U.S. patent application number 11/503377 was filed with the patent office on 2007-03-22 for immunostimulatory nucleic acid molecules for activating dendritic cells.
This patent application is currently assigned to University of Iowa Research Foundation. Invention is credited to Gunther Hartmann, Arthur M. Krieg.
Application Number | 20070065467 11/503377 |
Document ID | / |
Family ID | 27539249 |
Filed Date | 2007-03-22 |
United States Patent
Application |
20070065467 |
Kind Code |
A1 |
Krieg; Arthur M. ; et
al. |
March 22, 2007 |
Immunostimulatory nucleic acid molecules for activating dendritic
cells
Abstract
The present invention relates generally to methods and products
for activating dendritic cells. In particular, the invention
relates to oligonucleotides which have a specific sequence
including at least one unmethylated CpG dinucleotide which are
useful for activating dendritic cells. The methods are useful for
in vitro, ex-vivo, and in vivo methods such as cancer
immunotherapeutics, treatment of infectious disease and treatment
of allergic disease.
Inventors: |
Krieg; Arthur M.;
(Wellesley, MA) ; Hartmann; Gunther; (Alfter,
DE) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2206
US
|
Assignee: |
University of Iowa Research
Foundation
Iowa City
IA
|
Family ID: |
27539249 |
Appl. No.: |
11/503377 |
Filed: |
August 11, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10161229 |
Jun 3, 2002 |
|
|
|
11503377 |
Aug 11, 2006 |
|
|
|
09191170 |
Nov 13, 1998 |
6429199 |
|
|
10161229 |
Jun 3, 2002 |
|
|
|
08960774 |
Oct 30, 1997 |
6239116 |
|
|
09191170 |
Nov 13, 1998 |
|
|
|
08738652 |
Oct 30, 1996 |
6207646 |
|
|
08960774 |
Oct 30, 1997 |
|
|
|
08386063 |
Feb 7, 1995 |
6194388 |
|
|
08738652 |
Oct 30, 1996 |
|
|
|
08276358 |
Jul 15, 1994 |
|
|
|
08386063 |
Feb 7, 1995 |
|
|
|
Current U.S.
Class: |
424/275.1 ;
424/277.1; 435/372; 435/455 |
Current CPC
Class: |
A61K 2039/55561
20130101; C12Q 1/68 20130101; A61K 39/39 20130101; A61K 31/7125
20130101; A61P 37/04 20180101; C07H 21/00 20130101; A61K 31/711
20130101; A61K 2039/5158 20130101; A61K 2039/5156 20130101; A61K
31/7048 20130101; C12N 2501/056 20130101; C12N 5/0639 20130101;
A61K 31/00 20130101; A61K 31/4706 20130101 |
Class at
Publication: |
424/275.1 ;
435/455; 435/372; 424/277.1 |
International
Class: |
A61K 39/35 20060101
A61K039/35; A61K 39/00 20060101 A61K039/00; C12N 5/08 20060101
C12N005/08; C12N 15/09 20060101 C12N015/09 |
Claims
1.-39. (canceled)
40. A method of treating a tumor in a human or vertebrate animal
subject, comprising administering to the subject a nucleic acid
delivery complex, said complex comprising a cationic lipid
associated with an immunostimulatory nucleic acid 8-80 bases in
length comprising at least one unmethylated CpG dinucleotide, in an
amount effective to treat the tumor, wherein the administering is
in a local region of the tumor.
41. A method of treating a tumor in a human or vertebrate animal
subject, comprising administering to the subject a nucleic acid
delivery complex, said complex comprising a cationic lipid
associated with an immunostimulatory nucleic acid 8-80 bases in
length comprising at least one unmethylated CpG dinucleotide, in an
amount effective to treat the tumor, wherein the administering is
aerosol administration.
42. A method of boosting a subject's immune response to a vaccine,
wherein the vaccine comprises a cancer antigen, comprising
administering to a subject said vaccine and an adjuvant, wherein
said adjuvant comprises a cationic lipid associated with an
immunostimulatory nucleic acid 8-80 bases in length comprising at
least one unmethylated CpG dinucleotide.
43. A composition for treating a tumor in a human or vertebrate
animal subject, consisting essentially of a cationic lipid in
association with an immunostimulatory nucleic acid 8-80 bases in
length comprising at least one unmethylated cytosine-guanine (CpG)
dinucleotide, and optionally, a conventional adjuvant.
44. A method of generating an anti-tumor cell immune response in a
tumor-bearing mammal comprising the step of administering to said
mammal a composition comprising a complex, said complex comprising:
a cationic lipid and an immunologically active nucleic acid
sequence without an expressible cDNA insert, wherein said
composition is administered in an amount effective to stimulate an
immune response against said tumor.
45. A method according to claim 44, wherein said immunologically
active nucleic acid sequence is a bacterially derived plasmid.
46. A method according to claim 45, wherein said bacterially
derived plasmid comprises CpG rich motifs.
47. A method according to claim 44, wherein said step of
administering is accomplished by intra-tumoral administration or
administration into a body cavity compartment containing a
tumor.
48. A method according to claim 44, wherein said step of
administering is chosen from aerosolization, intravenous injection,
intraperitoneal, intranasal, topical, and transmucosal
administration.
49. A method according to claim 44, wherein said anti-tumor cell
response is a systemic response.
50. A method of generating a protective anti-tumor cell immune
response in a tumor-bearing mammal comprising the step of
administering to said mammal a composition comprising a complex,
wherein said complex comprises a cationic lipid and an
immunologically active nucleic acid sequence that does not encode
for an expressible tumor associated antigen, wherein said complex
is administered in an amount effective to stimulate an immune
response against said tumor.
51. A method according to claim 50, wherein said immunologically
active nucleic acid sequence is not capable of transcription or
translation of a biologically active peptide in said mammal.
52. A method according to claim 50, wherein said immunologically
active nucleic acid sequence is bacterially derived.
53. A method according to claim 50, wherein said immunologically
active nucleic acid sequence is a plasmid.
54. A method according to claim 50, wherein said immunologically
active nucleic acid sequence comprises genomic bacterial DNA.
55. A method according to claim 50, wherein said immunologically
active nucleic acid sequence is a fragment.
56. A method according to claim 50, wherein said immunologically
active nucleic acid sequence comprises CpG rich motifs.
57. A method according to claim 50, wherein said step of
administering is accomplished by intra-tumoral administration or
administration into a body cavity compartment containing a
tumor.
58. A method according to claim 50, wherein said step of
administering is chosen from aerosolization, intravenous
injections, intraperitoneal, intranasal, topical, and transmucosal
administration.
59. A method according to claim 50, wherein said protective
anti-tumor cell immune response is a systemic response.
60. A method of increasing the efficacy of a tumor antigen
comprising the administration of said tumor antigen and an
adjuvant, wherein said adjuvant comprises a cationic
molecule:immunologically active nucleic acid sequence complex
wherein said immunologically active nucleic acid sequence is
without an expressible cDNA insert.
61. A composition for generating a protective anti-tumor cell
immune response in a tumor-bearing mammal consisting essentially
of: a cationic lipid; and a immunologically active nucleic acid
sequence without an expressible cDNA insert, and optionally, an
adjuvant.
62. A method according to claim 50, wherein said nucleic acid
sequence is selected from the group comprising plasmid DNA, genomic
DNA, messenger RNA, and ribosomal RNA.
63. A method according to claim 50, wherein said immune response
comprises immune memory against the tumor.
64. A method according to claim 63, wherein said immune response
comprises an adaptive immune response against the tumor.
65. A method according to claim 50, wherein said immune response
reduces tumor burden distal to the treatment site.
66. A method according to claim 50, wherein said immune response
comprises an immune response selected from one of the following
responses: an inflammatory response, a humoral response, a cellular
response, a Th1 type response, or a Th2 type response.
67. A method according to claim 66, wherein said immune response
reduces tumor burden distal to the treatment site.
68. A method according to claim 50, wherein said immune response
prolongs the survival of a tumor-bearing mammal.
69. A method according to claim 66, wherein said immune response
prolongs the survival of a tumor-bearing mammal.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of co-pending U.S. Ser. No.
09/191,170, filed on Nov. 13, 1998, now allowed which is a
continuation-in-part of U.S. Ser. No. 08/960,774, filed Oct. 30,
1997, now issued as U.S. Pat. No. 6,239,116B1 on May 29, 2001,
which is a continuation-in-part of U.S. Ser. No. 08/738,652, filed
Oct. 30, 1996 and which is now issued as U.S. Pat. No. 6,207,646B1
on Mar. 27, 2001, and which patent is a continuation-in-part of
U.S. Ser. No. 08/386,063, filed Feb. 7, 1995 and which is now
issued as U.S. Pat. No. 6,194,388B1 on Feb. 27, 2001, and which
patent is a continuation-in-part of U.S. Ser. No. 08/276,358, filed
Jul. 15, 1994 and which is abandoned, each of which are
incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to methods and
products for activating dendritic cells. In particular, the
invention relates to oligonucleotides which have a specific
sequence including at least one unmethylated CpG dinucleotide which
are useful for activating dendritic cells.
BACKGROUND OF THE INVENTION
[0003] In the 1970s, several investigators reported the binding of
high molecular weight DNA to cell membranes (Lerner, R. A., et al.,
1971, Proc. Natl. Acad. Sci. USA, 68:1212; Aggarwal, S. K., et al.,
1975, Proc. Natl. Acad. Sci. USA, 72:928). In 1985, Bennett et al.
presented the first evidence that DNA binding to lymphocytes is
similar to a ligand receptor interaction; binding is saturable,
competitive, and leads to DNA endocytosis and degradation into
oligonucleotides (Bennett, R. M., et al., J. Clin. Invest.,
76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to
enter cells in a saturable, sequence independent, and temperature
and energy dependent fashion (reviewed in Jaroszewski, J. W., et
al. and J. S. Cohen, 1991, Advanced Drug Delivery Reviews, 6:235;
Akhtar, et al., 1992, in: "Gene Regulation: Biology of Antisense
RNA and DNA," R. P. Erickson, Eds, Raven Press, Ltd., New York, p.
133; and Zhao, et al., 1994, Blood, 84:3660). No receptor for DNA
or ODN uptake has yet been cloned, and it is not yet clear whether
ODN binding and cell uptake occurs through the same or a different
mechanism from that of high molecular weight DNA.
[0004] Lymphocyte ODN uptake has been shown to be regulated by cell
activation. Spleen cells stimulated with the B cell mitogen (LPS)
had dramatically enhanced ODN uptake in the B cell population,
while spleen cells treated with the T cell mitogen ConA showed
enhanced ODN uptake by T but not B cells (Krieg, A. M., et al.,
1991, Antisense Research and Development, 1: 161).
[0005] Several polynucleotides have been extensively evaluated as
biological response modifiers. Perhaps the best example is poly(IC)
which is a potent inducer of interferon (IFN) production as well as
a macrophage activator and inducer of NK activity (Talmadge, J. E.,
et al., 1985, Cancer Res., 45:1058; Wiltrout, et al., 1985, J.
Biol. Resp. Mod., 4:512; Krown, S. E., 1986, Sem. Oncol., 13:207;
and Ewel, C. H., et al., 1992, Canc. Res., 52:3005). It appears
that this murine NK activation may be due solely to induction of
IFN-.beta. secretion (Ishikawa, R., and C. A. Biron, 1993, J.
Immunol., 150:3713). This activation was specific for the ribose
sugar since deoxyribose was ineffective. Its potent in vitro
anti-tumor activity led to several clinical trials using poly(IC)
complexed with poly-L-lysine and carboxymethylcellulose (to reduce
degradation by RNAse) (Talmadge, et al., cited supra; Wiltrout, et
al., cited supra; Krown, et al., cited supra, and Ewel, et al.,
cited supra). Unfortunately, toxic side effects has thus far
prevented poly(IC) from becoming a useful therapeutic agent.
[0006] Guanine ribonucleotides substituted at the C8 position with
either a bromine or a thiol group are B cell mitogens and may
replace "B cell differentiation factors" (Feldbush, T. L., and Z.
K. Ballas, 1985, J. Immunol., 134:3204; and Goodman, M. J., 1986,
J. Immunol., 136:3335). 8-mercaptoguanosine and 8-bromoguanosine
also can substitute for the cytokine requirement for the generation
of MHC restricted CTL (Feldbush, T. L., cited supra), augment
murine NK activity (Koo, G. C., et al., 1988, J. Immunol.,
140:3249) and synergize with IL-2 in inducing murine LAK generation
(Thompson, R. A., and Z. K. Ballas, 1990, J. Immunol., 145:3524).
The NK and LAK augmenting activities of these C8-substituted
guanosines appear to be due to their induction of IFN (Thompson,
cited supra). Recently a 5' triphosphorylated thymidine produced by
a mycobacterium was found to be mitogenic for a subset of human
.gamma..delta. T cells (Constant, P., et al., 1994, Science,
264:267). This report indicated the possibility that the immune
system may have evolved ways to preferentially respond to microbial
nucleic acids.
[0007] Several observations suggest that certain DNA structures may
also have the potential to activate lymphocytes. For example, Bell,
et al. reported that nucleosomal protein-DNA complexes (but not
naked DNA) in spleen cell supernatants caused B cell proliferation
and immunoglobulin secretion (Bell, D. A., et al., 1990, J. Clin.
Invest., 85:1487). In other cases, naked DNA has been reported to
have immune effects. For example, Messina, et al. have recently
reported that 260-800 bp fragments of poly(dG)-(dC) and
poly(dG)(dC) were mitogenic for B cells (Messina, J. P., et al.,
1993, Cell. Immunol., 147:148). Tokunaga, et al. have reported that
poly(dG,dC) induces the .gamma.-IFN and NK activity (Tokunaga, et
al., 1988, Jpn. J. Cancer Res., 79:682). Aside from such artificial
homopolymer sequences, Pisetsky, et al. reported that pure
mammalian DNA has no detectable immune effects, but that DNA from
certain bacteria induces B cell activation and immunoglobulin
secretion (Messina, et al., 1991, J. Immunol., 147:1759). Assuming
that these data did not result from some unusual contaminant, these
studies suggested that a particular structure or other
characteristic of bacterial DNA renders it capable of triggering B
cell activation. Investigations of microbacterial DNA sequences
have demonstrated that ODN, which contains certain palindrome
sequences can activate NK cells (Yamamoto, et al., 1992, J.
Immunol., 148:4072; and Kuramoto, et al., 1992, Jpn. J. Cancer
Res., 83:1128).
[0008] Several phosphorothioate modified ODN have been reported to
induce in vitro or in vivo B cell stimulation (Tanaka, et al.,
1992, J. Exp. Med., 175:597; Branda, R. S., et al., 1993, Biochem.
Pharmacol., 45:2037; McIntyre, K., et al., 1993, Antisense Res.
Develop., 3:309; and Pisetsky, et al., 1994, Life Sciences,
54:101). These reports do not suggest a common structure motif or
sequence element in these ODN that might explain their effects.
[0009] Dendritic cells are considered to be the most potent
professional antigen-presenting cells (APC) (Guery, J. D., et al.,
1995, J. Immunol., 154:536). Dendritic cells capture antigen and
present them as peptide fragments to T cells, stimulating T cell
dependent immunity. These powerful APCs have been found in skin,
blood, dense tissue, and mucosa, and spleen. Several studies have
demonstrated that after human dendritic cells which are isolated
from peripheral blood are presented peptide antigen they can be
used to stimulate and expand antigen specific CD4+ and CD8+ T
cells, in vitro and ex vivo (Engleman, E. G., 1997, Cytotechnology,
25:1). Several clinical trials are currently underway, based on
these findings, using ex vivo manipulation of dendritic cells to
generate specific anti-tumor dendritic cells for reimplantation.
There has been a growing interest in using dendritic cells ex vivo
as tumor or infectious disease vaccine adjuvants (Nestle F O, et
al., "Vaccination of melanoma patients with peptide- or tumor
lysate-pulsed dendritic cells", Nat Med, 1998; 4: 328-332;
Rosenberg S A, et al., "Immunologic and therapeutic evaluation of a
synthetic peptide vaccine for the treatment of patients with
metastatic melanoma", Nat Med, 1998; 4:321-327; Hsu F J, et al.,
"Vaccination of patients with B-cell lymphoma using autologous
antigen-pulsed dendritic cells", Nat Med, 1996; 2: 52-58; Tjoa B A,
et al., "Evaluation of phase I/II clinical trials in prostate
cancer with dendritic cells and PSMA peptides", Prostate, 1998; 36:
39-44. Numerous animal models demonstrate conclusively that ex vivo
generated DC pulsed with protein antigen can be successfully
applied for the immunotherapy of cancer and infectious diseases.
(Fields R C, et al., "Murine dendritic cells pulsed with whole
tumor lysates mediate potent antitumor immune responses in vitro
and in vivo", Proc Natl Acad Sci, USA, 1998; 95: 9482-9487; Okada
H, et al., "Bone marrow-derived dendritic cells pulsed with a
tumor-specific peptide elicit effective anti-tumor immunity against
intracranial neoplasms", Int J Cancer, 1998; 78: 196-201; Su H, et
al., "Vaccination against chlamydial genital tract infection after
immunization with dendritic cells pulsed ex vivo with nonviable
Chlamydiae", J Exp Med, 1998; 188: 809-818; DeMatos P., et al.,
"Pulsing of dendritic cells with cell lysates from either B16
melanoma or MCA-106 fibrosarcoma yields equally effective vaccines
against B16 tumors in mice", J Surg Oncol, 1998; 68: 79-91; "Yang
S, et al., "Immunotherapeutic potential of tumor antigen-pulsed and
unpulsed dendritic cells generated from murine bone marrow", Cell
Immunol, 1997; 179: 84-95; Nair S K, et al., "Regression of tumors
in mice vaccinated with professional antigen-presenting cells
pulsed with tumor extracts", Int J Cancer, 1997; 70: 706-715.
SUMMARY OF THE INVENTION
[0010] As described in co-pending parent patent application U.S.
Ser. No. 08/960,774 the vertebrate immune system has the ability to
recognize the presence of bacterial DNA based on the recognition of
so-called CpG-motifs, unmethylated cytidine-guanosine dinucleotides
within specific patterns of flanking bases. According to these
disclosures CpG functions as an adjuvant and is as potent at
inducing B-cell and T-cell responses as the complete Freund's
adjuvant, but is preferable since CpG induces a higher Th1 response
and is less toxic. Alum, the adjuvant which is used routinely in
human vaccination, induces the less favorable Th2 response.
Compared to alum, CpG is a more effective adjuvant. The combination
of CpG and alum was found to produce a synergistic adjuvant
effect.
[0011] CpG oligonucleotides also show adjuvant effects towards
various immune cells. For instance, CpG enhances the efficacy of
monoclonal antibody therapy, thus functioning as an effective
immune adjuvant for antigen immunization in a B cell lymphoma
model. Cytotoxic T cell responses to protein antigen also are
induced by CpG. Furthermore, the presence of immunostimulatory DNA
sequences in plasmids was found to be necessary for effective
intradermal gene immunization.
[0012] It was discovered according to an aspect of the invention
that the adjuvant activity of CpG is based on the direct activation
of dendritic cells by CpG. Potent immunostimulatory CpG
oligonucleotides and control oligonucleotides were found to cause
dramatic changes in dendritic cells isolated from peripheral blood
by immunomagnetic cell sorting. CpG oligonucleotides provided
excellent Dendritic cell survival, differentiation, activation and
maturation, and were superior to the combination of GM-CSF and LPS.
In fact, the combination of CpG and GM-CSF produced unexpected
synergistic effects on the activation of dendritic cells. The
invention thus encompasses both CpG oligonucleotides and the
combination of CpG oligonucleotides and cytokines such as GM-CSF as
well as in vitro, ex vivo, and in vivo methods of activating
dendritic cells for various assays and immunotherapeutic
strategies.
[0013] In one aspect the invention is a method for activating a
dendritic cell. The method includes the steps of contacting a
dendritic cell with an isolated nucleic acid containing at least
one unmethylated CpG dinucleotide wherein the nucleic acid is from
about 8-80 bases in length in an amount effective to activate a
dendritic cell. In one embodiment the dendritic cell is an isolated
dendritic cell.
[0014] The isolated nucleic acid is one which contains at least one
unmethylated CpG dinucleotide and which is from about 8-80 bases in
length. In one embodiment the unmethylated CpG dinucleotide has a
formula: 5'N.sub.1X.sub.1CGX.sub.2N.sub.23' wherein at least one
nucleotide separates consecutive CpGs; X.sub.1 is adenine, guanine,
or thymine; X.sub.2 is cytosine, adenine, or thymine; N is any
nucleotide and N.sub.1+N.sub.2 is from about 0-25 nucleotides. In
another embodiment the unmethylated CpG dinucleotide has a formula:
5'NX.sub.1X.sub.2CGX.sub.3X.sub.4N3' wherein at least one
nucleotide separates consecutive CpGs; X.sub.1X.sub.2 is selected
from the group consisting of TpT, CpT, TpC, and ApT; X.sub.3X.sub.4
is selected from the group consisting of GpT, GpA, ApA and ApT; N
is any nucleotide and N.sub.1+N.sub.2 is from about 0-25
nucleotides. In a preferred embodiment N.sub.1 and N.sub.2 of the
nucleic acid do not contain a CCGG quadmer or more than one CCG or
CGG trimer. In an illustrative embodiment the isolated nucleic acid
is selected from the group consisting of SEQ ID Nos. 20, 24, and
38-46. In another embodiment the isolated nucleic acid is SEQ ID
NO.: 84 or 85.
[0015] In yet another embodiment the nucleotide of the isolated
nucleic acid has a phosphate backbone modification, such as, for
example, a phosphorothioate or phosphorodithioate modification. In
one embodiment the phosphate backbone modification occurs at the 5'
end of the nucleic acid. Preferably the phosphate backbone
modification occurs at the first two internucleotide linkages of
the 5' end of the nucleic acid. According to another embodiment the
phosphate backbone modification occurs at the 3' end of the nucleic
acid. Preferably, the phosphate backbone modification occurs at the
last five internucleotide linkages of the 3' end of the nucleic
acid.
[0016] The method for activating the dendritic cell may be
performed in vitro, ex vivo, or in vivo. The method in some aspects
is a method for cancer immunotherapy, treating an infectious
disease, or treating an allergy. When these methods are performed
ex vivo they are performed by administering an activated dendritic
cell that expresses a specific cancer antigen, microbial antigen,
or allergen to a subject in need thereof, wherein the activated
dendritic cell is prepared by the methods described above. In a
preferred embodiment the isolated nucleic acid is administered to a
human subject.
[0017] In other embodiments the method includes the step of
contacting the dendritic cell with a cytokine selected from the
group consisting of GM-CSF, IL-4, TNF.alpha., INF-.gamma., IL-6,
Flt3 ligand, and IL-3. In yet other embodiments the method includes
the step of contacting the dendritic cell with an antigen prior to
the isolated nucleic acid.
[0018] The invention in another aspect is an isolated
antigen-expressing dendritic cell population produced by the
process of: exposing an isolated dendritic cell to an antigen;
contacting the isolated dendritic cell with an isolated nucleic
acid containing at least one unmethylated CpG dinucleotide wherein
the isolated nucleic acid is from about 8-80 bases in length; and
allowing the isolated dendritic cell to process and express the
antigen.
[0019] The isolated nucleic acid is one which contains at least one
unmethylated CpG dinucleotide and which is from about 8-80 bases in
length. In one embodiment the unmethylated CpG dinucleotide has a
formula: 5'N.sub.1X.sub.1CGX.sub.2N.sub.23' wherein at least one
nucleotide separates consecutive CpGs; X.sub.1 is adenine, guanine,
or thymine; X.sub.2 is cytosine, adenine, or thymine; N is any
nucleotide and N.sub.1+N.sub.2 is from about 0-25 nucleotides. In
another embodiment the unmethylated CpG dinucleotide has a formula:
5'NX.sub.1X.sub.2CGX.sub.3X.sub.4N3' wherein at least one
nucleotide separates consecutive CpGs; X.sub.1X.sub.2 is selected
from the group consisting of TpT, CpT, TpC, and ApT; X.sub.3X.sub.4
is selected from the group consisting of GpT, GpA, ApA and ApT; N
is any nucleotide and N.sub.1+N.sub.2 is from about 0-25
nucleotides. In a preferred embodiment N.sub.1 and N.sub.2 of the
nucleic acid do not contain a CCGG quadmer or more than one CCG or
CGG trimer. In an illustrative embodiment the isolated nucleic acid
is selected from the group consisting of SEQ ID Nos. 20, 24, and
38-46. In another embodiment the isolated nucleic acid is SEQ ID
NO.: 84 or 85.
[0020] In yet another embodiment the nucleotide of the isolated
nucleic acid has a phosphate backbone modification, such as, for
example, a phosphorothioate or phosphorodithioate modiciation. In
one embodiment the phosphate backbone modification occurs at the 5'
end of the nucleic acid. Preferably the phosphate backbone
modification occurs at the first two internucleotide linkages of
the 5' end of the nucleic acid. According to another embodiment the
phosphate backbone modification occurs at the 3' end of the nucleic
acid. Preferably, the phosphate backbone modification occurs at the
last five internucleotide linkages of the 3' end of the nucleic
acid.
[0021] According to another embodiment the isolated
antigen-expressing dendritic cell is prepared by contacting the
isolated dendritic cell with a cytokine selected from the group
consisting of GM-CSF, IL-4, TNF.alpha., INF-.gamma., IL-6, Flt3
ligand, and IL-3.
[0022] In yet another embodiment the isolated antigen-expressing
dendritic cell is prepared by contacting the isolated dendritic
cell with the antigen prior to the isolated nucleic acid.
[0023] The invention in another aspect is a composition, including
an effective amount for synergistically activating a dendritic cell
of an isolated nucleic acid containing at least one unmethylated
CpG dinucleotide wherein the nucleic acid is from about 8-80 bases
in length; and an effective amount for synergistically activating a
dendritic cell of a cytokine selected from the group consisting of
GM-CSF, IL-4, TNF.alpha., Flt3 ligand, and IL-3. In an illustrative
embodiment the cytokine is GM-CSF. In another embodiment the
composition also includes an antigen, such as, for example a cancer
antigen, a microbial antigen, or an allergen.
[0024] In another aspect the invention is a screening assay for
identifying compounds that are effective for preventing dendritic
cell maturation. The assay includes the following steps: contacting
an immature dendritic cell with an isolated nucleic acid containing
at least one unmethylated CpG dinucleotide wherein the nucleic acid
is from about 8-80 bases in length; exposing the dendritic cell to
a putative drug; and detecting the presence or absence of a
maturation marker on the dendritic cell, wherein the absence of the
maturation marker indicates that the putative drug is an effective
compound for preventing dendritic cell maturation. In one
illustrative embodiment the maturation marker is CD83.
[0025] The invention in another aspect is a method for generating a
high yield of dendritic cells. The method includes the following
steps administering an isolated nucleic acid containing at least
one unmethylated CpG dinucleotide wherein the nucleic acid is from
about 8-80 bases in length in an amount effective for activating
dendritic cells to a subject; allowing the isolated nucleic acid to
activate dendritic cells of the subject; and isolating dendritic
cells from the subject.
[0026] In another aspect the invention is a method for producing a
CD40 expressing dendritic cell. The method includes the following
steps: contacting a dendritic cell with an isolated nucleic acid
containing at least one unmethylated CpG dinucleotide wherein the
nucleic acid is from about 8-80 bases in length in an amount
effective to produce a CD40 expressing dendritic cell.
[0027] A method for causing maturation of a dendritic cell is
provided according to another aspect of the invention. The method
includes the step of contacting a dendritic cell with an isolated
nucleic acid containing at least one unmethylated CpG dinucleotide
wherein the nucleic acid is from about 8-80 bases in length in an
amount effective to cause maturation of the dendritic cell.
[0028] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 shows FACS chart depicting CpG oligonucleotide
promoted survival of dendritic precursor cells. Freshly isolated
dendritic precursor cells were incubated for 2 days in the presence
of either oligonucleotides or GMCSF (800 U/ml). Flow cytometric
analysis of morphology (forward scatter, FSC; sideward scatter,
SSC) showed that CpG oligonucleotides (2006: CpG phosphorothioate
oligonucleotide, 1.times.2 .mu.g/ml, 2080 CpG phosphodiester
oligonucleotide, 3.times.30 .mu.g/ml) promote survival of dendritic
precursor cells, while the non CpG controls (2117: 2006 with
methylated CpG; 2078: identical to 2080 but GpCs instead of CpGs)
showed no positive effect on cell survival compared to the sample
without oligonucleotides and GMCSF (no addition). Morphologically
(FSC and SSC), viable cells were found in region A, non-viable
cells in region B (regions drawn in lower left dot plot).
[0030] FIG. 2 is a graph showing that the combination of CpG and
GMCSF enhances viability of dendritic cells. Dendritic precursor
cells were isolated from peripheral blood and incubated for 48
hours with GMCSF (800 U/ml) and oligonucleotides (2006: CpG
phosphorothioate; 2117: CpGs in 2006 methylated; 2 .mu.g/ml) as
indicated. Viability was examined by flow cytometry. Data represent
the mean of two independent experiments.
[0031] FIG. 3 shows FACS charts demonstrating that an increase in
dendritic cell size is associated with enhanced MHC II expression.
Dendritic precursor cells are incubated for 48 hours in the
presence of GMCSF (800 U/ml) and oligonucleotides as indicated and
examined by flow cytometry (sideward scatter, SSC). Viable cells
(2500 per sample) were counted. Phosphodiester oligonucleotides
(2080: CpG; 2078: non-CpG) were added at 0 hours, 12 hours and 24
hours (30 .mu.g/ml each time point).
[0032] FIG. 4 shows FACS charts demonstrating that ICAM-1 and MHC
II expression of dendritic cells in response to GMCSF and CpG.
Dendritic precursor cells were incubated for 48 hours in the
presence of GMCSF (800 U/ml) and 2006 (CpG phosphorothioate; 6
.mu.g/ml). Expression of ICAM-1 (CD54) and MHC II was examined by
flow cytometry (2500 viable cells are counted in each sample).
[0033] FIG. 5 is graphs depicting induction of co-stimulatory
molecule expression on dendritic cells by CpG. Dendritic precursor
cells were incubated for 48 hours in the presence of GMCSF (800
U/ml) and oligonucleotides (2006: CpG phosphorothioate, 6 .mu.g/ml)
as indicated. Expression of CD54 (ICAM-1) (panel A), CD86 (B7-2)
(panel B) and CD40 (panel C) was quantified by flow cytometry (MFI,
mean fluorescence intensity). The combination of GMCSF and 2006
shows synergy for increasing the expression of CD86 and CD40, while
the effect on CD54 was additive. Results represent the mean of 5
independent experiments (CD54 and CD86) and 4 experiments (CD40).
Statistical significance of the increase compared to the cell only
sample is indicated by * (p<0.05). Statistical evaluation is
performed by the unpaired t-test, error bars indicate SEM.
[0034] FIG. 6 is graphs depicting the enhancement of CD40
expression on dendritic cells is CpG specific and not induced by
LPS. Dendritic precursor cells are cultured for 48 hours in the
presence of GMCSF (800 U/ml), LPS (10 ng/ml) and oligonucleotides
(2006, CpG phosphorothioate, 6 .mu.g/ml: 2117, methylated 2006;
2080 CpG phosphodiester, 30 .mu.g/ml at 0 hours, 12 hours and 24
hours; 2078 GpC version of 2080). CD40 expression is examined by
flow cytometry (MFI, mean fluorescence intensity). Panel A and
panel B show the results of two separate sets of experiments. Panel
A shows CpG specificity (methylated control oligonucleotide) for
the synergy of CpG and GMCSF for induction of CD40 expression.
Panel B shows that CpG is equally effective in enhancing CD40
expression as GMCSF, and that this effect is CpG specific (GpC
control oligonucleotide). Panel A and B represent the mean of two
independent experiments each.
[0035] FIG. 7 is graphs depicting the induction of CD54 and CD86
expression on dendritic cells is CpG specific and not induced by
LPS. Dendritic precursor cells are cultured for 48 hours in the
presence of GMCSF (800 U/ml), LPS (10 ng/ml) and oligonucleotides
(2006, CpG phosphorothioate, 2 .mu.g/ml: 2117, methylated 2006).
CD54 (panel A) and CD86 (panel B) expression is examined by flow
cytometry (MFI, mean fluorescence intensity). Panel A and B
represent the mean of two independent experiments (error bars
indicate SEM).
[0036] FIG. 8 shows FACS charts demonstrating that CD86 expression
on monocyte-derived Dendritic cells is induced by LPS but not by
CpG. CD14-positive monocytes were prepared from PBMC by
immunomagnetic separation and incubated in the presence of GMCSF
(800 U/ml) and IL-4 (500 U/ml, Genzyme, Cambridge, Mass.). After
five days (fresh medium and cytokines added every other day), cells
showed the characteristic surface marker pattern of
monocyte-derived dendritic cells (lineage marker negative, MHC II
bright, CD1a bright, CD40 intermediate, CD54 intermediate, CD80
dim, CD86 dim) and characteristic morphology. From day 5 to day 7,
LPS (1 ng/ml), TNF (1000 U/ml) or oligonucleotides in the indicated
concentrations were added. CD 86 expression is measured by flow
cytometry (numbers represent mean fluorescence intensity). In this
series of experiments, the non-CpG phosphorothioate control
oligonucleotide 2041 (5'-CTG GTC TTT CTG GTT TTT TTC TGG-3') (SEQ
ID No.:93) was used. The results are representative for 8
independent experiments, in which CpG did not stimulate
monocyte-derived dendritic cells.
[0037] FIG. 9 shows FACS charts demonstrating that CpG induces
maturation (CD83 expression) of dendritic cells. After 48 hours
incubation with GMCSF (800 U/ml), LPS (10 ng/ml) and
oligonucleotides (2006: CpG phosphorothioate; 2117 methylated 2006;
2 .mu.g/ml), CD83 and CD86 expression on dendritic cells is
determined in flow cytometry. Values (%) represent the percentage
of CD83 positive (mature) cells of all viable cells. Results are
representative for four independent experiments.
[0038] FIG. 10 are electron micrographs depicting CpG induction of
morphologic changes in dendritic cells. Dendritic cells were
incubated for 2 days in the presence of GMCSF (800 U/ml) and 2006
(2 .mu.g/ml) (panel A), with 2006 (2 .mu.g/ml) (panel B), with
GMCSF (800 U/ml) (panel C), and with the control oligonucleotide
2117 (2 .mu.g/ml) (panel D). Cells were fixed and processed for
scanning electron microscopy according to standard procedures.
[0039] FIG. 11 are electron micrographs depicting Ultrastructural
differences due to CpG. Dendritic cells were incubated for 2 days
in the presence of GM-CSF (800 U/ml) and 2006 (2 .mu.g/ml) (panel
A) or with GMCSF (800 U/ml) (panel B) and transmission electron
microscopy was performed. In the presence of CpG (panel A)
multilamellar bodies (>) and multivesicular structures can be
seen.
[0040] FIG. 12 are electron micrographs depicting High
magnification of CpG-characteristic ultrastructural differences.
Dendritic cells incubated with GMCSF (800 U/ml) and 2006 (2
.mu.g/ml) were examined by transmission electron microscopy. Arrows
point to characteristic multilamellar bodies (>) and to
multivesicular structures (>>).
DETAILED DESCRIPTION OF THE INVENTION
[0041] Dendritic cells form the link between the innate and the
acquired immune system by presenting antigens as well as through
their expression of pattern recognition receptors which detect
microbial molecules like LPS in their local environment. It has
been discovered according to the invention that CpG has the unique
capability to promote cell survival, differentiation, activation
and maturation of dendritic cells. In fact dendritic precursor
cells isolated from human blood by immunomagnetic cell sorting
develop morphologic and functional characteristics of dendritic
cells during a two day incubation with GM-CSF. Without GM-CSF these
cells undergo apoptosis. It was discovered according to the
invention that CpG was superior to GM-CSF in promoting survival and
differentiation of dendritic cells (MHC II expression, cell size,
granularity). As shown in the Examples below, the CpG
phosphorothioate oligonucleotide 2006 (2 .mu.g/ml) induced the
expression of ICAM-1 (CD54) by 3.6-fold (p=0.02; n=5), the
co-stimulatory molecule B7-2 (CD86) by 2.4-fold (p=0.03; n=5) and
CD40 by 4.1-fold (p=0.04; n=4). The combination of GM-CSF and 2006
showed a synergistic induction of CD86 and CD40, and an additive
effect for CD54. Induction of CD54, CD86 and CD40 by 2006 alone was
higher compared to either GM-CSF alone or GM-CSF combined with LPS.
Electron microscopy revealed major ultrastructural changes of
dendritic cells in response to CpG, indicating that these cells
were differentiated. Additionally CpG was found to induce
maturation of dendritic cells. CpG oligonucleotide 2006 was
superior to GM-CSF and LPS at inducing maturation marker CD83. A
synergistic maturation effect was observed when CpG oligonucleotide
2006 and GM-CSF were used together.
[0042] All effects of CpG on dendritic cells were CpG-specific as
shown by control oligonucleotides with methylated CpG motifs and
oligonucleotides containing GpC instead of CpG. Thus, the addition
of a CpG oligonucleotide is sufficient for improving survival,
differentiation, activation and maturation of human dendritic
cells. Since dendritic cells form the link between the innate and
the acquired immune system the ability to activate dendritic cells
with CpG supports the use of CpG-based strategies for immunotherapy
against disorders such as cancer and allergic or infectious
diseases.
[0043] Adjuvants are nonspecific stimulators of the immune
response. They are considered to be nonspecific because they only
produce an immune response in the presence of an antigen. Adjuvants
allow much smaller doses of antigen to be used and are essential to
inducing a strong antibody response to soluble antigens (Harlow and
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.,
current edition). It is shown according to the invention that CpG
functions as an adjuvant by activating dendritic cells. CpG is a
particularly useful adjuvant in humans because of its low toxicity.
Many potent adjuvants in mice or other animals, like the Freunds
complete adjuvant, cannot be used in humans due to toxicity.
Additionally, as demonstrated in the examples below, CpG activates
and matures human primary blood dendritic cells where other known
adjuvants such as LPS fail to do so. Furthermore, CpG is known to
induce a Th1 immune response which is believed to be superior to
the immune response induced by alum, the adjuvant currently used in
humans.
[0044] Thus the use of CpG allows the generation of mature
dendritic cells from peripheral blood within two days in a well
defined system. The application of CpG for this purpose is superior
to GM-CSF, which is currently used for this purpose. CpG
oligonucleotides have a longer half life, are less expensive, and
show a greater magnitude of immune effects. The combination of CpG
and GM-CSF shows synergistic activity for the induction of
co-stimulatory molecules (CD86, CD40).
[0045] The invention relates in one aspect to methods and products
for activating dendritic cells for in vitro, ex vivo and in vivo
purposes. It was demonstrated according to the invention that CpG
oligodeoxyribonucleotides are potent activators of dendritic cells.
Dendritic cells are believed to be essential for the initiation of
primary immune responses in immune cells in vivo. It was
discovered, according to the invention, that CpG
oligodeoxyribonucleotide was capable of activating dendritic cells
to initiate primary immune responses in T cells, similar to an
adjuvant. It was also discovered the CpG ODN induces the production
of large amounts of IL-12 in dendritic cells, indicating its
propensity to augment the development of Th1 immune responses in
vivo. The findings that CpG oligonucleotides were sufficient for
survival, differentiation, activation, and maturation of human
dendritic cells demonstrate the potent adjuvant activity of CpG and
provide the basis for the use of CpG oligodeoxyribonucleotides as
immunotherapeutics in the treatment of disorders such as cancer,
infectious diseases, and allergy. In one aspect, the invention is a
method for activating a dendritic cell by contacting the dendritic
cell with an isolated nucleic acid containing at least one
unmethylated CpG dinucleotide, wherein the nucleic acid is from
about 8-80 bases in length.
[0046] The methods and products of the invention are useful for a
variety of purposes. For instance, the invention is particularly
useful as an adjuvant for stimulating specific B and T cell
responses to immunization. This is accomplished by contacting
immature dendritic cells with an isolated nucleic acid containing
at least one unmethylated CpG dinucleotide to cause the dendritic
cell to become activated and to mature. The activated dendritic
cell is then incubated with resting T cells to cause activation of
the T cells in order to initiate a primary immune response. In some
cases the dendritic cell is also contacted with an antigen.
Dendritic cells efficiently internalize process and present the
soluble tumor-specific antigen to which it is exposed. The process
of internalizing and presenting antigen causes rapid upregulation
of the expression of major histocompatibility complex (MHC) and
costimulatory molecules, the production of cytokines, and migration
toward lymphatic organs where they are believed to be involved in
the activation of T cells.
[0047] One specific use for the CpG nucleic acids of the invention
is to activate dendritic cells for the purpose of enhancing a
specific immune response against cancer antigens. The immune
response may be enhanced using ex vivo or in vivo techniques. An
"ex vivo" method as used herein is a method which involves
isolation of an immature dendritic cell from a subject,
manipulation of the cell outside of the body, and reimplantation of
the manipulated cell into a subject. The ex vivo procedure may be
used on autologous or heterologous cells, but is preferably used on
autologous cells. In preferred embodiments, the immature dendritic
cells are isolated from peripheral blood or bone marrow, but may be
isolated from any source of dendritic cells. When the ex vivo
procedure is performed to specifically produce dendritic cells
active against a specific cancer antigen, the dendritic cells may
be exposed to the cancer antigen in addition to the CpG. In other
cases the dendritic cell may have already been exposed to antigen
but may not be expressing the antigen on the surface efficiently.
Activation will dramatically increase antigen processing. The
activated dendritic cell then presents the cancer antigen on its
surface. When returned to the subject, the activated dendritic cell
expressing the cancer antigen activates T cells in vivo which are
specific for the cancer antigen. Ex vivo manipulation of dendritic
cells for the purposes of cancer immunotherapy have been described
in several references in the art, including Engleman, E. G., 1997,
Cytotechnology, 25:1; Van Schooten, W., et al., 1997, Molecular
Medicine Today, June, 255; Steinman, R. M., 1996, Experimental
Hematology, 24, 849; and Gluckman, J. C., 1997, Cytokines, Cellular
and Molecular Therapy, 3:187. The ex vivo activation of dendritic
cells of the invention may be performed by routine ex vivo
manipulation steps known in the art, but with the use of CpG as the
activator.
[0048] The dendritic cells may also be contacted with CpG using in
vivo methods. In order to accomplish this, CpG is administered
directly to a subject in need of immunotherapy. The CpG may be
administered in combination with an antigen or may be administered
alone. In some embodiments, it is preferred that the CpG be
administered in the local region of the tumor.
[0049] An "antigen" as used herein is a molecule capable of
provoking an immune response. Antigens include but are not limited
to cells, cell extracts, polysaccharides, polysaccharide
conjugates, lipids, glycolipids, carbohydrate, viruses, and viral
extracts. A "cancer antigen" as used herein is a peptide associated
with a tumor or cancer cell surface and which is capable of
provoking an immune response when expressed on the surface of an
antigen presenting cell in the context of an MHC molecule. Cancer
antigens can be prepared from cancer cells either by preparing
crude extracts of cancer cells, for example, as described in Cohen,
et al., 1994, Cancer Research, 54:1055, by partially purifying the
antigens, by recombinant technology, or by de novo synthesis of
known antigens. Cancer antigens are isolated from a tumor or cancer
(e.g. tumors of the brain, lung (e.g. small cell and non-small
cell), ovary, breast, prostate, colon, as well as other carcinomas
and sarcomas).
[0050] The isolated dendritic cell is contacted with CpG and
exposed to an antigen. Although either step may be performed first
or the steps may be performed simultaneously, in one preferred
embodiment the antigen is exposed to the immature dendritic cell
before the cell is contacted with the CpG. It is believed that the
antigen is taken up by the dendritic cell and then when the
dendritic cell is contacted with the CpG, that the dendritic cell
is activated to process and present the antigen. Preferably, the
antigen is exposed to the cell within 48 hours of adding CpG. In a
more preferred embodiment, the dendritic cell is exposed to the
antigen within 24 hours of the CpG.
[0051] The antigen is exposed to the dendritic cell. As used
herein, the term "exposed to" refers to either the active step of
contacting the dendritic cell with an antigen in culture under
conditions which promote the uptake and processing of the antigen,
the passive exposure of antigen to the dendritic cell in vivo prior
to isolation of the dendritic cell, or the transfection of the
dendritic cell with a gene encoding the antigen, to cause
processing and presentation of the antigen through the
cytosolic/class I pathway. Methods for the active exposure of
dendritic cells to antigen are well-known in the art. In general,
purified dendritic cells are pulsed with antigen under culture
conditions which promote the uptake and processing of the antigen
such that the antigen will be expressed on the cell surface in
association with either class I or class II MHC. Methods for
transfecting dendritic cells with DNA encoding an antigen are also
well-known to those of ordinary skill in the art and require only
routine experimentation.
[0052] The compositions and methods of the invention are also
useful for treating infectious diseases. An infectious disease, as
used herein, is a disease arising from the presence of a foreign
microorganism in the body. CpG is used to stimulate an antigen
specific dendritic cell which can activate a T cell response
against an antigen of the microorganism. The methods are
accomplished in the same way as described above for the tumor
except that the antigen is specific for a microorganism using a
microbial antigen. A "microbial antigen" as used herein is an
antigen from a microorganism and includes but is not limited to
infectious virus, infectious bacteria, and infectious fungi.
[0053] Examples of infectious virus include: Retroviridae (e.g.
human immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola
viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus,
measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g.
influenza viruses); Bungaviridae (e.g. Hantaan viruses, bunga
viruses, phleboviruses and Nairo viruses); Arena viridae
(hemorrhagic fever viruses); Reoviridae (e.g. reoviruses,
orbiviruses and rotaviruses); Birnaviridae; Hepadnaviridae
(Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae
(papilloma viruses, polyoma viruses); Adenoviridae (most
adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2,
varicella zoster virus, cytomegalovirus (CMV), herpes virus);
Poxyiridae (variola viruses, vaccinia viruses, pox viruses); and
Iridoviridae (e.g. African swine fever virus); and unclassified
viruses (e.g. the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e. Hepatitis C); Norwalk and related
viruses, and astroviruses).
[0054] Examples of infectious bacteria include: Helicobacter
pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria
sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M.
kansasii, M. gordonae), Staphylococcus aureus, Neisseria
gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes,
Streptococcus pyogenes(Group A Streptococcus), Streptococcus
agalactiae (Group B Streptococcus), Streptococcus (viridans group),
Streptococcus faecalis, Streptococcus bovis, Streptococcus
(anaerobic sps.), Streptococcus pneumoniae, pathogenic
Campylobacter sp., Enterococcus sp., Haemophilus influenzae,
Bacillus anthracis, corynebacterium diphtheriae, corynebacterium
sp., Erysipelothrix rhusiopathiae, Clostridium perfringens,
Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae,
Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum,
Streptobacillus moniliformis, Treponema pallidum, Treponema
pertenue, Leptospira, and Actinomyces israelli.
[0055] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
falciparum and Toxoplasma gondii.
[0056] The methods of the invention are also useful for treating
allergic diseases. The methods are accomplished in the same way as
described above for the tumor immunotherapy and treatment of
infectious diseases except that the antigen is specific for an
allergen. Currently, allergic diseases are generally treated by the
injection of small doses of antigen followed by subsequent
increasing dosage of antigen. It is believed that this procedure
produces a memory immune response to prevent further allergic
reactions. These methods, however, are associated with the risk of
side effects such as an allergic response. The methods of the
invention avoid these problems.
[0057] An "allergen" refers to a substance (antigen) that can
induce an allergic or asthmatic response in a susceptible subject.
The list of allergens is enormous and can include pollens, insect
venoms, animal dander, dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include proteins specific to the following genuses: Canine (Canis
familiaris); Dermatophagoides (e.g. Dermatophagoides farinae);
Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium
(e.g. Lolium perenne or Lolium multiflorum); Cryptomeria
(Cryptomeria japonica); Alternaria (Alternaria alternata); Alder;
Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus
(Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris);
Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria
officinalis or Parietaria judaica); Blattella (e.g. Blattella
germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus
sempervirens, Cupressus arizonica and Cupressus macrocarpa);
Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana,
Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya
orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta
(e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens);
Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum);
Dactylis (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior);
Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena
sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g.
Anthoxanthum odoratum); Arrhenatherum (e.g. Arrhenatherum elatius);
Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense);
Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum
notatum); Sorghum (e.g. Sorghum halepensis); and Bromus (e.g.
Bromus inermis).
[0058] An "allergy" refers to acquired hypersensitivity to a
substance (allergen). Allergic conditions include but are not
limited to eczema, allergic rhinitis or coryza, hay fever,
bronchial asthma, urticaria (hives) and food allergies, and other
atopic conditions. A subject having an allergic reaction is a
subject that has or is at risk of developing an allergy.
[0059] "Asthma" refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
[0060] In addition to the treatment of active disorders, the
methods and products of the invention can be used as a prophylactic
vaccine. In this case, the CpG nucleic acid sequence is
administered in vivo, preferably in the presence of an antigen or
dendritic cells are prepared ex vivo and administered.
[0061] The CpG oligonucleotides of the invention are
immunostimulatory molecules. An "immunostimulatory nucleic acid
molecule" refers to a nucleic acid molecule, which contains an
unmethylated cytosine, guanine dinucleotide sequence (i.e. "CpG
DNA" or DNA containing a cytosine followed by guanosine and linked
by a phosphate bond) and stimulates (e.g. has a mitogenic effect
on, or induces or increases cytokine expression by) a dendritic
cell. An immunostimulatory nucleic acid molecule can be
double-stranded or single-stranded. Generally, double-stranded
molecules are more stable in vivo, while single-stranded molecules
have increased immune activity.
[0062] A "nucleic acid" or "DNA" means multiple nucleotides (i.e.
molecules comprising a sugar (e.g. ribose or deoxyribose) linked to
a phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the term refers to ribonucleotides as well as
oligodeoxyribonucleotides. The term shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acid molecules can
be obtained from existing nucleic acid sources (e.g. genomic or
cDNA), but are preferably synthetic (e.g. produced by
oligonucleotide synthesis).
[0063] In one preferred embodiment the invention provides an
isolated immunostimulatory nucleic acid sequence containing a CpG
motif represented by the formula:
5'N.sub.1X.sub.1CGX.sub.2N.sub.23' wherein at least one nucleotide
separates consecutive CpGs; X.sub.1 is adenine, guanine, or
thymine; X.sub.2 is cytosine, adenine, or thymine; N is any
nucleotide and N.sub.1+N.sub.2 is from about 0-25 nucleotides.
[0064] In another embodiment the invention provides an isolated
immunostimulatory nucleic acid sequence containing a CpG motif
represented by the formula: 5'NX.sub.1X.sub.2CGX.sub.3X.sub.4N3'
wherein at least one nucleotide separates consecutive CpGs;
X.sub.1X.sub.2 is selected from the group consisting of TpT, CpT,
TpC, and ApT; X.sub.3X.sub.4 is selected from the group consisting
of GpT, GpA, ApA and ApT; N is any nucleotide and N.sub.1+N.sub.2
is from about 0-25 nucleotides. In a preferred embodiment N.sub.1
and N.sub.2 of the nucleic acid do not contain a CCGG quadmer or
more than one CCG or CGG trimer.
[0065] Preferably the immunostimulatory nucleic acid sequences of
the invention include X.sub.1X.sub.2 selected from the group
consisting of GpT, GpG, GpA and ApA and X.sub.3X.sub.4 is selected
from the group consisting of TpT, CpT and GpT. For facilitating
uptake into cells, CpG containing immunostimulatory nucleic acid
molecules are preferably in the range of 8 to 30 bases in length.
However, nucleic acids of any size (even many kb long) are
immunostimulatory if sufficient immunostimulatory motifs are
present, since larger nucleic acids are degraded into
oligonucleotides inside of cells. Preferred synthetic
oligonucleotides do not include a CCGG quadmer or more than one CCG
or CGG trimer at or near the 5' and/or 3' terminals and/or the
consensus mitogenic CpG motif is not a palindrome. Prolonged
immunostimulation can be obtained using stabilized
oligonucleotides, where the oligonucleotide incorporates a
phosphate backbone modification, as discussed in more detail below.
For example, the modification is a phosphorothioate or
phosphorodithioate modification. More particularly, the phosphate
backbone modification occurs at the 5' end of the nucleic acid for
example, at the first two nucleotides of the 5' end of the nucleic
acid. Further, the phosphate backbone modification may occur at the
3' end of the nucleic acid for example, at the last five
nucleotides of the 3' end of the nucleic acid.
[0066] Preferably the immunostimulatory CpG DNA is in the range of
between 8 to 30 bases in size when it is an oligonucleotide.
Alternatively, CpG dinucleotides can be produced on a large scale
in plasmids, which after being administered to a subject are
degraded into oligonucleotides. Preferred immunostimulatory nucleic
acid molecules (e.g. for use in increasing the effectiveness of a
vaccine or to treat an immune system deficiency by stimulating an
antibody (i.e. humoral response in a subject) have a relatively
high stimulation index with regard to B cell, dendritic cell and/or
natural killer cell responses (e.g. cytokine, proliferative, lytic
or other responses).
[0067] A "nucleic acid delivery complex" shall mean a nucleic acid
molecule associated with (e.g. ionically or covalently bound to; or
encapsulated within) a targeting means (e.g. a molecule that
results in higher affinity binding to target cell (e.g. dendritic
cell surfaces and/or increased cellular uptake by target cells).
Examples of nucleic acid delivery complexes include nucleic acids
associated with: a sterol (e.g. cholesterol), a lipid (e.g. a
cationic lipid, virosome or liposome), or a target cell specific
binding agent (e.g. a ligand recognized by target cell specific
receptor). Preferred complexes must be sufficiently stable in vivo
to prevent significant uncoupling prior to internalization by the
target cell. However, the complex should be cleavable under
appropriate conditions within the cell so that the nucleic acid is
released in a functional form.
[0068] "Palindromic sequence" shall mean an inverted repeat (i.e. a
sequence such as ABCDEE'D'C'B'A' in which A and A' are bases
capable of forming the usual Watson-Crick base pairs. In vivo, such
sequences may form double-stranded structures.
[0069] A "stabilized nucleic acid molecule" shall mean a nucleic
acid molecule that is relatively resistant to in vivo degradation
(e.g. via an exo- or endo-nuclease). Stabilization can be a
function of length or secondary structure. Unmethylated CpG
containing nucleic acid molecules that are tens to hundreds of kbs
long are relatively resistant to in vivo degradation. For shorter
immunostimulatory nucleic acid molecules, secondary structure can
stabilize and increase their effect. For example, if the 3' end of
a nucleic acid molecule has self-complementarity to an upstream
region, so that it can fold back and form a sort of stem loop
structure, then the nucleic acid molecule becomes stabilized and
therefore exhibits more activity.
[0070] Preferred stabilized nucleic acid molecules of the instant
invention have a modified backbone. It was shown according to the
invention that modification of the oligonucleotide backbone
provided enhanced activity of the CpG molecules of the invention
when administered in vivo. CpG constructs, including at least two
phosphorothioate linkages at the 5' end of the
oligodeoxyribonucleotide and multiple phosphorothioate linkages at
the 3' end, preferably 5, provided maximal activity and protected
the oligodeoxyribonucleotide from degradation by intracellular exo-
and endo-nucleases. Other modified oligodeoxyribonucleotides
include phosphodiester modified oligodeoxyribonucleotide,
combinations of phosphodiester and phosphorothioate
oligodeoxyribonucleotide, methylphosphonate,
methylphosphorothioate, phosphorodithioate, and combinations
thereof. Each of these combinations and their particular effects on
immune cells is discussed in more detail in copending PCT patent
application U.S. Ser. No. 08/960,774, filed on Oct. 30, 1997, the
entire contents of which is hereby incorporated by reference. It is
believed that these modified oligodeoxyribonucleotides may show
more stimulatory activity due to enhanced nuclease resistance,
increased cellular uptake, increased protein binding, and/or
altered intracellular localization.
[0071] Both phosphorothioate and phosphodiester oligonucleotides
containing CpG motifs were active in dendritic cells. However,
based on the concentration needed to induce CpG specific effects,
the nuclease resistant phosphorothioate backbone CpG
oligonucleotides were more potent (2 .mu.g/ml for the
phosphorothioate vs. a total of 90 .mu.g/ml for phosphodiester). In
the concentration used in this study, phosphorothioate
oligonucleotides without CpG motifs showed no background
stimulatory activity such as that described earlier for high
phosphorothioate oligonucleotide concentrations.
[0072] Other stabilized nucleic acid molecules include: nonionic
DNA analogs, such as alkyl- and aryl-phosphates (in which the
charged phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acid molecules which contain
diol, such as tetraethyleneglycol or hexaethyleneglycol, at either
or both termini have also been shown to be substantially resistant
to nuclease degradation.
[0073] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. Preferred vectors are those capable of autonomous
replication and expression of nucleic acids to which they are
linked (e.g. an episome). Vectors capable of directing the
expression of genes to which they are operatively linked are
referred to herein as "expression vectors." In general, expression
vectors of utility in recombinant DNA techniques are often in the
form of "plasmids" which refer generally to circular
double-stranded DNA loops which, in their vector form, are not
bound to the chromosome. In the present specification, "plasmid"
and "vector" are used interchangeably as the plasmid is the most
commonly used form of vector. However, the invention is intended to
include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
[0074] A "subject" shall mean a human or vertebrate animal
including a dog, cat, horse, cow, pig, sheep, goat, chicken,
monkey, rat, and mouse.
[0075] The nucleic acid sequences of the invention which are useful
for stimulating dendritic cells are those broadly described above.
Exemplary sequences include but are not limited to those sequences
shown in Table 1-7 as well as TABLE-US-00001 TCCATGTCGCTCCTGATGCT,
(SEQ ID NO:42) TCCATGTCGTTCCTGATGCT, (SEQ ID NO:43)
TCGTCGTTGTCGTTGTCGTT; (SEQ ID NO:83) TCGTCGTTTTGTCGTTTTGTCGTT, (SEQ
ID NO:84) TCGTCGTTGTCGTTTTGTCGTT, (SEQ ID NO:85)
GCGTGCGTTGTCGTTGTCGTT, (SEQ ID NO:86) TGTCGTTTGTCGTTTGTCGTT (SEQ ID
NO:88) TGTCGTTGTCGTTGTCGTT, (SEQ ID NO:90) TCGTCGTCGTCGTT, (SEQ ID
NO:91) TCCTGTCGTTCCTTGTCGTT, (SEQ ID NO:73) TCCTGTCGTTTTTTGTCGTT,
(SEQ ID NO:75) TCGTCGCTGTCTGCCCTTCTT, (SEQ ID NO:76)
TCGTCGCTGTTGTCGTTTCTT, (SEQ ID NO:77) TCCATGACGTTCCTGACGTT, (SEQ ID
NO:97) GTCG(T/C)T and TGTCG(T/C)T.
[0076] The stimulation index of a particular immunostimulatory CpG
DNA can be tested in various immune cell assays. Preferably, the
stimulation index of the immunostimulatory CgG DNA with regard to B
cell proliferation is at least about 5, preferably at least about
10, more preferably at least about 15 and most preferably at least
about 20 as determined by incorporation of .sup.3H uridine in a
murine B cell culture, which has been contacted with 20 .mu.M of
ODN for 20 h at 37.degree. C. and has been pulsed with 1 .mu.Ci of
.sup.3H uridine; and harvested and counted 4 h later as described
in detail in copending PCT patent application U.S. Ser. No.
08/960,774. For use in vivo, for example to treat an immune system
deficiency by stimulating a cell-mediated (local) immune response
in a subject, it is important that the immunostimulatory CpG DNA be
capable of effectively inducing cytokine secretion by dendritic
cells.
[0077] Preferred immunostimulatory CpG nucleic acids should effect
at least about 500 pg/ml of TNF-.alpha., 15 pg/ml IFN-.gamma., 70
pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on
the therapeutic indication, as determined by the assays described
in the Examples. Other preferred immunostimulatory CpG DNAs should
effect at least about 10%, more preferably at least about 15% and
most preferably at least about 20% YAC-1 cell specific lysis or at
least about 30, more preferably at least about 35 and most
preferably at least about 40% 2C11 cell specific lysis.
[0078] It was found that the motifs that stimulate murine cells
best differ from those that are more effective with human cells.
Certain CpG oligodeoxynucleotides are poor at activating human
cells (oligodeoxyribonucleotide 1707, 1708, which contain the
palindrome forming sequences GACGTC and CACGTG, respectively).
[0079] The CpG oligonucleotides are used to induce survival,
activation, maturation, and differentiation of dendritic cells. A
dendritic cell has its ordinary meaning in the art and includes
immature dendritic cells, mature dendritic cells, antigen
expressing dendritic cells, non antigen expressing cells, precursor
and progenitor dendritic cells. Dendritic cells are known to
express different panels of cell surface molecules at different
stages of development as described in more detail below. An
activated dendritic cell is a dendritic cell which capable of
efficiently processing antigen. Activated dendritic cells may or
may not have already taken up antigen. A mature dendritic cell as
used herein is a dendritic cell which expresses CD83 on the
surface.
[0080] Dendritic cells useful according to the invention may be
isolated from any source as long as the cell is capable of being
activated by CpG to produce an active antigen expressing dendritic
cell. Several in vivo sources of immature dendritic cells may be
used according to the methods of the invention. For instance bone
marrow dendritic cells and peripheral blood dendritic cells are
both excellent sources of immature dendritic cells that are
activated by CpG. Other sources may easily be determined by those
of skill in the art without requiring undue experimentation, by for
instance, isolating a primary source of dendritic cells and testing
activation by CpG in vitro (e.g., using assays described in the
Examples section). The invention also encompasses the use of any
immature dendritic cells maintained in culture as a cell line as
long as the cell is capable of being activated by CpG. Such cell
types may be routinely identified using standard assays known in
the art.
[0081] It was discovered according to the invention, that not all
sources of dendritic cells that are known to be activated by
cytokines to produce antigen presenting dendritic cells are capable
of being activated by CpG. For instance, monocyte-derived dendritic
cells are not activated by CpG. Recently, the method of
monocyte-derived dendritic cells has attracted major attention
because the incubation of purified CD14-positive monocytes with
GM-CSF and IL-4 and subsequent maturation with conditioned medium
or TNF provides large numbers of dendritic cells within one week.
Romani N, et al. J Immunol Methods 1996; 196: 137-151. Since these
cells tend to de-differentiate into macrophages in the absence of
IL-4 Hausser G, et al. Immunobiology 1997; 197: 534-542, these
dendritic cells may not resemble the physiologic situation.
Although these cells are highly responsive to LPS it was discovered
that monocyte-derived dendritic cells do not respond to CpG (see
Examples). It was also demonstrated that human monocytes, while
highly sensitive to LPS, show a minor and delayed response to
CpG.
[0082] Peripheral blood dendritic cells isolated by immunomagnetic
cell sorting, which are activated by CpG, represent a more
physiologic cell population of dendritic cells than monocyte
derived dendritic cells. Immature dendritic cells comprise
approximately 1-3% of the cells in the bone marrow and
approximately 10-100 fold less in the peripheral blood. Peripheral
blood cells can be collected using devices well-known in the art,
e.g., Haemonetics model v. 50 apheresis device (Haemonetics,
Braintree, Mass.). Red blood cells and neutrophils are removed from
the blood by centrifugation. The mononuclear cells located at the
interface are isolated. Methods for isolating CD4+ dendritic cells
from peripheral blood have been described O'Doherty U, et al., J
Exp Med 1993; 178: 1067-1076 and are set forth in the Examples. In
the presence of GM-CSF these cells differentiate to dendritic cells
with characteristic cellular processes within two days.
Differentiation is accompanied by an increase in cell size,
granularity and MHC II expression, which can be easily followed
using flow cytometry. Freshly isolated dendritic cells cultured in
the absence of GM-CSF rapidly undergo apoptosis. Strikingly, in the
presence of CpG oligonucleotides without addition of GM-CSF, both
cell survival and differentiation is markedly improved compared to
GM-CSF. In the presence of CpG, dendritic cells form cell clusters
which when examined by ultrastructural techniques such as electron
microscopy revealed characteristic dense multilamellar
intracytoplasmic bodies and multi-vesicular structures, which were
not present in dendritic cells incubated with GM-CSF. Scanning
electron microscopy showed long veil and sheet-like processes
thought to be used for intercellular interactions, and an irregular
cell shape. In contrast, cells incubated with GM-CSF were
round-shaped and had only minor cellular processes. In addition to
promoting survival and differentiation of dendritic cells, a single
addition of CpG oligonucleotide led to activation as represented by
upregulation of the co-stimulatory molecules ICAM-1 (CD54), B7-2
(CD86) and CD40. The combination of CpG oligonucleotide and GM-CSF
enhanced the expression of CD86 and CD40 synergistically, proving
that activation is not due to CpG-induced GM-CSF.
[0083] In addition to activating dendritic cells CpG was capable of
causing maturation of the dendritic cells. Maturation is assessed
by the appearance of CD83, a specific marker for mature human
dendritic cells. The presence of CpG alone for two days was
sufficient to cause maturation of a variable percentage of the
cells and the combination of GM-CSF and CpG was found to act
synergistically to cause maturation of an even greater number of
cells.
[0084] Each of the effects observed by culturing cells in the
presence of CpG, improved survival, differentiation, activation and
maturation of dendritic cells, were CpG specific since control
oligonucleotides with methylated CpGs and oligonucleotides with GpC
instead of CpGs were inactive. Additionally, CpG was superior to
LPS in inducing both activation and maturation.
[0085] CD40-mediated activation of dendritic cells plays a key role
for the induction of cytotoxic T-cells from naive T-cells. The
profound changes observed in CpG-stimulated dendritic cells are
similar to those seen after activation by CD40 Lanzavecchia A.
License to kill. Nature 1998; 393: 413-414. Recently the central
role of CD40 ligation for "superactivation" of dendritic cells has
been identified. Lanzavecchia A. License to kill. Nature 1998; 393:
413-414; Schoenberger S P, et al. Nature 1998; 393: 480-483; Ridge
J P, Di Rosa F, Matzinger P. Nature 1998; 393: 474-478. Bennett S
R, et al. Nature 1998; 393: 478-480. While TNF and LPS activate
dendritic cells by upregulation of co-stimulatory molecules, CD40
ligation on dendritic cells is required for the dendritic
cell-dependent induction of cytotoxic T-cells from naive T-cells.
CD40 ligand present on the surface of activated T helper cells
provides this signal under physiologic circumstances. In addition
to the data presented herein the data presented in the parent
application indicate that CpG may be substitutes for CD40 ligation
on dendritic cells. CD40 and CpG perform a number of parallel
actions. First, CpG and CD40 both activate c-Jun NH2-terminal
kinase and p38, but do not activate the extracellular receptor
kinase in B cells. Second, CD40 and CpG are each sufficient to
induce proliferation of B-cells. Finally, both CD40 and CpG
activate NK cells in an IL-12 dependent manner.
[0086] The ability of CpG to activate human dendritic cells differs
from that of murine dendritic cells. It has also been discovered
that CpG upregulates MHC class II and co-stimulatory molecules on
murine Langerhans cells. In another study similar changes were
described for murine bone marrow-derived dendritic cells.
Sparwasser T, et al. Eur J Immunol 1998; 28: 2045-2054. In both
studies the efficacy of CpG to induce co-stimulatory molecules does
not exceed the effects seen for LPS, to which monocytic cells are
highly sensitive. Murine monocytes/macrophages are known to secrete
high amounts of inflammatory cytokines in response to CpG. Since
the murine cell preparation may include other myelomonocytic cells
in the analysis as well a secondary indirect effect of CpG on
Dendritic cells in these cell preparations may have contributed to
the described activation of Dendritic cells.
[0087] It has been shown according to the invention that purified
human blood dendritic cells are highly sensitive to CpG, while
their response to LPS is barely detectable. The LPS concentration
used in this study (10 ng/ml) is 10-fold higher than the
concentration found to induce maximal cytokine secretion in human
monocytes (1 ng/ml). It is important to note that murine
macrophages are approximately 1000-fold less sensitive to LPS than
human macrophages. In contrast to human macrophages, the low
sensitivity of human blood dendritic cells to LPS and the high
sensitivity to CpG is striking.
Certain Unmethylated CpG Containing Nucleic Acids were Initially
Demonstrated to have B Cell Stimulatory Activity as Shown In Vitro
and In Vivo
[0088] In the course of investigating the lymphocyte stimulatory
effects of two antisense oligonucleotides specific for endogenous
retroviral sequences, using protocols described in the attached
Examples 1 and 2 of Co-pending parent patent application U.S. Ser.
No. 08/960,774, it was surprisingly found that two out of
twenty-four "controls" (including various scrambled, sense, and
mismatch controls for a panel of "antisense"
oligodeoxyribonucleotides) also mediated B cell activation and IgM
secretion, while the other "controls" had no effect.
[0089] Two observations suggested that the mechanism of this B cell
activation by the "control" oligodeoxyribonucleotides may not
involve antisense effects 1) comparison of vertebrate DNA sequences
listed in GenBank showed no greater homology than that seen with
non-stimulatory oligodeoxyribonucleotide and 2) the two controls
showed no hybridization to Northern blots with 10 .mu.g of spleen
poly A+ RNA. Resynthesis of these oligodeoxyribonucleotide on a
different synthesizer or extensive purification by polyacrylamide
gel electrophoresis or high pressure liquid chromatography have
identical stimulation, eliminating the possibility of impurity.
Similar stimulation was seen using B cells from C3H/HeJ mice,
eliminating the possibility that lipopolysaccharide (LPS)
contamination could account for the results.
[0090] The fact that two "control" oligodeoxyribonucleotide caused
B cell activation similar to that of the two "antisense"
oligodeoxyribonucleotide raised the possibility that all four
oligodeoxyribonucleotide were stimulating B cells through some
non-antisense mechanism involving a sequence motif that was absent
in all of the other nonstimulatory control
oligodeoxyribonucleotide. In comparing these sequences, it was
discovered that all of the four stimulatory
oligodeoxyribonucleotide containing CpG dinucleotides that were in
a different sequence context from the nonstimulatory control.
[0091] To determine whether the CpG motif present in the
stimulatory oligodeoxyribonucleotide was responsible for the
observed stimulation, over 300 oligodeoxyribonucleotide ranging in
length from 5 to 42 bases that contained methylated, unmethylated,
or no CpG dinucleotides in various sequence contexts were
synthesized. These oligodeoxyribonucleotide, including the two
original "controls" (ODN 1 and 2) and two originally synthesized as
"antisense" (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448
(1989)), were then examined for in vitro effects on spleen cells
(representative sequences are listed in Table 1). Several
oligodeoxyribonucleotides that contained CpG dinucleotides induced
B cell activation and IgM secretion; the magnitude of this
stimulation typically could be increased by adding more CpG
dinucleotides (Table 1; compare ODN 2 to 2a or 3D to 3Da and 3 Db).
* NB Table 1 is only a sequence listing--comparative data.
Stimulation did not appear to result from an antisense mechanism or
impurity. Oligodeoxyribonucleotides caused no detectable
proliferation of .gamma..delta. or other T cell populations.
[0092] Mitogenic oligodeoxyribonucleotide sequences uniformly
became nonstimulatory if the CpG dinucleotide was mutated (Table 1;
compare ODN 1 to 1a; 3D to 3Dc; 3M to 3Ma; and 4 to 4a) or if the
cytosine of the CpG dinucleotide was replaced by 5-methylcytosine
(Table 1; ODN 1b, 2b, 3Dd, and 3 Mb). Partial methylation of CpG
motifs caused a partial loss of stimulatory effect (compare 2a to
2c, Table 1). In contrast methylation of other cytosines did not
reduce oligodeoxyribonucleotide activity (ODN 1c, 2d, 3De and 3Mc).
These data confirmed that a CpG motif is the essential element
present in oligodeoxyribonucleotide that activate B cells.
[0093] In the course of these studies, it became clear that the
bases flanking the CpG dinucleotide played an important role in
determining the murine B cell activation induced by an
oligodeoxyribonucleotide. The optimal stimulatory motif was
determined to consist of a CpG flanked by two 5' purines
(preferably a GpA dinucleotide) and two 3' pyrimidines (preferably
a TpT or TpC dinucleotide). Mutations of oligodeoxyribonucleotide
to bring the CpG motif closer to this ideal improved stimulation
(e.g. Table 1, compare ODN 2 to 2e; 3M to 3Md) while mutations that
disturbed the motif reduced stimulation (e.g. Table 1, compare ODN
3D to 3Df; 4 to 4b, 4c and 4d). On the other hand, mutations
outside the CpG motif did not reduce stimulation (e.g. Table 1,
compare ODN 1 to 1d; 3D to 3Dg; 3M to 3Me). For activation of human
cells, the best flanking bases are slightly different (see Table
3).
[0094] Of those tested, oligodeoxyribonucleotides shorter than 8
bases were non-stimulatory (e.g. Table 1, ODN 4e). Among the
forty-eight 8 base oligodeoxyribonucleotide tested, a highly
stimulatory sequence was identified as TCAACGTT (ODN 4) which
contains the self complementary "palindrome" AACGTT. In further
optimizing this motif, it was found that oligodeoxyribonucleotide
containing Gs at both ends showed increased stimulation,
particularly if the oligodeoxyribonucleotide were rendered nuclease
resistant by phosphorothioate modification of the terminal
internucleotide linkages. Oligodeoxyribonucleotide 1585 (5'
GGGGTCAACGTTGAGGGGGG 3') (SEQ ID NO: 47)), in which the first two
and last five internucleotide linkages are phosphorothioate
modified caused an average 25.4 fold increase in mouse spleen cell
proliferation compared to an average 3.2 fold increase in
proliferation induced by oligodeoxyribonucleotide 1638 (5'
AAAATCAACGTTGAAAAAAA 3'; SEQ ID NO: 99), which has the same
sequence as ODN 1585 except that the 10 Gs at the two ends are
replaced by 10 As. The effect of the G-rich ends is cis; addition
of an oligodeoxyribonucleotide with poly G ends but no CpG motif to
cells along with 1638 gave no increased proliferation. For nucleic
acid molecules longer than 8 base pairs, non-palindromic motifs
containing an unmethylated CpG were found to be more
immunostimulatory.
[0095] Other octamer oligodeoxyribonucleotide containing a 6 base
palindrome with a TpC dinucleotide at the 5' end were also active
(e.g. Table 1, ODN 4b, 4c). Other dinucleotides at the 5' end gave
reduced stimulation (e.g. ODN 4f; all sixteen possible
dinucleotides were tested). The presence of a 3' dinucleotide was
insufficient to compensate for the lack of a 5' dinucleotide (e.g.
Table 1, ODN 4 g). Disruption of the palindrome eliminated
stimulation in octamer oligodeoxyribonucleotide (e.g. Table 1, ODN
4 h), but palindromes were not required in longer
oligodeoxyribonucleotide.
[0096] The kinetics of lymphocyte activation were investigated
using mouse spleen cells. When the cells were pulsed at the same
time as oligodeoxyribonucleotide addition and harvested just four
hours later, there was already a two-fold increase in 3H uridine
incorporation. Stimulation peaked at 12-48 hours and then
decreased. After 24 hours, no intact oligodeoxyribonucleotide were
detected, perhaps accounting for the subsequent fall in stimulation
when purified B cells with or without anti-IgM (at a submitogenic
dose) were cultured with CpG oligodeoxyribonucleotide,
proliferation was found to synergistically increase about 10-fold
by the two mitogens in combination after 48 hours. The magnitude of
stimulation was concentration dependent and consistently exceeded
that of LPS under optimal conditions for both. Oligonucleotides
containing a nuclease resistant phosphorothioate backbone were
approximately two hundred times more potent than unmodified
oligonucleotides.
[0097] Cell cycle analysis was used to determine the proportion of
B cells activated by CpG-oligodeoxyribonucleotide.
CpG-oligodeoxyribonucleotide induced cycling in more than 95% of B
cells. Splenic B lymphocytes sorted by flow cytometry into CD23-
(marginal zone) and CD23+ (follicular) subpopulations were equally
responsive to oligodeoxyribonucleotide-induced stimulation, as were
both resting and activated populations of B cells isolated by
fractionation over Percoll gradients. These studies demonstrated
that CpG-oligodeoxyribonucleotide induce essentially all B cells to
enter the cell cycle.
Immunostimulatory Nucleic Acid Molecules Block Murine B Cell
Apoptosis
[0098] Certain B cell lines, such as WEHI-231, are induced to
undergo growth arrest and/or apoptosis in response to crosslinking
of their antigen receptor by anti-IgM (Jakway, J. P., et al.,
"Growth regulation of the B lymphoma cell line WEHI-231 by
anti-immunoglobulin, lipopolysaccharide and other bacterial
products," J. Immunol. 137:2225 (1986); Tusubata, T., J. Wu and T.
Honjo: "B-cell apoptosis induced by antigen receptor crosslinking
is blocked by a T-cell signal through CD40," Nature, 364:634
(1993)). WEHI-231 cells are rescued from this growth arrest by
certain stimuli such as LPS and by the CD40 ligand.
oligodeoxyribonucleotide containing the CpG motif were also found
to protect WEHI-231 from anti-IgM induced growth arrest, indicating
that accessory cell populations are not required for the effect.
Subsequent work indicates that CpG oligodeoxyribonucleotide induce
Bcl-x and myc expression, which may account for the protection from
apoptosis. Also, CpG nucleic acids have been found to block
apoptosis in human cells. This inhibition of apoptosis is
important, since it should enhance and prolong immune activation by
CpG DNA.
Method for Making Immunostimulatory Nucleic Acids
[0099] For use in the instant invention, nucleic acids can be
synthesized de novo using any of a number of procedures well known
in the art. For example, the .beta.-cyanoethyl phosphoramidite
method (S. L. Beaucage and M. H. Caruthers, 1981, Tet. Let.
22:1859); nucleoside H-phosphonate method (Garegg, et al., 1986,
Tet. Let. 27:4051-4054; Froehler, et al., 1986, Nucl. Acid. Res.
14:5399-5407; Garegg, et al., 1986, Tet. Let. 27:4055-4058,
Gaffney, et al., 1988), Tet. Let. 29:2619-2622. These chemistries
can be performed by a variety of automated oligonucleotide
synthesizers available in the market. Alternatively,
oligonucleotides can be prepared from existing nucleic acid
sequences (e.g. genomic or cDNA) using known techniques, such as
those employing restriction enzymes, exonucleases or
endonucleases.
[0100] For use in vivo, nucleic acids are preferably relatively
resistant to degradation (e.g. via endo- and exo-nucleases).
Secondary structures, such as stem loops, can stabilize nucleic
acids against degradation. Alternatively, nucleic acid
stabilization can be accomplished via phosphate backbone
modifications. A preferred stabilized nucleic acid can be
accomplished via phosphate backbone modifications. A preferred
stabilized nucleic acid has at least a partial phosphorothioate
modified backbone. Phosphorothioates may be synthesized using
automated techniques employing either phosphoramidate or
H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made
for example as described in U.S. Pat. No. 4,469,863; and
alkylphosphotriesters (in which the charged oxygen moiety is
alkylated as described in U.S. Pat. No. 5,023,243 and European
Patent No. 092,574) can be prepared by automated solid phase
synthesis using commercially available reagents. Methods for making
other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., 1990, Chem Rev. 90:544;
Goodchild, J., 1990, Bioconjugate Chem. 1:165). 2'-O-methyl nucleic
acids with CpG motifs also cause immune activation, as do
ethoxy-modified CpG nucleic acids. In fact, no backbone
modifications have been found that completely abolish the CpG
effect, although it is greatly reduced by replacing the C with a
5-methyl C.
[0101] For administration in vivo, nucleic acids may be associated
with a molecule that results in higher affinity binding to target
cell (e.g. dendritic cell) surfaces and/or increased cellular
uptake by target cells to form a "nucleic acid delivery complex."
Nucleic acids can be ionically, or covalently associated with
appropriate molecules using techniques which are well known in the
art. A variety of coupling or crosslinking agents can be used, for
example protein A, carbodiimide, and
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP). Nucleic acids
can alternatively be encapsulated in liposomes or virosomes using
well-known techniques.
Therapeutic Uses of Immunostimulatory Nucleic Acid Molecules
[0102] Based on their immunostimulatory properties, nucleic acid
molecules containing at least one unmethylated CpG dinucleotide can
be used as described in detail. The nucleic acid molecules may also
be used as set forth herein and in co-pending parent patent
application U.S. Ser. No. 08/960,774, now issued U.S. Pat. No.
6,239,116B1.
[0103] Immunostimulatory nucleic acid molecules can also be
administered to a subject in conjunction with a vaccine to boost a
subject's immune system and thereby effect a better response from
the vaccine. Preferably the immunostimulatory nucleic acid molecule
is administered slightly before or at the same time as the vaccine.
A conventional adjuvant may optionally be administered in
conjunction with the vaccine, which is minimally comprised of an
antigen, as the conventional adjuvant may further improve the
vaccination by enhancing antigen absorption.
[0104] When the vaccine is a DNA vaccine at least two components
determine its efficacy. First, the antigen encoded by the vaccine
determines the specificity of the immune response. Second, if the
backbone of the plasmid contains CpG motifs, it functions as an
adjuvant for the vaccine. Thus, CpG DNA acts as an effective
"danger signal" and causes the immune system to respond vigorously
to new antigens in the area. This mode of action presumably results
primarily from the stimulatory local effects of CpG DNA on
dendritic cells and other "professional" antigen presenting cells,
as well as from the co-stimulatory effects on B cells.
[0105] Immunostimulatory oligonucleotides and unmethylated CpG
containing vaccines, which directly activate lymphocytes and
co-stimulate an antigen-specific response, are fundamentally
different from conventional adjuvants (e.g. aluminum precipitates),
which are inert when injected alone and are thought to work through
absorbing the antigen and thereby presenting it more effectively to
immune cells. Further, conventional adjuvants only work for certain
antigens, only induce an antibody (humoral) immune response (Th2),
and are very poor at inducing cellular immune responses (Th1). For
many pathogens, the humoral response contributes little to
protection, and can even be detrimental.
[0106] In addition, an immunostimulatory oligonucleotide can be
administered prior to, along with or after administration of a
chemotherapy or immunotherapy to increase the responsiveness of the
malignant cells to subsequent chemotherapy or immunotherapy or to
speed the recovery of the bone marrow through induction of
restorative cytokines such as GM-CSF. CpG nucleic acids also
increase natural killer cell lytic activity and antibody dependent
cellular cytotoxicity (ADCC). Induction of NK activity and ADCC may
likewise be beneficial in cancer immunotherapy, alone or in
conjunction with other treatments.
[0107] Another use of the described immunostimulatory nucleic acid
molecules is in desensitization therapy for allergies, which are
generally caused by IgE antibody generation against harmless
allergens. The cytokines that are induced by unmethylated CpG
nucleic acids are predominantly of a class called "Th1" which is
most marked by a cellular immune response and is associated with
IL-12 and IFN-.gamma.. The other major type of immune response is
termed as Th2 immune response, which is associated with more of an
antibody immune response and with the production of IL-4, IL-5 and
IL-10. In general, it appears that allergic diseases are mediated
by Th2 type immune responses and autoimmune diseases by Th1 immune
response. Based on the ability of the immunostimulatory nucleic
acid molecules to shift the immune response in a subject from a Th2
(which is associated with production of IgE antibodies and allergy)
to a Th1 response (which is protective against allergic reactions),
an effective dose of an immunostimulatory nucleic acid (or a vector
containing a nucleic acid) alone or in conjunction with an allergen
can be administered to a subject to treat or prevent an
allergy.
[0108] Nucleic acids containing unmethylated CpG motifs may also
have significant therapeutic utility in the treatment of asthma.
Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways
of asthmatic subjects. These cytokines, especially IL-4 and IL-5
are elevated in the airways of asthmatic subjects. These cytokines
promote important aspects of the asthmatic inflammatory response,
including IgE isotope switching, eosinophil chemotaxis and
activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines.
[0109] As described in Co-pending parent patent application U.S.
Ser. No. 08/960,774, oligonucleotides containing an unmethylated
CpG motif (i.e. TCCATGACGTTCCTGACGTT; SEQ ID NO: 97), but not a
control oligonucleotide (TCCATGAGCTTCCTGAGTCT; SEQ ID NO: 98)
prevented the development of an inflammatory cellular infiltrate
and eosinophilia in a murine model of asthma. Furthermore, the
suppression of eosinophilic inflammation was associated with a
suppression of Th2 response and induction of a Th1 response.
[0110] For use in therapy, an effective amount of an appropriate
immunostimulatory nucleic acid molecule alone or formulated as a
delivery complex can be administered to a subject by any mode
allowing the oligonucleotide to be taken up by the appropriate
target cells (e.g. dendritic cells). Preferred routes of
administration include oral and transdermal (e.g. via a patch).
Examples of other routes of administration include injection
(subcutaneous, intravenous, parenteral, intraperitoneal,
intrathecal, etc.). The injection can be in a bolus or a continuous
infusion.
[0111] A nucleic acid alone or as a nucleic acid delivery complex
can be administered in conjunction with a pharmaceutically
acceptable carrier. As used herein, the phrase "pharmaceutically
acceptable carrier" is intended to include substances that can be
coadministered with a nucleic acid or a nucleic acid delivery
complex and allows the nucleic acid to perform its indicated
function. Examples of such carriers include solutions, solvents,
dispersion media, delay agents, emulsions and the like. The use of
such media for pharmaceutically active substances are well known in
the art. Any other conventional carrier suitable for use with the
nucleic acids fall within the scope of the instant invention.
[0112] The term "effective amount" of a nucleic acid molecule
refers to the amount necessary or sufficient to realize a desired
biologic effect. For example, an effective amount of a nucleic acid
containing at least one unmethylated CpG for treating an immune
system deficiency could be that amount necessary to eliminate a
tumor, cancer, or bacterial, viral or fungal infection. An
effective amount for use as a vaccine adjuvant could be that amount
useful for boosting a subject's immune response to a vaccine. An
"effective amount" for treating asthma can be that amount useful
for redirecting a Th2 type of immune response that is associated
with asthma to a Th1 type of response. The effective amount for any
particular application can vary depending on such factors as the
disease or condition being treated, the particular nucleic acid
being administered (e.g. the number of unmethylated CpG motifs or
their location in the nucleic acid), the size of the subject, or
the severity of the disease or condition. One of ordinary skill in
the art can empirically determine the effective amount of a
particular oligonucleotide without necessitating undue
experimentation.
[0113] The compositions of the invention, including activated
dendritic cells, isolated CpG nucleic acid molecules, cytokines,
and mixtures thereof are administered in pharmaceutically
acceptable compositions. The compositions may be administered by
bolus injection, continuous infusion, sustained release from
implants, aerosol, or any other suitable technique known in the
art.
[0114] It is also contemplated according to the methods of the
invention that any compositions of the invention may also be
administered in conjunction with other immune stimulating agents,
such as for instance cytokines. Cytokines, include but are not
limited to, IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12,
IL-15, granulocyte-macrophage colony stimulating factor (GMCSF),
granulocyte colony stimulating factor (GCSF), interferon-.gamma.
(IFN-.gamma.), tumor necrosis factor (TNF), TGF-.beta., FLT-3
ligand, and CD40 ligand.
[0115] As reported herein, in response to unmethylated CpG
containing nucleic acid molecules, an increased number of spleen
cells secrete IL-6, IL-12, IFN-.gamma., IFN-.alpha., IFN-.beta.,
IL-1, IL-3, IL-10, TNF-.alpha., TNF-.beta., GM-CSF, RANTES, and
probably others. The increased IL-6 expression was found to occur
in B cells, CD4+ T cells, monocytic cells, as well as dendritic
cells.
[0116] FLT3 ligand is a class of compounds described in EP0627487A2
and WO94/28391. A human FLT3 ligand cDNA was deposited with the
American Tissue Type Culture Collection, Rockville, Md., and
assigned accession number ATCC 69382. Interleukins have been
described extensively in the art, e.g., Mosley, et al., 1989, Cell,
59:335, Idzerda, et al., 1990, J. Exp. Med., 171:861. GM-CSF is
commercially available as sargramostine, leukine (Immunex).
[0117] Systemic administration of CpG alone in some embodiments is
useful for immunotherapy against antigens. Alternative agents like
GM-CSF have a shorter half life, although their synergistic effects
with CpG will likely make this combination useful. On the other
hand, some activators of dendritic cells like LPS or inflammatory
cytokines (TNF) have dose limiting toxicity, which makes their
systemic use for this purpose not practical. The present study
provides the functional rationale and methods for the use of CpG
for dendritic cell-based immunotherapeutic strategies against
cancer and for its use as an adjuvant in humans.
[0118] Systemically administered CpG oligonucleotides enhances the
availability of immature and mature dendritic cells in the blood
and in tissues.
[0119] The invention is also useful for in vitro screening assays.
For instance, immature dendritic cells may be used in vitro to
identify other CpG specific motifs which are useful for activating
or causing maturation of dendritic cells. These motifs may then be
used in vivo or ex vivo for activating dendritic cells.
Additionally, the same type of assay may be used to identify
cytokines or other immunostimulatory molecules which may have
synergistic adjuvant effects when combined with isolated CpG
nucleic acid sequences of the invention.
[0120] Another assay useful according to the invention is an assay
for identifying compounds which inhibit dendritic cell activation
or maturation. The assay would involve the addition of a putative
drug to a immature dendritic cell which is activated by CpG. If the
putative drug prevents activation, then it may be a compound which
is therapeutically capable of inhibiting activation or maturation
of the dendritic cell. Such compounds would be useful in methods of
gene therapy when it is desirable to specifically inhibit the
immune response to prevent an immune response against the
therapeutic protein. For instance, when factor VIII is delivered by
gene therapy methods, it is desirable to prevent an immune response
from developing against the therapeutic factor VIII. It is also
useful for preventing immune response to transplanted heterologous
tissue.
[0121] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Example 1
Generation and Characterization of Dendritic Cells
Methods
[0122] Isolation of dendritic cells: Dendritic cells represent a
small population of peripheral blood mononuclear cells (0.1 to
0.4%). They express substantial levels of CD4, but lack the T cell
molecules CD3, CD8, and T cell receptor, and other lineage markers
(CD19, CD14, CD16, CD56) (O'Doherty U, et al., "Dendritic cells
freshly isolated from human blood express CD4 and mature into
typical immunostimulatory dendritic cells after culture in
monocyte-conditioned medium", J Exp Med, 1993; 178: 1067-1076).
Using these characteristics, dendritic cells can be separated by
high gradient immunomagnetic cell sorting using the VARIOMACS
technique (Miltenyi Biotec Inc., Auburn, Calif.). Peripheral blood
mononuclear cells were obtained from buffy coats of healthy blood
donors (Elmer L. DeGowin Blood Center, University of Iowa) by
Ficoll-Paque density gradient centrifugation (Histopaque-1077,
Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G, et
al., "Specific suppression of human tumor necrosis factor-alpha
synthesis by antisense oligodeoxynucleotides", Antisense Nucleic
Acid Drug Dev, 1996; 6: 291-299). Cells were resuspended in
phosphate buffered saline (0.5% bovine serum albumin, 2 mM EDTA, pH
7.4) and incubated with colloidal superparamagnetic microbeads
conjugated with CD3, CD14, CD16, CD19 and CD56). Thereafter cells
were passed over a depletion column in a strong magnetic field.
Cells in the flow through were collected, washed two times,
incubated with a microbead-conjugated antibody to CD4, and passed
over a positive selection column. CD4-positive cells were eluted
from the column by removal of the column from the magnetic device.
Eluted cells were passed over a second column to enhance purity of
the preparation. By this technique we were able to isolate
6.times.10.sup.5 to 2.2.times.10.sup.7 dendritic cells from
2.times.10.sup.8 to 5.times.10.sup.8 peripheral blood mononuclear
cells in a purity of 94 to 99% (MHC class II expression, lineage
marker negative). Viability was determined by trypan blue exclusion
(>95%). In light microscopy, purified cells had the appearance
of medium sized lymphocytes.
[0123] Cell culture Cells were suspended in RPMI 1640 culture
medium supplemented with 10% (v/v) heat-inactivated (56.degree. C.,
1 h) FCS (HyClone, Logan, Utah), 1.5 mM L-glutamine, 100 U/ml
penicillin and 100 .mu.g/ml streptomycin (all from Gibco BRL, Grand
Island, N.Y.) (complete medium). All compounds were purchased
endotoxin-tested. Freshly prepared dendritic cells (final
concentration 4.times.10.sup.5 cells/ml) were cultured in 96-well
plates in 200 .mu.l complete medium in a 5% CO.sub.2 humidified
incubator at 37.degree. C. for either 48 hours or 72 hours as
indicated. The cell culture medium contained 800 U/ml GMCSF
(1.25.times.10.sup.4 U/mg; Genzyme, Cambridge, Mass.), 10 ng/ml LPS
(from salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.)
or oligonucleotides as indicated.
Results
[0124] Dendritic cells can be obtained in large numbers by
incubation of CD14-positive monocytes with GMCSF and IL-4 for 7
days. However, upon withdrawal of IL-4 these cells lose their
dendritic cell characteristics and become CD14 positive macrophages
(Hausser G, et al. "Monocyte-derived dendritic cells represent a
transient stage of differentiation in the myeloid lineage",
Immunobiology, 1997; 197: 534-542). In addition, IL-4 induces a Th2
immune response which may not be optimal for the induction of a
specific cytotoxic T-cell response. Therefore, monocyte-derived
dendritic cells, despite their availability in large numbers, may
not be optimal for immunotherapeutic purposes. We found that
monocyte-derived dendritic cells are sensitive to LPS but
surprisingly are not activated by CpG motifs (FIG. 8). It is
believed that the inability of monocyte-derived DC to respond to
CpG might be due to the unphysiologic methods by which these cells
are prepared. Consequently, the effect of CpG oligonucleotides on
primary peripheral blood DC was examined.
[0125] Physiologically, DC are present in small numbers (<0.5%)
in peripheral blood mononuclear cells. Blood dendritic cells can be
identified by the expression of CD4 and HLA-DR surface antigens and
the absence of lineage markers (B cell, T cell, NK cell and
monocyte). Immunomagnetic depletion of lineage-positive cells and
subsequent positive selection of CD4-positive cells allows the
isolation of DC from peripheral blood. In our experiments, we
obtained 0.7 to 2.4.times.10.sup.6 DC from single buffy coats (2.5
to 5.times.10.sup.8 mononuclear cells). The purity of the DC
preparation (MHC II bright, lineage marker negative) varied from
93% to 99%. Freshly isolated dendritic cells have the appearance of
medium sized lymphocytes. During a two days incubation with GMCSF,
the cells gain the specific characteristics of dendritic cells.
Morphologically, they enlarge and exhibit sheet like cell
processes. They express low levels of the co-stimulatory molecules
CD54 (ICAM-1, adhesion molecule), CD80 (B7-1), CD86 (B7-2) and
CD40.
Example 2
CpG Substitutes for GMCSF for DC Survival
Methods
[0126] Oligodeoxynucleotides Unmodified (phosphodiester) and
modified nuclease-resistant (phosphorothioate)
oligodeoxyribonucleotide were purchased from Operon Technologies
(Alameda, Calif.). The optimal motif recognized by human immune
cells is different from the optimal mouse motif. Based on other
studies in which we tested a large number of oligonucleotides for
their ability to activate human B-cells and NK-cells, we selected
particularly potent oligonucleotides as examples of a family of
active CpG-containing oligonucleotides for the use in the present
study. The CpG oligonucleotides used were: 2006 (24-mer), 5'-TCG
TCG TTT TGT CGT TTT GTC GTT-3' (SEQ ID NO: 84), completely
phosphorothioate-modified, and 2080 (20-mer), 5'-TCG TCG TTC CCC
CCC CCC CC-3' (SEQ ID NO: 94), unmodified phosphodiester. The
non-CpG control oligonucleotides used were: 2117 (24-mer), 5'-TQG
TQG TTT TGT QGT TTT GTQ GTT-3' (SEQ ID NO: 95), Q=5 methyl
cytosine, completely phosphorothioate-modified, and 2078 (20-mer),
5'-TGC TGC TTC CCC CCC CCC CC-3' (SEQ ID NO: 96), unmodified
phosphodiester. Oligonucleotides were diluted in TE (10 mM
Tris-HCl, 1 mM EDTA, pH 8) using pyrogen-free reagents.
Phosphorothioate oligonucleotides (2006 and 2117) were added at a
final concentration of either 2 .mu.g/ml or 6 .mu.g/ml as
indicated. Based on preliminary experiments in which no effect was
seen after a single addition, phosphodiester oligonucleotides were
added at 0 hours, 12 hours and 24 hours at 30 .mu.g/ml each (total
addition 90 .mu.g/ml).
[0127] Flow cytometry Flow cytometric data on 2500 viable cells per
sample or 4000 total counts were acquired on a FACScan (Beckton
Dickinson Immunocytometry systems, San Jose, Calif.). Spectral
overlap was corrected by appropriate compensation. Fluorescence
detector settings were identical in all experiments. Analysis was
performed on viable dendritic cells present within a morphologic
gate (FSC, SSC, >94% of cells MHC II positive and lineage marker
negative). Data were analyzed using the computer program FlowJo
(version 2.5.1, Tree Star, Inc., Stanford, Calif.).
Results
[0128] The presence of GMCSF is required for the survival of
freshly isolated DC from peripheral blood. In the absence of GMCSF,
DC undergo apoptosis during the first two days of cell culture. We
examined the effect of CpG oligonucleotides on survival of DC in
cell culture. Freshly isolated DC were incubated in the presence of
GM-CSF or oligonucleotides for 48 hours. Light microscopy showed
the formation of cell clusters within one day for both the sample
with GMCSF alone and the sample with the CpG phosphorothioate
oligonucleotide 2006. While the size of the clusters was not
different between these two samples, the DC incubated with 2006
displayed longer processes seen at the surface of the clusters,
resembling the morphology of mature dendritic cells. This
difference was distinctive between GMCSF and 2006 samples by using
light microscopy. Without GMCSF or CpG, no clusters could be found
but there was an increasing number of non-viable cells as revealed
by trypan blue staining. Viability of DC was quantified by flow
cytometry (FIG. 1). Cell survival was dramatically improved in the
presence of CpG motifs. This effect was found to be CpG specific
for both phosphorothioate (2006, 2117) and phosphodiester (2080,
2078) oligonucleotides, since both non-CpG control oligonucleotides
(2117: methylated version of 2006; 2078: CpGs in 2080 inverted to
GpCs) showed no improved survival compared to the sample with cells
only. While for the nuclease resistant phosphorothioate
oligonucleotides a single addition of 2 .mu.g/ml was sufficient,
the phosphodiester oligonucleotides were added repeatedly in a
higher concentration (30 .mu.g/ml at 0 hours, 12 hours and 24
hours).
[0129] Quantification of viability (percentage of viable cells of
all counted events in flow cytometry) revealed that a single
addition of 2006 (2 .mu.g/ml) to freshly prepared DC was superior
to GMCSF (800 U/ml) in promoting cell survival (74.3+-5.2% vs.
57.1+-2.3%) (FIG. 2). The combination of GMCSF and 2006 further
increased the number of viable cells (81.0+-6.7%). In the presence
of the control oligonucleotide 2117 (2 .mu.g/ml) cell survival was
low and comparable to the sample with cells only (10.8+-5.2% and
7.4+-4.2%). These results show that CpG can substitute for GMCSF
for promoting DC survival, and that the combination of both is
favorable over each of them alone.
Example 3
Increased Size and Granularity of DC Induced by CpG is Associated
with Enhanced Expression of MHC II
Methods
[0130] Surface antigen staining At the indicated time points, cells
were harvested and surface antigen staining was performed as
previously described. Monoclonal antibodies to HLA-DR (Immu-357),
CD80 (MAB104) and to CD83 (HB15A) were purchased from Immunotech,
Marseille, France. All other antibodies were purchased from
Pharmingen, San Diego, Calif.: mABs to CD1a (HI149), CD3 (UCHT1),
CD14 (M5E2), CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 (2331
(FUN-1)). FITC-labeled IgG.sub.1, .kappa. (MOPC-21) and PE-labeled
IgG.sub.2b, .kappa. (27-35) were used to control for specific
staining.
Results
[0131] Flow cytometric analysis suggested that differentiation of
DC is enhanced by CpG and is associated with an increase of cell
size (FSC) and granularity (SSC) (FIG. 1). The surface expression
of MHC II is known to be positively correlated with differentiation
of DC. DC isolated from peripheral blood were cultured in the
presence of GMCSF and oligonucleotides for 48 hours, stained for
HLA-DR (MHC II) and examined by flow cytometry (2500 viable cells
counted) (FIG. 3). In the sample with cells only or the non-CpG
oligonucleotide (2078), a large immature population with low
granularity (SSC) and lower MHC II expression was found (FIG. 3
region A). A small population showed high SSC and high expression
of MHC II representing differentiated DC (FIG. 3, region B). The
addition of either GMCSF or the CpG oligonucleotide 2080 enhanced
both granularity and MHC II expression on a per cell basis (FIG. 3
left two panels). The CpG oligonucleotide 2080 showed a superior
effect compared to GMCSF indicating that CpG promotes
differentiation of DC in addition to an enhancement of cell
survival.
Example 4
CpG Increases Co-Stimulatory Molecules on DC
Methods
[0132] Detection of endotoxin The activity of LPS is standardized
by the FDA using the limulus amebocyte lysate (LAL) assay (EU/ml).
The lower detection limit of the LAL-assay in our hands was 0.03
EU/ml (LAL-assay BioWhittaker, Walkersville, Md.). The LPS sample
used in our studies (from salmonella typhimurium, Sigma Chemical
Co., St. Louis, Mo.) had an activity of 4.35 ng/EU. No endotoxin
could be detected in the oligonucleotides (<0.075 EU/mg).
Results
[0133] Differentiation of DC by the criteria of morphology and MHC
II expression is not sufficient for the induction of a specific
immune response by DC. Functional activation of DC requires by the
expression of co-stimulatory molecules. We examined the effect of
CpG on the expression of the intercellular adhesion molecule-1
(ICAM-1, CD54), and the co-stimulatory surface molecules B7-2
(CD86) and CD40. First, we were interested if an enhanced
expression of MHC II on DC (differentiation) was correlated to
activation reflected by CD54 expression. No positive correlation
could be found confirming that differentiation is not necessarily
associated with activation of DC (FIG. 4). The expression of the
co-stimulatory molecules CD54 (FIG. 5, panel A), CD86 (FIG. 5,
panel B) and CD40 (FIG. 5, panel C) was quantified in flow
cytometry by the mean fluorescence intensity (MFI) of viable DC. In
all experiments, CpG was superior to GM-CSF in enhancing expression
of co-stimulatory molecules. Compared to the cells only sample, the
CpG oligonucleotide 2006 enhanced the expression of CD54 (25.0+-5.7
vs. 7.0+-1.8; p=0.02, n=5), CD 86 (3.9+-0.8 vs. 1.6+-0.3; p=0.01;
n=5) and CD40 (3.5+-1.0 vs. 0.9+-0.1; p=0.04, n=4). The combination
of GMCSF and 2006 showed an additive effect for CD54 (38.5+-7.9;
p=0.03; n=5), and enhanced the expression of CD86 and CD40
synergistically (CD86: 7.0+-1.6; p=0.01; n=5; CD40: 8.5+-1.0;
p<0.01; n=4).
[0134] Specificity was tested using 2117 (methylated version of
2006) and 2078 (GpC version of 2080). As shown in FIG. 6 for CD40,
the non-CpG oligonucleotide 2117 showed no synergistic enhancement
of CD40 expression when combined with GM-CSF (FIG. 6 panel A). The
non-CpG oligonucleotide 2078 alone did not induce CD40 compared to
cells only (FIG. 6 B). Induction of CD86 (FIG. 7 panel A) and CD54
(FIG. 7 panel B) was also found to be CpG specific.
[0135] Interestingly, LPS (10 ng/ml) showed no or only slight
activation of DC isolated from peripheral blood (FIG. 6 and FIG.
7). This is surprising, since a ten-fold less concentration of LPS
(1 ng/ml) stimulates human CD14-positive monocytes to express CD54
and CD86, and to produce the proinflammatory cytokines TNF and
IL-6. TNF synthesis of monocytes can be found for LPS
concentrations as low as 10 pg/ml, and 1 ng/ml already induces the
maximal response in terms of cytokine production. Monocyte-derived
DC are highly sensitive to LPS but do not respond to CpG suggesting
major functional differences between monocyte-derived DC and DC
isolated from peripheral blood (FIG. 8).
Example 5
CpG Induces Maturation (CD83 Expression) of DC
Results
[0136] Mature human DC express the specific DC marker CD83, while
immature DC do not. Mature DC effectively present antigen and
maintain their stimulatory capacity while migrating from peripheral
tissues to lymph nodes. Maturation of DC is thought to be essential
if these cells are intended to be used for therapeutic strategies
where they would be activated ex vivo, pulsed with antigens, and
then reinfused into a patient. We looked at simultaneous expression
of CD83 and the co-stimulatory molecule CD86 on viable DC (FIG. 9).
Freshly isolated DC were incubated for 3 days with GMCSF, LPS or
oligonucleotides. In the absence of either GMCSF or CpG, or with
the methylated control oligonucleotide 2117 (2 .mu.g/ml), survival
of cells was poor. The remaining viable cells did not express CD83
(<2%) or CD86 (FIG. 9, right dot plot, middle row). Cells
incubated with GMCSF showed low expression of CD86, and only 4.1%
of the cells expressed CD83 (FIG. 9, left dot plot, lower row). If
LPS (10 ng/ml) is present in addition to GMCSF, the percentage of
CD83 positive cells is increased to 8.6% (FIG. 9, right dot plot,
lower row). In contrast, the single addition of 2006 (2 .mu.g/ml)
renders 16% of the DC CD83 positive (FIG. 9, left dot plot, middle
row). The combination of GM-CSF and 2006 even enhances CD83
expression synergistically (37%) (FIG. 9, left dot plot, upper
row). This induction of CD83 expression was CpG specific as shown
by the control oligonucleotide 2117 in combination with GM-CSF
(9.7%) (FIG. 9, right dot plot, upper row). Independently of the
percentage of CD83 positive cells, cells positive for CD83 also
expressed higher levels of CD86. The results of FIG. 9 are
representative of four independent experiments.
Example 6
Ultrastructural Changes of DC in Response to CpG
Results
[0137] We examined DC by electron microscopy to detect
ultrastructural differences due to CpG. In scanning electron
microscopy (FIG. 10), DC cultivated with either GM-CSF and CpG
(FIG. 10 A) or with CpG alone (FIG. 10 B) displayed a more
irregular shape, longer veil processes and sheet-like projections,
and more intercellular contacts than cells cultivated with GM-CSF
alone (FIG. 10 C) or in combination with the non-CpG control
oligonucleotide (FIG. 10 D). Transmission electron microscopic
imaging revealed striking differences between DC generated with
GMCSF combined with CpG (FIG. 11 A) and GMCSF alone (FIG. 11 B). DC
generated in the presence of CpG showed multilamellar
intracytoplasmic bodies of high density (FIG. 11 A, FIG. 12,
indicated by >), which are absent without CpG (FIG. 11 B). In
addition, CpG-generated DC showed prominent multivesicular bodies
(FIG. 11 A, FIG. 12, indicated by >>), and a less
heterochromatin in the nucleus. The functional significance of
these ultrastructural differences is unclear.
Statistical Analysis
[0138] Data were expressed as means+/-SEM. Statistical significance
of differences was determined by the unpaired two-tailed Student's
t-test. Differences were considered statistically significant for
p<0.05. Statistical analyses were performed by using StatView
4.51 software (Abacus Concepts Inc., Calabasas, Calif.).
TABLE-US-00002 TABLE 1 ODN Sequence (5' to 3') .uparw. 1 (SEQ ID
NO:1) GCTAGACGTTAGCGT 1a (SEQ ID NO:2) ......T........ 1b (SEQ ID
NO:3) ......Z........ 1c (SEQ ID NO:4) ............Z.. 1d (SEQ ID
NO:5) ..AT......GAGC. 2 (SEQ ID NO:6) ATGGAAGGTCCAGCGTTCTC 2a (SEQ
ID NO:7) ..C..CTC..G......... 2b (SEQ ID NO:8) ..Z..CTC..ZG......
2c (SEQ ID NO:9) ..Z..CTC..G......... 2d (SEQ ID NO:10)
..C..CTC..G......Z.. 2e (SEQ ID NO:11) ............A....... 3D (SEQ
ID NO:12) GAGAACGCTGGACCTTCCAT 3Da (SEQ ID NO:13)
.........C.......... 3Db SEQ ID NO:14) .........C.......G.. 3Dc
(SEQ ID NO:15) ...C.A.............. 3Dd (SEQ ID NO:16)
.....Z.............. 3De (SEQ ID NO:17) .............Z...... 3Df
(SEQ ID NO:18) .......A............ 3Dg (SEQ ID NO:19)
.........CC.G.ACTG.. 3M (SEQ ID NO:20) TCCATGTCGGTCCTGATGCT 3Ma
(SEQ ID NO:21) ......CT............ 3Mb (SEQ ID NO:22)
.......Z............ 3Mc (SEQ ID NO:23) ...........Z........ 3Md
(SEQ ID NO:24) ......A..T.......... 3Me (SEQ ID NO:25)
...............C..A. 4 (SEQ ID NO:26) TCAACGTT 4a (SEQ ID NO:27)
....GC.. 4b (SEQ ID NO:28) ...GCGC. 4c (SEQ ID NO:29) ...TCGA. 4d
(SEQ ID NO:30) ..TT..AA 4e (SEQ ID NO:31) -....... 4f (SEQ ID
NO:32) C....... 4g (SEQ ID NO:33) --......CT 4h (SEQ ID NO:34)
.......C
[0139] TABLE-US-00003 TABLE 2 5a SEQ ID NO:35 ATGGACTCTCCAGCGTTCTC
5b SEQ ID NO:11 .....AGG....A....... 5c SEQ ID NO:7
..C.......G......... 5d SEQ ID NO:36 ....AGG..C..T.......
.ltoreq.10 5e SEQ ID NO:37 ..C.......G..Z...... 5f SEQ ID NO:8
..Z......ZG..Z...... .ltoreq.10 5g SEQ ID NO:10
..C.......G......Z.. 5'GCATGACGTTGAGCT3', (SEQ ID NO:5)
5'GCTAGATGTTAGCGT3', (SEQ ID NO:2)
[0140] TABLE-US-00004 TABLE 3 512 SEQ ID NO:20 TCCATGTCGGTCCTGATGCT
1637 SEQ ID NO:38 ......C............. 1615 SEQ ID NO:39
......G............. 1614 SEQ ID NO:40 ......A............. 1636
SEQ ID NO:41 .........A.......... 1634 SEQ ID NO:42
.........C.......... 1619 SEQ ID NO:43 .........T.......... 1618
SEQ ID NO:24 ......A..T.......... 1639 SEQ ID NO:44
.....AA..T.......... 1707 SEQ ID NO:45 ......A..TC......... 1708
SEQ ID NO:46 .....CA..TG.........
[0141] TABLE-US-00005 TABLE 4 1585 ggGGTCAACGTTGAGggggg (SEQ ID
NO:47) 1629 --------------gtc------------- (SEQ ID NO:48) 1613
GCTAGACGTTAGTGT (SEQ ID NO:49) 1769 -------------Z-------------
(SEQ ID NO:50) 1619 TCCATGTCGTTCCTGATGCT (SEQ ID NO:43) 1765
--------------Z------------------- (SEQ ID NO:51)
[0142] TABLE-US-00006 TABLE 5 ODN Sequence (5'-3') SEQ ID NO: 1754
ACCATGGACGATCTGTTTCCCCTC 52 1758 TCTCCCAGCGTGCGCCAT 53 1761
TACCGCGTGCGACCCTCT 54 1776 ACCATGGACGAACTGTTTCCCCTC 55 1777
ACCATGGACGAGCTGTTTCCCCTC 56 1778 ACCATGGACGACCTGTTTCCCCTC 57 1779
ACCATGGACGTACTGTTTCCCCTC 58 1780 ACCATGGACGGTCTGTTTCCCCTC 59 1781
ACCATGGACGTTCTGTTTCCCCTC 60 1823 GCATGACGTTGAGCT 5 1824
CACGTTGAGGGGCAT 61 1825 CTGCTGAGACTGGAG 62 1828 TCAGCGTGCGCC 63
1829 ATGACGTTCCTGACGTT 64 1830.sup.2 RANDOM SEQUENCE -- 1834
TCTCCCAGCGGGCGCAT 65 1836 TCTCCCAGCGCGCGCCAT 66 1840
TCCATGTCGTTCCTGTCGTT 67 1841 TCCATAGCGTTCCTAGCGTT 68 1842
TCGTCGCTGTCTCCGCTTCTT 69 1851 TCCTGACGTTCCTGACGTT 70
[0143] TABLE-US-00007 TABLE 6 ODN.sup.1 Sequence (5'-3') SEQ ID NO:
1840 TCCATGTCGTTCCTGTCGTT 67 1960 TCCTGTCGTTCCTGTCGTT 71 1961
TCCATGTCGTTTTTGTCGTT 72 1962 TCCTGTCGTTCCTTGTCGTT 73 1963
TCCTTGTCGTTCCTGTCGTT 74 1965 TCCTGTCGTTTTTTGTCGTT 75 1966
TCGTCGCTGTCTCCGCTTCTT 69 1967 TCGTCGCTGTCTGCCCTTCTT 76 1968
TCGTCGCTGTTGTCGTTTCTT 77 1979.sup.2 TCCATGTZGTTCCTGTZGTT 78 1982
TCCAGGACTTCTCTCAGGTT 79 1990 TCCATGCGTGCGTGCGTTTT 80 1991
TCCATGCGTTGCGTTGCGTT 81 2002 TCCACGACGTTTTCGACGTT 82 2005
TCGTCGTTGTCGTTGTCGTT 83 2006 TCGTCGTTTTGTCGTTTTGTCGTT 84 2007
TCGTCGTTGTCGTTTTGTCGTT 85 2008 GCGTGCGTTGTCGTTGTCGTT 86 2010
GCGGCGGGCGGCGCGCGCCC 87 2012 TGTCGTTTGTCGTTTGTCGTT 88 2013
TGTCGTTGTCGTTGTCGTTGTCGTT 89 2014 TGTCGTTGTCGTTGTCGTT 90 2015
TCGTCGTCGTCGTT 91 2016 TGTCGTTGTCGTT 92 1841 TCCATAGCGTTCCTAGCGTT
68
[0144] TABLE-US-00008 TABLE 7 ODN.sup.1 Sequence (5'-3') SEQ ID NO:
1962 TCCTGTCGTTCCTTGTCGTT 73 1965 TCCTGTCGTTTTTTGTCGTT 75 1967
TCGTCGCTGTCTGCCCTTCTT 76 1968 TCGTCGCTGTTGTCGTTTCTT 77 2005
TCGTCGTTGTCGTTGTCGTT 83 2006 TCGTCGTTTTGTCGTTTTGTCGTT 84 2014
TGTCGTTGTCGTTGTCGTT 90 2015 TCGTCGTCGTCGTT 91 2016 TGTCGTTGTCGTT 92
1668 TCCATGACGTTCCTGATGCT 24 1758 TCTCCCAGCGTGCGCCAT 53
[0145] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
[0146] All references, patents and patent publications that are
recited in this application are incorporated in their entirety
herein by reference.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 99 <210>
SEQ ID NO 1 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 1 gctagacgtt agcgt 15 <210> SEQ ID NO 2
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE: 2
gctagatgtt agcgt 15 <210> SEQ ID NO 3 <211> LENGTH: 15
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: n = m5c <400> SEQUENCE: 3 gctagangtt agcgt 15
<210> SEQ ID NO 4 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: n = m5c
<400> SEQUENCE: 4 gctagacgtt agngt 15 <210> SEQ ID NO 5
<211> LENGTH: 15 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE: 5
gcatgacgtt gagct 15 <210> SEQ ID NO 6 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 6 atggaaggtc cagcgttctc 20
<210> SEQ ID NO 7 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 7 atcgactctc gagcgttctc 20 <210> SEQ ID
NO 8 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: n = m5c <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10)
<223> OTHER INFORMATION: n = m5c <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (14)..(14)
<223> OTHER INFORMATION: n = m5c <400> SEQUENCE: 8
atngactctn gagngttctc 20 <210> SEQ ID NO 9 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (3)..(3) <223>
OTHER INFORMATION: n = m5c <400> SEQUENCE: 9 atngactctc
gagcgttctc 20 <210> SEQ ID NO 10 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (18)..(18) <223> OTHER
INFORMATION: n = m5c <400> SEQUENCE: 10 atcgactctc gagcgttntc
20 <210> SEQ ID NO 11 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 11 atggaaggtc caacgttctc 20 <210> SEQ
ID NO 12 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
12 gagaacgctg gaccttccat 20 <210> SEQ ID NO 13 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 13 gagaacgctc
gaccttccat 20 <210> SEQ ID NO 14 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 14 gagaacgctc gaccttcgat 20
<210> SEQ ID NO 15 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 15 gagcaagctg gaccttccat 20 <210> SEQ
ID NO 16 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: n = m5c <400> SEQUENCE: 16
gagaangctg gaccttccat 20 <210> SEQ ID NO 17 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (14)..(14) <223>
OTHER INFORMATION: n = m5c <400> SEQUENCE: 17 gagaacgctg
gacnttccat 20 <210> SEQ ID NO 18 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 18 gagaacgatg gaccttccat 20
<210> SEQ ID NO 19 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 19 gagaacgctc cagcactgat 20 <210> SEQ
ID NO 20 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
20 tccatgtcgg tcctgatgct 20 <210> SEQ ID NO 21 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 21 tccatgctgg
tcctgatgct 20 <210> SEQ ID NO 22 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n = m5c <400> SEQUENCE: 22 tccatgtngg tcctgatgct
20 <210> SEQ ID NO 23 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (12)..(12) <223> OTHER INFORMATION: n = m5c
<400> SEQUENCE: 23 tccatgtcgg tnctgatgct 20 <210> SEQ
ID NO 24 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
24 tccatgacgt tcctgatgct 20 <210> SEQ ID NO 25 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 25 tccatgtcgg
tcctgctgat 20 <210> SEQ ID NO 26 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 26 tcaacgtt 8 <210> SEQ
ID NO 27 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
27 tcaagctt 8 <210> SEQ ID NO 28 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 28 tcagcgct 8 <210> SEQ
ID NO 29 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
29 tcatcgat 8 <210> SEQ ID NO 30 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 30 tcttcgaa 8 <210> SEQ
ID NO 31 <211> LENGTH: 7 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
31 caacgtt 7 <210> SEQ ID NO 32 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 32 ccaacgtt 8 <210> SEQ
ID NO 33 <211> LENGTH: 8 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
33 aacgttct 8 <210> SEQ ID NO 34 <211> LENGTH: 8
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 34 tcaacgtc 8 <210> SEQ
ID NO 35 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
35 atggactctc cagcgttctc 20 <210> SEQ ID NO 36 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 36 atggaggctc
catcgttctc 20 <210> SEQ ID NO 37 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (14)..(14) <223> OTHER
INFORMATION: n = m5c <400> SEQUENCE: 37 atcgactctc gagngttctc
20 <210> SEQ ID NO 38
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE: 38
tccatgccgg tcctgatgct 20 <210> SEQ ID NO 39 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 39 tccatggcgg
tcctgatgct 20 <210> SEQ ID NO 40 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 40 tccatgacgg tcctgatgct 20
<210> SEQ ID NO 41 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 41 tccatgtcga tcctgatgct 20 <210> SEQ
ID NO 42 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
42 tccatgtcgc tcctgatgct 20 <210> SEQ ID NO 43 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 43 tccatgtcgt
tcctgatgct 20 <210> SEQ ID NO 44 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 44 tccataacgt tcctgatgct 20
<210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 45 tccatgacgt ccctgatgct 20 <210> SEQ
ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
46 tccatcacgt gcctgatgct 20 <210> SEQ ID NO 47 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 47 ggggtcaacg
ttgagggggg 20 <210> SEQ ID NO 48 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 48 ggggtcagtc ttgagggggg 20
<210> SEQ ID NO 49 <211> LENGTH: 15 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 49 gctagacgtt agtgt 15 <210> SEQ ID NO
50 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: n = m5c <400> SEQUENCE: 50
gctagangtt agtgt 15 <210> SEQ ID NO 51 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (8)..(8) <223> OTHER
INFORMATION: n = m5c <400> SEQUENCE: 51 tccatgtngt tcctgatgct
20 <210> SEQ ID NO 52 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 52 accatggacg atctgtttcc cctc 24 <210>
SEQ ID NO 53 <211> LENGTH: 18 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 53 tctcccagcg tgcgccat 18 <210> SEQ ID
NO 54 <211> LENGTH: 18 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
54 taccgcgtgc gaccctct 18 <210> SEQ ID NO 55 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 55 accatggacg
aactgtttcc cctc 24 <210> SEQ ID NO 56 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 56 accatggacg agctgtttcc cctc
24 <210> SEQ ID NO 57 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 57 accatggacg acctgtttcc cctc 24 <210>
SEQ ID NO 58 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 58 accatggacg tactgtttcc cctc
24 <210> SEQ ID NO 59 <211> LENGTH: 24 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 59 accatggacg gtctgtttcc cctc 24 <210>
SEQ ID NO 60 <211> LENGTH: 24 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 60 accatggacg ttctgtttcc cctc 24 <210>
SEQ ID NO 61 <211> LENGTH: 15 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 61 cacgttgagg ggcat 15 <210> SEQ ID NO
62 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
62 ctgctgagac tggag 15 <210> SEQ ID NO 63 <211> LENGTH:
12 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 63 tcagcgtgcg cc 12
<210> SEQ ID NO 64 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 64 atgacgttcc tgacgtt 17 <210> SEQ ID
NO 65 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
65 tctcccagcg ggcgcat 17 <210> SEQ ID NO 66 <211>
LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 66 tctcccagcg
cgcgccat 18 <210> SEQ ID NO 67 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 67 tccatgtcgt tcctgtcgtt 20
<210> SEQ ID NO 68 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 68 tccatagcgt tcctagcgtt 20 <210> SEQ
ID NO 69 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
69 tcgtcgctgt ctccgcttct t 21 <210> SEQ ID NO 70 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 70 tcctgacgtt
cctgacgtt 19 <210> SEQ ID NO 71 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 71 tcctgtcgtt cctgtcgtt 19
<210> SEQ ID NO 72 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 72 tccatgtcgt ttttgtcgtt 20 <210> SEQ
ID NO 73 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
73 tcctgtcgtt ccttgtcgtt 20 <210> SEQ ID NO 74 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 74 tccttgtcgt
tcctgtcgtt 20 <210> SEQ ID NO 75 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 75 tcctgtcgtt ttttgtcgtt 20
<210> SEQ ID NO 76 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 76 tcgtcgctgt ctgcccttct t 21 <210> SEQ
ID NO 77 <211> LENGTH: 21 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
77 tcgtcgctgt tgtcgtttct t 21 <210> SEQ ID NO 78 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)..(8) <223>
OTHER INFORMATION: n = m5c <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (17)..(17) <223>
OTHER INFORMATION: n = m5c
<400> SEQUENCE: 78 tccatgtngt tcctgtngtt 20 <210> SEQ
ID NO 79 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
79 tccaggactt ctctcaggtt 20 <210> SEQ ID NO 80 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 80 tccatgcgtg
cgtgcgtttt 20 <210> SEQ ID NO 81 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 81 tccatgcgtt gcgttgcgtt 20
<210> SEQ ID NO 82 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 82 tccacgacgt tttcgacgtt 20 <210> SEQ
ID NO 83 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
83 tcgtcgttgt cgttgtcgtt 20 <210> SEQ ID NO 84 <211>
LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 84 tcgtcgtttt
gtcgttttgt cgtt 24 <210> SEQ ID NO 85 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 85 tcgtcgttgt cgttttgtcg tt
22 <210> SEQ ID NO 86 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 86 gcgtgcgttg tcgttgtcgt t 21 <210> SEQ
ID NO 87 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
87 gcggcgggcg gcgcgcgccc 20 <210> SEQ ID NO 88 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 88 tgtcgtttgt
cgtttgtcgt t 21 <210> SEQ ID NO 89 <211> LENGTH: 25
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 89 tgtcgttgtc gttgtcgttg
tcgtt 25 <210> SEQ ID NO 90 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 90 tgtcgttgtc gttgtcgtt 19
<210> SEQ ID NO 91 <211> LENGTH: 14 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 91 tcgtcgtcgt cgtt 14 <210> SEQ ID NO
92 <211> LENGTH: 13 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <400> SEQUENCE:
92 tgtcgttgtc gtt 13 <210> SEQ ID NO 93 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 93 ctggtctttc tggttttttt ctgg
24 <210> SEQ ID NO 94 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 94 tcgtcgttcc cccccccccc 20 <210> SEQ
ID NO 95 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic Oligonucleotide <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(2)
<223> OTHER INFORMATION: n = m5c <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(5)
<223> OTHER INFORMATION: n = m5c <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (13)..(13)
<223> OTHER INFORMATION: n = m5c <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: n = m5c <400> SEQUENCE: 95
tngtngtttt gtngttttgt ngtt 24 <210> SEQ ID NO 96 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic Oligonucleotide <400> SEQUENCE: 96 tgctgcttcc
cccccccccc 20 <210> SEQ ID NO 97 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 97 tccatgacgt tcctgacgtt 20
<210> SEQ ID NO 98 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
Oligonucleotide <400> SEQUENCE: 98 tccatgagct tcctgagtct 20
<210> SEQ ID NO 99 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic Oligonucleotide
<400> SEQUENCE: 99 aaaatcaacg ttgaaaaaaa 20
* * * * *