hormonal
control of gene expression: Multiplicity and versatility of cyclic
adenosine 3',5'-monophosphate-responsive nuclear regulators". Mol.
Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson:
"Transcriptional regulation by CREB and its relatives". Biochim.
Biophys. Acta 1174:221, 1993.). They all belong to the basic
region/leucine zipper (bZip) class of proteins. All cells appear to
express one or more CREB/ATF proteins, but the members expressed
and the regulation of mRNA splicing appear to be tissue-specific.
Differential splicing of activation domains can determine whether a
particular CREB/ATF protein will be a transcriptional inhibitor or
activator. Many CREB/ATF proteins activate viral transcription, but
some splicing variants which lack the activation domain are
inhibitory. CREB/ATF proteins can bind DNA as homo- or
hetero-dimers through the cAMP response element, the CRE, the
consensus form of which is the unmethylated sequence TGACGTC
(binding is abolished if the CpG is methylated) (Iguchi-Ariga, S.
M. M., and W. Schaffner: "CpG methylation of the cAMP-responsive
enhancer/promoter sequence TGACGTCA abolishes specific factor
binding as well as transcriptional activation". Genes &
Develop. 3:612, 1989.).
[0013] The transcriptional activity of the CRE is increased during
B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein:
"Induction of CREB activity via the surface Ig receptor of B
cells". J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to
regulate the expression of multiple genes through the CRE including
immunologically important genes such as fos, jun B, Rb-1, IL6, IL-1
(Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E.
Auron: "Transcription factors NF-IL6 and CREB recognize a common
essential site in the human prointerleukin 1.beta. gene". Mol.
Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel,
M. Root, J. M. Pow-Sang, and E. Wickstrom: "Antisense DNA
inhibition of tumor growth induced by c-Ha-ras oncogene in nude
mice". Cancer Res. 53:577, 1993), IFN-.beta. (Du, W., and T.
Maniatis: "An ATF/CREB binding site protein is required for virus
induction of the human interferon B gene". Proc. Natl. Acad. Sci.
USA 89:2150, 1992), TGF-.beta.1 (Asiedu, C. K., L. Scott, R. K.
Assoian, M. Ehrlich: "Binding of AP-1/CREB proteins and of MDBP to
contiguous sites downstream of the human TGF-B1 gene". Biochim.
Biophys. Acta 1219:55, 1994.), TGF-.beta.2, class II MHC (Cox, P.
M., and C. R. Goding: "An ATF/CREB binding motif is required for
aberrant constitutive expression of the MHC class II DRa promoter
and activation by SV40 T-antigen". Nucl. Acids Res. 20:4881,
1992.), E-selectin, GM-CSF, CD-8.alpha., the germline Ig.alpha.
constant region gene, the TCR V.beta. gene, and the proliferating
cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J.
Orten, S. H. Hinrichs, and M. B. Prystowsky: "Promoter activity of
the proliferating-cell nuclear antigen gene is associated with
inducible CRE-binding proteins in interleukin 2-stimulated T
lymphocytes". Mol. Cell. Biol. 14:4233, 1994.). In addition to
activation through the cAMP pathway, CREB can also mediate
transcriptional responses to changes in intracellular Ca.sup.++
concentration (Sheng, M., G. McFadden, and M. E. Greenberg:
"Membrane depolarization and calcium induce c-fos transcription via
phosphorylation of transcription factor CREB". Neuron 4:571,
1990).
[0014] The role of protein-protein interactions in transcriptional
activation by CREB/ATF proteins appears to be extremely important.
There are several published studies reporting direct or indirect
interactions between NFKB proteins and CREB/ATF proteins (Whitley,
et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al.,
(1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189;
and Du, et al., (1993) Cell 74:887. Activation of CREB through the
cyclic AMP pathway requires protein kinase A (PKA), which
phosphorylates CREB.sup.341 on sera.sup.133 and allows it to bind
to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad,
J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S.
G. E. Roberts, M. R. Green, and R. H. Goodman: "Nuclear protein CBP
is a coactivator for the transcription factor CREB". Nature
370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret,
T. Smea, M. Karin, J. Feramisco, and M. Montminy: "Activation of
cAMP and mitogen responsive genes relies on a common nuclear
factor". Nature 370:226, 1994.). CBP in turn interacts with the
basal transcription factor TFIIB causing increased transcription.
CREB also has been reported to interact with dTAFII 110, a TATA
binding protein-associated factor whose binding may regulate
transcription (Ferreri, K., G. Gill, and M. Montminy: "The
cAMP-regulated transcription factor CREB interacts with a component
of the TFIID complex". Proc. Natl. Acad. Sci. USA 91:1210, 1994.).
In addition to these interactions, CREB/ATF proteins can
specifically bind multiple other nuclear factors (Hoeffler, J. P.,
J. W. Lustbader, and C.-Y. Chen: "Identification of multiple
nuclear factors that interact with cyclic adenosine
3',5'-monophosphate response element-binding protein and activating
transcription factor-2 by protein-protein interactions". Mol.
Endocrinol. 5:256, 1991) but the biologic significance of most of
these interactions is unknown. CREB is normally thought to bind DNA
either as a homodimer or as a heterodimer with several other
proteins. Surprisingly, CREB monomers constitutively activate
transcription (Krajewski, W., and K. A. W. Lee: "A monomeric
derivative of the cellular transcription factor CREB functions as a
constitutive activator". Mol. Cell. Biol. 14:7204, 1994.).
[0015] Aside from their critical role in regulating cellular
transcription, it has recently been shown that CREB/ATF proteins
are subverted by some infectious viruses and retroviruses, which
require them for viral replication. For example, the
cytomegalovirus immediate early promoter, one of the strongest
known mammalian promoters, contains eleven copies of the CRE which
are essential for promoter function (Chang, Y.-N., S. Crawford, J.
Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: "The
palindromic series 1 repeats in the simian cytomegalovirus major
immediate-early promoter behave as both strong basal enhancers and
cyclic AMP response elements". J. Virol. 64:264, 1990). At least
some of the transcriptional activating effects of the adenovirus
E1A protein, which induces many promoters, are due to its binding
to the DNA binding domain of the CREB/ATF protein, ATF-2, which
mediates E1A inducible transcription activation (Liu, F., and M. R.
Green: "Promoter targeting by adenovirus E1a through interaction
with different cellular DNA-binding domains". Nature 368:520,
1994). It has also been suggested that E1A binds to the
CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M.
Livingston, and R. Eckner: "E1A-associated p300 and CREB-associated
CBP belong to a conserved family of coactivators". Cell 77:799,
1994). Human T lymphotropic virus-1 (HTLV-1), the retrovirus which
causes human T cell leukemia and tropical spastic paresis, also
requires CREB/ATF proteins for replication. In this case, the
retrovirus produces a protein, Tax, which binds to CREB/ATF
proteins and redirects them from their normal cellular binding
sites to different DNA sequences (flanked by G- and C-rich
sequences) present within the HTLV transcriptional enhancer
(Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R.
Cullen, I. M. Boros, and C.-Z. Giam: "In vitro selection of DNA
elements highly responsive to the human T-cell lymphotropic virus
type 1 transcriptional activator, Tax". Mol. Cell. Biol. 14:456,
1994; Adya, N., L.-J. Zhao, W. Huang, 1. Boros, and C.-Z. Giam:
"Expansion of CREB's DNA recognition specificity by Tax results
from interaction with Ala-Ala-Arg at positions 282-284 near the
conserved DNA-binding domain of CREB". Proc. Natl. Acad. Sci. USA
91:5642, 1994).
SUMMARY OF THE INVENTION
[0016] The instant invention is based on the finding that certain
nucleic acids containing unmethylated cytosine-guanine (CpG)
dinucleotides activate lymphocytes in a subject and redirect a
subjects immune response from a Th2 to a Th1 (e.g. by inducing
monocytic cells and other cells to produce Th1 cytokines, including
IL-12, IFN-.gamma. and GM-CSF). Based on this finding, the
invention features, in one aspect, novel immunostimulatory nucleic
acid compositions.
[0017] In a preferred embodiment, the immunostimulatory nucleic
acid contains a consensus mitogenic CpG motif represented by the
formula:
5' X1CGX2 3'
[0018] wherein X.sub.1 is selected from the group consisting of A,G
and T; and X.sub.2 is C or T.
[0019] In a particularly preferred embodiment an immunostimulatory
nucleic acid molecule contains a consensus mitogenic CpG motif
represented by the formula:
5' X1X2CGX3X4 3'
[0020] wherein C and G are unmethylated; and X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are nucleotides.
[0021] Enhanced immunostimulatory activity of human cells occurs
where X.sub.1X.sub.2 is selected from the group consisting of GpT,
GpG, GpA and ApA and/or X.sub.3X.sub.4 is selected from the group
consisting of TpT, CpT and GpT (Table 5). For facilitating uptake
into cells, CpG containing immunostimulatory nucleic acid molecules
are preferably in the range of 8 to 40 base pairs in size. However,
nucleic acids of any size (even many kb long) are immunostimulatory
if sufficient immunostimulatory motifs are present, since such
larger nucleic acids are degraded into oligonucleotides inside of
cells. Preferred synthetic oligonucleotides do not include a GCG
trinucleotide sequence at or near the 5' and/or 3' terminals and/or
the consensus mitogenic CpG motif is not a palindrome. Prolonged
immunostimulation can be obtained using stabilized
oligonucleotides, particularly phosphorothioate stabilized
oligonucleotides.
[0022] In a second aspect, the invention features useful therapies,
which are based on the immunostimulatory activity of the nucleic
acid molecules. For example, the immunostimulatory nucleic acid
molecules can be used to treat, prevent or ameliorate an immune
system deficiency (e.g., a tumor or cancer or a viral, fungal,
bacterial or parasitic infection in a subject). In addition,
immunostimulatory nucleic acid molecules can be administered to
stimulate a subject's response to a vaccine.
[0023] Further, by redirecting a subject's immune response from Th2
to Th1, the instant claimed nucleic acid molecules can be
administered to treat or prevent the symptoms of asthma. In
addition, the instant claimed nucleic acid molecules can be
administered in conjunction with a particular allergen to a subject
as a type of desensitization therapy to treat or prevent the
occurrence of an allergic reaction.
[0024] Further, the ability of immunostimulatory nucleic acid
molecules to induce leukemic cells to enter the cell cycle supports
the use of immunostimulatory nucleic acid molecules in treating
leukemia by increasing the sensitivity of chronic leukemia cells
and then administering conventional ablative chemotherapy, or
combining the immunostimulatory nucleic acid molecules with another
immunotherapy.
[0025] Other features and advantages of the invention will become
more apparent from the following detailed description and
claims.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1A-C are graphs plotting dose-dependent IL-6 production
in response to various DNA sequences in T cell depleted spleen cell
cultures. A. E. coli DNA (.circle-solid.) and calf thymus DNA
(.box-solid.) sequences and LPS (at 10.times. the concentration of
E. coli and calf thymus DNA) (.diamond-solid.). B. Control
phosphodiester oligodeoxynucleotide (ODN)
.sup.5'ATGGAAGGTCCAGTGTTCTC.sup.3' (SEQ ID NO:1) (.box-solid.) and
two phosphodiester CpG ODN.sup.5'ATCGACCTACGTGCGT- TCTC.sup.3' (SEQ
ID NO:2) (.diamond-solid.) and .sup.5'TCCATAACGTTCCTGATGC- T.sup.3'
(SEQ ID NO:3) (.circle-solid.). C. Control phosphorothioate ODN
.sup.5'GCTAGATGTTAGCGT.sup.3' (SEQ ID NO:4) (.box-solid.) and two
phosphorothioate CpG ODN .sup.5'GAGAACGTCGACCTTCGAT.sup.3' (SEQ ID
NO:5) (.diamond-solid.) and .sup.5'GCATGACGTTGAGCT.sup.3' (SEQ ID
NO:6) (.circle-solid.). Data present the mean.+-.standard deviation
of triplicates.
[0027] FIG. 2 is a graph plotting IL-6 production induced by CpG
DNA in vivo as determined 1-8 hrs after injection. Data represent
the mean from duplicate analyses of sera from two mice. BALB/c mice
(two mice/group) were injected iv. with 100 .mu.l of PBS
(.quadrature.) or 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.box-solid.) or non-CpG
phosphorothioate ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8)
(.diamond-solid.).
[0028] FIG. 3 is an autoradiograph showing IL-6 mRNA expression as
determined by reverse transcription polymerase chain reaction in
liver, spleen, and thymus at various time periods after in vivo
stimulation of BALB/c mice (two mice/group) injected iv with 100
.mu.l of PBS, 200 .mu.g of CpG phosphorothioate ODN 5'
TCCATGACGTTCCTGATGCT 3' (SEQ [D NO:7) or non-CpG phosphorothioate
ODN 5' TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8).
[0029] FIG. 4A is a graph plotting dose-dependent inhibition of
CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2
mice were stimulated with CpG ODN .sup.5'TCCAAGACGTTCCTGATGCE (SEQ
ID NO:9) in the presence of the indicated concentrations of
neutralizing anti-IL-6 (.diamond-solid.) or isotype control Ab
(.circle-solid.) and IgM levels in culture supernatants determined
by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect
on IgM secretion (.box-solid.).
[0030] FIG. 4B is a graph plotting the stimulation index of
CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN
5' TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) (.diamond-solid.) or
anti-IL-6 antibody only (.box-solid.). Data present the
mean.+-.standard deviation of triplicates.
[0031] FIG. 5 is a bar graph plotting chloramphenicol
acetyltransferase (CAT) activity in WEHI-231 cells transfected with
a promoter-less CAT construct (pCAT), positive control plasmid
(RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5'
TCCATGACGTTCCTGATGCT 3' (SEQ ID NO:7) or non-CpG 5'
TCCATGAGCTTCCTGAGTCT 3' (SEQ ID NO:8) phosphorothioate ODN at the
indicated concentrations. Data present the mean of triplicates.
[0032] FIG. 6 is a schematic overview of the immune effects of the
immunostimulatory unmethylated CpG containing nucleic acids, which
can directly activate both B cells and monocytic cells (including
macrophages and dendritic cells) as shown. The immunostimulatory
oligonucleotides do not directly activate purified NK cells, but
render them competent to respond to IL-12 with a marked increase in
their IFN.sub.1 production. By inducing 1]-12 production and the
subsequent increased IFN-.gamma. secretion by NK cells, the
immunostimulatory nucleic acids promote a Th1 type immune response.
No direct activation of proliferation of cytokine secretion by
highly purified T cells has been found. However, the induction of
Th1 cytokine secretion by the immunostimulatory oligonucleotides
promotes the development of a cytotoxic lymphocyte response.
[0033] FIG. 7 is an autoradiograph showing NF.kappa.B mRNA
induction in monocytes treated with E. coli (EC) DNA (containing
unmethylated CpG motifs), control (CT) DNA (containing no
unmethylated CpG motifs) and lipopolysaccharide (LPS) at various
measured times, 15 and 30 minutes after contact.
[0034] FIG. 8A shows the results from a flow cytometry study using
mouse B cells with the dihydrorhodamine 123 dye to determine levels
of reactive oxygen species. The dye only sample in Panel A of the
figure shows the background level of cells positive for the dye at
28.6%. This level of reactive oxygen species' was greatly increased
to 80% in the cells treated for 20 minutes with PMA and ionomycin,
a positive control (Panel B). The cells treated with the CpG oligo
(TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the
level of reactive oxygen species such that more than 50% of the
cells became positive (Panel D). However, cells treated with an
oligonucleotide with the identical sequence except that the CpGs
were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show
this significant increase in the level of reactive oxygen species
(Panel E).
[0035] FIG. 8B shows the results from a flow cytometry study using
mouse B cells in the presence of chloroquine with the
dihydrorhodamine 123 dye to determine levels of reactive oxygen
species. Chloroquine slightly lowers the background level of
reactive oxygen species in the cells such that the untreated cells
in Panel A have only 4.3% that are positive. Chloroquine completely
abolishes the induction of reactive oxygen species in the cells
treated with CpG DNA (Panel B) but does not reduce the level of
reactive oxygen species in the cells treated with PMA and ionomycin
(Panel E).
[0036] FIG. 9 is a graph plotting lung lavage cell count over time.
The graph shows that when the mice are initially injected with
Schistosoma mansoni eggs "egg", which induces a Th2 immune
response, and subsequently inhale Schistosoma mansoni egg antigen
"SEA" (open circle), many inflammatory cells are present in the
lungs. However, when the mice are initially given CpG oligo (SEQ ID
NO:10) along with egg, the inflammatory cells in the lung are not
increased by subsequent inhalation of SEA (open triangles).
[0037] FIG. 10 is a graph plotting lung lavage eosinophil count
over time. Again, the graph shows that when the mice are initially
injected with egg and subsequently inhale SEA (open circle), many
eosinophils are present in the lungs. However, when the mice are
initially given CpG oligo (SEQ ID NO:10) along with egg, the
inflammatory cells in the lung are not increased by subsequent
inhalation of the SEA (open triangles).
[0038] FIG. 11 is a bar graph plotting the effect on the percentage
of macrophage, lymphocyte, neutrophil and eosinophil cells induced
by exposure to saline alone; egg, then SEA; egg and SEQ ID NO:11,
then SEA; and egg and control oligo (SEQ ID NO:11), then SEA. When
the mice are treated with the control oligo at the time of the
initial exposure to the egg, there is little effect on the
subsequent influx of eosinophils into the lungs after inhalation of
SEA. Thus, when mice inhale the eggs on days 14 or 21, they develop
an acute inflammatory response in the lungs. However, giving a CpG
oligo along with the eggs at the time of initial antigen exposure
on days 0 and 7 almost completely abolishes the increase in
eosinophils when the mice inhale the egg antigen on day 14.
[0039] FIG. 12 is a bar graph plotting eosinophil count in response
to injection of various amounts of the protective oligo SEQ ID
NO:10.
[0040] FIG. 13 is a graph plotting interleukin 4 (IL4) production
(pg/ml) in mice over time in response to injection of egg, then SEA
(open diamond); egg and SEQ ID NO:10, then SEA (open circle); or
saline, then saline (open square). The graph shows that the
resultant inflammatory response correlates with the levels of the
Th2 cytokine MLA in the lung.
[0041] FIG. 14 is a bar graph plotting interleukin 12 (IL-12)
production (pg/ml) in mice over time in response to injection of
saline; egg, then SEA; or SEQ ID NO:10 and egg, then SEA. The graph
shows that administration of an oligonucleotide containing an
unmethylated CpG motif can actually redirect the cytokine response
of the lung to production of IL-12, indicating a Th1 type of immune
response.
[0042] FIG. 15 is a bar graph plotting interferon gamma
(IFN-.gamma.) production (pg/ml) in mice over time in response to
injection of saline; egg, then saline; or SEQ ID NO:10 and egg,
then SEA. The graph shows that administration of an oligonucleotide
containing an unmethylated CpG motif can also redirect the cytokine
response of the lung to production of IFN-.gamma., indicating a Th1
type of immune response.
DETAILED DESCRIPTION OF THE INVENTION
[0043] Definitions
[0044] As used herein, the following terms and phrases shall have
the meanings set forth below:
[0045] An "allergen" refers to a substance that can induce an
allergic or asthmatic response in a susceptible subject. The list
of allergens is enormous and can include pollens, insect venoms,
animal dander, dust, fungal spores and drugs (e.g. penicillin).
Examples of natural, animal and plant allergens include proteins
specific to the following genera: Canine (Canis familiaris);
Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis
domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium
perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica);
Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa);
Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea
europa); Arlemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or
Parietariajudaica); Blattella (e.g. Blattella germanica); Apis
(e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens,
Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g.
Juniperus sabinoides, Juniperus virginiana, Juniperus communis and
Juniperus asheq); Thuya (e.g. Thuya orientalis); Chamaecyparis
(e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta
americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale
cereale); Triticum (e.g. Triticum aestivum); Dactylis (e.g.
Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa
pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus
(e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum);
Arrhenatherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis
alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris
arundinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g.
Sorghum halepensis); and Bromus (e.g. Bromus inermis).
[0046] An "allergy" refers to acquired hypersensitivity to a
substance (allergen). Allergic conditions include eczema, allergic
rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives)
and food allergies, and other atopic conditions.
[0047] "Asthma"--refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
[0048] An "immune system deficiency" shall mean a disease or
disorder in which the subject's immune system is not functioning in
normal capacity or in which it would be useful to boost a subject's
immune response for example to eliminate a tumor or cancer (e.g.
tumors of the brain, lung (e.g. small cell and non-small cell),
ovary, breast, prostate, colon, as well as other carcinomas and
sarcomas) or an infection in a subject.
[0049] Examples of infectious virus include: Retroviridae (e.g.,
human immunodeficiency viruses, such as HIV-I (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g., strains that cause gastroenteritis);
Togaviridae (e.g., equine encephalitis viruses, rubella viruses);
Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow
fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae
(e.g., vesicular stomatitis viruses, rabies viruses); Flaviridae
(e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses);
Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g.,
reoviruses, orbiviurses and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1
and 2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxyiridae (variola viruses, vaccinia viruses, pox
viruses); and Iridoviridae (e.g., African swine fever virus); and
unclassified viruses (e.g., the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0050] Examples of infectious bacteria include: Helicobacter
pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria
spp. (e.g., M. luberculosis, M. avium, M. intracellulare, M.
kansasii, M. gordonae), Staphylococcus aureus, Neisseria
gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes,
Streptococcus pyogenev (Group A Streptococcus), Streptococcus
agalactiae (Group B Streptococcus), Streptococcus (viridans group),
Streptococcus faecalis, Streptococcus bovis, Streptococcus
(anaerobic spp.), Streptococcus pneumoniae, pathogenic
Campylobacter sp., Enterococcus sp., Haemophilus influenzae,
Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium
sp., Erysipelothrix rhusiopaihiae, Closiridium perfringens,
Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae,
Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum,
Streptobacillus moniliformis, Treponema pallidum, Treponema
pertenue, Leptospira, and Actinomyces israelli.
[0051] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
falciparum and Toxoplasma gondii.
[0052] An "immunostimulatory nucleic acid molecule" refers to a
nucleic acid molecule, which contains an unmethylated cytosine,
guanine dinucleotide sequence (i.e. "CpG DNA" or DNA containing a
cytosine followed by guanosine and linked by a phosphate bond) and
stimulates (e.g. has a mitogenic effect on, or induces or increases
cytokine expression by) a vertebrate lymphocyte. An
immunostimulatory nucleic acid molecule can be double-stranded or
single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity.
[0053] In a preferred embodiment, the immunostimulatory nucleic
acid contains a consensus mitogenic CpG motif represented by the
formula:
5' X1CGX2 3'
[0054] wherein X.sub.1 is selected from the group consisting of A,G
and T; and X.sub.2 is C or T.
[0055] In a particularly preferred embodiment, immunostimulatory
nucleic acid molecules are between 2 to 100 base pairs in size and
contain a consensus mitogenic CpG motif represented by the
formula:
5 X1X2CGX3X4 3'
[0056] wherein C and G are unmethylated, X.sub.1, X.sub.2, X.sub.3
and X4 are nucleotides.
[0057] For economic reasons, preferably the immunostimulatory CpG
DNA is in the range of between 8 to 40 base pairs in size if it is
synthesized as an oligonucleotide. Alternatively, CpG dinucleotides
can be produced on a large scale in plasmids, which after being
administered to a subject are degraded into oligonucleotides.
Preferred immunostimulatory nucleic acid molecules (e.g. for use in
increasing the effectiveness of a vaccine or to treat an immune
system deficiency by stimulating an antibody [humoral] response in
a subject) have a relatively high stimulation index with regard to
B cell, monocyte and/or natural killer cell responses (e.g.
cytokine, proliferative, lytic or other responses).
[0058] The stimulation index of a particular immunostimulatory CpG
DNA can be tested in various immune cell assays. Preferably, the
stimulation index of the immunostimulatory CpG DNA with regard to
B-cell proliferation is at least about 5, preferably at least about
10, more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with a 20 .mu.M of
ODN for 20 h at 37.degree. C. and has been pulsed with 1 Ci of
.sup.3H uridine; and harvested and counted 4h later as described in
detail in Example 1. For use in vivo, for example to treat an
immune system deficiency by stimulating a cell-mediated (local)
immune response in a subject, it is important that the
immunostimulatory CpG DNA be capable of effectively inducing
cytokine secretion by monocytic cells and/or Natural Killer (NK)
cell lytic activity.
[0059] Preferred immunostimulatory CpG nucleic acids should effect
at least about 500 pg/ml of TNF-.alpha., 15 pg/ml IFN-.gamma., 70
pg/ml of GMCSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the
therapeutic indication, as determined by the assays described in
Example 12. Other preferred immunostimulatory CpG DNAs should
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30, more preferably at least about 35 and most
preferably at least about 40% 2C11 cell specific lysis as
determined by the assay described in detail in Example 4.
[0060] A "nucleic acid" or "DNA" shall mean multiple nucleotides
(i.e. molecules comprising a sugar (e.g. ribose or deoxyribose)
linked to a phosphate group and to an exchangeable organic base,
which is either a substituted pyrimidine (e.g. cytosine (C),
thymine (T) or uracil (U)) or a substituted purine (e.g. adenine
(A) or guanine (G)). As used herein, the term refers to
ribonucleotides as well as oligodeoxyribonucleotides. The term
shall also include polynucleosides (i.e. a polynucleotide minus the
phosphate) and any other organic base containing polymer. Nucleic
acid molecules can be obtained from existing nucleic acid sources
(e.g. genomic or cDNA), but are preferably synthetic (e.g. produced
by oligonucleotide synthesis).
[0061] A "nucleic acid delivery complex" shall mean a nucleic acid
molecule associated with (e.g. ionically or covalently bound to; or
encapsulated within) a targeting means (e.g. a molecule that
results in higher affinity binding to target cell (e.g. B-cell and
natural killer (NK) cell) surfaces and/or increased cellular uptake
by target cells). Examples of nucleic acid delivery complexes
include nucleic acids associated with: a sterol (e.g. cholesterol),
a lipid (e.g. a cationic lipid, virosome or liposome), or a target
cell specific binding agent (e.g. a ligand recognized by target
cell specific receptor). Preferred complexes must be sufficiently
stable in vivo to prevent significant uncoupling prior to
internalization by the target cell. However, the complex should be
cleavable under appropriate conditions within the cell so that the
nucleic acid is released in a functional form.
[0062] "Palindromic sequence" shall mean an inverted repeat (i.e. a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double stranded structures.
[0063] A "stabilized nucleic acid molecule" shall mean a nucleic
acid molecule that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease). Stabilization can be a
function of length or secondary structure. Unmethylated CpG
containing nucleic acid molecules that are tens to hundreds of kbs
long are relatively resistant to in vivo degradation. For shorter
immunostimulatory nucleic acid molecules, secondary structure can
stabilize and increase their effect. For example, if the 3' end of
a nucleic acid molecule has self-complementarity to an upstream
region, so that it can fold back and form a sort of stem loop
structure, then the nucleic acid molecule becomes stabilized and
therefore exhibits more activity.
[0064] Preferred stabilized nucleic acid molecules of the instant
invention have a modified backbone. For use in immune stimulation,
especially preferred stabilized nucleic acid molecules are
phosphorothioate modified nucleic acid molecules (i.e. at least one
of the phosphate oxygens of the nucleic acid molecule is replaced
by sulfur). Preferably the phosphate modification occurs at or near
the 5' and/or 3' end of the nucleic acid molecule. In addition to
stabilizing nucleic acid molecules, as reported further herein,
phosphorothioate-modified nucleic acid molecules (including
phosphorodithioate-modified) can increase the extent of immune
stimulation of the nucleic acid molecule, which contains an
unmethylated CpG dinucleotide as shown herein. International Patent
Application Publication Number: WO 95/26204 entitled "Immune
Stimulation By Phosphorothioate Oligonucleotide Analogs" also
reports on the non-sequence specific immunostimulatory effect of
phosphorothioate modified oligonucleotides. As reported herein,
unmethylated CpG containing nucleic acid molecules having a
phosphorothioate backbone have been found to preferentially
activate B-cell activity, while unmethylated CpG containing nucleic
acid molecules having a phosphodiester backbone have been found to
preferentially activate monocytic (macrophages, dendritic cells and
monocytes) and NK cells. Phosphorothioate CpG oligonucleotides with
preferred human motifs are also strong activators of monocytic and
NK cells.
[0065] Other stabilized nucleic acid molecules include: nonionic
DNA analogs, such as alkyl- and aryl-phosphonates (in which the
charged phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acid molecules which contain a
diol, such as tetraethyleneglycol or hexaethyleneglycol, at either
or both termini have also been shown to be substantially resistant
to nuclease degradation.
[0066] A "subject" shall mean a human or vertebrate animal
including a dog, cat, horse, cow, pig, sheep, goat, chicken,
monkey, rat, mouse, etc.
[0067] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. Preferred vectors are those capable of autonomous
replication and expression of nucleic acids to which they are
linked (e.g., an episome). Vectors capable of directing the
expression of genes to which they are operatively linked are
referred to herein as "expression vectors." In general, expression
vectors of utility in recombinant DNA techniques are often in the
form of "plasmids" which refer generally to circular double
stranded DNA loops which, in their vector form, are not bound to
the chromosome. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
[0068] Certain Unmethylated CpG Containing Nucleic Acids Have B
Cell Stimulator Activity as Shown In Vitro and In Vivo
[0069] In the course of investigating the lymphocyte stimulatory
effects of two antisense oligonucleotides specific for endogenous
retroviral sequences, using protocols described in the attached
Examples 1 and 2, it was surprisingly found that two out of
twenty-four "controls" (including various scrambled, sense, and
mismatch controls for a panel of "antisense" ODN) also mediated B
cell activation and IgM secretion, while the other "controls" had
no effect.
[0070] Two observations suggested that the mechanism of this B cell
activation by the "control" ODN may not involve antisense effects
1) comparison of vertebrate DNA sequences listed in GenBank showed
no greater homology than that seen with non-stimulatory ODN and 2)
the two controls showed no hybridization to Northern blots with 10
.mu.g of spleen poly A+ RNA. Resynthesis of these ODN on a
different synthesizer or extensive purification by polyacrylamide
gel electrophoresis or high pressure liquid chromatography gave
identical stimulation, eliminating the possibility of an impurity.
Similar stimulation was seen using B cells from C3H/HeJ mice,
eliminating the possibility that lipopolysaccharide (LPS)
contamination could account for the results.
[0071] The fact that two "control" ODN caused B cell activation
similar to that of the two "antisense" ODN raised the possibility
that all four ODN were stimulating B cells through some
non-antisense mechanism involving a sequence motif that was absent
in all of the other nonstimulatory control ODN. In comparing these
sequences, it was discovered that all of the four stimulatory ODN
contained CpG dinucleotides that were in a different sequence
context from the nonstimulatory control.
[0072] To determine whether the CpG motif present in the
stimulatory ODN was responsible for the observed stimulation, over
300 ODN ranging in length from 5 to 42 bases that contained
methylated, unmethylated, or no CpG dinucleotides in various
sequence contexts were synthesized. These ODNs, including the two
original "controls" (ODN 1 and 2) and two originally synthesized as
"antisense" (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448
(1989)), were then examined for in vitro effects on spleen cells
(representative sequences are listed in Table 1). Several ODN that
contained CpG dinucleotides induced B cell activation and IgM
secretion; the magnitude of this stimulation typically could be
increased by adding more CpG dinucleotides (Table 1; compare ODN 2
to 2a or 3D to 3Da and 3 Db). Stimulation did not appear to result
from an antisense mechanism or impurity. ODN caused no detectable
proliferation of .gamma..delta. or other T cell populations.
[0073] Mitogenic ODN sequences uniformly became nonstimulatory if
the CpG dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D
to 3Dc; 3M to 3Ma; and 4 to 4a) or if the cytosine of the CpG
dinucleotide was replaced by 5-methylcytosine (Table 1; ODN
1b,2b,3Dd, and 3 Mb). Partial methylation of CpG motifs caused a
partial loss of stimulatory effect (compare 2a to 2c, Table 1). In
contrast, methylation of other cytosines did not reduce ODN
activity (ODN 1c, 2d, 3De and 3Mc). These data confirmed that a CpG
motif is the essential element present in ODN that activate B
cells.
[0074] In the course of these studies, it became clear that the
bases flanking the CpG dinucleotide played an important role in
determining the murine B cell activation induced by an ODN. The
optimal stimulatory motif was determined to consist of a CpG
flanked by two 5' purines (preferably a GpA dinucleotide) and two
3' pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of
ODN to bring the CpG motif closer to this ideal improved
stimulation (e.g. Table 1, compare ODN 2 to 2e; 3M to 3Md) while
mutations that disturbed the motif reduced stimulation (e.g. Table
1, compare ODN 3D to 3Df; 4 to 4b, 4c and 4d). On the other hand,
mutations outside the CpG motif did not reduce stimulation (e.g.
Table 1, compare ODN 1 to 1d; 3D to 3Dg; 3M to 3Me). For activation
of human cells, the best flanking bases are slightly different (See
Table 5).
[0075] Of those tested, ODNs shorter than 8 bases were
non-stimulatory (e.g. Table 1, ODN 4e). Among the forty-eight 8
base ODN tested, the most stimulatory sequence identified was
TCAACGTT (ODN 4) which contains the self complementary "palindrome"
AACGTT. In further optimizing this motif, it was found that ODN
containing Gs at both ends showed increased stimulation,
particularly if the ODN were rendered nuclease resistant by
phosphorothioate modification of the terminal internucleotide
linkages. ODN 1585 (5' GGGTCAACGTTGAGGGGGG 3' (SEQ ID NO:12)), in
which the first two and last five internucleotide linkages are
phosphorothioate modified caused an average 25.4 fold increase in
mouse spleen cell proliferation compared to an average 3.2 fold
increase in proliferation induced by ODN 1638, which has the same
sequence as ODN 1585 except that the 10 Gs at the two ends are
replaced by 10 As. The effect of the G-rich ends is cis; addition
of an ODN with poly G ends but no CpG motif to cells along with
1638 gave no increased proliferation. For nucleic acid molecules
longer than 8 base pairs, non-palindromic motifs containing an
unmethylated CpG were found to be more immunostimulatory.
[0076] Other octamer ODN containing a 6 base palindrome with a TpC
dinucleotide at the 5' end were also active (e.g. Table 1, ODN
4b,4c). Other dinucleotides at the 5' end gave reduced stimulation
(e.g. ODN 4f; all sixteen possible dinucleotides were tested). The
presence of a 3' dinucleotide was insufficient to compensate for
the lack of a 5' dinucleotide (e.g. Table 1, ODN 4g). Disruption of
the palindrome eliminated stimulation in octamer ODN (e-g. Table 1,
ODN 4h), but palindromes were not required in longer ODN.
1TABLE 1 Oligonucleotide Stimulation of Mouse B Cells ODN
Stimulation Index' Production Sequence (5' to 3').dagger. .sup.3
Uridine IgM 1 (SEQ ID NO:13) GCTAGACGTTAGCGT 6.1 .+-. 0.8 17.9 .+-.
3.6 1a (SEQ. ID NO:4) ......T........ 1.2 .+-. 0.2 1.7 .+-. 0.5 1b
(SEQ ID NO:14) ......Z........ 1.2 .+-. 0.1 1.8 .+-. 0.0 1c (SEQ ID
NO:15) ............Z.. 10.3 .+-. 4.4 9.5 .+-. 1.8 1d (SEQ ID NO:16)
..AT......GAGC. 13.0 .+-. 2.3 18.3 .+-. 7.5 2 (SEQ ID NO:17)
ATGGAAGGTCCAGCGTTCTC 2.9 .+-. 0.2 13.6 .+-. 2.0 2a (SEQ ID NO:18)
..C..CTC..G......... 7.7 .+-. 0.8 24.2 .+-. 3.2 2b (SEQ ID NO:19)
..Z..CTC.ZG..Z...... 1.6 .+-. 0.5 2.8 .+-. 2.2 2c (SEQ ID NO:20)
..Z..CTC..G......... 3.1 .+-. 0.6 7.3 .+-. 1.4 2d (SEQ ID NO:21)
..C..CTC..G......Z.. 7.4 .+-. 1.4 27.7 .+-. 5.4 2e (SEQ ID NO:22)
............A....... 5.6 .+-. 2.0 ND 3D (SEQ ID NO:23)
GAGAACGCTGGACCTTCCAT 4.9 .+-. 0.5 19.9 .+-. 3.6 3Da (SEQ ID NO:24)
.........C.......... 6.6 .+-. 1.5 33.9 .+-. 6.8 3Db (SEQ ID NO:25)
.........C......G.. 10.1 .+-. 2.8 25.4 .+-. 0.8 3Dc (SEQ ID NO:26)
...C.A.............. 1.0 .+-. 0.2 1.2 .+-. 0.5 3Dd (SEQ ID NO:27)
.....Z.............. 1.2 .+-. 0.2 1.0 .+-. 0.4 3De (SEQ ID NO:28)
.............Z...... 4.4 .+-. 1.2 18.8 .+-. 4.4 3Df (SEQ ID NO:29)
.......A............ 1.6 .+-. 0.1 7.7 .+-. 0.4 3Dg (SEQ ID NO:30)
.........CC.G.ACTG.. 6.1 .+-. 1.5 18.6 .+-. 1.5 3M (SEQ ID NO:31)
TCCATGTCGGTCCTGATGCT 4.1 .+-. 0.2 23.2 .+-. 4.9 3Ma (SEQ ID NO:32)
......CT............ 0.9 .+-. 0.1 1.8 .+-. 0.5 3Mb (SEQ ID NO:33)
.......Z............ 1.3 .+-. 0.3 1.5 .+-. 0.6 3Mc (SEQ ID NO:34)
...........Z........ 5.4 .+-. 1.5 8.5 .+-. 2.6 3Md (SEQ ID NO:35)
......A..T.......... 17.2 .+-. 9.4 ND 3Me (SEQ ID NO:36)
...............C..A. 3.6 .+-. 0.2 14.2 .+-. 5.2 4 TCAACGTT 6.1 .+-.
1.4 19.2 .+-. 5.2 4a ....GC.. 1.1 .+-. 0.2 1.5 .+-. 1.1 4b ...GCGC.
4.5..+-. 0.2 9.6 .+-. 3.4 4c ...TCGA. 2.7..+-. 1.0 ND 4d ..TT..AA
1.3 .+-. 0.2 ND 4e -....... 1.3 .+-. 0.2 1.1 .+-. 0.5 4f C.......
3.9 .+-. 1.4 ND 4g --......CT 1.4 .+-. 0.3 ND 4h .......C 1.2 .+-.
0.2 ND LPS 7.8 .+-. 2.5 4.8 .+-. 1.0 'Stimulation indexes are the
means and std. dev. derived from at least 3 separate experiments,
and are compared to wells cultured with no added ODN. ND = not
done. CpG dinucleotides are underlined. Dots indicate identity;
dashes indicate deletions. Z indicates 5 methyl cytosine.
[0077]
2TABLE 2 Identification of the optimal CpG motif for Murine IL-6
production and B cell activation. IL-6 (pg/ml).sup.a SEQUENCE
SPLENIC B ODN (5'-3') CH12.LX CELL SI.sup.b IgM (ng/ml).sup.c 512
(SEQ ID NO:37) TCCATGTCGGTCCTGATGCT 1300 .+-. 106 627 .+-. 43 5.8
.+-. 0.3 7315 .+-. 1324 1637 (SEQ ID NO:38) ......C.............
136 .+-. 27 46 .+-.6 1.7 .+-. 0.2 770 .+-. 72 1615 (SEQ ID NO:39)
......G............. 1201 .+-. 155 850 .+-. 202 3.7 .+-. 0.3 3212
.+-. 617 1614 (SEQ ID NO:40) ......A............. 1533 .+-. 321
1812 .+-. 103 10.8 .+-. 0.6 7558 .+-. 414 1636 (SEQ ID NO:41)
.........A.......... 1181 .+-. 76 947 .+-. 132 5.4 .+-. 0.4 3983
.+-. 485 1634 (SEQ ID NO:42) .........C.......... 1049 .+-. 223
1671 .+-. 175 9.2 .+-. 0.9 6256 .+-. 261 1619 (SEQ ID NO:43)
.........T.......... 1555 .+-. 304 2908 .+-. 129 12.5 .+-. 1.0 8243
.+-. 698 1618 (SEQ ID NO:44) ......A..T.......... 2109 .+-. 291
2596 .+-. 166 12.9 .+-. 0.7 10425 .+-. 674 1639 (SEQ ID NO:45)
.....AA..T.......... 1827 .+-. 83 2012 .+-. 132 11.5 .+-. 0.4 9489
.+-. 103 1707 (SEQ ID NO:46) ......A..TC......... ND 1147 .+-. 175
4.0 .+-. 0.2 3534 .+-. 217 1708 (SEQ ID NO:47) .....CA..TG.........
ND 59 .+-. 3 1.5 .+-. 0.1 466 .+-. 109 Dots indicate identity; CpG
dinucleotides are underlined; ND = not done .sup.aThe experiment
was done at least three times with similar results. The level of
IL-6 of unstimulated control cultures of both CH12.LX and splenic B
cells was .ltoreq.10 pg/ml. The IgM level of unstimulated culture
was 547 .+-. 82 ng/ml. CpG dinucleotides are underlined and dots
indicate identity. .sup.b[.sup.3H] Uridine uptake was indicated as
a fold increase (SI: stimulation index) from unstimulated control
(2322.67 .+-. 213.68 cpm). Cells were stimulated with 20 .mu.M of
various CpG O-ODN. Data present the mean .+-.SD of triplicates
.sup.cMeasured by ELISA.
[0078] The kinetics of lymphocyte activation were investigated
using mouse spleen cells. When the cells were pulsed at the same
time as ODN addition and harvested just four hours later, there was
already a two-fold increase in .sup.3H uridine incorporation.
Stimulation peaked at 12-48 hours and then decreased. After 24
hours, no intact ODN were detected, perhaps accounting for the
subsequent fall in stimulation when purified B cells with or
without anti-IgM (at a submitogenic dose) were cultured with CpG
ODN, proliferation was found to synergistically increase about
10-fold by the two mitogens in combination after 48 hours. The
magnitude of stimulation was concentration dependent and
consistently exceeded that of LPS under optimal conditions for
both. Oligonucleotides containing a nuclease resistant
phosphorothioate backbone were approximately two hundred times more
potent than unmodified oligonucleotides.
[0079] Cell cycle analysis was used to determine the proportion of
B cells activated by CpG-ODN. CpG-ODN induced cycling in more than
95% of B cells. Splenic B lymphocytes sorted by flow cytometry into
CD23- (marginal zone) and CD23+ (follicular) subpopulations were
equally responsive to ODN-induced stimulation, as were both resting
and activated populations of B cells isolated by fractionation over
Percoll gradients. These studies demonstrated that CpGODN induce
essentially all B cells to enter the cell cycle.
[0080] Immunostimulatory Nucleic Acid Molecules Block Murine B Cell
Apoptosis
[0081] Certain B cell lines such as WEHI-231 are induced to undergo
growth arrest and/or apoptosis in response to crosslinking of their
antigen receptor by anti-IgM (Jakway, J. P. et al., "Growth
regulation of the B lymphoma cell line WEHI-231 by
anti-immunoglobulin, lipopolysaccharide and other bacterial
products" J. Immunol. 137: 2225 (1986); Tsubata, T., J. Wu and T.
Honjo: B-cell apoptosis induced by antigen receptor crosslinking is
blocked by a T-cell signal through CD40." Nature 364: 645 (1993)).
WEHI-231 cells are rescued from this growth arrest by certain
stimuli such as LPS and by the CD40 ligand. ODN containing the CpG
motif were also found to protect WEHI-231 from anti-IgM induced
growth arrest, indicating that accessory cell populations are not
required for the effect. Subsequent work indicates that CpG ODN
induce Bcl-x and myc expression, which may account for the
protection from apoptosis. Also, CpG nucleic acids have been found
to block apoptosis in human cells. This inhibition of apoptosis is
important, since it should enhance and prolong immune activation by
CpG DNA.
[0082] Induction of Murine Cytokine Secretion by C G motifs in
Bacterial DNA or Oligonucleotides.
[0083] As described in Example 9, the amount of IL-6 secreted by
spleen cells after CpG DNA stimulation was measured by ELISA. T
cell depleted spleen cell cultures rather than whole spleen cells
were used for in vitro studies following preliminary studies
showing that T cells contribute little or nothing to the IL-6
produced by CpG DNA-stimulated spleen cells. As shown in Table 3,
ILL production was markedly increased in cells cultured with E.
coli DNA but not in cells cultured with calf thymus DNA. To confirm
that the increased IL-6 production observed with E. coli DNA was
not due to contamination by other bacterial products, the DNA was
digested with DNAse prior to analysis. DNAse pretreatment abolished
IL-6 production induced by E. coli DNA (Table 3). In addition,
spleen cells from LPS-nonresponseive C3H/HeJ mouse produced similar
levels of IL-6 in response to bacterial DNA. To analyze whether the
IL-6 secretion induced by E. coli DNA was mediated by the
unmethylated CpG dinucleotides in bacterial DNA, methylated E. coli
DNA and a panel of synthetic ODN were examined. As shown in Table
3, CpG ODN significantly induced IL-6 secretion (ODN 5a, 5b, 5c)
while CpG methylated E. coli DNA, or ODN containing methylated CpG
(ODN 5f) or no CpG (ODN 5d) did not. Changes at sites other than
CpG dinucleotides (ODN 5b) or methylation of other cytosines (ODN
5g) did not reduce the effect of CpG ODN. Methylation of a single
CpG in an ODN with three CpGs resulted in a partial reduction in
the stimulation (compare ODN 5c to 5e; Table 3).
3TABLE 3 Induction of Murine IL-6 secretion by CpG motifs in
bacterial DNA or oligonucleotides. Treatment IL-6 (pg/ml) calf
thymus DNA .ltoreq.10 calf thymus DNA + DNase .ltoreq.10 E.coli DNA
1169.5 .+-. 94.1 E. coil DNA + DNase .ltoreq.10 CpG methylated E.
coli DNA <10 LPS 280.1 .+-. 17.1 Media (no DNA) .ltoreq.10 ODN
5a SEQ ID NO:1 ATGGACTCTCCAGCGTTCTC 1096.4 .+-. 372.0 5b SEQ ID
NO:2 .....AGG....A....... 1124.5 .+-.126.2 5c SEQ ID NO:3
..C.......G......... 1783.0 .+-. 189.5 5d SEQ ID NO:4
.....AGG..C..T...... .ltoreq.10 5e SEQ ID NO:5 ..C.......G..Z......
851.1 .+-. 114.4 5f SEQ ID NO:6 ..Z......ZG..Z...... <10 5g SEQ
ID NO:7 ..C.......G......Z.. 1862.3 .+-. 87.26 T cell depleted
spleen cells from DBA/2 mice were stimulated with phosphodiester
modified oligonucleotides (O-ODN) (20 .mu.M), calf thymus DNA (50
.mu.g/li) or E. coli DNA (50 .mu.g/ml) with or without enzyme
treatment, or LPS (10 .mu.g/ml) for 24 hr. Data represent the mean
(pg/ml) .+-. SD of triplicates. CpG dinucleotides are underlined
and dots indicate identity. Z indicates 5-methylcytosine.
[0084] Identification of the Optimal CpG Motif for Induction of
Murine IL-6 and IgM Secretion and B Cell Proliferation.
[0085] To evaluate whether the optimal B cell stimulatory CpG motif
was identical with the optimal CpG motif for IL-6 secretion, a
panel of ODN in which the bases flanking the CpG dinucleotide were
progressively substituted was studied. This ODN panel was analyzed
for effects on B cell proliferation, Ig production, and IL-6
secretion, using both splenic B cells and CH12.LX cells. As shown
in Table 2, the optimal stimulatory motif is composed of an
unmethylated CpG flanked by two 5' purines and two 3' pyrimidines.
Generally a mutation of either 5' purine to pyrimidine or 3'
pyrimidine to purine significantly reduced its effects. Changes in
5' purines to C were especially deleterious, but changes in 5'
purines to T or 3' pyrimidines to purines had less marked effects.
Based on analyses of these and scores of other ODN, it was
determined that the optimal CpG motif for induction of IL-6
secretion is TGACGTT, which is identical with the optimal mitogenic
and IgM-inducing CpG motif (Table 2). This motif was more
stimulatoiy than any of the palindrome containing sequences studied
(1639, 1707 and 1708).
[0086] Titration of Induction of Murine IL-6 Secretion by CpG
Motifs.
[0087] Bacterial DNA and CpG ODN induced IL-6 production in T cell
depleted murine spleen cells in a dose-dependent manner, but
vertebrate DNA and non-CpG ODN did not (FIG. 1). IL-6 production
plateaued at approximately 50 .mu.g/ml of bacterial DNA or 40 .mu.M
of CpG O-ODN. The maximum levels of IL-6 induced by bacterial DNA
and CpG ODN were 1-1.5 ng/ml and 24 ng/ml respectively. These
levels were significantly greater than those seen after stimulation
by LPS (0.35 ng/ml) (FIG. 1A). To evaluate whether CpG ODN with a
nuclease-resistant DNA backbone would also induce IL6 production,
S-ODN were added to T cell depleted murine spleen cells. CpG S-ODN
also induced IL-6 production in a dose-dependent manner to
approximately the same level as CpG O-ODN while non-CpG S-ODN
failed to induce IL-6 (FIG. 1C). CpG S-ODN at a concentration of
0.05 .mu.M could induce maximal IL-6 production in these cells.
This result indicated that the nuclease-resistant DNA backbone
modification retains the sequence specific ability of CpG DNA to
induce IL-6 secretion and that CpG S-ODN are more than 80-fold more
potent than CpG O-ODN in this assay system.
[0088] Induction of Murine IL-6 Secretion by CpG DNA In Vivo.
[0089] To evaluate the ability of bacterial DNA and CpG S-ODN to
induce IL-6 secretion in vivo, BALB/c mice were injected iv. with
100 .mu.g of E. coli DNA, calf thymus DNA, or CpG or
non-stimulatory S-ODN and bled 2 hr after stimulation. The level of
IL-6 in the sera from the E. coli DNA injected group was
approximately 13 ng/ml while IL-6 was not detected in the sera from
calf thymus DNA or PBS injected groups (Table 4). CpG S-ODN also
induced IL-6 secretion in viva. The IL6 level in the sera from CpG
S-ODN injected groups was approximately 20 ng/ml. In contrast, IL-6
was not detected in the sera from non-stimulatory S-ODN stimulated
group (Table 4).
4TABLE 4 Secretion of Murine IL-6 induced by CpG DNA stimulation in
vivo. Stimulant IL-6 (pg/ml) PBS <50 E. coli DNA 13858 .+-. 3143
Calf Thymus DNA <50 CpG S-ODN 20715 .+-. 606 non-CpG S-ODN
<50
[0090] Mice (2 mice/group) were i.v. injected with 100 .mu.l of
PBS, 200 .mu.g of E. coli DNA or calf thymus DNA, or 500 .mu.g of
CpG S-ODN or non-CpG control S-ODN. Mice were bled 2 hr after
injection and 1:10 dilution of each serum was analyzed by IL-6
ELISA. Sensitivity limit of IL-6 ELISA was 5 pg/ml. Sequences of
the CpG S-ODN is 5'GCATGACGTTGAGCT3' (SEQ ID NO:48) and of the
non-stimulatory S-ODN is 5'GCTAGATGTTAGCGT3' (SEQ ID NO:49). Note
that although there is a CpG in sequence 48, it is too close to the
3' end to effect stimulation, as explained herein. Data represent
mean.+-.SD of duplicates. The experiment was done at least twice
with similar results.
[0091] Kinetics of Murine IL-6 Secretion after Stimulation by CpG
Motifs In Vivo.
[0092] To evaluate the kinetics of induction of IL-6 secretion by
CpG DNA in vivo, BALB/c mice were injected iv. with CpG or control
non-CpG S-ODN. Serum IL-6 levels were significantly increased
within 1 hr and peaked at 2 hr to a level of approximately 9 ng/ml
in the CpG S-ODN injected group (FIG. 2). IL-6 protein in sera
rapidly decreased after 4 hr and returned to basal level by 12 hr
after stimulation. In contrast to CpG DNA stimulated groups, no
significant increase of IL-6 was observed in the sera from the
non-stimulatory S-ODN or PBS injected groups (FIG. 2).
[0093] Tissue Distribution and Kinetics of Il-6 Mrna Expression
Induced by CpG Motifs In Vivo.
[0094] As shown in FIG. 2, the level of serum IL-6 increased
rapidly after CpG DNA stimulation. To investigate the possible
tissue origin of this serum IL-6, and the kinetics of IL-6 gene
expression in vivo after CpG DNA stimulation, BALB/c mice were
injected iv with CpG or non-CpG S-ODN and RNA was extracted from
liver, spleen, thymus, and bone marrow at various time points after
stimulation. As shown in FIG. 3A, the level of IL-6 mRNA in liver,
spleen, and thymus was increased within 30 min. after injection of
CpG S-ODN. The liver IL-6 mRNA peaked at 2 hr post-injection and
rapidly decreased and reached basal level 8 hr after stimulation
(FIG. 3A). Splenic IL-6 mRNA peaked at 2 hr after stimulation and
then gradually decreased (FIG. 3A). Thymus IL-6 mRNA peaked at 1 hr
post-injection and then gradually decreased (FIG. 3A). IL-6 mRNA
was significantly increased in bone marrow within 1 hr after CpG
S-ODN injection but then returned to basal level. In response to
CpG S-ODN, liver, spleen and thymus showed more substantial
increases in IL-6 mRNA expression than the bone marrow.
[0095] Patterns of Murine Cytokine Expression Induced by CpG
DNA
[0096] In vivo or in whole spleen cells, no significant increase in
the protein levels of the following interleukins: IL-2, IL-3, IL4,
IL-5, or IL-10 was detected within the first six hours (Klinman, D.
M. et al., (1996) Proc. Nail. Acad. Sci. USA 93:2879-2883).
However, the level of TNF-.alpha. is increased within 30 minutes
and the level of IL-6 increased strikingly within 2 hours in the
serum of Mice injected with CpG ODN. Increased expression of IL-12
and interferon gamma (IFN-.gamma.) mRNA by spleen cells was also
detected within the first two hours.
5TABLE 5 Induction of human PBMC cytokine secrtetion by CpG oligos
ODN Sequence (5'-3') IL-6' TNF-.alpha..sup.1 IFN-.gamma..sup.1
GM-CSF IL-12 512 TCCATGTCGGTCCTGATGCT 500 140 15.6 70 250 SEQ ID
NO:37 1637 ......C............. 550 16 7.8 15.6 35 SEQ ID NO:38
1615 ......G............. 600 145 7.8 45 250 SEQ ID NO:39 1614
......A............. 550 31 0 50 250 SEQ ID NO:40 1636
.........A.......... 325 250 35 40 0 SEQ ID NO:41 1634
.........C.......... 300 400 40 85 200 SEQ ID NO:42 1619
.........T.......... 275 450 200 80 >500 SEQ ID NO:43 1618
......A..T.......... 300 60 15.6 15.6 62 SEQ ID NO:44 1639
.....AA..T.......... 625 220 15.6 40 60 SEQ ID NO:45 1707
......A..TC......... 300 70 17 0 0 SEQ ID NO:46 1708
.....CA..TG......... 270 10 17 0 0 SEQ ID NO:47 dots indicate
identity; CpG dinucleotides are underlined .sup.1measured by ELISA
using Quantikine kits from R&D Systems (pg/ml) Cells were
cultured in 10% autologous serum with the indicated
oligodeoxynucleotides (12 .mu.g/ml) for 4 hr in the case of
TNF-.alpha. or 24 hr for the other cytokines before supernatant
harvest and assay. Data are presented as the level of cytokine
above that in wells with no added oligodeoxynucleotide.
[0097] CpG Induces Cytokine Secretion by Human PBMC, Specifically
Monocytes.
[0098] The same panels of ODN used for studying mouse cytokine
expression were used to determine whether human cells also are
induced by CpG motifs to express cytokine (or proliferate), and to
identify the CpG motif(s) responsible. Oligonucleotide 1619
(GTCGTT) was the best inducer of TNF-.alpha. and IFN-.gamma.
secretion, and was closely followed by a nearly identical motif in
oligonucleotide 1634 (GTCGCT) (Table 5). The motifs in
oligodeoxynucleotides 1637 and 1614 (GCCGGT and GACGGT) led to
strong IL-6 secretion with relatively little induction of other
cytokines. Thus, it appears that human lymphocytes, like murine
lymphocytes, secrete cytokines differentially in response to CpG
dinucleotides, depending on the surrounding bases. Moreover, the
motifs that stimulate murine cells best differ from those that are
most effective with human cells. Certain CpG oligodeoxynucleotides
are poor at activating human cells (oligodeoxynucleotides 1707,
1708, which contain the palindrome forming sequences GACGTC and
CACGTG respectively).
[0099] The cells responding to the DNA appear to be monocytes,
since the cytokine secretion is abolished by treatment of the cells
with L-leucyl-L-leucine methyl ester (L-LME), which is selectively
toxic to monocytes (but also to cytotoxic T lymphocytes and NK
cells), and does not affect B cell Ig secretion (Table 6, and data
not shown). The cells surviving L-LME treatment had >95%
viability by trypan blue exclusion, indicating that the lack of a
cytokine response among these cells did not simply reflect a
nonspecific death all all cell types. Cytokine secretion in
response to E. coli (EC) DNA requires unmethylated CpG motifs,
since it is abolished by methylation of the EC DNA (next to the
bottom row, Table 6). LPS contamination of the DNA cannot explain
the results since the level of contamination was identical in the
native and methylated DNA, and since addition of twice the highest
amount of contaminating LPS had no effect (not shown).
6TABLE 6 CpG DNA induces cytokine secretion by human PBMC
TNF-.alpha. IL-6 IFN-.gamma. RANTES DNA (pg/ml).sup.1 (pg/ml)
(pg/ml) (pg/ml) EC DNA (50 .mu.g/ml) 900 12,000 700 1560 EC DNA (5
.mu.g/ml) 850 11,000 400 750 EC DNA (0.5 .mu.g/ml) 500 ND 200 0 EC
DNA (0.05 .mu.g/ml) 62.5 10,000 15.6 0 EC DNA (50 .mu.g/ml) +
L-LME.sup.2 0 ND ND ND EC DNA (10 .mu.g/ml) Methyl..sup.3 0 5 ND ND
CT DNA (50 .mu.g/ml) 0 600 0 0 .sup.1Levels of all cytokines were
determined by ELISA using Quantikine kits from R&D Systems as
described in the previous table. Results are representative using
PBMC from different donors. .sup.2Cells were pretreated for 15 min.
with L-leucyl-L-leucine methyl ester (M-LME) to determine whether
the cytokine production under these conditions was from monocytes
(or other L-LME-sensitive cells). .sup.3EC DNA was methylated using
2 U/.mu.g DNA of CpG methylase (New England Biolabs) according to
the manufacturer's directions, and methylation confirmed by
digestion with Hpa-II and Msp-I. As a negative control, samples
were included containing twice the maximal amount of LPS contained
in the highest concentration of EC DNA which failed to induce
detectable cytokine production under these experimental conditions.
ND = not done
[0100] The loss of cytokine production in the PBMC treated with
L-LME suggested that monocytes may be responsible for cytokine
production in response to CpG DNA. To test this hypothesis more
directly, the effects of CpG DNA on highly purified human monocytes
and macrophages was tested. As hypothesized, CpG DNA directly
activated production of the cytokines IL-6, GM-CSF, and TNF-.alpha.
by human macrophages, whereas non-CpG DNA did not (Table 7).
7TABLE 7 CpG DNA induces cytokine expression in purified human
macrophages IL-6 (pg/ml) GM-CSF (pg/ml) TNF-.alpha. (pg/ml) Cells
alone 0 0 0 CT DNA (50 .mu.g/ml) 0 0 0 EC DNA (50 .mu.g/ml) 2000
15.6 1000
[0101] Biological Role of IL-6 in Inducing Murine IgM Production in
Response to CRG Motifs.
[0102] The kinetic studies described above revealed that induction
of IL-6 secretion, which occurs within 1 hr post CpG stimulation,
precedes IgM secretion. Since the optimal CpG motif for ODN
inducing secretion of IL-6 is the same as that for IgM (Table 2),
whether the CpG motifs independently induce IgM and IL-6 production
or whether the IgM production is dependent on prior IL-6 secretion
was examined. The addition of neutralizing anti-IL-6 antibodies
inhibited in vitro IgM production mediated by CpG ODN in a
dose-dependent manner but a control antibody did not (FIG. 4A). In
contrast, anti-IL-6 addition did not affect either the basal level
or the CpG-induced B cell proliferation (FIG. 4B).
[0103] Increased Transcriptional Activity of the Il-6 Promoter in
Response to CpG DNA.
[0104] The increased level of IL-6 mRNA and protein after CpG DNA
stimulation could result from transcriptional or
post-transcriptional regulation. To determine if the
transcriptional activity of the IL-6 promoter was upregulated in B
cells cultured with CpG ODN, a murine B cell line, WEHI-231, which
produces IL-6 in response to CpG DNA, was transfected with an ILL
promoter-CAT construct (pIL-6/CAT) (Pottratz, S. T. et al.,
17B-estradiol) inhibits expression of human
interleukin-6-promoter-reporter constructs by a receptor-dependent
mechanism. J. Clin. Invest. 93:944). CAT assays were performed
after stimulation with various concentrations of CpG or non-CpG
ODN. As shown in FIG. 5, CpG ODN induced increased CAT activity in
dose-dependent manner while non-CpG ODN failed to induce CAT
activity. This confirms that CpG induces the transcriptional
activity of the IL-6 promoter.
[0105] Dependence of B Cell Activation by CpG ODN on the Number of
5' and 3' Phosphorothioate Internucleotide Linkages.
[0106] To determine whether partial sulfur modification of the ODN
backbone would be sufficient to enhance B cell activation, the
effects of a series of ODN with the same sequence, but with
differing numbers of S internucleotide linkages at the 5' and 3'
ends were tested. Based on previous studies of nuclease degradation
of ODN, it was determined that at least two phosphorothioate
linkages at the 5' end of ODN were required to provide optimal
protection of the ODN from degradation by intracellular exo- and
endo-nucleases. Only chimeric ODN containing two 5'
phosphorothioate-modified linkages, and a variable number of 3'
modified linkages were therefore examined.
[0107] The lymphocyte stimulating effects of these ODN were tested
at three concentrations (3.3, 10, and 30 .mu.M) by measuring the
total levels of RNA synthesis (by .sup.3H uridine incorporation) or
DNA synthesis (by .sup.3H thymidine incorporation) in treated
spleen cell cultures (Example 10). O-ODN (0/0 phosphorothioate
modifications) bearing a CpG motif caused no spleen cell
stimulation unless added to the cultures at concentrations of at
least 10 .mu.M (Example 10). However, when this sequence was
modified with two S linkages at the 5' end and at least three S
linkages at the 3' end, significant stimulation was seen at a dose
of 3.3 .mu.M. At this low dose, the level of stimulation showed a
progressive increase as the number of 3' modified bases was
increased, until this reached or exceeded six, at which point the
stimulation index began to decline. In general, the optimal number
of 3' S linkages for spleen cell stimulation was five. At all three
concentrations tested in these experiments, the S-ODN was less
stimulatory than the optimal chimeric compounds.
[0108] Dependence of CpG-Mediated Lymphocyte Activation on the Type
of Backbone Modification.
[0109] Phosphorothioate modified ODN (S-ODN) are far more nuclease
resistant than phosphodiester modified ODN (O-ODN). Thus, the
increased immune stimulation caused by S-ODN and S-O-ODN (i.e.
chimeric phosphorothioate ODN in which the central linkages are
phosphodiester, but the two 5' and five 3' linkages are
phosphorothioate modified) compared to O-ODN may result from the
nuclease resistance of the former. To determine the role of ODN
nuclease resistance in immune stimulation by CpG ODN, the
stimulatory effects of chimeric ODN in which the 5' and 3' ends
were rendered nuclease resistant with either methylphosphonate
(MP-), methylphosphorothioate (MPS-), phosphorothioate (S-), or
phosphorodithioate (S.sub.2-) internucleotide linkages were tested
(Example 10). These studies showed that despite their nuclease
resistance, MP-O-ODN were actually less immune stimulatory than
O-ODN. However, combining the MP and S modifications by replacing
both nonbridging O molecules with 5' and 3' MPS internucleotide
linkages restored immune stimulation to a slightly higher level
than that triggered by O-ODN.
[0110] S-O-ODN were far more stimulatory than O-ODN, and were even
more stimulatory than S-ODN, at least at concentrations above 3.3
.mu.M. At concentrations below 3 .mu.M, the S-ODN with the 3M
sequence was more potent than the corresponding S-O-ODN, while the
S-ODN with the 3D sequence was less potent than the corresponding
S-O-ODN (Example 10). In comparing the stimulatory CpG motifs of
these two sequences, it was noted that the 3D sequence is a perfect
match for the stimulatory motif in that the CpG is flanked by two
5' purines and two 3' pyrimidines. However, the bases immediately
flanking the CpG in ODN 3D are not optimal; it has a 5' pyrimidine
and a 3' purine. Based on further testing, it was found that the
sequence requirement for immune stimulation is more stringent for
S-ODN than for S-O- or O-ODN. S-ODN with poor matches to the
optimal CpG motif cause little or no lymphocyte activation (e.g.
Sequence 3D). However, S-ODN with good matches to the motif, most
critically at the positions immediately flanking the CpG, are more
potent than the corresponding S-O-ODN (e.g. Sequence 3M, Sequences
4 and 6), even though at higher concentrations (greater than 3
.mu.M) the peak effect from the S-ODN is greater (Example 10).
[0111] S.sub.2-O-ODN were remarkably stimulatory, and caused
substantially greater lymphocyte activation than the corresponding
S-ODN or S-O-ODN at every tested concentration.
[0112] The increased B cell stimulation seen with CpG ODN bearing S
or S.sub.2 substitutions could result from any or all of the
following effects: nuclease resistance, increased cellular uptake,
increased protein binding, and altered intracellular localization.
However, nuclease resistance can not be the only explanation, since
the MP-O-ODN were actually less stimulatory than the O-ODN with CpG
motifs. Prior studies have shown that ODN uptake by lymphocytes is
markedly affected by the backbone chemistry (Zhao et al., (1993)
Comparison of cellular binding and uptake of antisense
phosphodiester, phosphorothioate, and mixed phosphorothioate and
methylphosphonate oligonucleotides. (Antisense Research and
Development 3, 53-66; Zhao et al., (1994) Stage specific
oligonucleotide uptake in murine bone marrow B cell precursors.
Blood 84, 3660-3666.) The highest cell membrane binding and uptake
was seen with S-ODN, followed by S-O-ODN, O-ODN, and MP-ODN. This
differential uptake correlates well with the degree of immune
stimulation.
[0113] Unmethylated CDG Containing Oligos Have NK Cell Stimulatory
Activity
[0114] Experiments were conducted to determine whether CpG
containing oligonucleotides stimulated the activity of natural
killer (NK) cells in addition to B cells. As shown in Table 8, a
marked induction of NK activity among spleen cells cultured with
CpG ODN 1 and 3Dd was observed. In contrast, there was relatively
no induction in effectors that had been treated with non-CpG
control ODN.
8TABLE 8 Induction Of NK Activity By CpG Oligodeoxynucleotides
(ODN) % YAC-1 Specific Lysis* % 2C11 Specific Lysis Effector:Target
Effector:Target ODN 50:1 100:1 50:1 100:1 None -1.1 -1.4 15.3 16.6
1 16.1 24.5 38.7 47.2 3Dd 17.1 27.0 37.0 40.0 non-CpG ODN -1.6 -1.7
14.8 15.4
[0115] Induction of Nk Activity by DNA Containing CpG Motifs, but
not by Non-CpG DNA.
[0116] Bacterial DNA cultured for 18 hrs. at 37.degree. C. and then
assayed for killing of K562 (human) or Yac-1 (mouse) target cells
induced NK lytic activity in both mouse spleen cells depleted of B
cells and human PBMC, but vertebrate DNA did not (Table 9). To
determine whether the stimulatory activity of bacterial DNA may bc
a consequence of its increased level of unmethylated CpG
dinucleotides, the activating properties of more than 50 synthetic
ODN containing unmethylated, methylated, or no CpG dinucleotides
was tested. The results, summarized in Table 9, demonstrate that
synthetic ODN can stimulate significant NK activity, as long as
they contain at least one unmethylated CpG dinucleotide. No
difference was observed in the stimulatory effects of ODN in which
the CpG was within a palindrome (such as ODN 1585, which contains
the palindrome AACGTT) from those ODN without palindromes (such as
1613 or 1619), with the caveat that optimal stimulation was
generally seen with ODN in which the CpG was flanked by two 5'
purines or a 5' GpT dinucleotide and two 3' pyrimidines. Kinetic
experiments demonstrated that NK activity peaked around 18 hrs.
after addition of the ODN. The data indicates that the murine NK
response is dependent on the prior activation of monocytes by CpG
DNA, leading to the production of IL-12, TNF-.alpha., and
IFN-.alpha./.beta. (Example 11).
9TABLE 9 Induction of NK Activity by DNA Containing CpG Motifs but
not by Non-CpG DNA LU/10.sup.6 Mouse Human DNA or Cytokine Added
Cells Cells Expt. 1 None 0.00 0.00 IL-2 16.68 15.82 E. coli DNA
7.23 5.05 Calf thymus DNA 0.00 0.00 Expt. 2 None 0.00 3.28 1585
gggGTCAACGTTGAgggggG (SEQ ID NO:12) 7.38 17.98 1629
.......gtc.......... (SEQ ID NO:50) 0.00 4.4 Expt. 3 None 0.00 1613
GCTAGACGTTAGTGT (SEQ ID NO:51) 5.22 1769 .......Z....... (SEQ ID
NO:52) 0.02 ND 1619 TCCATGTCGTTCCTGATGCT (SEQ ID NQ:43) 3.35 1765
.......Z............ (SEQ ID NO:53) 0.11
[0117] CpG dinucleotides in ODN sequences are indicated by
underlying; Z indicates methylcytosine. Lower case letters indicate
nuclease resistant phosphorothioate modified internucleotide
linkages which, in titration experiments, were more than 20 times
as potent as non-modified ODN, depending on the flanking bases.
Poly G ends (g) were used in some ODN, because they significantly
increase the level of ODN uptake.
[0118] From all of these studies, a more complete understanding of
the immune effects of CpG DNA has been developed, which is
summarized in FIG. 6.
[0119] Identification of B Cell and Monocyte/NK Cell-Specific
Oligonucleotides
[0120] As shown in FIG. 6, CpG DNA can directly activate highly
purified B cells and monocytic cells. There are many similarities
in the mechanism through which CpG DNA activates these cell types.
For example, both require NF.kappa.B activation as explained
further below.
[0121] In further studies of different immune effects of CpG DNA,
it was found that there is more than one type of CpG motif
Specifically, oligo 1668, with the best mouse B cell motif, is a
strong inducer of both B cell and natural killer (NK) cell
activation, while oligo 1758 is a weak B cell activator, but still
induces excellent NK responses (Table 10).
10TABLE 10 Different CpG motifs stimulate optimal murine B cell and
NK activation B cell NK ODN Sequence activation.sup.1
activation.sup.2 1668 TCCATGACGTTCCTGATGCT (SEQ ID NO:54) 42,849
2.52 1758 TCTCCCAGCGTGCGCCAT (SEQ ID NO:55) 1,747 6.66 NONE 367
0.00
[0122] CpG dinucleotides are underlined; oligonucleotides were
synthesized with phosphorothioate modified backbones to improve
their nuclease resistance. .sup.1Measured by .sup.3H thymidine
incorporation after 48 hr culture with oligodeoxynucleotides at a
200 nM concentration as described in Example 1. .sup.2Measured in
lytic units.
[0123] Teleological Basis of Immunostimulatory, Nucleic Acids
[0124] Vertebrate DNA is highly methylated and CpG dinucleotides
are underrepresented. However, the stimulatory CpG motif is common
in microbial genomic DNA, but quite rare in vertebrate DNA. In
addition, bacterial DNA has been reported to induce B cell
proliferation and immunoglobulin (Ig) production, while mammalian
DNA does not (Messina, J. P. et al., J. Immunol. 147:1759 (1991)).
Experiments further described in Example 3, in which methylation of
bacterial DNA with CpG methylase was found to abolish mitogenicity,
demonstrates that the difference in CpG status is the cause of B
cell stimulation by bacterial DNA. This data supports the following
conclusion: that unmethylated CpG dinucleotides present within
bacterial DNA are responsible for the stimulatory effects of
bacterial DNA.
[0125] Teleologically, it appears likely that lymphocyte activation
by the CpG motif represents an immune defense mechanism that can
thereby distinguish bacterial from host DNA. Host DNA, which would
commonly be present in many anatomic regions and areas of
inflammation due to apoptosis (cell death), would generally induce
little or no lymphocyte activation due to CpG suppression and
methylation. However, the presence of bacterial DNA containing
unmethylated CpG motifs can cause lymphocyte activation precisely
in infected anatomic regions, where it is beneficial. This novel
activation pathway provides a rapid alternative to T cell dependent
antigen specific B cell activation. Since the CpG pathway
synergizes with B cell activation through the antigen receptor, B
cells bearing antigen receptor specific for bacterial antigens
would receive one activation signal through cell membrane Ig and a
second signal from bacterial DNA, and would therefore tend to be
preferentially activated. The interrelationship of this pathway
with other pathways of B cell activation provide a physiologic
mechanism employing a polyclonal antigen to induce antigen-specific
responses.
[0126] However, it is likely that B cell activation would not be
totally nonspecific. B cells bearing antigen receptors specific for
bacterial products could receive one activation signal through cell
membrane Ig, and a second from bacterial DNA, thereby more
vigorously triggering antigen specific immune responses. As with
other immune defense mechanisms, the response to bacterial DNA
could have undesirable consequences in some settings. For example,
autoimmune responses to self antigens would also tend to be
preferentially triggered by bacterial infections, since
autoantigens could also provide a second activation signal to
autoreactive B cells triggered by bacterial DNA. Indeed the
induction of autoimmunity by bacterial infections is a common
clinical observance. For example, the autoimmune disease systemic
lupus erythematosus, which is: i) characterized by the production
of anti-DNA antibodies; ii) induced by drugs which inhibit DNA
methyltransferase (Cornacchia, E. J. et al., J. Clin. Invest. 92:38
(1993)); and iii) associated with reduced DNA methylation
(Richardson, B. L. et al., Arth. Rheum 35:647 (1992)), is likely
triggered at least in part by activation of DNA-specific B cells
through stimulatory signals provided by CpG motifs, as well as by
binding of bacterial DNA to antigen receptors.
[0127] Further, sepsis, which is characterized by high morbidity
and mortality due to massive and nonspecific activation of the
immune system may be initiated by bacterial DNA and other products
released from dying bacteria that reach concentrations sufficient
to directly activate many lymphocytes. Further evidence of the role
of CpG DNA in the sepsis syndrome is described in Cowdery, J., et.
al., (1996) The Journal of Immunology 156:4570-4575.
[0128] Proposed Mechanisms of Action
[0129] Unlike antigens that trigger B cells through their surface
Ig receptor, CpG-ODN did not induce any detectable Ca.sup.2+ flux,
changes in protein tyrosine phosphorylation, or IP 3 generation.
Flow cytometry with FITC-conjugated ODN with or without a CpG motif
was performed as described in Zhao, Q et al., (Antisense Research
and Development 3:53-66 (1993)), and showed equivalent membrane
binding, cellular uptake, efflux, and intracellular localization.
This suggests that there may not be cell membrane proteins specific
for CpG ODN. Rather than acting through the cell membrane, that
data suggests that unmethylated CpG containing oligonucleotides
require cell uptake for activity: ODN covalently linked to a solid
Teflon support were nonstimulatory, as were biotinylated ODN
immobilized on either avidin beads or avidin coated petri dishes.
CpG ODN conjugated to either FITC or biotin retained full mitogenic
properties, indicating no steric hindrance.
[0130] Recent data indicate the involvement of the transcription
factor NF.kappa.B as a direct or indirect mediator of the CpG
effect. For example, within 15 minutes of treating B cells or
monocytes with CpG DNA, the level of NF.kappa.B binding activity is
increased (FIG. 7). However, it is not increased by DNA that does
not contain CpG motifs. In addition, it was found that two
different inhibitors of NF.kappa.B activation, PDTC and gliotoxin,
completely block the lymphocyte stimulation by CpG DNA as measured
by B cell proliferation or monocytic cell cytokine secretion,
suggesting that NF.kappa.B activation is required for both cell
types.
[0131] There are several possible mechanisms through which
NF.kappa.B can be activated. These include through activation of
various protein kinases, or through the generation of reactive
oxygen species. No evidence for protein kinase activation induced
immediately after CpG DNA treatment of B cells or monocytic cells
have been found, and inhibitors of protein kinase A, protein kinase
C, and protein tyrosine kinases had no effects on the CpG induced
activation. However, CpG DNA causes a rapid induction of the
production of reactive oxygen species in both B cells and monocytic
cells, as detected by the sensitive fluorescent dye
dihydrorhodamine 123 as described in Royall, J. A., and
Ischiropoulos, H. (Archives of Biochemistry and Biophysics
302:348-355 (1993)). Moreover, inhibitors of the generation of
these reactive oxygen species completely block the induction of
NF.kappa.B and the later induction of cell proliferation and
cytokine secretion by CpG DNA.
[0132] Working backwards, the next question was how CpG DNA leads
to the generation of reactive oxygen species so quickly. Previous
studies by the inventors demonstrated that oligonucleotides and
plasmid or bacterial DNA are taken up by cells into endosomes.
These endosomes rapidly become acidified inside the cell. To
determine whether this acidification step may be important in the
mechanism through which CpG DNA activates reactive oxygen species,
the acidification step was blocked with specific inhibitors of
endosome acidification including chloroquine, monensin, and
bafilomycin, which work through different mechanisms. FIG. 8A shows
the results from a flow cytometry study using mouse B cells with
the dihydrorhodamine 123 dye to determine levels of reactive oxygen
species. The dye only sample in Panel A of the figure shows the
background level of cells positive for the dye at 28.6%. As
expected, this level of reactive oxygen species was greatly
increased to 80% in the cells treated for 20 minutes with PMA and
ionomycin, a positive control (Panel B). The cells treated with the
CpG oligo also showed an increase in the level of reactive oxygen
species such that more than 50% of the cells became positive (Panel
D). However, cells treated with an oligonucleotide with the
identical sequence except that the CpG was switched did not show
this significant increase in the level of reactive oxygen species
(Panel E).
[0133] In the presence of chloroquine, the results are very
different (FIG. 8B). Chloroquine slightly lowers the background
level of reactive oxygen species in the cells such that the
untreated cells in Panel A have only 4.3% that are positive.
Chloroquine completely abolishes the induction of reactive oxygen
species in the cells treated with CpG DNA (Panel B) but does not
reduce the level of reactive oxygen species in the cells treated
with PMA and ionomycin (Panel E). This demonstrates that unlike the
PMA plus ionomycin, the generation of reactive oxygen species
following treatment of B cells with CpG DNA requires that the DNA
undergo an acidification step in the endosomes. This is a
completely novel mechanism of leukocyte activation. Chloroquine,
monensin, and bafilomycin also appear to block the activation of
NF.kappa.B by CpG DNA as well as the subsequent proliferation and
induction of cytokine secretion.
[0134] Presumably, there is a protein in or near the endosomes that
specifically recognizes DNA containing CpG motifs and leads to the
generation of reactive oxygen species. To detect any protein in the
cell cytoplasm that may specifically bind CpG DNA, we used
electrophoretic mobility shift assays (EMSA) with 5' radioactively
labeled oligonucleotides with or without CpG motifs. A band was
found that appears to represent a protein binding specifically to
single stranded oligonucleotides that have CpG motifs, but not to
oligonucleotides that lack CpG motifs or to oligonucleotides in
which the CpG motif has been methylated. This binding activity is
blocked if excess of oligonucleotides that contain the NF.kappa.B
binding site was added. This suggests that an NFKB or related
protein is a component of a protein or protein complex that binds
the stimulatory CpG oligonucleotides.
[0135] No activation of CREB/ATF proteins was found at time points
where NF.kappa.B was strongly activated. These data therefore do
not provide proof that NF.kappa.B proteins actually bind to the CpG
nucleic acids, but rather that the proteins are required in some
way for the CpG activity. It is possible that a CREB/ATF or related
protein may interact in some way with NFkB proteins or other
proteins thus explaining the remarkable similarity in the binding
motifs for CREB proteins and the optimal CpG motif. It remains
possible that the oligos bind to a CREB/ATF or related protein, and
that this leads to NF.kappa.B activation.
[0136] Alternatively, it is very possible that the CpG nucleic
acids may bind to one of the TRAF proteins that bind to the
cytoplasmic region of CD40 and mediate NF.kappa.B activation when
CD40 is cross-linked. Examples of such TRAF proteins include TRAF-2
and TRAF-5.
[0137] Method for Making Immunostimulatory Nucleic Acids
[0138] For use in the instant invention, nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the .beta.-cyanoethyl phosphoramidite
method (S. L. Beaucage and M. H. Caruthers, (1981) Tet. Let.
22:1859); nucleoside H-phosphonate method (Garegg et. al., (1986)
Tet. Let. 27: 40514054; Froehler et al., (1986) Nucl. Acid Res. 14:
5399-5407; Garegg et al., (1986) Tet. Let. 27: 40554058, Gaffney et
al., (1988) Tet. Let. 29:2619-2622). These chemistries can be
performed by a variety of automated oligonucleotide synthesizers
available in the market. Alternatively, oligonucleotides can be
prepared from existing nucleic acid sequences (e.g. genomic or
cDNA) using known techniques, such as those employing restriction
enzymes, exonucleases or endonucleases.
[0139] For use in vivo, nucleic acids are preferably relatively
resistant to degradation (e.g. via endo- and exo-nucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications. A preferred stabilized nucleic acid has at least a
partial phosphorothioate modified backbone. Phosphorothioates may
be synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made e.g. as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544;
Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2'-O-methyl nucleic
acids with CpG motifs also cause immune activation, as do
ethoxy-modified CpG nucleic acids. In fact, no backbone
modifications have been found that completely abolish the CpG
effect, although it is greatly reduced by replacing the C with a
5-methyl C.
[0140] For administration in vivo, nucleic acids may be associated
with a molecule that results in higher affinity binding to target
cell (e.g. B-cell, monocytic cell and natural killer (NK) cell)
surfaces and/or increased cellular uptake by target cells to form a
"nucleic acid delivery complex". Nucleic acids can be ionically, or
covalently associated with appropriate molecules using techniques
which are well known in the art. A variety of coupling or
crosslinking agents can be used e.g. protein A, carbodiimide, and
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Nucleic acids
can alternatively be encapsulated in liposomes or virosomes using
well-known techniques
[0141] Therapeutic Uses of Immunostimulatory Nucleic Acid
Molecules
[0142] Based on their immunostimulatory properties, nucleic acid
molecules containing at least one unmethylated CpG dinucleotide can
be administered to a subject in vivo to treat an "immune system
deficiency". Alternatively, nucleic acid molecules containing at
least one unmethylated CpG dinucleotide can be contacted with
lymphocytes (e.g. B cells, monocytic cells or NK cells) obtained
from a subject having an immune system deficiency ex vivo and
activated lymphocytes can then be reimplanted in the subject.
[0143] As reported herein, in response to unmethylated CpG
containing nucleic acid molecules, an increased number of spleen
cells secrete IL-6, IL-12, IFN-.gamma., IFN-.alpha., IFN-.beta.,
IL-1, IL-3, IL-10, TNF-.alpha., TNF-.beta., GM-CSF, RANTES, and
probably others. The increased IL-6 expression was found to occur
in B cells, CD4.sup.+ T cells and monocytic cells.
[0144] Immunostimulatory nucleic acid molecules can also be
administered to a subject in conjunction with a vaccine to boost a
subject's immune system and thereby effect a better response from
the vaccine. Preferably the immunostimulatory nucleic acid molecule
is administered slightly before or at the same time as the vaccine.
A conventional adjuvant may optionally be administered in
conjunction with the vaccine, which is minimally comprised of an
antigen, as the conventional adjuvant may further improve the
vaccination by enhancing antigen absorption.
[0145] When the vaccine is a DNA vaccine at least two components
determine its efficacy. First, the antigen encoded by the vaccine
determines the specificity of the immune response. Second, if the
backbone of the plasmid contains CpG motifs, it functions as an
adjuvant for the vaccine. Thus, CpG DNA acts as an effective
"danger signal" and causes the immune system to respond vigorously
to new antigens in the area. This mode of action presumably results
primarily from the stimulatory local effects of CpG DNA on
dendritic cells and other "professional" antigen presenting cells,
as well as from the costimulatory effects on B cells.
[0146] Immunostimulatory oligonucleotides and unmethylated CpG
containing vaccines, which directly activate lymphocytes and
co-stimulate an antigen-specific response, are fundamentally
different from conventional adjuvants (e.g. aluminum precipitates),
which are inert when injected alone and are thought to work through
absorbing the antigen and thereby presenting it more effectively to
immune cells. Further, conventional adjuvants only work for certain
antigens, only induce an antibody (humoral) immune response (Th2),
and are very poor at inducing cellular immune responses (Th 1). For
many pathogens, the humoral response contributes little to
protection, and can even be detrimental.
[0147] In addition, an immunostimulatory oligonucleotide can be
administered prior to, along with or after administration of a
chemotherapy or immunotherapy to increase the responsiveness of the
malignant cells to subsequent chemotherapy or immunotherapy or to
speed the recovery of the bone marrow through induction of
restorative cytokines such as GM-CSF. CpG nucleic acids also
increase natural killer cell lytic activity and antibody dependent
cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may
likewise be beneficial in cancer immunotherapy, alone or in
conjunction with other treatments.
[0148] Another use of the described immunostimulatory nucleic acid
molecules is in desensitization therapy for allergies, which are
generally caused by IgE antibody generation against harmless
allergens. The cytokines that are induced by unmethylated CpG
nucleic acids are predominantly of a class called "Th1" which is
most marked by a cellular immune response and is associated with
IL-12 and IFN-.gamma.. The other major type of immune response is
termed a Th2 immune response, which is associated with more of an
antibody immune response and with the production of IL4, IL-5 and
IL-10. In general, it appears that allergic diseases are mediated
by Th2 type immune responses and autoimmune diseases by Th1 immune
response. Based on the ability of the immunostimulatory nucleic
acid molecules to shift the immune response in a subject from a Th2
(which is associated with production of IgE antibodies and allergy)
to a Th1 response (which is protective against allergic reactions),
an effective dose of an immunostimulatory nucleic acid (or a vector
containing a nucleic acid) alone or in conjunction with an allergen
can be administered to a subject to treat or prevent an
allergy.
[0149] Nucleic acids containing unmethylated CpG motifs may also
have significant therapeutic utility in the treatment of asthma.
Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways
of asthmatic subjects. These cytokines promote important aspects of
the asthmatic inflammatory response, including IgE isotype
switching, eosinophil chemotaxis and activation and mast cell
growth. Th1 cytokines, especially IFN-.gamma. and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines.
[0150] As described in detail in the following Example 12,
oligonucleotides containing an unmethylated CpG motif (i.e.
TCCATGACGTTCCTGACGTT; SEQ ID NO:10), but not a control
oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO:11) prevented the
development of an inflammatory cellular infiltrate and eosinophilia
in a murine model of asthma. Furthermore, the suppression of
eosinophilic inflammation was associated with a suppression of a
Th2 response and induction of a Th1 response.
[0151] For use in therapy, an effective amount of an appropriate
immunostimulatory nucleic acid molecule alone or formulated as a
delivery complex can be administered to a subject by any mode
allowing the oligonucleotide to be taken up by the appropriate
target cells (e.g., B-cells and monocytic cells). Preferred routes
of administration include oral and transdermal (e.g., via a patch).
Examples of other routes of administration include injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.). The injection can be in a bolus or a continuous
infusion.
[0152] A nucleic acid alone or as a nucleic acid delivery complex
can be administered in conjunction with a pharmaceutically
acceptable carrier. As used herein, the phrase "pharmaceutically
acceptable carrier" is intended to include substances that can be
coadministered with a nucleic acid or a nucleic acid delivery
complex and allows the nucleic acid to perform its indicated
function. Examples of such carriers include solutions, solvents,
dispersion media, delay agents, emulsions and the like. The use of
such media for pharmaceutically active substances are well known in
the art. Any other conventional carrier suitable for use with the
nucleic acids falls within the scope of the instant invention.
[0153] The language "effective amount" of a nucleic acid molecule
refers to the amount necessary or sufficient to realize a desired
biologic effect. For example, an effective amount of a nucleic acid
containing at least one unmethylated CpG for treating an immune
system deficiency could be that amount necessary to eliminate a
tumor, cancer, or bacterial, viral or fungal infection. An
effective amount for use as a vaccine adjuvant could be that amount
useful for boosting a subjects immune response to a vaccine. An
"effective amount" for treating asthma can be that amount useful
for redirecting a Th2 type of immune response that is associated
with asthma to a Th1 type of response. The effective amount for any
particular application can vary depending on such factors as the
disease or condition being treated, the particular nucleic acid
being administered (e.g. the number of unmethylated CpG motifs or
their location in the nucleic acid), the size of the subject, or
the severity of the disease or condition. One of ordinary skill in
the art can empirically determine the effective amount of a
particular oligonucleotide without necessitating undue
experimentation.
[0154] The present invention is further illustrated by the
following Examples which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Example 1
Effects of ODNs on B Cell Total RNA Synthesis and Cell Cycle
[0155] B cells were purified from spleens obtained from 6-12 wk old
specific pathogen free DBA/2 or BXSB mice (bred in the University
of Iowa animal care facility; no substantial strain differences
were noted) that were depleted of T cells with anti-Thy-1.2 and
complement and centrifugation over lympholyte M (Cedarlane
Laboratories, Hornby, Ontario, Canada) ("B cells"). B cells
contained fewer than 1% CD4.sup.+ or CD8.sup.+ cells.
8.times.10.sup.4 B cells were dispensed in triplicate into 96 well
microtiter plates in 100 .mu.l RPMI containing 10% FBS (heat
inactivated to 65.degree. C. for 30 min.), 50 .mu.M
2-mercaptoethanol, 100 U/ml penicillin, 100 ug/ml streptomycin, and
2 mM L-glutamate. 20 .mu.M ODN were added at the start of culture
for 20 h at 37.degree. C., cells pulsed with 1 .mu.Ci of 3H
uridine, and harvested and counted 4 hr later. Ig secreting B cells
were enumerated using the ELISA spot assay after culture of whole
spleen cells with ODN at 20 .mu.M for 48 hr. Data, reported in
Table 1, represent the stimulation index compared to cells cultured
without ODN. .sup.3H thymidine incorporation assays showed similar
results, but with some nonspecific inhibition by thymidine released
from degraded ODN (Matson. S and A. M. Krieg (1992) Nonspecific
suppression of .sup.3H-thymidine incorporation by control
oligonucleotides. Antisense Research and Development 2:325).
Example 2
Effects of ODN on Production of IgM from B Cells
[0156] Single cell suspensions from the spleens of freshly killed
mice were treated with anti-Thyl, anti-CD4, and anti-CD8 and
complement by the method of Leibson et al., J. Exp. Med. 154:1681
(1981)). Resting B cells (<0.2% T cell contamination) were
isolated from the 63-70% band of a discontinuous Percoll gradient
by the procedure of DeFranco et al, J. Exp. Med. 155:1523 (1982).
These were cultured as described above in 30 .mu.M ODN or 20
.mu.g/ml LPS for 48 hr. The number of B cells actively secreting
IgM was maximal at this time point, as determined by ELIspot assay
(Klinman, D. M. et al. J. Immunol. 144:506 (1990)). In that assay,
B cells were incubated for 6 hrs on anti-1 g coated microtiter
plates. The Ig they produced (>99% IgM) was detected using
phosphatase-labelled anti-Ig (Southern Biotechnology Associated,
Birmingham, Ala.). The antibodies produced by individual B cells
were visualized by addition of BCIP (Sigma Chemical Co., St. Louis
Mo.) which forms an insoluble blue precipitate in the presence of
phosphatase. The dilution of cells producing 20-40 spots/well was
used to determine the total number of antibody-secreting B
cells/sample. All assays were performed in triplicate (data
reported in Table 1). In some experiments, culture supernatants
were assayed for IgM by ELISA, and showed similar increases in
response to CpG-ODN.
Example 3
B cell Stimulation by Bacterial DNA
[0157] DBA/2 B cells were cultured with no DNA or 50 .mu.g/ml of a)
Micrococcus lysodeikticus; b) NZB/N mouse spleen; and c) NFS/N
mouse spleen genomic DNAs for 48 hours, then pulsed with .sup.3H
thymidine for 4 hours prior to cell harvest. Duplicate DNA samples
were digested with DNAse I for 30 minutes at 37 C. prior to
addition to cell cultures. E coli DNA also induced an 8.8 fold
increase in the number of IgM secreting B cells by 48 hours using
the ELISA-spot assay.
[0158] DBA/2 B cells were cultured with either no additive, 50
.mu.g/ml LPS or the ODN 1; 1a; 4; or 4a at 20 .mu.M. Cells were
cultured and harvested at 4, 8, 24 and 48 hours. BXSB cells were
cultured as in Example 1 with 5, 10, 20, 40 or 80 .mu.M of ODN 1;
1a; 4; or 4a or LPS. In this experiment, wells with no ODN had 3833
cpm. Each experiment was performed at least three times with
similar results. Standard deviations of the triplicate wells were
<5%.
Example 4
Effects of ODN on Natural Killer INK) Activity
[0159] 10.times.10.sup.6 C57BL/6 spleen cells were cultured in two
ml RPMI (supplemented as described for Example 1) with or without
40 .mu.M CpG or non-CpG ODN for forty-eight hours. Cells were
washed, and then used as effector cells in a short term .sup.51Cr
release assay with YAC-1 and 2C11, two NK sensitive target cell
lines (Ballas, Z. K. et al. (1993) J. Immunol. 150:17). Effector
cells were added at various concentrations to 10.sup.4 51Cr-labeled
target cells in V-bottom microtiter plates in 0.2 ml, and incubated
in 5% CO.sub.2 for 4 hr. at 37.degree. C. Plates were then
centrifuged, and an aliquot of the supernatant counted for
radioactivity. Percent specific lysis was determined by calculating
the ratio of the .sup.51Cr released in the presence of effector
cells minus the .sup.51Cr released when the target cells are
cultured alone, over the total counts released after cell lysis in
2% acetic acid minus the .sup.51Cr cpm released when the cells are
cultured alone.
Example 5
In Vivo Studies with CpG Phosphorothioate ODN
[0160] Mice were weighed and injected IP with 0.25 ml of sterile
PBS or the indicated phophorothioate ODN dissolved in PBS. Twenty
four hours later, spleen cells were harvested, washed, and stained
for flow cytometry using phycoerythrin conjugated 6B2 to gate on B
cells in conjunction with biotin conjugated anti Ly-6A/E or
anti-1a.sup.d (Pharmingen, San Diego, Calif.) or anti-Bla-1 (Hardy,
R. R. et al., J. Exp. Med. 159:1169 (1984). Two mice were studied
for each condition and analyzed individually.
Example 6
Titration of Phosphorothioate ODN for B Cell Stimulation
[0161] B cells were cultured with phosphorothioate ODN with the
sequence of control ODN 1a or the CpG ODN 1d and 3 Db and then
either pulsed after 20 hr with .sup.3H uridine or after 44 hr with
.sup.3H thymidine before harvesting and determining cpm.
Example 7
Rescue of B Cells From Apoptosis
[0162] WEHI-231 cells (5.times.10.sup.4/well) were cultured for 1
hr. at 37 C. in the presence or absence of LPS or the control ODN
1a or the CpG ODN 1d and 3 Db before addition of anti-IgM
(1.mu./ml). Cells were cultured for a further 20 hr. before a 4 hr.
pulse with 2 .mu.Ci/well .sup.3H thymidine. In this experiment,
cells with no ODN or anti-IgM gave 90.4.times.10.sup.3 cpm of
.sup.3H thymidine incorporation by addition of anti-IgM. The
phosphodiester ODN shown in Table 1 gave similar protection, though
with some nonspecific suppression due to ODN degradation. Each
experiment was repeated at least 3 times with similar results.
Example 8
In Vivo Induction of Murine IL-6
[0163] DBA/2 female mice (2 mos. old) were injected IP with 500
.mu.g CpG or control phosphorothioate ODN. At various time points
after injection, the mice were bled. Two mice were studied for each
time point. IL-6 was measured by Elisa, and IL-6 concentration was
calculated by comparison to a standard curve generated using
recombinant IL-6. The sensitivity of the assay was 10 pg/ml. Levels
were undetectable after 8 hr.
Example 9
Systemic Induction of Murine IL-6 Transcription
[0164] Mice and cell lines. DBA/2, BALB/c, and C3H/HeJ mice at 5-10
wk of age were used as a source of lymphocytes. All mice were
obtained from The Jackson Laboratory (Bar Harbor, Me.), and bred
and maintained under specific pathogen-free conditions in the
University of Iowa Animal Care Unit. The mouse B cell line CH12.LX
was kindly provided by Dr. G. Bishop (University of Iowa, Iowa
City).
[0165] Cell preparation. Mice were killed by cervical dislocation.
Single cell suspensions were prepared aseptically from the spleens
from mice. T cell depleted mouse splenocytes were prepared by using
anti-Thy-1.2 and complement and centrifugation over lympholyte M
(Cedarlane Laboratories, Hornby, Ontario, Canada) as described
(Krieg, A. M. et al., (1989) A role for endogenous retroviral
sequences in the regulation of lymphocyte activation. J. Immunol.
143:2448).
[0166] ODN and DNA. Phosphodiester oligonucleotides (O-ODN) and the
backbone modified phosphorothioate oligonucleotides (S-ODN) were
obtained from the DNA Core facility at the University of Iowa or
from Operon Technologies (Alameda, Calif.). E. coli DNA (Strain B)
and calf thymus DNA were purchased from Sigma (St. Louis, Mo.). All
DNA and ODN were purified by extraction with
phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol
precipitation. E. coli and calf thymus DNA were single stranded
prior to use by boiling for 10 min. followed by cooling on ice for
5 min. For some experiments, E. coli and calf thymus DNA were
digested with DNAse I (2 U/.mu.g of DNA) at 37.degree. C. for 2 hr
in 1.times.SSC with 5 mM MgCl.sub.2. To methylate the cytosine in
CpG dinucleotides in E. coli DNA, E. coli DNA was treated with CpG
methylase (M. SssI; 2 U/.mu.g of DNA) in NEBuffer 2 supplemented
with 160 .mu.M S-adenosyl methionine and incubated overnight at
37.degree. C. Methylated DNA was purified as above. Efficiency of
methylation was confirmed by Hpa II digestion followed by analysis
by gel electrophoresis. All enzymes were purchased from New England
Biolabs (Beverly, Mass.). LPS level in ODN was less than 12.5 ng/mg
and E. coli and calf thymus DNA contained less than 2.5 ng of
LPS/mg of DNA by Limulus assay.
[0167] Cell Culture. All cells were cultured at 37.degree. C. in a
5% CO.sub.2 humidified incubator maintained in RPMI-1640
supplemented with 10% (v/v) heat inactivated fetal calf serum
(FCS), 1.5 mM L-glutamine, 50 .mu.g/ml), CpG or non-CpG
phosphodiester ODN (O-ODN) (20 .mu.M), phosphorothioate ODN (S-ODN)
(0.5 .mu.M), or E. coli or calf thymus DNA (50 .mu.g/ml) at
37.degree. C. for 24 hr. (for IL-6 production) or 5 days (for IgM
production). Concentrations of stimulants were chosen based on
preliminary studies with titrations. In some cases, cells were
treated with CpG O-DN along with various concentrations (1-10
.mu.g/ml) of neutralizing rat IgG1 antibody against murine IL-6
(hybridoma MP5-20F3) or control rat IgG1 mAb to E. coli
.beta.-galactosidase (hybridoma GL113; ATCC, Rockville, Md.) (20)
for 5 days. At the end of incubation, culture supernatant fractions
were analyzed by ELISA as below.
[0168] In vivo induction of IL-6 and IgM. BALB/c mice were injected
intravenously (iv) with PBS, calf thymus DNA (200 .mu.g/100
.mu.l/100 PBS/mouse), E. coli DNA (200 .mu.g/100 .mu.l PBS/mouse),
or CpG or non-CpG S-ODN (200 .mu.g/100 .mu.l PBS/mouse). Mice
(two/group) were bled by retroorbital puncture and sacrificed by
cervical dislocation at various time points. Liver, spleen, thymus,
and bone marrow were removed and RNA was prepared from those organs
using RNAzol B (Tel-Test, Friendswood, Tex.) according to the
manufacturers protocol.
[0169] ELISA. Flat-bottomed Immun 1 plates (Dynatech Laboratories,
Inc., Chantilly, Va.) were coated with 100 .mu.l/well of anti-mouse
IL-6 mAb (MP5-20F3) (2 .mu.g/ml) or anti-mouse IgM .mu.-chain
specific (5 .mu.g/ml; Sigma, St. Louis, Mo.) in
carbonate-bicarbonate, pH 9.6 buffer (15 nM Na.sub.2CO.sub.3, 35 mM
NaHCO.sub.3) overnight at 4.degree. C. The plates were then washed
with TPBS (0.5 mM MgCl.sub.2o6H.sub.2O, 2.68 mM KCl, 1.47 mM
KH.sub.2PO.sub.4, 0.14 M NaCl, 6.6 mM K.sub.2HPO.sub.4, 0.5% Tween
20) and blocked with 10% FCS in TPBS for 2 hr at room temperature
and then washed again. Culture supernatants, mouse sera,
recombinant mouse IL-6 (Pharmingen, San Diego, Calif.) or purified
mouse IgM (Calbiochem, San Diego, Calif.) were appropriately
diluted in 10% FCS and incubated in triplicate wells for 6 hr at
room temperature. The plates were washed and 100 .mu.l/well of
biotinylated rat anti-mouse IL-6 monoclonal antibodies (MP5-32C11,
Pharmingen, San Diego, Calif.) (1 .mu.g/ml in 10% FCS) or
biotinylated anti-mouse Ig (Sigma, St. Louis, Mo.) were added and
incubated for 45 min. at room temperature following washes with
TPBS. Horseradish peroxidase (HRP) conjugated avid in (Bio-rad
Laboratories, Hercules, Calif.) at 1:4000 dilution in 10% FCS (100
.mu.l/well) was added and incubated at room temperature for 30 min.
The plates were washed and developed with o-phenylendiamine
dihydrochloride (OPD; Sigma, St. Louis Mo.) 0.05 M
phosphate-citrate buffer, pH 5.0, for 30 min. The reaction was
stopped with 0.67 N H.sub.2SO.sub.4 and plates were read on a
microplate reader (Cambridge Technology, Inc., Watertown, Mass.) at
490-600 nm. The results are shown in FIGS. 1 and 2.
[0170] RT-PCR. A sense primer, an antisense primer, and an internal
oligonucleotide probe for IL6 were synthesized using published
sequences (Montgomery, R. A. and M. S. Dallman (1991), Analysis of
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554). cDNA synthesis
and IL-6 PCR was done essentially as described by Montgomery and
Dallman (Montgomery, R. A. and M. S. Dallman (1991), Analysis of
cytokine gene expression during fetal thymic ontogeny using the
polymerase chain reaction (J. Immunol.) 147:554) using RT-PCR
reagents from Perkin-Elmer Corp. (Hayward, Calif.). Samples were
analyzed after 30 cycles of amplification by gel electrophoresis
followed by unblot analysis (Stoye, J. P. et al., (1991) DNA
hybridization in dried gels with fragmented probes: an improvement
over blotting techniques, Techniques 3:123). Briefly, the gel was
hybridized at room temperature for 30 min. in denaturation buffer
(0.05 M NaOH, 1.5 M NaCl) followed by incubation for 30 min. in
renaturation buffer (1.5 M NaCl, 1 M Tris, pH 8) and a 30 min. wash
in double distilled water. The gel was dried and prehybridized at
47.degree. C. for 2 hr. hybridization buffer (5.times. SSPE, 0.1%
SDS) containing 10 .mu.g/ml denatured salmon sperm DNA. The gel was
hybridized with 2.times.10.sup.6 cpm/ml .gamma.-[.sup.32 P]ATP
end-labeled internal oligonucleotide probe for IL-6
(5'CATTTCCACGATTTCCCA3') SEQ ID NO:56) overnight at 47.degree. C.,
washed 4 times (2.times.SSC, 0.2% SDS) at room temperature and
autoradiographed. The results are shown in FIG. 3.
[0171] Cell Proliferation assay. DBA/2 mice spleen B cells
(5.times.10.sup.4 cells/100 .mu.l/well) were treated with media,
CpG or non-CpG S-ODN (0.5 .mu.M) or O-ODN (20 .mu.M) for 24 hr at
37.degree. C. Cells were pulsed for the last four hr. with either
[.sup.3H] Thymidine or [.sup.3H] Uridine (1 .mu.Ci/well). Amounts
of [.sup.3H] incorporated were measured using Liquid Scintillation
Analyzer (Packard Instrument Co., Downers Grove, Ill.).
[0172] Transfections and CAT assays. WEHI-231 cells (10.sup.7
cells) were electroporated with 20 .mu.g of control or human IL-6
promoter-CAT construct (kindly provided by S. Manolagas, Univ. of
Arkansas) (Pottratz, S. T. et al., (1994) 17B-estradiol inhibits
expression of human interleukin6 promoter-reporter constructs by a
receptor-dependent mechanism. J. Clin. Invest 93:944) at 250 mV and
960 .mu.F. Cells were stimulated with various concentrations or CpG
or non-CpG ODN after electroporation. Chloramphenicol
acetyltransferase (CAT) activity was measured by a solution assay
(Seed, B. and J. Y. Sheen (1988) A single phase-extraction assay
for chloramphenicol acetyl transferase activity. Gene 76:271) 16
hr. after transfection. The results are presented in FIG. 5.
Example 10
Oligodeoxynucleotide Modifications Determine the Magnitude of B
Cell Stimulation by CQG Motifs
[0173] ODN were synthesized on an Applied Biosystems Inc. (Foster
City, Calif.) model 380A, 380B, or 394 DNA synthesizer using
standard procedures (Beacage and Caruthers (1981) Deoxynucleoside
phosphoramidites--A new class of key intermediates for
deoxypolynucleotide synthesis. Tetrahedron Letters 22, 1859-1862.).
Phosphodiester ODN were synthesized using standard beta-cyanoethyl
phosphoramidite chemistry. Phosphorothioate linkages were
introduced by oxidizing the phosphite linkage with elemental sulfur
instead of the standard iodine oxidation. The four common
nucleoside phosphoramidites were purchased from Applied Biosystems.
All phosphodiester and thioate containing ODN were deprotected by
treatment with concentrated ammonia at 55.degree. C. for 12 hours.
The ODN were purified by gel exclusion chromatography and
lyophilized to dryness prior to use. Phosphorodithioate linkages
were introduced by using deoxynucleoside S-(b-benzoylmercaptoethyl)
pyrrolidino thiophosphoramidites (Wiesler, W. T. et al., (1993) In
Methods in Molecular Biology: Protocols for Oligonucleotides and
Analogs-Synthesis and Properties, Agrawal, S. (ed.), Humana Press,
191-206.). Dithioate containing ODN were deprotected by treatment
with concentrated ammonia at 55.degree. C. for 12 hours followed by
reverse phase HPLC purification.
[0174] In order to synthesize oligomers containing
methylphosphonothioates or methylphosphonates as well as
phosphodiesters at any desired internucleotide linkage, two
different synthetic cycles were used. The major synthetic
differences in the two cycles are the coupling reagent where
dialkylaminomethylnucleoside phosphines are used and the oxidation
reagents in the case of methylphosphonothioates. In order to
synthesize either derivative, the condensation time has been
increased for the dialkylaminomethylnucleoside phosphines due to
the slower kinetics of coupling (Jager and Engels, (1984) Synthesis
of deoxynucleoside methylphosphonates via a phosphonamidite
approach. Tetrahedron Letters 24, 1437-1440). After the coupling
step has been completed, the methylphosphinodiester is treated with
the sulfurizing reagent (5% elemental sulfur, 100 millimolar
N,N-diamethylaminopyridine in carbon
disulfide/pyridine/triethylamine), four consecutive times for 450
seconds each to produce methylphosphonothioates. To produce
methylphosphonate linkages, the methylphosphinodiester is treated
with standard oxidizing reagent (0.1 M iodine in
tetrahydrofuran/2,6-lutidine/water).
[0175] The silica gel bound oligomer was treated with distilled
pyridine/concentrated ammonia, 1:1, (v/v) for four days at 4
degrees centigrade. The supernatant was dried in vacuo, dissolved
in water and chromatographed on a G50/50 Sephadex column.
[0176] As used herein, O-ODN refers to ODN which are
phosphodiester; S-ODN are completely phosphorothioate modified;
S-O-ODN are chimeric ODN in which the central linkages are
phosphodiester, but the two 5' and five 3' linkages are
phosphorothioate modified; S.sub.2-O-ODN are chimeric ODN in which
the central linkages are phosphodiester, but the two 5' and five 3'
linkages are phosphorodithioate modified; and MP-O-ODN are chimeric
ODN in which the central linkages are phosphodiester, but the two
5' and five 3' linkages are methylphosphonate modified. The ODN
sequences studied (with CpG dinucleotides indicated by underlining)
include:
11 3D (5'GAGAACGCTGGACCTTCCAT),; (SEQ ID NO:14) 3M
(5'TCCATGTCGGTCCTGATGCT),; (SEQ ID NO:22) 5
(5'GGCGTTATTCCTGACTCGCC),; (SEQ ID NO:57) and
6(5'CCTACGTTGTATGCGCCCAGCT),. (SEQ ID NO:58).
[0177] These sequences are representative of literally hundreds of
CpG and non-CpG ODN that have been tested in the course of these
studies.
[0178] Mice. DBA/2, or BXSB mice obtained from The Jackson
Laboratory (Bar Harbor, Me.), and maintained under specific
pathogen-free conditions were used as a source of lymphocytes at
5-10 wk of age with essentially identical results.
[0179] Cell proliferation assay. For cell proliferation assays,
mouse spleen cells (5.times.10.sup.4 cells/100 .mu.l/well) were
cultured at 37.degree. C. in a 5% CO.sub.2 humidified incubator in
RPMI-1640 supplemented with 10% (v/v) heat inactivated fetal calf
serum (heated to 65.degree. C. for experiments with O-ODN, or
56.degree. C. for experiments using only modified ODN), 1.5 .mu.M
L-glutamine, 50 .mu.M 2-mercaptoethanol, 100 U/ml penicillin and
100 .mu.g/ml streptomycin for 24 hr or 48 hr as indicated. 1 .mu.Ci
of .sup.3H uridine or thymidine (as indicated) was added to each
well, and the cells harvested after an additional 4 hours of
culture. Filters were counted by scintillation counting. Standard
deviations of the triplicate wells were <S %. The results are
presented in FIGS. 6-8.
Example 11
Induction of NK Activity
[0180] Phosphodiester ODN were purchased from Operon Technologies
(Alameda, Calif.). Phosphorothioate ODN were purchased from the DNA
core facility, University of Iowa, or from The Midland Certified
Reagent Company (Midland Tex.). E. coli (strain B) DNA and calf
thymus DNA were purchased from Sigma (St. Louis, Mo.). All DNA and
ODN were purified by extraction with phenol:chloroform:isoamyl
alcohol (25:24:1) and/or ethanol precipitation. The LPS level in
ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA
contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
[0181] Virus-free, 4-6 week old, DBA/2, C57BU6 (B6) and
congenitally athymic BALB/C mice were obtained on contract through
the Veterans Affairs from the National Cancer Institute (Bethesda,
Md.). C57BU6 SCID mice were bred in the SPF barrier facility at the
University of Iowa Animal Care Unit.
[0182] Human peripheral mononuclear blood leukocytes (PBMC) were
obtained as previously described (Ballas, Z. K. et al., (1990) J.
Allergy Clin. Immunol. 85:453; Ballas, Z. K. and W. Rasmussen
(1990) J. Immunol. 145:1039; Ballas, Z. K. and W. Rasmussen (1993)
J. Immunol. 150; 17). Human or murine cells were cultured at
5.times.10.sup.6/well, at 37.degree. C. in a 5% CO.sub.2 humidified
atmosphere in 24-well plates (Ballas, Z. K. et al., (1990) J.
Allergy Clin. Immunol. 85:453; Ballas, Z. K. and W. Rasmussen
(1990) J. Immunol 145:1039; and Ballas, Z. K. and W. Rasmussen
(1993) J. Immunol, 150:17), with medium alone or with CpG or
non-CpG ODN at the indicated concentrations, or with E. coli or
calf thymus (50 .mu.g/ml) at 37.degree. C. for 24 hr. All cultures
were harvested at 18 hr. and the cells were used as effectors in a
standard 4 hr. .sup.51Cr-release assay against K562 (human) or
YAC-1 (mouse) target cells as previously described. For calculation
of lytic units (LU), 1 LU was defined as the number of cells needed
to effect 30% specific lysis. Where indicated, neutralizing
antibodies against IFN-.beta. (Lee Biomolecular, San Diego, Calif.)
or IL-12 (C15.1, C15.6, C17.8, and C17.15; provided by Dr. Giorgio
Trinchieri, The Wistar Institute, Philadelphia, Pa.) or their
isotype controls were added at the initiation of cultures to a
concentration of 10 .mu.g/ml. For anti-IL-12 addition, 10 .mu.g of
each of the 4 MAB (or isotype controls) were added simultaneously.
Recombinant human IL-2 was used at a concentration of 100 U/ml.
Example 12
Prevention of the Development of an Inflammatory Cellular
Infiltrate and Eosinophilia in a Murine Model of Asthma
[0183] 6-8 week old C56BL/6 mice (from The Jackson Laboratory, Bar
Harbor, Me.) were immunized with 5,000 Schistosoma mansoni eggs by
intraperitoneal (i.p.) injection on days 0 and 7. Schistosoma
mansoni eggs contain an antigen (Schistosoma mansoni egg antigen
(SEA)) that induces a Th2 immune response (e.g. production of IgE
antibody). IgE antibody production is known to be an important
cause of asthma.
[0184] The immunized mice were then treated with oligonucleotides
(30 .mu.g in 200 .mu.l saline by i.p. injection), which either
contained an unmethylated CpG motif (i.e. TCCATGACGTTCCTGACGTT SEQ
ID NO.10) or did not (i.e. control, TCCATGAGCTTCCTGAGTCT; SEQ ID
NO.11). Soluble SEA (10 .mu.g in 25 .mu.l of saline) was
administered by intranasal instillation on days 14 and 21. Saline
was used as a control.
[0185] Mice were sacrificed at various times after airway
challenge. Whole lung lavage was performed to harvest airway and
alveolar inflammatory cells. Cytokine levels were measured from
lavage fluid by ELISA. RNA was isolated from whole lung for
Northern analysis and RT-PCR studies using CsCl gradients. Lungs
were inflated and perfused with 4% paraformaldehyde for histologic
examination.
[0186] FIG. 9 shows that when the mice are initially injected with
the eggs i.p., and then inhale the egg antigen (open circle), many
inflammatory cells are present in the lungs. However, when the mice
are initially given a nucleic acid containing an unmethylated CpG
motif along with the eggs, the inflammatory cells in the lung are
not increased by subsequent inhalation of the egg antigen (open
triangles).
[0187] FIG. 10 shows that the same results are obtained when only
eosinophils present in the lung lavage are measured. Eosinophils
are the type of inflammatory cell most closely associated with
asthma.
[0188] FIG. 11 shows that when the mice are treated with a control
oligo at the time of the initial exposure to the egg, there is
little effect on the subsequent influx of eosinophils into the
lungs after inhalation of SEA. Thus, when mice inhale the eggs on
days 14 or 21, they develop an acute inflammatory response in the
lungs. However, giving a CpG oligo along with the eggs at the time
of initial antigen exposure on days 0 and 7 almost completely
abolishes the increase in eosinophils when the mice inhale the egg
antigen on day 14.
[0189] FIG. 12 shows that very low doses of oligonucleotide (<10
.mu.g) can give this protection.
[0190] FIG. 13 shows that the resultant inflammatory response
correlates with the levels of the Th2 cytokine IL-4 in the
lung.
[0191] FIG. 14 shows that administration of an oligonucleotide
containing an unmethylated CpG motif can actually redirect the
cytokine response of the lung to production of II-12, indicating a
Th1 type of immune response.
[0192] FIG. 15 shows that administration of an oligonucleotide
containing an unmethylated CpG motif can also redirect the cytokine
response of the lung to production of IFN-.gamma., indicating a Th1
type of immune response.
Example 13
CDG Otlionucteotides Induce Human PBMC to Secrete Cytokines
[0193] Human PBMC were prepared from whole blood by standard
centrifugation over ficoll hypaque. Cells (5.times.10.sup.5/ml)
were cultured in 10% autologous serum in 96 well microtiter plates
with CpG or control oligodeoxynucleotides (24 .mu.g/ml for
phosphodiester oligonucleotides; 6 .mu.g/ml for nuclease resistant
phosphorothioate oligonucleotides) for 4 hr in the case of
TNF-.alpha. or 24 hr. for the other cytokines before supernatant
harvest and assay, measured by ELISA using Quantikine kits or
reagents from R&D Systems (pg/ml) or cytokine ELISA kits from
Biosource (for IL-12 assay). Assays were performed as per the
manufacturer's instructions. Data are presented in Table 6 as the
level of cytokine above that in wells with no added
oligodeoxynucleotide.
[0194] Equivalents
[0195] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
56 1 20 DNA Artificial Sequence Synthetic oligonucleotide 1
atggaaggtc cagtgttctc 20 2 20 DNA Artificial Sequence Synthetic
oligonucleotide 2 atcgacctac gtgcgttctc 20 3 20 DNA Artificial
Sequence Synthetic oligonucleotide 3 tccataacgt tcctgatgct 20 4 15
DNA Artificial Sequence Synthetic oligonucleotide 4 gctagatgtt
agcgt 15 5 19 DNA Artificial Sequence Synthetic oligonucleotide 5
gagaacgtcg accttcgat 19 6 15 DNA Artificial Sequence Synthetic
oligonucleotide 6 gcatgacgtt gagct 15 7 20 DNA Artificial Sequence
Synthetic oligonucleotide 7 tccatgacgt tcctgatgct 20 8 20 DNA
Artificial Sequence Synthetic oligonucleotide 8 tccatgagct
tcctgagtct 20 9 20 DNA Artificial Sequence Synthetic
oligonucleotide 9 tccaagacgt tcctgatgct 20 10 20 DNA Artificial
Sequence Synthetic oligonucleotide 10 tccatgacgt tcctgacgtt 20 11
21 DNA Artificial Sequence Synthetic oligonucleotide 11 tccatgagct
tcctgagtgc t 21 12 20 DNA Artificial Sequence Synthetic
oligonucleotide 12 ggggtcaacg ttgagggggg 20 13 15 DNA Artificial
Sequence Synthetic oligonucleotide 13 gctagacgtt agcgt 15 14 15 DNA
Artificial Sequence Synthetic oligonucleotide 14 gctagacgtt agcgt
15 15 15 DNA Artificial Sequence Synthetic oligonucleotide 15
gctagacgtt agcgt 15 16 15 DNA Artificial Sequence Synthetic
oligonucleotide 16 gcatgacgtt gagct 15 17 20 DNA Artificial
Sequence Synthetic oligonucleotide 17 atggaaggtc cagcgttctc 20 18
20 DNA Artificial Sequence Synthetic oligonucleotide 18 atcgactctc
gagcgttctc 20 19 20 DNA Artificial Sequence Synthetic
oligonucleotide 19 atcgactctc gagcgttctc 20 20 20 DNA Artificial
Sequence Synthetic oligonucleotide 20 atcgactctc gagcgttctc 20 21
20 DNA Artificial Sequence Synthetic oligonucleotide 21 atcgactctc
gagcgttctc 20 22 20 DNA Artificial Sequence Synthetic
oligonucleotide 22 atggaaggtc caacgttctc 20 23 20 DNA Artificial
Sequence Synthetic oligonucleotide 23 gagaacgctg gaccttccat 20 24
20 DNA Artificial Sequence Synthetic oligonucleotide 24 gagaacgctc
gaccttccat 20 25 20 DNA Artificial Sequence Synthetic
oligonucleotide 25 gagaacgctc gaccttcgat 20 26 20 DNA Artificial
Sequence Synthetic oligonucleotide 26 gagcaagctg gaccttccat 20 27
20 DNA Artificial Sequence Synthetic oligonucleotide 27 gagaacgctg
gaccttccat 20 28 20 DNA Artificial Sequence Synthetic
oligonucleotide 28 gagaacgctg gaccttccat 20 29 20 DNA Artificial
Sequence Synthetic oligonucleotide 29 gagaacgatg gaccttccat 20 30
20 DNA Artificial Sequence Synthetic oligonucleotide 30 gagaacgctc
cagcactgat 20 31 20 DNA Artificial Sequence Synthetic
oligonucleotide 31 tccatgtcgg tcctgatgct 20 32 20 DNA Artificial
Sequence Synthetic oligonucleotide 32 tccatgctgg tcctgatgct 20 33
20 DNA Artificial Sequence Synthetic oligonucleotide 33 tccatgtcgg
tcctgatgct 20 34 20 DNA Artificial Sequence Synthetic
oligonucleotide 34 tccatgtcgg tcctgatgct 20 35 20 DNA Artificial
Sequence Synthetic oligonucleotide 35 tccatgacgt tcctgatgct 20 36
20 DNA Artificial Sequence Synthetic oligonucleotide 36 tccatgtcgg
tcctgctgat 20 37 20 DNA Artificial Sequence Synthetic
oligonucleotide 37 tccatgtcgg tcctgatgct 20 38 20 DNA Artificial
Sequence Synthetic oligonucleotide 38 tccatgccgg tcctgatgct 20 39
20 DNA Artificial Sequence Synthetic oligonucleotide 39 tccatggcgg
tcctgatgct 20 40 20 DNA Artificial Sequence Synthetic
oligonucleotide 40 tccatgacgg tcctgatgct 20 41 20 DNA Artificial
Sequence Synthetic oligonucleotide 41 tccatgtcga tcctgatgct 20 42
20 DNA Artificial Sequence Synthetic oligonucleotide 42 tccatgtcgc
tcctgatgct 20 43 20 DNA Artificial Sequence Synthetic
oligonucleotide 43 tccatgtcgt tcctgatgct 20 44 20 DNA Artificial
Sequence Synthetic oligonucleotide 44 tccatgacgt tcctgatgct 20 45
20 DNA Artificial Sequence Synthetic oligonucleotide 45 tccataacgt
tcctgatgct 20 46 20 DNA Artificial Sequence Synthetic
oligonucleotide 46 tccatgacgt ccctgatgct 20 47 20 DNA Artificial
Sequence Synthetic oligonucleotide 47 tccatcacgt gcctgatgct 20 48
15 DNA Artificial Sequence Synthetic oligonucleotide 48 gcatgacgtt
gagct 15 49 15 DNA Artificial Sequence Synthetic oligonucleotide 49
gctagatgtt agcgt 15 50 20 DNA Artificial Sequence Synthetic
oligonucleotide 50 ggggtcaagt ctgagggggg 20 51 15 DNA Artificial
Sequence Synthetic oligonucleotide 51 gctagacgtt agtgt 15 52 15 DNA
Artificial Sequence Synthetic oligonucleotide 52 gctagacctt agtgt
15 53 20 DNA Artificial Sequence Synthetic oligonucleotide 53
tccatgtcgt tcctgatgct 20 54 20 DNA Artificial Sequence Synthetic
oligonucleotide 54 tccatgacgt tcctgatgct 20 55 18 DNA Artificial
Sequence Synthetic oligonucleotide 55 tctcccagcg tgcgccat 18 56 18
DNA Artificial Sequence Synthetic oligonucleotide 56 catttccacg
atttccca 18
* * * * *