U.S. patent application number 12/393866 was filed with the patent office on 2009-07-30 for immunostimulatory nucleic acids.
This patent application is currently assigned to University of Iowa Research Foundation. Invention is credited to Arthur M. Krieg, Christian Schetter, Jorg Vollmer.
Application Number | 20090191188 12/393866 |
Document ID | / |
Family ID | 27387805 |
Filed Date | 2009-07-30 |
United States Patent
Application |
20090191188 |
Kind Code |
A1 |
Krieg; Arthur M. ; et
al. |
July 30, 2009 |
IMMUNOSTIMULATORY NUCLEIC ACIDS
Abstract
The invention relates to immunostimulatory nucleic acid
compositions and methods of using the compositions. The T-rich
nucleic acids contain poly T sequences and/or have greater than 25%
T nucleotide residues. The TG nucleic acids have TG dinucleotides.
The C-rich nucleic acids have at least one poly-C region and/ore
greater than 50% c nucleotides. These immunostimulatory nucleic
acids function in a similar manner to nucleic acids containing CpG
motifs. The invention also encompasses preferred CpG nucleic
acids.
Inventors: |
Krieg; Arthur M.;
(Wellesley, MA) ; Schetter; Christian; (Hilden,
DE) ; Vollmer; Jorg; (Dusseldorf, DE) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, P.C.
600 ATLANTIC AVENUE
BOSTON
MA
02210-2206
US
|
Assignee: |
University of Iowa Research
Foundation
Iowa City
IA
Coley Pharmaceutical GmbH
Dusseldorf
|
Family ID: |
27387805 |
Appl. No.: |
12/393866 |
Filed: |
February 26, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09669187 |
Sep 25, 2000 |
|
|
|
12393866 |
|
|
|
|
60156113 |
Sep 25, 1999 |
|
|
|
60156135 |
Sep 27, 1999 |
|
|
|
60227436 |
Aug 23, 2000 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
424/184.1; 514/44R |
Current CPC
Class: |
A61P 31/12 20180101;
A61P 15/00 20180101; A61K 2039/55561 20130101; A61P 1/00 20180101;
A61P 25/00 20180101; A61K 31/7088 20130101; A61K 31/7105 20130101;
A61P 1/18 20180101; A61P 31/00 20180101; A61P 27/02 20180101; A61P
37/08 20180101; A61P 13/12 20180101; A61P 17/00 20180101; A61P
19/00 20180101; A61K 45/06 20130101; A61P 11/06 20180101; A61P
35/00 20180101; A61P 37/00 20180101; A61P 37/04 20180101; A61K
39/39 20130101; A61P 31/04 20180101; A61P 11/00 20180101; A61P 1/16
20180101; A61K 31/7125 20130101 |
Class at
Publication: |
424/130.1 ;
514/44; 424/184.1 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61K 39/395 20060101 A61K039/395; A61K 39/00 20060101
A61K039/00 |
Claims
1. A method of stimulating an immune response comprising
administering an immunostimulatory nucleic acid to a non-rodent
subject in an amount effective to induce an immune response in the
non-rodent subject, wherein the immunostimulatory nucleic acid is
greater than 60% T, contains a CpG dinucleotide, and is 8-100
nucleotides in length.
2. (canceled)
3. The method of claim 1, wherein the immunostimulatory nucleic
acid is a poly T nucleic acid comprising 5'TTTT3'.
4. The method of claim 3, wherein the poly T nucleic acid comprises
5'X.sub.1X.sub.2TTTTX.sub.3X.sub.43' wherein X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are nucleotides.
5. The method of claim 3, wherein the immunostimulatory nucleic
acid comprises a plurality of poly T nucleic acid motifs.
6. The method of claim 4, wherein X.sub.1X.sub.2 is TT.
7. The method of claim 4, wherein X.sub.3X.sub.4 is TT.
8-14. (canceled)
15. The method of claim 1, wherein the immunostimulatory nucleic
acid comprises a nucleotide composition of greater than 80% T.
16-17. (canceled)
18. The method of claim 1, wherein the immunostimulatory nucleic
acid has a nucleotide backbone which includes at least one backbone
modification.
19. The method of claim 18, wherein the backbone modification is a
phosphorothioate modification.
20. The method of claim 18, wherein the nucleotide backbone is
chimeric.
21. The method of claim 18, wherein the nucleotide backbone is
entirely modified.
22-33. (canceled)
34. The method of claim 1, wherein the immune response is a mucosal
immune response.
35. The method of claim 1, wherein the immune response is a
systemic immune response.
36. (canceled)
37. The method of claim 1, further comprising exposing the subject
to an antigen and wherein the immune response is an
antigen-specific immune response.
38-51. (canceled)
52. The method of claim 1, wherein the subject is a human.
53. (canceled)
54. The method of claim 1, further comprising administering an
antibody specific for a cell surface antigen, and wherein the
immune response results in antigen dependent cellular cytotoxicity
(ADCC).
55-75. (canceled)
76. The method of claim 1, wherein the immunostimulatory nucleic
acid is administered on a regular basis.
77. The method of claim 1, wherein the immune response is an innate
immune response.
78. A composition comprising a sustained release device including
an immunostimulatory nucleic acid, wherein the immunostimulatory
nucleic acid is free of unmethylated CpG motifs and is a T-rich
nucleic acid.
79. (canceled)
80. A composition of a nutritional supplement comprising an
immunostimulatory nucleic acid in a delivery device selected from
the group consisting of a capsule, a pill, and a sublingual tablet,
wherein the immunostimulatory nucleic acid is free of unmethylated
CpG motifs and is a T-rich nucleic acid.
81. (canceled)
82. A composition comprising an immunostimulatory nucleic acid and
an antigen, wherein the immunostimulatory nucleic acid is free of
unmethylated CpG motifs and is a T-rich nucleic acid.
83. A composition comprising an immunostimulatory nucleic acid and
another therapeutic agent selected from the group consisting of: an
anti-microbial agent, an anti-cancer agent, an asthma/allergy
medicament, wherein the immunostimulatory nucleic acid is free of
unmethylated CpG motifs and is a T-rich nucleic acid.
84-94. (canceled)
95. A pharmaceutical composition comprising an effective amount for
stimulating an immune response of an isolated the immunostimulatory
nucleic acid of claim 1, and a pharmaceutically acceptable
carrier.
96. A composition of matter, comprising the immunostimulatory
nucleic acid of claim 1, and a pharmaceutically acceptable
carrier.
97-101. (canceled)
102. A composition comprising an immunostimulatory nucleic acid
consisting essentially of: 5'M.sub.1TCGTCGTTM.sub.23' wherein at
least one of the Cs is unmethylated, wherein M.sub.1 is a nucleic
acid having at least one nucleotide, wherein M.sub.2 is a nucleic
acid having between 0 and 50 nucleotides, and wherein the
immunostimulatory nucleic acid has less than 100 nucleotides.
103. A pharmaceutical composition comprising an immunostimulatory
nucleic acid comprising: 5'TCGTCGTT3' wherein at least one of the
Cs is unmethylated, wherein the immunostimulatory nucleic acid has
less than 100 nucleotides and a phosphodiester backbone, and a
sustained release device.
104-106. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/669,187 filed Sep. 25, 2000, currently
pending, which claims priority under 35 U.S.C. .sctn. 119 to U.S.
Provisional Patent Application Nos. 60/156,113, filed Sep. 25,
1999, 60/156,135, filed Sep. 27, 1999, and 60/227,436, filed Aug.
23, 2000, the entire contents of all of which are hereby
incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to immunostimulatory
nucleic acids, compositions thereof and methods of using the
immunostimulatory nucleic acids.
BACKGROUND OF THE INVENTION
[0003] Bacterial DNA has immune stimulatory effects to activate B
cells and natural killer cells, but vertebrate DNA does not
(Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79:682-686;
Tokunaga, T., et al., 1984, JNCI 72:955-962; Messina, J. P., et
al., 1991, J. Immunol. 147:1759-1764; and reviewed in Krieg, 1998,
In: Applied Oligonucleotide Technology, C. A. Stein and A. M.
Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y., pp.
431-448). It is now understood that these immune stimulatory
effects of bacterial DNA are a result of the presence of
unmethylated CpG dinucleotides in particular base contexts (CpG
motifs), which are common in bacterial DNA, but methylated and
underrepresented in vertebrate DNA (Krieg et al, 1995 Nature
374:546-549; Krieg, 1999 Biochim. Biophys. Acta 93321:1-10). The
immune stimulatory effects of bacterial DNA can be mimicked with
synthetic oligodeoxynucleotides (ODN) containing these CpG motifs.
Such CpG ODN have highly stimulatory effects on human and murine
leukocytes, inducing B cell proliferation; cytokine and
immunoglobulin secretion; natural killer (NK) cell lytic activity
and IFN-.gamma. secretion; and activation of dendritic cells (DCs)
and other antigen presenting cells to express costimulatory
molecules and secrete cytokines, especially the Th1-like cytokines
that are important in promoting the development of Th1-like T cell
responses. These immune stimulatory effects of native
phosphodiester backbone CpG ODN are highly CpG specific in that the
effects are essentially abolished if the CpG motif is methylated,
changed to a GpC, or otherwise eliminated or altered (Krieg et al,
1995 Nature 374:546-549; Hartmann et al, 1999 Proc. Natl. Acad.
Sci. USA 96:9305-10). Phosphodiester CpG ODN can be formulated in
lipids, alum, or other types of vehicles with depot properties or
improved cell uptake in order to enhance the immune stimulatory
effects (Yamamoto et al, 1994 Microbiol. Immunol. 38:831-836;
Gramzinski et al, 1998 Mol. Med. 4:109-118).
[0004] In early studies, it was thought that the immune stimulatory
CpG motif followed the formula
purine-purine-CpG-pyrimidine-pyrimidine (Krieg et al, 1995 Nature
374:546-549; Pisetsky, 1996 J. Immunol. 156:421-423; Hacker et al.,
1998 EMBO J. 17:6230-6240; Lipford et al, 1998 Trends in Microbiol.
6:496-500). However, it is now clear that mouse lymphocytes respond
quite well to phosphodiester CpG motifs that do not follow this
"formula" (Yi et al., 1998 J. Immunol. 160:5898-5906) and the same
is true of human B cells and dendritic cells (Hartmann et al, 1999
Proc. Natl. Acad. Sci. USA 96:9305-10; Liang, 1996 J. Clin. Invest.
98:1119-1129).
[0005] Several past investigators have looked at whether the
nucleotide content of ODN may have effects independently of the
sequence of the ODN. Interestingly, antisense ODN have been found
to be generally enriched in the content of GG, CCC, CC, CAC, and CG
sequences, while having reduced frequency of TT or TCC nucleotide
sequences compared to what would be expected if base usage were
random (Smetsers et al., 1996 Antisense Nucleic Acid Drug Develop.
6:63-67). This raised the possibility that the over-represented
sequences may comprise preferred targeting elements for antisense
oligonucleotides or visa versa. One reason to avoid the use of
thymidine-rich ODN for antisense experiments is that degradation of
the ODN by nucleases present in cells releases free thymidine which
competes with .sup.3H-thymidine which is frequently used in
experiments to assess cell proliferation (Matson et al., 1992
Antisense Research and Development 2:325-330).
SUMMARY OF THE INVENTION
[0006] The present invention relates in part to pyrimidine rich
(Py-rich) and in some embodiments thymidine (T) rich
immunostimulatory nucleic acids which do not require the presence
of a CpG motif. The present invention also relates in part to the
discovery that nucleic acids which contain a TG dinucleotide motif
are also immunostimulatory. The invention is based in part on the
unexpected finding that nucleic acid sequences which do not contain
CpG motifs are immunostimulatory. It was discovered upon analysis
of the immune stimulation properties of many nucleic acid sequences
that these sequences may be Py-rich e.g., T-rich or that they may
contain TG motifs. It was also discovered that these sequences
preferentially activate non-rodent immune cells. The Py-rich and TG
sequences are only minimally immunostimulatory with respect to
rodent immune cells, compared to non-rodent immune cells. Thus, it
is possible according to the methods of the invention to induce an
immune response in a non-rodent subject by administering Py-rich or
TG immunostimulatory nucleic acids. The Py-rich and TG
immunostimulatory nucleic acids of the invention may optionally
include CpG motifs. These findings have important implications for
the clinical development of immunostimulatory CpG containing and
non-CpG containing nucleic acids.
[0007] In one aspect the invention is a pharmaceutical composition
comprising an effective amount for stimulating an immune response
of isolated Py-rich or TG immunostimulatory nucleic acids, and a
pharmaceutically acceptable carrier. In other aspects the invention
is a composition of matter, comprising an isolated Py-rich or TG
immunostimulatory nucleic acid. In other embodiments, the
immunostimulatory nucleic acid may be T-rich. In still other
embodiments, the immunostimulatory nucleic acid may be T-rich and
also have at least one TG motif.
[0008] Preferably the Py-rich nucleic acid is a T-rich nucleic
acid. In some embodiments the T-rich immunostimulatory nucleic acid
is a poly T nucleic acid comprising 5' TTTT 3'. In yet other
embodiments the poly T nucleic acid comprises 5' X.sub.1
X.sub.2TTTTX.sub.3 X.sub.4 3' wherein X.sub.1, X.sub.2, X.sub.3 and
X.sub.4 are nucleotides. In some embodiments X.sub.1X.sub.2 is TT
and/or X.sub.3X.sub.4 is TT. In other embodiments X.sub.1X.sub.2 is
selected from the group consisting of TA, TG, TC, AT, AA, AG, AC,
CT, CC, CA, CG, GT, GG, GA, and GC; and/or X.sub.3X.sub.4 is
selected from the group consisting of TA, TG, TC, AT, AA, AG, AC,
CT, CC, CA, CG, GT, GG, GA, and GC.
[0009] The T-rich immunostimulatory nucleic acid may have only a
single poly T motif or it may have a plurality of poly T nucleic
acid motifs. In some embodiments the T-rich immunostimulatory
nucleic acid comprises at least 2, at least 3, at least 4, at least
5, at least 6, at least 7, or at least 8 T motifs. In other
embodiments it comprises at least 2, at least 3, at least 4, at
least 5, at least 6, at least 7, or at least 8 CpG motifs. In
preferred embodiments the plurality of CpG motifs and poly T motifs
are interspersed.
[0010] In yet other embodiments at least one of the plurality of
poly T motifs comprises at least 3, at least 4, at least 5, at
least 6, at least 7, at least 8, or at least 9 contiguous T
nucleotide residues. In other embodiments the plurality of poly T
motifs is at least 3 motifs and wherein at least 3 motifs each
comprises at least 3 contiguous T nucleotide residues or the
plurality of poly T motifs is at least 4 motifs and wherein the at
least 4 motifs each comprises at least 3 contiguous T nucleotide
residues.
[0011] In some cases the T-rich immunostimulatory nucleic acid may
be free of poly T motifs but may rather comprise a nucleotide
composition of greater than 25% T. In other embodiments the T-rich
immunostimulatory nucleic acids have poly T motifs and also
comprise a nucleotide composition of greater than 25% T. In
preferred embodiments the T-rich immunostimulatory nucleic acid
comprises a nucleotide composition of greater than 35% T, greater
than 40% T, greater than 50% T, greater than 60% T, greater than
80% T, or greater than 90% T nucleotide residues. In important
embodiments, the nucleic acid is at least 50% T.
[0012] The T-rich and TG immunostimulatory nucleic acids can have
any length greater than 7 nucleotides, but in some embodiments can
be between 8 and 100 nucleotide residues in length. In preferred
embodiments the T-rich immunostimulatory nucleic acid comprises at
least 20 nucleotides, at least 24 nucleotides, at least 27,
nucleotides, or at least 30 nucleotides. In preferred embodiments,
the TG immunostimulatory nucleic acid is between 15 and 25
nucleotides in length. The T-rich and TG immunostimulatory nucleic
acids may be single stranded or double stranded.
[0013] In one preferred embodiment, the immunostimulatory nucleic
acid has a T-rich region located in the middle of its length (i.e.,
an approximately equal number of nucleotides flank the T-rich
region on the 5' and 3' ends).
[0014] The T rich nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226,
241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471,
479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852,
861, 867, 868, 882, 886, 905, 907, 908, and 910-913. In other
embodiments the T rich nucleic acids are sequence selected from the
group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208,
214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300,
305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407,
411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692,
693, 804, 862, 883, 884, 888, 890, and 891.
[0015] In other embodiments the Py-rich immunostimulatory nucleic
acid is a C-rich nucleic acid. An immunostimulatory C-rich nucleic
acid is a nucleic acid including at least one and preferably at
least 2 poly-C regions or which includes 50% or greater C
nucleotides.
[0016] The Py-rich and TG immunostimulatory nucleic acids may
include one or more CpG motifs. The motifs may be methylated or
unmethylated. In other embodiments the Py-rich and TG
immunostimulatory nucleic acids are free of one or more CpG
dinucleotides.
[0017] In other embodiments the Py-rich and TG immunostimulatory
nucleic acids also include poly-A, poly G, and/or poly C motifs. In
yet other embodiments the Py-rich or TG immunostimulatory nucleic
acid is free of two poly C sequences of at least 3 contiguous C
nucleotide residues or is free of two poly A sequences of at least
3 contiguous A nucleotide residues. In other embodiments the
Py-rich or TG immunostimulatory nucleic acid comprises a nucleotide
composition of greater than 25% C or greater than 25% A. In yet
other embodiments the Py-rich or TG immunostimulatory nucleic acid
is free of poly-C sequences, poly-G sequences or poly-A
sequences.
[0018] A poly G nucleic acid in some embodiments is selected from
the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276,
282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733,
768, 795, 796, 914-925, 928-931, 933-936, and 938. In other
embodiments the poly G nucleic acid includes a sequence selected
from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148,
173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475,
519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662,
725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937.
[0019] According to another aspect of the invention, the
immunostimulatory nucleic acids may be defined as those which
possess a TG motif, herein referred to as TG immunostimulatory
nucleic acids. The TG nucleic acid in one embodiment contains at
least one TG dinucleotide having a sequence including at least the
following formula: 5'N.sub.1X.sub.1TGX.sub.2N.sub.23'. In related
embodiments, N.sub.1 is a nucleic acid sequence composed of a
number of nucleotides ranging from (11-N.sub.2) to (21-N.sub.2) and
N.sub.2 is a nucleic acid sequence composed of a number of
nucleotides ranging from (11-N.sub.1) to (21-N.sub.1). In a
preferred embodiment, X.sub.2 is thymidine.
[0020] In other embodiments, the TG nucleic acid has at least the
following formula: 5' X.sub.1 X.sub.2TGX.sub.3 X.sub.4 3'. In yet
another embodiment, the TG nucleic acid comprises the following
sequence: 5'N.sub.1X.sub.1X.sub.2TGX.sub.3X.sub.4N.sub.23'. In a
related embodiment, N.sub.1 is a nucleic acid sequence composed of
a number of nucleotides ranging from (9-N.sub.2) to (19-N.sub.2)
and N.sub.2 is a nucleic acid sequence composed of a number of
nucleotides ranging from (9-N.sub.1) to (19-N.sub.1). In one
preferred embodiment, X.sub.3 is thymidine. X.sub.1X.sub.2 are
nucleotides which may be selected from the group consisting of GT,
GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X.sub.3X.sub.4 are
nucleotides which may be selected from the group consisting of TT,
CT, AT, AG, CG, TC, AC, CC, TA, AA, and CA. In some preferred
embodiments, X.sub.3 is a thymidine. In important embodiments,
X.sub.3X.sub.4 are nucleotides selected from the group consisting
of TT, TC, TA and TG. In other embodiments X.sub.1X.sub.2 are GA or
GT and X.sub.3X.sub.4 are TT. In yet other embodiments X.sub.1 or
X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are
pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or
both are pyrimidines. In one embodiment X.sub.2 is a T and X.sub.3
is a pyrimidine.
[0021] In one embodiment the 5' X.sub.1 X.sub.2TGX.sub.3 X.sub.4 3'
sequence of the TG nucleic acid or the entire length or some
fragment thereof of the TG nucleic acid is a non-palindromic
sequence, and in other embodiments it is a palindromic
sequence.
[0022] In some preferred embodiments, the TG nucleic acid is also
T-rich.
[0023] The Py-rich and TG immunostimulatory nucleic acids in some
embodiments have a nucleotide backbone which includes at least one
backbone modification, such as a phosphorothioate modification. The
nucleotide backbone may be chimeric, or preferably the nucleotide
backbone is entirely modified. In one preferred embodiment, the
immunostimulatory nucleic acid has a poly T motif and a
phosphorothioate backbone.
[0024] In another aspect the invention is a composition of an
immunostimulatory nucleic acid, in the form of a Py-rich or a TG
nucleic acid, and an antigen, wherein the nucleic acid is free of
unmethylated CpG motifs.
[0025] Another composition of the invention is a Py-rich or TG
immunostimulatory nucleic acid and an anti-microbial agent, wherein
the Py-rich or TG nucleic acid is free of unmethylated CpG motifs.
Preferably the anti-microbial agent is selected from the group
consisting of an anti-viral agent, an anti-parasitic agent, an
anti-bacterial agent and an anti-fungal agent.
[0026] A composition of a sustained release device including a
Py-rich and/or TG immunostimulatory nucleic acid, wherein the
Py-rich and/or TG nucleic acid is free of unmethylated CpG motifs,
is provided according to another aspect of the invention.
[0027] The invention also includes nutritional supplements of a
Py-rich or TG immunostimulatory nucleic acid in a delivery device
selected from the group consisting of a capsule, a pill, and a
sublingual tablet, wherein the Py-rich or TG nucleic acid is free
of unmethylated CpG motifs.
[0028] It should be understood that when it is useful to administer
a Py-rich e.g., poly T, T-rich, C-rich, or TG oligonucleotide and a
CpG oligonucleotide, it may also be desirable to co-administer a
Py-rich or a TG oligonucleotide together with a physically separate
CpG, Py-rich or TG oligonucleotide. Alternatively, the CpG, Py-rich
or TG motif may be present on the same contiguous nucleic acid as
the Py-rich or TG oligonucleotide. In yet a further embodiment, all
or some combination of Py-rich, TG and CpG nucleic acids may be
co-administered either on separate nucleic acids or in the same
nucleic acid molecule. By co-administer it is intended that the
nucleic acids be administered close enough in time to one another
to achieve a combined benefit of both oligonucleotides, preferably
more than the benefit achieved by administering each of the
oligonucleotides alone at the same dose.
[0029] CpG oligonucleotides have, in general, the formula
5'X.sub.1X.sub.2CGX.sub.3X.sub.43', wherein X.sub.1, X.sub.2,
X.sub.3 and X.sub.4 are nucleotides and wherein at least the C of
CpG is unmethylated. Preferred CpG oligonucleotides are 8-100
nucleotides in length and have modified back bones. Particular
structures are detailed in the published PCT applications, U.S.
applications and references cited herein, the disclosures of which
are incorporated herein in their entirety. In one embodiment, the
CpG oligonucleotide is free of poly T and TG motifs and is not
T-rich.
[0030] In other embodiments, the CpG oligonucleotide has a sequence
selected from the group consisting of SEQ ID NO: 1, 3, 4, 14-16,
18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87,
90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141,
146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214,
216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275,
277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312,
314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365,
367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404,
406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450,
453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488,
489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541,
543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611,
613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706,
708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761,
763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799,
804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859,
862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0031] In another embodiment, the Py-rich or TG oligonucleotide is
free of a CpG motifs. This embodiment of the invention also
involves pharmaceutical compositions and kits which contain both a
CpG oligonucleotide (which can be free of poly T and TG motifs and
not be T-rich) and a Py-rich and/or TG oligonucleotide physically
separate from the CpG oligonucleotide. The pharmaceutical
preparations are in effective amounts and typically include
pharmaceutically acceptable carriers, all as set forth in detail
herein with respect to Py-rich and TG oligonucleotides. The kits
include at least one container containing an oligonucleotide which
is a Py-rich or TG oligonucleotide (or some combination thereof).
The same container, or in other embodiments, a second container,
may contain an oligonucleotide with a CpG motif, which may be free
of Py-rich and/or TG motifs. The kit also contains instructions for
administering the oligonucleotides to a subject. The kits also may
include a container containing a solvent or a diluent.
[0032] In summary, as if fully recited herein, a CpG
oligonucleotide physically separate from the Py-rich or TG
oligonucleotide can be used together with the Py-rich or TG
oligonucleotides in the methods, compositions and products
described above.
[0033] The invention relates in other aspects to immunostimulatory
oligonucleotides which have chimeric backbones and which do not
require the presence of a CpG motif. The invention is based in part
on the discovery that nucleic acid sequences which did not contain
CpG motifs were immunostimulatory, and that those which have
chimeric backbones have unexpectedly enhanced immune stimulating
properties. Thus the invention in one aspect relates to a
composition of an oligonucleotide having a formula: 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3', wherein Y.sub.1 and Y.sub.2 are,
independent of one another, nucleic acid molecules having between 1
and 10 nucleotides, wherein Y.sub.1 includes at least one modified
internucleotide linkage and Y.sub.2 includes at least one modified
internucleotide linkage and wherein N.sub.1 and N.sub.2 are nucleic
acid molecules, each independent of one another, having between 0
and 5 nucleotides, but wherein N.sub.1ZN.sub.2 has at least 6
nucleotides in total and wherein the nucleotides of N.sub.1ZN.sub.2
have a phosphodiester backbone, and wherein Z is an
immunostimulatory nucleic acid motif but does not include a CG. In
one embodiment Z is a nucleic acid sequence selected from the group
consisting of TTTT, TG, and a sequence wherein at least 50% of the
bases of the sequence are Ts.
[0034] In some embodiments Y.sub.1 and/or Y.sub.2 have between 3
and 8 nucleotides. In other embodiments Y.sub.1 and/or Y.sub.2 are
comprised of at least three Gs, at least four Gs, least seven Gs,
or all Gs. In other embodiments Y.sub.1 and/or Y.sub.2 are selected
from the group consisting of TCGTCG, TCGTCGT, and TCGTCGTT (SEQ ID
NO:1145). In yet other embodiments Y.sub.1 and/or Y.sub.2 include
at least one, two, three, four, or five poly-A, poly-T, or poly-C
sequences.
[0035] The center nucleotides (N.sub.1ZN.sub.2) of the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 have phosphodiester internucleotide
linkages and Y.sub.1 and Y.sub.2 have at least one modified
internucleotide linkage. In some embodiments Y.sub.1 and/or Y.sub.2
have at least two modified internucleotide linkages. In other
embodiments Y.sub.1 and/or Y.sub.2 have between two and five
modified internucleotide linkages. In yet other embodiments Y.sub.1
has two modified internucleotide linkages and Y.sub.2 has five
modified internucleotide linkages or Y.sub.1 has five modified
internucleotide linkages and Y.sub.2 has two modified
internucleotide linkages. The modified internucleotide linkage, in
some embodiments is a phosphorothioate modified linkage, a
phosphorodithioate modified linkage or a p-ethoxy modified
linkage.
[0036] Portions of the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 may
optionally form a palindrome. Thus, in some embodiments the
nucleotides of N.sub.1ZN.sub.2 form a palindrome. In some
embodiments the palindrome is not a direct repeat. In yet other
embodiments the nucleotides of N.sub.1ZN.sub.2 do not form a
palindrome.
[0037] According to other embodiments N.sub.1ZN.sub.2 has a
sequence of nucleotides selected from the group consisting of
GATTTTATCGTC (SEQ ID NO: 1098); TCGATTTTTCGA (SEQ ID NO: 1099);
TCATTTTTATGA (SEQ ID NO: 1100); GTTTTTTACGAC (SEQ ID NO: 1101);
TCAATTTTTTGA (SEQ ID NO: 1102); ACGTTTTTACGT (SEQ ID NO: 1103);
TCGTTTTTACGA (SEQ ID NO: 1104); TCGATTTTTACGTCGA (SEQ ID NO: 1105);
AATTTTTTAACGTT (SEQ ID NO: 1106); TCGTTTTTTAACGA (SEQ ID NO: 1107);
ACGTTTTTTAACGT (SEQ ID NO: 1108); GATTTTTATCGTC (SEQ ID NO: 1109);
GACGATTTTTCGTC (SEQ ID NO: 1110); GATTTTAGCTCGTC (SEQ ID NO: 1111);
GATTTTTACGTC (SEQ ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113);
AACGATTTTTCGTT (SEQ ID NO: 1114); TCACTTTTGTGA (SEQ ID NO: 1115);
TCGTATTTTA (SEQ ID NO: 1116); ACTTTTGTACCGGT (SEQ ID NO: 1117);
TCGATTTTTCGACGTCGA (SEQ ID NO: 1118); ACGATTTTTCGT (SEQ ID NO:
1119); GATGATCGTC (SEQ ID NO: 1120); TCGATGTCGA (SEQ ID NO: 1121);
TCATGTATGA (SEQ ID NO: 1122); GTGTTACGAC (SEQ ID NO: 1123);
TCAATGTTGA (SEQ ID NO: 1124); ACGTGTACGT (SEQ ID NO: 1125);
TCGTGTACGA (SEQ ID NO: 1126); TCGATGTACGTCGA (SEQ ID NO: 1127);
AATGTTAACGTT (SEQ ID NO: 1128); TCGTGTTAACGA (SEQ ID NO: 1129);
ACGTGTTAACGT (SEQ ID NO: 1130); GATGTATCGTC (SEQ ID NO: 1131);
GACGATGTCGTC (SEQ ID NO: 1132); GATGAGCTCGTC (SEQ ID NO: 1133);
GATGTACGTC (SEQ ID NO: 1134); ATGATCGT (SEQ ID NO: 1135);
AACGATGTCGTT (SEQ ID NO: 1136); TCACTGGTGA (SEQ ID NO: 1137);
TCGTATGA (SEQ ID NO: 1138); ACTGGTACCGGT (SEQ ID NO: 1139);
TCGATGTCGACGTCGA (SEQ ID NO: 1140); and ACGATGTCGT (SEQ ID NO:
1141).
[0038] The composition may optionally include a pharmaceutical
carrier and/or be formulated in a delivery device. In some
embodiments the delivery device is selected from the group
consisting of cationic lipids, cell permeating proteins, and
sustained release devices. In one preferred embodiment the
sustained release device is a biodegradable polymer. In another
embodiment the sustained release device is a microparticle.
[0039] In another aspect the invention is a composition of an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, and an antigen.
[0040] Another composition of the invention is an immunostimulatory
oligonucleotide having the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2,
and an anti-microbial therapeutic agent. Preferably the
anti-microbial therapeutic agent is selected from the group
consisting of an anti-viral agent, an anti-parasitic agent, an
anti-bacterial agent, or an anti-fungal agent.
[0041] A composition of a sustained release device including an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, is provided according to another
aspect of the invention.
[0042] The invention also includes nutritional supplements of an
immunostimulatory oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2, in a delivery device selected from
the group consisting of a capsule, a sublingual tablet, and a
pill.
[0043] In another aspect the compositions described above also
include an immunostimulatory nucleic acid having an unmethylated CG
dinucleotide, a TG dinucleotide or a Py-rich sequence wherein the
immunostimulatory nucleic acid having an unmethylated CG
dinucleotide, a TG dinucleotide or a Py-rich sequence has a
different sequence than the oligonucleotide comprising 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3'.
[0044] In some embodiments the immunostimulatory nucleic acid
having an unmethylated CG dinucleotide, a TG dinucleotide or a
Py-rich sequence has a completely phosphodiester backbone and in
other embodiments the immunostimulatory nucleic acid having an
unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich
sequence has a modified backbone, which optionally may have
internucleotide linkages selected from the group consisting of
phosphorothioate, phosphorodithioate, and p-ethoxy.
[0045] In one embodiment immunostimulatory nucleic acid having an
unmethylated CG dinucleotide has a formula comprising: 5'
X.sub.1X.sub.2CGX.sub.3X.sub.4 31 wherein X.sub.1, X.sub.2, X.sub.3
and X.sub.4 are nucleotides. In other embodiments the
immunostimulatory nucleic acid sequence includes at least the
following formula: 5' TCNTX.sub.1X.sub.2CGX.sub.3X.sub.4 3' wherein
N is a nucleic acid sequence composed of from about 0-25
nucleotides, wherein at least one nucleotide has a modified
internucleotide linkage, and wherein the nucleic acid has less than
or equal to 100 nucleotides. According to some embodiments
X.sub.1X.sub.2 are nucleotides selected from the group consisting
of: GT, GG, GA and AA and X.sub.3X.sub.4 are nucleotides selected
from the group consisting of: TT, CT or GT. In a preferred
embodiment X.sub.1X.sub.2 are GA and X.sub.3X.sub.4 are TT.
[0046] In another embodiment the immunostimulatory nucleic acid
sequence having an unmethylated CG dinucleotide includes at least
one of the following sequences:
TABLE-US-00001 ATCGACTCTCGAGCGTTCTC; (SEQ ID No. 15)
TCCATGTCGGTCCTGCTGAT; (SEQ ID No. 32) TCCATGTCGGTZCTGATGCT; (SEQ ID
No. 31) ATCGACTCTCGAGCGTTZTC; (SEQ ID No. 18) TCCATGTCGGTCCTGATGCT;
(SEQ ID No. 28) GGGGGG; (SEQ ID No. 12) TCCATGACGGTCCTGATGCT; (SEQ
ID No. 35) TCCATGGCGGTCCTGATGCT; (SEQ ID No. 34)
TCCATGACGTTCCTGATGCT; (SEQ ID No. 7) TCCATGTCGTTCCTGATGCT; (SEQ ID
No. 38) GGGGTCAGTCTTGACGGGG; (SEQ ID No. 41) TCCATGTCGCTCCTGATGCT;
(SEQ ID No. 37) TCCATGTCGATCCTGATGCT; (SEQ ID No. 36)
TCCATGCCGGTCCTGATGCT; (SEQ ID No. 33) TCCATAACGTTCCTGATGCT; (SEQ ID
No. 3) TCCATGACGTTCCTGATGCT; (SEQ ID No. 7) TCCATGACGTCCCTGATGCT;
(SEQ ID No. 39) TCCATCACGTGCCTGATGCT; (SEQ ID No. 48)
TCCATGACGTTCCTGACGTT; (SEQ ID No. 10) ATGACGTTCCTGACGTT; (SEQ ID
No. 70) TCTCCCAGCGCGCGCCAT; (SEQ ID No. 72) TCCATGTCGTTCCTGTCGTT;
(SEQ ID No. 73) TCCATAGCGTTCCTAGCGTT; (SEQ ID No. 74)
TCCTGACGTTCCTGACGTT; (SEQ ID No. 76) TCCTGTCGTTCCTGTCGTT; (SEQ ID
No. 77) TCCTGTCGTTCCTTGTCGTT; (SEQ ID No. 52) TCCTTGTCGTTCCTGTCGTT;
(SEQ ID No. 121) TCCTGTCGTTTTTTGTCGTT; (SEQ ID No. 208)
TCGTCGCTGTTGTCGTTTCTT; (SEQ ID No. 120) TCCATGCGTTGCGTTGCGTT; (SEQ
ID No. 81) TCCACGACGTTTTCGACGTT; (SEQ ID No. 82)
TCGTCGTTGTCGTTGTCGTT; (SEQ ID No. 47) TCGTCGTTTTGTCGTTTTGTCGTT;
(SEQ ID No. 46) TCGTCGTTGTCGTTTTGTCGTT; (SEQ ID No. 49)
GCGTGCGTTGTCGTTGTCGTT; (SEQ ID No. 56) TGTCGTTTGTCGTTTGTCGTT; (SEQ
ID No. 48) TGTCGTTGTCGTTGTCGTTGTCGTT; (SEQ ID No. 84)
TGTCGTTGTCGTTGTCGTT; (SEQ ID No. 50) TCGTCGTCGTCGTT; (SEQ ID No.
51) and TGTCGTTGTCGTT. (SEQ ID No. 85)
In another embodiment the immunostimulatory nucleic acid having a
Py-rich or TG sequence is a nucleic acid as described above.
[0047] In another aspect the invention relates to pharmaceutical
compositions and kits which contain both an oligonucleotide having
the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 and a CpG oligonucleotide
(which optionally may be free of poly T and TG motifs and not be
Py-rich), a Py-rich and/or TG oligonucleotide physically separate
from the oligonucleotide having the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2. The pharmaceutical preparations are
in effective amounts and typically include pharmaceutically
acceptable carriers, all as set forth in detail herein. The kits
include at least one container containing an oligonucleotide having
the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2. The same container, or
in other embodiments, a second container, may contain an
oligonucleotide with a CpG motif, which optionally may be free of
Py-rich and/or TG motifs and/or a Py-rich or TG oligonucleotide (or
some combination thereof). The kit also contains instructions for
administering the oligonucleotides to a subject. The kits also may
include a container containing a solvent or a diluent.
[0048] In summary, as if fully recited herein, an oligonucleotide
having the formula Y.sub.1N.sub.1ZN.sub.2Y.sub.2 which is
physically separate from the CpG, Py-rich or TG oligonucleotide can
be used together with the CpG, Py-rich, TG oligonucleotides, in the
methods, compositions and products described herein.
[0049] In another aspect the invention relates to a pharmaceutical
composition including at least two oligonucleotides of the
invention, wherein the at least two oligonucleotides have different
sequences from one another and a pharmaceutically acceptable
carrier.
[0050] A vaccine formulation is provided according to another
aspect of the invention. The vaccine includes any of the
compositions of the invention in combination with an antigen.
[0051] According to another aspect of the invention a method of
stimulating an immune response is provided. The method involves
administering a Py-rich or a TG immunostimulatory nucleic acid to a
non-rodent subject in an amount effective to induce an immune
response in the non-rodent subject. Preferably the Py-rich or TG
immunostimulatory nucleic acid is administered orally, locally, in
a sustained release device, mucosally to a mucosal surface,
systemically, parenterally, or intramuscularly. When the Py-rich or
TG immunostimulatory nucleic acid is administered to the mucosal
surface it may be delivered in an amount effective for inducing a
mucosal immune response or a systemic immune response. In preferred
embodiments the mucosal surface is selected from the group
consisting of an oral, nasal, rectal, vaginal, and ocular
surface.
[0052] In some embodiments the method includes exposing the subject
to an antigen wherein the immune response is an antigen-specific
immune response. The antigen may be encoded by a nucleic acid
vector which can be delivered to the subject. In some embodiments
the antigen is selected from the group consisting of a tumor
antigen, a viral antigen, a bacterial antigen, a parasitic antigen
and a peptide antigen.
[0053] Py-rich and TG immunostimulatory nucleic acids are capable
of provoking a broad spectrum of immune response. For instance
these immunostimulatory nucleic acids can be used to redirect a Th2
to a Th1 immune response. Py-rich and TG nucleic acids may also be
used to activate an immune cell, such as a leukocyte, a dendritic
cell, and an NK cell. The activation can be performed in vivo, in
vitro, or ex vivo, i.e., by isolating an immune cell from the
subject, contacting the immune cell with an effective amount to
activate the immune cell of the Py-rich or TG immunostimulatory
nucleic acid and re-administering the activated immune cell to the
subject. In some embodiments the dendritic cell expresses a cancer
antigen. The dendritic cell can be exposed to the cancer antigen ex
vivo.
[0054] The immune response produced by Py-rich or TG nucleic acids
may also result in induction of cytokine production, e.g.,
production of IL-6, IL-12, IL-18 TNF, IFN-.alpha. and
IFN-.gamma..
[0055] In still another embodiment, the Py-rich and TG nucleic
acids are useful for treating cancer. The Py-rich and TG nucleic
acids are also useful according to other aspects of the invention
in preventing cancer (e.g., reducing a risk of developing cancer)
in a subject at risk of developing a cancer. The cancer may be
selected from the group consisting of biliary tract cancer, breast
cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial
cancer, gastric cancer, intraepithelial neoplasms, lymphomas, liver
cancer, lung cancer (e.g. small cell and non-small cell), melanoma,
neuroblastomas, oral cancer, ovarian cancer, pancreas cancer,
prostate cancer, rectal cancer, sarcomas, thyroid cancer, and renal
cancer, as well as other carcinomas and sarcomas. In some important
embodiments, the cancer is selected from the group consisting of
bone cancer, brain and CNS cancer, connective tissue cancer,
esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer,
oral cavity cancer, skin cancer, and testicular cancer.
[0056] Py-rich and TG nucleic acids may also be used for increasing
the responsiveness of a cancer cell to a cancer therapy (e.g., an
anti-cancer therapy), optionally when the Py-rich or TG
immunostimulatory nucleic acid is administered in conjunction with
an anti-cancer therapy. The anti-cancer therapy may be a
chemotherapy, a vaccine (e.g., an in vitro primed dendritic cell
vaccine or a cancer antigen vaccine) or an antibody based therapy.
This latter therapy may also involve administering an antibody
specific for a cell surface antigen of, for example, a cancer cell,
wherein the immune response results in antibody dependent cellular
cytotoxicity (ADCC). In one embodiment, the antibody may be
selected from the group consisting Rituxin, Herceptin, Quadramet,
Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN,
Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103,
3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2,
MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H,
GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior
egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab,
SMART ABL 364 Ab and ImmuRAIT-CEA.
[0057] Thus, according to some aspects of the invention, a subject
having cancer or at risk of having a cancer is administered an
immunostimulatory nucleic acid and an anti-cancer therapy. In some
embodiments, the anti-cancer therapy is selected from the group
consisting of a chemotherapeutic agent, an immunotherapeutic agent
and a cancer vaccine. The chemotherapeutic agent may be selected
from the group consisting of methotrexate, vincristine, adriamycin,
cisplatin, non-sugar containing chloroethylnitrosoureas,
5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine,
taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and
poliferposan, MMI270, BAY 12-9566, RAS farnesyl transferase
inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514,
LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan,
PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone,
Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340,
AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA
2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805,
DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD
32/Valrubicin, Metastron/strontium derivative,
Temodal/Temozolomide, Evacet/liposomal doxorubicin,
Yewtaxan/Placlitaxel, Taxol/Paclitaxel, Xeload/Capecitabine,
Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid,
SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609
(754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT
(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU
enhancer, Campto/Levamisole, Camptosar/Irinotecan,
Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel,
Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin,
Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU
79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal
doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine
seeds, CDK4 and CDK2 inhibitors, PARP inhibitors,
D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide,
Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD
9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane
Analog, nitrosoureas, alkylating agents such as melphelan and
cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate,
but it is not so limited.
[0058] The immunotherapeutic agent may be selected from the group
consisting of Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8,
BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03,
ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF,
Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE,
Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000,
LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS,
anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and
ImmuRAIT-CEA, but it is not so limited.
[0059] The cancer vaccine may be selected from the group consisting
of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma
vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex,
M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal
idiotypic vaccine, Melacine, peptide antigen vaccines,
toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vacine,
TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it is not so
limited.
[0060] In still another embodiment of the methods directed to
preventing or treating cancer, the subject may be further
administered interferon-.alpha..
[0061] The invention in other aspects relates to methods for
preventing disease in a subject. The method involves administering
to the subject a Py-rich or a TG immunostimulatory nucleic acid on
a regular basis to promote immune system responsiveness to prevent
disease in the subject. Examples of diseases or conditions sought
to be prevented using the prophylactic methods of the invention
include microbial infections (e.g., sexually transmitted diseases)
and anaphylactic shock from food allergies.
[0062] In other aspects, the invention is a method for inducing an
innate immune response by administering to the subject a Py-rich or
a TG immunostimulatory nucleic acid in an amount effective for
activating an innate immune response.
[0063] According to another aspect of the invention a method for
treating or preventing a viral or retroviral infection is provided.
The method involves administering to a subject having or at risk of
having a viral or retroviral infection, an effective amount for
treating or preventing the viral or retroviral infection of any of
the compositions of the invention. In some embodiments the virus is
caused by a hepatitis virus, HIV, hepatitis B, hepatitis C, herpes
virus, or papillomavirus.
[0064] A method for treating or preventing a bacterial infection is
provided according to another aspect of the invention. The method
involves administering to a subject having or at risk of having a
bacterial infection, an effective amount for treating or preventing
the bacterial infection of any of the compositions of the
invention. In one embodiment the bacterial infection is due to an
intracellular bacteria.
[0065] In another aspect the invention is a method for treating or
preventing a parasite infection by administering to a subject
having or at risk of having a parasite infection, an effective
amount for treating or preventing the parasite infection of any of
the compositions of the invention. In one embodiment the parasite
infection is due to an intracellular parasite. In another
embodiment the parasite infection is due to a non-helminthic
parasite.
[0066] In some embodiments the subject is a human and in other
embodiments the subject is a non-human vertebrate selected from the
group consisting of a dog, cat, horse, cow, pig, goat, fish,
monkey, chicken, and sheep.
[0067] In yet another aspect, the invention is a method for
treating or preventing asthma, by administering to a subject having
or at risk of having asthma, an effective amount for treating or
preventing the asthma of any of the compositions of the invention.
In one embodiment the asthma is allergic asthma.
[0068] In another aspect the invention relates to a method for
treating or preventing allergy. The method involves administering
to a subject having or at risk of having allergy, an effective
amount for treating or preventing the allergy of any of the
compositions of the invention.
[0069] A method for treating or preventing an immune deficiency is
provided according to another aspect of the invention. The method
involves administering to a subject having or at risk of an immune
deficiency, an effective amount for treating or preventing the
immune deficiency of any of the compositions of the invention.
[0070] In another aspect the invention relates to a method for
inducing a TH1 immune response by administering to a subject any of
the compositions of the invention in an effective amount to produce
a TH1 immune response.
[0071] In one embodiment the methods of the invention involve
administering an oligonucleotide of formula 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and an immunostimulatory nucleic
acid having an unmethylated CG dinucleotide a TG dinucleotide or a
T-rich sequence. In an embodiment the oligonucleotide comprising 5'
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' is administered separately from
the immunostimulatory nucleic acid. In some embodiments the
oligonucleotide comprising 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and
the immunostimulatory nucleic acid are administered on an
alternating weekly schedule and in other embodiments the
oligonucleotide comprising 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2 3' and
the immunostimulatory nucleic acid are administered on an
alternating biweekly schedule.
[0072] The invention provides in another aspect a composition,
comprising an immunostimulatory nucleic acid and an anti-cancer
therapy, formulated in a pharmaceutically-acceptable carrier and in
an effective amount to treat a cancer or to reduce the risk of
developing a cancer. In important embodiments, the
immunostimulatory nucleic acid is selected from the group
consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich
nucleic acid.
[0073] The invention further provides a kit comprising a first
container housing an immunostimulatory nucleic acid and at least
one other container (e.g., a second container) housing a an
anti-cancer therapy, and instructions for use. In one embodiment,
the kit further comprises interferon-.alpha., which may be
separately housed in yet another container (e.g., a third
container). In an important embodiment, the kit comprises a
sustained-release vehicle containing an immunostimulatory nucleic
acid, and at least one container housing an anti-cancer therapy,
and instructions for timing of administration of the anti-cancer
therapy. The immunostimulatory nucleic acid may be selected from
the group consisting of a Py-rich nucleic acid, a TG nucleic acid
and a CpG nucleic acid, wherein the CpG nucleic acid has a
nucleotide sequence comprising SEQ ID NO: 246.
[0074] The invention further provides a method for preventing or
treating asthma or allergy, comprising administering an
immunostimulatory nucleic acid and an asthma/allergy medicament in
an effective amount to treat or prevent the asthma or allergy. In
important embodiments, the immunostimulatory nucleic acid is
selected from the group consisting of a T-rich nucleic acid, a TG
nucleic acid and a C-rich nucleic acid.
[0075] In one embodiment the immunostimulatory nucleic acid is a
T-rich nucleic acid. In a related embodiment, the T-rich nucleic
acid has a nucleotide sequence selected from the group consisting
of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301,
304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497,
503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882,
886, 905, 907, 908, and 910-913. In other embodiments the T-rich
nucleic acids are sequence selected from the group consisting of
SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244,
246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343,
344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435,
443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884,
888, 890, and 891.
[0076] In yet a further related embodiment, the T-rich nucleic acid
is not a TG nucleic acid. In yet still another embodiment, the
T-rich nucleic acid is not a CpG nucleic acid.
[0077] In one embodiment, the immunostimulatory nucleic acid is a
TG nucleic acid. In a further related embodiment, the TG nucleic
acid is not a T-rich nucleic acid. In another related embodiment,
the TG nucleic acid is not a CpG nucleic acid.
[0078] In one embodiment, the immunostimulatory nucleic acid is a
CpG nucleic acid, wherein the CpG nucleic acid has a nucleotide
sequence comprising SEQ ID NO: 246.
[0079] In another embodiment, the asthma/allergy medicament is a
medicament selected from the group consisting of PDE-4 inhibitor,
Bronchodilator/beta-2 agonist, K+ channel opener, VLA-4 antagonist,
Neurokin antagonist, TXA2 synthesis inhibitor, Xanthanine,
Arachidonic acid antagonist, 5 lipoxygenase inhibitor, Thromboxin
A2 receptor antagonist, Thromboxane A2 antagonist, Inhibitor of
5-lipox activation protein, and Protease inhibitor, but is not so
limited. In some important embodiments, the asthma/allergy
medicament is a Bronchodilator/beta-2 agonist selected from the
group consisting of salmeterol, salbutamol, terbutaline,
D2522/formoterol, fenoterol, and orciprenaline.
[0080] In another embodiment, the asthma/allergy medicament is a
medicament selected from the group consisting of Anti-histamines
and Prostaglandin inducers. In one embodiment, the anti-histamine
is selected from the group consisting of loratidine, cetirizine,
buclizine, ceterizine analogues, fexofenadine, terfenadine,
desloratadine, norastemizole, epinastine, ebastine, ebastine,
astemizole, levocabastine, azelastine, tranilast, terfenadine,
mizolastine, betatastine, CS 560, and HSR 609. In another
embodiment, the Prostaglandin inducer is S-5751.
[0081] In yet another embodiment, the asthma/allergy medicament is
selected from the group consisting of Steroids and
Immunomodulators. The immunomodulators may be selected from the
group consisting of anti-inflammatory agents, leukotriene
antagonists, IL4 muteins, Soluble IL-4 receptors,
Immunosuppressants, anti-IL-4 antibodies, IL-4 antagonists,
anti-IL-5 antibodies, soluble IL-13 receptor-Fc fusion proteins,
anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4
inhibitors, and Downregulators of IgE, but are not so limited. In
one embodiment, the downregulator of IgE is an anti-IgE.
[0082] In another embodiment, the Steroid is selected from the
group consisting of beclomethasone, fluticasone, tramcinolone,
budesonide, and budesonide. In still a further embodiment, the
Immunosuppressant is a Tolerizing peptide vaccine.
[0083] In one embodiment, the immunostimulatory nucleic acid is
administered concurrently with the asthma/allergy medicament. In
another embodiment, the subject is an immunocompromised
subject.
[0084] The immunostimulatory nucleic acids to be administered to a
subject in the methods disclosed herein relating to the prevention
and treatment of asthma/allergy are as described for other method
aspects of the invention.
[0085] In another aspect, the invention provides a kit comprising a
first container housing an immunostimulatory nucleic acid, and at
least another container (e.g., a second container) housing an
asthma/allergy medicament, and instructions for use. The
immunostimulatory nucleic acid useful in the kit is as described
herein. In important embodiments, the immunostimulatory nucleic
acid is selected from the group consisting of a T-rich nucleic
acid, a TG nucleic acid and a C-rich nucleic acid. In another
important embodiment, the kit comprises a sustained-release vehicle
containing an immunostimulatory nucleic acid, and at least one
container housing an asthma/allergy medicament, and instructions
for timing of administration of the asthma/allergy medicament. The
asthma/allergy medicament may be selected from the group of
asthma/allergy medicaments described in the foregoing methods
directed towards the prevention or treatment of asthma/allergy.
[0086] In yet another aspect, the invention provides a composition,
comprising an immunostimulatory nucleic acid and an asthma/allergy
medicament, formulated in a pharmaceutically-acceptable carrier and
in an effective amount for preventing or treating an immune
response associated with exposure to a mediator of asthma or
allergy. The immunostimulatory nucleic acid may be selected from
the group of immunostimulatory nucleic acids described for the
foregoing methods and compositions. In important embodiments, the
immunostimulatory nucleic acid is selected from the group
consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich
nucleic acid. The asthma/allergy medicament may be selected from
the group consisting of asthma medicaments and allergy medicaments
as described in the foregoing methods and compositions.
[0087] In still a further aspect, the invention provides a
composition comprising an immunostimulatory nucleic acid selected
from the group consisting of SEQ ID NO: 95-136, SEQ ID NO: 138-152,
SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID
NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO:
414-420, SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: 959-1022,
SEQ ID NO: 1024-1093, and a pharmaceutically acceptable carrier.
Preferably the immunostimulatory nucleic acid is present in the
composition in an effective amount. In one embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
induce an immune response. In another embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
prevent or treat cancer. In yet a further embodiment, the
immunostimulatory nucleic acid is present in an effective amount to
prevent or treat asthma/allergy. The invention also provides kits
comprising any of the foregoing immunostimulatory nucleic acid
compositions, and instructions for use.
[0088] In another aspect the invention includes a composition of an
immunostimulatory nucleic acid consisting essentially of: 5'
M.sub.1TCGTCGTTM.sub.2 3' wherein at least one of the Cs is
unmethylated, wherein M.sub.1 is a nucleic acid having at least one
nucleotide, wherein M.sub.2 is a nucleic acid having between 0 and
50 nucleotides, and wherein the immunostimulatory nucleic acid has
less than 100 nucleotides.
[0089] In yet other aspects the invention relates to a
pharmaceutical composition of an immunostimulatory nucleic acid
comprising: 5' TCGTCGTT 3' wherein at least one of the Cs is
unmethylated, wherein the immunostimulatory nucleic acid has less
than 100 nucleotides and a phosphodiester backbone, and a sustained
release device. In some embodiments the sustained release device is
a microparticle. In other embodiments the composition includes an
antigen.
[0090] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0091] FIG. 1A is a histogram of the expression of CD86 (Y-axis) by
CD19+ cells following exposure of these cells to the
oligonucleotides shown on the X-axis at a concentration of 0.15
.mu.g/ml.
[0092] FIG. 1B is a table with the data from FIG. 1A.
[0093] FIG. 1C is a histogram of the expression of CD86 (Y-axis) by
CD19+ cells following exposure of these cells to the
oligonucleotides shown on the X-axis at a concentration of 0.30
.mu.g/ml.
[0094] FIG. 1D is a table with the data from FIG. 1C.
[0095] FIG. 2 is a graph comparing the abilities of ODN 2137, ODN
2177, ODN 2200 and ODN 2202 to stimulate B cell proliferation at
concentrations ranging from 0.2 .mu.g/ml to 20 .mu.g/ml.
[0096] FIG. 3 is a graph comparing the abilities of ODN 2188, ODN
2189, ODN 2190 and ODN 2182 to stimulate B cell proliferation at
concentrations ranging from 0.2 .mu.g/ml to 20 .mu.g/ml.
[0097] FIG. 4 is a bar graph depicting dose-dependent B cell
activation induced by non-CpG ODN. PBMC of a blood donor were
incubated with the indicated concentrations of ODNs 2006 (SEQ ID
NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 5126
(SEQ ID NO.: 1058) and 5162 (SEQ ID NO.: 1094) and stained with mAb
for CD19 (B cell marker) and CD86 (B cell activation marker, B7-2).
Expression was measured by flow cytometry.
[0098] FIG. 5 is a bar graph depicting stimulation of B cells by a
diverse set of non-CpG ODNs. PBMC of one representative donor were
stimulated by 0.4 .mu.g/ml, 1.0 .mu.g/ml or 10.0 .mu.g/ml of the
following ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913),
2194 (SEQ ID NO.: 911), 5162 (SEQ ID NO.: 1094), 5163 (SEQ ID NO.:
1095), 5168 (SEQ ID NO.: 1096) and 5169 (SEQ ID NO.: 1097) and
expression of the activation marker CD86 (B7-2) on CD19-positive B
cells was measured by flow cytometry.
[0099] FIG. 6 is a bar graph depicting B cell activation by non-CpG
ODNs 1982 and 2041. PBMC were incubated with the indicated
concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.:
225) and 2041 (SEQ ID NO.: 282) and B cell activation (expression
of the activation marker CD86) was measured by flow cytometry.
[0100] FIG. 7 is a bar graph depicting NK cells are activated by
non-CpG ODNs. PBMC were incubated with 6 .mu.g/ml of the following
ODNs: 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID
NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126
(SEQ ID NO.: 1058) and stained with mAb for CD3 (T cell marker),
CD56 (NK cell marker) and CD69 (early activation marker).
Expression of CD69 on CD56-positive NK cells was measured by flow
cytometry.
[0101] FIG. 8 is a bar graph depicting NK-mediated cytotoxicity is
enhanced by non-CpG ODN. NK-mediated lysis of K-562 target cells
was measured after over night incubation of PBMC with 6 .mu.g/ml of
the ODN 2006 (SEQ ID NO.: 246), 2194 (SEQ ID NO.: 911) and 5126
(SEQ ID NO.: 1058).
[0102] FIG. 9 is a bar graph depicting NKT cells can be activated
by non-CpG ODN. PBMC of one representative donor were incubated
with 6 .mu.g/ml ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358),
2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.:
911) and 5126 (SEQ ID NO.: 1058) for 24 h and activation of NKT
cells was measured by flow cytometry after staining of cells with
mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early
activation marker).
[0103] FIG. 10 is a bar graph depicting stimulation of monocytes by
different CpG and non-CpG ODN. PBMC were incubated with 6 .mu.g/ml
2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.:
886), 2178 (SEQ ID NO.: 428), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID
NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) and
stained for CD14 (monocyte marker) and CD80 (B7-1, activation
marker). Expression was measured by flow cytometry.
[0104] FIG. 11 is a bar graph depicting release of TNF.alpha. upon
culture of human cells with non-CpG ODN. PBMC were cultured for 24
h with or without 6 .mu.g/ml of the indicated ODNs or 1 .mu.g/ml
LPS as positive control and TNF.alpha. measured by ELISA.
[0105] FIG. 12 is a bar graph depicting release of IL-6 after
culture with non-CpG ODNs shows the same pattern as for TNF.alpha..
PBMC were cultured with the indicated ODNs (1.0 .mu.g/ml) and IL-6
was measured in the supernatants by ELISA.
DETAILED DESCRIPTION
[0106] The invention in one aspect involves the finding that
pyrimidine (Py) rich and preferably thymidine (T) rich nucleic
acids as well as nucleic acids that contain TG dinucleotide motifs
are effective in mediating immune stimulatory effects. It was known
in the prior art that CpG containing nucleic acids are therapeutic
and prophylactic compositions that stimulate the immune system to
treat cancer, infectious diseases, allergy, asthma and other
disorders and to help protect against opportunistic infections
following cancer chemotherapies. The strong yet balanced, cellular
and humoral immune responses that result from CpG stimulation
reflect the body's own natural defense system against invading
pathogens and cancerous cells. CpG sequences, while relatively rare
in human DNA are commonly found in the DNA of infectious organisms
such as bacteria. The human immune system has apparently evolved to
recognize CpG sequences as an early warning sign of infection, and
to initiate an immediate and powerful immune response against
invading pathogens without causing adverse reactions frequently
seen with other immune stimulatory agents. Thus CpG containing
nucleic acids, relying on this innate immune defense mechanism, can
utilize a unique and natural pathway for immune therapy. The
effects of CpG nucleic acids on immune modulation were discovered
by the inventor of the instant patent application and have been
described extensively in co-pending patent applications, such as
U.S. patent application Ser. Nos. 08/386,063, now U.S. Pat. No.
6,194,388, filed on 02/07/95 (and related PCT U.S. 95/01570);
08/738,652, now U.S. Pat. No. 6,207,646, filed on Oct. 30, 1996;
08/960,774, now U.S. Pat. No. 6,429,199, filed on Oct. 30, 1997
(and related PCT/U.S. 97/19791, WO 98/18810); 09/191,170 filed on
Nov. 13, 1998; 09/030,701, now U.S. Pat. No. 6,214,806, filed on
02/25/98 (and related PCT/U.S. 98/03678; 09/082,649, now U.S. Pat.
No. 6,339,068, filed on May 20, 1998 (and related PCT/U.S.
98/10408); 09/325,193, now U.S. Pat. No. 6,405,705, filed on Jun.
3, 1999 (and related PCT/U.S. 98/04703); 09/286,098, now U.S. Pat.
No. 6,218,371, filed on Apr. 2, 1999 (and related PCT/U.S.
99/07335); 09/306,281 filed on May 6, 1999 (and related PCT/U.S.
99/09863). The entire contents of each of these patents and patent
applications is hereby incorporated by reference.
[0107] The findings of the instant invention are applicable to all
of the above described uses of CpG containing nucleic acids as well
as any other known use for CpG nucleic acids. The invention
involves, in one aspect, the discovery that Py-rich and preferably
T-rich and TG nucleic acids have similar immune stimulatory
properties to CpG oligonucleotides regardless of whether a CpG
motif is present. Thus the invention is useful for any method for
stimulating the immune system using Py-rich or TG nucleic acids. It
was also discovered surprisingly according to the invention that
chimeric oligonucleotides which lack a CpG motif are immune
stimulatory and have many of the same prophylactic and therapeutic
activities as a CpG oligonucleotide.
[0108] A Py-rich nucleic acid is a T-rich or C-rich
immunostimulatory nucleic acid. In some embodiments T-rich nucleic
acids are preferred. A T-rich nucleic acid is a nucleic acid which
includes at least one poly T sequence and/or which has a nucleotide
composition of greater than 25% T nucleotide residues. A nucleic
acid having a poly-T sequence includes at least four Ts in a row,
such as 5'TTTT3'. Preferably the T-rich nucleic acid includes more
than one poly T sequence. In preferred embodiments the T-rich
nucleic acid may have 2, 3, 4, etc poly T sequences, such as
oligonucleotide #2006 (SEQ ID NO:246). One of the most highly
immunostimulatory T-rich oligonucleotides discovered according to
the invention is a nucleic acid composed entirely of T nucleotide
residues, e.g., oligonucleotide #2183 (SEQ ID NO:433). Other T-rich
nucleic acids according to the invention have a nucleotide
composition of greater than 25% T nucleotide residues, but do not
necessarily include a poly T sequence. In these T-rich nucleic
acids the T nucleotide resides may be separated from one another by
other types of nucleotide residues, i.e., G, C, and A. In some
embodiments the T-rich nucleic acids have a nucleotide composition
of greater than 35%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T
nucleotide residues and every integer % in between. Preferably the
T-rich nucleic acids have at least one poly T sequence and a
nucleotide composition of greater than 25% T nucleotide
residues.
[0109] It was discovered according to the invention that the T
content of an ODN has a dramatic effect on the immune stimulatory
effect of the ODN and that T-rich ODN can activate multiple human
immune cell types in the absence of any CpG motifs. An
oligonucleotide having a 3' poly-T region and 2 5'CGs e.g., ODN
2181 (SEQ ID NO:431) is highly immune stimulatory. An
oligonucleotide of similar length, ODN 2116 (SEQ ID NO:357) which
contains two CG dinucleotides at the 5' end and a poly-C region at
the 3' end was also immune stimulatory but to a lesser extent than
the T-rich oligonucleotide using standard experimental conditions.
Thus, although C and T have almost identical structures, their
effects on the immune properties of an ODN are varied. They both
are capable of inducing an immune response but to different
extents. Thus both T-rich and C-rich oligonucleotides are useful
according to the invention, but T-rich oligonucleotides are
preferred. Furthermore, if the T content of the ODN is reduced by
incorporating other bases such as G, A, or C, then the immune
stimulatory effects are reduced (ODN #2188 (SEQ ID NO:905), 2190
(SEQ ID NO:907), 2191 (SEQ ID NO:908), and 2193 (SEQ ID
NO:910)).
[0110] A C-rich nucleic acid is a nucleic acid molecule having at
least one or preferably at least two poly-C regions or which is
composed of at least 50% C nucleotides. A poly-C region is at least
four C residues in a row. Thus a poly-C region is encompassed by
the formula 5'CCCC 3'. In some embodiments it is preferred that the
poly-C region have the formula 5'CCCCCC 3'. Other C-rich nucleic
acids according to the invention have a nucleotide composition of
greater than 50% C nucleotide residues, but do not necessarily
include a poly C sequence. In these C-rich nucleic acids the C
nucleotide residues may be separated from one another by other
types of nucleotide residues, i.e., G, T, and A. In some
embodiments the C-rich nucleic acids have a nucleotide composition
of greater than 60%, 70%, 80%, 90%, and 99%, C nucleotide residues
and every integer % in between. Preferably the C-rich nucleic acids
have at least one poly C sequence and a nucleotide composition of
greater than 50% C nucleotide residues, and in some embodiments are
also T-rich.
[0111] As shown in the Examples, several ODN previously believed to
be non-immunostimulatory, including two ODNs SEQ ID NO.: 225 and
SEQ ID NO.: 282 previously described to be non-stimulatory and
mainly used as control ODNs (Takahashi, T., M. Nieda, Y. Koezuka,
A. Nicol, S. A. Porcelli, Y. Ishikawa, K. Tadokoro, H. Hirai, and
T. Juji. 2000. Analysis of human VA24+CD4+ NKT cells activated by
a-glycosylceramide-pulsed monocyte-derived dendritic cells. J.
Immunol. 164:4458) were found to be immunostimulatory. Our
experiments, demonstrated that these ODNs can stimulate B cells,
although at higher concentrations compared to CpG ODNs (FIG. 6). A
long Poly T ODN (30 mer) induced, at least in some experiments,
comparable strong activation of B cells to one of the strongest CpG
ODN activators of B cells. These experiments also revealed the
surprising finding that even Poly C ODNs can lead to stimulation of
B cells.
[0112] Immunostimulation by these ODNs, however, was not limited to
human B cells. Different experimental assays clearly demonstrated
in addition that monocytes, NK cells and even NKT cells can be
activated by such non-CpG ODNs (FIG. 7-10). In contrast to Poly T
and Poly C sequences, immunostimulation by Poly A sequences (at
least for monocytes, B and NK cells) was not achieved.
Interestingly it was found that the introduction of a CpG motif
into SEQ ID NO.: 225 enhanced the immunostimulatory activity
whereas the elongation with a Poly T stretch did not enhance
immunostimulation. This suggests that CpG and T-rich ODN may
operate through different mechanisms or pathways. It is also
possible that insertion of a poly-T motif into a different position
of SEQ ID NO.: 225 may result in a change in immunostimulatory
properties.
[0113] A "TG nucleic acid" or a "TG immunostimulatory nucleic acid"
as used herein is a nucleic acid containing at least one TpG
dinucleotide (thymidine-guanine dinucleotide sequence, i.e. "TG
DNA" or DNA containing a 5' thymidine followed by 3' guanosine and
linked by a phosphate bond) and activates a component of the immune
system.
[0114] In one embodiment the invention provides a TG nucleic acid
represented by at least the formula:
5'N.sub.1X.sub.1TGX.sub.2N.sub.23'
[0115] wherein X.sub.1 and X.sub.2 are nucleotides and N is any
nucleotide and N.sub.1 and N.sub.2 are nucleic acid sequences
composed of any number of N provided that the sum total of N.sub.1
and N.sub.2 is in the range of 11 to 21. As an example, if N.sub.1
is 5, then N.sub.2 may be 6 (leading to a total length for the
oligonucleotide of 15 nucleotides). The TG may be located anywhere
within the oligonucleotide stretch, including the 5' end, the
center and the 3' end. Thus, N.sub.1 may be zero through to 21,
inclusive, provided that N.sub.2 is appropriately chosen to give a
sum of N.sub.2 and N.sub.1 equal to 11 through to 21, inclusive.
Similarly, N.sub.2 may be zero through to 21, inclusive, provided
that the sum total of N.sub.1 and N.sub.2 equals 11 to 21,
inclusive. In some embodiments X.sub.1 is adenine, guanine, or
thymidine and X.sub.2 is cytosine, adenine, or thymidine. In one
preferred embodiment, X.sub.2 is thymidine. In other embodiments
X.sub.1 is cytosine and/or X.sub.2 is guanine. In other
embodiments, as discussed herein, the nucleic acid may encompass
other motifs, provided it is long enough to do so.
[0116] In other embodiments the TG nucleic acid is represented by
at least the formula:
5'N.sub.1X.sub.1X.sub.2TGX.sub.3X.sub.4N.sub.23'
[0117] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In some embodiments, X.sub.1X.sub.2 are nucleotides
selected from the group consisting of: GpT, GpG, GpA, ApA, ApT,
ApG, CpT, CpA, TpA and TpT; and X.sub.3X.sub.4 are nucleotides
selected from the group consisting of: TpT, CpT, ApT, ApG, TpC,
ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N.sub.1 and
N.sub.2 are nucleic acid sequences composed of any number of
nucleotides provide that the sum total of N.sub.1 and N.sub.2 is in
the range of 9 to 19. In some embodiments, X.sub.1X.sub.2 are GpA
or GpT and X.sub.3X.sub.4 are TpT. In other embodiments X.sub.1 or
X.sub.2 or both are purines and X.sub.3 or X.sub.4 or both are
pyrimidines or X.sub.1X.sub.2 are GpA and X.sub.3 or X.sub.4 or
both are pyrimidines. In one preferred embodiment, X.sub.3X.sub.4
are nucleotides selected from the group consisting of: TpT, TpC and
TpA.
[0118] The immunostimulatory nucleic acid may be any size (i.e.,
length) provided it is at least 4 nucleotides. In important
embodiments, the immunostimulatory nucleic acids have a length in
the range of between 6 and 100. In still other embodiments, the
length is in the range of between 8 and 35 nucleotides. Preferably,
the TG oligonucleotides range in size from 15 to 25
nucleotides.
[0119] The size (i.e., the number of nucleotide residues along the
length of the nucleic acid) of the immunostimulatory nucleic acid
may also contribute to the stimulatory activity of the nucleic
acid. It has been discovered, surprisingly that even for highly
immune stimulating immunostimulatory nucleic acids, the length of
the nucleic acid influences the extent of immunostimulation that
can be achieved. It has been demonstrated that increasing the
length of a T-rich nucleic acid up to 24 nucleotides causes
increased immune stimulation. The experiments presented in the
examples demonstrate that when the length of the T-rich nucleic
acid is increased from 18 to 27 nucleotides the ability of the
nucleic acid to stimulate an immune response is increased
significantly (compare ODN #2194, 2183, 2195, and 2196 decreasing
in size from 27-18 nucleotides). Increasing the length of the
nucleic acid up to 30 nucleotides had a dramatic impact on the
biological properties of the nucleic acid but increasing the length
beyond 30 nucleotides did not appear to further influence the
immune stimulatory effect (e.g., compare ODN 2179 to 2006).
[0120] It has been shown that TG nucleic acids ranging in length
from 15 to 25 nucleotides in length may exhibit an increased immune
stimulation. Thus, in one aspect, the invention provides an
oligonucleotide that is 15-27 nucleotides in length (i.e., an
oligonucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26 or 27 nucleotides in length) that may be a T-rich nucleic acid
or may be a TG nucleic acid, or may be both a T-rich and a TG
nucleic acid. In one embodiment, the oligonucleotide is not a
T-rich nucleic acid nor is it a TG nucleic acid. In other
embodiments, the oligonucleotide does not have a CG motif. The
invention similarly provides oligonucleotides that are 15-27
nucleotides in length, oligonucleotides that are 18-25 nucleotides
in length, oligonucleotides that are 20-23 nucleotides in length,
and oligonucleotides that are 23-25 nucleotides in length. Any of
the foregoing embodiments relating to oligonucleotides 15-27 in
length also relate to the oligonucleotides of these differing
lengths. The invention further embraces the use of any of these
foregoing oligonucleotides in the methods recited herein.
[0121] Although a maximal level of immune stimulation is achieved
with some T-rich nucleic acids when the nucleic acid is 24-30
nucleotide residues in length, as well as with some TG nucleic
acids that range from 15 to 25 nucleotides in length, shorter or
longer immunostimulatory nucleic acids can also be used according
to the methods of the invention. For facilitating uptake into cells
immunostimulatory nucleic acids preferably have a minimum length of
6 nucleotide residues. Nucleic acids of any size greater than 6
nucleotides (even many kb long) are capable of inducing an immune
response according to the invention if sufficient immunostimulatory
motifs are present, since larger nucleic acids are degraded inside
of cells. Preferably the immunostimulatory nucleic acids are in the
range of between 8 and 100 and in some embodiments T-rich
containing immunostimulatory nucleic acids are between 24 and 40
nucleotides in length and TG containing immunostimulatory nucleic
acids are between 15 and 25 nucleotides in length.
[0122] In one embodiment the T-rich nucleic acid is represented by
at least the formula:
5'X.sub.1X.sub.2TTTTX.sub.3X.sub.43'
[0123] wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are
nucleotides. In one embodiment X.sub.1X.sub.2 is TT and/or
X.sub.3X.sub.4 is TT. In another embodiment X.sub.1X.sub.2 are any
one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT,
CC, CA, GT, GG, GA, and GC; and X.sub.3X.sub.4 are any one of the
following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT,
GG, GA, and GC.
[0124] In some embodiments it is preferred that the
immunostimulatory nucleic acids do not contain poly-C(CCCC), or
poly-A (AAAA). In other embodiments it is preferred that the
immunostimulatory nucleic acid include poly-C, poly-A, poly-G
(GGGG) or multiple GGs. In particular poly-G or multiple GG motifs
have dramatic effects on some immunostimulatory nucleic acids. The
effect of these non-T sequences depends in part on the status of
the nucleic acid backbone. For instance, if the nucleic acid has a
phosphodiester backbone or a chimeric backbone the inclusion of
these sequences in the nucleic acid will only have minimal if any
effect on the biological activity of the nucleic acid. If the
backbone is completely phosphorothioate (or other phosphate
modification) or significantly phosphorothioate then the inclusion
of these sequences may have more influence on the biological
activity or the kinetics of the biological activity, causing a
decrease in potency of the T-rich and TG immunostimulatory nucleic
acids.
[0125] Although C-rich nucleic acids have been demonstrated to have
immune stimulating properties, insertion of Poly-C sequences into a
T-rich nucleic acid in a manner that would reduce the relative
proportion of T nucleotides in the nucleic acid can have a negative
impact on the nucleic acid. Although applicants are not bound by a
proposed mechanism, it is believed that the immune system has
developed a mechanism for distinguishing nucleic acids having
different nucleotide properties, possibly resulting from different
sets of binding proteins which recognize different sequences or
specific binding proteins which recognize all the immunostimulatory
sequences but with different affinities. In general nucleic acids
including unmethylated CpG motifs are the most immunostimulatory,
followed by T-rich nucleic acids, TG nucleic acids and C-rich
nucleic acids. This generalization, however, has many exceptions.
For instance a strong T-rich nucleic acid like SEQ ID NO.: 886 is
more immune stimulatory in some assays than some CpG containing
nucleic acids (e.g., a phosphorothioate CpG nucleic acid containing
a single CpG motif).
[0126] It has also been discovered that the addition of a poly-A
tail to an immunostimulatory nucleic acid can enhance the activity
of the nucleic acid. It was discovered that when a highly immune
stimulatory CpG nucleic acid (SEQ ID NO.: 246) was modified with
the addition of a poly-A tail (AAAAAA) or a poly-T tail (TTTTTT),
the resultant oligonucleotides increased in immune stimulatory
activity. The ability of the poly-A tail and the poly-T tail to
increase the immunostimulating properties of the oligonucleotide
was very similar. SEQ ID NO.: 246 is a T-rich oligonucleotide. It
is likely that if poly-A and poly-T tails are added to a nucleic
acid which is not T-rich, it would have a bigger impact on the
immune stimulating capability of the nucleic acid. Since the poly-T
tail was added to a nucleic acid that was already highly T-rich the
immune stimulating properties of the poly-T addition was diluted
somewhat, although not completely. This finding has important
implications for the use of poly-A regions. Thus in some
embodiments the immunostimulatory nucleic acids include a poly-A
region and in other embodiments they do not.
[0127] Some of the immunostimulatory nucleic acids of the invention
include one or more CG motifs. The presence of CG motifs in the
immunostimulatory nucleic acids also has an influence on the
biological activity of the nucleic acids. If the total length of an
immunostimulatory nucleic acid is 20 nucleotide residues or less,
then CpG motifs are important in determining the immune effect of
the nucleic acid, and methylation of these motifs reduces the
potency of the immune stimulatory effects of the nucleic acid. If
the length of the immunostimulatory nucleic acid is increased to
24, then the immune stimulatory effects of the nucleic acid become
less dependent on the CpG motifs, and are no longer abolished by
methylation of the CpG motifs or by their inversion to GC
dinucleotides, provided the other immune-stimulatory properties
described herein are present.
[0128] For example, ODN 2006 (SEQ ID NO:246) is a highly immune
stimulatory T-rich nucleic acid of 24 nucleotide residues in length
with four CpG dinucleotides. However, ODN 2117 (SEQ ID NO:358), in
which the CpG motifs are methylated is also highly immune
stimulatory. ODN 2137 (SEQ ID NO:886), in which the CpG motifs of
ODN 2006 are inverted to GpC, and which as a result possesses six
TG dinucleotides is also immune stimulatory. The immune stimulatory
effects of nucleic acids such as ODN 2117 and 2137 are regulated by
their T and TG content. Each of these three nucleic acids is T-rich
and ODN 2137 is additionally TG rich. If their T content is reduced
by inserting other bases such as A (ODN 2117 (SEQ ID NO:358)) or if
their TG content is reduced by substituting TG with AG, then the
immune stimulatory effects are somewhat reduced. In another
example, a nucleic acid 24 nucleotides in length in which all of
the positions are randomized has only a modest immune stimulatory
effect (ODN 2182 (SEQ ID NO:432)). Likewise, a nucleic acid 24
nucleotides in length with other nucleotide compositions have
variable immune stimulatory effects, depending on their T content
(ODN 2188 (SEQ ID NO:905), 2189 (SEQ ID NO:906), 2190 (SEQ ID
NO:907), 2191 (SEQ ID NO:908), 2193 (SEQ ID NO:910), 2183 (SEQ ID
NO:433), and 2178 (SEQ ID NO:428)). ODN 2190 which contains TGT
motifs is more immune stimulatory than ODN 2202 which possesses TGG
motifs. Thus, in some embodiments, TGT motifs are preferred. In
still other embodiments, the number of TG motifs is important in
that an increase in the number of TG motifs leads to an increase in
immune stimulation. Some preferred TG nucleic acids contain at
least three TG motifs.
[0129] Examples of CpG nucleic acids include but are not limited to
those listed in Table A, such as SEQ ID NO: 1, 3, 4, 14-16, 18-24,
28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91,
93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150,
152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220,
223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281,
286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317,
320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369,
373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426,
429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456,
460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492,
493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555,
564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617,
619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709,
711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763,
766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808,
810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865,
872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0130] In some embodiments of the invention the immunostimulatory
nucleic acids include CpG dinucleotides and in other embodiments
the immunostimulatory nucleic acids are free of CpG dinucleotides.
The CpG dinucleotides may be methylated or unmethylated. A nucleic
acid containing at least one unmethylated CpG dinucleotide is a
nucleic acid molecule which contains an unmethylated
cytosine-guanine dinucleotide sequence (i.e. "CpG DNA" or DNA
containing an unmethylated 5' cytosine followed by 3' guanosine and
linked by a phosphate bond) and activates the immune system. A
nucleic acid containing at least one methylated CpG dinucleotide is
a nucleic acid which contains a methylated cytosine-guanine
dinucleotide sequence (i.e., a methylated 5' cytosine followed by a
3' guanosine and linked by a phosphate bond).
[0131] Examples of T rich nucleic acids that are free of CpG
nucleic acids include but are not limited to those listed in Table
A, such as SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269,
282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486,
491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867,
868, 882, 886, 905, 907, 908, and 910-913. Examples of T rich
nucleic acids that include CpG nucleic acids include but are not
limited to those listed in Table A, such as SEQ ID NO: 64, 98, 112,
146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263,
265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374,
376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501,
518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[0132] The immunostimulatory nucleic acids can be double-stranded
or single-stranded. Generally, double-stranded molecules are more
stable in vivo, while single-stranded molecules have increased
immune activity. Thus in some aspects of the invention it is
preferred that the nucleic acid be single stranded and in other
aspects it is preferred that the nucleic acid be double
stranded.
[0133] The term T-rich nucleic acid and TG nucleic acid, as used
herein, refers to an immunostimulatory T-rich nucleic acid and an
immunostimulatory TG nucleic acid, respectively, unless otherwise
indicated. The T-rich nucleic acid sequences of the invention are
those broadly described above as well as the nucleic acids shown in
Table A that have at least one poly T motif and/or have a
composition of greater than 25% T or preferably 35% nucleotide
residues. The C-rich nucleic acids are those having at least one
and preferably at least two poly-C regions. The TG nucleic acids of
the invention are those broadly described above as well as the
specific nucleic acids shown in Table A that have at least one TG
motif.
[0134] The nucleic acids of the invention may, but need not, also
include a poly G motif. Poly G containing nucleic acids are also
immunostimulatory. A variety of references, including Pisetsky and
Reich, 1993 Mol. Biol. Reports, 18:217-221; Krieger and Herz, 1994,
Ann. Rev. Biochem., 63:601-637; Macaya et al., 1993, PNAS,
90:3745-3749; Wyatt et al., 1994, PNAS, 91:1356-1360; Rando and
Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed.
Krieg and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem.
116, 991-994 also describe the immunostimulatory properties of poly
G nucleic acids.
[0135] Poly G nucleic acids preferably are nucleic acids having the
following formulas:
5'X.sub.1X.sub.2GGGX.sub.3X.sub.43'
wherein X.sub.1, X.sub.2, X.sub.3, and X.sub.4 are nucleotides. In
preferred embodiments at least one of X.sub.3 and X.sub.4 are a G.
In other embodiments both of X.sub.3 and X.sub.4 are a G. In yet
other embodiments the preferred formula is 5' GGGNGGG 3', or 5'
GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides.
In other embodiments the poly G nucleic acid is free of
unmethylated CG dinucleotides, such as, for example, the nucleic
acids listed below as SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282,
288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768,
795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments
the poly G nucleic acid includes at least one unmethylated CG
dinucleotide, such as, for example, the nucleic acids listed above
as SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214,
224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527,
535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857,
876, 892, 909, 926, 927, 932, and 937.
[0136] The terms "nucleic acid" and "oligonucleotide" are used
interchangeably to mean multiple nucleotides (i.e. molecules
comprising a sugar (e.g. ribose or deoxyribose) linked to a
phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g. cytosine (C), thymidine (T)
or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides. The terms shall also include
polynucleosides (i.e. a polynucleotide minus the phosphate) and any
other organic base containing polymer. Nucleic acid molecules can
be obtained from existing nucleic acid sources (e.g., genomic or
cDNA), but are preferably synthetic (e.g. produced by nucleic acid
synthesis).
[0137] The terms nucleic acid and oligonucleotide also encompass
nucleic acids or oligonucleotides with substitutions or
modifications, such as in the bases and/or sugars. For example,
they include nucleic acids having backbone sugars which are
covalently attached to low molecular weight organic groups other
than a hydroxyl group at the 3' position and other than a phosphate
group at the 5' position. Thus modified nucleic acids may include a
2'-O-alkylated ribose group. In addition, modified nucleic acids
may include sugars such as arabinose instead of ribose. Thus the
nucleic acids may be heterogeneous in backbone composition thereby
containing any possible combination of polymer units linked
together such as peptide-nucleic acids (which have amino acid
backbone with nucleic acid bases). In some embodiments, the nucleic
acids are homogeneous in backbone composition. Nucleic acids also
include substituted purines and pyrimidines such as C-5 propyne
modified bases (Wagner et al., Nature Biotechnology 14:840-844,
1996). Purines and pyrimidines include but are not limited to
adenine, cytosine, guanine, thymidine, 5-methylcytosine,
2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine,
hypoxanthine, and other naturally and non-naturally occurring
nucleobases, substituted and unsubstituted aromatic moieties. Other
such modifications are well known to those of skill in the art.
[0138] For use in the instant invention, the nucleic acids of the
invention can be synthesized de novo using any of a number of
procedures well known in the art. For example, the b-cyanoethyl
phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., Tet.
Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et
al., Tet. Let. 27:4051-4054, 1986; Froehler et al., Nucl. Acid.
Res. 14:5399-5407, 1986,; Garegg et al., Tet. Let. 27:4055-4058,
1986, Gaffney et al., Tet. Let. 29:2619-2622, 1988). These
chemistries can be performed by a variety of automated nucleic acid
synthesizers available in the market. These nucleic acids are
referred to as synthetic nucleic acids. Alternatively, T-rich
and/or TG dinucleotides can be produced on a large scale in
plasmids, (see Sambrook, T., et al., "Molecular Cloning: A
Laboratory Manual", Cold Spring Harbor laboratory Press, New York,
1989) and separated into smaller pieces or administered whole.
Nucleic acids can be prepared from existing nucleic acid sequences
(e.g., genomic or cDNA) using known techniques, such as those
employing restriction enzymes, exonucleases or endonucleases.
Nucleic acids prepared in this manner are referred to as isolated
nucleic acid. An isolated nucleic acid generally refers to a
nucleic acid which is separated from components which it is
normally associated with in nature. As an example, an isolated
nucleic acid may be one which is separated from a cell, from a
nucleus, from mitochondria or from chromatin. The terms Py-rich
nucleic acids and TG nucleic acids encompasses both synthetic and
isolated Py-rich nucleic acids and TG nucleic acids.
[0139] For use in vivo, the Py-rich and TG nucleic acids may
optionally be relatively resistant to degradation (e.g., are
stabilized). A "stabilized nucleic acid molecule" shall mean a
nucleic acid molecule that is relatively resistant to in vivo
degradation (e.g. via an exo- or endo-nuclease). Stabilization can
be a function of length or secondary structure. Nucleic acids that
are tens to hundreds of kbs long are relatively resistant to in
vivo degradation. For shorter nucleic acids, secondary structure
can stabilize and increase their effect. For example, if the 3' end
of an nucleic acid has self-complementarity to an upstream region,
so that it can fold back and form a sort of stem loop structure,
then the nucleic acid becomes stabilized and therefore exhibits
more activity.
[0140] Alternatively, nucleic acid stabilization can be
accomplished via phosphate backbone modifications. Preferred
stabilized nucleic acids of the instant invention have a modified
backbone. It has been demonstrated that modification of the nucleic
acid backbone provides enhanced activity of the Py-rich and TG
nucleic acids when administered in vivo. These stabilized
structures are preferred because the Py-rich and TG molecules of
the invention have at least a partial modified backbone. Py-rich
and TG constructs having phosphorothioate linkages provide maximal
activity and protect the nucleic acid from degradation by
intracellular exo- and endo-nucleases. Other modified nucleic acids
include phosphodiester modified nucleic acids, combinations of
phosphodiester and phosphorothioate nucleic acid,
methylphosphonate, methylphosphorothioate, phosphorodithioate,
p-ethoxy, and combinations thereof. Each of these combinations and
their particular effects on immune cells is discussed in more
detail with respect to CpG nucleic acids in PCT Published Patent
Applications PCT/U.S. 95/01570 (WO 96/02555) and PCT/U.S. 97/19791
(WO 98/18810) claiming priority to U.S. Ser. Nos. 08/386,063, now
U.S. Pat. Nos. 6,194,388, and 08/960,774, now U.S. Pat. No.
6,239,116, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively,
the entire contents of which are hereby incorporated by reference.
It is believed that these modified nucleic acids may show more
stimulatory activity due to enhanced nuclease resistance, increased
cellular uptake, increased protein binding, and/or altered
intracellular localization.
[0141] The compositions of the invention may optionally be chimeric
oligonucleotides. The chimeric oligonucleotides are
oligonucleotides having a formula: 5' Y.sub.1N.sub.1ZN.sub.2Y.sub.2
3'. Y.sub.1 and Y.sub.2 are nucleic acid molecules having between 1
and 10 nucleotides. Y.sub.1 and Y.sub.2 each include at least one
modified internucleotide linkage. Since at least 2 nucleotides of
the chimeric oligonucleotides include backbone modifications these
nucleic acids are an example of one type of "stabilized
immunostimulatory nucleic acids."
[0142] With respect to the chimeric oligonucleotides, Y.sub.1 and
Y.sub.2 are considered independent of one another. This means that
each of Y.sub.1 and Y.sub.2 may or may not have different sequences
and different backbone linkages from one anther in the same
molecule. The sequences vary, but in some cases Y.sub.1 and Y.sub.2
have a poly-G sequence. A poly-G sequence refers to at least 3 Gs
in a row. In other embodiments the poly-G sequence refers to at
least 4, 5, 6, 7, or 8 Gs in a row. In other embodiments Y.sub.1
and Y.sub.2 may be TCGTCG, TCGTCGT, or TCGTCGTT (SEQ ID NO: 1145).
Y.sub.1 and Y.sub.2 may also have a poly-C, poly-T, or poly-A
sequence. In some embodiments Y.sub.1 and/or Y.sub.2 have between 3
and 8 nucleotides.
[0143] N.sub.1 and N.sub.2 are nucleic acid molecules having
between 0 and 5 nucleotides as long as N.sub.1ZN.sub.2 has at least
6 nucleotides in total. The nucleotides of N.sub.1ZN.sub.2 have a
phosphodiester backbone and do not include nucleic acids having a
modified backbone.
[0144] Z is an immunostimulatory nucleic acid motif but does not
include a CG. For instance, Z may be a nucleic acid a T-rich
sequence, e.g. including a TTTT motif or a sequence wherein at
least 50% of the bases of the sequence are Ts or Z may be a TG
sequence.
[0145] The center nucleotides (N.sub.1ZN.sub.2) of the formula
Y.sub.1N.sub.1ZN.sub.2Y.sub.2 have phosphodiester internucleotide
linkages and Y.sub.1 and Y.sub.2 have at least one, but may have
more than one or even may have all modified internucleotide
linkages. In preferred embodiments Y.sub.1 and/or Y.sub.2 have at
least two or between two and five modified internucleotide linkages
or Y.sub.1 has two modified internucleotide linkages and Y.sub.2
has five modified internucleotide linkages or Y.sub.1 has five
modified internucleotide linkages and Y.sub.2 has two modified
internucleotide linkages. The modified internucleotide linkage, in
some embodiments is a phosphorothioate modified linkage, a
phosphorodithioate modified linkage or a p-ethoxy modified
linkage.
[0146] Modified backbones such as phosphorothioates may be
synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries. Aryl- and
alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No.
4,469,863; and alkylphosphotriesters (in which the charged oxygen
moiety is alkylated as described in U.S. Pat. No. 5,023,243 and
European Patent No. 092,574) can be prepared by automated solid
phase synthesis using commercially available reagents. Methods for
making other DNA backbone modifications and substitutions have been
described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990;
Goodchild, J., Bioconjugate Chem. 1:165, 1990).
[0147] Other stabilized nucleic acids include: nonionic DNA
analogs, such as alkyl- and aryl-phosphates (in which the charged
phosphonate oxygen is replaced by an alkyl or aryl group),
phosphodiester and alkylphosphotriesters, in which the charged
oxygen moiety is alkylated. Nucleic acids which contain diol, such
as tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
[0148] In the case when the Py-rich or TG nucleic acid is
administered in conjunction with an antigen which is encoded in a
nucleic acid vector, it is preferred that the backbone of the
Py-rich or TG nucleic acid be a chimeric combination of
phosphodiester and phosphorothioate (or other phosphate
modification). The cell may have a problem taking up a plasmid
vector in the presence of completely phosphorothioate nucleic acid.
Thus when both a vector and a nucleic acid are delivered to a
subject, it is preferred that the nucleic acid have a chimeric
backbone or have a phosphorothioate backbone but that the plasmid
be associated with a vehicle that delivers it directly into the
cell, thus avoiding the need for cellular uptake. Such vehicles are
known in the art and include, for example, liposomes and gene
guns.
[0149] The nucleic acids described herein as well as various
control nucleic acids are presented below in Table A.
TABLE-US-00002 TABLE A SEQ ID NO: ODN SEQUENCE BACKBONE 1
tctcccagcgtgcgccat s 2 ataatccagcttgaaccaag s 3
ataatcgacgttcaagcaag s 4 taccgcgtgcgaccctct s 5 ggggagggt s 6
ggggagggg s 7 ggtgaggtg s 8 tccatgtzgttcctgatgct o 9
gctaccttagzgtga o 10 tccatgazgttcctgatgct o 11 tccatgacgttcztgatgct
o 12 gctagazgttagtgt o 13 agctccatggtgctcactg s 14
ccacgtcgaccctcaggcga s 15 gcacatcgtcccgcagccga s 16
gtcactcgtggtacctcga s 17 gttggatacaggccagactttgttg o 18
gattcaacttgcgctcatcttaggc o 19 accatggacgaactgtttcccctc s 20
accatggacgagctgtttcccctc s 21 accatggacgacctgtttcccctc s 22
accatggacgtactgtttcccctc s 23 accatggacggtctgtttcccctc s 24
accatggacgttctgtttcccctc s 25 ccactcacatctgctgctccacaag o 26
acttctcatagtccctttggtccag o 27 tccatgagcttcctgagtct o 28
gaggaaggigiggaigacgt o 29 gtgaaticgttcicgggict o 30 aaaaaa s 31
cccccc s 32 ctgtca s 33 tcgtag s 34 tcgtgg s 35 cgtcgt s 36
tccatgtcggtcctgagtct sos 37 tccatgccggtcctgagtct sos 38
tccatgacggtcctgagtct sos 39 tccatgacggtcctgagtct sos 40
tccatgtcgatcctgagtct sos 41 tccatgtcgctcctgagtct sos 42
tccatgtcgttcctgagtct sos 43 tccatgacgttcctgagtct sos 44
tccataacgttcctgagtct sos 45 tccatgacgtccctgagtct sos 46
tccatcacgtgcctgagtct sos 47 tccatgctggtcctgagtct sos 48
tccatgtzggtcctgagtct sos 49 ccgcttcctccagatgagctcatgggtttc o
tccaccaag 50 cttggtggagaaacccatgagctcatctgg o aggaagcgg 51
ccccaaagggatgagaagtt o 52 agatagcaaatcggctgacg o 53
ggttcacgtgctcatggctg o 54 tctcccagcgtgcgccat s 55
tctcccagcgtgcgccat s 56 taccgcgtgcgaccctct s 57
ataatccagcttgaaccaag s 58 ataatcgacgttcaagcaag s 59
tccatgattttcctgatttt o 62 tgctgcttttgtgcttttgtgctt s 63
tgctgcttgtgcttttgtgctt o 64 gcattcatcaggcgggcaagaat o 65
taccgagcttcgacgagatttca o 66 gcatgacgttgagct s 67 cacgttgaggggcat s
68 ctgctgagactggag s 69 tccatgacgttcctgacgtt s 70 gcatgagcttgagctga
o 71 tcagcgtgcgcc s 72 atgacgttcctgacgtt s 73 ttttggggttttggggtttt
s 74 tctaggctttttaggcttcc s 75 tgcattttttaggccaccat s 76
tctcccagcgtgcgtgcgccat s 77 tctcccagcgggcgcat s 78
tctcccagcgagcgccat s 79 tctcccagcgcgcgccat s 80 ggggtgacgttcagggggg
sos 81 ggggtccagcgtgcgccatggggg sos 82 ggggtgtcgttcagggggg sos 83
tccatgtcgttcctgtcgtt s 84 tccatagcgttcctagcgtt s 85
tcgtcgctgtctccgcttctt s 86 gcatgacgttgagct sos 87
tctcccagcgtgcgccatat sos 88 tccatgazgttcctgazgtt s 89
gcatgazgttgagct o 90 tccagcgtgcgccata sos 91 tctcccagcgtgcgccat o
92 tccatgagcttcctgagtct o 93 gcatgtcgttgagct sos 94
tcctgacgttcctgacgtt s 95 gcatgatgttgagct o 96 gcatttcgaggagct o 97
gcatgtagctgagct o 98 tccaggacgttcctagttct o 99 tccaggagcttcctagttct
o 100 tccaggatgttcctagttct o 101 tccagtctaggcctagttct o 102
tccagttcgagcctagttct o 103 gcatggcgttgagct sos 104 gcatagcgttgagct
sos 105 gcattgcgttgagct sos 106 gcttgcgttgcgttt sos 107
tctcccagcgttgcgccatat sos 108 tctcccagcgtgcgttatat sos 109
tctccctgcgtgcgccatat sos 110 tctgcgtgcgtgcgccatat sos 111
tctcctagcgtgcgccatat sos 112 tctcccagcgtgcgcctttt sos 113
gctandcghhagc o 114 tcctgacgttccc o 115 ggaagacgttaga 0 116
tcctgacgttaga o 117 tcagaccagctggtcgggtgttcctga o 118
tcaggaacacccgaccagctggtctga o 119 gctagtcgatagc o 120 gctagtcgctagc
o 121 gcttgacgtctagc o 122 gcttgacgtttagc o 123 gcttgacgtcaagc o
124 gctagacgtttagc o
125 tccatgacattcctgatgct o 126 gctagacgtctagc o 127
ggctatgtcgttcctagcc o 128 ggctatgtcgatcctagcc o 129
ctcatgggtttctccaccaag o 130 cttggtggagaaacccatgag o 131
tccatgacgttcctagttct o 132 ccgcttcctccagatgagctcatg o 133
catgagctcatctggaggaagcgg o 134 ccagatgagctcatgggtttctcc o 135
ggagaaacccatgagctcatctgg o 136 agcatcaggaacgacatgga o 137
tccatgacgttcctgacgtt rna 138 gcgcgcgcgcgcgcgcgcg o 139
ccggccggccggccggccgg o 140 ttccaatcagccccacccgctctggcccca o
ccctcaccctcca 141 tggagggtgagggtggggccagagcgggtg o gggctgattggaa
142 tcaaatgtgggattttcccatgagtct o 143 agactcatgggaaaatcccacatttga o
144 tgccaagtgctgagtcactaataaaga o 145 tctttattagtgactcagcacttggca o
146 tgcaggaagtccgggttttccccaaccccc o c 147
ggggggttggggaaaacccggacttcctgc o a 148
ggggactttccgctggggactttccagggg sos gactttcc 149
tccatgacgttcctctccatgacgttcctc o tccatgacgttcctc 150
gaggaacgtcatggagaggaacgtcatgga o gaggaacgtcatgga 151
ataatagagcttcaagcaag s 152 tccatgacgttcctgacgtt s 153
tccatgacgttcctgacgtt sos 154 tccaggactttcctcaggtt s 155
tcttgcgatgctaaaggacgtcacattgca o caatcttaataaggt 156
accttattaagattgtgcaatgtgacgtcc o tttagcatcgcaaga 157
tcctgacgttcctggcggtcctgtcgct o 158 tcctgtcgctcctgtcgct o 159
tcctgacgttgaagt o 160 tcctgtcgttgaagt o 161 tcctggcgttgaagt o 162
tcctgccgttgaagt o 163 tccttacgttgaagt o 164 tcctaacgttgaagt o 165
tcctcacgttgaagt o 166 tcctgacgatgaagt o 167 tcctgacgctgaagt o 168
tcctgacggtgaagt o 169 tcctgacgtagaagt o 170 tcctgacgtcgaagt o 171
tcctgacgtggaagt o 172 tcctgagcttgaagt o 173 gggggacgttggggg o 174
tcctgacgttccttc o 175 tctcccagcgagcgagcgccat s 176
tcctgacgttcccctggcggtcccctgtcg o ct 177
tcctgtcgctcctgtcgctcctgtcgct o 178 tcctggcggggaagt o 179
tcctgazgttgaagt o 180 tcztgacgttgaagt o 181 tcctagcgttgaagt o 182
tccagacgttgaagt o 183 tcctgacggggaagt o 184 tcctggcggtgaagt o 185
ggctccggggagggaatttttgtctat o 186 atagacaaaaattccctccccggagcc o 187
tccatgagcttccttgagtct rna 188 tcgtcgctgtctccgcttctt so 189
tcgtcgctgtctccgcttctt s20 190 tcgagacattgcacaatcatctg o 191
cagattgtgcaatgtctcga o 192 tccatgtcgttcctgatgcg o 193
gcgatgtcgttcctgatgct o 194 gcgatgtcgttcctgatgcg o 195
tccatgtcgttccgcgcgcg o 196 tccatgtcgttcctgccgct o 197
tccatgtcgttcctgtagct o 198 gcggcgggcggcgcgcgccc o 199
atcaggaacgtcatgggaagc o 200 tccatgagcttcctgagtct p-ethoxy 201
tcaacgtt p-ethoxy 202 tcaagctt p-ethoxy 203 tcctgtcgttcctgtcgtt s
204 tccatgtcgtttttgtcgtt s 205 tcctgtcgttccttgtcgtt s 206
tccttgtcgttcctgtcgtt s 207 btccattccatgacgttcctgatgcttcca os 208
tcctgtcgttttttgtcgtt s 209 tcgtcgctgtctccgcttctt s 210
tcgtcgctgtctgcccttctt s 211 tcgtcgctgttgtcgtttctt s 212
tcctgtcgttcctgtcgttggaacgacagg o 213 tcctgtcgttcctgtcgtttcaacgtcagg
o aacgacagga 214 ggggtctgtcgttttgggggg sos 215
ggggtctgtgcttttgggggg sos 216 tccggccgttgaagt o 217 tccggacggtgaagt
o 218 tcccgccgttgaagt o 219 tccagacggtgaagt o 220 tcccgacggtgaagt o
221 tccagagcttgaagt o 222 tccatgtzgttcctgtzgtt s 223
tccatgacgttcctgacgtt sos 224 ggggttgacgttttgggggg sos 225
tccaggacttctctcaggtt s 226 tttttttttttttttttttt s 227
tccatgccgttcctgccgtt s 228 tccatggcgggcctggcggg s 229
tccatgacgttcctgccgtt s 230 tccatgacgttcctggcggg s 231
tccatgacgttcctgcgttt s 232 tccatgacggtcctgacggt s 233
tccatgcgtgcgtgcgtttt s 234 tccatgcgttgcgttgcgtt s 235
btccattccattctaggcctgagtcttccat os 236 tccatagcgttcctagcgtt o 237
tccatgtcgttcctgtcgtt o 238 tccatagcgatcctagcgat o 239
tccattgcgttccttgcgtt o 240 tccatagcggtcctagcggt o 241
tccatgattttcctgcagttcctgatttt 242 tccatgacgttcctgcagttcctgacgtt s
243 ggcggcggcggcggcggcgg o 244 tccacgacgttttcgacgtt s
245 tcgtcgttgtcgttgtcgtt s 246 tcgtcgttttgtcgttttgtcgtt s 247
tcgtcgttgtcgttttgtcgtt s 248 gcgtgcgttgtcgttgtcgtt s 249
czggczggczgggczccgg o 250 gcggcgggcggcgcgcgccc s 251
agicccgigaacgiattcac o 252 tgtcgtttgtcgtttgtcgtt s 253
tgtcgttgtcgttgtcgttgtcgtt s 254 tgtcgttgtcgttgtcgttgtcgtt s 255
tcgtcgtcgtcgtt s 256 tgtcgttgtcgtt s 257 cccccccccccccccccccc s 258
tctagcgtttttagcgttcc sos 259 tgcatcccccaggccaccat s 260
tcgtcgtcgtcgtcgtcgtcgtt sos 261 tcgtcgttgtcgttgtcgtt sos 262
tcgtcgttttgtcgttttgtcgtt sos 263 tcgtcgttgtcgttttgtcgtt sos 264
ggggagggaggaacttcttaaaattccccca o gaatgttt 265
aaacattctgggggaattttaagaagttcct o ccctcccc 266
atgtttacttcttaaaattcccccagaatgt o tt 267
aaacattctgggggaattttaagaagtaaac o at 268
atgtttactagacaaaattcccccagaatgt o tt 269
aaacattctgggggaattttgtctagtaaac o at 270 aaaattgacgttttaaaaaa sos
271 ccccttgacgttttcccccc sos 272 ttttcgttgtttttgtcgtt 273
tcgtcgttttgtcgttttgtcgtt sos 274 ctgcagcctgggac o 275
acccgtcgtaattatagtaaaaccc o 276 ggtacctgtggggacattgtg o 277
agcaccgaacgtgagagg o 278 tccatgccgttcctgccgtt o 279
tccatgacggtcctgacggt o 280 tccatgccggtcctgccggt o 281
tccatgcgcgtcctgcgcgt o 282 ctggtctttctggtttttttctgg s 283
tcaggggtggggggaacctt sos 284 tccatgazgttcctagttct o 285
tccatgatgttcctagttct o 286 cccgaagtcatttcctcttaacctgg o 287
ccaggttaagaggaaatgacttcggg o 288 tcctggzggggaagt o 289
gzggzgggzggzgzgzgccc x 290 tccatgtgcttcctgatgct o 291
tccatgtccttcctgatgct 292 tccatgtcgttcctagttct 293
tccaagtagttcctagttct o 294 tccatgtagttcctagttct o 295
tcccgcgcgttccgcgcgtt s 296 tcctggcggtcctggcggtt s 297
tcctggaggggaagt o 298 tcctgggggggaagt o 299 tcctggtggggaagt o 300
tcgtcgttttgtcgttttgtcgtt o 301 ctggtctttctggtttttttctgg o 302
tccatgacgttcctgacgtt o 303 tccaggacttctctcaggtt sos 304
tzgtzgttttgtzgttttgtzgtt o 305 btcgtcgttttgtcgttttgtcgttttttt os
306 gctatgacgttccaaggg s 307 tcaacgtt s 308 tccaggactttcctcaggtt o
309 ctctctgtaggcccgcttgg s 310 ctttccgttggacccctggg s 311
gtccgggccaggccaaagtc s 312 gtgcgcgcgagcccgaaatc s 313
tccatgaigttcctgaigtt s 314 aatagtcgccataacaaaac o 315
aatagtcgccatggcggggc o 316 btttttccatgtcgttcctgatgcttttt os 317
tcctgtcgttgaagtttttt o 318 gctagctttagagctttagagctt o 319
tgctgcttcccccccccccc o 320 tcgacgttcccccccccccc o 321
tcgtcgttcccccccccccc o 322 tcgtcgttcccccccccccc o 323
tcgccgttcccccccccccc o 324 tcgtcgatcccccccccccc o 325
tcctgacgttgaagt s 326 tcctgccgttgaagt s 327 tcctgacggtgaagt s 328
tcctgagcttgaagt s 329 tcctggcggggaagt s 330 aaaatctgtgcttttaaaaaa
sos 331 gatccagtcacagtgacctggcagaatctgg o at 332
gatccagattctgccaggtcactgtgactgg o at 333
gatccagtcacagtgactcagcagaatctgg o at 334
gatccagattctgctgagtcactgtgactgg o at 335 tcgtcgttccccccczcccc o 336
tzgtqgttcccccccccccc o 337 tzgtcgttcccccccccccc o 338
tcgtzgttcccccccccccc o 339 tcgtcgctcccccccccccc o 340
tcgtcggtcccccccccccc o 341 tcggcgttcccccccccccc o 342
ggccttttcccccccccccc o 343 tcgtcgttttgacgttttgtcgtt s 344
tcgtcgttttgacgttttgacgtt s 345 ccgtcgttcccccccccccc o 346
gcgtcgttcccccccccccc o 347 tcgtcattcccccccccccc o 348
acgtcgttcccccccccccc o 349 ctgtcgttcccccccccccc o 350
btttttcgtcgttcccccccccccc os 351 tcgtcgttccccccccccccb o 352
tcgtcgttttgtcgttttgtcgttb o 353 tccagttccttcctcagtct o 354
tzgtcgttttgtcgttttgtcgtt o 355 tcctggaggggaagt s 356
tcctgaaaaggaagt s 357 tcgtcgttccccccccc s 358
tzgtzgttttgtzgttttgtzgtt s 359 ggggtcaagcttgagggggg sos 360
tgctgcttcccccccccccc s 361 tcgtcgtcgtcgtt s2 362 tcgtcgtcgtcgtt s20
363 tcgtcgtcgtcgtt os2 364 tcaacgttga s
365 tcaacgtt s 366 atagttttccatttttttac 367 aatagtcgccatcgcgcgac o
368 aatagtcgccatcccgggac o 369 aatagtcgccatcccccccc o 370
tgctgcttttgtgcttttgtgctt o 371 ctgtgctttctgtgtttttctgtg s 372
ctaatctttctaatttttttctaa s 373 tcgtcgttggtgtcgttggtgtcgtt s 374
tcgtcgttggttgtcgttttggtt s 375 accatggacgagctgtttcccctc 376
tcgtcgttttgcgtgcgttt s 377 ctgtaagtgagcttggagag 378
gagaacgctggaccttcc 379 cgggcgactcagtctatcgg 380
gttctcagataaagcggaaccagcaacagac acagaa 381
ttctgtgtctgttgctggttccgctttatc tgagaac 382 cagacacagaagcccgatagacg
383 agacagacacgaaacgaccg 384 gtctgtcccatgatctcgaa 385
gctggccagcttacctcccg 386 ggggcctctatacaacctggg 387
ggggtccctgagactgcc 388 gagaacgctggaccttccat 389
tccatgtcggtcctgatgct 390 ctcttgcgacctggaaggta 391
aggtacagccaggactacga 392 accatggacgacctgtttcccctc 393
accatggattacctttttcccctt 394 atggaaggtccagcgttctc o 395
agcatcaggaccgacatgga o 396 ctctccaagctcacttacag 397
tccctgagactgccccacctt 398 gccaccaaaacttgtccatg 399
gtccatggcgtgcgggatga 400 cctctatacaacctgggac 401
cgggcgactcagtctatcgg 402 gcgctaccggtagcctgagt 403
cgactgccgaacaggatatcggtgatcagca ctgg 404
ccagtgctgatcaccgatatcctgttcggca gtcg 405 ccaggttgtatagaggc 406
tctcccagcgtacgccat s 407 tctcccagcgtgcgtttt s 408
tctcccgacgtgcgccat s 409 tctcccgtcgtgcgccat s 410
ataatcgtcgttcaagcaag s 411 tcgtcgttttgtcgttttgtcgt s2 412
tcgtcgttttgtcgttttgtcgtt s2 413 tcgtcgttttgtcgttttgtcgtt s2 414
tcntcgtnttntcgtnttntcgtn s 415 tctcccagcgtcgccat s 416
tctcccatcgtcgccat s 417 ataatcgtgcgttcaagaaag s 418
ataatcgacgttcccccccc s 419 tctatcgacgttcaagcaag s 420 tcc tga cgg
gg agt s 421 tccatgacgttcctgatcc 422 tccatgacgttcctgatcc 423
tccatgacgttcctgatcc 424 tcc tgg cgt gga agt s 425
tccatgacgttcctgatcc 426 tcgtcgctgttgtcgtttctt s 427
agcagctttagagctttagagctt s 428 cccccccccccccccccccccccc s 429
tcgtcgttttgtcgttttgtcgttttgtcgt s t 430
tcgtcgttttttgtcgttttttgtcgtt s 431 tcgtcgtttttttttttttt s 432
tttttcaacgttgatttttt sos 434 ggggtcgtcgttttgggggg 435
tcgtcgttttgtcgttttgggggg 436 tcgtcgctgtctccgcttcttcttgcc s 437
tcgtcgctgtctccg s 438 ctgtaagtgagcttggagag 439 gagaacgctggaccttccat
440 ccaggttgtatagaggc 441 gctagacgttagcgtga 442
ggagctcttcgaacgccata 443 tctccatgatggttttatcg 444
aaggtggggcagtctcaggga 445 atcggaggactggcgcgccg 446
ttaggacaaggtctagggtg 447 accacaacgagaggaacgca 448
ggcagtgcaggctcaccggg 449 gaaccttccatgctgtt 450 gctagacgttagcgtga
451 gcttggagggcctgtaagtg 452 gtagccttccta 453 cggtagccttccta 454
cacggtagccttccta 455 agcacggtagccttccta 456 gaacgctggaccttccat 457
gaccttccat 458 tggaccttccat 459 gctggaccttccat 460 acgctggaccttccat
461 taagctctgtcaacgccagg 462 gagaacgctggaccttccatgt 463
tccatgtcggtcctgatgct 464 ttcatgccttgcaaaatggcg 465
tgctagctgtgcctgtacct 466 agcatcaggaccgacatgga 467
gaccttccatgtcggtcctgat 468 acaaccacgagaacgggaac 469
gaaccttccatgctgttccg 470 caatcaatctgaggagaccc 471
tcagctctggtactttttca 472 tggttacggtctgtcccatg 473
gtctatcggaggactggcgc 474 cattttacgggcgggcgggc 475
gaggggaccattttacgggc 476 tgtccagccgaggggaccat 477
cgggcttacggcggatgctg 478 tggaccttctatgtcggtcc 479
tgtcccatgtttttagaagc 480 gtggttacggtcgtgcccat 481
cctccaaatgaaagaccccc 482 ttgtactctccatgatggtt 483
ttccatgctgttccggctgg 484 gaccttctatgtcggtcctg 485
gagaccgctcgaccttcgat 486 ttgccccatattttagaaac 487
ttgaaactgaggtgggac 488 ctatcggaggactggcgcgcc
489 cttggagggcctcccggcgg 490 gctgaaccttccatgctgtt 491
tagaaacagcattcttcttttagggcagcac a 492 agatggttctcagataaagcggaa 493
ttccgctttatctgagaaccatct 494 gtcccaggttgtatagaggctgc 495
gcgccagtcctccgatagac 496 atcggaggactggcgcgccg 497
ggtctgtcccatatttttag 498 tttttcaacgttgagggggg sos 499
tttttcaagcgttgatttttt sos 500 ggggtcaacgttgatttttt sos 501
ggggttttcaacgttttgagggggg sos 502 ggttacggtctgtcccatat 503
ctgtcccatatttttagaca 504 accatcctgaggccattcgg 505
cgtctatcgggcttctgtgtctg 506 ggccatcccacattgaaagtt 507
ccaaatatcggtggtcaagcac 508 gtgcttgaccaccgatatttgg 509
gtgctgatcaccgatatcctgttcgg 510 ggccaactttcaatgtgggatggcctc 511
ttccgccgaatggcctcaggatggtac 512 tatagtccctgagactgccccaccttctcaa
caacc 513 gcagcctctatacaacctgggacggga 514 ctatcggaggactggcgcgccg
515 tatcggaggactggcgcgccg 516 gatcggaggactggcgcgccg 517
ccgaacaggatatcggtgatcagcac 518 ttttggggtcaacgttgagggggg 519
ggggtcaacgttgagggggg sos 520 cgcgcgcgcgcgcgcgcgcg s 521
ggggcatgacgttcgggggg ss 522 ggggcatgacgttcaaaaaa s 523
ggggcatgagcttcgggggg s 524 ggggcatgacgttcgggggg sos 525
aaaacatgacgttcaaaaaa sos 526 aaaacatgacgttcgggggg sos 527
ggggcatgacgttcaaaaaa sos 528 accatggacgatctgtttcccctc s 529
gccatggacgaactgttccccctc s 530 cccccccccccccccccccc sos 531
gggggggggggggggggggg sos 532 gctgtaaaatgaatcggccg sos 533
ttcgggcggactcctccatt sos 534 tatgccgcgcccggacttat sos 535
ggggtaatcgatcagggggg sos 536 tttgagaacgctggaccttc sos 537
gatcgctgatctaatgctcg sos 538 gtcggtcctgatgctgttcc sos 539
tcgtcgtcagttcgctgtcg sos 540 ctggaccttccatgtcgg sos 541
gctcgttcagcgcgtct sos 542 ctggaccttccatgtc sos 543 cactgtccttcgtcga
sos 544 cgctggaccttccatgtcgg sos 545 gctgagctcatgccgtctgc sos 546
aacgctggaccttccatgtc sos 547 tgcatgccgtacacagctct sos 548
ccttccatgtcggtcctgat sos 549 tactcttcggatcccttgcg sos 550
ttccatgtcggtcctgat sos 551 ctgattgctctctcgtga sos 552
ggcgttattcctgactcgcc o 553 cctacgttgtatgcgcccagct o 554
ggggtaatcgatgagggggg o 555 ttcgggcggactcctccatt o 557
gggggttttttttttggggg o 558 tttttggggggggggttttt o 559
ggggggggggggggggggt o 560 aaaaaaaaaaaaaaaaaaaa o 561
cccccaaaaaaaaaaccccc o 562 aaaaaccccccccccaaaaa o 563
tttgaattcaggactggtgaggttgag o 564 tttgaatcctcagcggtctccagtggc o 565
aattctctatcggggcttctgtgtctgttgc o tggttccgctttat 566
ctagataaagcggaaccagcaacagacacag o aagccccgatagag 567
ttttctagagaggtgcacaatgctctgg o 568 tttgaattccgtgtacagaagcgagaagc o
569 tttgcggccgctagacttaacctgagagata o 570
tttgggcccacgagagacagagacacttc o 571 tttgggcccgcttctcgcttctgtacacg o
572 gagaacgctggaccttccat s 573 tccatgtcggtcctgatgct s 574 ctgtcg s
575 tcgtga s 576 cgtcga s 577 agtgct s 578 ctgtcg o 579 agtgct o
580 cgtcga o 581 tcgtga o 582 gagaacgctccagcttcgat o 583
gctagacgtaagcgtga o 584 gagaacgctcgaccttccat o 585
gagaacgctggacctatccat o 586 gctagaggttagcgtga o 587
gagaacgctggacttccat o 588 tcacgctaacgtctagc o 589
bgctagacgttagcgtga o 590 atggaaggtcgagcgttctc o 591
gagaacgctggaccttcgat o 592 gagaacgatggaccttccat o 593
gagaacgctggatccat o 594 gagaacgctccagcactgat o 595
tccatgtcggtcctgctgat o 596 atgtcctcggtcctgatgct o 597
gagaacgctccaccttccat o 598 gagaacgctggaccttcgta o 599
batggaaggtccagcgttctc o 600 tcctga o 601 tcaacgtt o 602 aacgtt o
603 aacgttga o 604 tcacgctaacctctagc o 605 gagaacgctggaccttgcat o
606 gctggaccttccat o 607 gagaacgctggacctcatccat o 608
gagaacgctggacgctcatccat o 609 aacgttgaggggcat o 610 atgcccctcaacgtt
o 611 tcaacgttga o 612 gctggaccttccat o 613 caacgtt o
614 acaacgttga o 615 tcacgt o 616 tcaagctt o 617 tcgtca o 618
aggatatc o 619 tagacgtc o 620 gacgtcat o 621 ccatcgat o 622
atcgatgt o 623 atgcatgt o 624 ccatgcat o 625 agcgctga o 626
tcagcgct o 627 ccttcgat o 628 gtgccggggtctccgggc s 629
gctgtggggcggctcctg s 630 btcaacgtt o 631 ftcaacgtt o 632 faacgttga
o 633 tcaacgt s 634 aacgttg s 635 cgacga o 636 tcaacgtt o 637 tcgga
o 638 agaacgtt o 639 tcatcgat o 640 taaacgtt s 641 ccaacgtt s 642
gctcga s 643 cgacgt s 644 cgtcgt s 645 acgtgt s 646 cgttcg s 647
gagcaagctggaccttccat s 648 cgcgta s 649 cgtacg s 650 tcaccggt s 651
caagagatgctaacaatgca s 652 acccatcaatagctctgtgc s 653 ccatcgat o
654 tcgacgtc o 655 ctagcgct o 656 taagcgct o 657 tcgcgaattcgcg o
658 atggaaggtccagcgttct o 659 actggacgttagcgtga o 660
cgcctggggctggtctgg o 661 gtgtcggggtctccgggc o 662
gtgccggggtctccgggc o 663 cgccgtcgcggcggttgg o 664
gaagttcacgttgaggggcat o 665 atctggtgagggcaagctatg s 666
gttgaaacccgagaacatcat s 667 gcaacgtt o 668 gtaacgtt o 669 cgaacgtt
o 670 gaaacgtt o 671 caaacgtt o 672 ctaacgtt o 673 ggaacgtt o 674
tgaacgtt o 675 acaacgtt o 676 ttaacgtt o 677 aaaacgtt o 678
ataacgtt o 679 aacgttct o 680 tccgatcg o 681 tccgtacg o 682
gctagacgctagcgtga o 683 gagaacgctggacctcatcatccat o 684
gagaacgctagaccttctat o 685 actagacgttagtgtga o 686
cacaccttggtcaatgtcacgt o 687 tctccatcctatggttttatcg o 688
cgctggaccttccat o 689 caccaccttggtcaatgtcacgt o 690
gctagacgttagctgga o 691 agtgcgattgcagatcg o 692
ttttcgttttgtggttttgtggtt 693 ttttcgtttgtcgttttgtcgtt 694
tttttgttttgtggttttgtggtt 695 accgcatggattctaggcca s 696
gctagacgttagcgt o 697 aacgctggaccttccat o 698 tcaazgtt o 699
ccttcgat o 700 actagacgttagtgtga s 701 gctagaggttagcgtga s 702
atggactctccagcgttctc 0 703 atcgactctcgagcgttctc o 704 gctagacgttagc
o 705 gctagacgt o 706 agtgcgattcgagatcg o 707 tcagzgct o 708
ctgattgctctctcgtga o 709 tzaacgtt o 710 gagaazgctggaccttccat o 711
gctagacgttaggctga o 712 gctacttagcgtga o 713 gctaccttagcgtga o 714
atcgacttcgagcgttctc o 715 atgcactctgcagcgttctc o 716
agtgactctccagcgttctc o 717 gccagatgttagctgga o 718
atcgactcgagcgttctc o 719 atcgatcgagcgttctc o 720
bgagaacgctcgaccttcgat o 721 gctagacgttagctgga sos 722
atcgactctcgagcgttctc sos 723 tagacgttagcgtga o 724
cgactctcgagcgttctc o 725 ggggtcgaccttggagggggg sos 726
gctaacgttagcgtga o 727 cgtcgtcgt o 728 gagaacgctggaczttccat o 729
atcgacctacgtgcgttztc o 730 atzgacctacgtgcgttctc o 731
gctagazgttagcgt o 732 atcgactctcgagzgttctc o 733
ggggtaatgcatcagggggg sos 734 ggctgtattcctgactgccc s 735
ccatgctaacctctagc o 736 gctagatgttagcgtga o 737 cgtaccttacggtga o
738 tccatgctggtcctgatgct o
739 atcgactctctcgagcgttctc o 740 gctagagcttagcgtga o 741
atcgactctcgagtgttctc o 742 aacgctcgaccttcgat o 743
ctcaacgctggaccttccat o 744 atcgacctacgtgcgttctc o 745
gagaatgctggaccttccat o 746 tcacgctaacctctgac o 747
bgagaacgctccagcactgat o 748 bgagcaagctggaccttccat o 749
cgctagaggttagcgtga o 750 gctagatgttaacgt o 751 atggaaggtccacgttctc
o 752 gctagatgttagcgt o 753 gctagacgttagtgt o 754
tccatgacggtcctgatgct o 755 tccatggcggtcctgatgct o 756
gctagacgatagcgt o 757 gctagtcgatagcgt o 758 tccatgacgttcctgatgct o
759 tccatgtcgttcctgatgct o 760 gctagacgttagzgt o 761
gctaggcgttagcgt o 762 tccatgtzggtcctgatgct o 763
tccatgtcggtzctgatgct o 764 atzgactctzgagzgttctc o 765
atggaaggtccagtgttctc o 766 gcatgacgttgagct o 767
ggggtcaacgttgagggggg s 768 ggggtcaagtctgagggggg sos 769
cgcgcgcgcgcgcgcgcgcg o 770 cccccccccccccccccccccccccccc s 771
ccccccccccccccccccccccccccccccc s cccc 772 tccatgtcgctcctgatcct o
773 gctaaacgttagcgt o 774 tccatgtcgatcctgatgct o 775
tccatgccggtcctgatgct o 776 aaaatcaacgttgaaaaaaa sos 777
tccataacgttcctgatgct o 778 tggaggtcccaccgagatcggag o 779
cgtcgtcgtcgtcgtcgtcgt s 780 ctgctgctgctgctgctgctg s 781
gagaacgctccgaccttcgat s 782 gctagatgttagcgt s 783 gcatgacgttgagct s
784 tcaatgctgaf o 785 tcaacgttgaf o 786 tcaacgttgab o 787
gcaatattgcb o 788 gcaatattgcf o 789 agttgcaact o 790 tcttcgaa o 791
tcaacgtc o 792 ccatgtcggtcctgatgct o 793 gtttttatataatttggg o 794
tttttgtttgtcgttttgtcgtt o 795 ttggggggggtt s 796 ggggttgggggtt s
797 ggtggtgtaggttttgg o 798 bgagaazgctcgaccttcgat o 799
tcaacgttaacgttaacgtt o 800 bgagcaagztggaccttccat o 801
bgagaazgctccagcactgat o 802 tcaazgttgax o 803 gzaatattgcx o 804
tgctgcttttgtcgttttgtgctt o 805 ctgcgttagcaatttaactgtg o 806
tccatgacgttcctgatgct s 807 tgcatgccgtgcatccgtacacagctct s 808
tgcatgccgtacacagctct s 809 tgcatcagctct s 810 tgcgctct s 811
cccccccccccccccccccc s 812 cccccccccccc s 813 cccccccc s 814
tgcatcagctct sos 815 tgcatgccgtacacagctct o 816
gagcaagctggaccttccat s 817 tcaacgttaacgttaacgttaacgttaacgt s t 818
gagaacgctcgaccttcgat s 819 gtccccatttcccagaggaggaaat o 820
ctagcggctgacgtcatcaagctag o 821 ctagcttgatgacgtcagccgctag o 822
cggctgacgtcatcaa s 823 ctgacgtg o 824 ctgacgtcat o 825
attcgatcggggcggggcgag o 826 ctcgccccgccccgatcgaat o 827
gactgacgtcagcgt o 828 ctagcggctgacgtcataaagctagc s 829
ctagctttatgacgtcagccgctagc s 830 ctagcggctgagctcataaagctagc s 831
ctagtggctgacgtcatcaagctag s 832 tccaccacgtggtctatgct s 833
gggaatgaaagattttattataag o 834 tctaaaaaccatctattcttaaccct o 835
agctcaacgtcatgc o 836 ttaacggtggtagcggtattggtc o 837
ttaagaccaataccgctaccaccg o 838 gatctagtgatgagtcagccggatc o 839
gatccggctgactcatcactagatc o 840 tccaagacgttcctgatgct o 841
tccatgacgtccctgatgct o 842 tccaccacgtggctgatgct o 843
ccacgtggacctctagc o 844 tcagaccacgtggtcgggtgttcctga o 845
tcaggaacacccgaccacgtggtctga o 846 catttccacgatttccca o 847
ttcctctctgcaagagact o 848 tgtatctctctgaaggact o 849
ataaagcgaaactagcagcagtttc o 850 gaaactgctgctagtttcgctttat o 851
tgcccaaagaggaaaatttgtttcatacag o 852 ctgtatgaaacaaattttcctctttgggca
o 853 ttagggttagggttagggtt ss 854 tccatgagcttcctgatgct ss 855
aaaacatgacgttcaaaaaa ss 856 aaaacatgacgttcgggggg ss 857
ggggcatgagcttcgggggg sos 858 ctaggctgacgtcatcaagctagt o 859
tctgacgtcatctgacgttggctgacgtct o 860 ggaattagtaatagatatagaagtt o
861 tttaccttttataaacataactaaaacaaa o 862 gcgtttttttttgcg s 863
atatctaatcaaaacattaacaaa o
864 tctatcccaggtggttcctgttag o 865 btccatgacgttcctgatgct o 866
btccatgagcttcctgatgct o 867 tttttttttttttf o 868 tttttttttttttf so
869 ctagcttgatgagctcagccgctag o 870 ttcagttgtcttgctgcttagctaa o 871
tccatgagcttcctgagtct s 872 ctagcggctgacgtcatcaatctag o 873
tgctagctgtgcctgtacct s 874 atgctaaaggacgtcacattgca o 875
tgcaatgtgacgtcctttagcat o 876 gtaggggactttccgagctcgagatcctatg o 877
cataggatctcgagctcggaaagtcccctac o 878 ctgtcaggaactgcaggtaagg o 879
cataacataggaatatttactcctcgc o 880 ctccagctccaagaaaggacg o 881
gaagtttctggtaagtcttcg o 882 tgctgcttttgtgcttttgtgctt s 883
tcgtcgttttgtggttttgtggtt s 884 tcgtcgtttgtcgttttgtcgtt s 885
tcctgacgttcggcgcgcgccc s 886 tgctgcttttgtgcttttgtgctt 887
tccatgagcttcctgagctt s 888 tcgtcgtttcgtcgttttgacgtt s 889
tcgtcgtttgcgtgcgtttcgtcgtt s 890 tcgcgtgcgttttgtcgttttgacgtt s 891
ttcgtcgttttgtcgttttgtcgtt s 892 tcctgacggggaagt s 893
tcctggcgtggaagt s 894 tcctggcggtgaagt s 895 tcctggcgttgaagt s 896
tcctgacgtggaagt s 897 gcgacgttcggcgcgcgccc s 898
gcgacgggcggcgcgcgccc s 899 gcggcgtgcggcgcgcgccc s 900
gcggcggtcggcgcgcgccc s 901 gcgacggtcggcgcgcgccc s 902
gcggcgttcggcgcgcgccc s 903 gcgacgtgcggcgcgcgccc s 904
tcgtcgctgtctccg s 905 tgtgggggttttggttttgg s 906
aggggaggggaggggagggg s 907 tgtgtgtgtgtgtgtgtgtgt s 908
ctctctctctctctctctctct chimeric 909 ggggtcgacgtcgagggggg s 910
atatatatatatatatatatat s 912 ttttttttttttttttttttt s 914
gctagaggggagggt 915 gctagatgttagggg 916 gcatgagggggagct 917
atggaaggtccagggggctc 918 atggactctggagggggctc 919
atggaaggtccaaggggctc 920 gagaaggggggaccttggat 921
gagaaggggggaccttccat 922 gagaaggggccagcactgat 923
tccatgtggggcctgatgct 924 tccatgaggggcctgatgct 925
tccatgtggggcctgctgat 926 atggactctccggggttctc 927
atggaaggtccggggttctc 928 atggactctggaggggtctc 929
atggaggctccatggggctc 930 atggactctggggggttctc 931
tccatgtgggtggggatgct 932 tccatgcgggtggggatgct 933
tccatgggggtcctgatgct 934 tccatggggtccctgatgct 935
tccatggggtgcctgatgct 936 tccatggggttcctgatgct 937
tccatcgggggcctgatgct 938 gctagagggagtgt 940 gmggtcaacgttgagggmggg s
941 ggggagttcgttgaggggggg s 942 tcgtcgtttccccccccccc s 943
ttggggggttttttttttttttttt s 944 tttaaattttaaaatttaaaata s 945
ttggtttttttggtttttttttgg s 946 tttcccttttccccttttcccctc s 947
ggggtcatcgatgagggggg s sos 948 tccatgacgttcctgacgtt 949
tccatgacgttcctgacgtt 950 tccatgacgttcctgacgtt 951
tccatgacgttcctgacgtt 952 tccatgacgttcctgacgtt 953
tccatgacgttcctgacgtt 954 tccatgacgttcctgacgtt 955
tccatgacgttcctgacgtt 956 tccatgacgttcctgacgtt 957
tccatgacgttcctgacgtt 958 tccatgacgttcctgacgtt 959
gggggacgatcgtcggggg sos 960 gggggtcgtacgacgggggg sos 962
aaaaaaaaaaaaaaaaaaaaaaaa po 963 cccccccccccccccccccccccc po 964
tcgtcgttttgtcgttttgtcgtt 965 tcgtcgttttgtcgttttgtcgtt 966
tcgtcgttttgtcgttttgtcgtt 967 tcgtcgttttgtcgttttgtcgtt 968
ggggtcaacgttgagggggg 969 ggggtcaacgttgagggggg 970
ggggtcaagcttgagggggg 971 tgctgcttcccccccccccc 972
ggggacgtcgacgtgggggg sos 973 ggggtcgtcgacgagggggg sos 974
ggggtcgacgtacgtcgagggggg sos 975 ggggaccggtaccggtgggggg sos 976
gggtcgacgtcgagggggg sos 977 ggggtcgacgtcgaggggg sos 978
ggggaacgttaacgttgggggg sos 979 ggggtcaccggtgagggggg sos 980
ggggtcgttcgaacgagggggg sos 981 ggggacgttcgaacgtgggggg sos 982
tcaactttga s 983 tcaagcttga s 984 tcacgatcgtga s 985 tcagcatgctga s
986 gggggagcatgctggggggg sos 987 gggggggggggggggggggg sos 988
gggggacgatatcgtcgggggg sos 989 gggggacgacgtcgtcgggggg sos 990
gggggacgagctcgtcgggggg sos 991 gggggacgtacgtcgggggg sos 992
tcaacgtt
993 tccataccggtcctgatgct 994 tccataccggtcctaccggt s 995
gggggacgatcgttgggggg sos 996 ggggaacgatcgtcgggggg sos 997 ggg ggg
acg atc gtc ggg ggg sos 998 ggg gga cga tcg tcg ggg ggg sos 999 aaa
gac gtt aaa po 1000 aaagagcttaaa po 1001 aaagazgttaaa po 1002
aaattcggaaaa po 1003 gggggtcatcgatgagggggg sos 1004
gggggtcaacgttgagggggg sos 1005 atgtagcttaataacaaagc po 1006
ggatcccttgagttacttct po 1007 ccattccacttctgattacc po 1008
tatgtattatcatgtagata po 1009 agcctacgtattcaccctcc po 1010
ttcctgcaactactattgta po 1011 atagaaggccctacaccagt po 1012
ttacaccggtctatggaggt po 1013 ctaaccagatcaagtctagg po 1014
cctagacttgatctggttag po 1015 tataagcctcgtccgacatg po 1016
catgtcggacgaggcttata po 1017 tggtggtggggagtaagctc po 1018
gagctactcccccaccacca po 1019 gccttcgatcttcgttggga po 1020
tggacttctctttgccgtct po 1021 atgctgtagcccagcgataa po 1022
accgaatcagcggaaagtga po 1023 tccatgacgttcctgacgtt 1024
ggagaaacccatgagctcatctgg 1025 accacagaccagcaggcaga 1026
gagcgtgaactgcgcgaaga 1027 tcggtacccttgcagcggtt 1028
ctggagccctagccaaggat 1029 gcgactccatcaccagcgat 1030
cctgaagtaagaaccagatgt 1031 ctgtgttatctgacatacacc 1032
aattagccttaggtgattggg 1033 acatctggttcttacttcagg 1034
ataagtcatattttgggaactac 1035 cccaatcacctaaggctaatt 1036
ggggtcgtcgacgagggggg sos 1037 ggggtcgttcgaacgagggggg sos 1038
ggggacgttcgaacgtgggggg sos 1039 tcctggcgqggaagt s 1040
ggggaacgacgtcgttgggggg sos 1041 ggggaacgtacgtcgggggg sos 1042
ggggaacgtacgtacgttgggggg sos 1043 ggggtcaccggtgagggggg sos 1044
ggggtcgacgtacgtcgagggggg sos 1045 ggggaccggtaccggtgggggg sos 1046
gggtcgacgtcgagggggg sos 1047 ggggtcgacgtcgagggg sos 1048
ggggaacgttaacgttgggggg sos 1049 ggggacgtcgacgtggggg sos 1050
gcactcttcgaagctacagccggcagcctct gat 1051
cggctcttccatgaggtctttgctaatcttg g 1052
cggctcttccatgaaagtctttggacgatgt gagc 1053 tcctgcaggttaagt s 1054
gggggtcgttcgttgggggg sos 1055 gggggatgattgttgggggg sos 1056
gggggazgatzgttgggggg sos 1057 gggggagctagcttgggggg sos 1058
ggttcttttggtccttgtct s 1059 ggttcttttggtcctcgtct s 1060
ggttcttttggtccttatct s 1061 ggttcttggtttccttgtct s 1062
tggtcttttggtccttgtct s 1063 ggttcaaatggtccttgtct s 1064
gggtcttttgggccttgtct s 1065 tccaggacttctctcaggtttttt s 1066
tccaaaacttctctcaaatt s 1067 tactacttttatacttttatactt s 1068
tgtgtgtgtgtgtgtgtgtgtgtg s 1069 ttgttgttgttgtttgttgttgttg s 1070
ggctccggggagggaatttttgtctat s 1071 gggacgatcgtcggggggg sos 1072
gggtcgtcgacgaggggggg sos 1073 ggtcgtcgacgaggggggg sos 1074
gggtcgtcgtcgtggggggg sos 1075 ggggacgatcgtcggggggg sos 1076
ggggacgtcgtcgtgggggg sos 1077 ggggtcgacgtcgacgtcgaggggggg sos 1078
ggggaaccgcggttggggggg sos 1079 ggggacgacgtcgtggggggg sos 1080
tcgtcgtcgtcgtcgtggggggg sos 1081 tcctgccggggaagt s 1082
tcctgcaggggaagt s 1083 tcctgaaggggaagt s 1084 tcctggcgggcaagt s
1085 tcctggcgggtaagt s 1086 tcctggcgggaaagt s 1087 tccgggcggggaagt
s 1088 tcggggcggggaagt s 1089 tcccggcggggaagt s 1090
gggggacgttggggg s 1091 ggggttttttttttgggggg sos 1092
ggggccccccccccgggggg sos 1093 ggggttgttgttgttgggggg sos 1094
tttttttttttttttttttttttttttttt 1095 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
1096 cccccccccccccccccccccccccccccc 1097
cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
[0150] While CpG effects in mice are well characterized,
information regarding the human system is limited. CpG
phosphorothioate oligonucleotides with strong stimulatory activity
in the mouse system show lower activity on human and other
non-rodent immune cells. In the examples the development of a
potent human CpG motif and the characterization of its effects and
mechanisms of action on human primary B-cells is described. DNA
containing this CpG motif strongly stimulated primary human B-cells
to proliferate, to produce IL-6 and to express increased levels of
CD86, CD40, CD54 and MHC II. It increased DNA binding activity of
the transcription factors NF.kappa.B and AP-1, as well as
phosphorylation of the stress activated protein kinases JNK and
p38, and the transcription factor ATF-2. B-cell signaling pathways
activated by CpG DNA were different from those activated by the
B-cell receptor which activated ERK and a different isoform of JNK,
but did not activate p38 and ATF-2. In general the data on CpG
DNA-initiated signal transduction are consistent with those
obtained in mice (Hacker H., Mischak H., Miethke T., Liptay S.,
Schmid R., Sparwasser T., Heeg K., Lipford G. B., and Wagner H.
1998. CpG-DNA-specific activation of antigen-presenting cells
requires stress kinase activity and is preceded by non-specific
endocytosis and endosomal maturation. Embo J 17:6230, Yi A. K., and
Krieg A. M. 1998. Rapid induction of mitogen-activated protein
kinases by immune stimulatory CpG DNA. J Immunol 161:4493).
[0151] The preferred non-rodent motif is 5' TCGTCGTT 3'. Base
exchanges within the most potent 8 mer CpG motif (5' TCGTCGTT 3')
diminished the activity of the oligonucleotide. The thymidines at
the 5' and the 3' position of this motif were more important than
the thymidine at the middle position. An adenine or guanosine at
the middle position produced a decrease in the activity.
[0152] Of note, our studies demonstrate that one human CpG motif
within a phosphodiester oligonucleotide (2080) is sufficient to
produce the maximal effect, and that additional CpG motifs (2059)
did not further enhance the activity. The oligonucleotide with the
8 mer motif 5' TCG TCG TT 3' (2080) containing two CpG
dinucleotides showed the highest activity in the studies.
Replacement of the bases flanking the two CpG dinucleotides (5'
position, middle position, 3' position) reduced the activity of
this sequence. Both CpG dinucleotides within the 8 mer CpG motif
were required for the optimal activity (2108, 2106). Cytidine
methylation of the CpG dinucleotides (2095) abolished the activity
of 2080, while methylation of an unrelated cytidine (2094) did not.
The addition of two CpG motifs into the sequence of 2080 resulting
in 2059 did not further increase the activity of the phosphodiester
oligonucleotide. The sequence of 2080 with a phosphorothioate
backbone (2116) demonstrated less activity, suggesting that
additional CpG motifs are preferred for a potent phosphorothioate
oligonucleotide.
[0153] It has been discovered according to the invention that the
immunostimulatory nucleic acids have dramatic immune stimulatory
effects on human cells such as NK cells, B cells, and DCs in vitro.
It has been demonstrated that that the in vitro assays used herein
predict in vivo effectiveness as a vaccine adjuvant in non-rodent
vertebrates (Example 12), suggesting that immunostimulatory nucleic
acids are effective therapeutic agents for human vaccination,
cancer immunotherapy, asthma immunotherapy, general enhancement of
immune function, enhancement of hematopoietic recovery following
radiation or chemotherapy, and other immune modulatory
applications.
[0154] Thus the immunostimulatory nucleic acids are useful in some
aspects of the invention as a prophylactic vaccine for the
treatment of a subject at risk of developing an infection with an
infectious organism or a cancer in which a specific cancer antigen
has been identified or an allergy or asthma where the allergen or
predisposition to asthma is known. The immunostimulatory nucleic
acids can also be given without the antigen or allergen for shorter
term protection against infection, allergy or cancer, and in this
case repeated doses will allow longer term protection. A subject at
risk as used herein is a subject who has any risk of exposure to an
infection causing pathogen or a cancer or an allergen or a risk of
developing cancer. For instance, a subject at risk may be a subject
who is planning to travel to an area where a particular type of
infectious agent is found or it may be a subject who through
lifestyle or medical procedures is exposed to bodily fluids which
may contain infectious organisms or directly to the organism or
even any subject living in an area where an infectious organism or
an allergen has been identified. Subjects at risk of developing
infection also include general populations to which a medical
agency recommends vaccination with a particular infectious organism
antigen. If the antigen is an allergen and the subject develops
allergic responses to that particular antigen and the subject may
be exposed to the antigen, i.e., during pollen season, then that
subject is at risk of exposure to the antigen. A subject at risk of
developing an allergy to asthma includes those subjects that have
been identified as having an allergy or asthma but that don't have
the active disease during the immunostimulatory nucleic acid
treatment as well as subjects that are considered to be at risk of
developing these diseases because of genetic or environmental
factors.
[0155] A subject at risk of developing a cancer is one who is who
has a high probability of developing cancer. These subjects
include, for instance, subjects having a genetic abnormality, the
presence of which has been demonstrated to have a correlative
relation to a higher likelihood of developing a cancer and subjects
exposed to cancer causing agents such as tobacco, asbestos, or
other chemical toxins, or a subject who has previously been treated
for cancer and is in apparent remission. When a subject at risk of
developing a cancer is treated with an antigen specific for the
type of cancer to which the subject is at risk of developing and a
immunostimulatory nucleic acid, the subject may be able to kill the
cancer cells as they develop. If a tumor begins to form in the
subject, the subject will develop a specific immune response
against the tumor antigen.
[0156] In addition to the use of the immunostimulatory nucleic
acids for prophylactic treatment, the invention also encompasses
the use of the immunostimulatory nucleic acids for the treatment of
a subject having an infection, an allergy, asthma, or a cancer.
[0157] A subject having an infection is a subject that has been
exposed to an infectious pathogen and has acute or chronic
detectable levels of the pathogen in the body. The
immunostimulatory nucleic acids can be used with an antigen to
mount an antigen specific systemic or mucosal immune response that
is capable of reducing the level of or eradicating the infectious
pathogen. An infectious disease, as used herein, is a disease
arising from the presence of a foreign microorganism in the body.
It is particularly important to develop effective vaccine
strategies and treatments to protect the body's mucosal surfaces,
which are the primary site of pathogenic entry.
[0158] A subject having an allergy is a subject that has or is at
risk of developing an allergic reaction in response to an allergen.
An allergy refers to acquired hypersensitivity to a substance
(allergen). Allergic conditions include but are not limited to
eczema, allergic rhinitis or coryza, hay fever, conjunctivitis,
bronchial asthma, urticaria (hives) and food allergies, and other
atopic conditions.
[0159] Currently, allergic diseases are generally treated by the
injection of small doses of antigen followed by subsequent
increasing dosage of antigen. It is believed that this procedure
induces tolerization to the allergen to prevent further allergic
reactions. These methods, however, can take several years to be
effective and are associated with the risk of side effects such as
anaphylactic shock. The methods of the invention avoid these
problems.
[0160] Allergies are generally caused by IgE antibody generation
against harmless allergens. The cytokines that are induced by
systemic or mucosal administration of immunostimulatory nucleic
acids are predominantly of a class called Th1 (examples are IL-12
and IFN-.gamma.) and these induce both humoral and cellular immune
responses. The types of antibodies associated with a Th1 response
are generally more protective because they have high neutralization
and opsonization capabilities. The other major type of immune
response, which is associated with the production of IL-4, IL-5 and
IL-10 cytokines, is termed a Th2 immune response. Th2 responses
involve predominately antibodies and these have less protective
effect against infection and some Th2 isotypes (e.g., IgE) are
associated with allergy. In general, it appears that allergic
diseases are mediated by Th2 type immune responses while Th1
responses provide the best protection against infection, although
excessive Th1 responses are associated with autoimmune disease.
Based on the ability of the immunostimulatory nucleic acids to
shift the immune response in a subject from a Th2 (which is
associated with production of IgE antibodies and allergy) to a Th1
response (which is protective against allergic reactions), an
effective dose for inducing an immune response of a
immunostimulatory nucleic acid can be administered to a subject to
treat or prevent an allergy.
[0161] Thus, the immunostimulatory nucleic acids have significant
therapeutic utility in the treatment of allergic and non-allergic
conditions such as asthma. Th2 cytokines, especially IL-4 and IL-5
are elevated in the airways of asthmatic subjects. These cytokines
promote important aspects of the asthmatic inflammatory response,
including IgE isotope switching, eosinophil chemotaxis and
activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines. Asthma refers to a disorder of the
respiratory system characterized by inflammation, narrowing of the
airways and increased reactivity of the airways to inhaled agents.
Asthma is frequently, although not exclusively associated with
atopic or allergic symptoms.
[0162] A subject having a cancer is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g. small cell and non-small cell); melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer;
prostate cancer; rectal cancer; sarcomas; skin cancer; testicular
cancer; thyroid cancer; and renal cancer, as well as other
carcinomas and sarcomas. In one embodiment the cancer is hairy cell
leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia,
multiple myeloma, follicular lymphoma, malignant melanoma, squamous
cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder
cell carcinoma, or colon carcinoma.
[0163] A subject according to the invention is a non-rodent
subject. A non-rodent subject shall mean a human or vertebrate
animal including but not limited to a dog, cat, horse, cow, pig,
sheep, goat, chicken, primate, e.g., monkey, and fish (aquaculture
species), e.g. salmon, but specifically excluding rodents such as
rats and mice.
[0164] Thus, the invention can also be used to treat cancer and
tumors in non human subjects. Cancer is one of the leading causes
of death in companion animals (i.e., cats and dogs). Cancer usually
strikes older animals which, in the case of house pets, have become
integrated into the family. Forty-five % of dogs older than 10
years of age, are likely to succumb to the disease. The most common
treatment options include surgery, chemotherapy and radiation
therapy. Others treatment modalities which have been used with some
success are laser therapy, cryotherapy, hyperthermia and
immunotherapy. The choice of treatment depends on type of cancer
and degree of dissemination. Unless the malignant growth is
confined to a discrete area in the body, it is difficult to remove
only malignant tissue without also affecting normal cells.
[0165] Malignant disorders commonly diagnosed in dogs and cats
include but are not limited to lymphosarcoma, osteosarcoma, mammary
tumors, mastocytoma, brain tumor, melanoma, adenosquamous
carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar
adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma,
neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma,
Wilm's tumor, Burkitt's lymphoma, microglioma, neuroblastoma,
osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and
rhabdomyosarcoma. Other neoplasias in dogs include genital squamous
cell carcinoma, transmissable veneral tumor, testicular tumor,
seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma,
chloroma (granulocytic sarcoma), corneal papilloma, corneal
squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma,
basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma,
oral papillomatosis, hemangioendothelioma and cystadenoma.
Additional malignancies diagnosed in cats include follicular
lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary
squamous cell carcinoma. The ferret, an ever-more popular house pet
is known to develop insulinoma, lymphoma, sarcoma, neuroma,
pancreatic islet cell tumor, gastric MALT lymphoma and gastric
adenocarcinoma.
[0166] Neoplasias affecting agricultural livestock include
leukemia, hemangiopericytoma and bovine ocular neoplasia (in
cattle); preputial fibrosarcoma, ulcerative squamous cell
carcinoma, preputial carcinoma, connective tissue neoplasia and
mastocytoma (in horses); hepatocellular carcinoma (in swine);
lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma,
lymphoma, Rous sarcoma, reticulendotheliosis, fibrosarcoma,
nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian
species); retinoblastoma, hepatic neoplasia, lymphosarcoma
(lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder
sarcoma (in fish), caseous lumphadenitis (CLA): chronic,
infectious, contagious disease of sheep and goats caused by the
bacterium Corynebacterium pseudotuberculosis, and contagious lung
tumor of sheep caused by jaagsiekte.
[0167] The subject is exposed to the antigen. As used herein, the
term exposed to refers to either the active step of contacting the
subject with an antigen or the passive exposure of the subject to
the antigen in vivo. Methods for the active exposure of a subject
to an antigen are well-known in the art. In general, an antigen is
administered directly to the subject by any means such as
intravenous, intramuscular, oral, transdermal, mucosal, intranasal,
intratracheal, or subcutaneous administration. The antigen can be
administered systemically or locally. Methods for administering the
antigen and the immunostimulatory nucleic acid are described in
more detail below. A subject is passively exposed to an antigen if
an antigen becomes available for exposure to the immune cells in
the body. A subject may be passively exposed to an antigen, for
instance, by entry of a foreign pathogen into the body or by the
development of a tumor cell expressing a foreign antigen on its
surface.
[0168] The methods in which a subject is passively exposed to an
antigen can be particularly dependent on timing of administration
of the immunostimulatory nucleic acid. For instance, in a subject
at risk of developing a cancer or an infectious disease or an
allergic or asthmatic response, the subject may be administered the
immunostimulatory nucleic acid on a regular basis when that risk is
greatest, i.e., during allergy season or after exposure to a cancer
causing agent. Additionally the immunostimulatory nucleic acid may
be administered to travelers before they travel to foreign lands
where they are at risk of exposure to infectious agents. Likewise
the immunostimulatory nucleic acid may be administered to soldiers
or civilians at risk of exposure to biowarfare to induce a systemic
or mucosal immune response to the antigen when and if the subject
is exposed to it.
[0169] An antigen as used herein is a molecule capable of provoking
an immune response. Antigens include but are not limited to cells,
cell extracts, proteins, polypeptides, peptides, polysaccharides,
polysaccharide conjugates, peptide and non-peptide mimics of
polysaccharides and other molecules, small molecules, lipids,
glycolipids, carbohydrates, viruses and viral extracts and
muticellular organisms such as parasites and allergens. The term
antigen broadly includes any type of molecule which is recognized
by a host immune system as being foreign. Antigens include but are
not limited to cancer antigens, microbial antigens, and
allergens.
[0170] A cancer antigen as used herein is a compound, such as a
peptide or protein, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen presenting cell in the context of an
MHC molecule. Cancer antigens can be prepared from cancer cells
either by preparing crude extracts of cancer cells, for example, as
described in Cohen, et al., 1994, Cancer Research, 54:1055, by
partially purifying the antigens, by recombinant technology, or by
de novo synthesis of known antigens. Cancer antigens include but
are not limited to antigens that are recombinantly expressed, an
immunogenic portion of, or a whole tumor or cancer. Such antigens
can be isolated or prepared recombinantly or by any other means
known in the art.
[0171] A microbial antigen as used herein is an antigen of a
microorganism and includes but is not limited to virus, bacteria,
parasites, and fungi. Such antigens include the intact
microorganism as well as natural isolates and fragments or
derivatives thereof and also synthetic compounds which are
identical to or similar to natural microorganism antigens and
induce an immune response specific for that microorganism. A
compound is similar to a natural microorganism antigen if it
induces an immune response (humoral and/or cellular) to a natural
microorganism antigen. Such antigens are used routinely in the art
and are well known to those of ordinary skill in the art.
[0172] Examples of viruses that have been found in humans include
but are not limited to: Retroviridae (e.g. human immunodeficiency
viruses, such as HIV-1 (also referred to as HTLV-III, LAV or
HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP;
Picornaviridae (e.g. polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae
(e.g. equine encephalitis viruses, rubella viruses); Flaviridae
(e.g. dengue viruses, encephalitis viruses, yellow fever viruses);
Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular
stomatitis viruses, rabies viruses); Coronaviridae (e.g.
coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae
(e.g. parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g. influenza
viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g. reoviruses, orbiviurses and
rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus);
Parvovirida (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes virus; Poxyiridae (variola viruses,
vaccinia viruses, pox viruses); and Iridoviridae (e.g. African
swine fever virus); and unclassified viruses (e.g. the etiological
agents of Spongiform encephalopathies, the agent of delta hepatitis
(thought to be a defective satellite of hepatitis B virus), the
agents of non-A, non-B hepatitis (class 1=internally transmitted;
class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and
related viruses, and astroviruses).
[0173] Both gram negative and gram positive bacteria serve as
antigens in vertebrate animals. Such gram positive bacteria
include, but are not limited to, Pasteurella species, Staphylococci
species, and Streptococcus species. Gram negative bacteria include,
but are not limited to, Escherichia coli, Pseudomonas species, and
Salmonella species. Specific examples of infectious bacteria
include but are not limited to, Helicobacter pyloris, Borelia
burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M.
tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria
meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group
A Streptococcus), Streptococcus agalactiae (Group B Streptococcus),
Streptococcus (viridans group), Streptococcus faecalis,
Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus
pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.,
Haemophilus influenzae, Bacillus antracis, corynebacterium
diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae,
Clostridium perfringers, Clostridium tetani, Enterobacter
aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides
sp., Fusobacterium nucleatum, Streptobacillus moniliformis,
Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia,
and Actinomyces israelli.
[0174] Examples of fungi include Cryptococcus neoformans,
Histoplasma capsulatum, Coccidioides immitis, Blastomyces
dermatitidis, Chlamydia trachomatis, Candida albicans.
[0175] Other infectious organisms (i.e., protists) include
Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae,
Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii.
Blood-borne and/or tissues parasites include Plasmodium spp.,
Babesia microti, Babesia divergens, Leishmania tropica, Leishmania
spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma
gambiense and Trypanosoma rhodesiense (African sleeping sickness),
Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
[0176] Other medically relevant microorganisms have been described
extensively in the literature, e.g., see C. G. A Thomas, Medical
Microbiology, Bailliere Tindall, Great Britain 1983, the entire
contents of which is hereby incorporated by reference.
[0177] Although many of the microbial antigens described above
relate to human disorders, the invention is also useful for
treating other nonhuman vertebrates. Nonhuman vertebrates are also
capable of developing infections which can be prevented or treated
with the Immunostimulatory nucleic acids disclosed herein. For
instance, in addition to the treatment of infectious human
diseases, the methods of the invention are useful for treating
infections of animals.
[0178] As used herein, the term treat, treated, or treating when
used with respect to an infectious disease refers to a prophylactic
treatment which increases the resistance of a subject (a subject at
risk of infection) to infection with a pathogen or, in other words,
decreases the likelihood that the subject will become infected with
the pathogen as well as a treatment after the subject (a subject
who has been infected) has become infected in order to fight the
infection, e.g., reduce or eliminate the infection or prevent it
from becoming worse.
[0179] Many vaccines for the treatment of non-human vertebrates are
disclosed in Bennett, K. Compendium of Veterinary Products, 3rd ed.
North American Compendiums, Inc., 1995. As discussed above,
antigens include infectious microbes such as virus, parasite,
bacteria and fungi and fragments thereof, derived from natural
sources or synthetically. Infectious viruses of both human and
non-human vertebrates, include retroviruses, RNA viruses and DNA
viruses. This group of retroviruses includes both simple
retroviruses and complex retroviruses. The simple retroviruses
include the subgroups of B-type retroviruses, C-type retroviruses
and D-type retroviruses. An example of a B-type retrovirus is mouse
mammary tumor virus (MMTV). The C-type retroviruses include
subgroups C-type group A (including Rous sarcoma virus (RSV), avian
leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and
C-type group B (including feline leukemia virus (FeLV), gibbon ape
leukemia virus (GALV), spleen necrosis virus (SNV),
reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)).
The D-type retroviruses include Mason-Pfizer monkey virus (MPMV)
and simian retrovirus type 1 (SRV-1). The complex retroviruses
include the subgroups of lentiviruses, T-cell leukemia viruses and
the foamy viruses. Lentiviruses include HIV-1, but also include
HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and
equine infectious anemia virus (EIAV). The T-cell leukemia viruses
include HTLV-1, HTLV-II, simian T-cell leukemia virus (STLV), and
bovine leukemia virus (BLV). The foamy viruses include human foamy
virus (HFV), simian foamy virus (SFV) and bovine foamy virus
(BFV).
[0180] Examples of other RNA viruses that are antigens in
vertebrate animals include, but are not limited to, members of the
family Reoviridae, including the genus Orthoreovirus (multiple
serotypes of both mammalian and avian retroviruses), the genus
Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus,
African horse sickness virus, and Colorado Tick Fever virus), the
genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus,
simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the
family Picornaviridae, including the genus Enterovirus (poliovirus,
Coxsackie virus A and B, enteric cytopathic human orphan (ECHO)
viruses, hepatitis A virus, Simian enteroviruses, Murine
encephalomyelitis (ME) viruses, Poliovirus muris, Bovine
enteroviruses, Porcine enteroviruses, the genus Cardiovirus
(Encephalomyocarditis virus (EMC), Mengovirus), the genus
Rhinovirus (Human rhinoviruses including at least 113 subtypes;
other rhinoviruses), the genus Apthovirus (Foot and Mouth disease
(FMDV); the family Calciviridae, including Vesicular exanthema of
swine virus, San Miguel sea lion virus, Feline picornavirus and
Norwalk virus; the family Togaviridae, including the genus
Alphavirus (Eastern equine encephalitis virus, Semliki forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavirius (Mosquito borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine Influenza viruses;
influenza type B (many human subtypes), and influenza type C
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus and Pneumonia
virus); the family Rhabdoviridae, including the genus Vesiculovirus
(VSV), Chandipura virus, Flanders-Hart Park virus), the genus
Lyssavirus (Rabies virus), fish Rhabdoviruses, and two probable
Rhabdoviruses (Marburg virus and Ebola virus); the family
Arenaviridae, including Lymphocytic choriomeningitis virus (LCM),
Tacaribe virus complex, and Lassa virus; the family Coronoaviridae,
including Infectious Bronchitis Virus (IBV), Hepatitis virus, Human
enteric corona virus, and Feline infectious peritonitis (Feline
coronavirus).
[0181] Illustrative DNA viruses that are antigens in vertebrate
animals include, but are not limited to, the family Poxyiridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox,
goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus
(contagious postular dermatitis virus, pseudocowpox, bovine papular
stomatitis virus); the family Iridoviridae (African swine fever
virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the
family Herpesviridae, including the alpha-Herpesviruses (Herpes
Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus,
Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine
keratoconjunctivitis virus, infectious bovine rhinotracheitis
virus, feline rhinotracheitis virus, infectious laryngotracheitis
virus) the Beta-herpesviruses (Human cytomegalovirus and
cytomegaloviruses of swine and monkeys); the gamma-herpesviruses
(Epstein-Barr virus (EBV), Marek's disease virus, Herpes saimiri,
Herpesvirus ateles, Herpesvirus sylvilagus, guinea pig herpes
virus, Lucke tumor virus); the family Adenoviridae, including the
genus Mastadenovirus (Human subgroups A, B, C, D, E and ungrouped;
simian adenoviruses (at least 23 serotypes), infectious canine
hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many
other species, the genus Aviadenovirus (Avian adenoviruses); and
non-cultivatable adenoviruses; the family Papoviridae, including
the genus Papillomavirus (Human papilloma viruses, bovine papilloma
viruses, Shope rabbit papilloma virus, and various pathogenic
papilloma viruses of other species), the genus Polyomavirus
(polyomavirus, Simian vacuolating agent (SV-40), Rabbit vacuolating
agent (RKV), K virus, BK virus, JC virus, and other primate polyoma
viruses such as Lymphotrophic papilloma virus); the family
Parvoviridae including the genus Adeno-associated viruses, the
genus Parvovirus (Feline panleukopenia virus, bovine parvovirus,
canine parvovirus, Aleutian mink disease virus, etc). Finally, DNA
viruses may include viruses which do not fit into the above
families such as Kuru and Creutzfeldt-Jacob disease viruses and
chronic infectious neuropathic agents (CHINA virus).
[0182] Each of the foregoing lists is illustrative, and is not
intended to be limiting.
[0183] In addition to the use of the immunostimulatory nucleic
acids to induce an antigen specific immune response in humans, the
methods of the preferred embodiments are particularly well suited
for treatment of birds such as hens, chickens, turkeys, ducks,
geese, quail, and pheasant. Birds are prime targets for many types
of infections.
[0184] Hatching birds are exposed to pathogenic microorganisms
shortly after birth. Although these birds are initially protected
against pathogens by maternal derived antibodies, this protection
is only temporary, and the bird's own immature immune system must
begin to protect the bird against the pathogens. It is often
desirable to prevent infection in young birds when they are most
susceptible. It is also desirable to prevent against infection in
older birds, especially when the birds are housed in closed
quarters, leading to the rapid spread of disease. Thus, it is
desirable to administer the Immunostimulatory nucleic acid and the
non-nucleic acid adjuvant of the invention to birds to enhance an
antigen-specific immune response when antigen is present.
[0185] An example of a common infection in chickens is chicken
infectious anemia virus (CIAV). CIAV was first isolated in Japan in
1979 during an investigation of a Marek's disease vaccination break
(Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV
has been detected in commercial poultry in all major poultry
producing countries (van Bulow et al., 1991, pp. 690-699) in
Diseases of Poultry, 9th edition, Iowa State University Press).
[0186] CIAV infection results in a clinical disease, characterized
by anemia, hemorrhage and immunosuppression, in young susceptible
chickens. Atrophy of the thymus and of the bone marrow and
consistent lesions of CIAV-infected chickens are also
characteristic of CIAV infection. Lymphocyte depletion in the
thymus, and occasionally in the bursa of Fabricius, results in
immunosuppression and increased susceptibility to secondary viral,
bacterial, or fungal infections which then complicate the course of
the disease. The immunosuppression may cause aggravated disease
after infection with one or more of Marek's disease virus (MDV),
infectious bursal disease virus, reticuloendotheliosis virus,
adenovirus, or reovirus. It has been reported that pathogenesis of
MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In Proceedings
of the 38th Western Poultry Diseases Conference, Tempe, Ariz.).
Further, it has been reported that CIAV aggravates the signs of
infectious bursal disease (Rosenberger et al., 1989, Avian Dis.
33:707-713). Chickens develop an age resistance to experimentally
induced disease due to CAA. This is essentially complete by the age
of 2 weeks, but older birds are still susceptible to infection
(Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24,
202-209, 1980). However, if chickens are dually infected with CAA
and an immunosuppressive agent (IBDV, MDV etc.), age resistance
against the disease is delayed (Yuasa, N. et al., 1979 and 1980
supra; Bulow von V. et al., J. Veterinary Medicine 33, 93-116,
1986). Characteristics of CIAV that may potentiate disease
transmission include high resistance to environmental inactivation
and some common disinfectants. The economic impact of CIAV
infection on the poultry industry is clear from the fact that 10%
to 30% of infected birds in disease outbreaks die.
[0187] Vaccination of birds, like other vertebrate animals can be
performed at any age. Normally, vaccinations are performed at up to
12 weeks of age for a live microorganism and between 14-18 weeks
for an inactivated microorganism or other type of vaccine. For in
ovo vaccination, vaccination can be performed in the last quarter
of embryo development. The vaccine may be administered
subcutaneously, by spray, orally, intraocularly, intratracheally,
nasally, or by other mucosal delivery methods described herein.
Thus, the immunostimulatory nucleic acids of the invention can be
administered to birds and other non-human vertebrates using routine
vaccination schedules and the antigen can be administered after an
appropriate time period as described herein.
[0188] Cattle and livestock are also susceptible to infection.
Diseases which affect these animals can produce severe economic
losses, especially amongst cattle. The methods of the invention can
be used to protect against infection in livestock, such as cows,
horses, pigs, sheep, and goats.
[0189] Cows can be infected by bovine viruses. Bovine viral
diarrhea virus (BVDV) is a small enveloped positive-stranded RNA
virus and is classified, along with hog cholera virus (HOCV) and
sheep border disease virus (BDV), in the pestivirus genus.
Although, Pestiviruses were previously classified in the
Togaviridae family, some studies have suggested their
reclassification within the Flaviviridae family along with the
flavivirus and hepatitis C virus (HCV) groups (Francki, et al.,
1991).
[0190] BVDV, which is an important pathogen of cattle can be
distinguished, based on cell culture analysis, into cytopathogenic
(CP) and noncytopathogenic (NCP) biotypes. The NCP biotype is more
widespread although both biotypes can be found in cattle. If a
pregnant cow becomes infected with an NCP strain, the cow can give
birth to a persistently infected and specifically immunotolerant
calf that will spread virus during its lifetime. The persistently
infected cattle can succumb to mucosal disease and both biotypes
can then be isolated from the animal. Clinical manifestations can
include abortion, teratogenesis, and respiratory problems, mucosal
disease and mild diarrhea. In addition, severe thrombocytopenia,
associated with herd epidemics, that may result in the death of the
animal has been described and strains associated with this disease
seem more virulent than the classical BVDVs.
[0191] Equine herpes viruses (EHV) comprise a group of
antigenically distinct biological agents which cause a variety of
infections in horses ranging from subclinical to fatal disease.
These include Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen
in horses. EHV-1 is associated with epidemics of abortion,
respiratory tract disease, and central nervous system disorders.
Primary infection of upper respiratory tract of young horses
results in a febrile illness which lasts for 8 to 10 days.
Immunologically experienced mares may be re-infected via the
respiratory tract without disease becoming apparent, so that
abortion usually occurs without warning. The neurological syndrome
is associated with respiratory disease or abortion and can affect
animals of either sex at any age, leading to lack of co-ordination,
weakness and posterior paralysis (Telford, E. A. R. et al.,
Virology 189, 304-316, 1992). Other EHV's include EHV-2, or equine
cytomegalovirus, EHV-3, equine coital exanthema virus, and EHV-4,
previously classified as EHV-1 subtype 2.
[0192] Sheep and goats can be infected by a variety of dangerous
microorganisms including visna-maedi.
[0193] Primates such as monkeys, apes and macaques can be infected
by simian immunodeficiency virus. Inactivated cell-virus and
cell-free whole simian immunodeficiency vaccines have been reported
to afford protection in macaques (Stott et al. (1990) Lancet
36:1538-1541; Desrosiers et al. PNAS USA (1989) 86:6353-6357;
Murphey-Corb et al. (1989) Science 246:1293-1297; and Carlson et
al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). A recombinant
HIV gp120 vaccine has been reported to afford protection in
chimpanzees (Berman et al. (1990) Nature 345:622-625).
[0194] Cats, both domestic and wild, are susceptible to infection
with a variety of microorganisms. For instance, feline infectious
peritonitis is a disease which occurs in both domestic and wild
cats, such as lions, leopards, cheetahs, and jaguars. When it is
desirable to prevent infection with this and other types of
pathogenic organisms in cats, the methods of the invention can be
used to vaccinate cats to protect them against infection.
[0195] Domestic cats may become infected with several retroviruses,
including but not limited to feline leukemia virus (FeLV), feline
sarcoma virus (FeSV), endogenous type Concomavirus (RD-114), and
feline syncytia-forming virus (FeSFV). Of these, FeLV is the most
significant pathogen, causing diverse symptoms, including
lymphoreticular and myeloid neoplasms, anemias, immune mediated
disorders, and an immunodeficiency syndrome which is similar to
human acquired immune deficiency syndrome (AIDS). Recently, a
particular replication-defective FeLV mutant, designated FeLV-AIDS,
has been more particularly associated with immunosuppressive
properties.
[0196] The discovery of feline T-lymphotropic lentivirus (also
referred to as feline immunodeficiency) was first reported in
Pedersen et al. (1987) Science 235:790-793. Characteristics of FIV
have been reported in Yamamoto et al. (1988) Leukemia, December
Supplement 2:204 S-215S; Yamamoto et al. (1988) Am. J. Vet. Res.
49:1246-1258; and Ackley et al. (1990) J. Virol. 64:5652-5655.
Cloning and sequence analysis of FIV have been reported in Olmsted
et al. (1989) Proc. Natl. Acad. Sci. USA 86:2448-2452 and
86:4355-4360.
[0197] Feline infectious peritonitis (FIP) is a sporadic disease
occurring unpredictably in domestic and wild Felidae. While FIP is
primarily a disease of domestic cats, it has been diagnosed in
lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller
wild cats that have been afflicted with FIP include the lynx and
caracal, sand cat, and pallas cat. In domestic cats, the disease
occurs predominantly in young animals, although cats of all ages
are susceptible. A peak incidence occurs between 6 and 12 months of
age. A decline in incidence is noted from 5 to 13 years of age,
followed by an increased incidence in cats 14 to 15 years old.
[0198] Viral, bacterial, and parasitic diseases in fin-fish,
shellfish or other aquatic life forms pose a serious problem for
the aquaculture industry. Owing to the high density of animals in
the hatchery tanks or enclosed marine farming areas, infectious
diseases may eradicate a large proportion of the stock in, for
example, a fin-fish, shellfish, or other aquatic life forms
facility. Prevention of disease is a more desired remedy to these
threats to fish than intervention once the disease is in progress.
Vaccination of fish is the only preventative method which may offer
long-term protection through immunity. Nucleic acid based
vaccinations are described in U.S. Pat. No. 5,780,448 issued to
Davis.
[0199] The fish immune system has many features similar to the
mammalian immune system, such as the presence of B cells, T cells,
lymphokines, complement, and immunoglobulins. Fish have lymphocyte
subclasses with roles that appear similar in many respects to those
of the B and T cells of mammals. Vaccines can be administered by
immersion or orally.
[0200] Aquaculture species include but are not limited to fin-fish,
shellfish, and other aquatic animals. Fin-fish include all
vertebrate fish, which may be bony or cartilaginous fish, such as,
for example, salmonids, carp, catfish, yellowtail, seabream, and
seabass. Salmonids are a family of fin-fish which include trout
(including rainbow trout), salmon, and Arctic char. Examples of
shellfish include, but are not limited to, clams, lobster, shrimp,
crab, and oysters. Other cultured aquatic animals include, but are
not limited to eels, squid, and octopi.
[0201] Polypeptides of viral aquaculture pathogens include but are
not limited to glycoprotein (G) or nucleoprotein (N) of viral
hemorrhagic septicemia virus (VHSV); G or N proteins of infectious
hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural
proteins of infectious pancreatic necrosis virus (IPNV); G protein
of spring viremia of carp (SVC); and a membrane-associated protein,
tegumin or capsid protein or glycoprotein of channel catfish virus
(CCV).
[0202] Typical parasites infecting horses are Gasterophilus spp.;
Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babesia spp.
(RBC's), Theileria equi; Trypanosoma spp.; Klossiella equi;
Sarcocystis spp.
[0203] Typical parasites infecting swine include Eimeria bebliecki,
Eimeria scabra, Isospora suis, Giardia spp.; Balantidium coli,
Entamoeba histolytica; Toxoplasma gondii and Sarcocystis spp., and
Trichinella spiralis.
[0204] The major parasites of dairy and beef cattle include Eimeria
spp., Cryptosporidium sp., Giardia spp.; Toxoplasma gondii; Babesia
bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (plasma),
Theileria spp. (RBC); Theileria parva (lymphocytes); Tritrichomonas
foetus; and Sarcocystis spp.
[0205] The major parasites of raptors include Trichomonas gallinae;
Coccidia (Eimeria spp.); Plasmodium relictum, Leucocytozoon
danilewskyi (owls), Haemoproteus spp., Trypanosoma spp.;
Histomonas; Cryptosporidium meleagridis, Cryptosporidium baileyi,
Giardia, Eimeria; Toxoplasma.
[0206] Typical parasites infecting sheep and goats include Eimeria
spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia
spp. (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); and
Sarcocystis spp.
[0207] Typical parasitic infections in poultry include coccidiosis
caused by Eimeria acervulina, E. necatrix, E. tenella, Isospora
spp. and Eimeria truncata; histomoniasis, caused by Histomonas
meleagridis and Histomonas gallinarum; trichomoniasis caused by
Trichomonas gallinae; and hexamitiasis caused by Hexamita
meleagridis. Poultry can also be infected Emeria maxima, Emeria
meleagridis, Eimeria adenoeides, Eimeria meleagrimitis,
Cryptosporidium, Eimeria brunetti, Emeria adenoeides, Leucocytozoon
spp., Plasmodium spp., Hemoproteus meleagridis, Toxoplasma gondii
and Sarcocystis.
[0208] The methods of the invention can also be applied to the
treatment and/or prevention of parasitic infection in dogs, cats,
birds, fish and ferrets. Typical parasites of birds include
Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia;
Cryptosporidium; Sarcocystis spp., Toxoplasma gondii,
Haemoproteus/Parahaemoproteus, Plasmodium spp.,
Leucocytozoon/Akiba, Atoxoplasma, Trypanosoma spp. Typical
parasites infecting dogs include Trichinella spiralis; Isopora
spp., Sarcocystis spp., Cryptosporidium spp., Hammondia spp.,
Giardia duodenalis (canis); Balantidium coli, Entamoeba
histolytica; Hepatozoon canis; Toxoplasma gondii, Trypanosoma
cruzi; Babesia canis; Leishmania amastigotes; Neospora caninum.
[0209] Typical parasites infecting feline species include Isospora
spp., Toxoplasma gondii, Sarcocystis spp., Hammondia hammondi,
Besnoitia spp., Giardia spp.; Entamoeba histolytica; Hepatozoon
canis, Cytauxzoon sp., Cytauxzoon sp., Cytauxzoon sp. (red cells,
RE cells).
[0210] Typical parasites infecting fish include Hexamita spp.,
Eimeria spp.; Cryptobia spp., Nosema spp., Myxosoma spp.,
Chilodonella spp., Trichodina spp.; Plistophora spp., Myxosoma
Henneguya; Costia spp., Ichthyophithirius spp., and Oodinium
spp.
[0211] Typical parasites of wild mammals include Giardia spp.
(carnivores, herbivores), Isospora spp. (carnivores), Eimeria spp.
(carnivores, herbivores); Theileria spp. (herbivores), Babesia spp.
(carnivores, herbivores), Trypanosoma spp. (carnivores,
herbivores); Schistosoma spp. (herbivores); Fasciola hepatica
(herbivores), Fascioloides magna (herbivores), Fasciola gigantica
(herbivores), Trichinella spiralis (carnivores, herbivores).
[0212] Parasitic infections in zoos can also pose serious problems.
Typical parasites of the bovidae family (blesbok, antelope,
banteng, eland, gaur, impala, klipspringer, kudu, gazelle) include
Eimeria spp. Typical parasites in the pinnipedae family (seal, sea
lion) include Eimeria phocae. Typical parasites in the camelidae
family (camels, llamas) include Eimeria spp. Typical parasites of
the giraffidae family (giraffes) include Eimeria spp. Typical
parasites in the elephantidae family (African and Asian) include
Fasciola spp. Typical parasites of lower primates (chimpanzees,
orangutans, apes, baboons, macaques, monkeys) include Giardia sp.;
Balantidium coli, Entamoeba histolytica, Sarcocystis spp.,
Toxoplasma gondii; Plasmodim spp. (RBC), Babesia spp. (RBC),
Trypanosoma spp. (plasma), Leishmania spp. (macrophages).
[0213] Polypeptides of bacterial pathogens include but are not
limited to an iron-regulated outer membrane protein, (IROMP), an
outer membrane protein (OMP), and an A-protein of Aeromonis
salmonicida which causes furunculosis, p57 protein of Renibacterium
salmoninarum which causes bacterial kidney disease (BKD), major
surface associated antigen (msa), a surface expressed cytotoxin
(mpr), a surface expressed hemolysin (ish), and a flagellar antigen
of Yersiniosis; an extracellular protein (ECP), an iron-regulated
outer membrane protein (IROMP), and a structural protein of
Pasteurellosis; an OMP and a flagellar protein of Vibrosis
anguillarum and V. ordalii; a flagellar protein, an OMP protein,
aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and
surface antigen of Ichthyophthirius; and a structural and
regulatory protein of Cytophaga columnari; and a structural and
regulatory protein of Rickettsia.
[0214] Polypeptides of a parasitic pathogen include but are not
limited to the surface antigens of Ichthyophthirius.
[0215] An allergen refers to a substance (antigen) that can induce
an allergic or asthmatic response in a susceptible subject. The
list of allergens is enormous and can include pollens, insect
venoms, animal dander dust, fungal spores and drugs (e.g.
penicillin). Examples of natural, animal and plant allergens
include but are not limited to proteins specific to the following
genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia
(Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium
multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria
(Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula
(Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa);
Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuco (e.g. Festuco elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum
halepensis); and Bromus (e.g. Bromus inermis).
[0216] The antigen may be an antigen that is encoded by a nucleic
acid vector or it may be not encoded in a nucleic acid vector. In
the former case the nucleic acid vector is administered to the
subject and the antigen is expressed in vivo. In the latter case
the antigen may be administered directly to the subject. An antigen
not encoded in a nucleic acid vector as used herein refers to any
type of antigen that is not a nucleic acid. For instance, in some
aspects of the invention the antigen not encoded in a nucleic acid
vector is a polypeptide. Minor modifications of the primary amino
acid sequences of polypeptide antigens may also result in a
polypeptide which has substantially equivalent antigenic activity
as compared to the unmodified counterpart polypeptide. Such
modifications may be deliberate, as by site-directed mutagenesis,
or may be spontaneous. All of the polypeptides produced by these
modifications are included herein as long as antigenicity still
exists. The polypeptide may be, for example, a viral
polypeptide.
[0217] The term substantially purified as used herein refers to a
polypeptide which is substantially free of other proteins, lipids,
carbohydrates or other materials with which it is naturally
associated. One skilled in the art can purify viral or bacterial
polypeptides using standard techniques for protein purification.
The substantially pure polypeptide will often yield a single major
band on a non-reducing polyacrylamide gel. In the case of partially
glycosylated polypeptides or those that have several start codons,
there may be several bands on a non-reducing polyacrylamide gel,
but these will form a distinctive pattern for that polypeptide. The
purity of the viral or bacterial polypeptide can also be determined
by amino-terminal amino acid sequence analysis. Other types of
antigens not encoded by a nucleic acid vector such as
polysaccharides, small molecule, mimics etc are described above,
and included within the invention.
[0218] The invention also utilizes polynucleotides encoding the
antigenic polypeptides. It is envisioned that the antigen may be
delivered to the subject in a nucleic acid molecule which encodes
for the antigen such that the antigen must be expressed in vivo.
Such antigens delivered to the subject in a nucleic acid vector are
referred to as antigens encoded by a nucleic acid vector. The
nucleic acid encoding the antigen is operatively linked to a gene
expression sequence which directs the expression of the antigen
nucleic acid within a eukaryotic cell. The gene expression sequence
is any regulatory nucleotide sequence, such as a promoter sequence
or promoter-enhancer combination, which facilitates the efficient
transcription and translation of the antigen nucleic acid to which
it is operatively linked. The gene expression sequence may, for
example, be a mammalian or viral promoter, such as a constitutive
or inducible promoter. Constitutive mammalian promoters include,
but are not limited to, the promoters for the following genes:
hypoxanthine phosphoribosyl transferase (HPTR), adenosine
deaminase, pyruvate kinase, b-actin promoter and other constitutive
promoters. Exemplary viral promoters which function constitutively
in eukaryotic cells include, for example, promoters from the
cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus,
adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus,
cytomegalovirus, the long terminal repeats (LTR) of Moloney
leukemia virus and other retroviruses, and the thymidine kinase
promoter of herpes simplex virus. Other constitutive promoters are
known to those of ordinary skill in the art. The promoters useful
as gene expression sequences of the invention also include
inducible promoters. Inducible promoters are expressed in the
presence of an inducing agent. For example, the metallothionein
promoter is induced to promote transcription and translation in the
presence of certain metal ions. Other inducible promoters are known
to those of ordinary skill in the art.
[0219] In general, the gene expression sequence shall include, as
necessary, 5' non-transcribing and 5' non-translating sequences
involved with the initiation of transcription and translation,
respectively, such as a TATA box, capping sequence, CAAT sequence,
and the like. Especially, such 5' non-transcribing sequences will
include a promoter region which includes a promoter sequence for
transcriptional control of the operably joined antigen nucleic
acid. The gene expression sequences optionally include enhancer
sequences or upstream activator sequences as desired.
[0220] The antigen nucleic acid is operatively linked to the gene
expression sequence. As used herein, the antigen nucleic acid
sequence and the gene expression sequence are said to be operably
linked when they are covalently linked in such a way as to place
the expression or transcription and/or translation of the antigen
coding sequence under the influence or control of the gene
expression sequence. Two DNA sequences are said to be operably
linked if induction of a promoter in the 5' gene expression
sequence results in the transcription of the antigen sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the antigen sequence, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a gene expression sequence would be operably linked
to an antigen nucleic acid sequence if the gene expression sequence
were capable of effecting transcription of that antigen nucleic
acid sequence such that the resulting transcript is translated into
the desired protein or polypeptide.
[0221] The antigen nucleic acid of the invention may be delivered
to the immune system alone or in association with a vector. In its
broadest sense, a vector is any vehicle capable of facilitating the
transfer of the antigen nucleic acid to the cells of the immune
system so that the antigen can be expressed and presented on the
surface of the immune cell. The vector generally transports the
nucleic acid to the immune cells with reduced degradation relative
to the extent of degradation that would result in the absence of
the vector. The vector optionally includes the above-described gene
expression sequence to enhance expression of the antigen nucleic
acid in immune cells. In general, the vectors useful in the
invention include, but are not limited to, plasmids, phagemids,
viruses, other vehicles derived from viral or bacterial sources
that have been manipulated by the insertion or incorporation of the
antigen nucleic acid sequences. Viral vectors are a preferred type
of vector and include, but are not limited to, nucleic acid
sequences from the following viruses: retrovirus, such as Moloney
murine leukemia virus, Harvey murine sarcoma virus, murine mammary
tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated
virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses;
papilloma viruses; herpes virus; vaccinia virus; polio virus; and
RNA virus such as a retrovirus. One can readily employ other
vectors not named but known in the art.
[0222] Preferred viral vectors are based on non-cytopathic
eukaryotic viruses in which non-essential genes have been replaced
with the gene of interest. Non-cytopathic viruses include
retroviruses, the life cycle of which involves reverse
transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. Retroviruses have been
approved for human gene therapy trials. Most useful are those
retroviruses that are replication-deficient (i.e., capable of
directing synthesis of the desired proteins, but incapable of
manufacturing an infectious particle). Such genetically altered
retroviral expression vectors have general utility for the
high-efficiency transduction of genes in vivo. Standard protocols
for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a
plasmid, transfection of a packaging cell lined with plasmid,
production of recombinant retroviruses by the packaging cell line,
collection of viral particles from tissue culture media, and
infection of the target cells with viral particles) are provided in
Kriegler, M., Gene Transfer and Expression, A Laboratory Manual
W.H. Freeman C.O., New York (1990) and Murry, E. J. Methods in
Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, N.J.
(1991).
[0223] A preferred virus for certain applications is the
adeno-associated virus, a double-stranded DNA virus. The
adeno-associated virus can be engineered to be
replication-deficient and is capable of infecting a wide range of
cell types and species. It further has advantages such as, heat and
lipid solvent stability; high transduction frequencies in cells of
diverse lineages, including hemopoietic cells; and lack of
superinfection inhibition thus allowing multiple series of
transductions. Reportedly, the adeno-associated virus can integrate
into human cellular DNA in a site-specific manner, thereby
minimizing the possibility of insertional mutagenesis and
variability of inserted gene expression characteristic of
retroviral infection. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than
100 passages in the absence of selective pressure, implying that
the adeno-associated virus genomic integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
[0224] Other vectors include plasmid vectors. Plasmid vectors have
been extensively described in the art and are well-known to those
of skill in the art. See e.g., Sambrook et al., Molecular Cloning:
A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory
Press, 1989. In the last few years, plasmid vectors have been found
to be particularly advantageous for delivering genes to cells in
vivo because of their inability to replicate within and integrate
into a host genome. These plasmids, however, having a promoter
compatible with the host cell, can express a peptide from a gene
operatively encoded within the plasmid. Some commonly used plasmids
include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other
plasmids are well-known to those of ordinary skill in the art.
Additionally, plasmids may be custom designed using restriction
enzymes and ligation reactions to remove and add specific fragments
of DNA.
[0225] It has recently been discovered that gene carrying plasmids
can be delivered to the immune system using bacteria. Modified
forms of bacteria such as Salmonella can be transfected with the
plasmid and used as delivery vehicles. The bacterial delivery
vehicles can be administered to a host subject orally or by other
administration means. The bacteria deliver the plasmid to immune
cells, e.g. B cells, dendritic cells, likely by passing through the
gut barrier. High levels of immune protection have been established
using this methodology. Such methods of delivery are useful for the
aspects of the invention utilizing systemic delivery of antigen,
Immunostimulatory nucleic acid and/or other therapeutic agent.
[0226] Thus, the immunostimulatory nucleic acids are useful as
vaccine adjuvants. It was previously established that CpG
oligonucleotides are excellent vaccine adjuvants. It was also
demonstrated, however, that CpG ODN which are superb vaccine
adjuvants in mice are not the preferred adjuvants in non-rodent
animals. In order to identify the best immunostimulatory nucleic
acids for use as a vaccine adjuvant in humans and other non-rodent
animals, in vivo screening of different nucleic acids for this
purpose was conducted. Several in vitro assays were evaluated in
mice for their predictive value of adjuvant activity in vivo in
mice. During the course of this study, an in vitro test that is
predictive of in vivo efficacy was identified. It was discovered,
rather surprisingly, that both B cell and NK cell activation
correlated particularly well with the ability of an
immunostimulatory nucleic acid to enhance an in vivo immune
response against an antigen.
[0227] The good predictive value of B cell activation for in vivo
vaccine adjuvant activity is most likely linked to the central role
of B cells in the establishment of a specific immune response.
Polyclonal proliferation of B cells (induced by immunostimulatory
nucleic acids) increases the likelihood of an antigen specific B
cell/T helper cell match. Furthermore, enhanced expression of the
co-stimulatory molecule CD86 on polyclonally expanded B cells
activates antigen specific T helper cells. B cells also increase
their CD40 expression in response to immunostimulatory nucleic
acids improving the capability of CD40L expressing activated T
helper cells to stimulate B cells. Increased ICAM-1 synthesis on B
cells facilitates the cell to cell contact. Thus, the activation
status of polyclonal B cells plays a critical role during the
initiation of a specific antibody response.
[0228] The contribution of NK cell activity for the establishment
of specific antibodies was, however, surprising. NK cells are part
of the innate immune system and as such are involved in the first
line of defense against pathogens. Most likely the cytokine pattern
produced by NK cells upon activation is closely related to the
initiation of a specific immune response. Thus, in one aspect the
invention relates to a method of identifying an adjuvant, by
detecting NK cell activation. The NK cell activation assay may be
carried out as described in the Examples below or using other known
NK cell activity assays. It is preferred, however that a mixed cell
population such as PBMC be used because of the likelihood that NK
cell activation is an indirect effect. The assay is preferably
useful for identifying immunostimulatory nucleic acids which are
useful as adjuvants in human and other non-rodent animals.
[0229] Cytokine induction was also identified as an important
predictor of in vivo adjuvant activity. As there is a 2 log higher
endotoxin sensitivity of human than mouse primary monocytes, some
caution, however, is required to avoid endotoxin contamination of
immunostimulatory nucleic acids used for testing in the human
system (Hartmann G., and Krieg A. M. 1999. Gene Therapy 6:893).
Since TNF-.alpha., IL-6 and IL-12 are produced by human monocytes
in response to even low amounts of endotoxin, their value for high
throughput in vitro screening assays is limited. On the other hand,
human B cells and NK cells show only minor activation by endotoxin
and thus are far more useful in testing for immunostimulatory
activity.
[0230] Stimulation of cellular function in either NK or B cells
(i.e., lytic activity, proliferation) requires a stronger
immunostimulatory nucleic acid than the induction of activation
markers at their surface (CD69, CD86). For both cell types, the use
of cell surface activation markers showed a higher nonspecific
background attributable to the phosphorothioate backbone compared
to the functional assays. This high sensitivity of surface markers
requires the use of low immunostimulatory nucleic acid
concentrations for optimal discrimination between immunostimulatory
nucleic acid of similar activity. Thus, the use of surface markers
allows the comparison of immunostimulatory nucleic acids with weak
activity, while functional assays are preferred for comparing
immunostimulatory nucleic acids with high activity. It is of note
that the optimal immunostimulatory nucleic acid concentrations for
stimulating B cells and NK cells differ. While 0.6 .mu.g/ml ODN is
already maximal to stimulate B cells, optimal NK cell activation
may require 6 .mu.g/ml ODN. Both B cell activation and NK cell
functional activity were measured within freshly isolated PBMC. It
was previously found that highly purified human primary B cells are
activated by CpG DNA. The existence of a direct effect of CpG DNA
on NK cells is less clear, and a secondary mechanism mediated by
another cell type within PBMC might contribute to CpG-induced
functional activity of NK cells.
[0231] The nucleic acids of the invention may be administered to a
subject with an anti-microbial agent. An anti-microbial agent, as
used herein, refers to a naturally-occurring or synthetic compound
which is capable of killing or inhibiting infectious
microorganisms. The type of anti-microbial agent useful according
to the invention will depend upon the type of microorganism with
which the subject is infected or at risk of becoming infected.
Anti-microbial agents include but are not limited to anti-bacterial
agents, anti-viral agents, anti-fungal agents and anti-parasitic
agents. Phrases such as "anti-infective agent", "anti-bacterial
agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic
agent" and "parasiticide" have well-established meanings to those
of ordinary skill in the art and are defined in standard medical
texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and
include antibiotics as well as other synthetic or natural compounds
having similar functions. Antibiotics are low molecular weight
molecules which are produced as secondary metabolites by cells,
such as microorganisms. In general, antibiotics interfere with one
or more bacterial functions or structures which are specific for
the microorganism and which are not present in host cells.
Anti-viral agents can be isolated from natural sources or
synthesized and are useful for killing or inhibiting viruses.
Anti-fungal agents are used to treat superficial fungal infections
as well as opportunistic and primary systemic fungal infections.
Anti-parasite agents kill or inhibit parasites.
[0232] Examples of anti-parasitic agents, also referred to as
parasiticides useful for human administration include but are not
limited to albendazole, amphotericin B, benznidazole, bithionol,
chloroquine HCl, chloroquine phosphate, clindamycin,
dehydroemetine, diethylcarbamazine, diloxanide furoate,
eflomithine, furazolidaone, glucocorticoids, halofantrine,
iodoquinol, ivermectin, mebendazole, mefloquine, meglumine
antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide,
nifurtimox, oxamniquine, paromomycin, pentamidine isethionate,
piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel
pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine,
quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin,
stibogluconate sodium (sodium antimony gluconate), suramin,
tetracycline, doxycycline, thiabendazole, tinidazole,
trimethroprim-sulfamethoxazole, and tryparsamide some of which are
used alone or in combination with others.
[0233] Parasiticides used in non-human subjects include piperazine,
diethylcarbamazine, thiabendazole, fenbendazole, albendazole,
oxfendazole, oxibendazole, febantel, levamisole, pyrantel tartrate,
pyrantel pamoate, dichlorvos, ivermectin, doramectic, milbemycin
oxime, iprinomectin, moxidectin, N-butyl chloride, toluene,
hygromycin B thiacetarsemide sodium, melarsomine, praziquantel,
epsiprantel, benzimidazoles such as fenbendazole, albendazole,
oxfendazole, clorsulon, albendazole, amprolium; decoquinate,
lasalocid, monensin sulfadimethoxine; sulfamethazine,
sulfaquinoxaline, metronidazole.
[0234] Parasiticides used in horses include mebendazole,
oxfendazole, febantel, pyrantel, dichlorvos, trichlorfon,
ivermectin, piperazine; for S. westeri: ivermectin, benzimiddazoles
such as thiabendazole, cambendazole, oxibendazole and fenbendazole.
Useful parasiticides in dogs include milbemycin oxine, ivermectin,
pyrantel pamoate and the combination of ivermectin and pyrantel.
The treatment of parasites in swine can include the use of
levamisole, piperazine, pyrantel, thiabendazole, dichlorvos and
fenbendazole. In sheep and goats anthelmintic agents include
levamisole or ivermectin. Caparsolate has shown some efficacy in
the treatment of D. immitis (heartworm) in cats.
[0235] Antibacterial agents kill or inhibit the growth or function
of bacteria. A large class of antibacterial agents is antibiotics.
Antibiotics, which are effective for killing or inhibiting a wide
range of bacteria, are referred to as broad spectrum antibiotics.
Other types of antibiotics are predominantly effective against the
bacteria of the class gram-positive or gram-negative. These types
of antibiotics are referred to as narrow spectrum antibiotics.
Other antibiotics which are effective against a single organism or
disease and not against other types of bacteria, are referred to as
limited spectrum antibiotics. Antibacterial agents are sometimes
classified based on their primary mode of action. In general,
antibacterial agents are cell wall synthesis inhibitors, cell
membrane inhibitors, protein synthesis inhibitors, nucleic acid
synthesis or functional inhibitors, and competitive inhibitors.
[0236] Anti-bacterial agents useful in the invention include but
are not limited to natural penicillins, semi-synthetic penicillins,
clavulanic acid, cephalolsporins, bacitracin, ampicillin,
carbenicillin, oxacillin, azlocillin, mezlocillin, piperacillin,
methicillin, dicloxacillin, nafcillin, cephalothin, cephapirin,
cephalexin, cefamandole, cefaclor, cefazolin, cefuroxine,
cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime,
ceftriaxone, cefoperazone, ceftazidine, moxalactam, carbapenems,
imipenems, monobactems, euztreonam, vancomycin, polymyxin,
amphotericin B, nystatin, imidazoles, clotrimazole, miconazole,
ketoconazole, itraconazole, fluconazole, rifampins, ethambutol,
tetracyclines, chloramphenicol, macrolides, aminoglycosides,
streptomycin, kanamycin, tobramycin, amikacin, gentamicin,
tetracycline, minocycline, doxycycline, chlortetracycline,
erythromycin, roxithromycin, clarithromycin, oleandomycin,
azithromycin, chloramphenicol, quinolones, co-trimoxazole,
norfloxacin, ciprofloxacin, enoxacin, nalidixic acid, temafloxacin,
sulfonamides, gantrisin, and trimethoprim; Acedapsone; Acetosulfone
Sodium; Alamecin; Alexidine; Amdinocillin; Amdinocillin Pivoxil;
Amicycline; Amifloxacin; Amifloxacin Mesylate; Amikacin; Amikacin
Sulfate; Aminosalicylic acid; Aminosalicylate sodium; Amoxicillin;
Amphomycin; Ampicillin; Ampicillin Sodium; Apalcillin Sodium;
Apramycin; Aspartocin; Astromicin Sulfate; Avilamycin; Avoparcin;
Azithromycin; Azlocillin; Azlocillin Sodium; Bacampicillin
Hydrochloride; Bacitracin; Bacitracin Methylene Disalicylate;
Bacitracin Zinc; Bambermycins; Benzoylpas Calcium; Berythromycin;
Betamicin Sulfate; Biapenem; Biniramycin; Biphenamine
Hydrochloride; Bispyrithione Magsulfex; Butikacin; Butirosin
Sulfate; Capreomycin Sulfate; Carbadox; Carbenicillin Disodium;
Carbenicillin Indanyl Sodium; Carbenicillin Phenyl Sodium;
Carbenicillin Potassium; Carumonam Sodium; Cefaclor; Cefadroxil;
Cefamandole; Cefamandole Nafate; Cefamandole Sodium; Cefaparole;
Cefatrizine; Cefazaflur Sodium; Cefazolin; Cefazolin Sodium;
Cefbuperazone; Cefdinir; Cefepime; Cefepime Hydrochloride;
Cefetecol; Cefixime; Cefmenoxime Hydrochloride; Cefmetazole;
Cefmetazole Sodium; Cefonicid Monosodium; Cefonicid Sodium;
Cefoperazone Sodium; Ceforanide; Cefotaxime Sodium; Cefotetan;
Cefotetan Disodium; Cefotiam Hydrochloride; Cefoxitin; Cefoxitin
Sodium; Cefpimizole; Cefpimizole Sodium; Cefpiramide; Cefpiramide
Sodium; Cefpirome Sulfate; Cefpodoxime Proxetil; Cefprozil;
Cefroxadine; Cefsulodin Sodium; Ceftazidime; Ceftibuten;
Ceftizoxime Sodium; Ceftriaxone Sodium; Cefuroxime; Cefuroxime
Axetil; Cefuroxime Pivoxetil; Cefuroxime Sodium; Cephacetrile
Sodium; Cephalexin; Cephalexin Hydrochloride; Cephaloglycin;
Cephaloridine; Cephalothin Sodium; Cephapirin Sodium; Cephradine;
Cetocycline Hydrochloride; Cetophenicol; Chloramphenicol;
Chloramphenicol Palmitate; Chloramphenicol Pantothenate Complex;
Chloramphenicol Sodium Succinate; Chlorhexidine Phosphanilate;
Chloroxylenol; Chlortetracycline Bisulfate; Chlortetracycline
Hydrochloride; Cinoxacin; Ciprofloxacin; Ciprofloxacin
Hydrochloride; Cirolemycin; Clarithromycin; Clinafloxacin
Hydrochloride; Clindamycin; Clindamycin Hydrochloride; Clindamycin
Palmitate Hydrochloride; Clindamycin Phosphate; Clofazimine;
Cloxacillin Benzathine; Cloxacillin Sodium; Cloxyquin;
Colistimethate Sodium; Colistin Sulfate; Coumermycin; Coumermycin
Sodium; Cyclacillin; Cycloserine; Dalfopristin; Dapsone;
Daptomycin; Demeclocycline; Demeclocycline Hydrochloride;
Demecycline; Denofungin; Diaveridine; Dicloxacillin; Dicloxacillin
Sodium; Dihydrostreptomycin Sulfate; Dipyrithione; Dirithromycin;
Doxycycline; Doxycycline Calcium; Doxycycline Fosfatex; Doxycycline
Hyclate; Droxacin Sodium; Enoxacin; Epicillin; Epitetracycline
Hydrochloride; Erythromycin; Erythromycin Acistrate; Erythromycin
Estolate; Erythromycin Ethylsuccinate; Erythromycin Gluceptate;
Erythromycin Lactobionate; Erythromycin Propionate; Erythromycin
Stearate; Ethambutol Hydrochloride; Ethionamide; Fleroxacin;
Floxacillin; Fludalanine; Flumequine; Fosfomycin; Fosfomycin
Tromethamine; Fumoxicillin; Furazolium Chloride; Furazolium
Tartrate; Fusidate Sodium; Fusidic Acid; Gentamicin Sulfate;
Gloximonam; Gramicidin; Haloprogin; Hetacillin; Hetacillin
Potassium; Hexedine; Ibafloxacin; Imipenem; Isoconazole;
Isepamicin; Isoniazid; Josamycin; Kanamycin Sulfate; Kitasamycin;
Levofuraltadone; Levopropylcillin Potassium; Lexithromycin;
Lincomycin; Lincomycin Hydrochloride; Lomefloxacin; Lomefloxacin
Hydrochloride; Lomefloxacin Mesylate; Loracarbef; Mafenide;
Meclocycline; Meclocycline Sulfosalicylate; Megalomicin Potassium
Phosphate; Mequidox; Meropenem; Methacycline; Methacycline
Hydrochloride; Methenamine; Methenamine Hippurate; Methenamine
Mandelate; Methicillin Sodium; Metioprim; Metronidazole
Hydrochloride; Metronidazole Phosphate; Mezlocillin; Mezlocillin
Sodium; Minocycline; Minocycline Hydrochloride; Mirincamycin
Hydrochloride; Monensin; Monensin Sodium; Nafcillin Sodium;
Nalidixate Sodium; Nalidixic Acid; Natamycin; Nebramycin; Neomycin
Palmitate; Neomycin Sulfate; Neomycin Undecylenate; Netilmicin
Sulfate; Neutramycin; Nifuradene; Nifuraldezone; Nifuratel;
Nifuratrone; Nifurdazil; Nifurimide; Nifurpirinol; Nifurquinazol;
Nifurthiazole; Nitrocycline; Nitrofurantoin; Nitromide;
Norfloxacin; Novobiocin Sodium; Ofloxacin; Ormetoprim; Oxacillin
Sodium; Oximonam; Oximonam Sodium; Oxolinic Acid; Oxytetracycline;
Oxytetracycline Calcium; Oxytetracycline Hydrochloride; Paldimycin;
Parachlorophenol; Paulomycin; Pefloxacin; Pefloxacin Mesylate;
Penamecillin; Penicillin G Benzathine; Penicillin G Potassium;
Penicillin G Procaine; Penicillin G Sodium; Penicillin V;
Penicillin V Benzathine; Penicillin V Hydrabamine; Penicillin V
Potassium; Pentizidone Sodium; Phenyl Aminosalicylate; Piperacillin
Sodium; Pirbenicillin Sodium; Piridicillin Sodium; Pirlimycin
Hydrochloride; Pivampicillin Hydrochloride; Pivampicillin Pamoate;
Pivampicillin Probenate; Polymyxin B Sulfate; Porfiromycin;
Propikacin; Pyrazinamide; Pyrithione Zinc; Quindecamine Acetate;
Quinupristin; Racephenicol; Ramoplanin; Ranimycin; Relomycin;
Repromicin; Rifabutin; Rifametane; Rifamexil; Rifamide; Rifampin;
Rifapentine; Rifaximin; Rolitetracycline; Rolitetracycline Nitrate;
Rosaramicin; Rosaramicin Butyrate; Rosaramicin Propionate;
Rosaramicin Sodium Phosphate; Rosaramicin Stearate; Rosoxacin;
Roxarsone; Roxithromycin; Sancycline; Sanfetrinem Sodium;
Sarmoxicillin; Sarpicillin; Scopafungin; Sisomicin; Sisomicin
Sulfate; Sparfloxacin; Spectinomycin Hydrochloride; Spiramycin;
Stallimycin Hydrochloride; Steffimycin; Streptomycin Sulfate;
Streptonicozid; Sulfabenz; Sulfabenzamide; Sulfacetamide;
Sulfacetamide Sodium; Sulfacytine; Sulfadiazine; Sulfadiazine
Sodium; Sulfadoxine; Sulfalene; Sulfamerazine; Sulfameter;
Sulfamethazine; Sulfamethizole; Sulfamethoxazole;
Sulfamonomethoxine; Sulfamoxole; Sulfanilate Zinc; Sulfanitran
Sulfasalazine; Sulfasomizole; Sulfathiazole; Sulfazamet;
Sulfisoxazole; Sulfisoxazole Acetyl; Sulfisoxazole Diolamine;
Sulfomyxin; Sulopenem; Sultamicillin; Suncillin Sodium;
Talampicillin Hydrochloride; Teicoplanin; Temafloxacin
Hydrochloride; Temocillin; Tetracycline; Tetracycline
Hydrochloride; Tetracycline Phosphate Complex; Tetroxoprim;
Thiamphenicol; Thiphencillin Potassium; Ticarcillin Cresyl Sodium;
Ticarcillin Disodium; Ticarcillin Monosodium; Ticlatone; Tiodonium
Chloride; Tobramycin; Tobramycin Sulfate; Tosufloxacin;
Trimethoprim; Trimethoprim Sulfate; Trisulfapyrimidines;
Troleandomycin; Trospectomycin Sulfate; Tyrothricin; Vancomycin;
Vancomycin Hydrochloride; Virginiamycin; and Zorbamycin.
[0237] Antiviral agents are compounds which prevent infection of
cells by viruses or replication of the virus within the cell. There
are many fewer antiviral drugs than antibacterial drugs because the
process of viral replication is so closely related to DNA
replication within the host cell, that non-specific antiviral
agents would often be toxic to the host. There are several stages
within the process of viral infection which can be blocked or
inhibited by antiviral agents. These stages include, attachment of
the virus to the host cell (immunoglobulin or binding peptides),
uncoating of the virus (e.g. amantadine), synthesis or translation
of viral mRNA (e.g. interferon), replication of viral RNA or DNA
(e.g. nucleoside analogues), maturation of new virus proteins (e.g.
protease inhibitors), and budding and release of the virus.
[0238] Nucleotide analogues are synthetic compounds which are
similar to nucleotides, but which have an incomplete or abnormal
deoxyribose or ribose group. Once the nucleotide analogues are in
the cell, they are phosphorylated, producing the triphosphate
formed which competes with normal nucleotides for incorporation
into the viral DNA or RNA. Once the triphosphate form of the
nucleotide analogue is incorporated into the growing nucleic acid
chain, it causes irreversible association with the viral polymerase
and thus chain termination. Nucleotide analogues include, but are
not limited to, acyclovir (used for the treatment of herpes simplex
virus and varicella-zoster virus), gancyclovir (useful for the
treatment of cytomegalovirus), idoxuridine, ribavirin (useful for
the treatment of respiratory syncitial virus), dideoxyinosine,
dideoxycytidine, and zidovudine (azidothymidine).
[0239] The interferons are cytokines which are secreted by
virus-infected cells as well as immune cells. The interferons
function by binding to specific receptors on cells adjacent to the
infected cells, causing the change in the cell which protects it
from infection by the virus. .alpha. and .beta.-interferon also
induce the expression of Class I and Class II MHC molecules on the
surface of infected cells, resulting in increased antigen
presentation for host immune cell recognition. .alpha. and
.beta.-interferons are available as recombinant forms and have been
used for the treatment of chronic hepatitis B and C infection. At
the dosages which are effective for anti-viral therapy, interferons
have severe side effects such as fever, malaise and weight
loss.
[0240] Immunoglobulin therapy is used for the prevention of viral
infection. Immunoglobulin therapy for viral infections is different
than bacterial infections, because rather than being
antigen-specific, the immunoglobulin therapy functions by binding
to extracellular virions and preventing them from attaching to and
entering cells which are susceptible to the viral infection. The
therapy is useful for the prevention of viral infection for the
period of time that the antibodies are present in the host. In
general there are two types of immunoglobulin therapies, normal
immunoglobulin therapy and hyper-immunoglobulin therapy. Normal
immune globulin therapy utilizes a antibody product which is
prepared from the serum of normal blood donors and pooled. This
pooled product contains low titers of antibody to a wide range of
human viruses, such as hepatitis A, parvovirus, enterovirus
(especially in neonates). Hyper-immune globulin therapy utilizes
antibodies which are prepared from the serum of individuals who
have high titers of an antibody to a particular virus. Those
antibodies are then used against a specific virus. Examples of
hyper-immune globulins include zoster immune globulin (useful for
the prevention of varicella in immuno-compromised children and
neonates), human rabies immunoglobulin (useful in the post-exposure
prophylaxis of a subject bitten by a rabid animal), hepatitis B
immune globulin (useful in the prevention of hepatitis B virus,
especially in a subject exposed to the virus), and RSV immune
globulin (useful in the treatment of respiratory syncitial virus
infections).
[0241] Another type of immunoglobulin therapy is active
immunization. This involves the administration of antibodies or
antibody fragments to viral surface proteins. Two types of vaccines
which are available for active immunization of hepatitis B include
serum-derived hepatitis B antibodies and recombinant hepatitis B
antibodies. Both are prepared from HBsAg. The antibodies are
administered in three doses to subjects at high risk of infection
with hepatitis B virus, such as health care workers, sexual
partners of chronic carriers, and infants.
[0242] Thus, anti-viral agents useful in the invention include but
are not limited to immunoglobulins, amantadine, interferon,
nucleoside analogues, and protease inhibitors. Specific examples of
anti-virals include but are not limited to Acemannan; Acyclovir;
Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox;
Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate;
Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride;
Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril;
Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine
Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscamet
Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium;
Idoxuridine; Kethoxal; Lamivudine; Lobucavir; Memotine
Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir;
Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate;
Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine;
Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride;
Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate;
Viroxime; Zalcitabine; Zidovudine; and Zinviroxime.
[0243] Anti-fungal agents are useful for the treatment and
prevention of infective fungi. Anti-fungal agents are sometimes
classified by their mechanism of action. Some anti-fungal agents
function as cell wall inhibitors by inhibiting glucose synthase.
These include, but are not limited to, basiungin/ECB. Other
anti-fungal agents function by destabilizing membrane integrity.
These include, but are not limited to, immidazoles, such as
clotrimazole, sertaconzole, fluconazole, itraconazole,
ketoconazole, miconazole, and voriconacole, as well as FK 463,
amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292,
butenafine, and terbinafine. Other anti-fungal agents function by
breaking down chitin (e.g. chitinase) or immunosuppression (501
cream). Some examples of commercially-available agents are shown in
Table B.
TABLE-US-00003 TABLE B Company Brand Name Generic Name Indication
Mechanism of Action PHARMACIA & PNU 196443 PNU 196443 Anti
Fungal n/k UPJOHN Lilly LY 303366 Basiungin/ECB Fungal Infections
Anti-fungal/cell wall inhibitor, glucose synthase inhibitor Bayer
Canesten Clotrimazole Fungal Infections Membrane integrity
destabilizer Fujisawa FK 463 FK 463 Fungal Infections Membrane
integrity destabilizer Mylan Sertaconzaole Sertaconzole Fungal
Infections Membrane integrity destabilizer Genzyme Chitinase
Chitinase Fungal Infections, Systemic Chitin Breakdown Liposome
Abelcet Amphotericin B, Liposomal Fungal Infections, Systemic
Membrane integrity destabilizer Sequus Amphotec Amphotericin B,
Liposomal Fungal Infections, Systemic Membrane integrity
destabilizer Bayer BAY 38-9502 BAY 38-9502 Fungal Infections,
Systemic Membrane integrity destabilizer Pfizer Diflucan
Fluconazole Fungal Infections, Systemic Membrane integrity
destabilizer Johnson & Johnson Sporanox Itraconazole Fungal
Infections, Systemic Membrane integrity destabilizer Sepracor
Itraconzole (2R, 4S) Itraconzole (2R, 4S) Fungal Infections,
Systemic Membrane integrity destabilizer Johnson & Johnson
Nizoral Ketoconazole Fungal Infections, Systemic Membrane integrity
destabilizer Johnson & Johnson Monistat Miconazole Fungal
Infections, Systemic Membrane integrity destabilizer Merck MK 991
MK 991 Fungal Infections, Systemic Membrane integrity destabilizer
Bristol Myers Sq'b Pradimicin Pradimicin Fungal Infections,
Systemic Membrane integrity destabilizer Pfizer UK-292, 663 UK-292,
663 Fungal Infections, Systemic Membrane integrity destabilizer
Pfizer Voriconazole Voriconazole Fungal Infections, Systemic
Membrane integrity destabilizer Mylan 501 Cream 501 Cream
Inflammatory Fungal Immunosuppression Conditions Mylan Mentax
Butenafine Nail Fungus Membrane Integrity Destabiliser Schering
Plough Anti Fungal Anti Fungal Opportunistic Infections Membrane
Integrity Destabiliser Alza Mycelex Troche Clotrimazole Oral Thrush
Membrane Integrity Stabliser Novartis Lamisil Terbinafine Systemic
Fungal Infections, Membrane Integrity Destabiliser
Onychomycosis
[0244] Thus, the anti-fungal agents useful in the invention include
but are not limited to imidazoles, FK 463, amphotericin B, BAY
38-9502, MK 991, pradimicin, UK 292, butenafine, chitinase, 501
cream, Acrisorcin; Ambruticin; Amorolfine, Amphotericin B;
Azaconazole; Azaserine; Basifungin; Bifonazole; Biphenamine
Hydrochloride; Bispyrithione Magsulfex; Butoconazole Nitrate;
Calcium Undecylenate; Candicidin; Carbol-Fuchsin; Chlordantoin;
Ciclopirox; Ciclopirox Olamine; Cilofungin; Cisconazole;
Clotrimazole; Cuprimyxin; Denofungin; Dipyrithione; Doconazole;
Econazole; Econazole Nitrate; Enilconazole; Ethonam Nitrate;
Fenticonazole Nitrate; Filipin; Fluconazole; Flucytosine;
Fungimycin; Griseofulvin; Hamycin; Isoconazole; Itraconazole;
Kalafungin; Ketoconazole; Lomofungin; Lydimycin; Mepartricin;
Miconazole; Miconazole Nitrate; Monensin; Monensin Sodium;
Naftifine Hydrochloride; Neomycin Undecylenate; Nifuratel;
Nifurmerone; Nitralamine Hydrochloride; Nystatin; Octanoic Acid;
Orconazole Nitrate; Oxiconazole Nitrate; Oxifungin Hydrochloride;
Parconazole Hydrochloride; Partricin; Potassium Iodide; Proclonol;
Pyrithione Zinc; Pyrrolnitrin; Rutamycin; Sanguinarium Chloride;
Saperconazole; Scopafungin; Selenium Sulfide; Sinefungin;
Sulconazole Nitrate; Terbinafine; Terconazole; Thiram; Ticlatone;
Tioconazole; Tolciclate; Tolindate; Tolnaftate; Triacetin;
Triafungin; Undecylenic Acid; Viridofulvin; Zinc Undecylenate; and
Zinoconazole Hydrochloride.
[0245] Immunostimulatory nucleic acids can be combined with other
therapeutic agents such as adjuvants to enhance immune responses.
The immunostimulatory nucleic acid and other therapeutic agent may
be administered simultaneously or sequentially. When the other
therapeutic agents are administered simultaneously they can be
administered in the same or separate formulations, but are
administered at the same time. The other therapeutic agents are
administered sequentially with one another and with
immunostimulatory nucleic acid, when the administration of the
other therapeutic agents and the immunostimulatory nucleic acid is
temporally separated. The separation in time between the
administration of these compounds may be a matter of minutes or it
may be longer. Other therapeutic agents include but are not limited
to adjuvants, cytokines, antibodies, antigens, etc.
[0246] The immunostimulatory nucleic acids are useful as adjuvants
for inducing a systemic immune response. Thus either can be
delivered to a subject exposed to an antigen to produce an enhanced
immune response to the antigen.
[0247] In addition to the immunostimulatory nucleic acids, the
compositions of the invention may also be administered with
non-nucleic acid adjuvants. A non-nucleic acid adjuvant is any
molecule or compound except for the immunostimulatory nucleic acids
described herein which can stimulate the humoral and/or cellular
immune response. Non-nucleic acid adjuvants include, for instance,
adjuvants that create a depo effect, immune stimulating adjuvants,
and adjuvants that create a depo effect and stimulate the immune
system.
[0248] An adjuvant that creates a depo effect as used herein is an
adjuvant that causes the antigen to be slowly released in the body,
thus prolonging the exposure of immune cells to the antigen. This
class of adjuvants includes but is not limited to alum (e.g.,
aluminum hydroxide, aluminum phosphate); or emulsion-based
formulations including mineral oil, non-mineral oil, water-in-oil
or oil-in-water-in oil emulsion, oil-in-water emulsions such as
Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720,
AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing
a stabilizing detergent and a micelle-forming agent; IDEC,
Pharmaceuticals Corporation, San Diego, Calif.).
[0249] An immune stimulating adjuvant is an adjuvant that causes
activation of a cell of the immune system. It may, for instance,
cause an immune cell to produce and secrete cytokines. This class
of adjuvants includes but is not limited to saponins purified from
the bark of the Q. saponaria tree, such as QS21 (a glycolipid that
elutes in the 21.sup.st peak with HPLC fractionation; Aquila
Biopharmaceuticals, Inc., Worcester, Mass.);
poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus
Research Institute, USA); derivatives of lipopolysaccharides such
as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and
threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine
disaccharide related to lipid A; OM Pharma SA, Meyrin,
Switzerland); and Leishmania elongation factor (a purified
Leishmania protein; Corixa Corporation, Seattle, Wash.).
[0250] Adjuvants that create a depo effect and stimulate the immune
system are those compounds which have both of the above-identified
functions. This class of adjuvants includes but is not limited to
ISCOMS (Immunostimulating complexes which contain mixed saponins,
lipids and form virus-sized particles with pores that can hold
antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham
adjuvant system #2 which is an oil-in-water emulsion containing MPL
and QS21: SmithKline Beecham Biologicals [SBB], Rixensart,
Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4 which
contains alum and MPL; SBB, Belgium); non-ionic block copolymers
that form micelles such as CRL 1005 (these contain a linear chain
of hydrophobic polyoxpropylene flanked by chains of
polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant
Formulation (SAF, an oil-in-water emulsion containing Tween 80 and
a nonionic block copolymer; Syntex Chemicals, Inc., Boulder,
Colo.).
[0251] The immunostimulatory nucleic acids are also useful as
mucosal adjuvants. It has previously been discovered that both
systemic and mucosal immunity are induced by mucosal delivery of
CpG nucleic acids. The systemic immunity induced in response to CpG
nucleic acids included both humoral and cell-mediated responses to
specific antigens that were not capable of inducing systemic
immunity when administered alone to the mucosa. Furthermore, both
CpG nucleic acids and cholera toxin (CT, a mucosal adjuvant that
induces a Th2-like response) induced CTL. This was surprising since
with systemic immunization, the presence of Th2-like antibodies is
normally associated with a lack of CTL (Schirmbeck et al., 1995).
Based on the results presented herein it is expected that the
immunostimulatory nucleic acids will function in a similar
manner.
[0252] Additionally, the immunostimulatory nucleic acids induce a
mucosal response at both local (e.g., lung) and remote (e.g., lower
digestive tract) mucosal sites. Significant levels of IgA
antibodies are induced at distant mucosal sites by the
immunostimulatory nucleic acids. CT is generally considered to be a
highly effective mucosal adjuvant. As has been previously reported
(Snider 1995), CT induces predominantly IgG1 isotype of antibodies,
which are indicative of Th2-type response. In contrast, the
immunostimulatory nucleic acids are more Th1 with predominantly
IgG2a antibodies, especially after boost or when the two adjuvants
are combined. Th1-type antibodies in general have better
neutralizing capabilities, and furthermore, a Th2 response in the
lung is highly undesirable because it is associated with asthma
(Kay, 1996, Hogg, 1997). Thus the use of immunostimulatory nucleic
acids as a mucosal adjuvant has benefits that other mucosal
adjuvants cannot achieve. The immunostimulatory nucleic acids of
the invention also are useful as mucosal adjuvants for induction of
both a systemic and a mucosal immune response.
[0253] Mucosal adjuvants referred to as non-nucleic acid mucosal
adjuvants may also be administered with the Immunostimulatory
nucleic acids. A non-nucleic acid mucosal adjuvant as used herein
is an adjuvant other than a immunostimulatory nucleic acid that is
capable of inducing a mucosal immune response in a subject when
administered to a mucosal surface in conjunction with an antigen.
Mucosal adjuvants include but are not limited to Bacterial toxins
e.g., Cholera toxin (CT), CT derivatives including but not limited
to CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998);
CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys)
(Fontana et al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995);
CTD53/K63 (Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54
(Arg to His) (Fontana et al., 1995); CTN107 (His to Asn) (Fontana
et al., 1995); CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K
(Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe)
(Yamamoto et al., 1997a, 1997b); CTS106 (Pro to Lys) (Douce et al.,
1997, Fontana et al., 1995); and CTK63 (Ser to Lys) (Douce et al.,
1997, Fontana et al., 1995), Zonula occludens toxin, zot,
Escherichia coli heat-labile enterotoxin, Labile Toxin (LT), LT
derivatives including but not limited to LT B subunit (LTB)
(Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998,
Douce et al., 1995); LT61F (Ser to Phe) (Komase et al., 1998);
LT112K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu)
(Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998);
LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys)
(Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et
al., 1996); and LTR72 (Ala to Arg) (Giuliani et al., 1998),
Pertussis toxin, PT. (Lycke et al., 1992, Spangler BD, 1992,
Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al.,
1995) including PT-9K/129G (Roberts et al., 1995, Cropley et al.,
1995); Toxin derivatives (see below) (Holmgren et al., 1993,
Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements,
1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL)
(Sasaki et al., 1998, Vancott et al., 1998; Muramyl Dipeptide (MDP)
derivatives (Fukushima et al., 1996, Ogawa et al., 1989, Michalek
et al., 1983, Morisaki et al., 1983); Bacterial outer membrane
proteins (e.g., outer surface protein A (OspA) lipoprotein of
Borrelia burgdorferi, outer membrane protein of Neisseria
meningitidis)(Marinaro et al., 1999, Van de Verg et al., 1996);
Oil-in-water emulsions (e.g., MF59) (Barchfield et al., 1999,
Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka et
al., 1998, 1999); and Saponins (e.g., QS21) Aquila
Biopharmaceuticals, Inc., Worster, Mass.) (Sasaki et al., 1998,
MacNeal et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants
(e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an
oil-in-water emulsion containing a stabilizing detergent and a
micelle-forming agent; IDEC Pharmaceuticals Corporation, San Diego,
Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc.,
Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP
polymer; Virus Research Institute, USA) and Leishmania elongation
factor (Corixa Corporation, Seattle, Wash.).
[0254] Immune responses can also be induced or augmented by the
co-administration or co-linear expression of cytokines (Bueler
& Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997;
Iwasaki et al., 1997; Kim et al., 1997) or B-7 co-stimulatory
molecules (Iwasaki et al., 1997; Tsuji et al, 1997) with the
Immunostimulatory nucleic acids. The cytokines can be administered
directly with Immunostimulatory nucleic acids or may be
administered in the form of a nucleic acid vector that encodes the
cytokine, such that the cytokine can be expressed in vivo. In one
embodiment, the cytokine is administered in the form of a plasmid
expression vector. The term cytokine is used as a generic name for
a diverse group of soluble proteins and peptides which act as
humoral regulators at nano- to picomolar concentrations and which,
either under normal or pathological conditions, modulate the
functional activities of individual cells and tissues. These
proteins also mediate interactions between cells directly and
regulate processes taking place in the extracellular environment.
Examples of cytokines include, but are not limited to IL-1, IL-2,
IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18,
granulocyte-macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), interferon-.alpha.
(.alpha.-IFN), IFN-.alpha., tumor necrosis factor (TNF),
TGF-.beta., FLT-3 ligand, and CD40 ligand.
[0255] Cytokines play a role in directing the T cell response.
Helper (CD4+) T cells orchestrate the immune response of mammals
through production of soluble factors that act on other immune
system cells, including other T cells. Most mature CD4+ T helper
cells express one of two cytokine profiles: Th1 or Th2. The Th1
subset promotes delayed-type hypersensitivity, cell-mediated
immunity, and immunoglobulin class switching to IgG.sub.2a. The Th2
subset induces humoral immunity by activating B cells, promoting
antibody production, and inducing class switching to IgG.sub.1 and
IgE. In some embodiments, it is preferred that the cytokine be a
Th1 cytokine.
[0256] The nucleic acids are also useful for redirecting an immune
response from a Th2 immune response to a Th1 immune response.
Redirection of an immune response from a Th2 to a Th1 immune
response can be assessed by measuring the levels of cytokines
produced in response to the nucleic acid (e.g., by inducing
monocytic cells and other cells to produce Th1 cytokines, including
IL-12, IFN-.gamma. and GM-CSF). The redirection or rebalance of the
immune response from a Th2 to a Th1 response is particularly useful
for the treatment or prevention of asthma. For instance, an
effective amount for treating asthma can be that amount; useful for
redirecting a Th2 type of immune response that is associated with
asthma to a Th1 type of response. Th2 cytokines, especially IL-4
and IL-5 are elevated in the airways of asthmatic subjects. These
cytokines promote important aspects of the asthmatic inflammatory
response, including IgE isotype switching, eosinophil chemotaxis
and activation and mast cell growth. Th1 cytokines, especially
IFN-.gamma. and IL-12, can suppress the formation of Th2 clones and
production of Th2 cytokines. The immunostimulatory nucleic acids of
the invention cause an increase in Th1 cytokines which helps to
rebalance the immune system, preventing or reducing the adverse
effects associated with a predominately Th2 immune response.
[0257] The nucleic acids are also useful for improving survival,
differentiation, activation and maturation of dendritic cells. The
immunostimulatory nucleic acids have the unique capability to
promote cell survival, differentiation, activation and maturation
of dendritic cells. Dendritic precursor cells isolated from blood
by immunomagnetic cell sorting develop morphologic and functional
characteristics of dendritic cells during a two day incubation with
GM-CSF. Without GM-CSF these cells undergo apoptosis. The
immunostimulatory nucleic acids are superior to GM-CSF in promoting
survival and differentiation of dendritic cells (MHC II expression,
cell size, granularity). The immunostimulatory nucleic acids also
induce maturation of dendritic cells. Since dendritic cells form
the link between the innate and the acquired immune system, by
presenting antigens as well as through their expression of pattern
recognition receptors which detect microbial molecules like LPS in
their local environment, the ability to activate dendritic cells
with immunostimulatory nucleic acids supports the use of these
immunostimulatory nucleic acid based strategies for in vivo and
ex-vivo immunotherapy against disorders such as cancer and allergic
or infectious diseases. The immunostimulatory nucleic acids are
also useful for activating and inducing maturation of dendritic
cells.
[0258] Immunostimulatory nucleic acids also increase natural killer
cell lytic activity and antibody dependent cellular cytotoxicity
(ADCC). ADCC can be performed using a immunostimulatory nucleic
acid in combination with an antibody specific for a cellular
target, such as a cancer cell. When the immunostimulatory nucleic
acid is administered to a subject in conjunction with the antibody
the subject's immune system is induced to kill the tumor cell. The
antibodies useful in the ADCC procedure include antibodies which
interact with a cell in the body. Many such antibodies specific for
cellular targets have been described in the art and many are
commercially available. Examples of these antibodies are listed
below among the list of cancer immunotherapies.
[0259] The immunostimulatory nucleic acids may also be administered
in conjunction with an anti-cancer therapy. Anti-cancer therapies
include cancer medicaments, radiation and surgical procedures. As
used herein, a "cancer medicament" refers to a agent which is
administered to a subject for the purpose of treating a cancer. As
used herein, "treating cancer" includes preventing the development
of a cancer, reducing the symptoms of cancer, and/or inhibiting the
growth of an established cancer. In other aspects, the cancer
medicament is administered to a subject at risk of developing a
cancer for the purpose of reducing the risk of developing the
cancer. Various types of medicaments for the treatment of cancer
are described herein. For the purpose of this specification, cancer
medicaments are classified as chemotherapeutic agents,
immunotherapeutic agents, cancer vaccines, hormone therapy, and
biological response modifiers.
[0260] As used herein, a "cancer medicament" refers to an agent
which is administered to a subject for the purpose of treating a
cancer. As used herein, "treating cancer" includes preventing the
development of a cancer, reducing the symptoms of cancer, and/or
inhibiting the growth of an established cancer. In other aspects,
the cancer medicament is administered to a subject at risk of
developing a cancer for the purpose of reducing the risk of
developing the cancer. Various types of medicaments for the
treatment of cancer are described herein. For the purpose of this
specification, cancer medicaments are classified as
chemotherapeutic agents, immunotherapeutic agents, cancer vaccines,
hormone therapy, and biological response modifiers. Additionally,
the methods of the invention are intended to embrace the use of
more than one cancer medicament along with the immunostimulatory
nucleic acids. As an example, where appropriate, the
immunostimulatory nucleic acids may be administered with a both a
chemotherapeutic agent and an immunotherapeutic agent.
Alternatively, the cancer medicament may embrace an
immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic
agent and a cancer vaccine, or a chemotherapeutic agent, an
immunotherapeutic agent and a cancer vaccine all administered to
one subject for the purpose of treating a subject having a cancer
or at risk of developing a cancer.
[0261] Cancer medicaments function in a variety of ways. Some
cancer medicaments work by targeting physiological mechanisms that
are specific to tumor cells. Examples include the targeting of
specific genes and their gene products (i.e., proteins primarily)
which are mutated in cancers. Such genes include but are not
limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor
genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4,
p21, telomerase). Cancer medicaments can alternately target signal
transduction pathways and molecular mechanisms which are altered in
cancer cells. Targeting of cancer cells via the epitopes expressed
on their cell surface is accomplished through the use of monoclonal
antibodies. This latter type of cancer medicament is generally
referred to herein as immunotherapy.
[0262] Other cancer medicaments target cells other than cancer
cells. For example, some medicaments prime the immune system to
attack tumor cells (i.e., cancer vaccines). Still other
medicaments, called angiogenesis inhibitors, function by attacking
the blood supply of solid tumors. Since the most malignant cancers
are able to metastasize (i.e., exist the primary tumor site and
seed a distal tissue, thereby forming a secondary tumor),
medicaments that impede this metastasis are also useful in the
treatment of cancer. Angiogenic mediators include basic FGF, VEGF,
angiopoietins, angiostatin, endostatin, TNF.alpha., TNP-470,
thrombospondin-1, platelet factor 4, CAI, and certain members of
the integrin family of proteins. One category of this type of
medicament is a metalloproteinase inhibitor, which inhibits the
enzymes used by the cancer cells to exist the primary tumor site
and extravasate into another tissue.
[0263] Some cancer cells are antigenic and thus can be targeted by
the immune system. In one aspect, the combined administration of
immunostimulatory nucleic acids and cancer medicaments,
particularly those which are classified as cancer immunotherapies,
is useful for stimulating a specific immune response against a
cancer antigen. A "cancer antigen" as used herein is a compound,
such as a peptide, associated with a tumor or cancer cell surface
and which is capable of provoking an immune response when expressed
on the surface of an antigen presenting cell in the context of an
MHC molecule. Cancer antigens, such as those present in cancer
vaccines or those used to prepare cancer immunotherapies, can be
prepared from crude cancer cell extracts, as described in Cohen, et
al., 1994, Cancer Research, 54:1055, or by partially purifying the
antigens, using recombinant technology, or de novo synthesis of
known antigens. Cancer antigens can be used in the form of
immunogenic portions of a particular antigen or in some instances a
whole cell or a tumor mass can be used as the antigen. Such
antigens can be isolated or prepared recombinantly or by any other
means known in the art.
[0264] The theory of immune surveillance is that a prime function
of the immune system is to detect and eliminate neoplastic cells
before a tumor forms. A basic principle of this theory is that
cancer cells are antigenically different from normal cells and thus
elicit immune reactions that are similar to those that cause
rejection of immunologically incompatible allografts. Studies have
confirmed that tumor cells differ, either qualitatively or
quantitatively, in their expression of antigens. For example,
"tumor-specific antigens" are antigens that are specifically
associated with tumor cells but not normal cells. Examples of tumor
specific antigens are viral antigens in tumors induced by DNA or
RNA viruses. "Tumor-associated" antigens are present in both tumor
cells and normal cells but are present in a different quantity or a
different form in tumor cells. Examples of such antigens are
oncofetal antigens (e.g., carcinoembryonic antigen),
differentiation antigens (e.g., T and Tn antigens), and oncogene
products (e.g., HER/neu).
[0265] Different types of cells that can kill tumor targets in
vitro and in vivo have been identified: natural killer cells (NK
cells), cytolytic T lymphocytes (CTLs), lymphokine-activated killer
cells (LAKs), and activated macrophages. NK cells can kill tumor
cells without having been previously sensitized to specific
antigens, and the activity does not require the presence of class I
antigens encoded by the major histocompatibility complex (MHC) on
target cells. NK cells are thought to participate in the control of
nascent tumors and in the control of metastatic growth. In contrast
to NK cells, CTLs can kill tumor cells only after they have been
sensitized to tumor antigens and when the target antigen is
expressed on the tumor cells that also express MHC class I. CTLs
are thought to be effector cells in the rejection of transplanted
tumors and of tumors caused by DNA viruses. LAK cells are a subset
of null lymphocytes distinct from the NK and CTL populations.
Activated macrophages can kill tumor cells in a manner that is not
antigen dependent nor MHC restricted once activated. Activated
macrophages are through to decrease the growth rate of the tumors
they infiltrate. In vitro assays have identified other immune
mechanisms such as antibody-dependent, cell-mediated cytotoxic
reactions and lysis by antibody plus complement. However, these
immune effector mechanisms are thought to be less important in vivo
than the function of NK, CTLs, LAK, and macrophages in vivo (for
review see Piessens, W. F., and David, J., "Tumor Immunology", In:
Scientific American Medicine, Vol. 2, Scientific American Books,
N.Y., pp. 1-13, 1996.
[0266] The goal of immunotherapy is to augment a patient's immune
response to an established tumor. One method of immunotherapy
includes the use of adjuvants. Adjuvant substances derived from
microorganisms, such as bacillus Calmette-Guerin, heighten the
immune response and enhance resistance to tumors in animals.
[0267] Immunotherapeutic agents are medicaments which derive from
antibodies or antibody fragments which specifically bind or
recognize a cancer antigen. As used herein a cancer antigen is
broadly defined as an antigen expressed by a cancer cell.
Preferably, the antigen is expressed at the cell surface of the
cancer cell. Even more preferably, the antigen is one which is not
expressed by normal cells, or at least not expressed to the same
level as in cancer cells. Antibody-based immunotherapies may
function by binding to the cell surface of a cancer cell and
thereby stimulate the endogenous immune system to attack the cancer
cell. Another way in which antibody-based therapy functions is as a
delivery system for the specific targeting of toxic substances to
cancer cells. Antibodies are usually conjugated to toxins such as
ricin (e.g., from castor beans), calicheamicin and maytansinoids,
to radioactive isotopes such as Iodine-131 and Yttrium-90, to
chemotherapeutic agents (as described herein), or to biological
response modifiers. In this way, the toxic substances can be
concentrated in the region of the cancer and non-specific toxicity
to normal cells can be minimized. In addition to the use of
antibodies which are specific for cancer antigens, antibodies which
bind to vasculature, such as those which bind to endothelial cells,
are also useful in the invention. This is because generally solid
tumors are dependent upon newly formed blood vessels to survive,
and thus most tumors are capable of recruiting and stimulating the
growth of new blood vessels. As a result, one strategy of many
cancer medicaments is to attack the blood vessels feeding a tumor
and/or the connective tissues (or stroma) supporting such blood
vessels.
[0268] The use of immunostimulatory nucleic acids in conjunction
with immunotherapeutic agents such as monoclonal antibodies is able
to increase long-term survival through a number of mechanisms
including significant enhancement of ADCC (as discussed above),
activation of natural killer (NK) cells and an increase in
IFN.alpha. levels. The nucleic acids when used in combination with
monoclonal antibodies serve to reduce the dose of the antibody
required to achieve a biological result.
[0269] Examples of cancer immunotherapies which are currently being
used or which are in development are listed in Table C.
TABLE-US-00004 TABLE C Cancer Immunotherapies in Development or on
the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION
IDEC/Genentech, Inc./Hoffmann- Rituxan .TM. (rituximab, Mabthera)
(IDEC- non-Hodgkin's lymphoma LaRoche (first monoclonal C2B8,
chimeric murine/human anti-CD20 antibody licensed for the MAb)
treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche
Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet
(CYT-424) radiotherapeutic agent Bone metastases
Centocor/Glaxo/Ajinomoto Panorex .RTM. (17-1A) (murine monoclonal
Adjuvant therapy for antibody) colorectal (Dukes-C)
Centocor/Ajinomoto Panorex .RTM. (17-1A) (chimeric murine
Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8
(murine, anti-CD20 MAb non-Hodgkin's lymhoma labeled with
Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the
GD.sub.3 Small cell lung epitope) (with BCG) ImClone Systems C225
(chimeric monoclonal antibody to Renal cell epidermal growth factor
receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1
monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to
131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute
myleoid leukemia Techniclone .sup.131I LYM-1 (Oncolym .TM.)
non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. Acute promyelocytic
leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head
& neck, non-small antibody) + cisplatin or radiation cell lung
cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA125,
Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar
(anti-CD20 Mab labeled with .sup.131I) non-Hodgkin's lymphoma have
been positive, but the drug has been associated with significant
bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN .RTM.
Kaposi's sarcoma IDEC Pharmaceuticals Rituxan .TM. (MAb against
CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo. with
chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte
antigen Chronic lymphocytic CAMPATH leukemia (CLL) Center of
Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast,
ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2
bispecific Prostate, non-small cell antibody) lung, pancreatic,
breast Medarex MDX-11 (complement activating receptor Acute
myelogenous (CAR) monoclonal antibody) leukemia (AML)
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and
colon antibody) Medarex MDX-11 (complement activating receptor Ex
vivo bone marrow (CAR) monoclonal antibody) purging in acute
myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific
antibody, Acute myleoid leukemia MAb-conjugates) (complement
cascade activators) Cytogen OV103 (Yttrium-90 labelled antibody)
Ovarian Cytogen OV103 (Yttrium-90 labelled antibody) Prostate
Aronex Pharmaceuticals, Inc. ATRAGEN .RTM. non-Hodgkin's lymphoma
Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A)
non-small cell lung, pancarcinoma antigen on adenocarcinomas
prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits
angiogenesis) Lung, breast, prostate, colorectal Protein Design
Labs Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab,
humanized) Protein Design Labs SMART M195 Ab, humanized Acute
promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr
monoclonal Breast antibody) + taxol ImClone Systems (licensed from
C225 (chimeric anti-EGFr monoclonal prostate RPR) antibody) +
doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal
prostate antibody) + adriamycin ImClone Systems BEC2
(anti-idiotypic MAb, mimics the GD.sub.3 Melanoma epitope) Medarex
MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex
MDX-220 (bispecific for tumors that express Lung, colon, prostate,
TAG-72) ovarian, endometrial, pancreatic and gastric
Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate
antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor
EGF receptor cancers bispecific antibody) (head & neck,
prostate, lung, bladder, cervical, ovarian) Medarex/Novartis
MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G-
antibody) CSF for various cancers, esp. breast IDEC MELIMMUNE-2
(murine monoclonal Melanoma antibody therapeutic vaccine) IDEC
MELIMMUNE-1 (murine monoclonal Melanoma antibody therapeutic
vaccine) Immunomedics, Inc. CEACIDE .TM. (I-131) Colorectal and
other NeoRx Pretarget .TM. radioactive antibodies non-Hodgkin's B
cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma
specific Ab) Cancer Techniclone Corporation/ TNT (chimeric MAb to
histone antigens) Brain Cambridge Antibody Technology Techniclone
International/ TNT (chimeric MAb to histone antigens) Brain
Cambridge Antibody Technology Novopharm Gliomab-H
(Monoclonals-Humanized Abs) Brain, melanomas, neuroblastomas
Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000
(chimeric-EGF antagonist) Cancer Immunomedics LymphoCide (humanized
LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676
(monoclonal antibody conjugate) Acute myelogenous leukemia
Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic
Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, small-cell
lung Center of Molecular Immunology ior egf/r3 (anti EGF-R
humanized Ab) Radioimmunotherapy Center of Molecular Immunology ior
c5 (murine MAb colorectal) for Colorectal radioimmunotherapy
Creative BioMolecules/ BABS (biosynthetic antibody binding site)
Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2
(monoclonal antibody to fetal liver Tumor-associated kinase-2
(FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/small-drug
conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets
GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab
Cancer Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein
Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon
Immunomedics, Inc. ImmuRAIT-CEA Colorectal
[0270] Yet other types of chemotherapeutic agents which can be used
according to the invention include Aminoglutethimide, Asparaginase,
Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine
sulfate.
[0271] Cancer vaccines are medicaments which are intended to
stimulate an endogenous immune response against cancer cells.
Currently produced vaccines predominantly activate the humoral
immune system (i.e., the antibody dependent immune response). Other
vaccines currently in development are focused on activating the
cell-mediated immune system including cytotoxic T lymphocytes which
are capable of killing tumor cells. Cancer vaccines generally
enhance the presentation of cancer antigens to both antigen
presenting cells (e.g., macrophages and dendritic cells) and/or to
other immune cells such as T cells, B cells, and NK cells.
[0272] Although cancer vaccines may take one of several forms, as
discussed infra, their purpose is to deliver cancer antigens and/or
cancer associated antigens to antigen presenting cells (APC) in
order to facilitate the endogenous processing of such antigens by
APC and the ultimate presentation of antigen presentation on the
cell surface in the context of MHC class I molecules. One form of
cancer vaccine is a whole cell vaccine which is a preparation of
cancer cells which have been removed from a subject, treated ex
vivo and then reintroduced as whole cells in the subject. Lysates
of tumor cells can also be used as cancer vaccines to elicit an
immune response. Another form cancer vaccine is a peptide vaccine
which uses cancer-specific or cancer-associated small proteins to
activate T cells. Cancer-associated proteins are proteins which are
not exclusively expressed by cancer cells (i.e., other normal cells
may still express these antigens). However, the expression of
cancer-associated antigens is generally consistently upregulated
with cancers of a particular type. Yet another form of cancer
vaccine is a dendritic cell vaccine which includes whole dendritic
cells which have been exposed to a cancer antigen or a
cancer-associated antigen in vitro. Lysates or membrane fractions
of dendritic cells may also be used as cancer vaccines. Dendritic
cell vaccines are able to activate antigen-presenting cells
directly. Other cancer vaccines include ganglioside vaccines,
heat-shock protein vaccines, viral and bacterial vaccines, and
nucleic acid vaccines.
[0273] The use of immunostimulatory nucleic acids in conjunction
with cancer vaccines provides an improved antigen-specific humoral
and cell mediated immune response, in addition to activating NK
cells and endogenous dendritic cells, and increasing IFN.alpha.
levels. This enhancement allows a vaccine with a reduced antigen
dose to be used to achieve the same beneficial effect. In some
instances, cancer vaccines may be used along with adjuvants, such
as those described above.
[0274] As used herein, the terms "cancer antigen" and "tumor
antigen" are used interchangeably to refer to antigens which are
differentially expressed by cancer cells and can thereby be
exploited in order to target cancer cells. Cancer antigens are
antigens which can potentially stimulate apparently tumor-specific
immune responses. Some of these antigens are encoded, although not
necessarily expressed, by normal cells. These antigens can be
characterized as those which are normally silent (i.e., not
expressed) in normal cells, those that are expressed only at
certain stages of differentiation and those that are temporally
expressed such as embryonic and fetal antigens. Other cancer
antigens are encoded by mutant cellular genes, such as oncogenes
(e.g., activated ras oncogene), suppressor genes (e.g., mutant
p53), fusion proteins resulting from internal deletions or
chromosomal translocations. Still other cancer antigens can be
encoded by viral genes such as those carried on RNA and DNA tumor
viruses.
[0275] Other vaccines take the form of dendritic cells which have
been exposed to cancer antigens in vitro, have processed the
antigens and are able to express the cancer antigens at their cell
surface in the context of MHC molecules for effective antigen
presentation to other immune system cells.
[0276] The immunostimulatory nucleic acids are used in one aspect
of the invention in conjunction with cancer vaccines which are
dendritic cell based. A dendritic cell is a professional antigen
presenting cell. Dendritic cells form the link between the innate
and the acquired immune system by presenting antigens and through
their expression of pattern recognition receptors which detect
microbial molecules like LPS in their local environment. Dendritic
cells efficiently internalize, process, and present soluble
specific antigen to which it is exposed. The process of
internalizing and presenting antigen causes rapid upregulation of
the expression of major histocompatibility complex (MHC) and
costimulatory molecules, the production of cytokines, and migration
toward lymphatic organs where they are believed to be involved in
the activation of T cells.
[0277] Table D lists a variety of cancer vaccines which are either
currently being used or are in development.
TABLE-US-00005 TABLE D Cancer Vaccines in Development or on the
Market MARKETER BRAND NAME (GENERIC NAME) INDICATION Center of
Molecular EGF Cancer Immunology Center of Molecular Ganglioside
cancer Immunology vaccine Center of Molecular Anti-idiotypic Cancer
vaccine Immunology ImClone Systems/Memorial Gp75 antigen Melanoma
Sloan-Kettering Cancer Center ImClone Systems/Memorial
Anti-idiotypic Abs Cancer vaccines Sloan-Kettering Cancer Center
Progenics Pharmaceuticals, Inc. GMK melanoma vaccine Melanoma
Progenics Pharmaceuticals, Inc, MGV ganglioside conjugate vaccine
Lymphoma, colorectal, lung Corixa Her2/neu Breast, ovarian AltaRex
Ovarex Ovarian AVAX Technologies Inc. M-Vax, autologous whole cell
Melanoma AVAX Technologies Inc. 0-Vax, autologous whole cell
Ovarian AVAX Technologies Inc. L-Vax, autologous whole cell
Leukemia-AML Biomira Inc./Chiron Theratope, STn-KLH Breast,
Colorectal Biomira Inc. BLP25, MUC-1 peptide vaccine encapsulated
Lung in liposomal delivery system Biomira Inc. BLP25, MUC-1 peptide
vaccine encapsulated Lung in liposomal delivery system + Liposomal
IL-2 Biomira Inc. Liposomal idiotypic vaccine Lymphoma B-cell
malignancies Ribi Immunochem Melacine, cell lysate Melanoma Corixa
Peptide antigens, microsphere delivery sysem Breast and LeIF
adjuvant Corixa Peptide antigens, microsphere delivery sysem
Prostate and LeIF adjuvant Corixa Peptide antigens, microsphere
delivery sysem Ovarian and LeIF adjuvant Corixa Peptide antigens,
microsphere delivery sysem Lymphoma and LeIF adjuvant Corixa
Peptide antigens, microsphere delivery sysem Lung and LeIF adjuvant
Virus Research Institute Toxin/antigen recombinant delivery system
All cancers Apollon Inc. Genevax-TCR T-cell lymphoma Bavarian
Nordic Research MVA-based (vaccinia virus) vaccine Melanoma
Institute A/S BioChem Pharma/BioChem PACIS, BCG vaccine Bladder
Vaccine Cantab Pharmaceuticals TA-HPV Cervical Cantab
Pharmaceuticals TA-CIN Cervical Cantab Pharmaceuticals DISC-Virus,
immunotherapy Cancer Pasteur Merieux Connaught ImmuCyst
.RTM./TheraCys .RTM. - BCG Bladder Immunotherapeutic (Bacillus
Calmette- Guerin/Connaught), for intravesical treatment of
superficial bladder cancer
[0278] As used herein, chemotherapeutic agents embrace all other
forms of cancer medicaments which do not fall into the categories
of immunotherapeutic agents or cancer vaccines. Chemotherapeutic
agents as used herein encompass both chemical and biological
agents. These agents function to inhibit a cellular activity which
the cancer cell is dependent upon for continued survival.
Categories of chemotherapeutic agents include alkylating/alkaloid
agents, antimetabolites, hormones or hormone analogs, and
miscellaneous antineoplastic drugs. Most if not all of these agents
are directly toxic to cancer cells and do not require immune
stimulation. Combination chemotherapy and immunostimulatory nucleic
acid administration increases the maximum tolerable dose of
chemotherapy.
[0279] Chemotherapeutic agents which are currently in development
or in use in a clinical setting are shown in Table E.
TABLE-US-00006 TABLE E Cancer Drugs in Development or on the Market
Marketer Brand Name Generic Name Indication Abbott TNP 470/AGM 1470
Fragyline Anti-Angiogenesis in Cancer Takeda TNP 470/AGM 1470
Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA
Meglamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder
Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin
Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer
Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed
Cancer (b) Undisclosed Cancer (b) Cancer Bristol Myers RAS Famesyl
Transferase RAS FamesylTransferase Cancer Squib Inhibitor Inhibitor
Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY 12-9566
Cancer Merck Famesyl Transferase Inhibitor Famesyl Transferase
Cancer (Solid tumors - Inhibitor pancrease, colon, lung, breast)
Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE Tyrosine Kinase
Cancer, angiogenesis Lilly MTA/LY 231514 MTA/LY 231514 Cancer Solid
Tumors Lilly LY 264618/Lometexol Lometexol Cancer Solid Tumors
Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast,
linolenate) colon Warner Lambert CI-994 CI-994 Cancer, Solid
Tumors/ Leukemia Schering AG Angiogenesis inhibitor Angiogenesis
Inhibitor Cancer/Cardio Takeda TNP-470 n/k Malignant Tumor
Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer Beecham
Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer Novartis
Valspodar PSC 833 Myeloid Leukemia/Ovarian Cancer Immunex
Novantrone Mitoxantrone Pain related to hormone refractory prostate
cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF
Anti-VEGF Prostate/Breast/Colorectal/ NSCL Cancer British Biotech
Batimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid
Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682
CS-682 Solid Tumors Agouron AG2037 AG2037 Solid Tumors IDEC Pharma
9-AC 9-AC Solid Tumors Agouron VEGF/b-FGF Inhibitors VEGF/b-FGF
Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors/Macular
Degen Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853 VX-853
Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors
Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698
Solid Tumors Tanube Seiyaku TA 2516 Marimistat Solid Tumors British
Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP
845 Aggrecanase Inhibitor Solid Tumors/Breast Cancer Chiroscience
D2163 D2163 Solid Tumors/Metastases Warner Lambert PD 183805 PD
183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi Lemonal DP 2202
Lemonal DP 2202 Anti-Cancer Fujisawa FK 317 FK 317 Anticancer
Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD
32/valrubicin Valrubicin Bladder Cancer-Refractory Amersham Insitu
Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer
(adjunt therapy, Amersham Pain) Schering Plough Temodal
Temozolomide Brain Tumours Schering Plough Temodal Temozolonide
Brain Tumours Liposome Evacet Doxorubicin, Liposomal Breast Cancer
Nycomed Yewtaxan Paclitaxel Breast Cancer Advanced, Amersham
Ovarian Cancer Advanced Bristol Myers Taxol Paclitaxel Breast
Cancer Advanced, Squib Ovarian Cancer Advanced, NSCLC Roche Xeloda
Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon
Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer
Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia
Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone
Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Novantrone
Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer
Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer
Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol Myers
BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squib Bristol Myers
UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Cancer Oral Squib Johnson
& Ergamisol Levamisole Cancer Therapy Johnson Glaxo Wellcome
Eniluracil/776C85 5FU Enhancer Cancer, Refractory Solid &
Colorectal Cancer Johnson & Ergamisol Levamisole Colon Cancer
Johnson Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical
Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer,
Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer,
Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy
Cell Leukaemia Johnson Ivax Paxene Paclitaxel Kaposi Sarcoma Sequus
Doxil Doxorubicin, Liposomal KS/Cancer Sequus Caelyx Doxorubicin,
Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia
Pharmacia & Pharmorubicin Epirubicin Lung/Breast Cancer Upjohn
Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839
Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553
Bis-Naphtalimide Oncology BASF LU 103793 Dolastain Oncology Shering
Plough Caetyx Doxorubicin-Liposome Ovarian/Breast Cancer Lilly
Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer,
Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed
Platinum based NSCL, ovarian etc. Yamanouchi YM 116 YM 116 Prostate
Cancer Nycomed Seeds/I-125 Rapid St Lodine Seeds Prostate Cancer
Amersham Agouron Cdk4/cdk2 inhibitors cdk4/cdk2 inhibitors Solid
Tumors Agouron PARP inhibitors PARP Inhibitors Solid Tumors
Chiroscience D4809 Dexifosamide Solid Tumors Bristol Myers UFT
(Tegafur/Uracil) UFT (Tegafur/Uracil) Solid Tumors Squib Sankyo
Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide
Solid Tumors Bristol Meyers Ifex/Mesnex Ifosamide Solid Tumors
Squib Bristol Myers Vumon Teniposide Solid Tumors Squib Bristol
Myers Paraplatin Carboplatin Solid Tumors Squib Bristol Myers
Plantinol Cisplatin, Stealth Solid Tumors Squib Bristol Myers
Plantinol Cisplatin Solid Tumors Squib Bristol Myers Vepeside
Etoposide Solid Tumors Melanoma Squib Zeneca ZD 9331 ZD 9331 Solid
Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors,
Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast
Cancer Glaxo Wellcome Prodrug of guanine Prodrug of arabinside T
Cell Leukemia/Lymphoma arabinside & B Cell Neoplasm Bristol
Myers Taxane Analog Taxane Analog Taxol follow up Squib
[0280] In one embodiment, the methods of the invention use
immunostimulatory nucleic acids as a replacement to the use of
IFN.alpha. therapy in the treatment of cancer. Currently, some
treatment protocols call for the use of IFN.alpha.. Since
IFN.alpha. is produced following the administration of some
immunostimulatory nucleic acids, these nucleic acids can be used to
generate IFN.alpha. endogenously.
[0281] The invention also includes a method for inducing antigen
non-specific innate immune activation and broad spectrum resistance
to infectious challenge using the immunostimulatory nucleic acids.
The term antigen non-specific innate immune activation as used
herein refers to the activation of immune cells other than B cells
and for instance can include the activation of NK cells, T cells or
other immune cells that can respond in an antigen independent
fashion or some combination of these cells. A broad spectrum
resistance to infectious challenge is induced because the immune
cells are in active form and are primed to respond to any invading
compound or microorganism. The cells do not have to be specifically
primed against a particular antigen. This is particularly useful in
biowarfare, and the other circumstances described above such as
travelers.
[0282] The stimulation index of a particular immunostimulatory
nucleic acid can be tested in various immune cell assays.
Preferably, the stimulation index of the immunostimulatory nucleic
acid with regard to B cell proliferation is at least about 5,
preferably at least about 10, more preferably at least about 15 and
most preferably at least about 20 as determined by incorporation of
.sup.3H uridine in a murine B cell culture, which has been
contacted with 20 .mu.M of nucleic acid for 20 h at 37.degree. C.
and has been pulsed with 1 .mu.Ci of .sup.3H uridine; and harvested
and counted 4 h later as described in detail in PCT Published
Patent Applications PCT/U.S. 95/01570 (WO 96/02555) and PCT/U.S.
97/19791 (WO 98/18810) claiming priority to U.S. Ser. Nos.
08/386,063, now U.S. Pat. Nos. 6,194,388, and 08/960,774, now U.S.
Pat. No. 6,239,116, filed on Feb. 7, 1995 and Oct. 30, 1997
respectively. For use in vivo, for example, it is important that
the immunostimulatory nucleic acids be capable of effectively
inducing an immune response, such as, for example, antibody
production.
[0283] Immunostimulatory nucleic acids are effective in non-rodent
vertebrate. Different immunostimulatory nucleic acid can cause
optimal immune stimulation depending on the type of subject and the
sequence of the immunostimulatory nucleic acid. Many vertebrates
have been found according to the invention to be responsive to the
same class of immunostimulatory nucleic acids, sometimes referred
to as human specific immunostimulatory nucleic acids. Rodents,
however, respond to different nucleic acids. As shown herein an
immunostimulatory nucleic acid causing optimal stimulation in
humans may not generally cause optimal stimulation in a mouse and
vice versa. An immunostimulatory nucleic acid causing optimal
stimulation in humans often does, however, cause optimal
stimulation in other animals such as cow, horses, sheep, etc. One
of skill in the art can identify the optimal nucleic acid sequences
useful for a particular species of interest using routine assays
described herein and/or known in the art, using the guidance
supplied herein.
[0284] The immunostimulatory nucleic acids may be directly
administered to the subject or may be administered in conjunction
with a nucleic acid delivery complex. A nucleic acid delivery
complex shall mean a nucleic acid molecule associated with (e.g.
ionically or covalently bound to; or encapsulated within) a
targeting means (e.g. a molecule that results in higher affinity
binding to target cell (e.g., B cell surfaces and/or increased
cellular uptake by target cells). Examples of nucleic acid delivery
complexes include nucleic acids associated with a sterol (e.g.
cholesterol), a lipid (e.g. a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g. a ligand
recognized by target cell specific receptor). Preferred complexes
may be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex can be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
[0285] Delivery vehicles or delivery devices for delivering antigen
and nucleic acids to surfaces have been described. The
Immunostimulatory nucleic acid and/or the antigen and/or other
therapeutics may be administered alone (e.g., in saline or buffer)
or using any delivery vehicles known in the art. For instance the
following delivery vehicles have been described: Cochleates
(Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al.,
1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et
al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers
et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b);
Live bacterial vectors (e.g., Salmonella, Escherichia coli,
Bacillus calmatte-guerin, Shigella, Lactobacillus) (Hone et al.,
1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al.,
1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia,
adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et
al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et
al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996,
Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994,
Eldridge et al., 1989); Nucleic acid vaccines (Fynan et al., 1993,
Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii
et al., 1997); Polymers (e.g. carboxymethylcellulose, chitosan)
(Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings
(Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et
al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998);
Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et
al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995,
Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl
et al., 1998). Other delivery vehicles are known in the art and
some additional examples are provided below in the discussion of
vectors.
[0286] The term effective amount of a immunostimulatory nucleic
acid refers to the amount necessary or sufficient to realize a
desired biologic effect. For example, an effective amount of a
immunostimulatory nucleic acid for inducing mucosal immunity is
that amount necessary to cause the development of IgA in response
to an antigen upon exposure to the antigen, whereas that amount
required for inducing systemic immunity is that amount necessary to
cause the development of IgG in response to an antigen upon
exposure to the antigen. Combined with the teachings provided
herein, by choosing among the various active compounds and weighing
factors such as potency, relative bioavailability, patient body
weight, severity of adverse side-effects and preferred mode of
administration, an effective prophylactic or therapeutic treatment
regimen can be planned which does not cause substantial toxicity
and yet is entirely effective to treat the particular subject. The
effective amount for any particular application can vary depending
on such factors as the disease or condition being treated, the
particular immunostimulatory nucleic acid being administered, the
antigen, the size of the subject, or the severity of the disease or
condition. One of ordinary skill in the art can empirically
determine the effective amount of a particular immunostimulatory
nucleic acid and/or antigen and/or other therapeutic agent without
necessitating undue experimentation.
[0287] Subject doses of the compounds described herein for mucosal
or local delivery typically range from about 0.1 .mu.g to 10 mg per
administration, which depending on the application could be given
daily, weekly, or monthly and any other amount of time
therebetween. More typically mucosal or local doses range from
about 10 .mu.g to 5 mg per administration, and most typically from
about 100 .mu.g to 1 mg, with 2-4 administrations being spaced days
or weeks apart. More typically, immune stimulant doses range from 1
.mu.g to 10 mg per administration, and most typically 10 .mu.g to 1
mg, with daily or weekly administrations. Subject doses of the
compounds described herein for parenteral delivery for the purpose
of inducing an antigen-specific immune response, wherein the
compounds are delivered with an antigen but not another therapeutic
agent are typically 5 to 10,000 times higher than the effective
mucosal dose for vaccine adjuvant or immune stimulant applications,
and more typically 10 to 1,000 times higher, and most typically 20
to 100 times higher. Doses of the compounds described herein for
parenteral delivery for the purpose of inducing an innate immune
response or for increasing ADCC or for inducing an antigen specific
immune response when the immunostimulatory nucleic acids are
administered in combination with other therapeutic agents or in
specialized delivery vehicles typically range from about 0.1 .mu.g
to 10 mg per administration, which depending on the application
could be given daily, weekly, or monthly and any other amount of
time therebetween. More typically parenteral doses for these
purposes range from about 10 .mu.g to 5 mg per administration, and
most typically from about 100 .mu.g to 1 mg, with 2-4
administrations being spaced days or weeks apart. In some
embodiments, however, parenteral doses for these purposes may be
used in a range of 5 to 10,000 times higher than the typical doses
described above.
[0288] For any compound described herein the therapeutically
effective amount can be initially determined from animal models. A
therapeutically effective dose can also be determined from human
data for CpG oligonucleotides which have been tested in humans
(human clinical trials have been initiated) and for compounds which
are known to exhibit similar pharmacological activities, such as
other mucosal adjuvants, e.g., LT and other antigens for
vaccination purposes, for the mucosal or local administration.
Higher doses are required for parenteral administration. The
applied dose can be adjusted based on the relative bioavailability
and potency of the administered compound. Adjusting the dose to
achieve maximal efficacy based on the methods described above and
other methods as are well-known in the art is well within the
capabilities of the ordinarily skilled artisan.
[0289] The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0290] For use in therapy, an effective amount of the
immunostimulatory nucleic acid can be administered to a subject by
any mode that delivers the nucleic acid to the desired surface,
e.g., mucosal, systemic. Administering the pharmaceutical
composition of the present invention may be accomplished by any
means known to the skilled artisan. Preferred routes of
administration include but are not limited to oral, parenteral,
intramuscular, intranasal, intratracheal, inhalation, ocular,
vaginal, and rectal.
[0291] For oral administration, the compounds (i.e.,
immunostimulatory nucleic acids, antigens and other therapeutic
agents) can be formulated readily by combining the active
compound(s) with pharmaceutically acceptable carriers well known in
the art. Such carriers enable the compounds of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels,
syrups, slurries, suspensions and the like, for oral ingestion by a
subject to be treated. Pharmaceutical preparations for oral use can
be obtained as solid excipient, optionally grinding a resulting
mixture, and processing the mixture of granules, after adding
suitable auxiliaries, if desired, to obtain tablets or dragee
cores. Suitable excipients are, in particular, fillers such as
sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers for neutralizing
internal acid conditions or may be administered without any
carriers.
[0292] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0293] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
[0294] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0295] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0296] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0297] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0298] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0299] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0300] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
[0301] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0302] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer, Science 249:1527-1533, 1990, which is incorporated herein
by reference.
[0303] The immunostimulatory nucleic acids and optionally other
therapeutics and/or antigens may be administered per se (neat) or
in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0304] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0305] The pharmaceutical compositions of the invention contain an
effective amount of a Immunostimulatory nucleic acid and optionally
antigens and/or other therapeutic agents optionally included in a
pharmaceutically-acceptable carrier. The term
pharmaceutically-acceptable carrier means one or more compatible
solid or liquid filler, diluents or encapsulating substances which
are suitable for administration to a human or other vertebrate
animal. The term carrier denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being commingled
with the compounds of the present invention, and with each other,
in a manner such that there is no interaction which would
substantially impair the desired pharmaceutical efficiency.
[0306] The immunostimulatory nucleic acids useful in the invention
may be delivered in mixtures with additional adjuvant(s), other
therapeutics, or antigen(s). A mixture may consist of several
adjuvants in addition to the Immunostimulatory nucleic acid or
several antigens or other therapeutics.
[0307] A variety of administration routes are available. The
particular mode selected will depend, of course, upon the
particular adjuvants or antigen selected, the particular condition
being treated and the dosage required for therapeutic efficacy. The
methods of this invention, generally speaking, may be practiced
using any mode of administration that is medically acceptable,
meaning any mode that produces effective levels of an immune
response without causing clinically unacceptable adverse effects.
Preferred modes of administration are discussed above.
[0308] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
compounds into association with a carrier which constitutes one or
more accessory ingredients. In general, the compositions are
prepared by uniformly and intimately bringing the compounds into
association with a liquid carrier, a finely divided solid carrier,
or both, and then, if necessary, shaping the product. Liquid dose
units are vials or ampoules. Solid dose units are tablets, capsules
and suppositories. For treatment of a patient, depending on
activity of the compound, manner of administration, purpose of the
immunization (i.e., prophylactic or therapeutic), nature and
severity of the disorder, age and body weight of the patient,
different doses may be necessary. The administration of a given
dose can be carried out both by single administration in the form
of an individual dose unit or else several smaller dose units.
Multiple administration of doses at specific intervals of weeks or
months apart is usual for boosting the antigen-specific
responses.
[0309] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compounds, increasing
convenience to the subject and the physician. Many types of release
delivery systems are available and known to those of ordinary skill
in the art. They include polymer base systems such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides. Microcapsules of the foregoing polymers containing
drugs are described in, for example, U.S. Pat. No. 5,075,109.
Delivery systems also include non-polymer systems that are: lipids
including sterols such as cholesterol, cholesterol esters and fatty
acids or neutral fats such as mono-di- and tri-glycerides; hydrogel
release systems; sylastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152, and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
[0310] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Materials and Methods
[0311] Oligodeoxynucleotides: Native phosphodiester and
phosphorothioate-modified ODN were purchased from Operon
Technologies (Alameda, Calif.) and Hybridon Specialty Products
(Milford, Mass.). ODN were tested for endotoxin using the LAL-assay
(LAL-as say BioWhittaker, Walkersville, Md.; lower detection limit
0.1 EU/ml). For in vitro assays, ODN were diluted in TE-buffer (10
mM Tris, pH 7.0, 1 mM EDTA), and stored at -20.degree. C. For in
vivo use, ODN were diluted in phosphate buffered saline (0.1 M PBS,
pH 7.3) and stored at 4.degree. C. All dilutions were carried out
using pyrogen-free reagents.
[0312] Isolation of human PBMC and cell culture: Peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers by Ficoll-Paque density gradient centrifugation
(Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described
(Hartmann et al., 1999 Proc. Natl. Acad. Sci. USA 96:9305-10).
Cells were suspended in RPMI 1640 culture medium supplemented with
10% (v/v) heat-inactivated (56.degree. C., 1 h) FCS (HyClone,
Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100
.mu.g/ml streptomycin (all from Gibco BRL, Grand Island, N.Y.)
(complete medium). Cells (final concentration 1.times.10.sup.6
cells/ml) were cultured in complete medium in a 5% CO.sub.2
humidified incubator at 37.degree. C. ODN and LPS (from Salmonella
typhimurium, Sigma Chemical Co., St. Louis, Mo.) or anti-IgM were
used as stimuli. For measurement of human NK lytic activity, PBMC
were incubated at 5.times.10.sup.6/well in 24-well plates. Cultures
were harvested after 24 hours, and cells were used as effectors in
a standard 4 hours .sup.51Cr-release assay against K562 target
cells as previously described (Ballas et al., 1996J. Immunol.
157:1840-1845). For B cell proliferation, 1 .mu.Ci of .sup.3H
thymidine was added 18 hours before harvest, and the amount of
.sup.3H thymidine incorporation was determined by scintillation
counting at day 5. Standard deviations of the triplicate wells were
<5%.
[0313] Flow cytometry on human PBMC: Surface antigens on primate
PBMC were stained as previously described (Hartmann et al., 1998 J.
Pharmacol. Exp. Ther. 285:920-928). Monoclonal antibodies to CD3
(UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86
(2331 [FUN-1]) were purchased from Pharmingen, San Diego, Calif.
IgG.sub.1, .kappa. (MOPC-21) and IgG.sub.2b, .kappa. (Hartmann et
al., 1999 Proc. Natl. Acad. Sci. USA 96:9305-10) were used to
control for non-specific staining. NK cells were identified by CD56
expression on CD3, CD14 and CD19 negative cells, whereas B cells
were identified by expression of CD19. Flow cytometric data of
10000 cells per sample were acquired on a FACScan (Beckton
Dickinson Immunocytometry Systems, San Jose, Calif.). The viability
of cells within the FSC/SSC gate used for analysis was examined by
propidium iodide staining (2 .mu.g/ml) and found to be higher than
98%. Data were analyzed using the computer program FlowJo (version
2.5.1, Tree Star, Inc., Stanford, Calif.).
[0314] Results:
Example 1
CpG-Dependent Stimulation of Human B Cells Depends on Methylation
and ODN Length
[0315] Human PBMC were obtained from normal donors and cultured for
five days at 2.times.10.sup.5 cells/well with the indicated
concentrations of the indicated ODN sequences. As shown in Table F,
human PBMCs proliferate above the background when cultured with a
variety of different CpG ODN, but also show some proliferation even
with ODN that do not contain any CpG motifs. The importance of
unmethylated CpG motifs in providing optimal immune stimulation
with these ODN is demonstrated by the fact that ODN 1840 (SEQ ID
NO. 83) induces 56,603 counts of .sup.3H-thymidine incorporation
whereas the same T-rich ODN with the CpG motifs methylated
(non-CpG), 1979 (SEQ ID NO. 222), induces lower, but still
increased over background, activity (only 18,618 counts) at the
same concentration of 0.6 .mu.g/ml. The reduced proliferation at
higher ODN concentrations may be an artifact of the cells becoming
exhausted under these experimental conditions or could reflect some
toxicity of the higher ODN concentrations. Interestingly, shorter
ODN containing CpG motifs, such as the 13-14 mers 2015 and 2016,
are less stimulatory despite the fact that their molar
concentration would actually be higher since the ODNs were added on
the basis of mass rather than molarity. This demonstrates that ODN
length may also be an important determinant in the immune effects
of the ODN. A non-CpG ODN but slight T-rich ODN (about 30% T), 1982
(SEQ ID NO. 225), caused only a small amount of background cell
proliferation.
TABLE-US-00007 TABLE F Oligo Concentration ODN# 0.15 .mu.g/ml 0.6
.mu.g/ml 2 .mu.g/ml Cues only 648 837 799 1840 5744 56,603 31,787
(SEQ ID NO. 83) 2016 768 4607 20,497 (SEQ ID NO. 256) 1979 971
18,618 29,246 (SEQ ID NO. 222) 1892 787 10,078 22,850 (SEQ ID NO.
135) 2010 849 20,741 8,054 (SEQ ID NO. 250) 2012 2586 62,955 52,462
(SEQ ID NO. 252) 2013 1043 47,960 47,231 (SEQ ID NO. 253) 2014 2700
50,708 46,625 (SEQ ID NO. 254) 2015 1059 23,239 36,119 (SEQ ID NO.
255)
[0316] Numbers represent cpm of .sup.3H-thymidine incorporation for
cultures of human PBMCs set up as described above.
Example 2
Concentration-Dependent Activation of Human NK Cell Activity with
Thymidine-Rich ODN
[0317] Human PBMCs were cultured for 24 hours with a panel of
different CpG or non-CpG ODN at two different concentrations, and
then tested for their ability to kill NK target cells as described
previously (Ballas et al., 1996 J. Immunol. 157:1840-1845). Killing
is measured as lytic units, or L.U. The human donor used in this
experiment had a background level of 3.69 L.U. which increased to
180.36 L.U. using the positive control, IL-2. A CpG oligo, 2006
(SEQ ID NO. 246), induced high levels of NK lytic function at a low
concentration of 0.6, and a lower level at a concentration of 6.0.
Surprisingly, a T-rich ODN in which the CpG motifs of 2006 were
methylated (ODN at 2117 (SEQ ID NO. 358)) or inverted to GpCs (ODN
2137 (SEQ ID NO. 886)) retained strong immune stimulatory function
at the higher ODN concentrations, as shown in Table G. These
concentration-dependent immune stimulatory effects are not a
general property of the phosphorothioate backbone since the
experiments described below demonstrate that a poly-A ODN, is
nonstimulatory above background levels. Some stimulation is seen
with a 24-base long ODN in which all of the base positions are
randomized so that A, C, G, and T will occur at a frequency of 25%
in each of the base positions (ODN 2182 (SEQ ID NO. 432)). However,
the stimulatory effect of such a 24-base ODN is greatly enhanced if
it is pure poly-T, in which case stimulation is also seen at the
lowest concentration of 0.6 .mu.g/ml (ODN 2183 (SEQ ID NO. 433)).
In fact, the stimulatory activity of ODN SEQ ID NO. 433 at this low
concentration is higher than that of any other ODN tested at this
low concentration, aside from the optimal human immune stimulatory
ODN of SEQ ID NO. 246. In fact, the higher concentration of ODN SEQ
ID NO. 433 stimulated more NK activity than any other
phosphorothioate ODN except for the strong CpG ODN 2142 (SEQ ID NO.
890), which was marginally higher. If the G content of ODN SEQ ID
NO. 246 is increased relative to the T content by addition of more
Gs, thus resulting in a decrease in the proportion of T nucleotides
the immune stimulatory effect of the ODN is reduced (see ODN 2132
(SEQ ID NO. 373)). Thus, the T content of an ODN is an important
determinant of its immune stimulatory effect. Although a poly-T ODN
is the most stimulatory of the non-CpG ODN, other bases are also
important in determining the immune stimulatory effect of a non-CpG
ODN. ODN 2131 (SEQ ID NO. 372), in which slightly more than half of
the bases are T and in which there are no Gs, is immune stimulatory
at a concentration of 6 .mu.g/ml but has less activity than other
T-rich ODN. If the 6 A's in ODN 2131 (SEQ ID NO. 372) are replaced
by 6 Gs, the immune stimulatory effect of the ODN can be increased
(see ODN 2130 (SEQ ID NO. 371)).
TABLE-US-00008 TABLE G HUMAN PBL CULTURED OVERNIGHT WITH OLIGOS MR
3605 SR 256 % SR 7.11 EFFECTOR 0.63 1.25 2.50 5.00 10.00 20.00
CONTROL [RM] L.U. ALONE 2.65 5.45 10.15 17.65 29.92 39.98 3.69 +IL2
(100 U/ml) 35.95 57.66 86.26 100.39 99.71 93.64 180.36 +1585 (0.6
ug/ml) 3.75 6.10 12.14 23.70 36.06 43.98 5.48 +1585 (6.0 ug/ml)
15.42 31.09 47.07 73.34 94.29 97.73 35.85 +2006 (0.6 ug/ml) 6.71
15.99 26.92 44.75 64.12 68.83 16.96 +2006 (6.0 ug/ml) 6.19 8.18
16.13 24.35 39.35 56.07 8.04 +2117 (0.6 ug/ml) 4.54 4.73 9.56 18.04
28.57 39.85 3.49 +2117 (6.0 ug/ml) 7.03 10.76 16.90 30.59 52.14
59.46 10.96 +2137 (0.6 ug/ml) 4.61 5.35 10.04 15.16 23.79 37.86
2.57 +2137 (6.0 ug/ml) 7.99 10.37 16.55 32.32 49.78 60.30 11.01
+2178 (0.6 ug/ml) 2.88 4.52 11.47 16.05 24.85 34.27 2.37 +2178 (6.0
ug/ml) 4.21 5.03 11.16 16.39 28.22 36.45 2.94 +2182 (0.6 ug/ml)
2.42 6.57 10.49 19.73 26.55 35.30 2.89 +2182 (6.0 ug/ml) 4.11 7.98
14.60 26.56 40.40 51.98 7.59 +2183 (0.6 ug/ml) 3.73 8.46 15.52
24.48 37.78 56.77 7.80 +2183 (0.6 ug/ml) 8.86 12.89 23.08 41.49
66.26 75.85 16.57 +2140 (0.6 ug/ml) 3.78 5.27 12.30 20.79 35.75
45.62 5.40 +2140 (6.0 ug/ml) 6.56 13.24 21.26 37.96 60.80 73.05
14.82 +2141 (0.6 ug/ml) 2.63 6.34 10.21 17.73 30.93 43.57 4.29
+2141 (6.0 ug/ml) 4.98 15.30 25.22 37.88 58.47 69.12 14.83 +2142
(0.6 ug/ml) 3.18 3.66 6.99 14.62 19.68 32.52 1.56 +2142 (6.0 ug/ml)
7.08 15.80 25.65 41.72 68.09 73.14 17.11 +2143 (0.6 ug/ml) 4.12
6.90 10.77 22.96 35.78 42.94 5.19 +2143 (6.0 ug/ml) 3.16 8.40 12.38
21.69 34.80 54.21 6.64 +2159 (6.0 ug/ml) 5.05 11.76 21.67 41.12
51.68 65.47 13.19 +2132 (6.0 ug/ml) 4.23 6.06 10.50 18.74 32.68
44.06 4.61 +2179 (6.0 ug/ml) 6.14 9.49 21.06 42.48 60.12 71.87
14.54 +2180 (6.0 ug/ml) 2.37 8.57 15.44 29.66 44.35 61.31 9.47
+2133 (6.0 ug/ml) 6.53 12.58 23.10 38.03 61.16 68.36 14.62 +2134
(6.0 ug/ml) 7.51 12.14 21.14 32.46 54.47 67.12 12.98 +2184 (6.0
ug/ml) 5.22 9.19 17.54 30.76 45.35 63.55 10.42 +2185 (6.0 ug/ml)
8.11 14.77 26.27 40.31 55.61 70.65 15.60 +2116 (6.0 ug/ml) 5.58
10.54 16.77 37.82 59.80 66.33 13.07 +2181 (6.0 ug/ml) 4.43 9.85
17.55 27.05 53.16 69.16 11.43 +2130 (6.0 ug/ml) 3.81 8.07 17.11
27.17 42.04 53.73 8.27 +2131 (6.0 ug/ml) 2.29 6.73 7.30 18.02 32.73
49.06 5.08 +2156 (0.3 ug/ml) 2.50 5.26 8.20 15.95 26.64 33.07 2.31
+2156 (1.0 ug/ml) 5.91 10.99 17.31 26.97 50.64 63.78 10.84 +2157
(0.3 ug/ml) 2.36 4.00 6.65 12.94 24.13 38.86 2.58 +2157 (1.0 ug/ml)
3.72 9.55 17.15 34.55 52.27 65.33 11.58 +2158 (0.3 ug/ml) 1.25 2.36
6.90 16.39 15.63 29.82 1.17 +2158 (1.0 ug/ml) 4.73 7.26 11.07 15.55
30.80 43.71 4.16 +2118 (0.6 ug/ml) 1.55 3.38 6.85 13.36 20.15 27.71
1.13 +2118 (6.0 ug/ml) 2.65 3.88 9.29 12.19 22.47 28.99 1.34
Example 3
Induction of B Cell Proliferation by T-Rich Non-CpG ODN
[0318] To assess the ability of T-rich ODN to activate B cell
proliferation, human PBMCs were stained with the cytoplasmic dye
CSFE, incubated with five days with the indicated ODN at either
0.15 or 0.3 ug/ml, and then analyzed by flow cytometry. B cells
were identified by gating on cells positive for the lineage marker
CD19). CpG ODN 2006 was a strong inducer of B cell proliferation,
and this effect was reduced if the CpG motifs were methylated or
inverted to GpC as shown in FIGS. 1A, B, C and D at an ODN
concentration of 0.3 ug/ml. The base composition of the ODN appears
to be important in determining the immune stimulatory effect.
Reducing the T content of an ODN substantially reduces immune
stimulatory effect, as exemplified by ODN 2177 (SEQ ID NO. 427) in
which 6 of the Ts present in ODN 2137 (SEQ ID NO. 886) have been
switched to A's, resulting in a greatly reduced immune stimulatory
effect. The importance of T's in the immune stimulatory effect of
an ODN is also shown by comparison of ODN 2116 (SEQ ID NO. 357) and
2181 (SEQ ID NO. 431), which differ in the 3' end of the ODN. ODN
2181, in which the 3' end is poly-T is more stimulatory than ODN
2116, in which the 3' end is poly-C, despite the fact that both ODN
have a TCGTCG at the 5' end.
Example 4
B Cell Proliferation Induced by TG Oligonucleotides
[0319] The stimulatory effects of TG motifs are shown in FIG. 2.
ODN 2137 has the identical base composition as ODN 2006, but the CG
motifs have all been inverted to GC's resulting in a CG-free
nucleic acid. ODN does however contain 6 TG dinucleotides. In ODN
2177, all the TG dinucleotides of ODN 2137 have been changed to AG.
Although ODN 2177 contains only 6 adenines, it is virtually
nonstimulatory at a concentration of 0.2 .mu.g/ml. For comparison,
an ODN 24 bases in length in which each position is randomized to
be any of the four bases (ODN 2182) induces>12% of B cells to
proliferate at a concentration of 0.2 .mu.g/ml. These results
indicate that the stimulatory effects of ODN 2137 are not simply
those of a phosphorothioate backbone, but relate to the presence of
TG dinucleotides.
[0320] In order to determine the effect of varying the number of TG
dinucleotide motifs, ODN 2200 and ODN 2202 were compared, as shown
in FIG. 2. Both ODN contain 18 Ts and 6 Gs, but in ODN 2200 all of
the Gs are consecutive, so that there is only one TG dinucleotide,
whereas in ODN 2202, the Gs are split up as GG dinucleotides
throughout the ODN so that there are three TGs. ODN 2202 is
significantly more stimulatory than ODN 2200, consistent with the
model that at least three TG motifs in an ODN are required for
optimal stimulatory activity. It is likely that even higher levels
of stimulation could be achieved if the TG motifs had been
optimized as taught herein.
Example 5
Effects of TTG Versus TTG Motifs
[0321] FIG. 3 shows the results of experiments conducted to study
TG content in terms of the relative levels of Ts versus Gs as it
relates to the stimulatory effect of an ODN. The Figure shows that
an ODN in which all of the bases are randomized to be either T or G
(ODN 2188 (SEQ ID NO. 905)) is nonstimulatory at a concentration of
0.2 .mu.g/ml, similar to an ODN in which all of the bases are
randomized to be either A or G (ODN 2189 (SEQ ID NO. 906)).
However, at the higher concentration of 2 .mu.g/ml, the randomized
T/G ODN 2188 is significantly more stimulatory. This latter level
of stimulation is still lower than that which occurs with a totally
randomized ODN (ODN 2182 (SEQ ID NO. 432)). The highest stimulation
at low concentrations is seen with an ODN in which half of the
bases are fixed at T and the other half of the bases are randomized
to be either T or G (ODN 2190 (SEQ ID NO. 907)). Since every other
base is fixed to be a T, there cannot be any TG motifs. The data in
FIG. 3 show that increasing the TG content of an ODN improves its
stimulatory activity.
[0322] In yet other experiments, the results of which are not
diagrammed herein, ODN 2190 (SEQ ID NO. 907) exhibited a
stimulation of NK activity compared to ODN 2188 (SEQ ID NO. 905) or
ODN 2189 (SEQ ID NO. 906).
Examples 6-8
Introduction
[0323] Above, we demonstrated that Poly T sequences are able to
enhance stimulation of B and NK cells. Here and below we
investigate the effect of a variety of non-CpG T-rich ODN as well
as Poly C ODN for their ability to stimulate human B cells, NK
cells and monocytes.
[0324] Materials and Methods:
[0325] Oligonucleotides: Phosphorothioate-modified ODN were
purchased from ARK Scientific GmbH (Darmstadt, Germany). The
sequences used were:
TABLE-US-00009 (SEQ ID NO.: 225) 1982: 5'-tccaggacttctctcaggtt-3',
(SEQ ID NO.: 246) 2006: 5'-tcgtcgttttgtcgttttgtcgtt-3', (SEQ ID
NO.: 282) 2041: 5'-ctggtctttctggtttttttctgg-3', (SEQ ID NO.: 358)
2117: 5'-tzgtzgttttgtgtzgttttgtzgtt-3', (SEQ ID NO.: 886) 2137:
5'-tgctgcttttgtgcttttgtgctt-3', (SEQ ID NO.: 443) 2183:
5'-ttttttttttttttttttttt-3', (SEQ ID NO.: 911) 2194:
5'-ttttttttttttttttttttttttttt-3', (SEQ ID NO.: 913) 2196:
5'-tttttttttttttttttt-3', (SEQ ID NO.: 1058) 5126:
5'-ggttcttttggtccttgtct-3', (SEQ ID NO.: 1095) 5162:
5'-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3', (SEQ ID NO.: 1096) 5168:
5'-cccccccccccccccccccccccccccccc-3' and (SEQ ID NO.: 1097) 5169:
5'-cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg-3'.
Most ODN were tested for LPS content using the LAL assay
(BioWhittaker, Belgium) (lower detection limit 0.1EU/ml) also
described herein. For all assays ODN were diluted in TE buffer and
stored at -20.degree. C. All dilutions were conducted using
pyrogen-free reagents.
[0326] Cell preparation and cell culture: Human PBMC were isolated
from peripheral blood of healthy volunteers, obtained by the German
Red Cross (Ratingen, Germany), as described above in Example 1, but
all material were purchased from Life Technologies, Germany and
were endotoxin-tested. For the B cell, NK cell and monocyte
activation assays PBMC were cultured in complete medium at a
concentration of 2.times.10.sup.6 cells/ml in 200 .mu.l in 96 round
bottom plates in a humidified incubator at 37.degree. C. Different
ODNs, LPS (Sigma) or IL-2 (R&D Systems, USA) were used as
stimuli. At the indicated time points, cells were harvested for
flow cytometry.
[0327] Flow cytometry: MAbs used for staining of surface antigens
were: CD3, CD14, CD19, CD56, CD69, CD80 and CD86 (all obtained from
Pharmingen/Becton Dickinson, Germany). For monocytes Fc receptors
were blocked using human IgG (Myltenyi, Germany) as previously
described (Bauer, M., K. Heeg, H. Wagner, and G. B. Lipford. 1999.
DNA activates human immune cells through a CpG sequence dependent
manner. Immunology 97:699). Flow cytometric data of at least 1000
cells of a specified subpopulation (B cells, monocytes, NK cells,
NKT cells or T cells) were acquired on a FACSCalibur (Becton
Dickinson). Data were analyzed using the program CellQuest (Becton
Dickinson).
[0328] NK-mediated cytotoxicity: PBMC were cultured overnight with
or without 6 .mu.g/ml ODN or 100 U/ml IL-2 at 37.degree. C., 5%
CO.sub.2. The next morning, K-562 target cells were labeled with a
fluorescent dye, CFSE, as described previously for human B cells
(Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a
newly identified CpG DNA motif in human primary B cells. J.
Immunol. 164:944). PBMC were added in different ratios (50:1, 25:1
and 12.5:1) to 2.times.10.sup.5 target cells and incubated for 4 h
at 37.degree. C. Cells were harvested and incubated with the
DNA-specific dye 7-AAD (Pharmingen) for detection of apoptotic
cells. Results were measured by flow cytometry.
[0329] ELISA: PBMC (3.times.10.sup.6 cells/ml) were cultured with
the specified concentrations of ODN or LPS for 24 h (IL-6,
IFN.gamma. and TNF.alpha.) or 8 h (IL-11) in 48 well plates in a
humidified atmosphere at 37.degree. C. Supernatants were collected
and cytokines were measured using OPTeia ELISA Kits (Pharmingen)
for IL-6, IFN.gamma. and TNF.alpha. or an Eli-pair ELISA assay
(Hoelzel, Germany) for IL-11 according to the manufacturer
protocols.
Example 6
B Cell Activation Induced by ODNs Lacking CpG Motifs
[0330] In the Experiments described above in Example 3, we
demonstrate that T-rich ODN were capable of activating B cells. We
expand those studies here using additional ODN and different cell
and reagent sources. In a first set of experiments, we compared the
activation potential of different non-CpG T-rich ODNs with the very
potent known CpG ODN 2006 (SEQ ID NO.: 246). PBMC (2.times.06
cells/ml) of a blood donor (n=2) were incubated with the indicated
concentrations of ODNs 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.:
358), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058), and 5162
(SEQ ID NO.: 1094). Cells were incubated for 48 h at 37.degree. C.
as described above and stained with mAb for CD19 (B cell marker)
and CD86 (B cell activation marker, B7-2). Expression was measured
by flow cytometry.
[0331] Using different concentrations of ODNs, we showed (FIG. 4)
that T-rich ODNs without a CpG motif, can induce stimulation of
human B cells. ODN 5126 (SEQ ID NO.: 1058) which contains only a
single poly-T sequence but is greater than 50% T, caused high
levels of human B cell activation. Although there are some
similarities to SEQ ID NO.: 246 (e.g. more than 80% T/G content),
this ODN clearly lacks any known immunostimulatory CpG motif.
Surprisingly, for all tested T-rich ODNs, the highest stimulatory
index was obtained at concentrations between 3 and 10 .mu.g/ml. The
highest stimulatory index of the tested ODNs was achieved by
CpG/T-rich ODN SEQ ID NO.: 246 at 0.4 .mu.g/ml. Interestingly, the
activity decreased at high concentrations.
[0332] Poly A, Poly C and Poly T sequences were synthesized and
tested for biological activity. PBMC (2.times.10.sup.6 cells/ml) of
one representative donor (n=3) were stimulated as described above
by 0.4 .mu.g/ml, 1.0 .mu.g/ml or 10.0 .mu.g/ml of the following
ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913) (Poly T, 18
bases), 2194 (SEQ ID NO.: 911) (Poly T, 27 bases), 5162 (SEQ ID
NO.: 1094) (Poly T, 30 bases), 5163 (SEQ ID NO.: 1095) (Poly A, 30
bases), 5168 (SEQ ID NO.: 1096) (Poly C, 30 bases) and 5169 (SEQ ID
NO.: 1097) (Poly CG, 30 bases). Expression of the activation marker
CD86 (B7-2) on CD19-positive B cells was measured by flow
cytometry.
[0333] FIG. 5 demonstrates that the length of the sequence, at
least for Poly T ODNs, has an important impact on its activity. A
Poly T sequence containing only 18 bases (SEQ ID NO.: 913) was
shown to be less stimulatory than one with 27 bases (SEQ ID NO.:
911) or one with 30 bases (SEQ ID NO.: 1094) with a clear rank of
stimulation: SEQ ID NO.: 1094>SEQ ID NO.: 911>SEQ ID NO.:
913. Poly A (SEQ ID NO.: 1095) or Poly CG (SEQ ID NO.: 1097)
sequences, in contrast, do not induce activation of human B cells.
Surprisingly it was also discovered that Poly C sequences (SEQ ID
NO.: 1096) can activate human B cells at least at high
concentrations (10 .mu.g/ml) (FIG. 5).
[0334] Two other T-rich ODNs, namely 1982 (SEQ ID NO.: 225) and
2041 (SEQ ID NO.: 282) lacking CpG motifs were tested for their
effect on human B cells. PBMC (n=2) were incubated with the
indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ
ID NO.: 225) and 2041 (SEQ ID NO.: 282) as described above. B cell
activation (expression of the activation marker CD86) was measured
by flow cytometry.
[0335] FIG. 6 demonstrates that T-rich non-CpG ODN are
immunostimulatory at concentrations higher than 1 g/ml.
Incorporation of a CpG motif into 1982 enhanced the
immunostimulatory activity. Elongation with a Poly T sequence did
not enhance the immunostimulatory activity of this already T-rich
ODN but rather, decreased the activation potential slightly.
Example 7
Immunostimulation of Non-CpG ODNs is Reflected in the Enhancement
of NK Activation, NK Cytotoxicity and Monocyte Activation
[0336] NK cells as well as monocytes were tested for their response
to non-CpG ODNs. PBMC (2.times.10.sup.6 cells/ml) were incubated
with 6 .mu.g/ml of the following ODNs (n=4): 2006 (SEQ ID NO.:
246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID
NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058).
After 24 h of cultivation at 37.degree. C. cells were harvested and
stained with mAb for CD3 (T cell marker), CD56 (NK cell marker) and
CD69 (early activation marker) as described above. Expression of
CD69 on CD56-positive NK cells was measured by flow cytometry.
[0337] FIG. 7 shows that for Poly T ODNs similar effects can be
observed as described in FIG. 5. The stimulation of NK cells, like
B cells, may be influenced by the length of the ODN. ODN 2183 (SEQ
ID NO.: 433) (21 bases) induced activation of NK cells but to a
lesser extent than the longer ODN 2194 (SEQ ID NO.: 911) (27
bases), as measured by enhanced expression of the early activation
marker CD69. ODN 5126 (SEQ ID NO.: 1058) was also demonstrated to
activate human NK cells (FIG. 7).
[0338] It is believed that the anti-tumor activity of CpG ODNs can
be assessed by the ability of the ODN to enhance NK-mediated
cytotoxicity in vitro. ODNs containing at the 5' and 3' ends
stretches of Poly G were shown to result in the highest induction
of cytotoxicity (Ballas, Z. K., W. L. Rasmussen, and A. M. Krieg.
1996. Induction of natural killer cell activity in murine and human
cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J.
Immunol. 157:1840). To investigate the influence of non-CpG T-rich
ODN on NK cytotoxicity, we analyzed the effect of the ODNs 2194
(SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) on NK-mediated lysis
(FIG. 8). NK-mediated lysis of K-562 target cells was measured
after over night incubation of PBMC with 6 .mu.g/ml of the ODN 2006
(SEQ ID NO.: 246), SEQ ID NO.: 911 (SEQ ID NO.: 911) (Poly T, 27
bases) and 5126 (SEQ ID NO.: 1058) as described above. SEQ ID NO.:
1058 demonstrated small increases in lysis by human NK cells as
compared to no ODN. SEQ ID NO.: 911 and SEQ ID NO.: 246 enhanced
human NK cell cytotoxicity to an even higher extent.
[0339] Previous reports demonstrated that not only NK cells but
also NKT cells are mediators of cytotoxic responses to tumor cells
(14). We, therefore, looked at the potential activation of human
NKT cells by T-rich non-CpG ODN. PBMC of one representative donor
(n=2) were incubated with 6 .mu.g/ml ODN 2006 (SEQ ID NO.: 246),
2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.:
433), 2194 (SEQ ID NO.: 913) and 5126 (SEQ ID NO.: 1058) for 24 h
as described above. Activation of NKT cells was measured by flow
cytometry after staining of cells with mAb for CD3 (T cell marker),
CD56 (NK cell marker) and CD69 (early activation marker). Shown is
the expression of CD69 on CD3 and CD56 double-positive cells (NKT
cells).
[0340] In FIG. 9, SEQ ID NO.: 911 as well as SEQ ID NO.: 1058 were
found to stimulate NKT cells. Similar to NK cells SEQ ID NO.: 911
(Poly T) was more active than SEQ ID NO. 1058. In addition, as
described above for B cells and NK cells, the length of the ODN has
some influence on the immunostimulatory potential, with the longer
ODN having stronger effects on NKT cells. Similar results were
observed for human T cells.
[0341] Another type of cell of the immune system involved in
fighting infections is the monocytes. These cells release upon
activation a variety of cytokines and can mature into dendritic
cells (DC), professional antigen-presenting cells (Roitt, I., J.
Brostoff, and D. Male. 1998. Immunology. Mosby, London). FIG. 10
shows activation of human monocytes after culturing of PBMC with
different ODNs. PBMC (2.times.10.sup.6 cells/ml) were incubated
with 6 .mu.g/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358),
2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.:1096), 2183 (SEQ ID NO.:
433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ
ID NO.: 1095) overnight at 37.degree. C. as described above (n=3).
Cells were harvested and stained for CD14 (monocyte marker) and
CD80 (B7-1, activation marker). Expression was measured by flow
cytometry.
[0342] As demonstrated above for NK and B cells, T-rich sequences
(e.g., SEQ ID NO.: 433, SEQ ID NO.: 911) of different length induce
monocyte stimulation but have different levels of activity e.g.,
SEQ ID NO.: 433>SEQ ID NO.: 911. Poly A (SEQ ID NO.: 1095) as
well as Poly C (SEQ ID NO.: 1096 (2178) sequences, in contrast, did
not lead to activation of monocytes (measured by the upregulation
of CD80 at a concentration of 6 .mu.g/ml ODN).
Example 8
Induction of Cytokine Release by Non-CpG ODNs
[0343] Next the ability of different T-rich ODNs to influence the
cytokine milieu was examined. PBMC (3.times.10.sup.6 cells/ml) were
cultured for 24 h with or without 6 .mu.g/ml of the indicated ODNs
or 1 .mu.g/ml LPS as positive control (n=2). After incubation
supernatants were collected and TNF.alpha. measured by ELISA as
described above and the results are shown in FIG. 11. PBMC were
cultured with the indicated ODNs (1.0 .mu.g/ml) as described in
FIG. 11 and IL-6 was measured in the supernatants by ELISA and the
results are shown in FIG. 12.
[0344] FIGS. 11 and 12 demonstrate that T-rich non-CpG and
T-rich/CpG ODNs can induce the secretion of the pro-inflammatory
cytokines TNF.alpha. and IL-6. For both cytokines, ODN 5126 (SEQ ID
NO.: 1058) was found in most assays to be as potent as ODN 2194
(SEQ ID NO.: 911). It is known that CpG ODNs influence the Th1/Th2
balance by preferentially inducing Th1 cytokines (Krieg, A. M.
1999. Mechanism and applications of immune stimulatory CpG
oligodeoxynucleotides. Biochemica et Biophysica Acta 93321:1). To
test whether T-rich ODN caused a similar shift to Th1 cytokines,
IFN.gamma. production in PBMC was measured. In a first set of
experiments, it was demonstrated that, as described for IL-6 and
TNF.alpha., ODNs SEQ ID NO.: 1058 and SEQ ID NO.: 911 induced the
release of comparable amounts of this Th1 cytokine IFN.gamma.. In
addition, it was demonstrated that another pro-inflammatory
cytokine, IL-1.beta., was released upon culture of PBMC with these
two ODNs. Although the amount of these cytokines induced by the
T-rich ODN lacking CpG motifs was less than when CpG ODN SEQ ID
NO.: 246 was used the amounts induced by T-rich ODN were
significantly higher than the control.
Examples 9-11
Introduction
[0345] An optimal CpG motif for immune system activation in
non-rodent vertebrates is described herein. A phosphodiester
oligonucleotide containing this motif was found to strongly
stimulate CD86, CD40, CD54 and MHC II expression, IL-6 synthesis
and proliferation of primary human B-cells. These effects required
internalisation of the oligonucleotide and endosomal maturation.
This CpG motif was associated with the sustained induction of the
NF.kappa.B p50/p65 heterodimer and of the transcription factor
complex activating protein-1 (AP-1). Transcription factor
activation by CpG DNA was preceded by increased phosphorylation of
the stress kinases c-jun NH.sub.2 terminal kinase (JNK) and p38,
and of activating transcription factor-2 (ATF-2). In contrast to
CpG, signaling through the B-cell receptor led to activation of
extracellular receptor kinase (ERK) and to phosphorylation of a
different isoform of JNK.
[0346] Materials and Methods:
[0347] Oligodeoxynucleotides: Unmodified (phosphodiester, PE) and
modified nuclease-resistant (phosphorothioate, PS) ODN were
purchased from Operon Technologies (Alameda, Calif.) and Hybridon
Specialty Products (Milford, Mass.). The sequences used are
provided in Table H. E. coli DNA and calf thymus DNA were purchased
from Sigma Chemical Co., St. Louis, Mo. Genomic DNA samples were
purified by extraction with phenol-chloroform-isoamyl alcohol
(25/24/1) and ethanol precipitation. DNA was purified from
endotoxin by repeated extraction with triton x-114 (Sigma Chemical
Co., St. Louis, Mo.) and tested for endotoxin using the LAL-assay
(LAL-assay BioWhittaker, Walkersville, Md.; lower detection limit
0.1 EU/ml) and the high sensitivity assay for endotoxin described
earlier (lower detection limit 0.0014 EU/ml) (Hartmann G., and
Krieg A. M. 1999. CpG DNA and LPS induce distinct patterns of
activation in human monocytes. Gene Therapy 6:893). Endotoxin
content of DNA samples was below 0.0014 U/ml. E. coli and calf
thymus DNA were made single stranded before use by boiling for 10
minutes, followed by cooling on ice for 5 minutes. DNA samples were
diluted in TE-buffer using pyrogen-free reagents.
TABLE-US-00010 TABLE H Oligonucleotide panel used.sup.1 Name (SEQ
ID NO) Sequence 5' to 3' Starting sequence PE 2079 (320) TCG ACG
TTC CCC CCC CCC CC Middle base PE 2100 (341) TCG GCG TTC CCC CCC
CCC CC PE 2082 (323) TCG CCG TTC CCC CCC CCC CC Human CpG motif PE
2080 (321) TCG TCG TTC CCC CCC CCC CC 5'flanking base PE 2105 (346)
GCG TCG TTC CCC CCC CCC CC PE 2107 (348) ACG TCG TTC CCC CCC CCC CC
PE 2104 (345) CCG TCG TTC CCC CCC CCC CC 3'flanking base PE 2098
(339) TCG TCG CTC CCC CCC CCC CC PE 2099 (340) TCG TCG GTC CCC CCC
CCC CC PE 2083 (324) TCG TCG ATC CCC CCC CCC CC First CpG deleted
PE 2108 (349) CTG TCG TTC CCC CCC CCC CC Second CpG deleted PE 2106
(347) TCG TCA TTC CCC CCC CCC CC Methylation PE 2095 (336) TZG TZG
TTC CCC CCC CCC CC PE 2094 (335) TCG TCG TTC CCC CCC ZCC CC Non-CpG
control of PE 2078 (319) TGC TGC TTC CCC CCC CCC CC 2080 PE 2101
(342) GGC CTT TTC CCC CCC CCC CC Ps form of 2080 PS 2116 (357) TCG
TCG TTC CCC CCC CCC CC Additional CpG motifs PE 2059 (300) TCG TCG
TTT TGT CGT TTT GTC GTT Best PS PS 2006 (246) TCG TCG TTT TGT CGT
TTT GTC GTT Methylated 2006 PS 2117 (358) TZG TZG TTT TGT ZGT TTT
GTZGTT .sup.1PE, phosphodiester; Ps, phosphorothioate; bold, base
exchange; bold Z, methylated cytidine; underlined, CpG
dinucleotides.
[0348] Cell preparation and cell culture: Human peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers by Ficoll-Paque density gradient centrifugation
(Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described
(Hartmann G., Krug A., Eigler A., Moeller J., Murphy J., Albrecht
R., and Endres S. 1996. Specific suppression of human tumor
necrosis factor-alpha synthesis by antisense oligodeoxynucleotides.
Antisense Nucleic Acid Drug Dev 6:291)). Cells were suspended in
RPMI 1640 culture medium supplemented with 10% (v/v)
heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, Utah),
1.5 mM L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete
medium). All compounds were purchased endotoxin-tested. Viability
was determined before and after incubation with ODN by trypan blue
exclusion (conventional microscopy) or by propidium iodide
exclusion (flow cytometric analysis). In all experiments, 96% to
99% of PBMC were viable. Cells (final concentration
1.times.10.sup.6 cells/ml) were cultured in complete medium in a 5%
CO.sub.2 humidified incubator at 37.degree. C. Different
oligonucleotides (see table I, concentration as indicated in the
figure legends), LPS (from salmonella typhimurium, Sigma Chemical
Co., St. Louis, Mo.) or anti-IgM were used as stimuli. Chloroquine
(5 .mu.g/ml; Sigma Chemical Co., St. Louis, Mo.) was used to block
endosomal maturation/acidification. At the indicated time points,
cells were harvested for flow cytometry as described below.
[0349] For signal transduction studies, human primary B-cells were
isolated by immunomagnetic cell sorting using the VARIOMACS
technique (Miltenyi Biotec Inc., Auburn, Calif.) as described by
the manufacturer. In brief, PBMC obtained from buffy coats of
healthy blood donors (Elmer L. DeGowin Blood Center, University of
Iowa) were incubated with a microbeads-conjugated antibody to CD19
and passed over a positive selection column. Purity of B-cells was
higher than 95%. After stimulation, whole cellular extracts
(Western blot) and nuclear extracts (EMSA) for signal transduction
studies were prepared.
[0350] For CpG binding protein studies, Ramos cells (human Burkitt
lymphoma B cell line, ATCC CRL-1923 or CRL-1596; Intervirology 5:
319-334, 1975) were grown in complete medium. Untreated cells were
harvested and cytosolic protein extracts were prepared and analyzed
for the presence of CpG oligonucleotide binding proteins by EMSA
and UV-crosslink as described below.
[0351] Flow cytometry: Staining of surface antigens was performed
as previously described (Hartmann G., Krug A., Bidlingmaier M.,
Hacker U., Eigler A., Albrecht R., Strasburger C. J., and Endres S.
1998. Spontaneous and cationic lipid-mediated uptake of antisense
oligonucleotides in human monocytes and lymphocytes. J Pharmacol
Exp Ther 285:920). Monoclonal antibodies to HLA-DR were purchased
from Immunotech, Marseille, France. All other antibodies were
purchased from Pharmingen, San Diego, Calif.: mABs to CD19 (B43),
CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). IgG.sub.1, .kappa.
(MOPC-21) and IgG.sub.2b, .kappa. were used to control for specific
staining. Intracellular cytokine staining for IL-6 was performed as
described (Hartmann G., and Krieg A. M. 1999. CpG DNA and LPS
induce distinct patterns of activation in human monocytes. Gene
Therapy 6:893). In brief, PBMC (final concentration
1.times.10.sup.6 cells/ml) were incubated in the presence of
brefeldin A (final concentration 1 .mu.g/ml, Sigma Chemical Co.,
St. Louis, Mo.). After incubation, cells were harvested and stained
using a FITC-labeled mAB to CD19 (B43), a PE-labeled rat anti-human
IL-6 mAb (MQ2-6A3, Pharmingen) and the Fix and Perm Kit (Caltag
Laboratories, Burlingame, Calif.). Flow cytometric data of 5000
cells per sample were acquired on a FACScan (Beckton Dickinson
Immunocytometry Systems, San Jose, Calif.). Non-viable cells were
excluded from analysis by propidium iodide staining (2 .mu.g/ml).
Data were analyzed using the computer program FlowJo (version
2.5.1, Tree Star, Inc., Stanford, Calif.).
[0352] Proliferation assay: CFSE (5-(and -6-) carboxyfluorescein
diacetate succinimidyl ester, Molecular Probes, USA) is a
fluorescein-derived intracellular fluorescent label which is
divided equally between daughter cells upon cell division. Staining
of cells with CFSE allows both quantification and immunophenotyping
(phycoerythrin-labeled antibodies) of proliferating cells in a
mixed cell suspension. Briefly, PBMC were washed twice in PBS,
resuspended in PBS containing CFSE at a final concentration of 5
.mu.M, and incubated at 37.degree. C. for 10 minutes. Cells were
washed three times with PBS and incubated for five days as
indicated in the figure legends. Proliferating CD19-positive
B-cells were identified by decreased CFSE content using flow
cytometry.
[0353] Preparation of whole cell, nuclear and cytosolic protein
extracts: For Western blot analysis, whole cell extracts were
prepared. Primary B-cells were treated with medium, the
phosphodiester oligonucleotides 2080 (SEQ ID NO.: 321) or 2078 (SEQ
ID NO.: 319) at 30 .mu.g/ml, or anti-IgM (10 .mu.g/ml). Cells were
harvested, washed twice with ice-cold PBS containing 1 mM
Na.sub.3VO.sub.4, resuspended in lysis buffer (150 mM NaCl, 10 mM
TRIS pH 7.4, 1% NP40, 1 mM Na.sub.3VO.sub.4, 50 mM NaF, 30 mg/ml
leupeptin, 50 mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin,
50 .mu.g/ml phenylmethylsulfonylfluoride (PMSF)), incubated for 15
min on ice and spun at 14000 rpm for 10 min. The supernatant was
frozen at -80 C. For the preparation of nuclear extracts, primary
B-cells were resuspended in hypotonic buffer (10 mM HEPES/KOH (pH
7.9), 10 mM KCl, 0.05% NP40, 1.5 mM MgCl.sub.2, 0.5 mM
dithiothreitol (DTT), 0.5 mM PMSF, 30 mg/ml leupeptin, 50 mg/ml
aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin). After 15 minutes
incubation on ice, the suspension was centrifuged at 1000.times.g
for 5 minutes. The pelleted nuclei were resuspended in extraction
buffer (20 mM HEPES (pH 7.9), 450 mM NaCl, 50 mM NaF, 20% glycerol,
1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 30 mg/ml leupeptin, 50
mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin) and incubated
on ice for one hour. The nuclear suspension was centrifuged for 10
minutes at 16,000 g at 4.degree. C. Supernatant was collected and
stored at -80.degree. C. Cytosolic extracts for the CpG binding
protein studies were prepared from unstimulated Ramos cells, which
were lysed with hypotonic buffer as described for the preparation
of the nuclear extract. After centrifugation, the supernatant was
removed as cytoplasmic fraction and stored at -80.degree. C.
Protein concentrations were measured using a Bradford protein assay
(Bio-Rad, Hercules, Calif.) according to the manufacturer.
[0354] Western blot analysis: Equal concentrations of whole cell
protein extracts (25 .mu.g/lane) were boiled in SDS sample buffer
(50 mM Tris-Cl, pH 6.8; 1% .beta.-mercaptoethanol; 2% SDS; 0.1%
bromphenolblue; 10% glycerol) for 4 min before being subjected to
electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS
(SDS-PAGE). After electrophoresis, proteins were transferred to
Immobilion-P transfer membranes (Millipore Corp. Bedford, Mass.).
Blots were blocked with 5% nonfat dry milk. Specific antibodies
against the phosphorylated form of extracellular receptor kinase
(ERK), c-jun NH2-terminal kinase (JNK), p38 and activating
transcription factor-2 (ATF-2) were used (New England BioLabs,
Beverly, Mass.). Blots were developed in enhanced chemiluminescence
reagent (ECL; Amersham International, Aylesbury, U.K.) according to
the manufacturer's recommended procedure.
[0355] Electrophoretic mobility shift assay (EMSA): To detect the
DNA-binding activity of the transcription factor activator
protein-1 (AP-1) and NF.kappa.B, nuclear extracts (1 .mu.g/lane)
were analyzed by EMSA using the dsODNs 5' GAT CTA GTG ATG AGT CAG
CCG GAT C 3' (SEQ ID NO.: 838) containing the AP-1 binding
sequence, and the NF.kappa.B URE from the c-myc promotor region 5'
TGC AGG AAG TCC GGG TTT TCC CCA ACC CCC C 3' (SEQ ID NO.: 1142), as
probes. ODNs were end labeled with T4-polynucleotide kinase (New
England Biolabs) and (.gamma.-.sup.32P) ATP (Amersham, Arlington
Heights, Ill.). Binding reactions were performed with 1 .mu.g
nuclear protein extract in DNA-binding buffer (10 mM Tris-HCl (pH
7.5), 40 mM MgCl.sub.2, 20 mM EDTA, 1 mM dithiothreitol, 8%
glycerol and 100-400 ng of poly (dI-dC) with 20.000-40.000 cpm
labeled ODN in 10 .mu.l total volume. Specificity of the NF.kappa.B
bands was confirmed by competition studies with cold
oligonucleotides from unrelated transcription factor binding sites
(10-100 ng). For the supershift assay, 2 .mu.g of specific
antibodies for c-Rel, p50 and p65 (Santa Cruz Biotechnology, Inc.,
Santa Cruz, Calif.) were added into the reaction mixture for 30 min
before the radiolabeled probe was added. Following incubation for
30 minutes at room temperature loading buffer was added and the
probes were electrophoresed on a 6% polyacrylamide gel in
Tris-borate-EDTA running buffer (90 mM Tris, 90 mM boric acid, 2 mM
EDTA, pH 8.0). Gels were dried and then autoradiographed.
[0356] UV-crosslinking and denaturing protein electrophoresis:
Nuclear extracts were incubated with labeled phosphodiester
oligonucleotide as described for the EMSA. DNA-protein complexes
were crosslinked with UV-light in a Stratalinker (Stratagene) for
10 minutes. Probes were mixed with SDS-sample buffer, boiled for 10
minutes and loaded on a 7.5% SDS-PAGE. The gel was dried on Whatman
paper and autoradiographed. Plotting the distance against the
molecular weight of the marker proteins yielded a standard curve
which was used to calculate the approximate molecular weight of the
crosslinked protein-ODN complexes. The molecular weight of the
oligonucleotide was subtracted from this value to give the
size.
Example 9
Identification of an Optimal CpG Motif for Use Alone or in
Combination with a T-Rich ODN
[0357] Phosphorothioate oligonucleotides containing the murine CpG
motif GACGTT (SEQ ID NO.: 1143) (for example 1826 (SEQ ID NO.: 69))
and used at concentrations which are active in murine B-cells (Yi
A. K., Chang M., Peckham D. W., Krieg A. M., and Ashman R. F. 1998.
CpG oligodeoxyribonucleotides rescue mature spleen B cells from
spontaneous apoptosis and promote cell cycle entry. J Immunol
160:5898), have showed little or no immunostimulatory activity on
human immune cells. At higher concentrations this ODN was found to
demonstrate some stimulatory effect on human B cells.
[0358] In earlier studies on B-cell activation in mice, it was
found that a CpG-dinucleotide flanked by two 5' purines and two 3'
pyrimidines and preferably the 6 mer motif 5' GACGTT 3' (SEQ ID NO:
1143) was optimal for a phosphodiester oligonucleotide to be active
(Krieg A. M., et al. 1995 Nature 374:546, Yi A. K., Chang M., et
al. 1998 J Immunol 160:5898).
[0359] In order to identify an optimal motif for stimulation of an
immune response in humans and non-rodent vertebrates we designed a
series of ODN and tested their activity. First we designed a 20 mer
phosphodiester oligonucleotide with a TC dinucleotide at the 5' end
preceding the optimal murine CpG motif 5' GACGTT 3' (SEQ ID NO.:
1143) and followed by a poly C tail (2079: 5' TCG ACG TTC CCC CCC
CCC CC 3'(SEQ ID NO.: 320)). This oligonucleotide if added to human
primary B-cells under the same conditions as found to be optimal
for E. coli DNA (repeated addition at 0 hours, 4 hours and 18
hours; 30 .mu.g/ml for each time point) stimulated high levels of
CD86 expression on human primary B-cells after two days. To
determine the structure-function relationship of the CpG motifs, we
replaced the bases adjacent to the CpG dinucleotides while
maintaining the two CpG dinucleotides within the sequence. Exchange
of the adenine located between both CpG dinucleotides by thymidine
(2080 (SEQ ID NO.: 321)) resulted in slightly higher activity.
Replacement by guanosine (2100 (SEQ ID NO.: 341)) or cytidine (2082
(SEQ ID NO.: 323)) at this position showed no major changes
compared to 2079 (SEQ ID NO.: 320). In contrast, replacement of the
thymidine 3' to the second CpG dinucleotide by the purines
guanosine (2099 (SEQ ID NO.: 340)) or adenine (2083 (SEQ ID NO.:
324)) resulted in a major drop in activity of the oligonucleotide,
while the pyrimidine cytidine caused only a minor decrease. The
thymidine immediately 5' to the first CpG dinucleotide was also
important. Replacement of the thymidine by any other base (2105
(SEQ ID NO.: 346), guanosine; 2107 (SEQ ID NO.: 348), adenine; 2104
(SEQ ID NO.: 345), cytidine) led to a marked decrease in activity
of the oligonucleotide. Elimination of the first (2108 (SEQ ID NO.:
349)) or the second (2106 (SEQ ID NO.: 347)) CpG dinucleotide also
partially reduced the activity.
[0360] The addition of more 5' GTCGTT 3' (SEQ ID NO.: 1144) CpG
motifs to the phosphodiester oligonucleotide containing the 8 mer
duplex CpG motif (5' TCGTCGTT 3' (SEQ ID NO:1145), 2080 (SEQ ID
NO.: 321)) did not further enhance CD86 expression on B-cells (2059
(SEQ ID NO.: 300)). An oligonucleotide with the same sequence as
2080 (SEQ ID NO.: 321) but with a phosphorothioate backbone showed
no activity above background (2116 (SEQ ID NO.: 357)). This was
surprising since the phosphorothioate backbone has been reported to
greatly stabilize oligonucleotides and enhance CpG-induced
stimulation (Krieg A. M., Yi A. K., Matson S., Waldschmidt T. J.,
Bishop G. A., Teasdale R., Koretzky G. A., and Klinman D. M. 1995.
CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature 374:546). We therefore performed further structure-function
analysis of phosphorothioate oligonucleotides containing the 5'
GTCGTT 3' (SEQ ID NO: 1144) and 5' TCGTCGTT 3' (SEQ ID NO:1145)
motifs, which showed that additional CpG motifs (2006 (SEQ ID NO.:
246)) tended to increase the activity of phosphorothioate
oligonucleotides.
[0361] Purified B-cells isolated from peripheral blood by
immunomagnetic cell sorting were activated by CpG DNA to the same
extent as unpurified B-cells within PBMC. Thus, activation of
B-cells is a primary response and not a secondary effect caused by
cytokines secreted by other cells.
[0362] In addition to the co-stimulatory molecule CD86, the
functional stage of B-cells is characterized by other surface
markers. For example, activated T helper cells stimulate B-cells by
CD40 ligation, the intercellular adhesion molecule-1 (ICAM-1, CD54)
mediates binding to other immune cells, and major
histocompatibility complex II (MHC II) is responsible for antigen
presentation. We found that B cell expression of CD40, CD54 and MHC
II was upregulated by the CpG oligonucleotide 2080 (SEQ ID NO.:
321). The non-CpG control oligonucleotide 2078 (SEQ ID NO.: 319)
showed no activity compared to medium alone.
[0363] When PBMC were incubated for 5 days in the presence of 2080
(SEQ ID NO.: 321) (added at 0 hours, 4 hours, 18 hours and every
subsequent morning), it was intriguing that a subpopulation of
lymphocytes increased in cell size (FSC) and became more granular
(SSC). To examine if this subpopulation represented proliferating
B-cells, we stained freshly isolated PBMC with CFSE (5-(and -6-)
carboxyfluorescein diacetate succinimidyl ester) at day 0 and
incubated them for 5 days with 2080 (SEQ ID NO.: 321) as above.
CFSE is a fluorescent molecule that binds irreversibly to cell
proteins. Each cell division decreases CFSE stain by 50%. Cells
staining low with CFSE (proliferating cells) were found to be
mainly CD19-positive B-cells. The oligonucleotide 2080 (SEQ ID NO.:
321) induced 60 to 70% of CD19 positive B-cells to proliferate
within 5 days. The control oligonucleotide 2078 (SEQ ID NO.: 319)
induced less than 5% of B-cells to proliferate. Proliferating
B-cells (CFSE low) showed a larger cell size (FSC) and higher
granularity.
[0364] Proliferating B-cells expressed higher levels of CD86 than
non-proliferating cells (not shown). In agreement with this
finding, the oligonucleotide panel tested above for induction of
CD86 expression resulted in an almost identical pattern of B-cell
proliferation. Replacement of the 3' thymidine reduced activity
more than changing the thymidine in the middle position.
Example 10
B-Cell Activation Requires Endosomal Maturation/Acidification
[0365] It has previously been shown that chloroquine, an inhibitor
of endosomal acidification, blocks CpG-mediated stimulation of
murine antigen presenting cells and B-cells, while not influencing
LPS-mediated effects (Hacker H., et al 1998 Embo J 17:6230, Yi A.
K. et al 1998 J Immunol 160:4755, Macfarlane D. E., and Manzel L.
1998 J Immunol 160:1122). We found that the addition of 5 .mu.g/ml
chloroquine completely blocked CpG DNA-mediated induction of CD86
expression on primary B-cells (MFI CD86: 2006 (SEQ ID NO.: 246),
4.7 vs 1.4; E. coli DNA, 3.4 vs. 1.4; medium only, 0.9; n=4).
Furthermore, chloroquine completely inhibited the induction of
B-cell proliferation by the phosphorothioate oligonucleotide 2006
(SEQ ID NO.: 246) measured with the CFSE proliferation assay as
well as with the standard. These results suggest that as with
murine cells, activation of human B-cells by CpG DNA requires the
uptake of DNA in endosomes and subsequent endosomal
acidification.
Example 11
Analysis of Sub-Cellular Events Resulting Upon Human B Cell
Stimulation with Optimal Human ODN
[0366] Since the CpG motif requirement for maximal B-cell
activation is substantially different between mouse (GACGTT) (SEQ
ID NO: 1143) and humans (TCGTCGTT) (SEQ ID NO: 1145), we were
interested if the basic intracellular signaling events are
comparable. Rapid induction of NF.kappa.B binding activity has been
found earlier in murine B-cells and macrophages (Stacey K. J., et
al 1996 J Immunol 157:2116, Yi A. K et al 1998 J Immunol 160:4755).
To investigate the NF.kappa.B response to CpG DNA in humans, human
primary B-cells were isolated from peripheral blood by
immunomagnetic cell sorting and incubated with the CpG
oligonucleotide 2080 (SEQ ID NO.: 321), the non-CpG control
oligonucleotide 2078 (SEQ ID NO.: 319), or medium. At the indicated
time points, cells were harvested and nuclear extracts were
prepared. In the presence of CpG oligonucleotide, NF.kappa.B
binding activity was increased within one hour and maintained up to
18 hours (latest time point examined). The non-CpG control
oligonucleotide 2078 (SEQ ID NO.: 319) did not show enhanced
NF.kappa.B activity compared to cells incubated with medium only.
The NF.kappa.B band was identified by cold competition, and shown
to consist of p50 and p65 subunits by supershift assay.
[0367] The activating protein-1 (AP-1) transcription factor is
involved in the regulation of immediate early genes and cytokine
expression (Karin M. 1995. The regulation of AP-1 activity by
mitogen-activated protein kinases. J Biol Chem 270:16483). In
murine B-cells, AP-1 binding activity is induced in response to CpG
DNA (Yi A. K., and Krieg A. M. 1998. Rapid induction of
mitogen-activated protein kinases by immune stimulatory CpG DNA. J
Immunol 161:4493). To determine whether this transcription factor
would also be induced by CpG DNA in humans, we examined AP-1 DNA
binding activity in human primary B-cells. Cells were incubated
with the CpG oligonucleotide 2080 (SEQ ID NO.: 321) or the control
oligonucleotide 2078 (SEQ ID NO.: 319). Nuclear extracts were
prepared and the AP-1 binding activity was analyzed by EMSA. AP-1
binding activity was enhanced within one hour, and increased up to
18 hours (latest time point examined), showing a sustained
response.
[0368] Since AP-1 activity is induced by many stimuli (Angel P.,
and Karin M. 1991. The role of Jun, Fos and the AP-1 complex in
cell-proliferation and transformation. Biochim Biophys Acta
1072:129), we were interested in signal transduction pathways
upstream of AP-1. The AP-1 transcription factor complex integrates
different mitogen activated protein kinase (MAPK) pathways (Karin
M. 1995. The regulation of AP-1 activity by mitogen-activated
protein kinases. J Biol Chem 270:16483). Western blots were
performed using whole cell extracts from primary B-cells incubated
with the CpG oligonucleotide 2080 (SEQ ID NO.: 321), the control
2078 (SEQ ID NO.: 319), or medium only. Specific antibodies to the
phosphorylated form of JNK, p38, ATF-2 and ERK were used. Strong
induction of JNK phosphorylation was found 30 min and 60 min after
exposure to CpG-DNA, while the non-CpG oligonucleotide showed no
activity above background. The protein kinase p38, another stress
activated protein kinase (SAPK), was also phosphorylated in
response to CpG DNA within 60 min. ATF-2, a substrate of both p38
and JNK (Gupta S., Campbell D., Derijard B., and Davis R. J. 1995.
Transcription factor ATF2 regulation by the JNK signal transduction
pathway. Science 267:389) and a component of the AP-1 complex,
showed weak phosphorylation after 30 min which increased after 60
min. CpG DNA failed to induce substantial phosphorylation of ERK.
In contrast, anti-IgM, stimulating the B-cell receptor, did trigger
phosphorylation of ERK. Anti-IgM activated different isoforms of
JNK than CpG DNA.
Example 12
Assay for In Vivo Adjuvant Activity
[0369] An in vitro screening assay to identify ODN useful as an
adjuvant in vivo in humans and other non-rodent animals was
developed. Since we saw not only quantitative but also qualitative
differences in activities of different CpG ODN in mice, we first
screened a panel of CpG and non-CpG control ODN on mouse cells to
find in vitro assays with reliable and strong correlation to in
vivo adjuvant activity with hepatitis B surface antigen (HBsAg). We
then systematically tested a panel of more than 250 ODN in
corresponding human assays to identify sequences with in vitro
immunostimulatory activity. We next examined if the ODN with the
highest activity in these human assays also activate B cell
proliferation in chimpanzees and monkeys, and finally, if they are
active as adjuvants with HBsAg in chimpanzees and cynomolgus
monkeys in vivo. These studies revealed that the sequence, number
and spacing of individual CpG motifs contribute to the
immunostimulatory activity of a CpG phosphorothioate ODN. An ODN
with a TC dinucleotide at the 5' end followed by three 6 mer CpG
motifs (5' GTCGTT 3') separated by TT dinucleotides consistently
showed the highest activity for human, chimpanzee, and rhesus
monkey leukocytes. Chimpanzees or monkeys vaccinated once against
hepatitis B with this CpG ODN adjuvant developed 15 times higher
anti-HBs antibody titers than those receiving vaccine alone.
[0370] Materials and Methods
[0371] Oligodeoxynucleotides: Phosphorothioate-modified ODN were
purchased from Operon Technologies (Alameda, Calif.) and Hybridon
Specialty Products (Milford, Mass.). ODN were tested for endotoxin
using the LAL-assay (LAL-assay BioWhittaker, Walkersville, Md.;
lower detection limit 0.1 EU/ml). For in vitro assays, ODN were
diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA), and stored at
-20.degree. C. For in vivo use, ODN were diluted in phosphate
buffered saline (0.1 M PBS, pH 7.3) and stored at 4.degree. C. All
dilutions were carried out using pyrogen-free reagents.
[0372] Mouse spleen cell cultures: Spleens were removed from 6-12
week old female BALB/c (The Jackson Laboratory), 2.times.10.sup.6
splenocytes were cultured with 0.2 .mu.M ODN for 4 hours
(TNF-.alpha.) or 24 hours (IL-6, IFN-.gamma., IL-12), and cytokines
were detected by ELISA as previously described (Yi A. K., Klinman
D. M., Martin T. L., Matson S., and Krieg A. M. 1996. Rapid immune
activation by CpG motifs in bacterial DNA. Systemic induction of
IL-6 transcription through an antioxidant-sensitive pathway. J
Immunol 157:5394). To evaluate CpG-induced B cell proliferation,
spleen cells were depleted of T cells with anti-Thy-1.2 and
complement and centrifugation over lympholyte M.RTM. (Cedarlane
Laboratories, Hornby, ON, Canada), cultured for 44 hours with the
indicated ODN, and then pulsed for 4 hours with 1 .mu.Ci of .sup.3H
thymidine as described previously (Krieg A. M., Yi A. K., Matson
S., Waldschmidt T. J., Bishop G. A., Teasdale R., Koretzky G. A.,
and Klinman D. M. 1995. CpG motifs in bacterial DNA trigger direct
B-cell activation. Nature 374:546). To examine NK cell lytic
activity murine spleen cells were depleted of B cells using
magnetic beads coated with goat anti-mouse Ig as previously
detailed (Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated
killer cells. VII. IL-4 induces an NK1.1.sup.+CD8
.alpha..sup.+.beta..sup.- TCR-.alpha..beta. B220+
lymphokine-activated killer subset. J Immunol 150:17). Cells were
cultured at 5.times.10.sup.6/well in 24-well plates and harvested
at 18 hours for use as effector cells in a standard 4 hour
5Cr-release assay against YAC-1 target cells. One unit (LU) was
defined as the number of cells needed to effect 30% specific
lysis.
[0373] Immunization of mice against HBsAg and evaluation of the
humoral response: Groups of 6-8 week old female BALB/c mice (n=5 or
10, Charles River, Montreal, QC) were immunized against HBsAg as
previously described (Davis H. L., et al 1998 J Immunol 160:870).
In brief, each mouse received a single IM injection of 50 .mu.l PBS
containing 1 .mu.g recombinant HBsAg (Medix Biotech, Foster City,
Calif.) and 10 .mu.g of CpG ODN or non-CpG ODN as a sole adjuvant
or combined with alum (Alhydrogel "85", Superfos Biosector,
Vedbaek, Denmark; 25 mg Al.sup.3+/mg HBsAg). Control mice were
immunized with HBsAg without adjuvant or with alum. Plasma was
recovered from mice at various times after immunization and Abs
specific to HBsAg (anti-HBs) were quantified by end-point dilution
ELISA assay (in triplicate) as described previously (Davis H. L et
al 1998 J Immunol 160:870). End-point titers were defined as the
highest plasma dilution that resulted in an absorbance value
(OD450) two times higher than that of non-immune plasma with a
cut-off value of 0.05.
[0374] Isolation of primate PBMC and cell culture: Peripheral blood
mononuclear cells (PBMC) were isolated from peripheral blood of
healthy volunteers, chimpanzees or rhesus or cynomolgus monkeys by
Ficoll-hypaque density gradient centrifugation (Histopaque-1077,
Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G., et
al 1996 Antisense Nucleic Acid Drug Dev 6:291). Cells were
suspended in RPMI 1640 culture medium supplemented with 10% (v/v)
heat-inactivated (56.degree. C., 1 h) FCS (HyClone, Logan, Utah),
1.5 mM L-glutamine, 100 U/ml penicillin and 100 .mu.g/ml
streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete
medium). Cells (final concentration 1.times.10.sup.6 cells/ml) were
cultured in complete medium in a 5% CO.sub.2 humidified incubator
at 37.degree. C. ODN and LPS (from Salmonella typhimurium, Sigma
Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For
measurement of human NK lytic activity, PBMC were incubated at
5.times.10.sup.6/well in 24-well plates. Cultures were harvested
after 24 hours, and cells were used as effectors in a standard 4
hours .sup.51Cr-release assay against K562 target cells as
previously described (Ballas Z. K., Rasmussen W. L., and Krieg A.
M. 1996. Induction of NK activity in murine and human cells by CpG
motifs in oligodeoxynucleotides and bacterial DNA. J Immunol
157:1840; Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated
killer cells. VII. IL-4 induces an NK1.1.sup.+CD8
.alpha..sup.+.beta..sup.- TCR-.alpha..beta. B220.sup.+
lymphokine-activated killer subset. J Immunol 150:17). For B cell
proliferation, 1 .mu.Ci of .sup.3H thymidine was added 18 hours
before harvest, and the amount of .sup.3H thymidine incorporation
was determined by scintillation counting at day 5. Standard
deviations of the triplicate wells were <5%.
[0375] Flow cytometry on primate PBMC: Surface antigens on primate
PBMC were stained as previously described (Hartmann G et al 1998 J
Pharmacol Exp Ther 285:920). Monoclonal antibodies to CD3 (UCHT1),
CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331
(FUN-1)) were purchased from Pharmingen, San Diego, Calif.
IgG.sub.1, .kappa. (MOPC-21) and IgG.sub.2b, .kappa. (Hartmann G et
al 1999 PNAS 96:9305) were used to control for non-specific
staining. NK cells were identified by CD56 expression on CD3, CD14
and CD19 negative cells, whereas B cells were identified by
expression of CD19. Flow cytometric data from 10000 cells per
sample were acquired on a FACScan (Beckton Dickinson
Immunocytometry Systems, San Jose, Calif.). The viability of cells
within the FSC/SSC gate used for analysis was examined by propidium
iodide staining (2 .mu.g/ml) and found to be higher than 98%. Data
were analyzed using the computer program FlowJo (version 2.5.1,
Tree Star, Inc., Stanford, Calif.).
[0376] Immunization of chimpanzees and cynomolgus monkeys against
HBsAg and evaluation of the humoral response: Fourteen cynomolgus
monkeys (2.0-3.5 kg) were immunized with a pediatric dose of
Engerix-B (SmithKline Beecham Biologicals, Rixensart, BE)
containing 10 .mu.g HBsAg adsorbed to alum (25 mg Al.sup.3+/mg
HBsAg). This was administered alone (n=5), or combined with CpG ODN
1968 (n=5, 500 .mu.g) or CpG ODN 2006 (SEQ ID NO.: 246) (n=4, 150
.mu.g). Four chimpanzees (10-20 kg) were immunized in the same
fashion with two receiving control vaccine (Engerix-B only) and two
receiving experimental vaccine (Engerix-B plus 1 mg CpG ODN 2006).
All vaccines were administered IM in the right anterior thigh in a
total volume of 1 ml. Monkeys were maintained in the animal
facility of the Primate Research Center (Bogor, Indonesia) and
chimpanzees were housed at Bioqual (Rockville, Md.). Animals were
monitored daily by animal care specialists. No symptoms of general
ill health or local adverse reactions at the injection site were
noted. Plasma was recovered by IV puncture prior to and at various
times after immunization and was stored frozen (-20.degree. C.)
until assayed for antibodies. Anti-HBs antibodies were detected
using a commercial ELISA kit (Monolisa Anti-HBs; Sanofi-Pasteur,
Montreal, QC) and titers were expressed in mIU/ml based on
comparison with WHO defined standards (Monolisa Anti-HBs Standards;
Sanofi-Pasteur).
[0377] Results
[0378] Identification of CpG ODN with different profiles of in
vitro immune activities: Our studies showed that the precise bases
on the 5' and 3' sides of a CpG dinucleotide within a CpG motif may
have an impact on the level of immune activation of a synthetic
ODN, but it has been unclear whether different CpG motifs might
display different immune effects. To evaluate this possibility, we
tested a panel of CpG ODN for their ability to induce NK lytic
activity, B cell proliferation, and to stimulate synthesis of
TNF-.alpha., IL-6, IFN-.gamma. and IL-12 in murine spleen cells.
Immunostimulatory activity of ODN without CpG motifs (ODN 1982 (SEQ
ID NO.: 225), ODN 1983 (SEQ ID NO.: 226)) was negative or weak
compared to CpG ODN. ODN with non optimal CpG motifs (ODN 1628 (SEQ
ID NO.: 767), ODN 1758 (SEQ ID NO.: 1)) were less active than ODN
containing CpG motifs flanked by two 5' purines and two 3'
pyrimidines (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69),
ODN 1841 (SEQ ID NO.: 84)). ODN 1826 containing two optimal murine
CpG motifs (5' GACGTT 3') (SEQ ID NO: 1143) had the highest
activity for 5 of 6 measured endpoints. Except for ODN 1628, all
ODN showed a generally similar pattern of activity (NK
cell-mediated lysis, B cell proliferation, IL-12, IL-6, TNF
.alpha., IFN-.gamma.). Of note, ODN 1628, which was unique in this
panel for containing two G-rich regions, showed preferential
induction of IFN-.gamma. synthesis but relatively low stimulation
of the other activities.
[0379] Identification of in vitro assays which correlate with in
vivo adjuvant activity: Since adjuvant activity is an in vivo
endpoint, we were interested in identifying in vitro assays that
would predict the adjuvant activity of a CpG ODN in vivo. The same
ODN used for in vitro endpoints therefore were tested for their
adjuvant activity to immunize mice against HBsAg. This was carried
out both with ODN alone and with ODN combined with alum, since
earlier studies had shown strong synergy for CpG ODN and alum
adjuvants (PCT Published Patent Application WO98/40100).
[0380] BALB/c mice immunized with HBsAg without adjuvant attained
only low titers of anti-HBs by 4 weeks, and this was not affected
by addition of control ODN. In contrast, addition of CpG ODN raised
anti-HBs titers by 5 to 40 fold, depending on the sequence used.
When alum was added, titers of anti HBs were approximately 6 times
higher than with HBsAg alone. Specifically, control ODN had no
effect and the various CpG ODN augmented these titers 2 to 36 fold.
Results obtained with the different ODN alone correlated very
strongly (r=0.96) with those obtained using the same ODN plus alum.
When linear regression was performed, a very high degree of
correlation was found between certain in vitro assays and in vivo
augmentation of anti-HBs titers. Of all the in vitro endpoints
examined, the induction of NK lytic activity showed the best
correlation to in vivo adjuvant activity (without alum, r=0.98;
with alum, r=0.95; p<0.0001). A good correlation regarding
adjuvant activity was also obtained for B-cell stimulation (r=0.84
and 0.7), as well as secretion of TNF-.alpha. (r=0.9 and 0.88),
IL-12 (r=0.88 and 0.86) and IL-6 (r=0.85 and 0.91). The one in
vitro assay that did not correlate well with the in vivo results
was IFN-.gamma. secretion (r=0.57 and 0.68). These data demonstrate
that in vitro assays for NK lytic activity, B cell activation and
production of TNF-.alpha., IL-6 and IL-12 provide valuable
information in vitro to predict the adjuvant activity of a given
ODN in vivo.
[0381] Screening of a phosphorothioate ODN panel to activate human
NK cells: In previous studies we found that synthesis of
inflammatory cytokines by human PBMC is induced by extremely low
amounts of endotoxin (induced TNF-.alpha. secretion is detectable
with just 6 .mu.g/ml endotoxin, 2 logs more sensitive than murine
immune cells). In contrast, activation of human B cells and
induction of human NK cell lytic activity with endotoxin is low
even at high endotoxin concentrations. Based on these results we
selected activation of NK cells (lytic activity and CD69
expression) and B cells (proliferation and CD86 expression) as the
most highly specific and reproducible assays with low inter-subject
variability and used these assays for in vitro screening of a pool
of ODN.
[0382] First we studied the effect of phosphorothioate ODN
containing various combinations and permutations of CpG motifs on
NK cell-mediated lysis of target cells. For clarity and ease of
presentation, only data with selected representative CpG and
control ODN are shown. Human PBMC were incubated with different
phosphorothioate ODN (6 .mu.g/ml) for 24 hours and tested for their
ability to lyse .sup.51Cr-labeled K562 cells. ODN with two 6-mer
CpG motifs (either 5' GACGTT 3' (SEQ ID NO.: 1143) or 5' GTCGTT 3'
(SEQ ID NO.: 1144)) in combination with a TpC at the 5' end of the
ODN (ODN 1840 5' TCCATGTCGTTCCTGTCGTT 3' (SEQ ID NO.: 83), ODN 1851
5' TCCTGACGTTCCTGACGTT 3' (SEQ ID NO.: 94) or with at least three
6-mer motifs without a TpC at the 5' end (ODN 2013 (SEQ ID NO.:
253)) show intermediate activity. High activity was found when the
5' TpC directly preceded a 6-mer human CpG motif (5' TCGTCGTT 3'
(SEQ ID NO: 1145) (in SEQ ID NO.: 246)) and was followed by two
6-mer motifs (ODN 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.:
246) and ODN 2007 (SEQ ID NO.: 247)). The best results were
obtained when the 6-mer CpG motifs were separated from each other
and from the 5' 8-mer CpG motif by TpT (ODN 2006 (SEQ ID NO.:
246)).
[0383] Expression of the activation marker CD69 is rapidly
upregulated on the surface of NK cells subsequent to stimulation.
To confirm the results from the NK cell lysis assay, PBMC were
incubated for 18 hours with ODN (2 .mu.g/ml). CD69 expression was
examined on CD56 positive NK cells (CD3, CD14 and CD19 negative).
Although induction of CD69 expression was less sequence restricted
than stimulation of NK cell functional activity, control ODN(ODN
1982, ODN 2116, ODN 2117, ODN 2010) showed only low activity
similar to background levels. ODN with two human CpG motifs
separated by 5' TTTT 3' (ODN 1965 (SEQ ID NO.: 208)) or four human
CpG motifs without spacing (ODN 2013 (SEQ ID NO.: 253)) were
relatively more active at inducing CD69 expression than at
stimulating NK cell lytic activity. Optimal NK cell functional
activity, as well as CD69 expression, was obtained with ODNs
containing a TpC dinucleotide preceding the human CpG motif, and
additional human motifs within the sequence (ODN 2006 (SEQ ID NO.:
246), ODN 2007 (SEQ ID NO.: 247)).
[0384] Activity of phosphorothioate ODN for stimulating human B
cells: In preliminary experiments we found that the percentage of
proliferating B cells (CFSE assay, see methods section) correlated
with the surface expression of the co-stimulatory CD86 on B cells,
as measured by flow cytometry. Thus we used CD86 expression on B
cells to screen a panel of ODN for their immunostimulatory
activity. PBMC were incubated with 0.6 .mu.g/ml ODN. Expression of
CD86 (mean fluorescence intensity, MFI) was examined on CD19
positive B cells. A poly C ODN (ODN 2017 (SEQ ID NO.: 257)) or ODN
without CpG dinucleotides (ODN 1982 (SEQ ID NO.: 225)) failed to
stimulate human B cells under these experimental conditions. A
phosphorothioate ODN (ODN 2116 (SEQ ID NO.: 256)) with one optimal
human CpG motif preceded by a TpC (5' TCGTCGTT 3' (SEQ ID NO: 1145)
(in SEQ ID NO.: 246)) was inactive. The presence of one human 6-mer
CpG motif (5' GTCGTT 3' (SEQ ID NO.: 1144)) had no activating
effect. Two of these CpG motifs within the sequence showed no (ODN
1960 (SEQ ID NO.: 203), ODN 2016 (SEQ ID NO.: 256)) or intermediate
(ODN 1965 (SEQ ID NO.: 208)) activity dependent on the sequence
context. If the ODN was composed of three or four copies of this
motif (ODN 2012 (SEQ ID NO.: 252), ODN 2013 (SEQ ID NO.: 253), ODN
2014 (SEQ ID NO.: 254)), intermediate activity on B cells could be
detected. The combination of the human 8-mer CpG motif on the 5'
end of the ODN with two 6-mer CpG motifs (ODN 2005 (SEQ ID NO.:
245), ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247), ODN
2102 (SEQ ID NO.: 343), ODN 2103 (SEQ ID NO.: 344)) led to a
considerable increase in the ability of the ODN to stimulate B
cells. The spacing between the single motifs was critical. The
separation of CpG motifs by TpT was preferable (ODN 2006 (SEQ ID
NO.: 246)) compared to unseparated CpG motifs (ODN 2005 (SEQ ID
NO.:); also compare ODN 1965 (SEQ ID NO.: 208) to ODN 1960 (SEQ ID
NO.: 203)). The human 6-mer CpG motif (5' GTCGTT 3') was better
than the optimal mouse 6-mer CpG motif (5' GACGTT 3' (SEQ ID NO.:
246)) when combined with the human 8-mer CpG motif on the 5' end
(ODN 2006 vs. ODN 2102 (SEQ ID NO.: 343) and ODN 2103 (SEQ ID NO.:
344)). A (TCG).sub.poly ODN was inactive or only weakly active, as
were ODN containing CpG dinucleotides flanked by guanines or other
CpG dinucleotides (ODN 2010 (SEQ ID NO.: 250)). Taken together, the
findings for NK cells and B cells showed consistently that of the
ODN tested, ODN 2006 (SEQ ID NO.: 246) has the highest
immunostimulatory activity on human immune cells.
[0385] Comparative analysis of potency of CpG phosphorothioate ODNs
in different primates: Different CpG motifs are optimal to activate
murine and human immune cells. Furthermore, the number and location
of CpG motifs within an active phosphorothioate ODN is different in
mice and humans. We were interested to know if CpG phosphorothioate
ODN show a similar activity among different species of primates. We
compared a panel of CpG ODN for their ability to induce B cell
proliferation in humans, chimpanzees and rhesus or cynomolgus
monkeys. The capability of ODN to stimulate human B cell
proliferation (Table J) correlated well with their ability to
induce CD86 expression on B cells. ODN 2006 (SEQ ID NO.: 246),
which showed the highest activity in human B cells and NK cells,
was also the most active in stimulating chimpanzee and rhesus
monkey B cell proliferation (Table J). ODN 1968 (SEQ ID NO.: 211)
and ODN 2006 (SEQ ID NO.: 246) gave the highest activation of
cynomolgus monkey B-cells in vitro (SI of 25 and 29 respectively at
6 .mu.g ODN/ml). Surprisingly, CpG ODN 2007 (SEQ ID NO.: 247),
which displayed similarly high activity as the optimal ODN 2006
(SEQ ID NO.: 246) in human cells, did not stimulate Rhesus monkey
or chimpanzee B cell proliferation, and the ODN 1968 (SEQ ID NO.:
211) showed low activity. CpG ODN originally identified with high
activity in mice (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.:
69)) showed little activity in monkeys (Table J).
TABLE-US-00011 TABLE J Proliferative response of PBMC to
phosphorothioate CpG ODN in primates Rhesus Humans Chimpanzee
monkey No addition 0.5 +- 0.1 0.5 +- 0.1 0.5 +- 0.0 ODN 1760 23 +-
7 0.3 +- 0.1 0.5 +- 0.3 (SEQ ID NO.: 3) ODN 1826 0.8 +- 0.1 0.4 +-
0.1 0.6 +- 0.1 (SEQ ID NO.: 69) ODN 1968 35 +- 9 20.0 +- 3.8 1.9 +-
0.7 (SEQ ID NO.: 211) ODN 1982 9.7 +- 1.1 2.5 +- 1.1 0.7 +- 0.1
(SEQ ID NO.: 225) ODN 2006 58 +- 8 27.4 +- 8.9 6.3 +- 3.3 (SEQ ID
NO.: 246) ODN 2007 47 +- 11 0.5 +- 0.1 0.4 +- 0.2 (SEQ ID NO.:
247)
PBMC were prepared from peripheral blood and incubated with ODN
(0.6 .mu.g/ml) as indicated for five days. Proliferation was
measured by uptake of .sup.3H/thymidine (cpm/1000) during the last
18 hours. More than 95% of proliferating cells were B-cells as
determined using the CFSE assay. Four human probands, six
chimpanzees and two rhesus monkeys were tested.
[0386] In vivo adjuvant activity of CpG ODN in chimpanzees and
cynomolgus monkeys: In order to evaluate whether CpG ODN with
strong in vitro stimulatory effects on primate cells had detectable
adjuvant activity in vivo, Cynomolgus monkeys and chimpanzees were
immunized with Engerix B, which comprises HBsAg adsorbed to alum,
alone or with added ODN 1968 (500 .mu.g) or ODN 2006 (SEQ ID NO.:
246) (1 mg) respectively. Compared to controls not receiving CpG
ODN, anti-HBs titers at 4 weeks post-prime and 2 weeks post-boost
were 66- and 16-fold higher respectively in the monkeys, and 15-
and 3-fold higher in the chimpanzees (Table K). Thus a clear
adjuvant effect of CpG ODN was seen, and this was particularly
striking after a single immunization.
TABLE-US-00012 TABLE K Anti-HBs responses in primates immunized
against HBsAg with CpG ODN.sup.3 Anti-HBs (mIU/ml) Primate 4 wks 2
wks species n CpG ODN post-prime post-boost Cynomolgus 5 None 15
.+-. 44 4880 .+-. 13113 monkey 5 ODN 1968 (500 .mu.g) 995 .+-. 1309
76449 .+-. 42094 (SEQ ID NO. 211) Chimpanzee 2 None 6, 11 3712,
4706 2 ODN 2006 (1 mg) 125, 135 9640, 16800 (SEQ ID NO. 246)
.sup.3Animals were immunized by IM injection of Engerix B
containing 10 .mu.g HBsAg adsorbed to alum, alone or with added CpG
ODN. Cynomolgus monkeys were boosted at 10 wks and chimpanzees were
boosted at 4 wks post-prime. Anti-HBs was determined by ELISA
assay; values for monkeys are GMT .+-. SEM (n = 5) whereas
individual values for the two chimpanzees in each group are
provided.
[0387] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the invention.
Sequence CWU 1
1
1145118DNAArtificial SequenceSynthetic Sequence 1tctcccagcg
tgcgccat 18220DNAArtificial SequenceSynthetic Sequence 2ataatccagc
ttgaaccaag 20320DNAArtificial SequenceSynthetic Sequence
3ataatcgacg ttcaagcaag 20418DNAArtificial SequenceSynthetic
Sequence 4taccgcgtgc gaccctct 1859DNAArtificial SequenceSynthetic
Sequence 5ggggagggt 969DNAArtificial SequenceSynthetic Sequence
6ggggagggg 979DNAArtificial SequenceSynthetic Sequence 7ggtgaggtg
9820DNAArtificial Sequencemodified_base(8)...(8)m5c 8tccatgtngt
tcctgatgct 20915DNAArtificial Sequencemodified_base(11)...(11)m5c
9gctaccttag ngtga 151020DNAArtificial
Sequencemodified_base(8)...(8)m5c 10tccatgangt tcctgatgct
201120DNAArtificial Sequencemodified_base(13)...(13)m5c
11tccatgacgt tcntgatgct 201215DNAArtificial
Sequencemodified_base(7)...(7)m5c 12gctagangtt agtgt
151319DNAArtificial SequenceSynthetic Sequence 13agctccatgg
tgctcactg 191420DNAArtificial SequenceSynthetic Sequence
14ccacgtcgac cctcaggcga 201520DNAArtificial SequenceSynthetic
Sequence 15gcacatcgtc ccgcagccga 201619DNAArtificial
SequenceSynthetic Sequence 16gtcactcgtg gtacctcga
191725DNAArtificial SequenceSynthetic Sequence 17gttggataca
ggccagactt tgttg 251825DNAArtificial SequenceSynthetic Sequence
18gattcaactt gcgctcatct taggc 251924DNAArtificial SequenceSynthetic
Sequence 19accatggacg aactgtttcc cctc 242024DNAArtificial
SequenceSynthetic Sequence 20accatggacg agctgtttcc cctc
242124DNAArtificial SequenceSynthetic Sequence 21accatggacg
acctgtttcc cctc 242224DNAArtificial SequenceSynthetic Sequence
22accatggacg tactgtttcc cctc 242324DNAArtificial SequenceSynthetic
Sequence 23accatggacg gtctgtttcc cctc 242424DNAArtificial
SequenceSynthetic Sequence 24accatggacg ttctgtttcc cctc
242525DNAArtificial SequenceSynthetic Sequence 25ccactcacat
ctgctgctcc acaag 252625DNAArtificial SequenceSynthetic Sequence
26acttctcata gtccctttgg tccag 252720DNAArtificial SequenceSynthetic
Sequence 27tccatgagct tcctgagtct 202820DNAArtificial
SequenceSynthetic Sequence 28gaggaaggng nggangacgt
202920DNAArtificial SequenceSynthetic Sequence 29gtgaatncgt
tcncgggnct 20306DNAArtificial SequenceSynthetic Sequence 30aaaaaa
6316DNAArtificial SequenceSynthetic Sequence 31cccccc
6326DNAArtificial SequenceSynthetic Sequence 32ctgtca
6336DNAArtificial SequenceSynthetic Sequence 33tcgtag
6346DNAArtificial SequenceSynthetic Sequence 34tcgtgg
6356DNAArtificial SequenceSynthetic Sequence 35cgtcgt
63620DNAArtificial SequenceSynthetic Sequence 36tccatgtcgg
tcctgagtct 203720DNAArtificial SequenceSynthetic Sequence
37tccatgccgg tcctgagtct 203820DNAArtificial SequenceSynthetic
Sequence 38tccatgacgg tcctgagtct 203920DNAArtificial
SequenceSynthetic Sequence 39tccatgacgg tcctgagtct
204020DNAArtificial SequenceSynthetic Sequence 40tccatgtcga
tcctgagtct 204120DNAArtificial SequenceSynthetic Sequence
41tccatgtcgc tcctgagtct 204220DNAArtificial SequenceSynthetic
Sequence 42tccatgtcgt tcctgagtct 204320DNAArtificial
SequenceSynthetic Sequence 43tccatgacgt tcctgagtct
204420DNAArtificial SequenceSynthetic Sequence 44tccataacgt
tcctgagtct 204520DNAArtificial SequenceSynthetic Sequence
45tccatgacgt ccctgagtct 204620DNAArtificial SequenceSynthetic
Sequence 46tccatcacgt gcctgagtct 204720DNAArtificial
SequenceSynthetic Sequence 47tccatgctgg tcctgagtct
204820DNAArtificial Sequencemodified_base(8)...(8)m5c 48tccatgtngg
tcctgagtct 204939DNAArtificial SequenceSynthetic Sequence
49ccgcttcctc cagatgagct catgggtttc tccaccaag 395039DNAArtificial
SequenceSynthetic Sequence 50cttggtggag aaacccatga gctcatctgg
aggaagcgg 395120DNAArtificial SequenceSynthetic Sequence
51ccccaaaggg atgagaagtt 205220DNAArtificial SequenceSynthetic
Sequence 52agatagcaaa tcggctgacg 205320DNAArtificial
SequenceSynthetic Sequence 53ggttcacgtg ctcatggctg
205418DNAArtificial SequenceSynthetic Sequence 54tctcccagcg
tgcgccat 185518DNAArtificial SequenceSynthetic Sequence
55tctcccagcg tgcgccat 185618DNAArtificial SequenceSynthetic
Sequence 56taccgcgtgc gaccctct 185720DNAArtificial
SequenceSynthetic Sequence 57ataatccagc ttgaaccaag
205820DNAArtificial SequenceSynthetic Sequence 58ataatcgacg
ttcaagcaag 205920DNAArtificial SequenceSynthetic Sequence
59tccatgattt tcctgatttt 206024DNAArtificial SequenceSynthetic
Sequence 60ttgttttttt gtttttttgt tttt 246122DNAArtificial
SequenceSynthetic Sequence 61ttttttttgt ttttttgttt tt
226224DNAArtificial SequenceSynthetic Sequence 62tgctgctttt
gtgcttttgt gctt 246322DNAArtificial SequenceSynthetic Sequence
63tgctgcttgt gcttttgtgc tt 226423DNAArtificial SequenceSynthetic
Sequence 64gcattcatca ggcgggcaag aat 236523DNAArtificial
SequenceSynthetic Sequence 65taccgagctt cgacgagatt tca
236615DNAArtificial SequenceSynthetic Sequence 66gcatgacgtt gagct
156715DNAArtificial SequenceSynthetic Sequence 67cacgttgagg ggcat
156815DNAArtificial SequenceSynthetic Sequence 68ctgctgagac tggag
156920DNAArtificial SequenceSynthetic Sequence 69tccatgacgt
tcctgacgtt 207017DNAArtificial SequenceSynthetic Sequence
70gcatgagctt gagctga 177112DNAArtificial SequenceSynthetic Sequence
71tcagcgtgcg cc 127217DNAArtificial SequenceSynthetic Sequence
72atgacgttcc tgacgtt 177320DNAArtificial SequenceSynthetic Sequence
73ttttggggtt ttggggtttt 207420DNAArtificial SequenceSynthetic
Sequence 74tctaggcttt ttaggcttcc 207520DNAArtificial
SequenceSynthetic Sequence 75tgcatttttt aggccaccat
207622DNAArtificial SequenceSynthetic Sequence 76tctcccagcg
tgcgtgcgcc at 227717DNAArtificial SequenceSynthetic Sequence
77tctcccagcg ggcgcat 177818DNAArtificial SequenceSynthetic Sequence
78tctcccagcg agcgccat 187918DNAArtificial SequenceSynthetic
Sequence 79tctcccagcg cgcgccat 188019DNAArtificial
SequenceSynthetic Sequence 80ggggtgacgt tcagggggg
198124DNAArtificial SequenceSynthetic Sequence 81ggggtccagc
gtgcgccatg gggg 248219DNAArtificial SequenceSynthetic Sequence
82ggggtgtcgt tcagggggg 198320DNAArtificial SequenceSynthetic
Sequence 83tccatgtcgt tcctgtcgtt 208420DNAArtificial
SequenceSynthetic Sequence 84tccatagcgt tcctagcgtt
208521DNAArtificial SequenceSynthetic Sequence 85tcgtcgctgt
ctccgcttct t 218615DNAArtificial SequenceSynthetic Sequence
86gcatgacgtt gagct 158720DNAArtificial SequenceSynthetic Sequence
87tctcccagcg tgcgccatat 208820DNAArtificial
Sequencemodified_base(8)...(8)m5c 88tccatgangt tcctgangtt
208915DNAArtificial Sequencemodified_base(7)...(7)m5c 89gcatgangtt
gagct 159016DNAArtificial SequenceSynthetic Sequence 90tccagcgtgc
gccata 169118DNAArtificial SequenceSynthetic Sequence 91tctcccagcg
tgcgccat 189220DNAArtificial SequenceSynthetic Sequence
92tccatgagct tcctgagtct 209315DNAArtificial SequenceSynthetic
Sequence 93gcatgtcgtt gagct 159419DNAArtificial SequenceSynthetic
Sequence 94tcctgacgtt cctgacgtt 199515DNAArtificial
SequenceSynthetic Sequence 95gcatgatgtt gagct 159615DNAArtificial
SequenceSynthetic Sequence 96gcatttcgag gagct 159715DNAArtificial
SequenceSynthetic Sequence 97gcatgtagct gagct 159820DNAArtificial
SequenceSynthetic Sequence 98tccaggacgt tcctagttct
209920DNAArtificial SequenceSynthetic Sequence 99tccaggagct
tcctagttct 2010020DNAArtificial SequenceSynthetic Sequence
100tccaggatgt tcctagttct 2010120DNAArtificial SequenceSynthetic
Sequence 101tccagtctag gcctagttct 2010220DNAArtificial
SequenceSynthetic Sequence 102tccagttcga gcctagttct
2010315DNAArtificial SequenceSynthetic Sequence 103gcatggcgtt gagct
1510415DNAArtificial SequenceSynthetic Sequence 104gcatagcgtt gagct
1510515DNAArtificial SequenceSynthetic Sequence 105gcattgcgtt gagct
1510615DNAArtificial SequenceSynthetic Sequence 106gcttgcgttg cgttt
1510721DNAArtificial SequenceSynthetic Sequence 107tctcccagcg
ttgcgccata t 2110820DNAArtificial SequenceSynthetic Sequence
108tctcccagcg tgcgttatat 2010920DNAArtificial SequenceSynthetic
Sequence 109tctccctgcg tgcgccatat 2011020DNAArtificial
SequenceSynthetic Sequence 110tctgcgtgcg tgcgccatat
2011120DNAArtificial SequenceSynthetic Sequence 111tctcctagcg
tgcgccatat 2011220DNAArtificial SequenceSynthetic Sequence
112tctcccagcg tgcgcctttt 2011313DNAArtificial SequenceSynthetic
Sequence 113gctandcghh agc 1311413DNAArtificial SequenceSynthetic
Sequence 114tcctgacgtt ccc 1311513DNAArtificial SequenceSynthetic
Sequence 115ggaagacgtt aga 1311613DNAArtificial SequenceSynthetic
Sequence 116tcctgacgtt aga 1311727DNAArtificial SequenceSynthetic
Sequence 117tcagaccagc tggtcgggtg ttcctga 2711827DNAArtificial
SequenceSynthetic Sequence 118tcaggaacac ccgaccagct ggtctga
2711913DNAArtificial SequenceSynthetic Sequence 119gctagtcgat agc
1312013DNAArtificial SequenceSynthetic Sequence 120gctagtcgct agc
1312114DNAArtificial SequenceSynthetic Sequence 121gcttgacgtc tagc
1412214DNAArtificial SequenceSynthetic Sequence 122gcttgacgtt tagc
1412314DNAArtificial SequenceSynthetic Sequence 123gcttgacgtc aagc
1412414DNAArtificial SequenceSynthetic Sequence 124gctagacgtt tagc
1412520DNAArtificial SequenceSynthetic Sequence 125tccatgacat
tcctgatgct 2012614DNAArtificial SequenceSynthetic Sequence
126gctagacgtc tagc 1412719DNAArtificial SequenceSynthetic Sequence
127ggctatgtcg ttcctagcc 1912819DNAArtificial SequenceSynthetic
Sequence 128ggctatgtcg atcctagcc 1912921DNAArtificial
SequenceSynthetic Sequence 129ctcatgggtt tctccaccaa g
2113021DNAArtificial SequenceSynthetic Sequence 130cttggtggag
aaacccatga g 2113120DNAArtificial SequenceSynthetic Sequence
131tccatgacgt tcctagttct 2013224DNAArtificial SequenceSynthetic
Sequence 132ccgcttcctc cagatgagct catg 2413324DNAArtificial
SequenceSynthetic Sequence 133catgagctca tctggaggaa gcgg
2413424DNAArtificial SequenceSynthetic Sequence 134ccagatgagc
tcatgggttt ctcc 2413524DNAArtificial SequenceSynthetic Sequence
135ggagaaaccc atgagctcat ctgg 2413620DNAArtificial
SequenceSynthetic Sequence 136agcatcagga acgacatgga
2013720DNAArtificial SequenceSynthetic Sequence 137tccatgacgt
tcctgacgtt 2013819DNAArtificial SequenceSynthetic Sequence
138gcgcgcgcgc gcgcgcgcg 1913920DNAArtificial SequenceSynthetic
Sequence 139ccggccggcc ggccggccgg 2014043DNAArtificial
SequenceSynthetic Sequence 140ttccaatcag ccccacccgc tctggcccca
ccctcaccct cca 4314143DNAArtificial SequenceSynthetic Sequence
141tggagggtga gggtggggcc agagcgggtg gggctgattg gaa
4314227DNAArtificial SequenceSynthetic Sequence 142tcaaatgtgg
gattttccca tgagtct 2714327DNAArtificial SequenceSynthetic Sequence
143agactcatgg gaaaatccca catttga 2714427DNAArtificial
SequenceSynthetic Sequence 144tgccaagtgc tgagtcacta ataaaga
2714527DNAArtificial SequenceSynthetic Sequence 145tctttattag
tgactcagca cttggca 2714631DNAArtificial SequenceSynthetic Sequence
146tgcaggaagt ccgggttttc cccaaccccc c 3114731DNAArtificial
SequenceSynthetic Sequence 147ggggggttgg ggaaaacccg gacttcctgc a
3114838DNAArtificial SequenceSynthetic Sequence 148ggggactttc
cgctggggac tttccagggg gactttcc 3814945DNAArtificial
SequenceSynthetic Sequence 149tccatgacgt tcctctccat gacgttcctc
tccatgacgt tcctc 4515045DNAArtificial
SequenceSynthetic Sequence 150gaggaacgtc atggagagga acgtcatgga
gaggaacgtc atgga 4515120DNAArtificial SequenceSynthetic Sequence
151ataatagagc ttcaagcaag 2015220DNAArtificial SequenceSynthetic
Sequence 152tccatgacgt tcctgacgtt 2015320DNAArtificial
SequenceSynthetic Sequence 153tccatgacgt tcctgacgtt
2015420DNAArtificial SequenceSynthetic Sequence 154tccaggactt
tcctcaggtt 2015545DNAArtificial SequenceSynthetic Sequence
155tcttgcgatg ctaaaggacg tcacattgca caatcttaat aaggt
4515645DNAArtificial SequenceSynthetic Sequence 156accttattaa
gattgtgcaa tgtgacgtcc tttagcatcg caaga 4515728DNAArtificial
SequenceSynthetic Sequence 157tcctgacgtt cctggcggtc ctgtcgct
2815819DNAArtificial SequenceSynthetic Sequence 158tcctgtcgct
cctgtcgct 1915915DNAArtificial SequenceSynthetic Sequence
159tcctgacgtt gaagt 1516015DNAArtificial SequenceSynthetic Sequence
160tcctgtcgtt gaagt 1516115DNAArtificial SequenceSynthetic Sequence
161tcctggcgtt gaagt 1516215DNAArtificial SequenceSynthetic Sequence
162tcctgccgtt gaagt 1516315DNAArtificial SequenceSynthetic Sequence
163tccttacgtt gaagt 1516415DNAArtificial SequenceSynthetic Sequence
164tcctaacgtt gaagt 1516515DNAArtificial SequenceSynthetic Sequence
165tcctcacgtt gaagt 1516615DNAArtificial SequenceSynthetic Sequence
166tcctgacgat gaagt 1516715DNAArtificial SequenceSynthetic Sequence
167tcctgacgct gaagt 1516815DNAArtificial SequenceSynthetic Sequence
168tcctgacggt gaagt 1516915DNAArtificial SequenceSynthetic Sequence
169tcctgacgta gaagt 1517015DNAArtificial SequenceSynthetic Sequence
170tcctgacgtc gaagt 1517115DNAArtificial SequenceSynthetic Sequence
171tcctgacgtg gaagt 1517215DNAArtificial SequenceSynthetic Sequence
172tcctgagctt gaagt 1517315DNAArtificial SequenceSynthetic Sequence
173gggggacgtt ggggg 1517415DNAArtificial SequenceSynthetic Sequence
174tcctgacgtt ccttc 1517522DNAArtificial SequenceSynthetic Sequence
175tctcccagcg agcgagcgcc at 2217632DNAArtificial SequenceSynthetic
Sequence 176tcctgacgtt cccctggcgg tcccctgtcg ct
3217728DNAArtificial SequenceSynthetic Sequence 177tcctgtcgct
cctgtcgctc ctgtcgct 2817815DNAArtificial SequenceSynthetic Sequence
178tcctggcggg gaagt 1517915DNAArtificial
Sequencemodified_base(7)...(7)m5c 179tcctgangtt gaagt
1518015DNAArtificial Sequencemodified_base(3)...(3)m5c
180tcntgacgtt gaagt 1518115DNAArtificial SequenceSynthetic Sequence
181tcctagcgtt gaagt 1518215DNAArtificial SequenceSynthetic Sequence
182tccagacgtt gaagt 1518315DNAArtificial SequenceSynthetic Sequence
183tcctgacggg gaagt 1518415DNAArtificial SequenceSynthetic Sequence
184tcctggcggt gaagt 1518527DNAArtificial SequenceSynthetic Sequence
185ggctccgggg agggaatttt tgtctat 2718627DNAArtificial
SequenceSynthetic Sequence 186atagacaaaa attccctccc cggagcc
2718721DNAArtificial SequenceSynthetic Sequence 187tccatgagct
tccttgagtc t 2118821DNAArtificial SequenceSynthetic Sequence
188tcgtcgctgt ctccgcttct t 2118921DNAArtificial SequenceSynthetic
Sequence 189tcgtcgctgt ctccgcttct t 2119023DNAArtificial
SequenceSynthetic Sequence 190tcgagacatt gcacaatcat ctg
2319120DNAArtificial SequenceSynthetic Sequence 191cagattgtgc
aatgtctcga 2019220DNAArtificial SequenceSynthetic Sequence
192tccatgtcgt tcctgatgcg 2019320DNAArtificial SequenceSynthetic
Sequence 193gcgatgtcgt tcctgatgct 2019420DNAArtificial
SequenceSynthetic Sequence 194gcgatgtcgt tcctgatgcg
2019520DNAArtificial SequenceSynthetic Sequence 195tccatgtcgt
tccgcgcgcg 2019620DNAArtificial SequenceSynthetic Sequence
196tccatgtcgt tcctgccgct 2019720DNAArtificial SequenceSynthetic
Sequence 197tccatgtcgt tcctgtagct 2019820DNAArtificial
SequenceSynthetic Sequence 198gcggcgggcg gcgcgcgccc
2019921DNAArtificial SequenceSynthetic Sequence 199atcaggaacg
tcatgggaag c 2120020DNAArtificial SequenceSynthetic Sequence
200tccatgagct tcctgagtct 202018DNAArtificial SequenceSynthetic
Sequence 201tcaacgtt 82028DNAArtificial SequenceSynthetic Sequence
202tcaagctt 820319DNAArtificial SequenceSynthetic Sequence
203tcctgtcgtt cctgtcgtt 1920420DNAArtificial SequenceSynthetic
Sequence 204tccatgtcgt ttttgtcgtt 2020520DNAArtificial
SequenceSynthetic Sequence 205tcctgtcgtt ccttgtcgtt
2020620DNAArtificial SequenceSynthetic Sequence 206tccttgtcgt
tcctgtcgtt 2020729DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
207tccattccat gacgttcctg atgcttcca 2920820DNAArtificial
SequenceSynthetic Sequence 208tcctgtcgtt ttttgtcgtt
2020921DNAArtificial SequenceSynthetic Sequence 209tcgtcgctgt
ctccgcttct t 2121021DNAArtificial SequenceSynthetic Sequence
210tcgtcgctgt ctgcccttct t 2121121DNAArtificial SequenceSynthetic
Sequence 211tcgtcgctgt tgtcgtttct t 2121230DNAArtificial
SequenceSynthetic Sequence 212tcctgtcgtt cctgtcgttg gaacgacagg
3021340DNAArtificial SequenceSynthetic Sequence 213tcctgtcgtt
cctgtcgttt caacgtcagg aacgacagga 4021421DNAArtificial
SequenceSynthetic Sequence 214ggggtctgtc gttttggggg g
2121521DNAArtificial SequenceSynthetic Sequence 215ggggtctgtg
cttttggggg g 2121615DNAArtificial SequenceSynthetic Sequence
216tccggccgtt gaagt 1521715DNAArtificial SequenceSynthetic Sequence
217tccggacggt gaagt 1521815DNAArtificial SequenceSynthetic Sequence
218tcccgccgtt gaagt 1521915DNAArtificial SequenceSynthetic Sequence
219tccagacggt gaagt 1522015DNAArtificial SequenceSynthetic Sequence
220tcccgacggt gaagt 1522115DNAArtificial SequenceSynthetic Sequence
221tccagagctt gaagt 1522220DNAArtificial
Sequencemodified_base(8)...(8)m5c 222tccatgtngt tcctgtngtt
2022320DNAArtificial SequenceSynthetic Sequence 223tccatgacgt
tcctgacgtt 2022420DNAArtificial SequenceSynthetic Sequence
224ggggttgacg ttttgggggg 2022520DNAArtificial SequenceSynthetic
Sequence 225tccaggactt ctctcaggtt 2022620DNAArtificial
SequenceSynthetic Sequence 226tttttttttt tttttttttt
2022720DNAArtificial SequenceSynthetic Sequence 227tccatgccgt
tcctgccgtt 2022820DNAArtificial SequenceSynthetic Sequence
228tccatggcgg gcctggcggg 2022920DNAArtificial SequenceSynthetic
Sequence 229tccatgacgt tcctgccgtt 2023020DNAArtificial
SequenceSynthetic Sequence 230tccatgacgt tcctggcggg
2023120DNAArtificial SequenceSynthetic Sequence 231tccatgacgt
tcctgcgttt 2023220DNAArtificial SequenceSynthetic Sequence
232tccatgacgg tcctgacggt 2023320DNAArtificial SequenceSynthetic
Sequence 233tccatgcgtg cgtgcgtttt 2023420DNAArtificial
SequenceSynthetic Sequence 234tccatgcgtt gcgttgcgtt
2023530DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to
biotin moiety. 235tccattccat tctaggcctg agtcttccat
3023620DNAArtificial SequenceSynthetic Sequence 236tccatagcgt
tcctagcgtt 2023720DNAArtificial SequenceSynthetic Sequence
237tccatgtcgt tcctgtcgtt 2023820DNAArtificial SequenceSynthetic
Sequence 238tccatagcga tcctagcgat 2023920DNAArtificial
SequenceSynthetic Sequence 239tccattgcgt tccttgcgtt
2024020DNAArtificial SequenceSynthetic Sequence 240tccatagcgg
tcctagcggt 2024129DNAArtificial SequenceSynthetic Sequence
241tccatgattt tcctgcagtt cctgatttt 2924229DNAArtificial
SequenceSynthetic Sequence 242tccatgacgt tcctgcagtt cctgacgtt
2924320DNAArtificial SequenceSynthetic Sequence 243ggcggcggcg
gcggcggcgg 2024420DNAArtificial SequenceSynthetic Sequence
244tccacgacgt tttcgacgtt 2024520DNAArtificial SequenceSynthetic
Sequence 245tcgtcgttgt cgttgtcgtt 2024624DNAArtificial
SequenceSynthetic Sequence 246tcgtcgtttt gtcgttttgt cgtt
2424722DNAArtificial SequenceSynthetic Sequence 247tcgtcgttgt
cgttttgtcg tt 2224821DNAArtificial SequenceSynthetic Sequence
248gcgtgcgttg tcgttgtcgt t 2124919DNAArtificial SequenceSynthetic
Sequence 249cnggcnggcn gggcnccgg 1925020DNAArtificial
SequenceSynthetic Sequence 250gcggcgggcg gcgcgcgccc
2025120DNAArtificial SequenceSynthetic Sequence 251agncccgnga
acgnattcac 2025221DNAArtificial SequenceSynthetic Sequence
252tgtcgtttgt cgtttgtcgt t 2125325DNAArtificial SequenceSynthetic
Sequence 253tgtcgttgtc gttgtcgttg tcgtt 2525425DNAArtificial
SequenceSynthetic Sequence 254tgtcgttgtc gttgtcgttg tcgtt
2525514DNAArtificial SequenceSynthetic Sequence 255tcgtcgtcgt cgtt
1425613DNAArtificial SequenceSynthetic Sequence 256tgtcgttgtc gtt
1325720DNAArtificial SequenceSynthetic Sequence 257cccccccccc
cccccccccc 2025820DNAArtificial SequenceSynthetic Sequence
258tctagcgttt ttagcgttcc 2025920DNAArtificial SequenceSynthetic
Sequence 259tgcatccccc aggccaccat 2026023DNAArtificial
SequenceSynthetic Sequence 260tcgtcgtcgt cgtcgtcgtc gtt
2326120DNAArtificial SequenceSynthetic Sequence 261tcgtcgttgt
cgttgtcgtt 2026224DNAArtificial SequenceSynthetic Sequence
262tcgtcgtttt gtcgttttgt cgtt 2426322DNAArtificial
SequenceSynthetic Sequence 263tcgtcgttgt cgttttgtcg tt
2226439DNAArtificial SequenceSynthetic Sequence 264ggggagggag
gaacttctta aaattccccc agaatgttt 3926539DNAArtificial
SequenceSynthetic Sequence 265aaacattctg ggggaatttt aagaagttcc
tccctcccc 3926633DNAArtificial SequenceSynthetic Sequence
266atgtttactt cttaaaattc ccccagaatg ttt 3326733DNAArtificial
SequenceSynthetic Sequence 267aaacattctg ggggaatttt aagaagtaaa cat
3326833DNAArtificial SequenceSynthetic Sequence 268atgtttacta
gacaaaattc ccccagaatg ttt 3326933DNAArtificial SequenceSynthetic
Sequence 269aaacattctg ggggaatttt gtctagtaaa cat
3327020DNAArtificial SequenceSynthetic Sequence 270aaaattgacg
ttttaaaaaa 2027120DNAArtificial SequenceSynthetic Sequence
271ccccttgacg ttttcccccc 2027220DNAArtificial SequenceSynthetic
Sequence 272ttttcgttgt ttttgtcgtt 2027324DNAArtificial
SequenceSynthetic Sequence 273tcgtcgtttt gtcgttttgt cgtt
2427414DNAArtificial SequenceSynthetic Sequence 274ctgcagcctg ggac
1427525DNAArtificial SequenceSynthetic Sequence 275acccgtcgta
attatagtaa aaccc 2527621DNAArtificial SequenceSynthetic Sequence
276ggtacctgtg gggacattgt g 2127718DNAArtificial SequenceSynthetic
Sequence 277agcaccgaac gtgagagg 1827820DNAArtificial
SequenceSynthetic Sequence 278tccatgccgt tcctgccgtt
2027920DNAArtificial SequenceSynthetic Sequence 279tccatgacgg
tcctgacggt 2028020DNAArtificial SequenceSynthetic Sequence
280tccatgccgg tcctgccggt 2028120DNAArtificial SequenceSynthetic
Sequence 281tccatgcgcg tcctgcgcgt 2028224DNAArtificial
SequenceSynthetic Sequence 282ctggtctttc tggttttttt ctgg
2428320DNAArtificial SequenceSynthetic Sequence 283tcaggggtgg
ggggaacctt 2028420DNAArtificial Sequencemodified_base(8)...(8)m5c
284tccatgangt tcctagttct 2028520DNAArtificial SequenceSynthetic
Sequence 285tccatgatgt tcctagttct 2028626DNAArtificial
SequenceSynthetic Sequence 286cccgaagtca tttcctctta acctgg
2628726DNAArtificial SequenceSynthetic Sequence 287ccaggttaag
aggaaatgac ttcggg 2628815DNAArtificial
Sequencemodified_base(7)...(7)m5c 288tcctggnggg gaagt
1528920DNAArtificial Sequencemodified_base(2)...(2)m5c
289gnggngggng gngngngccc 2029020DNAArtificial SequenceSynthetic
Sequence 290tccatgtgct tcctgatgct 2029120DNAArtificial
SequenceSynthetic Sequence 291tccatgtcct tcctgatgct
2029220DNAArtificial SequenceSynthetic Sequence 292tccatgtcgt
tcctagttct 2029320DNAArtificial SequenceSynthetic Sequence
293tccaagtagt tcctagttct 2029420DNAArtificial SequenceSynthetic
Sequence 294tccatgtagt tcctagttct 2029520DNAArtificial
SequenceSynthetic Sequence 295tcccgcgcgt tccgcgcgtt
2029620DNAArtificial SequenceSynthetic Sequence 296tcctggcggt
cctggcggtt 2029715DNAArtificial SequenceSynthetic Sequence
297tcctggaggg gaagt 1529815DNAArtificial SequenceSynthetic
Sequence
298tcctgggggg gaagt 1529915DNAArtificial SequenceSynthetic Sequence
299tcctggtggg gaagt 1530024DNAArtificial SequenceSynthetic Sequence
300tcgtcgtttt gtcgttttgt cgtt 2430124DNAArtificial
SequenceSynthetic Sequence 301ctggtctttc tggttttttt ctgg
2430220DNAArtificial SequenceSynthetic Sequence 302tccatgacgt
tcctgacgtt 2030320DNAArtificial SequenceSynthetic Sequence
303tccaggactt ctctcaggtt 2030424DNAArtificial SequenceSynthetic
Sequence 304tngtngtttt gtngttttgt ngtt 2430529DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
305tcgtcgtttt gtcgttttgt cgttttttt 2930618DNAArtificial
SequenceSynthetic Sequence 306gctatgacgt tccaaggg
183078DNAArtificial SequenceSynthetic Sequence 307tcaacgtt
830820DNAArtificial SequenceSynthetic Sequence 308tccaggactt
tcctcaggtt 2030920DNAArtificial SequenceSynthetic Sequence
309ctctctgtag gcccgcttgg 2031020DNAArtificial SequenceSynthetic
Sequence 310ctttccgttg gacccctggg 2031120DNAArtificial
SequenceSynthetic Sequence 311gtccgggcca ggccaaagtc
2031220DNAArtificial SequenceSynthetic Sequence 312gtgcgcgcga
gcccgaaatc 2031320DNAArtificial Sequencemodified_base(8)...(8)I
313tccatgangt tcctgangtt 2031420DNAArtificial SequenceSynthetic
Sequence 314aatagtcgcc ataacaaaac 2031520DNAArtificial
SequenceSynthetic Sequence 315aatagtcgcc atggcggggc
2031628DNAArtificial Sequencemisc_difference(1)...(3)Biotin moiety
attached at 5' end of sequence. 316tttttccatg tcgttcctga tgcttttt
2831720DNAArtificial SequenceSynthetic Sequence 317tcctgtcgtt
gaagtttttt 2031824DNAArtificial SequenceSynthetic Sequence
318gctagcttta gagctttaga gctt 2431920DNAArtificial
SequenceSynthetic Sequence 319tgctgcttcc cccccccccc
2032020DNAArtificial SequenceSynthetic Sequence 320tcgacgttcc
cccccccccc 2032120DNAArtificial SequenceSynthetic Sequence
321tcgtcgttcc cccccccccc 2032220DNAArtificial SequenceSynthetic
Sequence 322tcgtcgttcc cccccccccc 2032320DNAArtificial
SequenceSynthetic Sequence 323tcgccgttcc cccccccccc
2032420DNAArtificial SequenceSynthetic Sequence 324tcgtcgatcc
cccccccccc 2032515DNAArtificial SequenceSynthetic Sequence
325tcctgacgtt gaagt 1532615DNAArtificial SequenceSynthetic Sequence
326tcctgccgtt gaagt 1532715DNAArtificial SequenceSynthetic Sequence
327tcctgacggt gaagt 1532815DNAArtificial SequenceSynthetic Sequence
328tcctgagctt gaagt 1532915DNAArtificial SequenceSynthetic Sequence
329tcctggcggg gaagt 1533021DNAArtificial SequenceSynthetic Sequence
330aaaatctgtg cttttaaaaa a 2133133DNAArtificial SequenceSynthetic
Sequence 331gatccagtca cagtgacctg gcagaatctg gat
3333233DNAArtificial SequenceSynthetic Sequence 332gatccagatt
ctgccaggtc actgtgactg gat 3333333DNAArtificial SequenceSynthetic
Sequence 333gatccagtca cagtgactca gcagaatctg gat
3333433DNAArtificial SequenceSynthetic Sequence 334gatccagatt
ctgctgagtc actgtgactg gat 3333520DNAArtificial
Sequencemodified_base(16)...(16)m5c 335tcgtcgttcc cccccncccc
2033620DNAArtificial Sequencemodified_base(2)...(2)m5c
336tngtngttcc cccccccccc 2033720DNAArtificial
Sequencemodified_base(2)...(2)m5c 337tngtcgttcc cccccccccc
2033820DNAArtificial Sequencemodified_base(5)...(5)m5c
338tcgtngttcc cccccccccc 2033920DNAArtificial SequenceSynthetic
Sequence 339tcgtcgctcc cccccccccc 2034020DNAArtificial
SequenceSynthetic Sequence 340tcgtcggtcc cccccccccc
2034120DNAArtificial SequenceSynthetic Sequence 341tcggcgttcc
cccccccccc 2034220DNAArtificial SequenceSynthetic Sequence
342ggccttttcc cccccccccc 2034324DNAArtificial SequenceSynthetic
Sequence 343tcgtcgtttt gacgttttgt cgtt 2434424DNAArtificial
SequenceSynthetic Sequence 344tcgtcgtttt gacgttttga cgtt
2434520DNAArtificial SequenceSynthetic Sequence 345ccgtcgttcc
cccccccccc 2034620DNAArtificial SequenceSynthetic Sequence
346gcgtcgttcc cccccccccc 2034720DNAArtificial SequenceSynthetic
Sequence 347tcgtcattcc cccccccccc 2034820DNAArtificial
SequenceSynthetic Sequence 348acgtcgttcc cccccccccc
2034920DNAArtificial SequenceSynthetic Sequence 349ctgtcgttcc
cccccccccc 2035024DNAArtificial Sequencemisc_feature(1)...(3)Biotin
moiety attached at 5' end of sequence. 350tttttcgtcg ttcccccccc
cccc 2435120DNAArtificial Sequencemisc_feature(18)...(20)Biotin
moiety attached at 3' end of sequence. 351tcgtcgttcc cccccccccc
2035224DNAArtificial Sequencemisc_feature(22)...(24)Biotin moiety
attached at 3' end of sequence. 352tcgtcgtttt gtcgttttgt cgtt
2435320DNAArtificial SequenceSynthetic Sequence 353tccagttcct
tcctcagtct 2035424DNAArtificial Sequencemodified_base(2)...(2)m5c
354tngtcgtttt gtcgttttgt cgtt 2435515DNAArtificial
SequenceSynthetic Sequence 355tcctggaggg gaagt 1535615DNAArtificial
SequenceSynthetic Sequence 356tcctgaaaag gaagt 1535717DNAArtificial
SequenceSynthetic Sequence 357tcgtcgttcc ccccccc
1735824DNAArtificial SequenceSynthetic Sequence 358tngtngtttt
gtngttttgt ngtt 2435920DNAArtificial SequenceSynthetic Sequence
359ggggtcaagc ttgagggggg 2036020DNAArtificial SequenceSynthetic
Sequence 360tgctgcttcc cccccccccc 2036114DNAArtificial
SequenceSynthetic Sequence 361tcgtcgtcgt cgtt 1436214DNAArtificial
SequenceSynthetic Sequence 362tcgtcgtcgt cgtt 1436314DNAArtificial
SequenceSynthetic Sequence 363tcgtcgtcgt cgtt 1436410DNAArtificial
SequenceSynthetic Sequence 364tcaacgttga 103658DNAArtificial
SequenceSynthetic Sequence 365tcaacgtt 836620DNAArtificial
SequenceSynthetic Sequence 366atagttttcc atttttttac
2036720DNAArtificial SequenceSynthetic Sequence 367aatagtcgcc
atcgcgcgac 2036820DNAArtificial SequenceSynthetic Sequence
368aatagtcgcc atcccgggac 2036920DNAArtificial SequenceSynthetic
Sequence 369aatagtcgcc atcccccccc 2037024DNAArtificial
SequenceSynthetic Sequence 370tgctgctttt gtgcttttgt gctt
2437124DNAArtificial SequenceSynthetic Sequence 371ctgtgctttc
tgtgtttttc tgtg 2437224DNAArtificial SequenceSynthetic Sequence
372ctaatctttc taattttttt ctaa 2437326DNAArtificial
SequenceSynthetic Sequence 373tcgtcgttgg tgtcgttggt gtcgtt
2637424DNAArtificial SequenceSynthetic Sequence 374tcgtcgttgg
ttgtcgtttt ggtt 2437524DNAArtificial SequenceSynthetic Sequence
375accatggacg agctgtttcc cctc 2437620DNAArtificial
SequenceSynthetic Sequence 376tcgtcgtttt gcgtgcgttt
2037720DNAArtificial SequenceSynthetic Sequence 377ctgtaagtga
gcttggagag 2037818DNAArtificial SequenceSynthetic Sequence
378gagaacgctg gaccttcc 1837920DNAArtificial SequenceSynthetic
Sequence 379cgggcgactc agtctatcgg 2038037DNAArtificial
SequenceSynthetic Sequence 380gttctcagat aaagcggaac cagcaacaga
cacagaa 3738137DNAArtificial SequenceSynthetic Sequence
381ttctgtgtct gttgctggtt ccgctttatc tgagaac 3738223DNAArtificial
SequenceSynthetic Sequence 382cagacacaga agcccgatag acg
2338320DNAArtificial SequenceSynthetic Sequence 383agacagacac
gaaacgaccg 2038420DNAArtificial SequenceSynthetic Sequence
384gtctgtccca tgatctcgaa 2038520DNAArtificial SequenceSynthetic
Sequence 385gctggccagc ttacctcccg 2038621DNAArtificial
SequenceSynthetic Sequence 386ggggcctcta tacaacctgg g
2138718DNAArtificial SequenceSynthetic Sequence 387ggggtccctg
agactgcc 1838820DNAArtificial SequenceSynthetic Sequence
388gagaacgctg gaccttccat 2038920DNAArtificial SequenceSynthetic
Sequence 389tccatgtcgg tcctgatgct 2039020DNAArtificial
SequenceSynthetic Sequence 390ctcttgcgac ctggaaggta
2039120DNAArtificial SequenceSynthetic Sequence 391aggtacagcc
aggactacga 2039224DNAArtificial SequenceSynthetic Sequence
392accatggacg acctgtttcc cctc 2439324DNAArtificial
SequenceSynthetic Sequence 393accatggatt acctttttcc cctt
2439420DNAArtificial SequenceSynthetic Sequence 394atggaaggtc
cagcgttctc 2039520DNAArtificial SequenceSynthetic Sequence
395agcatcagga ccgacatgga 2039620DNAArtificial SequenceSynthetic
Sequence 396ctctccaagc tcacttacag 2039721DNAArtificial
SequenceSynthetic Sequence 397tccctgagac tgccccacct t
2139820DNAArtificial SequenceSynthetic Sequence 398gccaccaaaa
cttgtccatg 2039920DNAArtificial SequenceSynthetic Sequence
399gtccatggcg tgcgggatga 2040019DNAArtificial SequenceSynthetic
Sequence 400cctctataca acctgggac 1940120DNAArtificial
SequenceSynthetic Sequence 401cgggcgactc agtctatcgg
2040220DNAArtificial SequenceSynthetic Sequence 402gcgctaccgg
tagcctgagt 2040335DNAArtificial SequenceSynthetic Sequence
403cgactgccga acaggatatc ggtgatcagc actgg 3540435DNAArtificial
SequenceSynthetic Sequence 404ccagtgctga tcaccgatat cctgttcggc
agtcg 3540517DNAArtificial SequenceSynthetic Sequence 405ccaggttgta
tagaggc 1740618DNAArtificial SequenceSynthetic Sequence
406tctcccagcg tacgccat 1840718DNAArtificial SequenceSynthetic
Sequence 407tctcccagcg tgcgtttt 1840818DNAArtificial
SequenceSynthetic Sequence 408tctcccgacg tgcgccat
1840918DNAArtificial SequenceSynthetic Sequence 409tctcccgtcg
tgcgccat 1841020DNAArtificial SequenceSynthetic Sequence
410ataatcgtcg ttcaagcaag 2041123DNAArtificial SequenceSynthetic
Sequence 411tcgtcgtttt gtcgttttgt cgt 2341224DNAArtificial
SequenceSynthetic Sequence 412tcgtcgtttt gtcgttttgt cgtt
2441324DNAArtificial SequenceSynthetic Sequence 413tcgtcgtttt
gtcgttttgt cgtt 2441424DNAArtificial
Sequencemisc_difference(3)...(3)n is a or c or g or t/u
414tcntcgtntt ntcgtnttnt cgtn 2441517DNAArtificial
SequenceSynthetic Sequence 415tctcccagcg tcgccat
1741617DNAArtificial SequenceSynthetic Sequence 416tctcccatcg
tcgccat 1741721DNAArtificial SequenceSynthetic Sequence
417ataatcgtgc gttcaagaaa g 2141820DNAArtificial SequenceSynthetic
Sequence 418ataatcgacg ttcccccccc 2041920DNAArtificial
SequenceSynthetic Sequence 419tctatcgacg ttcaagcaag
2042014DNAArtificial SequenceSynthetic Sequence 420tcctgacggg gagt
1442119DNAArtificial SequenceSynthetic Sequence 421tccatgacgt
tcctgatcc 1942219DNAArtificial SequenceSynthetic Sequence
422tccatgacgt tcctgatcc 1942319DNAArtificial SequenceSynthetic
Sequence 423tccatgacgt tcctgatcc 1942415DNAArtificial
SequenceSynthetic Sequence 424tcctggcgtg gaagt 1542519DNAArtificial
SequenceSynthetic Sequence 425tccatgacgt tcctgatcc
1942621DNAArtificial SequenceSynthetic Sequence 426tcgtcgctgt
tgtcgtttct t 2142724DNAArtificial SequenceSynthetic Sequence
427agcagcttta gagctttaga gctt 2442824DNAArtificial
SequenceSynthetic Sequence 428cccccccccc cccccccccc cccc
2442932DNAArtificial SequenceSynthetic Sequence 429tcgtcgtttt
gtcgttttgt cgttttgtcg tt 3243028DNAArtificial SequenceSynthetic
Sequence 430tcgtcgtttt ttgtcgtttt ttgtcgtt 2843120DNAArtificial
SequenceSynthetic Sequence 431tcgtcgtttt tttttttttt
2043220DNAArtificial SequenceSynthetic Sequence 432tttttcaacg
ttgatttttt 2043324DNAArtificial SequenceSynthetic Sequence
433tttttttttt tttttttttt tttt 2443420DNAArtificial
SequenceSynthetic Sequence 434ggggtcgtcg ttttgggggg
2043524DNAArtificial SequenceSynthetic Sequence 435tcgtcgtttt
gtcgttttgg gggg 2443627DNAArtificial SequenceSynthetic Sequence
436tcgtcgctgt ctccgcttct tcttgcc 2743715DNAArtificial
SequenceSynthetic Sequence 437tcgtcgctgt ctccg 1543820DNAArtificial
SequenceSynthetic Sequence 438ctgtaagtga gcttggagag
2043920DNAArtificial SequenceSynthetic Sequence 439gagaacgctg
gaccttccat 2044017DNAArtificial SequenceSynthetic Sequence
440ccaggttgta tagaggc 1744117DNAArtificial SequenceSynthetic
Sequence 441gctagacgtt agcgtga 1744220DNAArtificial
SequenceSynthetic Sequence 442ggagctcttc gaacgccata
2044320DNAArtificial SequenceSynthetic Sequence 443tctccatgat
ggttttatcg 2044421DNAArtificial SequenceSynthetic Sequence
444aaggtggggc agtctcaggg a 2144520DNAArtificial SequenceSynthetic
Sequence 445atcggaggac tggcgcgccg 2044620DNAArtificial
SequenceSynthetic Sequence 446ttaggacaag gtctagggtg
2044720DNAArtificial SequenceSynthetic Sequence 447accacaacga
gaggaacgca 2044820DNAArtificial SequenceSynthetic Sequence
448ggcagtgcag gctcaccggg 2044917DNAArtificial SequenceSynthetic
Sequence 449gaaccttcca tgctgtt 1745017DNAArtificial
SequenceSynthetic Sequence 450gctagacgtt agcgtga
1745120DNAArtificial SequenceSynthetic Sequence 451gcttggaggg
cctgtaagtg 2045212DNAArtificial SequenceSynthetic Sequence
452gtagccttcc ta 1245314DNAArtificial SequenceSynthetic Sequence
453cggtagcctt ccta 1445416DNAArtificial SequenceSynthetic Sequence
454cacggtagcc ttccta 1645518DNAArtificial SequenceSynthetic
Sequence 455agcacggtag ccttccta 1845618DNAArtificial
SequenceSynthetic Sequence 456gaacgctgga ccttccat
1845710DNAArtificial SequenceSynthetic Sequence 457gaccttccat
1045812DNAArtificial SequenceSynthetic Sequence 458tggaccttcc at
1245914DNAArtificial SequenceSynthetic Sequence 459gctggacctt ccat
1446016DNAArtificial SequenceSynthetic Sequence 460acgctggacc
ttccat 1646120DNAArtificial SequenceSynthetic Sequence
461taagctctgt caacgccagg 2046222DNAArtificial SequenceSynthetic
Sequence 462gagaacgctg gaccttccat gt 2246320DNAArtificial
SequenceSynthetic Sequence 463tccatgtcgg tcctgatgct
2046421DNAArtificial SequenceSynthetic Sequence 464ttcatgcctt
gcaaaatggc g 2146520DNAArtificial SequenceSynthetic Sequence
465tgctagctgt gcctgtacct 2046620DNAArtificial SequenceSynthetic
Sequence 466agcatcagga ccgacatgga 2046722DNAArtificial
SequenceSynthetic Sequence 467gaccttccat gtcggtcctg at
2246820DNAArtificial SequenceSynthetic Sequence 468acaaccacga
gaacgggaac 2046920DNAArtificial SequenceSynthetic Sequence
469gaaccttcca tgctgttccg 2047020DNAArtificial SequenceSynthetic
Sequence 470caatcaatct gaggagaccc 2047120DNAArtificial
SequenceSynthetic Sequence 471tcagctctgg tactttttca
2047220DNAArtificial SequenceSynthetic Sequence 472tggttacggt
ctgtcccatg 2047320DNAArtificial SequenceSynthetic Sequence
473gtctatcgga ggactggcgc 2047420DNAArtificial SequenceSynthetic
Sequence 474cattttacgg gcgggcgggc 2047520DNAArtificial
SequenceSynthetic Sequence 475gaggggacca ttttacgggc
2047620DNAArtificial SequenceSynthetic Sequence 476tgtccagccg
aggggaccat 2047720DNAArtificial SequenceSynthetic Sequence
477cgggcttacg gcggatgctg 2047820DNAArtificial SequenceSynthetic
Sequence 478tggaccttct atgtcggtcc 2047920DNAArtificial
SequenceSynthetic Sequence 479tgtcccatgt ttttagaagc
2048020DNAArtificial SequenceSynthetic Sequence 480gtggttacgg
tcgtgcccat 2048120DNAArtificial SequenceSynthetic Sequence
481cctccaaatg aaagaccccc 2048220DNAArtificial SequenceSynthetic
Sequence 482ttgtactctc catgatggtt 2048320DNAArtificial
SequenceSynthetic Sequence 483ttccatgctg ttccggctgg
2048420DNAArtificial SequenceSynthetic Sequence 484gaccttctat
gtcggtcctg 2048520DNAArtificial SequenceSynthetic Sequence
485gagaccgctc gaccttcgat 2048620DNAArtificial SequenceSynthetic
Sequence 486ttgccccata ttttagaaac 2048718DNAArtificial
SequenceSynthetic Sequence 487ttgaaactga ggtgggac
1848821DNAArtificial SequenceSynthetic Sequence 488ctatcggagg
actggcgcgc c 2148920DNAArtificial SequenceSynthetic Sequence
489cttggagggc ctcccggcgg 2049020DNAArtificial SequenceSynthetic
Sequence 490gctgaacctt ccatgctgtt 2049132DNAArtificial
SequenceSynthetic Sequence 491tagaaacagc attcttcttt tagggcagca ca
3249224DNAArtificial SequenceSynthetic Sequence 492agatggttct
cagataaagc ggaa 2449324DNAArtificial SequenceSynthetic Sequence
493ttccgcttta tctgagaacc atct 2449423DNAArtificial
SequenceSynthetic Sequence 494gtcccaggtt gtatagaggc tgc
2349520DNAArtificial SequenceSynthetic Sequence 495gcgccagtcc
tccgatagac 2049620DNAArtificial SequenceSynthetic Sequence
496atcggaggac tggcgcgccg 2049720DNAArtificial SequenceSynthetic
Sequence 497ggtctgtccc atatttttag 2049820DNAArtificial
SequenceSynthetic Sequence 498tttttcaacg ttgagggggg
2049921DNAArtificial SequenceSynthetic Sequence 499tttttcaagc
gttgattttt t 2150020DNAArtificial SequenceSynthetic Sequence
500ggggtcaacg ttgatttttt 2050125DNAArtificial SequenceSynthetic
Sequence 501ggggttttca acgttttgag ggggg 2550220DNAArtificial
SequenceSynthetic Sequence 502ggttacggtc tgtcccatat
2050320DNAArtificial SequenceSynthetic Sequence 503ctgtcccata
tttttagaca 2050420DNAArtificial SequenceSynthetic Sequence
504accatcctga ggccattcgg 2050523DNAArtificial SequenceSynthetic
Sequence 505cgtctatcgg gcttctgtgt ctg 2350621DNAArtificial
SequenceSynthetic Sequence 506ggccatccca cattgaaagt t
2150722DNAArtificial SequenceSynthetic Sequence 507ccaaatatcg
gtggtcaagc ac 2250822DNAArtificial SequenceSynthetic Sequence
508gtgcttgacc accgatattt gg 2250926DNAArtificial SequenceSynthetic
Sequence 509gtgctgatca ccgatatcct gttcgg 2651027DNAArtificial
SequenceSynthetic Sequence 510ggccaacttt caatgtggga tggcctc
2751127DNAArtificial SequenceSynthetic Sequence 511ttccgccgaa
tggcctcagg atggtac 2751236DNAArtificial SequenceSynthetic Sequence
512tatagtccct gagactgccc caccttctca acaacc 3651327DNAArtificial
SequenceSynthetic Sequence 513gcagcctcta tacaacctgg gacggga
2751422DNAArtificial SequenceSynthetic Sequence 514ctatcggagg
actggcgcgc cg 2251521DNAArtificial SequenceSynthetic Sequence
515tatcggagga ctggcgcgcc g 2151621DNAArtificial SequenceSynthetic
Sequence 516gatcggagga ctggcgcgcc g 2151726DNAArtificial
SequenceSynthetic Sequence 517ccgaacagga tatcggtgat cagcac
2651824DNAArtificial SequenceSynthetic Sequence 518ttttggggtc
aacgttgagg gggg 2451920DNAArtificial SequenceSynthetic Sequence
519ggggtcaacg ttgagggggg 2052020DNAArtificial SequenceSynthetic
Sequence 520cgcgcgcgcg cgcgcgcgcg 2052120DNAArtificial
SequenceSynthetic Sequence 521ggggcatgac gttcgggggg
2052220DNAArtificial SequenceSynthetic Sequence 522ggggcatgac
gttcaaaaaa 2052320DNAArtificial SequenceSynthetic Sequence
523ggggcatgag cttcgggggg 2052420DNAArtificial SequenceSynthetic
Sequence 524ggggcatgac gttcgggggg 2052520DNAArtificial
SequenceSynthetic Sequence 525aaaacatgac gttcaaaaaa
2052620DNAArtificial SequenceSynthetic Sequence 526aaaacatgac
gttcgggggg 2052720DNAArtificial SequenceSynthetic Sequence
527ggggcatgac gttcaaaaaa 2052824DNAArtificial SequenceSynthetic
Sequence 528accatggacg atctgtttcc cctc 2452924DNAArtificial
SequenceSynthetic Sequence 529gccatggacg aactgttccc cctc
2453020DNAArtificial SequenceSynthetic Sequence 530cccccccccc
cccccccccc 2053120DNAArtificial SequenceSynthetic Sequence
531gggggggggg gggggggggg 2053220DNAArtificial SequenceSynthetic
Sequence 532gctgtaaaat gaatcggccg 2053320DNAArtificial
SequenceSynthetic Sequence 533ttcgggcgga ctcctccatt
2053420DNAArtificial SequenceSynthetic Sequence 534tatgccgcgc
ccggacttat 2053520DNAArtificial SequenceSynthetic Sequence
535ggggtaatcg atcagggggg 2053620DNAArtificial SequenceSynthetic
Sequence 536tttgagaacg ctggaccttc 2053720DNAArtificial
SequenceSynthetic Sequence 537gatcgctgat ctaatgctcg
2053820DNAArtificial SequenceSynthetic Sequence 538gtcggtcctg
atgctgttcc 2053920DNAArtificial SequenceSynthetic Sequence
539tcgtcgtcag ttcgctgtcg 2054018DNAArtificial SequenceSynthetic
Sequence 540ctggaccttc catgtcgg 1854117DNAArtificial
SequenceSynthetic Sequence 541gctcgttcag cgcgtct
1754216DNAArtificial SequenceSynthetic Sequence 542ctggaccttc
catgtc 1654316DNAArtificial SequenceSynthetic Sequence
543cactgtcctt cgtcga 1654420DNAArtificial SequenceSynthetic
Sequence 544cgctggacct tccatgtcgg 2054520DNAArtificial
SequenceSynthetic Sequence 545gctgagctca tgccgtctgc
2054620DNAArtificial SequenceSynthetic Sequence 546aacgctggac
cttccatgtc 2054720DNAArtificial SequenceSynthetic Sequence
547tgcatgccgt acacagctct 2054820DNAArtificial SequenceSynthetic
Sequence 548ccttccatgt cggtcctgat 2054920DNAArtificial
SequenceSynthetic Sequence 549tactcttcgg atcccttgcg
2055018DNAArtificial SequenceSynthetic Sequence 550ttccatgtcg
gtcctgat 1855118DNAArtificial SequenceSynthetic Sequence
551ctgattgctc tctcgtga 1855220DNAArtificial SequenceSynthetic
Sequence 552ggcgttattc ctgactcgcc 2055322DNAArtificial
SequenceSynthetic Sequence 553cctacgttgt atgcgcccag ct
2255420DNAArtificial SequenceSynthetic Sequence 554ggggtaatcg
atgagggggg 2055520DNAArtificial SequenceSynthetic Sequence
555ttcgggcgga ctcctccatt 2055620DNAArtificial SequenceSynthetic
Sequence 556tttttttttt tttttttttt 2055720DNAArtificial
SequenceSynthetic Sequence 557gggggttttt tttttggggg
2055820DNAArtificial SequenceSynthetic Sequence 558tttttggggg
gggggttttt 2055919DNAArtificial SequenceSynthetic Sequence
559gggggggggg ggggggggt 1956020DNAArtificial SequenceSynthetic
Sequence 560aaaaaaaaaa aaaaaaaaaa 2056120DNAArtificial
SequenceSynthetic Sequence 561cccccaaaaa aaaaaccccc
2056220DNAArtificial SequenceSynthetic Sequence 562aaaaaccccc
cccccaaaaa 2056327DNAArtificial SequenceSynthetic Sequence
563tttgaattca ggactggtga ggttgag 2756427DNAArtificial
SequenceSynthetic Sequence 564tttgaatcct cagcggtctc cagtggc
2756545DNAArtificial SequenceSynthetic Sequence 565aattctctat
cggggcttct gtgtctgttg ctggttccgc tttat 4556645DNAArtificial
SequenceSynthetic Sequence 566ctagataaag cggaaccagc aacagacaca
gaagccccga tagag 4556728DNAArtificial SequenceSynthetic Sequence
567ttttctagag aggtgcacaa tgctctgg 2856829DNAArtificial
SequenceSynthetic Sequence 568tttgaattcc gtgtacagaa gcgagaagc
2956931DNAArtificial SequenceSynthetic Sequence 569tttgcggccg
ctagacttaa cctgagagat a 3157029DNAArtificial SequenceSynthetic
Sequence 570tttgggccca cgagagacag agacacttc 2957129DNAArtificial
SequenceSynthetic Sequence 571tttgggcccg cttctcgctt ctgtacacg
2957220DNAArtificial SequenceSynthetic Sequence 572gagaacgctg
gaccttccat 2057320DNAArtificial SequenceSynthetic Sequence
573tccatgtcgg tcctgatgct 205746DNAArtificial SequenceSynthetic
Sequence 574ctgtcg 65756DNAArtificial SequenceSynthetic Sequence
575tcgtga 65766DNAArtificial SequenceSynthetic Sequence 576cgtcga
65776DNAArtificial SequenceSynthetic Sequence 577agtgct
65786DNAArtificial SequenceSynthetic Sequence 578ctgtcg
65796DNAArtificial SequenceSynthetic Sequence 579agtgct
65806DNAArtificial SequenceSynthetic Sequence 580cgtcga
65816DNAArtificial SequenceSynthetic Sequence 581tcgtga
658220DNAArtificial SequenceSynthetic Sequence 582gagaacgctc
cagcttcgat 2058317DNAArtificial SequenceSynthetic Sequence
583gctagacgta agcgtga 1758420DNAArtificial SequenceSynthetic
Sequence 584gagaacgctc gaccttccat 2058521DNAArtificial
SequenceSynthetic Sequence 585gagaacgctg gacctatcca t
2158617DNAArtificial SequenceSynthetic Sequence 586gctagaggtt
agcgtga 1758719DNAArtificial SequenceSynthetic Sequence
587gagaacgctg gacttccat 1958817DNAArtificial SequenceSynthetic
Sequence 588tcacgctaac gtctagc 1758917DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
589gctagacgtt agcgtga 1759020DNAArtificial SequenceSynthetic
Sequence 590atggaaggtc gagcgttctc 2059120DNAArtificial
SequenceSynthetic Sequence 591gagaacgctg gaccttcgat
2059220DNAArtificial SequenceSynthetic Sequence 592gagaacgatg
gaccttccat 2059317DNAArtificial SequenceSynthetic Sequence
593gagaacgctg gatccat 1759420DNAArtificial SequenceSynthetic
Sequence 594gagaacgctc cagcactgat
2059520DNAArtificial SequenceSynthetic Sequence 595tccatgtcgg
tcctgctgat 2059620DNAArtificial SequenceSynthetic Sequence
596atgtcctcgg tcctgatgct 2059720DNAArtificial SequenceSynthetic
Sequence 597gagaacgctc caccttccat 2059820DNAArtificial
SequenceSynthetic Sequence 598gagaacgctg gaccttcgta
2059920DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to
biotin moiety. 599atggaaggtc cagcgttctc 206006DNAArtificial
SequenceSynthetic Sequence 600tcctga 66018DNAArtificial
SequenceSynthetic Sequence 601tcaacgtt 86026DNAArtificial
SequenceSynthetic Sequence 602aacgtt 66038DNAArtificial
SequenceSynthetic Sequence 603aacgttga 860417DNAArtificial
SequenceSynthetic Sequence 604tcacgctaac ctctagc
1760520DNAArtificial SequenceSynthetic Sequence 605gagaacgctg
gaccttgcat 2060614DNAArtificial SequenceSynthetic Sequence
606gctggacctt ccat 1460722DNAArtificial SequenceSynthetic Sequence
607gagaacgctg gacctcatcc at 2260823DNAArtificial SequenceSynthetic
Sequence 608gagaacgctg gacgctcatc cat 2360915DNAArtificial
SequenceSynthetic Sequence 609aacgttgagg ggcat 1561015DNAArtificial
SequenceSynthetic Sequence 610atgcccctca acgtt 1561110DNAArtificial
SequenceSynthetic Sequence 611tcaacgttga 1061214DNAArtificial
SequenceSynthetic Sequence 612gctggacctt ccat 146137DNAArtificial
SequenceSynthetic Sequence 613caacgtt 761410DNAArtificial
SequenceSynthetic Sequence 614acaacgttga 106156DNAArtificial
SequenceSynthetic Sequence 615tcacgt 66168DNAArtificial
SequenceSynthetic Sequence 616tcaagctt 86176DNAArtificial
SequenceSynthetic Sequence 617tcgtca 66188DNAArtificial
SequenceSynthetic Sequence 618aggatatc 86198DNAArtificial
SequenceSynthetic Sequence 619tagacgtc 86208DNAArtificial
SequenceSynthetic Sequence 620gacgtcat 86218DNAArtificial
SequenceSynthetic Sequence 621ccatcgat 86228DNAArtificial
SequenceSynthetic Sequence 622atcgatgt 86238DNAArtificial
SequenceSynthetic Sequence 623atgcatgt 86248DNAArtificial
SequenceSynthetic Sequence 624ccatgcat 86258DNAArtificial
SequenceSynthetic Sequence 625agcgctga 86268DNAArtificial
SequenceSynthetic Sequence 626tcagcgct 86278DNAArtificial
SequenceSynthetic Sequence 627ccttcgat 862818DNAArtificial
SequenceSynthetic Sequence 628gtgccggggt ctccgggc
1862918DNAArtificial SequenceSynthetic Sequence 629gctgtggggc
ggctcctg 186308DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
630tcaacgtt 86318DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to FITC moiety. 631tcaacgtt
86328DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to FITC
moiety. 632aacgttga 86337DNAArtificial SequenceSynthetic Sequence
633tcaacgt 76347DNAArtificial SequenceSynthetic Sequence 634aacgttg
76356DNAArtificial SequenceSynthetic Sequence 635cgacga
66368DNAArtificial SequenceSynthetic Sequence 636tcaacgtt
86375DNAArtificial SequenceSynthetic Sequence 637tcgga
56388DNAArtificial SequenceSynthetic Sequence 638agaacgtt
86398DNAArtificial SequenceSynthetic Sequence 639tcatcgat
86408DNAArtificial SequenceSynthetic Sequence 640taaacgtt
86418DNAArtificial SequenceSynthetic Sequence 641ccaacgtt
86426DNAArtificial SequenceSynthetic Sequence 642gctcga
66436DNAArtificial SequenceSynthetic Sequence 643cgacgt
66446DNAArtificial SequenceSynthetic Sequence 644cgtcgt
66456DNAArtificial SequenceSynthetic Sequence 645acgtgt
66466DNAArtificial SequenceSynthetic Sequence 646cgttcg
664720DNAArtificial SequenceSynthetic Sequence 647gagcaagctg
gaccttccat 206486DNAArtificial SequenceSynthetic Sequence 648cgcgta
66496DNAArtificial SequenceSynthetic Sequence 649cgtacg
66508DNAArtificial SequenceSynthetic Sequence 650tcaccggt
865120DNAArtificial SequenceSynthetic Sequence 651caagagatgc
taacaatgca 2065220DNAArtificial SequenceSynthetic Sequence
652acccatcaat agctctgtgc 206538DNAArtificial SequenceSynthetic
Sequence 653ccatcgat 86548DNAArtificial SequenceSynthetic Sequence
654tcgacgtc 86558DNAArtificial SequenceSynthetic Sequence
655ctagcgct 86568DNAArtificial SequenceSynthetic Sequence
656taagcgct 865713DNAArtificial SequenceSynthetic Sequence
657tcgcgaattc gcg 1365819DNAArtificial SequenceSynthetic Sequence
658atggaaggtc cagcgttct 1965917DNAArtificial SequenceSynthetic
Sequence 659actggacgtt agcgtga 1766018DNAArtificial
SequenceSynthetic Sequence 660cgcctggggc tggtctgg
1866118DNAArtificial SequenceSynthetic Sequence 661gtgtcggggt
ctccgggc 1866218DNAArtificial SequenceSynthetic Sequence
662gtgccggggt ctccgggc 1866318DNAArtificial SequenceSynthetic
Sequence 663cgccgtcgcg gcggttgg 1866421DNAArtificial
SequenceSynthetic Sequence 664gaagttcacg ttgaggggca t
2166521DNAArtificial SequenceSynthetic Sequence 665atctggtgag
ggcaagctat g 2166621DNAArtificial SequenceSynthetic Sequence
666gttgaaaccc gagaacatca t 216678DNAArtificial SequenceSynthetic
Sequence 667gcaacgtt 86688DNAArtificial SequenceSynthetic Sequence
668gtaacgtt 86698DNAArtificial SequenceSynthetic Sequence
669cgaacgtt 86708DNAArtificial SequenceSynthetic Sequence
670gaaacgtt 86718DNAArtificial SequenceSynthetic Sequence
671caaacgtt 86728DNAArtificial SequenceSynthetic Sequence
672ctaacgtt 86738DNAArtificial SequenceSynthetic Sequence
673ggaacgtt 86748DNAArtificial SequenceSynthetic Sequence
674tgaacgtt 86758DNAArtificial SequenceSynthetic Sequence
675acaacgtt 86768DNAArtificial SequenceSynthetic Sequence
676ttaacgtt 86778DNAArtificial SequenceSynthetic Sequence
677aaaacgtt 86788DNAArtificial SequenceSynthetic Sequence
678ataacgtt 86798DNAArtificial SequenceSynthetic Sequence
679aacgttct 86808DNAArtificial SequenceSynthetic Sequence
680tccgatcg 86818DNAArtificial SequenceSynthetic Sequence
681tccgtacg 868217DNAArtificial SequenceSynthetic Sequence
682gctagacgct agcgtga 1768325DNAArtificial SequenceSynthetic
Sequence 683gagaacgctg gacctcatca tccat 2568420DNAArtificial
SequenceSynthetic Sequence 684gagaacgcta gaccttctat
2068517DNAArtificial SequenceSynthetic Sequence 685actagacgtt
agtgtga 1768622DNAArtificial SequenceSynthetic Sequence
686cacaccttgg tcaatgtcac gt 2268722DNAArtificial SequenceSynthetic
Sequence 687tctccatcct atggttttat cg 2268815DNAArtificial
SequenceSynthetic Sequence 688cgctggacct tccat 1568923DNAArtificial
SequenceSynthetic Sequence 689caccaccttg gtcaatgtca cgt
2369017DNAArtificial SequenceSynthetic Sequence 690gctagacgtt
agctgga 1769117DNAArtificial SequenceSynthetic Sequence
691agtgcgattg cagatcg 1769224DNAArtificial SequenceSynthetic
Sequence 692ttttcgtttt gtggttttgt ggtt 2469323DNAArtificial
SequenceSynthetic Sequence 693ttttcgtttg tcgttttgtc gtt
2369424DNAArtificial SequenceSynthetic Sequence 694tttttgtttt
gtggttttgt ggtt 2469520DNAArtificial SequenceSynthetic Sequence
695accgcatgga ttctaggcca 2069615DNAArtificial SequenceSynthetic
Sequence 696gctagacgtt agcgt 1569717DNAArtificial SequenceSynthetic
Sequence 697aacgctggac cttccat 176988DNAArtificial
Sequencemodified_base(5)...(5)m5c 698tcaangtt 86998DNAArtificial
SequenceSynthetic Sequence 699ccttcgat 870017DNAArtificial
SequenceSynthetic Sequence 700actagacgtt agtgtga
1770117DNAArtificial SequenceSynthetic Sequence 701gctagaggtt
agcgtga 1770220DNAArtificial SequenceSynthetic Sequence
702atggactctc cagcgttctc 2070320DNAArtificial SequenceSynthetic
Sequence 703atcgactctc gagcgttctc 2070413DNAArtificial
SequenceSynthetic Sequence 704gctagacgtt agc 137059DNAArtificial
SequenceSynthetic Sequence 705gctagacgt 970617DNAArtificial
SequenceSynthetic Sequence 706agtgcgattc gagatcg
177078DNAArtificial Sequencemodified_base(5)...(5)m5c 707tcagngct
870818DNAArtificial SequenceSynthetic Sequence 708ctgattgctc
tctcgtga 187098DNAArtificial Sequencemodified_base(2)...(2)m5c
709tnaacgtt 871020DNAArtificial Sequencemodified_base(6)...(6)m5c
710gagaangctg gaccttccat 2071117DNAArtificial SequenceSynthetic
Sequence 711gctagacgtt aggctga 1771214DNAArtificial
SequenceSynthetic Sequence 712gctacttagc gtga 1471315DNAArtificial
SequenceSynthetic Sequence 713gctaccttag cgtga 1571419DNAArtificial
SequenceSynthetic Sequence 714atcgacttcg agcgttctc
1971520DNAArtificial SequenceSynthetic Sequence 715atgcactctg
cagcgttctc 2071620DNAArtificial SequenceSynthetic Sequence
716agtgactctc cagcgttctc 2071717DNAArtificial SequenceSynthetic
Sequence 717gccagatgtt agctgga 1771818DNAArtificial
SequenceSynthetic Sequence 718atcgactcga gcgttctc
1871917DNAArtificial SequenceSynthetic Sequence 719atcgatcgag
cgttctc 1772020DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
720gagaacgctc gaccttcgat 2072117DNAArtificial SequenceSynthetic
Sequence 721gctagacgtt agctgga 1772220DNAArtificial
SequenceSynthetic Sequence 722atcgactctc gagcgttctc
2072315DNAArtificial SequenceSynthetic Sequence 723tagacgttag cgtga
1572418DNAArtificial SequenceSynthetic Sequence 724cgactctcga
gcgttctc 1872521DNAArtificial SequenceSynthetic Sequence
725ggggtcgacc ttggaggggg g 2172616DNAArtificial SequenceSynthetic
Sequence 726gctaacgtta gcgtga 167279DNAArtificial SequenceSynthetic
Sequence 727cgtcgtcgt 972820DNAArtificial
Sequencemodified_base(14)...(14)m5c 728gagaacgctg gacnttccat
2072920DNAArtificial Sequencemodified_base(18)...(18)m5c
729atcgacctac gtgcgttntc 2073020DNAArtificial
Sequencemodified_base(3)...(3)m5c 730atngacctac gtgcgttctc
2073115DNAArtificial Sequencemodified_base(7)...(7)m5c
731gctagangtt agcgt 1573220DNAArtificial
Sequencemodified_base(14)...(14)m5c 732atcgactctc gagngttctc
2073320DNAArtificial SequenceSynthetic Sequence 733ggggtaatgc
atcagggggg 2073420DNAArtificial SequenceSynthetic Sequence
734ggctgtattc ctgactgccc 2073517DNAArtificial SequenceSynthetic
Sequence 735ccatgctaac ctctagc 1773617DNAArtificial
SequenceSynthetic Sequence 736gctagatgtt agcgtga
1773715DNAArtificial SequenceSynthetic Sequence 737cgtaccttac ggtga
1573820DNAArtificial SequenceSynthetic Sequence 738tccatgctgg
tcctgatgct 2073922DNAArtificial SequenceSynthetic Sequence
739atcgactctc tcgagcgttc tc 2274017DNAArtificial SequenceSynthetic
Sequence 740gctagagctt agcgtga 1774120DNAArtificial
SequenceSynthetic Sequence 741atcgactctc gagtgttctc
2074217DNAArtificial SequenceSynthetic Sequence 742aacgctcgac
cttcgat 1774320DNAArtificial SequenceSynthetic Sequence
743ctcaacgctg gaccttccat 2074420DNAArtificial SequenceSynthetic
Sequence 744atcgacctac gtgcgttctc 2074520DNAArtificial
SequenceSynthetic Sequence 745gagaatgctg gaccttccat
2074617DNAArtificial SequenceSynthetic Sequence 746tcacgctaac
ctctgac 1774720DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
747gagaacgctc cagcactgat 2074820DNAArtificial
Sequencemisc_feature(1)...(3)Biotin moiety attached at 5' end of
sequence. 748gagcaagctg gaccttccat 2074918DNAArtificial
SequenceSynthetic Sequence 749cgctagaggt tagcgtga
1875015DNAArtificial SequenceSynthetic Sequence 750gctagatgtt aacgt
1575119DNAArtificial SequenceSynthetic Sequence 751atggaaggtc
cacgttctc 1975215DNAArtificial SequenceSynthetic Sequence
752gctagatgtt agcgt 1575315DNAArtificial SequenceSynthetic Sequence
753gctagacgtt agtgt 1575420DNAArtificial SequenceSynthetic Sequence
754tccatgacgg tcctgatgct 2075520DNAArtificial SequenceSynthetic
Sequence 755tccatggcgg tcctgatgct 2075615DNAArtificial
SequenceSynthetic Sequence 756gctagacgat agcgt 1575715DNAArtificial
SequenceSynthetic Sequence 757gctagtcgat agcgt 1575820DNAArtificial
SequenceSynthetic Sequence 758tccatgacgt tcctgatgct
2075920DNAArtificial SequenceSynthetic Sequence 759tccatgtcgt
tcctgatgct 2076015DNAArtificial Sequencemodified_base(13)...(13)m5c
760gctagacgtt agngt 1576115DNAArtificial SequenceSynthetic Sequence
761gctaggcgtt agcgt 1576220DNAArtificial
Sequencemodified_base(8)...(8)m5c 762tccatgtngg tcctgatgct
2076320DNAArtificial Sequencemodified_base(12)...(12)m5c
763tccatgtcgg tnctgatgct 2076420DNAArtificial SequenceSynthetic
Sequence 764atngactctn gagngttctc 2076520DNAArtificial
SequenceSynthetic Sequence 765atggaaggtc cagtgttctc
2076615DNAArtificial SequenceSynthetic Sequence 766gcatgacgtt gagct
1576720DNAArtificial SequenceSynthetic Sequence 767ggggtcaacg
ttgagggggg 2076820DNAArtificial SequenceSynthetic Sequence
768ggggtcaagt ctgagggggg 2076920DNAArtificial SequenceSynthetic
Sequence 769cgcgcgcgcg cgcgcgcgcg 2077028DNAArtificial
SequenceSynthetic Sequence 770cccccccccc cccccccccc cccccccc
2877135DNAArtificial SequenceSynthetic Sequence 771cccccccccc
cccccccccc cccccccccc ccccc 3577220DNAArtificial SequenceSynthetic
Sequence 772tccatgtcgc tcctgatcct 2077315DNAArtificial
SequenceSynthetic Sequence 773gctaaacgtt agcgt 1577420DNAArtificial
SequenceSynthetic Sequence 774tccatgtcga tcctgatgct
2077520DNAArtificial SequenceSynthetic Sequence 775tccatgccgg
tcctgatgct 2077620DNAArtificial SequenceSynthetic Sequence
776aaaatcaacg ttgaaaaaaa 2077720DNAArtificial SequenceSynthetic
Sequence 777tccataacgt tcctgatgct 2077823DNAArtificial
SequenceSynthetic Sequence 778tggaggtccc accgagatcg gag
2377921DNAArtificial SequenceSynthetic Sequence 779cgtcgtcgtc
gtcgtcgtcg t 2178021DNAArtificial SequenceSynthetic Sequence
780ctgctgctgc tgctgctgct g 2178121DNAArtificial SequenceSynthetic
Sequence 781gagaacgctc cgaccttcga t 2178215DNAArtificial
SequenceSynthetic Sequence 782gctagatgtt agcgt 1578315DNAArtificial
SequenceSynthetic Sequence 783gcatgacgtt gagct 1578410DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to FITC moiety.
784tcaatgctga 1078510DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to FITC moiety.
785tcaacgttga 1078610DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to biotin moiety.
786tcaacgttga 1078710DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to biotin moiety.
787gcaatattgc 1078810DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to FITC moiety.
788gcaatattgc 1078910DNAArtificial SequenceSynthetic Sequence
789agttgcaact 107908DNAArtificial SequenceSynthetic Sequence
790tcttcgaa 87918DNAArtificial SequenceSynthetic Sequence
791tcaacgtc 879219DNAArtificial SequenceSynthetic Sequence
792ccatgtcggt cctgatgct 1979318DNAArtificial SequenceSynthetic
Sequence 793gtttttatat aatttggg 1879423DNAArtificial
SequenceSynthetic Sequence 794tttttgtttg tcgttttgtc gtt
2379512DNAArtificial SequenceSynthetic Sequence 795ttgggggggg tt
1279613DNAArtificial SequenceSynthetic Sequence 796ggggttgggg gtt
1379717DNAArtificial SequenceSynthetic Sequence 797ggtggtgtag
gttttgg 1779820DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
798gagaangctc gaccttcgat 2079920DNAArtificial SequenceSynthetic
Sequence 799tcaacgttaa cgttaacgtt 2080020DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
800gagcaagntg gaccttccat 2080120DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
801gagaangctc cagcactgat 2080210DNAArtificial
Sequencemodified_base(5)...(5)m5c 802tcaangttga
1080310DNAArtificial Sequencemodified_base(2)...(2)m5c
803gnaatattgc 1080424DNAArtificial SequenceSynthetic Sequence
804tgctgctttt gtcgttttgt gctt 2480522DNAArtificial
SequenceSynthetic Sequence 805ctgcgttagc aatttaactg tg
2280620DNAArtificial SequenceSynthetic Sequence 806tccatgacgt
tcctgatgct 2080728DNAArtificial SequenceSynthetic Sequence
807tgcatgccgt gcatccgtac acagctct 2880820DNAArtificial
SequenceSynthetic Sequence 808tgcatgccgt acacagctct
2080912DNAArtificial SequenceSynthetic Sequence 809tgcatcagct ct
128108DNAArtificial SequenceSynthetic Sequence 810tgcgctct
881120DNAArtificial SequenceSynthetic Sequence 811cccccccccc
cccccccccc 2081212DNAArtificial SequenceSynthetic Sequence
812cccccccccc cc 128138DNAArtificial SequenceSynthetic Sequence
813cccccccc 881412DNAArtificial SequenceSynthetic Sequence
814tgcatcagct ct 1281520DNAArtificial SequenceSynthetic Sequence
815tgcatgccgt acacagctct 2081620DNAArtificial SequenceSynthetic
Sequence 816gagcaagctg gaccttccat 2081732DNAArtificial
SequenceSynthetic Sequence 817tcaacgttaa cgttaacgtt aacgttaacg tt
3281820DNAArtificial SequenceSynthetic Sequence 818gagaacgctc
gaccttcgat 2081925DNAArtificial SequenceSynthetic Sequence
819gtccccattt cccagaggag gaaat 2582025DNAArtificial
SequenceSynthetic Sequence 820ctagcggctg acgtcatcaa gctag
2582125DNAArtificial SequenceSynthetic Sequence 821ctagcttgat
gacgtcagcc gctag 2582216DNAArtificial SequenceSynthetic Sequence
822cggctgacgt catcaa 168238DNAArtificial SequenceSynthetic Sequence
823ctgacgtg 882410DNAArtificial SequenceSynthetic Sequence
824ctgacgtcat 1082521DNAArtificial SequenceSynthetic Sequence
825attcgatcgg ggcggggcga g 2182621DNAArtificial SequenceSynthetic
Sequence 826ctcgccccgc cccgatcgaa t 2182715DNAArtificial
SequenceSynthetic Sequence 827gactgacgtc agcgt 1582826DNAArtificial
SequenceSynthetic Sequence 828ctagcggctg acgtcataaa gctagc
2682926DNAArtificial SequenceSynthetic Sequence 829ctagctttat
gacgtcagcc gctagc 2683026DNAArtificial SequenceSynthetic Sequence
830ctagcggctg agctcataaa gctagc 2683125DNAArtificial
SequenceSynthetic Sequence 831ctagtggctg acgtcatcaa gctag
2583220DNAArtificial SequenceSynthetic Sequence 832tccaccacgt
ggtctatgct 2083324DNAArtificial SequenceSynthetic Sequence
833gggaatgaaa gattttatta taag 2483426DNAArtificial
SequenceSynthetic Sequence 834tctaaaaacc atctattctt aaccct
2683515DNAArtificial SequenceSynthetic Sequence 835agctcaacgt catgc
1583624DNAArtificial SequenceSynthetic Sequence 836ttaacggtgg
tagcggtatt ggtc 2483724DNAArtificial SequenceSynthetic Sequence
837ttaagaccaa taccgctacc accg 2483825DNAArtificial
SequenceSynthetic Sequence 838gatctagtga tgagtcagcc ggatc
2583925DNAArtificial SequenceSynthetic Sequence 839gatccggctg
actcatcact agatc 2584020DNAArtificial SequenceSynthetic Sequence
840tccaagacgt tcctgatgct 2084120DNAArtificial SequenceSynthetic
Sequence 841tccatgacgt ccctgatgct 2084220DNAArtificial
SequenceSynthetic Sequence 842tccaccacgt ggctgatgct
2084317DNAArtificial SequenceSynthetic Sequence 843ccacgtggac
ctctagc 1784427DNAArtificial SequenceSynthetic Sequence
844tcagaccacg tggtcgggtg ttcctga 2784527DNAArtificial
SequenceSynthetic Sequence 845tcaggaacac ccgaccacgt ggtctga
2784618DNAArtificial SequenceSynthetic Sequence 846catttccacg
atttccca 1884719DNAArtificial SequenceSynthetic Sequence
847ttcctctctg caagagact 1984819DNAArtificial SequenceSynthetic
Sequence 848tgtatctctc tgaaggact 1984925DNAArtificial
SequenceSynthetic Sequence 849ataaagcgaa actagcagca gtttc
2585025DNAArtificial SequenceSynthetic Sequence 850gaaactgctg
ctagtttcgc tttat 2585130DNAArtificial SequenceSynthetic Sequence
851tgcccaaaga ggaaaatttg tttcatacag 3085230DNAArtificial
SequenceSynthetic Sequence 852ctgtatgaaa caaattttcc tctttgggca
3085320DNAArtificial SequenceSynthetic Sequence 853ttagggttag
ggttagggtt 2085420DNAArtificial SequenceSynthetic Sequence
854tccatgagct tcctgatgct 2085520DNAArtificial SequenceSynthetic
Sequence 855aaaacatgac gttcaaaaaa 2085620DNAArtificial
SequenceSynthetic Sequence 856aaaacatgac gttcgggggg
2085720DNAArtificial SequenceSynthetic Sequence 857ggggcatgag
cttcgggggg 2085824DNAArtificial SequenceSynthetic Sequence
858ctaggctgac gtcatcaagc tagt 2485930DNAArtificial
SequenceSynthetic Sequence 859tctgacgtca tctgacgttg gctgacgtct
3086025DNAArtificial SequenceSynthetic Sequence 860ggaattagta
atagatatag aagtt 2586130DNAArtificial SequenceSynthetic Sequence
861tttacctttt ataaacataa ctaaaacaaa 3086215DNAArtificial
SequenceSynthetic Sequence 862gcgttttttt ttgcg 1586324DNAArtificial
SequenceSynthetic Sequence 863atatctaatc aaaacattaa caaa
2486424DNAArtificial SequenceSynthetic Sequence 864tctatcccag
gtggttcctg ttag 2486520DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
865tccatgacgt tcctgatgct 2086620DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety.
866tccatgagct tcctgatgct 2086713DNAArtificial
Sequencemisc_feature(11)...(13)Conjugated to FITC moiety.
867tttttttttt ttt 1386813DNAArtificial
Sequencemisc_feature(11)...(13)Conjugated to biotin moiety.
868tttttttttt ttt 1386925DNAArtificial SequenceSynthetic Sequence
869ctagcttgat gagctcagcc gctag 2587025DNAArtificial
SequenceSynthetic Sequence 870ttcagttgtc ttgctgctta gctaa
2587120DNAArtificial SequenceSynthetic Sequence 871tccatgagct
tcctgagtct 2087225DNAArtificial SequenceSynthetic Sequence
872ctagcggctg acgtcatcaa tctag 2587320DNAArtificial
SequenceSynthetic Sequence 873tgctagctgt gcctgtacct
2087423DNAArtificial SequenceSynthetic Sequence 874atgctaaagg
acgtcacatt gca 2387523DNAArtificial SequenceSynthetic Sequence
875tgcaatgtga cgtcctttag cat 2387631DNAArtificial SequenceSynthetic
Sequence 876gtaggggact ttccgagctc gagatcctat g 3187731DNAArtificial
SequenceSynthetic Sequence 877cataggatct cgagctcgga aagtccccta c
3187822DNAArtificial SequenceSynthetic Sequence 878ctgtcaggaa
ctgcaggtaa gg 2287927DNAArtificial SequenceSynthetic Sequence
879cataacatag gaatatttac tcctcgc 2788021DNAArtificial
SequenceSynthetic Sequence 880ctccagctcc aagaaaggac g
2188121DNAArtificial SequenceSynthetic Sequence 881gaagtttctg
gtaagtcttc g 2188224DNAArtificial SequenceSynthetic Sequence
882tgctgctttt gtgcttttgt gctt 2488324DNAArtificial
SequenceSynthetic Sequence 883tcgtcgtttt gtggttttgt ggtt
2488423DNAArtificial SequenceSynthetic Sequence 884tcgtcgtttg
tcgttttgtc gtt 2388522DNAArtificial SequenceSynthetic Sequence
885tcctgacgtt cggcgcgcgc cc 2288624DNAArtificial SequenceSynthetic
Sequence
886tgctgctttt gtgcttttgt gctt 2488720DNAArtificial
SequenceSynthetic Sequence 887tccatgagct tcctgagctt
2088824DNAArtificial SequenceSynthetic Sequence 888tcgtcgtttc
gtcgttttga cgtt 2488926DNAArtificial SequenceSynthetic Sequence
889tcgtcgtttg cgtgcgtttc gtcgtt 2689027DNAArtificial
SequenceSynthetic Sequence 890tcgcgtgcgt tttgtcgttt tgacgtt
2789125DNAArtificial SequenceSynthetic Sequence 891ttcgtcgttt
tgtcgttttg tcgtt 2589215DNAArtificial SequenceSynthetic Sequence
892tcctgacggg gaagt 1589315DNAArtificial SequenceSynthetic Sequence
893tcctggcgtg gaagt 1589415DNAArtificial SequenceSynthetic Sequence
894tcctggcggt gaagt 1589515DNAArtificial SequenceSynthetic Sequence
895tcctggcgtt gaagt 1589615DNAArtificial SequenceSynthetic Sequence
896tcctgacgtg gaagt 1589720DNAArtificial SequenceSynthetic Sequence
897gcgacgttcg gcgcgcgccc 2089820DNAArtificial SequenceSynthetic
Sequence 898gcgacgggcg gcgcgcgccc 2089920DNAArtificial
SequenceSynthetic Sequence 899gcggcgtgcg gcgcgcgccc
2090020DNAArtificial SequenceSynthetic Sequence 900gcggcggtcg
gcgcgcgccc 2090120DNAArtificial SequenceSynthetic Sequence
901gcgacggtcg gcgcgcgccc 2090220DNAArtificial SequenceSynthetic
Sequence 902gcggcgttcg gcgcgcgccc 2090320DNAArtificial
SequenceSynthetic Sequence 903gcgacgtgcg gcgcgcgccc
2090415DNAArtificial SequenceSynthetic Sequence 904tcgtcgctgt ctccg
1590520DNAArtificial SequenceSynthetic Sequence 905tgtgggggtt
ttggttttgg 2090620DNAArtificial SequenceSynthetic Sequence
906aggggagggg aggggagggg 2090721DNAArtificial SequenceSynthetic
Sequence 907tgtgtgtgtg tgtgtgtgtg t 2190822DNAArtificial
SequenceSynthetic Sequence 908ctctctctct ctctctctct ct
2290920DNAArtificial SequenceSynthetic Sequence 909ggggtcgacg
tcgagggggg 2091022DNAArtificial SequenceSynthetic Sequence
910atatatatat atatatatat at 2291127DNAArtificial SequenceSynthetic
Sequence 911tttttttttt tttttttttt ttttttt 2791221DNAArtificial
SequenceSynthetic Sequence 912tttttttttt tttttttttt t
2191318DNAArtificial SequenceSynthetic Sequence 913tttttttttt
tttttttt 1891415DNAArtificial SequenceSynthetic Sequence
914gctagagggg agggt 1591515DNAArtificial SequenceSynthetic Sequence
915gctagatgtt agggg 1591615DNAArtificial SequenceSynthetic Sequence
916gcatgagggg gagct 1591720DNAArtificial SequenceSynthetic Sequence
917atggaaggtc cagggggctc 2091820DNAArtificial SequenceSynthetic
Sequence 918atggactctg gagggggctc 2091920DNAArtificial
SequenceSynthetic Sequence 919atggaaggtc caaggggctc
2092020DNAArtificial SequenceSynthetic Sequence 920gagaaggggg
gaccttggat 2092120DNAArtificial SequenceSynthetic Sequence
921gagaaggggg gaccttccat 2092220DNAArtificial SequenceSynthetic
Sequence 922gagaaggggc cagcactgat 2092320DNAArtificial
SequenceSynthetic Sequence 923tccatgtggg gcctgatgct
2092420DNAArtificial SequenceSynthetic Sequence 924tccatgaggg
gcctgatgct 2092520DNAArtificial SequenceSynthetic Sequence
925tccatgtggg gcctgctgat 2092620DNAArtificial SequenceSynthetic
Sequence 926atggactctc cggggttctc 2092720DNAArtificial
SequenceSynthetic Sequence 927atggaaggtc cggggttctc
2092820DNAArtificial SequenceSynthetic Sequence 928atggactctg
gaggggtctc 2092920DNAArtificial SequenceSynthetic Sequence
929atggaggctc catggggctc 2093020DNAArtificial SequenceSynthetic
Sequence 930atggactctg gggggttctc 2093120DNAArtificial
SequenceSynthetic Sequence 931tccatgtggg tggggatgct
2093220DNAArtificial SequenceSynthetic Sequence 932tccatgcggg
tggggatgct 2093320DNAArtificial SequenceSynthetic Sequence
933tccatggggg tcctgatgct 2093420DNAArtificial SequenceSynthetic
Sequence 934tccatggggt ccctgatgct 2093520DNAArtificial
SequenceSynthetic Sequence 935tccatggggt gcctgatgct
2093620DNAArtificial SequenceSynthetic Sequence 936tccatggggt
tcctgatgct 2093720DNAArtificial SequenceSynthetic Sequence
937tccatcgggg gcctgatgct 2093814DNAArtificial SequenceSynthetic
Sequence 938gctagaggga gtgt 1493918DNAArtificial SequenceSynthetic
Sequence 939tttttttttt tttttttt 1894021DNAArtificial
Sequencemisc_difference(2)...(2)m is a or c 940gmggtcaacg
ttgagggmgg g 2194121DNAArtificial SequenceSynthetic Sequence
941ggggagttcg ttgagggggg g 2194220DNAArtificial SequenceSynthetic
Sequence 942tcgtcgtttc cccccccccc 2094325DNAArtificial
SequenceSynthetic Sequence 943ttggggggtt tttttttttt ttttt
2594423DNAArtificial SequenceSynthetic Sequence 944tttaaatttt
aaaatttaaa ata 2394524DNAArtificial SequenceSynthetic Sequence
945ttggtttttt tggttttttt ttgg 2494624DNAArtificial
SequenceSynthetic Sequence 946tttccctttt ccccttttcc cctc
2494721DNAArtificial Sequencemisc_difference(21)...(21)s is g or c
947ggggtcatcg atgagggggg s 2194820DNAArtificial SequenceSynthetic
Sequence 948tccatgacgt tcctgacgtt 2094920DNAArtificial
SequenceSynthetic Sequence 949tccatgacgt tcctgacgtt
2095020DNAArtificial SequenceSynthetic Sequence 950tccatgacgt
tcctgacgtt 2095120DNAArtificial SequenceSynthetic Sequence
951tccatgacgt tcctgacgtt 2095220DNAArtificial SequenceSynthetic
Sequence 952tccatgacgt tcctgacgtt 2095320DNAArtificial
SequenceSynthetic Sequence 953tccatgacgt tcctgacgtt
2095420DNAArtificial SequenceSynthetic Sequence 954tccatgacgt
tcctgacgtt 2095520DNAArtificial SequenceSynthetic Sequence
955tccatgacgt tcctgacgtt 2095620DNAArtificial SequenceSynthetic
Sequence 956tccatgacgt tcctgacgtt 2095720DNAArtificial
SequenceSynthetic Sequence 957tccatgacgt tcctgacgtt
2095820DNAArtificial SequenceSynthetic Sequence 958tccatgacgt
tcctgacgtt 2095919DNAArtificial SequenceSynthetic Sequence
959gggggacgat cgtcggggg 1996020DNAArtificial SequenceSynthetic
Sequence 960gggggtcgta cgacgggggg 2096124DNAArtificial
SequenceSynthetic Sequence 961tttttttttt tttttttttt tttt
2496224DNAArtificial SequenceSynthetic Sequence 962aaaaaaaaaa
aaaaaaaaaa aaaa 2496324DNAArtificial SequenceSynthetic Sequence
963cccccccccc cccccccccc cccc 2496424DNAArtificial
SequenceSynthetic Sequence 964tcgtcgtttt gtcgttttgt cgtt
2496524DNAArtificial SequenceSynthetic Sequence 965tcgtcgtttt
gtcgttttgt cgtt 2496624DNAArtificial SequenceSynthetic Sequence
966tcgtcgtttt gtcgttttgt cgtt 2496724DNAArtificial
SequenceSynthetic Sequence 967tcgtcgtttt gtcgttttgt cgtt
2496820DNAArtificial SequenceSynthetic Sequence 968ggggtcaacg
ttgagggggg 2096920DNAArtificial SequenceSynthetic Sequence
969ggggtcaacg ttgagggggg 2097020DNAArtificial SequenceSynthetic
Sequence 970ggggtcaagc ttgagggggg 2097120DNAArtificial
SequenceSynthetic Sequence 971tgctgcttcc cccccccccc
2097220DNAArtificial SequenceSynthetic Sequence 972ggggacgtcg
acgtgggggg 2097320DNAArtificial SequenceSynthetic Sequence
973ggggtcgtcg acgagggggg 2097424DNAArtificial SequenceSynthetic
Sequence 974ggggtcgacg tacgtcgagg gggg 2497522DNAArtificial
SequenceSynthetic Sequence 975ggggaccggt accggtgggg gg
2297619DNAArtificial SequenceSynthetic Sequence 976gggtcgacgt
cgagggggg 1997719DNAArtificial SequenceSynthetic Sequence
977ggggtcgacg tcgaggggg 1997822DNAArtificial SequenceSynthetic
Sequence 978ggggaacgtt aacgttgggg gg 2297920DNAArtificial
SequenceSynthetic Sequence 979ggggtcaccg gtgagggggg
2098022DNAArtificial SequenceSynthetic Sequence 980ggggtcgttc
gaacgagggg gg 2298122DNAArtificial SequenceSynthetic Sequence
981ggggacgttc gaacgtgggg gg 2298210DNAArtificial SequenceSynthetic
Sequence 982tcaactttga 1098310DNAArtificial SequenceSynthetic
Sequence 983tcaagcttga 1098412DNAArtificial SequenceSynthetic
Sequence 984tcacgatcgt ga 1298512DNAArtificial SequenceSynthetic
Sequence 985tcagcatgct ga 1298620DNAArtificial SequenceSynthetic
Sequence 986gggggagcat gctggggggg 2098720DNAArtificial
SequenceSynthetic Sequence 987gggggggggg gggggggggg
2098822DNAArtificial SequenceSynthetic Sequence 988gggggacgat
atcgtcgggg gg 2298922DNAArtificial SequenceSynthetic Sequence
989gggggacgac gtcgtcgggg gg 2299022DNAArtificial SequenceSynthetic
Sequence 990gggggacgag ctcgtcgggg gg 2299120DNAArtificial
SequenceSynthetic Sequence 991gggggacgta cgtcgggggg
209928DNAArtificial SequenceSynthetic Sequence 992tcaacgtt
899320DNAArtificial SequenceSynthetic Sequence 993tccataccgg
tcctgatgct 2099420DNAArtificial SequenceSynthetic Sequence
994tccataccgg tcctaccggt 2099520DNAArtificial SequenceSynthetic
Sequence 995gggggacgat cgttgggggg 2099620DNAArtificial
SequenceSynthetic Sequence 996ggggaacgat cgtcgggggg
2099721DNAArtificial SequenceSynthetic Sequence 997ggggggacga
tcgtcggggg g 2199821DNAArtificial SequenceSynthetic Sequence
998gggggacgat cgtcgggggg g 2199912DNAArtificial SequenceSynthetic
Sequence 999aaagacgtta aa 12100012DNAArtificial SequenceSynthetic
Sequence 1000aaagagctta aa 12100112DNAArtificial
Sequencemodified_base(6)...(6)m5c 1001aaagangtta aa
12100212DNAArtificial SequenceSynthetic Sequence 1002aaattcggaa aa
12100321DNAArtificial SequenceSynthetic Sequence 1003gggggtcatc
gatgaggggg g 21100421DNAArtificial SequenceSynthetic Sequence
1004gggggtcaac gttgaggggg g 21100520DNAArtificial SequenceSynthetic
Sequence 1005atgtagctta ataacaaagc 20100620DNAArtificial
SequenceSynthetic Sequence 1006ggatcccttg agttacttct
20100720DNAArtificial SequenceSynthetic Sequence 1007ccattccact
tctgattacc 20100820DNAArtificial SequenceSynthetic Sequence
1008tatgtattat catgtagata 20100920DNAArtificial SequenceSynthetic
Sequence 1009agcctacgta ttcaccctcc 20101020DNAArtificial
SequenceSynthetic Sequence 1010ttcctgcaac tactattgta
20101120DNAArtificial SequenceSynthetic Sequence 1011atagaaggcc
ctacaccagt 20101220DNAArtificial SequenceSynthetic Sequence
1012ttacaccggt ctatggaggt 20101320DNAArtificial SequenceSynthetic
Sequence 1013ctaaccagat caagtctagg 20101420DNAArtificial
SequenceSynthetic Sequence 1014cctagacttg atctggttag
20101520DNAArtificial SequenceSynthetic Sequence 1015tataagcctc
gtccgacatg 20101620DNAArtificial SequenceSynthetic Sequence
1016catgtcggac gaggcttata 20101720DNAArtificial SequenceSynthetic
Sequence 1017tggtggtggg gagtaagctc 20101820DNAArtificial
SequenceSynthetic Sequence 1018gagctactcc cccaccacca
20101920DNAArtificial SequenceSynthetic Sequence 1019gccttcgatc
ttcgttggga 20102020DNAArtificial SequenceSynthetic Sequence
1020tggacttctc tttgccgtct 20102120DNAArtificial SequenceSynthetic
Sequence 1021atgctgtagc ccagcgataa 20102220DNAArtificial
SequenceSynthetic Sequence 1022accgaatcag cggaaagtga
20102320DNAArtificial SequenceSynthetic Sequence 1023tccatgacgt
tcctgacgtt 20102424DNAArtificial SequenceSynthetic Sequence
1024ggagaaaccc atgagctcat ctgg 24102520DNAArtificial
SequenceSynthetic Sequence 1025accacagacc agcaggcaga
20102620DNAArtificial SequenceSynthetic Sequence 1026gagcgtgaac
tgcgcgaaga 20102720DNAArtificial SequenceSynthetic Sequence
1027tcggtaccct tgcagcggtt 20102820DNAArtificial SequenceSynthetic
Sequence 1028ctggagccct agccaaggat 20102920DNAArtificial
SequenceSynthetic Sequence 1029gcgactccat caccagcgat
20103021DNAArtificial SequenceSynthetic Sequence 1030cctgaagtaa
gaaccagatg t
21103121DNAArtificial SequenceSynthetic Sequence 1031ctgtgttatc
tgacatacac c 21103221DNAArtificial SequenceSynthetic Sequence
1032aattagcctt aggtgattgg g 21103321DNAArtificial SequenceSynthetic
Sequence 1033acatctggtt cttacttcag g 21103423DNAArtificial
SequenceSynthetic Sequence 1034ataagtcata ttttgggaac tac
23103521DNAArtificial SequenceSynthetic Sequence 1035cccaatcacc
taaggctaat t 21103620DNAArtificial SequenceSynthetic Sequence
1036ggggtcgtcg acgagggggg 20103722DNAArtificial SequenceSynthetic
Sequence 1037ggggtcgttc gaacgagggg gg 22103822DNAArtificial
SequenceSynthetic Sequence 1038ggggacgttc gaacgtgggg gg
22103915DNAArtificial Sequencemodified_base(9)...(9)n is
5-methylcytosine. 1039tcctggcgng gaagt 15104022DNAArtificial
SequenceSynthetic Sequence 1040ggggaacgac gtcgttgggg gg
22104120DNAArtificial SequenceSynthetic Sequence 1041ggggaacgta
cgtcgggggg 20104224DNAArtificial SequenceSynthetic Sequence
1042ggggaacgta cgtacgttgg gggg 24104320DNAArtificial
SequenceSynthetic Sequence 1043ggggtcaccg gtgagggggg
20104424DNAArtificial SequenceSynthetic Sequence 1044ggggtcgacg
tacgtcgagg gggg 24104522DNAArtificial SequenceSynthetic Sequence
1045ggggaccggt accggtgggg gg 22104619DNAArtificial
SequenceSynthetic Sequence 1046gggtcgacgt cgagggggg
19104718DNAArtificial SequenceSynthetic Sequence 1047ggggtcgacg
tcgagggg 18104822DNAArtificial SequenceSynthetic Sequence
1048ggggaacgtt aacgttgggg gg 22104919DNAArtificial
SequenceSynthetic Sequence 1049ggggacgtcg acgtggggg
19105034DNAArtificial SequenceSynthetic Sequence 1050gcactcttcg
aagctacagc cggcagcctc tgat 34105132DNAArtificial SequenceSynthetic
Sequence 1051cggctcttcc atgaggtctt tgctaatctt gg
32105235DNAArtificial SequenceSynthetic Sequence 1052cggctcttcc
atgaaagtct ttggacgatg tgagc 35105315DNAArtificial SequenceSynthetic
Sequence 1053tcctgcaggt taagt 15105420DNAArtificial
SequenceSynthetic Sequence 1054gggggtcgtt cgttgggggg
20105520DNAArtificial SequenceSynthetic Sequence 1055gggggatgat
tgttgggggg 20105620DNAArtificial Sequencemodified_base(7)...(7)m5c
1056gggggangat ngttgggggg 20105720DNAArtificial SequenceSynthetic
Sequence 1057gggggagcta gcttgggggg 20105820DNAArtificial
SequenceSynthetic Sequence 1058ggttcttttg gtccttgtct
20105920DNAArtificial SequenceSynthetic Sequence 1059ggttcttttg
gtcctcgtct 20106020DNAArtificial SequenceSynthetic Sequence
1060ggttcttttg gtccttatct 20106120DNAArtificial SequenceSynthetic
Sequence 1061ggttcttggt ttccttgtct 20106220DNAArtificial
SequenceSynthetic Sequence 1062tggtcttttg gtccttgtct
20106320DNAArtificial SequenceSynthetic Sequence 1063ggttcaaatg
gtccttgtct 20106420DNAArtificial SequenceSynthetic Sequence
1064gggtcttttg ggccttgtct 20106524DNAArtificial SequenceSynthetic
Sequence 1065tccaggactt ctctcaggtt tttt 24106620DNAArtificial
SequenceSynthetic Sequence 1066tccaaaactt ctctcaaatt
20106724DNAArtificial SequenceSynthetic Sequence 1067tactactttt
atacttttat actt 24106824DNAArtificial SequenceSynthetic Sequence
1068tgtgtgtgtg tgtgtgtgtg tgtg 24106925DNAArtificial
SequenceSynthetic Sequence 1069ttgttgttgt tgtttgttgt tgttg
25107027DNAArtificial SequenceSynthetic Sequence 1070ggctccgggg
agggaatttt tgtctat 27107119DNAArtificial SequenceSynthetic Sequence
1071gggacgatcg tcggggggg 19107220DNAArtificial SequenceSynthetic
Sequence 1072gggtcgtcga cgaggggggg 20107319DNAArtificial
SequenceSynthetic Sequence 1073ggtcgtcgac gaggggggg
19107420DNAArtificial SequenceSynthetic Sequence 1074gggtcgtcgt
cgtggggggg 20107520DNAArtificial SequenceSynthetic Sequence
1075ggggacgatc gtcggggggg 20107620DNAArtificial SequenceSynthetic
Sequence 1076ggggacgtcg tcgtgggggg 20107727DNAArtificial
SequenceSynthetic Sequence 1077ggggtcgacg tcgacgtcga ggggggg
27107821DNAArtificial SequenceSynthetic Sequence 1078ggggaaccgc
ggttgggggg g 21107921DNAArtificial SequenceSynthetic Sequence
1079ggggacgacg tcgtgggggg g 21108023DNAArtificial SequenceSynthetic
Sequence 1080tcgtcgtcgt cgtcgtgggg ggg 23108115DNAArtificial
SequenceSynthetic Sequence 1081tcctgccggg gaagt
15108215DNAArtificial SequenceSynthetic Sequence 1082tcctgcaggg
gaagt 15108315DNAArtificial SequenceSynthetic Sequence
1083tcctgaaggg gaagt 15108415DNAArtificial SequenceSynthetic
Sequence 1084tcctggcggg caagt 15108515DNAArtificial
SequenceSynthetic Sequence 1085tcctggcggg taagt
15108615DNAArtificial SequenceSynthetic Sequence 1086tcctggcggg
aaagt 15108715DNAArtificial SequenceSynthetic Sequence
1087tccgggcggg gaagt 15108815DNAArtificial SequenceSynthetic
Sequence 1088tcggggcggg gaagt 15108915DNAArtificial
SequenceSynthetic Sequence 1089tcccggcggg gaagt
15109015DNAArtificial SequenceSynthetic Sequence 1090gggggacgtt
ggggg 15109120DNAArtificial SequenceSynthetic Sequence
1091ggggtttttt ttttgggggg 20109220DNAArtificial SequenceSynthetic
Sequence 1092ggggcccccc ccccgggggg 20109321DNAArtificial
SequenceSynthetic Sequence 1093ggggttgttg ttgttggggg g
21109430DNAArtificial SequenceSynthetic Sequence 1094tttttttttt
tttttttttt tttttttttt 30109530DNAArtificial SequenceSynthetic
Sequence 1095aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 30109630DNAArtificial
SequenceSynthetic Sequence 1096cccccccccc cccccccccc cccccccccc
30109730DNAArtificial SequenceSynthetic Sequence 1097cgcgcgcgcg
cgcgcgcgcg cgcgcgcgcg 30109812DNAArtificial SequenceSynthetic
Sequence 1098gattttatcg tc 12109912DNAArtificial SequenceSynthetic
Sequence 1099tcgatttttc ga 12110012DNAArtificial SequenceSynthetic
Sequence 1100tcatttttat ga 12110112DNAArtificial SequenceSynthetic
Sequence 1101gttttttacg ac 12110212DNAArtificial SequenceSynthetic
Sequence 1102tcaatttttt ga 12110312DNAArtificial SequenceSynthetic
Sequence 1103acgtttttac gt 12110412DNAArtificial SequenceSynthetic
Sequence 1104tcgtttttac ga 12110516DNAArtificial SequenceSynthetic
Sequence 1105tcgattttta cgtcga 16110614DNAArtificial
SequenceSynthetic Sequence 1106aattttttaa cgtt
14110714DNAArtificial SequenceSynthetic Sequence 1107tcgtttttta
acga 14110814DNAArtificial SequenceSynthetic Sequence
1108acgtttttta acgt 14110913DNAArtificial SequenceSynthetic
Sequence 1109gatttttatc gtc 13111014DNAArtificial SequenceSynthetic
Sequence 1110gacgattttt cgtc 14111114DNAArtificial
SequenceSynthetic Sequence 1111gattttagct cgtc
14111212DNAArtificial SequenceSynthetic Sequence 1112gatttttacg tc
12111310DNAArtificial SequenceSynthetic Sequence 1113attttatcgt
10111414DNAArtificial SequenceSynthetic Sequence 1114aacgattttt
cgtt 14111512DNAArtificial SequenceSynthetic Sequence
1115tcacttttgt ga 12111610DNAArtificial SequenceSynthetic Sequence
1116tcgtatttta 10111714DNAArtificial SequenceSynthetic Sequence
1117acttttgtac cggt 14111818DNAArtificial SequenceSynthetic
Sequence 1118tcgatttttc gacgtcga 18111912DNAArtificial
SequenceSynthetic Sequence 1119acgatttttc gt 12112010DNAArtificial
SequenceSynthetic Sequence 1120gatgatcgtc 10112110DNAArtificial
SequenceSynthetic Sequence 1121tcgatgtcga 10112210DNAArtificial
SequenceSynthetic Sequence 1122tcatgtatga 10112310DNAArtificial
SequenceSynthetic Sequence 1123gtgttacgac 10112410DNAArtificial
SequenceSynthetic Sequence 1124tcaatgttga 10112510DNAArtificial
SequenceSynthetic Sequence 1125acgtgtacgt 10112610DNAArtificial
SequenceSynthetic Sequence 1126tcgtgtacga 10112714DNAArtificial
SequenceSynthetic Sequence 1127tcgatgtacg tcga
14112812DNAArtificial SequenceSynthetic Sequence 1128aatgttaacg tt
12112912DNAArtificial SequenceSynthetic Sequence 1129tcgtgttaac ga
12113012DNAArtificial SequenceSynthetic Sequence 1130acgtgttaac gt
12113111DNAArtificial SequenceSynthetic Sequence 1131gatgtatcgt c
11113212DNAArtificial SequenceSynthetic Sequence 1132gacgatgtcg tc
12113312DNAArtificial SequenceSynthetic Sequence 1133gatgagctcg tc
12113410DNAArtificial SequenceSynthetic Sequence 1134gatgtacgtc
1011358DNAArtificial SequenceSynthetic Sequence 1135atgatcgt
8113612DNAArtificial SequenceSynthetic Sequence 1136aacgatgtcg tt
12113710DNAArtificial SequenceSynthetic Sequence 1137tcactggtga
1011388DNAArtificial SequenceSynthetic Sequence 1138tcgtatga
8113912DNAArtificial SequenceSynthetic Sequence 1139actggtaccg gt
12114016DNAArtificial SequenceSynthetic Sequence 1140tcgatgtcga
cgtcga 16114110DNAArtificial SequenceSynthetic Sequence
1141acgatgtcgt 10114231DNAArtificial SequenceSynthetic Sequence
1142tgcaggaagt ccgggttttc cccaaccccc c 3111436DNAArtificial
SequenceSynthetic Sequence 1143gacgtt 611446DNAArtificial
SequenceSynthetic Sequence 1144gtcgtt 611458DNAArtificial
SequenceSynthetic Sequence 1145tcgtcgtt 8
* * * * *