U.S. patent application number 11/507079 was filed with the patent office on 2007-03-22 for immunostimulatory nucleic acids.
This patent application is currently assigned to Coley Pharmaceutical GmbH. Invention is credited to Arthur M. Krieg, Christian Schetter, Jorg Vollmer.
Application Number | 20070066554 11/507079 |
Document ID | / |
Family ID | 27387805 |
Filed Date | 2007-03-22 |
United States Patent
Application |
20070066554 |
Kind Code |
A1 |
Krieg; Arthur M. ; et
al. |
March 22, 2007 |
Immunostimulatory nucleic acids
Abstract
The invention relates to immunostimulatory nucleic acid
compositions and methods of using the compositions. The T-rich
nucleic acids contain poly T sequences and/or have greater than 25%
T nucleotide residues. The TG nucleic acids have TG dinucleotides.
The C-rich nucleic acids have at least one poly-C region and/ore
greater than 50% c nucleotides. These immunostimulatory nucleic
acids function in a similar manner to nucleic acids containing CpG
motifs. The invention also encompasses preferred CpG nucleic
acids.
Inventors: |
Krieg; Arthur M.;
(Wellesley, MA) ; Schetter; Christian; (Hilden,
DE) ; Vollmer; Jorg; (Dusseldorf, DE) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2206
US
|
Assignee: |
Coley Pharmaceutical GmbH
Langenfeld
IA
University of Iowa Research Foundation
Iowa City
|
Family ID: |
27387805 |
Appl. No.: |
11/507079 |
Filed: |
August 18, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09669187 |
Sep 25, 2000 |
|
|
|
11507079 |
Aug 18, 2006 |
|
|
|
60227436 |
Aug 23, 2000 |
|
|
|
60156135 |
Sep 27, 1999 |
|
|
|
60156113 |
Sep 25, 1999 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/6.14 |
Current CPC
Class: |
A61K 31/7125 20130101;
A61P 15/00 20180101; A61P 31/12 20180101; A61P 37/08 20180101; A61P
1/18 20180101; A61P 31/04 20180101; A61P 17/00 20180101; A61P 27/02
20180101; A61K 31/7105 20130101; A61P 25/00 20180101; A61P 19/00
20180101; A61P 1/16 20180101; A61P 11/00 20180101; A61K 31/7088
20130101; A61P 35/00 20180101; A61K 45/06 20130101; A61P 11/06
20180101; A61P 37/04 20180101; A61P 37/00 20180101; A61P 1/00
20180101; A61P 13/12 20180101; A61K 2039/55561 20130101; A61P 31/00
20180101; A61K 39/39 20130101 |
Class at
Publication: |
514/044 ;
435/006 |
International
Class: |
A61K 48/00 20070101
A61K048/00; C12Q 1/68 20060101 C12Q001/68 |
Claims
1-106. (canceled)
107. A therapeutic composition for the elicitation of a systemic,
non-antigen specific immune response in a mammal comprising: a. a
liposome delivery vehicle; and b. an isolated nucleic acid molecule
selected from the group consisting of: i. an oligonucleotide
containing no CpG motifs; and ii. an isolated nucleic acid vector
without a gene insert, or a fragment thereof; wherein said
therapeutic composition elicits a systemic, non-antigen-specific
immune response in said mammal.
108. The composition of claim 107, wherein said liposome delivery
vehicle comprises cationic liposomes.
109. The composition of claim 107, further comprising a
pharmaceutically acceptable excipient.
110. The composition of claim 109, wherein said excipient comprises
a non-ionic diluent.
111. The composition of claim 107, wherein said oligonucleotide is
at least 10 base pairs in length.
112. The composition of claim 111, wherein said oligonucleotide is
in the range of 10 to 100 base pairs in length.
113. A method for eliciting a systemic, non-antigen specific immune
response in a mammal, comprising administering to said mammal an
amount of a composition effective to elicit said immune response,
wherein said composition comprises: a. a liposome delivery vehicle;
and b. an isolated nucleic acid molecule selected from the group
consisting of: i. an oligonucleotide containing no CpG motifs; and
ii. an isolated nucleic acid vector without a gene insert or a
fragment thereof.
114. The method of claim 113, wherein said liposome delivery
vehicle comprises cationic liposomes.
115. The method of claim 113, wherein said composition further
comprises a pharmaceutically acceptable excipient.
116. The method of claim 115, wherein said excipient comprises a
non-ionic diluent.
117. A pharmaceutical composition for inducing antigen non-specific
innate immune activation in a subject comprising: a. a nucleic acid
delivery complex, and b. an isolated oligonucleotide that is free
of CpG dinucleotides, wherein said composition induces an antigen
non-specific innate immune activation in the subject.
118. The composition of claim 117, wherein the immune activation
comprises activation of NK cells.
119. The composition of claim 117, wherein the immune activation
comprises induction of IFN-gamma.
120. The composition of claim 117, wherein the nucleic acid
delivery complex comprises a sterol.
121. The composition of claim 120, wherein the sterol is
cholesterol.
122. The composition of claim 117, wherein the nucleic acid
delivery complex comprises a lipid.
123. The composition of claim 122, wherein the lipid is a cationic
lipid, virosome or liposome.
124. The composition of claim 117, further comprising a
pharmaceutically acceptable carrier.
125. The composition of claim 124, wherein the carrier comprises a
cellulose derivative, dextran or sorbitol.
126. The composition of claim 125, wherein the cellulose derivative
is sodium carboxymethyl cellulose.
127. The composition of claim 117, wherein the oligonucleotide is
at least 4 base pairs in length.
128. The composition of claim 127, wherein the oligonucleotide has
a length in the range of 6 to 100 nucleotides.
129. The composition of claim 117, wherein the subject is a
human.
130. The composition of claim 117, wherein the antigen non-specific
innate immune activation is systemic.
131. The composition of claim 117, wherein the composition induces
an antigen non-specific innate immune activation in the subject
when administered by intraperitoneal or intravenous route.
132. The composition of claim 117, wherein the oligonucleotide is a
T-rich oligonucleotide or a TG oligonucleotide.
133. The composition of claim 117, wherein the oligonucleotide has
the sequence of SEQ ID NO:225, SEQ ID NO:282, or SEQ ID NO:
886.
134. The composition of claim 117, wherein the composition induces
an antigen non-specific innate immune activation in the subject
when administered by parenteral route.
135. A method for inducing an antigen non-specific innate immune
activation in a subject, comprising administering to the subject an
amount of a composition effective to induce the immune activation,
wherein said composition comprises: a. a nucleic acid delivery
complex; and b. an isolated oligonucleotide that is free of CpG
dinucleotides.
136. The method of claim 135, wherein the immune activation
comprises activation of NK cells.
137. The method of claim 135, wherein the immune activation
comprises induction of IFN-gamma.
138. The method of claim 135, wherein the nucleic acid delivery
complex comprises a sterol.
139. The method of claim 138, wherein the sterol is
cholesterol.
140. The method of claim 135, wherein the nucleic acid delivery
complex comprises a lipid.
141. The method of claim 140, wherein the lipid is a cationic
lipid, virosome or liposome.
142. The method of claim 135, further comprising a pharmaceutically
acceptable carrier.
143. The method of claim 142, wherein the carrier comprises a
cellulose derivative, dextran or sorbitol.
144. The method of claim 143, wherein the cellulose derivative is
sodium carboxymethyl cellulose.
145. The method of claim 135, wherein the subject is a human.
146. The method of claim 135, wherein the antigen non-specific
innate immune activation is systemic.
147. The method of claim 135, wherein the composition is
administered by intraperitoneal or intravenous route.
148. The method of claim 135, wherein the oligonucleotide is a
T-rich oligonucleotide or a TG oligonucleotide.
149. The method of claim 135, wherein the oligonucleotide has the
sequence of SEQ ID NO:225, SEQ ID NO:282, or SEQ ID NO: 886.
150. The method of claim 135, wherein the composition is
administered by parenteral route.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/669,187, filed Sep. 25, 2000, which claims
priority under 35 U.S.C. .sctn.119 to U.S. Provisional Patent
Application Nos. 60/156,113, filed Sep. 25, 1999, 60/156,135, filed
Sep. 27, 1999, and 60/227,436, filed Aug. 23, 2000, the entire
contents of all of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to immunostimulatory
nucleic acids, compositions thereof and methods of using the
immunostimulatory nucleic acids.
BACKGROUND OF THE INVENTION
[0003] Bacterial DNA has immune stimulatory effects to activate B
cells and natural killer cells, but vertebrate DNA does not
(Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79:682-686;
Tokunaga, T., et al., 1984, JNCI72:955-962; Messina, J. P., et al.,
1991, J. Immunol. 147:1759-1764; and reviewed in Krieg, 1998, In:
Applied Oligonucleotide Technology, C. A. Stein and A. M. Krieg,
(Eds.), John Wiley and Sons, Inc., New York, N.Y., pp. 431-448). It
is now understood that these immune stimulatory effects of
bacterial DNA are a result of the presence of unmethylated CpG
dinucleotides in particular base contexts (CpG motifs), which are
common in bacterial DNA, but methylated and underrepresented in
vertebrate DNA (Krieg et al, 1995 Nature 374:546-549; Krieg, 1999
Biochim. Biophys. Acta 93321:1-10). The immune stimulatory effects
of bacterial DNA can be mimicked with synthetic
oligodeoxynucleotides (ODN) containing these CpG motifs. Such CpG
ODN have highly stimulatory effects on human and murine leukocytes,
inducing B cell proliferation; cytokine and immunoglobulin
secretion; natural killer (NK) cell lytic activity and IFN-.gamma.
secretion; and activation of dendritic cells (DCs) and other
antigen presenting cells to express costimulatory molecules and
secrete cytokines, especially the Th1-like cytokines that are
important in promoting the development of Th1-like T cell
responses. These immune stimulatory effects of native
phosphodiester backbone CpG ODN are highly CpG specific in that the
effects are essentially abolished if the CpG motif is methylated,
changed to a GpC, or otherwise eliminated or altered (Krieg et al,
1995 Nature 374:546-549; Hartmann et al, 1999 Proc. Natl. Acad. Sci
USA 96:9305-10). Phosphodiester CpG ODN can be formulated in
lipids, alum, or other types of vehicles with depot properties or
improved cell uptake in order to enhance the immune stimulatory
effects (Yamamoto et al, 1994 Microbiol. Immunol. 38:831-836;
Gramzinski et al, 1998 Mol. Med. 4:109-118).
[0004] In early studies, it was thought that the immune stimulatory
CpG motif followed the formula
purine-purine-CpG-pyrimidine-pyrimidine (Krieg et al, 1995 Nature
374:546-549; Pisetsky, 1996 J. Immunol. 156:421-423; Hacker et al.,
1998 EMBO J. 17:6230-6240; Lipford et al, 1998 Trends in Microbiol.
6:496-500). However, it is now clear that mouse lymphocytes respond
quite well to phosphodiester CpG motifs that do not follow this
"formula" (Yi et al., 1998 J. Immunol. 160:5898-5906) and the same
is true of human B cells and dendritic cells (Hartmann et al, 1999
Proc. Natl. Acad. Sci USA 96:9305-10; Liang, 1996 J. Clin. Invest.
98:1119-1129).
[0005] Several past investigators have looked at whether the
nucleotide content of ODN may have effects independently of the
sequence of the ODN. Interestingly, antisense ODN have been found
to be generally enriched in the content of GG, CCC, CC, CAC, and CG
sequences, while having reduced frequency of TT or TCC nucleotide
sequences compared to what would be expected if base usage were
random (Smetsers et al., 1996 Antisense Nucleic Acid Drug Develop.
6:63-67). This raised the possibility that the over-represented
sequences may comprise preferred targeting elements for antisense
oligonucleotides or visa versa. One reason to avoid the use of
thymidine-rich ODN for antisense experiments is that degradation of
the ODN by nucleases present in cells releases free thymidine which
competes with .sup.3H-thymidine which is frequently used in
experiments to assess cell proliferation (Matson et al., 1992
Antisense Research and Development 2:325-330).
SUMMARY OF THE INVENTION
[0006] The present invention relates in part to pyrimidine rich
(Py-rich) and in some embodiments thymidine (T) rich
immunostimulatory nucleic acids which do not require the presence
of a CpG motif. The present invention also relates in part to the
discovery that nucleic acids which contain a TG dinucleotide motif
are also immunostimulatory. The invention is based in part on the
unexpected finding that nucleic acid sequences which do not contain
CpG motifs are immunostimulatory. It was discovered upon analysis
of the immune stimulation properties of many nucleic acid sequences
that these sequences may be Py-rich e.g., T-rich or that they may
contain TG motifs. It was also discovered that these sequences
preferentially activate non-rodent immune cells. The Py-rich and TG
sequences are only minimally immunostimulatory with respect to
rodent immune cells, compared to non-rodent immune cells. Thus, it
is possible according to the methods of the invention to induce an
immune response in a non-rodent subject by administering Py-rich or
TG immunostimulatory nucleic acids. The Py-rich and TG
immunostimulatory nucleic acids of the invention may optionally
include CpG motifs. These findings have important implications for
the clinical development of immunostimulatory CpG containing and
non-CpG containing nucleic acids.
[0007] In one aspect the invention is a pharmaceutical composition
comprising an effective amount for stimulating an immune response
of isolated Py-rich or TG immunostimulatory nucleic acids, and a
pharmaceutically acceptable carrier. In other aspects the invention
is a composition of matter, comprising an isolated Py-rich or TG
immunostimulatory nucleic acid. In other embodiments, the
immunostimulatory nucleic acid may be T-rich. In still other
embodiments, the immunostimulatory nucleic acid may be T-rich and
also have at least one TG motif.
[0008] Preferably the Py-rich nucleic acid is a T-rich nucleic
acid. In some embodiments the T-rich immunostimulatory nucleic acid
is a poly T nucleic acid comprising 5' TTTT 3'. In yet other
embodiments the poly T nucleic acid comprises 5' X.sub.1
X.sub.2TTTTX.sub.3 X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3 and
X.sub.4 are nucleotides. In some embodiments X.sub.1X.sub.2 is TT
and/or X.sub.3X.sub.4 is TT. In other embodiments X.sub.1X.sub.2 is
selected from the group consisting of TA, TG, TC, AT, AA, AG, AC,
CT, CC, CA, CG, GT, GG, GA, and GC; and/or X.sub.3X.sub.4 is
selected from the group consisting of TA, TG, TC, AT, AA, AG, AC,
CT, CC, CA, CG, GT, GG, GA, and GC.
[0009] The T-rich immunostimulatory nucleic acid may have only a
single poly T motif or it may have a plurality of poly T nucleic
acid motifs. In some embodiments the T-rich immunostimulatory
nucleic acid comprises at least 2, at least 3, at least 4, at least
5, at least 6, at least 7, or at least 8 T motifs. In other
embodiments it comprises at least 2, at least 3, at least 4, at
least 5, at least 6, at least 7, or at least 8 CpG motifs. In
preferred embodiments the plurality of CpG motifs and poly T motifs
are interspersed.
[0010] In yet other embodiments at least one of the plurality of
poly T motifs comprises at least 3, at least 4, at least 5, at
least 6, at least 7, at least 8, or at least 9 contiguous T
nucleotide residues. In other embodiments the plurality of poly T
motifs is at least 3 motifs and wherein at least 3 motifs each
comprises at least 3 contiguous T nucleotide residues or the
plurality of poly T motifs is at least 4 motifs and wherein the at
least 4 motifs each comprises at least 3 contiguous T nucleotide
residues.
[0011] In some cases the T-rich immunostimulatory nucleic acid may
be free of poly T motifs but may rather comprise a nucleotide
composition of greater than 25% T. In other embodiments the T-rich
immunostimulatory nucleic acids have poly T motifs and also
comprise a nucleotide composition of greater than 25% T. In
preferred embodiments the T-rich immunostimulatory nucleic acid
comprises a nucleotide composition of greater than 35% T, greater
than 40% T, greater than 50% T, greater than 60% T, greater than
80% T, or greater than 90% T nucleotide residues. In important
embodiments, the nucleic acid is at least 50% T.
[0012] The T-rich and TG immunostimulatory nucleic acids can have
any length greater than 7 nucleotides, but in some embodiments can
be between 8 and 100 nucleotide residues in length. In preferred
embodiments the T-rich immunostimulatory nucleic acid comprises at
least 20 nucleotides, at least 24 nucleotides, at least 27,
nucleotides, or at least 30 nucleotides. In preferred embodiments,
the TG immunostimulatory nucleic acid is between 15 and 25
nucleotides in length. The T-rich and TG immunostimulatory nucleic
acids may be single stranded or double stranded.
[0013] In one preferred embodiment, the immunostimulatory nucleic
acid has a T-rich region located in the middle of its length (i.e.,
an approximately equal number of nucleotides flank the T-rich
region on the 5' and 3' ends).
[0014] The T rich nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226,
241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471,
479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852,
861, 867, 868, 882, 886, 905, 907, 908, and 910-913. In other
embodiments the T rich nucleic acids are sequence selected from the
group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208,
214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300,
305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407,
411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692,
693, 804, 862, 883, 884, 888, 890, and 891.
[0015] In other embodiments the Py-rich immunostimulatory nucleic
acid is a C-rich nucleic acid. An immunostimulatory C-rich nucleic
acid is a nucleic acid including at least one and preferably at
least 2 poly-C regions or which includes 50% or greater C
nucleotides.
[0016] The Py-rich and TG immunostimulatory nucleic acids may
include one or more CpG motifs. The motifs may be methylated or
unmethylated. In other embodiments the Py-rich and TG
immunostimulatory nucleic acids are free of one or more CpG
dinucleotides.
[0017] In other embodiments the Py-rich and TG immunostimulatory
nucleic acids also include poly-A, poly G, and/or poly C motifs. In
yet other embodiments the Py-rich or TG immunostimulatory nucleic
acid is free of two poly C sequences of at least 3 contiguous C
nucleotide residues or is free of two poly A sequences of at least
3 contiguous A nucleotide residues. In other embodiments the
Py-rich or TG immunostimulatory nucleic acid comprises a nucleotide
composition of greater than 25% C or greater than 25% A. In yet
other embodiments the Py-rich or TG immunostimulatory nucleic acid
is free of poly-C sequences, poly-G sequences or poly-A
sequences.
[0018] A poly G nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276,
282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733,
768, 795, 796, 914-925, 928-931, 933-936, and 938. In other
embodiments the poly G nucleic acid includes a sequence selected
from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148,
173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475,
519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662,
725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937.
[0019] According to another aspect of the invention, the
immunostimulatory nucleic acids may be defined as those which
possess a TG motif, herein referred to as TG immunostimulatory
nucleic acids. The TG nucleic acid in one embodiment contains at
least one TG dinucleotide having a sequence including at least the
following formula: 5'N.sub.1X.sub.1TGX.sub.2N.sub.23'. In related
embodiments, N.sub.1 is a nucleic acid sequence composed of a
number of nucleotides ranging from (11-N.sub.2) to (21-N.sub.2) and
N.sub.2 is a nucleic acid sequence composed of a number of
nucleotides ranging from (11-N.sub.1) to (21-N.sub.1). In a
preferred embodiment, X.sub.2 is thymidine.
[0020] In other embodiments, the TG nucleic acid has at least the
following formula: 5' X.sub.1 X.sub.2TGX.sub.3 X.sub.4 3'. In yet
another embodiment, the TG nucleic acid comprises the following
sequence: 5'N.sub.1X.sub.1X.sub.2TGX.sub.3X.sub.4N.sub.23'. In a
related embodiment, N.sub.1 is a nucleic acid sequence composed of
a number of nucleotides ranging from (9-N.sub.2) to (19-N.sub.2)
and N.sub.2 is a nucleic acid sequence composed of a number of
nucleotides ranging from (9-N.sub.1) to (19-N.sub.1). In one
preferred embodiment, X.sub.3 is thymidine. X.sub.1X.sub.2 are
nucleotides which may be selected from the group consisting of GT,
GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X.sub.3X.sub.4 are
nucleotides which may be selected from the group consisting of TT,
CT, AT, AG, CG, TC, AC, CC, TA, AA, and CA. In some preferred
embodiments, X.sub.3 is a thymidine. In important embodiments,
X.sub.3X.sub.4 are nucleotides selected from the group consisting
of TT, TC, TA and TG. In other embodiments X.sub.1X.sub.2 are GA or
GT and X.sub.3X.sub.4 are TT. In yet other embodiments X.sub.1 or
X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are
pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or
both are pyrimidines. In one embodiment X.sub.2 is a T and X.sub.3
is a pyrimidine.
[0021] In one embodiment the 5' X.sub.1 X.sub.2TGX.sub.3 X.sub.4 3'
sequence of the TG nucleic acid or the entire length or some
fragment thereof of the TG nucleic acid is a non-palindromic
sequence, and in other embodiments it is a palindromic
sequence.
[0022] In some preferred embodiments, the TG nucleic acid is also
T-rich.
[0023] The Py-rich and TG immunostimulatory nucleic acids in some
embodiments have a nucleotide backbone which includes at least one
backbone modification, such as a phosphorothioate modification. The
nucleotide backbone may be chimeric, or preferably the nucleotide
backbone is entirely modified. In one preferred embodiment, the
immunostimulatory nucleic acid has a poly T motif and a
phosphorothioate backbone.
[0024] In another aspect the invention is a composition of an
immunostimulatory nucleic acid, in the form of a Py-rich or a TG
nucleic acid, and an antigen, wherein the nucleic acid is free of
unmethylated CpG motifs.
[0025] Another composition of the invention is a Py-rich or TG
immunostimulatory nucleic acid and an anti-microbial agent, wherein
the Py-rich or TG nucleic acid is free of unmethylated CpG motifs.
Preferably the anti-microbial agent is selected from the group
consisting of an anti-viral agent, an anti-parasitic agent, an
anti-bacterial agent and an anti-fungal agent.
[0026] A composition of a sustained release device including a
Py-rich and/or TG immunostimulatory nucleic acid, wherein the
Py-rich and/or TG nucleic acid is free of unmethylated CpG motifs,
is provided according to another aspect of the invention.
[0027] The invention also includes nutritional supplements of a
Py-rich or TG immunostimulatory nucleic acid in a delivery device
selected from the group consisting of a capsule, a pill, and a
sublingual tablet, wherein the Py-rich or TG nucleic acid is free
of unmethylated CpG motifs.
[0028] It should be understood that when it is useful to administer
a Py-rich e.g., poly T, T-rich, C-rich, or TG oligonucleotide and a
CpG oligonucleotide, it may also be desirable to co-administer a
Py-rich or a TG oligonucleotide together with a physically separate
CpG, Py-rich or TG oligonucleotide. Alternatively, the CpG, Py-rich
or TG motif may be present on the same contiguous nucleic acid as
the Py-rich or TG oligonucleotide. In yet a further embodiment, all
or some combination of Py-rich, TG and CpG nucleic acids may be
co-administered either on separate nucleic acids or in the same
nucleic acid molecule. By co-administer it is intended that the
nucleic acids be administered close enough in time to one another
to achieve a combined benefit of both oligonucleotides, preferably
more than the benefit achieved by administering each of the
oligonucleotides alone at the same dose.
[0029] CpG oligonucleotides have, in general, the formula
5'X.sub.1X.sub.2CGX.sub.3X.sub.43', wherein X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are nucleotides and wherein at least the C of
CpG is unmethylated. Preferred CpG oligonucleotides are 8-100
nucleotides in length and have modified back bones. Particular
structures are detailed in the published PCT applications, U.S.
applications and references cited herein, the disclosures of which
are incorporated herein in their entirety. In one embodiment, the
CpG oligonucleotide is free of poly T and TG motifs and is not
T-rich.
[0030] In other embodiments, the CpG oligonucleotide has a sequence
selected from the group consisting of SEQ ID NO: 1, 3, 4, 14-16,
18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87,
90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141,
146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214,
216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275,
277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312,
314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365,
367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404,
406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450,
453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488,
489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541,
543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611,
613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706,
708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761,
763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799,
804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859,
862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0031] In another embodiment, the Py-rich or TG oligonucleotide is
free of a CpG motifs. This embodiment of the invention also
involves pharmaceutical compositions and kits which contain both a
CpG oligonucleotide (which can be free of poly T and TG motifs and
not be T-rich) and a Py-rich and/or TG oligonucleotide physically
separate from the CpG oligonucleotide. The pharmaceutical
preparations are in effective amounts and typically include
pharmaceutically acceptable carriers, all as set forth in detail
herein with respect to Py-rich and TG oligonucleotides. The kits
include at least one container containing an oligonucleotide which
is a Py-rich or TG oligonucleotide (or some combination thereof).
The same container, or in other embodiments, a second container,
may contain an oligonucleotide with a CpG motif, which may be free
of Py-rich and/or TG motifs. The kit also contains instructions for
administering the oligonucleotides to a subject. The kits also may
include a container containing a solvent or a diluent.
[0032] In summary, as if fully recited herein, a CpG
oligonucleotide physically separate from the Py-rich or TG
oligonucleotide can be used together with the Py-rich or TG
oligonucleotides in the methods, compositions and products
described above.
[0033] The invention relates in other aspects to immunostimulatory
oligonucleotides which have chimeric backbones and which do not
require the presence of a CpG motif. The invention is based in part
on the discovery that nucleic acid sequences which did not contain
CpG motifs were immunostimulatory, and that those which have
chimeric backbones have unexpectedly enhanced immune stimulating
properties. Thus the invention in one aspect relates to a
composition of an oligonucleotide having a formula: 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3', wherein Y.sub.1 and Y.sub.2 are,
independent of one another, nucleic acid molecules having between 1
and 10 nucleotides, wherein Y.sub.1 includes at least one modified
internucleotide linkage and Y.sub.2 includes at least one modified
internucleotide linkage and wherein N.sub.1 and N.sub.2 are nucleic
acid molecules, each independent of one another, having between 0
and 5 nucleotides, but wherein N.sub.1ZN.sub.2 has at least 6
nucleotides in total and wherein the nucleotides of N.sub.1ZN.sub.2
have a phosphodiester backbone, and wherein Z is an
immunostimulatory nucleic acid motif but does not include a CG. In
one embodiment Z is a nucleic acid sequence selected from the group
consisting of TTTT, TG, and a sequence wherein at least 50% of the
bases of the sequence are Ts.
[0034] In some embodiments Y.sub.1 and/or Y.sub.2 have between 3
and 8 nucleotides. In other embodiments Y.sub.1 and/or Y.sub.2 are
comprised of at least three Gs, at least four Gs, least seven Gs,
or all Gs. In other embodiments Y.sub.1 and/or Y.sub.2 are selected
from the group consisting of TCGTCG, TCGTCGT, and TCGTCGTT (SEQ ID
NO:1145). In yet other embodiments Y.sub.1 and/or Y.sub.2 include
at least one, two, three, four, or five poly-A, poly-T, or poly-C
sequences.
[0035] The center nucleotides (N.sub.1ZN.sub.2) of the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 have phosphodiester internucleotide
linkages and Y.sub.1 and Y.sub.2 have at least one modified
internucleotide linkage. In some embodiments Y.sub.1 and/or Y.sub.2
have at least two modified internucleotide linkages. In other
embodiments Y.sub.1 and/or Y.sub.2 have between two and five
modified internucleotide linkages. In yet other embodiments Y.sub.1
has two modified internucleotide linkages and Y.sub.2 has five
modified internucleotide linkages or Y.sub.1 has five modified
internucleotide linkages and Y.sub.2 has two modified
internucleotide linkages. The modified internucleotide linkage, in
some embodiments is a phosphorothioate modified linkage, a
phosphorodithioate modified linkage or a p-ethoxy modified
linkage.
[0036] Portions of the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 may
optionally form a palindrome. Thus, in some embodiments the
nucleotides of N.sub.1ZN.sub.2 form a palindrome. In some
embodiments the palindrome is not a direct repeat. In yet other
embodiments the nucleotides of N.sub.1ZN.sub.2 do not form a
palindrome.
[0037] According to other embodiments N.sub.1ZN.sub.2 has a
sequence of nucleotides selected from the group consisting of
GATTTTATCGTC (SEQ ID NO: 1098); TCGATTTTTCGA (SEQ ID NO: 1099);
TCATTTTTATGA (SEQ ID NO: 1100); GTTTTTTACGAC (SEQ ID NO: 1101);
TCAATTTTTTGA (SEQ ID NO: 1102); ACGTTTTTACGT (SEQ ID NO: 1103);
TCGTTTTTACGA (SEQ ID NO: 1104); TCGATTTTTACGTCGA (SEQ ID NO: 1105);
AATTTTTTAACGTT (SEQ ID NO:
[0038] 1106); TCGTTTTTTAACGA (SEQ ID NO: 1107); ACGTTTTTTAACGT (SEQ
ID NO: 1108); GATTTTTATCGTC (SEQ ID NO: 1109); GACGATTTTTCGTC (SEQ
ID NO: 1110); GATTTTAGCTCGTC (SEQ ID NO: 1111); GATTTTTACGTC (SEQ
ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113); AACGATTTTTCGTT (SEQ ID
NO: 1114); TCACTTTTGTGA (SEQ ID NO: 1115); TCGTATTTTA (SEQ ID NO:
1116); ACTTTTGTACCGGT (SEQ ID NO: 1117); TCGATTTTTCGACGTCGA (SEQ ID
NO: 1118); ACGATTTTTCGT (SEQ ID NO: 1119); GATGATCGTC (SEQ ID NO:
1120); TCGATGTCGA (SEQ ID NO: 1121); TCATGTATGA (SEQ ID NO: 1122);
GTGTTACGAC (SEQ ID NO: 1123); TCAATGTTGA (SEQ ID NO: 1124);
ACGTGTACGT (SEQ ID NO: 1125); TCGTGTACGA (SEQ ID NO: 1126);
TCGATGTACGTCGA (SEQ ID NO: 1127); AATGTTAACGTT (SEQ ID NO: 1128);
TCGTGTTAACGA (SEQ ID NO: 1129); ACGTGTTAACGT (SEQ ID NO: 1130);
GATGTATCGTC (SEQ ID NO: 1131); GACGATGTCGTC (SEQ ID NO: 1132);
GATGAGCTCGTC (SEQ ID NO: 1133); GATGTACGTC (SEQ ID NO: 1134);
ATGATCGT (SEQ ID NO: 1135); AACGATGTCGTT (SEQ ID NO: 1136);
TCACTGGTGA (SEQ ID NO: 1137); TCGTATGA (SEQ ID NO: 1138);
ACTGGTACCGGT (SEQ ID NO: 1139); TCGATGTCGACGTCGA (SEQ ID NO: 1140);
and ACGATGTCGT (SEQ ID NO: 1141).
[0039] The composition may optionally include a pharmaceutical
carrier and/or be formulated in a delivery device. In some
embodiments the delivery device is selected from the group
consisting of cationic lipids, cell permeating proteins, and
sustained release devices. In one preferred embodiment the
sustained release device is a biodegradable polymer. In another
embodiment the sustained release device is a microparticle.
[0040] In another aspect the invention is a composition of an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, and an antigen.
[0041] Another composition of the invention is an immunostimulatory
oligonucleotide having the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2,
and an anti-microbial therapeutic agent. Preferably the
anti-microbial therapeutic agent is selected from the group
consisting of an anti-viral agent, an anti-parasitic agent, an
anti-bacterial agent, or an anti-fungal agent.
[0042] A composition of a sustained release device including an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, is provided according to another
aspect of the invention.
[0043] The invention also includes nutritional supplements of an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, in a delivery device selected from
the group consisting of a capsule, a sublingual tablet, and a
pill.
[0044] In another aspect the compositions described above also
include an immunostimulatory nucleic acid having an unmethylated CG
dinucleotide, a TG dinucleotide or a Py-rich sequence wherein the
immunostimulatory nucleic acid having an unmethylated CG
dinucleotide, a TG dinucleotide or a Py-rich sequence has a
different sequence than the oligonucleotide comprising 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3'.
[0045] In some embodiments the immunostimulatory nucleic acid
having an unmethylated CG dinucleotide, a TG dinucleotide or a
Py-rich sequence has a completely phosphodiester backbone and in
other embodiments the immunostimulatory nucleic acid having an
unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich
sequence has a modified backbone, which optionally may have
internucleotide linkages selected from the group consisting of
phosphorothioate, phosphorodithioate, and p-ethoxy.
[0046] In one embodiment immunostimulatory nucleic acid having an
unmethylated CG dinucleotide has a formula comprising: 5'
X.sub.1X.sub.2CGX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3
and X.sub.4 are nucleotides. In other embodiments the
immunostimulatory nucleic acid sequence includes at least the
following formula: 5' TCNTX.sub.1X.sub.2CGX.sub.3X.sub.4 3' wherein
N is a nucleic acid sequence composed of from about 0-25
nucleotides, wherein at least one nucleotide has a modified
internucleotide linkage, and wherein the nucleic acid has less than
or equal to 100 nucleotides. According to some embodiments
X.sub.1X.sub.2 are nucleotides selected from the group consisting
of: GT, GG, GA and AA and X.sub.3X.sub.4 are nucleotides selected
from the group consisting of: TT, CT or GT. In a preferred
embodiment X.sub.1X.sub.2 are GA and X.sub.3X.sub.4 are TT.
[0047] In another embodiment the immunostimulatory nucleic acid
sequence having an unmethylated CG dinucleotide includes at least
one of the following sequences: ATCGACTCTCGAGCGTTCTC (SEQ ID No.
15); TCCATGTCGGTCCTGCTGAT (SEQ ID No. 32); TCCATGTCGGTZCTGATGCT
(SEQ ID No. 31); ATCGACTCTCGAGCGTTZTC (SEQ ID No. 18);
TCCATGTCGGTCCTGATGCT (SEQ ID No. 28); GGGGGG (SEQ ID No. 12);
TCCATGACGGTCCTGATGCT (SEQ ID No. 35); TCCATGGCGGTCCTGATGCT (SEQ ID
No. 34); TCCATGACGTTCCTGATGCT (SEQ ID No. 7); TCCATGTCGTTCCTGATGCT
(SEQ ID No. 38); GGGGTCAGTCTTGACGGGG (SEQ ID No. 41);
TCCATGTCGCTCCTGATGCT (SEQ ID No. 37); TCCATGTCGATCCTGATGCT (SEQ ID
No. 36); TCCATGCCGGTCCTGATGCT (SEQ ID No. 33); TCCATAACGTTCCTGATGCT
(SEQ ID No. 3); TCCATGACGTTCCTGATGCT (SEQ ID No. 7);
TCCATGACGTCCCTGATGCT (SEQ ID No 39); TCCATCACGTGCCTGATGCT (SEQ ID
No. 48); TCCATGACGTTCCTGACGTT (SEQ ID No. 10); ATGACGTTCCTGACGTT
(SEQ ID No. 70); TCTCCCAGCGCGCGCCAT (SEQ ID No. 72);
TCCATGTCGTTCCTGTCGTT (SEQ ID No. 73); TCCATAGCGTTCCTAGCGTT (SEQ ID
No. 74); TCCTGACGTTCCTGACGTT (SEQ ID No. 76); TCCTGTCGTTCCTGTCGTT
(SEQ ID No. 77); TCCTGTCGTTCCTTGTCGTT (SEQ ID No. 52);
TCCTTGTCGTTCCTGTCGTT (SEQ ID No 121); TCCTGTCGTTTTTTGTCGTT (SEQ ID
No. 208); TCGTCGCTGTTGTCGTTTCTT (SEQ ID No. 120);
TCCATGCGTTGCGTTGCGTT (SEQ ID No. 81); TCCACGACGTTTTCGACGTT (SEQ ID
No. 82); TCGTCGTTGTCGTTGTCGTT (SEQ ID No. 47);
TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46); TCGTCGTTGTCGTTTTGTCGTT
(SEQ ID No. 49); GCGTGCGTTGTCGTTGTCGTT (SEQ ID No. 56);
TGTCGTTTGTCGTTTGTCGTT (SEQ ID No. 48); TGTCGTTGTCGTTGTCGTTGTCGTT
(SEQ ID No. 84); TGTCGTTGTCGTTGTCGTT (SEQ ID No. 50);
TCGTCGTCGTCGTT (SEQ ID No. 51); and TGTCGTTGTCGTT (SEQ ID No. 85).
In another embodiment the immunostimulatory nucleic acid having a
Py-rich or TG sequence is a nucleic acid as described above.
[0048] In another aspect the invention relates to pharmaceutical
compositions and kits which contain both an oligonucleotide having
the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 and a CpG oligonucleotide
(which optionally may be free of poly T and TG motifs and not be
Py-rich), a Py-rich and/or TG oligonucleotide physically separate
from the oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2. The pharmaceutical preparations are
in effective amounts and typically include pharmaceutically
acceptable carriers, all as set forth in detail herein. The kits
include at least one container containing an oligonucleotide having
the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2. The same container, or
in other embodiments, a second container, may contain an
oligonucleotide with a CpG motif, which optionally may be free of
Py-rich and/or TG motifs and/or a Py-rich or TG oligonucleotide (or
some combination thereof). The kit also contains instructions for
administering the oligonucleotides to a subject. The kits also may
include a container containing a solvent or a diluent.
[0049] In summary, as if fully recited herein, an oligonucleotide
having the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 which is
physically separate from the CpG, Py-rich or TG oligonucleotide can
be used together with the CpG, Py-rich, TG oligonucleotides, in the
methods, compositions and products described herein.
[0050] In another aspect the invention relates to a pharmaceutical
composition including at least two oligonucleotides of the
invention, wherein the at least two oligonucleotides have different
sequences from one another and a pharmaceutically acceptable
carrier.
[0051] A vaccine formulation is provided according to another
aspect of the invention. The vaccine includes any of the
compositions of the invention in combination with an antigen.
[0052] According to another aspect of the invention a method of
stimulating an immune response is provided. The method involves
administering a Py-rich or a TG immunostimulatory nucleic acid to a
non-rodent subject in an amount effective to induce an immune
response in the non-rodent subject. Preferably the Py-rich or TG
immunostimulatory nucleic acid is administered orally, locally, in
a sustained release device, mucosally to a mucosal surface,
systemically, parenterally, or intramuscularly. When the Py-rich or
TG immunostimulatory nucleic acid is administered to the mucosal
surface it may be delivered in an amount effective for inducing a
mucosal immune response or a systemic immune response. In preferred
embodiments the mucosal surface is selected from the group
consisting of an oral, nasal, rectal, vaginal, and ocular
surface.
[0053] In some embodiments the method includes exposing the subject
to an antigen wherein the immune response is an antigen-specific
immune response. The antigen may be encoded by a nucleic acid
vector which can be delivered to the subject. In some embodiments
the antigen is selected from the group consisting of a tumor
antigen, a viral antigen, a bacterial antigen, a parasitic antigen
and a peptide antigen.
[0054] Py-rich and TG immunostimulatory nucleic acids are capable
of provoking a broad spectrum of immune response. For instance
these immunostimulatory nucleic acids can be used to redirect a Th2
to a Th1 immune response. Py-rich and TG nucleic acids may also be
used to activate an immune cell, such as a leukocyte, a dendritic
cell, and an NK cell. The activation can be performed in vivo, in
vitro, or ex vivo, i.e., by isolating an immune cell from the
subject, contacting the immune cell with an effective amount to
activate the immune cell of the Py-rich or TG immunostimulatory
nucleic acid and re-administering the activated immune cell to the
subject. In some embodiments the dendritic cell expresses a cancer
antigen. The dendritic cell can be exposed to the cancer antigen ex
vivo.
[0055] The immune response produced by Py-rich or TG nucleic acids
may also result in induction of cytokine production, e.g.,
production of IL-6, IL-12, IL-18 TNF, IFN-.alpha. and
IFN-.gamma..
[0056] In still another embodiment, the Py-rich and TG nucleic
acids are useful for treating cancer. The Py-rich and TG nucleic
acids are also useful according to other aspects of the invention
in preventing cancer (e.g., reducing a risk of developing cancer)
in a subject at risk of developing a cancer. The cancer may be
selected from the group consisting of biliary tract cancer, breast
cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial
cancer, gastric cancer, intraepithelial neoplasms, lymphomas, liver
cancer, lung cancer (e.g. small cell and non-small cell), melanoma,
neuroblastomas, oral cancer, ovarian cancer, pancreas cancer,
prostate cancer, rectal cancer, sarcomas, thyroid cancer, and renal
cancer, as well as other carcinomas and sarcomas. In some important
embodiments, the cancer is selected from the group consisting of
bone cancer, brain and CNS cancer, connective tissue cancer,
esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer,
oral cavity cancer, skin cancer, and testicular cancer.
[0057] Py-rich and TG nucleic acids may also be used for increasing
the responsiveness of a cancer cell to a cancer therapy (e.g., an
anti-cancer therapy), optionally when the Py-rich or TG
immunostimulatory nucleic acid is administered in conjunction with
an anti-cancer therapy. The anti-cancer therapy may be a
chemotherapy, a vaccine (e.g., an in vitro primed dendritic cell
vaccine or a cancer antigen vaccine) or an antibody based therapy.
This latter therapy may also involve administering an antibody
specific for a cell surface antigen of, for example, a cancer cell,
wherein the immune response results in antigen dependent cellular
cytotoxicity (ADCC). In one embodiment, the antibody may be
selected from the group consisting Ributaxin, Herceptin, Quadramet,
Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN,
Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103,
3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2,
MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H,
GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior
egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab,
SMART ABL 364 Ab and ImmuRAIT-CEA.
[0058] Thus, according to some aspects of the invention, a subject
having cancer or at risk of having a cancer is administered an
immunostimulatory nucleic acid and an anti-cancer therapy. In some
embodiments, the anti-cancer therapy is selected from the group
consisting of a chemotherapeutic agent, an immunotherapeutic agent
and a cancer vaccine. The chemotherapeutic agent may be selected
from the group consisting of methotrexate, vincristine, adriamycin,
cisplatin, non-sugar containing chloroethylnitrosoureas,
5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine,
taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and
poliferposan, MMI270, BAY 12-9566, RAS farnesyl transferase
inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514,
LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan,
PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone,
Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340,
AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA
2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805,
DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD
32/Valrubicin, Metastron/strontium derivative,
Temodal/Temozolomide, Evacet/liposomal doxorubicin,
Yewtaxan/Placlitaxel, Taxol/Paclitaxel, Xeload/Capecitabine,
Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid,
SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609
(754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT
(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU
enhancer, Campto/Levamisole, Camptosar/Irinotecan,
Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin,
Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU
79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal
doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine
seeds, CDK4 and CDK2 inhibitors, PARP inhibitors,
D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide,
Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD
9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane
Analog, nitrosoureas, alkylating agents such as melphelan and
cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCI, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate,
but it is not so limited.
[0059] The immunotherapeutic agent may be selected from the group
consisting of Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8,
BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03,
ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF,
Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE,
Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000,
LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS,
anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and
ImmuRAIT-CEA, but it is not so limited.
[0060] The cancer vaccine may be selected from the group consisting
of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma
vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex,
M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal
idiotypic vaccine, Melacine, peptide antigen vaccines,
toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vacine,
TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it is not so
limited.
[0061] In still another embodiment of the methods directed to
preventing or treating cancer, the subject may be further
administered interferon-.alpha..
[0062] The invention in other aspects relates to methods for
preventing disease in a subject. The method involves administering
to the subject a Py-rich or a TG immunostimulatory nucleic acid on
a regular basis to promote immune system responsiveness to prevent
disease in the subject. Examples of diseases or conditions sought
to be prevented using the prophylactic methods of the invention
include microbial infections (e.g., sexually transmitted diseases)
and anaphylactic shock from food allergies.
[0063] In other aspects, the invention is a method for inducing an
innate immune response by administering to the subject a Py-rich or
a TG immunostimulatory nucleic acid in an amount effective for
activating an innate immune response.
[0064] According to another aspect of the invention a method for
treating or preventing a viral or retroviral infection is provided.
The method involves administering to a subject having or at risk of
having a viral or retroviral infection, an effective amount for
treating or preventing the viral or retroviral infection of any of
the compositions of the invention. In some embodiments the virus is
caused by a hepatitis virus, HIV, hepatitis B, hepatitis C, herpes
virus, or papillomavirus.
[0065] A method for treating or preventing a bacterial infection is
provided according to another aspect of the invention. The method
involves administering to a subject having or at risk of having a
bacterial infection, an effective amount for treating or preventing
the bacterial infection of any of the compositions of the
invention. In one embodiment the bacterial infection is due to an
intracellular bacteria.
[0066] In another aspect the invention is a method for treating or
preventing a parasite infection by administering to a subject
having or at risk of having a parasite infection, an effective
amount for treating or preventing the parasite infection of any of
the compositions of the invention. In one embodiment the parasite
infection is due to an intracellular parasite. In another
embodiment the parasite infection is due to a non-helminthic
parasite.
[0067] In some embodiments the subject is a human and in other
embodiments the subject is a non-human vertebrate selected from the
group consisting of a dog, cat, horse, cow, pig, goat, fish,
monkey, chicken, and sheep.
[0068] In yet another aspect, the invention is a method for
treating or preventing asthma, by administering to a subject having
or at risk of having asthma, an effective amount for treating or
preventing the asthma of any of the compositions of the invention.
In one embodiment the asthma is allergic asthma.
[0069] In another aspect the invention relates to a method for
treating or preventing allergy. The method involves administering
to a subject having or at risk of having allergy, an effective
amount for treating or preventing the allergy of any of the
compositions of the invention.
[0070] A method for treating or preventing an immune deficiency is
provided according to another aspect of the invention. The method
involves administering to a subject having or at risk of an immune
deficiency, an effective amount for treating or preventing the
immune deficiency of any of the compositions of the invention.
[0071] In another aspect the invention relates to a method for
inducing a TH1 immune response by administering to a subject any of
the compositions of the invention in an effective amount to produce
a TH1 immune response.
[0072] In one embodiment the methods of the invention involve
administering an oligonucleotide of formula 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and an immunostimulatory nucleic
acid having an unmethylated CG dinucleotide a TG dinucleotide or a
T-rich sequence. In an embodiment the oligonucleotide comprising 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' is administered separately from
the immunostimulatory nucleic acid. In some embodiments the
oligonucleotide comprising 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and
the immunostimulatory nucleic acid are administered on an
alternating weekly schedule and in other embodiments the
oligonucleotide comprising 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and
the immunostimulatory nucleic acid are administered on an
alternating biweekly schedule.
[0073] The invention provides in another aspect a composition,
comprising an immunostimulatory nucleic acid and an anti-cancer
therapy, formulated in a pharmaceutically-acceptable carrier and in
an effective amount to treat a cancer or to reduce the risk of
developing a cancer. In important embodiments, the
immunostimulatory nucleic acid is selected from the group
consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich
nucleic acid.
[0074] The invention further provides a kit comprising a first
container housing an immunostimulatory nucleic acid and at least
one other container (e.g., a second container) housing a an
anti-cancer therapy, and instructions for use. In one embodiment,
the kit further comprises interferon-.alpha., which may be
separately housed in yet another container (e.g., a third
container). In an important embodiment, the kit comprises a
sustained-release vehicle containing an immunostimulatory nucleic
acid, and at least one container housing an anti-cancer therapy,
and instructions for timing of administration of the anti-cancer
therapy. The immunostimulatory nucleic acid may be selected from
the group consisting of a Py-rich nucleic acid, a TG nucleic acid
and a CpG nucleic acid, wherein the CpG nucleic acid has a
nucleotide sequence comprising SEQ ID NO: 246.
[0075] The invention further provides a method for preventing or
treating asthma or allergy, comprising administering an
immunostimulatory nucleic acid and an asthma/allergy medicament in
an effective amount to treat or prevent the asthma or allergy. In
important embodiments, the immunostimulatory nucleic acid is
selected from the group consisting of a T-rich nucleic acid, a TG
nucleic acid and a C-rich nucleic acid.
[0076] In one embodiment the immunostimulatory nucleic acid is a
T-rich nucleic acid. In a related embodiment, the T-rich nucleic
acid has a nucleotide sequence selected from the group consisting
of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301,
304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497,
503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882,
886, 905, 907, 908, and 910-913. In other embodiments the T-rich
nucleic acids are sequence selected from the group consisting of
SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244,
246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343,
344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435,
443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884,
888, 890, and 891.
[0077] In yet a further related embodiment, the T-rich nucleic acid
is not a TG nucleic acid. In yet still another embodiment, the
T-rich nucleic acid is not a CpG nucleic acid.
[0078] In one embodiment, the immunostimulatory nucleic acid is a
TG nucleic acid. In a further related embodiment, the TG nucleic
acid is not a T-rich nucleic acid. In another related embodiment,
the TG nucleic acid is not a CpG nucleic acid.
[0079] In one embodiment, the immunostimulatory nucleic acid is a
CpG nucleic acid, wherein the CpG nucleic acid has a nucleotide
sequence comprising SEQ ID NO: 246.
[0080] In another embodiment, the asthma/allergy medicament is a
medicament selected from the group consisting of PDE-4 inhibitor,
Bronchodilator/beta-2 agonist, K+ channel opener, VLA-4 antagonist,
Neurokin antagonist, TXA2 synthesis inhibitor, Xanthanine,
Arachidonic acid antagonist, 5 lipoxygenase inhibitor, Thromboxin
A2 receptor antagonist, Thromboxane A2 antagonist, Inhibitor of
5-lipox activation protein, and Protease inhibitor, but is not so
limited. In some important embodiments, the asthma/allergy
medicament is a Bronchodilator/beta-2 agonist selected from the
group consisting of salmeterol, salbutamol, terbutaline,
D2522/formoterol, fenoterol, and orciprenaline.
[0081] In another embodiment, the asthma/allergy medicament is a
medicament selected from the group consisting of Anti-histamines
and Prostaglandin inducers. In one embodiment, the anti-histamine
is selected from the group consisting of loratidine, cetirizine,
buclizine, ceterizine analogues, fexofenadine, terfenadine,
desloratadine, norastemizole, epinastine, ebastine, ebastine,
astemizole, levocabastine, azelastine, tranilast, terfenadine,
mizolastine, betatastine, CS 560, and HSR 609. In another
embodiment, the Prostaglandin inducer is S-5751.
[0082] In yet another embodiment, the asthma/allergy medicament is
selected from the group consisting of Steroids and
Immunomodulators. The immunomodulators may be selected from the
group consisting of anti-inflammatory agents, leukotriene
antagonists, IL4 muteins, Soluble IL-4 receptors,
Immunosuppressants, anti-IL-4 antibodies, IL-4 antagonists,
anti-IL-5 antibodies, soluble IL-13 receptor-Fc fusion proteins,
anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4
inhibitors, and Downregulators of IgE, but are not so limited. In
one embodiment, the downregulator of IgE is an anti-IgE.
[0083] In another embodiment, the Steroid is selected from the
group consisting of beclomethasone, fluticasone, tramcinolone,
budesonide, and budesonide. In still a further embodiment, the
Immunosuppressant is a Tolerizing peptide vaccine.
[0084] In one embodiment, the immunostimulatory nucleic acid is
administered concurrently with the asthma/allergy medicament. In
another embodiment, the subject is an immunocompromised subject
[0085] The immunostimulatory nucleic acids to be administered to a
subject in the methods disclosed herein relating to the prevention
and treatment of asthma/allergy are as described for other method
aspects of the invention.
[0086] In another aspect, the invention provides a kit comprising a
first container housing an immunostimulatory nucleic acid, and at
least another container (e.g., a second container) housing an
asthma/allergy medicament, and instructions for use. The
immunostimulatory nucleic acid useful in the kit is as described
herein. In important embodiments, the immunostimulatory nucleic
acid is selected from the group consisting of a T-rich nucleic
acid, a TG nucleic acid and a C-rich nucleic acid. In another
important embodiment, the kit comprises a sustained-release vehicle
containing an immunostimulatory nucleic acid, and at least one
container housing an asthma/allergy medicament, and instructions
for timing of administration of the asthma/allergy medicament. The
asthma/allergy medicament may be selected from the group of
asthma/allergy medicaments described in the foregoing methods
directed towards the prevention or treatment of asthma/allergy.
[0087] In yet another aspect, the invention provides a composition,
comprising an immunostimulatory nucleic acid and an asthma/allergy
medicament, formulated in a pharmaceutically-acceptable carrier and
in an effective amount for preventing or treating an immune
response associated with exposure to a mediator of asthma or
allergy. The immunostimulatory nucleic acid may be selected from
the group of immunostimulatory nucleic acids described for the
foregoing methods and compositions. In important embodiments, the
immunostimulatory nucleic acid is selected from the group
consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich
nucleic acid. The asthma/allergy medicament may be selected from
the group consisting of asthma medicaments and allergy medicaments
as described in the foregoing methods and compositions.
[0088] In still a further aspect, the invention provides a
composition comprising an immunostimulatory nucleic acid selected
from the group consisting of SEQ ID NO: 95-136, SEQ ID NO: 138-152,
SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID
NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO:
414-420, SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: 959-1022,
SEQ ID NO: 1024-1093, and a pharmaceutically acceptable carrier.
Preferably the immunostimulatory nucleic acid is present in the
composition in an effective amount. In one embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
induce an immune response. In another embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
prevent or treat cancer. In yet a further embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
prevent or treat asthma/allergy. The invention also provides kits
comprising any of the foregoing immunostimulatory nucleic acid
compositions, and instructions for use.
[0089] In another aspect the invention includes a composition of an
immunostimulatory nucleic acid consisting essentially of: 5'
M.sub.1TCGTCGTTM.sub.2 3' wherein at least one of the Cs is
unmethylated, wherein M.sub.1 is a nucleic acid having at least one
nucleotide, wherein M.sub.2 is a nucleic acid having between 0 and
50 nucleotides, and wherein the immunostimulatory nucleic acid has
less than 100 nucleotides.
[0090] In yet other aspects the invention relates to a
pharmaceutical composition of an immunostimulatory nucleic acid
comprising: 5' TCGTCGTT 3' wherein at least one of the Cs is
unmethylated, wherein the immunostimulatory nucleic acid has less
than 10 nucleotides and a phosphodiester backbone, and a sustained
release device. In some embodiments the sustained release device is
a microparticle. In other embodiments the composition includes an
antigen.
[0091] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0092] FIG. 1A is a histogram of the expression of CD86 (Y-axis) by
CD19+ cells following exposure of these cells to the
oligonucleotides shown on the X-axis at a concentration of 0.15
.mu.g/ml.
[0093] FIG. 1B is a table with the data from FIG. 1A.
[0094] FIG. 1C is a histogram of the expression of CD86 (Y-axis) by
CD19+ cells following exposure of these cells to the
oligonucleotides shown on the X-axis at a concentration of 0.30
.mu.g/ml.
[0095] FIG. 1D is a table with the data from FIG. 1C.
[0096] FIG. 2 is a graph comparing the abilities of ODN 2137, ODN
2177, ODN 2200 and ODN 2202 to stimulate B cell proliferation at
concentrations ranging from 0.2 .mu.g/ml to 20 .mu.g/ml.
[0097] FIG. 3 is a graph comparing the abilities of ODN 2188, ODN
2189, ODN 2190 and ODN 2182 to stimulate B cell proliferation at
concentrations ranging from 0.2 .mu.g/ml to 20 .mu.g/ml.
[0098] FIG. 4 is a bar graph depicting dose-dependent B cell
activation induced by non-CpG ODN. PBMC of a blood donor were
incubated with the indicated concentrations of ODNs 2006 (SEQ ID
NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 5126
(SEQ ID NO.: 1058) and 5162 (SEQ ID NO.: 1094) and stained with mAb
for CD19 (B cell marker) and CD86 (B cell activation marker, B7-2).
Expression was measured by flow cytometry.
[0099] FIG. 5 is a bar graph depicting stimulation of B cells by a
diverse set of non-CpG ODNs. PBMC of one representative donor were
stimulated by 0.4 .mu.g/ml, 1.0 g/ml or 10.0 .mu.g/ml of the
following ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913),
2194 (SEQ ID NO.: 911), 5162 (SEQ ID NO.: 1094), 5163 (SEQ ID NO.:
1095), 5168 (SEQ ID NO.: 1096) and 5169 (SEQ ID NO.: 1097) and
expression of the activation marker CD86 (B7-2) on CD19-positive B
cells was measured by flow cytometry.
[0100] FIG. 6 is a bar graph depicting B cell activation by non-CpG
ODNs 1982 and 2041. PBMC were incubated with the indicated
concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.:
225) and 2041 (SEQ ID NO.: 282) and B cell activation (expression
of the activation marker CD86) was measured by flow cytometry.
[0101] FIG. 7 is a bar graph depicting NK cells are activated by
non-CpG ODNs. PBMC were incubated with 6 .mu.g/ml of the following
ODNs: 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID
NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126
(SEQ ID NO.: 1058) and stained with mAb for CD3 (T cell marker),
CD56 (NK cell marker) and CD69 (early activation marker).
Expression of CD69 on CD56-positive NK cells was measured by flow
cytometry.
[0102] FIG. 8 is a bar graph depicting NK-mediated cytotoxicity is
enhanced by non-CpG ODN. NK-mediated lysis of K-562 target cells
was measured after over night incubation of PBMC with 6 .mu.g/ml of
the ODN 2006 (SEQ ID NO.: 246), 2194 (SEQ ID NO.: 911) and 5126
(SEQ ID NO.: 1058).
[0103] FIG. 9 is a bar graph depicting NKT cells can be activated
by non-CpG ODN. PBMC of one representative donor were incubated
with 6 .mu.g/ml ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358),
2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.:
911) and 5126. (SEQ ID NO.: 1058) for 24 h and activation of NKT
cells was measured by flow cytometry after staining of cells with
mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early
activation marker).
[0104] FIG. 10 is a bar graph depicting stimulation of monocytes by
different CpG and non-CpG ODN. PBMC were incubated with 6 .mu.g/ml
2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.:
886), 2178 (SEQ ID NO.: 428), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID
NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) and
stained for CD14 (monocyte marker) and CD80 (B7-1, activation
marker). Expression was measured by flow cytometry.
[0105] FIG. 11 is a bar graph depicting release of TNF.alpha. upon
culture of human cells with non-CpG ODN. PBMC were cultured for 24
h with or without 6 .mu.g/ml of the indicated ODNs or 1 .mu.g/ml
LPS as positive control and TNF.alpha. measured by ELISA.
[0106] FIG. 12 is a bar graph depicting release of IL-6 after
culture with non-CpG ODNs shows the same pattern as for TNF.alpha..
PBMC were cultured with the indicated ODNs (1.0 .mu.g/ml) and IL-6
was measured in the supernatants by ELISA.
DETAILED DESCRIPTION
[0107] The invention in one aspect involves the finding that
pyrimidine (Py) rich and preferably thymidine (T) rich nucleic
acids as well as nucleic acids that contain TG dinucleotide motifs
are effective in mediating immune stimulatory effects. It was known
in the prior art that CpG containing nucleic acids are therapeutic
and prophylactic compositions that stimulate the immune system to
treat cancer, infectious diseases, allergy, asthma and other
disorders and to help protect against opportunistic infections
following cancer chemotherapies. The strong yet balanced, cellular
and humoral immune responses that result from CpG stimulation
reflect the body's own natural defense system against invading
pathogens and cancerous cells. CpG sequences, while relatively rare
in human DNA are commonly found in the DNA of infectious organisms
such as bacteria. The human immune system has apparently evolved to
recognize CpG sequences as an early warning sign of infection, and
to initiate an immediate and powerful immune response against
invading pathogens without causing adverse reactions frequently
seen with other immune stimulatory agents. Thus CpG containing
nucleic acids, relying on this innate immune defense mechanism, can
utilize a unique and natural pathway for immune therapy. The
effects of CpG nucleic acids on immune modulation were discovered
by the inventor of the instant patent application and have been
described extensively in co-pending patent applications, such as
U.S. patent application Ser. No. 08/386,063 filed on Feb. 7, 1995
(and related PCT US95/01570); Ser. No. 08/738,652 filed on Oct. 30,
1996; Ser. No. 08/960,774 filed on Oct. 30, 1997 (and related
PCT/US97/19791, WO 98/18810); 09/191,170 filed on Nov. 13, 1998;
Ser. No. 09/030,701 filed on Feb. 25, 1998 (and related
PCT/US98/03678; Ser. No. 09/082,649 filed on May 20, 1998 (and
related PCT/US98/10408); 09/325,193 filed on Jun. 3, 1999 (and
related PCT/US98/04703); 09/286,098 filed on Apr. 2, 1999 (and
related PCT/US99/07335); Ser. No. 09/306,281 filed on May 6, 1999
(and related PCT/US99/09863). The entire contents of each of these
patents and patent applications is hereby incorporated by
reference.
[0108] The findings of the instant invention are applicable to all
of the above described uses of CpG containing nucleic acids as well
as any other known use for CpG nucleic acids. The invention
involves, in one aspect, the discovery that Py-rich and preferably
T-rich and TG nucleic acids have similar immune stimulatory
properties to CpG oligonucleotides regardless of whether a CpG
motif is present. Thus the invention is useful for any method for
stimulating the immune system using Py-rich or TG nucleic acids. It
was also discovered surprisingly according to the invention that
chimeric oligonucleotides which lack a CpG motif are immune
stimulatory and have many of the same prophylactic and therapeutic
activities as a CpG oligonucleotide.
[0109] A Py-rich nucleic acid is a T-rich or C-rich
immunostimulatory nucleic acid. In some embodiments T-rich nucleic
acids are preferred. A T-rich nucleic acid is a nucleic acid which
includes at least one poly T sequence and/or which has a nucleotide
composition of greater than 25% T nucleotide residues. A nucleic
acid having a poly-T sequence includes at least four Ts in a row,
such as 5'TTTT3'. Preferably the T-rich nucleic acid includes more
than one poly T sequence. In preferred embodiments the T-rich
nucleic acid may have 2, 3, 4, etc poly T sequences, such as
oligonucleotide #2006. (SEQ ID NO:246). One of the most highly
immunostimulatory T-rich oligonucleotides discovered according to
the invention is a nucleic acid composed entirely of T nucleotide
residues, e.g., oligonucleotide #2183 (SEQ ID NO:433). Other T-rich
nucleic acids according to the invention have a nucleotide
composition of greater than 25% T nucleotide residues, but do not
necessarily include a poly T sequence. In these T-rich nucleic
acids the T nucleotide resides may be separated from one another by
other types of nucleotide residues, i.e., G, C, and A. In some
embodiments the T-rich nucleic acids have a nucleotide composition
of greater than 35%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T
nucleotide residues and every integer % in between. Preferably the
T-rich nucleic acids have at least one poly T sequence and a
nucleotide composition of greater than 25% T nucleotide
residues.
[0110] It was discovered according to the invention that the T
content of an ODN has a dramatic effect on the immune stimulatory
effect of the ODN and that T-rich ODN can activate multiple human
immune cell types in the absence of any CpG motifs. An
oligonucleotide having a 3' poly-T region and 2 5'CGs e.g., ODN
2181 (SEQ ID NO:431) is highly immune stimulatory. An
oligonucleotide of similar length, ODN 2116 (SEQ ID NO:357) which
contains two CG dinucleotides at the 5' end and a poly-C region at
the 3' end was also immune stimulatory but to a lesser extent than
the T-rich oligonucleotide using standard experimental conditions.
Thus, although C and T have almost identical structures, their
effects on the immune properties of an ODN are varied. They both
are capable of inducing an immune response but to different
extents. Thus both T-rich and C-rich oligonucleotides are useful
according to the invention, but T-rich oligonucleotides are
preferred. Furthermore, if the T content of the ODN is reduced by
incorporating other bases such as G, A, or C, then the immune
stimulatory effects are reduced (ODN #2188 (SEQ ID NO:905), 2190
(SEQ ID NO:907), 2191 (SEQ ID NO:908), and 2193 (SEQ ID
NO:910)).
[0111] A C-rich nucleic acid is a nucleic acid molecule having at
least one or preferably at least two poly-C regions or which is
composed of at least 50% C nucleotides. A poly-C region is at least
four C residues in a row. Thus a poly-C region is encompassed by
the formula 5'CCCC 3'. In some embodiments it is preferred that the
poly-C region have the formula 5'CCCCCC 3'. Other C-rich nucleic
acids according to the invention have a nucleotide composition of
greater than 50% C nucleotide residues, but do not necessarily
include a poly C sequence. In these C-rich nucleic acids the C
nucleotide residues may be separated from one another by other
types of nucleotide residues, i.e., G, T, and A. In some
embodiments the C-rich nucleic acids have a nucleotide composition
of greater than 60%, 70%, 80%, 90%, and 99%, C nucleotide residues
and every integer % in between. Preferably the C-rich nucleic acids
have at least one poly C sequence and a nucleotide composition of
greater than 50% C nucleotide residues, and in some embodiments are
also T-rich.
[0112] As shown in the Examples, several ODN previously believed to
be non-immunostimulatory, including two ODNs SEQ ID NO.: 225 and
SEQ ID NO.: 282 previously described to be non-stimulatory and
mainly used as control ODNs (Takahashi, T., M. Nieda, Y. Koezuka,
A. Nicol, S. A. Porcelli, Y. Ishikawa, K. Tadokoro, H. Hirai, and
T. Juji. 2000. Analysis of human VA24+ CD4+ NKT cells activated by
a-glycosylceramide-pulsed monocyte-derived dendritic cells. J.
Immunol. 164:4458) were found to be immunostimulatory. Our
experiments, demonstrated that these ODNs can stimulate B cells,
although at higher concentrations compared to CpG ODNs (FIG. 6). A
long Poly T ODN (30mer) induced, at least in some experiments,
comparable strong activation of B cells to one of the strongest CpG
ODN activators of B cells. These experiments also revealed the
surprising finding that even Poly C ODNs can lead to stimulation of
B cells.
[0113] Immunostimulation by these ODNs, however, was not limited to
human B cells. Different experimental assays clearly demonstrated
in addition that monocytes, NK cells and even NKT cells can be
activated by such non-CpG ODNs (FIG. 7-10). In contrast to Poly T
and Poly C sequences, immunostimulation by Poly A sequences (at
least for monocytes, B and NK cells) was not achieved.
Interestingly it was found that the introduction of a CpG motif
into SEQ ID NO.: 225 enhanced the immunostimulatory activity
whereas the elongation with a Poly T stretch did not enhance
immunostimulation. This suggests that CpG and T-rich ODN may
operate through different mechanisms or pathways. It is also
possible that insertion of a poly-T motif into a different position
of SEQ ID NO.: 225 may result in a change in immunostimulatory
properties.
[0114] A "TG nucleic acid" or a "TG immunostimulatory nucleic acid"
as used herein is a nucleic acid containing at least one TpG
dinucleotide (thymidine-guanine dinucleotide sequence, i.e. "TG
DNA" or DNA containing a 5' thymidine followed by 3' guanosine and
linked by a phosphate bond) and activates a component of the immune
system.
[0115] In one embodiment the invention provides a TG nucleic acid
represented by at least the formula:
5'N.sub.1X.sub.1TGX.sub.2N.sub.23'
[0116] wherein X.sub.1 and X.sub.2 are nucleotides and N is any
nucleotide and N.sub.1 and N.sub.2 are nucleic acid sequences
composed of any number of N provided that the sum total of N.sub.1
and N.sub.2 is in the range of 11 to 21. As an example, if N.sub.1
is 5, then N.sub.2 may be 6 (leading to a total length for the
oligonucleotide of 15 nucleotides). The TG may be located anywhere
within the oligonucleotide stretch, including the 5' end, the
center and the 3' end. Thus, N.sub.1 may be zero through to 21,
inclusive, provided that N.sub.2 is appropriately chosen to give a
sum of N.sub.2 and N.sub.1 equal to 111 through to 21, inclusive.
Similarly, N.sub.2 may be zero through to 21, inclusive, provided
that the sum total of N.sub.1 and N.sub.2 equals 11 to 21,
inclusive. In some embodiments X.sub.1 is adenine, guanine, or
thymidine and X.sub.2 is cytosine, adenine, or thymidine. In one
preferred embodiment, X.sub.2 is thymidine. In other embodiments
X.sub.1 is cytosine and/or X.sub.2 is guanine. In other
embodiments, as discussed herein, the nucleic acid may encompass
other motifs, provided it is long enough to do so.
[0117] In other embodiments the TG nucleic acid is represented by
at least the formula:
5'N.sub.1X.sub.1X.sub.2TGX.sub.3X.sub.4N.sub.23'
[0118] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In some embodiments, X.sub.1X.sub.2 are nucleotides
selected from the group consisting of: GpT, GpG, GpA, ApA, ApT,
ApG, CpT, CpA, TpA and TpT; and X.sub.3X.sub.4 are nucleotides
selected from the group consisting of: TpT, CpT, ApT, ApG, TpC,
ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N.sub.1 and
N.sub.2 are nucleic acid sequences composed of any number of
nucleotides provide that the sum total of N.sub.1 and N.sub.2 is in
the range of 9 to 19. In some embodiments, X.sub.1X.sub.2 are GpA
or GpT and X.sub.3X.sub.4 are TpT. In other embodiments X.sub.1 or
X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are
pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or
both are pyrimidines. In one preferred embodiment, X.sub.3X.sub.4
are nucleotides selected from the group consisting of: TpT, TpC and
TpA.
[0119] The immunostimulatory nucleic acid may be any size (i.e.,
length) provided it is at least 4 nucleotides. In important
embodiments, the immunostimulatory nucleic acids have a length in
the range of between 6 and 100. In still other embodiments, the
length is in the range of between 8 and 35 nucleotides. Preferably,
the TG oligonucleotides range in size from 15 to 25
nucleotides.
[0120] The size (i.e., the number of nucleotide residues along the
length of the nucleic acid) of the immunostimulatory nucleic acid
may also contribute to the stimulatory activity of the nucleic
acid. It has been discovered, surprisingly that even for highly
immune stimulating immunostimulatory nucleic acids, the length of
the nucleic acid influences the extent of immunostimulation that
can be achieved. It has been demonstrated that increasing the
length of a T-rich nucleic acid up to 24 nucleotides causes
increased immune stimulation. The experiments presented in the
examples demonstrate that when the length of the T-rich nucleic
acid is increased from 18 to 27 nucleotides the ability of the
nucleic acid to stimulate an immune response is increased
significantly (compare ODN #2194, 2183, 2195, and 2196 decreasing
in size from 27-18 nucleotides). Increasing the length of the
nucleic acid up to 30 nucleotides had a dramatic impact on the
biological properties of the nucleic acid but increasing the length
beyond 30 nucleotides did not appear to further influence the
immune stimulatory effect (e.g., compare ODN 2179 to 2006).
[0121] It has been shown that TG nucleic acids ranging in length
from 15 to 25 nucleotides in length may exhibit an increased immune
stimulation. Thus, in one aspect, the invention provides an
oligonucleotide that is 15-27 nucleotides in length (i.e., an
oligonucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26 or 27 nucleotides in length) that may be a T-rich nucleic acid
or may be a TG nucleic acid, or may be both a T-rich and a TG
nucleic acid. In one embodiment, the oligonucleotide is not a
T-rich nucleic acid nor is it a TG nucleic acid. In other
embodiments, the oligonucleotide does not have a CG motif. The
invention similarly provides oligonucleotides that are 15-27
nucleotides in length, oligonucleotides that are 18-25 nucleotides
in length, oligonucleotides that are 20-23 nucleotides in length,
and oligonucleotides that are 23-25 nucleotides in length. Any of
the foregoing embodiments relating to oligonucleotides 15-27 in
length also relate to the oligonucleotides of these differing
lengths. The invention further embraces the use of any of these
foregoing oligonucleotides in the methods recited herein.
[0122] Although a maximal level of immune stimulation is achieved
with some T-rich nucleic acids when the nucleic acid is 24-30
nucleotide residues in length, as well as with some TG nucleic
acids that range from 15 to 25 nucleotides in length, shorter or
longer immunostimulatory nucleic acids can also be used according
to the methods of the invention. For facilitating uptake into cells
immunostimulatory nucleic acids preferably have a minimum length of
6 nucleotide residues. Nucleic acids of any size greater than 6
nucleotides (even many kb long) are capable of inducing an immune
response according to the invention if sufficient immunostimulatory
motifs are present, since larger nucleic acids are degraded inside
of cells. Preferably the immunostimulatory nucleic acids are in the
range of between 8 and 100 and in some embodiments T-rich
containing immunostimulatory nucleic acids are between 24 and 40
nucleotides in length and TG containing immunostimulatory nucleic
acids are between 15 and 25 nucleotides in length.
[0123] In one embodiment the T-rich nucleic acid is represented by
at least the formula: 5'X.sub.1X.sub.2TTTTX.sub.3X.sub.43'
[0124] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In one embodiment X.sub.1X.sub.2 is TT and/or
X.sub.3X.sub.4 is TT. In another embodiment X.sub.1X.sub.2 are any
one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT,
CC, CA, GT, GG, GA, and GC; and X.sub.3X.sub.4 are any one of the
following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT,
GG, GA, and GC.
[0125] In some embodiments it is preferred that the
immunostimulatory nucleic acids do not contain poly-C(CCCC), or
poly-A (AAAA). In other embodiments it is preferred that the
immunostimulatory nucleic acid include poly-C, poly-A, poly-G
(GGGG) or multiple GGs. In particular poly-G or multiple GG motifs
have dramatic effects on some immunostimulatory nucleic acids. The
effect of these non-T sequences depends in part on the status of
the nucleic acid backbone. For instance, if the nucleic acid has a
phosphodiester backbone or a chimeric backbone the inclusion of
these sequences in the nucleic acid will only have minimal if any
effect on the biological activity of the nucleic acid. If the
backbone is completely phosphorothioate (or other phosphate
modification) or significantly phosphorothioate then the inclusion
of these sequences may have more influence on the biological
activity or the kinetics of the biological activity, causing a
decrease in potency of the T-rich and TG immunostimulatory nucleic
acids.
[0126] Although C-rich nucleic acids have been demonstrated to have
immune stimulating properties, insertion of Poly-C sequences into a
T-rich nucleic acid in a manner that would reduce the relative
proportion of T nucleotides in the nucleic acid can have a negative
impact on the nucleic acid. Although applicants are not bound by a
proposed mechanism, it is believed that the immune system has
developed a mechanism for distinguishing nucleic acids having
different nucleotide properties, possibly resulting from different
sets of binding proteins which recognize different sequences or
specific binding proteins which recognize all the immunostimulatory
sequences but with different affinities. In general nucleic acids
including unmethylated CpG motifs are the most immunostimulatory,
followed by T-rich nucleic acids, TG nucleic acids and C-rich
nucleic acids. This generalization, however, has many exceptions.
For instance a strong T-rich nucleic acid like SEQ ID NO.: 886 is
more immune stimulatory in some assays than some CpG containing
nucleic acids (e.g., a phosphorothioate CpG nucleic acid containing
a single CpG motif).
[0127] It has also been discovered that the addition of a poly-A
tail to an immunostimulatory nucleic acid can enhance the activity
of the nucleic acid. It was discovered that when a highly immune
stimulatory CpG nucleic acid (SEQ ID NO.: 246) was modified with
the addition of a poly-A tail (AAAAAA) or a poly-T tail (TTTTTT),
the resultant oligonucleotides increased in immune stimulatory
activity. The ability of the poly-A tail and the poly-T tail to
increase the immunostimulating properties of the oligonucleotide
was very similar. SEQ ID NO.: 246 is a T-rich oligonucleotide. It
is likely that if poly-A and poly-T tails are added to a nucleic
acid which is not T-rich, it would have a bigger impact on the
immune stimulating capability of the nucleic acid. Since the poly-T
tail was added to a nucleic acid that was already highly T-rich the
immune stimulating properties of the poly-T addition was diluted
somewhat, although not completely. This finding has important
implications for the use of poly-A regions. Thus in some
embodiments the immunostimulatory nucleic acids include a poly-A
region and in other embodiments they do not.
[0128] Some of the immunostimulatory nucleic acids of the invention
include one or more CG motifs. The presence of CG motifs in the
immunostimulatory nucleic acids also has an influence on the
biological activity of the nucleic acids. If the total length of an
immunostimulatory nucleic acid is 20 nucleotide residues or less,
then CpG motifs are important in determining the immune effect of
the nucleic acid, and methylation of these motifs reduces the
potency of the immune stimulatory effects of the nucleic acid. If
the length of the immunostimulatory nucleic acid is increased to
24, then the immune stimulatory effects of the nucleic acid become
less dependent on the CpG motifs, and are no longer abolished by
methylation of the CpG motifs or by their inversion to GC
dinucleotides, provided the other immune-stimulatory properties
described herein are present.
[0129] For example, ODN 2006 (SEQ ID NO:246) is a highly immune
stimulatory T-rich nucleic acid of 24 nucleotide residues in length
with four CpG dinucleotides. However, ODN 2117 (SEQ ID NO:358), in
which the CpG motifs are methylated is also highly immune
stimulatory. ODN 2137 (SEQ ID NO:886), in which the CpG motifs of
ODN 2006 are inverted to GpC, and which as a result possesses six
TG dinucleotides is also immune stimulatory. The immune stimulatory
effects of nucleic acids such as ODN 2117 and 2137 are regulated by
their T and TG content. Each of these three nucleic acids is T-rich
and ODN 2137 is additionally TG rich. If their T content is reduced
by inserting other bases such as A (ODN 2117 (SEQ ID NO:358)) or if
their TG content is reduced by substituting TG with AG, then the
immune stimulatory effects are somewhat reduced. In another
example, a nucleic acid 24 nucleotides in length in which all of
the positions are randomized has only a modest immune stimulatory
effect (ODN 2182 (SEQ ID NO:432)). Likewise, a nucleic acid 24
nucleotides in length with other nucleotide compositions have
variable immune stimulatory effects, depending on their T content
(ODN 2188 (SEQ ID NO:905), 2189 (SEQ ID NO:906), 2190 (SEQ ID
NO:907), 2191 (SEQ ID NO:908), 2193 (SEQ ID NO:910), 2183 (SEQ ID
NO:433), and 2178 (SEQ ID NO:428)). ODN 2190 which contains TGT
motifs is more immune stimulatory than ODN 2202 which possesses TGG
motifs. Thus, in some embodiments, TGT motifs are preferred. In
still other embodiments, the number of TG motifs is important in
that an increase in the number of TG motifs leads to an increase in
immune stimulation. Some preferred TG nucleic acids contain at
least three TG motifs.
[0130] Examples of CpG nucleic acids include but are not limited to
those listed in Table A, such as SEQ ID NO: 1, 3, 4, 14-16, 18-24,
28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91,
93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150,
152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220,
223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281,
286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317,
320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369,
373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426,
429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456,
460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492,
493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555,
564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617,
619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709,
711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763,
766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808,
810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865,
872, 874-877, 879-8.81, 883-885, 888-904, and 909-913.
[0131] In some embodiments of the invention the immunostimulatory
nucleic acids include CpG dinucleotides and in other embodiments
the immunostimulatory nucleic acids are free of CpG dinucleotides.
The CpG dinucleotides may be methylated or unmethylated. A nucleic
acid containing at least one unmethylated CpG dinucleotide is a
nucleic acid molecule which contains an unmethylated
cytosine-guanine dinucleotide sequence (i.e. "CpG DNA" or DNA
containing an unmethylated 5' cytosine followed by 3' guanosine and
linked by a phosphate bond) and activates the immune system. A
nucleic acid containing at least one methylated CpG dinucleotide is
a nucleic acid which contains a methylated cytosine-guanine
dinucleotide sequence (i.e., a methylated 5' cytosine followed by a
3' guanosine and linked by a phosphate bond).
[0132] Examples of T rich nucleic acids that are free of CpG
nucleic acids include but are not limited to those listed in Table
A, such as SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269,
282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486,
491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867,
868, 882, 886, 905, 907, 908, and 910-913. Examples of T rich
nucleic acids that include CpG nucleic acids include but are not
limited to those listed in Table A, such as SEQ ID NO: 64, 98, 112,
146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263,
265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374,
376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501,
518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[0133] The immunostimulatory nucleic acids can be double-stranded
or single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity. Thus in some aspects of the invention it is
preferred that the nucleic acid be single stranded and in other
aspects it is preferred that the nucleic acid be double
stranded.
[0134] The term T-rich nucleic acid and TG nucleic acid, as used
herein, refers to an immunostimulatory T-rich nucleic acid and an
immunostimulatory TG nucleic acid, respectively, unless otherwise
indicated. The T-rich nucleic acid sequences of the invention are
those broadly described above as well as the nucleic acids shown in
Table A that have at least one poly T motif and/or have a
composition of greater than 25% T or preferably 35% nucleotide
residues. The C-rich nucleic acids are those having at least one
and preferably at least two poly-C regions. The TG nucleic acids of
the invention are those broadly described above as well as the
specific nucleic acids shown in Table A that have at least one TG
motif.
[0135] The nucleic acids of the invention may, but need not, also
include a poly G motif. Poly G containing nucleic acids are also
immunostimulatory. A variety of references, including Pisetsky and
Reich, 1993 Mol. Biol. Reports, 18:217-221; Krieger and Herz, 1994,
Ann. Rev. Biochem., 63:601-637; Macaya et al., 1993, PNAS,
90:3745-3749; Wyatt et al., 1994, PNAS, 91:1356-1360; Rando and
Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed.
Krieg and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem.
116, 991-994 also describe the immunostimulatory properties of poly
G nucleic acids.
[0136] Poly G nucleic acids preferably are nucleic acids having the
following formulas: 5' X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein
X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In
preferred embodiments at least one of X.sub.3 and X.sub.4 are a G.
In other embodiments both of X.sub.3 and X.sub.4 are a G. In yet
other embodiments the preferred formula is 5' GGGNGGG 3', or 5'
GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
In other embodiments the poly G nucleic acid is free of
unmethylated CG dinucleotides, such as, for example, the nucleic
acids listed below as SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282,
288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768,
795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments
the poly G nucleic acid includes at least one unmethylated CG
dinucleotide, such as, for example, the nucleic acids listed above
as SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214,
224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527,
535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857,
876, 892, 909, 926, 927, 932, and 937.
[0137] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymidine (T)
or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acid molecules can
be obtained from existing nucleic acid sources (e.g., genomic or
cDNA), but are preferably synthetic (e.g. produced by nucleic acid
synthesis).
[0138] The terms nucleic acid and oligonucleotide also encompass
nucleic acids or oligonucleotides with substitutions or
modifications, such as in the bases and/or sugars. For example,
they include nucleic acids having backbone sugars which are
covalently attached to low molecular weight organic groups other
than a hydroxyl group at the 3' position and other than a phosphate
group at the 5' position. Thus modified nucleic acids may include a
2'-O-alkylated ribose group. In addition, modified nucleic acids
may include sugars such as arabinose instead of ribose. Thus the
nucleic acids may be heterogeneous in backbone composition thereby
containing any possible combination of polymer units linked
together such as peptide-nucleic acids (which have amino acid
backbone with nucleic acid bases). In some embodiments, the nucleic
acids are homogeneous in backbone composition. Nucleic acids also
include substituted purines and pyrimidines such as C-5 propyne
modified bases (Wagner et al., Nature Biotechnology 14:840-844,
1996). Purines and pyrimidines include but are not limited to
adenine, cytosine, guanine, thymidine, 5-methylcytosine,
2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine,
hypoxanthine, and other naturally and non-naturally occurring
nucleobases, substituted and unsubstituted aromatic moieties. Other
such modifications are well known to those of skill in the art.
[0139] For use in the instant invention, the nucleic acids of the
invention can be synthesized de novo using any of a number of
procedures well known in the art. For example, the b-cyanoethyl
phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., Tet.
Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et
al., Tet. Let. 27:4051-4054, 1986; Froehler et al., Nucl. Acid.
Res. 14:5399-5407, 1986, Garegg et al., Tet. Let. 27:4055-4058,
1986, Gaffney et al., Tet. Let. 29:2619-2622, 1988). These
chemistries can be performed by a variety of automated nucleic acid
synthesizers available in the market. These nucleic acids are
referred to as synthetic nucleic acids. Alternatively, T-rich
and/or TG dinucleotides can be produced on a large scale in
plasmids, (see Sambrook, T., et al., "Molecular Cloning: A
Laboratory Manual", Cold Spring Harbor laboratory Press, New York,
1989) and separated into smaller pieces or administered whole.
Nucleic acids can be prepared from existing nucleic acid sequences
(e.g., genomic or cDNA) using known techniques, such as those
employing restriction enzymes, exonucleases or endonucleases.
Nucleic acids prepared in this manner are referred to as isolated
nucleic acid. An isolated nucleic acid generally refers to a
nucleic acid which is separated from components which it is
normally associated with in nature. As an example, an isolated
nucleic acid may be one which is separated from a cell, from a
nucleus, from mitochondria or from chromatin. The terms Py-rich
nucleic acids and TG nucleic acids encompasses both synthetic and
isolated Py-rich nucleic acids and TG nucleic acids.
[0140] For use in vivo, the Py-rich and TG nucleic acids may
optionally be relatively resistant to degradation (e.g., are
stabilized). A "stabilized nucleic acid molecule" shall mean a
nucleic acid molecule that is relatively resistant to in vivo
degradation (e.g. via an exo- or endo-nuclease). Stabilization can
be a function of length or secondary structure. Nucleic acids that
are tens to hundreds of kbs long are relatively resistant to in
vivo degradation. For shorter nucleic acids, secondary structure
can stabilize and increase their effect. For example, if the 3' end
of an nucleic acid has self-complementarity to an upstream region,
so that it can fold back and form a sort of stem loop structure,
then the nucleic acid becomes stabilized and therefore exhibits
more activity.
[0141] Alternatively, nucleic acid stabilization can be
accomplished via phosphate backbone modifications. Preferred
stabilized nucleic acids of the instant invention have a modified
backbone. It has been demonstrated that modification of the nucleic
acid backbone provides enhanced activity of the Py-rich and TG
nucleic acids when administered in vivo. These stabilized
structures are preferred because the Py-rich and TG molecules of
the invention have at least a partial modified backbone. Py-rich
and TG constructs having phosphorothioate linkages provide maximal
activity and protect the nucleic acid from degradation by
intracellular exo- and endo-nucleases. Other modified nucleic acids
include phosphodiester modified nucleic acids, combinations of
phosphodiester and phosphorothioate nucleic acid,
methylphosphonate, methylphosphorothioate, phosphorodithioate,
p-ethoxy, and combinations thereof. Each of these combinations and
their particular effects on immune cells is discussed in more
detail with respect to CpG nucleic acids in PCT Published Patent
Applications PCT/US95/01570 (WO 96/02555) and PCT/US97/19791 (WO
98/18810) claiming priority to U.S. Ser. Nos. 08/386,063 and
08/960,774, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively,
the entire contents of which are hereby incorporated by reference.
It is believed that these modified nucleic acids may show more
stimulatory activity due to enhanced nuclease resistance, increased
cellular uptake, increased protein binding, and/or altered
intracellular localization.
[0142] The compositions of the invention may optionally be chimeric
oligonucleotides. The chimeric oligonucleotides are
oligonucleotides having a formula: 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2
3'. Y.sub.1 and Y.sub.2 are nucleic acid molecules having between 1
and 10 nucleotides. Y.sub.1 and Y.sub.2 each include at least one
modified internucleotide linkage. Since at least 2 nucleotides of
the chimeric oligonucleotides include backbone modifications these
nucleic acids are an example of one type of "stabilized
immunostimulatory nucleic acids."
[0143] With respect to the chimeric oligonucleotides, Y.sub.1 and
Y.sub.2 are considered independent of one another. This means that
each of Y.sub.1 and Y.sub.2 may or may not have different sequences
and different backbone linkages from one anther in the same
molecule. The sequences vary, but in some cases Y.sub.1 and Y.sub.2
have a poly-G sequence. A poly-G sequence refers to at least 3 Gs
in a row. In other embodiments the poly-G sequence refers to at
least 4, 5, 6, 7, or 8 Gs in a row. In other embodiments Y.sub.1
and Y.sub.2 may be TCGTCG, TCGTCGT, or TCGTCGTT (SEQ ID NO:1145).
Y.sub.1 and Y.sub.2 may also have a poly-C, poly-T, or poly-A
sequence. In some embodiments Y.sub.1 and/or Y.sub.2 have between 3
and 8 nucleotides.
[0144] N.sub.1 and N.sub.2 are nucleic acid molecules having
between 0 and 5 nucleotides as long as N.sub.1ZN.sub.2 has at least
6 nucleotides in total. The nucleotides of N.sub.1ZN.sub.2 have a
phosphodiester backbone and do not include nucleic acids having a
modified backbone.
[0145] Z is an immunostimulatory nucleic acid motif but does not
include a CG. For instance, Z may be a nucleic acid a T-rich
sequence, e.g. including a TTTT motif or a sequence wherein at
least 50% of the bases of the sequence are Ts or Z may be a TG
sequence.
[0146] The center nucleotides (N.sub.1ZN.sub.2) of the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 have phosphodiester internucleotide
linkages and Y.sub.1 and Y.sub.2 have at least one, but may have
more than one or even may have all modified internucleotide
linkages. In preferred embodiments Y.sub.1 and/or Y.sub.2 have at
least two or between two and five modified internucleotide linkages
or Y.sub.1 has two modified internucleotide linkages and Y.sub.2
has five modified internucleotide linkages or Y.sub.1 has five
modified internucleotide linkages and Y.sub.2 has two modified
internucleotide linkages. The modified internucleotide linkage, in
some embodiments is a phosphorothioate modified linkage, a
phosphorodithioate modified linkage or a p-ethoxy modified
linkage.
[0147] Modified backbones such as phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990;
Goodchild, J., Bioconjugate Chem. 1:165, 1990).
[0148] Other stabilized nucleic acids include: nonionic DNA
analogs, such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acids which contain diol, such
as tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
[0149] In the case when the Py-rich or TG nucleic acid is
administered in conjunction with an antigen which is encoded in a
nucleic acid vector, it is preferred that the backbone of the
Py-rich or TG nucleic acid be a chimeric combination of
phosphodiester and phosphorothioate (or other phosphate
modification). The cell may have a problem taking up a plasmid
vector in the presence of completely phosphorothioate nucleic acid.
Thus when both a vector and a nucleic acid are delivered to a
subject, it is preferred that the nucleic acid have a chimeric
backbone or have a phosphorothioate backbone but that the plasmid
be associated with a vehicle that delivers it directly into the
cell, thus avoiding the need for cellular uptake. Such vehicles are
known in the art and include, for example, liposomes and gene
guns.
[0150] The nucleic acids described herein as well as various
control nucleic acids are presented below in Table A.
TABLE-US-00001 TABLE A SEQ ID NO: ODN SEQUENCE BACKBONE 1
tctcccagcgtgcgccat s 2 ataatccagcttgaaccaag s 3
ataatcgacgttcaagcaag s 4 taccgcgtgcgaccctct s 5 ggggagggt s 6
ggggagggg s 7 ggtgaggtg s 8 tccatgtzgttcctgatgct o 9
gctaccttagzgtga o 10 tccatgazgttcctgatgct o 11 tccatgacgttcztgatgct
o 12 gctagazgttagtgt o 13 agctccatggtgctcactg s 14
ccacgtcgaccctcaggcga s 15 gcacatcgtcccgcagccga s 16
gtcactcgtggtacctcga s 17 gttggatacaggccagactttgttg o 18
gattcaacttgcgctcatcttaggc o 19 accatggacgaactgtttcccctc s 20
accatggacgagctgtttcccctc s 21 accatggacgacctgtttcccctc s 22
accatggacgtactgtttcccctc s 23 accatggacggtctgtttcccctc s 24
accatggacgttctgtttcccctc s 25 ccactcacatctgctgctccacaag o 26
acttctcatagtccctttggtccag o 27 tccatgagcttcctgagtct o 28
gaggaaggigiggaigacgt o 29 gtgaaticgttcicgggict o 30 aaaaaa s 31
cccccc s 32 ctgtca s 33 tcgtag s 34 tcgtgg s 35 cgtcgt s 36
tccatgtcggtcctgagtct sos 37 tccatgccggtcctgagtct sos 38
tccatgacggtcctgagtct sos 39 tccatgacggtcctgagtct sos 40
tccatgtcgatcctgagtct sos 41 tccatgtcgctcctgagtct sos 42
tccatgtcgttcctgagtct sos 43 tccatgacgttcatgagtct sos 44
tccataacgttcctgagtct sos 45 tccatgacgtccctgagtct sos 46
tccatcacgtgcctgagtct sos 47 tccatgctggtcctgagtct sos 48
tccatgtzggtcctgagtct sos 49 ccgcttcctccagatgagctcatgggtttctccaccaag
o 50 cttggtggagaaacccatgagctcatctggaggaagcgg o 51
ccccaaagggatgagaagtt o 52 agatagcaaatcggctgacg o 53
ggttcacgtgctcatggatg o 54 tctcccagcgtgcgccat s 55
tctcccagcgtgcgccat s 56 taccgcgtgcgaccctct s 57
ataatccagcttgaaccaag s 58 ataatcgacgttcaagcaag s 59
tccatgattttcctgatttt o 60 ttgtttttttgtttttttgttttt s 61
ttttttttgtttttttgttttt o 62 tgctgcttttgtgcttttgtgctt s 63
tgctgcttgtgcttttgtgctt o 64 gcattcatcaggcgggcaagaat o 65
taccgagcttcgacgagatttca o 66 gcatgacgttgagct s 67 cacgttgaggggcat s
68 ctgctgagactggag s 69 tccatgacgttcctgacgtt s 70 gcatgagcttgagctga
o 71 tcagcgtgcgcc s 72 atgacgttcctgacgtt s 73 ttttggggttttggggtttt
s 74 tctaggctttttaggcttcc s 75 tgcattttttaggccaccat s 76
tctcccagcgtgcgtgcgccat s 77 tctcccagcgggcgcat s 78
tctcccagcgagcgccat s 79 tctcccagcgcgcgccat s 80 ggggtgacgttcagggggg
sos 81 ggggtccagcgtgcgccatggggg sos 82 ggggtgtcgttcagggggg sos 83
tccatgtcgttcctgtcgtt s 84 tccatagcgttcctagcgtt s 85
tcgtcgctgtctccgcttctt s 86 gcatgacgttgagct sos 87
tctcccagcgtgcgccatat sos 88 tccatgazgttcctgazgtt s 89
gcatgazgttgagct o 90 tccagcgtgcgccata sos 91 tctcccagcgtgcgccat o
92 tccatgagcttcctgagtct o 93 gcatgtcgttgagct sos 94
tcctgacgttcctgacgtt s 95 gcatgatgttgagct o 96 gcatttcgaggagct o 97
gcatgtagctgagct o 98 tccaggacgttcctagttct o 99 tccaggagcttcctagttct
o 100 tccaggatgttcctagttct o 101 tccagtctaggcctagttct o 102
tccagttcgagcctagttct o 103 gcatggcgttgagct sos 104 gcatagcgttgagct
sos 105 gcattgcgttgagct sos 106 gcttgcgttgcgttt sos 107
tctcccagcgttgcgccatat sos 108 tctcccagcgtgcgttatat sos 109
tctccctgcgtgcgccatat sos 110 tctgcgtgcgtgcgccatat sos 111
tctcctagcgtgcgccatat sos 112 tctaccagcgtgcgcctttt sos 113
gctandcghhagc o 114 tcctgacgttccc o 115 ggaagacgttaga o 116
tcctgacgttaga o 117 tcagaccagctggtcgggtgttcctga o 118
tcaggaacacccgaccagctggtctga o 119 gctagtcgatagc o 120 gctagtcgctagc
o 121 gcttgacgtctagc o 122 gcttgacgtttagc o
123 gcttgacgtcaagc o 124 gctagacgtttagc o 125 tccatgacattcctgatgct
o 126 gctagacgtctagc o 127 ggctatgtcgttcctagcc o 128
ggctatgtcgatcctagcc o 129 ctcatgggtttctccaccaag o 130
cttggtggagaaaccaatgag o 131 tccatgacgttcctagttct o 132
ccgcttcctccagatgagctcatg o 133 catgagctcatctggaggaagcgg o 134
ccagatgagctcatgggtttctcc o 135 ggagaaacccatgagctcatctgg o 136
agcatcaggaacgacatgga o 137 tccatgaagttcctgacgtt rna 138
gcgcgcgcgcgcgcgcgcg o 139 ccggccggccggccggccgg o 140
ttccaatcagccccacccgctctggccccaccctcaccctcca o 141
tggagggtgagggtggggccagagagggtggggctgattggaa o 142
tcaaatgtgggattttcccatgagtct o 143 agactcatgggaaaatcccacatttga o 144
tgccaagtgctgagtcactaataaaga o 145 tctttattagtgactcagcacttggca o 146
tgcaggaagtccgggttttccccaacccccc o 147
ggggggttggggaaaacccggacttcctgca o 148
ggggactttccgctggggactttccagggggactttcc sos 149
tccatgacgttcctctccatgacgttcccctccatgacgttcctc o 150
gaggaacgtcatggagaggaacgtcatggagaggaacgtcatgga o 151
ataatagagcttcaagcaag s 152 tccatgacgttcctgacgtt s 153
tccatgacgttcctgacgtt sos 154 tccaggactttcctcaggtt s 155
tcttgcgatgctaaaggacgtcacattgcacaatcttaataaggt o 156
accttattaagattgtgcaatgtgacgtcctttagcatcgcaaga o 157
tcctgacgttcctggcggtcctgtcgct o 158 tcctgtcgctcctgtcgct o 159
tcctgacgttgaagt o 160 tcctgtcgttgaagt o 161 tcctggcgttgaagt o 162
tcctgccgttgaagt o 163 tccttacgttgaagt o 164 tcctaacgttgaagt o 165
tcctcacgttgaagt o 166 tcctgacgatgaagt o 167 tcctgacgctgaagt o 168
tcctgacggtgaagt o 169 tcctgacgtagaagt o 170 tcctgacgtcgaagt o 171
tcctgacgtggaagt o 172 tcctgagcttgaagt o 173 gggggacgttggggg o 174
tcctgacgttccttc o 175 tctcccagcgagcgagcgccat s 176
tcctgacgttcccctggcggtcccctgtcgct o 177 tcctgtcgctcctgtcgctcctgtcgct
o 178 tcctggcggggaagt o 179 tcctgazgttgaagt o 180 tcztgacgttgaagt o
181 tcctagcgttgaagt o 182 tccagacgttgaagt o 183 tcctgacggggaagt o
184 tcctggcggtgaagt o 185 ggctccggggagggaatttttgtctat o 186
atagacaaaaattccctccccggagcc o 187 tccatgagcttccttgagtct rna 188
tcgtcgctgtctccgcttctt so 189 tcgtcgctgtctccgcttctt s20 190
tcgagacattgcacaatcatctg o 191 cagattgtgcaatgtctcga o 192
tccatgtcgttcctgatgcg o 193 gcgatgtcgttcctgatgct o 194
gcgatgtagttcctgatgcg o 195 tccatgtcgttccgcgcgcg o 196
tccatgtcgttcctgccgct o 197 tccatgtcgttdctgtagct o 198
gcggcgggcggcgcgcgccc o 199 atcaggaacgtcatgggaagc o 200
tccatgagcttcctgagtct p-ethoxy 201 tcaacgtt p-ethoxy 202 tcaagctt
p-ethoxy 203 tcctgtcgttcctgtcgtt s 204 tccatgtcgtttttgtcgtt s 205
tcctgtcgttccttgtcgtt s 206 tccttgtcgttcctgtcgtt s 207
btccattccatgacgttcctgatgcttcca os 208 tcctgtcgttttttgtcgtt s 209
tcgtcgctgtctccgcttctt s 210 tcgtcgctgtctgcccttctt s 211
tcgtcgctgttgtcgtttctt s 212 tcctgtcgttcctgtcgttggaacgacagg o 213
tcctgtcgttcctgtcgtttcaacgtcaggaacgacagga o 214
ggggtctgtcgttttgggggg sos 215 ggggtctgtgcttttgggggg sos 216
tccggccgttgaagt o 217 tccggacggtgaagt o 218 tcccgccgttgaagt o 219
tccagacggtgaagt o 220 tcccgacggtgaagt o 221 tccagagcttgaagt o 222
tccatgtzgttcctgtzgtt s 223 tccatgacgttcctgacgtt sos 224
ggggttgacgttttgggggg sos 225 tccaggacttctctcaggtt s 226
tttttttttttttttttttt s 227 tccatgccgttcctgccgtt s 228
tccatggcgggcctggcggg s 229 tccatgacgttcctgccgtt s 230
tccatgacgttcctggcggg s 231 tccatgacgttcctgcgttt s 232
tccatgacggtcctgacggt s 233 tccatgcgtgcgtgcgtttt s 234
tccatgcgttgcgttgcgtt s 235 btccattccattctaggcctgagtcttccat os 236
tccatagcgttcctagcgtt o 237 tccatgtcgttcctgtcgtt o 238
tccatagcgatcctagcgat o 239 tccattgcgttccttgcgtt o 240
tccatagcggtcctagcggt o 241 tccatgattttcctgcagttcctgatttt 242
tccatgacgttcctgcagttcctgacgtt s 243 ggcggcggcggcggcggcgg o 244
tccacgacgttttcgacgtt s 245 tcgtcgttgtcgttgtcgtt s 246
tcgtcgttttgtcgttttgtcgtt s 247 tcgtcgttgtcgttttgtcgtt s
248 gcgtgcgttgtcgttgtcgtt s 249 czggczggczgggczccgg o 250
gcggcgggcggcgcgcgccc s 251 agicccgigaacgiattcac o 252
tgtcgtttgtcgtttgtcgtt s 253 tgtcgttgtcgttgtcgttgtcgtt s 254
tgtcgttgtcgttgtcgttgtcgtt s 255 tcgtcgtcgtcgtt s 256 tgtcgttgtcgtt
s 257 cccccccccccccccccccc s 258 tctagcgtttttagcgttcc sos 259
tgcatcccccaggccaccat s 260 tcgtcgtcgtcgtcgtcgtcgtt sos 261
tcgtcgttgtcgttgtcgtt sos 262 tcgtcgttttgtcgttttgtcgtt sos 263
tcgtcgttgtcgttttgtcgtt sos 264
ggggagggaggaacttcttaaaattcccccagaatgttt o 265
aaacattctgggggaattttaagaagttcctccctcccc o 266
atgtttacttcttaaaattcccccagaatgttt o 267
aaacattctgggggaattttaagaagtaaacat o 268
atgtttactagacaaaattcccccagaatgttt o 269
aaacattctgggggaattttgtctagtaaacat o 270 aaaattgacgttttaaaaaa sos
271 ccccttgacgttttcccccc sos 272 ttttcgttgtttttgtcgtt 273
tcgtcgttttgtcgttttgtcgtt sos 274 ctgcagcctgggac o 275
acccgtcgtaattatagtaaaaccc o 276 ggtacctgtggggacattgtg o 277
agcaccgaacgtgagagg o 278 tccatgccgttcctgccgtt o 279
tccatgacggtcctgacggt o 280 tccatgccggtcctgccggt o 281
tccatgcgcgtcctgcgcgt o 282 ctggtctttctggtttttttctgg s 283
tcaggggtggggggaacctt sos 284 tccatgazgttcctagttct o 285
tccatgatgttcctagttct o 286 cccgaagtcatttcctcttaacctgg o 287
ccaggttaagaggaaatgacttcggg o 288 tcctggzggggaagt o 289
gzggzgggzggzgzgzgccc x 290 tccatgtgcttcctgatgct o 291
tccatgtccttcctgatgct 292 tccatgtcgttcctagttct 293
tccaagtagttcctagttct o 294 tccatgtagttcctagttct o 295
tcccgcgcgttccgcgcgtt s 296 tcctggcggtcctggcggtt s 297
tcctggaggggaagt o 298 tcctgggggggaagt o 299 tcctggtggggaagt o 300
tcgtcgttttgtcgttttgtcgtt o 301 ctggtctttctggtttttttctgg o 302
tccatgacgttcctgacgtt o 303 tccaggacttctctcaggtt sos 304
tzgtzgttttgtzgttttgtzgtt o 305 btcgtcgttttgtcgttttgtcgttttttt os
306 gctatgacgttccaaggg s 307 tcaacgtt s 308 tccaggactttcctcaggtt o
309 ctctctgtaggcccgcttgg s 310 ctttccgttggacccctggg s 311
gtccgggccaggccaaagtc s 312 gtgcgcgcgagcccgaaatc s 313
tccatgaigttcctgaigtt s 314 aatagtcgccataacaaaac o 315
aatagtcgccatggcggggc o 316 btttttccatgtcgttcctgatgcttttt os 317
tcctgtcgttgaagtttttt o 318 gctagctttagagctttagagctt o 319
tgctgcttcccccccccccc o 320 tcgacgttcccccccccccc o 321
tcgtcgttcccccccccccc o 322 tcgtcgttcccccccccccc o 323
tcgccgttcccccccccccc o 324 tcgtcgatcccccccccccc o 325
tcctgacgttgaagt s 326 tcctgccgttgaagt s 327 tcctgacggtgaagt s 328
tcctgagcttgaagt s 329 tcctggcggggaagt s 330 aaaatctgtgcttttaaaaaa
sos 331 gatccagtcacagtgacctggcagaatctggat o 332
gatccagattctgccaggtcactgtgactggat o 333
gatccagtcacagtgactcagcagaatctggat o 334
gatccagattctgctgagtcactgtgactggat o 335 tcgtcgttccccccczcccc o 336
tzgtggttcccccccccccc o 337 tzgtcgttcccccccccccc o 338
tcgtzgttcccccccccccc o 339 tcgtcgctcccccccccccc o 340
tcgtcggtcccccccccccc o 341 tcggcgttcccccccccccc o 342
ggccttttcccccccccccc o 343 tcgtcgttttgacgttttgtcgtt s 344
tcgtcgttttgacgttttgacgtt s 345 ccgtcgttcccccccccccc o 346
gcgtcgttcccccccccccc o 347 tcgtcattcccccccccccc o 348
acgtcgttcccccccccccc o 349 ctgtcgttcccccccccccc o 350
btttttcgtcgttcccccccccccc os 351 tcgtcgttccccccccccccb o 352
tcgtcgttttgtcgttttgtcgttb o 353 tccagttccttcctcagtct o 354
tzgtcgttttgtcgttttgtcgtt o 355 tcctggaggggaagt s 356
tcctgaaaaggaagt s 357 tcgtcgttccccccccc s 358
tzgtzgttttgtzgttttgtzgtt s 359 ggggtcaagcttgagggggg sos 360
tgctgcttcccccccccccc s 361 tcgtcgtcgtcgtt s2 362 tcgtcgtcgtcgtt s20
363 tcgtcgtcgtcgtt os2 364 tcaacgttga s 365 tcaacgtt s 366
atagttttccatttttttac 367 aatagtcgccatcgcgcgac o 368
aatagtcgccatcccgggac o 369 aatagtcgccatcccccccc o 370
tgctgcttttgtgcttttgtgctt o 371 ctgtgctttctgtgtttttctgtg s 372
ctaatctttctaatttttttctaa s 373 tcgtcgttggtgtcgttggtgtcgtt s
374 tcgtcgttggttgtcgttttggtt s 375 accatggacgagctgtttcccctc 376
tcgtcgttttgcgtgcgttt s 377 ctgtaagtgagcttggagag 378
gagaacgctggaccttcc 379 cgggcgactcagtctatcgg 380
gttctcagataaagcggaaccagcaacagacacagaa 381
ttctgtgtctgttgctggttccgctttatctgagaac 382 cagacacagaagcccgatagacg
383 agacagacacgaaacgaccg 384 gtctgtcccatgatctcgaa 385
gctggccagcttacctcccg 386 ggggcctctatacaacctggg 387
ggggtccctgagactgcc 388 gagaacgctggaccttccat 389
tccatgtcggtcctgatgct 390 ctcttgcgacctggaaggta 391
aggtacagccaggactacga 392 accatggacgacctgtttcccctc 393
accatggattacctttttcccctt 394 atggaaggtccagcgttctc o 395
agcatcaggaccgacatgga o 396 ctctccaagctcacttacag 397
tccctgagactgccccacctt 398 gccaccaaaaattgtccatg 399
gtccatggcgtgcgggatga 400 cctctatacaacctgggac 401
cgggcgactcagtctatcgg 402 gcgctaccggtagcctgagt 403
cgactgccgaacaggatatcggtgatcagcactgg 404
ccagtgctgatcaccgatatcctgttcggcagtcg 405 ccaggttgtatagaggc 406
tctcccagcgtacgccat s 407 tctcccagcgtgcgtttt s 408
tctcccgacgtgcgccat s 409 tctcccgtcgtgcgccat s 410
ataatcgtcgttcaagcaag s 411 tcgtcgttttgtcgttttgtcgt s2 412
tcgtcgttttgtcgttttgtcgtt s2 413 tcgtcgttttgtcgttttgtcgtt s2 414
tcntcgtnttntcgtnttntcgtn s 415 tctcccagcgtcgccat s 416
tctcccatcgtcgccat s 417 ataatcgtgcgttcaagaaag s 418
ataatcgacgttcccccccc s 419 tctatcgacgttcaagcaag s 420 tcc tga cgg
gg agt s 421 tccatgacgttcctgatcc 422 tccatgacgttcctgatcc 423
tccatgacgttcctgatcc 424 tcc tgg cgt gga agt s 425
tccatgacgttcctgatcc 426 tcgtcgctgttgtcgtttctt s 427
agcagctttagagctttagagctt s 428 cccccccccccccccccccccccc s 429
tcgtcgttttgtcgttttgtcgttttgtcgtt s 430 tcgtcgttttttgtcgttttttgtcgtt
s 431 tcgtcgtttttttttttttt s 432 tttttcaacgttgatttttt sos 433
tttttttttttttttttttttttt s 434 ggggtcgtcgttttgggggg 435
tcgtcgttttgtcgttttgggggg 436 tcgtcgctgtctccgcttcttcttgcc s 437
tcgtcgctgtctccg s 438 ctgtaagtgagcttggagag 439 gagaacgctggaccttccat
440 ccaggttgtatagaggc 441 gctagacgttagcgtga 442
ggagctcttcgaacgccata 443 tctccatgatggttttatcg 444
aaggtggggcagtctcaggga 445 atcggaggactggcgcgccg 446
ttaggacaaggtctagggtg 447 accacaacgagaggaacgca 448
ggcagtgcaggctcaccggg 449 gaaccttccatgctgtt 450 gctagacgttagcgtga
451 gcttggagggcctgtaagtg 452 gtagccttccta 453 cggtagccttccta 454
cacggtagccttccta 455 agcacggtagccttccta 456 gaacgctggaccttccat 457
gaccttccat 458 tggaccttccat 459 gctggaccttccat 460 acgctggaccttccat
461 taagctctgtcaacgccagg 462 gagaacgctggaccttccatgt 463
tccatgtcggtcctgatgct 464 ttcatgccttgcaaaatggcg 465
tgctagctgtgcctgtacct 466 agcatcaggaccgacatgga 467
gaccttccatgtcggtcctgat 468 acaaccacgagaacgggaac 469
gaaccttccatgctgttccg 470 caatcaatctgaggagaccc 471
tcagctctggtactttttca 472 tggttacggtctgtcccatg 473
gtctatcggaggactggcgc 474 cattttacgggcgggcgggc 475
gaggggaccattttacgggc 476 tgtccagccgaggggaccat 477
cgggcttacggcggatgctg 478 tggaccttctatgtcggtcc 479
tgtcccatgtttttagaagc 480 gtggttacggtcgtgcccat 481
cctccaaatgaaagaccccc 482 ttgtactctccatgatggtt 483
ttccatgctgttccggctgg 484 gaccttctatgtcggtcctg 485
gagaccgctcgaccttcgat 486 ttgccccatattttagaaac 487
ttgaaactgaggtgggac 488 ctatcggaggactggcgcgcc 489
cttggagggcctcccggcgg 490 gctgaaccttccatgctgtt 491
tagaaacagcattcttcttttagggcagcaca 492 agatggttctcagataaagcggaa 493
ttccgctttatctgagaaccatct 494 gtcccaggttgtatagaggctgc 495
gcgccagtcctccgatagac 496 atcggaggactggcgcgccg 497
ggtctgtcccatatttttag 498 tttttcaacgttgagggggg sos
499 tttttcaagcgttgatttttt sos 500 ggggtcaacgttgatttttt sos 501
ggggttttcaacgttttgagggggg sos 502 ggttacggtctgtcccatat 503
ctgtcccatatttttagaca 504 accatcctgaggccattcgg 505
cgtctatcgggcttctgtgtctg 506 ggccatcccacattgaaagtt 507
ccaaatatcggtggtcaagcac 508 gtgcttgaccaccgatatttgg 509
gtgctgatcaccgatatcctgttcgg 510 ggccaactttcaatgtgggatggcctc 511
ttccgccgaatggcctcaggatggtac 512
tatagtccctgagactgccccaccttctcaacaacc 513
gcagcctctatacaacctgggacggga 514 ctatcggaggactggcgcgccg 515
tatcggaggactggcgcgccg 516 gatcggaggactggcgcgccg 517
ccgaacaggatatcggtgatcagcac 518 ttttggggtcaacgttgagggggg 519
ggggtcaacgttgagggggg sos 520 cgcgcgcgcgcgcgcgcgcg s 521
ggggcatgacgttcgggggg ss 522 ggggcatgacgttcaaaaaa s 523
ggggcatgagcttcgggggg s 524 ggggcatgacgttcgggggg sos 525
aaaacatgacgttcaaaaaa sos 526 aaaacatgacgttcgggggg sos 527
ggggcatgacgttcaaaaaa sos 528 accatggacgatctgtttcccctc s 529
gccatggacgaactgttccccctc s 530 cccccccccccccccccccc sos 531
gggggggggggggggggggg sos 532 gctgtaaaatgaatcggccg sos 533
ttcgggcggactcctccatt sos 534 tatgccgcgcccggacttat sos 535
ggggtaatcgatcagggggg sos 536 tttgagaacgctggaccttc sos 537
gatcgctgatctaatgctcg sos 538 gtcggtcctgatgctgttcc sos 539
tcgtcgtcagttcgctgtcg sos 540 ctggaccttccatgtcgg sos 541
gctcgttcagcgcgtct sos 542 ctggaccttccatgtc sos 543 cactgtccttcgtcga
sos 544 cgctggaccttccatgtcgg sos 545 gctgagctcatgccgtctgc sos 546
aacgctggaccttccatgtc sos 547 tgcatgccgtacacagctct sos 548
ccttccatgtcggtcctgat sos 549 tactcttcggatcccttgcg sos 550
ttccatgtcggtcctgat sos 551 ctgattgctctctcgtga sos 552
ggcgttattcctgactcgcc o 553 cctacgttgtatgcgcccagct o 554
ggggtaatcgatgagggggg o 555 ttcgggcggactdctcdatt o 556
tttttttttttttttttttt o 557 gggggttttttttttggggg o 558
tttttggggggggggttttt o 559 ggggggggggggggggggt o 560
aaaaaaaaaaaaaaaaaaaa o 561 cccccaaaaaaaaaaccccc o 562
aaaaaccccccccccaaaaa o 563 tttgaattcaggactggtgaggttgag o 564
tttgaatcctcagcggtctccagtggc o 565
aattctctatcggggcttctgtgtctgttgctggttccgctttat o 566
ctagataaagcggaaccagcaacagacacagaagccccgatagag o 567
ttttctagagaggtgcacaatgctctgg o 568 tttgaattccgtgtacagaagcgagaagc o
569 tttgcggccgctagacttaacctgagagata o 570
tttgggcccacgagagacagagacacttc o 571 tttgggcccgcttctcgcttctgtacacg o
572 gagaacgctggaccttccat s 573 tccatgtcggtcctgatgct s 574 ctgtcg s
575 tcgtga s 576 cgtcga s 577 agtgct s 578 ctgtcg o 579 agtgct o
580 cgtcga o 581 tcgtga o 582 gagaacgctccagcttcgat o 583
gctagacgtaagcgtga o 584 gagaacgctcgaccttccat o 585
gagaacgctggacctatccat o 586 gctagaggttagcgtga o 587
gagaacgctggacttccat o 588 tcacgctaacgtctagc o 589
bgctagacgttagcgtga o 590 atggaaggtcgagcgttctc o 591
gagaacgctggaccttcgat o 592 gagaacgatggaccttccat o 593
gagaacgctggatccat o 594 gagaacgctccagcactgat o 595
tccatgtcggtcctgctgat o 596 atgtcctcggtcctgatgct o 597
gagaacgctccaccttccat o 598 gagaacgctggaccttcgta o 599
batggaaggtccagcgttctc o 600 tcctga o 601 tcaacgtt o 602 aacgtt o
603 aacgttga o 604 tcacgctaacctctagc o 605 gagaacgctggaccttgcat o
606 gctggaccttccat o 607 gagaacgctggacctcatccat o 608
gagaacgctggacgctcatccat o 609 aacgttgaggggcat o 610 atgcccctcaacgtt
o 611 tcaacgttga o 612 gctggaccttccat o 613 caacgtt o 614
acaacgttga o 615 tcacgt o 616 tcaagctt o 617 tcgtca o 618 aggatatc
o 619 tagacgtc o 620 gacgtcat o 621 ccatcgat o 622 atcgatgt o 623
atgcatgt o 624 ccatgcat o
625 agcgctga o 626 tcagcgct o 627 ccttcgat o 628 gtgccggggtctccgggc
s 629 gctgtggggcggctcctg s 630 btcaacgtt o 631 ftcaacgtt o 632
faacgttga o 633 tcaacgt s 634 aacgttg s 635 cgacga o 636 tcaacgtt o
637 tcgga o 638 agaacgtt o 639 tcatcgat o 640 taaacgtt s 641
ccaacgtt s 642 gctcga s 643 cgaagt s 644 cgtcgt s 645 acgtgt s 646
cgttag s 647 gagcaagctggaccttccat s 648 cgcgta s 649 cgtacg s 650
tcaccggt s 651 caagagatgctaacaatgca s 652 acccatcaatagctctgtgc s
653 ccatcgat o 654 tcgacgtc o 655 ctagcgct o 656 taagcgct o 657
tcgcgaattcgcg o 658 atggaaggtccagcgttct o 659 actggacgttagcgtga o
660 cgcctggggctggtctgg o 661 gtgtcggggtctccgggc o 662
gtgccggggtctccgggc o 663 cgccgtcgcggcggttgg o 664
gaagttcacgttgaggggcat o 665 atctggtgagggcaagctatg s 666
gttgaaacccgagaacatcat s 667 gcaacgtt o 668 gtaacgtt o 669 cgaacgtt
o 670 gaaacgtt o 671 caaacgtt o 672 ctaacgtt o 673 ggaacgtt o 674
tgaacgtt o 675 acaacgtt o 676 ttaacgtt o 677 aaaacgtt o 678
ataacgtt o 679 aacgttct o 680 tccgatcg o 681 tccgtacg o 682
gctagacgctagcgtga o 683 gagaacgctggacctcatcatccat o 684
gagaacgctagaccttctat o 685 actagacgttagtgtga o 686
cacaccttggtcaatgtcacgt o 687 tctccatcctatggttttatcg o 688
cgctggaccttccat o 689 caccaccttggtcaatgtcacgt o 690
gctagacgttagctgga o 691 agtgcgattgcagatcg o 692
ttttcgttttgtggttttgtggtt 693 ttttcgtttgtcgttttgtcgtt 694
tttttgttttgtggttttgtggtt 695 accgcatggattctaggcca s 696
gctagacgttagcgt o 697 aacgctggaccttccat o 698 tcaazgtt o 699
ccttcgat o 700 actagacgttagtgtga s 701 gctagaggttagcgtga s 702
atggactctccagcgttctc o 703 atcgactctcgagcgttctc o 704 gctagacgttagc
o 705 gctagacgt o 706 agtgcgattcgagatcg o 707 tcagzgct o 708
ctgattgctctctcgtga o 709 tzaacgtt o 710 gagaazgctggaccttccat o 711
gctagacgttaggctga o 712 gctacttagcgtga o 713 gctaccttagcgtga o 714
atcgacttcgagcgttctc o 715 atgcactctgcagcgttctc o 716
agtgactctccagcgttctc o 717 gccagatgttagctgga o 718
atcgactcgagcgttctc o 719 atcgatcgagcgttctc o 720
bgagaacgctcgaccttcgat o 721 gctagacgttagctgga sos 722
atcgactctcgagcgttctc sos 723 tagacgttagcgtga o 724
cgactctcgagcgttctc o 725 ggggtcgaccttggagggggg sos 726
gctaacgttagcgtga o 727 cgtcgtcgt o 728 gagaacgctggaczttccat o 729
atcgacctacgtgcgttztc o 730 atzgacctacgtgcgttctc o 731
gctagazgttagcgt o 732 atcgactctcgagzgttctc o 733
ggggtaatgcatcagggggg sos 734 ggctgtattcctgactgccc s 735
ccatgctaacctctagc o 736 gctagatgttagcgtga o 737 cgtaccttacggtga o
738 tccatgctggtcctgatgct o 739 atcgactctctcgagcgttctc o 740
gctagagcttagcgtga o 741 atcgactctcgagtgttctc o 742
aacgctcgaccttcgat o 743 ctcaacgctggaccttccat o 744
atcgacctacgtgcgttctc o 745 gagaatgctggaccttccat o 746
tcacgctaacctctgac o 747 bgagaacgctccagcactgat o 748
bgagcaagctggaccttccat o 749 cgctagaggttagcgtga o
750 gctagatgttaacgt o 751 atggaaggtccacgttctc o 752 gctagatgttagcgt
o 753 gctagacgttagtgt o 754 tccatgacggtcctgatgct o 755
tccatggcggtcctgatgct o 756 gctagacgatagcgt o 757 gctagtcgatagcgt o
758 tccatgacgttcctgatgct o 759 tccatgtcgttcctgatgct o 760
gctagacgttagzgt o 761 gctaggcgttagcgt o 762 tccatgtzggtcctgatgct o
763 tccatgtcggtzctgatgct o 764 atzgactctzgagzgttctc o 765
atggaaggtccagtgttctc o 766 gcatgacgttgagct o 767
ggggtcaacgttgagggggg s 768 ggggtcaagtctgagggggg sos 769
cgcgcgcgcgcgcgcgcgcg o 770 cccccccccccccccccccccccccccc s 771
ccccccccccccccccccccccccccccccccccc s 772 tccatgtcgctcctgatcct o
773 gctaaacgttagcgt o 774 tccatgtcgatcctgatgct o 775
tccatgccggtcctgatgct o 776 aaaatcaacgttgaaaaaaa sos 777
tccataacgttcctgatgct o 778 tggaggtcccaccgagatcggag o 779
cgtcgtcgtcgtcgtcgtcgt s 780 ctgctgctgctgctgctgctg s 781
gagaacgctccgaccttcgat s 782 gctagatgttagcgt s 783 gcatgacgttgagct s
784 tcaatgctgaf o 785 tcaacgttgaf o 786 tcaacgttgab o 787
gcaatattgcb o 788 gcaatattgcf o 789 agttgcaact o 790 tcttcgaa o 791
tcaacgtc o 792 ccatgtcggtcctgatgct o 793 gtttttatataatttggg o 794
tttttgtttgtcgttttgtcgtt o 795 ttggggggggtt s 796 ggggttgggggtt s
797 ggtggtgtaggttttgg o 798 bgagaazgctcgaccttcgat o 799
tcaacgttaacgttaacgtt o 800 bgagcaagztggaccttccat o 801
bgagaazgctccagcactgat o 802 tcaazgttgax o 803 gzaatattgcx o 804
tgctgcttttgtcgttttgtgctt o 805 ctgcgttagcaatttaactgtg o 806
tccatgacgttcctgatgct s 807 tgcatgccgtgcatccgtacacagctct s 808
tgcatgccgtacacagctct s 809 tgcatcagctct s 810 tgcgctct s 811
cccccccccccccccccccc s 812 cccccccccccc s 813 cccccccc s 814
tgcatcagctct sos 815 tgcatgccgtacacagctct o 816
gagcaagctggaccttccat s 817 tcaacgttaacgttaacgttaacgttaacgtt s 818
gagaacgctcgaccttcgat s 819 gtccccatttcccagaggaggaaat o 820
ctagcggctgacgtcatcaagctag o 821 ctagcttgatgacgtcagccgctag o 822
cggctgacgtcatcaa s 823 ctgacgtg o 824 ctgacgtcat o 825
attcgatcggggcggggcgag o 826 ctcgccccgccccgatcgaat o 827
gactgacgtcagcgt o 828 ctagcggctgacgtcataaagctagc s 829
ctagctttatgacgtcagccgctagc s 830 ctagcggctgagctcataaagctagc s 831
ctagtggctgacgtcatcaagctag s 832 tccaccacgtggtctatgct s 833
gggaatgaaagattttattataag o 834 tctaaaaaccatctattcttaaccct o 835
agctcaacgtcatgc o 836 ttaacggtggtagcggtattggtc o 837
ttaagaccaataccgctaccaccg o 838 gatctagtgatgagtcagccggatc o 839
gatccggctgactcatcactagatc o 840 tccaagacgttcctgatgct o 841
tccatgacgtccctgatgct o 842 tccaccacgtggctgatgct o 843
ccacgtggacctctagc o 844 tcagaccacgtggtcgggtgttcctga o 845
tcaggaacacccgaccacgtggtctga o 846 catttccacgatttccca o 847
ttcctctctgcaagagact o 848 tgtatctctctgaaggact o 849
ataaagcgaaactagcagcagtttc o 850 gaaactgctgctagtttcgctttat o 851
tgcccaaagaggaaaatttgtttcatacag o 852 ctgtatgaaacaaattttcctctttgggca
o 853 ttagggttagggttagggtt ss 854 tccatgagcttcctgatgct ss 855
aaaacatgacgttcaaaaaa ss 856 aaaacatgacgttcgggggg ss 857
ggggcatgagcttcgggggg sos 858 ctaggctgacgtcatcaagctagt o 859
tctgacgtcatctgacgttggctgacgtct o 860 ggaattagtaatagatatagaagtt o
861 tttaccttttataaacataactaaaacaaa o 862 gcgtttttttttgcg s 863
atatctaatcaaaacattaacaaa o 864 tctatcccaggtggttcctgttag o 865
btccatgacgttcctgatgct o 866 btccatgagcttcctgatgct o 867
tttttttttttttf o 868 tttttttttttttf so 869
ctagcttgatgagctcagccgctag o 870 ttcagttgtcttgctgcttagctaa o 871
tccatgagcttcctgagtct s 872 ctagcggctgacgtcatcaatctag o 873
tgctagctgtgcctgtacct s 874 atgctaaaggacgtcacattgca o 875
tgcaatgtgacgtcctttagcat o
876 gtaggggactttccgagctcgagatcctatg o 877
cataggatctcgagctcggaaagtcccctac o 878 ctgtcaggaactgcaggtaagg o 879
cataacataggaatatttactcctcgc o 880 ctccagctccaagaaaggacg o 881
gaagtttctggtaagtcttcg o 882 tgctgcttttgtgcttttgtgctt s 883
tcgtcgttttgtggttttgtggtt s 884 tcgtcgtttgtcgttttgtcgtt s 885
tcctgacgttcggcgcgcgccc s 886 tgctgcttttgtgcttttgtgctt 887
tccatgagcttcctgagctt s 888 tcgtcgtttcgtcgttttgacgtt s 889
tcgtcgtttgcgtgcgtttcgtcgtt s 890 tcgcgtgcgttttgtcgttttgacgtt s 891
ttcgtcgttttgtcgttttgtcgtt s 892 tcctgacggggaagt s 893
tcctggcgtggaagt s 894 tcctggcggtgaagt s 895 tcctggcgttgaagt s 896
tcctgacgtggaagt s 897 gcgacgttcggcgcgcgccc s 898
gcgacgggcggcgcgcgccc s 899 gcggcgtgcggcgcgcgccc s 900
gcggcggtcggcgcgcgccc s 901 gcgacggtcggcgcgcgccc s 902
gcggcgttcggcgcgcgccc s 903 gcgacgtgcggcgcgcgccc s 904
tcgtcgctgtctccg s 905 tgtgggggttttggttttgg s 906
aggggaggggaggggagggg s 907 tgtgtgtgtgtgtgtgtgtgt s 908
ctctctctctctctctctctct chimeric 909 ggggtcgacgtcgagggggg s 910
atatatatatatatatatatat s 911 ttttttttttttttttttttttttttt s 912
ttttttttttttttttttttt s 913 tttttttttttttttttt s 914
gctagaggggagggt 915 gctagatgttagggg 916 gcatgagggggagct 917
atggaaggtccagggggctc 918 atggactctggagggggctc 919
atggaaggtccaaggggctc 920 gagaaggggggaccttggat 921
gagaaggggggaccttccat 922 gagaaggggccagcactgat 923
tccatgtggggcctgatgct 924 tccatgaggggcctgatgct 925
tccatgtggggcctgctgat 926 atggactctccggggttctc 927
atggaaggtccggggttctc 928 atggactctggaggggtctc 929
atggaggctccatggggctc 930 atggactctggggggttctc 931
tccatgtgggtggggatgct 932 tccatgcgggtggggatgct 933
tccatgggggtcctgatgct 934 tccatggggtccctgatgct 935
tccatggggtgcctgatgct 936 tccatggggttcctgatgct 937
tccatcgggggcctgatgct 938 gctagagggagtgt 939 tttttttttttttttttt s
940 gmggtcaacgttgagggmggg s 941 ggggagttcgttgaggggggg s 942
tcgtcgtttccccccccccc s 943 ttggggggttttttttttttttttt s 944
tttaaattttaaaatttaaaata s 945 ttggtttttttggtttttttttgg s 946
tttcccttttccccttttcccctc s 947 ggggtcatcgatgagggggg s sos 948
tccatgacgttcctgacgtt 949 tccatgacgttcctgacgtt 950
tccatgacgttcctgacgtt 951 tccatgacgttcctgacgtt 952
tccatgacgttcctgacgtt 953 tccatgacgttcctgacgtt 954
tccatgacgttcctgacgtt 955 tccatgacgttcctgacgtt 956
tccatgacgttcctgacgtt 957 tccatgacgttcctgacgtt 958
tccatgacgttcctgacgtt 959 gggggacgatcgtcggggg sos 960
gggggtcgtacgacgggggg sos 961 tttttttttttttttttttttttt po 962
aaaaaaaaaaaaaaaaaaaaaaaa po 963 cccccccccccccccccccccccc po 964
tcgtcgttttgtcgttttgtcgtt 965 tcgtcgttttgtcgttttgtcgtt 966
tcgtcgttttgtcgttttgtcgtt 967 tcgtcgttttgtcgttttgtcgtt 968
ggggtcaacgttgagggggg 969 ggggtcaacgttgagggggg 970
ggggtcaagcttgagggggg 971 tgctgcttcccccccccccc 972
ggggacgtcgacgtgggggg sos 973 ggggtcgtcgacgagggggg sos 974
ggggtcgacgtacgtcgagggggg sos 975 ggggaccggtaccggtgggggg sos 976
gggtcgacgtcgagggggg sos 977 ggggtcgacgtcgaggggg sos 978
ggggaacgttaacgttgggggg sos 979 ggggtcaccggtgagggggg sos 980
ggggtcgttcgaacgagggggg sos 981 ggggacgttcgaacgtgggggg sos 982
tcaactttga s 983 tcaagcttga s 984 tcacgatcgtga s 985 tcagcatgctga s
986 gggggagcatgctggggggg sos 987 gggggggggggggggggggg sos 988
gggggacgatatcgtcgggggg sos 989 gggggacgacgtcgtcgggggg sos 990
gggggacgagctcgtcgggggg sos 991 gggggacgtacgtcgggggg sos 992
tcaacgtt 993 tccataccggtcctgatgct 994 tccataccggtcctaccggt s 995
gggggacgatcgttgggggg sos 996 ggggaacgatcgtcgggggg sos 997 ggg ggg
acg atc gtc ggg ggg sos 998 ggg gga cga tcg tcg ggg ggg sos 999 aaa
gac gtt aaa po 1000 aaagagcttaaa po
1001 aaagazgttaaa po 1002 aaattcggaaaa po 1003
gggggtcatcgatgagggggg sos 1004 gggggtcaacgttgagggggg sos 1005
atgtagcttaataacaaagc po 1006 ggatcccttgagttacttct po 1007
ccattccacttctgattacc po 1008 tatgtattatcatgtagata po 1009
agcctacgtattcaccctcc po 1010 ttcctgcaactactattgta po 1011
atagaaggccctacaccagt po 1012 ttacaccggtctatggaggt po 1013
ctaaccagatcaagtctagg po 1014 cctagacttgatctggttag po 1015
tataagcctcgtccgacatg po 1016 catgtcggacgaggcttata po 1017
tggtggtggggagtaagctc po 1018 gagctactcccccaccacca po 1019
gccttcgatcttcgttggga po 1020 tggacttctctttgccgtct po 1021
atgctgtagcccagcgataa po 1022 accgaatcagcggaaagtga po 1023
tccatgacgttcctgacgtt 1024 ggagaaacccatgagctcatctgg 1025
accacagaccagcaggcaga 1026 gagcgtgaactgcgcgaaga 1027
tcggtacccttgcagcggtt 1028 ctggagccctagccaaggat 1029
gcgactccatcaccagcgat 1030 cctgaagtaagaaccagatgt 1031
ctgtgttatctgacatacacc 1032 aattagccttaggtgattggg 1033
acatctggttcttacttcagg 1034 ataagtcatattttgggaactac 1035
cccaatcacctaaggctaatt 1036 ggggtcgtcgacgagggggg sos 1037
ggggtcgttcgaacgagggggg sos 1038 ggggacgttcgaacgtgggggg sos 1039
tcctggcggggaagt s 1040 ggggaacgacgtcgttgggggg sos 1041
ggggaacgtacgtcgggggg sos 1042 ggggaacgtacgtacgttgggggg sos 1043
ggggtcaccggtgagggggg sos 1044 ggggtcgacgtacgtcgagggggg sos 1045
ggggaccggtaccggtgggggg sos 1046 gggtcgacgtcgagggggg sos 1047
ggggtcgacgtcgagggg sos 1048 ggggaacgttaacgttgggggg sos 1049
ggggacgtcgacgtggggg sos 1050 gcactcttcgaagctacagccggcagcctctgat
1051 cggctcttccatgaggtctttgctaatcttgg 1052
cggctcttccatgaaagtctttggacgatgtgagc 1053 tcctgcaggttaagt s 1054
gggggtcgttcgttgggggg sos 1055 gggggatgattgttgggggg sos 1056
gggggazgatzgttgggggg sos 1057 gggggagctagcttgggggg sos 1058
ggttcttttggtccttgtct s 1059 ggttcttttggtcctcgtct s 1060
ggttcttttggtccttatct s 1061 ggttcttggtttccttgtct s 1062
tggtcttttggtccttgtct s 1063 ggttcaaatggtccttgtct s 1064
gggtcttttgggccttgtct s 1065 tccaggacttctctcaggtttttt s 1066
tccaaaacttctctcaaatt s 1067 tactacttttatacttttatactt s 1068
tgtgtgtgtgtgtgtgtgtgtgtg s 1069 ttgttgttgttgtttgttgttgttg s 1070
ggctccggggagggaatttttgtctat s 1071 gggacgatcgtcggggggg sos 1072
gggtcgtcgacgaggggggg sos 1073 ggtcgtcgacgaggggggg sos 1074
gggtcgtcgtcgtggggggg sos 1075 ggggacgatcgtcggggggg sos 1076
ggggacgtcgtcgtgggggg sos 1077 ggggtcgacgtcgacgtcgaggggggg sos 1078
ggggaaccgcggttggggggg sos 1079 ggggacgacgtcgtggggggg sos 1080
tcgtcgtcgtcgtcgtggggggg sos 1081 tcctgccggggaagt s 1082
tcctgcaggggaagt s 1083 tcctgaaggggaagt s 1084 tcctggcgggcaagt s
1085 tcctggcgggtaagt s 1086 tcctggcgggaaagt s 1087 tccgggcggggaagt
s 1088 tcggggcggggaagt s 1089 tcccggcggggaagt s 1090
gggggacgttggggg s 1091 ggggttttttttttgggggg sos 1092
ggggccccccccccgggggg sos 1093 ggggttgttgttgttgggggg Sos 1094
tttttttttttttttttttttttttttttt 1095 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
1096 cccccccccccccccccccccccccccccc 1097
cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
[0151] While CpG effects in mice are well characterized,
information regarding the human system is limited. CpG
phosphorothioate oligonucleotides with strong stimulatory activity
in the mouse system show lower activity on human and other
non-rodent immune cells. In the examples the development of a
potent human CpG motif and the characterization of its effects and
mechanisms of action on human primary B-cells is described. DNA
containing this CpG motif strongly stimulated primary human B-cells
to proliferate, to produce IL-6 and to express increased levels of
CD86, CD40, CD54 and MHC II. It increased DNA binding activity of
the transcription factors NF.kappa.B and AP-1, as well as
phosphorylation of the stress activated protein kinases JNK and
p38, and the transcription factor ATF-2. B-cell signaling pathways
activated by CpG DNA were different from those activated by the
B-cell receptor which activated ERK and a different isoform of JNK,
but did not activate p38 and ATF-2. In general the data on CpG
DNA-initiated signal transduction are consistent with those
obtained in mice (Hacker H., Mischak H., Miethke T., Liptay S.,
Schmid R., Sparwasser T., Heeg K., Lipford G. B., and Wagner H.
1998. CpG-DNA-specific activation of antigen-presenting cells
requires stress kinase activity and is preceded by non-specific
endocytosis and endosomal maturation. Embo J 17:6230, Yi A. K., and
Krieg A. M. 1998. Rapid induction of mitogen-activated protein
kinases by immune stimulatory CpG DNA. J Immunol 161:4493).
[0152] The preferred non-rodent motif is 5' TCGTCGTT 3'. Base
exchanges within the most potent 8mer CpG motif (5' TCGTCGTT 3')
diminished the activity of the oligonucleotide. The thymidines at
the 5' and the 3' position of this motif were more important than
the thymidine at the middle position. An adenine or guanosine at
the middle position produced a decrease in the activity.
[0153] Of note, our studies demonstrate that one human CpG motif
within a phosphodiester oligonucleotide (2080) is sufficient to
produce the maximal effect, and that additional CpG motifs (2059)
did not further enhance the activity. The oligonucleotide with the
8mer motif 5' TCG TCG TT 3' (2080) containing two CpG dinucleotides
showed the highest activity in the studies. Replacement of the
bases flanking the two CpG dinucleotides (5' position, middle
position, 3' position) reduced the activity of this sequence. Both
CpG dinucleotides within the 8mer CpG motif were required for the
optimal activity (2108, 2106). Cytidine methylation of the CpG
dinucleotides (2095) abolished the activity of 2080, while
methylation of an unrelated cytidine (2094) did not. The addition
of two CpG motifs into the sequence of 2080 resulting in 2059 did
not further increase the activity of the phosphodiester
oligonucleotide. The sequence of 2080 with a phosphorothioate
backbone (2116) demonstrated less activity, suggesting that
additional CpG motifs are preferred for a potent phosphorothioate
oligonucleotide.
[0154] It has been discovered according to the invention that the
immunostimulatory nucleic acids have dramatic immune stimulatory
effects on human cells such as NK cells, B cells, and DCs in vitro.
It has been demonstrated that that the in vitro assays used herein
predict in vivo effectiveness as a vaccine adjuvant in non-rodent
vertebrates (Example 12), suggesting that immunostimulatory nucleic
acids are effective therapeutic agents for human vaccination,
cancer immunotherapy, asthma immunotherapy, general enhancement of
immune function, enhancement of hematopoietic recovery following
radiation or chemotherapy, and other immune modulatory
applications.
[0155] Thus the immunostimulatory nucleic acids are useful in some
aspects of the invention as a prophylactic vaccine for the
treatment of a subject at risk of developing an infection with an
infectious organism or a cancer in which a specific cancer antigen
has been identified or an allergy or asthma where the allergen or
predisposition to asthma is known. The immunostimulatory nucleic
acids can also be given without the antigen or allergen for shorter
term protection against infection, allergy or cancer, and in this
case repeated doses will allow longer term protection. A subject at
risk as used herein is a subject who has any risk of exposure to an
infection causing pathogen or a cancer or an allergen or a risk of
developing cancer. For instance, a subject at risk may be a subject
who is planning to travel to an area where a particular type of
infectious agent is found or it may be a subject who through
lifestyle or medical procedures is exposed to bodily fluids which
may contain infectious organisms or directly to the organism or
even any subject living in an area where an infectious organism or
an allergen has been identified. Subjects at risk of developing
infection also include general populations to which a medical
agency recommends vaccination with a particular infectious organism
antigen. If the antigen is an allergen and the subject develops
allergic responses to that particular antigen and the subject may
be exposed to the antigen, i.e., during pollen season, then that
subject is at risk of exposure to the antigen. A subject at risk of
developing an allergy to asthma includes those subjects that have
been identified as having an allergy or asthma but that don't have
the active disease during the immunostimulatory nucleic acid
treatment as well as subjects that are considered to be at risk of
developing these diseases because of genetic or environmental
factors.
[0156] A subject at risk of developing a cancer is one who is who
has a high probability of developing cancer. These subjects
include, for instance, subjects having a genetic abnormality, the
presence of which has been demonstrated to have a correlative
relation to a higher likelihood of developing a cancer and subjects
exposed to cancer causing agents such as tobacco, asbestos, or
other chemical toxins, or a subject who has previously been treated
for cancer and is in apparent remission. When a subject at risk of
developing a cancer is treated with an antigen specific for the
type of cancer to which the subject is at risk of developing and a
immunostimulatory nucleic acid, the subject may be able to kill the
cancer cells as they develop. If a tumor begins to form in the
subject, the subject will develop a specific immune response
against the tumor antigen.
[0157] In addition to the use of the immunostimulatory nucleic
acids for prophylactic treatment, the invention also encompasses
the use of the immunostimulatory nucleic acids for the treatment of
a subject having an infection, an allergy, asthma, or a cancer.
[0158] A subject having an infection is a subject that has been
exposed to an infectious pathogen and has acute or chronic
detectable levels of the pathogen in the body. The
immunostimulatory nucleic acids can be used with an antigen to
mount an antigen specific systemic or mucosal immune response that
is capable of reducing the level of or eradicating the infectious
pathogen. An infectious disease, as used herein, is a disease
arising from the presence of a foreign microorganism in the body.
It is particularly important to develop effective vaccine
strategies and treatments to protect the body's mucosal surfaces,
which are the primary site of pathogenic entry.
[0159] A subject having an allergy is a subject that has or is at
risk of developing an allergic reaction in response to an allergen.
An allergy refers to acquired hypersensitivity to a substance
(allergen). Allergic conditions include but are not limited to
eczema, allergic rhinitis or coryza, hay fever, conjunctivitis,
bronchial asthma, urticaria (hives) and food allergies, and other
atopic conditions.
[0160] Currently, allergic diseases are generally treated by the
injection of small doses of antigen followed by subsequent
increasing dosage of antigen. It is believed that this procedure
induces tolerization to the allergen to prevent further allergic
reactions. These methods, however, can take several years to be
effective and are associated with the risk of side effects such as
anaphylactic shock. The methods of the invention avoid these
problems.
[0161] Allergies are generally caused by IgE antibody generation
against harmless allergens. The cytokines that are induced by
systemic or mucosal administration of immunostimulatory nucleic
acids are predominantly of a class called Th1 (examples are IL-12
and IFN-.gamma.) and these induce both humoral and cellular immune
responses. The types of antibodies associated with a Th1 response
are generally more protective because they have high neutralization
and opsonization capabilities. The other major type of immune
response, which is associated with the production of IL-4, IL-5 and
IL-10 cytokines, is termed a Th2 immune response. Th2 responses
involve predominately antibodies and these have less protective
effect against infection and some Th2 isotypes (e.g., IgE) are
associated with allergy. In general, it appears that allergic
diseases are mediated by Th2 type immune responses while Th1
responses provide the best protection against infection, although
excessive Th1 responses are associated with autoimmune disease.
Based on the ability of the immunostimulatory nucleic acids to
shift the immune response in a subject from a Th2 (which is
associated with production of IgE antibodies and allergy) to a Th1
response (which is protective against allergic reactions), an
effective dose for inducing an immune response of a
immunostimulatory nucleic acid can be administered to a subject to
treat or prevent an allergy.
[0162] Thus, the immunostimulatory nucleic acids have significant
therapeutic utility in the treatment of allergic and non-allergic
conditions such as asthma. Th2 cytokines, especially IL-4 and IL-5
are elevated in the airways of asthmatic subjects. These cytokines
promote important aspects of the asthmatic inflammatory response,
including IgE isotope switching, eosinophil chemotaxis and
activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines. Asthma refers to a disorder of the
respiratory system characterized by inflammation, narrowing of the
airways and increased reactivity of the airways to inhaled agents.
Asthma is frequently, although not exclusively associated with
atopic or allergic symptoms.
[0163] A subject having a cancer is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g. small cell and non-small cell); melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer;
prostate cancer; rectal cancer; sarcomas; skin cancer; testicular
cancer; thyroid cancer; and renal cancer, as well as other
carcinomas and sarcomas. In one embodiment the cancer is hairy cell
leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia,
multiple myeloma, follicular lymphoma, malignant melanoma, squamous
cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder
cell carcinoma, or colon carcinoma.
[0164] A subject according to the invention is a non-rodent
subject. A non-rodent subject shall mean a human or vertebrate
animal including but not limited to a dog, cat, horse, cow, pig,
sheep, goat, chicken, primate, e.g., monkey, and fish (aquaculture
species), e.g. salmon, but specifically excluding rodents such as
rats and mice.
[0165] Thus, the invention can also be used to treat cancer and
tumors in non human subjects. Cancer is one of the leading causes
of death in companion animals (i.e., cats and dogs). Cancer usually
strikes older animals which, in the case of house pets, have become
integrated into the family. Forty-five % of dogs older than 10
years of age, are likely to succumb to the disease. The most common
treatment options include surgery, chemotherapy and radiation
therapy. Others treatment modalities which have been used with some
success are laser therapy, cryotherapy, hyperthermia and
immunotherapy. The choice of treatment depends on type of cancer
and degree of dissemination. Unless the malignant growth is
confined to a discrete area in the body, it is difficult to remove
only malignant tissue without also affecting normal cells.
[0166] Malignant disorders commonly diagnosed in dogs and cats
include but are not limited to lymphosarcoma, osteosarcoma, mammary
tumors, mastocytoma, brain tumor, melanoma, adenosquamous
carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar
adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma,
neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma,
Wilm's tumor, Burkitt's lymphoma, microglioma, neuroblastoma,
osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
rhabdomyosarcoma. Other neoplasias in dogs include genital squamous
cell carcinoma, transmissable veneral tumor, testicular tumor,
seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma,
chloroma (granulocytic sarcoma), corneal papilloma, corneal
squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma,
basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma,
oral papillomatosis, hemangioendothelioma and cystadenoma.
Additional malignancies diagnosed in cats include follicular
lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary
squamous cell carcinoma. The ferret, an ever-more popular house pet
is known to develop insulinoma, lymphoma, sarcoma, neuroma,
pancreatic islet cell tumor, gastric MALT lymphoma and gastric
adenocarcinoma.
[0167] Neoplasias affecting agricultural livestock include
leukemia, hemangiopericytoma and bovine ocular neoplasia (in
cattle); preputial fibrosarcoma, ulcerative squamous cell
carcinoma, preputial carcinoma, connective tissue neoplasia and
mastocytoma (in horses); hepatocellular carcinoma (in swine);
lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma,
lymphoma, Rous sarcoma, reticulendotheliosis, fibrosarcoma,
nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian
species); retinoblastoma, hepatic neoplasia, lymphosarcoma
(lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder
sarcoma (in fish), caseous lumphadenitis (CLA): chronic,
infectious, contagious disease of sheep and goats caused by the
bacterium Corynebacterium pseudotuberculosis, and contagious lung
tumor of sheep caused by jaagsiekte.
[0168] The subject is exposed to the antigen. As used herein, the
term exposed to refers to either the active step of contacting the
subject with an antigen or the passive exposure of the subject to
the antigen in vivo. Methods for the active exposure of a subject
to an antigen are well-known in the art. In general, an antigen is
administered directly to the subject by any means such as
intravenous, intramuscular, oral, transdermal, mucosal, intranasal,
intratracheal, or subcutaneous administration. The antigen can be
administered systemically or locally. Methods for administering the
antigen and the immunostimulatory nucleic acid are described in
more detail below. A subject is passively exposed to an antigen if
an antigen becomes available for exposure to the immune cells in
the body. A subject may be passively exposed to an antigen, for
instance, by entry of a foreign pathogen into the body or by the
development of a tumor cell expressing a foreign antigen on its
surface.
[0169] The methods in which a subject is passively exposed to an
antigen can be particularly dependent on timing of administration
of the immunostimulatory nucleic acid. For instance, in a subject
at risk of developing a cancer or an infectious disease or an
allergic or asthmatic response, the subject may be administered the
immunostimulatory nucleic acid on a regular basis when that risk is
greatest, i.e., during allergy season or after exposure to a cancer
causing agent. Additionally the immunostimulatory nucleic acid may
be administered to travelers before they travel to foreign lands
where they are at risk of exposure to infectious agents. Likewise
the immunostimulatory nucleic acid may be administered to soldiers
or civilians at risk of exposure to biowarfare to induce a systemic
or mucosal immune response to the antigen when and if the subject
is exposed to it.
[0170] An antigen as used herein is a molecule capable of provoking
an immune response. Antigens include but are not limited to cells,
cell extracts, proteins, polypeptides, peptides, polysaccharides,
polysaccharide conjugates, peptide and non-peptide mimics of
polysaccharides and other molecules, small molecules, lipids,
glycolipids, carbohydrates, viruses and viral extracts and
multicellular organisms such as parasites and allergens. The term
antigen broadly includes any type of molecule which is recognized
by a host immune system as being foreign. Antigens include but are
not limited to cancer antigens, microbial antigens, and
allergens.
[0171] A cancer antigen as used herein is a compound, such as a
peptide or protein, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen presenting cell in the context of an
MHC molecule. Cancer antigens can be prepared from cancer cells
either by preparing crude extracts of cancer cells, for example, as
described in Cohen, et al., 1994, Cancer Research, 54:1055, by
partially purifying the antigens, by recombinant technology, or by
de novo synthesis of known antigens. Cancer antigens include but
are not limited to antigens that are recombinantly expressed, an
immunogenic portion of, or a whole tumor or cancer. Such antigens
can be isolated or prepared recombinantly or by any other means
known in the art.
[0172] A microbial antigen as used herein is an antigen of a
microorganism and includes but is not limited to virus, bacteria,
parasites, and fungi. Such antigens include the intact
microorganism as well as natural isolates and fragments or
derivatives thereof and also synthetic compounds which are
identical to or similar to natural microorganism antigens and
induce an immune response specific for that microorganism. A
compound is similar to a natural microorganism antigen if it
induces an immune response (humoral and/or cellular) to a natural
microorganism antigen. Such antigens are used routinely in the art
and are well known to those of ordinary skill in the art.
[0173] Examples of viruses that have been found in humans include
but are not limited to: Retroviridae (e.g. human immunodeficiency
viruses, such as HIV-1 (also referred to as HTLV-III, LAV or
HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP;
Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxyiridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and
related viruses, and astroviruses).
[0174] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to, Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to, Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M. avium, M. intracellulare, M. kansaii, M gordonae),
Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
and Actinomyces israelli.
[0175] Examples of fungi include Cryptococcus neoformans,
Histoplasma capsulatum, Coccidioides immitis, Blastomyces
dermatitidis, Chlamydia trachomatis, Candida albicans.
[0176] Other infectious organisms (i.e., protists) include
Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae,
Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii.
Blood-borne and/or tissues parasites include Plasmodium spp.,
Babesia microti, Babesia divergens, Leishmania tropica, Leishmania
spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma
gambiense and Trypanosoma rhodesiense (African sleeping sickness),
Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
[0177] Other medically relevant microorganisms have been described
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0178] Although many of the microbial antigens described above
relate to human disorders, the invention is also useful for
treating other nonhuman vertebrates. Nonhuman vertebrates are also
capable of developing infections which can be prevented or treated
with the Immunostimulatory nucleic acids disclosed herein. For
instance, in addition to the treatment of infectious human
diseases, the methods of the invention are useful for treating
infections of animals.
[0179] As used herein, the term treat, treated, or treating when
used with respect to an infectious disease refers to a prophylactic
treatment which increases the resistance of a subject (a subject at
risk of infection) to infection with a pathogen or, in other words,
decreases the likelihood that the subject will become infected with
the pathogen as well as a treatment after the subject (a subject
who has been infected) has become infected in order to fight the
infection, e.g., reduce or eliminate the infection or prevent it
from becoming worse.
[0180] Many vaccines for the treatment of non-human vertebrates are
disclosed in Bennett, K. Compendium of Veterinary Products, 3rd ed.
North American Compendiums, Inc., 1995. As discussed above,
antigens include infectious microbes such as virus, parasite,
bacteria and fungi and fragments thereof, derived from natural
sources or synthetically. Infectious viruses of both human and
non-human vertebrates, include retroviruses, RNA viruses and DNA
viruses. This group of retroviruses includes both simple
retroviruses and complex retroviruses. The simple retroviruses
include the subgroups of B-type retroviruses, C-type retroviruses
and D-type retroviruses. An example of a B-type retrovirus is mouse
mammary tumor virus (MMTV). The C-type retroviruses include
subgroups C-type group A (including Rous sarcoma virus (RSV), avian
leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and
C-type group B (including feline leukemia virus (FeLV), gibbon ape
leukemia virus (GALV), spleen necrosis virus (SNV),
reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)).
The D-type retroviruses include Mason-Pfizer monkey virus (MPMV)
and simian retrovirus type 1 (SRV-1). The complex retroviruses
include the subgroups of lentiviruses, T-cell leukemia viruses and
the foamy viruses. Lentiviruses include HIV-1, but also include
HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and
equine infectious anemia virus (EIAV). The T-cell leukemia viruses
include HTLV-1, HTLV-II, simian T-cell leukemia virus (STLV), and
bovine leukemia virus (BLV). The foamy viruses include human foamy
virus (HFV), simian foamy virus (SFV) and bovine foamy virus
(BFV).
[0181] Examples of other RNA viruses that are antigens in
vertebrate animals include, but are not limited to, members of the
family Reoviridae, including the genus Orthoreovirus (multiple
serotypes of both mammalian and avian retroviruses), the genus
Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus,
African horse sickness virus, and Colorado Tick Fever virus), the
genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus,
simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the
family Picornaviridae, including the genus Enterovirus (poliovirus,
Coxsackie virus A and B, enteric cytopathic human orphan (ECHO)
viruses, hepatitis A virus, Simian enteroviruses, Murine
encephalomyelitis (ME) viruses, Poliovirus muris, Bovine
enteroviruses, Porcine enteroviruses, the genus Cardiovirus
(Encephalomyocarditis virus (EMC), Mengovirus), the genus
Rhinovirus (Human rhinoviruses including at least 113 subtypes;
other rhinoviruses), the genus Apthovirus (Foot and Mouth disease
(FMDV); the family Calciviridae, including Vesicular exanthema of
swine virus, San Miguel sea lion virus, Feline picornavirus and
Norwalk virus; the family Togaviridae, including the genus
Alphavirus (Eastern equine encephalitis virus, Semliki forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavirius (Mosquito borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine Influenza viruses;
influenza type B (many human subtypes), and influenza type C
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia
virus); the family Rhabdoviridae, including the genus Vesiculovirus
(VSV), Chandipura virus, Flanders-Hart Park virus), the genus
Lyssavirus (Rabies virus), fish Rhabdoviruses, and two probable
Rhabdoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Hepatitis virus, Human
enteric corona virus, and Feline infectious peritonitis (Feline
coronavirus).
[0182] Illustrative DNA viruses that are antigens in vertebrate
animals include, but are not limited to, the family Poxyiridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox,
goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Iridoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine and monkeys); the gamma-herpesviruses
(Epstein-Barr virus (EBV), Marek's disease virus, Herpes saimiri,
Herpesvirus ateles, Herpesvirus sylvilagus, guinea pig herpes
virus, Lucke tumor virus); the family Adenoviridae, including the
genus Mastadenovirus (Human subgroups A,B,C,D,E and ungrouped;
simian adenoviruses (at least 23 serotypes), infectious canine
hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many
other species, the genus Aviadenovirus (Avian adenoviruses); and
non-cultivatable adenoviruses; the family Papoviridae, including
the genus Papillomavirus (Human papilloma viruses, bovine papilloma
viruses, Shope rabbit papilloma virus, and various pathogenic
papilloma viruses of other species), the genus Polyomavirus
(polyomavirus, Simian vacuolating agent (SV-40), Rabbit vacuolating
agent (RKV), K virus, BK virus, JC virus, and other primate polyoma
viruses such as Lymphotrophic papilloma virus); the family
Parvoviridae including the genus Adeno-associated viruses, the
genus Parvovirus (Feline panleukopenia virus, bovine parvovirus,
canine parvovirus, Aleutian mink disease virus, etc). Finally, DNA
viruses may include viruses which do not fit into the above
families such as Kuru and Creutzfeldt-Jacob disease viruses and
chronic infectious neuropathic agents (CHINA virus).
[0183] Each of the foregoing lists is illustrative, and is not
intended to be limiting.
[0184] In addition to the use of the immunostimulatory nucleic
acids to induce an antigen specific immune response in humans, the
methods of the preferred embodiments are particularly well suited
for treatment of birds such as hens, chickens, turkeys, ducks,
geese, quail, and pheasant. Birds are prime targets for many types
of infections.
[0185] Hatching birds are exposed to pathogenic microorganisms
shortly after birth. Although these birds are initially protected
against pathogens by maternal derived antibodies, this protection
is only temporary, and the bird's own immature immune system must
begin to protect the bird against the pathogens. It is often
desirable to prevent infection in young birds when they are most
susceptible. It is also desirable to prevent against infection in
older birds, especially when the birds are housed in closed
quarters, leading to the rapid spread of disease. Thus, it is
desirable to administer the Immunostimulatory nucleic acid and the
non-nucleic acid adjuvant of the invention to birds to enhance an
antigen-specific immune response when antigen is present.
[0186] An example of a common infection in chickens is chicken
infectious anemia virus (CIAV). CIAV was first isolated in Japan in
1979 during an investigation of a Marek's disease vaccination break
(Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV
has been detected in commercial poultry in all major poultry
producing countries (van Bulow et al., 1991, pp. 690-699) in
Diseases of Poultry, 9th edition, Iowa State University Press).
[0187] CIAV infection results in a clinical disease, characterized
by anemia, hemorrhage and immunosuppression, in young susceptible
chickens. Atrophy of the thymus and of the bone marrow and
consistent lesions of CIAV-infected chickens are also
characteristic of CIAV infection. Lymphocyte depletion in the
thymus, and occasionally in the bursa of Fabricius, results in
immunosuppression and increased susceptibility to secondary viral,
bacterial, or fungal infections which then complicate the course of
the disease. The immunosuppression may cause aggravated disease
after infection with one or more of Marek's disease virus (MDV),
infectious bursal disease virus, reticuloendotheliosis virus,
adenovirus, or reovirus. It has been reported that pathogenesis of
MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In Proceedings
of the 38th Western Poultry Diseases Conference, Tempe, Ariz.).
Further, it has been reported that CIAV aggravates the signs of
infectious bursal disease (Rosenberger et al., 1989, Avian Dis.
33:707-713). Chickens develop an age resistance to experimentally
induced disease due to CAA. This is essentially complete by the age
of 2 weeks, but older birds are still susceptible to infection
(Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24,
202-209, 1980). However, if chickens are dually infected with CAA
and an immunosuppressive agent (IBDV, MDV etc.), age resistance
against the disease is delayed (Yuasa, N. et al., 1979 and 1980
supra; Bulow von V. et al., J. Veterinary Medicine 33, 93-116,
1986). Characteristics of CIAV that may potentiate disease
transmission include high resistance to environmental inactivation
and some common disinfectants. The economic impact of CIAV
infection on the poultry industry is clear from the fact that 10%
to 30% of infected birds in disease outbreaks die.
[0188] Vaccination of birds, like other vertebrate animals can be
performed at any age. Normally, vaccinations are performed at up to
12 weeks of age for a live microorganism and between 14-18 weeks
for an inactivated microorganism or other type of vaccine. For in
ovo vaccination, vaccination can be performed in the last quarter
of embryo development. The vaccine may be administered
subcutaneously, by spray, orally, intraocularly, intratracheally,
nasally, or by other mucosal delivery methods described herein.
Thus, the immunostimulatory nucleic acids of the invention can be
administered to birds and other non-human vertebrates using routine
vaccination schedules and the antigen can be administered after an
appropriate time period as described herein.
[0189] Cattle and livestock are also susceptible to infection.
Diseases which affect these animals can produce severe economic
losses, especially amongst cattle. The methods of the invention can
be used to protect against infection in livestock, such as cows,
horses, pigs, sheep, and goats.
[0190] Cows can be infected by bovine viruses. Bovine viral
diarrhea virus (BVDV) is a small enveloped positive-stranded RNA
virus and is classified, along with hog cholera virus (HOCV) and
sheep border disease virus (BDV), in the pestivirus genus.
Although, Pestiviruses were previously classified in the
Togaviridae family, some studies have suggested their
reclassification within the Flaviviridae family along with the
flavivirus and hepatitis C virus (HCV) groups (Francki, et al.,
1991).
[0191] BVDV, which is an important pathogen of cattle can be
distinguished, based on cell culture analysis, into cytopathogenic
(CP) and noncytopathogenic (NCP) biotypes. The NCP biotype is more
widespread although both biotypes can be found in cattle. If a
pregnant cow becomes infected with an NCP strain, the cow can give
birth to a persistently infected and specifically immunotolerant
calf that will spread virus during its lifetime. The persistently
infected cattle can succumb to mucosal disease and both biotypes
can then be isolated from the animal. Clinical manifestations can
include abortion, teratogenesis, and respiratory problems, mucosal
disease and mild diarrhea. In addition, severe thrombocytopenia,
associated with herd epidemics, that may result in the death of the
animal has been described and strains associated with this disease
seem more virulent than the classical BVDVs.
[0192] Equine herpes viruses (EHV) comprise a group of
antigenically distinct biological agents which cause a variety of
infections in horses ranging from subclinical to fatal disease.
These include Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen
in horses. EHV-1 is associated with epidemics of abortion,
respiratory tract disease, and central nervous system disorders.
Primary infection of upper respiratory tract of young horses
results in a febrile illness which lasts for 8 to 10 days.
Immunologically experienced mares may be re-infected via the
respiratory tract without disease becoming apparent, so that
abortion usually occurs without warning. The neurological syndrome
is associated with respiratory disease or abortion and can affect
animals of either sex at any age, leading to lack of co-ordination,
weakness and posterior paralysis (Telford, E. A. R. et al.,
Virology 189, 304-316, 1992). Other EHV's include EHV-2, or equine
cytomegalovirus, EHV-3, equine coital exanthema virus, and EHV-4,
previously classified as EHV-1 subtype 2.
[0193] Sheep and goats can be infected by a variety of dangerous
microorganisms including visna-maedi.
[0194] Primates such as monkeys, apes and macaques can be infected
by simian immunodeficiency virus. Inactivated cell-virus and
cell-free whole simian immunodeficiency vaccines have been reported
to afford protection in macaques (Stott et al. (1990) Lancet
36:1538-1541; Desrosiers et al. PNAS USA (1989) 86:6353-6357;
Murphey-Corb et al. (1989) Science 246:1293-1297; and Carlson et
al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). A recombinant
HIV gp120 vaccine has been reported to afford protection in
chimpanzees (Berman et al. (1990) Nature 345:622-625).
[0195] Cats, both domestic and wild, are susceptible to infection
with a variety of microorganisms. For instance, feline infectious
peritonitis is a disease which occurs in both domestic and wild
cats, such as lions, leopards, cheetahs, and jaguars. When it is
desirable to prevent infection with this and other types of
pathogenic organisms in cats, the methods of the invention can be
used to vaccinate cats to protect them against infection.
[0196] Domestic cats may become infected with several retroviruses,
including but not limited to feline leukemia virus (FeLV), feline
sarcoma virus (FeSV), endogenous type Concomavirus (RD-114), and
feline syncytia-forming virus (FeSFV). Of these, FeLV is the most
significant pathogen, causing diverse symptoms, including
lymphoreticular and myeloid neoplasms, anemias, immune mediated
disorders, and an immunodeficiency syndrome which is similar to
human acquired immune deficiency syndrome (AIDS). Recently, a
particular replication-defective FeLV mutant, designated FeLV-AIDS,
has been more particularly associated with immunosuppressive
properties.
[0197] The discovery of feline T-lymphotropic lentivirus (also
referred to as feline immunodeficiency) was first reported in
Pedersen et al. (1987) Science 235:790-793. Characteristics of FIV
have been reported in Yamamoto et al. (1988) Leukemia, December
Supplement 2:204S-215S; Yamamoto et al. (1988) Am. J. Vet. Res.
49:1246-1258; and Ackley et al. (1990) J. Virol. 64:5652-5655.
Cloning and sequence analysis of FIV have been reported in Olmsted
et al. (1989) Proc. Natl. Acad. Sci. USA 86:2448-2452 and
86:4355-4360.
[0198] Feline infectious peritonitis (FIP) is a sporadic disease
occurring unpredictably in domestic and wild Felidae. While FIP is
primarily a disease of domestic cats, it has been diagnosed in
lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller
wild cats that have been afflicted with FIP include the lynx and
caracal, sand cat, and pallas cat. In domestic cats, the disease
occurs predominantly in young animals, although cats of all ages
are susceptible. A peak incidence occurs between 6 and 12 months of
age. A decline in incidence is noted from 5 to 13 years of age,
followed by an increased incidence in cats 14 to 15 years old.
[0199] Viral, bacterial, and parasitic diseases in fin-fish,
shellfish or other aquatic life forms pose a serious problem for
the aquaculture industry. Owing to the high density of animals in
the hatchery tanks or enclosed marine farming areas, infectious
diseases may eradicate a large proportion of the stock in, for
example, a fin-fish, shellfish, or other aquatic life forms
facility. Prevention of disease is a more desired remedy to these
threats to fish than intervention once the disease is in progress.
Vaccination of fish is the only preventative method which may offer
long-term protection through immunity. Nucleic acid based
vaccinations are described in U.S. Pat. No. 5,780,448 issued to
Davis.
[0200] The fish immune system has many features similar to the
mammalian immune system, such as the presence of B cells, T cells,
lymphokines, complement, and immunoglobulins. Fish have lymphocyte
subclasses with roles that appear similar in many respects to those
of the B and T cells of mammals. Vaccines can be administered by
immersion or orally.
[0201] Aquaculture species include but are not limited to fin-fish,
shellfish, and other aquatic animals. Fin-fish include all
vertebrate fish, which may be bony or cartilaginous fish, such as,
for example, salmonids, carp, catfish, yellowtail, seabream, and
seabass. Salmonids are a family of fin-fish which include trout
(including rainbow trout), salmon, and Arctic char. Examples of
shellfish include, but are not limited to, clams, lobster, shrimp,
crab, and oysters. Other cultured aquatic animals include, but are
not limited to eels, squid, and octopi.
[0202] Polypeptides of viral aquaculture pathogens include but are
not limited to glycoprotein (G) or nucleoprotein (N) of viral
hemorrhagic septicemia virus (VHSV); G or N proteins of infectious
hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural
proteins of infectious pancreatic necrosis virus (IPNV); G protein
of spring viremia of carp (SVC); and a membrane-associated protein,
tegumin or capsid protein or glycoprotein of channel catfish virus
(CCV).
[0203] Typical parasites infecting horses are Gasterophilus spp.;
Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babesia spp.
(RBC's), Theileria equi; Trypanosoma spp.; Klossiella equi;
Sarcocystis spp.
[0204] Typical parasites infecting swine include Eimeria bebliecki,
Eimeria scabra, Isospora suis, Giardia spp.; Balantidium coli,
Entamoeba histolytica; Toxoplasma gondii and Sarcocystis spp., and
Trichinella spiralis.
[0205] The major parasites of dairy and beef cattle include Eimeria
spp., Cryptosporidium sp., Giardia spp., Toxoplasma gondii; Babesia
bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (plasma),
Theileria spp. (RBC); Theileriaparva (lymphocytes);
Tritrichomonasfoetus; and Sarcocystis spp.
[0206] The major parasites of raptors include Trichomonas gallinae;
Coccidia (Eimeria spp.); Plasmodium relictum, Leucocytozoon
danilewskyi (owls), Haemoproteus spp., Trypanosoma spp.;
Histomonas; Cryptosporidium meleagridis, Cryptosporidium baileyi,
Giardia, Eimeria; Toxoplasma.
[0207] Typical parasites infecting sheep and goats include Eimeria
spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia
spp. (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); and
Sarcocystis spp.
[0208] Typical parasitic infections in poultry include coccidiosis
caused by Eimeria acervulina, E. necatrix, E. tenella, Isospora
spp. and Eimeria truncata; histomoniasis, caused by Histomonas
meleagridis and Histomonas gallinarum; trichomoniasis caused by
Trichomonas gallinae; and hexamitiasis caused by Hexamita
meleagridis. Poultry can also be infected Emeria maxima, Emeria
meleagridis, Eimeria adenoeides, Eimeria meleagrimitis,
Cryptosporidium, Eimeria brunetti, Emeria adenoeides, Leucocytozoon
spp., Plasmodium spp., Hemoproteus meleagridis, Toxoplasma gondii
and Sarcocystis.
[0209] The methods of the invention can also be applied to the
treatment and/or prevention of parasitic infection in dogs, cats,
birds, fish and ferrets. Typical parasites of birds include
Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia;
Cryptosporidium; Sarcocystis spp., Toxoplasma gondii,
Haemoproteus/Parahaemoproteus, Plasmodium spp.,
Leucocytozoon/Akiba, Atoxoplasma, Trypanosoma spp. Typical
parasites infecting dogs include Trichinella spiralis, Isopora
spp., Sarcocystis spp., Cryptosporidium spp., Hammondia spp.,
Giardia duodenalis (canis); Balantidium coli, Entamoeba
histolytica; Hepatozoon canis; Toxoplasma gondii, Trypanosoma
cruzi; Babesia canis, Leishmania amastigotes, Neospora caninum.
[0210] Typical parasites infecting feline species include Isospora
spp., Toxoplasma gondii, Sarcocystis spp., Hammondia hammondi,
Besnoitia spp., Giardia spp.; Entamoeba histolytica; Hepatozoon
canis, Cytauxzoon sp., Cytauxzoon sp., Cytauxzoon sp. (red cells,
RE cells).
[0211] Typical parasites infecting fish include Hexamita spp.,
Eimeria spp.; Cryptobia spp., Nosema spp., Myxosoma spp.,
Chilodonella spp., Trichodina spp.; Plistophora spp., Myxosoma
Henneguya; Costia spp., Ichthyophithirius spp., and Oodinium
spp.
[0212] Typical parasites of wild mammals include Giardia spp.
(carnivores, herbivores), Isospora spp. (carnivores), Eimeria spp.
(carnivores, herbivores); Theileria spp. (herbivores), Babesia spp.
(carnivores, herbivores), Trypanosoma spp. (carnivores,
herbivores); Schistosoma spp. (herbivores); Fasciola hepatica
(herbivores), Fascioloides magna (herbivores), Fasciola gigantica
(herbivores), Trichinella spiralis (carnivores, herbivores).
[0213] Parasitic infections in zoos can also pose serious problems.
Typical parasites of the bovidae family (blesbok, antelope,
banteng, eland, gaur, impala, klipspringer, kudu, gazelle) include
Eimeria spp. Typical parasites in the pinnipedae family (seal, sea
lion) include Eimeriaphocae. Typical parasites in the camelidae
family (camels, llamas) include Eimeria spp. Typical parasites of
the giraffidae family (giraffes) include Eimeria spp. Typical
parasites in the elephantidae family (African and Asian) include
Fasciola spp. Typical parasites of lower primates (chimpanzees,
orangutans, apes, baboons, macaques, monkeys) include Giardia sp.;
Balantidium coli, Entamoeba histolytica, Sarcocystis spp.,
Toxoplasma gondii; Plasmodim spp. (RBC), Babesia spp. (RBC),
Trypanosoma spp. (plasma), Leishmania spp. (macrophages).
[0214] Polypeptides of bacterial pathogens include but are not
limited to an iron-regulated outer membrane protein, (IROMP), an
outer membrane protein (OMP), and an A-protein of Aeromonis
salmonicida which causes furunculosis, p57 protein of Renibacterium
salmoninarum which causes bacterial kidney disease (BKD), major
surface associated antigen (msa), a surface expressed cytotoxin
(mpr), a surface expressed hemolysin (ish), and a flagellar antigen
of Yersiniosis; an extracellular protein (ECP), an iron-regulated
outer membrane protein (IROMP), and a structural protein of
Pasteurellosis; an OMP and a flagellar protein of Vibrosis
anguillarum and V. ordalii; a flagellar protein, an OMP protein,
aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and
surface antigen of Ichthyophthirius; and a structural and
regulatory protein of Cytophaga columnari; and a structural and
regulatory protein of Rickettsia.
[0215] Polypeptides of a parasitic pathogen include but are not
limited to the surface antigens of Ichthyophthirius.
[0216] An allergen refers to a substance (antigen) that can induce
an allergic or asthmatic response in a susceptible subject. The
list of allergens is enormous and can include pollens, insect
venoms, animal dander dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poapratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis).
[0217] The antigen may be an antigen that is encoded by a nucleic
acid vector or it may be not encoded in a nucleic acid vector. In
the former case the nucleic acid vector is administered to the
subject and the antigen is expressed in vivo. In the latter case
the antigen may be administered directly to the subject. An antigen
not encoded in a nucleic acid vector as used herein refers to any
type of antigen that is not a nucleic acid. For instance, in some
aspects of the invention the antigen not encoded in a nucleic acid
vector is a polypeptide. Minor modifications of the primary amino
acid sequences of polypeptide antigens may also result in a
polypeptide which has substantially equivalent antigenic activity
as compared to the unmodified counterpart polypeptide. Such
modifications may be deliberate, as by site-directed mutagenesis,
or may be spontaneous. All of the polypeptides produced by these
modifications are included herein as long as antigenicity still
exists. The polypeptide may be, for example, a viral
polypeptide.
[0218] The term substantially purified as used herein refers to a
polypeptide which is substantially free of other proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify viral or bacterial
polypeptides using standard techniques for protein purification.
The substantially pure polypeptide will often yield a single major
band on a non-reducing polyacrylamide gel. In the case of partially
glycosylated polypeptides or those that have several start codons,
there may be several bands on a non-reducing polyacrylamide gel,
but these will form a distinctive pattern for that polypeptide. The
purity of the viral or bacterial polypeptide can also be determined
by amino-terminal amino acid sequence analysis. Other types of
antigens not encoded by a nucleic acid vector such as
polysaccharides, small molecule, mimics etc are described above,
and included within the invention.
[0219] The invention also utilizes polynucleotides encoding the
antigenic polypeptides. It is envisioned that the antigen may be
delivered to the subject in a nucleic acid molecule which encodes
for the antigen such that the antigen must be expressed in vivo.
Such antigens delivered to the subject in a nucleic acid vector are
referred to as antigens encoded by a nucleic acid vector. The
nucleic acid encoding the antigen is operatively linked to a gene
expression sequence which directs the expression of the antigen
nucleic acid within a eukaryotic cell. The gene expression sequence
is any regulatory nucleotide sequence, such as a promoter sequence
or promoter-enhancer combination, which facilitates the efficient
transcription and translation of the antigen nucleic acid to which
it is operatively linked. The gene expression sequence may, for
example, be a mammalian or viral promoter, such as a constitutive
or inducible promoter. Constitutive mammalian promoters include,
but are not limited to, the promoters for the following genes:
hypoxanthine phosphoribosyl transferase (HPTR), adenosine
deaminase, pyruvate kinase, b-actin promoter and other constitutive
promoters. Exemplary viral promoters which function constitutively
in eukaryotic cells include, for example, promoters from the
cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus,
adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus,
cytomegalovirus, the long terminal repeats (LTR) of Moloney
leukemia virus and other retroviruses, and the thymidine kinase
promoter of herpes simplex virus. Other constitutive promoters are
known to those of ordinary skill in the art. The promoters useful
as gene expression sequences of the invention also include
inducible promoters. Inducible promoters are expressed in the
presence of an inducing agent. For example, the metallothionein
promoter is induced to promote transcription and translation in the
presence of certain metal ions. Other inducible promoters are known
to those of ordinary skill in the art.
[0220] In general, the gene expression sequence shall include, as
necessary, 5' non-transcribing and 5' non-translating sequences
involved with the initiation of transcription and translation,
respectively, such as a TATA box, capping sequence, CAAT sequence,
and the like. Especially, such 5' non-transcribing sequences will
include a promoter region which includes a promoter sequence for
transcriptional control of the operably joined antigen nucleic
acid. The gene expression sequences optionally include enhancer
sequences or upstream activator sequences as desired.
[0221] The antigen nucleic acid is operatively linked to the gene
expression sequence. As used herein, the antigen nucleic acid
sequence and the gene expression sequence are said to be operably
linked when they are covalently linked in such a way as to place
the expression or transcription and/or translation of the antigen
coding sequence under the influence or control of the gene
expression sequence. Two DNA sequences are said to be operably
linked if induction of a promoter in the 5' gene expression
sequence results in the transcription of the antigen sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the antigen sequence, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a gene expression sequence would be operably linked
to an antigen nucleic acid sequence if the gene expression sequence
were capable of effecting transcription of that antigen nucleic
acid sequence such that the resulting transcript is translated into
the desired protein or polypeptide.
[0222] The antigen nucleic acid of the invention may be delivered
to the immune system alone or in association with a vector. In its
broadest sense, a vector is any vehicle capable of facilitating the
transfer of the antigen nucleic acid to the cells of the immune
system so that the antigen can be expressed and presented on the
surface of the immune cell. The vector generally transports the
nucleic acid to the immune cells with reduced degradation relative
to the extent of degradation that would result in the absence of
the vector. The vector optionally includes the above-described gene
expression sequence to enhance expression of the antigen nucleic
acid in immune cells. In general, the vectors useful in the
invention include, but are not limited to, plasmids, phagemids,
viruses, other vehicles derived from viral or bacterial sources
that have been manipulated by the insertion or incorporation of the
antigen nucleic acid sequences. Viral vectors are a preferred type
of vector and include, but are not limited to, nucleic acid
sequences from the following viruses: retrovirus, such as Moloney
murine leukemia virus, Harvey murine sarcoma virus, murine mammary
tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated
virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses;
papilloma viruses; herpes virus; vaccinia virus; polio virus; and
RNA virus such as a retrovirus. One can readily employ other
vectors not named but known in the art.
[0223] Preferred viral vectors are based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with the gene of interest. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. Retroviruses have been
approved for human gene therapy trials. Most useful are those
retroviruses that are replication-deficient (i.e., capable of
directing synthesis of the desired proteins, but incapable of
manufacturing an infectious particle). Such genetically altered
retroviral expression vectors have general utility for the
high-efficiency transduction of genes in vivo. Standard protocols
for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a
plasmid, transfection of a packaging cell lined with plasmid,
production of recombinant retroviruses by the packaging cell line,
collection of viral particles from tissue culture media, and
infection of the target cells with viral particles) are provided in
Kriegler, M., Gene Transfer and Expression, A Laboratory Manual
W.H. Freeman C.O., New York (1990) and Murry, E. J. Methods in
Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, N.J.
(1991).
[0224] A preferred virus for certain applications is the
adeno-associated virus, a double-stranded DNA virus. The
adeno-associated virus can be engineered to be
replication-deficient and is capable of infecting a wide range of
cell types and species. It further has advantages such as, heat and
lipid solvent stability; high transduction frequencies in cells of
diverse lineages, including hemopoietic cells; and lack of
superinfection inhibition thus allowing multiple series of
transductions. Reportedly, the adeno-associated virus can integrate
into human cellular DNA in a site-specific manner, thereby
minimizing the possibility of insertional mutagenesis and
variability of inserted gene expression characteristic of
retroviral infection. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than
100 passages in the absence of selective pressure, implying that
the adeno-associated virus genomic integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
[0225] Other vectors include plasmid vectors. Plasmid vectors have
been extensively described in the art and are well-known to those
of skill in the art. See e.g., Sambrook et al., Molecular Cloning:
A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory
Press, 1989. In the last few years, plasmid vectors have been found
to be particularly advantageous for delivering genes to cells in
vivo because of their inability to replicate within and integrate
into a host genome. These plasmids, however, having a promoter
compatible with the host cell, can express a peptide from a gene
operatively encoded within the plasmid. Some commonly used plasmids
include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other
plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction
enzymes and ligation reactions to remove and add specific fragments
of DNA.
[0226] It has recently been discovered that gene carrying plasmids
can be delivered to the immune system using bacteria. Modified
forms of bacteria such as Salmonella can be transfected with the
plasmid and used as delivery vehicles. The bacterial delivery
vehicles can be administered to a host subject orally or by other
administration means. The bacteria deliver the plasmid to immune
cells, e.g. B cells, dendritic cells, likely by passing through the
gut barrier. High levels of immune protection have been established
using this methodology. Such methods of delivery are useful for the
aspects of the invention utilizing systemic delivery of antigen,
Immunostimulatory nucleic acid and/or other therapeutic agent.
[0227] Thus, the immunostimulatory nucleic acids are useful as
vaccine adjuvants. It was previously established that CpG
oligonucleotides are excellent vaccine adjuvants. It was also
demonstrated, however, that CpG ODN which are superb vaccine
adjuvants in mice are not the preferred adjuvants in non-rodent
animals. In order to identify the best immunostimulatory nucleic
acids for use as a vaccine adjuvant in humans and other non-rodent
animals, in vivo screening of different nucleic acids for this
purpose was conducted. Several in vitro assays were evaluated in
mice for their predictive value of adjuvant activity in vivo in
mice. During the course of this study, an in vitro test that is
predictive of in vivo efficacy was identified. It was discovered,
rather surprisingly, that both B cell and NK cell activation
correlated particularly well with the ability of an
immunostimulatory nucleic acid to enhance an in vivo immune
response against an antigen.
[0228] The good predictive value of B cell activation for in vivo
vaccine adjuvant activity is most likely linked to the central role
of B cells in the establishment of a specific immune response.
Polyclonal proliferation of B cells (induced by immunostimulatory
nucleic acids) increases the likelihood of an antigen specific B
cell/T helper cell match. Furthermore, enhanced expression of the
co-stimulatory molecule CD86 on polyclonally expanded B cells
activates antigen specific T helper cells. B cells also increase
their CD40 expression in response to immunostimulatory nucleic
acids improving the capability of CD40L expressing activated T
helper cells to stimulate B cells. Increased ICAM-1 synthesis on B
cells facilitates the cell to cell contact. Thus, the activation
status of polyclonal B cells plays a critical role during the
initiation of a specific antibody response.
[0229] The contribution of NK cell activity for the establishment
of specific antibodies was, however, surprising. NK cells are part
of the innate immune system and as such are involved in the first
line of defense against pathogens. Most likely the cytokine pattern
produced by NK cells upon activation is closely related to the
initiation of a specific immune response. Thus, in one aspect the
invention relates to a method of identifying an adjuvant, by
detecting NK cell activation. The NK cell activation assay may be
carried out as described in the Examples below or using other known
NK cell activity assays. It is preferred, however that a mixed cell
population such as PBMC be used because of the likelihood that NK
cell activation is an indirect effect. The assay is preferably
useful for identifying immunostimulatory nucleic acids which are
useful as adjuvants in human and other non-rodent animals.
[0230] Cytokine induction was also identified as an important
predictor of in vivo adjuvant activity. As there is a 2 log higher
endotoxin sensitivity of human than mouse primary monocytes, some
caution, however, is required to avoid endotoxin contamination of
immunostimulatory nucleic acids used for testing in the human
system (Hartmann G., and Krieg A. M. 1999. Gene Therapy 6:893).
Since TNF-.alpha., IL-6 and IL-12 are produced by human monocytes
in response to even low amounts of endotoxin, their value for high
throughput in vitro screening assays is limited. On the other hand,
human B cells and NK cells show only minor activation by endotoxin
and thus are far more useful in testing for immunostimulatory
activity.
[0231] Stimulation of cellular function in either NK or B cells
(i.e., lytic activity, proliferation) requires a stronger
immunostimulatory nucleic acid than the induction of activation
markers at their surface (CD69, CD86). For both cell types, the use
of cell surface activation markers showed a higher nonspecific
background attributable to the phosphorothioate backbone compared
to the functional assays. This high sensitivity of surface markers
requires the use of low immunostimulatory nucleic acid
concentrations for optimal discrimination between immunostimulatory
nucleic acid of similar activity. Thus, the use of surface markers
allows the comparison of immunostimulatory nucleic acids with weak
activity, while functional assays are preferred for comparing
immunostimulatory nucleic acids with high activity. It is of note
that the optimal immunostimulatory nucleic acid concentrations for
stimulating B cells and NK cells differ. While 0.6 .mu.g/ml ODN is
already maximal to stimulate B cells, optimal NK cell activation
may require 6 .mu.g/ml ODN. Both B cell activation and NK cell
functional activity were measured within freshly isolated PBMC. It
was previously found that highly purified human primary B cells are
activated by CpG DNA. The existence of a direct effect of CpG DNA
on NK cells is less clear, and a secondary mechanism mediated by
another cell type within PBMC might contribute to CpG-induced
functional activity of NK cells.
[0232] The nucleic acids of the invention may be administered to a
subject with an anti-microbial agent. An anti-microbial agent, as
used herein, refers to a naturally-occurring or synthetic compound
which is capable of killing or inhibiting infectious
microorganisms. The type of anti-microbial agent useful according
to the invention will depend upon the type of microorganism with
which the subject is infected or at risk of becoming infected.
Anti-microbial agents include but are not limited to anti-bacterial
agents, anti-viral agents, anti-fungal agents and anti-parasitic
agents. Phrases such as "anti-infective agent", "anti-bacterial
agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic
agent" and "parasiticide" have well-established meanings to those
of ordinary skill in the art and are defined in standard medical
texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and
include antibiotics as well as other synthetic or natural compounds
having similar functions. Antibiotics are low molecular weight
molecules which are produced as secondary metabolites by cells,
such as microorganisms. In general, antibiotics interfere with one
or more bacterial functions or structures which are specific for
the microorganism and which are not present in host cells.
Anti-viral agents can be isolated from natural sources or
synthesized and are useful for killing or inhibiting viruses.
Anti-fungal agents are used to treat superficial fungal infections
as well as opportunistic and primary systemic fungal infections.
Anti-parasite agents kill or inhibit parasites.
[0233] Examples of anti-parasitic agents, also referred to as
parasiticides useful for human administration include but are not
limited to albendazole, amphotericin B, benznidazole, bithionol,
chloroquine HCl, chloroquine phosphate, clindamycin,
dehydroemetine, diethylcarbamazine, diloxanide furoate,
eflomithine, furazolidaone, glucocorticoids, halofantrine,
iodoquinol, ivermectin, mebendazole, mefloquine, meglumine
antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide,
nifurtimox, oxamniquine, paromomycin, pentamidine isethionate,
piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel
pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine,
quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin,
stibogluconate sodium (sodium antimony gluconate), suramin,
tetracycline, doxycycline, thiabendazole, tinidazole,
trimethroprim-sulfamethoxazole, and tryparsamide some of which are
used alone or in combination with others.
[0234] Parasiticides used in non-human subjects include piperazine,
diethylcarbamazine, thiabendazole, fenbendazole, albendazole,
oxfendazole, oxibendazole, febantel, levamisole, pyrantel tartrate,
pyrantel pamoate, dichlorvos, ivermectin, doramectic, milbemycin
oxime, iprinomectin, moxidectin, N-butyl chloride, toluene,
hygromycin B thiacetarsemide sodium, melarsomine, praziquantel,
epsiprantel, benzimidazoles such as fenbendazole, albendazole,
oxfendazole, clorsulon, albendazole, amprolium; decoquinate,
lasalocid, monensin sulfadimethoxine; sulfamethazine,
sulfaquinoxaline, metronidazole.
[0235] Parasiticides used in horses include mebendazole,
oxfendazole, febantel, pyrantel, dichlorvos, trichlorfon,
ivermectin, piperazine; for S. westeri: ivermectin, benzimiddazoles
such as thiabendazole, cambendazole, oxibendazole and fenbendazole.
Useful parasiticides in dogs include milbemycin oxine, ivermectin,
pyrantel pamoate and the combination of ivermectin and pyrantel.
The treatment of parasites in swine can include the use of
levamisole, piperazine, pyrantel, thiabendazole, dichlorvos and
fenbendazole. In sheep and goats anthelmintic agents include
levamisole or ivermectin. Caparsolate has shown some efficacy in
the treatment of D. immitis (heartworm) in cats.
[0236] Antibacterial agents kill or inhibit the growth or function
of bacteria. A large class of antibacterial agents is antibiotics.
Antibiotics, which are effective for killing or inhibiting a wide
range of bacteria, are referred to as broad spectrum antibiotics.
Other types of antibiotics are predominantly effective against the
bacteria of the class gram-positive or gram-negative. These types
of antibiotics are referred to as narrow spectrum antibiotics.
Other antibiotics which are effective against a single organism or
disease and not against other types of bacteria, are referred to as
limited spectrum antibiotics. Antibacterial agents are sometimes
classified based on their primary mode of action. In general,
antibacterial agents are cell wall synthesis inhibitors, cell
membrane inhibitors, protein synthesis inhibitors, nucleic acid
synthesis or functional inhibitors, and competitive inhibitors.
[0237] Anti-bacterial agents useful in the invention include but
are not limited to natural penicillins, semi-synthetic penicillins,
clavulanic acid, cephalolsporins, bacitracin, ampicillin,
carbenicillin, oxacillin, azlocillin, mezlocillin, piperacillin,
methicillin, dicloxacillin, nafcillin, cephalothin, cephapirin,
cephalexin, cefamandole, cefaclor, cefazolin, cefuroxine,
cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime,
ceftriaxone, cefoperazone, ceftazidine, moxalactam, carbapenems,
imipenems, monobactems, euztreonam, vancomycin, polymyxin,
amphotericin B, nystatin, imidazoles, clotrimazole, miconazole,
ketoconazole, itraconazole, fluconazole, rifampins, ethambutol,
tetracyclines, chloramphenicol, macrolides, aminoglycosides,
streptomycin, kanamycin, tobramycin, amikacin, gentamicin,
tetracycline, minocycline, doxycycline, chlortetracycline,
erythromycin, roxithromycin, clarithromycin, oleandomycin,
azithromycin, chloramphenicol, quinolones, co-trimoxazole,
norfloxacin, ciprofloxacin, enoxacin, nalidixic acid, temafloxacin,
sulfonamides, gantrisin, and trimethoprim; Acedapsone; Acetosulfone
Sodium; Alamecin; Alexidine; Amdinocillin; Amdinocillin Pivoxil;
Amicycline; Amifloxacin; Amifloxacin Mesylate; Amikacin; Amikacin
Sulfate; Aminosalicylic acid; Aminosalicylate sodium; Amoxicillin;
Amphomycin; Ampicillin; Ampicillin Sodium; Apalcillin Sodium;
Apramycin; Aspartocin; Astromicin Sulfate; Avilamycin; Avoparcin;
Azithromycin; Azlocillin; Azlocillin Sodium; Bacampicillin
Hydrochloride; Bacitracin; Bacitracin Methylene Disalicylate;
Bacitracin Zinc; Bambermycins; Benzoylpas Calcium; Berythromycin;
Betamicin Sulfate; Biapenem; Biniramycin; Biphenamine
Hydrochloride; Bispyrithione Magsulfex; Butikacin; Butirosin
Sulfate; Capreomycin Sulfate; Carbadox; Carbenicillin Disodium;
Carbenicillin Indanyl Sodium; Carbenicillin Phenyl Sodium;
Carbenicillin Potassium; Carumonam Sodium; Cefaclor; Cefadroxil;
Cefamandole; Cefamandole Nafate; Cefamandole Sodium; Cefaparole;
Cefatrizine; Cefazaflur Sodium; Cefazolin; Cefazolin Sodium;
Cefbuperazone; Cefdinir; Cefepime; Cefepime Hydrochloride;
Cefetecol; Cefixime; Cefmenoxime Hydrochloride; Cefmetazole;
Cefmetazole Sodium; Cefonicid Monosodium; Cefonicid Sodium;
Cefoperazone Sodium; Ceforanide; Cefotaxime Sodium; Cefotetan;
Cefotetan Disodium; Cefotiam Hydrochloride; Cefoxitin; Cefoxitin
Sodium; Cefpimizole; Cefpimizole Sodium; Cefpiramide; Cefpiramide
Sodium; Cefpirome Sulfate; Cefpodoxime Proxetil; Cefprozil;
Cefroxadine; Cefsulodin Sodium; Ceftazidime; Ceftibuten;
Ceftizoxime Sodium; Ceftriaxone Sodium; Cefuroxime; Cefuroxime
Axetil; Cefuroxime Pivoxetil; Cefuroxime Sodium; Cephacetrile
Sodium; Cephalexin; Cephalexin Hydrochloride; Cephaloglycin;
Cephaloridine; Cephalothin Sodium; Cephapirin Sodium; Cephradine;
Cetocycline Hydrochloride; Cetophenicol; Chloramphenicol;
Chloramphenicol Palmitate; Chloramphenicol Pantothenate Complex;
Chloramphenicol Sodium Succinate; Chlorhexidine Phosphanilate;
Chloroxylenol; Chlortetracycline Bisulfate; Chlortetracycline
Hydrochloride; Cinoxacin; Ciprofloxacin; Ciprofloxacin
Hydrochloride; Cirolemycin; Clarithromycin; Clinafloxacin
Hydrochloride; Clindamycin; Clindamycin Hydrochloride; Clindamycin
Palmitate Hydrochloride; Clindamycin Phosphate; Clofazimine;
Cloxacillin Benzathine; Cloxacillin Sodium; Cloxyquin;
Colistimethate Sodium; Colistin Sulfate; Coumermycin; Coumermycin
Sodium; Cyclacillin; Cycloserine; Dalfopristin; Dapsone;
Daptomycin; Demeclocycline; Demeclocycline Hydrochloride;
Demecycline; Denofungin; Diaveridine; Dicloxacillin; Dicloxacillin
Sodium; Dihydrostreptomycin Sulfate; Dipyrithione; Dirithromycin;
Doxycycline; Doxycycline Calcium; Doxycycline Fosfatex; Doxycycline
Hyclate; Droxacin Sodium; Enoxacin; Epicillin; Epitetracycline
Hydrochloride; Erythromycin; Erythromycin Acistrate; Erythromycin
Estolate; Erythromycin Ethylsuccinate; Erythromycin Gluceptate;
Erythromycin Lactobionate; Erythromycin Propionate; Erythromycin
Stearate; Ethambutol Hydrochloride; Ethionamide; Fleroxacin;
Floxacillin; Fludalanine; Flumequine; Fosfomycin; Fosfomycin
Tromethamine; Fumoxicillin; Furazolium Chloride; Furazolium
Tartrate; Fusidate Sodium; Fusidic Acid; Gentamicin Sulfate;
Gloximonam; Gramicidin; Haloprogin; Hetacillin; Hetacillin
Potassium; Hexedine; Ibafloxacin; Imipenem; Isoconazole;
Isepamicin; Isoniazid; Josamycin; Kanamycin Sulfate; Kitasamycin;
Levofuraltadone; Levopropylcillin Potassium; Lexithromycin;
Lincomycin; Lincomycin Hydrochloride; Lomefloxacin; Lomefloxacin
Hydrochloride; Lomefloxacin Mesylate; Loracarbef; Mafenide;
Meclocycline; Meclocycline Sulfosalicylate; Megalomicin Potassium
Phosphate; Mequidox; Meropenem; Methacycline; Methacycline
Hydrochloride; Methenamine; Methenamine Hippurate; Methenamine
Mandelate; Methicillin Sodium; Metioprim; Metronidazole
Hydrochloride; Metronidazole Phosphate; Mezlocillin; Mezlocillin
Sodium; Minocycline; Minocycline Hydrochloride; Mirincamycin
Hydrochloride; Monensin; Monensin Sodium; Nafcillin Sodium;
Nalidixate Sodium; Nalidixic Acid; Natamycin; Nebramycin; Neomycin
Palmitate; Neomycin Sulfate; Neomycin Undecylenate; Netilmicin
Sulfate; Neutramycin; Nifuradene; Nifuraldezone; Nifuratel;
Nifuratrone; Nifurdazil; Nifurimide; Nifurpirinol; Nifurquinazol;
Nifurthiazole; Nitrocycline; Nitrofurantoin; Nitromide;
Norfloxacin; Novobiocin Sodium; Ofloxacin; Ormetoprim; Oxacillin
Sodium; Oximonam; Oximonam Sodium; Oxolinic Acid; Oxytetracycline;
Oxytetracycline Calcium; Oxytetracycline Hydrochloride; Paldimycin;
Parachlorophenol; Paulomycin; Pefloxacin; Pefloxacin Mesylate;
Penamecillin; Penicillin G Benzathine; Penicillin G Potassium;
Penicillin G Procaine; Penicillin G Sodium; Penicillin V;
Penicillin V Benzathine; Penicillin V Hydrabamine; Penicillin V
Potassium; Pentizidone Sodium; Phenyl Aminosalicylate; Piperacillin
Sodium; Pirbenicillin Sodium; Piridicillin Sodium; Pirlimycin
Hydrochloride; Pivampicillin Hydrochloride; Pivampicillin Pamoate;
Pivampicillin Probenate; Polymyxin B Sulfate; Porfiromycin;
Propikacin; Pyrazinamide; Pyrithione Zinc; Quindecamine Acetate;
Quinupristin; Racephenicol; Ramoplanin; Ranimycin; Relomycin;
Repromicin; Rifabutin; Rifametane; Rifamexil; Rifamide; Rifampin;
Rifapentine; Rifaximin; Rolitetracycline; Rolitetracycline Nitrate;
Rosaramicin; Rosaramicin Butyrate; Rosaramicin Propionate;
Rosaramicin Sodium Phosphate; Rosaramicin Stearate; Rosoxacin;
Roxarsone; Roxithromycin; Sancycline; Sanfetrinem Sodium;
Sarmoxicillin; Sarpicillin; Scopafungin; Sisomicin; Sisomicin
Sulfate; Sparfloxacin; Spectinomycin Hydrochloride; Spiramycin;
Stallimycin Hydrochloride; Steffimycin; Streptomycin Sulfate;
Streptonicozid; Sulfabenz; Sulfabenzamide; Sulfacetamide;
Sulfacetamide Sodium; Sulfacytine; Sulfadiazine; Sulfadiazine
Sodium; Sulfadoxine; Sulfalene; Sulfamerazine; Sulfameter;
Sulfamethazine; Sulfamethizole; Sulfamethoxazole;
Sulfamonomethoxine; Sulfamoxole; Sulfanilate Zinc; Sulfanitran;
Sulfasalazine; Sulfasomizole; Sulfathiazole; Sulfazamet;
Sulfisoxazole; Sulfisoxazole Acetyl; Sulfisoxazole Diolamine;
Sulfomyxin; Sulopenem; Sultamicillin; Suncillin Sodium;
Talampicillin Hydrochloride; Teicoplanin; Temafloxacin
Hydrochloride; Temocillin; Tetracycline; Tetracycline
Hydrochloride; Tetracycline Phosphate Complex; Tetroxoprim;
Thiamphenicol; Thiphencillin Potassium; Ticarcillin Cresyl Sodium;
Ticarcillin Disodium; Ticarcillin Monosodium; Ticlatone; Tiodonium
Chloride; Tobramycin; Tobramycin Sulfate; Tosufloxacin;
Trimethoprim; Trimethoprim Sulfate; Trisulfapyrimidines;
Troleandomycin; Trospectomycin Sulfate; Tyrothricin; Vancomycin;
Vancomycin Hydrochloride; Virginiamycin; and Zorbamycin.
[0238] Antiviral agents are compounds which prevent infection of
cells by viruses or replication of the virus within the cell. There
are many fewer antiviral drugs than antibacterial drugs because the
process of viral replication is so closely related to DNA
replication within the host cell, that non-specific antiviral
agents would often be toxic to the host. There are several stages
within the process of viral infection which can be blocked or
inhibited by antiviral agents. These stages include, attachment of
the virus to the host cell (immunoglobulin or binding peptides),
uncoating of the virus (e.g. amantadine), synthesis or translation
of viral mRNA (e.g. interferon), replication of viral RNA or DNA
(e.g. nucleoside analogues), maturation of new virus proteins (e.g.
protease inhibitors), and budding and release of the virus.
[0239] Nucleotide analogues are synthetic compounds which are
similar to nucleotides, but which have an incomplete or abnormal
deoxyribose or ribose group. Once the nucleotide analogues are in
the cell, they are phosphorylated, producing the triphosphate
formed which competes with normal nucleotides for incorporation
into the viral DNA or RNA. Once the triphosphate form of the
nucleotide analogue is incorporated into the growing nucleic acid
chain, it causes irreversible association with the viral polymerase
and thus chain termination. Nucleotide analogues include, but are
not limited to, acyclovir (used for the treatment of herpes simplex
virus and varicella-zoster virus), gancyclovir (useful for the
treatment of cytomegalovirus), idoxuridine, ribavirin (useful for
the treatment of respiratory syncitial virus), dideoxyinosine,
dideoxycytidine, and zidovudine (azidothymidine).
[0240] The interferons are cytokines which are secreted by
virus-infected cells as well as immune cells. The interferons
function by binding to specific receptors on cells adjacent to the
infected cells, causing the change in the cell which protects it
from infection by the virus. .alpha. and .beta.-interferon also
induce the expression of Class I and Class II MHC molecules on the
surface of infected cells, resulting in increased antigen
presentation for host immune cell recognition. .alpha. and
.beta.-interferons are available as recombinant forms and have been
used for the treatment of chronic hepatitis B and C infection. At
the dosages which are effective for anti-viral therapy, interferons
have severe side effects such as fever, malaise and weight
loss.
[0241] Immunoglobulin therapy is used for the prevention of viral
infection. Immunoglobulin therapy for viral infections is different
than bacterial infections, because rather than being
antigen-specific, the immunoglobulin therapy functions by binding
to extracellular virions and preventing them from attaching to and
entering cells which are susceptible to the viral infection. The
therapy is useful for the prevention of viral infection for the
period of time that the antibodies are present in the host. In
general there are two types of immunoglobulin therapies, normal
immunoglobulin therapy and hyper-immunoglobulin therapy. Normal
immune globulin therapy utilizes a antibody product which is
prepared from the serum of normal blood donors and pooled. This
pooled product contains low titers of antibody to a wide range of
human viruses, such as hepatitis A, parvovirus, enterovirus
(especially in neonates). Hyper-immune globulin therapy utilizes
antibodies which are prepared from the serum of individuals who
have high titers of an antibody to a particular virus. Those
antibodies are then used against a specific virus. Examples of
hyper-immune globulins include zoster immune globulin (useful for
the prevention of varicella in immuno-compromised children and
neonates), human rabies immunoglobulin (useful in the post-exposure
prophylaxis of a subject bitten by a rabid animal), hepatitis B
immune globulin (useful in the prevention of hepatitis B virus,
especially in a subject exposed to the virus), and RSV immune
globulin (useful in the treatment of respiratory syncitial virus
infections).
[0242] Another type of immunoglobulin therapy is active
immunization. This involves the administration of antibodies or
antibody fragments to viral surface proteins. Two types of vaccines
which are available for active immunization of hepatitis B include
serum-derived hepatitis B antibodies and recombinant hepatitis B
antibodies. Both are prepared from HBsAg. The antibodies are
administered in three doses to subjects at high risk of infection
with hepatitis B virus, such as health care workers, sexual
partners of chronic carriers, and infants.
[0243] Thus, anti-viral agents useful in the invention include but
are not limited to immunoglobulins, amantadine, interferon,
nucleoside analogues, and protease inhibitors. Specific examples of
anti-virals include but are not limited to Acemannan; Acyclovir;
Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox;
Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate;
Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride;
Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril;
Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine
Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet
Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium;
Idoxuridine; Kethoxal; Lamivudine; Lobucavir; Memotine
Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir;
Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate;
Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine;
Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride;
Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate;
Viroxime; Zalcitabine; Zidovudine; and Zinviroxime.
[0244] Anti-fungal agents are useful for the treatment and
prevention of infective fungi. Anti-fungal agents are sometimes
classified by their mechanism of action. Some anti-fungal agents
function as cell wall inhibitors by inhibiting glucose synthase.
These include, but are not limited to, basiungin/ECB. Other
anti-fungal agents function by destabilizing membrane integrity.
These include, but are not limited to, immidazoles, such as
clotrimazole, sertaconzole, fluconazole, itraconazole,
ketoconazole, miconazole, and voriconacole, as well as FK 463,
amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292,
butenafine, and terbinafine. Other anti-fungal agents function by
breaking down chitin (e.g. chitinase) or immunosuppression (501
cream). Some examples of commercially-available agents are shown in
Table B TABLE-US-00002 TABLE B Company Brand Name Generic Name
Indication Mechanism of Action PHARMACIA & PNU 196443 PNU
196443 Anti Fungal n/k UPJOHN Lilly LY 303366 Basiungin/ECB Fungal
Infections Anti-fungal/cell wall inhibitor, glucose synthase
inhibitor Bayer Canesten Clotrimazole Fungal Infections Membrane
integrity destabilizer Fujisawa FK 463 FK 463 Fungal Infections
Membrane integrity destabilizer Mylan Sertaconzaole Sertaconzole
Fungal Infections Membrane integrity destabilizer Genzyme Chitinase
Chitinase Fungal Infections, Systemic Chitin Breakdown Liposome
Abelcet Amphotericin B, Liposomal Fungal Infections, Systemic
Membrane integrity destabilizer Sequus Amphotec Amphotericin B,
Liposomal Fungal Infections, Systemic Membrane integrity
destabilizer Bayer BAY 38-9502 BAY 38-9502 Fungal Infections,
Systemic Membrane integrity destabilizer Pfizer Diflucan
Fluconazole Fungal Infections, Systemic Membrane integrity
destabilizer Johnson & Johnson Sporanox Itraconazole Fungal
Infections, Systemic Membrane integrity destabilizer Sepracor
Itraconzole (2R, 4S) Itraconzole (2R, 4S) Fungal Infections,
Systemic Membrane integrity destabilizer Johnson & Johnson
Nizoral Ketoconazole Fungal Infections, Systemic Membrane integrity
destabilizer Johnson & Johnson Monistat Miconazole Fungal
Infections, Systemic Membrane integrity destabilizer Merck MK 991
MK 991 Fungal Infections, Systemic Membrane integrity destabilizer
Bristol Myers Sq'b Pradimicin Pradimicin Fungal Infections,
Systemic Membrane integrity destabilizer Pfizer UK-292, 663 UK-292,
663 Fungal Infections, Systemic Membrane integrity destabilizer
Pfizer Voriconazole Voriconazole Fungal Infections, Systemic
Membrane integrity destabilizer Mylan 501 Cream 501 Cream
Inflammatory Fungal Immunosuppression Conditions Mylan Mentax
Butenafine Nail Fungus Membrane Integrity Destabiliser Schering
Plough Anti Fungal Anti Fungal Opportunistic Infections Membrane
Integrity Destabiliser Alza Mycelex Troche Clotrimazole Oral Thrush
Membrane Integrity Stabliser Novartis Lamisil Terbinafine Systemic
Fungal Infections, Membrane Integrity Destabiliser
Onychomycosis
[0245] Thus, the anti-fungal agents useful in the invention include
but are not limited to imidazoles, FK 463, amphotericin B, BAY
38-9502, MK 991, pradimicin, UK 292, butenafine, chitinase, 501
cream, Acrisorcin; Ambruticin; Amorolfine, Amphotericin B;
Azaconazole; Azaserine; Basifungin; Bifonazole; Biphenamine
Hydrochloride; Bispyrithione Magsulfex; Butoconazole Nitrate;
Calcium Undecylenate; Candicidin; Carbol-Fuchsin; Chlordantoin;
Ciclopirox; Ciclopirox Olamine; Cilofungin; Cisconazole;
Clotrimazole; Cuprimyxin; Denofungin; Dipyrithione; Doconazole;
Econazole; Econazole Nitrate; Enilconazole; Ethonam Nitrate;
Fenticonazole Nitrate; Filipin; Fluconazole; Flucytosine;
Fungimycin; Griseofulvin; Hamycin; Isoconazole; Itraconazole;
Kalafungin; Ketoconazole; Lomofungin; Lydimycin; Mepartricin;
Miconazole; Miconazole Nitrate; Monensin; Monensin Sodium;
Naftifine Hydrochloride; Neomycin Undecylenate; Nifuratel;
Nifurmerone; Nitralamine Hydrochloride; Nystatin; Octanoic Acid;
Orconazole Nitrate; Oxiconazole Nitrate; Oxifungin Hydrochloride;
Parconazole Hydrochloride; Partricin; Potassium Iodide; Proclonol;
Pyrithione Zinc; Pyrrolnitrin; Rutamycin; Sanguinarium Chloride;
Saperconazole; Scopafungin; Selenium Sulfide; Sinefungin;
Sulconazole Nitrate; Terbinafine; Terconazole; Thiram; Ticlatone;
Tioconazole; Tolciclate; Tolindate; Tolnaftate; Triacetin;
Triafungin; Undecylenic Acid; Viridofulvin; Zinc Undecylenate; and
Zinoconazole Hydrochloride.
[0246] Immunostimulatory nucleic acids can be combined with other
therapeutic agents such as adjuvants to enhance immune responses.
The immunostimulatory nucleic acid and other therapeutic agent may
be administered simultaneously or sequentially. When the other
therapeutic agents are administered simultaneously they can be
administered in the same or separate formulations, but are
administered at the same time. The other therapeutic agents are
administered sequentially with one another and with
immunostimulatory nucleic acid, when the administration of the
other therapeutic agents and the immunostimulatory nucleic acid is
temporally separated. The separation in time between the
administration of these compounds may be a matter of minutes or it
may be longer. Other therapeutic agents include but are not limited
to adjuvants, cytokines, antibodies, antigens, etc.
[0247] The immunostimulatory nucleic acids are useful as adjuvants
for inducing a systemic immune response. Thus either can be
delivered to a subject exposed to an antigen to produce an enhanced
immune response to the antigen.
[0248] In addition to the immunostimulatory nucleic acids, the
compositions of the invention may also be administered with
non-nucleic acid adjuvants. A non-nucleic acid adjuvant is any
molecule or compound except for the immunostimulatory nucleic acids
described herein which can stimulate the humoral and/or cellular
immune response. Non-nucleic acid adjuvants include, for instance,
adjuvants that create a depo effect, immune stimulating adjuvants,
and adjuvants that create a depo effect and stimulate the immune
system.
[0249] An adjuvant that creates a depo effect as used herein is an
adjuvant that causes the antigen to be slowly released in the body,
thus prolonging the exposure of immune cells to the antigen. This
class of adjuvants includes but is not limited to alum (e.g.,
aluminum hydroxide, aluminum phosphate); or emulsion-based
formulations including mineral oil, non-mineral oil, water-in-oil
or oil-in-water-in oil emulsion, oil-in-water emulsions such as
Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720,
AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing
a stabilizing detergent and a micelle-forming agent; IDEC,
Pharmaceuticals Corporation, San Diego, Calif.).
[0250] An immune stimulating adjuvant is an adjuvant that causes
activation of a cell of the immune system. It may, for instance,
cause an immune cell to produce and secrete cytokines. This class
of adjuvants includes but is not limited to saponins purified from
the bark of the Q. saponaria tree, such as QS21 (a glycolipid that
elutes in the 21.sup.st peak with HPLC fractionation; Aquila
Biopharmaceuticals, Inc., Worcester, Mass.);
poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus
Research Institute, USA); derivatives of lipopolysaccharides such
as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and
threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine
disaccharide related to lipid A; OM Pharma SA, Meyrin,
Switzerland); and Leishmania elongation factor (a purified
Leishmania protein; Corixa Corporation, Seattle, Wash.).
[0251] Adjuvants that create a depo effect and stimulate the immune
system are those compounds which have both of the above-identified
functions. This class of adjuvants includes but is not limited to
ISCOMS (Immunostimulating complexes which contain mixed saponins,
lipids and form virus-sized particles with pores that can hold
antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham
adjuvant system #2 which is an oil-in-water emulsion containing MPL
and QS21: SmithKline Beecham Biologicals [SBB], Rixensart,
Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4 which
contains alum and MPL; SBB, Belgium); non-ionic block copolymers
that form micelles such as CRL 1005 (these contain a linear chain
of hydrophobic polyoxpropylene flanked by chains of
polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant
Formulation (SAF, an oil-in-water emulsion containing Tween 80 and
a nonionic block copolymer; Syntex Chemicals, Inc., Boulder,
Colo.).
[0252] The immunostimulatory nucleic acids are also useful as
mucosal adjuvants. It has previously been discovered that both
systemic and mucosal immunity are induced by mucosal delivery of
CpG nucleic acids. The systemic immunity induced in response to CpG
nucleic acids included both humoral and cell-mediated responses to
specific antigens that were not capable of inducing systemic
immunity when administered alone to the mucosa. Furthermore, both
CpG nucleic acids and cholera toxin (CT, a mucosal adjuvant that
induces a Th2-like response) induced CTL. This was surprising since
with systemic immunization, the presence of Th2-like antibodies is
normally associated with a lack of CTL (Schirmbeck et al., 1995).
Based on the results presented herein it is expected that the
immunostimulatory nucleic acids will function in a similar
manner.
[0253] Additionally, the immunostimulatory nucleic acids induce a
mucosal response at both local (e.g., lung) and remote (e.g., lower
digestive tract) mucosal sites. Significant levels of IgA
antibodies are induced at distant mucosal sites by the
immunostimulatory nucleic acids. CT is generally considered to be a
highly effective mucosal adjuvant. As has been previously reported
(Snider 1995), CT induces predominantly IgG1 isotype of antibodies,
which are indicative of Th2-type response. In contrast, the
immunostimulatory nucleic acids are more Th1 with predominantly
IgG2a antibodies, especially after boost or when the two adjuvants
are combined. Th1-type antibodies in general have better
neutralizing capabilities, and furthermore, a Th2 response in the
lung is highly undesirable because it is associated with asthma
(Kay, 1996, Hogg, 1997). Thus the use of immunostimulatory nucleic
acids as a mucosal adjuvant has benefits that other mucosal
adjuvants cannot achieve. The immunostimulatory nucleic acids of
the invention also are useful as mucosal adjuvants for induction of
both a systemic and a mucosal immune response.
[0254] Mucosal adjuvants referred to as non-nucleic acid mucosal
adjuvants may also be administered with the Immunostimulatory
nucleic acids. A non-nucleic acid mucosal adjuvant as used herein
is an adjuvant other than a immunostimulatory nucleic acid that is
capable of inducing a mucosal immune response in a subject when
administered to a mucosal surface in conjunction with an antigen.
Mucosal adjuvants include but are not limited to Bacterial toxins
e.g., Cholera toxin (CT), CT derivatives including but not limited
to CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998);
CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys)
(Fontana et al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995);
CTD53/K63 (Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54
(Arg to His) (Fontana et al., 1995); CTN107 (His to Asn) (Fontana
et al., 1995); CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K
(Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe)
(Yamamoto et al., 1997a, 1997b); CTS106 (Pro to Lys) (Douce et al.,
1997, Fontana et al., 1995); and CTK63 (Ser to Lys) (Douce et al.,
1997, Fontana et al., 1995), Zonula occludens toxin, zot,
Escherichia coli heat-labile enterotoxin, Labile Toxin (LT), LT
derivatives including but not limited to LT B subunit (LTB)
(Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998,
Douce et al., 1995); LT61F (Ser to Phe) (Komase et al., 1998);
LT112K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu)
(Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998);
LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys)
(Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et
al., 1996); and LTR72 (Ala to Arg) (Giuliani et al., 1998),
Pertussis toxin, PT. (Lycke et al., 1992, Spangler B D, 1992,
Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al.,
1995) including PT-9K/129G (Roberts et al., 1995, Cropley et al.,
1995); Toxin derivatives (see below) (Holmgren et al., 1993,
Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements,
1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL)
(Sasaki et al., 1998, Vancott et al., 1998; Muramyl Dipeptide (MDP)
derivatives (Fukushima et al., 1996, Ogawa et al., 1989, Michalek
et al., 1983, Morisaki et al., 1983); Bacterial outer membrane
proteins (e.g., outer surface protein A (OspA) lipoprotein of
Borrelia burgdorferi, outer membrane protine of Neisseria
meningitidis) (Marinaro et al., 1999, Van de Verg et al., 1996);
Oil-in-water emulsions (e.g., MF59) (Barchfield et al., 1999,
Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka et
al., 1998, 1999); and Saponins (e.g., QS21) Aquila
Biopharmaceuticals, Inc., Worster, Mass.) (Sasaki et al., 1998,
MacNeal et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants
(e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an
oil-in-water emulsion containing a stabilizing detergent and a
micelle-forming agent; IDEC Pharmaceuticals Corporation, San Diego,
Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc.,
Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP
polymer; Virus Research Institute, USA) and Leishmania elongation
factor (Corixa Corporation, Seattle, Wash.).
[0255] Immune responses can also be induced or augmented by the
co-administration or co-linear expression of cytokines (Bueler
& Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997;
Iwasaki et al., 1997; Kim et al., 1997) or B-7 co-stimulatory
molecules (Iwasaki et al., 1997; Tsuji et al., 1997) with the
Immunostimulatory nucleic acids. The cytokines can be administered
directly with Immunostimulatory nucleic acids or may be
administered in the form of a nucleic acid vector that encodes the
cytokine, such that the cytokine can be expressed in vivo. In one
embodiment, the cytokine is administered in the form of a plasmid
expression vector. The term cytokine is used as a generic name for
a diverse group of soluble proteins and peptides which act as
humoral regulators at nano- to picomolar concentrations and which,
either under normal or pathological conditions, modulate the
functional activities of individual cells and tissues. These
proteins also mediate interactions between cells directly and
regulate processes taking place in the extracellular environment.
Examples of cytokines include, but are not limited to IL-1, IL-2,
IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18,
granulocyte-macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), interferon-.gamma.
(.gamma.-IFN), IFN-.alpha., tumor necrosis factor (TNF),
TGF-.beta., FLT-3 ligand, and CD40 ligand.
[0256] Cytokines play a role in directing the T cell response.
Helper (CD4+) T cells orchestrate the immune response of mammals
through production of soluble factors that act on other immune
system cells, including other T cells. Most mature CD4+ T helper
cells express one of two cytokine profiles: Th1 or Th2. The Th1
subset promotes delayed-type hypersensitivity, cell-mediated
immunity, and immunoglobulin class switching to IgG.sub.2a. The Th2
subset induces humoral immunity by activating B cells, promoting
antibody production, and inducing class switching to IgG.sub.1 and
IgE. In some embodiments, it is preferred that the cytokine be a
Th1 cytokine.
[0257] The nucleic acids are also useful for redirecting an immune
response from a Th2 immune response to a Th1 immune response.
Redirection of an immune response from a Th2 to a Th1 immune
response can be assessed by measuring the levels of cytokines
produced in response to the nucleic acid (e.g., by inducing
monocytic cells and other cells to produce Th1 cytokines, including
IL-12, IFN-.gamma. and GM-CSF). The redirection or rebalance of the
immune response from a Th2 to a Th1 response is particularly useful
for the treatment or prevention of asthma. For instance, an
effective amount for treating asthma can be that amount; useful for
redirecting a Th2 type of immune response that is associated with
asthma to a Th1 type of response. Th2 cytokines, especially IL-4
and IL-5 are elevated in the airways of asthmatic subjects. These
cytokines promote important aspects of the asthmatic inflammatory
response, including IgE isotype switching, eosinophil chemotaxis
and activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines. The immunostimulatory nucleic acids of
the invention cause an increase in Th1 cytokines which helps to
rebalance the immune system, preventing or reducing the adverse
effects associated with a predominately Th2 immune response.
[0258] The nucleic acids are also useful for improving survival,
differentiation, activation and maturation of dendritic cells. The
immunostimulatory nucleic acids have the unique capability to
promote cell survival, differentiation, activation and maturation
of dendritic cells. Dendritic precursor cells isolated from blood
by immunomagnetic cell sorting develop morphologic and functional
characteristics of dendritic cells during a two day incubation with
GM-CSF. Without GM-CSF these cells undergo apoptosis. The
immunostimulatory nucleic acids are superior to GM-CSF in promoting
survival and differentiation of dendritic cells (MHC II expression,
cell size, granularity). The immunostimulatory nucleic acids also
induce maturation of dendritic cells. Since dendritic cells form
the link between the innate and the acquired immune system, by
presenting antigens as well as through their expression of pattern
recognition receptors which detect microbial molecules like LPS in
their local environment, the ability to activate dendritic cells
with immunostimulatory nucleic acids supports the use of these
immunostimulatory nucleic acid based strategies for in vivo and
ex-vivo immunotherapy against disorders such as cancer and allergic
or infectious diseases. The immunostimulatory nucleic acids are
also useful for activating and inducing maturation of dendritic
cells.
[0259] Immunostimulatory nucleic acids also increase natural killer
cell lytic activity and antibody dependent cellular cytotoxicity
(ADCC). ADCC can be performed using a immunostimulatory nucleic
acid in combination with an antibody specific for a cellular
target, such as a cancer cell. When the immunostimulatory nucleic
acid is administered to a subject in conjunction with the antibody
the subject's immune system is induced to kill the tumor cell. The
antibodies useful in the ADCC procedure include antibodies which
interact with a cell in the body. Many such antibodies specific for
cellular targets have been described in the art and many are
commercially available. Examples of these antibodies are listed
below among the list of cancer immunotherapies.
[0260] The immunostimulatory nucleic acids may also be administered
in conjunction with an anti-cancer therapy. Anti-cancer therapies
include cancer medicaments, radiation and surgical procedures. As
used herein, a "cancer medicament" refers to a agent which is
administered to a subject for the purpose of treating a cancer. As
used herein, "treating cancer" includes preventing the development
of a cancer, reducing the symptoms of cancer, and/or inhibiting the
growth of an established cancer. In other aspects, the cancer
medicament is administered to a subject at risk of developing a
cancer for the purpose of reducing the risk of developing the
cancer. Various types of medicaments for the treatment of cancer
are described herein. For the purpose of this specification, cancer
medicaments are classified as chemotherapeutic agents,
immunotherapeutic agents, cancer vaccines, hormone therapy, and
biological response modifiers.
[0261] As used herein, a "cancer medicament" refers to an agent
which is administered to a subject for the purpose of treating a
cancer. As used herein, "treating cancer" includes preventing the
development of a cancer, reducing the symptoms of cancer, and/or
inhibiting the growth of an established cancer. In other aspects,
the cancer medicament is administered to a subject at risk of
developing a cancer for the purpose of reducing the risk of
developing the cancer. Various types of medicaments for the
treatment of cancer are described herein. For the purpose of this
specification, cancer medicaments are classified as
chemotherapeutic agents, immunotherapeutic agents, cancer vaccines,
hormone therapy, and biological response modifiers. Additionally,
the methods of the invention are intended to embrace the use of
more than one cancer medicament along with the immunostimulatory
nucleic acids. As an example, where appropriate, the
immunostimulatory nucleic acids may be administered with a both a
chemotherapeutic agent and an immunotherapeutic agent.
Alternatively, the cancer medicament may embrace an
immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic
agent and a cancer vaccine, or a chemotherapeutic agent, an
immunotherapeutic agent and a cancer vaccine all administered to
one subject for the purpose of treating a subject having a cancer
or at risk of developing a cancer.
[0262] Cancer medicaments function in a variety of ways. Some
cancer medicaments work by targeting physiological mechanisms that
are specific to tumor cells. Examples include the targeting of
specific genes and their gene products (i.e., proteins primarily)
which are mutated in cancers. Such genes include but are not
limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor
genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4,
p21, telomerase). Cancer medicaments can alternately target signal
transduction pathways and molecular mechanisms which are altered in
cancer cells. Targeting of cancer cells via the epitopes expressed
on their cell surface is accomplished through the use of monoclonal
antibodies. This latter type of cancer medicament is generally
referred to herein as immunotherapy.
[0263] Other cancer medicaments target cells other than cancer
cells. For example, some medicaments prime the immune system to
attack tumor cells (i.e., cancer vaccines). Still other
medicaments, called angiogenesis inhibitors, function by attacking
the blood supply of solid tumors. Since the most malignant cancers
are able to metastasize (i.e., exist the primary tumor site and
seed a distal tissue, thereby forming a secondary tumor),
medicaments that impede this metastasis are also useful in the
treatment of cancer. Angiogenic mediators include basic FGF, VEGF,
angiopoietins, angiostatin, endostatin, TNF.alpha., TNP-470,
thrombospondin-1, platelet factor 4, CAI, and certain members of
the integrin family of proteins. One category of this type of
medicament is a metalloproteinase inhibitor, which inhibits the
enzymes used by the cancer cells to exist the primary tumor site
and extravasate into another tissue.
[0264] Some cancer cells are antigenic and thus can be targeted by
the immune system. In one aspect, the combined administration of
immunostimulatory nucleic acids and cancer medicaments,
particularly those which are classified as cancer immunotherapies,
is useful for stimulating a specific immune response against a
cancer antigen. A "cancer antigen" as used herein is a compound,
such as a peptide, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen presenting cell in the context of an
MHC molecule. Cancer antigens, such as those present in cancer
vaccines or those used to prepare cancer immunotherapies, can be
prepared from crude cancer cell extracts, as described in Cohen, et
al., 1994, Cancer Research, 54:1055, or by partially purifying the
antigens, using recombinant technology, or de novo synthesis of
known antigens. Cancer antigens can be used in the form of
immunogenic portions of a particular antigen or in some instances a
whole cell or a tumor mass can be used as the antigen. Such
antigens can be isolated or prepared recombinantly or by any other
means known in the art.
[0265] The theory of immune surveillance is that a prime function
of the immune system is to detect and eliminate neoplastic cells
before a tumor forms. A basic principle of this theory is that
cancer cells are antigenically different from normal cells and thus
elicit immune reactions that are similar to those that cause
rejection of immunologically incompatible allografts. Studies have
confirmed that tumor cells differ, either qualitatively or
quantitatively, in their expression of antigens. For example,
"tumor-specific antigens" are antigens that are specifically
associated with tumor cells but not normal cells. Examples of tumor
specific antigens are viral antigens in tumors induced by DNA or
RNA viruses. "Tumor-associated" antigens are present in both tumor
cells and normal cells but are present in a different quantity or a
different form in tumor cells. Examples of such antigens are
oncofetal antigens (e.g., carcinoembryonic antigen),
differentiation antigens (e.g., T and Tn antigens), and oncogene
products (e.g., HER/neu).
[0266] Different types of cells that can kill tumor targets in
vitro and in vivo have been identified: natural killer cells (NK
cells), cytolytic T lymphocytes (CTLs), lymphokine-activated killer
cells (LAKs), and activated macrophages. NK cells can kill tumor
cells without having been previously sensitized to specific
antigens, and the activity does not require the presence of class I
antigens encoded by the major histocompatibility complex (MHC) on
target cells. NK cells are thought to participate in the control of
nascent tumors and in the control of metastatic growth. In contrast
to NK cells, CTLs can kill tumor cells only after they have been
sensitized to tumor antigens and when the target antigen is
expressed on the tumor cells that also express MHC class I. CTLs
are thought to be effector cells in the rejection of transplanted
tumors and of tumors caused by DNA viruses. LAK cells are a subset
of null lymphocytes distinct from the NK and CTL populations.
Activated macrophages can kill tumor cells in a manner that is not
antigen dependent nor MHC restricted once activated. Activated
macrophages are through to decrease the growth rate of the tumors
they infiltrate. In vitro assays have identified other immune
mechanisms such as antibody-dependent, cell-mediated cytotoxic
reactions and lysis by antibody plus complement. However, these
immune effector mechanisms are thought to be less important in vivo
than the function of NK, CTLs, LAK, and macrophages in vivo (for
review see Piessens, W. F., and David, J., "Tumor Immunology", In:
Scientific American Medicine, Vol. 2, Scientific American Books,
N.Y., pp. 1-13, 1996.
[0267] The goal of immunotherapy is to augment a patient's immune
response to an established tumor. One method of immunotherapy
includes the use of adjuvants. Adjuvant substances derived from
microorganisms, such as bacillus Calmette-Guerin, heighten the
immune response and enhance resistance to tumors in animals.
[0268] Immunotherapeutic agents are medicaments which derive from
antibodies or antibody fragments which specifically bind or
recognize a cancer antigen. As used herein a cancer antigen is
broadly defined as an antigen expressed by a cancer cell.
Preferably, the antigen is expressed at the cell surface of the
cancer cell. Even more preferably, the antigen is one which is not
expressed by normal cells, or at least not expressed to the same
level as in cancer cells. Antibody-based immunotherapies may
function by binding to the cell surface of a cancer cell and
thereby stimulate the endogenous immune system to attack the cancer
cell. Another way in which antibody-based therapy functions is as a
delivery system for the specific targeting of toxic substances to
cancer cells. Antibodies are usually conjugated to toxins such as
ricin (e.g., from castor beans), calicheamicin and maytansinoids,
to radioactive isotopes such as Iodine-131 and Yttrium-90, to
chemotherapeutic agents (as described herein), or to biological
response modifiers. In this way, the toxic substances can be
concentrated in the region of the cancer and non-specific toxicity
to normal cells can be minimized. In addition to the use of
antibodies which are specific for cancer antigens, antibodies which
bind to vasculature, such as those which bind to endothelial cells,
are also useful in the invention. This is because generally solid
tumors are dependent upon newly formed blood vessels to survive,
and thus most tumors are capable of recruiting and stimulating the
growth of new blood vessels. As a result, one strategy of many
cancer medicaments is to attack the blood vessels feeding a tumor
and/or the connective tissues (or stroma) supporting such blood
vessels.
[0269] The use of immunostimulatory nucleic acids in conjunction
with immunotherapeutic agents such as monoclonal antibodies is able
to increase long-term survival through a number of mechanisms
including significant enhancement of ADCC (as discussed above),
activation of natural killer (NK) cells and an increase in
IFN.alpha. levels. The nucleic acids when used in combination with
monoclonal antibodies serve to reduce the dose of the antibody
required to achieve a biological result.
[0270] Examples of cancer immunotherapies which are currently being
used or which are in development are listed in Table C.
TABLE-US-00003 TABLE C Cancer Immunotherapies in Development or on
the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION
IDEC/Genentech, Inc./Hoffmann- Rituxan .TM. (rituximab, Mabthera)
(IDEC- non-Hodgkin's lymphoma LaRoche (first monoclonal C2B8,
chimeric murine/human anti-CD20 antibody licensed for the MAb)
treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche
Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet
(CYT-424) radiotherapeutic agent Bone metastases
Centocor/Glaxo/Ajinomoto Panorex .RTM. (17-1A) (murine monoclonal
Adjuvant therapy for antibody) colorectal (Dukes-C)
Centocor/Ajinomoto Panorex .RTM. (17-1A) (chimeric murine
Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8
(murine, anti-CD20 MAb non-Hodgkin's lymhoma labeled with
Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the
GD.sub.3 Small cell lung epitope) (with BCG) ImClone Systems C225
(chimeric monoclonal antibody to Renal cell epidermal growth factor
receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1
monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to
131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute
myleoid leukemia Techniclone .sup.131 I LYM-1 (Oncolym .TM.)
non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. Acute promyelocytic
leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head
& neck, non-small antibody) + cisplatin or radiation cell lung
cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA 125,
Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar
(anti-CD20 Mab labeled with .sup.131 I) non-Hodgkin's lymphoma have
been positive, but the drug has been associated with significant
bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN .RTM.
Kaposi's sarcoma IDEC Pharmaceuticals Rituxan .TM. (MAb against
CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo with
chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte
antigen Chronic lymphocytic CAMPATH leukemia (CLL) Center of
Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast,
ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2
bispecific Prostate, non-small cell antibody) lung, pancreatic,
breast Medarex MDX- 11 (complement activating receptor Acute
myelogenous (CAR) monoclonal antibody) leukemia (AML)
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and
colon antibody) Medarex MDX- 11 (complement activating receptor Ex
vivo bone marrow (CAR) monoclonal antibody) purging in acute
myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific
antibody, Acute myleoid leukemia MAb-conjugates) (complement
cascade activators) Cytogen OV 103 (Yttrium-90 labelled antibody)
Ovarian Cytogen OV 103 (Yttrium-90 labelled antibody) Prostate
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. non-Hodgkin's lymphoma
Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A)
non-small cell lung, pancarcinoma antigen on adenocarcinomas
prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits
angiogenesis) Lung, breast, prostate, colorectal Protein Design
Labs Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab,
humanized) Protein Design Labs SMART M195 Ab, humanized Acute
promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr
monoclonal Breast antibody) + taxol ImClone Systems (licensed from
C225 (chimeric anti-EGFr monoclonal prostate RPR) antibody) +
doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal
prostate antibody) + adriamycin ImClone Systems BEC2
(anti-idiotypic MAb, mimics the GD.sub.3 Melanoma epitope) Medarex
MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex
MDX-220 (bispecific for tumors that express Lung, colon, prostate,
TAG-72) ovarian, endometrial, pancreatic and gastric
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate
antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor
EGF receptor cancers bispecific antibody) (head & neck,
prostate, lung, bladder, cervical, ovarian) Medarex/Novartis
MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G-
antibody) CSF for various cancers, esp. breast IDEC MELIMMUNE-2
(murine monoclonal Melanoma antibody therapeutic vaccine) IDEC
MELIMMUNE-1 (murine monoclonal Melanoma antibody therapeutic
vaccine) Immunomedics, Inc. CEACIDE .TM. (I-131) Colorectal and
other NeoRx Pretarget .TM. radioactive antibodies non-Hodgkin's B
cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma
specific Ab) Cancer Techniclone Corporation/ TNT (chimeric MAb to
histone antigens) Brain Cambridge Antibody Technology Techniclone
International/ TNT (chimeric MAb to histone antigens) Brain
Cambridge Antibody Technology Novopharm Gliomab-H (Monoclonals -
Humanized Abs) Brain, melanomas, neuroblastomas Genetics
Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000
(chimeric-EGF antagonist) Cancer Immunomedics LymphoCide (humanized
LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676
(monoclonal antibody conjugate) Acute myelogenous leukemia
Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic
Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, small-cell
lung Center of Molecular Immunology ior egf/r3 (anti EGF-R
humanized Ab) Radioimmunotherapy Center of Molecular Immunology ior
c5 (murine MAb colorectal) for Colorectal radioimmunotherapy
Creative BioMolecules/ BABS (biosynthetic antibody binding site)
Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2
(monoclonal antibody to fetal liver Tumor-associated kinase-2
(FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/small-drug
conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets
GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab
Cancer Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein
Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon
Immunomedics, Inc. ImmuRAIT-CEA Colorectal
[0271] Yet other types of chemotherapeutic agents which can be used
according to the invention include Aminoglutethimide, Asparaginase,
Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine
sulfate.
[0272] Cancer vaccines are medicaments which are intended to
stimulate an endogenous immune response against cancer cells.
Currently produced vaccines predominantly activate the humoral
immune system (i.e., the antibody dependent immune response). Other
vaccines currently in development are focused on activating the
cell-mediated immune system including cytotoxic T lymphocytes which
are capable of killing tumor cells. Cancer vaccines generally
enhance the presentation of cancer antigens to both antigen
presenting cells (e.g., macrophages and dendritic cells) and/or to
other immune cells such as T cells, B cells, and NK cells.
[0273] Although cancer vaccines may take one of several forms, as
discussed infra, their purpose is to deliver cancer antigens and/or
cancer associated antigens to antigen presenting cells (APC) in
order to facilitate the endogenous processing of such antigens by
APC and the ultimate presentation of antigen presentation on the
cell surface in the context of MHC class I molecules. One form of
cancer vaccine is a whole cell vaccine which is a preparation of
cancer cells which have been removed from a subject, treated ex
vivo and then reintroduced as whole cells in the subject. Lysates
of tumor cells can also be used as cancer vaccines to elicit an
immune response. Another form cancer vaccine is a peptide vaccine
which uses cancer-specific or cancer-associated small proteins to
activate T cells. Cancer-associated proteins are proteins which are
not exclusively expressed by cancer cells (i.e., other normal cells
may still express these antigens). However, the expression of
cancer-associated antigens is generally consistently upregulated
with cancers of a particular type. Yet another form of cancer
vaccine is a dendritic cell vaccine which includes whole dendritic
cells which have been exposed to a cancer antigen or a
cancer-associated antigen in vitro. Lysates or membrane fractions
of dendritic cells may also be used as cancer vaccines. Dendritic
cell vaccines are able to activate antigen-presenting cells
directly. Other cancer vaccines include ganglioside vaccines,
heat-shock protein vaccines, viral and bacterial vaccines, and
nucleic acid vaccines.
[0274] The use of immunostimulatory nucleic acids in conjunction
with cancer vaccines provides an improved antigen-specific humoral
and cell mediated immune response, in addition to activating NK
cells and endogenous dendritic cells, and increasing IFN.alpha.
levels. This enhancement allows a vaccine with a reduced antigen
dose to be used to achieve the same beneficial effect. In some
instances, cancer vaccines may be used along with adjuvants, such
as those described above.
[0275] As used herein, the terms "cancer antigen" and "tumor
antigen" are used interchangeably to refer to antigens which are
differentially expressed by cancer cells and can thereby be
exploited in order to target cancer cells. Cancer antigens are
antigens which can potentially stimulate apparently tumor-specific
immune responses. Some of these antigens are encoded, although not
necessarily expressed, by normal cells. These antigens can be
characterized as those which are normally silent (i.e., not
expressed) in normal cells, those that are expressed only at
certain stages of differentiation and those that are temporally
expressed such as embryonic and fetal antigens. Other cancer
antigens are encoded by mutant cellular genes, such as oncogenes
(e.g., activated ras oncogene), suppressor genes (e.g., mutant
p53), fusion proteins resulting from internal deletions or
chromosomal translocations. Still other cancer antigens can be
encoded by viral genes such as those carried on RNA and DNA tumor
viruses.
[0276] Other vaccines take the form of dendritic cells which have
been exposed to cancer antigens in vitro, have processed the
antigens and are able to express the cancer antigens at their cell
surface in the context of MHC molecules for effective antigen
presentation to other immune system cells.
[0277] The immunostimulatory nucleic acids are used in one aspect
of the invention in conjunction with cancer vaccines which are
dendritic cell based. A dendritic cell is a professional antigen
presenting cell. Dendritic cells form the link between the innate
and the acquired immune system by presenting antigens and through
their expression of pattern recognition receptors which detect
microbial molecules like LPS in their local environment. Dendritic
cells efficiently internalize, process, and present soluble
specific antigen to which it is exposed. The process of
internalizing and presenting antigen causes rapid upregulation of
the expression of major histocompatibility complex (MHC) and
costimulatory molecules, the production of cytokines, and migration
toward lymphatic organs where they are believed to be involved in
the activation of T cells.
[0278] Table D lists a variety of cancer vaccines which are either
currently being used or are in development. TABLE-US-00004 TABLE D
Cancer Vaccines in Development or on the Market MARKETER BRAND NAME
(GENERIC NAME) INDICATION Center of Molecular EGF Cancer Immunology
Center of Molecular Ganglioside cancer Immunology vaccine Center of
Molecular Anti-idiotypic Cancer vaccine Immunology ImClone
Systems/Memorial Gp75 antigen Melanoma Sloan-Kettering Cancer
Center ImClone Systems/Memorial Anti-idiotypic Abs Cancer vaccines
Sloan-Kettering Cancer Center Progenics Pharmaceuticals, Inc. GMK
melanoma vaccine Melanoma Progenics Pharmaceuticals, Inc, MGV
ganglioside conjugate vaccine Lymphoma, colorectal, lung Corixa
Her2/neu Breast, ovarian AltaRex Ovarex Ovarian AVAX Technologies
Inc. M-Vax, autologous whole cell Melanoma AVAX Technologies Inc.
O-Vax, autologous whole cell Ovarian AVAX Technologies Inc. L-Vax,
autologous whole cell Leukemia-AML Biomira Inc./Chiron Theratope,
STn-KLH Breast, Colorectal Biomira Inc. BLP25, MUC-1 peptide
vaccine encapsulated Lung in liposomal delivery system Biomira Inc.
BLP25, MUC-1 peptide vaccine encapsulated Lung in liposomal
delivery system + Liposomal IL- 2 Biomira Inc. Liposomal idiotypic
vaccine Lymphoma B-cell malignancies Ribi Immunochem Melacine, cell
lysate Melanoma Corixa Peptide antigens, microsphere delivery sysem
Breast and LeIF adjuvant Corixa Peptide antigens, microsphere
delivery sysem Prostate and LeIF adjuvant Corixa Peptide antigens,
microsphere delivery sysem Ovarian and LeIF adjuvant Corixa Peptide
antigens, microsphere delivery sysem Lymphoma and LeIF adjuvant
Corixa Peptide antigens, microsphere delivery sysem Lung and LeIF
adjuvant Virus Research Institute Toxin/antigen recombinant
delivery system All cancers Apollon Inc. Genevax-TCR T-cell
lymphoma Bavarian Nordic Research MVA-based (vaccinia virus)
vaccine Melanoma Institute A/S BioChem Pharma/BioChem PACIS, BCG
vaccine Bladder Vaccine Cantab Pharmaceuticals TA-HPV Cervical
Cantab Pharmaceuticals TA-CIN Cervical Cantab Pharmaceuticals
DISC-Virus, immunotherapy Cancer Pasteur Merieux Connaught ImmuCyst
.RTM./TheraCys .RTM. - BCG Bladder Immunotherapeutic (Bacillus
Calmette- Guerin/Connaught), for intravesical treatment of
superficial bladder cancer
[0279] As used herein, chemotherapeutic agents embrace all other
forms of cancer medicaments which do not fall into the categories
of immunotherapeutic agents or cancer vaccines. Chemotherapeutic
agents as used herein encompass both chemical and biological
agents. These agents function to inhibit a cellular activity which
the cancer cell is dependent upon for continued survival.
Categories of chemotherapeutic agents include alkylating/alkaloid
agents, antimetabolites, hormones or hormone analogs, and
miscellaneous antineoplastic drugs. Most if not all of these agents
are directly toxic to cancer cells and do not require immune
stimulation. Combination chemotherapy and immunostimulatory nucleic
acid administration increases the maximum tolerable dose of
chemotherapy.
[0280] Chemotherapeutic agents which are currently in development
or in use in a clinical setting are shown in Table E.
TABLE-US-00005 TABLE E Cancer Drugs in Development or on the Market
Marketer Brand Name Generic Name Indication Abbott TNP 470/AGM 1470
Fragyline Anti-Angiogenesis in Cancer Takeda TNP 470/AGM 1470
Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA
Meglamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder
Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin
Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer
Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed
Cancer (b) Undisclosed Cancer (b) Cancer Bristol Myers RAS Famesyl
Transferase RAS Famesyl Transferase Cancer Squib Inhibitor
Inhibitor Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY
12-9566 Cancer Merck Famesyl Transferase Inhibitor Famesyl
Transferase Cancer (Solid tumors - Inhibitor pancrease, colon,
lung, breast) Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE
Tyrosine Kinase Cancer, angiogenesis Lilly MTA/LY 231514 MTA/LY
231514 Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol
Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer,
pancreatic, breast, linolenate) colon Warner Lambert CI-994 CI-994
Cancer, Solid Tumors / Leukemia Schering AG Angiogenesis inhibitor
Angiogenesis Inhibitor Cancer/Cardio Takeda TNP-470 n/k Malignant
Tumor Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer
Beecham Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer
Novartis Valspodar PSC 833 Myeloid Leukemia/Ovarian Cancer Immunex
Novantrone Mitoxantrone Pain related to hormone refractory prostate
cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF
Anti-VEGF Prostate/Breast/Colorectal /NSCL Cancer British Biotech
Batimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid
Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682
CS-682 Solid Tumors Agouron AG2037 AG2037 Solid Tumors IDEC Pharma
9-AC 9-AC Solid Tumors Agouron VEGF/b-FGF Inhibitors VEGF/b-FGF
Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors/Macular
Degen Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853 VX-853
Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors
Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698
Solid Tumors Tanube Seiyaku TA 2516 Marimistat Solid Tumors British
Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP
845 Aggrecanase Inhibitor Solid Tumors/Breast Cancer Chiroscience
D2163 D2163 Solid Tumors/Metastases Warner Lambert PD 183805 PD
183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi Lemonal DP 2202
Lemonal DP 2202 Anti-Cancer Fujisawa FK 317 FK 317 Anticancer
Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD
32/valrubicin Valrubicin Bladder Cancer-Refractory Amersham Insitu
Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer
(adjunt therapy, Amersham Pain) Schering Plough Temodal
Temozolomide Brain Tumours Schering Plough Temodal Temozolonide
Brain Tumours Liposome Evacet Doxorubicin, Liposomal Breast Cancer
Nycomed Yewtaxan Paclitaxel Breast Cancer Advanced, Amersham
Ovarian Cancer Advanced Bristol Myers Taxol Paclitaxel Breast
Cancer Advanced, Squib Ovarian Cancer Advanced, NSCLC Roche Xeloda
Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon
Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer
Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia
Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone
Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Novantrone
Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer
Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer
Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol Myers
BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squib Bristol Myers
UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Cancer Oral Squib Johnson
& Ergamisol Levamisole Cancer Therapy Johnson Glaxo Wellcome
Eniluracil/776C85 5FU Enhancer Cancer, Refractory Solid &
Colorectal Cancer Johnson & Ergamisol Levamisole Colon Cancer
Johnson Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical
Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer,
Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer,
Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy
Cell Leukaemia Johnson Ivax Paxene Paclitaxel Kaposi Sarcoma Sequus
Doxil Doxorubicin, Liposomal KS/Cancer Sequus Caelyx Doxorubicin,
Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia
Pharmacia & Pharmorubicin Epirubicin Lung/Breast Cancer Upjohn
Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD 1839 ZD 1839
Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553
Bis-Naphtalimide Oncology BASF LU 103793 Dolastain Oncology Shering
Plough Caetyx Doxorubicin-Liposome Ovarian/Breast Cancer Lilly
Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer,
Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed
Platinum based NSCL, ovarian etc. Yamanouchi YM 116 YM 116 Prostate
Cancer Nycomed Seeds/I-125 Rapid St Lodine Seeds Prostate Cancer
Amersham Agouron Cdk4/cdk2 inhibitors cdk4/cdk2 inhibitors Solid
Tumors Agouron PARP inhibitors PARP Inhibitors Solid Tumors
Chiroscience D4809 Dexifosamide Solid Tumors Bristol Myers UFT
(Tegafur/Uracil) UFT (Tegafur/Uracil) Solid Tumors Squib Sankyo
Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide
Solid Tumors Bristol Meyers Ifex/Mesnex Ifosamide Solid Tumors
Squib Bristol Myers Vumon Teniposide Solid Tumors Squib Bristol
Myers Paraplatin Carboplatin Solid Tumors Squib Bristol Myers
Plantinol Cisplatin, Stealth Solid Tumors Squib Bristol Myers
Plantinol Cisplatin Solid Tumors Squib Bristol Myers Vepeside
Etoposide Solid Tumors Melanoma Squib Zeneca ZD 9331 ZD 9331 Solid
Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors,
Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast
Cancer Glaxo Wellcome Prodrug of guanine Prodrug of arabinside T
Cell Leukemia/Lymphoma arabinside & B Cell Neoplasm Bristol
Myers Taxane Analog Taxane Analog Taxol follow up Squib
[0281] In one embodiment, the methods of the invention use
immunostimulatory nucleic acids as a replacement to the use of
IFN.alpha. therapy in the treatment of cancer. Currently, some
treatment protocols call for the use of IFN.alpha.. Since
IFN.alpha. is produced following the administration of some
immunostimulatory nucleic acids, these nucleic acids can be used to
generate IFN.alpha. endogenously.
[0282] The invention also includes a method for inducing antigen
non-specific innate immune activation and broad spectrum resistance
to infectious challenge using the immunostimulatory nucleic acids.
The term antigen non-specific innate immune activation as used
herein refers to the activation of immune cells other than B cells
and for instance can include the activation of NK cells, T cells or
other immune cells that can respond in an antigen independent
fashion or some combination of these cells. A broad spectrum
resistance to infectious challenge is induced because the immune
cells are in active form and are primed to respond to any invading
compound or microorganism. The cells do not have to be specifically
primed against a particular antigen. This is particularly useful in
biowarfare, and the other circumstances described above such as
travelers.
[0283] The stimulation index of a particular immunostimulatory
nucleic acid can be tested in various immune cell assays.
Preferably, the stimulation index of the immunostimulatory nucleic
acid with regard to B cell proliferation is at least about 5,
preferably at least about 10, more preferably at least about 15 and
most preferably at least about 20 as determined by incorporation of
.sup.3H uridine in a murine B cell culture, which has been
contacted with 20 .mu.M of nucleic acid for 20 h at 37.degree. C.
and has been pulsed with 1 .mu.Ci of .sup.3H uridine; and harvested
and counted 4 h later as described in detail in PCT Published
Patent Applications PCT/US95/01570 (WO 96/02555) and PCT/US97/19791
(WO 98/18810) claiming priority to U.S. Ser. Nos. 08/386,063 and
08/960,774, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively.
For use in vivo, for example, it is important that the
immunostimulatory nucleic acids be capable of effectively inducing
an immune response, such as, for example, antibody production.
[0284] Immunostimulatory nucleic acids are effective in non-rodent
vertebrate. Different immunostimulatory nucleic acid can cause
optimal immune stimulation depending on the type of subject and the
sequence of the immunostimulatory nucleic acid. Many vertebrates
have been found according to the invention to be responsive to the
same class of immunostimulatory nucleic acids, sometimes referred
to as human specific immunostimulatory nucleic acids. Rodents,
however, respond to different nucleic acids. As shown herein an
immunostimulatory nucleic acid causing optimal stimulation in
humans may not generally cause optimal stimulation in a mouse and
vice versa. An immunostimulatory nucleic acid causing optimal
stimulation in humans often does, however, cause optimal
stimulation in other animals such as cow, horses, sheep, etc. One
of skill in the art can identify the optimal nucleic acid sequences
useful for a particular species of interest using routine assays
described herein and/or known in the art, using the guidance
supplied herein.
[0285] The immunostimulatory nucleic acids may be directly
administered to the subject or may be administered in conjunction
with a nucleic acid delivery complex. A nucleic acid delivery
complex shall mean a nucleic acid molecule associated with (e.g.
ionically or covalently bound to; or encapsulated within) a
targeting means (e.g. a molecule that results in higher affinity
binding to target cell (e.g., B cell surfaces and/or increased
cellular uptake by target cells). Examples of nucleic acid delivery
complexes include nucleic acids associated with a sterol (e.g.
cholesterol), a lipid (e.g. a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g. a ligand
recognized by target cell specific receptor). Preferred complexes
may be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex can be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
[0286] For use in therapy, an effective amount of an appropriate
immunostimulatory nucleic acid molecule alone or formulated as a
delivery complex can be administered to a subject by any mode
allowing the oligonucleotide to be taken up by the appropriate
target cells (e.g., B-cells and monocytic cells). Preferred routes
of administration include oral and transdermal (e.g., via a patch).
Examples of other routes of administration include injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.). The injection can be in a bolus or a continuous
infusion.
[0287] Delivery vehicles or delivery devices for delivering antigen
and nucleic acids to surfaces have been described. The
Immunostimulatory nucleic acid and/or the antigen and/or other
therapeutics may be administered alone (e.g., in saline or buffer)
or using any delivery vehicles known in the art. For instance the
following delivery vehicles have been described: Cochleates
(Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al.,
1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et
al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers
et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b);
Live bacterial vectors (e.g., Salmonella, Escherichia coli,
Bacillus calmatte-guerin, Shigella, Lactobacillus) (Hone et al.,
1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al.,
1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia,
adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et
al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et
al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996,
Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994,
Eldridge et al., 1989); Nucleic acid vaccines (Fynan et al., 1993,
Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii
et al., 1997); Polymers (e.g. carboxymethylcellulose, chitosan)
(Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings
(Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et
al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et
al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995,
Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl
et al., 1998). Other delivery vehicles are known in the art and
some additional examples are provided below in the discussion of
vectors.
[0288] The term effective amount of a immunostimulatory nucleic
acid refers to the amount necessary or sufficient to realize a
desired biologic effect. For example, an effective amount of a
immunostimulatory nucleic acid for inducing mucosal immunity is
that amount necessary to cause the development of IgA in response
to an antigen upon exposure to the antigen, whereas that amount
required for inducing systemic immunity is that amount necessary to
cause the development of IgG in response to an antigen upon
exposure to the antigen. Combined with the teachings provided
herein, by choosing among the various active compounds and weighing
factors such as potency, relative bioavailability, patient body
weight, severity of adverse side-effects and preferred mode of
administration, an effective prophylactic or therapeutic treatment
regimen can be planned which does not cause substantial toxicity
and yet is entirely effective to treat the particular subject. The
effective amount for any particular application can vary depending
on such factors as the disease or condition being treated, the
particular immunostimulatory nucleic acid being administered, the
antigen, the size of the subject, or the severity of the disease or
condition. One of ordinary skill in the art can empirically
determine the effective amount of a particular immunostimulatory
nucleic acid and/or antigen and/or other therapeutic agent without
necessitating undue experimentation.
[0289] Subject doses of the compounds described herein for mucosal
or local delivery typically range from about 0.1 .mu.g to 10 mg per
administration, which depending on the application could be given
daily, weekly, or monthly and any other amount of time
therebetween. More typically mucosal or local doses range from
about 10 .mu.g to 5 mg per administration, and most typically from
about 100 .mu.g to 1 mg, with 2-4 administrations being spaced days
or weeks apart. More typically, immune stimulant doses range from 1
.mu.g to 10 mg per administration, and most typically 10 .mu.g to 1
mg, with daily or weekly administrations. Subject doses of the
compounds described herein for parenteral delivery for the purpose
of inducing an antigen-specific immune response, wherein the
compounds are delivered with an antigen but not another therapeutic
agent are typically 5 to 10,000 times higher than the effective
mucosal dose for vaccine adjuvant or immune stimulant applications,
and more typically 10 to 1,000 times higher, and most typically 20
to 100 times higher. Doses of the compounds described herein for
parenteral delivery for the purpose of inducing an innate immune
response or for increasing ADCC or for inducing an antigen specific
immune response when the immunostimulatory nucleic acids are
administered in combination with other therapeutic agents or in
specialized delivery vehicles typically range from about 0.1 .mu.g
to 10 mg per administration, which depending on the application
could be given daily, weekly, or monthly and any other amount of
time therebetween. More typically parenteral doses for these
purposes range from about 10 .mu.g to 5 mg per administration, and
most typically from about 100 .mu.g to 1 mg, with 2-4
administrations being spaced days or weeks apart. In some
embodiments, however, parenteral doses for these purposes may be
used in a range of 5 to 10,000 times higher than the typical doses
described above.
[0290] For any compound described herein the therapeutically
effective amount can be initially determined from animal models. A
therapeutically effective dose can also be determined from human
data for CpG oligonucleotides which have been tested in humans
(human clinical trials have been initiated) and for compounds which
are known to exhibit similar pharmacological activities, such as
other mucosal adjuvants, e.g., LT and other antigens for
vaccination purposes, for the mucosal or local administration.
Higher doses are required for parenteral administration. The
applied dose can be adjusted based on the relative bioavailability
and potency of the administered compound. Adjusting the dose to
achieve maximal efficacy based on the methods described above and
other methods as are well-known in the art is well within the
capabilities of the ordinarily skilled artisan.
[0291] The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0292] For use in therapy, an effective amount of the
immunostimulatory nucleic acid can be administered to a subject by
any mode that delivers the nucleic acid to the desired surface,
e.g., mucosal, systemic. Administering the pharmaceutical
composition of the present invention may be accomplished by any
means known to the skilled artisan. Preferred routes of
administration include but are not limited to oral, parenteral,
intramuscular, intranasal, intratracheal, inhalation, ocular,
vaginal, and rectal.
[0293] For oral administration, the compounds (i.e.,
immunostimulatory nucleic acids, antigens and other therapeutic
agents) can be formulated readily by combining the active
compound(s) with pharmaceutically acceptable carriers well known in
the art. Such carriers enable the compounds of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels,
syrups, slurries, suspensions and the like, for oral ingestion by a
subject to be treated. Pharmaceutical preparations for oral use can
be obtained as solid excipient, optionally grinding a resulting
mixture, and processing the mixture of granules, after adding
suitable auxiliaries, if desired, to obtain tablets or dragee
cores. Suitable excipients are, in particular, fillers such as
sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers for neutralizing
internal acid conditions or may be administered without any
carriers.
[0294] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0295] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
[0296] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0297] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0298] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0299] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0300] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0301] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0302] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
[0303] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0304] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer, Science 249:1527-1533, 1990, which is incorporated herein
by reference.
[0305] The immunostimulatory nucleic acids and optionally other
therapeutics and/or antigens may be administered per se (neat) or
in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0306] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0307] The pharmaceutical compositions of the invention contain an
effective amount of a Immunostimulatory nucleic acid and optionally
antigens and/or other therapeutic agents optionally included in a
pharmaceutically-acceptable carrier. The term
pharmaceutically-acceptable carrier means one or more compatible
solid or liquid filler, diluents or encapsulating substances which
are suitable for administration to a human or other vertebrate
animal. The term carrier denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being commingled
with the compounds of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficiency.
[0308] The immunostimulatory nucleic acids useful in the invention
may be delivered in mixtures with additional adjuvant(s), other
therapeutics, or antigen(s). A mixture may consist of several
adjuvants in addition to the Immunostimulatory nucleic acid or
several antigens or other therapeutics.
[0309] A variety of administration routes are available. The
particular mode selected will depend, of course, upon the
particular adjuvants or antigen selected, the particular condition
being treated and the dosage required for therapeutic efficacy. The
methods of this invention, generally speaking, may be practiced
using any mode of administration that is medically acceptable,
meaning any mode that produces effective levels of an immune
response without causing clinically unacceptable adverse effects.
Preferred modes of administration are discussed above.
[0310] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
compounds into association with a carrier which constitutes one or
more accessory ingredients. In general, the compositions are
prepared by uniformly and intimately bringing the compounds into
association with a liquid carrier, a finely divided solid carrier,
or both, and then, if necessary, shaping the product. Liquid dose
units are vials or ampoules. Solid dose units are tablets, capsules
and suppositories. For treatment of a patient, depending on
activity of the compound, manner of administration, purpose of the
immunization (i.e., prophylactic or therapeutic), nature and
severity of the disorder, age and body weight of the patient,
different doses may be necessary. The administration of a given
dose can be carried out both by single administration in the form
of an individual dose unit or else several smaller dose units.
Multiple administration of doses at specific intervals of weeks or
months apart is usual for boosting the antigen-specific
responses.
[0311] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compounds, increasing
convenience to the subject and the physician. Many types of release
delivery systems are available and known to those of ordinary skill
in the art. They include polymer base systems such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides. Microcapsules of the foregoing polymers containing
drugs are described in, for example, U.S. Pat. No. 5,075,109.
Delivery systems also include non-polymer systems that are: lipids
including sterols such as cholesterol, cholesterol esters and fatty
acids or neutral fats such as mono-di- and tri-glycerides; hydrogel
release systems; sylastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152, and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
[0312] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
[0313] Materials and Methods:
[0314] Oligodeoxynucleotides: Native phosphodiester and
phosphorothioate-modified ODN were purchased from Operon
Technologies (Alameda, Calif.) and Hybridon Specialty Products
(Milford, Mass.). ODN were tested for endotoxin using the LAL-assay
(LAL-assay BioWhittaker, Walkersville, Md.; lower detection limit
0.1 EU/ml). For in vitro assays, ODN were diluted in TE-buffer (10
mM Tris, pH 7.0, 1 mM EDTA), and stored at -20.degree. C. For in
vivo use, ODN were diluted in phosphate buffered saline (0.1 M PBS,
pH 7.3) and stored at 4.degree. C. All dilutions were carried out
using pyrogen-free reagents.
[0315] Isolation of human PBMC and cell culture: Peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers by Ficoll-Paque density gradient centrifugation
(Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described
(Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96:9305-10). Cells
were suspended in RPMI 1640 culture medium supplemented with 10%
(v/v) heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan,
Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete
medium). Cells (final concentration 1.times.10.sup.6 cells/ml) were
cultured in complete medium in a 5% CO.sub.2 humidified incubator
at 37.degree. C. ODN and LPS (from Salmonella typhimurium, Sigma
Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For
measurement of human NK lytic activity, PBMC were incubated at
5.times.10.sup.6/well in 24-well plates. Cultures were harvested
after 24 hours, and cells were used as effectors in a standard 4
hours .sup.51Cr-release assay against K562 target cells as
previously described (Ballas et al., 1996 J. Immunol.
157:1840-1845). For B cell proliferation, 1 .mu.Ci of .sup.3H
thymidine was added 18 hours before harvest, and the amount of
.sup.3H thymidine incorporation was determined by scintillation
counting at day 5. Standard deviations of the triplicate wells were
<5%.
[0316] Flow cytometry on human PBMC: Surface antigens on primate
PBMC were stained as previously described (Hartmann et al., 1998 J.
Pharmacol. Exp. Ther. 285:920-928). Monoclonal antibodies to CD3
(UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86
(2331 [FUN-1]) were purchased from Pharmingen, San Diego, Calif.
IgG.sub.1,.kappa. (MOPC-21) and IgG.sub.2b,.kappa. (Hartmann et
al., 1999 Proc. Natl. Acad. Sci USA 96:9305-10) were used to
control for non-specific staining. NK cells were identified by CD56
expression on CD3, CD14 and CD19 negative cells, whereas B cells
were identified by expression of CD19. Flow cytometric data of
10000 cells per sample were acquired on a FACScan (Beckton
Dickinson Immunocytometry Systems, San Jose, Calif.). The viability
of cells within the FSC/SSC gate used for analysis was examined by
propidium iodide staining (2 .mu.g/ml) and found to be higher than
98%. Data were analyzed using the computer program FlowJo (version
2.5.1, Tree Star, Inc., Stanford, Calif.).
[0317] Results:
Example 1
CpG-Dependent Stimulation of Human B Cells Depends on Methylation
and ODN Length
[0318] Human PBMC were obtained from normal donors and cultured for
five days at 2.times.10.sup.5 cells/well with the indicated
concentrations of the indicated ODN sequences. As shown in Table F,
human PBMCs proliferate above the background when cultured with a
variety of different CpG ODN, but also show some proliferation even
with ODN that do not contain any CpG motifs. The importance of
unmethylated CpG motifs in providing optimal immune stimulation
with these ODN is demonstrated by the fact that ODN 1840 (SEQ ID
NO. 83) induces 56,603 counts of .sup.3H-thymidine incorporation
whereas the same T-rich ODN with the CpG motifs methylated
(non-CpG), 1979 (SEQ ID NO. 222), induces lower, but still
increased over background, activity (only 18,618 counts) at the
same concentration of 0.6 .mu.g/ml. The reduced proliferation at
higher ODN concentrations may be an artifact of the cells becoming
exhausted under these experimental conditions or could reflect some
toxicity of the higher ODN concentrations. Interestingly, shorter
ODN containing CpG motifs, such as the 13-14 mers 2015 and 2016,
are less stimulatory despite the fact that their molar
concentration would actually be higher since the ODNs were added on
the basis of mass rather than molarity. This demonstrates that ODN
length may also be an important determinant in the immune effects
of the ODN. A non-CpG ODN but slight T-rich ODN (about 30% T), 1982
(SEQ ID NO. 225), caused only a small amount of background cell
proliferation. TABLE-US-00006 TABLE F Oligo Concentration ODN# 0.15
.mu.g/ml 0.6 .mu.g/ml 2 .mu.g/ml Cues only 648 837 799 1840 5744
56,603 31,787 (SEQ ID NO. 83) 2016 768 4607 20,497 (SEQ ID NO. 256)
1979 971 18,618 29,246 (SEQ ID NO. 222) 1892 787 10,078 22,850 (SEQ
ID NO. 135) 2010 849 20,741 8,054 (SEQ ID NO. 250) 2012 2586 62,955
52,462 (SEQ ID NO. 252) 2013 1043 47,960 47,231 (SEQ ID NO. 253)
2014 2700 50,708 46,625 (SEQ ID NO. 254) 2015 1059 23,239 36,119
(SEQ ID NO. 255)
[0319] Numbers represent cpm of .sup.3H-thymidine incorporation for
cultures of human PBMCs set up as described above.
Example 2
Concentration-Dependent Activation of Human NK Cell Activity with
Thymidine-Rich ODN
[0320] Human PBMCs were cultured for 24 hours with a panel of
different CpG or non-CpG ODN at two different concentrations, and
then tested for their ability to kill NK target cells as described
previously (Ballas et al., 1996 J. Immunol. 157:1840-1845). Killing
is measured as lytic units, or L.U. The human donor used in this
experiment had a background level of 3.69 L.U. which increased to
180.36 L.U. using the positive control, IL-2. A CpG oligo, 2006
(SEQ ID NO. 246), induced high levels of NK lytic function at a low
concentration of 0.6, and a lower level at a concentration of 6.0.
Surprisingly, a T-rich ODN in which the CpG motifs of 2006 were
methylated (ODN at 2117 (SEQ ID NO. 358)) or inverted to GpCs (ODN
2137 (SEQ ID NO. 886)) retained strong immune stimulatory function
at the higher ODN concentrations, as shown in Table G. These
concentration-dependent immune stimulatory effects are not a
general property of the phosphorothioate backbone since the
experiments described below demonstrate that a poly-A ODN, is
nonstimulatory above background levels. Some stimulation is seen
with a 24-base long ODN in which all of the base positions are
randomized so that A, C, G, and T will occur at a frequency of 25%
in each of the base positions (ODN 2182 (SEQ ID NO. 432)). However,
the stimulatory effect of such a 24-base ODN is greatly enhanced if
it is pure poly-T, in which case stimulation is also seen at the
lowest concentration of 0.6 .mu.g/ml (ODN 2183 (SEQ ID NO. 433)).
In fact, the stimulatory activity of ODN SEQ ID NO. 433 at this low
concentration is higher than that of any other ODN tested at this
low concentration, aside from the optimal human immune stimulatory
ODN of SEQ ID NO. 246. In fact, the higher concentration of ODN SEQ
ID NO. 433 stimulated more NK activity than any other
phosphorothioate ODN except for the strong CpG ODN 2142 (SEQ ID NO.
890), which was marginally higher. If the G content of ODN SEQ ID
NO. 246 is increased relative to the T content by addition of more
Gs, thus resulting in a decrease in the proportion of T nucleotides
the immune stimulatory effect of the ODN is reduced (see ODN 2132
(SEQ ID NO. 373)). Thus, the T content of an ODN is an important
determinant of its immune stimulatory effect. Although a poly-T ODN
is the most stimulatory of the non-CpG ODN, other bases are also
important in determining the immune stimulatory effect of a non-CpG
ODN. ODN 2131 (SEQ ID NO. 372), in which slightly more than half of
the bases are T and in which there are no Gs, is immune stimulatory
at a concentration of 6 .mu.g/ml but has less activity than other
T-rich ODN. If the 6 A's in ODN 2131 (SEQ ID NO. 372) are replaced
by 6 Gs, the immune stimulatory effect of the ODN can be increased
(see ODN 2130 (SEQ ID NO. 371)). TABLE-US-00007 TABLE G HUMAN PBL
CULTURED OVERNIGHT WITH OLIGOS MR 3605 SR 256 % SR 7.11 EFFECTOR
0.63 1.25 2.50 5.00 10.00 20.00 ##STR1## ##STR2## ALONE 2.65 5.45
10.15 17.65 29.92 39.98 3.69 +IL2 (100 U/ml) 35.95 57.66 86.26
100.39 99.71 93.64 180.36 +1585 (0.6 3.75 6.10 12.14 23.70 36.06
43.98 5.48 ug/ml) +1585 (6.0 15.42 31.09 47.07 73.34 94.29 97.73
35.85 ug/ml) +2006 (0.6 6.71 15.99 26.92 44.75 64.12 68.83 16.96
ug/ml) +2006 (6.0 6.19 8.18 16.13 24.35 39.35 56.07 8.04 ug/ml)
+2117(0.6 4.54 4.73 9.56 18.04 28.57 39.85 3.49 ug/ml) +2117 (6.0
7.03 10.76 16.90 30.59 52.14 59.46 10.96 ug/ml) +2137 (0.6 4.61
5.35 10.04 15.16 23.79 37.86 2.57 ug/ml) +2137 (6.0 7.99 10.37
16.55 32.32 49.78 60.30 11.01 ug/ml) +2178 (0.6 2.88 4.52 11.47
16.05 24.85 34.27 2.37 ug/ml) +2178 (6.0 4.21 5.03 11.16 16.39
28.22 36.45 2.94 ug/ml) +2182 (0.6 2.42 6.57 10.49 19.73 26.55
35.30 2.89 ug/ml) +2182 (6.0 4.11 7.98 14.60 26.56 40.40 51.98 7.59
ug/ml) +2183 (0.6 3.73 8.46 15.52 24.48 37.78 56.77 7.80 ug/ml)
+2183 (0.6 8.86 12.89 23.08 41.49 66.26 75.85 16.57 ug/ml) +2140
(0.6 3.78 5.27 12.30 20.79 35.75 45.62 5.40 ug/ml) +2140 (6.0 6.56
13.24 21.26 37.96 60.80 73.05 14.82 ug/ml) +2141 (0.6 2.63 6.34
10.21 17.73 30.93 43.57 4.29 ug/ml) +2141 (6.0 4.98 15.30 25.22
37.88 58.47 69.12 14.83 ug/ml) +2142 (0.6 3.18 3.66 6.99 14.62
19.68 32.52 1.56 ug/ml) +2142 (6.0 7.08 15.80 25.65 41.72 68.09
73.14 17.11 ug/ml) +2143 (0.6 4.12 6.90 10.77 22.96 35.78 42.94
5.19 ug/ml) +2143 (6.0 3.16 8.40 12.38 21.69 34.80 54.21 6.64
ug/ml) +2159 (6.0 5.05 11.76 21.67 41.12 51.68 65.47 13.19 ug/ml)
+2132 (6.0 4.23 6.06 10.50 18.74 32.68 44.06 4.61 ug/ml) +2179 (6.0
6.14 9.49 21.06 42.48 60.12 71.87 14.54 ug/ml) +2180 (6.0 2.37 8.57
15.44 29.66 44.35 61.31 9.47 ug/ml) +2133 (6.0 6.53 12.58 23.10
38.03 61.16 68.36 14.62 ug/ml) +2134 (6.0 7.51 12.14 21.14 32.46
54.47 67.12 12.98 ug/ml) +2184 (6.0 5.22 9.19 17.54 30.76 45.35
63.55 10.42 ug/ml) +2185 (6.0 8.11 14.77 26.27 40.31 55.61 70.65
15.60 ug/ml) +2116 (6.0 5.58 10.54 16.77 37.82 59.80 66.33 13.07
ug/ml) +2181 (6.0 4.43 9.85 17.55 27.05 53.16 69.16 11.43 ug/ml)
+2130 (6.0 3.81 8.07 17.11 27.17 42.04 53.73 8.27 ug/ml) +2131 (6.0
2.29 6.73 7.30 18.02 32.73 49.06 5.08 ug/ml) +2156 (0.3 2.50 5.26
8.20 15.95 26.64 33.07 2.31 ug/ml) +2156 (1.0 5.91 10.99 17.31
26.97 50.64 63.78 10.84 ug/ml) +2157 (0.3 2.36 4.00 6.65 12.94
24.13 38.86 2.58 ug/ml) +2157 (1.0 3.72 9.55 17.15 34.55 52.27
65.33 11.58 ug/ml) +2158 (0.3 1.25 2.36 6.90 16.39 15.63 29.82 1.17
ug/ml) +2158 (1.0 4.73 7.26 11.07 15.55 30.80 43.71 4.16 ug/ml)
+2118 (0.6 1.55 3.38 6.85 13.36 20.15 27.71 1.13 ug/ml) +2118 (6.0
2.65 3.88 9.29 12.19 22.47 28.99 1.34 ug/ml)
Example 3
Induction of B Cell Proliferation by T-Rich Non-CpG ODN
[0321] To assess the ability of T-rich ODN to activate B cell
proliferation, human PBMCs were stained with the cytoplasmic dye
CSFE, incubated with five days with the indicated ODN at either
0.15 or 0.3 ug/ml, and then analyzed by flow cytometry. B cells
were identified by gating on cells positive for the lineage marker
CD19). CpG ODN 2006 was a strong inducer of B cell proliferation,
and this effect was reduced if the CpG motifs were methylated or
inverted to GpC as shown in FIGS. 1A, B, C and D at an ODN
concentration of 0.3 ug/ml. The base composition of the ODN appears
to be important in determining the immune stimulatory effect.
Reducing the T content of an ODN substantially reduces immune
stimulatory effect, as exemplified by ODN 2177 (SEQ ID NO. 427) in
which 6 of the Ts present in ODN 2137 (SEQ ID NO. 886) have been
switched to A's, resulting in a greatly reduced immune stimulatory
effect. The importance of T's in the immune stimulatory effect of
an ODN is also shown by comparison of ODN 2116 (SEQ ID NO. 357) and
2181 (SEQ ID NO. 431), which differ in the 3' end of the ODN. ODN
2181, in which the 3' end is poly-T is more stimulatory than ODN
2116, in which the 3' end is poly-C, despite the fact that both ODN
have a TCGTCG at the 5' end.
Example 4
B Cell Proliferation Induced by TG Oligonucleotides
[0322] The stimulatory effects of TG motifs are shown in FIG. 2.
ODN 2137 has the identical base composition as ODN 2006, but the CG
motifs have all been inverted to GC's resulting in a CG-free
nucleic acid. ODN does however contain 6 TG dinucleotides. In ODN
2177, all the TG dinucleotides of ODN 2137 have been changed to AG.
Although ODN 2177 contains only 6 adenines, it is virtually
nonstimulatory at a concentration of 0.2 .mu.g/ml. For comparison,
an ODN 24 bases in length in which each position is randomized to
be any of the four bases (ODN 2182) induces >12% of B cells to
proliferate at a concentration of 0.2 .mu.g/ml. These results
indicate that the stimulatory effects of ODN 2137 are not simply
those of a phosphorothioate backbone, but relate to the presence of
TG dinucleotides.
[0323] In order to determine the effect of varying the number of TG
dinucleotide motifs, ODN 2200 and ODN 2202 were compared, as shown
in FIG. 2. Both ODN contain 18 Ts and 6 Gs, but in ODN 2200 all of
the Gs are consecutive, so that there is only one TG dinucleotide,
whereas in ODN 2202, the Gs are split up as GG dinucleotides
throughout the ODN so that there are three TGs. ODN 2202 is
significantly more stimulatory than ODN 2200, consistent with the
model that at least three TG motifs in an ODN are required for
optimal stimulatory activity. It is likely that even higher levels
of stimulation could be achieved if the TG motifs had been
optimized as taught herein.
Example 5
Effects of TTG Versus TTG Motifs
[0324] FIG. 3 shows the results of experiments conducted to study
TG content in terms of the relative levels of Ts versus Gs as it
relates to the stimulatory effect of an ODN. The Figure shows that
an ODN in which all of the bases are randomized to be either T or G
(ODN 2188 (SEQ ID NO. 905)) is nonstimulatory at a concentration of
0.2 .mu.g/ml, similar to an ODN in which all of the bases are
randomized to be either A or G (ODN 2189 (SEQ ID NO. 906)).
However, at the higher concentration of 2 .mu.g/ml, the randomized
T/G ODN 2188 is significantly more stimulatory. This latter level
of stimulation is still lower than that which occurs with a totally
randomized ODN (ODN 2182 (SEQ ID NO. 432)). The highest stimulation
at low concentrations is seen with an ODN in which half of the
bases are fixed at T and the other half of the bases are randomized
to be either T or G (ODN 2190 (SEQ ID NO. 907)). Since every other
base is fixed to be a T, there cannot be any TG motifs. The data in
FIG. 3 show that increasing the TG content of an ODN improves its
stimulatory activity.
[0325] In yet other experiments, the results of which are not
diagrammed herein, ODN 2190 (SEQ ID NO. 907) exhibited a
stimulation of NK activity compared to ODN 2188 (SEQ ID NO. 905) or
ODN 2189 (SEQ ID NO. 906).
Examples 6-8
[0326] Introduction:
[0327] Above, we demonstrated that Poly T sequences are able to
enhance stimulation of B and NK cells. Here and below we
investigate the effect of a variety of non-CpG T-rich ODN as well
as Poly C ODN for their ability to stimulate human B cells, NK
cells and monocytes.
[0328] Materials and Methods.
[0329] Oligonucleotides: Phosphorothioate-modified ODN were
purchased from ARK Scientific GmbH (Darmstadt, Germany). The
sequences used were: 1982: 5'-tccaggacttctctcaggtt-3' (SEQ ID NO.:
225), 2006: 5'-tcgtcgttttgtcgttttgtcgtt-3' (SEQ ID NO.: 246), 2041:
5'-ctggtctttctggtttttttctgg-3' (SEQ ID NO.: 282), 2117:
5'-tzgtzgttttgtgtzgttttgtzgtt-3' (SEQ ID NO.: 358), 2137:
5'-tgctgcttttgtgcttttgtgctt-3' (SEQ ID NO.: 886), 2183:
5'-ttttttttttttttttttttt-3' (SEQ ID NO.: 433), 2194:
5'-tttttttttttttttMttttttttt-3' (SEQ ID NO.: 911), 2196:
5'-tttttttttttttttt-3' (SEQ ID NO.: 913), 5126:
5'-ggttcttttggtccttgtct-3' (SEQ ID NO.: 1058), 5162:
5'-tttttttttttttttttttttttttttttt-3' (SEQ ID NO.: 1094), 5163:
5'-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3' (SEQ ID NO.: 1095), 5168:
5'-cccccccccccccccccccccccccccccc-3' (SEQ ID NO.: 1096) and 5169:
5'-cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg-3' (SEQ ID NO.: 1097). Most ODN
were tested for LPS content using the LAL assay (BioWhittaker,
Belgium) (lower detection limit 0.1 EU/ml) also described herein.
For all assays ODN were diluted in TE buffer and stored at
-20.degree. C. All dilutions were conducted using pyrogen-free
reagents.
[0330] Cell preparation and cell culture: Human PBMC were isolated
from peripheral blood of healthy volunteers, obtained by the German
Red Cross (Ratingen, Germany), as described above in Example 1, but
all material were purchased from Life Technologies, Germany and
were endotoxin-tested. For the B cell, NK cell and monocyte
activation assays PBMC were cultured in complete medium at a
concentration of 2.times.10.sup.6 cells/ml in 200 .mu.l in 96 round
bottom plates in a humidified incubator at 37.degree. C. Different
ODNs, LPS (Sigma) or IL-2 (R&D Systems, USA) were used as
stimuli. At the indicated time points, cells were harvested for
flow cytometry.
[0331] Flow cytometry: MAbs used for staining of surface antigens
were: CD3, CD14, CD19, CD56, CD69, CD80 and CD86 (all obtained from
Pharmingen/Becton Dickinson, Germany). For monocytes Fc receptors
were blocked using human IgG (Myltenyi, Germany) as previously
described (Bauer, M., K. Heeg, H. Wagner, and G. B. Lipford. 1999.
DNA activates human immune cells through a CpG sequence dependent
manner. Immunology 97:699). Flow cytometric data of at least 1000
cells of a specified subpopulation (B cells, monocytes, NK cells,
NKT cells or T cells) were acquired on a FACSCalibur (Becton
Dickinson). Data were analyzed using the program CellQuest (Becton
Dickinson).
[0332] NK-mediated cytotoxicity: PBMC were cultured overnight with
or without 6 .mu.g/ml ODN or 100 U/ml IL-2 at 37.degree. C., 5%
CO.sub.2. The next morning, K-562 target cells were labeled with a
fluorescent dye, CFSE, as described previously for human B cells
(Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a
newly identified CpG DNA motif in human primary B cells. J.
Immunol. 164:944). PBMC were added in different ratios (50:1, 25:1
and 12.5:1) to 2.times.10.sup.5 target cells and incubated for 4 h
at 37.degree. C. Cells were harvested and incubated with the
DNA-specific dye 7-AAD (Pharmingen) for detection of apoptotic
cells. Results were measured by flow cytometry.
[0333] ELISA: PBMC (3.times.10.sup.6 cells/ml) were cultured with
the specified concentrations of ODN or LPS for 24 h (IL-6,
IFN.gamma. and TNF.alpha.) or 8 h (IL-1.beta.) in 48 well plates in
a humidified atmosphere at 37.degree. C. Supernatants were
collected and cytokines were measured using OPTeia ELISA Kits
(Pharmingen) for IL-6, IFN.gamma. and TNF.alpha. or an Eli-pair
ELISA assay (Hoelzel, Germany) for IL-1.beta. according to the
manufacturer protocols.
Example 6
B Cell Activation Induced by ODNs Lacking CpG Motifs
[0334] In the Experiments described above in Example 3, we
demonstrate that T-rich ODN were capable of activating B cells. We
expand those studies here using additional ODN and different cell
and reagent sources. In a first set of experiments, we compared the
activation potential of different non-CpG T-rich ODNs with the very
potent known CpG ODN 2006 (SEQ ID NO.: 246). PBMC (2.times.10.sup.6
cells/ml) of a blood donor (n=2) were incubated with the indicated
concentrations of ODNs 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.:
358), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058), and 5162
(SEQ ID NO.: 1094). Cells were incubated for 48 h at 37.degree. C.
as described above and stained with mAb for CD19 (B cell marker)
and CD86 (B cell activation marker, B7-2). Expression was measured
by flow cytometry.
[0335] Using different concentrations of ODNs, we showed (FIG. 4)
that T-rich ODNs without a CpG motif, can induce stimulation of
human B cells. ODN 5126 (SEQ ID NO.: 1058) which contains only a
single poly-T sequence but is greater than 50% T, caused high
levels of human B cell activation. Although there are some
similarities to SEQ ID NO.: 246 (e.g. more than 80% T/G content),
this ODN clearly lacks any known immunostimulatory CpG motif.
Surprisingly, for all tested T-rich ODNs, the highest stimulatory
index was obtained at concentrations between 3 and 10 .mu.g/ml. The
highest stimulatory index of the tested ODNs was achieved by
CpG/T-rich ODN SEQ ID NO.: 246 at 0.4 .mu.g/ml. Interestingly, the
activity decreased at high concentrations.
[0336] Poly A, Poly C and Poly T sequences were synthesized and
tested for biological activity. PBMC (2.times.10.sup.6 cells/ml) of
one representative donor (n=3) were stimulated as described above
by 0.4 .mu.g/ml, 1.0 .mu.g/ml or 10.0 .mu.g/ml of the following
ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913) (Poly T, 18
bases), 2194 (SEQ ID NO.: 911) (Poly T, 27 bases), 5162 (SEQ ID
NO.: 1094) (Poly T, 30 bases), 5163 (SEQ ID NO.: 1095) (Poly A, 30
bases), 5168 (SEQ ID NO.: 1096) (Poly C, 30 bases) and 5169 (SEQ ID
NO.: 1097) (Poly CG, 30 bases). Expression of the activation marker
CD86 (B7-2) on CD19-positive B cells was measured by flow
cytometry.
[0337] FIG. 5 demonstrates that the length of the sequence, at
least for Poly T ODNs, has an important impact on its activity. A
Poly T sequence containing only 18 bases (SEQ ID NO.: 913) was
shown to be less stimulatory than one with 27 bases (SEQ ID NO.:
911) or one with 30 bases (SEQ ID NO.: 1094) with a clear rank of
stimulation: SEQ ID NO.: 1094>SEQ ID NO.: 911>SEQ ID NO.:
913. Poly A (SEQ ID NO.: 1095) or Poly CG (SEQ ID NO.: 1097)
sequences, in contrast, do not induce activation of human B cells.
Surprisingly it was also discovered that Poly C sequences (SEQ ID
NO.: 1096) can activate human B cells at least at high
concentrations (10 .mu.g/ml) (FIG. 5).
[0338] Two other T-rich ODNs, namely 1982 (SEQ ID NO.: 225) and
2041 (SEQ ID NO.: 282) lacking CpG motifs were tested for their
effect on human B cells. PBMC (n=2) were incubated with the
indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ
ID NO.: 225) and 2041 (SEQ ID NO.: 282) as described above. B cell
activation (expression of the activation marker CD86) was measured
by flow cytometry.
[0339] FIG. 6 demonstrates that T-rich non-CpG ODN are
immunostimulatory at concentrations higher than 1 .mu.g/ml.
Incorporation of a CpG motif into 1982 enhanced the
immunostimulatory activity. Elongation with a Poly T sequence did
not enhance the immunostimulatory activity of this already T-rich
ODN but rather, decreased the activation potential slightly.
Example 7
Immunostimulation of Non-CpG ODNs is Reflected in the Enhancement
of NK Activation, NK Cytotoxicity and Monocyte Activation
[0340] NK cells as well as monocytes were tested for their response
to non-CpG ODNs. PBMC (2.times.10.sup.6 cells/ml) were incubated
with 6 .mu.g/ml of the following ODNs (n=4): 2006 (SEQ ID NO.:
246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID
NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058).
After 24 h of cultivation at 37.degree. C. cells were harvested and
stained with mAb for CD3 (T cell marker), CD56 (NK cell marker) and
CD69 (early activation marker) as described above. Expression of
CD69 on CD56-positive NK cells was measured by flow cytometry.
[0341] FIG. 7 shows that for Poly T ODNs similar effects can be
observed as described in FIG. 5. The stimulation of NK cells, like
B cells, may be influenced by the length of the ODN. ODN 2183 (SEQ
ID NO.: 433) (21 bases) induced activation of NK cells but to a
lesser extent than the longer ODN 2194 (SEQ ID NO.: 911) (27
bases), as measured by enhanced expression of the early activation
marker CD69. ODN 5126 (SEQ ID NO.: 1058) was also demonstrated to
activate human NK cells (FIG. 7).
[0342] It is believed that the anti-tumor activity of CpG ODNs can
be assessed by the ability of the ODN to enhance NK-mediated
cytotoxicity in vitro. ODNs containing at the 5' and 3' ends
stretches of Poly G were shown to result in the highest induction
of cytotoxicity (Ballas, Z. K., W. L. Rasmussen, and A. M. Krieg.
1996. Induction of natural killer cell activity in murine and human
cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J.
Immunol. 157:1840). To investigate the influence of non-CpG T-rich
ODN on NK cytotoxicity, we analyzed the effect of the ODNs 2194
(SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) on NK-mediated lysis
(FIG. 8). NK-mediated lysis of K-562 target cells was measured
after over night incubation of PBMC with 6 .mu.g/ml of the ODN 2006
(SEQ ID NO.: 246), SEQ ID NO.: 911 (SEQ ID NO.: 911) (Poly T, 27
bases) and 5126 (SEQ ID NO.: 1058) as described above. SEQ ID NO.:
1058 demonstrated small increases in lysis by human NK cells as
compared to no ODN. SEQ ID NO.: 911 and SEQ ID NO.: 246 enhanced
human NK cell cytotoxicity to an even higher extent.
[0343] Previous reports demonstrated that not only NK cells but
also NKT cells are mediators of cytotoxic responses to tumor cells
(14). We, therefore, looked at the potential activation of human
NKT cells by T-rich non-CpG ODN. PBMC of one representative donor
(n=2) were incubated with 6 .mu.g/ml ODN 2006 (SEQ ID NO.: 246),
2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.:
433), 2194 (SEQ ID NO.: 913) and 5126 (SEQ ID NO.: 1058) for 24 h
as described above. Activation of NKT cells was measured by flow
cytometry after staining of cells with mAb for CD3 (T cell marker),
CD56 (NK cell marker) and CD69 (early activation marker). Shown is
the expression of CD69 on CD3 and CD56 double-positive cells (NKT
cells).
[0344] In FIG. 9, SEQ ID NO.: 911 as well as SEQ ID NO.: 1058 were
found to stimulate NKT cells. Similar to NK cells SEQ ID NO.: 911
(Poly T) was more active than SEQ ID NO. 1058. In addition, as
described above for B cells and NK cells, the length of the ODN has
some influence on the immunostimulatory potential, with the longer
ODN having stronger effects on NKT cells. Similar results were
observed for human T cells.
[0345] Another type of cell of the immune system involved in
fighting infections is the monocytes. These cells release upon
activation a variety of cytokines and can mature into dendritic
cells (DC), professional antigen-presenting cells (Roitt, I., J.
Brostoff, and D. Male. 1998. Immunology. Mosby, London). FIG. 10
shows activation of human monocytes after culturing of PBMC with
different ODNs. PBMC (2.times.10.sup.6 cells/ml) were incubated
with 6 .mu.g/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358),
2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.:1096), 2183 (SEQ ID NO.:
433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ
ID NO.: 1095) overnight at 37.degree. C. as described above (n=3).
Cells were harvested and stained for CD14 (monocyte marker) and
CD80 (B7-1, activation marker). Expression was measured by flow
cytometry.
[0346] As demonstrated above for NK and B cells, T-rich sequences
(e.g., SEQ ID NO.: 433, SEQ ID NO.: 911) of different length induce
monocyte stimulation but have different levels of activity e.g.,
SEQ ID NO.: 433>SEQ ID NO.: 911. Poly A (SEQ ID NO.: 1095) as
well as Poly C (SEQ ID NO.: 1096 (2178) sequences, in contrast, did
not lead to activation of monocytes (measured by the upregulation
of CD80 at a concentration of 6 .mu.g/ml ODN).
Example 8
Induction of Cytokine Release by Non-CpG ODNs
[0347] Next the ability of different T-rich ODNs to influence the
cytokine milieu was examined. PBMC (3.times.10.sup.6 cells/ml) were
cultured for 24 h with or without 6 .mu.g/ml of the indicated ODNs
or 1 g/ml LPS as positive control (n=2). After incubation
supernatants were collected and TNF.alpha. measured by ELISA as
described above and the results are shown in FIG. 11. PBMC were
cultured with the indicated ODNs (1.0 .mu.g/ml) as described in
FIG. 11 and IL-6 was measured in the supernatants by ELISA and the
results are shown in FIG. 12.
[0348] FIGS. 11 and 12 demonstrate that T-rich non-CpG and
T-rich/CpG ODNs can induce the secretion of the pro-inflammatory
cytokines TNF.alpha. and IL-6. For both cytokines, ODN 5126 (SEQ ID
NO.: 1058) was found in most assays to be as potent as ODN 2194
(SEQ ID NO.: 911). It is known that CpG ODNs influence the Th1/Th2
balance by preferentially inducing Th1 cytokines (Krieg, A. M.
1999. Mechanism and applications of immune stimulatory CpG
oligodeoxynucleotides. Biochemica et Biophysica Acta 93321:1). To
test whether T-rich ODN caused a similar shift to Th1 cytokines,
IFN.gamma. production in PBMC was measured. In a first set of
experiments, it was demonstrated that, as described for IL-6 and
TNF.alpha., ODNs SEQ ID NO.: 1058 and SEQ ID NO.: 911 induced the
release of comparable amounts of this Th1 cytokine IFN.gamma.. In
addition, it was demonstrated that another pro-inflammatory
cytokine, IL-1, was released upon culture of PBMC with these two
ODNs. Although the amount of these cytokines induced by the T-rich
ODN lacking CpG motifs was less than when CpG ODN SEQ ID NO.: 246
was used the amounts induced by T-rich ODN were significantly
higher than the control.
Examples 9-11
[0349] Introduction:
[0350] An optimal CpG motif for immune system activation in
non-rodent vertebrates is described herein. A phosphodiester
oligonucleotide containing this motif was found to strongly
stimulate CD86, CD40, CD54 and MHC II expression, IL-6 synthesis
and proliferation of primary human B-cells. These effects required
internalisation of the oligonucleotide and endosomal maturation.
This CpG motif was associated with the sustained induction of the
NF.kappa.B p50/p65 heterodimer and of the transcription factor
complex activating protein-1 (AP-1). Transcription factor
activation by CpG DNA was preceded by increased phosphorylation of
the stress kinases c-jun NH.sub.2 terminal kinase (JNK) and p38,
and of activating transcription factor-2 (ATF-2). In contrast to
CpG, signaling through the B-cell receptor led to activation of
extracellular receptor kinase (ERK) and to phosphorylation of a
different isoform of JNK.
[0351] Materials and Methods.
[0352] Oligodeoxynucleotides: Unmodified (phosphodiester, PE) and
modified nuclease-resistant (phosphorothioate, PS) ODN were
purchased from Operon Technologies (Alameda, Calif.) and Hybridon
Specialty Products (Milford, Mass.). The sequences used are
provided in Table H. E. coli DNA and calf thymus DNA were purchased
from Sigma Chemical Co., St. Louis, Mo. Genomic DNA samples were
purified by extraction with phenol-chloroform-isoamyl alcohol
(25/24/1) and ethanol precipitation. DNA was purified from
endotoxin by repeated extraction with triton x-114 (Sigma Chemical
Co., St. Louis, Mo.) and tested for endotoxin using the LAL-assay
(LAL-assay BioWhittaker, Walkersville, Md.; lower detection limit
0.1 EU/ml) and the high sensitivity assay for endotoxin described
earlier (lower detection limit 0.0014 EU/ml) (Hartmann G., and
Krieg A. M. 1999. CpG DNA and LPS induce distinct patterns of
activation in human monocytes. Gene Therapy 6:893). Endotoxin
content of DNA samples was below 0.0014 U/ml. E. coli and calf
thymus DNA were made single stranded before use by boiling for 10
minutes, followed by cooling on ice for 5 minutes. DNA samples were
diluted in TE-buffer using pyrogen-free reagents. TABLE-US-00008
TABLE H Oligonucleotide panel used.sup.1 Name (SEQ ID NO) Sequence
5' to 3' Starting sequence PE 2079 TCG ACG TTC CCC CCC CCC (320) CC
Middle base PE 2100 TCG GCG TTC CCC CCC CCC (341) CC PE 2082 TCG
CCG TTC CCC CCC CCC (323) CC Human CpG motif PEb 2080 TCG TCG TTC
CCC CCC CCC (321) CC 5' flanking base PE 2105 GCG TCG TTC CCC CCC
CCC (346) CC PE 2107 ACG TCG TTC CCC CCC CCC (348) CC PE 2104 CCG
TCG TTC CCC CCC CCC (345) CC 3' flanking base PE 2098 TCG TCG CTC
CCC CCC CCC (339) CC PE 2099 TCG TCG GTC CCC CCC CCC (340) CC PE
2083 TCG TCG ATC CCC CCC CCC (324) CC First CpG deleted PE 2108 CTG
TCG TTC CCC CCC CCC (349) CC Second CpG deleted PE 2106 TCG TCA TTC
CCC CCC CCC (347) CC Methylation PE 2095 TZG TZG TTC CCC CCC CCC
(336) CC PE 2094 TCG TCG TTC CCC CCC ZCC (335) CC Non-CpG Control
of PE 2078 TGC TGC TTC CCC CCC CCC 2080 (319) CC PE 2101 GGC CTT
TTC CCC CCC CCC (342) CC PS form of 2080 PS 2116 TCG TCG TTC CCC
CCC CCC (357) CC Additional CpG PE 2059 TCG TCG TTT TGT CGT TTT
motifs (300) GTC GTT Best PS PS 2006 TCG TCG TTT TGT CGT TTT (246)
GTC GTT Methylated 2006 PS 2117 TZG TZG TTT TGT ZGT TTT (358) GTZ
GTT .sup.1PE, phosphodiester; PS, phosphorothioate; bold, base
exchange; bold Z, methylated cytidine; underlined, CpG
dinucleotides.
[0353] Cell preparation and cell culture: Human peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers by Ficoll-Paque density gradient centrifugation
(Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described
(Hartmann G., Krug A., Eigler A., Moeller J., Murphy J., Albrecht
R., and Endres S. 1996. Specific suppression of human tumor
necrosis factor-alpha synthesis by antisense oligodeoxynucleotides.
Antisense Nucleic Acid Drug Dev 6:291)). Cells were suspended in
RPMI 1640 culture medium supplemented with 10% (v/v)
heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, Utah),
1.5 mM L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete
medium). All compounds were purchased endotoxin-tested. Viability
was determined before and after incubation with ODN by trypan blue
exclusion (conventional microscopy) or by propidium iodide
exclusion (flow cytometric analysis). In all experiments, 96% to
99% of PBMC were viable. Cells (final concentration
1.times.10.sup.6 cells/ml) were cultured in complete medium in a 5%
CO.sub.2 humidified incubator at 37.degree. C. Different
oligonucleotides (see table I, concentration as indicated in the
figure legends), LPS (from salmonella typhimurium, Sigma Chemical
Co., St. Louis, Mo.) or anti-IgM were used as stimuli. Chloroquine
(5 .mu.g/ml; Sigma Chemical Co., St. Louis, Mo.) was used to block
endosomal maturation/acidification. At the indicated time points,
cells were harvested for flow cytometry as described below.
[0354] For signal transduction studies, human primary B-cells were
isolated by immunomagnetic cell sorting using the VARIOMACS
technique (Miltenyi Biotec Inc., Auburn, Calif.) as described by
the manufacturer. In brief, PBMC obtained from buffy coats of
healthy blood donors (Elmer L. DeGowin Blood Center, University of
Iowa) were incubated with a microbeads-conjugated antibody to CD19
and passed over a positive selection column. Purity of B-cells was
higher than 95%. After stimulation, whole cellular extracts
(Western blot) and nuclear extracts (EMSA) for signal transduction
studies were prepared.
[0355] For CpG binding protein studies, Ramos cells (human Burkitt
lymphoma B cell line, ATCC CRL-1923 or CRL-1596; Intervirology 5:
319-334, 1975) were grown in complete medium. Untreated cells were
harvested and cytosolic protein extracts were prepared and analyzed
for the presence of CpG oligonucleotide binding proteins by EMSA
and UV-crosslink as described below.
[0356] Flow cytometry: Staining of surface antigens was performed
as previously described (Hartmann G., Krug A., Bidlingmaier M.,
Hacker U., Eigler A., Albrecht R., Strasburger C. J., and Endres S.
1998. Spontaneous and cationic lipid-mediated uptake of antisense
oligonucleotides in human monocytes and lymphocytes. J Pharmacol
Exp Ther 285:920). Monoclonal antibodies to HLA-DR were purchased
from Immunotech, Marseille, France. All other antibodies were
purchased from Pharmingen, San Diego, Calif.: mABs to CD19 (B43),
CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). IgG.sub.1,.kappa.
(MOPC-21) and IgG.sub.2b,.kappa. were used to control for specific
staining. Intracellular cytokine staining for IL-6 was performed as
described (Hartmann G., and Krieg A. M. 1999. CpG DNA and LPS
induce distinct patterns of activation in human monocytes. Gene
Therapy 6:893). In brief, PBMC (final concentration
1.times.10.sup.6 cells/ml) were incubated in the presence of
brefeldin A (final concentration 1 .mu.g/ml, Sigma Chemical Co.,
St. Louis, Mo.). After incubation, cells were harvested and stained
using a FITC-labeled mAB to CD19 (B43), a PE-labeled rat anti-human
IL-6 mAb (MQ2-6A3, Pharmingen) and the Fix and Perm Kit (Caltag
Laboratories, Burlingame, Calif.). Flow cytometric data of 5000
cells per sample were acquired on a FACScan (Beckton Dickinson
Immunocytometry Systems, San Jose, Calif.). Non-viable cells were
excluded from analysis by propidium iodide staining (2 .mu.g/ml).
Data were analyzed using the computer program FlowJo (version
2.5.1, Tree Star, Inc., Stanford, Calif.).
[0357] Proliferation assay: CFSE (5-(and-6-) carboxyfluorescein
diacetate succinimidyl ester, Molecular Probes, USA) is a
fluorescein-derived intracellular fluorescent label which is
divided equally between daughter cells upon cell division. Staining
of cells with CFSE allows both quantification and immunophenotyping
(phycoerythrin-labeled antibodies) of proliferating cells in a
mixed cell suspension. Briefly, PBMC were washed twice in PBS,
resuspended in PBS containing CFSE at a final concentration of 5
.mu.M, and incubated at 37.degree. C. for 10 minutes. Cells were
washed three times with PBS and incubated for five days as
indicated in the figure legends. Proliferating CD19-positive
B-cells were identified by decreased CFSE content using flow
cytometry.
[0358] Preparation of whole cell, nuclear and cytosolic protein
extracts: For Western blot analysis, whole cell extracts were
prepared. Primary B-cells were treated with medium, the
phosphodiester oligonucleotides 2080 (SEQ ID NO.: 321) or 2078 (SEQ
ID NO.: 319) at 30 .mu.g/ml, or anti-IgM (10 .mu.g/ml). Cells were
harvested, washed twice with ice-cold PBS containing 1 mM
Na.sub.3VO.sub.4, resuspended in lysis buffer (150 mM NaCl, 10 mM
TRIS pH 7.4, 1% NP40, 1 mM Na.sub.3VO.sub.4, 50 mM NaF, 30 mg/ml
leupeptin, 50 mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin,
50 .mu.g/ml phenylmethylsulfonylfluoride (PMSF)), incubated for 15
min on ice and spun at 14000 rpm for 10 min. The supernatant was
frozen at -80 C. For the preparation of nuclear extracts, primary
B-cells were resuspended in hypotonic buffer (10 mM HEPES/KOH (pH
7.9), 10 mM KCl, 0.05% NP40, 1.5 mM MgCl.sub.2, 0.5 mM
dithiothreitol (DTT), 0.5 mM PMSF, 30 mg/ml leupeptin, 50 mg/ml
aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin). After 15 minutes
incubation on ice, the suspension was centrifuged at 1000.times.g
for 5 minutes. The pelleted nuclei were resuspended in extraction
buffer (20 mM HEPES (pH 7.9), 450 mM NaCl, 50 mM NaF, 20% glycerol,
1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 30 mg/ml leupeptin, 50
mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin) and incubated
on ice for one hour. The nuclear suspension was centrifuged for 10
minutes at 16,000 g at 4.degree. C. Supernatant was collected and
stored at -80.degree. C. Cytosolic extracts for the CpG binding
protein studies were prepared from unstimulated Ramos cells, which
were lysed with hypotonic buffer as described for the preparation
of the nuclear extract. After centrifugation, the supernatant was
removed as cytoplasmic fraction and stored at -80.degree. C.
Protein concentrations were measured using a Bradford protein assay
(Bio-Rad, Hercules, Calif.) according to the manufacturer.
[0359] Western blot analysis: Equal concentrations of whole cell
protein extracts (25 .mu.g/lane) were boiled in SDS sample buffer
(50 mM Tris-Cl, pH 6.8; 1% .beta.-mercaptoethanol; 2% SDS; 0.1%
bromphenolblue; 10% glycerol) for 4 min before being subjected to
electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS
(SDS-PAGE). After electrophoresis, proteins were transferred to
Immobilion-P transfer membranes (Millipore Corp. Bedford, Mass.).
Blots were blocked with 5% nonfat dry milk. Specific antibodies
against the phosphorylated form of extracellular receptor kinase
(ERK), c-jun NH2-terminal kinase (JNK), p38 and activating
transcription factor-2 (ATF-2) were used (New England BioLabs,
Beverly, Mass.). Blots were developed in enhanced chemiluminescence
reagent (ECL; Amersham International, Aylesbury, U.K.) according to
the manufacturer's recommended procedure.
[0360] Electrophoretic mobility shift assay (EMSA): To detect the
DNA-binding activity of the transcription factor activator
protein-1 (AP-1) and NF.kappa.B, nuclear extracts (1 .mu.g/lane)
were analyzed by EMSA using the dsODNs 5' GAT CTA GTG ATG AGT CAG
CCG GAT C.sub.3' (SEQ ID NO.: 838) containing the AP-1 binding
sequence, and the NF.kappa.B URE from the c-myc promotor region 5'
TGC AGG AAG TCC GGG TTT TCC CCA ACC CCC C.sub.3' (SEQ ID NO.:
1142), as probes. ODNs were end labeled with T4-polynucleotide
kinase (New England Biolabs) and (.gamma.-.sup.32P) ATP (Amersham,
Arlington Heights, Ill.). Binding reactions were performed with 1
.mu.g nuclear protein extract in DNA-binding buffer (10 mM Tris-HCl
(pH 7.5), 40 mM MgCl.sub.2, 20 mM EDTA, 1 mM dithiothreitol, 8%
glycerol and 100-400 ng of poly (dI-dC) with 20.000-40.000 cpm
labeled ODN in 10 .mu.l total volume. Specificity of the NF.kappa.B
bands was confirmed by competition studies with cold
oligonucleotides from unrelated transcription factor binding sites
(10-100 ng). For the supershift assay, 2 .mu.g of specific
antibodies for c-Rel, p50 and p65 (Santa Cruz Biotechnology, Inc.,
Santa Cruz, Calif.) were added into the reaction mixture for 30 min
before the radiolabeled probe was added. Following incubation for
30 minutes at room temperature loading buffer was added and the
probes were electrophoresed on a 6% polyacrylamide gel in
Tris-borate-EDTA running buffer (90 mM Tris, 90 mM boric acid, 2 mM
EDTA, pH 8.0). Gels were dried and then autoradiographed.
[0361] UV-crosslinking and denaturing protein electrophoresis:
Nuclear extracts were incubated with labeled phosphodiester
oligonucleotide as described for the EMSA. DNA-protein complexes
were crosslinked with UV-light in a Stratalinker (Stratagene) for
10 minutes. Probes were mixed with SDS-sample buffer, boiled for 10
minutes and loaded on a 7.5% SDS-PAGE. The gel was dried on Whatman
paper and autoradiographed. Plotting the distance against the
molecular weight of the marker proteins yielded a standard curve
which was used to calculate the approximate molecular weight of the
crosslinked protein-ODN complexes. The molecular weight of the
oligonucleotide was subtracted from this value to give the
size.
Example 9
Identification of an Optimal CpG Motif for Use Alone or in
Combination with a T-Rich ODN
[0362] Phosphorothioate oligonucleotides containing the murine CpG
motif GACGTT (SEQ ID NO.: 1143) (for example 1826 (SEQ ID NO.: 69))
and used at concentrations which are active in murine B-cells (Yi
A. K., Chang M., Peckham D. W., Krieg A. M., and Ashman R. F. 1998.
CpG oligodeoxyribonucleotides rescue mature spleen B cells from
spontaneous apoptosis and promote cell cycle entry. J Immunol
160:5898), have showed little or no immunostimulatory activity on
human immune cells. At higher concentrations this ODN was found to
demonstrate some stimulatory effect on human B cells.
[0363] In earlier studies on B-cell activation in mice, it was
found that a CpG-dinucleotide flanked by two 5' purines and two 3'
pyrimidines and preferably the 6mer motif 5' GACGTT 3' (SEQ ID
NO:1143) was optimal for a phosphodiester oligonucleotide to be
active (Krieg A. M., et al. 1995 Nature 374:546, Yi A. K., Chang
M., et al. 1998 J Immunol 160:5898).
[0364] In order to identify an optimal motif for stimulation of an
immune response in humans and non-rodent vertebrates we designed a
series of ODN and tested their activity. First we designed a 20 mer
phosphodiester oligonucleotide with a TC dinucleotide at the 5' end
preceding the optimal murine CpG motif 5' GACGTT 3' (SEQ ID NO.:
1143) and followed by a poly C tail (2079: 5' TCG ACG TTC CCC CCC
CCC CC 3' (SEQ ID NO.: 320)). This oligonucleotide if added to
human primary B-cells under the same conditions as found to be
optimal for E. coli DNA (repeated addition at 0 hours, 4 hours and
18 hours; 30 .mu.g/ml for each time point) stimulated high levels
of CD86 expression on human primary B-cells after two days. To
determine the structure-function relationship of the CpG motifs, we
replaced the bases adjacent to the CpG dinucleotides while
maintaining the two CpG dinucleotides within the sequence. Exchange
of the adenine located between both CpG dinucleotides by thymidine
(2080 (SEQ ID NO.: 321)) resulted in slightly higher activity.
Replacement by guanosine (2100 (SEQ ID NO.: 341)) or cytidine (2082
(SEQ ID NO.: 323)) at this position showed no major changes
compared to 2079 (SEQ ID NO.: 320). In contrast, replacement of the
thymidine 3' to the second CpG dinucleotide by the purines
guanosine (2099 (SEQ ID NO.: 340)) or adenine (2083 (SEQ ID NO.:
324)) resulted in a major drop in activity of the oligonucleotide,
while the pyrimidine cytidine caused only a minor decrease. The
thymidine immediately 5' to the first CpG dinucleotide was also
important. Replacement of the thymidine by any other base (2105
(SEQ ID NO.: 346), guanosine; 2107 (SEQ ID NO.: 348), adenine; 2104
(SEQ ID NO.: 345), cytidine) led to a marked decrease in activity
of the oligonucleotide. Elimination of the first (2108 (SEQ ID NO.:
349)) or the second (2106 (SEQ ID NO.: 347)) CpG dinucleotide also
partially reduced the activity.
[0365] The addition of more 5' GTCGTT 3' (SEQ ID NO.: 1144) CpG
motifs to the phosphodiester oligonucleotide containing the 8mer
duplex CpG motif (5' TCGTCGTT 3' (SEQ ID NO:1145), 2080 (SEQ ID
NO.: 321)) did not further enhance CD86 expression on B-cells (2059
(SEQ ID NO.: 300)). An oligonucleotide with the same sequence as
2080 (SEQ ID NO.: 321) but with a phosphorothioate backbone showed
no activity above background (2116 (SEQ ID NO.: 357)). This was
surprising since the phosphorothioate backbone has been reported to
greatly stabilize oligonucleotides and enhance CpG-induced
stimulation (Krieg A. M., Yi A. K., Matson S., Waldschmidt T. J.,
Bishop G. A., Teasdale R., Koretzky G. A., and Klinman D. M. 1995.
CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature 374:546). We therefore performed further structure-function
analysis of phosphorothioate oligonucleotides containing the 5'
GTCGTT 3' (SEQ ID NO: 1144) and 5' TCGTCGTT 3' (SEQ ID NO:1145)
motifs, which showed that additional CpG motifs (2006 (SEQ ID NO.:
246)) tended to increase the activity of phosphorothioate
oligonucleotides.
[0366] Purified B-cells isolated from peripheral blood by
immunomagnetic cell sorting were activated by CpG DNA to the same
extent as unpurified B-cells within PBMC. Thus, activation of
B-cells is a primary response and not a secondary effect caused by
cytokines secreted by other cells.
[0367] In addition to the co-stimulatory molecule CD86, the
functional stage of B-cells is characterized by other surface
markers. For example, activated T helper cells stimulate B-cells by
CD40 ligation, the intercellular adhesion molecule-1 (ICAM-1, CD54)
mediates binding to other immune cells, and major
histocompatibility complex II (MHC II) is responsible for antigen
presentation. We found that B cell expression of CD40, CD54 and MHC
II was upregulated by the CpG oligonucleotide 2080 (SEQ ID NO.:
[0368] 321). The non-CpG control oligonucleotide 2078 (SEQ ID NO.:
319) showed no activity compared to medium alone.
[0369] When PBMC were incubated for 5 days in the presence of 2080
(SEQ ID NO.: 321) (added at 0 hours, 4 hours, 18 hours and every
subsequent morning), it was intriguing that a subpopulation of
lymphocytes increased in cell size (FSC) and became more granular
(SSC). To examine if this subpopulation represented proliferating
B-cells, we stained freshly isolated PBMC with CFSE (5-(and-6-)
carboxyfluorescein diacetate succinimidyl ester) at day 0 and
incubated them for 5 days with 2080 (SEQ ID NO.: 321) as above.
CFSE is a fluorescent molecule that binds irreversibly to cell
proteins. Each cell division decreases CFSE stain by 50%. Cells
staining low with CFSE (proliferating cells) were found to be
mainly CD19-positive B-cells. The oligonucleotide 2080 (SEQ ID NO.:
321) induced 60 to 70% of CD19 positive B-cells to proliferate
within 5 days. The control oligonucleotide 2078 (SEQ ID NO.: 319)
induced less than 5% of B-cells to proliferate. Proliferating
B-cells (CFSE low) showed a larger cell size (FSC) and higher
granularity.
[0370] Proliferating B-cells expressed higher levels of CD86 than
non-proliferating cells (not shown). In agreement with this
finding, the oligonucleotide panel tested above for induction of
CD86 expression resulted in an almost identical pattern of B-cell
proliferation. Replacement of the 3' thymidine reduced activity
more than changing the thymidine in the middle position.
Example 10
B-Cell Activation Requires Endosomal Maturation/Acidification
[0371] It has previously been shown that chloroquine, an inhibitor
of endosomal acidification, blocks CpG-mediated stimulation of
murine antigen presenting cells and B-cells, while not influencing
LPS-mediated effects (Hacker H., et al 1998 Embo J 17:6230, Yi A.
K. et al 1998 J Immunol 160:4755, Macfarlane D. E., and Manzel L.
1998 J Immunol 160:1122). We found that the addition of 5 .mu.g/ml
chloroquine completely blocked CpG DNA-mediated induction of CD86
expression on primary B-cells (MFI CD86: 2006 (SEQ ID NO.: 246),
4.7 vs 1.4; E. coli DNA, 3.4 vs. 1.4; medium only, 0.9; n=4).
Furthermore, chloroquine completely inhibited the induction of
B-cell proliferation by the phosphorothioate oligonucleotide 2006
(SEQ ID NO.: 246) measured with the CFSE proliferation assay as
well as with the standard. These results suggest that as with
murine cells, activation of human B-cells by CpG DNA requires the
uptake of DNA in endosomes and subsequent endosomal
acidification.
Example 11
Analysis of Sub-Cellular Events Resulting Upon Human B Cell
Stimulation with Optimal Human ODN
[0372] Since the CpG motif requirement for maximal B-cell
activation is substantially different between mouse (GACGTT) (SEQ
ID NO: 1143) and humans (TCGTCGTT) (SEQ ID NO: 1145), we were
interested if the basic intracellular signaling events are
comparable. Rapid induction of NF.kappa.B binding activity has been
found earlier in murine B-cells and macrophages (Stacey K. J., et
al 1996 J Immunol 157:2116, Yi A. K et al 1998 J Immunol 160:4755).
To investigate the NF.kappa.B response to CpG DNA in humans, human
primary B-cells were isolated from peripheral blood by
immunomagnetic cell sorting and incubated with the CpG
oligonucleotide 2080 (SEQ ID NO.: 321), the non-CpG control
oligonucleotide 2078 (SEQ ID NO.: 319), or medium. At the indicated
time points, cells were harvested and nuclear extracts were
prepared. In the presence of CpG oligonucleotide, NF.kappa.B
binding activity was increased within one hour and maintained up to
18 hours (latest time point examined). The non-CpG control
oligonucleotide 2078 (SEQ ID NO.: 319) did not show enhanced
NF.kappa.B activity compared to cells incubated with medium only.
The NF.kappa.B band was identified by cold competition, and shown
to consist of p50 and p65 subunits by supershift assay.
[0373] The activating protein-1 (AP-1) transcription factor is
involved in the regulation of immediate early genes and cytokine
expression (Karin M. 1995. The regulation of AP-1 activity by
mitogen-activated protein kinases. J Biol Chem 270:16483). In
murine B-cells, AP-1 binding activity is induced in response to CpG
DNA (Yi A. K., and Krieg A. M. 1998. Rapid induction of
mitogen-activated protein kinases by immune stimulatory CpG DNA. J
Immunol 161:4493). To determine whether this transcription factor
would also be induced by CpG DNA in humans, we examined AP-1 DNA
binding activity in human primary B-cells. Cells were incubated
with the CpG oligonucleotide 2080 (SEQ ID NO.: 321) or the control
oligonucleotide 2078 (SEQ ID NO.: 319). Nuclear extracts were
prepared and the AP-1 binding activity was analyzed by EMSA. AP-1
binding activity was enhanced within one hour, and increased up to
18 hours (latest time point examined), showing a sustained
response.
[0374] Since AP-1 activity is induced by many stimuli (Angel P.,
and Karin M. 1991. The role of Jun, Fos and the AP-1 complex in
cell-proliferation and transformation. Biochim Biophys Acta
1072:129), we were interested in signal transduction pathways
upstream of AP-1. The AP-1 transcription factor complex integrates
different mitogen activated protein kinase (MAPK) pathways (Karin
M. 1995. The regulation of AP-1 activity by mitogen-activated
protein kinases. J Biol Chem 270:16483). Western blots were
performed using whole cell extracts from primary B-cells incubated
with the CpG oligonucleotide 2080 (SEQ ID NO.: 321), the control
2078 (SEQ ID NO.: 319), or medium only. Specific antibodies to the
phosphorylated form of JNK, p38, ATF-2 and ERK were used. Strong
induction of JNK phosphorylation was found 30 min and 60 min after
exposure to CpG-DNA, while the non-CpG oligonucleotide showed no
activity above background. The protein kinase p38, another stress
activated protein kinase (SAPK), was also phosphorylated in
response to CpG DNA within 60 min. ATF-2, a substrate of both p38
and JNK (Gupta S., Campbell D., Derijard B., and Davis R. J. 1995.
Transcription factor ATF2 regulation by the JNK signal transduction
pathway. Science 267:389) and a component of the AP-1 complex,
showed weak phosphorylation after 30 min which increased after 60
min. CpG DNA failed to induce substantial phosphorylation of ERK.
In contrast, anti-IgM, stimulating the B-cell receptor, did trigger
phosphorylation of ERK. Anti-IgM activated different isoforms of
JNK than CpG DNA.
Example 12
Assay for In Vivo Adjuvant Activity
[0375] An in vitro screening assay to identify ODN useful as an
adjuvant in vivo in humans and other non-rodent animals was
developed. Since we saw not only quantitative but also qualitative
differences in activities of different CpG ODN in mice, we first
screened a panel of CpG and non-CpG control ODN on mouse cells to
find in vitro assays with reliable and strong correlation to in
vivo adjuvant activity with hepatitis B surface antigen (HBsAg). We
then systematically tested a panel of more than 250 ODN in
corresponding human assays to identify sequences with in vitro
immunostimulatory activity. We next examined if the ODN with the
highest activity in these human assays also activate B cell
proliferation in chimpanzees and monkeys, and finally, if they are
active as adjuvants with HBsAg in chimpanzees and cynomolgus
monkeys in vivo. These studies revealed that the sequence, number
and spacing of individual CpG motifs contribute to the
immunostimulatory activity of a CpG phosphorothioate ODN. An ODN
with a TC dinucleotide at the 5' end followed by three 6mer CpG
motifs (5' GTCGTT 3') separated by TT dinucleotides consistently
showed the highest activity for human, chimpanzee, and rhesus
monkey leukocytes. Chimpanzees or monkeys vaccinated once against
hepatitis B with this CpG ODN adjuvant developed 15 times higher
anti-HBs antibody titers than those receiving vaccine alone.
[0376] Materials and Methods
[0377] Oligodeoxynucleotides: Phosphorothioate-modified ODN were
purchased from Operon Technologies (Alameda, Calif.) and Hybridon
Specialty Products (Milford, Mass.). ODN were tested for endotoxin
using the LAL-assay (LAL-assay BioWhittaker, Walkersville, Md.;
lower detection limit 0.1 EU/ml). For in vitro assays, ODN were
diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA), and stored at
-20.degree. C. For in vivo use, ODN were diluted in phosphate
buffered saline (0.1 M PBS, pH 7.3) and stored at 4.degree. C. All
dilutions were carried out using pyrogen-free reagents.
[0378] Mouse spleen cell cultures: Spleens were removed from 6-12
week old female BALB/c (The Jackson Laboratory), 2.times.10.sup.6
splenocytes were cultured with 0.2 .mu.M ODN for 4 hours
(TNF-.alpha.) or 24 hours (IL-6, IFN-.gamma., IL-12), and cytokines
were detected by ELISA as previously described (Yi A. K., Klinman
D. M., Martin T. L., Matson S., and Krieg A. M. 1996. Rapid immune
activation by CpG motifs in bacterial DNA. Systemic induction of
IL-6 transcription through an antioxidant-sensitive pathway. J
Immunol 157:5394). To evaluate CpG-induced B cell proliferation,
spleen cells were depleted of T cells with anti-Thy-1.2 and
complement and centrifugation over lympholyte M.RTM. (Cedarlane
Laboratories, Hornby, ON, Canada), cultured for 44 hours with the
indicated ODN, and then pulsed for 4 hours with 1 .mu.Ci of .sup.3H
thymidine as described previously (Krieg A. M., Yi A. K., Matson
S., Waldschmidt T. J., Bishop G. A., Teasdale R., Koretzky G. A.,
and Klinman D. M. 1995. CpG motifs in bacterial DNA trigger direct
B-cell activation. Nature 374:546). To examine NK cell lytic
activity murine spleen cells were depleted of B cells using
magnetic beads coated with goat anti-mouse Ig as previously
detailed (Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated
killer cells. VII. IL-4 induces an NK1.1.sup.+CD8
.alpha..sup.+.beta..sup.- TCR-.alpha..beta. B220.sup.+
lymphokine-activated killer subset. J Immunol 150:17). Cells were
cultured at 5.times.10.sup.6/well in 24-well plates and harvested
at 18 hours for use as effector cells in a standard 4 hour
.sup.51Cr-release assay against YAC-1 target cells. One unit (LU)
was defined as the number of cells needed to effect 30% specific
lysis.
[0379] Immunization of mice against HBsAg and evaluation of the
humoral response: Groups of 6-8 week old female BALB/c mice (n=5 or
10, Charles River, Montreal, QC) were immunized against HBsAg as
previously described (Davis H. L., et al 1998 J Immunol 160:870).
In brief, each mouse received a single IM injection of 50 .mu.l PBS
containing 1 .mu.g recombinant HBsAg (Medix Biotech, Foster City,
Calif.) and 10 .mu.g of CpG ODN or non-CpG ODN as a sole adjuvant
or combined with alum (Alhydrogel "85", Superfos Biosector,
Vedbaek, Denmark; 25 mg Al.sup.3+/mg HBsAg). Control mice were
immunized with HBsAg without adjuvant or with alum. Plasma was
recovered from mice at various times after immunization and Abs
specific to HBsAg (anti-HBs) were quantified by end-point dilution
ELISA assay (in triplicate) as described previously (Davis H. L et
al 1998 J Immunol 160:870). End-point titers were defined as the
highest plasma dilution that resulted in an absorbance value
(OD450) two times higher than that of non-immune plasma with a
cut-off value of 0.05.
[0380] Isolation of primate PBMC and cell culture: Peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers, chimpanzees or rhesus or cynomolgus monkeys by
Ficoll-hypaque density gradient centrifugation (Histopaque-1077,
Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G., et
al 1996 Antisense Nucleic Acid Drug Dev 6:291). Cells were
suspended in RPMI 1640 culture medium supplemented with 10% (v/v)
heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, Utah),
1.5 mM L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete
medium). Cells (final concentration 1.times.10.sup.6 cells/ml) were
cultured in complete medium in a 5% CO.sub.2 humidified incubator
at 37.degree. C. ODN and LPS (from Salmonella typhimurium, Sigma
Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For
measurement of human NK lytic activity, PBMC were incubated at
5.times.10.sup.6/well in 24-well plates. Cultures were harvested
after 24 hours, and cells were used as effectors in a standard 4
hours .sup.51Cr-release assay against K562 target cells as
previously described (Ballas Z. K., Rasmussen W. L., and Krieg A.
M. 1996. Induction of NK activity in murine and human cells by CpG
motifs in oligodeoxynucleotides and bacterial DNA. J Immunol
157:1840; Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated
killer cells. VII. IL-4 induces an NK1.1.sup.+CD8
.alpha..sup.+.beta..sup.- TCR-.alpha..beta. B220.sup.+
lymphokine-activated killer subset. J Immunol 150:17). For B cell
proliferation, 1 .mu.Ci of .sup.3H thymidine was added 18 hours
before harvest, and the amount of .sup.3H thymidine incorporation
was determined by scintillation counting at day 5. Standard
deviations of the triplicate wells were <5%.
[0381] Flow cytometry on primate PBMC: Surface antigens on primate
PBMC were stained as previously described (Hartmann G et al 1998 J
Pharmacol Exp Ther 285:920). Monoclonal antibodies to CD3 (UCHT1),
CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331
(FUN-1)) were purchased from Pharmingen, San Diego, Calif.
IgG.sub.1,.kappa. (MOPC-21) and IgG.sub.2b,.kappa. (Hartmann G et
al 1999 PNAS 96:9305) were used to control for non-specific
staining. NK cells were identified by CD56 expression on CD3, CD14
and CD19 negative cells, whereas B cells were identified by
expression of CD19. Flow cytometric data from 10000 cells per
sample were acquired on a FACScan (Beckton Dickinson
Immunocytometry Systems, San Jose, Calif.). The viability of cells
within the FSC/SSC gate used for analysis was examined by propidium
iodide staining (2 .mu.g/ml) and found to be higher than 98%. Data
were analyzed using the computer program FlowJo (version 2.5.1,
Tree Star, Inc., Stanford, Calif.).
[0382] Immunization of chimpanzees and cynomolgus monkeys against
HBsAg and evaluation of the humoral response: Fourteen cynomolgus
monkeys (2.0-3.5 kg) were immunized with a pediatric dose of
Engerix-B (SmithKline Beecham Biologicals, Rixensart, BE)
containing 10 .mu.g HBsAg adsorbed to alum (25 mg Al.sup.3+/mg
HBsAg). This was administered alone (n=5), or combined with CpG ODN
1968 (n=5, 500 .mu.g) or CpG ODN 2006 (SEQ ID NO.: 246) (n=4, 150
.mu.g). Four chimpanzees (10-20 kg) were immunized in the same
fashion with two receiving control vaccine (Engerix-B only) and two
receiving experimental vaccine (Engerix-B plus 1 mg CpG ODN 2006).
All vaccines were administered IM in the right anterior thigh in a
total volume of 1 ml. Monkeys were maintained in the animal
facility of the Primate Research Center (Bogor, Indonesia) and
chimpanzees were housed at Bioqual (Rockville, Md.). Animals were
monitored daily by animal care specialists. No symptoms of general
ill health or local adverse reactions at the injection site were
noted. Plasma was recovered by IV puncture prior to and at various
times after immunization and was stored frozen (-20.degree. C.)
until assayed for antibodies. Anti-HBs antibodies were detected
using a commercial ELISA kit (Monolisa Anti-HBs; Sanofi-Pasteur,
Montreal, QC) and titers were expressed in mIU/ml based on
comparison with WHO defined standards (Monolisa Anti-HBs Standards;
Sanofi-Pasteur).
[0383] Results
[0384] Identification of CpG ODN with different profiles of in
vitro immune activities: Our studies showed that the precise bases
on the 5' and 3' sides of a CpG dinucleotide within a CpG motif may
have an impact on the level of immune activation of a synthetic
ODN, but it has been unclear whether different CpG motifs might
display different immune effects. To evaluate this possibility, we
tested a panel of CpG ODN for their ability to induce NK lytic
activity, B cell proliferation, and to stimulate synthesis of
TNF-.alpha., IL-6, IFN-.gamma. and IL-12 in murine spleen cells.
Immunostimulatory activity of ODN without CpG motifs (ODN 1982 (SEQ
ID NO.: 225), ODN 1983 (SEQ ID NO.: 226)) was negative or weak
compared to CpG ODN. ODN with non optimal CpG motifs (ODN 1628 (SEQ
ID NO.: 767), ODN 1758 (SEQ ID NO.: 1)) were less active than ODN
containing CpG motifs flanked by two 5' purines and two 3'
pyrimidines (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69),
ODN 1841 (SEQ ID NO.: 84)). ODN 1826 containing two optimal murine
CpG motifs (5' GACGTT 3') (SEQ ID NO: 1143) had the highest
activity for 5 of 6 measured endpoints. Except for ODN 1628, all
ODN showed a generally similar pattern of activity (NK
cell-mediated lysis, B cell proliferation, IL-12, IL-6, TNF a,
IFN-.gamma.). Of note, ODN 1628, which was unique in this panel for
containing two G-rich regions, showed preferential induction of
IFN-.gamma. synthesis but relatively low stimulation of the other
activities.
[0385] Identification of in vitro assays which correlate with in
vivo adjuvant activity: Since adjuvant activity is an in vivo
endpoint, we were interested in identifying in vitro assays that
would predict the adjuvant activity of a CpG ODN in vivo. The same
ODN used for in vitro endpoints therefore were tested for their
adjuvant activity to immunize mice against HBsAg. This was carried
out both with ODN alone and with ODN combined with alum, since
earlier studies had shown strong synergy for CpG ODN and alum
adjuvants (PCT Published Patent Application WO98/40100).
[0386] BALB/c mice immunized with HBsAg without adjuvant attained
only low titers of anti-HBs by 4 weeks, and this was not affected
by addition of control ODN. In contrast, addition of CpG ODN raised
anti-HBs titers by 5 to 40 fold, depending on the sequence used.
When alum was added, titers of anti HBs were approximately 6 times
higher than with HBsAg alone. Specifically, control ODN had no
effect and the various CpG ODN augmented these titers 2 to 36 fold.
Results obtained with the different ODN alone correlated very
strongly (r=0.96) with those obtained using the same ODN plus alum.
When linear regression was performed, a very high degree of
correlation was found between certain in vitro assays and in vivo
augmentation of anti-HBs titers. Of all the in vitro endpoints
examined, the induction of NK lytic activity showed the best
correlation to in vivo adjuvant activity (without alum, r=0.98;
with alum, r=0.95; p<0.0001). A good correlation regarding
adjuvant activity was also obtained for B-cell stimulation (r=0.84
and 0.7), as well as secretion of TNF-.alpha. (r=0.9 and 0.88),
IL-12 (r=0.88 and 0.86) and IL-6 (r=0.85 and 0.91). The one in
vitro assay that did not correlate well with the in vivo results
was IFN-.gamma. secretion (r=0.57 and 0.68). These data demonstrate
that in vitro assays for NK lytic activity, B cell activation and
production of TNF-.alpha., IL-6 and IL-12 provide valuable
information in vitro to predict the adjuvant activity of a given
ODN in vivo.
[0387] Screening of a phosphorothioate ODN panel to activate human
NK cells: In previous studies we found that synthesis of
inflammatory cytokines by human PBMC is induced by extremely low
amounts of endotoxin (induced TNF-.alpha. secretion is detectable
with just 6 pg/ml endotoxin, 2 logs more sensitive than murine
immune cells). In contrast, activation of human B cells and
induction of human NK cell lytic activity with endotoxin is low
even at high endotoxin concentrations. Based on these results we
selected activation of NK cells (lytic activity and CD69
expression) and B cells (proliferation and CD86 expression) as the
most highly specific and reproducible assays with low inter-subject
variability and used these assays for in vitro screening of a pool
of ODN.
[0388] First we studied the effect of phosphorothioate ODN
containing various combinations and permutations of CpG motifs on
NK cell-mediated lysis of target cells. For clarity and ease of
presentation, only data with selected representative CpG and
control ODN are shown. Human PBMC were incubated with different
phosphorothioate ODN (6 .mu.g/ml) for 24 hours and tested for their
ability to lyse .sup.51Cr-labeled K562 cells. ODN with two 6-mer
CpG motifs (either 5' GACGTT 3' (SEQ ID NO.: 1143) or 5' GTCGTT 3'
(SEQ ID NO.: 1144)) in combination with a TpC at the 5'end of the
ODN (ODN 1840 5' TCCATGTCGTTCCTGTCGTT 3' (SEQ ID NO.: 83), ODN 1851
5' TCCTGACGTTCCTGACGTT 3' (SEQ ID NO.: 94) or with at least three
6-mer motifs without a TpC at the 5' end (ODN 2013 (SEQ ID NO.:
253)) show intermediate activity. High activity was found when the
5' TpC directly preceded a 6-mer human CpG motif (5' TCGTCGTT 3'
(SEQ ID NO:1145) (in SEQ ID NO.: 246)) and was followed by two
6-mer motifs (ODN 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.:
246) and ODN 2007 (SEQ ID NO.: 247)). The best results were
obtained when the 6-mer CpG motifs were separated from each other
and from the 5' 8-mer CpG motif by TpT (ODN 2006 (SEQ ID NO.:
246)).
[0389] Expression of the activation marker CD69 is rapidly
upregulated on the surface of NK cells subsequent to stimulation.
To confirm the results from the NK cell lysis assay, PBMC were
incubated for 18 hours with ODN (2 .mu.g/ml). CD69 expression was
examined on CD56 positive NK cells (CD3, CD14 and CD19 negative).
Although induction of CD69 expression was less sequence restricted
than stimulation of NK cell functional activity, control ODN (ODN
1982, ODN 2116, ODN 2117, ODN 2010) showed only low activity
similar to background levels. ODN with two human CpG motifs
separated by 5' TTTT 3' (ODN 1965 (SEQ ID NO.: 208)) or four human
CpG motifs without spacing (ODN 2013 (SEQ ID NO.: 253)) were
relatively more active at inducing CD69 expression than at
stimulating NK cell lytic activity. Optimal NK cell functional
activity, as well as CD69 expression, was obtained with ODNs
containing a TpC dinucleotide preceding the human CpG motif, and
additional human motifs within the sequence (ODN 2006 (SEQ ID NO.:
246), ODN 2007 (SEQ ID NO.: 247)).
[0390] Activity of phosphorothioate ODN for stimulating human B
cells: In preliminary experiments we found that the percentage of
proliferating B cells (CFSE assay, see methods section) correlated
with the surface expression of the co-stimulatory CD86 on B cells,
as measured by flow cytometry. Thus we used CD86 expression on B
cells to screen a panel of ODN for their immunostimulatory
activity. PBMC were incubated with 0.6 .mu.g/ml ODN. Expression of
CD86 (mean fluorescence intensity, MFI) was examined on CD19
positive B cells. A poly C ODN (ODN 2017 (SEQ ID NO.: 257)) or ODN
without CpG dinucleotides (ODN 1982 (SEQ ID NO.: 225)) failed to
stimulate human B cells under these experimental conditions. A
phosphorothioate ODN (ODN 2116 (SEQ ID NO.: 256)) with one optimal
human CpG motif preceded by a TpC (5' TCGTCGTT 3' (SEQ ID NO: 1145)
(in SEQ ID NO.: 246)) was inactive. The presence of one human 6-mer
CpG motif (5' GTCGTT 3' (SEQ ID NO.: 1144)) had no activating
effect. Two of these CpG motifs within the sequence showed no (ODN
1960 (SEQ ID NO.: 203), ODN 2016 (SEQ ID NO.: 256)) or intermediate
(ODN 1965 (SEQ ID NO.: 208)) activity dependent on the sequence
context. If the ODN was composed of three or four copies of this
motif (ODN 2012 (SEQ ID NO.: 252), ODN 2013 (SEQ ID NO.: 253), ODN
2014 (SEQ ID NO.: 254)), intermediate activity on B cells could be
detected. The combination of the human 8-mer CpG motif on the 5'
end of the ODN with two 6-mer CpG motifs (ODN 2005 (SEQ ID NO.:
245), ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247), ODN
2102 (SEQ ID NO.: 343), ODN 2103 (SEQ ID NO.: 344)) led to a
considerable increase in the ability of the ODN to stimulate B
cells. The spacing between the single motifs was critical. The
separation of CpG motifs by TpT was preferable (ODN 2006 (SEQ ID
NO.: 246)) compared to unseparated CpG motifs (ODN 2005 (SEQ ID
NO.:); also compare ODN 1965 (SEQ ID NO.: 208) to ODN 1960 (SEQ ID
NO.: 203)). The human 6-mer CpG motif (5' GTCGTT 3') was better
than the optimal mouse 6-mer CpG motif (5' GACGTT 3' (SEQ ID NO.:
246)) when combined with the human 8-mer CpG motif on the 5' end
(ODN 2006 vs. ODN 2102 (SEQ ID NO.: 343) and ODN 2103 (SEQ ID NO.:
344)). A (TCG).sub.poly ODN was inactive or only weakly active, as
were ODN containing CpG dinucleotides flanked by guanines or other
CpG dinucleotides (ODN 2010 (SEQ ID NO.: 250)). Taken together, the
findings for NK cells and B cells showed consistently that of the
ODN tested, ODN 2006 (SEQ ID NO.: 246) has the highest
immunostimulatory activity on human immune cells.
[0391] Comparative analysis of potency of CpG phosphorothioate ODNs
in different primates: Different CpG motifs are optimal to activate
murine and human immune cells.
[0392] Furthermore, the number and location of CpG motifs within an
active phosphorothioate ODN is different in mice and humans. We
were interested to know if CpG phosphorothioate ODN show a similar
activity among different species of primates. We compared a panel
of CpG ODN for their ability to induce B cell proliferation in
humans, chimpanzees and rhesus or cynomolgus monkeys. The
capability of ODN to stimulate human B cell proliferation (Table J)
correlated well with their ability to induce CD86 expression on B
cells. ODN 2006 (SEQ ID NO.: 246), which showed the highest
activity in human B cells and NK cells, was also the most active in
stimulating chimpanzee and rhesus monkey B cell proliferation
(Table J). ODN 1968 (SEQ ID NO.: 211) and ODN 2006 (SEQ ID NO.:
246) gave the highest activation of cynomolgus monkey B-cells in
vitro (SI of 25 and 29 respectively at 6 .mu.g ODN/ml).
Surprisingly, CpG ODN 2007 (SEQ ID NO.: 247), which displayed
similarly high activity as the optimal ODN 2006 (SEQ ID NO.: 246)
in human cells, did not stimulate Rhesus monkey or chimpanzee B
cell proliferation, and the ODN 1968 (SEQ ID NO.: 211) showed low
activity. CpG ODN originally identified with high activity in mice
(ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69)) showed little
activity in monkeys (Table J). TABLE-US-00009 TABLE J Proliferative
response of PBMC to phosphorothioate CpG ODN in primates Rhesus
Humans Chimpanzee monkey No addition 0.5 +- 0.1 0.5 +- 0.1 0.5 +-
0.0 ODN 1760 23 +- 7 0.3 +- 0.1 0.5 +- 0.3 (SEQ ID NO.: 3) ODN 1826
0.8 +- 0.1 0.4 +- 0.1 0.6 +- 0.1 (SEQ ID NO.: 69) ODN 1968 35 +- 9
20.0 +- 3.8 1.9 +- 0.7 (SEQ ID NO.: 211) ODN 1982 9.7 +- 1.1 2.5 +-
1.1 0.7 +- 0.1 (SEQ ID NO.: 225) ODN 2006 58 +- 8 27.4 +- 8.9 6.3
+- 3.3 (SEQ ID NO.: 246) ODN 2007 47 +- 11 0.5 +- 0.1 0.4 +- 0.2
(SEQ ID NO.: 247)
PBMC were prepared from peripheral blood and incubated with ODN
(0.6 .mu.g/ml) as indicated for five days. Proliferation was
measured by uptake of .sup.3H/thymidine (cpm/1000) during the last
18 hours. More than 95% of proliferating cells were B-cells as
determined using the CFSE assay. Four human probands, six
chimpanzees and two rhesus monkeys were tested.
[0393] In vivo adjuvant activity of CpG ODN in chimpanzees and
cynomolgus monkeys: In order to evaluate whether CpG ODN with
strong in vitro stimulatory effects on primate cells had detectable
adjuvant activity in vivo, Cynomolgus monkeys and chimpanzees were
immunized with Engerix B, which comprises HBsAg adsorbed to alum,
alone or with added ODN 1968 (500 .mu.g) or ODN 2006 (SEQ ID NO.:
246) (1 mg) respectively. Compared to controls not receiving CpG
ODN, anti-HBs titers at 4 weeks post-prime and 2 weeks post-boost
were 66- and 16-fold higher respectively in the monkeys, and 15-
and 3-fold higher in the chimpanzees (Table K). Thus a clear
adjuvant effect of CpG ODN was seen, and this was particularly
striking after a single immunization. TABLE-US-00010 TABLE K
Anti-HBs responses in primates immunized against HBsAg with CpG
ODN.sup.3 Anti-HBs (mIU/ml) 4 wks 2 wks Primate species n CpG ODN
post-prime post-boost Cynomolgus 5 None 15 .+-. 44 4880 .+-. 13113
monkey 5 ODN 1968 (500 .mu.g) 995 .+-. 1309 76449 .+-. 42094 (SEQ
ID NO. 211) Chimpanzee 2 None 6, 11 3712, 4706 2 ODN 2006 (1 mg)
125, 135 9640, 16800 (SEQ ID NO. 246) .sup.3Animals were immunized
by IM injection of Engerix B containing 10 .mu.tg HBsAg adsorbed to
alum, alone or with added CpG ODN. Cynomolgus monkeys were boosted
at 10 wks and chimpanzees were boosted at 4 wks post-prime.
Anti-HBs was determined by ELISA assay; values for monkeys are GMT
.+-. SEM (n=5) whereas individual values for the two chimpanzees in
each group are provided.
[0394] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
SEQUENCE LISTING
[0395] The sequence listing of the present application is submitted
in the enclosed Compact Disks (CD-R), Labeled "Copy 1 of 2" and
"Copy 2 of 2", respectively, both of which contain identical files
labeled "7035 Sequence Listing.doc", were created on Aug. 17, 2006,
and are 529 KB in size. The sequence listing in the submitted CD-Rs
is incorporated by reference herein in its entirety.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 1145 <210>
SEQ ID NO 1 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1 tctcccagcg tgcgccat 18 <210> SEQ ID NO 2
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 2 ataatccagc
ttgaaccaag 20 <210> SEQ ID NO 3 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 3 ataatcgacg ttcaagcaag 20
<210> SEQ ID NO 4 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 4 taccgcgtgc gaccctct 18 <210> SEQ ID NO 5
<211> LENGTH: 9 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 5 ggggagggt 9
<210> SEQ ID NO 6 <211> LENGTH: 9 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 6 ggggagggg 9 <210> SEQ ID NO 7 <211> LENGTH:
9 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 7 ggtgaggtg 9 <210> SEQ ID NO
8 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223>
OTHER INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 8 tccatgtngt
tcctgatgct 20 <210> SEQ ID NO 9 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (11)...(11) <223> OTHER INFORMATION:
m5c <220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 9 gctaccttag ngtga 15 <210>
SEQ ID NO 10 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (8)...(8)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 10
tccatgangt tcctgatgct 20 <210> SEQ ID NO 11 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (13)...(13) <223> OTHER INFORMATION:
m5c <220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 11 tccatgacgt tcntgatgct 20
<210> SEQ ID NO 12 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (7)...(7)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 12
gctagangtt agtgt 15 <210> SEQ ID NO 13 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 13 agctccatgg tgctcactg 19
<210> SEQ ID NO 14 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 14 ccacgtcgac cctcaggcga 20 <210> SEQ ID NO 15
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 15 gcacatcgtc
ccgcagccga 20 <210> SEQ ID NO 16 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 16 gtcactcgtg gtacctcga 19
<210> SEQ ID NO 17 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 17 gttggataca ggccagactt tgttg 25 <210> SEQ ID NO
18 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 18
gattcaactt gcgctcatct taggc 25 <210> SEQ ID NO 19 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence
<400> SEQUENCE: 19 accatggacg aactgtttcc cctc 24 <210>
SEQ ID NO 20 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 20 accatggacg agctgtttcc cctc 24 <210> SEQ ID NO 21
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 21 accatggacg
acctgtttcc cctc 24 <210> SEQ ID NO 22 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 22 accatggacg tactgtttcc cctc 24
<210> SEQ ID NO 23 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 23 accatggacg gtctgtttcc cctc 24 <210> SEQ ID NO 24
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 24 accatggacg
ttctgtttcc cctc 24 <210> SEQ ID NO 25 <211> LENGTH: 25
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 25 ccactcacat ctgctgctcc acaag 25
<210> SEQ ID NO 26 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 26 acttctcata gtccctttgg tccag 25 <210> SEQ ID NO
27 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 27
tccatgagct tcctgagtct 20 <210> SEQ ID NO 28 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (9)...(9) <223> OTHER
INFORMATION: I <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (11)...(11) <223> OTHER
INFORMATION: I <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (15)...(15) <223> OTHER
INFORMATION: I <400> SEQUENCE: 28 gaggaaggng nggangacgt 20
<210> SEQ ID NO 29 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <220>
FEATURE: <221> NAME/KEY: modified_base <222> LOCATION:
(7)...(7) <223> OTHER INFORMATION: I <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(13)...(13) <223> OTHER INFORMATION: I <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(18)...(18) <223> OTHER INFORMATION: I <400> SEQUENCE:
29 gtgaatncgt tcncgggnct 20 <210> SEQ ID NO 30 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 30 aaaaaa 6 <210>
SEQ ID NO 31 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 31 cccccc 6 <210> SEQ ID NO 32 <211> LENGTH:
6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 32 ctgtca 6 <210> SEQ ID NO 33
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 33 tcgtag 6
<210> SEQ ID NO 34 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 34 tcgtgg 6 <210> SEQ ID NO 35 <211> LENGTH:
6 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 35 cgtcgt 6 <210> SEQ ID NO 36
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 36 tccatgtcgg
tcctgagtct 20 <210> SEQ ID NO 37 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 37 tccatgccgg tcctgagtct 20
<210> SEQ ID NO 38 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 38 tccatgacgg tcctgagtct 20 <210> SEQ ID NO 39
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 39 tccatgacgg
tcctgagtct 20 <210> SEQ ID NO 40 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 40 tccatgtcga tcctgagtct 20
<210> SEQ ID NO 41 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 41 tccatgtcgc tcctgagtct 20 <210> SEQ ID NO 42
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 42 tccatgtcgt
tcctgagtct 20 <210> SEQ ID NO 43 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 43 tccatgacgt tcctgagtct 20
<210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 44 tccataacgt tcctgagtct 20 <210> SEQ ID NO 45
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 45 tccatgacgt
ccctgagtct 20 <210> SEQ ID NO 46 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 46 tccatcacgt gcctgagtct 20
<210> SEQ ID NO 47 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 47 tccatgctgg tcctgagtct 20 <210> SEQ ID NO 48
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 48 tccatgtngg
tcctgagtct 20 <210> SEQ ID NO 49 <211> LENGTH: 39
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 49 ccgcttcctc cagatgagct catgggtttc
tccaccaag 39 <210> SEQ ID NO 50 <211> LENGTH: 39
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 50 cttggtggag aaacccatga gctcatctgg
aggaagcgg 39 <210> SEQ ID NO 51 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 51 ccccaaaggg atgagaagtt 20
<210> SEQ ID NO 52 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 52 agatagcaaa tcggctgacg 20 <210> SEQ ID NO 53
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 53 ggttcacgtg
ctcatggctg 20 <210> SEQ ID NO 54 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 54 tctcccagcg tgcgccat 18
<210> SEQ ID NO 55 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 55 tctcccagcg tgcgccat 18 <210> SEQ ID NO 56
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 56 taccgcgtgc
gaccctct 18 <210> SEQ ID NO 57 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 57 ataatccagc ttgaaccaag 20
<210> SEQ ID NO 58 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 58 ataatcgacg ttcaagcaag 20
<210> SEQ ID NO 59 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 59 tccatgattt tcctgatttt 20 <210> SEQ ID NO 60
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 60 ttgttttttt
gtttttttgt tttt 24 <210> SEQ ID NO 61 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 61 ttttttttgt ttttttgttt tt 22
<210> SEQ ID NO 62 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 62 tgctgctttt gtgcttttgt gctt 24 <210> SEQ ID NO 63
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 63 tgctgcttgt
gcttttgtgc tt 22 <210> SEQ ID NO 64 <211> LENGTH: 23
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 64 gcattcatca ggcgggcaag aat 23
<210> SEQ ID NO 65 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 65 taccgagctt cgacgagatt tca 23 <210> SEQ ID NO 66
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 66 gcatgacgtt
gagct 15 <210> SEQ ID NO 67 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 67 cacgttgagg ggcat 15 <210>
SEQ ID NO 68 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 68 ctgctgagac tggag 15 <210> SEQ ID NO 69
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 69 tccatgacgt
tcctgacgtt 20 <210> SEQ ID NO 70 <211> LENGTH: 17
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 70 gcatgagctt gagctga 17 <210>
SEQ ID NO 71 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 71 tcagcgtgcg cc 12 <210> SEQ ID NO 72 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 72 atgacgttcc tgacgtt 17
<210> SEQ ID NO 73 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 73 ttttggggtt ttggggtttt 20 <210> SEQ ID NO 74
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 74 tctaggcttt
ttaggcttcc 20 <210> SEQ ID NO 75 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 75 tgcatttttt aggccaccat 20
<210> SEQ ID NO 76 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 76 tctcccagcg tgcgtgcgcc at 22 <210> SEQ ID NO 77
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 77 tctcccagcg
ggcgcat 17 <210> SEQ ID NO 78 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 78 tctcccagcg agcgccat 18
<210> SEQ ID NO 79 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 79 tctcccagcg cgcgccat 18
<210> SEQ ID NO 80 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 80 ggggtgacgt tcagggggg 19 <210> SEQ ID NO 81
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 81 ggggtccagc
gtgcgccatg gggg 24 <210> SEQ ID NO 82 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 82 ggggtgtcgt tcagggggg 19
<210> SEQ ID NO 83 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 83 tccatgtcgt tcctgtcgtt 20 <210> SEQ ID NO 84
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 84 tccatagcgt
tcctagcgtt 20 <210> SEQ ID NO 85 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 85 tcgtcgctgt ctccgcttct t 21
<210> SEQ ID NO 86 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 86 gcatgacgtt gagct 15 <210> SEQ ID NO 87
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 87 tctcccagcg
tgcgccatat 20 <210> SEQ ID NO 88 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (8)...(8) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: modified_base <222> LOCATION:
(17)...(17) <223> OTHER INFORMATION: m5c <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 88 tccatgangt tcctgangtt 20 <210> SEQ ID NO 89
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (7)...(7) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 89 gcatgangtt
gagct 15 <210> SEQ ID NO 90 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 90 tccagcgtgc gccata 16 <210>
SEQ ID NO 91 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 91 tctcccagcg tgcgccat 18 <210> SEQ ID NO 92
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 92 tccatgagct
tcctgagtct 20 <210> SEQ ID NO 93 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 93 gcatgtcgtt gagct 15 <210>
SEQ ID NO 94 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 94 tcctgacgtt cctgacgtt 19 <210> SEQ ID NO 95
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 95 gcatgatgtt
gagct 15 <210> SEQ ID NO 96 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 96 gcatttcgag gagct 15 <210>
SEQ ID NO 97 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 97 gcatgtagct gagct 15 <210> SEQ ID NO 98
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 98 tccaggacgt
tcctagttct 20 <210> SEQ ID NO 99 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 99 tccaggagct tcctagttct 20
<210> SEQ ID NO 100 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 100 tccaggatgt tcctagttct 20 <210> SEQ ID NO 101
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 101
tccagtctag gcctagttct 20 <210> SEQ ID NO 102 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 102 tccagttcga gcctagttct
20 <210> SEQ ID NO 103 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 103 gcatggcgtt gagct 15 <210> SEQ ID NO
104 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 104
gcatagcgtt gagct 15 <210> SEQ ID NO 105 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 105 gcattgcgtt gagct 15 <210>
SEQ ID NO 106 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 106 gcttgcgttg cgttt 15 <210> SEQ ID NO 107
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 107
tctcccagcg ttgcgccata t 21 <210> SEQ ID NO 108 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 108 tctcccagcg tgcgttatat
20 <210> SEQ ID NO 109 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 109 tctccctgcg tgcgccatat 20 <210> SEQ
ID NO 110 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 110
tctgcgtgcg tgcgccatat 20 <210> SEQ ID NO 111 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 111 tctcctagcg tgcgccatat
20 <210> SEQ ID NO 112 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 112 tctcccagcg tgcgcctttt 20 <210> SEQ
ID NO 113 <211> LENGTH: 13 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION:
(5)...(5) <223> OTHER INFORMATION: n is a or g or c or t/u
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: (6)...(6) <223> OTHER INFORMATION: d is
a or g or t/u; not c <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: (9)...(10) <223> OTHER
INFORMATION: h is a or c or t/u; not g <400> SEQUENCE: 113
gctandcghh agc 13 <210> SEQ ID NO 114 <211> LENGTH: 13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 114 tcctgacgtt ccc 13 <210>
SEQ ID NO 115 <211> LENGTH: 13 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 115 ggaagacgtt aga 13 <210> SEQ ID NO 116
<211> LENGTH: 13 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 116
tcctgacgtt aga 13 <210> SEQ ID NO 117 <211> LENGTH: 27
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 117 tcagaccagc tggtcgggtg ttcctga 27
<210> SEQ ID NO 118 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 118 tcaggaacac ccgaccagct ggtctga 27 <210> SEQ ID
NO 119 <211> LENGTH: 13 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 119
gctagtcgat agc 13
<210> SEQ ID NO 120 <211> LENGTH: 13 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 120 gctagtcgct agc 13 <210> SEQ ID NO 121
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 121
gcttgacgtc tagc 14 <210> SEQ ID NO 122 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 122 gcttgacgtt tagc 14 <210>
SEQ ID NO 123 <211> LENGTH: 14 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 123 gcttgacgtc aagc 14 <210> SEQ ID NO 124
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 124
gctagacgtt tagc 14 <210> SEQ ID NO 125 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 125 tccatgacat tcctgatgct 20
<210> SEQ ID NO 126 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 126 gctagacgtc tagc 14 <210> SEQ ID NO 127
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 127
ggctatgtcg ttcctagcc 19 <210> SEQ ID NO 128 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 128 ggctatgtcg atcctagcc
19 <210> SEQ ID NO 129 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 129 ctcatgggtt tctccaccaa g 21 <210>
SEQ ID NO 130 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 130 cttggtggag aaacccatga g 21 <210> SEQ ID NO 131
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 131
tccatgacgt tcctagttct 20 <210> SEQ ID NO 132 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 132 ccgcttcctc cagatgagct
catg 24 <210> SEQ ID NO 133 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 133 catgagctca tctggaggaa gcgg 24
<210> SEQ ID NO 134 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 134 ccagatgagc tcatgggttt ctcc 24 <210> SEQ ID NO
135 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 135
ggagaaaccc atgagctcat ctgg 24 <210> SEQ ID NO 136 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 136 agcatcagga acgacatgga
20 <210> SEQ ID NO 137 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 137 tccatgacgt tcctgacgtt 20 <210> SEQ
ID NO 138 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 138
gcgcgcgcgc gcgcgcgcg 19 <210> SEQ ID NO 139 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 139 ccggccggcc ggccggccgg
20 <210> SEQ ID NO 140 <211> LENGTH: 43 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 140
ttccaatcag ccccacccgc tctggcccca ccctcaccct cca 43 <210> SEQ
ID NO 141 <211> LENGTH: 43 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 141
tggagggtga gggtggggcc agagcgggtg gggctgattg gaa 43 <210> SEQ
ID NO 142 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 142
tcaaatgtgg gattttccca tgagtct 27 <210> SEQ ID NO 143
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 143
agactcatgg gaaaatccca catttga 27 <210> SEQ ID NO 144
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 144
tgccaagtgc tgagtcacta ataaaga 27 <210> SEQ ID NO 145
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 145
tctttattag tgactcagca cttggca 27 <210> SEQ ID NO 146
<211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 146
tgcaggaagt ccgggttttc cccaaccccc c 31 <210> SEQ ID NO 147
<211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 147
ggggggttgg ggaaaacccg gacttcctgc a 31 <210> SEQ ID NO 148
<211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 148
ggggactttc cgctggggac tttccagggg gactttcc 38 <210> SEQ ID NO
149 <211> LENGTH: 45 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 149
tccatgacgt tcctctccat gacgttcctc tccatgacgt tcctc 45 <210>
SEQ ID NO 150 <211> LENGTH: 45 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 150 gaggaacgtc atggagagga acgtcatgga gaggaacgtc atgga 45
<210> SEQ ID NO 151 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 151 ataatagagc ttcaagcaag 20 <210> SEQ ID NO 152
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 152
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 153 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 153 tccatgacgt tcctgacgtt
20 <210> SEQ ID NO 154 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 154 tccaggactt tcctcaggtt 20 <210> SEQ
ID NO 155 <211> LENGTH: 45 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 155
tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt 45 <210>
SEQ ID NO 156 <211> LENGTH: 45 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 156 accttattaa gattgtgcaa tgtgacgtcc tttagcatcg caaga 45
<210> SEQ ID NO 157 <211> LENGTH: 28 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 157 tcctgacgtt cctggcggtc ctgtcgct 28 <210> SEQ ID
NO 158 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 158
tcctgtcgct cctgtcgct 19 <210> SEQ ID NO 159 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 159 tcctgacgtt gaagt 15
<210> SEQ ID NO 160 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 160 tcctgtcgtt gaagt 15 <210> SEQ ID NO 161
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 161
tcctggcgtt gaagt 15 <210> SEQ ID NO 162 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 162 tcctgccgtt gaagt 15 <210>
SEQ ID NO 163 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 163 tccttacgtt gaagt 15 <210> SEQ ID NO 164
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 164
tcctaacgtt gaagt 15 <210> SEQ ID NO 165 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 165 tcctcacgtt gaagt 15 <210>
SEQ ID NO 166 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 166 tcctgacgat gaagt 15 <210> SEQ ID NO 167
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 167
tcctgacgct gaagt 15 <210> SEQ ID NO 168 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 168 tcctgacggt gaagt 15 <210>
SEQ ID NO 169 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 169 tcctgacgta gaagt 15 <210> SEQ ID NO 170
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 170
tcctgacgtc gaagt 15 <210> SEQ ID NO 171 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 171 tcctgacgtg gaagt 15 <210>
SEQ ID NO 172 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 172 tcctgagctt gaagt 15 <210> SEQ ID NO 173
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 173
gggggacgtt ggggg 15 <210> SEQ ID NO 174 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 174 tcctgacgtt ccttc 15 <210>
SEQ ID NO 175 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 175 tctcccagcg agcgagcgcc at 22 <210> SEQ ID NO 176
<211> LENGTH: 32 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 176
tcctgacgtt cccctggcgg tcccctgtcg ct 32 <210> SEQ ID NO 177
<211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 177
tcctgtcgct cctgtcgctc ctgtcgct 28 <210> SEQ ID NO 178
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 178
tcctggcggg gaagt 15 <210> SEQ ID NO 179 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 179 tcctgangtt gaagt 15 <210>
SEQ ID NO 180 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (3)...(3)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 180
tcntgacgtt gaagt 15 <210> SEQ ID NO 181 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 181 tcctagcgtt gaagt 15
<210> SEQ ID NO 182 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 182 tccagacgtt gaagt 15 <210> SEQ ID NO 183
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 183
tcctgacggg gaagt 15 <210> SEQ ID NO 184 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 184 tcctggcggt gaagt 15 <210>
SEQ ID NO 185 <211> LENGTH: 27 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 185 ggctccgggg agggaatttt tgtctat 27 <210> SEQ ID
NO 186 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 186
atagacaaaa attccctccc cggagcc 27 <210> SEQ ID NO 187
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 187
tccatgagct tccttgagtc t 21 <210> SEQ ID NO 188 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 188 tcgtcgctgt ctccgcttct
t 21 <210> SEQ ID NO 189 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 189 tcgtcgctgt ctccgcttct t 21 <210>
SEQ ID NO 190 <211> LENGTH: 23 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 190 tcgagacatt gcacaatcat ctg 23 <210> SEQ ID NO
191 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 191
cagattgtgc aatgtctcga 20 <210> SEQ ID NO 192 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 192 tccatgtcgt tcctgatgcg
20 <210> SEQ ID NO 193 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 193 gcgatgtcgt tcctgatgct 20 <210> SEQ
ID NO 194 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 194
gcgatgtcgt tcctgatgcg 20 <210> SEQ ID NO 195 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 195 tccatgtcgt tccgcgcgcg
20 <210> SEQ ID NO 196 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 196 tccatgtcgt tcctgccgct 20 <210> SEQ
ID NO 197 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 197
tccatgtcgt tcctgtagct 20 <210> SEQ ID NO 198 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 198 gcggcgggcg gcgcgcgccc
20 <210> SEQ ID NO 199 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 199 atcaggaacg tcatgggaag c 21 <210>
SEQ ID NO 200 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 200 tccatgagct tcctgagtct 20 <210> SEQ ID NO 201
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 201 tcaacgtt
8 <210> SEQ ID NO 202 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 202 tcaagctt 8
<210> SEQ ID NO 203 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 203 tcctgtcgtt cctgtcgtt 19 <210> SEQ ID NO 204
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 204
tccatgtcgt ttttgtcgtt 20 <210> SEQ ID NO 205 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 205 tcctgtcgtt ccttgtcgtt
20 <210> SEQ ID NO 206 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 206 tccttgtcgt tcctgtcgtt 20 <210> SEQ
ID NO 207 <211> LENGTH: 29 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(3) <223>
OTHER INFORMATION: Conjugated to biotin moiety. <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 207 tccattccat gacgttcctg atgcttcca 29
<210> SEQ ID NO 208 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 208 tcctgtcgtt ttttgtcgtt 20 <210> SEQ ID NO 209
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 209
tcgtcgctgt ctccgcttct t 21 <210> SEQ ID NO 210 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 210 tcgtcgctgt ctgcccttct
t 21 <210> SEQ ID NO 211 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 211 tcgtcgctgt tgtcgtttct t 21 <210>
SEQ ID NO 212 <211> LENGTH: 30 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 212 tcctgtcgtt cctgtcgttg gaacgacagg 30 <210> SEQ
ID NO 213 <211> LENGTH: 40 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 213
tcctgtcgtt cctgtcgttt caacgtcagg aacgacagga 40 <210> SEQ ID
NO 214 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 214
ggggtctgtc gttttggggg g 21 <210> SEQ ID NO 215 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 215 ggggtctgtg cttttggggg
g 21 <210> SEQ ID NO 216 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 216 tccggccgtt gaagt 15 <210> SEQ ID NO
217 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 217
tccggacggt gaagt 15 <210> SEQ ID NO 218 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 218 tcccgccgtt gaagt 15 <210>
SEQ ID NO 219 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 219 tccagacggt gaagt 15 <210> SEQ ID NO 220
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 220
tcccgacggt gaagt 15 <210> SEQ ID NO 221 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 221 tccagagctt gaagt 15 <210>
SEQ ID NO 222 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (8)...(8)
<223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (17)...(17) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 222
tccatgtngt tcctgtngtt 20
<210> SEQ ID NO 223 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 223 tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 224
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 224
ggggttgacg ttttgggggg 20 <210> SEQ ID NO 225 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 225 tccaggactt ctctcaggtt
20 <210> SEQ ID NO 226 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 226 tttttttttt tttttttttt 20 <210> SEQ
ID NO 227 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 227
tccatgccgt tcctgccgtt 20 <210> SEQ ID NO 228 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 228 tccatggcgg gcctggcggg
20 <210> SEQ ID NO 229 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 229 tccatgacgt tcctgccgtt 20 <210> SEQ
ID NO 230 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 230
tccatgacgt tcctggcggg 20 <210> SEQ ID NO 231 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 231 tccatgacgt tcctgcgttt
20 <210> SEQ ID NO 232 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 232 tccatgacgg tcctgacggt 20 <210> SEQ
ID NO 233 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 233
tccatgcgtg cgtgcgtttt 20 <210> SEQ ID NO 234 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 234 tccatgcgtt gcgttgcgtt
20 <210> SEQ ID NO 235 <211> LENGTH: 30 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(3) <223> OTHER INFORMATION: Conjugated to biotin
moiety. <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 235 tccattccat tctaggcctg
agtcttccat 30 <210> SEQ ID NO 236 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 236 tccatagcgt tcctagcgtt 20
<210> SEQ ID NO 237 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 237 tccatgtcgt tcctgtcgtt 20 <210> SEQ ID NO 238
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 238
tccatagcga tcctagcgat 20 <210> SEQ ID NO 239 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 239 tccattgcgt tccttgcgtt
20 <210> SEQ ID NO 240 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 240 tccatagcgg tcctagcggt 20 <210> SEQ
ID NO 241 <211> LENGTH: 29 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 241
tccatgattt tcctgcagtt cctgatttt 29 <210> SEQ ID NO 242
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 242
tccatgacgt tcctgcagtt cctgacgtt 29 <210> SEQ ID NO 243
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 243 ggcggcggcg gcggcggcgg 20 <210> SEQ ID NO 244
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 244
tccacgacgt tttcgacgtt 20 <210> SEQ ID NO 245 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 245 tcgtcgttgt cgttgtcgtt
20 <210> SEQ ID NO 246 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 246 tcgtcgtttt gtcgttttgt cgtt 24 <210>
SEQ ID NO 247 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 247 tcgtcgttgt cgttttgtcg tt 22 <210> SEQ ID NO 248
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 248
gcgtgcgttg tcgttgtcgt t 21 <210> SEQ ID NO 249 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (2)...(2) <223> OTHER
INFORMATION: m5c <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (6)...(6) <223> OTHER
INFORMATION: m5c <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (10)...(10) <223> OTHER
INFORMATION: m5c <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (15)...(15) <223> OTHER
INFORMATION: m5c <400> SEQUENCE: 249 cnggcnggcn gggcnccgg 19
<210> SEQ ID NO 250 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 250 gcggcgggcg gcgcgcgccc 20 <210> SEQ ID NO 251
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <220> FEATURE: <221>
NAME/KEY: modified_base <222> LOCATION: (3)...(3) <223>
OTHER INFORMATION: I <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: I <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (14)...(14) <223> OTHER
INFORMATION: I <400> SEQUENCE: 251 agncccgnga acgnattcac 20
<210> SEQ ID NO 252 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 252 tgtcgtttgt cgtttgtcgt t 21 <210> SEQ ID NO 253
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 253
tgtcgttgtc gttgtcgttg tcgtt 25 <210> SEQ ID NO 254
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 254
tgtcgttgtc gttgtcgttg tcgtt 25 <210> SEQ ID NO 255
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 255
tcgtcgtcgt cgtt 14 <210> SEQ ID NO 256 <211> LENGTH: 13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 256 tgtcgttgtc gtt 13 <210>
SEQ ID NO 257 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 257 cccccccccc cccccccccc 20 <210> SEQ ID NO 258
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 258
tctagcgttt ttagcgttcc 20 <210> SEQ ID NO 259 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 259 tgcatccccc aggccaccat
20 <210> SEQ ID NO 260 <211> LENGTH: 23 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 260 tcgtcgtcgt cgtcgtcgtc gtt 23 <210>
SEQ ID NO 261 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 261 tcgtcgttgt cgttgtcgtt 20
<210> SEQ ID NO 262 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 262 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
263 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 263
tcgtcgttgt cgttttgtcg tt 22 <210> SEQ ID NO 264 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 264 ggggagggag gaacttctta
aaattccccc agaatgttt 39 <210> SEQ ID NO 265 <211>
LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 265 aaacattctg ggggaatttt
aagaagttcc tccctcccc 39 <210> SEQ ID NO 266 <211>
LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 266 atgtttactt cttaaaattc
ccccagaatg ttt 33 <210> SEQ ID NO 267 <211> LENGTH: 33
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 267 aaacattctg ggggaatttt aagaagtaaa
cat 33 <210> SEQ ID NO 268 <211> LENGTH: 33 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 268 atgtttacta gacaaaattc ccccagaatg ttt 33
<210> SEQ ID NO 269 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 269 aaacattctg ggggaatttt gtctagtaaa cat 33 <210>
SEQ ID NO 270 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 270 aaaattgacg ttttaaaaaa 20 <210> SEQ ID NO 271
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 271
ccccttgacg ttttcccccc 20 <210> SEQ ID NO 272 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 272 ttttcgttgt ttttgtcgtt
20 <210> SEQ ID NO 273 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 273 tcgtcgtttt gtcgttttgt cgtt 24 <210>
SEQ ID NO 274 <211> LENGTH: 14 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 274 ctgcagcctg ggac 14 <210> SEQ ID NO 275
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 275
acccgtcgta attatagtaa aaccc 25 <210> SEQ ID NO 276
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 276
ggtacctgtg gggacattgt g 21 <210> SEQ ID NO 277 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 277 agcaccgaac gtgagagg 18
<210> SEQ ID NO 278 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 278 tccatgccgt tcctgccgtt 20 <210> SEQ ID NO 279
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 279
tccatgacgg tcctgacggt 20 <210> SEQ ID NO 280 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 280 tccatgccgg tcctgccggt
20 <210> SEQ ID NO 281 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 281 tccatgcgcg tcctgcgcgt 20 <210> SEQ
ID NO 282 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 282
ctggtctttc tggttttttt ctgg 24
<210> SEQ ID NO 283 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 283 tcaggggtgg ggggaacctt 20 <210> SEQ ID NO 284
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 284
tccatgangt tcctagttct 20 <210> SEQ ID NO 285 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 285 tccatgatgt tcctagttct
20 <210> SEQ ID NO 286 <211> LENGTH: 26 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 286 cccgaagtca tttcctctta acctgg 26
<210> SEQ ID NO 287 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 287 ccaggttaag aggaaatgac ttcggg 26 <210> SEQ ID NO
288 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: modified_base <222> LOCATION: (7)...(7) <223>
OTHER INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 288
tcctggnggg gaagt 15 <210> SEQ ID NO 289 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (9)...(9) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (12)...(12) <223> OTHER INFORMATION:
m5c <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (14)...(14) <223> OTHER INFORMATION:
m5c <221> NAME/KEY: modified_base <222> LOCATION:
(16)...(16) <223> OTHER INFORMATION: m5c <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 289 gnggngggng gngngngccc 20 <210> SEQ ID NO 290
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 290
tccatgtgct tcctgatgct 20 <210> SEQ ID NO 291 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 291 tccatgtcct tcctgatgct
20 <210> SEQ ID NO 292 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 292 tccatgtcgt tcctagttct 20 <210> SEQ
ID NO 293 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 293
tccaagtagt tcctagttct 20 <210> SEQ ID NO 294 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 294 tccatgtagt tcctagttct
20 <210> SEQ ID NO 295 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 295 tcccgcgcgt tccgcgcgtt 20 <210> SEQ
ID NO 296 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 296
tcctggcggt cctggcggtt 20 <210> SEQ ID NO 297 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 297 tcctggaggg gaagt 15
<210> SEQ ID NO 298 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 298 tcctgggggg gaagt 15 <210> SEQ ID NO 299
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 299
tcctggtggg gaagt 15 <210> SEQ ID NO 300 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 300 tcgtcgtttt gtcgttttgt cgtt 24
<210> SEQ ID NO 301 <211> LENGTH: 24 <212> TYPE:
DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 301 ctggtctttc tggttttttt ctgg 24 <210> SEQ ID NO
302 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 302
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 303 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 303 tccaggactt ctctcaggtt
20 <210> SEQ ID NO 304 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (13)...(13) <223> OTHER INFORMATION:
m5c <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (21)...(21) <223> OTHER INFORMATION:
m5c <400> SEQUENCE: 304 tngtngtttt gtngttttgt ngtt 24
<210> SEQ ID NO 305 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(3)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 305 tcgtcgtttt gtcgttttgt cgttttttt
29 <210> SEQ ID NO 306 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 306 gctatgacgt tccaaggg 18 <210> SEQ ID
NO 307 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 307
tcaacgtt 8 <210> SEQ ID NO 308 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 308 tccaggactt tcctcaggtt 20
<210> SEQ ID NO 309 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 309 ctctctgtag gcccgcttgg 20 <210> SEQ ID NO 310
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 310
ctttccgttg gacccctggg 20 <210> SEQ ID NO 311 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 311 gtccgggcca ggccaaagtc
20 <210> SEQ ID NO 312 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 312 gtgcgcgcga gcccgaaatc 20 <210> SEQ
ID NO 313 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: modified_base <222> LOCATION: (8)...(8) <223>
OTHER INFORMATION: I <221> NAME/KEY: modified_base
<222> LOCATION: (17)...(17) <223> OTHER INFORMATION: I
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 313 tccatgangt tcctgangtt 20
<210> SEQ ID NO 314 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 314 aatagtcgcc ataacaaaac 20 <210> SEQ ID NO 315
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 315
aatagtcgcc atggcggggc 20 <210> SEQ ID NO 316 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: (1)...(3) <223> OTHER INFORMATION:
Biotin moiety attached at 5' end of sequence. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 316 tttttccatg tcgttcctga tgcttttt 28 <210> SEQ ID
NO 317 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 317
tcctgtcgtt gaagtttttt 20 <210> SEQ ID NO 318 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 318 gctagcttta gagctttaga
gctt 24 <210> SEQ ID NO 319 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence
<400> SEQUENCE: 319 tgctgcttcc cccccccccc 20 <210> SEQ
ID NO 320 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 320
tcgacgttcc cccccccccc 20 <210> SEQ ID NO 321 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 321 tcgtcgttcc cccccccccc
20 <210> SEQ ID NO 322 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 322 tcgtcgttcc cccccccccc 20 <210> SEQ
ID NO 323 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 323
tcgccgttcc cccccccccc 20 <210> SEQ ID NO 324 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 324 tcgtcgatcc cccccccccc
20 <210> SEQ ID NO 325 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 325 tcctgacgtt gaagt 15 <210> SEQ ID NO
326 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 326
tcctgccgtt gaagt 15 <210> SEQ ID NO 327 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 327 tcctgacggt gaagt 15 <210>
SEQ ID NO 328 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 328 tcctgagctt gaagt 15 <210> SEQ ID NO 329
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 329
tcctggcggg gaagt 15 <210> SEQ ID NO 330 <211> LENGTH:
21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 330 aaaatctgtg cttttaaaaa a 21
<210> SEQ ID NO 331 <211> LENGTH: 33 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 331 gatccagtca cagtgacctg gcagaatctg gat 33 <210>
SEQ ID NO 332 <211> LENGTH: 33 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 332 gatccagatt ctgccaggtc actgtgactg gat 33 <210>
SEQ ID NO 333 <211> LENGTH: 33 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 333 gatccagtca cagtgactca gcagaatctg gat 33 <210>
SEQ ID NO 334 <211> LENGTH: 33 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 334 gatccagatt ctgctgagtc actgtgactg gat 33 <210>
SEQ ID NO 335 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(16)...(16) <223> OTHER INFORMATION: m5c <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 335 tcgtcgttcc cccccncccc 20 <210> SEQ ID NO 336
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (2)...(2) <223> OTHER
INFORMATION: m5c <221> NAME/KEY: modified_base <222>
LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 336 tngtngttcc cccccccccc 20 <210> SEQ
ID NO 337 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: modified_base <222> LOCATION: (2)...(2) <223>
OTHER INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 337
tngtcgttcc cccccccccc 20 <210> SEQ ID NO 338 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 338 tcgtngttcc cccccccccc 20
<210> SEQ ID NO 339 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 339 tcgtcgctcc cccccccccc 20 <210> SEQ ID NO 340
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 340
tcgtcggtcc cccccccccc 20 <210> SEQ ID NO 341 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 341 tcggcgttcc cccccccccc
20 <210> SEQ ID NO 342 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 342 ggccttttcc cccccccccc 20 <210> SEQ
ID NO 343 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 343
tcgtcgtttt gacgttttgt cgtt 24 <210> SEQ ID NO 344 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 344 tcgtcgtttt gacgttttga
cgtt 24 <210> SEQ ID NO 345 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 345 ccgtcgttcc cccccccccc 20
<210> SEQ ID NO 346 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 346 gcgtcgttcc cccccccccc 20 <210> SEQ ID NO 347
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 347
tcgtcattcc cccccccccc 20 <210> SEQ ID NO 348 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 348 acgtcgttcc cccccccccc
20 <210> SEQ ID NO 349 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 349 ctgtcgttcc cccccccccc 20 <210> SEQ
ID NO 350 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(3) <223>
OTHER INFORMATION: Biotin moiety attached at 5' end of sequence.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 350 tttttcgtcg ttcccccccc cccc 24
<210> SEQ ID NO 351 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(18)...(20) <223> OTHER INFORMATION: Biotin moiety attached
at 3' end of sequence. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 351
tcgtcgttcc cccccccccc 20 <210> SEQ ID NO 352 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (22)...(24) <223> OTHER INFORMATION:
Biotin moiety attached at 3' end of sequence. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 352 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
353 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 353
tccagttcct tcctcagtct 20 <210> SEQ ID NO 354 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 354 tngtcgtttt gtcgttttgt cgtt 24
<210> SEQ ID NO 355 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 355 tcctggaggg gaagt 15 <210> SEQ ID NO 356
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 356
tcctgaaaag gaagt 15 <210> SEQ ID NO 357 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 357 tcgtcgttcc ccccccc 17
<210> SEQ ID NO 358 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (13)...(13) <223> OTHER INFORMATION:
m5c <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (21)...(21) <223> OTHER INFORMATION:
m5c <400> SEQUENCE: 358 tngtngtttt gtngttttgt ngtt 24
<210> SEQ ID NO 359 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 359 ggggtcaagc ttgagggggg 20 <210> SEQ ID NO 360
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 360
tgctgcttcc cccccccccc 20 <210> SEQ ID NO 361 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 361 tcgtcgtcgt cgtt 14
<210> SEQ ID NO 362 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 362 tcgtcgtcgt cgtt 14 <210> SEQ ID NO 363
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 363
tcgtcgtcgt cgtt 14 <210> SEQ ID NO 364 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 364 tcaacgttga 10 <210> SEQ ID
NO 365 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 365
tcaacgtt 8 <210> SEQ ID NO 366 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 366 atagttttcc atttttttac 20
<210> SEQ ID NO 367 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 367 aatagtcgcc atcgcgcgac 20 <210> SEQ ID NO 368
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 368
aatagtcgcc atcccgggac 20 <210> SEQ ID NO 369 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 369 aatagtcgcc atcccccccc
20 <210> SEQ ID NO 370 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 370 tgctgctttt gtgcttttgt gctt 24 <210>
SEQ ID NO 371 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 371 ctgtgctttc tgtgtttttc tgtg 24 <210> SEQ ID NO
372 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 372
ctaatctttc taattttttt ctaa 24 <210> SEQ ID NO 373 <211>
LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 373 tcgtcgttgg tgtcgttggt
gtcgtt 26 <210> SEQ ID NO 374 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 374 tcgtcgttgg ttgtcgtttt ggtt 24
<210> SEQ ID NO 375 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 375 accatggacg agctgtttcc cctc 24 <210> SEQ ID NO
376 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 376
tcgtcgtttt gcgtgcgttt 20 <210> SEQ ID NO 377 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 377
ctgtaagtga gcttggagag 20 <210> SEQ ID NO 378 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 378 gagaacgctg gaccttcc 18
<210> SEQ ID NO 379 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 379 cgggcgactc agtctatcgg 20 <210> SEQ ID NO 380
<211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 380
gttctcagat aaagcggaac cagcaacaga cacagaa 37 <210> SEQ ID NO
381 <211> LENGTH: 37 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 381
ttctgtgtct gttgctggtt ccgctttatc tgagaac 37 <210> SEQ ID NO
382 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 382
cagacacaga agcccgatag acg 23 <210> SEQ ID NO 383 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 383 agacagacac gaaacgaccg
20 <210> SEQ ID NO 384 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 384 gtctgtccca tgatctcgaa 20 <210> SEQ
ID NO 385 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 385
gctggccagc ttacctcccg 20 <210> SEQ ID NO 386 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 386 ggggcctcta tacaacctgg
g 21 <210> SEQ ID NO 387 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 387 ggggtccctg agactgcc 18 <210> SEQ ID
NO 388 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 388
gagaacgctg gaccttccat 20 <210> SEQ ID NO 389 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 389 tccatgtcgg tcctgatgct
20 <210> SEQ ID NO 390 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 390 ctcttgcgac ctggaaggta 20 <210> SEQ
ID NO 391 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 391
aggtacagcc aggactacga 20 <210> SEQ ID NO 392 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 392 accatggacg acctgtttcc
cctc 24 <210> SEQ ID NO 393 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 393 accatggatt acctttttcc cctt 24
<210> SEQ ID NO 394 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 394 atggaaggtc cagcgttctc 20 <210> SEQ ID NO 395
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 395
agcatcagga ccgacatgga 20 <210> SEQ ID NO 396 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 396 ctctccaagc tcacttacag
20 <210> SEQ ID NO 397 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 397 tccctgagac tgccccacct t 21 <210>
SEQ ID NO 398 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 398
gccaccaaaa cttgtccatg 20 <210> SEQ ID NO 399 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 399 gtccatggcg tgcgggatga
20 <210> SEQ ID NO 400 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 400 cctctataca acctgggac 19 <210> SEQ
ID NO 401 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 401
cgggcgactc agtctatcgg 20 <210> SEQ ID NO 402 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 402 gcgctaccgg tagcctgagt
20 <210> SEQ ID NO 403 <211> LENGTH: 35 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 403 cgactgccga acaggatatc ggtgatcagc actgg 35
<210> SEQ ID NO 404 <211> LENGTH: 35 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 404 ccagtgctga tcaccgatat cctgttcggc agtcg 35 <210>
SEQ ID NO 405 <211> LENGTH: 17 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 405 ccaggttgta tagaggc 17 <210> SEQ ID NO 406
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 406
tctcccagcg tacgccat 18 <210> SEQ ID NO 407 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 407 tctcccagcg tgcgtttt 18
<210> SEQ ID NO 408 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 408 tctcccgacg tgcgccat 18 <210> SEQ ID NO 409
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 409
tctcccgtcg tgcgccat 18 <210> SEQ ID NO 410 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 410 ataatcgtcg ttcaagcaag
20 <210> SEQ ID NO 411 <211> LENGTH: 23 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 411 tcgtcgtttt gtcgttttgt cgt 23 <210>
SEQ ID NO 412 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 412 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
413 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 413
tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 414 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: (3)...(3) <223> OTHER INFORMATION: n is
a or c or g or t/u <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: (8)...(8) <223> OTHER
INFORMATION: n is a or c or g or t/u <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION:
(11)...(11) <223> OTHER INFORMATION: n is a or c or g or t/u
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: (16)...(16) <223> OTHER INFORMATION: n
is a or c or g or t/u <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: (19)...(19) <223> OTHER
INFORMATION: n is a or c or g or t/u <221> NAME/KEY:
misc_difference <222> LOCATION: (24)...(24) <223> OTHER
INFORMATION: n is a or c or g or t/u <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 414 tcntcgtntt ntcgtnttnt cgtn 24 <210> SEQ ID NO
415 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 415
tctcccagcg tcgccat 17 <210> SEQ ID NO 416 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 416 tctcccatcg tcgccat 17
<210> SEQ ID NO 417 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 417
ataatcgtgc gttcaagaaa g 21 <210> SEQ ID NO 418 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 418 ataatcgacg ttcccccccc
20 <210> SEQ ID NO 419 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 419 tctatcgacg ttcaagcaag 20 <210> SEQ
ID NO 420 <211> LENGTH: 14 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 420
tcctgacggg gagt 14 <210> SEQ ID NO 421 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 421 tccatgacgt tcctgatcc 19
<210> SEQ ID NO 422 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 422 tccatgacgt tcctgatcc 19 <210> SEQ ID NO 423
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 423
tccatgacgt tcctgatcc 19 <210> SEQ ID NO 424 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 424 tcctggcgtg gaagt 15
<210> SEQ ID NO 425 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 425 tccatgacgt tcctgatcc 19 <210> SEQ ID NO 426
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 426
tcgtcgctgt tgtcgtttct t 21 <210> SEQ ID NO 427 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 427 agcagcttta gagctttaga
gctt 24 <210> SEQ ID NO 428 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 428 cccccccccc cccccccccc cccc 24
<210> SEQ ID NO 429 <211> LENGTH: 32 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 429 tcgtcgtttt gtcgttttgt cgttttgtcg tt 32 <210>
SEQ ID NO 430 <211> LENGTH: 28 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 430 tcgtcgtttt ttgtcgtttt ttgtcgtt 28 <210> SEQ ID
NO 431 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 431
tcgtcgtttt tttttttttt 20 <210> SEQ ID NO 432 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 432 tttttcaacg ttgatttttt
20 <210> SEQ ID NO 433 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 433 tttttttttt tttttttttt tttt 24 <210>
SEQ ID NO 434 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 434 ggggtcgtcg ttttgggggg 20 <210> SEQ ID NO 435
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 435
tcgtcgtttt gtcgttttgg gggg 24 <210> SEQ ID NO 436 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 436 tcgtcgctgt ctccgcttct
tcttgcc 27 <210> SEQ ID NO 437 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 437 tcgtcgctgt ctccg 15 <210>
SEQ ID NO 438 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 438 ctgtaagtga gcttggagag 20 <210> SEQ
ID NO 439 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 439
gagaacgctg gaccttccat 20 <210> SEQ ID NO 440 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 440 ccaggttgta tagaggc 17
<210> SEQ ID NO 441 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 441 gctagacgtt agcgtga 17 <210> SEQ ID NO 442
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 442
ggagctcttc gaacgccata 20 <210> SEQ ID NO 443 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 443 tctccatgat ggttttatcg
20 <210> SEQ ID NO 444 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 444 aaggtggggc agtctcaggg a 21 <210>
SEQ ID NO 445 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 445 atcggaggac tggcgcgccg 20 <210> SEQ ID NO 446
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 446
ttaggacaag gtctagggtg 20 <210> SEQ ID NO 447 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 447 accacaacga gaggaacgca
20 <210> SEQ ID NO 448 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 448 ggcagtgcag gctcaccggg 20 <210> SEQ
ID NO 449 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 449
gaaccttcca tgctgtt 17 <210> SEQ ID NO 450 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 450 gctagacgtt agcgtga 17
<210> SEQ ID NO 451 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 451 gcttggaggg cctgtaagtg 20 <210> SEQ ID NO 452
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 452
gtagccttcc ta 12 <210> SEQ ID NO 453 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 453 cggtagcctt ccta 14 <210>
SEQ ID NO 454 <211> LENGTH: 16 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 454 cacggtagcc ttccta 16 <210> SEQ ID NO 455
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 455
agcacggtag ccttccta 18 <210> SEQ ID NO 456 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 456 gaacgctgga ccttccat 18
<210> SEQ ID NO 457 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 457 gaccttccat 10 <210> SEQ ID NO 458 <211>
LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 458 tggaccttcc at 12
<210> SEQ ID NO 459 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 459 gctggacctt ccat 14 <210> SEQ ID NO
460 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 460
acgctggacc ttccat 16 <210> SEQ ID NO 461 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 461 taagctctgt caacgccagg 20
<210> SEQ ID NO 462 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 462 gagaacgctg gaccttccat gt 22 <210> SEQ ID NO 463
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 463
tccatgtcgg tcctgatgct 20 <210> SEQ ID NO 464 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 464 ttcatgcctt gcaaaatggc
g 21 <210> SEQ ID NO 465 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 465 tgctagctgt gcctgtacct 20 <210> SEQ
ID NO 466 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 466
agcatcagga ccgacatgga 20 <210> SEQ ID NO 467 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 467 gaccttccat gtcggtcctg
at 22 <210> SEQ ID NO 468 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 468 acaaccacga gaacgggaac 20 <210> SEQ
ID NO 469 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 469
gaaccttcca tgctgttccg 20 <210> SEQ ID NO 470 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 470 caatcaatct gaggagaccc
20 <210> SEQ ID NO 471 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 471 tcagctctgg tactttttca 20 <210> SEQ
ID NO 472 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 472
tggttacggt ctgtcccatg 20 <210> SEQ ID NO 473 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 473 gtctatcgga ggactggcgc
20 <210> SEQ ID NO 474 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 474 cattttacgg gcgggcgggc 20 <210> SEQ
ID NO 475 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 475
gaggggacca ttttacgggc 20 <210> SEQ ID NO 476 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 476 tgtccagccg aggggaccat
20 <210> SEQ ID NO 477 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 477 cgggcttacg gcggatgctg 20 <210> SEQ
ID NO 478 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 478
tggaccttct atgtcggtcc 20 <210> SEQ ID NO 479 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 479 tgtcccatgt ttttagaagc
20 <210> SEQ ID NO 480 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 480 gtggttacgg tcgtgcccat 20 <210> SEQ ID NO 481
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 481
cctccaaatg aaagaccccc 20 <210> SEQ ID NO 482 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 482 ttgtactctc catgatggtt
20 <210> SEQ ID NO 483 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 483 ttccatgctg ttccggctgg 20 <210> SEQ
ID NO 484 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 484
gaccttctat gtcggtcctg 20 <210> SEQ ID NO 485 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 485 gagaccgctc gaccttcgat
20 <210> SEQ ID NO 486 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 486 ttgccccata ttttagaaac 20 <210> SEQ
ID NO 487 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 487
ttgaaactga ggtgggac 18 <210> SEQ ID NO 488 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 488 ctatcggagg actggcgcgc
c 21 <210> SEQ ID NO 489 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 489 cttggagggc ctcccggcgg 20 <210> SEQ
ID NO 490 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 490
gctgaacctt ccatgctgtt 20 <210> SEQ ID NO 491 <211>
LENGTH: 32 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 491 tagaaacagc attcttcttt
tagggcagca ca 32 <210> SEQ ID NO 492 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 492 agatggttct cagataaagc ggaa 24
<210> SEQ ID NO 493 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 493 ttccgcttta tctgagaacc atct 24 <210> SEQ ID NO
494 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 494
gtcccaggtt gtatagaggc tgc 23 <210> SEQ ID NO 495 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 495 gcgccagtcc tccgatagac
20 <210> SEQ ID NO 496 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 496 atcggaggac tggcgcgccg 20 <210> SEQ
ID NO 497 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 497
ggtctgtccc atatttttag 20 <210> SEQ ID NO 498 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 498 tttttcaacg ttgagggggg
20 <210> SEQ ID NO 499 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 499 tttttcaagc gttgattttt t 21 <210>
SEQ ID NO 500 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 500 ggggtcaacg ttgatttttt 20 <210> SEQ ID NO 501
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 501 ggggttttca acgttttgag ggggg 25
<210> SEQ ID NO 502 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 502 ggttacggtc tgtcccatat 20 <210> SEQ ID NO 503
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 503
ctgtcccata tttttagaca 20 <210> SEQ ID NO 504 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 504 accatcctga ggccattcgg
20 <210> SEQ ID NO 505 <211> LENGTH: 23 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 505 cgtctatcgg gcttctgtgt ctg 23 <210>
SEQ ID NO 506 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 506 ggccatccca cattgaaagt t 21 <210> SEQ ID NO 507
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 507
ccaaatatcg gtggtcaagc ac 22 <210> SEQ ID NO 508 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 508 gtgcttgacc accgatattt
gg 22 <210> SEQ ID NO 509 <211> LENGTH: 26 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 509 gtgctgatca ccgatatcct gttcgg 26
<210> SEQ ID NO 510 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 510 ggccaacttt caatgtggga tggcctc 27 <210> SEQ ID
NO 511 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 511
ttccgccgaa tggcctcagg atggtac 27 <210> SEQ ID NO 512
<211> LENGTH: 36 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 512
tatagtccct gagactgccc caccttctca acaacc 36 <210> SEQ ID NO
513 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 513
gcagcctcta tacaacctgg gacggga 27 <210> SEQ ID NO 514
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 514
ctatcggagg actggcgcgc cg 22 <210> SEQ ID NO 515 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 515 tatcggagga ctggcgcgcc
g 21 <210> SEQ ID NO 516 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 516 gatcggagga ctggcgcgcc g 21 <210>
SEQ ID NO 517 <211> LENGTH: 26 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 517 ccgaacagga tatcggtgat cagcac 26 <210> SEQ ID NO
518 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 518
ttttggggtc aacgttgagg gggg 24 <210> SEQ ID NO 519 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 519 ggggtcaacg ttgagggggg
20 <210> SEQ ID NO 520 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 520 cgcgcgcgcg cgcgcgcgcg 20 <210> SEQ
ID NO 521 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 521
ggggcatgac gttcgggggg 20 <210> SEQ ID NO 522 <211>
LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 522 ggggcatgac gttcaaaaaa 20 <210> SEQ ID NO 523
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 523
ggggcatgag cttcgggggg 20 <210> SEQ ID NO 524 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 524 ggggcatgac gttcgggggg
20 <210> SEQ ID NO 525 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 525 aaaacatgac gttcaaaaaa 20 <210> SEQ
ID NO 526 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 526
aaaacatgac gttcgggggg 20 <210> SEQ ID NO 527 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 527 ggggcatgac gttcaaaaaa
20 <210> SEQ ID NO 528 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 528 accatggacg atctgtttcc cctc 24 <210>
SEQ ID NO 529 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 529 gccatggacg aactgttccc cctc 24 <210> SEQ ID NO
530 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 530
cccccccccc cccccccccc 20 <210> SEQ ID NO 531 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 531 gggggggggg gggggggggg
20 <210> SEQ ID NO 532 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 532 gctgtaaaat gaatcggccg 20 <210> SEQ
ID NO 533 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 533
ttcgggcgga ctcctccatt 20 <210> SEQ ID NO 534 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 534 tatgccgcgc ccggacttat
20 <210> SEQ ID NO 535 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 535 ggggtaatcg atcagggggg 20 <210> SEQ
ID NO 536 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 536
tttgagaacg ctggaccttc 20 <210> SEQ ID NO 537 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 537 gatcgctgat ctaatgctcg
20 <210> SEQ ID NO 538 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 538 gtcggtcctg atgctgttcc 20 <210> SEQ
ID NO 539 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 539
tcgtcgtcag ttcgctgtcg 20 <210> SEQ ID NO 540 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 540 ctggaccttc catgtcgg 18
<210> SEQ ID NO 541 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 541 gctcgttcag cgcgtct 17 <210> SEQ ID NO 542
<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 542
ctggaccttc catgtc 16 <210> SEQ ID NO 543 <211> LENGTH:
16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 543 cactgtcctt cgtcga 16 <210>
SEQ ID NO 544 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 544 cgctggacct tccatgtcgg 20 <210> SEQ ID NO 545
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 545
gctgagctca tgccgtctgc 20 <210> SEQ ID NO 546 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 546 aacgctggac cttccatgtc
20 <210> SEQ ID NO 547 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 547 tgcatgccgt acacagctct 20 <210> SEQ
ID NO 548 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 548
ccttccatgt cggtcctgat 20 <210> SEQ ID NO 549 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 549 tactcttcgg atcccttgcg
20 <210> SEQ ID NO 550 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 550 ttccatgtcg gtcctgat 18 <210> SEQ ID
NO 551 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 551
ctgattgctc tctcgtga 18 <210> SEQ ID NO 552 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 552 ggcgttattc ctgactcgcc
20 <210> SEQ ID NO 553 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 553 cctacgttgt atgcgcccag ct 22 <210>
SEQ ID NO 554 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 554 ggggtaatcg atgagggggg 20 <210> SEQ ID NO 555
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 555
ttcgggcgga ctcctccatt 20 <210> SEQ ID NO 556 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 556 tttttttttt tttttttttt
20 <210> SEQ ID NO 557 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 557 gggggttttt tttttggggg 20 <210> SEQ
ID NO 558 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 558
tttttggggg gggggttttt 20 <210> SEQ ID NO 559 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 559 gggggggggg ggggggggt
19 <210> SEQ ID NO 560 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 560 aaaaaaaaaa aaaaaaaaaa 20 <210> SEQ
ID NO 561 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 561
cccccaaaaa aaaaaccccc 20 <210> SEQ ID NO 562 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 562 aaaaaccccc cccccaaaaa
20 <210> SEQ ID NO 563 <211> LENGTH: 27 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 563 tttgaattca ggactggtga ggttgag 27
<210> SEQ ID NO 564
<211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 564
tttgaatcct cagcggtctc cagtggc 27 <210> SEQ ID NO 565
<211> LENGTH: 45 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 565
aattctctat cggggcttct gtgtctgttg ctggttccgc tttat 45 <210>
SEQ ID NO 566 <211> LENGTH: 45 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 566 ctagataaag cggaaccagc aacagacaca gaagccccga tagag 45
<210> SEQ ID NO 567 <211> LENGTH: 28 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 567 ttttctagag aggtgcacaa tgctctgg 28 <210> SEQ ID
NO 568 <211> LENGTH: 29 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 568
tttgaattcc gtgtacagaa gcgagaagc 29 <210> SEQ ID NO 569
<211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 569
tttgcggccg ctagacttaa cctgagagat a 31 <210> SEQ ID NO 570
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 570
tttgggccca cgagagacag agacacttc 29 <210> SEQ ID NO 571
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 571
tttgggcccg cttctcgctt ctgtacacg 29 <210> SEQ ID NO 572
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 572
gagaacgctg gaccttccat 20 <210> SEQ ID NO 573 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 573 tccatgtcgg tcctgatgct
20 <210> SEQ ID NO 574 <211> LENGTH: 6 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 574 ctgtcg 6 <210> SEQ ID NO 575
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 575 tcgtga 6
<210> SEQ ID NO 576 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 576 cgtcga 6 <210> SEQ ID NO 577 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 577 agtgct 6 <210>
SEQ ID NO 578 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 578 ctgtcg 6 <210> SEQ ID NO 579 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 579 agtgct 6 <210>
SEQ ID NO 580 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 580 cgtcga 6 <210> SEQ ID NO 581 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 581 tcgtga 6 <210>
SEQ ID NO 582 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 582 gagaacgctc cagcttcgat 20 <210> SEQ ID NO 583
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 583
gctagacgta agcgtga 17 <210> SEQ ID NO 584 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 584 gagaacgctc gaccttccat 20
<210> SEQ ID NO 585 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 585 gagaacgctg gacctatcca t 21 <210> SEQ ID NO 586
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 586
gctagaggtt agcgtga 17 <210> SEQ ID NO 587 <211> LENGTH:
19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 587 gagaacgctg gacttccat 19
<210> SEQ ID NO 588 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 588 tcacgctaac gtctagc 17 <210> SEQ ID NO 589
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(3) <223> OTHER
INFORMATION: Conjugated to biotin moiety. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 589 gctagacgtt agcgtga 17 <210> SEQ ID NO 590
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 590
atggaaggtc gagcgttctc 20 <210> SEQ ID NO 591 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 591 gagaacgctg gaccttcgat
20 <210> SEQ ID NO 592 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 592 gagaacgatg gaccttccat 20 <210> SEQ
ID NO 593 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 593
gagaacgctg gatccat 17 <210> SEQ ID NO 594 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 594 gagaacgctc cagcactgat 20
<210> SEQ ID NO 595 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 595 tccatgtcgg tcctgctgat 20 <210> SEQ ID NO 596
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 596
atgtcctcgg tcctgatgct 20 <210> SEQ ID NO 597 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 597 gagaacgctc caccttccat
20 <210> SEQ ID NO 598 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 598 gagaacgctg gaccttcgta 20 <210> SEQ
ID NO 599 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (1)...(3) <223>
OTHER INFORMATION: Conjugated to biotin moiety. <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 599 atggaaggtc cagcgttctc 20 <210> SEQ
ID NO 600 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 600
tcctga 6 <210> SEQ ID NO 601 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 601 tcaacgtt 8 <210> SEQ ID NO
602 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 602
aacgtt 6 <210> SEQ ID NO 603 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 603 aacgttga 8 <210> SEQ ID NO
604 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 604
tcacgctaac ctctagc 17 <210> SEQ ID NO 605 <211> LENGTH:
20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 605 gagaacgctg gaccttgcat 20 <210> SEQ ID NO 606
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 606
gctggacctt ccat 14 <210> SEQ ID NO 607 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 607 gagaacgctg gacctcatcc at 22
<210> SEQ ID NO 608 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 608 gagaacgctg gacgctcatc cat 23 <210> SEQ ID NO
609 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 609
aacgttgagg ggcat 15 <210> SEQ ID NO 610 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 610 atgcccctca acgtt 15 <210>
SEQ ID NO 611 <211> LENGTH: 10 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 611 tcaacgttga 10 <210> SEQ ID NO 612 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 612 gctggacctt ccat 14
<210> SEQ ID NO 613 <211> LENGTH: 7 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 613 caacgtt 7 <210> SEQ ID NO 614 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 614 acaacgttga 10
<210> SEQ ID NO 615 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 615 tcacgt 6 <210> SEQ ID NO 616 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 616 tcaagctt 8 <210>
SEQ ID NO 617 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 617 tcgtca 6 <210> SEQ ID NO 618 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 618 aggatatc 8 <210>
SEQ ID NO 619 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 619 tagacgtc 8 <210> SEQ ID NO 620 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 620 gacgtcat 8 <210>
SEQ ID NO 621 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 621 ccatcgat 8 <210> SEQ ID NO 622 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 622 atcgatgt 8 <210>
SEQ ID NO 623 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 623 atgcatgt 8 <210> SEQ ID NO 624 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 624 ccatgcat 8 <210>
SEQ ID NO 625 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 625 agcgctga 8 <210> SEQ ID NO 626 <211>
LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 626 tcagcgct 8 <210> SEQ ID NO
627 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 627
ccttcgat 8 <210> SEQ ID NO 628 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 628 gtgccggggt ctccgggc 18
<210> SEQ ID NO 629 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 629 gctgtggggc ggctcctg 18 <210> SEQ ID NO 630
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(3) <223> OTHER
INFORMATION: Conjugated to biotin moiety. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 630 tcaacgtt 8 <210> SEQ ID NO 631 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(3) <223> OTHER INFORMATION:
Conjugated to FITC moiety. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 631 tcaacgtt
8 <210> SEQ ID NO 632 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(3)
<223> OTHER INFORMATION: Conjugated to FITC moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 632 aacgttga 8 <210> SEQ ID NO
633 <211> LENGTH: 7 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 633
tcaacgt 7 <210> SEQ ID NO 634 <211> LENGTH: 7
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 634 aacgttg 7 <210> SEQ ID NO
635 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 635
cgacga 6 <210> SEQ ID NO 636 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 636 tcaacgtt 8 <210> SEQ ID NO
637 <211> LENGTH: 5 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 637
tcgga 5 <210> SEQ ID NO 638 <211> LENGTH: 8 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 638 agaacgtt 8 <210> SEQ ID NO 639
<211> LENGTH: 8 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 639 tcatcgat
8 <210> SEQ ID NO 640 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 640 taaacgtt 8 <210> SEQ ID NO 641 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 641 ccaacgtt 8 <210>
SEQ ID NO 642 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 642 gctcga 6 <210> SEQ ID NO 643 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 643 cgacgt 6 <210>
SEQ ID NO 644 <211> LENGTH: 6 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 644 cgtcgt 6 <210> SEQ ID NO 645 <211>
LENGTH: 6 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 645 acgtgt 6 <210>
SEQ ID NO 646
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 646 cgttcg 6
<210> SEQ ID NO 647 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 647 gagcaagctg gaccttccat 20 <210> SEQ ID NO 648
<211> LENGTH: 6 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 648 cgcgta 6
<210> SEQ ID NO 649 <211> LENGTH: 6 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 649 cgtacg 6 <210> SEQ ID NO 650 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 650 tcaccggt 8 <210>
SEQ ID NO 651 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 651 caagagatgc taacaatgca 20 <210> SEQ ID NO 652
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 652
acccatcaat agctctgtgc 20 <210> SEQ ID NO 653 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 653 ccatcgat 8 <210>
SEQ ID NO 654 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 654 tcgacgtc 8 <210> SEQ ID NO 655 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 655 ctagcgct 8 <210>
SEQ ID NO 656 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 656 taagcgct 8 <210> SEQ ID NO 657 <211>
LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 657 tcgcgaattc gcg 13
<210> SEQ ID NO 658 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 658 atggaaggtc cagcgttct 19 <210> SEQ ID NO 659
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 659
actggacgtt agcgtga 17 <210> SEQ ID NO 660 <211> LENGTH:
18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 660 cgcctggggc tggtctgg 18
<210> SEQ ID NO 661 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 661 gtgtcggggt ctccgggc 18 <210> SEQ ID NO 662
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 662
gtgccggggt ctccgggc 18 <210> SEQ ID NO 663 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 663 cgccgtcgcg gcggttgg 18
<210> SEQ ID NO 664 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 664 gaagttcacg ttgaggggca t 21 <210> SEQ ID NO 665
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 665
atctggtgag ggcaagctat g 21 <210> SEQ ID NO 666 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 666 gttgaaaccc gagaacatca
t 21
<210> SEQ ID NO 667 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 667 gcaacgtt 8 <210> SEQ ID NO 668 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 668 gtaacgtt 8 <210>
SEQ ID NO 669 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 669 cgaacgtt 8 <210> SEQ ID NO 670 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 670 gaaacgtt 8 <210>
SEQ ID NO 671 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 671 caaacgtt 8 <210> SEQ ID NO 672 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 672 ctaacgtt 8 <210>
SEQ ID NO 673 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 673 ggaacgtt 8 <210> SEQ ID NO 674 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 674 tgaacgtt 8 <210>
SEQ ID NO 675 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 675 acaacgtt 8 <210> SEQ ID NO 676 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 676 ttaacgtt 8 <210>
SEQ ID NO 677 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 677 aaaacgtt 8 <210> SEQ ID NO 678 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 678 ataacgtt 8 <210>
SEQ ID NO 679 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 679 aacgttct 8 <210> SEQ ID NO 680 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 680 tccgatcg 8 <210>
SEQ ID NO 681 <211> LENGTH: 8 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 681 tccgtacg 8 <210> SEQ ID NO 682 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 682 gctagacgct agcgtga 17
<210> SEQ ID NO 683 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 683 gagaacgctg gacctcatca tccat 25 <210> SEQ ID NO
684 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 684
gagaacgcta gaccttctat 20 <210> SEQ ID NO 685 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 685 actagacgtt agtgtga 17
<210> SEQ ID NO 686 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 686 cacaccttgg tcaatgtcac gt 22 <210> SEQ ID NO 687
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 687
tctccatcct atggttttat cg 22
<210> SEQ ID NO 688 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 688 cgctggacct tccat 15 <210> SEQ ID NO 689
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 689
caccaccttg gtcaatgtca cgt 23 <210> SEQ ID NO 690 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 690 gctagacgtt agctgga 17
<210> SEQ ID NO 691 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 691 agtgcgattg cagatcg 17 <210> SEQ ID NO 692
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 692
ttttcgtttt gtggttttgt ggtt 24 <210> SEQ ID NO 693 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 693 ttttcgtttg tcgttttgtc
gtt 23 <210> SEQ ID NO 694 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 694 tttttgtttt gtggttttgt ggtt 24 <210>
SEQ ID NO 695 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 695 accgcatgga ttctaggcca 20 <210> SEQ ID NO 696
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 696
gctagacgtt agcgt 15 <210> SEQ ID NO 697 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 697 aacgctggac cttccat 17
<210> SEQ ID NO 698 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (5)...(5)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 698
tcaangtt 8 <210> SEQ ID NO 699 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 699 ccttcgat 8 <210> SEQ ID NO
700 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 700
actagacgtt agtgtga 17 <210> SEQ ID NO 701 <211> LENGTH:
17 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 701 gctagaggtt agcgtga 17
<210> SEQ ID NO 702 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 702 atggactctc cagcgttctc 20 <210> SEQ ID NO 703
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 703
atcgactctc gagcgttctc 20 <210> SEQ ID NO 704 <211>
LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 704 gctagacgtt agc 13
<210> SEQ ID NO 705 <211> LENGTH: 9 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 705 gctagacgt 9 <210> SEQ ID NO 706 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 706 agtgcgattc gagatcg 17
<210> SEQ ID NO 707 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (5)...(5)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 707
tcagngct 8 <210> SEQ ID NO 708 <211> LENGTH: 18
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 708 ctgattgctc tctcgtga 18
<210> SEQ ID NO 709 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (2)...(2)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 709
tnaacgtt 8 <210> SEQ ID NO 710 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 710 gagaangctg gaccttccat 20
<210> SEQ ID NO 711 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 711 gctagacgtt aggctga 17 <210> SEQ ID NO 712
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 712
gctacttagc gtga 14 <210> SEQ ID NO 713 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 713 gctaccttag cgtga 15 <210>
SEQ ID NO 714 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 714 atcgacttcg agcgttctc 19 <210> SEQ ID NO 715
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 715
atgcactctg cagcgttctc 20 <210> SEQ ID NO 716 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 716 agtgactctc cagcgttctc
20 <210> SEQ ID NO 717 <211> LENGTH: 17 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 717 gccagatgtt agctgga 17 <210> SEQ ID
NO 718 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 718
atcgactcga gcgttctc 18 <210> SEQ ID NO 719 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 719 atcgatcgag cgttctc 17
<210> SEQ ID NO 720 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(3)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 720 gagaacgctc gaccttcgat 20
<210> SEQ ID NO 721 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 721 gctagacgtt agctgga 17 <210> SEQ ID NO 722
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 722
atcgactctc gagcgttctc 20 <210> SEQ ID NO 723 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 723 tagacgttag cgtga 15
<210> SEQ ID NO 724 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 724 cgactctcga gcgttctc 18 <210> SEQ ID NO 725
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 725
ggggtcgacc ttggaggggg g 21 <210> SEQ ID NO 726 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 726 gctaacgtta gcgtga 16
<210> SEQ ID NO 727 <211> LENGTH: 9 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 727 cgtcgtcgt 9 <210> SEQ ID NO 728
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (14)...(14) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 728
gagaacgctg gacnttccat 20 <210> SEQ ID NO 729 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (18)...(18) <223> OTHER INFORMATION:
m5c <220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 729 atcgacctac gtgcgttntc 20
<210> SEQ ID NO 730 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (3)...(3)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 730
atngacctac gtgcgttctc 20 <210> SEQ ID NO 731 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (7)...(7) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 731 gctagangtt agcgt 15 <210>
SEQ ID NO 732 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(14)...(14) <223> OTHER INFORMATION: m5c <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 732 atcgactctc gagngttctc 20 <210> SEQ ID NO 733
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 733
ggggtaatgc atcagggggg 20 <210> SEQ ID NO 734 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 734 ggctgtattc ctgactgccc
20 <210> SEQ ID NO 735 <211> LENGTH: 17 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 735 ccatgctaac ctctagc 17 <210> SEQ ID
NO 736 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 736
gctagatgtt agcgtga 17 <210> SEQ ID NO 737 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 737 cgtaccttac ggtga 15 <210>
SEQ ID NO 738 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 738 tccatgctgg tcctgatgct 20 <210> SEQ ID NO 739
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 739
atcgactctc tcgagcgttc tc 22 <210> SEQ ID NO 740 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 740 gctagagctt agcgtga 17
<210> SEQ ID NO 741 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 741 atcgactctc gagtgttctc 20 <210> SEQ ID NO 742
<211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 742
aacgctcgac cttcgat 17 <210> SEQ ID NO 743 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 743 ctcaacgctg gaccttccat 20
<210> SEQ ID NO 744 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 744 atcgacctac gtgcgttctc 20 <210> SEQ ID NO 745
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 745
gagaatgctg gaccttccat 20 <210> SEQ ID NO 746 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 746 tcacgctaac ctctgac 17
<210> SEQ ID NO 747 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)...(3) <223> OTHER INFORMATION: Conjugated to
biotin moiety. <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 747 gagaacgctc cagcactgat
20 <210> SEQ ID NO 748 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(3) <223> OTHER INFORMATION: Biotin moiety attached at
5' end of sequence. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 748
gagcaagctg gaccttccat 20 <210> SEQ ID NO 749 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 749 cgctagaggt tagcgtga 18
<210> SEQ ID NO 750 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 750 gctagatgtt aacgt 15 <210> SEQ ID NO 751
<211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 751
atggaaggtc cacgttctc 19 <210> SEQ ID NO 752 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 752 gctagatgtt agcgt 15
<210> SEQ ID NO 753 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 753 gctagacgtt agtgt 15 <210> SEQ ID NO 754
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 754
tccatgacgg tcctgatgct 20 <210> SEQ ID NO 755 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 755 tccatggcgg tcctgatgct
20 <210> SEQ ID NO 756 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 756 gctagacgat agcgt 15 <210> SEQ ID NO
757 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 757
gctagtcgat agcgt 15 <210> SEQ ID NO 758 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 758 tccatgacgt tcctgatgct 20
<210> SEQ ID NO 759 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 759 tccatgtcgt tcctgatgct 20 <210> SEQ ID NO 760
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
modified_base <222> LOCATION: (13)...(13) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 760
gctagacgtt agngt 15 <210> SEQ ID NO 761 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 761 gctaggcgtt agcgt 15 <210>
SEQ ID NO 762 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION: (8)...(8)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 762
tccatgtngg tcctgatgct 20 <210> SEQ ID NO 763 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (12)...(12) <223> OTHER INFORMATION:
m5c <220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 763 tccatgtcgg tnctgatgct 20
<210> SEQ ID NO 764 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <220>
FEATURE: <221> NAME/KEY: modified_base <222> LOCATION:
(3)...(3) <223> OTHER INFORMATION: m5c <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(10)...(10) <223> OTHER INFORMATION: m5c <220> FEATURE:
<221> NAME/KEY: modified_base <222> LOCATION:
(14)...(14) <223> OTHER INFORMATION: m5c <400>
SEQUENCE: 764 atngactctn gagngttctc 20 <210> SEQ ID NO 765
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence
<400> SEQUENCE: 765 atggaaggtc cagtgttctc 20 <210> SEQ
ID NO 766 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 766
gcatgacgtt gagct 15 <210> SEQ ID NO 767 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 767 ggggtcaacg ttgagggggg 20
<210> SEQ ID NO 768 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 768 ggggtcaagt ctgagggggg 20 <210> SEQ ID NO 769
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 769
cgcgcgcgcg cgcgcgcgcg 20 <210> SEQ ID NO 770 <211>
LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 770 cccccccccc cccccccccc
cccccccc 28 <210> SEQ ID NO 771 <211> LENGTH: 35
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 771 cccccccccc cccccccccc cccccccccc
ccccc 35 <210> SEQ ID NO 772 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 772 tccatgtcgc tcctgatcct 20
<210> SEQ ID NO 773 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 773 gctaaacgtt agcgt 15 <210> SEQ ID NO 774
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 774
tccatgtcga tcctgatgct 20 <210> SEQ ID NO 775 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 775 tccatgccgg tcctgatgct
20 <210> SEQ ID NO 776 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 776 aaaatcaacg ttgaaaaaaa 20 <210> SEQ
ID NO 777 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 777
tccataacgt tcctgatgct 20 <210> SEQ ID NO 778 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 778 tggaggtccc accgagatcg
gag 23 <210> SEQ ID NO 779 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 779 cgtcgtcgtc gtcgtcgtcg t 21 <210>
SEQ ID NO 780 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 780 ctgctgctgc tgctgctgct g 21 <210> SEQ ID NO 781
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 781
gagaacgctc cgaccttcga t 21 <210> SEQ ID NO 782 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 782 gctagatgtt agcgt 15
<210> SEQ ID NO 783 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 783 gcatgacgtt gagct 15 <210> SEQ ID NO 784
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)...(10) <223> OTHER
INFORMATION: Conjugated to FITC moiety. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 784 tcaatgctga 10 <210> SEQ ID NO 785 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (8)...(10) <223> OTHER INFORMATION:
Conjugated to FITC moiety. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 785
tcaacgttga 10 <210> SEQ ID NO 786 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)...(10) <223> OTHER INFORMATION: Conjugated to
biotin moiety. <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 786 tcaacgttga 10
<210> SEQ ID NO 787 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)...(10)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 787 gcaatattgc 10 <210> SEQ ID
NO 788 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)...(10) <223>
OTHER INFORMATION: Conjugated to FITC moiety. <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 788 gcaatattgc 10 <210> SEQ ID NO 789 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 789 agttgcaact 10
<210> SEQ ID NO 790 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 790 tcttcgaa 8 <210> SEQ ID NO 791 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 791 tcaacgtc 8 <210>
SEQ ID NO 792 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 792 ccatgtcggt cctgatgct 19 <210> SEQ ID NO 793
<211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 793
gtttttatat aatttggg 18 <210> SEQ ID NO 794 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 794 tttttgtttg tcgttttgtc
gtt 23 <210> SEQ ID NO 795 <211> LENGTH: 12 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 795 ttgggggggg tt 12 <210> SEQ ID NO
796 <211> LENGTH: 13 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 796
ggggttgggg gtt 13 <210> SEQ ID NO 797 <211> LENGTH: 17
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 797 ggtggtgtag gttttgg 17
<210> SEQ ID NO 798 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(3)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<221> NAME/KEY: modified_base <222> LOCATION: (6)...(6)
<223> OTHER INFORMATION: m5c <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 798
gagaangctc gaccttcgat 20 <210> SEQ ID NO 799 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 799 tcaacgttaa cgttaacgtt
20 <210> SEQ ID NO 800 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(3) <223> OTHER INFORMATION: Conjugated to biotin
moiety. <221> NAME/KEY: modified_base <222> LOCATION:
(8)...(8) <223> OTHER INFORMATION: m5c <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 800 gagcaagntg gaccttccat 20 <210> SEQ ID NO 801
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)...(3) <223> OTHER
INFORMATION: Conjugated to biotin moiety. <221> NAME/KEY:
modified_base <222> LOCATION: (6)...(6) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 801
gagaangctc cagcactgat 20 <210> SEQ ID NO 802 <211>
LENGTH: 10 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (5)...(5) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: misc_feature <222> LOCATION: (8)...(10)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 802 tcaangttga 10 <210> SEQ ID
NO 803 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (2)...(2) <223> OTHER INFORMATION: m5c
<221> NAME/KEY: misc_feature <222> LOCATION: (8)...(10)
<223> OTHER INFORMATION: Conjugated to biotin moiety.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 803 gnaatattgc 10 <210> SEQ ID
NO 804 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 804
tgctgctttt gtcgttttgt gctt 24 <210> SEQ ID NO 805 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 805 ctgcgttagc aatttaactg
tg 22 <210> SEQ ID NO 806 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 806 tccatgacgt tcctgatgct 20 <210> SEQ
ID NO 807 <211> LENGTH: 28 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 807
tgcatgccgt gcatccgtac acagctct 28 <210> SEQ ID NO 808
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 808
tgcatgccgt acacagctct 20 <210> SEQ ID NO 809 <211>
LENGTH: 12 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 809 tgcatcagct ct 12
<210> SEQ ID NO 810 <211> LENGTH: 8 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 810 tgcgctct 8 <210> SEQ ID NO 811 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 811 cccccccccc cccccccccc
20 <210> SEQ ID NO 812 <211> LENGTH: 12 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 812 cccccccccc cc 12 <210> SEQ ID NO
813 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 813
cccccccc 8 <210> SEQ ID NO 814 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 814 tgcatcagct ct 12 <210> SEQ
ID NO 815 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 815
tgcatgccgt acacagctct 20 <210> SEQ ID NO 816 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 816 gagcaagctg gaccttccat
20 <210> SEQ ID NO 817 <211> LENGTH: 32 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 817 tcaacgttaa cgttaacgtt aacgttaacg tt 32
<210> SEQ ID NO 818 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 818 gagaacgctc gaccttcgat 20 <210> SEQ ID NO 819
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 819
gtccccattt cccagaggag gaaat 25 <210> SEQ ID NO 820
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 820
ctagcggctg acgtcatcaa gctag 25 <210> SEQ ID NO 821
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 821
ctagcttgat gacgtcagcc gctag 25 <210> SEQ ID NO 822
<211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 822
cggctgacgt catcaa 16 <210> SEQ ID NO 823 <211> LENGTH:
8 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 823
ctgacgtg 8 <210> SEQ ID NO 824 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 824 ctgacgtcat 10 <210> SEQ ID
NO 825 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 825
attcgatcgg ggcggggcga g 21 <210> SEQ ID NO 826 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 826 ctcgccccgc cccgatcgaa
t 21 <210> SEQ ID NO 827 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 827 gactgacgtc agcgt 15 <210> SEQ ID NO
828 <211> LENGTH: 26 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 828
ctagcggctg acgtcataaa gctagc 26 <210> SEQ ID NO 829
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 829
ctagctttat gacgtcagcc gctagc 26 <210> SEQ ID NO 830
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 830
ctagcggctg agctcataaa gctagc 26 <210> SEQ ID NO 831
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 831
ctagtggctg acgtcatcaa gctag 25 <210> SEQ ID NO 832
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 832
tccaccacgt ggtctatgct 20 <210> SEQ ID NO 833 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 833 gggaatgaaa gattttatta
taag 24 <210> SEQ ID NO 834 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 834 tctaaaaacc atctattctt aaccct 26
<210> SEQ ID NO 835 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 835 agctcaacgt catgc 15 <210> SEQ ID NO 836
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 836
ttaacggtgg tagcggtatt ggtc 24 <210> SEQ ID NO 837 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 837 ttaagaccaa taccgctacc
accg 24 <210> SEQ ID NO 838 <211> LENGTH: 25
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 838 gatctagtga tgagtcagcc ggatc 25
<210> SEQ ID NO 839 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 839 gatccggctg actcatcact agatc 25 <210> SEQ ID NO
840 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 840
tccaagacgt tcctgatgct 20 <210> SEQ ID NO 841 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 841 tccatgacgt ccctgatgct
20 <210> SEQ ID NO 842 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 842 tccaccacgt ggctgatgct 20 <210> SEQ
ID NO 843 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 843
ccacgtggac ctctagc 17 <210> SEQ ID NO 844 <211> LENGTH:
27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence
<400> SEQUENCE: 844 tcagaccacg tggtcgggtg ttcctga 27
<210> SEQ ID NO 845 <211> LENGTH: 27 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 845 tcaggaacac ccgaccacgt ggtctga 27 <210> SEQ ID
NO 846 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 846
catttccacg atttccca 18 <210> SEQ ID NO 847 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 847 ttcctctctg caagagact
19 <210> SEQ ID NO 848 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 848 tgtatctctc tgaaggact 19 <210> SEQ
ID NO 849 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 849
ataaagcgaa actagcagca gtttc 25 <210> SEQ ID NO 850
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 850
gaaactgctg ctagtttcgc tttat 25 <210> SEQ ID NO 851
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 851
tgcccaaaga ggaaaatttg tttcatacag 30 <210> SEQ ID NO 852
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 852
ctgtatgaaa caaattttcc tctttgggca 30 <210> SEQ ID NO 853
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 853
ttagggttag ggttagggtt 20 <210> SEQ ID NO 854 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 854 tccatgagct tcctgatgct
20 <210> SEQ ID NO 855 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 855 aaaacatgac gttcaaaaaa 20 <210> SEQ
ID NO 856 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 856
aaaacatgac gttcgggggg 20 <210> SEQ ID NO 857 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 857 ggggcatgag cttcgggggg
20 <210> SEQ ID NO 858 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 858 ctaggctgac gtcatcaagc tagt 24 <210>
SEQ ID NO 859 <211> LENGTH: 30 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 859 tctgacgtca tctgacgttg gctgacgtct 30 <210> SEQ
ID NO 860 <211> LENGTH: 25 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 860
ggaattagta atagatatag aagtt 25 <210> SEQ ID NO 861
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 861
tttacctttt ataaacataa ctaaaacaaa 30 <210> SEQ ID NO 862
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 862
gcgttttttt ttgcg 15 <210> SEQ ID NO 863 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 863 atatctaatc aaaacattaa caaa 24
<210> SEQ ID NO 864 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 864 tctatcccag gtggttcctg ttag 24 <210> SEQ ID NO
865 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: misc_feature
<222> LOCATION: (1)...(3) <223> OTHER INFORMATION:
Conjugated to biotin moiety. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 865
tccatgacgt tcctgatgct 20 <210> SEQ ID NO 866 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (1)...(3) <223> OTHER INFORMATION:
Conjugated to biotin moiety. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 866
tccatgagct tcctgatgct 20 <210> SEQ ID NO 867 <211>
LENGTH: 13 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (11)...(13) <223> OTHER INFORMATION:
Conjugated to FITC moiety. <221> NAME/KEY: misc_feature
<222> LOCATION: (0)...(0) <223> OTHER INFORMATION: Has
phosphodiester backbone. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 867
tttttttttt ttt 13 <210> SEQ ID NO 868 <211> LENGTH: 13
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)...(13) <223> OTHER INFORMATION: Conjugated to
biotin moiety. <221> NAME/KEY: misc_feature <222>
LOCATION: (0)...(0) <223> OTHER INFORMATION: Has
phosphorothioate and phosphodiester chimeric backbone with
phosphodiester on 3' end. <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 868
tttttttttt ttt 13 <210> SEQ ID NO 869 <211> LENGTH: 25
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 869 ctagcttgat gagctcagcc gctag 25
<210> SEQ ID NO 870 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 870 ttcagttgtc ttgctgctta gctaa 25 <210> SEQ ID NO
871 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 871
tccatgagct tcctgagtct 20 <210> SEQ ID NO 872 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 872 ctagcggctg acgtcatcaa
tctag 25 <210> SEQ ID NO 873 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 873 tgctagctgt gcctgtacct 20
<210> SEQ ID NO 874 <211> LENGTH: 23 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 874 atgctaaagg acgtcacatt gca 23 <210> SEQ ID NO
875 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 875
tgcaatgtga cgtcctttag cat 23 <210> SEQ ID NO 876 <211>
LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 876 gtaggggact ttccgagctc
gagatcctat g 31 <210> SEQ ID NO 877 <211> LENGTH: 31
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 877 cataggatct cgagctcgga aagtccccta
c 31 <210> SEQ ID NO 878 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 878 ctgtcaggaa ctgcaggtaa gg 22 <210>
SEQ ID NO 879 <211> LENGTH: 27 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 879 cataacatag gaatatttac tcctcgc 27 <210> SEQ ID
NO 880 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 880
ctccagctcc aagaaaggac g 21 <210> SEQ ID NO 881 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 881 gaagtttctg gtaagtcttc
g 21 <210> SEQ ID NO 882 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 882 tgctgctttt gtgcttttgt gctt 24 <210>
SEQ ID NO 883 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 883 tcgtcgtttt gtggttttgt ggtt 24 <210> SEQ ID NO
884 <211> LENGTH: 23 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 884 tcgtcgtttg tcgttttgtc gtt 23 <210>
SEQ ID NO 885 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 885 tcctgacgtt cggcgcgcgc cc 22 <210> SEQ ID NO 886
<211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 886
tgctgctttt gtgcttttgt gctt 24 <210> SEQ ID NO 887 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 887 tccatgagct tcctgagctt
20 <210> SEQ ID NO 888 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 888 tcgtcgtttc gtcgttttga cgtt 24 <210>
SEQ ID NO 889 <211> LENGTH: 26 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 889 tcgtcgtttg cgtgcgtttc gtcgtt 26 <210> SEQ ID NO
890 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 890
tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> SEQ ID NO 891
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 891
ttcgtcgttt tgtcgttttg tcgtt 25 <210> SEQ ID NO 892
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 892
tcctgacggg gaagt 15 <210> SEQ ID NO 893 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 893 tcctggcgtg gaagt 15 <210>
SEQ ID NO 894 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 894 tcctggcggt gaagt 15 <210> SEQ ID NO 895
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 895
tcctggcgtt gaagt 15 <210> SEQ ID NO 896 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 896 tcctgacgtg gaagt 15 <210>
SEQ ID NO 897 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 897 gcgacgttcg gcgcgcgccc 20 <210> SEQ ID NO 898
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 898
gcgacgggcg gcgcgcgccc 20 <210> SEQ ID NO 899 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 899 gcggcgtgcg gcgcgcgccc
20 <210> SEQ ID NO 900 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 900 gcggcggtcg gcgcgcgccc 20 <210> SEQ
ID NO 901 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 901
gcgacggtcg gcgcgcgccc 20 <210> SEQ ID NO 902 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 902 gcggcgttcg gcgcgcgccc
20 <210> SEQ ID NO 903 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 903 gcgacgtgcg gcgcgcgccc 20 <210> SEQ
ID NO 904 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 904
tcgtcgctgt ctccg 15 <210> SEQ ID NO 905 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 905 tgtgggggtt ttggttttgg 20 <210> SEQ ID NO 906
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 906
aggggagggg aggggagggg 20 <210> SEQ ID NO 907 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 907 tgtgtgtgtg tgtgtgtgtg
t 21 <210> SEQ ID NO 908 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 908 ctctctctct ctctctctct ct 22 <210>
SEQ ID NO 909 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 909 ggggtcgacg tcgagggggg 20 <210> SEQ ID NO 910
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 910
atatatatat atatatatat at 22 <210> SEQ ID NO 911 <211>
LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 911 tttttttttt tttttttttt
ttttttt 27 <210> SEQ ID NO 912 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 912 tttttttttt tttttttttt t 21
<210> SEQ ID NO 913 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 913 tttttttttt tttttttt 18 <210> SEQ ID NO 914
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 914
gctagagggg agggt 15 <210> SEQ ID NO 915 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 915 gctagatgtt agggg 15 <210>
SEQ ID NO 916 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 916 gcatgagggg gagct 15 <210> SEQ ID NO 917
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 917
atggaaggtc cagggggctc 20 <210> SEQ ID NO 918 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 918 atggactctg gagggggctc
20 <210> SEQ ID NO 919 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 919 atggaaggtc caaggggctc 20 <210> SEQ
ID NO 920 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 920
gagaaggggg gaccttggat 20 <210> SEQ ID NO 921 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 921 gagaaggggg gaccttccat
20 <210> SEQ ID NO 922 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 922 gagaaggggc cagcactgat 20 <210> SEQ
ID NO 923 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 923
tccatgtggg gcctgatgct 20 <210> SEQ ID NO 924 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 924 tccatgaggg gcctgatgct
20 <210> SEQ ID NO 925 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 925 tccatgtggg gcctgctgat 20 <210> SEQ
ID NO 926 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 926 atggactctc cggggttctc 20
<210> SEQ ID NO 927 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 927 atggaaggtc cggggttctc 20 <210> SEQ ID NO 928
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 928
atggactctg gaggggtctc 20 <210> SEQ ID NO 929 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 929 atggaggctc catggggctc
20 <210> SEQ ID NO 930 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 930 atggactctg gggggttctc 20 <210> SEQ
ID NO 931 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 931
tccatgtggg tggggatgct 20 <210> SEQ ID NO 932 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 932 tccatgcggg tggggatgct
20 <210> SEQ ID NO 933 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 933 tccatggggg tcctgatgct 20 <210> SEQ
ID NO 934 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 934
tccatggggt ccctgatgct 20 <210> SEQ ID NO 935 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 935 tccatggggt gcctgatgct
20 <210> SEQ ID NO 936 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 936 tccatggggt tcctgatgct 20 <210> SEQ
ID NO 937 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 937
tccatcgggg gcctgatgct 20 <210> SEQ ID NO 938 <211>
LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 938 gctagaggga gtgt 14
<210> SEQ ID NO 939 <211> LENGTH: 18 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 939 tttttttttt tttttttt 18 <210> SEQ ID NO 940
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: (2)...(2) <223> OTHER
INFORMATION: m is a or c <221> NAME/KEY: misc_difference
<222> LOCATION: (18)...(18) <223> OTHER INFORMATION: m
is a or c <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 940 gmggtcaacg ttgagggmgg
g 21 <210> SEQ ID NO 941 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 941 ggggagttcg ttgagggggg g 21 <210>
SEQ ID NO 942 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 942 tcgtcgtttc cccccccccc 20 <210> SEQ ID NO 943
<211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 943
ttggggggtt tttttttttt ttttt 25 <210> SEQ ID NO 944
<211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 944
tttaaatttt aaaatttaaa ata 23 <210> SEQ ID NO 945 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 945 ttggtttttt tggttttttt
ttgg 24 <210> SEQ ID NO 946 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 946
tttccctttt ccccttttcc cctc 24 <210> SEQ ID NO 947 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: (21)...(21) <223> OTHER INFORMATION: s
is g or c <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 947 ggggtcatcg atgagggggg
s 21 <210> SEQ ID NO 948 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 948 tccatgacgt tcctgacgtt 20 <210> SEQ
ID NO 949 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 949
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 950 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 950 tccatgacgt tcctgacgtt
20 <210> SEQ ID NO 951 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 951 tccatgacgt tcctgacgtt 20 <210> SEQ
ID NO 952 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 952
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 953 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 953 tccatgacgt tcctgacgtt
20 <210> SEQ ID NO 954 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 954 tccatgacgt tcctgacgtt 20 <210> SEQ
ID NO 955 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 955
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 956 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 956 tccatgacgt tcctgacgtt
20 <210> SEQ ID NO 957 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 957 tccatgacgt tcctgacgtt 20 <210> SEQ
ID NO 958 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 958
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 959 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 959 gggggacgat cgtcggggg
19 <210> SEQ ID NO 960 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 960 gggggtcgta cgacgggggg 20 <210> SEQ
ID NO 961 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 961
tttttttttt tttttttttt tttt 24 <210> SEQ ID NO 962 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 962 aaaaaaaaaa aaaaaaaaaa
aaaa 24 <210> SEQ ID NO 963 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 963 cccccccccc cccccccccc cccc 24
<210> SEQ ID NO 964 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 964 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
965 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 965
tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO 966 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 966 tcgtcgtttt gtcgttttgt
cgtt 24 <210> SEQ ID NO 967 <211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 967 tcgtcgtttt gtcgttttgt cgtt 24 <210> SEQ ID NO
968 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 968
ggggtcaacg ttgagggggg 20 <210> SEQ ID NO 969 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 969 ggggtcaacg ttgagggggg
20 <210> SEQ ID NO 970 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 970 ggggtcaagc ttgagggggg 20 <210> SEQ
ID NO 971 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 971
tgctgcttcc cccccccccc 20 <210> SEQ ID NO 972 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 972 ggggacgtcg acgtgggggg
20 <210> SEQ ID NO 973 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 973 ggggtcgtcg acgagggggg 20 <210> SEQ
ID NO 974 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 974
ggggtcgacg tacgtcgagg gggg 24 <210> SEQ ID NO 975 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 975 ggggaccggt accggtgggg
gg 22 <210> SEQ ID NO 976 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 976 gggtcgacgt cgagggggg 19 <210> SEQ
ID NO 977 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 977
ggggtcgacg tcgaggggg 19 <210> SEQ ID NO 978 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 978 ggggaacgtt aacgttgggg
gg 22 <210> SEQ ID NO 979 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 979 ggggtcaccg gtgagggggg 20 <210> SEQ
ID NO 980 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 980
ggggtcgttc gaacgagggg gg 22 <210> SEQ ID NO 981 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 981 ggggacgttc gaacgtgggg
gg 22 <210> SEQ ID NO 982 <211> LENGTH: 10 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 982 tcaactttga 10 <210> SEQ ID NO 983
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 983
tcaagcttga 10 <210> SEQ ID NO 984 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 984 tcacgatcgt ga 12 <210> SEQ
ID NO 985 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 985
tcagcatgct ga 12 <210> SEQ ID NO 986 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 986 gggggagcat gctggggggg 20
<210> SEQ ID NO 987 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 987 gggggggggg gggggggggg 20 <210> SEQ ID NO 988
<211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 988 gggggacgat atcgtcgggg gg 22
<210> SEQ ID NO 989 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 989 gggggacgac gtcgtcgggg gg 22 <210> SEQ ID NO 990
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 990
gggggacgag ctcgtcgggg gg 22 <210> SEQ ID NO 991 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 991 gggggacgta cgtcgggggg
20 <210> SEQ ID NO 992 <211> LENGTH: 8 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 992 tcaacgtt 8 <210> SEQ ID NO 993
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 993
tccataccgg tcctgatgct 20 <210> SEQ ID NO 994 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 994 tccataccgg tcctaccggt
20 <210> SEQ ID NO 995 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 995 gggggacgat cgttgggggg 20 <210> SEQ
ID NO 996 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 996
ggggaacgat cgtcgggggg 20 <210> SEQ ID NO 997 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 997 ggggggacga tcgtcggggg
g 21 <210> SEQ ID NO 998 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 998 gggggacgat cgtcgggggg g 21 <210>
SEQ ID NO 999 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 999 aaagacgtta aa 12 <210> SEQ ID NO 1000
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1000
aaagagctta aa 12 <210> SEQ ID NO 1001 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: modified_base
<222> LOCATION: (6)...(6) <223> OTHER INFORMATION: m5c
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1001 aaagangtta aa 12 <210>
SEQ ID NO 1002 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1002 aaattcggaa aa 12 <210> SEQ ID NO 1003
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1003
gggggtcatc gatgaggggg g 21 <210> SEQ ID NO 1004 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1004 gggggtcaac gttgaggggg
g 21 <210> SEQ ID NO 1005 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1005 atgtagctta ataacaaagc 20 <210> SEQ
ID NO 1006 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1006
ggatcccttg agttacttct 20 <210> SEQ ID NO 1007 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1007 ccattccact tctgattacc
20 <210> SEQ ID NO 1008 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1008
tatgtattat catgtagata 20 <210> SEQ ID NO 1009 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1009 agcctacgta ttcaccctcc
20 <210> SEQ ID NO 1010 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1010 ttcctgcaac tactattgta 20 <210> SEQ
ID NO 1011 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1011
atagaaggcc ctacaccagt 20 <210> SEQ ID NO 1012 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1012 ttacaccggt ctatggaggt
20 <210> SEQ ID NO 1013 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1013 ctaaccagat caagtctagg 20 <210> SEQ
ID NO 1014 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1014
cctagacttg atctggttag 20 <210> SEQ ID NO 1015 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1015 tataagcctc gtccgacatg
20 <210> SEQ ID NO 1016 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1016 catgtcggac gaggcttata 20 <210> SEQ
ID NO 1017 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1017
tggtggtggg gagtaagctc 20 <210> SEQ ID NO 1018 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1018 gagctactcc cccaccacca
20 <210> SEQ ID NO 1019 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1019 gccttcgatc ttcgttggga 20 <210> SEQ
ID NO 1020 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1020
tggacttctc tttgccgtct 20 <210> SEQ ID NO 1021 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1021 atgctgtagc ccagcgataa
20 <210> SEQ ID NO 1022 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1022 accgaatcag cggaaagtga 20 <210> SEQ
ID NO 1023 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1023
tccatgacgt tcctgacgtt 20 <210> SEQ ID NO 1024 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1024 ggagaaaccc atgagctcat
ctgg 24 <210> SEQ ID NO 1025 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1025 accacagacc agcaggcaga 20
<210> SEQ ID NO 1026 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1026 gagcgtgaac tgcgcgaaga 20 <210> SEQ ID NO 1027
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1027
tcggtaccct tgcagcggtt 20 <210> SEQ ID NO 1028 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1028 ctggagccct agccaaggat
20 <210> SEQ ID NO 1029 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1029
gcgactccat caccagcgat 20 <210> SEQ ID NO 1030 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1030 cctgaagtaa gaaccagatg
t 21 <210> SEQ ID NO 1031 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1031 ctgtgttatc tgacatacac c 21 <210>
SEQ ID NO 1032 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1032 aattagcctt aggtgattgg g 21 <210> SEQ ID NO
1033 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1033
acatctggtt cttacttcag g 21 <210> SEQ ID NO 1034 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1034 ataagtcata ttttgggaac
tac 23 <210> SEQ ID NO 1035 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1035 cccaatcacc taaggctaat t 21
<210> SEQ ID NO 1036 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1036 ggggtcgtcg acgagggggg 20 <210> SEQ ID NO 1037
<211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1037
ggggtcgttc gaacgagggg gg 22 <210> SEQ ID NO 1038 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1038 ggggacgttc gaacgtgggg
gg 22 <210> SEQ ID NO 1039 <211> LENGTH: 15 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: modified_base <222> LOCATION:
(9)...(9) <223> OTHER INFORMATION: n is 5-methylcytosine.
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1039 tcctggcgng gaagt 15 <210>
SEQ ID NO 1040 <211> LENGTH: 22 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1040 ggggaacgac gtcgttgggg gg 22 <210> SEQ ID NO
1041 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1041
ggggaacgta cgtcgggggg 20 <210> SEQ ID NO 1042 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1042 ggggaacgta cgtacgttgg
gggg 24 <210> SEQ ID NO 1043 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1043 ggggtcaccg gtgagggggg 20
<210> SEQ ID NO 1044 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1044 ggggtcgacg tacgtcgagg gggg 24 <210> SEQ ID NO
1045 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1045
ggggaccggt accggtgggg gg 22 <210> SEQ ID NO 1046 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1046 gggtcgacgt cgagggggg
19 <210> SEQ ID NO 1047 <211> LENGTH: 18 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1047 ggggtcgacg tcgagggg 18 <210> SEQ
ID NO 1048 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1048
ggggaacgtt aacgttgggg gg 22 <210> SEQ ID NO 1049 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1049 ggggacgtcg acgtggggg
19 <210> SEQ ID NO 1050 <211> LENGTH: 34 <212>
TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1050 gcactcttcg aagctacagc cggcagcctc tgat 34 <210>
SEQ ID NO 1051 <211> LENGTH: 32 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1051 cggctcttcc atgaggtctt tgctaatctt gg 32 <210>
SEQ ID NO 1052 <211> LENGTH: 35 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1052 cggctcttcc atgaaagtct ttggacgatg tgagc 35
<210> SEQ ID NO 1053 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1053 tcctgcaggt taagt 15 <210> SEQ ID NO 1054
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1054
gggggtcgtt cgttgggggg 20 <210> SEQ ID NO 1055 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1055 gggggatgat tgttgggggg
20 <210> SEQ ID NO 1056 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: modified_base <222> LOCATION:
(7)...(7) <223> OTHER INFORMATION: m5c <221> NAME/KEY:
modified_base <222> LOCATION: (11)...(11) <223> OTHER
INFORMATION: m5c <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1056
gggggangat ngttgggggg 20 <210> SEQ ID NO 1057 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1057 gggggagcta gcttgggggg
20 <210> SEQ ID NO 1058 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1058 ggttcttttg gtccttgtct 20 <210> SEQ
ID NO 1059 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1059
ggttcttttg gtcctcgtct 20 <210> SEQ ID NO 1060 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1060 ggttcttttg gtccttatct
20 <210> SEQ ID NO 1061 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1061 ggttcttggt ttccttgtct 20 <210> SEQ
ID NO 1062 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1062
tggtcttttg gtccttgtct 20 <210> SEQ ID NO 1063 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1063 ggttcaaatg gtccttgtct
20 <210> SEQ ID NO 1064 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1064 gggtcttttg ggccttgtct 20 <210> SEQ
ID NO 1065 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1065
tccaggactt ctctcaggtt tttt 24 <210> SEQ ID NO 1066
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1066
tccaaaactt ctctcaaatt 20 <210> SEQ ID NO 1067 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1067 tactactttt atacttttat
actt 24 <210> SEQ ID NO 1068 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1068 tgtgtgtgtg tgtgtgtgtg tgtg 24
<210> SEQ ID NO 1069 <211> LENGTH: 25 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1069 ttgttgttgt tgtttgttgt tgttg 25 <210> SEQ ID NO
1070 <211> LENGTH: 27 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1070 ggctccgggg agggaatttt tgtctat 27
<210> SEQ ID NO 1071 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1071 gggacgatcg tcggggggg 19 <210> SEQ ID NO 1072
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1072
gggtcgtcga cgaggggggg 20 <210> SEQ ID NO 1073 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1073 ggtcgtcgac gaggggggg
19 <210> SEQ ID NO 1074 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1074 gggtcgtcgt cgtggggggg 20 <210> SEQ
ID NO 1075 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1075
ggggacgatc gtcggggggg 20 <210> SEQ ID NO 1076 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1076 ggggacgtcg tcgtgggggg
20 <210> SEQ ID NO 1077 <211> LENGTH: 27 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1077 ggggtcgacg tcgacgtcga ggggggg 27
<210> SEQ ID NO 1078 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1078 ggggaaccgc ggttgggggg g 21 <210> SEQ ID NO
1079 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1079
ggggacgacg tcgtgggggg g 21 <210> SEQ ID NO 1080 <211>
LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1080 tcgtcgtcgt cgtcgtgggg
ggg 23 <210> SEQ ID NO 1081 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1081 tcctgccggg gaagt 15 <210>
SEQ ID NO 1082 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1082 tcctgcaggg gaagt 15 <210> SEQ ID NO 1083
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1083
tcctgaaggg gaagt 15 <210> SEQ ID NO 1084 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1084 tcctggcggg caagt 15 <210>
SEQ ID NO 1085 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1085 tcctggcggg taagt 15 <210> SEQ ID NO 1086
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1086
tcctggcggg aaagt 15 <210> SEQ ID NO 1087 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1087 tccgggcggg gaagt 15 <210>
SEQ ID NO 1088 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1088 tcggggcggg gaagt 15 <210> SEQ ID NO 1089
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1089
tcccggcggg gaagt 15 <210> SEQ ID NO 1090 <211> LENGTH:
15 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1090 gggggacgtt ggggg 15 <210>
SEQ ID NO 1091 <211> LENGTH: 20 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1091 ggggtttttt ttttgggggg 20 <210> SEQ
ID NO 1092 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1092
ggggcccccc ccccgggggg 20 <210> SEQ ID NO 1093 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1093 ggggttgttg ttgttggggg
g 21 <210> SEQ ID NO 1094 <211> LENGTH: 30 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Sequence
<400> SEQUENCE: 1094 tttttttttt tttttttttt tttttttttt 30
<210> SEQ ID NO 1095 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1095 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 30 <210> SEQ
ID NO 1096 <211> LENGTH: 30 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1096
cccccccccc cccccccccc cccccccccc 30 <210> SEQ ID NO 1097
<211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1097
cgcgcgcgcg cgcgcgcgcg cgcgcgcgcg 30 <210> SEQ ID NO 1098
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1098
gattttatcg tc 12 <210> SEQ ID NO 1099 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1099 tcgatttttc ga 12 <210>
SEQ ID NO 1100 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1100 tcatttttat ga 12 <210> SEQ ID NO 1101
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1101
gttttttacg ac 12 <210> SEQ ID NO 1102 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1102 tcaatttttt ga 12 <210>
SEQ ID NO 1103 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1103 acgtttttac gt 12 <210> SEQ ID NO 1104
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1104
tcgtttttac ga 12 <210> SEQ ID NO 1105 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1105 tcgattttta cgtcga 16
<210> SEQ ID NO 1106 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1106 aattttttaa cgtt 14 <210> SEQ ID NO 1107
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1107
tcgtttttta acga 14 <210> SEQ ID NO 1108 <211> LENGTH:
14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1108 acgtttttta acgt 14 <210>
SEQ ID NO 1109 <211> LENGTH: 13 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1109 gatttttatc gtc 13 <210> SEQ ID NO 1110
<211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1110
gacgattttt cgtc 14 <210> SEQ ID NO 1111 <211> LENGTH:
14 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1111 gattttagct cgtc 14 <210>
SEQ ID NO 1112 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1112 gatttttacg tc 12 <210> SEQ ID NO 1113
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1113
attttatcgt 10 <210> SEQ ID NO 1114 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1114 aacgattttt cgtt 14 <210>
SEQ ID NO 1115 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1115 tcacttttgt ga 12 <210> SEQ ID NO 1116
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1116
tcgtatttta 10 <210> SEQ ID NO 1117 <211> LENGTH: 14
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1117 acttttgtac cggt 14 <210>
SEQ ID NO 1118 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1118 tcgatttttc gacgtcga 18 <210> SEQ ID NO 1119
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1119
acgatttttc gt 12 <210> SEQ ID NO 1120 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1120 gatgatcgtc 10 <210> SEQ
ID NO 1121 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1121
tcgatgtcga 10 <210> SEQ ID NO 1122 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1122 tcatgtatga 10 <210> SEQ
ID NO 1123 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1123
gtgttacgac 10 <210> SEQ ID NO 1124 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1124 tcaatgttga 10 <210> SEQ
ID NO 1125 <211> LENGTH: 10 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1125
acgtgtacgt 10 <210> SEQ ID NO 1126 <211> LENGTH: 10
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1126 tcgtgtacga 10 <210> SEQ
ID NO 1127 <211> LENGTH: 14 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1127
tcgatgtacg tcga 14 <210> SEQ ID NO 1128 <211> LENGTH:
12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1128 aatgttaacg tt 12 <210>
SEQ ID NO 1129 <211> LENGTH: 12 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1129 tcgtgttaac ga 12 <210> SEQ ID NO 1130
<211> LENGTH: 12 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1130
acgtgttaac gt 12 <210> SEQ ID NO 1131 <211> LENGTH: 11
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1131 gatgtatcgt c 11 <210> SEQ
ID NO 1132 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1132
gacgatgtcg tc 12 <210> SEQ ID NO 1133 <211> LENGTH: 12
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1133 gatgagctcg tc 12 <210>
SEQ ID NO 1134 <211> LENGTH: 10 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1134 gatgtacgtc 10 <210> SEQ ID NO 1135 <211>
LENGTH: 8 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1135 atgatcgt 8
<210> SEQ ID NO 1136 <211> LENGTH: 12 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1136 aacgatgtcg tt 12 <210> SEQ ID NO 1137
<211> LENGTH: 10 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Sequence <400> SEQUENCE: 1137
tcactggtga 10 <210> SEQ ID NO 1138 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1138 tcgtatga 8 <210> SEQ ID
NO 1139 <211> LENGTH: 12 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1139
actggtaccg gt 12 <210> SEQ ID NO 1140 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1140 tcgatgtcga cgtcga 16
<210> SEQ ID NO 1141 <211> LENGTH: 10 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Sequence <400>
SEQUENCE: 1141 acgatgtcgt 10 <210> SEQ ID NO 1142 <211>
LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Sequence <400> SEQUENCE: 1142 tgcaggaagt ccgggttttc
cccaaccccc c 31 <210> SEQ ID NO 1143 <211> LENGTH: 6
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1143 gacgtt 6 <210> SEQ ID NO
1144 <211> LENGTH: 6 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Sequence <400> SEQUENCE: 1144
gtcgtt 6 <210> SEQ ID NO 1145 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Sequence <400> SEQUENCE: 1145 tcgtcgtt 8
* * * * *