U.S. patent application number 11/518284 was filed with the patent office on 2007-05-24 for vglut-specific dsrna compounds.
This patent application is currently assigned to Gruenenthal GmbH. Invention is credited to Gregor Bahrenberg, Florian Bender, Thomas Christoph, Clemens Gillen, Martin K.H. Schaefer, Eberhard Weihe.
Application Number | 20070117771 11/518284 |
Document ID | / |
Family ID | 34960530 |
Filed Date | 2007-05-24 |
United States Patent
Application |
20070117771 |
Kind Code |
A1 |
Gillen; Clemens ; et
al. |
May 24, 2007 |
VGLUT-specific dsRNA compounds
Abstract
VGLUT-specific dsRNAs capable of triggering the phenomenon of
RNA interference, host cells containing theses dsRNAs, and
pharmaceutical compositions containing these dsRNAs, in particular
for the treatment of pain and other diseases associated with VGLUT
family members.
Inventors: |
Gillen; Clemens; (Aachen,
DE) ; Bahrenberg; Gregor; (Aachen, DE) ;
Christoph; Thomas; (Aachen, DE) ; Weihe;
Eberhard; (Marburg, DE) ; Schaefer; Martin K.H.;
(Marburg, DE) ; Bender; Florian; (Wuerzburg,
DE) |
Correspondence
Address: |
CROWELL & MORING LLP;INTELLECTUAL PROPERTY GROUP
P.O. BOX 14300
WASHINGTON
DC
20044-4300
US
|
Assignee: |
Gruenenthal GmbH
Aachen
DE
|
Family ID: |
34960530 |
Appl. No.: |
11/518284 |
Filed: |
September 11, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/EP05/01970 |
Feb 24, 2005 |
|
|
|
11518284 |
Sep 11, 2006 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61K 38/00 20130101;
C12N 2310/14 20130101; C12N 15/1138 20130101; C12N 2799/021
20130101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07H 21/02 20060101 C07H021/02 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 10, 2004 |
DE |
10 2004 011 687.3 |
Claims
1. A double-stranded RNA containing a sequence having the structure
5'-(N.sub.17-25)-3', which is at least 80% complementary to a
fragment of the (m)RNA sequence of a member of the VGLUT family,
wherein N is any base.
2. The RNA of claim 1, said RNA containing a sequence which is at
least 90% complementary to a fragment of the (m)RNA sequence of a
member of the VGLUT family.
3. The RNA of claim 1, said RNA containing a sequence which is at
least 99% complementary to a fragment of the (m)RNA sequence of a
member of the VGLUT family.
4. The RNA of claim 1, said RNA containing a sequence which is 100%
complementary to a fragment of the (m)RNA sequence of a member of
the VGLUT family.
5. A double-stranded RNA according to claim 1, comprising a
sequence having the structure 5'-(N.sub.19-25)-3'.
6. A double-stranded RNA according to 1, comprising a sequence
having the structure 5'-(N.sub.21-23)-3'.
7. A double-stranded RNA according to claim 1, wherein the sequence
having the structure 5'-(N.sub.21-23)-3' is completely
complementary to a fragment of the (m)RNA of a member of the VGLUT
family, wherein N is any base.
8. A double-stranded RNA according to claim 1, wherein the
double-stranded RNA (dsRNA) is complementary to nucleotide
fragments on the (m)RNA of VGLUT1, VGLUT2 orVGLUT3.
9. A double-stranded RNA according to claim 1, comprising dsRNA
against nucleotide fragments of the encoding region of
VGLUT-(m)RNA, which are at least 50 nucleotides removed from the
AUG initiating triplet of the encoding region of the (m)RNA.
10. The RNA of claim 9, wherein the dsRNA against nucleotide
fragments of the encoding region of VGLUT-(m)RNA, are at least 70
nucleotides removed from the AUG initiating triplet of the encoding
region of the (m)RNA.
11. The RNA of claim 9, wherein the dsRNA against nucleotide
fragments of the encoding region of VGLUT-(m)RNA, are at least 100
nucleotides removed from the AUG initiating triplet of the encoding
region of the (m)RNA.
12. A double-stranded RNA according to claim 8, wherein the dsRNA
is complementary to nucleotide fragments of the encoding region of
VGLUT-(m)RNA, which is at least 50 nucleotides removed from the
3'-terminus encoding region of the (m)RNA.
13. A double-stranded RNA (dsRNA) according to claim 1, wherein the
double-stranded RNA is an siRNA, a long dsRNA comprising at least
30 nucleotides, a siRNA-based hairpin RNA, or an miRNA-based
hairpin RNA.
14. A double-stranded RNA according to claim 1, wherein the dsRNA
is complementary to fragments in the encoding region of the
VGLUT-(m)RNA, containing the sequence AA.
15. A double-stranded RNA according to claim 1, wherein the dsRNA
at the 5-terminus is complementary to the sequence AA.
16. A double-stranded RNA according to claim 1, wherein the dsRNA
is complementary to nucleotide fragments in the non-encoding 5'
region of the VGLUT-(m)RNA.
17. A double-stranded RNA according to claim 1, wherein the dsRNA
satisfies at least one of the following: (a) the GC content is at
least 38%; (b) the dsRNA is not directed against regions which are
at most 50 nucleotides removed from the initiating or terminating
codon; (c) at most two successive guanidine radicals, and (d) the
target sequence occurs only in the target gene in the genome to be
investigated.
18. A double-stranded RNA according to claim 1, wherein the VGLUT
target sequence comprises at least one sequence selected from the
group consisting of: TABLE-US-00026 (SEQ ID NO:16)
AATGCCTTTAGCTGGCATTCT, (SEQ ID NO:17) AATGGTCTGGTACATGTTTTG, (SEQ
ID NO:18) AAAGTCCTGCAAAGCATCCTA, (SEQ ID NO:20)
AAGAACGTAGGTACATAGAAG, (SEQ ID NO:21) AATTGTTGCAAACTTCTGCAG, (SEQ
ID NO:22) AAATTAGCAAGGTTGGTATGC, (SEQ ID NO:23)
AATTAGCAAGGTTGGTATGCT, (SEQ ID NO:24) AAGGTTGGTATGCTATCTGCT, (SEQ
ID NO:25) AAGCAAGCAGATTCTTCAAC, (SEQ ID NO:27)
AATGGGCATTTCGAATGGTGT, (SEQ ID NO:28) AATAAGTCACGTGAAGAGTGG, (SEQ
ID NO:31) AATATTTGCCTCAGGAGAGAA, (SEQ ID NO:32)
AAGTCTATGGTGCCACAACA, (SEQ ID NO:34) AAGACTCACATAGCTATAAGG, (SEQ ID
NO:19) AAGTCCTGCAAAGCATCCTAC, (SEQ ID NO:26) AACCACTTGGATATCGCTCCA,
(SEQ ID NO:29) AAGTCACGTGAAGAGTGGCAG, (SEQ ID NO:30)
AAGAGTGGCAGTATGTCTTCC, (SEQ ID NO:33) AATGGAGGTTGGCCTAGTGGT, (SEQ
ID NO:35) AATCTTGGAGTTGCCATTGTG, (SEQ ID NO:38)
AATTCCAGGTGGTTTCATTTC, (SEQ ID NO:39) AACATCGACTCTGAACATGTT, (SEQ
ID NO:41) AAGAGGTCTTTGGATTTGCAA, (SEQ ID NO:42)
AATAAGTAAGGTGGGTCTCTT, (SEQ ID NO:45) AATCGTTGTACCTATTGGAGG, (SEQ
ID NO:47) AAGAATGGCAGAATGTGTTCC, (SEQ ID NO:48)
AATCATTGACCAGGACGAATT, (SEQ ID NO:49) AACTCAACCATGAGAGTTTTG, (SEQ
ID NO:50) AAAGAAGATGTCTTATGGAGC, (SEQ ID NO:52)
AAGAGCTGACATCCTACCAGA, (SEQ ID NO:36) AACCGGAAATTCAGACAGCAC, (SEQ
ID NO:37) AAACAGTGGGCCTTATCCATG, (SEQ ID NO:40)
AAGGTTTAGTGGAGGGTGTGA, (SEQ ID NO:43) AAGTAAGGTGGGTCTCTTGTC, (SEQ
ID NO:44) AAGGTGGGTCTCTTGTCAGCA, (SEQ ID NO:46)
AAGACCCGTGAAGAATGGCAG and (SEQ ID NO:14) AACGTGCGCAAGTTGATGAAC.
19. A double-stranded RNA according to claim 1, wherein the dsRNA
is chemically modified.
20. A double-stranded RNA according to claim 1, wherein the
double-stranded RNA suppresses the expression of at least one
member of the VGLUT family in the cell by at least 50% (dsRNA).
21. A double-stranded RNA according to claim 1, wherein the dsRNA
is complementary with nucleotide fragments of the (m)RNA of a
member of the VGLUT family of mammals.
22. The double-stranded RNA according to claim 21, wherein the
dsRNA is complementary with nucleotide fragments of the (m)RNA of a
member of the VGLUT family in humans.
23. A double-stranded RNA according to claim 1, wherein the dsRNA
comprises at least one blunt end.
24. A double-stranded RNA according to claim 1, wherein the dsRNA
comprises at least one overhanging end.
25. A double-stranded RNA according to claim 24, wherein the
overhanging end has the nucleotides dTdT.
26. A double-stranded RNA according to claim 24, wherein the
overhanging end comprises at least two overhanging nucleotides.
27. A double-stranded RNA according to claim 24, wherein the
overhanging end comprises from 2 to 10 overhanging nucleotides.
28. A double-stranded RNA according to claim 24, wherein the
overhanging end comprises from 2 to 5 overhanging nucleotides.
29. A double-stranded RNA according to claim 24, wherein the
overhanging nucleotides are attached to the double strand
complementary with the (m)RNA sequence of a member of the VGLUT
family.
30. A double-stranded RNA according to claim 29, wherein the
overhanging nucleotides are deoxidized thymidines or uracils.
31. A double-stranded RNA according to claim 1, wherein the
sequence complementary with the dsRNA sequence is
5'-AAGUGUACUUUAGGCAAAGGG-3' (SEQ ID NO: 110).
32. A double-stranded RNA according to claim 31, of which the sense
strand comprises the sequence 5'-GUGUACUUUAGGCAAAGGGdTdT-3' (SEQ ID
NO: 111) and of which the antisense strand comprises the sequence
5'-CCCUUUGCCUAAAGUACACdTdT-3' (SEQ ID NO: 112).
33. A cell containing at least one dsRNA according to claim 1.
34. A pharmaceutical composition comprising at least one dsRNA
according to claim 1 or a cell containing at least one dsRNA
according to claim 1, and at least one pharmaceutically acceptable
auxiliary or additive.
35. A diagnostic reagent comprising at least one dsRNA according to
claim 1 or a cell containing at least one dsRNA according to claim
1 and, optionally, at least one suitable additive.
36. A method of alleviating pain in a mammal said method comprising
the step of administering to said mammal a pain-alleviating amount
of a dsRNA according to claim 1 or of a cell containing at least
one dsRNA according to claim 1.
37. The method of claim 36, wherein said pain is chronic pain,
tactile allodynia, thermally triggered pain or inflammatory
pain.
38. A method of treating urinary incontinence, neurogenic bladder
symptoms, pruritus, tumors, inflammation or any disease symptoms
associated with the physiological function of VGLUT family members
in a mammal said method comprising the step of administering to
said mammal a dsRNA according to claim 1 or of a cell containing at
least one dsRNA according to claim 1.
39. The method of claim 38, wherein said method is a method for
treating inflammation or symptoms associated with the physiological
function of VGLUT family members.
40. The method of claim 38, wherein said method is a method for
treating asthma.
41. The method of claim 38, wherein said dsRNA is administered
through in vivo or in vitro gene therapy.
42. A process for inhibiting the expression of at least one VGLUT
family member in a cell, comprising introducing a dsRNA according
to claim 1 into the cell, wherein a strand of the dsRNA comprises a
region complementary with the (m)RNA of a member of the VGLUT
family, and wherein the complementary region comprises less than 25
successive nucleotide pairs.
43. A process according to claim 42, wherein the dsRNA is enclosed
in micellar structures.
44. The process of claim 43, wherein said micellar structures are
liposomes.
45. A process according to claim 42, wherein the dsRNA is enclosed
in viral natural capsids or in chemically or enzymatically produced
capsids or structures derived therefrom.
46. A process for identifying dsRNA with a pain-modulating
function, comprising measuring, in a binding assay, the binding
constant between a dsRNA according to claim 1, as a test substance,
and an (m)RNA of a member of the VGLUT family.
47. The process of claim 46, wherein the dsRNA according to claim 1
is marked.
48. A process for identifying a pain-modulating substance, said
process comprising: (a) over-expressing a VGLUT, in a test cell;
(b) manipulating at least one cell as a test cell with at least one
dsRNA according to claim 1; (b') simultaneously manipulating at
least one identical cell as a control cell, the control cell either
being manipulated by addition of dsRNA or being manipulated with an
altered dsRNA not corresponding to claim 1, or process step (b')
being omitted, (c) simultaneously incubating the at least one
manipulated test cell according to process step (b) and optionally
the at least one control cell according to process step (b') under
suitable conditions, (d) measuring the concentration of expressed
VGLUT in the at least one test cell and optionally the at least one
control cell, the binding of the test substance on the VGLUT-(m)RNA
in the at least one test cell, of at least one of the functional
parameters of the test cell altered by the effect of the test
substance or of at least one signal correlating with the expression
level of VGLUT in the at least one test cell, and (e) identifying
potentially pain-modulating substances via the extent of the
difference between the measured value in the at least one test cell
and the measured value in the at least one control cell.
49. The process of claim 48, wherein said VGLUT is VGLUT1, VGLUT2
orVGLUT3.
50. A process according to claim 48, wherein the cell used in
process step (a) is genetically manipulated.
51. A process according to claim 48, wherein genetic manipulation
allows the measurement of at least one functional parameter altered
by the test substance and said process includes the step of
measuring at least one functional parameter altered by the test
substance.
52. A process according to claim 48, wherein a form of a member of
the VGLUT family is expressed or a reporter gene is introduced by
genetic manipulation.
53. The process of claim 52, wherein the member of the VGLUT family
expressed is VGLUT1, VGLUT2 or VGLUT3 not endogenously expressed in
the cell.
54. A process according to claim 48, wherein .gtoreq.8 hours elapse
between the simultaneous process steps (b) and (b') and the process
step (c).
55. A process according to claim 48, wherein .gtoreq.12 hours
elapse between the simultaneous process steps (b) and (b') and the
process step (c).
56. A process according to claim 48, wherein .gtoreq.24 hours
elapse between the simultaneous process steps (b) and (b') and the
process step (c).
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of international patent
application no. PCT/EP2005/001970, filed Feb. 24, 2005, designating
the United States of America, and published in German on Sep. 29,
2005 as WO 2005/090571, the entire disclosure of which is
incorporated herein by reference. Priority is claimed based on
Federal Republic of Germany patent application no. DE 10 2004 011
687.3, filed Mar. 10, 2004.
BACKGROUND OF THE INVENTION
[0002] The invention relates to small, in particular
interference-triggering, double-stranded RNA molecules (dsRNA),
which are directed against members of the VGLUT family, and to host
cells containing dsRNA according to the invention. dsRNA according
to the invention and corresponding host cells are suitable as
pharmaceutical compositions and for the production of
pharmaceutical compositions, in particular for the treatment of
pain and other diseases associated with VGLUT family members or the
non-physiological expression thereof.
[0003] As defined by the International Association for the Study of
Pain (IASP), pain is "an unpleasant sensory and emotional
experience associated with acute or potential tissue damage, or
described in terms of such damage" (Wall and Melzack, 1999). The
organism reacts to a painful (nociceptive) stimulus with a complex
reaction, in which sensory/discriminatory, cognitive, effective,
autonomous and motor components participate. Whereas acute pain
involves a physiological protective reaction and is vital to the
survival of an individual, chronic pain, on the other hand, does
not have a clear biological function. Nociceptive pain is triggered
by noxious stimuli, such as heat, mechanical stimulation, protons
or coldness, on specialized high-threshold sensory apparatus, the
nociceptors, and is conveyed into the posterior horn of the spinal
cord in the form of electrical activity by unmyelinated C-fibres or
weakly myelinated A.delta. fibres. The nociceptors are equipped
with specific receptors and ion channels for this purpose (Scholz
and Woolf, 2002).
[0004] Damaged or injured tissue, inflammation or tumour cells may
be signals of nociceptors; they lead to the release of chemical
mediators from inflamed cells, blood vessels and from the afferent
terminals, which either themselves lead to activation of the
nociceptors (for example by bradykinin) or alter the stimulus
response behaviour of nociceptive afferent nerve fibres, for
example by lowering the activation threshold (for example by
prostaglandins, interleukins, NGF), and thus lead to sensitisation
of the nociceptors (Sholz and Woolf, 2002).
[0005] The intensity of pain is coded by the number of impulses per
unit time. In the case of nociceptive peripheral stimulation, the
rapid synaptic response components (5 to 20 msec) and monosynaptic
reflex responses in the spinal cord are brought about by
AMP-kainate receptors, whereas NMDA and metabotrope glutamate
receptors participate in particular in late, longer lasting (20 to
150 msec), polysynaptically mediated response components (Tolle,
1997).
[0006] The release of glutamate in the posterior horn of the spinal
cord plays a decisive part in the creation of chronic pain
(Baranauskas and Nistri, 1998; Zhuo, 2001). The release of
glutamate leads to activation of the glutamate receptors (AMPA,
kainite, mGlu-R, NMDA). Proteins which participate in the release
of glutamate therefore represent interesting targets for pain
research.
[0007] Glutamate is one of the most important excitatory
neurotransmitters in the nervous system of vertebrates. The
nonessential amino acid, glutamate, cannot breach the blood-nerve
barrier and is therefore synthesized in the brain from glucose and
a large number of other precursors.
[0008] The formation of glutamate in the excitatory nerve endings
is catalysed by the enzyme, phosphate-activated glutaminase (PAG),
from glutamine. The vesicular glutamate transporter (VGLUT) packs
the glutamate in vesicles and releases the glutamate after arrival
of a depolarized action potential by the influx of calcium from the
vesicles into the synaptic cleft. From the synaptic cleft, the
glutamate is transported in part by a plasma membrane transporter
for excitatory amino acids (EAATs) back into the excitatory
terminals, where it is packed in vesicles again.
[0009] Therefore, transporter proteins from two superfamilies
participate in the transport of glutamate: plasma membrane
transporters and the vesicular membrane transporters (Disbrow et
al., 1982; Shioi et al., 1989; Tabb et al., 1992).
[0010] Three vesicular glutamate transporters, VGLUT1 (SLC17A6),
VGLUT2 (SLC17A7) and VGLUT3 (SLC17A8), have been identified as
members of the SLC-17 transporter family (type I
phosphate/vesicular glutamate transporter), which induces the
transport of organic anions, and have initially been identified as
Na.sup.+-dependent phosphate transporters. VGLUT1, VGLUT2 and
VGLUT3 bear the collective name of VGLUT. The proteins of the SLC17
family are expansive transmembrane proteins with 6 to 12
hypothetical transmembrane domains, the three aforementioned
glutamate transporters occurring as the subfamily of the SLC17
family. The three aforementioned VGLUTs are highly homologous with
one another in their amino acid sequence (Takamori et al., 2002).
The cDNA sequence of human VGLUT2 appears under gene bank accession
number NM.sub.--020346 in the databases. The amino acid sequence of
human VGLUT2 appears under NP.sub.--065079 in the databases. The
cDNA sequence of VGLUT2, rat, appears under NM.sub.--053427 in the
databases. The amino acid sequence of VGLUT2, rat, appears under
NP.sub.--445879 in the databases. The cDNA sequence of VGLUT2,
mouse, appears under AN: BC038375 in the databases, the amino acid
sequence of VGLUT2, mouse, appears under AAH38375 in the
databases.
[0011] The cortical layers of the cerebrum have a pronounced mRNA
expression level for VGLUT1, whereas VGLUT2 mRNA could be detected,
in particular, in layer IV of the cortex. VGLUT3 expression is
localized, for example, in the inhibitory cells in layer II of the
parietal cortex, or in GAD-positive interneurons in the Stratum
radiatum of CA1-CA3 of the hippocampus. Furthermore, VGLUT1 and
VGLUT2 could only be detected in the nerve endings, whereas VGLUT3
was detected not only in the synaptic vesicles but also in
vesicular structures of astrocytes and neuronal dendrites (Fremeau
et al., 2002).
[0012] VGLUT1 and VGLUT2 are expressed in two separate populations
in the spinal ganglion, a third subpopulation having coexpression
for VGLUT1 and VGLUT2. VGLUT2-mRNA is expressed predominantly by
small and medium DRG neurons, whereas VGLUT1-mRNA is expressed by
medium and large DRG neurons (posterior root fibre ganglion). In
isolated cases, VGLUT3-mRNA-expressing neurons can also appear in
the spinal ganglion (Oliveira et al., 2003; Todd et al, 2003).
[0013] Both VGLUT1 and VGLUT2 can be detected at protein level in
the grey matter of the spinal cord (Varoqui et al., 2002). The
dominance of VGLUT2 in the superficial posterior horn is evidence
of a prominent role in pain transmission. The dominance of VGLUT1
in the deep posterior horn is evidence of a role in proprioception.
Therefore, VGLUT2, in particular, but also VGLUT1 is a pain target
(Varoqui et al., 2002).
[0014] The effective treatment of pain is a great challenge in
molecular medicine. Acute and transitory pain is an important
signal from the body to protect people from serious damage by the
environment or overloading of the body. On the other hand, chronic
pain, which lasts longer than the cause of the pain and the
expected duration of healing, has no known biological function and
affects hundred of millions of humans throughout the world.
Approximately 7.5 million people suffer from chronic pain in the
Federal Republic of Germany alone. Unfortunately, the
pharmacological treatment of chronic pain is still unsatisfactory
and therefore remains a challenge in current medical research.
Frequently, currently existing analgesics are not sufficiently
effective and sometimes have serious side effects.
[0015] Due to their function and expression profile, VGLUT proteins
in general, but VGLUT2 in particular, represent an interesting
starting point as a target for new pain remedies (Varoqui et al.,
2002).
[0016] Some substances which are capable of modulating the activity
or expression of VGLUT are known, for example, from research into
pain relief (Carrigan et al. 2002; Roseth et al., 1995; Roseth et
al., 1998). However, they do not act subtype-specifically, and
therapeutic formulations would be limited both by the availability
of the inhibitors in the nervous system and at the synaptic
vesicles and by the nonspecific effect on all three VGLUTs.
SUMMARY OF THE INVENTION
[0017] An object of the present invention is to provide further
substances, which are capable of selectively and efficiently
modulating the effect of the VGLUTs, for example VGLUT1, VGLUT2 and
VGLUT3.
[0018] Another object of the invention is to provide
VGLUT-modulating substance which optionally exhibit cell
permeability.
[0019] A further object of the invention is to provide
VGLUT-modulating substances which are usable for therapeutic
purposes, in particular for the treatment of pain.
[0020] These and other objects are achieved by the present
invention as described and claimed hereinafter. According to the
invention, the object is achieved by VGLUT-specific dsRNAs that are
capable of triggering the phenomenon of RNA interference.
[0021] Double-stranded RNA (dsRNA) according to the invention
contains a sequence with the general structure 5'-(N.sub.17-25)-3',
wherein N is any base and represents nucleotides. The general
structure consists of a double-stranded RNA with a macromolecule
made up of ribonucleotides, wherein the ribonucleotide consists of
a pentose (ribose), an organic base and a phosphate. The organic
bases in the RNA consist of the purine bases, adenine (A) and
guanine (G), and the pyrimidine bases, cytosine (C) and uracil (U).
The dsRNA contains nucleotides with a directed structure with
overhangs. Double-stranded RNAs according to the invention of this
type can trigger the phenomenon of RNA interference (siRNAs).
[0022] The phenomenon of RNA interference as an immunological
defence system was noticed during immunological research into
higher eukaryotes.
[0023] The system was originally described in various species
independently of one another, initially in C. elegans (Fire et al.,
1998), before the underlying mechanisms could be identified as
identical at specific levels of the processes: RNA-mediated virus
resistance in plants (Lindbo and Dougherty, 1992), PTGS
(post-transcriptional gene silencing) in plants (Napoli et al.,
1990) and RNA interference in eukaryotes are accordingly based on a
common mode of operation (Plasterk, 2002).
[0024] The in vitro technique of RNA interference (RNAi) is based
on double-stranded RNA molecules (dsRNA) which trigger the
sequence-specific suppression of gene expression (Zamore (2001)
Nat. Struct. Biol. 9: 746-750; Sharp (2001) Genes Dev. 5:485-490:
Hannon (2002) Nature 41: 244-251). The activation of protein kinase
R and RNaseL brought about nonspecific effects such as an
interferon response (Stark et al. (1998) Annu. Rev. Biochem, 67:
227-264; He und Katze (2002) Viral Immunol. 15: 95-119) during the
transfection of mammalian cells with long dsRNA. These nonspecific
effects are obviated by using smaller, for example 21 to 23-type
so-called dsRNA (small interfering RNA), as nonspecific effects are
not triggered by dsRNA that is smaller than 30 bp (Elbashir et al.
(2001) Nature 411: 494-498). dsRNA molecules have also been used
recently in vivo (McCaffrey et al. (2002), Nature 418: 38-39; Xia
et al. (2002), Nature Biotech 20: 1006-1010; Brummelkamp et al.
(2002), Cancer Cell 2: 243-247.
[0025] dsRNAs that are directed against members of the VGLUT family
are disclosed in the context of the present invention. According to
the invention, these dsRNAs may be of various categories. dsRNA
according to the invention may exist in the form (i) of an siRNA,
(ii) of a long dsRNA containing one or more identical or different
siRNA(s) in the long dsRNA sequence, (iii) of an siRNA-based
hairpin RNA or (iv) of a miRNA-based hairpin siRNA. All the
aforementioned embodiments are covered by the term "dsRNA".
[0026] Although (i) siRNA (typically chemically synthesized and
then incorporated into the RISC complex intracellularly while
bypassing the dicing step, so sequence-specific mRNA degradation
(of the target sequence) takes place) is described in more detail
hereinafter, (ii), in other words a long dsRNA (ds:
double-stranded), is a precursor of siRNA (according to (i)), which
is only processed into pure siRNA by a dicing step (enzyme: dicer).
This precursor of siRNA, which is typically converted only
intracellularly into mature siRNA, meets the requirements for use,
for example, as a pharmaceutical composition or for production of a
pharmaceutical composition for the treatment of the indications
mentioned in the present application. In a preferred embodiment, a
plurality of different siRNAs, which may differ in efficiency, are
formed according to the invention in this respect, in other words
from largerVGLUT-dsRNA molecules, in particularVGLUT1-, 2- or
3-specific dsRNA molecules (preferably >30 bp, more preferably
>40 bp and even more preferably >50 bp), after dicer
processing. Long (optionally hairpin-shaped) dsRNA molecules, which
are transformed intracellularly into various siRNAs after dicer
processing may also be expressed in a cell on a vector basis (apart
from chemical synthesis) under the control of a Pol II promoter.
The Pol II promoter allows inducible tissue- or cell type-specific
expression (Kennerdell and Carthew, 2000). This form of application
therefore allows inducible transient simultaneous expression of a
large number of siRNAs, which originate from a precursor dsRNA.
According to a further particularly preferred embodiment, dsRNA
molecules according to the invention of this type may form a
specific phenotype by genetic manipulation techniques such as
homologous recombination of stem cells.
[0027] Modifications of siRNA according to (i), namely siRNA-based
hairpin bends (iii), may also be used according to the invention.
Hairpins of this type can preferably occur at one end, but
optionally also at both ends of the siRNA double strand. There are
typically at least 5, more preferably at least 8 and even more
preferably at least 10 nucleotides, which, owing to modifications
and/or in the absence of corresponding complementarity, do not form
double-stranded interactions, but form a bend which initially bonds
the two strands together covalently. An siRNA-based hairpin RNA of
this type may be further processed into active siRNA by
corresponding enzymes (for example dicers), for example
intracellularly. Finally, (iv), miRNA-based hairpin RNAs directed
against sequences of the VGLUT family, also form part of the
present invention. These are imperfectly complementary siRNAs,
preferably with at least one hairpin at the terminus (at the
termini). Imperfectly complementary duplex strands of mRNA of this
type comprise at least one defective conjugation, preferably
between 1 and 4 defective conjugations in the duplex strand. The
effect of miRNA-based hairpin RNA is based on the enzymatic
processing thereof (for example by dicers) to miRNA(s), subsequent
incorporation thereof into miRNPs and finally the translation
inhibition thereof.
[0028] The respective length of the duplex strands in embodiments
(i), (iii) and (iv) according to the invention does not differ and
all embodiments can be chemically synthesized.
[0029] dsRNAs according to the invention preferably have the
general structure 5'-(N.sub.19-25)-3', more preferably
5'-(N.sub.19-24)-3', even more preferably 5'-(N.sub.21-23)-3',
where N is any base. At least 90%, preferably 99% and, in
particular 100% of the nucleotides of a dsRNA according to the
invention may be complementary to a fragment of the (m)RNA sequence
of a member of VGLUT family, in particularVGLUT1, VGLUT2 or VGLUT3.
90% complementary means that, for example, with a given length of
20 nucelotides of a dsRNA according to the invention, it is not
complementary with the corresponding fragment on the (m)RNA in the
case of at most 2 nucleotides. The sequence of the double-stranded
RNA, with its general structure, is preferably completely
complementary with a fragment of the (m)RNA of a member of the
VGLUT family, in particularVGLUT1, VGLUT2 or VGLUT3.
[0030] VGLUT-dsRNA comprising the following sequence patterns are
also preferred: AAN.sub.19TT, NAN.sub.19NN, NARN.sub.17YNN and/or
NANN.sub.17YNN, wherein N represents any nucleotide, A represents
adenosine, T represents thymidine, R represents purines (A or G)
and Y represents pyrimidine bases (C or T).
[0031] A dsRNA according to the invention can basically be
complementary with any desired fragment on the mRNA or the primary
transcript of a member of the VGLUT family.
[0032] In a eukaryotic cell, the gene is transcribed over its
entire length, including both introns and exons, into a long RNA
molecule, the primary transcript, to produce an mRNA. The stability
of the cellular mRNA is ensured by processing the primary
transcript at the 5' end with an addition of an untypical
nucleotide having a methylated guanine and polyadenylation at the
3' end. Before the RNA leaves the cell nucleus, the intron
sequences are removed and the exons spliced together by RNA
splicing.
[0033] Both the primary transcript and the processed mRNA may be
target sequences for dsRNA according to the invention. The primary
transcript and the mRNA are described hereinafter as (m)RNA for
short.
[0034] Basically any 17 to 29, preferably 17 to 25, base pair long
fragments occurring in the encoding region of the (m)RNA can serve
as the target sequence for a dsRNA according to the invention.
Target sequences for dsRNAs according to the invention which lie
between position 70 and 1730 (calculated from the respective AUG
starting triplet of the encoding region of the (m)RNA of human
VGLUT2 or VGLUT3), preferably between 100 and 1500 and quite
particularly preferably between 600 and 1200 are also particularly
preferred. Therefore, 17 to 25, in particular 19 to 25 and quite
particularly 21 to 23, base pair long fragments on the (m)RNA, of
which the starting nucleotide corresponds to a nucleotide of a
position 80 to 1600 (or the aforementioned further preferred
regions) of the encoding region of the VGLUT2- or 3-(m)RNA and of
which the terminal nucleotide lies 17 to 25, preferably 19 to 25
and quite particularly preferably 21 to 23 nucleotides further
downstream from the respective initiating nucleotide, are
preferred.
[0035] With respect to VGLUT1, target sequences of the encoding
region are similarly particularly preferred, in particular target
sequences lying between position 600 and 1200 of the encoding
region (calculated from the AUG initiating triplet).
[0036] dsRNAs which are directed against regions in the encoding
region (m)RNA of a member of the VGLUT family are particularly
preferred. In particular, dsRNAs according to the invention of this
type, which are located in the central area of the encoding region,
preferably at least 50, 70, 100 nucleotides removed from the AUG
initiating triplet of the (m)RNA or at least 50 nucleotides,
preferably at least 70, and more preferably 100 nucleotides removed
from the 3'-terminal encoding region of the (m)RNA, should be
directed against VGLUT-(m)RNA fragments.
[0037] Particularly preferred are dsRNAs according to the
invention, in particular siRNAs which are directed against
fragments in the encoding region of the VGLUT1, 2 or 3 (m)RNA (or
cDNA), which begin with the initiating sequence AA.
[0038] dsRNAs according to the invention, in particular siRNAs
which are directed against fragments in the encoding region of the
VGLUT1-(m)RNA (or cDNA) are more particularly preferred; dsRNAs
according to the invention, in particular siRNAs, which are
directed against the sequences AACGTGCGCAAGTTGATGAAC (SEQ ID NO:
14) or AAGTTGATGAACTGCGGAGGC (SEQ ID NO: 14), are additionally
preferred.
[0039] With respect to dsRNAs according to the invention, in
particular siRNAs against VGLUT2, dsRNAs, in particular siRNAs are
more particularly preferred, which are complementary and therefore
directed against (m)RNA-fragments (or cDNA) which, for example,
comprise the sequence AATGCCTTTAGCTGGCATTCT (SEQ ID NO: 16),
AATGGTCTGGTACATGTTTTG (SEQ ID NO: 17), AAAGTCCTGCAAAGCATCCTA (SEQ
ID NO: 18), AAGAACGTAGGTACATAGAAG (SEQ ID NO: 20),
AATTGTTGCAAACTTCTGCAG (SEQ ID NO: 21), AAATTAGCAAGGTTGGTATGC (SEQ
ID NO: 22), AATTAGCAAGGTTGGTATGCT (SEQ ID NO: 23),
AAGGTTGGTATGCTATCTGCT (SEQ ID NO: 24), AAGCAAGCAGATTCTTTCAAC (SEQ
ID NO: 25), AATGGGCATTTCGAATGGTGT (SEQ ID NO: 27),
AATAAGTCACGTGAAGAGTGG (SEQ ID NO: 28), AATATTTGCCTCAGGAGAGAA (SEQ
ID NO: 31), AAGTCTTATGGTGCCACAACA (SEQ ID NO: 32),
AAGACTCACATAGCTATAAGG (SEQ ID NO: 34), and preferably
AAGTCCTGCAAAGCATCCTAC (SEQ ID NO: 19), AACCACTTGGATATCGCTCCA (SEQ
ID NO: 26), AAGTCACGTGAAGAGTGGCAG (SEQ ID NO: 29),
AAGAGTGGCAGTATGTCTTCC (SEQ ID NO: 30), and/or AATGGAGGTTGGCCTAGTGGT
(SEQ ID NO: 33).
[0040] Quite particularly preferred are those dsRNAs according to
the invention, in particular siRNAs, which are directed against
fragments in the encoding region of the VGLUT3-(m)RNA (or cDNA),
more preferably in turn those dsRNAs according to the invention, in
particular siRNAs, which are directed against AATCTTGGAGTTGCCATTGTG
(SEQ ID NO: 35), AATTCCAGGTGGTTTCATTTC (SEQ ID NO: 38),
AACATCGACTCTGAACATGTT (SEQ ID NO: 39), AAGAGGTCTTTGGATTTGCAA (SEQ
ID NO: 41), AATAAGTAAGGTGGGTCTCTT (SEQ ID NO: 42),
AATCGTTGTACCTATTGGAGG (SEQ ID NO: 45), AAGAATGGCAGAATGTGTTCC (SEQ
ID NO: 47), AATCATTGACCAGGACGAATT (SEQ ID NO: 48),
AACTCAACCATGAGAGTTTTG (SEQ ID NO: 49), AAAGAAGATGTCTTATGGAGC (SEQ
ID NO: 50), and/or AAGAGCTGACATCCTACCAGA (SEQ ID NO: 52), and
preferably AACCGGAAATTCAGACAGCAC (SEQ ID NO: 36),
AAACAGTGGGCCTTATCCATG (SEQ ID NO: 37), AAGGTTTAGTGGAGGGTGTGA (SEQ
ID NO: 40), AAGTAAGGTGGGTCTCTTGTC (SEQ ID NO: 43),
AAGGTGGGTCTCTTGTCAGCA (SEQ ID NO: 44), and/or AAGACCCGTGAAGAATGGCAG
(SEQ ID NO: 46).
[0041] Preferably, (double-stranded) siRNAs according to the
invention or suitable molecules of the other embodiments will
comprise the sequence TT at the terminus of at least one strand,
preferably in an overhanging manner relative to the terminus of the
complementary other strand. The complementary other strand of the
siRNA according to the invention then typically corresponds in its
sequence at a terminus to the, for example aforementioned,
sequences after AA (wherein T, in contrast to the foregoing target
sequences, is replaced by U in the siRNA according to the
invention) and at the other terminus typically has an overhanging
TT (see also embodiment 4).
[0042] However, dsRNAs according to the invention could also be
directed against nucleotide sequences on the VGLUT1, VGLUT2,
VGLUT3-(m)RNA, which do not lie in the encoding region, in
particular in the non-encoding 5' region of the (m)RNA, of the
regulating functions.
[0043] The boundaries at the 5' end of the target sequence with,
for example, AA of the nucleotide bonds are also reflected in the
associated dsRNA according to the invention in a sequence
5'-AAN.sub.15-23 (with the strand 3'-TTN.sub.15-23 which is
complementary therewith). A strand of the double-stranded RNA is
therefore complementary with the primary or processed RNA
transcript of the VGLUT1, 2 or 3 gene.
[0044] Preferably, however, effective blocking and cleavage of the
(m)RNA of a member of the VGLUT family is achieved in particular in
that certain rules of selection are adhered to when selecting the
target sequence of dsRNAs according to the invention.
[0045] A particularly preferred embodiment of the present invention
is a dsRNA which has a GC content of at least 30%, of 30 to 70% in
a more preferred embodiment, and from 40% to 60% in a more
preferred configuration, or even more preferably between 45% and
55%.
[0046] A further particularly preferred embodiment of the present
invention is a target sequence which contains the same frequency of
all nucleotides on the antisense strand. Finally, it is
particularly preferred if 2'-deoxythymidine appears for the 2-nt 3'
overhang in an siRNA according to the invention or suitable dsRNA
molecules of further embodiments, as it is thus protected from
exonuclease activity. It is further preferred if the target
sequence of a dsRNA according to the invention appears only once in
the target genes or is also singular for the respective genome of
the treated cells.
[0047] Combinations of the aforementioned properties in dsRNAs
according to the invention are also particularly preferred.
[0048] dsRNAs according to the invention, which are not directed
against binding points for proteins which bind to a VGLUT(m)RNA,
are also quite particularly preferred. In particular, a dsRNA
according to the invention should not be directed against those
regions on a VGLUT-(m)RNA which relate, for example, to the
5'-UTR-region, the 3'-UTR-region (respective regions at which the
splicing process takes place), an initiating codon and/or exon/exon
transitions. It is also preferred if the target region on the
(m)RNA, to which the dsRNA according to the invention binds, does
not have monotonic or repetitive sequences, in particular fragments
with poly-G-sequences. Target sequences in intron regions are also
preferably avoided in the complementary dsRNA according to the
invention, as RNAi is a cytoplasmatic process.
[0049] A modified nucleotide can preferably appear in a dsRNA
according to the invention. According to the invention, the term
"modified nucleotide" means that the respective nucleotide is
chemically modified. By the term "chemical modification", the
person skilled in the art understands that the modified nucleotide
is altered by replacement, attachment or removal of individual or a
plurality of atoms or atom groups in comparison with naturally
occurring nucleotides. At least one modified nucleotide in dsRNA
according to the invention serves, on the one hand, for stability
and, on the other hand, to prevent dissociation.
[0050] Preferably between 2 and 10, and quite particularly
preferably between 2 and 5, nucleotides are modified.
[0051] The ends of the double-stranded RNA (dsRNA) can preferably
be modified to counteract degradation in the cell or dissociation
into the individual strands, in particular to prevent premature
degradation by nucleases.
[0052] Dissociation of the individual strands of dsRNA, which is
generally undesirable, occurs, in particular, when using low
concentrations or short chain lengths. For particularly effective
inhibition of dissociation, the nucleotide pair-mediated cohesion
of the double-stranded structure of dsRNA according to the
invention may be increased by at least one, preferably a plurality,
in particular 2 to 5, chemical linkages. A dsRNA according to the
invention, of which the dissociation is reduced, has higher
stability to enzymatic and chemical degradation in the cell and in
the organism or ex vivo.
[0053] The chemical linkage of the individual strands of a dsRNA
according to the invention is advantageously formed by a covalent
or ionic bond, hydrogen bridge bond, hydrophobic interaction,
preferably van der Waals or stacking interactions or by metal ion
coordination. According to a particularly advantageous
configuration, it may be produced at least at one, preferably at
both, ends. It has also proven to be advantageous that the chemical
linkage is formed by means of one or more groups of compounds, the
groups of compounds preferably being
poly-(oxyphosphinicooxy-1,3-propane-diol) and/or polyethyleneglycol
chains. The chemical linkage may also be formed by purine analogues
used in the double-stranded structure, instead of purines. A
further advantage is that the chemical linkage is formed by
azabenzene units introduced in the double-stranded structure. It
may also be formed by branched nucleotide analogues used in the
double-stranded structure, instead of nucleotides.
[0054] It has proven advantageous to produce the chemical linkage
using at least one of the following groups: methyl blue;
bifunctional groups, preferably bis-(2-chorethyl)-amine;
N-acetyl-N'-(p-glyoxybenzoyl)-cystamine; 4-thiouracil; psoralene.
The chemical linkage may further be formed by thiophosphoryl groups
arranged at the ends of the double-stranded region. The chemical
linkage is preferably produced by triple helical bonds at the ends
of the double-stranded region. The chemical linkage may
advantageously be induced by ultraviolet light.
[0055] Modification of the nucleotides of the dsRNA leads to
deactivation of a protein kinase (PKR) dependent on
(double-stranded) RNA, in the cell. The PKR induces apoptosis.
Advantageously, at least one 2' hydroxy group of the nucleotides of
the dsRNA in the double-stranded structure is replaced by a
chemical group, preferably a 2'-amino or a 2'-methyl group. At
least one nucleotide in at least one strand of the double-stranded
structure may also be what is known as a locked nucleotide with a
sugar ring which is preferably chemically modified by a 2'-O,
4'-C-methylene bridge. Advantageously, a plurality of nucleotides
are locked nucleotides.
[0056] Modification of the nucleotides of dsRNA according to the
invention affects, in particular, the dissociation of the
nucleotides by reinforcing hydrogen bridge bonding. The stability
of the nucleotides is increased and protected from an attack by
RNAs.
[0057] A further method of preventing premature dissociation of
dsRNA according to the invention in the cell involves the formation
of the hairpin bend. In a preferred embodiment, a dsRNA according
to the invention has a hairpin structure, to slow down the
dissociation kinetics. With a structure of this type, a loop
structure is preferably formed at the 5'- and/or 3'-end. A loop
structure of this type does not have hydrogen bridges.
[0058] In addition, premature degradation may be prevented by
modifying the backbone of the dsRNA according to the invention.
dsRNA which is modified (for example, phosphorus thioate,
2'-O-methyl-RNA, LNA, LNA/DNA gapmers) and therefore has a longer
half-life in vivo is particularly preferred.
[0059] A dsRNA according to the invention is preferably derived
against the (m)RNA of the VGLUT family, in particular from VGLUT1,
VGLUT2 and/or VGLUT3, from mammals, such as humans, monkeys, rats,
dogs, cats, mice, rabbits, guinea pigs, hamsters, cattle, pigs,
sheep and goats.
[0060] A dsRNA according to the invention preferably suppresses the
expression of VGLUT1, VGLUT2 and/or VGLUT3 in the cell by at least
50%, 60%, 70%, particularly preferably to at least 90%; the dsRNAs
according to the invention are therefore, in particular, suitable
dsRNA molecules of the embodiments according to the invention, in
other words (i) siRNA or (ii) long dsRNA or (iii) siRNA-based
hairpin RNA or (iv) miRNA-based hairpin RNA, which can trigger the
phenomenon of RNA interference. Suppression can be measured via a
Northern blot, quantitative real time PCR or at protein level with
VGLUT1-, VGLUT2-or VGLUT3-specific antibodies.
[0061] dsRNAs according to the invention, in particular human
dsRNAs according to the invention, can have what are known as blunt
ends, but also overhanging ends.
[0062] Overhanging ends can basically comprise at least two
overhanging nucleotides, preferably 2 to 10, in particular 2 to 5,
overhanging nucleotides at the 3'-terminus, optionally however also
alternatively at the 5'-terminus.
[0063] dTdT at the respective 3'-terminus of the double-stranded
dsRNA according to the invention, in particular siRNA, are
preferred for the overhanging ends. As mentioned above, the
overhanging nucleotides may be dT (deoxythymidine) or also uracil,
but any overhanging ends can basically be attached to the dsRNA
double strands according to the invention that are complementary
with mRNA of VGLUT1, 2 or 3.
[0064] dsRNAs according to the invention, in particular siRNAs, may
be directed against human VGLUT sequences or sequences of mammals,
for example rats, pigs or mice or of domestic animals.
[0065] In the case of rat VGLUT sequences, preferred embodiments of
the dsRNA according to the invention are directed against a target
sequence of the VGLUT2-mRNA of the rat, which in a preferred
embodiment is the (m)RNA-target sequence 5'-AAG GCU CCG CUA UGC GAC
UGU-3' (SEQ ID NO: 70) (the sequence corresponds at the level of
the cDNA, although U is replaced by T). A particularly preferred
dsRNA of the present invention is therefore a duplex molecule of
which the sense strand has the sequence 5'-GGC UCC GCU AUG CGA CUG
UTT-3' (SEQ ID NO: 71) (i.e. with an overhanging TT at the
3'-terminus) and of which the antisense strand has the sequence
5'-ACA GUC GCA UAG CGG AGC CTT-3' (SEQ ID NO: 72) (also with a TT
which overhangs relative to the sense strand at the 3'-terminus).
This ds molecule according to the invention is directed against the
aforementioned fragment of the VGLUT2-mRNA. A further particularly
preferred embodiment of the dsRNA according to the invention is
directed against a different target sequence of the VGLUT2-mRNA (of
the rat), namely against 5'-AAG CAG GAU AAC CGA GAG ACC-3' (SEQ ID
NO: 86). The two strands of a double-stranded siRNA according to
the invention then typically contain the following sequences:
5'-r(GCAGGAUAACCGAGAGACC)dTT-3' (SEQ ID NO: 87) (sense strand) and
5'-r(GGUCUCUCGGUUAUCCUGC)d(TT)-3' (SEQ ID NO: 88) (antisense
strand) or consist thereof.
[0066] The dsRNA is produced by processes known to the person
skilled in the art by synthesizing nucleotides, in particular also
oligonucleotides, for example by Merryfield synthesis, on an
insoluble support (H. G. Gassen, Chemical and Enzymatic Synthesis
of Gene Fragments (Verlag Chemie. Weinheim 1982)) or by a different
method (Beyer/Walter, Lehrbruch der Organischen Chemie, 20th
edition, (S. Hirzel Verlag, Stuttgart 1984), p. 816 ff.).
VGLUT-mRNA may be obtained by hybridization using genome and cDNA
databases. dsRNA molecules according to the invention, in
particular siRNA molecules may, for example, be produced
synthetically and optionally also obtained from various suppliers,
for example IBA GmbH (Gottingen, Germany).
[0067] Double-stranded RNA according to the invention (dsRNA) may
be enclosed in micellar structures which influence the separation
of groups of substances in vitro and in vivo. The dsRNA preferably
occurs in liposomes. Liposomes are artificial membranes, which are
spherically closed in on themselves, of phospholipids in which
hydrophilic substances are encapsulated in the aqueous interior and
lipophilic substances may also be incorporated in the internal
region of the lipid membrane. To be used for experimental or
therapeutic purposes, liposomes have to be compatible with cells
and tissues. The dsRNA, which is preferably present in the
liposomes, may be modified by a peptide sequence, preferably by a
lysine and arginine-rich sequence, for example a sequence of the
viral TAT protein (for example containing AS 49-57) and then breach
the cell membrane more easily as a transporter peptide.
[0068] The dsRNA can similarly be enclosed in viral natural capsids
or in chemically or enzymatically produced artificial capsids or
structures derived therefrom. The aforementioned features allow the
dsRNA to be funnelled into predetermined target cells.
[0069] A further preferred subject of the present invention is a
configuration of the VGLUT-dsRNAs according to the invention, which
is an alternative to siRNA, namely as microRNAs (loc. cit.) with at
least one hairpin bend, by means of which the two imperfectly
complementary strands are covalently bound to one another
(miRNA-based hairpin RNA) (cf. also Schwarz et al., 2002). These
VGLUT-miRNAs according to the invention are transcribed by the
cells themselves and, after sequence-specific binding to the mRNA,
do not lead to mRNA degradation but merely induce translation
repression. VGLUT-miRNAs according to the invention are transcribed
as at least 50, preferably between 60 and 80, quite particularly
preferably between 65 and 75 nucleotide-long precursors and form a
characteristic "hairpin structure". The enzyme dicer cuts, from
these precursors in the cell, a 21 to 23 nucleotide-long
double-stranded region that is unwound in further steps. Therefore,
the mature miRNA can be incorporated, for example, into miRNP
particles. These particles may then induce specific translation
repression of the complementary mRNA. The degree of complementarity
to the target mRNA decides whether the DNA duplex formed acts as
miRNA or siRNA.
[0070] According to the invention, numerous vector systems allow
the use of miRNAs for subsequent stable and regulated transcription
of the corresponding VGLUT-siRNAs. The transcription of the miRNAs
may be controlled by polymerase III promoters (for example HI or U6
promoters) and also by polymerase II promoters (Brummelkamp et al.,
2002; Lee et al., 2002; Miyagishi and Taira, 2002). The sense and
antisense strands of various promoters may be read off and
accumulate in the cell to form 19-nt duplices with 4-nt overhangs
(B) (Lee et al., 2002), or the expression of hairpin structures is
used (Brummelkamp et al., 2002).
[0071] Viral vectors, for example retroviral or adenovirus-derived
vectors, are preferably used for these vector systems. Viral
vectors have very efficient targeted transduction of specific
cells, including primary cells, and can therefore be used widely,
for example, in pain therapy.
[0072] According to a further particularly advantageous embodiment,
it is provided that the dsRNA is bound to at least one capsid
protein which originates from a virus or is derived therefrom or
from a synthetically produced viral capsid protein, associated
therewith or surrounded thereby. The capsid protein may be derived
from the polyoma virus. It may therefore be, for example, the virus
protein 1 (VP1) and/or the virus protein 2 (VP2) of the polyoma
virus. The use of such capsid proteins is known, for example, from
DE 19618797 A1. The aforementioned features substantially simplify
introduction of the dsRNA in to the cell.
[0073] In a preferred embodiment, the dsRNA according to the
invention is expressed in that the first template (sense dsRNA) and
the second template (antisense dsRNA) are under the control of two
identical or different promoters. Expression takes place in vivo
and is brought into the cells by vectors in the course of gene
therapy.
[0074] The present invention further relates to a pharmaceutical
composition containing at least one dsRNA according to the
invention and/or a cell containing it, and optionally auxiliaries
and/or additives.
[0075] Pharmaceutical composition: a substance corresponding to the
definition in Article 1 .sctn.2 of the German law regulating the
circulation of pharmaceutical compositions (AMG). In other words,
substances or preparations of substances which are intended, by
application onto or into the body of a human or animal, [0076] 1.
to heal, relieve, prevent or detect diseases, illness, physical
disorders or disease ailments, [0077] 2. to reveal the nature, the
state or the function of the body or mental states, [0078] 3. to
replace effective substances or body fluids produced by the human
body, [0079] 4. to repel, eliminate or render harmless pathogens,
parasites or extraneous substances, or [0080] 5. to influence the
nature, the state or the functions of the body or mental
states.
[0081] The pharmaceutical compositions according to the invention
may be administered as liquid pharmaceutical preparations in the
form of injection solutions, drops or syrups, as semi-solid
pharmaceutical preparations in the form of granules, tablets,
pellets, patches, capsules, plasters or aerosols and contain, in
addition to the at least one subject of the invention, optionally
excipients, fillers, solvents, diluents, dyes and/or binders,
depending on the galenical form. The choice of auxiliary agents and
the quantities thereof to be used depend on whether the
pharmaceutical preparation is to be applied orally, stemerally,
intravenously, intraperitoneally, intradermally, intramuscularly,
intranasally, buccally, rectally or topically, for example to
infections of the skin, the mucous membranes or the eyes.
Preparations in the form of tablets, dragees, capsules, granules,
drops and syrups are suitable for oral application, solutions,
suspensions, easily reconstitutable dry preparations and sprays are
suitable for stemeral, topical and inhalative applications.
Subjects according to the invention in a deposit, in dissolved form
or in a plaster, optionally with the addition of agents to promote
skin penetration, are suitable percutaneous application
preparations. Orally or percutaneously applicable preparation forms
can release the compounds according to the invention after a delay.
The amount of active ingredient to be administered to the patient
varies according to the weight of patient, the method of
application, the indication and the severity of the disease. 2 to
500 mg/kg of at least one subject according to the invention are
usually applied. If the pharmaceutical composition is to be used,
in particular, for gene therapy, a physiological sodium chloride
solution, stabilizers, proteinase, DNAse inhibitors etc., are
recommended as suitable auxiliaries or additives.
[0082] The present invention further relates to host cells, except
for human germ cells, and human embryonic stem cells, which are
transformed by at least one dsRNA according to the invention. dsRNA
molecules according to the invention may be introduced into the
respective host cell by conventional methods, for example
transformation, transfection, transduction, electroporation or
particle gun. During transformation, at least two dsRNAs which are
different from one another are introduced into the cell, one strand
of each dsRNA being complementary, at least in certain fragments,
with the (m)RNA of a member of the VGLUT family, in particular
complementary to the (m)RNA of VGLUT1, VGLUT2 or VGLUT3. The region
of the dsRNA complementary with the (m)RNA of VGLUT1, 2 or 3
contains less than 25 successive nucleotide pairs.
[0083] Suitable host cells include any cells of a prokaryotic or
eukaryotic nature, for example of bacteria, fungi, yeasts,
vegetable or animal cells. Preferred host cells include bacterial
cells such as Escherichia coli, Streptomyces, Bacillus or
Pseudomonas, eukaryotic microorganisms such as Aspergillus or
Saccharomyces cerevisiae or conventional baker's yeast (Stinchcomb
et al. (1997) Nature 282: 39)
[0084] In a preferred embodiment, however, cells from multicellular
organisms are selected for transformation by means of dsRNA
constructs according to the invention. In principle, any higher
eukaryotic cell culture is available as a host cell, although cells
of mammals, for example monkeys, rats, hamsters, mice or humans,
are quite particularly preferred. A large number of established
cell lines is known to the person skilled in the art. The following
cell lines are mentioned in a list, which is not exhaustive: 293T
(embryonic renal cell line) (Grahan et al., J. Gen. Virol. 36:59
(1997), BHK (baby hamster renal cells), CHO (cells from hamster
ovaries, Urlaub and Chasin, Proc. Natl. Accad. Sci. USA 77: 4216,
(1980)), Hela (human carcinoma cells) and further cell
lines--established in particular for laboratory use-, for example
HEK293, SF9 or COS cells, wt-PC12 and DRG primary cultures. Quite
particularly preferred are human cells, in particular neuronal stem
cells and cells from the pain pathway, preferably primary sensory
neurons. Human cells, in particular autologous cells from a
patient, are suitable, after (in particular ex vivo) transformation
with dsRNA molecules according to the invention, in other words
after cell removal, optionally ex vivo expansion, transformation,
selection and final retransplantation in the patient, quite
particularly as pharmaceutical compositions for, for example, gene
therapy.
[0085] A further preferred subject is also the use of at least one
dsRNA according to the invention or pharmaceutical composition
and/or of at least one cell according to the invention for
producing a pharmaceutical preparation or pain remedy for the
treatment of pain, in particular chronic pain, tactile allodynia,
thermally triggered pain and/or inflammatory pain.
[0086] The subjects of the invention are suitable as pharmaceutical
compositions, for example for nociception inhibition, for example
by reducing the expression of at least one member of the VGLUT
family, for example VGLUT1, -2 or -3, using dsRNA according to the
invention.
[0087] Also disclosed is the use of at least one dsRNA according to
the invention containing dsRNA according to the invention and/or a
cell according to the invention for producing a pharmaceutical
composition for the treatment of urinary incontinence; also of
neurogenic bladder symptoms, pruritus, tumours, inflammation; in
particular of VGLUT-associated inflammation with symptoms such as
asthma; and of any disease symptoms associated with VGLUT family
members.
[0088] The invention further relates to a process for the
treatment, in particular pain treatment, of a non-human mammal or
human, which requires the treatment of pain, in particular chronic
pain, by administration of a pharmaceutical composition according
to the invention, in particular those containing a dsRNA according
to the invention. The invention further relates to corresponding
processes for the treatment of pruritus and/or urinary
incontinence.
[0089] A further preferred subject is also the use of at least one
dsRNA according to the invention, in particular siRNA, and/or of a
cell according to the invention for gene therapy, preferably in
vivo or in vitro gene therapy. Gene therapy is understood to be a
form of therapy during which, for example, an effector gene,
usually a protein, and, in the present case, in particular dsRNA
according to the invention, is expressed by the introduction of
nucleic acids in cells.
[0090] A basic distinction is made between in vivo and in vitro
processes. In the case of in vitro processes cells are removed from
the organism and are transfected ex vivo with vectors and are then
introduced back into the same organism or into another organism.
With in vivo gene therapy, vectors, for example for combating
tumours, are applied systemically (for example via the bloodstream)
or directly into the tumour. According to a preferred embodiment, a
vector is administered, which contains both the transcription
element for the sense-dsRNA and the transcription element for the
antisense-dsRNA under the control of suitable promoters. According
to a further preferred embodiment, the two transcription elements
may be located on different vectors.
[0091] A further preferred subject is also a diagnostic reagent
containing at least one dsRNA and/or a cell according to the
invention and optionally suitable additives. A diagnostic reagent
herein denotes a compound or a process which may be used to
diagnose a disease.
[0092] According to the invention, a further preferred subject is
also a process for identifying pain-modulating substances. In a
preferably upstream process step (a), over-expression of VGLUT,
preferably VGLUT1, VGLUT2 or VGLUT3, takes place in a test cell.
This over-expression in a test cell ensures that there is an
increased concentration of VGLUT in these manipulated test cells,
which are used for further examination, so the efficiency of
potentially pain-modulating substances may be determined more
accurately by means of scale expansion. However, in principle,
cells that have not been manipulated in this manner, but
nevertheless natively express VGLUT, may be used for the process
according to the invention.
[0093] The preferably cultivatable cells, which may have been
obtained by the placement upstream of process step (a), are
subjected to the (in particular simultaneous) process steps (b) and
(b'), namely (b) preferably genetic manipulation of at least one
cell (test cell) with at least one dsRNA according to the invention
and (b') an (in particular simultaneous) comparative test (control
test) with at least one identical cell (control cell). A
comparative test of this type according to process step (b') may
follow different target directions, depending on the desired
knowledge to be obtained. Various embodiments are therefore
conceivable. The comparative test may thus, for example, be
conducted with test cells that, in contrast to process step (b),
are used without any genetic manipulation with dsRNA.
Alternatively, however, control cells may also comprise an altered
dsRNA, one not according to the invention, for example, or else be
manipulated with a specific dsRNA that has a known effect on the
VGLUT expression. Finally, process step (b') may optionally also be
omitted. In a process step (c), the test cells, which both express
VGLUT and also, according to process step (b), comprise the
substance to be tested, are incubated under suitable conditions.
The test cells from process step (b) and the control cells
according to process step (b') are typically incubated
simultaneously.
[0094] In a process step (d), for example, the binding of the test
substance on the VGLUT-(m)RNA synthesized by the cells is then
measured, preferably under suitable conditions. A preparation of
the test cells manipulated with the test substance may, for
example, be required for this purpose. Measurement of at least one
of the functional parameters altered by the binding of the test
substance, typically dsRNA, on the VGLUT-(m)RNA, for example, is,
however, preferred. This altered parameter may, for example, be a
quantifiable phenotype of the incubated cell that is adjusted by
means of the binding of the test substance on VGLUT-(m)RNA, for
example on the basis of the expression of the VGLUT protein
suppressed by the binding. The measurement may also take place via
immunofluorescence methods, for example, by means of which the
concentration of VGLUT in the target cells is determined. However,
the VGLUT that is over-expressed in the test cell by means of a
process step (a) may (additionally) be configured with a reporter
function. A fluorescence property connected to the over-expressed
VGLUT by means of a corresponding gene construct (or the optional
suppression of said property by means of the addition of a
positively tested test substance according to the invention) would,
for example, be directly measurable in the cell. Potentially
pain-modulating substances are then identified, for example, via
the extent of the difference between the measured value in the test
cell and the measured value in the control cell, in a process step
(e).
[0095] The dsRNA that is transferred into the test cells according
to process step (b) or (b') in the form of genetic manipulation, as
a typical test substance of a process according to the invention,
may also be transferred into the test cells via any alternative
route. For example, the addition to the test cells may take place
exogenously, optionally in conjunction with further chemical or
physical measures known from the prior art, in order to ensure the
absorption of the dsRNA into the cells, for example by means of
electroporation, etc. Insofar as the dsRNA test substances applied
exogenously to the test cells are unable per se to penetrate
cellular membrane, their cellular membrane penetration capacity may
also be increased by means of corresponding formulations, for
example in liposomes or by coupling of known membrane penetration
reinforcing agents, for example suitable polymers or transfection
reagents.
[0096] The term pain-modulating refers to a potential regulating
influence on the physiological occurrence of pain, in particular to
an analgesic effect. The term substance covers any compound that is
suitable as a pharmaceutical active ingredient, in particular
therefore low-molecular active ingredients, but also others such as
nucleic acids, fats, sugars, peptides or proteins such as
antibodies. Incubation under suitable conditions herein means that
the substance to be investigated can react with the cell or the
corresponding preparation in an aqueous medium a defined time
before measurement. The temperature of the aqueous medium may be
controlled, for example at between 4.degree. C. and 40.degree. C.,
preferably at ambient temperature or at 37.degree. C. The
incubation time may be varied between a few seconds and a plurality
of hours, depending on the interaction of the substance with the
protein. However, times between 1 min and 60 min are preferred. The
aqueous medium may contain suitable salts and/or buffer systems,
so, for example, a pH between 6 and 8, preferably pH 7.0-7.5
prevails in the medium during incubation. Further suitable
substances such as coenzymes, nutrients, etc. may be added to the
medium. A person skilled in the art can easily determine suitable
conditions as a function of the interaction of the substance to be
investigated with the protein, on the basis of his experience, the
literature or a few simple preliminary tests, in order thereby to
obtain a measured value that is as clear as possible. A cell that
has synthesized a protein is a cell which has already expressed
this protein endogenously or a cell which has been genetically
modified so it expresses this protein and accordingly contains the
protein from the beginning of the process according to the
invention. The cells may be cells from possibly immortalized cell
lines or native cells originating from tissues and isolated from
them, the cell assembly usually being dissolved. The preparation
from these cells comprises, in particular, homogenates from the
cells, the cytosol, a membrane fraction of the cells with membrane
fragments, a suspension of isolated cell organelles, etc.
[0097] The criterion by which the process allows the discovery of
useful substances is either the binding to the protein, which may
be demonstrated, for example, by displacement of a known ligand or
the extent of bound substance, or the alteration of a functional
parameter by the interaction of the substance with the protein.
This interaction may reside, in particular, in regulation,
inhibition and/or activation of receptors, ion channels and/or
enzymes. Altered functional parameters may be, for example, gene
expression, ion milieu, the pH or the membrane potential, and the
alteration of enzyme activity or the concentration of the second
messenger. In the foregoing: [0098] genetically manipulated refers
to manipulation of cells, tissues or organisms in such a way that
genetic material is introduced here; [0099] endogenously expressed
means expression of a protein comprising a cell line under suitable
culture conditions, without this corresponding protein being caused
to perform expression by genetic manipulation.
[0100] A further preferred embodiment of this process provides that
the cell is genetically manipulated before process steps (b) and
(b').
[0101] A further preferred embodiment of this process provides that
genetic manipulation allows the measurement of at least one of the
functional parameters altered by the test substance.
[0102] A further preferred embodiment of this process provides that
a form of a member of the VGLUT family, preferably VGLUT1, VGLUT2
or VGLUT3, which is not endogenously expressed in the cell, is
expressed or a reporter gene is introduced by genetic
manipulation.
[0103] A further preferred embodiment of this process provides that
the bond is measured via the displacement of a known marked ligand
of a member of the VGLUT family, preferably VGLUT1, VGLUT2 or
VGLUT3.
[0104] A further preferred embodiment of this process provides that
.gtoreq.8 hours, preferably .gtoreq.12 hours, in particular
.gtoreq.24 hours elapse between the simultaneous process steps (b)
and (b') and process step (c).
[0105] The subjects according to the invention may be introduced
into the cell in the above-described manner.
BRIEF DESCRIPTION OF THE DRAWINGS
[0106] The invention will be described in further detail
hereinafter with reference to the accompanying drawing figures, in
which:
[0107] FIG. 1 shows strategies for RNA interference technology.
Synthetic siRNA duplices may be transfected directly in cells,
where they induce target mRNA degradation via the cellular RNAi
machinery. On the other hand, vector-coded siRNAs are formed as
hairpin-shaped precursors in the cell nucleus and are processed to
siRNA in the cytoplasm of dicer.
[0108] FIG. 2a shows siRNAs which have been produced in vitro:
there are basically a plurality of ways of utilising RNAi
technology: chemically synthesized siRNA may be used (see FIG. 2A)
or also methods from molecular biology (for example FIG. 2B).
[0109] (A) Chemically synthesized siRNA bypasses the dicing step,
incorporates into the RISC and leads to sequence-specific mRNA
degradation. (B) Long dsRNA is processed into active siRNAs by
dicers. (C) Duplex hairpin RNA may be processed into active siRNAs
by dicers. (D) Incomplete duplex hairpin RNA is processed into
miRNAs by dicers, incorporated into miRNPs and leads to translation
inhibition. Long dsRNA molecules (B), transfected in cells, are
processed in short 19 to 21 bp siRNA molecules which lead to the
degradation of complementary mRNA sequences. Chemically
synthesizable single-stranded 21-mers imitate the siRNAs found in
vivo and, after duplex formation, are used for relatively short
transient RNAi effects in vitro and in vivo (Elbashir et al.,
2001a; Holen et al., 2002; Yu et al., 2002). Four embodiments of
dsRNA according to the invention against VGLUT family members are
therefore described.
[0110] Plasmids which express dsRNA according to the invention, (in
particular siRNA) (FIG. 2b), in other words short RNA fragments
generated in vivo, offer a further possibility:
[0111] (A) Long hairpin RNA expressed by RNA polymerase II leads,
after dicer processing, to a plurality of siRNAs with a wide
variety of sequence specificities.
[0112] (B) Tandem pol III promoters allow the expression of
individual sense and antisense strands which accumulate in the cell
to active siRNAs.
[0113] (C) An individual pol III promoter allows expression of a
short hairpin-shaped (sh)RNA which is processed to active siRNA by
dicers.
[0114] Using RNA polymerase III promoters such as U6 or H1, it is
possible to express dsRNA and then siRNA molecules intracellularly
and therefore to establish stable RNAi systems in mammalian cells
(Brummelkamp et al., 2002; Lee et al., 2002; Miyagishi and Taira,
2002). Either the sense or antisense strands of various promoters
may be read off and accumulate in the cell to 19-nt duplices with
4-nt overhangs, or the expression of hairpin structures is
utilized. In both cases, effective, stable suppression of gene
expression is achieved by the RISC-mediated RNAi process. Although
the small size of a transcript which may be expressed by the pol
III promoter does not initially impede siRNA technology, it
restricts the number of different siRNAs which may be formed by a
transcript (Myslinski, 2001).
[0115] FIG. 3 shows the production of the DNA patterns for siRNA
synthesis.
[0116] FIG. 4 shows the transcription and hybridization of the
siRNA.
[0117] FIG. 5 shows VGLUT1 cDNA with siRNA target sequence; Gene
Bank Accession No. U07609. Highlighted in color: initiating codon
(yellow), siRNA si-rVGLUT1 739-759 EGT (red), primer rVGLUT1
(2.sub.--4)F (light grey), primer rVGLUT1 (2.sub.--4)R (dark
grey).
[0118] FIG. 6 shows VGLUT2 cDNA with siRNA target sequences; Gene
Bank Accession No. NM.sub.--053427. Highlighted in color:
initiating codon (yellow), siRNA si-rVGLUT2 100-120 EGT (red),
siRNA si-rVGLUT2 100-120 AMB (green), siRNA si-rVGLUT2 166-186 AMB
(blue), primer rVGLUT2(8.sub.--9)F (light grey), primer
rVGLUT2(8.sub.--9)R (dark grey).
[0119] FIG. 7 shows VGLUT3 cDNA with siRNA target sequence; Gene
Bank Accession No. AJ491795. Highlighted in color: initiating codon
(yellow), siRNA si-rVGLUT3 220-240 EGT (red), primer
rVGLUT3(4.sub.--5)F (light grey), primer rVGLUT3(4.sub.--5)R (dark
grey).
[0120] FIG. 8 shows the transfection of PC12 MR_A cells with
Cy3-labelled siRNA; Cy3-labelled siRNA (100 pmol) was transfected
using LF2000 (1 .mu.l) in cells of the PC12 MR-A cell line (B).
LF2000 was dispensed with during the control (A). The cells were
fixed for 24 hours after transfection and the cell nuclei
complementarily colored with DAPI.
[0121] FIG. 9 shows the transfection rate in DRG primary cultures.
The transfection rate in 250,000 cells of a DRG primary culture
(P0, 1 d.i.v.) was determined in a 24-well plate using various
amounts of Lipofectamine.TM. 2000 (0.2-1.4 .mu.l) and different
Cy3-siRNA concentrations (10 to 200 pmol) 24 hours after
transfection using a fluorescence microscope.
[0122] FIG. 10 shows the transfection rate in PC12 MR-A cells. The
transfection rate in 250,000 PC12 MR-A cells was determined in a
24-well plate using various amounts of LF 2000 (0.2-1.4 .mu.l) and
different Cy3-siRNA concentrations (10 to 200 pmol) 24 hours after
transfection using a fluorescence microscope.
[0123] FIG. 11 shows the transfection rate in wt-PC12 cells. For
this purpose, the transfection rate in 250,000 wt-PC12 cells was
determined in a 24-hole plate using various amounts of LF 2000
(0.2-1.4 .mu.l) and different Cy3-siRNA concentrations (10 to 200
pmol) 24 hours after transfection using a fluorescence
microscope.
[0124] FIG. 12 shows the results of the treatment of a DRG primary
culture with Cy3-labelled siRNA against VGLUT2. The suppression of
VGLUT2 protein expression by means of Cy3-labelled siRNA in neurons
of a DRG primary cultre (P0, 2 d.i.v.) was determined by immune
fluorescence 48 hours after transfection with LF2000 (1 .mu.l/well)
in a 24-well plate. VGLUT2 (guinea pig, 1:800, green),
Cy3-si-rVGLUT2 166-186 AMB (100 pmol, red) and superimposed
depiction of the VGLUT2 and Cy3-siRNA signals with DAPI-colored
cell nuclei (C, F, I).
[0125] FIG. 13 shows VGLUT2-protein expression in PC12 MR-A cells
and protein suppression by means of siRNA. Immunocytochemical
detection of VGLUT2 protein expression was carried out (A) in cells
of cell line PC12 MR-A and reduction of the VGLUT2 protein level by
means of siRNA against VGLUT2 (si-rVGLUT2 100-120 EGT), 100 pmol
siRNA (C), 200 pmol siRNA (D) and negative control (B) without
primary antibodies against VGLUT2 (rabbit, 1:800).
[0126] FIG. 14 shows the detection of VGLUT2 in transfected wt-PC12
cells. VGLUT2 protein with primary antibodies against VGLUT2
(rabbit, 1:800) was detected by immunocytochemistry 24 hours after
transfection of rVGLUT2 plasmids by means of LF2000.TM. in wt-PC12
cells: (A) VGLUT2-positive cells (A488-labelled, green) in
rVGLUT2-transfected cells; (B) no VGLUT2-immune reactivity in
non-transfected cells (negative control).
[0127] FIG. 15 shows the siRNA treatment of VGLUT2-cotransfected
wt-PC 12 cells. The immunocytochemically labelled, VGLUT2-positive
wt-PC12 cells were counted out 24 hours after co-transfection of
rVGLUT2 plasmid with siRNAs against VGLUT2 (si-rVGLUT2 100-120 EGT,
si-rVGLUT2 100-120 AMB, si-rVGLUT2 166-186), against VGLUT1
(si-rVGLUT1 739-759 EGT) and against VGLUT3 (si-rVGLUT3 220-240
EGT), and with a mismatch siRNA (si-rVGLUT2 MM EGT). Illustration
of the mean values.+-.S.E.M. for n=6 per group. *p<0.05;
**p<0.01 and ***p<0.001 in comparison with the control group
without siRNA treatment (ANOVA, Bonferroni Test). Comparison of two
methods of evaluation: (A) manual counting (B) digital
counting.
[0128] FIG. 16 shows the efficiency of the siRNAs in wt-PC12 cells.
The siRNA efficiencies (percentage reduction in VGLUT2-positive
cells based on VGLUT2 expression without siRNA) were compared 24
hours after co-transfection of rVGLUT2 plasmid and siRNA in wt-PC12
cells. Illustration of the mean values.+-.S.E.M. for n=6 per group.
***p<0.001 in comparison with the treatment with mismatch siRNA
(ANOVA, Bonferroni test).
[0129] FIG. 17 shows the siRNA treatment of wt-PC12 cells 6 hours
before transfection with rVGLUT2. Immunocytochemically labelled
VGLUT2-positive wt-PC12 cells were counted out 24 hours after
treatment with siRNAs against VGLUT2 (si-rVGLUT2 100-120 EGT,
si-rVGLUT2 100-120 AMB, si-rVGLUT2 166-186), against VGLUT1
(si-rVGLUT1 739-759 EGT) and against VGLUT3 (si-rVGLUT3 220-240
EGT), and with a mismatch siRNA (si-rVGLUT2 MM EGT). The cells were
transfected 6 hours after siRNA treatment with rVGLUT2 plasmid.
Illustration of the mean values.+-.S.E.M. for n=6 per group.
**p<0.01 in comparison with the treatment with mismatch siRNA
(ANOVA, Bonferroni test).
[0130] FIG. 18 shows the influence of siRNA treatment 24 hours
after rVGLUT2 transfection. Immunocytochemically labelled
VGLUT2-positive wt-PC12 cells were counted out 24 hours after
treatment with siRNAs against VGLUT2 (si-rVGLUT2 100-120 EGT,
si-rVGLUT2 100-120 AMB, si-rVGLUT2 166-186), against VGLUT1
(si-rVGLUT1 739-759 EGT) and against VGLUT3 (si-rVGLUT3 220-240
EGT), and with a mismatch siRNA (si-rVGLUT2 MM EGT). The cells were
transfected 24 hours before siRNA treatment with rVGLUT2 plasmid.
Illustration of the mean values.+-.S.E.M. for n=6 per group.
*p<0.05 and **p<0.01 in comparison with the treatment with
untreated cells (ANOVA, Bonferroni test).
[0131] FIG. 19 shows the efficiency of the siRNAs 24 hours after
rVGLUT2 transfection. The siRNA efficiencies (proportion of VGLUT2
suppression based on VGLUT2 expression without siRNA) were compared
24 hours after siRNA treatment in wt-PC12 cells, which had been
transfected with rVGLUT2 plasmid 24 hours prior to the siRNA
treatment. Illustration of the mean values.+-.S.E.M. for n=6 per
group. ***p<0.001 in comparison with the treatment with mismatch
siRNA (ANOVA, Bonferroni test).
[0132] FIG. 20 shows the characterisation of the cells in a primary
culture of the spinal ganglion. Light and fluorescence microscopic
documentation on different types of cells in a primary culture of
the spinal ganglion (postnatal day 2, 1 to 5 days in vitro) are
illustrated: (A) light microscopic documentation (1 d.i.v.); (B, C)
immunocytochemical detection of (B) neurons (5 d.i.v) by means of
primary antibodies against PGP9.5U (1:1500) and of (C) Schwann
cells (5 d.i.v.) by means of primary antibodies against GFAP
(1:5000). The cell nuclei are complementarily colored blue in (B)
and (C) with DAPI.
[0133] FIG. 21 shows nociceptive neurons in DRG primary cultures.
Nociceptive label proteins were detected immunocytochemically in
cells of a DRG primary culture (P.sup.2, 8 d.i.v.) by means of
primary antibodies against (A) CGRP (rabbit, 1:8000); (B) TRPV1
(rabbit, 1:250); (C) TRPV2 (rabbit, 1:400).
[0134] FIG. 22 shows VGLUT2 protein expression in DRG primary
cultures. For this purpose, VGLUT2 protein expression in primary
cultures of spinal ganglia was characterized immunocytochemically:
(A) VGLUT2 (guinea pig, 1:800); (B) VGLUT2 (1:800, green), PGP9.5
(rabbit, 1:1500, red) co-expression of VGLUT2 and PGP9.5 (yellow);
(C) VGLUT2 (1:800, green), GFAP (rabbit, 1:5000, red). All cell
nuclei were complementarily colored with DAPI.
[0135] FIG. 23 shows the VGLUT1 and VGLUT2 expression in
peptidergic DRG neurons. Double immune fluorescence of VGLUT1 and
VGLUT2 with CGRP in DRG neurons (A-M) is illustrated: (A, C, D, F)
VGLUT1 (guinea pig, 1:800, green); (B, C, E, F, H, I, L, M) CGRP
(rabbit, 1:5000, red); (G, I, K, M) VGLUT2 (guinea pig, 1:800,
green). VGLUT1 and CGRP are expressed in various subpopulations (C,
F), as CGRP coexists with VGLUT2 (I, M, yellow signal).
[0136] FIG. 24 shows the expression of VGLUT2 in TRPV1-positive
neurons. VGLUT2 expression in TRPV1-positive neurons of a DRG
primary culture was detected immunocytochemically: (A) VGLUT2
(guinea pig, 1:800, green); (B) TRPV1 (rabbit, 1:250, red); (C)
VGLUT2 co-localisation in TRPV1-positive neurons (yellow signal);
(D) enlargement of part of Fig. C; signals of VGLUT2 in the cell
soma (yellow) and in the axon (yellow, green) of the TRPV1-positive
neuron; (E, F) frequency distribution of the cell surfaces of
VGLUT2 or TRPV1-positive neurons.
[0137] FIG. 25 gives an overview of the various VGLUT sequences
(human, rat) (VGLUT1, VGLUT2, VGLUT3), including the respective
database accession code.
[0138] FIG. 26 shows DNA target sequences of VGLUT-isoform-specific
siRNAs. The preferred sequences are shown in bold print. Homologues
have been tested by the Smith-Waterman algorithm.
[0139] FIG. 27 shows the nucleotide sequences of VGLUT1, VGLUT2 and
VGLUT3 (human in each case).
[0140] FIG. 28 shows the results of the in vivo tests on rats using
Bennett's pain model (see embodiment 4). Three different doses were
tested. FIGS. 28A, 28B and 28C show the results of the tests, using
1 ng, 10 ng and 100 ng of test substance (VGLUT2-siRNA) and
corresponding amounts of control siRNA. In addition, NaCl was
administered to each animal as a further control. The
anti-allodynic effect of VGLUT2-siRNA (cross symbol) can be seen
clearly, in particular, in FIG. 28A.
[0141] The present invention is characterized in more detail by the
following practical examples.
EXAMPLES
Example 1
A) Design of siRNA Molecules
[0142] The design of the siRNA molecules according to the invention
used corresponded to particularly preferred embodiments. FIGS. 5, 6
and 7 show the encoding sequences of the three different vesicular
glutamate transporters. Colored highlighting is used for the
initiating codon (yellow), and for the primer pairs used for the
(quantitative) determination (light and dark grey) respectively.
The target sequences of the various siRNAs are also highlighted in
color (red, green, blue).
[0143] B) Production of the siRNA
[0144] The siRNAs used were ordered for synthesis by Eurogentec
(EGT), on the one hand, and were self-made using the siRNA
construction kit from Ambion (AMB), on the other hand. The
following siRNA molecules were ordered for synthesis at Eurogentec:
TABLE-US-00001 si-rVGLUT1 739-759 EGT 5' AGC GCC AAG CUC AUG AAC
CTT 3' GC content: 52.4% 3' TT UCG CGG UUC GAG UAC UUG G 5'
si-rVGLUT2 100-120 EGT (active siRNA) 5' GCA GGA UAA CCG AGA GAC
CTT 3' GC content: 42.8% 3' TT CGU CCU AUU GGC UCU CUG G 5'
si-rVGLUT3 220-240 EGT 5' GCG GUA CAU CAU CGC UGU CTT 3' GC
content: 52.4% 3' TT CGC CAU GUA GUA GCG ACA G 5' si-rVGLUT2 MM EGT
(control siRNA) 5' GGA CUA GCA AAG CGA GCC ATT 3' GC content: 42.8%
3' TT CCU GAU CGU UUC GCU CGG U 5'
[0145] The following siRNA molecules were produced using the
Silencer.TM. siRNA construction kit from Ambion: TABLE-US-00002
si-rVGLUT2 100-120 AMB (active siRNA) 5' GCA GGA UAA CCG AGA GAC
CTT 3' GC content: 42.8% 3' TT CGU CCU AUU GGC UCU CUG G 5'
si-rVGLUT2 166-186 AMB 5' GGC UCC GCU AUG CGA CUG UTT 3' GC
content: 57.1% 3' TT CCG AGG CGA UAC GCU GAC A 5'
[0146] A proportion of the self-produced siRNAs was labelled with
the dye Cy3 using the Silencer siRNA labelling kit from Ambion. The
aforementioned sequences were used for the in vitro experiments
described hereinafter.
[0147] Production of siRNA Using Silencer siRNA Construction Kit
(Ambion)
[0148] In order to produce efficient transcription patterns for
siRNA synthesis, the sense and antisense oligonucleotides have to
be converted in dsRNA using T7 promoter at the 5' end. This is
achieved by hybridizing the two oligonucleotides with the T7
promoter primer and lengthening them by a subsequent DNA polymerase
reaction (cf. FIG. 3).
[0149] The sense and antisense siRNA templates are transcribed in
separate reaction mixtures for 2 hours. The mixtures are then
blended and the common reaction mixture incubated overnight. The
separated transcription mixtures prevent potential competition
around the transcription reagents between the templates, as this
could limit the synthesis of one of the two strands of siRNA.
Hybridization of the two siRNA strands is simplified by mixing the
transcription mixtures and continuous RNA synthesis thus permitted,
increasing the yield of dsRNA. The siRNA obtained by in vitro
transcription has, at the 5' end, overhanging leader sequences
which have to be removed before transfection. This leader sequence
is digested by an individual strand-specific ribonuclease. The DNA
template is removed by DNase digestion in the same reaction mixture
(cf. FIG. 4).
[0150] The resultant siRNA has to be cleaned up from the mixture of
nucleotides, enzymes, short oligomers and salts, using RNA
columns.
[0151] The siRNA purified in this way is eluted in nuclease-free
water and is then available for transfection.
[0152] Procedure
[0153] A 100 .mu.M solution of each siRNA ONV was produced from the
200 .mu.M stock solution. The following respective reaction
mixtures were produced for hybridization of the siRNA ONV with the
T7 promoter primer for sense and antisense: TABLE-US-00003 T7
promoter primer 2 .mu.l DNA hyb buffer 6 .mu.l Sense/antisense
siRNA ONV 2 .mu.l
[0154] The mixtures were first heated to 70.degree. C. for 5 min,
then kept at ambient temperature for 5 min. The following reaction
mix was then fed to the reaction mixtures, carefully mixed and
incubated for 30 min at 37.degree. C.: TABLE-US-00004 10 .times.
Klenow reaction buffer 2 .mu.l 10 .times. dNTP mix 2 .mu.l
Nuclease-free water 4 .mu.l Exo-Klenow DNA polymerase 2 .mu.l
[0155] For both DNA formulations, a respective transcription
reaction mixture was produced at ambient temperature in order to
synthesize the sense and antisense ssRNA strands. For this purpose,
the following components were combined in the specified sequence,
were carefully mixed, without pipetting, and were incubated for 2
hours at 37.degree. C.: TABLE-US-00005 Sense or antisense DNA
template 2 .mu.l Nuclease-free water 4 .mu.l 2 .times. NTP mix 10
.mu.l 10 .times. T7 reaction buffer 2 .mu.l T7 enzyme mix 2
.mu.l
After the 2 hours, two transcription mixtures were pipetted
together and incubated overnight at 37.degree. C.
[0156] The following reaction mixture was made up to digest the
hybridized dsRNA with RNase and DNase and was added to the dsRNA by
pipetting, carefully mixed and incubated at 37.degree. C. for 2
hours: TABLE-US-00006 Digestion buffer 6 .mu.l Nuclease-free water
48.5 .mu.l RNase 3 .mu.l
[0157] 400 .mu.l siRNA binder buffer were then fed to nuclease
digestion and incubated for 2 to 5 min at ambient temperature. The
filter membrane also supplied was, in the meantime, moistened with
100 .mu.l siRNA. The siRNA was applied to the moistened filter in
the siRNA binder buffer and centrifuged for 1 min at 10,000 rpm.
The flow was discarded and the filter membrane washed twice with
500 .mu.l of the siRNA washing buffer in each case and centrifuged
(2 min at 10,000 rpm). The purified siRNA was then eluted in 100
.mu.l 75.degree. C. hot nuclease-free water and centrifuged off
into a clean receiver (2 min at 12,000 rpm). The siRNA was stored
at -20.degree. C. or -80.degree. C. until use.
[0158] Synthesis at Eurogentec and siRNA Duplex Formation
[0159] The RNA oligonucleotides synthesized by Eurogentec were
brought into a 50 .mu.M solution by means of DEPC-treated H.sub.2O
and aliquoted. 30 .mu.l of the RNA oligonucleotide solutions
belonging together were mixed in each case with 15 .mu.l 5.times.
annealing buffer (final concentration: 20 .mu.M siRNA duplex; 50 mM
tris pH 7.5-8.0; 100 mM NaCl in DEPC-H.sub.2O). The solution was
heated for 1 to 2 min in a water bath at 90 to 95.degree. C. and
left to cool for 45 to 60 min at ambient temperature. The siRNA was
stored at -20.degree. C. until use.
[0160] Labelling of the siRNA with Cy3
[0161] The siRNAs synthesized by Eurogentec as well as the
self-produced duplex siRNAs were used for siRNA labelling with the
fluorescence dye Cy3. The following reaction mixture was produced
and incubated for 1 hour at 37.degree. C. in order to label 5 .mu.g
siRNA: TABLE-US-00007 Nuclease-free water 18.3 .mu.l 10 .times.
labelling mix 5.0 .mu.l 21-mer duplex siRNA (20 .mu.M) 19.2 .mu.l 3
labelling reagent 7.5 .mu.l
The Cy3-labelled siRNA was purified with ethanol precipitation. For
this purpose, 0.1 volume 5 M NaCl and 2.5 volumes 100% ethanol were
added to the reaction mixture, thoroughly mixed and stored for 60
min at -80.degree. C. The precipitate was pelletized by
centrifugation for 20 min (>8,000.times.g), the supernatant
being carefully removed without destroying the pellet, and was
finally washed with 175 .mu.l 70% ethanol. After centrifuging off
(5 min at >8,000.times.g), all the supernatant was removed, the
pellet dried at ambient temperature for 5 to 10 min and finally
dissolved in a corresponding amount of nuclease-free water (19.2
.mu.l in this case).
Example 2
Use of VGLUT siRNAs in Various in vitro Models
[0162] In order to test the efficacy of the siRNAs produced, they
were used in various in vitro models and protein expression was
then determined by immunocytochemistry.
[0163] A) Optimization of the Transfection Conditions
[0164] Highly efficient siRNA gene suppression necessitates not
only the actual effectiveness of the siRNA but also a high
transfection rate of the respective cells. The cell density, the
amount of transfection reagent and the concentration of the siRNA
play an important part in it. While varying these various
parameters, the transfection rate (R.sub.T=number of transfected
cells/total number of cells) was determined using Cy3-labelled
siRNA. Lipofectamine.TM. 2000 was used as the transfection
reagent.
[0165] FIG. 8 shows examples of the results of localisation of
Cy3-labelled siRNA 24 hours after transfection with LF2000.TM.. In
the PC12 MR-A cells shown here, the labelled SiRNA accumulates in
the cytoplasm predominantly in the vicinity of the cell
nucleus.
[0166] Trasfection of spinal ganglion cells in a primary culture
proved extremely difficult. As shown in FIG. 9, a maximum
transfection rate of .about.2% maximum is achieved during
transfection of the cells with Cy3-labelled siRNA using LF2000. No
preference for the transfection of a specific cell type was
discerned, neuronal and non-neuronal cells similarly exhibiting a
Cy3 fluorescence signal. However, as the maximum neuron content was
60%, the yield of siRNA-transfected neurons was very low.
[0167] The maximum transfection rates (R.sub.Tmax.apprxeq.80%) were
achieved with cells in cell lines PC12 MR-A and PC12 MR-B, as
shown, for example, in FIG. 10, for the cell line PC12 MR-A.
[0168] Normal wt-PC12 cells may also be transfected well with
siRNA. FIG. 11 shows the different transfection rates for the
various transfection conditions. The maximum transfection rate was
.about.28%.
[0169] B) Suppression of VGLUT Expression by siRNA in Various in
vitro Models
[0170] 1. Suppression of Endogenous VGLUT Expression in DRG Primary
Cultures
[0171] The cells of DRG primary cultures were transfected with
various siRNAs directly after dissociation of the ganglia and
purification of the cell suspension with the transfection reagent
LF2000.TM.. The transfected cells were either seeded in normal
culture dishes or cultivated in a 24-well plate on
poly-L-lysine-coated cover slips.
[0172] DRG primary cultures, which had been transfected with
Cy3-labelled siRNA (Cy3-si-rVGLUT2 166-186 AMB), were fixed 48
hours after transfection and characterized immunocytochemically
with respect to theirVGLUT2 protein expression. FIG. 12 shows the
result of such an siRNA treatment.
[0173] Approximately 2% transfected cells, which could be detected
by their Cy3 dye, were on the siRNA-treated cover slips. None of
these siRNA-transfected cells showed a clear protein signal for
VGLUT1 after immunocytochemical labelling of the vesicular
glutamate transporterVGLUT2. On the other hand, all VGLUT2-positive
cells were without signals of the Cy3-labelled siRNA.
[0174] 2. Suppression of Endogenous VGLUT Expression in Established
Cell Lines
[0175] The differentiated cell lines PC12 MR-A and PC12 MR-B
express the vesicular glutamate transporterVGLUT1 and VGLUT2. FIG.
13 shows the expression of the VGLUT2 protein in the PC12 MR-A
cells.
[0176] Under optimized conditions, these cells were transfected
with siRNA against VGLUT2 (si-rVGLUT2 100-120 EGT). As shown in
FIG. 13, a reduction in the VGLUT2 immune reactivity is achieved
with 100 pmol siRNA (C) and most cells are without VGLUT2 immune
reactivity or have only slight VGLUT2 immune reactivity at 200 pmol
siRNA (D).
[0177] 3. Suppression of VGLUT2 Expression in Transiently
Transfected wt-PC12 Cells
[0178] Cells of the normal wt-PC12 cell line express only VGLUT1
and no VGLUT2. For this reason, these endocrine vesicle-producing
cells are suitable as a model system for suppression experiments
after transient VGLUT2 transfection. An EGFP vector, of which the
gene product, the green fluorescent protein (GFP), may be detected
directly by a fluorescence microscope was used to optimize DNA
transfection. An EGFP transfection rate of .about.40% was achieved
by optimising the DNA transfection conditions. A similar high
transfection rate could also be achieved in the case of
transfection with rVGLUT2 plasmids (FIG. 14).
[0179] The siRNA suppression experiments were configured in
different ways:
[0180] Co-transfection of siRNA cDNA vector
[0181] siRNA transfection 6 hours before cDNA
[0182] cDNA transfection 24 hours before siRNA transfection.
[0183] Co-transfection was initially carried out with rVGLUT2
plasmids and various siRNAs. Three siRNAs against VGLUT2 were used,
as well as siRNAs against VGLUT1, VGLUT3 and a mismatch siRNA for
specificity control. The cells were fixed 24 hours after
transfection and the VGLUT2 protein expression detected by
immunocytochemistry. Evaluation was carried out on a fluorescence
microscope, the VGLUT2-positive cells being counted out both
manually and by digital image analysis (MCID).
[0184] FIG. 15 show a comparison of the content of VGLUT2-positive
cells after rVGLUT2-plasmid transfection without and with
siRNA-co-transfection, and a comparison of the two methods of
evaluation. The results of the time-saving digital counting (B)
agree with the manual count (A) with their relative conditions. All
subsequent experiments were therefore evaluated digitally. After
treatment with siRNAs directed specifically against VGLUT2, the
content of VGLUT2-positive cells was significantly reduced in
comparison with cells not treated with siRNA (24.92.+-.1.9)
(si-rVGLUT2 100-120 EGT 11.4.+-.2.2 p<0.01; si-rVGLUT2 100-120
AMB 9.84.+-.1.1 p<0.01; si-rVGLUT2 166-186 AMB 6.29.+-.1.1
p<0.001).
[0185] On the other hand, the siRNAs against VGLUT1 and against
VGLUT3 and the mismatch siRNA do not significantly (p>0.05)
influence the content of the VGLUT2-positive cells (A).
[0186] If the efficiency of the siRNAs used is calculated from
these results as a percentage of the reduction of VGLUT2-positive
cells, based on the VGLUT2 expression without the influence of
siRNA treatment, the result shown in FIG. 16 is obtained.
[0187] It may be seen that the siRNAs directed against VGLUT2 have
high efficiency in comparison with ineffective mismatch siRNA. They
reduce the content of VGLUT2-expressing cells by 79 to 82%, the
self-produced siRNAs acting more effectively in the concentrations
used than the siRNA synthesized at Eurogentec. Whereas the siRNA
against VGLUT3 and the mismatch siRNA do not exert a significant
effect on VGLUT2 protein expression, the siRNA directed against
VGLUT1 with an efficiency of .about.47% appears to act
non-specifically on VGLUT2 expression. However, the siRNAs against
VGLUT2 are significantly more efficient (p<0.001) than the siRNA
against VGLUT1.
[0188] The transfection experiment has been modified hereinafter:
the wt-PC12 cells were treated with the various siRNAs 6 hours
before transfection with rVGLUT2 plasmid so the siRNAs were already
in the cells at the moment of DNA transfection.
[0189] FIG. 17 shows the proportion of VGLUT2-positive cells in
this test batch. As with co-transfection, the siRNAs against VGLUT2
lead to a significant reduction (p<0.01) in VGLUT2-expressing
cells in comparison with the cultures that were treated with
mismatch siRNA. On the other hand, the proportion of
VGLUT2-positive cells is not significantly altered (p>0.05) by
treatment with siRNAs against VGLUT1 and VGLUT3.
[0190] The influence of the existing VGLUT2 protein level on the
suppression efficiency of the siRNAs was tested in a further
experiment. This model corresponds rather to the endogenously
VGLUT2-expresing cells and the situation in vivo. For this purpose
the wt-PC12 cells were transfected with the rVGLUT2 plasmid 24
hours before the siRNA treatment. The proportion of VGLUT2-positive
cells was determined after a further 24 hours.
[0191] FIG. 18 shows the proportion of VGLUT2-positive cells after
immunocytochemical labelling. As in the previous experiments, the
control siRNAs (against VGLUT1 and VGLUT3, mismatch siRNA) do not
lead to a significant reduction (p>0.05) in VGLUT2 protein
expression. On the other hand, the siRNAs directed specifically
against VGLUT2 (from Ambion) significantly reduce the proportion of
VGLUT2-positive cells.
[0192] FIG. 19 shows the efficiency of the siRNAs in this batch of
experiments. This diagram also shows that the siRNAs directed
against VGLUT2 significantly reduce the proportion of
VGLUT2-positive cells and that this effect is highly significant in
comparison with the mismatch siRNA (p<0.001).
[0193] The results of these experiments demonstrate the specific
effectiveness of the siRNAs directed against VGLUT2 (si-rVGLUT2
100-120 EGT; si-rVGLUT2 100-120 AMB; si-rVGLUT2 166-186 AMB). There
is no difference between the self-produced siRNA (si-rVGLUT2
100-120 AMB) and the siRNA synthesized by Eurogentec (si-rVGLUT2
100-120 EGT). The siRNA controls against VGLUT1 (si-rVGLUT1 739-759
EGT) and against VGLUT3 (si-rVGLUT3 220-240 EGT) do not lead to a
reduction in the VGLUT2 protein level. What is known as the
mismatch siRNA (si-rVGLUT2 MM EGT), which has the same nucleotides
as the specific siRNA against VGLUT2, but in a random and therefore
non-complementary arrangement, does not influence the VGLUT2
protein level either.
[0194] In these experiments, the efficiencies of the specific
siRNAs lie between .about.15 and .about.80%. High siRNA
efficiencies (78 to 82%) are achieved with simultaneous
co-transfection of siRNA and DNA, whereas lower efficiencies (15 to
23%) are achieved in the suppression experiments with existing
VGLUT2 protein levels at the moment of siRNA transfection. This
shows that, firstly, the specific siRNAs highly efficiently reduce
VGLUT2 protein formation and, secondly, the VGLUT2 proteins are
very stable and have only a low turnover.
Example 3
Characterization of VGLUT Expression in Primary Cultures of the
Spinal Ganglion
[0195] The spinal ganglia from neonatal rats were prepared and
cultivated as described under the experimental conditions recited
in more detail after the practical examples. 20 to 30 respective
spinal ganglia from 8 to 16 neonatal rats were prepared for the
cultures and the cells were purified. The proportions of neurons in
the total number of cells was significantly increased relative to
the standard procedure by purification over a BSA column, and by
plating out the cell suspension onto poly-L-lysine-coated materials
(Grothe and Unsicker, 1987). The neurons, which are much larger and
therefore heavier than the non-neuronal cells, settle more rapidly
on the coated support. The number of non-neuronal cells, which
present predominantly as spindle-shaped cells with branches, is
reduced after only 5 min by removing the supernatant. After 4 to 10
days in vitro, the cells were fixed and characterized
immunocytochemically.
[0196] FIG. 20 shows the cultivated cells of the spinal ganglion.
The various cell types may be distinguished by their morphology
using a light microscope (A). The neurons may be detected by their
spherical configuration and the clear optical refraction while the
majority of non-neuronal cells are spindle-shaped fibroblasts. The
neurons could also be depicted immunocytochemically with primary
antibodies against the pan-neuronal label, "protein gene product
9.5" (PGP 9.5) (B). The cultures also contained a few Schwann cells
which were identified by antibodies against GFAP (C).
[0197] As the primary sensory nociceptive neurons would be of
particular interest for the subsequent experiments,
immunocytochemical labels indicated that this neuron population is
present in the primary culture and may be cultivated in vitro for
at least 8 days. FIG. 21 shows these neurons: peptidergic spinal
ganglion cells (A) with CGRP protein expression and heat-sensitive
neurons which express the ion channels (B) TRPV1 and (C) TRPV2.
[0198] FIG. 22 shows the expression of VGLUT2 (A-C, green signal)
in cells of the DRG primary culture. VGLUT2 is expressed in neurons
therein (B), all VGLUT2 positive cells also being positive for the
neuron label PGP9.5 (yellow signal) but not all PGP9.5-positive
cells being VGLUT2-positive (red signal). Co-expression of VGLUT2
in Schwann cells could be ruled out by co-labelling with the used
antibodies against GFAP (C, red signal).
[0199] Protein expression behaves in a corresponding manner for
VGLUT1 (not shown): VGLUT1 is expressed in a subpopulation of
PGP9.5-positive neurons and does not occur in Schwann cells.
[0200] The expression of the vesicular glutamate transporters
VGLUT1 and VGLUT2 was then investigated in peptidergic
CGRP-positive neurons (FIG. 23): VGLUT1 (green) and CGRP (red) are
expressed in two different cell populations (C, F), whereas VGLUT2
and CGRP coexist (I, M). It can be seen that all CGRP
immune-reactive neurons have the vesicular glutamate transporter
VGLUT2. However, not all VGLUT2-positive neurons form the
neuropeptide CGRP.
[0201] Double immunofluorescence for VGLUT2 and TRVP1 was carried
out in order to investigate VGLUT2 expression in polymodal
nociceptors. As shown in FIG. 24, all TRPV1-positive neurons use
the vesicular glutamate transporter VGLUT2 (C, D). VGLUT2 was found
predominantly in the cell soma and the axon (D). FIG. 24 (E, F)
shows the frequency distribution of the cell sizes of the
VGLUT2-positive neurons (E) and the TRPV1-positive neurons (F). It
can be seen that TRPV1-postive neurons, with an average cell size
.about.180 .mu.m.sup.2, make up a sub-population of the smaller and
medium-sized VGLUT2-positive neurons which have an average cell
size of .about.200 .mu.m.sup.2.
Example 4
In vivo Experiments on the Effectiveness of siRNA Against VGLUT2
During Pain Treatment in vivo
[0202] Bennett's pain model of the rat was used for this purpose.
The analgesic effect of the siRNA according to the invention was
investigated in vivo in the rat model. An SiRNA directed against
the target sequence of VGLUT2 AAGCAGGATAACCGAGAGACC was used as the
active component for this purpose. The two strands of this
double-stranded siRNA have the following sequences:
r(GCAGGAUAACCGAGAGACC)dTT and r(GGUCUCUCGGUUAUCCUGC)d (TT).
[0203] The control siRNA is directed against the following target
sequence (AACGACTAGCAAAGCGAGCCA) (no VGLUT2 sequence). The strands
of the double-stranded control siRNA each have the following
sequences: r(GGACUAGCAAAGCGAGCCA)d(TT) and
r(UGGCUCGCUUUGCUAGUCC)d(TT).
[0204] All the aforementioned sequences were chemically synthesized
(Xeragon, Germantown, SA) and their purity checked by MALDI-TOF
analysis. The sequences were dissolved in 0.9% NaCl solution.
[0205] Neuropathic pain occurs inter alia after damage to
peripheral or central nerves and may accordingly be induced and
observed by intentional lesions to individual nerves in animal
experiments. Bennett's nerve lesion (Bennett and Xie 1988) Pain 33:
87-107) is one animal model. In Bennett's model, the sciatic nerve
is provided unilaterally with loose ligatures. The development of
signs of neuropathic pain is observed and may be quantified by
thermal or mechanical allodynia.
[0206] For this purpose, five male Sprague-Dawley rats (Janvier,
France) weighing 140 to 160 g were initially anaesthetized with
Pentobarbital (50 mg per kg body weight of the rat Nembutal.RTM.,
i.p. Sanofi, Wirtschaftsgenossenschaft deutscher Tierarzte eG,
Hanover, Germany). One-sided multiple ligatures were then formed on
the right-hand main sciatic nerve of the rat. For this purpose the
sciatic nerve was exposed halfway along the femur and four loose
ligatures (softcat.RTM. chrom USP 4/0, metric2, Braun Melsungen,
Germany) were bound round the sciatic nerve in such a way that the
epineural circulation of blood was not interrupted. The date of the
operation was day 1. Measurements were taken I week after ligature
of the nerve.
[0207] The allodynia was tested on a metal plate of which the
temperature was controlled to 4.degree. C. by means of a water
bath. To check the allodynia, the rats were placed on the cold
metal plate, which was located in a plastic cage. The frequency
with which the animals flinched violently from the cooled metal
plate with their damaged paw was then counted over a period of 2
minutes prior to application of a solution (preliminary value). The
solutions containing 3.16 .mu.g (5 .mu.l) of siRNA according to the
invention in 15 .mu.l NaCl or 3.16 .mu.g (5 .mu.l) control RNA
(sense strand of the siRNA) in 15 .mu.l NaCl i.t. or NaCl solutions
(5 .mu.l) were then applied for control purposes after a single
acute intrathecal application under ether narcosis, and the number
of retraction reactions was again counted for 2 min after 60 min in
each case (test value). The measurements were taken on 4 successive
days at respective intervals of 24 hours (days 2-5) for 3 different
respective doses (0.001, 0.01 and 0.1 .mu.g/animal). Animals to
which pure NaCl solution was applied were used in the experiments
both with siRNA and with control RNA as a comparison group.
[0208] The siRNA according to the invention against VGLUT2 showed a
pronounced analgesic effect in this pain model, namely clear
inhibition of cold allodynia without dose dependency with the best
effect with the lowest dose group (1 ng/animal). With the highest
dose, the animals showed increased spontaneous activity both in the
control group and in the verum group. This could be the reason for
the weaker effect in the high dose group. There were no further
side effects (cf. FIG. 28).
[0209] The materials and methods used and mentioned in the
aforementioned practical examples and specific experimental
conditions are described in more detail hereinafter:
[0210] 1. Materials Used
1.1 Experimental Animals
[0211] All adult experimental animals were male or female Wistar
rats (300 g) and were obtained from Charles River (Sulzfeld) and
from the German Experimental Animal Institute (Hanover). The
animals were kept in a 12 h/12 h day/night rhythm with free access
to food and water. At least 4 days, in which the health of the
animals was monitored, elapsed between supply of the animals and
the beginning of the experiment. The neonatal rats originated from
an individual breed of male and female Wistar rats which were
covered at regular intervals. All neonatal animals were used for
the production of primary cultures from P0 (postnatal day 0) to
P5.
[0212] 1.2 Cell Lines
wt-PC12
[0213] The immortal tumour cell line PC12 was isolated from a
tumour of the adrenal marrow of the rat in 1976 (Greene and
Tischler, 1976). The cells grow in a non-adherent manner, lead to
transplantable tumours in rats and react reversibly to NGF (nerve
growth factor) with the formation of neuron-like projections. The
PC12 cell line was made available to Grunenthal's laboratory
(Aachen), which, in turn, obtained the cell line from ATCC. The
cells were cultivated in a modified DMEM medium. These PC12 cells
are designated hereinafter as wtPC12 (wild type) for better
distinction.
[0214] PC12 MR-A and PC12 MR-B
[0215] These two cell lines are mutated or differentiated variants
of the wt-PC12 cells which were originally obtained from Dr. Reiner
Westermann (Institute for Anatomy and Cell Biology, Marburg) from
ATCC. In contrast to their wt mutants, the cells grew adherently,
and were flat and spindle-shaped and formed projections without the
addition of NGF. References in the literature lead to the
assumption that these variants could form a glutamatergic phenotype
(Jimenez et al, 2003; Zheng et al, 1996). TABLE-US-00008 1.3
Bacterial strains E. coli strain DH5.alpha. Clontech (Heidelberg)
E. coli strain Xl-1 blue Clontech (Heidelberg)
[0216] TABLE-US-00009 1.4 Apparatus Centrifuges Biofuge pico type
table centrifuge Heraeus (Hanau) Labofuge III Heraeus (Hanau)
Cooling centrifuge, 5043 Eppendorf (Hamburg) JS21 centrifuge
Beckmann (Munich)
[0217] TABLE-US-00010 Incubators Incubation oven (16/37.degree. C.)
WTB Binder (Reiskirchen) Incubator (37.degree. C./5% CO.sub.2)
Heraeus (Hanau) Incubator (37.degree. C./5% CO.sub.2) Heraeus
(Hanau)
[0218] TABLE-US-00011 Electrophoresis Agarose gel electrophoresis
equipment Kodak/Integra (New Haven) Gel documentation equipment,
Gel Doc BIO-RAD (Munich) 1000
[0219] TABLE-US-00012 Microscope and digital image analysis
Confocal laser scanning microscope Olympus (Hamburg) AX70
Microscope Olympus (Hamburg) IX70 Microscope Olympus (Hamburg)
Olympus SZH10 research stereo Olympus (Hamburg) MCID M4 image
analysis system Imaging Research (St. Catherine's, Canada) SPOT
camera Diagnostics Instruments Inc. (Seoul, Korea) SPOT image
analyses (Version 3.4) Diagnostics Instruments Inc. (Seoul)
[0220] TABLE-US-00013 Other equipment and consumables Suction
device Neo-Lab, Vogel (Heidelberg) Autoclave Integra BioSciences
Inc. (Woburn, USA) Autoradiographic cassette Amersham (Little
Chalfont, England) Bacteria shaker Certomat H Braun Biotech
(Melsungen) Cover slips Menzel (Braunschweig) Disposable pipettes
Greiner bio-one (Frickhausen) Tissue culture bottles Cellstar .RTM.
Greiner bio-one (Frickhausen) Heating plate Medax (Kiel) Piston
pipettes Eppendorf (Hamburg) Cryotubes Nalge Nunc International
(Rochester USA) Cryostat CM3050 Leica (Nussloch) Neubauer counting
chamber Marienfeld (Lauda-Konigshofen) Object carrier Menzel
(Braunschweig) Peltier thermal cycler PTC-200 M J Research
(Watertown, USA) pH Meter 766 Knick (Berlin) Petridishes Nalge Nunc
International (Rochester, USA) Pipette tips Eppendorf (Hamburg)
Plastic baths Neolab, (Heidelberg) Water purifier (Milli-Q)
Millipore (Billerica, USA) Speedvac (cold trap) Heraeus (Hanau)
Stereotactic apparatus David Kopf Instruments (Tujunga, USA) 1040
polymax tumbler M J Research (New York, USA) Thermometer IKA
Labortechnik (Staufen) Circulating air oven Memmert (Schabach)
Video printer Mitsubishi Electric (Tokyo, Japan) Vortex: VF2 and
MS2 Minishaker IKA (Staufen) Vortex Genie 2 Bender & Hohenheim
AG (Zurich, Switzerland) 1012 MP balance Sartorius (Gottingen)
Julabo 5 water bath Julabo (Seelbach) Water bath Memmert (Schabach)
Nunclon .TM. cell culture dishes (Jun. 24, 1996 well) Nalge Nunc
International (Rochester, USA)
[0221] 1.5 Chemicals
[0222] Any chemicals not listed in detail here were obtained from
Fluka (Buchs, Switzerland), GibcoBRL (Eggenstein),
Merck(Darmstadt), Riedel de Haen (Seelze), Roche (Basel,
Switzerland), Roth (Karlsruhe), Serva (Heidelberg) and Sigma
(Deisenhofen), unless stated otherwise in the method section.
TABLE-US-00014 Bacto Agar Difco (Detroit, USA) Bacto Tryptone Difco
(Detroit, USA) Bacto Yeast Extract Difco (Detroit, USA) Fixing
solution Formamide BDH (Poole, England) NAOH Baker (Deventer,
Holland) Ketamine Parke-Davis (Freiburg) Paraffin Vogel Histo-Comp
x-GAL Invitrogen (Karlsruhe) Xylazin Bayer (Leverkusen)
[0223] 1.6 Buffer and Solutions TABLE-US-00015 H.sub.2O MilliQ
purified and autoclaved PBS (phosphate buffered saline): 6.5 mM
Na.sub.2HPO.sub.4 1.5 mM KH.sub.2PO.sub.4 2.5 mM KCl 140 mM NaCl pH
7.25 6 x sample buffer (DNA/RNA): 50% (w/v) glycerine 1 nM EDTA
0.4% (w/v) bromophenol blue 0.4% (w/v) xylene cyanol TE (tris EDTA)
10 mM tris-base 1 mM EDTA pH 8.0 TAE (tris-acetate-EDTA): 1 x TAE
40 mM tris base, 2 mM EDTA 50x 242 g tris base 57.1 ml glacial
acetic acid 37.2 g Na.sub.2EDTA .times. H.sub.2O ad 1 H.sub.2O pH
8.5
[0224] 1.7 Media and Media Additives
I. Basic Media
[0225] All media were obtained from GibcoBRL (Eggenstein):
[0226] DMEM (Dulbecco's modified Eagle Medium) with a high glucose
content TABLE-US-00016 Ham's F12 HBSS (10x)
Ca.sup.2+/Mg.sup.2+-free OptiMEM (serum-reduced) RPMI 1640 (Roswell
Park Memorial Institute)
[0227] II. Media Additives TABLE-US-00017 Antibiotic mix GibcoBRL
(Eggenstein) Cytosine arabinoside Sigma (Deisenhofen) Foetal calf
serum Sigma (Deisenhofen) HyClone FBS GibcoBRL (Eggenstein) HAT
supplement GibcoBRL (Eggenstein) Glutamine GibcoBRL (Eggenstein)
Horse serum GibcoBRL (Eggenstein) Nerve growth factor NGF 7S Sigma
(Deisenhofen)
[0228] Composition of the Growth Media
Medium for PC12 cells: RPMI with
[0229] 10% Horse serum
[0230] 5% FCS
[0231] 1% Glutamine (200 mM)
[0232] 1% Antibiotic mix (100.times.)
Medium for spinal ganglion cells: DMEM with
[0233] 10% FCS
[0234] 1% Antibiotic mix (100.times.)
[0235] 1% Glutamine
[0236] 10 .mu.M Cytosine arabinoside
[0237] 25 ng/ml NGF
[0238] 1.8 Enzymes and other proteins TABLE-US-00018 Collagenase
(267 U/ml) Seromed, Biochrom (Berlin) Dispase GibcoBRL (Eggenstein)
DNA-Polymerase AmpliTaq Gold .TM. Applied Biosystems (Foster City,
USA) DNase (LS002139) Worthington Poly-L-Lysine, Hydrobromide Sigma
(Deisenhofen) Poly-D-Lysine, MG >300 kDa Sigma (Deisenhofen)
Restriction endonucleases Boehringer (Mannheim) RNA-polymerases
(SP6, T3, T7) Boehringer (Mannheim) RNase-free DNase 1 Boehringer
(Mannheim) RNase (A, T1) Boehringer (Mannheim) RNAsin Fermentas
(Vilnius, Lithuania) Superscript .TM. 11 H-Reverse Transcriptase
GibcoBRL (Eggenstein) T4 DNA-Ligase Biolabs (Beverly, USA)
Trypsin/EDTA (0.5%/0.2%) GibcoBRL (Eggenstein) Trypsin GibcoBRL
(Eggenstein)
[0239] 1.9 Nucleic Acids and Vectors TABLE-US-00019 100
bp-DNA-ladder GibcoBRL (Eggenstein) 1 kb-DNA-ladder GibcoBRL
(Eggenstein) ATP, CTP, GTP, UTP GibcoBRL (Eggenstein) Transcript
vectors (pGEM-T) Promega (Madison, USA) Expression vectors (pCR3.1)
Invitrogen (Karlsruhe) Oligo (dT) 15-18 primer Boehringer
(Mannheim)
[0240] 1.10 Oligonucleotides
[0241] All oligonucleotides were designed with the oligo 4.0
programme itself, checked for undesirable sequence homology using
BLAST and the synthesis ordered from MWG-Biotech(Ebersberg).
TABLE-US-00020 PCR primer rVGLUT1 rVGluT1(2_4)F
5'-TCTGGGTTTCTGCATCAGC-3' PCR product size: 153 bp rVGluT1(2_4)R
5'-CCATGTATGAGGCCGACAGT-3' rVGLUT2 rVGluT2(8_9)F
5'-AAGACCCCATGGAGGAAGTT-3' PCR product size: 184 bp rVGluT2(8_9)R
5'-ATTGTCATGACCAGGTGTGG-3' rVGLUT3 rVGluT3(4_5)F
5'-ATCCAGAGACGGTGGGTCTT-3' PCR product size: 185 bp rVGluT3(4_5)R
5'-ATGACACAGCCGTAATGCAC-3' rGAPDH rGAPDH(7_8)F
5'-ATCCTGGGCTACACTGAGGA-3' PCR-Product size: 162 bp rGAPDH(7_8)R
5'-ATGTAGGCCATGAGGTCCAC-3' Primer for siRNA-synthesis using
siRNA-construction kit (Ambion): For siRNA si-rVGLUT2 100-120 AMB
rVGluT2 TS10 as 5'-AAGCAGGATAACCGAGAGACCCCTGTCTC-3' rVGluT2 TS10 s
5'-AAGGTCTCTCGGTTATCCTGCCCTGTCTC-3' For siRNA si-rVGLUT2 166-186
AMB rVGluT2 TS14 as 5'-AAGGCTCCGCTATGCGACTGTCCTGTCTC-3' rVGluT2
TS14 s 5'-AAACAGTCGCATAGCGGAGCCCCTGTCTC-3'
[0242] 1.11 Kits TABLE-US-00021 qPCR Core kit for SYBR .RTM. Green
Eurogentec (Liege, Belgium) RNeasy Mini Kit QIAGEN (Hilden)
Silencer .TM. siRNA Construction Kit Ambion (Austin, USA) Silencer
.TM. siRNA Labelling Kit Ambion (Austin, USA) QIAamp DNA Mini Kit
QIAGEN (Hilden) QIAprep spin MAxiprep Kit QIAGEN (Hilden) QIAprep
spin Miniprep Kit QIAGEN (Hilden) QIAquick Gel Extraction Kit
QIAGEN (Hilden) QIAquick Nucleotide Removal Kit QIAGEN (Hilden)
QIAquick PCR Purification Kit QIAGEN (Hilden) Vectastain Elite
Avdin-Biotin-Blocking Kit Vector Laboratories Vectastain Elite ABC
Kit Vector Laboratories
[0243] 1.12 Antibodies and Detection Systems
[0244] The various cell types were detected with primary antibodies
against generally recognized, readily characterized epitopes
(labels) in the respective cell type. These are PGP9.5 for neurons,
GFAP for astrocytes and S100 for oligodendrocytes. In addition to
these, further antibodies against specific proteins were used. The
optimum concentrations of the primary antibodies were titrated out
in each case. Table 1 gives an overview of the primary antibodies
used and also the working dilutions thereof.
[0245] The primary antibodies were then detected by
fluorochrome-coupled secondary antibodies or fluorochrome-coupled
streptavidin (Table 2) which interacted with species-specific
biotinylated antibodies. Cy3 (red fluorescence) or Alexa 488 (green
fluorescence) were used as fluorochromes. TABLE-US-00022 TABLE 1
List of primary antibodies used Antigen Internal Source Dilution
Species .beta.-III Tubulin Tubulin DPC/Biermann 1:4 Mouse, Bad
Nauheim monoclonal CGRP CGRP/Ste Fred Nyberg, 1:8000 Rabbit Stefan
Persson GFAP GFAP-Dako DakoCytomation 1:5000 Rabbit Denmark GFAP
GFAP Boehringer 1:4 Mouse, (Mannheim) monoclonal PGP9.5 PGP
UItraClone 1:1500 Rabbit, (Wellow, England) polyclonal S100 S100
Biogenesis prediluted Rabbit, (Poole, England) polycllonal
Substance P SP Lee Eiden (NIH, 1:1000 Rabbit USA) TRPV1 Caps.
receptor (SA 6583) Eurogentec 1:250 Rabbit (Belgium) TRPV VRL-1
Chemicon 1:400 Rabbit, Temecula, USA polyclonal VGLUT1 BNPI/BC66 J.
Erickson (New 1:600 Rabbit Orleans) (Varoqui et al., 2002b) VGLUT1
BNPI/p437/7/01 J. Erickson (New 1:800 Guinea pig Orleans) (Varoqui
et al., 2002b) VGLUT2 NPI/p438/7/01 J. Erickson (New 1:800 Guinea
pig Orleans) (Varoqui et al., 2002b) VGLUT2 DNPI/DC68 J. Erickson
(New 1:100 Rabbit Orleans) (Varoqui et al., 2002b) VGLUT3
VGLUT3/447/b19 J. Erickson (New 1:600 Guinea pig Orleans) (Schafer
et al., 2002) VGLUT3 VGLUT3/94/b15 affi. J. Erickson (New 1:50
Rabbit Orleans) (Schafer et al., 2002) VGL VGLUT3 Chemicon 1:5000
Guinea pig, UT3 Chemicon (Temecula, USA) polyclonal
[0246] The biotinylated Isolectin B4 (Sigma, Deisenhofen) was also
used in a concentration of 1:20. TABLE-US-00023 TABLE 2 List of
secondary antibodies used Antibody Source Dilution A. D Anti-guinea
pig-IgG-Cy3 Dianova (Hamburg) 1:100 Donkey Anti-mouse-IgG-Cy3
Dianova (Hamburg) 1:100 Donkey Anti-rabbit-IgG-Cy3 Dianova
(Hamburg) 1:100 Donkey Anti-guinea pig-IgG-A488 Dianova (Hamburg)
1:100 Donkey Anti-mouse-IgG-A488 Dianova (Hamburg) 1:100 Donkey
Anti-rabbit-IgG-A488 Dianova (Hamburg) 1:100 Donkey
Avdin-biotin-peroxidase Boehrinher 1:500 Donkey Streptavidin-Alexa
488 MoBiTec (Gottingen) 1:200 Donkey
[0247] 2. Methods
2.1 Removal and Treatment of Tissue
[0248] The animals were killed by CO.sub.2 inhalation and
subsequent decapitation. The tissue required for the various
purposes was then removed in different ways:
[0249] Nucleic Acid Extraction:
[0250] After removal, the tissue was spread over ice, placed in a
cryotube and, after shock-freezing in liquid nitrogen, the tissue
was initially stored on dry ice and then at -70.degree. C.
[0251] Primary Culture:
[0252] For the application of primary cultures, the tissue (spinal
ganglia) was immediately removed on self-produced ice-cooled
preparation dishes and initially collected in 1.times. CMF medium
for further treatment. The calcium-free and magnesium-free 1.times.
CMF medium consisted of 10% HBSS (10.times.), 1% antibiotic mix and
0.2% phenol red (0.5%). The pH was titrated with bicarbonate (7.5%)
and could be detected by the cherry-red color of the indicator.
[0253] 2.2 Application of Primary Cultures
[0254] For application of the primary cultures, neonatal rats from
stages P0 to P5 were used for the spinal ganglion cell culture and
P0 to P3 for the cerebellum cultures. The animals were disinfected
with alcohol and killed by decapitation with sterile shears.
[0255] 2.2.1 Neuronal Primary Cultures of Spinal Ganglia
[0256] The spinal ganglia were prepared by C-Grothe's modified
procedure (Grothe and Unsicker, 1987).
[0257] Dissection of the Spinal Ganglia
[0258] The body of the killed rat was fixed ventrally on a cork
board and the vertebral column exposed by removing the skin and the
muscles at the back of the neck and shoulders. The vertebral column
was then opened from the caudal end to the cranial end and the bone
marrow displayed. In the juvenile animals, the bone marrow was left
in the spinal canal and the opened vertebral column removed in its
entirety for fixing in a cooled preparation dish. Only then was the
bone marrow carefully removed in steps and the spinal ganglia taken
from the exposed intervertebral holes.
[0259] The dissected spinal ganglia were collected in a cooled
Petri dish with 1.times. CMF medium until fine preparation. The
spinal ganglion was cleaned of nerves, connective tissue and blood
residues under the binocular device, and was then transferred into
an ice-cooled tube filled with 1.times. CMF medium.
[0260] Dissociation and Purification of the Spinal Ganglion
Cells
[0261] After removal of the medium, the spinal ganglia were
incubated for 30 to 45 min at 37.degree. C. and 5% CO.sub.2 for
chemical dissociation with an enzyme mixture of 0.075% collagenase
and 0.15% dispase in CMF medium. Adhesion of the ganglia was to be
prevented by repeated shaking during incubation. Half of the enzyme
mixture was removed on completion of incubation and the same volume
of a 0.25% trypsin solution fed to the remaining residue. After
incubation for 15 to 25 min at 37.degree. C. and 5% CO.sub.2, the
enzyme solution was removed to 300 .mu.l and the ganglia in this
volume were mechanically dissociated. Three siliconized sterile
Pasteur pipette orifices of different sizes, produced under the
Bunsen burner flame were used for this purpose. By increasingly
reducing the orifice diameter, a uniform cell suspension of the
spinal ganglia could be produced. The cell suspension was finally
centrifuged for 5 min at 1000 rpm, the supernatant discarded and
the cell pellet resuspended in .about.1 ml CMF. To concentrate the
culture with neuronal cells, the cell suspension was coated over a
20% BSA column (20% BSA w/v in 0.5 ml CMF medium) and then
centrifuged for 5 min at 1000 rpm. The medium was suction filtered
to .about.100 .mu.l and resuspended in 1 ml fresh medium. The later
culture medium (DMEM/FCS) was used for this purpose.
[0262] Plating Out of the Cells
[0263] After determining the number of cells, the spinal ganglion
cells were distributed over the culture vessels, according to the
subsequent use, and cultivated at 37.degree. C. in 5% CO.sub.2. A
glucose-rich DMEM medium with various additives was used for
cultivation purposes (exact composition described under the
heading: Cell Culture). In addition to glutamine and an antibiotic
mix, the nerve growth factor NGF 7S was supplied in a concentration
of 25 ng/ml, as the survival and the differentiation of the
neonatal neurons of the spinal ganglion are NGF-dependent. In
addition, the mitose inhibitor, cytosine arabinoside, was added in
a concentration of 10 .mu.M to the medium to prevent proliferation
of the non-neuronal cells. The plated out spinal ganglion cells
could be cultivated without difficulty for up to 2 weeks by
changing the medium every 2 to 3 days.
[0264] 2.3 Eukaryotic Cell Culture
Cultivation and Passaging of Eukaryotic Cells
[0265] All the aforementioned cell lines work best in their
respective growth medium at 37.degree. C. in the gasification
incubator at 95% relative atmospheric humidity and 5% CO.sub.2.
Media and solutions were heated to 37.degree. C. prior to use.
[0266] The adherently growing cell lines (F-11, wt-PC12 MR-A, PC12
MR-B) were routinely split every 4 to 6 days. For this purpose,
they were treated with trypsin/EDTA solution (0.05% trypsin, 0.02%
EDTA in PBS) for a few minutes at 37.degree. C. (microscopic
control). Trypsin is a proteolytic enzyme which hydrolyses peptide
bonds of cell/cell bonds in which the carbonyl group is taken from
the lysine or arginine. Slight traces of medium can impair the
effect of trypsin, which is why the cells had to be washed with
phosphate-buffered calcium-free and magnesium-free salt solution
(PBS) prior to the trypsin treatment. The trypsin used could be
inactivated again by addition of medium with addition of FCS. The
chelator EDTA binds calcium which is required by some cell/cell
bonds.
[0267] Once the cells had dissolved, they were transferred with
serum-containing medium from the culture vessel into a Falcon tube.
After centrifuging and suction filtering the old medium, the cell
pellets were resuspended in 5 ml fresh medium and plated out into
the respective culture vessels in their growth medium, depending on
the subsequent use.
[0268] The wt-PC12 cells are suspension cells. For passaging, the
culture vessels were placed obliquely so the wt-PC12 cells growing
in grape-like heaps sedimented gradually in a corner of the vessel.
The supernatant, which also contained the lighter cell debris, was
removed and the cells transferred into a Falcon tube with fresh
medium. The suspension was then centrifuged for 5 min at 1000 rpm,
the supernatant was removed and the cells were plated out in fresh
growth medium.
[0269] Freezing of Eukaryotic Cells
[0270] The cells were frozen in DMSO-containing medium in liquid
nitrogen for long-term storage, in order to protect them from
genetic modification and to minimize the risk of contamination.
Without the addition of reagents, which act as cryoprotection for
the cells, most mammalian cells die when frozen. The mortality of
cells is minimized by DMSO in the medium, as the freezing point is
lowered and the cooling process therefore decelerated.
[0271] After separation with trypsin/EDTA solution, the cells were
initially washed with PBS and the number of cells determined using
the Neubauer counting chamber. The amount of cells to be frozen was
placed in a Falcon tube, and the supernatant discarded after
centrifugation at 1000 rpm. The cell pellet was finally resuspended
in the freezing medium (90% growth medium, 10% DMSO) and aliquoted
in Nunc tubes with 2 ml in each case (for example with 2 million
cells). The tubes were frozen at -80.degree. C. for several hours
in a cryofreezing unit with a cooling rate of 1.degree. C. per
minute and were then stored in liquid nitrogen.
[0272] Revitalization of Eukaryotic Cells
[0273] In some cases, cells were recultivated. For this purpose,
they were heated rapidly to 37.degree. C. in a water bath after
removal from the nitrogen tank (-196.degree. C.). The cell
suspension was removed, transferred into 5 ml preheated medium and
sedimented in the centrifuge (3 min, 200.times.g). The medium was
suction filtered, the target pellet resuspended in fresh medium and
transferred into a cell culture dish. On the next day, the cells
were washed with PPS and supplied with fresh medium.
[0274] Determination of Number of Cells
[0275] A Neubauer counting chamber was used to determine the number
of cells. For this purpose, a drop of the cell suspension was
applied to the Neubauer counting chamber and the number of cells
(Z=cells/0.01 mm.sup.2) counted out under the microscope from four
corner squares and the number of cells per ml determined (number of
cells=Z.times.2500) (Amiri et al.).
[0276] Mycoplasm Test
[0277] All cell lines were tested at regular intervals for
mycoplasm contamination. Mycoplasms are obligate parasitic
bacteria. They are wall-less, very small intracellular parasites
and cannot propagate independently of the host cell. As they have
only one cell membrane, but no bacterial wall of murein, they do
not have a fixed form and are insensitive to penicillin. Their size
varies between 0.22 and 2 .mu.m. Filtration through a membrane with
a pore size of 0.1 .mu.m allows separation of mycoplasm.
Contamination with mycoplasm may be detected most rapidly by
staining the mycoplasm DNA with the fluorochrome DAPI
(4-6-diamidino-2-phenylindol-di-hydrochloride) which binds
specifically to DNA. In the case of mycoplasm contamination of cell
cultures, individual fluorescing points are found in the cytoplasm
and sometimes also in the intercellular space.
[0278] For the mycoplasm test, a corresponding amount of DAPI stock
solution (1 mg/ml, 10 mg DAPI dissolved in 10 ml water, aliquoted
and stored at -20.degree. C.) was diluted with methanol to a
working concentration of 1 .mu.g/ml (stable for about 6 months at
4.degree. C.). To stain the cells, the cells cultivated on cover
slips or Petri dishes were washed once with the working solution
and incubated for 15 min at ambient temperature with the working
solution. The solution was washed once with methanol and the cover
slips were embedded in a drop of glycerine or PBS then evaluated
under the fluorescence microscope.
[0279] Coating of Culture Vessels
[0280] For certain experiments, the culture vessels or cover slips
were coated to assist adhesion of the cells. As coating materials,
poly-L-lysine (0.1 mg/ml) was used for wt-PC12 cells or
poly-D-lysine (0.5 mg/ml) for the cerebellum culture. The culture
vessels were incubated for at least 2 hours at ambient temperature
with poly-L-lysine and poly-D-lysine, then washed twice with
H.sub.2O and coated with H.sub.2O and stored at 4.degree. C. until
use. Whereas the poly-L-lysine coated materials were used in the
moist state, the poly-D-lysine coated materials were not used until
they had been dried under the sterile bench.
[0281] Transfection in Eukaryotic Cells
[0282] Transfection is understood to be the introduction of
extraneous DNA or RNA into eukaryotic cells by physical or chemical
methods. The most important chemical method for the transfer of
nucleic acids is lipofection: reagents from cationic lipids form
small (100-400 mm) unilamellar liposomes under optimum conditions
in aqueous solution. The surface of these liposomes is positively
charged and is electrostatically attracted both by the phosphate
backbone of the nucleic acids and by the negatively charged cell
membrane (Gareis et al., 1991; Gershon et al., 1993; Smith et al.,
1993). The nucleic acids are not enclosed within the liposomes, but
bind spontaneously to the positively charged liposomes and form
DNA/RNA lipid complexes (Felgner et al., 1987). There are
indications that the complexes are incorporated via the endosomal
or lysosomal pathway (Coonrod et al., 1997).
[0283] Transfection of DNA by Liptofectamine.TM. 2000
[0284] For the transfection of DNA in eukaryotic cells, the
cationic lipid reagent Liptofectamine.TM. 2000 (LF2000.TM.) was
predominantly used, while adhering to the following general
recommendations from the manufacturer, Invitrogen:
[0285] A DNA to LF2000.TM. ratio of 1:2 to 1:3 was recommended for
producing DNA-LF2000.TM. complexes. A cell density of 90 to 95%
should exist at the moment of transfection, to achieve high
efficiency and a high expression level. Antibiotics were not added
during transfection, as they would trigger cell death. Transfection
under various conditions was carried out with an EGFP vector to
optimize the efficiency of transfection. To measure the efficiency
of transfection, the protein expression of the green fluorescing
protein GFP was determined semi-quantitatively using a fluorescence
microscope.
[0286] Tranfection of DNA in wt-PC12 Cells
[0287] 2.5.times.10.sup.5 wt-PC12 cells were plated out in a
24-well plate on poly-L-lysine-coated cover slips in 0.5 ml medium
on the day before transfection. The medium was the normal growth
medium for wt-PC12 cells, but without the addition of antibiotics.
0.8-1 .mu.g DNA was dissolved in 50 .mu.l OPTI-MEM.RTM. for each
well to be transfected. In addition, 1-2 .mu.l LF2000.TM. were
diluted in 50 .mu.l OPTI-MEM.RTM. for each well and incubated for 5
min at ambient temperature. The dissolved DNA was now mixed with
the diluted LF2000.TM. solution and incubated for 20 min at ambient
temperature to form the DNA-LF2000.TM. complexes, and 100 .mu.l of
the complexes then placed directly in the corresponding wells,
which were mixed by careful swinging. The cells were cultivated for
a further 24-72 hours in the same medium under normal conditions
until analysis of the expression.
[0288] Transfection of DNA in Spinal Ganglion Cells
[0289] For transfection, 5.times.10.sup.5 die cells of the freshly
purified DRG suspension were used, which were plated out in a
24-well plate on poly-L-lysine-coated cover slips in 0.5 ml growth
medium without the addition of antibiotics. 0.8-1 .mu.g DNA was
dissolved in 50 .mu.l OPTI-MEM.RTM. for each well to be
transfected. In addition, 1-2 .mu.l LF2000.TM. were diluted in 50
.mu.l OPTI-MEM.RTM. for each well and incubated for 5 min at
ambient temperature. The dissolved DNA was now mixed with the
diluted LF2000.TM. solution and incubated for 20 min at ambient
temperature to form the DNA-LF2000.TM. complexes, and 100 .mu.l of
the complexes then placed directly in the corresponding wells,
which were mixed by careful swinging. The cells were cultivated for
a further 24-72 hours in the same medium under normal conditions
until analysis of the expression.
[0290] Transfection of siRNA
[0291] The transfection of siRNA in eukaryotic cells was carried
out using Lipofectamine.TM. 2000. LF2000.TM. has already been
successfully used for RNAi experiments in mammalian cells by other
groups (Gitlin et al., 2002; Yu et al., 2002). As with the
transfection of DNA, the optimum transfection conditions had to be
determined experimentally. Cy3-labelled siRNA was used for this
purpose.
[0292] Transfection of siRNA in wt-PC12 Cells
[0293] 2.5.times.10.sup.5 wt-PC12 cells were plated out in a
24-well plate on poly-L-lysine-coated cover slips in 0.5 ml medium
on the day before transfection. The medium was the normal growth
medium for wt-PC12 cells, but without the addition of antibiotics.
20-100 pmol siRNA were dissolved in 50 .mu.l OPTI-MEM.RTM. for each
well to be transfected. In addition, 1-2 .mu.l LF2000.TM. were
diluted in 50 .mu.l OPTI-MEM.RTM. for each well and incubated for 5
min at ambient temperature. The dissolved siRNA was now mixed with
the diluted LF2000.TM. solution and incubated for 20 min at ambient
temperature to form the DNA-LF2000.TM. complexes, and 100 .mu.l of
the complexes then placed directly in the corresponding wells,
which were mixed by careful swinging. The cells were cultivated for
a further 24-72 hours in the same medium under normal conditions
until analysis of the expression.
[0294] Transfection of siRNA in Cells of the PC12 MR-A and PC12
MR-B Lines
[0295] 2.5.times.10.sup.5 PC12 cells were plated out in a 24-well
plate on cover slips in 0.5 ml medium on the day before
transfection. The medium was the normal growth medium for PC12
MR-A/B cells, but without the addition of antibiotics. 20-200 pmol
siRNA were dissolved in 50 .mu.l OPTI-MEM.RTM. for each well to be
transfected. In addition, 1-2 .mu.l LF2000.TM. were diluted in 50
.mu.l OPTI-MEM.RTM. for each well and incubated for 5 min at
ambient temperature. The dissolved siRNA was now mixed with the
diluted LF2000.TM. solution and incubated for 20 min at ambient
temperature to form the DNA-LF2000.TM. complexes, and 100 .mu.l of
the complexes then placed directly in the corresponding wells,
which were mixed by careful swinging. The cells were cultivated for
a further 24-72 hours in the same medium under normal conditions
until analysis of the expression.
[0296] Transfection of siRNA in Cells of the DRG Primary
Cultures
[0297] For transfection, 5.times.10.sup.5 die cells of the freshly
purified DRG suspension were used, which were plated out in a
24-well plate on poly-L-lysine-coated cover slips in 0.5 ml growth
medium without the addition of antibiotics. 20-200 pmol siRNA were
dissolved in 50 .mu.l OPTI-MEM.RTM. for each well to be
transfected. In addition, 1-2 .mu.l LF2000.TM. were diluted in 50
.mu.l OPTI-MEM.RTM. for each well and incubated for 5 min at
ambient temperature. The dissolved siRNA was now mixed with the
diluted LF2000.TM. solution and incubated for 20 min at ambient
temperature to form the DNA-LF2000.TM. complexes, and 100 .mu.l of
the complexes then placed directly in the corresponding wells,
which were mixed by careful swinging. The cells were cultivated for
a further 24-72 hours in the same medium under normal conditions
until analysis of the expression.
[0298] Toxicity Study
[0299] An assay with trypan blue was carried out to investigate the
cytotoxic influence of the transfection reagent LF2000.TM. on the
cells. For this purpose, 3.0.times.10.sup.4 cells were plated out
in a 24-well plate 24 hours before transfection. Transfection was
carried out with siRNA negative controls and different amounts of
transfection reagents. All cells were washed with PBS 48 hours
after transfection and stained with 10% trypan blue. The survival
rate was calculated as follows: Vitality rate=(total number of
cells-number of stained cells)/total number of cells.times.100.
[0300] Fixing of Cells
[0301] The cells were fixed either for 20 min at ambient
temperature in PBS with 3-4% (v/v) paraformaldehyde or for 15 min
at ambient temperature with methanol (-20% .degree. C).
[0302] 2.4 Microbiology
[0303] Competent bacteria were used to amplify double-stranded DNA
fragments. For this purpose, the DNA to be amplified was
incorporated into plasmids with selection labels and transformed
into bacteria. Bacteria were plated out on selective agar plates
and corresponding clones were removed and cultured in
antibiotic-containing LB medium. The plasmids with insert were
later isolated from the propagated bacteria and further
processed.
[0304] Production of Transformation-Competent Cells
[0305] Treatment with ice-cold magnesium and calcium chloride
solution enables the bacteria to absorb extraneous DNA
spontaneously (transformation). The E. coli strains DH5.alpha. and
XL-1 blue were used to produce the competent bacterial cells. For
this purpose, a cell culture was placed in TYM medium (LB-medium+10
mM MgSO.sub.4) and incubated until an adequate density (OD600
nm=0.4-0.6) was achieved. The cells should be in the log phase.
After brief centrifugation and pouring off the supernatant, the
pellet was resuspended in 40 ml Tfb1-buffer (30 mM KAc, 50 nM
MgCl.sub.2.times.2H.sub.2O, 100 mM KCl, 10 mM
CaCl.sub.2.times.2H.sub.2O, 15% glycerol) per 100 ml culture. After
45 min incubation on ice, the cells were pelletized again and
incorporated in 1/10 volume Tfb2-buffer (10 mM Na-MOPS, 10 mM KCl,
75 mM CaCl.sub.2.times.2H.sub.2O, 15% glycerol). The competent
cells were stored as 100 .mu.l aliquots at -70.degree. C. until
use.
[0306] Transformation of E. coli
[0307] Competent bacteria (approximately 10.sup.8 clones per .mu.g
plasmid DNA) were reacted with plasmid DNA, and incubated for 45
min on ice and just 1 min at 42.degree. C. LB medium (Sambrook et
al., 1989) was then added and the mixture incubated for a further
30 min at 37.degree. C. while shaking. The bacteria were separated
on selective agar plates (Sambrook et al., 1989) and incubated
overnight at 37.degree. C. Precultures (5 ml LB medium with a
suitable antibiotic) were inoculated with separated colonies and
shaken for several hours at 37.degree. C. Preparatory cultures (100
ml LB with a suitable antibiotic) were inoculated 1:1000 with the
precultures and incubated overnight at 37.degree. C. while
shaking.
[0308] Analytical Plasmid Isolation
[0309] In order to isolate the plasmids from the bacteria, the
bacteria have to be lysed. The plasmids are then separated by
centrifugation of proteins and genomic bacteria-DNA. The plasmids
were purified by column chromatography with commercial kits from
Qiagen. The bacteria were pelletized by centrifugation for 5 min at
5000.times.g, the supernatant was discarded and the pellet
resuspended in 250 .mu.l buffer P1. The bacteria were lysed by
addition of 250 .mu.l buffer P2 and the solution was neutralized by
a further 350 .mu.l buffer N3. The mixture was then centrifuged for
10 min (the centrifugation steps were carried out at maximum speed,
unless otherwise stated), the supernatant being carefully removed
and transferred into a QIAprep column. After 1 min centrifugation,
the column was again washed with 750 .mu.l buffer PE and in turn
centrifuged for 1 min. The plasmid DNA was eluted into a clean
receiver by addition of 30-50 .mu.l H.sub.2O onto the column and
subsequent centrifugation for 1 min. For quality control, 5 to 10
ml of this mixture were analysed by restriction digestion and
subsequent agarose gel electrophoresis.
[0310] Quantitative Plasmid Isolation
[0311] Relatively large amounts of plasmid DNA with a high degree
of purity for carrying out transfections were isolated using the
Qiagen Plasmid Maxi Kit. For this purpose, a preculture was
prepared during the day, i.e. a bacterial colony was inoculated in
3 ml ampicillin-containing medium and cultivated for approximately
7 hours in the shaking incubator at 37.degree. C. This preculture
was then transferred into 500 ml LB medium and shaken overnight at
37.degree. C. The bacterial suspension was centrifuged off at
4.degree. C. at 3000 rpm the next morning. The resultant bacterial
pellet was used for plasmid isolation following the manufacturer's
directions.
[0312] After absorption of the DNA pellets in sterile H.sub.2O, the
concentration was determined platemetrically and the DNA quality
checked by restriction digestion and subsequent agarose gel
electrophoresis.
[0313] 2.5 Molecular Biological Methods
2.5.1 Nucleic Acids
Purification of DNA
[0314] Nucleic acids may be concentrated from dilute aqueous
solutions or purified from non-precipitable substances by salt
formation and subsequent alcohol precipitation or by purification
using silica get columns (QIAGEN). An advantage of the first method
is, for example, the possibility of concentrating the nucleic acid
during absorption in the eluate after drying. Advantages of
purification using columns include the ease of handling.
[0315] Precipitation of DNA
[0316] 1:10 volumes of 3 M sodium acetate (pH 5.2) and 3 volumes of
100% ethanol mixture were added to the DNA solution and stored at
-20.degree. C. for at least 4 hours. The mixture was then
centrifuged for 30 min at +4.degree. C. with 13,000.times.g, the
supernatant was discarded and the pellet resuspended by addition of
500 .mu.l 70% ethanol (-20.degree. C.). After a further
centrifugation step for 10 min (10 min, 13.000.times.g, 4.degree.
C.), the supernatant was discarded and the pellet dried for 10 min
in the precooled cold trap and finally dissolved in a corresponding
amount of water.
[0317] Purification of the PCR Amplificate DNA with the Qiagen PCR
Purification Kit
[0318] The PCR mixture was diluted in 5 volumes of buffer PB and
transferred onto the column after thorough mixing and centrifuged
for 1 min. 500 .mu.l of washing buffer PE were applied to the
column and again centrifuged. The bound DNA amplificates were
eluted in a clean receiver by addition of 30-50 .mu.l water onto
the column and by centrifugation.
[0319] Purification of Nucleic Acids from Agarose Gels with the
Qiagen Gel Extraction Kit
[0320] The agarose gel strips with the nucleic acid to be isolated
were cut out, weighed and a corresponding amount of buffer QX1 (3
volumes of the gel weight) was added. The gel was dissolved by 10
min incubation at 50.degree. C., the solution transferred onto a
column and centrifuged. After addition of 750 .mu.l washing buffer
PE and subsequent centrifugation, the bound nucleic acid was eluted
into a clean receiver by addition of 30-50 .mu.l water onto the
column and subsequent centrifugation.
[0321] Isolation and Purification of RNA
[0322] RNA was extracted from tissue and cells for analysis of
expression by means of RT-PCR. Extraction was carried out either by
the TRIzol chloroform method with corresponding RNA isolation kits
from Qiagen or Roche.
[0323] RNA Extraction Using TRIzol Reagent
[0324] During purification of RNA from tissue, the pieces of tissue
(<100 mg) were weighed out and homogenized with a glass pot
after addition of 1 ml TRIzol reagent. During RNA purification from
cultivated cells, 1 ml TRIzol reagent for 3.5 cm.sup.2 culture dish
monolayer or 1 ml TRIzol reagent for centrifuged suspension culture
(5-10.times.10.sup.6 cells) was applied directly to the cells and
homogenized by pipetting on and off. The TRIzol mixture was
incubated for approximately 5 min at ambient temperature. The
mixture was shaken vigorously after addition of 20 .mu.l
chloroform, incubated for a further 5 min and finally centrifuged
(20 min, 12000.times.g, 4.degree. C.), so three phases could form:
(a) RNA in the upper aqueous phase, (b) DNA in the middle
interphase and (c) protein in the lower organic phase.
[0325] The aqueous phase was carefully removed, without touching
the interphase, and reacted with 500 .mu.l 100% isopropanol. Brief
vortexing was followed by incubation for 10 min and subsequent
centrifugation (10 min, 16000.times.g, 4.degree. C.). The
supernatant was discarded and the pellet washed with 1 ml 70%
ethanol (-20.degree. C.) and re-pelletized (10 min, 12000.times.g,
4.degree. C.). The supernatant was discarded and the pellet dried
in the precooled cold trap. The RNA was finally dissolved in the
desired volume of water and stored at -80.degree. C.
[0326] RNA Extraction Using Qiagen RNeasy Mini Kit
[0327] 350 .mu.l buffer RLT were added to the cell pellet
(approximately 5.times.10.sup.6 cells) and the cell pellet
homogenized by Qiagen shredder columns. After addition of 350 .mu.l
70% ethanol and vigorous shaking, the suspension was applied to the
column and centrifuged (30 sec at 8000.times.g). The column was
washed by addition of 700 .mu.l buffer RW1 and centrifugation (30
sec at 8000.times.g). Washing was carried out twice by addition of
500 .mu.l buffer RPE in each case and centrifugation (30 sec,
8000.times.g). Washing was then carried out twice by addition of
500 .mu.l buffer RPE and centrifugation (30 sec, 8000.times.g) in
each case. The column was subsequently dried by centrifugation (2
min, 12000 rpm). The bound RNA was eluted by addition of 30 to 50
.mu.l water and centrifugation (1 min at 8000.times.g).
[0328] DNase-I-Treatment
[0329] To avoid possible DNA contamination of the purified RNA, the
RNA solution was treated enzymatically with DNase-I. For this
purpose, 4 .mu.l DNase-I and 6 .mu.l 10.times. transcription buffer
were added to 50 .mu.l RNA and incubated for 30 to 45 min at
37.degree. C. RNA purification was then carried out using QIAGEN
RNeasy mini columns.
[0330] Restriction Digestion
[0331] Restriction digestion was used to check whether the desired
insert is also contained in a plasmid. This may be cut out by the
digestion and identified by means of its size. Restriction
digestion was carried out using enzymes and reaction buffers from
GincoBRL/Eggenstein and Boehringer/Mannheim. 1 .mu.l plasmid DNA
was digested in a total volume of 20 .mu.l. The incubation time was
1 to 2 hours at a temperature corresponding to the optimum
temperature for the enzyme.
[0332] Quantification of Nucleic Acids
[0333] The concentration was detected using UV spectroplatemeters.
The concentration was calculated from the absorption at the
specific wavelength I (for RNA, oligonucleotides and DNA 260
nm).
[0334] A=d.times.e.times.c (A absorption; d layer thickness; e
material constant; c concentration). An OD260 of 1 corresponds to a
concentration of: 50 .mu.g/ml DNA, 40 .mu.g/ml RNA or 30 .mu.g/ml
oligonucleotide. Measurement was carried out in quartz vessels
which were thoroughly washed with autoclaved water between
measurements.
[0335] DNA Oligonucleotide Starting Materials for siRNA
Production
[0336] The oligonucleotide starting materials (ONV) were diluted in
nuclease-free water to a final concentration of 200 .mu.m, and the
absorption A was measured at 260 nm of a 1:250 dilution. By means
of the measured absorption, the ONV concentration B was calculated
in .mu.g/ml and B' in .mu.m: A.times.5000=B[.mu.g/ml] (5000=250
fold dilution.times.20 .mu.g oligo/ml/absorption unit)
B[.mu.g/ml]/9.7=B'[.mu.m] (29 nt.times.0.333 .mu.g/nmol for each
nt=9.7 .mu.g/nmol)
[0337] siRNA
[0338] To quantify the siRNA solutions, the absorption A was
measured at 260 nm of a 1:25 dilution. The siRNA concentration B in
.mu.g/ml and B' in .mu.M was calculated from the measured
absorption: A.times.1000=B[.mu.g/ml] (1000=25 fold
dilution.times.40 .mu.g siRNA/ml/absorption unit)
B[.mu.g/ml]/14=B'[.mu.m] (21 nt.times.2 strands=42 nt.times.0.333
.mu.g/nmol for each nt=14 .mu.g/nmol)
[0339] Quality Check by Agarose Gel Electrophoresis
[0340] 1 to 2 percent TAE agarose gels with 0.5 .mu.g/ml ethidium
bromide were used to separated plasmid DNA, restriction-digested
plasmid DNA, PCR products and RNA. Electrophoresis was carried out
in 1.times. TAE buffer (cf. 2.1.3). The samples and 1 .mu.g size
label ("100 bb DNA ladder" "1 kb DNA ladder") were reacted with 1/6
volume sample buffer and separated at 10 V/cm. Using the
intercalating dye, ethidium bromide, the DNA and RNA could be made
visible under UV light and documented plategraphically. To avoid
degeneration during the electrophoresis of RNA, both the chamber
and the comb were cleaned with ethanol and the flow buffer freshly
prepared with autoclaved DEPC-H.sub.2O.
[0341] 2.5.2 Reverse Transcription Polymerase Chain Reaction
(RT-PCR)
[0342] During reverse transcription, RNA is transcribed into cDNA.
Oligo(dT)15-18 primers, which bind specifically to the poly-A-tail
of the mRNA, for example, are used as a base for the reverse
transcriptase. Depending on the starting material, 0.5-2.5 .mu.g
RNA (dissolved in 11 .mu.l water) were mixed with 1 .mu.l 100 nm
oligo(dT) 15-18 primer and denatured for 10 min at 70.degree. C.
After cooling to 4.degree. C., 4 .mu.l 5.times. RT buffer, 2 .mu.l
100 nM DTT, 1 .mu.l 10 mM dNTP-Mix, 1 .mu.l RNAsin and 1 .mu.l
Superscript.TM. II (200 U/.mu.l) were added and incubation was
carried out at 42.degree. C. for 1 hours. The cDNA was stored at
-20.degree. C. until use.
[0343] 2.5.3 Polymerase Chain Reaction
[0344] The polymerase chain reaction (PCR) developed in 1987
enables nucleotide sequences determined in vitro to be
enzymatically copied a million times (Saiki et al., 1988). This
procedure, known as amplification, also enables very small amounts
of DNA to be analysed. The following reaction mixture was laid out
for a PCR reaction (25 .mu.l): TABLE-US-00024 10x buffer 2.5 .mu.l
(1x) MgCl.sub.2 (25 mM) 3 .mu.l (3 mM) dNTPs (10 mM) 0.5 .mu.l (0.2
mM) Primer mix (2 .mu.M) 5 .mu.l (0.4 .mu.M) cDNA/RNA 1 .mu.l Ampli
- TaqPolymerase (5 U/.mu.l) 0.1 .mu.l (0.5 U) H.sub.2O 12.9
.mu.l
The optimum MgCl.sub.2 concentration and the number of
amplification cycles were determined individually for each primer
pair (sequence, position and size of the amplicon are shown under
(0)). Before the start, denaturation was carried out for 1 min at
94.degree. C. and the duration of the individual steps of a cycle
was 20 sec in each case. The thermocycler (PTC-200 (MJ Research))
was used.
[0345] Standard PCR: TABLE-US-00025 95.degree. C. 2 min 95.degree.
C. 57.degree. C. 70.degree. C. ##STR1## 40x 70.degree. C. 5 min
+4.degree. C. .infin.
[0346] 2.5.4 Ligation
[0347] Ligation was carried out using the T4-DNA ligase (Promega).
The T4-DNA ligase is an enzyme which covalently bonds 3'- and 5'-
ends of linear DNA as a function of energy (ATP). Much less energy
is consumed with `cohesive-ended` overhangs than with `blunt-ended`
overhangs. Ligation was therefore carried out for 1 hour at ambient
temperature in the case of cohesive ends and overnight at 4.degree.
C. in the case of PCR products or DNA without overhangs. The pGEM-T
vector was used as the plasmid.
[0348] The foregoing description and examples have been set forth
merely to illustrate the invention and are not intended to be
limiting. Since modifications of the described embodiments
incorporating the spirit and substance of the invention may occur
to persons skilled in the art, the invention should be construed
broadly to include all variations within the scope of the appended
claims and equivalents thereof.
BIBLIOGRAPHY
[0349] (All documents cited in the present patent application also
form part of the disclosure of the present invention.) [0350]
Ahlquist, P. (2002). RNA-dependent RNA polymerases, viruses, and
RNA silencing. Science 296, 1270-1273. [0351] Aihara, Y., Mashima,
H., Onda, H., Hisano, S., Kasuya, H., Hori, T., Yamada, S., Tomura,
H., Yamada, Y., Inoue, I., et al. (2000). Molecular cloning of a
novel brain-type Na(+)-dependent inorganic phosphate cotransporter.
J Neurochem 74, 2622-2625. [0352] Amiri, A., Keiper, B. D.,
Kawasaki, I., Fan, Y., Kohara, Y., Rhoads, R. E., and Strome, S.
(2001). An isoform of eIF4E is a component of germ granules and is
required for spermatogenesis in C. elegans. Development 128,
3899-3912. [0353] Andres, K. H. (1961). Untersuchungen uber den
Feinbau von Spinalganglien. Z Zellforsch A55, 1-48. [0354] Arriza,
J. L., Eliasof, S., Kavanaugh, M. P., and Amara, S. G. (1997).
Excitatory amino acid transporter 5, a retinal glutamate
transporter coupled to a chloride conductance. Proc Natl Acad Sci
USA 94, 4155-4160. [0355] Arriza, J. L., Fairman, W. A., Wadiche,
J. I., Murdoch, G. H., Kavanaugh, M. P., and Amara, S. G. (1994).
Functional comparisons of three glutamate transporter subtypes
cloned from human motor cortex. J Neurosci 14, 5559-5569. [0356]
Baccei, M. L., Bardoni, R., and Fitzgerald, M. (2003). Development
of nociceptive synaptic inputs to the neonatal rat dorsal horn:
glutamate release by capsaicin and menthol. J Physiol 549, 231-242.
[0357] Bai,-L., Xu, H., Collins, J. F., and Ghishan, F. K. (2001).
Molecular and functional analysis of a novel neuronal vesicular
glutamate transporter. J Biol Chem 276, 36764-36769. [0358] Bai,
L., Zhang, X., and Ghishan, F. K. (2003). Characterization of
vesicular glutamate transporter in pancreatic alpha- and beta-cells
and its regulation by glucose. Am J Physiol Gastrointest Liver
Physiol 284, G808-814. [0359] Banerjea, A., Li, M. J., Bauer, G.,
Remling, L., Lee, N. S., Rossi, J., and Akkina, R. (2003).
Inhibition of HIV-1 by lentiviral vector-transduced siRNAs in T
lymphocytes differentiated in SCID-hu mice and CD34+ progenitor
cell-derived macrophages. Mol Ther 8, 62-71. [0360] Baranauskas,
G., and Nistri, A. (1998). Sensitization of pain pathways in the
spinal cord: cellular mechanisms. Prog Neurobiol 54, 349-365.
[0361] Barton, G. M., and Medzhitov, R. (2002). Retroviral delivery
of small interfering RNA into primary cells. Proc Natl Acad Sci USA
99, 14943-14945. [0362] Bass, B. L. (2000). Double-stranded RNA as
a template for gene silencing. Cell 101, 235-238. [0363]
Bellocchio, E. E., Hu, H., Pohorille, A., Chan, J., Pickel, V. M.,
and Edwards, R. H. (1998). The localization of the brain-specific
inorganic phosphate transporter suggests a specific presynaptic
role in glutamatergic transmission. J Neurosci 18, 8648-8659.
[0364] Bellocchio, E. E., Reimer, R. J., Fremeau, R. T., Jr., and
Edwards, R. H. (2000). Uptake of glutamate into synaptic vesicles
by an inorganic phosphate transporter. Science 289, 957-960. [0365]
Bender, A. S., Reichelt, W., and Norenberg, M. D. (2002a).
Characterization of cystine uptake in cultured astrocytes.
Neurochem Int 37, 269-276. [0366] Bender, F. L. P., Mederos y
Schnitzler, M., Li, Y., Ji, A., Weihe, E., Gudermann, T., and
Schafer, M. K.-H. (2002b). Expression and functional
characterization of the vanilloid receptor-like TRP channel VRL-1
in the primary sensory cell line F-11. 2002 Abstract Viewer
Itinerary Planner Program No. 48.23. [0367] Bernstein, E., Caudy,
A. A., Hammond, S. M., and Hannon, G. J. (2001). Role for a
bidentate ribonuclease in the initiation step of RNA interference.
Nature 409, 363-366. [0368] Boland, L. M., and Dingledine, R.
(1990). Expression of sensory neuron antigens by a dorsal root
ganglion cell line, F-11. Brain Res Dev Brain Res 51, 259-266.
[0369] Bothwell, M. A., Schechter, A. L., and Vaughn, K. M. (1980).
Clonal variants of PC12 pheochromocytoma cells with altered
response to nerve growth factor. Cell 21, 857-866. [0370]
Brummelkamp, T. R., Bernards, R., and Agami, R. (2002). A system
for stable expression of short interfering RNAs in mammalian cells.
Science 296, 550-553. [0371] Burger, P. M., Mehl, E., Cameron, P.
L., Maycox, P. R., Baumert, M., Lottspeich, F., De Camilli, P., and
Jahn, R. (1989). Synaptic vesicles immunoisolated from rat cerebral
cortex contain high level of glutamate. Neuron 7, 287-293. [0372]
Bushman, F. (2003). RNA interference: applications in vertebrates.
Mol Ther 7, 9-10. [0373] Calderon-Martinez, D., Garavito, Z.,
Spinel, C., and Hurtado, H. (2002). Schwann cell-enriched cultures
from adult human peripheral nerve: a technique combining short
enzymatic dissociation and treatment with cytosine arabinoside
(Ara-C). J Neurosci Methods 114, 1-8. [0374] Carlton, S. M., Zhou,
S., and Coggeshall, R. E. (1998). Evidence for the interaction of
glutamate and NK1 receptors in the periphery. Brain Res 790,
160-169. [0375] Carrigan, C. N., Bartlett, R. D., Esslinger, C. S.,
Cybulski, K. A., Tongcharoensirikul, P., Bridges, R. J., and
Thompson, C. M. (2002). Synthesis and in vitro pharmacology of
substituted quinoline-2,4-dicarboxylic acids as inhibitors of
vesicular glutamate transport. J Med Chem 45, 2260-2276. [0376]
Casey, B. P., and Glazer, P. M. (2001). Gene targeting via
triple-helix formation. Prog Nucleic Acid Res Mol Biol 67, 163-192.
[0377] Caterina, M. J., Rosen, T. A., Tominaga, M., Brake, A. J.,
and Julius, D. (1999). A capsaicin-receptor homologue with a high
threshold for noxious heat. Nature 398, 436-441. [0378] Caterina,
M. J., Schumacher, M. A., Tominaga, M., Rosen, T. A., Levine, J.
D., and Julius, D. (1997). The capsaicin receptor: a heat-activated
ion channel in the pain pathway. Nature 389, 816-824. [0379] Chen,
L., and Huang, M. L.-Y. (1992). Protein kinase C reduces Mg2+ block
of NMDA-receptor channels as a mechanism of modulation. Nature 356,
521-523. [0380] Chong, S. S., Kristjansson, K., Zoghbi, H. Y., and
Hughes, M. R. (1993). Molecular cloning of the cDNA encoding a
human renal sodium phosphate transport protein and its assignment
to chromosome 6p21.3-p23. Genomics 18, 355-359. [0381] Coburn, G.
A., and Cullen, B. R. (2002). Potent and specific inhibition of
human immunodeficiency virus type 1 replication by RNA
interference. J Virol 76, 9225-9231. [0382] Coonrod, A., Li, F. Q.,
and Horwitz, M. (1997). On the mechanism of DNA transfection:
efficient gene transfer without viruses. Gene Ther 4, 1313-1321.
[0383] Davis, J. B., Gray, J., Gunthorpe, M. J., Hatcher, J. P.,
Davey, P. T., Overend, P., Harries, M. H., Latcham, J., Clapham,
C., Atkinson, K., et al. (2000). Vanilloid receptor-1 is essential
for inflammatory thermal hyperalgesia. Nature 405, 183-187. [0384]
Devroe, E., and Silver, P. A. (2002). Retrovirus-delivered siRNA.
BMC Biotechnol 2, 15. [0385] Disbrow, J., Gershten, M., and Ruth,
J. (1982). Uptake of L-[3H]glutamic acid by crude and purified
synaptic vesicles from rat brain. Biochem Biophys Res Commun 108,
1221-1227. [0386] Doench, J. G., Petersen, C. P., and Sharp, P. A.
(2003). siRNAs can function as miRNAs. Genes Dev 17, 438-442.
[0387] Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. (2003).
Killing the messenger: Short RNAs that silence gene expression. Nat
Rev Mol Cell Biol 4, 457-467. [0388] Eggert, C., and Fischer, U.
(2003). RNA-lnterferenz: Ein Werkzeug zur Analyse der Genfunktion.
BIOspektrum 9, 372-274. [0389] Elbashir, S. M., Harborth, J.,
Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001a).
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured
mammalian cells. Nature 411, 494-498. [0390] Elbashir, S. M.,
Harborth, J., Weber, K., and Tuschl, T. (2002). Analysis of gene
function in somatic mammalian cells using small interfering RNAs.
Methods 26, 199-213. [0391] Elbashir, S. M., Martinez, J.,
Patkaniowska, A., Lendeckel, W., and Tuschl, T. (2001b). Functional
anatomy of siRNAs for mediating efficient RNAi in Drosophila
melanogaster embryo lysate. Embo J 20, 6877-6888. [0392]
Erdreich-Epstein, A., and Shackleford, G. M. (1998). Differential
expression of Wnt genes in normal and flat variants of PC12 cells,
a cell line responsive to ectopic Wnt1 expression. Growth Factors
15, 149-158. [0393] Fagg, G. E., and Foster, A. C. (1983). Amino
acid neurotransmitters and their pathways in the mammalian brain.
Neuroscience 9, 701-719. [0394] Fairman, W. A., Vandenberg, R. J.,
Arriza, J. L., Kavanaugh, M. P., and Amara, S. G. (1995). An
excitatory amino-acid transporter with properties of a ligend-gated
chloride channel. Nature 375, 599-603. [0395] Felgner, P. L.,
Gadek, T. R., Holm, M., Roman, R., Chan, H. W., Wenz, M., Northrop,
J. P., Ringold, G. M., and Danielsen, M. (1987). Lipofection: a
highly efficient, lipid-mediated DNA-transfection procedure. Proc
Natl Acad Sci USA 84, 7413-7417. [0396] Fire, A., Xu, S.,
Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C.
(1998). Potent and specific genetic interference by double-stranded
RNA in Caenorhabditis elegans. Nature 391, 806-811. [0397] Fonnum,
F. (1984). Glutamate: A neurotransmitter in the mammalian brain. J
Neurochem 42. [0398] Forth, W., Henschler, D., and Rummel, W.
(2001). Allgemeine und spezielle Pharmakologie und Toxikologie, 8
edn (Munchen--Jena, Urban & Fischer Verlag). [0399] Francel, P.
C., Harris, K., Smith, M., Fishman, M. C., Dawson, G., and Miller,
R. J. (1987). Neurochemical characteristics of a novel dorsal root
ganglion X neuroblastoma hybrid cell line, F-11. J Neurochem 48,
1624-1631. [0400] Fremeau, R. T., Jr., Burman, J., Qureshi, T.,
Tran, C. H., Proctor, J., Johnson, J., Zhang, H., Sulzer, D.,
Copenhagen, D. R., Storm-Mathisen, J., et al. (2002). The
identification of vesicular glutamate transporter 3 suggests novel
modes of signaling by glutamate. Proc Natl Acad Sci USA 99,
14488-14493. [0401] Fremeau, R. T., Jr., Troyer, M. D., Pahner, I.,
Nygaard, G. O., Tran, C. H., Reimer, R. J., Bellocchio, E. E.,
Fortin, D., Storm-Mathisen, J., and Edwards, R. H. (2001). The
expression of vesicular glutamate transporters defines two classes
of excitatory synapse. Neuron 31, 247-260. [0402] Gareis, M.,
Harrer, P., and Bertling, W. M. (1991). Homologous recombination of
exogenous DNA fragments with genomic DNA in somatic cells of mice.
Cell Mol Biol 37, 191-203. [0403] Gasnier, B. (2000). The loading
of neurotransmitters into synaptic vesicles. Biochimie 82, 327-337.
[0404] Gershon, H., Ghirlando, R., Guttman, S. B., and Minsky, A.
(1993). Mode of formation and structural features of DNA-cationic
liposome complexes used for transfection. Biochemistry 32,
7143-7151. [0405] Gil, J., and Esteban, M. (2000). Induction of
apoptosis by the dsRNA-dependent protein kinase (PKR): mechanisms
of action. Apoptosis 5. [0406] Gitlin, L., Karelsky, S., and
Andino, R. (2002). Short interfering RNA confers intracellular
antiviral immunity in human cells. Nature 418, 430-434. [0407]
Gonzalez, M. P., Herrero, M. T., Vicente, S., and Oset-Gasque, M.
J. (1998). Effect of glutamate receptor agonists on catecholamine
secretion in bovine chromaffin cells. Neuroendocrinology 67,
181-189. [0408] Gras, C., Herzog, E., Bellenchi, G. C., Bernard,
V., Ravassard, P., Pohl, M., Gasnier, B., Giros, B., and El
Mestikawy, S. (2002). A third vesicular glutamate transporter
expressed by cholinergic and serotoninergic neurons. J Neurosci 22,
5442-5451. [0409] Greene, G. C. (1949). Gross anatomy in the rat in
laboratory investigation. (Philadelphia, J. B. Lippincott Company).
[0410] Greene, L. A., and Rein, G. (1977). Release, storage and
uptake of catecholamines by a clonal cell line of nerve growth
factor responsive pheo-chromocytoma cells. Brain Res 129, 247-263.
[0411] Greene, L. A., and Tischler, A. S. (1976). Establishment of
a noradrenergic clonal line of rat adrenal pheochromocytoma cells
which respond to nerve growth factor. Proc Natl Acad Sci USA 73,
2424-2428. [0412] Grothe, C., and Unsicker, K. (1987).
Neuron-enriched cultures of adult rat dorsal root ganglia:
establishment, characterization, survival, and neuropeptide
expression in response to trophic factors. J Neurosci Res 18,
539-550. [0413] Grunweller, A., Wyszko, E., Bieber, B., Jahnel, R.,
Erdmann, V. A., and Kurreck, J. (2003). Comparison of different
antisense strategies in mammalian cells using locked nucleic acids,
2'-O-methyl RNA, phosphorothioates and small interfering RNA.
Nucleic Acids Res 31, 3185-3193. [0414] Grynfeld, A., Pahlman, S.,
and Axelson, H. (2000). Induced neuroblastoma cell differentiation,
associated with transient HES-1 activity and reduced HASH-1
expression, is inhibited by Notch1. Int J Cancer 88, 401-410.
[0415] Guerrero, I., Pellicer, A., and Burstein, D. E. (1988).
Dissociation of c-fos from ODC expression and neuronal
differentiation in a PC12 subline stably transfected with an
inducible N-ras oncogene. Biochem Biophys Res Commun 150,
1185-1192. [0416] Guerrero, I., Wong, H., Pellicer, A., and
Burstein, D. E. (1986). Activated N-ras gene induces neuronal
differentiation of PC12 rat pheochromocytoma cells. J Cell Physiol
129, 71-76. [0417] Guo, S., and Kemphues, K. J. (1995). par-1, a
gene required for establishing polarity in C. elegans embryos,
encodes a putative Ser/Thr kinase that is asymmetrically
distributed. Cell 81, 611-620. [0418] Hammond, S. M., Bernstein,
E., Beach, D., and Hannon, G. J. (2000). An RNA-directed nuclease
mediates posttranscriptional gene silencing in Drosophila cells.
Nature 404, 293-296. [0419] Hayashi, M., Otsuka, M., Morimoto, R.,
Hirota, S., Yatsushiro, S., Takeda, J., Yamamoto, A., and Moriyama,
Y. (2001). Differentiation-associated Na+-dependent inorganic
phosphate cotransporter (DNPI) is a vesicular glutamate transporter
in endocrine glutamatergic systems. J Biol Chem 276, 43400-43406.
[0420] Hayashi, M., Yamada, H., Uehara, S., Morimoto, R., Muroyama,
A., Yatsushiro, S., Takeda, J., Yamamoto, A., and Moriyama, Y.
(2003). Secretory granule-mediated co-secretion of L-glutamate and
glucagon triggers glutamatergic signal transmission in islets of
Langerhans. J Biol Chem 278, 1966-1974. [0421] Hemann, M. T.,
Fridman, J. S., Zilfou, J. T., Hernando, E., Paddison, P. J.,
Cordon-Cardo, C., Hannon, G. J., and Lowe, S. W. (2003). An
epi-allelic series of p53 hypomorphs created by stable RNAi
produces distinct tumor phenotypes in vivo. Nat Genet 33, 396-400.
[0422] Herzog, E., Bellenchi, G. C., Gras, C., Bernard, V.,
Ravassard, P., Bedet, C., Gasnier, B., Giros, B., and El Mestikawy,
S. (2001). The existence of a second vesicular glutamate
transporter specifies subpopulations of glutamatergic neurons. J
Neurosci 21, RC181. [0423] Hioki, H., Fujiyama, F., Taki, K.,
Tomioka, R., Furuta, T., Tamamaki, N., and Kaneko, T. (2003).
Differential distribution of vesicular glutamate transporters in
the rat cerebellar cortex. Neuroscience 117, 1-6.
[0424] Hisano, S., Sawada, K., Kawano, M., Kanemoto, M., Xiong, G.,
Mogi, K., Sakata-Haga, H., Takeda, J., Fukui, Y., and Nogami, H.
(2002). Expression of inorganic phosphate/vesicular glutamate
transporters (BNPI/VGLUT1 and DNPI/VGLUT2) in the cerebellum and
precerebellar nuclei of the rat. Brain Res Mol Brain Res 107,
23-31. [0425] Holen, T., Amarzguioui, M., Wiiger, M. T., Babaie,
E., and Prydz, H. (2002). Positional effects of short interfering
RNAs targeting the human coagulation trigger Tissue Factor. Nucleic
Acids Res 30, 1757-1766. [0426] Hu, W. Y., Myers, C. P., Kilzer, J.
M., Pfaff, S. L., and Bushman, F. D. (2002). Inhibition of
retroviral pathogenesis by RNA interference. Curr Biol 12,
1301-1311. [0427] Huber, K., Bruhl, B., Guillemont, F., Olson, E.
N., Ernsberger, U., and Unsicker, K. (2002a). Development of
chromaffin cells depends on MASH1 function. Development 129,
4729-4738. [0428] Huber, K., Combs, S., Ernsberger, U., Kalcheim,
C., and Unsicker, K. (2002b). Generation of neuroendocrine
chromaffin cells from sympathoadrenal preogenitors: beyond the
glucocorticoid hypothesis. Ann N Y Acad Sci 971, 554-549. [0429]
Hunt, S. P., and Mantyh, P. W. (2001). The molecular dynamics of
pain control. Nat Rev Neuroscience 2, 83-91. [0430] Israel, M.,
Tomasi, M., Bostel, S., and Meunier, F. M. (2001). Cellular
resistance to Evans blue toxicity involves an up-regulation of a
phosphate transporter implicated in vesicular glutamate storage. J
Neurochem 78, 658-663. [0431] Issack, P. S., and Ziff, E. B.
(1998a). Altered expression of helix-loop-helix transcriptional
regulators and cyclin D1 in Wnt-1 -transformed PC12 cells. Cell
Growth Differ 9, 837-845. [0432] Issack, P. S., and Ziff, E. B.
(1998b). Genetic elements regulating HES-1 induction in
Wnt-1-transformed PC12 cells. Cell Growth Differ 9, 827-836. [0433]
Jacque, J. M., Triques, K., and Stevenson, M. (2002). Modulation of
HIV-1 replication by RNA interference. Nature 418, 435-438. [0434]
Jahn, R., and Sudhof, T. C. (1993). Synaptic vesicle traffic: rush
hour in the nerve terminal. J Neurochem 61, 12-21. [0435] Jimenez,
A. L., Chou, A. H., Khadadadi, O., Palos, T. P., and Howard, B. D.
(2003). Wnt-1 has multiple effects on the expression of glutamate
transporters. Neurochem Int 42, 345-351. [0436] Jogi, A., Persson,
P., Grynfeld, A., Pahlman, S., and Axelson, H. (2002). Modulation
of basic helix-loop-helix transcription complex formation by Id
proteins during neuronal differentiation. J Biol Chem 277,
9118-9126. [0437] Jue, S. F., Bradley, R. S., Rudnicki, J. A.,
Varmus, H. E., and Brown, A. M. (1992). The mouse Wnt-1 gene can
act via paracrine mechanism in transformation of mammary epithelial
cells. Mol Cell Biol 12, 321-328. [0438] Kamath, R. S., Fraser, A.
G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le
Bot, N., Moreno, S., Sohrmann, M., et al. (2003). Systematic
functional analysis of the Caenorhabditis elegans genome using
RNAi. Nature 421, 231-237. [0439] Kanai, Y., and Hediger, M. A.
(1992). Primary structure and functional characterization of a
high-affinity glutamate transporter. Nature 360, 467-471. [0440]
Kaneko, T., and Fujiyama, F. (2002). Complementary distribution of
vesicular glutamate transporters in the central nervous system.
Neurosci Res 42, 243-250. [0441] Kapadia, S. B., Brideau-Andersen,
A., and Chisari, F. V. (2003). Interference of hepatitis C virus
RNA replication by short interfering RNAs. Proc Natl Acad Sci USA
100, 2014-2018. [0442] Katoh-Semba, R., Oohira, A., Sano, M.,
Watanabe, K., Kitajima, S., and Kashiwamata, S. (1989).
Glycosaminoglycan composition of PC12 pheochromocytoma cells: a
comparison with PC12D cells, a new subline of PC12 cells. J
Neurochem 52, 889-895. [0443] Keck, J. L., Roche, D. D. Lynch, A.
S., and Berger, J. M. (2000). Structure of the RNA polymerase
domain of E. coli primase. Science 287; 2482-2486. [0444]
Kennerdell, J. R., and Carthew, R. W. (2000). Heritable gene
silencing in Drosophila using double-stranded RNA. Nat Biotechnol
18, 896-898. [0445] Kish, P. E., Fischer-Bovenkerk, C., and Ueda,
T. (1989). Active transport of GABA and glycin into synaptic
vesicles. Proc Natl Acad Sci USA 86, 3877-3881. [0446] Kobayashi,
S., and Millhorn, D. E. (2001). Hypoxia regulates glutamate
metabolism and membrane transport in rat PC12 cells. J Neurochem
76, 1935-1948. [0447] Lee, N. S., Dohjima, T., Bauer, G., Li, H.,
Li, M. J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002).
Expression of small interfering RNAs targeted against HIV-1 rev
transcripts in human cells. Nat Biotechnol 20, 500-505. [0448] Lee,
R. Y., Sawin, E. R., Chalfie, M., Horvitz, H. R., and Avery, L.
(1999). EAT-4, a homolog of a mammalian sodium-dependent inorganic
phosphate cotransporter, is necessary for glutamatergic
neurotransmission in caenorhabditis elegans. J Neurosci 19,
159-167. [0449] Levy, L. M., Warr, O., and Attwell, D. (1998).
Stoichiometry of the glial glutamate transporter GLT-1 expressed
inducibly in a Chinese hamster ovary cell line selected for low
endogenous Na+-dependent glutamate uptake. J Neurosci 18,
9620-9628. [0450] Li, H., Li, W. X., and Ding, S. W. (2002).
Induction and suppression of RNA silencing by an animal virus.
Science 296, 1319-1321. [0451] Li, J. L., Fujiyama, F., Kaneko, T.,
and Mizuno, N. (2003a). Expression of vesicular glutamate
transporters, VGluT1 and VGluT2, in axon terminals of nociceptive
primary afferent fibers in the superficial layers of the medullary
and spinal dorsal horns of the rat. J Comp Neurol 457, 236-249.
[0452] Li, J. L., Xiong, K. H., Dong, Y. L., Fujiyama, F., Kaneko,
T., and Mizuno, N. (2003b). Vesicular glutamate transporters,
VGluT1 and VGluT2, in the trigeminal ganglion neurons of the rat,
with special reference to coexpression. J Comp Neurol 463, 212-220.
[0453] Lindbo, J. A., and Dougherty, W. G. (1992). Untranslatable
transcripts of the tobacco etch virus coat protein gene sequence
can interfere with tobacco etch virus replication in transgenic
plants and protoplasts. Virology 189, 725-733. [0454] Luqmani, Y.
A. (1981). Nucleotide uptake by isolated cholinergic synaptic
vesicles: Evidence for a carrier of adenosine 5'-triphosphate.
Neuroscience 6, 1011-1021. [0455] Mackenzie, B., and Erickson, J.
(2003). Sodium-coupled neutral amino acid (System N/A) transporters
of the SLC38 family. Pflugers Arch. [0456] Macnaughton, T. B., Shi,
S. T., Modahl, L. E., and Lai, M. M. (2002). Rolling circle
replication of hepatitis delta virus RNA is carried out by two
different cellular RNA polymerases. J Virol 76, 3920-3927. [0457]
Manfras, B. J., and Boehm, B. O. (1995). Expression of a glutamate
transporter cDNA in human pancreatic islets. Exp Clin Endocrinol
Diabetes 103 Suppl 2, 95-98. [0458] Masson, J., Sagne, C., Hamon,
M., and El Mestikawy, S. (1999). Neurotransmitter transporters in
the central nervous system. Pharmacol Rev 51, 439-464. [0459]
McIntire, S. L., Reimer, R. J., Schuske, K., Edwards, R. H., and
Jorgensen, E. M. (1997). Identification and characterization of the
vesicular GABA transporter. Nature 389, 870-876. [0460] McMahon, A.
P., and Bradley, A. (1990). The Wnt-1 (Int-1) proto-oncogen is
required for development of brain. Cell 62, 1071-1085. [0461]
McManus, M. T., and Sharp, P. A. (2002). Gene silencing in mammals
by small interfering RNAs. Nat Rev Genet 3, 737-747. [0462] Mertz,
K. D., Weisheit, G., Schilling, K., and Luers, G. H. (2002).
Electroporation of primary neural cultures: a simple method for
directed gene transfer in vitro. Histochem Cell Biol 118, 501-506.
[0463] Miyagishi, M., and Taira, K. (2002). U6 promoter-driven
siRNAs with four uridine 3' overhangs efficiently suppress targeted
gene expression in mammalian cells. Nat Biotechnol 20, 497-500.
[0464] Moraleda, G., and Taylor, J. (2001). Host RNA polymerase
requirements for transcription of the human hepatitis delta virus
genome. J Virol 75, 10161-10169. [0465] Myslinski, E. (2001). An
unusually compact external promotor for RNA polymerase III
transcription of the human H1RNA gene. Nucleic Acids Res 29,
2502-2509. [0466] Naito, S., and Ueda, T. (1985). Characterization
of glutamate uptake into synaptic vesicles. J Neurochem 44, 99-109.
[0467] Napoli, C., Lemieux, C., and Jorgensen, R. (1990).
Introduction of a Chimeric Chalcone Synthase Gene into Petunia
Results in Reversible Co-Suppression of Homologous Genes in trans.
Plant Cell 2, 279-289. [0468] Nestler, E. J., Hyman, S. E., and
Malenka, R. C. (2001). Molecular Neuropharmacology, 1 edn,
McGraw-Hill Companies). [0469] Ni, B., Du, Y., Wu, X., DeHoff, B.
S., Rosteck, P. R., Jr., and Paul, S. M. (1996). Molecular cloning,
expression, and chromosomal localization of a human brain-specific
Na(+)-dependent inorganic phosphate cotransporter. J Neurochem 66,
2227-2238. [0470] Ni, B., Rosteck, P. R., Jr., Nadi, N. S., and
Paul, S. M. (1994). Cloning and expression of a cDNA encoding a
brain-specific Na(+)-dependent inorganic phosphate cotransporter.
Proc Natl Acad Sci USA 91, 5607-5611. [0471] Ni, B., Wu, X., Yan,
G. M., Wang, J., and Paul, S. M. (1995). Regional expression and
cellular localization of the Na(+)-dependent inorganic phosphate
cotransporter of rat brain. J Neurosci 15, 5789-5799. [0472] Njus,
D., Kelley, P. M., and Hardabek, G. J. (1986). Bioenegetics of
secretory vesicles. Biochim Biophys Acta 853, 237-265. [0473] Noda,
M., Ko, M., Ogura, A., Liu, D. G., Amano, T., Takano, T., and
Ikawa, Y. (1985). Sarcoma viruses carrying ras oncogenes induce
differentiation-associated properties in a neuronal cell line.
Nature 318, 73-75. [0474] Novina, C. D., Murray, M. F., Dykxhoorn,
D. M., Beresford, P. J., Riess, J., Lee, S. K., Collman, R. G.,
Lieberman, J., Shankar, P., and Sharp, P. A. (2002). siRNA-directed
inhibition of HIV-1 infection. Nat Med 8, 681-686. [0475] Oliveira,
A. C. R., Hydling, F., Olsson, E., Shi, T., Edwards, R. H.,
Fujiyama, F., Kaneko, T., Hokfelt, T., Cullheim, S., and Meister,
B. (2003). Cellular Localization of Three Vesikular Glutamate
Transporter mRNAs and Proteins in Rat Spinal Cord and Dorsal Root
Ganglia. Synapse 50, 117-129. [0476] Oset-Gasque, M. J., Castro,
E., and Gonzalez, A. M. (1990). Mechanisms of 3H-GABA release by
chromaffin cells in primary culture. J Neurosci Res 26, 181-187.
[0477] Ottersen, O. P., and Storm-Mathisen, J. (1984). Neurons
containing or accumulating transmitter amino acids. In Handbook of
Chemical Neuroanatomy, A. Bjorklund, H. T., and M. J. Kuhar, eds.
(Amsterdam, Elsevier), pp. 141-246. [0478] Ozkan, E. D., and Ueda,
T. (1998). Glutamate transport and storage in synaptic vesicles.
Jpn J Pharmacol 77, 1-10. [0479] Paddison, P. J., and Hannon, G. J.
(2002). RNA interference: the new somatic cell genetics? Cancer
Cell 2, 17-23. [0480] Palauqui, J. C. e. a. (1997). Systemic
acquired silencing: transgenespecific post-transcriptional
silencing is transmitted by grafting from silenced stocks to
non-silenced scions. Embo J 16, 4738-4745. [0481] Patapoutian, A.,
Peier, A. M., Story, G. M., and Viswanath, V. (2003). ThermoTRP
channnels and beyond: mechanisms of temperature sensation. Nat Rev
Neuroscience 4, 529-539. [0482] Patapoutian, A., and Reichardt, L.
F. (2001). Trk receptors: mediators of neurotrophin action. Curr
Opin Neurobiol 11, 272-280. [0483] Pines, G., Danbolt, N. C.,
Bjoras, M., Zhang, Y., Bendahan, A., Eide, L., Koepsell, H.,
Storm-Mathisen, J., Seeberg, E., and Kanner, B. I. (1992). Cloning
and expression of a rat brain L-glutamate transporter. Nature 360,
464-467. [0484] Plasterk, R. H. (2002). RNA silencing: the genome's
immune system. Science 296, 1263-1265. [0485] Platika, D., Baizer,
L., and Fishman, M. C. (1985). Sensory neurons "immortalized" by
fusion with neuroblastoma cells. Trans Assoc Am Physicians 98,
301-304. [0486] Qin, X. F., An, D. S., Chen, I. S., and Baltimore,
D. (2003). Inhibiting HIV-1 infection in human T cells by
lentiviral-mediated delivery of small interfering RNA against CCR5.
Proc Natl Acad Sci USA 100, 183-188. [0487] Ramachandran, B.,
Houben, K., Rozenberg, Y. Y., Haigh, J. R., Varpetian, A., and
Howard, B. D. (1993). Differential expression of transporters for
norepinephrine and glutamate in wild type, variant, and
WNT1-expressing PC12 cells. J Biol Chem 268, 23891-23897. [0488]
Reimer, R. J., and Edwards, R. H. (2003). Organic anion transport
is the primary function of the SLC17/type I phosphate transporter
family. Pflugers Arch. [0489] Ren, K. (1994). Wind up and the
NMDA-receptor: from animal studies to humans. Pain 59, 157-158.
[0490] Romero, O., Figueroa, S., Vicente, S., Gonzalez, M. P., and
Oset-Gasque, M. J. (2003). Molecular mechanisms of glutamate
release by bovine chromaffin cells in primary culture. Neuroscience
116, 817-829. [0491] Roseth, S., Fykse, E. M., and Fonnum, F.
(1995). Uptake of L-glutamate into rat brain synaptic vesicles:
effect of inhibitors that bind specifically to the glutamate
transporter. J Neurochem 65, 96-103. [0492] Roseth, S., Fykse, E.
M., and Fonnum, F. (1998). Uptake of L-glutamate into synaptic
vesicles: competitive inhibition by dyes with biphenyl and amino-
and sulphonic acid-substituted naphthyl groups. Biochem Pharmacol
56, 1243-1249. [0493] Rothstein, J. D., Dykes-Hoberg, M., Pardo, C.
A., Bristol, L. A., Jin, L., Kuncl, R. W., Kanai, Y., Hediger, M.
A., Wang, Y., Schielke, J. P., and Welty, D. F. (1996). Knockout of
glutamate transporters reveals a major role for astroglial
transport in excitotoxicity and clearance of glutamate. Neuron 16,
675-686. [0494] Rozenberg, Y. Y., and Howard, B. D. (1994).
Contrasting morphological changes in PC12 flat cells expressing two
different forms of exogenous encogenic ras. Exp Cell Res 211,
59-67. [0495] Rubinson, D. A., Dillon, C. P., Kwiatkowski, A. V.,
Sievers, C., Yang, L., Kopinja, J., Rooney, D. L., Ihrig, M. M.,
McManus, M. T., Gertler, F. B., et al. (2003). A lentivirusbased
system to functionally silence genes in primary mammalian cells,
stem cells and transgenic mice by RNA interference. Nat Genet 33,
401-406. [0496] Sagne, C., El Mestikawy, S., Isambert, M.-F.,
Hamon, M., Henry, J.-P., Giros, B., and Gasnier, B. (1997). Cloning
of a functional GABA and glycine transporter by screening of genome
databases. FEBS Lett 417, 177-183. [0497] Saiki, R. K., Gelfand, D.
H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis,
K. B., and Erlich, H. A. (1988). Primer-directed enzymatic
amplification of DNA with a thermostable DNA polymerase. Science
239, 487-491. [0498] Sassone-Corsi, P., Der, C. J., and Verma, I.
M. (1989). ras-induced differentiation of PC12 cells: possible
involment of fos and jun. Mol Cell Biol 9, 3174-3183. [0499]
Schafer, M. K., Varoqui, H., Defamie, N., Weihe, E., and Erickson,
J. D. (2002). Molecular cloning and functional identification of
mouse vesicular glutamate transporter 3 and its expression in
subsets of novel excitatory neurons. J Biol Chem 277,
50734-50748.
[0500] Scholz, J., and Woolf, C. J. (2002). Can we conquer pain?
Nat Neurosci 5, 1062-1067. [0501] Schwarz, D. S., Hutvagner, G.,
Haley, B., and Zamore, P. D. (2002). Evidence that siRNAs function
as guides, not primers, in the Drosophila and human RNAi pathways.
Mol Cell 10, 537-548. [0502] Shackleford, G. M., Willert, K., Wang,
J., and Varmus, H. E. (1993). The Wnt-1 proto-oncogene induces
changes in morphology, gene expression and growth factor
responsivness in PC12 cells. Neuron 11, 865-875. [0503] Shen, C.,
Buck, A. K., Liu, X., Winkler, M., and Reske, S. N. (2003). Gene
silencing by adenovirus-delivered siRNA. FEBS Lett 539, 111-114.
[0504] Shi, Y. (2003). Mammalian RNAi for the masses. Trends Genet
19, 9-12. [0505] Shioi, J., Naito, S., and Ueda, T. (1989).
Glutamate uptake into synaptic vesicles from bovine cerebral cortex
and electrochemical potential difference of proton across the
membrane. Biochem J 258, 449-504. [0506] Shuey, D. J., McCallus, D.
E., and Giordano, T. (2002). RNAi: gene-silencing in therapeutic
intervention. Drug Discov Today 7, 1040-1046. [0507] Sijen, T.,
Fleenor, J., Simmer, F., Thijssen, K. L., Parrish, S., Timmons, L.,
Plasterk, R. H., and Fire, A. (2001). On the role of RNA
amplification in dsRNA-triggered gene silencing. Cell 107, 465-476.
[0508] Sindrup, S. H., and Jensen, T. S. (1999). Efficiacy of
pharmacological treatments of neuropathic pain: an update and
effect related to mechanism of drug action. Pain 83, 389-400.
[0509] Skerry, T. M., and Genever, P. G. (2001). Glutamate
signalling in non-neuronal tissues. Trends Pharmacol Sci 22,
174-181. [0510] Smith, J. G., Walzem, R. L., and German, J. B.
(1993). Liposomes as agents of DNA transfer. Biochim Biophys Acta
1154, 327-340. [0511] Snider, W. D., and McMahon, S. B. (1998).
Tackling pain at the source: new ideas about nociceptors. Neuron
20, 629-632. [0512] Stark, G. (1998). How cells respond to
interferons. Annu Rev Biochem 67, 227-264. [0513] Stewart, S. A.,
Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S.,
Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., et al.
(2003). Lentivirus-delivered stable gene silencing by RNAi in
primary cells. Rna 9, 493-501. [0514] Storck, T., Schulte, S.,
Hofmann, K., and Stoffel, W. (1992). Structure, expression, and
functional analysis of a Na(+)-dependent glutamate/aspartate
transporter from rat brain. Proc Natl Acad Sci USA 89, 10955-10959.
[0515] Stucky, C. L., and Lewin, G. R. (1999). Isolectin
B(4)-positive and -negative nociceptors are functionally distinct.
J Neurosci 19, 6497-6505. [0516] Sung, B., Lim, G., and Mao, J.
(2003). Altered expression and uptake activity of spinal glutamate
transporters after nerve injury contribute to the pathogenesis of
neuropathic pain in rats. J Neurosci 23, 2899-2910. [0517] Tabb,
J., Kish, P., Vandyke, R., and Ueda, T. (1992). Glutamate transport
into synaptic vesicles--role of membrane potential, pH gradient and
intravesicular pH. J Biol Chem 267, 15412-15418. [0518] Takamori,
S., Malherbe, P., Broger, C., and Jahn, R. (2002). Molecular
cloning and functional characterization of human vesicular
glutamate transporter 3. EMBO Rep 3, 798-803. [0519] Takamori, S.,
Rhee, J. S., Rosenmund, C., and Jahn, R. (2000). Identification of
a vesicular glutamate transporter that defines a glutamatergic
phenotype in neurons. Nature 407, 189-194. [0520] Tijsterman, M.,
Ketting, R. F., Okihara, K. L., Sijen, T., and Plasterk, R. H.
(2002). RNA helicase MUT-14-dependent gene silencing triggered in
C. elegans by short antisense RNAs. Science 295, 694-697. [0521]
Timmons, L., Court, D. L., and Fire, A. (2001). Ingestion of
bacterially expressed dsRNAs can produce specific and potent
genetic interference in Caenorhabditis elegans. Gene 263, 103-112.
[0522] Todd, A. J., Hughes, D. I., Polgar, E., Nagy, G. G., Mackie,
M., Ottersen, O. P., and Maxwell, D. J. (2003). The expression of
vesicular glutamate transporters VGLUT1 and VGLUT2 in
neurochemically defined axonal populations in the rat spinal cord
with emphasis on the dorsal horn. Eur J Neurosci 17, 13-27. [0523]
Toll, L., and Howard, D. B. (1980). Evidence that an ATPase and a
proton-motive force function in the transport of acetylcholine. J
Biol Chem 255, 1787-1789. [0524] Tolle, T. R. (1997). Chronischer
Schmerz. In Klinische Neurobiologie: molekulare Pathogenese und
Therapie von neurologischen Erkrankungen, T. Herdegen, T. R. Tolle,
and M. Bahr, eds. (Heidelberg, Spektrum Akademischer Verlag), pp.
307-336. [0525] Tominaga, M., Caterina, M. J., Malmberg, A. B.,
Rosen, T. A., Gilbert, H., Skinner, K., Raumann, B. E., Basbaum, A.
I., and Julius, D. (1998). The cloned capsaicin receptor integrates
multiple pain-producing stimuli. Neuron 21, 531-543. [0526] Tuschl,
T. (2002). Expanding small RNA interference. Nat Biotechnol 20,
446-448. [0527] Vaistij, F. E., Jones, L., and Baulcombe, D. C.
(2002). Spreading of RNA targeting and DNA methylation in RNA
silencing requires transcription of the target gene and a putative
RNA-dependent RNA polymerase. Plant Cell 14, 857-867. [0528]
Vandenberg, R. J. (1998). Molecular pharmacology and physiology of
glutamate transporters in the central nervous system. Clin Exp
Pharmacol Physiol 25, 393-400. [0529] Varoqui, H., Schafer, M. K.,
Zhu, H., Weihe, E., and Erickson, J. D. (2002). Identification of
the differentiation-associated Na+/PI transporter as a novel
vesicular glutamate transporter expressed in a distinct set of
glutamatergic synapses. J Neurosci 22, 142-155. [0530] Wall, P. D.,
and Melzack, R. (1999). Textbook of pain (Edinburgh, Churchill
Livingstone). [0531] Wesley, S. V., Helliwell, C. A., Smith, N. A.,
Wang, M. B., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S. P.,
Abbott, D., Stoutjesdijk, P. A., et al. (2001). Construct design
for efficient, effective and high-throughput gene silencing in
plants. Plant J 27, 581-590. [0532] Willis, W. D. (2001). Role of
neurotransmitters in sensitization of pain responses. Ann N Y Acad
Sci 933, 142-156. [0533] Winston, W. M., Molodowitch, C., and
Hunter, C. P. (2002). Systemic RNAi in C. elegans requires the
putative transmembrane protein SID-1. Science 295, 2456-2459.
[0534] Wood, P. M. (1976). Separation of functional Schwann cells
and neurons from normal peripheral nerve tissue. Brain Res 115,
361-375. [0535] Yu, J. Y., DeRuiter, S. L., and Turner, D. L.
(2002). RNA interference by expression of short-interfering RNAs
and hairpin RNAs in mammalian cells. Proc Natl Acad Sci USA 99,
6047-6052. [0536] Zamore, P. D., Tuschl, T., Sharp, P. A., and
Bartel, D. P. (2000). RNAi: double-stranded RNA directs the
ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals.
Cell 101, 25-33. [0537] Zerangue, N., and Kavanaugh, M. P. (1996).
Flux coupling in a neuronal glutamate transporter. Nature 383,
634-637. [0538] Zheng, S., Ramachandran, B., Haigh, J. R., Palos,
T. P., Steger, K., and Howard, B. D. (1996). The induction of ret
by Wnt-1 in PC12 cells is atypically dependent on continual Wnt-1
expression. Oncogene 12, 555-562. [0539] Zhuo, M. (2001). No pain,
no gains. ScientificWorldJournal 1, 204-206.
Sequence CWU 1
1
112 1 17 RNA Artificial sequence Chemcially synthesized
misc_feature (1)..(17) n = a, u, g, c, unknown or other 1
nnnnnnnnnn nnnnnnn 17 2 18 RNA Artificial sequence Chemcially
synthesized misc_feature (1)..(18) n = a, u, g, c, unknown or other
2 nnnnnnnnnn nnnnnnnn 18 3 19 RNA Artificial sequence Chemcially
synthesized misc_feature (1)..(19) n = a, u, g, c, unknown or other
3 nnnnnnnnnn nnnnnnnnn 19 4 20 RNA Artificial sequence Chemcially
synthesized misc_feature (1)..(20) n = a, u, g, c, unknown or other
4 nnnnnnnnnn nnnnnnnnnn 20 5 21 RNA Artificial sequence Chemcially
synthesized misc_feature (1)..(21) n = a, u, g, c, unknown or other
5 nnnnnnnnnn nnnnnnnnnn n 21 6 22 RNA Artificial sequence
Chemcially synthesized misc_feature (1)..(22) n = a, u, g, c,
unknown or other 6 nnnnnnnnnn nnnnnnnnnn nn 22 7 23 RNA Artificial
sequence Chemcially synthesized misc_feature (1)..(23) n = a, u, g,
c, unknown or other 7 nnnnnnnnnn nnnnnnnnnn nnn 23 8 24 RNA
Artificial sequence Chemcially synthesized misc_feature (1)..(24) n
= a, u, g, c, unknown or other 8 nnnnnnnnnn nnnnnnnnnn nnnn 24 9 25
RNA Artificial sequence Chemcially synthesized misc_feature
(1)..(25) n = a, u, g, c, unknown or other 9 nnnnnnnnnn nnnnnnnnnn
nnnnn 25 10 23 DNA Artificial sequence Sequence motif of a
preferred VGLUT-dsRNA according to the invention (p. 9 of the
specification). The sequence motif is AAN(19)TT misc_feature
(3)..(21) n = a, u, g, c, unknown or other 10 aannnnnnnn nnnnnnnnnn
ntt 23 11 23 DNA Artificial sequence Sequence motif of a preferred
VGLUT-dsRNA according to the invention (p. 9 of the specification).
The sequence motif is NAN(19)NN. misc_feature (1)..(23) n = a, t/u,
g, c, unknown or other 11 nannnnnnnn nnnnnnnnnn nnn 23 12 23 DNA
Artificial sequence Sequence motif of a preferred VGLUT-dsRNA
according to the invention (p. 9 of the specification). The
sequence motif is NARN(17)YNN. misc_feature (1)..(23) n = a, t/u,
g, c, unknown or other; y = c or t; r = a or g 12 narnnnnnnn
nnnnnnnnnn ynn 23 13 23 DNA Artificial sequence Sequence motif of a
preferred VGLUT-dsRNA according to the invention (p. 9 of the
specification). The sequence motif is NANN(17)YNN. misc_feature
(1)..(23) n = a, t/u, g, c, unknown or other; y = c or t. 13
nannnnnnnn nnnnnnnnnn ynn 23 14 21 DNA Homo sapiens misc_feature
(1)..(21) DNA target sequence of VGLUT1 (Fig. 26). 14 aacgtgcgca
agttgatgaa c 21 15 21 DNA Homo sapiens misc_feature (1)..(21) DNA
target sequence of VGLUT1 (Fig. 26). 15 aagttgatga actgcggagg c 21
16 21 DNA Homo sapiens misc_feature (1)..(21) DNA target sequence
of VGLUT2 (Fig. 26). 16 aatgccttta gctggcattc t 21 17 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 17 aatggtctgg tacatgtttt g 21 18 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 18 aaagtcctgc aaagcatcct a 21 19 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 19 aagtcctgca aagcatccta c 21 20 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 20 aagaacgtag gtacatagaa g 21 21 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 21 aattgttgca aacttctgca g 21 22 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 22 aaattagcaa ggttggtatg c 21 23 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 23 aattagcaag gttggtatgc t 21 24 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 24 aaggttggta tgctatctgc t 21 25 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 25 aagcaagcag attctttcaa c 21 26 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 26 aaccacttgg atatcgctcc a 21 27 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 27 aatgggcatt tcgaatggtg t 21 28 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 28 aataagtcac gtgaagagtg g 21 29 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 29 aagtcacgtg aagagtggca g 21 30 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 30 aagagtggca gtatgtcttc c 21 31 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 31 aatatttgcc tcaggagaga a 21 32 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 32 aagtcttatg gtgccacaac a 21 33 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 33 aatggaggtt ggcctagtgg t 21 34 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT2 (Fig. 26). 34 aagactcaca tagctataag g 21 35 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 35 aatcttggag ttgccattgt g 21 36 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 36 aaccggaaat tcagacagca c 21 37 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 37 aaacagtggg ccttatccat g 21 38 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 38 aattccaggt ggtttcattt c 21 39 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 39 aacatcgact ctgaacatgt t 21 40 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 40 aaggtttagt ggagggtgtg a 21 41 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 41 aagaggtctt tggatttgca a 21 42 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 42 aataagtaag gtgggtctct t 21 43 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 43 aagtaaggtg ggtctcttgt c 21 44 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 44 aaggtgggtc tcttgtcagc a 21 45 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 45 aatcgttgta cctattggag g 21 46 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 46 aagacccgtg aagaatggca g 21 47 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 47 aagaatggca gaatgtgttc c 21 48 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 48 aatcattgac caggacgaat t 21 49 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 49 aactcaacca tgagagtttt g 21 50 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 50 aaagaagatg tcttatggag c 21 51 21 DNA Homo
sapiens misc_feature (1)..(21) One of the DNA target sequences of
VGLUT3 (Fig. 26). 51 aagagctgac atcctaccag a 21 52 17 DNA
Artificial sequence Sequence of a dsRNA, wherein the sequence of
the dsRNA comprises the nucleotides AA at its 5'-end (p.12 of the
specification). Sequence motif 5'AAN(15-23) misc_feature (3)..(17)
n = a, t/u, g, c, unknown or other. 52 aannnnnnnn nnnnnnn 17 53 18
DNA Artificial sequence Sequence of a dsRNA, wherein the sequence
of the dsRNA comprises the nucleotides AA at its 5'-end (p.12 of
the specification). Sequence motif 5'AAN(15-23) misc_feature
(3)..(18) n = a, t/u, g, c, unknown or other. 53 aannnnnnnn
nnnnnnnn 18 54 19 DNA Artificial sequence Sequence of a dsRNA,
wherein the sequence of the dsRNA comprises the nucleotides AA at
its 5'-end (p.12 of the specification). Sequence motif 5'AAN(15-23)
misc_feature (3)..(19) n = a, t/u, g, c, unknown or other. 54
aannnnnnnn nnnnnnnnn 19 55 20 DNA Artificial sequence Sequence of a
dsRNA, wherein the sequence of the dsRNA comprises the nucleotides
AA at its 5'-end (p.12 of the specification). Sequence motif
5'AAN(15-23) misc_feature (3)..(20) n = a, t/u, g, c, unknown or
other 55 aannnnnnnn nnnnnnnnnn 20 56 21 DNA Artificial sequence
Sequence of a dsRNA, wherein the sequence of the dsRNA comprises
the nucleotides AA at its 5'-end (p.12 of the specification).
Sequence motif 5'AAN(15-23) misc_feature (3)..(21) n = a, t/u, g,
c, unknown or other 56 aannnnnnnn nnnnnnnnnn n 21 57 22 DNA
Artificial sequence Sequence of a dsRNA, wherein the sequence of
the dsRNA comprises the nucleotides AA at its 5'-end (p.12 of the
specification). Sequence motif 5'AAN(15-23) misc_feature (3)..(22)
n = a, t/u, g, c, unknown or other 57 aannnnnnnn nnnnnnnnnn nn 22
58 23 DNA Artificial sequence Sequence of a dsRNA, wherein the
sequence of the dsRNA comprises the nucleotides AA at its 5'-end
(p.12 of the specification). Sequence motif 5'AAN(15-23)
misc_feature (3)..(23) n = a, t/u, g, c, unknown or other 58
aannnnnnnn nnnnnnnnnn nnn 23 59 24 DNA Artificial sequence Sequence
of a dsRNA, wherein the sequence of the dsRNA comprises the
nucleotides AA at its 5'-end (p.12 of the specification). Sequence
motif 5'AAN(15-23) misc_feature (3)..(24) n = a, t/u, g, c, unknown
or other 59 aannnnnnnn nnnnnnnnnn nnnn 24 60 25 DNA Artificial
sequence Sequence of a dsRNA, wherein the sequence of the dsRNA
comprises the nucleotides AA at its 5'-end (p.12 of the
specification). Sequence motif 5'AAN(15-23) misc_feature (3)..(25)
n = a, t/u, g, c, unknown or other 60 aannnnnnnn nnnnnnnnnn nnnnn
25 61 17 DNA Artificial sequence Sequence of a dsRNA, wherein the
sequence of the dsRNA comprises the nucleotides TT at its 3'-end
(p.12 of the specification). Sequence motif 3'TTN(15-23)
misc_feature (1)..(15) n = a, t/u, g, c, unknown or other 61
nnnnnnnnnn nnnnntt 17 62 18 DNA Artificial sequence Sequence of a
dsRNA, wherein the sequence of the dsRNA comprises the nucleotides
TT at its 3'-end (p.12 of the specification). Sequence motif
3'TTN(15-23) misc_feature (1)..(16) n = a, t/u, g, c, unknown or
other 62 nnnnnnnnnn nnnnnntt 18 63 19 DNA Artificial sequence
Sequence of a dsRNA, wherein the sequence of the dsRNA comprises
the nucleotides TT at its 3'-end (p.12 of the specification).
Sequence motif 3'TTN(15-23) misc_feature (1)..(17) n = a, t/u, g,
c, unknown or other 63 nnnnnnnnnn nnnnnnntt 19 64 20 DNA Artificial
sequence Sequence of a dsRNA, wherein the sequence of the dsRNA
comprises the nucleotides TT at its 3'-end (p.12 of the
specification). Sequence motif 3'TTN(15-23) misc_feature (1)..(18)
n = a, t/u, g, c, unknown or other 64 nnnnnnnnnn nnnnnnnntt 20 65
21 DNA Artificial sequence Sequence of a dsRNA, wherein the
sequence of the dsRNA comprises the nucleotides TT at its 3'-end
(p.12 of the specification). Sequence motif 3'TTN(15-23)
misc_feature (1)..(19) n = a, t/u, g, c, unknown or other 65
nnnnnnnnnn nnnnnnnnnt t 21 66 22 DNA Artificial sequence Sequence
of a dsRNA, wherein the sequence of the dsRNA comprises the
nucleotides TT at its 3'-end (p.12 of the specification). Sequence
motif 3'TTN(15-23) misc_feature (1)..(20) n = a, t/u, g, c, unknown
or other 66 nnnnnnnnnn nnnnnnnnnn tt 22 67 23 DNA Artificial
sequence Sequence of a dsRNA, wherein the sequence of the dsRNA
comprises the nucleotides TT at its 3'-end (p.12 of the
specification). Sequence motif 3'TTN(15-23) misc_feature (1)..(21)
n = a, t/u, g, c, unknown or other 67 nnnnnnnnnn nnnnnnnnnn ntt 23
68 24 DNA Artificial sequence Sequence of a dsRNA, wherein the
sequence of the dsRNA comprises the nucleotides TT at its 3'-end
(p.12 of the specification). Sequence motif 3'TTN(15-23)
misc_feature (1)..(22) n = a, t/u, g, c, unknown or other 68
nnnnnnnnnn nnnnnnnnnn nntt 24 69 25 DNA Artificial sequence
Sequence of a dsRNA, wherein the sequence of the dsRNA comprises
the nucleotides TT at its 3'-end (p.12 of the specification).
Sequence motif 3'TTN(15-23) misc_feature (1)..(23) n = a, t/u, g,
c, unknown or other 69 nnnnnnnnnn nnnnnnnnnn nnntt 25 70 21 RNA
Rattus norvegicus misc_feature (1)..(21) Target sequence of
VGLUT2-mRNA (p. 17 of the specification). 70 aaggcuccgc uaugcgacug
u 21 71 21 DNA Artificial sequence Sense strand of dsRNA, directed
to the afore disclosed target sequence of VGLUT2-mRNA from rat
(having an overhanging TT at its 3'-terminus). (p. 17 of the
specification). 71 ggcuccgcua ugcgacugut t 21 72 21 DNA Artificial
sequence Antisense strand of dsRNA, directed to the afore disclosed
target sequence of VGLUT2-mRNA from rat (having an overhanging TT
at its 3'-terminus). (p. 17 of the specification). 72 acagucgcau
agcggagcct t 21 73 21 DNA Artificial sequence si-rVGLUT1 739-759
EGT (p. 36 of the specification). 73 agcgccaagc ucaugaacct t 21 74
21 DNA Artificial sequence si-rVGLUT1 739-759 EGT (p. 36 of the
specification) 74 gguucaugag cuuggcgcut t 21 75 21 DNA Artificial
sequence si-rVGLUT2 100-120 EGT (active siRNA) (p. 36 of the
specification) 75 gcaggauaac cgagagacct t 21 76 21 DNA Artificial
sequence si-rVGLUT2 100-120 EGT (active siRNA) (p. 36 of the
specification) 76 ggucucucgg uuauccugct t 21 77 21 DNA Artificial
sequence si-rVGLUT3 220-240 EGT (p. 36 of the specification) 77
gcgguacauc aucgcuguct t 21 78 21 DNA Artificial sequence si-rVGLUT3
220-240 EGT (p. 36 of the specification) 78 gacagcgaug auguaccgct t
21 79 21 DNA Artificial sequence si-VGLUT2 MM EGT (siRNA control )
(p. 36 of the specification) 79 ggacuagcaa agcgagccat t 21 80 21
DNA Artificial sequence si-VGLUT2 MM EGT (siRNA control ) (p. 36 of
the specification) 80 uggcucgcuu ugcuagucct t 21 81 21 DNA
Artificial sequence si-rVGLUT2 100-120 AMB (active siRNA) (p. 36 of
the specification) 81
gcaggauaac cgagagacct t 21 82 21 DNA Artificial sequence si-rVGLUT2
100-120 AMB (active siRNA) (p. 36 of the specification) 82
ggucucucgg uuauccugct t 21 83 21 DNA Artificial sequence si-rVGLUT2
166-186 AMB (p. 36 of the specification) 83 ggcuccgcua ugcgacugut t
21 84 21 DNA Artificial sequence si-rVGLUT2 166-186 AMB (p. 37 of
the specification) 84 acagucgcau agcggagcct t 21 85 21 DNA Rattus
norvegicus misc_feature (1)..(21) Target sequence of VGLUT2 from
rat (p. 18 of the specification). 85 aagcaggata accgagagac c 21 86
21 RNA Rattus norvegicus misc_feature (1)..(21) Target sequence of
VGLUT2-mRNA from rat (p. 48 of the specification). 86 aagcaggaua
accgagagac c 21 87 21 DNA Artificial sequence Sense strand of
siRNA, directed to the afore disclosed target sequence of VGLUT2 or
to the target sequence of VGLUT2-mRNA, respectively (p. 18 u. 48 of
the specification). misc_feature (20)..(20) T = dT (desoxy
Thymidin) misc_feature (21)..(21) T = dT (desoxy Thymidin) 87
gcaggauaac cgagagacct t 21 88 21 DNA Artificial sequence Antisense
strand of siRNA, directed to the afore disclosed target sequence of
VGLUT2 or to the target sequence of VGLUT2-mRNA, respectively (p.
18 u. 48 of the specification). misc_feature (20)..(20) T = dT
(desoxy Thymidin) misc_feature (21)..(21) T = dT (desoxy Thymidin)
88 ggucucucgg uuauccugct t 21 89 21 DNA Artificial sequence Target
sequence (no VGLUT2 sequence) of siRNA control in Example 4. (p. 48
of the specification). 89 aaggactagc aaagcgagcc a 21 90 21 DNA
Artificial sequence Sense strand of double stranded siRNA control,
directed to the afore disclosed target sequence. (p. 48 of the
specification). misc_feature (20)..(20) T = dT (desoxy Thymidin)
misc_feature (21)..(21) T = dT (desoxy Thymidin) 90 ggacuagcaa
agcgagccat t 21 91 21 DNA Artificial sequence Antisense strand of
double stranded siRNA control, directed to the afore disclosed
target sequence. (p. 48 of the specification). misc_feature
(20)..(20) T = dT (desoxy Thymidin) misc_feature (21)..(21) T = dT
(desoxy Thymidin) 91 uggcucgcuu ugcuagucct t 21 92 19 DNA
Artificial sequence PCR primer rVGluT1(2_4)F; (p. 56 of the
specification). 92 tctgggtttc tgcatcagc 19 93 20 DNA Artificial
sequence PCR primer rVGluT1(2_4)R; (p. 56 of the specification). 93
ccatgtatga ggccgacagt 20 94 20 DNA Artificial sequence PCR primer
rVGluT2(8_9)F; (p. 56 of the specification). 94 aagaccccat
ggaggaagtt 20 95 20 DNA Artificial sequence PCR primer
rVGluT2(8_9)R; (p. 56 of the specification). 95 attgtcatga
ccaggtgtgg 20 96 20 DNA Artificial sequence PCR primer
rVGluT3(4_5)F; (p. 56 of the specification). 96 atccagagac
ggtgggtctt 20 97 20 DNA Artificial sequence PCR primer
rVGluT3(4_5)R; (p. 56 of the specification). 97 atgacacagc
cgtaatgcac 20 98 20 DNA Artificial sequence PCR primer
rGAPDH(7_8)F; (p. 56 of the specification). 98 atcctgggct
acactgagga 20 99 20 DNA Artificial sequence PCR primer
rGAPDH(7_8)R; (p. 56 of the specification). 99 atgtaggcca
tgaggtccac 20 100 29 DNA Artificial sequence Primer rVGluT2 TS10
as; (p. 56 of the specification). 100 aagcaggata accgagagac
ccctgtctc 29 101 29 DNA Artificial sequence Primer rVGluT2 TS10 s;
(p. 56 of the specification). 101 aaggtctctc ggttatcctg ccctgtctc
29 102 29 DNA Artificial sequence Primer rVGluT2 TS14 as; (p. 57 of
the specification). 102 aaggctccgc tatgcgactg tcctgtctc 29 103 29
DNA Artificial sequence Primer rVGluT2 TS14 s; (p. 57 of the
specification). 103 aaacagtcgc atagcggagc ccctgtctc 29 104 1683 DNA
Unknown Coding sequence of VGLUT1, having the accession number
U07609 (Fig. 5). 104 atggagttcc ggcaggagga gtttcggaag ctggcggggc
gcgccctggg gaggctgcac 60 cggttactgg agaagcggca ggaaggcgcg
gagacattgg agctgagcgc cgacgggcgc 120 ccagtgacca cacacacgcg
ggacccgccg gtggtggact gcacttgctt tggcctccct 180 cgccgctaca
tcatcgcgat catgagcggt ctgggtttct gcatcagctt tggcatccgc 240
tgcaacctgg gcgtggccat cgtatccatg gtcaacaaca gtacaaccca ccgtgggggc
300 cacgtggtgg tgcagaaagc ccagttcaac tgggatccag agactgtcgg
cctcatacat 360 ggctcctttt tctgggggta cattgtcact cagattcctg
gaggatttat ctgccaaaaa 420 ttcgcagcca acagggtctt tggctttgcc
attgtggcta cctccaccct aaatatgttg 480 atcccttcag cagcccgtgt
tcactatggc tgtgtcatct tcgtgaggat ccttcaggga 540 ttggtggagg
gggtcacata ccctgcttgc catggcatct ggagcaaatg ggcccctccc 600
ttagaacgga gtcggctggc gacgacagcc ttttgcggtt cctatgccgg ggcagtggtt
660 gccatgcctc tggctggggt cctggtacag tattcaggat ggagttctgt
cttctatgtc 720 tatggcagct tcgggatctt ttggtacctg ttctggttgc
ttgtctccta cgagtcacct 780 gcactacacc ccagcatctc cgaggaggag
cgcaaataca ttgaggatgc catcggagaa 840 agcgccaagc tcatgaaccc
tgttacgaag tttaacacac cctggaggcg cttctttacc 900 tccatgccgg
tctatgccat cattgtcgcc aacttttgcc gcagctggac tttctacctg 960
ctcctcatct cccagcccgc ctactttgaa gaagtgttcg gctttgagat cagcaaggtg
1020 ggactggtgt cggcactgcc tcaccttgtc atgactatca tcgtacccat
cggaggccag 1080 atcgccgact tcctgcgcag tcgtcatata atgtccacga
ccaatgtgcg aaagctgatg 1140 aactgcgggg gtttcgggat ggaagctacg
ctgctgctgg tggtcggata ctcacactcc 1200 aagggcgtgg ccatctcctt
cctggtcctg gctgtgggct tcagtggctt tgctatctct 1260 gggtttaacg
tgaaccactt ggacatcgcc cctcgatatg ccagcatctt gatgggcatt 1320
tccaatggcg tgggcacact gtctgggatg gtgtgcccca tcatcgtggg tgcaatgacc
1380 aagcacaaga cgcgggagga gtggcagtac gtgttcctca tagcctccct
ggtgcactat 1440 ggaggtgtca tcttctatgg ggtctttgct tcgggagaga
aacagccgtg ggcagagccg 1500 gaggagatga gcgaggagaa gtgtggcttt
gttggccacg accagctggc tggcagtgac 1560 gaaagtgaaa tggaagacga
ggttgagccc ccgggggcac cccccgcacc tccgccttcc 1620 tacggggcca
cacacagcac agttcagcct ccaaggcccc caccccctgt ccgggactac 1680 tga
1683 105 1749 DNA Rattus norvegicus misc_feature (1)..(1749) Coding
sequence of VGLUT2,; Genbank accession number NM_053427 (Figur 6).
105 atggagtcgg taaaacaaag gattttggcc ccggggaaag aggggataaa
gaattttgct 60 ggaaaatccc tcggacagat ctacagggtg ctggagaaga
agcaggataa ccgagagacc 120 atcgagctga cagaggacgg caagcccctg
gaggtgcctg agaagaaggc tccgctatgc 180 gactgtacgt gcttcggcct
gccgcgccgc tacatcatag ccatcatgag cggcctcggc 240 ttctgcatct
cctttggtat ccgctgtaac ctgggtgtgg ccattgtgga catggtcaac 300
aacagcacca tccaccgggg tggcaaagtt atcaaggaga aagccaagtt taactgggac
360 cccgagactg tggggatgat tcacgggtcg ttcttctggg gctatatcat
cacgcagatt 420 ccgggcggat acatcgcatc gcgactggct gctaaccggg
tctttggggc tgccatactg 480 cttacctcta ccctcaatat gctgatccca
tctgcagcca gagtgcatta tggatgcgtc 540 atctttgtta gaatattgca
aggacttgtg gagggcgtca cctacccagc ctgtcacggg 600 atatggagca
agtgggcccc tcctttggag aggagtaggt tggctaccac ctccttctgt 660
ggttcctatg ctggagcagt cattgcaatg cccctagctg gtatcctggt gcagtacact
720 ggatggtctt cagtatttta cgtatatgga agctttggta tggtctggta
tatgttctgg 780 cttctggtgt cttacgagag ccccgcaaag catccaacca
taacagacga agaacgtagg 840 tacatagaag agagcatcgg ggagagcgca
aatctgttag gagcaatgga gaaattcaag 900 accccatgga ggaagttttt
cacatccatg cccgtctatg cgataattgt tgcaaacttc 960 tgcaggagtt
ggacttttta tttactgctc atcagtcaac cagcttattt cgaggaggtt 1020
tttggatttg aaatcagcaa ggttggcatg ttgtctgcgg tcccacacct ggtcatgaca
1080 atcattgtgc ctatcggggg gcaaattgca gactttctaa ggagcaagca
aattctttca 1140 acaactacag tgcgaaagat catgaactgc gggggttttg
gcatggaagc cacactgctt 1200 ctggttgttg gctactctca tactagaggg
gtggccatct ccttcttggt gcttgcagtg 1260 ggattcagtg gatttgctat
ctctggtttc aatgtgaacc acttggatat tgccccgaga 1320 tatgccagta
tcttaatggg catttcaaat ggtgttggca cgctgtcggg aatggtctgc 1380
ccgatcattg ttggtgcaat gacgaagaac aagtcccgtg aagaatggca gtatgtcttc
1440 ctcatcgctg cactggtcca ctatggtgga gtcatatttt atgcactatt
tgcctcagga 1500 gagaagcaac cttgggcaga ccctgaggaa acaagcgaag
aaaagtgtgg cttcattcat 1560 gaagatgaac tggatgaaga aacgggggac
atcactcaga attacataaa ttacggtacc 1620 accaaatcct acggcgccac
ctcacaggag aacggaggct ggcctaacgg ctgggagaaa 1680 aaggaagaat
ttgtgcaaga aagtgcgcaa gacgcgtact cctataagga ccgagatgat 1740
tattcataa 1749 106 1767 DNA Unknown Coding sequence of VGLUT3
having the accession number AJ491795 (Fig. 7). 106 atgccattta
acgcatttga taccttcaaa gaaaaaattt tgaaacccgg gaaggaagga 60
gtgaagaatg ccgtgggaga ttcgctgggg atcttacaaa gaaaactcga tgggaccaac
120 gaggagggag atgccattga gctgagtgag gaaggaaggc ccgtgcagac
atccagagcc 180 cgagcccctg tgtgcgactg cagctgctgt ggcatcccca
agcggtacat catcgctgtc 240 atgagtggcc tgggattctg catttccttt
gggattcggt gcaaccttgg agtggccatt 300 gtggaaatgg tcaacaatag
cactgtgtat gtggatggga aaccggaaat ccagacagca 360 cagtttaact
gggatccaga gacggtgggt cttatccatg gatctttttt ctggggttat 420
attgtgacac aaattcccgg tggcttcatt tcaaacaagt ttgctgctaa cagggtcttt
480 ggagctgcca tcttcttgac gtcaaccctg aacatgttca tcccttccgc
ggccagggtg 540 cattacggct gtgtcatgtg tgtgaggatt ttgcagggtc
tggtggaggg tgtgacctac 600 ccagcctgcc acgggatgtg gagtaagtgg
gcacctcccc tggagagaag tcgtctagcc 660 acaacctctt tttgtggttc
ctatgccggg gcagtcgttg ctatgcccct tgcaggagta 720 ttggtgcagt
acattggctg ggcctctgtc ttttatattt acgggatgtt tggaattatt 780
tggtacatgt tttggctgct gcaggcttat gagtgtccag cagttcaccc aacaatatcc
840 aatgaagaac ggacctacat agagacaagt ataggagaag gcgccaactt
ggccagtctg 900 agcaaattca acacaccatg gagaaggttt ttcacatcct
tgcctgtcta tgccattatt 960 gtggcaaact tttgtagaag ctggaccttc
tatttgctct taataagtca gcctgcttac 1020 tttgaagagg tctttgggtt
tgcaataagt aaggtgggtc tcttgtcagc tgtcccacac 1080 atggtgatga
caatcgtggt acccattgga ggacaactgg ctgattattt aagaagccga 1140
aagattttga ccacaactgc tgtcagaaag atcatgaatt gtggaggctt tggcatggag
1200 gcaaccttgc tcctggtggt tgggttttcc cataccaaag gagtggctat
ctccttcctg 1260 gtgcttgctg taggatttag tggctttgca atttcaggtt
tcaatgtcaa ccacctggac 1320 attgctccac gatatgccag catcctcatg
gggatctcaa atggcgtggg aaccctctct 1380 ggaatggttt gtcccctcat
tgttggtgca atgacaaagc acaagacccg ggaagaatgg 1440 cagaatgtgt
tcctcatagc agccctggtg cactacagtg gagtcatctt ctacggggtc 1500
tttgcttctg gggaaaaaca ggactgggct gatccagaga atctctctga ggagaaatgt
1560 ggaatcattg accaagatga attagccgag gaaacagaac tcaaccacga
ggctttcgta 1620 agtcccagaa agaagatgtc ttatggagcc accacccaga
attgtgaggt ccagaagacg 1680 gatcggagac aacagagaga atccgccttc
gagggggagg agccattatc ctaccagaat 1740 gaagaggact tttcagaaac atcttaa
1767 107 2959 DNA Homo sapiens misc_feature (1)..(2959) VGLUT1
(Fig. 27A) 107 acttgcagcc tccttccccc cgagcggagc tgcggggccg
gccgggccgg ggcggacccc 60 gggaacccgg acgcggccgc ccgggcccgc
gggcgggggg atcggcgggg gggacccgcg 120 gggtgaccgg cggcaggagc
cgccaccatg gagttccgcc aggaggagtt tcggaagcta 180 gcgggtcgtg
ctctcgggaa gctgcaccgc cttctggaga agcggcagga aggcgcggag 240
acgctggagc tgagtgcgga tgggcgcccg gtgaccacgc agacccggga cccgccggtg
300 gtggactgca cctgcttcgg cctccctcgc cgctacatta tcgccatcat
gagtggtctg 360 ggcttctgca tcagctttgg catccgctgc aacctgggcg
tggccatcgt ctccatggtc 420 aataacagca cgacccaccg cgggggccac
gtggtggtgc agaaagccca gttcagctgg 480 gatccagaga ctgtcggcct
catacacggc tcctttttct ggggctacat tgtcactcag 540 attccaggag
gatttatctg tcaaaaattt gcagccaaca gagttttcgg ctttgctatt 600
gtggcaacat ccactctaaa catgctgatc ccctcagctg cccgcgtcca ctatggctgt
660 gtcatcttcg tgaggatcct gcaggggttg gtagaggggg tcacataccc
cgcctgccat 720 gggatctgga gcaaatgggc cccaccctta gaacggagtc
gcctggcgac gacagccttt 780 tgtggttcct atgctggggc ggtggtcgcg
atgcccctcg ccggggtcct tgtgcagtac 840 tcaggatgga gctctgtttt
ctacgtctac ggcagcttcg ggatcttctg gtacctgttc 900 tggctgctcg
tctcctacga gtcccccgcg ctgcacccaa gcatctcgga ggaggagcgc 960
aagtacatcg aggacgccat cggagagagc gcgaaactca tgaaccccct cacgaagttt
1020 agcactccct ggcggcgctt cttcacgtct atgccagtct atgccatcat
cgtggccaac 1080 ttctgccgca gctggacgtt ctacctgctg ctcatctccc
agcccgccta cttcgaagaa 1140 gtgttcggct tcgagatcag caaggtaggc
ctggtgtccg cgctgcccca cctggtcatg 1200 accatcatcg tgcccatcgg
cggccagatc gcggacttcc tgcggagccg ccgcatcatg 1260 tccaccacca
acgtgcgcaa gttgatgaac tgcggaggct tcggcatgga agccacgctg 1320
ctgttggtgg tcggctactc gcactccaag ggcgtggcca tctccttcct ggtcctagcc
1380 gtgggcttca gcggcttcgc catctctggg ttcaacgtga accacctgga
catagcccgg 1440 cgctacgcca gcatcctcat gggcatctcc aacggcgtgg
gcacactgtc gggcatggtg 1500 tgccccatca tcgtgggggc catgactaag
cacaagactc gggaggagtg gcagtacgtg 1560 ttcctaattg cctccctggt
gcactatgga ggtgtcatct tctacggggt ctttgcttct 1620 ggagagaagc
agccgtgggc agagcctgag gagatgagcg aggagaagtg tggcttcgtt 1680
ggccatgacc agctggctgg cagtgacgac agcgaaatgg aggatgaggc tgagcccccg
1740 ggggcacccc ctgcaccccc gccctcctat ggggccacac acagcacatt
tcagcccccc 1800 aggcccccac cccctgtccg ggactactga ccatgtgcct
cccactgaat ggcagtttcc 1860 aggacctcca ttccactcat ctctggcctg
agtgacagtg tcaaggaacc ctgctcctct 1920 ctgtcctgcc tcaggcctaa
gaagcactct cccttgttcc cagtgctgtc aaatcctctt 1980 tccttcccaa
ttgcctctca ggggtagtga agctgcagac tgacagtttc aaggataccc 2040
aaattcccct aaaggttccc tctccacccg ttctgcctca gtggtttcaa atctctcctt
2100 tcagggcttt atttgaatgg acagttcgac ctcttactct ctcttgtggt
tttgaggcac 2160 ccacaccccc cgctttcctt tatctccagg gactctcagg
ctaacctttg agatcactca 2220 gctcccatct cctttcagaa aaattcaagg
tcctcctcta gaagtttcaa atctctccca 2280 actctgttct gcatcttcca
gattggttta accaattact tgtccccgcc attccaggga 2340 ttgattctca
ccagcgtttc tgatggaaaa tggcggtttc aagtccccga ttccgtgccc 2400
acttcacatc tcccctacca gcagattctg cgaaagcacc aaatttctca agaccctctt
2460 ctccctagct tagcataatg tctggggaaa caaccaaaat cgcaatttta
acaatatgcc 2520 tctctacccc cgtgcacttt ttctgacatg gttttcaggt
ctaaatagtg gctgctccag 2580 tccatgaact caaaggtttg aagctaccac
cattgaactc ccccatggtg gtttcatgat 2640 gccccctccc caattcctcg
cactttattc tcctgggtgg tttcgaacta ccctgtttct 2700 cagtggccat
ttgttgtgtc cctcaggggc ttaatgactc aaaatctggg atccttcccc 2760
tctcagacac ccctctttca gcttagaatt tggggaacct atagagaagt cacagaatcc
2820 catgaaaggg aatggggcag gagacagggg tgttttttcc cagtgcaggg
ttgtgtcttt 2880 gtgtctctgt ctctgtgact gtaaatcctg ccctgcccca
ctcccaataa aagctttggt 2940 gtataggcaa aaaaaaaaa 2959 108 3946 DNA
Homo sapiens misc_feature (1)..(3946) VGLUT2 (Fig. 27B) 108
cgtttaaaag ccatcagatt tgagagcaat aagtcttcaa aaccgggaat ttacattgtt
60 tttcagctga ccgacttcca ggaaaaggac tcaaccgcat ctacccaaat
accgtggcac 120 tgcttgcgct ctttgccacc ggatactccc cttccaatga
gactttctga ttgtgtctac 180 caactctcct attaggaaac ccgtgggttg
catgcagcta ttctgttgta ttctcattct 240 cactctccct cccttctctc
actctcactc ttgctggagg cgagccacta ccattctgct 300 gagaaggaaa
agcccgcaac tactttaaga gattaagaca atatgcgcaa tcctcgcctt 360
tcctagcaat cactatttaa atctggcaag aactgacaac agtctttgca agaatggaat
420 ccgtaaaaca aaggattttg gccccaggaa aagaggggct aaagaatttt
gctggaaaat 480 cactcggcca gatctacagg gtgctggaga agaagcaaga
caccggggag acaatcgagc 540 tgacggagga tgggaagccc ctagaggtgc
ccgagaggaa ggcgccgctg tgcgactgca 600 cgtgcttcgg cctgccccgc
cgctacatta tcgccatcat gagcggcctg ggcttctgca 660 tctccttcgg
tatccgctgc aacctgggcg tggccattgt ggacatggtc aacaacagca 720
ccatccaccg cgggggcaag gtcatcaagg agaaagccaa attcaactgg gacccggaaa
780 ccgtggggat gatccacggt tccttctttt ggggctacat catcactcag
attccgggag 840 gctacatcgc gtctcggctg gcagccaaca gggttttcgg
agctgccata cttcttacct 900 ctaccctaaa tatgctaatt ccatcagcag
ccagagtgca ttatggatgt gtcatctttg 960 tcagaatact gcagggactt
gttgagggtg tgacctaccc agcatgtcat gggatatgga 1020 gcaaatgggc
cccacctcta gagaggagta gactggcaac cacctccttt tgtggttcct 1080
atgccggagc tgtgattgca atgcctttag ctggcattct tgtgcagtac actggctggt
1140 cttcagtgtt ttatgtctac ggaagctttg gaatggtctg gtacatgttt
tggcttttgg 1200 tgtcttatga aagtcctgca aagcatccta ctattacaga
tgaagaacgt aggtacatag 1260 aagaaagcat tggagagagt gcaaatcttt
taggtgcaat ggaaaaattc aagactccat 1320 ggaggaagtt ttttacatcc
atgccagtct atgcaataat tgttgcaaac ttctgcagaa 1380 gctggacttt
ttatttattg cttattagtc agccagcata ttttgaggaa gtctttggat 1440
ttgaaattag caaggttggt atgctatctg ctgtgccaca cttagtaatg acaattattg
1500 tgcctattgg gggacaaatt gcagattttc taagaagcaa gcagattctt
tcaactacga 1560 cagtgagaaa gatcatgaat tgtggtggtt ttggcatgga
agccacactg ctcctggtcg 1620 ttggctattc tcatactaga ggggtagcaa
tctcattctt ggtacttgca gtgggattca 1680 gtggatttgc tatatctggt
ttcaatgtta accacttgga tatcgctcca agatatgcca 1740 gtatcttaat
gggcatttcg aatggtgttg gcacattgtc aggaatggtt tgtcctatca 1800
ttgttggtgc aatgacaaag aataagtcac gtgaagagtg gcagtatgtc ttcctgatcg
1860 ctgccctagt ccactatggt ggagttatat tttatgcaat atttgcctca
ggagagaaac 1920 aaccctgggc agacccggag gaaacaagtg aagaaaaatg
tggatttatt catgaagatg 1980 aactcgatga agaaacaggg gacattactc
aaaattatat aaattatggt accaccaagt 2040 cttatggtgc cacaacacag
gccaatggag gttggcctag tggttgggaa aagaaagagg 2100 aatttgtaca
aggagaagta caagactcac atagctataa ggaccgagtt gattattcat 2160
aacaaaacta attactggat ttatttttag tgtttgtgat taaattcatt gtgattgcac
2220 aaaaatttta aaaacacgtg atgtaaactt
gcaagcatat caaccaggca agtcttgctg 2280 taaaaatgaa aacaaaacaa
acccatgagg ttaccatcaa gtgcaatctg taaaattgtg 2340 aagttccatc
atttccattc aagtcatcca ttcttgcatt tgtgacttaa aggttgactg 2400
gtcaaaattg tagaaacaag tagttaccca ttggattcat atgagctaaa actcatcact
2460 atttactaaa gcacaacatc tcatcctaca aaagttaaga agccaaagct
acttgatcat 2520 gcaaaatgca cttatatatt tgttacactg tattgcaaga
tagcacacag aagttggctg 2580 cgtcaagtag aggcgacatt tattaagtga
aaatcatgga gttgggatat ctctcaatta 2640 aagaaataca ttgtgaacta
tcagctacaa agttgtactg aataactatt agaattgcat 2700 aatgtgagat
attttgttag tcctcaaaag gaatatcttg cagtgttttc tatgaaatgc 2760
ttgggcacaa acacttattt ctgtgaaaga gaacatgtaa gttgaggggt atgcttcatg
2820 ttcttccatc catttaccta atagtatgaa acagttcaca tttcaataaa
atcaaacttt 2880 tcatgtagcg tatcacataa cttttttgca aaaaatataa
aaagaaataa acttcaatgt 2940 attttttatt acaactttgt actggttgta
acttgcatta gaaaaaaaaa agagatatat 3000 aaaccacaaa gaatctaata
agaaatttat tatggagata tagcccttaa aatgcaatat 3060 taagaacaaa
gaaatagaaa atggtttaga tatctttctt ccttcataat taaatactat 3120
atgaaacttg tgccacagag ctatatgtaa tatgaaaaga ttaacttcat agagatattg
3180 taagtaggta attttattat ttaaagtcct attaagaaat atttgtctta
aatatatagg 3240 acaatacatt atattaaaat ggtctctctc tatatatatc
tgtatatctt atacatgtcc 3300 atacacagaa acataataaa caatcttcac
acgaaaccaa aaatagcata cacctaatgt 3360 tgggttaggg aattgcaatt
tctactttca tagagtcata gaattttagg tggggaagag 3420 gcattttgct
tgtcatttct taatataact caacaagaat tgcaacattt gtgtaccaag 3480
caataagtgc aatgcataaa atttcctgtc tgtatattac cttcattttg cttgtagtag
3540 ctgtttgggt ggttggaata attttatttt tcttttaaaa aagctaacat
cagacccctt 3600 tataatgtcc taaaattatg ataatacatt tcccaattca
actcaaaata ttattggtgt 3660 attttgtcta ttctggatat ttgatctgtt
taatgtactg tgctagtgac tggaggccct 3720 gctactgcaa atataaaacc
taaagtttgt ttaaaaaaat gcaaatcatt ctttacctta 3780 agaaaaaaaa
aatacccttt gctttgtgcc tcaaagtgat gtaatgtgat cacagctttt 3840
gttgtgttga atgaaaatat gtggactgtc attttgttgc agcaaaaaag tgttaataaa
3900 atgctctatt tatccttttt taaaaaaaaa aaaaaaaaaa aaaaaa 3946 109
3838 DNA Homo sapiens misc_feature (1)..(3838) VGLUT3 (Fig. 27C)
109 tcttggaaga tccgagctgg gtttcatctc ctttttgatt ttgagtagtt
ccctccacga 60 gaactgactt ccaggtgttc accaagggaa acaaggtggt
tctcacactg gaaatgagga 120 aggatgacag tttttgagac tgactgttaa
cggctcagag gtgcccctca ttcaaaatgc 180 cttttaaagc atttgatacc
ttcaaagaaa aaattctgaa acctgggaag gaaggagtga 240 agaacgccgt
gggagattct ttgggaattt tacaaagaaa aatcgatggg acaactgagg 300
aagaagataa cattgagctg aatgaagaag gaaggccggt gcagacgtcc aggccaagcc
360 ccccactctg cgactgccac tgctgcggcc tccccaagcg ttacatcatt
gctatcatga 420 gtgggctggg attctgcatt tcctttggga tccggtgcaa
tcttggagtt gccattgtgg 480 aaatggtcaa caatagcacc gtatatgttg
atggaaaacc ggaaattcag acagcacagt 540 ttaactggga tccagaaaca
gtgggcctta tccatggatc ttttttctgg ggctatatta 600 tgacacaaat
tccaggtggt ttcatttcaa acaagtttgc tgctaacagg gtctttggag 660
ctgccatctt cttaacatcg actctgaaca tgtttattcc ctctgcagcc agagtgcatt
720 acggatgcgt catgtgtgtc agaattctgc aaggtttagt ggagggtgtg
acctacccag 780 cctgccatgg gatgtggagt aagtgggcac cacctttgga
gagaagccga ctggccacaa 840 cctctttttg tggttcctat gcaggggcag
tggttgccat gcccctggct ggggtgttgg 900 tgcagtacat tggatggtcc
tctgtctttt atatttatgg catgtttggg attatttggt 960 acatgttttg
gctgttgcag gcctatgagt gcccagcagc tcatccaaca atatccaatg 1020
aggagaagac ctatatagag acaagcatag gagagggggc caacgtggtt agtctaagta
1080 aatttagtac cccatggaaa agatttttca catctttgcc ggtttacgca
atcattgtgg 1140 caaatttttg cagaagctgg accttttatt tgctcctcat
aagtcagcct gcttattttg 1200 aagaggtctt tggatttgca ataagtaagg
tgggtctctt gtcagcagtc ccacacatgg 1260 ttatgacaat cgttgtacct
attggaggac aattggctga ttatttaaga agcagacaaa 1320 ttttaaccac
aactgctgtc agaaaaatca tgaactgtgg aggttttggc atggaggcaa 1380
ccttactcct ggtggttggc ttttcgcata ccaaaggggt ggctatctcc tttctggtac
1440 ttgctgtagg atttagtggc ttcgctattt caggttttaa tgtcaaccac
ctggacattg 1500 ccccacgcta tgccagcatt ctcatgggga tctcaaacgg
agtgggaacc ctctctggaa 1560 tggtctgtcc cctcattgtc ggtgcaatga
ccaggcacaa gacccgtgaa gaatggcaga 1620 atgtgttcct catagctgcc
ctggtgcatt acagtggtgt gatcttctat ggggtctttg 1680 cttctgggga
gaaacaggag tgggctgacc cagagaatct ctctgaggag aaatgtggaa 1740
tcattgacca ggacgaatta gctgaggaga tagaactcaa ccatgagagt tttgcgagtc
1800 ccaaaaagaa gatgtcttat ggagccacct cccagaattg tgaagtccag
aagaaggaat 1860 ggaaaggaca gagaggagcg acccttgatg aggaagagct
gacatcctac cagaatgaag 1920 agagaaactt ctcaactata tcctaatgtc
tgagaggcac ttctgtcttc tccttacttt 1980 agaaacagaa agtatccata
cctattgcct ttcttgtagc ccagcttgcc agaggtccaa 2040 atattgggag
gggagaagat ctaaccagca acagggaaaa gagaaatatt atctttcaat 2100
gacatgtata ggtaaggagc tgcgctcagt tgataacata gttgataata catatttttt
2160 gaattgacag ttgacccttc tctcaaagag ctaaacttat tcagaaagga
atgactagaa 2220 gaaaaaggag acaataccat gttgttcaaa gaaacattga
aggaaattgg gatgtttggc 2280 cagaaggaat gtaaacagta gtagtagctg
ccaccacatc tctagggtag ccatgcagag 2340 gagggcttca tattcccaat
aaaccccacg ttgtggcagg tgctttataa acactcttat 2400 ttaatctcca
cacctttatg acacacattt cttatcccca ttttacaacc aaggcatcta 2460
aagcaacaag aaatgaactt gcccaaggtc atctgccagg gtcagtgctg agactgttga
2520 agctctcaat aggtggcagt tttagggaag atttccattc agtgtaggga
agacatttgt 2580 aataatgaaa actgaaaatg gagtaattgt gagtaactca
ccactttagc aggtgttggg 2640 gaagggaaac atttgggttg atgaggcaga
ggggattcaa atgtgtgaga ggctagattc 2700 aaagaccctc agtgttctat
gttatctgaa gagtcaaatg gttttgtgac tccatagttt 2760 ttaaagtaat
aagggtcaaa gactacatca gagattcaaa taggttttta aagaaaagct 2820
aagcaagaga gccaaatttt tagaaatctg atggtcaaaa tagctgaaag cagtaaacaa
2880 gagattggct attaaatttc aactttccat aatattaaga atgtagctaa
atgatgtccc 2940 aaactactta caaactttta agacatttaa taatttaaga
agtaggttca tgtgttttct 3000 taggtaaagt tcttctgaaa gaattttcta
tttttaaaaa atgtatctct ttagcctttt 3060 ctgctggaga ttatattagg
aagtttcatc agattgtata aaattatgat tttgtatcaa 3120 aagtattcat
gatgactcta tttggaatga tattcaggga aatcacaata atatagcagt 3180
agttatacag agaaatacta caatgaaaac atttggggca attagaccta cagttactgt
3240 tgaaaaattc acctttgatt gcataaggca attacatgga tacttttaga
tatatttaaa 3300 attttaacat tggcatctaa agtgttattt gaaaataaaa
ttattttcct gttcattgat 3360 tttaaacatt ttattcctac tttcagaaga
aaaatataat acggaaaaaa ttatagattt 3420 acttgtagct tattattgta
aagtgttttt tttttttttc taatttctcc cacatgtatt 3480 tctggtcccc
agtgatacta gctgagttgt agtgtatttt ataaatggaa taatcttggg 3540
gaaaaattgc gattcttcat taaataatat tctttatgtc actagcatac aatttatgtt
3600 agtagacatc tttaaatctc tttaatgagt gaatccatgc aagccccata
aaacagttcc 3660 tagcatgcag aaaatgccca cgtaaatagc tgtcatcatc
attatctttt aacattttgg 3720 gggactttcc agttgaaaag aaaacatgct
atgtcatttt tatccattat ccctggaact 3780 tattgtgaaa gttgtgctgt
tttctaagta aaataaaaaa taaaaaatta gcaattta 3838 110 21 RNA Unknown
Target sequence of a mRNA of a member of the VGLUT-Family, being
complementary to a dsRNA sequence according to the invention (claim
21). 110 aaguguacuu uaggcaaagg g 21 111 21 DNA Artificial sequence
Sense strand of dsRNA, which is complementary to the afore
disclosed target sequence (claim 22). misc_feature (20)..(20) T =
dT (desoxy Thymidin) misc_feature (21)..(21) T = dT (desoxy
Thymidin) 111 guguacuuua ggcaaagggt t 21 112 21 DNA Artificial
sequence Antisense strand of dsRNA, which is complementary to the
afore disclosed target sequence (claim 22). misc_feature (20)..(20)
T = dT (desoxy Thymidin) misc_feature (21)..(21) T = dT (desoxy
Thymidin) 112 cccuuugccu aaaguacact t 21
* * * * *