U.S. patent application number 12/615614 was filed with the patent office on 2010-07-22 for nucleic acid-lipophilic conjugates.
This patent application is currently assigned to Coley Pharmaceutical Group, Inc.. Invention is credited to Arthur M. Krieg, Eugen Uhlmann, Jorg Vollmer.
Application Number | 20100183639 12/615614 |
Document ID | / |
Family ID | 34393097 |
Filed Date | 2010-07-22 |
United States Patent
Application |
20100183639 |
Kind Code |
A1 |
Uhlmann; Eugen ; et
al. |
July 22, 2010 |
NUCLEIC ACID-LIPOPHILIC CONJUGATES
Abstract
The invention relates to a nucleic acid-lipophilic conjugates
and methods for modulating an immune response using the conjugates.
The lipophilic moiety associated with an immunostimulatory nucleic
acid.
Inventors: |
Uhlmann; Eugen;
(Glashuetten, DE) ; Vollmer; Jorg; (Duesseldorf,
DE) ; Krieg; Arthur M.; (Wellesley, MA) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, P.C.
600 ATLANTIC AVENUE
BOSTON
MA
02210-2206
US
|
Assignee: |
Coley Pharmaceutical Group,
Inc.
New York
NY
Coley Pharmaceutical GmbH
Dusseldorf
|
Family ID: |
34393097 |
Appl. No.: |
12/615614 |
Filed: |
November 10, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10952254 |
Sep 27, 2004 |
7615539 |
|
|
12615614 |
|
|
|
|
60505977 |
Sep 25, 2003 |
|
|
|
Current U.S.
Class: |
424/184.1 ;
536/23.1 |
Current CPC
Class: |
A61K 47/642 20170801;
A61P 37/08 20180101; A61P 31/12 20180101; A61P 11/06 20180101; A61P
11/00 20180101; A61P 35/00 20180101; A61K 47/54 20170801; A61P
37/00 20180101; A61P 43/00 20180101; A61P 31/10 20180101; A61P
31/04 20180101; A61P 37/02 20180101; A61P 35/02 20180101; A61P
31/18 20180101; A61P 31/00 20180101; A61P 31/14 20180101; A61P
33/00 20180101 |
Class at
Publication: |
424/184.1 ;
536/23.1 |
International
Class: |
A61K 39/00 20060101
A61K039/00; C07H 21/00 20060101 C07H021/00 |
Claims
1. A composition comprising; (N.sub.1PN.sub.2).L wherein N.sub.1
and N.sub.2 are independently nucleic acids of 0-100 nucleotides in
length, P is a palindromic containing nucleic acid and comprising
at least one YR dinucleotide, wherein Y is a cytosine or a modified
cytosine and R is a guanine or a modified guanine, and wherein L is
a lipophilic group.
2. The composition of claim 1, wherein N.sub.1PN.sub.2 is 3-14
nucleotides in length.
3. The composition of claim 1, wherein L is linked to the
nucleotide at the 3' end of N.sub.1PN.sub.2.
4. The composition of claim 1, wherein L is linked by a linker to a
2'-position of a nucleotide in N.sub.1PN.sub.2, to a heterocyclic
base of a nucleotide in N.sub.1PN.sub.2, or a phosphodiester
linkage in N.sub.1PN.sub.2.
5. The composition of claim 4, wherein the nucleotide is selected
from the group consisting of a nucleotide at the 3' end of
N.sub.1PN.sub.2 and an internal nucleotide.
6. The composition of claim 1, wherein L is selected from the group
consisting of a cholesteryl, a modified cholesteryl, a cholesterol
derivative, a reduced cholesterol, and a substituted
cholesterol.
7-8. (canceled)
9. The composition of claim 1, wherein the formula comprises
N.sub.1PN.sub.2-L-N.sub.3PN.sub.4, wherein N.sub.3 and N.sub.4 are
independently nucleic acids of 0-100 nucleotides in length.
10-13. (canceled)
14. The composition of claim 1, wherein the formula comprises
([N.sub.1PN.sub.2].sub.n--(X.sub.3).sub.m).(L).sub.p wherein
X.sub.3 is a linker, m is an integer from 0 to 20 (preferably from
1-10), n is an integer from 0 to 20 (preferably from 1-10), p is an
integer from 1 to 10 (preferably 1), and wherein the
oligonucleotide N.sub.1PN.sub.2 has a length of 4 to 40
nucleotides.
15. The composition of claim 14, wherein X.sub.3 is a
non-nucleotidic linker selected from the group consisting of abasic
residues (dSpacer), oligoethyleneglycol, such as triethyleneglycol
(spacer 9) or hexaethylenegylcol (spacer 18), and alkane-diol, such
as butanediol.
16. The composition of claim 14, wherein the linker is attached to
the oligonucleotide through a linkage selected from the group
consisting of phosphodiester, phosphorothioate, methylphosphonate,
and amide linkages.
17. The composition of claim 14, wherein n is greater than 1 and
the multiple [N.sub.1PN.sub.2] are linked through 3'-ends.
18. The composition of claim 14, wherein N.sub.1PN.sub.2 is a
branched ODN and wherein N.sub.1 includes at least one CG
dinucleotide.
19. The composition of claim 14, wherein L is attached to the 3'
end of the oligonucleotide [N.sub.1PN.sub.2].
20. The composition of claim 14, wherein P is
X.sub.1--Y--R--X.sub.2, wherein X.sub.1 and X.sub.2 are
independently from 0 to 4 nucleotides.
21-24. (canceled)
25. The composition of claim 20, wherein X.sub.2 is a palindrome or
an inverted repeat.
26. The composition of claim 25, wherein the palindrome or inverted
repeat contains at least one unmethylated CpG motif.
27-47. (canceled)
48. The composition of claim 1, further comprising: a nucleic acid
having at least one exposed 5' end; comprising, at least one YR
dinucleotide, wherein Y is a cytosine or a modified cytosine and R
is a guanine or a modified guanine, at least one single stranded
region, at least one double stranded region and wherein the nucleic
acid is linked to at least one lipophilic group.
49-55. (canceled)
56. A method for modulating an immune response, comprising
administering to a subject a composition of claim 1, in an
effective amount to modulate an immune response.
57-72. (canceled)
73. A composition comprising; (N.sub.1YRN.sub.2).L wherein N.sub.1
and N.sub.2 are independently nucleic acids of 0-100 nucleotides in
length, wherein Y is a cytosine or a modified cytosine and R is a
guanine or a modified guanine, and N.sub.1YRN.sub.2 is at least 10
nucleotides in length, wherein L is a lipophilic group, and wherein
L is linked by a linker to a 2'-position of a nucleotide in
N.sub.1YRN.sub.2, or to a heterocyclic base of a nucleotide in
N.sub.1YRN.sub.2.
74-77. (canceled)
78. A composition comprising; (N.sub.1PN.sub.2).L wherein N.sub.1
and N.sub.2 are independently nucleic acids of 0-100 nucleotides in
length, P is a palindromic containing nucleic acid and comprising
at least one YR dinucleotide, wherein Y is a cytosine or a modified
cytosine and R is a guanine or a modified guanine, and wherein L is
cholesterol.
79-80. (canceled)
Description
RELATED APPLICATIONS
[0001] This Application claims the benefit under 35 U.S.C.
.sctn.120 of U.S. application Ser. No. 10/952,254, entitled
"NUCLEIC ACID-LIPOPHILIC CONJUGATES" filed on Sep. 27, 2004 issued
on Nov. 10, 2009 as U.S. Pat. No. 7,615,539, which is herein
incorporated by reference in its entirety. Application Ser. No.
10/952,254 claims priority under 35 U.S.C. .sctn.119(e) to U.S.
Provisional Application Ser. No. 60/505,977, entitled
"OLIGONUCLEOTIDE ANALOGS WITH HIGH IMMUNOSTIMULATORY POTENCY" filed
on Sep. 25, 2003, which is herein incorporated by reference in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates generally to nucleic
acids-lipophilic conjugates, compositions thereof and methods of
using the conjugates.
BACKGROUND OF THE INVENTION
[0003] Bacterial DNA has immune stimulatory effects to activate B
cells and natural killer cells, but vertebrate DNA does not
(Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79:682-686;
Tokunaga, T., et al., 1984, JNCI 72:955-962; Messina, J. P., et
al., 1991, J. Immunol. 147:1759-1764; and reviewed in Krieg, 1998,
In: Applied Oligonucleotide Technology, C. A. Stein and A. M.
Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y., pp.
431-448) and Krieg. A. M. CpG motifs in bacterial DNA and their
immune effects (2002) Annu. Rev. Immunol. 20: 709-760. It is now
understood that these immune stimulatory effects of bacterial DNA
are a result of the presence of unmethylated CpG dinucleotides in
particular base contexts (CpG motifs), which are common in
bacterial DNA, but methylated and underrepresented in vertebrate
DNA (Krieg et al, 1995 Nature 374:546-549; Krieg, 1999 Biochim
Biophys. Acta 93321:1-10). The immune stimulatory effects of
bacterial DNA can be mimicked with synthetic oligodeoxynucleotides
(ODN) containing these CpG motifs. Such CpG ODN have highly
stimulatory effects on human and murine leukocytes, inducing B cell
proliferation; cytokine and immunoglobulin secretion; natural
killer (NK) cell lytic activity and IFN-.gamma. secretion; and
activation of dendritic cells (DCs) and other antigen presenting
cells to express costimulatory molecules and secrete cytokines,
especially the Th1-like cytokines that are important in promoting
the development of Th1-like T cell responses. These immune
stimulatory effects of native phosphodiester backbone CpG ODN are
highly CpG specific in that the effects are dramatically reduced if
the CpG motif is methylated, changed to a GpC, or otherwise
eliminated or altered (Krieg et al, 1995 Nature 374:546-549;
Hartmann et al, 1999 Proc. Natl. Acad. Sci. USA 96:9305-10).
[0004] In early studies, it was thought that the immune stimulatory
CpG motif followed the formula
purine-purine-CpG-pyrimidine-pyrimidine (Krieg et al, 1995 Nature
374:546-549; Pisetsky, 1996 J. Immunol. 156:421-423; Hacker et al.,
1998 EMBO J. 17:6230-6240; Lipford et al, 1998 Trends in Microbiol.
6:496-500). However, it is now clear that mouse lymphocytes respond
quite well to phosphodiester CpG motifs that do not follow this
"formula" (Yi et al., 1998 J. Immunol. 160:5898-5906) and the same
is true of human B cells and dendritic cells (Hartmann et al, 1999
Proc. Natl. Acad. Sci. USA 96:9305-10; Liang, 1996 J. Clin. Invest.
98:1119-1129). Nevertheless, the term "CpG motif" is generally used
to refer to a hexamer motif in which the CpG dinucleotide is
located at the center.
SUMMARY OF THE INVENTION
[0005] The present invention relates in part to immunostimulatory
nucleic acids linked to a lipophilic group. It has been discovered
that specific immunostimulatory nucleic acids linked to lipophilic
groups have enhanced activity, whereas the linkage of lipophilic
groups to other immunostimulatory nucleic acids has minimal effect
on the immunostimulatory capability of the molecule.
[0006] The invention, in one aspect, relates to a composition of
(N.sub.1PN.sub.2) L, wherein N.sub.1 and N.sub.2 are independently
nucleic acids of 0-100 nucleotides in length, P is a palindrome
containing nucleic acid and comprising at least one YR
dinucleotide, wherein Y is a cytosine or a modified cytosine and R
is a guanine or a modified guanine, and wherein L is a lipophilic
group. In one embodiment N.sub.1PN.sub.2 is 3-14 nucleotides in
length. In another embodiment L is linked to the nucleotide at the
3' end of N.sub.1PN.sub.2 Optionally the nucleotide is selected
from the group consisting of a nucleotide at the 3' end of
N.sub.1PN.sub.2 and an internal nucleotide. In one embodiment P is
2-100 nucleotides in length. In another embodiment P is 4-14
nucleotides in length.
[0007] In other embodiments L is linked by a linker to a
2'-position of a nucleotide in N.sub.1PN.sub.2, to a heterocyclic
base of a nucleotide in N.sub.1PN.sub.2, or a phosphodiester
linkage in N.sub.1PN.sub.2.
[0008] L is a lipophilic group which is a cholesteryl, a modified
cholesteryl, a cholesterol derivative, a reduced cholesterol, a
substituted cholesterol, cholestan, C16 alkyl chain, bile acids,
cholic acid, taurocholic acid, deoxycholate, oleyl litocholic acid,
oleoyl cholenic acid, glycolipids, phospholipids, sphingolipids,
isoprenoids, such as steroids, vitamins, such as vitamin E,
saturated fatty acids, unsaturated fatty acids, fatty acid esters,
such as triglycerides, pyrenes, porphyrines, Texaphyrine,
adamantane, acridines, biotin, coumarin, fluorescein, rhodamine,
Texas-Red, digoxygenin, dimethoxytrityl, t-butyldimethylsilyl,
t-butyldiphenylsilyl, cyanine dyes (e.g. Cy3 or Cy5), Hoechst 33258
dye, psoralen, or ibuprofen. The composition may include at least 2
L.
[0009] In some embodiments the formula comprises
N.sub.1PN.sub.2-L.sup.- N.sub.3PN.sub.4, wherein N.sub.3 and
N.sub.4 are independently nucleic acids of 0-100 nucleotides in
length. L may be linked to N.sub.1PN.sub.2 and N.sub.3PN.sub.4
through a linkage selected from the group consisting of -3'-L-3'-,
-2'-L-2'-, -3'-L-2'- and -2'-L-3'-. In some embodiments
N.sub.1PN.sub.2 and N.sub.3PN.sub.4 are identical. In other
embodiments N.sub.1PN.sub.2 and N.sub.3PN.sub.4 are different.
[0010] The composition in other aspects of the invention is the
following formula
([N.sub.1PN.sub.2].sub.n--(X.sub.3).sub.m).(L).sub.p. X.sub.3 is a
linker, m is an integer from 0 to 20 (preferably from 1-10), n is
an integer from 0 to 20 (preferably from 1-10), and p is an integer
from 1 to 10 (preferably 1). The oligonucleotide N.sub.1PN.sub.2
has a length of 4 to 40 nucleotides. n may be greater than 1 and
the multiple [N.sub.1PN.sub.2] are linked through 3'-ends.
[0011] In some embodiments X.sub.3 is a non-nucleotidic linker
selected from the group consisting of abasic residues (dSpacer),
oligoethyleneglycol, such as triethyleneglycol (spacer 9) or
hexaethylenegylcol (spacer 18), and alkane-diol, such as
butanediol.
[0012] In other embodiments the linker is attached to the
oligonucleotide through a linkage selected from the group
consisting of phosphodiester, phosphorothioate, methylphosphonate,
and amide linkages.
[0013] Optionally N.sub.1PN.sub.2 is a branched ODN and wherein
N.sub.1 includes at least one CG dinucleotide.
[0014] L may be attached to the 3' end of the oligonucleotide
[N.sub.1PN.sub.2]. The linkage between L and N.sub.1PN.sub.2-- may
be metabolically stable or metabolically labile.
[0015] P may have the formula X.sub.1--Y--R--X.sub.2, wherein
X.sub.1 and X.sub.2 are independently from 0 to 4 nucleotides. In
some embodiments X.sub.1 is 1 to 2 nucleotides. In other
embodiments X.sub.1 is a pyrimidine. Optionally the pyrimidine is
selected from the group consisting of a thymidine, deoxyuridine and
a 5-substituted deoxyuridine. In other embodiments X.sub.2 is a
palindrome or an inverted repeat (partial palindrome). The
palindrome or inverted repeat (partial palindrome) may contain at
least one unmethylated CpG motif. P may be selected from the group
consisting of C_G_A_C, C_G_T_C, T_C_G_A_C, C_G_A_C_G_T_C,
C_G_G_C_G_G and G_A_C_G_A.
[0016] In some embodiments the oligonucleotide N.sub.1PN.sub.2 has
a length of 4 to 20 nucleotides or 6 to 14 nucleotides.
[0017] Optionally the oligonucleotide includes at least one linear
or branched non-nucleoside linkage.
[0018] An immune stimulatory molecule may be associated with the
composition. An example of an immune stimulatory molecule is a TLR9
ligand.
[0019] The oligonucleotide may include at least one stabilized
internucleotide linkage. Preferably the stabilized internucleotide
linkage is the linkage between Y and R and is a phosphorothioate
linkage in an Rp configuration. Preferably the internucleotide
linkages of the oligonucleotide are all phosphodiester
linkages.
[0020] At least one nucleotide in the oligonucleotide may be a
substituted or modified purine or pyrimidine. In one embodiment the
substituted pyrimidine is a C5 substitution or the substituted
purine is a C8 or C7 substitution. In another embodiment the
substituted or modified purine or pyrimidine is selected from the
group consisting of 5-substituted cytosines (e.g.
5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine,
5-bromo-cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine,
5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and
unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted
cytosines, N4-substituted cytosines (e.g. N4-ethyl-cytosine),
5-aza-cytosine, 2-mercapto-cytosine, isocytosine,
pseudo-isocytosine, cytosine analogs with condensed ring systems
(e.g. N,N'-propylene cytosine or phenoxazine), and uracil and its
derivatives (e.g. 5-fluoro-uracil, 5-bromo-uracil,
5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil,
5-propynyl-uracil), thymine derivatives (e.g. 2-thiothymine,
4-thiothymine, 6-substituted thymines), 7-deazaguanine,
7-deaza-7-substituted guanine (such as
7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine,
7-deaza-8-aza guanine, hypoxanthine, N2-substituted guanines (e.g.
N2-methyl-guanine),
5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione,
2,6-diaminopurine, 2-aminopurine, purine, indole, adenine,
substituted adenines (e.g. to N6-methyl-adenine, 8-oxo-adenine)
8-substituted guanine (e.g. 8-hydroxyguanine and 8-bromoguanine),
and 6-thioguanine. In another embodiment of the invention, the base
is substituted by a universal base (e.g. 4-methyl-indole,
5-nitro-indole, 3-nitropyrrole, P-base, and K-base), an aromatic
ring system (e.g. benzimidazole or dichloro-benzimidazole,
1-methyl-1H-1,2,41-triazole-3-carboxylic acid amide) an aromatic
ring system (e.g. fluorobenzene or difluorobenzene) and a hydrogen
atom (dSpacer).
[0021] Multiple oligonucleotides may be linked by multiple doubler
or trebler moieties and form a dendrimer.
[0022] The composition may include at least one amino acid residue
linked by an amide linkage.
[0023] Optionally the oligonucleotide includes at least one
internucleotide linkage selected from the group consisting of a
3'5'-, a 2'5'-, a 3'3'- and a 5'5'-linkage.
[0024] In one embodiment L is associated with a carrier. Optionally
the carrier is selected from the group consisting of a liposome,
ISCOM, a hydrophobic bead, a hydrophobic formulation, a polymer, a
peptide, a protein, and a nucleic acid. The composition may also
include a therapeutic agent.
[0025] The invention in other aspects is a composition that further
comprises a nucleic acid having at least one exposed 5' end
comprising, at least one YR dinucleotide, wherein Y is a cytosine
or a modified cytosine and R is a guanine or a modified guanine, at
least one single stranded region, at least one double stranded
region and wherein the nucleic acid is linked to at least one
lipophilic group.
[0026] The nucleic acid may be a single chain nucleic acid or have
a double stranded region involving base pairing of at least two
nucleic acids on each side of the double stranded region. In one
embodiment the nucleic acid forms a double stranded region
involving base pairing of at least three nucleic acids on each side
of the double stranded region.
[0027] In some embodiments the nucleic acid is a branched nucleic
acid.
[0028] In other embodiments the nucleic acid is two single chain
nucleic acids at least partially hybridized to one another.
[0029] The nucleic acid may be linked to at least two lipophilic
groups. Optionally the lipophilic group is linked to the nucleotide
at the 3' end of the nucleic acid.
[0030] In another aspect the invention is a lipophilic composition
of (N.sub.1YRN.sub.2).L wherein N.sub.1 and N.sub.2 are
independently nucleic acids of 0-100 nucleotides in length, wherein
Y is a cytosine or a modified cytosine and R is a guanine or a
modified guanine, and N.sub.1YRN.sub.2 is at least 10 nucleotides
in length. L is a lipophilic group linked to a 2'-position of a
nucleotide in N.sub.1YRN.sub.2, or to a heterocyclic base of a
nucleotide in N.sub.1YRN.sub.2. In one embodiment N.sub.1YRN.sub.2
is 5'TCCG3', 5' TTCG3' or 5' TCGTCG3'.
[0031] In yet another aspect, the invention is a composition of
(N.sub.1PN.sub.2).L wherein N.sub.1 and N.sub.2 are independently
nucleic acids of 0-100 nucleotides in length, P is a palindromic
containing nucleic acid and comprising at least one YR
dinucleotide, wherein Y is a cytosine or a modified cytosine and R
is a guanine or a modified guanine, and wherein L is cholesterol.
In certain embodiments L is linked to the nucleotide at the 3' end
of N.sub.1PN.sub.2. In certain embodiments N.sub.1PN.sub.2 is
selected from the group consisting of 5'TCGACGTCGT3' (SEQ ID NO:
111) and 5'TCGACGTCGA3' SEQ ID NO: 112).
[0032] In another aspect, the invention relates to a method for
treating allergy or asthma. The method is performed by
administering to a subject having or at risk of having allergy or
asthma an immunostimulatory CpG oligonucleotide described herein in
an effective amount to treat allergy or asthma. In one embodiment
the oligonucleotide is administered to a mucosal surface, such as a
respiratory tissue. In other embodiments the oligonucleotide is
administered in an aerosol formulation. Optionally the
oligonucleotide is administered intranasally. In other embodiments
the subject has or is at risk of developing allergic asthma.
[0033] A method for inducing cytokine production is provided
according to another aspect of the invention. The method is
performed by administering to a subject an immunostimulatory CpG
oligonucleotide described herein in an effective amount to induce a
cytokine selected from the group consisting of IP10, IL6, IL 8,
IL12, IL18, TNF, IFN-.alpha. chemokines, and IFN-.gamma..
[0034] In another aspect the invention is a composition of the
Lipophilic conjugates described herein in combination with an
antigen or other therapeutic compound, such as an anti-microbial
agent or an anti-cancer agent. The anti-microbial agent may be, for
instance, an anti-viral agent, an anti-parasitic agent, an
anti-bacterial agent or an anti-fungal agent.
[0035] The composition may optionally include a pharmaceutical
carrier and/or be formulated in a delivery device. In some
embodiments the delivery device is selected from the group
consisting of cationic lipids, cell permeating proteins, and
sustained release devices. In one embodiment the sustained release
device is a biodegradable polymer or a microparticle.
[0036] According to another aspect of the invention a method of
stimulating an immune response is provided. The method involves
administering a Lipophilic conjugate to a subject in an amount
effective to induce an immune response in the subject. Preferably
the Lipophilic conjugate is administered orally, locally, in a
sustained release device, mucosally, systemically, parenterally, or
intramuscularly. When the Lipophilic conjugate is administered to
the mucosal surface it may be delivered in an amount effective for
inducing a mucosal immune response or a systemic immune response.
In preferred embodiments the mucosal surface is an oral, nasal,
rectal, vaginal, or ocular surface.
[0037] In some embodiments the method includes exposing the subject
to an antigen wherein the immune response is an antigen-specific
immune response. In some embodiments the antigen is selected from
the group consisting of a tumor antigen, a viral antigen, a
bacterial antigen, a parasitic antigen and a peptide antigen.
[0038] CpG immunostimulatory oligonucleotides are capable of
provoking a broad spectrum of immune response. For instance these
Lipophilic conjugates can be used to redirect a Th2 to a Th1 immune
response. Lipophilic conjugates may also be used to activate an
immune cell, such as a lymphocyte (e.g., B and T cells), a
dendritic cell, and an NK cell. The activation can be performed in
vivo, in vitro, or ex vivo, i.e., by isolating an immune cell from
the subject, contacting the immune cell with an effective amount to
activate the immune cell of the Lipophilic conjugate and
re-administering the activated immune cell to the subject. In some
embodiments the dendritic cell presents a cancer antigen. The
dendritic cell can be exposed to the cancer antigen ex vivo.
[0039] The immune response produced by Lipophilic conjugates may
also result in induction of cytokine production, e.g., production
of IP10, IL6, IL 8, IL12, IL18, TNF, IFN-.alpha., chemokines, and
IFN-.gamma..
[0040] In still another embodiment, the Lipophilic conjugates are
useful for treating to cancer in a subject having or at risk of
developing a cancer. The cancer may be selected from the group
consisting of biliary tract cancer, breast cancer, cervical cancer,
choriocarcinoma, colon cancer, endometrial cancer, gastric cancer,
intraepithelial neoplasms, lymphomas, liver cancer, lung cancer
(e.g. small cell and non-small cell), melanoma, neuroblastomas,
oral cancer, ovarian cancer, pancreatic cancer, prostate cancer,
rectal cancer, sarcomas, thyroid cancer, and renal cancer, as well
as other carcinomas and sarcomas. In some important embodiments,
the cancer is selected from the group consisting of bone cancer,
brain and CNS cancer, connective tissue cancer, esophageal cancer,
eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer,
skin cancer, and testicular cancer.
[0041] Lipophilic conjugates may also be used for increasing the
responsiveness of a cancer cell to a cancer therapy (i.e., an
anti-cancer therapy), optionally when the Lipophilic conjugate is
administered in conjunction with an anti-cancer therapy. The
anti-cancer therapy may be, for instance, a chemotherapy, a vaccine
(e.g., an in vitro primed dendritic cell vaccine or a cancer
antigen vaccine) or an immunotherapeutic agent such as an antibody
based therapy. This latter therapy may also involve administering
an antibody specific for a cell surface antigen of, for example, a
cancer cell, wherein the immune response results in antibody
dependent cellular cytotoxicity (ADCC). In one embodiment, the
antibody may be selected from the group consisting of Ributaxin,
Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym,
SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, for t6, MDX-210,
MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220,
MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2,
TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676,
Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260,
ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and ImmuRAIT-CEA.
[0042] Thus, according to some aspects of the invention, a subject
having cancer or at risk of having a cancer is administered a
Lipophilic conjugate and an anti-cancer therapy.
[0043] In some embodiments, the anti-cancer therapy is selected
from the group consisting of a chemotherapeutic agent, an
immunotherapeutic agent and a cancer vaccine.
[0044] In still another embodiment of the methods directed to
treating cancer, the subject may be further administered
interferon-.alpha..
[0045] In other aspects, the invention is a method for inducing an
innate immune response by administering to the subject a Lipophilic
conjugate in an amount effective for activating an innate immune
response. Thus the ODN are useful for treating pathogens such as
Leishmania, Listeria, and Anthrax.
[0046] According to another aspect of the invention a method for
treating a viral or retroviral infection is provided. The method
involves administering to a subject having or at risk of having a
viral or retroviral infection, an effective amount for treating the
viral or retroviral infection of any of the compositions of the
invention. In some embodiments the virus is caused by hepatitis
virus e.g., hepatitis B or hepatitis C, HIV, herpes virus, or
papillomavirus.
[0047] A method for treating a bacterial infection is provided
according to another aspect of the invention. The method involves
administering to a subject having or at risk of having a bacterial
infection, an effective amount for treating the bacterial infection
of any of the compositions of the invention. In one embodiment the
bacterial infection is due to an intracellular bacteria.
[0048] In another aspect the invention is a method for treating a
parasite infection by administering to a subject having or at risk
of having a parasite infection, an effective amount for treating
the parasite infection of any of the compositions of the invention.
In one embodiment the parasite infection is due to an intracellular
parasite. In another embodiment the parasite infection is due to a
non-helminthic parasite.
[0049] In some embodiments the subject is a human and in other
embodiments the subject is a non-human vertebrate such as a dog,
cat, horse, cow, pig, turkey, goat, fish, monkey, chicken, rat,
mouse, or sheep.
[0050] In another aspect the invention relates to a method for
inducing a TH1 immune response by administering to a subject any of
the compositions of the invention in an effective amount to produce
a TH1 immune response.
[0051] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] The present invention may be more easily and completely
understood when taken in conjunction with the accompanying
figures.
[0053] FIG. 1 is a graph depicting the effect of linkage of a
lipophilic group to an immunostimulatory nucleic acid through
induction of IFN-.alpha..
[0054] FIG. 2 is a bar graph depicting effect of linkage of a
lipophilic group to an immunostimulatory nucleic acid through
induction of IL-6.
[0055] FIG. 3 is a bar graph depicting effect of linkage of a
lipophilic group to an immunostimulatory nucleic acid through
induction of IL-10.
[0056] FIG. 4 is a bar graph demonstrating that a lipophilic group
conjugated to an immunostimulatory nucleic acid enhances induction
of TLR9-dependent NFB signaling.
[0057] FIG. 5 is a bar graph depicting the in vitro mouse
splenocyte stimulation effect of linkage of a lipophilic group to
an immunostimulatory nucleic acid through induction of IL-6, IL-12,
and TNF-.alpha..
[0058] FIG. 6 is a bar graph depicting the in vitro TLR9.sup.+/+
and TLR9.sup.-/- mouse splenocyte stimulation effect of linkage of
a lipophilic group to an immunostimulatory nucleic acid through
induction of IL-12.
[0059] FIG. 7 is a graph depicting the in vivo time-dependent
effect of linkage of a lipophilic group to an immunostimulatory
nucleic acid through induction of IP-10.
[0060] FIG. 8 is a bar graph depicting the in vivo stimulation
effect of linkage of a lipophilic group to an immunostimulatory
nucleic acid through induction of IP-10, IL-12 and IL-6.
DETAILED DESCRIPTION
[0061] The invention in one aspect involves the finding that
specific sub-classes of immunostimulatory oligonucleotides linked
to a lipophilic group are highly effective in mediating immune
stimulatory effects. These conjugates are useful therapeutically
and prophylactically for stimulating the immune system to treat
cancer, infectious diseases, allergy, asthma and other
disorders.
[0062] A-Class immunostimulatory CpG oligonucleotides, such as
oligonucleotide SEQ ID NO: 40, are characterized by their very
efficient induction of IFN-.alpha. secretion, but to low B cell
stimulation. SEQ ID NO: 40 is composed of a palindromic
phosphodiester CpG sequence (SEQ ID NO: 110) clamped by
phosphorothioate (G)n stretches. ODN sequences are presented in
Table 1 below. A-Class immunostimulatory CpG oligonucleotides, in
which the 3'- and 5'-ends are phosphorothioate-modified and the
center portion is phosphodiester, have runs of at least four G
residues at both ends of the oligonucleotide. As a result of
intermolecular tetrad formation which results in high molecular
weight aggregates, the development of G-rich oligonucleotides has
been difficult. Issues related to the biophysical properties of
this class of compounds include tendency to aggregation, poor
solubility, difficulty in quality control and solid phase
extraction (SPE) used in PK studies.
[0063] It is known that (G)n stretches in oligonucleotides, where
n.gtoreq.4, lead to intermolecular tetrad formation resulting in
non homogeneous high molecular weight aggregates. The uptake of
oligonucleotides with (G)n stretches is about 20 to 40-times higher
than of non-aggregated oligonucleotides and the intracellular
localization appears also to be different. It is not understood how
these observations correlate with biological activity.
[0064] In an attempt to discover new immunostimulatory
oligonucleotides having similar potency to A-class oligonucleotides
such as SEQ ID NO: 40 but more favorable biophysical properties
than G-rich oligonucleotides, a series of oligonucleotides without
(G)n stretches but having lipophilic residues covalently attached
have been developed according to the invention. Surprisingly, high
Interferon-alpha (IFN-.alpha.) induction was detected, when an
oligonucleotide having a palindromic center region, preferably with
phosphodiester linkages, and at least one lipophilic group
attached, even without the G.sub.n sequences believed to be
critical for A-class activity. For highest IFN-.alpha. induction,
it is preferable that the number of phosphorothioate residues is
kept to a minimum. An unexpectedly high induction of IFN-.alpha.
secretion was observed with compositions composed of an L
(lipophilic group) attached to the 3'-end of an oligonucleotide
with a 5'-TCG and having only few or no phosphorothioate
linkages.
[0065] It is also of interest that B-Class CpG oligonucleotides,
when modified at the 3'-end with Cholesterol (SEQ ID NO: 38), are
less immunostimulatory than the corresponding 3'-unmodified (SEQ ID
NO: 36) both in IFN-.alpha. induction and in a TLR9 assay.
Similarly, the activity of a 5'-Cholesterol modified ODN (SEQ ID
NO: 37) is much lower than that of the 5'-unmodified SEQ ID NO: 36.
B-class ODN consist of non-palindromic sequences and are usually
fully phosphorothioate modified. The decreased activity of B-class
CpG ODN resulting from cholesterol modification is in contrast to
the palindromic phosphodiester CpG ODN described herein.
Cholesterol modification of the latter at the 3'-end results in
increased immunostimulatory activity (SEQ ID NO: 4) while
5'-cholesterol modification of the same sequence completely
abolishes activity (SEQ ID NO: 6).
[0066] In some instances non-palindromic YR containing
oligonucleotides having phosphodiester backbones also have
increased immune stimulatory activity when a lipophilic group is
conjugated at the 3' end of the oligonucleotide. Chimeric
oligonucleotides having at least one YR motif that is
phosphodiester but having at least one phosphorothioate or other
modified linkage at the 5' and 3' end of the oligonucleotide also
have increased immune stimulatory activity if a lipophilic group is
conjugated at the 3' end of the molecule. The YR motifs in such
chimeric oligonucleotides may be palindromic or nonpalindromic.
[0067] Thus, the invention involves, in one aspect, the discovery
that a subset of immunostimulatory oligonucleotides linked to
lipophilic groups have improved immune stimulatory properties. In
some aspects the invention is a conjugate having the following
formula (N.sub.1PN.sub.2).L. L is a lipophilic group.
[0068] The lipophilic group L is preferably a cholesterol, a
cholesteryl or modified cholesteryl residue. The cholesterol moiety
may be reduced (e.g. as in cholestan) or may be substituted (e.g.
by halogen). A combination of different lipophilic groups in one
molecule is also possible. Other lipophilic groups include but are
not limited to bile acids, cholic acid or taurocholic acid,
deoxycholate, oleyl litocholic acid, oleoyl cholenic acid,
glycolipids, phospholipids, sphingolipids, isoprenoids, such as
steroids, vitamins, such as vitamin E, fatty acids either saturated
or unsaturated, fatty acid esters, such as triglycerides, pyrenes,
porphyrines, Texaphyrine, adamantane, acridines, biotin, coumarin,
fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl,
t-butyldimethylsilyl, t-butyldiphenylsilyl, cyanine dyes (e.g. Cy3
or Cy5), Hoechst 33258 dye, psoralen, or ibuprofen. In some
embodiments L is not a cholesterol.
[0069] The highest immunostimulatory activity was brought about by
cholesterol modification as compared to other end-modifications,
such as hexedecyl, vitamine E or triethylenglycole. It is expected,
however, that these agents will produce more activity when more
than one agent is attached to an oligonucleotide. Thus, in some
embodiments the compositions of the invention have multiple L
groups.
[0070] L is preferably at or near the 3' end of the
oligonucleotide, unless it is in a branched oligonucleotide where
there is at least one unobstructed 5' CpG motif. Cholesterol
substitution at the only available 5'-end of the oligonucleotides
tested was detrimental to the immunostimulatory effect (SEQ ID NO:
5 and SEQ ID NO: 6).
[0071] L may be connected to the oligonucleotide by a linker
moiety. Optionally the linker moiety is a non-nucleotidic linker
moiety. Non-nucleotidic linkers are e.g. abasic residues (dSpacer),
oligoethyleneglycol, such as triethyleneglycol (spacer 9) or
hexaethylenegylcol (spacer 18), or alkane-diol, such as butanediol.
The spacer units are preferably linked by phosphodiester or
phosphorothioate bonds. The linker units may appear just once in
the molecule or may be incorporated several times, e.g. via
phosphodiester, phosphorothioate, methylphosphonate, or amide
linkages.
[0072] The lipophilic group L may be attached at various positions
of the oligonucleotide. As described above, the lipophilic group L
is linked to the 3'-end of the oligonucleotide, where it also
serves the purpose to enhance the stability of the oligomer against
3'-exonucleoases. Alternatively, it may be linked to an internal
nucleotide or a nucleotide on a branch. The lipophilic group L may
be attached to a 2'-position of the nucleotide. The lipophilic
group L may also be linked to the heterocyclic base of the
nucleotide.
[0073] The oligonucleotides may have one or more than one
accessible 5' ends. This may be achieved, for instance by attaching
two oligonucleotides through a 3'-3' or other linkage or to connect
two 3' ends through an L group to generate an oligonucleotide
having one or two accessible 5' ends. Such a structure might have a
formula such as 5'TCGN.sub.1-L-N.sub.1GCT5'. The 3'3'-linkage may
be, for instance, a phosphodiester, phosphorothioate or any other
modified internucleoside bridge. Methods for accomplishing such
linkages are known in the art. For instance, such linkages have
been described in Seliger, H.; et al., Oligonucleotide analogs with
terminal 3'-3'- and 5'-5'-internucleotidic linkages as antisense
inhibitors of viral gene expression, Nucleosides & Nucleotides
(1991), 10(1-3), 469-77 and Jiang, et al., Pseudo-cyclic
oligonucleotides: in vitro and in vivo properties, Bioorganic &
Medicinal Chemistry (1999), 7(12), 2727-2735.
[0074] Additionally, 3'3'-linked ODNs where the linkage between the
3'-terminal nucleosides is not a phosphodiester, phosphorothioate
or other modified bridge, can be prepared using an additional
spacer, such as tri- or tetra-ethylenglycol phosphate moiety
(Durand, M. et al, Triple-helix formation by an oligonucleotide
containing one (dA)12 and two (dT)12 sequences bridged by two
hexaethylene glycol chains, Biochemistry (1992), 31(38), 9197-204,
U.S. Pat. No. 5,658,738, and U.S. Pat. No. 5,668,265).
Alternatively, the non-nucleotidic linker may be derived from
ethanediol, propanediol, or from an abasic deoxyribose (dSpacer)
unit (Fontanel, Marie Laurence et al., Sterical recognition by T4
polynucleotide kinase of non-nucleosidic moieties 5'-attached to
oligonucleotides; Nucleic Acids Research (1994), 22(11), 2022-7)
using standard phosphoramidite chemistry. The non-nucleotidic
linkers can be incorporated once or multiple times, or combined
with each other allowing for any desirable distance between the
3'-ends of the two ODNs to be linked.
[0075] Further preferred are oligonucleotides of the formula in
which the lipophilic modification is part of the inter-nucleotide
linkage which connects two adjacent nucleosides. If the lipophilic
residue is within the sequence, thus linking different sequence
parts together, then the sequence parts are preferentially not
connected via their 5'-ends. In this case, two or more 3'3'-linked
sequences are preferred. Also preferred are 2'2'-, 3'2'- or
2'3'-linked sequences, respectively. Optionally the linkage could
be a 5'3' linkage. If two or more sequences are linked, these can
be identical or different.
[0076] Preferred linkages are phosphodiester, phosphorothioate,
amide, ether, thioether, urea, thiourea, sulfonamide, Schiff' Base
and disulfide linkages. Another possibility is the use of the
Solulink BioConjugation System.
[0077] The lipophilic group may be linked to the oligonucleotide
without additional spacers (m=0) or can be linked via one or more
linker units (m>1). The linkage between the oligonucleotide and
the lipophilic residue may be a metabolically stable or
metabolically labile one.
[0078] Thus, in some embodiments the conjugate may have the
following formula:
([N.sub.1PN.sub.2].sub.n--(X.sub.3).sub.m).(L).sub.p.
[0079] N.sub.1 and N.sub.2 are independently nucleic acids of 0-100
nucleotides in length, P is a palindromic containing nucleic acid
and comprising at least one YR dinucleotide, wherein Y is a
cytosine or a modified cytosine and R is a guanine or a modified
guanine.
[0080] N may optionally have interspersed linear or branched
non-nucleoside linkages or other immune stimulatory conjugates such
as ligands for TLR molecules. It has been discovered that
oligonucleotides having a 5'TCG or 5' UCG have particularly strong
immunostimulatory capability.
[0081] The oligonucleotide of the formula (separate from the
linkers connecting nucleotides to L) may also contain
non-nucleotidic linkers, in particular abasic linkers (dSpacers),
trietyhlene glycol units or hexaethylene glycol units. Further
preferred linkers are alkylamino linkers, such as C3, C6, C12
aminolinkers, and also alkylthiol linkers, such as C3 or C6 thiol
linkers. Oligonucleotides with a 3'3'-linkeage may also contain a
Doubler or Trebler unit. Branching of the oligonucleotides by
multiple doubler or trebler moieties leads to dendrimers which are
a further embodiment of this invention. The oligonucleotide of
formula I may also contain linker units resulting from peptide
modifying reagents or oligonucleotide modifying reagents.
Furthermore, it may contain one or more natural or unnatural amino
acid residues which are connected by peptide (amide) linkages. The
nucleotides in the formula may be linked through 3'5'- and/or
2'5'-linkages. It may further contain independently from each other
one or more 3'3'-linkages and/or 5'5'-linkages.
[0082] P is a palindrome or inverted repeat, i.e. a partial
palindrome. Preferably, the palindrome or inverted repeat (partial
palindrome) contains at least one unmethylated CpG motif. In some
embodiments it includes at least 2 or 3 CpG motifs. In SEQ ID NO:
4, the sequence (TCGACGTCGT, SEQ ID NO: 111) is only partially
palindromic (CGACGTCG), i.e. inverted repeat, whereas in SEQ ID NO:
13, the sequence forms a complete palindrome. Preferably, at least
one of the CpG motifs in the palindrome or inverted repeat (partial
palindrome) is TCGA, ACGT, or CGGCCG. Some preferred palindromes
include:
TABLE-US-00001 C_G_A_C_G_T_C_G C_G_T_C_G_A_C_G T_C_G_A_C_G_T_C_G_A
SEQ ID NO: 112 C_G_A_C_G_T_C_G_A_C_G_T_C_G SEQ ID NO: 113
C_G_G_C_G_G_C_C_G_C_C_G SEQ ID NO: 114 G_A_C_G_A_T_C_G_T_C SEQ ID
NO: 115
[0083] The immunostimulatory oligonucleotides generally have a
length in the range of between 4 and 100 nucleotides. In some
embodiments the length is in the range of 4-40, 13-100, 13-40,
13-30, 15-50, or 15-30 nucleotides or any integer range
therebetween.
[0084] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e., molecules
comprising a sugar (e.g., ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g., adenine (A) or guanine
(G)). As used herein, the terms "nucleic acid" and
"oligonucleotide" refer to oligoribonucleotides as well as
oligodeoxyribonucleotides.
[0085] The terms "nucleic acid" and "oligonucleotide" shall also
include polynucleosides (i.e., a polynucleotide minus the
phosphate) and any other organic base containing polymer. Nucleic
acid molecules can be obtained from existing nucleic acid sources
(e.g., genomic or cDNA), but are preferably synthetic (e.g.,
produced by nucleic acid synthesis). The term oligonucleotide
generally refers to a shorter molecule, i.e. 100 nucleotides or
less in length.
[0086] The terms "nucleic acid" and "oligonucleotide" also
encompass nucleic acids or oligonucleotides with substitutions or
modifications, such as in the bases and/or sugars. For example,
they include nucleic acids having backbone sugars that are
covalently attached to low molecular weight organic groups other
than a hydroxyl group at the 2' position and other than a phosphate
group or hydroxy group at the 5' position. Thus modified nucleic
acids may include a 2'-O-alkylated ribose group. In addition,
modified nucleic acids may include sugars such as arabinose or
2'-fluoroarabinose instead of ribose. Thus the nucleic acids may be
heterogeneous in backbone composition thereby containing any
possible combination of polymer units linked together such as
peptide-nucleic acids (which have an amino acid backbone with
nucleic acid bases). Other examples are described in more detail
below.
[0087] The immunostimulatory oligonucleotides of the instant
invention can encompass various chemical modifications and
substitutions, in comparison to natural RNA and DNA, involving a
phosphodiester internucleoside bridge, a .beta.-D-ribose unit
and/or a natural nucleoside base (adenine, guanine, cytosine,
thymine, uracil). Examples of chemical modifications are known to
the skilled person and are described, for example, in Uhlmann E et
al. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and
Analogs" Synthesis and Properties & Synthesis and Analytical
Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; Crooke
S T et al. (1996) Annu Rev Pharmacol Toxicol 36:107-129; and
Hunziker J et al. (1995) Mod Synth Methods 7:331-417. An
oligonucleotide according to the invention may have one or more
modifications, wherein each modification is located at a particular
phosphodiester internucleoside bridge and/or at a particular
.beta.-D-ribose unit and/or at a particular natural nucleoside base
position in comparison to an oligonucleotide of the same sequence
which is composed of natural DNA or RNA.
[0088] For example, the oligonucleotides may comprise one or more
modifications and wherein each modification is independently
selected from: [0089] a) the replacement of a phosphodiester
internucleoside bridge located at the 3' and/or the 5' end of a
nucleoside by a modified internucleoside bridge, [0090] b) the
replacement of phosphodiester bridge located at the 3' and/or the
5' end of a nucleoside by a dephospho bridge, [0091] c) the
replacement of a sugar phosphate unit from the sugar phosphate
backbone by another unit, [0092] d) the replacement of a
.beta.-D-ribose unit by a modified sugar unit, and [0093] e) the
replacement of a natural nucleoside base by a modified nucleoside
base.
[0094] More detailed examples for the chemical modification of an
oligonucleotide are as follows.
[0095] The oligonucleotides may include modified internucleotide
linkages, such as those described in a or b above. These modified
linkages may be partially resistant to degradation (e.g., are
stabilized). A "stabilized oligonucleotide molecule" shall mean an
oligonucleotide that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease) resulting form such
modifications. Oligonucleotides having phosphorothioate linkages,
in some embodiments, may provide maximal activity and protect the
oligonucleotide from degradation by intracellular exo- and
endo-nucleases.
[0096] A phosphodiester internucleoside bridge located at the 3'
and/or the 5' end of a nucleoside can be replaced by a modified
internucleoside bridge, wherein the modified to internucleoside
bridge is for example selected from phosphorothioate,
phosphorodithioate, NR.sup.1R.sup.2-phosphoramidate,
boranophosphate, .alpha.-hydroxybenzyl phosphonate,
phosphate-(C.sub.1-C.sub.21)--O-alkyl ester,
phosphate-[(C.sub.6-C12)aryl-(C.sub.1-C.sub.21)-.beta.-alkyl]ester,
(C.sub.1-C.sub.8)alkylphosphonate and/or
(C.sub.6-C.sub.12)arylphosphonate bridges,
(C.sub.7-C.sub.12)--hydroxymethyl-aryl (e.g., disclosed in WO
95/01363), wherein (C.sub.6-C.sub.12)aryl, (C.sub.6-C.sub.20)aryl
and (C.sub.6-C.sub.14) aryl are optionally substituted by halogen,
alkyl, alkoxy, nitro, cyano, and where R.sup.1 and R.sup.2 are,
independently of each other, hydrogen, (C.sub.1-C.sub.18)-alkyl,
(C.sub.6-C.sub.20)-aryl,
(C.sub.6-C.sub.14)-aryl-(C.sub.1-C.sub.8)-aryl, preferably
hydrogen, (C.sub.1-C.sub.8-alkyl, preferably
(C.sub.1-C.sub.4)-alkyl and/or methoxyethyl, or R.sup.1 and form,
together with the nitrogen atom carrying them, a 5-6-membered
heterocyclic ring which can additionally contain a further
heteroatom from the group O, S and N.
[0097] The replacement of a phosphodiester bridge located at the 3'
and/or the 5' end of a nucleoside by a dephospho bridge (dephospho
bridges are described, for example, in Uhlmann E and Peyman A in
"Methods in Molecular Biology", Vol. 20, "Protocols for
Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press,
Totowa 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is
for example selected from the dephospho bridges formacetal,
3'-thioformacetal, methylhydroxylamine, oxime,
methylenedimethyl-hydrazo, dimethylenesulfone and/or silyl
groups.
[0098] A sugar phosphate unit (i.e., a .beta.-D-ribose and
phosphodiester internucleoside bridge together forming a sugar
phosphate unit) from the sugar phosphate backbone (i.e., a sugar
phosphate backbone is composed of sugar phosphate units) can be
replaced by another unit, wherein the other unit is for example
suitable to build up a "morpholino-derivative" oligomer (as
described, for example, in Stirchak E P et al. (1989) Nucleic Acids
Res 17:6129-41), that is, e.g., the replacement by a
morpholino-derivative unit; or to build up a polyamide nucleic acid
("PNA"; as described for example, in Nielsen P E et al. (1994)
Bioconjug Chem 5:3-7), that is, e.g., the replacement by a PNA
backbone unit, e.g., by 2-aminoethylglycine. The oligonucleotide
may have other carbohydrate backbone modifications and
replacements, such as peptide nucleic acids with phosphate groups
(PHONA), locked nucleic acids (LNA), and oligonucleotides having
backbone sections with alkyl linkers or amino linkers. The alkyl
linker may be branched or unbranched, substituted or unsubstituted,
and chirally pure or a racemic mixture.
[0099] A .beta.-ribose unit or a .beta.-D-2'-deoxyribose unit can
be replaced by a modified sugar unit, wherein the modified sugar
unit is for example selected from .beta.-D-ribose,
.beta.-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose,
2'-F-arabinose, 2'-O--(C.sub.1-C.sub.6)alkyl-ribose, preferably
2'-O--(C.sub.1-C.sub.6)alkyl-ribose is 2'-O-methylribose,
2'-O--(C.sub.2-C.sub.6)alkenyl-ribose,
2'-[O--(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl]-ribose,
2'-NH.sub.2-2'-deoxyribose, .beta.-D-xylo-furanose,
.alpha.-arabinofuranose,
2,4-dideoxy-.beta.-D-erythro-hexo-pyranose, and carbocyclic
(described, for example, in Froehler J (1992) Am Chem Soc 114:8320)
and/or open-chain sugar analogs (described, for example, in
Vandendriessche et al. (1993) Tetrahedron 49:7223) and/or
bicyclosugar analogs (described, for example, in Tarkov M et al.
(1993) Helv Chim Acta 76:481).
[0100] In some embodiments the sugar is 2'-O-methylribose,
particularly for one or both nucleotides linked by a phosphodiester
or phosphodiester-like internucleoside linkage.
[0101] Nucleic acids also include substituted purines and
pyrimidines such as C-5 propyne pyrimidine and
7-deaza-7-substituted purine modified bases. Wagner R W et al.
(1996) Nat Biotechnol 14:840-4. Purines and pyrimidines include but
are not limited to adenine, cytosine, guanine, and thymine, and
other naturally and non-naturally occurring nucleobases,
substituted and unsubstituted aromatic moieties.
[0102] A modified base is any base which is chemically distinct
from the naturally occurring bases typically found in DNA and RNA
such as T, C, G, A, and U, but which share basic chemical
structures with these naturally occurring bases. The modified
nucleoside base may be, for example, selected from hypoxanthine,
uracil, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil,
5-aminouracil, 5-(C.sub.1-C.sub.6)-alkyluracil,
5-(C.sub.2-C.sub.6)-alkenyluracil,
5-(C.sub.2-C.sub.6)-alkynyluracil, 5-(hydroxymethyl)uracil,
5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine,
5-(C.sub.1-C.sub.6)-alkylcytosine,
5-(C.sub.2-C.sub.6)-alkenylcytosine,
5-(C.sub.2-C.sub.6)-alkynylcytosine, 5-chlorocytosine,
5-fluorocytosine, 5-bromocytosine, N.sup.2-dimethylguanine,
2,4-diamino-purine, 8-azapurine, a substituted 7-deazapurine,
preferably 7-deaza-7-substituted and/or 7-deaza-8-substituted
purine, 5-hydroxymethylcytosine, N4-alkylcytosine, e.g.,
N4-ethylcytosine, 5-hydroxydeoxycytidine,
5-hydroxymethyldeoxycytidine, N4-alkyldeoxycytidine, e.g.,
N4-ethyldeoxycytidine, 6-thiodeoxyguanosine, and
deoxyribonucleosides of nitropyrrole, C5-propynylpyrimidine, and
diaminopurine e.g., 2,6-diaminopurine, inosine, 5-methylcytosine,
2-aminopurine, 2-amino-6-chloropurine, hypoxanthine or other
modifications of a natural nucleoside bases. This list is meant to
be exemplary and is not to be interpreted to be limiting.
[0103] In particular formulas described herein a set of modified
bases is defined. For instance the letter Y is used to refer to a
nucleotide containing a cytosine or a modified cytosine. A modified
cytosine as used herein is a naturally occurring or non-naturally
occurring pyrimidine base analog of cytosine which can replace this
base without impairing the immunostimulatory activity of the
oligonucleotide. Modified cytosines include but are not limited to
5-substituted cytosines (e.g. 5-methyl-cytosine, 5-fluoro-cytosine,
5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine,
5-hydroxy-cytosine, 5-hydroxymethyl-cytosine,
5-difluoromethyl-cytosine, and unsubstituted or substituted
5-alkynyl-cytosine), 6-substituted cytosines, N4-substituted
cytosines (e.g. N4-ethyl-cytosine), 5-aza-cytosine,
2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine
analogs with condensed ring systems (e.g. N,N'-propylene cytosine
or phenoxazine), and uracil and its derivatives (e.g.
5-fluoro-uracil, 5-bromo-uracil, 5-bromovinyl-uracil,
4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil). Some of the
preferred cytosines include 5-methyl-cytosine, 5-fluoro-cytosine,
5-hydroxy-cytosine, 5-hydroxymethyl-cytosine, and
N4-ethyl-cytosine. In another embodiment of the invention, the
cytosine base is substituted by a universal base (e.g.
3-nitropyrrole, P-base), an aromatic ring system (e.g.
fluorobenzene or difluorobenzene) or a hydrogen atom (dSpacer).
[0104] The letter R is used to refer to guanine or a modified
guanine base. A modified guanine as used herein is a naturally
occurring or non-naturally occurring purine base analog of guanine
which can replace this base without impairing the immunostimulatory
activity of the oligonucleotide. Modified guanines include but are
not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such
as 7-deaza-7-(C.sub.2-C.sub.6)alkynylguanine),
7-deaza-8-substituted guanine, hypoxanthine, N2-substituted
guanines (e.g. N2-methyl-guanine),
5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione,
2,6-diaminopurine, 2-aminopurine, purine, indole, adenine,
substituted adenines (e.g. N6-methyl-adenine, 8-oxo-adenine)
8-substituted guanine (e.g. 8-hydroxyguanine and 8-bromoguanine),
and 6-thioguanine 1n another embodiment of the invention, the
guanine base is substituted by a universal base (e.g.
4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring
system (e.g. benzimidazole or dichloro-benzimidazole,
1-methyl-1H-[1,2,4]triazole-3-carboxylic acid amide) or a hydrogen
atom (dSpacer).
[0105] Certain base modifications were also allowed. SEQ ID NO: 29,
in which the terminal T residues at either end were replaced by
deoxyuridine (U), turned out to be a potent inducer of IFN-.alpha..
In contrast, replacing G by deoxyinosine (I) in all CpG motifs (as
in SEQ ID NO: 30) completely abolished IFN-.alpha. induction.
Surprisingly, modification of G residues as 7-deaza deoxyguanosine
(SEQ ID NO: 31) resulted in high IFN-.alpha. induction. Therefore,
the need for tetrad formation via Hoogsteen base-pairing, a
prerequisite for high activity of the previously described G-rich
A-Class oligonucleotides, can be excluded for the new cholesterol
modified A-Class immunostimulatory oligonucleotides.
[0106] For use in the instant invention, the oligonucleotides of
the invention can be synthesized de novo using any of a number of
procedures well known in the art. For example, the
.beta.-cyanoethyl phosphoramidite method (Beaucage, S. L., and
Caruthers, M. H., Tet. Let. 22:1859, 1981); nucleoside
H-phosphonate method (Garegg et al., Tet. Let. 27:4051-4054, 1986;
Froehler et al., Nucl. Acid. Res. 14:5399-5407, 1986; Garegg et
al., Tet. Let. 27:4055-4058, 1986, Gaffney et al., Tet. Let.
29:2619-2622, 1988). These chemistries can be performed by a
variety of automated nucleic acid synthesizers available in the
market. These oligonucleotides are referred to as synthetic
oligonucleotides. An isolated oligonucleotide generally refers to
an oligonucleotide which is separated from components which it is
normally associated with in nature. As an example, an isolated
oligonucleotide may be one which is separated from a cell, from a
nucleus, from mitochondria or from chromatin.
[0107] The internucleotide linkages in the oligonucleotide, may be
a non-stabilized or stabilized linkage (against nucleases),
preferably a phosphodiester (non stabilized), a phosphorothioate
(stabilized) or another charged backbone, most preferably a
phosphodiester linkage. If the internucleotide linkage at Y--R is a
phosphorothioate, the chirality of this linkage may be random, or
is preferably a phosphorothioate linkage of Rp configuration.
Increasing numbers of phosphorothioate linkages (SEQ ID NO: 3, SEQ
ID NO: 15, SEQ ID NO: 25), in particular at the 5'-end, resulted in
diminished or no IFN-.alpha. induction.
[0108] Modified backbones such as phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (e.g., Uhlmann, E. and Peyman, A., Chem. Rev. 90:544,
1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990).
TABLE-US-00002 TABLE 1 ODN # Sequence SEQ ID NO: 1
T*C_G_A_C_G_T_C_GT_teg SEQ ID NO: 2 T*C_G_A_C_G_T_C_G_T_L SEQ ID
NO: 3 T*C_G_A_C_G_T_C_G*T-Chol SEQ ID NO: 4
T_C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 5 Chol-T_C_GA_C G_T_C_G_T-Chol
SEQ ID NO: 6 Chol_T_C_GA_C_G_T_C_G_T_teg SEQ ID NO: 7
T_C_G_T_C_G_A_C_G_T_G_Chol SEQ ID NO: 8 T_C_G_A_C_G_T_C_G_T_T_Chol
SEQ ID NO: 9 G_T_C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 10
G_T_CGA_C_G_T_C_G_T_T_Chol SEQ ID NO: 11 T_C_G_T_C_G_A_C_G_T_T_Chol
SEQ ID NO: 12 A_C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 13
T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 14 G_A_C_G_A_C_G_T_C_G_T_T_Chol
SEQ ID NO: 15 T*C*G*A*C*G*T*C*G*T_Chol SEQ ID NO: 16
T*C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 17 T_C_G_A_C_G_T_C_G*T_Chol SEQ
ID NO: 18 T_C_G_A_C_G_T_C_G_T_teg SEQ ID NO: 19
T_C_G_A_C_G_T_C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 20
T_C_G_T_C_G_T_C_G_T_Chol SEQ ID NO: 21 T_G_C_A_G_C_T_G_C_T-Chol SEQ
ID NO: 22 . . . C_G_A_C_G_T_C_G_ . . . _Chol SEQ ID NO: 23
T_A_A_C_G_T_T_T_Chol SEQ ID NO: 24 T_G_A_C_G_T_T_T_Chol SEQ ID NO:
25 T*C*G*T_C GA_C_G_T_C_G_T_Chol SEQ ID NO: 26
T*C*G*T*C*G*T*T*T*T_C_G_A_C_G_T_C_G_ T_Chol SEQ ID NO: 27
T_C_G_G_C_G_G_C_C_G_C_C_G_Chol SEQ ID NO: 28
T*C*G*T_C_G_G_C_G_G_C_C_G_C_C_G_T_ Chol SEQ ID NO: 29
U_C_G_A_C_G_T_C_G_U-Chol SEQ ID NO: 30 T_C_I_A_C_I_T_C_I_T-Chol SEQ
ID NO: 31 T_C_7_A_C_7_T_C_7_T-Chol SEQ ID NO: 32
T_C_A_T_C_G_A_T_G_A_Chol SEQ ID NO: 33 . . .
G_A_C_G_A_T_C_G_T_C_Chol SEQ ID NO: 34 T_C_A_C_C_G_G_T_G_A_Chol SEQ
ID NO: 35 G_A_C_G_T_T_A_A_C_G_T_C_Chol SEQ ID NO: 36
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T* G*T*C*G*T*T (B-Class ODN) SEQ
ID NO: 37 Chol_T*C*G*T*C*G*T*T*T*T*G*T*C*G*T* T*T*T*G*T*C*G*T*T SEQ
ID NO: 38 T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T* G*T*C*G*T*T_Chol SEQ
ID NO: 39 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C* G*C*C*G (C-Class
ODN) SEQ ID NO: 40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G* G*G*G
(A-Class ODN) SEQ ID NO: 41 T_C_G_A_Chol SEQ ID NO: 42
T_C_G_C_G_A_Chol SEQ ID NO: 43 T_C_G_C_G_C_G_A_Chol SEQ ID NO: 44
T_C_G_C_C_G_G_C_G_AChol SEQ ID NO: 45 T_C_G_G_C_G_C_C_G_A_Chol SEQ
ID NO: 46 T_C_G_C_G_C_G_C_G_A_Chol SEQ ID NO: 47
T_C_G_T_C_G_A_C_G_A_Chol SEQ ID NO: 48 T_C_G_T_A_C_G_A_Chol SEQ ID
NO: 49 T_C_G_A_A_T_T_C_G_A_Chol SEQ ID NO: 50
T_C_G_T_T_A_A_C_G_A_Chol SEQ ID NO: 51 T_C_G_A_A_C_G_T_T_C_G_AChol
SEQ ID NO: 52 T_C_G_T_T_C_G_A_A_C_G_A_Chol SEQ ID NO: 53
T_C_G_A_C_G_A_T_C_G_T_C_G_A_Chol SEQ ID NO: 54
T_C_G_G_A_C_G_A_T_C_G_T_C_C_G_A_Chol SEQ ID NO: 55
T_C_G_A_C_G_A_G_C_T_C_G_T_C_G_A_Chol SEQ ID NO: 56
T_C_G_G_C_G_G_C_C_G_C_C_G_A_Chol SEQ ID NO: 57
T_C_G_A_C_G_T_C_G_A*Chol SEQ ID NO: 58 T_C_G_A_C_G_T_C_G*A_Chol SEQ
ID NO: 59 T_C_G_A_C_G_T_C*G*A_Chol SEQ ID NO: 60
T_C_G_A_C_G_T*C*G*A_Chol SEQ ID NO: 61 G_C_G_A_C_G_T_C_G_A_Chol SEQ
ID NO: 62 C_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 63
I_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 64 U_C_G_A_C_G_T_C_G__A_Chol
SEQ ID NO: 65 Z_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 66
T_T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 67
T_T_T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 68
T_C_G_T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 69
T_C_G_A_A_T_A_T_A_T_A_T_T_A_C_G_A_chol SEQ ID NO: 70
T_C_G_A_A_T_A_T_A_T_A_T_T_A_chol SEQ ID NO: 71
T_C_A_T_C_G_A_T_G_A_Chol SEQ ID NO: 72 T_C_G_A_C_G_T_T_G_A_Chol SEQ
ID NO: 73 F_C_G_A_C_G_F_C_G_A_Chol SEQ ID NO: 74
T_H_G_A_H_G_T_H_G_A_Chol SEQ ID NO: 75 T_Z_G_A_Z_G_T_Z_G_A_Chol SEQ
ID NO: 76 T_C_G_V_C_G_T_C_G_V_Chol SEQ ID NO: 77
T_C_V_A_C_V_T_C_V_A_Chol SEQ ID NO: 78 T_C_R_A_C_R_T_C_R_A_Chol SEQ
ID NO: 79 T_C_O_A_C_O_T_C_O_A_Chol SEQ ID NO: 80
T_C_S_A_C_S_T_C_S_A_Chol SEQ ID NO: 81 T_C_G_S_C_G_T_C_G_S_Chol SEQ
ID NO: 82 T_S_G_A_S_G_T_S_G_A_Chol SEQ ID NO: 83
T_C_G_A_C_G_S_C_G_A_Chol SEQ ID NO: 84 T_C_6G_A_C_6G_T_C_6G_A_Chol
SEQ ID NO: 85 ff_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 86
4T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 87 yU_C_G_A_C_G_T_C_G_A_Chol
SEQ ID NO: 88 5U_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 89
T_C_D_A_C_G_T_C_G_A_Chol SEQ ID NO: 90 T_C_G_A_D_G_T_C_G_A_Chol SEQ
ID NO: 91 T_C_G_A_C_G_T_C_D_A_Chol SEQ ID NO: 92
T_C_G_A_D_D_T_C_G_A_Chol SEQ ID NO: 93 5T_C__A_C_G_T_C_G_A_Chol SEQ
ID NO: 94 3T_C_G_A_C_G_T_C_G_A_Chol SEQ ID NO: 95
T_aC_G_A_aC_G_T_aC_G_A_Chol SEQ ID NO: 96
T_fC_G_A_fC_G_T_fC_G_A_Chol SEQ ID NO: 97
fU_C_G_A_C_G_fU_C_G_A_Chol SEQ ID NO: 98 mU_C_G_A_C_G_T_C_G_A_Chol
SEQ ID NO: 99 mU_mC_mG_mA_mC_mG_mU_mC_mG mA_Chol SEQ ID NO: 100
rU_C_G_AC_G_TC_GA_Chol SEQ ID NO: 101
rU_rC_rG_rA_rC_rG_rU_rC_rG_rA_Chol SEQ ID NO: 102
mU&mC&mG&mA&mC&mG&mU&mC&mG&mA_Chol
SEQ ID NO: 103 T_C_G_A_C_G_T_C_G_A_D_D_D_D_T_C_G_
A_C_G_T_C_G_A_chol SEQ ID NO: 104 3'-teg_A_G_C_T_G_C_A_G_C_T_(5'5'
link)DDD_D_T_C_G_A_C_G_T_C_G_A_ chol-3' The symbol * refers to the
presence of a stabilized intemucleotide linkage and _: refers to
the presence of a phosphodiester linkage. The following are
definitions of symbols and letters in table 1: & 2'5'-linkage
as phosphodiester * phosphorothioate *p 5'-Thiophosphate _
phosphodiester (P0-bonds) A, C, G, T 2'-Deoxynucleotide (dA, dC,
dG, T) chol Cholesterol D dSpacer (abasic residue) 7 7-Deaza-dG F
5-Fluoro-dU H 5-Hydroxy-dC I Inosine (deoxy) J Spacer C3
(propanediol phosphate) L Spacer 18 (hexaethylenglycol phosphate)
mA, mC, mG 2'-oder 3-0-Methyl Ribonucleotide (A, C, G) mA, mC, mG
3-0-Methyl-A (C, G) mT 3'-O-Methyl-T mU 2'-O-Methyl Uridine 0
8-Oxo-dG 3'-Thiophosphate Q 8-Oxo-dA R 2-Aminopurine
(deoxyribofuranoside) rA,rC,rG,rU RNA S 5NI = 5-Nitroindol teg
Spacer 9 (triethylenglycol phosphate) U 2'-Deoxyuridine
V 2.6-Diaminopurine (deoxyribofuranoside) vitE Vitamin E W
Nebularine (deoxyribofuranoside) Z 5-Methyl-deoxycytidine 5T
5-Methoxy-deoxythymidine doub Doubler (Glenresearch) doub2 Doubler2
(Chemgenes) but 1,4-Butandiole 6G 6-Thiodeoxyguanosine ff
Difluorotoluyldeoxyribonucleotide 4T 4-Thiothymidine yU
Pseudodeoxyuridine 5U 5-Hydroxymethyldeoxyuridine 5T
5-Methoxythymidine 3T 2'3'- Dideoxythymidine aC Ara-cytidine
(5'5'-linked) fC 2'-Fluoro-cytidine fU 2'-Fluoro-uridine rU
Ribo-uridine bC 5'-Bromo-cytidine eC N-4-Ethyl-cytidine dP P-Base
cC Amino-Modifier-C6-cytidine
[0109] The invention also relates to compositions that are a set of
oligonucleotides forming a duplex. As shown in the examples below,
the oligonucleotides have minimal or no activity when used alone.
However when they are prepared as a duplex the activity of the
duplex is greatly enhanced.
[0110] The duplex that forms between the two oligonucleotides has
partial complementarity. Partial complementarity refers to at least
a portion of the duplex that includes nucleotides that base-pair
with one another. Thus one region of the first oligonucleotide may
include at least some nucleotides that form a base pair with
complementary nucleotides in a region of the second
oligonucleotide. The partial complementarity is that amount that is
sufficient to stabilize the duplex in the presence or absence of an
exogenous stabilizer. In general the region of partial
complementarity should include at least 2 nucleotides on each
oligonucleotide that are capable of base pairing with the other
oligonucleotide, depending on the length of the oligonucleotide
pair. In some embodiments it is preferred that the region of
partial complementarity is greater than 2 nucleotides. For instance
it may include at least 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides on
each oligonucleotide. Thus, the region of the nucleotides that has
partial complementarity may include one or more nucleotide
mis-matches.
[0111] Alternatively the entire region of the nucleotide
participating in the duplex may be perfectly complementary. A
region that is perfectly complementary is one that includes only
nucleotides that base-pair with a complementary nucleotide on the
other oligonucleotide.
[0112] The duplex can be stabilized by the interaction between the
base-pairing nucleotides. In some instances, the duplex may be
stabilized or further stabilized with the use of an exogenous
stabilizer. An exogenous stabilizer is any molecule, such as a
linker that reduces the level of disassociation of the duplex, or
in other words increases the stability of the duplex.
[0113] At least one of the oligonucleotides includes a YR motif and
preferably a CG motif. One or both oligonucleotides may include a
palindrome, but it is not necessary. In some embodiments neither
oligonucleotide includes a palindrome.
[0114] An example of a functionally active duplex of
oligonucleotides is SEQ ID NO: 108 and SEQ ID NO: 109.
TABLE-US-00003 SEQ ID NO: 108 5'-T_C_G_T_C_G_T_C_G_A_Chol SEQ ID
NO: 109 Chol-A_G_C_A_G_C_A_G_C_T-5'
[0115] It has been discovered according to the invention that the
subsets of lipophilic conjugates have dramatic immune stimulatory
effects on human cells, suggesting that these conjugates are
effective therapeutic agents for human vaccination, cancer
immunotherapy, asthma immunotherapy, general enhancement of immune
function, enhancement of hematopoietic recovery following radiation
or chemotherapy, and other immune modulatory applications.
[0116] As used herein, the terms treat, treated, or treating when
used with respect to a disorder such as an infectious disease,
cancer, allergy, or asthma refers to a prophylactic treatment which
increases the resistance of a subject to development of the disease
(e.g., to infection with a pathogen) or, in other words, decreases
the likelihood that the subject will develop the disease (e.g.,
become infected with the pathogen) as well as a treatment after the
subject has developed the disease in order to fight the disease
(e.g., reduce or eliminate the infection) or prevent the disease
from becoming worse.
[0117] Thus the Lipophilic conjugates are useful in some aspects of
the invention as a vaccine for the treatment of a subject having or
at risk of developing allergy or asthma, an infection with an
infectious organism or a cancer in which a specific cancer antigen
has been identified. The Lipophilic conjugates can also be given
alone without the antigen or allergen for protection against
infection, allergy or cancer or may be administered with other
therapeutic agents. Repeated doses may allow longer term
protection. A subject at risk as used herein is a subject who has
any risk of exposure to to an infection causing pathogen or a
cancer or an allergen or a risk of developing cancer. For instance,
a subject at risk may be a subject who is planning to travel to an
area where a particular type of infectious agent is found or it may
be a subject who through lifestyle or medical procedures is exposed
to bodily fluids which may contain infectious organisms or directly
to the organism or even any subject living in an area where an
infectious organism or an allergen has been identified. Subjects at
risk of developing infection also include general populations to
which a medical agency recommends vaccination with a particular
infectious organism antigen. If the antigen is an allergen and the
subject develops allergic responses to that particular antigen and
the subject may be exposed to the antigen, i.e., during pollen
season, then that subject is at risk of exposure to the antigen. A
subject at risk of developing an allergy to asthma includes those
subjects that have been identified as having an allergy or asthma
but that don't have the active disease during the Lipophilic
conjugate treatment as well as subjects that are considered to be
at risk of developing these diseases because of genetic or
environmental factors.
[0118] A subject at risk of developing a cancer is one who has a
high probability of developing cancer. These subjects include, for
instance, subjects having a genetic abnormality, the presence of
which has been demonstrated to have a correlative relation to a
higher likelihood of developing a cancer and subjects exposed to
cancer causing agents such as tobacco, asbestos, or other chemical
toxins, or a subject who has previously been treated for cancer and
is in apparent remission. When a subject at risk of developing a
cancer is treated with a Lipophilic conjugate and optionally an
antigen specific for the type of cancer to which the subject is at
risk of developing, the subject may be able to kill the cancer
cells as they develop. If a tumor begins to form in the subject,
the subject will develop an innate immune response or a specific
immune response against the tumor antigen.
[0119] In addition to the use of the Lipophilic conjugates for
prophylactic treatment, the invention also encompasses the use of
the Lipophilic conjugates for the treatment of a subject having an
infection, an allergy, asthma, or a cancer.
[0120] A subject having an infection is a subject that has been
exposed to an infectious pathogen and has acute or chronic
detectable levels of the pathogen in the body. The Lipophilic
conjugates can be used with or without an antigen or other
therapeutic to mount an innate or an antigen specific systemic or
mucosal immune response that is capable of reducing the level of or
eradicating the infectious pathogen. An infectious disease, as used
herein, is a disease arising from the presence of a foreign
microorganism in the body. It is particularly important to develop
effective vaccine strategies and treatments to protect the body's
mucosal surfaces, which are the primary site of pathogenic
entry.
[0121] A subject having an allergy is a subject that is capable of
developing an allergic reaction in response to an allergen. An
allergy refers to acquired hypersensitivity to a substance
(allergen). Allergic conditions include but are not limited to
eczema, allergic rhinitis or coryza, hay fever, conjunctivitis,
bronchial asthma, allergic asthma, urticaria (hives) and food
allergies, and other atopic conditions.
[0122] Allergies are generally caused by IgE antibody generation
against harmless allergens. The cytokines that are induced by
systemic or mucosal administration of Lipophilic conjugates are
predominantly of a class called Th1 (examples are IL-12, IP-10,
IFN-.alpha. and IFN-.gamma.) and these induce both humoral and
cellular immune responses. The other major type of immune response,
which is associated with the production of IL-4 and IL-5 cytokines,
is termed a Th2 immune response. In general, it appears that
allergic diseases are mediated by Th2 type immune responses. Based
on the ability of the Lipophilic conjugates described herein to
shift the immune response in a subject from a predominant Th2
(which is associated with production of IgE antibodies and allergy)
to a balanced Th2/Th1 response (which is protective against
allergic reactions), an effective dose for inducing an immune
response of a Lipophilic conjugate can be administered to a subject
to treat asthma and allergy.
[0123] Thus, the Lipophilic conjugates have significant therapeutic
utility in the treatment of allergic conditions and asthma. Th2
cytokines, especially IL-4 and IL-5 are elevated in the airways of
asthmatic subjects. These cytokines promote important aspects of
the asthmatic inflammatory response, including IgE isotope
switching, eosinophil chemotaxis and activation and mast cell
growth. Th1 cytokines, especially IFN-.gamma. and IL-12, can
suppress the formation of Th2 clones and production of Th2
cytokines. Asthma refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms. Thus, asthma includes allergic asthma and
non-allergic asthma.
[0124] A subject having a cancer is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g. small cell and non-small cell); melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer;
prostate cancer; rectal cancer; sarcomas; skin cancer; testicular
cancer; thyroid cancer; and renal cancer, as well as other
carcinomas and sarcomas. In one embodiment the cancer is hairy cell
leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia,
multiple myeloma, follicular lymphoma, malignant melanoma, squamous
cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder
cell carcinoma, or colon carcinoma.
[0125] A subject shall mean a human or vertebrate animal or mammal
including but not limited to a dog, cat, horse, cow, pig, sheep,
goat, turkey, chicken, primate, e.g., monkey, and fish (aquaculture
species), e.g. salmon. Thus, the compounds may be used to treat
cancer and tumors, infections, and allergy/asthma in human and non
human subjects. Cancer is one of the leading causes of death in
companion animals (i.e., cats and dogs).
[0126] In the instances when the CpG oligonucleotide is
administered with an antigen, the subject may be exposed to the
antigen. As used herein, the term exposed to refers to either the
active step of contacting the subject with an antigen or the
passive exposure of the subject to the antigen in vivo. Methods for
the active exposure of a subject to an antigen are well-known in
the art. In general, an antigen is administered directly to the
subject by any means such as intravenous, intramuscular, oral,
transdermal, mucosal, intranasal, intratracheal, or subcutaneous
administration. The antigen can be administered systemically or
locally. Methods for administering the antigen and the Lipophilic
conjugate are described in more detail below. A subject is
passively exposed to an antigen if an antigen becomes available for
exposure to the immune cells in the body. A subject may be
passively exposed to an antigen, for instance, by entry of a
foreign pathogen into the body or by the development of a tumor
cell expressing a foreign antigen on its surface.
[0127] The methods in which a subject is passively exposed to an
antigen can be to particularly dependent on timing of
administration of the Lipophilic conjugate. For instance, in a
subject at risk of developing a cancer or an infectious disease or
an allergic or asthmatic response, the subject may be administered
the Lipophilic conjugate on a regular basis when that risk is
greatest, i.e., during allergy season or after exposure to a cancer
causing agent. Additionally the Lipophilic conjugate may be
administered to travelers before they travel to foreign lands where
they are at risk of exposure to infectious agents. Likewise the
Lipophilic conjugate may be administered to soldiers or civilians
at risk of exposure to biowarfare to induce a systemic or mucosal
immune response to the antigen when and if the subject is exposed
to it.
[0128] An antigen as used herein is a molecule capable of provoking
an immune response. Antigens include but are not limited to cells,
cell extracts, proteins, polypeptides, peptides, polysaccharides,
polysaccharide conjugates, peptide and non-peptide mimics of
polysaccharides and other molecules, small molecules, lipids,
glycolipids, carbohydrates, viruses and viral extracts and
muticellular organisms such as parasites and allergens. The term
antigen broadly includes any type of molecule which is recognized
by a host immune system as being foreign. Antigens include but are
not limited to cancer antigens, microbial antigens, and
allergens.
[0129] A cancer antigen as used herein is a compound, such as a
peptide or protein, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen presenting cell in the context of an
MHC molecule. Cancer antigens can be prepared from cancer cells
either by preparing crude extracts of cancer cells, for example, as
described in Cohen, et al., 1994, Cancer Research, 54:1055, by
partially purifying the antigens, by recombinant technology, or by
de novo synthesis of known antigens. Cancer antigens include but
are not limited to antigens that are recombinantly expressed, an
immunogenic portion thereof, or a whole tumor or cancer cell. Such
antigens can be isolated or prepared recombinantly or by any other
means known in the art.
[0130] As used herein, the terms "cancer antigen" and "tumor
antigen" are used interchangeably to refer to antigens which are
differentially expressed by cancer cells and can thereby be
exploited in order to target cancer cells. Cancer antigens are
antigens which can potentially stimulate apparently tumor-specific
immune responses. Some of these antigens are encoded, although not
necessarily expressed, by normal cells. These antigens can be
characterized as those which are normally silent (i.e., not
expressed) in normal cells, those that are expressed only at
certain stages of differentiation and those that are temporally
expressed such as embryonic and fetal antigens. Other cancer
antigens are encoded by mutant cellular genes, such as oncogenes
(e.g., activated ras oncogene), suppressor genes (e.g., mutant
p53), fusion proteins resulting from internal deletions or
chromosomal translocations. Still other cancer antigens can be
encoded by viral genes such as those carried on RNA and DNA tumor
viruses.
[0131] A microbial antigen as used herein is an antigen of a
microorganism and includes but is not limited to virus, bacteria,
parasites, and fungi. Such antigens include the intact
microorganism as well as natural isolates and fragments or
derivatives thereof and also synthetic compounds which are
identical to or similar to natural microorganism antigens and
induce an immune response specific for that microorganism. A
compound is similar to a natural microorganism antigen if it
induces an immune response (humoral and/or cellular) to a natural
microorganism antigen. Such antigens are used routinely in the art
and are well known to those of ordinary skill in the art.
[0132] Examples of viruses that have been found in humans include
but are not limited to: Retroviridae (e.g. human immunodeficiency
viruses, such as HIV-1 (also referred to as HTLV-III, LAV or
HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP;
Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxyiridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the agent of
delta hepatitis (thought to be a defective satellite of hepatitis B
virus), Hepatitis C; Norwalk and related viruses, and
astroviruses).
[0133] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to, Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to, Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
and Actinomyces israelli.
[0134] Examples of fungi include Cryptococcus neoformans,
Histoplasma capsulatum, Coccidioides immitis, Blastomyces
dermatitidis, Chlamydia trachomatis, Candida albicans.
[0135] Other infectious organisms (i.e., protists) include
Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae,
Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii.
Blood-borne and/or tissues parasites include Plasmodium spp.,
Babesia microti, Babesia divergens, Leishmania tropica, Leishmania
spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma
gambiense and Trypanosoma rhodesiense (African sleeping sickness),
Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
[0136] Other medically relevant microorganisms have been described
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great to Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0137] An allergen refers to a substance (antigen) that can induce
an allergic or asthmatic response in a susceptible subject. The
list of allergens is enormous and can include pollens, insect
venoms, animal dander dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis).
[0138] The antigen may be substantially purified. The term
substantially purified as used herein refers to an antigen, i.e., a
polypeptide which is substantially free of other proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify polypeptide antigens
using standard techniques for protein purification. The
substantially pure polypeptide will often yield a single major band
on a non-reducing polyacrylamide gel. In the case of partially
glycosylated polypeptides or those that have several start codons,
there may be several bands on a non-reducing polyacrylamide gel,
but these will form a distinctive pattern for that polypeptide. The
purity of the polypeptide antigen may also be determined by to
amino-terminal amino acid sequence analysis. Other types of
antigens such as polysaccharides, small molecule, mimics etc are
included within the invention and may optionally be substantially
pure.
[0139] The conjugates of the invention may be administered to a
subject with an anti-microbial agent. An anti-microbial agent, as
used herein, refers to a naturally-occurring or synthetic compound
which is capable of killing or inhibiting infectious
microorganisms. The type of anti-microbial agent useful according
to the invention will depend upon the type of microorganism with
which the subject is infected or at risk of becoming infected.
Anti-microbial agents include but are not limited to anti-bacterial
agents, anti-viral agents, anti-fungal agents and anti-parasitic
agents. Phrases such as "anti-infective agent", "anti-bacterial
agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic
agent" and "parasiticide" have well-established meanings to those
of ordinary skill in the art and are defined in standard medical
texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and
include antibiotics as well as other synthetic or natural compounds
having similar functions. Antibiotics are low molecular weight
molecules which are produced as secondary metabolites by cells,
such as microorganisms. In general, antibiotics interfere with one
or more bacterial functions or structures which are specific for
the microorganism and which are not present in host cells.
Anti-viral agents can be isolated from natural sources or
synthesized and are useful for killing or inhibiting viruses.
Anti-fungal agents are used to treat superficial fungal infections
as well as opportunistic and primary systemic fungal infections.
Anti-parasitic agents kill or inhibit parasites.
[0140] Examples of anti-parasitic agents, also referred to as
parasiticides useful for human administration include but are not
limited to albendazole, amphotericin B, benznidazole, bithionol,
chloroquine HCl, chloroquine phosphate, clindamycin,
dehydroemetine, diethylcarbamazine, diloxanide furoate,
eflornithine, furazolidaone, glucocorticoids, halofantrine,
iodoquinol, ivermectin, mebendazole, mefloquine, meglumine
antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide,
nifurtimox, oxamniquine, paromomycin, pentamidine isethionate,
piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel
pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine,
quinacrine HCl, quinine sulfate, quinidine to gluconate,
spiramycin, stibogluconate sodium (sodium antimony gluconate),
suramin, tetracycline, doxycycline, thiabendazole, timidazole,
trimethroprim-sulfamethoxazole, and tryparsamide some of which are
used alone or in combination with others.
[0141] Antibacterial agents kill or inhibit the growth or function
of bacteria. A large class of antibacterial agents is antibiotics.
Antibiotics, which are effective for killing or inhibiting a wide
range of bacteria, are referred to as broad spectrum antibiotics.
Other types of antibiotics are predominantly effective against the
bacteria of the class gram-positive or gram-negative. These types
of antibiotics are referred to as narrow spectrum antibiotics.
Other antibiotics which are effective against a single organism or
disease and not against other types of bacteria, are referred to as
limited spectrum antibiotics. Antibacterial agents are sometimes
classified based on their primary mode of action. In general,
antibacterial agents are cell wall synthesis inhibitors, cell
membrane inhibitors, protein synthesis inhibitors, nucleic acid
synthesis or functional inhibitors, and competitive inhibitors.
[0142] Antiviral agents are compounds which prevent infection of
cells by viruses or replication of the virus within the cell. There
are many fewer antiviral drugs than antibacterial drugs because the
process of viral replication is so closely related to DNA
replication within the host cell, that non-specific antiviral
agents would often be toxic to the host. There are several stages
within the process of viral infection which can be blocked or
inhibited by antiviral agents. These stages include, attachment of
the virus to the host cell (immunoglobulin or binding peptides),
uncoating of the virus (e.g. amantadine), synthesis or translation
of viral mRNA (e.g. interferon), replication of viral RNA or DNA
(e.g. nucleoside analogues), maturation of new virus proteins (e.g.
protease inhibitors), and budding and release of the virus.
[0143] Nucleotide analogues are synthetic compounds which are
similar to nucleotides, but which have an incomplete or abnormal
deoxyribose or ribose group. Once the nucleotide analogues are in
the cell, they are phosphorylated, producing the triphosphate form
which competes with normal nucleotides for incorporation into the
viral DNA or RNA. Once the triphosphate form of the nucleotide
analogue is incorporated into the growing nucleic acid chain, it
causes irreversible association with the viral polymerase and thus
chain termination. Nucleotide analogues include, but are not
limited to, to acyclovir (used for the treatment of herpes simplex
virus and varicella-zoster virus), gancyclovir (useful for the
treatment of cytomegalovirus), idoxuridine, ribavirin (useful for
the treatment of respiratory syncitial virus), dideoxyinosine,
dideoxycytidine, zidovudine (azidothymidine), imiquimod, and
resimiquimod.
[0144] The interferons are cytokines which are secreted by
virus-infected cells as well as immune cells. The interferons
function by binding to specific receptors on cells adjacent to the
infected cells, causing the change in the cell which protects it
from infection by the virus. .alpha. and .beta.-interferon also
induce the expression of Class I and Class II MHC molecules on the
surface of infected cells, resulting in increased antigen
presentation for host immune cell recognition. .alpha. and
.beta.-interferons are available as recombinant forms and have been
used for the treatment of chronic hepatitis B and C infection. At
the dosages which are effective for anti-viral therapy, interferons
have severe side effects such as fever, malaise and weight
loss.
[0145] Anti-viral agents useful in the invention include but are
not limited to immunoglobulins, amantadine, interferons, nucleoside
analogues, and protease inhibitors. Specific examples of
anti-virals include but are not limited to Acemannan; Acyclovir;
Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox;
Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate;
Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride;
Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril;
Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine
Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet
Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium;
Idoxuridine; Kethoxal; Lamivudine; Lobucavir; Memotine
Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir;
Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate;
Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine;
Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride;
Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate;
Viroxime; Zalcitabine; Zidovudine; and Zinviroxime.
[0146] Anti-fungal agents are useful for the treatment and
prevention of infective fungi. Anti-fungal agents are sometimes
classified by their mechanism of action. Some anti-fungal agents
function as cell wall inhibitors by inhibiting glucose synthase.
These include, but are not limited to, basiungin/ECB. Other
anti-fungal agents function by destabilizing membrane integrity.
These include, but are not limited to, immidazoles, to such as
clotrimazole, sertaconzole, fluconazole, itraconazole,
ketoconazole, miconazole, and voriconacole, as well as FK 463,
amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292,
butenafine, and terbinafine. Other anti-fungal agents function by
breaking down chitin (e.g. chitinase) or immunosuppression (501
cream).
[0147] Lipophilic conjugates can be combined with other therapeutic
agents such as adjuvants to enhance immune responses. The
Lipophilic conjugate and other therapeutic agent may be
administered simultaneously or sequentially. When the other
therapeutic agents are administered simultaneously they can be
administered in the same or separate formulations, but are
administered at the same time. The other therapeutic agents are
administered sequentially with one another and with Lipophilic
conjugate, when the administration of the other therapeutic agents
and the Lipophilic conjugate is temporally separated. The
separation in time between the administration of these compounds
may be a matter of minutes or it may be longer. Other therapeutic
agents include but are not limited to adjuvants, cytokines,
antibodies, antigens, etc.
[0148] The compositions of the invention may also be administered
with non-nucleic acid adjuvants. A non-nucleic acid adjuvant is any
molecule or compound except for the Lipophilic conjugates described
herein which can stimulate the humoral and/or cellular immune
response. Non-nucleic acid adjuvants include, for instance,
adjuvants that create a depo effect, immune stimulating adjuvants,
and adjuvants that create a depo effect and stimulate the immune
system.
[0149] The Lipophilic conjugates are also useful as mucosal
adjuvants. It has previously been discovered that both systemic and
mucosal immunity are induced by mucosal delivery of CpG nucleic
acids. Thus, the oligonucleotides may be administered in
combination with other mucosal adjuvants.
[0150] Immune responses can also be induced or augmented by the
co-administration or co-linear expression of cytokines (Bueler
& Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997;
Iwasaki et al., 1997; Kim et al., 1997) or co-stimulatory molecules
such as B7 (Iwasaki et al., 1997; Tsuji et al., 1997) with the
Lipophilic conjugates. The term cytokine is used as a generic name
for a diverse group of soluble proteins and peptides which act as
humoral regulators at nano- to picomolar concentrations and which,
either under normal or pathological conditions, modulate the
functional activities of individual cells and tissues. These
proteins also mediate interactions between cells directly and
regulate processes taking place in the extracellular environment.
Examples of cytokines include, but are not limited to IP-10, IL-1,
IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18,
granulocyte-macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), interferon-.gamma.
(IFN-.gamma.), IFN-.alpha., tumor necrosis factor (TNF),
TGF-.beta., FLT-3 ligand, and CD40 ligand. In addition to cytokines
the CpG oligonucleotides may be used in combination with antibodies
against certain cytokines, such as anti-IL-10 and anti-TGF-.beta.,
as well as Cox inhibitors, i.e. COX-1 and COX-2 inhibitors.
[0151] The oligonucleotides are also useful in mediating immune
responses through cellular toll-like receptors (TLRs). TLRs are a
series of signaling pattern-recognition receptors known as play a
major role in the inflammatory responses and the induction of
immunity. Different TLRs directly or indirectly bind different
microbial molecules. For example, TLR-2 recognizes peptidoglycan
and lipoproteins; TLR-4 recognizes lipopolysaccharide and
lipoteichoic acid; TLR-5 recognizes bacterial flagellin; and TLR-9
recognizes bacterial DNA. The stimulation of TLR transmits a signal
to the cell's nucleus inducting the expression of genes coding for
the synthesis of intracellular regulatory molecules such as
cytokines. The cytokines, in turn, bind to cytokine receptors on
other defense cells. These cytokines trigger innate immune defenses
such as inflammation, fever, and phagocytosis and provide an
immediate response against the invading microorganism. TLRs also
participate in adoptive immunity by triggering various secondary
signals needed for humoral immunity (the production of antibodies)
and cell-mediated immunity (the production of cytotoxic
T-lymphocytes and additional cytokines). The oligonucleotides of
the invention are useful in mediating TLR immune responses, and can
the oligonucleotides of the invention can stimulate the production
of certain cytokines in a TLR dependent manner.
[0152] The oligonucleotides are also useful for redirecting an
immune response from a Th2 immune response to a Th1 immune
response. This results in the production of a relatively balanced
Th1/Th2 environment. Redirection of an immune response from a Th2
to a Th1 immune response can be assessed by measuring the levels of
cytokines produced in response to the nucleic acid (e.g., by
inducing monocytic cells and other cells to produce Th1 cytokines,
including IL-12, IFN-.gamma. and GM-CSF). The redirection or
rebalance of the immune response from a Th2 to a Th1 response is
particularly useful for the treatment of asthma. For instance, an
effective amount for treating asthma can be that amount; useful for
redirecting a Th2 type of immune response that is associated with
asthma to a Th1 type of response or a balanced Th1/Th2 environment.
Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways
of asthmatic subjects. The Lipophilic conjugates described herein
cause an increase in Th1 cytokines which helps to rebalance the
immune system, preventing or reducing the adverse effects
associated with a predominately Th2 immune response.
[0153] The Lipophilic conjugates have the unique capability to
promote cell survival, differentiation, activation and maturation
of dendritic cells, and are useful for in vitro, in vivo, and ex
vivo methods involving dendritic cells.
[0154] Lipophilic conjugates also increase natural killer cell
lytic activity and antibody dependent cellular cytotoxicity (ADCC).
ADCC can be performed using a Lipophilic conjugate in combination
with an antibody specific for a cellular target, such as a cancer
cell. When the Lipophilic conjugate is administered to a subject in
conjunction with the antibody the subject's immune system is
induced to kill the tumor cell. The antibodies useful in the ADCC
procedure include antibodies which interact with a cell in the
body. Many such antibodies specific for cellular targets have been
described in the art and many are commercially available.
[0155] The Lipophilic conjugates may also be administered in
conjunction with an anti-cancer therapy. Anti-cancer therapies
include cancer medicaments, radiation and surgical procedures. As
used herein, a "cancer medicament" refers to an agent which is
administered to a subject for the purpose of treating a cancer. As
used herein, "treating cancer" includes preventing the development
of a cancer, reducing the symptoms of cancer, and/or inhibiting the
growth of an established cancer. In other aspects, the cancer
medicament is administered to a subject at risk of developing a
cancer for the purpose of reducing the risk of developing the
cancer. Various types of medicaments for the treatment of cancer
are described herein. For the purpose of this specification, cancer
medicaments are classified as chemotherapeutic agents,
immunotherapeutic agents, cancer vaccines, hormone therapy, and
biological response modifiers.
[0156] Additionally, the methods of the invention are intended to
embrace the use of more than one cancer medicament along with the
Lipophilic conjugates. As an example, where appropriate, the
Lipophilic conjugates may be administered with both a
chemotherapeutic agent and an immunotherapeutic agent.
Alternatively, the cancer medicament may embrace an
immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic
agent and a cancer vaccine, or a chemotherapeutic agent, an
immunotherapeutic agent and a cancer vaccine all administered to
one subject for the purpose of treating a subject having a cancer
or at risk of developing a cancer.
[0157] The chemotherapeutic agent may be, for instance,
methotrexate, vincristine, adriamycin, cisplatin, non-sugar
containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C,
bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine
GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566,
RAS farnesyl transferase inhibitor, farnesyl transferase inhibitor,
MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470,
Hycamtin/Topotecan, PKC412, Valspodar/PSC833,
Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070,
BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853,
ZD0101, IS1641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP
845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317,
Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative,
Temodal/Temozolomide, Evacet/liposomal doxorubicin,
Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Xeload/Capecitabine,
Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid,
SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609
(754)/RAS oncogene inhibitor, BMS-182751/oral platinum,
UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU
enhancer, Campto/Levamisole, Camptosar/Irinotecan,
Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin,
Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU
79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal
doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, iodine
seeds, CDK4 and CDK2 inhibitors, PARP inhibitors,
D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide,
Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD
9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane
Analog, nitrosoureas, alkylating agents such as melphelan and
cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCI, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2' deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) or Vindesine sulfate,
but it is not so limited.
[0158] The immunotherapeutic agent may be, for instance, Ributaxin,
Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym,
SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210,
MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220,
MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2,
TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676,
Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260,
ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab or ImmuRAIT-CEA, but it is
not so limited.
[0159] The cancer vaccine may be, for instance, EGF, Anti-idiotypic
cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV
ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax,
L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic
vaccine, Melacine, peptide antigen vaccines, toxin/antigen
vaccines, MVA-based vaccine, PACIS, BCG vacine, TA-HPV, TA-CIN,
DISC-virus or ImmuCyst/TheraCys, but it is not so limited.
[0160] The use of Lipophilic conjugates in conjunction with
immunotherapeutic agents such as monoclonal antibodies is able to
increase long-term survival through a number of mechanisms
including significant enhancement of ADCC (as discussed above),
activation of natural killer (NK) cells and an increase in
IFN-.alpha. levels. The nucleic acids when used in combination with
monoclonal antibodies serve to reduce the dose of the antibody
required to achieve a biological result.
[0161] The invention also includes methods for inducing antigen
non-specific innate immune activation and broad spectrum resistance
to infectious challenge using the Lipophilic conjugates. The term
innate immune activation as used herein refers to the to activation
of immune cells other than memory B cells and for instance can
include the activation of NK cells, T cells and/or other immune
cells that can respond in an antigen independent fashion. A broad
spectrum resistance to infectious challenge is induced because the
immune cells are in active form and are primed to respond to any
invading compound or microorganism. The cells do not have to be
specifically primed against a particular antigen. This is
particularly useful in biowarfare, and the other circumstances
described above such as travelers.
[0162] The conjugates of the invention may be formulated as other
oligonucleotides, or with variations due to the lipophilic group,
e.g., the formation of multimers by the binding or embedding of the
L group in a surface, such as a liposome, ISCOM, or other suitable
hydrophobic bead or formulation. The conjugates may be formulated
in a complex with a desired carrier structure, such as a polymer, a
peptide, a protein, or a nucleic acid of interest. The conjugates
may be formulated in vesicles comprising mainly or almost
exclusively a lipophilic compound as described herein. The present
invention also provides a method for increasing the lipophilicity
of an immunostimulatory oligonucleotide in order to increase its
affinity to a formulation reagent. Therefore, the oligonucleotides
described herein posses favorable properties when encapsulated in a
lipid composition. In conventional liposomes, it is often difficult
to entrap a high concentration of a drug. By lipophilic
derivatisation of the immunostimulatory oligonucleotide and
incorporation into liposomes, the oligonucleotide may be more
appropriate for long-term storage, since there will be less leakage
of drug from the liposome. The lipophilic ligand may also lead to
improved bioavailability and favorable biodistribution to certain
organs, such as liver, and may also reduce toxic side effects.
Without being bound to any particular mechanism of action. The free
5' ends of the ODN protruding from such multimeric macromolecules
will be available to interact with the TLR9 receptor in such a way
that leads to the crosslinking of the receptor, which may induce
even further increased production of IFN-.alpha..
[0163] The Lipophilic conjugate and/or the antigen and/or other
therapeutics may be administered alone (e.g., in saline or buffer)
or using any delivery vehicles known in the art. For instance the
following delivery vehicles have been described: Cochleates to
(Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al.,
1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et
al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers
et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b);
Live bacterial vectors (e.g., Salmonella, Escherichia coli,
Bacillus calmatte-guerin, Shigella, Lactobacillus) (Hone et al.,
1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al.,
1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia,
adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et
al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et
al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996,
Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994,
Eldridge et al., 1989); Nucleic acid vaccines (Fynan et al., 1993,
Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii
et al., 1997); Polymers (e.g. carboxymethylcellulose, chitosan)
(Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings
(Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et
al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et
al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995,
Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl
et al., 1998). Other delivery vehicles are known in the art.
[0164] The term effective amount of a Lipophilic conjugate refers
to the amount necessary or sufficient to realize a desired biologic
effect. For example, an effective amount of a Lipophilic conjugate
administered with an antigen for inducing mucosal immunity is that
amount necessary to cause the development of IgA in response to an
antigen upon exposure to the antigen, whereas that amount required
for inducing systemic immunity is that amount necessary to cause
the development of IgG in response to an antigen upon exposure to
the antigen. Combined with the teachings provided herein, by
choosing among the various active compounds and weighing factors
such as potency, relative bioavailability, patient body weight,
severity of adverse side-effects and preferred mode of
administration, an effective prophylactic or therapeutic treatment
regimen can be planned which does not cause substantial toxicity
and yet is entirely effective to treat the particular subject. The
effective amount for any particular application can vary depending
on such factors as the disease or condition being treated, the
particular Lipophilic conjugate being administered the size of the
subject, or the severity of the disease or condition. One of
ordinary skill in the art can empirically to determine the
effective amount of a particular Lipophilic conjugate and/or
antigen and/or other therapeutic agent without necessitating undue
experimentation.
[0165] Subject doses of the compounds described herein for mucosal
or local delivery typically range from about 10 .mu.g to 1000 mg
per administration, which depending on the application could be
given daily, weekly, or monthly and any other amount of time
therebetween or as otherwise required. More typically mucosal or
local doses range from about 100 .mu.g to 50 mg per administration,
and most typically from about 500 .mu.g to 5 mg, with 2-4
administrations being spaced days or weeks apart. More typically,
immune stimulant doses range from 100 .mu.g to 1000 mg per
administration, and most typically 500 .mu.g to 50 mg, with daily
or weekly administrations. Doses of the compounds described herein
for parenteral delivery for the purpose of inducing an innate
immune response or for increasing ADCC or for inducing an antigen
specific immune response when the Lipophilic conjugates are
administered in combination with other therapeutic agents or in
specialized delivery vehicles typically range from about 10 .mu.g
to 1000 mg per administration, which depending on the application
could be given daily, weekly, or monthly and any other amount of
time therebetween or as otherwise required. More typically
parenteral doses for these purposes range from about 100 .mu.g to
50 mg per administration, and most typically from about 1000 .mu.g
to 10 mg, with 2-4 administrations being spaced days or weeks
apart. In some embodiments, however, parenteral doses for these
purposes may be used in a range of 5 to 10,000 times higher than
the typical doses described above.
[0166] For any compound described herein the therapeutically
effective amount can be initially determined from animal models. A
therapeutically effective dose can also be determined from human
data for other CpG oligonucleotides which have been tested in
humans (human clinical trials are ongoing) and for compounds which
are known to exhibit similar pharmacological activities, such as
other adjuvants, e.g., LT and other antigens for vaccination
purposes. Higher doses may be required for parenteral
administration. The applied dose can be adjusted based on the
relative bioavailability and potency of the administered compound.
Adjusting the dose to achieve maximal efficacy based on the methods
described above and other methods as are well-known in the art is
well within the capabilities of the ordinarily skilled artisan.
[0167] The formulations of the invention are administered in
pharmaceutically to acceptable solutions, which may routinely
contain pharmaceutically acceptable concentrations of salt,
buffering agents, preservatives, compatible carriers, adjuvants,
and optionally other therapeutic ingredients.
[0168] For use in therapy, an effective amount of the Lipophilic
conjugate an/or other therapeutics can be administered to a subject
by any mode that delivers the compound to the desired surface,
e.g., local, mucosal, systemic. Administering the pharmaceutical
composition of the present invention may be accomplished by any
means known to the skilled artisan. Preferred routes of
administration include but are not limited to oral, parenteral,
intramuscular, intranasal, sublingual, intratracheal, inhalation,
ocular, vaginal, and rectal.
[0169] For oral administration, the compounds (i.e., Lipophilic
conjugates, antigens and/or other therapeutic agents) can be
formulated readily by combining the active compound(s) with
pharmaceutically acceptable carriers well known in the art. Such
carriers enable the compounds of the invention to be formulated as
tablets, pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions and the like, for oral ingestion by a subject to be
treated. Pharmaceutical preparations for oral use can be obtained
as solid excipient, optionally grinding a resulting mixture, and
processing the mixture of granules, after adding suitable
auxiliaries, if desired, to obtain tablets or dragee cores.
Suitable excipients are, in particular, fillers such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose
preparations such as, for example, maize starch, wheat starch, rice
starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Optionally the oral formulations may also be formulated
in saline or buffers for neutralizing internal acid conditions or
may be administered without any carriers.
[0170] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0171] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
[0172] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0173] The compounds may be administered by inhalation to pulmonary
tract, especially the bronchi and more particularly into the
alveoli of the deep lung, using standard inhalation devices. The
compounds may be delivered in the form of an aerosol spray
presentation from pressurized packs or a nebulizer, with the use of
a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide
or other suitable gas. In the case of a pressurized aerosol, the
dosage unit may be determined by providing a valve to deliver a
metered amount. An inhalation apparatus may be used to deliver the
compounds to a subject. An inhalation apparatus, as used herein, is
any device for administering an aerosol, such as dry powdered form
of the compounds. This type of equipment is well known in the art
and has been described in detail, such as that description found in
Remington: The Science and Practice of Pharmacy, 19.sup.th Edition,
1995, Mac Publishing Company, Easton, Pa., pages 1676-1692. Many
U.S. patents also describe inhalation devices, such as U.S. Pat.
No. 6,116,237.
[0174] "Powder" as used herein refers to a composition that
consists of finely dispersed solid particles. Preferably the
compounds are relatively free flowing and capable of being
dispersed in an inhalation device and subsequently inhaled by a
subject so that the compounds reach the lungs to permit penetration
into the alveoli. A "dry powder" refers to a powder composition
that has a moisture content such that the particles are readily
dispersible in an inhalation device to form an aerosol. The
moisture content is generally to below about 10% by weight (% w)
water, and in some embodiments is below about 5% w and preferably
less than about 3% w. The powder may be formulated with polymers or
optionally may be formulated with other materials such as
liposomes, albumin and/or other carriers.
[0175] Aerosol dosage and delivery systems may be selected for a
particular therapeutic application by one of skill in the art, such
as described, for example in Gonda, I. "Aerosols for delivery of
therapeutic and diagnostic agents to the respiratory tract," in
Critical Reviews in Therapeutic Drug Carrier Systems, 6:273-313
(1990), and in Moren, "Aerosol dosage forms and formulations," in
Aerosols in Medicine. Principles, Diagnosis and Therapy, Moren, et
al., Eds., Esevier, Amsterdam, 1985.
[0176] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0177] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0178] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0179] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0180] In addition to the formulations described previously, the
compounds may also be to formulated as a depot preparation. Such
long acting formulations may be formulated with suitable polymeric
or hydrophobic materials (for example as an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0181] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0182] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer, Science 249:1527-1533, 1990, which is incorporated herein
by reference. The Lipophilic conjugates and optionally other
therapeutics and/or antigens may be administered per se (neat) or
in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0183] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0184] The pharmaceutical compositions of the invention contain an
effective amount of a Lipophilic conjugate and optionally antigens
and/or other therapeutic agents optionally included in a
pharmaceutically-acceptable carrier. The term
pharmaceutically-acceptable carrier means one or more compatible
solid or liquid filler, diluents or encapsulating substances which
are suitable for administration to a human or other vertebrate
animal. The term carrier denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being comingled
with the compounds of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficiency.
[0185] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Materials and Methods Examples 1-5
[0186] Oligodeoxynucleotides. All ODN were provided by Coley
Pharmaceutical Group (Langenfeld, Germany) and had undetectable
endotoxin levels (<0.1EU/ml) measured by the Limulus assay
(BioWhittaker, Verviers, Belgium). ODN were suspended in sterile,
endotoxin-free Tris-EDTA (Sigma, Deisenhofen, Germany), and stored
and handled under aseptic conditions to prevent both microbial and
endotoxin contamination. All dilutions were carried out using
pyrogen-free phosphate-buffered saline (Life Technologies,
Eggenstein, Germany).
[0187] TLR9 assay. HEK293 cells were transfected by electroporation
with vectors expressing the human TLR9 and a
6xNF.kappa.B-luciferase reporter plasmid. Stable transfectants
(3.times.10.sup.4 cells/well) were incubated with ODN for 16 h at
37.degree. C. in a humidified incubator. Each data point was done
in triplicate. Cells were lysed and assayed for luciferase gene
activity (using the Britlite kit from Perkin-Elmer, Ueberlingen,
Germany). Stimulation indices were calculated in reference to
reporter gene activity of medium without addition of ODN.
[0188] Cell purification. Peripheral blood buffy coat preparations
from healthy human donors were obtained from the Blood Bank of the
University of Dusseldorf (Germany) and PBMC were purified by
centrifugation over Ficoll-Hypaque (Sigma). Cells were cultured in
a humidified incubator at 37.degree. C. in RPMI 1640 medium
supplemented with 5% (v/v) heat inactivated human AB serum
(BioWhittaker) or 10% (v/v) heat inactivated FCS, 1.5 mM
L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml streptomycin (all
from Sigma).
[0189] Cytokine detection. PBMC were resuspended at a concentration
of 5.times.10.sup.6 cells/ml and added to 48 well flat-bottomed
plates (1 ml/well) or 96 well round-bottomed plates (200
.mu.l/well), which had previously received nothing or ODN in
different concentrations. Culture supernatants (SN) were collected
after the indicated time points. If not used immediately,
supernatants were frozen at -20.degree. C. until required. Amounts
of cytokines in the supernatants were assessed using commercially
available ELISA Kits (IL-6, IL-10; from Diaclone, Besancon, France)
or an in-house ELISA developed using commercially available
antibodies (from PBL, New Brunswick, N.J., USA for detection of
multiple IFN-.alpha. species).
Materials and Methods Examples 6-9
[0190] CpG ODN. The CpG ODN used were of sequences
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 116) and
T-C-G-A-C-G-T-C-G-A-Cholesterol (SEQ ID NO: 13). The GpC analogue
of SEQ ID NO: 116 was used as a non-CpG control. All ODN were
supplied by Coley Pharmaceutical Group (Wellesley, Mass.). All ODN
were re-suspended in sterile, endotoxin free TE at pH 8.0
(OmniPer.RTM.; EM Science, Gibbstown, N.J.) and stored and handled
under aseptic conditions to prevent both microbial and endotoxin
contamination. Dilution of ODNs for assays was carried out in
sterile, endotoxin free PBS at pH 7.2 (Sigma Chemical Company, St.
Lois, Mo.).
[0191] Animals. Female BALB/c mice (purchased from Charles River
Canada; Montreal, Quebec, Canada, TLR9 knock out or their wild type
counterparts (obtained from Dr. S. Akira at Osaka University, Japan
and bred at the Coley Canada Animal Care Facility) all at 6-8 weeks
of age were used for experiments. All animals were housed in
micro-isolators at the Coley Canada Animal Care Facility and
experiments were carried out with approval of the Animal Care
Committee and under the guidelines of the Canadian Council on
Animal Care.
[0192] In vitro assays. Naive BALB/c splenocytes (5.times.10.sup.6
cells per ml) were stimulated with either CPG SEQ ID NO: 116, CpG
SEQ ID NO: 13 or the non-CpG control at 0.3, 1, 3 or 10 .mu.g/ml.
Concanavalin A (10 .mu.g/ml, Sigma Chemical Company) and/or LPS (10
.mu.g/ml, Sigma Chemical Company) were used as positive controls
and cells cultured with media alone were used as negative controls.
Culture supernatants were collected at 6 hr (for TNF-.alpha.) or at
24 hr (for IL-6 and IL-12) and were tested for cytokines using
commercial ELISA kits (mouse OptEIA kits; PharMingen, Mississauga,
ON).
[0193] In vivo assays. Female BALB/c mice (n=3 or 5/group) were
injected either subcutaneously or intravenously with 500 .mu.g of
ODN or 500 .mu.l PBS (negative control) and bled at 3 or 8 hrs post
ODN administration. Plasma was tested for IP-10, IL-6 or IL-12 by
ELISA.
Example 1
Lipophilic Conjugates Demonstrate Enhanced IFN-.alpha.
Production
[0194] Human PBMC were incubated with increasing concentrations of
SEQ ID NO: 36
[0195] (CpG B-Class), SEQ ID NO: 39 (CpG C-Class), non-CpG control,
SEQ ID NO: 40 (CpG A-Class), non-CpG control A-Class or SEQ ID NO:
4 (CpG ODN with lipophilic conjugate) for 48 h. Supernatants were
harvested and IFN-.alpha. measured by ELISA. Shown is the
Mean.+-.SEM of three blood donors. The results are shown in FIG. 1.
The CpG ODN with lipophilic conjugate, the CpG C-Class
oligonucleotide, and the CpG A-Class oligonucleotide all induced
IFN-.alpha. production. The CpG ODN with lipophilic conjugate at a
concentration of 0.5 .mu.g/ml and 2 .mu.g/ml was measured to induce
IFN-.alpha. production of about 1000 pg/ml and 3250 pg/ml
respectively. The CpG B-Class oligonucleotide, the non-CpG control
oligonucleotide, and the non-CpG control A-Class oligonucleotide
did not induce any measurable IFN-.alpha. response.
Example 2
Lipophilic Conjugates Demonstrate Potency in IL-6 Production
[0196] Human PBMC were incubated with increasing concentrations of
SEQ ID NO: 36 (CpG B-Class), SEQ ID NO: 39 (CpG C-Class), non-CpG
control, SEQ ID NO: 40 (CpG A-Class), non-CpG control A-Class or
SEQ ID NO: 4 (CpG ODN with lipophilic conjugate) for 24 h.
Supernatant were harvested and IL-6 measured by ELISA. Shown is the
Mean.+-.SEM of three blood donors. The results are shown in FIG. 2.
In this assay the CpG ODN with lipophilic conjugate at a
concentration of 2 .mu.g/ml showed the highest measured induction
of IL-6 in comparison to the other ODNs used, about 750 pg/ml. At
lower concentrations (0.031, 0.125 and 0.5) the CpG ODN with
lipophilic conjugate induced IL-6 with reduced potency. The CpG
B-Class, CpG C-Class and to certain extend the CpG A-Class, ODNs
all demonstrated potency in IL-6 induction. The non-CpG control and
the non-CpG control A-Class oligonucleotides showed no or low
capacity for induction of IL-6.
Example 3
Lipophilic Conjugates Demonstrate Reduced Potency in IL-10
Production
[0197] Human PBMC were incubated with increasing concentrations of
SEQ ID NO: 36 (CpG B-Class), SEQ ID NO: 39 (CpG C-Class), non-CpG
control, SEQ ID NO: 40 (CpG A-Class), non-CpG control A-Class or
SEQ ID NO: 4 (CpG ODN with lipophilic conjugate) for 24 h.
Supernatants were harvested and IL-6 measured by ELISA. Shown is
the Mean.+-.SEM of three blood donors. The results are shown in
FIG. 3. The CpG ODN with lipophilic conjugate showed significantly
reduced potency in stimulating IL-10 production. Even at the
highest concentration used 2 .mu.g/ml the CpG ODN with lipophilic
conjugate did not significantly induce IL-10 stimulation. Similar
results were obtained with the A-Class ODN, while in contrast the
B-Class ODN and the C-Class ODN showed high capacity for induction
of IL-10 production. The non-CpG control and the non-CpG control
A-Class oligonucleotides showed no or low capacity for induction of
IL-10.
Example 4
Lipophilic Conjugates Induce TLR9-Dependent NF.kappa.B
Signaling
[0198] HEK293 cells expressing the human TLR9 were incubated with
the indicated ODN concentrations. NF.kappa.B stimulation was
measured through luciferase activity. Stimulation indices were
calculated in reference to luciferase activity of medium without
addition of CpG ODN (fold induction of luciferase activity). The
results are shown in FIG. 4. The CpG ODN with lipophilic conjugate
at the highest used dose of 10 .mu.g/ml induced a stimulation index
of about 20. In comparison the B-Class ODN induced a stimulation
index of 20 at a much lower concentration of 0.625 10 .mu.g/ml. The
A-Class ODN showed the lowest NF.kappa.B stimulation and the
highest measured stimulation index was 5 for an ODN concentration
of 10 .mu.g/ml.
Example 5
Effect of Sequence and Lipophilic Group of Conjugate on IFN-.alpha.
Production
[0199] Human PBMC of three donors were incubated for 48 h with the
indicated ODN.
[0200] Supernatants were harvested and IFN-.alpha. measured by
ELISA. Shown is the level of activation of each ODN by -: no; +:
low; +/++: intermediate; +++/++++: strong, as well as the maximal
IFN-.alpha. amount induced by each ODN. The results are shown in
Table 2.
TABLE-US-00004 TABLE 2 ODN # Sequence and Modification IFN-.alpha.
secretion SEQ ID NO: 36 T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T (+)
65/400 *T*G*T*C*G*T*T SEQ ID NO: 40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G
++++ 3134 *G*G*G*G*G SEQ ID NO: 3 T*C G_A_C_G_T_C_G*T-Chol + 1126
SEQ ID NO: 4 T_C_G_A_C_G_T_C_G_T_Chol +++ 2134 SEQ ID NO: 5
Chol-T_C_G_A_C_G_T_C_G_T-Chol + 456 SEQ ID NO: 6
Chol_T_C_GA_C_G_T_C_G_T_teg - 7 SEQ ID NO: 36
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T + 58 *T*G*T*C*G*T*T SEQ ID NO: 39
T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C* +++ 3198 G*C*G*C*C*G SEQ ID NO: 40
G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G ++++ 5018 *G*G*G*G*G SEQ ID NO: 4
T_C_G_A_C_G_T_C_G_T_Chol +++ 3439 SEQ ID NO: 7
T_C_G_T_C_G_A_C_G_T_G_Chol +++ 3395 SEQ ID NO: 8
T_C_G_A_C_G_T_C_G_T_T_Chol +++ 3383 SEQ ID NO: 9
G_T_C_G_A_C_G_T_C_G_T_Chol +++ 3408 SEQ ID NO: 10
G_T_C_G_A_C_G_T_C_G_T_T_Chol +++ 3511 SEQ ID NO: 11
T_C_G_T_C_G_A_C_G_T_T_Chol +++ 3468 SEQ ID NO: 19
T_C_G_A_C_G_T_C_G_A_C_GT_C_G_T_ ++ 3351 Chol SEQ ID NO: 25
T*C*G*T_C_G_A_C_G_T_C_G_T_Chol + 374 SEQ ID NO: 26
T*C*G*T*C*G*T*T*T*T_C_G_A_C_G_T_ - 23 C_G_T_Chol SEQ ID NO: 27
T_C_G_G_C_G_G_C_C_G_C_C_G_Chol +++ 3233 SEQ ID NO: 28
T*C*G*T_C_G_G_C_G_G_C_C_G_C_C_G_ + 208 T_Chol SEQ ID NO: 29
U_C_G_A_C_G_T_C_G_U-Chol +++ 2190 SEQ ID NO: 30
T_C_I_A_C_I_T_C_I_T-Chol - 9 SEQ ID NO: 31 T_C_7_A_C_7_T_C_7_T-Chol
+++ 2259 SEQ ID NO: 36 T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T + 477
*T*G*T*C*G*T*T SEQ ID NO: 39 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C* +++
2329 G*C*G*C*C*G SEQ ID NO: 40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G ++++
3667 *G*G*G*G*G SEQ ID NO: 12 A_C_G_A_C_G_T_C_G_T_Chol +/- 71 SEQ
ID NO: 13 T_C_G_A_C_G_T_C_G_A_Chol ++++ 2894 SEQ ID NO: 14
G_A_C_G_A_C_G_T_C_G_T_T_Chol ++ 3490 SEQ ID NO: 15
T*C*G*A*C*G*T*C*G*T_Chol - 7 SEQ ID NO: 16 T*C_G_A_C_G_T_C_G_T_Chol
+ 2717 SEQ ID NO: 17 T_C_G_A_C_G_T_C_G*T_Chol +++ 3600 SEQ ID NO:
18 T_C_G_A_C_G_T_C_G_T_teg - 21 SEQ ID NO: 19
T_C_G_T_C_G_T_C_G_T_Chol - 21 SEQ ID NO: 20
T_G_C_A_G_C_T_G_C_T-Chol - 14 SEQ ID NO: 21 . . . C_G_A_C_G_T_C_G .
. . _Chol - 8 SEQ ID NO: 22 T_A_A_C_G_T_T_T_Chol - 24 SEQ ID NO: 23
T_G_A_C_G_T_T_T_Chol - 18 SEQ ID NO: 32 T_C_A_T_C_G_A_T_G_A_Chol +
650 SEQ ID NO: 33 . . . G_A_C_G_A_T_C_G_T_C_Chol + 877 SEQ ID NO:
34 T_C_A_C_C_G_G_T_G_A_Chol -7 SEQ ID NO: 35
G_A_C_G_T_T_A_A_C_G_T_C_Chol - 0 SEQ ID NO: 105
T_C_A_A_C_G_T_T_G_A-Chol + 418 SEQ ID NO: 36
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T + 315 *T*G*T*C*G*T*T SEQ ID NO:
39 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C* +++ 3053 G*C*G*C*C*G SEQ ID NO:
40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G ++++ 4503 *G*G*G*G*G SEQ ID NO:
4 T_C_G_A_C_G_T_C_G_T_Chol SEQ ID NO: 13 T_C_G_A_C_G_T_C_G_A_Chol
++++ 3610 SEQ ID NO: 41 T_C_G_A_Chol - 73 SEQ ID NO: 42
T_C_G_C_G_A_Chol - 23 SEQ ID NO: 43 T_C_G_C_G_C_G_A_Chol - 44 SEQ
ID NO: 48 T_C_G_T_A_C_G_A_Chol ++(+) 2531 SEQ ID NO: 44
T_C_G_C_C_G_G_C_G_A_Chol ++ 2060 SEQ ID NO: 45
T_C_G_G_C_G_C_C_G_A_Chol +++ 3654 SEQ ID NO: 46
T_C_G_C_G_C_G_C_G_A_Chol +++ 3573 SEQ ID NO: 47
T_C_G_T_C_G_A_C_G_A_Chol - 40 SEQ ID NO: 49
T_C_G_A_A_T_T_C_G_A_Chol ++ 2788 SEQ ID NO: 50
T_C_G_T_T_A_A_C_G_A_Chol ++++ 4161 SEQ ID NO: 51
T_C_G_A_A_C_G_T_T_C_G_A_Chol ++(+) 2954 SEQ ID NO: 52
T_C_G_T_T_C_G_A_A_C_G_A_Chol ++++ 4033 SEQ ID NO: 53
T_C_G_A_C_G_A_T_C_G_T_C_G_A_Chol +(+) 3187 SEQ ID NO: 56
T_C_G_G_C_G_G_C_C_G_C_C_G_A_Chol + 1385 SEQ ID NO: 54
T_C_G_G_A_C_G_A_T_C_G_T_C_C_G_A ++(+) 3391 Chol SEQ ID NO: 36
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T + 776 *T*G*T*C*G*T*T SEQ ID NO:
39 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C* +++ 3201 G*C*G*C*C*G SEQ ID NO:
40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G ++++ 3706 *G*G*G*G*G SEQ ID NO:
13 T_C_G_A_C_G_T_C_G_A_Chol ++++ 3485 SEQ ID NO: 59
T_C_G_A_C_G_T_C*G*A_Chol +++(+) 2744 SEQ ID NO: 60
T_C_G_A_C_G_T*C*G*A_Chol +++(+) 3297 SEQ ID NO: 61
G_C_G_A_C_G_T_C_G_A_Chol - 304 SEQ ID NO: 62
C_C_G_A_C_G_T_C_G_A_Chol - 562 SEQ ID NO: 63
I_C_G_A_C_G_T_C_G_A_Chol - 226 SEQ ID NO: 64
U_C_G_A_C_G_T_C_G_A_Chol +(+) 1578 SEQ ID NO: 65
Z_C_G_A_C_G_T_C_G_A_Chol - 272 SEQ ID NO: 66
T_T_C_G_A_C_G_T_C_G_A_Chol +++(+) 2619 SEQ ID NO: 67
T_T_T_C_G_A_C_G_T_C_G_A_Chol ++ 1800 SEQ ID NO: 68
T_C_G_T_C_G_A_C_G_T_C_G_A_Chol +++ 2593 SEQ ID NO. 69
T_C_G_A_A_T_A_T_A_T_A_T_T_A_C_G_ - 43 A_chol SEQ ID NO: 70
T_C_G_A_A_T_A_T_A_T_A_T_T_A_chol - 96 SEQ ID NO: 71
T_C_A_T_C_G_A_T_G_A_Chol - 293 SEQ ID NO: 106
T*C_G*T*C_G*T*T*T*C_G*T*C_G*T*T_chol - 108 SEQ ID NO: 107
T_C_G_T_C_G_T_T_T_C_G_T_C_G_T_T_chol - 48 SEQ ID NO: 36
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T + 177 *T*G*T*C*G*T*T SEQ ID NO:
39 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C* +++ 1881 G*C*G*C*C*G SEQ ID NO:
40 G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G ++++ 2309 *G*G*G*G*G SEQ ID NO:
13 T_C_G_A_C_G_T_C_G_A_Chol +++ 2562 SEQ ID NO: 108
T_C_G_T_C_G_T_C_G_A_Chol - 35 SEQ ID NO: 109
T_C_G_A_C_G_A_C_G_A_Chol + 635 SEQ ID NO: 108 + +++ 2340 SEQ ID NO:
109
[0201] A palindromic or partial palindromic sequence with at least
one CpG motif was required but not sufficient for high IFN-.alpha.
induction. SEQ ID NO: 27 having the palindrome CGGCGGCCGCCG (SEQ ID
NO: 114) and an additional T at the 5'-end resulted in potent
induction of IFN-.alpha.. Addition of a G residue to the 5'-end or
a T residue to the 3'-end, such as in SEQ ID NO: 9, SEQ ID NO: 10,
and SEQ ID NO: 8, resulted in similar biological activity. However,
significant extension of the palindrome (SEQ ID NO: 19) resulted in
slightly decreased IFN-.alpha. induction. These results suggest
that with an oligonucleotide of this length and design the sequence
of the ODN must be to at least partially palindromic and that a TCG
(e.g. SEQ ID NO: 4, SEQ ID NO: 13), GTCG (SEQ ID NO: 9), GACG (SEQ
ID NO: 14), or a UCG (as in SEQ ID NO: 29) motif at the 5'-end or
near the 5'-end is of particular advantage to obtaining high
IFN-.alpha. induction.
[0202] The 3'-cholesterol modified SEQ ID NO: 4 shows high
secretion of IFN-.alpha. but low induction of IL-10 secretion, a
characteristic property of A-class CpG oligonucleotides.
Example 6
In vitro Mouse Splenocyte Stimulation
[0203] BALB/c mouse splenocytes were incubated for 24 h (FIG. 5a-b)
or 6 h (FIG. 5c) with the indicated concentrations of SEQ ID NO: 13
or control SEQ ID NO: 117. SN were harvested and cytokines measured
by ELISA. As shown in FIG. 5a, the CpG ODN with lipophilic
conjugate induced IL-6 production in adose dependent manner. At the
highest ODN concentration tested of 10 .mu.g/ml the measured IL-6
response was approximately 900 pg/ml. The control non-CpG ODN did
not stimulate any IL-6 induction. FIG. 5b shows the induction of
IL-12 by the CpG ODN with lipophilic conjugate. The CpG ODN with
lipophilic conjugate induced IL-12 production in a dose dependent
matter, and at the highest ODN concentration used, 10 .mu.g/ml, the
measured to IL-12 induction was about 3750 pg/ml. In contrast the
control non-CpG ODN did not stimulate any IL-12 production. FIG. 5c
shows the induction of TNF-.alpha. by the CpG ODN with lipophilic
conjugate in comparison to the control non-CpG ODN. At the
concentration of 10 .mu.g/ml, the CpG ODN with lipophilic conjugate
induced about 140 pg/ml of TNF-.alpha., while in contrast the
control non-CpG ODN did not significantly induce any TNF-.alpha.
production.
Example 7
In vitro TLR9.sup.+/+ and TLR9.sup.-/- Splenocyte Stimulation
[0204] Balb/c splenocytes from TLR9.sup.+/+ (FIG. 6a) or
TLR9.sup.-/- (FIG. 6b) mice were incubated for 24 h with the
indicated concentrations of SEQ ID NO: 13 or control SEQ ID NO:
117. SN were harvested and IL-12p40 measured by ELISA. FIG. 6a
shows that the CpG ODN with lipophilic conjugate induced IL-12
dose-response that was TLR-dependent. The highest concentration of
CpG ODN with lipophilic conjugate used, 10 .mu.g/ml, induced IL-12
concentration of 1200 pg/ml. In contrast, the control non-CpG ODN
did not significantly induce any IL-12 production at any
concentration used. FIG. 6b shows that both, the CpG ODN with
lipophilic conjugate and the control non-CpG ODN did not
significantly induce any IL-12 production in TLR deficient cells
even at concentration of 10 .mu.g/ml.
Example 8
In vivo Time-Dependent Plasma IP-10 Stimulation
[0205] Balb/c mice (n=5) were injected SC with 500 .mu.g of SEQ ID
NO: 13 and bled at 1, 2, 3, 6, 8, 12 and 24 hr post ODN
administration. Plasma was tested for IP-10 by ELISA (FIG. 7). As
shown in FIG. 7, the CpG ODN with lipophilic conjugate stimulated
production of IP-10 in time-dependent fashion. There was no
detectable IP-10 induction during the first three hours post
injection. At six hours post injection the IP-10 concentration was
increased to 500 pg/ml. At eight hours post injection the IP-10
stimulation peaked at about 2000 pg/ml. At 12 hours post injection
the IP-10 concentration decreased to about 500 pg/ml, equaling the
stimulation measured at six hours post injection. At twenty-four
hours post injection there was no detectable stimulation of IP-10
production. The control PBS treatment showed no induction of IP-10
production at any of the time points examined.
Example 9
In vivo Plasma Cytokine and Chemokine Stimulation
[0206] Balb/c mice (n=3) were injected IV with 500 .mu.g of SEQ ID
NO: 13 or 500 .mu.l PBS (negative control) and bled at 3 and 8 hrs
post ODN administration. Plasma was tested for cytokines or
chemokine by ELISA (FIG. 8). Solid bar=3 hr; Hatched bar=8 hr. FIG.
8a shows that the CpG ODN with lipophilic conjugate stimulated
production of IP-10 in time-dependent fashion, about 9000 and 4000
pg/ml of IP-10 were stimulated at 3 and 8 hrs respectively. In
contrast the control non-CPG ODN (SEQ ID NO: 117) did not stimulate
any IP-10 production at the same time points. FIG. 8b shows that
the stimulation of IL-12 production by the CpG ODN with lipophilic
conjugate was lower at 3 hrs, about 20,000 pg/ml of IL-12, than at
8 hrs, about 25,000 pg/ml of IL-12 produced. The control non-CpG
ODN did not induce any IL-12 production at either time point
tested. FIG. 8c shows that the CpG ODN with lipophilic conjugate
stimulated production of IL-6 in time-dependent fashion. At 3 hrs
post injection the IL-6 production ranged from 250 to 500 pg/ml,
while at 8 hrs post injection the IL-6 production was about 400
pg/ml. The control non-CpG ODN did not show significant induction
of IL-6 production in comparison to the PBS control.
[0207] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. Various modifications of the invention in addition to
those shown and described herein will become apparent to those
skilled in the art from the foregoing description and fall within
the scope of the appended claims. The advantages and objects of the
invention are not necessarily encompassed by each embodiment of the
invention.
Sequence CWU 1
1
116110DNAArtificial sequenceSynthetic oligonucleotide 1tcgacgtcgt
10210DNAArtificial sequenceSynthetic oligonucleotide 2tcgacgtcgt
10310DNAArtificial sequenceSynthetic oligonucleotide 3tcgacgtcgt
10410DNAArtificial sequenceSynthetic oligonucleotide 4tcgacgtcgt
10510DNAArtificial sequenceSynthetic oligonucleotide 5tcgacgtcgt
10610DNAArtificial sequenceSynthetic oligonucleotide 6tcgacgtcgt
10711DNAArtificial sequenceSynthetic oligonucleotide 7tcgtcgacgt g
11811DNAArtificial sequenceSynthetic oligonucleotide 8tcgacgtcgt t
11911DNAArtificial sequenceSynthetic oligonucleotide 9gtcgacgtcg t
111012DNAArtificial sequenceSynthetic oligonucleotide 10gtcgacgtcg
tt 121111DNAArtificial sequenceSynthetic oligonucleotide
11tcgtcgacgt t 111210DNAArtificial sequenceSynthetic
oligonucleotide 12acgacgtcgt 101310DNAArtificial sequenceSynthetic
oligonucleotide 13tcgacgtcga 101412DNAArtificial sequenceSynthetic
oligonucleotide 14gacgacgtcg tt 121510DNAArtificial
sequenceSynthetic oligonucleotide 15tcgacgtcgt 101610DNAArtificial
sequenceSynthetic oligonucleotide 16tcgacgtcgt 101710DNAArtificial
sequenceSynthetic oligonucleotide 17tcgacgtcgt 101810DNAArtificial
sequenceSynthetic oligonucleotide 18tcgacgtcgt 101916DNAArtificial
sequenceSynthetic oligonucleotide 19tcgacgtcga cgtcgt
162010DNAArtificial sequenceSynthetic oligonucleotide 20tcgtcgtcgt
102110DNAArtificial sequenceSynthetic oligonucleotide 21tgcagctgct
10228DNAArtificial sequenceSynthetic oligonucleotide 22cgacgtcg
8238DNAArtificial sequenceSynthetic oligonucleotide 23taacgttt
8248DNAArtificial sequenceSynthetic oligonucleotide 24tgacgttt
82513DNAArtificial sequenceSynthetic oligonucleotide 25tcgtcgacgt
cgt 132619DNAArtificial sequenceSynthetic oligonucleotide
26tcgtcgtttt cgacgtcgt 192713DNAArtificial sequenceSynthetic
oligonucleotide 27tcggcggccg ccg 132817DNAArtificial
sequenceSynthetic oligonucleotide 28tcgtcggcgg ccgccgt
172910DNAArtificial sequenceSynthetic oligonucleotide 29ncgacgtcgt
103010DNAArtificial sequenceSynthetic oligonucleotide 30tcnacntcnt
103110DNAArtificial sequenceSynthetic oligonucleotide 31tcnacntcnt
103210DNAArtificial sequenceSynthetic oligonucleotide 32tcatcgatga
103310DNAArtificial sequenceSynthetic oligonucleotide 33gacgatcgtc
103410DNAArtificial sequenceSynthetic oligonucleotide 34tcaccggtga
103512DNAArtificial sequenceSynthetic oligonucleotide 35gacgttaacg
tc 123624DNAArtificial sequenceSynthetic oligonucleotide
36tcgtcgtttt gtcgttttgt cgtt 243724DNAArtificial sequenceSynthetic
oligonucleotide 37tcgtcgtttt gtcgttttgt cgtt 243824DNAArtificial
sequenceSynthetic oligonucleotide 38tcgtcgtttt gtcgttttgt cgtt
243922DNAArtificial sequenceSynthetic oligonucleotide 39tcgtcgtttt
cggcgcgcgc cg 224021DNAArtificial sequenceSynthetic oligonucleotide
40ggggacgacg tcgtgggggg g 21414DNAArtificial sequenceSynthetic
oligonucleotide 41tcga 4426DNAArtificial sequenceSynthetic
oligonucleotide 42tcgcga 6438DNAArtificial sequenceSynthetic
oligonucleotide 43tcgcgcga 84410DNAArtificial sequenceSynthetic
oligonucleotide 44tcgccggcga 104510DNAArtificial sequenceSynthetic
oligonucleotide 45tcggcgccga 104610DNAArtificial sequenceSynthetic
oligonucleotide 46tctctctcta 104710DNAArtificial sequenceSynthetic
oligonucleotide 47tcgtcgacga 10488DNAArtificial sequenceSynthetic
oligonucleotide 48tcgtacga 84910DNAArtificial sequenceSynthetic
oligonucleotide 49tcgaattcga 105010DNAArtificial sequenceSynthetic
oligonucleotide 50tcgttaacga 105112DNAArtificial sequenceSynthetic
oligonucleotide 51tcgaacgttc ga 125212DNAArtificial
sequenceSynthetic oligonucleotide 52tcgttcgaac ga
125314DNAArtificial sequenceSynthetic oligonucleotide 53tcgacgatcg
tcga 145416DNAArtificial sequenceSynthetic oligonucleotide
54tcggacgatc gtccga 165516DNAArtificial sequenceSynthetic
oligonucleotide 55tcgacgagct cgtcga 165614DNAArtificial
sequenceSynthetic oligonucleotide 56tcggcggccg ccga
145710DNAArtificial sequenceSynthetic oligonucleotide 57tcgacgtcga
105810DNAArtificial sequenceSynthetic oligonucleotide 58tcgacgtcga
105910DNAArtificial sequenceSynthetic oligonucleotide 59tcgacgtcga
106010DNAArtificial sequenceSynthetic oligonucleotide 60tcgacgtcga
106110DNAArtificial sequenceSynthetic oligonucleotide 61gcgacgtcga
106210DNAArtificial sequenceSynthetic oligonucleotide 62ccgacgtcga
106310DNAArtificial sequenceSynthetic oligonucleotide 63ncgacgtcga
106410DNAArtificial sequenceSynthetic oligonucleotide 64ncgacgtcga
106510DNAArtificial sequenceSynthetic oligonucleotide 65ncgacgtcga
106611DNAArtificial sequenceSynthetic oligonucleotide 66ttcgacgtcg
a 116712DNAArtificial sequenceSynthetic oligonucleotide
67tttcgacgtc ga 126813DNAArtificial sequenceSynthetic
oligonucleotide 68tcgtcgacgt cga 136917DNAArtificial
sequenceSynthetic oligonucleotide 69tcgaatatat attacga
177014DNAArtificial sequenceSynthetic oligonucleotide 70tcgaatatat
atta 147110DNAArtificial sequenceSynthetic oligonucleotide
71tcatcgatga 107210DNAArtificial sequenceSynthetic oligonucleotide
72tcgacgttga 107310DNAArtificial sequenceSynthetic oligonucleotide
73ncgacgncga 107410DNAArtificial sequenceSynthetic oligonucleotide
74tngangtnga 107510DNAArtificial sequenceSynthetic oligonucleotide
75tngangtnga 107610DNAArtificial sequenceSynthetic oligonucleotide
76tcgncgtcgn 107710DNAArtificial sequenceSynthetic oligonucleotide
77tcnacntcna 107810DNAArtificial sequenceSynthetic oligonucleotide
78tcnacntcna 107910DNAArtificial sequenceSynthetic oligonucleotide
79tcnacntcna 108010DNAArtificial sequenceSynthetic oligonucleotide
80tcnacntcna 108110DNAArtificial sequenceSynthetic oligonucleotide
81tcgncgtcgn 108210DNAArtificial sequenceSynthetic oligonucleotide
82tngangtnga 108310DNAArtificial sequenceSynthetic oligonucleotide
83tcgacgncga 108410DNAArtificial sequenceSynthetic oligonucleotide
84tcgacgtcga 108510DNAArtificial sequenceSynthetic oligonucleotide
85ncgacgtcga 108610DNAArtificial sequenceSynthetic oligonucleotide
86tcgacgtcga 108710DNAArtificial sequenceSynthetic oligonucleotide
87ncgacgtcga 108810DNAArtificial sequenceSynthetic oligonucleotide
88ncgacgtcga 108910DNAArtificial sequenceSynthetic oligonucleotide
89tcnacgtcga 109010DNAArtificial sequenceSynthetic oligonucleotide
90tcgangtcga 109110DNAArtificial sequenceSynthetic oligonucleotide
91tcgacgtcna 109210DNAArtificial sequenceSynthetic oligonucleotide
92tcganntcga 109310DNAArtificial sequenceSynthetic oligonucleotide
93tcgacgtcga 109410DNAArtificial sequenceSynthetic oligonucleotide
94tcgacgtcga 109510DNAArtificial sequenceSynthetic oligonucleotide
95tcgacgtcga 109610DNAArtificial sequenceSynthetic oligonucleotide
96tcgacgtcga 109710DNAArtificial sequenceSynthetic oligonucleotide
97ncgacgncga 109810DNAArtificial sequenceSynthetic oligonucleotide
98ncgacgtcga 109910DNAArtificial sequenceSynthetic oligonucleotide
99ncgacgncga 1010010DNAArtificial sequenceSynthetic oligonucleotide
100ncgacgtcga 1010110DNAArtificial sequenceSynthetic
oligonucleotide 101ncgacgncga 1010210DNAArtificial
sequenceSynthetic oligonucleotide 102ncgacgncga
1010324DNAArtificial sequenceSynthetic oligonucleotide
103tcgacgtcga nnnntcgacg tcga 2410424DNAArtificial
sequenceSynthetic oligonucleotide 104agctgcagct nnnntcgacg tcga
2410510DNAArtificial sequenceSynthetic oligonucleotide
105tcaacgttga 1010616DNAArtificial sequenceSynthetic
oligonucleotide 106tcgtcgtttc gtcgtt 1610716DNAArtificial
sequenceSynthetic oligonucleotide 107tcgtcgtttc gtcgtt
1610810DNAArtificial sequenceSynthetic oligonucleotide
108tcgtcgtcga 1010910DNAArtificial sequenceSynthetic
oligonucleotide 109tcgacgacga 1011010DNAArtificial
sequenceSynthetic oligonucleotide 110acgacgtcgt
1011110DNAArtificial sequenceSynthetic oligonucleotide
111tcgacgtcgt 1011210DNAArtificial sequenceSynthetic
oligonucleotide 112tcgacgtcga 1011314DNAArtificial
sequenceSynthetic oligonucleotide 113cgacgtcgac gtcg
1411412DNAArtificial sequenceSynthetic oligonucleotide
114cggcggccgc cg 1211510DNAArtificial sequenceSynthetic
oligonucleotide 115gacgatcgtc 1011624DNAArtificial
sequenceSynthetic oligonucleotide 116tcgtcgtttt gtcgttttgt cgtt
24
* * * * *