U.S. patent application number 10/365678 was filed with the patent office on 2004-05-13 for immunostimulatory oligonucleotides with modified bases and methods of use thereof.
Invention is credited to Schwartz, David.
Application Number | 20040092468 10/365678 |
Document ID | / |
Family ID | 26778537 |
Filed Date | 2004-05-13 |
United States Patent
Application |
20040092468 |
Kind Code |
A1 |
Schwartz, David |
May 13, 2004 |
Immunostimulatory oligonucleotides with modified bases and methods
of use thereof
Abstract
Immunomodulatory oligonucleotide compositions are disclosed.
These oligonucleotides comprise an immunostimulatory hexanucleotide
sequence comprising a modified cytosine. These oligonucleotides can
be administered in conjunction with an immunomodulatory peptide or
antigen. Methods of modulating an immune response upon
administration of the oligonucleotide comprising a modified
immunostimulatory sequence are also disclosed.
Inventors: |
Schwartz, David; (Encinitas,
CA) |
Correspondence
Address: |
Catherine M. Polizzi
Morrison & Foerster LLP
755 Page Mill Road
Palo Alto
CA
94304
US
|
Family ID: |
26778537 |
Appl. No.: |
10/365678 |
Filed: |
February 10, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10365678 |
Feb 10, 2003 |
|
|
|
09324191 |
Jun 1, 1999 |
|
|
|
6562798 |
|
|
|
|
60088310 |
Jun 5, 1998 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61K 2039/57 20130101;
A61K 47/54 20170801; A61K 31/7115 20130101; C12N 15/117 20130101;
A61P 37/04 20180101; C07H 21/00 20130101; C12N 2310/18 20130101;
A61K 2039/55561 20130101; C12N 2310/334 20130101; A61K 39/39
20130101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
We claim:
1. An immunomodulatory oligonucleotide comprising an
immunostimulatory sequence (ISS) comprising a modified
cytosine.
2. An immunomodulatory oligonucleotide of claim 1, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-5.
3. An immunomodulatory oligonucleotide of claim 1, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-6.
4. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises a modified cytosine selected from the group consisting of
azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine,
chlorinated cytosine, cyclocytosine, cytosine arabinoside,
fluorinated cytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, halogenated cytosine, halogenated pyrimidine
analogue, hydroxyurea, iodouracil, 5-nitrocytosine,
5-trifluoromethyl-cytosine, uracil, 5-fluorocytosine,
5-trifluoromethylcytosine, and 5,6-dihydrocytosine.
5. An immunomodulatory oligonucleotide of claim 1, wherein the
modified cytosine is a 5'-bromocytidine.
6. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises the sequence 5'-Purine, Purine, Cytosine, Guanine,
Pyrimidine, Pyrimidine-3'.
7. An immunomodulatory oligonucleotide of claim 6, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-5.
8. An immunomodulatory oligonucleotide of claim 6, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-6.
9. An immunomodulatory oligonucleotide of claim 6, wherein the
modified cytosine is a 5'-bromocytidine.
10. An immunomodulatory oligonucleotide of claim 9, wherein the
cytosine at the third position from the 5' end of the ISS
octanucleotide is substituted with a 5'-bromocytidine.
11. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises the sequence 5'-Purine, Purine, Cytosine, Guanine,
Pyrimidine, Pyrimidine, Cytosine, Cytosine-3'.
12. An immunomodulatory oligonucleotide of claim 11, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-5.
13. An immunomodulatory oligonucleotide of claim 11, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-6.
14. An immunomodulatory oligonucleotide of claim 11, wherein the
modified cytosine is a 5'-bromocytidine.
15. An immunomodulatory oligonucleotide of claim 11, wherein the
cytosine at the third position from the 5' end of the ISS is
substituted with a 5'bromocytidine.
16. An immunomodulatory oligonucleotide of claim 11, wherein the
cytosine at the third position from the 5' end of the ISS is
substituted with a 5'-bromocytidine and the cytosine at the seventh
position from the 5' end of the ISS is substituted with a
5'-bromocytidine.
17. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises the sequence 5'-Purine, Purine, Cytosine, Guanine,
Pyrimidine, Pyrimidine, Cytosine, Guanine-3'.
18. An immunomodulatory oligonucleotide of claim 17, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-5.
19. An immunomodulatory oligonucleotide of claim 17, wherein the
modified cytosine comprises an addition of an electron-withdrawing
group to at least position C-6.
20. An immunomodulatory oligonucleotide of claim 17, wherein the
modified cytosine is a 5'-bromocytidine.
21. An immunomodulatory oligonucleotide of claim 17, wherein the
Cytosine at the third position from the 5' end of the ISS
octanucleotide is substituted with a 5'-bromocytidine.
22. An immunomodulatory oligonucleotide of claim 17, wherein the
cytosine at the third position from the 5' end of the ISS is
substituted with a 5'-bromocytidine and the cytosine at the seventh
position from the 5' end of the ISS is substituted with a
5'-bromocytidine.
23. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises a phosphorothioate group.
24. An immunomodulatory oligonucleotide of claim 1, wherein the ISS
comprises a sequence selected from the group consisting of AACGTT,
GACGTT, AACGTTCC, AACGTTCG, GACGTTCC, and GACGTTCG, wherein at
least one C is substituted with a modified cytosine.
25. An immunomodulatory oligonucleotide of claim 24, wherein the
ISS further comprises a second modified cytosine.
26. An immunomodulatory oligonucleotide of claim 1, wherein the
oligonucleotide portion further comprises an RNA sequence.
27. An immunomodulatory oligonucleotide of claim 26, wherein the
ISS is an RNA sequence comprising a single-stranded or
double-stranded sequence selected from the group consisting of
AACGUU, GACGUU, AACGUUCC, AACGUUCG, GACGUUCC, and GACGUUCG, wherein
at least one C is substituted with a modified cytosine.
28. An immunomodulatory oligonucleotide of claim 27, wherein the
ISS further comprises a second modified cytosine.
29. An immunomodulatory oligonucleotide comprising the sequence SEQ
ID NO:2.
30. An immunomodulatory oligonucleotide comprising the sequence SEQ
ID NO:5.
31. An immunomodulatory oligonucleotide comprising the sequence SEQ
ID NO:6.
32. An immunomodulatory composition comprising an immunomodulatory
oligonucleotide according to claim 1; and further comprising an
antigen.
33. An immunomodulatory composition of claim 32, wherein the
antigen is selected from the group consisting of peptides,
glycoproteins, polysaccharides, and lipids.
34. An immunomodulatory composition of claim 32, wherein the
antigen is conjugated to the immunomodulatory oligonucleotide.
35. An immunomodulatory composition comprising an immunomodulatory
oligonucleotide according to claim 1; and further comprising a
facilitator selected from the group consisting of co-stimulatory
molecules, cytokines, chemokines, targeting protein ligand, a
trans-activating factor, a peptide, and a peptide comprising a
modified amino acid.
36. An immunomodulatory composition of claim 35, wherein the
facilitator is conjugated to the immunomodulatory
oligonucleotide.
37. An immunomodulatory composition comprising an immunomodulatory
oligonucleotide according to claim 1; and further comprising an
antigen; and further comprising an adjuvant.
38. An immunomodulatory composition of claim 37, wherein the
antigen is selected from the group consisting of peptides,
glycoproteins, polysaccharides, and lipids.
39. An immunomodulatory composition of claim 37, wherein the
antigen is conjugated to the immunomodulatory oligonucleotide.
40. A method of modulating an immune response comprising
co-administration of an immunomodulatory composition comprising an
antigen and an immunomodulatory oligonucleotide according to claim
1.
41. The method of claim 40, wherein the modulating of an immune
response comprises induction of a Th1-type response.
42. A method of modulating an immune response comprising
administration of an immunomodulatory composition according to
claim 34.
43. The method of claim 42, wherein the modulating of an immune
response comprises induction of a Th 1-type response.
44. A method of modulating an immune response comprising the
co-administration of an antigen, an adjuvant and an
immunomodulatory oligonucleotide according to claim 1.
45. The method of claim 44, wherein the modulating of an immune
response comprises induction of a Th1-type response.
46. A method of modulating an immune response comprising the
administration of an immunomodulatory composition according to
claim 35, wherein the components of the composition are
co-administered.
47. A method of modulating an immune response comprising
administration of an immunomodulatory composition according to
claim 39.
48. A method of treating an individual in need of immune modulation
comprising administration of a composition comprising an
immunomodulatory oligonucleotide of claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the priority benefit of U.S.
application Ser. No. 09/324,191, filed Jun. 1, 1999, allowed, which
claims the priority benefit of U.S. Provisional Patent Application
No. 60/088,310 filed Jun. 5, 1998. The aforementioned applications
are hereby incorporated herein by reference in their entirety.
STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH
[0002] Not Applicable
TECHNICAL FIELD
[0003] The present invention relates to immunomodulatory
compositions comprising an immunostimulatory oligonucleotide
sequence (ISS) in which at least one base has been substituted with
a base modified by the addition to C-5 and/or C-6 on cytosine with
an electron-withdrawing moiety. It also relates to the
administration of said ISS to modulate an immune response.
BACKGROUND ART
[0004] The type of immune response generated to infection or other
antigenic challenge can generally be distinguished by the subset of
T helper (Th) cells involved in the response. The Th1 subset is
responsible for classical cell-mediated functions such as
delayed-type hypersensitivity and activation of cytotoxic T
lymphocytes (CTLs), whereas the Th2 subset functions more
effectively as a helper for B-cell activation. The type of immune
response to an antigen is generally determined by the cytokines
produced by the cells responding to the antigen. Differences in the
cytokines secreted by Th1 and Th2 cells are believed to reflect
different biological functions of these two subsets.
[0005] The Th1 subset may be particularly suited to respond to
viral infections and intracellular pathogens because it secretes
IL-2 and IFN-.gamma., which activate CTLs. The Th2 subset may be
more suited to respond to free-living bacteria and helminthic
parasites and may mediate allergic reactions, since IL-4 and IL-5
are known to induce IgE production and eosinophil activation,
respectively. In general, Th1 and Th2 cells secrete distinct
patterns of cytokines and so one type of response can moderate the
activity of the other type of response. A shift in the Th1/Th2
balance can result in an allergic response, for example, or,
alternatively, in an increased CTL response.
[0006] Immunization of a host animal against a particular antigen
has been accomplished traditionally by repeatedly vaccinating the
host with an immunogenic form of the antigen. While most current
vaccines elicit effective humoral (antibody, or "Th2-type")
responses, they fail to elicit cellular responses (in particular,
major histocompatibility complex (MHC) class I-restricted CTL, or
"Th1-type" responses) which are generally absent or weak. For many
infectious diseases, such as tuberculosis and malaria, Th2-type
responses are of little protective value against infection.
Moreover, antibody responses are inappropriate in certain
indications, most notably in allergy where an antibody response can
result in anaphylactic shock. Proposed vaccines using small
peptides derived from the target antigen and other currently used
antigenic agents that avoid use of potentially infective intact
viral particles, do not always elicit the immune response necessary
to achieve a therapeutic effect. The lack of a therapeutically
effective human immunodeficiency virus (HIV) vaccine is an
unfortunate example of this failure.
[0007] Protein-based vaccines typically induce Th2-type immune
responses, characterized by high titers of neutralizing antibodies
but without significant cell-mediated immunity. In contrast,
intradermal delivery of "naked", or uncomplexed, DNA encoding an
antigen stimulates immune responses to the antigen with a Th1-type
bias, characterized by the expansion of CD4.sup.+ T cells producing
IFN-.gamma. and cytotoxic CD8.sup.+ T cells. Manickan et al. (1995)
J. Immunol. 155:250-265; Xiang et al. (1995) Immunity 2:129-135;
Raz et al. (1995) Proc. Natl. Acad. Sci. USA 93:5141-5145; and
Briode et al. (1997) J. Allergy Clin. Immunol. 99:s129. Injection
of antigen-encoding naked DNA reproducibly induces both humoral and
cellular immune responses against the encoded antigens. Pardoll and
Beckerleg (1995) Immunity 3:165-169. DNA vaccines can provide a new
approach to infectious disease prophylaxis. See, for instance,
Dixon (1995) Bio/Technology 13:420 and references cited
therein.
[0008] Certain types of DNA, without being translated, have been
shown to stimulate immune responses. Bacterial DNA induces anti-DNA
antibodies in injected mice, as well as cytokine production by
macrophage and natural killer (NK) cells. Pisetsky (1996) J.
Immunol. 156:421-423; Shimada et al. (1986) Jpn. J. Cancer Res.
77:808-816; Yamamoto et al. (1992a) Microbiol. Immunol. 36:983-897;
and Cowdery et al. (1996) J. Immunol. 156:4570-4575.
[0009] B cell and NK cell activation properties of bacterial DNA
have been associated with short (6 base pair hexamer) sequences
that include a central unmethylated CpG dinucleotide. Yamamoto et
al. (1992a); and Krieg et al. (1995) Nature 374:546-549.
Oligonucleotides comprising a CpG sequence flanked by two 5'
purines and two 3' pyrimidines have been shown to be most potent in
B cell and NK cell stimulation. For example, when a variety of
oligonucleotides comprising hexamers were tested for their ability
to augment the NK cell activity of mouse spleen cells, the most
immunogenic hexamers included AACGTT, AGCGCT, GACGTC. Yamamoto et
al. (1992b) J. Immunol. 148:4072-4076. In a study in which B cell
activation was measured in response to oligonucleotides, the most
stimulatory hexamer sequences (e.g., AACGTC, AACGTT, GACGTC,
GACGTT) also matched the sequence of 5'-purine, purine, CG,
pyrimidine, pyrimidine-3'. Krieg et al. (1995).
[0010] Bacterial DNA stimulated macrophages to produce IL-12 and
TNF-.alpha.. These macrophage-produced cytokines were found to
induce the production of IL-12 and IFN-.gamma. from splenocytes.
Halpern et al. (1996) Cell. Immunol. 167:72-78. In vitro treatment
of splenocytes with either bacterial DNA or CpG containing
oligonucleotides induced the production of IL-6, IL-12 and
IFN-.gamma.. Klinman et al. (1996) Proc. Natl. Acad. Sci. USA
93:2879:2883. Production of all of these cytokines is indicative of
induction of a Th1-type immune response rather than a Th2-type
response.
[0011] Todate, no clear consensus has been reached on the sequences
both necessary and sufficient of immune stimulation. A recent study
which examined induction of NK activity in response to CpG
containing-oligonucleotides suggested that the unmethylated CpG
motif was necessary but not sufficient for oligonucleotide
induction of NK lytic activity. Ballas et al. (1996) J. Immunol.
157:1840-1845. Sequences flanking the CpG appeared to influence the
immunostimulatory activity of an oligonucleotide. Immunostimulatory
activity of immunostimulatory sequences appears to be independent
of adenosine-methylation, and whether the nucleotide is single or
double-stranded. See, for example, Tokunaga et al. (1989)
Microbiol. Immunol. 33:929; Tokunaga et al. (1992) Microbiol.
Immunol. 36:55-66; Yamamoto et al. (1992b); Messina et al. (1993)
Cell. Immunol. 147:148-157; and Sato et al. (1996) Science
273:352-354. Oligonucleotide length also does not seem to be a
factor, as double-stranded DNA 4 kb long (Sato et al. (1996)) or
single-stranded DNA as short as 15 nucleotides in length (Ballas et
al. (1996)) illicited immune responses; though if oligonucleotide
length was reduced below 8 bases or if the DNA was methylated with
CpG methylase, immunostimulatory activity was abolished. Krieg et
al. (1995).
[0012] Allergic responses, including those of allergic asthma, are
characterized-by an early phase response, which occurs within
seconds to minutes of allergen exposure and is characterized by
cellular degranulation, and a late phase response, which occurs 4
to 24 hours later and is characterized by infiltration of
eosinophils into the site of allergen exposure. Specifically,
during the early phase of the allergic response, activation of
Th2-type lymphocytes stimulates the production of antigen-specific
IgE antibodies, which in turn triggers the release of histamine and
other mediators of inflammation from mast cells and basophils.
During the late phase response, IL-4 and IL-5 production by
CD4.sup.+ Th2 cells is elevated. These cytokines appear to play a
significant role in recruiting eosinophils into site of allergen
exposure, where tissue damage and dysfunction result.
[0013] Antigen immunotherapy for allergic disorders involves the
subcutaneous injection of small, but gradually increasing amounts,
of antigen. Such immunization treatments present the risk of
inducing IgE-mediated anaphylaxis and do not address the
cytokine-mediated events of the allergic late phase response.
[0014] Vaccination with certain DNA containing immunostimulatory
motifs induces an immune response with a Th1-type bias. For
example, mice injected intradermally with Escherichia coli (E.
coli) .beta.-galactosidase (.beta.-Gal) in saline or in the
adjuvant alum responded by producing specific IgG1 and IgE
antibodies, and CD4.sup.+ cells that secreted IL-4 and IL-5, but
not IFN-.gamma., demonstrating that the T cells were predominantly
of the Th2 subset. However, mice injected intradermally (or with a
tyne skin scratch applicator) with plasmid DNA (in saline) encoding
.beta.-Gal and containing an ISS responded by producing IgG2a
antibodies and CD4.sup.+ cells that secreted IFN-.gamma., but not
IL-4 and IL-5, demonstrating that the T cells were predominantly of
the Th1 subset. Moreover, specific IgE production by the plasmid
DNA-injected mice was reduced 66-75%. Raz et al. (1996) Proc. Natl.
Acad. Sci. USA 93:5141-5145. In general, the response to naked DNA
immunization is characterized by production of IL-2, TNF.alpha. and
IFN-.gamma. by antigen-stimulated CD4.sup.+ T cells, which is
indicative of a Th1-type response. This is particularly important
in treatment of allergy and asthma as shown by the decreased IgE
production.
[0015] In another example, the presence of an immunostimulatory
sequence, such as the palindromic hexamer AACGTT, in an
antigen-encoding plasmid vector injected intradermally prompted the
production of large amounts of IFN-.alpha., IFN-.beta. and IL-12.
Sato et al. (1996). IFN-.alpha. plays a role in the differentiation
of naive T cells toward a Th1-type phenotype, antagonizes Th2
cells, inhibits IgE synthesis, promotes IgG2a production and
induces a Th1 phenotype of antigen-specific T cell clones. IL-12
promotes IFN-.gamma. production by T cells and favors maturation of
Th1 cells.
[0016] It would be useful in treatment of a wide variety of
indications to be able to specifically enhance the Th1-type
response to a particular antigen while down-regulating the Th2-type
response to the same antigen. Treatment or palliation of these
indications includes, but is not limited to, tumor therapy,
treatment of allergic disorders and induction of a vigorous
cellular immune response. The present invention provides
compositions comprising oligonucleotide sequences that can be
employed in these contexts.
[0017] All of the cited literature included in the preceding
section, as well as the cited literature included in the following
disclosure, are hereby incorporated by reference.
DISCLOSURE OF THE INVENTION
[0018] In one embodiment, the ISS comprises a hexameric sequence or
hexanucleotide comprising a central CG sequence, where the C
residue is modified by the addition to C-5 and/or C-6 with an
electron-withdrawing moiety. Preferably, the electron-withdrawing
group is a halogen or halogen-containing ligand. Suitable halogens
include chlorine, bromine and fluorine. Suitable halogen-containing
ligands include, but are not limited to, 5-bromocytosine,
5-fluorocytosine, 5-chlorocytosine, and 5-trifluoromethyl
cytosine.
[0019] In another embodiment, the modified ISS comprises the
general sequence 5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,
Pyrimidine-3'. More preferably, the modified ISS comprises the
general sequences selected from the group consisting of AACGTC,
AACGTT, AGCGTC, AGCGCT, AGCGTT, GACGTC, GACGTT, and GGCGTT. The
modified ISS can also comprise any other physiologically acceptable
modification.
[0020] In another embodiment, the modified ISS comprises the
general sequence 5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,
Pyrimidine, Cytosine, Cytosine-3'. More preferably, the modified
ISS comprises a sequence selected form the group consisting of
AACGTTCC and GACGTTCC.
[0021] In another embodiment, the modified ISS comprises the
general sequence 5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,
Pyrimidine, Cytosine, Guanine-3'. More preferably, the modified ISS
comprises a sequence selected form the group consisting of AACGTTCG
and GACGTTCG.
[0022] In another embodiment, the modified ISS comprises the
sequence of SEQ ID NO: 2.
[0023] In another embodiment, the modified ISS comprises the
sequence of SEQ ID NO:6.
[0024] In another embodiment, the modified ISS comprises the
sequence of SEQ ID NO:7.
[0025] In another embodiment, the invention provides an
immunomodulatory composition comprising a modified ISS and further
comprising an antigen.
[0026] In another embodiment, the invention provides an
immunomodulatory composition comprising a modified [SS in
conjunction with a member of the group of immunomodulation
facilitators consisting of co-stimulatory molecules, cytokines,
chemokines, targeting protein ligand, a trans-activating factor, a
peptide, or a peptide comprising a modified amino acid.
[0027] In another embodiment, the invention provides an
immunomodulatory composition comprising a modified ISS, an antigen
and an adjuvant.
[0028] The present invention also provides for a method of
modulating an immune response comprising the administration of an
amount of a modified ISS effective to induce an immune response.
Preferably, modulation of an immune response comprises induction of
a Th 1-type immune response.
[0029] In another embodiment, the invention provides methods of
treating an individual in need of immune modulation comprising
administration of a composition comprising a modified ISS.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 illustrates the structure of 5-cytosine substituted
CpG dinucleotide.
[0031] FIG. 2 presents a graph depicting the level of IL-6 found in
the culture supernatant of splenocytes after exposure to
oligonucleotides for 48 hours. See Table 1 for identification of
oligonucleotides.
[0032] FIG. 3 presents a graph depicting the level of IL-12 found
in the culture supernatant of splenocytes after exposure to
oligonucleotides for 48 hours. See Table 1 for identification of
oligonucleotides.
[0033] FIG. 4 presents a graph showing the efficacy of various
oligonucleotides comprising modified cytosines to stimulate
proliferation of splenocytes. Cell proliferation determined after
48 hours in culture. See Table 1 for identification of
oligonucleotides.
MODES FOR CARRYING OUT THE INVENTION
[0034] We have discovered modified oligonucleotide sequences
capable of modulating an immune response. Such oligonucleotide
sequences comprise an immunostimulatory sequence (ISS) comprising a
CG dinucleotide in which the C residue is modified by addition to
C-5 and/or C-6 of an electron-withdrawing moiety ("modified ISS").
Compositions of the subject invention comprise the modified ISS
oligonucleotide alone or in conjunction with an immunomodulatory
agent, such as a peptide, an antigen and/or an additional adjuvant.
When the same cytosine is methylated, all immunostimulatory
activity of the oligonucleotide is lost. Some of the modified ISS
have approximately the same, if not greater, immunostimulatory
activity relative to the same sequence without a modified base.
[0035] Previously described immunostimulatory sequences have
comprised a hexamer sequence with a central CpG dinucleotide. The
ISS of the present invention comprises any immunostimulatory
sequence having the CpG dinucleotide where the C-5 and/or C-6
positions of the C is modified with an electron-withdrawing group.
Preferably, the modified ISS contains an hexanucleotide sequence
which comprises 5'-purine, purine, cytosine, guanine, pyrimidine,
pyrimidine-3'. More preferably, the modified ISS contains an
hexanucleotide sequence which comprises 5'-AACGTT-3' or
5'-GACGTT-3'. More preferably, the modified ISS contains an
octanucleotide sequence which comprises the previously described
hexamer and two additional nucleotides 3' of the hexamer.
Preferably, the modified ISS octamer comprises 5'-purine, purine,
cytosine, guanine, pyrimidine, pyrimidine, cytosine, guanine-3' or
the modified ISS octamer comprises 5'-purine, purine, cytosine,
guanine, pyrimidine, pyrimidine, cytosine, cytosine-3'. More
preferably, the modified ISS octanucleotide comprises
5'-GACGTTCG-3' or 5'-GACGTTCC-3'. Still more preferably, the
modified ISS octanucleotide comprises 5'-AACGTTCG-3' or
5'-AACGTTCC-3'.
[0036] The ISS oligonucleotide of the present invention can
comprises any other physiologically acceptable modified nucleotide
base. Preferably, in such compositions, the cytosine in the third
position from the 5' end can be substituted with a cytosine analog,
preferably 5-bromocytidine, fluorinated cytosine, or chlorinated
cytosine.
[0037] The invention also provides a method and compositions for a
general stimulation of an immune response through the adjuvant-like
effect of an administered modified ISS.
[0038] The present invention also provides methods for the use of a
modified ISS in conjunction with an antigen in stimulation of an
immune response. Preferably, as used in such methods, the modified
ISS provides an adjuvant-like activity in the generation of a
Th1-type immune response to the antigen.
[0039] Preferably, the immune response stimulated according to the
invention is biased toward the Th1-type phenotype and away from the
Th2-type phenotype. With reference to the invention, stimulating a
Th1-type immune response can be determined in vitro or ex vivo by
measuring cytokine production from cells treated with modified ISS
as compared to those treated without modified ISS. Methods to
determine the cytokine production of cells include those methods
described herein and any known in the art. The type of cytokines
produced in response to modified ISS treatment indicate a Th1-type
or a Th2-type biased immune response by the cells. As used herein,
the term "Th1-type biased" cytokine production refers to the
measurable increased production of cytokines associated with a
Th1-type immune response in the presence of a stimulator as
compared to production of such cytokines in the absence of
stimulation. Examples of such Th1-type biased cytokines include,
but are not limited to, IL-2, IL-12, and IFN-.gamma.. In contrast,
"Th2-type biased cytokines" refers to those associated with a
Th2-type immune response, and include, but are not limited to,
IL-4, IL-5, IL-10 and IL-13. Cells useful for the determination of
ISS activity include cells of the immune system, primary cells
isolated from a host and/or cell lines, preferably APCs and
lymphocytes, even more preferably macrophages and T cells.
[0040] Stimulating a Th1-type immune response can also be measured
in a host treated with a modified ISS-antigen composition and can
be determined by any method known in the art including, but not
limited to: (1) a reduction in levels of IL-4 measured before and
after antigen-challenge; or detection of lower (or even absent)
levels of IL-4 in a modified ISS-antigen treated host as compared
to an antigen-primed, or primed and challenged, control treated
without modified ISS; (2) an increase in levels of IL-12, IL-18
and/or IFN (.alpha., .beta. or .gamma.) before and after antigen
challenge; or detection of higher levels of IL-12, IL-18 and/or IFN
(.alpha., .beta. or .gamma.) in a modified ISS-antigen treated host
as compared to an antigen-primed or, primed and challenged, control
treated without modified ISS; (3) IgG2a antibody production in a
modified ISS-antigen treated host as compared to a control treated
without modified ISS; and/or (4) a reduction in levels of
antigen-specific IgE as measured before and after antigen
challenge; or detection of lower (or even absent) levels of
antigen-specific IgE in a modified ISS-antigen treated host as
compared to an antigen-primed, or primed and challenged, control
treated without modified ISS. A variety of these determinations can
be made by measuring cytokines made by APCs and/or lymphocytes,
preferably macrophages and/or T cells, in vitro or ex vivo using
methods described herein or any known in the art. Methods to
determine antibody production include any known in the art.
[0041] The Th1-biased cytokine induction which occurs as a result
of modified ISS administration produces enhanced cellular immune
responses, such as those performed by NK cells, cytotoxic killer
cells, Th1 helper and memory cells. These responses are
particularly beneficial for use in protective or therapeutic
vaccination against viruses, fungi, protozoan parasites, bacteria,
allergic diseases and asthma, as well as tumors.
[0042] General Techniques
[0043] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology,
biochemistry and immunology, which are within the skill of the art.
Such techniques are explained fully in the literature, such as,
"Molecular Cloning: A Laboratory Manual", second edition (Sambrook
et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984);
"Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in
Enzymology" (Academic Press, Inc.); "Handbook of Experimental
Immunology" (D. M. Weir & C. C. Blackwell, eds.); "Gene
Transfer Vectors for Mammalian Cells" (J. M. Miller & M. P.
Calos, eds., 1987); "Current Protocols in Molecular Biology" (F. M.
Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction",
(Mullis et al., eds., 1994); and "Current Protocols in Immunology"
(J. E. Coligan et al., eds., 1991).
[0044] Compositions Comprising the Modified ISS
[0045] A composition of the subject invention is a modified ISS
which is capable of eliciting a desired immune response upon
administration. The term "modified ISS" as used herein refers to
oligonucleotide sequences that effect a measurable immune response
and comprise a CG dinucleotide in which the C residue is modified
by addition to C-5 and/or C-6 of an electron-withdrawing moiety.
Examples of measurable immune responses include, but are not
limited to, antigen-specific antibody production, secretion of
cytokines, activation or expansion of lymphocyte populations such
as NK cells, CD4.sup.+ T lymphocytes, CD8.sup.+ T lymphocytes, B
lymphocytes, and the like. Preferably, the modified ISS sequences
preferentially activate the Th1-type response.
[0046] This oligonucleotide can be administered in conjunction with
an immunomodulatory molecule, such as an antigen or an
immunostimulatory peptide, as described herein. The modified
oligonucleotide of the composition contains at least one modified
immunostimulatory oligonucleotide sequence ("modified ISS").
[0047] The modified ISS preferably comprises a CpG containing
sequence, as illustrated in FIG. 1. More preferably, the modified
ISS comprises an oligomer of the hexanucleotide sequence 5'-Purine,
Purine, CG, Pyrimidine, Pyrimidine-3'. More preferably the modified
ISS comprises a hexanucleotide sequence selected from the group
consisting of AACGTT and GACGTT. More preferable still, the
modified ISS comprises an oligomer of the octanucleotide sequence
5'-Purine, Purine, CG, Pyrimidine, Pyrimidine, Cytosine,
Cytosine-3' or the octanucleotide sequence 5'-Purine, Purine, CG,
Pyrimidine, Pyrimidine, Cytosine, Guanine-3'. Even more preferably,
the modified ISS comprises an octanucleotide selected from the
group consisting of AACGTTCC, AACGTTCG, GACGTTCC and GACGTTCG.
[0048] Where the oligonucleotide comprises an RNA sequence, the
modified ISS preferably comprises a single-stranded or
double-stranded sequence selected from the group consisting of
AACGUU, GACGUU, AACGUUCC, AACGUUCG, GACGUUCC, and GACGUUCG.
[0049] In accordance with the present invention, the
oligonucleotide contains at least one modified ISS, and can contain
multiple modified ISSs. The modified ISSs can be adjacent within
the oligonucleotide, or they can be separated by additional
nucleotide bases within the oligonucleotide.
[0050] As used interchangeably herein, the terms "oligonucleotide"
and "polynucleotide" include single-stranded DNA (ssDNA),
double-stranded DNA (dsDNA), single-stranded RNA (ssRNA) and
double-stranded RNA (dsRNA), modified oligonucleotides and
oligonucleosides or combinations thereof. The oligonucleotide can
be linearly or circularly configured, or the oligonucleotide can
contain both linear and circular segments.
[0051] The ISS can be of any length greater than 6 bases or base
pairs, preferably greater than 15 bases or basepairs, more
preferably greater than 20 bases or base pairs in length.
[0052] In general, dsRNA exerts an immunostimulatory effect and is
encompassed by the invention. Further modifications of modified ISS
include, but are not limited to, modifications of the 3'OH or 5'OH
group, modifications of the nucleotide base, modifications of the
sugar component, and modifications of the phosphate group. Various
such modifications are described below.
[0053] Modified Bases and Base Analogs
[0054] Oligonucleotides are polymers of nucleosides joined,
generally, through phosphoester linkages. A nucleoside consists of
a purine (adenine or guanine or derivative thereof) or pyrimidine
(thymine, cytosine or uracil, or derivative thereof) base bonded to
a sugar. The four nucleoside units (or bases) in DNA are called
deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine.
A nucleotide is a phosphate ester of a nucleoside.
[0055] Multiple bases, sugars, or phosphates in any combination can
be substituted in the modified ISS.
[0056] The oligonucleotide of the invention can comprise
ribonucleotides (containing ribose as the only or principal sugar
component), deoxyribonucleotides (containing deoxyribose as the
principal sugar component), or, in accordance with the state of the
art, modified sugars or sugar analogs can be incorporated in the
modified ISS. Thus, in addition to ribose and deoxyribose, the
sugar moiety can be pentose, deoxypentose, hexose, deoxyhexose,
glucose, arabinose, xylose, lyxose, and a sugar "analog"
cyclopentyl group. The sugar can be in pyranosyl or in a furanosyl
form. In the modified ISS, the sugar moiety is preferably the
furanoside of ribose, deoxyribose, arabinose or 2'-0-methylribose,
and the sugar can be attached to the respective heterocyclic bases
either in .alpha. or .beta. anomeric configuration. The preparation
of these sugars or sugar analogs and the respective "nucleosides"
wherein such sugars or analogs are attached to a heterocyclic base
(nucleic acid base) per se is known, and need not be described
here, except to the extent such preparation can pertain to any
specific example.
[0057] The phosphorous derivative (or modified phosphate group)
which can be attached to the sugar or sugar analog moiety in the
oligonucleotides of the present invention can be a monophosphate,
diphosphate, triphosphate, alkylphosphate, alkanephosphate,
phosphorothioate, phosphorodithioate or the like. A phosphorothiate
linkage can be used in place of a phosphodiester linkage. The
preparation of the above-noted phosphate analogs, and their
incorporation into nucleotides, modified nucleotides and
oligonucleotides, per se, is also known and need not be described
here in detail. Peyrottes et al. (1996) Nucleic Acids Res.
24:1841-1848; Chaturvedi et al. (1996) Nucleic Acids Res.
24:2318-2323; and Schultz et al. (1996) Nucleic Acids Res.
24:2966-2973. Preferably, oligonucleotides of the present invention
comprise phosphorothioate linkages. Oligonucleotides with
phosphorothioate backbones can be more immunogenic than those with
phosphodiester backbones and appear to be more resistant to
degradation after injection into the host. Braun et al. (1988) J.
Immunol. 141:2084-2089; and Latimer et al. (1995) Mol. Immunol.
32:1057-1064.
[0058] The heterocyclic bases, or nucleic acid bases, which are
incorporated in the modified ISS can be the naturally-occurring
principal purine and pyrimidine bases, (namely uracil or thymine,
cytosine, adenine and guanine, as mentioned above), as well as
naturally-occurring and synthetic modifications of said principal
bases.
[0059] Those skilled in the art will recognize that a large number
of "synthetic" non-natural nucleosides comprising various
heterocyclic bases and various sugar moieties (and sugar analogs)
are available in the art, and that as long as other criteria of the
present invention are satisfied, the modified ISS can include one
or several heterocyclic bases other than the principal five base
components of naturally-occurring nucleic acids. Preferably,
however, the heterocyclic base in the modified ISS includes, but is
not limited to, uracil-5-yl, cytosin-5-yl, adenin-7-yl,
adenin-8-yl, guanin-7-yl, guanin-8-yl, 4-aminopyrrolo [2.3-d]
pyrimidin-5-yl, 2-amino-4-oxopyrolo [2,3-d]pyrimidin-5-yl,
2-amino-4-oxopyrrolo [2.3-d] pyrimidin-3-yl groups, where the
purines are attached to the sugar moiety of the modified ISS via
the 9-position, the pyrimidines via the 1-position, the
pyrrolopyrimidines via the 7-position and the pyrazolopyrimidines
via the 1-position.
[0060] A cytosine in the modified ISS can be substituted with a
modified cytosine including, but not limited to, azacytosine,
5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated
cytosine, cyclocytosine, cytosine arabinoside, fluorinated
cytosine, fluoropyrimidine, fluorouracil, 5,6-dihydrocytosine,
halogenated cytosine, halogenated pyrimidine analogue, hydroxyurea,
iodouracil, 5-nitrocytosine, 5-trifluoromethyl-cytosine,
5,6-dihydrocytosine, uracil, and any other pyrimidine analog or
modified pyrimidine. The present invention also includes
dihydrocytosine analogs as potential potent activators of an immune
response.
[0061] Methods of Modulating Immune Responses with Modified ISS
[0062] In one embodiment, the invention provides compositions
comprising modified ISS as the only immunologically active
substance. Upon administration, such modified ISS induces a
stimulation of the immune system.
[0063] In other embodiments, modified ISS can be administered in
conjunction with one or more members of the group of
immunomodulatory molecules comprising antigens (including, but not
limited to, proteins, glycoproteins, polysaccharides, and lipids),
and/or immunomodulatory facilitators such as co-stimulatory
molecules (including, but not limited to, cytokines, chemokines,
targeting protein ligand, trans-activating factors, peptides, and
peptides comprising a modified amino acid) and adjuvants
(including, but not limited to, alum, lipid emulsions, and
polylactide/polyglycolide microparticles). The term
"immunomodulatory" as used herein includes immunostimulatory as
well as immunosuppressive effects. Immunostimulatory effects
include, but are not limited to, those that directly or indirectly
enhance cellular or humoral immune responses. Examples of
immunostimulatory effects include, but are not limited to,
increased antigen-specific antibody production; activation or
proliferation of a lymphocyte population such as NK cells,
CD4.sup.+ T lymphocytes, CD8.sup.+ T lymphocytes, macrophages and
the like; increased synthesis of immunostimulatory cytokines
including, but not limited to, IL-1, IL-2, IL-4, IL-5, IL-6, IL-12,
IFN-.gamma., TNF-.alpha. and the like. Immunosuppressive effects
include those that directly or indirectly decrease cellular or
humoral immune responses. Examples of immunosuppressive effects
include, but are not limited to, a reduction in antigen-specific
antibody production such as reduced IgE production; activation of
lymphocyte or other cell populations that have immunosuppressive
activities such as those that result in immune tolerance; and
increased synthesis of cytokines that have suppressive effects
toward certain cellular functions. One example of this is
IFN-.gamma., which appears to block IL-4 induced class switch to
IgE and IgG1, thereby reducing the levels of these antibody
subclasses.
[0064] The modified ISS and the antigen and/or immunomodulatory
facilitator can be administered together in the form of a conjugate
or co-administered in an admixture sufficiently close in time so as
to modulate an immune response. Preferably, the modified ISS and
immunomodulatory molecule are administered simultaneously. The term
"co-administration" as used herein refers to the administration of
at least two different substances sufficiently close in time to
modulate an immune response. Preferably, co-administration refers
to simultaneous administration of at least two different
substances.
[0065] As used herein, the term "conjugate" refers to a complex in
which a modified ISS and an immunomodulatory molecule are linked.
Such conjugate linkages include covalent and/or non-covalent
linkages.
[0066] As used herein, the term "antigen" means a substance that is
recognized and bound specifically by an antibody or by a T cell
antigen receptor. Antigens can include peptides, proteins,
glycoproteins, polysaccharides, gangliosides and lipids; portions
thereof and combinations thereof. The antigens can be those found
in nature or can be synthetic. Haptens are included within the
scope of "antigen." A hapten is a low molecular weight compound
that is not immunogenic by itself but is rendered immunogenic when
conjugated with an immunogenic molecule containing antigenic
determinants.
[0067] As used herein, the term "adjuvant" refers to a substance
which, when added to an immunogenic agent, nonspecifically enhances
or potentiates an immune response to the agent in the recipient
host upon exposure to the mixture.
[0068] In another embodiment, the invention provides compositions
comprising modified ISS and an antigen. Antigens suitable for
administration with modified ISS include any molecule capable of
eliciting a B cell or T cell antigen-specific response. Preferably,
antigens elicit an antibody response specific for the antigen. A
wide variety of molecules are antigens. These include, but are not
limited to, sugars, lipids and polypeptides, as well as
macromolecules such as complex carbohydrates, and phospholipids.
Small molecules may need to be haptenized in order to be rendered
antigenic. Preferably, antigens of the present invention include
peptides, lipids (e.g. sterols, fatty acids, and phospholipids),
polysaccharides such as those used in Hemophilus influenza
vaccines, gangliosides and glycoproteins.
[0069] As used herein, the term "peptide" includes peptides and
proteins that are of sufficient length and composition to effect a
biological response, e.g. antibody production or cytokine activity
whether or not the peptide is a hapten. Typically, the peptides are
of at least six amino acid residues in length. The term "peptide"
further includes modified amino acids, such modifications
including, but not limited to, phosphorylation, glycosylation,
pegylation, lipidization and methylation.
[0070] In one embodiment, the invention provides compositions
comprising modified ISS and antigenic peptides. Antigenic peptides
can include purified native peptides, synthetic peptides,
recombinant proteins, crude protein extracts, attenuated or
inactivated viruses, cells, micro-organisms, or fragments of such
peptides.
[0071] Many antigenic peptides and proteins are known, and
available in the art; others can be identified using conventional
techniques. Protein antigens that can serve as immunomodulatory
facilitators include, but are not limited to, the following
examples. Isolated native or recombinant antigens can be derived
from plant pollens (see, for example, Rafnar et al. (1991) J. Biol.
Chem. 266:1229-1236; Breiteneder et al. (1989) EMBO J. 8:1935-1938;
Elsayed et al. (1991) Scand. J. Clin. Lab. Invest. Suppl.
204:17-31; and Malley (1989) J. Reprod. Immunol. 16:173-186), dust
mite proteins (see, for example, Chua et al. (1988) J. Exp. Med.
167:175-182; Chua et al. (1990) Int. Arch. Allergy Appl. Immunol.
91:124-129; and Joost van Neerven et al. (1993) J. Immunol.
151:2326-2335), animal dander (see, for example, Rogers et al.
(1993) Mol. Immunol. 30:559-568), animal saliva, bee venom, and
fungal spores. Live, attenuated and inactivated microorganisms such
as HIV-1, HIV-2, herpes simplex virus, hepatitis A virus (Bradley
et al. (1984) J. Med. Virol. 14:373-386), rotavirus, polio virus
(Jiang et al. (1986) J. Biol. Stand. 14:103-109), hepatitis B
virus, measles virus (James et al. (1995) N. Engl. J. Med.
332:1262-1266), human and bovine papilloma virus, and slow brain
viruses can provide peptide antigens. For immunization against
tumor formation, immunomodulatory peptides can include tumor cells
(live or irradiated), tumor cell extracts, or protein subunits of
tumor antigens. Vaccines for immuno-based contraception can be
formed by including sperm proteins administered with modified ISS.
Lea et al. (1996) Biochim. Biophys. Acta 1307:263.
[0072] The modified ISS and antigen can be administered as a
modified ISS-antigen conjugate and/or they can be co-administered
as a complex in the form of an admixture, such as in an emulsion.
The association of the modified ISS and the antigen molecules in a
modified ISS-antigen conjugate can be through covalent interactions
and/or through non-covalent interactions, including high affinity
and/or low affinity interactions. Examples of non-covalent
interactions that can couple a modified ISS and an antigen in a
modified ISS-antigen conjugate include, but are not limited to,
ionic bonds, hydrophobic interactions, hydrogen bonds and van der
Waals attractions.
[0073] In another embodiment, modified ISS can be administered in
conjunction with one or more immunomodulatory facilitator. Thus,
the invention provides compositions comprising modified ISS and an
immunomodulatory facilitator. As used herein, the term
"immunomodulatory facilitator" refers to molecules which support
and/or enhance the immunomodulatory activity of a modified ISS.
Examples of immunomodulatory facilitators can include
co-stimulatory molecules, such as cytokines, and/or adjuvants. The
modified ISS and facilitator can be administered as a modified
ISS-facilitator conjugate and/or they can be co-administered as a
complex in the form of an admixture, such as in an emulsion. The
association of the modified ISS and the facilitator molecules in a
modified ISS-facilitator conjugate can be through covalent
interactions and/or through non-covalent interactions, including
high affinity and/or low affinity interactions. Examples of
non-covalent interactions that can couple a modified ISS and a
facilitator in a modified ISS-facilitator conjugate include, but
are not limited to, ionic bonds, hydrophobic interactions, hydrogen
bonds and van der Waals attractions.
[0074] Immunomodulatory facilitators include, but are not limited
to, co-stimulatory molecules (such as cytokines, chemokines,
targeting protein ligand, trans-activating factors, peptides, and
peptides comprising a modified amino acid) and adjuvants (such as
alum, lipid emulsions, and polylactide/polyglycolide
microparticles).
[0075] Among suitable immunomodulatory cytokine peptides for
administration with modified ISS are the interleukins (e.g., IL-1,
IL-2, IL-3, etc.), interferons (e.g., IFN-.alpha., IFN-.beta.,
IFN-.gamma.), erythropoietin, colony stimulating factors (e.g.,
G-CSF, M-CSF, GM-CSF) and TNF-.alpha.. Preferably,
immunostimulatory peptides for use in conjunction with modified ISS
oligonucleotides are those that stimulate Th1-type immune
responses, such as IL-] 2 (Bliss et al. (1996) J. Immunol.
156:887-894), IL-18, TNF-.alpha., .beta. and .gamma., and/or
transforming growth factor (TGF)-.alpha..
[0076] Peptides administered with modified ISS can also include
amino acid sequences that mediate protein binding to a specific
receptor or that mediate targeting to a specific cell type or
tissue. Examples include, but are not limited to, antibodies or
antibody fragments, peptide hormones such as human growth hormone,
and enzymes. Immunomodulatory peptides also include peptide
hormones, peptide neurotransmitters and peptide growth factors.
Co-stimulatory molecules such as B7 (CD80), trans-activating
proteins such as transcription factors, chemokines such as
macrophage chemotactic protein (MCP) and other chemoattractant or
chemotactic peptides are also useful peptides for administration
with modified ISS.
[0077] The modified ISS can also be conjugated to other antigens
such as lipids, polysaccharides, gangliosides and the like, through
a linking group such as a peptide.
[0078] The invention also provides for the administration of
modified ISS in conjunction with an adjuvant. Administration of an
antigen with a modified ISS and an adjuvant leads to a potentiation
of a immune response to the antigen and thus, can result in an
enhanced immune response compared to that which results from a
composition comprising the modified ISS and antigen alone. Thus, in
another embodiment, the invention provides compositions comprising
ISS, an antigen and an adjuvant whereby the modified
ISS/antigen/adjuvant are co-administered. Preferably, the
immunogenic composition contains an amount of an adjuvant
sufficient to potentiate the immune response to the immunogen.
Preferably, adjuvants include, but are not limited to, oil-in-water
emulsions, water-in oil emulsions, alum (aluminum salts), liposomes
and microparticles, including but not limited to, polysytrene,
starch, polyphosphazene and polylactide/polyglycosides. More
preferably, the modified ISS and antigen are co-administered with
alum. More preferably, the modified ISS and antigen are
co-administered with liposomes. Still more preferably, the modified
ISS and antigen are co-administered with an oil-in-water
emulsion.
[0079] Suitable adjuvants also include, but are not limited to,
squalene mixtures (SAF-1), muramyl peptide, saponin derivatives,
mycobacterium cell wall preparations, monophosphoryl lipid A,
mycolic acid derivatives, nonionic block copolymer surfactants,
Quil A, cholera toxin B subunit, polyphosphazene and derivatives,
and immunostimulating complexes (ISCOMs) such as those described by
Takahashi et al. (1990) Nature 344:873-875, as well as, lipid-based
adjuvants and others described herein. For veterinary use and for
production of antibodies in animals, mitogenic components of
Freund's adjuvant (both complete and incomplete) can be used.
[0080] As with all immunogenic compositions, the immunologically
effective amounts of the components must be determined empirically.
Factors to be considered include the antigenicity, whether or not
modified ISS and/or antigen will be complexed with or covalently
attached to an immunomodulatory facilitator, an adjuvant or carrier
protein or other carrier, route of administration and the number of
immunizing doses to be administered. Such factors are known in the
vaccine art and it is well within the skill of immunologists to
make such determinations without undue experimentation.
[0081] The invention further provides for compositions in which
modified ISS and an immunomodulatory molecule(s) are in proximate
association at a distance effective to enhance the immune response
generated compared to the administration of the modified ISS and
the immunomodulatory molecule as an admixture. Thus, the invention
provides compositions and methods of use thereof comprising an
encapsulating agent that can maintain the proximate association of
the modified ISS and immunomodulatory molecule until the complex is
available to the target. Preferably, the composition comprising
modified ISS, immunomodulatory molecule and encapsulating agent is
in the form of adjuvant oil-in-water emulsions, microparticles
and/or liposomes. More preferably, adjuvant oil-in-water emulsions,
microparticles and/or liposomes encapsulating a modified
ISS-immunomodulatory molecule are in the form of particles from
about 0.04 .mu.m to about 100 .mu.m in size, more preferably, from
about 0.1 .mu.m to about 20 .mu.m, even more preferably, from about
0.15 .mu.m to about 10 .mu.m.
[0082] Colloidal dispersion systems, such as microspheres, beads,
macromolecular complexes, nanocapsules and lipid-based system, such
as oil-in-water emulsions, micelles, mixed micelles and liposomes
can provide effective encapsulation of modified ISS-containing
compositions.
[0083] The encapsulation composition further comprises any of a
wide variety of components. These include, but are not limited to,
alum, lipids, phospholipids, lipid membrane structures (LMS),
polyethylene glycol (PEG) and other polymers, such as polypeptides,
glycopeptides, and polysaccharides.
[0084] Polypeptides suitable for encapsulation components include
any known in the art and include, but are not limited to, fatty
acid binding proteins. Modified polypeptides contain any of a
variety of modifications, including, but not limited to
glycosylation, phosphorylation, myristylation, sulfation and
hydroxylation. As used herein, a suitable polypeptide is one that
will protect a modified ISS-containing composition to preserve the
immunomodulatory activity thereof. Examples of binding proteins
include, but are not limited to, albumins such as bovine serum
albumin (BSA) and pea albumin.
[0085] Other suitable polymers can be any known in the art of
pharmaceuticals and include, but are not limited to,
naturally-occurring polymers such as dextrans, hydroxyethyl starch,
and polysaccharides, and synthetic polymers. Examples of naturally
occurring polymers include proteins, glycopeptides,
polysaccharides, dextran and lipids. The additional polymer can be
a synthetic polymer. Examples of synthetic polymers which are
suitable for use in the present invention include, but are not
limited to, polyalkyl glycols (PAG) such as PEG, polyoxyethylated
polyols (POP), such as polyoxyethylated glycerol (POG),
polytrimethylene glycol (PTG) polypropylene glycol (PPG),
polyhydroxyethyl methacrylate, polyvinyl alcohol (PVA), polyacrylic
acid, polyethyloxazoline, polyacrylamide, polyvinylpyrrolidone
(PVP), polyamino acids, polyurethane and polyphosphazene. The
synthetic polymers can also be linear or branched, substituted or
unsubstituted, homopolymeric, co-polymers, or block co-polymers of
two or more different synthetic monomers.
[0086] PEGs constitute a diverse group of molecules. A general
formula for PEGs is as follows:
R.sub.1 O-(CH.sub.2CH.sub.2O).sub.n-R.sub.3
[0087] where R.sub.1 and R.sub.3 are independently H, H.sub.3C, OH,
or a linear or branched, substituted or unsubstituted alkyl group
and n is an integer between 1 and about 1,000. The term "PEG"
includes both unsubstituted (R.sub.1 and R.sub.3=H) as well as
substituted PEG. The PEGs for use in encapsulation compositions of
the present invention are either purchased from chemical suppliers
or synthesized using techniques known to those of skill in the
art.
[0088] The term "LMS", as used herein, means lamellar lipid
particles wherein polar head groups of a polar lipid are arranged
to face an aqueous phase of an interface to form membrane
structures. Examples of the LMSs include liposomes, micelles,
cochleates (i.e., generally cylindrical liposomes), microemulsions,
unilamellar vesicles, multilamellar vesicles, and the like.
[0089] A preferred colloidal dispersion system of this invention is
a liposome. In mice immunized with a liposome-encapsulated antigen,
liposomes appeared to enhance a Th1-type immune response to the
antigen. Aramaki et al. (1995) Vaccine 13:1809-1814. As used
herein, a "liposome" or "lipid vesicle" is a small vesicle bounded
by at least one and possibly more than one bilayer lipid membrane.
Liposomes are made artificially from phospholipids, glycolipids,
lipids, steroids such as cholesterol, related molecules, or a
combination thereof by any technique known in the art, including
but not limited to sonication, extrusion, or removal of detergent
from lipid-detergent complexes. A liposome can also optionally
comprise additional components, such as a tissue targeting
component. It is understood that a "lipid membrane" or "lipid
bilayer" need not consist exclusively of lipids, but can
additionally contain any suitable other components, including, but
not limited to, cholesterol and other steroids, lipid-soluble
chemicals, proteins of any length, and other amphipathic molecules,
providing the general structure of the membrane is a sheet of two
hydrophilic surfaces sandwiching a hydrophobic core. For a general
discussion of membrane structure, see The Encyclopedia of Molecular
Biology by J. Kendrew (1994). For suitable lipids see e.g., Lasic
(1993) "Liposomes: from Physics to Applications" Elsevier,
Amsterdam.
[0090] Preferably, a liposomal composition is chosen that allows
the membrane to be formed with reproducible qualities, such as
diameter, and is stable in the presence of elements expected to
occur where the liposome is to be used, such as physiological
buffers and circulating molecules. Preferably, the liposome is
resilient to the effects of manipulation by storage, freezing, and
mixing with pharmaceutical excipients.
[0091] Lipids suitable for incorporation into lipid membrane
structures include, but are not limited to, natural, semi-synthetic
or synthetic mono- or di-glycerophospholipids including, but not
limited to, phosphatidylcholines (PCs), phosphatidylethanolamines
(PEs), phosphatidylglycerols (PGs), phosphatidylinositols (PIs),
phosphatidic acids (PAs), phosphatidylserines (PSs), glycero- and
cardiolipins. Sphingolipids such as sphingomyelin (SM) and
cerebrosides can also be incorporated. While natural phospholipids
occur with the phospho moiety at the sn-3 position and hydrophobic
chains at the sn-1 and sn-2 positions, synthetic lipids can have
alternative stereochemistry with, e.g., the phospho group at the
sn-1 or sn-2 positions. Furthermore, the hydrophobic chains can be
attached to the glycerol backbone by acyl, ether, alkyl or other
linkages. Derivatives of these lipids are also suitable for
incorporation into liposomes. Derivatives suitable for use include,
but are not limited to, haloalkyl derivatives, including those in
which all or some of the hydrogen atoms of the alkyl chains are
substituted with, e.g., fluorine. In addition, cholesterol and
other amphipathic steroids, bolaamphiphiles (lipids with polar
moieties at either end of the molecule which form monolayer
membranes) and polyglycerolmonoalkylthers can also be incorporated.
Liposomes can be composed of a single lipid or mixtures of two or
more different lipids.
[0092] In one embodiment, the lipid bilayer of the liposome is
formed primarily from phospholipids. Preferably, the phospholipid
composition is a complex mixture, comprising a combination of PS
and additional lipids such as PC, PA, PE, PG and SM, PI, and/or
cardiolipin (diphosphatidylglycerol). If desired, SM can be
replaced with a greater proportion of PC, PE, or a combination
thereof. PS can be optionally replaced with PG. The composition is
chosen so as to confer upon the LMS both stability during storage
and administration.
[0093] Practitioners of ordinary skill will readily appreciate that
each phospholipid in the foregoing list can vary in its structure
depending on the fatty acid moieties that are esterified to the
glycerol moiety of the phospholipid. Generally, most commercially
available forms of a particular phospholipid can be used. However,
phospholipids containing particular fatty acid moieties may be
preferred for certain applications.
[0094] A general process for preparing liposomes containing
modified ISS-containing compositions is as follows. An aqueous
dispersion of liposomes is prepared from membrane components, such
as phospholipids (e.g. PS, PC, PG, SM and PE) and glycolipids
according to any known methods. See, e.g., Ann. Rev. Biophys.
Bioeng. 9:467 (1980). The liposomes can further contain sterols,
dialkylphosphates, diacylphosphatidic acids, stearylamine,
.alpha.-tocopherol, etc., in the liposomal membrane.
[0095] To the liposomal dispersion thus prepared is added an
aqueous solution of the modified ISS-containing composition and the
mixture is allowed to stand for a given period of time, preferably
under warming at a temperature above the phase transition
temperature of the membrane or above 40.degree. C., followed by
cooling to thereby prepare liposomes containing the modified
ISS-containing composition in the liposomal membrane.
[0096] Alternatively, the desired liposomes can also be prepared by
previously mixing the above-described membrane components and
modified ISS-containing composition and treating the mixture in
accordance with known methods for preparing liposomes.
[0097] The lipid vesicles can be prepared by any suitable technique
known in the art. Methods include, but are not limited to,
microencapsulation, microfluidization, LLC method, ethanol
injection, freon injection, the "bubble" method, detergent
dialysis, hydration, sonication, and reverse-phase evaporation.
Reviewed in Watwe et al. (1995) Curr. Sci. 68:715-724. For example,
ultrasonication and dialysis methods generally produce small
unilamellar vesicles; extrusion and reverse-phase evaporation
generally produce larger sized vesicles. Techniques may be combined
in order to provide vesicles with the most desirable
attributes.
[0098] Optionally, the LMS also includes steroids to improve the
rigidity of the membrane. Any amount of a steroid can be used.
Suitable steroids include, but are not limited to, cholesterol and
cholestanol. Other molecules that can be used to increase the
rigidity of the membrane include, but are not limited to,
cross-linked phospholipids.
[0099] Other preferred LMSs for use in vivo are those with an
enhanced ability to evade the reticuloendothelial system, which
normally phagocytoses and destroys non-native materials, thereby
giving the liposomes a longer period in which to reach the target
cell. Effective lipid compositions in this regard are those with a
large proportion of SM and cholesterol, or SM and PI. LMSs with
prolonged circulation time also include those that comprise the
monosialoganglioside GM1, glucuronide, or PEG.
[0100] The invention encompasses LMSs containing tissue or cellular
targeting components. Such targeting components are components of a
LMS that enhance its accumulation at certain tissue or cellular
sites in preference to other tissue or cellular sites when
administered to an intact animal, organ, or cell culture. A
targeting component is generally accessible from outside the
liposome, and is therefore preferably either bound to the outer
surface or inserted into the outer lipid bilayer. A targeting
component can be inter alia a peptide, a region of a larger
peptide, an antibody specific for a cell surface molecule or
marker, or antigen binding fragment thereof, a nucleic acid, a
carbohydrate, a region of a complex carbohydrate, a special lipid,
or a small molecule such as a drug, hormone, or hapten, attached to
any of the aforementioned molecules. Antibodies with specificity
toward cell type-specific cell surface markers are known in the art
and are readily prepared by methods known in the art.
[0101] The LMSs can be targeted to any cell type toward which a
therapeutic treatment is to be directed, e.g., a cell type which
can modulate and/or participate in an immune response. Such target
cells and organs include, but are not limited to, APCs, such as
macrophages, dendritic cells and lymphocytes, lymphatic structures,
such as lymph nodes and the spleen, and nonlymphatic structures,
particularly those in which dendritic cells are found.
[0102] The LMS compositions of the present invention can
additionally comprise surfactants. Surfactants can be cationic,
anionic, amphiphilic, or nonionic. A preferred class of surfactants
are nonionic surfactants; particularly preferred are those that are
water soluble. Nonionic, water soluble surfactants include
polyoxyethylene derivatives of fatty alcohols, fatty acid ester of
fatty alcohols and glyceryl esters, wherein the polyoxyethylene
group is coupled via an ether linkage to an alcohol group. Examples
include, but are not limited to, polyoxyethylene sorbitan fatty
acid esters, polyoxyethylene castor oil derivatives,
polyoxyethylene hardened castor oil derivatives, fatty acid sodium
salts, sodium cholates, polyexyethylene fatty acid ester and
polyoxyethylene alkyl ethers.
[0103] The LMS compositions encompassed herein include micelles.
The term "micelles" as used herein means aggregates which form from
tenside molecules in aqueous solutions above a specific temperature
(Krafft point) or a characteristic concentration, the critical
micellization concentration (cmc). When the cmc is exceeded, the
monomer concentration remains practically constant and the excess
tenside molecules form micelles. Micelles are thermodynamically
stable association colloids of surfactant substances in which the
hydrophobic radicals of the monomers lie in the interior of the
aggregates and are held together by hydrophobic interaction; the
hydrophilic groups face the water and by solvation provide the
solubility of the colloid. Micelles occur in various shapes
(spheres, rods, discs) depending on the chemical constitution of
the tenside and on the temperature, concentration or ionic strength
of the solution. Reaching the cmc is manifest by abrupt changes in
surface tension, osmotic pressure, electrical conductivity and
viscosity.
[0104] A process for preparing micelles containing modified
ISS-containing compositions is as follows. A micelle-forming
surfactant, such as polyoxyethylene sorbitan fatty acid esters,
polyoxyethylene castor oil derivatives, polyoxyethylene hardened
castor oil derivatives, fatty acid sodium salts, sodium cholates,
polyoxyethylene fatty acid ester, and polyoxyethylene alkyl ethers,
alkyl glycosides, is added to water at a concentration above the
cmc to prepare a micellar dispersion. To the micellar dispersion is
added an aqueous solution of a modified ISS-containing composition
and the mixture is allowed to stand for a given period of time,
preferably under warming at 40.degree. C. or higher, followed by
cooling, to thereby prepare micelles containing modified
ISS-containing compositions in the micellar membrane.
Alternatively, the desired micelles can also be prepared by
previously mixing the above-described micelle-forming substances
and modified ISS-containing compositions and treating the mixture
according to known methods for micelle formation.
[0105] Synthesis of the Modified ISS
[0106] a) Modified ISS
[0107] The modified ISS can be synthesized using techniques and
nucleic acid synthesis equipment which are well known in the art
including, but not limited to, enzymatic methods, chemical methods,
and the degradation of larger oligonucleotide sequences. See, for
example, Ausubel et al. (1987); and Sambrook et al. (1989). When
assembled enzymatically, the individual units can be ligated, for
example, with a ligase such as T4 DNA or RNA ligase. U.S. Pat. No.
5,124,246. Chemical synthesis of oligonucleotides can involve
conventional automated methods, such as the phosphoramidite method
disclosed by Warner et al. (1984) DNA 3:401. See also U.S. Pat. No.
4,458,066. Oligonucleotide degradation can be accomplished through
the exposure of an oligonucleotide to a nuclease, as exemplified in
U.S. Pat. No. 4,650,675.
[0108] The modified ISS can also be isolated using conventional
polynucleotide isolation procedures. Such procedures include, but
are not limited to, hybridization of probes to genomic or cDNA
libraries to detect shared nucleotide sequences, antibody screening
of expression libraries to detect shared structural features and
synthesis of particular native sequences by the polymerase chain
reaction.
[0109] Circular modified ISS can be isolated, synthesized through
recombinant methods, or chemically synthesized. Where the circular
modified ISS is obtained through isolation or through recombinant
methods, the modified ISS will preferably be a plasmid. The
chemical synthesis of smaller circular oligonucleotides can be
performed using any method described in the literature. See, for
instance, Gao et al. (1995) Nucleic Acids Res. 23:2025-2029; and
Wang et al. (1994) Nucleic Acids Res. 22:2326-2333.
[0110] The modified ISS can also contain phosphorous based modified
oligonucleotides. These can be synthesized using standard chemical
transformations. The efficient solid-support based construction of
methylphosphonates has also been described. The synthesis of other
phosphorous based modified oligonucleotides, such as
phosphotriesters (Miller et al. (1971) JACS 93:6657-6665),
phosphoramidates (Jager et al. (1988) Biochem. 27:7247-7246), and
phosphorodithioates (U.S. Pat. No. 5,453,496) has also been
described. Other non-phosphorous based modified oligonucleotides
can also be used. Stirchak et al. (1989) Nucleic Acids Res.
17:6129-6141.
[0111] The techniques for making phosphate group modifications to
oligonucleotides are known in the art. For review of one such
useful technique, an intermediate phosphate triester for the target
oligonucleotide product is prepared and oxidized to the naturally
occurring phosphate triester with aqueous iodine or with other
agents, such as anhydrous amines. The resulting oligonucleotide
phosphoramidates can be treated with sulfur to yield
phosphorothioates. The same general technique (excepting the sulfur
treatment step) can be applied to yield methylphosphoamidites from
methylphosphonates. See also, U.S. Pat. Nos. 4,425,732; 4,458,066;
5,218,103; and 5,453,496.
[0112] The preparation of base-modified nucleosides, and the
synthesis of modified oligonucleotides using said base-modified
nucleosides as precursors, has been described, for example, in U.S.
Pat. Nos. 4,910,300, 4,948,882, and 5,093,232. These base-modified
nucleosides have been designed so that they can be incorporated by
chemical synthesis into either terminal or internal positions of an
oligonucleotide. Such base-modified nucleosides, present at either
terminal or internal positions of an oligonucleotide, can serve as
sites for attachment of a peptide or other antigen. Nucleosides
modified in their sugar moiety have also been described (including,
but not limited to, e.g., U.S. Pat. Nos. 4,849,513, 5,015,733,
5,118,800, 5,118,802) and can be used similarly.
[0113] b) Immunomodulatory Molecules
[0114] Attenuated and inactivated viruses are suitable for use
herein as the antigen. Preparation of these viruses is well-known
in the art. Polio virus can be inactivated by chemical agents such
as beta-propiolactone. Jiang et al. (1986). The growth of
attenuated strains of Hepatitis A virus has been described (Bradley
et al. (1984)), as well as the growth of attenuated measles virus
(James et al. (1995). Additionally, attenuated and inactivated
viruses such as HIV-1, HIV-2, herpes simplex virus, hepatitis B
virus, rotavirus, human and non-human papillomavirus and slow brain
viruses can provide peptide antigens.
[0115] Allergens are suitable for use herein as immunomodulatory
molecules. Preparation of many allergens is well-known in the art,
including, but not limited to, preparation of ragweed pollen
allergen Antigen E (Amb aI) (Rafnar et al. 1991), major dust mite
allergens Der pI and Der PII (Chua et al. (1988); and Chua et al.
(1990)), white birch pollen Betvl (Breitneder et al. 1989),
domestic cat allergen Fel dI (Rogers et al. (1993), and protein
antigens from tree pollen (Elsayed et al. (1991)). Preparation of
protein antigens from grass pollen for in vivo administration has
been reported. Malley (1989).
[0116] Immunomodulatory peptides can be native or synthesized
chemically or enzymatically. Any method of chemical synthesis known
in the art is suitable. Solution phase peptide synthesis can be
used to construct peptides of moderate size or, for the chemical
construction of peptides, solid phase synthesis can be employed.
Atherton et al. (1981) Hoppe Seylers Z. Physiol. Chem. 362:833-839.
Proteolytic enzymes can also be utilized to couple amino acids to
produce peptides. Kullmann (1987) Enzymatic Peptide Synthesis, CRC
Press, Inc. Alternatively, the peptide can be obtained by using the
biochemical machinery of a cell, or by isolation from a biological
source. Recombinant DNA techniques can be employed for the
production of peptides. Hames et al. (1987) Transcription and
Translation: A Practical Approach, IRL Press. Peptides can also be
isolated using standard techniques such as affinity
chromatography.
[0117] Preferably the antigens are peptides, lipids (e.g. sterols,
fatty acids, and phospholipids), polysaccharides such as those used
in H. influenza vaccines, gangliosides and glycoproteins. These can
be obtained through several methods known in the art, including
isolation and synthesis using chemical and enzymatic methods. In
certain cases, such as for many sterols, fatty acids and
phospholipids, the antigenic portions of the molecules are
commercially available.
[0118] c) Modified ISS-Immunomodulatory Molecule Conjugates
[0119] The modified ISS portion can be coupled with the
immunomodulatory molecule portion of a conjugate in a variety of
ways, including covalent and/or non-covalent interactions.
[0120] The link between the portions can be made at the 3' or 5'
end of the modified ISS, or at a suitably modified base at an
internal position in the modified ISS. If the immunomodulatory
molecule is a peptide and contains a suitable reactive group (e.g.,
an N-hydroxysuccinimide ester) it can be reacted directly with the
N.sup.4 amino group of cytosine residues. Depending on the number
and location of cytosine residues in the modified ISS, specific
labeling at one or more residues can be achieved.
[0121] Alternatively, modified oligonucleosides, such as are known
in the art, can be incorporated at either terminus, or at internal
positions in the modified ISS. These can contain blocked functional
groups which, when deblocked, are reactive with a variety of
functional groups which can be present on, or attached to, the
immunomodulatory molecule of interest.
[0122] Where the immunomodulatory molecule is a peptide, this
portion of the conjugate can be attached to the 3'-end of the
modified ISS through solid support chemistry. For example, the
modified ISS portion can be added to a polypeptide portion that has
been pre-synthesized on a support. Haralambidis et al. (1990a)
Nucleic Acids Res. 18:493-499; and Haralambidis et al. (1990b)
Nucleic Acids Res. 18:501-505. Alternatively, the modified ISS can
be synthesized such that it is connected to a solid support through
a cleavable linker extending from the 3'end. Upon chemical cleavage
of the modified ISS from the support, a terminal thiol group is
left at the 3'-end of the oligonucleotide (Zuckermann et al. (1987)
Nucleic Acids Res. 15:5305-5321; and Corey et al. (1987) Science
238:1401-1403) or a terminal amine group is left at the 3'-end of
the oligonucleotide (Nelson et al. (1989) Nucleic Acids Res.
17:1781-1794). Conjugation of the amino-modified modified ISS to
amino groups of the peptide can be performed as described in Benoit
et al. (1987) Neuromethods 6:43-72. Conjugation of the
thiol-modified modified ISS to carboxyl groups of the peptide can
be performed as described in Sinah et al. (1991) Oligonucleotide
Analogues. A Practical Approach, IRL Press. Coupling of an
oligonucleotide carrying an appended maleimide to the thiol side
chain of a cysteine residue of a peptide has also been described.
Tung et al. (1991) Bioconjug. Chem. 2:464-465.
[0123] The peptide portion of the conjugate can be attached to the
5'-end of the modified ISS through an amine, thiol, or carboxyl
group that has been incorporated into the oligonucleotide during
its synthesis. Preferably, while the oligonucleotide is fixed to
the solid support, a linking group comprising a protected amine,
thiol, or carboxyl at one end, and a phosphoramidite at the other,
is covalently attached to the 5'-hydroxyl. Agrawal et al. (1986)
Nucleic Acids Res. 14:6227-6245; Connolly (1985) Nucleic Acids Res.
13:4485-4502; Kremsky et al. (1987) Nucleic Acids Res.
15:2891-2909; Connolly (1987) Nucleic Acids Res. 15:3131-3139;
Bischoff et al. (1987) Anal. Biochem. 164:336-344; Blanks et al.
(1988) Nucleic Acids Res. 16:10283-10299; and U.S. Pat. Nos.
4,849,513, 5,015,733, 5,118,800, and 5,118,802. Subsequent to
deprotection, the latent amine, thiol, and carboxyl functionalities
can be used to covalently attach the oligonucleotide to a peptide.
Benoit et al. (1987); and Sinah et al. (1991).
[0124] The peptide portion can be attached to a modified cytosine
or uracil at any position in the modified ISS. The incorporation of
a "linker arm" possessing a latent reactive functionality, such as
an amine or carboxyl group, at C-5 of the modified base provides a
handle for the peptide linkage. Ruth, 4th Annual Congress for
Recombinant DNA Research, p. 123.
[0125] A modified ISS-immunomodulatory molecule conjugate can also
be formed through non-covalent interactions, such as ionic bonds,
hydrophobic interactions, hydrogen bonds and/or van der Waals
attractions.
[0126] Non-covalently linked conjugates can include a non-covalent
interaction such as a biotin-streptavidin complex. A biotinyl group
can be attached, for example, to a modified base of an ISS. Roget
et al. (1989) Nucleic Acids Res. 17:7643-7651. Incorporation of a
streptavidin moiety into the peptide portion allows formation of a
non-covalently bound complex of the streptavidin conjugated peptide
and the biotinylated oligonucleotide.
[0127] Non-covalent associations can also occur through ionic
interactions involving a modified ISS and residues within the
immunomodulatory molecule, such as charged amino acids, or through
the use of a linker portion comprising charged residues that can
interact with both the oligonucleotide and the immunomodulatory
molecule. For example, non-covalent conjugation can occur between a
generally negatively-charged modified ISS and positively-charged
amino acid residues of a peptide, e.g., polylysine and polyarginine
residues.
[0128] Non-covalent conjugation between modified ISS and
immunomodulatory molecules can occur through DNA binding motifs of
molecules that interact with DNA as their natural ligands. For
example, such DNA binding motifs can be found in transcription
factors and anti-DNA antibodies.
[0129] The linkage of the modified ISS to a lipid can be formed
using standard methods. These methods include, but are not limited
to, the synthesis of oligonucleotide-phospholipid conjugates
(Yanagawa et al. (1988) Nucleic Acids Symp. Ser. 19:189-192),
oligonucleotide-fatty acid conjugates (Grabarek et al. (1990) Anal.
Biochem. 185:131-135; and Staros et al. (1986) Anal. Biochem.
156:220-222), and oligonucleotide-sterol conjugates. Boujrad et al.
(1993) Proc. Natl. Acad. Sci. USA 90:5728-5731.
[0130] The linkage of the oligonucleotide to an oligosaccharide can
be formed using standard known methods. These methods include, but
are not limited to, the synthesis of
oligonucleotide-oligosaccharide conjugates, wherein the
oligosaccharide is a moiety of an immunoglobulin. O'Shannessy et
al. (1985) J. Applied Biochem. 7:347-355.
[0131] The linkage of a circular modified ISS to a peptide or
antigen can be formed in several ways. Where the circular modified
ISS is synthesized using recombinant or chemical methods, a
modified nucleoside is suitable. Ruth (1991) in Oligonucleotides
and Analogues: A Practical Approach, IRL Press. Standard linking
technology can then be used to connect the circular modified ISS to
the antigen or other peptide. Goodchild (1990) Bioconjug. Chem.
1:165. Where the circular modified ISS is isolated, or synthesized
using recombinant or chemical methods, the linkage can be formed by
chemically activating, or photoactivating, a reactive group (e.g.
carbene, radical) that has been incorporated into the antigen or
other peptide.
[0132] Additional methods for the attachment of peptides and other
molecules to oligonucleotides can be found in U.S. Pat. No.
5,391,723; Kessler (1992) "Nonradioactive labeling methods for
nucleic acids" in Kricka (ed.) Nonisotopic DNA Probe Techniques,
Academic Press; and Geoghegan et al. (1992) Bioconjug. Chem.
3:138-146.
[0133] Assessment of Immune Response to Modified ISS
[0134] Analysis (both qualitative and quantitative) of the immune
response to modified ISS-containing compositions can be by any
method known in the art, including, but not limited to, measuring
antigen-specific antibody production, activation of specific
populations of lymphocytes such as CD4.sup.+ T cells or NK cells,
and/or production of cytokines such as IFN, IL-2, IL-4, or IL-12.
Methods for measuring specific antibody responses include
enzyme-linked immunosorbent assay (ELISA) and are well known in the
art. Measurement of numbers of specific types of lymphocytes such
as CD4.sup.+ T cells can be achieved, for example, with
fluorescence-activated cell sorting (FACS). Cytotoxicity assays can
be performed for instance as described in Raz et al. (1994) Proc.
Natl. Acad. Sci. USA 91:9519-9523. Serum concentrations of
cytokines can be measured, for example, by ELISA. These and other
assays to evaluate the immune response to an immunogen are well
known in the art. See, for example, Selected Methods in Cellular
Immunology (1980) Mishell and Shiigi, eds., W. H. Freeman and
Co.
[0135] Administration of the Modified ISS
[0136] The modified ISS can be administered alone or in combination
with other pharmaceutical and/or immunogenic and/or
immunostimulatory agents and can be combined with a physiologically
acceptable carrier thereof. The effective amount and method of
administration of the particular modified ISS formulation can vary
based on the individual patient and the stage of the disease and
other factors evident to one skilled in the art. The route(s) of
administration useful in a particular application are apparent to
one of skill in the art. Routes of administration include but are
not limited to topical, dermal, transdermal, transmucosal,
epidermal parenteral, gastrointestinal, and naso-pharyngeal and
pulmonary, including transbronchial and transalveolar. A suitable
dosage range is one that provides sufficient modified
ISS-containing composition to attain a tissue concentration of
about 1-10 .mu.M as measured by blood levels. The absolute amount
given to each patient depends on pharmacological properties such as
bioavailability, clearance rate and route of administration.
[0137] As described herein, APCs and tissues with high
concentration of APCs are preferred targets for the modified
ISS-containing compositions. Thus, administration of modified ISS
to mammalian skin and/or mucosa, where APCs are present in
relatively high concentration, is preferred.
[0138] The present invention provides modified ISS-containing
compositions suitable for topical application including, but not
limited to, physiologically acceptable implants, ointments, creams,
rinses and gels. Topical administration is, for instance, by a
dressing or bandage having dispersed therein a delivery system, or
by direct administration of a delivery system into incisions or
open wounds. Creams, rinses, gels or ointments having dispersed
therein a modified ISS-containing composition are suitable for use
as topical ointments or wound filling agents.
[0139] Preferred routes of dermal administration are those which
are least invasive. Preferred among these means are transdermal
transmission, epidermal administration and subcutaneous injection.
Of these means, epidermal administration is preferred for the
greater concentrations of APCs expected to be in intradermal
tissue.
[0140] Transdermal administration is accomplished by application of
a cream, rinse, gel, etc. capable of allowing the modified
ISS-containing composition to penetrate the skin and enter the
blood stream. Compositions suitable for transdermal administration
include, but are not limited to, pharmaceutically acceptable
suspensions, oils, creams and ointments applied directly to the
skin or incorporated into a protective carrier such as a
transdermal device (so-called "patch"). Examples of suitable
creams, ointments etc. can be found, for instance, in the
Physician's Desk Reference.
[0141] For transdermal transmission, iontophoresis is a suitable
method lontophoretic transmission can be accomplished using
commercially available patches which deliver their product
continuously through unbroken skin for periods of several days or
more. Use of this method allows for controlled transmission of
pharmaceutical compositions in relatively great concentrations,
permits infusion of combination drugs and allows for
contemporaneous use of an absorption promoter.
[0142] An exemplary patch product for use in this method is the
LECTRO PATCH trademarked product of General Medical Company of Los
Angeles, Calif. This product electronically maintains reservoir
electrodes at neutral pH and can be adapted to provide dosages of
differing concentrations, to dose continuously and/or periodically.
Preparation and use of the patch should be performed according to
the manufacturer's printed instructions which accompany the LECTRO
PATCH product; those instructions are incorporated herein by this
reference.
[0143] For transdermal transmission, low-frequency ultrasonic
delivery is also a suitable method. Mitragotri et al. (1995)
Science 269:850-853. Application of low-frequency ultrasonic
frequencies (about 1 MHz) allows the general controlled delivery of
therapeutic compositions, including those of high molecular
weight.
[0144] Epidermal administration essentially involves mechanically
or chemically irritating the outermost layer of the epidermis
sufficiently to provoke an immune response to the irritant.
Specifically, the irritation should be sufficient to attract APCs
to the site of irritation.
[0145] An exemplary mechanical irritant means employs a
multiplicity of very narrow diameter, short tines which can be used
to irritate the skin and attract APCs to the site of irritation, to
take up modified ISS-containing compositions transferred from the
end of the tines. For example, the MONO-VACC old tuberculin test
manufactured by Pasteur Merieux of Lyon, France contains a device
suitable for introduction of modified ISS-containing
compositions.
[0146] The device (which is distributed in the U.S. by Connaught
Laboratories, Inc. of Swiftwater, Pa.) consists of a plastic
container having a syringe plunger at one end and a tine disk at
the other. The tine disk supports a multiplicity of narrow diameter
tines of a length which will just scratch the outermost layer of
epidermal cells. Each of the tines in the MONO-VACC kit is coated
with old tuberculin; in the present invention, each needle is
coated with a pharmaceutical composition of modified ISS-containing
composition. Use of the device is preferably according to the
manufacturer's written instructions included with the device
product. Similar devices which can also be used in this embodiment
are those which are currently used to perform allergy tests.
[0147] Another suitable approach to epidermal administration of
modified ISS is by use of a chemical which irritates the outermost
cells of the epidermis, thus provoking a sufficient immune response
to attract APCs to the area. An example is a keratinolytic agent,
such as the salicylic acid used in the commercially available
topical depilatory creme sold by Noxema Corporation under the
trademark NAIR. This approach can also be used to achieve
epithelial administration in the mucosa. The chemical irritant can
also be applied in conjunction with the mechanical irritant (as,
for example, would occur if the MONO-VACC type tine were also
coated with the chemical irritant). The modified ISS can be
suspended in a carrier which also contains the chemical irritant or
coadministered therewith.
[0148] Another delivery method for administering modified
ISS-containing compositions makes use of non-lipid polymers, such
as a synthetic polycationic amino polymer. Leff (1997) Bioworld
86:1-2.
[0149] Parenteral routes of administration include but are not
limited to electrical (iontophoresis) or direct injection such as
direct injection into a central venous line, intravenous,
intramuscular, intraperitoneal, intradermal, or subcutaneous
injection. Compositions suitable for parenteral administration
include, but are not limited, to pharmaceutically acceptable
sterile isotonic solutions. Such solutions include, but are not
limited to, saline and phosphate buffered saline for injection of
the modified ISS-containing compositions.
[0150] Gastrointestinal routes of administration include, but are
not limited to, ingestion and rectal. The invention includes
modified ISS-containing compositions suitable for gastrointestinal
administration including, but not limited to, pharmaceutically
acceptable, powders, pills or liquids for ingestion and
suppositories for rectal administration.
[0151] Naso-pharyngeal and pulmonary routes of administration
include, but are not limited to, by-inhalation, transbronchial and
transalveolar routes. The invention includes ISS-containing
compositions suitable for by-inhalation administration including,
but not limited to, various types of aerosols for inhalation, as
well as powder forms for delivery systems. Devices suitable for
by-inhalation administration of modified ISS-containing
compositions include, but are not limited to, atomizers and
vaporizers. Atomizers and vaporizers filled with the powders are
among a variety of devices suitable for use in by-inhalation
delivery of powders. See, e.g., Lindberg (1993) Summary of Lecture
at Management Forum 6-7 December 1993 "Creating the Future for
Portable Inhalers."
[0152] The methods of producing suitable devices for injection,
topical application, atomizers and vaporizers are known in the art
and will not be described in detail.
[0153] The choice of delivery routes can be used to modulate the
immune response elicited. For example, IgG titers and CTL
activities were identical when an influenza virus vector was
administered via intramuscular or epidermal (gene gun) routes;
however, the muscular inoculation yielded primarily IgG2A, while
the epidermal route yielded mostly IgG1. Pertmer et al. (1996) J.
Virol. 70:6119-6125. Thus, one of skill in the art can take
advantage of slight differences in immunogenicity elicited by
different routes of administering the immunomodulatory
oligonucleotides of the present invention.
[0154] The above-mentioned compositions and methods of
administration are meant to describe but not limit the methods of
administering the modified ISS-containing compositions of the
invention. The methods of producing the various compositions and
devices are within the ability of one skilled in the art and are
not described in detail here.
[0155] The following examples are provided to illustrate but not
limit the invention.
EXAMPLES
Example 1
[0156] Stimulation of Cytokine Production by Oligonucleotides
Comprising Modified ISS
[0157] Several oligonucleotides comprising modified ISS were tested
for their immunostimulatory activity on mouse splenocytes and on
human peripheral blood mononuclear cells (hPBMCs).
Immunostimulation in response to oligonucleotide was assessed by
measurement of cytokine secretion into the culture media and by
cell proliferation. Cytokine levels in the culture supernatant were
determined by enzyme-linked immunosorbent assay (ELISA) tests.
[0158] The oligonucleotides were synthesized using standard solid
phase oligonucleotide techniques. The solid phase ready analog
monomers were purchased from Glen Research, Sterling, Va. and
included in the standard manner in a solid phase oligonucleotide
synthesizer. The synthesis of the oligonucleotides were performed
by TriLink Bio Technologies Inc., San Diego, Calif.
[0159] Cells were isolated and prepared using standard techniques.
hPBMCs were isolated from heparinized peripheral blood from healthy
donors by ficoll Hypaque gradients. Spleens of BALB/c mice were
harvested and the splenocytes isolated using standard teasing and
treatment with ACK lysing buffer from Bio Whittaker, Inc. Isolated
cells were washed in RPMI 1640 media supplemented with 2%
heat-inactivated fetal calf serum (FCS), 50 .mu.M
2-mercaptoethanol, 1% penicillin-streptomycin, and 2 mM L-glutamine
and resuspended at approximately 4.times.10.sup.6 cells/ml in 110%
FCS/RPMI (RPMI 1640 media with 10% heat-inactivated FCS, 50 .mu.M
2-mercaptoethanol, 1% penicillin-streptomycin, and 2 mM
L-glutamine).
[0160] Generally, cell cultures were set up in triplicate with
approximately 4.times.10.sup.5 cells/well in a 96-well, flat
microtiter plate in 100 .mu.l 10% FCS/RPMI with the cells allowed
to rest for at lest 1 hour after plating. For oligonucleotide
activity assays, oligonucleotides were diluted in 10% FCS/RPMI and
100 .mu.l of the desired oligonucleotide dilution was added to the
appropriate well. In general, final oligonucleotide concentrations
included 0.1 .mu.g/ml, 1.0 .mu.g/ml, and 10 .mu.g/ml. Cells were
then incubated for 1, 2, or 3 days.
[0161] To determine cell proliferation, 100 .mu.l of supernatant
was harvested from each well on appropriate days, pulsed with 1.0
.mu.M tritiated thymidine and incubated overnight. Standard methods
to assess tritiated thymidine incorporation were used to determine
cell proliferation. Cytokine production by the cells was determined
by ELISAs of culture supernatant using commercially-available
antibodies to the cytokines. Examples of results of such
experiments are graphically depicted in FIGS. 2-4. The
oligonucleotides used included the following:
1TABLE 1 SEQ ID NO: Oligonucleotide Sequence 1
tgactgtgaacgttcgagatga ISS (bold, underline) 2
tgactgtgaabgttccagatga b = 5-bromocytosine 3 tgactgtgaagcttagagatga
no ISS 4 tcactctcttccttactcttct no ISS 5 tgactgtgaabgttcgagatga b =
5-bromocytosine 6 tgactgtgaabgttbgagatga b = 5-bromocytosine 7
tccatgabgttcgtgatcgt b = 5-bromocytosine 8 tccataabgttcctgatgct b =
5-bromocytosine 9 tccataabgttcgtgatgct b = 5-bromocytosine 10
tccataabgttcgcctaacgttcg b = 5-bromocytosine 11
tccataabgttcgcctaabgttcg b = 5-bromocytosine
[0162] Results from an experiment in which mouse splenocytes were
treated with 10 .mu.g/ml or 1 .mu.g/ml of the oligonucleotides
listed in Table 1 are depicted in FIGS. 2-4. Treatment of the cells
with oligonucleotides comprising at least one ISS resulted in the
production of IL-6 and IL-12 from the cells, as well as a
stimulation of cell proliferation. See, for example, FIGS. 2-4,
oligonucleotide 1. The oligonucleotides comprising a modified ISS
were, in general, as effective as or more effective than the
oligonucleotide with an unmodified ISS. See, for example, FIGS.
2-4, oligonucleotides 2, 5-11. Oligonucleotides without an ISS were
unable to stimulate IL-6 or IL-12 production or cell proliferation.
See, for example, FIGS. 2-4, oligonucleotides 3 and 4. All
oligonucleotides used in this experiment contained a
phosphorothioate backbone.
Example 2
[0163] Potentiation of an Immune Response with Adjuvant
Co-Administration
[0164] The effect of adjuvant co-administration with antigen and
modified ISS (mISS) on an immune response to the antigen is
examined using the adjuvants alum and MF59. Compositions comprising
1 .mu.g AgE, a major allergic component is short ragweed, is
injected intradermally into mice at week 0, 2, and 4. Antigen
compositions usable are listed below:
2 AgE AgE - mISS conjugate AgE + mISS mix (equivalent) AgE + mISS
mix (50 .mu.g mISS) AgE and MF59 AgE - mISS conjugate and MF59 AgE
and alum (25 .mu.g) AgE - mISS conjugate and alum (25 .mu.g) AgE
and alum (800 .mu.g)
[0165] The amount of anti-AgE antibody in the serum of the mice is
determined at day 0 and weeks 2, 4, and 6. Anti-AgE antibody assays
(IgE, IgG1, IgG2a) are performed by ELISA tests using the original
AgE vaccine as the coated antigen on microtiter plates as described
in Raz et al. (1996).
[0166] A comparison of anti-AgE antibody production, including
anti-AgE antibody subtypes, provides an indication as to the level
and type of immune response that results from each administered
composition.
Example 3
[0167] Selective Induction of a Th1-type Response in a Host after
Administration of a Composition Comprising a modified ISS
[0168] In mice, IgG2A antibodies are serological markers for a
Th1-type immune response, whereas IgG1 antibodies are indicative of
a Th2-type immune response. The production of the cytokine
IFN-.gamma. is also an indicator of a Th 1-type response.
[0169] To determine which response, if any, would be produced by
mice who received modified ISS compositions according to the
invention, groups of BALB/c mice are immunized with 10 .mu.g
.beta.-galactosidase (.beta.-Gal) protein. Some mice receive
.beta.-Gal alone, some receive a modified ISS-.beta.-Gal conjugate,
some receive a modified ISS-.beta.-Gal-adjuvant composition, and
some receive a composition of .beta.-Gal with a nonstimulatory
oligonucleotide. Nave mice are also included in the experiment.
[0170] At two week intervals, any IgG2A and IgG1 to .beta.-Gal
present in the serum of each mouse is measured by ELISA on
microtiter pates coated with .beta.-Gal. The titers of
anti-.beta.-Gal IgG2A and IgG1 antibodies from mice are compared to
determine whether the immune response, if any, is of the Th1- or
Th2-type.
[0171] Another set of BALB/c mice are immunized with .beta.-Gal as
described above and sacrificed 24 hours later. Spleens are
harvested from each mouse and splenocytes are isolated as described
previously. The splenocytes are added to microtiter wells
pre-coated with anti-CD-3 antibody. (The anti-CD-3 antibody
stimulates T cells through the T cell receptor complex.) The
splenocytes are cultured in RPMI 1640 with 10% FBS at
4.times.10.sup.5 cells/well and the supernatants sampled at 24, 48,
and 72 hours of culture. Cytokine production by the splenocytes is
determined with ELISA tests as described above. Relatively high
levels of IFN-.gamma. and IL-12 and relatively low levels of IL-4
would be expected with a Th1-type immune response. Relatively low
levels of IFN-.gamma. and IL-12 and relatively high levels of IL-4
would be expected with a Th2-type immune response. CTL activity of
the splenocytes is determined.
[0172] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications may be practiced. Therefore,
the descriptions and examples should not be construed as limiting
the scope of the invention, which is delineated by the appended
claims.
Sequence CWU 1
1
11 1 22 DNA Artificial sequence Synthetic construct 1 tgactgtgaa
cgttcgagat ga 22 2 22 DNA Artificial sequence Synthetic construct 2
tgactgtgaa ngttccagat ga 22 3 22 DNA Artificial sequence Synthetic
construct 3 tgactgtgaa gcttagagat ga 22 4 22 DNA Artificial
sequence Synthetic construct 4 tcactctctt ccttactctt ct 22 5 22 DNA
Artificial sequence Synthetic construct 5 tgactgtgaa ngttcgagat ga
22 6 22 DNA Artificial sequence Synthetic construct 6 tgactgtgaa
ngttngagat ga 22 7 20 DNA Artificial sequence Synthetic construct 7
tccatgangt tcgtgatcgt 20 8 20 DNA Artificial sequence Synthetic
construct 8 tccataangt tcctgatgct 20 9 20 DNA Artificial sequence
Synthetic construct 9 tccataangt tcgtgatgct 20 10 24 DNA Artificial
sequence Synthetic construct 10 tccataangt tcgcctaacg ttcg 24 11 24
DNA Artificial sequence Synthetic construct 11 tccataangt
tcgcctaang ttcg 24
* * * * *