U.S. patent application number 16/790557 was filed with the patent office on 2022-09-01 for compositions and methods for modulating ttr expression.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Ionis Pharmaceuticals, Inc.. Invention is credited to Thazha P. Prakash, Punit P. Seth, Eric E. Swayze.
Application Number | 20220275365 16/790557 |
Document ID | / |
Family ID | 1000006534395 |
Filed Date | 2022-09-01 |
United States Patent
Application |
20220275365 |
Kind Code |
A9 |
Prakash; Thazha P. ; et
al. |
September 1, 2022 |
COMPOSITIONS AND METHODS FOR MODULATING TTR EXPRESSION
Abstract
Provided herein are oligomeric compounds with conjugate groups.
In certain embodiments, the oligomeric compounds are conjugated to
N-Acetylgalactosamine.
Inventors: |
Prakash; Thazha P.;
(Carlsbad, CA) ; Seth; Punit P.; (Carlsbad,
CA) ; Swayze; Eric E.; (Encinitas, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20210024923 A1 |
January 28, 2021 |
|
|
Family ID: |
1000006534395 |
Appl. No.: |
16/790557 |
Filed: |
February 13, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15687306 |
Aug 25, 2017 |
10683499 |
|
|
16790557 |
|
|
|
|
14822493 |
Aug 10, 2015 |
9932580 |
|
|
15687306 |
|
|
|
|
14633491 |
Feb 27, 2015 |
9145558 |
|
|
14822493 |
|
|
|
|
PCT/US2014/036463 |
May 1, 2014 |
|
|
|
14633491 |
|
|
|
|
61986867 |
Apr 30, 2014 |
|
|
|
61976991 |
Apr 8, 2014 |
|
|
|
61880790 |
Sep 20, 2013 |
|
|
|
61871673 |
Aug 29, 2013 |
|
|
|
61843887 |
Jul 8, 2013 |
|
|
|
61823826 |
May 15, 2013 |
|
|
|
61818442 |
May 1, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/31 20130101;
C12N 2310/113 20130101; C12N 2320/32 20130101; C12N 2310/353
20130101; C12N 2310/17 20130101; C12N 15/113 20130101; C12N
2310/3513 20130101; C12N 2310/3341 20130101; C12N 15/111 20130101;
C12N 2310/321 20130101; C12N 2310/315 20130101; C12N 2310/3525
20130101; C07H 21/04 20130101; C12N 2310/341 20130101; C12N
2310/322 20130101; A61K 47/549 20170801; C12N 2310/346 20130101;
C12N 2310/3511 20130101; C12N 2310/3231 20130101; C12N 2310/351
20130101; C12N 2310/11 20130101; A61K 31/713 20130101; A61K 31/7088
20130101; C12N 2310/3515 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C07H 21/04 20060101 C07H021/04; A61K 47/54 20060101
A61K047/54; C12N 15/11 20060101 C12N015/11; A61K 31/7088 20060101
A61K031/7088; A61K 31/713 20060101 A61K031/713 |
Claims
1-33. (canceled)
34. A method of treating transthyretin amyloidosis in a subject
comprising administering a modified oligonucleotide, wherein the
anion form of the modified oligonucleotide has the following
chemical structure: ##STR00266## wherein the modified
oligonucleotide is a salt, wherein the cation of the salt is
sodium, and wherein the transthyretin amyloidosis is senile
systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP),
or familial amyloid cardiopathy (FAC).
35-39. (canceled)
40. The method of claim 34, wherein the transthyretin amyloidosis
is senile systemic amyloidosis (SSA).
41. The method of claim 34, wherein the transthyretin amyloidosis
is familial amyloid polyneuropathy (FAP).
42. The method of claim 34, wherein the transthyretin amyloidosis
is familial amyloid cardiopathy (FAC).
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0248USC5SEQ_ST25.txt, created on Feb. 13, 2020,
which is 20 Kb in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] The principle behind antisense technology is that an
antisense compound hybridizes to a target nucleic acid and
modulates the amount, activity, and/or function of the target
nucleic acid. For example in certain instances, antisense compounds
result in altered transcription or translation of a target. Such
modulation of expression can be achieved by, for example, target
mRNA degradation or occupancy-based inhibition. An example of
modulation of RNA target function by degradation is RNase H-based
degradation of the target RNA upon hybridization with a DNA-like
antisense compound. Another example of modulation of gene
expression by target degradation is RNA interference (RNAi). RNAi
refers to antisense-mediated gene silencing through a mechanism
that utilizes the RNA-induced siliencing complex (RISC). An
additional example of modulation of RNA target function is by an
occupancy-based mechanism such as is employed naturally by
microRNA. MicroRNAs are small non-coding RNAs that regulate the
expression of protein-coding RNAs. The binding of an antisense
compound to a microRNA prevents that microRNA from binding to its
messenger RNA targets, and thus interferes with the function of the
microRNA. MicroRNA mimics can enhance native microRNA function.
Certain antisense compounds alter splicing of pre-mRNA. Regardless
of the specific mechanism, sequence-specificity makes antisense
compounds attractive as tools for target validation and gene
functionalization, as well as therapeutics to selectively modulate
the expression of genes involved in the pathogenesis of
diseases.
[0003] Antisense technology is an effective means for modulating
the expression of one or more specific gene products and can
therefore prove to be uniquely useful in a number of therapeutic,
diagnostic, and research applications. Chemically modified
nucleosides may be incorporated into antisense compounds to enhance
one or more properties, such as nuclease resistance,
pharmacokinetics or affinity for a target nucleic acid. In 1998,
the antisense compound, Vitravene.RTM. (fomivirsen; developed by
Isis Pharmaceuticals Inc., Carlsbad, Calif.) was the first
antisense drug to achieve marketing clearance from the U.S. Food
and Drug Administration (FDA), and is currently a treatment of
cytomegalovirus (CMV)-induced retinitis in AIDS patients.
[0004] New chemical modifications have improved the potency and
efficacy of antisense compounds, uncovering the potential for oral
delivery as well as enhancing subcutaneous administration,
decreasing potential for side effects, and leading to improvements
in patient convenience. Chemical modifications increasing potency
of antisense compounds allow administration of lower doses, which
reduces the potential for toxicity, as well as decreasing overall
cost of therapy. Modifications increasing the resistance to
degradation result in slower clearance from the body, allowing for
less frequent dosing. Different types of chemical modifications can
be combined in one compound to further optimize the compound's
efficacy.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, the present disclosure provides
conjugated antisense compounds. In certain embodiments, the present
disclosure provides conjugated antisense compounds comprising an
antisense oligonucleotide complementary to a nucleic acid
transcript. In certain embodiments, the present disclosure provides
methods comprising contacting a cell with a conjugated antisense
compound comprising an antisense oligonucleotide complementary to a
nucleic acid transcript. In certain embodiments, the present
disclosure provides methods comprising contacting a cell with a
conjugated antisense compound comprising an antisense
oligonucleotide and reducing the amount or activity of a nucleic
acid transcript in a cell.
[0006] The asialoglycoprotein receptor (ASGP-R) has been described
previously. See e.g., Park et al., PNAS vol. 102, No. 47, pp
17125-17129 (2005). Such receptors are expressed on liver cells,
particularly hepatocytes. Further, it has been shown that compounds
comprising clusters of three N-acetylgalactosamine (GalNAc) ligands
are capable of binding to the ASGP-R, resulting in uptake of the
compound into the cell. See e.g., Khorev et al., Bioorganic and
Medicinal Chemistry, 16, 9, pp 5216-5231 (May 2008). Accordingly,
conjugates comprising such GalNAc clusters have been used to
facilitate uptake of certain compounds into liver cells,
specifically hepatocytes. For example it has been shown that
certain GalNAc-containing conjugates increase activity of duplex
siRNA compounds in liver cells in vivo. In such instances, the
GalNAc-containing conjugate is typically attached to the sense
strand of the siRNA duplex. Since the sense strand is discarded
before the antisense strand ultimately hybridizes with the target
nucleic acid, there is little concern that the conjugate will
interfere with activity. Typically, the conjugate is attached to
the 3' end of the sense strand of the siRNA. See e.g., U.S. Pat.
No. 8,106,022. Certain conjugate groups described herein are more
active and/or easier to synthesize than conjugate groups previously
described.
[0007] In certain embodiments of the present invention, conjugates
are attached to single-stranded antisense compounds, including, but
not limited to RNase H based antisense compounds and antisense
compounds that alter splicing of a pre-mRNA target nucleic acid. In
such embodiments, the conjugate should remain attached to the
antisense compound long enough to provide benefit (improved uptake
into cells) but then should either be cleaved, or otherwise not
interfere with the subsequent steps necessary for activity, such as
hybridization to a target nucleic acid and interaction with RNase H
or enzymes associated with splicing or splice modulation. This
balance of properties is more important in the setting of
single-stranded antisense compounds than in siRNA compounds, where
the conjugate may simply be attached to the sense strand. Disclosed
herein are conjugated single-stranded antisense compounds having
improved potency in liver cells in vivo compared with the same
antisense compound lacking the conjugate. Given the required
balance of properties for these compounds such improved potency is
surprising.
[0008] In certain embodiments, conjugate groups herein comprise a
cleavable moiety. As noted, without wishing to be bound by
mechanism, it is logical that the conjugate should remain on the
compound long enough to provide enhancement in uptake, but after
that, it is desirable for some portion or, ideally, all of the
conjugate to be cleaved, releasing the parent compound (e.g.,
antisense compound) in its most active form. In certain
embodiments, the cleavable moiety is a cleavable nucleoside. Such
embodiments take advantage of endogenous nucleases in the cell by
attaching the rest of the conjugate (the cluster) to the antisense
oligonucleotide through a nucleoside via one or more cleavable
bonds, such as those of a phosphodiester linkage. In certain
embodiments, the cluster is bound to the cleavable nucleoside
through a phosphodiester linkage. In certain embodiments, the
cleavable nucleoside is attached to the antisense oligonucleotide
(antisense compound) by a phosphodiester linkage. In certain
embodiments, the conjugate group may comprise two or three
cleavable nucleosides. In such embodiments, such cleavable
nucleosides are linked to one another, to the antisense compound
and/or to the cluster via cleavable bonds (such as those of a
phosphodiester linkage). Certain conjugates herein do not comprise
a cleavable nucleoside and instead comprise a cleavable bond. It is
shown that that sufficient cleavage of the conjugate from the
oligonucleotide is provided by at least one bond that is vulnerable
to cleavage in the cell (a cleavable bond).
[0009] In certain embodiments, conjugated antisense compounds are
prodrugs. Such prodrugs are administered to an animal and are
ultimately metabolized to a more active form. For example,
conjugated antisense compounds are cleaved to remove all or part of
the conjugate resulting in the active (or more active) form of the
antisense compound lacking all or some of the conjugate.
[0010] In certain embodiments, conjugates are attached at the 5'
end of an oligonucleotide. Certain such 5'-conjugates are cleaved
more efficiently than counterparts having a similar conjugate group
attached at the 3' end. In certain embodiments, improved activity
may correlate with improved cleavage. In certain embodiments,
oligonucleotides comprising a conjugate at the 5' end have greater
efficacy than oligonucleotides comprising a conjugate at the 3' end
(see, for example, Examples 56, 81, 83, and 84). Further,
5'-attachment allows simpler oligonucleotide synthesis. Typically,
oligonucleotides are synthesized on a solid support in the 3' to 5'
direction. To make a 3'-conjugated oligonucleotide, typically one
attaches a pre-conjugated 3' nucleoside to the solid support and
then builds the oligonucleotide as usual. However, attaching that
conjugated nucleoside to the solid support adds complication to the
synthesis. Further, using that approach, the conjugate is then
present throughout the synthesis of the oligonucleotide and can
become degraded during subsequent steps or may limit the sorts of
reactions and reagents that can be used. Using the structures and
techniques described herein for 5'-conjugated oligonucleotides, one
can synthesize the oligonucleotide using standard automated
techniques and introduce the conjugate with the final (5'-most)
nucleoside or after the oligonucleotide has been cleaved from the
solid support.
[0011] In view of the art and the present disclosure, one of
ordinary skill can easily make any of the conjugates and conjugated
oligonucleotides herein. Moreover, synthesis of certain such
conjugates and conjugated oligonucleotides disclosed herein is
easier and/or requires few steps, and is therefore less expensive
than that of conjugates previously disclosed, providing advantages
in manufacturing. For example, the synthesis of certain conjugate
groups consists of fewer synthetic steps, resulting in increased
yield, relative to conjugate groups previously described. Conjugate
groups such as GalNAc3-10 in Example 46 and GalNAc3-7 in Example 48
are much simpler than previously described conjugates such as those
described in U.S. Pat. No. 8,106,022 or 7,262,177 that require
assembly of more chemical intermediates. Accordingly, these and
other conjugates described herein have advantages over previously
described compounds for use with any oligonucleotide, including
single-stranded oligonucleotides and either strand of
double-stranded oligonucleotides (e.g., siRNA).
[0012] Similarly, disclosed herein are conjugate groups having only
one or two GalNAc ligands. As shown, such conjugates groups improve
activity of antisense compounds. Such compounds are much easier to
prepare than conjugates comprising three GalNAc ligands. Conjugate
groups comprising one or two GalNAc ligands may be attached to any
antisense compounds, including single-stranded oligonucleotides and
either strand of double-stranded oligonucleotides (e.g.,
siRNA).
[0013] In certain embodiments, the conjugates herein do not
substantially alter certain measures of tolerability. For example,
it is shown herein that conjugated antisense compounds are not more
immunogenic than unconjugated parent compounds. Since potency is
improved, embodiments in which tolerability remains the same (or
indeed even if tolerability worsens only slightly compared to the
gains in potency) have improved properties for therapy.
[0014] In certain embodiments, conjugation allows one to alter
antisense compounds in ways that have less attractive consequences
in the absence of conjugation. For example, in certain embodiments,
replacing one or more phosphorothioate linkages of a fully
phosphorothioate antisense compound with phosphodiester linkages
results in improvement in some measures of tolerability. For
example, in certain instances, such antisense compounds having one
or more phosphodiester are less immunogenic than the same compound
in which each linkage is a phosphorothioate. However, in certain
instances, as shown in Example 26, that same replacement of one or
more phosphorothioate linkages with phosphodiester linkages also
results in reduced cellular uptake and/or loss in potency. In
certain embodiments, conjugated antisense compounds described
herein tolerate such change in linkages with little or no loss in
uptake and potency when compared to the conjugated
full-phosphorothioate counterpart. In fact, in certain embodiments,
for example, in Examples 44, 57, 59, and 86, oligonucleotides
comprising a conjugate and at least one phosphodiester
internucleoside linkage actually exhibit increased potency in vivo
even relative to a full phosphorothioate counterpart also
comprising the same conjugate. Moreover, since conjugation results
in substantial increases in uptake/potency a small loss in that
substantial gain may be acceptable to achieve improved
tolerability. Accordingly, in certain embodiments, conjugated
antisense compounds comprise at least one phosphodiester
linkage.
[0015] In certain embodiments, conjugation of antisense compounds
herein results in increased delivery, uptake and activity in
hepatocytes. Thus, more compound is delivered to liver tissue.
However, in certain embodiments, that increased delivery alone does
not explain the entire increase in activity. In certain such
embodiments, more compound enters hepatocytes. In certain
embodiments, even that increased hepatocyte uptake does not explain
the entire increase in activity. In such embodiments, productive
uptake of the conjugated compound is increased. For example, as
shown in Example 102, certain embodiments of GalNAc-containing
conjugates increase enrichment of antisense oligonucleotides in
hepatocytes versus non-parenchymal cells. This enrichment is
beneficial for oligonucleotides that target genes that are
expressed in hepatocytes.
[0016] In certain embodiments, conjugated antisense compounds
herein result in reduced kidney exposure. For example, as shown in
Example 20, the concentrations of antisense oligonucleotides
comprising certain embodiments of GalNAc-containing conjugates are
lower in the kidney than that of antisense oligonucleotides lacking
a GalNAc-containing conjugate. This has several beneficial
therapeutic implications. For therapeutic indications where
activity in the kidney is not sought, exposure to kidney risks
kidney toxicity without corresponding benefit. Moreover, high
concentration in kidney typically results in loss of compound to
the urine resulting in faster clearance. Accordingly for non-kidney
targets, kidney accumulation is undesired.
[0017] In certain embodiments, the present disclosure provides
conjugated antisense compounds represented by the formula:
##STR00001##
[0018] wherein
[0019] A is the antisense oligonucleotide;
[0020] B is the cleavable moiety
[0021] C is the conjugate linker
[0022] D is the branching group
[0023] each E is a tether;
[0024] each F is a ligand; and
[0025] q is an integer between 1 and 5.
[0026] In the above diagram and in similar diagrams herein, the
branching group "D" branches as many times as is necessary to
accommodate the number of (E-F) groups as indicated by "q". Thus,
where q=1, the formula is:
A-B-C-D-E-F
[0027] where q=2, the formula is:
##STR00002##
[0028] where q=3, the formula is:
##STR00003##
[0029] where q=4, the formula is:
##STR00004##
[0030] where q=5, the formula is:
##STR00005##
[0031] In certain embodiments, conjugated antisense compounds are
provided having the structure:
##STR00006##
[0032] In certain embodiments, conjugated antisense compounds are
provided having the structure:
##STR00007##
[0033] In certain embodiments, conjugated antisense compounds are
provided having the structure:
##STR00008##
[0034] In certain embodiments, conjugated antisense compounds are
provided having the structure:
##STR00009##
[0035] In embodiments having more than one of a particular variable
(e.g., more than one "m" or "n"), unless otherwise indicated, each
such particular variable is selected independently. Thus, for a
structure having more than one n, each n is selected independently,
so they may or may not be the same as one another.
DETAILED DESCRIPTION
[0036] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the disclosure.
Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0037] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
A. Definitions
[0038] Unless specific definitions are provided, the nomenclature
used in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa.,
21.sup.st edition, 2005; and "Antisense Drug Technology,
Principles, Strategies, and Applications"
[0039] Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.;
and Sambrook et al., "Molecular Cloning, A laboratory Manual,"
2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which
are hereby incorporated by reference for any purpose. Where
permitted, all patents, applications, published applications and
other publications and other data referred to throughout in the
disclosure are incorporated by reference herein in their
entirety.
[0040] Unless otherwise indicated, the following terms have the
following meanings:
[0041] As used herein, "nucleoside" means a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA) and modified nucleosides. Nucleosides may be linked to a
phosphate moiety.
[0042] As used herein, "chemical modification" means a chemical
difference in a compound when compared to a naturally occurring
counterpart. Chemical modifications of oligonucleotides include
nucleoside modifications (including sugar moiety modifications and
nucleobase modifications) and internucleoside linkage
modifications. In reference to an oligonucleotide, chemical
modification does not include differences only in nucleobase
sequence.
[0043] As used herein, "furanosyl" means a structure comprising a
5-membered ring comprising four carbon atoms and one oxygen
atom.
[0044] As used herein, "naturally occurring sugar moiety" means a
ribofuranosyl as found in naturally occurring RNA or a
deoxyribofuranosyl as found in naturally occurring DNA.
[0045] As used herein, "sugar moiety" means a naturally occurring
sugar moiety or a modified sugar moiety of a nucleoside.
[0046] As used herein, "modified sugar moiety" means a substituted
sugar moiety or a sugar surrogate.
[0047] As used herein, "substituted sugar moiety" means a furanosyl
that is not a naturally occurring sugar moiety. Substituted sugar
moieties include, but are not limited to furanosyls comprising
substituents at the 2'-position, the 3'-position, the 5'-position
and/or the 4'-position. Certain substituted sugar moieties are
bicyclic sugar moieties.
[0048] As used herein, "2'-substituted sugar moiety" means a
furanosyl comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is
not a bicyclic sugar moiety (i.e., the 2'-substituent of a
2'-substituted sugar moiety does not form a bridge to another atom
of the furanosyl ring.
[0049] As used herein, "MOE" means
--OCH.sub.2CH.sub.2OCH.sub.3.
[0050] As used herein, "2'-F nucleoside" refers to a nucleoside
comprising a sugar comprising fluorine at the 2' position. Unless
otherwise indicated, the fluorine in a 2'-F nucleoside is in the
ribo position (replacing the OH of a natural ribose).
[0051] As used herein the term "sugar surrogate" means a structure
that does not comprise a furanosyl and that is capable of replacing
the naturally occurring sugar moiety of a nucleoside, such that the
resulting nucleoside sub-units are capable of linking together
and/or linking to other nucleosides to form an oligomeric compound
which is capable of hybridizing to a complementary oligomeric
compound. Such structures include rings comprising a different
number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings);
replacement of the oxygen of a furanosyl with a non-oxygen atom
(e.g., carbon, sulfur, or nitrogen); or both a change in the number
of atoms and a replacement of the oxygen. Such structures may also
comprise substitutions corresponding to those described for
substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic
sugar surrogates optionally comprising additional substituents).
Sugar surrogates also include more complex sugar replacements
(e.g., the non-ring systems of peptide nucleic acid). Sugar
surrogates include without limitation morpholinos, cyclohexenyls
and cyclohexitols.
[0052] As used herein, "bicyclic sugar moiety" means a modified
sugar moiety comprising a 4 to 7 membered ring (including but not
limited to a furanosyl) comprising a bridge connecting two atoms of
the 4 to 7 membered ring to form a second ring, resulting in a
bicyclic structure. In certain embodiments, the 4 to 7 membered
ring is a sugar ring. In certain embodiments the 4 to 7 membered
ring is a furanosyl. In certain such embodiments, the bridge
connects the 2'-carbon and the 4'-carbon of the furanosyl.
[0053] As used herein, "nucleotide" means a nucleoside further
comprising a phosphate linking group. As used herein, "linked
nucleosides" may or may not be linked by phosphate linkages and
thus includes, but is not limited to "linked nucleotides." As used
herein, "linked nucleosides" are nucleosides that are connected in
a continuous sequence (i.e. no additional nucleosides are present
between those that are linked).
[0054] As used herein, "nucleobase" means a group of atoms that can
be linked to a sugar moiety to create a nucleoside that is capable
of incorporation into an oligonucleotide, and wherein the group of
atoms is capable of bonding with a complementary naturally
occurring nucleobase of another oligonucleotide or nucleic acid.
Nucleobases may be naturally occurring or may be modified.
[0055] As used herein the terms, "unmodified nucleobase" or
"naturally occurring nucleobase" means the naturally occurring
heterocyclic nucleobases of RNA or DNA: the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) (including 5-methyl C), and uracil (U).
[0056] As used herein, "modified nucleobase" means any nucleobase
that is not a naturally occurring nucleobase.
[0057] As used herein, "modified nucleoside" means a nucleoside
comprising at least one chemical modification compared to naturally
occurring RNA or DNA nucleosides. Modified nucleosides comprise a
modified sugar moiety and/or a modified nucleobase.
[0058] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety.
[0059] As used herein, "constrained ethyl nucleoside" or "cEt"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--O-2'bridge.
[0060] As used herein, "locked nucleic acid nucleoside" or "LNA"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH.sub.2--O-2'bridge.
[0061] As used herein, "2'-substituted nucleoside" means a
nucleoside comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted nucleoside is
not a bicyclic nucleoside.
[0062] As used herein, "deoxynucleoside" means a nucleoside
comprising 2'-H furanosyl sugar moiety, as found in naturally
occurring deoxyribonucleosides (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (e.g., uracil).
[0063] As used herein, "oligonucleotide" means a compound
comprising a plurality of linked nucleosides. In certain
embodiments, an oligonucleotide comprises one or more unmodified
ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA)
and/or one or more modified nucleosides.
[0064] As used herein "oligonucleoside" means an oligonucleotide in
which none of the internucleoside linkages contains a phosphorus
atom. As used herein, oligonucleotides include
oligonucleosides.
[0065] As used herein, "modified oligonucleotide" means an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0066] As used herein, "linkage" or "linking group" means a group
of atoms that link together two or more other groups of atoms.
[0067] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides in an oligonucleotide.
[0068] As used herein "naturally occurring internucleoside linkage"
means a 3' to 5' phosphodiester linkage. As used herein, "modified
internucleoside linkage" means any internucleoside linkage other
than a naturally occurring internucleoside linkage.
[0069] As used herein, "terminal internucleoside linkage" means the
linkage between the last two nucleosides of an oligonucleotide or
defined region thereof.
[0070] As used herein, "phosphorus linking group" means a linking
group comprising a phosphorus atom. Phosphorus linking groups
include without limitation groups having the formula:
##STR00010##
wherein:
[0071] R.sub.a and R.sub.d are each, independently, O, S, CH.sub.2,
NH, or NJ.sub.1 wherein J.sub.1 is C.sub.1-C.sub.6 alkyl or
substituted C.sub.1-C.sub.6 alkyl;
[0072] R.sub.b is O or S;
[0073] R.sub.c is OH, SH, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, amino or substituted amino; and
[0074] J.sub.1 is R.sub.b is O or S.
[0075] Phosphorus linking groups include without limitation,
phosphodiester, phosphorothioate, phosphorodithioate, phosphonate,
phosphoramidate, phosphorothioamidate, thionoalkylphosphonate,
phosphotriesters, thionoalkylphosphotriester and
boranophosphate.
[0076] As used herein, "internucleoside phosphorus linking group"
means a phosphorus linking group that directly links two
nucleosides.
[0077] As used herein, "non-internucleoside phosphorus linking
group" means a phosphorus linking group that does not directly link
two nucleosides. In certain embodiments, a non-internucleoside
phosphorus linking group links a nucleoside to a group other than a
nucleoside. In certain embodiments, a non-internucleoside
phosphorus linking group links two groups, neither of which is a
nucleoside.
[0078] As used herein, "neutral linking group" means a linking
group that is not charged. Neutral linking groups include without
limitation phosphotriesters, methylphosphonates, MMI
(--CH.sub.2--N(CH.sub.3)--O--), amide-3
(--CH.sub.2--C(.dbd.O)--N(H)--), amide-4
(--CH.sub.2--N(H)--C(.dbd.O)--), formacetal (--O--CH.sub.2--O--),
and thioformacetal (--S--CH.sub.2--O--).
[0079] Further neutral linking groups include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook Eds. ACS Symposium Series 580; Chapters 3 and 4, (pp.
40-65)). Further neutral linking groups include nonionic linkages
comprising mixed N, O, S and CH.sub.2 component parts.
[0080] As used herein, "internucleoside neutral linking group"
means a neutral linking group that directly links two
nucleosides.
[0081] As used herein, "non-internucleoside neutral linking group"
means a neutral linking group that does not directly link two
nucleosides. In certain embodiments, a non-internucleoside neutral
linking group links a nucleoside to a group other than a
nucleoside. In certain embodiments, a non-internucleoside neutral
linking group links two groups, neither of which is a
nucleoside.
[0082] As used herein, "oligomeric compound" means a polymeric
structure comprising two or more sub-structures. In certain
embodiments, an oligomeric compound comprises an oligonucleotide.
In certain embodiments, an oligomeric compound comprises one or
more conjugate groups and/or terminal groups. In certain
embodiments, an oligomeric compound consists of an oligonucleotide.
Oligomeric compounds also include naturally occurring nucleic
acids. In certain embodiments, an oligomeric compound comprises a
backbone of one or more linked monomeric subunits where each linked
monomeric subunit is directly or indirectly attached to a
heterocyclic base moiety. In certain embodiments, oligomeric
compounds may also include monomeric subunits that are not linked
to a heterocyclic base moiety, thereby providing abasic sites. In
certain embodiments, the linkages joining the monomeric subunits,
the sugar moieties or surrogates and the heterocyclic base moieties
can be independently modified. In certain embodiments, the
linkage-sugar unit, which may or may not include a heterocyclic
base, may be substituted with a mimetic such as the monomers in
peptide nucleic acids.
[0083] As used herein, "terminal group" means one or more atom
attached to either, or both, the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more terminal group nucleosides.
[0084] As used herein, "conjugate" or "conjugate group" means an
atom or group of atoms bound to an oligonucleotide or oligomeric
compound. In general, conjugate groups modify one or more
properties of the compound to which they are attached, including,
but not limited to pharmacodynamic, pharmacokinetic, binding,
absorption, cellular distribution, cellular uptake, charge and/or
clearance properties.
[0085] As used herein, "conjugate linker" or "linker" in the
context of a conjugate group means a portion of a conjugate group
comprising any atom or group of atoms and which covalently link (1)
an oligonucleotide to another portion of the conjugate group or (2)
two or more portions of the conjugate group.
[0086] Conjugate groups are shown herein as radicals, providing a
bond for forming covalent attachment to an oligomeric compound such
as an antisense oligonucleotide. In certain embodiments, the point
of attachment on the oligomeric compound is the 3'-oxygen atom of
the 3'-hydroxyl group of the 3' terminal nucleoside of the
oligomeric compound. In certain embodiments the point of attachment
on the oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl
group of the 5' terminal nucleoside of the oligomeric compound. In
certain embodiments, the bond for forming attachment to the
oligomeric compound is a cleavable bond. In certain such
embodiments, such cleavable bond constitutes all or part of a
cleavable moiety.
[0087] In certain embodiments, conjugate groups comprise a
cleavable moiety (e.g., a cleavable bond or cleavable nucleoside)
and a carbohydrate cluster portion, such as a GalNAc cluster
portion. Such carbohydrate cluster portion comprises: a targeting
moiety and, optionally, a conjugate linker. In certain embodiments,
the carbohydrate cluster portion is identified by the number and
identity of the ligand. For example, in certain embodiments, the
carbohydrate cluster portion comprises 3 GalNAc groups and is
designated "GalNAc.sub.3". In certain embodiments, the carbohydrate
cluster portion comprises 4 GalNAc groups and is designated
"GalNAc.sub.4". Specific carbohydrate cluster portions (having
specific tether, branching and conjugate linker groups) are
described herein and designated by Roman numeral followed by
subscript "a". Accordingly "GalNac3-1.sub.a" refers to a specific
carbohydrate cluster portion of a conjugate group having 3 GalNac
groups and specifically identified tether, branching and linking
groups. Such carbohydrate cluster fragment is attached to an
oligomeric compound via a cleavable moiety, such as a cleavable
bond or cleavable nucleoside.
[0088] As used herein, "cleavable moiety" means a bond or group
that is capable of being split under physiological conditions. In
certain embodiments, a cleavable moiety is cleaved inside a cell or
sub-cellular compartments, such as a lysosome. In certain
embodiments, a cleavable moiety is cleaved by endogenous enzymes,
such as nucleases. In certain embodiments, a cleavable moiety
comprises a group of atoms having one, two, three, four, or more
than four cleavable bonds.
[0089] As used herein, "cleavable bond" means any chemical bond
capable of being split. In certain embodiments, a cleavable bond is
selected from among: an amide, a polyamide, an ester, an ether, one
or both esters of a phosphodiester, a phosphate ester, a carbamate,
a di-sulfide, or a peptide.
[0090] As used herein, "carbohydrate cluster" means a compound
having one or more carbohydrate residues attached to a scaffold or
linker group. (see, e.g., Maier et al., "Synthesis of Antisense
Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster
for Cellular Targeting," Bioconjugate Chemistry, 2003, (14): 18-29,
which is incorporated herein by reference in its entirety, or
Rensen et al., "Design and Synthesis of Novel
N-Acetylgalactosamine-Terminated Glycolipids for Targeting of
Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J Med.
Chem. 2004, (47): 5798-5808, for examples of carbohydrate conjugate
clusters).
[0091] As used herein, "carbohydrate derivative" means any compound
which may be synthesized using a carbohydrate as a starting
material or intermediate.
[0092] As used herein, "carbohydrate" means a naturally occurring
carbohydrate, a modified carbohydrate, or a carbohydrate
derivative.
[0093] As used herein "protecting group" means any compound or
protecting group known to those having skill in the art.
Non-limiting examples of protecting groups may be found in
"Protective Groups in Organic Chemistry", T. W. Greene, P. G. M.
Wuts, ISBN 0-471-62301-6, John Wiley & Sons, Inc, New York,
which is incorporated herein by reference in its entirety.
[0094] As used herein, "single-stranded" means an oligomeric
compound that is not hybridized to its complement and which lacks
sufficient self-complementarity to form a stable self-duplex.
[0095] As used herein, "double stranded" means a pair of oligomeric
compounds that are hybridized to one another or a single
self-complementary oligomeric compound that forms a hairpin
structure. In certain embodiments, a double-stranded oligomeric
compound comprises a first and a second oligomeric compound.
[0096] As used herein, "antisense compound" means a compound
comprising or consisting of an oligonucleotide at least a portion
of which is complementary to a target nucleic acid to which it is
capable of hybridizing, resulting in at least one antisense
activity.
[0097] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid. In certain
embodiments, antisense activity includes modulation of the amount
or activity of a target nucleic acid transcript (e.g. mRNA). In
certain embodiments, antisense activity includes modulation of the
splicing of pre-mRNA.
[0098] As used herein, "RNase H based antisense compound" means an
antisense compound wherein at least some of the antisense activity
of the antisense compound is attributable to hybridization of the
antisense compound to a target nucleic acid and subsequent cleavage
of the target nucleic acid by RNase H.
[0099] As used herein, "RISC based antisense compound" means an
antisense compound wherein at least some of the antisense activity
of the antisense compound is attributable to the RNA Induced
Silencing Complex (RISC).
[0100] As used herein, "detecting" or "measuring" means that a test
or assay for detecting or measuring is performed. Such detection
and/or measuring may result in a value of zero. Thus, if a test for
detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed.
[0101] As used herein, "detectable and/or measureable activity"
means a statistically significant activity that is not zero.
[0102] As used herein, "essentially unchanged" means little or no
change in a particular parameter, particularly relative to another
parameter which changes much more. In certain embodiments, a
parameter is essentially unchanged when it changes less than 5%. In
certain embodiments, a parameter is essentially unchanged if it
changes less than two-fold while another parameter changes at least
ten-fold. For example, in certain embodiments, an antisense
activity is a change in the amount of a target nucleic acid. In
certain such embodiments, the amount of a non-target nucleic acid
is essentially unchanged if it changes much less than the target
nucleic acid does, but the change need not be zero.
[0103] As used herein, "expression" means the process by which a
gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, post-transcriptional modification
(e.g., splicing, polyadenlyation, addition of 5'-cap), and
translation.
[0104] As used herein, "target nucleic acid" means a nucleic acid
molecule to which an antisense compound is intended to hybridize to
result in a desired antisense activity. Antisense oligonucleotides
have sufficient complementarity to their target nucleic acids to
allow hybridization under physiological conditions.
[0105] As used herein, "nucleobase complementarity" or
"complementarity" when in reference to nucleobases means a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase means a nucleobase of
an antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair. Nucleobases comprising
certain modifications may maintain the ability to pair with a
counterpart nucleobase and thus, are still capable of nucleobase
complementarity.
[0106] As used herein, "non-complementary" in reference to
nucleobases means a pair of nucleobases that do not form hydrogen
bonds with one another.
[0107] As used herein, "complementary" in reference to oligomeric
compounds (e.g., linked nucleosides, oligonucleotides, or nucleic
acids) means the capacity of such oligomeric compounds or regions
thereof to hybridize to another oligomeric compound or region
thereof through nucleobase complementarity.
[0108] Complementary oligomeric compounds need not have nucleobase
complementarity at each nucleoside. Rather, some mismatches are
tolerated. In certain embodiments, complementary oligomeric
compounds or regions are complementary at 70% of the nucleobases
(70% complementary). In certain embodiments, complementary
oligomeric compounds or regions are 80% complementary. In certain
embodiments, complementary oligomeric compounds or regions are 90%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 95% complementary. In certain embodiments,
complementary oligomeric compounds or regions are 100%
complementary.
[0109] As used herein, "mismatch" means a nucleobase of a first
oligomeric compound that is not capable of pairing with a
nucleobase at a corresponding position of a second oligomeric
compound, when the first and second oligomeric compound are
aligned. Either or both of the first and second oligomeric
compounds may be oligonucleotides.
[0110] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleobases.
[0111] As used herein, "specifically hybridizes" means the ability
of an oligomeric compound to hybridize to one nucleic acid site
with greater affinity than it hybridizes to another nucleic acid
site.
[0112] As used herein, "fully complementary" in reference to an
oligonucleotide or portion thereof means that each nucleobase of
the oligonucleotide or portion thereof is capable of pairing with a
nucleobase of a complementary nucleic acid or contiguous portion
thereof. Thus, a fully complementary region comprises no mismatches
or unhybridized nucleobases in either strand.
[0113] As used herein, "percent complementarity" means the
percentage of nucleobases of an oligomeric compound that are
complementary to an equal-length portion of a target nucleic acid.
Percent complementarity is calculated by dividing the number of
nucleobases of the oligomeric compound that are complementary to
nucleobases at corresponding positions in the target nucleic acid
by the total length of the oligomeric compound.
[0114] As used herein, "percent identity" means the number of
nucleobases in a first nucleic acid that are the same type
(independent of chemical modification) as nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid.
[0115] As used herein, "modulation" means a change of amount or
quality of a molecule, function, or activity when compared to the
amount or quality of a molecule, function, or activity prior to
modulation. For example, modulation includes the change, either an
increase (stimulation or induction) or a decrease (inhibition or
reduction) in gene expression. As a further example, modulation of
expression can include a change in splice site selection of
pre-mRNA processing, resulting in a change in the absolute or
relative amount of a particular splice-variant compared to the
amount in the absence of modulation.
[0116] As used herein, "chemical motif" means a pattern of chemical
modifications in an oligonucleotide or a region thereof. Motifs may
be defined by modifications at certain nucleosides and/or at
certain linking groups of an oligonucleotide.
[0117] As used herein, "nucleoside motif" means a pattern of
nucleoside modifications in an oligonucleotide or a region thereof.
The linkages of such an oligonucleotide may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only nucleosides are intended to be nucleoside motifs. Thus, in
such instances, the linkages are not limited.
[0118] As used herein, "sugar motif" means a pattern of sugar
modifications in an oligonucleotide or a region thereof.
[0119] As used herein, "linkage motif" means a pattern of linkage
modifications in an oligonucleotide or region thereof. The
nucleosides of such an oligonucleotide may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only linkages are intended to be linkage motifs. Thus, in such
instances, the nucleosides are not limited.
[0120] As used herein, "nucleobase modification motif" means a
pattern of modifications to nucleobases along an oligonucleotide.
Unless otherwise indicated, a nucleobase modification motif is
independent of the nucleobase sequence.
[0121] As used herein, "sequence motif" means a pattern of
nucleobases arranged along an oligonucleotide or portion thereof.
Unless otherwise indicated, a sequence motif is independent of
chemical modifications and thus may have any combination of
chemical modifications, including no chemical modifications.
[0122] As used herein, "type of modification" in reference to a
nucleoside or a nucleoside of a "type" means the chemical
modification of a nucleoside and includes modified and unmodified
nucleosides. Accordingly, unless otherwise indicated, a "nucleoside
having a modification of a first type" may be an unmodified
nucleoside.
[0123] As used herein, "differently modified" mean chemical
modifications or chemical substituents that are different from one
another, including absence of modifications. Thus, for example, a
MOE nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified. For example, a nucleoside comprising a 2'-OMe
modified sugar and an unmodified adenine nucleobase and a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
thymine nucleobase are not differently modified.
[0124] As used herein, "the same type of modifications" refers to
modifications that are the same as one another, including absence
of modifications. Thus, for example, two unmodified DNA nucleosides
have "the same type of modification," even though the DNA
nucleoside is unmodified. Such nucleosides having the same type
modification may comprise different nucleobases.
[0125] As used herein, "separate regions" means portions of an
oligonucleotide wherein the chemical modifications or the motif of
chemical modifications of any neighboring portions include at least
one difference to allow the separate regions to be distinguished
from one another.
[0126] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline.
[0127] As used herein the term "metabolic disorder" means a disease
or condition principally characterized by dysregulation of
metabolism--the complex set of chemical reactions associated with
breakdown of food to produce energy.
[0128] As used herein, the term "cardiovascular disorder" means a
disease or condition principally characterized by impaired function
of the heart or blood vessels.
[0129] As used herein the term "mono or polycyclic ring system" is
meant to include all ring systems selected from single or
polycyclic radical ring systems wherein the rings are fused or
linked and is meant to be inclusive of single and mixed ring
systems individually selected from aliphatic, alicyclic, aryl,
heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl,
heteroaromatic and heteroarylalkyl. Such mono and poly cyclic
structures can contain rings that each have the same level of
saturation or each, independently, have varying degrees of
saturation including fully saturated, partially saturated or fully
unsaturated. Each ring can comprise ring atoms selected from C, N,
O and S to give rise to heterocyclic rings as well as rings
comprising only C ring atoms which can be present in a mixed motif
such as for example benzimidazole wherein one ring has only carbon
ring atoms and the fused ring has two nitrogen atoms. The mono or
polycyclic ring system can be further substituted with substituent
groups such as for example phthalimide which has two .dbd.O groups
attached to one of the rings. Mono or polycyclic ring systems can
be attached to parent molecules using various strategies such as
directly through a ring atom, fused through multiple ring atoms,
through a substituent group or through a bifunctional linking
moiety.
[0130] As used herein, "prodrug" means an inactive or less active
form of a compound which, when administered to a subject, is
metabolized to form the active, or more active, compound (e.g.,
drug).
[0131] As used herein, "substituent" and "substituent group," means
an atom or group that replaces the atom or group of a named parent
compound. For example a substituent of a modified nucleoside is any
atom or group that differs from the atom or group found in a
naturally occurring nucleoside (e.g., a modified 2'-substituent is
any atom or group at the 2'-position of a nucleoside other than H
or OH). Substituent groups can be protected or unprotected. In
certain embodiments, compounds of the present disclosure have
substituents at one or at more than one position of the parent
compound. Substituents may also be further substituted with other
substituent groups and may be attached directly or via a linking
group such as an alkyl or hydrocarbyl group to a parent
compound.
[0132] Likewise, as used herein, "substituent" in reference to a
chemical functional group means an atom or group of atoms that
differs from the atom or a group of atoms normally present in the
named functional group. In certain embodiments, a substituent
replaces a hydrogen atom of the functional group (e.g., in certain
embodiments, the substituent of a substituted methyl group is an
atom or group other than hydrogen which replaces one of the
hydrogen atoms of an unsubstituted methyl group). Unless otherwise
indicated, groups amenable for use as substituents include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino (.dbd.NR.sub.bb), amido
(--C(O)N--(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa),
ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb
and R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0133] As used herein, "alkyl," as used herein, means a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred.
[0134] As used herein, "alkenyl," means a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include without limitation, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0135] As used herein, "alkynyl," means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl,
and the like. Alkynyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkynyl groups
as used herein may optionally include one or more further
substituent groups.
[0136] As used herein, "acyl," means a radical formed by removal of
a hydroxyl group from an organic acid and has the general Formula
--C(O)--X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic
sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used
herein may optionally include further substituent groups.
[0137] As used herein, "alicyclic" means a cyclic ring system
wherein the ring is aliphatic. The ring system can comprise one or
more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substituent groups.
[0138] As used herein, "aliphatic" means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms
wherein the saturation between any two carbon atoms is a single,
double or triple bond. An aliphatic group preferably contains from
1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms with from 1 to about 6 carbon atoms being more
preferred. The straight or branched chain of an aliphatic group may
be interrupted with one or more heteroatoms that include nitrogen,
oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by
heteroatoms include without limitation, polyalkoxys, such as
polyalkylene glycols, polyamines, and polyimines. Aliphatic groups
as used herein may optionally include further substituent
groups.
[0139] As used herein, "alkoxy" means a radical formed between an
alkyl group and an oxygen atom wherein the oxygen atom is used to
attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include without limitation, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0140] As used herein, "aminoalkyl" means an amino substituted
C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical
forms a covalent bond with a parent molecule. The amino group can
be located at any position and the aminoalkyl group can be
substituted with a further substituent group at the alkyl and/or
amino portions.
[0141] As used herein, "aralkyl" and "arylalkyl" mean an aromatic
group that is covalently linked to a C.sub.1-C.sub.12 alkyl
radical. The alkyl radical portion of the resulting aralkyl (or
arylalkyl) group forms a covalent bond with a parent molecule.
Examples include without limitation, benzyl, phenethyl and the
like. Aralkyl groups as used herein may optionally include further
substituent groups attached to the alkyl, the aryl or both groups
that form the radical group.
[0142] As used herein, "aryl" and "aromatic" mean a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include without limitation,
phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon
atoms in one or more rings. Aryl groups as used herein may
optionally include further substituent groups.
[0143] As used herein, "halo" and "halogen," mean an atom selected
from fluorine, chlorine, bromine and iodine.
[0144] As used herein, "heteroaryl," and "heteroaromatic," mean a
radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatoms. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include without limitation,
pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl,
thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl,
thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl,
benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can
be attached to a parent molecule directly or through a linking
moiety such as an aliphatic group or hetero atom. Heteroaryl groups
as used herein may optionally include further substituent
groups.
[0145] As used herein, "conjugate compound" means any atoms, group
of atoms, or group of linked atoms suitable for use as a conjugate
group. In certain embodiments, conjugate compounds may possess or
impart one or more properties, including, but not limited to
pharmacodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and/or clearance
properties.
[0146] As used herein, unless otherwise indicated or modified, the
term "double-stranded" refers to two separate oligomeric compounds
that are hybridized to one another. Such double stranded compounds
may have one or more or non-hybridizing nucleosides at one or both
ends of one or both strands (overhangs) and/or one or more internal
non-hybridizing nucleosides (mismatches) provided there is
sufficient complementarity to maintain hybridization under
physiologically relevant conditions.
B. Certain Compounds
[0147] In certain embodiments, the invention provides conjugated
antisense compounds comprising antisense oligonucleoitdes and a
conjugate.
[0148] a. Certain Antisense Oligonucleotides
[0149] In certain embodiments, the invention provides antisense
oligonucleotides. Such antisense oligonucleotides comprise linked
nucleosides, each nucleoside comprising a sugar moiety and a
nucleobase. The structure of such antisense oligonucleotides may be
considered in terms of chemical features (e.g., modifications and
patterns of modifications) and nucleobase sequence (e.g., sequence
of antisense oligonucleotide, identity and sequence of target
nucleic acid).
[0150] i. Certain Chemistry Features
[0151] In certain embodiments, antisense oligonucleotide comprise
one or more modification. In certain such embodiments, antisense
oligonucleotides comprise one or more modified nucleosides and/or
modified internucleoside linkages. In certain embodiments, modified
nucleosides comprise a modified sugar moiety and/or modified
nucleobase.
[0152] 1. Certain Sugar Moieties
[0153] In certain embodiments, compounds of the disclosure comprise
one or more modified nucleosides comprising a modified sugar
moiety. Such compounds comprising one or more sugar-modified
nucleosides may have desirable properties, such as enhanced
nuclease stability or increased binding affinity with a target
nucleic acid relative to an oligonucleotide comprising only
nucleosides comprising naturally occurring sugar moieties. In
certain embodiments, modified sugar moieties are substituted sugar
moieties. In certain embodiments, modified sugar moieties are sugar
surrogates. Such sugar surrogates may comprise one or more
substitutions corresponding to those of substituted sugar
moieties.
[0154] In certain embodiments, modified sugar moieties are
substituted sugar moieties comprising one or more non-bridging
sugar substituent, including but not limited to substituents at the
2' and/or 5' positions. Examples of sugar substituents suitable for
the 2'-position, include, but are not limited to: 2'-F,
2'-OCH.sub.3 ("OMe" or "O-methyl"), and
2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
sugar substituents at the 2' position is selected from allyl,
amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
O--C.sub.1-C.sub.10 substituted alkyl; OCF.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O--N(Rm)(Rn), and
O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C.sub.1-C.sub.10
alkyl. Examples of sugar substituents at the 5'-position, include,
but are not limited to: 5'-methyl (R or S); 5'-vinyl, and
5'-methoxy. In certain embodiments, substituted sugars comprise
more than one non-bridging sugar substituent, for example,
2'-F-5'-methyl sugar moieties (see, e.g., PCT International
Application WO 2008/101157, for additional 5', 2'-bis substituted
sugar moieties and nucleosides).
[0155] Nucleosides comprising 2'-substituted sugar moieties are
referred to as 2'-substituted nucleosides. In certain embodiments,
a 2'-substituted nucleoside comprises a 2'-substituent group
selected from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3,
OCF.sub.3, O, S, or N(R.sub.m)-alkyl; O, S, or N(R.sub.m)-alkenyl;
O, S or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl,
aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0156] In certain embodiments, a 2'-substituted nucleoside
comprises a 2'-substituent group selected from F, NH.sub.2,
N.sub.3, OCF.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH.sub.2--CH.dbd.CH.sub.2, O--CH.sub.2--CH.dbd.CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0157] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, OCF.sub.3, O--CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0158] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, O--CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0159] Certain modified sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' sugar substituents, include, but are not
limited to: --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'-CH.sub.2-2',
4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-(CH.sub.2)--O-2'
(LNA); 4'-(CH.sub.2)--S-2'; 4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-
CH(CH.sub.3)--O-2' (cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2', and
analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul.
15, 2008); 4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof,
(see, e.g., WO2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0160] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--;
[0161] wherein:
[0162] x is 0, 1, or 2;
[0163] n is 1, 2, 3, or 4;
[0164] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H),
substituted acyl, a heterocycle radical, a substituted heterocycle
radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl, or a protecting group.
[0165] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include,
but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA (also referred to as locked nucleic acid or
LNA), (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H)
methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl carbocyclic
(4'-CH.sub.2--CH(CH.sub.3)-2') BNA, and (J) propylene carbocyclic
(4'-(CH.sub.2).sub.3-2') BNA as depicted below.
##STR00011## ##STR00012##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0166] Additional bicyclic sugar moieties are known in the art, for
example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et
al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499,
7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO
1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Applications Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0167] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the .beta.-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') bicyclic nucleosides
have been incorporated into antisense oligonucleotides that showed
antisense activity (Frieden et al., Nucleic Acids Research, 2003,
21, 6365-6372).
[0168] In certain embodiments, substituted sugar moieties comprise
one or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).
(see, PCT International Application WO 2007/134181, published on
Nov. 22, 2007, wherein LNA is substituted with, for example, a
5'-methyl or a 5'-vinyl group).
[0169] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
naturally occurring sugar is substituted, e.g., with a sulfur,
carbon or nitrogen atom. In certain such embodiments, such modified
sugar moiety also comprises bridging and/or non-bridging
substituents as described above. For example, certain sugar
surrogates comprise a 4'-sulfur atom and a substitution at the
2'-position (see, e.g., published U.S. Patent Application
US2005/0130923, published on Jun. 16, 2005) and/or the 5' position.
By way of additional example, carbocyclic bicyclic nucleosides
having a 4'-2' bridge have been described (see, e.g., Freier et
al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et
al., J. Org. Chem., 2006, 71, 7731-7740).
[0170] In certain embodiments, sugar surrogates comprise rings
having other than 5-atoms. For example, in certain embodiments, a
sugar surrogate comprises a morphlino. Morpholino compounds and
their use in oligomeric compounds has been reported in numerous
patents and published articles (see for example: Braasch et al.,
Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685;
5,166,315; 5,185,444; and 5,034,506). As used here, the term
"morpholino" means a sugar surrogate having the following
structure:
##STR00013##
In certain embodiments, morpholinos may be modified, for example by
adding or altering various substituent groups from the above
morpholino structure. Such sugar surrogates are referred to herein
as "modified morpholinos."
[0171] For another example, in certain embodiments, a sugar
surrogate comprises a six-membered tetrahydropyran. Such
tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include, but
are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid
(ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. &
Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those
compounds having Formula VI:
##STR00014##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula VI:
[0172] Bx is a nucleobase moiety;
[0173] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5' or 3'-terminal group; q.sub.1,
q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each,
independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and R.sub.2 is
independently selected from among: hydrogen, halogen, substituted
or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or
NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently,
H or C.sub.1-C.sub.6 alkyl.
[0174] In certain embodiments, the modified THP nucleosides of
Formula VI are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at
least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6
and q.sub.7 is other than H. In certain embodiments, at least one
of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7
is methyl. In certain embodiments, THP nucleosides of Formula VI
are provided wherein one of R.sub.1 and R.sub.2 is F. In certain
embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy
and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is
H.
[0175] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see, e.g., review
article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002,
10, 841-854).
[0176] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 Published on Aug. 21, 2008
for other disclosed 5', 2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
In certain embodiments, the present disclosure provides
oligonucleotides comprising modified nucleosides. Those modified
nucleotides may include modified sugars, modified nucleobases,
and/or modified linkages. The specific modifications are selected
such that the resulting oligonucleotides possess desirable
characteristics. In certain embodiments, oligonucleotides comprise
one or more RNA-like nucleosides. In certain embodiments,
oligonucleotides comprise one or more DNA-like nucleotides.
[0177] 2. Certain Nucleobase Modifications
[0178] In certain embodiments, nucleosides of the present
disclosure comprise one or more unmodified nucleobases. In certain
embodiments, nucleosides of the present disclosure comprise one or
more modified nucleobases.
[0179] In certain embodiments, modified nucleobases are selected
from: universal bases, hydrophobic bases, promiscuous bases,
size-expanded bases, and fluorinated bases as defined herein.
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and
3-deazaadenine, universal bases, hydrophobic bases, promiscuous
bases, size-expanded bases, and fluorinated bases as defined
herein. Further modified nucleobases include tricyclic pyrimidines
such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0180] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include without limitation, U.S.
Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617;
5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and
6,005,096, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0181] 3. Certain Internucleoside Linkages
[0182] In certain embodiments, the present disclosure provides
oligonucleotides comprising linked nucleosides. In such
embodiments, nucleosides may be linked together using any
internucleoside linkage. The two main classes of internucleoside
linking groups are defined by the presence or absence of a
phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters (PO), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (PS). Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the oligonucleotide. In
certain embodiments, internucleoside linkages having a chiral atom
can be prepared as a racemic mixture, or as separate enantiomers.
Representative chiral linkages include, but are not limited to,
alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing
internucleoside linkages are well known to those skilled in the
art.
[0183] The oligonucleotides described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.alpha. or .beta. such as for sugar anomers, or as (D) or (L) such
as for amino acids etc. Included in the antisense compounds
provided herein are all such possible isomers, as well as their
racemic and optically pure forms.
[0184] Neutral internucleoside linkages include without limitation,
phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5').
Further neutral internucleoside linkages include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4,
40-65). Further neutral internucleoside linkages include nonionic
linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0185] 4. Certain Motifs
[0186] In certain embodiments, antisense oligonucleotides comprise
one or more modified nucleoside (e.g., nucleoside comprising a
modified sugar and/or modified nucleobase) and/or one or more
modified internucleoside linkage. The pattern of such modifications
on an oligonucleotide is referred to herein as a motif. In certain
embodiments, sugar, nucleobase, and linkage motifs are independent
of one another.
[0187] a. Certain Sugar Motifs
[0188] In certain embodiments, oligonucleotides comprise one or
more type of modified sugar moieties and/or naturally occurring
sugar moieties arranged along an oligonucleotide or region thereof
in a defined pattern or sugar modification motif. Such motifs may
include any of the sugar modifications discussed herein and/or
other known sugar modifications.
[0189] In certain embodiments, the oligonucleotides comprise or
consist of a region having a gapmer sugar motif, which comprises
two external regions or "wings" and a central or internal region or
"gap." The three regions of a gapmer sugar motif (the 5'-wing, the
gap, and the 3'-wing) form a contiguous sequence of nucleosides
wherein at least some of the sugar moieties of the nucleosides of
each of the wings differ from at least some of the sugar moieties
of the nucleosides of the gap. Specifically, at least the sugar
moieties of the nucleosides of each wing that are closest to the
gap (the 3'-most nucleoside of the 5'-wing and the 5'-most
nucleoside of the 3'-wing) differ from the sugar moiety of the
neighboring gap nucleosides, thus defining the boundary between the
wings and the gap. In certain embodiments, the sugar moieties
within the gap are the same as one another. In certain embodiments,
the gap includes one or more nucleoside having a sugar moiety that
differs from the sugar moiety of one or more other nucleosides of
the gap. In certain embodiments, the sugar motifs of the two wings
are the same as one another (symmetric sugar gapmer). In certain
embodiments, the sugar motifs of the 5'-wing differs from the sugar
motif of the 3'-wing (asymmetric sugar gapmer).
[0190] i. Certain 5'-Wings
[0191] In certain embodiments, the 5'-wing of a gapmer consists of
1 to 8 linked nucleosides. In certain embodiments, the 5'-wing of a
gapmer consists of 1 to 7 linked nucleosides. In certain
embodiments, the 5'-wing of a gapmer consists of 1 to 6 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 1 to 5 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 2 to 5 linked nucleosides. In
certain embodiments, the 5'-wing of a gapmer consists of 3 to 5
linked nucleosides.
[0192] In certain embodiments, the 5'-wing of a gapmer consists of
4 or 5 linked nucleosides. In certain embodiments, the 5'-wing of a
gapmer consists of 1 to 4 linked nucleosides. In certain
embodiments, the 5'-wing of a gapmer consists of 1 to 3 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 1 or 2 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 2 to 4 linked nucleosides. In
certain embodiments, the 5'-wing of a gapmer consists of 2 or 3
linked nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 3 or 4 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 1 nucleoside. In certain
embodiments, the 5'-wing of a gapmer consists of 2 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 3 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 4 linked nucleosides. In certain
embodiments, the 5'-wing of a gapmer consists of 5 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 6 linked nucleosides.
[0193] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside. In certain embodiments, the 5'-wing
of a gapmer comprises at least two bicyclic nucleosides. In certain
embodiments, the 5'-wing of a gapmer comprises at least three
bicyclic nucleosides. In certain embodiments, the 5'-wing of a
gapmer comprises at least four bicyclic nucleosides. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside. In certain embodiments, the 5'-wing
of a gapmer comprises at least one LNA nucleoside. In certain
embodiments, each nucleoside of the 5'-wing of a gapmer is a
bicyclic nucleoside. In certain embodiments, each nucleoside of the
5'-wing of a gapmer is a constrained ethyl nucleoside. In certain
embodiments, each nucleoside of the 5'-wing of a gapmer is a LNA
nucleoside.
[0194] In certain embodiments, the 5'-wing of a gapmer comprises at
least one non-bicyclic modified nucleoside. In certain embodiments,
the 5'-wing of a gapmer comprises at least one 2'-substituted
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one 2'-MOE nucleoside. In certain embodiments,
the 5'-wing of a gapmer comprises at least one 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the 5'-wing of a gapmer
is a non-bicyclic modified nucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-substituted
nucleoside. In certain embodiments, each nucleoside of the 5'-wing
of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-OMe nucleoside.
[0195] In certain embodiments, the 5'-wing of a gapmer comprises at
least one 2'-deoxynucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-deoxynucleoside. In a
certain embodiments, the 5'-wing of a gapmer comprises at least one
ribonucleoside. In certain embodiments, each nucleoside of the
5'-wing of a gapmer is a ribonucleoside. In certain embodiments,
one, more than one, or each of the nucleosides of the 5'-wing is an
RNA-like nucleoside.
[0196] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside and at least one non-bicyclic
modified nucleoside. In certain embodiments, the 5'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 5'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one
2'-deoxynucleoside.
[0197] In certain embodiments, the 5'-wing of a gapmer comprises at
least one constrained ethyl nucleoside and at least one
non-bicyclic modified nucleoside. In certain embodiments, the
5'-wing of a gapmer comprises at least one constrained ethyl
nucleoside and at least one 2'-substituted nucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In
certain embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In
certain embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one
2'-deoxynucleoside.
[0198] ii. Certain 3'-Wings
[0199] In certain embodiments, the 3'-wing of a gapmer consists of
1 to 8 linked nucleosides. In certain embodiments, the 3'-wing of a
gapmer consists of 1 to 7 linked nucleosides. In certain
embodiments, the 3'-wing of a gapmer consists of 1 to 6 linked
nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 1 to 5 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 2 to 5 linked nucleosides. In
certain embodiments, the 3'-wing of a gapmer consists of 3 to 5
linked nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 4 or 5 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 1 to 4 linked nucleosides. In
certain embodiments, the 3'-wing of a gapmer consists of 1 to 3
linked nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 1 or 2 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 2 to 4 linked nucleosides. In
certain embodiments, the 3'-wing of a gapmer consists of 2 or 3
linked nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 3 or 4 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 1 nucleoside. In certain
embodiments, the 3'-wing of a gapmer consists of 2 linked
nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 3 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 4 linked nucleosides. In certain
embodiments, the 3'-wing of a gapmer consists of 5 linked
nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 6 linked nucleosides.
[0200] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside. In certain embodiments, the 3'-wing
of a gapmer comprises at least one constrained ethyl nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
LNA nucleoside. In certain embodiments, each nucleoside of the
3'-wing of a gapmer is a bicyclic nucleoside. In certain
embodiments, each nucleoside of the 3'-wing of a gapmer is a
constrained ethyl nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a LNA nucleoside.
[0201] In certain embodiments, the 3'-wing of a gapmer comprises at
least one non-bicyclic modified nucleoside. In certain embodiments,
the 3'-wing of a gapmer comprises at least two non-bicyclic
modified nucleosides. In certain embodiments, the 3'-wing of a
gapmer comprises at least three non-bicyclic modified nucleosides.
In certain embodiments, the 3'-wing of a gapmer comprises at least
four non-bicyclic modified nucleosides. In certain embodiments, the
3'-wing of a gapmer comprises at least one 2'-substituted
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one 2'-MOE nucleoside. In certain embodiments,
the 3'-wing of a gapmer comprises at least one 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the 3'-wing of a gapmer
is a non-bicyclic modified nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-substituted
nucleoside. In certain embodiments, each nucleoside of the 3'-wing
of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-OMe nucleoside.
[0202] In certain embodiments, the 3'-wing of a gapmer comprises at
least one 2'-deoxynucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-deoxynucleoside. In a
certain embodiments, the 3'-wing of a gapmer comprises at least one
ribonucleoside. In certain embodiments, each nucleoside of the
3'-wing of a gapmer is a ribonucleoside. In certain embodiments,
one, more than one, or each of the nucleosides of the 5'-wing is an
RNA-like nucleoside.
[0203] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside and at least one non-bicyclic
modified nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one
2'-deoxynucleoside.
[0204] In certain embodiments, the 3'-wing of a gapmer comprises at
least one constrained ethyl nucleoside and at least one
non-bicyclic modified nucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside and at least one 2'-substituted nucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one
2'-deoxynucleoside.
[0205] In certain embodiments, the 3'-wing of a gapmer comprises at
least one LNA nucleoside and at least one non-bicyclic modified
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one LNA nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-deoxynucleoside.
[0206] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one LNA
nucleoside, at least one non-bicyclic modified nucleoside, and at
least one 2'-deoxynucleoside.
[0207] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one LNA
nucleoside, at least one 2'-substituted nucleoside, and at least
one 2'-deoxynucleoside.
[0208] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-MOE nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-MOE nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-MOE
nucleoside, and at least one 2'-deoxynucleoside.
[0209] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-OMe nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-OMe nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-OMe
nucleoside, and at least one 2'-deoxynucleoside.
[0210] iii. Certain Central Regions (Gaps)
[0211] In certain embodiments, the gap of a gapmer consists of 6 to
20 linked nucleosides. In certain embodiments, the gap of a gapmer
consists of 6 to 15 linked nucleosides. In certain embodiments, the
gap of a gapmer consists of 6 to 12 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 to 10 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 6 to 9 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 6 to 8 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 or 7 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 7 to 10 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 7 to 9 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 7 or 8 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 8 to 10 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 8 or 9 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 linked nucleosides.
In certain embodiments, the gap of a gapmer consists of 7 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 8 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 9 linked nucleosides. In certain embodiments,
the gap of a gapmer consists of 10 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 11 linked nucleosides.
In certain embodiments, the gap of a gapmer consists of 12 linked
nucleosides.
[0212] In certain embodiments, each nucleoside of the gap of a
gapmer is a 2'-deoxynucleoside. In certain embodiments, the gap
comprises one or more modified nucleosides. In certain embodiments,
each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside or
is a modified nucleoside that is "DNA-like." In such embodiments,
"DNA-like" means that the nucleoside has similar characteristics to
DNA, such that a duplex comprising the gapmer and an RNA molecule
is capable of activating RNase H. For example, under certain
conditions, 2'-(ara)-F have been shown to support RNase H
activation, and thus is DNA-like. In certain embodiments, one or
more nucleosides of the gap of a gapmer is not a 2'-deoxynucleoside
and is not DNA-like. In certain such embodiments, the gapmer
nonetheless supports RNase H activation (e.g., by virtue of the
number or placement of the non-DNA nucleosides).
[0213] In certain embodiments, gaps comprise a stretch of
unmodified 2'-deoxynucleoside interrupted by one or more modified
nucleosides, thus resulting in three sub-regions (two stretches of
one or more 2'-deoxynucleosides and a stretch of one or more
interrupting modified nucleosides). In certain embodiments, no
stretch of unmodified 2'-deoxynucleosides is longer than 5, 6, or 7
nucleosides. In certain embodiments, such short stretches is
achieved by using short gap regions. In certain embodiments, short
stretches are achieved by interrupting a longer gap region.
[0214] In certain embodiments, the gap comprises one or more
modified nucleosides. In certain embodiments, the gap comprises one
or more modified nucleosides selected from among cEt, FHNA, LNA,
and 2-thio-thymidine. In certain embodiments, the gap comprises one
modified nucleoside. In certain embodiments, the gap comprises a
5'-substituted sugar moiety selected from among 5'-Me, and
5'-(R)-Me. In certain embodiments, the gap comprises two modified
nucleosides. In certain embodiments, the gap comprises three
modified nucleosides. In certain embodiments, the gap comprises
four modified nucleosides. In certain embodiments, the gap
comprises two or more modified nucleosides and each modified
nucleoside is the same. In certain embodiments, the gap comprises
two or more modified nucleosides and each modified nucleoside is
different.
[0215] In certain embodiments, the gap comprises one or more
modified linkages. In certain embodiments, the gap comprises one or
more methyl phosphonate linkages. In certain embodiments the gap
comprises two or more modified linkages. In certain embodiments,
the gap comprises one or more modified linkages and one or more
modified nucleosides. In certain embodiments, the gap comprises one
modified linkage and one modified nucleoside. In certain
embodiments, the gap comprises two modified linkages and two or
more modified nucleosides.
[0216] b. Certain Internucleoside Linkage Motifs
[0217] In certain embodiments, oligonucleotides comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, oligonucleotides comprise a
region having an alternating internucleoside linkage motif. In
certain embodiments, oligonucleotides of the present disclosure
comprise a region of uniformly modified internucleoside linkages.
In certain such embodiments, the oligonucleotide comprises a region
that is uniformly linked by phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide is uniformly
linked by phosphorothioate internucleoside linkages. In certain
embodiments, each internucleoside linkage of the oligonucleotide is
selected from phosphodiester and phosphorothioate. In certain
embodiments, each internucleoside linkage of the oligonucleotide is
selected from phosphodiester and phosphorothioate and at least one
internucleoside linkage is phosphorothioate.
[0218] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 7
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 8 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 9 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 11 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 12 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 13 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least 14 phosphorothioate
internucleoside linkages.
[0219] In certain embodiments, the oligonucleotide comprises at
least one block of at least 6 consecutive phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 7
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 9 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least one block of at least 10 consecutive phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least block of at least one 12
consecutive phosphorothioate internucleoside linkages. In certain
such embodiments, at least one such block is located at the 3' end
of the oligonucleotide. In certain such embodiments, at least one
such block is located within 3 nucleosides of the 3' end of the
oligonucleotide. In certain embodiments, the oligonucleotide
comprises less than 15 phosphorothioate internucleoside linkages.
In certain embodiments, the oligonucleotide comprises less than 14
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises less than 13 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 12 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 11 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 9 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 8 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 7 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 6 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises less than 5 phosphorothioate
internucleoside linkages.
[0220] c. Certain Nucleobase Modification Motifs
[0221] In certain embodiments, oligonucleotides comprise chemical
modifications to nucleobases arranged along the oligonucleotide or
region thereof in a defined pattern or nucleobases modification
motif. In certain such embodiments, nucleobase modifications are
arranged in a gapped motif. In certain embodiments, nucleobase
modifications are arranged in an alternating motif. In certain
embodiments, each nucleobase is modified. In certain embodiments,
none of the nucleobases is chemically modified.
[0222] In certain embodiments, oligonucleotides comprise a block of
modified nucleobases. In certain such embodiments, the block is at
the 3'-end of the oligonucleotide. In certain embodiments the block
is within 3 nucleotides of the 3'-end of the oligonucleotide. In
certain such embodiments, the block is at the 5'-end of the
oligonucleotide. In certain embodiments the block is within 3
nucleotides of the 5'-end of the oligonucleotide.
[0223] In certain embodiments, nucleobase modifications are a
function of the natural base at a particular position of an
oligonucleotide. For example, in certain embodiments each purine or
each pyrimidine in an oligonucleotide is modified. In certain
embodiments, each adenine is modified. In certain embodiments, each
guanine is modified. In certain embodiments, each thymine is
modified. In certain embodiments, each cytosine is modified. In
certain embodiments, each uracil is modified.
[0224] In certain embodiments, some, all, or none of the cytosine
moieties in an oligonucleotide are 5-methyl cytosine moieties.
Herein, 5-methyl cytosine is not a "modified nucleobase."
Accordingly, unless otherwise indicated, unmodified nucleobases
include both cytosine residues having a 5-methyl and those lacking
a 5 methyl. In certain embodiments, the methylation state of all or
some cytosine nucleobases is specified.
[0225] In certain embodiments, chemical modifications to
nucleobases comprise attachment of certain conjugate groups to
nucleobases. In certain embodiments, each purine or each pyrimidine
in an oligonucleotide may be optionally modified to comprise a
conjugate group.
[0226] d. Certain Overall Lengths
[0227] In certain embodiments, the present disclosure provides
oligonucleotides of any of a variety of ranges of lengths. In
certain embodiments, oligonucleotides consist of X to Y linked
nucleosides, where X represents the fewest number of nucleosides in
the range and Y represents the largest number of nucleosides in the
range. In certain such embodiments, X and Y are each independently
selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that
X.ltoreq.Y. For example, in certain embodiments, the
oligonucleotide may consist of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8
to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to
20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27,
8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to
14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21,
9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to
29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10
to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22,
10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to
29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11
to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23,
11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to
30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12
to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25,
12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to
15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13
to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28,
13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to
19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14
to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17,
15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to
24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16
to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23,
16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to
30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17
to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30,
18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to
25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19
to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29,
19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to
24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21
to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28,
21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to
27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23
to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27,
24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to
29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27
to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked
nucleosides. In embodiments where the number of nucleosides of an
oligonucleotide of a compound is limited, whether to a range or to
a specific number, the compound may, nonetheless further comprise
additional other substituents. For example, an oligonucleotide
comprising 8-30 nucleosides excludes oligonucleotides having 31
nucleosides, but, unless otherwise indicated, such an
oligonucleotide may further comprise, for example one or more
conjugate groups, terminal groups, or other substituents.
[0228] Further, where an oligonucleotide is described by an overall
length range and by regions having specified lengths, and where the
sum of specified lengths of the regions is less than the upper
limit of the overall length range, the oligonucleotide may have
additional nucleosides, beyond those of the specified regions,
provided that the total number of nucleosides does not exceed the
upper limit of the overall length range.
[0229] 5. Certain Antisense Oligonucleotide Chemistry Motifs
[0230] In certain embodiments, the chemical structural features of
antisense oligonucleotides are characterized by their sugar motif,
internucleoside linkage motif, nucleobase modification motif and
overall length. In certain embodiments, such parameters are each
independent of one another. Thus, each internucleoside linkage of
an oligonucleotide having a gapmer sugar motif may be modified or
unmodified and may or may not follow the gapmer modification
pattern of the sugar modifications. Thus, the internucleoside
linkages within the wing regions of a sugar-gapmer may be the same
or different from one another and may be the same or different from
the internucleoside linkages of the gap region. Likewise, such
sugar-gapmer oligonucleotides may comprise one or more modified
nucleobase independent of the gapmer pattern of the sugar
modifications. One of skill in the art will appreciate that such
motifs may be combined to create a variety of oligonucleotides.
[0231] In certain embodiments, the selection of internucleoside
linkage and nucleoside modification are not independent of one
another.
[0232] i. Certain Sequences and Targets
[0233] In certain embodiments, the invention provides antisense
oligonucleotides having a sequence complementary to a target
nucleic acid. Such antisense compounds are capable of hybridizing
to a target nucleic acid, resulting in at least one antisense
activity. In certain embodiments, antisense compounds specifically
hybridize to one or more target nucleic acid. In certain
embodiments, a specifically hybridizing antisense compound has a
nucleobase sequence comprising a region having sufficient
complementarity to a target nucleic acid to allow hybridization and
result in antisense activity and insufficient complementarity to
any non-target so as to avoid or reduce non-specific hybridization
to non-target nucleic acid sequences under conditions in which
specific hybridization is desired (e.g., under physiological
conditions for in vivo or therapeutic uses, and under conditions in
which assays are performed in the case of in vitro assays). In
certain embodiments, oligonucleotides are selective between a
target and non-target, even though both target and non-target
comprise the target sequence. In such embodiments, selectivity may
result from relative accessibility of the target region of one
nucleic acid molecule compared to the other.
[0234] In certain embodiments, the present disclosure provides
antisense compounds comprising oligonucleotides that are fully
complementary to the target nucleic acid over the entire length of
the oligonucleotide. In certain embodiments, oligonucleotides are
99% complementary to the target nucleic acid. In certain
embodiments, oligonucleotides are 95% complementary to the target
nucleic acid. In certain embodiments, such oligonucleotides are 90%
complementary to the target nucleic acid.
[0235] In certain embodiments, such oligonucleotides are 85%
complementary to the target nucleic acid. In certain embodiments,
such oligonucleotides are 80% complementary to the target nucleic
acid. In certain embodiments, an antisense compound comprises a
region that is fully complementary to a target nucleic acid and is
at least 80% complementary to the target nucleic acid over the
entire length of the oligonucleotide. In certain such embodiments,
the region of full complementarity is from 6 to 14 nucleobases in
length.
[0236] In certain embodiments, oligonucleotides comprise a
hybridizing region and a terminal region. In certain such
embodiments, the hybridizing region consists of 12-30 linked
nucleosides and is fully complementary to the target nucleic acid.
In certain embodiments, the hybridizing region includes one
mismatch relative to the target nucleic acid. In certain
embodiments, the hybridizing region includes two mismatches
relative to the target nucleic acid. In certain embodiments, the
hybridizing region includes three mismatches relative to the target
nucleic acid. In certain embodiments, the terminal region consists
of 1-4 terminal nucleosides. In certain embodiments, the terminal
nucleosides are at the 3' end. In certain embodiments, one or more
of the terminal nucleosides are not complementary to the target
nucleic acid.
[0237] Antisense mechanisms include any mechanism involving the
hybridization of an oligonucleotide with target nucleic acid,
wherein the hybridization results in a biological effect. In
certain embodiments, such hybridization results in either target
nucleic acid degradation or occupancy with concomitant inhibition
or stimulation of the cellular machinery involving, for example,
translation, transcription, or splicing of the target nucleic
acid.
[0238] One type of antisense mechanism involving degradation of
target RNA is RNase H mediated antisense. RNase H is a cellular
endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It
is known in the art that single-stranded antisense compounds which
are "DNA-like" elicit RNase H activity in mammalian cells.
Activation of RNase H, therefore, results in cleavage of the RNA
target, thereby greatly enhancing the efficiency of DNA-like
oligonucleotide-mediated inhibition of gene expression.
[0239] In certain embodiments, a conjugate group comprises a
cleavable moiety. In certain embodiments, a conjugate group
comprises one or more cleavable bond. In certain embodiments, a
conjugate group comprises a linker. In certain embodiments, a
linker comprises a protein binding moiety. In certain embodiments,
a conjugate group comprises a cell-targeting moiety (also referred
to as a cell-targeting group). In certain embodiments a
cell-targeting moiety comprises a branching group. In certain
embodiments, a cell-targeting moiety comprises one or more tethers.
In certain embodiments, a cell-targeting moiety comprises a
carbohydrate or carbohydrate cluster.
[0240] ii. Certain Cleavable Moieties
[0241] In certain embodiments, a cleavable moiety is a cleavable
bond. In certain embodiments, a cleavable moiety comprises a
cleavable bond. In certain embodiments, the conjugate group
comprises a cleavable moiety. In certain such embodiments, the
cleavable moiety attaches to the antisense oligonucleotide. In
certain such embodiments, the cleavable moiety attaches directly to
the cell-targeting moiety. In certain such embodiments, the
cleavable moiety attaches to the conjugate linker. In certain
embodiments, the cleavable moiety comprises a phosphate or
phosphodiester. In certain embodiments, the cleavable moiety is a
cleavable nucleoside or nucleoside analog. In certain embodiments,
the nucleoside or nucleoside analog comprises an optionally
protected heterocyclic base selected from a purine, substituted
purine, pyrimidine or substituted pyrimidine. In certain
embodiments, the cleavable moiety is a nucleoside comprising an
optionally protected heterocyclic base selected from uracil,
thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine,
4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine
and 2-N-isobutyrylguanine. In certain embodiments, the cleavable
moiety is 2'-deoxy nucleoside that is attached to the 3' position
of the antisense oligonucleotide by a phosphodiester linkage and is
attached to the linker by a phosphodiester or phosphorothioate
linkage. In certain embodiments, the cleavable moiety is 2'-deoxy
adenosine that is attached to the 3' position of the antisense
oligonucleotide by a phosphodiester linkage and is attached to the
linker by a phosphodiester or phosphorothioate linkage. In certain
embodiments, the cleavable moiety is 2'-deoxy adenosine that is
attached to the 3' position of the antisense oligonucleotide by a
phosphodiester linkage and is attached to the linker by a
phosphodiester linkage.
[0242] In certain embodiments, the cleavable moiety is attached to
the 3' position of the antisense oligonucleotide. In certain
embodiments, the cleavable moiety is attached to the 5' position of
the antisense oligonucleotide. In certain embodiments, the
cleavable moiety is attached to a 2' position of the antisense
oligonucleotide. In certain embodiments, the cleavable moiety is
attached to the antisense oligonucleotide by a phosphodiester
linkage. In certain embodiments, the cleavable moiety is attached
to the linker by either a phosphodiester or a phosphorothioate
linkage. In certain embodiments, the cleavable moiety is attached
to the linker by a phosphodiester linkage. In certain embodiments,
the conjugate group does not include a cleavable moiety.
[0243] In certain embodiments, the cleavable moiety is cleaved
after the complex has been administered to an animal only after
being internalized by a targeted cell. Inside the cell the
cleavable moiety is cleaved thereby releasing the active antisense
oligonucleotide. While not wanting to be bound by theory it is
believed that the cleavable moiety is cleaved by one or more
nucleases within the cell. In certain embodiments, the one or more
nucleases cleave the phosphodiester linkage between the cleavable
moiety and the linker. In certain embodiments, the cleavable moiety
has a structure selected from among the following:
##STR00015##
wherein each of Bx, Bx.sub.1, Bx.sub.2, and Bx.sub.3 is
independently a heterocyclic base moiety. In certain embodiments,
the cleavable moiety has a structure selected from among the
following:
##STR00016##
[0244] iii. Certain Linkers
[0245] In certain embodiments, the conjugate groups comprise a
linker. In certain such embodiments, the linker is covalently bound
to the cleavable moiety. In certain such embodiments, the linker is
covalently bound to the antisense oligonucleotide. In certain
embodiments, the linker is covalently bound to a cell-targeting
moiety. In certain embodiments, the linker further comprises a
covalent attachment to a solid support. In certain embodiments, the
linker further comprises a covalent attachment to a protein binding
moiety. In certain embodiments, the linker further comprises a
covalent attachment to a solid support and further comprises a
covalent attachment to a protein binding moiety. In certain
embodiments, the linker includes multiple positions for attachment
of tethered ligands. In certain embodiments, the linker includes
multiple positions for attachment of tethered ligands and is not
attached to a branching group. In certain embodiments, the linker
further comprises one or more cleavable bond. In certain
embodiments, the conjugate group does not include a linker.
[0246] In certain embodiments, the linker includes at least a
linear group comprising groups selected from alkyl, amide,
disulfide, polyethylene glycol, ether, thioether (--S--) and
hydroxylamino (--O--N(H)--) groups. In certain embodiments, the
linear group comprises groups selected from alkyl, amide and ether
groups. In certain embodiments, the linear group comprises groups
selected from alkyl and ether groups. In certain embodiments, the
linear group comprises at least one phosphorus linking group. In
certain embodiments, the linear group comprises at least one
phosphodiester group. In certain embodiments, the linear group
includes at least one neutral linking group. In certain
embodiments, the linear group is covalently attached to the
cell-targeting moiety and the cleavable moiety. In certain
embodiments, the linear group is covalently attached to the
cell-targeting moiety and the antisense oligonucleotide. In certain
embodiments, the linear group is covalently attached to the
cell-targeting moiety, the cleavable moiety and a solid support. In
certain embodiments, the linear group is covalently attached to the
cell-targeting moiety, the cleavable moiety, a solid support and a
protein binding moiety. In certain embodiments, the linear group
includes one or more cleavable bond.
[0247] In certain embodiments, the linker includes the linear group
covalently attached to a scaffold group. In certain embodiments,
the scaffold includes a branched aliphatic group comprising groups
selected from alkyl, amide, disulfide, polyethylene glycol, ether,
thioether and hydroxylamino groups. In certain embodiments, the
scaffold includes a branched aliphatic group comprising groups
selected from alkyl, amide and ether groups. In certain
embodiments, the scaffold includes at least one mono or polycyclic
ring system.
[0248] In certain embodiments, the scaffold includes at least two
mono or polycyclic ring systems. In certain embodiments, the linear
group is covalently attached to the scaffold group and the scaffold
group is covalently attached to the cleavable moiety and the
linker. In certain embodiments, the linear group is covalently
attached to the scaffold group and the scaffold group is covalently
attached to the cleavable moiety, the linker and a solid support.
In certain embodiments, the linear group is covalently attached to
the scaffold group and the scaffold group is covalently attached to
the cleavable moiety, the linker and a protein binding moiety. In
certain embodiments, the linear group is covalently attached to the
scaffold group and the scaffold group is covalently attached to the
cleavable moiety, the linker, a protein binding moiety and a solid
support. In certain embodiments, the scaffold group includes one or
more cleavable bond.
[0249] In certain embodiments, the linker includes a protein
binding moiety. In certain embodiments, the protein binding moiety
is a lipid such as for example including but not limited to
cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric
acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol,
geranyloxyhexyl group, hexadecylglycerol, borneol, menthol,
1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,
O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine), a vitamin (e.g., folate, vitamin
A, vitamin E, biotin, pyridoxal), a peptide, a carbohydrate (e.g.,
monosaccharide, disaccharide, trisaccharide, tetrasaccharide,
oligosaccharide, polysaccharide), an endosomolytic component, a
steroid (e.g., uvaol, hecigenin, diosgenin), a terpene (e.g.,
triterpene, e.g., sarsasapogenin, friedelin, epifriedelanol
derivatized lithocholic acid), or a cationic lipid. In certain
embodiments, the protein binding moiety is a C16 to C22 long chain
saturated or unsaturated fatty acid, cholesterol, cholic acid,
vitamin E, adamantane or 1-pentafluoropropyl.
[0250] In certain embodiments, a linker has a structure selected
from among:
##STR00017## ##STR00018##
[0251] wherein each n is, independently, from 1 to 20; and p is
from 1 to 6.
[0252] In certain embodiments, a linker has a structure selected
from among:
##STR00019## ##STR00020##
[0253] wherein each n is, independently, from 1 to 20.
[0254] In certain embodiments, a linker has a structure selected
from among:
##STR00021## ##STR00022##
[0255] wherein n is from 1 to 20.
[0256] In certain embodiments, a linker has a structure selected
from among:
##STR00023## ##STR00024##
[0257] wherein each L is, independently, a phosphorus linking group
or a neutral linking group; and
[0258] each n is, independently, from 1 to 20.
In certain embodiments, a linker has a structure selected from
among:
##STR00025## ##STR00026## ##STR00027##
[0259] In certain embodiments, a linker has a structure selected
from among:
##STR00028## ##STR00029##
[0260] In certain embodiments, a linker has a structure selected
from among:
##STR00030## ##STR00031##
[0261] In certain embodiments, a linker has a structure selected
from among:
##STR00032##
[0262] wherein n is from 1 to 20.
[0263] In certain embodiments, a linker has a structure selected
from among:
##STR00033##
[0264] In certain embodiments, a linker has a structure selected
from among:
##STR00034##
[0265] In certain embodiments, a linker has a structure selected
from among:
##STR00035##
[0266] In certain embodiments, the conjugate linker has the
structure:
##STR00036##
[0267] In certain embodiments, the conjugate linker has the
structure:
##STR00037##
[0268] In certain embodiments, a linker has a structure selected
from among:
##STR00038##
[0269] In certain embodiments, a linker has a structure selected
from among:
##STR00039##
[0270] wherein each n is independently, 0, 1, 2, 3, 4, 5, 6, or
7.
[0271] iv. Certain Cell-Targeting Moieties
[0272] In certain embodiments, conjugate groups comprise
cell-targeting moieties. Certain such cell-targeting moieties
increase cellular uptake of antisense compounds. In certain
embodiments, cell-targeting moieties comprise a branching group,
one or more tether, and one or more ligand. In certain embodiments,
cell-targeting moieties comprise a branching group, one or more
tether, one or more ligand and one or more cleavable bond.
[0273] 1. Certain Branching Groups
[0274] In certain embodiments, the conjugate groups comprise a
targeting moiety comprising a branching group and at least two
tethered ligands. In certain embodiments, the branching group
attaches the conjugate linker. In certain embodiments, the
branching group attaches the cleavable moiety. In certain
embodiments, the branching group attaches the antisense
oligonucleotide. In certain embodiments, the branching group is
covalently attached to the linker and each of the tethered ligands.
In certain embodiments, the branching group comprises a branched
aliphatic group comprising groups selected from alkyl, amide,
disulfide, polyethylene glycol, ether, thioether and hydroxylamino
groups. In certain embodiments, the branching group comprises
groups selected from alkyl, amide and ether groups. In certain
embodiments, the branching group comprises groups selected from
alkyl and ether groups. In certain embodiments, the branching group
comprises a mono or polycyclic ring system. In certain embodiments,
the branching group comprises one or more cleavable bond. In
certain embodiments, the conjugate group does not include a
branching group.
[0275] In certain embodiments, a branching group has a structure
selected from among:
##STR00040## ##STR00041## ##STR00042##
[0276] wherein each n is, independently, from 1 to 20;
[0277] j is from 1 to 3; and
[0278] m is from 2 to 6.
[0279] In certain embodiments, a branching group has a structure
selected from among:
##STR00043## ##STR00044##
[0280] wherein each n is, independently, from 1 to 20; and
[0281] m is from 2 to 6.
[0282] In certain embodiments, a branching group has a structure
selected from among:
##STR00045## ##STR00046## ##STR00047##
[0283] In certain embodiments, a branching group has a structure
selected from among:
##STR00048## [0284] wherein each A.sub.1 is independently, O, S,
C.dbd.O or NH; and [0285] each n is, independently, from 1 to
20.
[0286] In certain embodiments, a branching group has a structure
selected from among:
##STR00049##
[0287] wherein each A.sub.1 is independently, O, S, C.dbd.O or NH;
and each n is, independently, from 1 to 20.
[0288] In certain embodiments, a branching group has a structure
selected from among:
##STR00050##
[0289] wherein A.sub.1 is O, S, C.dbd.O or NH; and
[0290] each n is, independently, from 1 to 20.
[0291] In certain embodiments, a branching group has a structure
selected from among:
##STR00051##
[0292] In certain embodiments, a branching group has a structure
selected from among:
##STR00052##
[0293] In certain embodiments, a branching group has a structure
selected from among:
##STR00053##
[0294] 2. Certain Tethers
[0295] In certain embodiments, conjugate groups comprise one or
more tethers covalently attached to the branching group. In certain
embodiments, conjugate groups comprise one or more tethers
covalently attached to the linking group. In certain embodiments,
each tether is a linear aliphatic group comprising one or more
groups selected from alkyl, ether, thioether, disulfide, amide and
polyethylene glycol groups in any combination. In certain
embodiments, each tether is a linear aliphatic group comprising one
or more groups selected from alkyl, substituted alkyl, ether,
thioether, disulfide, amide, phosphodiester and polyethylene glycol
groups in any combination. In certain embodiments, each tether is a
linear aliphatic group comprising one or more groups selected from
alkyl, ether and amide groups in any combination. In certain
embodiments, each tether is a linear aliphatic group comprising one
or more groups selected from alkyl, substituted alkyl,
phosphodiester, ether and amide groups in any combination. In
certain embodiments, each tether is a linear aliphatic group
comprising one or more groups selected from alkyl and
phosphodiester in any combination. In certain embodiments, each
tether comprises at least one phosphorus linking group or neutral
linking group.
[0296] In certain embodiments, the tether includes one or more
cleavable bond. In certain embodiments, the tether is attached to
the branching group through either an amide or an ether group. In
certain embodiments, the tether is attached to the branching group
through a phosphodiester group. In certain embodiments, the tether
is attached to the branching group through a phosphorus linking
group or neutral linking group. In certain embodiments, the tether
is attached to the branching group through an ether group. In
certain embodiments, the tether is attached to the ligand through
either an amide or an ether group. In certain embodiments, the
tether is attached to the ligand through an ether group. In certain
embodiments, the tether is attached to the ligand through either an
amide or an ether group. In certain embodiments, the tether is
attached to the ligand through an ether group.
[0297] In certain embodiments, each tether comprises from about 8
to about 20 atoms in chain length between the ligand and the
branching group. In certain embodiments, each tether group
comprises from about 10 to about 18 atoms in chain length between
the ligand and the branching group. In certain embodiments, each
tether group comprises about 13 atoms in chain length.
[0298] In certain embodiments, a tether has a structure selected
from among:
##STR00054##
[0299] wherein each n is, independently, from 1 to 20; and
[0300] each p is from 1 to about 6.
[0301] In certain embodiments, a tether has a structure selected
from among:
##STR00055##
[0302] In certain embodiments, a tether has a structure selected
from among:
##STR00056## [0303] wherein each n is, independently, from 1 to
20.
[0304] In certain embodiments, a tether has a structure selected
from among:
##STR00057## [0305] wherein L is either a phosphorus linking group
or a neutral linking group; [0306] Z.sub.1 is C(.dbd.O)O--R.sub.2;
[0307] Z.sub.2 is H, C.sub.1-C.sub.6 alkyl or substituted
C.sub.1-C.sub.6 alky; [0308] R.sub.2 is H, C.sub.1-C.sub.6 alkyl or
substituted C.sub.1-C.sub.6 alky; and [0309] each m.sub.1 is,
independently, from 0 to 20 wherein at least one m.sub.1 is greater
than 0 for each tether.
[0310] In certain embodiments, a tether has a structure selected
from among:
##STR00058##
[0311] In certain embodiments, a tether has a structure selected
from among:
##STR00059## [0312] wherein Z.sub.2 is H or CH.sub.3; and [0313]
each m.sub.1 is, independently, from 0 to 20 wherein at least one
m.sub.1 is greater than 0 for each tether.
[0314] In certain embodiments, a tether has a structure selected
from among:
##STR00060##
wherein each n is independently, 0, 1, 2, 3, 4, 5, 6, or 7.
[0315] In certain embodiments, a tether comprises a phosphorus
linking group. In certain embodiments, a tether does not comprise
any amide bonds. In certain embodiments, a tether comprises a
phosphorus linking group and does not comprise any amide bonds.
[0316] 3. Certain Ligands
[0317] In certain embodiments, the present disclosure provides
ligands wherein each ligand is covalently attached to a tether. In
certain embodiments, each ligand is selected to have an affinity
for at least one type of receptor on a target cell. In certain
embodiments, ligands are selected that have an affinity for at
least one type of receptor on the surface of a mammalian liver
cell. In certain embodiments, ligands are selected that have an
affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In
certain embodiments, each ligand is a carbohydrate. In certain
embodiments, each ligand is, independently selected from galactose,
N-acetyl galactoseamine, mannose, glucose, glucosamone and fucose.
In certain embodiments, each ligand is N-acetyl galactoseamine
(GalNAc). In certain embodiments, the targeting moiety comprises 2
to 6 ligands. In certain embodiments, the targeting moiety
comprises 3 ligands. In certain embodiments, the targeting moiety
comprises 3 N-acetyl galactoseamine ligands.
[0318] In certain embodiments, the ligand is a carbohydrate,
carbohydrate derivative, modified carbohydrate, multivalent
carbohydrate cluster, polysaccharide, modified polysaccharide, or
polysaccharide derivative. In certain embodiments, the ligand is an
amino sugar or a thio sugar. For example, amino sugars may be
selected from any number of compounds known in the art, for example
glucosamine, sialic acid, .alpha.-D-galactosamine,
N-Acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose
(GalNAc),
2-Amino-3-O--[(R)-1-carboxyethyl]-2-deoxy-.beta.-D-glucopyranose
(.beta.-muramic acid), 2-Deoxy-2-methylamino-L-glucopyranose,
4,6-Dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose,
2-Deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and
N-Glycoloyl-.alpha.-neuraminic acid. For example, thio sugars may
be selected from the group consisting of
5-Thio-.beta.-D-glucopyranose, Methyl
2,3,4-tri-O-acetyl-1-thio-6-O-trityl-.alpha.-D-glucopyranoside,
4-Thio-.beta.-D-galactopyranose, and ethyl
3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-.alpha.-D-gluco-heptopyranoside-
.
[0319] In certain embodiments, "GalNac" or "Gal-NAc" refers to
2-(Acetylamino)-2-deoxy-D-galactopyranose, commonly referred to in
the literature as N-acetyl galactosamine. In certain embodiments,
"N-acetyl galactosamine" refers to
2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments,
"GalNac" or "Gal-NAc" refers to
2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments,
"GalNac" or "Gal-NAc" refers to
2-(Acetylamino)-2-deoxy-D-galactopyranose, which includes both the
(.beta.-form: 2-(Acetylamino)-2-deoxy-.beta.-D-galactopyranose and
.alpha.-form: 2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain
embodiments, both the .beta.-form:
2-(Acetylamino)-2-deoxy-.beta.-D-galactopyranose and .alpha.-form:
2-(Acetylamino)-2-deoxy-D-galactopyranose may be used
interchangeably. Accordingly, in structures in which one form is
depicted, these structures are intended to include the other form
as well. For example, where the structure for an .alpha.-form:
2-(Acetylamino)-2-deoxy-D-galactopyranose is shown, this structure
is intended to include the other form as well. In certain
embodiments, In certain preferred embodiments, the .beta.-form
2-(Acetylamino)-2-deoxy-D-galactopyranose is the preferred
embodiment.
##STR00061##
[0320] In certain embodiments one or more ligand has a structure
selected from among:
##STR00062##
[0321] wherein each R.sub.1 is selected from OH and NHCOOH.
[0322] In certain embodiments one or more ligand has a structure
selected from among:
##STR00063##
[0323] In certain embodiments one or more ligand has a structure
selected from among:
##STR00064##
[0324] In certain embodiments one or more ligand has a structure
selected from among:
##STR00065##
[0325] i. Certain Conjugates
[0326] In certain embodiments, conjugate groups comprise the
structural features above. In certain such embodiments, conjugate
groups have the following structure:
##STR00066##
[0327] wherein each n is, independently, from 1 to 20.
[0328] In certain such embodiments, conjugate groups have the
following structure:
##STR00067##
[0329] In certain such embodiments, conjugate groups have the
following structure:
##STR00068##
[0330] wherein each n is, independently, from 1 to 20;
[0331] Z is H or a linked solid support;
[0332] Q is an antisense compound;
[0333] X is O or S; and
[0334] Bx is a heterocyclic base moiety.
[0335] In certain such embodiments, conjugate groups have the
following structure:
##STR00069##
[0336] In certain such embodiments, conjugate groups have the
following structure:
##STR00070##
[0337] In certain such embodiments, conjugate groups have the
following structure:
##STR00071##
[0338] In certain such embodiments, conjugate groups have the
following structure:
##STR00072##
[0339] In certain such embodiments, conjugate groups have the
following structure:
##STR00073##
[0340] In certain such embodiments, conjugate groups have the
following structure:
##STR00074##
[0341] In certain such embodiments, conjugate groups have the
following structure:
##STR00075##
[0342] In certain such embodiments, conjugate groups have the
following structure:
##STR00076##
[0343] In certain embodiments, conjugates do not comprise a
pyrrolidine.
[0344] In certain such embodiments, conjugate groups have the
following structure:
##STR00077##
[0345] In certain such embodiments, conjugate groups have the
following structure:
##STR00078##
[0346] In certain such embodiments, conjugate groups have the
following structure:
##STR00079##
[0347] In certain such embodiments, conjugate groups have the
following structure:
##STR00080##
[0348] In certain such embodiments, conjugate groups have the
following structure:
##STR00081##
[0349] In certain such embodiments, conjugate groups have the
following structure:
##STR00082##
[0350] In certain such embodiments, conjugate groups have the
following structure:
##STR00083##
[0351] In certain such embodiments, conjugate groups have the
following structure:
##STR00084##
[0352] In certain such embodiments, conjugate groups have the
following structure:
##STR00085##
[0353] In certain such embodiments, conjugate groups have the
following structure:
##STR00086##
[0354] In certain such embodiments, conjugate groups have the
following structure:
##STR00087##
In certain embodiments, the cell-targeting moiety of the conjugate
group has the following structure:
##STR00088##
wherein X is a substituted or unsubstituted tether of six to eleven
consecutively bonded atoms. In certain embodiments, the
cell-targeting moiety of the conjugate group has the following
structure:
##STR00089##
wherein X is a substituted or unsubstituted tether of ten
consecutively bonded atoms. In certain embodiments, the
cell-targeting moiety of the conjugate group has the following
structure:
##STR00090##
wherein X is a substituted or unsubstituted tether of four to
eleven consecutively bonded atoms and wherein the tether comprises
exactly one amide bond. In certain embodiments, the cell-targeting
moiety of the conjugate group has the following structure:
##STR00091##
wherein Y and Z are independently selected from a C.sub.1-C.sub.12
substituted or unsubstituted alkyl, alkenyl, or alkynyl group, or a
group comprising an ether, a ketone, an amide, an ester, a
carbamate, an amine, a piperidine, a phosphate, a phosphodiester, a
phosphorothioate, a triazole, a pyrrolidine, a disulfide, or a
thioether. In certain such embodiments, the cell-targeting moiety
of the conjugate group has the following structure:
##STR00092##
wherein Y and Z are independently selected from a C.sub.1-C.sub.12
substituted or unsubstituted alkyl group, or a group comprising
exactly one ether or exactly two ethers, an amide, an amine, a
piperidine, a phosphate, a phosphodiester, or a phosphorothioate.
In certain such embodiments, the cell-targeting moiety of the
conjugate group has the following structure:
##STR00093##
wherein Y and Z are independently selected from a C.sub.1-C.sub.12
substituted or unsubstituted alkyl group. In certain such
embodiments, the cell-targeting moiety of the conjugate group has
the following structure:
##STR00094##
wherein m and n are independently selected from 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, and 12. In certain such embodiments, the
cell-targeting moiety of the conjugate group has the following
structure:
##STR00095##
wherein m is 4, 5, 6, 7, or 8, and n is 1, 2, 3, or 4. In certain
embodiments, the cell-targeting moiety of the conjugate group has
the following structure:
##STR00096##
wherein X is a substituted or unsubstituted tether of four to
thirteen consecutively bonded atoms, and wherein X does not
comprise an ether group. In certain embodiments, the cell-targeting
moiety of the conjugate group has the following structure:
##STR00097##
wherein X is a substituted or unsubstituted tether of eight
consecutively bonded atoms, and wherein X does not comprise an
ether group. In certain embodiments, the cell-targeting moiety of
the conjugate group has the following structure:
##STR00098##
wherein X is a substituted or unsubstituted tether of four to
thirteen consecutively bonded atoms, and wherein the tether
comprises exactly one amide bond, and wherein X does not comprise
an ether group. In certain embodiments, the cell-targeting moiety
of the conjugate group has the following structure:
##STR00099##
wherein X is a substituted or unsubstituted tether of four to
thirteen consecutively bonded atoms and wherein the tether consists
of an amide bond and a substituted or unsubstituted
C.sub.2-C.sub.11 alkyl group. In certain embodiments, the
cell-targeting moiety of the conjugate group has the following
structure:
##STR00100##
wherein Y is selected from a C.sub.1-C.sub.12 substituted or
unsubstituted alkyl, alkenyl, or alkynyl group, or a group
comprising an ether, a ketone, an amide, an ester, a carbamate, an
amine, a piperidine, a phosphate, a phosphodiester, a
phosphorothioate, a triazole, a pyrrolidine, a disulfide, or a
thioether. In certain such embodiments, the cell-targeting moiety
of the conjugate group has the following structure:
##STR00101##
wherein Y is selected from a C.sub.1-C.sub.12 substituted or
unsubstituted alkyl group, or a group comprising an ether, an
amine, a piperidine, a phosphate, a phosphodiester, or a
phosphorothioate. In certain such embodiments, the cell-targeting
moiety of the conjugate group has the following structure:
##STR00102##
wherein Y is selected from a C.sub.1-C.sub.12 substituted or
unsubstituted alkyl group. In certain such embodiments, the
cell-targeting moiety of the conjugate group has the following
structure:
##STR00103##
Wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.
[0355] In certain such embodiments, the cell-targeting moiety of
the conjugate group has the following structure:
##STR00104##
wherein n is 4, 5, 6, 7, or 8.
[0356] b. Certain Conjugated Antisense Compounds
[0357] In certain embodiments, the conjugates are bound to a
nucleoside of the antisense oligonucleotide at the 2', 3', of 5'
position of the nucleoside. In certain embodiments, a conjugated
antisense compound has the following structure:
##STR00105##
[0358] wherein
[0359] A is the antisense oligonucleotide;
[0360] B is the cleavable moiety
[0361] C is the conjugate linker
[0362] D is the branching group
[0363] each E is a tether;
[0364] each F is a ligand; and
[0365] q is an integer between 1 and 5.
In certain embodiments, a conjugated antisense compound has the
following structure:
##STR00106##
[0366] wherein
[0367] A is the antisense oligonucleotide;
[0368] C is the conjugate linker
[0369] D is the branching group
[0370] each E is a tether;
[0371] each F is a ligand; and
[0372] q is an integer between 1 and 5.
[0373] In certain such embodiments, the conjugate linker comprises
at least one cleavable bond.
[0374] In certain such embodiments, the branching group comprises
at least one cleavable bond.
[0375] In certain embodiments each tether comprises at least one
cleavable bond.
In certain embodiments, the conjugates are bound to a nucleoside of
the antisense oligonucleotide at the 2', 3', of 5' position of the
nucleoside.
[0376] In certain embodiments, a conjugated antisense compound has
the following structure:
##STR00107##
[0377] wherein
[0378] A is the antisense oligonucleotide;
[0379] B is the cleavable moiety
[0380] C is the conjugate linker
[0381] each E is a tether;
[0382] each F is a ligand; and
[0383] q is an integer between 1 and 5.
In certain embodiments, the conjugates are bound to a nucleoside of
the antisense oligonucleotide at the 2', 3', of 5' position of the
nucleoside. In certain embodiments, a conjugated antisense compound
has the following structure:
##STR00108##
[0384] wherein
[0385] A is the antisense oligonucleotide;
[0386] C is the conjugate linker
[0387] each E is a tether;
[0388] each F is a ligand; and
[0389] q is an integer between 1 and 5.
In certain embodiments, a conjugated antisense compound has the
following structure:
##STR00109##
[0390] wherein
[0391] A is the antisense oligonucleotide;
[0392] B is the cleavable moiety
[0393] D is the branching group
[0394] each E is a tether;
[0395] each F is a ligand; and
[0396] q is an integer between 1 and 5.
In certain embodiments, a conjugated antisense compound has the
following structure:
##STR00110##
[0397] wherein
[0398] A is the antisense oligonucleotide;
[0399] D is the branching group
[0400] each E is a tether;
[0401] each F is a ligand; and
[0402] q is an integer between 1 and 5.
[0403] In certain such embodiments, the conjugate linker comprises
at least one cleavable bond.
[0404] In certain embodiments each tether comprises at least one
cleavable bond.
[0405] In certain embodiments, a conjugated antisense compound has
a structure selected from among the following:
##STR00111##
[0406] In certain embodiments, a conjugated antisense compound has
a structure selected from among the following:
##STR00112##
[0407] In certain embodiments, a conjugated antisense compound has
a structure selected from among the following:
##STR00113##
[0408] Representative United States patents, United States patent
application publications, and international patent application
publications that teach the preparation of certain of the above
noted conjugates, conjugated antisense compounds, tethers, linkers,
branching groups, ligands, cleavable moieties as well as other
modifications include without limitation, U.S. Pat. Nos. 5,994,517,
6,300,319, 6,660,720, 6,906,182, 7,262,177, 7,491,805, 8,106,022,
7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO
2012/037254, each of which is incorporated by reference herein in
its entirety.
[0409] Representative publications that teach the preparation of
certain of the above noted conjugates, conjugated antisense
compounds, tethers, linkers, branching groups, ligands, cleavable
moieties as well as other modifications include without limitation,
BIESSEN et al., "The Cholesterol Derivative of a Triantennary
Galactoside with High Affinity for the Hepatic Asialoglycoprotein
Receptor: a Potent Cholesterol Lowering Agent" J. Med. Chem. (1995)
38:1846-1852, BIESSEN et al., "Synthesis of Cluster Galactosides
with High Affinity for the Hepatic Asialoglycoprotein Receptor" J.
Med. Chem. (1995) 38:1538-1546, LEE et al., "New and more efficient
multivalent glyco-ligands for asialoglycoprotein receptor of
mammalian hepatocytes" Bioorganic & Medicinal Chemistry (2011)
19:2494-2500, RENSEN et al., "Determination of the Upper Size Limit
for Uptake and Processing of Ligands by the Asialoglycoprotein
Receptor on Hepatocytes in Vitro and in Vivo" J. Biol. Chem. (2001)
276(40):37577-37584, RENSEN et al., "Design and Synthesis of Novel
N-Acetylgalactosamine-Terminated Glycolipids for Targeting of
Lipoproteins to the Hepatic Asialoglycoprotein Receptor" J. Med.
Chem. (2004) 47:5798-5808, SLIEDREGT et al., "Design and Synthesis
of Novel Amphiphilic Dendritic Galactosides for Selective Targeting
of Liposomes to the Hepatic Asialoglycoprotein Receptor" J. Med.
Chem. (1999) 42:609-618, and Valentijn et al., "Solid-phase
synthesis of lysine-based cluster galactosides with high affinity
for the Asialoglycoprotein Receptor" Tetrahedron, 1997, 53(2),
759-770, each of which is incorporated by reference herein in its
entirety.
[0410] In certain embodiments, conjugated antisense compounds
comprise an RNase H based oligonucleotide (such as a gapmer) or a
splice modulating oligonucleotide (such as a fully modified
oligonucleotide) and any conjugate group comprising at least one,
two, or three GalNAc groups. In certain embodiments a conjugated
antisense compound comprises any conjugate group found in any of
the following references: Lee, Carbohydr Res, 1978, 67, 509-514;
Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int
J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984,
23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328;
Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et
al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al.,
Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997,
38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato
et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem,
2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362,
38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et
al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et
al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg
Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011,
19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46;
Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448;
Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al.,
J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47,
5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26,
169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato
et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org
Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14,
1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et
al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug
Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12,
5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12,
103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et
al., Bioorg Med Chem, 2013, 21, 5275-5281; International
applications WO1998/013381; WO2011/038356; WO1997/046098;
WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053;
WO2011/100131; WO2011/163121; WO2012/177947; WO2013/033230;
WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607;
WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563;
WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187;
WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352;
WO2012/089602; WO2013/166121; WO2013/165816; U.S. Pat. Nos.
4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319;
8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812;
6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772;
8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182;
6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent
Application Publications US2011/0097264; US2011/0097265;
US2013/0004427; US2005/0164235; US2006/0148740; US2008/0281044;
US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869;
[0411] US2011/0269814; US2009/0286973; US2011/0207799;
US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135;
US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760;
US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954;
US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829;
US2008/0108801; and US2009/0203132; each of which is incorporated
by reference in its entirety.
C. Certain Uses and Features
[0412] In certain embodiments, conjugated antisense compounds
exhibit potent target RNA reduction in vivo. In certain
embodiments, unconjugated antisense compounds accumulate in the
kidney. In certain embodiments, conjugated antisense compounds
accumulate in the liver. In certain embodiments, conjugated
antisense compounds are well tolerated. Such properties render
conjugated antisense compounds particularly useful for inhibition
of many target RNAs, including, but not limited to those involved
in metabolic, cardiovascular and other diseases, disorders or
conditions. Thus, provided herein are methods of treating such
diseases, disorders or conditions by contacting liver tissues with
the conjugated antisense compounds targeted to RNAs associated with
such diseases, disorders or conditions. Thus, also provided are
methods for ameliorating any of a variety of metabolic,
cardiovascular and other diseases, disorders or conditions with the
conjugated antisense compounds of the present invention.
[0413] In certain embodiments, conjugated antisense compounds are
more potent than unconjugated counterpart at a particular tissue
concentration. Without wishing to be bound by any theory or
mechanism, in certain embodiments, the conjugate may allow the
conjugated antisense compound to enter the cell more efficiently or
to enter the cell more productively. For example, in certain
embodiments conjugated antisense compounds may exhibit greater
target reduction as compared to its unconjugated counterpart
wherein both the conjugated antisense compound and its unconjugated
counterpart are present in the tissue at the same concentrations.
For example, in certain embodiments conjugated antisense compounds
may exhibit greater target reduction as compared to its
unconjugated counterpart wherein both the conjugated antisense
compound and its unconjugated counterpart are present in the liver
at the same concentrations.
[0414] Productive and non-productive uptake of oligonucleotides has
been discussed previously (See e.g. Geary, R. S., E. Wancewicz, et
al. (2009). "Effect of Dose and Plasma Concentration on Liver
Uptake and Pharmacologic Activity of a 2'-Methoxyethyl Modified
Chimeric Antisense Oligonucleotide Targeting PTEN." Biochem.
Pharmacol. 78(3): 284-91; & Koller, E., T. M. Vincent, et al.
(2011). "Mechanisms of single-stranded phosphorothioate modified
antisense oligonucleotide accumulation in hepatocytes." Nucleic
Acids Res. 39(11): 4795-807). Conjugate groups described herein may
improve productive uptake.
[0415] In certain embodiments, the conjugate groups described
herein may further improve potency by increasing the affinity of
the conjugated antisense compound for a particular type of cell or
tissue. In certain embodiments, the conjugate groups described
herein may further improve potency by increasing recognition of the
conjugated antisense compound by one or more cell-surface
receptors. In certain embodiments, the conjugate groups described
herein may further improve potency by facilitating endocytosis of
the conjugated antisense compound.
[0416] In certain embodiments, the cleavable moiety may further
improve potency by allowing the conjugate to be cleaved from the
antisense oligonucleotide after the conjugated antisense compound
has entered the cell. Accordingly, in certain embodiments,
conjugated antisense compounds can be administered at doses lower
than would be necessary for unconjugated antisense
oligonucleotides.
[0417] Phosphorothioate linkages have been incorporated into
antisense oligonucleotides previously. Such phosphorothioate
linkages are resistant to nucleases and so improve stability of the
oligonucleotide. Further, phosphorothioate linkages also bind
certain proteins, which results in accumulation of antisense
oligonucleotide in the liver. Oligonucleotides with fewer
phosphorothioate linkages accumulate less in the liver and more in
the kidney (see, for example, Geary, R., "Pharmacokinetic
Properties of 2'-O-(2-Methoxyethyl)-Modified Oligonucleotide
Analogs in Rats," Journal of Pharmacology and Experimental
Therapeutics, Vol. 296, No. 3, 890-897; & Pharmacological
Properties of 2'-O-Methoxyethyl Modified Oligonucleotides in
Antisense a Drug Technology, Chapter 10, Crooke, S. T., ed., 2008)
In certain embodiments, oligonucleotides with fewer
phosphorothioate internculeoside linkages and more phosphodiester
internucleoside linkages accumulate less in the liver and more in
the kidney. When treating diseases in the liver, this is
undesirable for several reasons (1) less drug is getting to the
site of desired action (liver); (2) drug is escaping into the
urine; and (3) the kidney is exposed to relatively high
concentration of drug which can result in toxicities in the kidney.
Thus, for liver diseases, phosphorothioate linkages provide
important benefits.
[0418] In certain embodiments, however, administration of
oligonucleotides uniformly linked by phosphoro-thioate
internucleoside linkages induces one or more proinflammatory
reactions. (see for example: J Lab Clin Med. 1996 September;
128(3):329-38. "Amplification of antibody production by
phosphorothioate oligodeoxynucleotides". Branda et al.; and see
also for example: Toxicologic Properties in Antisense a Drug
Technology, Chapter 12, pages 342-351, Crooke, S. T., ed., 2008).
In certain embodiments, administration of oligonucleotides wherein
most of the internucleoside linkages comprise phosphorothioate
internucleoside linkages induces one or more proinflammatory
reactions.
[0419] In certain embodiments, the degree of proinflammatory effect
may depend on several variables (e.g. backbone modification,
off-target effects, nucleobase modifications, and/or nucleoside
modifications) see for example: Toxicologic Properties in Antisense
a Drug Technology, Chapter 12, pages 342-351, Crooke, S. T., ed.,
2008). In certain embodiments, the degree of proinflammatory effect
may be mitigated by adjusting one or more variables. For example
the degree of proinflammatory effect of a given oligonucleotide may
be mitigated by replacing any number of phosphorothioate
internucleoside linkages with phosphodiester internucleoside
linkages and thereby reducing the total number of phosphorothioate
internucleoside linkages.
[0420] In certain embodiments, it would be desirable to reduce the
number of phosphorothioate linkages, if doing so could be done
without losing stability and without shifting the distribution from
liver to kidney. For example, in certain embodiments, the number of
phosphorothioate linkages may be reduced by replacing
phosphorothioate linkages with phosphodiester linkages. In such an
embodiment, the antisense compound having fewer phosphorothioate
linkages and more phosphodiester linkages may induce less
proinflammatory reactions or no proinflammatory reaction. Although
the the antisense compound having fewer phosphoro-thioate linkages
and more phosphodiester linkages may induce fewer proinflammatory
reactions, the antisense compound having fewer phosphorothioate
linkages and more phosphodiester linkages may not accumulate in the
liver and may be less efficacious at the same or similar dose as
compared to an antisense compound having more phosphorothioate
linkages. In certain embodiments, it is therefore desirable to
design an antisense compound that has a plurality of phosphodiester
bonds and a plurality of phosphorothioate bonds but which also
possesses stability and good distribution to the liver.
[0421] In certain embodiments, conjugated antisense compounds
accumulate more in the liver and less in the kidney than
unconjugated counterparts, even when some of the phosporothioate
linkages are replaced with less proinflammatory phosphodiester
internucleoside linkages. In certain embodiments, conjugated
antisense compounds accumulate more in the liver and are not
excreted as much in the urine compared to its unconjugated
counterparts, even when some of the phosporothioate linkages are
replaced with less proinflammatory phosphodiester internucleoside
linkages. In certain embodiments, the use of a conjugate allows one
to design more potent and better tolerated antisense drugs. Indeed,
in certain embodiments, conjugated antisense compounds have larger
therapeutic indexes than unconjugated counterparts. This allows the
conjugated antisense compound to be administered at a higher
absolute dose, because there is less risk of proinflammatory
response and less risk of kidney toxicity. This higher dose, allows
one to dose less frequently, since the clearance (metabolism) is
expected to be similar. Further, because the compound is more
potent, as described above, one can allow the concentration to go
lower before the next dose without losing therapeutic activity,
allowing for even longer periods between dosing.
[0422] In certain embodiments, the inclusion of some
phosphorothioate linkages remains desirable. For example, the
terminal linkages are vulnerable to exonucleoases and so in certain
embodiments, those linkages are phosphorothioate or other modified
linkage. Internucleoside linkages linking two deoxynucleosides are
vulnerable to endonucleases and so in certain embodiments those
those linkages are phosphorothioate or other modified linkage.
Internucleoside linkages between a modified nucleoside and a
deoxynucleoside where the deoxynucleoside is on the 5' side of the
linkage deoxynucleosides are vulnerable to endonucleases and so in
certain embodiments those those linkages are phosphorothioate or
other modified linkage. Internucleoside linkages between two
modified nucleosides of certain types and between a deoxynucleoside
and a modified nucleoside of certain type where the modified
nucleoside is at the 5' side of the linkage are sufficiently
resistant to nuclease digestion, that the linkage can be
phosphodiester.
[0423] In certain embodiments, the antisense oligonucleotide of a
conjugated antisense compound comprises fewer than 16
phosphorthioate linkages. In certain embodiments, the antisense
oligonucleotide of a conjugated antisense compound comprises fewer
than 15 phosphorthioate linkages. In certain embodiments, the
antisense oligonucleotide of a conjugated antisense compound
comprises fewer than 14 phosphorthioate linkages. In certain
embodiments, the antisense oligonucleotide of a conjugated
antisense compound comprises fewer than 13 phosphorthioate
linkages. In certain embodiments, the antisense oligonucleotide of
a conjugated antisense compound comprises fewer than 12
phosphorthioate linkages. In certain embodiments, the antisense
oligonucleotide of a conjugated antisense compound comprises fewer
than 11 phosphorthioate linkages. In certain embodiments, the
antisense oligonucleotide of a conjugated antisense compound
comprises fewer than 10 phosphorthioate linkages. In certain
embodiments, the antisense oligonucleotide of a conjugated
antisense compound comprises fewer than 9 phosphorthioate linkages.
In certain embodiments, the antisense oligonucleotide of a
conjugated antisense compound comprises fewer than 8
phosphorthioate linkages.
[0424] In certain embodiments, antisense compounds comprising one
or more conjugate group described herein has increased activity
and/or potency and/or tolerability compared to a parent antisense
compound lacking such one or more conjugate group. Accordingly, in
certain embodiments, attachment of such conjugate groups to an
oligonucleotide is desirable. Such conjugate groups may be attached
at the 5'-, and/or 3'-end of an oligonucleotide. In certain
instances, attachment at the 5'-end is synthetically desirable.
Typically, oligonucleotides are synthesized by attachment of the 3'
terminal nucleoside to a solid support and sequential coupling of
nucleosides from 3' to 5' using techniques that are well known in
the art. Accordingly if a conjugate group is desired at the
3'-terminus, one may (1) attach the conjugate group to the
3'-terminal nucleoside and attach that conjugated nucleoside to the
solid support for subsequent preparation of the oligonucleotide or
(2) attach the conjugate group to the 3'-terminal nucleoside of a
completed oligonucleotide after synthesis. Neither of these
approaches is very efficient and thus both are costly. In
particular, attachment of the conjugated nucleoside to the solid
support, while demonstrated in the Examples herein, is an
inefficient process. In certain embodiments, attaching a conjugate
group to the 5'-terminal nucleoside is synthetically easier than
attachment at the 3'-end. One may attach a non-conjugated 3'
terminal nucleoside to the solid support and prepare the
oligonucleotide using standard and well characterized reactions.
One then needs only to attach a 5'nucleoside having a conjugate
group at the final coupling step. In certain embodiments, this is
more efficient than attaching a conjugated nucleoside directly to
the solid support as is typically done to prepare a 3'-conjugated
oligonucleotide. The Examples herein demonstrate attachment at the
5'-end. In addition, certain conjugate groups have synthetic
advantages. For Example, certain conjugate groups comprising
phosphorus linkage groups are synthetically simpler and more
efficiently prepared than other conjugate groups, including
conjugate groups reported previously (e.g., WO/2012/037254).
[0425] In certain embodiments, conjugated antisense compounds are
administered to a subject. In such embodiments, antisense compounds
comprising one or more conjugate group described herein has
increased activity and/or potency and/or tolerability compared to a
parent antisense compound lacking such one or more conjugate group.
Without being bound by mechanism, it is believed that the conjugate
group helps with distribution, delivery, and/or uptake into a
target cell or tissue. In certain embodiments, once inside the
target cell or tissue, it is desirable that all or part of the
conjugate group to be cleaved to release the active
oligonucleoitdes. In certain embodiments, it is not necessary that
the entire conjugate group be cleaved from the oligonucleotide. For
example, in Example 20 a conjugated oligonucleotide was
administered to mice and a number of different chemical species,
each comprising a different portion of the conjugate group
remaining on the oligonucleotide, were detected (Table 10a). This
conjugated antisense compound demonstrated good potency (Table 10).
Thus, in certain embodiments, such metabolite profile of multiple
partial cleavage of the conjugate group does not interfere with
activity/potency. Nevertheless, in certain embodiments it is
desirable that a prodrug (conjugated oligonucleotide) yield a
single active compound. In certain instances, if multiple forms of
the active compound are found, it may be necessary to determine
relative amounts and activities for each one. In certain
embodiments where regulatory review is required (e.g., USFDA or
counterpart) it is desirable to have a single (or predominantly
single) active species. In certain such embodiments, it is
desirable that such single active species be the antisense
oligonucleotide lacking any portion of the conjugate group. In
certain embodiments, conjugate groups at the 5'-end are more likely
to result in complete metabolism of the conjugate group. Without
being bound by mechanism it may be that endogenous enzymes
responsible for metabolism at the 5' end (e.g., 5' nucleases) are
more active/efficient than the 3' counterparts.
[0426] In certain embodiments, the specific conjugate groups are
more amenable to metabolism to a single active species. In certain
embodiments, certain conjugate groups are more amenable to
metabolism to the oligonucleotide.
D. Antisense
[0427] In certain embodiments, oligomeric compounds of the present
invention are antisense compounds. In such embodiments, the
oligomeric compound is complementary to a target nucleic acid. In
certain embodiments, a target nucleic acid is an RNA. In certain
embodiments, a target nucleic acid is a non-coding RNA. In certain
embodiments, a target nucleic acid encodes a protein. In certain
embodiments, a target nucleic acid is selected from a mRNA, a
pre-mRNA, a microRNA, a non-coding RNA, including small non-coding
RNA, and a promoter-directed RNA. In certain embodiments,
oligomeric compounds are at least partially complementary to more
than one target nucleic acid. For example, oligomeric compounds of
the present invention may be microRNA mimics, which typically bind
to multiple targets.
[0428] In certain embodiments, antisense compounds comprise a
portion having a nucleobase sequence at least 70% complementary to
the nucleobase sequence of a target nucleic acid. In certain
embodiments, antisense compounds comprise a portion having a
nucleobase sequence at least 80% complementary to the nucleobase
sequence of a target nucleic acid. In certain embodiments,
antisense compounds comprise a portion having a nucleobase sequence
at least 90% complementary to the nucleobase sequence of a target
nucleic acid. In certain embodiments, antisense compounds comprise
a portion having a nucleobase sequence at least 95% complementary
to the nucleobase sequence of a target nucleic acid. In certain
embodiments, antisense compounds comprise a portion having a
nucleobase sequence at least 98% complementary to the nucleobase
sequence of a target nucleic acid. In certain embodiments,
antisense compounds comprise a portion having a nucleobase sequence
that is 100% complementary to the nucleobase sequence of a target
nucleic acid. In certain embodiments, antisense compounds are at
least 70%, 80%, 90%, 95%, 98%, or 100% complementary to the
nucleobase sequence of a target nucleic acid over the entire length
of the antisense compound.
[0429] Antisense mechanisms include any mechanism involving the
hybridization of an oligomeric compound with target nucleic acid,
wherein the hybridization results in a biological effect. In
certain embodiments, such hybridization results in either target
nucleic acid degradation or occupancy with concomitant inhibition
or stimulation of the cellular machinery involving, for example,
translation, transcription, or polyadenylation of the target
nucleic acid or of a nucleic acid with which the target nucleic
acid may otherwise interact.
[0430] One type of antisense mechanism involving degradation of
target RNA is RNase H mediated antisense. RNase H is a cellular
endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It
is known in the art that single-stranded antisense compounds which
are "DNA-like" elicit RNase H activity in mammalian cells.
Activation of RNase H, therefore, results in cleavage of the RNA
target, thereby greatly enhancing the efficiency of DNA-like
oligonucleotide-mediated inhibition of gene expression.
[0431] Antisense mechanisms also include, without limitation RNAi
mechanisms, which utilize the RISC pathway. Such RNAi mechanisms
include, without limitation siRNA, ssRNA and microRNA mechanisms.
Such mechanisms include creation of a microRNA mimic and/or an
anti-microRNA.
[0432] Antisense mechanisms also include, without limitation,
mechanisms that hybridize or mimic non-coding RNA other than
microRNA or mRNA. Such non-coding RNA includes, but is not limited
to promoter-directed RNA and short and long RNA that effects
transcription or translation of one or more nucleic acids.
[0433] In certain embodiments, oligonucleotides comprising
conjugates described herein are RNAi compounds. In certain
embodiments, oligomeric oligonucleotides comprising conjugates
described herein are ssRNA compounds. In certain embodiments,
oligonucleotides comprising conjugates described herein are paired
with a second oligomeric compound to form an siRNA. In certain such
embodiments, the second oligomeric compound also comprises a
conjugate. In certain embodiments, the second oligomeric compound
is any modified or unmodified nucleic acid. In certain embodiments,
the oligonucleotides comprising conjugates described herein is the
antisense strand in an siRNA compound. In certain embodiments, the
oligonucleotides comprising conjugates described herein is the
sense strand in an siRNA compound. In embodiments in which the
conjugated oligomeric compound is double-stranded siRnA, the
conjugate may be on the sense strand, the antisense strand or both
the sense strand and the antisense strand.
D. Target Nucleic Acids, Regions and Segments
[0434] In certain embodiments, conjugated antisense compounds
target any nucleic acid. In certain embodiments, the target nucleic
acid encodes a target protein that is clinically relevant. In such
embodiments, modulation of the target nucleic acid results in
clinical benefit. Certain target nucleic acids include, but are not
limited to, the target nucleic acids illustrated in Table 1.
TABLE-US-00001 TABLE 1 Certain Target Nucleic Acids GENBANK .RTM.
Target Species Accession Number SEQ ID NO HBV Human U95551.1 1
Transthyretin (TTR) Human NM_000371.3 2
[0435] The targeting process usually includes determination of at
least one target region, segment, or site within the target nucleic
acid for the antisense interaction to occur such that the desired
effect will result.
[0436] In certain embodiments, a target region is a structurally
defined region of the nucleic acid. For example, in certain such
embodiments, a target region may encompass a 3' UTR, a 5' UTR, an
exon, an intron, a coding region, a translation initiation region,
translation termination region, or other defined nucleic acid
region or target segment.
[0437] In certain embodiments, a target segment is at least about
an 8-nucleobase portion of a target region to which a conjugated
antisense compound is targeted. Target segments can include DNA or
RNA sequences that comprise at least 8 consecutive nucleobases from
the 5'-terminus of one of the target segments (the remaining
nucleobases being a consecutive stretch of the same DNA or RNA
beginning immediately upstream of the 5'-terminus of the target
segment and continuing until the DNA or RNA comprises about 8 to
about 30 nucleobases). Target segments are also represented by DNA
or RNA sequences that comprise at least 8 consecutive nucleobases
from the 3'-terminus of one of the target segments (the remaining
nucleobases being a consecutive stretch of the same DNA or RNA
beginning immediately downstream of the 3'-terminus of the target
segment and continuing until the DNA or RNA comprises about 8 to
about 30 nucleobases). Target segments can also be represented by
DNA or RNA sequences that comprise at least 8 consecutive
nucleobases from an internal portion of the sequence of a target
segment, and may extend in either or both directions until the
conjugated antisense compound comprises about 8 to about 30
nucleobases.
[0438] In certain embodiments, antisense compounds targeted to the
nucleic acids listed in Table 1 can be modified as described
herein. In certain embodiments, the antisense compounds can have a
modified sugar moiety, an unmodified sugar moiety or a mixture of
modified and unmodified sugar moieties as described herein. In
certain embodiments, the antisense compounds can have a modified
internucleoside linkage, an unmodified internucleoside linkage or a
mixture of modified and unmodified internucleoside linkages as
described herein. In certain embodiments, the antisense compounds
can have a modified nucleobase, an unmodified nucleobase or a
mixture of modified and unmodified nucleobases as described herein.
In certain embodiments, the antisense compounds can have a motif as
described herein.
[0439] In certain embodiments, antisense compounds targeted to the
nucleic acids listed in Table 1 can be conjugated as described
herein.
1. Hepatitis B (HBV)
[0440] Hepatitis B is a viral disease transmitted parenterally by
contaminated material such as blood and blood products,
contaminated needles, sexually and vertically from infected or
carrier mothers to their offspring. It is estimated by the World
Health Organization that more than 2 billion people have been
infected worldwide, with about 4 million acute cases per year, 1
million deaths per year, and 350-400 million chronic carriers
(World Health Organization: Geographic Prevalence of Hepatitis B
Prevalence, 2004.
http://www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm).
[0441] The virus, HBV, is a double-stranded hepatotropic virus
which infects only humans and non-human primates. Viral replication
takes place predominantly in the liver and, to a lesser extent, in
the kidneys, pancreas, bone marrow and spleen (Hepatitis B virus
biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and
immune markers are detectable in blood and characteristic
antigen-antibody patterns evolve over time. The first detectable
viral marker is HBsAg, followed by hepatitis B e antigen (HBeAg)
and HBV DNA. Titers may be high during the incubation period, but
HBV DNA and HBeAg levels begin to fall at the onset of illness and
may be undetectable at the time of peak clinical illness (Hepatitis
B virus infection--natural history and clinical consequences. N
Engl J Med. 350: 2004; 1118-1129). HBeAg is a viral marker
detectable in blood and correlates with active viral replication,
and therefore high viral load and infectivity (Hepatitis B e
antigen--the dangerous end game of hepatitis B. N Engl J Med. 347:
2002; 208-210). The presence of anti-HBsAb and anti-HBcAb (IgG)
indicates recovery and immunity in a previously infected
individual.
[0442] Currently the recommended therapies for chronic HBV
infection by the American Association for the Study of Liver
Diseases (AASLD) and the European Association for the Study of the
Liver (EASL) include interferon alpha (INF.alpha.), pegylated
interferon alpha-2a (Peg-IFN2a), entecavir, and tenofovir. The
nucleoside and nucleobase therapies, entecavir and tenofovir, are
successful at reducing viral load, but the rates of HBeAg
seroconversion and HBsAg loss are even lower than those obtained
using IFN.alpha. therapy. Other similar therapies, including
lamivudine (3TC), telbivudine (LdT), and adefovir are also used,
but for nucleoside/nucleobase therapies in general, the emergence
of resistance limits therapeutic efficacy.
[0443] Thus, there is a need in the art to discover and develop new
anti-viral therapies. Additionally, there is a need for new
anti-HBV therapies capable of increasing HBeAg and HBsAg
seroconversion rates. Recent clinical research has found a
correlation between seroconversion and reductions in HBeAg (Fried
et al (2008) Hepatology 47:428) and reductions in HBsAg (Moucari et
al (2009) Hepatology 49:1151). Reductions in antigen levels may
have allowed immunological control of HBV infection because high
levels of antigens are thought to induce immunological tolerance.
Current nucleoside therapies for HBV are capable of dramatic
reductions in serum levels of HBV but have little impact on HBeAg
and HBsAg levels.
[0444] Antisense compounds targeting HBV have been previously
disclosed in WO2011/047312, WO2012/145674, and WO2012/145697, each
herein incorporated by reference in its entirety. Clinical studies
are planned to assess the effect of antisense compounds targeting
HBV in patients. However, there is still a need to provide patients
with additional and more potent treatment options.
Certain Conjugated Antisense Compounds Targeted to a HBV Nucleic
Acid
[0445] In certain embodiments, conjugated antisense compounds are
targeted to a HBV nucleic acid having the sequence of GENBANK.RTM.
Accession No. U95551.1, incorporated herein as SEQ ID NO: 1. In
certain such embodiments, a conjugated antisense compound targeted
to SEQ ID NO: 1 is at least 90%, at least 95%, or 100%
complementary to SEQ ID NO: 1.
[0446] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 3. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 3.
[0447] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 4. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 4.
[0448] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 5. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 5.
[0449] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 6. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 6.
[0450] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 7. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 7.
[0451] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 8. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 8.
[0452] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 9. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 9.
[0453] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 10. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 10.
[0454] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 1 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 11. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 1 comprises a
nucleobase sequence of SEQ ID NO: 11.
TABLE-US-00002 TABLE 2 Antisense Compounds targeted to HBV SEQ ID
NO: 1 Target Start SEQ ID ISIS No Site Sequence (5'-3') Motif NO
505358 1583 GCAGAGGTGAAGCGAAGTGC eeeeeddddddddddeeeee 3 509934 1780
CCAATTTATGCCTACAGCCT eeeeeddddddddddeeeee 4 510100 411
GGCATAGCAGCAGGATG eeeddddddddddeeee 5 552023 1266
AGGAGTTCCGCAGTATGGAT eeeeeeddddddddddeeee 6 552024 1577
GTGAAGCGAAGTGCACACGG eeeeeeddddddddddeeee 7 552032 1585
GTGCAGAGGTGAAGCGAAGT eeeeeeddddddddddeeee 8 552859 1583
AGGTGAAGCGAAGTGC ekkddddddddddkke 9 552925 1264 TCCGCAGTATGGATCG
ekddddddddddkeke 10 577119 1780 AATTTATGCCTACAGCCT
kdkdkddddddddeeeee 11
[0455] In certain embodiments, a compound comprises or consists of
ISIS 505358 and a conjugate group. ISIS 505358 is a modified
oligonucleotide having the formula: Ges mCes Aes Ges Aes Gds Gds
Tds Gds Ads Ads Gds mCds Gds Ads Aes Ges Tes Ges mCe, wherein,
[0456] A=an adenine,
[0457] mC=a 5'-methylcytosine
[0458] G=a guanine,
[0459] T=a thymine,
[0460] e=a 2'-O-methoxyethyl modified nucleoside,
[0461] d=a 2'-deoxynucleoside, and
[0462] s=a phosphorothioate internucleoside linkage.
[0463] In certain embodiments, a compound comprises or consists of
ISIS 509934 and a conjugate group. ISIS 509934 is a modified
oligonucleotide having the formula: mCes mCes Aes Aes Tes Tds Tds
Ads Tds Gds mCds mCds Tds Ads mCds Aes Ges mCes mCes Te,
wherein,
[0464] A=an adenine,
[0465] mC=a 5'-methylcytosine
[0466] G=a guanine,
[0467] T=a thymine,
[0468] e=a 2'-O-methoxyethyl modified nucleoside,
[0469] d=a 2'-deoxynucleoside, and
[0470] s=a phosphorothioate internucleoside linkage.
[0471] In certain embodiments, a compound comprises or consists of
ISIS 510100 and a conjugate group. ISIS 510100 is a modified
oligonucleotide having the formula: Ges Ges mCes Ads Tds Ads Gds
mCds Ads Gds mCds Ads Gds Ges Aes Tes Ge, wherein,
[0472] A=an adenine,
[0473] mC=a 5'-methylcytosine
[0474] G=a guanine,
[0475] T=a thymine,
[0476] e=a 2'-O-methoxyethyl modified nucleoside,
[0477] d=a 2'-deoxynucleoside, and
[0478] s=a phosphorothioate internucleoside linkage.
[0479] In certain embodiments, a compound comprises or consists of
ISIS 552023 and a conjugate group. ISIS 552023 is a modified
oligonucleotide having the formula: Aes Ges Ges Aes Ges Tes Tds
mCds mCds Gds mCds Ads Gds Tds Ads Tds Ges Ges Aes Te, wherein,
[0480] A=an adenine,
[0481] mC=a 5'-methylcytosine
[0482] G=a guanine,
[0483] T=a thymine,
[0484] e=a 2'-O-methoxyethyl modified nucleoside,
[0485] d=a 2'-deoxynucleoside, and
[0486] s=a phosphorothioate internucleoside linkage.
[0487] In certain embodiments, a compound comprises or consists of
ISIS 552024 and a conjugate group. ISIS 552024 is a modified
oligonucleotide having the formula: Ges Tes Ges Aes Aes Ges mCds
Gds Ads Ads Gds Tds Gds mCds Ads mCds Aes mCes Ges Ge, wherein,
[0488] A=an adenine,
[0489] mC=a 5'-methylcytosine
[0490] G=a guanine,
[0491] T=a thymine,
[0492] e=a 2'-O-methoxyethyl modified nucleoside,
[0493] d=a 2'-deoxynucleoside, and
[0494] s=a phosphorothioate internucleoside linkage.
[0495] In certain embodiments, a compound comprises or consists of
ISIS 552032 and a conjugate group. ISIS 552032 is a modified
oligonucleotide having the formula: Ges Tes Ges mCes Aes Ges Ads
Gds Gds Tds Gds Ads Ads Gds mCds Gds Aes Aes Ges Te, wherein,
[0496] A=an adenine,
[0497] mC=a 5'-methylcytosine
[0498] G=a guanine,
[0499] T=a thymine,
[0500] e=a 2'-O-methoxyethyl modified nucleoside,
[0501] d=a 2'-deoxynucleoside, and
[0502] s=a phosphorothioate internucleoside linkage.
[0503] In certain embodiments, a compound comprises or consists of
ISIS 552859 and a conjugate group. ISIS 552859 is a modified
oligonucleotide having the formula: Aes Gks Gks Tds Gds Ads Ads Gds
mCds Gds Ads Ads Gds Tks Gks mCe, wherein,
[0504] A=an adenine,
[0505] mC=a 5'-methylcytosine
[0506] G=a guanine,
[0507] T=a thymine,
[0508] e=a 2'-O-methoxyethyl modified nucleoside,
[0509] k=a cEt modified nucleoside,
[0510] d=a 2'-deoxynucleoside, and
[0511] s=a phosphorothioate internucleoside linkage.
[0512] In certain embodiments, a compound comprises or consists of
ISIS 552925 and a conjugate group. ISIS 552925 is a modified
oligonucleotide having the formula: Tes mCks mCds Gds mCds Ads Gds
Tds Ads Tds Gds Gds Aks Tes mCks Ge, wherein,
[0513] A=an adenine,
[0514] mC=a 5'-methylcytosine
[0515] G=a guanine,
[0516] T=a thymine,
[0517] e=a 2'-O-methoxyethyl modified nucleoside,
[0518] k=a cEt modified nucleoside,
[0519] d=a 2'-deoxynucleoside, and
[0520] s=a phosphorothioate internucleoside linkage.
s=a phosphorothioate internucleoside linkage.
[0521] In certain embodiments, a compound comprises or consists of
ISIS 577119 and a conjugate group. ISIS 577119 is a modified
oligonucleotide having the formula: Aks Ads Tks Tds Tks Ads Tds Gds
mCds mCds Tds Ads mCds Aes Ges mCes mCes Te, wherein,
[0522] A=an adenine,
[0523] mC=a 5'-methylcytosine
[0524] G=a guanine,
[0525] T=a thymine,
[0526] e=a 2'-O-methoxyethyl modified nucleoside,
[0527] k=a cEt modified nucleoside,
[0528] d=a 2'-deoxynucleoside, and
[0529] s=a phosphorothioate internucleoside linkage.
[0530] In certain embodiments, a compound having the following
chemical structure comprises or consists of ISIS 505358 with a
5'-X, wherein X is a conjugate group as described herein:
##STR00114##
[0531] In certain embodiments, a compound comprises or consists of
ISIS 712408 having the following chemical structure:
##STR00115##
[0532] In certain embodiments, a compound comprises or consists of
ISIS 695324 having the following chemical structure:
##STR00116##
[0533] In certain embodiments, a compound comprises or consists of
SEQ ID NO: 3, 5'-GalNAc, and chemical modifications as represented
by the following chemical structure:
##STR00117##
wherein either R.sup.1 is --OCH.sub.2CH.sub.2OCH.sub.3 (MOE) and
R.sup.2 is H; or R.sup.1 and R.sup.2 together form a bridge,
wherein R.sup.1 is --O-- and R.sup.2 is --CH.sub.2--,
--CH(CH.sub.3)--, or --CH.sub.2CH.sub.2--, and R.sup.1 and R.sup.2
are directly connected such that the resulting bridge is selected
from: --O--CH.sub.2--, --O--CH(CH.sub.3)--, and
--O--CH.sub.2CH.sub.2--; and for each pair of R.sup.3 and R.sup.4
on the same ring, independently for each ring: either R.sup.3 is
selected from H and --OCH.sub.2CH.sub.2OCH.sub.3 and R.sup.4 is H;
or R.sup.3 and R.sup.4 together form a bridge, wherein R.sup.3 is
--O--, and R.sup.4 is --CH.sub.2--, --CH(CH.sub.3)--, or
--CH.sub.2CH.sub.2-- and R.sup.3 and R.sup.4 are directly connected
such that the resulting bridge is selected from: --O--CH.sub.2--,
--O--CH(CH.sub.3)--, and --O--CH.sub.2CH.sub.2--; and R.sup.5 is
selected from H and --CH.sub.3; and Z is selected from S.sup.- and
O.sup.-.
[0534] In certain embodiments, a compound comprises an antisense
oligonucleotide disclosed in WO 2012/145697, which is incorporated
by reference in its entirety herein, and a conjugate group
described herein. In certain embodiments, a compound comprises an
antisense oligonucleotide having a nucleobase sequence of any of
SEQ ID NOs 5-310, 321-802, 804-1272, 1288-1350, 1364-1372, 1375,
1376, and 1379 disclosed in WO 2012/145697 and a conjugate group
described herein. In certain embodiments, a compound comprises an
antisense oligonucleotide disclosed in WO 2011/047312, which is
incorporated by reference in its entirety herein, and a conjugate
group described herein. In certain embodiments, a compound
comprises an antisense oligonucleotide having a nucleobase sequence
of any of SEQ ID NOs 14-22 disclosed in WO 2011/047312 and a
conjugate group described herein. In certain embodiments, a
compound comprises an antisense oligonucleotide disclosed in WO
2012/145674, which is incorporated by reference in its entirety
herein, and a conjugate group described herein. In certain
embodiments, a compound comprises an antisense oligonucleotide
having a nucleobase sequence of any of SEQ ID NOs 18-35 disclosed
in WO 2012/145674. In certain embodiments, a compound comprises a
double-stranded oligonucleotide disclosed in WO 2013/159109, which
is incorporated by reference in its entirety herein, and a
conjugate group described herein. In certain embodiments, a
compound comprises a double-stranded oligonucleotide in which one
strand has a nucleobase sequence of any of SEQ ID NOs 30-125
disclosed in WO 2013/159109. The nucleobase sequences of all of the
aforementioned referenced SEQ ID NOs are incorporated by reference
herein.
HBV Therapeutic Indications
[0535] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a HBV nucleic
acid for modulating the expression of HBV in a subject. In certain
embodiments, the expression of HBV is reduced.
[0536] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a HBV nucleic
acid in a pharmaceutical composition for treating a subject. In
certain embodiments, the subject has a HBV-related condition. In
certain embodiments, the HBV-related condition includes, but is not
limited to, chronic HBV infection, inflammation, fibrosis,
cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer,
liver inflammation, liver fibrosis, liver cirrhosis, liver failure,
diffuse hepatocellular inflammatory disease, hemophagocytic
syndrome, serum hepatitis, and HBV viremia. In certain embodiments,
the HBV-related condition may have symptoms which may include any
or all of the following: flu-like illness, weakness, aches,
headache, fever, loss of appetite, diarrhea, jaundice, nausea and
vomiting, pain over the liver area of the body, clay- or
grey-colored stool, itching all over, and dark-colored urine, when
coupled with a positive test for presence of a hepatitis B virus, a
hepatitis B viral antigen, or a positive test for the presence of
an antibody specific for a hepatitis B viral antigen. In certain
embodiments, the subject is at risk for an HBV-related condition.
This includes subjects having one or more risk factors for
developing an HBV-related condition, including sexual exposure to
an individual infected with Hepatitis B virus, living in the same
house as an individual with a lifelong hepatitis B virus infection,
exposure to human blood infected with the hepatitis B virus,
injection of illicit drugs, being a person who has hemophilia, and
visiting an area where hepatitis B is common. In certain
embodiments, the subject has been identified as in need of
treatment for an HBV-related condition.
[0537] Certain embodiments provide a method of reducing HBV DNA
and/or HBV antigen levels in a animal infected with HBV comprising
administering to the animal a conjugated antisense compound
targeted to a HBV nucleic acid. In certain embodiments, the antigen
is HBsAG or HBeAG. In certain embodiments, the amount of HBV
antigen may be sufficiently reduced to result in
seroconversion.
[0538] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a HBV nucleic
acid in the preparation of a medicament.
[0539] In certain embodiments, the invention provides a conjugated
antisense compound targeted to a HBV nucleic acid, or a
pharmaceutically acceptable salt thereof, for use in therapy.
[0540] Certain embodiments provide a conjugated antisense compound
targeted to a HBV nucleic acid for use in the treatment of a
HBV-related condition. The HBV-related condition includes, but is
not limited to, chronic HBV infection, inflammation, fibrosis,
cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer,
liver inflammation, liver fibrosis, liver cirrhosis, liver failure,
diffuse hepatocellular inflammatory disease, hemophagocytic
syndrome, serum hepatitis, and HBV viremia.
[0541] Certain embodiments provide a conjugated antisense compound
targeted to a HBV nucleic acid for use in reducing HBV DNA and/or
HBV antigen levels in a animal infected with HBV comprising
administering to the animal a conjugated antisense compound
targeted to a HBV nucleic acid. In certain embodiments, the antigen
is HBsAG or HBeAG. In certain embodiments, the amount of HBV
antigen may be sufficiently reduced to result in
seroconversion.
[0542] It will be understood that any of the compounds described
herein can be used in the aforementioned methods and uses. For
example, in certain embodiments a conjugated antisense compound
targeted to a HBV nucleic acid in the aforementioned methods and
uses can include, but is not limited to, a conjugated antisense
compound targeted to SEQ ID NO: 1 comprising an at least 8
consecutive nucleobase sequence of any of SEQ ID NOs: 3-11; a
conjugated antisense compound targeted to SEQ ID NO: 1 comprising a
nucleobase sequence of any of SEQ ID NOs: 3-11; a compound
comprising or consisting of ISIS 505358, ISIS 509934, ISIS 510100,
ISIS 552023, ISIS 552024, ISIS 552032, ISIS 552859, ISIS 552925, or
ISIS 577119 and a conjugate group; a compound comprising an
antisense oligonucleotide disclosed in WO 2012/145697, which is
incorporated by reference in its entirety herein, and a conjugate
group; a compound comprising an antisense oligonucleotide having a
nucleobase sequence of any of SEQ ID NOs 5-310, 321-802, 804-1272,
1288-1350, 1364-1372, 1375, 1376, and 1379 disclosed in WO
2012/145697 and a conjugate group described herein; a compound
comprising an antisense oligonucleotide having a nucleobase
sequence of any of SEQ ID NOs 14-22 disclosed in WO 2011/047312 and
a conjugate group described herein; a compound comprising an
antisense oligonucleotide having a nucleobase sequence of any of
SEQ ID NOs 18-35 disclosed in WO 2012/145674; or a compound
comprising a double-stranded oligonucleotide in which one strand
has a nucleobase sequence of any of SEQ ID NOs 30-125 disclosed in
WO 2013/159109.
2. Transthyretin (TTR)
[0543] TTR (also known as prealbumin, hyperthytoxinemia,
dysprealbuminemic, thyroxine; senile systemic amyloidosis, amyloid
polyneuropathy, amyloidosis I, PALB; dystransthyretinemic, HST2651;
TBPA; dysprealbuminemic euthyroidal hyperthyroxinemia) is a
serum/plasma and cerebrospinal fluid protein responsible for the
transport of thyroxine and retinol (Sakaki et al, Mol Biol Med.
1989, 6:161-8). Structurally, TTR is a homotetramer; point
mutations and misfolding of the protein leads to deposition of
amyloid fibrils and is associated with disorders, such as senile
systemic amyloidosis (SSA), familial amyloid polyneuropathy (FAP),
and familial amyloid cardiopathy (FAC).
[0544] TTR is synthesized primarily by the liver and the choroid
plexus of the brain and, to a lesser degree, by the retina in
humans (Palha, Clin Chem Lab Med, 2002, 40, 1292-1300).
Transthyretin that is synthesized in the liver is secreted into the
blood, whereas transthyretin originating in the choroid plexus is
destined for the CSF. In the choroid plexus, transthyretin
synthesis represents about 20% of total local protein synthesis and
as much as 25% of the total CSF protein (Dickson et al., J Biol
Chem, 1986, 261, 3475-3478).
[0545] With the availability of genetic and immunohistochemical
diagnostic tests, patients with TTR amyloidosis have been found in
many nations worldwide. Recent studies indicate that TTR
amyloidosis is not a rare endemic disease as previously thought,
and may affect as much as 25% of the elderly population (Tanskanen
et al, Ann Med. 2008; 40(3):232-9).
[0546] At the biochemical level, TTR was identified as the major
protein component in the amyloid deposits of FAP patients (Costa et
al, Proc. Natl. Acad. Sci. USA 1978, 75:4499-4503) and later, a
substitution of methionine for valine at position 30 of the protein
was found to be the most common molecular defect causing the
disease (Saraiva et al, J. Clin. Invest. 1984, 74: 104-119). In
FAP, widespread systemic extracellular deposition of TTR aggregates
and amyloid fibrils occurs throughout the connective tissue,
particularly in the peripheral nervous system (Sousa and Saraiva,
Prog. Neurobiol. 2003, 71: 385-400). Following TTR deposition,
axonal degeneration occurs, starting in the unmyelinated and
myelinated fibers of low diameter, and ultimately leading to
neuronal loss at ganglionic sites.
[0547] Antisense compounds targeting TTR have been previously
disclosed in US2005/0244869, WO2010/017509, and WO2011/139917, each
herein incorporated by reference in its entirety. An antisense
oligonucleobase targeting TTR, ISIS-TTR.sub.Rx, is currently in
Phase 2/3 clinical trials to study its effectiveness in treating
subjects with Familial Amyloid Polyneuropathy. However, there is
still a need to provide patients with additional and more potent
treatment options.
Certain Conjugated Antisense Compounds Targeted to a TTR Nucleic
Acid
[0548] In certain embodiments, conjugated antisense compounds are
targeted to a TTR nucleic acid having the sequence of GENBANK.RTM.
Accession No. NM_000371.3, incorporated herein as SEQ ID NO: 2. In
certain such embodiments, a conjugated antisense compound targeted
to SEQ ID NO: 2 is at least 90%, at least 95%, or 100%
complementary to SEQ ID NO: 2.
[0549] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of any one of SEQ ID NOs: 12-19. In certain
embodiments, a conjugated antisense compound targeted to SEQ ID NO:
2 comprises a nucleobase sequence of any one of SEQ ID NO:
12-19.
[0550] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 12. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 12.
[0551] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 13. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 13.
[0552] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 14. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 14.
[0553] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 15. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 15.
[0554] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 16 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 78. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 16 comprises a
nucleobase sequence of SEQ ID NO: 78.
[0555] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 17. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 17.
[0556] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 18. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 18.
[0557] In certain embodiments, a conjugated antisense compound
targeted to SEQ ID NO: 2 comprises an at least 8 consecutive
nucleobase sequence of SEQ ID NO: 19. In certain embodiments, a
conjugated antisense compound targeted to SEQ ID NO: 2 comprises a
nucleobase sequence of SEQ ID NO: 19.
TABLE-US-00003 TABLE 3 Antisense Compounds targeted to TTR SEQ ID
NO: 2 Target Start SEQ ID ISIS No Site Sequence (5'-3') Motif NO
420915 508 TCTTGGTTACATGAAATCCC eeeeeddddddddddeeeee 12 304299 507
CTTGGTTACATGAAATCCCA eeeeeddddddddddeeeee 13 420921 515
GGAATACTCTTGGTTACATG eeeeeddddddddddeeeee 14 420922 516
TGGAATACTCTTGGTTACAT eeeeeddddddddddeeeee 15 420950 580
TTTTATTGTCTCTGCCTGGA eeeeeddddddddddeeeee 16 420955 585
GAATGTTTTATTGTCTCTGC eeeeeddddddddddeeeee 17 420957 587
AGGAATGTTTTATTGTCTCT eeeeeddddddddddeeeee 18 420959 589
ACAGGAATGTTTTATTGTCT eeeeeddddddddddeeeee 19
[0558] In certain embodiments, a compound comprises or consists of
ISIS 420915 and a conjugate group. ISIS 420915 is a modified
oligonucleotide having the formula: Tes mCes Tes Tes Ges Gds Tds
Tds Ads mCds Ads Tds Gds Ads Ads Aes Tes mCes mCes mCe, wherein
[0559] A=an adenine,
[0560] mC=a 5'-methylcytosine
[0561] G=a guanine,
[0562] T=a thymine,
[0563] e=a 2'-O-methoxyethyl modified nucleoside,
[0564] d=a 2'-deoxynucleoside, and
[0565] s=a phosphorothioate internucleoside linkage.
[0566] In certain embodiments, a compound comprises or consists of
ISIS 304299 and a conjugate group. ISIS 304299 is a modified
oligonucleotide having the formula: mCes Tes Tes Ges Ges Tds Tds
Ads mCds Ads Tds Gds Ads Ads Ads Tes mCes mCes mCes Ae, wherein
[0567] A=an adenine,
[0568] mC=a 5'-methylcytosine
[0569] G=a guanine,
[0570] T=a thymine,
[0571] e=a 2'-O-methoxyethyl modified nucleoside,
[0572] d=a 2'-deoxynucleoside, and
[0573] s=a phosphorothioate internucleoside linkage.
[0574] In certain embodiments, a compound comprises or consists of
ISIS 420921 and a conjugate group. ISIS 420921 is a modified
oligonucleotide having the formula: Ges Ges Aes Aes Tes Ads mCds
Tds mCds Tds Tds Gds Gds Tds Tds Aes mCes Aes Tes Ge, wherein
[0575] A=an adenine,
[0576] mC=a 5'-methylcytosine
[0577] G=a guanine,
[0578] T=a thymine,
[0579] e=a 2'-O-methoxyethyl modified nucleoside,
[0580] d=a 2'-deoxynucleoside, and
[0581] s=a phosphorothioate internucleoside linkage.
[0582] In certain embodiments, a compound comprises or consists of
ISIS 420922 and a conjugate group. ISIS 420922 is a modified
oligonucleotide having the formula: Tes Ges Ges Aes Aes Tds Ads
mCds Tds mCds Tds Tds Gds Gds Tds Tes Aes mCes Aes Te, wherein
[0583] A=an adenine,
[0584] mC=a 5'-methylcytosine
[0585] G=a guanine,
[0586] T=a thymine,
[0587] e=a 2'-O-methoxyethyl modified nucleoside,
[0588] d=a 2'-deoxynucleoside, and
[0589] s=a phosphorothioate internucleoside linkage.
[0590] In certain embodiments, a compound comprises or consists of
ISIS 420950 and a conjugate group.
[0591] ISIS 420950 is a modified oligonucleotide having the
formula: Tes Tes Tes Tes Aes Tds Tds Gds Tds mCds Tds mCds Tds Gds
mCds mCes Tes Ges Ges Ae, wherein
[0592] A=an adenine,
[0593] mC=a 5'-methylcytosine
[0594] G=a guanine,
[0595] T=a thymine,
[0596] e=a 2'-O-methoxyethyl modified nucleoside,
[0597] d=a 2'-deoxynucleoside, and
[0598] s=a phosphorothioate internucleoside linkage.
[0599] In certain embodiments, a compound comprises or consists of
ISIS 420955 and a conjugate group. ISIS 420955 is a modified
oligonucleotide having the formula: Ges Aes Aes Tes Ges Tds Tds Tds
Tds Ads Tds Tds Gds Tds mCds Tes mCes Tes Ges mCe, wherein
[0600] A=an adenine,
[0601] mC=a 5'-methylcytosine
[0602] G=a guanine,
[0603] T=a thymine,
[0604] e=a 2'-O-methoxyethyl modified nucleoside,
[0605] d=a 2'-deoxynucleoside, and
[0606] s=a phosphorothioate internucleoside linkage.
[0607] In certain embodiments, a compound comprises or consists of
ISIS 420957 and a conjugate group.
[0608] ISIS 420957 is a modified oligonucleotide having the
formula: Aes Ges Ges Aes Aes Tds Gds Tds Tds Tds Tds Ads Tds Tds
Gds Tes mCes Tes mCes Te, wherein
[0609] A=an adenine,
[0610] mC=a 5'-methylcytosine
[0611] G=a guanine,
[0612] T=a thymine,
[0613] e=a 2'-O-methoxyethyl modified nucleoside,
[0614] d=a 2'-deoxynucleoside, and
[0615] s=a phosphorothioate internucleoside linkage.
[0616] In certain embodiments, a compound comprises or consists of
ISIS 420959 and a conjugate group. ISIS 420959 is a modified
oligonucleotide having the formula: Aes mCes Aes Ges Ges Ads Ads
Tds Gds Tds Tds Tds Tds Ads Tds Tes Ges Tes mCes Te, wherein
[0617] A=an adenine,
[0618] mC=a 5'-methylcytosine
[0619] G=a guanine,
[0620] T=a thymine,
[0621] e=a 2'-O-methoxyethyl modified nucleoside,
[0622] d=a 2'-deoxynucleoside, and
[0623] s=a phosphorothioate internucleoside linkage.
In certain embodiments, a compound having the following chemical
structure comprises or consists of ISIS 420915 with a 5'-X, wherein
X is a conjugate group as described herein:
##STR00118##
In certain embodiments, a compound comprises or consists of ISIS
682877 having the following chemical structure:
##STR00119##
In certain embodiments, a compound comprises or consists of ISIS
682884 having the following chemical structure:
##STR00120##
[0624] In certain embodiments, a compound comprises or consists of
SEQ ID NO: 12, 5'-GalNAc, and chemical modifications as represented
by the following chemical structure:
##STR00121##
wherein either R' is --OCH.sub.2CH.sub.2OCH.sub.3 (MOE) and R.sup.2
is H; or R.sup.1 and R.sup.2 together form a bridge, wherein
R.sup.1 is --O-- and R.sup.2 is --CH.sub.2--, --CH(CH.sub.3)--, or
--CH.sub.2CH.sub.2--, and R.sup.1 and R.sup.2 are directly
connected such that the resulting bridge is selected from:
--O--CH.sub.2--, --O--CH(CH.sub.3)--, and --O--CH.sub.2CH.sub.2--;
and for each pair of R.sup.3 and R.sup.4 on the same ring,
independently for each ring: either R.sup.3 is selected from H and
--OCH.sub.2CH.sub.2OCH.sub.3 and R.sup.4 is H; or R.sup.3 and
R.sup.4 together form a bridge, wherein R.sup.3 is --O-- and
R.sup.4 is --CH.sub.2--, --CH(CH.sub.3)--, or --CH.sub.2CH.sub.2--
and R.sup.3 and R.sup.4 are directly connected such that the
resulting bridge is selected from: --O--CH.sub.2--,
--O--CH(CH.sub.3)--, and --O--CH.sub.2CH.sub.2--; and R.sup.5 is
selected from H and --CH.sub.3; and Z is selected from S.sup.- and
O.sup.-.
[0625] In certain embodiments, a compound comprises an antisense
oligonucleotide disclosed in WO 2011/139917 or U.S. Pat. No.
8,101,743, which are incorporated by reference in their entireties
herein, and a conjugate group. In certain embodiments, a compound
comprises an antisense oligonucleotide having a nucleobase sequence
of any of SEQ ID NOs 8-160, 170-177 disclosed in WO 2011/139917 and
a conjugate group described herein. In certain embodiments, a
compound comprises an antisense oligonucleotide having a nucleobase
sequence of any of SEQ ID NOs 12-89 disclosed in U.S. Pat. No.
8,101,743 and a conjugate group described herein. In certain
embodiments, a compound comprises an antisense oligonucleotide
having a nucleobase sequence complementary to a preferred target
segment of any of SEQ ID NOs 90-133 disclosed in U.S. Pat. No.
8,101,743 and a conjugate group described herein. The nucleobase
sequences of all of the aforementioned referenced SEQ ID NOs are
incorporated by reference herein.
TTR Therapeutic Indications
[0626] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a TTR nucleic
acid for modulating the expression of TTR in a subject. In certain
embodiments, the expression of TTR is reduced.
[0627] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a TTR nucleic
acid in a pharmaceutical composition for treating a subject. In
certain embodiments, the subject has a transthyretin related
disease, disorder or condition, or symptom thereof. In certain
embodiments, the transthyretin related disease, disorder or
condition is transthyretin amyloidosis. "Transthyretin-related
amyloidosis" or "transthyretin amyloidosis" or "Transthyretin
amyloid disease", as used herein, is any pathology or disease
associated with dysfunction or dysregulation of transthyretin that
result in formation of transthyretin-containing amyloid fibrils.
Transthyretin amyloidosis includes, but is not limited to,
hereditary TTR amyloidosis, leptomeningeal amyloidosis, familial
amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy,
familial oculoleptomeningeal amyloidosis, senile cardiac
amyloidosis, or senile systemic amyloidosis.
[0628] In certain embodiments, the invention provides methods for
using a conjugated antisense compound targeted to a TTR nucleic
acid in the preparation of a medicament.
[0629] In certain embodiments, the invention provides a conjugated
antisense compound targeted to a TTR nucleic acid, or a
pharmaceutically acceptable salt thereof, for use in therapy.
[0630] Certain embodiments provide a conjugated antisense compound
targeted to a TTR nucleic acid for use in the treatment of a
transthyretin related disease, disorder or condition, or symptom
thereof. In certain embodiments, the transthyretin related disease,
disorder or condition is transthyretin amyloidosis.
[0631] It will be understood that any of the compounds described
herein can be used in the aforementioned methods and uses. For
example, in certain embodiments a conjugated antisense compound
targeted to a TTR nucleic acid in the aforementioned methods and
uses can include, but is not limited to, a conjugated antisense
compound targeted to SEQ ID NO: 2 comprising an at least 8
consecutive nucleobase sequence of any one of SEQ ID NOs: 12-19; a
conjugated antisense compound targeted to SEQ ID NO: 2 comprising a
nucleobase sequence of any one of SEQ ID NO: 12-19; a compound
comprising or consisting of ISIS 420915, ISIS 304299, ISIS 420921,
ISIS 420922, ISIS 420950, ISIS 420955, ISIS 420957, or ISIS 420959
and a conjugate group; a compound comprising an antisense
oligonucleotide disclosed in WO 2011/139917 or U.S. Pat. No.
8,101,743, which are incorporated by reference in their entireties
herein, and a conjugate group; a compound comprising an antisense
oligonucleotide having a nucleobase sequence of any of SEQ ID NOs
8-160, 170-177 disclosed in WO 2011/139917 and a conjugate group
described herein; an antisense oligonucleotide having a nucleobase
sequence of any of SEQ ID NOs 12-89 disclosed in U.S. Pat. No.
8,101,743 and a conjugate group described herein; or a compound
comprising an antisense oligonucleotide having a nucleobase
sequence complementary to a preferred target segment of any of SEQ
ID NOs 90-133 disclosed in U.S. Pat. No. 8,101,743 and a conjugate
group described herein. The nucleobase sequences of all of the
aforementioned referenced SEQ ID NOs are incorporated by reference
herein.
E. Certain Pharmaceutical Compositions
[0632] In certain embodiments, the present disclosure provides
pharmaceutical compositions comprising one or more antisense
compound. In certain embodiments, such pharmaceutical composition
comprises a suitable pharmaceutically acceptable diluent or
carrier. In certain embodiments, a pharmaceutical composition
comprises a sterile saline solution and one or more antisense
compound. In certain embodiments, such pharmaceutical composition
consists of a sterile saline solution and one or more antisense
compound. In certain embodiments, the sterile saline is
pharmaceutical grade saline. In certain embodiments, a
pharmaceutical composition comprises one or more antisense compound
and sterile water. In certain embodiments, a pharmaceutical
composition consists of one or more antisense compound and sterile
water. In certain embodiments, the sterile saline is pharmaceutical
grade water. In certain embodiments, a pharmaceutical composition
comprises one or more antisense compound and phosphate-buffered
saline (PBS). In certain embodiments, a pharmaceutical composition
consists of one or more antisense compound and sterile
phosphate-buffered saline (PBS). In certain embodiments, the
sterile saline is pharmaceutical grade PBS.
[0633] In certain embodiments, antisense compounds may be admixed
with pharmaceutically acceptable active and/or inert substances for
the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions depend on a number of criteria, including, but not
limited to, route of administration, extent of disease, or dose to
be administered.
[0634] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising antisense compounds comprise one or more oligonucleotide
which, upon administration to an animal, including a human, is
capable of providing (directly or indirectly) the biologically
active metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0635] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligonucleotide which are
cleaved by endogenous nucleases within the body, to form the active
antisense oligonucleotide.
[0636] Lipid moieties have been used in nucleic acid therapies in a
variety of methods. In certain such methods, the nucleic acid is
introduced into preformed liposomes or lipoplexes made of mixtures
of cationic lipids and neutral lipids. In certain methods, DNA
complexes with mono- or poly-cationic lipids are formed without the
presence of a neutral lipid. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to a
particular cell or tissue. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to
fat tissue. In certain embodiments, a lipid moiety is selected to
increase distribution of a pharmaceutical agent to muscle
tissue.
[0637] In certain embodiments, pharmaceutical compositions provided
herein comprise one or more modified oligonucleotides and one or
more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0638] In certain embodiments, a pharmaceutical composition
provided herein comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0639] In certain embodiments, a pharmaceutical composition
provided herein comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present disclosure to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0640] In certain embodiments, a pharmaceutical composition
provided herein comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0641] In certain embodiments, a pharmaceutical composition
provided herein is prepared for oral administration. In certain
embodiments, pharmaceutical compositions are prepared for buccal
administration.
[0642] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0643] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0644] In certain embodiments, a pharmaceutical composition
provided herein comprises an oligonucleotide in a therapeutically
effective amount. In certain embodiments, the therapeutically
effective amount is sufficient to prevent, alleviate or ameliorate
symptoms of a disease or to prolong the survival of the subject
being treated. Determination of a therapeutically effective amount
is well within the capability of those skilled in the art.
[0645] In certain embodiments, one or more modified oligonucleotide
provided herein is formulated as a prodrug. In certain embodiments,
upon in vivo administration, a prodrug is chemically converted to
the biologically, pharmaceutically or therapeutically more active
form of an oligonucleotide. In certain embodiments, prodrugs are
useful because they are easier to administer than the corresponding
active form. For example, in certain instances, a prodrug may be
more bioavailable (e.g., through oral administration) than is the
corresponding active form. In certain instances, a prodrug may have
improved solubility compared to the corresponding active form. In
certain embodiments, prodrugs are less water soluble than the
corresponding active form. In certain instances, such prodrugs
possess superior transmittal across cell membranes, where water
solubility is detrimental to mobility. In certain embodiments, a
prodrug is an ester. In certain such embodiments, the ester is
metabolically hydrolyzed to carboxylic acid upon administration. In
certain instances the carboxylic acid containing compound is the
corresponding active form. In certain embodiments, a prodrug
comprises a short peptide (polyaminoacid) bound to an acid group.
In certain of such embodiments, the peptide is cleaved upon
administration to form the corresponding active form.
[0646] In certain embodiments, the present disclosure provides
compositions and methods for reducing the amount or activity of a
target nucleic acid in a cell. In certain embodiments, the cell is
in an animal. In certain embodiments, the animal is a mammal. In
certain embodiments, the animal is a rodent. In certain
embodiments, the animal is a primate. In certain embodiments, the
animal is a non-human primate. In certain embodiments, the animal
is a human.
[0647] In certain embodiments, the present disclosure provides
methods of administering a pharmaceutical composition comprising an
oligonucleotide of the present disclosure to an animal. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intracerebroventricular,
intraperitoneal, intranasal, intraocular, intratumoral, and
parenteral (e.g., intravenous, intramuscular, intramedullary, and
subcutaneous). In certain embodiments, pharmaceutical intrathecals
are administered to achieve local rather than systemic exposures.
For example, pharmaceutical compositions may be injected directly
in the area of desired effect (e.g., into the liver).
Nonlimiting Disclosure and Incorporation by Reference
[0648] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety. Certain compounds,
compositions, and methods herein are described as "comprising
exactly" or "comprises exactly" a particular number of a particular
element or feature. Such descriptions are used to indicate that
while the compound, composition, or method may comprise additional
other elements, the number of the particular element or feature is
the identified number. For example, "a conjugate comprising exactly
one GalNAc" is a conjugate that contains one and only one GalNAc,
though it may contain other elements in addition to the one
GalNAc.
[0649] Although the sequence listing accompanying this filing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications. One of skill in the art will readily
appreciate that such designation as "RNA" or "DNA" to describe
modified oligonucleotides is, in certain instances, arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine base could be described as a DNA
having a modified sugar (2'-OH for the natural 2'-H of DNA) or as
an RNA having a modified base (thymine (methylated uracil) for
natural uracil of RNA).
[0650] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligonucleotide having the
nucleobase sequence "ATCGATCG" encompasses any oligonucleotides
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and oligonucleotides
having other modified bases, such as "AT.sup.meCGAUCG," wherein
.sup.meC indicates a cytosine base comprising a methyl group at the
5-position.
EXAMPLES
[0651] The following examples illustrate certain embodiments of the
present disclosure and are not limiting. Moreover, where specific
embodiments are provided, the inventors have contemplated generic
application of those specific embodiments. For example, disclosure
of an oligonucleotide having a particular motif provides reasonable
support for additional oligonucleotides having the same or similar
motif. And, for example, where a particular high-affinity
modification appears at a particular position, other high-affinity
modifications at the same position are considered suitable, unless
otherwise indicated.
Example 1: General Method for the Preparation of Phosphoramidites,
Compounds 1, 1a and 2
##STR00122##
[0653] Bx is a heterocyclic base;
[0654] Compounds 1, 1a and 2 were prepared as per the procedures
well known in the art as described in the specification herein (see
Seth et al., Bioorg. Med. Chem., 2011, 21(4), 1122-1125, J. Org.
Chem., 2010, 75(5), 1569-1581, Nucleic Acids Symposium Series,
2008, 52(1), 553-554); and also see published PCT International
Applications (WO 2011/115818, WO 2010/077578, WO2010/036698,
WO2009/143369, WO 2009/006478, and WO 2007/090071), and U.S. Pat.
No. 7,569,686).
Example 2: Preparation of Compound 7
##STR00123##
[0656] Compounds 3
(2-acetamido-1,3,4,6-tetra-O-acetyl-2-deoxy-.beta.-D
galactopyranose or galactosamine pentaacetate) is commercially
available. Compound 5 was prepared according to published
procedures (Weber et al., J. Med. Chem., 1991, 34, 2692).
Example 3: Preparation of Compound 11
##STR00124##
[0658] Compounds 8 and 9 are commercially available.
Example 4: Preparation of Compound 18
##STR00125## ##STR00126##
[0660] Compound 11 was prepared as per the procedures illustrated
in Example 3. Compound 14 is commercially available. Compound 17
was prepared using similar procedures reported by Rensen et al., J
Med. Chem., 2004, 47, 5798-5808.
Example 5: Preparation of Compound 23
##STR00127##
[0662] Compounds 19 and 21 are commercially available.
Example 6: Preparation of Compound 24
##STR00128##
[0664] Compounds 18 and 23 were prepared as per the procedures
illustrated in Examples 4 and 5.
Example 7: Preparation of Compound 25
##STR00129##
[0666] Compound 24 was prepared as per the procedures illustrated
in Example 6.
Example 8: Preparation of Compound 26
##STR00130##
[0668] Compound 24 is prepared as per the procedures illustrated in
Example 6.
Example 9: General Preparation of Conjugated ASOs Comprising
GalNAc.sub.3-1 at the 3' Terminus, Compound 29
##STR00131## ##STR00132##
[0670] Wherein the protected GalNAc.sub.3-1 has the structure:
##STR00133##
[0671] The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-1 (GalNAc.sub.3-1.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. Wherein
GalNAc.sub.3-1.sub.a has the formula:
##STR00134##
[0672] The solid support bound protected GalNAc.sub.3-1, Compound
25, was prepared as per the procedures illustrated in Example 7.
Oligomeric Compound 29 comprising GalNAc.sub.3-1 at the 3' terminus
was prepared using standard procedures in automated DNA/RNA
synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45,
3623-3627). Phosphoramidite building blocks, Compounds 1 and 1a
were prepared as per the procedures illustrated in Example 1. The
phosphoramidites illustrated are meant to be representative and not
intended to be limiting as other phosphoramidite building blocks
can be used to prepare oligomeric compounds having a predetermined
sequence and composition. The order and quantity of
phosphoramidites added to the solid support can be adjusted to
prepare gapped oligomeric compounds as described herein. Such
gapped oligomeric compounds can have predetermined composition and
base sequence as dictated by any given target.
Example 10: General Preparation Conjugated ASOs Comprising
GalNAc.sub.3-1 at the 5' Terminus, Compound 34
##STR00135## ##STR00136##
[0674] The Unylinker.TM. 30 is commercially available. Oligomeric
Compound 34 comprising a GalNAc.sub.3-1 cluster at the 5' terminus
is prepared using standard procedures in automated DNA/RNA
synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45,
3623-3627). Phosphoramidite building blocks, Compounds 1 and 1a
were prepared as per the procedures illustrated in Example 1. The
phosphoramidites illustrated are meant to be representative and not
intended to be limiting as other phosphoramidite building blocks
can be used to prepare an oligomeric compound having a
predetermined sequence and composition. The order and quantity of
phosphoramidites added to the solid support can be adjusted to
prepare gapped oligomeric compounds as described herein. Such
gapped oligomeric compounds can have predetermined composition and
base sequence as dictated by any given target.
Example 11: Preparation of Compound 39
##STR00137## ##STR00138##
[0676] Compounds 4, 13 and 23 were prepared as per the procedures
illustrated in Examples 2, 4, and 5. Compound 35 is prepared using
similar procedures published in Rouchaud et al., Eur. J. Org.
Chem., 2011, 12, 2346-2353.
Example 12: Preparation of Compound 40
##STR00139##
[0678] Compound 38 is prepared as per the procedures illustrated in
Example 11.
Example 13: Preparation of Compound 44
##STR00140## ##STR00141##
[0680] Compounds 23 and 36 are prepared as per the procedures
illustrated in Examples 5 and 11. Compound 41 is prepared using
similar procedures published in WO 2009082607.
Example 14: Preparation of Compound 45
##STR00142##
[0682] Compound 43 is prepared as per the procedures illustrated in
Example 13.
Example 15: Preparation of Compound 47
##STR00143##
[0684] Compound 46 is commercially available.
Example 16: Preparation of Compound 53
##STR00144## ##STR00145##
[0686] Compounds 48 and 49 are commercially available. Compounds 17
and 47 are prepared as per the procedures illustrated in Examples 4
and 15.
Example 17: Preparation of Compound 54
##STR00146##
[0688] Compound 53 is prepared as per the procedures illustrated in
Example 16.
Example 18: Preparation of Compound 55
##STR00147##
[0690] Compound 53 is prepared as per the procedures illustrated in
Example 16.
Example 19: General Method for the Preparation of Conjugated ASOs
Comprising GalNAc.sub.3-1 at the 3' Position Via Solid Phase
Techniques (Preparation of ISIS 647535, 647536 and 651900)
[0691] Unless otherwise stated, all reagents and solutions used for
the synthesis of oligomeric compounds are purchased from commercial
sources. Standard phosphoramidite building blocks and solid support
are used for incorporation nucleoside residues which include for
example T, A, G, and .sup.mC residues. A 0.1 M solution of
phosphoramidite in anhydrous acetonitrile was used for
.beta.-D-2'-deoxyribonucleoside and 2'-MOE.
[0692] The ASO syntheses were performed on ABI 394 synthesizer (1-2
.mu.mol scale) or on GE Healthcare Bioscience AKTA oligopilot
synthesizer (40-200 .mu.mol scale) by the phosphoramidite coupling
method on an GalNAc.sub.3-1 loaded VIMAD solid support (110
.mu.mol/g, Guzaev et al., 2003) packed in the column. For the
coupling step, the phosphoramidites were delivered 4 fold excess
over the loading on the solid support and phosphoramidite
condensation was carried out for 10 min. All other steps followed
standard protocols supplied by the manufacturer. A solution of 6%
dichloroacetic acid in toluene was used for removing
dimethoxytrityl (DMT) group from 5'-hydroxyl group of the
nucleotide. 4,5-Dicyanoimidazole (0.7 M) in anhydrous CH.sub.3CN
was used as activator during coupling step. Phosphorothioate
linkages were introduced by sulfurization with 0.1 M solution of
xanthane hydride in 1:1 pyridine/CH.sub.3CN for a contact time of 3
minutes. A solution of 20% tert-butylhydroperoxide in CH.sub.3CN
containing 6% water was used as an oxidizing agent to provide
phosphodiester internucleoside linkages with a contact time of 12
minutes.
[0693] After the desired sequence was assembled, the cyanoethyl
phosphate protecting groups were deprotected using a 1:1 (v/v)
mixture of triethylamine and acetonitrile with a contact time of 45
minutes. The solid-support bound ASOs were suspended in aqueous
ammonia (28-30 wt %) and heated at 55.degree. C. for 6 h.
[0694] The unbound ASOs were then filtered and the ammonia was
boiled off. The residue was purified by high pressure liquid
chromatography on a strong anion exchange column (GE Healthcare
Bioscience, Source 30Q, 30 .mu.m, 2.54.times.8 cm, A=100 mM
ammonium acetate in 30% aqueous CH.sub.3CN, B=1.5 M NaBr in A,
0-40% of B in 60 min, flow 14 mL min-1, .lamda.=260 nm). The
residue was desalted by HPLC on a reverse phase column to yield the
desired ASOs in an isolated yield of 15-30% based on the initial
loading on the solid support. The ASOs were characterized by
ion-pair-HPLC coupled MS analysis with Agilent 1100 MSD system.
[0695] Antisense oligonucleotides not comprising a conjugate were
synthesized using standard oligonucleotide synthesis procedures
well known in the art.
[0696] Using these methods, three separate antisense compounds
targeting ApoC III were prepared. As summarized in Table 4, below,
each of the three antisense compounds targeting ApoC III had the
same nucleobase sequence; ISIS 304801 is a 5-10-5 MOE gapmer having
all phosphorothioate linkages; ISIS 647535 is the same as ISIS
304801, except that it had a GalNAc.sub.3-1 conjugated at its
3'end; and ISIS 647536 is the same as ISIS 647535 except that
certain internucleoside linkages of that compound are
phosphodiester linkages. As further summarized in Table 4, two
separate antisense compounds targeting SRB-1 were synthesized. ISIS
440762 was a 2-10-2 cEt gapmer with all phosphorothioate
internucleoside linkages; ISIS 651900 is the same as ISIS 440762,
except that it included a GalNAc.sub.3-1 at its 3'-end.
TABLE-US-00004 TABLE 4 Modified ASO targeting ApoC III and SRB-1
SEQ CalCd Observed ID ASO Sequence (5' to 3') Target Mass Mass No.
ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC-
.sub.dsT.sub.esT.sub.esT.sub.esA.sub.esT.sub.e ApoC 7165.4 7164.4
20 304801 III ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC-
.sub.dsT.sub.esT.sub.esT.sub.esA.sub.es ApoC 9239.5 9237.8 21
647535 III ISIS
A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC-
.sub.dsT.sub.eoT.sub.eoT.sub.esA.sub.es ApoC 9142.9 9140.8 21
647536 III ISIS
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT-
.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
SRB-1 4647.0 4646.4 22 440762 ISIS
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG-
.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ko SRB-1
6721.1 6719.4 23 651900 Subscripts: "e" indicates 2'-MOE modified
nucleoside; "d" indicates .beta.-D-2'-deoxyribonucleoside; "k"
indicates 6'-(S)-CH.sub.3 bicyclic nucleoside (e.g. cEt); "s"
indicates phosphorothioate internucleoside linkages (PS); "o```
indicates phosphodiester internucleoside linkages (PO); and "o"
indicates --O--P(.dbd.O)(OH)--. Superscript "m" indicates
5-methylcytosines. " " indicates a conjugate group having the
structure shown previously in Example 9. Note that comprises a
cleavable adenosine which links the ASO to remainder of the
conjugate, which is designated " ." This nomenclature is used in
the above table to show the full nucleobase sequence, including the
adenosine, which is part of the conjugate. Thus, in the above
table, the sequences could also be listed as ending with " " with
the "A.sub.do" omitted. This convention of using the subscript "a"
to indicate the portion of a conjugate group lacking a cleavable
nucleoside or cleavable moiety is used throughout these Examples.
This portion of a conjugate group lacking the cleavable moiety is
referred to herein as a "cluster" or "conjugate cluster" or
"GalNAc.sub.3 cluster." In certain instances it is convenient to
describe a conjugate group by separately providing its cluster and
its cleavable moiety.
Example 20: Dose-Dependent Antisense Inhibition of Human ApoC III
in huApoC III Transgenic Mice
[0697] ISIS 304801 and ISIS 647535, each targeting human ApoC III
and described above, were separately tested and evaluated in a
dose-dependent study for their ability to inhibit human ApoC III in
human ApoC III transgenic mice.
Treatment
[0698] Human ApoCIII transgenic mice were maintained on a 12-hour
light/dark cycle and fed ad libitum Teklad lab chow. Animals were
acclimated for at least 7 days in the research facility before
initiation of the experiment. ASOs were prepared in PBS and
sterilized by filtering through a 0.2 micron filter. ASOs were
dissolved in 0.9% PBS for injection.
[0699] Human ApoC III transgenic mice were injected
intraperitoneally once a week for two weeks with ISIS 304801 or
647535 at 0.08, 0.25. 0.75, 2.25 or 6.75 .mu.mol/kg or with PBS as
a control. Each treatment group consisted of 4 animals. Forty-eight
hours after the administration of the last dose, blood was drawn
from each mouse and the mice were sacrificed and tissues were
collected.
ApoC HI mRNA Analysis
[0700] ApoC III mRNA levels in the mice's livers were determined
using real-time PCR and RIBOGREEN.RTM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.) according to standard
protocols. ApoC III mRNA levels were determined relative to total
RNA (using Ribogreen), prior to normalization to PBS-treated
control. The results below are presented as the average percent of
ApoC III mRNA levels for each treatment group, normalized to
PBS-treated control and are denoted as "% PBS". The half maximal
effective dosage (ED.sub.50) of each ASO is also presented in Table
5, below.
[0701] As illustrated, both antisense compounds reduced ApoC III
RNA relative to the PBS control. Further, the antisense compound
conjugated to GalNAc.sub.3-1 (ISIS 647535) was substantially more
potent than the antisense compound lacking the GalNAc.sub.3-1
conjugate (ISIS 304801).
TABLE-US-00005 TABLE 5 Effect of ASO treatment on ApoC III mRNA
levels in human ApoC III transgenic mice SEQ Dose % ED.sub.50 3'
Internucleoside ID ASO (.mu.mol/kg) PBS (.mu.mol/kg) Conjugate
Linkage/Length No. PBS 0 100 -- -- -- ISIS 0.08 95 0.77 None PS/20
20 304801 0.75 42 2.25 32 6.75 19 ISIS 0.08 50 0.074 GalNAc.sub.3-1
PS/20 21 647535 0.75 15 2.25 17 6.75 8
ApoC III Protein Analysis (Turbidometric Assay)
[0702] Plasma ApoC III protein analysis was determined using
procedures reported by Graham et al, Circulation Research,
published online before print Mar. 29, 2013.
[0703] Approximately 100 .mu.l of plasma isolated from mice was
analyzed without dilution using an Olympus Clinical Analyzer and a
commercially available turbidometric ApoC III assay (Kamiya, Cat
#KAI-006, Kamiya Biomedical, Seattle, Wash.). The assay protocol
was performed as described by the vendor.
[0704] As shown in the Table 6 below, both antisense compounds
reduced ApoC III protein relative to the PBS control. Further, the
antisense compound conjugated to GalNAc.sub.3-1 (ISIS 647535) was
substantially more potent than the antisense compound lacking the
GalNAc.sub.3-1 conjugate (ISIS 304801).
TABLE-US-00006 TABLE 6 Effect of ASO treatment on ApoC III plasma
protein levels in human ApoC III transgenic mice SEQ Dose %
ED.sub.50 3' Internucleoside ID ASO (.mu.mol/kg) PBS (.mu.mol/kg)
Conjugate Linkage/Length No. PBS 0 100 -- -- -- ISIS 0.08 86 0.73
None PS/20 20 304801 0.75 51 2.25 23 6.75 13 ISIS 0.08 72 0.19
GalNAc.sub.3-1 PS/20 21 647535 0.75 14 2.25 12 6.75 11
[0705] Plasma triglycerides and cholesterol were extracted by the
method of Bligh and Dyer (Bligh, E. G. and Dyer, W. J. Can. J.
Biochem. Physiol. 37: 911-917, 1959)(Bligh, E and Dyer, W, Can J
Biochem Physiol, 37, 911-917, 1959) (Bligh, E and Dyer, W, Can J
Biochem Physiol, 37, 911-917, 1959) and measured by using a
Beckmann Coulter clinical analyzer and commercially available
reagents.
[0706] The triglyceride levels were measured relative to PBS
injected mice and are denoted as "% PBS". Results are presented in
Table 7. As illustrated, both antisense compounds lowered
triglyceride levels. Further, the antisense compound conjugated to
GalNAc.sub.3-1 (ISIS 647535) was substantially more potent than the
antisense compound lacking the GalNAc.sub.3-1 conjugate (ISIS
304801).
TABLE-US-00007 TABLE 7 Effect of ASO treatment on triglyceride
levels in transgenic mice SEQ Dose % ED50 3' Internucleoside ID ASO
(.mu.mol/kg) PBS (.mu.mol/kg) Conjugate Linkage/Length No. PBS 0
100 -- -- -- ISIS 0.08 87 0.63 None PS/20 20 304801 0.75 46 2.25 21
6.75 12 ISIS 0.08 65 0.13 GalNAc.sub.3-1 PS/20 21 647535 0.75 9
2.25 8 6.75 9
[0707] Plasma samples were analyzed by HPLC to determine the amount
of total cholesterol and of different fractions of cholesterol (HDL
and LDL). Results are presented in Tables 8 and 9. As illustrated,
both antisense compounds lowered total cholesterol levels; both
lowered LDL; and both raised HDL. Further, the antisense compound
conjugated to GalNAc.sub.3-1 (ISIS 647535) was substantially more
potent than the antisense compound lacking the GalNAc.sub.3-1
conjugate (ISIS 304801). An increase in HDL and a decrease in LDL
levels is a cardiovascular beneficial effect of antisense
inhibition of ApoC III.
TABLE-US-00008 TABLE 8 Effect of ASO treatment on total cholesterol
levels in transgenic mice Total Dose Cholesterol 3' Internucleoside
SEQ ASO (.mu.mol/kg) (mg/dL) Conjugate Linkage/Length ID No. PBS 0
257 -- -- ISIS 0.08 226 None PS/20 20 304801 0.75 164 2.25 110 6.75
82 ISIS 0.08 230 GalNAc.sub.3-1 PS/20 21 647535 0.75 82 2.25 86
6.75 99
TABLE-US-00009 TABLE 9 Effect of ASO treatment on HDL and LDL
cholesterol levels in transgenic mice SEQ Dose HDL LDL 3'
Internucleoside ID ASO (.mu.mol/kg) (mg/dL) (mg/dL) Conjugate
Linkage/Length No. PBS 0 17 28 -- -- ISIS 0.08 17 23 None PS/20 32
304801 0.75 27 12 2.25 50 4 6.75 45 2 ISIS 0.08 21 21
GalNAc.sub.3-1 PS/20 111 647535 0.75 44 2 2.25 50 2 6.75 58 2
Pharmacokinetics Analysis (PK)
[0708] The PK of the ASOs was also evaluated. Liver and kidney
samples were minced and extracted using standard protocols. Samples
were analyzed on MSD1 utilizing IP-HPLC-MS. The tissue level (nig)
of full-length ISIS 304801 and 647535 was measured and the results
are provided in Table 10. As illustrated, liver concentrations of
total full-length antisense compounds were similar for the two
antisense compounds. Thus, even though the
GalNAc.sub.3-1-conjugated antisense compound is more active in the
liver (as demonstrated by the RNA and protein data above), it is
not present at substantially higher concentration in the liver.
Indeed, the calculated EC.sub.50 (provided in Table 10) confirms
that the observed increase in potency of the conjugated compound
cannot be entirely attributed to increased accumulation. This
result suggests that the conjugate improved potency by a mechanism
other than liver accumulation alone, possibly by improving the
productive uptake of the antisense compound into cells.
[0709] The results also show that the concentration of
GalNAc.sub.3-1 conjugated antisense compound in the kidney is lower
than that of antisense compound lacking the GalNAc conjugate. This
has several beneficial therapeutic implications. For therapeutic
indications where activity in the kidney is not sought, exposure to
kidney risks kidney toxicity without corresponding benefit.
Moreover, high concentration in kidney typically results in loss of
compound to the urine resulting in faster clearance. Accordingly,
for non-kidney targets, kidney accumulation is undesired. These
data suggest that GalNAc.sub.3-1 conjugation reduces kidney
accumulation.
TABLE-US-00010 TABLE 10 PK analysis of ASO treatment in transgenic
mice Dose Liver Kidney Liver EC.sub.50 Internucleoside SEQ ASO
(.mu.mol/kg) (.mu.g/g) (.mu.g/g) (.mu.g/g) 3' Conjugate
Linkage/Length ID No. ISIS 0.1 5.2 2.1 53 None PS/20 20 304801 0.8
62.8 119.6 2.3 142.3 191.5 6.8 202.3 337.7 ISIS 0.1 3.8 0.7 3.8
GalNAc.sub.3-1 PS/20 21 647535 0.8 72.7 34.3 2.3 106.8 111.4 6.8
237.2 179.3
[0710] Metabolites of ISIS 647535 were also identified and their
masses were confirmed by high resolution mass spectrometry
analysis. The cleavage sites and structures of the observed
metabolites are shown below. The relative % of full length ASO was
calculated using standard procedures and the results are presented
in Table 10a. The major metabolite of ISIS 647535 was full-length
ASO lacking the entire conjugate (i.e. ISIS 304801), which results
from cleavage at cleavage site A, shown below. Further, additional
metabolites resulting from other cleavage sites were also observed.
These results suggest that introducing other cleabable bonds such
as esters, peptides, disulfides, phosphoramidates or
acyl-hydrazones between the GalNAc.sub.3-1 sugar and the ASO, which
can be cleaved by enzymes inside the cell, or which may cleave in
the reductive environment of the cytosol, or which are labile to
the acidic pH inside endosomes and lyzosomes, can also be
useful.
TABLE-US-00011 TABLE 10a Observed full length metabolites of ISIS
647535 Cleavage Relative Metabolite ASO site % 1 ISIS 304801 A 36.1
2 ISIS 304801 + dA B 10.5 3 ISIS 647535 minus [3 GalNAc] C 16.1 4
ISIS 647535 minus D 17.6 [3 GalNAc + 1 5-hydroxy-pentanoic acid
tether] 5 ISIS 647535 minus D 9.9 [2 GalNAc + 2 5-hydroxy-pentanoic
acid tether] 6 ISIS 647535 minus D 9.8 [3 GalNAc + 3
5-hydroxy-pentanoic acid tether] ##STR00148## ##STR00149##
##STR00150## ##STR00151## ##STR00152## ##STR00153##
##STR00154##
Example 21: Antisense Inhibition of Human ApoC III in Human ApoC
III Transgenic Mice in Single Administration Study
[0711] ISIS 304801, 647535 and 647536 each targeting human ApoC III
and described in Table 4, were further evaluated in a single
administration study for their ability to inhibit human ApoC III in
human ApoC III transgenic mice.
Treatment
[0712] Human ApoCIII transgenic mice were maintained on a 12-hour
light/dark cycle and fed ad libitum Teklad lab chow. Animals were
acclimated for at least 7 days in the research facility before
initiation of the experiment. ASOs were prepared in PBS and
sterilized by filtering through a 0.2 micron filter. ASOs were
dissolved in 0.9% PBS for injection.
[0713] Human ApoC III transgenic mice were injected
intraperitoneally once at the dosage shown below with ISIS 304801,
647535 or 647536 (described above) or with PBS treated control. The
treatment group consisted of 3 animals and the control group
consisted of 4 animals. Prior to the treatment as well as after the
last dose, blood was drawn from each mouse and plasma samples were
analyzed. The mice were sacrificed 72 hours following the last
administration.
[0714] Samples were collected and analyzed to determine the ApoC
III mRNA and protein levels in the liver; plasma triglycerides; and
cholesterol, including HDL and LDL fractions were assessed as
described above (Example 20). Data from those analyses are
presented in Tables 11-15, below. Liver transaminase levels,
alanine aminotransferase (ALT) and aspartate aminotransferase
(AST), in serum were measured relative to saline injected mice
using standard protocols. The ALT and AST levels showed that the
antisense compounds were well tolerated at all administered
doses.
[0715] These results show improvement in potency for antisense
compounds comprising a GalNAc.sub.3-1 conjugate at the 3' terminus
(ISIS 647535 and 647536) compared to the antisense compound lacking
a GalNAc.sub.3-1 conjugate (ISIS 304801). Further, ISIS 647536,
which comprises a GalNAc.sub.3-1 conjugate and some phosphodiester
linkages was as potent as ISIS 647535, which comprises the same
conjugate and all internucleoside linkages within the ASO are
phosphorothioate.
TABLE-US-00012 TABLE 11 Effect of ASO treatment on ApoC III mRNA
levels in human ApoC III transgenic mice SEQ Dose ED50 3'
Internucleoside ID ASO (mg/kg) % PBS (mg/kg) Conjugate
linkage/Length No. PBS 0 99 -- -- -- ISIS 1 104 13.2 None PS/20 20
304801 3 92 10 71 30 40 ISIS 0.3 98 1.9 GalNAc.sub.3-1 PS/20 21
647535 1 70 3 33 10 20 ISIS 0.3 103 1.7 GalNAc.sub.3-1 PS/PO/20 21
647536 1 60 3 31 10 21
TABLE-US-00013 TABLE 12 Effect of ASO treatment on ApoC III plasma
protein levels in human ApoC III transgenic mice Dose % ED.sub.50
3' Internucleoside SEQ ASO (mg/kg) PBS (mg/kg) Conjugate
Linkage/Length ID No. PBS 0 99 -- -- -- ISIS 1 104 23.2 None PS/20
20 304801 3 92 10 71 30 40 ISIS 0.3 98 2.1 GalNAc.sub.3- PS/20 21
647535 1 70 1 3 33 10 20 ISIS 0.3 103 1.8 GalNAc.sub.3- PS/PO/20 21
647536 1 60 1 3 31 10 21
TABLE-US-00014 TABLE 13 Effect of ASO treatment on triglyceride
levels in transgenic mice Dose % ED.sub.50 3' Internucleoside SEQ
ASO (mg/kg) PBS (mg/kg) Conjugate Linkage/Length ID No. PBS 0 98 --
-- -- ISIS 1 80 29.1 None PS/20 20 304801 3 92 10 70 30 47 ISIS 0.3
100 2.2 GalNAc.sub.3-1 PS/20 21 647535 1 70 3 34 10 23 ISIS 0.3 95
1.9 GaINAc.sub.3-1 PS/PO/20 21 647536 1 66 3 31 10 23
TABLE-US-00015 TABLE 14 Effect of ASO treatment on total
cholesterol levels in transgenic mice Dose Internucleoside ASO
(mg/kg) % PBS 3' Conjugate Linkage/Length SEQ ID No. PBS 0 96 -- --
ISIS 1 104 None PS/20 20 304801 3 96 10 86 30 72 ISIS 0.3 93
GalNAc.sub.3-1 PS/20 21 647535 1 85 3 61 10 53 ISIS 0.3 115
GalNAc.sub.3-1 PS/PO/20 21 647536 1 79 3 51 10 54
TABLE-US-00016 TABLE 15 Effect of ASO treatment on HDL and LDL
cholesterol levels in transgenic mice Dose HDL LDL 3'
Internucleoside SEQ ASO (mg/kg) % PBS % PBS Conjugate
Linkage/Length ID No. PBS 0 131 90 -- -- ISIS 1 130 72 None PS/20
20 304801 3 186 79 10 226 63 30 240 46 ISIS 0.3 98 86 GalNAc.sub.3-
PS/20 21 647535 1 214 67 1 3 212 39 10 218 35 ISIS 0.3 143 89
GalNAc.sub.3- PS/PO/20 21 647536 1 187 56 1 3 213 33 10 221 34
[0716] These results confirm that the GalNAc.sub.3-1 conjugate
improves potency of an antisense compound. The results also show
equal potency of a GalNAc.sub.3-1 conjugated antisense compounds
where the antisense oligonucleotides have mixed linkages (ISIS
647536 which has six phosphodiester linkages) and a full
phosphorothioate version of the same antisense compound (ISIS
647535).
[0717] Phosphorothioate linkages provide several properties to
antisense compounds. For example, they resist nuclease digestion
and they bind proteins resulting in accumulation of compound in the
liver, rather than in the kidney/urine. These are desirable
properties, particularly when treating an indication in the liver.
However, phosphorothioate linkages have also been associated with
an inflammatory response. Accordingly, reducing the number of
phosphorothioate linkages in a compound is expected to reduce the
risk of inflammation, but also lower concentration of the compound
in liver, increase concentration in the kidney and urine, decrease
stability in the presence of nucleases, and lower overall potency.
The present results show that a GalNAc.sub.3-1 conjugated antisense
compound where certain phosphorothioate linkages have been replaced
with phosphodiester linkages is as potent against a target in the
liver as a counterpart having full phosphorothioate linkages. Such
compounds are expected to be less proinflammatory (See Example 24
describing an experiment showing reduction of PS results in reduced
inflammatory effect).
Example 22: Effect of GalNAc.sub.3-1 Conjugated Modified ASO
Targeting SRB-1 In Vivo
[0718] ISIS 440762 and 651900, each targeting SRB-1 and described
in Table 4, were evaluated in a dose-dependent study for their
ability to inhibit SRB-1 in Balb/c mice.
Treatment
[0719] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 440762, 651900 or with PBS treated control. Each
treatment group consisted of 4 animals. The mice were sacrificed 48
hours following the final administration to determine the SRB-1
mRNA levels in liver using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. SRB-1 mRNA levels were determined
relative to total RNA (using Ribogreen), prior to normalization to
PBS-treated control. The results below are presented as the average
percent of SRB-1 mRNA levels for each treatment group, normalized
to PBS-treated control and is denoted as "% PBS".
[0720] As illustrated in Table 16, both antisense compounds lowered
SRB-1 mRNA levels. Further, the antisense compound comprising the
GalNAc.sub.3-1 conjugate (ISIS 651900) was substantially more
potent than the antisense compound lacking the GalNAc.sub.3-1
conjugate (ISIS 440762). These results demonstrate that the potency
benefit of GalNAc.sub.3-1 conjugates are observed using antisense
oligonucleotides complementary to a different target and having
different chemically modified nucleosides, in this instance
modified nucleosides comprise constrained ethyl sugar moieties (a
bicyclic sugar moiety).
TABLE-US-00017 TABLE 16 Effect of ASO treatment on SRB-1 mRNA
levels in Balb/c mice Dose Liver ED.sub.50 3' Internucleoside SEQ
ASO (mg/kg) % PBS (mg/kg) Conjugate linkage/Length ID No. PBS 0 100
-- -- ISIS 0.7 85 2.2 None PS/14 22 440762 2 55 7 12 20 3 ISIS 0.07
98 0.3 GalNAc.sub.3- PS/14 23 651900 0.2 63 1 0.7 20 2 6 7 5
Example 23: Human Peripheral Blood Mononuclear Cells (hPBMC) Assay
Protocol
[0721] The hPBMC assay was performed using BD Vautainer CPT tube
method. A sample of whole blood from volunteered donors with
informed consent at US HealthWorks clinic (Faraday & El Camino
Real, Carlsbad) was obtained and collected in 4-15 BD Vacutainer
CPT 8 ml tubes (VWR Cat #BD362753). The approximate starting total
whole blood volume in the CPT tubes for each donor was recorded
using the PBMC assay data sheet.
[0722] The blood sample was remixed immediately prior to
centrifugation by gently inverting tubes 8-10 times. CPT tubes were
centrifuged at rt (18-25.degree. C.) in a horizontal (swing-out)
rotor for 30 min. at 1500-1800 RCF with brake off (2700 RPM Beckman
Allegra 6R). The cells were retrieved from the buffy coat interface
(between Ficoll and polymer gel layers); transferred to a sterile
50 ml conical tube and pooled up to 5 CPT tubes/50 ml conical
tube/donor. The cells were then washed twice with PBS (Ca.sup.++,
Mg.sup.++ free; GIBCO). The tubes were topped up to 50 ml and mixed
by inverting several times. The sample was then centrifuged at
330.times.g for 15 minutes at rt (1215 RPM in Beckman Allegra 6R)
and aspirated as much supernatant as possible without disturbing
pellet. The cell pellet was dislodged by gently swirling tube and
resuspended cells in RPMI+10% FBS+pen/strep (.about.1 ml/10 ml
starting whole blood volume). A 60 .mu.l sample was pipette into a
sample vial (Beckman Coulter) with 600 .mu.l VersaLyse reagent
(Beckman Coulter Cat #A09777) and was gently vortexed for 10-15
sec. The sample was allowed to incubate for 10 min. at rt and being
mixed again before counting. The cell suspension was counted on
Vicell XR cell viability analyzer (Beckman Coulter) using PBMC cell
type (dilution factor of 1:11 was stored with other parameters).
The live cell/ml and viability were recorded. The cell suspension
was diluted to 1.times.10.sup.7 live PBMC/ml in RPMI+10%
FBS+pen/strep.
[0723] The cells were plated at 5.times.10.sup.5 in 50 .mu.l/well
of 96-well tissue culture plate (Falcon Microtest). 50 .mu.l/well
of 2.times. concentration oligos/controls diluted in RPMI+10%
FBS+pen/strep. was added according to experiment template (100
.mu.l/well total). Plates were placed on the shaker and allowed to
mix for approx. 1 min. After being incubated for 24 hrs at
37.degree. C.; 5% CO.sub.2, the plates were centrifuged at
400.times.g for 10 minutes before removing the supernatant for MSD
cytokine assay (i.e. human IL-6, IL-10, IL-8 and MCP-1).
Example 24: Evaluation of Proinflammatory Effects in hPBMC Assay
for GalNAc.sub.3-1 Conjugated ASOs
[0724] The antisense oligonucleotides (ASOs) listed in Table 17
were evaluated for proinflammatory effect in hPBMC assay using the
protocol described in Example 23. ISIS 353512 is an internal
standard known to be a high responder for IL-6 release in the
assay. The hPBMCs were isolated from fresh, volunteered donors and
were treated with ASOs at 0, 0.0128, 0.064, 0.32, 1.6, 8, 40 and
200 .mu.M concentrations. After a 24 hr treatment, the cytokine
levels were measured.
[0725] The levels of IL-6 were used as the primary readout. The
EC.sub.50 and E.sub.max was calculated using standard procedures.
Results are expressed as the average ratio of E.sub.max/EC.sub.50
from two donors and is denoted as "E.sub.max/EC.sub.50." The lower
ratio indicates a relative decrease in the proinflammatory response
and the higher ratio indicates a relative increase in the
proinflammatory response.
[0726] With regard to the test compounds, the least proinflammatory
compound was the PS/PO linked ASO (ISIS 616468). The GalNAc.sub.3-1
conjugated ASO, ISIS 647535 was slightly less proinflammatory than
its non-conjugated counterpart ISIS 304801. These results indicate
that incorporation of some PO linkages reduces proinflammatory
reaction and addition of a GalNAc.sub.3-1 conjugate does not make a
compound more proinflammatory and may reduce proinflammatory
response. Accordingly, one would expect that an antisense compound
comprising both mixed PS/PO linkages and a GalNAc.sub.3-1 conjugate
would produce lower proinflammatory responses relative to full PS
linked antisense compound with or without a GalNAc.sub.3-1
conjugate. These results show that GalNAc.sub.3-1 conjugated
antisense compounds, particularly those having reduced PS content
are less proinflammatory.
[0727] Together, these results suggest that a GalNAc.sub.3-1
conjugated compound, particularly one with reduced PS content, can
be administered at a higher dose than a counterpart full PS
antisense compound lacking a GalNAc.sub.3-1 conjugate. Since
half-life is not expected to be substantially different for these
compounds, such higher administration would result in less frequent
dosing. Indeed such administration could be even less frequent,
because the GalNAc.sub.3-1 conjugated compounds are more potent
(See Examples 20-22) and re-dosing is necessary once the
concentration of a compound has dropped below a desired level,
where such desired level is based on potency.
TABLE-US-00018 TABLE 17 Modified ASOs SEQ ID ASO Sequence (5' to
3') Target No. ISIS
G.sub.es.sup.mC.sub.esT.sub.esG.sub.esA.sub.esT.sub.dsT.sub.dsA.sub.d-
sG.sub.dsA.sub.dsG.sub.ds TNF.alpha. 24 104838
A.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.esT.sub.es.sup.mC.sub.es.sup.-
mC.sub.es.sup.mC.sub.e ISIS
T.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsT.sub.dsT.s-
ub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds CRP 25 353512
G.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.e-
sG.sub.esG.sub.e ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds ApoC III 20 304801
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.esT-
.sub.esT.sub.esA.sub.esT.sub.e ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds ApoC III 21 647535
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.esT-
.sub.esT.sub.esA.sub.esT.sub.eo ISIS
A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.dsT.sub.asT-
.sub.dsG.sub.dsT.sub.ds ApoC III 20 616468
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoT-
.sub.eoT.sub.esA.sub.esT.sub.e Subscripts: "e" indicates 2'-MOE
modified nucleoside; "d" indicates .beta.-D-2'-deoxyribonucleoside;
"k" indicates 6'-(S)-CH.sub.3 bicyclic nucleoside (e.g. cEt); "s"
indicates phosphorothioate internucleoside linkages (PS); "o"
indicates phosphodiester internucleoside linkages (PO); and "o```
indicates --O--P(.dbd.O)(OH)--. Superscript "m" indicates
5-methylcytosines. " " indicates a conjugate having the structure
shown in Example 9 attached to the 3'-end of the antisense
oligonucleotide, as indicated.
TABLE-US-00019 TABLE 18 Proinflammatory Effect of ASOs targeting
ApoC III in hPBMC assay Inter- nucleoside EC.sub.50 E.sub.max
E.sub.max/ 3' Linkage/ SEQ ASO (.mu.M) (.mu.M) EC.sub.50 Conjugate
Length ID No. ISIS 353512 0.01 265.9 26,590 None PS/20 25 (high
responder) ISIS 304801 0.07 106.55 1,522 None PS/20 20 ISIS 647535
0.12 138 1,150 GalNAc.sub.3-1 PS/20 21 ISIS 616468 0.32 71.52 224
None PS/PO/20 20
Example 25: Effect of GalNAc.sub.3-1 Conjugated Modified ASO
Targeting Human ApoC III In Vitro
[0728] ISIS 304801 and 647535 described above were tested in vitro.
Primary hepatocyte cells from transgenic mice at a density of
25,000 cells per well were treated with 0.03, 0.08, 0.24, 0.74,
2.22, 6.67 and 20 .mu.M concentrations of modified
oligonucleotides. After a treatment period of approximately 16
hours, RNA was isolated from the cells and mRNA levels were
measured by quantitative real-time PCR and the hApoC III mRNA
levels were adjusted according to total RNA content, as measured by
RIBOGREEN.
[0729] The IC.sub.50 was calculated using the standard methods and
the results are presented in Table 19. As illustrated, comparable
potency was observed in cells treated with ISIS 647535 as compared
to the control, ISIS 304801.
TABLE-US-00020 TABLE 19 Modified ASO targeting human ApoC III in
primary hepatocytes Internucleoside SEQ ASO IC.sub.50 (.mu.M) 3'
Conjugate linkage/Length ID No. ISIS 0.44 None PS/20 20 304801 ISIS
0.31 GalNAc.sub.3-1 PS/20 21 647535
[0730] In this experiment, the large potency benefits of
GalNAc.sub.3-1 conjugation that are observed in vivo were not
observed in vitro. Subsequent free uptake experiments in primary
hepatocytes in vitro did show increased potency of oligonucleotides
comprising various GalNAc conjugates relative to oligonucleotides
that lacking the GalNAc conjugate. (see Examples 60, 82, and
92)
Example 26: Effect of PO/PS Linkages on ApoC III ASO Activity
[0731] Human ApoC III transgenic mice were injected
intraperitoneally once at 25 mg/kg of ISIS 304801, or ISIS 616468
(both described above) or with PBS treated control once per week
for two weeks. The treatment group consisted of 3 animals and the
control group consisted of 4 animals. Prior to the treatment as
well as after the last dose, blood was drawn from each mouse and
plasma samples were analyzed. The mice were sacrificed 72 hours
following the last administration.
[0732] Samples were collected and analyzed to determine the ApoC
III protein levels in the liver as described above (Example 20).
Data from those analyses are presented in Table 20, below.
[0733] These results show reduction in potency for antisense
compounds with PO/PS (ISIS 616468) in the wings relative to full PS
(ISIS 304801).
TABLE-US-00021 TABLE 20 Effect of ASO treatment on ApoC III protein
levels in human ApoC III transgenic mice Dose Internucleoside SEQ
ID ASO (mg/kg) % PBS 3' Conjugate linkage/Length No. PBS 0 99 -- --
ISIS 25 24 None Full PS 20 304801 mg/kg/wk for 2 wks ISIS 25 40
None 14 PS/6 PO 20 616468 mg/kg/wk for 2 wks
Example 27: Compound 56
##STR00155##
[0735] Compound 56 is commercially available from Glen Research or
may be prepared according to published procedures reported by
Shchepinov et al., Nucleic Acids Research, 1997, 25(22),
4447-4454.
Example 28: Preparation of Compound 60
##STR00156##
[0737] Compound 4 was prepared as per the procedures illustrated in
Example 2. Compound 57 is commercially available. Compound 60 was
confirmed by structural analysis.
[0738] Compound 57 is meant to be representative and not intended
to be limiting as other monoprotected substituted or unsubstituted
alkyl diols including but not limited to those presented in the
specification herein can be used to prepare phosphoramidites having
a predetermined composition.
Example 29: Preparation of Compound 63
##STR00157##
[0740] Compounds 61 and 62 are prepared using procedures similar to
those reported by Tober et al., Eur. Org. Chem., 2013, 3, 566-577;
and Jiang et al., Tetrahedron, 2007, 63(19), 3982-3988.
[0741] Alternatively, Compound 63 is prepared using procedures
similar to those reported in scientific and patent literature by
Kim et al., Synlett, 2003, 12, 1838-1840; and Kim et al., published
PCT International Application, WO 2004063208.
Example 30: Preparation of Compound 63b
##STR00158##
[0743] Compound 63a is prepared using procedures similar to those
reported by Hanessian et al., Canadian Journal of Chemistry, 1996,
74(9), 1731-1737.
Example 31: Preparation of Compound 63d
##STR00159##
[0745] Compound 63c is prepared using procedures similar to those
reported by Chen et al., Chinese Chemical Letters, 1998, 9(5),
451-453.
Example 32: Preparation of Compound 67
##STR00160##
[0747] Compound 64 was prepared as per the procedures illustrated
in Example 2. Compound 65 is prepared using procedures similar to
those reported by Or et al., published PCT International
Application, WO 2009003009. The protecting groups used for Compound
65 are meant to be representative and not intended to be limiting
as other protecting groups including but not limited to those
presented in the specification herein can be used.
Example 33: Preparation of Compound 70
##STR00161##
[0749] Compound 64 was prepared as per the procedures illustrated
in Example 2. Compound 68 is commercially available. The protecting
group used for Compound 68 is meant to be representative and not
intended to be limiting as other protecting groups including but
not limited to those presented in the specification herein can be
used.
Example 34: Preparation of Compound 75a
##STR00162##
[0751] Compound 75 is prepared according to published procedures
reported by Shchepinov et al., Nucleic Acids Research, 1997,
25(22), 4447-4454.
Example 35: Preparation of Compound 79
##STR00163##
[0753] Compound 76 was prepared according to published procedures
reported by Shchepinov et al., Nucleic Acids Research, 1997,
25(22), 4447-4454.
Example 36: Preparation of Compound 79a
##STR00164##
[0755] Compound 77 is prepared as per the procedures illustrated in
Example 35.
Example 37: General Method for the Preparation of Conjugated
Oligomeric Compound 82 Comprising a Phosphodiester Linked
GalNAc.sub.3-2 Conjugate at 5' Terminus Via Solid Support (Method
I)
##STR00165## ##STR00166##
[0756] wherein GalNAc.sub.3-2 has the structure:
##STR00167##
[0757] The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-2 (GalNAc.sub.3-2.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. Wherein
GalNAc.sub.3-2.sub.a has the formula:
##STR00168##
[0758] The VIMAD-bound oligomeric compound 79b was prepared using
standard procedures for automated DNA/RNA synthesis (see Dupouy et
al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). The
phosphoramidite Compounds 56 and 60 were prepared as per the
procedures illustrated in Examples 27 and 28, respectively. The
phosphoramidites illustrated are meant to be representative and not
intended to be limiting as other phosphoramidite building blocks
including but not limited those presented in the specification
herein can be used to prepare an oligomeric compound having a
phosphodiester linked conjugate group at the 5' terminus. The order
and quantity of phosphoramidites added to the solid support can be
adjusted to prepare the oligomeric compounds as described herein
having any predetermined sequence and composition.
Example 38: Alternative Method for the Preparation of Oligomeric
Compound 82 Comprising a Phosphodiester Linked GalNAc.sub.3-2
Conjugate at 5' Terminus (Method II)
##STR00169##
[0760] The VIMAD-bound oligomeric compound 79b was prepared using
standard procedures for automated DNA/RNA synthesis (see Dupouy et
al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). The
GalNAc.sub.3-2 cluster phosphoramidite, Compound 79 was prepared as
per the procedures illustrated in Example 35. This alternative
method allows a one-step installation of the phosphodiester linked
GalNAc.sub.3-2 conjugate to the oligomeric compound at the final
step of the synthesis. The phosphoramidites illustrated are meant
to be representative and not intended to be limiting, as other
phosphoramidite building blocks including but not limited to those
presented in the specification herein can be used to prepare
oligomeric compounds having a phosphodiester conjugate at the 5'
terminus. The order and quantity of phosphoramidites added to the
solid support can be adjusted to prepare the oligomeric compounds
as described herein having any predetermined sequence and
composition.
Example 39: General Method for the Preparation of Oligomeric
Compound 83h Comprising a GalNAc.sub.3-3 Conjugate at the 5'
Terminus (GalNAc.sub.3-1 Modified for 5' End Attachment) Via Solid
Support
##STR00170## ##STR00171## ##STR00172##
[0762] Compound 18 was prepared as per the procedures illustrated
in Example 4. Compounds 83a and 83b are commercially available.
Oligomeric Compound 83e comprising a phosphodiester linked
hexylamine was prepared using standard oligonucleotide synthesis
procedures. Treatment of the protected oligomeric compound with
aqueous ammonia provided the 5'-GalNAc.sub.3-3 conjugated
oligomeric compound (83h).
[0763] Wherein GalNAc.sub.3-3 has the structure:
##STR00173##
[0764] The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-3 (GalNAc.sub.3-3.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. Wherein
GalNAc.sub.3-3.sub.a has the formula:
##STR00174##
Example 40: General Method for the Preparation of Oligomeric
Compound 89 Comprising a Phosphodiester Linked GalNAc.sub.3-4
Conjugate at the 3' Terminus Via Solid Support
##STR00175## ##STR00176## ##STR00177##
[0765] Wherein GalNAc.sub.3-4 has the structure:
##STR00178##
[0766] Wherein CM is a cleavable moiety. In certain embodiments,
cleavable moiety is:
##STR00179##
[0767] The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-4 (GalNAc.sub.3-4.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. Wherein
GalNAc.sub.3-4.sub.a has the formula:
##STR00180##
[0768] The protected Unylinker functionalized solid support
Compound 30 is commercially available. Compound 84 is prepared
using procedures similar to those reported in the literature (see
Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454;
Shchepinov et al., Nucleic Acids Research, 1999, 27, 3035-3041; and
Hornet et al., Nucleic Acids Research, 1997, 25, 4842-4849).
[0769] The phosphoramidite building blocks, Compounds 60 and 79a
are prepared as per the procedures illustrated in Examples 28 and
36. The phosphoramidites illustrated are meant to be representative
and not intended to be limiting as other phosphoramidite building
blocks can be used to prepare an oligomeric compound having a
phosphodiester linked conjugate at the 3' terminus with a
predetermined sequence and composition. The order and quantity of
phosphoramidites added to the solid support can be adjusted to
prepare the oligomeric compounds as described herein having any
predetermined sequence and composition.
Example 41: General Method for the Preparation of ASOs Comprising a
Phosphodiester Linked GalNAc.sub.3-2 (See Example 37, Bx is
Adenine) Conjugate at the 5' Position Via Solid Phase Techniques
(Preparation of ISIS 661134)
[0770] Unless otherwise stated, all reagents and solutions used for
the synthesis of oligomeric compounds are purchased from commercial
sources. Standard phosphoramidite building blocks and solid support
are used for incorporation nucleoside residues which include for
example T, A, G, and .sup.mC residues. Phosphoramidite compounds 56
and 60 were used to synthesize the phosphodiester linked
GalNAc.sub.3-2 conjugate at the 5' terminus. A 0.1 M solution of
phosphoramidite in anhydrous acetonitrile was used for
.beta.-D-2'-deoxyribonucleoside and 2'-MOE.
[0771] The ASO syntheses were performed on ABI 394 synthesizer (1-2
.mu.mol scale) or on GE Healthcare Bioscience AKTA oligopilot
synthesizer (40-200 .mu.mol scale) by the phosphoramidite coupling
method on VIMAD solid support (110 .mu.mol/g, Guzaev et al., 2003)
packed in the column. For the coupling step, the phosphoramidites
were delivered at a 4 fold excess over the initial loading of the
solid support and phosphoramidite coupling was carried out for 10
min. All other steps followed standard protocols supplied by the
manufacturer. A solution of 6% dichloroacetic acid in toluene was
used for removing the dimethoxytrityl (DMT) groups from 5'-hydroxyl
groups of the nucleotide. 4,5-Dicyanoimidazole (0.7 M) in anhydrous
CH.sub.3CN was used as activator during the coupling step.
Phosphorothioate linkages were introduced by sulfurization with 0.1
M solution of xanthane hydride in 1:1 pyridine/CH.sub.3CN for a
contact time of 3 minutes. A solution of 20%
tert-butylhydroperoxide in CH.sub.3CN containing 6% water was used
as an oxidizing agent to provide phosphodiester internucleoside
linkages with a contact time of 12 minutes.
[0772] After the desired sequence was assembled, the cyanoethyl
phosphate protecting groups were deprotected using a 20%
diethylamine in toluene (v/v) with a contact time of 45 minutes.
The solid-support bound ASOs were suspended in aqueous ammonia
(28-30 wt %) and heated at 55.degree. C. for 6 h. The unbound ASOs
were then filtered and the ammonia was boiled off. The residue was
purified by high pressure liquid chromatography on a strong anion
exchange column (GE Healthcare Bioscience, Source 30Q, 30 .mu.m,
2.54.times.8 cm, A=100 mM ammonium acetate in 30% aqueous
CH.sub.3CN, B=1.5 M NaBr in A, 0-40% of B in 60 min, flow 14 mL
min-1, .lamda.=260 nm). The residue was desalted by HPLC on a
reverse phase column to yield the desired ASOs in an isolated yield
of 15-30% based on the initial loading on the solid support. The
ASOs were characterized by ion-pair-HPLC coupled MS analysis with
Agilent 1100 MSD system.
TABLE-US-00022 TABLE 21 ASO comprising a phosphodiester linked
GalNAc.sub.3-2 conjugate at the 5' position targeting SRB-1
Observed SEQ ID ISIS No. Sequence (5' to 3') CalCd Mass Mass No.
661134
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.ds 6482.2 6481.6 26
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates
.beta.-D-2'-deoxyribonucleoside; "k" indicates 6'-(S)-CH.sub.3
bicyclic nucleoside (e.g. cEt); "s" indicates phosphorothioate
internucleoside linkages (PS); "o" indicates phosphodiester
internucleoside linkages (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Superscript "m" indicates 5-methylcytosines.
The structure of GalNAc.sub.3-2.sub.a is shown in Example 37.
Example 42: General Method for the Preparation of ASOs Comprising a
GalNAc.sub.3-3 Conjugate at the 5' Position Via Solid Phase
Techniques (Preparation of ISIS 661166)
[0773] The synthesis for ISIS 661166 was performed using similar
procedures as illustrated in Examples 39 and 41.
[0774] ISIS 661166 is a 5-10-5 MOE gapmer, wherein the 5' position
comprises a GalNAc.sub.3-3 conjugate. The ASO was characterized by
ion-pair-HPLC coupled MS analysis with Agilent 1100 MSD system.
TABLE-US-00023 TABLE 21a ASO comprising a GalNAc.sub.3-3 conjugate
at the 5' position via a hexylamino phosphodiester linkage
targeting Malat-1 ISIS Calcd Observed SEQ ID No. Sequence (5' to
3') Conjugate Mass Mass No. 661166 5'
.sup.mC.sub.esG.sub.esG.sub.esT.sub.esG.sub.es 8992.16 8990.51 27
.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.dsA.sub.dsG.sub.ds G.sub.esA.sub.esA.sub.esT.sub.esT.sub.e
Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates
.beta.-D-2'-deoxyribonucleoside; "s" indicates phosphorothioate
internucleoside linkages (PS); "o" indicates phosphodiester
internucleoside linkages (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Superscript "m" indicates 5-methylcytosines.
The structure of "5`-GalNAc.sub.3-3a" is shown in Example 39.
Example 43: Dose-Dependent Study of Phosphodiester Linked
GalNAc.sub.3-2 (See Examples 37 and 41, Bx is Adenine) at the 5'
Terminus Targeting SRB-1 In Vivo
[0775] ISIS 661134 (see Example 41) comprising a phosphodiester
linked GalNAc.sub.3-2 conjugate at the 5' terminus was tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Unconjugated ISIS 440762 and 651900 (GalNAc.sub.3-1 conjugate at 3'
terminus, see Example 9) were included in the study for comparison
and are described previously in Table 4.
Treatment
[0776] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 440762, 651900, 661134 or with PBS treated control.
Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration to determine
the liver SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM.
RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. SRB-1 mRNA levels were determined
relative to total RNA (using Ribogreen), prior to normalization to
PBS-treated control. The results below are presented as the average
percent of SRB-1 mRNA levels for each treatment group, normalized
to PBS-treated control and is denoted as "% PBS". The ED.sub.50s
were measured using similar methods as described previously and are
presented below.
[0777] As illustrated in Table 22, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. Indeed, the antisense oligonucleotides comprising the
phosphodiester linked GalNAc.sub.3-2 conjugate at the 5' terminus
(ISIS 661134) or the GalNAc.sub.3-1 conjugate linked at the 3'
terminus
[0778] (ISIS 651900) showed substantial improvement in potency
compared to the unconjugated antisense oligonucleotide (ISIS
440762). Further, ISIS 661134, which comprises the phosphodiester
linked GalNAc.sub.3-2 conjugate at the 5' terminus was equipotent
compared to ISIS 651900, which comprises the GalNAc.sub.3-1
conjugate at the 3' terminus.
TABLE-US-00024 TABLE 22 ASOs containing GalNAc3-1 or GalNAc.sub.3-2
targeting SRB-1 ISIS Dosage SRB-1 mRNA ED.sub.50 No. (mg/kg) levels
(% PBS) (mg/kg) Conjugate SEQ ID No. PBS 0 100 -- -- 440762 0.2 116
2.58 No conjugate 22 0.7 91 2 69 7 22 20 5 651900 0.07 95 0.26 3'
GalNAc.sub.3-1 23 0.2 77 0.7 28 2 11 7 8 661134 0.07 107 0.25 5'
GalNAc.sub.3-2 26 0.2 86 0.7 28 2 10 7 6
[0779] Structures for 3' GalNAc.sub.3-1 and 5' GalNAc.sub.3-2 were
described previously in Examples 9 and 37.
Pharmacokinetics Analysis (PK)
[0780] The PK of the ASOs from the high dose group (7 mg/kg) was
examined and evaluated in the same manner as illustrated in Example
20. Liver sample was minced and extracted using standard protocols.
The full length metabolites of 661134 (5' GalNAc.sub.3-2) and ISIS
651900 (3' GalNAc.sub.3-1) were identified and their masses were
confirmed by high resolution mass spectrometry analysis. The
results showed that the major metabolite detected for the ASO
comprising a phosphodiester linked GalNAc.sub.3-2 conjugate at the
5' terminus (ISIS 661134) was ISIS 440762 (data not shown). No
additional metabolites, at a detectable level, were observed.
Unlike its counterpart, additional metabolites similar to those
reported previously in Table 10a were observed for the ASO having
the GalNAc.sub.3-1 conjugate at the 3' terminus (ISIS 651900).
These results suggest that having the phosphodiester linked
GalNAc.sub.3-1 or GalNAc.sub.3-2 conjugate may improve the PK
profile of ASOs without compromising their potency.
Example 44: Effect of PO/PS Linkages on Antisense Inhibition of
ASOs Comprising GalNAc.sub.3-1 Conjugate (See Example 9) at the 3'
Terminus Targeting SRB-1
[0781] ISIS 655861 and 655862 comprising a GalNAc.sub.3-1 conjugate
at the 3' terminus each targeting SRB-1 were tested in a single
administration study for their ability to inhibit SRB-1 in mice.
The parent unconjugated compound, ISIS 353382 was included in the
study for comparison.
[0782] The ASOs are 5-10-5 MOE gapmers, wherein the gap region
comprises ten 2'-deoxyribonucleosides and each wing region
comprises five 2'-MOE modified nucleosides. The ASOs were prepared
using similar methods as illustrated previously in Example 19 and
are described Table 23, below.
TABLE-US-00025 TABLE 23 Modified ASOs comprising GalNAc.sub.3-1
conjugate at the 3' terminus targeting SRB-1 SEQ ID ISIS No.
Sequence (5' to 3') Chemistry No. 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds Full PS no
conjugate 28 (parent)
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.e-
sT.sub.e 655861
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.asG.sub.dsA.sub.ds Full PS
with 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o conjugate 655862
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds Mixed PS/PO
with 29
.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e-
o conjugate Subscripts: "e" indicates 2'-MOE modified nucleoside;
"d" indicates .beta.-D-2'-deoxyribonucleoside; "s" indicates
phosphorothioate internucleoside linkages (PS); "o" indicates
phosphodiester internucleoside linkages (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Superscript "m" indicates 5-methylcytosines.
The structure of "GalNAc.sub.3-1" is shown in Example 9.
Treatment
[0783] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 353382, 655861, 655862 or with PBS treated control.
Each treatment group consisted of 4 animals. Prior to the treatment
as well as after the last dose, blood was drawn from each mouse and
plasma samples were analyzed. The mice were sacrificed 72 hours
following the final administration to determine the liver SRB-1
mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. SRB-1 mRNA levels were determined
relative to total RNA (using Ribogreen), prior to normalization to
PBS-treated control. The results below are presented as the average
percent of SRB-1 mRNA levels for each treatment group, normalized
to PBS-treated control and is denoted as "% PBS". The ED.sub.50s
were measured using similar methods as described previously and are
reported below.
[0784] As illustrated in Table 24, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner compared to PBS treated control. Indeed, the antisense
oligonucleotides comprising the GalNAc.sub.3-1 conjugate at the 3'
terminus (ISIS 655861 and 655862) showed substantial improvement in
potency comparing to the unconjugated antisense oligonucleotide
(ISIS 353382). Further, ISIS 655862 with mixed PS/PO linkages
showed an improvement in potency relative to full PS (ISIS
655861).
TABLE-US-00026 TABLE 24 Effect of PO/PS linkages on antisense
inhibition of ASOs comprising GalNAc.sub.3-1 conjugate at 3'
terminus targeting SRB-1 SRB-1 mRNA SEQ ISIS Dosage levels
ED.sub.50 ID No. (mg/kg) (% PBS) (mg/kg) Chemistry No. PBS 0 100 --
-- 353382 3 76.65 10.4 Full PS 28 (parent) 10 52.40 without 30
24.95 conjugate 655861 0.5 81.22 2.2 Full PS with 29 1.5 63.51
GalNAc.sub.3-1 5 24.61 conjugate 15 14.80 655862 0.5 69.57 1.3
Mixed PS/PO 29 1.5 45.78 with 5 19.70 GalNAc.sub.3-1 15 12.90
conjugate
[0785] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Organ
weights were also evaluated. The results demonstrated that no
elevation in transaminase levels (Table 25) or organ weights (data
not shown) were observed in mice treated with ASOs compared to PBS
control. Further, the ASO with mixed PS/PO linkages (ISIS 655862)
showed similar transaminase levels compared to full PS (ISIS
655861).
TABLE-US-00027 TABLE 25 Effect of PO/PS linkages on transaminase
levels of ASOs comprising GalNAc.sub.3-1 conjugate at 3' terminus
targeting SRB-1 SEQ ISIS Dosage ALT AST ID No. (mg/kg) (U/L) (U/L)
Chemistry No. PBS 0 28.5 65 -- 353382 3 50.25 89 Full PS 28
(parent) 10 27.5 79.3 without 30 27.3 97 conjugate 655861 0.5 28
55.7 Full PS with 29 1.5 30 78 GalNAc.sub.3-1 5 29 63.5 15 28.8
67.8 655862 0.5 50 75.5 Mixed PS/PO 29 1.5 21.7 58.5 with 5 29.3 69
GalNAc.sub.3-1 15 22 61
Example 45: Preparation of PFP Ester, Compound 110a
##STR00181## ##STR00182##
[0787] Compound 4 (9.5 g, 28.8 mmoles) was treated with compound
103a or 103b (38 mmoles), individually, and TMSOTf (0.5 eq.) and
molecular sieves in dichloromethane (200 mL), and stirred for 16
hours at room temperature. At that time, the organic layer was
filtered thru celite, then washed with sodium bicarbonate, water
and brine. The organic layer was then separated and dried over
sodium sulfate, filtered and reduced under reduced pressure. The
resultant oil was purified by silica gel chromatography (2%->10%
methanol/dichloromethane) to give compounds 104a and 104b in
>80% yield. LCMS and proton NMR was consistent with the
structure.
[0788] Compounds 104a and 104b were treated to the same conditions
as for compounds 100a-d (Example 47), to give compounds 105a and
105b in >90% yield. LCMS and proton NMR was consistent with the
structure.
[0789] Compounds 105a and 105b were treated, individually, with
compound 90 under the same conditions as for compounds 901a-d, to
give compounds 106a (80%) and 106b (20%). LCMS and proton NMR was
consistent with the structure.
[0790] Compounds 106a and 106b were treated to the same conditions
as for compounds 96a-d (Example 47), to give 107a (60%) and 107b
(20%). LCMS and proton NMR was consistent with the structure.
[0791] Compounds 107a and 107b were treated to the same conditions
as for compounds 97a-d (Example 47), to give compounds 108a and
108b in 40-60% yield. LCMS and proton NMR was consistent with the
structure. Compounds 108a (60%) and 108b (40%) were treated to the
same conditions as for compounds 100a-d (Example 47), to give
compounds 109a and 109b in >80% yields. LCMS and proton NMR was
consistent with the structure.
[0792] Compound 109a was treated to the same conditions as for
compounds 101a-d (Example 47), to give Compound 110a in 30-60%
yield. LCMS and proton NMR was consistent with the structure.
Alternatively, Compound 110b can be prepared in a similar manner
starting with Compound 109b.
Example 46: General Procedure for Conjugation with PFP Esters
(Oligonucleotide 111); Preparation of ISIS 666881
(GalNAc.sub.3-10)
[0793] A 5'-hexylamino modified oligonucleotide was synthesized and
purified using standard solid-phase oligonucleotide procedures. The
5'-hexylamino modified oligonucleotide was dissolved in 0.1 M
sodium tetraborate, pH 8.5 (200 .mu.L) and 3 equivalents of a
selected PFP esterified GalNAc.sub.3 cluster dissolved in DMSO (50
.mu.L) was added. If the PFP ester precipitated upon addition to
the ASO solution DMSO was added until all PFP ester was in
solution. The reaction was complete after about 16 h of mixing at
room temperature. The resulting solution was diluted with water to
12 mL and then spun down at 3000 rpm in a spin filter with a mass
cut off of 3000 Da. This process was repeated twice to remove small
molecule impurities. The solution was then lyophilized to dryness
and redissolved in concentrated aqueous ammonia and mixed at room
temperature for 2.5 h followed by concentration in vacuo to remove
most of the ammonia. The conjugated oligonucleotide was purified
and desalted by RP-HPLC and lyophilized to provide the GalNAc.sub.3
conjugated oligonucleotide.
##STR00183##
[0794] Oligonucleotide 111 is conjugated with GalNAc.sub.3-10. The
GalNAc.sub.3 cluster portion of the conjugate group GalNAc.sub.3-10
(GalNAc.sub.3-10.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. In certain embodiments,
the cleavable moiety is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)-- as
shown in the oligonucleotide (ISIS 666881) synthesized with
GalNAc.sub.3-10 below. The structure of GalNAc.sub.3-10
(GalNAc.sub.3-10.sub.a-CM-) is shown below:
##STR00184##
[0795] Following this general procedure ISIS 666881 was prepared.
5'-hexylamino modified oligonucleotide, ISIS 660254, was
synthesized and purified using standard solid-phase oligonucleotide
procedures. ISIS 660254 (40 mg, 5.2 .mu.mop was dissolved in 0.1 M
sodium tetraborate, pH 8.5 (200 .mu.L) and 3 equivalents PFP ester
(Compound 110a) dissolved in DMSO (50 .mu.L) was added. The PFP
ester precipitated upon addition to the ASO solution requiring
additional DMSO (600 .mu.L) to fully dissolve the PFP ester. The
reaction was complete after 16 h of mixing at room temperature. The
solution was diluted with water to 12 mL total volume and spun down
at 3000 rpm in a spin filter with a mass cut off of 3000 Da. This
process was repeated twice to remove small molecule impurities. The
solution was lyophilized to dryness and redissolved in concentrated
aqueous ammonia with mixing at room temperature for 2.5 h followed
by concentration in vacuo to remove most of the ammonia. The
conjugated oligonucleotide was purified and desalted by RP-HPLC and
lyophilized to give ISIS 666881 in 90% yield by weight (42 mg, 4.7
.mu.mol).
TABLE-US-00028 GalNAc.sub.3-10 conjugated oligonucleotide SEQ ASO
Sequence (5' to 3') 5' group ID No. ISIS 660254
NH.sub.2(CH.sub.2).sub.6-.sub.oA.sub.doG.sub.es.sup.mC.sub.esT.sub.esT.su-
b.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds Hexylamine 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS 666881
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e Capital letters
indicate the nucleobase for each nucleoside and .sup.mC indicates a
5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE modified
nucleoside; "d" indicates a .beta.-D-2'-deoxyribonucleoside; "s"
indicates a phosphorothioate internucleoside linkage (PS); "o"
indicates a phosphodiester internucleoside linkage (PO); and "o```
indicates --O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
Example 47: Preparation of Oligonucleotide 102 Comprising
GalNAc.sub.3-8
##STR00185## ##STR00186## ##STR00187##
[0797] The triacid 90 (4 g, 14.43 mmol) was dissolved in DMF (120
mL) and N,N-Diisopropylethylamine (12.35 mL, 72 mmoles).
Pentafluorophenyl trifluoroacetate (8.9 mL, 52 mmoles) was added
dropwise, under argon, and the reaction was allowed to stir at room
temperature for 30 minutes. Boc-diamine 91a or 91b (68.87 mmol) was
added, along with N,N-Diisopropylethylamine (12.35 mL, 72 mmoles),
and the reaction was allowed to stir at room temperature for 16
hours. At that time, the DMF was reduced by >75% under reduced
pressure, and then the mixture was dissolved in dichloromethane.
The organic layer was washed with sodium bicarbonate, water and
brine. The organic layer was then separated and dried over sodium
sulfate, filtered and reduced to an oil under reduced pressure. The
resultant oil was purified by silica gel chromatography (2%->10%
methanol/dichloromethane) to give compounds 92a and 92b in an
approximate 80% yield. LCMS and proton NMR were consistent with the
structure.
[0798] Compound 92a or 92b (6.7 mmoles) was treated with 20 mL of
dichloromethane and 20 mL of trifluoroacetic acid at room
temperature for 16 hours. The resultant solution was evaporated and
then dissolved in methanol and treated with DOWEX-OH resin for 30
minutes. The resultant solution was filtered and reduced to an oil
under reduced pressure to give 85-90% yield of compounds 93a and
93b.
[0799] Compounds 7 or 64 (9.6 mmoles) were treated with HBTU (3.7
g, 9.6 mmoles) and N,N-Diisopropylethylamine (5 mL) in DMF (20 mL)
for 15 minutes. To this was added either compounds 93a or 93b (3
mmoles), and allowed to stir at room temperature for 16 hours. At
that time, the DMF was reduced by >75% under reduced pressure,
and then the mixture was dissolved in dichloromethane. The organic
layer was washed with sodium bicarbonate, water and brine. The
organic layer was then separated and dried over sodium sulfate,
filtered and reduced to an oil under reduced pressure. The
resultant oil was purified by silica gel chromatography (5%->20%
methanol/dichloromethane) to give compounds 96a-d in 20-40% yield.
LCMS and proton NMR was consistent with the structure.
[0800] Compounds 96a-d (0.75 mmoles), individually, were
hydrogenated over Raney Nickel for 3 hours in Ethanol (75 mL). At
that time, the catalyst was removed by filtration thru celite, and
the ethanol removed under reduced pressure to give compounds 97a-d
in 80-90% yield. LCMS and proton NMR were consistent with the
structure.
[0801] Compound 23 (0.32 g, 0.53 mmoles) was treated with HBTU (0.2
g, 0.53 mmoles) and N,N-Diisopropylethylamine (0.19 mL, 1.14
mmoles) in DMF (30 mL) for 15 minutes. To this was added compounds
97a-d (0.38 mmoles), individually, and allowed to stir at room
temperature for 16 hours. At that time, the DMF was reduced by
>75% under reduced pressure, and then the mixture was dissolved
in dichloromethane. The organic layer was washed with sodium
bicarbonate, water and brine. The organic layer was then separated
and dried over sodium sulfate, filtered and reduced to an oil under
reduced pressure. The resultant oil was purified by silica gel
chromatography (2%->20% methanol/dichloromethane) to give
compounds 98a-d in 30-40% yield. LCMS and proton NMR was consistent
with the structure.
[0802] Compound 99 (0.17 g, 0.76 mmoles) was treated with HBTU
(0.29 g, 0.76 mmoles) and N,N-Diisopropylethylamine (0.35 mL, 2.0
mmoles) in DMF (50 mL) for 15 minutes. To this was added compounds
97a-d (0.51 mmoles), individually, and allowed to stir at room
temperature for 16 hours. At that time, the DMF was reduced by
>75% under reduced pressure, and then the mixture was dissolved
in dichloromethane. The organic layer was washed with sodium
bicarbonate, water and brine. The organic layer was then separated
and dried over sodium sulfate, filtered and reduced to an oil under
reduced pressure. The resultant oil was purified by silica gel
chromatography (5%->20% methanol/dichloromethane) to give
compounds 100a-d in 40-60% yield. LCMS and proton NMR was
consistent with the structure.
[0803] Compounds 100a-d (0.16 mmoles), individually, were
hydrogenated over 10% Pd(OH).sub.2/C for 3 hours in methanol/ethyl
acetate (1:1, 50 mL). At that time, the catalyst was removed by
filtration thru celite, and the organics removed under reduced
pressure to give compounds 101a-d in 80-90% yield. LCMS and proton
NMR was consistent with the structure.
[0804] Compounds 101a-d (0.15 mmoles), individually, were dissolved
in DMF (15 mL) and pyridine (0.016 mL, 0.2 mmoles).
Pentafluorophenyl trifluoroacetate (0.034 mL, 0.2 mmoles) was added
dropwise, under argon, and the reaction was allowed to stir at room
temperature for 30 minutes. At that time, the DMF was reduced by
>75% under reduced pressure, and then the mixture was dissolved
in dichloromethane. The organic layer was washed with sodium
bicarbonate, water and brine. The organic layer was then separated
and dried over sodium sulfate, filtered and reduced to an oil under
reduced pressure. The resultant oil was purified by silica gel
chromatography (2%->5% methanol/dichloromethane) to give
compounds 102a-d in an approximate 80% yield. LCMS and proton NMR
were consistent with the structure.
##STR00188##
[0805] Oligomeric Compound 102, comprising a GalNAc.sub.3-8
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-8 (GalNAc.sub.3-8.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In a preferred embodiment, the cleavable moiety
is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
[0806] The structure of GalNAc.sub.3-8 (GalNAc.sub.3-8.sub.a-CM-)
is shown below:
##STR00189##
Example 48: Preparation of Oligonucleotide 119 Comprising
GalNAc.sub.3-7
##STR00190## ##STR00191##
[0808] Compound 112 was synthesized following the procedure
described in the literature Med. Chem. 2004, 47, 5798-5808).
[0809] Compound 112 (5 g, 8.6 mmol) was dissolved in 1:1
methanol/ethyl acetate (22 mL/22 mL). Palladium hydroxide on carbon
(0.5 g) was added. The reaction mixture was stirred at room
temperature under hydrogen for 12 h. The reaction mixture was
filtered through a pad of celite and washed the pad with 1:1
methanol/ethyl acetate. The filtrate and the washings were combined
and concentrated to dryness to yield Compound 105a (quantitative).
The structure was confirmed by LCMS.
[0810] Compound 113 (1.25 g, 2.7 mmol), HBTU (3.2 g, 8.4 mmol) and
DIEA (2.8 mL, 16.2 mmol) were dissolved in anhydrous DMF (17 mL)
and the reaction mixture was stirred at room temperature for 5 min.
To this a solution of Compound 105a (3.77 g, 8.4 mmol) in anhydrous
DMF (20 mL) was added. The reaction was stirred at room temperature
for 6 h. Solvent was removed under reduced pressure to get an oil.
The residue was dissolved in CH.sub.2Cl.sub.2 (100 mL) and washed
with aqueous saturated NaHCO.sub.3 solution (100 mL) and brine (100
mL). The organic phase was separated, dried (Na.sub.2SO.sub.4),
filtered and evaporated. The residue was purified by silica gel
column chromatography and eluted with 10 to 20% MeOH in
dichloromethane to yield Compound 114 (1.45 g, 30%). The structure
was confirmed by LCMS and .sup.1H NMR analysis.
[0811] Compound 114 (1.43 g, 0.8 mmol) was dissolved in 1:1
methanol/ethyl acetate (4 mL/4 mL). Palladium on carbon (wet, 0.14
g) was added. The reaction mixture was flushed with hydrogen and
stirred at room temperature under hydrogen for 12 h. The reaction
mixture was filtered through a pad of celite. The celite pad was
washed with methanol/ethyl acetate (1:1). The filtrate and the
washings were combined together and evaporated under reduced
pressure to yield Compound 115 (quantitative). The structure was
confirmed by LCMS and .sup.1H NMR analysis.
[0812] Compound 83a (0.17 g, 0.75 mmol), HBTU (0.31 g, 0.83 mmol)
and DIEA (0.26 mL, 1.5 mmol) were dissolved in anhydrous DMF (5 mL)
and the reaction mixture was stirred at room temperature for 5 min.
To this a solution of Compound 115 (1.22 g, 0.75 mmol) in anhydrous
DMF was added and the reaction was stirred at room temperature for
6 h. The solvent was removed under reduced pressure and the residue
was dissolved in CH.sub.2Cl.sub.2. The organic layer was washed
aqueous saturated NaHCO.sub.3 solution and brine and dried over
anhydrous Na.sub.2SO.sub.4 and filtered. The organic layer was
concentrated to dryness and the residue obtained was purified by
silica gel column chromatography and eluted with 3 to 15% MeOH in
dichloromethane to yield Compound 116 (0.84 g, 61%). The structure
was confirmed by LC MS and .sup.1H NMR analysis.
##STR00192##
[0813] Compound 116 (0.74 g, 0.4 mmol) was dissolved in 1:1
methanol/ethyl acetate (5 mL/5 mL). Palladium on carbon (wet, 0.074
g) was added. The reaction mixture was flushed with hydrogen and
stirred at room temperature under hydrogen for 12 h. The reaction
mixture was filtered through a pad of celite. The celite pad was
washed with methanol/ethyl acetate (1:1). The filtrate and the
washings were combined together and evaporated under reduced
pressure to yield compound 117 (0.73 g, 98%). The structure was
confirmed by LCMS and .sup.1H NMR analysis.
[0814] Compound 117 (0.63 g, 0.36 mmol) was dissolved in anhydrous
DMF (3 mL). To this solution N,N-Diisopropylethylamine (70 .mu.L,
0.4 mmol) and pentafluorophenyl trifluoroacetate (72 .mu.L, 0.42
mmol) were added. The reaction mixture was stirred at room
temperature for 12 h and poured into a aqueous saturated
NaHCO.sub.3 solution. The mixture was extracted with
dichloromethane, washed with brine and dried over anhydrous
Na.sub.2SO.sub.4. The dichloromethane solution was concentrated to
dryness and purified with silica gel column chromatography and
eluted with 5 to 10% MeOH in dichloromethane to yield compound 118
(0.51 g, 79%). The structure was confirmed by LCMS and .sup.1H and
.sup.1H and .sup.19F NMR.
##STR00193##
[0815] Oligomeric Compound 119, comprising a GalNAc.sub.3-7
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-7 (GalNAc.sub.3-7.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
[0816] The structure of GalNAc.sub.3-7 (GalNAc.sub.3-7.sub.a-CM-)
is shown below:
##STR00194##
Example 49: Preparation of Oligonucleotide 132 Comprising
GalNAc.sub.3-5
##STR00195##
[0818] Compound 120 (14.01 g, 40 mmol) and HBTU (14.06 g, 37 mmol)
were dissolved in anhydrous DMF (80 mL). Triethylamine (11.2 mL,
80.35 mmol) was added and stirred for 5 min. The reaction mixture
was cooled in an ice bath and a solution of compound 121 (10 g,
mmol) in anhydrous DMF (20 mL) was added. Additional triethylamine
(4.5 mL, 32.28 mmol) was added and the reaction mixture was stirred
for 18 h under an argon atmosphere. The reaction was monitored by
TLC (ethyl acetate:hexane; 1:1; Rf=0.47). The solvent was removed
under reduced pressure. The residue was taken up in EtOAc (300 mL)
and washed with 1M NaHSO.sub.4 (3.times.150 mL), aqueous saturated
NaHCO.sub.3 solution (3.times.150 mL) and brine (2.times.100 mL).
Organic layer was dried with Na.sub.2SO.sub.4. Drying agent was
removed by filtration and organic layer was concentrated by rotary
evaporation. Crude mixture was purified by silica gel column
chromatography and eluted by using 35-50% EtOAc in hexane to yield
a compound 122 (15.50 g, 78.13%). The structure was confirmed by
LCMS and .sup.1H NMR analysis. Mass m/z 589.3 [M+H].sup.+.
[0819] A solution of LiOH (92.15 mmol) in water (20 mL) and THF (10
mL) was added to a cooled solution of Compound 122 (7.75 g, 13.16
mmol) dissolved in methanol (15 mL). The reaction mixture was
stirred at room temperature for 45 min. and monitored by TLC
(EtOAc:hexane; 1:1). The reaction mixture was concentrated to half
the volume under reduced pressure. The remaining solution was
cooled an ice bath and neutralized by adding concentrated HCl. The
reaction mixture was diluted, extracted with EtOAc (120 mL) and
washed with brine (100 mL). An emulsion formed and cleared upon
standing overnight. The organic layer was separated dried
(Na.sub.2SO.sub.4), filtered and evaporated to yield Compound 123
(8.42 g). Residual salt is the likely cause of excess mass. LCMS is
consistent with structure. Product was used without any further
purification. M.W.cal:574.36; M.W.fd:575.3[M+H].sup.+.
##STR00196##
[0820] Compound 126 was synthesized following the procedure
described in the literature (I Am. Chem. Soc. 2011, 133,
958-963).
##STR00197## ##STR00198##
[0821] Compound 123 (7.419 g, 12.91 mmol), HOBt (3.49 g, 25.82
mmol) and compound 126 (6.33 g, 16.14 mmol) were dissolved in and
DMF (40 mL) and the resulting reaction mixture was cooled in an ice
bath. To this N,N-Diisopropylethylamine (4.42 mL, 25.82 mmol),
PyBop (8.7 g, 16.7 mmol) followed by Bop coupling reagent (1.17 g,
2.66 mmol) were added under an argon atmosphere. The ice bath was
removed and the solution was allowed to warm to room temperature.
The reaction was completed after 1 h as determined by TLC
(DCM:MeOH:AA; 89:10:1). The reaction mixture was concentrated under
reduced pressure. The residue was dissolved in EtOAc (200 mL) and
washed with 1 M NaHSO.sub.4 (3.times.100 mL), aqueous saturated
NaHCO.sub.3 (3.times.100 mL) and brine (2.times.100 mL). The
organic phase separated dried (Na.sub.2SO.sub.4), filtered and
concentrated. The residue was purified by silica gel column
chromatography with a gradient of 50% hexanes/EtOAC to 100% EtOAc
to yield Compound 127 (9.4 g) as a white foam. LCMS and .sup.1H NMR
were consistent with structure. Mass m/z 778.4 [M+H].sup.+.
[0822] Trifluoroacetic acid (12 mL) was added to a solution of
compound 127 (1.57 g, 2.02 mmol) in dichloromethane (12 mL) and
stirred at room temperature for 1 h. The reaction mixture was
co-evaporated with toluene (30 mL) under reduced pressure to
dryness. The residue obtained was co-evaporated twice with
acetonitrile (30 mL) and toluene (40 mL) to yield Compound 128
(1.67 g) as trifluoro acetate salt and used for next step without
further purification. LCMS and .sup.1H NMR were consistent with
structure. Mass m/z 478.2 [M+H].sup.+.
[0823] Compound 7 (0.43 g, 0.963 mmol), HATU (0.35 g, 0.91 mmol),
and HOAt (0.035 g, 0.26 mmol) were combined together and dried for
4 h over P.sub.2O.sub.5 under reduced pressure in a round bottom
flask and then dissolved in anhydrous DMF (1 mL) and stirred for 5
min. To this a solution of compound 128 (0.20 g, 0.26 mmol) in
anhydrous DMF (0.2 mL) and N,N-Diisopropylethylamine (0.2 mL) was
added. The reaction mixture was stirred at room temperature under
an argon atmosphere. The reaction was complete after 30 min as
determined by LCMS and TLC (7% MeOH/DCM). The reaction mixture was
concentrated under reduced pressure. The residue was dissolved in
DCM (30 mL) and washed with 1 M NaHSO.sub.4 (3.times.20 mL),
aqueous saturated NaHCO.sub.3 (3.times.20 mL) and brine (3.times.20
mL). The organic phase was separated, dried over Na.sub.2SO.sub.4,
filtered and concentrated. The residue was purified by silica gel
column chromatography using 5-15% MeOH in dichloromethane to yield
Compound 129 (96.6 mg). LC MS and .sup.1H NMR are consistent with
structure. Mass m/z 883.4 [M+2H].sup.+.
[0824] Compound 129 (0.09 g, 0.051 mmol) was dissolved in methanol
(5 mL) in 20 mL scintillation vial. To this was added a small
amount of 10% Pd/C (0.015 mg) and the reaction vessel was flushed
with H.sub.2 gas. The reaction mixture was stirred at room
temperature under H.sub.2 atmosphere for 18 h. The reaction mixture
was filtered through a pad of Celite and the Celite pad was washed
with methanol. The filtrate washings were pooled together and
concentrated under reduced pressure to yield Compound 130 (0.08 g).
LCMS and .sup.1H NMR were consistent with structure. The product
was used without further purification. Mass m/z 838.3
[M+2E1].sup.+.
[0825] To a 10 mL pointed round bottom flask were added compound
130 (75.8 mg, 0.046 mmol), 0.37 M pyridine/DMF (200 .mu.L) and a
stir bar. To this solution was added 0.7 M pentafluorophenyl
trifluoroacetate/DMF (100 .mu.L) drop wise with stirring. The
reaction was completed after 1 h as determined by LC MS. The
solvent was removed under reduced pressure and the residue was
dissolved in CHCl.sub.3 (.about.10 mL). The organic layer was
partitioned against NaHSO.sub.4 (1 M, 10 mL), aqueous saturated
NaHCO.sub.3 (10 mL) and brine (10 mL) three times each. The organic
phase separated and dried over Na.sub.2SO.sub.4, filtered and
concentrated to yield Compound 131 (77.7 mg). LCMS is consistent
with structure. Used without further purification. Mass m/z 921.3
[M+2H].sup.+.
##STR00199##
[0826] Oligomeric Compound 132, comprising a GalNAc.sub.3-5
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-5 (GalNAc.sub.3-5.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
[0827] The structure of GalNAc.sub.3-5 (GalNAc.sub.3-5.sub.a-CM-)
is shown below:
##STR00200##
Example 50: Preparation of Oligonucleotide 144 Comprising
GalNAc.sub.4-11
##STR00201## ##STR00202##
[0829] Synthesis of Compound 134. To a Merrifield flask was added
aminomethyl VIMAD resin (2.5 g, 450 .mu.mol/g) that was washed with
acetonitrile, dimethylformamide, dichloromethane and acetonitrile.
The resin was swelled in acetonitrile (4 mL). Compound 133 was
pre-activated in a 100 mL round bottom flask by adding 20 (1.0
mmol, 0.747 g), TBTU (1.0 mmol, 0.321 g), acetonitrile (5 mL) and
DIEA (3.0 mmol, 0.5 mL). This solution was allowed to stir for 5
min and was then added to the Merrifield flask with shaking. The
suspension was allowed to shake for 3 h. The reaction mixture was
drained and the resin was washed with acetonitrile, DMF and DCM.
New resin loading was quantitated by measuring the absorbance of
the DMT cation at 500 nm (extinction coefficient=76000) in DCM and
determined to be 238 .mu.mol/g. The resin was capped by suspending
in an acetic anhydride solution for ten minutes three times.
[0830] The solid support bound compound 141 was synthesized using
iterative Fmoc-based solid phase peptide synthesis methods. A small
amount of solid support was withdrawn and suspended in aqueous
ammonia (28-30 wt %) for 6 h. The cleaved compound was analyzed by
LC-MS and the observed mass was consistent with structure. Mass m/z
1063.8 [M+2E1].sup.+.
[0831] The solid support bound compound 142 was synthesized using
solid phase peptide synthesis methods.
##STR00203##
[0832] The solid support bound compound 143 was synthesized using
standard solid phase synthesis on a DNA synthesizer.
[0833] The solid support bound compound 143 was suspended in
aqueous ammonia (28-30 wt %) and heated at 55.degree. C. for 16 h.
The solution was cooled and the solid support was filtered. The
filtrate was concentrated and the residue dissolved in water and
purified by HPLC on a strong anion exchange column. The fractions
containing full length compound 144 were pooled together and
desalted. The resulting GalNAc.sub.4-11 conjugated oligomeric
compound was analyzed by LC-MS and the observed mass was consistent
with structure.
[0834] The GalNAc.sub.4 cluster portion of the conjugate group
GalNAc.sub.4-11 (GalNAc.sub.4-11.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. In
certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
[0835] The structure of GalNAc.sub.4-11 (GalNAc.sub.4-11.sub.a-CM)
is shown below:
##STR00204##
Example 51: Preparation of Oligonucleotide 155 Comprising
GalNAc.sub.3-6
##STR00205##
[0837] Compound 146 was synthesized as described in the literature
(Analytical Biochemistry 1995, 229, 54-60).
##STR00206##
[0838] Compound 4 (15 g, 45.55 mmol) and compound 35b (14.3 grams,
57 mmol) were dissolved in CH.sub.2Cl.sub.2 (200 ml). Activated
molecular sieves (4 .ANG.. 2 g, powdered) were added, and the
reaction was allowed to stir for 30 minutes under nitrogen
atmosphere. TMS-OTf was added (4.1 ml, 22.77 mmol) and the reaction
was allowed to stir at room temp overnight. Upon completion, the
reaction was quenched by pouring into solution of saturated aqueous
NaHCO.sub.3 (500 ml) and crushed ice (.about.150 g). The organic
layer was separated, washed with brine, dried over MgSO.sub.4,
filtered, and was concentrated to an orange oil under reduced
pressure. The crude material was purified by silica gel column
chromatography and eluted with 2-10% MeOH in CH.sub.2Cl.sub.2 to
yield Compound 112 (16.53 g, 63%). LCMS and .sup.1H NMR were
consistent with the expected compound.
[0839] Compound 112 (4.27 g, 7.35 mmol) was dissolved in 1:1
MeOH/EtOAc (40 ml). The reaction mixture was purged by bubbling a
stream of argon through the solution for 15 minutes. Pearlman's
catalyst (palladium hydroxide on carbon, 400 mg) was added, and
hydrogen gas was bubbled through the solution for 30 minutes. Upon
completion (TLC 10% MeOH in CH.sub.2Cl.sub.2, and LCMS), the
catalyst was removed by filtration through a pad of celite. The
filtrate was concentrated by rotary evaporation, and was dried
briefly under high vacuum to yield Compound 105a (3.28 g). LCMS and
1H NMR were consistent with desired product.
[0840] Compound 147 (2.31 g, 11 mmol) was dissolved in anhydrous
DMF (100 mL). N,N-Diisopropylethylamine (DIEA, 3.9 mL, 22 mmol) was
added, followed by HBTU (4 g, 10.5 mmol). The reaction mixture was
allowed to stir for .about.15 minutes under nitrogen. To this a
solution of compound 105a (3.3 g, 7.4 mmol) in dry DMF was added
and stirred for 2 h under nitrogen atmosphere. The reaction was
diluted with EtOAc and washed with saturated aqueous NaHCO.sub.3
and brine. The organics phase was separated, dried (MgSO.sub.4),
filtered, and concentrated to an orange syrup. The crude material
was purified by column chromatography 2-5% MeOH in CH.sub.2Cl.sub.2
to yield Compound 148 (3.44 g, 73%). LCMS and .sup.1H NMR were
consistent with the expected product.
[0841] Compound 148 (3.3 g, 5.2 mmol) was dissolved in 1:1
MeOH/EtOAc (75 ml). The reaction mixture was purged by bubbling a
stream of argon through the solution for 15 minutes. Pearlman's
catalyst (palladium hydroxide on carbon) was added (350 mg).
Hydrogen gas was bubbled through the solution for 30 minutes. Upon
completion (TLC 10% MeOH in DCM, and LCMS), the catalyst was
removed by filtration through a pad of celite. The filtrate was
concentrated by rotary evaporation, and was dried briefly under
high vacuum to yield Compound 149 (2.6 g). LCMS was consistent with
desired product. The residue was dissolved in dry DMF (10 ml) was
used immediately in the next step.
##STR00207##
[0842] Compound 146 (0.68 g, 1.73 mmol) was dissolved in dry DMF
(20 ml). To this DIEA (450 .mu.L, 2.6 mmol, 1.5 eq.) and HBTU (1.96
g, 0.5.2 mmol) were added. The reaction mixture was allowed to stir
for 15 minutes at room temperature under nitrogen. A solution of
compound 149 (2.6 g) in anhydrous DMF (10 mL) was added. The pH of
the reaction was adjusted to pH=9-10 by addition of DIEA (if
necessary). The reaction was allowed to stir at room temperature
under nitrogen for 2 h. Upon completion the reaction was diluted
with EtOAc (100 mL), and washed with aqueous saturated aqueous
NaHCO.sub.3, followed by brine. The organic phase was separated,
dried over MgSO.sub.4, filtered, and concentrated. The residue was
purified by silica gel column chromatography and eluted with 2-10%
MeOH in CH.sub.2Cl.sub.2 to yield Compound 150 (0.62 g, 20%). LCMS
and .sup.1H NMR were consistent with the desired product.
[0843] Compound 150 (0.62 g) was dissolved in 1:1 MeOH/EtOAc (5 L).
The reaction mixture was purged by bubbling a stream of argon
through the solution for 15 minutes. Pearlman's catalyst (palladium
hydroxide on carbon) was added (60 mg). Hydrogen gas was bubbled
through the solution for 30 minutes. Upon completion (TLC 10% MeOH
in DCM, and LCMS), the catalyst was removed by filtration
(syringe-tip Teflon filter, 0.45 .mu.m). The filtrate was
concentrated by rotary evaporation, and was dried briefly under
high vacuum to yield Compound 151 (0.57 g). The LCMS was consistent
with the desired product. The product was dissolved in 4 mL dry DMF
and was used immediately in the next step.
##STR00208##
[0844] Compound 83a (0.11 g, 0.33 mmol) was dissolved in anhydrous
DMF (5 mL) and N,N-Diisopropylethylamine (75 .mu.L, 1 mmol) and
PFP-TFA (90 .mu.L, 0.76 mmol) were added. The reaction mixture
turned magenta upon contact, and gradually turned orange over the
next 30 minutes. Progress of reaction was monitored by TLC and
LCMS. Upon completion (formation of the PFP ester), a solution of
compound 151 (0.57 g, 0.33 mmol) in DMF was added. The pH of the
reaction was adjusted to pH=9-10 by addition of
N,N-Diisopropylethylamine (if necessary). The reaction mixture was
stirred under nitrogen for .about.30 min. Upon completion, the
majority of the solvent was removed under reduced pressure. The
residue was diluted with CH.sub.2Cl.sub.2 and washed with aqueous
saturated NaHCO.sub.3, followed by brine. The organic phase
separated, dried over MgSO.sub.4, filtered, and concentrated to an
orange syrup. The residue was purified by silica gel column
chromatography (2-10% MeOH in CH.sub.2Cl.sub.2) to yield Compound
152 (0.35 g, 55%). LCMS and .sup.1H NMR were consistent with the
desired product.
[0845] Compound 152 (0.35 g, 0.182 mmol) was dissolved in 1:1
MeOH/EtOAc (10 mL). The reaction mixture was purged by bubbling a
stream of argon thru the solution for 15 minutes. Pearlman's
catalyst (palladium hydroxide on carbon) was added (35 mg).
Hydrogen gas was bubbled thru the solution for 30 minutes. Upon
completion (TLC 10% MeOH in DCM, and LCMS), the catalyst was
removed by filtration (syringe-tip Teflon filter, 0.45 .mu.m). The
filtrate was concentrated by rotary evaporation, and was dried
briefly under high vacuum to yield Compound 153 (0.33 g,
quantitative). The LCMS was consistent with desired product.
[0846] Compound 153 (0.33 g, 0.18 mmol) was dissolved in anhydrous
DMF (5 mL) with stirring under nitrogen. To this
N,N-Diisopropylethylamine (65 .mu.L, 0.37 mmol) and PFP-TFA (35
.mu.L, 0.28 mmol) were added. The reaction mixture was stirred
under nitrogen for .about.30 min. The reaction mixture turned
magenta upon contact, and gradually turned orange. The pH of the
reaction mixture was maintained at pH=9-10 by adding more
N,N-Diisopropylethylamine. The progress of the reaction was
monitored by TLC and LCMS. Upon completion, the majority of the
solvent was removed under reduced pressure. The residue was diluted
with CH.sub.2Cl.sub.2 (50 mL), and washed with saturated aqueous
NaHCO.sub.3, followed by brine. The organic layer was dried over
MgSO.sub.4, filtered, and concentrated to an orange syrup. The
residue was purified by column chromatography and eluted with 2-10%
MeOH in CH.sub.2Cl.sub.2 to yield Compound 154 (0.29 g, 79%). LCMS
and .sup.1H NMR were consistent with the desired product.
##STR00209##
[0847] Oligomeric Compound 155, comprising a GalNAc.sub.3-6
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-6 (GalNAc.sub.3-6.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
[0848] The structure of GalNAc.sub.3-6 (GalNAc.sub.3-6.sub.a-CM-)
is shown below:
##STR00210##
Example 52: Preparation of Oligonucleotide 160 Comprising
GalNAc.sub.3-9
##STR00211## ##STR00212##
[0850] Compound 156 was synthesized following the procedure
described in the literature Med. Chem. 2004, 47, 5798-5808).
[0851] Compound 156, (18.60 g, 29.28 mmol) was dissolved in
methanol (200 mL). Palladium on carbon (6.15 g, 10 wt %, loading
(dry basis), matrix carbon powder, wet) was added. The reaction
mixture was stirred at room temperature under hydrogen for 18 h.
The reaction mixture was filtered through a pad of celite and the
celite pad was washed thoroughly with methanol. The combined
filtrate was washed and concentrated to dryness. The residue was
purified by silica gel column chromatography and eluted with 5-10%
methanol in dichloromethane to yield Compound 157 (14.26 g, 89%).
Mass m/z 544.1 [M-H].sup.-.
[0852] Compound 157 (5 g, 9.17 mmol) was dissolved in anhydrous DMF
(30 mL). HBTU (3.65 g, 9.61 mmol) and N,N-Diisopropylethylamine
(13.73 mL, 78.81 mmol) were added and the reaction mixture was
stirred at room temperature for 5 minutes. To this a solution of
compound 47 (2.96 g, 7.04 mmol) was added. The reaction was stirred
at room temperature for 8 h. The reaction mixture was poured into a
saturated NaHCO.sub.3 aqueous solution. The mixture was extracted
with ethyl acetate and the organic layer was washed with brine and
dried (Na.sub.2SO.sub.4), filtered and evaporated. The residue
obtained was purified by silica gel column chromatography and
eluted with 50% ethyl acetate in hexane to yield compound 158 (8.25
g, 73.3%). The structure was confirmed by MS and .sup.1H NMR
analysis.
[0853] Compound 158 (7.2 g, 7.61 mmol) was dried over
P.sub.2O.sub.5 under reduced pressure. The dried compound was
dissolved in anhydrous DMF (50 mL). To this 1H-tetrazole (0.43 g,
6.09 mmol) and N-methylimidazole (0.3 mL, 3.81 mmol) and
2-cyanoethyl-N,N,N',N'-tetraisopropyl phosphorodiamidite (3.65 mL,
11.50 mmol) were added. The reaction mixture was stirred t under an
argon atmosphere for 4 h. The reaction mixture was diluted with
ethyl acetate (200 mL). The reaction mixture was washed with
saturated NaHCO.sub.3 and brine. The organic phase was separated,
dried (Na.sub.2SO.sub.4), filtered and evaporated. The residue was
purified by silica gel column chromatography and eluted with 50-90%
ethyl acetate in hexane to yield Compound 159 (7.82 g, 80.5%). The
structure was confirmed by LCMS and .sup.31P NMR analysis.
##STR00213##
[0854] Oligomeric Compound 160, comprising a GalNAc.sub.3-9
conjugate group, was prepared using standard oligonucleotide
synthesis procedures. Three units of compound 159 were coupled to
the solid support, followed by nucleotide phosphoramidites.
Treatment of the protected oligomeric compound with aqueous ammonia
yielded compound 160. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-9 (GalNAc.sub.3-9.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-9 (GalNAc.sub.3-9.sub.a-CM) is shown below:
##STR00214##
Example 53: Alternate Procedure for Preparation of Compound 18
(GalNAc.sub.3-1a and GalNAc.sub.3-3a)
##STR00215##
[0856] Lactone 161 was reacted with diamino propane (3-5 eq) or
Mono-Boc protected diamino propane (1 eq) to provide alcohol 162a
or 162b. When unprotected propanediamine was used for the above
reaction, the excess diamine was removed by evaporation under high
vacuum and the free amino group in 162a was protected using CbzCl
to provide 162b as a white solid after purification by column
chromatography. Alcohol 162b was further reacted with compound 4 in
the presence of TMSOTf to provide 163a which was converted to 163b
by removal of the Cbz group using catalytic hydrogenation. The
pentafluorophenyl (PFP) ester 164 was prepared by reacting triacid
113 (see Example 48) with PFPTFA (3.5 eq) and pyridine (3.5 eq) in
DMF (0.1 to 0.5 M). The triester 164 was directly reacted with the
amine 163b (3-4 eq) and DIPEA (3-4 eq) to provide Compound 18. The
above method greatly facilitates purification of intermediates and
minimizes the formation of byproducts which are formed using the
procedure described in Example 4.
Example 54: Alternate Procedure for Preparation of Compound 18
(GalNAc.sub.3-1a and GalNAc.sub.3-3a)
##STR00216##
[0858] The triPFP ester 164 was prepared from acid 113 using the
procedure outlined in example 53 above and reacted with mono-Boc
protected diamine to provide 165 in essentially quantitative yield.
The Boc groups were removed with hydrochloric acid or
trifluoroacetic acid to provide the triamine which was reacted with
the PFP activated acid 166 in the presence of a suitable base such
as DIPEA to provide Compound 18.
[0859] The PFP protected Gal-NAc acid 166 was prepared from the
corresponding acid by treatment with PFPTFA (1-1.2 eq) and pyridine
(1-1.2 eq) in DMF. The precursor acid in turn was prepared from the
corresponding alcohol by oxidation using TEMPO (0.2 eq) and BAIB in
acetonitrile and water. The precursor alcohol was prepared from
sugar intermediate 4 by reaction with 1,6-hexanediol (or
1,5-pentanediol or other diol for other n values) (2-4 eq) and
TMSOTf using conditions described previously in example 47.
Example 55: Dose-Dependent Study of Oligonucleotides Comprising
Either a 3' or 5'-Conjugate Group (Comparison of GalNAc.sub.3-1, 3,
8 and 9) Targeting SRB-1 In Vivo
[0860] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Unconjugated ISIS 353382 was included as a standard. Each of the
various GalNAc.sub.3 conjugate groups was attached at either the 3'
or 5' terminus of the respective oligonucleotide by a
phosphodiester linked 2'-deoxyadenosine nucleoside (cleavable
moiety).
TABLE-US-00029 TABLE 26 Modified ASO targeting SRB-1 SEQ ID ASO
Sequence (5' to 3') Motif Conjugate No. ISIS 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds 5/10/5 none 28
(parent)
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.e-
sT.sub.e ISIS 655861
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds 5/10/5 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o ISIS 664078
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds 5/10/5 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o ISIS 661161 5/10/5 30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
ISIS 665001 5/10/5 30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
Capital letters indicate the nucleobase for each nucleoside and
.sup.mC indicates a 5-methyl cytosine. Subscripts: "e" indicates a
2'-MOE modified nucleoside; "d" indicates a
.beta.-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0861] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9. The structure of GalNAc.sub.3-9 was shown previously
in Example 52. The structure of GalNAc.sub.3-3 was shown previously
in Example 39. The structure of GalNAc.sub.3-8 was shown previously
in Example 47.
Treatment
[0862] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 353382, 655861, 664078, 661161, 665001 or with
saline. Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration to determine
the liver SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM.
RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control. As illustrated in Table 27,
treatment with antisense oligonucleotides lowered SRB-1 mRNA levels
in a dose-dependent manner. Indeed, the antisense oligonucleotides
comprising the phosphodiester linked GalNAc.sub.3-1 and
GalNAc.sub.3-9 conjugates at the 3' terminus (ISIS 655861 and ISIS
664078) and the GalNAc.sub.3-3 and GalNAc.sub.3-8 conjugates linked
at the 5' terminus (ISIS 661161 and ISIS 665001) showed substantial
improvement in potency compared to the unconjugated antisense
oligonucleotide (ISIS 353382). Furthermore, ISIS 664078, comprising
a GalNAc.sub.3-9 conjugate at the 3' terminus was essentially
equipotent compared to ISIS 655861, which comprises a
GalNAc.sub.3-1 conjugate at the 3' terminus. The 5' conjugated
antisense oligonucleotides, ISIS 661161 and ISIS 665001, comprising
a GalNAc.sub.3-3 or GalNAc.sub.3-9, respectively, had increased
potency compared to the 3' conjugated antisense oligonucleotides
(ISIS 655861 and ISIS 664078).
TABLE-US-00030 TABLE 27 ASOs containing GalNAc.sub.3-1, 3, 8 or 9
targeting SRB-1 ISIS Dosage SRB-1 mRNA No. (mg/kg) (% Saline)
Conjugate Saline n/a 100 353382 3 88 none 10 68 30 36 655861 0.5 98
GalNac.sub.3-1 (3') 1.5 76 5 31 15 20 664078 0.5 88 GalNac.sub.3-9
(3') 1.5 85 5 46 15 20 661161 0.5 92 GalNac.sub.3-3 (5') 1.5 59 5
19 15 11 665001 0.5 100 GalNac.sub.3-8 (5') 1.5 73 5 29 15 13
[0863] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The change in body weights
was evaluated with no significant change from the saline group.
ALTs, ASTs, total bilirubin and BUN values are shown in the table
below.
TABLE-US-00031 TABLE 28 Dosage Total ISIS No. mg/kg ALT AST
Bilirubin BUN Conjugate Saline 24 59 0.1 37.52 353382 3 21 66 0.2
34.65 none 10 22 54 0.2 34.2 30 22 49 0.2 33.72 655861 0.5 25 62
0.2 30.65 GalNac.sub.3-1 (3') 1.5 23 48 0.2 30.97 5 28 49 0.1 32.92
15 40 97 0.1 31.62 664078 0.5 40 74 0.1 35.3 GalNac.sub.3-9 (3')
1.5 47 104 0.1 32.75 5 20 43 0.1 30.62 15 38 92 0.1 26.2 661161 0.5
101 162 0.1 34.17 GalNac.sub.3-3 (5') 1.5 g 42 100 0.1 33.37 5 g 23
99 0.1 34.97 15 53 83 0.1 34.8 665001 0.5 28 54 0.1 31.32
GalNac.sub.3-8 (5') 1.5 42 75 0.1 32.32 5 24 42 0.1 31.85 15 32 67
0.1 31.
Example 56: Dose-Dependent Study of Oligonucleotides Comprising
Either a 3' or 5'-Conjugate Group (Comparison of GalNAc.sub.3-1, 2,
3, 5, 6, 7 and 10) Targeting SRB-1 In Vivo
[0864] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Unconjugated ISIS 353382 was included as a standard. Each of the
various GalNAc.sub.3 conjugate groups was attached at the 5'
terminus of the respective oligonucleotide by a phosphodiester
linked 2'-deoxyadenosine nucleoside (cleavable moiety) except for
ISIS 655861 which had the GalNAc.sub.3 conjugate group attached at
the 3' terminus.
TABLE-US-00032 TABLE 29 Modified ASO targeting SRB-1 SEQ ASO
Sequence (5' to 3') Motif Conjugate ID No. ISIS 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds 5/10/5 no
conjugate 28 (parent)
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.e-
sT.sub.e ISIS 655861
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds 5/10/5 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o ISIS 664507
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 5/10/5 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS 661161 5/10/5
30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
ISIS 666224
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 5/10/5 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS 666961
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 5/10/5 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS 666981
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 5/10/5 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS 666881
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub-
.ds 5/10/5 30
.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.-
mC.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e Capital
letters indicate the nucleobase for each nucleoside and .sup.mC
indicates a 5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE
modified nucleoside; "d" indicates a
.beta.-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0865] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9. The structure of GalNAc.sub.3-2.sub.a was shown
previously in Example 37. The structure of GalNAc.sub.3-3.sub.a was
shown previously in Example 39. The structure of
GalNAc.sub.3-5.sub.a was shown previously in Example 49. The
structure of GalNAc.sub.3-6.sub.a was shown previously in Example
51. The structure of GalNAc.sub.3-7.sub.a was shown previously in
Example 48. The structure of GalNAc.sub.3-10.sub.a was shown
previously in Example 46.
Treatment
[0866] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 353382, 655861, 664507, 661161, 666224, 666961,
666981, 666881 or with saline. Each treatment group consisted of 4
animals. The mice were sacrificed 72 hours following the final
administration to determine the liver SRB-1 mRNA levels using
real-time PCR and RIBOGREEN.RTM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.) according to standard
protocols. The results below are presented as the average percent
of SRB-1 mRNA levels for each treatment group, normalized to the
saline control.
[0867] As illustrated in Table 30, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. Indeed, the conjugated antisense oligonucleotides showed
substantial improvement in potency compared to the unconjugated
antisense oligonucleotide (ISIS 353382). The 5' conjugated
antisense oligonucleotides showed a slight increase in potency
compared to the 3' conjugated antisense oligonucleotide.
TABLE-US-00033 TABLE 30 ISIS Dosage SRB-1 mRNA No. (mg/kg) (%
Saline) Conjugate Saline n/a 100.0 353382 3 96.0 none 10 73.1 30
36.1 655861 0.5 99.4 GalNac.sub.3-1 (3') 1.5 81.2 5 33.9 15 15.2
664507 0.5 102.0 GalNac.sub.3-2 (5') 1.5 73.2 5 31.3 15 10.8 661161
0.5 90.7 GalNac.sub.3-3 (5') 1.5 67.6 5 24.3 15 11.5 666224 0.5
96.1 GalNac.sub.3-5 (5') 1.5 61.6 5 25.6 15 11.7 666961 0.5 85.5
GalNAc.sub.3-6 (5') 1.5 56.3 5 34.2 15 13.1 666981 0.5 84.7
GalNAc.sub.3-7 (5') 1.5 59.9 5 24.9 15 8.5 666881 0.5 100.0
GalNAc.sub.3-10 (5') 1.5 65.8 5 26.0 15 13.0
[0868] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The change in body weights
was evaluated with no significant change from the saline group.
ALTs, ASTs, total bilirubin and BUN values are shown in Table 31
below.
TABLE-US-00034 TABLE 31 Dosage Total ISIS No. mg/kg ALT AST
Bilirubin BUN Conjugate Saline 26 57 0.2 27 353382 3 25 92 0.2 27
none 10 23 40 0.2 25 30 29 54 0.1 28 655861 0.5 25 71 0.2 34
GalNac.sub.3-1 (3') 1.5 28 60 0.2 26 5 26 63 0.2 28 15 25 61 0.2 28
664507 0.5 25 62 0.2 25 GalNac.sub.3-2 (5') 1.5 24 49 0.2 26 5 21
50 0.2 26 15 59 84 0.1 22 661161 0.5 20 42 0.2 29 GalNac.sub.3-3
(5') 1.5 g 37 74 0.2 25 5g 28 61 0.2 29 15 21 41 0.2 25 666224 0.5
34 48 0.2 21 GalNac.sub.3-5 (5') 1.5 23 46 0.2 26 5 24 47 0.2 23 15
32 49 0.1 26 666961 0.5 17 63 0.2 26 GalNAc.sub.3-6 (5') 1.5 23 68
0.2 26 5 25 66 0.2 26 15 29 107 0.2 28 666981 0.5 24 48 0.2 26
GalNAc.sub.3-7 (5') 1.5 30 55 0.2 24 5 46 74 0.1 24 15 29 58 0.1 26
666881 0.5 20 65 0.2 27 GalNAc.sub.3-10 (5') 1.5 23 59 0.2 24 5 45
70 0.2 26 15 21 57 0.2 24
Example 57: Duration of Action Study of Oligonucleotides Comprising
a 3'-Conjugate Group Targeting ApoC III In Vivo
[0869] Mice were injected once with the doses indicated below and
monitored over the course of 42 days for ApoC-III and plasma
triglycerides (Plasma TG) levels. The study was performed using 3
transgenic mice that express human APOC-III in each group.
TABLE-US-00035 TABLE 32 Modified ASO targeting ApoC III SEQ Link-
ID ASO Sequence (5' to 3') ages No. ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds PS 20 304801
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.esT-
.sub.esT.sub.esA.sub.esT.sub.e ISIS
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds PS 21 647535
A.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.esT.sub.esT.sub.esA.sub.esT.sub-
.eo ISIS
A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.dsT.sub.dsT-
.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds PO/ 21 647536
A.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoT.sub.esA.sub.esT.sub-
.eo PS Capital letters indicate the nucleobase for each nucleoside
and .sup.mC indicates a 5-methyl cytosine. Subscripts: "e"
indicates a 2'-MOE modified nucleoside; "d" indicates a
.beta.-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0870] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9.
TABLE-US-00036 TABLE 33 ApoC III mRNA (% Saline on Day 1) and
Plasma TG Levels (% Saline on Day 1) Day Day Day Day Day ASO Dose
Target 3 7 14 35 42 Saline 0 mg/kg ApoC-III 98 100 100 95 116 ISIS
304801 30 mg/kg ApoC-III 28 30 41 65 74 ISIS 647535 10 mg/kg
ApoC-III 16 19 25 74 94 ISIS 647536 10 mg/kg ApoC-III 18 16 17 35
51 Saline 0 mg/kg Plasma TG 121 130 123 105 109 ISIS 304801 30
mg/kg Plasma TG 34 37 50 69 69 ISIS 647535 10 mg/kg Plasma TG 18 14
24 18 71 ISIS 647536 10 mg/kg Plasma TG 21 19 15 32 35
[0871] As can be seen in the table above the duration of action
increased with addition of the 3'-conjugate group compared to the
unconjugated oligonucleotide. There was a further increase in the
duration of action for the conjugated mixed PO/PS oligonucleotide
647536 as compared to the conjugated full PS oligonucleotide
647535.
Example 58: Dose-Dependent Study of Oligonucleotides Comprising a
3'-Conjugate Group (Comparison of GalNAc.sub.3-1 and
GalNAc.sub.4-11) Targeting SRB-1 In Vivo
[0872] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Unconjugated ISIS 440762 was included as an unconjugated standard.
Each of the conjugate groups were attached at the 3' terminus of
the respective oligonucleotide by a phosphodiester linked
2'-deoxyadenosine nucleoside cleavable moiety.
[0873] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9. The structure of GalNAc.sub.3-11.sub.a was shown
previously in Example 50.
Treatment
[0874] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 440762, 651900, 663748 or with saline. Each
treatment group consisted of 4 animals. The mice were sacrificed 72
hours following the final administration to determine the liver
SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control.
[0875] As illustrated in Table 34, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. The antisense oligonucleotides comprising the
phosphodiester linked GalNAc.sub.3-1 and GalNAc.sub.4-11 conjugates
at the 3' terminus (ISIS 651900 and ISIS 663748) showed substantial
improvement in potency compared to the unconjugated antisense
oligonucleotide (ISIS 440762). The two conjugated oligonucleotides,
GalNAc.sub.3-1 and GalNAc.sub.4-11, were equipotent.
TABLE-US-00037 TABLE 34 Modified ASO targeting SRB-1 Dose % Saline
SEQ ID ASO Sequence (5' to 3') mg/kg control No. Saline 100 ISIS
440762
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.dsG.sub.dsA.sub.ds 0.6 73.45 22
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k 2 59.66 6 23.50 ISIS
651900
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.dsG.sub.dsA.sub.ds 0.2 62.75 23
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ko 0.6 29.14 2 8.61 6
5.62 ISIS 663748
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.dsG.sub.dsA.sub.ds 0.2 63.99 23
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ko 0.6 33.53 2 7.58 6
5.52 Capital letters indicate the nucleobase for each nucleoside
and .sup.mC indicates a 5-methyl cytosine. Subscripts: "e"
indicates a 2'-MOE modified nucleoside; "k" indicates
6'-(S)-CH.sub.3 bicyclic nucleoside; "d" indicates a
.beta.-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o``` indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0876] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The change in body weights
was evaluated with no significant change from the saline group.
ALTs, ASTs, total bilirubin and BUN values are shown in Table 35
below.
TABLE-US-00038 TABLE 35 Dosage Total ISIS No. mg/kg ALT AST
Bilirubin BUN Conjugate Saline 30 76 0.2 40 440762 0.60 32 70 0.1
35 none 2 26 57 0.1 35 6 31 48 0.1 39 651900 0.2 32 115 0.2 39
GalNac.sub.3-1 (3') 0.6 33 61 0.1 35 2 30 50 0.1 37 6 34 52 0.1 36
663748 0.2 28 56 0.2 36 GalNac.sub.4-11 (3') 0.6 34 60 0.1 35 2 44
62 0.1 36 6 38 71 0.1 33
Example 59: Effects of GalNAc.sub.3-1 Conjugated ASOs Targeting FXI
In Vivo
[0877] The oligonucleotides listed below were tested in a multiple
dose study for antisense inhibition of FXI in mice. ISIS 404071 was
included as an unconjugated standard. Each of the conjugate groups
was attached at the 3' terminus of the respective oligonucleotide
by a phosphodiester linked 2'-deoxyadenosine nucleoside cleavable
moiety.
TABLE-US-00039 TABLE 36 Modified ASOs targeting FXI SEQ Link- ID
ASO Sequence (5' to 3') ages No. ISIS
T.sub.esG.sub.esG.sub.esT.sub.esA.sub.esA.sub.dsT.sub.ds PS 31
404071 .sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.esG.sub.esA.sub.es
G.sub.esG.sub.e ISIS
T.sub.esG.sub.esG.sub.esT.sub.esA.sub.esA.sub.dsT.sub.ds PS 32
656172
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds
T.sub.ds.sup.mC.sub.dsA.sub.esG.sub.esA.sub.esG.sub.esG.sub.eo ISIS
T.sub.esG.sub.eoG.sub.eoT.sub.eoA.sub.eoA.sub.ds PO/PS 32 656173
T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eo
A.sub.esG.sub.esG.sub.eo Capital letters indicate the nucleobase
for each nucleoside and .sup.mC indicates a 5-methyl cytosine.
Subscripts: "e" indicates a 2'-MOE modified nucleoside; "d"
indicates a .beta.-D-2'-deoxyribonucleoside; "s" indicates a
phosphorothioate internucleoside linkage (PS); "o" indicates a
phosphodiester internucleoside linkage (PO); and "o'" indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0878] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9.
Treatment
[0879] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously twice a week for 3 weeks
at the dosage shown below with ISIS 404071, 656172, 656173 or with
PBS treated control. Each treatment group consisted of 4 animals.
The mice were sacrificed 72 hours following the final
administration to determine the liver FXI mRNA levels using
real-time PCR and RIBOGREEN.RTM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.) according to standard
protocols. Plasma FXI protein levels were also measured using
ELISA. FXI mRNA levels were determined relative to total RNA (using
RIBOGREEN.RTM.), prior to normalization to PBS-treated control. The
results below are presented as the average percent of FXI mRNA
levels for each treatment group. The data was normalized to
PBS-treated control and is denoted as "% PBS". The ED.sub.50s were
measured using similar methods as described previously and are
presented below.
TABLE-US-00040 TABLE 37 Factor XI mRNA (% Saline) Dose % ASO mg/kg
Control Conjugate Linkages Saline 100 none ISIS 3 92 none PS 404071
10 40 30 15 ISIS 0.7 74 GalNAc.sub.3-1 PS 656172 2 33 6 9 ISIS 0.7
49 GalNAc.sub.3-1 PO/PS 656173 2 22 6 1
[0880] As illustrated in Table 37, treatment with antisense
oligonucleotides lowered FXI mRNA levels in a dose-dependent
manner. The oligonucleotides comprising a 3'-GalNAc.sub.3-1
conjugate group showed substantial improvement in potency compared
to the unconjugated antisense oligonucleotide (ISIS 404071).
Between the two conjugated oligonucleotides an improvement in
potency was further provided by substituting some of the PS
linkages with PO (ISIS 656173).
[0881] As illustrated in Table 37a, treatment with antisense
oligonucleotides lowered FXI protein levels in a dose-dependent
manner. The oligonucleotides comprising a 3'-GalNAc.sub.3-1
conjugate group showed substantial improvement in potency compared
to the unconjugated antisense oligonucleotide (ISIS 404071).
Between the two conjugated oligonucleotides an improvement in
potency was further provided by substituting some of the PS
linkages with PO (ISIS 656173).
TABLE-US-00041 TABLE 37a Factor XI protein (% Saline) Dose Protein
(% ASO mg/kg Control) Conjugate Linkages Saline 100 none ISIS 3 127
none PS 404071 10 32 30 3 ISIS 0.7 70 GalNAc.sub.3-1 PS 656172 2 23
6 1 ISIS 0.7 45 GalNAc.sub.3-1 PO/PS 656173 2 6 6 0
[0882] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin, total albumin, CRE and BUN were also evaluated. The
change in body weights was evaluated with no significant change
from the saline group. ALTs, ASTs, total bilirubin and BUN values
are shown in the table below.
TABLE-US-00042 TABLE 38 Dosage Total Total ISIS No. mg/kg ALT AST
Albumin Bilirubin CRE BUN Conjugate Saline 71.8 84.0 3.1 0.2 0.2
22.9 404071 3 152.8 176.0 3.1 0.3 0.2 23.0 none 10 73.3 121.5 3.0
0.2 0.2 21.4 30 82.5 92.3 3.0 0.2 0.2 23.0 656172 0.7 62.5 111.5
3.1 0.2 0.2 23.8 GalNac.sub.3-1 (3') 2 33.0 51.8 2.9 0.2 0.2 22.0 6
65.0 71.5 3.2 0.2 0.2 23.9 656173 0.7 54.8 90.5 3.0 0.2 0.2 24.9
GalNac.sub.3-1 (3') 2 85.8 71.5 3.2 0.2 0.2 21.0 6 114.0 101.8 3.3
0.2 0.2 22.7
Example 60: Effects of Conjugated ASOs Targeting SRB-1 In Vitro
[0883] The oligonucleotides listed below were tested in a multiple
dose study for antisense inhibition of SRB-1 in primary mouse
hepatocytes. ISIS 353382 was included as an unconjugated standard.
Each of the conjugate groups were attached at the 3' or 5' terminus
of the respective oligonucleotide by a phosphodiester linked
2'-deoxyadenosine nucleoside cleavable moiety.
TABLE-US-00043 TABLE 39 Modified ASO targeting SRB-1 SEQ Sequence
ID ASO (5' to 3') Motif Conjugate No. ISIS
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
5/10/5 none 28 353382
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS
G.sub.es.sup.mC.sub.esT.sub.eST.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
5/10/5 29 655861
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.es
T.sub.eo ISIS
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.ds
5/10/5 29 655862
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.d-
s T.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.eo ISIS
G.sub.es 5/10/5 30 661161
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
ISIS G.sub.es 5/10/5 30 665001
.sup.mG.sub.esT.sub.esT.sub.eS.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
5/10/5 29 664078
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.d-
s T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.eo ISIS
G.sub.es 5/10/5 30 666961
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS G.sub.es
5/10/5 30 664507
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS G.sub.es
5/10/5 30 666881
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS G.sub.es
5/10/5 30 666224
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e ISIS G.sub.es
5/10/5 30 666981
.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.d-
s
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e Capital letters
indicate the nucleobase for each nucleoside and .sup.mC indicates a
5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE modified
nucleoside; "d" indicates a .beta.-D-2'-deoxyribonucleoside; "s"
indicates a phosphorothioate internucleoside linkage (PS); "o"
indicates a phosphodiester internucleoside linkage (PO); and "o'"
indicates --O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0884] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9. The structure of GalNAc.sub.3-3a was shown previously
in Example 39. The structure of GalNAc.sub.3-8a was shown
previously in Example 47. The structure of GalNAc.sub.3-9a was
shown previously in Example 52. The structure of GalNAc.sub.3-6a
was shown previously in Example 51. The structure of
GalNAc.sub.3-2a was shown previously in Example 37. The structure
of GalNAc.sub.3-10a was shown previously in Example 46. The
structure of GalNAc.sub.3-5a was shown previously in Example 49.
The structure of GalNAc.sub.3-7a was shown previously in Example
48.
Treatment
[0885] The oligonucleotides listed above were tested in vitro in
primary mouse hepatocyte cells plated at a density of 25,000 cells
per well and treated with 0.03, 0.08, 0.24, 0.74, 2.22, 6.67 or 20
nM modified oligonucleotide. After a treatment period of
approximately 16 hours, RNA was isolated from the cells and mRNA
levels were measured by quantitative real-time PCR and the SRB-1
mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM..
[0886] The IC.sub.50 was calculated using standard methods and the
results are presented in Table 40. The results show that, under
free uptake conditions in which no reagents or electroporation
techniques are used to artificially promote entry of the
oligonucleotides into cells, the oligonucleotides comprising a
GalNAc conjugate were significantly more potent in hepatocytes than
the parent oligonucleotide (ISIS 353382) that does not comprise a
GalNAc conjugate.
TABLE-US-00044 TABLE 40 Inter- SEQ IC.sub.50 nucleoside ID ASO (nM)
linkages Conjugate No. ISIS 353382 190.sup.a PS none 28 ISIS 655861
11.sup.a PS GalNAc.sub.3-1 29 ISIS 655862 3.sup. PO/PS
GalNAc.sub.3-1 29 ISIS 661161 15.sup.a PS GalNAc.sub.3-3 30 ISIS
665001 20.sup. PS GalNAc.sub.3-8 30 ISIS 664078 55.sup. PS
GalNAc.sub.3-9 29 ISIS 666961 22.sup.a PS GalNAc.sub.3-6 30 ISIS
664507 30.sup. PS GalNAc.sub.3-2 30 ISIS 666881 30.sup. PS
GalNAc.sub.3-10 30 ISIS 666224 30.sup.a PS GalNAc.sub.3-5 30 ISIS
666981 40.sup. PS GalNAc.sub.3-7 30 .sup.aAverage of multiple
runs.
Example 61: Preparation of Oligomeric Compound 175 Comprising
GalNAc.sub.3-12
##STR00217## ##STR00218## ##STR00219##
[0887] Compound 169 is commercially available. Compound 172 was
prepared by addition of benzyl (perfluorophenyl) glutarate to
compound 171. The benzyl (perfluorophenyl) glutarate was prepared
by adding PFP-TFA and DIEA to 5-(benzyloxy)-5-oxopentanoic acid in
DMF. Oligomeric compound 175, comprising a GalNAc.sub.3-12
conjugate group, was prepared from compound 174 using the general
procedures illustrated in Example 46. The GalNAc.sub.3 cluster
portion of the conjugate group GalNAc.sub.3-12
(GalNAc.sub.3-12.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. In a certain embodiments,
the cleavable moiety is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
The structure of GalNAc.sub.3-12 (GalNAc.sub.3-12.sub.a-CM-) is
shown below:
##STR00220##
Example 62: Preparation of Oligomeric Compound 180 Comprising
GalNAc.sub.3-13
##STR00221##
[0888] Compound 176 was prepared using the general procedure shown
in Example 2. Oligomeric compound 180, comprising a GalNAc.sub.3-13
conjugate group, was prepared from compound 177 using the general
procedures illustrated in Example 49. The GalNAc.sub.3 cluster
portion of the conjugate group GalNAc.sub.3-13
(GalNAc.sub.3-13.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. In a certain embodiments,
the cleavable moiety is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
The structure of GalNAc.sub.3-13 (GalNAc.sub.3-13.sub.a-CM-) is
shown below:
##STR00222##
Example 63: Preparation of Oligomeric Compound 188 Comprising
GalNAc.sub.3-14
##STR00223## ##STR00224##
[0889] Compounds 181 and 185 are commercially available. Oligomeric
compound 188, comprising a GalNAc.sub.3-14 conjugate group, was
prepared from compound 187 using the general procedures illustrated
in Example 46. The GalNAc.sub.3 cluster portion of the conjugate
group GalNAc.sub.3-14 (GalNAc.sub.3-14.sub.a) can be combined with
any cleavable moiety to provide a variety of conjugate groups. In
certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-14 (GalNAc.sub.3-14.sub.a-CM-) is shown below:
##STR00225##
Example 64: Preparation of Oligomeric Compound 197 Comprising
GalNAc.sub.3-15
##STR00226##
[0890] Compound 189 is commercially available. Compound 195 was
prepared using the general procedure shown in Example 31.
Oligomeric compound 197, comprising a GalNAc.sub.3-15 conjugate
group, was prepared from compounds 194 and 195 using standard
oligonucleotide synthesis procedures. The GalNAc.sub.3 cluster
portion of the conjugate group GalNAc.sub.3-15
(GalNAc.sub.3-15.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. In certain embodiments,
the cleavable moiety is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
The structure of GalNAc.sub.3-15 (GalNAc.sub.3-15.sub.a-CM-) is
shown below:
##STR00227##
Example 65: Dose-Dependent Study of Oligonucleotides Comprising a
5'-Conjugate Group (Comparison of GalNAc.sub.3-3, 12, 13, 14, and
15) Targeting SRB-1 In Vivo
[0891] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Unconjugated ISIS 353382 was included as a standard. Each of the
GalNAc.sub.3 conjugate groups was attached at the 5' terminus of
the respective oligonucleotide by a phosphodiester linked
2'-deoxyadenosine nucleoside (cleavable moiety).
TABLE-US-00045 TABLE 41 Modified ASOs targeting SRB-1 SEQ ISIS ID
No. Sequences (5' to 3') Conjugate No. 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds none 28 T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds
G.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 661161
G.sub.es.sup.mC.sub.es GalNAC.sub.3-3 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 671144
G.sub.es.sup.mC.sub.es GalNAC.sub.3-12 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 670061
G.sub.es.sup.mC.sub.es GalNAC.sub.3-13 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 671261
G.sub.es.sup.mC.sub.es GalNAC.sub.3-14 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 671262
G.sub.es.sup.mC.sub.es GalNAC.sub.3-15 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e Capital
letters indicate the nucleobase for each nucleoside and .sup.mC
indicates a 5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE
modified nucleoside; "d" indicates a
.beta.-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o'" indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0892] The structure of GalNAc.sub.3-3.sub.a was shown previously
in Example 39. The structure of GalNAc.sub.3-12a was shown
previously in Example 61. The structure of GalNAc.sub.3-13a was
shown previously in Example 62. The structure of GalNAc.sub.3-14a
was shown previously in Example 63. The structure of
GalNAc.sub.3-15a was shown previously in Example 64.
Treatment
[0893] Six to eight week old C57bl6 mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once or twice at the
dosage shown below with ISIS 353382, 661161, 671144, 670061,
671261, 671262, or with saline. Mice that were dosed twice received
the second dose three days after the first dose. Each treatment
group consisted of 4 animals. The mice were sacrificed 72 hours
following the final administration to determine the liver SRB-1
mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control.
[0894] As illustrated in Table 42, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. No significant differences in target knockdown were
observed between animals that received a single dose and animals
that received two doses (see ISIS 353382 dosages 30 and 2.times.15
mg/kg; and ISIS 661161 dosages 5 and 2.times.2.5 mg/kg). The
antisense oligonucleotides comprising the phosphodiester linked
GalNAc.sub.3-3, 12, 13, 14, and 15 conjugates showed substantial
improvement in potency compared to the unconjugated antisense
oligonucleotide (ISIS 335382).
TABLE-US-00046 TABLE 42 SRB-1 mRNA (% Saline) SRB-1 ISIS Dosage
mRNA (% ED.sub.50 No. (mg/kg) Saline) (mg/kg) Conjugate Saline n/a
100.0 n/a n/a 353382 3 85.0 22.4 none 10 69.2 30 34.2 2 .times. 15
36.0 661161 0.5 87.4 2.2 GalNAc.sub.3-3 1.5 59.0 5 25.6 2 .times.
2.5 27.5 15 17.4 671144 0.5 101.2 3.4 GalNAc.sub.3-12 1.5 76.1 5
32.0 15 17.6 670061 0.5 94.8 2.1 GalNAc.sub.3-13 1.5 57.8 5 20.7 15
13.3 671261 0.5 110.7 4.1 GalNAc.sub.3-14 1.5 81.9 5 39.8 15 14.1
671262 0.5 109.4 9.8 GalNAc.sub.3-15 1.5 99.5 5 69.2 15 36.1
[0895] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The changes in body weights
were evaluated with no significant differences from the saline
group (data not shown). ALTs, ASTs, total bilirubin and BUN values
are shown in Table 43 below.
TABLE-US-00047 TABLE 43 Total Dosage ALT Bilirubin BUN ISIS No.
(mg/kg) (U/L) AST (U/L) (mg/dL) (mg/dL) Conjugate Saline n/a 28 60
0.1 39 n/a 353382 3 30 77 0.2 36 none 10 25 78 0.2 36 30 28 62 0.2
35 2 .times. 15 22 59 0.2 33 661161 0.5 39 72 0.2 34 GalNAc.sub.3-3
1.5 26 50 0.2 33 5 41 80 0.2 32 2 .times. 2.5 24 72 0.2 28 15 32 69
0.2 36 671144 0.5 25 39 0.2 34 GalNAc.sub.3-12 1.5 26 55 0.2 28 5
48 82 0.2 34 15 23 46 0.2 32 670061 0.5 27 53 0.2 33
GalNAc.sub.3-13 1.5 24 45 0.2 35 5 23 58 0.1 34 15 24 72 0.1 31
671261 0.5 69 99 0.1 33 GalNAc.sub.3-14 1.5 34 62 0.1 33 5 43 73
0.1 32 15 32 53 0.2 30 671262 0.5 24 51 0.2 29 GalNAc.sub.3-15 1.5
32 62 0.1 31 5 30 76 0.2 32 15 31 64 0.1 32
Example 66: Effect of Various Cleavable Moieties on Antisense
Inhibition In Vivo by Oligonucleotides Targeting SRB-1 Comprising a
5'-GalNAc.sub.3 Cluster
[0896] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Each of the GalNAc.sub.3 conjugate groups was attached at the 5'
terminus of the respective oligonucleotide by a phosphodiester
linked nucleoside (cleavable moiety (CM)).
TABLE-US-00048 TABLE 44 Modified ASOs targeting SRB-I ISIS
GalNAc.sub.3 SEQ No. Sequences (5' to 3') Cluster CM ID No. 661161
G.sub.es.sup.mC.sub.es GalNAc.sub.3-3a A.sub.d 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds
A.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub-
.es .sup.mC.sub.esT.sub.esT.sub.e 670699 G.sub.es.sup.mC.sub.eo
GalNAc.sub.3-3a T.sub.d 33
T.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds
A.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.eo
.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 670700
G.sub.es.sup.mC.sub.eo GalNAc.sub.3-3a A.sub.e 30
T.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds
A.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.eo
.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 670701 G.sub.es
GalNAc.sub.3-3a T.sub.c 33
.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.dsT.sub.ds
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds
T.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 671165
GalNAc.sub.3-13a A.sub.d 30
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.ds
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
G.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e Capital
letters indicate the nucleobase for each nucleoside and .sup.mC
indicates a 5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE
modified nucleoside; "d" indicates a
.beta.-D-2''-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o'" indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0897] The structure of GalNAc.sub.3-3.sub.a was shown previously
in Example 39. The structure of GalNAc.sub.3-13a was shown
previously in Example 62.
Treatment
[0898] Six to eight week old C57bl6 mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with ISIS 661161, 670699, 670700, 670701, 671165, or with
saline. Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration to determine
the liver SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM.
RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control.
[0899] As illustrated in Table 45, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. The antisense oligonucleotides comprising various cleavable
moieties all showed similar potencies.
TABLE-US-00049 TABLE 45 SRB-1 mRNA (% Saline) SRB-1 ISIS Dosage
mRNA GalNAc.sub.3 No. (mg/kg) (% Saline) Cluster CM Saline n/a
100.0 n/a n/a 661161 0.5 87.8 GalNAc.sub.3-3a A.sub.d 1.5 61.3 5
33.8 15 14.0 670699 0.5 89.4 GalNAc.sub.3-3a T.sub.d 1.5 59.4 5
31.3 15 17.1 670700 0.5 79.0 GalNAc.sub.3-3a A.sub.e 1.5 63.3 5
32.8 15 17.9 670701 0.5 79.1 GalNAc.sub.3-3a T.sub.e 1.5 59.2 5
35.8 15 17.7 671165 0.5 76.4 GalNAc.sub.3-13a A.sub.d 1.5 43.2 5
22.6 15 10.0
[0900] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The changes in body weights
were evaluated with no significant differences from the saline
group (data not shown). ALTs, ASTs, total bilirubin and BUN values
are shown in Table 46 below.
TABLE-US-00050 TABLE 46 Total ISIS Dosage ALT AST Bilirubin BUN
GalNAc.sub.3 No. (mg/kg) (U/L) (U/L) (mg/dL) (mg/dL) Cluster CM
Saline n/a 24 64 0.2 31 n/a n/a 661161 0.5 25 64 0.2 31
GalNAc.sub.3-3a A.sub.d 1.5 24 50 0.2 32 5 26 55 0.2 28 15 27 52
0.2 31 670699 0.5 42 83 0.2 31 GalNAc.sub.3-3a T.sub.d 1.5 33 58
0.2 32 5 26 70 0.2 29 15 25 67 0.2 29 670700 0.5 40 74 0.2 27
GalNAc.sub.3-3a A.sub.e 1.5 23 62 0.2 27 5 24 49 0.2 29 15 25 87
0.1 25 670701 0.5 30 77 0.2 27 GalNAc.sub.3-3a T.sub.e 1.5 22 55
0.2 30 5 81 101 0.2 25 15 31 82 0.2 24 671165 0.5 44 84 0.2 26
GalNAc.sub.3-13a A.sub.d 1.5 47 71 0.1 24 5 33 91 0.2 26 15 33 56
0.2 29
Example 67: Preparation of Oligomeric Compound 199 Comprising
GalNAc.sub.3-16
##STR00228##
[0901] Oligomeric compound 199, comprising a GalNAc.sub.3-16
conjugate group, is prepared using the general procedures
illustrated in Examples 7 and 9. The GalNAc.sub.3 cluster portion
of the conjugate group GalNAc.sub.3-16 (GalNAc.sub.3-16.sub.a) can
be combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-16 (GalNAc.sub.3-16.sub.a-CM-) is shown below:
##STR00229##
Example 68: Preparation of Oligomeric Compound 200 Comprising
GalNAc.sub.3-17
##STR00230##
[0902] Oligomeric compound 200, comprising a GalNAc.sub.3-17
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-17 (GalNAc.sub.3-17.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-17 (GalNAc.sub.3-17.sub.a-CM-) is shown below:
##STR00231##
Example 69: Preparation of Oligomeric Compound 201 Comprising
GalNAc.sub.3-18
##STR00232##
[0903] Oligomeric compound 201, comprising a GalNAc.sub.3-18
conjugate group, was prepared using the general procedures
illustrated in Example 46. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-18 (GalNAc.sub.3-18.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-18 (GalNAc.sub.3-18.sub.a-CM-) is shown below:
##STR00233##
Example 70: Preparation of Oligomeric Compound 204 Comprising
GalNAc.sub.3-19
##STR00234##
[0904] Oligomeric compound 204, comprising a GalNAc.sub.3-19
conjugate group, was prepared from compound 64 using the general
procedures illustrated in Example 52. The GalNAc.sub.3 cluster
portion of the conjugate group GalNAc.sub.3-19
(GalNAc.sub.3-19.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. In certain embodiments,
the cleavable moiety is --P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--.
The structure of GalNAc.sub.3-19 (GalNAc.sub.3-19.sub.a-CM-) is
shown below:
##STR00235##
Example 71: Preparation of Oligomeric Compound 210 Comprising
GalNAc.sub.3-20
##STR00236## ##STR00237##
[0905] Compound 205 was prepared by adding PFP-TFA and DIEA to
6-(2,2,2-trifluoroacetamido)hexanoic acid in acetonitrile, which
was prepared by adding triflic anhydride to 6-aminohexanoic acid.
The reaction mixture was heated to 80.degree. C., then lowered to
rt. Oligomeric compound 210, comprising a GalNAc.sub.3-20 conjugate
group, was prepared from compound 208 using the general procedures
illustrated in Example 52. The GalNAc.sub.3 cluster portion of the
conjugate group GalNAc.sub.3-20 (GalNAc.sub.3-20.sub.a) can be
combined with any cleavable moiety to provide a variety of
conjugate groups. In certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.cr P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-20 (GalNAc.sub.3-20.sub.a-CM-) is shown below:
##STR00238##
Example 72: Preparation of Oligomeric Compound 215 Comprising
GalNAc.sub.3-21
##STR00239##
[0906] Compound 211 is commercially available. Oligomeric compound
215, comprising a GalNAc.sub.3-21 conjugate group, was prepared
from compound 213 using the general procedures illustrated in
Example 52. The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-21 (GalNAc.sub.3-21.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. In
certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-21 (GalNAc.sub.3-21.sub.a-CM-) is shown below:
##STR00240##
Example 73: Preparation of Oligomeric Compound 221 Comprising
GalNAc.sub.3-22
##STR00241##
[0907] Compound 220 was prepared from compound 219 using
diisopropylammonium tetrazolide. Oligomeric compound 221,
comprising a GalNAc.sub.3-21 conjugate group, is prepared from
compound 220 using the general procedure illustrated in Example 52.
The GalNAc.sub.3 cluster portion of the conjugate group
GalNAc.sub.3-22 (GalNAc.sub.3-22.sub.a) can be combined with any
cleavable moiety to provide a variety of conjugate groups. In
certain embodiments, the cleavable moiety is
--P(.dbd.O)(OH)-A.sub.d-P(.dbd.O)(OH)--. The structure of
GalNAc.sub.3-22 (GalNAc.sub.3-22.sub.a-CM-) is shown below:
##STR00242##
Example 74: Effect of Various Cleavable Moieties on Antisense
Inhibition In Vivo by Oligonucleotides Targeting SRB-1 Comprising a
5'-GalNAc.sub.3 Conjugate
[0908] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Each of the GalNAc.sub.3 conjugate groups was attached at the 5'
terminus of the respective oligonucleotide.
TABLE-US-00051 TABLE 47 Modified ASOs targeting SRB-1 ISIS
Sequences GalNAc.sub.3 SEQ No. (5' to 3') Cluster CM ID No. 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
s n/a n/a 28
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.es 661161
GalNAc.sub.3- A.sub.d 30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
3a
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.esmC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 666904
GalNAc.sub.3- PO 28
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
3a
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.esmC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 675441
GalNAc.sub.3- A.sub.d 30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
17a
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.esmC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 675442
GalNAc.sub.3- A.sub.d 30
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds
18a
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.esmC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
In all tables, capital letters indicate the nucleobase for each
nucleoside and .sup.mC indicates a 5-methyl cytosine. Subscripts:
"e" indicates a 2'-MOE modified nucleoside; "d" indicates a
0-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate
internucleoside linkage (PS); "o" indicates a phosphodiester
internucleoside linkage (PO); and "o" indicates
--O--P(.dbd.O)(OH)--. Conjugate groups are in bold.
[0909] The structure of GalNAc.sub.3-3.sub.a was shown previously
in Example 39. The structure of GalNAc.sub.3-17a was shown
previously in Example 68, and the structure of GalNAc.sub.3-18a was
shown in Example 69.
Treatment
[0910] Six to eight week old C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with an oligonucleotide listed in Table 47 or with saline.
Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration to determine
the SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control.
[0911] As illustrated in Table 48, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner. The antisense oligonucleotides comprising a GalNAc
conjugate showed similar potencies and were significantly more
potent than the parent oligonucleotide lacking a GalNAc
conjugate.
TABLE-US-00052 TABLE 48 SRB-1 mRNA (% Saline) SRB-1 ISIS Dosage
mRNA GalNAc.sub.3 No. (mg/kg) (% Saline) Cluster CM Saline n/a
100.0 n/a n/a 353382 3 79.38 n/a n/a 10 68.67 30 40.70 661161 0.5
79.18 GalNAc.sub.3-3a A.sub.d 1.5 75.96 5 30.53 15 12.52 666904 0.5
91.30 GalNAc.sub.3-3a PO 1.5 57.88 5 21.22 15 16.49 675441 0.5
76.71 GalNAc.sub.3-17a A.sub.d 1.5 63.63 5 29.57 15 13.49 675442
0.5 95.03 GalNAc.sub.3-18a A.sub.d 1.5 60.06 5 31.04 15 19.40
[0912] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were measured
relative to saline injected mice using standard protocols. Total
bilirubin and BUN were also evaluated. The change in body weights
was evaluated with no significant change from the saline group
(data not shown). ALTs, ASTs, total bilirubin and BUN values are
shown in Table 49 below.
TABLE-US-00053 TABLE 49 Total Dosage ALT AST Bilirubin BUN
GalNAc.sub.3 ISIS No. (mg/kg) (U/L) (U/L) (mg/dL) (mg/dL) Cluster
CM Saline n/a 26 59 0.16 42 n/a n/a 353382 3 23 58 0.18 39 n/a n/a
10 28 58 0.16 43 30 20 48 0.12 34 661161 0.5 30 47 0.13 35
GalNAc.sub.3-3a A.sub.d 1.5 23 53 0.14 37 5 26 48 0.15 39 15 32 57
0.15 42 666904 0.5 24 73 0.13 36 GalNAc.sub.3-3a PO 1.5 21 48 0.12
32 5 19 49 0.14 33 15 20 52 0.15 26 675441 0.5 42 148 0.21 36
GalNAc.sub.3-17a A.sub.d 1.5 60 95 0.16 34 5 27 75 0.14 37 15 24 61
0.14 36 675442 0.5 26 65 0.15 37 GalNAc.sub.3-18a A.sub.d 1.5 25 64
0.15 43 5 27 69 0.15 37 15 30 84 0.14 37
Example 75: Pharmacokinetic Analysis of Oligonucleotides Comprising
a 5'-Conjugate Group
[0913] The PK of the ASOs in Tables 41, 44 and 47 above was
evaluated using liver samples that were obtained following the
treatment procedures described in Examples 65, 66, and 74. The
liver samples were minced and extracted using standard protocols
and analyzed by IP-HPLC-MS alongside an internal standard. The
combined tissue level (.mu.g/g) of all metabolites was measured by
integrating the appropriate UV peaks, and the tissue level of the
full-length ASO missing the conjugate ("parent," which is Isis No.
353382 in this case) was measured using the appropriate extracted
ion chromatograms (EIC).
TABLE-US-00054 TABLE 50 PK Analysis in Liver Parent Total ASO
Tissue Tissue Level Level ISIS Dosage by UV by EIC GalNAc.sub.3 No.
(mg/kg) (.mu.g/g) (.mu.g/g) Cluster CM 353382 3 8.9 8.6 n/a n/a 10
22.4 21.0 30 54.2 44.2 661161 5 32.4 20.7 GalNAc.sub.3-3a A.sub.d
15 63.2 44.1 671144 5 20.5 19.2 GalNAc.sub.3-12a A.sub.d 15 48.6
41.5 670061 5 31.6 28.0 GalNAc.sub.3-13a A.sub.d 15 67.6 55.5
671261 5 19.8 16.8 GalNAc.sub.3-14a A.sub.d 15 64.7 49.1 671262 5
18.5 7.4 GalNAc.sub.3-15a A.sub.d 15 52.3 24.2 670699 5 16.4 10.4
GalNAc.sub.3-3a T.sub.d 15 31.5 22.5 670700 5 19.3 10.9
GalNAc.sub.3-3a A.sub.e 15 38.1 20.0 670701 5 21.8 8.8
GalNAc.sub.3-3a T.sub.e 15 35.2 16.1 671165 5 27.1 26.5
GalNAc.sub.3-13a A.sub.d 15 48.3 44.3 666904 5 30.8 24.0
GalNAc.sub.3-3a PO 15 52.6 37.6 675441 5 25.4 19.0 GalNAc.sub.3-17a
A.sub.d 15 54.2 42.1 675442 5 22.2 20.7 GalNAc.sub.3-18a A.sub.d 15
39.6 29.0
[0914] The results in Table 50 above show that there were greater
liver tissue levels of the oligonucleotides comprising a
GalNAc.sub.3 conjugate group than of the parent oligonucleotide
that does not comprise a GalNAc.sub.3 conjugate group (ISIS 353382)
72 hours following oligonucleotide administration, particularly
when taking into consideration the differences in dosing between
the oligonucleotides with and without a GalNAc.sub.3 conjugate
group. Furthermore, by 72 hours, 40-98% of each oligonucleotide
comprising a GalNAc.sub.3 conjugate group was metabolized to the
parent compound, indicating that the GalNAc.sub.3 conjugate groups
were cleaved from the oligonucleotides.
Example 76: Preparation of Oligomeric Compound 230 Comprising
GalNAc.sub.3-23
##STR00243##
[0916] Compound 222 is commercially available. 44.48 ml (0.33 mol)
of compound 222 was treated with tosyl chloride (25.39 g, 0.13 mol)
in pyridine (500 mL) for 16 hours. The reaction was then evaporated
to an oil, dissolved in EtOAc and washed with water, sat.
NaHCO.sub.3, brine, and dried over Na.sub.2SO.sub.4. The ethyl
acetate was concentrated to dryness and purified by column
chromatography, eluted with EtOAc/hexanes (1:1) followed by 10%
methanol in CH.sub.2Cl.sub.2 to give compound 223 as a colorless
oil. LCMS and NMR were consistent with the structure. 10 g (32.86
mmol) of 1-Tosyltriethylene glycol (compound 223) was treated with
sodium azide (10.68 g, 164.28 mmol) in DMSO (100 mL) at room
temperature for 17 hours. The reaction mixture was then poured onto
water, and extracted with EtOAc. The organic layer was washed with
water three times and dried over Na.sub.2SO.sub.4. The organic
layer was concentrated to dryness to give 5.3 g of compound 224
(92%). LCMS and NMR were consistent with the structure.
1-Azidotriethylene glycol (compound 224, 5.53 g, 23.69 mmol) and
compound 4 (6 g, 18.22 mmol) were treated with 4A molecular sieves
(5 g), and TMSOTf (1.65 ml, 9.11 mmol) in dichloromethane (100 mL)
under an inert atmosphere. After 14 hours, the reaction was
filtered to remove the sieves, and the organic layer was washed
with sat. NaHCO.sub.3, water, brine, and dried over
Na.sub.2SO.sub.4. The organic layer was concentrated to dryness and
purified by column chromatography, eluted with a gradient of 2 to
4% methanol in dichloromethane to give compound 225. LCMS and NMR
were consistent with the structure. Compound 225 (11.9 g, 23.59
mmol) was hydrogenated in EtOAc/Methanol (4:1, 250 mL) over
Pearlman's catalyst. After 8 hours, the catalyst was removed by
filtration and the solvents removed to dryness to give compound
226. LCMS and NMR were consistent with the structure.
[0917] In order to generate compound 227, a solution of
nitromethanetrispropionic acid (4.17 g, 15.04 mmol) and Hunig's
base (10.3 ml, 60.17 mmol) in DMF (100 mL) were treated dropwise
with pentaflourotrifluoro acetate (9.05 ml, 52.65 mmol). After 30
minutes, the reaction was poured onto ice water and extracted with
EtOAc. The organic layer was washed with water, brine, and dried
over Na.sub.2SO.sub.4. The organic layer was concentrated to
dryness and then recrystallized from heptane to give compound 227
as a white solid. LCMS and NMR were consistent with the structure.
Compound 227 (1.5 g, 1.93 mmol) and compound 226 (3.7 g, 7.74 mmol)
were stirred at room temperature in acetonitrile (15 mL) for 2
hours. The reaction was then evaporated to dryness and purified by
column chromatography, eluting with a gradient of 2 to 10% methanol
in dichloromethane to give compound 228. LCMS and NMR were
consistent with the structure. Compound 228 (1.7 g, 1.02 mmol) was
treated with Raney Nickel (about 2 g wet) in ethanol (100 mL) in an
atmosphere of hydrogen. After 12 hours, the catalyst was removed by
filtration and the organic layer was evaporated to a solid that was
used directly in the next step. LCMS and NMR were consistent with
the structure. This solid (0.87 g, 0.53 mmol) was treated with
benzylglutaric acid (0.18 g, 0.8 mmol), HBTU (0.3 g, 0.8 mmol) and
DIEA (273.7 .mu.l, 1.6 mmol) in DMF (5 mL). After 16 hours, the DMF
was removed under reduced pressure at 65.degree. C. to an oil, and
the oil was dissolved in dichloromethane. The organic layer was
washed with sat. NaHCO.sub.3, brine, and dried over
Na.sub.2SO.sub.4. After evaporation of the organic layer, the
compound was purified by column chromatography and eluted with a
gradient of 2 to 20% methanol in dichloromethane to give the
coupled product. LCMS and NMR were consistent with the structure.
The benzyl ester was deprotected with Pearlman's catalyst under a
hydrogen atmosphere for 1 hour. The catalyst was them removed by
filtration and the solvents removed to dryness to give the acid.
LCMS and NMR were consistent with the structure. The acid (486 mg,
0.27 mmol) was dissolved in dry DMF (3 mL). Pyridine (53.61 .mu.l,
0.66 mmol) was added and the reaction was purged with argon.
Pentaflourotriflouro acetate (46.39 .mu.l, 0.4 mmol) was slowly
added to the reaction mixture. The color of the reaction changed
from pale yellow to burgundy, and gave off a light smoke which was
blown away with a stream of argon. The reaction was allowed to stir
at room temperature for one hour (completion of reaction was
confirmed by LCMS). The solvent was removed under reduced pressure
(rotovap) at 70.degree. C. The residue was diluted with DCM and
washed with 1N NaHSO.sub.4, brine, saturated sodium bicarbonate and
brine again. The organics were dried over Na.sub.2SO.sub.4,
filtered, and were concentrated to dryness to give 225 mg of
compound 229 as a brittle yellow foam. LCMS and NMR were consistent
with the structure.
[0918] Oligomeric compound 230, comprising a GalNAc.sub.3-23
conjugate group, was prepared from compound 229 using the general
procedure illustrated in Example 46. The GalNAc.sub.3 cluster
portion of the GalNAc.sub.3-23 conjugate group
(GalNAc.sub.3-23.sub.a) can be combined with any cleavable moiety
to provide a variety of conjugate groups. The structure of
GalNAc.sub.3-23 (GalNAc.sub.3-23.sub.a-CM) is shown below:
##STR00244##
Example 77: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising a GalNAc.sub.3 Conjugate
[0919] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
TABLE-US-00055 TABLE 51 Modified ASOs targeting SRB-1 SEQ ISIS
Sequences GalNAc.sub.3 ID No. (5' to 3') Cluster CM No. 661161
G.sub.es.sup.mC.sub.es GalNAc.sub.3- A.sub.d 30
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub-
.dsT.sub.ds 3a
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 666904 G.sub.es.sup.mC.sub.esT.sub.esT.sub.es
GalNAc.sub.3- PO 28
.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub-
.ds 3a
A.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.e-
sT.sub.e 673502 G.sub.es.sup.mC.sub.esT.sub.es GalNAc.sub.3-
A.sub.d 30
T.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.ds 10a
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.e-
sT.sub.esT.sub.e 677844 G.sub.es.sup.mC.sub.esT.sub.es
GalNAc.sub.3- A.sub.d 30
T.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.ds 9a
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 677843 G.sub.es.sup.mC.sub.esT.sub.es
GalNAc.sub.3- A.sub.d 30
T.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub-
.ds 23a
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 655861
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.ds GalNAc.sub.3- A.sub.d 29
GA.sub.dsT.sub.dsdsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.s-
up.mC.sub.es la T.sub.esT.sub.eo 677841
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.ds GalNAc.sub.3- A.sub.d 29
A.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub-
.es.sup.mC.sub.es 19a T.sub.esT.sub.eo 677842
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.ds GalNAc.sub.3- A.sub.d 29
A.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub-
.es.sup.mC.sub.es 20a T.sub.esT.sub.eo
[0920] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-9a was shown in Example 52, GalNAc.sub.3-10a was shown
in Example 46, GalNAc.sub.3-19.sub.a was shown in Example 70,
GalNAc.sub.3-20.sub.a was shown in Example 71, and
GalNAc.sub.3-23.sub.a was shown in Example 76.
Treatment
[0921] Six to eight week old C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were each injected subcutaneously once at a dosage
shown below with an oligonucleotide listed in Table 51 or with
saline. Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration to determine
the SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of SRB-1 mRNA levels for each treatment group,
normalized to the saline control.
[0922] As illustrated in Table 52, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner.
TABLE-US-00056 TABLE 52 SRB-1 mRNA (% Saline) SRB-1 ISIS Dosage
mRNA GalNAc.sub.3 No. (mg/kg) (% Saline Cluster CM Saline n/a 100.0
n/a n/a 661161 0.5 89.18 GalNAc.sub.3-3a A.sub.d 1.5 77.02 5 29.10
15 12.64 666904 0.5 93.11 GalNAc.sub.3-3a PO 1.5 55.85 5 21.29 15
13.43 673502 0.5 77.75 GalNAc.sub.3-10a A.sub.d 1.5 41.05 5 19.27
15 14.41 677844 0.5 87.65 GalNAc.sub.3-9a A.sub.d 1.5 93.04 5 40.77
15 16.95 677843 0.5 102.28 GalNAc.sub.3-23a A.sub.d 1.5 70.51 5
30.68 15 13.26 655861 0.5 79.72 GalNAc.sub.3-1a A.sub.d 1.5 55.48 5
26.99 15 17.58 677841 0.5 67.43 GalNAc.sub.3-19a A.sub.d 1.5 45.13
5 27.02 15 12.41 677842 0.5 64.13 GalNAc.sub.3-20a A.sub.d 1.5
53.56 5 20.47 15 10.23
[0923] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in serum were also measured
using standard protocols. Total bilirubin and BUN were also
evaluated. Changes in body weights were evaluated, with no
significant change from the saline group (data not shown). ALTs,
ASTs, total bilirubin and BUN values are shown in Table 53
below.
TABLE-US-00057 TABLE 53 Total Dosage ALT AST Bilirubin BUN
GalNAc.sub.3 ISIS No. (mg/kg) (U/L) (U/L) (mg/dL) (mg/dL) Cluster
CM Saline n/a 21 45 0.13 34 n/a n/a 661161 0.5 28 51 0.14 39
GalNAc.sub.3-3a A.sub.d 1.5 23 42 0.13 39 5 22 59 0.13 37 15 21 56
0.15 35 666904 0.5 24 56 0.14 37 GalNAc.sub.3-3a PO 1.5 26 68 0.15
35 5 23 77 0.14 34 15 24 60 0.13 35 673502 0.5 24 59 0.16 34
GalNAc.sub.3-10a A.sub.d 1.5 20 46 0.17 32 5 24 45 0.12 31 15 24 47
0.13 34 677844 0.5 25 61 0.14 37 GalNAc.sub.3-9a A.sub.d 1.5 23 64
0.17 33 5 25 58 0.13 35 15 22 65 0.14 34 677843 0.5 53 53 0.13 35
GalNAc.sub.3-23a A.sub.d 1.5 25 54 0.13 34 5 21 60 0.15 34 15 22 43
0.12 38 655861 0.5 21 48 0.15 33 GalNAc.sub.3-1a A.sub.d 1.5 28 54
0.12 35 5 22 60 0.13 36 15 21 55 0.17 30 677841 0.5 32 54 0.13 34
GalNAc.sub.3-19a A.sub.d 1.5 24 56 0.14 34 5 23 92 0.18 31 15 24 58
0.15 31 677842 0.5 23 61 0.15 35 GalNAc.sub.3-20a A.sub.d 1.5 24 57
0.14 34 5 41 62 0.15 35 15 24 37 0.14 32
Example 78: Antisense Inhibition In Vivo by Oligonucleotides
Targeting Angiotensinogen Comprising a GalNAc.sub.3 Conjugate
[0924] The oligonucleotides listed below were tested in a
dose-dependent study for antisense inhibition of Angiotensinogen
(AGT) in normotensive Sprague Dawley rats.
TABLE-US-00058 TABLE 54 Modified ASOs targeting AGT ISIS Sequences
GalNAc.sub.3 SEQ No. (5` to 3`) Cluster CM ID No. 552668
.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.esG.sub.esA.sub.dsT.sub.d-
sT.sub.dsT.sub.ds n/a n/a 34
T.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.e-
sG.sub.es G.sub.esA.sub.esT.sub.e 669509
.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.esG.sub.esA.sub.dsT.sub.d-
sT.sub.dsT.sub.ds GalNAc.sub.3- Ad 35
T.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.e-
sG.sub.es 1.sub.a G.sub.esA.sub.esT.sub.eo
The structure of GalNAc.sub.3-1.sub.a was shown previously in
Example 9.
Treatment
[0925] Six week old, male Sprague Dawley rats were each injected
subcutaneously once per week at a dosage shown below, for a total
of three doses, with an oligonucleotide listed in Table 54 or with
PBS. Each treatment group consisted of 4 animals. The rats were
sacrificed 72 hours following the final dose. AGT liver mRNA levels
were measured using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. AGT plasma protein levels were
measured using the Total Angiotensinogen ELISA (Catalog #JP27412,
IBL International, Toronto, ON) with plasma diluted 1:20,000. The
results below are presented as the average percent of AGT mRNA
levels in liver or AGT protein levels in plasma for each treatment
group, normalized to the PBS control.
[0926] As illustrated in Table 55, treatment with antisense
oligonucleotides lowered AGT liver mRNA and plasma protein levels
in a dose-dependent manner, and the oligonucleotide comprising a
GalNAc conjugate was significantly more potent than the parent
oligonucleotide lacking a GalNAc conjugate.
TABLE-US-00059 TABLE 55 AGT liver mRNA and plasma protein levels
AGT AGT liver plasma ISIS mRNA protein GalNAc.sub.3 No. Dosage (%
PBS) (% PBS) Cluster CM PBS n/a 100 100 n/a n/a 552668 3 95 122 n/a
n/a 10 85 97 30 46 79 90 8 11 669509 0.3 95 70 GalNAc.sub.3-1a
A.sub.d 1 95 129 3 62 97 10 9 23
[0927] Liver transaminase levels, alanine aminotransferase (ALT)
and aspartate aminotransferase (AST), in plasma and body weights
were also measured at time of sacrifice using standard protocols.
The results are shown in Table 56 below.
TABLE-US-00060 TABLE 56 Liver transaminase levels and rat body
weights Body Dosage ALT AST Weight (% GalNAc.sub.3 ISIS No. (mg/kg)
(U/L) (U/L) of baseline) Cluster CM PBS n/a 51 81 186 n/a n/a
552668 3 54 93 183 n/a n/a 10 51 93 194 30 59 99 182 90 56 78 170
669509 0.3 53 90 190 GalNAc.sub.3- A.sub.d 1 51 93 192 1a 3 48 85
189 10 56 95 189
Example 79: Duration of Action In Vivo of Oligonucleotides
Targeting APOC-III Comprising a GalNAc.sub.3 Conjugate
[0928] The oligonucleotides listed in Table 57 below were tested in
a single dose study for duration of action in mice.
TABLE-US-00061 TABLE 57 Modified ASOs targeting APOC-III SEQ ISIS
Sequences GalNAc.sub.3 ID No. (5` to 3`) Cluster CM No. 304801
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.d-
sT.sub.ds n/a n/a 20
G.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.d-
s T.sub.esT.sub.esT.sub.esA.sub.esT.sub.e 647535
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.d-
sT.sub.ds GalNAc.sub.3- A.sub.d 21
G.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.d-
sT.sub.es 1a T.sub.esT.sub.esA.sub.esT.sub.eo 663083
A.sub.esG.sub.es.sup.mC.sub.es GalNAc.sub.3- A.sub.d 36
T.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds 3a
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.es
T.sub.esT.sub.esA.sub.esT.sub.e 674449
A.sub.esG.sub.es.sup.mC.sub.es GalNAc.sub.3- A.sub.d 36
T.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds 7a
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.es
T.sub.esT.sub.esA.sub.esT.sub.e 674450
A.sub.esG.sub.es.sup.mC.sub.es GalNAc.sub.3- A.sub.d 36
T.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds 10a
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.es
T.sub.esT.sub.esA.sub.esT.sub.e 674451
A.sub.esG.sub.es.sup.mC.sub.es GalNAc.sub.3- A.sub.d 36
T.sub.esT.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds 13a
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.es
T.sub.esT.sub.esA.sub.esT.sub.e
The structure of GalNAc.sub.3-1.sub.a was shown previously in
Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-7.sub.a was shown in Example 48, GalNAc.sub.3-10.sub.a
was shown in Example 46, and GalNAc.sub.3-13.sub.a was shown in
Example 62.
Treatment
[0929] Six to eight week old transgenic mice that express human
APOC-III were each injected subcutaneously once with an
oligonucleotide listed in Table 57 or with PBS. Each treatment
group consisted of 3 animals. Blood was drawn before dosing to
determine baseline and at 72 hours, 1 week, 2 weeks, 3 weeks, 4
weeks, 5 weeks, and 6 weeks following the dose. Plasma triglyceride
and APOC-III protein levels were measured as described in Example
20. The results below are presented as the average percent of
plasma triglyceride and APOC-III levels for each treatment group,
normalized to baseline levels, showing that the oligonucleotides
comprising a GalNAc conjugate group exhibited a longer duration of
action than the parent oligonucleotide without a conjugate group
(ISIS 304801) even though the dosage of the parent was three times
the dosage of the oligonucleotides comprising a GalNAc conjugate
group.
TABLE-US-00062 TABLE 58 Plasma triglyceride and APOC-III protein
levels in transgenic mice Time point Tri- APOC-III ISIS Dosage
(days post- glycerides protein (% GalNAc.sub.3 No. (mg/kg) dose) (%
baseline) baseline) Cluster CM PBS n/a 3 97 102 n/a n/a 7 101 98 14
108 98 21 107 107 28 94 91 35 88 90 42 91 105 304801 30 3 40 34 n/a
n/a 7 41 37 14 50 57 21 50 50 28 57 73 35 68 70 42 75 93 647535 10
3 36 37 GalNAc.sub.3- A.sub.d 7 39 47 1a 14 40 45 21 41 41 28 42 62
35 69 69 42 85 102 663083 10 3 24 18 GalNAc.sub.3- A.sub.d 7 28 23
3a 14 25 27 21 28 28 28 37 44 35 55 57 42 60 78 674449 10 3 29 26
GalNAc.sub.3- A.sub.d 7 32 31 7a 14 38 41 21 44 44 28 53 63 35 69
77 42 78 99 674450 10 3 33 30 GalNAc.sub.3- A.sub.d 7 35 34 10a 14
31 34 21 44 44 28 56 61 35 68 70 42 83 95 674451 10 3 35 33
GalNAc.sub.3- A.sub.d 7 24 32 13a 14 40 34 21 48 48 28 54 67 35 65
75 42 74 97
Example 80: Antisense Inhibition In Vivo by Oligonucleotides
Targeting Alpha-1 Antitrypsin (A1AT) Comprising a GalNAc.sub.3
Conjugate
[0930] The oligonucleotides listed in Table 59 below were tested in
a study for dose-dependent inhibition of A1AT in mire
TABLE-US-00063 TABLE 59 Modified ASOs targeting A1AT ISIS
GalNAc.sub.3 SEQ ID No. Sequences (5' to 3') Cluster CM No. 476366
A.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT-
.sub.ds n/a n/a 37
T.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds
A.sub.esA.sub.esG.sub.esG.sub.esA.sub.e 656326
A.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT-
.sub.dsT.sub.ds.sup.mC.sub.ds GalNAC.sub.3- A.sub.d 38
A.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.es
1a G.sub.esA.sub.eo 678381 A.sub.es.sup.mC.sub.es GalNAC.sub.3-
A.sub.d 39
.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.d-
sA.sub.dsG.sub.ds 3a
A.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.esG.sub.esA.sub.e
678382 A.sub.es.sup.mC.sub.es GalNAC.sub.3- A.sub.d 39
.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.d-
sA.sub.ds 7a
G.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.esG.sub.esA-
.sub.e 678383 A.sub.es.sup.mC.sub.es GalNAC.sub.3- A.sub.d 39
.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.d-
sA.sub.dsG.sub.ds 10a
A.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.esG.sub.esA.sub.e
678384 A.sub.es.sup.mC.sub.es GalNAC.sub.3- A.sub.d 39
.sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.d-
sA.sub.dsG.sub.ds 13a
A.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.esA.sub.esG.sub.esG.sub.esA.sub.e
[0931] The structure of GalNAc.sub.3-1.sub.a was shown previously
in Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-7.sub.a was shown in Example 48, GalNAc.sub.3-10.sub.a
was shown in Example 46, and GalNAc.sub.3-13.sub.a was shown in
Example 62.
Treatment
[0932] Six week old, male C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were each injected subcutaneously once per week at a
dosage shown below, for a total of three doses, with an
oligonucleotide listed in Table 59 or with PBS. Each treatment
group consisted of 4 animals. The mice were sacrificed 72 hours
following the final administration. A1AT liver mRNA levels were
determined using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. A1AT plasma protein levels were
determined using the Mouse Alpha 1-Antitrypsin ELISA (catalog
#41-A1AMS-E01, Alpco, Salem, N.H.). The results below are presented
as the average percent of A1AT liver mRNA and plasma protein levels
for each treatment group, normalized to the PBS control.
[0933] As illustrated in Table 60, treatment with antisense
oligonucleotides lowered A1AT liver mRNA and A1AT plasma protein
levels in a dose-dependent manner. The oligonucleotides comprising
a GalNAc conjugate were significantly more potent than the parent
(ISIS 476366).
TABLE-US-00064 TABLE 60 A1AT liver mRNA and plasma protein levels
A1AT A1AT liver plasma ISIS Dosage mRNA protein GalNAc.sub.3 No.
(mg/kg) (% PBS) (% PBS) Cluster CM PBS n/a 100 100 n/a n/a 476366 5
86 78 n/a n/a 15 73 61 45 30 38 656326 0.6 99 90 GalNAc.sub.3-1a
A.sub.d 2 61 70 6 15 30 18 6 10 678381 0.6 105 90 GalNAc.sub.3-3a
A.sub.d 2 53 60 6 16 20 18 7 13 678382 0.6 90 79 GalNAc.sub.3-7a
A.sub.d 2 49 57 6 21 27 18 8 11 678383 0.6 94 84 GalNAc.sub.3-10a
A.sub.d 2 44 53 6 13 24 18 6 10 678384 0.6 106 91 GalNAc.sub.3-13a
A.sub.d 2 65 59 6 26 31 18 11 15
[0934] Liver transaminase and BUN levels in plasma were measured at
time of sacrifice using standard protocols. Body weights and organ
weights were also measured. The results are shown in Table 61
below. Body weight is shown as % relative to baseline. Organ
weights are shown as % of body weight relative to the PBS control
group.
TABLE-US-00065 TABLE 61 Body Liver Kidney Spleen ISIS Dosage ALT
AST BUN weight (% weight (Rel weight (Rel weight (Rel No. (mg/kg)
(U/L) (U/L) (mg/dL) baseline) % BW) % BW) % BW) PBS n/a 25 51 37
119 100 100 100 476366 5 34 68 35 116 91 98 106 15 37 74 30 122 92
101 128 45 30 47 31 118 99 108 123 656326 0.6 29 57 40 123 100 103
119 2 36 75 39 114 98 111 106 6 32 67 39 125 99 97 122 18 46 77 36
116 102 109 101 678381 0.6 26 57 32 117 93 109 110 2 26 52 33 121
96 106 125 6 40 78 32 124 92 106 126 18 31 54 28 118 94 103 120
678382 0.6 26 42 35 114 100 103 103 2 25 50 31 117 91 104 117 6 30
79 29 117 89 102 107 18 65 112 31 120 89 104 113 678383 0.6 30 67
38 121 91 100 123 2 33 53 33 118 98 102 121 6 32 63 32 117 97 105
105 18 36 68 31 118 99 103 108 678384 0.6 36 63 31 118 98 103 98 2
32 61 32 119 93 102 114 6 34 69 34 122 100 100 96 18 28 54 30 117
98 101 104
Example 81: Duration of Action In Vivo of Oligonucleotides
Targeting A1AT Comprising a GalNAc.sub.3 Cluster
[0935] The oligonucleotides listed in Table 59 were tested in a
single dose study for duration of action in mice.
Treatment
[0936] Six week old, male C57BL/6 mice were each injected
subcutaneously once with an oligonucleotide listed in Table 59 or
with PBS. Each treatment group consisted of 4 animals. Blood was
drawn the day before dosing to determine baseline and at 5, 12, 19,
and 25 days following the dose. Plasma A1AT protein levels were
measured via ELISA (see Example 80). The results below are
presented as the average percent of plasma A1AT protein levels for
each treatment group, normalized to baseline levels. The results
show that the oligonucleotides comprising a GalNAc conjugate were
more potent and had longer duration of action than the parent
lacking a GalNAc conjugate (ISIS 476366). Furthermore, the
oligonucleotides comprising a 5'-GalNAc conjugate (ISIS 678381,
678382, 678383, and 678384) were generally even more potent with
even longer duration of action than the oligonucleotide comprising
a 3'-GalNAc conjugate (ISIS 656326).
TABLE-US-00066 TABLE 62 Plasma A1AT protein levels in mice Time
point (days ISIS Dosage post- A1AT (% GalNAc.sub.3 No. (mg/kg)
dose) baseline) Cluster CM PBS n/a 5 93 n/a n/a 12 93 19 90 25 97
476366 100 5 38 n/a n/a 12 46 19 62 25 77 656326 18 5 33
GalNAc.sub.3-1a A.sub.d 12 36 19 51 25 72 678381 18 5 21
GalNAc.sub.3-3a A.sub.d 12 21 19 35 25 48 678382 18 5 21
GalNAc.sub.3-7a A.sub.d 12 21 19 39 25 60 678383 18 5 24
GalNAc.sub.3-10a A.sub.d 12 21 19 45 25 73 678384 18 5 29
GalNAc.sub.3-13a A.sub.d 12 34 19 57 25 76
Example 82: Antisense Inhibition In Vitro by Oligonucleotides
Targeting SRB-1 Comprising a GalNAc.sub.3 Conjugate
[0937] Primary mouse liver hepatocytes were seeded in 96 well
plates at 15,000 cells/well 2 hours prior to treatment. The
oligonucleotides listed in Table 63 were added at 2, 10, 50, or 250
nM in Williams E medium and cells were incubated overnight at
37.degree. C. in 5% CO.sub.2. Cells were lysed 16 hours following
oligonucleotide addition, and total RNA was purified using RNease
3000 BioRobot (Qiagen). SRB-1 mRNA levels were determined using
real-time PCR and RIBOGREEN.RTM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.) according to standard
protocols. IC.sub.50 values were determined using Prism 4 software
(GraphPad). The results show that oligonucleotides comprising a
variety of different GalNAc conjugate groups and a variety of
different cleavable moieties are significantly more potent in an in
vitro free uptake experiment than the parent oligonucleotides
lacking a GalNAc conjugate group (ISIS 353382 and 666841).
TABLE-US-00067 TABLE 63 Inhibition of SRB-1 expression in vitro
ISIS Sequence GalNAc IC.sub.50 SEQ No. (5` to 3') Linkages cluster
CM (nM) ID No. 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PS n/a n/a
250 28
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
655861
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PS
GalNAc.sub.3- A.sub.d 40 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o l.sub.a 661161
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.ds PS
GalNAc.sub.3- A.sub.d 40 30
G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
3.sub.a
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
661162
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- A.sub.d 8 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 3.sub.a
664078
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PS
GalNAc.sub.3- A.sub.d 20 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o 9.sub.a 665001
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds PS GalNAc.sub.3- A.sub.d 70 30
.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub-
.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 8.sub.a 666224
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.ds PS
GalNAc.sub.3- A.sub.d 80 30
G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub-
.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
5.sub.a 666841
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PO/PS n/a
n/a >250 28
.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e
666881 G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.ds
PS GalNAc.sub.3- A.sub.d 30 30
G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub-
.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
10.sub.a 666904
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- PO 9 28
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 3.sub.a
666924 G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.ds
PS GalNAc.sub.3- T.sub.d 15 33
G.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub-
.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
3.sub.a 666961
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 150 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 6.sub.a
666981
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 20 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 7.sub.a
670061
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 30 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 13.sub.a
670699
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- T.sub.d 15 33
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 3.sub.a
670700
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- A.sub.d 30 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 3.sub.a
670701
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- T.sub.d 25 33
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 3.sub.a
671144
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 40 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 12.sub.a
671165
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- A.sub.d 8 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 13.sub.a
671261
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d >250 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 14.sub.a
671262
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d >250 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 15.sub.a
673501
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- A.sub.d 30 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 7.sub.a
673502
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
ds PO/PS GalNAc.sub.3- A.sub.d 8 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.e 10.sub.a
675441
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 30 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 17.sub.a
675442
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 20 30
.sup.mT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 18.sub.a
677841
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PS
GalNAc.sub.3- A.sub.d 40 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o 19.sub.a 677842
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds PS
GalNAc.sub.3- A.sub.d 30 29
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e-
o 20.sub.a 677843
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
ds PS GalNAc.sub.3- A.sub.d 40 30
T.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e 23.sub.a
The structure of GalNAc.sub.3-1.sub.a was shown previously in
Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-5.sub.a was shown in Example 49, GalNAc.sub.3-6.sub.a
was shown in Example 51, GalNAc.sub.3-7.sub.a was shown in Example
48, GalNAc.sub.3-8.sub.a was shown in Example 47,
GalNAc.sub.3-9.sub.a was shown in Example 52, GalNAc.sub.3-10.sub.a
was shown in Example 46, GalNAc.sub.3-12.sub.a was shown in Example
61, GalNAc.sub.3-13.sub.a was shown in Example 62,
GalNAc.sub.3-14.sub.a was shown in Example 63,
GalNAc.sub.3-15.sub.a was shown in Example 64,
GalNAc.sub.3-17.sub.a was shown in Example 68,
GalNAc.sub.3-18.sub.a was shown in Example 69,
GalNAc.sub.3-19.sub.a was shown in Example 70,
GalNAc.sub.3-20.sub.a was shown in Example 71, and
GalNAc.sub.3-23.sub.a was shown in Example 76.
Example 83: Antisense Inhibition In Vivo by Oligonucleotides
Targeting Factor XI Comprising a GalNAc.sub.3 Cluster
[0938] The oligonucleotides listed in Table 64 below were tested in
a study for dose-dependent inhibition of Factor XI in mice.
TABLE-US-00068 TABLE 64 Modified Oligonucleotides targeting Factor
XI ISIS GalNAc SEQ No. Sequence (5' to 3`) cluster CM ID No. 404071
T.sub.esG.sub.esG.sub.esT.sub.esA.sub.esA.sub.ds n/a n/a 31
T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.es
G.sub.esA.sub.esG.sub.esG.sub.e 656173
T.sub.esG.sub.eoG.sub.eoT.sub.eoA.sub.eoA.sub.dsT.sub.ds
GalNAc.sub.3-1.sub.a A.sub.d 32
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds
T.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eoA.sub.esG.sub.esG.sub.eo
663086 GalNAc.sub.3-3.sub.a A.sub.d 40
T.sub.esG.sub.eoG.sub.eoT.sub.eoA.sub.eoA.sub.dsT.sub.ds
.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds
T.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eoA.sub.esG.sub.esG.sub.eo
678347 GalNAc.sub.3-7.sub.a A.sub.d 40
T.sub.esG.sub.eoG.sub.eoT.sub.eoA.sub.eoA.sub.ds
T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eo
A.sub.esG.sub.esG.sub.eo 678348 GalNAc.sub.3-10.sub.a A.sub.d 40
T.sub.esG.sub.eoG.sub.eoT.sub.eoA.sub.eoA.sub.ds
T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.eoG.sub.eo
A.sub.esG.sub.esG.sub.eo
The structure of GalNAc.sub.3-1.sub.a was shown previously in
Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-7.sub.a was shown in Example 48, GalNAc.sub.3-10.sub.a
was shown in Example 46, and GalNAc.sub.3-13.sub.a was shown in
Example 62.
Treatment
[0939] Six to eight week old mice were each injected subcutaneously
once per week at a dosage shown below, for a total of three doses,
with an oligonucleotide listed below or with PBS. Each treatment
group consisted of 4 animals. The mice were sacrificed 72 hours
following the final dose. Factor XI liver mRNA levels were measured
using real-time PCR and normalized to cyclophilin according to
standard protocols. Liver transaminases, BUN, and bilirubin were
also measured. The results below are presented as the average
percent for each treatment group, normalized to the PBS
control.
[0940] As illustrated in Table 65, treatment with antisense
oligonucleotides lowered Factor XI liver mRNA in a dose-dependent
manner. The results show that the oligonucleotides comprising a
GalNAc conjugate were more potent than the parent lacking a GalNAc
conjugate (ISIS 404071). Furthermore, the oligonucleotides
comprising a 5'-GalNAc conjugate (ISIS 663086, 678347, 678348, and
678349) were even more potent than the oligonucleotide comprising a
3'-GalNAc conjugate (ISIS 656173).
TABLE-US-00069 TABLE 65 Factor XI liver mRNA, liver transaminase,
BUN, and bilirubin levels ISIS Dosage Factor XI ALT AST BUN
Bilirubin GalNAc.sub.3 SEQ No. (mg/kg) mRNA (% PBS) (U/L) (U/L)
(mg/dL) (mg/dL) Cluster ID No. PBS n/a 100 63 70 21 0.18 n/a n/a
404071 3 65 41 58 21 0.15 10 33 49 53 23 0.15 n/a 31 30 17 43 57 22
0.14 656173 0.7 43 90 89 21 0.16 GalNAc.sub.3-1a 32 2 9 36 58 26
0.17 6 3 50 63 25 0.15 663086 0.7 33 91 169 25 0.16 GalNAc.sub.3-3a
40 2 7 38 55 21 0.16 6 1 34 40 23 0.14 678347 0.7 35 28 49 20 0.14
GalNAc.sub.3-7a 40 2 10 180 149 21 0.18 6 1 44 76 19 0.15 678348
0.7 39 43 54 21 0.16 GalNAc.sub.3-10a 40 2 5 38 55 22 0.17 6 2 25
38 20 0.14 678349 0.7 34 39 46 20 0.16 GalNAc.sub.3-13a 40 2 8 43
63 21 0.14 6 2 28 41 20 0.14
Example 84: Duration of Action In Vivo of Oligonucleotides
Targeting Factor XI Comprising a GalNAc.sub.3 Conjugate
[0941] The oligonucleotides listed in Table 64 were tested in a
single dose study for duration of action in mice.
Treatment
[0942] Six to eight week old mice were each injected subcutaneously
once with an oligonucleotide listed in Table 64 or with PBS. Each
treatment group consisted of 4 animals. Blood was drawn by tail
bleeds the day before dosing to determine baseline and at 3, 10,
and 17 days following the dose. Plasma Factor XI protein levels
were measured by ELISA using Factor XI capture and biotinylated
detection antibodies from R & D
[0943] Systems, Minneapolis, Minn. (catalog #AF2460 and #BAF2460,
respectively) and the OptEIA Reagent Set B (Catalog #550534, BD
Biosciences, San Jose, Calif.). The results below are presented as
the average percent of plasma Factor XI protein levels for each
treatment group, normalized to baseline levels. The results show
that the oligonucleotides comprising a GalNAc conjugate were more
potent with longer duration of action than the parent lacking a
GalNAc conjugate (ISIS 404071). Furthermore, the oligonucleotides
comprising a 5'-GalNAc conjugate (ISIS 663086, 678347, 678348, and
678349) were even more potent with an even longer duration of
action than the oligonucleotide comprising a 3'-GalNAc conjugate
(ISIS 656173).
TABLE-US-00070 TABLE 66 Plasma Factor XI protein levels in mice
Time point Factor ISIS Dosage (days XI (% GalNAc.sub.3 SEQ ID No.
(mg/kg) post-dose) baseline) Cluster CM No. PBS n/a 3 123 n/a n/a
n/a 10 56 17 100 404071 30 3 11 n/a n/a 31 10 47 17 52 656173 6 3 1
GalNAc.sub.3-1a A.sub.d 32 10 3 17 21 663086 6 3 1 GalNAc.sub.3-3a
A.sub.d 40 10 2 17 9 678347 6 3 1 GalNAc.sub.3-7a A.sub.d 40 10 1
17 8 678348 6 3 1 GalNAc.sub.3-10a A.sub.d 40 10 1 17 6 678349 6 3
1 GalNAc.sub.3-13a A.sub.d 40 10 1 17 5
Example 85: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising a GalNAc.sub.3 Conjugate
[0944] Oligonucleotides listed in Table 63 were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
Treatment
[0945] Six to eight week old C57BL/6 mice were each injected
subcutaneously once per week at a dosage shown below, for a total
of three doses, with an oligonucleotide listed in Table 63 or with
saline. Each treatment group consisted of 4 animals. The mice were
sacrificed 48 hours following the final administration to determine
the SRB-1 mRNA levels using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. The results below are presented as
the average percent of liver SRB-1 mRNA levels for each treatment
group, normalized to the saline control.
[0946] As illustrated in Tables 67 and 68, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner.
TABLE-US-00071 TABLE 67 SRB-1 mRNA in liver ISIS Dosage SRB-1 mRNA
GalNAc.sub.3 No. (mg/kg) (% Saline) Cluster CM Saline n/a 100 n/a
n/a 655861 0.1 94 GalNAc.sub.3-1a A.sub.d 0.3 119 1 68 3 32 661161
0.1 120 GalNAc.sub.3-3a A.sub.d 0.3 107 1 68 3 26 666881 0.1 107
GalNAc.sub.3-10a A.sub.d 0.3 107 1 69 3 27 666981 0.1 120
GalNAc.sub.3-7a A.sub.d 0.3 103 1 54 3 21 670061 0.1 118
GalNAc.sub.3-13a A.sub.d 0.3 89 1 52 3 18 677842 0.1 119
GalNAc.sub.3-20a A.sub.d 0.3 96 1 65 3 23
TABLE-US-00072 TABLE 68 SRB-1 mRNA in liver ISIS Dosage SRB-1 mRNA
GalNAc.sub.3 No. (mg/kg) (% Saline) Cluster CM 661161 0.1 107
GalNAc.sub.3-3a A.sub.d 0. 3 95 1 53 3 18 677841 0.1 110
GalNAc.sub.3-19a A.sub.d 0.3 88 1 52 3 25
[0947] Liver transaminase levels, total bilirubin, BUN, and body
weights were also measured using standard protocols. Average values
for each treatment group are shown in Table 69 below.
TABLE-US-00073 TABLE 69 ISIS Dosage ALT AST Bilirubin BUN Body
Weight GalNAc.sub.3 No. (mg/kg) (U/L) (U/L) (mg/dL) (mg/dL) (%
baseline) Cluster CM Saline n/a 19 39 0.17 26 118 n/a n/a 655861
0.1 25 47 0.17 27 114 GalNAc.sub.3-la A.sub.d 0.3 29 56 0.15 27 118
1 20 32 0.14 24 112 3 27 54 0.14 24 115 661161 0.1 35 83 0.13 24
113 GalNAc.sub.3-3a A.sub.d 0.3 42 61 0.15 23 117 1 34 60 0.18 22
116 3 29 52 0.13 25 117 666881 0.1 30 51 0.15 23 118
GalNAc.sub.3-10a A.sub.d 0.3 49 82 0.16 25 119 1 23 45 0.14 24 117
3 20 38 0.15 21 112 666981 0.1 21 41 0.14 22 113 GalNAc.sub.3-7a
A.sub.d 0.3 29 49 0.16 24 112 1 19 34 0.15 22 111 3 77 78 0.18 25
115 670061 0.1 20 63 0.18 24 111 GalNAc.sub.3-13a A.sub.d 0.3 20 57
0.15 21 115 1 20 35 0.14 20 115 3 27 42 0.12 20 116 677842 0.1 20
38 0.17 24 114 GalNAc.sub.3-20a A.sub.d 0.3 31 46 0.17 21 117 1 22
34 0.15 21 119 3 41 57 0.14 23 118
Example 86: Antisense Inhibition In Vivo by Oligonucleotides
Targeting TTR Comprising a GalNAc.sub.3 Cluster
[0948] Oligonucleotides listed in Table 70 below were tested in a
dose-dependent study for antisense inhibition of human
transthyretin (TTR) in transgenic mice that express the human TTR
gene.
Treatment
[0949] Eight week old TTR transgenic mice were each injected
subcutaneously once per week for three weeks, for a total of three
doses, with an oligonucleotide and dosage listed in the tables
below or with PBS. Each treatment group consisted of 4 animals. The
mice were sacrificed 72 hours following the final administration.
Tail bleeds were performed at various time points throughout the
experiment, and plasma TTR protein, ALT, and AST levels were
measured and reported in Tables 72-74. After the animals were
sacrificed, plasma ALT, AST, and human TTR levels were measured, as
were body weights, organ weights, and liver human TTR mRNA levels.
TTR protein levels were measured using a clinical analyzer (AU480,
Beckman Coulter, CA). Real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.) were
used according to standard protocols to determine liver human TTR
mRNA levels. The results presented in Tables 71-74 are the average
values for each treatment group. The mRNA levels are the average
values relative to the average for the PBS group. Plasma protein
levels are the average values relative to the average value for the
PBS group at baseline. Body weights are the average percent weight
change from baseline until sacrifice for each individual treatment
group. Organ weights shown are normalized to the animal's body
weight, and the average normalized organ weight for each treatment
group is then presented relative to the average normalized organ
weight for the PBS group.
[0950] In Tables 71-74, "BL" indicates baseline, measurements that
were taken just prior to the first dose. As illustrated in Tables
71 and 72, treatment with antisense oligonucleotides lowered TTR
expression levels in a dose-dependent manner. The oligonucleotides
comprising a GalNAc conjugate were more potent than the parent
lacking a GalNAc conjugate (ISIS 420915). Furthermore, the
oligonucleotides comprising a GalNAc conjugate and mixed PS/PO
internucleoside linkages were even more potent than the
oligonucleotide comprising a GalNAc conjugate and full PS
linkages.
TABLE-US-00074 TABLE 70 Oligonucleotides targeting human TTR Isis
Sequence Link- GalNAc SEQ No. 5' to 3' ages cluster CM ID No.
420915
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.ds PS
n/a n/a 41
T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
A.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e
660261 PS GalNAc.sub.3- Ad 42
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.ds 1a
T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
A.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo
682883 PS/ GalNAc.sub.3- PO 74
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.ds PO
3a T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
A.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo
682884 PS/ GalNAc.sub.3- PO 41
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.ds PO
7a T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
A.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo
682885 PS/ GalNAc.sub.3- PO 41
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.ds PO
10a T.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
A.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo
The legend for Table 72 can be found in Example 74. The structure
of GalNAc.sub.3-1 was shown in Example 9. The structure of
GalNAc.sub.3-3.sub.a was shown in Example 39. The structure of
GalNAc.sub.3-7.sub.a was shown in Example 48. The structure of
GalNAc.sub.3-10.sub.a was shown in Example 46. The structure of
GalNAc.sub.3-13.sub.a was shown in Example 62. The structure of
GalNAc.sub.3-19.sub.a was shown in Example 70.
TABLE-US-00075 TABLE 71 Antisense inhibition of human TTR in vivo
TTR Plasma Isis Dosage mRNA TTR protein SEQ No. (mg/kg) (% PBS) (%
PBS) GalNAc cluster CM ID No. PBS n/a 100 100 n/a n/a 420915 6 99
95 n/a n/a 41 20 48 65 60 18 28 660261 0.6 113 87 GalNAc.sub.3-1a
A.sub.d 42 2 40 56 6 20 27 20 9 11
TABLE-US-00076 TABLE 72 Antisense inhibition of human TTR in vivo
TTR Plasma TTR protein (% PBS at BL) Dosage mRNA Day 17 GalNAc SEQ
ID Isis No. (mg/kg) (% PBS) BL Day 3 Day 10 (After sac) cluster CM
No. PBS n/a 100 100 96 90 114 n/a n/a 420915 6 74 106 86 76 83 n/a
n/a 41 20 43 102 66 61 58 60 24 92 43 29 32 682883 0.6 60 88 73 63
68 GalNAc.sub.3- PO 41 2 18 75 38 23 23 3a 6 10 80 35 11 9 682884
0.6 56 88 78 63 67 GalNAc.sub.3- PO 41 2 19 76 44 25 23 7a 6 15 82
35 21 24 682885 0.6 60 92 77 68 76 GalNAc.sub.3- PO 41 2 22 93 58
32 32 10a 6 17 85 37 25 20 682886 0.6 57 91 70 64 69
GalNAc.sub.3-13a PO 41 2 21 89 50 31 30 6 18 102 41 24 27 684057
0.6 53 80 69 56 62 GalNAc.sub.3- A.sub.d 42 2 21 92 55 34 30 19a 6
11 82 50 18 13
TABLE-US-00077 TABLE 73 Transaminase levels, body weight changes,
and relative organ weights ALT (U/L) AST (U/L) Body Liver Spleen
Kidney SEQ Dosage Day Day Day Day Day Day (% (% (% (% ID Isis No.
(mg/kg) BL 3 10 17 BL 3 10 17 BL) PBS) PBS) PBS) No. PBS n/a 33 34
33 24 58 62 67 52 105 100 100 100 n/a 420915 6 34 33 27 21 64 59 73
47 115 99 89 91 41 20 34 30 28 19 64 54 56 42 111 97 83 89 60 34 35
31 24 61 58 71 58 113 102 98 95 660261 0.6 33 38 28 26 70 71 63 59
111 96 99 92 42 2 29 32 31 34 61 60 68 61 118 100 92 90 6 29 29 28
34 58 59 70 90 114 99 97 95 20 33 32 28 33 64 54 68 95 114 101 106
92
TABLE-US-00078 TABLE 74 Transaminase levels, body weight changes,
and relative organ weights ALT (U/L) AST (U/L) Body Liver Spleen
Kidney SEQ Dosage Day Day Day Day Day Day (% (% (% (% ID Isis No.
(mg/kg) BL 3 10 17 BL 3 10 17 BL) PBS) PBS) PBS) No. PBS n/a 32 34
37 41 62 78 76 77 104 100 100 100 n/a 420915 6 32 30 34 34 61 71 72
66 102 103 102 105 41 20 41 34 37 33 80 76 63 54 106 107 135 101 60
36 30 32 34 58 81 57 60 106 105 104 99 682883 0.6 32 35 38 40 53 81
74 76 104 101 112 95 41 2 38 39 42 43 71 84 70 77 107 98 116 99 6
35 35 41 38 62 79 103 65 105 103 143 97 682884 0.6 33 32 35 34 70
74 75 67 101 100 130 99 41 2 31 32 38 38 63 77 66 55 104 103 122
100 6 38 32 36 34 65 85 80 62 99 105 129 95 682885 0.6 39 26 37 35
63 63 77 59 100 109 109 112 41 2 30 26 38 40 54 56 71 72 102 98 111
102 6 27 27 34 35 46 52 56 64 102 98 113 96 682886 0.6 30 40 34 36
58 87 54 61 104 99 120 101 41 2 27 26 34 36 51 55 55 69 103 91 105
92 6 40 28 34 37 107 54 61 69 109 100 102 99 684057 0.6 35 26 33 39
56 51 51 69 104 99 110 102 42 2 33 32 31 40 54 57 56 87 103 100 112
97 6 39 33 35 40 67 52 55 92 98 104 121 108
Example 87: Duration of Action In Vivo by Single Doses of
Oligonucleotides Targeting TTR Comprising a GalNAc.sub.3
Cluster
[0951] ISIS numbers 420915 and 660261 (see Table 70) were tested in
a single dose study for duration of action in mice. ISIS numbers
420915, 682883, and 682885 (see Table 70) were also tested in a
single dose study for duration of action in mice.
Treatment
[0952] Eight week old, male transgenic mice that express human TTR
were each injected subcutaneously once with 100 mg/kg ISIS No.
420915 or 13.5 mg/kg ISIS No. 660261. Each treatment group
consisted of 4 animals. Tail bleeds were performed before dosing to
determine baseline and at days 3, 7, 10, 17, 24, and 39 following
the dose. Plasma TTR protein levels were measured as described in
Example 86. The results below are presented as the average percent
of plasma TTR levels for each treatment group, normalized to
baseline levels.
TABLE-US-00079 TABLE 75 Plasma TTR protein levels ISIS Dosage Time
point TTR (% GalNAc.sub.3 SEQ No. (mg/kg) (days post-dose)
baseline) Cluster CM ID No. 420915 100 3 30 n/a n/a 41 7 23 10 35
17 53 24 75 39 100 660261 13.5 3 27 GalNAc.sub.3- A.sub.d 42 7 21
1a 10 22 17 36 24 48 39 69
Treatment
[0953] Female transgenic mice that express human TTR were each
injected subcutaneously once with 100 mg/kg ISIS No. 420915, 10.0
mg/kg ISIS No. 682883, or 10.0 mg/kg 682885. Each treatment group
consisted of 4 animals. Tail bleeds were performed before dosing to
determine baseline and at days 3, 7, 10, 17, 24, and 39 following
the dose. Plasma TTR protein levels were measured as described in
Example 86. The results below are presented as the average percent
of plasma TTR levels for each treatment group, normalized to
baseline levels.
TABLE-US-00080 TABLE 76 Plasma TTR protein levels ISIS Dosage Time
point TTR (% GalNAc.sub.3 SEQ No. (mg/kg) (days post-dose)
baseline) Cluster CM ID No. 420915 100 3 48 n/a n/a 41 7 48 10 48
17 66 31 80 682883 10.0 3 45 GalNAc.sub.3- PO 41 7 37 3a 10 38 17
42 31 65 682885 10.0 3 40 GalNAc.sub.3- PO 41 7 33 10a 10 34 17 40
31 64
The results in Tables 75 and 76 show that the oligonucleotides
comprising a GalNAc conjugate are more potent with a longer
duration of action than the parent oligonucleotide lacking a
conjugate (ISIS 420915).
Example 88: Splicing Modulation In Vivo by Oligonucleotides
Targeting SMN Comprising a GalNAc.sub.3 Conjugate
[0954] The oligonucleotides listed in Table 77 were tested for
splicing modulation of human survival of motor neuron (SMN) in
mice.
TABLE-US-00081 TABLE 77 Modified ASOs targeting SMN ISIS Sequences
(5' to 3') GalNAC3 SEQ No. Cluster CM ID No. 387954
A.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.e-
s n/a n/a 43
T.sub.esT.sub.es.sup.mC.sub.esA.sub.esT.sub.esA.sub.esA.sub.es
T.sub.esG.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.e 699819
GalNAc.sub.3- PO 43
A.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.es
7a T.sub.esT.sub.es.sup.mC.sub.esA.sub.esT.sub.esA.sub.esA.sub.es
T.sub.esG.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.e 699821
GalNAc.sub.3- PO 43
A.sub.esT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.es.sup.mC.sub.esT.sub.es7a
7a T.sub.esT.sub.es.sup.mC.sub.esA.sub.esT.sub.esA.sub.esA.sub.es
T.sub.esG.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.e 700000
A.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.e-
s GalNAc.sub.3- Ad 44
T.sub.esT.sub.es.sup.mC.sub.esA.sub.esT.sub.esA.sub.esA.sub.es 1a
T.sub.esG.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.eo 703421
X-ATT.sup.mCA.sup.mCTTT n/a n/a 43 .sup.mCATAATG.sup.mCTGG 703422
GalNAc.sub.3- n/a 43 X-ATT.sup.mCA.sup.mC 7b
TTT.sup.mCATAATG.sup.mCTGG
The structure of GalNAc.sub.3-7.sub.a was shown previously in
Example 48. "X" indicates a 5' primary amine generated by Gene
Tools (Philomath, Oreg.), and GalNAc.sub.3-7.sub.b indicates the
structure of GalNAc.sub.3-7.sub.a lacking the --NH--C.sub.6--O
portion of the linker as shown below:
##STR00245##
ISIS numbers 703421 and 703422 are morphlino oligonucleotides,
wherein each nucleotide of the two oligonucleotides is a morpholino
nucleotide.
Treatment
[0955] Six week old transgenic mice that express human SMN were
injected subcutaneously once with an oligonucleotide listed in
Table 78 or with saline. Each treatment group consisted of 2 males
and 2 females. The mice were sacrificed 3 days following the dose
to determine the liver human SMN mRNA levels both with and without
exon 7 using real-time PCR according to standard protocols. Total
RNA was measured using Ribogreen reagent. The SMN mRNA levels were
normalized to total mRNA, and further normalized to the averages
for the saline treatment group. The resulting average ratios of SMN
mRNA including exon 7 to SMN mRNA missing exon 7 are shown in Table
78. The results show that fully modified oligonucleotides that
modulate splicing and comprise a GalNAc conjugate are significantly
more potent in altering splicing in the liver than the parent
oligonucleotides lacking a GlaNAc conjugate. Furthermore, this
trend is maintained for multiple modification chemistries,
including 2'-MOE and morpholino modified oligonucleotides.
TABLE-US-00082 TABLE 78 Effect of oligonucleotides targeting human
SMN in vivo ISIS Dose +Exon 7/ GalNAc.sub.3 SEQ No. (mg/kg) -Exon 7
Cluster CM ID No. Saline n/a 1.00 n/a n/a n/a 387954 32 1.65 n/a
n/a 43 387954 288 5.00 n/a n/a 43 699819 32 7.84 GalNAc.sub.3-7a PO
43 699821 32 7.22 GalNAc.sub.3-7a PO 43 700000 32 6.91
GalNAc.sub.3-1a A.sub.d 44 703421 32 1.27 n/a n/a 43 703422 32 4.12
GalNAc.sub.3-7b n/a 43
Example 89: Antisense Inhibition In Vivo by Oligonucleotides
Targeting Apolipoprotein a (Apo(a)) Comprising a GalNAc.sub.3
Conjugate
[0956] The oligonucleotides listed in Table 79 below were tested in
a study for dose-dependent inhibition of Apo(a) in transgenic
mice.
TABLE-US-00083 TABLE 79 Modified ASOs targeting Apo(a) ISIS
Sequences GalNAc.sub.3 SEQ ID No. (5' to 3') Cluster CM No. 494372
T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ds
n/a n/a 53 G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds
.sup.mC.sub.dsT.sub.dsT.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.e
681257 GalNAc.sub.3- PO 53
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.dsG.sub.d-
s 7a T.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds
T.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.sup.mC.sub.e
The structure of GalNAc.sub.3-7.sub.a was shown in Example 48.
Treatment
[0957] Eight week old, female C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were each injected subcutaneously once per week at a
dosage shown below, for a total of six doses, with an
oligonucleotide listed in Table 79 or with PBS. Each treatment
group consisted of 3-4 animals. Tail bleeds were performed the day
before the first dose and weekly following each dose to determine
plasma Apo(a) protein levels. The mice were sacrificed two days
following the final administration. Apo(a) liver mRNA levels were
determined using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc. Eugene, Oreg.)
according to standard protocols. Apo(a) plasma protein levels were
determined using ELISA, and liver transaminase levels were
determined. The mRNA and plasma protein results in Table 80 are
presented as the treatment group average percent relative to the
PBS treated group. Plasma protein levels were further normalized to
the baseline (BL) value for the PBS group. Average absolute
transaminase levels and body weights (% relative to baseline
averages) are reported in Table 81.
[0958] As illustrated in Table 80, treatment with the
oligonucleotides lowered Apo(a) liver mRNA and plasma protein
levels in a dose-dependent manner. Furthermore, the oligonucleotide
comprising the GalNAc conjugate was significantly more potent with
a longer duration of action than the parent oligonucleotide lacking
a GalNAc conjugate. As illustrated in Table 81, transaminase levels
and body weights were unaffected by the oligonucleotides,
indicating that the oligonucleotides were well tolerated.
TABLE-US-00084 TABLE 80 Apo(a) liver mRNA and plasma protein levels
ISIS Dosage Apo(a) mRNA Apo(a) plasma protein (% PBS) No. (mg/kg)
(% PBS) BL Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 PBS n/a 100
100 120 119 113 88 121 97 494372 3 80 84 89 91 98 87 87 79 10 30 87
72 76 71 57 59 46 30 5 92 54 28 10 7 9 7 681257 0.3 75 79 76 89 98
71 94 78 1 19 79 88 66 60 54 32 24 3 2 82 52 17 7 4 6 5 10 2 79 17
6 3 2 4 5
TABLE-US-00085 TABLE 81 ISIS Dosage ALT AST Body weight No. (mg/kg)
(U/L) (U/L) (% baseline) PBS n/a 37 54 103 494372 3 28 68 106 10 22
55 102 30 19 48 103 681257 0.3 30 80 104 1 26 47 105 3 29 62 102 10
21 52 107
Example 90: Antisense Inhibition In Vivo by Oligonucleotides
Targeting TTR Comprising a GalNAc.sub.3 Cluster
[0959] Oligonucleotides listed in Table 82 below were tested in a
dose-dependent study for antisense inhibition of human
transthyretin (TTR) in transgenic mice that express the human TTR
gene.
Treatment
[0960] TTR transgenic mice were each injected subcutaneously once
per week for three weeks, for a total of three doses, with an
oligonucleotide and dosage listed in Table 83 or with PBS. Each
treatment group consisted of 4 animals. Prior to the first dose, a
tail bleed was performed to determine plasma TTR protein levels at
baseline (BL). The mice were sacrificed 72 hours following the
final administration. TTR protein levels were measured using a
clinical analyzer (AU480, Beckman Coulter, CA). Real-time PCR and
RIBOGREEN.RTM. RNA quantification reagent (Molecular Probes, Inc.
Eugene, Oreg.) were used according to standard protocols to
determine liver human TTR mRNA levels. The results presented in
Table 83 are the average values for each treatment group. The mRNA
levels are the average values relative to the average for the PBS
group. Plasma protein levels are the average values relative to the
average value for the PBS group at baseline. "BL" indicates
baseline, measurements that were taken just prior to the first
dose. As illustrated in Table 83, treatment with antisense
oligonucleotides lowered TTR expression levels in a dose-dependent
manner. The oligonucleotides comprising a GalNAc conjugate were
more potent than the parent lacking a GalNAc conjugate (ISIS
420915), and oligonucleotides comprising a phosphodiester or
deoxyadenosine cleavable moiety showed significant improvements in
potency compared to the parent lacking a conjugate (see ISIS
numbers 682883 and 666943 vs 420915 and see Examples 86 and
87).
TABLE-US-00086 TABLE 82 Oligonucleotides targeting human TTR Isis
Sequence Link- GalNAC SEQ No. 5' to 3' ages cluster CM ID No.
420915 T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.ds PS
n/a n/a 41 T.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds
G.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es
.sup.mC.sub.es.sup.mC.sub.e 682883 PS/PO GalNAC.sub.3- PO 41
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eo 3a
G.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eo
.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 666943 PS/PO
GalNAC.sub.3- A.sub.d 45
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eo 3a
G.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eo
.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 682887 PS/PO
GalNAC.sub.3- A.sub.d 45
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eo 7a
G.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eo
.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 682888 PS/PO
GalNAC.sub.3- A.sub.d 45
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eo 10a
G.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eo
.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e 682889 PS/PO
GalNAC.sub.3- A.sub.d 45
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eo 13a
G.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.eoT.sub.eo
.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.e
The legend for Table 82 can be found in Example 74. The structure
of GalNAc.sub.3-3.sub.a was shown in Example 39. The structure of
GalNAc.sub.3-7.sub.a was shown in Example 48. The structure of
GalNAc.sub.3-10.sub.a was shown in Example 46. The structure of
GalNAc.sub.3-13.sub.a was shown in Example 62.
TABLE-US-00087 TABLE 83 Antisense inhibition of human TTR in vivo
TTR TTR Dosage mRNA protein GalNAc Isis No. (mg/kg) (% PBS) (% BL)
cluster CM PBS n/a 100 124 n/a n/a 420915 6 69 114 n/a n/a 20 71 86
60 21 36 682883 0.6 61 73 GalNAc.sub.3-3a PO 2 23 36 6 18 23 666943
0.6 74 93 GalNAc.sub.3-3a A.sub.d 2 33 57 6 17 22 682887 0.6 60 97
GalNAc.sub.3-7a A.sub.d 2 36 49 6 12 19 682888 0.6 65 92
GalNAc.sub.3-10a A.sub.d 2 32 46 6 17 22 682889 0.6 72 74
GalNAc.sub.3-13a A.sub.d 2 38 45 6 16 18
Example 91: Antisense Inhibition In Vivo by Oligonucleotides
Targeting Factor VII Comprising a GalNAc.sub.3 Conjugate in
Non-Human Primates
[0961] Oligonucleotides listed in Table 84 below were tested in a
non-terminal, dose escalation study for antisense inhibition of
Factor VII in monkeys.
Treatment
[0962] Non-naive monkeys were each injected subcutaneously on days
0, 15, and 29 with escalating doses of an oligonucleotide listed in
Table 84 or with PBS. Each treatment group consisted of 4 males and
1 female. Prior to the first dose and at various time points
thereafter, blood draws were performed to determine plasma Factor
VII protein levels. Factor VII protein levels were measured by
ELISA. The results presented in Table 85 are the average values for
each treatment group relative to the average value for the PBS
group at baseline (BL), the measurements taken just prior to the
first dose. As illustrated in Table 85, treatment with antisense
oligonucleotides lowered Factor VII expression levels in a
dose-dependent manner, and the oligonucleotide comprising the
GalNAc conjugate was significantly more potent in monkeys compared
to the oligonucleotide lacking a GalNAc conjugate.
TABLE-US-00088 TABLE 84 Oligonucleotides targeting Factor VII
GalNAc SEQ Isis No. Sequence 5' to 3' Linkages cluster CM ID No.
407935
A.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.esT.sub.dsG.sub.dsG.sub-
.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds
PS n/a n/a 46 T.sub.es.sup.mC.sub.esT.sub.esG.sub.esA.sub.e 686892
A.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.esT.sub.dsG.sub.dsG.su-
b.dsT.sub.dsG.sub.ds PS GalNAc.sub.3-10a PO 46
A.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.esT.sub-
.esG.sub.esA.sub.e
The legend for Table 84 can be found in Example 74. The structure
of GalNAc.sub.3-10.sub.a was shown in Example 46.
TABLE-US-00089 TABLE 85 Factor VII plasma protein levels ISIS No.
Day Dose (mg/kg) Factor VII (% BL) 407935 0 n/a 100 15 10 87 22 n/a
92 29 30 77 36 n/a 46 43 n/a 43 686892 0 3 100 15 10 56 22 n/a 29
29 30 19 36 n/a 15 43 n/a 11
Example 92: Antisense Inhibition in Primary Hepatocytes by
Antisense Oligonucleotides Targeting Apo-CIII Comprising a
GalNAc.sub.3 Conjugate
[0963] Primary mouse hepatocytes were seeded in 96-well plates at
15,000 cells per well, and the oligonucleotides listed in Table 86,
targeting mouse ApoC-III, were added at 0.46, 1.37, 4.12, or 12.35,
37.04, 111.11, or 333.33 nM or 1.00 .mu.M. After incubation with
the oligonucleotides for 24 hours, the cells were lysed and total
RNA was purified using RNeasy (Qiagen). ApoC-III mRNA levels were
determined using real-time PCR and RIBOGREEN.RTM. RNA
quantification reagent (Molecular Probes, Inc.) according to
standard protocols. IC.sub.50 values were determined using Prism 4
software (GraphPad). The results show that regardless of whether
the cleavable moiety was a phosphodiester or a
phosphodiester-linked deoxyadensoine, the oligonucleotides
comprising a GalNAc conjugate were significantly more potent than
the parent oligonucleotide lacking a conjugate.
TABLE-US-00090 TABLE 86 Inhibition of mouse APOC-III expression in
mouse primary hepatocytes ISIS IC.sub.50 SEQ No. Sequence (5' to
3') CM (nM) ID No. 440670
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.d-
sA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.s-
ub.esA.sub.esG.sub.es.sup.mC.sub.esA.sub.e n/a 13.20 47 661180
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.d-
sA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.s-
ub.es A.sub.d 1.40 48 A.sub.esG.sub.es.sup.mC.sub.esA.sub.eo 680771
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.-
sub.es PO 0.70 47 A.sub.esG.sub.es.sup.mC.sub.esAe 680772
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.-
sub.es PO 1.70 47 A.sub.esG.sub.es.sup.mC.sub.esAe 680773
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.-
sub.es PO 2.00 47 A.sub.esG.sub.es.sup.mC.sub.esAe 680774
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.-
sub.es PO 1.50 47 A.sub.esG.sub.es.sup.mC.sub.esAe 681272
.sup.mC.sub.esA.sub.eoG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.-
sub.eo PO <0.46 47 A.sub.eoG.sub.es.sup.mC.sub.esAe 681273
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds
A.sub.d 1.10 49 .sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esAe
683733
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.d-
sA.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.s-
ub.es A.sub.d 2.50 48 A.sub.esG.sub.es.sup.mC.sub.esA.sub.eo
The structure of GalNAc.sub.3-1.sub.a was shown previously in
Example 9, GalNAc.sub.3-3.sub.a was shown in Example 39,
GalNAc.sub.3-7.sub.a was shown in Example 48, GalNAc.sub.3-10.sub.a
was shown in Example 46, GalNAc.sub.3-13.sub.a was shown in Example
62, and GalNAc.sub.3-19.sub.a was shown in Example 70.
Example 93: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising Mixed Wings and a 5'-GalNAc.sub.3
Conjugate
[0964] The oligonucleotides listed in Table 87 were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
TABLE-US-00091 TABLE 87 Modified ASOs targeting SRB-1 ISIS
GalNAc.sub.3 SEQ No. Sequences(5' to 3') Cluster CM ID No. 449093
T.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.d-
sA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub-
.ks.sup.mC.sub.k n/a n/a 50 699806
T.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-3a PO
50 T.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 699807
T.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7a PO
50 T.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 699809
T.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7a PO
50 T.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e 699811
T.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7a PO
50 T.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 699813
T.sub.ksT.sub.ds.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7a PO
50 T.sub.dsT.sub.ks.sup.mC.sub.ds.sup.mC.sub.k 699815
T.sub.esT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.-
dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7a PO
50 T.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.e The structure of
GalNAc.sub.3-3.sub.a was shown previously in Example 39, and the
structure of GalNAc.sub.3-7a was shown previously in Example 48.
Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates
.beta.-D-2'-deoxyribonucleoside; "k" indicates 6'-(S)-CH.sub.3
bicyclic nucleoside (cEt); "s" indicates phosphorothioate
internucleoside linkages (PS); "o" indicates phosphodiester
internuclcoside linkages (PO). Supersript "m" indicates
5-methylcytosines.
Treatment
[0965] Six to eight week old C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once at the dosage shown
below with an oligonucleotide listed in Table 87 or with saline.
Each treatment group consisted of 4 animals. The mice were
sacrificed 72 hours following the final administration. Liver SRB-1
mRNA levels were measured using real-time PCR. SRB-1 mRNA levels
were normalized to cyclophilin mRNA levels according to standard
protocols. The results are presented as the average percent of
SRB-1 mRNA levels for each treatment group relative to the saline
control group. As illustrated in Table 88, treatment with antisense
oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent
manner, and the gapmer oligonucleotides comprising a GalNAc
conjugate and having wings that were either full cEt or mixed sugar
modifications were significantly more potent than the parent
oligonucleotide lacking a conjugate and comprising full cEt
modified wings.
[0966] Body weights, liver transaminases, total bilirubin, and BUN
were also measured, and the average values for each treatment group
are shown in Table 88. Body weight is shown as the average percent
body weight relative to the baseline body weight (% BL) measured
just prior to the oligonucleotide dose.
TABLE-US-00092 TABLE 88 SRB-1 mRNA, ALT, AST, BUN, and total
bilirubin levels and body weights SRB-1 Body ISIS Dosage mRNA ALT
AST weight No. (mg/kg) (% PBS) (U/L) (U/L) Bil BUN (% BL) PBS n/a
100 31 84 0.15 28 102 449093 1 111 18 48 0.17 31 104 3 94 20 43
0.15 26 103 10 36 19 50 0.12 29 104 699806 0.1 114 23 58 0.13 26
107 0.3 59 21 45 0.12 27 108 1 25 30 61 0.12 30 104 699807 0.1 121
19 41 0.14 25 100 0.3 73 23 56 0.13 26 105 1 24 22 69 0.14 25 102
699809 0.1 125 23 57 0.14 26 104 0.3 70 20 49 0.10 25 105 1 33 34
62 0.17 25 107 699811 0.1 123 48 77 0.14 24 106 0.3 94 20 45 0.13
25 101 1 66 57 104 0.14 24 107 699813 0.1 95 20 58 0.13 28 104 0.3
98 22 61 0.17 28 105 1 49 19 47 0.11 27 106 699815 0.1 93 30 79
0.17 25 105 0.3 64 30 61 0.12 26 105 1 24 18 41 0.14 25 106
Example 94: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising 2'-Sugar Modifications and a
5'-GalNAc.sub.3 Conjugate
[0967] The oligonucleotides listed in Table 89 were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
TABLE-US-00093 TABLE 89 Modified ASOs targeting SRB-1 ISIS
GalNAc.sub.3 SEQ No. Sequences (5' to 3') Cluster CM ID No. 353382
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.es n/a n/a 28 T.sub.esT.sub.e
700989
G.sub.msC.sub.msU.sub.msU.sub.msC.sub.msA.sub.dsG.sub.dsT.sub.ds.su-
p.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsU.sub.msC-
.sub.msC.sub.ms n/a n/a 51 U.sub.msU.sub.m 666904
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds
GalNAc.sub.3-3a PO 28
.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.e
700991
G.sub.msC.sub.msU.sub.msU.sub.msC.sub.msA.sub.dsG.sub.dsT.sub.ds.s-
up.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds GalNAc.sub.3-7a PO 51
A.sub.ds.sup.mC.sub.dsT.sub.dsU.sub.msC.sub.msC.sub.msU.sub.msUm
Subscript "m" indicatesa 2'-O-methyl modified nucleoside. See
Example 74 for complete table legend. The structure of
GalNAc.sub.3-3.sub.a was shown previously in Example 39, and the
structure of GalNAc.sub.3-7.sub.a was shown previously in Example
48.
Treatment
[0968] The study was completed using the protocol described in
Example 93. Results are shown in Table 90 below and show that both
the 2'-MOE and 2'-OMe modified oligonucleotides comprising a GalNAc
conjugate were significantly more potent than the respective parent
oligonucleotides lacking a conjugate. The results of the body
weights, liver transaminases, total bilirubin, and BUN measurements
indicated that the compounds were all well tolerated.
TABLE-US-00094 TABLE 90 SRB-1 mRNA ISIS No. Dosage (mg/kg) SRB-1
mRNA (% PBS) PBS n/a 100 353382 5 116 15 58 45 27 700989 5 120 15
92 45 46 666904 1 98 3 45 10 17 700991 1 118 3 63 10 14
Example 95: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising Bicyclic Nucleosides and a
5'-GalNAc.sub.3 Conjugate
[0969] The oligonucleotides listed in Table 91 were tested in a
dose-dependent study for antisense inhibition of SRB-1 in mice.
TABLE-US-00095 TABLE 91 Modified ASOs targeting SRB-1 ISIS GalNAc3
SEQ No. Sequenc.sub.es(5' to 3') Cluster CM ID No 440762
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.d-
sT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
n/a n/a 22 666905
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
GalNAc.sub.3-3.sub.a PO 22 699782
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
GalNAc.sub.3-7.sub.a PO 22 699783
T.sub.ls.sup.mC.sub.lsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ls.sup.mC.sub.l
GalNAc.sub.3-3.sub.a PO 22 653621
T.sub.ls.sup.mC.sub.lsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.d-
sT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ls.sup.mC.sub.10
GalNAc.sub.3-1.sub.a A.sub.d 23 439879
T.sub.gs.sup.mC.sub.gsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.d-
sTdG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.gs.sup.mC.sub.g n/a
n/a 22 699789
T.sub.gs.sup.mC.sub.gsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsTdG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.gs.sup.mC.sub.g
GalNAc.sub.3-3.sub.a PO 22 Subscript "g" indicatesa fluoro-HNA
nucleoside, subscript "l" indicates a locked nucleoside comprising
a 2'-O--CH.sub.2-4' bridge. See the Example 74 table legend for
other abbreviations. The structure of GalNAc.sub.3-1.sub.a was
shown previously in Example 9, the structure of
GalNAc.sub.3-3.sub.a was shown previously in Example 39, and the
structure of GalNAc.sub.3-7.sub.a was shown previously in Example
48.
Treatment
[0970] The study was completed using the protocol described in
Example 93. Results are shown in Table 92 below and show that
oligonucleotides comprising a GalNAc conjugate and various bicyclic
nucleoside modifications were significantly more potent than the
parent oligonucleotide lacking a conjugate and comprising bicyclic
nucleoside modifications. Furthermore, the oligonucleotide
comprising a GalNAc conjugate and fluoro-HNA modifications was
significantly more potent than the parent lacking a conjugate and
comprising fluoro-HNA modifications. The results of the body
weights, liver transaminases, total bilirubin, and BUN measurements
indicated that the compounds were all well tolerated.
TABLE-US-00096 TABLE 92 SRB-1 mRNA, ALT, AST, BUN, and total
bilirubin levels and body weights ISIS No. Dosage (mg/kg) SRB-1
mRNA (% PBS) PBS n/a 100 440762 1 104 3 65 10 35 666905 0.1 105 0.3
56 1 18 699782 0.1 93 0.3 63 1 15 699783 0.1 105 0.3 53 1 12 653621
0.1 109 0.3 82 1 27 439879 1 96 3 77 10 37 699789 0.1 82 0.3 69 1
26
Example 96: Plasma Protein Binding of Antisense Oligonucleotides
Comprising a GalNAc.sub.3 Conjugate Group
[0971] Oligonucleotides listed in Table 57 targeting ApoC-III and
oligonucleotides in Table 93 targeting Apo(a) were tested in an
ultra-filtration assay in order to assess plasma protein
binding.
TABLE-US-00097 TABLE 93 Modified
oligonucl.sub.eotid.sub.estargeting Apo(a) ISIS GalNAc.sub.3 SEQ
No. Sequenc.sub.es(5' to 3') Cluster CM ID No 494372
T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.dsG-
.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.esG.sub.esT.sub.es n/a n/a 53 T.sub.es.sup.mCe 693401
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.dsG-
.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eoG.sub.eoT.sub.es n/a n/a 53 T.sub.es.sup.mCe 681251
'T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.d-
sG.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds
GalNAc.sub.3-7.sub.a PO 53
T.sub.dsT.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.e 681257
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds
GalNAc.sub.3-7.sub.a PO 53
T.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.sup.mC.sub.e
See the Example 74 for table legend. The structure of
GalNAc.sub.3-7a was shown previously in Example 48.
[0972] Ultrafree-MC ultrafiltration units (30,000 NMWL, low-binding
regenerated cellulose membrane, Millipore, Bedford, Mass.) were
pre-conditioned with 300 .mu.l of 0.5% Tween 80 and centrifuged at
2000 g for 10 minutes, then with 3004 of a 300 .mu.g/mL solution of
a control oligonucleotide in H.sub.2O and centrifuged at 2000 g for
16 minutes. In order to assess non-specific binding to the filters
of each test oligonucleotide from Tables 57 and 93 to be used in
the studies, 300 .mu.L of a 250 ng/mL solution of oligonucleotide
in H.sub.2O at pH 7.4 was placed in the pre-conditioned filters and
centrifuged at 2000 g for 16 minutes. The unfiltered and filtered
samples were analyzed by an ELISA assay to determine the
oligonucleotide concentrations. Three replicates were used to
obtain an average concentration for each sample. The average
concentration of the filtered sample relative to the unfiltered
sample is used to determine the percent of oligonucleotide that is
recovered through the filter in the absence of plasma (%
recovery).
[0973] Frozen whole plasma samples collected in K3-EDTA from
normal, drug-free human volunteers, cynomolgus monkeys, and CD-1
mice, were purchased from Bioreclamation LLC (Westbury, N.Y.). The
test oligonucleotides were added to 1.2 mL aliquots of plasma at
two concentrations (5 and 150 .mu.g/mL). An aliquot (300 .mu.L) of
each spiked plasma sample was placed in a pre-conditioned filter
unit and incubated at 37.degree. C. for 30 minutes, immediately
followed by centrifugation at 2000 g for 16 minutes. Aliquots of
filtered and unfiltered spiked plasma samples were analyzed by an
ELISA to determine the oligonucleotide concentration in each
sample. Three replicates per concentration were used to determine
the average percentage of bound and unbound oligonucleotide in each
sample. The average concentration of the filtered sample relative
to the concentration of the unfiltered sample is used to determine
the percent of oligonucleotide in the plasma that is not bound to
plasma proteins (% unbound). The final unbound oligonucleotide
values are corrected for non-specific binding by dividing the %
unbound by the % recovery for each oligonucleotide. The final %
bound oligonucleotide values are determined by subtracting the
final % unbound values from 100. The results are shown in Table 94
for the two concentrations of oligonucleotide tested (5 and 150
.mu.g/mL) in each species of plasma. The results show that GalNAc
conjugate groups do not have a significant impact on plasma protein
binding. Furthermore, oligonucleotides with full PS internucleoside
linkages and mixed PO/PS linkages both bind plasma proteins, and
those with full PS linkages bind plasma proteins to a somewhat
greater extent than those with mixed PO/PS linkages.
TABLE-US-00098 TABLE 94 Percent of modified oligonucleotide bound
to plasma proteins Human plasma Monkey plasma Mouse plasma ISIS 5 5
5 No. .mu.g/mL 150 .mu.g/mL .mu.g/mL 150 .mu.g/mL .mu.g/mL 150
.mu.g/mL 304801 99.2 98.0 99.8 99.5 98.1 97.2 663083 97.8 90.9 99.3
99.3 96.5 93.0 674450 96.2 97.0 98.6 94.4 94.6 89.3 494372 94.1
89.3 98.9 97.5 97.2 93.6 693401 93.6 89.9 96.7 92.0 94.6 90.2
681251 95.4 93.9 99.1 98.2 97.8 96.1 681257 93.4 90.5 97.6 93.7
95.6 92.7
Example 97: Modified Oligonucleotides Targeting TTR Comprising a
GalNAc.sub.3 Conjugate Group
[0974] The oligonucleotides shown in Table 95 comprising a GalNAc
conjugate were designed to target TTR.
TABLE-US-00099 TABLE 95 Modified oligonucleotides targeting TTR
GalNAc.sub.3 SEQ ID ISIS No. Sequences (5' to 3') Cluster CM No
666941
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-3 A.sub.d 45
A.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.su-
p.mC.sub.es.sup.mC.sub.e 666942
T.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eoG.sub.eoG.sub.dsT.sub.dsT.sub-
.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds
GalNAc.sub.3-1 A.sub.d 42
A.sub.eoT.sub.eo.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo 682876
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.3-3 PO 41
G.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.-
mC.sub.e 682877
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.3-7 PO 41
G.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.-
mCe 682878
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.dsA.sub.ds GalNAc.sub.3-10 PO 41
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub-
.es.sup.mC.sub.e 682879
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.dsA.sub.ds GalNAc.sub.3-13 PO 41
T.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub-
.es.sup.mC.sub.e 682880
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-7 A.sub.d 45
A.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsik.sub.esT.sub.es.sup.mC.sub.es.s-
up.mC.sub.es.sup.mC.sub.e 682881
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-10 A.sub.d 45
A.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.su-
p.mC.sub.es.sup.mC.sub.e 682882
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.su-
b.dsA.sub.ds.sup.mC.sub.ds GalNAc.sub.3-13 A.sub.d 45
A.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.esT.sub.es.sup.mC.sub.es.su-
p.mC.sub.es.sup.mC.sub.e 684056
T.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.sub-
.dsA.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds
GalNAc.sub.3-19 A.sub.d 42
A.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.eo
The legend for Table 95 can be found in Example 74. The structure
of GalNAc.sub.3-1 was shown in Example 9. The structure of
GalNAc.sub.3-3.sub.a was shown in Example 39. The structure of
GalNAc.sub.3-7.sub.a was shown in Example 48. The structure of
GalNAc.sub.3-10.sub.a was shown in Example 46. The structure of
GalNAc.sub.3-13.sub.a was shown in Example 62. The structure of
GalNAc.sub.3-19.sub.a was shown in Example 70.
Example 98: Evaluation of Pro-Inflammatory Effects of
Oligonucleotides Comprising a GalNAc Conjugate in hPMBC Assay
[0975] The oligonucleotides listed in Table 96 and were tested for
pro-inflammatory effects in an hPMBC assay as described in Examples
23 and 24. (See Tables 17, 70, 82, and 95 for descriptions of the
oligonucleotides.) ISIS 353512 is a high responder used as a
positive control, and the other oligonucleotides are described in
Tables 70, 82, and 95. The results shown in Table 96 were obtained
using blood from one volunteer donor. The results show that the
oligonucleotides comprising mixed PO/PS internucleoside linkages
produced significantly lower pro-inflammatory responses compared to
the same oligonucleotides having full PS linkages. Furthermore, the
GalNAc conjugate group did not have a significant effect in this
assay.
TABLE-US-00100 TABLE 96 ISIS No. E.sub.max/EC.sub.50 GalNAc.sub.3
cluster Linkages CM 353512 3630 n/a PS n/a 420915 802 n/a PS n/a
682881 1311 GalNAc.sub.3-10 PS A.sub.d 682888 0.26 GalNAc.sub.3-10
PO/PS A.sub.d 684057 1.03 GalNAc.sub.3-19 PO/PS A.sub.d
Example 99: Binding Affinities of Oligonucleotides Comprising a
GalNAc Conjugate for the Asialoglycoprotein Receptor
[0976] The binding affinities of the oligonucleotides listed in
Table 97 (see Table 63 for descriptions of the oligonucleotides)
for the asialoglycoprotein receptor were tested in a competitive
receptor binding assay. The competitor ligand, .alpha.1-acid
glycoprotein (AGP), was incubated in 50 mM sodium acetate buffer
(pH 5) with 1 U neuraminidase-agarose for 16 hours at 3TC, and
>90% desialylation was confirmed by either sialic acid assay or
size exclusion chromatography (SEC). Iodine monochloride was used
to iodinate the AGP according to the procedure by Atsma et al. (see
J Lipid Res. 1991 January; 32(1):173-81.) In this method,
desialylated .alpha.1-acid glycoprotein (de-AGP) was added to 10 mM
iodine chloride, Na.sup.125I, and 1 M glycine in 0.25 M NaOH. After
incubation for 10 minutes at room temperature, .sup.125I-labeled
de-AGP was separated from free .sup.125I by concentrating the
mixture twice utilizing a 3 KDMWCO spin column. The protein was
tested for labeling efficiency and purity on a HPLC system equipped
with an Agilent SEC-3 column (7.8.times.300 mm) and a B-RAM
counter. Competition experiments utilizing .sup.125I-labeled de-AGP
and various GalNAc-cluster containing ASOs were performed as
follows. Human HepG2 cells (10.sup.6 cells/ml) were plated on
6-well plates in 2 ml of appropriate growth media. MEM media
supplemented with 10% fetal bovine serum (FBS), 2 mM L-Glutamine
and 10 mM HEPES was used. Cells were incubated 16-20 hours @ 3TC
with 5% and 10% CO.sub.2 respectively. Cells were washed with media
without FBS prior to the experiment. Cells were incubated for 30
min @37.degree. C. with 1 ml competition mix containing appropriate
growth media with 2% FBS, 10.sup.-8 M .sup.125I-labeled de-AGP and
GalNAc-cluster containing ASOs at concentrations ranging from
10.sup.-11 to 10.sup.-5 M. Non-specific binding was determined in
the presence of 10.sup.-2 M GalNAc sugar. Cells were washed twice
with media without FBS to remove unbound .sup.125I-labeled de-AGP
and competitor GalNAc ASO. Cells were lysed using Qiagen's RLT
buffer containing 1% .beta.-mercaptoethanol. Lysates were
transferred to round bottom assay tubes after a brief 10 min
freeze/thaw cycle and assayed on a .gamma.-counter. Non-specific
binding was subtracted before dividing .sup.125I protein counts by
the value of the lowest GalNAc-ASO concentration counts. The
inhibition curves were fitted according to a single site
competition binding equation using a nonlinear regression algorithm
to calculate the binding affinities (KS's).
[0977] The results in Table 97 were obtained from experiments
performed on five different days. Results for oligonucleotides
marked with superscript "a" are the average of experiments run on
two different days. The results show that the oligonucleotides
comprising a GalNAc conjugate group on the 5'-end bound the
asialoglycoprotein receptor on human HepG2 cells with 1.5 to
16-fold greater affinity than the oligonucleotides comprising a
GalNAc conjugate group on the 3'-end.
TABLE-US-00101 TABLE 97 Asialoglycoprotein receptor binding assay
results Oligonucleotide end GalNAc to which GalNAc K.sub.D ISIS No.
conjugate conjugate is attached (nM) 661161.sup.a GalNAc.sub.3-3 5'
3.7 666881.sup.a GalNAc.sub.3-10 5' 7.6 666981.sup. GalNAc.sub.3-7
5' 6.0 670061.sup. GalNAc.sub.3-13 5' 7.4 655861.sup.a
GalNAc.sub.3-1 3' 11.6 677841.sup.a GalNAc.sub.3-19 3' 60.8
Example 100: Antisense Inhibition In Vivo by Oligonucleotides
Comprising a GalNAc Conjugate Group Targeting Apo(a) In Vivo
[0978] The oligonucleotides listed in Table 98a below were tested
in a single dose study for duration of action in mice.
TABLE-US-00102 TABLE 98a Modified ASOs targeting APO(a) ISIS
GalNAc.sub.3 SEQ No. Sequences (5' to 3') Cluster CM ID No. 681251
T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-7a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e 681257
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-7a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e
The structure of GalNAc.sub.3-7.sub.a was shown in Example 48.
Treatment
[0979] Female transgenic mice that express human Apo(a) were each
injected subcutaneously once per week, for a total of 6 doses, with
an oligonucleotide and dosage listed in Table 98b or with PBS. Each
treatment group consisted of 3 animals. Blood was drawn the day
before dosing to determine baseline levels of Apo(a) protein in
plasma and at 72 hours, 1 week, and 2 weeks following the first
dose. Additional blood draws will occur at 3 weeks, 4 weeks, 5
weeks, and 6 weeks following the first dose. Plasma Apo(a) protein
levels were measured using an ELISA. The results in Table 98b are
presented as the average percent of plasma Apo(a) protein levels
for each treatment group, normalized to baseline levels (% BL), The
results show that the oligonucleotides comprising a GalNAc
conjugate group exhibited potent reduction in Apo(a) expression.
This potent effect was observed for the oligonucleotide that
comprises full PS internucleoside linkages and the oligonucleotide
that comprises mixed PO and PS linkages.
TABLE-US-00103 TABLE 98b Apo(a) plasma protein levels Apo(a) at
Apo(a) at Apo(a) at Dosage 72 hours 1 week 3 weeks ISIS No. (mg/kg)
(% BL) (% BL) (% BL) PBS n/a 116 104 107 681251 0.3 97 108 93 1.0
85 77 57 3.0 54 49 11 10.0 23 15 4 681257 0.3 114 138 104 1.0 91 98
54 3.0 69 40 6 10.0 30 21 4
Example 101: Antisense Inhibition by Oligonucleotides Comprising a
GalNAc Cluster Linked Via a Stable Moiety
[0980] The oligonucleotides listed in Table 99 were tested for
inhibition of mouse APOC-III expression in vivo. C57Bl/6 mice were
each injected subcutaneously once with an oligonucleotide listed in
Table 99 or with PBS. Each treatment group consisted of 4 animals.
Each mouse treated with ISIS 440670 received a dose of 2, 6, 20, or
60 mg/kg. Each mouse treated with ISIS 680772 or 696847 received
0.6, 2, 6, or 20 mg/kg. The GalNAc conjugate group of ISIS 696847
is linked via a stable moiety, a phosphorothioate linkage instead
of a readily cleavable phosphodiester containing linkage. The
animals were sacrificed 72 hours after the dose. Liver APOC-III
mRNA levels were measured using real-time PCR. APOC-III mRNA levels
were normalized to cyclophilin mRNA levels according to standard
protocols. The results are presented in Table 99 as the average
percent of APOC-III mRNA levels for each treatment group relative
to the saline control group. The results show that the
oligonucleotides comprising a GalNAc conjugate group were
significantly more potent than the oligonucleotide lacking a
conjugate group. Furthermore, the oligonucleotide comprising a
GalNAc conjugate group linked to the oligonucleotide via a
cleavable moiety (ISIS 680772) was even more potent than the
oligonucleotide comprising a GalNAc conjugate group linked to the
oligonucleotide via a stable moiety (ISIS 696847).
TABLE-US-00104 TABLE 99 Modified oligonucleotides targeting mouse
APOC-III APOC-III ISIS Dosage mRNA SEQ No. Sequences (5' to 3') CM
(mg/kg) (% PBS) ID No. 440670
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.d-
sA.sub.dsT.sub.dsT.sub.dsA.sub.ds n/a 2 92 47
G.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub-
.esAe 6 86 20 59 60 37 680772
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.ds PO 0.6 79 47
T.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.esA.s-
ub.esG.sub.es.sup.mC.sub.esAe 2 58 6 31 20 13 696847
.sup.mC.sub.esA.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.-
dsA.sub.dsT.sub.ds n/a (PS) 0.6 83 47
T.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.esA.sub.esG.s-
ub.es.sup.mC.sub.esAe 2 73 6 40 20 28
The structure of GalNAc.sub.3-7.sub.a was shown in Example 48.
Example 102: Distribution in Liver of Antisense Oligonucleotides
Comprising a GalNAc Conjugate
[0981] The liver distribution of ISIS 353382 (see Table 23) that
does not comprise a GalNAc conjugate and ISIS 655861 (see Table 23)
that does comprise a GalNAc conjugate was evaluated. Male balb/c
mice were subcutaneously injected once with ISIS 353382 or 655861
at a dosage listed in Table 100. Each treatment group consisted of
3 animals except for the 18 mg/kg group for ISIS 655861, which
consisted of 2 animals. The animals were sacrificed 48 hours
following the dose to determine the liver distribution of the
oligonucleotides. In order to measure the number of antisense
oligonucleotide molecules per cell, a Ruthenium (II)
tris-bipyridine tag (MSD TAG, Meso Scale Discovery) was conjugated
to an oligonucleotide probe used to detect the antisense
oligonucleotides. The results presented in Table 100 are the
average concentrations of oligonucleotide for each treatment group
in units of millions of oligonucleotide molecules per cell. The
results show that at equivalent doses, the oligonucleotide
comprising a GalNAc conjugate was present at higher concentrations
in the total liver and in hepatocytes than the oligonucleotide that
does not comprise a GalNAc conjugate. Furthermore, the
oligonucleotide comprising a GalNAc conjugate was present at lower
concentrations in non-parenchymal liver cells than the
oligonucleotide that does not comprise a GalNAc conjugate. And
while the concentrations of ISIS 655861 in hepatocytes and
non-parenchymal liver cells were similar per cell, the liver is
approximately 80% hepatocytes by volume. Thus, the majority of the
ISIS 655861 oligonucleotide that was present in the liver was found
in hepatocytes, whereas the majority of the ISIS 353382
oligonucleotide that was present in the liver was found in
non-parenchymal liver cells.
TABLE-US-00105 TABLE 100 Concentration in Concentration
Concentration non-parenchymal in whole liver in hepatocytes liver
cells ISIS Dosage (molecules * (molecules * (molecules * No.
(mg/kg) 10{circumflex over ( )}6 per cell) 10{circumflex over ( )}6
per cell) 10{circumflex over ( )}6 per cell) 353382 3 9.7 1.2 37.2
10 17.3 4.5 34.0 20 23.6 6.6 65.6 30 29.1 11.7 80.0 60 73.4 14.8
98.0 90 89.6 18.5 119.9 655861 0.5 2.6 2.9 3.2 1 6.2 7.0 8.8 3 19.1
25.1 28.5 6 44.1 48.7 55.0 18 76.6 82.3 77.1
Example 103: Duration of Action In Vivo of Oligonucleotides
Targeting APOC-III Comprising a GalNAc.sub.3 Conjugate
[0982] The oligonucleotides listed in Table 101 below were tested
in a single dose study for duration of action in mice.
TABLE-US-00106 TABLE 101 Modified ASOs targeting APOC-III ISIS
GalNAc.sub.3 SEQ No. Sequences (5' to 3') Cluster CM ID No. 304801
A.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.dsT.sub.d-
sT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.-
mC.sub.dsT.sub.esT.sub.es n/a n/a 20 T.sub.esA.sub.esT.sub.e 663084
A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.dsT.sub.-
dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds GalNAc3-3a A.sub.d 36
.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.eoT.sub.eoT.sub.esA.sub-
.esT.sub.e 679241
A.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.dsT.sub.d-
sT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.-
mC.sub.dsT.sub.eoT.sub.eo GalNAc3-19a A.sub.d 21
T.sub.esA.sub.esT.sub.eo
The structure of GalNAc.sub.3-3.sub.a was shown in Example 39, and
GalNAc.sub.3-19.sub.a was shown in Example 70.
Treatment
[0983] Female transgenic mice that express human APOC-III were each
injected subcutaneously once with an oligonucleotide listed in
Table 101 or with PBS. Each treatment group consisted of 3 animals.
Blood was drawn before dosing to determine baseline and at 3, 7,
14, 21, 28, 35, and 42 days following the dose. Plasma triglyceride
and APOC-III protein levels were measured as described in Example
20. The results in Table 102 are presented as the average percent
of plasma triglyceride and APOC-III levels for each treatment
group, normalized to baseline levels. A comparison of the results
in Table 58 of example 79 with the results in Table 102 below show
that oligonucleotides comprising a mixture of phosphodiester and
phosphorothioate internucleoside linkages exhibited increased
duration of action than equivalent oligonucleotides comprising only
phosphorothioate internucleoside linkages.
TABLE-US-00107 TABLE 102 Plasma triglyceride and APOC-III protein
levels in transgenic mice Time point APOC-III ISIS Dosage (days
post- Triglycerides protein (% GalNAc.sub.3 No. (mg/kg) dose) (%
baseline) baseline) Cluster CM PBS n/a 3 96 101 n/a n/a 7 88 98 14
91 103 21 69 92 28 83 81 35 65 86 42 72 88 304801 30 3 42 46 n/a
n/a 7 42 51 14 59 69 21 67 81 28 79 76 35 72 95 42 82 92 663084 10
3 35 28 GalNAc.sub.3- A.sub.d 7 23 24 3a 14 23 26 21 23 29 28 30 22
35 32 36 42 37 47 679241 10 3 38 30 GalNAc.sub.3- A.sub.d 7 31 28
19a 14 30 22 21 36 34 28 48 34 35 50 45 42 72 64
Example 104: Synthesis of Oligonucleotides Comprising a
5'-GalNAc.sub.2 Conjugate
##STR00246## ##STR00247##
[0985] Compound 120 is commercially available, and the synthesis of
compound 126 is described in Example 49. Compound 120 (1 g, 2.89
mmol), HBTU (0.39 g, 2.89 mmol), and HOBt (1.64 g, 4.33 mmol) were
dissolved in DMF (10 mL. and N,N-diisopropylethylamine (1.75 mL,
10.1 mmol) were added. After about 5 min, aminohexanoic acid benzyl
ester (1.36 g, 3.46 mmol) was added to the reaction. After 3 h, the
reaction mixture was poured into 100 mL of 1 M NaHSO.sub.4 and
extracted with 2.times.50 mL ethyl acetate. Organic layers were
combined and washed with 3.times.40 mL sat NaHCO.sub.3 and
2.times.brine, dried with Na.sub.2SO.sub.4, filtered and
concentrated. The product was purified by silica gel column
chromatography (DCM:EA:Hex, 1:1:1) to yield compound 231. LCMS and
NMR were consistent with the structure. Compounds 231 (1.34 g,
2.438 mmol) was dissolved in dichloromethane (10 mL) and
trifluoracetic acid (10 mL) was added. After stirring at room
temperature for 2 h, the reaction mixture was concentrated under
reduced pressure and co-evaporated with toluene (3.times.10 mL).
The residue was dried under reduced pressure to yield compound 232
as the trifuloracetate salt. The synthesis of compound 166 is
described in Example 54. Compound 166 (3.39 g, 5.40 mmol) was
dissolved in DMF (3 mL). A solution of compound 232 (1.3 g, 2.25
mmol) was dissolved in DMF (3 mL) and N,N-diisopropylethylamine
(1.55 mL) was added. The reaction was stirred at room temperature
for 30 minutes, then poured into water (80 mL) and the aqueous
layer was extracted with EtOAc (2.times.100 mL). The organic phase
was separated and washed with sat. aqueous NaHCO.sub.3 (3.times.80
mL), 1 M NaHSO.sub.4 (3.times.80 mL) and brine (2.times.80 mL),
then dried (Na.sub.2SO.sub.4), filtered, and concentrated. The
residue was purified by silica gel column chromatography to yield
compound 233. LCMS and NMR were consistent with the structure.
Compound 233 (0.59 g, 0.48 mmol) was dissolved in methanol (2.2 mL)
and ethyl acetate (2.2 mL). Palladium on carbon (10 wt % Pd/C, wet,
0.07 g) was added, and the reaction mixture was stirred under
hydrogen atmosphere for 3 h. The reaction mixture was filtered
through a pad of Celite and concentrated to yield the carboxylic
acid. The carboxylic acid (1.32 g, 1.15 mmol, cluster free acid)
was dissolved in DMF (3.2 mL). To this N,N-diisopropylehtylamine
(0.3 mL, 1.73 mmol) and PFPTFA (0.30 mL, 1.73 mmol) were added.
After 30 min stirring at room temperature the reaction mixture was
poured into water (40 mL) and extracted with EtOAc (2.times.50 mL).
A standard work-up was completed as described above to yield
compound 234. LCMS and NMR were consistent with the structure.
Oligonucleotide 235 was prepared using the general procedure
described in Example 46. The GalNAc.sub.2 cluster portion
(GalNAc.sub.2-24.sub.a) of the conjugate group GalNAc.sub.2-24 can
be combined with any cleavable moiety present on the
oligonucleotide to provide a variety of conjugate groups. The
structure of GalNAc.sub.2-24 (GalNAc.sub.2-24.sub.a-CM) is shown
below:
##STR00248##
Example 105: Synthesis of Oligonucleotides Comprising a
GalNAc.sub.1-25 Conjugate
##STR00249##
[0987] The synthesis of compound 166 is described in Example 54.
Oligonucleotide 236 was prepared using the general procedure
described in Example 46.
[0988] Alternatively, oligonucleotide 236 was synthesized using the
scheme shown below, and compound 238 was used to form the
oligonucleotide 236 using procedures described in Example 10.
##STR00250##
The GalNAc.sub.1 cluster portion (GalNAc.sub.1-25.sub.a) of the
conjugate group GalNAc.sub.1-25 can be combined with any cleavable
moiety present on the oligonucleotide to provide a variety of
conjugate groups. The structure of GalNAc.sub.1-25
(GalNAc.sub.1-25.sub.a-CM) is shown below:
##STR00251##
Example 106: Antisense Inhibition In Vivo by Oligonucleotides
Targeting SRB-1 Comprising a 5'-GalNAc.sub.2 or a 5'-GalNAc.sub.3
Conjugate
[0989] Oligonucleotides listed in Tables 103 and 104 were tested in
dose-dependent studies for antisense inhibition of SRB-1 in
mice.
Treatment
[0990] Six to week old, male C57BL/6 mice (Jackson Laboratory, Bar
Harbor, Me.) were injected subcutaneously once with 2, 7, or 20
mg/kg of ISIS No. 440762; or with 0.2, 0.6, 2, 6, or 20 mg/kg of
ISIS No. 686221, 686222, or 708561; or with saline. Each treatment
group consisted of 4 animals. The mice were sacrificed 72 hours
following the final administration. Liver SRB-1 mRNA levels were
measured using real-time PCR. SRB-1 mRNA levels were normalized to
cyclophilin mRNA levels according to standard protocols. The
antisense oligonucleotides lowered SRB-1 mRNA levels in a
dose-dependent manner, and the ED.sub.50 results are presented in
Tables 103 and 104. Although previous studies showed that trivalent
GalNAc-conjugated oligonucleotides were significantly more potent
than divalent GalNAc-conjugated oligonucleotides, which were in
turn significantly more potent than monovalent GalNAc conjugated
oligonucleotides (see, e.g., Khorev et al., Bioorg. & Med.
Chem., Vol. 16, 5216-5231 (2008)), treatment with antisense
oligonucleotides comprising monovalent, divalent, and trivalent
GalNAc clusters lowered SRB-1 mRNA levels with similar potencies as
shown in Tables 103 and 104.
TABLE-US-00108 TABLE 103 Modified oligonucleotides targeting SRB-1
ISIS ED.sub.50 SEQ No. Sequences (5' to 3') GalNAc Cluster (mg/kg)
ID No 440762
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.d-
sT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
n/a 4.7 22 686221
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds GalNAc.sub.2-24.sub.a 0.39 26
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k 686222
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds GalNAc.sub.3-13.sub.a 0.41 26
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
See Example 93 for table legend. The structure of GalNAc.sub.3-13a
was shown in Example 62, and the structure of GalNAc.sub.2-24a was
shown in Example 104.
TABLE-US-00109 TABLE 104 Modified oligonucleotides targeting SRB-1
ISIS ED50 SEQ No. Sequences (5' to 3') GalNAc Cluster (mg/kg) ID No
440762
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.d-
sT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
n/a 5 22 708561
T.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.-
dsT.sub.dsG.sub.dsA.sub.ds GalNAc.sub.1-25.sub.a 0.4 22
.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.k
See Example 93 for table legend. The structure of GalNAc.sub.1-25a
was shown in Example 105.
[0991] The concentrations of the oligonucleotides in Tables 103 and
104 in liver were also assessed, using procedures described in
Example 75. The results shown in Tables 104a and 104b below are the
average total antisense oligonucleotide tissues levels for each
treatment group, as measured by UV in units of .mu.g
oligonucleotide per gram of liver tissue. The results show that the
oligonucleotides comprising a GalNAc conjugate group accumulated in
the liver at significantly higher levels than the same dose of the
oligonucleotide lacking a GalNAc conjugate group. Furthermore, the
antisense oligonucleotides comprising one, two, or three GalNAc
ligands in their respective conjugate groups all accumulated in the
liver at similar levels. This result is surprising in view of the
Khorev et al. literature reference cited above and is consistent
with the activity data shown in Tables 103 and 104 above.
TABLE-US-00110 TABLE 104a Liver concentrations of oligonucleotides
comprising a GalNAc.sub.2 or GalNAc.sub.3 conjugate group
[Antisense Dosage oligonucleotide] GalNAc ISIS No. (mg/kg)
(.mu.g/g) cluster CM 440762 2 2.1 n/a n/a 7 13.1 20 31.1 686221 0.2
0.9 GalNAc.sub.2-24.sub.a A.sub.d 0.6 2.7 2 12.0 6 26.5 686222 0.2
0.5 GalNAc.sub.3-13.sub.a A.sub.d 0.6 1.6 2 11.6 6 19.8
TABLE-US-00111 TABLE 104b Liver concentrations of oligonucleotides
comprising a GalNAc.sub.1 conjugate group [Antisense Dosage
oligonucleotide] GalNAc ISIS No. (mg/kg) (.mu.g/g) cluster CM
440762 2 2.3 n/a n/a 7 8.9 20 23.7 708561 0.2 0.4
GalNAc.sub.1-25.sub.a PO 0.6 1.1 2 5.9 6 23.7 20 53.9
Example 107: Synthesis of Oligonucleotides Comprising a
GalNAc.sub.1-26 or GalNAc.sub.1-27 Conjugate
##STR00252##
[0993] Oligonucleotide 239 is synthesized via coupling of compound
47 (see Example 15) to acid 64 (see Example 32) using HBTU and DIEA
in DMF. The resulting amide containing compound is phosphitylated,
then added to the 5'-end of an oligonucleotide using procedures
described in Example 10. The GalNAc.sub.1 cluster portion
(GalNAc.sub.1-26.sub.a) of the conjugate group GalNAc.sub.1-26 can
be combined with any cleavable moiety present on the
oligonucleotide to provide a variety of conjugate groups. The
structure of GalNAc.sub.1-26 (GalNAc.sub.1-26.sub.a-CM) is shown
below:
##STR00253##
[0994] In order to add the GalNAc.sub.1 conjugate group to the
3'-end of an oligonucleotide, the amide formed from the reaction of
compounds 47 and 64 is added to a solid support using procedures
described in Example 7. The oligonucleotide synthesis is then
completed using procedures described in Example 9 in order to form
oligonucleotide 240.
##STR00254##
The GalNAc.sub.1 cluster portion (GalNAc.sub.1-27.sub.a) of the
conjugate group GalNAc.sub.1-27 can be combined with any cleavable
moiety present on the oligonucleotide to provide a variety of
conjugate groups. The structure of GalNAc.sub.1-27
(GalNAc.sub.1-27.sub.a-CM) is shown below:
##STR00255##
Example 108: Antisense Inhibition In Vivo by Oligonucleotides
Comprising a GalNAc Conjugate Group Targeting Apo(a) In Vivo
[0995] The oligonucleotides listed in Table 105 below were tested
in a single dose study in mice.
TABLE-US-00112 TABLE 105 Modified ASOs targeting APO(a) ISIS
Sequences (5' to 3') GalNAc.sub.3 No. Cluster ID No. CM SEQ 494372
T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.dsG-
.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds
n/a n/a 53 T.sub.dsT.sub.esG.sub.esT.sub.esT.sub.es.sup.mC.sub.e
681251
T.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-7a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.esG.sub.esT.sub.esT.sub.es.su-
p.mC.sub.e 681255
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-3a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e 681256
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-10a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e 681257
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-7a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e 681258
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.ds-
G.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds GalNAc.sub.3-13a PO 53
T.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eoG.sub.eoT.sub.esT.sub.es.su-
p.mC.sub.e 681260
T.sub.esG.sub.eo.sup.mC.sub.eoT.sub.eo.sup.mC.sub.eo.sup.mC.sub.dsG-
.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub-
.dsT.sub.eoG.sub.eo GalNAc.sub.3-19a A.sub.d 52
T.sub.esT.sub.es.sup.mC.sub.eo
The structure of GalNAc.sub.3-7.sub.a was shown in Example 48.
Treatment
[0996] Male transgenic mice that express human Apo(a) were each
injected subcutaneously once with an oligonucleotide and dosage
listed in Table 106 or with PBS. Each treatment group consisted of
4 animals. Blood was drawn the day before dosing to determine
baseline levels of Apo(a) protein in plasma and at 1 week following
the first dose. Additional blood draws will occur weekly for
approximately 8 weeks. Plasma Apo(a) protein levels were measured
using an ELISA. The results in Table 106 are presented as the
average percent of plasma Apo(a) protein levels for each treatment
group, normalized to baseline levels (% BL), The results show that
the antisense oligonucleotides reduced Apo(a) protein expression.
Furthermore, the oligonucleotides comprising a GalNAc conjugate
group exhibited even more potent reduction in Apo(a) expression
than the oligonucleotide that does not comprise a conjugate
group.
TABLE-US-00113 TABLE 106 Apo(a) plasma protein levels Apo(a) at 1
week ISIS No. Dosage (mg/kg) (% BL) PBS n/a 143 494372 50 58 681251
10 15 681255 10 14 681256 10 17 681257 10 24 681258 10 22 681260 10
26
Example 109: Synthesis of Oligonucleotides Comprising a
GalNAc.sub.1-28 or GalNAc.sub.1-29 Conjugate
##STR00256##
[0998] Oligonucleotide 241 is synthesized using procedures similar
to those described in Example 71 to form the phosphoramidite
intermediate, followed by procedures described in Example 10 to
synthesize the oligonucleotide. The GalNAc.sub.1 cluster portion
(GalNAc.sub.1-28.sub.a) of the conjugate group GalNAc.sub.1-28 can
be combined with any cleavable moiety present on the
oligonucleotide to provide a variety of conjugate groups. The
structure of GalNAc.sub.1-28 (GalNAc.sub.1-28.sub.a-CM) is shown
below:
##STR00257##
[0999] In order to add the GalNAc.sub.1 conjugate group to the
3'-end of an oligonucleotide, procedures similar to those described
in Example 71 are used to form the hydroxyl intermediate, which is
then added to the solid support using procedures described in
Example 7. The oligonucleotide synthesis is then completed using
procedures described in Example 9 in order to form oligonucleotide
242.
##STR00258##
The GalNAc.sub.1 cluster portion (GalNAc.sub.1-29.sub.a) of the
conjugate group GalNAc.sub.1-29 can be combined with any cleavable
moiety present on the oligonucleotide to provide a variety of
conjugate groups. The structure of GalNAc.sub.1-29
(GalNAc.sub.1-29.sub.a-CM) is shown below:
##STR00259##
Example 110: Synthesis of Oligonucleotides Comprising a
GalNAc.sub.1-30 Conjugate
##STR00260##
[1001] Oligonucleotide 246 comprising a GalNAc.sub.1-30 conjugate
group, wherein Y is selected from O, S, a substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, amino, substituted amino,
azido, alkenyl or alkynyl, is synthesized as shown above. The
GalNAc.sub.1 cluster portion (GalNAc.sub.1-30.sub.a) of the
conjugate group GalNAc.sub.1-30 can be combined with any cleavable
moiety to provide a variety of conjugate groups. In certain
embodiments, Y is part of the cleavable moiety. In certain
embodiments, Y is part of a stable moiety, and the cleavable moiety
is present on the oligonucleotide. The structure of
GalNAc.sub.1-30.sub.a is shown below:
##STR00261##
Example 111: Synthesis of Oligonucleotides Comprising a
GalNAc.sub.2-31 or GalNAc.sub.2-32 Conjugate
##STR00262##
[1003] Oligonucleotide 250 comprising a GalNAc.sub.2-31 conjugate
group, wherein Y is selected from O, S, a substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, amino, substituted amino,
azido, alkenyl or alkynyl, is synthesized as shown above. The
GalNAc.sub.2 cluster portion (GalNAc.sub.2-31.sub.a) of the
conjugate group GalNAc.sub.2-31 can be combined with any cleavable
moiety to provide a variety of conjugate groups. In certain
embodiments, the Y-containing group directly adjacent to the 5'-end
of the oligonucleotide is part of the cleavable moiety. In certain
embodiments, the Y-containing group directly adjacent to the 5'-end
of the oligonucleotide is part of a stable moiety, and the
cleavable moiety is present on the oligonucleotide. The structure
of GalNAc.sub.2-31.sub.a is shown below:
##STR00263##
[1004] The synthesis of an oligonucleotide comprising a
GalNAc.sub.2-32 conjugate is shown below.
##STR00264##
[1005] Oligonucleotide 252 comprising a GalNAc.sub.2-32 conjugate
group, wherein Y is selected from O, S, a substituted or
unsubstituted C.sub.1-C.sub.10 alkyl, amino, substituted amino,
azido, alkenyl or alkynyl, is synthesized as shown above. The
GalNAc.sub.2 cluster portion (GalNAc.sub.2-32.sub.a) of the
conjugate group GalNAc.sub.2-32 can be combined with any cleavable
moiety to provide a variety of conjugate groups. In certain
embodiments, the Y-containing group directly adjacent to the 5'-end
of the oligonucleotide is part of the cleavable moiety. In certain
embodiments, the Y-containing group directly adjacent to the 5'-end
of the oligonucleotide is part of a stable moiety, and the
cleavable moiety is present on the oligonucleotide. The structure
of GalNAc.sub.2-32.sub.a is shown below:
##STR00265##
Example 112: Modified Oligonucleotides Comprising a GalNAc.sub.1
Conjugate
[1006] The oligonucleotides in Table 107 targeting SRB-1 were
synthesized with a GalNAc.sub.1 conjugate group in order to further
test the potency of oligonucleotides comprising conjugate groups
that contain one GalNAc ligand.
TABLE-US-00114 TABLE 107 SEQ ISIS No. Sequence (5' to 3') GalNAc
cluster CM ID NO. 711461
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.ds GalNAc.sub.1-25.sub.a A.sub.d 30
T.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.-
mC.sub.esT.sub.esT.sub.e 711462
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-25.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 711463
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-25.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.e-
sT.sub.esT.sub.e 711465
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.ds GalNAc.sub.1-26.sub.a A.sub.d 30
T.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.-
mC.sub.esT.sub.esT.sub.e 711466
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-26.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 711467
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-26.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.e-
sT.sub.esT.sub.e 711468
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.ds GalNAc.sub.1-28.sub.a A.sub.d 30
T.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.-
mC.sub.esT.sub.esT.sub.e 711469
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-28.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.es.sup.mC.sub.es.sup.mC.sub.e-
sT.sub.esT.sub.e 711470
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.-
dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds GalNAc.sub.1-28.sub.a PO
28
G.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.eo.sup.mC.sub.eo.sup.mC.sub.e-
sT.sub.esT.sub.e 713844
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-27.sub.a PO 28
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.eo'- 713845
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-27.sub.a PO 28
T.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.eo'- 713846
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-27.sub.a A.sub.d 29
T.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.eo 713847
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-29.sub.a PO 28
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.eo'- 713848
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-29.sub.a PO 28
T.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.eo'- 713849
G.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-29.sub.a A.sub.d 29
T.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.eo 713850
G.sub.es.sup.mC.sub.eoT.sub.eoT.sub.eo.sup.mC.sub.eoA.sub.dsG.sub.d-
sT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub-
.ds GalNAc.sub.1-29.sub.a A.sub.d 29
T.sub.eo.sup.mC.sub.eo.sup.mC.sub.esT.sub.esT.sub.eo
Example 113: Modified Oligonucleotides Comprising a GalNAc
Conjugate Group Targeting Hepatitis B Virus (HBV)
[1007] The oligonucleotides listed in Table 108 below were designed
to target HBV. In certain embodiments, the cleavable moiety is a
phosphodiester linkage.
TABLE-US-00115 TABLE 108 Sequences (5' to 3') SEQ ID No.
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.su-
b.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.es-
T.sub.esG.sub.es.sup.mC.sub.e- 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.su-
b.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.eo-
T.sub.esG.sub.es.sup.mC.sub.e- 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.esA.sub.esG.sub.esA.sub.esG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.esG.sub.e-
sT.sub.esG.sub.es.sup.mC.sub.e 3
G.sub.es.sup.mC.sub.eoA.sub.eoG.sub.eoA.sub.eoG.sub.dsG.sub.dsT.sub.dsG.s-
ub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.eoG.sub.e-
oT.sub.esG.sub.es.sup.mC.sub.e 3
Sequence CWU 1
1
5313182DNAHepatitis B virus 1aattccacaa cctttcacca aactctgcaa
gatcccagag tgagaggcct gtatttccct 60gctggtggct ccagttcagg agcagtaaac
cctgttccga ctactgcctc tcccttatcg 120tcaatcttct cgaggattgg
ggaccctgcg ctgaacatgg agaacatcac atcaggattc 180ctaggacccc
ttctcgtgtt acaggcgggg tttttcttgt tgacaagaat cctcacaata
240ccgcagagtc tagactcgtg gtggacttct ctcaattttc tagggggaac
taccgtgtgt 300cttggccaaa attcgcagtc cccaacctcc aatcactcac
caacctcctg tcctccaact 360tgtcctggtt atcgctggat gtgtctgcgg
cgttttatca tcttcctctt catcctgctg 420ctatgcctca tcttcttgtt
ggttcttctg gactatcaag gtatgttgcc cgtttgtcct 480ctaattccag
gatcctcaac caccagcacg ggaccatgcc gaacctgcat gactactgct
540caaggaacct ctatgtatcc ctcctgttgc tgtaccaaac cttcggacgg
aaattgcacc 600tgtattccca tcccatcatc ctgggctttc ggaaaattcc
tatgggagtg ggcctcagcc 660cgtttctcct ggctcagttt actagtgcca
tttgttcagt ggttcgtagg gctttccccc 720actgtttggc tttcagttat
atggatgatg tggtattggg ggccaagtct gtacagcatc 780ttgagtccct
ttttaccgct gttaccaatt ttcttttgtc tttgggtata catttaaacc
840ctaacaaaac aaagagatgg ggttactctc tgaattttat gggttatgtc
attggaagtt 900atgggtcctt gccacaagaa cacatcatac aaaaaatcaa
agaatgtttt agaaaacttc 960ctattaacag gcctattgat tggaaagtat
gtcaacgaat tgtgggtctt ttgggttttg 1020ctgccccatt tacacaatgt
ggttatcctg cgttaatgcc cttgtatgca tgtattcaat 1080ctaagcaggc
tttcactttc tcgccaactt acaaggcctt tctgtgtaaa caatacctga
1140acctttaccc cgttgcccgg caacggccag gtctgtgcca agtgtttgct
gacgcaaccc 1200ccactggctg gggcttggtc atgggccatc agcgcgtgcg
tggaaccttt tcggctcctc 1260tgccgatcca tactgcggaa ctcctagccg
cttgttttgc tcgcagcagg tctggagcaa 1320acattatcgg gactgataac
tctgttgtcc tctcccgcaa atatacatcg tatccatggc 1380tgctaggctg
tgctgccaac tggatcctgc gcgggacgtc ctttgtttac gtcccgtcgg
1440cgctgaatcc tgcggacgac ccttctcggg gtcgcttggg actctctcgt
ccccttctcc 1500gtctgccgtt ccgaccgacc acggggcgca cctctcttta
cgcggactcc ccgtctgtgc 1560cttctcatct gccggaccgt gtgcacttcg
cttcacctct gcacgtcgca tggagaccac 1620cgtgaacgcc caccgaatgt
tgcccaaggt cttacataag aggactcttg gactctctgc 1680aatgtcaacg
accgaccttg aggcatactt caaagactgt ttgtttaaag actgggagga
1740gttgggggag gagattagat taaaggtctt tgtactagga ggctgtaggc
ataaattggt 1800ctgcgcacca gcaccatgca actttttcac ctctgcctaa
tcatctcttg ttcatgtcct 1860actgttcaag cctccaagct gtgccttggg
tggctttggg gcatggacat cgacccttat 1920aaagaatttg gagctactgt
ggagttactc tcgtttttgc cttctgactt ctttccttca 1980gtacgagatc
ttctagatac cgcctcagct ctgtatcggg aagccttaga gtctcctgag
2040cattgttcac ctcaccatac tgcactcagg caagcaattc tttgctgggg
ggaactaatg 2100actctagcta cctgggtggg tgttaatttg gaagatccag
catctagaga cctagtagtc 2160agttatgtca acactaatat gggcctaaag
ttcaggcaac tcttgtggtt tcacatttct 2220tgtctcactt ttggaagaga
aaccgttata gagtatttgg tgtctttcgg agtgtggatt 2280cgcactcctc
cagcttatag accaccaaat gcccctatcc tatcaacact tccggaaact
2340actgttgtta gacgacgagg caggtcccct agaagaagaa ctccctcgcc
tcgcagacga 2400aggtctcaat cgccgcgtcg cagaagatct caatctcggg
aacctcaatg ttagtattcc 2460ttggactcat aaggtgggga actttactgg
tctttattct tctactgtac ctgtctttaa 2520tcctcattgg aaaacaccat
cttttcctaa tatacattta caccaagaca ttatcaaaaa 2580atgtgaacag
tttgtaggcc cacttacagt taatgagaaa agaagattgc aattgattat
2640gcctgctagg ttttatccaa aggttaccaa atatttacca ttggataagg
gtattaaacc 2700ttattatcca gaacatctag ttaatcatta cttccaaact
agacactatt tacacactct 2760atggaaggcg ggtatattat ataagagaga
aacaacacat agcgcctcat tttgtgggtc 2820accatattct tgggaacaag
atctacagca tggggcagaa tctttccacc agcaatcctc 2880tgggattctt
tcccgaccac cagttggatc cagccttcag agcaaacaca gcaaatccag
2940attgggactt caatcccaac aaggacacct ggccagacgc caacaaggta
ggagctggag 3000cattcgggct gggtttcacc ccaccgcacg gaggcctttt
ggggtggagc cctcaggctc 3060agggcatact acaaactttg ccagcaaatc
cgcctcctgc ctccaccaat cgccagacag 3120gaaggcagcc taccccgctg
tctccacctt tgagaaacac tcatcctcag gccatgcagt 3180gg 31822938DNAHomo
sapiens 2gttgactaag tcaataatca gaatcagcag gtttgcagtc agattggcag
ggataagcag 60cctagctcag gagaagtgag tataaaagcc ccaggctggg agcagccatc
acagaagtcc 120actcattctt ggcaggatgg cttctcatcg tctgctcctc
ctctgccttg ctggactggt 180atttgtgtct gaggctggcc ctacgggcac
cggtgaatcc aagtgtcctc tgatggtcaa 240agttctagat gctgtccgag
gcagtcctgc catcaatgtg gccgtgcatg tgttcagaaa 300ggctgctgat
gacacctggg agccatttgc ctctgggaaa accagtgagt ctggagagct
360gcatgggctc acaactgagg aggaatttgt agaagggata tacaaagtgg
aaatagacac 420caaatcttac tggaaggcac ttggcatctc cccattccat
gagcatgcag aggtggtatt 480cacagccaac gactccggcc cccgccgcta
caccattgcc gccctgctga gcccctactc 540ctattccacc acggctgtcg
tcaccaatcc caaggaatga gggacttctc ctccagtgga 600cctgaaggac
gagggatggg atttcatgta accaagagta ttccattttt actaaagcag
660tgttttcacc tcatatgcta tgttagaagt ccaggcagag acaataaaac
attcctgtga 720aaggcacttt tcattccact ttaacttgat tttttaaatt
cccttattgt cccttccaaa 780aaaaagagaa tcaaaatttt acaaagaatc
aaaggaattc tagaaagtat ctgggcagaa 840cgctaggaga gatccaaatt
tccattgtct tgcaagcaaa gcacgtatta aatatgatct 900gcagccatta
aaaagacaca ttctgtaaaa aaaaaaaa 938320DNAArtificial
sequenceSynthetic oligonucleotide 3gcagaggtga agcgaagtgc
20420DNAArtificial sequenceSynthetic oligonucleotide 4ccaatttatg
cctacagcct 20517DNAArtificial sequenceSynthetic oligonucleotide
5ggcatagcag caggatg 17620DNAArtificial sequenceSynthetic
oligonucleotide 6aggagttccg cagtatggat 20720DNAArtificial
sequenceSynthetic oligonucleotide 7gtgaagcgaa gtgcacacgg
20820DNAArtificial sequenceSynthetic oligonucleotide 8gtgcagaggt
gaagcgaagt 20916DNAArtificial sequenceSynthetic oligonucleotide
9aggtgaagcg aagtgc 161016DNAArtificial sequenceSynthetic
oligonucleotide 10tccgcagtat ggatcg 161118DNAArtificial
sequenceSynthetic oligonucleotide 11aatttatgcc tacagcct
181220DNAArtificial sequenceSynthetic oligonucleotide 12tcttggttac
atgaaatccc 201320DNAArtificial sequenceSynthetic oligonucleotide
13cttggttaca tgaaatccca 201420DNAArtificial sequenceSynthetic
oligonucleotide 14ggaatactct tggttacatg 201520DNAArtificial
sequenceSynthetic oligonucleotide 15tggaatactc ttggttacat
201620DNAArtificial sequenceSynthetic oligonucleotide 16ttttattgtc
tctgcctgga 201720DNAArtificial sequenceSynthetic oligonucleotide
17gaatgtttta ttgtctctgc 201820DNAArtificial sequenceSynthetic
oligonucleotide 18aggaatgttt tattgtctct 201920DNAArtificial
sequenceSynthetic oligonucleotide 19acaggaatgt tttattgtct
202020DNAArtificial sequenceSynthetic oligonucleotide 20agcttcttgt
ccagctttat 202121DNAArtificial sequenceSynthetic oligonucleotide
21agcttcttgt ccagctttat a 212214DNAArtificial sequenceSynthetic
oligonucleotide 22tcagtcatga cttc 142315DNAArtificial
sequenceSynthetic oligonucleotide 23tcagtcatga cttca
152420DNAArtificial sequenceSynthetic oligonucleotide 24gctgattaga
gagaggtccc 202520DNAArtificial sequenceSynthetic oligonucleotide
25tcccatttca ggagacctgg 202615DNAArtificial sequenceSynthetic
oligonucleotide 26atcagtcatg acttc 152720DNAArtificial
sequenceSynthetic oligonucleotide 27cggtgcaagg cttaggaatt
202820DNAArtificial sequenceSynthetic oligonucleotide 28gcttcagtca
tgacttcctt 202921DNAArtificial sequenceSynthetic oligonucleotide
29gcttcagtca tgacttcctt a 213021DNAArtificial sequenceSynthetic
oligonucleotide 30agcttcagtc atgacttcct t 213120DNAArtificial
sequenceSynthetic oligonucleotide 31tggtaatcca ctttcagagg
203221DNAArtificial sequenceSynthetic oligonucleotide 32tggtaatcca
ctttcagagg a 213321DNAArtificial sequenceSynthetic oligonucleotide
33tgcttcagtc atgacttcct t 213420DNAArtificial sequenceSynthetic
oligonucleotide 34cactgatttt tgcccaggat 203521DNAArtificial
sequenceSynthetic oligonucleotide 35cactgatttt tgcccaggat a
213621DNAArtificial sequenceSynthetic oligonucleotide 36aagcttcttg
tccagcttta t 213720DNAArtificial sequenceSynthetic oligonucleotide
37acccaattca gaaggaagga 203821DNAArtificial sequenceSynthetic
oligonucleotide 38acccaattca gaaggaagga a 213921DNAArtificial
sequenceSynthetic oligonucleotide 39aacccaattc agaaggaagg a
214021DNAArtificial sequenceSynthetic oligonucleotide 40atggtaatcc
actttcagag g 214120DNAArtificial sequenceSynthetic oligonucleotide
41tcttggttac atgaaatccc 204221DNAArtificial sequenceSynthetic
oligonucleotide 42tcttggttac atgaaatccc a 214320DNAArtificial
sequenceSynthetic oligonucleotide 43attcactttc ataatgctgg
204421DNAArtificial sequenceSynthetic oligonucleotide 44attcactttc
ataatgctgg a 214521DNAArtificial sequenceSynthetic oligonucleotide
45atcttggtta catgaaatcc c 214620DNAArtificial sequenceSynthetic
oligonucleotide 46atgcatggtg atgcttctga 204720DNAArtificial
sequenceSynthetic oligonucleotide 47cagctttatt agggacagca
204821DNAArtificial sequenceSynthetic oligonucleotide 48cagctttatt
agggacagca a 214921DNAArtificial sequenceSynthetic oligonucleotide
49acagctttat tagggacagc a 215016DNAArtificial sequenceSynthetic
oligonucleotide 50ttcagtcatg acttcc 165118DNAArtificial
sequenceSynthetic oligonucleotidemisc_feature(1)..(4)bases at these
positions are RNAmisc_feature(15)..(18)bases at these positions are
RNA 51gcuucagtca tgactucc 185221DNAArtificial sequenceSynthetic
oligonucleotide 52tgctccgttg gtgcttgttc a 215320DNAArtificial
sequenceSynthetic oligonucleotide 53tgctccgttg gtgcttgttc 20
* * * * *
References