U.S. patent number 8,834,900 [Application Number 10/224,523] was granted by the patent office on 2014-09-16 for combination motif immune stimulatory oligonucleotides with improved activity.
This patent grant is currently assigned to Coley Pharmaceutical GmbH, University of Iowa Research Foundation. The grantee listed for this patent is Arthur M. Krieg, Jorg Vollmer. Invention is credited to Arthur M. Krieg, Jorg Vollmer.
United States Patent |
8,834,900 |
Krieg , et al. |
September 16, 2014 |
Combination motif immune stimulatory oligonucleotides with improved
activity
Abstract
A class of immunostimulatory nucleic acids having at least two
functionally and structurally defined domains is provided. This
class of combination motif immunostimulatory nucleic acids
activates an immune response and is useful for treating a variety
of immune related disorders such as cancer, infectious disease, and
allergic disorders. The nucleic acids also stimulate activation of
natural killer cells and production of type 1 interferon.
Inventors: |
Krieg; Arthur M. (Wellesley,
MA), Vollmer; Jorg (Duesseldorf, DE) |
Applicant: |
Name |
City |
State |
Country |
Type |
Krieg; Arthur M.
Vollmer; Jorg |
Wellesley
Duesseldorf |
MA
N/A |
US
DE |
|
|
Assignee: |
University of Iowa Research
Foundation (Iowa City, IA)
Coley Pharmaceutical GmbH (Dusseldorf, DE)
|
Family
ID: |
26978772 |
Appl.
No.: |
10/224,523 |
Filed: |
August 19, 2002 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20030148976 A1 |
Aug 7, 2003 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
60313273 |
Aug 17, 2001 |
|
|
|
|
60393952 |
Jul 3, 2002 |
|
|
|
|
Current U.S.
Class: |
424/278.1;
536/23.1 |
Current CPC
Class: |
A61P
37/04 (20180101); C12N 15/117 (20130101); A61P
35/04 (20180101); A61P 37/08 (20180101); A61P
43/00 (20180101); A61P 31/00 (20180101); A61P
35/00 (20180101); A61P 11/06 (20180101); C12N
2310/315 (20130101); A61K 38/00 (20130101); A61K
2039/55561 (20130101) |
Current International
Class: |
A61K
45/00 (20060101); C07H 21/02 (20060101) |
Field of
Search: |
;514/44 ;435/375 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
092574 |
|
Apr 1983 |
|
EP |
|
0 302 758 |
|
Feb 1989 |
|
EP |
|
0 468 520 |
|
Jan 1992 |
|
EP |
|
2107728 |
|
Mar 1998 |
|
RU |
|
WO 90/08777 |
|
Aug 1990 |
|
WO |
|
WO 91/12811 |
|
Sep 1991 |
|
WO |
|
WO 92/03456 |
|
Mar 1992 |
|
WO |
|
WO 94/01550 |
|
Jan 1994 |
|
WO |
|
WO 94/19945 |
|
Sep 1994 |
|
WO |
|
WO 95/03407 |
|
Feb 1995 |
|
WO |
|
WO 96/02555 |
|
Feb 1996 |
|
WO |
|
WO 98/18810 |
|
May 1998 |
|
WO |
|
WO 98/29430 |
|
Jul 1998 |
|
WO |
|
WO 98/32462 |
|
Jul 1998 |
|
WO |
|
WO 98/37919 |
|
Sep 1998 |
|
WO |
|
WO 98/40100 |
|
Sep 1998 |
|
WO |
|
WO 98/49288 |
|
Nov 1998 |
|
WO |
|
WO 98/52581 |
|
Nov 1998 |
|
WO |
|
WO 98/52962 |
|
Nov 1998 |
|
WO |
|
WO 99/50297 |
|
Oct 1999 |
|
WO |
|
WO 99/51259 |
|
Oct 1999 |
|
WO |
|
WO 99/56755 |
|
Nov 1999 |
|
WO |
|
WO 99/58118 |
|
Nov 1999 |
|
WO |
|
WO 99/61056 |
|
Dec 1999 |
|
WO |
|
WO 99/61056 |
|
Dec 1999 |
|
WO |
|
WO 99/63975 |
|
Dec 1999 |
|
WO |
|
WO 00/06588 |
|
Feb 2000 |
|
WO |
|
WO 00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/14217 |
|
Mar 2000 |
|
WO |
|
WO 00/61151 |
|
Oct 2000 |
|
WO |
|
WO 00/67023 |
|
Nov 2000 |
|
WO |
|
WO 00/67787 |
|
Nov 2000 |
|
WO |
|
WO 00/75304 |
|
Dec 2000 |
|
WO |
|
WO 01 22972 |
|
Apr 2001 |
|
WO |
|
WO 01/22990 |
|
Apr 2001 |
|
WO |
|
WO 01/22990 |
|
Apr 2001 |
|
WO |
|
WO 01/35991 |
|
May 2001 |
|
WO |
|
WO 01/45750 |
|
Jun 2001 |
|
WO |
|
WO 01/55370 |
|
Aug 2001 |
|
WO |
|
WO 01/62909 |
|
Aug 2001 |
|
WO |
|
WO 01 95935 |
|
Dec 2001 |
|
WO |
|
WO 01/97843 |
|
Dec 2001 |
|
WO |
|
WO 02/22809 |
|
Mar 2002 |
|
WO |
|
WO 02/053141 |
|
Jul 2002 |
|
WO |
|
WO 02/069369 |
|
Sep 2002 |
|
WO |
|
WO 03/012061 |
|
Feb 2003 |
|
WO |
|
WO 03/015711 |
|
Feb 2003 |
|
WO |
|
WO 03/031573 |
|
Apr 2003 |
|
WO |
|
WO 2004/007743 |
|
Jan 2004 |
|
WO |
|
WO 2004/026888 |
|
Apr 2004 |
|
WO |
|
WO 2004/094671 |
|
Nov 2004 |
|
WO |
|
WO 2007/075626 |
|
Jul 2007 |
|
WO |
|
WO 2008/030455 |
|
Mar 2008 |
|
WO |
|
WO 2008/033432 |
|
Mar 2008 |
|
WO |
|
WO 2008/039538 |
|
Apr 2008 |
|
WO |
|
WO 2008/068638 |
|
Jun 2008 |
|
WO |
|
WO 2008/139262 |
|
Nov 2008 |
|
WO |
|
Other References
Krieg A. M. BioDrugs, 5:341-346, 1998. cited by examiner .
Agrawal et al. Trends in Mol. Med., 8:114-121, 2002. cited by
examiner .
Ballas ZK et al. (1996) J Immunol 157:1840-5. cited by applicant
.
Beaucage SL et al. (1981) Tetrahedron Lett 22:1859. cited by
applicant .
Cella M et al. (1999) Nat Med 5:919-23. cited by applicant .
Cohen PA et al. (1994) Cancer Res 54:1055-8. cited by applicant
.
Crooke ST et al. (1996) Annu Rev Pharmacol Toxicol 36:107-129.
cited by applicant .
Froehler BC et al. (1986) Nucl Acid Res 14:5399-407. cited by
applicant .
Froehler BC et al. (1992) J. Am Chem Soc 114:8320. cited by
applicant .
Gaffney BL et al. (1988) Tetrahedron Lett 29:2619-22. cited by
applicant .
Garegg PJ et al. (1986) Tetrahedron Lett 27:4051-4. cited by
applicant .
Garegg PJ et al. (1986) Tetrahedron Lett 27:4055-8. cited by
applicant .
Goodchild J (1990) Bioconjugate Chem 1:165. cited by applicant
.
Grouard G et al. (1997) J Exp Med 185:1101-11. cited by applicant
.
Jahrsdoerfer B et al. "CpG DNA Increases Primary Malignant B Cell
Expression of Costimulatory Molecules and Target Antigens." J. of
Leukocyte Biology, Federation of American Societies for
Experimental, US. vol. 1, No. 69, Jan. 2001: pp. 81-88. cited by
applicant .
Krieg AM et al., "Applications of Immune Stimulatory CpG DNA for
Antigen-Specific and Antigen-Nonspecific Cancer Immunotherapy"
European Journal of Cancer. Pergamon Press, Oxford. vol. 35. No.
Suppl. 5. 1999: p. S10. cited by applicant .
Krieg AM (2001) Trends Microbiol 9:249-52. cited by applicant .
Krieg AM et al. (1995) Nature 374:546-9. cited by applicant .
Krieg AM et al. (1998) Proc Natl Acad Sci USA 95:12631-12636. cited
by applicant .
Krieg. AM et al. Vaccine (2001) 19:618-622. cited by applicant
.
Langer R (1990) Science 249:1527-33. cited by applicant .
Loetscher P et al. (2001) J Biol Chem 276:2986-91. cited by
applicant .
National Institutes of Health: Guidelines for the Diagnosis and
Management of Asthma, Expert Panel Report 2. NIH Publication No.
97/4051. Jul. 19. 1997. cited by applicant .
Nielsen PE et al. (1994) Bioconjug Chem 5:3-7. cited by applicant
.
Rissoan M-C et al. (1999) Science 283:1183-6. cited by applicant
.
Siegal FP et al. (1999) Science 284.1835-7. cited by applicant
.
Stirchak EP et al. (1989) Nucleic Acids Res 17:6129-41. cited by
applicant .
Tarkov M et al. (1993) Helv Chim Acta 76 481. cited by applicant
.
Uhlmann E et al. (1990) Chem Rev 90:544. cited by applicant .
Vandendriessche F et al. (1993) Tetrahedron 49:7223. cited by
applicant .
Wagner RW et al. (1996) Nat Biotechnol 14:840-4. cited by applicant
.
Warren TL et al. "CpC, oligodeoxynucleotides enhance monoclonal
antibody therapy of a murine lymphoma." Clinical Lymphoma vol. 1.
No. 1. Jun. 2000. pp. 57-61. cited by applicant .
Yamamoto S et al. (1992) J Immunol 148:4072-6. cited by applicant
.
Chatellier S et al., Preferential stimulation of human lymphocytes
by oligodeoxynucleotides that copy DNA CpG motifs present in
virulent genes of group A streptococci, Eur J Immunol. Apr.
2000;30(4):993-1001. cited by applicant .
Pisetsky D et al., Influence of backbone chemistry on immune
activation by synthetic oligonucleotides, Biochem Pharmacol. Dec.
15, 1999;58(12):1981-8. cited by applicant .
Hartmann G et al., Delineation of a CpG phosphorothioate
oligodeoxynucleotide for activating primate immune responses in
vitro and in vivo. J Immunol. Feb. 1, 2000;164(3):1617-24. cited by
applicant .
Agrawal et al., In vivo pharmacokinetics of phosphorothioate
oligonucleotides containing contiguous guanosines. Antisense
Nucleic Acid Drug Dev. Jun. 1997;7(3):245-9. cited by applicant
.
Agrawal et al., Antisense therapeutics: is it as simple as
complementary base recognition? Mol Med Today. Feb.
2000;6(2):72-81. cited by applicant .
Agrawal et al., Chapter 19: Pharmacokinetics and bioavailability of
antisense oligonucleotides following oral and colorectal
administrations in experimental animals. 1998: 525-43. cited by
applicant .
Agrawal et al., Antisense oligonucleotides: towards clinical
trials. Trends in Biotechnology, 1996; 14: 376-87. cited by
applicant .
Ballas et al., Induction of NK activity in murine and human cells
by CpG motifs in oligodeoxynucleotides and bacterial DNA. J
Immunol. Sep. 1, 1996;157(5):1840-5. cited by applicant .
Bates et al., Antiproliferative activity of G-rich oligonucleotides
correlates with protein binding. J Biol Chem. Sep. 10,
1999;274(37):26369-77. cited by applicant .
Bauer et al., DNA activates human immune cells through a CpG
sequence-dependent manner. Immunology. Aug. 1999;97(4):699-705.
cited by applicant .
Boggs et al., Characterization and modulation of immune stimulation
by modified oligonucleotides. Antisense Nucleic Acid Drug Dev. Oct.
1997;7(5):461-71. cited by applicant .
Branda et al., Immune stimulation by an antisense oligomer
complementary to the rev gene of HIV-1. Biochem Pharmacol. May 25,
1993;45(10):2037-43. cited by applicant .
Branda et al., Amplification of antibody production by
phosphorothioate oligodeoxynucleotides. J Lab Clin Med. Sep.
1996;128(3):329-38. cited by applicant .
Broide et al., DNA-Based immunization for asthma. Int Arch Allergy
Immunol. Feb.-Apr. 1999;118(2-4):453-6. cited by applicant .
Burgess et al., The antiproliferative activity of c-myb and c-myc
antisense oligonucleotides in smooth muscle cells is caused by a
nonantisense mechanism. Proc Natl Acad Sci U S A. Apr. 25,
1995;92(9):4051-5. cited by applicant .
Carpentier et al., Successful treatment of intracranial gliomas in
rat by oligodeoxynucleotides containing CpG motifs. Clin Cancer
Res. Jun. 2000;6(6):2469-73. cited by applicant .
Chu et al., CpG oligodeoxynucleotides act as adjuvants that switch
on T helper 1 (Th 1) immunity. J Exp Med. Nov. 17,
1997;186(10):1623-31. cited by applicant .
Coley Pharmaceutical Group Press Release, Coley Pharmaceutical
Group Updated Hepatitis C Drug Development Strategy. Jan. 22, 2007.
cited by applicant .
Coley Pharmaceutical Group Press Release, Coley Pharmaceutical
Announces Pfizer's Discontinuation of Clinical Trials for
PF-3512676 Combined with Cytotoxic Chemotherapy in Advanced Non
Small Cell Lung Cancer, Jun. 20, 2007. cited by applicant .
Cowsert et al., In vitro evaluation of phosphorothioate
oligonucleotides targeted to the E2 mRNA of papillomavirus:
potential treatment for genital warts. Antimicrob Agents Chemother.
Feb. 1993;37(2):171-7. cited by applicant .
Crooke et al., Phosphorothioate Oligonucleotides. Therapeut Apps.
1995;ch5:63-84. cited by applicant .
Crooke et al., Progress in antisense oligonucleotide therapeutics.
Annu Rev Pharmacol Toxicol. 1996;36:107-29. cited by applicant
.
Dapic et al., Proceedings of AACR, pp. 42 Mar. 2001:1122. cited by
applicant .
Davis, Use of CpG DNA for enhancing specific immune responses. Curr
Top Microbiol Immunol. 2000;247:171-83. cited by applicant .
Davis et al., CpG ODN is safe and highly effective in humans as
adjuvant to HBV vaccine: Preliminary results of Phase I trial with
CpG ODN 7909. Third Annual Conference on Vaccine Res. 2000.
Abstract s25, No. 47. cited by applicant .
Gallichan et al., Intranasal immunization with CpG
oligodeoxynucleotides as an adjuvant dramatically increases IgA and
protection against herpes simplex virus-2 in the genital tract. J
Immunol. Mar. 1, 2001;166(5):3451-7. cited by applicant .
Hafner et al., Antimetastatic effect of CpG DNA mediated by type I
IFN. Cancer Res. Jul. 15, 2001;61(14):5523-8. cited by applicant
.
Hahm et al., Efficacy of polyadenylic.polyuridylic acid in the
treatment of chronic active hepatitis B. Int J Immunopharmacol.
Mar. 1994;16(3):217-25. cited by applicant .
Harrington et al., Adjuvant effects of low doses of a
nuclease-resistant derivative of polyinosinic acid . polycytidylic
acid on antibody responses of monkeys to inactivated Venezuelan
equine encephalomyelitis virus vaccine. Infect Immun. Apr.
1979;24(1):160-6. cited by applicant .
Hartmann et al., CpG DNA and LPS induce distinct patterns of
activation in human monocytes. Gene Ther. May 1999;6(5):893-903.
cited by applicant .
Hartmann et al., Mechanism and function of a newly identified CpG
DNA motif in human primary B cells. J Immunol. Jan. 15,
2000;164(2):944-53. cited by applicant .
Hartmann et al., Specific suppression of human tumor necrosis
factor-alpha synthesis by antisense oligodeoxynucleotides.
Antisense Nucleic Acid Drug Dev. 1996 Winter;6(4):291-9. cited by
applicant .
Hartmann et al., Delineation of a CpG phosphorothioate
oligodeoxynucleotide for activating primate immune responses in
vitro and in vivo. J Immunol. Feb. 1, 2000;164(3):1617-24. cited by
applicant .
Hartmann et al., CpG DNA: a potent signal for growth, activation,
and maturation of human dendritic cells. Proc Natl Acad Sci U S A.
Aug. 3, 1999;96(16):9305-10. cited by applicant .
Heeg et al., CpG DNA as a Th 1 trigger. Int Arch Allergy Immunol.
Feb. 2000;121(2):87-97. cited by applicant .
Henry et al., Chemically modified oligonucleotides exhibit
decreased immune stimulation in mice. J Pharmacol Exp Ther. Feb.
2000;292(2):468-79. cited by applicant .
Hopkin et al., Curbing the CpGs of Bacterial and Viral DNA.
BioMedNet. Jun. 25, 1999; Issue 57. cited by applicant .
Hughes et al., Influence of base composition on membrane binding
and cellular uptake of 10-mer phosphorothioate oligonucleotides in
Chinese hamster ovary (CHRC5) cells. Antisense Res Dev. 1994
Fall;4(3):211-5. cited by applicant .
Iho et al., Oligodeoxynucleotides containing palindrome sequences
with internal 5'-CpG-3' act directly on human NK and activated T
cells to induce IFN-gamma production in vitro. J Immunol. Oct. 1,
1999;163(7):3642-52. cited by applicant .
Iversen et al., Pharmacokinetics of an antisense phosphorothioate
oligodeoxynucleotide against rev from human immunodeficiency virus
type 1 in the adult male rat following single injections and
continuous infusion. Antisense Res Dev. 1994 Spring;4(1):43-52.
cited by applicant .
Kataoka et al., Antitumor activity of synthetic oligonucleotides
with sequences from cDNA encoding proteins of Mycobacterium bovis
BCG. Jpn J Cancer Res. Mar. 1992;83(3):244-7. cited by applicant
.
Kataoka et al., Immunotherapeutic potential in guinea-pig tumor
model of deoxyribonucleic acid from Mycobacterium bovis BCG
complexed with poly-L-lysine and carboxymethylcellulose. Jpn J Med
Sci Biol. Oct. 1990;43(5):171-82. cited by applicant .
Kern et al., Herpesvirus hominis infection in newborn mice:
treatment with interferon inducer polyinosinic-polycytidylic acid.
Antimicrob Agents Chemother. Jun. 1975;7(6):793-800. cited by
applicant .
Kimura et al., Binding of oligoguanylate to scavenger receptors is
required for oligonucleotides to augment NK cell activity and
induce IFN. J Biochem (Tokyo). Nov. 1994;116(5):991-4. cited by
applicant .
Klinman et al., Immunotherapeutic applications of CpG-containing
oligodeoxynucleotides. Drug News Perspect. Jun. 2000;13(5):289-96.
cited by applicant .
Klinman et al., Immune recognition of foreign DNA: a cure for
bioterrorism? Immunity. Aug. 1999;11(2):123-9. cited by applicant
.
Klinman et al., CpG motifs present in bacteria DNA rapidly induce
lymphocytes to secrete interleukin 6, interleukin 12, and
interferon gamma. Proc Natl Acad Sci U S A. Apr. 2,
1996;93(7):2879-83. cited by applicant .
Kovarik et al., CpG oligodeoxynucleotides can circumvent the Th2
polarization of neonatal responses to vaccines but may fail to
fully redirect Th2 responses established by neonatal priming. J
Immunol. Feb. 1, 1999;162(3):1611-7. cited by applicant .
Krieg et al., Immune effects and therapeutic applications of CpG
motifs in bacterial DNA. Immunopharmacology. Jul. 25,
2000;48(3):303-5. cited by applicant .
Krieg et al., Lymphocyte activation mediated by
oligodeoxynucleotides or DNA containing novel un-methylated CpG
motifs. American College of Rheumatology 58.sup.th National
Scientific Meeting. Minneapolis, Minnesota, Oct. 22, 1994.
Abstracts. Arthritis Rheum. Sep. 1994;37(9 Suppl). cited by
applicant .
Krieg et al., Oligodeoxynucleotide modifications determine the
magnitude of B cell stimulation by CpG motifs. Antisense Nucleic
Acid Drug Dev. 1996 Summer;6(2):133-9. cited by applicant .
Krieg et al., Phosphorothioate oligodeoxynucleotides: antisense or
anti-protein? Antisense Res Dev. 1995 Winter;5(4):241. cited by
applicant .
Krieg et al., Leukocyte stimulation by oligodeoxynucleotides. In:
Applied Antisense Oligonucleotide Technology. 1998:431-48. cited by
applicant .
Krieg, CpG DNA: a pathogenic factor in systemic lupus
erythematosus? J Clin Immunol. Nov. 1995;15(6):284-92. cited by
applicant .
Krieg et al., CpG motifs in bacterial DNA trigger direct B-cell
activation. Nature. Apr. 6, 1995;374(6522):546-9. cited by
applicant .
Krieg et al., The role of CpG dinucleotides in DNA vaccines. Trends
Microbiol. Jan. 1998;6(1):23-7. cited by applicant .
Krieg, An innate immune defense mechanism based on the recognition
of CpG motifs in microbial DNA. J Lab Clin Med. Aug.
1996;128(2):128-33. cited by applicant .
Krieg et al., Applications of immune stimulatory CpG DNA for
antigen-specific and antigen-nonspecific cancer immunotherapy. Eur
J Canc. Oct. 1999; 35/Suppl4:S10. Abstract #14. cited by applicant
.
Krieg et al., Causing a commotion in the blood: immunotherapy
progresses from bacteria to bacterial DNA. Immunol Today. Oct.
2000;21(10):521-6. cited by applicant .
Krieg et al., Chapter 8: Immune Stimulation by Oligonucleotides.
In: Antisense Research and Application. Crooke, Ed. 1998:243-62.
cited by applicant .
Krieg et al., Bacterial DNA or oligonucleotides containing CpG
motifs protect mice from lethal L. monocytogenes challenge. 1996
Meeting on Molecular Approaches to the Control of Infectious
Diseases. Cold Spring Harbor Laboratory, Sep. 9-13, 1996:116. cited
by applicant .
Krieg et al., Enhancing vaccines with immune stimulatory CpG DNA.
Curr Opin Mol Ther. Feb. 2001;3(1):15-24. cited by applicant .
Krieg, Chapter 7: CpG oligonucleotides as immune adjuvants. Ernst
Schering Research Found Workshop 2001; 30:105-18. cited by
applicant .
Krieg, Immune effects and mechanisms of action of CpG motifs.
Vaccine. Nov. 8, 2001;19(6):61822. cited by applicant .
Krieg et al., Chapter 17:Immune stimulation by oligonucleotides. in
Antisense Drug Tech. 2001;1394:471-515. cited by applicant .
Krieg et al., Mechanisms and applications of immune stimulatory CpG
oligodeoxynucleotides. Biochim Biophys Acta. Dec. 10,
1999;1489(1):107-16. cited by applicant .
Krieg et al., The CpG motif: Implications for clinical immunology.
BioDrugs. Nov. 1, 1998;10(5):341-6. cited by applicant .
Krieg, The role of CpG motifs in innate immunity. Curr Opin
Immunol. Feb. 2000;12(1):35-43. cited by applicant .
Krieg et al., Mechanisms and therapeutic applications of immune
stimulatory CpG DNA. Pharmacol Ther. Nov. 1999;84(2):113-20. cited
by applicant .
Krieg et al., Sequence motifs in adenoviral DNA block immune
activation by stimulatory CpG motifs. Proc Natl Acad Sci U S A.
Oct. 13, 1998;95(21):12631-6. cited by applicant .
Krieg et al., CpG DNA induces sustained IL-12 expression in vivo
and resistance to Listeria monocytogenes challenge. J Immunol. Sep.
1, 1998;161(5):2428-34. cited by applicant .
Krieg et al., CpG DNA: a novel immunomodulator. Trends Microbiol.
Feb. 1999;7(2):64-5. cited by applicant .
Krieg, Signal transduction induced by immunostimulatory CpG DNA.
Springer Semin Immunopathol. 2000;22(1-2):97-105. cited by
applicant .
Krieg et al., How to exclude immunostimulatory and other
nonantisense effects of antisense oligonucleotides. Manual of
Antisense. 1999:79-89. cited by applicant .
Krieg et al., Infection. In: McGraw Hill Book. 1996:242-3. cited by
applicant .
Krieg et al., Lymphocyte activation by CpG dinucleotide motifs in
prokaryotic DNA. Trends Microbiol. Feb. 1996;4(2):73-6. cited by
applicant .
Krieg et al., Mechanism of action of CpG DNA. Curr Top Microbiol
Immunol. 2000;247:1-21. cited by applicant .
Kuramoto et al., Induction of T-cell-mediated immunity against
MethA fibrosarcoma by intratumoral injections of a bacillus
Calmette-Guerin nucleic acid fraction. Cancer Immunol Immunother.
1992;34(5):283-8. cited by applicant .
Kuramoto et al., Changes of host cell infiltration into Meth A
fibrosarcoma tumor during the course of regression induced by
injections of a BCG nucleic acid fraction. Int J Immunopharmacol.
Jul. 1992;14(5):773-82. cited by applicant .
Kuramoto et al., Oligonucleotide sequences required for natural
killer cell activation. Jpn J Cancer Res. Nov. 1992;83(11):1128-31.
cited by applicant .
Kuramoto et al., In situ infiltration of natural killer-like cells
induced by intradermal injection of the nucleic acid fraction from
BCG. Microbiol Immunol. 1989;33(11):929-40. cited by applicant
.
Lederman et al., Polydeoxyguanine motifs in a 12-mer
phosphorothioate oligodeoxynucleotide augment binding to the v3
loop of HIV-1 gp120 and potency of HIV-1 inhibition independency of
G-tetrad formation. Antisense Nucleic Acid Drug Dev. 1996
Winter;6(4):281-9. cited by applicant .
Lee et al., An oligonucleotide blocks interferon-gamma signal
transduction. Transplantation. Nov. 15, 1996;62(9):1297-301. cited
by applicant .
Leonard et al., Conformation of guanine-8-oxoadenine base pairs in
the crystal structure of d(CGCGAATT(O8A)GCG). Biochemistry. Sep.
15, 1992;31(36):8415-20. cited by applicant .
Levine et al., Phase I-II trials of poly IC stabilized with
poly-L-lysine. Cancer Treat Rep. Nov. 1978;62(11):1907-12. cited by
applicant .
Levy et al., Prophylactic control of simian hemorrhagic fever in
monkeys by an interferon inducer,
polyriboinosinic-polyribocytidylic acid-poly-L-lysine. J Infect
Dis. Jun. 1976;133 Suppl:A256-9. cited by applicant .
Lipford et al., CpG-containing synthetic oligonucleotides promote B
and cytotoxic T cell responses to protein antigen: a new class of
vaccine adjuvants. Eur J Immunol. Sep. 1997;27(9):2340-4. cited by
applicant .
Lipford et al., Immunostimulatory DNA: sequence-dependent
production of potentially harmful or useful cytokines. Eur J
Immunol. Dec. 1997;27(12):3420-6. cited by applicant .
Lipford et al., Bacterial DNA as immune cell activator. Trends
Microbiol. Dec. 1998;6(12):496-500. cited by applicant .
Lipford et al., Poly-guanosine motifs costimulate antigen-reactive
CD8 T cells while bacterial CpG-DNA affect T-cell activation via
antigen-presenting cell-derived cytokines. Immunology. Sep.
2000;101(1):46-52. cited by applicant .
Liu et al., CpG ODN is an effective adjuvant in immunization with
tumor antigen. J Invest Med. Sep. 7, 1997;45(7):333A. cited by
applicant .
Loke et al., Delivery of c-myc antisense phosphorothioate
oligodeoxynucleotides to hematopoietic cells in culture by liposome
fusion: specific reduction in c-myc protein expression correlates
with inhibition of cell growth and DNA synthesis. Curr Top
Microbiol Immunol. 1988;141:282-9. cited by applicant .
Macaya et al., Thrombin-binding DNA aptamer forms a unimolecular
quadruplex structure in solution. Proc Natl Acad Sci U S A. Apr.
15, 1993;90(8):3745-9. cited by applicant .
Maltese et al., Sequence context of antisense RelA/NF-kappa B
phosphorothioates determines specificity. Nucleic Acids Res. Apr.
11, 1995;23(7):1146-51. cited by applicant .
Martin-Orozco et al., Enhancement of antigen-presenting cell
surface molecules involved in cognate interactions by
immunostimulatory DNA sequences. Int Immunol. Jul.
1999;11(7):1111-8. cited by applicant .
Matson et al., Nonspecific suppression of [3H]thymidine
incorporation by "control" oligonucleotides. Antisense Res Dev.
1992 Winter;2(4):325-30. cited by applicant .
Matsukura et al., Regulation of viral expression of human
immunodeficiency virus in vitro by an antisense phosphorothioate
oligodeoxynucleotide against rev (art/trs) in chronically infected
cells. Proc Natl Acad Sci U S A. Jun. 1989;86(11):4244-8. cited by
applicant .
McCluskie et al., CpG DNA is a potent enhancer of systemic and
mucosal immune responses against hepatitis B surface antigen with
intranasal administration to mice. J Immunol. Nov. 1,
1998;161(9):4463-6. cited by applicant .
McCluskie et al., CpG DNA as mucosal adjuvant. Vaccine. 2000;18:
231-7. cited by applicant .
McIntyre et al., A sense phosphorothioate oligonucleotide directed
to the initiation codon of transcription factor NF-kappa B p65
causes sequence-specific immune stimulation. Antisense Res Dev.
1993 Winter;3(4):309-22. cited by applicant .
Messina et al., The influence of DNA structure on the in vitro
stimulation of murine lymphocytes by natural and synthetic
polynucleotide antigens. Cell Immunol. Mar. 1993;147(1):148-57.
cited by applicant .
Michelson et al. Poly(A).poly(U) as adjuvant in cancer treatment
distribution and pharmacokinetics in rabbits. Proc Soc Exp Biol
Med. Jun. 1985;179(2):180-6. cited by applicant .
Monteith et al., Immune stimulation--a class effect of
phosphorothioate oligodeoxynucleotides in rodents. Anticancer Drug
Des. Jul. 1997;12(5):421-32. cited by applicant .
Nyce et al., DNA antisense therapy for asthma in an animal model.
Nature. Feb. 20, 1997;385(6618):721-5. cited by applicant .
Park et al., The enhanced effect of a hexameric deoxyriboguanosine
run conjugation to CpG oligodeoxynucleotides on protection against
allergic asthma. J Allergy Clin Immunol. Oct. 2001;108(4):570-6.
cited by applicant .
Perlaky et al., Growth inhibition of human tumor cell lines by
antisense oligonucleotides designed to inhibit p120 expression.
Anticancer Drug Des. Feb. 1993;8(1):3-14. cited by applicant .
Pisetsky et al., The immunologic properties of DNA. J Immunol. Jan.
15, 1996;156(2):421-3. cited by applicant .
Pisetsky et al., Influence of backbone chemistry on immune
activation by synthetic oligonucleotides. Biochem Pharmacol. Dec.
15, 1999;58(12):1981-8. cited by applicant .
Pisetsky et al., Stimulation of murine lymphocyte proliferation by
a phosphorothioate oligonucleotide with antisense activity for
herpes simplex virus. Life Sci. 1994;54(2):101-7. cited by
applicant .
Pisetsky, Immunologic consequences of nucleic acid therapy.
Antisense Res Dev. 1995 Fall;5(3):219-25. cited by applicant .
Pisetsky et al., Stimulation of in vitro proliferation of murine
lymphocytes by synthetic oligodeoxynucleotides. Mol Biol Rep. Oct.
1993;18(3):217-21. cited by applicant .
Pisetsky, The influence of base sequence on the immunostimulatory
properties of DNA. Immunol Res. 1999;19(1):35-46. cited by
applicant .
Pisetsky et al., The influence of base sequence on the
immunological properties of defined oligonucleotides.
Immunopharmacology. Nov. 1998;40(3):199-208. cited by applicant
.
Polanczyk et al., Immunostimulatory effects of DNA and CpG motifs.
Cent Eur J of Immunol. 2000;25(3): 160-6. cited by applicant .
Rankin et al., CpG motif identification for veterinary and
laboratory species demonstrates that sequence recognition is highly
conserved. Antisense Nucleic Acid Drug Dev. Oct. 2001;11(5):333-40.
cited by applicant .
Roman et al., Immunostimulatory DNA sequences function as T
helper-1-promoting adjuvants. Nat Med. Aug. 1997;3(8):849-54. cited
by applicant .
Sarmiento et al., In vivo toxicological effects of rel A antisense
phosphorothioates in CD-1 mice. Antisense Res Dev. 1994
Summer;4(2):99-107. cited by applicant .
Sato et al., Immunostimulatory DNA sequences necessary for
effective intradermal gene immunization. Science. Jul. 19,
1996;273(5273):352-4. cited by applicant .
Sester et al., Phosphorothioate backbone modification modulates
macrophage activation by CpG DNA. J Immunol. Oct. 15,
2000;165(8):4165-73. cited by applicant .
Sonehara et al., Hexamer palindromic oligonucleotides with 5'-CG-3'
motif(s) induce production of interferon. J Interferon Cytokine
Res. Oct. 1996;16(10):799-803. cited by applicant .
Sparwasser et al., Bacterial DNA causes septic shock. Nature. Mar.
27, 1997;386(6623):336-7. cited by applicant .
Stein et al., Problems in interpretation of data derived from in
vitro and in vivo use of antisense oligodeoxynucleotides. Antisense
Res Dev. 1994 Summer;4(2):67-9. cited by applicant .
Stein et al., Non-antisense effects of oligodeoxynucleotides.
Antisense Technology. 1997; ch11: 241-64. cited by applicant .
Sun et al. Type I interferon-mediated stimulation of T cells by CpG
DNA. J Exp Med. Dec. 21, 1998;188(12):2335-42. cited by applicant
.
Sun et al. Multiple effects of immunostimulatory DNA on T cells and
the role of type I interferons. Springer Semin Immunopathol.
2000;22(1-2):77-84. cited by applicant .
Talmadge et al., Immunomodulatory effects in mice of
polyinosinic-polycytidylic acid complexed with poly-L-lysine and
carboxymethylcellulose. Cancer Res. Mar. 1985;45(3):1058-65. cited
by applicant .
Threadgill et al., Mitogenic synthetic polynucleotides suppress the
antibody response to a bacterial polysaccharide. Vaccine. Jan.
1998;16(1):76-82. cited by applicant .
Tokunaga et al., A synthetic single-stranded DNA, poly(dG,dC),
induces interferon-alpha/beta and -gamma, augments natural killer
activity, and suppresses tumor growth. Jpn J Cancer Res. Jun.
1988;79(6):682-6. cited by applicant .
Tortora et al., Oral antisense that targets protein kinase A
cooperates with taxol and inhibits tumor growth, angiogenesis, and
growth factor production. Clin Cancer Res. Jun. 2000;6(6):2506-12.
cited by applicant .
Valentine et al., Kinetics of formation of hypoxanthine containing
base pairs by HIV-RT: RNA template effects on the base substitution
frequencies. Nucleic Acids Res. 2001, 29(5): 1191-1199. cited by
applicant .
Verthelyi et al., Human peripheral blood cells differentially
recognize and respond to two distinct CPG motifs. J Immunol. Feb.
15, 2001;166(4):2372-7. cited by applicant .
Wagner et al., CpG motifs are efficient adjuvants for genetic
vaccines to induce antigen-specific protective anti-tumor T cell
responses. Immunobiology. 2000;203:429. Abstract R46. cited by
applicant .
Weeratna et al., CpG ODN can re-direct the Th bias of established
Th2 immune responses in adult and young mice. FEMS Immunol Med
Microbiol. Dec. 2001;32(1):65-71. cited by applicant .
Weiner et al., The immunobiology and clinical potential of
immunostimulatory CpG oligodeoxynucleotides. J Leukoc Biol. Oct.
2000;68(4):455-63. cited by applicant .
Yamamoto et al., Lipofection of synthetic oligodeoxyribonucleotide
having a palindromic sequence of AACGTT to murine splenocytes
enhances interferon production and natural killer activity.
Microbiol Immunol. 1994;38(10):831-6. cited by applicant .
Yamamoto et al., Unique palindromic sequences in
synthetic-oligonucleotides are required to induce IFN [correction
of INF] and augment IFN-mediated [correction of INF] natural killer
activity. J Immunol. Jun. 15, 1992;148(12):4072-6. cited by
applicant .
Yamamoto et al., Ability of oligonucleotides with certain
palindromes to induce interferon production and augment natural
killer cell activity is associated with their base length.
Antisense Res Dev. 1994 Summer;4(2):119-22. cited by applicant
.
Yamamoto et al., Synthetic oligonucleotides with certain
palindromes stimulate interferon production of human peripheral
blood lymphocytes in vitro. Jpn J Cancer Res. Aug.
1994;85(8):775-9. cited by applicant .
Yi et al. Rapid induction of mitogen-activated protein kinases by
immune stimulatory CpG DNA. J Immunol. Nov. 1, 1998;161(9):4493-7.
cited by applicant .
Yi et al. CpG oligodeoxyribonucleotides rescue mature spleen B
cells from spontaneous apoptosis and promote cell cycle entry. J
Immunol. Jun. 15, 1998;160(12):5898-906. cited by applicant .
Zhao et al., Pattern and kinetics of cytokine production following
administration of phosphorothioate oligonucleotides in mice.
Antisense Nucleic Acid Drug Dev. Oct. 1997;7(5):495-502. cited by
applicant .
Goldberg et al., Beyond danger: unmethylated CpG dinucleotides and
the immunopathogenesis of disease. Immunol Lett. Jul. 3,
2000;73(1):13-8. cited by applicant .
Hartmann et al., Rational design of new CpG oligonucleotides that
combine B cell activation with high IFN-alpha induction in
plasmacytoid dendritic cells. Eur J Immunol. Jun.
2003;33(6):1633-41. cited by applicant .
Krieg, Now I know my CpGs.Trends Microbiol. Jun. 2001;9(6):249-52.
cited by applicant .
Lee et al., Effects of a hexameric deoxyriboguanosine run
conjugation into CpG oligodeoxynucleotides on their
immunostimulatory potentials. J Immunol. Oct. 1,
2000;165(7):3631-9. cited by applicant .
Marshall et al., Identification of a novel CpG DNA class and motif
that optimally stimulate B cell and plasmacytoid dendritic cell
functions.J Leukoc Biol. Jun. 2003;73(6):781-92. cited by applicant
.
Mutwiri et al., Biological activity of immunostimulatory CpG DNA
motifs in domestic animals. Vet Immunol Immunopathol. Jan. 30,
2003;91(2):89-103. cited by applicant .
Scheule, The role of CpG motifs in immunostimulation and gene
therapy. Adv Drug Deliv Rev. Nov. 15, 2000;44(2-3):119-34. cited by
applicant .
Storey et al., Anti-sense phosphorothioate oligonucleotides have
both specific and non-specific effects on cells containing human
papillomavirus type 16. Nucleic Acids Res. Aug. 11,
1991;19(15):4109-14. cited by applicant .
Yamada et al., Effect of suppressive DNA on CpG-induced immune
activation. J Immunol. Nov. 15, 2002;169(10):5590-4. cited by
applicant .
Zhang et al., Antisense oligonucleotide inhibition of hepatitis C
virus (HCV) gene expression in livers of mice infected with an
HCV-vaccinia virus recombinant. Antimicrob Agents Chemother. Feb.
1999;43(2):347-53. cited by applicant .
Hanecak et al., Antisense oligonucleotide inhibition of hepatitis C
virus gene expression in transformed hepatocytes. J Virol. Aug.
1996;70(8):5203-12. cited by applicant .
Vollmer, TLR9 in health and disease. Int Rev Immunol. May-Aug.
2006;25(3-4):155-81. cited by applicant .
Vollmer et al., Identification of a new class of CpG
oligonucleotides capapble of inducing both B cell proliferation and
hihg IFN-alpha secretion from PBMC of HCV chronic carriers. Antiv
Ther. 2002;7:L115. cited by applicant.
|
Primary Examiner: Duffy; Patricia A
Attorney, Agent or Firm: Wolf, Greenfield & Sacks,
P.C.
Parent Case Text
RELATED APPLICATIONS
This application claims the benefit of priority of U.S. Provisional
Application Ser. Nos. 60/313,273, filed Aug. 17, 2001 and
60/393,952, filed Jul. 3, 2002, each of which is incorporated by
reference in its entirety.
Claims
We claim:
1. An isolated immunostimulatory nucleic acid of 14-100 nucleotides
in length having a sequence comprising the formula: 5'
PX.sub.1DCGHX.sub.2 3' or 5' X.sub.1DCGHX.sub.2P 3' wherein X.sub.1
and X.sub.2 are independently any sequence 0 to 10 nucleotides
long, D is a nucleotide other than C, C is unmethylated, H is a
nucleotide other than G, and P is a GC-rich palindrome containing
sequence at least 10 nucleotides long, wherein the
immunostimulatory nucleic acid has a completely nuclease-resistant
backbone such that each internucleotide linkage is modified,
wherein at least one of a), or b) is in the nucleic acid: a) P is
completely palindromic, H is T, and X.sub.2 is selected from the
group consisting of CG, CGT, CGTTT, and CGTTTT, wherein when P is
12 nucleotides X.sub.2 is not CGTTTT, b) P includes at least one
inosine.
2. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5'
X.sub.1DCGHX.sub.2PX.sub.3 3', wherein X.sub.3 is any sequence 0 to
10 nucleotides long.
3. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5' X.sub.1DCGHPX.sub.3 3',
wherein X.sub.3 is any sequence 0 to 10 nucleotides long.
4. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5' DCGHX.sub.2PX.sub.3 3',
wherein X.sub.3 is any sequence 0 to 10 nucleotides long.
5. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5' TCGHX.sub.2PX.sub.3 3',
wherein X.sub.3 is any sequence 0 to 10 nucleotides long.
6. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5' DCGHPX.sub.3 3',
wherein X.sub.3 is any sequence 0 to 10 nucleotides long.
7. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid comprises 5' DCGHP 3'.
8. The immunostimulatory nucleic acid of claim 1, wherein D is
T.
9. The immunostimulatory nucleic acid of claim 1, wherein H is
T.
10. The immunostimulatory nucleic acid of claim 1, wherein P is
completely palindromic, H is T, and X2 is selected from the group
consisting of CG, CGT, CGTTT, and CGTTTT.
11. The immunostimulatory nucleic acid of claim 10, wherein H is T
and X.sub.2 is CG.
12. The immunostimulatory nucleic acid of claim 1, wherein H is T
and X.sub.2 is CGTTT or CGTTTT.
13. An isolated immunostimulatory nucleic acid of 14-100
nucleotides in length having a sequence comprising the formula: 5'
PX.sub.1DCGHX.sub.2 3' or 5' X.sub.1DCGHX.sub.2P 3' wherein X.sub.1
and X.sub.2 are independently any sequence 0 to 10 nucleotides
long, D is a nucleotide other than C, C is unmethylated, H is a
nucleotide other than G, and P is a GC-rich palindrome containing
sequence at least 10 nucleotides long, the immunostimulatory
nucleic acid has a nuclease-resistant backbone and wherein: H is T
and X.sub.2 is selected from the group consisting of CG, CGT, CGTT,
CGTTT, and CGTTTT, and wherein P includes at least one inosine.
14. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid has a phosphorothioate backbone.
15. The immunostimulatory nucleic acid of claim 1, further
comprising a poly-T sequence at the 5' end.
16. The immunostimulatory nucleic acid of claim 1, further
comprising a poly-T sequence at the 3' end.
17. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid is 14-40 nucleotides in length.
18. The immunostimulatory nucleic acid of claim 1, wherein the
immunostimulatory nucleic acid is 14-30 nucleotides in length.
19. A pharmaceutical composition, comprising an immunostimulatory
nucleic acid of claim 1, and a pharmaceutically acceptable
carrier.
20. A vaccine composition of an isolated immunostimulatory nucleic
acid of 14-100 nucleotides in length having a sequence comprising
the formula: 5' NX.sub.1DCGHX.sub.2 3' or 5' X.sub.1DCGHX.sub.2N 3'
wherein X.sub.1 and X.sub.2 are independently any sequence 0 to 10
nucleotides long, D is a nucleotide other than C, C is
unmethylated, H is a nucleotide other than G, and N is a B-cell
neutralizing sequence, wherein N begins with CGG and is at least 10
nucleotides long, wherein: a) for 5' NX.sub.1DCGHX.sub.2 3' H is T
and X.sub.2 is selected from the group consisting of CG, CGT, CGTT,
CGTTT, and CGTTTT, b) for 5' X.sub.1DCGHX.sub.2N 3' H is T and
X.sub.2 is selected from the group consisting of CG, CGT, CGTT, and
CGTTT, and wherein the immunostimulatory nucleic acid has a fully
nuclease-resistant backbone, and an antigen.
21. The immunostimulatory nucleic acid of claim 20, wherein N
comprises at least four CG dinucleotides and no more than two CCG
trinucleotides.
22. The immunostimulatory nucleic acid of claim 20, wherein the
immunostimulatory nucleic acid has a phosphorothioate backbone.
23. The immunostimulatory nucleic acid of claim 20, further
comprising a poly-T sequence at the 5' end.
24. The immunostimulatory nucleic acid of claim 20, further
comprising a poly-T sequence at the 3' end.
25. The immunostimulatory nucleic acid of claim 20, wherein the
immunostimulatory nucleic acid is 14-40 nucleotides in length.
26. The immunostimulatory nucleic acid of claim 20, wherein the
immunostimulatory nucleic acid is 14-30 nucleotides in length.
27. A pharmaceutical composition, comprising an immunostimulatory
nucleic acid of claim 20, and a pharmaceutically acceptable
carrier.
28. An immunostimulatory nucleic, wherein the immunostimulatory
nucleic acid is TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO: 4).
Description
FIELD OF THE INVENTION
The present invention relates generally to immunostimulatory
nucleic acids, compositions thereof, and methods of using the
immunostimulatory nucleic acids.
BACKGROUND
Two main classes of immune stimulatory sequences are known in the
art which have differing profiles of immune stimulatory activity.
Krieg A M (2001) Trends Microbiol 9:249-52. These are so-called
class B CpG oligodeoxynucleotides (ODN), which are strong
activators of B cells, and class A CpG ODN, which are strong
activators of natural killer (NK) cells. In addition to these
immune stimulatory sequences, at least two classes of neutralizing
sequences are known, including CpG sequences in which the CG is
preceded by aC or followed by a G (Krieg A M et al. (1998) Proc
Natl Acad Sci USA 95:12631-12636), and DNA sequences in which the
CG is methylated. A neutralizing motif is a motif which has some
degree of immunostimulatory capability when present in an otherwise
non-stimulatory motif, but, which when present in the context of
other immunostimulatory motifs serves to reduce the
immunostimulatory potential of the other motifs.
SUMMARY OF THE INVENTION
A new class of immune stimulatory nucleic acids is provided herein.
In some instances these nucleic acids have a CG-rich palindrome or
CG-rich neutralizing motif. Applicants previously recognized and
described oligodeoxynucleotides (ODN) containing neutralizing
motifs consisting of repeats of the sequence CG such as CGCGCG or a
CG dinucleotide preceded by a C (i.e., CCG) and/or followed by a G
(i.e., CGG, CCGG). These neutralizing motifs were believed cause
some reduction in stimulatory effects of CpG containing ODN on
multiple readouts, such as secretion of IL-6, IL-12, IFN-.gamma.,
TNF-.alpha., and induction of an antigen-specific immune response.
Krieg A M et al. (1998) Proc Natl Acad Sci USA 95:12631-6.
The present invention is based in part on the surprising discovery
by the Applicants that certain ODN containing a combination of a
stimulating motif and a neutralizing motif are highly
immunostimulatory. The present invention is also based in part on
the surprising discovery by the Applicants that ODN having certain
CG-rich palindromic sequences, including palindromic sequences
containing neutralizing motifs, are highly immunostimulatory. The
neutralizing motif thus, may, but need not occur within the context
of a palindromic sequence to be highly immunostimulatory.
Furthermore, the immunostimulatory ODN of the instant invention
have immunostimulatory effects previously associated with both of
two distinct classes of CpG ODN, those that characteristically
activate B cells (class B CpG ODN) and those that
characteristically activate NK cells and induce production of
interferon (IFN)-.alpha. (class A CpG ODN). The novel
immunostimulatory ODN of the instant invention thus have a spectrum
of immunostimulatory effects distinct from either class A CpG ODN
or class B CpG ODN. The new class of immunostimulatory ODN of the
instant invention is referred to as type C CpG ODN. As described in
greater detail below, in certain embodiments the ODN of the present
invention involve a combination of motifs wherein one motif is a
CG-rich palindrome or a neutralizing motif, and another motif is a
stimulatory motif, e.g., a CpG motif or the sequence TCGTCG.
In some aspects an immunostimulatory nucleic acid of 14-100
nucleotides in length is provided. The nucleic acid has the
formula: 5' X.sub.1DCGHX.sub.2 3'. X.sub.1 and X.sub.2 are
independently any sequence 0 to 10 nucleotides long. D is a
nucleotide other than C. C is cytosine. G is guanine. H is a
nucleotide other than G. The nucleic acid sequence also includes a
nucleic acid sequence selected from the group consisting of P and N
positioned immediately 5' to X.sub.1 or immediately 3' to X.sub.2 N
is a B-cell neutralizing sequence which begins with a CGG
trinucleotide and is at least 10 nucleotides long. P is a GC-rich
palindrome containing sequence at least 10 nucleotides long.
In some embodiments the immunostimulatory nucleic acid is 5'
NX.sub.1DCGHX.sub.2 3', 5' X.sub.1DCGHX.sub.2N 3', 5'
PX.sub.1DCGHX.sub.2 3', 5' X.sub.1DCGHX.sub.2P 3', 5'
X.sub.1DCGHX.sub.2PX.sub.3 3', 5' X.sub.1DCGHPX.sub.3 3', 5'
DCGHX.sub.2PX.sub.3 3', 5' TCGHX.sub.2PX.sub.3 3', or 5'
DCGHPX.sub.3 3'. X.sub.3 is any sequence 0 to 10 nucleotides long.
In other embodiments the immunostimulatory nucleic acid is 5''
DCGHP 3'.
Optionally D and/or H are thymine (T).
In other embodiments H is T and X.sub.2 is CG, CGT, CGTT, CGTTT, or
CGTTTT.
H is T and X.sub.2 is CG or CGTTTT according to other
embodiments.
According to other embodiments C is unmethylated.
N includes at least four CG dinucleotides and no more than two CCG
trinucleotides in some embodiments.
Optionally P includes at least one Inosine.
The nucleic acid may also include a poly-T sequence at the 5' end
or the 3' end.
An immunostimulatory nucleic acid of 13-100 nucleotides in length
is provided according to other aspects of the invention. The
nucleic acid has the formula: 5' N.sub.1PyGN.sub.2P 3'. G is
guanine.
N.sub.1 is any sequence 1 to 6 nucleotides long. In some
embodiments N.sub.1 is at least 50% pyrimidines and preferably at
least 50% T. In other embodiments N.sub.1 includes at least one CG
motif, at least one TCG motif, at least one CT motif, at least one
TCI motif, at least one IG motif, or at least one TIG motif.
N.sub.1 is TCGG or TCGH in other embodiments. H is a nucleotide
other than G.
Py is a pyrimidine. In some embodiments Py is an unmethylated
C.
N.sub.2 is any sequence 0 to 30 nucleotides long. In some
embodiments N.sub.2 is at least 50% pyrimidines or is at least 50%
T. In other embodiments N.sub.2 does not includes any poly G or
poly A motifs.
P is a GC-rich palindrome containing sequence at least 10
nucleotides long. In some embodiments P is completely palindromic.
In other embodiments P is a palindrome having between 1 and 3
consecutive intervening nucleotides. Optionally the intervening
nucleotides may be TG. In other embodiments P includes at least 3,
4, or 5 C and at least 3, 4, or 5 G nucleotides. According to other
embodiments P includes at least one Inosine.
In one embodiment the GC-rich palindrome has a base content of at
least two-thirds G and C. In another embodiment the GC-rich
palindrome has a base content of at least 81 percent G and C. In
some embodiments the GC-rich palindrome is at least 12 nucleotides
long. The GC-rich palindrome may be made up exclusively of C and G.
In some embodiments the GC-rich palindrome can include at least one
nucleotide that is neither C nor G.
In some embodiments the GC-rich palindrome includes at least one
CGG trimer, at least one CCG trimer, or at least one CGCG tetramer.
In some embodiments the GC-rich palindrome includes at least four
CG dinucleotides. In certain preferred embodiments the GC-rich
palindrome has a central CG dinucleotide.
In certain embodiments the GC-rich palindrome is CGGCGCGCGCCG (SEQ
ID NO: 23), CGGCGGCCGCCG (SEQ ID NO: 28), CGACGATCGTCG (SEQ ID NO:
68) or CGACGTACGTCG (SEQ ID NO: 69).
In certain embodiments the GC-rich palindrome is not CGCGCGCGCGCG
(SEQ ID NO: 29), GCGCGCGCGCGC (SEQ ID NO: 30), CCCCCCGGGGGG (SEQ ID
NO: 31), GGGGGGCCCCCC (SEQ ID NO: 32), CCCCCGGGGG (SEQ ID NO: 33)
or GGGGGCCCCC (SEQ ID NO: 34).
In some embodiments N.sub.1PyGN.sub.2 is a sequence selected from
the group consisting of TTTTTCG, TCG, TTCG, TTTCG, TTTTCG, TCGT,
TTCGT, TTTCGT, and TCGTCGT.
An immunostimulatory nucleic acid of 13-100 nucleotides in length
is provided according to other aspects of the invention. The
nucleic acid has the formula: 5' N.sub.1PyG/IN.sub.2P 3'. G/I
refers to single nucleotide which is either a G or an I. G is
guanine and I is Inosine.
N.sub.1 is any sequence 1 to 6 nucleotides long. Py is a
pyrimidine. N.sub.2 is any sequence 0 to 30 nucleotides long.
P is a palindrome containing sequence at least 10 nucleotides long.
In some embodiments P is a GC-rich palindrome. In other embodiments
P is an IC-rich palindrome.
N.sub.1PyIN.sub.2 in some embodiments is TCITCITTTT (SEQ ID NO:
47).
The nucleic acid molecules described herein may have any type of
backbone composition. In some embodiments the immunostimulatory
nucleic acid has a completely nuclease-resistant backbone. The
nuclease-resistant backbone may be composed of phosphorothioate
linkages. In other embodiments the immunostimulatory nucleic acid
has a completely phosphodiester backbone. In yet other embodiments
the immunostimulatory nucleic acid has a chimeric backbone. In one
embodiment the immunostimulatory nucleic acid has at least one
phosphodiester linkage between a CG, CI or a IG motif.
Alternatively, the ODN of the instant invention are formulated with
microparticles, emulsions, or other means to avoid rapid digestion
in vivo.
The immunostimulatory nucleic acid molecules described herein have
a variety of lengths. In some embodiments the immunostimulatory
nucleic acid is 13-100, 13-40, 13-30, 14-100, 14-40, or 14-30
nucleotides in length or any integer therebetween.
An immunostimulatory nucleic acid having one of the following
sequences is also provided: TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO: 1),
TCGTCGTTTTCGGCGGCCGCCG (SEQ ID NO: 4), TCGTCGTTTTCGGCGCGCCGCG (SEQ
ID NO: 5), TCGTCGTTTTCGGCGCCGGCCG (SEQ ID NO: 6),
TCGTCGTTTTCGGCCCGCGCGG (SEQ ID NO: 7), TCGTCGTTTTCGGCGCGCGCCGTTTTT
(SEQ ID NO: 12), TCCTGACGTTCGGCGCGCGCCG (SEQ ID NO: 13),
TZGTZGTTTTZGGZGZGZGZZG (SEQ ID NO: 14), wherein Z is
5-methylcytosine, TCCTGACGTTCGGCGCGCGCCC (SEQ ID NO: 19),
TCGGCGCGCGCCGTCGTCGTTT (SEQ ID NO: 11), TCCTGACGTTCGGCGCGCGCCC (ODN
2136, SEQ ID NO: 19), TCGTCGTTTTCGGCGGCCGACG (ODN 5513, SEQ ID NO:
64), TCGTCGTTTTCGTCGGCCGCCG (ODN 5514, SEQ ID NO: 65),
TCGTCGTTTTCGACGGCCGCCG (ODN 5515, SEQ ID NO: 66), and
TCGTCGTTTTCGGCGGCCGTCG (ODN 5516, SEQ ID NO: 67).
Further according to other embodiments of the invention the
immunostimulatory nucleic acid is one of the following sequences:
TCGTCGTTTTCGGCGCGCGCCG (ODN 2395), TCGTCGTTTTCGGCGGCCGCCG (ODN
2429), TCGTCGTTTTCGGCGCGCCGCG (ODN 2430), TCGTCGTTTTCGGCGCCGGCCG
(ODN 2431), TCGTCGTTTTCGGCCCGCGCGG (ODN 2432),
TCGTCGTTTTCGGCGCGCGCCGTTTTT (ODN 2452), TCCTGACGTTCGGCGCGCGCCG (ODN
5315), TZGTZGTTTTZGGZGZGZGZZG (ODN 5327, wherein Z is
5-methylcytosine), TCCTGACGTTCGGCGCGCGCCC (ODN 2136),
TCGTCGTTTTCGGCGGCCGACG (ODN 5513), TCGTCGTTTTCGTCGGCCGCCG (ODN
5514), TCGTCGTTTTCGACGGCCGCCG (ODN 5515), TCGTCGTTTTCGGCGGCCGTCG
(ODN 5516), TCGTCGTTTTCGGCGCGCGCCG (ODN 2395),
TCGTCGTTTTCGGCGGCCGCCG (ODN 2429), TCGTCGTTTTCGGCGCGCCGCG (ODN
2430), TCGTCGTTTTCGGCGCCGGCCG (ODN 2431), TCGTCGTTTTCGGCCCGCGCGG
(ODN 2432), TCGTCGTTTTCGGCGCGCGCCGTTTTT (ODN 2452),
TCCTGACGTTCGGCGCGCGCCG (ODN 5315), TZGTZGTTTTZGGZGZGZGZZG (ODN
5327, wherein Z is 5-methylcytosine), TCCTGACGTTCGGCGCGCGCCC (ODN
2136), TCGTCGTTTTCGGCGGCCGACG (ODN 5513), TCGTCGTTTTCGTCGGCCGCCG
(ODN 5514), TCGTCGTTTTCGACGGCCGCCG (ODN 5515),
TCGTCGTTTTCGGCGGCCGTCG (ODN 5516), TCGGCGCGCGCCGTCGTCGTTT (ODN
2451), TCGTCGTTTCGACGGCCGTCG (ODN 20173, SEQ ID NO: 71),
TCGTCGTTTCGACGATCGTCG (ODN 20176, SEQ ID NO: 72),
TCGTCGTTTCGACGTACGTCG (ODN 20177, SEQ ID NO: 73),
TCGTCGCGACGGCCGTCG (ODN 20178, SEQ ID NO: 74), TCGTCGCGACGATCGTCG
(ODN 20179, SEQ ID NO: 75), TCGTCGCGACGTACGTCG (ODN 20180, SEQ ID
NO: 76), TCGTTTTTTTCGACGGCCGTCG (ODN 20184, SEQ ID NO: 77),
TCGTTTTTTTCGACGATCGTCG (ODN 20185, SEQ ID NO: 78), and
TCGTTTTTTTCGACGTACGTCG (ODN 20186, SEQ ID NO: 79).
According to certain embodiments the immunostimulatory nucleic acid
includes the sequence TCGGCGCGCGCCGTCGTCGTTT (ODN 2451, SEQ ID NO:
11). In certain embodiments the immunostimulatory nucleic acid is
the sequence TCGGCGCGCGCCGTCGTCGTTT (ODN 2451).
A pharmaceutical composition, comprising the immunostimulatory
nucleic acids described herein and a pharmaceutically acceptable
carrier is provided according to other aspects of the
invention.
In other aspects of the invention a method for inducing type 1
interferon (IFN) expression is provided. The method involves
contacting a cell capable of expressing type 1 IFN with an
effective amount of an immunostimulatory nucleic acid described
herein to induce expression of type 1 IFN.
The invention in other aspects is a method for activating a natural
killer (NK) cell. The method involves contacting an NK cell with an
effective amount of an immunostimulatory nucleic acid described
herein to activate the NK cell.
In yet other aspects the invention is a method for treating
infection by administering to a subject having or at risk of
developing an infection an effective amount of an immunostimulatory
nucleic acid described herein, to treat or prevent the infection.
In some embodiments the subject has or is at risk of developing an
infection selected from the group consisting of a viral, bacterial,
fungal and parasitic infection.
In certain embodiments the method involves administering an
immunostimulatory nucleic acid of the invention alone to treat or
prevent the infection. In certain embodiments the method according
to this aspect of the invention further includes administering to
the subject an antibiotic agent, which may be an antibacterial
agent, an antiviral agent, an antifungal agent, or an antiparasitic
agent.
In other aspects the invention is a method for treating an allergic
condition by administering to a subject having or at risk of
developing an allergic condition an effective amount of an
immunostimulatory nucleic acid described herein, to treat or
prevent the allergic condition. In some embodiments the allergic
condition is allergic asthma. In one embodiment the allergic
condition is asthma. In certain embodiments the method involves
administering an immunostimulatory nucleic acid of the invention
alone to treat or prevent the allergic condition. In certain
embodiments the method according to this aspect of the invention
further includes administering to the subject an asthma/allergy
medicament e.g., steroids, antihistamines, and prostaglandin
inducers.
A method for treating cancer is provided according to other aspects
of the invention. The method involves administering to a subject
having or at risk of developing a cancer an effective amount of an
immunostimulatory nucleic acid described herein, to treat or
prevent the cancer. In some embodiments the cancer is selected from
the group consisting of basal cell carcinoma, biliary tract cancer;
bladder cancer; bone cancer; brain and CNS cancer; breast cancer;
cervical cancer; choriocarcinoma; colon and rectum cancer;
connective tissue cancer; cancer of the digestive system;
endometrial cancer; esophageal cancer; eye cancer; cancer of the
head and neck; gastric cancer; intra-epithelial neoplasm; kidney
cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g.
small cell and non-small cell); lymphoma including Hodgkin's and
Non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral
cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian
cancer; pancreatic cancer; prostate cancer; retinoblastoma;
rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the
respiratory system; sarcoma; skin cancer; stomach cancer;
testicular cancer; thyroid cancer; uterine cancer; cancer of the
urinary system, and other carcinomas and sarcomas
In certain embodiments the method involves administering an
immunostimulatory nucleic acid of the invention alone to treat the
cancer. In certain embodiments the method according to this aspect
of the invention further includes administering to the subject an
anti-cancer medicament or treatment e.g., chemotherapeutic agents,
radiation.
Each of the limitations of the invention can encompass various
embodiments of the invention. It is, therefore, anticipated that
each of the limitations of the invention involving any one element
or combinations of elements can be included in each aspect of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The following figures are provided for illustrative purposes only
and are not required for understanding or practicing the
invention.
FIG. 1 is a bar graph depicting amounts of IFN-.alpha. (pg/ml)
induced in human PBMCs after 24 hours of culture alone, with IL-2,
or in the presence of the indicated ODN at the indicated
concentrations.
FIG. 2 is a bar graph depicting amounts of MCP-1 (pg/ml) induced in
human PBMCs after 24 hours of culture alone, with IL-2, or in the
presence of the indicated ODN at the indicated concentrations.
FIG. 3 is a bar graph depicting amounts of IP-10 (pg/ml) induced in
human PBMCs after 24 hours of culture alone, with IL-2, or in the
presence of the indicated ODN at the indicated concentrations.
FIG. 4 is a bar graph depicting amounts of IFN-.alpha. (pg/ml)
induced in human PBMCs after 48 hours of culture alone (N/A) or in
the presence of the indicated ODN at 1.0 .mu.g/ml.
FIG. 5 is a pair of bar graphs depicting surface staining on B
cells for CD86 (MFI) after 48 hours of culture alone (N/A) or in
the presence of the indicated ODN at 0.25 .mu.g/ml (panel A) or 1.0
.mu.g/ml (panel B).
FIG. 6 is a pair of bar graphs depicting results of a 72 hour B
cell proliferation assay (cpm .sup.3H-thymidine incorporation)
alone (N/A) or in the presence of the indicated ODN at 0.25
.mu.g/ml (panel A) or 1.0 .mu.g/ml (panel B).
FIG. 7 is a pair of bar graphs depicting amounts of IL-10 (pg/ml)
induced in human PBMCs after 24 hours of culture either alone (N/A)
or in the presence of the indicated ODN at 0.25 .mu.g/ml (panel A)
or 1.0 .mu.g/ml (panel B).
FIG. 8 is a bar graph depicting amounts of IFN-.alpha. (pg/ml)
induced in PBMC from two donors (D127, solid bars, and D124, open
bars) following 24 hours of culture alone (w/o) or in the presence
of the indicated ODN at the indicated concentrations (1 or 6
.mu.g/ml).
FIG. 9 is a bar graph depicting B cell activation as measured by
percent CD86-positive cells in human PBMC cultured for 24 hours
alone (w/o) or in the presence of the indicated ODN at the
indicated concentrations (0.4, 1.0, or 10.0 .mu.g/ml).
FIG. 10 is a bar graph depicting the amount of IFN-.alpha. (pg/ml)
secreted by PBMC from two donors (D141, open bars, and D142, solid
bars) following 24 hours of culture alone (w/o) or in the presence
of the indicated ODN at the indicated concentrations (1 or 6
.mu.g/ml).
FIG. 11 is a bar graph depicting the amount of IFN-.alpha. (pg/ml)
secreted by PBMC from two donors (D141, open bars, and D142, solid
bars) following 48 hours of culture alone (w/o) or in the presence
of the indicated ODN at the indicated concentrations (1 or 6
.mu.g/ml).
FIG. 12 is a bar graph depicting the amount of IFN-.alpha. (pg/ml)
secreted by PBMC from two donors (D141, shaded bars, and D142, open
bars) following 24 hours of culture alone (w/o) or in the presence
of the indicated ODN at 6 .mu.g/ml.
FIG. 13 is a series of three bar graphs depicting the amount of
IFN-.gamma. (pg/ml) secreted by PBMC following 24 hours of culture
alone (n/a) or in the presence of the indicated ODN at the
indicated concentrations (1, 3 or 10 .mu.g/ml in panels A, B, and
C, respectively).
FIG. 14 is a bar graph depicting the percentage of CD3+ cells
staining positive for IFN-.gamma. following 48 hours of culture
alone (NA) or in the presence of the indicated ODN.
FIG. 15 is a bar graph depicting the mean fluorescence intensity
(MFI) of IFN-.gamma. staining in T cells following 48 hours of
culture alone (NA) or in the presence of the indicated ODN.
FIG. 16 is a bar graph depicting the amount of IFN-.alpha. (pg/ml)
secreted by human PBMC following 24 hours of culture alone (N/A) or
in the presence of the indicated ODN at 1.0 .mu.g/ml.
FIG. 17 is a pair of bar graphs depicting the amount of IFN-.alpha.
(pg/ml) secreted by human PBMC following 24 or 48 hour culture
alone (w/o) or in the presence of the indicated ODN at the
indicated concentration (1 or 6 .mu.g/ml). Panel A depicts results
for PBMC pooled from two donors. Panel B depicts results for PBMC
obtained from two donors (D141 and D142).
FIG. 18 is a bar graph depicting the percent CD86-positive B cells
following 24 hours of culture alone (w/o) or in the presence of the
indicated ODN at the indicated concentrations (0.4 and 1.0
.mu.g/ml).
FIG. 19 is a series of three bar graphs depicting the concentration
of IFN-.gamma. (pg/ml) in culture supernatants of human PBMC after
incubation alone (w/o), with LPS, or with the indicated ODN at the
indicated concentrations (0.2 to 1.0 .mu.g/ml) for 6 hours (panel
A), 24 hours (panel B), or 48 hours (panel C).
FIG. 20 is a bar graph depicting the amount IFN-.gamma. (pg/ml)
generated in a two-way mixed lymphocyte reaction (MLR) in which
lymphocytes obtained from two donors were cultured for 24 hours
alone (w/o) or in the presence of the indicated ODN at 6 .mu.g/ml
and then mixed.
FIG. 21 is a series of three bar graphs depicting the concentration
of IL-10 (pg/ml) in culture supernatants of human PBMC after
incubation alone (w/o), with LPS, or with the indicated ODN at the
indicated concentrations (0.2 to 1.0 .mu.g/ml) for 6 hours (panel
A), 24 hours (panel B), or 48 hours (panel C).
FIG. 22 is a bar graph depicting the amounts of IP-10 (pg/ml) in
PBMC supernatants after 24 hours of incubation alone (n/a) or in
the presence of controls (IL-2, ODN 1585 (GGGGTCAACGTTGAGGGGGG, SEQ
ID NO: 35) and ODN 2118 (GGGGTCAAGCTTGAGGGGGG, SEQ ID NO: 36)) or
various indicated ODN at either 0.6 .mu.g/ml (open bars) or 3.0
.mu.g/ml (solid bars).
FIG. 23 is a pair of bar graphs depicting the amounts of
IFN-.alpha. (pg/ml) in PBMC supernatants after 24 hours of
incubation alone (n/a) or in the presence of controls (IL-2, ODN
1585, and ODN 2118) or various indicated ODN at either 0.6 .mu.g/ml
(panel A) or 3.0 .mu.g/ml (panel B).
FIG. 24 is a bar graph depicting the amounts of IFN-.gamma. (pg/ml)
in PBMC supernatants after 24 hours of incubation alone (n/a) or in
the presence of controls (IL-2, ODN 1585, and ODN 2118) or various
indicated ODN at either 0.6 .mu.g/ml (open bars) or 3.0 .mu.g/ml
(filled bars).
FIG. 25 is a bar graph depicting the amounts of IL-6 (pg/ml) in
PBMC supernatants after 24 hours of incubation alone (n/a) or in
the presence of controls (IL-2, ODN 1585, and ODN 2118) or various
indicated ODN at either 0.6 .mu.g/ml (open bars) or 3.0 .mu.g/ml
(filled bars).
FIG. 26 is a bar graph depicting amounts of IFN-.alpha. secretion
(pg/ml) by PBMC following 24 hours of culture alone (w/o) or in the
presence of the indicated ODN at the indicated concentrations (3.0
and 6.0 .mu.g/ml).
DETAILED DESCRIPTION OF THE INVENTION
It has been discovered that certain oligodeoxynucleotides (ODN),
which contain at least two distinct motifs have unique and
desirable stimulatory effects on cells of the immune system. Some
of these ODN have both a traditional "stimulatory" CpG sequence and
a "GC-rich" or "B-cell neutralizing" motif. These combination motif
nucleic acids have immune stimulating effects that fall somewhere
between those effects associated with traditional "class B" CpG
ODN, which are strong inducers of B cell activation and dendritic
cell (DC) activation, and those effects associated with a more
recently described class of immune stimulatory nucleic acids
("class A" CpG ODN) which are strong inducers of IFN-.alpha. and
natural killer (NK) cell activation but relatively poor inducers of
B-cell and DC activation. Krieg A M et al. (1995) Nature 374:546-9;
Ballas Z K et al. (1996) J Immunol 157:1840-5; Yamamoto S et al.
(1992) J Immunol 148:4072-6. While preferred class B CpG ODN often
have phosphorothioate backbones and preferred class A CpG ODN have
mixed or chimeric backbones, the new class of combination motif
immune stimulatory nucleic acids may have either stabilized, e.g.,
phosphorothioate, chimeric, or phosphodiester backbones.
In one aspect the invention provides immune stimulatory nucleic
acids belonging to this new class of combination motif
immune-stimulatory nucleic acids. The B cell stimulatory domain is
defined by a formula: 5' X.sub.1DCGHX.sub.2 3'. D is a nucleotide
other than C. C is cytosine. G is guanine. H is a nucleotide other
than G.
X.sub.1 and X.sub.2 are any nucleic acid sequence 0 to 10
nucleotides long. X.sub.1 may include a CG, in which case there is
preferably a T immediately preceding this CG. In some embodiments
DCG is TCG. X.sub.1 is preferably from 0 to 6 nucleotides in
length. In some embodiments X.sub.2 does not contain any poly G or
poly A motifs. In other embodiments the immunostimulatory nucleic
acid has a poly-T sequence at the 5' end or at the 3' end. As used
herein, "poly-A" or "poly-T" shall refer to a stretch of four or
more consecutive A's or T's respectively, e.g., 5' AAAA 3' or 5'
TTTT 3'.
As used herein, "poly-G end" shall refer to a stretch of four or
more consecutive G's, e.g., 5' GGGG 3', occurring at the 5' end or
the 3' end of a nucleic acid. As used herein, "poly-G nucleic acid"
shall refer to a nucleic acid having the formula 5'
X.sub.1X.sub.2GGGX.sub.3X.sub.4 3' wherein X.sub.1, X.sub.2,
X.sub.3, and X.sub.4 are nucleotides and preferably at least one of
X.sub.3 and X.sub.4 is a G.
Some preferred designs for the B cell stimulatory domain under this
formula comprise TTTTTCG, TCG, TTCG, TTTCG, TTTTCG, TCGT, TTCGT,
TTTCGT, TCGTCGT.
The second motif of the nucleic acid is referred to as either P or
N and is positioned immediately 5' to X.sub.1 or immediately 3' to
X.sub.2.
N is a B-cell neutralizing sequence that begins with a CGG
trinucleotide and is at least 10 nucleotides long. A B-cell
neutralizing motif includes at least one CpG sequence in which the
CG is preceded by a C or followed by a G (Krieg A M et al. (1998)
Proc Natl Acad Sci USA 95:12631-12636) or is a CG containing DNA
sequence in which the C of the CG is methylated. As used herein,
"CpG" shall refer to a 5' cytosine (C) followed by a 3' guanine (G)
and linked by a phosphate bond. At least the C of the 5' CG 3' must
be unmethylated. Neutralizing motifs are motifs which has some
degree of immunostimulatory capability when present in an otherwise
non-stimulatory motif, but, which when present in the context of
other immunostimulatory motifs serve to reduce the
immunostimulatory potential of the other motifs.
P is a GC-rich palindrome containing sequence at least 10
nucleotides long. As used herein, "palindrome" and, equivalently,
"palindromic sequence" shall refer to an inverted repeat, i.e., a
sequence such as ABCDEE'D'C'B'A' in which A and A', B and B', etc.,
are bases capable of forming the usual Watson-Crick base pairs.
As used herein, "GC-rich palindrome" shall refer to a palindrome
having a base composition of at least two-thirds G's and C's. In
some embodiments the GC-rich domain is preferably 3' to the "B cell
stimulatory domain". In the case of a 10-base long GC-rich
palindrome, the palindrome thus contains at least 8 G's and C's. In
the case of a 12-base long GC-rich palindrome, the palindrome also
contains at least 8 G's and C's. In the case of a 14-mer GC-rich
palindrome, at least ten bases of the palindrome are G's and C's.
In some embodiments the GC-rich palindrome is made up exclusively
of G's and C's.
In some embodiments the GC-rich palindrome has a base composition
of at least 81 percent G's and C's. In the case of such a 10-base
long GC-rich palindrome, the palindrome thus is made exclusively of
G's and C's. In the case of such a 12-base long GC-rich palindrome,
it is preferred that at least ten bases (83 percent) of the
palindrome are G's and C's. In some preferred embodiments, a
12-base long GC-rich palindrome is made exclusively of G's and C's.
In the case of a 14-mer GC-rich palindrome, at least twelve bases
(86 percent) of the palindrome are G's and C's. In some preferred
embodiments, a 14-base long GC-rich palindrome is made exclusively
of G's and C's. The C's of a GC-rich palindrome can be unmethylated
or they can be methylated.
In general this domain has at least 3 Cs and Gs, more preferably 4
of each, and most preferably 5 or more of each. The number of Cs
and Gs in this domain need not be identical. It is preferred that
the Cs and Gs are arranged so that they are able to form a
self-complementary duplex, or palindrome, such as CCGCGCGG. This
may be interrupted by As or Ts, but it is preferred that the
self-complementarity is at least partially preserved as for example
in the motifs CGACGTTCGTCG (SEQ ID NO: 80) or CGGCGCCGTGCCG (SEQ ID
NO: 81). When complementarity is not preserved, it is preferred
that the non-complementary base pairs be TG. In a preferred
embodiment there are no more than 3 consecutive bases that are not
part of the palindrome, preferably no more than 2, and most
preferably only 1. In some embodiments the GC-rich palindrome
includes at least one CGG trimer, at least one CCG trimer, or at
least one CGCG tetramer. In other embodiments the GC-rich
palindrome is not CCCCCCGGGGGG (SEQ ID NO: 31) or GGGGGGCCCCCC (SEQ
ID NO: 32), CCCCCGGGGG (SEQ ID NO: 33) or GGGGGCCCCC (SEQ ID NO:
34).
At least one of the G's of the GC rich region may be substituted
with an inosine (I). In some embodiments P includes more than one
I.
In certain embodiments the immunostimulatory nucleic acid has one
of the following formulas 5' NX.sub.1DCGHX.sub.2 3', 5'
X.sub.1DCGHX.sub.2N 3', 5' PX.sub.1DCGHX.sub.2 3', 5'
X.sub.1DCGHX.sub.2P 3', 5' X.sub.1DCGHX.sub.2PX.sub.3 3', 5'
X.sub.1DCGHPX.sub.3 3', 5' DCGHX.sub.2PX.sub.3 3', 5'
TCGHX.sub.2PX.sub.3 3', 5' DCGHPX.sub.3 3', or 5' DCGHP 3'.
In other aspects the invention provides immune stimulatory nucleic
acids which are defined by a formula: 5' N.sub.1PyGN.sub.2P 3'.
N.sub.1 is any sequence 1 to 6 nucleotides long. Py is a
pyrimidine. G is guanine. N.sub.2 is any sequence 0 to 30
nucleotides long. P is a GC-rich palindrome containing sequence at
least 10 nucleotides long.
N.sub.1 and N.sub.2 may contain more than 50% pyrimidines, and more
preferably more than 50% T. N.sub.1 may include a CG, in which case
there is preferably a T immediately preceding this CG. In some
embodiments N.sub.1PyG is TCG (such as ODN 5376, which has a 5'
TCGG), and most preferably a TCGN.sub.2, where N.sub.2 is not
G.
N.sub.1PyGN.sub.2P may include one or more inosine (I) nucleotides.
Either the C or the G in N1 may be replaced by inosine, but the CpI
is preferred to the IpG. For inosine substitutions such as IpG, the
optimal activity may be achieved with the use of a "semi-soft" or
chimeric backbone, where the linkage between the IG or the CI is
phosphodiester. N.sub.1 may include at least one CI, TCI, IG or TIG
motif.
In certain embodiments N.sub.1PyGN.sub.2 is a sequence selected
from the group consisting of TTTTTCG, TCG, TTCG, TTTCG, TTTTCG,
TCGT, TTCGT, TTTCGT, and TCGTCGT.
In other aspects the invention provides immune stimulatory nucleic
acids which are defined by a formula: 5' N.sub.1PyG/IN.sub.2P 3'.
N.sub.1 is any sequence 1 to 6 nucleotides long. Py is a
pyrimidine, G/I refers to single nucleotide which is either a G or
an I. G is guanine and I is inosine. N.sub.2 is any sequence 0 to
30 nucleotides long. P is a GC or IC rich palindrome containing
sequence at least 10 nucleotides long. In some embodiments
N.sub.1PyIN.sub.2 is TCITCITTTT (SEQ ID NO: 47).
Some non-limiting examples of combination motif immune stimulatory
nucleic acids, which are described by the formulas above, include
the following: TCGTCGTTTTCGGCGCGCGCCG (ODN 2395),
TCGTCGTTTTCGGCGGCCGCCG (ODN 2429), TCGTCGTTTTCGGCGCGCCGCG (ODN
2430), TCGTCGTTTTCGGCGCCGGCCG (ODN 2431), TCGTCGTTTTCGGCCCGCGCGG
(ODN 2432), TCGTCGTTTTCGGCGCGCGCCGTTTTT (ODN 2452),
TCCTGACGTTCGGCGCGCGCCG (ODN 5315), TZGTZGTTTTZGGZGZGZGZZG (ODN
5327, wherein Z is 5-methylcytosine), TCCTGACGTTCGGCGCGCGCCC (ODN
2136), TCGTCGTTTTCGGCGGCCGACG (ODN 5513), TCGTCGTTTTCGTCGGCCGCCG
(ODN 5514), TCGTCGTTTTCGACGGCCGCCG (ODN 5515),
TCGTCGTTTTCGGCGGCCGTCG (ODN 5516), TCGGCGCGCGCCGTCGTCGTTT (ODN
2451), TCGTCGTTTCGACGGCCGTCG (ODN 20173), TCGTCGTTTCGACGATCGTCG
(ODN 20176), TCGTCGTTTCGACGTACGTCG (ODN 20177), TCGTCGCGACGGCCGTCG
(ODN 20178), TCGTCGCGACGATCGTCG (ODN 20179), TCGTCGCGACGTACGTCG
(ODN 20180), TCGTTTTTTTCGACGGCCGTCG (ODN 20184),
TCGTTTTTTTCGACGATCGTCG (ODN 20185), TCGTTTTTTTCGACGTACGTCG (ODN
20186), TIGTIGTTTTCGGCGGCCGCCG (ODN 5569, SEQ ID NO: 63), and
TCITCITTTTCGGCGGCCGCCG (ODN 5570, SEQ ID NO: 70).
As used herein, "nucleic acid" and "oligonucleotide" are used
interchangeably and shall refer to mean multiple nucleotides (i.e.,
molecules comprising a sugar (e.g., ribose or deoxyribose) linked
to a phosphate group and to an exchangeable organic base, which is
either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or
uracil (U)) or a substituted purine (e.g., adenine (A) or guanine
(G)). As used herein, the terms refer to oligoribonucleotides as
well as oligodeoxyribonucleotides (ODN). The terms shall also
include polynucleosides (i.e., a polynucleotide minus the
phosphate) and any other organic base containing polymer. Nucleic
acid molecules can be obtained from existing nucleic acid sources
(e.g., genomic or cDNA), but are preferably synthetic (e.g.,
produced by nucleic acid synthesis).
The terms nucleic acid and oligonucleotide also encompass nucleic
acids or oligonucleotides with substitutions or modifications, such
as in the bases and/or sugars. For example, they include nucleic
acids having backbone sugars which are covalently attached to low
molecular weight organic groups other than a hydroxyl group at the
3' position and other than a phosphate group at the 5' position.
Thus modified nucleic acids may include a 2'-O-alkylated ribose
group. In addition, modified nucleic acids may include sugars such
as arabinose instead of ribose. Thus the nucleic acids may be
heterogeneous in backbone composition thereby containing any
possible combination of polymer units linked together such as
peptide-ucleic acids (which have amino acid backbone with nucleic
acid bases). In some embodiments, the nucleic acids are homogeneous
in backbone composition. Nucleic acids also include substituted
purines and pyrimidines such as C-5 propyne modified bases. Wagner
R W et al. (1996) Nat Biotechnol 14:840-4. Purines and pyrimidines
include but are not limited to adenine, cytosine, guanine,
thymidine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine,
2,6-diaminopurine, hypoxanthine, and other naturally and
non-naturally occurring nucleobases, substituted and unsubstituted
aromatic moieties. Other such modifications are well known to those
of skill in the art.
The immunostimulatory oligonucleotides of the instant invention can
encompass various chemical modifications and substitutions, in
comparison to natural RNA and DNA, involving a phosphodiester
internucleoside bridge, a .beta.-D-ribose unit and/or a natural
nucleoside base (adenine, guanine, cytosine, thymine, uracil).
Examples of chemical modifications are known to the skilled person
and are described, for example, in Uhlmann E et al. (1990) Chem Rev
90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and
Properties & Synthesis and Analytical Techniques, S. Agrawal,
Ed, Humana Press, Totowa, USA 1993; Crooke S T et al. (1996) Annu
Rev Pharmacol Toxicol 36:107-129; and Hunziker Jet al. (1995) Mod
Synth Methods 7:331-417. An oligonucleotide according to the
invention can have one or more modifications, wherein each
modification is located at the a particular phosphodiester
internucleoside bridge and/or at a particular .beta.-D-ribose unit
and/or at a particular natural nucleoside base position in
comparison to an oligonucleotide of the same sequence which is
composed of natural DNA or RNA.
For example, the invention relates to an oligonucleotide which
comprises one or more modifications and wherein each modification
is independently selected from: a) the replacement of a sugar
phosphate unit from the sugar phosphate backbone by another unit,
b) the replacement of a .beta.-D-ribose unit by a modified sugar
unit, and c) the replacement of a natural nucleoside base by a
modified nucleoside base.
More detailed examples for the chemical modification of an
oligonucleotide are as follows.
A sugar phosphate unit (i.e., a .beta.-D-ribose and phosphodiester
internucleoside bridge together forming a sugar phosphate unit)
from the sugar phosphate backbone (i.e., a sugar phosphate backbone
is composed of sugar phosphate units) can be replaced by another
unit, wherein the other unit is for example suitable to build up a
"morpholino-derivative" oligomer (as described, for example, in
Stirchak E P et al. (1989) Nucleic Acids Res 17:6129-41), that is,
e.g., the replacement by a morpholino-derivative unit; or to build
up a polyamide nucleic acid ("PNA"; as described for example, in
Nielsen P E et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., the
replacement by a PNA backbone unit, e.g., by
2-aminoethylglycine.
A .beta.-ribose unit or a .beta.-D-2'-deoxyribose unit can be
replaced by a modified sugar unit, wherein the modified sugar unit
is for example selected from .beta.-D-ribose,
.alpha.-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose,
2'-O--(C.sub.1-C.sub.6)alkyl-ribose, preferably
2'-O--(C.sub.1-C.sub.6)alkyl-ribose is 2'-O-methylribose,
2'-O--(C.sub.2-C.sub.6)alkenyl-ribose,
2'-[O--(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl]-ribose,
2'-NH.sub.2-2'-deoxyribose, .beta.-D-xylo-furanose,
.alpha.-arabinofuranose,
2,4-dideoxy-.beta.-D-erythro-hexo-pyranose, and carbocyclic
(described, for example, in Froehler J (1992) Am Chem Soc 114:8320)
and/or open-chain sugar analogs (described, for example, in
Vandendriessche et al. (1993) Tetrahedron 49:7223) and/or
bicyclosugar analogs (described, for example, in Tarkov M et al.
(1993) Helv Chim Acta 76:481).
A natural nucleoside base can be replaced by a modified nucleoside
base, wherein the modified nucleoside base is for example selected
from hypoxanthine, uracil, dihydrouracil, pseudouracil,
2-thiouracil, 4-thiouracil, 5-aminouracil,
5-(C.sub.1-C.sub.6)-alkyluracil, 5-(C.sub.2-C.sub.6)-alkenyluracil,
5-(C.sub.2-C.sub.6)-alkynyluracil, 5-(hydroxymethyl)uracil,
5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine,
5-(C.sub.1-C.sub.6)-alkylcytosine,
5-(C.sub.2-C.sub.6)-alkenylcytosine,
5-(C.sub.2-C.sub.6)-alkynylcytosine, 5-chlorocytosine,
5-fluorocytosine, 5-bromocytosine, N.sup.2-dimethylguanosine,
2,4-diamino-purine, 8-azapurine, a substituted 7-deazapurine,
preferably 7-deaza-7-substituted and/or 7-deaza-8-substituted
purine or other modifications of a natural nucleoside bases. This
list is meant to be exemplary and is not to be interpreted to be
limiting.
As used herein, "immune stimulatory nucleic acid" and,
equivalently, "immunostimulatory nucleic acid" shall refer to a
ribonucleic acid or deoxyribonucleic acid molecule, derivative or
analog thereof, characterized by its capacity to induce a
functional aspect of a cell of the immune system. Such functional
aspect of a cell of the immune system can include, for example,
elaboration of a cytokine or chemokine, expression of a cell
surface marker, secretion of an antibody, proliferation, or other
activity in response to or directed against an antigen or
antigen-bearing membrane-bound target.
For use in the instant invention, the nucleic acids of the
invention can be synthesized de novo using any of a number of
procedures well known in the art, for example, the
.beta.-cyanoethyl phosphoramidite method (Beaucage S L and
Caruthers M H (1981) Tetrahedron Lett 22:1859); and the nucleoside
H-phosphonate method (Garegg et al. (1986) Tetrahedron Lett
27:4051-4; Froehler et al. (1986) Nucl Acid Res 14:5399-407; Garegg
et al. (1986) Tetrahedron Lett 27:4055-8; Gaffney et al. (1988)
Tetrahedron Lett 29:2619-22). These chemistries can be performed by
a variety of automated nucleic acid synthesizers available in the
market. These nucleic acids are referred to as synthetic nucleic
acids. Alternatively, nucleic acids of the invention can be
produced on a large scale in plasmids, (see Sambrook T et al.,
"Molecular Cloning: A Laboratory Manual", Cold Spring Harbor
Laboratory Press, New York, 1989) and separated into smaller pieces
or administered whole. Nucleic acids can be prepared from existing
nucleic acid sequences (e.g., genomic or cDNA) using known
techniques, such as those employing restriction enzymes,
exonucleases or endonucleases. Nucleic acids prepared in this
manner are referred to as isolated nucleic acids. An isolated
nucleic acid generally refers to a nucleic acid which is separated
from components which it is normally associated with in nature. As
an example, an isolated nucleic acid may be one which is separated
from a cell, from a nucleus, from mitochondria or from chromatin.
The combination motif nucleic acids of the instant invention
encompass both synthetic and isolated combination motif nucleic
acids.
For use in vivo, the combination motif immunostimulatory nucleic
acids may optionally be relatively resistant to degradation (e.g.,
are stabilized). A "stabilized nucleic acid molecule" shall mean a
nucleic acid molecule that is relatively resistant to in vivo
degradation (e.g., via an exonuclease or endonuclease). Nucleic
acid stabilization can be accomplished via phosphate backbone
modifications. Preferred stabilized nucleic acids of the instant
invention have a modified backbone. It has been demonstrated that
modification of the nucleic acid backbone provides enhanced
activity of the combination motif immunostimulatory nucleic acids
when administered in vivo. Combination motif immunostimulatory
nucleic acids having phosphorothioate linkages in some instances
provide maximal activity and protect the nucleic acid from
degradation by intracellular exonucleases and endonucleases. Other
modified nucleic acids include modified phosphodiester nucleic
acids, combinations of phosphodiester and phosphorothioate nucleic
acids (i.e., chimeric), methylphosphonate, methylphosphorothioate,
phosphorodithioate, p-ethoxy, and combinations thereof.
Modified backbones such as phosphorothioates may be synthesized
using automated techniques employing either phosphoramidate or
H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be
made, e.g., as described in U.S. Pat. No. 4,469,863; and
alkylphosphotriesters (in which the charged oxygen moiety is
alkylated as described in U.S. Pat. No. 5,023,243 and European
Patent No. 092,574) can be prepared by automated solid phase
synthesis using commercially available reagents. Methods for making
other DNA backbone modifications and substitutions have been
described. Uhlmann E and Peyman A (1990) Chem Rev 90:544; Goodchild
J (1990) Bioconjugate Chem 1:165.
Other stabilized nucleic acids include: nonionic DNA analogs, such
as alkyl- and aryl-phosphates (in which the charged phosphonate
oxygen is replaced by an alkyl or aryl group), phosphodiester and
alkylphosphotriesters, in which the charged oxygen moiety is
alkylated. Nucleic acids which contain diol, such as
tetraethyleneglycol or hexaethyleneglycol, at either or both
termini have also been shown to be substantially resistant to
nuclease degradation.
In other embodiments the immunostimulatory nucleic acids may have
phosphodiester or chimeric e.g., soft or semi-soft backbones. A
chimeric backbone includes a combination of phosphodiester and
modified backbone linkages. A chimeric oligonucleotide, for
instance, may be a soft oligonucleotide or a semi-soft
oligonucleotide.
A soft oligonucleotide is an immunostimulatory oligonucleotide
having a partially stabilized backbone, in which phosphodiester or
phosphodiester-like internucleoside linkages occur only within and
immediately adjacent to at least one internal pyrimidine
nucleoside-guanosine (YG) dinucleotide. The at least one internal
YG dinucleotide itself has a phosphodiester or phosphodiester-like
internucleoside linkage. A phosphodiester or phosphodiester-like
internucleoside linkage occurring immediately adjacent to the at
least one internal YG dinucleotide can be 5', 3', or both 5' and 3'
to the at least one internal YG dinucleotide. Preferably a
phosphodiester or phosphodiester-like internucleoside linkage
occurring immediately adjacent to the at least one internal YG
dinucleotide is itself an internal internucleoside linkage. Thus
for a sequence N.sub.1YGN.sub.2, wherein N.sub.1 and N.sub.2 are
each, independent of the other, any single nucleotide, the YG
dinucleotide has a phosphodiester or phosphodiester-like
internucleoside linkage, and in addition (a) N.sub.1 and Y are
linked by a phosphodiester or phosphodiester-like internucleoside
linkage when N.sub.1 is an internal nucleotide, (b) G and N.sub.2
are linked by a phosphodiester or phosphodiester-like
internucleoside linkage when N.sub.2 is an internal nucleotide, or
(c) N.sub.1 and Y are linked by a phosphodiester or
phosphodiester-like internucleoside linkage when N.sub.1 is an
internal nucleotide and G and N.sub.2 are linked by a
phosphodiester or phosphodiester-like internucleoside linkage when
N.sub.2 is an internal nucleotide.
A semi-soft oligonucleotide is an immunostimulatory oligonucleotide
having a partially stabilized backbone, in which phosphodiester or
phosphodiester-like internucleoside linkages occur only within at
least one internal pyrimidine nucleoside-guanosine (YG)
dinucleotide. Semi-soft oligonucleotides can have a number of
advantages over immunostimulatory oligonucleotides with fully
stabilized backbones. For instance, semi-soft oligonucleotides may
possess increased immunostimulatory potency relative to
corresponding fully stabilized immunostimulatory
oligonucleotides.
The immunostimulatory nucleic acids may be used to treat a subject
to induce an immune response or treat an immune related disease
such as, for example, infectious disease, cancer, and allergic
disorders. As used herein, "subject" shall refer to a human or
vertebrate animal including, but not limited to, a dog, cat, horse,
cow, pig, sheep, goat, chicken, monkey, rabbit, rat, mouse,
etc.
As used herein, the terms "treat", "treating" and "treated" shall
refer to a prophylactic treatment which increases the resistance of
a subject to developing a disease or, in other words, decreases the
likelihood that the subject will develop a disease or slows the
development of the disease, as well as to a treatment after the
subject has developed the disease in order to fight the disease,
e.g., reduce or eliminate it altogether or prevent it from becoming
worse. For example, when used with respect to the treatment of an
infectious disease the terms refer to a prophylactic treatment
which increases the resistance of a subject to a microorganism or,
in other words, decreases the likelihood that the subject will
develop an infectious disease to the microorganism, as well as to a
treatment after the subject has been infected in order to fight the
infectious disease, e.g., reduce or eliminate it altogether or
prevent it from becoming worse. When used with respect to a disease
such as cancer the terms refer to the prevention or delay of the
development of a cancer, reducing the symptoms of cancer, and/or
inhibiting or slowing the growth of an established cancer.
Thus, the nucleic acids are useful as prophylactics for the
induction of immunity of a subject at risk of developing an
infection with an infectious organism or a subject at risk of
developing an allergic disorder or cancer. A "subject at risk" as
used herein is a subject who has any risk of exposure to an
infection-causing infectious pathogen, exposure to an allergen, or
developing cancer. For instance, a subject at risk may be a subject
who is planning to travel to an area where a particular type of
infectious agent or allergen is found or it may be a subject who
through lifestyle or medical procedures is exposed to bodily fluids
which may contain infectious organisms or even any subject living
in an area that an infectious organism or an allergen has been
identified and is exposed directly to the infectious agent or
allergen. It also may be a subject at risk of biowarfare such as
military personnel or those living in areas at risk of terrorist
attack. Subjects at risk of developing infection also include
general populations to which a medical agency recommends
vaccination with a particular infectious organism antigen. If the
antigen is an allergen and the subject develops allergic responses
to that particular antigen and the subject is exposed to the
antigen, i.e., during pollen season, then that subject is at risk
of exposure to the antigen. Subjects at risk of developing cancer
include those with a genetic predisposition or previously treated
for cancer, and those exposed to carcinogens such as tobacco,
asbestos, and other chemical toxins or excessive sunlight and other
types of radiation. The nucleic acids are also useful as
therapeutics in the treatment of infectious disease, cancer and
allergic disorders.
A "subject having an infection" is a subject that has been exposed
to an infectious pathogen and has acute or chronic detectable
levels of the pathogen in the body. The nucleic acids can be used
alone, or in conjunction with other therapeutic agents such as an
antigen or an antimicrobial medicament to mount an immune response
that is capable of reducing the level of or eradicating the
infectious pathogen. The method entails administering to a subject
having or at risk of developing an infection an effective amount of
a combination motif immune stimulatory nucleic acid of the
invention to treat the infection. The method can be used to treat
viral, bacterial, fungal, and parasitic infections in human and
non-human vertebrate subjects.
As used herein, "infection" and, equivalently, "infectious disease"
shall refer to a disease arising from the presence of a foreign
microorganism in the body of a subject. A foreign microorganism may
be a virus, a bacterium, a fungus, or a parasite.
Examples of infectious viruses include: Retroviridae (e.g., human
immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus;
enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g., strains that cause gastroenteritis);
Togaviridae (e.g., equine encephalitis viruses, rubella viruses);
Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow
fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae
(e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae
(e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses);
Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g.,
reoviruses, orbiviurses and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1
and 2, varicella zoster virus, cytomegalovirus (CMV), herpes
viruses); Poxviridae (variola viruses, vaccinia viruses, pox
viruses); and Iridoviridae (e.g., African swine fever virus); and
unclassified viruses (e.g., the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B virus), the agents of non-A,
non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Norwalk and related
viruses, and astroviruses).
Examples of infectious bacteria include: Actinomyces israelii,
Bacillus anthracis, Bacteroides spp., Borrelia burgdorferi,
Chlamydia trachomatis, Clostridium perfringens, Clostridium tetani,
Corynebacterium diphtheriae, Corynebacterium spp., Enterobacter
aerogenes, Enterococcus sp., Erysipelothrix rhusiopathiae,
Fusobacterium nucleatum, Haemophilus influenzae, Helicobacter
pyloris, Klebsiella pneumoniae, Legionella pneumophilia,
Leptospira, Listeria monocytogenes, Mycobacteria spp. (e.g., M.
tuberculosis, M. avium, M. intracellulare, M. kansasii, M.
gordonae), Neisseria gonorrhoeae, Neisseria meningitidis,
Pasturella multocida, pathogenic Campylobacter sp., Staphylococcus
aureus, Streptobacillus moniliformis, Streptococcus (anaerobic
spp.), Streptococcus (viridans group), Streptococcus agalactiae
(Group B Streptococcus), Streptococcus bovis, Streptococcus
faecalis, Streptococcus pneumoniae, Streptococcus pyogenes (Group A
Streptococcus), Treponema pallidium, and Treponema pertenue.
Examples of infectious fungi include: Candida albicans,
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, and Blastomyces dermatitidis.
Other infectious organisms (i.e., protists) include Plasmodium spp.
such as Plasmodium falciparum, Plasmodium malariae, Plasmodium
ovale, and Plasmodium vivax, and Toxoplasma gondii. Blood-borne
and/or tissue parasites include Plasmodium spp., Babesia microti,
Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania
braziliensis, Leishmania donovani, Trypanosoma gambiense and
Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma
cruzi (Chagas' disease), and Toxoplasma gondii.
The foregoing lists of viruses, bacteria, fungi, and other
infectious microorganisms is understood to be representative and
not limiting. Other medically relevant microorganisms have been
described extensively in the literature, e.g., see C. G. A Thomas,
Medical Microbiology, Bailliere Tindall, Great Britain 1983, the
entire contents of which is hereby incorporated by reference.
Although many of the microbial agents described above relate to
human disorders, the invention is also useful for treating
non-human vertebrates. Non-human vertebrates are also capable of
developing infections which can be prevented or treated with the
immunostimulatory nucleic acids disclosed herein. For instance, in
addition to the treatment of infectious human diseases, the methods
of the invention are useful for treating infections of animals.
Infectious viruses of both human and non-human vertebrates include
retroviruses, RNA viruses and DNA viruses. This group of
retroviruses includes both simple retroviruses and complex
retroviruses. The simple retroviruses include the subgroups of
B-type retroviruses, C-type retroviruses and D-type retroviruses.
An example of a B-type retrovirus is mouse mammary tumor virus
(MMTV). The C-type retroviruses include subgroups C-type group A
(including Rous sarcoma virus (RSV), avian leukemia virus (ALV),
and avian myeloblastosis virus (AMV)) and C-type group B (including
feline leukemia virus (FeLV), gibbon ape leukemia virus (GALV),
spleen necrosis virus (SNV), reticuloendotheliosis virus (RV) and
simian sarcoma virus (SSV)). The D-type retroviruses include
Mason-Pfizer monkey virus (MPMV) and simian retrovirus type 1
(SRV-1). The complex retroviruses include the subgroups of
lentiviruses, T-cell leukemia viruses and the foamy viruses.
Lentiviruses include HIV-1, but also include HIV-2, SIV, Visna
virus, feline immunodeficiency virus (FIV), and equine infectious
anemia virus (EIAV). The T-cell leukemia viruses include HTLV-1,
HTLV-II, simian T-cell leukemia virus (STLV), and bovine leukemia
virus (BLV). The foamy viruses include human foamy virus (HFV),
simian foamy virus (SFV) and bovine foamy virus (BFV).
Examples of other RNA viruses that are infectious agents in
vertebrate animals include, but are not limited to, members of the
family Reoviridae, including the genus Orthoreovirus (multiple
serotypes of both mammalian and avian retroviruses), the genus
Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus,
African horse sickness virus, and Colorado Tick Fever virus), the
genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus,
simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the
family Picornaviridae, including the genus Enterovirus (poliovirus,
Coxsackie virus A and B, enteric cytopathic human orphan (ECHO)
viruses, hepatitis A virus, Simian enteroviruses, Murine
encephalomyelitis (ME) viruses, Poliovirus muris, Bovine
enteroviruses, Porcine enteroviruses, the genus Cardiovirus
(Encephalomyocarditis virus (EMC), Mengovirus), the genus
Rhinovirus (Human rhinoviruses including at least 113 subtypes;
other rhinoviruses), the genus Apthovirus (Foot and Mouth disease
virus (FMDV); the family Calciviridae, including Vesicular
exanthema of swine virus, San Miguel sea lion virus, Feline
picornavirus and Norwalk virus; the family Togaviridae, including
the genus Alphavirus (Eastern equine encephalitis virus, Semliki
forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong
virus, Ross river virus, Venezuelan equine encephalitis virus,
Western equine encephalitis virus), the genus Flavivirus
(Mosquito-borne yellow fever virus, Dengue virus, Japanese
encephalitis virus, St. Louis encephalitis virus, Murray Valley
encephalitis virus, West Nile virus, Kunjin virus, Central European
tick borne virus, Far Eastern tick borne virus, Kyasanur forest
virus, Louping III virus, Powassan virus, Omsk hemorrhagic fever
virus), the genus Rubivirus (Rubella virus), the genus Pestivirus
(Mucosal disease virus, Hog cholera virus, Border disease virus);
the family Bunyaviridae, including the genus Bunyvirus (Bunyamwera
and related viruses, California encephalitis group viruses), the
genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever
virus), the genus Nairovirus (Crimean-Congo hemorrhagic fever
virus, Nairobi sheep disease virus), and the genus Uukuvirus
(Uukuniemi and related viruses); the family Orthomyxoviridae,
including the genus Influenza virus (Influenza virus type A, many
human subtypes); Swine influenza virus, and Avian and Equine
Influenza viruses; influenza type B (many human subtypes), and
influenza type C (possible separate genus); the family
paramyxoviridae, including the genus Paramyxovirus (Parainfluenza
virus type 1, Sendai virus, Hemadsorption virus, Parainfluenza
viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the
genus Morbillivirus (Measles virus, subacute sclerosing
panencephalitis virus, distemper virus, Rinderpest virus), the
genus Pneumovirus (respiratory syncytial virus (RSV), Bovine
respiratory syncytial virus and Pneumonia virus); the family
Rhabdoviridae, including the genus Vesiculovirus (VSV), Chandipura
virus, Flanders-Hart Park virus), the genus Lyssavirus (Rabies
virus), fish Rhabdoviruses, and two probable Rhabdoviruses (Marburg
virus and Ebola virus); the family Arenaviridae, including
Lymphocytic choriomeningitis virus (LCM), Tacaribe virus complex,
and Lassa virus; the family Coronoaviridae, including Infectious
Bronchitis Virus (IBV), Hepatitis virus, Human enteric corona
virus, and Feline infectious peritonitis (Feline coronavirus).
Illustrative DNA viruses that are infectious agents in vertebrate
animals include, but are not limited to, the family Poxviridae,
including the genus Orthopoxvirus (Variola major, Variola minor,
Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia),
the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus
(Fowlpox, other avian poxvirus), the genus Capripoxvirus
(sheep-pox, goatpox), the genus Suipoxvirus (Swinepox), the genus
Parapoxvirus (contagious pustular dermatitis virus, pseudocowpox,
bovine papular stomatitis virus); the family Iridoviridae (African
swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of
fish); the family Herpesviridae, including the alpha-Herpesviruses
(Herpes Simplex Types 1 and 2, Varicella-Zoster, Equine abortion
virus, Equine herpes virus 2 and 3, pseudorabies virus, infectious
bovine keratoconjunctivitis virus, infectious bovine
rhinotracheitis virus, feline rhinotracheitis virus, infectious
laryngotracheitis virus), the Beta-herpesviruses (Human
cytomegalovirus and cytomegaloviruses of swine and monkeys); the
gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A, B, C, D, E and ungrouped; simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses; the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
as Lymphotrophic papilloma virus); the family Parvoviridae
including the genus Adeno-associated viruses, the genus Parvovirus
(Feline panleukopenia virus, bovine parvovirus, canine parvovirus,
Aleutian mink disease virus, etc). Finally, DNA viruses may include
viruses which do not fit into the above families, such as Kuru and
Creutzfeldt-Jacob disease viruses and chronic infectious
neuropathic agents (CHINA virus).
The nucleic acids may be administered to a subject with an
anti-microbial agent. An anti-microbial agent, as used herein,
refers to a naturally-occurring, synthetic, or semi-synthetic
compound which is capable of killing or inhibiting infectious
microorganisms. The type of anti-microbial agent useful according
to the invention will depend upon the type of microorganism with
which the subject is infected or at risk of becoming infected.
Anti-microbial agents include but are not limited to anti-bacterial
agents, anti-viral agents, anti-fungal agents and anti-parasitic
agents. Phrases such as "anti-infective agent", "anti-bacterial
agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic
agent" and "parasiticide" have well-established meanings to those
of ordinary skill in the art and are defined in standard medical
texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and
include antibiotics as well as other synthetic or natural compounds
having similar functions. Antibiotics are low molecular weight
molecules which are produced as secondary metabolites by cells,
such as microorganisms. In general, antibiotics interfere with one
or more bacterial functions or structures which are specific for
the microorganism and which are not present in host cells.
Anti-viral agents can be isolated from natural sources or
synthesized and are useful for killing or inhibiting viruses.
Anti-fungal agents are used to treat superficial fungal infections
as well as opportunistic and primary systemic fungal infections.
Anti-parasite agents kill or inhibit parasites.
Antibacterial agents kill or inhibit the growth or function of
bacteria. A large class of antibacterial agents is antibiotics.
Antibiotics, which are effective for killing or inhibiting a wide
range of bacteria, are referred to as broad spectrum antibiotics.
Other types of antibiotics are predominantly effective against the
bacteria of the class gram-positive or gram-negative. These types
of antibiotics are referred to as narrow spectrum antibiotics.
Other antibiotics which are effective against a single organism or
disease and not against other types of bacteria, are referred to as
limited spectrum antibiotics. Antibacterial agents are sometimes
classified based on their primary mode of action. In general,
antibacterial agents are cell wall synthesis inhibitors, cell
membrane inhibitors, protein synthesis inhibitors, nucleic acid
synthesis or functional inhibitors, and competitive inhibitors.
Antiviral agents are compounds which prevent infection of cells by
viruses or replication of the virus within the cell. There are many
fewer antiviral drugs than antibacterial drugs because the process
of viral replication is so closely related to DNA replication
within the host cell, that non-specific antiviral agents would
often be toxic to the host. There are several stages within the
process of viral infection which can be blocked or inhibited by
antiviral agents. These stages include, attachment of the virus to
the host cell (immunoglobulin or binding peptides), uncoating of
the virus (e.g., amantadine), synthesis or translation of viral
mRNA (e.g., interferon), replication of viral RNA or DNA (e.g.,
nucleoside analogues), maturation of new virus proteins (e.g.,
protease inhibitors), and budding and release of the virus.
Nucleotide analogues are synthetic compounds which are similar to
nucleotides, but which have an incomplete or abnormal deoxyribose
or ribose group. Once the nucleotide analogues are in the cell,
they are phosphorylated, producing the triphosphate formed which
competes with normal nucleotides for incorporation into the viral
DNA or RNA. Once the triphosphate form of the nucleotide analogue
is incorporated into the growing nucleic acid chain, it causes
irreversible association with the viral polymerase and thus chain
termination. Nucleotide analogues include, but are not limited to,
acyclovir (used for the treatment of herpes simplex virus and
varicella-zoster virus), gancyclovir (useful for the treatment of
cytomegalovirus), idoxuridine, ribavirin (useful for the treatment
of respiratory syncitial virus), dideoxyinosine, dideoxycytidine,
and zidovudine (azidothymidine).
Immunoglobulin therapy is used for the prevention of viral
infection. Immunoglobulin therapy for viral infections is different
than bacterial infections, because rather than being
antigen-specific, the immunoglobulin therapy functions by binding
to extracellular virions and preventing them from attaching to and
entering cells which are susceptible to the viral infection. The
therapy is useful for the prevention of viral infection for the
period of time that the antibodies are present in the host. In
general there are two types of immunoglobulin therapies, normal
immunoglobulin therapy and hyper-immunoglobulin therapy. Normal
immune globulin therapy utilizes a antibody product which is
prepared from the serum of normal blood donors and pooled. This
pooled product contains low titers of antibody to a wide range of
human viruses, such as hepatitis A, parvovirus, enterovirus
(especially in neonates). Hyper-immune globulin therapy utilizes
antibodies which are prepared from the serum of individuals who
have high titers of an antibody to a particular virus. Those
antibodies are then used against a specific virus. Examples of
hyper-immune globulins include zoster immune globulin (useful for
the prevention of varicella in immuno-compromised children and
neonates), human rabies immunoglobulin (useful in the post-exposure
prophylaxis of a subject bitten by a rabid animal), hepatitis B
immune globulin (useful in the prevention of hepatitis B virus,
especially in a subject exposed to the virus), and RSV immune
globulin (useful in the treatment of respiratory syncitial virus
infections).
Another type of immunoglobulin therapy is active immunization. This
involves the administration of antibodies or antibody fragments to
viral surface proteins. Two types of vaccines which are available
for active immunization of hepatitis B include serum-derived
hepatitis B antibodies and recombinant hepatitis B antibodies. Both
are prepared from hepatitis B surface antigen (HbsAg). The
antibodies are administered in three doses to subjects at high risk
of infection with hepatitis B virus, such as health care workers,
sexual partners of chronic carriers, and infants.
Anti-fungal agents are useful for the treatment and prevention of
infective fungi. Anti-fungal agents are sometimes classified by
their mechanism of action. Some anti-fungal agents function as cell
wall inhibitors by inhibiting glucose synthase. These include, but
are not limited to, basiungin/ECB. Other anti-fungal agents
function by destabilizing membrane integrity. These include, but
are not limited to, immidazoles, such as clotrimazole,
sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole,
and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502,
MK 991, pradimicin, UK 292, butenafine, and terbinafine. Other
anti-fungal agents function by breaking down chitin (e.g.,
chitinase) or immunosuppression (501 cream).
The immunostimulatory nucleic acids may be used, either alone or in
combination with an anti-cancer therapy, for the treatment of
cancer. The method entails administering to a subject having or at
risk of developing cancer an effective amount of a combination
motif immune stimulatory nucleic acid of the invention to treat
cancer.
A "subject having a cancer" is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g., small cell and non-small cell);
melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas
cancer; prostate cancer; rectal cancer; sarcomas; skin cancer;
testicular cancer; thyroid cancer; and renal cancer, as well as
other carcinomas and sarcomas. In one embodiment the cancer is
hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell
leukemia, multiple myeloma, follicular lymphoma, malignant
melanoma, squamous cell carcinoma, renal cell carcinoma, prostate
carcinoma, bladder cell carcinoma, or colon carcinoma.
Cancer is one of the leading causes of death in companion animals
(i.e., cats and dogs). Malignant disorders commonly diagnosed in
dogs and cats include but are not limited to lymphosarcoma,
osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma,
adenosquamous carcinoma, carcinoid lung tumor, bronchial gland
tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma,
pulmonary sarcoma, neurosarcoma, osteoma, papilloma,
retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma,
microglioma, neuroblastoma, osteoclastoma, oral neoplasia,
fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasms in
dogs include genital squamous cell carcinoma, transmissible
venereal tumor, testicular tumor, seminoma, Sertoli cell tumor,
hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma),
corneal papilloma, corneal squamous cell carcinoma,
hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma,
stomach tumor, adrenal gland carcinoma, oral papillomatosis,
hemangioendothelioma and cystadenoma. Additional malignancies
diagnosed in cats include follicular lymphoma, intestinal
lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma.
The ferret, an ever-more popular house pet, is known to develop
insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell
tumor, gastric MALT lymphoma and gastric adenocarcinoma.
The immunostimulatory nucleic acids may also be administered in
conjunction with an anti-cancer therapy. Anti-cancer therapies
include cancer medicaments, radiation and surgical procedures. As
used herein, a "cancer medicament" refers to an agent which is
administered to a subject for the purpose of treating a cancer.
Various types of medicaments for the treatment of cancer are
described herein. For the purpose of this specification, cancer
medicaments are classified as chemotherapeutic agents,
immunotherapeutic agents, cancer vaccines, hormone therapy, and
biological response modifiers.
Cancer medicaments function in a variety of ways. Some cancer
medicaments work by targeting physiological mechanisms that are
specific to tumor cells. Examples include the targeting of specific
genes and their gene products (i.e., proteins primarily) which are
mutated in cancers. Such genes include but are not limited to
oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g.,
EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21,
telomerase). Cancer medicaments can alternately target signal
transduction pathways and molecular mechanisms which are altered in
cancer cells. Targeting of cancer cells via the epitopes expressed
on their cell surface is accomplished through the use of monoclonal
antibodies. This latter type of cancer medicament is generally
referred to herein as immunotherapy.
Other cancer medicaments target cells other than cancer cells. For
example, some medicaments prime the immune system to attack tumor
cells (i.e., cancer vaccines). Still other medicaments, called
angiogenesis inhibitors, function by attacking the blood supply of
solid tumors. Since the most malignant cancers are able to
metastasize (i.e., exist the primary tumor site and seed a distal
tissue, thereby forming a secondary tumor), medicaments that impede
this metastasis are also useful in the treatment of cancer.
Angiogenic mediators include basic FGF, VEGF, angiopoietins,
angiostatin, endostatin, TNF-.alpha., TNP-470, thrombospondin-1,
platelet factor 4, CAI, and certain members of the integrin family
of proteins. One category of this type of medicament is a
metalloproteinase inhibitor, which inhibits the enzymes used by the
cancer cells to exist the primary tumor site and extravasate into
another tissue.
Immunotherapeutic agents are medicaments which derive from
antibodies or antibody fragments which specifically bind or
recognize a cancer antigen. As used herein a cancer antigen is
broadly defined as an antigen expressed by a cancer cell.
Preferably, the antigen is expressed at the cell surface of the
cancer cell. Even more preferably, the antigen is one which is not
expressed by normal cells, or at least not expressed to the same
level as in cancer cells. Antibody-based immunotherapies may
function by binding to the cell surface of a cancer cell and
thereby stimulate the endogenous immune system to attack the cancer
cell. Another way in which antibody-based therapy functions is as a
delivery system for the specific targeting of toxic substances to
cancer cells. Antibodies are usually conjugated to toxins such as
ricin (e.g., from castor beans), calicheamicin and maytansinoids,
to radioactive isotopes such as Iodine-131 and Yttrium-90, to
chemotherapeutic agents (as described herein), or to biological
response modifiers. In this way, the toxic substances can be
concentrated in the region of the cancer and non-specific toxicity
to normal cells can be minimized. In addition to the use of
antibodies which are specific for cancer antigens, antibodies which
bind to vasculature, such as those which bind to endothelial cells,
are also useful in the invention. This is because generally solid
tumors are dependent upon newly formed blood vessels to survive,
and thus most tumors are capable of recruiting and stimulating the
growth of new blood vessels. As a result, one strategy of many
cancer medicaments is to attack the blood vessels feeding a tumor
and/or the connective tissues (or stroma) supporting such blood
vessels.
The use of immunostimulatory nucleic acids in conjunction with
immunotherapeutic agents such as monoclonal antibodies is able to
increase long-term survival through a number of mechanisms
including significant enhancement of antibody-dependent cellular
cytotoxicity (ADCC), activation of NK cells and an increase in
IFN-.alpha. levels. ADCC can be performed using a immunostimulatory
nucleic acid in combination with an antibody specific for a
cellular target, such as a cancer cell. When the immunostimulatory
nucleic acid is administered to a subject in conjunction with the
antibody the subject's immune system is induced to kill the tumor
cell. The antibodies useful in the ADCC procedure include
antibodies which interact with a cell in the body. Many such
antibodies specific for cellular targets have been described in the
art and many are commercially available. The nucleic acids when
used in combination with monoclonal antibodies serve to reduce the
dose of the antibody required to achieve a biological result.
Other types of chemotherapeutic agents which can be used according
to the invention include Aminoglutethimide, Asparaginase, Busulfan,
Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin,
Daunorubicin HCl, Estramustine phosphate sodium, Etoposide
(VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide,
Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a,
Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue),
Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard),
Mercaptopurine, Mesna, Mitotane (o.p-DDD), Mitoxantrone HCl,
Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen
citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine
(m-AMSA), Azacitidine, Erythropoietin, Hexamethylmelamine (HMM),
Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal
bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin),
Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine
sulfate.
Cancer vaccines are medicaments which are intended to stimulate an
endogenous immune response against cancer cells. Currently produced
vaccines predominantly activate the humoral immune system (i.e.,
the antibody dependent immune response). Other vaccines currently
in development are focused on activating the cell-mediated immune
system including cytotoxic T lymphocytes which are capable of
killing tumor cells. Cancer vaccines generally enhance the
presentation of cancer antigens to both antigen presenting cells
(e.g., macrophages and dendritic cells) and/or to other immune
cells such as T cells, B cells, and NK cells. In some instances,
cancer vaccines may be used along with adjuvants, such as those
described above.
Some cancer cells are antigenic and thus can be targeted by the
immune system. In one aspect, the combined administration of
immunostimulatory nucleic acids and cancer medicaments,
particularly those which are classified as cancer immunotherapies,
is useful for stimulating a specific immune response against a
cancer antigen. used herein, the terms "cancer antigen" and "tumor
antigen" are used interchangeably to refer to antigens which are
differentially expressed by cancer cells and can thereby be
exploited in order to target cancer cells. Cancer antigens are
antigens which can potentially stimulate apparently tumor-specific
immune responses. Some of these antigens are encoded, although not
necessarily expressed, by normal cells. These antigens can be
characterized as those which are normally silent (i.e., not
expressed) in normal cells, those that are expressed only at
certain stages of differentiation and those that are temporally
expressed such as embryonic and fetal antigens. Other cancer
antigens are encoded by mutant cellular genes, such as oncogenes
(e.g., activated ras oncogene), suppressor genes (e.g., mutant
p53), fusion proteins resulting from internal deletions or
chromosomal translocations. Still other cancer antigens can be
encoded by viral genes such as those carried on RNA and DNA tumor
viruses. "Tumor-associated" antigens are present in both tumor
cells and normal cells but are present in a different quantity or a
different form in tumor cells. Examples of such antigens are
oncofetal antigens (e.g., carcinoembryonic antigen),
differentiation antigens (e.g., T and Tn antigens), and oncogene
products (e.g., HER/neu).
Cancer antigens, such as those present in cancer vaccines or those
used to prepare cancer immunotherapies, can be prepared from crude
cancer cell extracts, as described in Cohen P A et al. (1994)
Cancer Res 54:1055-8, or by partially purifying the antigens, using
recombinant technology, or de novo synthesis of known antigens.
Cancer antigens can be used in the form of immunogenic portions of
a particular antigen or in some instances a whole cell or a tumor
mass can be used as the antigen. Such antigens can be isolated or
prepared recombinantly or by any other means known in the art.
Other vaccines take the form of dendritic cells which have been
exposed to cancer antigens in vitro, have processed the antigens
and are able to express the cancer antigens at their cell surface
in the context of MHC molecules for effective antigen presentation
to other immune system cells. Dendritic cells form the link between
the innate and the acquired immune system by presenting antigens
and through their expression of pattern recognition receptors which
detect microbial molecules like LPS in their local environment.
The combination motif immunostimulatory nucleic acids are useful
for the treatment of allergy, including asthma. The combination
motif immune stimulatory nucleic acids can be used, either alone or
in combination with an allergy/asthma medicament, to treat allergy.
The method entails administering to a subject having or at risk of
developing an allergic or asthmatic condition an effective amount
of a combination motif immune stimulatory nucleic acid of the
invention to treat the allergic or asthmatic condition.
As used herein, "allergy" shall refer to acquired hypersensitivity
to a substance (allergen). Allergic conditions include eczema,
allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria
(hives) and food allergies, and other atopic conditions. A "subject
having an allergy" is a subject that has or is at risk of
developing an allergic reaction in response to an allergen. An
"allergen" refers to a substance that can induce an allergic or
asthmatic response in a susceptible subject. The list of allergens
is enormous and can include pollens, insect venoms, animal dander,
dust, fungal spores and drugs (e.g., penicillin).
Examples of natural animal and plant allergens include proteins
specific to the following genuses: Canine (Canis familiaris);
Dermalophagoides (e.g., Dermalophagoides farinae); Felis (Felis
domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium
perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica);
Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa);
Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea
europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago
lanceolata); Parielaria (e.g., Parietaria officinalis or Parietaria
judaica); Blattella (e.g., Blattella germanica); Apis (e.g., Apis
mulliflorum); Cupressus (e.g., Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g., Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g., Thuya orientalis); Chamaecyparis (e.g.,
Chamaecyparis obtusa); Periplaneta (e.g., Periplaneta americana);
Agropyron (e.g., Agropyron repens); Secale (e.g., Secale cereals);
Triticum (e.g., Triticum aestivum); Dactylis (e.g., Dactylis
glomerata); Festuca (e.g., Festuca elatior); Poa (e.g., Poa
pratensis or Poa compressa); Avena (e.g., Avena sativa); Holcus
(e.g., Holcus lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum);
Arrhenatherum (e.g., Arrhenatherum elatius); Agrostis (e.g.,
Agrostis alba); Phleum (e.g., Phleum pratense); Phalaris (e.g.,
Phalaris arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum
(e.g., Sorghum halepensis); and Bromus (e.g., Bromus inermis).
As used herein, "asthma" shall refer to a disorder of the
respiratory system characterized by inflammation, narrowing of the
airways and increased reactivity of the airways to inhaled agents.
Asthma is frequently, although not exclusively, associated with
atopic or allergic symptoms.
An "asthma/allergy medicament" as used herein is a composition of
matter which reduces the symptoms, inhibits the asthmatic or
allergic reaction, or prevents the development of an allergic or
asthmatic reaction. Various types of medicaments for the treatment
of asthma and allergy are described in the Guidelines For The
Diagnosis and Management of Asthma, Expert Panel Report 2, NIH
Publication No. 97/4051, Jul. 19, 1997, the entire contents of
which are incorporated herein by reference. The summary of the
medicaments as described in the NIH publication is presented
below.
In most embodiments the asthma/allergy medicament is useful to some
degree for treating both asthma and allergy. Some asthma/allergy
medicaments are preferably used in combination with the
immunostimulatory nucleic acids to treat asthma. These are referred
to as asthma medicaments. Asthma medicaments include, but are not
limited, PDE-4 inhibitors, bronchodilator/beta-2 agonists, K+
channel openers, VLA-4 antagonists, neurokin antagonists, TXA2
synthesis inhibitors, xanthanines, arachidonic acid antagonists, 5
lipoxygenase inhibitors, thromboxin A2 receptor antagonists,
thromboxane A2 antagonists, inhibitor of 5-lipoxygenase activation
proteins, and protease inhibitors.
Other asthma/allergy medicaments are preferably used in combination
with the immunostimulatory nucleic acids to treat allergy. These
are referred to as allergy medicaments. Allergy medicaments
include, but are not limited to, anti-histamines, steroids,
immunomodulators, and prostaglandin inducers. Anti-histamines are
compounds which counteract histamine released by mast cells or
basophils. These compounds are well known in the art and commonly
used for the treatment of allergy. Anti-histamines include, but are
not limited to, loratidine, cetirizine, buclizine, ceterizine
analogues, fexofenadine, terfenadine, desloratadine, norastemizole,
epinastine, ebastine, ebastine, astemizole, levocabastine,
azelastine, tranilast, terfenadine, mizolastine, betatastine, CS
560, and HSR 609. Prostaglandin inducers are compounds which induce
prostaglandin activity. Prostaglandins function by regulating
smooth muscle relaxation. Prostaglandin inducers include, but are
not limited to, S-5751.
The steroids include, but are not limited to, beclomethasone,
fluticasone, tramcinolone, budesonide, corticosteroids and
budesonide. The combination of immunostimulatory nucleic acids and
steroids are particularly well suited to the treatment of young
subjects (e.g., children). To date, the use of steroids in children
has been limited by the observation that some steroid treatments
have been reportedly associated with growth retardation. Thus,
according to the present invention, the immunostimulatory nucleic
acids can be used in combination with growth retarding steroids,
and can thereby provide a "steroid sparing effect." The combination
of the two agents can result in lower required doses of
steroids.
The immunomodulators include, but are not limited to, the group
consisting of anti-inflammatory agents, leukotriene antagonists,
IL-4 muteins, soluble IL-4 receptors, immunosuppressants (such as
tolerizing peptide vaccine), anti-IL-4 antibodies, IL-4
antagonists, anti-IL-5 antibodies, soluble IL-13 receptor-Fc fusion
proteins, anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists,
VLA-4 inhibitors, and, and downregulators of IgE.
The immunostimulatory nucleic acids of the invention can be used to
induce type 1 IFN, i.e., IFN-.alpha. and IFN-.beta.. The method
involves contacting a cell capable of expressing a type 1 IFN with
an effective amount of a combination motif immune stimulatory
nucleic acid of the invention to induce type 1 IFN expression by
the cell. It has recently been appreciated that the major producer
cell type of IFN-.alpha. in humans is the plasmacytoid dendritic
cell (pDC). This type of cell occurs at very low frequency (0.2-0.4
percent) in PBMC and is characterized by a phenotype that is
lineage negative (i.e., does not stain for CD3, CD14, CD19, or
CD56) and CD11c negative, while positive for CD4, CD123
(IL-3R.alpha.), and class II major histocompatibility complex (MHC
class II). Grouard G et al. (1997) J Exp Med 185:1101-11; Rissoan
M-C et al. (1999) Science 283:1183-6; Siegal F P et al. (1999)
Science 284:1835-7; Cella M et al. (1999) Nat Med 5:919-23. Methods
of measuring type 1 IFN are well known by those skilled in the art,
and they include, for example, enzyme-linked immunosorbent assay
(ELISA), bioassay, and fluorescence-activated cell sorting (FACS).
Assays of this sort can be performed using readily available
commercial reagents and kits.
The immunostimulatory nucleic acids of the invention may be used to
activate NK cells. The method involves contacting an NK cell with
an effective amount of a combination motif immune stimulatory
nucleic acid of the invention to activate the NK cell. The
activation of the NK cells may be direct activation or indirect
activation. Indirect activation refers to the induction of
cytokines or other factors which cause the subsequent activation of
the NK cells. NK cell activation can be assessed by various
methods, including measurement of lytic activity, measurement of
induction of activation markers such as CD69, and measurement of
induction of certain cytokines. In addition to their characteristic
ability to kill certain tumor targets spontaneously, NK cells
participate in ADCC and are major producers of IFN-.gamma.,
TNF-.alpha., GM-CSF and IL-3.
The prototypical NK-sensitive cell target for mouse NK cells is
yeast artificial chromosome (YAC)-1, a thymoma derived from Moloney
virus-infected A strain mice. For human NK cells, a standard target
is K562, a cell line derived from an erythroleukemic lineage. In
microtiter plates, a constant number of radiolabeled targets (e.g.,
.sup.51Cr-labeled K562) is incubated either alone (spontaneous),
with detergent (maximum), or with varying numbers of effector cells
(experimental). The ratio of effector to target cells is referred
to as the E:T ratio. Enriched, activated NK cells typically are
effective at E:T ratios of less than 10:1, while unfractionated
PBMCs or splenocytes require E:T ratios of 100:1 or more.
The immunostimulatory nucleic acids also are useful as adjuvants
for inducing a systemic and/or mucosal immune response. The
combination motif immune stimulatory nucleic acids of the invention
can be delivered to a subject exposed to an antigen to produce an
enhanced immune response to the antigen. Thus for example
combination motif immune stimulatory nucleic acids are useful as
vaccine adjuvants.
The immunostimulatory nucleic acids may be administered in
combination with non-nucleic acid adjuvants. A non-nucleic acid
adjuvant is any molecule or compound except for the
immunostimulatory nucleic acids described herein which can
stimulate the humoral and/or cellular immune response. Non-nucleic
acid adjuvants include, for instance, adjuvants that create a depot
effect, immune stimulating adjuvants, and adjuvants that create a
depo effect and stimulate the immune system.
An adjuvant that creates a depot effect as used herein is an
adjuvant that causes the antigen to be slowly released in the body,
thus prolonging the exposure of immune cells to the antigen. This
class of adjuvants includes but is not limited to alum (e.g.,
aluminum hydroxide, aluminum phosphate); or emulsion-based
formulations including mineral oil, non-mineral oil, water-in-oil
or oil-in-water-in oil emulsion, oil-in-water emulsions such as
Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720,
AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing
a stabilizing detergent and a micelle-forming agent; IDEC,
Pharmaceuticals Corporation, San Diego, Calif.).
An immune stimulating adjuvant is an adjuvant that causes
activation of a cell of the immune system. It may, for instance,
cause an immune cell to produce and secrete cytokines. This class
of adjuvants includes but is not limited to saponins purified from
the bark of the Q. saponaria tree, such as QS21 (a glycolipid that
elutes in the 21.sup.st peak with HPLC fractionation; Aquila
Biopharmaceuticals, Inc., Worcester, Mass.);
poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus
Research Institute, USA); derivatives of lipopolysaccharides such
as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and
threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine
disaccharide related to lipid A; O M Pharma S A, Meyrin,
Switzerland); and Leishmania elongation factor (a purified
Leishmania protein; Corixa Corporation, Seattle, Wash.).
Adjuvants that create a depot effect and stimulate the immune
system are those compounds which have both of the above-identified
functions. This class of adjuvants includes but is not limited to
ISCOMS (Immunostimulating complexes which contain mixed saponins,
lipids and form virus-sized particles with pores that can hold
antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham
adjuvant system #2 which is an oil-in-water emulsion containing MPL
and QS21: SmithKline Beecham Biologicals [SBB], Rixensart,
Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4 which
contains alum and MPL; SBB, Belgium); non-ionic block copolymers
that form micelles such as CRL 1005 (these contain a linear chain
of hydrophobic polyoxpropylene flanked by chains of
polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant
Formulation (SAF, an oil-in-water emulsion containing Tween 80 and
a nonionic block copolymer; Syntex Chemicals, Inc., Boulder,
Colo.).
A non-nucleic acid mucosal adjuvant as used herein is an adjuvant
other than a immunostimulatory nucleic acid that is capable of
inducing a mucosal immune response in a subject when administered
to a mucosal surface in conjunction with an antigen. Mucosal
adjuvants include but are not limited to Bacterial toxins e.g.,
Cholera toxin (CT), CT derivatives including but not limited to CT
B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998); CTD53
(Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys) (Fontana et
al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995); CTD53/K63
(Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54 (Arg to His)
(Fontana et al., 1995); CTN107 (His to Asn) (Fontana et al., 1995);
CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K (Glu to Lys)
(Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al.,
1997a, 1997b); CTS106 (Pro to Ser) (Douce et al., 1997, Fontana et
al., 1995); and CTK63 (Ser to Lys) (Douce et al., 1997, Fontana et
al., 1995), Zonula occludens toxin, zot, Escherichia coli
heat-labile enterotoxin, Labile Toxin (LT), LT derivatives
including but not limited to LIT B subunit (LTB) (Verweij et al.,
1998); LT7K (Arg to Lys) (Komase et al., 1998, Douce et al., 1995);
LT61F (Ser to Phe) (Komase et al., 1998); LT112K (Glu to Lys)
(Komase et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998);
LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg to Gly)
(Komase et al., 1998); LTK63 (Ser to Lys) (Marchetti et al., 1998,
Douce et al., 1997, 1998, Di Tommaso et al., 1996); and LTR72 (Ala
to Arg) (Giuliani et al., 1998), Pertussis toxin, PT. (Lycke et
al., 1992, Spangler B D, 1992, Freytag and Clemments, 1999, Roberts
et al., 1995, Wilson et al., 1995) including PT-9K/129G (Roberts et
al., 1995, Cropley et al., 1995); Toxin derivatives (see below)
(Holmgren et al., 1993, Verweij et al., 1998, Rappuoli et al.,
1995, Freytag and Clements, 1999); Lipid A derivatives (e.g.,
monophosphoryl lipid A, MPL) (Sasaki et al., 1998, Vancott et al.,
1998; Muramyl Dipeptide (MDP) derivatives (Fukushima et al., 1996,
Ogawa et al., 1989, Michalek et al., 1983, Morisaki et al., 1983);
Bacterial outer membrane proteins (e.g., outer surface protein A
(OspA) lipoprotein of Borrelia burgdorferi, outer membrane protein
of Neisseria meningitidis) (Marinaro et al., 1999, Van de Verg et
al., 1996); Oil-in-water emulsions (e.g., MF59) (Barchfield et al.,
1999, Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka
et al., 1998, 1999); and Saponins (e.g., QS21) Aquila
Biopharmaceuticals, Inc., Worcester, Mass.) (Sasaki et al., 1998,
MacNeal et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion
stabilized with Span 85 and Tween 80; Chiron Corporation,
Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants
(e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an
oil-in-water emulsion containing a stabilizing detergent and a
micelle-forming agent; IDEC Pharmaceuticals Corporation, San Diego,
Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc.,
Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP
polymer; Virus Research Institute, USA) and Leishmania elongation
factor (Corixa Corporation, Seattle, Wash.).
The immunostimulatory nucleic acids of the invention may be
formulated as pharmaceutical compositions in a pharmaceutically
acceptable carrier. The immunostimulatory nucleic acids may be
directly administered to the subject or may be administered in
conjunction with a nucleic acid delivery complex. A nucleic acid
delivery complex shall mean a nucleic acid molecule associated with
(e.g., ionically or covalently bound to; or encapsulated within) a
targeting means (e.g., a molecule that results in higher affinity
binding to target cell (e.g., B-cell surfaces) and/or increased
cellular uptake by target cells). Examples of nucleic acid delivery
complexes include nucleic acids associated with a sterol (e.g.,
cholesterol), a lipid (e.g., a cationic lipid, virosome or
liposome), or a target cell specific binding agent (e.g., a ligand
recognized by target cell specific receptor). Preferred complexes
may be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex can be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
The immunostimulatory nucleic acid and/or the antigen and/or other
therapeutics may be administered alone (e.g., in saline or buffer)
or using any delivery vehicles known in the art. For instance the
following delivery vehicles have been described: Cochleates
(Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al.,
1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et
al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers
et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b);
Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al.,
1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al.,
1989); Polymers (e.g., carboxymethylcellulose, chitosan) (Hamajima
et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et
al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988,
1996, 1997); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995,
Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl
et al., 1998). Other delivery vehicles are known in the art.
Subject doses of the compounds described herein for mucosal or
local delivery typically range from about 0.1 .mu.g to 10 mg per
administration, which depending on the application could be given
daily, weekly, or monthly and any other amount of time
therebetween. More typically mucosal or local doses range from
about 10 .mu.g to 5 mg per administration, and most typically from
about 100 .mu.g to 1 mg, with 2-4 administrations being spaced days
or weeks apart. More typically, immune stimulant doses range from 1
.mu.g to 10 mg per administration, and most typically 10 .mu.g to 1
mg, with daily or weekly administrations. Subject doses of the
compounds described herein for parenteral delivery for the purpose
of inducing an antigen-specific immune response, wherein the
compounds are delivered with an antigen but not another therapeutic
agent are typically 5 to 10,000 times higher than the effective
mucosal dose for vaccine adjuvant or immune stimulant applications,
and more typically 10 to 1,000 times higher, and most typically 20
to 100 times higher. Doses of the compounds described herein for
parenteral delivery for the purpose of inducing an innate immune
response or for increasing ADCC or for inducing an antigen specific
immune response when the immunostimulatory nucleic acids are
administered in combination with other therapeutic agents or in
specialized delivery vehicles typically range from about 0.1 .mu.g
to 10 mg per administration, which depending on the application
could be given daily, weekly, or monthly and any other amount of
time therebetween. More typically parenteral doses for these
purposes range from about 10 .mu.g to 5 mg per administration, and
most typically from about 100 .mu.g to 1 mg, with 2-4
administrations being spaced days or weeks apart. In some
embodiments, however, parenteral doses for these purposes may be
used in a range of 5 to 10,000 times higher than the typical doses
described above.
As used herein, "effective amount" shall refer to the amount
necessary or sufficient to realize a desired biological effect. For
example, an effective amount of an immunostimulatory nucleic acid
for treating an infection is that amount necessary to treat the
infection. Combined with the teachings provided herein, by choosing
among the various active compounds and weighing factors such as
potency, relative bioavailability, patient body weight, severity of
adverse side-effects and preferred mode of administration, an
effective prophylactic or therapeutic treatment regimen can be
planned which does not cause substantial toxicity and yet is
entirely effective to treat the particular subject. The effective
amount for any particular application can vary depending on such
factors as the disease or condition being treated, the particular
immunostimulatory nucleic acid being administered, the antigen, the
size of the subject, or the severity of the disease or condition.
One of ordinary skill in the art can empirically determine the
effective amount of a particular immunostimulatory nucleic acid
and/or antigen and/or other therapeutic agent without necessitating
undue experimentation.
For any compound described herein the therapeutically effective
amount can be initially determined from animal models. A
therapeutically effective dose can also be determined from human
data for CpG oligonucleotides which have been tested in humans
(human clinical trials have been initiated) and for compounds which
are known to exhibit similar pharmacological activities, such as
other mucosal adjuvants, e.g., LT and other antigens for
vaccination purposes, for the mucosal or local administration.
Higher doses are required for parenteral administration. The
applied dose can be adjusted based on the relative bioavailability
and potency of the administered compound. Adjusting the dose to
achieve maximal efficacy based on the methods described above and
other methods as are well-known in the art is well within the
capabilities of the ordinarily skilled artisan.
The formulations of the invention are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
For use in therapy, an effective amount of the immunostimulatory
nucleic acid can be administered to a subject by any mode that
delivers the nucleic acid to the desired surface, e.g., mucosal,
systemic. Administering the pharmaceutical composition of the
present invention may be accomplished by any means known to the
skilled artisan. Preferred routes of administration include but are
not limited to oral, parenteral, intramuscular, intranasal,
intratracheal, inhalation, ocular, sublingual, vaginal, and
rectal.
For oral administration, the compounds (i.e., immunostimulatory
nucleic acids, antigens and other therapeutic agents) can be
formulated readily by combining the active compound(s) with
pharmaceutically acceptable carriers well known in the art. Such
carriers enable the compounds of the invention to be formulated as
tablets, pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions and the like, for oral ingestion by a subject to be
treated. Pharmaceutical preparations for oral use can be obtained
as solid excipient, optionally grinding a resulting mixture, and
processing the mixture of granules, after adding suitable
auxiliaries, if desired, to obtain tablets or dragee cores.
Suitable excipients are, in particular, fillers such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose
preparations such as, for example, maize starch, wheat starch, rice
starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Optionally the oral formulations may also be formulated
in saline or buffers for neutralizing internal acid conditions or
may be administered without any carriers.
Dragee cores are provided with suitable coatings. For this purpose,
concentrated sugar solutions may be used, which may optionally
contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel,
polyethylene glycol, and/or titanium dioxide, lacquer solutions,
and suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may be added to the tablets or dragee coatings for
identification or to characterize different combinations of active
compound doses.
Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of
tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according
to the present invention may be conveniently delivered in the form
of an aerosol spray presentation from pressurized packs or a
nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically,
may be formulated for parenteral administration by injection, e.g.,
by bolus injection or continuous infusion. Formulations for
injection may be presented in unit dosage form, e.g., in ampoules
or in multi-dose containers, with an added preservative. The
compositions may take such forms as suspensions, solutions or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing
agents.
Pharmaceutical formulations for parenteral administration include
aqueous solutions of the active compounds in water-soluble form.
Additionally, suspensions of the active compounds may be prepared
as appropriate oily injection suspensions. Suitable lipophilic
solvents or vehicles include fatty oils such as sesame oil, or
synthetic fatty acid esters, such as ethyl oleate or triglycerides,
or liposomes. Aqueous injection suspensions may contain substances
which increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
Alternatively, the active compounds may be in powder form for
constitution with a suitable vehicle, e.g., sterile pyrogen-free
water, before use.
The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
In addition to the formulations described previously, the compounds
may also be formulated as a depot preparation. Such long acting
formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
The pharmaceutical compositions also may comprise suitable solid or
gel phase carriers or excipients. Examples of such carriers or
excipients include but are not limited to calcium carbonate,
calcium phosphate, various sugars, starches, cellulose derivatives,
gelatin, and polymers such as polyethylene glycols.
Suitable liquid or solid pharmaceutical preparation forms are, for
example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer (1990) Science 249:1527-33, which is incorporated herein by
reference.
The immunostimulatory nucleic acids and optionally other
therapeutics and/or antigens may be administered per se (neat) or
in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
Suitable buffering agents include: acetic acid and a salt (1-2%
w/v); citric acid and a salt (1-3% w/v); boric acid and a salt
(0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
The pharmaceutical compositions of the invention contain an
effective amount of an immunostimulatory nucleic acid and
optionally antigens and/or other therapeutic agents optionally
included in a pharmaceutically acceptable carrier. The term
"pharmaceutically acceptable carrier" means one or more compatible
solid or liquid filler, diluents or encapsulating substances which
are suitable for administration to a human or other vertebrate
animal. The term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being commingled
with the compounds of the present invention, and with each other,
in a manner such that there is no interaction
For treatment of a subject, depending on activity of the compound,
manner of administration, purpose of the immunization (i.e.,
prophylactic or therapeutic), nature and severity of the disorder,
age and body weight of the patient, different doses may be
necessary. The administration of a given dose can be carried out
both by single administration in the form of an individual dose
unit or else several smaller dose units. Multiple administration of
doses at specific intervals of weeks or months apart is usual for
boosting the antigen-specific responses.
Other delivery systems can include time-release, delayed release or
sustained release delivery systems. Such systems can avoid repeated
administrations of the compounds, increasing convenience to the
subject and the physician. Many types of release delivery systems
are available and known to those of ordinary skill in the art. They
include polymer base systems such as poly(lactide-glycolide),
copolyoxalates, polycaprolactones, polyesteramides,
polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
Microcapsules of the foregoing polymers containing drugs are
described in, for example, U.S. Pat. No. 5,075,109. Delivery
systems also include non-polymer systems that are: lipids including
sterols such as cholesterol, cholesterol esters and fatty acids or
neutral fats such as mono-, di-, and tri-glycerides; hydrogel
release systems; silastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152, and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
The present invention is further illustrated by the following
Examples, which in no way should be construed as further limiting.
The entire contents of all of the references (including literature
references, issued patents, published patent applications, and
co-pending patent applications) cited throughout this application
are hereby expressly incorporated by reference.
EXAMPLES
Example 1
ODN 2395 is a Remarkably Strong Activator of NK Cells and
IFN-.alpha. Production
We previously recognized and described oligodeoxynucleotides (ODN)
containing neutralizing motifs consisting of repeats of the
sequence CG such as CGCGCG or where the CG is preceded by a C
and/or followed by a G. These neutralizing motifs were believed to
reduce the stimulatory effects of ODN on multiple readouts, such as
secretion of IL-6, IL-12, IFN-.gamma., TNF-.alpha., and induction
of an antigen-specific immune response. Krieg A M et al. (1998)
Proc Natl Acad Sci USA 95:12631-6.
In many cases, the presence of a neutralizing motif in an
oligonucleotide together with a stimulatory motif was believed to
prevent immune activation. One such ODN containing both stimulatory
and neutralizing motifs is ODN 2136, which has the sequence
TCCTGACGTTCGGCGCGCGCCC (SEQ ID NO: 19). The 3' end of this ODN
contains a fairly typical neutralizing motif, CGGCGCGCGCCC (SEQ ID
NO: 37), derived from the 3' end of the inhibitory ODN 2010
(GCGGCGGGCGGCGCGCGCCC, SEQ ID NO: 38). Surprisingly, ODN 2136 had
strong activity for inducing NK cell lytic activity (lytic units,
L.U.). As shown in Table 1, ODN 2136 at a concentration of 3
.mu.g/ml was actually stronger than our standard B-cell and NK cell
stimulatory phosphorothioate ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT,
SEQ ID NO: 39) for induction of L.U. More strikingly, whereas ODN
2006 only induced the production of 2,396 pg/ml of IFN-.alpha., ODN
2136 induced the production of 14,278 pg/ml (FIG. 1). This
indicated that, surprisingly, the presence of this neutralizing
sequence was not necessarily to be avoided.
TABLE-US-00001 TABLE 1 Human PBL Cultured Overnight With Various
ODN. E:T RATIO ODN 3.1 6.3 12.5 25.0 50.0 100.0 L.U. ALONE 0.86
1.47 4.15 7.25 11.66 18.57 0.13 IL-2 (100 U/ml) 12.21 29.21 46.63
67.88 78.28 76.65 33.26 1585 (3 .mu.g/ml) 6.47 12.61 24.65 36.82
49.30 53.00 11.69 1585 (10 .mu.g/ml) 8.52 18.17 33.20 51.26 72.13
73.89 20.94 1585 (30 .mu.g/ml) 5.75 13.05 20.00 34.34 45.02 56.49
10.66 2118 (10 .mu.g/ml) 0.62 2.08 3.90 8.53 12.79 15.93 0.09 2006
(0.6 .mu.g/ml) 1.62 2.88 8.24 14.10 21.85 31.91 1.73 2006 (3
.mu.g/ml) 7.07 17.02 30.28 50.66 69.13 74.27 19.41 2169 (0.6
.mu.g/ml) 3.65 3.81 6.67 13.45 24.48 32.42 1.84 2169 (3 .mu.g/ml)
11.20 21.47 38.15 59.66 78.96 77.72 25.76 1760 (0.6 .mu.g/ml) 0.35
2.70 6.85 8.59 16.09 20.63 0.33 1760 (3 .mu.g/ml) 7.57 12.94 27.50
46.63 62.43 66.97 16.60 1758 (0.6 .mu.g/ml) 2.07 6.05 12.80 23.25
34.57 44.93 5.43 1758 (3 .mu.g/ml) 8.40 17.84 33.41 52.20 69.52
74.46 20.78 2398 (0.6 .mu.g/ml) 1.83 1.92 6.21 11.21 20.38 26.71
0.98 2398 (3 .mu.g/ml) 4.36 12.90 24.10 42.37 60.51 70.03 15.02
2397 (0.6 .mu.g/ml) 2.14 3.15 8.79 17.37 28.71 42.45 3.80 2397 (3
.mu.g/ml) 10.09 22.52 38.96 61.85 77.69 74.87 26.12 2396 (0.6
.mu.g/ml) 2.93 5.80 13.22 25.32 36.83 46.77 6.13 2396 (3 .mu.g/ml)
9.03 18.65 32.71 54.62 72.62 73.67 21.64 2395 (0.6 .mu.g/ml) 5.10
9.22 17.21 31.67 49.53 60.53 10.59 2395 (3 .mu.g/ml) 10.91 24.55
40.42 61.23 71.11 75.52 26.94 2136 (0.6 .mu.g/ml) 0.39 2.89 7.12
12.70 18.88 24.11 0.78 2136 (3 .mu.g/ml) 11.94 23.57 39.11 55.16
70.84 71.99 25.62
ODN sequences for Table 1 1585 GGGGTCAACGTTGAGGGGGG (SEQ ID NO: 35)
1758 TCTCCCAGCGTGCGCCAT (SEQ ID NO: 40) 1760 ATAATCGACGTTCAAGCAAG
(SEQ ID NO: 41) 2006 TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 39) 2118
GGGGTCAAGCTTGAGGGGGG (SEQ ID NO: 36) 2136 TCCTGACGTTCGGCGCGCGCCC
(SEQ ID NO: 19) 2169 TCTATCGACGTTCAAGCAAG (SEQ ID NO: 42) 2395
TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO: 1) 2396
TCGTCGTTTTTGTCGTTTTTGTCGTT (SEQ ID NO: 43) 2397
TCGTCGTTTTGTCGTTTTTGTCGTTT (SEQ ID NO: 44) 2398
TTCGTGTTTTCGTGTTTTCGTCGT (SEQ ID NO: 45)
However, in an effort to understand this observation, an even
stronger NK activator and IFN-.alpha. inducer was created by
combining the 3' end of ODN 2136 with the 5' end of ODN 2006. The
resulting ODN 2395 (TCGTCGTTTTCGGCGCGCGCCG, SEQ ID NO: 1)
serendipitously incorporated a change of the last base on the 3'
end from a C to a G. This single base change has the effect of
creating a perfect 12-base-long palindrome at the 3' end of ODN
2395 where in ODN 2136 the palindrome is only 10 bases long.
Table 2 shows another example of data where ODN 2395 is remarkably
potent at inducing NK cell L.U. compared to most other
all-phosphorothioate backbone ODN. In this assay ODN 2395 is weaker
than the positive control ODN 1585, which has a chimeric
phosphorothioate/phosphodiester (SOS) backbone. ODN 1585
(ggGGTCAACGTTGAgggggG, SEQ ID NO: 35), is described in published
PCT Application WO 01/22990. At the low concentration of 0.6
.mu.g/ml tested in this experiment, ODN 2136 induced no L.U. above
the background of 0.03 in the no-ODN control. FIG. 2 and FIG. 3
show the level of monocyte chemotactic protein (MCP)-1 and
IFN-inducible protein (IP)-10, respectively, in the supernatants
from the NK cell cultures in Table 2. MCP-1 is a chemokine that is
a ligand for CCR2 and is associated with both Th1 and Th2-type
immune responses. IP-10 is a CXC chemokine that is a ligand for
CXCR3 and is associated with Th1 responses. Loetscher P et al.
(2001) J Biol Chem 276:2986-91. These data show that ODN 2395 is a
relatively strong inducer of IP-10 production, but induces only
average levels of MCP-1.
TABLE-US-00002 TABLE 2 Human PBL Cultured Overnight With Various
ODN. E:T RATIO ODN 3.1 6.3 12.5 25.0 50.0 100.0 L.U. ALONE 1.73
3.10 4.25 7.72 12.07 14.56 0.03 IL-2 (100 U/ml) 16.68 29.41 49.42
74.78 87.64 92.63 37.17 1585 (10 .mu.g/ml) 9.60 17.25 35.63 55.76
77.53 87.14 22.94 2118 (10 .mu.g/ml) 2.99 2.88 3.41 6.72 9.26 14.18
0.01 2183 (0.6 .mu.g/ml) 2.13 2.28 3.29 8.17 10.47 17.87 0.07 2186
(0.6 .mu.g/ml) 1.23 2.18 3.50 6.26 9.58 14.51 0.02 2133 (0.6
.mu.g/ml) 2.13 3.45 9.69 18.85 32.72 44.67 4.63 2135 (0.6 .mu.g/ml)
2.07 4.06 7.70 12.63 21.90 34.58 1.92 2139 (0.6 .mu.g/ml) 2.94 5.15
9.63 15.15 24.90 38.71 2.83 2117 (0.6 .mu.g/ml) 1.21 2.32 4.08 7.61
10.09 16.27 0.05 2137 (0.6 .mu.g/ml) 1.66 2.79 4.43 7.92 10.64
16.91 0.06 2006 (0.6 .mu.g/ml) 1.92 3.38 5.06 11.57 16.82 25.30
0.65 2006 (0.6 .mu.g/ml) 0.91 2.19 4.52 7.39 13.86 21.57 0.28 2006
(0.6 .mu.g/ml) 1.92 3.59 7.67 12.51 18.99 28.03 1.04 2395 (0.6
.mu.g/ml) 2.88 7.20 10.80 23.96 37.97 54.38 7.02 2396 (0.6
.mu.g/ml) 0.92 2.18 4.07 5.78 10.18 14.95 0.03 2397 (0.6 .mu.g/ml)
3.05 5.24 10.51 17.50 33.51 46.50 4.92 2398 (0.6 .mu.g/ml) 1.37
2.82 5.16 8.48 15.72 21.72 0.34 2012 (0.6 .mu.g/ml) 0.88 1.71 4.41
7.07 10.97 16.47 0.06 2102 (0.6 .mu.g/ml) 2.36 5.82 10.59 17.88
30.96 39.79 3.81 2103 (0.6 .mu.g/ml) 2.12 4.32 8.83 13.49 25.23
35.47 2.37 2013 (0.6 .mu.g/ml) 1.11 2.42 4.42 6.01 9.15 13.44 0.01
2142 (0.6 .mu.g/ml) 0.94 1.55 4.38 7.44 11.45 16.84 0.08 2180 (0.6
.mu.g/ml) 2.06 4.08 6.91 11.54 16.82 25.76 0.67 2007 (0.6 .mu.g/ml)
1.83 3.30 6.68 12.34 20.74 29.10 1.25 2136 (0.6 .mu.g/ml) 0.01
ODN sequences for Table 2 1585 GGGGTCAACGTTGAGGGGGG (SEQ ID NO: 35)
2006 TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 39) 2007
TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO: 46) 2013
TGTCGTTGTCGTTGTCGTTGTCGTT (SEQ ID NO: 48) 2102
TCGTCGTTTTGACGTTTTGTCGTT (SEQ ID NO: 49) 2103
TCGTCGTTTTGACGTTTTGACGTT (SEQ ID NO: 50) 2117
TZGTZGTTTTGTZGTTTTGTZGTT (SEQ ID NO: 51) 2118 GGGGTCAAGCTTGAGGGGGG
(SEQ ID NO: 36) 2133 TCGTCGTTGGTTGTCGTTTTGGTT (SEQ ID NO: 17) 2135
ACCATGGACGAGCTGTTTCCCCTC (SEQ ID NO: 18) 2136
TCCTGACGTTCGGCGCGCGCCC (SEQ ID NO: 19) 2137
TGCTGCTTTTGTGCTTTTGTGCTT (SEQ ID NO: 20) 2139
TCGTCGTTTCGTCGTTTTGACGTT (SEQ ID NO: 21) 2142
TCGCGTGCGTTTTGTCGTTTTGACGTT (SEQ ID NO: 22) 2180
TCGTCGTTTTTTGTCGTTTTTTGTCGTT (SEQ ID NO: 52) 2183
TTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 53) 2186
TCGTCGCTGTCTCCGCTTCTTCTTGCC (SEQ ID NO: 54) 2395
TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO: 1) 2396
TCGTCGTTTTTGTCGTTTTTGTCGTT (SEQ ID NO: 43) 2397
TCGTCGTTTTGTCGTTTTTGTCGTTT (SEQ ID NO: 44) 2398
TTCGTGTTTTCGTGTTTTCGTCGT (SEQ ID NO: 45)
Based on these and other data, we concluded that the ODN 2395
sequence was a remarkably strong activator of NK cells and
IFN-.alpha. production.
Example 2
ODN Related to ODN 2395 are Also Strong Activators of NK Cells and
IFN-.alpha. Production
Additional ODN 2427-2433 (SEQ ID NOs: 2-8) were designed and
synthesized to test the possibility that the palindrome at the 3'
end of ODN 2395 may be important in its immune stimulatory
activity. Table 3 compares the ability of these different ODN to
activate NK L.U. As is evident from these data, the strongest ODN
at the concentration of 1 .mu.g/ml is ODN 2429
(TCGTCGTTTTCGGCGGCCGCCG, SEQ ID NO: 4) which induced 2.85 L.U. of
NK activity. ODN 2006 was very weak in the experiment, and all of
the other oligos that were tested except for the control ODN 2118
(GGGGTCAAGCTTGAGGGGGG, SEQ ID NO: 36) that has no CG were stronger
than 2006. ODN 2429 is notable because it is the only one that
maintains a 12-base palindrome, although this is a different
palindrome from the one that was present in 2395. ODN 2430
(TCGTCGTTTTCGGCGCGCCGCG, SEQ ID NO: 5), which is the second
strongest ODN at the 1 .mu.g/ml concentration, is similar; but the
palindrome has been slightly shortened to 10 bases long. The
remainder of the ODN have either no or shorter palindromic
sequences, and induce less NK activity.
TABLE-US-00003 TABLE 3 Human PBL Cultured Overnight With Various
ODN. E:T RATIO ODN 3.1 6.3 12.5 25.0 50.0 100.0 L.U. ALONE 0.37
0.64 0.25 1.02 2.15 3.23 0.00 IL-2 (100 U/ml) 3.01 4.20 9.01 18.92
27.37 38.17 3.22 1585 (10 .mu.g/ml) 1.35 2.30 4.38 8.07 13.96 22.31
0.31 2118 (10 .mu.g/ml) -0.31 -0.21 0.22 1.57 1.24 2.41 0.00 2395
(1 .mu.g/ml) 1.01 2.61 5.73 11.39 18.92 28.16 1.04 2395 (3
.mu.g/ml) 1.59 2.55 5.96 12.09 20.46 33.87 1.71 2006 (1 .mu.g/ml)
-0.08 0.73 1.45 3.03 7.11 12.49 0.01 2006 (3 .mu.g/ml) 0.16 0.76
2.98 4.98 9.79 20.58 0.15 2427 (1 .mu.g/ml) 0.85 1.80 4.03 6.37
12.53 24.12 0.34 2427 (3 .mu.g/ml) 0.96 2.24 4.40 8.00 15.01 21.85
0.33 2428 (1 .mu.g/ml) 1.19 1.97 3.64 7.72 16.27 24.74 0.53 2428 (3
.mu.g/ml) 1.42 2.36 5.67 11.06 19.11 28.17 1.03 2429 (1 .mu.g/ml)
1.47 3.84 7.83 14.17 25.47 38.99 2.85 2429 (3 .mu.g/ml) 0.57 2.38
4.21 8.98 16.88 26.36 0.72 2430 (1 .mu.g/ml) 1.49 3.55 6.25 12.76
20.51 31.67 1.51 2430 (3 .mu.g/mi) 1.23 1.52 3.89 8.78 15.28 25.56
0.57 2431 (1 .mu.g/ml) 0.96 2.90 3.58 8.29 15.23 25.29 0.53 2431 (3
.mu.g/ml) 1.82 3.25 5.53 9.67 21.04 32.78 1.51 2432 (1 .mu.g/ml)
1.67 2.97 4.87 8.54 19.26 27.10 0.84 2432 (3 .mu.g/ml) 1.03 2.39
5.22 9.41 18.48 25.74 0.76 2433 (1 .mu.g/ml) 0.74 1.84 2.30 6.97
12.43 18.94 0.15 2433 (3 .mu.g/ml) 1.25 3.13 4.47 9.85 14.77 22.75
0.38
ODN sequences for Table 3 1585 GGGGTCAACGTTGAGGGGGG (SEQ ID NO: 35)
2006 TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 39) 2118
GGGGTCAAGCTTGAGGGGGG (SEQ ID NO: 36) 2395 TCGTCGTTTTCGGCGCGCGCCG
(SEQ ID NO: 1) 2427 TCGTCGTTTTCGTCGCGCGCCG (SEQ ID NO: 2) 2428
TCGTCGTTTTCGTCGCGCGGCG (SEQ ID NO: 3) 2429 TCGTCGTTTTCGGCGGCCGCCG
(SEQ ID NO: 4) 2430 TCGTCGTTTTCGGCGCGCCGCG (SEQ ID NO: 5) 2431
TCGTCGTTTTCGGCGCCGGCCG (SEQ ID NO: 6) 2432 TCGTCGTTTTCGGCCCGCGCGG
(SEQ ID NO: 7) 2433 TCGTCGTTTTCCGCCGCCGGGG (SEQ ID NO: 8)
FIG. 4 shows the ability of these oligos to induce IFN-.alpha.
production compared to the positive control SOS ODN 2216
(GGGGGACGATCGTCGGGGG, SEQ ID NO: 55), 2334
(GGGGTCGACGTCGACGTCGAGGGGGGG, SEQ ID NO: 56), and 2336
(GGGGACGACGTCGTGGGGGGG, SEQ ID NO: 57). All of the 2395-related ODN
induce a higher level of IFN-.alpha. production than ODN 2006,
although the levels are below the levels induced by the chimeric
SOS ODN. The rank order of induction of IFN-.alpha. expression is
roughly similar to that of NK L.U., with the strongest effects seen
by ODN 2395 and 2429.
Example 3
the Strong Stimulatory Effects on NK Cells and IFN-.alpha.
Production do not Correspond to B-Cell Effects
As shown in FIG. 5A, ODN 2395 and its relatives were significantly
weaker at a 0.25 .mu.g/ml concentration than ODN 2006 or its
relative 2397, in terms of their ability to induce B-cell
expression of CD86 at 48 hours. As we have noticed previously, at
higher ODN concentrations such as 1 .mu.g/ml, less difference was
seen between the various ODN (FIG. 5B). In the same experiment, we
also measured B-cell activation by a proliferation assay
(.sup.3H-thymidine incorporation; FIG. 6). Again, at the 0.25
.mu.g/ml concentration ODN 2006 and ODN 2397 (SEQ ID NO: 44) were
by far the strongest (FIG. 6A). However, at higher concentrations,
the 2395-related ODN were similar in their efficacy (FIG. 6B).
Example 4
ODN 2395 and Related ODN are Weak Inducers of IL-10
Our previous studies have suggested that most of the IL-10
production that is induced by CpG is derived from B cells. As shown
in FIG. 7, IL-10 expression correlated well with B-cell
proliferation. Again, ODN 2006 and its relative ODN 2397 were the
strongest at the low concentration of 0.25 .mu.g/ml. ODN 2395 and
its relatives induced less IL-10 production at this
concentration.
Example 5
Concentration Dependence of Immune Stimulatory Effect
Additional studies on this class of oligonucleotides and the
derivatives involved ODN numbers 2427-2433 (SEQ ID NOs: 2-8). Data
for these ODN are shown in FIG. 8. This demonstrates again that ODN
2006 was very weak at inducing IFN-.alpha. production at a
concentration of either 1 or 6 .mu.g/ml. However, ODN 2395 induced
substantial amounts of IFN-.alpha., especially at the lower
concentration of 1 .mu.g/ml. We have occasionally seen ODN where
the stimulatory activity was reduced at higher concentrations, such
as 6 .mu.g/ml, in comparison to the effects seen at lower
concentrations such as 1 .mu.g/ml. In the experiments shown in FIG.
8, ODN 2395 was more potent at the lower concentration than at the
higher concentration, but ODN 2429 was more potent at the higher
concentration. In contrast to the common inverted dose-response
curve of phosphorothioate ODN, chimeric ODN such as ODN 2336 in
this experiment typically showed increased immune stimulatory
effects at higher concentrations. The stimulatory effect of ODN
2432 in this experiment shown in FIG. 8 was interesting considering
that this ODN has no good palindrome. This system with the
relatively weak B cell stimulatory activity is shown in FIG. 5 and
FIG. 6.
Example 6
Reciprocal Relationship Between B-Cell Stimulation and NK
Stimulation and IFN-.alpha. Secretion
FIG. 9 shows another experiment, where ODN 2395 at a low
concentration of 0.4 .mu.g/ml was significantly weaker than ODN
2006 at inducing B cell expression of CD86. The other relatives of
2395 show a less marked loss of B cell stimulation. Interestingly,
there is the suggestion of the same rank order for loss of B cell
stimulation that had previously been seen for gain of NK
stimulation: ODN 2429, followed by ODN 2430, are the weakest B cell
stimulators among the 2395 relatives. This raises the possibility
that the loss of B cell stimulation by the 2395-like ODN is closely
related to the gain of NK stimulation and IFN-.alpha. secretion.
FIG. 10 and FIG. 11 show the IFN-.alpha. induction is seen with ODN
2395 and ODN 2429, followed by ODN 2430. Table 4 and FIG. 12, from
a separate experiment, also show the strong ability of ODN 2395 and
ODN 2429 to induce IFN-.alpha. secretion in two different human
donors (D141 and D142).
TABLE-US-00004 TABLE 4 IFN-.alpha. Secretion by Variants of ODN
2395.sup.1 IFN-.alpha., pg/ml ODN, 6 .mu.g/ml D141 D142 2006 10
.+-. 10 7 .+-. 0.5 2336 83,297 .+-. 1876.5 53530.5 .+-. 4840 2395
6214 .+-. 84.5 2031 .+-. 96 2429 7215 .+-. 68 1117.5 .+-. 495 5293
10 .+-. 0.5 27 .+-. 27 5294 2.5 .+-. 0.1 23 .+-. 23 5295 5 .+-. 0.5
0 .+-. 0 5296 10 .+-. 0 10 .+-. 0 5297 10 .+-. 0.5 26.5 .+-. 1
without(w/o) 110 .+-. 77.5 12 .+-. 12 .sup.1Data expressed in units
of pg/ml as mean .+-. standard deviation.
ODN sequences for Table 4 2006 TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:
39) 2336 GGGGACGACGTCGTGGGGGGG (SEQ ID NO: 57) 2395
TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO: 1) 2429 TCGTCGTTTTCGGCGGCCGCCG
(SEQ ID NO: 4) 5293 TCGTCGTTTTCGGCGGCCGCC (SEQ ID NO: 58) 5294
TCGTCGTTTTCGGCCGCCGCC (SEQ ID NO: 59) 5295 TCGTCGTTTTCGGCCGCCGCCG
(SEQ ID NO: 60) 5296 TCGTCGTTTTCGCCGCCGCCG (SEQ ID NO: 61) 5297
TGCTGCTTTTCGGCGGCCGCCG (SEQ ID NO: 62)
Example 7
Characteristics of the GC-Rich Domain
Surprisingly, none of the ODN 5293-5297 demonstrated strong immune
stimulatory responses. ODN 5293 contains a 10-base palindrome, but
the palindrome differs from that in 2395 in that the central CG is
inverted to a GC. However, it is believed that this change by
itself cannot explain the loss of activity since ODN 2429 also has
such an inversion. Rather, greater levels of activity may occur
with a 12-base palindrome unless there is a central CG in the
palindrome. However, ODN 2430 also has only a 10-base palindrome
with a central GC dinucleotide. The immune stimulatory activity of
ODN 2430 may be enhanced by the fact that it contains five CpG
dinucleotides in the 3' terminus, whereas ODN 5293 contains only
three.
ODN 5294 contains only a 6-base palindrome, which could possibly be
related to its low activity. ODN 5295 likewise has no good
palindrome. The low activity of ODN 5296 suggests that simple
repeats of CCG are not sufficient to confer the immune stimulatory
effects of ODN 2395. ODN 2397 has a perfect 12-base palindrome at
the 3' end, but has no CpG motifs at the 5' end. Since the 12-base
palindrome in ODN 5297 is the same at that in ODN 2429, it can be
concluded that the 5' TCGTCG motif of ODN 2429 is important for its
immune stimulatory activity. That is, it is believed that the
presence of the neutralizing palindrome of ODN 2429 at one end of
an oligonucleotide will be insufficient to provide immune
stimulatory activity in the absence of at least one stimulatory
motif at the other end.
Example 8
Effects on IFN-.gamma. Production
Several additional types of assays have been performed to better
understand the range of immune stimulatory effects of this new
class of immune stimulatory nucleic acid. FIG. 13 shows some of the
effects of these ODN on IFN-.gamma. production from the
supernatants of human PBMCs. These cells were the same as those
used in the experiments shown in Table 3, but the supernatants from
the cultures were assayed for their IFN-.gamma. levels. Panel C in
FIG. 13 shows that SOS CpG ODNs such as ODN 1585 induce some
IFN-.gamma. production, whereas ODNs without the CpG motif (e.g.,
control ODN 2118) do not. Panels A and B of FIG. 13 show that ODN
2006 is relatively weak at inducing IFN-.gamma. production, while
ODN 2395 and its cousins are somewhat stronger.
Another set of studies was performed to examine the effects of
these different ODN on dendritic cells. The plasmacytoid DC (pDC)
is the source of the IFN-.alpha. that is produced in response to
ODN 2395 and its relatives. The effects of the various ODN on
myeloid DC (mDC) are relatively similar in that all of the ODN
induce partially purified mDC to activate CD4.sup.+ T cells to
produce IFN-.gamma. (FIG. 14 and FIG. 15). Myeloid DC were isolated
from a buffy coat and incubated with GM-CSF (4.4 ng/ml) and various
ODN for 2 days. CD4+ naive T cells were then isolated from a
different donor and mixed with the DC at selected effector to
target (E:T) ratios and incubated for 6 more days. Cells were then
stained and analyzed by fluorescence activated cell sorting (FACS).
Results were measured in terms of the percentage of CD3+ cells that
stained for IFN-.gamma.. FIG. 14 shows the percentage of T cells
that stained positive for IFN-.gamma. and FIG. 15 shows the mean
fluorescence intensity (MFI) of IFN-.gamma. staining in these T
cells.
Example 9
not all GC-Rich Palindromes are Effective
Several additional ODN were synthesized in order better to
understand the structural requirements for this new class of ODN.
Since we noted that potent immune stimulatory ODN contained GC-rich
palindromes, ODN 2449 (TCGTCGTTTTCGGGGGGCCCCC, SEQ ID NO: 9) and
2450 (TCGTCGTTTTCCCCCCGGGGGG, SEQ ID NO: 10) were synthesized to
have GC-rich palindromes which were simply straight Gs followed by
straight Cs, or straight Cs followed by straight Gs. As shown in
FIG. 16, neither of these ODN induced IFN-.alpha. production.
Example 10
Effect of Orientation of Immune Stimulatory Sequence and
Neutralizing Motif
ODN 2451 (TCGGCGCGCGCCGTCGTCGTTT, SEQ ID NO: 11) was synthesized to
test the possibility that the 5' and 3' orientation of the
"stimulatory" TCGTCG motif and the "neutralizing" CGGCGCGCGCCG (SEQ
ID NO: 23) palindrome could be inverted without losing immune
stimulatory activity. Indeed, ODN 2451 was highly stimulatory (FIG.
16). ODN 2452 (TCGTCGTTTTCGGCGCGCGCCGTTTTT, SEQ ID NO: 12) was
synthesized to determine whether additional sequence could be added
to the 3' end of the CGGCGCGCCCCG (SEQ ID NO: 23) palindrome
without reducing the immune stimulatory activity, provided the
stimulatory TCGTCG motif was on the 5' end. Indeed, this ODN was
also highly immune stimulatory (FIG. 16).
Example 11
Variants of ODN 2395 and their Induction of IFN-.alpha.
To study in more detail the structural requirements of this new
class of ODN to induce IFN-.alpha. secretion, variants of ODN 2395
were synthesized and tested for their immunostimulatory activity.
Table 5 summarizes the data concerning IFN-.alpha. induction.
TABLE-US-00005 TABLE 5 Variants of ODN 2395 and their induction of
IFN-.alpha..sup.1,2 ODN SEQ ID NO: Sequence Palindrome Description
lFN-.alpha. Induction 2006 39 tcgtcgttttgtcgttttgtc- / ODN class B
- gtt 2336 57 ggGGACGACGTCCTGgggggG + ODN class A +++++ 2395 1
tcgtcgttttcggcgcgcgccg + 2006-2136 ++ 2427 2 tcgtcgttttcgtcgcgcgccg
- - 2428 3 tcgtcgttttcgtcgcgcgg- - - cg 2429 4
tcgtcgttttcggcggccgc- - cg.fwdarw.ge by preserving +++ cg
palindrome 2430 5 tcgtcgttttcggcgcgccg- - + cg 2431 6
tcgtcgttttcggcgcgccg- - +/- cg 2432 7 tcgtcgttttcggcccgcgc- - + gg
2433 8 tcgtcgttttccgccgccgg- - - gg 5293 58 tcgtcgttttcggcggccgcc
(+) 2429 w/o 3' g - 5294 59 tcgtcgttttcggccgccgcc - 3xgcc w/o 3' g
- 5295 60 tcgtcgttttcggccgccgc- - 5295 w/3' g - cg 5296 61
tcgtcgttttcgccgccgccg - - 5297 62 tgctgcttttcggcggccgc- + gc of
2429 - cg 5327 14 tgctzgttttzggzgzgzgz- + 2395 w/methyl-c (z) + zg
5328 15 tgctgcttttcggcgcgcgc- + ge of 2395 - cg 2136 19
tcctgacgttcggcgcgcgc- (+) +/- cc 5315 13 tcctgacgttcggcgcgcgc- +
2136 w/3' g + cg longer palindrome 5329 16 tcgtcgttttcgcgcgcgcgcg +
2006 +1631 (-) .sup.1Underlined are nucleotides that differ from
2395; palindromic sequences are in italics. .sup.2All except ODN
2336, that represents a chimeric backbone ODN (capitals indicate
phosphodiestcr linkage and lower case represent phosphorothioatc
linkage), are completely phosphorothioatc ODNs.
From the first set of experiments using the phosphorothioate ODNs
2395 and 2427-2433 it became clear that the palindromic sequence at
the 3' end of the ODN has an important role for induction of
IFN-.alpha. secretion by dendritic cells that are the main
producers of IFN-.alpha. (see 2395 and 2429), although some ODN
without such a palindrome at the 3' end (e.g., ODN 2430 and ODN
2432) also induced IFN-.alpha. in somewhat lower amounts (example
in FIG. 17A). ODN 2395 and ODN 2429 induced the highest amounts of
IFN-.alpha., whereas 2006 (class B ODN) induced none to minimal
amounts, and ODN 2336 (class A ODN) induced large amounts of this
cytokine. Most experiments demonstrated that ODN 2429 induced even
higher amounts of this cytokine (FIG. 17B). An introduction of an
additional TCG motif (e.g., ODN 2427 and ODN 2428) appeared to have
negative effects on IFN-.alpha. secretion. Based on data from these
and other studies of ODN 2186, the gcc at the 3' end seemed to play
a possible role in the observed effects.
Therefore, we tested another set of ODNs all having GCC sequences
at the 3' end. None of these ODN were observed to induce
IFN-.alpha.. Therefore, only GCC itself in a palindrome seems not
to be sufficient for the observed effects.
In addition, ODN 5297 with a TGC at the 5' end did not induce any
IFN-.alpha. despite bearing the palindromic 3' sequence. This led
to the conclusion that not only the 3' palindromic sequence but
also the 5' TCG motif is important for the activity of these
ODNs.
This was confirmed by using ODN 5328 (2395 with 5' TGC motif). In
contrast to methylation of class A ODNs, methylation at least of
the 5' motif decreased, but did not abrogate, IFN-.alpha.
secretion. This finding is in accordance with results obtained with
class B ODNs. Nevertheless, an ODN with part of the 3' palindrome
but a different sequence at the 5' end with only one CpG
dinucleotide (ODN 2136) also induced IFN-.alpha.. In preliminary
results using this ODN and an ODN with the full 3' palindrome (ODN
5315), ODN 5315 was better than ODN 2136 but not as good as ODN
2395.
The fact that ODN 5329 seems to induce no or only very low amounts
of IFN-.alpha. although having a full CG palindrome at the 3' end
indicates that specific palindromic sequences are preferred for
IFN-.alpha. activity.
Example 12
Reciprocal Relationship Between B-Cell Activation and Induction of
IFN-.alpha.
An additional B-cell activation experiment was performed with a
panel of some of the ODNs of Example 11 (FIG. 18). The results
indicated that the better is an ODN for induction of IFN-.alpha.,
the less active it is on B cells (compare especially ODNs 2006,
2336, 2395 and 2429). Nevertheless, it also demonstrated that all
of these ODNs were superior to 2336 (class A ODN) in stimulating B
cells.
Example 13
Effect on Secretion of IFN-.gamma.
We also determined secretion of IFN-.gamma. upon incubation of
PBMCs with different concentrations of ODN at different time points
(FIG. 19 A-C). The ODNs tested induced IFN-.gamma. secretion with
the rank order 2336>2395, 2429>2006. Nevertheless, the
difference between the ODNs was not as clear as by using
IFN-.alpha. as a read-out.
Example 14
Effect on IFN-.gamma. in MLR
We also determined the effect of these ODN on the induction of
IFN-.gamma. in a mixed lymphocyte reaction (MLR). In this setting
lymphocytes of one donor respond to antigens expressed on cells of
another donor. The results demonstrated that ODNs 2006, 2336, as
well as 2395 were able to enhance IFN-.gamma. secretion during such
an antigen-specific response (FIG. 20). This indicated that all
these ODN were able to enhance the reactivity to specific
antigen(s).
Example 15
ODN 2395 Induces Less IL-10 than ODN 2006
A further set of experiments focused on the induction of the
pro-inflammatory cytokine IL-10. Again, as before for IFN-.gamma.,
PBMCs were incubated for different times and with different
concentrations of ODNs (FIG. 21 A-C). The results demonstrate that,
as shown before, ODN 2006 induces relatively high amounts of IL-10
in contrast to ODN 2336 that induces only minimal to low amounts.
In contrast, ODNs 2395 as well as ODN 2429 induce more IL-10 than
ODN 2336 but less than ODN 2006. This again confirms that ODN of
this new class of immune stimulatory ODN have stimulatory
activities that place them between those described for ODNs of
class A and class B.
Example 16
ODN 2395 Induces Less TNF-.alpha. than ODN 2006 but More than ODN
8954
Human PBMCs were cultured for 6 hours with 1.6 .mu.g/ml of ODN
2006, 8954, 2395, 2429, or LPS, and supernatants were then
harvested and TNF-.alpha. measured by specific ELISA. Results are
shown in Table 6.
TABLE-US-00006 TABLE 6 Induction of TNF-.alpha. by representative
ODN of different classes ODN TNF-.alpha., pg/ml (LPS) >120 2006
40 2429 35 2395 21 8954 14 none 16
Additional experiments indicated that cytokines IL-5 as well as
IL-15 could not be detected in our experimental settings upon
incubation of PBMCs with these ODNs.
Example 17
Induction of IP-10
Human PBMCs were cultured either alone, in the presence of IL-2, in
the presence of control ODN 1585 or control ODN 2118 at 10
.mu.g/ml, or in the presence of various ODN at 0.6 or 3.0 .mu.g/ml.
Supernatants were harvested after 24 hours and IP-10 was measured
by specific enzyme-linked immunosorbant assay (ELISA). Results are
shown in FIG. 22. ODNs 2395, 2429, 2430, 2432, and 2451 at 3.0
.mu.g/ml, and ODN 2452 at 0.6 .mu.g/ml, all induced large amounts
of IP-10.
Example 18
Induction of IFN-.alpha.
Human PBMCs were cultured either alone, in the presence of IL-2, in
the presence of control ODN 1585 or control ODN 2118 at 10
.mu.g/ml, or in the presence of various ODN at 0.6 or 3.0 .mu.g/ml.
Supernatants were harvested after 24 hours and IFN-.alpha. was
measured by specific ELISA. Results are shown in FIG. 23A (ODN at
0.6 .mu.g/ml) and FIG. 23B (ODN at 3.0 .mu.g/ml). ODNs 2395, 2427,
2429, 2430, 2431, 2432, and 2451 at 3.0 .mu.g/ml, and ODN 2452 at
0.6 .mu.g/ml, all induced large amounts of IFN-.alpha..
Example 19
Induction of IFN-.gamma.
Human PBMCs were cultured either alone, in the presence of IL-2, in
the presence of control ODN 1585 or control ODN 2118 at 10
.mu.g/ml, or in the presence of various ODN at 0.6 or 3.0 .mu.g/ml.
Supernatants were harvested after 24 hours and IFN-.gamma. was
measured by specific ELISA. Results are shown in FIG. 24. ODNs
2395, 2427, 2429, 2430, 2431, 2432, 2451 and 2452 at 3.0 .mu.g/ml,
and ODN 2352 at 0.6 .mu.g/ml, all induced large amounts of
IFN-.gamma..
Example 20
Induction of IL-6
Human PBMCs were cultured either alone, in the presence of IL-2, in
the presence of control ODN 1585 or control ODN 2118 at 10
.mu.g/ml, or in the presence of various ODN at 0.6 or 3.0 .mu.g/ml.
Supernatants were harvested after 24 hours and IL-6 was measured by
specific ELISA. Results are shown in FIG. 25. ODNs 2395, 2430,
2432, 2433, 2136, 2449, 2450, 2451 and 2452 at 0.6 .mu.g/ml, and
ODN 2449 and ODN 2451 at 3.0 .mu.g/ml, all induced large amounts of
IL-6.
Example 21
Induction of IFN-.alpha.
Human PBMCs were cultured either alone or in the presence of
various ODN at 3.0 or 6.0 .mu.g/ml. ODNs included 2006, 8954, 2395,
2449, 2450, 2451, 2452, 5373 (CGGCGCGCGCCG, SEQ ID NO: 23), 5374
(CGGCGCGCGCCGCGGCGCGCGCCG, SEQ ID NO: 24), 5375
(CGGCGCGCGCCGTCGTCGTTT, SEQ ID NO: 25), 5376
(TCGGCGCGCGCCGTGCTGCTTT, SEQ ID NO: 26), and 5377
(CCGCCGTTTTCGGCGCGCGCCG, SEQ ID NO: 27). Supernatants were
harvested after 24 hours and IFN-.alpha. was measured by specific
ELISA. Results are shown in FIG. 26. ODNs 2395, 2451, 2452, and
5376 all induced IFN-.alpha..
Example 22
Induction of IFN-.alpha. by ODN 5515 and ODN 5516
Human PBMCs obtained from two donors (D346 and D240) were cultured
either alone or in the presence of ODN 2006, ODN 5515, or ODN 5516
at 0.8, 2.4, or 6.0 .mu.g/ml. Supernatants were harvested after 24
hours and IFN-.alpha. was measured by specific ELISA. Results are
shown in Table 7. ODN 5515 and ODN 5516 induced IFN-.alpha. more
effectively than ODN 2006, particularly at ODN concentrations of
2.4 and 6.0 .mu.g/ml.
Example 23
Induction of IFN-.alpha. by ODN 20184, 20185, and 20186
Human PBMCs obtained from three donors (D445, D446, and D448) were
cultured either alone or in the presence of ODN 2006, ODN 20184,
ODN 20185, or ODN 20186 at 0.05, 0.1, 0.2, 0.5, or 1.0 .mu.g/ml.
Supernatants were harvested after 24 hours and IFN-.alpha. was
measured by specific ELISA. Results are shown in Table 8. ODN
20184, ODN 20185, and ODN 20186 induced IFN-.alpha. more
effectively than ODN 2006, particularly at 0.2-0.5 .mu.g/ml.
TABLE-US-00007 TABLE 7 Induction of IFN-.alpha. (pg/ml) by ODN 5515
and ODN 5516 Conc. D346 D240 ODN .mu.g/ml Mean .+-. SD Mean .+-. SD
2006 0.8 18.5 .+-. 13.8 36 .+-. 3.3 2.4 0 .+-. 0 19.7 .+-. 6.4 6
2.7 .+-. 0 2.8 .+-. 0 5515 0.8 34.1 .+-. 6.9 16.5 .+-. 2.8 2.4 36.6
.+-. 2.1 106.7 .+-. 17.3 6 39.2 .+-. 26.5 127.3 .+-. 7.7 5516 0.8
4.3 .+-. 0 22.3 .+-. 0.1 2.4 31.9 .+-. 0 172.5 .+-. 82.3 6 26.6
.+-. 19 90.4 .+-. 15.4 none -- 0 .+-. 0 20.9 .+-. 6.5
TABLE-US-00008 TABLE 8 Induction of IFN-.alpha. (pg/ml) by ODN
20184, 20185, and 20186 Conc. D445 D446 D448 ODN .mu.g/ml Mean .+-.
SD Mean .+-. SD Mean .+-. SD 2006 0.05 5.2 .+-. 0.0 58.8 .+-. 1.9
0.9 .+-. 0.0 0.1 27.7 .+-. 14.4 283.5 .+-. 16.1 23.5 .+-. 3.8 0.2
54.9 .+-. 17.6 503.7 .+-. 9.7 39.1 .+-. 5.0 0.5 61.1 .+-. 14.6
227.8 .+-. 12.7 49.8 .+-. 0.4 1.0 26.4 .+-. 15.5 142.6 .+-. 23.1
48.7 .+-. 29.8 20184 0.05 25.6 .+-. 2.1 88.0 .+-. 12.2 0.0 .+-. 0.0
0.1 32.9 .+-. 7.3 691.2 .+-. 32.3 129.1 .+-. 24.8 0.2 256.2 .+-.
8.2 2155.1 .+-. 35.1 314.0 .+-. 22.2 0.5 757.2 .+-. 5.7 2171.8 .+-.
95.9 268.7 .+-. 15.9 1.0 194.3 .+-. 5.7 1181.9 .+-. 15.1 5.8 .+-.
3.4 20185 0.05 65.0 .+-. 10.8 217.9 .+-. 28.4 54.3 .+-. 14.2 0.1
63.6 .+-. 1.3 467.4 .+-. 23.7 150.9 .+-. 5.9 0.2 79.3 .+-. 2.4
1420.5 .+-. 83.7 160.2 .+-. 5.5 0.5 281.3 .+-. 0.2 1965.7 .+-. 72.3
162.4 .+-. 3.8 1.0 176.9 .+-. 12.5 1710.3 .+-. 19.7 181.1 .+-. 0.1
20186 0.05 21.9 .+-. 1.7 223.1 .+-. 1.2 79.8 .+-. 1.6 0.1 58.3 .+-.
7.6 812.2 .+-. 28.1 111.3 .+-. 6.8 0.2 153.6 .+-. 1.5 1302.5 .+-.
56.2 193.5 .+-. 10.5 0.5 267.7 .+-. 7.9 1744.1 .+-. 54.7 227.4 .+-.
6.9 1.0 153.0 .+-. 0.3 1113.6 .+-. 6.4 13.7 .+-. 15.4 Medium -- 0.0
.+-. 0.0 12.8 .+-. 2.0 64.8 .+-. 32.7 -- 0.0 .+-. 0.0 45.3 .+-.
12.9 36.4 .+-. 2.6
Example 24
Induction of IFN-.alpha. by ODN 8954, 5569, and 5570
Human PBMCs obtained from three donors (D521, D525, and D526) were
cultured either alone or in the presence of ODN 2006 (SEQ ID NO:
39), ODN 8954, ODN 5569 (TIGTIGTTTTCGGCGGCCGCCG SEQ ID NO: 63), or
ODN 5570 (TCITCITTTTCGGCGGCCGCCG SEQ ID NO: 70) at 0.03, 0.06,
0.125, 0.25, or 1.0 .mu.g/ml. Supernatants were harvested after 24
hours and IFN-.alpha. and IL-10 were measured by specific ELISA.
Results are shown in Table 9 and 10.
TABLE-US-00009 TABLE 9 Induction of IFN-.alpha. (pg/ml) by ODN
8954, 5569, and 5570 Conc. D521 D525 D526 ODN .mu.g/ml Mean .+-. SD
Mean .+-. SD Mean .+-. SD 2006 0.03 238.674 239.286 216.393 0.06
2405.63 385.161 126.516 0.125 3826.53 549.612 86.173 0.25 2248.94
532.67 74.493 1.0 362.74 161.892 57.087 8954 0.03 305.626 309.581
599.971 0.06 6039.51 2028.52 4707.01 0.125 7322.45 4669.31 5340.21
0.25 7651.13 4641.1 5324.55 1.0 7078.59 4679.59 5474.94 5569 0.03
112.784 121.422 87.751 0.06 110.723 65.753 47.888 0.125 104.547
49.365 41.046 0.25 111.755 62.383 43.216 1.0 2247.97 115.77 1101.58
5570 0.03 822.648 427.535 250.196 0.06 1858.16 1021.18 218.201
0.125 3470.67 1657.3 477.938 0.25 5612.53 3369.99 669.706 1.0
6798.3 3501.59 2560.93 Medium -- 145.436 214.212 66.853 -- 245.121
218.622 0
TABLE-US-00010 TABLE 10 Induction of IL10 (pg/ml) by ODN 8954,
10101 2, 5569, and 5570 Conc. D521 D525 D526 ODN .mu.g/ml Mean .+-.
SD Mean .+-. SD Mean .+-. SD 2006 0.03 151.976 112.414 485.823 0.06
384.377 218.651 898.299 0.125 404.352 242.289 991.614 0.25 357.657
247.405 1150.94 1.0 255.344 162.444 1171.72 8954 0.03 7.456 6.617
6.919 0.06 5.34 5.721 19.787 0.125 10.723 2.986 35.892 0.25 15.308
13.056 67.18 1.0 48.904 30.892 230.725 5569 0.03 0 1.287 1.348 0.06
0 0.127 4.592 0.125 18.815 3.615 62.963 0.25 105.32 30.094 350.529
1.0 256.785 136.833 1156.07 5570 0.03 0 0.31 5.867 0.06 6.599 7.027
29.879 0.125 98.553 38.528 455.145 0.25 259.812 107.164 1169.46 1.0
312.189 206.126 1595.63 Medium -- 1.755 10.543 0 -- 0.29 11.192
0
The foregoing written specification is considered to be sufficient
to enable one skilled in the art to practice the invention. The
present invention is not to be limited in scope by examples
provided, since the examples are intended as a single illustration
of one aspect of the invention and other functionally equivalent
embodiments are within the scope of the invention. Various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
All references, patents and patent publications that are recited in
this application are incorporated in their entirety herein by
reference.
SEQUENCE LISTINGS
1
81122DNAArtificial SequenceSynthetic Oligonucleotide 1tcgtcgtttt
cggcgcgcgc cg 22222DNAArtificial SequenceSynthetic Oligonucleotide
2tcgtcgtttt cgtcgcgcgc cg 22322DNAArtificial SequenceSynthetic
Oligonucleotide 3tcgtcgtttt cgtcgcgcgg cg 22422DNAArtificial
SequenceSynthetic Oligonucleotide 4tcgtcgtttt cggcggccgc cg
22522DNAArtificial SequenceSynthetic Oligonucleotide 5tcgtcgtttt
cggcgcgccg cg 22622DNAArtificial SequenceSynthetic Oligonucleotide
6tcgtcgtttt cggcgccggc cg 22722DNAArtificial SequenceSynthetic
Oligonucleotide 7tcgtcgtttt cggcccgcgc gg 22822DNAArtificial
SequenceSynthetic Oligonucleotide 8tcgtcgtttt ccgccgccgg gg
22922DNAArtificial SequenceSynthetic Oligonucleotide 9tcgtcgtttt
cggggggccc cc 221022DNAArtificial SequenceSynthetic Oligonucleotide
10tcgtcgtttt ccccccgggg gg 221122DNAArtificial SequenceSynthetic
Oligonucleotide 11tcggcgcgcg ccgtcgtcgt tt 221227DNAArtificial
SequenceSynthetic Oligonucleotide 12tcgtcgtttt cggcgcgcgc cgttttt
271322DNAArtificial SequenceSynthetic Oligonucleotide 13tcctgacgtt
cggcgcgcgc cg 221422DNAArtificial SequenceSynthetic Oligonucleotide
14tngtngtttt nggngngngn ng 221522DNAArtificial SequenceSynthetic
Oligonucleotide 15tgctgctttt cggcgcgcgc cg 221622DNAArtificial
SequenceSynthetic Oligonucleotide 16tcgtcgtttt cgcgcgcgcg cg
221724DNAArtificial SequenceSynthetic Oligonucleotide 17tcgtcgttgg
ttgtcgtttt ggtt 241824DNAArtificial SequenceSynthetic
Oligonucleotide 18accatggacg agctgtttcc cctc 241922DNAArtificial
SequenceSynthetic Oligonucleotide 19tcctgacgtt cggcgcgcgc cc
222024DNAArtificial SequenceSynthetic Oligonucleotide 20tgctgctttt
gtgcttttgt gctt 242124DNAArtificial SequenceSynthetic
Oligonucleotide 21tcgtcgtttc gtcgttttga cgtt 242227DNAArtificial
SequenceSynthetic Oligonucleotide 22tcgcgtgcgt tttgtcgttt tgacgtt
272312DNAArtificial SequenceSynthetic Oligonucleotide 23cggcgcgcgc
cg 122424DNAArtificial SequenceSynthetic Oligonucleotide
24cggcgcgcgc cgcggcgcgc gccg 242521DNAArtificial SequenceSynthetic
Oligonucleotide 25cggcgcgcgc cgtcgtcgtt t 212622DNAArtificial
SequenceSynthetic Oligonucleotide 26tcggcgcgcg ccgtgctgct tt
222722DNAArtificial SequenceSynthetic Oligonucleotide 27ccgccgtttt
cggcgcgcgc cg 222812DNAArtificial SequenceSynthetic Oligonucleotide
28cggcggccgc cg 122912DNAArtificial SequenceSynthetic
Oligonucleotide 29cgcgcgcgcg cg 123012DNAArtificial
SequenceSynthetic Oligonucleotide 30gcgcgcgcgc gc
123112DNAArtificial SequenceSynthetic Oligonucleotide 31ccccccgggg
gg 123212DNAArtificial SequenceSynthetic Oligonucleotide
32ggggggcccc cc 123310DNAArtificial SequenceSynthetic
Oligonucleotide 33cccccggggg 103410DNAArtificial SequenceSynthetic
Oligonucleotide 34gggggccccc 103520DNAArtificial SequenceSynthetic
Oligonucleotide 35ggggtcaacg ttgagggggg 203620DNAArtificial
SequenceSynthetic Oligonucleotide 36ggggtcaagc ttgagggggg
203712DNAArtificial SequenceSynthetic Oligonucleotide 37cggcgcgcgc
cc 123820DNAArtificial SequenceSynthetic Oligonucleotide
38gcggcgggcg gcgcgcgccc 203924DNAArtificial SequenceSynthetic
Oligonucleotide 39tcgtcgtttt gtcgttttgt cgtt 244018DNAArtificial
SequenceSynthetic Oligonucleotide 40tctcccagcg tgcgccat
184120DNAArtificial SequenceSynthetic Oligonucleotide 41ataatcgacg
ttcaagcaag 204220DNAArtificial SequenceSynthetic Oligonucleotide
42tctatcgacg ttcaagcaag 204326DNAArtificial SequenceSynthetic
Oligonucleotide 43tcgtcgtttt tgtcgttttt gtcgtt 264426DNAArtificial
SequenceSynthetic Oligonucleotide 44tcgtcgtttt gtcgtttttg tcgttt
264524DNAArtificial SequenceSynthetic Oligonucleotide 45ttcgtgtttt
cgtgttttcg tcgt 244622DNAArtificial SequenceSynthetic
Oligonucleotide 46tcgtcgttgt cgttttgtcg tt 224710DNAArtificial
SequenceSynthetic Oligonucleotide 47tcntcntttt 104825DNAArtificial
SequenceSynthetic Oligonucleotide 48tgtcgttgtc gttgtcgttg tcgtt
254924DNAArtificial SequenceSynthetic Oligonucleotide 49tcgtcgtttt
gacgttttgt cgtt 245024DNAArtificial SequenceSynthetic
Oligonucleotide 50tcgtcgtttt gacgttttga cgtt 245124DNAArtificial
SequenceSynthetic Oligonucleotide 51tngtngtttt gtngttttgt ngtt
245228DNAArtificial SequenceSynthetic Oligonucleotide 52tcgtcgtttt
ttgtcgtttt ttgtcgtt 285324DNAArtificial SequenceSynthetic
Oligonucleotide 53tttttttttt tttttttttt tttt 245427DNAArtificial
SequenceSynthetic Oligonucleotide 54tcgtcgctgt ctccgcttct tcttgcc
275519DNAArtificial SequenceSynthetic Oligonucleotide 55gggggacgat
cgtcggggg 195627DNAArtificial SequenceSynthetic Oligonucleotide
56ggggtcgacg tcgacgtcga ggggggg 275721DNAArtificial
SequenceSynthetic Oligonucleotide 57ggggacgacg tcctgggggg g
215821DNAArtificial SequenceSynthetic Oligonucleotide 58tcgtcgtttt
cggcggccgc c 215921DNAArtificial SequenceSynthetic Oligonucleotide
59tcgtcgtttt cggccgccgc c 216022DNAArtificial SequenceSynthetic
Oligonucleotide 60tcgtcgtttt cggccgccgc cg 226121DNAArtificial
SequenceSynthetic Oligonucleotide 61tcgtcgtttt cgccgccgcc g
216222DNAArtificial SequenceSynthetic Oligonucleotide 62tgctgctttt
cggcggccgc cg 226322DNAArtificial SequenceSynthetic Oligonucleotide
63tngtngtttt cggcggccgc cg 226422DNAArtificial SequenceSynthetic
Oligonucleotide 64tcgtcgtttt cggcggccga cg 226522DNAArtificial
SequenceSynthetic Oligonucleotide 65tcgtcgtttt cgtcggccgc cg
226622DNAArtificial SequenceSynthetic Oligonucleotide 66tcgtcgtttt
cgacggccgc cg 226722DNAArtificial SequenceSynthetic Oligonucleotide
67tcgtcgtttt cggcggccgt cg 226812DNAArtificial SequenceSynthetic
Oligonucleotide 68cgacgatcgt cg 126912DNAArtificial
SequenceSynthetic Oligonucleotide 69cgacgtacgt cg
127022DNAArtificial SequenceSynthetic Oligonucleotide 70tcntcntttt
cggcggccgc cg 227121DNAArtificial SequenceSynthetic Oligonucleotide
71tcgtcgtttc gacggccgtc g 217221DNAArtificial SequenceSynthetic
Oligonucleotide 72tcgtcgtttc gacgatcgtc g 217321DNAArtificial
SequenceSynthetic Oligonucleotide 73tcgtcgtttc gacgtacgtc g
217418DNAArtificial SequenceSynthetic Oligonucleotide 74tcgtcgcgac
ggccgtcg 187518DNAArtificial SequenceSynthetic Oligonucleotide
75tcgtcgcgac gatcgtcg 187618DNAArtificial SequenceSynthetic
Oligonucleotide 76tcgtcgcgac gtacgtcg 187722DNAArtificial
SequenceSynthetic Oligonucleotide 77tcgttttttt cgacggccgt cg
227822DNAArtificial SequenceSynthetic Oligonucleotide 78tcgttttttt
cgacgatcgt cg 227922DNAArtificial SequenceSynthetic Oligonucleotide
79tcgttttttt cgacgtacgt cg 228012DNAArtificial SequenceSynthetic
Oligonucleotide 80cgacgttcgt cg 128113DNAArtificial
SequenceSynthetic Oligonucleotide 81cggcgccgtg ccg 13
* * * * *