U.S. patent number 7,955,814 [Application Number 11/671,953] was granted by the patent office on 2011-06-07 for method.
This patent grant is currently assigned to Danisco A/S. Invention is credited to Arno De Kreij, Jonathan Goodwins, Susan Mampusti Madrid, Jorn Dalgaard Mikkelsen, Jorn Borch Soe, Mark Turner.
United States Patent |
7,955,814 |
De Kreij , et al. |
June 7, 2011 |
Method
Abstract
A method for the in situ production of an emulsifier in a
foodstuff, wherein a lipid acyltransferase is added to the
foodstuff. Preferably the emulsifier is produced without an
increase or without a substantial increase in the free fatty acid
content of the foodstuff. Preferably, the lipid acyltransferase is
one which is capable of transferring an acyl group from a lipid to
one or more of the following acyl acceptors: a sterol, a stanol, a
carbohydrate, a protein or a sub-unit thereof, glycerol.
Preferably, in addition to an emulsifier one or more of a stanol
ester or a stanol ester or a protein ester or a carbohydrate ester
or a diglyceride or a monoglyceride may be produced. One or more of
these may function as an additional emulsifier.
Inventors: |
De Kreij; Arno (Lausanne,
CH), Madrid; Susan Mampusti (Vedbaek, DK),
Mikkelsen; Jorn Dalgaard (Hvidovre, DK), Soe; Jorn
Borch (Tilst, DK), Turner; Mark (Hosholm,
DK), Goodwins; Jonathan (Indres et Loire,
FR) |
Assignee: |
Danisco A/S (Copenhagen,
DK)
|
Family
ID: |
36145667 |
Appl.
No.: |
11/671,953 |
Filed: |
February 6, 2007 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20080063783 A1 |
Mar 13, 2008 |
|
Related U.S. Patent Documents
|
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
Issue Date |
|
|
11182408 |
Jul 15, 2005 |
|
|
|
|
PCT/IB2004/000655 |
Jan 15, 2004 |
|
|
|
|
60489441 |
Jul 23, 2003 |
|
|
|
|
Foreign Application Priority Data
|
|
|
|
|
Jan 17, 2003 [GB] |
|
|
0301117.8 |
Jan 17, 2003 [GB] |
|
|
0301118.6 |
Jan 17, 2003 [GB] |
|
|
0301119.4 |
Jan 17, 2003 [GB] |
|
|
0301120.2 |
Jan 17, 2003 [GB] |
|
|
0301121.0 |
Jan 17, 2003 [GB] |
|
|
0301122.8 |
Dec 24, 2003 [GB] |
|
|
0330016.7 |
|
Current U.S.
Class: |
435/15; 426/49;
435/193 |
Current CPC
Class: |
C12Y
301/01032 (20130101); C12Y 301/01004 (20130101); A23L
29/06 (20160801); A23C 19/0328 (20130101); A23C
19/054 (20130101); C12Y 301/01003 (20130101); A23L
23/00 (20160801); A23C 9/1216 (20130101); A23L
27/60 (20160801); A23L 15/25 (20160801); C12Y
301/01026 (20130101); A23L 29/10 (20160801); A23V
2002/00 (20130101); A23V 2002/00 (20130101); A23V
2200/222 (20130101); A23V 2250/192 (20130101); A23V
2250/1846 (20130101); A23V 2250/2136 (20130101); A23V
2250/21372 (20130101); A23V 2250/21362 (20130101) |
Current International
Class: |
C12Q
1/48 (20060101); C12N 9/10 (20060101) |
Field of
Search: |
;435/15,193 ;426/49 |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
331094 |
|
Feb 1995 |
|
AR |
|
249546 |
|
Dec 1996 |
|
AR |
|
P000105426 |
|
Oct 2000 |
|
AR |
|
P040101441 |
|
Apr 2004 |
|
AR |
|
110 768 |
|
Aug 1987 |
|
AT |
|
570720 |
|
Sep 1984 |
|
AU |
|
723031 |
|
Apr 1998 |
|
AU |
|
754470 |
|
Nov 1999 |
|
AU |
|
8404421-7 |
|
Apr 1984 |
|
BR |
|
1270781 |
|
Jun 1990 |
|
CA |
|
2012723 |
|
Sep 1990 |
|
CA |
|
2134597 |
|
Oct 1994 |
|
CA |
|
2224143 |
|
Dec 1996 |
|
CA |
|
2 403 025 |
|
Apr 2004 |
|
CA |
|
036151 |
|
Feb 2002 |
|
CN |
|
172509 |
|
Jun 2003 |
|
CN |
|
97181706.5 |
|
Oct 2003 |
|
CN |
|
101200754 |
|
Dec 2007 |
|
CN |
|
2817087 |
|
Nov 1978 |
|
DE |
|
19620649 |
|
Nov 1997 |
|
DE |
|
69129988 |
|
Mar 1999 |
|
DE |
|
69330066 |
|
Oct 2001 |
|
DE |
|
10018787 |
|
May 2002 |
|
DE |
|
69527835 |
|
Apr 2003 |
|
DE |
|
69528070 |
|
Jun 2003 |
|
DE |
|
69333065 |
|
Jul 2003 |
|
DE |
|
69904161 |
|
Jul 2003 |
|
DE |
|
69716711 |
|
Sep 2003 |
|
DE |
|
69333065 |
|
Apr 2004 |
|
DE |
|
69531538 |
|
Jun 2004 |
|
DE |
|
69819782 |
|
Sep 2004 |
|
DE |
|
3106.200 |
|
Jan 1989 |
|
DK |
|
157560 |
|
Jan 1990 |
|
DK |
|
PA0888/92 |
|
Jul 1992 |
|
DK |
|
0217/94 |
|
Feb 1994 |
|
DK |
|
PA0830/95 |
|
Jul 1995 |
|
DK |
|
PA1096/95 |
|
Sep 1995 |
|
DK |
|
152763 |
|
Mar 1998 |
|
DK |
|
PA0543/98 |
|
Apr 1998 |
|
DK |
|
PA199801572 |
|
Nov 1998 |
|
DK |
|
PA5677000 |
|
Dec 1998 |
|
DK |
|
PA199801604 |
|
Dec 1998 |
|
DK |
|
PA199901736 |
|
Dec 1999 |
|
DK |
|
PA200000989 |
|
Jun 2000 |
|
DK |
|
PA200000991 |
|
Jun 2000 |
|
DK |
|
PA200100285 |
|
Feb 2001 |
|
DK |
|
PA200100843 |
|
May 2001 |
|
DK |
|
EP659049 |
|
Jun 2001 |
|
DK |
|
EP0784674 |
|
Nov 2002 |
|
DK |
|
EP0869167 |
|
Jan 2003 |
|
DK |
|
EP1073339 |
|
Jan 2003 |
|
DK |
|
PA200300634 |
|
Apr 2003 |
|
DK |
|
5559215 |
|
Jul 2003 |
|
DK |
|
EP0746608 |
|
Oct 2003 |
|
DK |
|
EP1042458 |
|
Mar 2004 |
|
DK |
|
0064855 |
|
Nov 1982 |
|
EP |
|
0010296 |
|
Dec 1982 |
|
EP |
|
0109244 |
|
May 1984 |
|
EP |
|
0130064 |
|
Jan 1985 |
|
EP |
|
0140542 |
|
May 1985 |
|
EP |
|
0167309 |
|
Jan 1986 |
|
EP |
|
0171995 |
|
Feb 1986 |
|
EP |
|
0205208 |
|
Dec 1986 |
|
EP |
|
0206390 |
|
Dec 1986 |
|
EP |
|
0214761 |
|
Mar 1987 |
|
EP |
|
0257388 |
|
Mar 1988 |
|
EP |
|
0260573 |
|
Mar 1988 |
|
EP |
|
0334462 |
|
Sep 1989 |
|
EP |
|
0195311 |
|
Jun 1990 |
|
EP |
|
0375102 |
|
Jun 1990 |
|
EP |
|
0426211 |
|
May 1991 |
|
EP |
|
0445692 |
|
Sep 1991 |
|
EP |
|
0449375 |
|
Oct 1991 |
|
EP |
|
0468731 |
|
Jan 1992 |
|
EP |
|
0493045 |
|
Jul 1992 |
|
EP |
|
0583265 |
|
Oct 1992 |
|
EP |
|
0513709 |
|
Nov 1992 |
|
EP |
|
0542351 |
|
May 1993 |
|
EP |
|
0558112 |
|
Sep 1993 |
|
EP |
|
0258068 |
|
Nov 1993 |
|
EP |
|
0238023 |
|
Dec 1993 |
|
EP |
|
0575133 |
|
Dec 1993 |
|
EP |
|
0580252 |
|
Jan 1994 |
|
EP |
|
0258068 |
|
Aug 1994 |
|
EP |
|
0622446 |
|
Nov 1994 |
|
EP |
|
0652289 |
|
May 1995 |
|
EP |
|
0654527 |
|
May 1995 |
|
EP |
|
0396162 |
|
Sep 1995 |
|
EP |
|
0687414 |
|
Dec 1995 |
|
EP |
|
0585988 |
|
Mar 1996 |
|
EP |
|
0721981 |
|
Jul 1996 |
|
EP |
|
0752008 |
|
Jan 1997 |
|
EP |
|
0776604 |
|
Jun 1997 |
|
EP |
|
0531104 |
|
Aug 1997 |
|
EP |
|
0808903 |
|
Nov 1997 |
|
EP |
|
0682116 |
|
Dec 1997 |
|
EP |
|
0812910 |
|
Dec 1997 |
|
EP |
|
0305216 |
|
Mar 1998 |
|
EP |
|
0847701 |
|
Jun 1998 |
|
EP |
|
0548228 |
|
Aug 1998 |
|
EP |
|
0866796 |
|
Sep 1998 |
|
EP |
|
0702712 |
|
Dec 1998 |
|
EP |
|
0882797 |
|
Dec 1998 |
|
EP |
|
0897667 |
|
Feb 1999 |
|
EP |
|
0913092 |
|
May 1999 |
|
EP |
|
0913468 |
|
May 1999 |
|
EP |
|
0321811 |
|
Dec 1999 |
|
EP |
|
1131416 |
|
Jun 2000 |
|
EP |
|
0739985 |
|
Nov 2000 |
|
EP |
|
1057415 |
|
Dec 2000 |
|
EP |
|
1071734 |
|
Jan 2001 |
|
EP |
|
0659049 |
|
Mar 2001 |
|
EP |
|
1103606 |
|
May 2001 |
|
EP |
|
1108360 |
|
Jun 2001 |
|
EP |
|
1138763 |
|
Oct 2001 |
|
EP |
|
1145637 |
|
Oct 2001 |
|
EP |
|
0191217 |
|
Feb 2002 |
|
EP |
|
0869167 |
|
Feb 2002 |
|
EP |
|
1193314 |
|
Apr 2002 |
|
EP |
|
0746618 |
|
Aug 2002 |
|
EP |
|
1233676 |
|
Aug 2002 |
|
EP |
|
0648263 |
|
Sep 2002 |
|
EP |
|
0784674 |
|
Sep 2002 |
|
EP |
|
1073339 |
|
Nov 2002 |
|
EP |
|
1275711 |
|
Jan 2003 |
|
EP |
|
1285969 |
|
Feb 2003 |
|
EP |
|
1298205 |
|
Apr 2003 |
|
EP |
|
0635053 |
|
Jun 2003 |
|
EP |
|
0675944 |
|
Jun 2003 |
|
EP |
|
0817838 |
|
Jun 2003 |
|
EP |
|
1280919 |
|
Jun 2003 |
|
EP |
|
0746608 |
|
Aug 2003 |
|
EP |
|
0851913 |
|
May 2004 |
|
EP |
|
1262562 |
|
Jun 2004 |
|
EP |
|
1433852 |
|
Jun 2004 |
|
EP |
|
0977869 |
|
Jul 2004 |
|
EP |
|
0743017 |
|
Sep 2004 |
|
EP |
|
0675949 |
|
Oct 2004 |
|
EP |
|
0880590 |
|
Oct 2004 |
|
EP |
|
0897423 |
|
Oct 2004 |
|
EP |
|
1466980 |
|
Oct 2004 |
|
EP |
|
0839186 |
|
Nov 2004 |
|
EP |
|
1162889 |
|
Feb 2005 |
|
EP |
|
1532863 |
|
May 2005 |
|
EP |
|
1559788 |
|
Aug 2005 |
|
EP |
|
1363506 |
|
Nov 2005 |
|
EP |
|
1 624 047 |
|
Feb 2006 |
|
EP |
|
1 624 047 |
|
Oct 2006 |
|
EP |
|
1762622 |
|
Mar 2007 |
|
EP |
|
1 788 080 |
|
May 2007 |
|
EP |
|
535608 |
|
Sep 1984 |
|
ES |
|
535602 |
|
Oct 1984 |
|
ES |
|
535609 |
|
Mar 1985 |
|
ES |
|
1086550 |
|
Oct 1967 |
|
GB |
|
1442418 |
|
Jul 1976 |
|
GB |
|
1577933 |
|
Oct 1980 |
|
GB |
|
2264429 |
|
Sep 1993 |
|
GB |
|
0028701.1 |
|
Nov 2000 |
|
GB |
|
2358784 |
|
Aug 2001 |
|
GB |
|
0301117.8 |
|
Jan 2003 |
|
GB |
|
0301118.6 |
|
Jan 2003 |
|
GB |
|
0301119.4 |
|
Jan 2003 |
|
GB |
|
0301120.2 |
|
Jan 2003 |
|
GB |
|
0301121.1 |
|
Jan 2003 |
|
GB |
|
0301122.8 |
|
Jan 2003 |
|
GB |
|
2379165 |
|
Mar 2003 |
|
GB |
|
2267033 |
|
Nov 2003 |
|
GB |
|
0330016.7 |
|
Dec 2003 |
|
GB |
|
59183881 |
|
Apr 1960 |
|
JP |
|
54-76892 |
|
Jun 1979 |
|
JP |
|
5476892 |
|
Jun 1979 |
|
JP |
|
55131340 |
|
Oct 1980 |
|
JP |
|
57-189638 |
|
Nov 1982 |
|
JP |
|
57-189637 |
|
Dec 1982 |
|
JP |
|
60078529 |
|
May 1985 |
|
JP |
|
62118883 |
|
Nov 1985 |
|
JP |
|
63042691 |
|
Aug 1986 |
|
JP |
|
62061590 |
|
Mar 1987 |
|
JP |
|
62285749 |
|
Dec 1987 |
|
JP |
|
10203974 |
|
Aug 1988 |
|
JP |
|
1252294 |
|
Oct 1989 |
|
JP |
|
2-49593 |
|
Feb 1990 |
|
JP |
|
2-153997 |
|
Jun 1990 |
|
JP |
|
04075592 |
|
Mar 1992 |
|
JP |
|
6014773 |
|
Mar 1992 |
|
JP |
|
4121186 |
|
Apr 1992 |
|
JP |
|
15626492 |
|
Jun 1992 |
|
JP |
|
04200339 |
|
Jul 1992 |
|
JP |
|
4300839 |
|
Oct 1992 |
|
JP |
|
4327536 |
|
Nov 1992 |
|
JP |
|
5211852 |
|
Aug 1993 |
|
JP |
|
6345800 |
|
Dec 1994 |
|
JP |
|
8268882 |
|
Apr 1995 |
|
JP |
|
7231788 |
|
Sep 1995 |
|
JP |
|
7330794 |
|
Dec 1995 |
|
JP |
|
8143457 |
|
Jun 1996 |
|
JP |
|
8266213 |
|
Oct 1996 |
|
JP |
|
9040689 |
|
Feb 1997 |
|
JP |
|
10155493 |
|
Jun 1998 |
|
JP |
|
10155493 |
|
Jun 1998 |
|
JP |
|
11 228986 |
|
Aug 1999 |
|
JP |
|
11290078 |
|
Oct 1999 |
|
JP |
|
2000226335 |
|
Aug 2000 |
|
JP |
|
03/024096 |
|
Jul 2001 |
|
JP |
|
3553958 |
|
May 2004 |
|
JP |
|
93-700773 |
|
Mar 1993 |
|
KR |
|
94-10252 |
|
Oct 1994 |
|
KR |
|
95-700043 |
|
Jan 1995 |
|
KR |
|
95-702583 |
|
Jun 1995 |
|
KR |
|
96-704602 |
|
Aug 1996 |
|
KR |
|
2001-7012115 |
|
Sep 2001 |
|
KR |
|
2003-7008997 |
|
Oct 2003 |
|
KR |
|
0784674 |
|
Dec 2002 |
|
NL |
|
0869167 |
|
Jan 2003 |
|
NL |
|
1073339 |
|
Feb 2003 |
|
NL |
|
0746608 |
|
Nov 2003 |
|
NL |
|
31068 |
|
Nov 1984 |
|
PH |
|
2140751 |
|
Jun 1997 |
|
RU |
|
2235775 |
|
Nov 1999 |
|
RU |
|
2001117497 |
|
Jun 2001 |
|
RU |
|
9802548 |
|
Jul 1998 |
|
SE |
|
200101551 |
|
Dec 1999 |
|
TR |
|
88/02775 |
|
Apr 1988 |
|
WO |
|
88/03365 |
|
May 1988 |
|
WO |
|
2008/901969 |
|
Mar 1989 |
|
WO |
|
89/06803 |
|
Jul 1989 |
|
WO |
|
91/00920 |
|
Jan 1991 |
|
WO |
|
91/06661 |
|
May 1991 |
|
WO |
|
91/14772 |
|
Oct 1991 |
|
WO |
|
WO 91/17243 |
|
Nov 1991 |
|
WO |
|
92/05249 |
|
Apr 1992 |
|
WO |
|
92/14830 |
|
Sep 1992 |
|
WO |
|
92/18645 |
|
Oct 1992 |
|
WO |
|
93/01285 |
|
Jan 1993 |
|
WO |
|
93/11249 |
|
Jun 1993 |
|
WO |
|
93/12812 |
|
Jul 1993 |
|
WO |
|
94/01541 |
|
Jan 1994 |
|
WO |
|
94/04035 |
|
Mar 1994 |
|
WO |
|
94/14940 |
|
Jul 1994 |
|
WO |
|
94/14951 |
|
Jul 1994 |
|
WO |
|
94/26883 |
|
Nov 1994 |
|
WO |
|
95/06720 |
|
Mar 1995 |
|
WO |
|
95/09909 |
|
Apr 1995 |
|
WO |
|
95/22606 |
|
Aug 1995 |
|
WO |
|
95/22615 |
|
Aug 1995 |
|
WO |
|
95/22625 |
|
Aug 1995 |
|
WO |
|
95/29996 |
|
Nov 1995 |
|
WO |
|
95/30744 |
|
Nov 1995 |
|
WO |
|
96/09772 |
|
Apr 1996 |
|
WO |
|
96/13578 |
|
May 1996 |
|
WO |
|
96/13579 |
|
May 1996 |
|
WO |
|
96/13580 |
|
May 1996 |
|
WO |
|
96/27002 |
|
Sep 1996 |
|
WO |
|
96/28542 |
|
Sep 1996 |
|
WO |
|
96/30502 |
|
Oct 1996 |
|
WO |
|
96/32472 |
|
Oct 1996 |
|
WO |
|
96/39851 |
|
Dec 1996 |
|
WO |
|
97/04079 |
|
Feb 1997 |
|
WO |
|
97/05219 |
|
Feb 1997 |
|
WO |
|
97/07202 |
|
Feb 1997 |
|
WO |
|
97/11083 |
|
Mar 1997 |
|
WO |
|
97/14713 |
|
Apr 1997 |
|
WO |
|
97/27237 |
|
Jul 1997 |
|
WO |
|
97/27276 |
|
Jul 1997 |
|
WO |
|
97/41212 |
|
Nov 1997 |
|
WO |
|
97/41735 |
|
Nov 1997 |
|
WO |
|
97/41736 |
|
Nov 1997 |
|
WO |
|
WO 98/00029 |
|
Jan 1998 |
|
WO |
|
98/08939 |
|
Mar 1998 |
|
WO |
|
98/14594 |
|
Apr 1998 |
|
WO |
|
WO 98/13479 |
|
Apr 1998 |
|
WO |
|
WO 98/16112 |
|
Apr 1998 |
|
WO |
|
98/18912 |
|
May 1998 |
|
WO |
|
98/26057 |
|
Jun 1998 |
|
WO |
|
WO 98/23162 |
|
Jun 1998 |
|
WO |
|
98/31790 |
|
Jul 1998 |
|
WO |
|
WO 98/31790 |
|
Jul 1998 |
|
WO |
|
98/41623 |
|
Sep 1998 |
|
WO |
|
98/44804 |
|
Oct 1998 |
|
WO |
|
98/45453 |
|
Oct 1998 |
|
WO |
|
98/50532 |
|
Nov 1998 |
|
WO |
|
98/51163 |
|
Nov 1998 |
|
WO |
|
98/59028 |
|
Dec 1998 |
|
WO |
|
99/33964 |
|
Jul 1999 |
|
WO |
|
99/34011 |
|
Jul 1999 |
|
WO |
|
99/37782 |
|
Jul 1999 |
|
WO |
|
99/42566 |
|
Aug 1999 |
|
WO |
|
99/50399 |
|
Oct 1999 |
|
WO |
|
99/53001 |
|
Oct 1999 |
|
WO |
|
99/53769 |
|
Oct 1999 |
|
WO |
|
99/55883 |
|
Nov 1999 |
|
WO |
|
00/05396 |
|
Feb 2000 |
|
WO |
|
00/28044 |
|
May 2000 |
|
WO |
|
00/32758 |
|
Jun 2000 |
|
WO |
|
00/34450 |
|
Jun 2000 |
|
WO |
|
00/36114 |
|
Jun 2000 |
|
WO |
|
00/43036 |
|
Jul 2000 |
|
WO |
|
00/49164 |
|
Aug 2000 |
|
WO |
|
00/58517 |
|
Oct 2000 |
|
WO |
|
00/59307 |
|
Oct 2000 |
|
WO |
|
00/60063 |
|
Oct 2000 |
|
WO |
|
00/61771 |
|
Oct 2000 |
|
WO |
|
00/71808 |
|
Nov 2000 |
|
WO |
|
00/75295 |
|
Dec 2000 |
|
WO |
|
01/16308 |
|
Mar 2001 |
|
WO |
|
01/27251 |
|
Apr 2001 |
|
WO |
|
01/29222 |
|
Apr 2001 |
|
WO |
|
WO 00/23461 |
|
Apr 2001 |
|
WO |
|
01/34835 |
|
May 2001 |
|
WO |
|
WO 01/39544 |
|
May 2001 |
|
WO |
|
01/39602 |
|
Jun 2001 |
|
WO |
|
01/42433 |
|
Jun 2001 |
|
WO |
|
01/47363 |
|
Jul 2001 |
|
WO |
|
01/66711 |
|
Sep 2001 |
|
WO |
|
01/78524 |
|
Oct 2001 |
|
WO |
|
WO 01/75083 |
|
Oct 2001 |
|
WO |
|
01/83559 |
|
Nov 2001 |
|
WO |
|
01/83770 |
|
Nov 2001 |
|
WO |
|
01/92502 |
|
Dec 2001 |
|
WO |
|
02/00852 |
|
Jan 2002 |
|
WO |
|
02/03805 |
|
Jan 2002 |
|
WO |
|
02/06457 |
|
Jan 2002 |
|
WO |
|
WO 02/06508 |
|
Jan 2002 |
|
WO |
|
02/24881 |
|
Mar 2002 |
|
WO |
|
02/30207 |
|
Apr 2002 |
|
WO |
|
WO 02/39828 |
|
May 2002 |
|
WO |
|
02/055679 |
|
Jul 2002 |
|
WO |
|
02/062973 |
|
Aug 2002 |
|
WO |
|
02/065854 |
|
Aug 2002 |
|
WO |
|
02/066622 |
|
Aug 2002 |
|
WO |
|
02/094123 |
|
Nov 2002 |
|
WO |
|
WO 0306644 |
|
Jan 2003 |
|
WO |
|
03/020923 |
|
Mar 2003 |
|
WO |
|
WO 03/020923 |
|
Mar 2003 |
|
WO |
|
WO 03/020941 |
|
Mar 2003 |
|
WO |
|
WO 2006/031699 |
|
Mar 2003 |
|
WO |
|
03/040091 |
|
May 2003 |
|
WO |
|
03/060112 |
|
Jul 2003 |
|
WO |
|
03/070013 |
|
Aug 2003 |
|
WO |
|
03/089620 |
|
Oct 2003 |
|
WO |
|
WO 03/089620 |
|
Oct 2003 |
|
WO |
|
03/097825 |
|
Nov 2003 |
|
WO |
|
WO 03/97835 |
|
Nov 2003 |
|
WO |
|
03/099016 |
|
Dec 2003 |
|
WO |
|
03/100044 |
|
Dec 2003 |
|
WO |
|
03/102118 |
|
Dec 2003 |
|
WO |
|
WO 03/100044 |
|
Dec 2003 |
|
WO |
|
2004/004467 |
|
Jan 2004 |
|
WO |
|
2004/018660 |
|
Mar 2004 |
|
WO |
|
2004/053039 |
|
Jun 2004 |
|
WO |
|
2004/053152 |
|
Jun 2004 |
|
WO |
|
2004/059075 |
|
Jul 2004 |
|
WO |
|
WO 2004/064537 |
|
Aug 2004 |
|
WO |
|
WO 2004/084638 |
|
Oct 2004 |
|
WO |
|
2004/097012 |
|
Nov 2004 |
|
WO |
|
2004/111216 |
|
Dec 2004 |
|
WO |
|
2005/003339 |
|
Jan 2005 |
|
WO |
|
2005/005977 |
|
Jan 2005 |
|
WO |
|
97/07205 |
|
Feb 2005 |
|
WO |
|
2005/056782 |
|
Jun 2005 |
|
WO |
|
2005/066347 |
|
Jul 2005 |
|
WO |
|
2005/066351 |
|
Jul 2005 |
|
WO |
|
2005069762 |
|
Aug 2005 |
|
WO |
|
WO 2005069762 |
|
Aug 2005 |
|
WO |
|
2005/080540 |
|
Sep 2005 |
|
WO |
|
2005/087918 |
|
Sep 2005 |
|
WO |
|
WO 2005/111203 |
|
Nov 2005 |
|
WO |
|
2006/008508 |
|
Jan 2006 |
|
WO |
|
2006/008653 |
|
Jan 2006 |
|
WO |
|
2006018205 |
|
Feb 2006 |
|
WO |
|
WO 200618205 |
|
Feb 2006 |
|
WO |
|
2006/032279 |
|
Mar 2006 |
|
WO |
|
WO 2006/045354 |
|
May 2006 |
|
WO |
|
WO 2006/066590 |
|
Jun 2006 |
|
WO |
|
WO 2008/003420 |
|
Jan 2008 |
|
WO |
|
WO 2008/036863 |
|
Mar 2008 |
|
WO |
|
WO 2008/090395 |
|
Jul 2008 |
|
WO |
|
WO 2008/094847 |
|
Aug 2008 |
|
WO |
|
WO 2009/002480 |
|
Dec 2008 |
|
WO |
|
WO 2009/024736 |
|
Feb 2009 |
|
WO |
|
WO 2009/024862 |
|
Feb 2009 |
|
WO |
|
WO 2009/081094 |
|
Jul 2009 |
|
WO |
|
Other References
Verenium Corporation leaflet Purifine Enzyme, "Convert Gums to Oils
Significantly Increase oil Yields no increase in Free Fatty Acids",
San Diego, Jan. 2008. cited by other .
AOCS Introduction to the Processing of Fats and Oils, four modules
on CD-ROM American Oil Chemists Society, 2003, pp. 111-16-111-19.
cited by other .
Anguita et al.,Appl. Environ. Microbiol., 1983, vol. 59, No. 8, pp.
2411-2417. cited by other .
Sutrisno et al., Journal of Bioscience and Bioengineering, 2001vol.
91, No. 6, pp. 599-602. cited by other .
Kalscheuer et al., Applied and Environmental Microbiology, 2004,
vol. 70, No. 12, pp. 7119-7125. cited by other .
Brunel et al., J. Biotechnology, Jul. 1, 2004, vol. 111 , No. 1,
pp. 41-50. cited by other .
Delphine Briand et al., "Substrate Specificity of the Lipase from
Candida parapsilosis", Lipids, 1995, vol. 30, No. 8. cited by other
.
"Definition of Recombined Milk", International Dairy Federation,
1979, doc. 116, p. 5. cited by other .
Stryer, L., Biochemistry, 1981, 2.sup.nd Edition, W H Freeman and
Co., San Francisco, p. 16. cited by other .
Jennifer L. Seffernick et al., "Melamine Deaminase and Atrazine
Chlorohydrolase: 98 Percent Identical but Functionally Different",
Journal of Bacteriology, Apr. 2001, vol. 183, No. 8, pp. 2405-2410.
cited by other .
Andrzej Witkowski et al., "Conversion of a .beta.-Ketoacyl Synthase
to a Malonyl Decarboxylase by Replacement of the Active-Site
Cysteine with Glutamine", Biochemistry, 1999, vol. 38, No. 6, pp.
11643-11650. cited by other .
"AOCS Introduction to the Processing of Fats and Oils", American
Oil Chemists Society, 2003, pp. III 16-19. cited by other .
Hajime Seino et al., "Enzymatic Synthesis of Carbohydrate Esters of
Fatty Acid (10 Esterification of Sucrose, Glucose, Fructose and
Sorbitol", JAOCS, Nov. 1984, vol. 61, No. 11. cited by other .
Roberto A. Chica et al., "Semi-rational approaches to engineering
enzyme activity: combining the benefits of directed evolution and
rational design", Biotechnology, 2005, vol. 16, pp. 378-384. cited
by other .
Anna Maria V. Garzillo et al., "Production, purification and
characterization of glucose oxidase from Penicillium variabile
P16.sup.1", Biotechnol. Appln. Biochem., 1995, vol. 22, pp.
169-178. cited by other .
Patent Abstracts of Japan; Publication No. 04-370055; Publication
Date Dec. 12, 1992. cited by other .
Patent Abstracts of Japan; Publication No. 07-079687; Publication
Date Mar. 28, 1995. cited by other .
Patent Abstracts of Japan; Publication No. 48-16612; Publication
Date May 23, 1973. cited by other .
"Purifine Enzyme", Verenium Corporation leaftlet, Jan. 2008. cited
by other .
Sequence alignment of database accession No. Q44268 with Seq. ID
No. 16, (1996). cited by other .
Sequence alignment of database accession No. Q44268 with Seq. ID
No. 70, (1996). cited by other .
S. Sen et al., "Developments in Directed Evolution for Improving
Enzyme Functions", Appl. Biotechnol., 2007, vol. 143, No. 3, pp.
212-223. cited by other .
Buckley J. Thomas, "Substrate specificity of bacterial
glycerophospholipid: Cholesterol Acyltransferase", Biochemistry,
1982, vol. 21, pp. 6699-6703. cited by other .
Nerland A.H., "The Nucleotide Sequence of the Gene Encoding GCAT
from Aeromonas salmonicida SSP. Salmonicida", Journal of Fish
Diseases, 1996, vol. 19, No. 2, pp. 145-150, XP008049669. cited by
other .
Nerland A.H., "Glycerophospholipid-cholesterol acyltransferase
precursor", SwissProt, Feb. 11, 2005, XP002318368. cited by other
.
U.S. Appl. No. 60/039,791, filed Mar. 4, 1997, Clausen. cited by
other .
U.S. Appl. No. 60/189,780, filed Mar. 16, 2000, Soe. cited by other
.
U.S. Appl. No. 60/489,441, filed Jul. 23, 2003, Kreij. cited by
other .
Acker, L. "Die Lipide des Getreides, ihre Zusammense und inre
Bedeutung", Getreide Mehl Brot (1974) 28:181-187. cited by other
.
Adamzcak, Marek, et al., "Application of Enzymatic Glycerolysis for
Production of Monoglycerides from Waste Fats", Polish Journal of
Food and Nutrition Science, Mar. 1994, p. 129-133. cited by other
.
Adhikari, B., et al., "Stickiness in Foods: A Review of Mechanisms
and Test Methods", International Journal of Food Properties, vol.
4, No. 1, 2001, 1pg. cited by other .
Agarwal et al., "Lipase Activity of Some Fungi Isolated from
Groundnut", Current Science, Dec. 5, 1984, vol. 53, No. 23, p.
1253. cited by other .
Aires-Barros M.R. et al., Isolation and purification of lipases, in
"Lipases their structure, biochemistry and application", editors
Woolley et al., Cambridge University Press, 1994, ISBN 0521445469
NZAS-00354436 p. 242-270. cited by other .
Aisaka, Kazuo et al., "Production of Lipoprotein Lipase and Lipase
by Rhizopus japonicu", Agri. Biol. Chem., vol. 43, No. 10, pp.
2125-2129, 1979. cited by other .
Akoh, Casimir C., et al., "GDSL family of serine esterases/lipases"
Progress in Lipid Research, vol. 43, 2004, pp. 534-552. cited by
other .
Allan Svendsen et al., "Biochemical properties of cloned lipases
from the Pseudomonas family", Biochimica et Biophysica Acta, vol.
1259, 1995, pp. 9-17. cited by other .
Al-Obaidy, K A, "Dough and Gluten Characteristics of Good and Poor
Quality Flours: Lipid-Protein Bindings affected by Mixing time,
water absorption, chemicals and heat," Dissertation Abstracts
International B (1987) vol. 47(9) 3597, order No. DA8624641, pp.
266. cited by other .
Amano Enzyme Inc.,
http://www.amano-enzyme.co.jp/english/productuse/oil.sub.--fat.html.
Date of visit: Jun. 21, 2004; (Copyright 2003) pp. 1-2. cited by
other .
Amano Enzymes "Enzymes for Gastrointestinal Digestion" Oct. 1997,
pp. 1-2. cited by other .
Amano Enzymes, Amano Enzyme Europe Ltd, Sep. 1994, pp. 1-4. cited
by other .
Amin, Neelam S., et al., "Direct transformation of site-saturation
libraries in Bacillus subtilis", BioTechniques, Dec. 2003, vol. 35
p. 1134-1140. cited by other .
Andersson, L., et al., "Hydrolysis of galactolipids by human
pancreatic lipolytic enzymes and duidenal contents", Journal of
Lipid Research, 1995, vol. 36, pp. 1392-1400. cited by other .
Sander, Andreas, et al., "Herstellung und Anwendungsmoelichkeiten
von Eiweiss-Fettsaeurekondensaten/Production and application of
acylated proten hydrolysates", Fett/Lipid 99 (1997) Nr. 4, pp.
115-120. cited by other .
An-I Yeh et al., "Effects of Oxido-reductants on rheological
properties of wheat flour dough and comparison with some
characteristics of extruded noodles", Cereal Chemistry, 1999, vol.
76, No. 5, pp. 614-620. cited by other .
Arbige, Michael A et al, "Novel lipase for cheddar cheese flavor
development" Food Technology, vol. 40, 1996, p. 91-98. cited by
other .
Archer, David B., et al., "Proteolytic degradation of heterologous
proteins expressed in Aspergillus niger", Biotechnology Letter,
vol. 14, No. 5, May 1992, pp. 357-362. cited by other .
Arcos J.A. et al, "Quantative Enzymatic Production of
6.O-Acylglucose Esters", Biotechnology and Bioengineering 1998 vol.
57, No. 5, p. 505-509. cited by other .
Arpigny Jean Louis et al, "Bacterial lipolytic enzymes:
Classification and properties", Biochemical Journal, vol. 343, No.
1, Oct. 1, 1999, pp. 177-183, XP002375631. cited by other .
Assignment Document for Enzymatisk detergent additiv, detergent og
vaskemetode, executed Aug. 13, 1986 p. 1-3. cited by other .
Atomi H, et al., "Microbial lipases-from screening to design", In:
Barnes PJ, ed. Oils-Fats-Lipids, 21st World Congress Int Soc Fat
Res. England: Bridgwater, 1995: pp. 49-50, vol. 1.
NZAS-0016055-NZAS-0016056. cited by other .
August C.A.P.A. et al. "The use of genetic engineering to obtain
efficient production of porcine pancreatic phospholipase A2",
Biochimica et Biophysica Acta, vol. 1089, 1991, pp. 345-351. cited
by other .
Aunstrup, Knud et al., "Production of Microbiol Enzymes", Microbiol
Technology, Academic Press, 1979, 2nd edition, vol. 1, chap. 9, p.
281-309. cited by other .
Ausubel, Frederick M., et al. (editors), "Short Protocols in
Molecular Biology--A Compendium of Methods from Current Protocols
in Molecular Biology", 1995, John Wiley & Sons, Inc,
NZAS-0028441-NZAS-002844. cited by other .
Bachmatova, I., et al., "Lipase of Pseudomonas mendocina 3121-1 and
its Substrate Specificty", Biologija, 1995, p. 57-59. cited by
other .
"Fat Splitting, Esterification, and Interesterification", in
Bailey's Industrial Oils and Fat Products, vol. 2, 4th Edition,
John Wiley and Sons, New York pp. 97-173, 1982. cited by other
.
Balcao V.M et. al., "Bioreactors with immobilized lipase: State of
the art," Enzyme Microb Technhol, May 1, 1996; 18(6):392-416. cited
by other .
Balcao, V. et. al. "Lipase Catalyzed Modification of Milkfat,"
(1998), Biotechnology Advances, vol. 16, No. 2, pp. 309-341. cited
by other .
Ballance, D.J., et al., "Transformation of Aspergillus Nidulans by
the orotidine-5'-phosphate decarboxylase gene of neurospora
crassa", Biochemical and biophysical Research Communications, vol.
112, No. 1, 1983, pp. 284-289. cited by other .
Ballance, "Transformation Systems for Filamentous Fungi and an
Overview of Fungal Gene Structure", Molecular Industrial Mycology,
Systems and Applications for Filamentous Fungi, Leong and Berka
(eds.), Marcel Dekker Inc, New York 1991, pp. 1-29. cited by other
.
Barbesgaard, Peder et al, "On the safety of Aspergillus oryzae: a
review," Applied Microbiology and Biotechnology (1992) 36: 569-572.
cited by other .
Barnes, P.J., "Lipids in Cereal Technology", Food and Science
Technology, Academic Press, 1983, pp. 167-171. cited by other .
Basrl, M., et al., "Amidination of Lipase with Hyrdophobic
Imidoesters", JAOCS, vol. 69, No. 6, Jun. 1992, p. 579-582. cited
by other .
Bateman A et. al., "HMM-based databases in InterPro," Briefings in
Bioinformatics vol. 3,No. 3, pp. 236-245 (2002). cited by other
.
Bateman A et al, (2002), "The Pfam Protein Families Database,"
Nucleic Acids Res. vol. 30, No. 1, p. 276-280. cited by other .
Becker T. "Separation and Purification Processes for Recovery of
Industrial Enzymes" in R.K. Singh, S.S.H. Rizvi (eds):
Bioseparation processes in Foods, Marcel Dekker, New York (1995)
pp. 427-445. cited by other .
Bekkers et al, "The use of genetic engineering to obtain efficient
production of porcine pancreatic phospholipase A2 by Saccharomyces
cerevisiae," (1991) Biochim Biophys Acta vol. 1089 No. 3, p.
345-51. cited by other .
Bengtsson Olivecrona Gunilla et al. "Phospholipase activity of milk
lipoprotein lipase," Methods in Enzymology, vol. 197, 1991 p.
345-356. cited by other .
Bentley S D et al, Complete genome sequence of the model
actinomycete Streptomyces coelicolor A3(2), Nature vol. 417, 2002,
pp. 141-147. cited by other .
Berger K.G. (1990) "Recent developments in palm oil." Oleagineux,
vol. 45, p. 437-443. cited by other .
Berks, Ben C., "A common export pathway for proteins binding
complex redox cofactors?" Molecular Microbiology, 1996, vol. 22,
pp. 393-404. cited by other .
Beucage S.L. et al, (1981), "Deoxynucleoside Phosphoramidites--A
New class of Key Intermediates for Deoxypolynucleotide Synthesis,"
Tetrahedron Letters 22, p. 1859-1869. cited by other .
Bieleski R.L., Sugar Alcohols, in Loewus F A & Tanner W (eds),
Plant Carbohydrates I. Intercellular Carbohydrates Encyclopedia
Plant Physiol. N.S., 1982, 13A, chapter 5, p. 158-192, Springer,
Berlin. cited by other .
Bilyk, Alexander, et al., "Lipase-catalyzed triglyceride Hydrolysis
in Organic Solvent", pp. 320-323, J, vol. 68, No. 5, May 1991.
cited by other .
Biocatalysts, Limited, Product Sheet for Lipomod(TM) 627P-L627P,
published Jan. 9, 2002, Pontypridd UK, p. 1. cited by other .
Jakobsen, Soren, "Biotekkomet falder hardt til jorden", Borsens, p.
6, Aug. 28, 2002. NZAS-0564031. cited by other .
Birch et al., "Evidence of Multiple Extracellular Phospholipase
Activities of Aspergillus fumigatus", Infection and Immunity, Mar.
1996, vol. 64, No. 3, 1996. cited by other .
Birgitte Hugh-Jensen et al., "Rhizomucor miehei Triglyceride Lipase
is Processed and Secreted from Transformed Aspergillus oryzae",
Lipids, vol. 24, No. 9, 1989. cited by other .
Biswas, et al., "Interfacial Behavior of Wheat Puroindolines: Study
of Adsorption at the Air-Water Interface from Surface Tension
Measurement Using Wilhelmy Plate Method", Journal of Colloid and
Interface Science, vol. 244, pp. 245-253, 2001. cited by other
.
Bjorkling, F., et al., "Lipase Catalyzed Organic Synthesis", S.
Servie (ed.), Microbial Reagents in Organic Synthesis, pp. 249-260,
1992. cited by other .
Bjorkling, Frederik, et al., "Lipase Catalyzed Synthesis of
Perozycarboxylic Acids and Lipase Mediated Oxidations",
Tetrahedron, vol. 48, No. 22, pp. 4587-4592, 1992. cited by other
.
Bjorkling, Frederik, et al., "Lipase -mediated Formation of
Peroxycarboxylic acids used in Catalytic Epoxidation of Alkenes",
J. Chem. Soc., Chemical Communications, Issue 19, 1990. cited by
other .
Bjurlin et al. Identification of carboxylesterase activities of
commercial triacylglycerol hydrolase (lipase) preparations, Eur. J.
Lipid Sci. Technol. 104 (2002) 143-155. cited by other .
Blain JA et al, The Nature of Mycelial Lipolytic enzymes in
filamentous fungi, Fems Microbiol. Lett., 1978, vol. 3, 85-87.
cited by other .
Blecker et al, Improved emulsifying and foaming of whey proteins
after enzymic fat hydrolysis, (1997) J Food Science, vol. 62, No.
1. cited by other .
Blumenthal, Cynthia Z., "Production of toxic metabolites in
Aspergillus niger, Aspergillus oryzae, and Trichoderma reesei:
justification of mycotoxin testing in food grade enzyme
preparations derived from the three fungi", Regulatory Toxicology
and Pharmacology, vol. 39, 2004, p. 214-228. cited by other .
Boel, Esper, et al.; "Rhizomucor miehei Triglyceride lipase is
Synthesized as a Precursor"; Novo Research Institute; vol. 23; No.
7; Jul. 1988. cited by other .
Bornscheuer U T et al, "Optimizing lipases and related enzymes for
efficient application," Trends in Biotechnology, Elsevier
Publications, Cambridge GB, vol. 20, No. 10, Oct. 1, 2002, pp.
433-437. cited by other .
Bornscheuer, Uwe T., "Lipase-catalyzed syntheses of
monoacylglycerols", Enzyme and Microbiol Technology, vol. 17, pp.
578-586, 1995. cited by other .
Brady, Leo, et al., "A serine protease triad forms the catalytic
centre of a triacylglycerol lipase", Nature, vol. 343, 1990, p.
767-770. cited by other .
Brockerhoff, Hans, et al., "Lipolytic Enzymes", Academic Press,
1974, 1 page. cited by other .
Brumlik, Michael J., et al., "Identification of the Catalytic Triad
of the Lipase/Acyltransferase from Aeromonas hydrophila", Journal
of Bacteriology, Apr. 1996, vol. 178, No. 7, pp. 2060-2064. cited
by other .
Brzozowski, A.M., et al., "A model for interfacial activation in
lipases from the structure of a fungal lipase-inhibitor comples",
Nature, vol. 351, 1991, pp. 491-494. cited by other .
Buckley J. Thomas et al, "Purification and Partial Characterization
of a Bacterial Phospholipid: Cholesterol Acyltransferase," Journal
of Biological Chemistry, vol. 257, No. 6, pp. 3320-3325, 1982.
cited by other .
Buckley, "Mechanism of action of a bacterial glycerophospholipid
cholesterol acyltransferase," Biochemistry 1983, 22, 5490-5493.
cited by other .
Bulkacz J et al, "Phospholipase A activity in supernatants from
cultures of Bacteroides melaninogenicus," Biochim. Biophys. Acta
(1981) vol. 664, pp. 148-155. cited by other .
Van Den Berg. G, Regulatory status and use of lipase in various
countries, Bulletin of the IDF 294/1994--The use of lipases in
cheesemaking, pp. 19-20, (1994). cited by other .
Burdge, Graham C., et al., "A method for separation of
phosphatidylcholine, triacylglycerol, non-esterified fatty acids
and cholesterol esters from plasma by solid-phase extraction",
British Journal of Nutrition, 2000, vol. 84, pp. 281-787. cited by
other .
Butcher, Bronwyn G., et al., "The divergent chromosomal ars operon
of Acidithiobacillus ferrooxidans is regulated by an atypical ArsR
protein," Microbiology, 2002, vol. 148, pp. 3983-3992. cited by
other .
Buxton et al, "Transformation of Aspergillus niger using the argB
gene of Aspergillus nidulans," Gene, 1985, 37:207-214. cited by
other .
Cao, Shu-Gui, et al., "Enzymatic Preparation of Monoglycerides via
Glycerolysis of Fats and Oils Catalyzed by Lipase from Pseudomonas
Species" National Laboratory of Enzyme Engineering. Monoglycerides,
Enzyme Engine, Annals New York Academy of Sciences, 1996, vol. 799,
issue 1, p. 670-677. cited by other .
Carriere et al, "Pancreatic Lipase Structure-Function Relationships
by Domain Exchange", American Chemical Society-Biochemistry (1997),
36, pp. 239-248. cited by other .
Carriere, Frederic , et al., "Structural basis for the substrate
selectivity of pancreatic lipases and some related proteins",
Biochemica et Biophysica Acta, vol. 1376, pp. 417-432, 1998. cited
by other .
Caruthers MH et al (1980) "New Chemical methods for Synthesizing
polynucleotides," Nuc Acids Res Symp Ser 215-223. cited by other
.
Casimir C A et al "GDSL family of serine esterases/lipases,"
Progress in Lipid Research, 2004, pp. 534-552. cited by other .
Castello, P., et al., "Technological and Biochemical effects of
exogenous lipases in breadmaking", 2nd European Symposium on
enzymes in Grain Processing, Dec. 8-10, 1999, Helsinki, p. 193-199.
Published by VTT, Espoo, 2000. cited by other .
Castello, Phillippe, et al., "Effect of exogenous lipase on dough
lipids during mixing of wheat flours", Cereal Chemistry, 1998, vol.
75, No. 5, pp. 595-601. cited by other .
Castello, Phillippe, et al., "Effects of mixing conditions and
wheat flour dough composition on lipid hydrolysis and oxidation
levels in the presence of exogenous lipase", Cereal Chemistry,
1999, vol. 76, No. 4. pp. 476-482. cited by other .
Chakravarti DN et al, Biol. Abstracts, 1981, vol. 72, abstract No.
012592. cited by other .
Cheng Cheng et al., "Transformation of Trichoderma viride using the
Neurospora crassa pyr4 gene and its use in the expression of a
Taka-amylase a gene from Aspergillus oryzae", Curr. Genet., 18:
453-456, 1990. cited by other .
Christensen et al, "A new and simple method to immobilise lipases
by means of granulation", 1998 Nachwachsende Rohstoff 10, 98-105.
cited by other .
Christie, William et al., "New Procedures for Rapid Screening of
Leaf Lipid Components from Arabidopsis", Phytochemical Analysis,
vol. 9, pp. 53-57, 1998. cited by other .
Christophersen, Claus, et al., "Enzymatic Characterisation of
Novamyl a Thermostable .alpha.-Amylase", Starch/Sturke, vol. 50,
1998, p. 39-45. cited by other .
Chung O K et al, "Defatted and Reconstituted wheat flours. VI.
Response to shortening addition and Lipid Removal in Flours that
vary in Bread-making Quality" Cereal Chemistry (1980), vol. 57(2),
p. 111-117. cited by other .
Chung OK et al, "Recent Research on Wheat Lipids" Bakers Digest
Oct. 1981. cited by other .
Ciuffreda, Pierangela, et al., "Spectrophotometric Assay of Lipase
Activity: A New 40nitrophenyl Ester of a Dialkylglycerol Suitable
as a Chromogenic Substrate of Pseudomonas cepacia Lipase",
Biocatalysis and Biotransformation, vol. 21, No. 3, pp. 123-127,
2003. cited by other .
Claesson et al., "Techniques for measuring surface forces",
Advances in Colloid and Interface Science, vol. 67, 1996, pp.
119-183. cited by other .
Clausen, Kim, "Enzymatic oil-degumming by a novel microbial
phospholipase", European Journal of Lipid Science and Technology,
vol. 103, 2001, pp. 333-340. cited by other .
Clausen, Kim, "New enzyme for degumming", Oils and Fats
International, vol. 17, No. 4, Jun. 2001, pp. 24-25. cited by other
.
Cloning of rad51 and rad52 homologues from Aspergillus oryzae and
the effect of their overexpression on homologous recombination,
Novozymes internal document Feb. 9, 2001. cited by other .
Collar C, et al, "Lipid binding fresh and stored formulated wheat
breads. Relationships with dough and bread technological
performance", Lab de Cereales Inst de Agroquimica y Tec de
Alimentos, CSIC, Food Science and Technology International 2001,
vol. 7(6), p. 501-510. cited by other .
Colombo, Diego, et al., "Optically Pure 1-0- and
3-0.beta.-D-Glucosylk- and Galactosyl-sn-glycerols through
Lipase-catalyzed Transformations", Tetrahedron Letters, vol. 36,
No. 27, pp. 2865-4868, 1995. cited by other .
Conference May 6-8, 1999 in Santorini, Greece--Lipases & Lipids
Structure, Function and Biotechnological Applications--Slides
presented by Charlotte Poulsen. cited by other .
Cordle et al, "The hydrophobic surface of colipase influences
lipase activity at an oil-water interface", Journal of Lipid
Research, vol. 39 (1998), 1759-1767. cited by other .
Coteron, A., et al., "Reactions of Olive Oil and Glycerol over
Immobilized Lipases", JAOCS, vol. 75, No. 5, 1998, p. 657-660.
cited by other .
Council Directive of Dec. 21, 1988 (89/107/EEC). cited by other
.
Council Regulation (EC) No. 2991/94 5/12/94 Official Journal of the
European Communities, Sep. 12, 1994, No. L316/2-7. cited by other
.
Courtin, Christophe M., et al., "Recent Advances in Enzymes in
Grain Processing", Laboratory of Food Chemistry, Leuven, Belgium,
2003, p. 267-274, ISBN 90-9016671-8. cited by other .
Creveld, Lucia D, et al., "Identification of Functional and
Unfolding Motions of Cutinase as Obtained from Molecular Dynamics
Computer Simulations", Proteins: Structure, Function, and Genetics,
33:253-264, 1998. cited by other .
Cromie, Susan. Psychrotrophs and their Enzyme residues in cheese
milk, The Australian Journal of Dairy Technology, vol. 47, Nov.
1992. cited by other .
Cui et al., "Purification and characterization of an intracellular
carboxylesterase from Arthrobacter viscosus NRRL B-1973", Enzyme
and Microbial Technology, vol. 24, pp. 200-208, 1999. cited by
other .
Daboussi et al, "Heterologous expression of the Aspergillus
nidulans regulatory gene nirA in Fusarium oxysporum," (1991) Gene
vol. 109, No. 1, p. 155-60. cited by other .
Daboussi et al., "Transformation of seven species of filamentous
fungi using the nitrate reductase gene of Aspergillus nidulans",
Curr. Genet., 15:453-456, 1989. cited by other .
Daftary R.D. et al., Functional Bread-making Properties of Wheat
Flour Lipids, Functional Bread-Making Properties of Lipids chapter
2, in Food Technology, Mar. 1968m vol. 22, No. 327, p. 79-82,
NZAS-0487568. cited by other .
Dahlquist, Anders, et al., "Phospholipid: diacylglycerol
acyltransferase: An enzyme that catalyzes the acyl-CoA-independent
formation of triacylglycerol in yeast and plants", PNAS, vol. 97,
No. 12, pp. 6487-6492, 2000. cited by other .
Dalrymple, Brian D., et al., "Three Neocallimastic patriciarum
esterases associated with the degradation of complex
polysaccharides are members of a new family of hydrolases",
Microbiology, vol. 142, pp. 2605-2614, 1997. cited by other .
Danisco, "Unique Chance for Better Bread" Direct, A Newsletter from
Danisco Ingredients (1996). cited by other .
Danisco, Hexose oxidase--nyt enzym med mange mulingheder (advert)
Mar. 15, 1999. cited by other .
Darnell et al., Eds., "Synthetic Peptide and Nucleotide Sequences:
Their Use in Isolating and Identifying Genes", in Molecular Cell
Biology, Chapter 6, Manipulating Macromolecules, 1990, Scientific
American Books, Baltimore. cited by other .
Accession No., P10480 "Glycerophosphospholipid-cholesterol
acyltransferase" created Jul. 1, 1989, available at
www.ncbi.nlm.nih.gov/entrez. cited by other .
Database accession No. Q44268 -& Database UniProt 'Online! Nov.
1, 1996. cited by other .
Database accession No. Q9F7Y6 Database UniProt 'Online!, Mar. 1,
2001. cited by other .
Database FSTA International Food Information Service (IFIS),
Frankfurt/Main, De Mine Y:"Application of the enzymatic methods to
the determination of contaminated yolk in egg white." XP002077295
see abstract & Food Research International, vol. 29, No. 1,
1997, pp. 81-84. cited by other .
Database FSTA International Food Information Service (IFIS),
Frankfurt/Main, De Nicolas J: "Action of oxidoreductases in
breadmaking. Maturation of soft wheat flours and kneading of
doughs." XP002077286 see abstract & Annales De Technologie
Agricole, vol. 28, No. 4, 1979, pp. 445-468. cited by other .
Database FSTA International Food Information Service (IFIS),
Frankfurt/Main, De Qi SI J: "New enzymes for the baking industry"
XP002077284 see abstract & Food Tech Europe vol. 3, No. 1,
1996, pp. 60-64, Novo Nordisk Ferment Ltd. cited by other .
Database FSTA International Food Information Service (IFIS),
Frankfurt/Main, De Weipert D:"Rheologie von Roggenteigen. II. Der
einfluss der enzyme unterschiedlicher spezifitat auf das
rheologische verhalten des teiges." XP002077285 see abstract &
Getreide, Mehl Und Brot, vol. 26, No. 10, 1972, pp. 275-280. cited
by other .
Database Uniprotkb Jun. 1, 2003, S. Omura et al: "putative secreted
hydrolase from streptomyces avermitilis" XP002376340 retrieved from
EBI, Hinxton, UK Database accession No. Q828T4 abstract. cited by
other .
Database Uniprotkb May 1, 2000, S.D. Bentley et al: "Putative
Secreted Hydrolase from Streptomyces coelicolor" XP002376339
retrieved from EBI, Hinxton, UK Database accession No. Q9S2A5
abstract. cited by other .
Davies, Progress in Industrial Microbiology, Martinelli and
Kinghorn (eds.), Elsevier, Amsterdam 1994, 29:525-560. cited by
other .
De Haas GH et al, "Purification and Properties of Phospholipase A
from Porcine Pancreas" Biochim. Biophys. ACTA, 1968, vol. 139, pp.
103-117. cited by other .
Declaration by Clive Graham Phipps Walter (Dec C) Jul. 4, 2003.
cited by other .
Declaration by Dr Jorn Borch Soe (Dec F) Dec. 2, 2003. cited by
other .
Declaration by Dr Mark Turner (Dec G) Feb. 4, 2005, pp. 1-6. cited
by other .
Declaration by Henrik Pedersen (Dec A) Jul. 7, 2003, pp. 1-3. cited
by other .
Declaration by Henrik Pedersen, Masoud Rajabi Zargahi and Clive
Graham Phipps Walter (Dec. 2) Feb. 7, 2005, pp. 1-26, D46. cited by
other .
Declaration by Janne Brunstedt (Dec D) Jul. 4, 2003. cited by other
.
Declaration by Kazuko Kato, Henrik Pedersen, Masoud Rajabi Zaghari,
Clive Phipps Walter, and Janne Brunstedt (Dec I) Feb. 7, 2005.
cited by other .
Declaration by Kim Borch Oct. 17, 2005. cited by other .
Declaration by Luise Erlandsen Oct. 21, 2005. cited by other .
Declaration by Masoud Rajabi Zargahi (Dec B) Jul. 7, 2003. cited by
other .
Declaration by Masoud Rajabi Zargahi (Dec E) Jul. 15, 2003. cited
by other .
Declaration by Tina Spendler Oct. 14, 2005. cited by other .
Delcros, Jean-Francois, et al., "Effect of mixing conditions on the
behavior of lipoxygenase, peroxidase, and catalase in wheat flour
doughs", Cereal Chemistry, 1998, vol. 75, No. 1, pp. 85-93. cited
by other .
Dellaporta, et al.; "A Plant DNA Minipreparation Version II"; Plant
Molecular Biology Reporter(1983); vol. 1(4); pp. 19-21. cited by
other .
Derewenda et al, "The crystal and molecular structure of the
Rhizomuxor miehei Triacylglyceride Lipase at 1.9 .ANG. Resolution",
J. Mol. Biol. 1992, 227:818-839. cited by other .
Derewenda, Urszula, et al., "Catalysis at the Interface: The
Anatomy of a Conformational Change in a Triglyceride Lipase",
Biochemistry, vol. 31, pp. 1532-1541, 1992. cited by other .
Dictionary of Biochemistry and Molecular Biology, Stenesh, J.
Second Edition, John Wiley, 1975, p. 16, ISBN 0471840890, p. 1-3.
cited by other .
Dinkci. N, Mucor miehei den elde edilen lipaz, Ege Univeraitesi
Ziraat Fakultesi Dergisi Cilt, 37, Saiy 2-3, 2000, 141-148. cited
by other .
Direct, "The Road to Success: New Stabilizers Rouses Big Interest,"
A Newsletter from Danisco Ingredients, Sep. 1996, p. 1-4. cited by
other .
Directive 2000/36/EC.
Http://europa.eu.int/scadplus/leg/en/lvb/121122b.htm. Dato:
16.06.04. cited by other .
Drost-Lustenberger, C and Spendler T Lipopan F BG--Application and
Mechanism of a new lipase for baking, Novozymes. Spanish version of
EP869167, Novozymes, Oct. 7, 1998. cited by other .
Drost-Lustenberger, C. et al., Novozymes, "Lipopan F
BG--application and mechanism of a new lipase for bread baking"
Cereal Food (2003), Novozymes internal draft. cited by other .
Drost-Lustenberger, Cornelia, et al., "Lipopan F BG-unlocking the
natural strengthening potential in dough", Cereal Food, 2004.
Novozymes internal draft, p. 1-6. cited by other .
Duan, Rui Dong, Fat Digestion and Absorption (2000), p. 25-46,
publisher AOCS Press, Champaign III CODEN 69ACBA Conference;
general review written in English. cited by other .
Dubreil, Laurence, et al., "Localization of Puroinoline-a and
Lipids in Bread Dough Using Confocal Scanning Laser Microscopy", J.
Agric. Food Chem., 2002, vol. 50, pp. 6078-6085. cited by other
.
Ducancel, Frederic, et al., "Complete amino acid sequence of a PLA2
from the tiger snake Notechis sculatus scutatus as deduced from a
complementary DNA", Nucleic Acids Research, vol. 16, No. 18, 1988.
cited by other .
Dugi KA et al, "Human hepatic and lipoprotein lipase: the loop
covering the catalytic site mediates lipase substrate specificity",
Journal of Biological Chemistry (1995), vol. 270, pp. 25, 396-pp.
25, 401. cited by other .
Dugruix, A. , et al., Preparation and Handling of Biological
Macromolecules, Oxford University Press (1992) p. 31-39. cited by
other .
Dutilh & Groger, "Improvement of Product Attributes of
Mayonnaise by Enzymic Hydrolysis of Egg Yolk with Phospholipase
A2", 1981 J. Sci. Food Agric. 32, 451-458. cited by other .
Eddine et al, "Cloning and expression analysis of NhL1, a gene
encoding an extracellular lipase from the fungal pea pathogen
Nextria haematococca MP VI (Fusarium solani f. sp. pisi) that is
expressed in planta", Mol. Genet. Genomics (2001) 265: 215-224.
cited by other .
EFEMA Index of Food Emulsifiers, Mono- and diglycerides of fatty
acids, Jan. 2004, 4th Edition, p. 1-3 and 51-55. cited by other
.
Efthymiou CC et al., "Development of domestic feta cheese", Journal
of Dairy Science 1964, vol. 47, No. 6, p. 593-598. cited by other
.
Ellaiah et al., "Production of lipase by immobilized cells of
Aspergillus niger", Process Biochemistry, vol. 39, 2004, pp.
525-528. cited by other .
Elyk, Alexander, et al., "Lipase-Catalyzed", JAOCS, vol. 08, No. 5,
May 1991, pp. 320-323. cited by other .
Engelhorn and Raab, "Rapid Electroblotting of Small DNA Fragments
from Polyacrylamide Gels", Biotechniques (1991) 11(5):594-6. cited
by other .
Engelhorn et al., "Rapid Electroblotting of Small DNA Fragments
from Polyacrylamide Gels"; Biotechniques(1991); vol. 11(5); pp.
594-596. cited by other .
Nagodawithana, T. "Enzymes in food processing" (3rd Ed.), Academic
press 1993, p. 205-219. cited by other .
EPO, Mobay Chemical Corporation--Decision of the Technical Board of
Appeal 3.3.1 dated Jul. 1, 1982, Official Journal EPO, Oct. 1982,
pp. 394-402. cited by other .
Ettinger, William F. et al., "Structure of Cutinase Gene, cDNA, and
the Derived Amino Acid Sequence from Phytopathogenic Fungi",
Biochemistry, vol. 26, pp. 7883-7892, 1987. cited by other .
Euromonitor International, "The World Market for Dairy
Products--Introduction, Executive Summary, Operating Environment,
World Market Overview, Key Trends and Developments" in Euromonitor,
Strategy 2000, Feb. 2001. cited by other .
European Parliament and Council Directive No. 95/2/EC of Feb. 20,
1995 on food additives other than colours and sweeteners. OJ No.
L61 Mar. 18, 1995 p. 1-53. cited by other .
European Parliament and Council Directive No. 98/72/EC of Oct. 15,
1998 amending Directive 95/2/EC on food additives other than
colours and sweeteners. OJ No. L295 Nov. 4, 1998 p. 18-30. cited by
other .
European Journal of Biochemistry, vol. 166, 1987, Published by
Springer International on behalf of the Federation of European
Biochemical Societies. cited by other .
Ezra, David, et al., "Coronamycins, peptide antibiotics produced by
a verticillate Streptomyces sp. (MSU-2110) endophytic on Monstera
sp.", Microbiology, 2004, vol. 150, p. 785-793. cited by other
.
Fauvel, et al.; "Purification of Two Lipases With High
Phospholipase A, Activity from Guinea-Pig Pancreas"; Biochimica et
Biophysica Acta(1981); vol. 663; pp. 446-456. cited by other .
Fernandez-Garcia et al., "The use of lipolytic and proteolytic
enzymees in the manufacture of manchego type cheese from ovine and
bovine milk", 1994 J. Dairy Sci. 77: 2139-2149. cited by other
.
Fernandez-Lafuente, Roberto, et al., The coimmobilization of
D-amino acid oxidase and catalase enables the quantitative
transformation of D-amino acids (D-phenylalanine) into .alpha.-keto
acids (phenylpyruvic acid), Enzyme and Microbial Technology, vol.
23, pp. 28-33, 1998. cited by other .
Ferrer et al, 2000, "Purification and properties of a lipase from
Penicillium chrysogenum isolated from industrial wastes," J. Chem.
Technol. Biotechnol. 75, 569-576. cited by other .
Finizym Technical Information, Novo Enzymes, 1981. cited by other
.
Fodevarenubusteriet (2003). Bekendtgorelse om indhold af
transfedtsyrer I olier og fedtstoffer. Bekendtgorelse nr. 160 af
Nov. 3, 2003. cited by other .
Food Enzymes: Stalingase L, Gist-brocades Food Ingredients, p. 1-2
(Date after 2000). cited by other .
Vafiades D, "Embracing Enzymes", Food R&D, Dairy Fields
ingredient technology section, Mar. 1996 p. 39-44. cited by other
.
Forman, Todd, "Enzymes Used in Bread Baking: An Application
Update", Technical Bulletin, vol. XXVI, Issue Oct. 10, 2004. cited
by other .
Fox, et al.; "Isolation and some Properties of Extracellular
Heat-Stable Lipases: from Pseudomonas Fluorescens Strain AFT 36";
Journal of Dairy Research (1988); vol. 50; pp. 77-89. cited by
other .
Frenken N. et al (1992) "cloning of the Pseudomonas glumae Lipase
Gene and Determination of the Active Site Residues," Appl. Envir.
Microbiol. 58 3787-3791. cited by other .
Freshzyme.TM., Novozymes Product Sheet Baking/2000-11814,
NZAS-0265916. Mar. 12, 2001, p. 1-3. cited by other .
Frohman, et al.;"Rapid Production of Full-Length cDNAs from Rare
transcripts: Amplification using a single gene-specific
oligonucleotide primer"; Proc. Natl. Acad. Sci. USA (1988); vol.
85; pp. 8998-9002. cited by other .
Frost & Sullivan leaflet for report #7954-88 U.S. Market for
Enzymes for Food Applications, May 2001, NZAS-0413133. cited by
other .
Fugman, Douglas A et al "Lipoprotein Lipase and phospholipase
A2-Catalyzed hydrolysis of phospholipid vesicles with an
encapsulated fluorescent dye," Biochemica et Biophysica acia 795
(1984) 191-195. cited by other .
Galliard T and Dennis S (1974) Phospholipase, Galactolipase, and
Acyl Transferase Activities of a Lipolytic Enzyme from Potatoe,
Phytochemistry vol. 13, pp. 1731-1735. cited by other .
Galliard, "The Enzymic Breakdown of Lipids in Potato Tuber by
Phospholipid- and Galactolipid-Acyl Hydrolase Activities and by
Lipoxygenase", Phytochemistry, 1970, vol. 9, pp. 1725-1734. cited
by other .
Gan, Z. et al., "Rapid Communication--Antisera agains: Wheat
Diacylgalactosylglycerol (MGDG) and Diacyldigalactosylglycerol
(DGDG)", Journal of Cereal Science, vol. 18, pp. 207-210, 1993.
cited by other .
Ganghro AB & Dahot MU, Sci Int. (Lahore), 1992, vol. 4, pp.
169-172. cited by other .
Gemel J et al., "Comparison of galactoplipase activity and free
fatty acid levels in chloroplasts of chill-sensitve and
chill-resistant plants", European Journal of Biochemistry, vol.
166, 1987, Published by Springer International on behalf of the
Federation of European Biochemical Societies, p. 229-233. cited by
other .
Geus et al (1987) Nucleic Acids Research 15(9) p. 3743-3759. cited
by other .
Gilbert, E. Jane, et al., "Purification and properties of
extracellular lipase from Pseudomonal aeruginosa EF2", Journal of
General Microbiology, 1991, vol. 137, pp. 2223-2229. cited by other
.
Gillian, B., Turgeon et al., "Cochliobolus heterostrophus using the
Aspergillus nidulans amdS gene", Mol Gen Genet, 201: 450-453, 1985.
cited by other .
Godfrey, Tony, et al., "Industrial Enzymology Second Edition",
Macmillan Press, 1996, ISBN 0333594649, Chapter 2.17, Olive and
other Edible Oils, p. 299-300. cited by other .
Goodey et al, "Expression and secretion of foreign polypeptides in
Yeast," Yeast Biotechnology, Berry et al (eds.), Allen and Unwin,
London 1987, pp. 401-429. cited by other .
Graille J, "Possible applications of acyltransferases in
Oleotechnology," Lipid Technology, vol. 5, No. 1, 1993, pp. 11-16.
cited by other .
GRAS Notification dated Apr. 11, 2001 by Novozymes for LecitaseR
and LipopanTM F. Gregg L. et al., A lipases preparation produced by
Aspergillus oryzae expressing the gene encoding a lipases from
Fusarium oxyporum. Novo Nordisk A/S product Sheet for Lecitase
Novo, Oct. 2000. cited by other .
Greenough et al (1996) "Safety evaluation of a lipase expressed in
Aspergillus oryzae," Food Chem Toxicology 34:161-166 and PubMed
abstract in respect thereof. cited by other .
Greenough R J et al, "Safety Evaluation of a Lipase Expressed in
Aspergillus oryzae," Food and Chemical Toxicology, vol. 34(2),
1996, pp. 161-166. cited by other .
Haas and Berka, 1991, "cloning, expression and characterization of
a cDNA encoding a lipase from Phizopus delemar," Gene, 109:107-113.
cited by other .
Haas, et al., "Enzymatic Phosphatidylcholine Hydrolysis in Organic
Solvents: An Examination of Selected Commercially Available
Lipases", JAOCS, vol. 71, No. 5, May 1994, pp. 483-490. cited by
other .
Haas, et al.; "Lipases of the Genera Rhizopus and Rhizomucor:
Versatile Catalysts in Nature and the Laboratory"; Food
Biotechnology Micro-organisims (1995); pp. 549-588. cited by other
.
Haggag H F et al. Egypt J Food Sci vol. 22, No. 1 pp. 99-107
(1994). cited by other .
Marion D et al., "Lipids, Lipid-protein interactions and the
quality of baked cereal products", chapter 6 in Hamer, Rob J., et
al., "Interaction: The Keys to Cereal Quality", American
Association of Cereal Chemists, S Paul, Minnesota, 1998, ISBN
0913250996, p. 131-167. cited by other .
Hanlin, Richard T., "Illustrated Genera of Ascomycetes"; The
American Phytopathological Society, 1992, St Paul, Minnesota, p.
48, 49, 234, 235, 244, 245. cited by other .
Hansen, Chr., Danisco and Novozymes, Apr. 3, 2002, Food Ingredients
day, R&D--the main ingredients for growth. cited by other .
Hara, et al.; "Comparative Study of Comercially Available Lipases
in Hydrolysis Reaction of Phosphatidylcholine"; JAOCS (1997); vol.
74; No. 9, pp. 1129-1132. cited by other .
Hawker, Kim L., et al., "Heterologous expression and regulation of
the Neurospora crassa nit-4 pathway-specific regulartory gene for
nitrate assimilation in Aspergillus nidulans", Gene., vol. 100, pp.
237-240, 1991. cited by other .
Hedin, Eva M.K., et al., "Selective reduction and chemical
modification of oxidized lipase cysteine mutants", Journal of
Chemistry (2002) vol. 89, p. 529-539. cited by other .
Helmsing, "Purification and Properties of Galactolipase", Biochim.,
Biophys., Acta, vol. 178, pp. 519-533, 1969. cited by other .
Henderson, H.E., et al., "Structure-function relationships of
lipoprotein lipase: mutation analysis and mutagenesis of the loop
region", Journal of Lipid Research, vol. 34, 1993, pp. 1593-1602.
cited by other .
Henke, Erik, et al., "Activity of Lipases and Esterases towards
Tertiary Alcohols: Insights into Structure-Function Relationships",
Angew. Chem. Int. Ed., 2002, vol. 41, No. 17. cited by other .
Hernquist L & Anjou K (1993) Diglycerides as a stabilizer of
the .beta.'-crystal form in margarines and fats, in Fette Seifen
Anstrichmittel 2:64-66. cited by other .
Hernquist L. Herslof B. Larsson K & Podlaha O. (1981)
Polymorphism of rapeseed oil with low content of erucic acid and
possibilities to stabilize the .beta.'-crystal form in fats, in
Journal of Science and Food Agriculture 32:1197-1202. cited by
other .
Hilton S et al, "Purification and spectral study of a microbial
fatty acyltransferase:activation by limited proteolysis,"
Biochemistry vol. 29, No. 38, 1990, pp. 9072-9078. cited by other
.
Hilton S, Buckley JT, "Studies on the reaction mechanism of a
microbial lipase/acyltransferase using chemical modification and
site-directed mutagenesis," J Biol Chem. Jan. 15, 1991; 266(2):
997-1000. cited by other .
Hirayama O et al, "Purification and properities of a lipid
acyl-hydrolase from potatoe tubers," Biochim Biophys Acta. 1975,
vol. 384(1), p. 127-37. cited by other .
Hirose, Yoshihiko et al., "Characteristics of Immobilized Lipase PS
on Chemically Modified Ceramics", Amano Pharmaceutical, p. 239
(Date Unknown). cited by other .
Hjorth, Annegrethe, et al., "A Structural Domain (the lid) Found in
Pancreatic Lipases is Absent in the Guinea Pic (Phospho) lipase",
Biochemistry, vol. 32, pp. 4702-4704, 1993. cited by other .
Hofelmann et al, J. Food Sci., 1985, 50:1721-1731. cited by other
.
Holmquist et al., "Lipases from Rhizomucor miehei and Humicola
lanuginosa: Modification of the Lid covering the active site alters
enantioselectivity", Journal of Protein Chemistry, vol. 12, No. 6,
1993. cited by other .
Holmquist et al., "Trp89 in the Lid of Humicola lanuginosa Lipase
is Important for Efficient Hydrolysis of Tributyrin", Lipids, vol.
29, No. 9, 1994. cited by other .
Horn T et al, Synthesis of oligonucleotides on cellulose. Part II:
design and synthetic strategy to the synthesis of 22
oligodeoxynucleotides coding for Gastric Inhibitory Polypeptide
(GIP), Nuc Acids Res Symp Ser No. 7, pp. 225-232 (1980). cited by
other .
Hoshino, et al.; "Calcium Ion Regulates the Release of Lipase of
Fusarium oxysporum"; J. Biochem (1991); vol. 110; pp. 457-461.
cited by other .
Hoshino, Tamotsu, et al., "Purfication and Some Characteristics of
Extracellular Lipase from Fusarium oxysporum", Biosci. Biotech.
Biochem., vol. 56, No. 4, pp. 660-664, 1992. cited by other .
Hossen, Monjur and Hernandez, Ernesto, "Phospolipase D-Catalyzed
Synthesis of Novel Phospholipid-Phytosterol Conjugates", Lipids,
vol. 39, Aug. 2004, pp. 777-782. cited by other .
Hou, Ching T, "pH dependence and thermostability of lipases from
cultures from the ARS Culture Collection", Journal of Industrial
Microbiology, vol. 13, No. 4, 1994, pp. 242-248. cited by other
.
Hubner et al., "Interactions at the lipid-water interface",
Chemistry and physics of Lipids, vol. 96, 1998, pp. 99-123. cited
by other .
Hugh-Jensen, Birgitte, et al., "Rhizomucor miehei Triglyceride
Lipase is Processed and Secreted from Transformed Aspergillus
oryzae", Lipids, vol. 24, No. 9, pp. 781-785, 1989. cited by other
.
Humum et al., "Enzyme Catalysed Synthesis in Ambient Temperature
Ionic Liquids", Biocatalysis and Biotransformation, 2001, vol. 19,
pp. 331-338, NZAS-0215170. cited by other .
Icard-Verniere, Christele, et al., "Effects of mixing conditions on
pasta dough development on biochemical changes", Cereal Chemistry,
1999, vol. 76, No. 4, pp. 558-565. cited by other .
Igrejas, Gilberto, et al., "Genetic and Environmental Effects on
Puroindoline-a and Puroindoline-b Content and their Relationship to
Technological Properties in French Bread Wheats", Journal of Cereal
Science, vol. 34, 2001, pp. 37-47. cited by other .
Ikeda H et al, "Complete genome sequence and comparative analysis
of the industrial microorganism Streptomyces avermitilis", Nature
Biotech, vol. 21, pp. 526-531, May 2003. cited by other .
Godfrey, Tony, et al., editors, Industrial enzymology (2nd Ed.),
The Macmillan press, pp. 299-300, (1996). cited by other .
Ishihara et al., "Studies on Lipase from Mucor JavanicusI.
Purification and Properties", Biochimica et Biophysica Acta vol.
388, pp. 413-422, (1975). cited by other .
Isobe and Nokihara, "Primary structure determination of mono- and
diacylglycerol lipase from Penicillium camembertti", Febs. Lett.,
Federation of European Biochemical Societies, vol. 320, No. 2, pp.
101-106, (1993). cited by other .
Isobe K et al, "A new enzymatic method for glycoaldehyde production
from ethylene glycol", Journal of Molecular Catalysis B: Enzymatic
1 (1995), pp. 37-43. cited by other .
Iwai and Tsujisaka, "Fungal lipase", (in Lipases, Borgstrom and
Brockman (eds.), Elsevier, Amsterdam, 1984, pp. 443-468. cited by
other .
Iwai, Mieko, et al., "Hydrolytic and Esterifying Actions of
Crystalline Lipase of Aspergillus niger", J. Gen. Appl. Microbiol.,
1964, vol. 10, No. 1, p. 13-21. cited by other .
Izco et al., "Capillary electrophoresis: Evaluation of the effect
of added enzymes on casein proteolysis during the ripening of a
ewe's-milk cheese", Adv Food Sci, vol. 21, No. 3/4, pp. 110-116,
(1999). cited by other .
Jacob, Jules S., et al., "The Effects of Galactolipid Depletion on
the Structure of a Photosynthetic Membrane", The Journal of Cell
Biology, vol. 103, Oct. 1986, pp. 1337-1347. cited by other .
Jacobsberg B. & Oh C.H. (1976) Studies in Palm Oil
Crystallisation, in Journal of the American Oil Chemist Society 53:
pp. 609-616. cited by other .
Jan-Willem F. A. Simons et al., "Cloning, purification and
characterisation of the lipase from Staphylococcus epidermidis",
Eur. J. Biochem., vol. 253, pp. 675-683, 1998. cited by other .
Jeng-yen Lin, Matthew, "Wheat Polar Lipids--A Theseis Submitted to
the Graduate Faculty of the North Dakota State University of
Agriculture and Applied Science", May 1972, pp. 34-45. cited by
other .
Jensen B et al "Effect and Activity of Lipases in Dough and Bread"
(translation), 48th Conference on Baking technology and 3rd
Conference on Cake & Pastry Technology, Nov. 4-6, 1997, pp.
67-76. cited by other .
Jensen, B., et al., "Effekt and Wirksamkeit von Lipasen in Teig und
Brot" 48th Conference on Baking technology and 3rd Conference on
Cake & Pastry Technology, Nov. 4-6, 1997, pp. 67-76. cited by
other .
Owens J., "Lecithinase Positive Bacteria in Milk", Process
Biochemistry, Jan. 1978, vol. 13, pp. 13-14, 30. cited by other
.
Joerger et al., "Alteration of Chain Length Selectivity of a
Rhizopus delemar Lipase through Site-Directed Mutagenesis", Lipids,
vol. 29, No. 6, 1994, pp. 377-384. cited by other .
Jong et al.; "American Type Culture Collection Catalogue of
Filamentous Fungi"; Eighteenth edition (1991) p. 80. cited by other
.
List of Cultures, Fungi and Yeasts, 32 edition, Institute of the
Royal Netherlands Academy of Arts and Sciences, p. 38. (1990).
cited by other .
JCM Catalogue of Strains, Fifth Edition, "Filamentous Fungi &
Yeasts", p. 246, (1992). cited by other .
List of Cultures, 1992 Microorganisms Ninth Edition, Institute for
Fermentation, Osaka, Japan, p. 325, (1992). cited by other .
Joshi, et al.; "Specificity of Fungal Lipase in Hydrolytic Cleavage
of Oil"; Acta Microbiologica Hungarica (1987); vol. 34(2); pp.
111-114. cited by other .
Joshi, Sunita, et al., "Specificity of Lipase isolated from
Fusarium oxysporum", Department of Chemistry, Indian Institute of
Technology, vol. 25, No. 1 & 2, pp. 76-78, (Jan.-Jun. 1985).
cited by other .
Juffer, A.H., et al., "Adsorption of Proteins onto Charged
Surfaces: A Monte Carlo Approach with Explicit Ions", Journal of
Computational Chemistry, vol. 17, No. 16, pp. 1783-1803, 1996.
cited by other .
Jurgens, Catharina, et al., "Directed evolution of a
(.beta..alpha.)8-barrel enzyme to catalyze related reactions in two
different metabolic pathways", PNAS, Aug. 29, 2000, vol. 97, No.
18, pp. 9925-9930. cited by other .
Kaniuga Z, "Galactolipase and chilling sensitivity of plants", Acta
Biochim Pol. (1997), vol. 44(1), pp. 21-35. cited by other .
Kapur J & Sood ML, J. "Effect of pH and Temperature on Lipase
and Phospholipase of Adult Haemonchus contortus (Nematoda:
Trichostrongylidae)" J. Parasit., 1986, vol. 72, No. 2, pp.
346-347. cited by other .
Kasai, Naoya, et al., "Chiral C3 epoxides and halophydrins: Their
preparation and synthetic application", Journal of Molecular
Catalysis B: Enzymatic, vol. 4, 1998, pp. 237-252. cited by other
.
Kasai, Naoya, et al., "Optically Active Chlorohydrins as Chiral C3
and C4 Building Units: Microbial Resolution and Synthetic
Applications", Chirality, vol. 10, pp. 682-692, (1998). cited by
other .
Kawamura, F., et al., "Construction of a Bacillus subtilis Double
Mutant Deficient in Extracellular Alkaline and Neutral Proteases",
J. of Bacteriology, vol. 160, No. 1, Oct. 1984, pp. 442-444. cited
by other .
Keller, R.C.A., et al., "Competitive Adsorption Behaviour of Wheat
Flour Components and Emulsifiers at an Air-Water Interface",
Journal of Cereal Science, vol. 25, 1997, pp. 175-183. cited by
other .
Keum J S et al., "Effect of Commercial Protease and Lipase on the
Ripening of Cheddar Cheese", Korean J Dairy Sci 15 (2): pp.
103-117, (1993). cited by other .
Kim, Hyung Kwoun, et al., Expression and characterization of
Ca2+-independent lipase from Bacillus pumilus B26, Biochimica et
Biophysica Acta, vol. 1583, 2002, pp. 205-212. cited by other .
Kim, Myo-Jeong, et al., "Thermal Inactivation Kinetics and
Application of Phospho and Galactolipid-Degrading Enzymes for
Evaluation of Quality Changes in Frozen Vegetables", J. Agric. Food
Chem., 2001, vol. 49, pp. 2241-2248. cited by other .
Kimura, Yoshiharu, et al., "Application of Immobilized Lipase to
Hydrolysis of Triacylglyceride", Eur J. Appl Microbiol Biotechnol,
1983, vol. 17, pp. 107-112. cited by other .
Kindstedt et al., Rapid Quantative test for free oil (Oiling off)
in melted Mozzarella cheese, J. Dairy Sci., 1990, vol. 73, p.
867-873. cited by other .
King et al, "The production of proteins and peptides from
Saccharomyces cervisiae", Molecular and Cell Biology of Yeasts,
Walton and Yarronton (eds.), Blackie, Glasgow, 1989, pp. 107-133.
cited by other .
Kirk, Ole, et al., "Fatty Acid Specificity in Lipase-Catalyzed
Synthesis of Glucoside Esters" Biocatalysis, 1992, vol. 6, pp.
127-134. cited by other .
Klein, Robert R., et al., "Altered Acyl Chain Length Specificity of
Rhizopus delemar Lipase Through Mutagenesis and Molecular
Modeling", Lipids, 1997, vol. 32, No. 2, pp. 123-130. cited by
other .
Klein, Robert R., et al., "Additive Effects of Acyl-Binding Site
Mutations on the Fatty Acid Selectivity of Rhizopus delemar
Lipase", JAOCS, vol. 74, No. 11, 1997, p. 1401-1407. cited by other
.
Kocak et al., Effect of lipase enzyme (palatase A 750 L) on the
ripening of tulum cheese, Tr. J. of Agriculture and Forestry, 1995,
vol. 19, p. 171-177. cited by other .
Kocak et al., Effect of added fungal lipase on the ripening of
Kasar cheese, Milchwissenschaft 51(1), 1996, p. 13-17. cited by
other .
Kochubei et al., Role of lipids in the organization of the closest
surroundings of the reaction centers, Molekulyarnaya Biologiya vol.
12, No. 1, pp. 47-54, Jan.-Feb. 1978. cited by other .
Kochubei S M et al, "Nature of Longwave Fluorescence of Particles
Enriched with Photosytem I", Biophysics (1981), vol. 26(2), pp.
299-304. cited by other .
Kochubei S M et al, "Differences in the Structure of Long Wave
Fluorescence Molecular Aggregates in Photosytems I and II"
Institute of Plant Physiology, Academy of Sciences of the Ukranian
SSR, Kiev, (Translated from Molekulyarnaya Biologiya vol. 9, No. 2,
pp. 190-193, Mar.-Apr. 1975) pp. 150-153, (1975). cited by other
.
Kochubei SM et al, "Role of Lipids in the Organization of the
Closest Surroundings of the Reaction Centers of Photosytem 1",
Institute of Plant Physiology, Academy of Sciences of the Ukranian
SSR, Kiev, (Translated from Molekulyarnaya Biologiya vol. 12, No.
1, pp. 47-54, Jan.-Feb. 1978) pp. 32-37, (1978). cited by other
.
Kolkovski et al., "The Effect of Dietary Enzymes with Age on
Protein and Lipid Assimilation and Deposition in Sparus Aurata
Larvae", in Fish Nutrition in Practice, Biarritz (France), Jun.
24-27, 1991, Ed. INRA Paris, 1993, les Colloques, No. 61, p.
569-578. cited by other .
Kostal, Jan, et al., "Enhanced Arsenic Accumulation in Engineered
Bacterial Cells Expressing ArsR", Applied and Environmental
Microbiology, Aug. 2004, vol. 70, No. 8, pp. 4582-4587. cited by
other .
Kouker, et al.; "Specific and Sensitive Plate Assay for Bacterial
Lipases"; Applied and Environmental Microbiology (1987); vol.
53(1); pp. 211-213. cited by other .
Krishna, Sajja Hari, et al., "Enantioselective transesterification
of a tertiary alcohol by lipase A from Candida antarctica",
Tetrahedron: Asymmetry, vol. 13, 2002, pp. 2693-2696. cited by
other .
Kristensen A.C.J., "Preparation of margarine and spreads by
enzyme-generated emulsifiers", Master thesis, The Royal Veterinary
and Agricultural University, Frederiksberg, Copenhagen, (Jan. 2004)
pp. 1-154. cited by other .
Krog, Niels J., "Dynamic and Unique Monoglycerides", Cereal Foods
World, The American Association of Cereal Chemists, Jan. 1979, vol.
24, No. 1, p. 10. cited by other .
Krupa, Zbigniew et al., "Requirement of Galactolipids for
Photosystem J Activity in Lyophilized Spinach Chloroplasts",
Biochimica et Biophysica Acta, 408, pp. 26-34, 1975. cited by other
.
Kuipers, Oscar P., et al., "Enhanced Activity and Altered
Specificity of Phospholipase A2 by Deletion of a Surface Loop",
Science, vol. 244, 1989, p82-85 NZAS-0668767. cited by other .
Kunze, Hans, et al., "On the mechanism of lysophospholipase
activity of secretory phospholipase A2 (EC 3.1.1.4): deacylation of
monoacylphosphoglycerides by intrinsic sn-1 specificity and
Ph-dependent acyl migration in combination with sn-2 specificity",
Biochimica et Biophysica Acta, vol. 1346, 1997, pp. 86-92. cited by
other .
Kuwabara, et al., "Purification and Some Properties of
Water-soluble Phospholipase B from Torulaspora delbrueckii", J.
Biochem., vol. 104, pp. 236-241, 1988. cited by other .
Kuwabara, et al., "Purification and Some Properties of
Water-soluble Phospholipase", Agric. Biol. Chem., vol. 52, No. 10,
pp. 2451-2458, 1988. cited by other .
Kweon et al., "Phospholipid Hydolysate and Antistaling Amylase
Effects on Retrogradation of Starch in Bread", Journal of Food
Science, vol. 59, No. 5, pp. 1072-1076, 1994. cited by other .
Larchenkova LP et al. "Effect of starter and souring temperature on
reproduction of E coli and lactobacili in milk," International
Dairy Congress XXI, vol. 1, book 2. Moscow, Jul. 12-16, 1982, Brief
Communications, p. 539. cited by other .
Larsen N G et al, "The Effect of Ball-milling on Phospholipid
Extractability and the Breadmaking Quality of Flour", Journal of
Cereal Science (1990), vol. 12(2), p. 155-164. cited by other .
Lecointe et al., "Ester Synthesis in Aqueous Media in the Presence
of Various Lipases" Biotechnology Letters, vol. 18, No. 8 (Aug.)
pp. 869-874, (1996). cited by other .
Lee, Keun Hyeung, et al., "Identification and characterization of
the antimicrobial peptide corresponding to C-terminal B-sheet
domain of tenecin 1, an antibacterial protein of larvae of Tenebrio
molitor", Biochem. J., 1996, vol. 334, pp. 99-105. cited by other
.
Leggio, Leila Lo, et al., "The 1.62 A structure of Thermoascus
aurantiacus endoglucanase: completing the structural picture of
subfamilies in glycoside hydrolase family 5", FEBS Letters, vol.
523, 2002, pp. 103-108. cited by other .
Leidich et al., "Cloning and Disruption of caPLB1, a Phospholipase
B Gene Involved in the Pathogenicity of Candida albicans", The
Journal of Biological Chemistry, vol. 273, No. 40, pp. 26078-26086,
1998. cited by other .
Li, W., et al., "Surface properties and locations of gluten
proteins and lipids revealed using confocal scanning laser
microscopy in bread dough", Journal of Cereal Science, vol. 39,
2004, pp. 403-411. cited by other .
Lih-ling Wang et al, "Inhibition of Listeria monocytogenes by
monoacylglycerols synthesized from coconut oil and milkfat by
lipase-catalyzed glycerolysis." Journal of Agricultural Food
Chemistry (1993), vol. 41, No. 8, pp. 1000-1005. cited by other
.
Lima, Vera L.M., et al., "Lecithin-cholesterol acyltransferase
(LCAT) as a plasma glycoprotein: an overview", Carbohydrate
Polymers, vol. 55, 2004, pp. 179-191. cited by other .
Lin M J Y et al, "Effect on quality of bread and pasta products"
Cereal Chemistry (1974), vol. 51(1), pp. 34-45. cited by other
.
Lin S et al, "Purification and characterization of a glycerol
oxidase from Penicillium sp. TS-622" Enzyme and Microbial
Technology 18 (1996), pp. 383-387. cited by other .
"Lipase A Amano" Technical Bulletin No. Lez-1 (Product
Specification from Armano Pharmaceutical Co Ltd Nagoya Japan), Dec.
16, 1985, pp. 1-6. cited by other .
Lipase A "Amano" 6 Assay Note from Armano Pharmaceutical Co Ltd
Nagoya Japan, Aug. 27, 1985, p. 1. cited by other .
Lipase A "Amano" 6 product sheet, Amano Enzyme Inc, Apr. 1, 1999,
pp. 1-2. cited by other .
Lipase SP677 as a Baking Enzyme, from Novo Nordisk, Denmark, Mar.
17, 1994, pp. 1-5. cited by other .
Lipomod L338P Data Sheet, Biocatalysts Limited, Aug. 15, 2003, pp.
1-2. cited by other .
Lipopan F: Keep the quality--cut your costs 2000 Novozymes A/S.
www.enzymes.novo.dk/cgl-bin/bvisapi.dll/biotimes/one.sub.--article.jsp?id-
=16947&lang=en&t=b1, pp. 1-2. (2000). cited by other .
Litthauer, Derek, et al., "Pseudomonas luteola lipase: A new member
of the 320-residue Pseudomonas lipase family", Enzyme and Microbial
Technology, vol. 30, pp. 209-215, 2002. cited by other .
Llustenberger, Cornelia, et al., "Application of Noopazyme in Asian
Noodles and Non-Durum Pasta", Cereal Food, 2002-18584-01, p. 1,
vol. 11. cited by other .
Llustenberger, Cornelia, et al., "Enzymes in Frozen Dough and
Parbaked Bread", Cereal Food, 2001-17056-01, p. 1, vol. 19. cited
by other .
Longhi, Sonia, et al., "Atomic Resolution (1.0 .ANG.) Crystal
Structure of Fusarium solani Cutinase: Stereochemical Analysis" J.
Mol. Biol. vol. 268, pp. 779-799, 1997. cited by other .
Lozano et al., "Over-stabilization of Candida antarctica lipase B
by ionic liquids in ester synthesis", Biotechnology Letters, vol.
23, pp. 1529-1533, 2001. cited by other .
Lustenberger, Cornelia et al., Abstract of "Application of lipase
in Asian Noodles and Non-durum Pasta" AACC 2000 Annual Meeting,
Nov. 5-9, 2000, pp. 1-2, available at
http://aaccnet.org/meetings/2000/Abstracts/a00ma031.htm. cited by
other .
Luzi, Paola et al "Structure and organization of the human
galactocerebrosidase (GALC) gene",Genomics (1995), vol. 26, No. 2,
p. 407-409. cited by other .
Madsen J.S. & Qvist K.B., "Hydrolysis of milk protein by
Bacillus licheniformis protease specific for acidic amino acid
residues" Journal of Food Science, vol. 62, pp. 579-582, (1997).
cited by other .
Mao, Cungui, et al., "Cloning and Characterization of a
Saccharomyces cerevisiae Alkaline Ceramidase with Specificity for
Dihydroceramide", The Journal of Biological Chemistry, vol. 275,
No. 40, 2000, pp. 31369-31378. cited by other .
Maria Teres Neves Petersen, PhD, "Total Internal Reflection
Fluorescence Flow System with Electrochemical Control", TIRF-EC
Flow System, University of Aalborg, pp. 1-13, Sep. 2002. cited by
other .
Marion D et al., "Lipids, Lipid-protein Interactions and the
Quality of Baked Cereal Products" from Interactions the Keys to
Cereal Quality, Chapter 6, Editors Hamer & Hoseney, American
Association of Cereal Chemists, Inc., St. Paul, Minnesota, pp.
131-167, (1998). ISBN 0 913250-99-6. cited by other .
Marion D et al., Wheat Lipids and Lipid-binding proteins: structure
and function, in "Wheat Structure Biochemistry &
Functionality", editor Schofield JP, 2000, Royal Society of
Chemistry Special publication 212 pp. 245-260 ISBN 085404777-8 (It
states that it is the Proceedings of Conference organised by Royal
Soc of Chemistry Food Chemistry Group held on Apr. 10-12, 1995, in
Reading, UK. However, it is unclear why there was such a delay).
cited by other .
Marsh, Derek, et al., "Derivatised lipids in membranes.
Physico-chemical aspexts of N-biotinyl phosphatidylethanolamines
and N-acyl ethanolamines", Chemistry and Physics of Lipids, vol.
105, 2000, pp. 43-69. cited by other .
Martinelle et al., "The Role of Glu87 and Trp89 in the lid of
Humicola lanuginosa lipase", Protein Engineering, vol. 9, No. 6,
1996, pp. 519-524. cited by other .
Martinez, Chrislaine, et al., "Engineering cysteine mutants to
obtain crystallographic phases with a cutinase from Fusarium solani
pisi", Protein Engineering, vol. 6, No. 2, pp. 157-165, 1993. cited
by other .
Martinez, Diego, et al., "Genome sequence of the lignocellulose
degrading fungus Phanerochaete chrysosporium strain RP78", Nature
Biotechnology, Nature Publishing Group, pp. 1-6, published online
on May 2, 2004. cited by other .
Mase et al., "Purification and Characterization of a new Lipase
from Fusarium sp. TM-30", Biosci. Biotech. Biochem., vol. 59, No.
9, pp. 1771-1772, 1995. cited by other .
Mason, "Use of Lipolytic Enzyme From Aeromonas in Detergents",
Research Disclosure, Kenneth Mason Publications, Westbourne GB no
390, Oct. 1996, pp. 661-662. cited by other .
Masuda, Naoko, et al., "Primary structure of protein moiety of
Penicillium notatum phospholipase B deduced from the Cdna", Eur. J.
Biochem., vol. 202, pp. 783-787, 1991. cited by other .
Matos, A.R., et al., "A patatin-like protein with galactolipase
activity is induced by drought stress in Vigna unguiculata leaves",
Biochemical Society Transactions, Lipid Catabolism: Lipid
Degradation, vol. 28, part 6, p. 779-781, Jun. 30, 2000. cited by
other .
Matos, AR et al, "A novel patatin-like gene stimulated by drought
stress encodes a galactolipid acyl hydrolase", FEBS Letters, 491,
pp. 188-192, (First published online Feb. 9, 2001). cited by other
.
Matsuda H et al, "Purification and properties of a lipolytic
acyl-hydrolase from potato leaves", Biochimica et Biophysica Acta,
vol. 573(1), p. 155-165, (1979). cited by other .
Matsuoka, et al.; "Purification and properties of a Phospholipase C
That has High Activity toward Sphingomyelin from Aspergillus
Saitoi"; Biotechonology and Applied Biochemistry (1987); vol. 9,
pp. 401-409. cited by other .
Matthes et al, "Simultaneous rapid chemical synthesis of over one
hundred oligonucleotides on a microscale" The EMBO Journal, vol. 3,
No. 4, pp. 801-805, (1984). cited by other .
Reetz M.T., Max-Planck-Institut fur Kohlenforschung et al.,
"Controlling the enantioselectivity of enzymes by directed
evolution: Practical and theoretical ramifications", PNAS, Apr. 20,
2004, vol. 101, No. 16, pp. 5716-5722. NZAS-0441867. cited by other
.
McAuley, Katherine E., et al., "Structure of a feruloyl esterase
from Aspergillus niger", Acta Crystallographica, Section D, D60,
Biological Crystallography, pp. 878-887, 2004. cited by other .
McCoy M G et al, "Characterization of the lipolytic activity of
endothelial lipase", Journal of Lipid Research (2002), vol. 43, pp.
921-929. cited by other .
McNeill G.P. & Berger R.G., Enzymatic glycerolysis of palm oil
fractions and palm oil based model mixture: Relationship between
fatty acid composition and monoglyceride yield, in Food
Biotechnology 7: pp. 75-87, (1993). cited by other .
McNeill, Gerald P., et al., "Further Improvements in the Yield of
Monoglycerides During Enzymatic Glycerolysis of Fats and Oils",
JAOCS, Jan. 1991, vol. 68, No. 1, pp. 6-10. NZAS-0213370. cited by
other .
McNeill, Gerald P., et al., "High-Yield Enzymatic Glycerolysis of
Fats and Oils", JAOCS, vol. 68, No. 1, pp. 1-5, Jan. 1991. cited by
other .
McNeill, Gerald P., et al., "Selective Distribution of Saturated
Fatty Acids into the Monoglyceride Fraction During Enzymatic
Glycerolysis", JAOCS, vol. 69, No. 11, pp. 1098-1103, Nov. 1992.
cited by other .
McNeill, Gerald P., et al., "Solid Phase Enzymatic Glycerolysis of
Beef Tallow Resulting in a High Yield of Monoglyceride", JAOCS,
vol. 67, No. 11, pp. 779-783, (Nov. 1990). cited by other .
Memo: From Charlotte Johanson, "Short introduction/ status on
Ferulic Acid Esterases and Acetyl Xylan Esterases", Protein
Biochemistry, pp. 1-2, Jan. 9, 2004. cited by other .
Meyer, V., et al., "Transcriptional regulation of the Antifungal
Protein in Aspergillus giganteus", Mol Genet Genomics, 2002, vol.
266, pp. 747-757. cited by other .
Meyers, Robert A., "Molecular Biology and Biotechnology--A
Comprehensive Desk Reference" VCH Publishers, pp. 731-737, (1995).
ISBN1560815698, NZAS-015769. cited by other .
Michalski et al., "Photosynthetic apparatus in chilling-sensitive
plants. VII. Comparison of the effect of galactolipase treatment of
chloroplasts and cold-dark storage of leaves on photosynthetic
electron flow", Biochimica et Biophysica Acta, vol. 589, pp. 84-99,
1980. cited by other .
Mielgo, I., et al., "Covalent immobilisation of manganese
peroxidases (MnP) from Phanerochaete chrysosporium and Bjerkandera
sp. BOS55", Enzyme and Microbial Technology, vol. 32, pp. 769-775
(2003). cited by other .
Miller, Byron S., et al., "A Comparison of Cereal, Fungal, and
Bacterial Alpha-Amylases as Supplements for Breadmaking", Food
Technology, pp. 38-42, (Jan. 1953). NZAS 0225991. cited by other
.
Mine Y, "Application of the enzymatic methods to the determination
of contaminated yolk in egg white", Food Research International,
vol. 29, No. 1, pp. 81-84, (1996). cited by other .
Ministerio da Ciencia e Tecnologia, Diario Oficial da Uniao, No.
134, p. 6, Jul. 15, 2003. ISSN 1677-7042, NZNA-0046369. cited by
other .
Mogensen, Jesper E., et al., "Activation, Inhibition, and
Destabilization of Thermomyces lanuginosus Lipase by Detergents",
Biochemistry, vol. 44, pp. 1719-1730, 2005. cited by other .
Molecular Biological Methods for Bacillus--Chapter 3 Plasmids (Ed.
C.R. Harwood and S.M. Cutting) John Wiley and Sons Ltd, Chichester,
UK, p. 75-174, 1990. cited by other .
M lgaard, Anne, et al., "Rhamnogalacturonan acetylesterase
elucidates the structure and function of a new family of
hydrolases", Structure, vol. 9, No. 4, pp. 373-383, 2000.
NZNA-0056695. cited by other .
Umanskii M.S. et al., Effect on quality of Kostroma cheese of
bacterial cultures selected on phospholipase activity, Molochnaya
Promyshlennost 1980 No. 11 21-25, 47--abstract from Food Sci &
Tech Abs. cited by other .
Monick John A., Alcohols, Their Chemistry, Properties and
Manufacture, Reinhold Book Cooperation, pp. 3, 6, 14, 47, 48,
(1968). cited by other .
"Mono- and Diglycerides of Edible Fatty Acids", in Monographs for
Emulsifiers for Foods, 2nd Edition, The European Food Emulsifier
Manufacturers' Association (EFEMA), pp. 47-51, Nov. 1985. cited by
other .
Moore, Charles M., et al., "Metal ion homeostasis in Bacillus
subtilis", Current Opinion in Microbiology, vol. 8, pp. 188-195,
2005. cited by other .
Morgan, Keith R., et al., "Stalling in Starch Breads: The Effect of
Antistaling .alpha.-Amylase", Starch/Starke, vol. 49, pp.
59-66,1997. cited by other .
Morgan-Jones, Gareth; "Notes on Coelomycetes.II. Concerning the
Fusicoccum Anamorph of Botryosphaneria Ribis"; Mycotoxon, vol. 30,
pp. 117-125; Oct.-Dec. 1987. cited by other .
Morinaga et al., "Improvement of Oligonucleotide-Directed
Site-Specific Mutagenesis Using Double-Stranded Plasmid DNA",
Biotechnology 2, pp. 636-639, (1984). cited by other .
Morten, T. & A., Letter, Rodovre, Jul. 2004. cited by other
.
Mukherjee, Kumar D. et al., "Enrichment of y-linolenic acid from
fungal oil by lipase-catalysed reactions", Appl. Microbiol
Biotechnol (1991), vol. 35, pp. 579-584. cited by other .
Murakami, Mototake, et al., "Transesterification of Oil by Fatty
Acid-Modified Lipase", Technical Research Institute, JAOCS, Jun.
1993, vol. 70, No. 6, p. 571-574 NZAS-0457255. cited by other .
Murakami, Nobutoshi, et al., "Enzymatic Transformation of
Glyceroglycolipids into sn-1 and sn-2 Lysoglyceroglycolipids by use
of Rhizopus arrhizus Lipase", Tetrahedron, vol. 50, No. 7, pp.
1993-2002, (1994). cited by other .
Mustranta, Annikka, et al., "Comparison of Lipases and
Phosphlipases in the Hydrolysis of Phospholipids", Process
Biochemistry, vol. 30, No. 5, pp. 393-401, 1995. cited by other
.
General Conditions of the company limited by shares N.V.
Nederlandsch Octrooibureau, Terms and Conditions, Jan. 2004.
NZAS-0012567. cited by other .
Nagano, et al.; "Cloning and Nucleotide Sequence of cDNA Encoding a
Lipase from Fusarium keteroporum"; J. Biochem (1994); vol. 116; pp.
535-540. cited by other .
Nagao T. et al, "C-Terminal Peptide of Fusarium heterosporum Lipase
is Necessary for its Increasing Thermostability", J. Biochem., vol.
124, 1124-1129, 1998. cited by other .
Nagao, T., et al, "Amino Acid Residues Contributing to
Stabilization of Fusarium heterosporum Lipase", J. of Bioscience
and Bioengineering, vol. 89, No. 5, pp. 446-450, 2000. cited by
other .
Nagao, T., et al, "Review: Increase in stability of Fusarium
heterosporum lipase", J. of Molecular Catalysis B: Enzymatic 17
(2002) pp. 125-132. cited by other .
Nagao, T., et al, "Use of Thermostable Fusarium heterosporum Lipase
for Production of Structured Lipid Containing Oleic and Palmitic
Acids in Organic Solvent-Free System", JAOCS vol. 78, No. 2, pp.
167-172, (2001). cited by other .
Nagao, Toshihiro et al., "Cloning and Nucleotide Sequence of CDNA
Encoding a Lipase from Fusarium heterosporum", J. Biochem., vol.
116, pp. 535-540, 1994. cited by other .
Nagao, Toshihiro et al., "Expression of Lipase cDNA from Fusarium
heterosporum by Saccharomyces cereviisiae: High-Level Production
and Purification", Journal of Fermentation and Bioengineering,
1996, vol. 81, No. 6, pp. 488-492. cited by other .
Godtfredsen S E, "Lipases", in "Enzymes in food processing" (3rd
Ed.), Nagodawithana T and Red G (editors), Academic Press, New
York, 1993, ISBN 0125136307, chapter 8, p. 205-219 NZAS-0665885.
cited by other .
National Research Council (U.S.) Committee on Specifications of the
Food Chemicals Codex, "Lipase Activity" in Food Chemicals Codex
(1981) National Academy Press, Washington, D.C. pp. 492-493. cited
by other .
Needleman & Wunsch (1970), J. of Molecular Biology 48, 443-453.
cited by other .
Nelson and Long, Analytical Biochemistry (1989), 180, p. 147-151.
cited by other .
Nerland A H, Journal of Fish Diseases, vol. 19, No. 2, 1996, pp.
145-150. cited by other .
Neron, et al., "Effects of lipase and the phosphlipase on the
lipids hydrolysis during mixing in correlation with the oxygen
consumption by wheat flour dough during kneading", poster 125 Ko at
AACC/Tia, San Diego, Calfornia, Sep. 20-22, 2004, available at
http://www.cnam.fr/biochimie. cited by other .
Ness, Jon. E., et al., "DNA shuffling of subgenomic sequences of
subtilisin" Nature Biotechnology, vol. 17, Sep. 1999. cited by
other .
Nestle Research Center, Brochure for "Food Colloids 2006" in
Montreux, Switzerland, Apr. 23-26, 2006. cited by other .
Neugnot Virginie et al, European Journal of Biochemistry, 2002,
vol. 269, pp. 1734-1745. cited by other .
Newport, G., et al., "KEX2 Influences Candida albicans Proteinase
Secretion and Hyphal Formation", The Journal of Biological
Chemistry, 1997, vol. 272, No. 46, pp. 28954-28961. cited by other
.
Nicolas, Anne, et al., "Contribution of Cutinase Serine 42 Side
Chain to the Stabilization of the Oxyanion Transition State",
Biochemistry, vol. 35, pp. 398-410, 1996. cited by other .
Nielsen et al., "Lipases A and B from the yeast Candida
antarctica", in "Biotechnological Applications of Cold-Adapted
Organisms" Margesin R & Shimmer F (editors), Springer, 1999,
ISBN 3540649727 p. 49-61 NZAS-0214451. cited by other .
Nierle W et al, Fette Seifen Anstrichmittel (Wheat Lipids: Function
and Effect in Flour Processing) (1981), vol. 83(10), p. 391-395.
cited by other .
Nierle, W., et al., "Versuche zur Verlangerung der Haltbarkeit von
Dartoffelprodukten", Chem. Mikrobiol. Technol. Lebensm., 1975, vol.
3, pp. 172-175. cited by other .
Nobutoshi M et al, Tetrahedron Letters (1991), vol. 31(1), p.
1331-4. cited by other .
Novozymes data dated Jul. 17, 2005 entitled "Baking performance of
prior art lipases from Humicola lanuginosa, Aspergillus tubigensis,
Rhizopus delemar and Rhizomucor miehei, and their activity on
galactolipids in dough". cited by other .
Novozymes Memo--Test of lipases for EP1193314B1, Jul. 6, 2005, p.
1-5. cited by other .
Novozymes Report 2002 Annual Report, "Successfor new baking
enzyme," p. 1-2. cited by other .
Novozymes journal BioTimes, "Biowhitening--a new concept for
steamed bread", Jan. 2005
http://www.biotimes.com/en/Articles/2005/March/Pages/Biowhitening-anewcon-
ceptforsteamedbread.aspx, p. 1-2. cited by other .
Novozymes, "Breakthrough: Less Fattening Fried Food" BioTimes, Jun.
2001, No. 2, p. 1-12. cited by other .
Novozymes, "Enzymes for dough strengthening", 2001, p. 16-21. cited
by other .
Novozymes, "Lipopan F BG-application and mechanism of a new lipase
for bread baking" (Draft) Cereal Food (2003) (Author:
Drost-Lustenberger, C. et al.), p. 1-29. cited by other .
Novozymes, "Product Sheet for Lipopan F BG", Cereal Food, (2001),
p. 1-3. cited by other .
Novozymes, "Product Sheet for Lipopan FS BG", Cereal Food (2002),
p. 1-3. cited by other .
Novozymes, "Product Sheet for Lipopan S BG", Cereal Food (2002), p.
1-3. cited by other .
Novozymes, "Product Sheet for Noopazyme", Cereal Food (2002) p.
1-3. cited by other .
Novozymes, "Product Sheet for Novozym 27016," Baking (2000), p.
1-6. cited by other .
Novozymes, "Product Sheet for Novozym 27019," Baking (2000), p.
1-6. cited by other .
Novozymes, "Product Sheet for Novozym 27080," Cereal Food (2003),
p. 1-3. cited by other .
Novozymes, "Revolutionizing baking", BioTimes (Dec. 2002) pp. 6-7.
cited by other .
Novozymes, "Strong sales for lipase that makes dough stronger"
BioTimes, Dec. 2003, p. 1-2. cited by other .
Novozymes, "The perfect roll every time for steers", BioTimes, Sep.
2003, p. 1-2. cited by other .
Novozymes, "The value of innovation", BioTimes, Mar. 2004, p. 8-9.
cited by other .
Novozymes, "The vital role of technical service in baking",
BioTimes, Jun. 2004, p. 8-9. cited by other .
Novozymes brochure "Enzymes at work" 2004, p. 1-60. cited by other
.
Nylander et al., "Interaction between lipids and lipases A
collection of papers presented at the European Meeting on lipid and
lipase interaction at Lund University" Sep. 2000. cited by other
.
Ognjenovic Radomir et al, Acceleration of ripening of semi-hard
cheese by proteolytic and lipolytic enzymes, Proceedings for
Natural Sciences, 1996, vol. 91, p. 5-17. cited by other .
Ohm, J.B., et al., "Relationships of Free Lipids with Quality
Factors in Hard Winter Wheat Flours", Cereal Chem., vol. 79, No. 2,
pp. 274-278, 2002. cited by other .
Ohta, S. et al., "Application of Enzymatic Modification of
Phospholipids on Breadmaking", Abstract from AACC 68th Annual
Meeting in Kansas City, MO, Oct. 30th-Nov. 3, 1983, published in
Cerial Foods World, p. 561. cited by other .
Ohta, Yoshifumi, et al., "Inhibition and Inactivation of Lipase by
Fat Peroxide in the Course of Batch and Continuous Glycerolyses of
Fat by Lipase", Agric. Biol. Chem., vol. 53, No. 7, pp. 1885-1890,
1989. cited by other .
Okiy D.A. (1977) "Partial glycerides and palm oil Crystallisation,"
in Journal of Science and Food Agriculture vol. 28, p. 955. cited
by other .
Okiy D.A. (1978) "Interaction of triglycerides and diglycerides of
palm oil," in Oleagineux, vol. 33 p. 625-628. cited by other .
Okiy D.A., Wright, W.B., Berger, K.G. & Morton I.D. (1978), The
physical properties of modified palm oil, in Journal of Science of
Food and Agriculture 29:1061-1068. cited by other .
Oluwatosin, Yemisi E., et al., "Phenotype: a Possible Role for the
Kex2 Endoprotease in Vacuolar Acidification", Molecular and
Cellular Biology, 1998, pp. 1534-1543. cited by other .
Oluwatosin, Yemisi E., et al., "Mutations in the Yeast KEX2 Gene
Cause a Vma-Like Phenotype: a Possible Role for the Kex2
Endoprotease in Vacuolar Acidification", Molecular and Cellular
Biology, vol. 18, No. 3, pp. 1534-1543, Mar. 1998. cited by other
.
O'Mahony et al. "Hydrolysis of the lipoprotein fractions of milk by
Phospholipase C," Journal of Dairy Science, 1972, vol. 55, No. 4,
p. 408-412. cited by other .
Orberg, Marie-Louise, "Self-assembly Structures Formed by Wheat
Polar Lipids and their Interaction with Lipases", Master of Scient
Thesis, Apr. 2005. cited by other .
Orskov, Janne, et al., "Solubilisation of poorly water-soluble
drugs during in vitro lipolysis of medium- and long-chain
triacylglycerols", European Journal of Pharmaceutical Sciences,
vol. 23, 2004. pp. 287-296. cited by other .
Osman, Mohamed, et al., "Lipolytic activity of Alternaria altemata
and Fusarium oxysporum and certain properties of their lipids",
Microbios Letters, vol. 39, pp. 131-135, 1988. cited by other .
O'Sullivan et al, "A Galactolipase activity associated with the
thylakoids of Wheat Leaves (Triticum aestivum L.)," J Plant
Physiol, vol. 313, (1987) p. 393-404. cited by other .
Outtrup, Gunther H., et al., "Properties and Application of a
Thermostable Maltogenic Amylase Produced by a Strain of Bacillus
Modified by Recombinant-DNA Techniques", Starch/Starke (2003) vol.
36, No. 12, pp. 405-411. cited by other .
Palomo, Jose M., et al., "Enzymatic production of (3S,
4R)-(-)-4-(4'-fluorophenyl)-6-oxo-piperidin-3-carboxylic acid using
a commerical preparation of lipase A from Candida antarctica: the
role of a contaminant esterase" Tetrahedron: Asymmetry, vol. 13,
2002, pp. 2653-2659. cited by other .
Palomo, Jose M., et al., "Enzymatic resolution of (.+-.)-glycidyl
butyrate in aquenous media. Strong modulation of the properties of
the lipase from Rhizopus oryzae via immobilization techniques",
Tetrahedron: Asymmetry, vol. 15, 2004, pp. 1157-1161. cited by
other .
Palomo, Jose M., et al., "Modulation of the enantioselectivity of
Candida antarctica B lipase via conformational engineering: kinetic
resolution of (.+-.)-.alpha.-hydroxy-phenylacetic acid
derivatives", Tetrahedron: Asymmetry, vol. 13, 2002, pp. 1337-1345.
cited by other .
Pariza, Michael, et al., "Evaluating the safety of Microbiol Enzyme
Preparations Used in Food Processing: Update for a New Century",
Regulatory Toxicology and Pharmacology (2001) vol. 33, pp. 173-186.
cited by other .
Patent Abstracts of Japan vol. 016, No. 528 (C-1001), Oct. 29, 1992
& JP 04 200339 A see abstract. cited by other .
Patent Abstracts of Japan vol. 095, No. 001, Feb. 28, 1995 & JP
06 296467 A see abstract. cited by other .
Peelman F, et al, "A proposed architecture for lecithin cholesterol
acyl transferase (LCAT): Identification of catalytic triad and
molecular modeling," Protein Science Mar. 1998; 7(3): 587-99. cited
by other .
Penninga et al, "Site-directed mutations in Tyrosine 195 of
Cyclodextrin Glycosyltransferase from Bacillus circulans Strain 251
affect qctivity and product Specificity," Biochemistry (1995),
3368-3376. cited by other .
Persson, Mattias, et al., "Enzymatic fatty acid exchange in
digalactosyldiacylglycerol", Chemistry and Physics of Lipids, vol.
104, 2000, pp. 13-21. cited by other .
Peters, G.H., et al., "Active Serine Involved in the Stabilization
of the Active Site Loop in the Humicola lanuginosa Lipase",
Biochemistry, 1998, vol. 37, pp. 12375-12383. cited by other .
Peters, G.H., et al.; "Dynamics of Rhizomucor miehei lipase in a
lipid or aqueous environment: Functional role of glycines"; Draft
for Biophys. J, Nov. 1996, vol. 71, No. 5, p. 2245-2255
NZAS-0031441. cited by other .
Peters, G.H., et al.; "Essential motions in lipases and their
relationship to the biological function", Proceedings of the German
Conference on Bioinformatics, GCB '96, Leipzig, Germany, Sep.
30-Oct. 2, 1996, poster, p. 280-282 NZAS-0031438. cited by other
.
Peters, Gunther H., et al., "Theoretical Investigation of the
Dynamics of the Active Site Lid in Rhizomucor miehei Lipase",
Biophysical Journal, vol. 71, 1996, pp. 119-129. cited by other
.
Harborne J.B. et al. (editors), Phytochemical Dictionary: A
Handbook of Bioactive Compounds from Plants, Taylor & Francis,
1993, ISBN 978050667363 Chapter 4, "Sugar Alcohols and Cyclitols",
p. 20-23. cited by other .
Picon et al., "Release of Encapsulated Proeinase from
Dehydration-Rehydration Liposomes by a Co-encapsulated
Phospholipase," Biotechnology Letters, Oct. 1995, vol. 17, No. 10,
pp. 1051-1056. cited by other .
Plijter J and JHGM Mutsaers, "The surface rheological properties of
dough and the influence of lipase on it, Gist-brocades," Bakery
Ingredients Division, Oct. 1994. cited by other .
Plou et al, "Enzymatic acylation of di- and trisaccharides with
fatty acids: choosing approiate enzyme, support and solvent," J.
Biotechnology 92 (2002) 55-66. cited by other .
Ponte J G, "Note on the Separation and Baking properties of Polar
and Nonpolar Wheat Flour Lipids," Cereal Chemistry (1969), vol.
46(3), p. 325-29. cited by other .
Poulsen, C.H., et al., "Effect and Functionality of Lipases in
Dough and Bread", in Angelino SAGF, Hamer RJ, van Hartingsveldt W,
Heidekamp F, van der Lugt JP (editors), First European Symposium on
Enzymes and Grain Processing, Zeist, The Netherlands, TNO Nutrition
and Food Research Institute, ISBN 90-75202-04-0, p. 204-214.
Proceedings of ESEGP-1, Noordwijkerhout, The Netherlands, Dec. 2-4,
1996. NZAS-0158559. cited by other .
Poulsen, Charlotte, et al. "Purification and Characterization of a
Hexose Oxidase with Excellent Strenghening Effects in Bread" Cereal
Chem. (1998) vol. 75(1); pp. 51-57. cited by other .
Punt, P. et. al., "Transformation of Filamentous Fungi Based on
Hygromycin B and Phleomycin Resistance Markers," Meth. Enzym.,
1992, 216:447-457. cited by other .
Pyler, E.J., "Baking Science and Technology," Third Edition vol. 1,
1988, p. 1-602. cited by other .
Pyler, E.J., "Baking Science and Technology," Third Edition, vol.
II, 1988, p. 1-784. cited by other .
Queener et al. (1994), "Improved Expression of a Hybrid:
Streptomyces clavuligerus cefE Gene in Penicillium chrysogenum,"
Ann N Y Acad Sci. 721, p. 178-193. cited by other .
Rambosek, J., "Recombinant DNA in Filamentous Fungi: Progress and
Prospects," CRC Crit. Rev. Biotechnol., 1987, vol. 6, No. 4, p.
357-393. cited by other .
Rapp, Peter, et al., "Formation of extracellular lipases by
filamentous fungi, yeasts, and bacteria", Enzyme Microb. Technol.,
1992, vol. 14, November. cited by other .
Rapp, Peter; "Production, regulation, and some properties of lipase
activity from Fusarium oxysporum f. sp. vasinfectum"; Enzyme and
Microbial Technology(1995); vol. 17; pp. 832-838. cited by other
.
Reetz M.T et. al., "Overexpression, immobilization and
biotechnological application of Pseudomonas lipases," Chem Phys
Lipids. Jun. 1998; 93(1-2): 3-14. cited by other .
Reetz Manfred T, "Lipases as practical biocatalysts," Current
Opinion in Chemical Biology, Apr. 2002, vol. 6, No. 2, pp. 145-150.
cited by other .
Reiser J et al.(1990). "Transfer and Expression of Heterologous
Genes in Yeasts other than Saccharomyces cerevisiae," Adv Biochem
Eng Biotechnol. 43, p. 75-102. cited by other .
Richardson & Hyslop, "Enzymes", pp. 371-476 in "Food Chemistry
Second Edition, Revised and Expanded", 1985, second edition, Owen
R. Fennema (ed), Marcel Dekker, Inc, New York and Basel. cited by
other .
Richardson and Hyslop, "Enzymes: XI--Enzymes Added to Foods During
Processing" in Food Chemistry, Marcel Dekker, Inc., New York, NY
1985. cited by other .
Arskog and Joergensen, "Baking performance of prior art lipases
from Candida cylindraceaand Aspergillus foeditus and their actiivty
on galactolipids in dough", Novozymes Report 2005. cited by other
.
Arskog and Joergensen, "Baking performance of prior art lipases
from Humicola lanuginosa, Aspergillus tubigensis, Rhizopus delemar
and Rhizomucor miehei, and their actiivty on galactolipids in
dough", Novozymes Report 2005. cited by other .
Richardson, Toby H., et al., "A Novel, High Performance Enzyme for
Starch Liquefaction", The Journal of Biological Chemistry, vol.
277, No. 29, Issue of Jul. 19, pp. 25501-26507, 2002. cited by
other .
Roberts et al. (1992) . "Heterologous gene expression in
Aspergillus niger: a glucoamylase-porcine pancreatic
prophospholipase A2 fusion protein is secreted and processed to
yield mature enzyme," Gene 122(1), 155-161. cited by other .
Roberts, et al.; "Extracellular Lipase Production by Fungi from
Sunflower Seed"; Mycologia(1987); vol. 79(2); pp. 265-273. cited by
other .
Robertson et al, "Influence of Active Site and Tyrosine
Modification on the Secretion and Activity of the Aeromonas
hydrophila Lipase/Acyltransferase," Journal of Biological
Chemistry, 1994, vol. 259, No. 3, p. 2146-2150. cited by other
.
Rodrigues, et al.;"Short Communication: Bioseparations with
Permeable Particles"; Journal of Chromatography & Biomedical
Applications(1995); vol. 655; pp. 233-240. cited by other .
Rogalska, Ewa, et al., "Stereoselective Hydrolysis of Triglycerides
by Animal and Microbial Lipases", Chirality, vol. 5, pp. 24-30,
1993. cited by other .
Rose, et al.;"CODEHOP (Consensus-Degenerate Hybrid Oligonucleotide
Primer) PCR primer design"; Nucleic Acids Research(2003); vol.
31(13); pp. 3763-3766. cited by other .
Rousseau, Derick, et al., "Tailoring the Textural Attributes of
Butter Fat/Canola Oil Blends via Rhizopus arrhizus Lipase-Catalyzed
Interesterification. 2. Modifications of Physical Properties", J.
Agric. Food Chem., vol. 1998, vol. 46, pp. 2375-2381. cited by
other .
Rydel, Timothy J. et al., "The Crystal Structure, Mutagenesis and
Activity Studies Reveal that Patatin Is a Lipid Acyl Hydrolase with
a Ser-Asp Catalytic Dyad", Biochemistry, 2003, vol. 42, pp.
6696-6708. cited by other .
Sahsah, Y., et al., "Enzymatic degradation of polar lipids in Vigna
unguiculata leaves and influence of drought stress", Physiologia
Plantarum, vol. 104, pp. 577-586, 1998. cited by other .
Sahsah, Y., et al., "Purification and characterization of a soluble
lipolytic acylhydrolase from Cowpea (vigna unguiculata L.) leaves",
Biochimica et Biophysica Acta, vol. 1215, pp. 66-73, 1994. cited by
other .
Saiki R.K. et al, "Primer-Directed Enzymatic Amplification of DNA
with a Thermostable DNA Polymerase," Science (1988) 239, pp.
487-491. cited by other .
Saito, Kunihiko, et al., "Phospholipase B from Penicillium
notatum", Methods in Enzymology, 1991, vol. 197, p. 446-456
NZAS-0418833. cited by other .
Sakai, Norio, et al., "Human glactocerebrosidase gene: promoter
analysis of the 5'-flanking region and structural organization",
Biochimica et Biophysica Acta, vol. 1395, pp. 62-67, 1998. cited by
other .
Sakaki T et al, Advanced Research on Plant Lipids, Proceedings of
the International Symposium on Plant Lipids, 15th, Okazaki, Japan,
May 12-17, 2002 (2003) p. 291-294, Publisher Kluwer Academic
Publishers. cited by other .
Sambrook et al, Chapters 1, 7, 9, 11, 12 and 13--Molecular Cloning
a laboratory manual, vol. 3, p. 1.113.104, Cold Spring Harbor
Laboratory Press (1989). cited by other .
Sambrook, J., et al. "Molecular Cloning: A Laboratory Manual,
Second Edition", Plasmid Vectors, 1989, p. 1-462. cited by other
.
Sanchez et al., "Solution and Interface Aggregation States of
Crotalus atrox Venom Phospholipase A2 by Two-Photon Excitation
Fluorescence Correlation Spectroscopy", Biochemistry, 2001, vol.
40, pp. 6903-6911. cited by other .
Sarney Douglas B. et al, "Enzymatic Synthesis of Sorbitan Esters
Using a Low-Boiling-Point Azeotrope as Reaction Solvent",
Biotechnology and Bioengineering, 1997, vol. 54(4). cited by other
.
Saxena, et al.; "Purification Strategies for Microbial Lipases";
Journal of Microbilogical Methods (2003); pp. 1-18. cited by other
.
Scheib et al.; "Stereoselectivity of Mucorales lipases toward
triradylglycerols--A simple solution to a complex problem"; Protein
Science (1999); vol. 8; pp. 215-221. cited by other .
Schiller, Jurgen, et al., "Lipid analysis of human spermatozoa and
seminal plasma by MALDI-TOF mass spectrometry and NMR
spectroscopy--effects of freezing and thawing" Chemistry and
Physics of Lipids, vol. 106, 2000, pp. 145-156. cited by other
.
Schofield, J. David, "Wheat Structure, Biochemistry and
Functionality", Department of Food Science and Technology, Apr.
2000, p. 243-260. cited by other .
Scopes, Robert K., "Section 8.4: Ultrafiltration" in Protein
Purification Principles and Practice, Third Edition (1994)
Springer-Verlag, New York, p. 267-269. cited by other .
Shehata, A. "Manufacture of Blue Cheese by Direct Acidification
Methods," University of Wisconsin, Nov. 30, 2005, p. 1-90. cited by
other .
Shillcock, Julian C., et al., "Equilibrium structure and lateral
stress distribution of amphiphilic bilayers from dissipative
particle dynamics simulations", Journal of Chemical Physics, vol.
117, No. 10, Sep. 8, 2002. cited by other .
Shillcock, Julian C., et al., "Tension-induced fusion of bilayer
membranes and vesicles", Advance Online Publication Feb. 13, 2005,
Nat. Mater., 2005, vol. 4, No. 3, p. 225-228 NZAS-0231181. cited by
other .
Shimada et al, "Enzymatic Purification of Polyunsaturated Fatty
Acids," J. of Bioscience and Bioengineering vol. 91, No. 6, 529-538
(2001). cited by other .
Shimada et al, "Purification and Characterization of a Novel
Solvent-Tolerant Lipase from Fusarium heterosporum," J. of
Fermentation and Bioengineering vol. 75, No. 5, 349-352 (1993).
cited by other .
Shimada et al, "Enrichment of Polyunsaturated Fatty Acids with
Geotrichum candidum Lipase," JAOCS vol. 71, No. 9, (Sep. 1994), p.
951-954. cited by other .
Shin, et al.; "Butyl-Toyopearl 650 as a New Hydrophobic Adsorbent
for Water-Soluable Enzyme Proteins"; Analytical Biochemistry(1984);
vol. 138; pp. 259-261. cited by other .
Shogren, M.D., et al., "Functional (Breadmaking) and Biochemical
Properties of Wheat Flour Components. I. Solubilizing Gluten and
Flour Protein", Cereal Chemistry, vol. 46, No. 2, Mar. 1969, p.
93-103. cited by other .
Si, Joan Qi, "Enzymes, Baking, Bread-Making", Encyclopedia of
Bioprocess Technology, Wiley, 1999, ISBN 0471138223 NZAS-0255053,
p. 1-18. cited by other .
Si, Joan Qi, "Synergistic Effect of Enzymes for Breadbaking", Novo
Nordisk publication A-06513b, p. 1-18, based on presentation No.
300 at AACC Annual Meeting 1996, Baltimore. Also Encyclopedia of
Bioprocess Technology, Wiley, 1999, ISBN 0471138223. cited by other
.
Si, Joan Qi, et al. "Enzymes for bread, noodles and non-durum
pasta", Cereal Food 2002 p. 1:3-3:4. Also in Enzymes in Food
Technology, RJ Whitehurst & BA Law, Enzymes in Food Technology,
Sheffield Academic Press, ISBN 1-84127-223-X, p. 19-54. cited by
other .
Si, Joan Qi, et al., "Novamyl--A true Anti-Staling Enzyme", Cereal
Food, Oct. 2001, p. 1-20. cited by other .
Si, Joan Qi, et al., "Synergistic Effect of Enzymes for
Breadbaking", Cereal Food, Oct. 2001, p. 1:21, based on
presentation No. 300 at AACC Annual Meeting 1996, Baltimore. Also
Encyclopedia of Bioprocess Technology, Wiley, 1999, ISBN
0471138223. cited by other .
Si, Joan Qi; "New Enzymes for the Baking Industry"; Food Tech
Europe (1996) pp. 60-64. cited by other .
Sias B et al, "Human Pancreatic Lipase-Related Protein 2 Is a
Galactolipase," Biochemistry, (2004), vol. 43(31), p. 10138-48.
cited by other .
Siew W.L. et. al. (1999) "Influence of diglycerides on
crystalisation of palm oil," in Journal of Science of Food and
Agriculture 79:722-726. cited by other .
Siew W.L. & Ng W.L. (2000) Differential scanning thermograms of
palm oil triglycerides in the presence of diglycerides, in Journal
of Oil Palm Research 12:107. cited by other .
Siew W.L. (2001) Understanding the Interactions of Diacylglycerols
with oil for better product performance, paper presented at the
2001 PIPOC International Palm Oil Congress--Chemistry and
Technology Conference Aug. 20-23, 2001, Kuala Lumpur, Malaysia.
cited by other .
Skovgaard, et al.;"Comparison of Intra- and extracellualr isozyme
banding patterns of Fusarium oxysporum"; Mycol. Res. (1998); vol.
102(9); pp. 1077-1084. cited by other .
Slotboom et al, "Hydrolysis of Phosphoglycerides by Purified Lipase
Preparation," Chem. Phys. Lipids vol. 4 (1970) 15-29. cited by
other .
Smith, George P.; "The Progeny of sexual PCR"; Nature; vol. 370;
No. 18; Aug. 4, 1994 p. 324-325. cited by other .
Smith, Timothy L., et al., "The promoter of the
glucoamylase-encoding gene of Aspergillus niger functions in
Ustilago maydis", Gene. 88, 259-262, 1990. cited by other .
Soe, J.B., "Analyses of Monoglycerides and Other Emulsifiers by
Gaschromatography", Fette, Seifen, Anstrichmittel, 1983, 85
Jahrgang, nr. 2, p. 72-76NZNA-0005896. cited by other .
Solares, Laura F., et al., "Enzymatic resolution of new carbonate
intermediates for the synthesis of (S)-(+)-zopiclone", Tetrahedron:
Asymmetry, vol. 13, 2002, pp. 2577-2582. cited by other .
Sols and De Le Fuente, "On the substrate specificity of glucose
oxidase", Biochem et Biophysica Acta (1957) 24:206-7. cited by
other .
Sonntag N. O.V. (1982a) Glycerolysis of Fats and methyl
esters--status, review and critique, in Journal of American Oil
Chemist Society 59:795-802A. cited by other .
Soragni, Elisabetta, et al., "A nutrient-regulated, dual
localization phospholipase A2 in the symbiotic fungus" The EMBO
Journal, vol. 20, No. 18, pp. 5079-5090, 2001. cited by other .
Sosland, Josh, "Alive and kicking", Milling & Baking News, Feb.
24, 2004.
http://www.bakingbusiness.com/co.sub.--articles.asp?ArticleID=70026
downloaded Sep. 16, 2004 p. 1-13. cited by other .
Soumanou, Mohamed M., et al., "Two-Step Enzymatic Reaction for the
Synthesis of Pure Structured Triacylglycerides", JAOCS, vol. 75,
No. 6, 1998. cited by other .
Spendler, et al., "Functionality and mechanism of a new 2nd
generation lipase for baking industry"--Abstract. 2001 AACC Annual
Meeting; Symposia at Charlotte, NC. Oct. 14-18, 2001. cited by
other .
Spradling J.E., "Tailoring Enzyme Systems for Food Processing,
in"Biocatalysis in Agricultural Biotechnology, ACS Symposium Series
389, ed. Whitaker, John R. et al., 1989, ISBN 0-8412-1571-5 p.
24-43 NZAS-0213683. cited by other .
Sreekrishna K et al (1988) "High level expression of heterologous
proteins in methylotrophic yeast Pichia pastoris," J Basic
Microbiol. 28(4), 265-78. cited by other .
Stadler et al., "Understanding Lipase Action and Selectivity",
CCACAA, vol. 68, No. 3, pp. 649-674, 1995. cited by other .
Steinstraesser, et al., "Activity of Novispirin G10 against
Pseudomonas aeruginosa in Vitro and in Infected Burns",
Antimicrobial Agents and Chemotherapy, Jun. 2002, vol. 46, No. 6,
pp. 1837-1844. cited by other .
Stemmer, Willem P.C.; "DNA shuffling by random fragmentation and
reassembly: In vitro recombination for molecular evolution"; Proc.
Natl. Acad. Sci. USA, vol. 91, pp. 10747-10751; Oct. 1994. cited by
other .
Stemmer, Willem P.C.; "Rapid evolution of a protein in vitro by DNA
shuffling"; Affymax Research Institute, Nature, vol. 370, Aug. 4,
1994. cited by other .
Sternberg, M., "Purification of Industrial Enzymes with Polyacrylic
Acids", Process Biochemistry, Sep. 1976. cited by other .
Strickland, James A., et al., "Inhibition of Diabrotica Larval
Growth by Patatin, the Lipid Acyl Hydrolase from Potato Tubers",
Plant Physiol, vol. 109, pp. 667-674, 1995. cited by other .
Sudbery et al (1988) Biochem Soc Trans. 16(6), 1081-3. cited by
other .
Sugatani, Junko, et al., "Studies of a Phospholipase B from
Penicillium notatum Substrate Specificity and Properties of Active
Site", Biochimica et Biophysica Acta, vol. 620, 1980, pp. 372-386.
cited by other .
Sugimoto et al., Agric. Biol. Chem. 47(6), 1201-1206 (1983). cited
by other .
Sugiyama et al., "Molecular cloning of a second phospholipase B
gene, caPLB2 from Candida albicans", Medical Mycology, vol. 37,
1999. cited by other .
Svendsen, A. "Engineered lipases for practical use", Inform (1994)
5(5):619-623. cited by other .
Svendsen, Allan, "Lipase protein engineering" Biochimica et
Biophysica Acta, vol. 1543, 2000, pp. 223-238. cited by other .
Svendsen, Allan, et al., "Biochemical properties of cloned lipases
from the Pseudomonas family", Biochimica et Biophysica Acta, vol.
1259, 1995, pp. 9-17. cited by other .
Sweigard, James A., et al., "Cloning and analysis of CUT1, a
cutinase gene from Magnaporthe grisea", Mol. Gen. Genet.,
232:174-182, 1992. cited by other .
Swinkels et al (1993) Antonie van Leeuwenhoek 64, 187-201. cited by
other .
Sztajer H et al Acta Biotechnol, vol. 8, 1988, pp. 169-175. cited
by other .
Talker-Huiber, Cynthia Z., et al., "Esterase EstE from Xanthomonas
vesicatoria (Xv.sub.--EstE) is an outer membrane protein capable of
hydrolyzing long-chain polar esters", Appl. Microbiol Biotechnol,
61:479-487, 2003. cited by other .
Terasaki, Masaru, et al., "Glycerolipid Acyl Hydrolase Activity in
the Brown Alga Cladosiphon okamuranus Tokida", Biosci. Biotechnol.
Biochem., vol. 67, No. 9, pp. 1986-1989, 2003. cited by other .
The New Enzyme Operatives, Ingredient Technology, 50, Aug. 1997.
cited by other .
Thommy L-G; Carlson, "Law and Order in Wheat Flour Dough; Colloidal
Aspects of the Wheat Flour Dough and its Lipid and Protein
Constitutents in Aqueous Media", Fortroligt, Lund 1981. cited by
other .
Thornton et al 1988 Biochem. Et Biophys. Acta. 959, 153-159. cited
by other .
Tiss, Aly, et al., "Effects of Gum Arabic on Lipase Interfacial
Binding and Activity", Analytical Biochemistry, vol. 294, pp.
36-43, 2001. cited by other .
Toida J et al, Bioscience, Biotechnology, and Biochemistry, Jul.
1995, vol. 59, No. 7, pp. 1199-1203. cited by other .
Tombs and Blake, Biochim. Biophys (1982) 700:81-89. cited by other
.
Topakas, E., et al. "Purification and characterization of a
feruloyl esterase from Fusarium oxysporum catalyzing esterification
of phenolic acids in ternary water--organic solvent mixtures",
Journal of Biotechnology, vol. 102, 2003, pp. 33-44. cited by other
.
Torossian and Bell (Biotechnol. Appl. Biochem., 1991, 13:205-211.
cited by other .
Tsao et al. (1973) J Supramol Struct. 1(6), 490-7. cited by other
.
Tsuchiya, Atsushi et al, Cloning and Nucelotide Sequence of the
Mono-and Diacylglycerol Lipase Gene (mdlB) of Aspergillus oryzae,
Fems Microbiology Letters (1996) vol. 143, pp. 63-67. cited by
other .
Tsuneo Yamane et al., "Glycerolysis of Fat by Lipase", Laboratory
of Bioreaction Engineering, vol. 35, No. 8, 1986. cited by other
.
Tsychiya, Atsushi, et al., "Cloning and nucleotide sequence of the
mono- and diacylglycerol lipase gene (mdlB) of Aspergillus oryzae",
FEMS Microbiology Letters, vol. 143, pp. 63-67, 1996. cited by
other .
Turnbull, K.M., et al., "Early expression of grain hardness in the
developing wheat endosperm", Planta, 2003, vol. 216, pp. 699-706.
cited by other .
Turner, Nigel A., et al., "At what temperature can enzymes maintain
their catalytic activity?", Enzyme and Microbial Technology, vol.
27, 2000, pp. 108-113. cited by other .
Turner, Progress in Industrial Microbiology, Martinelli and
Kinghorn (eds.), Elsevier, Amsterdam, 1994, 29:641-666. cited by
other .
Uppenberg, Jonas, et al., "Crystallographic and Molecular-Modeling
Studies of Lipase B from Candida antarctia Reveal a
Stereospecificity Pocket for Secondary alcohols", Biochemistry,
1995, vol. 34, pp. 16838-16851. cited by other .
Uppenberg, Jonas, et al., "The Sequence, crystal structure
determination and refinement of two crystal forms of lipase B from
Candida antarctica", Structure 1994, vol. 2, No. 4. cited by other
.
Upton C et al TIBS Trends in Biochemical Sciences, Elsevier
Publication (1995), vol. 20, pp. 178-179. cited by other .
Uusitalo et al. (1991) J Biotechnol. 17(1), 35-49. cited by other
.
Uwajima T et al, Agricultural and Biological Chemistry, 43(12), pp.
2633-2634, 1979. cited by other .
Uwajima T et al, Agricultural and Biological Chemistry, 44(9), pp.
2039-2045, 1980. cited by other .
Vaidehi, et al.; "Lipase Activity of Some Fungi Isolated from
Groundnut"; Current Science (1984); vol. 53(23); p. 1253. cited by
other .
van Binsbergen, Jan, et al., "Substitution of PHE-5 and ILE-9,
Amino Acids Involved in the Active Site of Phospholipase A2 (PLA),
and Chemical Modification of Enzymatically Generated (LYS-6)-PLA.",
Proceedings of the 20th European Peptide Symposium, Sep. 4-9, 1988,
University of Tubingen. cited by other .
Van Den Berg. G, Regulatory status and use of lipase in various
countries, Bulletin of the IDF 294, p. 19-20, 1994. cited by other
.
van Gemeren, I.A., et al., "Expression and Secretion of Defined
Cutinase Variants by Aspergillus awamori" Applied and Environmental
Microbiology, vol. 64, No. 8, pp. 2794-2799, Aug. 1998. cited by
other .
van Kampen, M.D., et al., "The phospholipase activity of
Staphylococcus hyicus lipase strongly depends on a single Ser to
Val mutation", Chemistry and Physics of Lipids, vol. 93, 1998, pp.
39-45. cited by other .
van Nieuqenhuyzen W., "Lecithins Open Doors to baked goods",
International Food Ingredients, 1998, No. 2, p. 32-36. cited by
other .
van Oort, Maarten G et al, Biochemistry 1989 9278-9285. cited by
other .
Vaysse et al J. of Biotechnology 53 (1997) 41-46. cited by other
.
Villenueva, Inform, vol. 8, No. 6, Jun. 1997. cited by other .
Vujaklija, Du{hacek over (s)}ica, et al., "A novel streptomycete
lipase: cloning, sequencing and high-level expression of the
Streptomyces rimosus GDS (L)-lipase gene", Arch. Microbiol, vol.
178, pp. 124-130, 2002. cited by other .
Wahnelt S.V., Meusel D, & Tulsner M, (1991) Zur kenntnis des
diglyceride influsses auf das kristallisationsverhalten von Felten,
in Fat Science Technology 4:117-121. cited by other .
Waninge, Rianne, et al., "Milk membrane lipid vesicle structures
studied with Cryo-TEM", Colloids and Surfaces B: Biointerfaces 31
(2003), pp. 257-264. cited by other .
Warmuth et al, 1992, Bio Forum 9, 282-283. cited by other .
Watanabe et al. Bio sci Biochem 63(5) 820-826, 1999. cited by other
.
Watanabe, Yasuo et al., "Cloning and sequencing of phospholipase B
gene from the yeast Torulaspora delbrueckii", FEMS Microbiology
Letters, vol. 124, 1994, pp. 29-34. cited by other .
Webb EC, Enzyme Nomenclature, 1992, p. 310. cited by other .
Weber et al. J Agric Food Chem 1985, 33, 1093-1096. cited by other
.
Wen-Chen Suen et al., "Improved activity and thermostability of
Candida antarctica lipase B by DNA family shuffling", Protein
Engineering, Design & Selection, vol. 17, No. 2, pp. 133-140,
2004. cited by other .
Wen-Chen Suen et al., "Improved activity and thermostability of
Candida antarctica lipase B by DNA family shuffling", Protein
Engineering, Design & Selection, vol. 17, No. 2, pp. 133-140,
2004. cited by other .
West S.; "Olive and Other Edible Oils"; Industrial Enzymology
(1996); pp. 295-299. cited by other .
Whitaker, John R., et al., "Biocatalysis in Agricultural
Biotechnology", ACS Symposium Series, American Chemical Society,
1989, p. 25-43. cited by other .
Whitehead, Michael, et al., "Transformation of a nitrate reductase
deficient mutant of Penicillium chrysogenum with the corresponding
Aspergillus niger and A. nidulans niaD genes", Mol Gen Genet, 216:
408-411, 1989. cited by other .
Wilhelm et al., "A Novel Lipolytic Enzyme Located in the Outer
Membrane of Pseudomonas aeruginosa", Journal of Bacteriology, vol.
181, No. 22, Nov. 1999, pp. 6977-6986. cited by other .
Williams K.R. et al., "Protein Analysis by Integrated Sample
Preparation, Chemistry, and Mass Spectrometry", in Molecular
Biology and Biotechnology--A Comprehensive Desk Reference, VCH,
1995, ISBN 1-56081-569-8 edited by Meyers R.A., p. 731-737. cited
by other .
Winnacker, E. "Chapter 11: Identification of Recombinant DNA" in
From Genes to Clones: Introduction to Gene Technology, 1987 John
Wiley & Sons. cited by other .
Winther, Ole, et al., "Teaching computers to fold proteins",
Physical Review, vol. 70, No. 030903, 2004. cited by other .
Helmerich G. et al., Strukur-Wirkungsbeziehehungen von
Phospholipiden in Backwaren, Wirkung von Phospholipiden, Getreide
Mehl und Brot, 2003, vol. 57, No. 5, p. 270-273 NZAS-0301096. cited
by other .
Withers-Martinez, Chrislaine, et al., "A pancreatic lipase with a
phospholipase A1 activity: crystal structure of a chimeric
pancreatic lipase-related protein 2 from guinea pig", Structure,
1996, vol. 4, No. 11. cited by other .
Witt, Wolfgang et al., "Secretion of Phospholipase B From
Saccharomyces cerevisiae", Biochimica et Biophysica Acta, vol. 795,
1984, pp. 117-124. cited by other .
Kelley R.L. and Reddy C.A., Glucose Oxidase of Phanerochaete
chrysosporium, in "Biomass, Part B, Lignin, Pectin, and Chitin",
Wood et al., Eds., Methods in Enzymology (1988) vol. 161, Academic
Press, San Diego, p. 307-316. cited by other .
Woolley et al., "Lipases their structure, biochemistry and
application", Cambridge University Press (1994) p. 242-270. cited
by other .
WPI Acc No. 93-298906(38) and JP05211852 Preparation of low fat
content cream-by adding lipase to mixture of fat and water, Nisshin
Oil and Fat Corp. Aug. 24, 1993. cited by other .
Xu, Jun, et al., "Intron requirement for AFP gene expression in
Trichoderma viride", Microbiology, 2003, vol. 149, pp. 3093-3097.
cited by other .
Yamaguchi et al, 1991, Gene 103:61-67. cited by other .
Yamane et al., "High-Yield Diacylglycerol Formation by Solid-Phase
Enzymatic Glycerolysis of Hydrogenated Beef Tallow", JAOCS, vol.
71, No. 3, Mar. 1994. cited by other .
Yamano Y et al., Surface activity of lysophosphatidyl choline from
soybean, 4th World Surfactants Congress, 1996, p. 24-34. cited by
other .
Yamauchi, Asao et al., "Evolvability of random polypetides through
functional selection within a small library", Protein Engineering,
vol. 15, No. 7, pp. 619-626, 2002. cited by other .
Yang, Baokang, et al., "Control of Lipase-Mediated Glycerolysis
Reactions with Butteroil in Dual Liquid Phase Media Devoid of
Organic Solvent", J. Agric. Food Chem., 1993, vol. 41, pp.
1905-1909. cited by other .
Yount, Nannette Y., et al., "Multidimensional signatures in
antimicrobial peptides" PNAS (2004) vol. 101, No. 10, p. 7363-7368.
cited by other .
Zaks, Aleksey, et al., "Enzyme-catalyzed processes in organic
solvents", Proc. Natl. Acad. Sci. USA, vol. 82, pp. 3192-3196, May
1985. cited by other .
Zaks, Aleksey, et al., "The Effect of Water on Enzyme Action in
Organic Media", The Journal of Biological Chemistry, vol. 263, No.
17, Issue of Jun. 15, pp. 8017-8021, 1988. cited by other .
Zangenbert, Niels Honberg, et al., "A dynamic in vitro lipolysis
model 1. Controlling the rate of lipolysis by continuous addition
of calcium", European Journal of Pharmaceutical Sciences, vol. 14,
2001, pp. 115-122. cited by other .
Zangenbert, Niels Honberg, et al., "A dynamic in vitro lipolysis
model II. Evaluation of the model", European Journal of
Pharmaceutical Sciences, vol. 14, 2001, pp. 237-244. cited by other
.
Zhang, Hong, et al., "Modification of Margarine Fats by Enzymatic
Interesterification: Evaluation of a Solid-Fat-Content-Based
Exponential Model with Two Groups of Oil Blends", JAOCS, vol. 81,
No. 1, 2004. cited by other .
Zaks, Aleksey, et al., "Enzyme-catalyzed processes in organic
solvents", Proc. Natl. Acad. Sci. USA, vol. 82, pp. 3192-3196, May
1985. cited by other .
AACC Method 54-21 Farinograph Method for Flour, from Physical Dough
Tests supplied by The British Library, Nov. 3, 1999. cited by other
.
Anderson D, "A Primer in Oils Processing Technology" in Bailey's
Industrial Oil and Fat Products, Sixth edition, John Wiley, 2005,
vol. 5, chapter 1, p. 1-56. ISBN 978047138401. cited by other .
"AOAC Official method 999.10 (Lead, Cadmium, Zinc, Copper, and Iron
in Foods Atomic absorption Spectrophotometry after Microwave
Digestion), First Action 1999 NMKL-AOAC Method", AOAC
International, pp. 1-3, 2002. cited by other .
AOCS Method 2c-25 "1997 Moisture and Volatile Matter Air Oven
Method" Sampling and Analysis of Commercial Fats and Oils, obtained
from The British Library, p. 1, 1997. cited by other .
AOCS Official Method Ca 20-99: "Analysis of Phosphorus in oil by
inductively Coupled Plasma Optical Emission Spectroscopy", Sampling
and Analysis of Commercial Fats and Oils, obtained from The British
Library, pp. 1-3, 2001. cited by other .
Archer D.B. & Peberdy, The Molecular Biology of Secreted Enzyme
Production by Fungi, Critical Reviews in Biotechnology, 1997, vol.
17, No. 4, p. 273-306. cited by other .
Arskog and Joergensen, "Baking performance of prior art lipases
from Candida cylindracea and Aspergillus foeditus and their
activity on galactolipids in dough", Novozymes Report Jul. 18,
2005, pp. 1-2. cited by other .
Arskog and Joergensen, "Baking performance of prior art lipases
from Humicola Lanuginosa, Aspergillus tubigensis, Rhizopus delemar
and Rhizomucor miehei, and their activity on galactolipids in
dough", Novozymes Report Jul. 17, 2005, pp. 1-8. cited by other
.
Aust K., "Applications of lecithin in bakery foods," AIB Research
Technical Bulletin, vol. XV, issue 12, Dec. 1993, p. 1-6. cited by
other .
Banas A. et al., "Cellular sterol ester synthesis in plants is
performed by an enzyme (Phospholipid: Sterol Acyltransferase)
different from the yeast and mammalian Acyl-CoA: Sterol
AcylTransferase", Journal of Biological Chemistry, 2005, vol. 280,
No. 41, pp. 34626-34634. cited by other .
Beggs J.D., Transformation of yeast by a replicating hybrid
plasmid, Nature (London), 1978, vol. 275, p. 104. cited by other
.
Bessette, "Efficient folding or proteins with multiple disulphide
bonds in the Escherida coli cytoplasm", Proc. Natl. Acad. Sci. USA,
1999, vol. 96, p. 13703-13708. cited by other .
Bo Yang et al., "Optimization of Enzymatic Degumming Process for
Rapseed Oil," JAOCS, 2006, vol. 83, No. 7, p. 653-658. cited by
other .
Bru R., Lopez-Nicolas J.M., Garcia-Carmona F., (1995) "Aggregation
of polyunsaturated fatty acid in the presence of cyclodextrins",
Colloids and Surfaces A: Physiochemical and Engineering Aspects.
97, p. 263-269. cited by other .
Buchold H. et. al., "Enzymatische Phosphatidentfernung aus
Pflanzenolen'" Technologies, 1993, vol. 95, No. 8, p. 300-304,
ISSN:0931-5985. cited by other .
Bylund G. (ed), 1995, Dairy Processing Handbook, Chapter 2, p.
17-42, Lund, Sweden. cited by other .
Bylund G. (ed), 1995, Dairy Processing Handbook, Chapter 9, p.
227-246, Lund, Sweden. cited by other .
Ceci L.N. et al, Oil recovery and lecithin production using water
degumming sludge of crude soybean oils, Journal of the Science of
Food and Agriculture, 2008, vol. 88, No. 14, p. 2460-2466. cited by
other .
Cereghino et al., Heterologous protein expression in the
methylotrophic yeast Pichia pastoris, FEMS Microbiology Review,
2000, vol. 24, No. 1, p. 45-66. cited by other .
Christou P., Genetic engineering of crop legumes and cereals:
current status and recent advances, Agro-Food-Industry Hi-Tech,
Mar./Apr. 1994, p. 17-27. cited by other .
Davis R.H. and de Serres, Genetic and Microbiological Research
Techniques for Neurospora crassa, Methods Enzymology, 1971, vol.
17A, p. 79-143. cited by other .
EC 1.1.3.10 (downloaded--Jul. 12, 2010 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC1/1/3/10.html). cited by
other .
EC 1.1.3.4 (downloaded--Jul. 12, 2010 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC1/1/3/4.html). cited by
other .
EC 1.1.3.5 (downloaded--Nov. 16, 2009 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC1/1/3/5.html). cited by
other .
EC 2.3.1.43 (downloaded Apr. 21, 2009 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC2/3/1/43.html). cited by
other .
EC 2.4.1.19 (Downloaded Jul. 12, 2010 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC2/4/1/19.html). cited by
other .
EC 3.1.1.26 (downloaded--Dec. 18, 2008 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/1/26.html). cited by
other .
EC 3.1.1.3 (downloaded--Dec. 18, 2008 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/1/3.html). cited by
other .
EC 3.1.1.32 (downloaded--May 22, 2008 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/1/32.html). cited by
other .
EC 3.1.1.4 Phospholipase A2 enzyme Enzyme Entry 1983 (downloaded
Apr. 21, 2009 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/1/4.html). cited by
other .
EC 3.1.1.5 (downloaded Dec. 18, 2008 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/1/5.html). cited by
other .
EC 3.2.1.3 (downloaded Jul. 12, 2010 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/2/1/3.html). cited by
other .
EC 3.2.1.32 (Downloaded Jul. 12, 2010 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/2/1/32.html). cited by
other .
EC 3.2.1.60 (downloaded Apr. 28, 2009from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/2/1/60.html). cited by
other .
Eliasson A-C. and Larssen K., "Chapter 2: Physiochemical Behavior
of the Components of Wheat Flour", Cereals in Breadmaking: a
molecular colloidal approach, Marcel Dekker Inc, 1993,
ISBN0824788168, p. 31-45. cited by other .
Genbank accession code NC.sub.--003888.1:8327480..8328367
(downloaded Apr. 21, 2009), p. 1. cited by other .
Genbank accession No. AL646052 (downloaded Apr. 21, 2009), pp. 1-2.
cited by other .
Genbank accession No. AL939131.1:265480..266367 (downloaded Apr.
21, 2009), p. 1. cited by other .
Genbank accession No. CAC42140 (downloaded Apr. 21, 2009), pp. 1-2.
cited by other .
Genbank accession No. NP.sub.--003888.1 (downloaded Apr. 21, 2009),
pp. 1. cited by other .
Genbank accession No. NP.sub.--631558.1 (downloaded Apr. 21, 2009),
pp. 1. cited by other .
Genbank accession No. P41734 (downloaded Apr. 21, 2009), pp. 1-4.
cited by other .
NCBI Accession No. Z75034 (downloaded Apr. 21, 2009) p. 1-2. cited
by other .
Hammond E.G. et al., "Soybean Oil" in Bailey's Industrial Oil and
Fat Products, Sixth edition, John Wiley, 2005, vol. 3, chapter 13,
p. 577-653. ISBN 978047138401. cited by other .
Hinchcliffe E., Kenny E., "Yeast as a vehicle for the expression of
heterologous genes", Yeasts, 1993, vol. 5, Anthony H. Rose and J.
Stuart Harrison, eds. 2nd edition, Academic Press Ltd. cited by
other .
Hinnen A. et al., Transformation of yeast, Proceedings of the
National Academy of Sciences USA, Apr. 1978, vol. 75, No. 4, p.
1929-1933. cited by other .
Hollenberg C.P. et al., Production of recombinant proteins by
methylotrophic yeasts, Current Opinion in Biotechnology Oct. 1997,
vol. 8, No. 5, pp. 554-560. cited by other .
Horwell DC, "The `peptoid` approach to the design of non-peptide,
small molecular agonists and antogonists of neuropeptides", Trends
Biotechnol., 1995, vol. 13, No. 4, pp. 132-134. cited by other
.
Hossen, Monjur, "Enzyme catalyzed synthesis of structured
phospholipids with conjugated linoleic acid and plant sterols, " A
Dissertation by MD Monjur Hossen, May 2005, p. 1-152. cited by
other .
HUI, Bailey's Industrial Oil and Fat Products, 5th edition vol. 2
Edible Oil and Fat Products: Oils and Oilseeds, Wiley Interscience
(1996), pp. 513-516. ISBN 0471594261. cited by other .
Ito H. et al., "Transformation of Intact Yeast Cells Treated with
Alkali Cations," J. Bacteriology, 1983, vol. 153, p. 163-168. cited
by other .
Jost R. et. al., "Milk and Dairy Products," Nestle Product
Technology Center, 2007, Wiley-VCH, pp. 1-62, Konolfingen,
Switzerland. cited by other .
Kane, "Effects of rare codon clusters on high-level expression of
heterolgous proteins in E.coli" Current Opinion Biotechnology,
1995, vol. 6, p. 494-500. cited by other .
Kimmel, A. et al. "Preparation of cDNA and the Generation of cDNA
Libraries: Overview," Methods in Enzymology, 1987, vol. 152, p.
307-316. cited by other .
LaVallie T.M., 2-Methoxyestradiol Inhibits Proliferation and
Induces Apoptosis Independently of Estrogen Receptors .alpha. and
.beta., Current Opinion in Biotechnology, 1995, vol. 6, No. 5, pp.
501-506. cited by other .
Leon et al., "A new approach to study starchy changes occurring the
double-baking process and during bread storage," Z. Lebensn Unters
Forsch A, 1997, vol. 204 pp. 316-320. cited by other .
McIntyre et al., "Distribution of Glycerophospholipid-Cholesterol
Acyltransferase in Selected Bacterial Species," Journal of
Bacteriology, Jul. 1979, vol. 139, No. pp. 132-136. cited by other
.
NCBI protein accession code AAK84028.1 GI:15082088, (downloaded
Dec. 18, 2009), pp. 1-2. cited by other .
NCBI protein accession code CAB39707.1 GI:4529178, (downloaded Dec.
18, 2009), pp. 1-2. cited by other .
NCBI protein accession code CAB62724.1 GI:6562793, (downloaded Dec.
18, 2009), pp. 1-2. cited by other .
NCBI protein accession code CAB88833.1 GI:7635996, (downloaded Dec.
18, 2009), pp. 1-2. cited by other .
NCBI protein accession code CAB89450.1; GI:7672261, (downloaded
Dec. 18, 2009), pp. 1-2. cited by other .
NCBI protein accession code CAC01477.1 GI:9716139, (downloaded Dec.
18, 2009), pp. 1-2. cited by other .
NCBI's Genbank database accession No. 1IVN.sub.--A ; GID:33357066,
(downloaded Oct. 14, 2010), pp. 1-2. cited by other .
Oil Mill Gazetteer, "Enzymatic Degumming Improves Oil Refining in
China," Jul. 2005 vol. 111, p. 2-4. cited by other .
Phospholipase C, E.C.3.1.4.3,, (downloaded Sep. 8, 2009 from
http://www.chem.qmul.ac.uk/iubmb/enzyme/EC3/1/4/3.html), p. 1.
cited by other .
Poldermans B and Schoppink P, "Controlling the baking process and
product quality with enzymes", Cereal Foods World, Mar. 1999, 44
(3), p. 132-135. cited by other .
Potrykus I., Gene Transfer to Plants: assessment of published
approaches and results, Annu. Rev. Plant Physiol. Plant Mol. Biol.,
1991, vol. 42, p. 205-225. cited by other .
PreSens Manual HydroPlate.RTM. HP96U and HydroPlate.RTM. HP96C, pp.
1-15, Aug. 17, 2004. cited by other .
Simon RJ et al.,"Peptoids: a modular approach to drug discovery",
Proc. Natl. Acad. Sci. USA, 1992, vol. 89, No. 20, pp. 9367-9371.
cited by other .
Szuhaj B.F., "Lecithins" in Bailey's Industrial Oil and Fat
Products, Sixth edition, John Wiley, 2005, vol. 2, chapter 13, p.
361-456. ISBN 978047138401. cited by other .
Tanji M.et al., "Lipase hydrolysis of milk fat and its soft
fractions", Research Bulletin of Obihiro University, 2001, vol. 22,
No. 2, p. 89-94. cited by other .
Tilden E.B. and Hudson C.S., Preparation and Properties of the
Amylases Produced by Bacillus Macerans and Bacillus Polymyxa, J.
Bacteriology, 1942, vol. 43, p. 527-544. cited by other .
Torres C.F. et al., A two steps enzymatic procedure to obtain
sterol esters, tocopherols and fatty acid ethyl esters from soybean
oil deodorizer distillate, Process Biochemistry, 2007, vol. 42,
No., 9, p. 1335-1341. cited by other .
Trueman L.J., "Heterologous Expression in Yeast," Methods Molecular
Biology, vol. 49, p. 341-354 (1995). cited by other .
Turner G. Vectors for generic manipulation, in Martinelli S.D,
Kinghorn J.R. (editors), Aspergillus: 50 years on. Progress in
industrial microbiology, 1994, vol. 29, p. 641-666. cited by other
.
Notification of Reasons for Refusal: JP Application No. 526105,
Feb. 12, 2003 (Translation). cited by other .
Notification of Reasons for Refusal: JP Application No. 526105,
Jun. 4, 2002 (Translation). cited by other .
Written Argument: JP Application No. 97181706.5, (Dec. 9, 1997)
(Translation). cited by other .
U.S. Appl. No. 60/083,277, filed Apr. 28, 1998, Spender, Tina et
al. cited by other.
|
Primary Examiner: Saidha; Tekchand
Attorney, Agent or Firm: Vedder Price P.C. Kowalski; Thomas
J. Lunasin; Heidi
Parent Case Text
REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. patent
application Ser. No. 11/182,408, filed Jul. 15, 2005, which is a is
a continuation-in-part of International Patent Application
PCT/IB2004/000655 filed Jan. 15, 2004 and published as WO
2004/064537 on Aug. 5, 2004 which claims priority to Great Britain
Application Numbers 0301117.8, 0301118.6, 0301119.4, 0301120.2,
0301121.0, 0301122.8, all of which were filed Jan. 17, 2003, U.S.
Patent Application No. 60/489,441 filed Jul. 23, 2003, and Great
Britain Application Number 0330016.7 filed Dec. 24, 2003.
Reference is also made to the following related applications: U.S.
application Ser. No. 09/750,990 filed on 20 Jul. 1999 and U.S.
application Ser. No. 10/409,391 filed Apr. 8, 2003, International
Patent Application Nos. PCT/IB2005/000575 filed Jan. 15, 2004 and
published as WO2004/064987 on Aug. 5, 2004, PCT/IB2004/004378 filed
Dec. 23, 2004 and published as WO 2005/066347 on Jul. 21, 2005,
PCT/IB2004/004374 filed Dec. 23, 2004 and published as WO
2005/066351 on Jul. 21, 2005 and PCT/GB05/002823 filed Jul. 18,
2005 and published as WO2006/008508 on Jan. 26, 2006.
Claims
The invention claimed is:
1. A method for the in situ production of an emulsifier in a
foodstuff, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff wherein the lipid acyltransferase
is one which is capable of transferring an acyl group from a lipid
to one or more of the following acyl acceptors: a sterol, a stanol,
a carbohydrate, a protein or a sub-unit thereof, glycerol; wherein
one or more of a sterol ester or a stanol ester or a protein ester
or a carbohydrate ester or a diglyceride or a monoglyceride is
produced in situ in the foodstuff and wherein the lipid
acyltransferase when tested using the Transferase Assay in Buffered
Substrate has at least 5% acyltransferase activity (relative
acyltransferase activity) wherein the Transferase Assay in Buffered
Substrate comprises: (a) heating to 35.degree. C. a substrate
solution comprising phosphatidylcholine, cholesterol, water and
HEPES buffer, wherein the substrate solution comprises
approximately 95% water and has pH 7.0; (b) adding an enzyme to the
substrate solution; and (c) determining acyltransferase activity of
the enzyme based upon cholesterol ester and fatty acids formed.
2. A method according to claim 1 wherein at least 2 emulsifiers are
produced.
3. A method according to claim 1 wherein the emulsifier is produced
without increasing or substantially increasing the free fatty acids
in the foodstuff.
4. A method according to claim 2 wherein at least one of the
emulsifiers is a carbohydrate ester.
5. A method according to claim 2 wherein at least one of the
emulsifiers is a protein ester.
6. A method according to claim 1 wherein the sterol ester is one or
more of alpha-sitosterol ester, beta-sitosterol ester, stigmasterol
ester, ergosterol ester, campesterol ester or cholesterol
ester.
7. A method according to claim 5 wherein the stanol ester is one or
more beta-sitostanol or ss-sitostanol.
8. A method according to claim 1 wherein the lipid acyltransferase
enzyme comprises H-309 or comprises a histidine residue at a
position corresponding to His-309 in the amino acid sequence of the
Aeromonas hydrophila lipolytic enzyme shown as SEQ ID No. 2 or SEQ
ID No. 32.
9. A method according to claim 1 wherein the lipid acyltransferase
is obtainable from an organism from one or more of the following
genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus,
Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium,
Bacillus, Campylobacter, Vibrionaceae, Xylella, Sulfolobus,
Aspergillus, Schizosaccharomyces, Listeria, Neisseria,
Mesorhizobium, Ralstonia, Xanthomonas and Candida.
10. A method according to claim 1 wherein the lipid acyltransferase
comprises one or more of the following amino acid sequences: (i)
the amino acid sequence shown as SEQ ID No. 2; (ii) the amino acid
sequence shown as SEQ ID No. 3; (iii) the amino acid sequence shown
as SEQ ID No. 4; (iv) the amino acid sequence shown as SED ID No.
5; (v) the amino acid sequence shown as SEQ ID No. 6; (vi) the
amino acid sequence shown as SEQ ID No. 12, (vii) the amino acid
sequence shown as SEQ ID No. 20, (viii) the amino acid sequence
shown as SEQ ID No. 22, (ix) the amino acid sequence shown as SEQ
ID No. 24, (x) the amino acid sequence shown as SEQ ID No. 26, (xi)
the amino acid sequence shown as SEQ ID No. 28, (xii) the amino
acid sequence shown as SEQ ID No. 30, (xiii) the amino acid
sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence
shown as SEQ ID No. 34, (xv) the amino acid sequence shown as SEQ
ID No. 62, (xvi) the amino acid sequence shown as SEQ ID No. 90, or
an amino acid sequence which has 75% or more identity with any one
of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4,
SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID
No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30,
SEQ ID No. 32 or SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
11. A method according to claim 1, wherein the emulsifier is one or
more of the following: a monoglyceride, a lysophosphatidylcholine,
DGMG.
12. A method of preparing a foodstuff comprising an emulsifier,
comprising the step of contacting a food material with a lipid
acyltransferase, wherein an emulsifier is thereby produced by
reaction of the lipid acyltransferase with one or more consistuents
of the food material, without increasing or without substantially
increasing the free fatty acids in the foodstuff, wherein the lipid
acyltransferase is one which is capable of transferring an acyl
group from a lipid to one or more of the following acyl acceptors:
a sterol, a stanol, a carbohydrate, a protein or a sub-unit
thereof, glycerol; wherein one or more of a sterol ester or a
stanol ester or a protein ester or a carbohydrate ester or a
diglyceride or a monoglyceride is produced in situ in the foodstuff
and wherein the lipid acyltransferase when tested using the
Transferase Assay in Buffered Substrate has at least 5%
acyltransferase activity (relative acyltransferase activity)
wherein the Transferase Assay in Buffered Substrate comprises: (a)
heating to 35.degree. C. a substrate solution comprising
phosphatidylcholine, cholesterol, water and HEPES buffer, wherein
the substrate solution comprises approximately 95% water and has pH
7.0; (b) adding an enzyme to the substrate solution; and (c)
determining acyltransferase activity of the enzyme based upon
cholesterol ester and fatty acids formed.
13. The method according to claim 12 wherein at least two
emulsifiers are produced.
14. The method according to claim 13 wherein at least one of the
emulsifiers is a carbohydrate ester.
15. The method according to claim 13 wherein at least one of the
emulsifiers is a protein ester.
16. The method according to claim 12 wherein the sterol ester is
one or more of alpha-sitosterol ester, beta-sitosterol ester,
stigmasterol ester, ergosterol ester, campesterol ester or
cholesterol ester.
17. The method according to claim 16 wherein the stanol ester is
one or more beta-sitostanol or ss-sitostanol.
18. The method according to claim 12 wherein the lipid
acyltransferase is characterised as an enzyme which possesses acyl
transferase activity and which comprises the amino acid sequence
motif GDSX, wherein X is one or more of the following amino acid
residues L, A, V, I, F, Y, H, Q, T, N, M or S.
19. The method according to claim 12 wherein the lipid
acyltransferase enzyme comprises H-309 or comprises a histidine
residue at a position corresponding to His-309 in the amino acid
sequence of the Aeromonas hydrophila lipolytic enzyme shown as SEQ
ID No. 2 or SEQ ID No. 32.
20. The method according to claim 12 wherein the lipid
acyltransferase is obtainable from an organism from one or more of
the following genera: Aeromonas, Streptomyces, Saccharomyces,
Lactococcus, Mycobacterium, Streptococcus, Lactobacillus,
Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella,
Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria,
Mesorhizobium, Ralstonia, Xanthomonas and Candida.
21. The method according to claim 12 wherein the lipid
acyltransferase comprises one or more of the following amino acid
sequences: (i) the amino acid sequence shown as SEQ ID No. 2; (ii)
the amino acid sequence shown as SEQ ID No. 3; (iii) the amino acid
sequence shown as SEQ ID No. 4; (iv) the amino acid sequence shown
as SED ID No. 5; (v) the amino acid sequence shown as SEQ ID No. 6;
(vi) the amino acid sequence shown as SEQ ID No. 12, (vii) the
amino acid sequence shown as SEQ ID No. 20, (viii) the amino acid
sequence shown as SEQ ID No. 22, (ix) the amino acid sequence shown
as SEQ ID No. 24, (x) the amino acid sequence shown as SEQ ID No.
26, (xi) the amino acid sequence shown as SEQ ID No. 28, (xii) the
amino acid sequence shown as SEQ ID No. 30, (xiii) the amino acid
sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence
shown as SEQ ID No. 34, (xv) the amino acid sequence shown as SEQ
ID No. 62, (xvi) the amino acid sequence shown as SEQ ID No. 90, or
an amino acid sequence which has 75% or more identity with any one
of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4,
SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID
No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30,
SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
22. The method according to claim 12, wherein the emulsifier is one
or more of the following: a monoglyceride, a
lysophosphatidylcholine, DGMG.
Description
Each of these applications and each of the documents cited in each
of these applications ("application cited documents"), and each
document referenced or cited in the application cited documents,
either in the text or during the prosecution of those applications,
as well as all arguments in support of patentability advanced
during such prosecution, are hereby incorporated herein by
reference. Various documents are also cited in this text ("herein
cited documents"). Each of the herein cited documents, and each
document cited or referenced in the herein cited documents, is
hereby incorporated herein by reference.
FIELD OF INVENTION
The present invention relates to a method for the in situ
production of an emulsifier within a foodstuff by use of a lipid
acyltransferase.
The present invention further relates to a method for the in situ
production of an emulsifier within a foodstuff by use of a lipid
acyltransferase, wherein the method is such that the emulsifier is
produced without increasing or without substantially increasing the
free fatty acids in the foodstuff.
The present invention yet further relates to a method for the in
situ production of at least two emulsifiers within a foodstuff by
use of a lipid acyltransferase.
The present invention also relates to a method for the in situ
production of a carbohydrate ester and/or a sterol ester and/or a
stanol ester and/or a protein ester and/or glycerol ester and/or a
hydroxy acid ester within a foodstuff by use of a lipid
acyltransferase.
The present invention relates to a food enzyme composition and/or a
feed enzyme composition, which contains a lipid acyltransferase,
and the use of such a composition in the methods of the present
invention.
The present invention further relates to a method of identifying
suitable lipid acyltransferases in accordance with the present
invention and to lipid acyltransferases so identified.
The present invention yet further relates to an immobilised lipid
acyltransferase.
TECHNICAL BACKGROUND
The beneficial use of phospholipases and lipases (referred to as
lipolytic enzymes, (EC. 3.1.1.x) used in food and/or feed
industrial applications has been known for many years.
For instance, in EP 0 585 988 it is claimed that lipase addition to
dough resulted in an improvement in the antistaling effect. It is
suggested that a lipase obtained from Rhizopus arrhizus when added
to dough can improve the quality of the resultant bread when used
in combination with shortening/fat. WO94/04035 teaches that an
improved softness can be obtained by adding a lipase to dough
without the addition of any additional fat/oil to the dough.
Castello, P. ESEGP 89-10 December 1999 Helsinki, shows that
exogenous lipases can modify bread volume.
Lipolytic enzymes hydrolyse one or more of the fatty acids from
lipids present in the food which can result in the formation of
powerful emulsifier molecules within the foodstuff which provide
commercially valuable functionality. The molecules which contribute
the most significant emulsifier characteristics are the partial
hydrolysis products, such as lyso-phospholipids, lyso-glycolipids,
and mono-glyceride molecules. The polar lipid hydrolysis products,
such as lyso-phospholipids and lyso-glycolipids are particularly
advantageous. In bread making, such in situ derived emulsifiers can
give equivalent functionality as emulsifiers, such as DATEM.
However, the activity of lipolytic enzymes also results in
accumulation of free fatty acids, which can lead to detrimental
functionality in the foodstuff. This inherent activity of lipolytic
enzymes limits their functionality.
Numerous solutions to this problem have been attempted in the art.
However, these result in a significant increase in free fatty acids
in the foodstuff, particularly food stuffs with high water content,
including, but not limited to bread doughs and egg yolk.
Phospholipases, particularly phospholipase A2 (E.C. 3.1.1.4), have
been used for many years for the treatment of egg or egg-based
products (see U.S. Pat. No. 4,034,124 and Dutihl & Groger 1981
J. Sci. Food Agric. 32, 451-458 for example). The phospholipase
activity during the treatment of egg or egg-based products results
in the accumulation of polar lysolecithin, which can act as an
emulsifier. Phospholipase treatment of egg or egg-based products
can improve the stability, thermal stability under heat treatment
such as pasteurization and result in substantial thickening.
Egg-based products may include, but are not limited to cake,
mayonnaise, salad dressings, sauces, ice creams and the like. Use
of phospholipases results in the accumulation of free fatty acids.
The accumulation of free fatty acids can result in significant
off-flavour. In addition, the accumulation of free fatty acids can
result in enhanced susceptibility to oxidation, and hence result in
poor shelf-life, product discoloration and alteration of other
critical food characteristics such as flavour and texture.
Recently, lipolytic enzymes with broader substrate specificity have
been marketed for treatment of egg yolk and related food products.
These have the advantage that, unlike most of the phospholipase
A2s, they do not originate from a mammalian source. However, they
result in significant accumulation of free fatty acids, not only
due to the hydrolysis of phospholipids, but also triglycerides.
As mentioned above, another area where lipases have been
extensively used is in the bakery industry. The use of
phospholipases in baking dates bake to the early 1980s.
The substrate for lipases in wheat flour is 1.5-3% endogenous wheat
lipids, which are a complex mixture of polar and non-polar lipids.
The polar lipids can be divided into glycolipids and phospholipids.
These lipids are built up of glycerol esterified with two fatty
acids and a polar group. The polar group contributes to surface
activity of these lipids.
Enzymatic cleavage of one of the fatty acids in these lipids leads
to lipids with a much higher surface activity. It is well known
that emulsifiers, such as DATEM, with high surface activity are
very functional when added to dough.
However, the use of lipases (E.C. 3.1.1.X) in dough products may
have a detrimental impact on yeast activity, and/or a negative
effect on bread volume. The negative effect on bread volume is
often explained by overdosing. Overdosing can lead to a decrease in
gluten elasticity which results in a dough which is too stiff and
thus results in reduced bread volumes. In addition, or
alternatively, such lipases can degrade shortening, oil or milk fat
added to the dough, resulting in off-flavour in the dough and baked
product. Overdosing and off flavour have been attributed to the
accumulation of free fatty acids in the dough.
In EP 1 193 314, EP 0 977 869 and also in WO 01/39602, the use of
lipolytic enzymes active on glycolipids was reported to be
particularly beneficial in application in bread making as the
partial hydrolysis products the lyso-glycolipids were found to have
very high emulsifier functionality, apparently resulting in a
higher proportion of positive emulsifier functionality compared to
the detrimental accumulation of free fatty acids. However, the
enzymes were also found to have significant non selective activity
on triglyceride which resulted in unnecessarily high free fatty
acid.
The same finding was reported in WO 00/32758, which disclosed
lipolytic enzyme variants with enhanced activity on phospholipids
and/or glycolipids, in addition to variants which had a preference
for long rather than short chain fatty acids. This latter feature,
also disclosed in WO 01/39602, was deemed of particular importance
to prevent the off-flavours associated with the accumulation of
free short chain fatty acids. However, significant free fatty acids
are produced.
The problem of high triglyceride activity was addressed in
WO02/094123, where the use of lipolytic enzymes active on the polar
lipids (i.e. glycolipids and phospholipids) in a dough, but
substantially not active on triglycerides or 1-mono-glycerides is
taught. However, significant free fatty acids are produced.
Some lipolytic enzymes have low or no activity on the lyso form of
polar lipids (e.g. glycolipids/phospholipids). The use of such
enzymes has been deemed preferable as they ensure the accumulation
of the highly polar lyso-lipids, resulting in optimal
functionality. Free fatty acids do however accumulate. This
selective functionality is characteristic of phospholipase A2
enzymes, and the glycolipases disclosed in EP 0 977 869, EP 1 193
314, and WO01/39602. Variant enzymes of less selective lipolytic
enzymes have been produced which have a lower activity on the
lyso-polar lipids when compared to the parent enzyme (WO03/060112).
However, significant free fatty acids are produced.
WO00/05396 teaches a process for preparing a foodstuff comprising
an emulsifier, wherein food material is contacted with an enzyme
such that an emulsifier is generated by the enzyme from a fatty
acid ester and a second functional ingredient is generated from a
second constituent. WO00/05396 teaches the use of in particular a
lipase or esterase enzyme. Nowhere in WO00/05396 is the specific
use of a lipid acyltransferase taught. In addition, in foodstuffs
with high water content, the use of the esterases and lipases as
taught in WO00/05396 would result in significant accumulation of
free fatty acids.
A disadvantage associated with the use of lipases, including
phospholipases and glycolipases, may be caused by the build-up of
free fatty acids released from the lipids. Over the past couple of
decades the use of lipolytic enzymes in foodstuffs has been limited
due to the balance between the detrimental accumulation of free
fatty acids and the production of the lyso-lipids which provide
positive functionality. Although numerous strategies in the art
have been attempted, some of which provided significant
improvements in functionality, none have completely addressed and
solved the fundamental problem in the art, i.e. the significant
accumulation of free fatty acids in foodstuffs prepared using
lipolytic enzymes in situ.
The presence of high levels of free fatty acids (FFA) in raw
materials or food products is generally recognised as a quality
defect and food processors and customers will usually include a
maximum FFA level in the food specifications. The resulting effects
of excess FFA levels can be in organoleptic and/or functional
defects.
A result of lipolysis is hydrolytic rancidity, with the formation
of characteristic "soapy" flavour. This "soapy" taste is especially
acute with fatty acids of intermediate chain length (C8-C12) which,
although not present in high concentrations, may be important
constituents of, for example, dairy products or vegetable oils. A
more common organoleptic defect is due to the combined effects of
lipolytic enzymes and oxidation processes. Unsaturated fatty acids
are more susceptible to enzymatic oxidation when unesterified than
when esterified in acyl lipids.
Functional defects in food due to high FFA levels are recognised,
but less readily explained. Without wishing to be bound by theory,
the hydrolysis of unchanged lipids to carboxylic acids will
increase [H+] and produce carbonyl groups that can combine with
other compounds or metal ions. Free fatty acids also combine
proteins by hydrophobic interactions and can complex with starch
during cooking. FFA may also interfere with the action of
surface-active agents, such as polar lipids and emulsifiers. (Lipid
in Cereal Technology, P. J. Barnes, Academic Press 1983.)
WO03/100044 discloses a class of acyl transferases known as PDATs
(or ATWAX). These enzymes use a monoglyceride or a diglyceride as
the acceptor molecule, and phosphatidylcholine (PC) as the donor
molecule to produce the following products: lyso
phosphatidylcholine and triacylglycerol and/or diacylglycerol.
In one embodiment, the present invention relates to improvements in
the incorporation of whey proteins into food products, providing
for improved yields without impairing the qualities--such as the
texture--of the food compositions and products.
Cheese compositions are typically prepared from dairy liquids by
processes that include treating the liquid with a coagulating or
clotting agent. The coagulating agent may be a curding enzyme, an
acid or a suitable bacterial culture, or it may include such a
culture. The curd that results generally incorporates transformed
casein, fats including natural butter fat, and flavourings that
arise especially when a bacterial culture is used. The curd may be
separated from the liquid whey, which contains soluble proteins not
affected by the coagulation and that therefore are not incorporated
into the curd.
Whey is thus a by-product of manufacturing in commercial processes
that produce food products--such as cheeses. Traditionally, whey is
disposed of as unused waste or used as fertiliser or animal feed or
processed into a food ingredient.
The inability of whey proteins to be substantially retained in the
curd is an important factor contributing to a lack of efficiency in
the conventional production of dairy products--such as cheese
curds--and to a reduction in overall yield relating to the
incorporation of all the protein solids that are present in the
starting dairy liquids into resulting cheese curds.
There have been numerous attempts to include whey proteins in
cheese e.g. by heat treatment of the milk, heat treatment of whey,
or by filtration--such as ultrafiltration.
There are also several descriptions of the use of specific
proteases to induce aggregation of whey proteins. A serine protease
derived from Bacillus licheniformis has been shown to have the
ability to induce aggregation of whey proteins (U.S. Pat. No.
5,523,237).
However, there remains many difficulties associated with adding
whey proteins in processes such as the manufacture of cheeses. For
example, incorporation of whey protein into cheeses is associated
with a deterioration in the taste and mouth-feel of the product,
and furthermore tends to interfere with curding and subsequent
processing of the product. Proteases that have been previously
reported that can be added to cheese milk for hydrolysis of whey
proteins result in significant hydrolysis of the caseins as
described by Madsen, J. S. & Qvist, K. B. (1997) Hydrolysis of
milk protein by a Bacillus licheniformis protease specific for
acidic amino acid residues. J. Food Sci. 62, 579-582.
Thus, there is a need in the art for methods and compositions that
provide for the improved incorporation of whey protein into food
products while maintaining organoleptic and other desirable
properties. Such optimisation would result in increased efficiency,
higher yields of food products, and reduced overall material
costs.
Lipase:cholesterol acyltransferases have been known for some time
(see for example Buckley--Biochemistry 1983, 22, 5490-5493). In
particular, glycerophospholipid:cholesterol acyl transferases
(GCATs) have been found, which like the plant and/or mammalian
lecithin:cholesterol acyltransferases (LCATs), will catalyse fatty
acid transfer between phosphatidylcholine and cholesterol.
Upton and Buckley (TIBS 20, May 1995 p 178-179) and Brumlik and
Buckley (J. of Bacteriology April 1996 p 2060-2064) teach a
lipase/acyltransferase from Aeromonas hydrophila which has the
ability to carry out acyl transfer to alcohol acceptors in aqueous
media.
SUMMARY ASPECTS OF THE PRESENT INVENTION
According to a first aspect of the present invention there is
provided a method of in situ production of an emulsifier in a
foodstuff, wherein the method comprises the step of adding to the
foodstuff a lipid acyltransferase as defined herein.
In a further aspect, the present invention provides a method of in
situ production of an emulsifier in a foodstuff, wherein the method
is such that the emulsifier is produced without increasing or
without substantially increasing the free fatty acids in the
foodstuff, and wherein the method comprises the step of adding a
lipid acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of in
situ production of an emulsifier and either a sterol ester and/or a
stanol ester in a foodstuff, wherein the method is such that the
emulsifier is produced without increasing or without substantially
increasing the free fatty acids in the foodstuff, and wherein the
method comprises the step of adding a lipid acyltransferase to the
foodstuff.
In another aspect, the present invention provides a method of in
situ production of an emulsifier and either a sterol ester and/or a
stanol ester in a foodstuff, wherein the method comprises the step
of adding a lipid acyltransferase to the foodstuff.
According to another aspect of the present invention there is
provided a method for the in situ production of at least two
emulsifiers in a foodstuff, wherein the method comprises the step
of adding to the foodstuff a lipid acyltransferase.
According to a further aspect of the present invention there is
provided a method of in situ production of at least two emulsifiers
and either a sterol ester and/or a stanol ester in a foodstuff,
wherein the method is such that the emulsifiers are produced
without increasing or without substantially increasing the free
fatty acids in the foodstuff, and wherein the method comprises the
step of adding a lipid acyltransferase to the foodstuff.
According to a further aspect of the present invention there is
provided a method of in situ production of at least two emulsifiers
and either a sterol ester and/or a stanol ester in a foodstuff,
wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In a further aspect, the present invention provides a method for
the in situ production of a carbohydrate ester in a foodstuff,
wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In another aspect, the present invention provides a method for the
in situ production of a carbohydrate ester together with an
emulsifier in a foodstuff, wherein the method comprises the step of
adding a lipid acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of in
situ production of an emulsifier, and one or more of a carbohydrate
ester; a sterol ester; a stanol ester; a protein ester; a
monoglyceride or a diglyceride in a foodstuff, and wherein the
method comprises the step of adding a lipid acyltransferase to the
foodstuff.
According to a further aspect of the present invention there is
provided a method of production of a foodstuff comprising an
emulsifier, wherein the method comprises the step of adding to the
foodstuff a lipid acyltransferase as defined herein.
In a further aspect, the present invention provides a method of
production of a foodstuff comprising an emulsifier, wherein the
method is such that the emulsifier is produced without increasing
or without substantially increasing the free fatty acids in the
foodstuff, and wherein the method comprises the step of adding a
lipid acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of the
production of a foodstuff comprising an emulsifier and either a
sterol ester and/or a stanol ester, wherein the method is such that
the emulsifier is produced without increasing or without
substantially increasing the free fatty acids in the foodstuff, and
wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of the
production of a foodstuff comprising an emulsifier and either a
sterol ester and/or a stanol ester, wherein the method comprises
the step of adding a lipid acyltransferase to the foodstuff.
According to a further aspect of the present invention there is
provided a method for the production of a foodstuff comprising at
least two emulsifiers, wherein the method comprises the step of
adding to the foodstuff a lipid acyltransferase.
According to a further aspect of the present invention there is
provided a method of the production of a foodstuff comprising at
least two emulsifiers and either a sterol ester and/or a stanol
ester, wherein the method is such that the emulsifiers are produced
without increasing or without substantially increasing the free
fatty acids in the foodstuff, and wherein the method comprises the
step of adding a lipid acyltransferase to the foodstuff.
According to a further aspect of the present invention there is
provided a method of the production of a foodstuff comprising at
least two emulsifiers and either a sterol ester and/or a stanol
ester, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In a further aspect, the present invention provides a method for
the production of a foodstuff comprising a carbohydrate ester,
wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In another aspect, the present invention provides a method for the
production of a foodstuff comprising a carbohydrate ester and an
emulsifier, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of the
production of a foodstuff comprising an emulsifier and one or more
of a carbohydrate ester; a sterol ester; a stanol ester; a protein
ester; a monoglyceride or a diglyceride, and wherein the method
comprises the step of adding a lipid acyltransferase to the
foodstuff.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising an emulsifier, wherein the emulsifier is generated from
constituents of the food material by the lipid acyltransferase.
In a further aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising an emulsifier, wherein the emulsifier is produced
without increasing or without substantially increasing the free
fatty acids in the foodstuff, and wherein the emulsifier is
generated from constituents of the food material by the lipid
acyltransferase.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising an emulsifier and either a sterol ester and/or a stanol
ester, wherein the emulsifier is produced without increasing or
without substantially increasing the free fatty acids in the
foodstuff, and wherein the emulsifier and/or sterol ester and/or
stanol ester is/are generated from constituents of the food
material by the lipid acyltransferase.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising an emulsifier and either a sterol ester and/or a stanol
ester, wherein the emulsifier and/or sterol ester and/or stanol
ester is/are generated from constituents of the food material by
the lipid acyltransferase.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising at least two emulsifiers, wherein the two emulsifiers
are generated from constituents of the food material by the lipid
acyltransferase.
According to a further aspect of the present invention there is
provided use of a lipid acyltransferase to prepare from a food
material a foodstuff comprising at least two emulsifiers and either
a sterol ester and/or a stanol ester, wherein the emulsifiers are
produced without increasing or without substantially increasing the
free fatty acids in the foodstuff, and wherein one or both of the
emulsifiers and/or the sterol ester and/or the stanol ester is/are
generated from constituents of the food material by the lipid
acyltransferase.
According to a further aspect of the present invention there is
provided use of a lipid acyltransferase to prepare from a food
material a foodstuff comprising at least two emulsifiers and either
a sterol ester and/or a stanol ester, wherein one or both of the
emulsifiers and/or the sterol ester and/or the stanol ester is/are
generated from constituents of the food material by the lipid
acyltransferase.
In a further aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising a carbohydrate ester, wherein the carbohydrate ester is
generated from constituents of the food material by the lipid
acyltransferase.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising at least a carbohydrate ester and a further emulsifier,
wherein the carbohydrate ester and the emulsifier are generated
from constituents of the food material by the lipid
acyltransferase.
In another aspect, the present invention provides use of a lipid
acyltransferase to prepare from a food material a foodstuff
comprising an emulsifier and one or more of a carbohydrate ester; a
sterol ester; a stanol ester; a protein ester; a monoglyceride or a
diglyceride, and wherein the emulsifier and/or the carbohydrate
ester and/or the sterol ester and/or the stanol ester and/or the
protein ester and/or the monoglyceride and/or the diglyceride
is/are generated from constituents of the food material by the
lipid acyltransferase.
In accordance with a further aspect of the present invention there
is provided a method of the in situ production of an emulsifier,
preferably a lysolecithin and a sterol ester in a egg based
foodstuff, wherein the method is such that the emulsifier is
produced without increasing or without substantially increasing the
free fatty acids in the foodstuff, and wherein the method comprises
the step of adding a lipid acyltransferase to the foodstuff.
In accordance with a further aspect of the present invention there
is provided a method of the in situ production of an emulsifier,
preferably a lysolecithin, and a sterol ester in an egg based
foodstuff, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of
production of a egg based foodstuff comprising an emulsifier,
preferably a lysolecithin, and a sterol ester in an egg based
foodstuff, wherein the emulsifier is produced without increasing or
without substantially increasing the free fatty acids in the
foodstuff, and wherein the method comprises the step of adding a
lipid acyltransferase to the foodstuff.
In another aspect, the present invention provides a method of
production of an egg based foodstuff comprising an emulsifier,
preferably a lysolecithin, and a sterol ester in an egg based
foodstuff, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
In a further aspect, the present invention further provides a
foodstuff obtainable by, preferably obtained by, a method according
to the present invention.
In another aspect the present invention further relates to a food
enzyme composition and/or a feed enzyme composition, which contains
a lipid acyltransferase, and the use of such a composition in the
methods of the present invention.
In accordance with a further aspect of the present invention there
is provided a method of identifying a suitable lipid
acyltransferase for use in accordance with the present invention,
comprising the steps of testing an enzyme of interest using one or
more of the "Transferase Assay in a Low Water environment", the
"Transferase Assay in High Water Egg Yolk" or the "Transferase
Assay in Buffered Substrate", and selecting a lipid acyltransferase
if it is one which has one or more of the following
characteristics: (a) when tested using the "Transferase Assay in a
Low Water Environment", measured after a time period selected from
30, 20 or 120 minutes, has a relative transferase activity of at
least 1%; (b) when tested using the "Transferase Assay in High
Water Egg Yolk" in an egg yolk with 54% water, has up to 100%
relative transferase activity; or (c) when tested using the
"Transferase Assay in Buffered Substrate" has at least 2%
acyltransferase activity.
The present invention yet further provides a lipid acyltransferase
identified using a method according to the present invention.
In accordance with a further aspect, the present invention provides
an immobilised lipid acyltransferase enzyme as defined herein.
DETAILED ASPECTS OF THE PRESENT INVENTION
The term "lipid acyltransferase" as used herein means an enzyme
which as well as having lipase activity (generally classified as
E.C. 3.1.1.x in accordance with the Enzyme Nomenclature
Recommendations (1992) of the Nomenclature Committee of the
International Union of Biochemistry and Molecular Biology) also has
acyltransferase activity (generally classified as E.C. 2.3.1.x),
whereby the enzyme is capable of transferring an acyl group from a
lipid to one or more acceptor substrates, such as one or more of
the following: a sterol; a stanol; a carbohydrate; a protein; a
protein subunit; glycerol.
The lipid acyltransferase for use in the methods and/or uses of the
present invention may be one as described in WO2004/064537 or
WO2004/064987, or PCT/IB2004/004378 or GB0513859.9, or
PCT/GB05/002823. These documents are incorporated herein by
reference.
The lipid acyltransferase for use in the methods and/or uses of the
present invention may be a natural lipid acyltransferase or may be
a variant lipid acyltransferase.
Preferably, the lipid acyltransferase for use in the methods and/or
uses of the present invention is capable of transferring an acyl
group from a lipid (as defined herein) to one or more of the
following acyl acceptor substrates: a sterol, a stanol, a
carbohydrate, a protein or subunits thereof, or a glycerol.
For some aspects the "acyl acceptor" according to the present
invention may be any compound comprising a hydroxy group (--OH),
such as for example, polyvalent alcohols, including glycerol;
sterol; stanols; carbohydrates; hydroxy acids including fruit
acids, citric acid, tartaric acid, lactic acid and ascorbic acid;
proteins or a sub-unit thereof, such as amino acids, protein
hydrolysates and peptides (partly hydrolysed protein) for example;
and mixtures and derivatives thereof. Preferably, the "acyl
acceptor" according to the present invention is not water.
In one embodiment, the acyl acceptor is preferably not a
monoglyceride and/or a diglyceride.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to a sterol and/or a stanol.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to a carbohydrate.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to a protein or a subunit thereof. Suitably
the protein subunit may be one or more of the following: an amino
acid, a protein hydrolysate, a peptide, a dipeptide, an
oligopeptide, a polypeptide.
Suitably in the protein or protein subunit the acyl acceptor may be
one or more of the following constituents of the protein or protein
subunit: a serine, a threonine, a tyrosine, or a cysteine.
When the protein subunit is an amino acid, suitably the amino acid
may be any suitable amino acid. Suitably the amino acid may be one
or more of a serine, a threonine, a tyrosine, or a cysteine for
example.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to glycerol.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to a hydroxy acid.
In one aspect, preferably the enzyme is capable of transferring an
acyl group from a lipid to a polyvalent alcohol.
In one aspect, the lipid acyltransferase may, as well as being able
to transfer an acyl group from a lipid to a sterol and/or a stanol,
additionally be able to transfer the acyl group from a lipid to one
or more of the following: a carbohydrate, a protein, a protein
subunit, glycerol.
Preferably, the lipid substrate upon which the lipid
acyltransferase according to the present invention acts is one or
more of the following lipids: a phospholipid, such as a lecithin,
e.g. phosphatidylcholine, a triacylglyceride, a cardiolipin, a
diglyceride, or a glycolipid, such as digalactosyldiglyceride
(DGDG) for example. This lipid substrate may be referred to herein
as the "lipid acyl donor". The term lecithin as used herein
encompasses phosphatidylcholine, phosphatidylethanolamine,
phosphatidylinositol, phosphatidylserine and
phosphatidylglycerol.
For some aspects, preferably the lipid substrate upon which the
lipid acyltransferase acts is a phospholipid, such as lecithin, for
example phosphatidylcholine.
For some aspects, preferably the lipid substrate is a glycolipid,
such as DGDG for example.
Preferably the lipid substrate is a food lipid, that is to say a
lipid component of a foodstuff.
For some aspects, preferably the lipid acyltransferase according to
the present invention is incapable, or substantially incapable, of
acting on a triglyceride and/or a 1-monoglyceride and/or
2-monoglyceride.
Suitably, the lipid substrate or lipid acyl donor may be one or
more lipids present in one or more of the following substrates:
fats, including lard, tallow and butter fat; oils including oils
extracted from or derived from palm oil, sunflower oil, soya bean
oil, safflower oil, cotton seed oil, ground nut oil, corn oil,
olive oil, peanut oil, coconut oil, and rape seed oil. Lecithin
from soya, rape seed or egg yolk is also a suitable lipid
substrate. The lipid substrate may be an oat lipid or other plant
based material containing galactolipids.
In one aspect the lipid acyl donor is preferably lecithin (such as
phosphatidylcholine) in egg yolk.
For some aspects of the present invention, the lipid may be
selected from lipids having a fatty acid chain length of from 8 to
22 carbons.
For some aspects of the present invention, the lipid may be
selected from lipids having a fatty acid chain length of from 16 to
22 carbons, more preferably of from 16 to 20 carbons.
For some aspects of the present invention, the lipid may be
selected from lipids having a fatty acid chain length of no greater
than 14 carbons, suitably from lipids having a fatty acid chain
length of from 4 to 14 carbons, suitably 4 to 10 carbons, suitably
4 to 8 carbons.
Suitably, the lipid acyltransferase according to the present
invention may exhibit one or more of the following lipase
activities: glycolipase activity (E.C. 3.1.1.26), triacylglycerol
lipase activity (E.C. 3.1.1.3), phospholipase A2 activity (E.C.
3.1.1.4) or phospholipase A1 activity (E.C. 3.1.1.32). The term
"glycolipase activity" as used herein encompasses "galactolipase
activity".
Suitably, the lipid acyltransferase according to the present
invention may have at least one or more of the following
activities: glycolipase activity (E.C. 3.1.1.26) and/or
phospholipase A1 activity (E.C. 3.1.1.32) and/or phospholipase A2
activity (E.C. 3.1.1.4).
For some aspects, the lipid acyltransferase according to the
present invention may have at least glycolipase activity (E.C.
3.1.1.26).
Suitably, for some aspects the lipid acyltransferase according to
the present invention may be capable of transferring an acyl group
from a glycolipid and/or a phospholipid to one or more of the
following acceptor substrates: a sterol, a stanol, a carbohydrate,
a protein, glycerol.
For some aspects, preferably the lipid acyltransferase according to
the present invention is capable of transferring an acyl group from
a glycolipid and/or a phospholipid to a sterol and/or a stanol to
form at least a sterol ester and/or a stanol ester.
For some aspects, preferably the lipid acyltransferase according to
the present invention is capable of transferring an acyl group from
a glycolipid and/or a phospholipid to a carbohydrate to form at
least a carbohydrate ester.
For some aspects, preferably the lipid acyltransferase according to
the present invention is capable of transferring an acyl group from
a glycolipid and/or a phospholipid to a protein to form at least
protein ester (or a protein fatty acid condensate).
For some aspects, preferably the lipid acyltransferase according to
the present invention is capable of transferring an acyl group from
a glycolipid and/or a phospholipid to glycerol to form at least a
diglyceride and/or a monoglyceride.
In one embodiment the acyl acceptor is glycerol. The glycerol may
be naturally comprised in the foodstuff and/or food material
comprising the acyl donor (i.e. the phospholipid for example)
--such as butter fat, milk or cream for instance. Alternatively the
glycerol may be added to the foodstuff and/or food material
comprising the acyl donor (i.e. the phospholipids for example)
--such as butterfat, milk or cream--either prior to, during or
subsequent to the addition of lipid acyl transferase enzyme.
For some aspects, preferably the lipid acyltransferase according to
the present invention does not exhibit triacylglycerol lipase
activity (E.C. 3.1.1.3) or significant triacylglycerol lipase
activity (E.C. 3.1.1.3).
In some aspects, the lipid acyltransferase may be capable of
transferring an acyl group from a lipid to a sterol and/or a
stanol. Thus, in one embodiment the "acyl acceptor" according to
the present invention may be either a sterol or a stanol or a
combination of both a sterol and a stanol.
In one embodiment suitably the sterol and/or stanol may comprise
one or more of the following structural features: i) a 3-beta
hydroxy group or a 3-alpha hydroxy group; and/or ii) A:B rings in
the cis position or A:B rings in the trans position or
C.sub.5-C.sub.6 is unsaturated.
Suitable sterol acyl acceptors include cholesterol and
phytosterols, for example alpha-sitosterol, beta-sitosterol,
stigmasterol, ergosterol, campesterol, 5,6-dihydrosterol,
brassicasterol, alpha-spinasterol, beta-spinasterol,
gamma-spinasterol, deltaspinasterol, fucosterol, dimosterol,
ascosterol, serebisterol, episterol, anasterol, hyposterol,
chondrillasterol, desmosterol, chalinosterol, poriferasterol,
clionasterol, sterol glycosides, and other natural or synthetic
isomeric forms and derivatives.
In one aspect of the present invention suitably more than one
sterol and/or stanol may act as the acyl acceptor, suitably more
than two sterols and/or stanols may act as the acyl acceptor. In
other words, in one aspect of the present invention, suitably more
than one sterol ester and/or stanol ester may be produced.
Suitably, when cholesterol is the acyl acceptor one or more further
sterols or one or more stanols may also act as the acyl acceptor.
Thus, in one aspect, the present invention provides a method for
the in situ production of both a cholesterol ester and at least one
sterol or stanol ester in combination. In other words, the lipid
acyltransferase for some aspects of the present invention may
transfer an acyl group from a lipid to both cholesterol and at
least one further sterol and/or at least one stanol.
In one aspect, preferably the sterol acyl acceptor is one or more
of the following: alpha-sitosterol, beta-sitosterol, stigmasterol,
ergosterol and campesterol.
In one aspect, preferably the sterol acyl acceptor is cholesterol.
When it is the case that cholesterol is the acyl acceptor for the
lipid acyltransferase, the amount of free cholesterol in the
foodstuff is reduced as compared with the foodstuff prior to
exposure to the lipid acyltransferase and/or as compared with an
equivalent foodstuff which has not been treated with the lipid
acyltransferase.
Advantageously, preferably the level of cholesterol in the
foodstuff (for example a dairy product, such as cheese, milk,
cream, butterfat or ice cream for instance) is reduced compared
with a control foodstuff (for example a dairy product, such as
cheese, milk, cream, butterfat or ice cream for instance), e.g. one
which has not been treated with a lipid acyltransferase in
accordance with the present invention).
In another embodiment the acyl acceptor is cholesterol. The
cholesterol may be naturally comprised in the foodstuff and/or food
material comprising the acyl donor (i.e. the phospholipid for
example) --such as butter fat, milk or cream for instance.
Alternatively the cholesterol may be added to the foodstuff and/or
food material comprising the acyl donor (i.e. the phospholipids for
example) --such as butterfat, milk or cream--either prior to,
during or subsequent to the addition of lipid acyl transferase
enzyme.
Suitable stanol acyl acceptors include phytostanols, for example
beta-sitostanol or ss-sitostanol.
In one aspect, preferably the sterol and/or stanol acyl acceptor is
a sterol and/or a stanol other than cholesterol.
In some aspects, the foodstuff prepared in accordance with the
present invention may be used to reduce blood serum cholesterol
and/or to reduce low density lipoprotein. Blood serum cholesterol
and low density lipoproteins have both been associated with certain
diseases in humans, such as atherosclerosis and/or heart disease
for example. Thus, it is envisaged that the foodstuffs prepared in
accordance with the present invention may be used to reduce the
risk of such diseases.
Thus, in one aspect the present invention provides the use of a
foodstuff according to the present invention for use in the
treatment and/or prevention of atherosclerosis and/or heart
disease.
In a further aspect, the present invention provides a medicament
comprising a foodstuff according to the present invention.
In a further aspect, the present invention provides a method of
treating and/or preventing a disease in a human or animal patient
which method comprising administering to the patient an effective
amount of a foodstuff according to the present invention.
Suitably, the sterol and/or the stanol "acyl acceptor" may be found
naturally within the foodstuff. Alternatively, the sterol and/or
the stanol may be added to the foodstuff. When it is the case that
a sterol and/or a stanol is added to the foodstuff, the sterol
and/or stanol may be added before, simultaneously with, and/or
after the addition of the lipid acyltransferase according to the
present invention. Suitably, the present invention may encompass
the addition of exogenous sterols/stanols, particularly
phytosterols/phytostanols, to the foodstuff prior to or
simultaneously with the addition of the enzyme according to the
present invention.
For some aspects, one or more sterols present in the foodstuff may
be converted to one or more stanols prior to or at the same time as
the lipid acyltransferase is added according to the present
invention. Any suitable method for converting sterols to stanols
may be employed. For example, the conversion may be carried out by
chemical hydrogenation for example. The conversion may be conducted
prior to the addition of the lipid acyltransferase in accordance
with the present invention or simultaneously with the addition of
the lipid acyltransferase in accordance with the present invention.
Suitably enzymes for the conversion of sterol to stanols are taught
in WO00/061771.
Suitably the present invention may be employed to produce
phytostanol esters in situ in a foodstuff. Phytostanol esters have
increased solubility through lipid membranes, bioavailability and
enhanced health benefits (see for example WO92/99640).
In some embodiments of the present invention the stanol ester
and/or the sterol ester may be a flavouring and/or a texturiser. In
which instances, the present invention encompasses the in situ
production of flavourings and/or texturisers.
For some aspects of the present invention, the lipid
acyltransferase according to the present invention may utilise a
carbohydrate as the acyl acceptor. The carbohydrate acyl acceptor
may be one or more of the following: a monosaccharide, a
disaccharide, an oligosaccharide or a polysaccharide. Preferably,
the carbohydrate is one or more of the following: glucose,
fructose, anhydrofructose, maltose, lactose, sucrose, galactose,
xylose, xylooligosacharides, arabinose, maltooligosaccharides,
tagatose, microthecin, ascopyrone P, ascopyrone T,
cortalcerone.
Suitably, the carbohydrate "acyl acceptor" may be found naturally
within the foodstuff. Alternatively, the carbohydrate may be added
to the foodstuff. When it is the case that the carbohydrate is
added to the foodstuff, the carbohydrate may be added before,
simultaneously with, and/or after the addition of the lipid
acyltransferase according to the present invention.
Carbohydrate esters can function as valuable emulsifiers in
foodstuffs. Thus, when it is the case that the enzyme functions to
transfer the acyl group to a sugar, the invention encompasses the
production of a second in situ emulsifier in the foodstuff.
In some embodiments, the lipid acyltransferase may utilise both a
sterol and/or stanol and a carbohydrate as an acyl acceptor.
The utilisation of lipid acyltransferase which can transfer the
acyl group to a carbohydrate as well as to a sterol and/or a stanol
is particularly advantageous for foodstuffs comprising eggs. In
particular, the presence of sugars, in particular glucose, in eggs
and egg products is often seen as disadvantageous. Egg yolk may
comprise up to 1% glucose. Typically, egg or egg based products may
be treated with glucose oxidase to remove some or all of this
glucose. However, in accordance with the present invention this
unwanted sugar can be readily removed by "esterifying" the sugar to
form a sugar ester.
For some aspects of the present invention, the lipid
acyltransferase according to the present invention may utilise a
protein as the acyl acceptor. Suitably, the protein may be one or
more of the proteins found in a food product, for example in a
dairy product and/or a meat product. By way of example only,
suitable proteins may be those found in curd or whey, such as
lactoglobulin. Other suitable proteins include ovalbumin from egg,
gliadin, glutenin, puroindoline, lipid transfer proteins from
grains, and myosin from meat.
Thus in accordance with the present invention, one or more of the
following advantageous properties can be achieved: in situ
production of an emulsifier without an increase in free fatty
acids; a reduction in the accumulation of free fatty acids in the
foodstuff; a reduction in free cholesterol levels in the foodstuff,
an increase in sterol esters and/or stanol esters; a reduction in
blood serum cholesterol and/or low density lipoproteins; an
increase in carbohydrate esters; a reduction in unwanted free
carbohydrates.
An advantage of the present invention is that the emulsifier(s)
is/are prepared in situ in the foodstuff without an increase, or a
substantial, increase, in the free fatty acid content of the
foodstuff. The production of free fatty acids can be detrimental to
foodstuffs. In particular, free fatty acids have been linked with
off-odours and/or off-flavours in foodstuffs, as well other
detrimental effects, including a soapy taste in cheese for
instance. Preferably, the method according to the present invention
results in the in situ preparation of an emulsifier(s) wherein the
accumulation of free fatty acids is reduced and/or eliminated.
Without wishing to be bound by theory, in accordance with the
present invention the fatty acid which is removed from the lipid is
transferred by the lipid acyltransferase to an acyl acceptor, for
example a sterol and/or a stanol. Thus, the overall level of free
fatty acids in the foodstuff does not increase or increases only to
an insignificant degree. This is in sharp contradistinction to the
situation when lipases (E.C. 3.1.1.x) are used to produce
emulsifiers in situ. In particular, the use of lipases can result
in an increased amount of free fatty acid in the foodstuff, which
can be detrimental. In accordance with the present invention, the
accumulation of free fatty acids is reduced and/or eliminated when
compared with the amount of free fatty acids which would have been
accumulated had a lipase enzyme, in particular a phospholipase A
enzyme, been used in place of the lipid acyltransferase in
accordance with the present invention.
The utilisation of a lipid acyltransferase which can transfer the
acyl group to a sterol and/or stanol may be particularly
advantageous for foodstuffs comprising eggs. In particular, it has
been found that an egg-based product with significantly better
properties can be obtained following treatment with a lipid
acyltransferase as defined herein compared with egg-based products
treated with conventional phospholipases, such as LipopanF.RTM.
(Novozymes A/S, Denmark)), Lecitase Ultra.RTM. (Novozymes A/S,
Denmark) or Lipomod 22 L from Biocatalysts, for instance.
In another aspect the acyl acceptor may be ascorbic acid or
comprises ascorbic acid. Therefore ascorbic acid bay be added to
the foodstuff and/or food material, or aqueous emulsion, possibly
in combination with an appropriate level of glycerol and optionally
sterol/stanols. Ascorbic ester is an antioxidant. The use of
ascorbic acid may be especially preferred when used in a foodstuff
as the anti-oxidant properties can act as a preservation agent,
e.g. to prevent or reduce oxidation of lipids. In this way the use
of ascorbic acid in the foodstuff and/or food material of the
present invention can prevent or reduce rancidity in the modified
foodstuff and/or food material. Therefore the use of asorbic acid
may be particularly useful for use in dairy products where
rancidity can be a problem, for example in cheese. The amount of
ascorbic acid added may be very low, e.g. at a level of up to
1/5.sup.th, such as up to 1/10.sup.th or up to 1/100.sup.th the
amounts recommended for the addition of glycerol as herein defined.
Preferably, the range of ascorbic acid should be 0.02-0.5 wt %. In
a preferable embodiment the ascorbic acid is added in the form of
an ascorbyl-palmitate, e.g. for use as an anti-oxidant in oil, and
the dosage is preferably between 0.1 and 0.2 wt % corresponding to
preferably between 0.04-0.08 wt % ascorbic acid.
In a preferred embodiment the modified foodstuff and/or food
material treated in accordance with the present invention comprises
lysophospholipid, preferably lysolecithin, preferably the foodstuff
and/or food material treated in accordance with the present
invention comprises at least 0.001 wt %, such as 0.005 wt %,
including at least 0.01 wt %, lysophospholipid, preferably
lysolecithin, more preferably at least 0.05 wt %, or at least 0.1
wt %, lysophospholipid, preferably lysolecithin. Higher
concentrations of lysophospholipid, preferably lysolecethin, are
also envisaged, such as at least 0.5 wt %, or at least 1 wt %,
lysophospholipid, preferably lysolecithin, including at least 2 wt
%, or at least 5%, lysophospholipid, preferably lysolecethin.
In a preferred embodiment the food stuff and/or food material
treated in accordance with the present invention comprises one or
more of the following
glycerophosphatylcholine/phosphatylethanolamine phosphatylinositol
and phosphatylserine, preferably the foodstuff and/or the food
material treated in accordance with the present invention comprises
at least 0.001 wt % of one or more of the following
glycerophosphatylcholine/phosphatylethanolamine phosphatylinositol
and phosphatylserine, such as 0.005 wt %, including at least 0.01
wt %, more preferably at least 0.05 wt %, or at least 0.1 wt %, one
or more of the following
glycerophosphatylcholine/phosphatylethanolamine phosphatylinositol
and phosphatylserine. Higher concentrations of one or more of the
following glycerophosphatylcholine/phosphatylethanolamine
phosphatylinositol and phosphatylserine, are also envisaged, such
as at least 0.5 wt %, or at least 1 wt %, including at least 2 wt
%, or at least 5%,
It is preferable that the modified foodstuff and/or food material
described in the above paragraph comprises
glycerophosphatylcholine.
When the modified foodstuff and/or food material comprises
glycerophosphatylcholine, the modified foodstuff and/or food
material may comprise of less than 0.001 wt % lysophospholipid,
such as lysolecithin. This may comprise less than 0.0005 wt %
lysophospholipid, including the embodiment where the modified
foodstuff and/or food material comprises no lysophospholipid.
In a preferred embodiment the modified foodstuff and/or food
material comprises at least 0.001 wt % monoglyceride such as 0.005
wt %, including at least 0.01 wt % monoglyceride, more preferably
at least 0.05 wt % monoglyceride, or at least 0.1 wt %
monoglyceride. Higher concentrations of monoglyceride, are also
envisaged, such as at least 0.5 wt % monoglyceride, or at least 1
wt % monoglyceride, including at least 2 wt % monoglyceride, or at
least 5%, monoglyceride.
In a preferred embodiment the modified foodstuff and/or food
material comprises at least 0.001 wt % sterol ester such as 0.005
wt %, including at least 0.01 wt % sterol ester, more preferably at
least 0.05 wt % sterol ester, or at least 0.1 wt % sterol ester.
Higher concentrations of sterol ester, are also envisaged, such as
at least 0.5 wt % sterol ester.
In one embodiment, i.e. where the acyl acceptor is glycerol for
instance, the functional ingredient of the present invention is
generated by a reaction selected from alcoholysis, preferably
glycerolysis.
A preferred temperature for the modification of the foodstuff
and/or food material according to processes of the invention may
depend on several factors including the temperature optima and
stability of the enzyme used, the melting point and viscosity of
the foodstuff and/or food material, the volume of the foodstuff
and/or food material to be modified, the heat stability of the
foodstuff and/or food material.
For example, in one embodiment the enzyme modification may occur
between 10-70.degree. C., such as 10 to 32.degree. C., or 10 to
34.degree. C. including between 10-20.degree. C., more preferably
between 20-60.degree. C., such as between 30-60.degree. C., or
36-60.degree. C., such as 37-60.degree. C., including between
40-60.degree. C.
For the enzyme modification of milk and/or cream for example it may
be preferable to use a temperature of less than about 50.degree.
C., such as between about 10 to 34.degree. C. for example, or
between about 36-49.degree. C. for example, or between about
40-49.degree. C. for example, or between about 40 to 45.degree. C.
for example, or between about 45-49.degree. C. for example.
Suitable temperatures of between 20-50.degree. C. may be used, such
as between 30-40.degree. C. for example.
In some embodiments, an advantage of the use of a lipid
acyltransferase herein disclosed may be that it has a high thermal
stability and may therefore be used in the treatment of a foodstuff
and/or food material at a temperature where the viscosity of said
foodstuff and/or food material is low. The high thermal stability
may also allow lower dosages of enzyme to be used.
Suitably, for some embodiments the lipid acyltransferase may have a
temperature optima of between about 50 to about 70.degree. C. for
example. Suitably, for some embodiments a lipid acyltransferase may
have a temperature stability, as measured using the PLU assay,
wherein said acyltransferase retains at least about 25%, such as at
least about 50% of its activity after 1 hour at 55.degree. C.
The process for the treatment of the foodstuff and/or food material
according to the invention may occur over any suitable time period.
This may depend for example on the temperature used and enzyme
dosage. By way of example only the time period may be between about
1 minute and about 4 hours, such as between about 5 minutes to
about 2 hours, or between about 10 minutes to about 1 hour, or
between about 5 minutes to about 30 minutes or between about 1
minute to about 29 minutes or between about 31 minutes to about 60
minutes. Suitably the time period may be between about 5 minutes
and 1 hour.
The enzyme dosage may be in any suitable dosage, for example the
enzyme dosage, when added in terms of PLU activity, may be dosed
between about 1-10,000 PLU/kg foodstuff and/or food material, such
as between 5-5000 PLU/kg foodstuff and/or food material, such as
between 100-1000 PLU/kg foodstuff and/or food material, or 1000 to
3000 PLU/kg foodstuff and/or food material. 50 to 1000 PLU/kg
foodstuff and/or food material may be preferable in some
embodiments for a lipid acyl transferase.
Preferably, the lipid acyltransferase enzyme according to the
present invention may be characterised using the following
criteria: (i) the enzyme possesses acyl transferase activity which
may be defined as ester transfer activity whereby the acyl part of
an original ester bond of a lipid acyl donor is transferred to an
acyl acceptor to form a new ester; and (ii) the enzyme comprises
the amino acid sequence motif GDSX, wherein X is one or more of the
following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or
S.
Preferably, X of the GDSX motif is L or Y. More preferably, X of
the GDSX motif is L. Thus, preferably the enzyme according to the
present invention comprises the amino acid sequence motif GSDL (SEQ
ID NO: 14).
The GDSX motif is comprised of four conserved amino acids.
Preferably, the serine within the motif is a catalytic serine of
the lipid acyltransferase enzyme. Suitably, the serine of the GDSX
motif may be in a position corresponding to Ser-16 in Aeromonas
hydrophila lipolytic enzyme taught in Brumlik & Buckley
(Journal of Bacteriology April 1996, Vol. 178, No. 7, p
2060-2064).
To determine if a protein has the GDSX motif according to the
present invention, the sequence is preferably compared with the
hidden markov model profiles (HMM profiles) of the pfam
database.
Pfam is a database of protein domain families. Pfam contains
curated multiple sequence alignments for each family as well as
profile hidden Markov models (profile HMMs) for identifying these
domains in new sequences. An introduction to Pfam can be found in
Bateman A et al. (2002) Nucleic Acids Res. 30; 276-280. Hidden
Markov models are used in a number of databases that aim at
classifying proteins, for review see Bateman A and Haft D H (2002)
Brief Bioinform 3; 236-245. (abstracts available from National
Center fro Biotechnology Information website maintained in
conjunction with the National Library of Medicine and the National
Institutes of Health.
For a detailed explanation of hidden Markov models and how they are
applied in the Pfam database see Durbin R, Eddy S, and Krogh A
(1998) Biological sequence analysis; probabilistic models of
proteins and nucleic acids. Cambridge University Press, ISBN
0-521-62041-4. The Hammer software package can be obtained from
Washington University, St Louis, USA.
Alternatively, the GDSX motif can be identified using the Hammer
software package, the instructions are provided in Durbin R, Eddy
S, and Krogh A (1998) Biological sequence analysis; probabilistic
models of proteins and nucleic acids. Cambridge University Press,
ISBN 0-521-62041-4 and the references therein, and the HMMER2
profile provided within this specification.
The PFAM database can be accessed, for example, through several
servers which are currently located websites maintained by the
Sanger Institute (UK) in conjunction with Wellcome Trust Institute,
the HHMI Janelia Farm Research Campus, the Institut National de la
Recherche Agronomique, and the Center for Genomics and
Bioinformatics of the Karolinska Institutet, among others.
The database offers a search facility where one can enter a protein
sequence. Using the default parameters of the database the protein
sequence will then be analysed for the presence of Pfam domains.
The GDSX domain is an established domain in the database and as
such its presence in any query sequence will be recognised. The
database will return the alignment of the Pfam00657 consensus
sequence to the query sequence.
A multiple alignment, including Aeromonas salmonicida or Aeromonas
hydrophila can be obtained by: a) manual obtain an alignment of the
protein of interest with the Pfam00657 consensus sequence and
obtain an alignment of P10480 with the Pfam00657 consensus sequence
following the procedure described above; or b) through the database
After identification of the Pfam00657 consensus sequence the
database offers the option to show an alignment of the query
sequence to the seed alignment of the Pfam00657 consensus sequence.
P10480 is part of this seed alignment and is indicated by
GCAT_AERHY. Both the query sequence and P10480 will be displayed in
the same window.
The Aeromonas hydrophila reference sequence:
The residues of Aeromonas hydrophila GDSX lipase are numbered in
the NCBI file P10480, the numbers in this text refer to the numbers
given in that file which in the present invention is used to
determine specific amino acids residues which, in a preferred
embodiment are present in the lipid acyltransferase enzymes of the
invention.
The Pfam alignment was performed (FIGS. 33 and 34):
The following conserved residues can be recognised and in a
preferable embodiment may be present in the enzymes for use in the
compositions and methods of the invention;
TABLE-US-00001 Block 1 - GDSX block hid hid hid hid Gly Asp Ser hid
28 29 30 31 32 33 34 35 Block 2 - GANDY block hid Gly hid Asn Asp
hid 130 131 132 133 134 135 Block 3 - HPT block His 309
Where `hid` means a hydrophobic residue selected from Met, Ile,
Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe.
Preferably the lipid acyltransferase enzyme for use in the
compositions/methods of the invention can be aligned using the
Pfam00657 consensus sequence.
Preferably, a positive match with the hidden markov model profile
(HMM profile) of the pfam00657 domain family indicates the presence
of the GDSL (SEQ ID NO: 14) or GDSX domain according to the present
invention.
Preferably when aligned with the Pfam00657 consensus sequence the
lipid acyltransferase for use in the compositions/methods of the
invention have at least one, preferably more than one, preferably
more than two, of the following, a GDSx block, a GANDY (SEQ ID NO:
15) block, a HPT block. Suitably, the lipid acyltransferase may
have a GDSx block and a GANDY (SEQ ID NO: 15) block. Alternatively,
the enzyme may have a GDSx block and a HPT block. Preferably the
enzyme comprises at least a GDSx block.
Preferably, residues of the GANDY (SEQ ID NO: 15) motif are
selected from GANDY (SEQ ID NO: 15), GGNDA (SEQ ID NO: 16), GGNDL
(SEQ ID NO: 18), most preferably GANDY (SEQ ID NO: 15).
Preferably, when aligned with the Pfam00657 consensus sequence the
enzyme for use in the compositions/methods of the invention have at
least one, preferably more than one, preferably more than two,
preferably more than three, preferably more than four, preferably
more than five, preferably more than six, preferably more than
seven, preferably more than eight, preferably more than nine,
preferably more than ten, preferably more than eleven, preferably
more than twelve, preferably more than thirteen, preferably more
than fourteen, of the following amino acid residues when compared
to the reference A. hydrophilia polypeptide sequence, namely SEQ ID
No. 32: 28hid, 29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid,
130hid, 131Gly, 132Hid, 133Asn, 134Asp, 135hid, 309His
The pfam00657 GDSX domain is a unique identifier which
distinguishes proteins possessing this domain from other
enzymes.
The pfam00657 consensus sequence is presented in FIG. 1 as SEQ ID
No. 1. This is derived from the identification of the pfam family
00657, database version 6, which may also be referred to as
pfam00657.6 herein.
The consensus sequence may be updated by using further releases of
the pfam database.
For example, FIGS. 33 and 34 show the pfam alignment of family
00657, from database version 11, which may also be referred to as
pfam00657.11 herein.
The presence of the GDSx, GANDY (SEQ ID NO: 15) and HPT blocks are
found in the pfam family 00657 from both releases of the database.
Future releases of the pfam database can be used to identify the
pfam family 00657.
Preferably, the lipid acyltransferase enzyme according to the
present invention may be characterised using the following
criteria: (i) the enzyme possesses acyl transferase activity which
may be defined as ester transfer activity whereby the acyl part of
an original ester bond of a lipid acyl donor is transferred to an
acyl acceptor to form a new ester; (ii) the enzyme comprises the
amino acid sequence motif GDSX, wherein X is one or more of the
following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S;
(iii) the enzyme comprises His-309 or comprises a histidine residue
at a position corresponding to His-309 in the Aeromonas hydrophila
lipolytic enzyme shown in FIG. 2 (SEQ ID No. 2 or SEQ ID No.
32).
Preferably, the amino acid residue of the GDSX motif is L.
In SEQ ID No. 2 or SEQ ID No. 32 the first 18 amino acid residues
form a signal sequence. His-309 of the full length sequence, that
is the protein including the signal sequence, equates to His-291 of
the mature part of the protein, i.e. the sequence without the
signal sequence.
Preferably, the lipid acyltransferase enzyme according to the
present invention comprises the following catalytic triad: Ser-34,
Asp-306 and His-309 or comprises a serine residue, an aspartic acid
residue and a histidine residue, respectively, at positions
corresponding to Ser-34, Asp-306 and His-309 in the Aeromonas
hydrophila lipolytic enzyme shown in FIG. 2 (SEQ ID No. 2) or FIG.
28 (SEQ ID No. 32). As stated above, in the sequence shown in SEQ
ID No. 2 or SEQ ID No. 32 the first 18 amino acid residues form a
signal sequence. Ser-34, Asp-306 and His-309 of the full length
sequence, that is the protein including the signal sequence, equate
to Ser-16, Asp-288 and His-291 of the mature part of the protein,
i.e. the sequence without the signal sequence. In the pfam00657
consensus sequence, as given in FIG. 1 (SEQ ID No. 1) the active
site residues correspond to Ser-7, Asp-345 and His-348.
Preferably, the lipid acyltransferase enzyme according to the
present invention may be characterised using the following
criteria: (i) the enzyme possesses acyl transferase activity which
may be defined as ester transfer activity whereby the acyl part of
an original ester bond of a first lipid acyl donor is transferred
to an acyl acceptor to form a new ester; and (ii) the enzyme
comprises at least Gly-32, Asp-33, Ser-34, Asp-306 and His-309 or
comprises glycine, aspartic acid, serine, aspartic acid and
histidine residues at positions corresponding to Gly-32, Asp-33,
Ser-34, Asp-306 and His-309, respectively, in the Aeromonas
hydrophila lipolytic enzyme shown in FIG. 2 (SEQ ID No. 2) or FIG.
28 (SEQ ID No. 32).
Suitably, the lipid acyltransferase enzyme according to the present
invention may be obtainable, preferably obtained, from organisms
from one or more of the following genera: Aeromonas, Streptomyces,
Saccharomyces, Lactococcus, Mycobacterium, Streptococcus,
Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter,
Vibrionaceae, Xylella, Sulfolobus, Aspergillus,
Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia,
Xanthomonas and Candida.
Suitably, the lipid acyltransferase enzyme according to the present
invention may be obtainable, preferably obtained, from one or more
of the following organisms: Aeromonas hydrophila, Aeromonas
salmonicida, Streptomyces coelicolor, Streptomyces rimosus,
Mycobacterium, Streptococcus pyogenes, Lactococcus lactis,
Streptococcus pyogenes, Streptococcus thermophilus, Lactobacillus
helveticus, Desulfitobacterium dehalogenans, Bacillus sp,
Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus
solfataricus, Saccharomyces cerevisiae, Aspergillus terreus,
Schizosaccharomyces pombe, Listeria innocua, Listeria
monocytogenes, Neisseria meningitidis, Mesorhizobium loti,
Ralstonia solanacearum, Xanthomonas campestris, Xanthomonas
axonopodis and Candida parapsilosis.
In one aspect, preferably the lipid acyltransferase enzyme
according to the present invention is obtainable, preferably
obtained, from one or more of Aeromonas hydrophila or Aeromonas
salmonicida.
Suitably, the lipid acyltransferase enzyme according to the present
invention may be encoded by any one of the following nucleotide
sequences: (a) the nucleotide sequence shown as SEQ ID No. 7 (see
FIG. 9); (b) the nucleotide sequence shown as SEQ ID No. 8 (see
FIG. 10); (c) the nucleotide sequence shown as SEQ ID No. 9 (see
FIG. 11); (d) the nucleotide sequence shown as SEQ ID No. 10 (see
FIG. 12); (e) the nucleotide sequence shown as SEQ ID No. 11 (see
FIG. 13); (f) the nucleotide sequence shown as SEQ ID No. 13 (see
FIG. 15); (g) the nucleotide sequence shown as SEQ ID No. 21 (see
FIG. 17); (h) the nucleotide sequence shown as SEQ ID No. 23 (see
FIG. 19); (i) the nucleotide sequence shown as SEQ ID No. 25 (see
FIG. 21); (j) the nucleotide sequence shown as SEQ ID No. 27 (see
FIG. 23); (k) the nucleotide sequence shown as SEQ ID No. 29 (see
FIG. 25); (l) the nucleotide sequence shown as SEQ ID No. 31 (see
FIG. 27); (m) the nucleotide sequence shown as SEQ ID No. 33 (see
FIG. 29); (n) the nucleotide sequence shown as SEQ ID No. 35 (see
FIG. 31); (o) the nucleotide sequence shown as SEQ ID No. 46 (see
FIG. 95); (p) the nucleotide sequence shown as SEQ ID No. 75 (see
FIG. 87); (q) the nucleotide sequence shown as SEQ ID No. 77 (see
FIG. 89); (r) the nucleotide sequence shown as SEQ ID No. 78 (see
FIG. 90); (s) the nucleotide sequence shown as SEQ ID No. 81 (see
FIG. 93); (t) the nucleotide sequence shown as SEQ ID No. 83 (see
FIG. 37); (u) the nucleotide sequence shown as SEQ ID No. 87 (see
FIG. 99); (v) the nucleotide sequence shown as SEQ ID No. 88 (see
FIG. 100); (w) or a nucleotide sequence which has 70% or more,
preferably 75% or more, identity with any one of the sequences
shown as SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10,
SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 21, SEQ ID No. 23, SEQ ID
No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33,
SEQ ID No. 35, SEQ ID No. 46, SEQ ID No. 75, SEQ ID No. 77, SEQ ID
No. 78, SEQ ID No. 81, SEQ ID No. 83, SEQ ID No.87, or SEQ ID No.
88.^^
Suitably the lipid acyltransferase encoded by the nucleotide
sequence of any one of the sequences shown as SEQ ID No. 7, SEQ ID
No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13,
SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID
No. 29, SEQ ID No. 31, SEQ ID No. 33, SEQ ID No. 35, SEQ ID No. 46,
SEQ ID No. 75, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 81, SEQ ID
No. 83, SEQ ID No.87, or SEQ ID No. 88 or by a nucleotide sequence
which has 70% or more, preferably 75% or more, identity with any
one of the sequences shown as SEQ ID No. 7, SEQ ID No. 8, SEQ ID
No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 21,
SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID
No. 31, SEQ ID No. 33, SEQ ID No. 35, SEQ ID No. 46, SEQ ID No. 75,
SEQ ID No. 77, SEQ ID No. 78, SEQ ID No. 81, SEQ ID No. 83, SEQ ID
No.87, or SEQ ID No. 88 may be post-transcriptionally and/or
post-translationally modified.
Suitably the nucleotide sequence may have 80% or more, preferably
85% or more, more preferably 90% or more and even more preferably
95% or more identity with any one of the sequences shown as SEQ ID
No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 1, SEQ
ID No. 13, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No.
27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33, SEQ ID No. 35, SEQ
ID No. 46, SEQ ID No. 75, SEQ ID No. 77, SEQ ID No. 78, SEQ ID No.
81, SEQ ID No. 83, SEQ ID No.87, or SEQ ID No. 88.
In one embodiment, the nucleotide sequence encoding a lipid
acyltransferase enzyme for use in the methods and uses of the
present invention is a nucleotide sequence which has 70% or more,
preferably 75% or more, identity with any one of the sequences
shown as: SEQ ID No. 88, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 33,
and SEQ ID No. 34. Suitably the nucleotide sequence may have 80% or
more, preferably 85% or more, more preferably 90% or more and even
more preferably 95% or more identity with any one of the sequences
shown as: SEQ ID No. 88, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 33,
and SEQ ID No. 34.
In one embodiment, the nucleotide sequence encoding a lipid
acyltransferase enzyme for use in the methods and uses of the
present invention is a nucleotide sequence which has 70% or more,
75% or more, 80% or more, preferably 85% or more, more preferably
90% or more and even more preferably 95% or more identity the
sequence shown as SEQ ID No. 88.
Suitably, the lipid acyltransferase enzyme according to the present
invention may comprise one or more of the following amino acid
sequences: (i) the amino acid sequence shown as SEQ ID No. 2 (see
FIG. 2) (ii) the amino acid sequence shown as SEQ ID No. 3 (see
FIG. 3) (iii) the amino acid sequence shown as SEQ ID No. 4 (see
FIG. 4) (iv) the amino acid sequence shown as SEQ ID No. 5 (see
FIG. 5) (v) the amino acid sequence shown as SEQ ID No. 6 (see FIG.
6) (vi) the amino acid sequence shown as SEQ ID No. 12 (see FIG.
14) (vii) the amino acid sequence shown as SEQ ID No. 20 (FIG. 16)
(viii) the amino acid sequence shown as SEQ ID No. 22 (FIG. 18)
(ix) the amino acid sequence shown as SEQ ID No. 24 (FIG. 20) (x)
the amino acid sequence shown as SEQ ID No. 26 (FIG. 22) (xi) the
amino acid sequence shown as SEQ ID No. 28 (FIG. 24) (xii) the
amino acid sequence shown as SEQ ID No. 30 (FIG. 26) (xiii) the
amino acid sequence shown as SEQ ID No. 32 (FIG. 28) (xiv) the
amino acid sequence shown as SEQ ID No. 34 (FIG. 30) (xv) the amino
acid sequence shown as SEQ ID No. 62 (FIG. 74) (xvi) the amino acid
sequence shown as SEQ ID No. 90 (FIG. 102) or an amino acid
sequence which has 75% or more identity with any one of the
sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID
No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22,
SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID
No. 32, SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
Suitably, the lipid acyltransferase enzyme according to the present
invention may comprise either the amino acid sequence shown as SEQ
ID No. 2 or as SEQ ID No. 3 or SEQ ID No. 32 or SEQ ID No. 34 or
SEQ ID No. 62 or SEQ ID No. 90 or may comprise an amino acid
sequence which has 75% or more, preferably 80% or more, preferably
85% or more, preferably 90% or more, preferably 95% or more,
identity with the amino acid sequence shown as SEQ ID No. 2 or the
amino acid sequence shown as SEQ ID No. 3 or the amino acid
sequence shown as SEQ ID No. 32 or the amino acid sequence shown as
SEQ ID No. 34 or the amino acid sequence shown as SEQ ID No.62 or
the amino acid sequence shown as SEQ ID No.90.
For the purposes of the present invention, the degree of identity
is based on the number of sequence elements which are the same. The
degree of identity in accordance with the present invention for
amino acid sequences may be suitably determined by means of
computer programs known in the art, such as Vector NTI 10
(Invitrogen Corp.). For pairwise alignment the score used is
preferably BLOSUM62 with Gap opening penalty of 10.0 and Gap
extension penalty of 0.1.
Suitably the lipid acyltransferase enzyme according to the present
invention comprises an amino acid sequence which has 80% or more,
preferably 85% or more, more preferably 90% or more and even more
preferably 95% or more identity with any one of the sequences shown
as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID
No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24,
SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, or SEQ
ID No. 34.
Suitably, the lipid acyltransferase enzyme according to the present
invention may comprise one or more of SEQ ID No. 2, SEQ ID No. 3,
SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No.
20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ
ID No. 30, SEQ ID No. 32, SEQ ID No. 34 or SEQ ID No. 62 before
being post-translationally modified. The present invention also
encompasses the use of a lipid acyltransferase enzyme which has
been post-translationally modified, wherein the originally
translated enzyme or pro-enzyme comprises one or more of SEQ ID No.
2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID
No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26,
SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, or SEQ
ID No. 62.
In one embodiment the lipid acyltransferase enzyme according to the
present invention may be a fragment of one or more of the amino
acid sequences SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No.
5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ
ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No.
32, SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90. In one
embodiment preferably the amino acid sequence fragment has 70% or
more, preferably 75% or more identity with any one of the sequences
shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5,
SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID
No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32,
SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90 when determined over
the whole of the sequence shown as SEQ ID No. 2, SEQ ID No. 3, SEQ
ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20,
SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID
No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No.
90 respectively.
In one embodiment, suitably the lipid acyl transferase in
accordance with the present invention comprises (or consists of)
the amino acid sequence shown in SEQ ID No. 90 or comprises (or
consists of) an amino acid sequence which has at least 70%, at
least 75%, at least 85%, at least 90%, at least 95%, at least 98%
identity to SEQ ID No. 90.
Suitably, the lipid acyltransferase enzyme according to the present
invention comprises one or more of the following amino acid
sequences: (a) an amino acid sequence shown as amino acid residues
1-100 of SEQ ID No. 2 or SEQ ID No. 32; (b) an amino acid sequence
shown as amino acids residues 101-200 of SEQ ID No. 2 or SEQ ID No.
32; (c) an amino acid sequence shown as amino acid residues 201-300
of SEQ ID No. 2 or SEQ ID No. 32; or (d) an amino acid sequence
which has 75% or more, preferably 85% or more, more preferably 90%
or more, even more preferably 95% or more identity to any one of
the amino acid sequences defined in (a)-(c) above.
Suitably, the lipid acyltransferase enzyme according to the present
invention comprises one or more of the following amino acid
sequences: (a) an amino acid sequence shown as amino acid residues
28-39 of SEQ ID No. 2 or SEQ ID No. 32; (b) an amino acid sequence
shown as amino acids residues 77-88 of SEQ ID No. 2 or SEQ ID No.
32; (c) an amino acid sequence shown as amino acid residues 126-136
of SEQ ID No. 2 or SEQ ID No. 32; (d) an amino acid sequence shown
as amino acid residues 163-175 of SEQ ID No. 2 or SEQ ID No. 32;
(e) an amino acid sequence shown as amino acid residues 304-311 of
SEQ ID No. 2 or SEQ ID No. 32; or (f) an amino acid sequence which
has 75% or more, preferably 85% or more, more preferably 90% or
more, even more preferably 95% or more identity to any one of the
amino acid sequences defined in (a)-(e) above.
In one aspect, the lipid acyl transferase for use in the method and
uses of the present invention may be the lipid acyl transferase
from Candida parapsilosis as taught in EP 1 275 711. Thus in one
aspect the lipid acyl transferase for use in the method and uses of
the present invention may be a lipid acyl transferase comprising
one of the amino acid sequences taught in SEQ ID No. 63 or SEQ ID
No. 64.
Much by preference, the lipid acyltransferase for use in the method
and uses of the present invention may be a lipid acyl transferase
(lipid acyltransferase) comprising the amino acid sequence shown as
SEQ ID No. 62, or the amino acid sequence shown as SEQ ID No. 90 or
an amino acid sequence which has 75% or more, preferably 85% or
more, more preferably 90% or more, even more preferably 95% or
more, even more preferably 98% or more, or even more preferably 99%
or more identity to SEQ ID No. 62 or SEQ ID No. 90. This enzyme may
be considered a variant enzyme.
In one aspect, the lipid acyltransferase according to the present
invention may be a lecithin:cholesterol acyltransferases (LCAT) or
variant thereof (for example a variant made by molecular
evolution)
Suitable LCATs are known in the art and may be obtainable from one
or more of the following organisms for example: mammals, rat, mice,
chickens, Drosophila melanogaster, plants, including Arabidopsis
and Oryza sativa, nematodes, fungi and yeast.
In one embodiment the lipid acyltransferase enzyme according to the
present invention may be the lipid acyltransferase obtainable,
preferably obtained, from the E. coli strains TOP 10 harbouring
pPet12aAhydro and pPet12aASalmo deposited by Danisco A/S of
Langebrogade 1, DK-1001 Copenhagen K, Denmark under the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the purposes of Patent Procedure at the National
Collection of Industrial, Marine and Food Bacteria (NCIMB) 23 St.
Machar Street, Aberdeen Scotland, GB on 22 Dec. 2003 under
accession numbers NICMB 41204 and NCIMB 41205, respectively.
Highly preferred lipid acyltransferase (in particular a
phospholipid glycerol acyl transferase) for use in the methods of
the invention include those isolated from Aeromonas spp.,
preferably Aeromonas hydrophila or A. salmonicida, most preferable
A. salmonicida. Most preferred lipid acyl transferases for use in
the present invention are encoded by one of SEQ ID No.s 2, 3, 32,
34, 62 or 90. It will be recognised by the skilled person that it
is preferable that the signal peptides of the acyl transferase has
been cleaved during expression of the transferase. The signal
peptide of SEQ ID 2, 3, 32, 34, 62 and 90 are amino acids 1-18.
Therefore the most preferred regions are amino acids 19-335 for SEQ
ID No. 32 and SEQ ID No. 2 (A. hydrophilia) and amino acids 19-336
for SEQ ID No. 3, SEQ ID No. 34, SEQ ID No. 62 and SEQ ID No. 90.
(A. salmonicida). When used to determine the homology of identity
of the amino acid sequences, it is preferred that the alignments as
herein described use the mature sequence. The mature sequence may
be on which has the signal peptide removed and/or may be one which
has been post-translationally modified.
Therefore the most preferred regions for determining homology
(identity) are amino acids 19-335 for SEQ ID No.s 32 and 2 (A.
hydrophilia) and amino acids 19-336 for SEQ ID No.s 3, 34 and 62.
(A. salmonicida). SEQ ID No.s 73 and 74 are "mature" (i.e. without
signal peptide) protein sequences of the highly preferred lipid
acyl transferases from A. hydrophilia and A. salmonicida
respectively. SEQ ID Nos. 73 and 74 may or may not undergo further
post-translational modification.
A lipid acyl transferase for use in the invention may also be
isolated from Thermobifida, preferably T. fusca, most preferably
that encoded by SEQ ID No. 67.
A lipid acyl transferase for use in the invention may also be
isolated from Streptomyces, preferable S. avermitis, most
preferably that encoded by SEQ ID No. 71. Other possible enzymes
for use in the present invention from Streptomyces include those
encoded by SEQ ID Nos. 4, 5, 20, 22, 24, 26, 28, 30, 70, 72.
An enzyme for use in the invention may also be isolated from
Corynebacterium, preferably C. efficiens, most preferably that
encoded by SEQ ID No. 68.
Suitably, the lipid acyltransferase for use in the methods and uses
according to the present invention may be a lipid acyltransferase
comprising any one of the amino acid sequences shown as SEQ ID Nos.
76, 77, 79, 80, 82, 84, or 86 or an amino acid sequence which has
at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity
therewith, or encoded by any one of the nucleotide sequences shown
as SEQ ID Nos. 75, 78, 81, 83, 85, or 87 or a nucleotide sequence
which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98%
identity therewith.
In one embodiment the lipid acyltransferase for use in the methods
and uses according to the present invention is preferably a lipid
acyltransferase encoded by a nucleic acid selected from the group
consisting of: a) a nucleic acid comprising a nucleotide sequence
shown in SEQ ID No. 75; b) a nucleic acid which is related to the
nucleotide sequence of SEQ ID No. 75 by the degeneration of the
genetic code; and c) a nucleic acid comprising a nucleotide
sequence which has at least 70% identity with the nucleotide
sequence shown in SEQ ID No. 75.
In one embodiment, the lipid acyltransferase for use in the methods
and uses according to the present invention is preferably a lipid
acyltransferase comprising an amino acid sequence as shown in SEQ
ID No. 76 or an amino acid sequence which has at least 60% identity
thereto.
In a further embodiment the lipid acyltransferase for use in the
methods and uses according to the present invention may be a lipid
acyltransferase comprising any one of the amino acid sequences
shown as SEQ ID No. 76, 77, 79, 80, 82, 84 or 86 or an amino acid
sequence which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%
or 98% identity therewith, or encoded by any one of the nucleotide
sequences shown as SEQ ID No. 78, 81, 83, 85 or 87 or a nucleotide
sequence which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%
or 98% identity therewith.
In a further embodiment the lipid acyltransferase for use in the
methods and uses according to the present invention may be a lipid
acyltransferase comprising any one of amino sequences shown as SEQ
ID No. 77, 79, 80, 84 or 86 or an amino acid sequence which has at
least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity
therewith for the uses described herein.
In a further embodiment the lipid acyltransferase for use in the
methods and uses according to the present invention may be a lipid
acyltransferase comprising any one of amino sequences shown as SEQ
ID No. 77, 79, or 86 or an amino acid sequence which has at least
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity therewith
for the uses described herein.
More preferably in one embodiment the lipid acyltransferase for use
in the methods and uses according to the present invention may be a
lipid acyltransferase comprising the amino acid sequence shown as
SEQ ID No. 86 or an amino acid sequence which has at least 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity therewith.
In another embodiment the lipid acyl transferase for use in the
methods and uses according to the present invention may be a lipid
acyltransferase comprising the amino acid sequence shown as SEQ ID
No. 82 or 83 or an amino acid sequence which has at least 80%, 85%,
90%, 95%, 96%, 97% or 98% identity therewith.
In another embodiment the lipid acyl transferase for use in the
methods and uses according to the present invention may be a lipid
acyltransferase comprising the amino acid sequence shown as SEQ ID
No. 80 or an amino acid sequence which has at least 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97% or 98% identity therewith.
In one embodiment the lipid acyl transferase for use in the methods
and uses according to the present invention may be a encoded by a
nucleic acid selected from the group consisting of: a) a nucleic
acid comprising a nucleotide sequence shown in SEQ ID No. 75; b) a
nucleic acid which is related to the nucleotide sequence of SEQ ID
No. 75 by the degeneration of the genetic code; and c) a nucleic
acid comprising a nucleotide sequence which has at least 70%
identity with the nucleotide sequence shown in SEQ ID No. 75.
In one embodiment the lipid acyltransferase according to the
present invention may be a lipid acyltransferase obtainable,
preferably obtained, from the Streptomyces strains L130 or L131
deposited by Danisco A/S of Langebrogade 1, DK-1001 Copenhagen K,
Denmark under the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms for the purposes of Patent
Procedure at the National Collection of Industrial, Marine and Food
Bacteria (NCIMB) 23 St. Machar Street, Aberdeen Scotland, GB on 25
Jun. 2004 under accession numbers NCIMB 41226 and NCIMB 41227,
respectively.
Suitable lipid acyltransferases for use in accordance with the
present invention and/or in the methods of the present invention
may comprise any one of the following amino acid sequences and/or
be encoded by the following nucleotide sequences: a polynucleotide
encoding a lipid acyltransferase according to the present invention
(SEQ ID No. 62); an amino acid sequence of a lipid acyltransferase
according to the present invention (SEQ ID No. 63); a
polynucleotide encoding a lipid acyltransferase according to the
present invention (SEQ ID No. 90).
A suitable lipid acyl-transferase enzyme for use in the methods of
the invention may also be identified by alignment to the L131 (SEQ
ID No. 76) sequence using Align X, the Clustal W pairwise alignment
algorithm of Vector NTI using default settings.
An alignment of the L131 and homologues from S. avermitilis and T.
fusca illustrates that the conservation of the GDSx motif (GDSY
(SEQ ID NO: 17) in L131 and S. avermitilis and T. fusca), the GANDY
(SEQ ID NO: 15) box, which is either GGNDA (SEQ ID NO: 16) or GGNDL
(SEQ ID NO: 18), and the HPT block (considered to be the conserved
catalytic histadine). These three conserved blocks are highlighted
in FIG. 103.
When aligned to either the pfam Pfam00657 consensus sequence and/or
the L131 sequence herein disclosed (SEQ ID No 76) it is possible to
identify three conserved regions, the GDSx block, the GANDY (SEQ ID
NO: 15) block and the HTP block.
When aligned to either the pfam Pfam00657 consensus sequence and/or
the L131 sequence herein disclosed (SEQ ID No 76) i) The lipid
acyl-transferase enzyme of the invention, or for use in methods of
the invention, has preferably a GDSx motif, more preferably a GDSx
motif selected from GDSL (SEQ ID NO: 14) or GDSY (SEQ ID NO: 17)
motif. and/or ii) The lipid acyl-transferase enzyme of the
invention, or for use in methods of the invention, has preferably a
GANDY (SEQ ID NO: 15) block, more preferably a GANDY (SEQ ID NO:
15) block comprising amino GGNDx (SEQ ID NO: 19), more preferably
GGNDA (SEQ ID NO: 16) or GGNDL (SEQ ID NO: 18). and/or iii) The
enzyme of the invention, or for use in methods of the invention,
has preferable an HTP block. and preferably iv) The lipid
acyl-transferase enzyme of the invention, or for use in methods of
the invention, has preferably a GDSx or GDSY (SEQ ID NO: 17) motif,
and a GANDY (SEQ ID NO: 15) block comprising amino GGNDx (SEQ ID
NO: 19), preferably GGNDA (SEQ ID NO: 16) or GGNDL (SEQ ID NO: 18),
and a HTP block (conserved histadine). Variant Lipid Acyl
Transferase
In a preferred embodiment the lipid acyl transferase is a variant
lipid acyl transferase. Suitable methods for the production of
lipid acyl transferases for use in the invention are disclosed in
WO2005/066347. Variants which have an increased activity on
phospholipids, such as increased hydrolytic activity and/or
increased transferase, preferably increased transferase activity on
phospholipids.
Preferably the variant lipid acyltransferase is prepared by one or
more amino acid modifications of the lipid acyl transferases as
herein defined.
Suitably, when the lipid acyltransferase for use in the methods or
uses of the present invention, may be a variant lipid
acyltransferase, in which case the enzyme may be characterised in
that the enzyme comprises the amino acid sequence motif GDSX,
wherein X is one or more of the following amino acid residues L, A,
V, I, F, Y, H, Q, T, N, M or S, and wherein the variant enzyme
comprises one or more amino acid modifications compared with a
parent sequence at any one or more of the amino acid residues
defined in set 2 or set 4 or set 6 or set 7 (as defined
WO2005/066347 and hereinbelow).
For instance the variant lipid acyltransferase enzyme for use in
the methods or uses of the present invention may be characterised
in that the enzyme comprises the amino acid sequence motif GDSX,
wherein X is one or more of the following amino acid residues L, A,
V, I, F, Y, H, Q, T, N, M or S, and wherein the variant enzyme
comprises one or more amino acid modifications compared with a
parent sequence at any one or more of the amino acid residues
detailed in set 2 or set 4 or set 6 or set 7 (as defined in
WO2005/066347 and hereinbelow) identified by said parent sequence
being structurally aligned with the structural model of P10480
defined herein, which is preferably obtained by structural
alignment of P10480 crystal structure coordinates with 1IVN.PDB
and/or 1DEO.PDB as defined WO2005/066347 and hereinbelow.
In a further embodiment the variant lipid acyltransferase enzyme
for use in the methods or uses of the present invention may be
characterised in that the enzyme comprises the amino acid sequence
motif GDSX, wherein X is one or more of the following amino acid
residues L, A, V, I, F, Y, H, Q, T, N, M or S, and wherein the
variant enzyme comprises one or more amino acid modifications
compared with a parent sequence at any one or more of the amino
acid residues taught in set 2 identified when said parent sequence
is aligned to the pfam consensus sequence (SEQ ID No. 1--FIG. 2)
and modified according to a structural model of P10480 to ensure
best fit overlap as defined WO2005/066347 and hereinbelow.
Suitably the variant lipid acyltransferase enzyme may comprise an
amino acid sequence, which amino acid sequence is shown as SEQ ID
No. 73, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ
ID No. 6, SEQ ID No. 12, SEQ ID No. 65, SEQ ID No. 22, SEQ ID No.
24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ
ID No. 34, SEQ ID No. 36, SEQ ID No. 89, SEQ ID No. 66, SEQ ID No.
67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID No. 71, or SEQ ID No. 72
except for one or more amino acid modifications at any one or more
of the amino acid residues defined in set 2 or set 4 or set 6 or
set 7 (as defined WO2005/066347 and hereinbelow) identified by
sequence alignment with SEQ ID No. 73.
Alternatively the variant lipid acyltransferase enzyme may be a
variant enzyme comprising an amino acid sequence, which amino acid
sequence is shown as SEQ ID No. 73, SEQ ID No. 2, SEQ ID No. 3, SEQ
ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 65,
SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID
No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 89,
SEQ ID No. 66, SEQ ID No. 67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID
No. 71, or SEQ ID No. 72 except for one or more amino acid
modifications at any one or more of the amino acid residues defined
in set 2 or set 4 or set 6 or set 7 as defined WO2005/066347 and
hereinbelow, identified by said parent sequence being structurally
aligned with the structural model of P10480 defined herein, which
is preferably obtained by structural alignment of P10480 crystal
structure coordinates with 1IVN.PDB and/or 1DEO.PDB as taught
within WO2005/066347 and hereinbelow.
Alternatively, the variant lipid acyltransferase enzyme may be a
variant enzyme comprising an amino acid sequence, which amino acid
sequence is shown as SEQ ID No. 73, SEQ ID No. 2, SEQ ID No. 3, SEQ
ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 89,
SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID
No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 89,
SEQ ID No. 66, SEQ ID No. 67, SEQ ID No. 68, SEQ ID No. 69, SEQ ID
No. 71, or SEQ ID No. 72 except for one or more amino acid
modifications at any one or more of the amino acid residues taught
in set 2 identified when said parent sequence is aligned to the
pfam consensus sequence (SEQ ID No. 1) and modified according to a
structural model of P10480 to ensure best fit overlap as taught
within WO2005/066347 and hereinbelow.
Preferably, the parent enzyme is an enzyme which comprises, or is
homologous to, the amino acid sequence shown as SEQ ID No. 73
and/or SEQ ID No. 34 and/or SEQ ID No. 74.
Preferably, the variant enzyme is an enzyme which comprises an
amino acid sequence, which amino acid sequence is shown as SEQ ID
No. 73 or SEQ ID No. 74 except for one or more amino acid
modifications at any one or more of the amino acid residues defined
in set 2 or set 4 or set 6 or set 7 as defined in WO2005/066347 and
hereinbelow.
DEFINITION OF SETS
Amino Acid Set 1:
Amino acid set 1 (note that these are amino acids in 1IVN --FIG. 53
and FIG. 54) Gly8, Asp9, Ser10, Leu11, Ser12, Tyr15, Gly44, Asp45,
Thr46, Glu69, Leu70, Gly71, Gly72, Asn73, Asp74, Gly75, Leu76,
Gln106, Ile107, Arg108, Leu109, Pro110, Tyr113, Phe121, Phe139,
Phe140, Met141, Tyr145, Met151, Asp154, His157, Gly155, Ile156,
Pro158
The highly conserved motifs, such as GDSx and catalytic residues,
were deselected from set 1 (residues underlined). For the avoidance
of doubt, set 1 defines the amino acid residues within 10 .ANG. of
the central carbon atom of a glycerol in the active site of the
1IVN model.
Amino Acid Set 2:
Amino acid set 2 (note that the numbering of the amino acids refers
to the amino acids in the P10480 mature sequence) Leu17, Lys22,
Met23, Gly40, Asn80, Pro81, Lys82, Asn87, Asn88, Trp111, Val112,
Ala114, Tyr117, Leu118, Pro156, Gly159, Gln160, Asn161, Pro162,
Ser163, Ala164, Arg165, Ser166, Gln167, Lys168, Val169, Val170,
Glu171, Ala172, Tyr179, His180, Asn181, Met209, Leu210, Arg211,
Asn215, Lys284, Met285, Gln289 and Val290.
Table of selected residues in Set 1 compared with Set 2:
TABLE-US-00002 IVN model P10480 A.hyd homologue Mature sequence IVN
PFAM Structure Residue Number Gly8 Gly32 Asp9 Asp33 Ser10 Ser34
Leu11 Leu35 Leu17 Ser12 Ser36 Ser18 Lys22 Met23 Tyr15 Gly58 Gly40
Gly44 Asn98 Asn80 Asp45 Pro99 Pro81 Thr46 Lys100 Lys82 Asn87 Asn88
Glu69 Trp129 Trp111 Leu70 Val130 Val112 Gly71 Gly131 Gly72 Ala132
Ala114 Asn73 Asn133 Asp74 Asp134 Gly75 Tyr135 Tyr117 Leu76 Leu136
Leu118 Gln106 Pro174 Pro156 Ile107 Gly177 Gly159 Arg108 Gln178
Gln160 Leu109 Asn179 Asn161 Pro110 180 to 190 Pro162 Tyr113 Ser163
Ala164 Arg165 Ser166 Gln167 Lys168 Val169 Val170 Glu171 Ala172
Phe121 His198 Tyr197 Tyr179 His198 His180 Asn199 Asn181 Phe139
Met227 Met209 Phe140 Leu228 Leu210 Met141 Arg229 Arg211 Tyr145
Asn233 Asn215 Lys284 Met151 Met303 Met285 Asp154 Asp306 Gly155
Gln307 Gln289 Ile156 Val308 Val290 His157 His309 Pro158 Pro310
Amino Acid Set 3:
Amino acid set 3 is identical to set 2 but refers to the Aeromonas
salmonicida (SEQ ID No. 3) coding sequence, i.e. the amino acid
residue numbers are 18 higher in set 3 as this reflects the
difference between the amino acid numbering in the mature protein
(SEQ ID No. 73) compared with the protein including a signal
sequence (SEQ ID No. 36).
The mature proteins of Aeromonas salmonicida GDSX (SEQ ID No. 3)
and Aeromonas hydrophila GDSX (SEQ ID No. 73) differ in five amino
acids. These are Thr3Ser, Gln182Lys, Glu309Ala, Ser310Asn, Gly318-,
where the salmonicida residue is listed first and the hydrophila
residue is listed last. The hydrophila protein is only 317 amino
acids long and lacks a residue in position 318. The Aeromonas
salmonicidae GDSX has considerably high activity on polar lipids
such as galactolipid substrates than the Aeromonas hydrophila
protein. Site scanning was performed on all five amino acid
positions.
Amino Acid Set 4:
Amino acid set 4 is S3, Q182, E309, S310, and -318.
Amino Acid Set 5:
F13S, D15N, S18G, S18V, Y30F, D116N, D116E, D157 N, Y226F, D228N
Y230F.
Amino Acid Set 6:
Amino acid set 6 is Ser3, Leu17, Lys22, Met23, Gly40, Asn80, Pro81,
Lys82, Asn 87, Asn88, Trp111, Val112, Ala114, Tyr117, Leu118,
Pro156, Gly159, Gln160, Asn161, Pro162, Ser163, Ala164, Arg165,
Ser166, Gln167, Lys168, Val169, Val170, Glu171, Ala172, Tyr179,
His180, Asn181, Gln182, Met209, Leu210, Arg211, Asn215, Lys284,
Met285, Gln289, Val290, Glu309, Ser310, -318.
The numbering of the amino acids in set 6 refers to the amino acids
residues in P10480 (SEQ ID No. 36) --corresponding amino acids in
other sequence backbones can be determined by homology alignment
and/or structural alignment to P10480 and/or 1IVN.
Amino Acid Set 7:
Amino acid set 7 is Ser3, Leu17, Lys22, Met23, Gly40, Asn80, Pro81,
Lys82, Asn 87, Asn88, Trp111, Val112, Ala114, Tyr117, Leu118,
Pro156, Gly159, Gln160, Asn161, Pro162, Ser163, Ala164, Arg165,
Ser166, Gln167, Lys168, Val69, Val170, Glu171, Ala172, Tyr179,
His180, Asn181, Gln182, Met209, Leu210, Arg211, Asn215, Lys284,
Met285, Gln289, Val290, Glu309, Ser310, -318, Y30X (where X is
selected from A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V, or
W), Y226X (where X is selected from A, C, D, E, G, H, I, K, L, M,
N, P, Q, R, S, T, V, or W), Y230X (where X is selected from A, C,
D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V, or W), S18X (where X
is selected from A, C, D, E, F, H, I, K, L, M, N, P, Q, R, T, W or
Y), D157X (where X is selected from A, C, E, F, G, H, I, K, L, M,
P, Q, R, S, T, V, W or Y).
The numbering of the amino acids in set 7 refers to the amino acids
residues in P10480 (SEQ ID No. 36) --corresponding amino acids in
other sequence backbones can be determined by homology alignment
and/or structural alignment to P10480 and/or 1IVN).
Suitably, the variant enzyme comprises one or more of the following
amino acid modifications compared with the parent enzyme: S3E, A,
G, K, M, Y, R, P, N, T or G E309Q, R or A, preferably Q or R -318Y,
H, S or Y, preferably Y.
Preferably, X of the GDSX motif is L. Thus, preferably the parent
enzyme comprises the amino acid motif GDSL (SEQ ID NO: 14).
Suitably, said first parent lipid acyltransferase may comprise any
one of the following amino acid sequences: SEQ ID No. 73, SEQ ID
No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ
ID No. 12, SEQ ID No. 65, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No.
26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ
ID No. 36, SEQ ID No. 89, SEQ ID No. 66, SEQ ID No. 67, SEQ ID No.
68, SEQ ID No. 69, SEQ ID No. 71 or SEQ ID No. 72.
Suitably, said second related lipid acyltransferase may comprise
any one of the following amino acid sequences: SEQ ID No. 2, SEQ ID
No. 73, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ
ID No. 12, SEQ ID No. 65, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No.
26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ
ID No. 36, SEQ ID No. 89, SEQ ID No. 66, SEQ ID No. 67, SEQ ID No.
68, SEQ ID No. 69, SEQ ID No. 71 or SEQ ID No. 72.
The variant enzyme must comprise at least one amino acid
modification compared with the parent enzyme. In some embodiments,
the variant enzyme may comprise at least 2, preferably at least 3,
preferably at least 4, preferably at least 5, preferably at least
6, preferably at least 7, preferably at least 8, preferably at
least 9, preferably at least 10 amino acid modifications compared
with the parent enzyme.
When referring to specific amino acid residues herein the numbering
is that obtained from alignment of the variant sequence with the
reference sequence shown as SEQ ID No. 73 or SEQ ID No. 74.
In one aspect preferably the variant enzyme comprises one or more
of the following amino acid substitutions: S3A, C, D, E, F, G, H,
I, K, L, M, N, P, Q, R, T, V, W, or Y; and/or L17A, C, D, E, F, G,
H, I, K, M, N, P, Q, R, S, T, V, W, or Y; and/or S18A, C, D, E, F,
H, I, K, L, M, N, P, Q, R, T, W, or Y; and/or K22A, C, D, E, F, G,
H, I, L, M, N, P, Q, R, S, T, V, W, or Y; and/or M23A, C, D, E, F,
G, H, I, K, L, N, P, Q, R, S, T, V, W, or Y; and/or Y30A, C, D, E,
G, H, I, K, L, M, N, P, Q, R, S, T, V, or W; and/or G40A, C, D, E,
F, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; and/or N80A, C, D,
E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W, or Y; and/or P81A, C,
D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W, or Y; and/or K82A,
C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, or Y; and/or
N87A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W, or Y;
and/or N88A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W, or
Y; and/or W111A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V,
W or Y; and/or V112A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S,
T, W, or Y; and/or A114C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S,
T, V, W, or Y; and/or Y 117A, C, D, E, F, G, H, I, K, L, M, N, P,
Q, R, S, T, V, or W; and/or L118A, C, D, E, F, G, H, I, K, M, N, P,
Q, R, S, T, V, W, or Y; and/or P156A, C, D, E, F, G, H, I, K, L, M,
N, Q, R, S, T, V, W, or Y; and/or D157A, C, E, F, G, H, I, K, L, M,
P, Q, R, S, T, V, W, or Y; and/or G159A, C, D, E, F, H, I, K, L, M,
N, P, Q, R, S, T, V, W, or Y; and/or Q160A, C, D, E, F, G, H, I, K,
L, M, N, P, R, S, T, V, W, or Y; and/or N161A, C, D, E, F, G, H, I,
K, L, M P, Q, R, S, T, V, W, or Y; and/or P162A, C, D, E, F, G, H,
I, K, L, M, N, Q, R, S, T, V, W, or Y; and/or S163A, C, D, E, F, G,
H, I, K, L, M, N, P, Q, R, T, V, W, or Y; and/or A164C, D, E, F, G,
H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; and/or R165A, C, D, E,
F, G, H, I, K, L, M, N, P, Q, S, T, V, W, or Y; and/or S166A, C, D,
E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W, or Y; and/or Q167A, C,
D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W, or Y; and/or K168A,
C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, or Y; and/or
V169A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W, or Y;
and/or V170A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W, or
Y; and/or E171A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W,
or Y; and/or A172C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V,
W, or Y; and/or Y179A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S,
T, V, or W; and/or H180A, C, D, E, F, G, I, K, L, M, P, Q, R, S, T,
V, W, or Y; and/or N181A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S,
T, V, W, or Y; and/or Q182A, C, D, E, F, G, H, I, K, L, M, N, P, R,
S, T, V, W, or Y, preferably K; and/or M209A, C, D, E, F, G, H, I,
K, L, N, P, Q, R, S, T, V, W, or Y; and/or L210 A, C, D, E, F, G,
H, I, K, M, N, P, Q, R, S, T, V, W, or Y; and/or R211A, C, D, E, F,
G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; and/or N215 A, C,
D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y; and/or
Y226A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V, or W; and/or
Y230A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; and/or
K284A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, or Y;
and/or M285A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W, or
Y; and/or Q289A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W,
or Y; and/or V290A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T,
W, or Y; and/or E309A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T,
V, W, or Y; and/or S310A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R,
T, V, W, or Y.
In addition or alternatively thereto there may be one or more
C-terminal extensions. Preferably the additional C-terminal
extension is comprised of one or more aliphatic amino acids,
preferably a non-polar amino acid, more preferably of I, L, V or G.
Thus, the present invention further provides for a variant enzyme
comprising one or more of the following C-terminal extensions:
318I, 318L, 318V, 318G.
Preferred variant enzymes may have a decreased hydrolytic activity
against a phospholipid, such as phosphatidylcholine (PC), may also
have an increased transferase activity from a phospholipid.
Preferred variant enzymes may have an increased transferase
activity from a phospholipid, such as phosphatidylcholine (PC),
these may also have an increased hydrolytic activity against a
phospholipid.
Modification of one or more of the following residues may result in
a variant enzyme having an increased absolute transferase activity
against phospholipid: S3, D157, S310, E309, Y179, N215, K22, Q289,
M23, H180, M209, L210, R211, P81, V112, N80, L82, N88; N87
Specific preferred modifications which may provide a variant enzyme
having an improved transferase activity from a phospholipid may be
selected from one or more of the following: S3A, C, D, E, F, G, H,
I, K, L, M, N, P, Q, R, T, V, W or Y; preferably N, E, K, R, A, P
or M, most preferably S3A D157A, C, E, F, G, H, I, K, L, M, N, P,
Q, R, S, T, V, W or Y; preferably D157S, R, E, N, G, T, V, Q, K or
C S310A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y;
preferably S310T -318 E E309A, C, D, E, F, G, H, I, K, L, M, N, P,
Q, R, T, V, W or Y; preferably E309 R, E, L, R or A Y179A, C, D, E,
F, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; preferably Y179 D,
T, E, R, N, V, K, Q or S, more preferably E, R, N, V, K or Q N215A,
C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; preferably
N215 S, L, R or Y K22A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S,
T, V, W or Y; preferably K22 E, R, C or A Q289A, C, D, E, F, G, H,
I, K, L, M, N, P, R, S, T, V, W or Y; preferably Q289 R, E, G, P or
N M23A, C, D, E, F, G, H, I, K, L N, P, Q, R, S, T, V, W or Y;
preferably M23 K, Q, L, G, T or S H180A, C, D, E, F, G, I, K, L, M,
P, Q, R, S, T, V, W or Y; preferably H180 Q, R or K M209 A, C, D,
E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y; preferably M209
Q, S, R, A, N, Y, E, V or L L210A, C, D, E, F, G, H, I, K, M, N, P,
Q, R, S, T, V, W or Y; preferably L210 R, A, V, S, T, I, W or M
R21A, C, D, E, F, G, H, I, K, L, M, N, P, Q, S, T, V, W or Y;
preferably R211T P81A, C, D, E, F, G, H, I, K, L, M, N, Q, R, S, T,
V, W or Y; preferably P81G V112A, C, D, E, F, G, H, I, K, L, M, N,
P, Q, R, S, T, W or Y; preferably V112C N80A, C, D, E, F, G, H, I,
K, L, M, P, Q, R, S, T, V, W or Y; preferably N80 R, G, N, D, P, T,
E, V, A or G L82A, C, D, E, F, G, H, I, M, N, P, Q, R, S, T, V, W
or Y; preferably L82N, S or E N88A, C, D, E, F, G, H, I, K, L, M,
P, Q, R, S, T, V, W or Y; preferably N88C N87A, C, D, E, F, G, H,
I, K, L, M, P, Q, R, S, T, V, W or Y; preferably N87M or G
Preferred modification of one or more of the following residues
results in a variant enzyme having an increased absolute
transferase activity against phospholipid: S3N, R, A, G M23 K, Q,
L, G, T, S H180 R L82 G Y179 E, R, N, V, K or Q E309R, S, L or
A
One preferred modification is N80D. This is particularly the case
when using the reference sequence SEQ ID No. 74. Therefore in a
preferred embodiment of the present invention the lipid
acyltransferase according to the present invention comprises SEQ ID
No. 74. or an amino acid sequence which has 75% or more, preferably
85% or more, more preferably 90% or more, even more preferably 95%
or more, even more preferably 98% or more, or even more preferably
99% or more identity to SEQ ID No. 74.
As noted above, when referring to specific amino acid residues
herein the numbering is that obtained from alignment of the variant
sequence with the reference sequence shown as SEQ ID No. 73 or SEQ
ID No. 74.
Much by preference, the lipid acyltransferase for use in the method
and uses of the present invention may be a lipid acyltransferase
comprising the amino acid sequence shown as SEQ ID No. 62 or the
amino acid sequence shown as SEQ ID No. 90, or an amino acid
sequence which has 75% or more, preferably 85% or more, more
preferably 90% or more, even more preferably 95% or more, even more
preferably 98% or more, or even more preferably 99% or more
identity to SEQ ID No. 62 and/or SEQ ID No. 90. This enzyme may be
considered a variant enzyme.
For the purposes of the present invention, the degree of identity
is based on the number of sequence elements which are the same. The
degree of identity in accordance with the present invention may be
suitably determined by means of computer programs known in the art,
such as GAP provided in the GCG program package (Program Manual for
the Wisconsin Package, Version 8, August 1994, Genetics Computer
Group, 575 Science Drive, Madison, Wis., US 53711) (Needleman &
Wunsch (1970), J. of Molecular Biology 48, 443-45) using the
following settings for polypeptide sequence comparison: GAP
creation penalty of 3.0 and GAP extension penalty of 0.1. Suitably,
the degree of identity with regard to an amino acid sequence is
determined over at least 20 contiguous amino acids, preferably over
at least 30 contiguous amino acids, preferably over at least 40
contiguous amino acids, preferably over at least 50 contiguous
amino acids, preferably over at least 60 contiguous amino
acids.
Suitably, the lipid acyltransferase/lipid acyl transferase enzyme
according to the present invention may be obtainable, preferably
obtained, from organisms from one or more of the following genera:
Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium,
Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus,
Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus,
Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia,
Xanthomonas, Candida, Thermobifida and Corynebacterium.
Suitably, the lipid acyltransferase/lipid acyl transferaseenzyme
according to the present invention may be obtainable, preferably
obtained, from one or more of the following organisms: Aeromonas
hydrophila, Aeromonas salmonicida, Streptomyces coelicolor,
Streptomyces rimosus, Mycobacterium, Streptococcus pyogenes,
Lactococcus lactis, Streptococcus pyogenes, Streptococcus
thermophilus, Streptomyces thermosacchari, Streptomyces avermitilis
Lactobacillus helveticus, Desulfitobacterium dehalogenans,
Bacillussp, Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa,
Sulfolobus solfataricus, Saccharomyces cerevisiae, Aspergillus
terreus, Schizosaccharomyces pombe, Listeria innocua, Listeria
monocytogenes, Neisseria meningitidis, Mesorhizobium loti,
Ralstonia solanacearum, Xanthomonas campestris, Xanthomonas
axonopodis, Candida parapsilosis Thermobifida fusca and
Corynebacterium efficiens.
In one aspect, preferably the lipid acyl transferase enzyme
according to the present invention is obtainable, preferably
obtained or derived from one or more of Aeromonas spp., Aeromonas
hydrophila or Aeromonas salmonicida.
Preferably, when carrying out a method according to the present
invention the product is produced without increasing or
substantially increasing the free fatty acids in the foodstuff.
The term "transferase" as used herein is interchangeable with the
term "lipid acyltransferase".
Suitably, the lipid acyltransferase as defined herein catalyses one
or more of the following reactions: interesterification,
transesterification, alcoholysis, hydrolysis.
The term "interesterification" refers to the enzymatic catalysed
transfer of acyl groups between a lipid donor and lipid acceptor,
wherein the lipid donor is not a free acyl group.
The term "transesterification" as used herein means the enzymatic
catalysed transfer of an acyl group from a lipid donor (other than
a free fatty acid) to an acyl acceptor (other than water).
As used herein, the term "alcoholysis" refers to the enzymatic
cleavage of a covalent bond of an acid derivative by reaction with
an alcohol ROH so that one of the products combines with the H of
the alcohol and the other product combines with the OR group of the
alcohol.
As used herein, the term "alcohol" refers to an alkyl compound
containing a hydroxyl group.
As used herein, the term "hydrolysis" refers to the enzymatic
catalysed transfer of an acyl group from a lipid to the OH group of
a water molecule. Acyl transfer which results from hydrolysis
requires the separation of the water molecule.
The term "without increasing or without substantially increasing
the free fatty acids" as used herein means that preferably the
lipid acyl transferase according to the present invention has 100%
transferase activity (i.e. transfers 100% of the acyl groups from
an acyl donor onto the acyl acceptor, with no hydrolytic activity);
however, the enzyme may transfer less than 100% of the acyl groups
present in the lipid acyl donor to the acyl acceptor. In which
case, preferably the acyltransferase activity accounts for at least
5%, more preferably at least 10%, more preferably at least 20%,
more preferably at least 30%, more preferably at least 40%, more
preferably 50%, more preferably at least 60%, more preferably at
least 70%, more preferably at least 80%, more preferably at least
90% and more preferably at least 98% of the total enzyme activity.
The % transferase activity (i.e. the transferase activity as a
percentage of the total enzymatic activity) may be determined by
the following protocol:
Protocol for the Determination of % Acyltransferase Activity:
A foodstuff to which a lipid acyltransferase according to the
present invention has been added may be extracted following the
enzymatic reaction with CHCl.sub.3:CH.sub.3OH 2:1 and the organic
phase containing the lipid material is isolated and analysed by GLC
and HPLC according to the procedure detailed hereinbelow. From the
GLC and HPLC analyses the amount of free fatty acids and one or
more of sterol/stanol esters; carbohydrate esters, protein esters;
diglycerides; or monoglycerides are determined. A control foodstuff
to which no enzyme according to the present invention has been
added, is analysed in the same way.
Calculation:
From the results of the GLC and HPLC analyses the increase in free
fatty acids and sterol/stanol esters and/or carbohydrate esters
and/or protein esters and/or diglycerides and/or monoglycerides can
be calculated: .DELTA. % fatty acid=% Fatty acid(enzyme)-% fatty
acid(control); Mv fatty acid=average molecular weight of the fatty
acids; A=.DELTA. % sterol ester/Mv sterol ester (where .DELTA. %
sterol ester=% sterol/stanol ester(enzyme)-% sterol/stanol
ester(control) and Mv sterol ester=average molecular weight of the
sterol/stanol esters)-applicable where the acyl acceptor is a
sterol and/or stanol; B=.DELTA. % carbohydrate ester/Mv
carbohydrate ester (where .DELTA. % carbohydrate ester=%
carbohydrate ester(enzyme)-% carbohydrate ester(control) and Mv
carbohydrate ester=average molecular weight of the carbohydrate
ester)-applicable where the acyl acceptor is a carbohydrate;
C=.DELTA. % protein ester/Mv protein ester (where .DELTA. % protein
ester=% protein ester(enzyme)-% protein ester(control) and Mv
protein ester=average molecular weight of the protein
ester)-applicable where the acyl acceptor is a protein; and
D=absolute value of diglyceride and/or monoglyceride/Mv
di/monoglyceride (where .DELTA. % diglyceride and/or
monoglyceride=% diglyceride and/or monoglyceride (enzyme)-%
diglyceride and/or monoglyceride (control) and Mv
di/monoglyceride=average molecular weight of the diglyceride and/or
monoglyceride)-applicable where the acyl acceptor is glycerol.
The transferase activity is calculated as a percentage of the total
enzymatic activity:
.times..times..times..times..times..DELTA..times..times..times..times..ti-
mes..times..times..times..times..times..times..times..times..times..times.
##EQU00001##
If the free fatty acids are increased in the foodstuff they are
preferably not increased substantially, i.e. to a significant
degree. By this we mean, that the increase in free fatty acid does
not adversely affect the quality of the foodstuff.
In some aspects of the present invention, the term "without
substantially increasing free fatty acids" as used herein means
that the amount of free fatty acid in a foodstuff or composition
treated with an lipid acyltransferase according to the present
invention is less than the amount of free fatty acid produced in
the foodstuff or composition when an enzyme other than a lipid
acyltransferase according to the present invention had been used,
such as for example as compared with the amount of free fatty acid
produced when a conventional phospholipase enzyme, e.g.
LipopanF.RTM. (Novozymes A/S, Denmark), had been used.
The term "in situ" as used herein means that the emulsifier(s)
and/or the sterol/stanol esters and/or the carbohydrate esters
and/or the protein esters and/or the mono- or diglycerides are
produced within the foodstuff or fraction of the foodstuff. This
contrasts the situation where the emulsifier(s) and/or the
sterol/stanol esters and/or the carbohydrate esters and/or the
protein esters and/or the mono- or diglycerides are produced
separately of the foodstuff and are added as formed products to the
foodstuff during preparation of the same. In other words, the term
"in situ" as used herein means that by the addition of the lipid
acyltransferase enzyme according to the present invention to a
foodstuff, or to the food ingredients/materials constituting the
foodstuff, an emulsifier and/or a sterol ester and/or a stanol
ester and/or a carbohydrate ester and/or a protein ester and/or a
mono- or diglyceride may be produced from components of the
foodstuff. Suitably, the components of the foodstuff may be the
substrate(s) for the enzyme. If necessary, the components of the
foodstuff may be supplemented by addition of one or more further
components which further components may be the same as those
present in the foodstuff or may be additional to those components
already present in the foodstuff. For the avoidance of doubt, in
one embodiment, the method according to the present invention may
be a method for the production of an emulsifier and/or a sterol
ester and/or a stanol ester and/or a carbohydrate ester and/or a
protein ester and/or a mono- or diglyceride in situ in a foodstuff
and is not a method for preparing an emulsifier and/or a sterol
ester and/or a stanol ester (for example is an isolated and/or
purified form) for subsequent addition to a foodstuff.
In another embodiment the lipase acyl-transferase may be used
during the food processing, but not remain in the foodstuff. For
example, the lipase acyl transferase may be immobilised, allowing
it to be reused.
Preferably, the lipid acyltransferase according to the present
invention is capable of transferring an acyl group from a lipid to
a sterol and/or stanol and/or a carbohydrate and/or a protein
and/or glycerol when present in a polar environment, preferably in
an aqueous environment, preferably a water containing foodstuff.
Suitably, the aqueous environment may be an aqueous buffer or may
be the aqueous phase in a foodstuff. The term "aqueous environment"
as used herein preferably means an environment which is absent an
organic solvent, preferably absent a polar organic solvent, more
preferably absent an non-edible organic solvent. In particular, the
term "aqueous environment" may refer to an environment to which no
exogenous organic solvents, preferably no polar organic solvents,
have been added. The term organic solvent as used herein does not
encompass food oils, preferably does not encompass food oils that
are high in non-polar lipids. In one embodiment the term organic
solvent may exclude edible organic solvents, such as ethanol,
propylene glycol and/or glycerol. Suitably, the aqueous environment
according to the present invention may comprise less than 80% by
volume organic solvents, less than 70% by volume organic solvents,
less than 50% by volume organic solvents, less than 30% by volume
organic solvents, more preferably less than 15% by volume organic
solvents, more preferably less than 5%. Suitably the foodstuff may
comprise between 1 and 5% organic solvent, for example ethanol.
However, when the foodstuff comprises such an organic solvent,
preferably it is produced endogenously within the foodstuff. That
is to say, when the foodstuff comprises such an organic solvent,
preferably the organic solvent is not an exogenous organic
solvent.
The term "foodstuff" as used herein means a substance which is
suitable for human and/or animal consumption.
Suitably, the term "foodstuff" as used herein may mean a foodstuff
in a form which is ready for consumption. Alternatively or in
addition, however, the term foodstuff as used herein may mean one
or more food materials which are used in the preparation of a
foodstuff. By way of example only, the term foodstuff encompasses
both baked goods produced from dough as well as the dough used in
the preparation of said baked goods. By way of further example, the
term foodstuff encompasses both the final product, i.e. for example
the final diary product such as cheese, as well as the milk (e.g.
cheese milk), the cream and/or the butterfat for example used in
the preparation of the said dairy product (e.g. the cheese).
The term "food material" as used herein means one or more materials
used in the preparation of a foodstuff. The term foodstuff may be
used herein to mean food material and vice versa. In some
embodiments for example the food material may be the final
foodstuff. By way of example only the final foodstuff may be an
edible oil (such as a cooking oil); in such instances the food
material may also be the edible oil. In some embodiments for
example the food material may be one constituent of the final
foodstuff. By way of example only the final foodstuff may be a
dairy product, such as cheese for instance; in such instances the
food material may be milk (e.g. cheese milk), cream and/or
butterfat for example used in the preparation of said diary product
(e.g. the cheese).
When the food material forms only on constituent of the final
foodstuff for instance in some embodiments the final foodstuff may
be comprised of less than 10 wt % of the food material, such as
less than 5 wt %.
In some embodiments, suitably the final foodstuff may be comprised
of from 0.01 to 4 wt % of the food material.
In some embodiments, suitably the final foodstuff may be comprised
of from 0.01 to 2 wt % of the food material.
In some embodiments, suitably the final foodstuff may be comprised
of from 0.01 to 1 wt % of the food material.
In some embodiments, suitably the final foodstuff may be comprised
of from 0.01 to 0.5 wt % of the food material.
In some embodiments, suitably the final foodstuff may be comprised
of from 0.01 to 0.3 wt % of the food material.
In a preferred aspect the present invention provides a foodstuff as
defined above wherein the foodstuff is selected from one or more of
the following: eggs, egg-based products, including but not limited
to mayonnaise, salad dressings, sauces, ice creams, egg powder,
modified egg yolk and products made therefrom; baked goods,
including breads, cakes, sweet dough products, laminated doughs,
liquid batters, muffins, doughnuts, biscuits, crackers and cookies;
confectionery, including chocolate, candies, caramels, halawa,
gums, including sugar free and sugar sweetened gums, bubble gum,
soft bubble gum, chewing gum and puddings; frozen products
including sorbets, preferably frozen dairy products, including ice
cream and ice milk; dairy products, including cheese, butter, milk,
coffee cream, whipped cream, custard cream, milk drinks and
yoghurts; mousses, whipped vegetable creams, meat products,
including processed meat products; edible oils and fats, aerated
and non-aerated whipped products, oil-in-water emulsions,
water-in-oil emulsions, margarine, shortening and spreads including
low fat and very low fat spreads; dressings, mayonnaise, dips,
cream based sauces, cream based soups, beverages, spice emulsions
and sauces.
Suitably the foodstuff in accordance with the present invention may
be a "fine foods", including cakes, pastry, confectionery,
chocolates, fudge and the like.
In one aspect the foodstuff in accordance with the present
invention may be a dough product or a baked product, such as a
bread, a fried product, a snack, cakes, pies, brownies, cookies,
noodles, snack items such as crackers, graham crackers, pretzels,
and potato chips, and pasta.
In a further aspect, the foodstuff in accordance with the present
invention may be a plant derived food product such as flours,
pre-mixes, oils, fats, cocoa butter, coffee whitener, salad
dressings, margarine, spreads, peanut butter, shortenings, ice
cream, cooking oils.
In another aspect, the foodstuff in accordance with the present
invention may be a dairy product, including butter, milk, cream,
cheese such as natural, processed, and imitation cheeses in a
variety of forms (including shredded, block, slices or grated),
cream cheese, ice cream, frozen desserts, yoghurt, yoghurt drinks,
butter fat, anhydrous milk fat, other dairy products. The enzyme
according to the present invention may improve fat stability in
dairy products.
As used herein the term `milk` may comprise milk from either animal
or vegetable origin. It is possible to use milk from animal sources
such as buffalo, (traditional) cow, sheep, goat etc. either
individually or combined. Vegetable milks such as soya milk may
also be used. The vegetable milk may be used in combination with
the animal milk, for example at a low percentage (of vegetable
milk) say below 15%, or below 20%, or below 25% v/v. The term milk
may also comprise cheese milk and cream. One advantage of the
present invention is that it may assist the incorporation of soy
milk into cheese production at a higher concentration when blended
with milk from an animal source. Without wishing to be bound by
theory, this may be due to the emulsification properties of soy
milk treated in accordance with the present invention.
In one aspect the foodstuff in accordance with the present
invention may be ice cream.
In one aspect the foodstuff in accordance with the present
invention may be or may comprise cheese or a cheese analogue.
In one embodiment the present invention relates to a method for the
production of cheese using a lipid acyltransferase and/or the use
of a lipid acyltransferase for the production of cheese.
Preferably, the use leads to one or more of the technical effects
in the cheese taught herein.
Suitably, in some embodiments the foodstuff may be a derivative of
the foodstuff in accordance with the present invention. By way of
example only the foodstuff may be a pizza comprising cheese
produced in accordance with the present invention.
In the present application, the term cheese "refers to any kind of
cheese, such as natural cheese, cheese analogues and processed
cheese for example. The cheese may be obtained by any suitable
process known in the art, such as, e.g. by enzymatic coagulation of
the cheese milk and/or cream with rennet, or by acidic coagulation
of the cheese milk and/or cream with food grade acid or acid
produced by lactic acid bacteria growth.
In one embodiment, the cheese manufactured by the process of the
invention is rennet-curd cheese. Rennet is commercially available,
e.g. as Naturene (animal rennet), Chy-maxe (fermentation produced
chymosin), Microlane (Microbial coagulant produced by
fermentation), all from Chr. Hansen A/S, Denmark). The cheese milk
and/or cream may be subjected to a conventional cheese-making
process.
A preferable coagulant is Marzyme.RTM., a pure, microbial
coagulant, provides the benefits of fermentation-produced chymosin
(FPC) without affecting yield or taste.
Processed cheese is preferably manufactured from natural cheese or
cheese analogues by cooking and emulsifying the cheese, such as,
with emulsifying salts (e.g. phosphates and citrate). The process
may further include the addition of spices/condiments.
The term "cheese analogues" refers to cheese-like products which
contain fat (such as, e.g., milk fat (e.g. cream)) as a part of the
composition, and, in which further contain, as part of the
composition, a non-milk constituents, such as, e.g. vegetable oil.
An example of a cheese analogue is cheese base. Cheese analogues
may comprise soya milk or soya protein.
The cheeses produced by the process of the present invention
comprise all varieties of cheese, such as, e.g. Campesino, Chester,
Danbo, Drabant, Herregard, Manchego, Primativo, Provolone, Saint
Paulin, Soft cheese, Svecia, Taleggio, White cheese, including
rennet-curd cheese produced by rennet-coagulation of the cheese
curd; ripened cheeses such as Cheddar, Colby, Edam, Muenster,
Gryere, Emmenthal, Camembert, Parmesan and Romano; fresh cheeses
such as Mozzarella and Feta; acid coagulated cheeses such as cream
cheese, Neufchatel, Quarg, Cottage Cheese and QuesoBlanco; and
pasta filata cheese.
One embodiment relates to the production of pizza cheese by the
process of the invention.
In cheese manufacturing, the coagulation of the casein in milk is
preferably performed in two ways: the so-called rennet-curd and
acid-curd cheese. In cheese production these two types of curds
makes up two major groups of cheese types. Fresh acid-curd cheeses
refer to those varieties of cheese produced by the coagulation of
milk, cream or whey via acidification or a combination of acid and
heat, and which are ready for consumption once the manufacturing
without ripening are completed. Fresh acid-curd cheeses generally
differ from rennet-curd cheese varieties (e.g. Camembert, Cheddar,
Emmenthal) where coagulation normally is induced by the action of
rennet at pH values 6.4-6.6, in that coagulation normally occur
close to the isoelectric point of casein, i.e. e.g. at pH 4.6 or at
higher values when elevated temperatures are used, e.g. in Ricotta
pH 6.0 and 80 C.
In one embodiment of the invention, the cheese belongs to the class
of rennet curd cheeses.
Mozzarella is a member of the so-called pasta filata, or stretched
curd, cheeses which are normally distinguished by a unique
plasticising and kneading treatment of the fresh curd in hot water,
which imparts the finished cheese its characteristic fibrous
structure and melting and stretching properties, cf. e.g.
"Mozzarella and Pizza cheese" by Paul S. Kindstedt, Cheese:
Chemistry, physics and microbiology, Volume 2: Major Cheese groups,
second edition, page 337-341, Chapman & Hall. Pizza cheese as
used herein includes cheeses suitable for pizzas and they are
usually pasta filata/stretched curd cheeses. In one embodiment, the
process of the invention further comprises a heat/stretching
treatment as for pasta filata cheeses, such as for the
manufacturing of Mozzarella.
In one embodiment preferably the cheese according to the present
invention is Mozzarella.
In further embodiments of the invention, the cheese milk is
prepared, totally or in part, from dried milk fractions, such as,
e.g., whole milk powder, skim milk powder, casein, caseinate, total
milk protein or buttermilk powder, or any combination thereof.
In one embodiment, preferably the foodstuff and/or the food
material in accordance with the present invention is butterfat.
In one embodiment, particularly when the foodstuff and/or the food
material treated with the lipid acyltransferase in accordance with
the present invention is butterfat, the enzyme treated butterfat
may be then used to produce a further dairy product (particularly
cheese) and/or margarine or spreads (including low fat and very low
fat spreads).
In one embodiment, the enzyme treated butterfat in accordance with
the present invention may be added to milk (e.g. cheese milk)
and/or cream which may subsequently be used to prepare a further
dairy product, such as cheese for example.
In another embodiment, the foodstuff and/or the food material in
accordance with the present invention may be milk and/or cream.
In one embodiment, particularly when the foodstuff and/or the food
material treated with the lipid acyltransferase in accordance with
the present invention is milk (preferably cheese milk) and/or
cream, the enzyme treated milk and/or cream may be then used to
produce a further dairy product (such as one or more of cheese, ice
cream, frozen desserts, yoghurt, yoghurt drinks for instance,
particularly cheese and/or ice cream).
In one embodiment the foodstuff consists of or comprises a cheese
foodstuff which is heated to above the melting temperature of the
cheese. The use of cheese prepared in accordance with the invention
in foodstuffs which are heated can lead to a reduced oiling off
effect from the cheese. There may also be beneficial texture and
flavour benefits in using cheese or cheese products prepared
according to the present invention.
The present invention further relates to use of the cheese produced
by the process of the present invention in pizza, ready-to-eat
dishes, such as lasagna or processed cheese, or as an ingredient in
other food products. Accordingly, the cheese produced according to
the process of the invention may be used in further processed food
products like processed cheese, pizza, burgers, toast, sauces,
dressings, cheese powder, or cheese flavours.
In further embodiments, the process of the invention further
comprises the step of subjecting the cheese, or foodstuff
comprising the cheese, prepared in accordance with the present
invention to a heating treatment, such as for example in the range
of about 150-350.degree. C., or in the range of about
155-345.degree. C., or in the range of about 160-340.degree. C. or
in the range of about 170-330.degree. C. or in the range of about
180-320.degree. C. or in the range of about 200-300.degree. C.
Suitably the heating treatment may be for at least 2 minutes such
as at least 5 minutes, including at least 10 minutes.
In one aspect of the present invention the cheese produced in
accordance with the present invention has a melting temperature
which does not significantly differ from that of a control cheese
(i.e. one which has not been produced using a lipid
acyltransferase).
In another aspect of the present invention the cheese produced in
accordance with the present invention has a texture and consistency
which is similar to (if not better than) that of a control cheese
(i.e. one which has not been produced using a lipid
acyltransferase).
It is particularly advantageous to utilise the present invention in
cheese as the production of free fatty acids in cheese is
associated with a "soapy" taste. Thus, the use of a lipid
acyltransferase in accordance with the present invention
advantageously produces cheese without a "soapy" taste.
The reduced "soapy" taste and/or reduced off-flavours and off-taste
associated with the use of a lipid acyltransferase in accordance
with the present invention provides a significant advantage
compared with the use of a standard lipase and/or phospholipase
(such as Lecitase.TM. for example). The reduced off-flavours and
off-taste may advantageously be the result of a reduction in the
production of free fatty acids during the enzyme reactions. Fatty
acids enzymatically removed by the lipid acyltransferase from the
acyl donor are transferred to an acyl acceptor molecule, and thus
do not accumulate in the cheese.
In another aspect, the foodstuff in accordance with the present
invention may be a food product containing animal derived
ingredients, such as processed meat products, cooking oils,
shortenings.
In a further aspect, the foodstuff in accordance with the present
invention may be a beverage, a fruit, mixed fruit, a vegetable or
wine. In some cases the beverage may contain up to 20 g/l of added
phytosterols.
In another aspect, the foodstuff in accordance with the present
invention may be an animal feed. The animal feed may be enriched
with phytosterol and/or phytostanols, preferably with
beta-sitosterol/stanol. Suitably, the animal feed may be a poultry
feed. When the foodstuff is poultry feed, the present invention may
be used to lower the cholesterol content of eggs produced by
poultry fed on the foodstuff according to the present
invention.
In one aspect preferably the foodstuff is selected from one or more
of the following: eggs, egg-based products, including mayonnaise,
salad dressings, sauces, ice cream, egg powder, modified egg yolk
and products made therefrom.
Preferably the foodstuff according to the present invention is a
water containing foodstuff. Suitably the foodstuff may be comprised
of 10-98% water, suitably 14-98%, suitably of 18-98% water,
suitably of 20-98%, suitably of 40-98%, suitably of 50-98%,
suitably of 70-98%, suitably of 75-98%.
For some aspects, preferably the foodstuff in accordance with the
present invention is not a pure plant derived oil, such as olive
oil, sunflower oil, peanut oil, rapeseed oil for instance. For the
avoidance of doubt, in some aspects of the present invention the
foodstuff according to the present invention may comprise an oil,
but preferably the foodstuff is not primarily composed of oil or
mixtures of oil. For some aspects, preferably the foodstuff
comprises less than 95% lipids, preferably less than 90% lipids,
preferably less than 85%, preferably less than 80% lipids. Thus,
for some aspects of the present invention oil may be a component of
the foodstuff, but preferably the foodstuff is not an oil per
se.
The claims of the present invention are to be construed to include
each of the foodstuffs listed above.
When it is the case that a carbohydrate ester is produced in
accordance with the present invention, the carbohydrate ester is
preferably an oligosaccharide ester, a monosaccharide ester or a
disaccharide ester.
Suitably, the carbohydrate ester when produced in accordance with
the present invention may be one or more of the following: glucose
ester, fructose ester, anhydrofructose ester, maltose ester,
lactose ester, galactose ester, xylose ester, xylooligosaccharide
ester, arabinose ester, maltooligosaccharide ester, tagatose ester,
sucrose ester, microthecin ester, ascopyrone P ester, ascopyrone T
ester or cortalcerone ester.
Preferably, the carbohydrate ester when produced in accordance with
the present invention is one or more of the following: a
carbohydrate mono-ester, a sugar mono-ester, an oligosaccharide
mono-ester, a trisaccharide mono-ester, a disaccharide mono-ester,
a monosaccharide mono-ester, a glucose mono-ester, a fructose
mono-ester, anhydrofructose mono-ester, maltose mono-ester, lactose
mono-ester, galactose mono-ester, xylose mono-ester,
xylooligosacchride mono-ester, arabinose mono-ester,
maltooligosaccharide mono-ester, tagatose mono-ester, sucrose
mono-ester, microthecin ester, ascopyrone P ester, ascopyrone T
ester or cortalcerone ester.
In one embodiment, the microthecin ester, ascopyrone P ester,
ascopyrone T ester and/or cortalcerone ester may function as an
antimicrobial agent. Alternatively or in addition thereto, the
microthecin ester, ascopyrone P ester, ascopyrone T ester and/or
cortalcerone ester may function as one or both of an antioxidant
and/or emulsifier.
Preferably, the formation of the carbohydrate ester (if any) in
accordance with the present invention is independent of
UDP-glucose.
Preferably, the foodstuff according to the present invention does
not comprise UDP-glucose, or only comprises UDP-glucose in
insignificant amounts.
Suitably, the emulsifier in accordance with the present invention
may be for example one or more of the following: a diglyceride, a
monoglyceride, such as 1-monoglyceride or a lysolecithin, such as
lysophosphatidylcholine for example, a digalactosyl monoglyceride
(DGMG). The emulsifier is preferably produced from the lipid acyl
donor following removal of one or more acyl groups from said lipid
acyl donor. The term lysolecithin as used herein encompasses
lysophosphatidylcholine, lysophosphatidylethanolamine,
lysophosphatidylinositol, lysophosphatidylserine and
lysophosphatidylglycerol
Where one of the emulsifiers is a carbohydrate ester, the second
emulsifier may be for example one or more of the following: a
diglyceride, a monoglyceride, such as 1-monoglyceride,
lysophosphatidylcholine, or digalactosyl monoglyceride (DGMG). The
second emulsifier is preferably produced from the lipid acyl donor
following removal of one or more acyl groups from said lipid acyl
donor. The term lysophosphatidylcholine as used herein is
synonymous with the term lysolecithin and these terms may be used
herein interchangeably.
Preferably the second emulsifier is DGMG. Suitably, the DGMG is
produced in situ by the removal of an acyl group from DGDG with the
transfer of the removed acyl group onto a carbohydrate to form a
carbohydrate ester.
Where one of the emulsifiers is a protein ester and/or a
diglyceride and/or a monoglyceride, the second emulsifier may be
for example one or more of the following: a diglyceride, a
monoglyceride, such as 1-monoglyceride, lysophosphatidylcholine, or
digalactosyl monoglyceride (DGMG). The second emulsifier is
preferably produced from the lipid acyl donor following removal of
one or more acyl groups from said lipid acyl donor. The term
lysophosphatidylcholine as used herein is synonymous with the term
lysolecithin and these terms may be used herein
interchangeably.
In one embodiment the lipid acyl transferase of the invention can
be used in a process for the preparation of a foodstuff such as a
cooking (e.g. edible) oil, margarine or spread, butterfat (e.g. for
subsequent use in cheese and/or margarine and/or spreads), whereby
the foodstuff naturally contains, or has been supplemented with,
glycerol and/or has been supplemented with at least one
phospholipid (for example lecithin) and/or glycolipid (for example
digalactosyl-diglyceride), and optionally a phytosterol or
phytostanol.
In one embodiment the lipid acyl transferase of the invention can
be used in a process for the preparation of a foodstuff such as
margarine or spread, whereby the foodstuff naturally contains, or
has been supplemented with, glycerol, at least one phospholipid
(for example lecithin) and/or glycolipid (for example
digalactosyl-diglyceride), and optionally a phytosterol or
phytostanol.
In one embodiment, the present invention provides a process for the
production of modified edible oil or fat (including butterfat)
comprising i) lysophospholipid and/or one or more of the following,
glycerophosphatylcholine, phosphatylethanolamine,
phosphatylinositol and phosphatylserine, and ii) monoglyceride,
said process comprising: a) selecting at least one edible oil or
fat, or combination thereof, wherein said edible oil or fat
comprises at least a phospholipid, b) supplementing said edible oil
or fat selected in step a) with exogenous glycerol and optionally
b) exogenous phospholipid; wherein when the modified edible oil or
fat selected in step a) essentially consists of a vegetable oil,
exogenous phospholipid is added during step b), c) contacting the
supplemented edible oil or fat of step b) with at least one lipid
acyl transferase, and optionally a further enzyme, to produce an
edible oil/enzyme reaction mixture, and d) incubating said edible
oil/enzyme reaction mixture at a temperature at which said at least
one lipid acyl transferase is active in order to produce a modified
edible oil or fat comprising i) lysophospholipid and/or one or more
of the following glycerophosphatylcholine, phosphatylethanolamine,
phosphatylinositol and phosphatylserine, and ii) monoglyceride, and
e) optionally deactivating or removing said lipid acyl transferase
and/or optional further enzyme.
When used as a cooking oil or margarine, the foodstuff may have
enhanced anti-plattering properties. In addition or alternatively
the foodstuff may have one or more beneficial technical properties,
for example improved oxidative stability, improved emulsification
properties, or health benefits.
In one embodiment the lipid acyl transferase of the invention can
be in the preparation of low fat foodstuffs, such as low fat
spreads, low fat salad dressings, low fat mayonnaise, low fat
margarines etc. In such low fat food products, the fat content is
typically reduced by the addition of emulsifiers and additional
water compared to the higher fat equivalent.
The lipid acyl transferases used in the compositions and methods of
the invention have been found to have unique properties when
compared to lipolytic enzymes in that they have a marked preference
for transfer of acyl groups from lipids to acceptors other than
water, even in the presence of significant water. In a comparison
with prior art enzymes, the lipid acyl transferase used in the
invention were found to have a high relative transferase activity
in the presence of 6% water, 54% water, 73% water, 89% water and
approximately 95%. Lipolytic enzymes tested had virtually no
significant relative transferase activity at these water
concentrations.
The phospholipase activity of an enzyme may be evaluated using the
following assays. In this way, a lipid acyltransferase having the
enzyme characteristics defined herein may be
obtained/identified.
Determination of Phospholipase Activity (Phospholipase Activity
TIPU-K Assay):
Substrate
1.75% L-Phosphatidylcholine 95% Plant (Avanti #441601), 6.3%
Triton-X 100 (Peroxide free) and 5 mM CaCl.sub.2 is dissolved in
0.05M HEPES buffer pH 7.
Assay Procedure:
21 .mu.L substrate is added to a cuvette (Kone-Lab. Robot) and
incubated 30.degree. C. for 5 minutes. At time t=0 min, 4 .mu.L
enzyme solution is added. Also a blank with water instead of enzyme
was analyzed. At time t=10 min 75 .mu.l NEFA A (Substrate A of NEFA
Kit from Wako Chemicals, Germany) is added, mixed and incubated at
30.degree. C. At time t=15 min 150 .mu.l NEFA B (Substrate B of
NEFA Kit from Wako Chemicals, Germany) is added and incubated at
30.degree. C. At time t=20 min the Absorbance (OD 520 nm) is
measured.
A calibration curve based on oleic acid is produced and used for
the calculation of free fatty acid in the samples.
Enzyme activity TIPU-K is calculated as micromole fatty acid
produced per minute under assay conditions.
Determination of Phospholipase Activity (Phospholipase Activity
PLU-7 Assay):
Substrate
0.6% L-.alpha. Phosphatidylcholine 95% Plant (Avanti #441601), 0.4%
Triton-X 100 (Sigma X-100) and 5 mM CaCl.sub.2 is dispersed in
0.05M HEPES buffer pH 7.
Assay Procedure:
400 .mu.L substrate is added to a 1.5 mL Eppendorf tube and placed
in an Eppendorf Thermomixer at 37.degree. C. for 5 minutes. At time
t=0 min, 50 .mu.L enzyme solution is added. Also a blank with water
instead of enzyme is analyzed. The sample is mixed at 10.times.100
rpm in an Eppendorf Thermomixer at 37.degree. C. for 10 minutes. At
time t=10 min the Eppendorf tube is placed in another thermomixer
at 99.degree. C. for 10 minutes to stop the reaction.
Free fatty acid in the samples is analyzed by using the NEFA C kit
from WAKO GmbH.
Enzyme activity PLU-7 at pH 7 is calculated as micromole fatty acid
produced per minute under assay conditions.
The lipase and acyltransferase activity of an enzyme may be
evaluated using the following assays. In this way, a lipid
acyltransferase having the enzyme characteristics defined herein
may be obtained/identified.
Transferase Assay in Buffered Substrate (see Example 12)
Enzymes which function as lipid acyltransferases for use in the
compositions and methods of the invention can be routinely
identified using the assay taught herein in Example 12. This assay
will be hereinafter referred to as the `Transferase Assay in
Buffered Substrate`. In Example 12 the lipid acyltransferase enzyme
from Aeromonas salmonicida in accordance with the present invention
was analysed and compared with a range of lipolytic enzymes not
encompassed by the present invention. As can be seen, of the
lipolytic enzymes only LIPOPAN.RTM. F (Novozymes, Denmark) was
found to have any transferase activity and then only a very low
level (1.3%).
Enzymes suitable for use in the compositions and methods of the
invention can be routinely identified using the Transferase Assay
in Buffered Substrate. Using this assay, in which there is a very
high water content--approximately 95%, lipid acyltransferases in
accordance with the present invention are those which have at least
2% acyltransferase activity (relative transferase activity),
preferably at least 5% relative transferase activity, preferably at
least 10% relative transferase activity, preferably at least 15%,
20%, 25% 26%, 28%, 30%, 40% 50%, 60% or 75% relative transferase
activity. Suitably, the lipid acyltransferase in accordance with
the present invention may have less than 28%, less than 30%,
preferably less than 40%, 50%, 60%, 70%, 80%, 90% or 100%
acyltransferase activity.
Transferase Assay in High Water Egg Yolk (See Example 11)
As an alternative to (or in addition to) using the "Transferase
Assay in Buffered Substrate" (see above), a lipid acyltransferase
for use in accordance with the present invention may be identified
using the "Transferase Assay in High Water Egg Yolk" taught in
Example 11.
In one embodiment, the lipid acyltransferase suitable for use in
the methods and/or compositions according to the present invention
is one which when tested using the Transferase Assay in High Water
Egg Yolk in an egg yolk with 54% water, has up to 100% relative
transferase activity. Indeed, experiments in high water egg yolk
have shown that at the start of the experiment the initial
transferase rate was calculated to be 100% transferase activity,
i.e. no hydrolytic activity was observed. In contrast, the
lipolytic enzymes used as control, i.e. LIPOPAN.RTM. F and
phospholipase A2, showed no detectable transferase activity in egg
yolk with 54% water, or egg yolk with enriched water content
(namely egg yolk with 73% water or 89% water). Preferably the
increase in water content does not significantly decrease the
percentage acyl transferase activity of a lipid acyltransferase for
use in the methods or compositions according to the present
invention.
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, with a water content of 54%, a lipid
acyltransferase for use in the present invention will have an
initial percentage acyltransferase activity (initial relative
transferase activity) measured after 10% consumption of the donor
molecule (i.e. phospholipid) of at least 0.1% relative transferase
activity, preferably at least 1% relative transferase activity,
preferably at least 5% relative transferase activity, preferable at
least 10% relative transferase activity, preferably at least 20%
relative transferase activity, preferably at least 30% relative
transferase activity, preferably at least 40% relative transferase
activity, preferably at least 50% relative transferase activity,
preferably at least 60%, preferably at least 70%, preferably at
least 80%, preferably at least 90%, preferably at least 95%,
preferably at least 99%, preferably about 100% acyl transferase
activity.
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, with a water content of 54%, and measured
after 10% consumption of the donor molecule (i.e. phospholipid),
the lipid acyltransferase for use in the compositions and methods
of the invention has detectable transferase activity, i.e. relative
transferase activity of between 0.1 and 100%, preferably at least
1% relative transferase activity, preferably at least 5% relative
transferase activity, preferable at least 10% relative transferase
activity, preferably at least 20% relative transferase activity,
preferably at least 30% relative transferase activity, preferably
at least 40% relative transferase activity, preferably at least
45%, 50%, 60%, 70%, 80%, or 90% relative transferase activity.
Suitably, the lipid acyl transferase in accordance with the present
invention may have, when using the Transferase Assay in High Water
Egg Yolk with 54% water content and measured after 10% consumption
of the donor molecule (i.e. phospholipid), a percentage acyl
transferase activity (relative transferase activity) of less than
45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, with a water content of 73%, measured after
10% consumption of the donor molecule (i.e. phospholipid), the
lipid acyltransferase for use in the compositions and methods of
the invention has detectable transferase activity, i.e. relative
transferase activity of between 0.1 and 100%, preferably at least
1% relative transferase activity, preferably at least 5% relative
transferase activity, preferable at least 10% relative transferase
activity, preferably at least 20% relative transferase activity,
preferably at least 30% relative transferase activity, preferably
at least 40% relative transferase activity, preferably at least
45%, 50%, 58%, 60%, 70%, 80%, or 90% relative transferase activity.
Suitably, the lipid acyl transferase in accordance with the present
invention may have, when using the Transferase Assay in High Water
Egg Yolk with 73% water content and measured after 10% consumption
of the donor molecule (i.e. phospholipid), a percentage acyl
transferase activity (relative transferase activity) of less than
45%, 47%, 50%, 58%, 60%, 70%, 80%, 90% or 100%.
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, with a water content of 89%, and measured
after 10% consumption of the donor molecule (i.e. phospholipid),
the lipid acyltransferase for use in the compositions and methods
of the invention has detectable transferase activity, i.e. relative
transferase activity of between 0.1 and 100%, preferably at least
1% relative transferase activity, preferably at least 5% relative
transferase activity, preferable at least 10% relative transferase
activity, preferably at least 20% relative transferase activity,
preferably at least 30% relative transferase activity, preferably
at least 40% relative transferase activity, preferably at least
45%, 50%, 60%, 70%, 80%, or 90% relative transferase activity.
Suitably, the lipid acyl transferase in accordance with the present
invention may have, when using the Transferase Assay in High Water
Egg Yolk with 89% water content and measured after 10% consumption
of the donor molecule (i.e. phospholipid), a percentage acyl
transferase activity (relative transferase activity) of less than
45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, a lipid acyltransferase for use in the
compositions and methods of the invention has significant relative
transferase activity (i.e. at least 0.1% at both water contents),
and has an equivalent relative transferase activity in egg yolk
with a water content of 54% as in an egg yolk with a water content
of 73%, when measured after 10% consumption of the donor molecule
(i.e. phospholipid).
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, a lipid acyltransferase for use in the
compositions and methods of the invention has significant relative
transferase activity (i.e. at least 0.1% at both water contents),
and has an equivalent relative transferase activity in egg yolk
with a water content of 54% as in an egg yolk with a water content
of 89%, when measured after 10% consumption of the donor molecule
(i.e. phospholipid).
In a preferable embodiment, with reference to the Transferase Assay
in High Water Egg Yolk, a lipid acyltransferase for use in the
compositions and methods of the invention has significant relative
transferase activity (i.e. at least 0.1% at both water contents),
and has an equivalent relative transferase activity in egg yolk
with a water content of 73% as in an egg yolk with a water content
of 89%, when measured after 10% consumption of the donor molecule
(i.e. phospholipid).
The term "equivalent relative transferase activity" as referred to
herein means that the enzyme has a relative transferase activity (%
acyltransferase activity) which is at least 2% lower, preferably at
least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% lower, in
the egg yolk with the higher water content compared with that in
the egg yolk with the lower water content.
Transferase Assay in a Low Water Environment
As an alternative to (or in addition to) using the "Transferase
Assay in High Water Egg Yolk" and/or the "Transferase Assay in
Buffered Substrate", lipid acyltransferases for use in accordance
with the present invention may be identified using the "Transferase
Assay in a Low Water Environment".
In order to determine if an enzyme is a lipid acyltransferase
according to the present invention, one may carry out a
"Transferase Assay in a Low Water Environment", namely in an oily
environment with 6% water as taught in Example 22. This example
illustrates that in an oily environment with 6% water content the
lipid acyltransferase of the invention has a high relative
transferase activity, where the prior art lipolytic enzymes have
hydrolytic activity.
In one embodiment, the lipid acyltransferase suitable for use in
the methods and/or compositions according to the present invention
is one which when tested using the "Transferase Assay in a Low
Water Environment", measured after a time period selected from 30,
20 or 120 minutes, has a relative transferase activity of at least
1%, preferably at least 2%, preferably at least 5%, preferably at
least 10%, preferably at least 20%, preferably at least 30%,
preferably at least 40%, preferably at least 50%, preferably at
least 60%, preferably at least 70%, preferably at least 75%.
Suitably, the lipid acyl transferase in accordance with the present
invention may have less than 30%, 40%, 50%, 60%, 70%, or 80%
activity when measured after a time period of 10, 20, 30 or 120
minutes using the "Transferase Assay in a Low Water
Environment".
As described above, the lipase acyltransferase of the invention can
be identified using either the "Transferase Assay in Buffered
Substrate" or in the "Transferase Assay in Low Water Environment"
using cholesterol as the acyl acceptor. Of course, the skilled
person would be readily aware that, with obvious amendments to the
analytical methods the `Transferase Assay in Buffered Substrate` or
the `Transferase Assay in Low Water Environment" may be used to
determine the lipid acyltransferase activity for any lipid acyl
donor or any acyl acceptor combination. The skilled person would,
if necessary, simply replace the acyl donor substrate (e.g.
phospholipid) with an alternative acyl donor substrate (e.g.
glycolipid, triacylglyceride) and/or replace the acyl acceptor
(e.g. cholesterol) with an alternative acyl acceptor substrate
(e.g. a carbohydrate, a protein, another sterol, a stanol or
glycerol).
The term "high water" as used herein means any substrate or
foodstuff with more than 2% water content, preferably more than 3%,
4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or
90%.
The term "low water" as used herein means any substrate or
foodstuff with less than 6% water content, preferably less than 5%,
4%, 3%, 2%, 1% or 0.5%.
LUS Assay
The ability to hydrolyse triglyeride (E.C. 3.1.1.3 activity) may be
determined by lipase activity is determined according to Food
Chemical Codex (3rd Ed., 1981, pp 492-493) modified to sunflower
oil and pH 5.5 instead of olive oil and pH 6.5. The lipase activity
is measured as LUS (lipase units sunflower) where 1 LUS is defined
as the quantity of enzyme which can release 1 [mu]mol of fatty
acids per minute from sunflower oil under the above assay
conditions.
LUT Assay
Alternatively the LUT assay as defined in WO9845453 may be used.
This reference is incorporated herein by reference.
The lipid acyl transferase lipid acyl transferase according to the
present invention or for use in the method and/or uses of the
present invention which is substantially incapable of acting on a
triglyceride may have a LUS/mg of less than 1000, for example less
than 500, such as less than 300, preferably less than 200, more
preferably less than 100, more preferably less than 50, more
preferably less than 20, more preferably less than 10, such as less
than 5, less than 2, more preferably less than 1 LUS/mg.
Alternatively LUT/mg activity is less than 500, such as less than
300, preferably less than 200, more preferably less than 100, more
preferably less than 50, more preferably less than 20, more
preferably less than 10, such as less than 5, less than 2, more
preferably less than 1 LUT/mg.
The lipid acyl transferase lipid acyl transferase according to the
present invention or for use in the method and/or uses of the
present invention which is substantially incapable of acting on a
monoglyceride may be determined by using mono-oleate (M7765
1-Oleoyl-rac-glycerol 99%) in place of the sunflower oil in the LUS
assay. 1 MGHU is defined as the quantity of enzyme which can
release 1 [mu]mol of fatty acids per minute from monoglyceride
under the assay conditions.
The lipid acyl transferase lipid acyl transferase according to the
present invention or for use in the method and/or uses of the
present invention which is substantially incapable of acting on a
triglyceride may have a MGHU/mg of less than 5000, for example less
than 1000, for example less than 500, such as less than 300,
preferably less than 200, more preferably less than 100, more
preferably less than 50, more preferably less than 20, more
preferably less than 10, such as less than 5, less than 2, more
preferably less than 1 MGHU/mg.
Preferably the method and/or use according to the present invention
may be carried out, for example, in foodstuff at a temperature of
15-60.degree. C., preferably at a temperature of 20-60.degree. C.,
preferably 20-50.degree. C., preferably 20-45.degree. C.,
preferably 20-40.degree. C. For some aspects, for example in dough,
preferably the temperature of the food during which the
acyltransferase reaction takes place is between 20 and 40.degree.
C. For other aspects, for example with regard to dairy products,
such as cheese, the temperature of the food may suitably be between
30.degree. C. and 60.degree. C. In yet other aspects, for example
with regard to mayonnaise, the temperature of the food may suitably
be between 20 and 40.degree. C., more preferably between 25 and
30.degree. C.
Preferably, the emulsifier produced according to the present
invention comprises less than 5 wt % of the foodstuff.
Preferably, the emulsifier produced according to the present
invention comprises from 0.01 to 4 wt % of the foodstuff.
Preferably, the emulsifier produced according to the present
invention comprises from 0.01 to 2 wt % of the foodstuff.
Preferably, the emulsifier produced according to the present
invention comprises from 0.01 to 1 wt % of the foodstuff.
Preferably, the emulsifier produced according to the present
invention comprises from 0.01 to 0.5 wt % of the foodstuff.
Preferably, the emulsifier produced according to the present
invention comprises from 0.01 to 0.3 wt % of the foodstuff.
Suitably, the method according to the present invention includes
inactivating or denaturing the enzyme to provide a foodstuff
comprising the enzyme in an inactive or denatured form. Suitably
the enzyme may be denatured by either baking or by
pasteurisation.
The present invention may further encompass the use of a lipid
acyltransferase as defined herein in food and/or feed enzyme
compositions, and may encompass food and/or feed enzyme
compositions comprising a lipid acyltransferase as defined herein.
Such compositions may contain one or more further enzymes, such as
those listed herein. Alternatively, the enzyme composition of the
invention may be used in combination with other food
ingredients/additives, such as those listed herein, including other
enzyme compositions. By formulation of the lipid acyl transferase
of the invention within a food and/or feed composition, the enzyme
can be stabilised to allow for prolonged storage (under suitable
conditions) prior to use in food and/or feed production. In
addition the enzyme composition of the present invention provides
the enzyme in a suitable form for safe use for the `in situ`
application in the preparation of foodstuffs and/or feedstuffs, or
ingredients for use in food and/or feed preparation. Such
compositions may be in either liquid, semi-liquid or solid/granular
form.
In one embodiment the food enzyme composition may suitable be a
dough improving composition. The dough improving composition may
comprise other beneficial components such as an emulsifier and/or
other enzymes as listed herein.
Food enzymes are sold as stabilised liquid concentrates or as
particulate solids. Formulation into food enzyme composition
minimises losses in enzymatic activity during transport, storage,
and use. Enzymes are often exposed to humid, hot, or oxidative
environments in food and beverage processing. Formulations enhance
stability by counteracting the primary forces of deactivation:
denaturation, catalytic-site deactivation, and proteololysis.
Denaturation occurs by physical unfolding of an enzyme's tertiary
protein structure under thermal or chemical stress. Once an enzyme
begins to unfold it becomes dramatically more vulnerable to
deactivation and proteolysis. To minimise unfolding, the formulator
can alter the protein's environment so as to induce a compact
protein structure; this is done most effectively by "preferential
exclusion" of water from the protein surface by adding
water-associating compounds such as sugars, polyhydric alcohols,
and lyotropic salts. The best ways to combat active site
inactivation are to ensure sufficient levels of any required
cofactors, to add reversible inhibitors, and to exclude oxidising
or reactive species from the formulation.
Besides enzymatic stability, a formulation should meet several key
secondary requirements, including preservation against microbial
contamination, avoidance of physical precipitation or haze
formation, minimising the formation of sensitising dusts or
aerosols, and the optimisation of aesthetic criteria such as colour
and odour. Many of these problems are best addressed by focusing as
far "upstream" as possible, including the choice of raw materials
in the fermentation or enzyme recovery process. Downstream
operations such as diafiltration, adsorption, chromatography,
crystallization, and extraction can be used to remove impurities
responsible for colour, odour, and precipitation. The risk of
physical precipitation is minimised by formulating near the
isoelectric point of the enzyme with hydrophilic solvents such as
glycerol or propylene glycol. One can effectively also add moderate
levels of solvating salts to avoid either salting-out or "reverse
salting-in". To prevent microbial contamination, one can use a
combination of filtration, acidification, and the minimisation of
free water; biocides can be effective, but the range of acceptable
chemicals for controlling or killing microbes is increasingly
circumscribed by health and safety regulations.
Two processes producing the most attrition-resistant granules to
date are high-shear granulation and fluidised-bed spray coating,
see for example T. Becker: "Separation and Purification Processes
for Recovery of Industrial Enzymes" in R. K. Singh, S. S. H. Rizvi
(eds.): Bioseparation Processes in Foods, Marcel Dekker, New York,
pp. 427-445. These processes use various binders, coatings, and
particle morphologies to produce nonfriable particles which still
protect enzymes during storage but allow for their ready release in
solution during use.
Food enzyme compositions containing the lipid acyl transferase of
the invention may be made using standard formulation techniques,
such as spray drying or liquid formulation.
The lipid acyl-transferase of the invention can be expressed in any
suitable expression host. For example the lipid acyltransferase of
the invention may be expressed in Bacillus subtilis and may be
purified by ultrafiltration and/or by precipitation in ethanol
and/or centrifugation, and may be subsequently spray dried using
starch (maltodextrin) as carrier for the enzyme. The spray dried
enzyme may be standardised to specified PLU activity by adding
further carrier in powder form. The techniques involved are well
established and routine in the art.
Alternatively, lipid acyltransferase for use in accordance with the
present invention, for example the heterologously produced lipid
acyl-transferase of the invention, once purified, may be stabilised
in a suitable liquid formulation, such as those based on glycerol.
Other methods of making stabilised enzyme formulations are
described in EP 0 770 037 and EP 0 702 712.
The acyl transferase in powder form can also be used in combination
with other enzymes as listed herein, for the production of enzyme
compositions with defined activity according to the product
specification.
Typically the dosage of the food enzyme formulation is between 10 g
and 1000 g per 1000 kg of foodstuff, preferably 50-200 g per 1000
kg of foodstuff, preferably, 75-125 gm per 1000 kg of
foodstuff.
Preferably the enzyme according to the present invention is present
in an inactive form or in a denatured form in the foodstuff.
In one embodiment, the enzyme according to the present invention is
preferably not immobilised, in particular is not immobilised on a
solid support.
In an alternative embodiment, the enzyme may be immobilised.
Immobilised lipid acyl transferase can be prepared using
immobilisation techniques known in the art. There are numerous
methods of preparing immobilised enzymes, which will be apparent to
a person skilled in the art (for example the techniques referred to
in EP 0 746 608; or Balcao V M, Paiva A L, Malcata F X., Enzyme
Microb Technol. 1996 May 1; 18(6):392-416; or Reetz M T, Jaeger K
E. Chem Phys Lipids. 1998 June; 93(1-2):3-14; or Bornscheuer U T,
Bessler C, Srinivas R, Krishna S H. Trends Biotechnol. 2002
October; 20(10):433-7 (each of which is incorporated herein by
reference).
In one embodiment, the foodstuff of the invention may contain food
ingredients, which have been prepared using immobilised lipid
acyltransferase, but do not contain the lipid acyltransferase in
the food ingredient or foodstuff. For example the foodstuff may
contain one or more of the following: an emulsifier, more than one
emulsifier, one or more flavouring agents, one or more textural
enhancers and/or one or more sterol esters, such as phytosterol
esters or phytostanol esters.
The enzyme according to the present invention may be used with one
or more conventional emulsifiers, including for example
monoglycerides, diacetyl tartaric acid esters of mono- and
diglycerides of fatty acids, and lecithins e.g. obtained from
soya.
The enzyme according to the present invention may be used with one
or more other suitable food grade enzymes. Thus, it is within the
scope of the present invention that, in addition to the enzyme of
the invention, at least one further enzyme is added to the
foodstuff. Such further enzymes include starch degrading enzymes
such as endo- or exoamylases, pullulanases, debranching enzymes,
hemicellulases including xylanases, cellulases, oxidoreductases,
e.g. peroxidases, phenol oxidases, glucose oxidase, pyranose
oxidase, sulfhydryl oxidase, or a carbohydrate oxidase such as one
which oxidises maltose, for example hexose oxidase (HOX), lipases,
phospholipases, glycolipases, galactolipases and proteases.
In one embodiment the enzyme may be Dairy HOX.TM., which acts as an
oxygen scavenger to prolong shelf life of cheese while providing
browning control in pizza ovens. Therefore in a one aspect the
present invention relates to the use of an enzyme capable of
reducing the maillard reaction in a foodstuff (see WO02/39828
incorporated herein by reference), such as a dairy product, for
example cheese, wherein the enzyme is preferably a maltose
oxidising enzyme such as carbohydrate oxidae, glucose oxidase
and/or hexose oxidase, in the process or preparing a food material
and/or foodstuff according to the present invention.
In one preferred embodiment the lipid acyltransferase is used in
combination with a lipase having one or more of the following
lipase activities: glycolipase activity (E.C. 3.1.1.26,
triacylglycerol lipase activity (E.C. 3.1.1.3), phospholipase A2
activity (E.C. 3.1.1.4) or phospholipase A1 activity (E.C.
3.1.1.32). Suitably, lipase enzymes are well know within the art
and include by way of example the following lipases: LIPOPAN.RTM. F
and/or LECITASE.RTM. ULTRA (Novozymes A/S, Denmark), phospholipase
A2 (e.g. phospholipase A2 from LIPOMOD.TM. 22L from Biocatalysts,
LIPOMAX.TM. from Genecor), LIPOLASE.RTM. (Novozymes A/S, Denmark),
the lipases taught in WO03/97835, EP 0 977 869 or EP 1 193 314.
This combination of a lipid acyl transferase as defined herein and
a lipase may be particularly preferred in dough or baked products
or in fine food products such as cakes and confectionary.
In some embodiments, it may also be beneficial to combine the use
of lipid acyltransferase with a lipase such as rennet paste
prepared from calf, lamb, kid stomachs, or Palatase A750L (Novo),
Palatase M200L (Novo), Palatase M1000 (Novo), or Piccantase A
(DSM), also Piccantase from animal sources from DSM (K, KL, L &
C) or Lipomod 187, Lipomod 338 (Bioctalysts). These lipases are
used conventionally in the production of cheese to produce cheese
flavours. These lipases may also be used to produce an
enzymatically-modified foodstuff, for example dairy product (e.g.
cheese), particularly where said dairy product consists of, is
produced from or comprises butterfat. A combination of the lipid
acyltransferase with one or more of these lipases may have a
beneficial effect on flavour in the dairy product (e.g. cheese for
instance).
The use of lipases in combination with the enzyme of the invention
may be particularly advantageous in instances where some
accumulation of free fatty acids maybe desirable, for example in
cheese where the free fatty acids can impart a desirable flavour,
or in the preparation of fine foods. The person skilled in the art
will be able to combine proportions of lipolytic enzymes, for
example LIPOPAN.RTM. F and/or LECITASE.RTM. ULTRA (Novozymes A/S,
Denmark), phospholipase A2 (e.g. phospholipase A2 from LIPOMOD.TM.
22L from Biocatalysts, LIPOMAX.TM. from Genecor), LIPOLASE.RTM.
(Novozymes A/S, Denmark), the lipases taught in WO03/97835, EP 0
977 869 or EP 1 193, 314 and the lipid acyltransferase of the
present invention to provide the desired ratio of hydrolytic to
transferase activity which results in a preferred technical effect
or combination of technical effects in the foodstuff (such as those
listed herein under `Technical Effects`).
It may also be beneficial to combine the use of lipid
acyltransferase with a phospholipase, such as phospholipase A1,
phospholipase A2, phospholipase B, Phospholipase C and/or
phospholipase D.
The combined use may be performed sequentially or concurrently,
e.g. the lipid acyl transferase treatment may occur prior to or
during the further enzyme treatment. Alternatively, the further
enzyme treatment may occur prior to or during the lipid acyl
transferase treatment.
In the case of sequential enzyme treatments, in some embodiments it
may be advantageous to remove the first enzyme used, e.g. by heat
deactivation or by use of an immobilised enzyme, prior to treatment
with the second (and/or third etc.) enzyme.
Traditionally the cake industry uses cake improvers for the
production of cakes and to secure high quality cakes in terms of
taste, structure, eating quality and appearance. These cake
improvers are normally based on emulsifiers spray dried on a
carrier like starch and malto dextrin. Some cake improvers are also
in a gel form based on emulsifiers, sugars and water. These cake
improvers are very important for the cake industry in order to
produce cake of high quality. Cake improvers however contain
emulsifiers and other "non-natural" ingredients with an E-number.
Because of demand for the consumers to reduce the numbers of
E-numbers, the cake industry has asked for alternative ways to
produce cakes of high quality without using emulsifiers.
An alternative way to produce cake is to use an enzyme, i.e. the
lipid acyltransferase defined herein or an enzyme composition
according to the present invention.
The lipid acyltransferase as defined herein and/or the food enzyme
composition of the present invention may be used in the
preparations of a fine food, such as a cake. In such instances, the
following constituents may be formed in the fine food: i) sugar
esters and lysolecithin (from the carbohydrate in the cake recipe
and the lecithin in egg which also form part of the cake recipe);
and/or ii) acylated peptides and lysolecithin (by transferring a
fatty acid from lecithin to a protein or peptide during formation
of protein-fatty acid condensates, which are known to be highly
efficient emulsifiers (Herstellung und Anvendungmoglichkeiten von
Eiweiss-Fettsaurekondensaten. Andreas Sander, Eberhard Eilers,
Andrea Heilemann, Edith von Kreis.Fett/lipid 99 (1997) Nr. 4,
115-120).
It is considered that in the production of some fine foods,
particularly high fat fine foods, such as cakes, it may be
desirable to have some accumulation of fatty acids. Therefore the
combination of the use of lipolytic enzymes and the lipid acyl
transferase as defined herein may be particularly beneficial for
production of high fat fine foods. Alternatively, additional free
fatty acids or fatty acid soap (E470a) may be selected and used in
combination with the lipid acyl transferase.
The foodstuff according to the present invention may suitably
comprise one or more of the following additives: soy protein
material; carotenoids, flavenoids, antioxidant and phytochemical
(especially anthocyanonide, carotenoid, bioflavinoid, glutathione,
catechin, isoflavone, lycopene, ginsenoside, pycnogenol, alkaloid,
pygeum phytosterol, sulphoraphone, resveretol, grape seed extract
or food containing stanol esters), vitamin (especially vitamin C,
vitamin A, vitamin B3, vitamin D, vitamin E, thiamine, riboflavin,
niacin, pyridoxine, cyanocobalamin, folic acid, biotin, pantothenic
acid or vitamin K), minerals (especially calcium, iodine,
magnesium, zinc, iron, selenium, manganese, chromium, copper,
cobalt, molybdenum or phosphorus), fatty acid (especially
gamma-linoleic acid, ucospentaenoic acid or decosahexaenoic acid),
oil (especially borage oil, high carotenoid canola oil or flax seed
oil), amino acid (especially tryptophan, lysine, methionine,
phenylalanine, threonine, valine, leucine, isoleucine, alanine,
arginine, aspartic acid, cystine, cysteine, glutamic acid,
glutamine, glycine, histidine, proline, hydroxyproline, serine,
taurine or tyrosine), enzyme (especially bromelain, papain,
amylase, cellulase or coenzyme Q), lignin, stanol ester or friendly
bacteria (especially Lactobacillus acidophilus, Lactobacillus
bulgaricus, Lactobacillus bifidus, Lactobacillus plantarum or
Streptococcus faecium), folic acid, and soluble fibre.
Technical Effect
Surprisingly lipid acyltransferases have significant
acyltransferase activity in foodstuffs. This activity has
surprising beneficial applications in methods of preparing
foodstuffs.
The present invention is predicated upon the surprising finding
that the lipid acyltransferases according to the present invention
can perform carbohydrate-esterification via alcoholosis, i.e. acyl
transfer from a lipid, in a foodstuff with a significant water
content. Prior art suggests that such enzymes if they would
function at all in this manner would only function in a solvent
environment (i.e. in environments with low or no water
content).
The present invention may provide one or more of the following
unexpected technical effects in egg products, particularly
mayonnaise: an improved heat stability during pasteurization;
improved organoleptic properties, an improved consistency.
The present invention may provide one or more of the following
unexpected technical effects in dough and/or baked products: an
improved specific volume of either the dough or the baked products
(for example of bread and/or of cake); an improved dough stability;
an improved crust score (for example a thinner and/or crispier
bread crust), an improved crumb score (for example a more
homogenous crumb distribution and/or a finer crumb structure and/or
a softer crumb); an improved appearance (for example a smooth
surface without blisters or holes or substantially without blisters
or holes); a reduced staling; an enhanced softness; an improved
odour; an improved taste.
The present invention may provide a beneficial effect from
formation of highly surface-active materials in a foodstuff without
formation of substantial amount of free fatty acids, which reduce
the ability of the foodstuff to oxidize upon storage, because free
fatty acids are more prone to oxidation than the corresponding
fatty acid esters.
Suitably, the present invention may provide one or more of the
following unexpected technical effects in a foodstuff: an improved
appearance, an improved mouthfeel, an improved stability, in
particular an improved thermal stability, an improved taste, an
improved softness, an improved resilience, an improved
emulsification.
Suitably, the present invention may provide one or more of the
following unexpected technical effects in dairy products, such as
ice cream for example: an improved mouthfeel (preferably a more
creamy mouthfeel); an improved taste; an improved meltdown.
Suitably, the present invention may provide one or more of the
following unexpected technical effects in egg or in egg products:
improved stability of emulsion; thermal stability of emulsion;
improved flavour; reduced mal-odour; improved thickening
properties, improved consistency.
Specific technical effects associated with the use of a lipid
acyltransferase as defined herein in the preparation of a foodstuff
are listed in the table below:
TABLE-US-00003 Foodstuff Effect 1 Bread, Muffins and Strengthens
dough and increases mechanical Doughnuts resistance and increases
water absorption capacity. Increases volume of bakery products and
maintains softness of crumb 2 Frozen dough Prevents spoiling during
refrigeration 3 Sponge cake Makes good cake volume and a uniform
soft texture 4 Biscuit, cracker and Makes stable emulsions of fat
and prevents cookie stickiness to the machine. Prevents blooming of
high fat products 5 Batter and breading Improves texture of fried
products. 6 Noodles Prevents dough from sticking to the machine.
Increases water content, and decreases cooking loss 7 Instant
noodles Prevent noodles form adhering to each other 8 Pasta Dough
conditioner prevents adhesion on cooking. 9 Custard cream Makes
starch paste with a smooth and creamy texture, and prevents
dehydration. 10 Coffee whitener Prevent oil and water separation 11
Whipping cream Provides stable emulsion 12 Chocolate Prevents or
reduced blooming 13 Caramel, candy and Improves emulsification of
molten sugar nougat and oil. Prevents separation of oil. 14
Processed meat, Improves water holding capacity of sausages
sausages and pressed ham, and prevents separation of oil phase of
pastes and pate.
Suitably, the present invention may provide one or more of the
following unexpected technical effects in cheese: a decrease in the
oiling-off effect in cheese; an increase in cheese yield; an
improvement in flavour; a reduced mal-odour; a reduced "soapy"
taste.
Oiling-off is the tendency to form free oil upon storage and
melting. Excessive oiling-off is a defect most often related to
heated products wherein cheese is used, e.g. pizza and related
foods (cf. e.g. Kindstedt J. S; Rippe J. K. 1990, J Dairy Sci. 73:
867873. It becomes more and more important to control/eliminate
this defect, as the consumer concern about dietary fat levels
increases. Free oil/fat in a product is perceived as a high fat
content, and is generally undesirable. The oiling off effect can
not only affect the appearance of the cheese, but in severe cases
the oil released by the cheese may spread across the food product,
and be absorbed by the food product. This is particularly
detrimental to food products which contain a baked components, such
as a pizza base, and the effect is not only seen in the undesirable
appearance, but also detrimental texture and flavour may also
result.
In foodstuffs the fat phase is often stabilised by mechanic
emulsification, e.g. homogenisation. This technology is generally
not applicable in cheese production as homogenisation of the cheese
milk has a negative influence on the coagulation properties of the
cheese milk and on the yield as well as the taste of the cheese
produced therefrom.
The use of the enzyme modified foodstuff and/or food material of
the present invention (including enzyme modified milk, cream and/or
butter fat for example) can be used to produce foodstuffs such as
cheese which have a reduced oiling-off effect and/or to improve the
homogenization properties of the cheese milk, and/or reduce the
negative influence of coagulation properties of homogenised cheese
milk when made into cheese, and/or improve the flavour and/or
texture of the cheese.
Oiling off effect and cheese yield and fat yield/content can be
measured according to the protocols disclosed in WO00/54601.
In one embodiment the foodstuff (for example the dairy product,
e.g. cheese) prepared in accordance with the present invention may
have a higher yield.
Cheese yield increases may occur either when the cheese milk and/or
cream is modified directly by enzyme treatment, and/or when the
cheese milk is supplemented with the enzyme modified oil or fat,
such as enzyme modified butterfat.
A further advantage of the present invention may be the reduction
of off-flavours and/or off-tastes, preferably by reducing the
amount of free fatty acids in the enzymatically treated foodstuffs
(e.g. in the cheese).
One advantage of the present invention is that the lipid
acyltransferase may be used in a lower dosage to produce the same
(or better) effects compared with a phospholipase A2 (PLA2). Thus
effectively enzyme may be necessary to achieve the same (or better)
results.
Another advantage of the present invention is that the lipid
acyltransferase for use in the present invention and particularly
in cheese manufacture does not necessarily require pre-treatment of
the milk and/or cream. In fact the lipid acyltransferase when used
in the present invention may be added directly to the cheese vat.
This may advantageously simplify the cheese manufacture process for
the end user.
Another advantage of the present invention is that the lipid
acyltransferase may increase the moisture content of the foodstuff,
such as for example a cheese (e.g. mozzarella) and/or butterfat,
compared to when a phospholipase such as Lecitase.TM. is used for
instance.
In one embodiment, the use of the enzyme modified foodstuff and/or
food material of the present invention can be used to produce a
foodstuff such as cheese that has an increased moisture content
compared to when a phospholipase such as Lecitase.TM. is used for
instance. This one embodiment may be particularly advantageous
where the foodstuff and/or food material is a dairy product, for
example milk, cream, butterfat, and/or cheese.
Another advantage of the present invention is that sterol esters
and/or stanol esters may be produced in foodstuff. This one
embodiment this may be particularly advantageous where the
foodstuff and/or food material is a dairy product, for example
milk, cream, butterfat, and/or cheese.
Advantageously the present invention may be used to reduce the
cholesterol level of a foodstuff, particularly a dairy product, for
example cheese.
In food production, in particular cheese production, the use of the
lipid acyltransferase in accordance with the present invention
provides a significant advantage in the ability to recover soluble
proteins from dairy products. For example, in cheese production
nearly 20% of all milk protein is removed in the whey (i.e. the
watery part of the milk that remains after the formation of curds).
The whey comprises the soluble milk proteins, whereas the
hydrophobic proteins are maintained in the curd. By use of the
lipid acyltransferase in accordance with the present invention it
is possible to transfer an acyl group from a lipid (preferably from
a glycolipid or a phospholipid), to a protein (in particular to a
whey protein such as lactoglobulin) to from a protein fatty acid
condensate. Thus, producing a product which is more hydrophobic and
which will stay in the curd rather than being eluted in the whey.
In this way, more of the milk protein can be maintained in the
final foodstuff, i.e. the final dairy product such as the
cheese.
In one aspect, the present invention is based in part on the
realisation that yields of foods--such as cheese--may be improved
by the use of a lipid acyl transferase. In addition or
alternatively, the flavour, texture, oxidative stability and/or
shelf life of the food may be improved. In addition or
alternatively, the food may have a reduced cholesterol level or
enhanced content of phytosterol/stanol esters.
Without wishing to be bound to a particular theory it is considered
that the increase in yield may be the result of the
transesterification of whey proteins and peptides, resulting in
significant increase in the hydrophobicity of the whey proteins and
precipitation of the acylated whey proteins in the cheese curd.
In biological systems, for example, the deposition of membrane
bound proteins and enzymes are achieved by two different
mechanisms. The membrane bound proteins either possess a number of
membrane-spanning or hydrophobic domains, or they have
alternatively a fatty acid linked to the polypeptide chain. The
fatty acids have normally a chain length of 14 or 16 carbon atoms.
The fatty acids are covalently linked to the polypeptide chain at 3
different position, the N-terminal amino acid as an amide-bond, a
cysteine residue as a thioester linkage, or a serine or threonine
amino acid as an ester linkage. Only one fatty acid per polypeptide
molecule is necessary to incorporate the protein into the cell
membrane.
When a fatty acid is covalently linked to a non-membrane protein,
the physical and functional properties will change drastically.
WO97/14713 describes the transformed soy and gluten proteins into
acyl derivatives by treatment with a lipase from Mucor miehei
(Lipozyme.TM., Novozymes), and a fatty acid in organic solvent. The
lipid acyl transferase according to the present invention may be
used in the production of acylated proteins is a low or high water
environment.
We note that acylated proteins form amphiphilic complexes that can
be used for a number of cosmetic products. The acylated protein can
form gels, bind water by retaining moisture, have emulsifying
properties and is very active in the interphase between water and
lipid.
Thus, the present invention may in one aspect provide a cosmetic
composition comprising a lipid acyl transferase as defined
herein.
In addition, the present invention may provide the use of an
acyltransferase as defined herein to produce a cosmetic
composition.
In a further aspect, the present invention provides a method of in
situ production of a protein ester in a cosmetic composition,
wherein the method comprises the step of adding to the cosmetic
composition (or components thereof) a lipid acyltransferase as
defined herein.
Many food proteins are soluble in aqueous solutions and are
therefore suitable for in situ modification by the lipase acyl
transferase. In the cheese production, .beta.-lactoglobulin is lost
to the whey fraction. After acylation with a lipase acyl
transferase, or a lipase acyl transferase variant, initial results
indicate that b-lactoglobulin may however, be deposited in the
casein micelle surface during rennet coagulation.
.beta.-lactoglobulin has three potential acylation sites (serine
residues) on three surface loops. Milk contains sufficient amounts
of lecithin, a suitable substrate for a lipid acyl transferase
enzyme to acylate the .beta.-lactoglobulin. The lysolecithin formed
may have an additional emulsifying effect.
The improvements observed with lipid acyltransferase according to
the present invention are in comparison to when lipolytic enzymes
without acyltransferase activity, such as triacylglycerol lipases
and phospholipases, are used.
Advantages
The generation of an emulsifier and a sterol/stanol ester in situ
from at least one constituent of the food material, means that the
food material will contain at least one less additive material.
This is advantageous because of the improvement in the ease of
production. For example, no further processing or addition of
ingredients or addition of emulsifiers may be required. Moreover,
the foodstuff may contain less "additives". The reduction or
elimination of "additives" is desirable to consumers and inclusion
of additives often must be declared to the consumer in the
ingredients listing on the foodstuff. Thus, the present invention
is further advantageous.
An advantage of the present invention may be the production in situ
of an emulsifier in a foodstuff without a detrimental increase in
the free fatty acid content of the foodstuff.
The generation of two emulsifiers and/or a carbohydrate ester in
situ from at least one constituent of the food material, means that
the food material will contain at least one less additive
material.
In addition, when the lipid acyltransferase acts on a glycolipid it
is possible to advantageously produce the emulsifier DGMG in situ
without a detrimental increase in the free fatty acid content of
the foodstuff. Thus, reducing detrimental effects attributed to an
increase in free fatty acids, including but not limited to a
reduction in "soapy" taste in cheese, prevention of overdosing in
dough and dough baked properties.
For some aspects, an advantage of the present invention is the
reduction in free cholesterol levels in the foodstuff.
For other aspect, an advantage of the present invention is the
increase in stanol and/or sterol esters in the foodstuff. Some
sterol/stanol esters may be effective flavourants and/or
texturisers. Thus, the present invention may not only results in
the in situ production of an emulsifier in a foodstuff, but also
the in situ production of a flavourant and/or a texturiser. Some
sterol/stanol esters are known to reduce blood serum cholesterol
and/or low density lipoproteins when consumed in a foodstuff. Thus,
the present invention may be used to prepare a foodstuff with
increased levels of sterol esters and/or stanol esters.
For some aspects, particularly when the enzyme according to the
present invention is used in egg based products, an advantage is
the removal of unwanted free carbohydrates.
Also advantageously the emulsification properties of the foodstuff
are enhanced, leading to improved appearance and/or handling
properties and/or structure and/or consistency and/or heat
stability without a negative impact on taste.
In addition, for some embodiments advantageously the effect of
"overdosing" observed when using lipases per se, is effectively
overcome by the addition of an enzyme in accordance with the
present invention. This is due at least in part to the fact that
free fatty acids are not produced or only produced to an
insignificant degree when using the enzyme according to the present
invention.
Further and/or alternative advantages are taught in the section
entitled "Tehnical Effects" above.
Isolated
In one aspect, preferably the polypeptide or protein for use in the
present invention is in an isolated form. The term "isolated" means
that the sequence is at least substantially free from at least one
other component with which the sequence is naturally associated in
nature and as found in nature.
Purified
In one aspect, preferably the polypeptide or protein for use in the
present invention is in a purified form. The term "purified" means
that the sequence is in a relatively pure state--e.g. at least
about 51% pure, or at least about 75%, or at least about 80%, or at
least about 90% pure, or at least about 95% pure or at least about
98% pure.
Cloning a Nucleotide Sequence Encoding a Polypeptide According To
the Present Invention
A nucleotide sequence encoding either a polypeptide which has the
specific properties as defined herein or a polypeptide which is
suitable for modification may be isolated from any cell or organism
producing said polypeptide. Various methods are well known within
the art for the isolation of nucleotide sequences.
For example, a genomic DNA and/or cDNA library may be constructed
using chromosomal DNA or messenger RNA from the organism producing
the polypeptide. If the amino acid sequence of the polypeptide is
known, labelled oligonucleotide probes may be synthesised and used
to identify polypeptide-encoding clones from the genomic library
prepared from the organism. Alternatively, a labelled
oligonucleotide probe containing sequences homologous to another
known polypeptide gene could be used to identify
polypeptide-encoding clones. In the latter case, hybridisation and
washing conditions of lower stringency are used.
Alternatively, polypeptide-encoding clones could be identified by
inserting fragments of genomic DNA into an expression vector, such
as a plasmid, transforming enzyme-negative bacteria with the
resulting genomic DNA library, and then plating the transformed
bacteria onto agar containing an enzyme inhibited by the
polypeptide, thereby allowing clones expressing the polypeptide to
be identified.
In a yet further alternative, the nucleotide sequence encoding the
polypeptide may be prepared synthetically by established standard
methods, e.g. the phosphoroamidite method described by Beucage S.
L. et al (1981) Tetrahedron Letters 22, p 1859-1869, or the method
described by Matthes et al (1984) EMBO J. 3, p 801-805. In the
phosphoroamidite method, oligonucleotides are synthesised, e.g. in
an automatic DNA synthesiser, purified, annealed, ligated and
cloned in appropriate vectors.
The nucleotide sequence may be of mixed genomic and synthetic
origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA
origin, prepared by ligating fragments of synthetic, genomic or
cDNA origin (as appropriate) in accordance with standard
techniques. Each ligated fragment corresponds to various parts of
the entire nucleotide sequence. The DNA sequence may also be
prepared by polymerase chain reaction (PCR) using specific primers,
for instance as described in U.S. Pat. No. 4,683,202 or in Saiki R
K et al (Science (1988) 239, pp 487-491).
Nucleotide Sequences
The present invention also encompasses nucleotide sequences
encoding polypeptides having the specific properties as defined
herein. The term "nucleotide sequence" as used herein refers to an
oligonucleotide sequence or polynucleotide sequence, and variant,
homologues, fragments and derivatives thereof (such as portions
thereof). The nucleotide sequence may be of genomic or synthetic or
recombinant origin, which may be double-stranded or single-stranded
whether representing the sense or antisense strand.
The term "nucleotide sequence" in relation to the present invention
includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it
means DNA, more preferably cDNA for the coding sequence.
In a preferred embodiment, the nucleotide sequence per se encoding
a polypeptide having the specific properties as defined herein does
not cover the native nucleotide sequence in its natural environment
when it is linked to its naturally associated sequence(s) that
is/are also in its/their natural environment. For ease of
reference, we shall call this preferred embodiment the "non-native
nucleotide sequence". In this regard, the term "native nucleotide
sequence" means an entire nucleotide sequence that is in its native
environment and when operatively linked to an entire promoter with
which it is naturally associated, which promoter is also in its
native environment. Thus, the polypeptide of the present invention
can be expressed by a nucleotide sequence in its native organism
but wherein the nucleotide sequence is not under the control of the
promoter with which it is naturally associated within that
organism.
Preferably the polypeptide is not a native polypeptide. In this
regard, the term "native polypeptide" means an entire polypeptide
that is in its native environment and when it has been expressed by
its native nucleotide sequence.
Typically, the nucleotide sequence encoding polypeptides having the
specific properties as defined herein is prepared using recombinant
DNA techniques (i.e. recombinant DNA). However, in an alternative
embodiment of the invention, the nucleotide sequence could be
synthesised, in whole or in part, using chemical methods well known
in the art (see Caruthers M H et al (1980) Nuc Acids Res Symp Ser
215-23 and Horn T et al (1980) Nuc Acids Res Symp Ser 225-232).
Molecular Evolution
Once an enzyme-encoding nucleotide sequence has been isolated, or a
putative enzyme-encoding nucleotide sequence has been identified,
it may be desirable to modify the selected nucleotide sequence, for
example it may be desirable to mutate the sequence in order to
prepare an enzyme in accordance with the present invention.
Mutations may be introduced using synthetic oligonucleotides. These
oligonucleotides contain nucleotide sequences flanking the desired
mutation sites.
A suitable method is disclosed in Morinaga et al (Biotechnology
(1984) 2, p 646-649). Another method of introducing mutations into
enzyme-encoding nucleotide sequences is described in Nelson and
Long (Analytical Biochemistry (1989), 180, p 147-151).
Instead of site directed mutagenesis, such as described above, one
can introduce mutations randomly for instance using a commercial
kit such as the GeneMorph PCR mutagenesis kit from Stratagene, or
the Diversify PCR random mutagenesis kit from Clontech. EP 0 583
265 refers to methods of optimising PCR based mutagenesis, which
can also be combined with the use of mutagenic DNA analogues such
as those described in EP 0 866 796. Error prone PCR technologies
are suitable for the production of variants of lipid acyl
transferases with preferred characterisitics. WO0206457 refers to
molecular evolution of lipases.
A third method to obtain novel sequences is to fragment
non-identical nucleotide sequences, either by using any number of
restriction enzymes or an enzyme such as Dnase I, and reassembling
full nucleotide sequences coding for functional proteins.
Alternatively one can use one or multiple non-identical nucleotide
sequences and introduce mutations during the reassembly of the full
nucleotide sequence. DNA shuffling and family shuffling
technologies are suitable for the production of variants of lipid
acyl transferases with preferred characteristics. Suitable methods
for performing `shuffling` can be found in EP0 752 008, EP1 138
763, EP1 103 606. Shuffling can also be combined with other forms
of DNA mutagenesis as described in U.S. Pat. No. 6,180,406 and WO
01/34835.
Thus, it is possible to produce numerous site directed or random
mutations into a nucleotide sequence, either in vivo or in vitro,
and to subsequently screen for improved functionality of the
encoded polypeptide by various means. Using in silico and exo
mediated recombination methods (see WO 00/58517, U.S. Pat. Nos.
6,344,328, 6,361,974), for example, molecular evolution can be
performed where the variant produced retains very low homology to
known enzymes or proteins. Such variants thereby obtained may have
significant structural analogy to known transferase enzymes, but
have very low amino acid sequence homology.
As a non-limiting example, In addition, mutations or natural
variants of a polynucleotide sequence can be recombined with either
the wild type or other mutations or natural variants to produce new
variants. Such new variants can also be screened for improved
functionality of the encoded polypeptide.
The application of the above-mentioned and similar molecular
evolution methods allows the identification and selection of
variants of the enzymes of the present invention which have
preferred characteristics without any prior knowledge of protein
structure or function, and allows the production of non-predictable
but beneficial mutations or variants. There are numerous examples
of the application of molecular evolution in the art for the
optimisation or alteration of enzyme activity, such examples
include, but are not limited to one or more of the following:
optimised expression and/or activity in a host cell or in vitro,
increased enzymatic activity, altered substrate and/or product
specificity, increased or decreased enzymatic or structural
stability, altered enzymatic activity/specificity in preferred
environmental conditions, e.g. temperature, pH, substrate
As will be apparent to a person skilled in the art, using molecular
evolution tools an enzyme may be altered to improve the
functionality of the enzyme.
Suitably, the lipid acyltransferase used in the invention may be a
variant, i.e. may contain at least one amino acid substitution,
deletion or addition, when compared to a parental enzyme. Variant
enzymes retain at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% homology with the parent
enzyme. Suitable parent enzymes may include any enzyme with
esterase or lipase activity. Preferably, the parent enzyme aligns
to the pfam00657 consensus sequence.
In a preferable embodiment a variant lipid acyltransferase enzyme
retains or incorporates at least one or more of the pfam00657
consensus sequence amino acid residues found in the GDSx, GANDY
(SEQ ID NO: 15) and HPT blocks.
Enzymes, such as lipases with no or low lipid acyltransferase
activity in an aqueous environment may be mutated using molecular
evolution tools to introduce or enhance the transferase activity,
thereby producing a lipid acyltransferase enzyme with significant
transferase activity suitable for use in the compositions and
methods of the present invention.
Suitably, the lipid acyltransferase for use in the invention may be
a variant with enhanced enzyme activity on polar lipids, preferably
phospholipids and/or glycolipids when compared to the parent
enzyme. Preferably, such variants also have low or no activity on
lyso polar lipids. The enhanced activity on polar lipids,
phospholipids and/or glycolipids may be the result of hydrolysis
and/or transferase activity or a combination of both.
Variant lipid acyltransferases for use in the invention may have
decreased activity on triglycerides, and/or monoglycerides and/or
diglycerides compared with the parent enzyme.
Suitably the variant enzyme may have no activity on triglycerides
and/or monoglycerides and/or diglycerides.
Alternatively, the variant enzyme for use in the invention may have
increased activity on triglycerides, and/or may also have increased
activity on one or more of the following, polar lipids,
phospholipids, lecithin, phosphatidylcholine, glycolipids,
digalactosyl monoglyceride, monogalactosyl monoglyceride.
Variants of lipid acyltransferases are known, and one or more of
such variants may be suitable for use in the methods and uses
according to the present invention and/or in the enzyme
compositions according to the present invention. By way of example
only, variants of lipid acyltransferases are described in the
following references may be used in accordance with the present
invention: Hilton & Buckley J. Biol. Chem. 1991 Jan. 15: 266
(2): 997-1000; Robertson et al J. Biol. Chem. 1994 Jan. 21;
269(3):2146-50; Brumlik et al J. Bacteriol 1996 April; 178 (7):
2060-4; Peelman et al Protein Sci. 1998 March; 7(3):587-99.
Amino Acid Sequences
The present invention also encompasses amino acid sequences of
polypeptides having the specific properties as defined herein.
As used herein, the term "amino acid sequence" is synonymous with
the term "polypeptide" and/or the term "protein". In some
instances, the term "amino acid sequence" is synonymous with the
term "peptide".
The amino acid sequence may be prepared/isolated from a suitable
source, or it may be made synthetically or it may be prepared by
use of recombinant DNA techniques.
Suitably, the amino acid sequences may be obtained from the
isolated polypeptides taught herein by standard techniques.
One suitable method for determining amino acid sequences from
isolated polypeptides is as follows:
Purified polypeptide may be freeze-dried and 100 .mu.g of the
freeze-dried material may be dissolved in 50 .mu.l of a mixture of
8 M urea and 0.4 M ammonium hydrogen carbonate, pH 8.4. The
dissolved protein may be denatured and reduced for 15 minutes at
50.degree. C. following overlay with nitrogen and addition of 5
.mu.l of 45 mM dithiothreitol. After cooling to room temperature, 5
.mu.l of 100 mM iodoacetamide may be added for the cysteine
residues to be derivatized for 15 minutes at room temperature in
the dark under nitrogen.
135 .mu.l of water and 5 .mu.g of endoproteinase Lys-C in 5 .mu.l
of water may be added to the above reaction mixture and the
digestion may be carried out at 37.degree. C. under nitrogen for 24
hours.
The resulting peptides may be separated by reverse phase HPLC on a
VYDAC C18 column (0.46.times.15 cm; 10 .mu.m; The Separation Group,
California, USA) using solvent A: 0.1% TFA in water and solvent B:
0.1% TFA in acetonitrile. Selected peptides may be
re-chromatographed on a Develosil C18 column using the same solvent
system, prior to N-terminal sequencing. Sequencing may be done
using an Applied Biosystems 476A sequencer using pulsed liquid fast
cycles according to the manufacturer's instructions (Applied
Biosystems, California, USA).
Sequence Identity or Sequence Homology
The present invention also encompasses the use of sequences having
a degree of sequence identity or sequence homology with amino acid
sequence(s) of a polypeptide having the specific properties defined
herein or of any nucleotide sequence encoding such a polypeptide
(hereinafter referred to as a "homologous sequence(s)"). Here, the
term "homologue" means an entity having a certain homology with the
subject amino acid sequences and the subject nucleotide sequences.
Here, the term "homology" can be equated with "identity".
The homologous amino acid sequence and/or nucleotide sequence
should provide and/or encode a polypeptide which retains the
functional activity and/or enhances the activity of the enzyme.
In the present context, a homologous sequence is taken to include
an amino acid sequence which may be at least 75, 85 or 90%
identical, preferably at least 95 or 98% identical to the subject
sequence. Typically, the homologues will comprise the same active
sites etc. as the subject amino acid sequence. Although homology
can also be considered in terms of similarity (i.e. amino acid
residues having similar chemical properties/functions), in the
context of the present invention it is preferred to express
homology in terms of sequence identity.
In the present context, a homologous sequence is taken to include a
nucleotide sequence which may be at least 75, 85 or 90% identical,
preferably at least 95 or 98% identical to a nucleotide sequence
encoding a polypeptide of the present invention (the subject
sequence). Typically, the homologues will comprise the same
sequences that code for the active sites etc. as the subject
sequence. Although homology can also be considered in terms of
similarity (i.e. amino acid residues having similar chemical
properties/functions), in the context of the present invention it
is preferred to express homology in terms of sequence identity.
Homology comparisons can be conducted by eye, or more usually, with
the aid of readily available sequence comparison programs. These
commercially available computer programs can calculate % homology
between two or more sequences.
% homology may be calculated over contiguous sequences, i.e. one
sequence is aligned with the other sequence and each amino acid in
one sequence is directly compared with the corresponding amino acid
in the other sequence, one residue at a time. This is called an
"ungapped" alignment. Typically, such ungapped alignments are
performed only over a relatively short number of residues.
Although this is a very simple and consistent method, it fails to
take into consideration that, for example, in an otherwise
identical pair of sequences, one insertion or deletion will cause
the following amino acid residues to be put out of alignment, thus
potentially resulting in a large reduction in % homology when a
global alignment is performed. Consequently, most sequence
comparison methods are designed to produce optimal alignments that
take into consideration possible insertions and deletions without
penalising unduly the overall homology score. This is achieved by
inserting "gaps" in the sequence alignment to try to maximise local
homology.
However, these more complex methods assign "gap penalties" to each
gap that occurs in the alignment so that, for the same number of
identical amino acids, a sequence alignment with as few gaps as
possible--reflecting higher relatedness between the two compared
sequences--will achieve a higher score than one with many gaps.
"Affine gap costs" are typically used that charge a relatively high
cost for the existence of a gap and a smaller penalty for each
subsequent residue in the gap. This is the most commonly used gap
scoring system. High gap penalties will of course produce optimised
alignments with fewer gaps. Most alignment programs allow the gap
penalties to be modified. However, it is preferred to use the
default values when using such software for sequence comparisons.
For example when using the GCG Wisconsin Bestfit package the
default gap penalty for amino acid sequences is -12 for a gap and
-4 for each extension.
Calculation of maximum % homology therefore firstly requires the
production of an optimal alignment, taking into consideration gap
penalties. A suitable computer program for carrying out such an
alignment is the GCG Wisconsin Bestfit package (Devereux et al 1984
Nuc. Acids Research 12 p 387) or the Vector NTI (Invitrogen Corp.).
Examples of software that can perform sequence comparisons include,
but are not limited to, the BLAST package (see Ausubel et al 1999
Short Protocols in Molecular Biology, 4.sup.th Ed--Chapter 18),
FASTA (Altschul et al 1990 J. Mol. Biol. 403-410) and Align X for
example. Both BLAST and FASTA are available for offline and online
searching (see Ausubel et al 1999, pages 7-58 to 7-60). A new tool,
called BLAST 2 Sequences is also available for comparing protein
and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2):
247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and
tatiana@ncbi.nlm.nih.gov).
Although the final % homology can be measured in terms of identity,
the alignment process itself is typically not based on an
all-or-nothing pair comparison. Instead, a scaled similarity score
matrix is generally used that assigns scores to each pairwise
comparison based on chemical similarity or evolutionary distance.
An example of such a matrix commonly used is the BLOSUM62
matrix--the default matrix for the BLAST suite of programs. Vector
NTI programs and GCG Wisconsin programs generally use either the
public default values or a custom symbol comparison table if
supplied (see user manual for further details). For some
applications, it is preferred to use the public default values for
the GCG package or Vector NTI, or in the case of other software,
the default matrix, such as BLOSUM62.
Alternatively, percentage homologies may be calculated using the
multiple alignment feature in DNASIS.TM. (Hitachi Software), based
on an algorithm, analogous to CLUSTAL (Higgins D G & Sharp P M
(1988), Gene 73(1), 237-244).
Should Gap Penalties be used when determining sequence identity,
then preferably the following parameters are used for pairwise
alignment:
TABLE-US-00004 FOR BLAST GAP OPEN 0 GAP EXTENSION 0 FOR CLUSTAL DNA
PROTEIN WORD SIZE 2 1 K triple GAP PENALTY 15 10 GAP EXTENSION 6.66
0.1
In one embodiment, CLUSTAL may be used with the gap penalty and gap
extension set as defined above.
Suitably, the degree of identity with regard to a nucleotide
sequence is determined over at least 20 contiguous nucleotides,
preferably over at least 30 contiguous nucleotides, preferably over
at least 40 contiguous nucleotides, preferably over at least 50
contiguous nucleotides, preferably over at least 60 contiguous
nucleotides, preferably over at least 100 contiguous
nucleotides.
Suitably, the degree of identity with regard to a nucleotide
sequence may be determined over the whole sequence.
Once the software has produced an optimal alignment, it is possible
to calculate % homology, preferably % sequence identity. The
software typically does this as part of the sequence comparison and
generates a numerical result.
The sequences may also have deletions, insertions or substitutions
of amino acid residues which produce a silent change and result in
a functionally equivalent substance. Deliberate amino acid
substitutions may be made on the basis of similarity in polarity,
charge, solubility, hydrophobicity, hydrophilicity, and/or the
amphipathic nature of the residues as long as the secondary binding
activity of the substance is retained. For example, negatively
charged amino acids include aspartic acid and glutamic acid;
positively charged amino acids include lysine and arginine; and
amino acids with uncharged polar head groups having similar
hydrophilicity values include leucine, isoleucine, valine, glycine,
alanine, asparagine, glutamine, serine, threonine, phenylalanine,
and tyrosine.
Conservative substitutions may be made, for example according to
the Table below. Amino acids in the same block in the second column
and preferably in the same line in the third column may be
substituted for each other:
TABLE-US-00005 ALIPHATIC Non-polar G A P I L V Polar - uncharged C
S T M N Q Polar - charged D E K R AROMATIC H F W Y
The present invention also encompasses homologous substitution
(substitution and replacement are both used herein to mean the
interchange of an existing amino acid residue, with an alternative
residue) that may occur i.e. like-for-like substitution such as
basic for basic, acidic for acidic, polar for polar etc.
Non-homologous substitution may also occur i.e. from one class of
residue to another or alternatively involving the inclusion of
unnatural amino acids such as ornithine (hereinafter referred to as
Z), diaminobutyric acid ornithine (hereinafter referred to as B),
norleucine ornithine (hereinafter referred to as O),
pyridylalanine, thienylalanine, naphthylalanine and
phenylglycine.
Replacements may also be made by unnatural amino acids.
Variant amino acid sequences may include suitable spacer groups
that may be inserted between any two amino acid residues of the
sequence including alkyl groups such as methyl, ethyl or propyl
groups in addition to amino acid spacers such as glycine or
.beta.-alanine residues. A further form of variation, involves the
presence of one or more amino acid residues in peptoid form, will
be well understood by those skilled in the art. For the avoidance
of doubt, "the peptoid form" is used to refer to variant amino acid
residues wherein the .alpha.-carbon substituent group is on the
residue's nitrogen atom rather than the .alpha.-carbon. Processes
for preparing peptides in the peptoid form are known in the art,
for example Simon R J et al., PNAS (1992) 89(20), 9367-9371 and
Horwell D C, Trends Biotechnol. (1995) 13(4), 132-134.
Nucleotide sequences for use in the present invention or encoding a
polypeptide having the specific properties defined herein may
include within them synthetic or modified nucleotides. A number of
different types of modification to oligonucleotides are known in
the art. These include methylphosphonate and phosphorothioate
backbones and/or the addition of acridine or polylysine chains at
the 3' and/or 5' ends of the molecule. For the purposes of the
present invention, it is to be understood that the nucleotide
sequences described herein may be modified by any method available
in the art. Such modifications may be carried out in order to
enhance the in vivo activity or life span of nucleotide
sequences.
The present invention also encompasses the use of nucleotide
sequences that are complementary to the sequences discussed herein,
or any derivative, fragment or derivative thereof. If the sequence
is complementary to a fragment thereof then that sequence can be
used as a probe to identify similar coding sequences in other
organisms etc.
Polynucleotides which are not 100% homologous to the sequences of
the present invention but fall within the scope of the invention
can be obtained in a number of ways. Other variants of the
sequences described herein may be obtained for example by probing
DNA libraries made from a range of individuals, for example
individuals from different populations. In addition, other
viral/bacterial, or cellular homologues particularly cellular
homologues found in mammalian cells (e.g. rat, mouse, bovine and
primate cells), may be obtained and such homologues and fragments
thereof in general will be capable of selectively hybridising to
the sequences shown in the sequence listing herein. Such sequences
may be obtained by probing cDNA libraries made from or genomic DNA
libraries from other animal species, and probing such libraries
with probes comprising all or part of any one of the sequences in
the attached sequence listings under conditions of medium to high
stringency. Similar considerations apply to obtaining species
homologues and allelic variants of the polypeptide or nucleotide
sequences of the invention.
Variants and strain/species homologues may also be obtained using
degenerate PCR which will use primers designed to target sequences
within the variants and homologues encoding conserved amino acid
sequences within the sequences of the present invention. Conserved
sequences can be predicted, for example, by aligning the amino acid
sequences from several variants/homologues. Sequence alignments can
be performed using computer software known in the art. For example
the GCG Wisconsin PileUp program is widely used.
The primers used in degenerate PCR will contain one or more
degenerate positions and will be used at stringency conditions
lower than those used for cloning sequences with single sequence
primers against known sequences.
Alternatively, such polynucleotides may be obtained by site
directed mutagenesis of characterised sequences. This may be useful
where for example silent codon sequence changes are required to
optimise codon preferences for a particular host cell in which the
polynucleotide sequences are being expressed. Other sequence
changes may be desired in order to introduce restriction
polypeptide recognition sites, or to alter the property or function
of the polypeptides encoded by the polynucleotides.
Polynucleotides (nucleotide sequences) of the invention may be used
to produce a primer, e.g. a PCR primer, a primer for an alternative
amplification reaction, a probe e.g. labelled with a revealing
label by conventional means using radioactive or non-radioactive
labels, or the polynucleotides may be cloned into vectors. Such
primers, probes and other fragments will be at least 15, preferably
at least 20, for example at least 25, 30 or 40 nucleotides in
length, and are also encompassed by the term polynucleotides of the
invention as used herein.
Polynucleotides such as DNA polynucleotides and probes according to
the invention may be produced recombinantly, synthetically, or by
any means available to those of skill in the art. They may also be
cloned by standard techniques.
In general, primers will be produced by synthetic means, involving
a stepwise manufacture of the desired nucleic acid sequence one
nucleotide at a time. Techniques for accomplishing this using
automated techniques are readily available in the art.
Longer polynucleotides will generally be produced using recombinant
means, for example using a PCR (polymerase chain reaction) cloning
techniques. This will involve making a pair of primers (e.g. of
about 15 to 30 nucleotides) flanking a region of the lipid
targeting sequence which it is desired to clone, bringing the
primers into contact with mRNA or cDNA obtained from an animal or
human cell, performing a polymerase chain reaction under conditions
which bring about amplification of the desired region, isolating
the amplified fragment (e.g. by purifying the reaction mixture on
an agarose gel) and recovering the amplified DNA. The primers may
be designed to contain suitable restriction enzyme recognition
sites so that the amplified DNA can be cloned into a suitable
cloning vector.
Hybridisation
The present invention also encompasses sequences that are
complementary to the sequences of the present invention or
sequences that are capable of hybridising either to the sequences
of the present invention or to sequences that are complementary
thereto.
The term "hybridisation" as used herein shall include "the process
by which a strand of nucleic acid joins with a complementary strand
through base pairing" as well as the process of amplification as
carried out in polymerase chain reaction (PCR) technologies.
The present invention also encompasses the use of nucleotide
sequences that are capable of hybridising to the sequences that are
complementary to the subject sequences discussed herein, or any
derivative, fragment or derivative thereof.
The present invention also encompasses sequences that are
complementary to sequences that are capable of hybridising to the
nucleotide sequences discussed herein.
Hybridisation conditions are based on the melting temperature (Tm)
of the nucleotide binding complex, as taught in Berger and Kimmel
(1987, Guide to Molecular Cloning Techniques, Methods in
Enzymology, Vol. 152, Academic Press, San Diego Calif.), and confer
a defined "stringency" as explained below.
Maximum stringency typically occurs at about Tm-5.degree. C.
(5.degree. C. below the Tm of the probe); high stringency at about
5.degree. C. to 10.degree. C. below Tm; intermediate stringency at
about 10.degree. C. to 20.degree. C. below Tm; and low stringency
at about 20.degree. C. to 25.degree. C. below Tm. As will be
understood by those of skill in the art, a maximum stringency
hybridisation can be used to identify or detect identical
nucleotide sequences while an intermediate (or low) stringency
hybridisation can be used to identify or detect similar or related
polynucleotide sequences.
Preferably, the present invention encompasses sequences that are
complementary to sequences that are capable of hybridising under
high stringency conditions or intermediate stringency conditions to
nucleotide sequences encoding polypeptides having the specific
properties as defined herein.
More preferably, the present invention encompasses sequences that
are complementary to sequences that are capable of hybridising
under high stringent conditions (e.g. 65.degree. C. and
0.1.times.SSC {1.times.SSC=0.15 M NaCl, 0.015 M Na-citrate pH 7.0})
to nucleotide sequences encoding polypeptides having the specific
properties as defined herein.
The present invention also relates to nucleotide sequences that can
hybridise to the nucleotide sequences discussed herein (including
complementary sequences of those discussed herein).
The present invention also relates to nucleotide sequences that are
complementary to sequences that can hybridise to the nucleotide
sequences discussed herein (including complementary sequences of
those discussed herein).
Also included within the scope of the present invention are
polynucleotide sequences that are capable of hybridising to the
nucleotide sequences discussed herein under conditions of
intermediate to maximal stringency.
In a preferred aspect, the present invention covers nucleotide
sequences that can hybridise to the nucleotide sequences discussed
herein, or the complement thereof, under stringent conditions (e.g.
50.degree. C. and 0.2.times.SSC).
In a more preferred aspect, the present invention covers nucleotide
sequences that can hybridise to the nucleotide sequences discussed
herein, or the complement thereof, under high stringent conditions
(e.g. 65.degree. C. and 0.1.times.SSC).
Expression of Polypeptides
A nucleotide sequence for use in the present invention or for
encoding a polypeptide having the specific properties as defined
herein can be incorporated into a recombinant replicable vector.
The vector may be used to replicate and express the nucleotide
sequence, in polypeptide form, in and/or from a compatible host
cell. Expression may be controlled using control sequences which
include promoters/enhancers and other expression regulation
signals. Prokaryotic promoters and promoters functional in
eukaryotic cells may be used. Tissue specific or stimuli specific
promoters may be used. Chimeric promoters may also be used
comprising sequence elements from two or more different promoters
described above.
The polypeptide produced by a host recombinant cell by expression
of the nucleotide sequence may be secreted or may be contained
intracellularly depending on the sequence and/or the vector used.
The coding sequences can be designed with signal sequences which
direct secretion of the substance coding sequences through a
particular prokaryotic or eukaryotic cell membrane.
Expression Vector
The term "expression vector" means a construct capable of in vivo
or in vitro expression.
Preferably, the expression vector is incorporated in the genome of
the organism. The term "incorporated" preferably covers stable
incorporation into the genome.
The nucleotide sequence of the present invention or coding for a
polypeptide having the specific properties as defined herein may be
present in a vector, in which the nucleotide sequence is operably
linked to regulatory sequences such that the regulatory sequences
are capable of providing the expression of the nucleotide sequence
by a suitable host organism, i.e. the vector is an expression
vector.
The vectors of the present invention may be transformed into a
suitable host cell as described below to provide for expression of
a polypeptide having the specific properties as defined herein.
The choice of vector, e.g. plasmid, cosmid, virus or phage vector,
will often depend on the host cell into which it is to be
introduced.
The vectors may contain one or more selectable marker genes--such
as a gene which confers antibiotic resistance e.g. ampicillin,
kanamycin, chloramphenicol or tetracyclin resistance.
Alternatively, the selection may be accomplished by
co-transformation (as described in WO91/17243).
Vectors may be used in vitro, for example for the production of RNA
or used to transfect or transform a host cell.
Thus, in a further embodiment, the invention provides a method of
making nucleotide sequences of the present invention or nucleotide
sequences encoding polypeptides having the specific properties as
defined herein by introducing a nucleotide sequence into a
replicable vector, introducing the vector into a compatible host
cell, and growing the host cell under conditions which bring about
replication of the vector.
The vector may further comprise a nucleotide sequence enabling the
vector to replicate in the host cell in question. Examples of such
sequences are the origins of replication of plasmids pUC19,
pACYC177, pUB110, pE194, pAMB1 and pIJ702.
Regulatory Sequences
In some applications, a nucleotide sequence for use in the present
invention or a nucleotide sequence encoding a polypeptide having
the specific properties as defined herein may be operably linked to
a regulatory sequence which is capable of providing for the
expression of the nucleotide sequence, such as by the chosen host
cell. By way of example, the present invention covers a vector
comprising the nucleotide sequence of the present invention
operably linked to such a regulatory sequence, i.e. the vector is
an expression vector.
The term "operably linked" refers to a juxtaposition wherein the
components described are in a relationship permitting them to
function in their intended manner. A regulatory sequence "operably
linked" to a coding sequence is ligated in such a way that
expression of the coding sequence is achieved under conditions
compatible with the control sequences.
The term "regulatory sequences" includes promoters and enhancers
and other expression regulation signals.
The term "promoter" is used in the normal sense of the art, e.g. an
RNA polymerase binding site.
Enhanced expression of the nucleotide sequence encoding the enzyme
having the specific properties as defined herein may also be
achieved by the selection of heterologous regulatory regions, e.g.
promoter, secretion leader and terminator regions.
Preferably, the nucleotide sequence of the present invention may be
operably linked to at least a promoter.
Examples of suitable promoters for directing the transcription of
the nucleotide sequence in a bacterial, fungal or yeast host are
well known in the art.
Constructs
The term "construct"--which is synonymous with terms such as
"conjugate", "cassette" and "hybrid"--includes a nucleotide
sequence encoding a polypeptide having the specific properties as
defined herein for use according to the present invention directly
or indirectly attached to a promoter. An example of an indirect
attachment is the provision of a suitable spacer group such as an
intron sequence, such as the ShI-intron or the ADH intron,
intermediate the promoter and the nucleotide sequence of the
present invention. The same is true for the term "fused" in
relation to the present invention which includes direct or indirect
attachment. In some cases, the terms do not cover the natural
combination of the nucleotide sequence coding for the protein
ordinarily associated with the wild type gene promoter and when
they are both in their natural environment.
The construct may even contain or express a marker which allows for
the selection of the genetic construct.
For some applications, preferably the construct comprises at least
a nucleotide sequence of the present invention or a nucleotide
sequence encoding a polypeptide having the specific properties as
defined herein operably linked to a promoter.
Host Cells
The term "host cell"--in relation to the present invention includes
any cell that comprises either a nucleotide sequence encoding a
polypeptide having the specific properties as defined herein or an
expression vector as described above and which is used in the
recombinant production of a polypeptide having the specific
properties as defined herein.
Thus, a further embodiment of the present invention provides host
cells transformed or transfected with a nucleotide sequence of the
present invention or a nucleotide sequence that expresses a
polypeptide having the specific properties as defined herein. The
cells will be chosen to be compatible with the said vector and may
for example be prokaryotic (for example bacterial), fungal, yeast
or plant cells. Preferably, the host cells are not human cells.
Examples of suitable bacterial host organisms are gram negative
bacterium or gram positive bacteria.
Depending on the nature of the nucleotide sequence encoding a
polypeptide having the specific properties as defined herein,
and/or the desirability for further processing of the expressed
protein, eukaryotic hosts such as yeasts or other fungi may be
preferred. In general, yeast cells are preferred over fungal cells
because they are easier to manipulate. However, some proteins are
either poorly secreted from the yeast cell, or in some cases are
not processed properly (e.g. hyperglycosylation in yeast). In these
instances, a different fungal host organism should be selected.
The use of suitable host cells, such as yeast, fungal and plant
host cells--may provide for post-translational modifications (e.g.
myristoylation, glycosylation, truncation, lapidation and tyrosine,
serine or threonine phosphorylation) as may be needed to confer
optimal biological activity on recombinant expression products of
the present invention.
The host cell may be a protease deficient or protease minus
strain.
Organism
The term "organism" in relation to the present invention includes
any organism that could comprise a nucleotide sequence according to
the present invention or a nucleotide sequence encoding for a
polypeptide having the specific properties as defined herein and/or
products obtained therefrom.
Suitable organisms may include a prokaryote, fungus, yeast or a
plant.
The term "transgenic organism" in relation to the present invention
includes any organism that comprises a nucleotide sequence coding
for a polypeptide having the specific properties as defined herein
and/or the products obtained therefrom, and/or wherein a promoter
can allow expression of the nucleotide sequence coding for a
polypeptide having the specific properties as defined herein within
the organism. Preferably the nucleotide sequence is incorporated in
the genome of the organism.
The term "transgenic organism" does not cover native nucleotide
coding sequences in their natural environment when they are under
the control of their native promoter which is also in its natural
environment.
Therefore, the transgenic organism of the present invention
includes an organism comprising any one of, or combinations of, a
nucleotide sequence coding for a polypeptide having the specific
properties as defined herein, constructs as defined herein, vectors
as defined herein, plasmids as defined herein, cells as defined
herein, or the products thereof. For example the transgenic
organism can also comprise a nucleotide sequence coding for a
polypeptide having the specific properties as defined herein under
the control of a heterologous promoter.
Transformation of Host Cells/Organism
As indicated earlier, the host organism can be a prokaryotic or a
eukaryotic organism. Examples of suitable prokaryotic hosts include
E. coli and Bacillus subtilis.
Teachings on the transformation of prokaryotic hosts is well
documented in the art, for example see Sambrook et al (Molecular
Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor
Laboratory Press). If a prokaryotic host is used then the
nucleotide sequence may need to be suitably modified before
transformation--such as by removal of introns.
In another embodiment the transgenic organism can be a yeast.
Filamentous fungi cells may be transformed using various methods
known in the art--such as a process involving protoplast formation
and transformation of the protoplasts followed by regeneration of
the cell wall in a manner known. The use of Aspergillus as a host
microorganism is described in EP 0 238 023.
Another host organism can be a plant. A review of the general
techniques used for transforming plants may be found in articles by
Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225)
and Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27).
Further teachings on plant transformation may be found in
EP-A-0449375.
General teachings on the transformation of fungi, yeasts and plants
are presented in following sections.
Transformed Fungus
A host organism may be a fungus--such as a filamentous fungus.
Examples of suitable such hosts include any member belonging to the
genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor,
Neurospora, Trichoderma and the like.
Teachings on transforming filamentous fungi are reviewed in U.S.
Pat. No. 5,741,665 which states that standard techniques for
transformation of filamentous fungi and culturing the fungi are
well known in the art. An extensive review of techniques as applied
to N. crassa is found, for example in Davis and de Serres, Methods
Enzymol (1971) 17A: 79-143.
Further teachings on transforming filamentous fungi are reviewed in
U.S. Pat. No. 5,674,707.
In one aspect, the host organism can be of the genus Aspergillus,
such as Aspergillus niger.
A transgenic Aspergillus according to the present invention can
also be prepared by following, for example, the teachings of Turner
G. 1994 (Vectors for genetic manipulation. In: Martinelli S. D.,
Kinghorn J. R. (Editors) Aspergillus: 50 years on. Progress in
industrial microbiology vol 29. Elsevier Amsterdam 1994. pp.
641-666).
Gene expression in filamentous fungi has been reviewed in Punt et
al. (2002) Trends Biotechnol 2002 May; 20(5):200-6, Archer &
Peberdy Crit. Rev Biotechnol (1997) 17(4):273-306.
Transformed Yeast
In another embodiment, the transgenic organism can be a yeast.
A review of the principles of heterologous gene expression in yeast
are provided in, for example, Methods Mol Biol (1995), 49:341-54,
and Curr Opin Biotechnol (1997) October; 8(5):554-60
In this regard, yeast--such as the species Saccharomyces cerevisi
or Pichia pastoris (see FEMS Microbiol Rev (2000 24(1):45-66), may
be used as a vehicle for heterologous gene expression.
A review of the principles of heterologous gene expression in
Saccharomyces cerevisiae and secretion of gene products is given by
E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the expression
of heterologous genes", Yeasts, Vol 5, Anthony H Rose and J Stuart
Harrison, eds, 2nd edition, Academic Press Ltd.).
For the transformation of yeast, several transformation protocols
have been developed. For example, a transgenic Saccharomyces
according to the present invention can be prepared by following the
teachings of Hinnen et al., (1978, Proceedings of the National
Academy of Sciences of the USA 75, 1929); Beggs, J D (1978, Nature,
London, 275, 104); and Ito, H et al (1983, J Bacteriology 153,
163-168).
The transformed yeast cells may be selected using various selective
markers--such as auxotrophic markers dominant antibiotic resistance
markers.
A suitable yeast host organism can be selected from the
biotechnologically relevant yeasts species such as, but not limited
to, yeast species selected from Pichia spp., Hansenula spp.,
Kluyveromyces, Yarrowinia spp., Saccharomyces spp., including S.
cerevisiae, or Schizosaccharomyce spp. including Schizosaccharomyce
pombe.
A strain of the methylotrophic yeast species Pichia pastoris may be
used as the host organism.
In one embodiment, the host organism may be a Hansenula species,
such as H. polymorpha (as described in WO01/39544).
Transformed Plants/Plant Cells
A host organism suitable for the present invention may be a plant.
A review of the general techniques may be found in articles by
Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225)
and Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27),
or in WO01/16308. The transgenic plant may produce enhanced levels
of phytosterol esters and phytostanol esters, for example.
Therefore the present invention also relates to a method for the
production of a transgenic plant with enhanced levels of
phytosterol esters and phytostanol esters, comprising the steps of
transforming a plant cell with a lipid acyltransferase as defined
herein (in particular with an expression vector or construct
comprising a lipid acyltransferase as defined herein), and growing
a plant from the transformed plant cell.
Secretion
Often, it is desirable for the polypeptide to be secreted from the
expression host into the culture medium from where the enzyme may
be more easily recovered. According to the present invention, the
secretion leader sequence may be selected on the basis of the
desired expression host. Hybrid signal sequences may also be used
with the context of the present invention.
Typical examples of heterologous secretion leader sequences are
those originating from the fungal amyloglucosidase (AG) gene
(glaA--both 18 and 24 amino acid versions e.g. from Aspergillus),
the a-factor gene (yeasts e.g. Saccharomyces, Kluyveromyces and
Hansenula) or the .alpha.-amylase gene (Bacillus).
Detection
A variety of protocols for detecting and measuring the expression
of the amino acid sequence are known in the art. Examples include
enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA)
and fluorescent activated cell sorting (FACS).
A wide variety of labels and conjugation techniques are known by
those skilled in the art and can be used in various nucleic and
amino acid assays.
A number of companies such as Pharmacia Biotech (Piscataway, N.J.),
Promega (Madison, Wis.), and US Biochemical Corp (Cleveland, Ohio)
supply commercial kits and protocols for these procedures.
Suitable reporter molecules or labels include those radionuclides,
enzymes, fluorescent, chemiluminescent, or chromogenic agents as
well as substrates, cofactors, inhibitors, magnetic particles and
the like. Patents teaching the use of such labels include U.S. Pat.
Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437;
4,275,149 and U.S. Pat. No. 4,366,241.
Also, recombinant immunoglobulins may be produced as shown in U.S.
Pat. No. 4,816,567.
Fusion Proteins
A polypeptide having the specific properties as defined herein may
be produced as a fusion protein, for example to aid in extraction
and purification thereof. Examples of fusion protein partners
include glutathione-S-transferase (GST), 6.times.His (SEQ ID NO:
55), GAL4 (DNA binding and/or transcriptional activation domains)
and .beta.-galactosidase. It may also be convenient to include a
proteolytic cleavage site between the fusion protein partner and
the protein sequence of interest to allow removal of fusion protein
sequences. Preferably the fusion protein will not hinder the
activity of the protein sequence.
Gene fusion expression systems in E. coli have been reviewed in
Curr. Opin. Biotechnol. (1995) 6(5):501-6.
In another embodiment of the invention, the amino acid sequence of
a polypeptide having the specific properties as defined herein may
be ligated to a heterologous sequence to encode a fusion protein.
For example, for screening of peptide libraries for agents capable
of affecting the substance activity, it may be useful to encode a
chimeric substance expressing a heterologous epitope that is
recognised by a commercially available antibody.
The invention will now be described, by way of example only, with
reference to the following Figures and Examples.
FIG. 1 shows a pfam00657 consensus sequence from database version 6
(SEQ ID No. 1);
FIG. 2 shows an amino acid sequence (SEQ ID No. 2) obtained from
the organism Aeromonas hydrophila (P10480; GI:121051);
FIG. 3 shows an amino acid sequence (SEQ ID No. 3) obtained from
the organism Aeromonas salmonicida (AAG098404; GI:9964017);
FIG. 4 shows an amino acid sequence (SEQ ID No. 4) obtained from
the organism Streptomyces coelicolor A3(2) (Genbank accession
number NP.sub.--631558);
FIG. 5 shows an amino acid sequence (SEQ ID No. 5) obtained from
the organism Streptomyces coelicolor A3(2) (Genbank accession
number: CAC42140);
FIG. 6 shows an amino acid sequence (SEQ ID No. 6) obtained from
the organism Saccharomyces cerevisiae (Genbank accession number
P41734);
FIG. 7 shows an alignment of selected sequences (SEQ ID NOS 61
& 91-94 disclosed respectively in order of appearance) to
pfam00657 consensus sequence (SEQ ID NO: 1);
FIG. 8 shows a pairwise alignment of SEQ ID No. 3 (residues 1-335)
with SEQ ID No. 2 showing 93% amino acid sequence identity. The
signal sequence is underlined. +denotes differences. The GDSX motif
containing the active site serine 16, and the active sites aspartic
acid 116 and histidine 291 are highlighted (see shaded regions).
Numbers after the amino acid is minus the signal sequence;
FIG. 9 shows a nucleotide sequence (SEQ ID No. 7) encoding a lipid
acyl transferase according to the present invention obtained from
the organism Aeromonas hydrophila;
FIG. 10 shows a nucleotide sequence (SEQ ID No. 8) encoding a lipid
acyl transferase according to the present invention obtained from
the organism Aeromonas salmonicida;
FIG. 11 shows a nucleotide sequence (SEQ ID No. 9) encoding a lipid
acyl transferase according to the present invention obtained from
the organism Streptomyces coelicolor A3(2) (Genbank accession
number NC.sub.--003888.1:8327480.8328367);
FIG. 12 shows a nucleotide sequence (SEQ ID No. 10) encoding a
lipid acyl transferase according to the present invention obtained
from the organism Streptomyces coelicolor A3(2) (Genbank accession
number AL939131.1:265480.266367);
FIG. 13 shows a nucleotide sequence (SEQ ID No. 11) encoding a
lipid acyl transferase according to the present invention obtained
from the organism Saccharomyces cerevisiae (Genbank accession
number Z75034);
FIG. 14 shows an amino acid sequence (SEQ ID No. 12) obtained from
the organism Ralstonia (Genbank accession number: AL646052);
FIG. 15 shows a nucleotide sequence (SEQ ID No. 13) encoding a
lipid acyl transferase according to the present invention obtained
from the organism Ralstonia;
FIG. 16 shows SEQ ID No. 20. Scoe1 NCBI protein accession code
CAB39707.1 GI:4539178 conserved hypothetical protein [Streptomyces
coelicolor A3(2)];
FIG. 17 shows a nucleotide sequence shown as SEQ ID No. 21 encoding
NCBI protein accession code CAB39707.1 GI:4539178 conserved
hypothetical protein [Streptomyces coelicolor A3(2)];
FIG. 18 shows an amino acid shown as SEQ ID No.22. Scoe2 NCBI
protein accession code CAC01477.1 GI:9716139 conserved hypothetical
protein [Streptomyces coelicolor A3(2)];
FIG. 19 shows a nucleotide sequence shown as SEQ ID No. 23 encoding
Scoe2 NCBI protein accession code CAC01477.1 GI:9716139 conserved
hypothetical protein [Streptomyces coelicolor A3(2)];
FIG. 20 shows an amino acid sequence (SEQ ID No.24) Scoe3 NCBI
protein accession code CAB88833.1 GI:7635996 putative secreted
protein. [Streptomyces coelicolor A3(2)];
FIG. 21 shows a nucleotide sequence shown as SEQ ID No. 25 encoding
Scoe3 NCBI protein accession code CAB88833.1 GI:7635996 putative
secreted protein. [Streptomyces coelicolor A3(2)];
FIG. 22 shows an amino acid sequence (SEQ ID No.26) Scoe4 NCBI
protein accession code CAB89450.1 GI:7672261 putative secreted
protein. [Streptomyces coelicolor A3(2)];
FIG. 23 shows an nucleotide sequence shown as SEQ ID No. 27
encoding Scoe4 NCBI protein accession code CAB89450.1 GI:7672261
putative secreted protein. [Streptomyces coelicolor A3(2)];
FIG. 24 shows an amino acid sequence (SEQ ID No.28) Scoe5 NCBI
protein accession code CAB62724.1 GI:6562793 putative lipoprotein
[Streptomyces coelicolor A3(2)];
FIG. 25 shows a nucleotide sequence shown as SEQ ID No. 29,
encoding Scoe5 NCBI protein accession code CAB62724.1 GI:6562793
putative lipoprotein [Streptomyces coelicolor A3(2)];
FIG. 26 shows an amino acid sequence (SEQ ID No.30) Sriml NCBI
protein accession code AAK84028.1 GI:15082088 GDSL-lipase
[Streptomyces rimosus];
FIG. 27 shows a nucleotide sequence shown as SEQ ID No. 31 encoding
Sriml NCBI protein accession code AAK84028.1 GI:15082088
GDSL-lipase [Streptomyces rimosus];
FIG. 28 shows an amino acid sequence (SEQ ID No.32) A lipid acyl
transferase from Aeromonas hydrophila (ATCC #7965);
FIG. 29 shows a nucleotide sequence (SEQ ID No. 33) encoding a
lipid acyltransferase from Aeromonas hydrophila (ATCC #7965);
FIG. 30 shows an amino acid sequence (SEQ ID No.34) of a lipid
acyltransferase from Aeromonas salmonicida subsp. Salmonicida
(ATCC#14174);
FIG. 31 shows a nucleotide sequence (SEQ ID No 35) encoding a lipid
acyltransferase from Aeromonas salmonicida subsp. Salmonicida
(ATCC#14174);
FIG. 32 shows that homologues of the Aeromonas genes can be
identified using the basic local alignment search tool service at
the National Center for Biotechnology Information, NIH, MD, USA and
the completed genome databases. The GDSX motif was used in the
database search and a number of sequences/genes potentially
encoding enzymes with lipolytic activity were identified. Genes
were identified from the genus Streptomyces, Xanthomonas and
Ralstonia. As an example below, the Ralstonia solanacearum (SEQ ID
NO: 96) was aligned to the Aeromonas salmonicida (satA) (SEQ ID NO:
95) gene. Pairwise alignment showed 23% identity. The active site
serine is present at the amino terminus and the catalytic residues
histidine and aspartic acid can be identified;
FIG. 33 shows the Pfam00657.11 [family 00657, database version 11]
consensus sequence (hereafter called Pfam consensus) and the
alignment of various sequences to the Pfam consensus sequence. The
arrows indicate the active site residues, the underlined boxes
indicate three of the homology boxes indicated by [Upton C and
Buckley JT (1995) Trends Biochem Sci 20; 179-179]. Capital letters
in the Pfam consensus indicate conserved residues in many family
members. The -- symbol indicates a position where the hidden Markov
model of the Pfam consensus expected to find a residue but did not,
so a gap is inserted. The . symbol indicates a residue without a
corresponding residue in the Pfam consensus. The sequences are the
amino acid sequences listed in FIGS. 16, 18, 20, 22, 24, 26, 28 and
30. (SEO ID NOS 97, 30, 20, 22, 24, 26, 28, 32, 34& 36)
FIG. 34 shows the Pfam00657.11 [family 00657, database version 11]
consensus sequence (hereafter called Pfam consensus) and the
alignment of various sequences to the Pfam consensus sequence. The
arrows indicate the active site residues, the underlined boxes
indicate three of the homology boxes indicated by [Upton C and
Buckley JT (1995) Trends Biochem Sci 20; 179-179]. Capital letters
in the Pfam consensus indicate conserved residues in many family
members. The -- symbol indicates a position where the hidden Markov
model of the Pfam consensus expected to find a residue but did not,
so a gap is inserted. The . symbol indicates a residue without a
corresponding residue in the Pfam consensus. The sequences are the
amino acid sequences listed in FIGS. 2, 16, 18, 20, 26, 28 and 30.
All these proteins were found to be active against lipid
substrates. (SEQ ID NOS 98, 30, 20, 22, 32, 34 & 36)
FIG. 35 shows a expression vector pet12-AsalGCAT=pSM containing the
C-terminal His-tagged Aeromonas salmonicida lipid acyltransferase
gene;
FIG. 36 shows the results of testing cell extracts in a NEFA Kit
Assay, which depicts the activity of a recombinant, A. salmonicida
lipid acyltransferase, towards lecithin. The wells from left to
right indicate: a positive control, a negative control (i.e.
extracts from empty plasmid) and samples collected after 0, 1, 2
and 3 hours cultivation after IPTG induction;
FIG. 37 shows growth optimisation of BL21(DE3)pLysS harboring the
expression vector pet12-AsalGCAT=pSM showing cultivation at
30.degree. C. resulted in the production of enzyme with high
activity towards lecithin. Cell extracts were tested for
phospholipase activity using the NEFA kit assay. Wells from left to
right: positive control; negative control; 20.degree. C.;
30.degree. C.;
FIG. 38 shows crude cell extracts from BL21(DE3)pLysS expressing
active lipid acyltransferase incubated with the substrate lecithin
and reaction mixture was analyzed using thin layer chromatography
showing the presence of degradation products. Lanes: 1. No enzyme;
2. +A.sal-10 ul 37.degree. C.; 3. +A.sal-20 ul 37.degree. C.; 4.
+A.sal-10 ul 24.degree. C.; 5. +A.sal-20 u 24.degree. C.;
FIG. 39 shows partial purification of the Aeromonas salmonicida
Acyl Transferase showing the phospholipase activity associated with
purified His-tag protein. SE=Sonicated extracts, His=Purified with
Ni-NTA spin-kit from Qiagen;
FIG. 40 shows the expression vector pet12-A.h. GCAT=pSMa containing
the C-terminal His-tagged Aeromonas hydrophila Glycerolipid Acyl
Transferase (GCAT) gene was used to transform E. coli strain
BL21(DE3)pLysS;
FIG. 41 shows the activity of the crude extracts (5 & 10 ul)
containing the recombinant Aeromonas hydrophila GCAT enzyme was
tested towards lecithin using Non-Esterified Fatty Acid (NEFA) kit
(Roche, Switzerland), showing the presence of active enzyme towards
the phospholipid, lecithin;
FIG. 42 shows growth optimisation of BL21(DE3)pLysS harboring the
expression vector pet12-AsalGCAT=pSM showing cultivation at
30.degree. C. resulted in the production of enzyme with high
activity towards lecithin. Cell extracts were tested for
phospholipase activity using the NEFA kit assay;
FIG. 43 shows the partial purification of the Aeromonas hydrophila
& A. salmonicida Acyl Transferases showing the phospholipase
activity associated with purified His-tag protein. SE=Sonicated
extracts, His=Purified with Ni-NTA spin-kit from Qiagen);
FIG. 44 shows the expression of the Aeromonas genes in Bacillus
subtilis 163 showing the production of secreted enzyme with
activity towards both lecithin and DGDG. pUB-AH=construct
containing the A. hydrophila gene and pUB-AS, construct with the A.
salmonicida gene, Culture filtrate was incubated with the
substrates for 60 minutes.
FIG. 45 and FIG. 46 show a TLC plate in developing solvent IV
(chloroform:methanol:water (65:25:4)); Lane 1: 40 mg sitosterol 30
min: Lane 2: Transferase+40 mg sitosterol 30 min; Lane 3:
Transferase+80 mg sitosterol 30 min; Lane 4: Transferase+40 mg
sitosterol 120 min; Lane 5: Transferase+80 mg sitosterol 120 min;
Lane 6: Transferase+40 mg sitosterol 300 min; Lane 7: 40 mg
sitosterol 300 min; Lane 8: Cholesterol; Lane 9: Sitosterol;
FIG. 47 depicts the reaction between phosphatidylcholine and
cholesterol which is catalysed by a lipid acyltransferase;
FIG. 48 shows a TLC analysis of lipids extracted from enzyme
treated or untreated egg yolk., 6) 0.31PLU/g Transferase #179, 7)
1.25PLU/g Transferase #178-9., 8) 23.25 PLU/g Phospholipase #3108,
9) Control.
FIG. 49 shows mayonnaise test samples produced by enzyme treated or
untreated egg yolk: 5) Transferase #179, 0.31 PLU/g. 6) Transferase
#178-9, 1.25 PLU/g, 7) Phospholipase #3108, 23.3 PLU/g 8) Control,
water
FIG. 50 shows a TLC (in solvent I) of egg yolk lipid treated with a
lipid acyl transferase from A. hydrophila;
FIG. 51 shows a TLC (in solvent IV) of egg yolk lipid treated with
a lipid acyl transferase from A. hydrophila;
FIG. 52 shows a TLC analysis of transferase treated lipid from egg
yolk over a time course;
FIG. 53 shows the amount of fatty acid and cholesterol ester
produced as a function of time when using a lipid acyltransferase
(Tranf #178-9) compared with when using a control lipolytic enzyme,
Thermomyces lanuginosus;
FIG. 54 shows relative transferase activity as % of transferase and
hydrolytic activity in enzymatic reactions in egg yolk with high
water content, #1991 (phospholipase A2) and #2427 (phospholipase
A1) are control phospholipases, #178 is a lipid
acyltransferase;
FIG. 55 shows the effect of water content in the assay on the
transferase activity of the transferase #178 in transferase
reactions in egg yolk with high water content;
FIG. 56 shows the transferase activity for a lipid acyltransferase
(#178) as a function of reaction time in transferase reactions in
egg yolk with high water;
FIG. 57 and FIG. 58 show graphs depicting fatty acid and
cholesterol ester as a function of time. The graphs depict results
obtained for GLC analysis in the assay for measurement of
acyltransferase activity using lecithin and cholesterol in buffer
as substrate;
FIG. 59 shows a TLC in solvent I. Egg yolk treated with lipid
acyltransferase #138 from Aeromonas salmonidica (lane no. 1 and 2)
or with a phospholipase #2938 (LIPOPAN.RTM. F) (lane no. 3) or
Untreated egg yolk (lane no. 4);
FIG. 60 shows a TLC in solvent IV. Egg yolk treated with lipid
acyltransferase #138 (lane no. 1 and 2) or with Phospholipase #2938
(lane no. 3). Untreated egg yolk (lane no. 4);
FIG. 61 shows egg yolk treated with lipid acyltransferase #138
(sample nos. 1 and 2) and with phospholipase #2938 (sample no. 3).
Untreated egg yolk (sample no. 4);
FIG. 62 shows a food emulsion after 2 hours at 100.degree. C., 0)
Untreated egg yolk 1) Egg yolk treated with lipid acyl transferase
#138 for 210 minutes. 3) Egg yolk treated with the control
phospholipase #2938 for 210 minutes;
FIG. 63 shows TLC plates showing the screening of transferase
activity on plant sterol and glycerol. PC=phosphatidylcholine,
LPC=lysophosphatidylcholine; PE=phosphatidylethanolamine;
monogl=monoglyceride;
FIG. 64 shows a TLC plate in solvent I, Samples 1 to 6 after 24
hours and samples 1 to 4 after 4 hours reaction time. The TLC
analysis confirms the formation of sterol ester in samples 1, 2, 5
and 6;
FIG. 65 shows a TLC plate in solvent I where the transferase
activity of an immobilised acyltransferase from Aeromonas
salmonicida was tested in an oil mixture--with samples taken at
0.5, 1, 3, 6 and 24 h;
FIGS. 66 and 67 show TLC plates in solvent I and IV. Lane
1=lecithin; Lane 2=control--10 mins; Lane 3=0.75 PLU, 10 mins; Lane
4=0.75 PLU, 60 mins; Lane 5=0.75 PLU, 220 mins; Lane 6=control, 20
h; Lane 7=0.75 PLU, 20 h; and Lane 8=cholesterol ester;
FIGS. 68 and 69 show TLC plates in solvent IV. Lane 1=lecithin;
Lane 2=control--10 mins; Lane 3=1 PLU, 10 mins; Lane 4=1 PLU, 60
mins; Lane 5=1 PLU, 180 mins; Lane 6=1PLU, 220 mins; Lane 7=1PLU,
1200 min; Lane 8=control, 1200 min; Lane 9=glucose ester; Lane
10=cholesterol; and Lane 11=glucose;
FIG. 70 shows the reaction between DGDG and glucose when catalysed
by a lipid acyltransferase;
FIG. 71 shows an amino acid sequence (SEQ ID No. 36) of the fusion
construct used for mutagenesis of the Aeromonas hydrophila lipid
acyltransferase gene in Example 17. The underlined amino acids is a
xylanase signal peptide;
FIG. 72 shows a nucleotide sequence (SEQ ID No. 54) encoding an
enzyme from Aeromonas hydrophila including a xylanase signal
peptide;
FIG. 73 shows a TLC plate clearly showing the formation of plant
sterol ester and monoglyceride. Lane 1 is after 1 hour reaction
time, Lane 2 is after 4 hours reaction time, Lane 3 is after 24
hours reaction time and Lane 4 is a plant sterol; and
FIG. 74 shows the amino acid sequence of a mutant Aeromonas
salmonicida mature lipid acyltransferase (GCAT) with a mutation of
Asn80Asp (notably, amino acid 80 is in the mature sequence) (SEQ ID
62);
FIG. 75 shows SEQ ID No 63 which is the amino acid sequence of a
lipid acyltransferase from Candida parapsilosis;
FIG. 76 shows SEQ ID No. 64 which is the amino acid sequence of a
lipid acyltransferase from Candida parapsilosis;
FIG. 77 shows SEQ ID No. 65. Scoe1 NCBI protein accession code
CAB39707.1 GI:4539178 conserved hypothetical protein [Streptomyces
coelicolor A3(2)];
FIG. 78 shows a polypeptide sequence of a lipid acyltransferase
enzyme from Thermobifida (SEQ ID No. 66);
FIG. 79 shows a polypeptide sequence of a lipid acyltransferase
enzyme from Thermobifida (SEQ ID No. 67);
FIG. 80 shows a polypeptide of a lipid acyltransferase enzyme from
Corynebacterium efficiens GDSx 300 amino acid-(SEQ ID No. 68);
FIG. 81 shows a polypeptide of a lipid acyltransferase enzyme from
Novosphingobium aromaticivorans GDSx 284 amino acid-(SEQ ID No.
69);
FIG. 82 shows a polypeptide of a lipid acyltransferase enzyme from
Streptomyces coelicolor GDSx 269 mino cid (SEQ ID No. 70);
FIG. 83 shows a polypeptide of a lipid acyltransferase enzyme from
Streptomyces avermitilis GDSx 269 amino acid (SEQ ID No. 71);
FIG. 84 shows a polypeptide of a lipid acyltransferase enzyme from
Streptomyces (SEQ ID No. 72);
FIG. 85 shows an amino acid sequence (SEQ ID No. 73) obtained from
the organism Aeromonas hydrophila (P10480; GI:121051) (notably,
this is the mature sequence);
FIG. 86 shows the amino acid sequence (SEQ ID No. 74) of a mutant
Aeromonas salmonicida mature lipid acyltransferase (GCAT) (notably,
this is the mature sequence);
FIG. 87 shows a nucleotide sequence (SEQ ID No. 75) from
Streptomyces thermosacchari;
FIG. 88 shows an amino acid sequence (SEQ ID No. 76) from
Streptomyces thermosacchari;
FIG. 89 shows an amino acid sequence (SEQ ID No. 77) from
Thermobifida fusca/GDSx 548 amino acid;
FIG. 90 shows a nucleotide sequence (SEQ ID No. 78) from
Thermobifida fusca;
FIG. 91 shows an amino acid sequence (SEQ ID No. 79) from
Thermobifida fusca/GDSx;
FIG. 92 shows an amino acid sequence (SEQ ID No. 80) from
Corynebacterium efficiens/GDSx 300 amino acid;
FIG. 93 shows a nucleotide sequence (SEQ ID No. 81) from
Corynebacterium efficiens;
FIG. 94 shows an amino acid sequence (SEQ ID No. 82) from S.
coelicolor/GDSx 268 amino acid;
FIG. 95 shows a nucleotide sequence (SEQ ID No. 83) from S.
coelicolor;
FIG. 96 shows an amino acid sequence (SEQ ID No. 84) from S.
avermitilis;
FIG. 97 shows a nucleotide sequence (SEQ ID No. 85) from S.
avermitilis;
FIG. 98 shows an amino acid sequence (SEQ ID No. 86) from
Thermobifida fusca/GDSx;
FIG. 99 shows a nucleotide sequence (SEQ ID No. 87) from
Thermobifida fusca/GDSx;
FIG. 100 shows a nucleotide sequence from Aeromonas salmonicida
(SEQ ID No. 88) including the signal sequence (preLAT --positions 1
to 87);
FIG. 101 shows a polypeptide sequence of a lipid acyltransferase
enzyme from Streptomyces (SEQ ID No. 89);
FIG. 102 shows shows the amino acid sequence of a mutant Aeromonas
salmonicida mature lipid acyltransferase (GCAT) with a mutation of
Asn80Asp (notably, amino acid 80 is in the mature sequence) --shown
herein as SEQ ID No. 62--after undergoing post-translational
modification (SEQ ID No. 90);
FIG. 103 shows an alignment of the L131 and homologues from S.
avermitilis and T. fusca illustrates that the conservation of the
GDSx motif (GDSY (SEQ ID NO: 17) in L131 and S.avermitilis and T.
fusca), the GANDY (SEQ ID NO: 15) box, which is either GGNDA (SEQ
ID NO: 16) or GGNDL (SEQ ID NO: 18), and the HPT block (considered
to be the conserved catalytic histadine). These three conserved
blocks are highlighted (SEQ ID NOS 99-101 are disclosed
respectively in order of appearance);
FIG. 104. TLC (running buffer 5) of 10 butterfat samples,
mono-diglyceride and St 17 containing cholesterol, oleic acid and
cholesterol ester;
FIG. 105 TLC (running buffer 1) of 10 butterfat samples,
mono-diglyceride and St 8 containing cholesterol;
FIG. 106 TLC (running buffer 5) of butterfat samples 1(ref) and
2(enzyme). Reference St. 17 containing cholesterol, oleic acid and
cholesterol ester;
FIG. 107 TLC (running buffer 1) of butterfat sample 1(reference),
2(enzyme), mono-diglyceride and St 17 containing cholesterol, fatty
acid and cholesterol ester;
FIG. 108 TLC (running buffer 4) of butterfat sample 1 (reference),
2(enzyme) and St. 4 containing phosphatidylcholine (PC) and
lyso-phosphatidylcholine;
FIG. 109 TLC (running buffer 5) of cream sample 3(ref), 4(enzyme)
and reference St. 17 containing cholesterol, oleic acid and
cholesterol ester;
FIG. 110 TLC (running buffer 1) of cream sample 3(reference),
4(enzyme), mono-diglyceride and St 17 containing cholesterol, fatty
acid and cholesterol ester;
FIG. 111 TLC (running buffer 4) of cream sample 3(reference),
4(enzyme) and St. 4 containing phosphatidylcholine (PC) and
lyso-phosphatidylcholine;
FIG. 112 shows a ribbon representation of the 1IVN.PDB crystal
structure which has glycerol in the active site. The Figure was
made using the Deep View Swiss-PDB viewer;
FIG. 113 shows 1IVN.PDB Crystal Structure--Side View using Deep
View Swiss-PDB viewer, with glycerol in active site--residues
within 10 {acute over (.ANG.)} of active site glycerol are coloured
black;
FIG. 114 shows 1IVN.PDB Crystal Structure--Top View using Deep View
Swiss-PDB viewer, with glycerol in active site--residues within 10
{acute over (.ANG.)} of active site glycerol are coloured
black;
FIG. 115 shows alignment 1 (1DEO (SEQ ID NO: 102); 1IVN (SEQ ID NO:
103); P10480 (SEQ ID NO: 104);
FIG. 116 shows alignment 2 (1DEOm (SEQ ID NO: 105); 1IVNm (SEQ ID
NO: 106); P10480m (SEQ ID NO: 107);
FIGS. 117 [1DEO (SEQ ID NO: 102); 1IVN (SEQ ID NO: 103); P10480
(SEQ ID NO: 104); 1DEOm (SEQ ID NO: 105); 1IVNm (SEQ ID NO: 106);
P10480m (SEQ ID NO: 107)]and 118 (SEQ ID NOS 108 & 109) show an
alignment of 1IVN to P10480 (P10480 is the database sequence for A.
hydrophila enzyme), this alignment was obtained from the PFAM
database and used in the model building process;
FIG. 119 shows an alignment where P10480 is the database sequence
for Aeromonas hydrophila. This sequence is used for the model
construction and the site selection. Note that the full protein
(SEQ ID No. 36) is depicted, the mature protein (equivalent to SEQ
ID No. 73) starts at residue 19. A.sal is Aeromonas salmonicida
(SEQ ID No. 3) GDSX lipase, A. hyd is Aeromonas hydrophila (SEQ ID
No. 73) GDSX lipase. The consensus sequence contains a * at the
position of a difference between the listed sequences;
FIG. 120 shows a diagram which illustrates the addition of enzyme
to each vat., Han PL is Lecitase, Dan PL is KLM3 a lipid
acyltransferase according to the present invention;
FIG. 121 shows a TLC (solvent 6) of lipid extracted from cream and
a standard mixture (ST16) of phospholipids; Phosphatidylcholine
(PC); Lyso-phosphatidylcholine (LPC); Phosphatidylinisitol (PI);
Phosphatidylethanolamine (PE); 5.13% Phosphatidic acid (PA); and
Spingholipid (SG);
FIG. 122 shows a TLC (solvent 1) of lipid extracted from cream and
a standard mixture of free fatty acids (FFA), cholesterol (CHL) and
cholesterol ester (CHL-ester);
FIG. 123 shows the ANOVA evaluation of cholesterol in enzyme
treated cream (30%) analyzed by TLC (Table 43), A=control,
B=Lecitase and C=KLM3';
FIG. 124 shows the ANOVA evaluation of Fatty acids in enzyme
treated cream (30%) analyzed by TLC (Table 43), A=control,
B=Lecitase and C=KLM3';
FIG. 125 shows ANOVA evaluation of cholesterol analyzed by GLC
(Table 44) A=control, B=Lecitase and C=KLM3';
FIG. 126 shows the ANOVA evaluation of cholesterol ester analyzed
by GLC (Table 44) A=control, B=Lecitase and C=KLM3';
FIG. 127 shows the ANOVA evaluation of Sum FFA (palmetic acid,
C:16:0+oleic acid, C18:1+Linoleic acid, C18:2+stearic acid, C18.0)
analyzed by GLC (Table 44) A=control, B=Lecitase and C=KLM3';
FIG. 128 shows a TLC (solvent 6) of lipid extracted from cheese and
a standard mixture of free fatty acids (FFA), cholesterol (CHL) and
cholesterol ester (CHL-ester);
FIG. 129 shows a TLC (solvent 6) of lipid extracted from cheese and
a standard mixture of phospholipids: Phosphatidylcholine (PC),
Lyso-phosphatidylcholine (LPC), Phosphatidylinisitol (PI),
Phosphatidylethanolamine (PE) and Phosphatidic acid (PA);
FIG. 130 shows the ANOVA evaluation of cholesterol in cheese
analyzed by GLC (Table 45) A=control, B=Lecitase and C=KLM3';
FIG. 131 shows the ANOVA evaluation of cholesterol ester in cheese
analyzed by GLC (Table 45) A=control, B=Lecitase and C=KLM3';
FIG. 132 shows the ANOVA evaluation of Oleic acid (C18:1)+linoleic
acid (C18:2) in cheese analyzed by GLC (Table 45) A=control,
B=Lecitase and C=KLM3';
FIG. 133 shows the ANOVA evaluation of Palmetic acid (C16:0),
Stearic acid (C18:0), Oleic acid (C18:1)+linoleic acid (C18:2) in
cheese analyzed by GLC (Table 45) A=control, B=Lecitase and
C=KLM3';
FIG. 134 shows a diagram depicting force as an outcome of mass,
acceleration and deflection properties of target material;
FIG. 135 shows the photos of the control samples DAN011 (left) and
the cheese produced with KLM3 DAN013 (right). 5 minutes standing
after heating step;
FIG. 136 shows Pizza baked with cheese DAN011 (left), DAN012
(centre) and DAN013 (right);
FIG. 137 shows a gene construct used in Example 32;
FIG. 138 shows a codon optimised gene construct (no. 052907) used
in Example 32; and
FIG. 139 shows the sequence of the XhoI insert containing the
LAT-KLM3' precursor gene, the -35 and -10 boxes are underlined (SEQ
ID NOS 110 & 111); and
FIG. 140 shows BML780-KLM3'CAP50 (comprising SEQ ID No. 90--upper
colony) and BML780 (the empty host strain--lower colony) after 48 h
growth at 37.degree. C. on 1% tributyrin agar.
EXAMPLES
Except where stated TLC analysis was performed as described in
Example 6 and GLC analysis was performed as described in Example
11.
Example 1
The Cloning, Sequencing and Heterologous Expression of a
Transferase from Aeromonas salmonicida subsp. Salmonicida
Strains Used:
Aeromonas salmonicida subsp. Salmonicida (ATCC 14174) was obtained
from ATCC and grown overnight at 30.degree. C. in Luria-Bertani
medium (LB). The cells were centrifuged and genomic DNA was
isolated using the procedures for genomic DNA isolation from Qiagen
Ltd. Genomic DNA buffer set (cat. 19060), protease K (cat. 19131)
and RNAse A (cat. 19101) were all obtained from Qiagen Ltd.
(Boundary court Gatwick Court, West Sussex, RH10 2AX).
Host bacterial strain BL21(DE3)pLysS (Novagen) was used for
production of the recombinant Aeromonas enzymes. Competent cells of
BL21(DE3)pLysS were used as host for transformation with the
expression vector pet12-AsalGCAT=pSM. Transformants containing the
appropriate plasmid were grown at 37.degree. C. in LB agar medium
containing 100-ug ampicillin/ml.
Construction of Expression Vector pet12-AsalGCAT-pSM:
For all DNA amplifications of the transferase genes from Aeromonas,
genomic DNA (0.2-1 ul) was used as template and pfu DNA polymerase
(2.5 units) was used with 10 ul of 10.times. pfu buffer, 1 ul each
primer (50 pmol/ul), 200 uMdNTP in a total reaction volume of 100
ul. PCR reactions were performed in a programmable thermal cycler
using the following conditions: 95.degree. C. for 30 seconds, 30
cycles of 95.degree. C. for 30 seconds, 60.degree. C. for 1 minute
and 68.degree. C. for 2 minutes. An additional extension of 5
minutes at 72.degree. C. was applied.
The PCR amplification of the transferase gene from A. salmonicida
was carried in 2 separate PCR reactions. PCR reaction 1 was
performed using primer pairs, as1USNEW(5'AGCATATGAAAA AATGGTTTGT
TTGTTTATTG GGG 3' [SEQ ID No. 56]) and asls950new (5' GTG ATG GTG
GGC GAG GAA CTC GTA CTG3' [SEQ ID No. 37]). A second PCR reaction
was performed to incorporate a C-terminal Histidine tag using the
PCR product from the first reaction and the primers:
as1USNEW(5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG 3' [SEQ ID No.
38]) and AHLS1001(5'TTGGATCC GAATTCAT CAATG GTG ATG GTG ATG GTG
GGC3' [SEQ ID No. 39]). The PCR product from the second reaction
was purified and digested with restriction enzymes Ndel and BamHI.
2 ug of pET 12a vector DNA was also digested with restriction
enzymes Ndel and BamHI and treated with phosphatase. The
restriction enzyme-treated pet12a and PCR product from reaction 2
were purified and ligated using the Rapid Ligation Kit (Roche,
Switzerland). The ligation mix was used to transform E. coli TOP10
cells. Transformants were plated on LB agar medium containing 100
ugm1 ampicillin.
The T7 promoter primer (5'TAATACGACTCACTATAG3' [SEQ ID No. 40]) and
the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3' [SEQ ID No. 41])
were used to verify the sequences and the orientation of the cloned
transferase genes in pET12a vector. DNA sequencing was performed
using ABI Prism.RTM. BigDye.TM. Terminators Cycle sequencing kit
with 500 ng plasmid DNA as template and 3.2 pmol T7 promoter and
terminator primers.
The construct shown in FIG. 35 was used to transform competent
bacterial host strain BL21(DE3)pLysS (Novagen) and ampicillin
resistant transformants were picked and used for expression
analysis.
Expression of the Recombinant Aeromonas salmonicida Lipid
Acyltransferase
Quantification of enzyme activity towards lecithin was determined
on cell extracts using Non-Esterified Fatty Acid (NEFA) kit (Roche,
Switzerland).
In FIG. 36, BL21(DE3)pLysS harboring the expression vector
pet12-AsalGCAT=pSM was grown in LB medium+100 ug/ml ampicillin and
incubated with shaking at 37.degree. C. until OD.sub.600=0.6 to1.0
is reached. The cultures are then induced using IPTG (0.4 mM) and
incubation was continued for the next 3 hours. Samples where taken
at 0 hour, 1, 2, and 3 hours after IPTG induction. Enzyme Activity
was tested using the NEFA kit and lecithin as substrate.
Growth Optimisation for the Production of More Active Enzymes
BL21(DE3)pLysS harboring the expression vector pet12-AsalGCAT=pSM
was grown in LB medium+100 ug/ml ampicillin and incubated with
shaking at different growth temperatures (37.degree. C., 30.degree.
C., & 20.degree. C.). The optimal condition for the production
of active lipid acyltransferase enzyme was when cultures are grown
at 30.degree. C. as shown in FIG. 37.
Partial Purification of Recombinant Aeromonas salmonicida
Transferase
Strain BL21(DE3)pLysS harboring the expression vector
pet12-AsalGCAT=pSM was grown at 37.degree. C. & crude cell
extracts were prepared by sonication. The recombinant enzyme was
further purified from the sonicated crude cell extracts using the
Ni-NTA spin kit from Qiagen. Phospholipase activity using the NEFA
kit & Lecithin as substrate. Crude cell extracts from
BL21(DE3)pLysS expressing active transferase incubated with the
substrate lecithin and reaction mixture was analysed using thin
layer chromatography showing the presence of degradation products
(see FIG. 38).
Partial Purification of Recombinant Aeromonas salmonicidae
Transferase.
Strain BL21(DE3)pLysS harbouring the expression vector
pet12-AsalGCAT=pSM was grown at 37.degree. C. and crude cell
extracts were prepared by sonication. The recombinant enzyme ware
further purified from the sonicated crude cell extract using the
Ni-NTA spin kit from Qiagen. Phospholipase activity using the NEFA
kit and lecithin as substrate was tested (see FIG. 39).
Example 2
Cloning and Expression of Aeromonas hydrophila Transferase in E.
coli
Aeromonas hydrophila (ATCC # 7965) was obtained from ATCC and grown
overnight at 30.degree. C. in Luria-Bertani medium (LB). The cells
were centrifuged and genomic DNA was isolated using the procedures
for genomic DNA isolation from Qiagen Ltd. Genomic DNA buffer set
(cat. 19060), protease K (cat. 19131) and RNAse A (cat. 19101) were
all obtained from Qiagen Ltd. (Boundary court Gatwick Court, West
Sussex, RH10 2AX).
Host bacterial strain BL21(DE3)pLysS (Novagen) was used for
production of the recombinant Aeromonas enzymes. Competent cells of
BL21(DE3)pLysS were used as host for transformation with the
expression vector pet12a-A.h.GCAT=pSMa. Transformants containing
the appropriate plasmid were grown at 37.degree. C. in LB agar
medium containing 100-ug ampicillin/ml.
Construction of Expression Vector pet12a-A.h.GCAT-pSMa:
For all DNA amplifications of the transferase gene from Aeromonas,
genomic DNA (0.2-1 ul) was used as template and pfu DNA polymerase
(2.5 units) was used with 10 ul of 10.times.pfu buffer, 1 ul each
primer (50 pmol/ul), 200 uMdNTP in a total reaction volume of 100
ul. PCR reactions were performed in a programmable thermal cycler
using the following conditions: 95.degree. C. for 30 seconds, 30
cycles of 95.degree. C. for 30 seconds, 60.degree. C. for 1 minute
and 68.degree. C. for 2 minutes. An additional extension of 5
minutes at 72.degree. C. was applied.
The PCR amplification of the transferase gene from A. hydrophila
(ATCC # 7965) was carried out in 2 separate PCR reactions.
PCR reaction 1 was performed using primer pairs, AHUS1
(5'GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3', SEQ ID No. 42) and
ahls950 (5'ATGGTGATGGTGGGCGAGGAACTCGTACTG3', SEQ ID No. 43).
A second PCR reaction was performed to incorporate a C-terminal
Histidine tag using the PCR product from the first reaction and the
primer pairs: AHUS1(5'GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3'
SEQ ID No. 44,) and
AHLS1001(5'TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3' SEQIDNo.
45).
The PCR product from the second reaction was purified and digested
with restriction enzymes Nde1 and BamHI. 2 ug of pET 12a vector DNA
was also digested with restriction enzymes Nde1 and BamHI and
treated with phosphatase. The restriction enzyme-treated pet12a and
PCR product from reaction 2 were purified and ligated using the
Rapid Ligation Kit (Roche, Switzerland). The ligation mix was used
to transform E. coli TOP10 cells. Transformants were plated on LB
agar medium containing 100 ug/ml ampicillin.
The T7 promoter primer (5'TAATACGACTCACTATAG3') (SEQ ID NO: 57) and
the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3') (SEQ ID NO: 58)
were used to verify the sequences and the orientation of the cloned
GCAT genes in pET12a vector. DNA sequencing was performed using ABI
Prism.RTM. BigDye.TM. Terminators Cycle sequencing kit with 500 ng
plasmid DNA as template and 3.2pmol T7 promoter and terminator
primers.
The construct shown in FIG. 40 was used to transform competent
bacterial host strain BL21 (DE3)pLysS (Novagen) and ampicillin
resistant transformants were picked and used for expression
analysis.
Expression of the Aeromonas hydrophila Transferase in
BL21(DE3)pLysS
The E. coli strain BL21(DE3)pLysS harboring the expression vector
pet12a-A.h.GCAT=pSMa was grown in LB medium+100 ug/ml ampicillin
and incubated with shaking at 37.degree. C. until OD.sub.600=0.6 to
1.0 is reached. The cultures are then induced using IPTG (0.4 mM)
and incubation was continued for the next 3 hours. Samples where
taken at 0 hour, 1, 2, and 3 hours after IPTG induction. Enzyme
Activity was tested using the NEFA kit and lecithin as substrate
(FIG. 41).
Growth Optimisation for the Production of More Active Enzymes
BL21(DE3)pLysS harboring the expression vector pet12a-A.h.GCAT=pSMa
was grown in LB medium+100 ug/ml ampicillin and incubated with
shaking at different growth temperatures (37.degree. C., 30.degree.
C., & 20.degree. C.). The optimal condition for the production
of active GCAT enzyme was when cultures are grown at 30.degree. C.
as shown in FIG. 42.
Partial Purification of Recombinant A. hydrophila Transferase
(GCAT)
Strain BL21(DE3)pLysS harboring the expression vector
pet12a-A.h.GCAT=pSMa was grown at 37.degree. C. & crude cell
extracts were prepared by sonication. The recombinant enzyme was
further purified from the sonicated crude cell extracts using the
Ni-NTA spin kit from Qiagen. Phospholipase activity assay using the
NEFA kit & Lecithin as substrate. (FIG. 43).
Example 3
Expression of Aeromonas Transferases in Bacillus subtilis 163
Plasmid Construction
Two different Bacillus subtilis expression vectors (pUB 110 &
pBE5) were used for the heterologous expression of the Aeromonas
genes in Bacillus subtilis. The pUB110 vector contains the alpha
amylase promoter while the pBE vector has the P32 promoter as the
regulatory region for the expression of the fused Aeromonas genes.
In pUB110, the first amino acid of the mature GCAT genes of
Aeromonas were fused in frame with the last amino acid of the
xylanase signal peptide sequence from Bacillus subtilis via the
restriction site Nhe1, creating an additional 2 amino acids in
front of the mature proteins. pBE5 contains the cgtase signal
sequence fusion at the Nco1 site for secretion of the recombinant
proteins into the culture filtrate.
PCR reactions were carried out to obtain the Aeromonas genes fuse
in frame to the signal sequences of the pUB 110 and the pBE5
vectors. PCRs were performed using the following primer pairs for
A. hydrophila gene:
PCR reaction 1: usAHncol (5'ATGCCATGGCCGACAGCCGTCCCGCC3', SEQ ID
No. 46) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID No.
47)
PCR reaction 2: US-Ahnhel (5'TTGCTAGCGCCGACAGCCGTCCCGCC3', SEQ ID
No. 48) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3, SEQ ID No. 49)
PCRs were performed using the following primer pairs for A.
salmonicida gene:
PCR reaction 3: US-Asncol (5'TTGCCATGGCCGACACTCGCCCCGCC3', SEQ ID
No. 50) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID No.
51)
PCR reaction 4: US-ASnhel (5'TTGCTAGCGCCGACACTCGCCCCGCC3', SEQ ID
No. 52) and lsAH (5'TTGGATCCGAATTCATCAATGGTGATG3', SEQ ID No.
53)
All the PCR products were cloned into PCR blunt II (TOPO vector)
and sequenced with reverse & forward sequencing primers.
Clones from PCR reactions 1 & 3 were cut with Nco1 & Bam HI
and used as inserts for ligation to the pBE5 vector cut with
Nco1/BamH1/phosphatase. Clones from PCR reactions 2 & 4 were
cut with Nhe1 & Bam H1 and used as inserts for ligation to the
pUB vector that was cut with Nhe1/BamH1/phosphatase.
Expression of the Aeromonas Transferase genes in Bacillus subtilis
and characterization of the Enzyme Activity.
The acyl transferases from the two Aeromonas species have been
successfully expressed in E. coli (results above). The Bacillus
pUB110 & pBE5 gene fusion constructs were used to transform
Bacillus subtilis and transformants were selected by plating on
kanamycin plates. The kanamycin resistant transformants isolated
and grown in 2.times.YT are capable of heterologous expression of
the Aeromonas genes in Bacillus. The culture filtrates have
digalactosyldiacylglycerol (DGDG) galactolipase activity, in
addition to having both acyl transferase and phospholipase
activities. The activity towards digalactosyldiacylglycerol (DGDG)
was measured after 60 minutes of incubation of culture supernatant
with the substrate, DGDG from wheat flour (obtainable form Sigma)
as well as the activity towards lecithin as shown in FIG. 44.
Bacillus produced the enzyme after overnight (20-24 hours) to 48
hours of cultivation in the culture medium as a secreted protein.
In some instances, the expression of the Aeromonas genes has been
shown to interfere with cell viability and growth in Bacillus &
E. coli, it is therefore necessary to carefully select expression
strains and optimise the growth conditions to ensure expression.
For example, several Bacillus host strains (B.s 163, DB104 and OS
21) were transformed with the expression vectors for growth
comparison. B.s163 is transformable with the 2 Aeromonas genes and
is capable of expressing active protein. DB104 is transformable
with all the constructs but is only able to express A. salmonicida
transferase.
Example 4
Fermentation and Purification of Aeromonas Lipid Acyltransferases
Produced in E. coli
E. coli Fermentations:
Microorganisms
Two strains of Eschericia coli, one containing an Aeromonas
hydrophila (Example 2) lipid acyltransferase and two containing
Aeromonas salmonicida lipid acyltransferases, (Example 1) were used
in this study.
The E. coli strain containing the A. hydrophila gene was named
DIDK0124, and the E. coli strain containing the A. salmonicida gene
was named DIDK0125. The fermentation with DIDK0124 was named
HYDRO0303 and the fermentation with DIDKO125 was named SAL0302. The
purified protein from HYDRO025 was named REF#138. The purified
protein from HYDRO0303 was named REF#135.
Growth Media and Culture Conditions
LB-agar
The LB agar plates used for maintaining the strains contained: 10
g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, 15 g/L agar, 100
mg/L ampicillin and 35 mg/L chloramphenicol. The agar plates were
incubated at 30.degree. C.
LB Shake Flask
The LB medium (50 mL pr shake flask) used for production of
inoculum material for the bioreactor cultivations contained: 10 g/L
tryptone, 5 g/L yeast extract, 5 g/L NaCl, 100 mg/L ampicillin and
35 mg/L chloramphenicol. The shake flasks were inoculated from the
LB agar plates, and incubated at 30.degree. C. and 200 rpm.
Bioreactor Cultivation
The bioreactor cultivations were carried out in 6 L in-house built
bioreactors filled with 4 L medium containing: 10 g/L tryptone, 5
g/L yeast extract, 5 g/L NaCl, 8 g/L KH.sub.2PO.sub.4, 0.9 g/L
MgSO.sub.4, 7H.sub.2O, 40 g/L glucose monohydrate, 0.4 mL/ADD
APT.RTM. Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The
Netherlands), 10 mg/L (NH.sub.4).sub.2Fe(SO.sub.4).sub.2.6H.sub.2O,
0.7 mg/L CuSO.sub.4.5H.sub.2O, 3 mg/L ZnSO.sub.4.7H.sub.2O, 3 mg/L
MnSO.sub.4H.sub.2O, 10 mg/L EDTA, 0.1 mg/L NiSO.sub.4.6H.sub.2O,
0.1 mg/L CoCl.sub.2, 0.1 mg/L H.sub.3BO.sub.4, 0.1 mg/L KI, 0.1
mg/L Na.sub.2MoO.sub.4.2H.sub.2O, 1 g/L ampicillin and 35 mg/L
chloramphenicol.
The bioreactors were inoculated with an amount of LB culture
ensuring end of growth after approximately 20 hours of cultivation
(calculated from the maximum specific growth rate of 0.6 h.sup.-1,
the OD.sub.600 of the LB shake flask and the final OD.sub.600 in
the bioreactor of approximately 20).
SAL0302 was inoculated with 10 mL of LB culture, and HYDRO0303 was
inoculated with 4 mL of LB culture.
The bioreactors were operated at the following conditions:
temperature 30.degree. C., stirring 800-1000 rpm (depending on
experiment), aeration 5 L/min, pH 6.9, pH control 8.75% (w/v)
NH.sub.3-water and 2 M H.sub.2SO.sub.4. Induction was achieved by
addition of isopropyl .beta.-D-thiogalactoside to a final
concentration of 0.6 mM, when 0.4 moles (HYDRO0303) and 0.7 moles
CO.sub.2 was produced respectively.
Harvest
The following procedure was used for harvest and homogenisation of
the biomass: 1) The fermentation broth from the fermentations was
centrifuged at 5000.times.g and 4.degree. C. for 10 minutes, and
the supernatant was discharged. The biomass was stored at
-20.degree. C. until use. The biomass was thawed and resuspended in
500 mL of 20 mM NaH.sub.2PO.sub.4, pH 7.4, 500 mM NaCl, 10 mM
Imidazole and Complete (EDTA-free) protease inhibitor (Roche,
Germany). 2) The suspended biomass was homogenized at 2 kbar and
4.degree. C. in a cell disrupter from Constant Systems Ltd
(Warwick, UK). 3) The cell debris was removed by centrifugation at
10.000.times.g and 4.degree. C. for 30 minutes followed by
collection of the supernatant. 4) The supernatant was clarified
further by centrifugation at 13.700.times.g and 4.degree. C. for 60
minutes, followed by collection of the supernatant. 5) The
supernatant was filtered through 0.2 .mu.m Vacu Cap filters (Pall
Life Sciences, UK) and the filtrate was collected for immediate
chromatographic purification. Chromatographic Purification of the
Transferases
A column (2.5.times.10 cm) was packed with 50 ml of Chelating
Sepharose ff. gel and charged with Ni-sulphate (according to the
method described by manufacturer, Amersham Biosciences). The column
was equilibrated with 200 ml of 20 mM NaH.sub.2PO.sub.4, pH 7.4,
500 mM NaCl, 10 mM Imidazole. 400 ml of crude was applied to the
column at a flow rate of 5 ml/min. The column was then washed with
20 mM NaH.sub.2PO.sub.4, pH 7.4, 500 mM NaCl, 10 mM Imidazole until
the UV280 reached the base line. The GCAT was then eluted with 40
ml of 20 mM NaH.sub.2PO.sub.4, pH 7.4, 500 mM NaCl and 500 mM
Imidazole.
Example 5
Fermentation and Purification of Aeromonas Lipid Acyltransferases
Produced in Bacillus subtilis
Fermentations
BAC0318-19, BAC0323-24 Microorganism
The microorganisms used in this study originate from transformation
of a Bacillus subtilis host strain, #163 with a plasmid containing
the gene encoding the Aeromonas salmonicida transferase inserted in
the vector pUB110OIS. The expression of the gene is controlled by
an alpha-amylase promoter, and the secretion of the transferase is
mediated by the B. subtilis xylanase signal sequence (Example 3).
The strains were named DIDK0138 (fermentation BAC0318-19) and
DIDK0153 (fermentation BAC0323-24).
Growth Media and Culture Conditions
Pre Culture Medium
A shake flask (500 mL total volume, with baffles) was added 100 mL
of a medium containing:
TABLE-US-00006 NaCl 5 g/L K.sub.2HPO.sub.4 10 g/L Soy flour 20 g/L
Yeast extract, BioSpringer 106 20 g/L Antifoam, SIN260 5 mL/L
PH was adjusted to 7.0 before autoclaving
After autoclaving 6 mL 50% (w/w) Nutriose were added pr flask.
Kanamycin was added at a concentration of 50 mg/L after
autoclaving.
Inoculation
A pre culture shake flask was inoculated with frozen culture
directly from a 25% (w/v) glycerol stock. The shake flask was
incubated at 33.degree. C. and 175 rpm for approximately 16 hours,
whereupon 50 mL was used to inoculate the fermentor.
Fermentations
The fermentations were carried out in 6 L in house built
fermentors.
The batch medium (3 L) contained:
TABLE-US-00007 Corn steep liquor (50% dw) 40 g/L Yeast extract
BioSpringer 153 (50% dw) 10 g/L NaCl 5 g/L CaCl.sub.2, 2H.sub.2O
0.25 g/L Mn(NO.sub.3).sub.2, H.sub.2O 0.2 g/L Antifoam SIN260 1
mL/L Kanamycin (filter sterilised to the fermentor 50 mg/L after
autoclaving
The feed contained:
TABLE-US-00008 Glucose monohydrate 540 g/kg MgSO.sub.4, 7H.sub.2O
4.8 g/kg Antofoam SIN260 4 mL/kg Yeast extract, BioSpringer 153
(50% dw) 150 g/kg (autoclaved separately)
The feed in fermentation BAC0318 and BAC0323 was started based on
the accumulated CO.sub.2, according to the equations below:
Feed-flow[g/h]=0, AcCO.sub.2<0.15 Feed-flow[g/h]=2.85+t1.54,
AcCO.sub.2.gtoreq.0.15 and t<12 Feed-flow[g/h]=21.3, t>12 t:
time (hours) from the point when the accumulated CO.sub.2
(AcCO.sub.2) reached 0.15 moles.
The feed in fermentation BAC0319 and BAC0324 was started based on
the accumulated CO.sub.2, according to the equations below:
Feed-flow[g/h]=0, AcCO.sub.2<0.15 Feed-flow[g/h]=2.0+t1.08,
AcCO.sub.2.gtoreq.0.15 and t<12 Feed-flow[g/h]=15, t>12 t:
time (hours) from the point when the accumulated CO.sub.2
(AcCO.sub.2) reached 0.15 moles.
The pH was controlled at 7.0 by adding 12.5% (w/v) NH.sub.3-water
or 2M phosphoric acid.
The aeration was 3 L/min corresponding to 1 vvm.
The temperature was 33.degree. C.
The fermentor was equipped with two 8 cm O Rushton impellers placed
with a distance of 10 cm.
Harvest
The biomass was removed by centrifugation at 16,000.times.g for 10
minutes at room temperature. The supernatant was filter sterilized,
and the filtrate was used for purification and application
tests.
Example 6
Application Tests in Egg Yolk
In the following experiments the isolated transferase from
Aeromonas salmonicida expressed in E-coli was tested in egg yolk
alone and in egg yolk where a plant sterol had been added. Material
Transferase from Aeromonas salmonicida REF#138 Egg yolk: from fresh
egg (hens eggs) Plant sterol: .beta.-sitosterol, Sigma S 5753 TLC
plates: Silica plates Merck nr. 1.05715.0001 TLC analysis.
TLC-plate was activated in a heat cupboard (110.degree. C.) for 1/2
h.
100 ml developing solvent was poured into a chromatography camber
with lid. The walls of the chamber were covered with filter paper
(Whatman 2) in order to saturate the chamber with the solvent
vapor.
The TLC-plate was placed in a frame and the sample was applied onto
the TLC plate 2 cm from the bottom. The TLC plate was then placed
in the TLC chamber with the developing solvent. When the developing
solvent reached 14 cm from the bottom of the plate. The TLC plate
was taken out and dried in fume board, and then placed in the heat
cupboard at 110.degree. C. for 10 minutes.
The TLC-plate was then immersed in the developing reagent, and
dried in the heat cupboard at 110.degree. C. for 15 minutes
Developing Solvent: Nr. IV:Chloroform:Methanol:H.sub.2O (65:25:4)
Nr. I:P-ether:MTBE:Acetic acid (60:40:1) Developing Buffer
(Vanadate-Buffer): 32 g Na.sub.2CO.sub.3 ad 300 ml H.sub.2O (1M)
18.2 g vanadate pentoxide (V.sub.2O.sub.5) is added and dissolved
during gentle heating. The solution is cooled to ambient. Carefully
460 ml 2.5 M H.sub.2SO.sub.4. (460 ml H.sub.2O+61 ml
H.sub.2SO.sub.4) is added Water is added to 1000 ml. Phospholipase
Activity. Substrate: 0.6% L-.alpha. Phosphatidylcholine 95% Plant
(Avanti #441601)+0.4% Triton-X 100(Sigma X-100)+5 mM CaCl.sub.2 is
dissolved in 0.05M HEPES buffer pH 7. Procedure.
400 .mu.l substrate was added to an 1.5 ml Eppendorf tube and
placed in a Eppendorf thermomixer at 30.degree. C. for 5
minutes.
To the time T=0 50 .mu.l enzyme solution was added. Also a blank
with water instead of enzyme was analysed.
The sample was mixed at 1000 rpm on Eppendorf Termomixer at
30.degree. C. for 10 minutes. To the time T=10 min. The Eppendorf
tube was placed in another termomixer at 99.degree. C. for 10
minutes to stops the reaction.
Free fatty acid in the samples were analyzed by using the NEFA kit
from WAKO GmbH.
Enzyme activity PLU-7 pH 7 was calculated as micromole fatty acid
produced per minute under assay conditions.
Lipid Extraction.
1 g egg yolk and 7.5 ml Chloroform:Methanol 2:1 was mixed on a
Whirley and centrifuged at 750.times.g for 10 minutes.
3 ml of the chloroform phase was isolated and used for further
lipid analysis.
Results:
The transferase (REF#138), from Aeromonas salmonicida expressed in
E-coli was analysed for phospholipase activity as described above,
and was also tested in egg yolk with and without .beta.-sitosterol.
The sample was stirred with a magnetic stirrer during the reaction.
The experimental design is shown in Table 1
TABLE-US-00009 TABLE 1 Reaction time Test at 37.degree. C. Egg yolk
Sitosterol Transferase #138 Nr Minutes gram mg Units 1 30 1 40 2 30
1 40 0.75 PLU 3 30 1 80 0.75 PLU 4 120 1 40 0.75 PLU 5 120 1 80
0.75 PLU 6 300 1 40 0.75 PLU 8 300 1 40
The reaction was stopped by adding 7.5 ml Chloroform:Methanol (2:1)
and mixed on a Whirley mixer for 30 seconds. The chloroform phase
was isolated by centrifugation and 2 .mu.l of the chloroform phase
was transferred to a pre-activated silica TLC plate and eluted with
developing solvent nr. I, and another TLC-plate in developing
solvent IV.
The results from the TLC analysis are shown in FIGS. 45 and 46.
Transferase reaction with a transferase from Aeromonas salmonicida
in egg yolk where plant sterol was added has shown that the enzyme
transfers fatty acid from lecithin in the egg yolk to the
cholesterol during formation of cholesterol ester. The TLC
chromatogram also indicated that part of the sterol added to egg
yolk was transferred to sterol ester.
The amount of sterol ester relative to the amount of cholesterol
ester formed during the reaction can be analysed by HPLC or
GLC.
It is known that plant sterol esters reduce the absorption of
cholesterol in the intestine. It is also indicated in the
literature that cholesterol esters are absorbed less than free
cholesterol in the intestine. When a transferase and plant sterol
is added to egg yolk a product with causes reduced cholesterol
absorption is obtained, and at the same time lysolecithin is
produced which improves the emulsification properties of the egg
yolk. A further advantage of adding transferase and plant sterol to
egg yolk is that plant sterol ester is ingested together with the
natural available cholesterol, which is expected to have the
highest effect on the reduction of cholesterol absorption.
Example 7
Modification of Egg Yolk by Lipid Acyl Transferase from Aeromonas
salmonicida
In accordance with the present invention it has now been shown that
it is possible to produce lysolecithin from egg yolk without
substantial free fatty acid formation by use of a transferase.
The lecithin content of egg yolk is an important emulsifier for the
production of mayonnaise with the limitation that the mayonnaise is
not heat stable. It has therefore been known for several years to
use a phospholipase from pancreas to modify lecithin in egg yolk to
lysolecithin, which is a more efficient emulsifier. The use of
enzyme modified egg yolk in mayonnaise production contributes to
better heat stability of the mayonnaise during pasteurisation. A
limitation of using pancreas phospholipase in egg yolk is that the
amount of free fatty acid also increases, which contributes to
reduced oxidative stability because free fatty acids are more prone
to oxidation than the corresponding ester. Free fatty acid may also
contribute to a soapy off taste.
The transferase from Aeromonas salmonicida was successfully
expressed in B. subtilis and fermented in lab scale as described in
Example 5, purified by liquid chromatography and used to modify egg
yolk lipids. The enzyme modified egg yolk was used to produce heat
stable mayonnaise.
The transferase from A. salmonicida can be used to produce
lysolecithin and cholesterol ester in egg yolk without production
of significant amounts of free fatty acids. That is to say without
increasing or substantially increasing the free fatty acids in the
foodstuff.
The enzyme modified egg yolk produced by transferase showed
improved emulsification properties and can be used for heat stable
mayonnaise.
This enzyme was highly functional in modification of egg yolk by
catalysing the lipid transfer reaction between lecithin and
cholesterol FIG. 47.
This study further investigated the use of transferase for
modification of egg yolk and the use of modified egg yolk in the
production of heat stable mayonnaise.
This example describes the fermentation, isolation, and application
of the transferase in egg yolks as well as the application of the
enzyme modified egg yolk in mayonnaise. The example is divided into
two parts:
A. Application of Transferase in Egg Yolk
B. Testing of Enzyme Modified Egg Yolk in Mayonnaise
Experimental
A. Application
Enzyme and Substrate Transferase # 178-9 from A. salmonicida,
purification 2554-100 C73, 15 PLU-7/ml. Transferase # 179 from A.
salmonicida, 18.5 PLU-7/ml. Phospholipase A1 LECITAS.TM. Ultra
(Novozymes A/S, Denamrk) Egg yolk: Liquid egg yolk with 8% salt,
SANOVA FOODS, DK
TLC analysis was performed as described previously (see above
Example 6).
Phospholipase activity: See previous examples.
Lipid Extraction
1 g egg yolk and 7.5 ml Chloroform:Methanol 2:1 was mixed on a
Whirley for 30 sec. and centrifuged at 750.times.g for 10
minutes.
4 ml of the chloroform phase was isolated and used for further
lipid analysis.
Oxidation Stability Test
Oxidation stability of mayonnaise was measured in an ML OXIPRESS
equipment where the sample is oxidative stressed by means of heat
under pressure in an oxygen atmosphere.
After a certain time, called the induction period (IP), the
oxidation of the sample causes a certain consumption of oxygen,
which is registered as pressure change of a pressure transducer.
Higher induction period indicates better oxidation stability.
Procedure.
5-gram mayonnaise is placed in a glass container and the glass
container is closed with the pressure transducer. The container is
filled with oxygen to 5 bars. The valve is opened to empty the
container. This procedure is repeated twice and the sample with 5
bar oxygen atmosphere is placed at 80.degree. C. The oxygen
pressure as a function of time is measured and the induction period
(IP) calculated in hours.
Results
Purified transferase from Aeromonas salmonicide sample no. #179 and
#178-9 were used to treat egg yolk as outlined in Table 2. The
initial test has shown that GCAT transferase should be added with
much lower phospholipase (PLU) activity, than a commercial
Phospholipase. This is explained by the fact that GCAT is a
transferase and therefore has much lower hydrolytic activity than a
normal phospholipase.
TABLE-US-00010 TABLE 2 # 3108, 2344-44 C89 Lecitase Ultra Sanofo
egg 18.5 PLU-7/ml Transferase 1500 PLU- yolk 8% salt Transferase
#178-9 7/ml Egg yolk #179 18.5 PLU-7/ml 7/ml Water nr gram gram
gram ml gram PLU-7/ml 6 120 2.00 8.00 0.31 7 120 10 0 1.25 8 120
1.86 8.14 23.25 9 120 10 0
The enzymatic reactions were conducted by scaling the egg yolk and
the enzyme in a beaker. The samples were placed in a heating
cabinet at 37.degree. C. during slow agitation. After 1, 2 and 4
hours reaction time a sample was taken out for TLC analysis. After
4 hours reaction time the product was stored at 5.degree. C. and
used for mayonnaise experiments.
The TLC analyses of lipids extracted from enzyme treated egg yolk
is shown in FIG. 48.
The TLC analysis in FIG. 48 shows a clear hydrolytic effect of
Phospholipase #3108 on triglyceride during formation of free fatty
acids, as well as some mono- and diglyceride. Phospholipase #3108
seem to have no effect on cholesterol. Both transferase samples
clearly contribute to the formation of cholesterol ester
concomitant with the reduction of the cholesterol content.
D. Enzyme Modified Egg Yolk in Mayonnaise
In order to investigate the effect of the modification of the egg
yolk samples mentioned in Table 2, application trials were
performed on mayonnaise with a fat content of 50%. A mayonnaise
containing untreated egg yolk was also produced.
The aim of the investigation was to determine the impact of
enzymatically modified egg yolks' emulsification properties and the
impact on heat stability. All mayonnaise samples contained the same
oil level and were emulsified with only egg yolk.
The mayonnaise samples were all produced using a Koruma mixer
(Disho V60/10) and heated during processing to 95.degree. C. for 5
minutes.
Samples of the mayonnaises (FIG. 49) produced by enzyme treated egg
yolk were nice and homogenous with no oil separation. The control
sample separated in an oil and a water phase.
The particle size of oil droplet in the mayonnaise samples with
enzyme treated egg yolk was measured on a Malvern Mastersizer. The
sample was mixed with 0.1% SDS in 0.1 M phosphate buffer pH 7 prior
to measurement. Reading was mean size of all particles as shown in
Table 3.
TABLE-US-00011 TABLE 3 Experiment Enzyme Mean particle size, .mu.m
6 Transferase #179, 0.31 PLU-7/g 12.9 7 Transferase #178-9, 1.25
PLU-7/g 7.2 8 #3108, Lecitase Ultra, 23 PLU-7/g 5.2
The results from the particle size measurement clearly show the
effect of increased dosage of transferase from A. salmonicida. With
the high dosage of transferase the particle size is close to the
mayonnaise produced by Lecitase Ultra. It should however be kept in
mind that Lecitase Ultra produces a lot of fatty acids, which might
contribute to a finer particle distribution.
The oil droplet size of the mayonnaise prepared with the enzyme is
significantly smaller than the oil droplet size of the mayonnaise
prepared without the enzyme (i.e. the control mayonnaise).
Oxidation Stability
The oxidation stability of the mayonnaise samples 7 and 8 were
analyzed on a ML OXIPRES with results shown in Table 4.
TABLE-US-00012 TABLE 4 Induction period Induction period 1.
determination 2. determination Sample hours hours 7 37.44 38.08 8
35.68 35.52
Measurement of oxidation stability gave a clear significant
difference in oxidation stability. The mayonnaise with transferase
179-8 treated egg yolk had a significant better oxidation stability
than the mayonnaise with Lecitase Ultra treated egg yolk. This
might be explained by the fact that Lecitase Ultra produces more
free fatty acids which are more prone to oxidation that the
corresponding fatty acid esters.
A sample of the egg yolks used for mayonnaise production were
extracted with chloroform, and the lipids from the egg yolk were
analysed by GLC with results shown in Table 5.
TABLE-US-00013 TABLE 5 Experi- Fatty Cholesterol Trigly- ment
Enzyme acid Cholesterol ester ceride 6 Transferase #179 0.96 0.94
0.49 23.95 7 Transferase 1.84 0.60 1.06 24.54 #178-9 8 #3108,
Lecitase 14.05 1.16 0.12 2.45 Ultra 9 Control 0.48 1.16 0.13
22.87
The GLC results in Table 5 confirm the results form the TLC
analysis that Lecitase Ultra produces a very high amount of free
fatty acids and a large part of the triglyceride is hydrolysed. On
the other hand the transferase produces only modest amount of free
fatty acids and no triglycerides are hydrolysed. It is also clearly
shown that transferase produce cholesterol ester from
cholesterol.
The results indicate that the amount of PC in the "enzyme treated"
mayonnaise is reduced as compared with the control mayonnaise,
whilst the amount of LPC is increase in the enzyme treated
mayonnaise as compared with the control mayonnaise. The increase in
the amount of LPC may well explain the improved emulsification
properties of the enzyme treated mayonnaise as compared with the
control mayonnaise. The HPLC and GLC analyses also indicate a lower
level of free cholesterol in the enzyme treated mayonnaise as
compared with the control mayonnaise, probably due to the
cholesterol being used as an acceptor molecule in the transferase
reaction resulting in an increase in the amount of cholesterol
esters in the enzyme treated mayonnaise as compared with the
control mayonnaise. In addition, the results indicate that the
amount of free fatty acids do not increases significantly when egg
yolk is treated with the transferase. The results further indicate
that the amount of free fatty acids produced in the foodstuff
treated with the lipid acyltransferase is significantly lower than
in the foodstuff treated with the control phospholipase, this is
true even if the amount of lysolecithin formed in the foodstuffs is
the same.
Example 8
Effect of Aeromonas salmonicida Transferase in Cakes
The effect of GCAT acyl-transferase form Aeromonas salmonicida is
tested in a cake recipe. The enzyme is tested alone and in
combination with other lipolytic enzymes. The enzymes are added to
some of the cake ingredients or added together with the other cake
ingredients before mixing the cake.
Preliminary results show that acyl-transferase combined with a
triglyceride-hydrolysing enzyme improves the cake volume and crumb
structure compared with a control.
In the following experiments a transferase from A. salmonicida and
variants are tested alone and in combination with triglyceride
hydrolysing enzymes. These enzymes are active on the lipid
components in the egg and the shortening as well as on the
carbohydrates, protein, glycerol and cholesterol (in egg), which
forms part of the cake recipe.
Materials and Method
Enzyme #179, Acyl-transferase from Aeromonas salmonicida Grindamyl
EXEL 16, Lipase from Thermomyces lanuginisus Cake recipe:
TABLE-US-00014 Ingredients % g Sugar 35/20 20.37 204 Cake flour,
Albatros 18.11 181 Wheat starch 5.21 52 Baking powder 0.36 4
Pasteurised liquid whole egg 22.63 226 Shortening Vegao (Aarhus
United) 18.11 181 Whey powder 0.68 7 Glucose sirup, 75% 42 DE 4.53
45 Glycerol 1.36 14 Salt 0.32 3 Rape seed oil 6.34 63 Potassium
sorbate 0.18 1.8
Equipment: Mixer: Hobart N50 with a spatula Oven: Simon cake oven
Procedure:
All ingredients must be tempered to room temperature. 1. Cream up
sugar and shortening for 3 minutes--start at 2.sup.nd speed and
move to 3.sup.rd speed within 30 sec 2. Add remaining
ingredients--start at 1.sup.st speed and move to 2.sup.nd speed
within 30 sec--mix total 5 min 3. Measure the volume of the batter
in 1 dl cup 4. The pound cake tins are sprayed with "Babette" oil
spread, and covered with paper 5. Scale 2.times.350 g into the
pound cake tins 6. Spread out the mass evenly with a spatula 7.
Before put in the oven--add a string of oil on top of the cake
(lengthwise in the middle--to make the cake break in the middle 8.
Bake for 50 min. at 180.degree. C. 9. After baking take the tins
out of the oven, and "drop" it on the table, before taking the
cakes out of the tins 10. Take paper off the cakes and turn the
right side up 11. The cakes are cooled on a grating for 60 min.
before weighing and measuring of the volume Remarks:
The enzyme(s) used is/are added at the beginning of mixing or
is/are added to some of the cake ingredients before added to the
other cake ingredients.
The enzymes are only active during the mixing or reaction of cake
components, and the enzymes are inactivated during baking of the
cake.
Results.
The following experiments are conducted as shown in the following
table:
TABLE-US-00015 1 2 3 4 Whole egg G 250 250 250 250 Glucose syrup,
75% DE 42 G 10 10 10 10 #179 acyl-transferase, 26 PLU/ml Ml 25 25
Grindamyl EXEL 16, Mg 37.5 37.5 Water 25
Egg, Glucose syrup and enzyme are reacted for 30 minutes at
37.degree. C. and shortly after the eggs are use to produce cake
according to the recipe mentioned above.
Preliminary results show that a combination of acyltransferase and
a triglyceride hydrolysing lipase from Thermomyces lanoginosus
improves the cake volume, and also the crumb structure, eating
quality and appearance is improved compared with a water control.
Preliminary results indicate in cake it may be preferably to use a
combination of lipid acyltransferase and a lipase.
Example 9
The Purpose of these Experiments was to Test a Transferase from A.
hydrophila Expressed in E. coli
The transferase reaction of A. hydrophila #135 (0.5 NEFA-PLU/ml)
was tested in egg yolk. The experimental set-up is shown in Table
6.
TABLE-US-00016 TABLE 6 Reaction time Egg yolk #135 conc. Nr Minutes
Gram Units, PLU-NEFA 1 30 1 0.000 2 30 2 0.100 3 60 2 0.100 4 150 2
0.100 5 240 2 0.100 6 1560 2 0.100 7 1560 1 0.000
The egg yolk was heated to 37.degree. C. and the enzyme added.
After reaction time 7 ml CHCl.sub.3:Methanol 2:1 was added and
mixed on a Whirley for 30 sec.
The sample was centrifuged 800.times.g for 10 minutes and the lower
solvent phase isolated. 2 .mu.l of this sample was applied onto a
TLC Silica plate and eluted in elution solvent IV. The results from
the TLC analysis is shown in FIGS. 50 and 51.
The methods and materials mentioned in this Example are those
detailed in Examples above.
Samples from this experiment was also analysed by GLC as TMS
derivatives. The results from the GLC analysis are shown in Table
7.
TABLE-US-00017 TABLE 7 GLC analysis of lipid from egg yolk Reaction
Transferase Free fatty Choles- Cholesterol- time #135 conc. acid
terol ester No. min Units/g egg yolk % % % 7 control 0 0.25 2.88
0.34 3 60 0.025 0.25 2.68 0.56 4 150 0.025 0.29 1.85 1.72 5 240
0.025 0.53 1.42 3.54 6 1560 0.025 0.95 0.3 4.43
From the GLC analysis of free fatty acid, cholesterol and
cholesterol ester it is possible to calculate the molar
concentration of each component and calculate % transferase
activity as shown in Table 7.
Calculation of % Transferase Activity
From the results the increase in free fatty acid, sterol esters are
calculated .DELTA. % fatty acid=% Fatty acid(enzyme)-% fatty
acid(control) .DELTA. % sterol ester=% sterol/stanol
ester(enzyme)-% sterol/stanol ester(control)
The transferase activity is calculated as % of the total enzymatic
activity:
.times..times..times..times..DELTA..times..times..times..times..times..ti-
mes..times..times..times..times..times..DELTA..times..times..times..times.-
.times..times..times..times..times..times..DELTA..times..times..times..tim-
es..times..times..times..times..times..times. ##EQU00002##
where:
Mv sterol ester=average molecular weight of the sterol esters
Mv fatty acid=average molecular weight of the fatty acids
TABLE-US-00018 TABLE 8 Transferase activity in egg yolk of A.
hydrophila #135 Transferase Reaction #135 conc. Free fatty
Cholesterol- Transferase Time Units/g acid Cholesterol ester
activity No. min egg yolk mM mM mM % 7 Control 0 8.9 74.5 5.3 -- 3
60 0.05 8.9 69.3 8.7 100 4 150 0.05 10.4 47.8 26.5 93 5 240 0.05
18.9 36.7 54.6 77 6 1560 0.05 33.9 7.8 68.4 48
Both TLC and GLC analysis confirm that initially the transferase
reaction of A. hydrophila #135 is the dominating reaction. After
150 minutes reaction time some hydrolytic activity occurs. After
1560 minutes the transferase reaction and the hydrolytic reaction
has almost reached the same level. The results also indicate that
as long as the acceptor molecule cholesterol is available the
transferase reaction is the dominating reaction. When the
concentration of cholesterol decreases the hydrolytic activity
becomes more dominant.
Example 10
Assay for Measurement of Transferase Activity Using Egg Yolk as
Substrate--Hereinafter Referred to as the "Egg Yolk Assay"
A lipid acyltransferase was isolated from Aeromonas salmonicida and
expressed in Bacillus subtilis. The purpose of this work is to
develop an analytical method, which is able to measure both
transferase and hydrolytic activity of enzymes and from these
analyses it is possible to define both transferase and hydrolytic
activity of enzymes using a substrate which contain lecithin and
cholesterol.
In this work egg yolk was used as substrate for the enzyme assay
because egg yolk contain both lecithin and cholesterol and it is
known that transferases and phospholipases works very well in this
substrate.
The drawback by using egg yolk is that this substrate is a complex
mixture of water, lipids, and proteins. Lipid components include
glycerides, 66.2%; phospholipids, 29.6%; and cholesterol, 4.2%. The
phospholipids consist of 73% lecithin, 15% cephalin, and 12% other
phospholipids. Of the fatty acids, 33% are saturated and 67%
unsaturated, including 42% oleic acid and 7% linoleic acid (ref.
Kirk-Othmer Encyclopedia of Chemical Technology, John Wiley &
Sons, Inc.)
Some variations in the egg yolk composition might be expected. In
the literature (Biochimica et Biophysica Acta, 1124 (1992) 205-222)
it is however mentioned that "The mature egg yolk of the domestic
hen possesses remarkably constant lipid and lipoprotein composition
despite much variation in dietary and environmental conditions",
and further it is quoted "As a result the egg yolk continues to
provide a food product of nearly constant composition, which serves
to maintain its chemical and physical-chemical properties for
reliable utilization in the baking, cosmetic and pharmaceutical
industries"
This reference indicates that egg yolk composition is very constant
and it was therefore decided to use hens egg yolk as substrate for
the Egg Yolk Assay.
Quantification of lipid reaction products from enzymatic treatment
of egg yolk was made by extraction of lipids from the substrate
followed by GLC analysis of the lipid components.
Procedure
Materials.
Egg yolk: Pasteurized liquid egg yolk from Danzg Products A/S,
DK-4000 Roskilde. HEPES buffer Sigma cat. no. H 3375 Chloroform,
Analytical grade Enzymes. Purified lipid acyltransferase from A.
salmonicida #178-9 Thermomyces lanuginosus lipase. GRINDAMYL EXEL
16, item nr. 147060 (Control) Enzyme Assay with Egg Yolk
Substrate.
5 gram liquid egg yolk was scaled in a 20 ml Wheaton glass and
heated to 35.degree. C.
0.25 ml enzyme solution was added and a stopwatch is started.
At regular intervals 0.5 g samples were transferred to a 10 ml Dram
glass.
20 .mu.l 4M HCl was added in order to stop the enzyme reaction and
acidify the fatty acid soap.
3 ml Chloroform was added. And the sample was mixed on a Whirley
mixer for 30 sec.
The sample was centrifuged at 3000 g for 10 min and 0.8 ml of the
chloroform phase was transferred to a tarred Dram glass. Chloroform
was evaporated at 60.degree. C. under a steam of nitrogen. The dram
glass was scaled again.
The isolated lipids were analysed by GLC and TLC. TLC analysis--as
described herein. GLC analysis--as described herein. Results
For the Egg Yolk Assay using egg yolk as substrate the experiment
shown in Table 9 was conducted.
TABLE-US-00019 TABLE 9 1 2 3 Egg yolk, liquid. gram 5 5 5
Transferase# 178-9, 32 PLU-7/ml* ml 0.25 T. lanuginosus lipase, 200
LIPU/ml ml 0.25 Water ml 0.25
0.5 g samples were taken out after 15, 30, 60 120 and 1080 minutes,
and the lipid isolated by solvent extraction. The lipids were
analysed by TLC using solvent I and IV respectively. Picture of the
TLC plate is shown in FIG. 52.
The TLC analysis clearly indicates the activity of transferase
#178-9 from A. salmonicida (sample 3). This can be seen from the
decrease in the phospholipids PC and PE. The results also indicate
that the amount of lysolecithin LPC is not as high as expected.
This might indicate hydrolytic activity on lysolecithin or it might
also be caused by insufficient extraction because lysolecithin is
very polar and therefore could be partly distributed in the water
phase.
The lipids isolated by solvent extraction was also analysed by GLC
in order to quantify the amount of free fatty acid, cholesterol and
cholesterol ester. The GLC results are shown in Table 10.
TABLE-US-00020 TABLE 10 GLC analysis of lipid from enzyme treated
egg yolk. Results are in % based on lipid content. 15 30 60 120
1080 Minutes Minutes Minutes Minutes Minutes Free fatty acids
Control 1 0.328 0.304 0.332 0.333 0.369 T. lanuginosus 2 0.391
0.376 0.459 0.627 22.909 A. salmonicida #178-9 3 1.007 1.668 4.013
6.761 15.098 Cholesterol Control 1 3.075 2.968 3.103 3.056 3.099 T.
lanuginosus 2 3.130 3.032 3.045 3.026 3.225 A. salmonicida #178-9 3
2.835 1.912 0.356 0.220 0.206 Cholesterol Control 1 0.416 0.397
0.422 0.408 0.437 ester T. lanuginosus 2 0.436 0.400 0.425 0.419
0.416 A. salmonicida #178-9 3 1.414 2.988 6.107 6.694 5.760
Triglyceride Control 1 76.153 73.505 75.565 79.344 77.382 T.
lanuginosus 2 74.099 74.413 77.079 74.284 21.781 A. salmonicida
#178-9 3 73.781 73.342 77.857 82.040 72.117
From the results it was observed that almost all the cholesterol
was esterified after 60 minutes in sample 3. It was concluded that
for the first 30 minutes there was surplus substrate for the
reaction. The results form samples taken out after 15 and 30
minutes were therefore used to calculate the activities of the
enzymes.
Based on the information in table 10 and the fact that egg yolk
contain 27% lipid the amount of micromole fatty acid and
cholesterol ester produced per ml enzyme was calculated with
results shown in Table 11 The results in Table 11 were obtained be
the following calculations of the results from fatty acids in
sample no. 3 (A. salmonicida, 15 min.)
Lipid in 5 g egg yolk=5*0.27=1.35 gram
1.35 gram lipid contain 1.007% fatty acids=1.35*1.007/100=0.01359
gram Average molecular weight of fatty acids is 272 0.01359
gram=0.01359*1000000/272 .mu.mol=49.9798 .mu.mol 0.25 ml enzyme is
added .mu.mol Fatty acid/ml enzyme=49.9798/0.25=199.9
TABLE-US-00021 TABLE 11 Micromole/ml enzyme 0 min 15 min 30 min
Free fatty acid Control 65.01 60.37 T. lanuginosa 77.61 74.71
Transferase #178-9 199.86 331.06 Cholesterol ester Control 35.09
33.50 T. lanuginosa 36.77 33.73 Transf. #178-9 119.29 252.15
From the results in Table 11 it is possible to calculate the change
in amount of fatty acid and cholesterol ester caused by the enzyme
relative to control as shown in Table 12.
TABLE-US-00022 TABLE 12 .DELTA. Micromole/ml enzyme 0 min 15 min 30
min Free fatty acid T. lanuginosus 0 12.593 14.340 Transf. #178-9 0
134.843 270.691 Cholesterol ester T. lanuginosus 0 1.677 0.235
Transf. #178-9 0 84.196 218.652
The amount of fatty acid or cholesterol ester produced as a
function of time is shown in FIG. 53.
From the slope of the curve the hydrolytic activity (FFA formation)
and the lipid acyltransferase activity (cholesterol ester
formation) as a function of time was calculated. The relative
transferase activity (% acyltransferase activity) and the relative
hydrolytic activity were then calculated as shown in Table 13. The
relative transferase activity was determined using the protocol for
the determination of % acyltransferase activity as described
hereinbefore. For example, calculation of relative activity for
#178-9:Total activity is FFA activity+transferase
activity=9,023+7,2884=16,311 .mu.mol/min/ml, Relative transferase
activity=7,2884*100/16,311=44.7, Relative hydrolytic
activity=9,023*100/16,311=55.3
TABLE-US-00023 TABLE 13 T. lanuginosus FFA activity 0.4780
.mu.mol/min/ml A. salmonicida #178-9 FFA activity 9.0230
.mu.mol/min/ml T. lanuginosus Cholesterol ester. 0.0078
.mu.mol/min/ml Activity A. salmonicida #178-9 Cholesterol ester.
7.2884 .mu.mol/min/ml Activity T. lanuginosus Relative transferase
1.6 activity A. salmonicida #178-9 44.7 T. lanuginosus Relative
hydrolytic 98.4 activity A. salmonicida #178-9 55.3
The results in Table 13 confirmed that the transferase enzyme from
A. salmonicida has a significant transferase activity, but the
results also confirmed that this enzyme has a significant
hydrolytic activity.
The lipase from T. lanuginosus mainly has hydrolytic activity, and
the relative transferase activity 1.6 was not a proof of any
transferase activity but was explained by the uncertainty of the
analysis.
Conclusion.
Egg yolk was used as substrate for the measurement of transferase
and hydrolase activity of lipid acyltransferase from Aeromonas
salmonicida and a lipase from Thermomyces lanuginosus. Under assay
conditions there was initially a linear relation between
cholestererol ester and free fatty acid formation and time for the
lipid acyltransferase enzyme. Based on this linear relationship it
was possible to calculate the hydrolytic activity (FFA formation)
and the transferase activity (cholesterol ester formation). The
relative hydrolytic and transferase activity was also calculated.
The lipid acyltransferase (in this case a GCAT) from Aeromonas
salmonicida showed almost equal hydrolytic and transferase activity
under these assay conditions.
Lipase from Thermomyces lanuginosus showed very low hydrolytic
activity and the transferase activity was not significant.
Example 11
Transferase Assay in High Water Egg Yolk
Introduction
A lipid acyltransferase in accordance with the present invention
was isolated from Aeromonas salmonicida and expressed in Bacillus
subtilis. Initial experiments have shown that this enzyme is very
efficient in transferring fatty acid from lecithin to cholesterol
using egg yolk as a substrate.
In the following experiments the transferase reaction was studied
in further detail using egg yolk as a substrate with special focus
on the water concentration in the substrate.
Procedure
Materials.
Egg yolk: Pasteurized liquid egg yolk from Danzg Products A/S,
DK-4000 Roskilde. HEPES buffer Sigma cat. no. H 3375 Chloroform,
Analytical grade Squalane, analytical grade Enzymes. #178-9 Lipid
acyl transferase in accordance with present invention from A.
salmonicida #2427 Phospholipase A1 from Fusarium oxysporum.
LIPOPAN.RTM. F from Novozymes, DK (comparative lipolytic
enzyme)
#1991 Phospholipase A2 from Pancreas, LIPOMOD 22L from
Biocatalysts, UK (comparative lipolytic enzyme)
Enzyme Assay with Egg Yolk Substrate.
5 gram liquid egg yolk substrate was scaled in a 20 ml Wheaton
glass and heated to 35.degree. C.
Water and enzyme solution was added and a stopwatch is started.
At regular intervals 0.5 g samples was transferred to a 10 ml Dram
glass.
20 .mu.l 4M HCl was added in order to stop the enzyme reaction and
acidify the fatty acid soap.
3 ml Chloroform was added. And the sample was mixed on a Whirley
mixer for 30 sec.
The sample was centrifuged at 3000 g for 10 min and 0.8 ml of the
chloroform phase was transferred to a tarred Dram glass. Chloroform
was evaporated at 60.degree. C. under a steam of nitrogen. The dram
glass is scaled again.
The isolated lipids are analysed by GLC
GLC Analysis
Perkin Elmer Autosystem 9000 Capillary Gas Chromatograph equipped
with WCOT fused silica column 12.5 m.times.0.25 mm ID.times.0.1.mu.
film thickness 5% phenyl-methyl-silicone (CP Sil 8 CB from
Chrompack). Carrier gas: Helium. Injector. PSSI cold split
injection (initial temp 50.degree. C. heated to 385.degree. C.),
volume 1.0 .mu.l Detector FID: 395.degree. C.
TABLE-US-00024 Oven program: 1 2 3 Oven temperature, .degree. C. 90
280 350 Isothermal, time, min. 1 0 10 Temperature rate, .degree.
C./min. 15 4
Sample preparation: 30 mg of sample was dissolved in 9 ml
Heptane:Pyridin, 2:1 containing internal standard heptadecane, 0.5
mg/ml. 300 .mu.l sample solution was transferred to a crimp vial,
300 .mu.l MSTFA (N-Methyl-N-trimethylsilyl-trifluoraceamid) was
added and reacted for 20 minutes at 60.degree. C.
Calculation: Response factors for mono-di-triglycerides and free
fatty acid were determined from Standard 2 (mono-di-triglyceride),
for Cholesterol, Cholesteryl palmitate and Cholesteryl stearate the
response factors were determined from pure reference material
(weighing for pure material 10 mg).
Results
Egg yolk containing 2% squalane was used as substrate for the
reactions. Squalane was added as an internal standard for the GLC
analysis, in order to quantify the lipid components in egg
yolk.
The experiment was set up as shown in Table 14.
TABLE-US-00025 TABLE 14 1 2 3 4 5 6 7 8 Substrate, egg yolk with 2%
squalane g 5 5 5 5 5 5 2.5 2.5 Transferase # 178-9, 14 PLU-7/ml ml
0.25 0.25 0.13 LIPOPAN .RTM. Fsolution, 200 PLU- ml 0.25 0.13 7/ml
#1991 Phospholipase A2, 6300 PLU/ml ml 0.25 0.25 Water ml 0.25 3.8
3.8 8.75 8.75
Samples were taken out after 30, 60 and 120 minutes and analysed
according the method described above (0.5 ml (exp 1-4) 0.86 ml
(exp. 5-6) and 2.2 ml (exp. 7-8) samples were taken).
The results from the GLC analysis are shown in Table 15. The GLC
results were expressed in percent of the substrate (egg yolk). The
table also indicate the reaction time and the total amount of water
in the reaction mixture.
TABLE-US-00026 TABLE 15 Reaction GLC GLC GLC time Water % % Fatty %
% cholesterol Enzyme minutes in reaction acid cholesterol ester
Control 120 54 0.247 0.863 0.083 #178 30 54 0.422 0.669 0.445 #178
60 54 0.515 0.549 0.672 #178 120 54 0.711 0.364 1.029 #2427 30 54
2.366 0.848 0.090 #2427 60 54 3.175 0.837 0.088 #2427 120 54 3.926
0.833 0.082 #1991 30 54 1.606 0.911 0.083 #1991 60 54 1.701 0.838
0.080 #1991 120 54 1.781 0.763 0.053 #178 30 73 0.377 0.764 0.495
#178 60 73 0.488 0.665 0.719 #178 120 73 0.626 0.426 0.931 #2427 30
73 2.471 0.853 0.092 #2427 60 73 3.284 0.858 0.087 #2427 120 73
4.176 0.837 0.081 #178 30 89 0.344 0.720 0.308 #178 60 89 0.443
0.725 0.446 #178 120 89 0.610 0.597 0.607 #2427 30 89 0.510 0.167
0.010 #2427 60 89 0.602 0.133 0.010 #2427 120 89 0.867 0.147
0.009
Based on the analyses of fatty acid, cholesterol and cholesterol
ester it was possible to calculate the amount of free fatty acid,
and cholesterol ester produced as a function of reaction time and
water content. Based on these results it was then possible to
calculate the total enzymatic activity as the sum of the fatty acid
formation and the cholesterol ester formation. The relative
hydrolytic activity and the relative transferase activity (i.e. %
acyltransferase activity) were then calculated with the results
shown in Table 16.
The results in Table 16. were also analysed statistically using a
Statgraphic Multifactor ANOVA. The statistical results in FIG. 54
confirm that Phospholipase A1, #2427 and phospholipase A2, #1991
have no transferase activity whereas the transferase #178-9 showed
almost 50% transferase activity under these assay conditions.
The effect of water content in the assay on the transferase
activity of the transferase #178 was also analysed statistically as
shown in FIG. 55. These results indicate that in the range from 54
to 89% water in the assay there was no strong effect of the water
content on the relative transferase activity.
The impact of reaction time on transferase activity for transferase
#178 was evaluated with results shown in Table 16 and FIG. 56. The
results in FIG. 56 indicate that the relative transferase activity
decreases as a function of reaction time. This might be explained
by the fact that most of the acceptor molecule cholesterol is
consumed and therefore the relative hydrolytic activity increases.
The negative values for transferase reaction for #2427 only
indicate no transferase activity within the variation for the
analytical method.
TABLE-US-00027 TABLE 16 Reaction Water % Cholesterol time in
reaction Fatty acid Cholesterol ester Hydrolytic Transferase Enzyme
minutes mixture Produced Consumed produced activity % activity %
#178 30 54 0.175 0.194 0.362 53 47 #178 60 54 0.268 0.314 0.589 52
48 #178 120 54 0.464 0.499 0.946 53 47 #2427 30 54 2.119 0.015
0.007 100 0 #2427 120 54 2.928 0.026 0.005 100 0 #2427 60 54 3.679
0.030 -0.001 100 0 #1991 30 54 1.359 -0.048 0.000 100 0 #1991 60 54
1.454 0.025 -0.003 100 0 #1991 120 54 1.534 0.100 -0.030 101 -1
#178 30 73 0.130 0.099 0.412 42 58 #178 60 73 0.241 0.198 0.636 47
53 #178 120 73 0.379 0.437 0.848 51 49 #2427 30 73 2.224 0.010
0.009 100 0 #2427 60 73 3.037 0.005 0.004 100 0 #2427 120 73 3.929
0.026 -0.002 100 0 #178 30 89 0.097 0.143 0.225 50 50 #178 60 89
0.196 0.138 0.363 56 44 #178 120 89 0.363 0.266 0.524 62 38 #2427
30 89 0.263 0.696 -0.073 113 -13 #2427 60 89 0.355 0.730 -0.073 110
-10 #2427 120 89 0.620 0.716 -0.074 105 -5
Conclusion.
The lipid acyltransferase from Aeromonas salmonicida was tested in
egg yolk as substrate and with different levels of water content.
This enzyme was compared with control lipolytic enzymes, namely
Phospholipase A1 from Fusarium oxysporum and a Phospholipase A2
from pancreas.
The results have proved that only the transferase catalysed the
transferase reaction between lecithin and cholesterol during
formation of cholesterol ester. The results showed that in the
range from 54% to 89% water in the substrate the relative
transferase activity was almost the same for transferase from
Aeromonas salmonicida.
Example 12
The "Transferase Assay in Buffered Substrate" for Measurement of
Acyltransferase Activity (e.g. for Use in a Foodstuff Using
Lecithin and Cholesterol)
The lipid acyltransferase was isolated from Aeromonas salmonicida
and expressed in Bacillus subtilis. This enzyme is very efficient
in transferring fatty acid from lecithin to cholesterol during
formation of cholesterol esters. It has also been shown that the
enzyme has some hydrolytic activity, which is observed by the
formation of free fatty acid. Traditional phospholipases (EC3.1.1.4
and EC3.1.1.32) have the ability to hydrolyse lecithin during
formation of free fatty acids and lysolecithin, and no transferase
reactions has been reported for these enzymes.
We detail herein an assay that is able to measure both transferase
and hydrolytic activity of enzymes and thus to identify lipid
acyltransferases in accordance with the present invention, the
assay uses a substrate which contains lecithin and cholesterol. In
this work a substrate based on phosphatidylcholine and cholesterol
dispersed in a buffer was used. Quantification of reaction products
was made by extraction of lipids from the substrate followed by GLC
analysis of the lipid components.
Procedure
Materials
L-alpha-Phosphatidylcholine 95% (Plant) Avanti no. 441601
Cholesterol: Sigma cat. C 8503 Cholesteryl Palmitate, Sigma C 6072
Cholesteryl Stearate, Sigma C 3549 HEPES buffer Sigma cat. No. H
3375 Chloroform, Analytical grade. Enzymes Purified GCAT from A.
salmonicida #178-9
TLC analysis was carried out as described in Example 6.
GLC analysis was carried out as described in Example 11.
Results: Transferase assay based on phosphatidylcholine and
cholesterol as substrate.
In the following the transferase activity of the transferase was
tested in a substrate based on phosphatidylcholine and cholesterol
according to the following procedure. 450 mg phosphatidylcholine
(>95% PC Avanti item no. 441601) and 50 mg cholesterol was
dissolved in chloroform and evaporated to dryness under vacuum. 300
mg cholesterol/phosphatidylcholine mixture was transferred to a
Wheaton glass and 15 ml 50 mM HEPES buffer pH 7 was added. The
lipid was dispersed in the buffer during agitation.
The substrate was heated to 35.degree. C. during mixing with a
magnetic stirrer and 0.25 ml enzyme solution was added. This is a
very high water environment of approximately 95% water.
Samples of 2 ml were taken out after 0, 5, 10, 15, 25, 40 and 60
minutes reaction time. Immediately 25 .mu.l 4M HCl was added to
acidify the free fatty acid and stop the enzyme reaction. 3.00 ml
chloroform was added, and the sample was shaken vigorously on a
Whirley for 30 seconds. The sample was centrifuged and 2 ml of the
chloroform phase was isolated and filtered through 0.45-.mu.m
filters into a 10 ml tared Dram glass. The chloroform was
evaporated under a stream of nitrogen at 60.degree. C., and the
samples were scaled again. The extracted lipid was analysed by
GLC.
The results from the GLC analysis are shown in Table 17. The
results are expressed in % calculated on extracted lipid. The
amount of fatty acid and cholesterol ester formed as a function of
time is illustrated in. FIG. 57 It can be concluded from FIG. 57
that the enzyme reaction is not linear as a function of time,
because an initially strong both hydrolytic and transferase
activity is observed. After approximately 10 minutes and until
approximately 60 minutes the reaction shows an almost linear
response of fatty acid and cholesterol ester formation as a
function of time. It was therefore decided to look at the enzymatic
reaction in this time interval.
TABLE-US-00028 TABLE 17 Minutes 0 5 10 15 25 40 60 Cholesterol, %
10.064 8.943 8.577 8.656 8.102 7.856 7.809 Cholesterol ester, %
0.000 1.571 2.030 2.058 2.282 2.659 3.081 FFA total, % 0.260 1.197
1.239 1.466 2.445 2.943 3.940
From the knowledge about the amount of lipid in the reaction
mixture and the amount of enzyme added it was possible to calculate
the formation of fatty acid and cholesterol ester expressed in
.mu.mol/ml enzyme (Table 18 and FIG. 58)
TABLE-US-00029 TABLE 18 Minutes 10 15 25 40 60 .mu.mol/ml
.mu.mol/ml .mu.mol/ml .mu.mol/ml .mu.mol/ml FFA total 58.1 68.7
114.6 138.0 184.7 Cholesterol ester 88.8 90.0 99.3 115.6 133.8
From the results in Table 18 and the slope of the curves in FIG. 58
it was possible to calculate the amount of fatty acid and
cholesterol ester as a function of time expressed in gmol/min per
ml enzyme.
The calculation of the hydrolytic activity and the transferase
activity is shown in Table 19. The relative transferase activity
was determined using the protocol for the determination of %
acyltransferase activity as described hereinbefore.
TABLE-US-00030 TABLE 19 Hydrolytic activity (fatty acid) 2.52
.mu.mol/min per ml enzyme Transferase activity(cholesterol ester)
0.94 .mu.mol/min per ml enzyme Total activity 3.45 .mu.mol/min per
ml enzyme Relative Transferase activity 27.1 % Relative hydrolytic
activity 72.9 %
Screening of Other Enzymes for Transferase Activity.
The method mentioned above was used to screen different lipolytic
enzymes for transferase and hydrolytic activity. The enzymes were
tested as shown in Table 20
TABLE-US-00031 TABLE 20 1 2 3 4 5 Substrate ml 15 15 15 15 15
#178-9Transferase ml 0.25 A. salmonicida 32 PLU-7/ml 5% #3016,
LIPOPAN .RTM. F ml 0.25 (F. oxysporum) 5%, Thermomyces lanuginosus
ml 0.25 5% Candida rugosa #2983 ml 0.25 5% Candida cylindracea
#3076 ml 0.25
The substrate containing 300 mg phosphatidylcholine/cholesterol
dispersed in 50 mM HEPES buffer pH 7.0 was heated to 35.degree. C.
with agitation. Enzyme solution was added and the sample was kept
at 35.degree. C. with agitation. Samples were taken out with
regular interval and extracted with Chloroform. The isolated lipids
were analysed by GLC with results shown in Table 21.
TABLE-US-00032 TABLE 21 Sample 1 Transferase 178-9 Minutes 0 5 10
15 25 40 60 FFA 1.216 2.516 2.983 2.62 2.894 3.448 3.911
Cholesterol 7.547 6.438 6.365 6.15 6.136 5.936 5.662 Chl. Ester 0
1.835 2.177 2.44 2.58 2.851 3.331 2 Fusarium oxysporum 0 5 10 15 25
40 60 (LIPOPAN .RTM. F) FFA 1.216 1.345 1.796 1.95 2.487 2.424
2.977 Cholesterol 7.547 7.309 7.366 7.33 7.429 7.341 7.326 Chl.
Ester 0 0.26 0.386 0.35 0.267 0.36 0.394 3 Thermomyces lanuginosus
0 5 10 15 25 40 60 FFA 1.216 0.853 0.875 1 0.896 1.105 1.009
Cholesterol 7.547 7.384 7.639 7.63 7.675 7.603 7.529 Chl. Ester 0 0
0 0 0 0 0 4 Candida rugosa (#2938) 0 5 10 15 25 40 60 FFA 1.216
0.982 0.987 1.02 1.135 1.131 1.15 Cholesterol 7.547 7.438 7.656
7.66 7.638 7.575 7.585 Chl. Ester 0 0 0 0 0 0 0 5 Candida
cylandracea 0 5 10 15 25 40 60 (#3076) FFA 1.216 1.032 1.097 1.07
1.203 1.131 1.43 Cholesterol 7.547 7.502 7.425 7.65 7.619 7.502
7.411 Chl. Ester 0 0 0 0 0 0 0
From the GLC analysis it was observed that only the lipid
acyltransferase (178-9) produced significant amount of cholesterol
ester and fatty acids. Phospholipase from Fusarium oxysporum also
gave a steady increase in free fatty acid but only an initial small
amount formation of cholesterol ester was formed but no increase in
cholesterol ester as a function of time was observed.
Based on the knowledge about the amount of lipid substrate and the
GLC analyses it was possible to calculate the relative transferase
activity and the relative hydrolytic activity based on the results
from 10 to 60 minutes reaction time. The results from Transferase
178-9 and Fusarium oxysporum lipase are shown in Table 21. The
other enzymes tested showed no activity.
TABLE-US-00033 TABLE 21 Fusarium Transferase 178-9 oxysporum
Hydrolytic activity, micromole/min 1.03 0.96 per ml enzyme
Transferase activity, micromole/min 0.40 0.01 per ml enzyme Total
activity, micromole/min per ml 1.43 0.98 enzyme Relative hydrolytic
activity 71.8 98.7 Relative transferase activity 28.2 1.3
The result shown in Table 21 confirm a significant transferase
activity from the lipid acyltransferase (sample 178-9). It is also
observed that the relative transferase activity is in good
agreement with the experiment mentioned in Table 19
A very low transferase activity form Fusarium oxysporum
phospholipase is however observed. This transferase level is so low
that it falls within the uncertainty of the analysis. As expected
Fusarium oxysporum phospholipase has a significant hydrolytic
activity.
Conclusion.
Instead of egg yolk (shown in Example 11) an artificial substrate
based on purified phosphatidylcholine and cholesterol was used as a
substrate to measure the activity of transferase from Aeromonas
salmonicida. Between 10 minutes and 60 minutes reaction time the
assay gave an almost linear formation of free fatty acids and
cholesterol ester as a function of time. Based on the activity
between 10 and 60 minutes reaction time the hydrolytic activity and
the transferase activity was calculated.
The concentration of substrates in this assay was relatively lower
than in egg yolk, and the amount of water in the assay was
relatively higher.
Based on the results from the assay of the lipid acyltransferase
(in this instance a GCAT) from Aeromonas salmonicida in a
artificial substrate of phosphatidylcholine/cholesterol in buffer
it is concluded that this enzyme has very good transferase activity
also in a system with a very high water content.
Both assays based on egg yolk (see Example 11) and
phosphatidylcholine/cholesterol in buffer (Example 12), can be used
to measure the transferase and hydrolytic activity of enzymes. The
egg yolk is preferred from the point of view that the hydrolytic
and the transferase activity is linear as a function of time, but
the phosphatidylcholine/cholesterol in buffer is only linear within
a certain time limit.
Example 13
Food Emulsions
The effect of enzyme modified liquid egg yolk was tested in a
standard Food emulsion recipe with 60% oil.
Standard methods and materials are as per those detailed in the
Examples above.
The egg yolk was treated with a lipid acyl transferase from
Aeromonas salmonicida (#138) or phospholipase, namely a
commercially available enzyme LipopanF.RTM. (Novozymes A/S,
Denmark) (#2938) as shown in Table 22.
TABLE-US-00034 TABLE 22 Enzyme treatment of egg yolk. 1 2 3 4 Egg
Yolk, Sanofo product no Gram 10 10 10 10 1123P2 #138, 10 PLU/ml Ml
1 1 #2938, 200 PLU/ml Ml 1 Water Ml 1 Reaction time Minutes 210 360
210 210
TLC analysis of the egg yolk lipids from enzyme treated egg yolk
(Table 9) is shown in FIGS. 59 and 60.
In this experiment the dosage of #2938 was increased by a factor of
10 and this gave a very clear activity on egg yolk. The amount of
free fatty acid increased significantly and lecithin (PC) was
hydrolysed to lysolecithin (LPC). The transferase #138 gave a clear
transferase reaction because free cholesterol was converted to
cholesterol ester and part of the lecithin was converted to
lysolecithin.
Another interesting aspect of the enzyme modification was the
consistency of the product. The sample treated with Phospholipase
#2938 became very solid, whereas the samples treated with the lipid
acyltransferase #138 kept the same liquid consistency as the
control sample (see FIG. 61).
These modified egg yolks were tested in a Food Emulsion recipe
shown in Table 23.
TABLE-US-00035 TABLE 23 Mayonnaise with enzyme modified egg yolk. 0
1a 2a 3a 4a % % % % % Rapsolie 60 60 60 60 60 Egg yolk, Sanofo
product 2.8 no. 1123P2 Enz. Modified egg yolk no. 1 2.8 Enz.
Modified egg yolk no. 2 2.8 Enz. Modified egg yolk no. 3 2.8
Control (untreated) egg yolk no. 4 2.8 Water 39 36.2 36.2 36.2 36.2
Vinegar, 10% acetic acid 1 1 1 1 1
Modified egg yolks 1 and 2 were treated with the lipid acyl
transferase; and modified egg yolk 3 was treated with the
commercially available phospholipase.
The food emulsion was produced as an oil in water emulsion
according to the following procedure: Egg yolk and water was scaled
in a beaker. The oil was scaled separately.
A Turrax mixer (20000 rpm) was immersed in the water phase. Oil was
pumped to the water phase at a constant speed over 2 minutes. The
mixing continued for further 1 minute. The vinegar was then added
and mixed for 5 seconds.
The stability of the emulsion was tested in a heating cabinet at
100.degree. C. After 2 hours at 100.degree. C. the emulsion was
evaluated (see FIG. 62).
The emulsion stability of untreated egg yolk was quite good in this
experiment. Treatment of egg yolk with the lipid acyltransferase
#138 however improved the stability because the amount of water
separation was reduced. Egg yolk treated with phospholipase #2938
gave a very unstable emulsion with almost complete separation of
the oil- and the water phase at 100.degree. C.
It is considered that in some applications the use of the
compositions and methods of the invention can provide enhanced
thermal stability of emulsions, such as oil in water salad
dressings and the like. This is particularly important in food
emulsions which are pasturised to ensure long shelf life and/or are
heated prior to serving, e.g. in pre-prepared meals for re-heating
prior to serving (e.g. microwave meals). Although not wishing to be
bound by any particular theory, it is considered that in some
applications the accumulation of free fatty acid may be detrimental
to the thermal stability of such emulsions. It should be recognised
that the enhanced thermal stability of the food emulsions produced
using the methods of the invention, may not be found, or even
desirable, in all food applications. It will be apparent to the
person skilled in the art in which applications such
characteristics are desirable, and the stability of the emulsions
can be easily determined using a simple heat tests, equivalent to,
for example pasteurization and or microwave reheating. The
inventors have discovered that in a preferable embodiment the food
emulsions obtained using the enzymes of the invention have enhanced
thermal stability.
Example 14
Transferase Reaction in Plant Sterol Enriched Egg Yolk
Transferase form Aeromonas salmonicida was able to catalyse to
formation of lysolecithin, monoglyceride and plant sterol esters in
egg yolk enriched with plant sterol and glycerol. The same enzyme
was also tested in a low water system containing palm oil,
lecithin, plant sterol and glycerol By TLC and GLC analyses it was
shown that monoglyceride, and plant sterol esters were produced
under these reaction conditions.
Introduction:
The transferase from Aeromonas salmonicida was tested for
transferase activity in almost water free system of lecithin, fat,
plant sterol and glycerol.
Materials:
Egg yolk: Pasteurized liquid egg yolk from Dan.ae butted.g Products
A/S, DK-4000 Roskilde GCAT transferase purification 178-9, 32
PLU-7/ml (Journal 2254-100) Soya lecithin. Yolkin from Aarhus
United, Denmark. Palm oil 43, from Aarhus United, Denmark.
L-.alpha. Phosphatidylcholine 95% Plant (Avanti #441601)
Sitosterol, Sigma no S5753 Plant Sterol Generol N122 from Cognis,
Germany Glycerol Item no. 085915 Results
Initial screening of transferase activity on plant sterol and
glycerol was conducted in egg yolk as shown in Table 24.
TABLE-US-00036 TABLE 24 1 2 3 4 Egg yolk Gram 1 1 1 1 Glycerol Gram
0.1 0.1 Sitosterol:olie 3:7 Gram 0.13 0.13 Transferase #178-9 Units
1 1 Water * * * Water corresponding to the amount of water in the
enzyme solution = 83 .mu.l
The ingredients were mixed and heated to 37.degree. C. and kept at
this temperature during agitation with a magnetic stirrer.
0.1 gram samples were taken out after 3 and 23 hours and analysed
by TLC.
The results from the TLC analysis is shown in FIG. 63.
The result in FIG. 63 indicated that both cholesterol and plant
sterols were esterified by the transferase reaction, concomitant
with the formation of lysolecithin (sample 3 and 4), because almost
all free sterol and cholesterol was converted to the corresponding
ester in sample 3.
The results also indicated that the sample with only glycerol and
egg yolk produced monoglyceride. The amount of monoglyceride needs
to be confirmed by GLC analysis. When sterol was added together
with glycerol (sample 3) the amount of monoglyceride was very low
and not detectable by TLC. This indicated that as long as there
were surplus of sterol or cholesterol the transferase reaction
using glycerol was modest.
In another experiment the transferase enzyme 178-9 was added to a
mixture soybean lecithin, glycerol and plant sterol, in order to
study the catalytic activity of the enzyme in this reaction
mixture.
The composition of the reaction mixtures in these experiments are
shown in Table 25
TABLE-US-00037 TABLE 25 1 2 3 4 5 6 Soya lecithin gram 1.875 2.25
1.875 2.5 3.5 3.5 Plantesterol; Generol gram 0.225 0.225 0 0 0.225
0.5 N 122 Palm oil 43 gram 2.675 2.25 2.8 2.125 1.062 0.831
Glycerol gram 0.225 0.275 0.325 0.375 0.248 0.238 Transferase
#178-9, ml 0.2 0.2 0.2 0.2 0.2 0.2 32 PLU/ml
The experiment was conducted by mixing the lipid components during
agitation at 46.degree. C. The enzyme was added and samples were
taken out after 4 and 24 hours.
The samples were analysed by TLC as shown in FIG. 64.
Sample from experiment 2, 4 and 5 after 24 hours reaction time were
also analysed by GLC with results shown in Table 26
TABLE-US-00038 TABLE 26 2 4 5 Glycerol % 3.16 5.71 4.17 Fatty acids
% 4.23 5.36 6.67 Mono % 2.24 3.87 3.92 Sterol % 2.13 2.62
Sterolester % 2.89 2.14
The results confirmed that transferase 178-9 was able to catalyse
to formation plant sterol esters and monoglyceride from a reaction
mixture containing soybean lecithin, glycerol and plant sterol.
Such reaction mixture could be of interest for use in margarine
production where monoglyceride is wanted for their emulsification
properties and plant sterol esters for their cholesterol lowering
effect.
Conclusion
CGAT transferase from Aeromonas salmonicida was able to catalyse
the formation of plant sterol esters and monoglyceride in egg yolk
where plant sterol and glycerol was added. The same enzyme also
catalysed the formation of plant sterol esters and monoglyceride in
a mixture of palm oil, lecithin, plant sterol and glycerol. This
enzyme therefore is of interest for use in margarine and other oil
containing food products where monoglyceride and lysolecithin are
needed for improved emulsification and the plant sterol ester for
their cholesterol lowering effects.
Example 15
Immobilisation of a Lipid Acyltransferase from Aeromonas
salmonicida and the Use in the Synthesis of Sterol Esters
A lipid acyltransferase (in this instance a GCAT) from A.
salmonicida was immobilised on Celite by acetone precipitation. 10
ml enzyme solution in 20 mM TEA buffer pH 7 was agitated slowly
with 0.1 gram Celite 535 535 (from Fluka) for 2 hours at room
temperature.
50 ml cool acetone was added during continued agitation.
The precipitate was isolated by centrifugation 5000 g for 1
minute.
The precipitate was washed 2 times with 20 ml cold acetone.
The Celite was tried at ambient temperature for about 1 hour
The immobilised transferase was tested in a oil mixture containing
13% Phosphatidylcholin and 7% plant sterol. (Table 27)
TABLE-US-00039 TABLE 27 % Avanti lecithin 12.0 Plant sterol,
Generol 122N 6.6 Palm 43 71.4 Glycerol 5.0 Immobilised Transferase
#178, 45 U/g 2.0 Water 3.0
Lecithin, plant sterol and soybean oil was heated to 46.degree. C.
and the plant sterol was dissolved. The immobilised transferase was
added.
The transferase reaction continued at 46.degree. C. during gentle
agitation with a magnetic stirrer. Samples were taken out for
analyses after 1/2, 1 3 6 and 24 hours and analysed by TLC.
The reaction was stopped after 24 hours reaction time and the
immobilised enzyme was filtered off.
The samples were analysed by TLC as shown in FIG. 65.
The TLC analysis clearly shows the effect of immobilised
transferase from A. salmonicida in the transformation of
cholesterol into cholesterol ester. It is also observed that small
amount of monoglyceride is formed. The enzyme has also been shown
to have a high activity in environments with high water content
(6-89%) water environments, the use of the transferase, and other
transferases for use in the invention can therefore also be used in
immobilised enzyme applications with a significant water content.
This allows the replacement of the solvents used by the current
immobilised lipases in the bioconvertion of lipids using
transferases.
Example 16
The Aeromonas hydrophilia Transferase can Transfer from a
Phospholipid to a Sterol to Form a Sterol Ester, and/or a Sugar
Molecule to Form a Sugar Ester
A lipid acyltransferase from Aeromonas hydrophila expressed in E.
coli (Hydro 0303 HVP), labelled #139 was purified on a Chelating
Sepharose FF, HR 2.5/10 column and analysed for Phospholipase
activity. The transferase activity was evaluated in egg yolk for
enzyme activity and functionality in egg yolk. The enzyme was also
tested in egg yolk containing glucose.
Phospholipase Activity.
Transferase #139 isolated from a Chelating Sepharose FF, HR 2.5/10
column was assayed by NEFA-PLU(pH7) The activity was 1.15 Units
NEFA-PLU/ml.
Egg Yolk
In an initial application test transferase #139 was tested in egg
yolk according to the following procedure.
1-gram fresh egg yolk was scaled in a 10 ml flask with screw lid.
The enzyme preparation was added and mixed on a Vortex mixer. The
sample was placed at 37.degree. C. and agitated with a magnetic
stirrer.
The reaction was stopped by adding 7.5 ml Chloroform:Methanol (2:1)
and mixed on a Whirley mixer for 30 seconds. The chloroform phase
was isolated by centrifugation and 2 .mu.l of the chloroform phase
was transferred to a pre-activated silica TLC plate and eluted with
running buffer nr. I and another TLC-plate in running buffer
IV,
The experimental set up is shown in table 28.
TABLE-US-00040 TABLE 28 Test Reaction time Egg yolk Transferase
#139 no. min. gram units 1 10 1 2 10 1 0.75 NEFA-PLU 3 60 1 0.75
NEFA-PLU 4 300 1 0.75 NEFA-PLU 5 1200 1 6 1200 1 0.75 NEFA-PLU
TLC analysis are shown in FIG. 66 and FIG. 67. The TLC analysis
clearly demonstrates the transferase reaction of transferase #139.
The cholesterol is converted to cholesterol ester and the amount of
lecithin is reduced. The results however also indicate that
lysolecithin are only accumulated in very small amount because
transferase #139 also is active on lysolecithin. This observation
is supported by the formation of free fatty acids (FFA).
Egg Yolk and Glucose
It was earlier shown that a transferase from Aeromonas salmonicida
(#138) was able to use glucose as acceptor molecule in a
transferase reaction. It has also been tested if transferase #139
can use glucose as acceptor molecule. The experimental set up is
seen in Table 29.
TABLE-US-00041 TABLE 29 Test Reaction time Egg yolk Glucose, 70%
Transferase #139 no. Minutes gram mg units 1 10 1 500 2 10 1 500 1
NEFA-PLU 3 60 1 500 1 NEFA-PLU 4 180 1 500 1 NEFA-PLU 5 300 1 500 1
NEFA-PLU 6 1200 1 500 1 NEFA-PLU 7 1200 1 500
The reaction products were analysed by TLC (FIG. 68 and FIG.
69).
The TLC analysis indicates formation of glucose ester after 220
min. reaction time (FIG. 69 lane 6) but after 1200 min reaction
time no glucose ester is seen.
It must therefore be concluded that transferase #139 has both
transferase and hydrolytic activity. This is also supported by the
fact that the amount of free fatty acids steadily increases as a
function of reaction time.
Resume:
Transferase from Aeromonas hydrophila was tested in egg yolk. The
results confirm that this enzyme catalyses the formation of
cholesterol ester concomitant with the formation of lysolecithin.
After extended reaction time when most of the cholesterol is
consumed free fatty acid are also formed. It can therefore be
concluded that the enzyme has primary transferase activity but also
hydrolytic activity was observed when only water was available as
donor molecule.
In an experiment with egg yolk and glucose it has been observed
that transferase from Aeromonas hydrophila is able to catalyse the
formation of glucose ester in situ in a high water food environment
(FIG. 70).
Example 17
Variants of a Lipid Acyltransferase from Aeromonas hydrophila
(Ahyd2)
SEQ ID No. 36 (see FIG. 71)
Mutations were introduced using the QuikChange.RTM. Multi-Site
Directed Mutagenesis kit from Stratagene, La Jolla, Calif. 92037,
USA following the instructions provided by Stratagene.
Variants at Tyr256 showed an increased activity towards
phospholipids.
Variants at Tyr256 and Tyr260 showed an increased activity towards
galactolipids.
Variants at Tyr265 show an increased transferase activity with
galactolipids as the acyl donor.
The numbers indicate positions on the following sequence: An enzyme
from Aeromonas hydrophila the amino acid sequence of which is shown
as SEQ ID No. 36 in FIG. 71 (the underlined amino acids show a
xylanase signal peptide). The nucleotide sequence is as shown as
SEQ ID No 54 in FIG. 72.
Example 18
Use of Acyl-Transferase Reaction for the Production of Plant Sterol
Ester and Monoglyceride for Margarine Production
An acyltransferase from Aeromonas salmonicida expressed in Bacillus
subtilis was tested in a palm oil mixture containing plant
lecithin, plant sterol and glycerol. The acyl-transferase showed
the ability to utilise both plant sterol and glycerol as acceptor
molecules during production of plant sterol ester and
monoglyceride. The reaction mixture was used to produce table
margarine of good quality based on the monoglyceride in the
reaction mixture and at the same time the margarine was enriched
with plant sterol ester, which has been shown to have a cholesterol
lowering effect.
The aim of this work was to study to possibility to produce
monoglyceride and plant sterol ester by enzymatic reaction of
lecithin, plant sterol and glycerol dissolved in vegetable fat.
Initial experiments has shown that it was possible to use
acyl-transferase from Aeromonas salmonicida to produce
monoglyceride and plant sterol ester from lecithin, glycerol and
plant sterol.
In this experiment such reaction mixture was used to produce table
margarine.
Materials:
Lipid acyltransferase from Aeromonas salmonicida, # 196 C101, 18.6
PLU/g (Journal 2254-104) Palm Oil 43, from Aarhus United, DK
L-.alpha. Phosphatidylcholine 95% Plant (Avanti #441601) Plant
Sterol Generol N122 from Cognis, Germany Glycerol Item no. 085915
Distilled Monoglyceride, Dimodan HP from Danisco. Margarine
Production. 1. Blend the water phase ingredients. (If required,
pasteurize the water phase by heating to approx. 80.degree. C.).
Adjust pH 5.5. 2. Melt the fat phase, and temper to approx.
40-45.degree. C. 3. Heat the emulsifier with some of the oil in a
ratio of 1 part emulsifier to 5 parts oil to a temperature
(75-80.degree.), which is 5-10.degree. C. higher than the melting
point of the emulsifier. When this blend is fully melted and well
stirred, add it to the remaining heated oil, stirring continuously.
4. Add the flavouring. 5. Add the water phase to the fat phase,
stirring continuously. 6. Cool in a tube chiller (normal capacity,
normal cooling) to an outlet temperature of 8-10.degree. C.
Results
Acyltransferase from A. salmonicida was tested in an palm oil
mixture as shown in Table 30. Lecithin, plant sterol, glycerol and
palm oil was heated to 60.degree. C. during agitation in order to
solubilize plant sterol and lecithin.
TABLE-US-00042 TABLE 30 Substrate: % Avanti lecithin 12 Plant
sterol, Generol 122N 6.6 Palm oil, melting point 43 76.4 Glycerol
5
The substrate was cooled to 48.degree. C. and acyl-transferase #196
was added in the amount shown in Table 31. The reaction mixture was
kept at 48.degree. C. for 24 hours during slow agitation.
TABLE-US-00043 TABLE 31 gram Substrate 220 Transferase # 196 C101,
18.6 PLU/g 15
Samples from the reaction mixture were taken out after 1, 4 and 24
hours reaction time, and analysed by TLC in solvent I (FIG. 73).
The TLC results clearly show the formation of plant sterol ester
and monoglyceride. In FIG. 73, the first lane is after 1 hour
reaction time, Lane 2 is 4 hours reaction time, Lane 3 is 24 hours
reaction time and Lane 4 is a plant sterol.
The reaction was stopped after 24 hours reaction time and residues
of undissolved plant sterol was removed, and the clear solution was
used to produce margarine.
Margarine.
The reaction mixture containing monoglyceride and plant sterol
ester was used to produce table margarine according to the recipe
shown in Table 32.
TABLE-US-00044 TABLE 32 Jour. No 3734 1 2 Water phase Water phase
16 16 Salt 0.5 0.5 Skim milk powder 1 1 Potassium sorbate 0.1 0.1
EDTA 0.015 0.015 PH 5.5 5.5 Water phase total 16.6 16.6 Fat phase
Palm 43 25 25 Rapeseed Oil 75 75 Fat phase total 83.2 78.4 Dimodan
HP 0.2 Reaction mixture 5
The margarine produced from the reaction mixture was evaluated of
good quality with good spreadability, and good mouth feel and
without any off flavour. The margarine was compared to be on
quality level with the reference margarine produced by using
distilled monoglyceride Dimodan HP.
The only difference observed was that the margarine jour. 3734 no 2
with the reaction mixture was slightly more firm, which was
explained by the fact that this recipe contained more Palm 43 than
the reference margarine.
Example 19
Use of a Lipid Acyltransferase During Bread Production
One of the limitations of using lipases in bread making is that
free fatty acid is formed during the lipase reaction. It is well
known that formation of too much free fatty acid will have a
negative impact on the baking performance of flour, because the
gluten gets too stiff and a bucky (i.e. less elastic) dough is
formed which can not expand during fermentation and baking.
Formation of free fatty acid should also be avoided from the point
of oxidative stability, because free fatty acids are more prone to
lipid oxidation than the corresponding triglyceride.
In the present invention the problems with free fatty acid
formation when adding a lipolytic enzyme to a dough has been
overcome by using a lipid acyltransferase which, instead of
producing free fatty acids, transfers one or more fatty acids from
the lipid acyl donor to a non water acceptor molecule present in
the dough, such as a carbohydrate, a protein or peptide, or if used
in bread with milk fat, a sterol, alternatively or in combination
other acceptors listed above mat be added to a dough, for example
phytosterols or phytostanols. Preferably, the acceptor molecule in
a dough may be one or more of glucose, sucrose or maltose and/or
other carbohydrates normally available in a dough.
In the following experiments acyl transferase is tested in mini
scale baking experiments. The formation of reaction products, and
the lipid components in fully proved dough is extracted by water
saturated butanol and analysed by HPLC and GLC analysis.
Materials and Methods
Enzymes:
Acyl Transferase, 550 PLU-7/ml Lipopan.TM. F BG, a commercial
lipase from Novozymes. 12000 LIPU/g or Grindamyl Exel 16. 12000
LIPU/g Lecithin powder, 95% phospholipid (available from Danisco
A/S Denmark) Digalactosyldiglyceride from whole wheat flour (from
Sigma D4651) Flour: So/lvmel nr. 2001084 (Danish wheat flour,
obtained from Havnemollerne, Odense, Denmark) Mini baking test.
Flour, 50 gram, Dry yeast 10 gram, glucose 0.8 gram, salt 0.8 gram,
70 ppm ascorbic acid and, water 400 Brabender units was kneaded in
a 50 g Brabender mixing bowl for 5 min at 30.degree. C.
Resting time was 10 min. at 34.degree. C. The dough was scaled 15
gram per dough. Then moulded on a special device where the dough is
rolled between a wooden plate and a plexiglas frame. The doughs
were proofed in tins for 45 min. at 34.degree. C., and baked in a
Voss household oven 8 min. 225.degree. C.
After baking the breads are cooled to ambient temperature and after
20 min. the breads are scaled and the volume is determined by rape
seed displacement method. The breads are also cut and crumb and
crust evaluated.
Results and Conclusion:
Preliminary results indicate that the lipid acyltransferase clearly
demonstrates a positive effect on both bread volume and bread
appearance. In particular, preliminary results indicate that the
use of the lipid acyltransferase results in increased specific
bread volume as compared with that obtained with the control (no
enzyme) and that obtained with the use of a commercially available
lipolytic enzyme, namely Grindamyl Exel 16 or LipopanF.TM..
Example 20
Standard Ice Cream with Dairy Fat
The function of emulsifiers used in ice cream is to bring about
controlled fat crystallisation and mild destabilization due to
protein desorption during ageing of the ice cream. This change
improves the ice cream quality. Mono-diglycerides are normally used
for the production of ice cream, but is also known to use polar
emulsifiers like polysorbate and sugar esters in ice cream
production in combination with mono-diglyceride to facilitate
controlled fat destabilization and produce ice cream with very good
creamy and smooth eating texture.
Emulsifiers used for ice cream are normally added the ice cream mix
as a powder. Recently it has however been shown that
mono-diglyceride can bee produced by enzymatic reaction of the fat
in the ice cream recipe using lipases. The problem by using lipases
is however that lipases also catalyse the formation of free fatty
acids, when water is available in the reaction mixture.
It has however surprisingly been shown that lipid acyl-transferase
overcomes the limitation by lipase because acyl-transferase is able
to transfer fatty acid from lecithin and other lipids to acceptor
molecules like sterol, cholesterol, glucose, glycerol and
proteins/peptides without formation of significant amount of free
fatty acids.
One of the main ingredients in ice cream is dairy cream containing
38% milk fat. Dairy cream also contains smaller amount of lecithin,
which is a donor molecule for acyl-transferase. ("Complex milk
lipids account for about 1% of the total milk fat and are mainly
composed of phospholipids". Ref. Ullmann's Encyclopedia of
Industrial Chemistry Copyright .COPYRGT. 2003 by Wiley-VCH Verlag
GmbH & Co. KGaA.). Dairy cream also contains small amount of
cholesterol, which is an acceptor molecule for
acyl-transferase.
From the constituents of ice cream it is thus possible to produce
both monoglyceride and polar emulsifiers like lyso-lecithin and
sugar ester, which are known for the beneficial effects in ice
cream production.
A further beneficial effect form the reaction of acyl-transferase
in dairy cream is the formation of cholesterol ester, which might
slow down the absorption of cholesterol in the intestine.
TABLE-US-00045 Ice cream Recipe With emulsifier With enzyme Dairy
cream, 38% 23.65 23.65 Skimmed milk 53.30 53.30 Skimmed milk powder
4.90 11.30 Sugar 12.00 12.00 Glucose sirup, DE 42, 75% TS 4.25 4.25
Glycerol 1.0 1.0 Stabilizer blend 0.2 0.2 Cremodan SE 30 0.6 Lipid
acyl transferase, 500 PLU/g 0.1 Grindsted Flavouring 2976 0.1 0.1
Colour + +
Ice Cream Production Process. 1. Heat dairy cream, glucose syrup
and glycerol to approx. 40.degree. C. Add the lipid acyl
transferase and let the mixture react for 30 minutes. A sample is
taken out for analysis 2. Heat all the other liquid ingredients to
approx. 40.degree. 3. Add the other dry ingredients. (stabiliser
blend is mixed with sugar before addition) 4. When the dry
ingredients are dissolved add the dairy cream-glucose mixture. 5.
Pasteurize at 80-85.degree. C./20-40 seconds 6. Homogenize at
80.degree. C. (190 bar for recipe 1 and 175 bar for recipe 2) 7.
Cool to ageing temperature, 4.degree. C. 8. Freeze in continuous
freezer to desired overrun (100% recommended) 9. Harden in tunnel
at -40.degree. C. 10. Store below -25.degree. C. Results:
Uses of Acyl-transferase in the production of ice cream contribute
to the production of ice cream with very good taste and excellent
creamy mouth feel comparable the ice cream produced by using a
commercial emulsifier Cremodan SE 30. The melt down of the ice
cream produced by the lipid acyl transferase is also improved.
Example 21
Acyl Transferase in Cheese
Cheese is the fresh or matured solid or semisolid product obtained
by coagulating milk, skimmed milk, partly skimmed milk, cream, whey
cream, or buttermilk, or any combination of these materials,
through the action of rennet or other suitable coagulating agents,
and partially draining the whey that results from such
coagulation.
The cheese yield depends primarily on the fat and protein contents
of the milk. The salt (particularly calcium salts) and protein
concentrations, as well as the acidity, are very important for
coagulation. (ref. Ullmann's Encyclopedia of Industrial Chemistry
Copyright .COPYRGT. 2003 by Wiley-VCH Verlag GmbH & Co).
Such effort has been made in order to optimise and increase the
cheese yield by optimisation of the cheese making procedure (U.S.
Pat. No. 4,959,229) or by using improved clotting method (U.S. Pat.
No. 4,581,240), which increase the amount of whey protein in the
curd.
In the present invention the amount of whey protein in the curd is
increased by enzymatic modification of the whey protein by
treatment of the milk during cheese making with a lipid acyl
transferase.
When a fatty acid is covalently linked to a non-membrane protein
like 3-lactoglobulin, the physical and functional properties will
change drastically.
For cheese production of the present invention acyl transferase is
added to the milk before or at the same time as rennet is added to
the milk.
During casein precipitation acyl transferase is able to use
lecithin and other lipids in the milk as donor and peptides or
protein as acceptor molecule during formation of acylated protein
or acylated peptides.
The change in hydrophobic properties of milk protein contributes to
increased protein precipitation in the curd during cheese
production.
Since the increase in cheese yield obtained by the present
invention originates from increased retention in the cheese
coagulum of proteins that are normally lost in the whey, a suitable
method, directly related to the mechanism of the invention, is
based on determination of the amount of protein that ends up in the
whey. Less protein in the whey necessarily means more protein in
the curd, and higher cheese yield.
The test for the amount of protein in the whey can be performed in
the following way. Skim or whole milk is warmed to a temperature
suitable for rennet coagulation, typically 30-35 oC in a 100 ml
beaker. Optionally 1% of a bulk lactic acid bacteria starter is
added, and standard rennet is added in an amount corresponding to
e.g. 0.03-0.05%. When the milk has turned into a coagulum solid
enough to allow it to be cut into cubes with a side length of about
0.5 cm, such cutting is performed with a sharp knife. Syneresis is
thereby initiated, and after 30 min holding period, that allows the
curd to settle, a whey sample is withdrawn, and centrifuged in a
laboratory centrifuge for 10 min. This sample is analyzed for
protein content, using e.g. the Kjeldahl method. Alternatively,
and/or as a supplement, the sample may be analyzed with methods
that allow the type and quantity of the individual protein
components to be established.
Example 22
Assay in Low Water Environment
Transferase reactions of lipolytic enzymes in low water
environment.
Procedure
Materials.
Cholesterol Sigma cat. C 8503 L-alpha-Phosphatidylcholine 95%
(Plant) Avanti #441601 Soybean oil, Aarhus United, DK. Chloroform,
Analytical grade Enzymes. #179, GCAT from A salmonicida #2427,
Phospholipase A1 from Fusarium oxysporum. LIPOPAN.RTM.F from
Novozymes, Denmark #1991, Phospholipase A2 from Pancreas, LIPOMOD
22L from Biocatalyst, UK #2373, Candida Antarctica lipase, Novozyme
525 L from Novozymes Denmark. Enzyme Assay
13.1% Lecithin and 6.6% cholesterol was dissolved in soybean oil by
heating to 60.degree. C. during agitation.
The substrate was scaled in a 20 ml Wheaton glass and heated to
46.degree. C.
Water and enzyme solution was added and a stopwatch is started.
At regular intervals 50 mg samples ware transferred to a 10 ml Dram
glass and frozen.
The isolated lipids were analysed by GLC
GLC Analysis
GLC analysis was carried out as described in Example 11
Results
The experiment was set up as shown in Table 33
The substrate based on soybean oil containing 13.1% lecithin and
6.6% cholesterol was heated to 46.degree. C. The enzyme solution
was added and a stopwatch started.
After 30, 60 and 120 minutes reaction time samples were taken out
for GLC analysis.
TABLE-US-00046 TABLE 33 1 2 3 4 5 Substrate gram 5 5 5 5 5
Transferase #179-C72, 56 PLU-7/ml ml 0.3 #2427, 200 PLU-7/ml ml 0.3
Pancreas PLA 2 #1991 6300 PLU/ml ml 0.3 Novozyme 525 L, #2373, 200
LIPU/ml ml 0.3 Water ml 0.3 % water 6 6 6 6 6
The results from the GLC analysis is shown in Table 34. The results
are expressed in percent based total sample composition. Based on
the GLC results it was possible to calculate the amount of fatty
acid and cholesterol ester produced by enzymatic reaction relative
to the control sample without enzyme added. Under these
experimental conditions the total enzymatic activity was estimated
as the hydrolytic activity measured as free fatty acid formation
and the transferase activity estimated as cholesterol ester
formation. From these results and the information about molecular
weight of fatty acid and cholesterol ester it was possible to
calculate to relative molar hydrolytic activity and the relative
molar transferase activity as shown in Table 35.
TABLE-US-00047 TABLE 34 Reaction time Enzyme minutes Fatty acid %
cholesterol % Cholesterol ester % Control 120 0.533 7.094 0.000
#179 30 0.770 5.761 2.229 #179 60 0.852 5.369 2.883 #179 120 0.876
4.900 3.667 #2427 30 3.269 7.094 0.000 #2427 60 3.420 7.094 0.000
#2427 120 3.710 7.094 0.000 #1991 30 2.871 7.094 0.000 #1991 60
3.578 7.094 0.000 #1991 120 3.928 7.094 0.000 #2373 30 1.418 7.094
0.000 #2373 60 1.421 7.094 0.000 #2373 120 1.915 7.094 0.000
TABLE-US-00048 TABLE 35 Reaction time Fatty acid Cholesterol
Cholesterol ester Hydrolytic Transferase Enzyme minutes produced
Used produced activity % activity % #179 30 0.238 1.334 2.229 20 80
#179 60 0.319 1.725 2.883 21 79 #179 120 0.343 2.195 3.667 18 82
#2427 30 2.737 0.000 0.000 100 0 #2427 60 2.887 0.000 0.000 100 0
#2427 120 3.177 0.000 0.000 100 0 #1991 30 2.338 0.000 0.000 100 0
#1991 60 3.046 0.000 0.000 100 0 #1991 120 3.395 0.000 0.000 100 0
#2373 30 0.885 0.000 0.000 100 0 #2373 60 0.888 0.000 0.000 100 0
#2373 120 1.383 0.000 0.000 100 0
Conclusion
In these experiments it was observed that all the tested enzymes
showed hydrolytic activity because the amount of fatty acid
increased. However the only enzyme which showed transferase
activity was GCAT from A. salmonicida. It is therefore concluded
that in an oily system with lecithin and cholesterol containing 6%
water phospholipase A1 from Fusarium oxysporum, phospholipase A2
from pancreas and a lipase from Candida antarctica only showed
hydrolytic activity.
Example 23
Treatment of Butterfat
Lipid acyl transferase derived from Aeromonas salmonicida (SEQ ID
No. 90, N80D variant) was expressed in Bacillus licheniformis
(hereinafter referred to as KLM3) (see below).
The lipid acyl transferase was tested in butterfat with the aim to
investigate the transfer reaction when 0.5% glycerol and 1%
phospholipid was added to the butterfat.
The reaction products were analysed by TLC and the results clearly
showed the formation of monoglyceride which confirm that lipid acyl
transferase utilizes glycerol as acceptor molecule.
Experimental
Enzymes:
Lipid acyl transferase (LAT) expressed in B. licheniformis: 2005876
(5500 TIPU/ml) Lipomod 699L, pancreatic phospholipase from
Biocatalysts. 10000 U/ml Butterfat: Anhydrous Butterfat A0019659
lot 0130547 from Croman Belgium. Glycerol: Lecithin:
Phosphatidylcholine 95% Plant (Avanti #441601), HPTLC Applicator:
LINOMAT 5, CAMAG applicator. HPTLC plate: 10.times.10 cm (Merck no.
1.05633) The plate was activated before use by drying in an oven at
160.degree. C. for 20-30 minutes. Application: 1.0 .mu.l of a 15.0%
solution of reacted butterfat dissolved in Chloroform:Methanol
(2:1) was applied to the HPTLC plate using LINOMAT 5 applicator.
Running-buffer: 1: P-ether:MTBE:Acetic acid (60:40:1)
Application/Elution time: 14 minutes. Running-buffer: 5:
P-ether:MTBE:Acetic acid (70:30:1) Application/Elution time: 12
minutes. Running-buffer: 4: Chloroform:Methanol:water (75:25:4)
Application/Elution time: 20 minutes. Developing fluid: 6%
Cupriacetate in 16% H.sub.3PO.sub.4
After elution the plate was dried in an oven at 160.degree. C. for
5 minutes, cooled and immersed in the developing fluid and then
dried additional in 5 minutes at 160.degree. C. The plate was
evaluated visually and scanned (Camag TLC scanner).
Results
Samples of butterfat, glycerol, lecithin and enzyme were scaled in
a 20 ml Wheaton glass as outlined in table 36.
TABLE-US-00049 TABLE 36 1 2 3 4 5 6 7 8 9 10 Croman Anhydrous
Butterfat g 10 10 10 10 10 9.9 9.9 9.9 9.9 9.9 lecithin, g 0.1 0.1
0.1 0.1 0.1 LAT, 500 mg 20 100 20 100 Lipopmod 699L 1000 mg 20 100
20 100 Glycero mg 50 30 30 50 30 30 Units/g 0 1 5 2 10 1 1 5 2 10 *
LAT 2005876 (5000 TIPU/ml) dissolved in glycerol:enzyme 9:1 **
Lipomod 699L (#3332) dissolved in glycerol:enzyme 9:1
The samples were placed in a heating block at 50.degree. C. for 4
hours and then a sample was taken out for analysis and dissolved in
chloroform:methanol 2:1.
The samples were analyzed by TLC in running buffer 5, 1 and 4 as
shown in FIG. 104.
The TLC plate shown in FIG. 105 was scanned by a Camag Densiometric
scanner and based on the amount of monoglyceride in the reference
sample of mono-diglyceride the amount of monoglyceride in the
butterfat is calculated as shown in table 37
TABLE-US-00050 TABLE 37 Monoglyceride in the butterfat samples
calculated by dentiometric measurement of TLC plate. Sample Jour.
2390-67 % Monoglyceride 1 0.005 2 0.005 3 0.009 4 0.005 5 0.005 6
0.004 7 0.423 8 0.449 9 0.004 10 0.004
Conclusion
The TLC results from enzymatic treatment of butter oil containing
glycerol/phospholipids with lipid acyltransferase conform the
ability of the enzyme to convert cholesterol into cholesterol ester
and glycerol to monoglyceride using phospholipid as acyl donor.
In the experiment conducted it was shown that all phospholipids
both phosphatidylcholine (PC) and lyso-phosphatidylcholine (LPC)
can be completely converted to glycerophosphocholine.
The experiments also indicated that the pancreatic phospholipase is
less active in low water environment and had no significant
acyltransferase activity.
The enzyme modified butterfat (samples 7 & 8 of Table 37) is
added to skimmed milk to a final concentration of 3.6 wt % fat to
produce a milk for use in the preparation of cheese.
Example 24
Treatment of Butterfat and Cream
The lipid acyl transferase was tested in butterfat and cream (38%
fat) with the aim to investigate the transfer reaction when 0.5%
glycerol and 1% phospholipid was added to the butterfat.
The reaction products was analysed by TLC and the results from
butterfat clearly showed the formation of monoglyceride and
lysophosphospholipid. The results from experiment with cream also
confirmed the formation of monoglyceride although at lower level,
possibly due to a competitive hydrolytic reaction causing the
formation of free fatty acids. In the experiments with cream little
increase in lysophospholipid was observed, but this might be
explained by too high enzyme dosage.
Experimental
Enzymes:
Lipid acyl transferase (as per Example 23) Butterfat: Anhydrous
Butterfat A0019659 lot 0130547 from Croman Belgium. Cream: 38% fat
from ARLA, DK Glycerol: Lecithin: Phosphatidylcholine 95% Plant
(Avanti #441601), HPTLC Applicator: LINOMAT 5, CAMAG applicator.
HPTLC plate: 10.times.10 cm (Merck no. 1.05633) The plate was
activated before use by drying in an oven at 160.degree. C. for
20-30 minutes. Application: 1.0 .mu.l of a 15.0% solution of
reacted butterfat dissolved in Chloroform:Methanol (2:1) was
applied to the HPTLC plate using LINOMAT 5 applicator.
Running-buffer: 1: P-ether:MTBE:Acetic acid (60:40:1)
Application/Elution time: 14 minutes. Running-buffer: 5:
P-ether:MTBE:Acetic acid (70:30:1) Application/Elution time: 12
minutes. Running-buffer: 4: Chloroform:Methanol:water (75:25:4)
Application/Elution time: 20 minutes. Developing fluid: 6%
Cupriacetate in 16% H.sub.3PO.sub.4
After elution the plate was dried in an oven at 160.degree. C. for
5 minutes, cooled and immersed in the developing fluid and then
dried additional in 5 minutes at 160.degree. C. The plate was
evaluated visually and scanned (Camag TLC scanner).
Results
Samples of butterfat, glycerol, lecithin and enzyme were scaled in
a 20 ml Wheaton glass as outlined in table 38
TABLE-US-00051 TABLE 38 1 2 Croman, Anhydrous Butterfat A0019659
lot 0130547 g 10 10 Cream, 38% g Lecithin, Avanti g 0.1 0.1 LAT,
500 TIPU/ml* mg 50 Glycerol mg 50 Units/g 0 2.5 *LAT (5000 TIPU/ml)
dissolved n glycerol:enzyme 9:1
The samples were placed in a heating block at 45.degree. C. and
samples were taken out after 10, 30, 60, and 120 minutes and
dissolved in chloroform:methanol 2:1.
The samples were analyzed by TLC in running buffer 5, 1 and 4 as
shown in FIG. 106, 107 and 108.
Conclusion. Butterfat Experiment.
The TLC results from enzymatic treatment of butter oil containing
glycerol/phospholipids with lipid acyltransferase confirm the
ability of this enzyme to convert cholesterol into cholesterolester
and glycerol to monoglyceride using phospholipid as acyl donor.
In the experiment conducted it was shown that phospholipid (PC) was
converted to lyso-phosphatidylcholine (LPC). By extended reaction
time lyso-phospholipid (LPC) was further converted to
glycophosphocholine. It is therefore possible to optimize enzyme
dosage and reaction time in order to identify the optimum level of
monoglyceride and lysophospholipid production for any particular
application.
The enzyme modified butterfat is added to skimmed milk to a final
concentration of 3.6 wt % fat to produce a milk for use in the
preparation of cheese. Initial experiments indicate that the enzyme
modified butter fat may be more easily incorporated into the
skimmed milk when compared to non modified butter fat.
Results with Cream
Samples of cream, glycerol, lecithin and enzyme were scaled in a 20
ml Wheaton glass as outlined in table 39
TABLE-US-00052 TABLE 39 3 4 Croman, Anhydrous Butterfat A0019659
lot 0130547 g Cream, 38% g 10 10 lecithin, Avanti g 0.1 0.1 LAT,
500 TIPU/ml* mg 50 Glycerol mg 50 *LAT (5000 TIPU/ml) dissolved in
glycerol:enzyme 9:1
The samples were placed in a heating block at 45.degree. C. and
samples were taken out after 10, 30, 60, and 120 minutes and
dissolved in chloroform:methanol 2:1.
The samples were analyzed by TLC in running buffer 5, 1 and 4 as
shown in figures. 109, 110 and 111.
Conclusion. Cream Experiment.
The TLC results from treatment of cream containing phospholipid and
glycerol with an enzyme lipid acyl transferase clearly confirm the
transfer reaction of acyl groups from phospholipid (PC) to
cholesterol during formation of cholesterol ester.
The transferase reaction of acyl groups to glycerol was also
observed. There was also a noticeable hydrolytic activity. Further
optimerization of to produce optimum level of monoglcyeride via
modulation of enzyme dosage, glycerol dosage and reaction time is
therefore is therefore possible.
Example 25
Production of Mozzarella
Enzymes
EDS 188: Lipid acyltransferase in accordance with the present
invention, (herein referred to KLM3) expressed in B. lichiniformis:
2005876 (1460 TIPU/ml) (SEQ ID No. 90, N80D variant). Lecitase,
pancreas phospholipase, Sigma P0861, 10,000 unit/ml. Day 1. 1. Milk
was separated at 55.degree. C. into skim (0.075% w/w fat) and cream
(30%, w/w) fat A "skim" (0.83%, w/w) fat was prepared by blending
the skim milk and cream (see FIG. 120) 2. 0.4 g CaCl2 (50%, w/v)
per kg of cream (30% fat) was added and the cream was divided into
3 equal lots--namely for control (Vat 1), Lecitase (Vat 2) and
KLM3' (Vat 3) 3. 0.2% (w/w of fat content), Lecitase to Vat 2
equivalent to 0.06% (w/w of 30% fat cream) or equivalent to 0.6 g
per kg of 30% fat cream was added. 4. KLM3' 25 TIPU/kg cream was
added to Vat 3. 5. In the control (Vat 1), no enzyme solution (or
water) was added. 6. All cream treatments (incl. control) were
incubated at 50.degree. C. for 30 min. 7. Immediately thereafter,
the correct weight of each cream to the correct of cold (10.degree.
C.) "skim milk (0.83% w/w) fat was added to get the correct fat
content (3.5%, w/w) in the mixtures, which are the standardized
milks. 8. These were pasteurized at 72.degree. C. for 26 seconds.
9. Cooled to 5 C and held overnight. Day 2. 10. The milk was heated
to 41.degree. C. and kept it for 30 minutes (This was done so as to
reverse the cold storage ageing effects on the milk). 11. The milk
was cooled to 34.4.degree. C. 12. Starter culture was added
(Choozit Ta 61 100DCU, Choozit LH100 50 DCU in DAN 011, Dan 012,
DAN 013; and Choozit Ta 61 100 DCU, Choozit LH100 23.3 DCU in DAN
021, DAN 022, DAN 023). DAN 021, DAN 022 and DAN 023 were dosed
with a reduced amount of Choozit LH100 to reflect the addition
rates of Helveticus culture normally used in industrial mozzarella
production. The cultures were added directly to the cheese milk and
left for 45 min. with agitation 13. The rennet was added ((145 ml
Marzyme10 (140 imcu/ml) diluted to 1 liter with water), 14. The
rennet was mixed in for 2 min. A sample of the rennet milk was
taken and placed in a rheometer to measure the change in the
elastic modulus, G', as a function of time. 15. The gel (curd) in
the vat was cut when the firmness (G') reached 40 Pa as determined
on a controlled stress rheometer. 16. The gel was cut using a wire
grid--(speed 2-15 seconds, stand 1 min, cut speed 1-15 seconds,
stand 1 min, Cut speed 1-10 seconds) and the curd whey mix was
allowed to sit quiescently (heal). This healing step is
incorporated in industrial cheese making to minimize fat losses to
the whey. 17. The curd whey mixture was stirred (at 10 min from
beginning of cut period) for 5 min, so as to get curd/whey mix in
motion. 18. The curd/whey mix was heated to 41.1.degree. C. in 30
min. 19. Stirring continued until curd pH (as measured on whey
squeezed from the curd) reached 5.9. 20. The curd whey mixture was
drained into finishing vat, and the whey removed by gravity flow.
21. The curd was trenched to sides of vat, leading to 2 curd
trenches. 22. The curd trenchs were cut into slabs. 23. The curd
slabs were turned every 15-20 min and held in the finishing vat
until the pH (as measured by inserting pH probe into sample of
curd) reached 5.25. 24. The curd was then milled into chips (0.75
cm.times.0.75 cm.times.7 cm long). 25. Covered with cold water
(17.degree. C.) for 15 mins. 26. The water drained for 10 mins. 27.
The curd was weighed and salt added to the curd at a level of 0.2%
(w/w) of cheese milk weight (0.9 kg to cheese curd from 450 kg of
milk). The curd was left to absorb applied salt for 20 min 28. The
curd was placed into a plasticization kneading/stretching unit (via
the shredding unit built into the equipment). 29. The curd was
kneaded/stretched while it is heated to 63.degree. C. by
circulating water at 80 C. 30. The curd was placed in 7.degree. C.
water for 30 min 31. The curd was then placed in 7.degree. C. brine
(23% NaCl) for 90 min. 32. The curd was remove from the brine and
left to drain for 10 mins. 33. The brined curd was weighed 34.
Vacuum packed, and placed at 4.degree. C. Results
TABLE-US-00053 TABLE 40 Cheese yield and fat content of whey wt
curd in unmoulded Curd ex Total wt of Cheese yield Wt Milk moulds
curd brine salted cheese kg/100 kg Fat in whey Code kg kg kg kg kg
milk %, w/w DAN011 454.1 26.62 18.36 26.78 45.25 9.96 0.48 DAN012
454.6 26.62 21.66 26.69 48.41 10.65 0.41* DAN013 454.2 26.6 23.56
26.83 50.59 11.14* 0.34* DAN021 454.4 26.55 18.63 26.7 45.44 10.00
0.51 DAN022 454.1 26.5 20.69 26.69 47.53 10.47 0.41* DAN023 454.3
26.4 21.61 26.52 48.23 10.62* 0.35* DAN011 and DAN021 = control,
DAN 012 and DAN022 = Lecitase, DAN013 and DAN023 = KLM3 [*means
statistically significant compared with the control]
Example 26
Pizza Made with Enzyme Modified Cheese
The cheese prepared according to Example 25 is used in the
preparation of pizza.
Pizza Base
500 gms strong white flour 12 gms fresh yeast dissolved in 200-250
ml water containing 1 teaspoon of dissolved sugar, and allowed to
stand at 20.degree. C. for 10 minutes. 1 egg 1-2 tablespoons olive
oil to taste. Salt to taste
The above are mixed and subsequently kneaded by hand for 5 minutes
to produce a dough. The dough is left, covered by a damp cloth, to
rise until at least doubled in volume. The dough is then rolled
until approximately 5 mm-1 cm thin depending on taste.
A tomato sauce is prepared by briefly frying finely chopped onion
and garlic in a pan with olive oil and adding chopped tomatoes. The
sauce is reduced to a desirable consistency. When cool, the sauce
is added to the rolled out pizza dough.
The cheese prepared in Example 25 is added, vegetable, meat and
seafood toppings may also be added. The pizza is baked at
200.degree. C. on a stone base in a fan assisted oven.
The pizza made with the cheese comprising the edible oil/fat of the
invention appears to have noticeably less surface oil and the baked
pizza base appear to be less saturated with the oil, especially
around the edges, and on the surface of the sauce and toppings (see
FIG. 136). This makes the pizza more appetizing to handle and to
eat.
The pizza has an improved over appearance with less visible oiling
off.
Example 27
Lipid Analysis
Cream and cheese from the production of mozzarella as detailed in
Example 25 were analysed as follows:
Lipid Analysis
Cream and cheese from the production of Mozzarella cheese as
detailed in Example 25 were extracted with organic solvents and the
isolated lipids were analysed by HPTLC and GLC. In the cheese
experiment the cream used to produce the cheese was treated with a
pancreatic phospholipase (Lecitase) or a lipid acyltransferase
according to the present invention (KLM3). A control experiment
without any enzyme treatment was also conducted. All three
experiments were made in duplicate over two days.
Lipid analysis of isolated lipids from enzyme treated cream as well
as the cheese produced from the creams showed that both Lecitase
and KLM3 were active on the phospholipids in the products, and the
main phospholipids, phosphatidylcholine (PC) and
phosphadidylethanolamine (PE) were almost completely degraded.
In the Lecitase treated sample the degradation of PC and PE was
followed by concomitant formation of free fatty acids, mainly oleic
acid and linoleic acid. In the experiment with KLM3 the formation
of free fatty acids were significantly lower than the degradation
of phospholipids because this enzyme carried out a transfer
reaction of fatty acids from phospholipids to cholesterol which
resulted in the formation of cholesterol esters. In the cheese
samples treated with KLM3 only 40% cholesterol was left compared
with control and Lecitase treated cheeses. In the cheese treated
with KLM3 small amounts of saturated free fatty acids were formed,
because of unspecific activity on the saturated fatty acids in the
sn-1 position of the phospholipids.
The enzyme treatment was made in a 30% cream which after enzymation
was added to skim milk and adjusted to 3.5% fat for cheese
production.
In this report the analyses of lipid components in the cream used
for the cheese production as well as the cheese were analysed.
Materials and Methods Enzymes: EDS188: Lipid acyltransferase in
accordance with the present invention, (hereinafter referred to
KLM3) expressed in B. lichiniformis: 2005876 (1460 TIPU/ml), (SEQ
ID No. 90, N80D variant). Lecitase, pancreas phospholipase, Sigma
P0861, 10,000 unit/ml. TLC Standards: ST16: 0.5% solution of
phospholipids containing 14.76% Phosphatidylcholine (PC), 0.49%
Lyso-phosphatidylcholine (LPC), 10.13% Phosphatidylinisitol (PI),
12.74% Phosphatidylethanolamine (PE) and 5.13% Phosphatidic acid
(PA). ST17: 0.1% solution of cholesterol, 0.1% cholesterolsteareate
and 0.1% oleic acid. Enzymation of Cream Used for Mozzarella Cheese
Production
Was carried out as disclosed in Example 25. HPTLC Applicator: CAMAG
applicator AST4. HPTLC plate: 20.times.10 cm (Merck no. 1.05641)
The plate was activated before use by drying in an oven at
160.degree. C. for 20-30 minutes. Application: 3.0 .mu.l of
extracted lipids dissolved in Chloroform:Methanol (2:1) was applied
to the HPTLC plate using AST4 applicator. 0.1, 0.3, 0.5, 0.8, 1.5
.mu.l of a standard solution of standard components with known
concentration are also applied to the HPTLC plate. Running-buffer:
1: P-ether:MTBE:Acetic acid (50:50:1) Application/Elution time: 12
minutes. Running-buffer: 6:
Methyl-acetate:Chloroform:Methanol:Tsopropanol: 0.25% KCl solution
in water. (25:25:25:10:9) Application/Elution time: 20 minutes.
Developing fluid: 6% Cupriacetate in 16% H.sub.3PO.sub.4
After elution the plate was dried in an oven at 160.degree. C. for
10 minutes, cooled and immersed in the developing fluid and then
dried additional in 5 minutes at 160.degree. C. The plate was
evaluated visually and scanned (Camag TLC scanner).
After drying the TLC spots are quantified by scanning the plate in
a TLC Scanner 3 from Camag. Based on the density of the standard
component a calibration curve is constructed, and used for
quantification of the components in the sample.
GLC Analysis
Perkin Elmer Autosystem 9000 Capillary Gas Chromatograph equipped
with WCOT fused silica column 12.5 m.times.0.25 mm ID.times.0.1.mu.
film thickness 5% phenyl-methyl-silicone (CP Sil 8 CB from
Chrompack). Carrier gas: Helium. Injector. PSSI cold split
injection (initial temp 50.degree. C. heated to 385.degree. C.),
volume 1.0 .mu.l Detector FID: 395.degree. C.
TABLE-US-00054 Oven program (used since 30.10.2003): 1 2 3 Oven
temperature, .degree. C. 90 280 350 Isothermal, time, min. 1 0 10
Temperature rate, .degree. C./min. 15 4
Sample preparation: Lipid extracted from cheese or cream samples
was dissolved in 0.5 ml Heptane:Pyridin, 2:1 containing internal
standard heptadecane, 0.5 mg/ml. 300 .mu.l sample solution is
transferred to a crimp vial, 300 .mu.l MSTFA
(N-Methyl-N-trimethylsilyl-trifluoraceamid) is added and reacted
for 20 minutes at 60.degree. C. Calculation: Response factors for
Free Fatty Acid (FFA), Cholesterol, Cholesteryl palmitate and
Cholesteryl stearate were determined from pure reference material.
Extraction Cream.
Cream samples in Eppendorph tubes were heated at 99.degree. C. for
10 min. in order to inactivate the enzyme, and cooled to ambient
temperature. 1 ml cream was transferred to a 10 ml dram glass with
screw lid. 3 Ml Chloroform:Methanol 2:1 was added and mixe on a
Whirley. The sample was extracted for 30 min on a Rotamix. The
sample was centrifuged for 10 min. at 1700 g. The lower organics
phase was isolated and used for TLC and GLC analysis.
Extraction Cheese
0.5 g cheese was scaled in a 12 ml centrifuge with screw lid. 2 ml
99% Ethanol was added and the sample was homogenized with a Ultra
Turrax Mixer for 30 sec at 20000 rpm. The mixer was rinsed with 1.5
ml Ethanol. 5 ml Chloroform was added and mixed on a whirley. The
sample was extracted for 30 min on a Rotamix 25 rpm. The sample was
centrifuged for 10 min. at 1700 g.
The lower organics phase was isolated and used for TLC and GLC
analysis
Samples
TABLE-US-00055 TABLE 41 Cream samples taken out after 30 min
enzymation. Test No. Enzyme Dosage, ppm Day DAN011 Control 0 1
DAN012 Lecitase 600 1 DAN013 KLM3 17.1 1 DAN021 Control 0 2 DAN022
Lecitase 600 2 DAN023 KLM3 17.1 2
TABLE-US-00056 TABLE 42 Labeliing of Mozzarella Cheese samples Test
No. Enzyme Day DAN011 Control 1 DAN012 Lecitase 1 DAN013 KLM3 1
DAN021 Control 2 DAN022 Lecitase 2 DAN023 KLM3 2
Results Cream Lipid Analysis.
Samples of cream used for the production of cheese were extracted
with Chloroform methanol according to the procedure mentioned under
Materials and Methods and analysed by HPTLC.
The results from TLC analysis of the cream samples are shown in
FIGS. 121 and 122.
FIG. 121 shows the TLC (solvent 6) of lipid extracted from cream
and a standard mixture (ST16) of phospholipids; Phosphatidylcholine
(PC); Lyso-phosphatidylcholine (LPC); Phosphatidylinisitol (PI);
Phosphatidylethanolamine (PE); 5.13% Phosphatidic acid (PA); and
Spingholipid (SG)
FIG. 122 shows a. TLC (solvent 1) of lipid extracted from cream and
a standard mixture of free fatty acids (FFA), cholesterol (CHL) and
cholesterol ester (CHL-ester).
The density of the bands from the TLC chromatogram were determined,
and based on the standard mixture of phospholipids the amount of PC
and PE were calculated from the TLC chromatogram in FIG. 121 and
based on the standard mixture of cholesterol and fatty acids the
amount of free fatty acids and cholesterol in the samples were
calculated from the TLC chromatogram. The results are shown in
table 43.
TABLE-US-00057 TABLE 43 Analysis of Phosphatidylcholine(PC),
phosphatidylethanolamine (PE), cholesterol (CHL) and free fatty
acids (FFA) based on TLC chromatograms FIGS. 121 and 122 ppm Ppm
ppm ppm Enzyme Day PC PE CHL FFA Control 1 149 278 713 201 Lecitase
1 23 17 638 396 KLM3 1 11 24 328 274 Control 2 117 214 638 166
Lecitase 2 39 29 629 345 KLM3 2 15 28 311 201
The results in table 43 were evaluated statistically by ANOVA using
Statgraphic Plus for Windows 3.1. The statistical evaluation for
cholesterol and free fatty acid are illustrated graphically in
FIGS. 123 and 124.
TLC analysis of cream treated with Lecitase and KLM3 has shown a
strong effect of phospholipases in the cream (FIG. 121) and it is
seen that the two main phospholipid components PC and PE are almost
completely hydrolyzed (table 43).
In FIG. 122 it is shown that KLM3 has a strong impact on the
cholesterol compared to Lecitase. It is also observed that the
amount of fatty acids produced in sample treated with Lecitase are
clearly higher than the samples treated with KLM3 and control.
A statistical evaluation of the amount of fatty acids (FIG. 124)
shows that KLM3 produces a small but not significant amount of free
fatty acids compared with control. The amount of fatty acids in the
sample treated with Lecitase is however significantly higher. This
is explained by the fact that Lecitase hydrolyses phospholipids
resulting in the formation of free fatty acids. KLM3 also degrades
the phospholipids (Table 43) but results in the fatty acids from
the phospholipids being transferred to cholesterol, thus resulting
in the formation of cholesterol ester. This is also confirmed by
the fact that the amount of cholesterol is significantly lower in
the sample treated with KLM3 whereas control and Lecitase treated
samples are on the same level (see FIG. 123).
On a molar ratio it can be calculated that the amount of degraded
PC and PE is 0.6 mmol/kg for both Lecitase and KLM3 and the amount
of fatty acids produced is 0.65 mmol/kg in Lecitase treated cream
and 0.2 mmol/kg for the KLM3 treated cream, which confirms the
observations that Lecitase hydrolyzes phospholipids, but KLM3
catalyses a transfer reaction.
The lipids extracted from cream after 30 minutes enzymation were
also analyzed by GLC in order to quantify specific fatty acids,
cholesterol and cholesterol ester.
The results from GLC analysis are shown in table 44
TABLE-US-00058 TABLE 44 GLC analysis of palmitic acid (FFA-16),
oleic acid (C18:1), linoleic acid (C18:2), stearic acid (C:18:0),
Sum FFA (C16:0, C18:0, C18:1 and C18:2), cholesterol and
cholesterol ester. FFA-18:1 Cholesterol FFA-16 and C:18:2 FFA-C18:0
Sum FFA Cholesterol ester Enzyme Day ppm ppm ppm ppm ppm Ppm
Control 1 119 154 54 327 551 0 Lecitase 1 133 316 60 508 546 0 KLM3
1 125 177 51 353 216 286 Control 2 111 152 54 317 520 0 Lecitase 2
130 314 62 507 547 0 KLM3 2 130 195 63 388 238 335
The results in table 44 are evaluated statistically by ANOVA using
Statgraphic Plus for Windows 3.1. The statistical evaluation for
cholesterol, cholesterol ester and Sum free fatty acid (FFA) are
illustrated in FIGS. 125 to 127.
The GLC analysis confirms what already was observed by TLC
analysis, that KLM3 significantly reduces the amount of cholesterol
(see FIG. 126) compared with control and Lecitase treated cream.
The cholesterol in the KLM3 treated cream is converted to
cholesterol ester (see FIG. 121), whereas cream treated with
Lecitase and control contain no cholesterol ester. The formation of
cholesterol ester also has an impact on the level of free fatty
acid (see FIG. 127) where Lecitase produces a significant amount of
free fatty acids by hydrolysis of phospholipids, and KLM3 only
produces a small and not significant amount of free fatty acids. It
is also observed that it is mainly the unsaturated fatty acid which
increases during enzymation, because Lecitase is a sn-2 specific
phospholipase and KLM3 is sn-2 specific with regard to transferase
reaction. In naturally occurring phospholipids the sn-2 position
contains mainly unsaturated fatty acids.
Cheese Lipids Analysis
Samples of cheese produced from enzyme modified cream were
extracted with chloroform ethanol according to the procedure
mentioned above and analyzed by HPTLC and GLC.
Each sample was analyzed in duplicate.
The results from the HPTLC analysis are shown in FIGS. 128 and
129.
The TLC chromatogram shown in FIG. 129 indicates that both Lecitase
and KLM3 has completely hydrolyzed the phospholipids
phosphatidylcholine and phosphatidylethanolamine. The chromatogram
in FIG. 128 illustrates that cheese treated with KLM3 has a reduced
content of cholesterol compared with control and Lecitase treated
cheese. It is also observed the amount of free fatty acids in
cheese treated with KLM3 is lower than cheese treated with Lecitase
although both enzymes completely hydrolysis phospholipids PC and
PE.
GLC Analysis of Lipids from Mozzarella Cheese.
The lipids extracted from cheese were also analyzed by GLC in order
to quantify specific fatty acids, cholesterol and cholesterol
ester. Each cheese was extracted and analyzed in duplicate.
The results from the GLC analysis is shown in Table 45. The fatty
acid analysis is split up in the amount of palmetic acid (C16:0),
oleic acid (C18:1) and linoleic acid (C18.2) and stearic acid
(C:18:0).
TABLE-US-00059 TABLE 45 GLC analysis of lipids from Mozzarella
cheese. FFA-18:1 and Cholesterol Enzyme Day FFA-16 18:2 FFA-18:0
Sum FFA Cholesterol ester Control 1 291 291 158 740 689 0 Control 1
304 275 156 735 758 0 Lecitase 1 345 566 195 1105 688 0 Lecitase 1
336 546 180 1062 690 0 KLM3 1 374 453 202 1030 296 440 KLM3 1 399
481 228 1109 304 492 Control 2 285 259 160 703 726 0 Control 2 302
261 167 730 702 0 Lecitase 2 354 584 202 1140 728 0 Lecitase 2 357
591 202 1150 744 0 KLM3 2 377 458 221 1056 302 419 KLM3 2 388 485
227 1099 315 487
The results in table 45 showing the GLC analysis of lipids in
Mozzarella cheese were evaluated statistically by ANOVA using
Statgraphic Plus for Windows 3.1. The statistical evaluation for
cholesterol, cholesterol ester, Oleic acid+linoleic acid and Sum
FFA are illustrated in FIGS. 130 to 133.
GLC analysis of lipids in Mozzarella has confirmed the effect of
KLM3 on cholesterol (see FIG. 130) and the formation of cholesterol
ester (see FIG. 131). Cheese produced with KLM3 contains only 40%
cholesterol compared with the control cheese. Lecitase did not show
any affect on the cholesterol level and no cholesterol ester was
formed in control and Lecitase treated cheese.
Because of the transfer reaction it is also seen that the amount of
free fatty acids in the cheeses produced with KLM3 is lower than in
cheese produced with Lecitase. This is clearly seen for the
unsaturated fatty acids oleic acid and linoleic acids (see FIG.
132), which are lower in the trials with KLM3 compared with
Lecitase. However the differences are less pronounced for Palmetic
acid and Stearic acid (see Table 45). It is known that pancreas
phospholipase--Lecitase is very specific for the sn-2 position of
the phospholipids and thus primary produces unsaturated fatty
acids. Some unspecific hydrolytic activity of KLM3 is known, which
can explain the formation of saturated fatty acids from sn-1
position of phospholipids in milk fat.
In this experiment it is seen that almost all phospholipids are
degraded after 30 minutes enzymation of the cream. However the
enzyme reaction continues during the standardization of the cheese
milk until the cheese milk was pasteurized. The ongoing enzyme
reaction after enzymation of cream, until the cheese milk is
pasteurized explains the formation saturated fatty acids C16:0 and
C18:0 in the experiment with KLM3. This is also confirmed by the
fact that no saturated fatty acids are formed in cream after 30
minutes enzymation with KLM3, but is only seen in the cheese. The
formation of saturated fatty acids in the experiment with KLM3 can
be reduced or prevented by reducing the incubation time of the
cream.
Conclusion
Enzymation of cream for use in Mozzarella cheese production has
shown that KLM3 and Lecitase were very active on phospholipids in
milk fat. An almost complete conversion of the phospholipids
phosphatidylcholine and phosphatidylethanolamine were observed.
The activity of Lecitase on phospholipids contributed to an
increase in free fatty acids. The fatty acids produced were mainly
the unsaturated fatty acids oleic acid and linoleic acid, because
Lecitase is sn-2 specific and the unsaturated fatty acids are most
abundant in the sn-2 position of the phospholipids.
KLM3 however produced less free fatty acids because this enzyme
transfers fatty acids from phospholipids to cholesterol during
formation of cholesterol ester.
Lipid analysis of lipid extracted from the final product Mozzarella
cheese showed almost the same lipid profiles as observed for the
cream used to produce the Mozzarella cheese.
Example 28
Moisture Analysis
Cheese from six experiments with the use of enzyme in pilot scale
Mozzarella cheese production (see Example 25) were analyzed for
moisture content by standard method IDF 4A, 1982 and the fat
content was determined by the standard method IDF 5B, 1986 from
International Dairy Federation.
Results:
TABLE-US-00060 TABLE 46 Analysis of moisture and fat content.
Cheese % Moisture % Fat DAN011 Control 48.75 23.26 DAN012 Lecitase
50.95 23.02 DAN013 KLM3 52.03 22.70 DAN021 Control 48.67 24.69
DAN022 Lecitase 49.60 24.25 DAN023 KLM3 51.66 23.67
The moisture content of the cheese was influenced by the enzyme
treatment; the KLM3 acyl transferase significantly increased the
moisture content of the cheese, both when compared to the lecitase
as well as the control. This partly explains the increased yield
obtained by the enzyme treatment. The percentage of fat in the
cheese thus decreases slightly due to the total increase in
yield.
Example 29
Oiling Off Analysis
Cheese from experiments with the use of enzyme in pilot scale
Mozzarella cheese production (see Example 25) were analyzed for
oiling off by a diffusion test. After production the cheeses
matured for 8 days at 6.degree. C.
Oiling Off Diameter Test:
Cheese samples (2 g) were ground up and pressed into a 2 cm wide
ring using a weight of 16 g dropped from a 5 cm height, applied
three times in order to make a compact mass. This is a key point
for measuring the oiling off, unless the amount of force used to
create the sample is known (along with the resistance of the
material being compacted) it will be unclear as to the density of
the final mass which has a direct effect on oiling off during
heating (see FIG. 134).
The samples were placed on Whatman number 4 filter papers and
heated together in a drying oven at 90.0.degree. C. for 5
minutes.
Measurements of oiling off as determined by the diameter of
translucent zones seen on the filter papers were measured after 10
minutes.
Results:
TABLE-US-00061 TABLE 47 oiling off % of Av. Area/ control Cheese
Mean SD mm2 area DAN011 32.33 1.25 821.09 DAN013 25.00 2.16 490.87
59.78
DAN011 (left) and the cheese produced with KLM3 DAN013 (right). 5
minutes standing after heating step.
Conclusions:
As can be seen from the results, after 10 minutes the day the KLM3
cheese did indeed register significantly less oiling off than the
control.
Example 30
Melting Test
Cheese from experiments with the use of enzyme in pilot scale
Mozzarella cheese production (see Example 25) were analyzed for
melting ability by the tube method described by Olsen (Olsen, N F.
& W V. Price, Journal of Dairy Science 1958, Vol. 41:
999-1000). The cheese flow is measured as percentage change from
the starting point before heating the tube (Olsen 1958).
Results:
TABLE-US-00062 TABLE 48 cheese flow results. Cheese flow Cheese (%)
DAN011 Control 211 DAN012 Lecitase 217 DAN013 KLM3 221 DAN021
Control 168 DAN022 Lecitase 200 DAN023 KLM3 200
No statistically significant difference was observed in the melting
test for the cheese, thus neither Lecitase nor the acyl transferase
KLM3 changed the melting properties of the cheese.
Melting properties was also determined by baking a pizza, to
determine visual changes of the mozzarella cheese as compared to
the control without enzyme. The cheese showed less oiling off on
the pizza and normal melting properties.
Example 31
Expression of a Lipid Acyltransferase in Bacillus licheniformis
A nucleotide sequence (SEQ ID No. 100) encoding a lipid
acyltransferase (SEQ. ID No. 90, hereinafter KLM3) was expressed in
Bacillus licheniformis as a fusion protein with the signal peptide
of B. licheniformis [alpha]-amylase (LAT) (see FIGS. 137 and 138).
For optimal expression in Bacillus, a codon optimized gene
construct (no. 052907) was ordered at Geneart (Geneart AG,
Regensburg, Germany).
Construct no. 052907 contains an incomplete LAT promoter (only the
-10 sequence) in front of the LAT-KLM3' precursor gene and the LAT
transcription (Tlat) downstream of the LAT-KLM3' precursor gene
(see FIGS. 137 and 139). To create a XhoI fragment that contains
the LAT-KLM3' precursor gene flanked by the complete LAT promoter
at the 5' end and the LAT terminator at the 3' end, a PCR
(polymerase chain reaction) amplification was performed with the
primers Plat5XhoI_FW and EBS2XhoI_RV and gene construct 052907 as
template.
TABLE-US-00063 Plat5XhoI_FW: (SEQ ID NO: 59)
ccccgctcgaggcttttcttttggaagaaaatatagggaaaatggtactt
gttaaaaattcggaatatttatacaatatcatatgtttcacattgaaagg gg EBS2XhoI_RV:
(SEQ ID NO: 60) tggaatctcgaggttttatcctttaccttgtctcc
PCR was performed on a thermocycler with Phusion High Fidelity DNA
polymerase (Finnzymes OY, Espoo, Finland) according to the
instructions of the manufacturer (annealing temperature of 55
[deg.] C.).
The resulting PCR fragment was digested with restriction enzyme
XhoI and ligated with T4 DNA ligase into XhoI digested pICatH
according to the instructions of the supplier (Invitrogen,
Carlsbad, Calif. USA).
The ligation mixture was transformed into B. subtilis strain SC6.1
as described in U.S. Patent Application US20020182734
(International Publication WO 02/14490). The sequence of the XhoI
insert containing the LAT-KLM3' precursor gene was confirmed by DNA
sequencing (BaseClear, Leiden, The Netherlands) and one of the
correct plasmid clones was designated pICatH-KLM3'(ori1) (FIG.
137). plCatH-KLM3'(ori1) was transformed into B. licheniformis
strain BML780 (a derivative of BRA7 and BML612, see WO2005111203)
at the permissive temperature (37 [deg.] C.).
One neomycin resistant (neoR) and chloramphenicol resistant (CmR)
transformant was selected and designated
BML780(plCatH-KLM3'(ori1)). The plasmid in
BML780(plCatH-KLM3'(ori1)) was integrated into the catH region on
the B. licheniformis genome by growing the strain at a
non-permissive temperature (50 [deg.] C) in medium with 5 [mu]g/ml
chloramphenicol. One CmR resistant clone was selected and
designated BML780-plCatH-KLM3'(ori1). BML780-plCatH-KLM3'(ori1) was
grown again at the permissive temperature for several generations
without antibiotics to loop-out vector sequences and then one
neomycin sensitive (neoS), CmR clone was selected. In this clone,
vector sequences of plCatH on the chromosome are excised (including
the neomycin resistance gene) and only the catH-LATKLM3' cassette
is left. Next, the catH-LATKLM3' cassette on the chromosome was
amplified by growing the strain in/on media with increasing
concentrations of chloramphenicol. After various rounds of
amplification, one clone (resistant against 50 [mu]g/ml
chloramphenicol) was selected and designated BML780-KLM3'CAP50. To
verify KLM3'expression, BML780-KLM3'CAP50 and BML780 (the empty
host strain) were grown for 48 h at 37 [deg.] C on a Heart Infusion
(Bacto) agar plate with 1% tributyrin. A clearing zone, indicative
for lipid acyltransferase activity, was clearly visible around the
colony of BML780-KLM3'CAP50 but not around the host strain BML780
(see FIG. 140). This result shows that a substantial amount of
KLM3' is expressed in B. licheniformis strain BML780-KLM3'CAP50 and
that these KLM3' molecules are functional.
All publications mentioned in the above specification are herein
incorporated by reference. Various modifications and variations of
the described methods and system of the present invention will be
apparent to those skilled in the art without departing from the
scope and spirit of the present invention. Although the present
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention which are obvious to those skilled in biochemistry and
biotechnology or related fields are intended to be within the scope
of the following claims.
The invention will now be further described by the following
numbered paragraphs:
1. A method for the in situ production of an emulsifier in a
foodstuff, wherein the method comprises the step of adding a lipid
acyltransferase to the foodstuff.
2. A method according to paragraph 1 wherein at least 2 emulsifiers
are produced.
3. A method according to paragraph 1 or paragraph 2 wherein the
emulsifier is produced without increasing or substantially
increasing the free fatty acids in the foodstuff.
4. A method according to any one of paragraphs 1-3 wherein the
lipid acyltransferase is one which is capable of transferring an
acyl group from a lipid to one or more of the following acyl
acceptors: a sterol, a stanol, a carbohydrate, a protein or a
sub-unit thereof, glycerol.
5. A method according to paragraph 2 wherein at least one of the
emulsifiers is a carbohydrate ester.
6. A method according to paragraph 2 wherein at least one of the
emulsifiers is a protein ester.
7. A method according to any one of the preceding paragraphs
wherein one or more of a sterol ester or a stanol ester or a
protein ester or a carbohydrate ester or a diglyceride or a
monoglyceride is produced in situ in the foodstuff.
8. A method according to paragraph 7 wherein the sterol ester is
one or more of alpha-sitosterol ester, beta-sitosterol ester,
stigmasterol ester, ergosterol ester, campesterol ester or
cholesterol ester.
9. A method according to paragraph 6 wherein the stanol ester is
one or more beta-sitostanol or ss-sitostanol.
10. A method according to any one of the preceding paragraphs
wherein the lipid acyltransferase is characterised as an enzyme
which possesses acyl transferase activity and which comprises the
amino acid sequence motif GDSX, wherein X is one or more of the
following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or
S.
11. A method according to any one of the preceding paragraphs
wherein the lipid acyltransferase enzyme comprises H-309 or
comprises a histidine residue at a position corresponding to
His-309 in the amino acid sequence of the Aeromonas hydrophila
lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No. 32.
12. A method according to any one of the preceding paragraphs
wherein the lipid acyltransferase is obtainable from an organism
from one or more of the following genera: Aeromonas, Streptomyces,
Saccharomyces, Lactococcus, Mycobacterium, Streptococcus,
Lactobacillus, Desulfitobacterium, Bacillus, Campylobacter,
Vibrionaceae, Xylella, Sulfolobus, Aspergillus,
Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia,
Xanthomonas and Candida.
13. A method according to any one of the preceding paragraphs
wherein the lipid acyltransferase comprises one or more of the
following amino acid sequences: (i) the amino acid sequence shown
as SEQ ID No. 2; (ii) the amino acid sequence shown as SEQ ID No.
3; (iii) the amino acid sequence shown as SEQ ID No. 4; (iv) the
amino acid sequence shown as SEQ ID No. 5; (v) the amino acid
sequence shown as SEQ ID No. 6; (vi) the amino acid sequence shown
as SEQ ID No. 12, (vii) the amino acid sequence shown as SEQ ID No.
20, (viii) the amino acid sequence shown as SEQ ID No. 22, (ix) the
amino acid sequence shown as SEQ ID No. 24, (x) the amino acid
sequence shown as SEQ ID No. 26, (xi) the amino acid sequence shown
as SEQ ID No. 28, (xii) the amino acid sequence shown as SEQ ID No.
30, (xiii) the amino acid sequence shown as SEQ ID No. 32, (xiv)
the amino acid sequence shown as SEQ ID No. 34, (xv) the amino acid
sequence shown as SEQ ID No. 62, (xvi) the amino acid sequence
shown as SEQ ID No. 90, or an amino acid sequence which has 75% or
more identity with any one of the sequences shown as SEQ ID No. 2,
SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No.
12, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ
ID No. 28, SEQ ID No. 30, SEQ ID No. 32 or SEQ ID No. 34, SEQ ID
No. 62 or SEQ ID No. 90.
14. A method according to any one of the preceding paragraphs,
wherein the emulsifier is one or more of the following: a
monoglyceride, a lysophosphatidylcholine, DGMG.
15. Use of a lipid acyltransferase to prepare from a food material
a foodstuff comprising an emulsifier, wherein the emulsifier is
produced without increasing or without substantially increasing the
free fatty acids in the foodstuff, and wherein the emulsifier is
generated from constituents of the food material by the lipid
acyltransferase.
16. Use according to paragraph 15 wherein at least two emulsifiers
are produced.
17. Use according to paragraph 16 wherein at least one of the
emulsifiers is a carbohydrate ester.
18. Use according to paragraph 16 wherein at least one of the
emulsifiers is a protein ester.
19. Use according to any one of paragraphs 15-18 wherein one or
more of a sterol ester or a stanol ester or a protein ester or a
carbohydrate ester or a diglyceride or a monoglyceride is also
produced in situ in the foodstuff.
20. Use according to paragraph 19 wherein the sterol ester is one
or more of alpha-sitosterol ester, beta-sitosterol ester,
stigmasterol ester, ergosterol ester, campesterol ester or
cholesterol ester.
21. Use according to paragraph 20 wherein the stanol ester is one
or more beta-sitostanol or ss-sitostanol.
22. Use according to any one of paragraphs 15 to 21 wherein the
lipid acyltransferase is characterised as an enzyme which possesses
acyl transferase activity and which comprises the amino acid
sequence motif GDSX, wherein X is one or more of the following
amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.
23. Use according to any one of paragraphs 15-22 wherein the lipid
acyltransferase enzyme comprises H-309 or comprises a histidine
residue at a position corresponding to His-309 in the amino acid
sequence of the Aeromonas hydrophila lipolytic enzyme shown as SEQ
ID No. 2 or SEQ ID No. 32.
24. Use according to any one of paragraphs 15-23 wherein the lipid
acyltransferase is obtainable from an organism from one or more of
the following genera: Aeromonas, Streptomyces, Saccharomyces,
Lactococcus, Mycobacterium, Streptococcus, Lactobacillus,
Desulfitobacterium, Bacillus, Campylobacter, Vibrionaceae, Xylella,
Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria,
Mesorhizobium, Ralstonia, Xanthomonas and Candida.
25. Use according to any one of paragraphs 15-24 wherein the lipid
acyltransferase comprises one or more of the following amino acid
sequences: (i) the amino acid sequence shown as SEQ ID No. 2; (ii)
the amino acid sequence shown as SEQ ID No. 3; (iii) the amino acid
sequence shown as SEQ ID No. 4; (iv) the amino acid sequence shown
as SEQ ID No. 5; (v) the amino acid sequence shown as SEQ ID No. 6;
(vi) the amino acid sequence shown as SEQ ID No. 12, (vii) the
amino acid sequence shown as SEQ ID No. 20, (viii) the amino acid
sequence shown as SEQ ID No. 22, (ix) the amino acid sequence shown
as SEQ ID No. 24, (x) the amino acid sequence shown as SEQ ID No.
26, (xi) the amino acid sequence shown as SEQ ID No. 28, (xii) the
amino acid sequence shown as SEQ ID No. 30, (xiii) the amino acid
sequence shown as SEQ ID No. 32, (xiv) the amino acid sequence
shown as SEQ ID No. 34, (xv) the amino acid sequence shown as SEQ
ID No. 62, (xvi) the amino acid sequence shown as SEQ ID No. 90, or
an amino acid sequence which has 75% or more identity with any one
of the sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4,
SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID
No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30,
SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
26. Use according to any one of paragraphs 15-25, wherein the
emulsifier is one or more of the following: a monoglyceride, a
lysophosphatidylcholine, DGMG.
27. A food or feed enzyme composition which contains a lipid
acyltransferase.
28. A food or feed enzyme composition according to paragraph 27
wherein the lipid acyltransferase is characterised as an enzyme
which possesses acyl transferase activity and which comprises the
amino acid sequence motif GDSX, wherein X is one or more of the
following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or
S.
29. A food or feed enzyme composition according to paragraph 27 or
paragraph 28 wherein the lipid acyltransferase enzyme comprises
H-309 or comprises a histidine residue at a position corresponding
to His-309 in the amino acid sequence of the Aeromonas hydrophila
lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No. 32.
30. A food or feed enzyme composition according to any one of
paragraphs 27-29 wherein the lipid acyltransferase is obtainable
from an organism from one or more of the following genera:
Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium,
Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus,
Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus,
Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia,
Xanthomonas and Candida.
31. A food or feed enzyme composition according to any one of
paragraphs 27-30 wherein the lipid acyltransferase comprises one or
more of the following amino acid sequences: (i) the amino acid
sequence shown as SEQ ID No. 2; (ii) the amino acid sequence shown
as SEQ ID No. 3; (iii) the amino acid sequence shown as SEQ ID No.
4; (iv) the amino acid sequence shown as SEQ ID No. 5; (v) the
amino acid sequence shown as SEQ ID No. 6; (vi) the amino acid
sequence shown as SEQ ID No. 12, (vii) the amino acid sequence
shown as SEQ ID No. 20, (viii) the amino acid sequence shown as SEQ
ID No. 22, (ix) the amino acid sequence shown as SEQ ID No. 24, (x)
the amino acid sequence shown as SEQ ID No. 26, (xi) the amino acid
sequence shown as SEQ ID No. 28, (xii) the amino acid sequence
shown as SEQ ID No. 30, (xiii) the amino acid sequence shown as SEQ
ID No. 32, (xiv) the amino acid sequence shown as SEQ ID No. 34,
(xv) the amino acid sequence shown as SEQ ID No. 62, (xvi) the
amino acid sequence shown as SEQ ID No. 90, or an amino acid
sequence which has 75% or more identity with any one of the
sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID
No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22,
SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID
No. 32 or SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
32. Use of a food or feed enzyme composition according to any one
of paragraphs 27-31 in accordance with any one of paragraphs 15-26
or in the method according to any one of paragraphs 1-14.
33. A foodstuff obtainable by the method according to any one of
paragraphs 1-14.
34. An immobilised lipid acyltransferase enzyme.
35. An immobilised lipid acyltransferase according to paragraph 34
wherein the lipid acyltransferase is characterised as an enzyme
which possesses acyl transferase activity and which comprises the
amino acid sequence motif GDSX, wherein X is one or more of the
following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or
S.
36. An immobilised lipid acyltransferase according to paragraph 34
or paragraph 35 wherein the lipid acyltransferase enzyme comprises
H-309 or comprises a histidine residue at a position corresponding
to His-309 in the amino acid sequence of the Aeromonas hydrophila
lipolytic enzyme shown as SEQ ID No. 2 or SEQ ID No. 32.
37. An immobilised lipid acyltransferase according to any one of
paragraphs 34-36 wherein the lipid acyltransferase is obtainable
from an organism from one or more of the following genera:
Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium,
Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus,
Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus,
Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia,
Xanthomonas and Candida.
38. An immobilised lipid acyltransferase according to any one of
paragraphs 34-37 wherein the lipid acyltransferase comprises one or
more of the following amino acid sequences: (i) the amino acid
sequence shown as SEQ ID No. 2; (ii) the amino acid sequence shown
as SEQ ID No. 3; (iii) the amino acid sequence shown as SEQ ID No.
4; (iv) the amino acid sequence shown as SEQ ID No. 5; (v) the
amino acid sequence shown as SEQ ID No. 6; (vi) the amino acid
sequence shown as SEQ ID No. 12, (vii) the amino acid sequence
shown as SEQ ID No. 20, (viii) the amino acid sequence shown as SEQ
ID No. 22, (ix) the amino acid sequence shown as SEQ ID No. 24, (x)
the amino acid sequence shown as SEQ ID No. 26, (xi) the amino acid
sequence shown as SEQ ID No. 28, (xii) the amino acid sequence
shown as SEQ ID No. 30, (xiii) the amino acid sequence shown as SEQ
ID No. 32, (xiv) the amino acid sequence shown as SEQ ID No. 34,
(xv) the amino acid sequence shown as SEQ ID No. 62, (xvi) the
amino acid sequence shown as SEQ ID No. 90, or an amino acid
sequence which has 75% or more identity with any one of the
sequences shown as SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID
No. 5, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 20, SEQ ID No. 22,
SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID
No. 32 or SEQ ID No. 34, SEQ ID No. 62 or SEQ ID No. 90.
39. A method of identifying a suitable lipid acyltransferase for
use in accordance with the present invention, comprising the steps
of testing an enzyme of interest using one or more of the
"Transferase Assay in a Low Water environment", the "Transferase
Assay in High Water Egg Yolk" or the "Transferase Assay in Buffered
Substrate", and selecting a lipid acyltransferase if it is one
which has one or more of the following characteristics: (a) when
tested using the "Transferase Assay in a Low Water Environment",
measured after a time period selected from 30, 20 or 120 minutes,
has a relative transferase activity of at least 1%; (b) when tested
using the "Transferase Assay in High Water Egg Yolk" in an egg yolk
with 54% water, has up to 100% relative transferase activity; or
(c) when tested using the "Transferase Assay in Buffered Substrate"
has at least 2% acyltransferase activity.
40. A method according to paragraph 39 wherein the lipid
acyltransferase is selected if it is one which has more than two of
the following characteristics (a) when tested using the
"Transferase Assay in a Low Water Environment", measured after a
time period selected from 30, 20 or 120 minutes, has a relative
transferase activity of at least 1%; (b) when tested using the
"Transferase Assay in High Water Egg Yolk" in an egg yolk with 54%
water, has up to 100% relative transferase activity; or (c) when
tested using the "Transferase Assay in Buffered Substrate" has at
least 2% acyltransferase activity.
41. A method according to paragraph 39 wherein the lipid
acyltransferase is selected if it is one which has more than three
of the following characteristics (a) when tested using the
"Transferase Assay in a Low Water Environment", measured after a
time period selected from 30, 20 or 120 minutes, has a relative
transferase activity of at least 1%; (b) when tested using the
"Transferase Assay in High Water Egg Yolk" in an egg yolk with 54%
water, has up to 100% relative transferase activity; or (c) when
tested using the "Transferase Assay in Buffered Substrate" has at
least 2% acyltransferase activity.
42. A method according to paragraph 39 wherein the lipid
acyltransferase is selected if it is one which has all of the
following characteristics (a) when tested using the "Transferase
Assay in a Low Water Environment", measured after a time period
selected from 30, 20 or 120 minutes, has a relative transferase
activity of at least 1%; (b) when tested using the "Transferase
Assay in High Water Egg Yolk" in an egg yolk with 54% water, has up
to 100% relative transferase activity; or (c) when tested using the
"Transferase Assay in Buffered Substrate" has at least 2%
acyltransferase activity.
43. A lipid acyltransferase identified using a method according to
any one of paragraphs 39-42.
SEQUENCE LISTINGS
1
1111361PRTArtificial SequenceDescription of Artificial Sequence
Synthetic pfam00657 consensus sequence 1Ile Val Ala Phe Gly Asp Ser
Leu Thr Asp Gly Glu Ala Tyr Tyr Gly 1 5 10 15Asp Ser Asp Gly Gly
Gly Trp Gly Ala Gly Leu Ala Asp Arg Leu Thr 20 25 30Ala Leu Leu Arg
Leu Arg Ala Arg Pro Arg Gly Val Asp Val Phe Asn 35 40 45Arg Gly Ile
Ser Gly Arg Thr Ser Asp Gly Arg Leu Ile Val Asp Ala 50 55 60Leu Val
Ala Leu Leu Phe Leu Ala Gln Ser Leu Gly Leu Pro Asn Leu 65 70 75
80Pro Pro Tyr Leu Ser Gly Asp Phe Leu Arg Gly Ala Asn Phe Ala Ser
85 90 95Ala Gly Ala Thr Ile Leu Pro Thr Ser Gly Pro Phe Leu Ile Gln
Val 100 105 110Gln Phe Lys Asp Phe Lys Ser Gln Val Leu Glu Leu Arg
Gln Ala Leu 115 120 125Gly Leu Leu Gln Glu Leu Leu Arg Leu Leu Pro
Val Leu Asp Ala Lys 130 135 140Ser Pro Asp Leu Val Thr Ile Met Ile
Gly Thr Asn Asp Leu Ile Thr145 150 155 160Ser Ala Phe Phe Gly Pro
Lys Ser Thr Glu Ser Asp Arg Asn Val Ser 165 170 175Val Pro Glu Phe
Lys Asp Asn Leu Arg Gln Leu Ile Lys Arg Leu Arg 180 185 190Ser Asn
Asn Gly Ala Arg Ile Ile Val Leu Ile Thr Leu Val Ile Leu 195 200
205Asn Leu Gly Pro Leu Gly Cys Leu Pro Leu Lys Leu Ala Leu Ala Leu
210 215 220Ala Ser Ser Lys Asn Val Asp Ala Ser Gly Cys Leu Glu Arg
Leu Asn225 230 235 240Glu Ala Val Ala Asp Phe Asn Glu Ala Leu Arg
Glu Leu Ala Ile Ser 245 250 255Lys Leu Glu Asp Gln Leu Arg Lys Asp
Gly Leu Pro Asp Val Lys Gly 260 265 270Ala Asp Val Pro Tyr Val Asp
Leu Tyr Ser Ile Phe Gln Asp Leu Asp 275 280 285Gly Ile Gln Asn Pro
Ser Ala Tyr Val Tyr Gly Phe Glu Thr Thr Lys 290 295 300Ala Cys Cys
Gly Tyr Gly Gly Arg Tyr Asn Tyr Asn Arg Val Cys Gly305 310 315
320Asn Ala Gly Leu Cys Asn Val Thr Ala Lys Ala Cys Asn Pro Ser Ser
325 330 335Tyr Leu Leu Ser Phe Leu Phe Trp Asp Gly Phe His Pro Ser
Glu Lys 340 345 350Gly Tyr Lys Ala Val Ala Glu Ala Leu 355
3602335PRTAeromonas hydrophila 2Met Lys Lys Trp Phe Val Cys Leu Leu
Gly Leu Val Ala Leu Thr Val 1 5 10 15Gln Ala Ala Asp Ser Arg Pro
Ala Phe Ser Arg Ile Val Met Phe Gly 20 25 30Asp Ser Leu Ser Asp Thr
Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45Leu Pro Ser Ser Pro
Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro 50 55 60Val Trp Leu Glu
Gln Leu Thr Asn Glu Phe Pro Gly Leu Thr Ile Ala 65 70 75 80Asn Glu
Ala Glu Gly Gly Pro Thr Ala Val Ala Tyr Asn Lys Ile Ser 85 90 95Trp
Asn Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu Val Thr 100 105
110Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val Ile Leu
115 120 125Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr
Glu Gln 130 135 140Asp Ala Lys Arg Val Arg Asp Ala Ile Ser Asp Ala
Ala Asn Arg Met145 150 155 160Val Leu Asn Gly Ala Lys Glu Ile Leu
Leu Phe Asn Leu Pro Asp Leu 165 170 175Gly Gln Asn Pro Ser Ala Arg
Ser Gln Lys Val Val Glu Ala Ala Ser 180 185 190His Val Ser Ala Tyr
His Asn Gln Leu Leu Leu Asn Leu Ala Arg Gln 195 200 205Leu Ala Pro
Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe 210 215 220Ala
Glu Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Gln Arg225 230
235 240Asn Ala Cys Tyr Gly Gly Ser Tyr Val Trp Lys Pro Phe Ala Ser
Arg 245 250 255Ser Ala Ser Thr Asp Ser Gln Leu Ser Ala Phe Asn Pro
Gln Glu Arg 260 265 270Leu Ala Ile Ala Gly Asn Pro Leu Leu Ala Gln
Ala Val Ala Ser Pro 275 280 285Met Ala Ala Arg Ser Ala Ser Thr Leu
Asn Cys Glu Gly Lys Met Phe 290 295 300Trp Asp Gln Val His Pro Thr
Thr Val Val His Ala Ala Leu Ser Glu305 310 315 320Pro Ala Ala Thr
Phe Ile Glu Ser Gln Tyr Glu Phe Leu Ala His 325 330
3353336PRTAeromonas salmonicida 3Met Lys Lys Trp Phe Val Cys Leu
Leu Gly Leu Ile Ala Leu Thr Val 1 5 10 15Gln Ala Ala Asp Thr Arg
Pro Ala Phe Ser Arg Ile Val Met Phe Gly 20 25 30Asp Ser Leu Ser Asp
Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45Leu Pro Ser Ser
Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro 50 55 60Val Trp Leu
Glu Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr Ile Ala 65 70 75 80Asn
Glu Ala Glu Gly Gly Ala Thr Ala Val Ala Tyr Asn Lys Ile Ser 85 90
95Trp Asn Pro Lys Tyr Gln Val Tyr Asn Asn Leu Asp Tyr Glu Val Thr
100 105 110Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val
Ile Leu 115 120 125Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp
Asn Thr Glu Gln 130 135 140Asp Ala Lys Arg Val Arg Asp Ala Ile Ser
Asp Ala Ala Asn Arg Met145 150 155 160Val Leu Asn Gly Ala Lys Gln
Ile Leu Leu Phe Asn Leu Pro Asp Leu 165 170 175Gly Gln Asn Pro Ser
Ala Arg Ser Gln Lys Val Val Glu Ala Val Ser 180 185 190His Val Ser
Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gln 195 200 205Leu
Ala Pro Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe 210 215
220Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Val
Glu225 230 235 240Asn Pro Cys Tyr Asp Gly Gly Tyr Val Trp Lys Pro
Phe Ala Thr Arg 245 250 255Ser Val Ser Thr Asp Arg Gln Leu Ser Ala
Phe Ser Pro Gln Glu Arg 260 265 270Leu Ala Ile Ala Gly Asn Pro Leu
Leu Ala Gln Ala Val Ala Ser Pro 275 280 285Met Ala Arg Arg Ser Ala
Ser Pro Leu Asn Cys Glu Gly Lys Met Phe 290 295 300Trp Asp Gln Val
His Pro Thr Thr Val Val His Ala Ala Leu Ser Glu305 310 315 320Arg
Ala Ala Thr Phe Ile Glu Thr Gln Tyr Glu Phe Leu Ala His Gly 325 330
3354295PRTStreptomyces coelicolor 4Met Pro Lys Pro Ala Leu Arg Arg
Val Met Thr Ala Thr Val Ala Ala 1 5 10 15Val Gly Thr Leu Ala Leu
Gly Leu Thr Asp Ala Thr Ala His Ala Ala 20 25 30Pro Ala Gln Ala Thr
Pro Thr Leu Asp Tyr Val Ala Leu Gly Asp Ser 35 40 45Tyr Ser Ala Gly
Ser Gly Val Leu Pro Val Asp Pro Ala Asn Leu Leu 50 55 60Cys Leu Arg
Ser Thr Ala Asn Tyr Pro His Val Ile Ala Asp Thr Thr 65 70 75 80Gly
Ala Arg Leu Thr Asp Val Thr Cys Gly Ala Ala Gln Thr Ala Asp 85 90
95Phe Thr Arg Ala Gln Tyr Pro Gly Val Ala Pro Gln Leu Asp Ala Leu
100 105 110Gly Thr Gly Thr Asp Leu Val Thr Leu Thr Ile Gly Gly Asn
Asp Asn 115 120 125Ser Thr Phe Ile Asn Ala Ile Thr Ala Cys Gly Thr
Ala Gly Val Leu 130 135 140Ser Gly Gly Lys Gly Ser Pro Cys Lys Asp
Arg His Gly Thr Ser Phe145 150 155 160Asp Asp Glu Ile Glu Ala Asn
Thr Tyr Pro Ala Leu Lys Glu Ala Leu 165 170 175Leu Gly Val Arg Ala
Arg Ala Pro His Ala Arg Val Ala Ala Leu Gly 180 185 190Tyr Pro Trp
Ile Thr Pro Ala Thr Ala Asp Pro Ser Cys Phe Leu Lys 195 200 205Leu
Pro Leu Ala Ala Gly Asp Val Pro Tyr Leu Arg Ala Ile Gln Ala 210 215
220His Leu Asn Asp Ala Val Arg Arg Ala Ala Glu Glu Thr Gly Ala
Thr225 230 235 240Tyr Val Asp Phe Ser Gly Val Ser Asp Gly His Asp
Ala Cys Glu Ala 245 250 255Pro Gly Thr Arg Trp Ile Glu Pro Leu Leu
Phe Gly His Ser Leu Val 260 265 270Pro Val His Pro Asn Ala Leu Gly
Glu Arg Arg Met Ala Glu His Thr 275 280 285Met Asp Val Leu Gly Leu
Asp 290 2955295PRTStreptomyces coelicolor 5Met Pro Lys Pro Ala Leu
Arg Arg Val Met Thr Ala Thr Val Ala Ala 1 5 10 15Val Gly Thr Leu
Ala Leu Gly Leu Thr Asp Ala Thr Ala His Ala Ala 20 25 30Pro Ala Gln
Ala Thr Pro Thr Leu Asp Tyr Val Ala Leu Gly Asp Ser 35 40 45Tyr Ser
Ala Gly Ser Gly Val Leu Pro Val Asp Pro Ala Asn Leu Leu 50 55 60Cys
Leu Arg Ser Thr Ala Asn Tyr Pro His Val Ile Ala Asp Thr Thr 65 70
75 80Gly Ala Arg Leu Thr Asp Val Thr Cys Gly Ala Ala Gln Thr Ala
Asp 85 90 95Phe Thr Arg Ala Gln Tyr Pro Gly Val Ala Pro Gln Leu Asp
Ala Leu 100 105 110Gly Thr Gly Thr Asp Leu Val Thr Leu Thr Ile Gly
Gly Asn Asp Asn 115 120 125Ser Thr Phe Ile Asn Ala Ile Thr Ala Cys
Gly Thr Ala Gly Val Leu 130 135 140Ser Gly Gly Lys Gly Ser Pro Cys
Lys Asp Arg His Gly Thr Ser Phe145 150 155 160Asp Asp Glu Ile Glu
Ala Asn Thr Tyr Pro Ala Leu Lys Glu Ala Leu 165 170 175Leu Gly Val
Arg Ala Arg Ala Pro His Ala Arg Val Ala Ala Leu Gly 180 185 190Tyr
Pro Trp Ile Thr Pro Ala Thr Ala Asp Pro Ser Cys Phe Leu Lys 195 200
205Leu Pro Leu Ala Ala Gly Asp Val Pro Tyr Leu Arg Ala Ile Gln Ala
210 215 220His Leu Asn Asp Ala Val Arg Arg Ala Ala Glu Glu Thr Gly
Ala Thr225 230 235 240Tyr Val Asp Phe Ser Gly Val Ser Asp Gly His
Asp Ala Cys Glu Ala 245 250 255Pro Gly Thr Arg Trp Ile Glu Pro Leu
Leu Phe Gly His Ser Leu Val 260 265 270Pro Val His Pro Asn Ala Leu
Gly Glu Arg Arg Met Ala Glu His Thr 275 280 285Met Asp Val Leu Gly
Leu Asp 290 2956238PRTSaccharomyces cerevisiae 6Met Asp Tyr Glu Lys
Phe Leu Leu Phe Gly Asp Ser Ile Thr Glu Phe 1 5 10 15Ala Phe Asn
Thr Arg Pro Ile Glu Asp Gly Lys Asp Gln Tyr Ala Leu 20 25 30Gly Ala
Ala Leu Val Asn Glu Tyr Thr Arg Lys Met Asp Ile Leu Gln 35 40 45Arg
Gly Phe Lys Gly Tyr Thr Ser Arg Trp Ala Leu Lys Ile Leu Pro 50 55
60Glu Ile Leu Lys His Glu Ser Asn Ile Val Met Ala Thr Ile Phe Leu
65 70 75 80Gly Ala Asn Asp Ala Cys Ser Ala Gly Pro Gln Ser Val Pro
Leu Pro 85 90 95Glu Phe Ile Asp Asn Ile Arg Gln Met Val Ser Leu Met
Lys Ser Tyr 100 105 110His Ile Arg Pro Ile Ile Ile Gly Pro Gly Leu
Val Asp Arg Glu Lys 115 120 125Trp Glu Lys Glu Lys Ser Glu Glu Ile
Ala Leu Gly Tyr Phe Arg Thr 130 135 140Asn Glu Asn Phe Ala Ile Tyr
Ser Asp Ala Leu Ala Lys Leu Ala Asn145 150 155 160Glu Glu Lys Val
Pro Phe Val Ala Leu Asn Lys Ala Phe Gln Gln Glu 165 170 175Gly Gly
Asp Ala Trp Gln Gln Leu Leu Thr Asp Gly Leu His Phe Ser 180 185
190Gly Lys Gly Tyr Lys Ile Phe His Asp Glu Leu Leu Lys Val Ile Glu
195 200 205Thr Phe Tyr Pro Gln Tyr His Pro Lys Asn Met Gln Tyr Lys
Leu Lys 210 215 220Asp Trp Arg Asp Val Leu Asp Asp Gly Ser Asn Ile
Met Ser225 230 23571005DNAAeromonas hydrophila 7atgaaaaaat
ggtttgtgtg tttattggga ttggtcgcgc tgacagttca ggcagccgac 60agccgtcccg
ccttctcccg gatcgtgatg tttggcgaca gcctctccga taccggcaag
120atgtacagca agatgcgcgg ttacctcccc tccagccccc cctactatga
gggccgcttc 180tccaacgggc ccgtctggct ggagcagctg accaacgagt
tcccgggcct gaccatagcc 240aacgaggcgg aaggcggacc gaccgccgtg
gcttacaaca agatctcctg gaatcccaag 300tatcaggtca tcaacaacct
ggactacgag gtcacccagt tcctgcaaaa agacagcttc 360aagccggacg
atctggtgat cctctgggtc ggcgccaacg actatctggc ctatggctgg
420aacacagagc aggatgccaa gcgggtgcgc gacgccatca gcgatgcggc
caaccgcatg 480gtgctgaacg gcgccaagga gatactgctg ttcaacctgc
cggatctggg ccagaacccc 540tcggcccgca gccagaaggt ggtcgaggcg
gccagccatg tctccgccta ccacaaccag 600ctgctgctga acctggcacg
ccagctggct cccaccggca tggtgaagct gttcgagatc 660gacaagcagt
ttgccgagat gctgcgtgat ccgcagaact tcggcctgag cgaccagagg
720aacgcctgct acggtggcag ctatgtatgg aagccgtttg cctcccgcag
cgccagcacc 780gacagccagc tctccgcctt caacccgcag gagcgcctcg
ccatcgccgg caacccgctg 840ctggcccagg ccgtcgccag ccccatggct
gcccgcagcg ccagcaccct caactgtgag 900ggcaagatgt tctgggatca
ggtccacccc accactgtcg tgcacgccgc cctgagcgag 960cccgccgcca
ccttcatcga gagccagtac gagttcctcg cccac 100581011DNAAeromonas
salmonicida 8atgaaaaaat ggtttgtttg tttattgggg ttgatcgcgc tgacagttca
ggcagccgac 60actcgccccg ccttctcccg gatcgtgatg ttcggcgaca gcctctccga
taccggcaaa 120atgtacagca agatgcgcgg ttacctcccc tccagcccgc
cctactatga gggccgtttc 180tccaacggac ccgtctggct ggagcagctg
accaagcagt tcccgggtct gaccatcgcc 240aacgaagcgg aaggcggtgc
cactgccgtg gcttacaaca agatctcctg gaatcccaag 300tatcaggtct
acaacaacct ggactacgag gtcacccagt tcttgcagaa agacagcttc
360aagccggacg atctggtgat cctctgggtc ggtgccaatg actatctggc
atatggctgg 420aatacggagc aggatgccaa gcgagttcgc gatgccatca
gcgatgcggc caaccgcatg 480gtactgaacg gtgccaagca gatactgctg
ttcaacctgc cggatctggg ccagaacccg 540tcagcccgca gtcagaaggt
ggtcgaggcg gtcagccatg tctccgccta tcacaacaag 600ctgctgctga
acctggcacg ccagctggcc cccaccggca tggtaaagct gttcgagatc
660gacaagcaat ttgccgagat gctgcgtgat ccgcagaact tcggcctgag
cgacgtcgag 720aacccctgct acgacggcgg ctatgtgtgg aagccgtttg
ccacccgcag cgtcagcacc 780gaccgccagc tctccgcctt cagtccgcag
gaacgcctcg ccatcgccgg caacccgctg 840ctggcacagg ccgttgccag
tcctatggcc cgccgcagcg ccagccccct caactgtgag 900ggcaagatgt
tctgggatca ggtacacccg accactgtcg tgcacgcagc cctgagcgag
960cgcgccgcca ccttcatcga gacccagtac gagttcctcg cccacggatg a
10119888DNAStreptomyces coelicolor 9atgccgaagc ctgcccttcg
ccgtgtcatg accgcgacag tcgccgccgt cggcacgctc 60gccctcggcc tcaccgacgc
caccgcccac gccgcgcccg cccaggccac tccgaccctg 120gactacgtcg
ccctcggcga cagctacagc gccggctccg gcgtcctgcc cgtcgacccc
180gccaacctgc tctgtctgcg ctcgacggcc aactaccccc acgtcatcgc
ggacacgacg 240ggcgcccgcc tcacggacgt cacctgcggc gccgcgcaga
ccgccgactt cacgcgggcc 300cagtacccgg gcgtcgcacc ccagttggac
gcgctcggca ccggcacgga cctggtcacg 360ctcaccatcg gcggcaacga
caacagcacc ttcatcaacg ccatcacggc ctgcggcacg 420gcgggtgtcc
tcagcggcgg caagggcagc ccctgcaagg acaggcacgg cacctccttc
480gacgacgaga tcgaggccaa cacgtacccc gcgctcaagg aggcgctgct
cggcgtccgc 540gccagggctc cccacgccag ggtggcggct ctcggctacc
cgtggatcac cccggccacc 600gccgacccgt cctgcttcct gaagctcccc
ctcgccgccg gtgacgtgcc ctacctgcgg 660gccatccagg cacacctcaa
cgacgcggtc cggcgggccg ccgaggagac cggagccacc 720tacgtggact
tctccggggt gtccgacggc cacgacgcct gcgaggcccc cggcacccgc
780tggatcgaac cgctgctctt cgggcacagc ctcgttcccg tccaccccaa
cgccctgggc 840gagcggcgca tggccgagca cacgatggac gtcctcggcc tggactga
88810888DNAStreptomyces coelicolor 10tcagtccagg ccgaggacgt
ccatcgtgtg ctcggccatg cgccgctcgc ccagggcgtt 60ggggtggacg ggaacgaggc
tgtgcccgaa gagcagcggt tcgatccagc gggtgccggg 120ggcctcgcag
gcgtcgtggc cgtcggacac cccggagaag tccacgtagg tggctccggt
180ctcctcggcg gcccgccgga ccgcgtcgtt gaggtgtgcc tggatggccc
gcaggtaggg 240cacgtcaccg gcggcgaggg ggagcttcag gaagcaggac
gggtcggcgg tggccggggt 300gatccacggg tagccgagag ccgccaccct
ggcgtgggga gccctggcgc ggacgccgag 360cagcgcctcc ttgagcgcgg
ggtacgtgtt ggcctcgatc tcgtcgtcga aggaggtgcc 420gtgcctgtcc
ttgcaggggc tgcccttgcc gccgctgagg acacccgccg tgccgcaggc
480cgtgatggcg ttgatgaagg tgctgttgtc gttgccgccg atggtgagcg
tgaccaggtc 540cgtgccggtg ccgagcgcgt ccaactgggg tgcgacgccc
gggtactggg cccgcgtgaa 600gtcggcggtc tgcgcggcgc cgcaggtgac
gtccgtgagg cgggcgcccg tcgtgtccgc 660gatgacgtgg gggtagttgg
ccgtcgagcg cagacagagc aggttggcgg ggtcgacggg 720caggacgccg
gagccggcgc tgtagctgtc gccgagggcg acgtagtcca gggtcggagt
780ggcctgggcg ggcgcggcgt gggcggtggc gtcggtgagg ccgagggcga
gcgtgccgac 840ggcggcgact gtcgcggtca tgacacggcg aagggcaggc ttcggcat
88811717DNASaccharomyces cerevisiae 11atggattacg agaagtttct
gttatttggg gattccatta ctgaatttgc ttttaatact 60aggcccattg aagatggcaa
agatcagtat gctcttggag ccgcattagt caacgaatat 120acgagaaaaa
tggatattct tcaaagaggg ttcaaagggt acacttctag atgggcgttg
180aaaatacttc ctgagatttt aaagcatgaa tccaatattg tcatggccac
aatatttttg 240ggtgccaacg atgcatgctc agcaggtccc caaagtgtcc
ccctccccga atttatcgat 300aatattcgtc aaatggtatc tttgatgaag
tcttaccata tccgtcctat tataatagga 360ccggggctag tagatagaga
gaagtgggaa aaagaaaaat ctgaagaaat agctctcgga 420tacttccgta
ccaacgagaa ctttgccatt tattccgatg ccttagcaaa actagccaat
480gaggaaaaag ttcccttcgt ggctttgaat aaggcgtttc aacaggaagg
tggtgatgct 540tggcaacaac tgctaacaga tggactgcac ttttccggaa
aagggtacaa aatttttcat 600gacgaattat tgaaggtcat tgagacattc
tacccccaat atcatcccaa aaacatgcag 660tacaaactga aagattggag
agatgtgcta gatgatggat ctaacataat gtcttga 71712347PRTRalstonia
solanacearum 12Met Asn Leu Arg Gln Trp Met Gly Ala Ala Thr Ala Ala
Leu Ala Leu 1 5 10 15Gly Leu Ala Ala Cys Gly Gly Gly Gly Thr Asp
Gln Ser Gly Asn Pro 20 25 30Asn Val Ala Lys Val Gln Arg Met Val Val
Phe Gly Asp Ser Leu Ser 35 40 45Asp Ile Gly Thr Tyr Thr Pro Val Ala
Gln Ala Val Gly Gly Gly Lys 50 55 60Phe Thr Thr Asn Pro Gly Pro Ile
Trp Ala Glu Thr Val Ala Ala Gln 65 70 75 80Leu Gly Val Thr Leu Thr
Pro Ala Val Met Gly Tyr Ala Thr Ser Val 85 90 95Gln Asn Cys Pro Lys
Ala Gly Cys Phe Asp Tyr Ala Gln Gly Gly Ser 100 105 110Arg Val Thr
Asp Pro Asn Gly Ile Gly His Asn Gly Gly Ala Gly Ala 115 120 125Leu
Thr Tyr Pro Val Gln Gln Gln Leu Ala Asn Phe Tyr Ala Ala Ser 130 135
140Asn Asn Thr Phe Asn Gly Asn Asn Asp Val Val Phe Val Leu Ala
Gly145 150 155 160Ser Asn Asp Ile Phe Phe Trp Thr Thr Ala Ala Ala
Thr Ser Gly Ser 165 170 175Gly Val Thr Pro Ala Ile Ala Thr Ala Gln
Val Gln Gln Ala Ala Thr 180 185 190Asp Leu Val Gly Tyr Val Lys Asp
Met Ile Ala Lys Gly Ala Thr Gln 195 200 205Val Tyr Val Phe Asn Leu
Pro Asp Ser Ser Leu Thr Pro Asp Gly Val 210 215 220Ala Ser Gly Thr
Thr Gly Gln Ala Leu Leu His Ala Leu Val Gly Thr225 230 235 240Phe
Asn Thr Thr Leu Gln Ser Gly Leu Ala Gly Thr Ser Ala Arg Ile 245 250
255Ile Asp Phe Asn Ala Gln Leu Thr Ala Ala Ile Gln Asn Gly Ala Ser
260 265 270Phe Gly Phe Ala Asn Thr Ser Ala Arg Ala Cys Asp Ala Thr
Lys Ile 275 280 285Asn Ala Leu Val Pro Ser Ala Gly Gly Ser Ser Leu
Phe Cys Ser Ala 290 295 300Asn Thr Leu Val Ala Ser Gly Ala Asp Gln
Ser Tyr Leu Phe Ala Asp305 310 315 320Gly Val His Pro Thr Thr Ala
Gly His Arg Leu Ile Ala Ser Asn Val 325 330 335Leu Ala Arg Leu Leu
Ala Asp Asn Val Ala His 340 345131044DNARalstonia solanacearum
13atgaacctgc gtcaatggat gggcgccgcc acggctgccc ttgccttggg cttggccgcg
60tgcgggggcg gtgggaccga ccagagcggc aatcccaatg tcgccaaggt gcagcgcatg
120gtggtgttcg gcgacagcct gagcgatatc ggcacctaca cccccgtcgc
gcaggcggtg 180ggcggcggca agttcaccac caacccgggc ccgatctggg
ccgagaccgt ggccgcgcaa 240ctgggcgtga cgctcacgcc ggcggtgatg
ggctacgcca cctccgtgca gaattgcccc 300aaggccggct gcttcgacta
tgcgcagggc ggctcgcgcg tgaccgatcc gaacggcatc 360ggccacaacg
gcggcgcggg ggcgctgacc tacccggttc agcagcagct cgccaacttc
420tacgcggcca gcaacaacac attcaacggc aataacgatg tcgtcttcgt
gctggccggc 480agcaacgaca ttttcttctg gaccactgcg gcggccacca
gcggctccgg cgtgacgccc 540gccattgcca cggcccaggt gcagcaggcc
gcgacggacc tggtcggcta tgtcaaggac 600atgatcgcca agggtgcgac
gcaggtctac gtgttcaacc tgcccgacag cagcctgacg 660ccggacggcg
tggcaagcgg cacgaccggc caggcgctgc tgcacgcgct ggtgggcacg
720ttcaacacga cgctgcaaag cgggctggcc ggcacctcgg cgcgcatcat
cgacttcaac 780gcacaactga ccgcggcgat ccagaatggc gcctcgttcg
gcttcgccaa caccagcgcc 840cgggcctgcg acgccaccaa gatcaatgcc
ctggtgccga gcgccggcgg cagctcgctg 900ttctgctcgg ccaacacgct
ggtggcttcc ggtgcggacc agagctacct gttcgccgac 960ggcgtgcacc
cgaccacggc cggccatcgc ctgatcgcca gcaacgtgct ggcgcgcctg
1020ctggcggata acgtcgcgca ctga 1044144PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 14Gly
Ser Asp Leu 1155PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 15Gly Ala Asn Asp Tyr 1
5165PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 16Gly Gly Asn Asp Ala 1 5174PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 17Gly
Asp Ser Tyr 1185PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 18Gly Gly Asn Asp Leu 1
5195PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 19Gly Gly Asn Asp Xaa 1 520261PRTStreptomyces
coelicolor 20Met Ile Gly Ser Tyr Val Ala Val Gly Asp Ser Phe Thr
Glu Gly Val 1 5 10 15Gly Asp Pro Gly Pro Asp Gly Ala Phe Val Gly
Trp Ala Asp Arg Leu 20 25 30Ala Val Leu Leu Ala Asp Arg Arg Pro Glu
Gly Asp Phe Thr Tyr Thr 35 40 45Asn Leu Ala Val Arg Gly Arg Leu Leu
Asp Gln Ile Val Ala Glu Gln 50 55 60Val Pro Arg Val Val Gly Leu Ala
Pro Asp Leu Val Ser Phe Ala Ala 65 70 75 80Gly Gly Asn Asp Ile Ile
Arg Pro Gly Thr Asp Pro Asp Glu Val Ala 85 90 95Glu Arg Phe Glu Leu
Ala Val Ala Ala Leu Thr Ala Ala Ala Gly Thr 100 105 110Val Leu Val
Thr Thr Gly Phe Asp Thr Arg Gly Val Pro Val Leu Lys 115 120 125His
Leu Arg Gly Lys Ile Ala Thr Tyr Asn Gly His Val Arg Ala Ile 130 135
140Ala Asp Arg Tyr Gly Cys Pro Val Leu Asp Leu Trp Ser Leu Arg
Ser145 150 155 160Val Gln Asp Arg Arg Ala Trp Asp Ala Asp Arg Leu
His Leu Ser Pro 165 170 175Glu Gly His Thr Arg Val Ala Leu Arg Ala
Gly Gln Ala Leu Gly Leu 180 185 190Arg Val Pro Ala Asp Pro Asp Gln
Pro Trp Pro Pro Leu Pro Pro Arg 195 200 205Gly Thr Leu Asp Val Arg
Arg Asp Asp Val His Trp Ala Arg Glu Tyr 210 215 220Leu Val Pro Trp
Ile Gly Arg Arg Leu Arg Gly Glu Ser Ser Gly Asp225 230 235 240His
Val Thr Ala Lys Gly Thr Leu Ser Pro Asp Ala Ile Lys Thr Arg 245 250
255Ile Ala Ala Val Ala 26021786DNAStreptomyces coelicolor
21gtgatcgggt cgtacgtggc ggtgggggac agcttcaccg agggcgtcgg cgaccccggc
60cccgacgggg cgttcgtcgg ctgggccgac cggctcgccg tactgctcgc ggaccggcgc
120cccgagggcg acttcacgta cacgaacctc gccgtgcgcg gcaggctcct
cgaccagatc 180gtggcggaac aggtcccgcg ggtcgtcgga ctcgcgcccg
acctcgtctc gttcgcggcg 240ggcggcaacg acatcatccg gcccggcacc
gatcccgacg aggtcgccga gcggttcgag 300ctggcggtgg ccgcgctgac
cgccgcggcc ggaaccgtcc tggtgaccac cgggttcgac 360acccgggggg
tgcccgtcct caagcacctg cgcggcaaga tcgccacgta caacgggcac
420gtccgcgcca tcgccgaccg ctacggctgc ccggtgctcg acctgtggtc
gctgcggagc 480gtccaggacc gcagggcgtg ggacgccgac cggctgcacc
tgtcgccgga ggggcacacc 540cgggtggcgc tgcgcgcggg gcaggccctg
ggcctgcgcg tcccggccga ccctgaccag 600ccctggccgc ccctgccgcc
gcgcggcacg ctcgacgtcc ggcgcgacga cgtgcactgg 660gcgcgcgagt
acctggtgcc gtggatcggg cgccggctgc ggggcgagtc gtcgggcgac
720cacgtgacgg ccaaggggac gctgtcgccg gacgccatca agacgcggat
cgccgcggtg 780gcctga 78622260PRTStreptomyces coelicolor 22Met Gln
Thr Asn Pro Ala Tyr Thr Ser Leu Val Ala Val Gly Asp Ser 1 5 10
15Phe Thr Glu Gly Met Ser Asp Leu Leu Pro Asp Gly Ser Tyr Arg Gly
20 25 30Trp Ala Asp Leu Leu Ala Thr Arg Met Ala Ala Arg Ser Pro Gly
Phe 35 40 45Arg Tyr Ala Asn Leu Ala Val Arg Gly Lys Leu Ile Gly Gln
Ile Val 50 55 60Asp Glu Gln Val Asp Val Ala Ala Ala Met Gly Ala Asp
Val Ile Thr 65 70 75 80Leu Val Gly Gly Leu Asn Asp Thr Leu Arg Pro
Lys Cys Asp Met Ala 85 90 95Arg Val Arg Asp Leu Leu Thr Gln Ala Val
Glu Arg Leu Ala Pro His 100 105 110Cys Glu Gln Leu Val Leu Met Arg
Ser Pro Gly Arg Gln Gly Pro Val 115 120 125Leu Glu Arg Phe Arg Pro
Arg Met Glu Ala Leu Phe Ala Val Ile Asp 130 135 140Asp Leu Ala Gly
Arg His Gly Ala Val Val Val Asp Leu Tyr Gly Ala145 150 155 160Gln
Ser Leu Ala Asp Pro Arg Met Trp Asp Val Asp Arg Leu His Leu 165 170
175Thr Ala Glu Gly His Arg Arg Val Ala Glu Ala Val Trp Gln Ser Leu
180 185 190Gly His Glu Pro Glu Asp Pro Glu Trp His Ala Pro Ile Pro
Ala Thr 195 200 205Pro Pro Pro Gly Trp Val Thr Arg Arg Thr Ala Asp
Val Arg Phe Ala 210 215 220Arg Gln His Leu Leu Pro Trp Ile Gly Arg
Arg Leu Thr Gly Arg Ser225 230 235 240Ser Gly Asp Gly Leu Pro Ala
Lys Arg Pro Asp Leu Leu Pro Tyr Glu 245 250 255Asp Pro Ala Arg
26023783DNAStreptomyces coelicolor 23atgcagacga accccgcgta
caccagtctc gtcgccgtcg gcgactcctt caccgagggc 60atgtcggacc tgctgcccga
cggctcctac cgtggctggg ccgacctcct cgccacccgg 120atggcggccc
gctcccccgg cttccggtac gccaacctgg cggtgcgcgg gaagctgatc
180ggacagatcg tcgacgagca ggtggacgtg gccgccgcca tgggagccga
cgtgatcacg 240ctggtcggcg ggctcaacga cacgctgcgg cccaagtgcg
acatggcccg ggtgcgggac 300ctgctgaccc aggccgtgga acggctcgcc
ccgcactgcg agcagctggt gctgatgcgc 360agtcccggtc gccagggtcc
ggtgctggag cgcttccggc cccgcatgga ggccctgttc 420gccgtgatcg
acgacctggc cgggcggcac ggcgccgtgg tcgtcgacct gtacggggcc
480cagtcgctgg ccgaccctcg gatgtgggac gtggaccggc tgcacctgac
cgccgagggc 540caccgccggg tcgcggaggc ggtgtggcag tcgctcggcc
acgagcccga ggaccccgag 600tggcacgcgc cgatcccggc gacgccgccg
ccggggtggg tgacgcgcag gaccgcggac 660gtccggttcg cccggcagca
cctgctgccc tggataggcc gcaggctgac cgggcgctcg 720tccggggacg
gcctgccggc caagcgcccg gacctgctgc cctacgagga ccccgcacgg 780tga
78324454PRTStreptomyces coelicolor 24Met Thr Arg Gly Arg Asp Gly
Gly Ala Gly Ala Pro Pro Thr Lys His 1 5 10 15Arg Ala Leu Leu Ala
Ala Ile Val Thr Leu Ile Val Ala Ile Ser Ala 20 25 30Ala Ile Tyr Ala
Gly Ala Ser Ala Asp Asp Gly Ser Arg Asp His Ala 35 40 45Leu Gln Ala
Gly Gly Arg Leu Pro Arg Gly Asp Ala Ala Pro Ala Ser 50 55 60Thr Gly
Ala Trp Val Gly Ala Trp Ala Thr Ala Pro Ala Ala Ala Glu 65 70 75
80Pro Gly Thr Glu Thr Thr Gly Leu Ala Gly Arg Ser Val Arg Asn Val
85 90 95Val His Thr Ser Val Gly Gly Thr Gly Ala Arg Ile Thr Leu Ser
Asn 100 105 110Leu Tyr Gly Gln Ser Pro Leu Thr Val Thr His Ala Ser
Ile Ala Leu 115 120 125Ala Ala Gly Pro Asp Thr Ala Ala Ala Ile Ala
Asp Thr Met Arg Arg 130 135 140Leu Thr Phe Gly Gly Ser Ala Arg Val
Ile Ile Pro Ala Gly Gly Gln145 150 155 160Val Met Ser Asp Thr Ala
Arg Leu Ala Ile Pro Tyr Gly Ala Asn Val 165 170 175Leu Val Thr Thr
Tyr Ser Pro Ile Pro Ser Gly Pro Val Thr Tyr His 180 185 190Pro Gln
Ala Arg Gln Thr Ser Tyr Leu Ala Asp Gly Asp Arg Thr Ala 195 200
205Asp Val Thr Ala Val Ala Tyr Thr Thr Pro Thr Pro Tyr Trp Arg Tyr
210 215 220Leu Thr Ala Leu Asp Val Leu Ser His Glu Ala Asp Gly Thr
Val Val225 230 235 240Ala Phe Gly Asp Ser Ile Thr Asp Gly Ala Arg
Ser Gln Ser Asp Ala 245 250 255Asn His Arg Trp Thr Asp Val Leu Ala
Ala Arg Leu His Glu Ala Ala 260 265 270Gly Asp Gly Arg Asp Thr Pro
Arg Tyr Ser Val Val Asn Glu Gly Ile 275 280 285Ser Gly Asn Arg Leu
Leu Thr Ser Arg Pro Gly Arg Pro Ala Asp Asn 290 295 300Pro Ser Gly
Leu Ser Arg Phe Gln Arg Asp Val Leu Glu Arg Thr Asn305 310 315
320Val Lys Ala Val Val Val Val Leu Gly Val Asn Asp Val Leu Asn Ser
325 330 335Pro Glu Leu Ala Asp Arg Asp Ala Ile Leu Thr Gly Leu Arg
Thr Leu 340 345 350Val Asp Arg Ala His Ala Arg Gly Leu Arg Val Val
Gly Ala Thr Ile 355 360 365Thr Pro Phe Gly Gly Tyr Gly Gly Tyr Thr
Glu Ala Arg Glu Thr Met 370 375 380Arg Gln Glu Val Asn Glu Glu Ile
Arg Ser Gly Arg Val Phe Asp Thr385 390 395 400Val Val Asp Phe Asp
Lys Ala Leu Arg Asp Pro Tyr Asp Pro Arg Arg 405 410 415Met Arg Ser
Asp Tyr Asp Ser Gly Asp His Leu His Pro Gly Asp Lys 420 425 430Gly
Tyr Ala Arg Met Gly Ala Val Ile Asp Leu Ala Ala Leu Lys Gly 435 440
445Ala Ala Pro Val Lys Ala 450251365DNAStreptomyces coelicolor
25atgacccggg gtcgtgacgg gggtgcgggg gcgcccccca ccaagcaccg tgccctgctc
60gcggcgatcg tcaccctgat agtggcgatc tccgcggcca tatacgccgg agcgtccgcg
120gacgacggca gcagggacca cgcgctgcag gccggaggcc gtctcccacg
aggagacgcc 180gcccccgcgt ccaccggtgc ctgggtgggc gcctgggcca
ccgcaccggc cgcggccgag 240ccgggcaccg agacgaccgg cctggcgggc
cgctccgtgc gcaacgtcgt gcacacctcg 300gtcggcggca ccggcgcgcg
gatcaccctc tcgaacctgt acgggcagtc gccgctgacc 360gtcacacacg
cctcgatcgc cctggccgcc gggcccgaca ccgccgccgc gatcgccgac
420accatgcgcc ggctcacctt cggcggcagc gcccgggtga tcatcccggc
gggcggccag 480gtgatgagcg acaccgcccg cctcgccatc ccctacgggg
cgaacgtcct ggtcaccacg 540tactccccca tcccgtccgg gccggtgacc
taccatccgc aggcccggca gaccagctac 600ctggccgacg gcgaccgcac
ggcggacgtc accgccgtcg cgtacaccac ccccacgccc 660tactggcgct
acctgaccgc cctcgacgtg ctgagccacg aggccgacgg cacggtcgtg
720gcgttcggcg actccatcac cgacggcgcc cgctcgcaga gcgacgccaa
ccaccgctgg 780accgacgtcc tcgccgcacg cctgcacgag gcggcgggcg
acggccggga cacgccccgc 840tacagcgtcg tcaacgaggg catcagcggc
aaccggctcc tgaccagcag gccggggcgg 900ccggccgaca acccgagcgg
actgagccgg ttccagcggg acgtgctgga acgcaccaac 960gtcaaggccg
tcgtcgtcgt cctcggcgtc aacgacgtcc tgaacagccc ggaactcgcc
1020gaccgcgacg ccatcctgac cggcctgcgc accctcgtcg accgggcgca
cgcccgggga 1080ctgcgggtcg tcggcgccac gatcacgccg ttcggcggct
acggcggcta caccgaggcc 1140cgcgagacga tgcggcagga ggtcaacgag
gagatccgct ccggccgggt cttcgacacg 1200gtcgtcgact tcgacaaggc
cctgcgcgac ccgtacgacc cgcgccggat gcgctccgac 1260tacgacagcg
gcgaccacct gcaccccggc gacaaggggt acgcgcgcat gggcgcggtc
1320atcgacctgg ccgcgctgaa gggcgcggcg ccggtcaagg cgtag
136526340PRTStreptomyces coelicolor 26Met Thr Ser Met Ser Arg Ala
Arg Val Ala Arg Arg Ile Ala Ala Gly 1 5 10 15Ala Ala Tyr Gly Gly
Gly Gly Ile Gly Leu Ala Gly Ala Ala Ala Val 20 25 30Gly Leu Val Val
Ala Glu Val Gln Leu Ala Arg Arg Arg Val Gly Val 35 40 45Gly Thr Pro
Thr Arg Val Pro Asn Ala Gln Gly Leu Tyr Gly Gly Thr 50 55 60Leu Pro
Thr Ala Gly Asp Pro Pro Leu Arg Leu Met Met Leu Gly Asp 65 70 75
80Ser Thr Ala Ala Gly Gln Gly Val His Arg Ala Gly Gln Thr Pro Gly
85 90 95Ala Leu Leu Ala Ser Gly Leu Ala Ala Val Ala Glu Arg Pro Val
Arg 100 105 110Leu Gly Ser Val Ala Gln Pro Gly Ala Cys Ser Asp Asp
Leu Asp Arg 115 120 125Gln Val Ala Leu Val Leu Ala Glu Pro Asp Arg
Val Pro Asp Ile Cys 130
135 140Val Ile Met Val Gly Ala Asn Asp Val Thr His Arg Met Pro Ala
Thr145 150 155 160Arg Ser Val Arg His Leu Ser Ser Ala Val Arg Arg
Leu Arg Thr Ala 165 170 175Gly Ala Glu Val Val Val Gly Thr Cys Pro
Asp Leu Gly Thr Ile Glu 180 185 190Arg Val Arg Gln Pro Leu Arg Trp
Leu Ala Arg Arg Ala Ser Arg Gln 195 200 205Leu Ala Ala Ala Gln Thr
Ile Gly Ala Val Glu Gln Gly Gly Arg Thr 210 215 220Val Ser Leu Gly
Asp Leu Leu Gly Pro Glu Phe Ala Gln Asn Pro Arg225 230 235 240Glu
Leu Phe Gly Pro Asp Asn Tyr His Pro Ser Ala Glu Gly Tyr Ala 245 250
255Thr Ala Ala Met Ala Val Leu Pro Ser Val Cys Ala Ala Leu Gly Leu
260 265 270Trp Pro Ala Asp Glu Glu His Pro Asp Ala Leu Arg Arg Glu
Gly Phe 275 280 285Leu Pro Val Ala Arg Ala Ala Ala Glu Ala Ala Ser
Glu Ala Gly Thr 290 295 300Glu Val Ala Ala Ala Met Pro Thr Gly Pro
Arg Gly Pro Trp Ala Leu305 310 315 320Leu Lys Arg Arg Arg Arg Arg
Arg Val Ser Glu Ala Glu Pro Ser Ser 325 330 335Pro Ser Gly Val
340271023DNAStreptomyces coelicolor 27atgacgagca tgtcgagggc
gagggtggcg cggcggatcg cggccggcgc ggcgtacggc 60ggcggcggca tcggcctggc
gggagcggcg gcggtcggtc tggtggtggc cgaggtgcag 120ctggccagac
gcagggtggg ggtgggcacg ccgacccggg tgccgaacgc gcagggactg
180tacggcggca ccctgcccac ggccggcgac ccgccgctgc ggctgatgat
gctgggcgac 240tccacggccg ccgggcaggg cgtgcaccgg gccgggcaga
cgccgggcgc gctgctggcg 300tccgggctcg cggcggtggc ggagcggccg
gtgcggctgg ggtcggtcgc ccagccgggg 360gcgtgctcgg acgacctgga
ccggcaggtg gcgctggtgc tcgccgagcc ggaccgggtg 420cccgacatct
gcgtgatcat ggtcggcgcc aacgacgtca cccaccggat gccggcgacc
480cgctcggtgc ggcacctgtc ctcggcggta cggcggctgc gcacggccgg
tgcggaggtg 540gtggtcggca cctgtccgga cctgggcacg atcgagcggg
tgcggcagcc gctgcgctgg 600ctggcccggc gggcctcacg gcagctcgcg
gcggcacaga ccatcggcgc cgtcgagcag 660ggcgggcgca cggtgtcgct
gggcgacctg ctgggtccgg agttcgcgca gaacccgcgg 720gagctcttcg
gccccgacaa ctaccacccc tccgccgagg ggtacgccac ggccgcgatg
780gcggtactgc cctcggtgtg cgccgcgctc ggcctgtggc cggccgacga
ggagcacccg 840gacgcgctgc gccgcgaggg cttcctgccg gtggcgcgcg
cggcggcgga ggcggcgtcc 900gaggcgggta cggaggtcgc cgccgccatg
cctacggggc ctcgggggcc ctgggcgctg 960ctgaagcgcc ggagacggcg
tcgggtgtcg gaggcggaac cgtccagccc gtccggcgtt 1020tga
102328305PRTStreptomyces coelicolor 28Met Gly Arg Gly Thr Asp Gln
Arg Thr Arg Tyr Gly Arg Arg Arg Ala 1 5 10 15Arg Val Ala Leu Ala
Ala Leu Thr Ala Ala Val Leu Gly Val Gly Val 20 25 30Ala Gly Cys Asp
Ser Val Gly Gly Asp Ser Pro Ala Pro Ser Gly Ser 35 40 45Pro Ser Lys
Arg Thr Arg Thr Ala Pro Ala Trp Asp Thr Ser Pro Ala 50 55 60Ser Val
Ala Ala Val Gly Asp Ser Ile Thr Arg Gly Phe Asp Ala Cys 65 70 75
80Ala Val Leu Ser Asp Cys Pro Glu Val Ser Trp Ala Thr Gly Ser Ser
85 90 95Ala Lys Val Asp Ser Leu Ala Val Arg Leu Leu Gly Lys Ala Asp
Ala 100 105 110Ala Glu His Ser Trp Asn Tyr Ala Val Thr Gly Ala Arg
Met Ala Asp 115 120 125Leu Thr Ala Gln Val Thr Arg Ala Ala Gln Arg
Glu Pro Glu Leu Val 130 135 140Ala Val Met Ala Gly Ala Asn Asp Ala
Cys Arg Ser Thr Thr Ser Ala145 150 155 160Met Thr Pro Val Ala Asp
Phe Arg Ala Gln Phe Glu Glu Ala Met Ala 165 170 175Thr Leu Arg Lys
Lys Leu Pro Lys Ala Gln Val Tyr Val Ser Ser Ile 180 185 190Pro Asp
Leu Lys Arg Leu Trp Ser Gln Gly Arg Thr Asn Pro Leu Gly 195 200
205Lys Gln Val Trp Lys Leu Gly Leu Cys Pro Ser Met Leu Gly Asp Ala
210 215 220Asp Ser Leu Asp Ser Ala Ala Thr Leu Arg Arg Asn Thr Val
Arg Asp225 230 235 240Arg Val Ala Asp Tyr Asn Glu Val Leu Arg Glu
Val Cys Ala Lys Asp 245 250 255Arg Arg Cys Arg Ser Asp Asp Gly Ala
Val His Glu Phe Arg Phe Gly 260 265 270Thr Asp Gln Leu Ser His Trp
Asp Trp Phe His Pro Ser Val Asp Gly 275 280 285Gln Ala Arg Leu Ala
Glu Ile Ala Tyr Arg Ala Val Thr Ala Lys Asn 290 295
300Pro30529918DNAStreptomyces coelicolor 29atgggtcgag ggacggacca
gcggacgcgg tacggccgtc gccgggcgcg tgtcgcgctc 60gccgccctga ccgccgccgt
cctgggcgtg ggcgtggcgg gctgcgactc cgtgggcggc 120gactcacccg
ctccttccgg cagcccgtcg aagcggacga ggacggcgcc cgcctgggac
180accagcccgg cgtccgtcgc cgccgtgggc gactccatca cgcgcggctt
cgacgcctgt 240gcggtgctgt cggactgccc ggaggtgtcg tgggcgaccg
gcagcagcgc gaaggtcgac 300tcgctggccg tacggctgct ggggaaggcg
gacgcggccg agcacagctg gaactacgcg 360gtcaccgggg cccggatggc
ggacctgacc gctcaggtga cgcgggcggc gcagcgcgag 420ccggagctgg
tggcggtgat ggccggggcg aacgacgcgt gccggtccac gacctcggcg
480atgacgccgg tggcggactt ccgggcgcag ttcgaggagg cgatggccac
cctgcgcaag 540aagctcccca aggcgcaggt gtacgtgtcg agcatcccgg
acctcaagcg gctctggtcc 600cagggccgca ccaacccgct gggcaagcag
gtgtggaagc tcggcctgtg cccgtcgatg 660ctgggcgacg cggactccct
ggactcggcg gcgaccctgc ggcgcaacac ggtgcgcgac 720cgggtggcgg
actacaacga ggtgctgcgg gaggtctgcg cgaaggaccg gcggtgccgc
780agcgacgacg gcgcggtgca cgagttccgg ttcggcacgg accagttgag
ccactgggac 840tggttccacc cgagtgtgga cggccaggcc cggctggcgg
agatcgccta ccgcgcggtc 900accgcgaaga atccctga
91830268PRTStreptomyces rimosus 30Met Arg Leu Ser Arg Arg Ala Ala
Thr Ala Ser Ala Leu Leu Leu Thr 1 5 10 15Pro Ala Leu Ala Leu Phe
Gly Ala Ser Ala Ala Val Ser Ala Pro Arg 20 25 30Ile Gln Ala Thr Asp
Tyr Val Ala Leu Gly Asp Ser Tyr Ser Ser Gly 35 40 45Val Gly Ala Gly
Ser Tyr Asp Ser Ser Ser Gly Ser Cys Lys Arg Ser 50 55 60Thr Lys Ser
Tyr Pro Ala Leu Trp Ala Ala Ser His Thr Gly Thr Arg 65 70 75 80Phe
Asn Phe Thr Ala Cys Ser Gly Ala Arg Thr Gly Asp Val Leu Ala 85 90
95Lys Gln Leu Thr Pro Val Asn Ser Gly Thr Asp Leu Val Ser Ile Thr
100 105 110Ile Gly Gly Asn Asp Ala Gly Phe Ala Asp Thr Met Thr Thr
Cys Asn 115 120 125Leu Gln Gly Glu Ser Ala Cys Leu Ala Arg Ile Ala
Lys Ala Arg Ala 130 135 140Tyr Ile Gln Gln Thr Leu Pro Ala Gln Leu
Asp Gln Val Tyr Asp Ala145 150 155 160Ile Asp Ser Arg Ala Pro Ala
Ala Gln Val Val Val Leu Gly Tyr Pro 165 170 175Arg Phe Tyr Lys Leu
Gly Gly Ser Cys Ala Val Gly Leu Ser Glu Lys 180 185 190Ser Arg Ala
Ala Ile Asn Ala Ala Ala Asp Asp Ile Asn Ala Val Thr 195 200 205Ala
Lys Arg Ala Ala Asp His Gly Phe Ala Phe Gly Asp Val Asn Thr 210 215
220Thr Phe Ala Gly His Glu Leu Cys Ser Gly Ala Pro Trp Leu His
Ser225 230 235 240Val Thr Leu Pro Val Glu Asn Ser Tyr His Pro Thr
Ala Asn Gly Gln 245 250 255Ser Lys Gly Tyr Leu Pro Val Leu Asn Ser
Ala Thr 260 265311068DNAStreptomyces rimosus 31ttcatcacaa
cgatgtcaca acaccggcca tccgggtcat ccctgatcgt gggaatgggt 60gacaagcctt
cccgtgacga aagggtcctg ctacatcaga aatgacagaa atcctgctca
120gggaggttcc atgagactgt cccgacgcgc ggccacggcg tccgcgctcc
tcctcacccc 180ggcgctcgcg ctcttcggcg cgagcgccgc cgtgtccgcg
ccgcgaatcc aggccaccga 240ctacgtggcc ctcggcgact cctactcctc
gggggtcggc gcgggcagct acgacagcag 300cagtggctcc tgtaagcgca
gcaccaagtc ctacccggcc ctgtgggccg cctcgcacac 360cggtacgcgg
ttcaacttca ccgcctgttc gggcgcccgc acaggagacg tgctggccaa
420gcagctgacc ccggtcaact ccggcaccga cctggtcagc attaccatcg
gcggcaacga 480cgcgggcttc gccgacacca tgaccacctg caacctccag
ggcgagagcg cgtgcctggc 540gcggatcgcc aaggcgcgcg cctacatcca
gcagacgctg cccgcccagc tggaccaggt 600ctacgacgcc atcgacagcc
gggcccccgc agcccaggtc gtcgtcctgg gctacccgcg 660cttctacaag
ctgggcggca gctgcgccgt cggtctctcg gagaagtccc gcgcggccat
720caacgccgcc gccgacgaca tcaacgccgt caccgccaag cgcgccgccg
accacggctt 780cgccttcggg gacgtcaaca cgaccttcgc cgggcacgag
ctgtgctccg gcgccccctg 840gctgcacagc gtcacccttc ccgtggagaa
ctcctaccac cccacggcca acggacagtc 900caagggctac ctgcccgtcc
tgaactccgc cacctgatct cgcggctact ccgcccctga 960cgaagtcccg
cccccgggcg gggcttcgcc gtaggtgcgc gtaccgccgt cgcccgtcgc
1020gccggtggcc ccgccgtacg tgccgccgcc cccggacgcg gtcggttc
106832335PRTAeromonas hydrophila 32Met Lys Lys Trp Phe Val Cys Leu
Leu Gly Leu Val Ala Leu Thr Val 1 5 10 15Gln Ala Ala Asp Ser Arg
Pro Ala Phe Ser Arg Ile Val Met Phe Gly 20 25 30Asp Ser Leu Ser Asp
Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr 35 40 45Leu Pro Ser Ser
Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro 50 55 60Val Trp Leu
Glu Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr Ile Ala 65 70 75 80Asn
Glu Ala Glu Gly Gly Ala Thr Ala Val Ala Tyr Asn Lys Ile Ser 85 90
95Trp Asn Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu Val Thr
100 105 110Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val
Ile Leu 115 120 125Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp
Asn Thr Glu Gln 130 135 140Asp Ala Lys Arg Val Arg Asp Ala Ile Ser
Asp Ala Ala Asn Arg Met145 150 155 160Val Leu Asn Gly Ala Lys Gln
Ile Leu Leu Phe Asn Leu Pro Asp Leu 165 170 175Gly Gln Asn Pro Ser
Ala Arg Ser Gln Lys Val Val Glu Ala Val Ser 180 185 190His Val Ser
Ala Tyr His Asn Gln Leu Leu Leu Asn Leu Ala Arg Gln 195 200 205Leu
Ala Pro Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe 210 215
220Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Val
Glu225 230 235 240Asn Pro Cys Tyr Asp Gly Gly Tyr Val Trp Lys Pro
Phe Ala Thr Arg 245 250 255Ser Val Ser Thr Asp Arg Gln Leu Ser Ala
Phe Ser Pro Gln Glu Arg 260 265 270Leu Ala Ile Ala Gly Asn Pro Leu
Leu Ala Gln Ala Val Ala Ser Pro 275 280 285Met Ala Arg Arg Ser Ala
Ser Pro Leu Asn Cys Glu Gly Lys Met Phe 290 295 300Trp Asp Gln Val
His Pro Thr Thr Val Val His Ala Ala Leu Ser Glu305 310 315 320Arg
Ala Ala Thr Phe Ile Ala Asn Gln Tyr Glu Phe Leu Ala His 325 330
335331008DNAAeromonas hydrophila 33atgaaaaaat ggtttgtgtg tttattggga
ttggtcgcgc tgacagttca ggcagccgac 60agtcgccccg ccttttcccg gatcgtgatg
ttcggcgaca gcctctccga taccggcaaa 120atgtacagca agatgcgcgg
ttacctcccc tccagcccgc cctactatga gggccgtttc 180tccaacggac
ccgtctggct ggagcagctg accaaacagt tcccgggtct gaccatcgcc
240aacgaagcgg aaggcggtgc cactgccgtg gcttacaaca agatctcctg
gaatcccaag 300tatcaggtca tcaacaacct ggactacgag gtcacccagt
tcttgcagaa agacagcttc 360aagccggacg atctggtgat cctctgggtc
ggtgccaatg actatctggc ctatggctgg 420aacacggagc aggatgccaa
gcgggttcgc gatgccatca gcgatgcggc caaccgcatg 480gtactgaacg
gtgccaagca gatactgctg ttcaacctgc cggatctggg ccagaacccg
540tcagctcgca gtcagaaggt ggtcgaggcg gtcagccatg tctccgccta
tcacaaccag 600ctgctgctga acctggcacg ccagctggcc cccaccggca
tggtaaagct gttcgagatc 660gacaagcaat ttgccgagat gctgcgtgat
ccgcagaact tcggcctgag cgacgtcgag 720aacccctgct acgacggcgg
ctatgtgtgg aagccgtttg ccacccgcag cgtcagcacc 780gaccgccagc
tctccgcctt cagtccgcag gaacgcctcg ccatcgccgg caacccgctg
840ctggcacagg ccgttgccag tcctatggcc cgccgcagcg ccagccccct
caactgtgag 900ggcaagatgt tctgggatca ggtacacccg accactgtcg
tgcacgcagc cctgagcgag 960cgcgccgcca ccttcatcgc gaaccagtac
gagttcctcg cccactga 100834336PRTAeromonas salmonicida 34Met Lys Lys
Trp Phe Val Cys Leu Leu Gly Leu Ile Ala Leu Thr Val 1 5 10 15Gln
Ala Ala Asp Thr Arg Pro Ala Phe Ser Arg Ile Val Met Phe Gly 20 25
30Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr
35 40 45Leu Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly
Pro 50 55 60Val Trp Leu Glu Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr
Ile Ala 65 70 75 80Asn Glu Ala Glu Gly Gly Ala Thr Ala Val Ala Tyr
Asn Lys Ile Ser 85 90 95Trp Asn Pro Lys Tyr Gln Val Ile Asn Asn Leu
Asp Tyr Glu Val Thr 100 105 110Gln Phe Leu Gln Lys Asp Ser Phe Lys
Pro Asp Asp Leu Val Ile Leu 115 120 125Trp Val Gly Ala Asn Asp Tyr
Leu Ala Tyr Gly Trp Asn Thr Glu Gln 130 135 140Asp Ala Lys Arg Val
Arg Asp Ala Ile Ser Asp Ala Ala Asn Arg Met145 150 155 160Val Leu
Asn Gly Ala Lys Gln Ile Leu Leu Phe Asn Leu Pro Asp Leu 165 170
175Gly Gln Asn Pro Ser Ala Arg Ser Gln Lys Val Val Glu Ala Val Ser
180 185 190His Val Ser Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala
Arg Gln 195 200 205Leu Ala Pro Thr Gly Met Val Lys Leu Phe Glu Ile
Asp Lys Gln Phe 210 215 220Ala Glu Met Leu Arg Asp Pro Gln Asn Phe
Gly Leu Ser Asp Val Glu225 230 235 240Asn Pro Cys Tyr Asp Gly Gly
Tyr Val Trp Lys Pro Phe Ala Thr Arg 245 250 255Ser Val Ser Thr Asp
Arg Gln Leu Ser Ala Phe Ser Pro Gln Glu Arg 260 265 270Leu Ala Ile
Ala Gly Asn Pro Leu Leu Ala Gln Ala Val Ala Ser Pro 275 280 285Met
Ala Arg Arg Ser Ala Ser Pro Leu Asn Cys Glu Gly Lys Met Phe 290 295
300Trp Asp Gln Val His Pro Thr Thr Val Val His Ala Ala Leu Ser
Glu305 310 315 320Arg Ala Ala Thr Phe Ile Glu Thr Gln Tyr Glu Phe
Leu Ala His Gly 325 330 335351011DNAAeromonas salmonicida
35atgaaaaaat ggtttgtttg tttattgggg ttgatcgcgc tgacagttca ggcagccgac
60actcgccccg ccttctcccg gatcgtgatg ttcggcgaca gcctctccga taccggcaaa
120atgtacagca agatgcgcgg ttacctcccc tccagcccgc cctactatga
gggccgtttc 180tccaacggac ccgtctggct ggagcagctg accaagcagt
tcccgggtct gaccatcgcc 240aacgaagcgg aaggcggtgc cactgccgtg
gcttacaaca agatctcctg gaatcccaag 300tatcaggtca tcaacaacct
ggactacgag gtcacccagt tcttgcagaa agacagcttc 360aagccggacg
atctggtgat cctctgggtc ggtgccaatg actatctggc atatggctgg
420aatacggagc aggatgccaa gcgagttcgc gatgccatca gcgatgcggc
caaccgcatg 480gtactgaacg gtgccaagca gatactgctg ttcaacctgc
cggatctggg ccagaacccg 540tcagcccgca gtcagaaggt ggtcgaggcg
gtcagccatg tctccgccta tcacaacaag 600ctgctgctga acctggcacg
ccagctggcc cccaccggca tggtaaagct gttcgagatc 660gacaagcaat
ttgccgagat gctgcgtgat ccgcagaact tcggcctgag cgacgtcgag
720aacccctgct acgacggcgg ctatgtgtgg aagccgtttg ccacccgcag
cgtcagcacc 780gaccgccagc tctccgcctt cagtccgcag gaacgcctcg
ccatcgccgg caacccgctg 840ctggcacagg ccgttgccag tcctatggcc
cgccgcagcg ccagccccct caactgtgag 900ggcaagatgt tctgggatca
ggtacacccg accactgtcg tgcacgcagc cctgagcgag 960cgcgccgcca
ccttcatcga gacccagtac gagttcctcg cccacggatg a 101136347PRTAeromonas
hydrophila 36Met Phe Lys Phe Lys Lys Asn Phe Leu Val Gly Leu Ser
Ala Ala Leu 1 5 10 15Met Ser Ile Ser Leu Phe Ser Ala Thr Ala Ser
Ala Ala Ser Ala Asp 20 25 30Ser Arg Pro Ala Phe Ser Arg Ile Val Met
Phe Gly Asp Ser Leu Ser 35 40 45Asp Thr Gly Lys Met Tyr Ser Lys Met
Arg Gly Tyr Leu Pro Ser Ser 50 55 60Pro Pro Tyr Tyr Glu Gly Arg Phe
Ser Asn Gly Pro Val Trp Leu Glu 65 70 75 80Gln Leu Thr Lys Gln Phe
Pro Gly Leu Thr Ile Ala Asn Glu Ala Glu 85 90 95Gly Gly Ala Thr Ala
Val Ala Tyr Asn Lys Ile Ser Trp Asn Pro Lys 100 105 110Tyr Gln Val
Ile Asn Asn Leu Asp Tyr Glu Val Thr Gln Phe Leu Gln 115 120 125Lys
Asp Ser Phe Lys Pro Asp Asp Leu Val Ile
Leu Trp Val Gly Ala 130 135 140Asn Asp Tyr Leu Ala Tyr Gly Trp Asn
Thr Glu Gln Asp Ala Lys Arg145 150 155 160Val Arg Asp Ala Ile Ser
Asp Ala Ala Asn Arg Met Val Leu Asn Gly 165 170 175Ala Lys Gln Ile
Leu Leu Phe Asn Leu Pro Asp Leu Gly Gln Asn Pro 180 185 190Ser Ala
Arg Ser Gln Lys Val Val Glu Ala Val Ser His Val Ser Ala 195 200
205Tyr His Asn Gln Leu Leu Leu Asn Leu Ala Arg Gln Leu Ala Pro Thr
210 215 220Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe Ala Glu
Met Leu225 230 235 240Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Val
Glu Asn Pro Cys Tyr 245 250 255Asp Gly Gly Tyr Val Trp Lys Pro Phe
Ala Thr Arg Ser Val Ser Thr 260 265 270Asp Arg Gln Leu Ser Ala Phe
Ser Pro Gln Glu Arg Leu Ala Ile Ala 275 280 285Gly Asn Pro Leu Leu
Ala Gln Ala Val Ala Ser Pro Met Ala Arg Arg 290 295 300Ser Ala Ser
Pro Leu Asn Cys Glu Gly Lys Met Phe Trp Asp Gln Val305 310 315
320His Pro Thr Thr Val Val His Ala Ala Leu Ser Glu Arg Ala Ala Thr
325 330 335Phe Ile Ala Asn Gln Tyr Glu Phe Leu Ala His 340
3453727DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 37gtgatggtgg gcgaggaact cgtactg
273835DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 38agcatatgaa aaaatggttt gtttgtttat tgggg
353939DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39ttggatccga attcatcaat ggtgatggtg atggtgggc
394018DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 40taatacgact cactatag 184118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
41ctagttattg ctcagcgg 184241DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 42gtcatatgaa aaaatggttt
gtgtgtttat tgggattggt c 414330DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 43atggtgatgg tgggcgagga
actcgtactg 304441DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 44gtcatatgaa aaaatggttt gtgtgtttat
tgggattggt c 414539DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 45ttggatccga attcatcaat ggtgatggtg
atggtgggc 394626DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 46atgccatggc cgacagccgt cccgcc
264727DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 47ttggatccga attcatcaat ggtgatg
274826DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48ttgctagcgc cgacagccgt cccgcc 264927DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49ttggatccga attcatcaat ggtgatg 275026DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
50ttgccatggc cgacactcgc cccgcc 265127DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51ttggatccga attcatcaat ggtgatg 275226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52ttgctagcgc cgacactcgc cccgcc 265327DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53ttggatccga attcatcaat ggtgatg 27541047DNAAeromonas hydrophila
54atgtttaagt ttaaaaagaa tttcttagtt ggattatcgg cagctttaat gagtattagc
60ttgttttcgg caaccgcctc tgcagctagc gccgacagcc gtcccgcctt ttcccggatc
120gtgatgttcg gcgacagcct ctccgatacc ggcaaaatgt acagcaagat
gcgcggttac 180ctcccctcca gcccgcccta ctatgagggc cgtttctcca
acggacccgt ctggctggag 240cagctgacca aacagttccc gggtctgacc
atcgccaacg aagcggaagg cggtgccact 300gccgtggctt acaacaagat
ctcctggaat cccaagtatc aggtcatcaa caacctggac 360tacgaggtca
cccagttctt gcagaaagac agcttcaagc cggacgatct ggtgatcctc
420tgggtcggtg ccaatgacta tctggcctat ggctggaaca cggagcagga
tgccaagcgg 480gttcgcgatg ccatcagcga tgcggccaac cgcatggtac
tgaacggtgc caagcagata 540ctgctgttca acctgccgga tctgggccag
aacccgtcag ctcgcagtca gaaggtggtc 600gaggcggtca gccatgtctc
cgcctatcac aaccagctgc tgctgaacct ggcacgccag 660ctggccccca
ccggcatggt aaagctgttc gagatcgaca agcaatttgc cgagatgctg
720cgtgatccgc agaacttcgg cctgagcgac gtcgagaacc cctgctacga
cggcggctat 780gtgtggaagc cgtttgccac ccgcagcgtc agcaccgacc
gccagctctc cgccttcagt 840ccgcaggaac gcctcgccat cgccggcaac
ccgctgctgg cacaggccgt tgccagtcct 900atggcccgcc gcagcgccag
ccccctcaac tgtgagggca agatgttctg ggatcaggta 960cacccgacca
ctgtcgtgca cgcagccctg agcgagcgcg ccgccacctt catcgcgaac
1020cagtacgagt tcctcgccca ctgatga 1047556PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6x His tag
55His His His His His His 1 55635DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 56agcatatgaa aaaatggttt
gtttgtttat tgggg 355718DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 57taatacgact cactatag
185818DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58ctagttattg ctcagcgg 1859102DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59ccccgctcga ggcttttctt ttggaagaaa atatagggaa aatggtactt gttaaaaatt
60cggaatattt atacaatatc atatgtttca cattgaaagg gg
1026035DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 60tggaatctcg aggttttatc ctttaccttg tctcc
3561295PRTAeromonas hydrophila 61Ile Val Met Phe Gly Asp Ser Leu
Ser Asp Thr Gly Lys Met Tyr Ser 1 5 10 15Lys Met Arg Gly Tyr Leu
Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg 20 25 30Phe Ser Asn Gly Pro
Val Trp Leu Glu Gln Leu Thr Asn Glu Phe Pro 35 40 45Gly Leu Thr Ile
Ala Asn Glu Ala Glu Gly Gly Pro Thr Ala Val Ala 50 55 60Tyr Asn Lys
Ile Ser Trp Asn Pro Lys Tyr Gln Val Ile Asn Asn Leu 65 70 75 80Asp
Tyr Glu Val Thr Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp 85 90
95Asp Leu Val Ile Leu Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly
100 105 110Trp Asn Thr Glu Gln Asp Ala Lys Arg Val Arg Asp Ala Ile
Ser Asp 115 120 125Ala Ala Asn Arg Met Val Leu Asn Gly Ala Lys Glu
Ile Leu Leu Phe 130 135 140Asn Leu Pro Asp Leu Gly Gln Asn Pro Ser
Ala Arg Ser Gln Lys Val145 150 155 160Val Glu Ala Ala Ser His Val
Ser Ala Tyr His Asn Gln Leu Leu Leu 165 170 175Asn Leu Ala Arg Gln
Leu Ala Pro Thr Gly Met Val Lys Leu Phe Glu 180 185 190Ile Asp Lys
Gln Phe Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly 195 200 205Leu
Ser Asp Gln Arg Asn Ala Cys Tyr Gly Gly Ser Tyr Val Trp Lys 210 215
220Pro Phe Ala Ser Arg Ser Ala Ser Thr Asp Ser Gln Leu Ser Ala
Phe225 230 235 240Asn Pro Gln Glu Arg Leu Ala Ile Ala Gly Asn Pro
Leu Leu Ala Gln 245 250 255Ala Val Ala Ser Pro Met Ala Ala Arg Ser
Ala Ser Thr Leu Asn Cys 260 265 270Glu Gly Lys Met Phe Trp Asp Gln
Val His Pro Thr Thr Val Val His 275 280 285Ala Ala Leu Ser Glu Pro
Ala 290 29562318PRTAeromonas salmonicida 62Ala Asp Thr Arg Pro Ala
Phe Ser Arg Ile Val Met Phe Gly Asp Ser 1 5 10 15Leu Ser Asp Thr
Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr Leu Pro 20 25 30Ser Ser Pro
Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro Val Trp 35 40 45Leu Glu
Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr Ile Ala Asn Glu 50 55 60Ala
Glu Gly Gly Ala Thr Ala Val Ala Tyr Asn Lys Ile Ser Trp Asp 65 70
75 80Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu Val Thr Gln
Phe 85 90 95Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val Ile Leu
Trp Val 100 105 110Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr
Glu Gln Asp Ala 115 120 125Lys Arg Val Arg Asp Ala Ile Ser Asp Ala
Ala Asn Arg Met Val Leu 130 135 140Asn Gly Ala Lys Gln Ile Leu Leu
Phe Asn Leu Pro Asp Leu Gly Gln145 150 155 160Asn Pro Ser Ala Arg
Ser Gln Lys Val Val Glu Ala Val Ser His Val 165 170 175Ser Ala Tyr
His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gln Leu Ala 180 185 190Pro
Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe Ala Glu 195 200
205Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Val Glu Asn Pro
210 215 220Cys Tyr Asp Gly Gly Tyr Val Trp Lys Pro Phe Ala Thr Arg
Ser Val225 230 235 240Ser Thr Asp Arg Gln Leu Ser Ala Phe Ser Pro
Gln Glu Arg Leu Ala 245 250 255Ile Ala Gly Asn Pro Leu Leu Ala Gln
Ala Val Ala Ser Pro Met Ala 260 265 270Arg Arg Ser Ala Ser Pro Leu
Asn Cys Glu Gly Lys Met Phe Trp Asp 275 280 285Gln Val His Pro Thr
Thr Val Val His Ala Ala Leu Ser Glu Arg Ala 290 295 300Ala Thr Phe
Ile Glu Thr Gln Tyr Glu Phe Leu Ala His Gly305 310
31563465PRTCandida parapsilosis 63Met Arg Tyr Phe Ala Ile Ala Phe
Leu Leu Ile Asn Thr Ile Ser Ala 1 5 10 15Phe Val Leu Ala Pro Lys
Lys Pro Ser Gln Asp Asp Phe Tyr Thr Pro 20 25 30Pro Gln Gly Tyr Glu
Ala Gln Pro Leu Gly Ser Ile Leu Lys Thr Arg 35 40 45Asn Val Pro Asn
Pro Leu Thr Asn Val Phe Thr Pro Val Lys Val Gln 50 55 60Asn Ala Trp
Gln Leu Leu Val Arg Ser Glu Asp Thr Phe Gly Asn Pro 65 70 75 80Asn
Ala Ile Val Thr Thr Ile Ile Gln Pro Phe Asn Ala Lys Lys Asp 85 90
95Lys Leu Val Ser Tyr Gln Thr Phe Glu Asp Ser Gly Lys Leu Asp Cys
100 105 110Ala Pro Ser Tyr Ala Ile Gln Tyr Gly Ser Asp Ile Ser Thr
Leu Thr 115 120 125Thr Gln Gly Glu Met Tyr Tyr Ile Ser Ala Leu Leu
Asp Gln Gly Tyr 130 135 140Tyr Val Val Thr Pro Asp Tyr Glu Gly Pro
Lys Ser Thr Phe Thr Val145 150 155 160Gly Leu Gln Ser Gly Arg Ala
Thr Leu Asn Ser Leu Arg Ala Thr Leu 165 170 175Lys Ser Gly Asn Leu
Thr Gly Val Ser Ser Asp Ala Glu Thr Leu Leu 180 185 190Trp Gly Tyr
Ser Gly Gly Ser Leu Ala Ser Gly Trp Ala Ala Ala Ile 195 200 205Gln
Lys Glu Tyr Ala Pro Glu Leu Ser Lys Asn Leu Leu Gly Ala Ala 210 215
220Leu Gly Gly Phe Val Thr Asn Ile Thr Ala Thr Ala Glu Ala Val
Asp225 230 235 240Ser Gly Pro Phe Ala Gly Ile Ile Ser Asn Ala Leu
Ala Gly Ile Gly 245 250 255Asn Glu Tyr Pro Asp Phe Lys Asn Tyr Leu
Leu Lys Lys Val Ser Pro 260 265 270Leu Leu Ser Ile Thr Tyr Arg Leu
Gly Asn Thr His Cys Leu Leu Asp 275 280 285Gly Gly Ile Ala Tyr Phe
Gly Lys Ser Phe Phe Ser Arg Ile Ile Arg 290 295 300Tyr Phe Pro Asp
Gly Trp Asp Leu Val Asn Gln Glu Pro Ile Lys Thr305 310 315 320Ile
Leu Gln Asp Asn Gly Leu Val Tyr Gln Pro Lys Asp Leu Thr Pro 325 330
335Gln Ile Pro Leu Phe Ile Tyr His Gly Thr Leu Asp Ala Ile Val Pro
340 345 350Ile Val Asn Ser Arg Lys Thr Phe Gln Gln Trp Cys Asp Trp
Gly Leu 355 360 365Lys Ser Gly Glu Tyr Asn Glu Asp Leu Thr Asn Gly
His Ile Thr Glu 370 375 380Ser Ile Val Gly Ala Pro Ala Ala Leu Thr
Trp Ile Ile Asn Arg Phe385 390 395 400Asn Gly Gln Pro Pro Val Asp
Gly Cys Gln His Asn Val Arg Ala Ser 405 410 415Asn Leu Glu Tyr Pro
Gly Thr Pro Gln Ser Ile Lys Asn Tyr Phe Glu 420 425 430Ala Ala Leu
His Ala Ile Leu Gly Phe Asp Leu Gly Pro Asp Val Lys 435 440 445Arg
Asp Lys Val Thr Leu Gly Gly Leu Leu Lys Leu Glu Arg Phe Ala 450 455
460Phe46564471PRTCandida parapsilosis 64Met Arg Tyr Phe Ala Ile Ala
Phe Leu Leu Ile Asn Thr Ile Ser Ala 1 5 10 15Phe Val Leu Ala Pro
Lys Lys Pro Ser Gln Asp Asp Phe Tyr Thr Pro 20 25 30Pro Gln Gly Tyr
Glu Ala Gln Pro Leu Gly Ser Ile Leu Lys Thr Arg 35 40 45Asn Val Pro
Asn Pro Leu Thr Asn Val Phe Thr Pro Val Lys Val Gln 50 55 60Asn Ala
Trp Gln Leu Leu Val Arg Ser Glu Asp Thr Phe Gly Asn Pro 65 70 75
80Asn Ala Ile Val Thr Thr Ile Ile Gln Pro Phe Asn Ala Lys Lys Asp
85 90 95Lys Leu Val Ser Tyr Gln Thr Phe Glu Asp Ser Gly Lys Leu Asp
Cys 100 105 110Ala Pro Ser Tyr Ala Ile Gln Tyr Gly Ser Asp Ile Ser
Thr Leu Thr 115 120 125Thr Gln Gly Glu Met Tyr Tyr Ile Ser Ala Leu
Leu Asp Gln Gly Tyr 130 135 140Tyr Val Val Thr Pro Asp Tyr Glu Gly
Pro Lys Ser Thr Phe Thr Val145 150 155 160Gly Leu Gln Ser Gly Arg
Ala Thr Leu Asn Ser Leu Arg Ala Thr Leu 165 170 175Lys Ser Gly Asn
Leu Thr Gly Val Ser Ser Asp Ala Glu Thr Leu Leu 180 185 190Trp Gly
Tyr Ser Gly Gly Ser Leu Ala Ser Gly Trp Ala Ala Ala Ile 195 200
205Gln Lys Glu Tyr Ala Pro Glu Leu Ser Lys Asn Leu Leu Gly Ala Ala
210 215 220Leu Gly Gly Phe Val Thr Asn Ile Thr Ala Thr Ala Glu Ala
Val Asp225 230 235 240Ser Gly Pro Phe Ala Gly Ile Ile Ser Asn Ala
Leu Ala Gly Ile Gly 245 250 255Asn Glu Tyr Pro Asp Phe Lys Asn Tyr
Leu Leu Lys Lys Val Ser Pro 260 265 270Leu Leu Ser Ile Thr Tyr Arg
Leu Gly Asn Thr His Cys Leu Leu Asp 275 280 285Gly Gly Ile Ala Tyr
Phe Gly Lys Ser Phe Phe Ser Arg Ile Ile Arg 290 295 300Tyr Phe Pro
Asp Gly Trp Asp Leu Val Asn Gln Glu Pro Ile Lys Thr305 310 315
320Ile Leu Gln Asp Asn Gly Leu Val Tyr Gln Pro Lys Asp Leu Thr Pro
325 330 335Gln Ile Pro Leu Phe Ile Tyr His Gly Thr Leu Asp Ala Ile
Val Pro 340 345 350Ile Val Asn Ser Arg Lys Thr Phe Gln Gln Trp Cys
Asp Trp Gly Leu 355 360 365Lys Ser Gly Glu Tyr Asn Glu Asp Leu Thr
Asn Gly His Ile Thr Glu 370 375 380Ser Ile Val Gly Ala Pro Ala Ala
Leu Thr Trp Ile Ile Asn Arg Phe385 390 395 400Asn Gly Gln Pro Pro
Val Asp Gly Cys Gln His Asn Val Arg Ala Ser 405 410 415Asn Leu Glu
Tyr Pro Gly Thr Pro Gln Ser Ile Lys Asn Tyr Phe Glu 420 425 430Ala
Ala Leu His Ala Ile Leu Gly Phe Asp Leu Gly Pro Asp Val Lys 435 440
445Arg Asp Lys Val Thr Leu Gly Gly Leu Leu Lys Leu Glu Arg Phe Ala
450 455 460Phe His His His His His His465 47065261PRTStreptomyces
coelicolor 65Met Ile Gly Ser Tyr Val Ala Val
Gly Asp Ser Phe Thr Glu Gly Val 1 5 10 15Gly Asp Pro Gly Pro Asp
Gly Ala Phe Val Gly Trp Ala Asp Arg Leu 20 25 30Ala Val Leu Leu Ala
Asp Arg Arg Pro Glu Gly Asp Phe Thr Tyr Thr 35 40 45Asn Leu Ala Val
Arg Gly Arg Leu Leu Asp Gln Ile Val Ala Glu Gln 50 55 60Val Pro Arg
Val Val Gly Leu Ala Pro Asp Leu Val Ser Phe Ala Ala 65 70 75 80Gly
Gly Asn Asp Ile Ile Arg Pro Gly Thr Asp Pro Asp Glu Val Ala 85 90
95Glu Arg Phe Glu Leu Ala Val Ala Ala Leu Thr Ala Ala Ala Gly Thr
100 105 110Val Leu Val Thr Thr Gly Phe Asp Thr Arg Gly Val Pro Val
Leu Lys 115 120 125His Leu Arg Gly Lys Ile Ala Thr Tyr Asn Gly His
Val Arg Ala Ile 130 135 140Ala Asp Arg Tyr Gly Cys Pro Val Leu Asp
Leu Trp Ser Leu Arg Ser145 150 155 160Val Gln Asp Arg Arg Ala Trp
Asp Ala Asp Arg Leu His Leu Ser Pro 165 170 175Glu Gly His Thr Arg
Val Ala Leu Arg Ala Gly Gln Ala Leu Gly Leu 180 185 190Arg Val Pro
Ala Asp Pro Asp Gln Pro Trp Pro Pro Leu Pro Pro Arg 195 200 205Gly
Thr Leu Asp Val Arg Arg Asp Asp Val His Trp Ala Arg Glu Tyr 210 215
220Leu Val Pro Trp Ile Gly Arg Arg Leu Arg Gly Glu Ser Ser Gly
Asp225 230 235 240His Val Thr Ala Lys Gly Thr Leu Ser Pro Asp Ala
Ile Lys Thr Arg 245 250 255Ile Ala Ala Val Ala
26066548PRTThermobifida fusca 66Met Leu Pro His Pro Ala Gly Glu Arg
Gly Glu Val Gly Ala Phe Phe 1 5 10 15Ala Leu Leu Val Gly Thr Pro
Gln Asp Arg Arg Leu Arg Leu Glu Cys 20 25 30His Glu Thr Arg Pro Leu
Arg Gly Arg Cys Gly Cys Gly Glu Arg Arg 35 40 45Val Pro Pro Leu Thr
Leu Pro Gly Asp Gly Val Leu Cys Thr Thr Ser 50 55 60Ser Thr Arg Asp
Ala Glu Thr Val Trp Arg Lys His Leu Gln Pro Arg 65 70 75 80Pro Asp
Gly Gly Phe Arg Pro His Leu Gly Val Gly Cys Leu Leu Ala 85 90 95Gly
Gln Gly Ser Pro Gly Val Leu Trp Cys Gly Arg Glu Gly Cys Arg 100 105
110Phe Glu Val Cys Arg Arg Asp Thr Pro Gly Leu Ser Arg Thr Arg Asn
115 120 125Gly Asp Ser Ser Pro Pro Phe Arg Ala Gly Trp Ser Leu Pro
Pro Lys 130 135 140Cys Gly Glu Ile Ser Gln Ser Ala Arg Lys Thr Pro
Ala Val Pro Arg145 150 155 160Tyr Ser Leu Leu Arg Thr Asp Arg Pro
Asp Gly Pro Arg Gly Arg Phe 165 170 175Val Gly Ser Gly Pro Arg Ala
Ala Thr Arg Arg Arg Leu Phe Leu Gly 180 185 190Ile Pro Ala Leu Val
Leu Val Thr Ala Leu Thr Leu Val Leu Ala Val 195 200 205Pro Thr Gly
Arg Glu Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln 210 215 220Asp
Trp Cys Leu Gly Val Pro Val Asp Ser Arg Gly Gln Pro Ala Glu225 230
235 240Asp Gly Glu Phe Leu Leu Leu Ser Pro Val Gln Ala Ala Thr Trp
Gly 245 250 255Asn Tyr Tyr Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asp
Gly Ala Arg 260 265 270Asp Tyr Tyr Pro Gly Thr Ala Val Lys Gly Gly
Cys Trp Arg Ser Ala 275 280 285Asn Ala Tyr Pro Glu Leu Val Ala Glu
Ala Tyr Asp Phe Ala Gly His 290 295 300Leu Ser Phe Leu Ala Cys Ser
Gly Gln Arg Gly Tyr Ala Met Leu Asp305 310 315 320Ala Ile Asp Glu
Val Gly Ser Gln Leu Asp Trp Asn Ser Pro His Thr 325 330 335Ser Leu
Val Thr Ile Gly Ile Gly Gly Asn Asp Leu Gly Phe Ser Thr 340 345
350Val Leu Lys Thr Cys Met Val Arg Val Pro Leu Leu Asp Ser Lys Ala
355 360 365Cys Thr Asp Gln Glu Asp Ala Ile Arg Lys Arg Met Ala Lys
Phe Glu 370 375 380Thr Thr Phe Glu Glu Leu Ile Ser Glu Val Arg Thr
Arg Ala Pro Asp385 390 395 400Ala Arg Ile Leu Val Val Gly Tyr Pro
Arg Ile Phe Pro Glu Glu Pro 405 410 415Thr Gly Ala Tyr Tyr Thr Leu
Thr Ala Ser Asn Gln Arg Trp Leu Asn 420 425 430Glu Thr Ile Gln Glu
Phe Asn Gln Gln Leu Ala Glu Ala Val Ala Val 435 440 445His Asp Glu
Glu Ile Ala Ala Ser Gly Gly Val Gly Ser Val Glu Phe 450 455 460Val
Asp Val Tyr His Ala Leu Asp Gly His Glu Ile Gly Ser Asp Glu465 470
475 480Pro Trp Val Asn Gly Val Gln Leu Arg Asp Leu Ala Thr Gly Val
Thr 485 490 495Val Asp Arg Ser Thr Phe His Pro Asn Ala Ala Gly His
Arg Ala Val 500 505 510Gly Glu Arg Val Ile Glu Gln Ile Glu Thr Gly
Pro Gly Arg Pro Leu 515 520 525Tyr Ala Thr Phe Ala Val Val Ala Gly
Ala Thr Val Asp Thr Leu Ala 530 535 540Gly Glu Val
Gly54567372PRTThermobifida fusca 67Met Gly Ser Gly Pro Arg Ala Ala
Thr Arg Arg Arg Leu Phe Leu Gly 1 5 10 15Ile Pro Ala Leu Val Leu
Val Thr Ala Leu Thr Leu Val Leu Ala Val 20 25 30Pro Thr Gly Arg Glu
Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln 35 40 45Asp Trp Cys Leu
Gly Val Pro Val Asp Ser Arg Gly Gln Pro Ala Glu 50 55 60Asp Gly Glu
Phe Leu Leu Leu Ser Pro Val Gln Ala Ala Thr Trp Gly 65 70 75 80Asn
Tyr Tyr Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asp Gly Ala Arg 85 90
95Asp Tyr Tyr Pro Gly Thr Ala Val Lys Gly Gly Cys Trp Arg Ser Ala
100 105 110Asn Ala Tyr Pro Glu Leu Val Ala Glu Ala Tyr Asp Phe Ala
Gly His 115 120 125Leu Ser Phe Leu Ala Cys Ser Gly Gln Arg Gly Tyr
Ala Met Leu Asp 130 135 140Ala Ile Asp Glu Val Gly Ser Gln Leu Asp
Trp Asn Ser Pro His Thr145 150 155 160Ser Leu Val Thr Ile Gly Ile
Gly Gly Asn Asp Leu Gly Phe Ser Thr 165 170 175Val Leu Lys Thr Cys
Met Val Arg Val Pro Leu Leu Asp Ser Lys Ala 180 185 190Cys Thr Asp
Gln Glu Asp Ala Ile Arg Lys Arg Met Ala Lys Phe Glu 195 200 205Thr
Thr Phe Glu Glu Leu Ile Ser Glu Val Arg Thr Arg Ala Pro Asp 210 215
220Ala Arg Ile Leu Val Val Gly Tyr Pro Arg Ile Phe Pro Glu Glu
Pro225 230 235 240Thr Gly Ala Tyr Tyr Thr Leu Thr Ala Ser Asn Gln
Arg Trp Leu Asn 245 250 255Glu Thr Ile Gln Glu Phe Asn Gln Gln Leu
Ala Glu Ala Val Ala Val 260 265 270His Asp Glu Glu Ile Ala Ala Ser
Gly Gly Val Gly Ser Val Glu Phe 275 280 285Val Asp Val Tyr His Ala
Leu Asp Gly His Glu Ile Gly Ser Asp Glu 290 295 300Pro Trp Val Asn
Gly Val Gln Leu Arg Asp Leu Ala Thr Gly Val Thr305 310 315 320Val
Asp Arg Ser Thr Phe His Pro Asn Ala Ala Gly His Arg Ala Val 325 330
335Gly Glu Arg Val Ile Glu Gln Ile Glu Thr Gly Pro Gly Arg Pro Leu
340 345 350Tyr Ala Thr Phe Ala Val Val Ala Gly Ala Thr Val Asp Thr
Leu Ala 355 360 365Gly Glu Val Gly 37068300PRTCorynebacterium
efficiens 68Met Arg Thr Thr Val Ile Ala Ala Ser Ala Leu Leu Leu Leu
Ala Gly 1 5 10 15Cys Ala Asp Gly Ala Arg Glu Glu Thr Ala Gly Ala
Pro Pro Gly Glu 20 25 30Ser Ser Gly Gly Ile Arg Glu Glu Gly Ala Glu
Ala Ser Thr Ser Ile 35 40 45Thr Asp Val Tyr Ile Ala Leu Gly Asp Ser
Tyr Ala Ala Met Gly Gly 50 55 60Arg Asp Gln Pro Leu Arg Gly Glu Pro
Phe Cys Leu Arg Ser Ser Gly 65 70 75 80Asn Tyr Pro Glu Leu Leu His
Ala Glu Val Thr Asp Leu Thr Cys Gln 85 90 95Gly Ala Val Thr Gly Asp
Leu Leu Glu Pro Arg Thr Leu Gly Glu Arg 100 105 110Thr Leu Pro Ala
Gln Val Asp Ala Leu Thr Glu Asp Thr Thr Leu Val 115 120 125Thr Leu
Ser Ile Gly Gly Asn Asp Leu Gly Phe Gly Glu Val Ala Gly 130 135
140Cys Ile Arg Glu Arg Ile Ala Gly Glu Asn Ala Asp Asp Cys Val
Asp145 150 155 160Leu Leu Gly Glu Thr Ile Gly Glu Gln Leu Asp Gln
Leu Pro Pro Gln 165 170 175Leu Asp Arg Val His Glu Ala Ile Arg Asp
Arg Ala Gly Asp Ala Gln 180 185 190Val Val Val Thr Gly Tyr Leu Pro
Leu Val Ser Ala Gly Asp Cys Pro 195 200 205Glu Leu Gly Asp Val Ser
Glu Ala Asp Arg Arg Trp Ala Val Glu Leu 210 215 220Thr Gly Gln Ile
Asn Glu Thr Val Arg Glu Ala Ala Glu Arg His Asp225 230 235 240Ala
Leu Phe Val Leu Pro Asp Asp Ala Asp Glu His Thr Ser Cys Ala 245 250
255Pro Pro Gln Gln Arg Trp Ala Asp Ile Gln Gly Gln Gln Thr Asp Ala
260 265 270Tyr Pro Leu His Pro Thr Ser Ala Gly His Glu Ala Met Ala
Ala Ala 275 280 285Val Arg Asp Ala Leu Gly Leu Glu Pro Val Gln Pro
290 295 30069284PRTNovosphingobium aromaticivorans 69Met Gly Gln
Val Lys Leu Phe Ala Arg Arg Cys Ala Pro Val Leu Leu 1 5 10 15Ala
Leu Ala Gly Leu Ala Pro Ala Ala Thr Val Ala Arg Glu Ala Pro 20 25
30Leu Ala Glu Gly Ala Arg Tyr Val Ala Leu Gly Ser Ser Phe Ala Ala
35 40 45Gly Pro Gly Val Gly Pro Asn Ala Pro Gly Ser Pro Glu Arg Cys
Gly 50 55 60Arg Gly Thr Leu Asn Tyr Pro His Leu Leu Ala Glu Ala Leu
Lys Leu 65 70 75 80Asp Leu Val Asp Ala Thr Cys Ser Gly Ala Thr Thr
His His Val Leu 85 90 95Gly Pro Trp Asn Glu Val Pro Pro Gln Ile Asp
Ser Val Asn Gly Asp 100 105 110Thr Arg Leu Val Thr Leu Thr Ile Gly
Gly Asn Asp Val Ser Phe Val 115 120 125Gly Asn Ile Phe Ala Ala Ala
Cys Glu Lys Met Ala Ser Pro Asp Pro 130 135 140Arg Cys Gly Lys Trp
Arg Glu Ile Thr Glu Glu Glu Trp Gln Ala Asp145 150 155 160Glu Glu
Arg Met Arg Ser Ile Val Arg Gln Ile His Ala Arg Ala Pro 165 170
175Leu Ala Arg Val Val Val Val Asp Tyr Ile Thr Val Leu Pro Pro Ser
180 185 190Gly Thr Cys Ala Ala Met Ala Ile Ser Pro Asp Arg Leu Ala
Gln Ser 195 200 205Arg Ser Ala Ala Lys Arg Leu Ala Arg Ile Thr Ala
Arg Val Ala Arg 210 215 220Glu Glu Gly Ala Ser Leu Leu Lys Phe Ser
His Ile Ser Arg Arg His225 230 235 240His Pro Cys Ser Ala Lys Pro
Trp Ser Asn Gly Leu Ser Ala Pro Ala 245 250 255Asp Asp Gly Ile Pro
Val His Pro Asn Arg Leu Gly His Ala Glu Ala 260 265 270Ala Ala Ala
Leu Val Lys Leu Val Lys Leu Met Lys 275 28070268PRTStreptomyces
coelicolor 70Met Arg Arg Phe Arg Leu Val Gly Phe Leu Ser Ser Leu
Val Leu Ala 1 5 10 15Ala Gly Ala Ala Leu Thr Gly Ala Ala Thr Ala
Gln Ala Ala Gln Pro 20 25 30Ala Ala Ala Asp Gly Tyr Val Ala Leu Gly
Asp Ser Tyr Ser Ser Gly 35 40 45Val Gly Ala Gly Ser Tyr Ile Ser Ser
Ser Gly Asp Cys Lys Arg Ser 50 55 60Thr Lys Ala His Pro Tyr Leu Trp
Ala Ala Ala His Ser Pro Ser Thr 65 70 75 80Phe Asp Phe Thr Ala Cys
Ser Gly Ala Arg Thr Gly Asp Val Leu Ser 85 90 95Gly Gln Leu Gly Pro
Leu Ser Ser Gly Thr Gly Leu Val Ser Ile Ser 100 105 110Ile Gly Gly
Asn Asp Ala Gly Phe Ala Asp Thr Met Thr Thr Cys Val 115 120 125Leu
Gln Ser Glu Ser Ser Cys Leu Ser Arg Ile Ala Thr Ala Glu Ala 130 135
140Tyr Val Asp Ser Thr Leu Pro Gly Lys Leu Asp Gly Val Tyr Ser
Ala145 150 155 160Ile Ser Asp Lys Ala Pro Asn Ala His Val Val Val
Ile Gly Tyr Pro 165 170 175Arg Phe Tyr Lys Leu Gly Thr Thr Cys Ile
Gly Leu Ser Glu Thr Lys 180 185 190Arg Thr Ala Ile Asn Lys Ala Ser
Asp His Leu Asn Thr Val Leu Ala 195 200 205Gln Arg Ala Ala Ala His
Gly Phe Thr Phe Gly Asp Val Arg Thr Thr 210 215 220Phe Thr Gly His
Glu Leu Cys Ser Gly Ser Pro Trp Leu His Ser Val225 230 235 240Asn
Trp Leu Asn Ile Gly Glu Ser Tyr His Pro Thr Ala Ala Gly Gln 245 250
255Ser Gly Gly Tyr Leu Pro Val Leu Asn Gly Ala Ala 260
26571269PRTStreptomyces avermitilis 71Met Arg Arg Ser Arg Ile Thr
Ala Tyr Val Thr Ser Leu Leu Leu Ala 1 5 10 15Val Gly Cys Ala Leu
Thr Gly Ala Ala Thr Ala Gln Ala Ser Pro Ala 20 25 30Ala Ala Ala Thr
Gly Tyr Val Ala Leu Gly Asp Ser Tyr Ser Ser Gly 35 40 45Val Gly Ala
Gly Ser Tyr Leu Ser Ser Ser Gly Asp Cys Lys Arg Ser 50 55 60Ser Lys
Ala Tyr Pro Tyr Leu Trp Gln Ala Ala His Ser Pro Ser Ser 65 70 75
80Phe Ser Phe Met Ala Cys Ser Gly Ala Arg Thr Gly Asp Val Leu Ala
85 90 95Asn Gln Leu Gly Thr Leu Asn Ser Ser Thr Gly Leu Val Ser Leu
Thr 100 105 110Ile Gly Gly Asn Asp Ala Gly Phe Ser Asp Val Met Thr
Thr Cys Val 115 120 125Leu Gln Ser Asp Ser Ala Cys Leu Ser Arg Ile
Asn Thr Ala Lys Ala 130 135 140Tyr Val Asp Ser Thr Leu Pro Gly Gln
Leu Asp Ser Val Tyr Thr Ala145 150 155 160Ile Ser Thr Lys Ala Pro
Ser Ala His Val Ala Val Leu Gly Tyr Pro 165 170 175Arg Phe Tyr Lys
Leu Gly Gly Ser Cys Leu Ala Gly Leu Ser Glu Thr 180 185 190Lys Arg
Ser Ala Ile Asn Asp Ala Ala Asp Tyr Leu Asn Ser Ala Ile 195 200
205Ala Lys Arg Ala Ala Asp His Gly Phe Thr Phe Gly Asp Val Lys Ser
210 215 220Thr Phe Thr Gly His Glu Ile Cys Ser Ser Ser Thr Trp Leu
His Ser225 230 235 240Leu Asp Leu Leu Asn Ile Gly Gln Ser Tyr His
Pro Thr Ala Ala Gly 245 250 255Gln Ser Gly Gly Tyr Leu Pro Val Met
Asn Ser Val Ala 260 26572267PRTStreptomyces sp. 72Met Arg Leu Thr
Arg Ser Leu Ser Ala Ala Ser Val Ile Val Phe Ala 1 5 10 15Leu Leu
Leu Ala Leu Leu Gly Ile Ser Pro Ala Gln Ala Ala Gly Pro 20 25 30Ala
Tyr Val Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asn Gly Ala Gly 35 40
45Ser Tyr Ile Asp Ser Ser Gly Asp Cys His Arg Ser Asn Asn Ala Tyr
50 55 60Pro Ala Arg Trp Ala Ala Ala Asn Ala Pro Ser Ser Phe Thr Phe
Ala 65 70 75 80Ala Cys Ser Gly Ala Val Thr Thr Asp Val Ile Asn Asn
Gln Leu Gly 85 90 95Ala Leu Asn Ala Ser Thr Gly Leu Val Ser Ile Thr
Ile Gly Gly Asn 100 105 110Asp Ala Gly Phe Ala Asp Ala Met Thr Thr
Cys Val Thr Ser Ser Asp 115 120 125Ser Thr Cys Leu Asn Arg Leu Ala
Thr Ala Thr Asn Tyr Ile Asn Thr 130 135 140Thr Leu Leu Ala Arg Leu
Asp Ala Val Tyr Ser
Gln Ile Lys Ala Arg145 150 155 160Ala Pro Asn Ala Arg Val Val Val
Leu Gly Tyr Pro Arg Met Tyr Leu 165 170 175Ala Ser Asn Pro Trp Tyr
Cys Leu Gly Leu Ser Asn Thr Lys Arg Ala 180 185 190Ala Ile Asn Thr
Thr Ala Asp Thr Leu Asn Ser Val Ile Ser Ser Arg 195 200 205Ala Thr
Ala His Gly Phe Arg Phe Gly Asp Val Arg Pro Thr Phe Asn 210 215
220Asn His Glu Leu Phe Phe Gly Asn Asp Trp Leu His Ser Leu Thr
Leu225 230 235 240Pro Val Trp Glu Ser Tyr His Pro Thr Ser Thr Gly
His Gln Ser Gly 245 250 255Tyr Leu Pro Val Leu Asn Ala Asn Ser Ser
Thr 260 26573317PRTAeromonas hydrophila 73Ala Asp Ser Arg Pro Ala
Phe Ser Arg Ile Val Met Phe Gly Asp Ser 1 5 10 15Leu Ser Asp Thr
Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr Leu Pro 20 25 30Ser Ser Pro
Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro Val Trp 35 40 45Leu Glu
Gln Leu Thr Asn Glu Phe Pro Gly Leu Thr Ile Ala Asn Glu 50 55 60Ala
Glu Gly Gly Pro Thr Ala Val Ala Tyr Asn Lys Ile Ser Trp Asn 65 70
75 80Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu Val Thr Gln
Phe 85 90 95Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val Ile Leu
Trp Val 100 105 110Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp Asn Thr
Glu Gln Asp Ala 115 120 125Lys Arg Val Arg Asp Ala Ile Ser Asp Ala
Ala Asn Arg Met Val Leu 130 135 140Asn Gly Ala Lys Glu Ile Leu Leu
Phe Asn Leu Pro Asp Leu Gly Gln145 150 155 160Asn Pro Ser Ala Arg
Ser Gln Lys Val Val Glu Ala Ala Ser His Val 165 170 175Ser Ala Tyr
His Asn Gln Leu Leu Leu Asn Leu Ala Arg Gln Leu Ala 180 185 190Pro
Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe Ala Glu 195 200
205Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Gln Arg Asn Ala
210 215 220Cys Tyr Gly Gly Ser Tyr Val Trp Lys Pro Phe Ala Ser Arg
Ser Ala225 230 235 240Ser Thr Asp Ser Gln Leu Ser Ala Phe Asn Pro
Gln Glu Arg Leu Ala 245 250 255Ile Ala Gly Asn Pro Leu Leu Ala Gln
Ala Val Ala Ser Pro Met Ala 260 265 270Ala Arg Ser Ala Ser Thr Leu
Asn Cys Glu Gly Lys Met Phe Trp Asp 275 280 285Gln Val His Pro Thr
Thr Val Val His Ala Ala Leu Ser Glu Pro Ala 290 295 300Ala Thr Phe
Ile Glu Ser Gln Tyr Glu Phe Leu Ala His305 310 31574318PRTAeromonas
salmonicida 74Ala Asp Thr Arg Pro Ala Phe Ser Arg Ile Val Met Phe
Gly Asp Ser 1 5 10 15Leu Ser Asp Thr Gly Lys Met Tyr Ser Lys Met
Arg Gly Tyr Leu Pro 20 25 30Ser Ser Pro Pro Tyr Tyr Glu Gly Arg Phe
Ser Asn Gly Pro Val Trp 35 40 45Leu Glu Gln Leu Thr Lys Gln Phe Pro
Gly Leu Thr Ile Ala Asn Glu 50 55 60Ala Glu Gly Gly Ala Thr Ala Val
Ala Tyr Asn Lys Ile Ser Trp Asn 65 70 75 80Pro Lys Tyr Gln Val Ile
Asn Asn Leu Asp Tyr Glu Val Thr Gln Phe 85 90 95Leu Gln Lys Asp Ser
Phe Lys Pro Asp Asp Leu Val Ile Leu Trp Val 100 105 110Gly Ala Asn
Asp Tyr Leu Ala Tyr Gly Trp Asn Thr Glu Gln Asp Ala 115 120 125Lys
Arg Val Arg Asp Ala Ile Ser Asp Ala Ala Asn Arg Met Val Leu 130 135
140Asn Gly Ala Lys Gln Ile Leu Leu Phe Asn Leu Pro Asp Leu Gly
Gln145 150 155 160Asn Pro Ser Ala Arg Ser Gln Lys Val Val Glu Ala
Val Ser His Val 165 170 175Ser Ala Tyr His Asn Lys Leu Leu Leu Asn
Leu Ala Arg Gln Leu Ala 180 185 190Pro Thr Gly Met Val Lys Leu Phe
Glu Ile Asp Lys Gln Phe Ala Glu 195 200 205Met Leu Arg Asp Pro Gln
Asn Phe Gly Leu Ser Asp Val Glu Asn Pro 210 215 220Cys Tyr Asp Gly
Gly Tyr Val Trp Lys Pro Phe Ala Thr Arg Ser Val225 230 235 240Ser
Thr Asp Arg Gln Leu Ser Ala Phe Ser Pro Gln Glu Arg Leu Ala 245 250
255Ile Ala Gly Asn Pro Leu Leu Ala Gln Ala Val Ala Ser Pro Met Ala
260 265 270Arg Arg Ser Ala Ser Pro Leu Asn Cys Glu Gly Lys Met Phe
Trp Asp 275 280 285Gln Val His Pro Thr Thr Val Val His Ala Ala Leu
Ser Glu Arg Ala 290 295 300Ala Thr Phe Ile Glu Thr Gln Tyr Glu Phe
Leu Ala His Gly305 310 315751371DNAStreptomyces thermosacchari
75acaggccgat gcacggaacc gtacctttcc gcagtgaagc gctctccccc catcgttcgc
60cgggacttca tccgcgattt tggcatgaac acttccttca acgcgcgtag cttgctacaa
120gtgcggcagc agacccgctc gttggaggct cagtgagatt gacccgatcc
ctgtcggccg 180catccgtcat cgtcttcgcc ctgctgctcg cgctgctggg
catcagcccg gcccaggcag 240ccggcccggc ctatgtggcc ctgggggatt
cctattcctc gggcaacggc gccggaagtt 300acatcgattc gagcggtgac
tgtcaccgca gcaacaacgc gtaccccgcc cgctgggcgg 360cggccaacgc
accgtcctcc ttcaccttcg cggcctgctc gggagcggtg accacggatg
420tgatcaacaa tcagctgggc gccctcaacg cgtccaccgg cctggtgagc
atcaccatcg 480gcggcaatga cgcgggcttc gcggacgcga tgaccacctg
cgtcaccagc tcggacagca 540cctgcctcaa ccggctggcc accgccacca
actacatcaa caccaccctg ctcgcccggc 600tcgacgcggt ctacagccag
atcaaggccc gtgcccccaa cgcccgcgtg gtcgtcctcg 660gctacccgcg
catgtacctg gcctcgaacc cctggtactg cctgggcctg agcaacacca
720agcgcgcggc catcaacacc accgccgaca ccctcaactc ggtgatctcc
tcccgggcca 780ccgcccacgg attccgattc ggcgatgtcc gcccgacctt
caacaaccac gaactgttct 840tcggcaacga ctggctgcac tcactcaccc
tgccggtgtg ggagtcgtac caccccacca 900gcacgggcca tcagagcggc
tatctgccgg tcctcaacgc caacagctcg acctgatcaa 960cgcacggccg
tgcccgcccc gcgcgtcacg ctcggcgcgg gcgccgcagc gcgttgatca
1020gcccacagtg ccggtgacgg tcccaccgtc acggtcgagg gtgtacgtca
cggtggcgcc 1080gctccagaag tggaacgtca gcaggaccgt ggagccgtcc
ctgacctcgt cgaagaactc 1140cggggtcagc gtgatcaccc ctcccccgta
gccgggggcg aaggcggcgc cgaactcctt 1200gtaggacgtc cagtcgtgcg
gcccggcgtt gccaccgtcc gcgtagaccg cttccatggt 1260cgccagccgg
tccccgcgga actcggtggg gatgtccgtg cccaaggtgg tcccggtggt
1320gtccgagagc accgggggct cgtaccggat gatgtgcaga tccaaagaat t
137176267PRTStreptomyces thermosacchari 76Met Arg Leu Thr Arg Ser
Leu Ser Ala Ala Ser Val Ile Val Phe Ala 1 5 10 15Leu Leu Leu Ala
Leu Leu Gly Ile Ser Pro Ala Gln Ala Ala Gly Pro 20 25 30Ala Tyr Val
Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asn Gly Ala Gly 35 40 45Ser Tyr
Ile Asp Ser Ser Gly Asp Cys His Arg Ser Asn Asn Ala Tyr 50 55 60Pro
Ala Arg Trp Ala Ala Ala Asn Ala Pro Ser Ser Phe Thr Phe Ala 65 70
75 80Ala Cys Ser Gly Ala Val Thr Thr Asp Val Ile Asn Asn Gln Leu
Gly 85 90 95Ala Leu Asn Ala Ser Thr Gly Leu Val Ser Ile Thr Ile Gly
Gly Asn 100 105 110Asp Ala Gly Phe Ala Asp Ala Met Thr Thr Cys Val
Thr Ser Ser Asp 115 120 125Ser Thr Cys Leu Asn Arg Leu Ala Thr Ala
Thr Asn Tyr Ile Asn Thr 130 135 140Thr Leu Leu Ala Arg Leu Asp Ala
Val Tyr Ser Gln Ile Lys Ala Arg145 150 155 160Ala Pro Asn Ala Arg
Val Val Val Leu Gly Tyr Pro Arg Met Tyr Leu 165 170 175Ala Ser Asn
Pro Trp Tyr Cys Leu Gly Leu Ser Asn Thr Lys Arg Ala 180 185 190Ala
Ile Asn Thr Thr Ala Asp Thr Leu Asn Ser Val Ile Ser Ser Arg 195 200
205Ala Thr Ala His Gly Phe Arg Phe Gly Asp Val Arg Pro Thr Phe Asn
210 215 220Asn His Glu Leu Phe Phe Gly Asn Asp Trp Leu His Ser Leu
Thr Leu225 230 235 240Pro Val Trp Glu Ser Tyr His Pro Thr Ser Thr
Gly His Gln Ser Gly 245 250 255Tyr Leu Pro Val Leu Asn Ala Asn Ser
Ser Thr 260 26577548PRTThermobifida fusca 77Met Leu Pro His Pro Ala
Gly Glu Arg Gly Glu Val Gly Ala Phe Phe 1 5 10 15Ala Leu Leu Val
Gly Thr Pro Gln Asp Arg Arg Leu Arg Leu Glu Cys 20 25 30His Glu Thr
Arg Pro Leu Arg Gly Arg Cys Gly Cys Gly Glu Arg Arg 35 40 45Val Pro
Pro Leu Thr Leu Pro Gly Asp Gly Val Leu Cys Thr Thr Ser 50 55 60Ser
Thr Arg Asp Ala Glu Thr Val Trp Arg Lys His Leu Gln Pro Arg 65 70
75 80Pro Asp Gly Gly Phe Arg Pro His Leu Gly Val Gly Cys Leu Leu
Ala 85 90 95Gly Gln Gly Ser Pro Gly Val Leu Trp Cys Gly Arg Glu Gly
Cys Arg 100 105 110Phe Glu Val Cys Arg Arg Asp Thr Pro Gly Leu Ser
Arg Thr Arg Asn 115 120 125Gly Asp Ser Ser Pro Pro Phe Arg Ala Gly
Trp Ser Leu Pro Pro Lys 130 135 140Cys Gly Glu Ile Ser Gln Ser Ala
Arg Lys Thr Pro Ala Val Pro Arg145 150 155 160Tyr Ser Leu Leu Arg
Thr Asp Arg Pro Asp Gly Pro Arg Gly Arg Phe 165 170 175Val Gly Ser
Gly Pro Arg Ala Ala Thr Arg Arg Arg Leu Phe Leu Gly 180 185 190Ile
Pro Ala Leu Val Leu Val Thr Ala Leu Thr Leu Val Leu Ala Val 195 200
205Pro Thr Gly Arg Glu Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln
210 215 220Asp Trp Cys Leu Gly Val Pro Val Asp Ser Arg Gly Gln Pro
Ala Glu225 230 235 240Asp Gly Glu Phe Leu Leu Leu Ser Pro Val Gln
Ala Ala Thr Trp Gly 245 250 255Asn Tyr Tyr Ala Leu Gly Asp Ser Tyr
Ser Ser Gly Asp Gly Ala Arg 260 265 270Asp Tyr Tyr Pro Gly Thr Ala
Val Lys Gly Gly Cys Trp Arg Ser Ala 275 280 285Asn Ala Tyr Pro Glu
Leu Val Ala Glu Ala Tyr Asp Phe Ala Gly His 290 295 300Leu Ser Phe
Leu Ala Cys Ser Gly Gln Arg Gly Tyr Ala Met Leu Asp305 310 315
320Ala Ile Asp Glu Val Gly Ser Gln Leu Asp Trp Asn Ser Pro His Thr
325 330 335Ser Leu Val Thr Ile Gly Ile Gly Gly Asn Asp Leu Gly Phe
Ser Thr 340 345 350Val Leu Lys Thr Cys Met Val Arg Val Pro Leu Leu
Asp Ser Lys Ala 355 360 365Cys Thr Asp Gln Glu Asp Ala Ile Arg Lys
Arg Met Ala Lys Phe Glu 370 375 380Thr Thr Phe Glu Glu Leu Ile Ser
Glu Val Arg Thr Arg Ala Pro Asp385 390 395 400Ala Arg Ile Leu Val
Val Gly Tyr Pro Arg Ile Phe Pro Glu Glu Pro 405 410 415Thr Gly Ala
Tyr Tyr Thr Leu Thr Ala Ser Asn Gln Arg Trp Leu Asn 420 425 430Glu
Thr Ile Gln Glu Phe Asn Gln Gln Leu Ala Glu Ala Val Ala Val 435 440
445His Asp Glu Glu Ile Ala Ala Ser Gly Gly Val Gly Ser Val Glu Phe
450 455 460Val Asp Val Tyr His Ala Leu Asp Gly His Glu Ile Gly Ser
Asp Glu465 470 475 480Pro Trp Val Asn Gly Val Gln Leu Arg Asp Leu
Ala Thr Gly Val Thr 485 490 495Val Asp Arg Ser Thr Phe His Pro Asn
Ala Ala Gly His Arg Ala Val 500 505 510Gly Glu Arg Val Ile Glu Gln
Ile Glu Thr Gly Pro Gly Arg Pro Leu 515 520 525Tyr Ala Thr Phe Ala
Val Val Ala Gly Ala Thr Val Asp Thr Leu Ala 530 535 540Gly Glu Val
Gly545783000DNAThermobifida fusca 78ggtggtgaac cagaacaccc
ggtcgtcggc gtgggcgtcc aggtgcaggt gcaggttctt 60caactgctcc agcaggatgc
cgccgtggcc gtgcacgatg gccttgggca ggcctgtggt 120ccccgacgag
tacagcaccc atagcggatg gtcgaacggc agcggggtga actccagttc
180cgcgccttcg cccgcggctt cgaactccgc ccaggacagg gtgtcggcga
cagggccgca 240gcccaggtac ggcaggacga cggtgtgctg caggctgggc
atgccgtcgc gcagggcttt 300gagcacgtca cggcggtcga agtccttacc
gccgtagcgg tagccgtcca cggccagcag 360cactttcggt tcgatctgcg
cgaaccggtc gaggacgctg cgcaccccga agtcggggga 420acaggacgac
caggtcgcac cgatcgcggc gcaggcgagg aatgcggccg tcgcctcggc
480gatgttcggc aggtaggcca cgacccggtc gccggggccc accccgaggc
tgcggagggc 540cgcagcgatc gcggcggtgc gggtccgcag ttctccccag
gtccactcgg tcaacggccg 600gagttcggac gcgtgccgga tcgccacggc
tgatgggtca cggtcgcgga agatgtgctc 660ggcgtagttg agggtggcgc
cggggaacca gacggcgccg ggcatggcgt cggaggcgag 720cactgtggtg
tacggggtgg cggcgcgcac ccggtagtac tcccagatcg cggaccagaa
780tccttcgagg tcggttaccg accagcgcca cagtgcctcg tagtccggtg
cgtccacacc 840gcggtgctcc cgcacccagc gggtgaacgc ggtgaggttg
gcgcgttctt tgcgctcctc 900gtcgggactc cacaggatcg gcggctgcgg
cttgagtgtc atgaaacgcg accccttcgt 960ggacggtgcg gatgcggtga
gcgtcgggtg cctcccctaa cgctccccgg tgacggagtg 1020ttgtgcacca
catctagcac gcgggacgcg gaaaccgtat ggagaaaaca cctacaaccc
1080cggccggacg gtgggtttcg gccacactta ggggtcgggt gcctgcttgc
cgggcagggc 1140agtcccgggg tgctgtggtg cgggcgggag ggctgtcgct
tcgaggtgtg ccggcgggac 1200actccgggcc tcagccgtac ccgcaacggg
gacagttctc ctcccttccg ggctggatgg 1260tcccttcccc cgaaatgcgg
cgagatctcc cagtcagccc ggaaaacacc cgctgtgccc 1320aggtactctt
tgcttcgaac agacaggccg gacggtccac gggggaggtt tgtgggcagc
1380ggaccacgtg cggcgaccag acgacggttg ttcctcggta tccccgctct
tgtacttgtg 1440acagcgctca cgctggtctt ggctgtcccg acggggcgcg
agacgctgtg gcgcatgtgg 1500tgtgaggcca cccaggactg gtgcctgggg
gtgccggtcg actcccgcgg acagcctgcg 1560gaggacggcg agtttctgct
gctttctccg gtccaggcag cgacctgggg gaactattac 1620gcgctcgggg
attcgtactc ttcgggggac ggggcccgcg actactatcc cggcaccgcg
1680gtgaagggcg gttgctggcg gtccgctaac gcctatccgg agctggtcgc
cgaagcctac 1740gacttcgccg gacacttgtc gttcctggcc tgcagcggcc
agcgcggcta cgccatgctt 1800gacgctatcg acgaggtcgg ctcgcagctg
gactggaact cccctcacac gtcgctggtg 1860acgatcggga tcggcggcaa
cgatctgggg ttctccacgg ttttgaagac ctgcatggtg 1920cgggtgccgc
tgctggacag caaggcgtgc acggaccagg aggacgctat ccgcaagcgg
1980atggcgaaat tcgagacgac gtttgaagag ctcatcagcg aagtgcgcac
ccgcgcgccg 2040gacgcccgga tccttgtcgt gggctacccc cggatttttc
cggaggaacc gaccggcgcc 2100tactacacgc tgaccgcgag caaccagcgg
tggctcaacg aaaccattca ggagttcaac 2160cagcagctcg ccgaggctgt
cgcggtccac gacgaggaga ttgccgcgtc gggcggggtg 2220ggcagcgtgg
agttcgtgga cgtctaccac gcgttggacg gccacgagat cggctcggac
2280gagccgtggg tgaacggggt gcagttgcgg gacctcgcca ccggggtgac
tgtggaccgc 2340agtaccttcc accccaacgc cgctgggcac cgggcggtcg
gtgagcgggt catcgagcag 2400atcgaaaccg gcccgggccg tccgctctat
gccactttcg cggtggtggc gggggcgacc 2460gtggacactc tcgcgggcga
ggtggggtga cccggcttac cgtccggccc gcaggtctgc 2520gagcactgcg
gcgatctggt ccactgccca gtgcagttcg tcttcggtga tgaccagcgg
2580cggggagagc cggatcgttg agccgtgcgt gtctttgacg agcacacccc
gctgcaggag 2640ccgttcgcac agttctcttc cggtggccag agtcgggtcg
acgtcgatcc cagcccacag 2700gccgatgctg cgggccgcga ccacgccgtt
gccgaccagt tggtcgaggc gggcgcgcag 2760cacgggggcg agggcgcgga
catggtccag gtaagggccg tcgcggacga ggctcaccac 2820ggcagtgccg
accgcgcagg cgagggcgtt gccgccgaag gtgctgccgt gctggccggg
2880gcggatcacg tcgaagactt ccgcgtcgcc taccgccgcc gccacgggca
ggatgccgcc 2940gcccagcgct ttgccgaaca ggtagatatc ggcgtcgact
ccgctgtggt cgcaggcccg 300079372PRTThermobifida fusca 79Val Gly Ser
Gly Pro Arg Ala Ala Thr Arg Arg Arg Leu Phe Leu Gly 1 5 10 15Ile
Pro Ala Leu Val Leu Val Thr Ala Leu Thr Leu Val Leu Ala Val 20 25
30Pro Thr Gly Arg Glu Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln
35 40 45Asp Trp Cys Leu Gly Val Pro Val Asp Ser Arg Gly Gln Pro Ala
Glu 50 55 60Asp Gly Glu Phe Leu Leu Leu Ser Pro Val Gln Ala Ala Thr
Trp Gly 65 70 75 80Asn Tyr Tyr Ala Leu Gly Asp Ser Tyr Ser Ser Gly
Asp Gly Ala Arg 85 90 95Asp Tyr Tyr Pro Gly Thr Ala Val Lys Gly Gly
Cys Trp Arg Ser Ala 100 105 110Asn Ala Tyr Pro Glu Leu Val Ala Glu
Ala Tyr Asp Phe Ala Gly His 115 120 125Leu Ser Phe Leu Ala Cys Ser
Gly Gln Arg Gly Tyr Ala Met Leu Asp 130 135 140Ala Ile Asp Glu Val
Gly Ser Gln Leu Asp Trp Asn Ser Pro His Thr145 150 155 160Ser Leu
Val Thr Ile Gly Ile
Gly Gly Asn Asp Leu Gly Phe Ser Thr 165 170 175Val Leu Lys Thr Cys
Met Val Arg Val Pro Leu Leu Asp Ser Lys Ala 180 185 190Cys Thr Asp
Gln Glu Asp Ala Ile Arg Lys Arg Met Ala Lys Phe Glu 195 200 205Thr
Thr Phe Glu Glu Leu Ile Ser Glu Val Arg Thr Arg Ala Pro Asp 210 215
220Ala Arg Ile Leu Val Val Gly Tyr Pro Arg Ile Phe Pro Glu Glu
Pro225 230 235 240Thr Gly Ala Tyr Tyr Thr Leu Thr Ala Ser Asn Gln
Arg Trp Leu Asn 245 250 255Glu Thr Ile Gln Glu Phe Asn Gln Gln Leu
Ala Glu Ala Val Ala Val 260 265 270His Asp Glu Glu Ile Ala Ala Ser
Gly Gly Val Gly Ser Val Glu Phe 275 280 285Val Asp Val Tyr His Ala
Leu Asp Gly His Glu Ile Gly Ser Asp Glu 290 295 300Pro Trp Val Asn
Gly Val Gln Leu Arg Asp Leu Ala Thr Gly Val Thr305 310 315 320Val
Asp Arg Ser Thr Phe His Pro Asn Ala Ala Gly His Arg Ala Val 325 330
335Gly Glu Arg Val Ile Glu Gln Ile Glu Thr Gly Pro Gly Arg Pro Leu
340 345 350Tyr Ala Thr Phe Ala Val Val Ala Gly Ala Thr Val Asp Thr
Leu Ala 355 360 365Gly Glu Val Gly 37080300PRTCorynebacterium
efficiens 80Met Arg Thr Thr Val Ile Ala Ala Ser Ala Leu Leu Leu Leu
Ala Gly 1 5 10 15Cys Ala Asp Gly Ala Arg Glu Glu Thr Ala Gly Ala
Pro Pro Gly Glu 20 25 30Ser Ser Gly Gly Ile Arg Glu Glu Gly Ala Glu
Ala Ser Thr Ser Ile 35 40 45Thr Asp Val Tyr Ile Ala Leu Gly Asp Ser
Tyr Ala Ala Met Gly Gly 50 55 60Arg Asp Gln Pro Leu Arg Gly Glu Pro
Phe Cys Leu Arg Ser Ser Gly 65 70 75 80Asn Tyr Pro Glu Leu Leu His
Ala Glu Val Thr Asp Leu Thr Cys Gln 85 90 95Gly Ala Val Thr Gly Asp
Leu Leu Glu Pro Arg Thr Leu Gly Glu Arg 100 105 110Thr Leu Pro Ala
Gln Val Asp Ala Leu Thr Glu Asp Thr Thr Leu Val 115 120 125Thr Leu
Ser Ile Gly Gly Asn Asp Leu Gly Phe Gly Glu Val Ala Gly 130 135
140Cys Ile Arg Glu Arg Ile Ala Gly Glu Asn Ala Asp Asp Cys Val
Asp145 150 155 160Leu Leu Gly Glu Thr Ile Gly Glu Gln Leu Asp Gln
Leu Pro Pro Gln 165 170 175Leu Asp Arg Val His Glu Ala Ile Arg Asp
Arg Ala Gly Asp Ala Gln 180 185 190Val Val Val Thr Gly Tyr Leu Pro
Leu Val Ser Ala Gly Asp Cys Pro 195 200 205Glu Leu Gly Asp Val Ser
Glu Ala Asp Arg Arg Trp Ala Val Glu Leu 210 215 220Thr Gly Gln Ile
Asn Glu Thr Val Arg Glu Ala Ala Glu Arg His Asp225 230 235 240Ala
Leu Phe Val Leu Pro Asp Asp Ala Asp Glu His Thr Ser Cys Ala 245 250
255Pro Pro Gln Gln Arg Trp Ala Asp Ile Gln Gly Gln Gln Thr Asp Ala
260 265 270Tyr Pro Leu His Pro Thr Ser Ala Gly His Glu Ala Met Ala
Ala Ala 275 280 285Val Arg Asp Ala Leu Gly Leu Glu Pro Val Gln Pro
290 295 300813000DNACorynebacterium efficiens 81ttctggggtg
ttatggggtt gttatcggct cgtcctgggt ggatcccgcc aggtggggta 60ttcacggggg
acttttgtgt ccaacagccg agaatgagtg ccctgagcgg tgggaatgag
120gtgggcgggg ctgtgtcgcc atgagggggc ggcgggctct gtggtgcccc
gcgacccccg 180gccccggtga gcggtgaatg aaatccggct gtaatcagca
tcccgtgccc accccgtcgg 240ggaggtcagc gcccggagtg tctacgcagt
cggatcctct cggactcggc catgctgtcg 300gcagcatcgc gctcccgggt
cttggcgtcc ctcggctgtt ctgcctgctg tccctggaag 360gcgaaatgat
caccggggag tgatacaccg gtggtctcat cccggatgcc cacttcggcg
420ccatccggca attcgggcag ctccgggtgg aagtaggtgg catccgatgc
gtcggtgacg 480ccatagtggg cgaagatctc atcctgctcg agggtgctca
ggccactctc cggatcgata 540tcgggggcgt ccttgatggc gtccttgctg
aaaccgaggt gcagcttgtg ggcttccaat 600ttcgcaccac ggagcgggac
gaggctggaa tgacggccga agagcccgtg gtggacctca 660acgaaggtgg
gtagtcccgt gtcatcattg aggaacacgc cctccaccgc acccagcttg
720tggccggagt tgtcgtaggc gctggcatcc agaagggaaa cgatctcata
tttgtcggtg 780tgctcagaca tgatcttcct ttgctgtcgg tgtctggtac
taccacggta gggctgaatg 840caactgttat ttttctgtta ttttaggaat
tggtccatat cccacaggct ggctgtggtc 900aaatcgtcat caagtaatcc
ctgtcacaca aaatgggtgg tgggagccct ggtcgcggtt 960ccgtgggagg
cgccgtgccc cgcaggatcg tcggcatcgg cggatctggc cggtaccccg
1020cggtgaataa aatcattctg taaccttcat cacggttggt tttaggtatc
cgcccctttc 1080gtcctgaccc cgtccccggc gcgcgggagc ccgcgggttg
cggtagacag gggagacgtg 1140gacaccatga ggacaacggt catcgcagca
agcgcattac tccttctcgc cggatgcgcg 1200gatggggccc gggaggagac
cgccggtgca ccgccgggtg agtcctccgg gggcatccgg 1260gaggaggggg
cggaggcgtc gacaagcatc accgacgtct acatcgccct cggggattcc
1320tatgcggcga tgggcgggcg ggatcagccg ttacggggtg agccgttctg
cctgcgctcg 1380tccggtaatt acccggaact cctccacgca gaggtcaccg
atctcacctg ccagggggcg 1440gtgaccgggg atctgctcga acccaggacg
ctgggggagc gcacgctgcc ggcgcaggtg 1500gatgcgctga cggaggacac
caccctggtc accctctcca tcgggggcaa tgacctcgga 1560ttcggggagg
tggcgggatg catccgggaa cggatcgccg gggagaacgc tgatgattgc
1620gtggacctgc tgggggaaac catcggggag cagctcgatc agcttccccc
gcagctggac 1680cgcgtgcacg aggctatccg ggaccgcgcc ggggacgcgc
aggttgtggt caccggttac 1740ctgccgctcg tgtctgccgg ggactgcccc
gaactggggg atgtctccga ggcggatcgt 1800cgttgggcgg ttgagctgac
cgggcagatc aacgagaccg tgcgcgaggc ggccgaacga 1860cacgatgccc
tctttgtcct gcccgacgat gccgatgagc acaccagttg tgcaccccca
1920cagcagcgct gggcggatat ccagggccaa cagaccgatg cctatccgct
gcacccgacc 1980tccgccggcc atgaggcgat ggccgccgcc gtccgggacg
cgctgggcct ggaaccggtc 2040cagccgtagc gccgggcgcg cgcttgtcga
cgaccaaccc atgccaggct gcagtcacat 2100ccgcacatag cgcgcgcggg
cgatggagta cgcaccatag aggatgagcc cgatgccgac 2160gatgatgagc
agcacactgc cgaagggttg ttccccgagg gtgcgcagag ccgagtccag
2220acctgcggcc tgctccggat catgggccca accggcgatg acgatcaaca
cccccaggat 2280cccgaaggcg ataccacggg cgacataacc ggctgttccg
gtgatgatga tcgcggtccc 2340gacctgccct gaccccgcac ccgcctccag
atcctcccgg aaatcccggg tggccccctt 2400ccagaggttg tagacacccg
cccccagtac caccagcccg gcgaccacaa ccagcaccac 2460accccagggt
tgggatagga cggtggcggt gacatcggtg gcggtctccc catcggaggt
2520gctgccgccc cgggcgaagg tggaggtggt caccgccagg gagaagtaga
ccatggccat 2580gaccgccccc ttggcccttt ccttgaggtc ctcgcccgcc
agcagctggc tcaattgcca 2640gagtcccagg gccgccaggg cgatgacggc
aacccacagg aggaactgcc cacccggagc 2700ctccgcgatg gtggccaggg
cacctgaatt cgaggcctca tcacccgaac cgccggatcc 2760agtggcgatg
cgcaccgcga tccacccgat gaggatgtgc agtatgccca ggacaatgaa
2820accacctctg gccagggtgg tcagcgcggg gtggtcctcg gcctggtcgg
cagcccgttc 2880gatcgtccgt ttcgcggatc tggtgtcgcc cttatccata
gctcccattg aaccgccttg 2940aggggtgggc ggccactgtc agggcggatt
gtgatctgaa ctgtgatgtt ccatcaaccc 300082268PRTStreptomyces
coelicolor 82Met Arg Arg Phe Arg Leu Val Gly Phe Leu Ser Ser Leu
Val Leu Ala 1 5 10 15Ala Gly Ala Ala Leu Thr Gly Ala Ala Thr Ala
Gln Ala Ala Gln Pro 20 25 30Ala Ala Ala Asp Gly Tyr Val Ala Leu Gly
Asp Ser Tyr Ser Ser Gly 35 40 45Val Gly Ala Gly Ser Tyr Ile Ser Ser
Ser Gly Asp Cys Lys Arg Ser 50 55 60Thr Lys Ala His Pro Tyr Leu Trp
Ala Ala Ala His Ser Pro Ser Thr 65 70 75 80Phe Asp Phe Thr Ala Cys
Ser Gly Ala Arg Thr Gly Asp Val Leu Ser 85 90 95Gly Gln Leu Gly Pro
Leu Ser Ser Gly Thr Gly Leu Val Ser Ile Ser 100 105 110Ile Gly Gly
Asn Asp Ala Gly Phe Ala Asp Thr Met Thr Thr Cys Val 115 120 125Leu
Gln Ser Glu Ser Ser Cys Leu Ser Arg Ile Ala Thr Ala Glu Ala 130 135
140Tyr Val Asp Ser Thr Leu Pro Gly Lys Leu Asp Gly Val Tyr Ser
Ala145 150 155 160Ile Ser Asp Lys Ala Pro Asn Ala His Val Val Val
Ile Gly Tyr Pro 165 170 175Arg Phe Tyr Lys Leu Gly Thr Thr Cys Ile
Gly Leu Ser Glu Thr Lys 180 185 190Arg Thr Ala Ile Asn Lys Ala Ser
Asp His Leu Asn Thr Val Leu Ala 195 200 205Gln Arg Ala Ala Ala His
Gly Phe Thr Phe Gly Asp Val Arg Thr Thr 210 215 220Phe Thr Gly His
Glu Leu Cys Ser Gly Ser Pro Trp Leu His Ser Val225 230 235 240Asn
Trp Leu Asn Ile Gly Glu Ser Tyr His Pro Thr Ala Ala Gly Gln 245 250
255Ser Gly Gly Tyr Leu Pro Val Leu Asn Gly Ala Ala 260
265832000DNAStreptomyces coelicolor 83cccggcggcc cgtgcaggag
cagcagccgg cccgcgatgt cctcgggcgt cgtcttcatc 60aggccgtcca tcgcgtcggc
gaccggcgcc gtgtagttgg cccggacctc gtcccaggtg 120cccgcggcga
tctggcgggt ggtgcggtgc gggccgcgcc gaggggagac gtaccagaag
180cccatcgtca cgttctccgg ctgcggttcg ggctcgtccg ccgctccgtc
cgtcgcctcg 240ccgagcacct tctcggcgag gtcggcgctg gtcgccgtca
ccgtgacgtc ggcgccccgg 300ctccagcgcg agatcagcag cgtccagccg
tcgccctccg ccagcgtcgc gctgcggtcg 360tcgtcgcggg cgatccgcag
cacgcgcgcg ccgggcggca gcagcgtggc gccggaccgt 420acgcggtcga
tgttcgccgc gtgcgagtac ggctgctcac ccgtggcgaa acggccgagg
480aacagcgcgt cgacgacgtc ggacggggag tcgctgtcgt ccacgttgag
ccggatcggc 540agggcttcgt gcgggttcac ggacatgtcg ccatgatcgg
gcacccggcc gccgcgtgca 600cccgctttcc cgggcacgca cgacaggggc
tttctcgccg tcttccgtcc gaacttgaac 660gagtgtcagc catttcttgg
catggacact tccagtcaac gcgcgtagct gctaccacgg 720ttgtggcagc
aatcctgcta agggaggttc catgagacgt ttccgacttg tcggcttcct
780gagttcgctc gtcctcgccg ccggcgccgc cctcaccggg gcagcgaccg
cccaggcggc 840ccaacccgcc gccgccgacg gctatgtggc cctcggcgac
tcctactcct ccggggtcgg 900agcgggcagc tacatcagct cgagcggcga
ctgcaagcgc agcacgaagg cccatcccta 960cctgtgggcg gccgcccact
cgccctccac gttcgacttc accgcctgtt ccggcgcccg 1020tacgggtgat
gttctctccg gacagctcgg cccgctcagc tccggcaccg gcctcgtctc
1080gatcagcatc ggcggcaacg acgccggttt cgccgacacc atgacgacct
gtgtgctcca 1140gtccgagagc tcctgcctgt cgcggatcgc caccgccgag
gcgtacgtcg actcgacgct 1200gcccggcaag ctcgacggcg tctactcggc
aatcagcgac aaggcgccga acgcccacgt 1260cgtcgtcatc ggctacccgc
gcttctacaa gctcggcacc acctgcatcg gcctgtccga 1320gaccaagcgg
acggcgatca acaaggcctc cgaccacctc aacaccgtcc tcgcccagcg
1380cgccgccgcc cacggcttca ccttcggcga cgtacgcacc accttcaccg
gccacgagct 1440gtgctccggc agcccctggc tgcacagcgt caactggctg
aacatcggcg agtcgtacca 1500ccccaccgcg gccggccagt ccggtggcta
cctgccggtc ctcaacggcg ccgcctgacc 1560tcaggcggaa ggagaagaag
aaggagcgga gggagacgag gagtgggagg ccccgcccga 1620cggggtcccc
gtccccgtct ccgtctccgt cccggtcccg caagtcaccg agaacgccac
1680cgcgtcggac gtggcccgca ccggactccg cacctccacg cgcacggcac
tctcgaacgc 1740gccggtgtcg tcgtgcgtcg tcaccaccac gccgtcctgg
cgcgagcgct cgccgcccga 1800cgggaaggac agcgtccgcc accccggatc
ggagaccgac ccgtccgcgg tcacccaccg 1860gtagccgacc tccgcgggca
gccgcccgac cgtgaacgtc gccgtgaacg cgggtgcccg 1920gtcgtgcggc
ggcggacagg cccccgagta gtgggtgcgc gagcccacca cggtcacctc
1980caccgactgc gctgcggggc 200084269PRTStreptomyces avermitilis
84Met Arg Arg Ser Arg Ile Thr Ala Tyr Val Thr Ser Leu Leu Leu Ala 1
5 10 15Val Gly Cys Ala Leu Thr Gly Ala Ala Thr Ala Gln Ala Ser Pro
Ala 20 25 30Ala Ala Ala Thr Gly Tyr Val Ala Leu Gly Asp Ser Tyr Ser
Ser Gly 35 40 45Val Gly Ala Gly Ser Tyr Leu Ser Ser Ser Gly Asp Cys
Lys Arg Ser 50 55 60Ser Lys Ala Tyr Pro Tyr Leu Trp Gln Ala Ala His
Ser Pro Ser Ser 65 70 75 80Phe Ser Phe Met Ala Cys Ser Gly Ala Arg
Thr Gly Asp Val Leu Ala 85 90 95Asn Gln Leu Gly Thr Leu Asn Ser Ser
Thr Gly Leu Val Ser Leu Thr 100 105 110Ile Gly Gly Asn Asp Ala Gly
Phe Ser Asp Val Met Thr Thr Cys Val 115 120 125Leu Gln Ser Asp Ser
Ala Cys Leu Ser Arg Ile Asn Thr Ala Lys Ala 130 135 140Tyr Val Asp
Ser Thr Leu Pro Gly Gln Leu Asp Ser Val Tyr Thr Ala145 150 155
160Ile Ser Thr Lys Ala Pro Ser Ala His Val Ala Val Leu Gly Tyr Pro
165 170 175Arg Phe Tyr Lys Leu Gly Gly Ser Cys Leu Ala Gly Leu Ser
Glu Thr 180 185 190Lys Arg Ser Ala Ile Asn Asp Ala Ala Asp Tyr Leu
Asn Ser Ala Ile 195 200 205Ala Lys Arg Ala Ala Asp His Gly Phe Thr
Phe Gly Asp Val Lys Ser 210 215 220Thr Phe Thr Gly His Glu Ile Cys
Ser Ser Ser Thr Trp Leu His Ser225 230 235 240Leu Asp Leu Leu Asn
Ile Gly Gln Ser Tyr His Pro Thr Ala Ala Gly 245 250 255Gln Ser Gly
Gly Tyr Leu Pro Val Met Asn Ser Val Ala 260
265851980DNAStreptomyces avermitilis 85ccaccgccgg gtcggcggcg
agtctcctgg cctcggtcgc ggagaggttg gccgtgtagc 60cgttcagcgc ggcgccgaac
gtcttcttca ccgtgccgcc gtactcgttg atcaggccct 120tgcccttgct
cgacgcggcc ttgaagccgg tgcccttctt gagcgtgacg atgtagctgc
180ccttgatcgc ggtgggggag ccggcggcga gcaccgtgcc ctcggccggg
gtggcctggg 240cgggcagtgc ggtgaatccg cccacgaggg cgccggtcgc
cacggcggtt atcgcggcga 300tccggatctt cttgctacgc agctgtgcca
tacgagggag tcctcctctg ggcagcggcg 360cgcctgggtg gggcgcacgg
ctgtgggggg tgcgcgcgtc atcacgcaca cggccctgga 420gcgtcgtgtt
ccgccctggg ttgagtaaag cctcggccat ctacgggggt ggctcaaggg
480agttgagacc ctgtcatgag tctgacatga gcacgcaatc aacggggccg
tgagcacccc 540ggggcgaccc cggaaagtgc cgagaagtct tggcatggac
acttcctgtc aacacgcgta 600gctggtacga cggttacggc agagatcctg
ctaaagggag gttccatgag acgttcccga 660attacggcat acgtgacctc
actcctcctc gccgtcggct gcgccctcac cggggcagcg 720acggcgcagg
cgtccccagc cgccgcggcc acgggctatg tggccctcgg cgactcgtac
780tcgtccggtg tcggcgccgg cagctacctc agctccagcg gcgactgcaa
gcgcagttcg 840aaggcctatc cgtacctctg gcaggccgcg cattcaccct
cgtcgttcag tttcatggct 900tgctcgggcg ctcgtacggg tgatgtcctg
gccaatcagc tcggcaccct gaactcgtcc 960accggcctgg tctccctcac
catcggaggc aacgacgcgg gcttctccga cgtcatgacg 1020acctgtgtgc
tccagtccga cagcgcctgc ctctcccgca tcaacacggc gaaggcgtac
1080gtcgactcca ccctgcccgg ccaactcgac agcgtgtaca cggcgatcag
cacgaaggcc 1140ccgtcggccc atgtggccgt gctgggctac ccccgcttct
acaaactggg cggctcctgc 1200ctcgcgggcc tctcggagac caagcggtcc
gccatcaacg acgcggccga ctatctgaac 1260agcgccatcg ccaagcgcgc
cgccgaccac ggcttcacct tcggcgacgt caagagcacc 1320ttcaccggcc
atgagatctg ctccagcagc acctggctgc acagtctcga cctgctgaac
1380atcggccagt cctaccaccc gaccgcggcc ggccagtccg gcggctatct
gccggtcatg 1440aacagcgtgg cctgagctcc cacggcctga atttttaagg
cctgaatttt taaggcgaag 1500gtgaaccgga agcggaggcc ccgtccgtcg
gggtctccgt cgcacaggtc accgagaacg 1560gcacggagtt ggacgtcgtg
cgcaccgggt cgcgcacctc gacggcgatc tcgttcgaga 1620tcgttccgct
cgtgtcgtac gtggtgacga acacctgctt ctgctgggtc tttccgccgc
1680tcgccgggaa ggacagcgtc ttccagcccg gatccgggac ctcgcccttc
ttggtcaccc 1740agcggtactc cacctcgacc ggcacccggc ccaccgtgaa
ggtcgccgtg aacgtgggcg 1800cctgggcggt gggcggcggg caggcaccgg
agtagtcggt gtgcacgccg gtgaccgtca 1860ccttcacgga ctgggccggc
ggggtcgtcg taccgccgcc gccaccgccg cctcccggag 1920tggagcccga
gctgtggtcg cccccgccgt cggcgttgtc gtcctcgggg gttttcgaac
198086372PRTThermobifida fusca 86Met Gly Ser Gly Pro Arg Ala Ala
Thr Arg Arg Arg Leu Phe Leu Gly 1 5 10 15Ile Pro Ala Leu Val Leu
Val Thr Ala Leu Thr Leu Val Leu Ala Val 20 25 30Pro Thr Gly Arg Glu
Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln 35 40 45Asp Trp Cys Leu
Gly Val Pro Val Asp Ser Arg Gly Gln Pro Ala Glu 50 55 60Asp Gly Glu
Phe Leu Leu Leu Ser Pro Val Gln Ala Ala Thr Trp Gly 65 70 75 80Asn
Tyr Tyr Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asp Gly Ala Arg 85 90
95Asp Tyr Tyr Pro Gly Thr Ala Val Lys Gly Gly Cys Trp Arg Ser Ala
100 105 110Asn Ala Tyr Pro Glu Leu Val Ala Glu Ala Tyr Asp Phe Ala
Gly His 115 120 125Leu Ser Phe Leu Ala Cys Ser Gly Gln Arg Gly Tyr
Ala Met Leu Asp 130 135 140Ala Ile Asp Glu Val Gly Ser Gln Leu Asp
Trp Asn Ser Pro His Thr145 150 155 160Ser Leu Val Thr Ile Gly Ile
Gly Gly Asn Asp Leu Gly Phe Ser Thr 165 170 175Val Leu Lys Thr Cys
Met Val Arg Val Pro Leu Leu Asp Ser Lys Ala 180 185 190Cys Thr Asp
Gln Glu Asp Ala Ile Arg Lys Arg Met Ala Lys Phe Glu 195 200 205Thr
Thr Phe Glu Glu Leu Ile Ser Glu Val Arg Thr Arg Ala Pro Asp 210 215
220Ala Arg Ile Leu Val Val Gly Tyr Pro Arg Ile Phe Pro Glu Glu
Pro225 230 235 240Thr Gly Ala Tyr Tyr Thr Leu Thr Ala Ser Asn Gln
Arg Trp Leu
Asn 245 250 255Glu Thr Ile Gln Glu Phe Asn Gln Gln Leu Ala Glu Ala
Val Ala Val 260 265 270His Asp Glu Glu Ile Ala Ala Ser Gly Gly Val
Gly Ser Val Glu Phe 275 280 285Val Asp Val Tyr His Ala Leu Asp Gly
His Glu Ile Gly Ser Asp Glu 290 295 300Pro Trp Val Asn Gly Val Gln
Leu Arg Asp Leu Ala Thr Gly Val Thr305 310 315 320Val Asp Arg Ser
Thr Phe His Pro Asn Ala Ala Gly His Arg Ala Val 325 330 335Gly Glu
Arg Val Ile Glu Gln Ile Glu Thr Gly Pro Gly Arg Pro Leu 340 345
350Tyr Ala Thr Phe Ala Val Val Ala Gly Ala Thr Val Asp Thr Leu Ala
355 360 365Gly Glu Val Gly 37087968DNAThermobifida fusca
87ctgcagacac ccgccccgcc ttctcccgga tcgtcatgtt cggcgactcc ctcagcgaca
60ccggcaagat gtactccaag atgcgcggct acctgccgtc ctccccgccg tactacgagg
120gccgcttctc gaacggcccg gtctggctgg agcagctgac gaagcagttc
cccggcctga 180cgatcgccaa cgaggccgag gggggcgcga ccgcagtcgc
ctacaacaag atctcctgga 240acccgaagta ccaggtcatt aacaacctcg
actacgaggt cacccagttc ttgcagaagg 300actcgttcaa gcccgacgac
ctggtcatcc tgtgggtggg cgccaacgac tacctggcct 360acggttggaa
cacggagcag gacgccaagc gggtgcgcga cgccatctcg gacgcggcaa
420accgcatggt cctgaacggc gcgaagcaga tcctgctgtt caacctgccc
gacctgggcc 480agaacccgtc cgcccgctcc cagaaggtcg tcgaggccgt
ctcgcacgtg tccgcctacc 540acaacaagct gctcctcaac ctcgcccggc
agctcgcccc gacgggcatg gtcaagctgt 600tcgagatcga caagcagttc
gcggagatgc tgcgcgaccc ccagaacttc ggcctgagcg 660acgtggagaa
cccgtgctac gacggcggct acgtgtggaa gccgttcgcc acccggtccg
720tctcgaccga ccggcagctg tcggccttct cgccccagga gcgcctggcg
atcgctggca 780acccgctcct ggcacaggcg gtagcttcgc cgatggcccg
ccgctcggcc tcgcccctca 840actgcgaggg caagatgttc tgggaccagg
tccaccccac caccgtggtc cacgccgccc 900tctcggagcg cgccgccacc
ttcatcgaga cccagtacga gttcctcgcc cactagtcta 960gaggatcc
968881044DNAAeromonas salmonicida 88atgaaacaac aaaaacggct
ttacgcccga ttgctgacgc tgttatttgc gctcatcttc 60ttgctgcctc attctgcagc
ttcagcagca gatacaagac cggcgtttag ccggatcgtc 120atgtttggag
atagcctgag cgatacgggc aaaatgtata gcaaaatgag aggctatctt
180ccgtcaagcc cgccgtatta tgaaggccgc tttagcaatg gaccggtctg
gctggaacaa 240ctgacgaaac aatttccggg actgacgatc gctaatgaag
cagaaggagg agcaacagcg 300gtcgcctata acaaaatcag ctgggacccg
aaatatcagg tcatcaacaa cctggactat 360gaagtcacac agtttcttca
gaaagacagc tttaaaccgg atgatctggt catcctttgg 420gtcggcgcca
atgattatct ggcgtatggc tggaacacag aacaagatgc caaaagagtc
480agagatgcca tcagcgatgc cgctaataga atggtcctga acggcgccaa
acaaatcctg 540ctgtttaacc tgccggatct gggacaaaat ccgagcgcca
gaagccaaaa agtcgtcgaa 600gcagtcagcc atgtcagcgc ctatcataac
aaactgctgc tgaacctggc aagacaattg 660gcaccgacgg gaatggttaa
attgtttgaa attgacaaac agtttgccga aatgctgaga 720gatccgcaaa
attttggcct gagcgatgtc gaaaacccgt gctatgatgg cggatatgtc
780tggaaaccgt ttgccacaag aagcgtcagc acggatagac aactgtcagc
gtttagcccg 840caagaaagac tggcaatcgc cggaaatccg cttttggcac
aagcagttgc ttcaccgatg 900gcaagaagat cagcaagccc gctgaattgc
gaaggcaaaa tgttttggga tcaggtccat 960ccgacaacag ttgtccatgc
tgccctttca gaaagagcgg cgacgtttat cgaaacacag 1020tatgaatttc
tggcccatgg ctga 104489267PRTStreptomyces sp. 89Met Arg Leu Thr Arg
Ser Leu Ser Ala Ala Ser Val Ile Val Phe Ala 1 5 10 15Leu Leu Leu
Ala Leu Leu Gly Ile Ser Pro Ala Gln Ala Ala Gly Pro 20 25 30Ala Tyr
Val Ala Leu Gly Asp Ser Tyr Ser Ser Gly Asn Gly Ala Gly 35 40 45Ser
Tyr Ile Asp Ser Ser Gly Asp Cys His Arg Ser Asn Asn Ala Tyr 50 55
60Pro Ala Arg Trp Ala Ala Ala Asn Ala Pro Ser Ser Phe Thr Phe Ala
65 70 75 80Ala Cys Ser Gly Ala Val Thr Thr Asp Val Ile Asn Asn Gln
Leu Gly 85 90 95Ala Leu Asn Ala Ser Thr Gly Leu Val Ser Ile Thr Ile
Gly Gly Asn 100 105 110Asp Ala Gly Phe Ala Asp Ala Met Thr Thr Cys
Val Thr Ser Ser Asp 115 120 125Ser Thr Cys Leu Asn Arg Leu Ala Thr
Ala Thr Asn Tyr Ile Asn Thr 130 135 140Thr Leu Leu Ala Arg Leu Asp
Ala Val Tyr Ser Gln Ile Lys Ala Arg145 150 155 160Ala Pro Asn Ala
Arg Val Val Val Leu Gly Tyr Pro Arg Met Tyr Leu 165 170 175Ala Ser
Asn Pro Trp Tyr Cys Leu Gly Leu Ser Asn Thr Lys Arg Ala 180 185
190Ala Ile Asn Thr Thr Ala Asp Thr Leu Asn Ser Val Ile Ser Ser Arg
195 200 205Ala Thr Ala His Gly Phe Arg Phe Gly Asp Val Arg Pro Thr
Phe Asn 210 215 220Asn His Glu Leu Phe Phe Gly Asn Asp Trp Leu His
Ser Leu Thr Leu225 230 235 240Pro Val Trp Glu Ser Tyr His Pro Thr
Ser Thr Gly His Gln Ser Gly 245 250 255Tyr Leu Pro Val Leu Asn Ala
Asn Ser Ser Thr 260 26590285PRTAeromonas salmonicida 90Ala Asp Thr
Arg Pro Ala Phe Ser Arg Ile Val Met Phe Gly Asp Ser 1 5 10 15Leu
Ser Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr Leu Pro 20 25
30Ser Ser Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro Val Trp
35 40 45Leu Glu Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr Ile Ala Asn
Glu 50 55 60Ala Glu Gly Gly Ala Thr Ala Val Ala Tyr Asn Lys Ile Ser
Trp Asp 65 70 75 80Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu
Val Thr Gln Phe 85 90 95Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu
Val Ile Leu Trp Val 100 105 110Gly Ala Asn Asp Tyr Leu Ala Tyr Gly
Trp Asn Thr Glu Gln Asp Ala 115 120 125Lys Arg Val Arg Asp Ala Ile
Ser Asp Ala Ala Asn Arg Met Val Leu 130 135 140Asn Gly Ala Lys Gln
Ile Leu Leu Phe Asn Leu Pro Asp Leu Gly Gln145 150 155 160Asn Pro
Ser Ala Arg Ser Gln Lys Val Val Glu Ala Val Ser His Val 165 170
175Ser Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gln Leu Ala
180 185 190Pro Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe
Ala Glu 195 200 205Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp
Val Glu Asn Pro 210 215 220Cys Tyr Asp Gly Gly Tyr Val Trp Lys Pro
Phe Arg Ser Ala Ser Pro225 230 235 240Arg Ser Ala Ser Pro Leu Asn
Cys Glu Gly Lys Met Phe Trp Asp Gln 245 250 255Val His Pro Thr Thr
Val Val His Ala Ala Leu Ser Glu Arg Ala Ala 260 265 270Thr Phe Ile
Glu Thr Gln Tyr Glu Phe Leu Ala His Gly 275 280
28591295PRTAeromonas salmonicida 91Ile Val Met Phe Gly Asp Ser Leu
Ser Asp Thr Gly Lys Met Tyr Ser 1 5 10 15Lys Met Arg Gly Tyr Leu
Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg 20 25 30Phe Ser Asn Gly Pro
Val Trp Leu Glu Gln Leu Thr Lys Gln Phe Pro 35 40 45Gly Leu Thr Ile
Ala Asn Glu Ala Glu Gly Gly Ala Thr Ala Val Ala 50 55 60Tyr Asn Lys
Ile Ser Trp Asn Pro Lys Tyr Gln Val Tyr Asn Asn Leu 65 70 75 80Asp
Tyr Glu Val Thr Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp 85 90
95Asp Leu Val Ile Leu Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly
100 105 110Trp Asn Thr Glu Gln Asp Ala Lys Arg Val Arg Asp Ala Ile
Ser Asp 115 120 125Ala Ala Asn Arg Met Val Leu Asn Gly Ala Lys Gln
Ile Leu Leu Phe 130 135 140Asn Leu Pro Asp Leu Gly Gln Asn Pro Ser
Ala Arg Ser Gln Lys Val145 150 155 160Val Glu Ala Val Ser His Val
Ser Ala Tyr His Asn Lys Leu Leu Leu 165 170 175Asn Leu Ala Arg Gln
Leu Ala Pro Thr Gly Met Val Lys Leu Phe Glu 180 185 190Ile Asp Lys
Gln Phe Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly 195 200 205Leu
Ser Asp Val Glu Asn Pro Cys Tyr Asp Gly Gly Tyr Val Trp Lys 210 215
220Pro Phe Ala Thr Arg Ser Val Ser Thr Asp Arg Gln Leu Ser Ala
Phe225 230 235 240Ser Pro Gln Glu Arg Leu Ala Ile Ala Gly Asn Pro
Leu Leu Ala Gln 245 250 255Ala Val Ala Ser Pro Met Ala Arg Arg Ser
Ala Ser Pro Leu Asn Cys 260 265 270Glu Gly Lys Met Phe Trp Asp Gln
Val His Pro Thr Thr Val Val His 275 280 285Ala Ala Leu Ser Glu Arg
Ala 290 29592247PRTStreptomyces coelicolor 92Tyr Val Ala Leu Gly
Asp Ser Tyr Ser Ala Gly Ser Gly Val Leu Pro 1 5 10 15Val Asp Pro
Ala Asn Leu Leu Cys Leu Arg Ser Thr Ala Asn Tyr Pro 20 25 30His Val
Ile Ala Asp Thr Thr Gly Ala Arg Leu Thr Asp Val Thr Cys 35 40 45Gly
Ala Ala Gln Thr Ala Asp Phe Thr Arg Ala Gln Tyr Pro Gly Val 50 55
60Ala Pro Gln Leu Asp Ala Leu Gly Thr Gly Thr Asp Leu Val Thr Leu
65 70 75 80Thr Ile Gly Gly Asn Asp Asn Ser Thr Phe Ile Asn Ala Ile
Thr Ala 85 90 95Cys Gly Thr Ala Gly Val Leu Ser Gly Gly Lys Gly Ser
Pro Cys Lys 100 105 110Asp Arg His Gly Thr Ser Phe Asp Asp Glu Ile
Glu Ala Asn Thr Tyr 115 120 125Pro Ala Leu Lys Glu Ala Leu Leu Gly
Val Arg Ala Arg Ala Pro His 130 135 140Ala Arg Val Ala Ala Leu Gly
Tyr Pro Trp Ile Thr Pro Ala Thr Ala145 150 155 160Asp Pro Ser Cys
Phe Leu Lys Leu Pro Leu Ala Ala Gly Asp Val Pro 165 170 175Tyr Leu
Arg Ala Ile Gln Ala His Leu Asn Asp Ala Val Arg Arg Ala 180 185
190Ala Glu Glu Thr Gly Ala Thr Tyr Val Asp Phe Ser Gly Val Ser Asp
195 200 205Gly His Asp Ala Cys Glu Ala Pro Gly Thr Arg Trp Ile Glu
Pro Leu 210 215 220Leu Phe Gly His Ser Leu Val Pro Val His Pro Asn
Ala Leu Gly Glu225 230 235 240Arg Arg Met Ala Glu His Thr
24593247PRTStreptomyces coelicolor 93Tyr Val Ala Leu Gly Asp Ser
Tyr Ser Ala Gly Ser Gly Val Leu Pro 1 5 10 15Val Asp Pro Ala Asn
Leu Leu Cys Leu Arg Ser Thr Ala Asn Tyr Pro 20 25 30His Val Ile Ala
Asp Thr Thr Gly Ala Arg Leu Thr Asp Val Thr Cys 35 40 45Gly Ala Ala
Gln Thr Ala Asp Phe Thr Arg Ala Gln Tyr Pro Gly Val 50 55 60Ala Pro
Gln Leu Asp Ala Leu Gly Thr Gly Thr Asp Leu Val Thr Leu 65 70 75
80Thr Ile Gly Gly Asn Asp Asn Ser Thr Phe Ile Asn Ala Ile Thr Ala
85 90 95Cys Gly Thr Ala Gly Val Leu Ser Gly Gly Lys Gly Ser Pro Cys
Lys 100 105 110Asp Arg His Gly Thr Ser Phe Asp Asp Glu Ile Glu Ala
Asn Thr Tyr 115 120 125Pro Ala Leu Lys Glu Ala Leu Leu Gly Val Arg
Ala Arg Ala Pro His 130 135 140Ala Arg Val Ala Ala Leu Gly Tyr Pro
Trp Ile Thr Pro Ala Thr Ala145 150 155 160Asp Pro Ser Cys Phe Leu
Lys Leu Pro Leu Ala Ala Gly Asp Val Pro 165 170 175Tyr Leu Arg Ala
Ile Gln Ala His Leu Asn Asp Ala Val Arg Arg Ala 180 185 190Ala Glu
Glu Thr Gly Ala Thr Tyr Val Asp Phe Ser Gly Val Ser Asp 195 200
205Gly His Asp Ala Cys Glu Ala Pro Gly Thr Arg Trp Ile Glu Pro Leu
210 215 220Leu Phe Gly His Ser Leu Val Pro Val His Pro Asn Ala Leu
Gly Glu225 230 235 240Arg Arg Met Ala Glu His Thr
24594198PRTSaccharomyces cerevisiae 94Phe Leu Leu Phe Gly Asp Ser
Ile Thr Glu Phe Ala Phe Asn Thr Arg 1 5 10 15Pro Ile Glu Asp Gly
Lys Asp Gln Tyr Ala Leu Gly Ala Ala Leu Val 20 25 30Asn Glu Tyr Thr
Arg Lys Met Asp Ile Leu Gln Arg Gly Phe Lys Gly 35 40 45Tyr Thr Ser
Arg Trp Ala Leu Lys Ile Leu Pro Glu Ile Leu Lys His 50 55 60Glu Ser
Asn Ile Val Met Ala Thr Ile Phe Leu Gly Ala Asn Asp Ala 65 70 75
80Cys Ser Ala Gly Pro Gln Ser Val Pro Leu Pro Glu Phe Ile Asp Asn
85 90 95Ile Arg Gln Met Val Ser Leu Met Lys Ser Tyr His Ile Arg Pro
Ile 100 105 110Ile Ile Gly Pro Gly Leu Val Asp Arg Glu Lys Trp Glu
Lys Glu Lys 115 120 125Ser Glu Glu Ile Ala Leu Gly Tyr Phe Arg Thr
Asn Glu Asn Phe Ala 130 135 140Ile Tyr Ser Asp Ala Leu Ala Lys Leu
Ala Asn Glu Glu Lys Val Pro145 150 155 160Phe Val Ala Leu Asn Lys
Ala Phe Gln Gln Glu Gly Gly Asp Ala Trp 165 170 175Gln Gln Leu Leu
Thr Asp Gly Leu His Phe Ser Gly Lys Gly Tyr Lys 180 185 190Ile Phe
His Asp Glu Leu 19595317PRTAeromonas salmonicida 95Ala Asp Thr Arg
Pro Ala Phe Ser Arg Ile Val Met Phe Gly Asp Ser 1 5 10 15Leu Ser
Asp Thr Gly Lys Met Tyr Ser Lys Met Arg Gly Tyr Leu Pro 20 25 30Ser
Ser Pro Pro Tyr Tyr Glu Gly Arg Phe Ser Asn Gly Pro Val Trp 35 40
45Leu Glu Gln Leu Thr Lys Gln Phe Pro Gly Leu Thr Ile Ala Asn Glu
50 55 60Ala Glu Gly Gly Ala Thr Ala Val Ala Tyr Asn Lys Ile Ser Trp
Asn 65 70 75 80Pro Lys Tyr Gln Val Ile Asn Asn Leu Asp Tyr Glu Val
Thr Gln Phe 85 90 95Leu Gln Lys Asp Ser Phe Lys Pro Asp Asp Leu Val
Ile Leu Trp Val 100 105 110Gly Ala Asn Asp Tyr Leu Ala Tyr Gly Trp
Asn Thr Glu Gln Asp Ala 115 120 125Lys Arg Val Arg Asp Ala Ile Ser
Asp Ala Ala Asn Arg Met Val Leu 130 135 140Asn Gly Ala Lys Gln Ile
Leu Leu Phe Asn Leu Pro Asp Leu Gly Gln145 150 155 160Asn Pro Ser
Ala Arg Ser Gln Lys Val Val Glu Ala Val Ser His Val 165 170 175Ser
Ala Tyr His Asn Lys Leu Leu Leu Asn Leu Ala Arg Gln Leu Ala 180 185
190Pro Thr Gly Met Val Lys Leu Phe Glu Ile Asp Lys Gln Phe Ala Glu
195 200 205Met Leu Arg Asp Pro Gln Asn Phe Gly Leu Ser Asp Val Glu
Asn Pro 210 215 220Cys Tyr Asp Gly Gly Tyr Val Trp Lys Pro Phe Ala
Thr Arg Ser Val225 230 235 240Ser Thr Asp Arg Gln Leu Ser Ala Phe
Ser Pro Gln Glu Arg Leu Ala 245 250 255Ile Ala Gly Asn Pro Leu Leu
Ala Gln Ala Val Ala Ser Pro Met Ala 260 265 270Arg Arg Ser Ala Ser
Pro Leu Asn Cys Glu Gly Lys Met Phe Trp Asp 275 280 285Gln Val His
Pro Thr Thr Val Val His Ala Ala Leu Ser Glu Arg Ala 290 295 300Ala
Thr Phe Ile Glu Thr Gln Tyr Glu Phe Leu Ala His305 310
31596320PRTRalstonia solanacearum 96Gln Ser Gly Asn Pro Asn Val Ala
Lys Val Gln Arg Met Val Val Phe 1 5 10 15Gly Asp Ser Leu Ser Asp
Ile Gly Thr Tyr Thr Pro Val Ala Gln Ala 20 25 30Val Gly Gly Gly Lys
Phe Thr Thr Asn Pro Gly Pro Ile Trp Ala Glu 35 40 45Thr Val Ala Ala
Gln Leu Gly Val Thr Leu Thr Pro Ala Val Met Gly 50 55 60Tyr Ala Thr
Ser Val Gln Asn Cys Pro Lys Ala Gly Cys Phe Asp Tyr 65 70 75 80Ala
Gln Gly Gly Ser Arg Val Thr Asp Pro Asn Gly Ile Gly His Asn 85 90
95Gly Gly Ala Gly Ala Leu Thr Tyr Pro Val Gln Gln Gln Leu Ala Asn
100 105
110Phe Tyr Ala Ala Ser Asn Asn Thr Phe Asn Gly Asn Asn Asp Val Val
115 120 125Phe Val Leu Ala Gly Ser Asn Asp Ile Phe Phe Trp Thr Thr
Ala Ala 130 135 140Ala Thr Ser Gly Ser Gly Val Thr Pro Ala Ile Ala
Thr Ala Gln Val145 150 155 160Gln Gln Ala Ala Thr Asp Leu Val Gly
Tyr Val Lys Asp Met Ile Ala 165 170 175Lys Gly Ala Thr Gln Val Tyr
Val Phe Asn Leu Pro Asp Ser Ser Leu 180 185 190Thr Pro Asp Gly Val
Ala Ser Gly Thr Thr Gly Gln Ala Leu Leu His 195 200 205Ala Leu Val
Gly Thr Phe Asn Thr Thr Leu Gln Ser Gly Leu Ala Gly 210 215 220Thr
Ser Ala Arg Ile Ile Asp Phe Asn Ala Gln Leu Thr Ala Ala Ile225 230
235 240Gln Asn Gly Ala Ser Phe Gly Phe Ala Asn Thr Ser Ala Arg Ala
Cys 245 250 255Asp Ala Thr Lys Ile Asn Ala Leu Val Pro Ser Ala Gly
Gly Ser Ser 260 265 270Leu Phe Cys Ser Ala Asn Thr Leu Val Ala Ser
Gly Ala Asp Gln Ser 275 280 285Tyr Leu Phe Ala Asp Gly Val His Pro
Thr Thr Ala Gly His Arg Leu 290 295 300Ile Ala Ser Asn Val Leu Ala
Arg Leu Leu Ala Asp Asn Val Ala His305 310 315
32097367PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Pfam00657.11 consensus sequence 97Ile Val Ala Phe Gly Asp
Ser Leu Thr Asp Gly Gly Gly Ala Tyr Tyr 1 5 10 15Gly Asp Ser Asp
Gly Gly Gly Trp Gly Ala Gly Leu Ala Asp Arg Leu 20 25 30Thr Ser Leu
Ala Arg Leu Arg Ala Arg Gly Arg Gly Val Asp Val Phe 35 40 45Asn Arg
Gly Ile Ser Gly Arg Thr Ser Asp Gly Arg Leu Val Val Asp 50 55 60Ala
Arg Leu Val Ala Thr Leu Leu Phe Leu Ala Gln Phe Leu Gly Leu 65 70
75 80Asn Leu Pro Pro Tyr Leu Ser Gly Asp Phe Leu Arg Gly Ala Asn
Phe 85 90 95Ala Ser Ala Gly Ala Thr Ile Leu Gly Thr Ser Leu Ile Pro
Phe Leu 100 105 110Asn Ile Gln Val Gln Phe Lys Asp Phe Lys Ser Lys
Val Leu Glu Leu 115 120 125Arg Gln Ala Leu Gly Leu Leu Gln Glu Leu
Leu Arg Leu Val Pro Val 130 135 140Leu Asp Ala Lys Ser Pro Asp Leu
Val Thr Ile Met Ile Gly Thr Asn145 150 155 160Asp Leu Ile Thr Val
Ala Lys Phe Gly Pro Lys Ser Thr Lys Ser Asp 165 170 175Arg Asn Val
Ser Val Pro Glu Phe Arg Asp Asn Leu Arg Lys Leu Ile 180 185 190Lys
Arg Leu Arg Ser Ala Asn Gly Ala Arg Ile Ile Ile Leu Ile Thr 195 200
205Leu Val Leu Leu Asn Leu Pro Leu Pro Leu Gly Cys Leu Pro Gln Lys
210 215 220Leu Ala Leu Ala Leu Ala Ser Ser Lys Asn Val Asp Ala Thr
Gly Cys225 230 235 240Leu Glu Arg Leu Asn Glu Ala Val Ala Asp Tyr
Asn Glu Ala Leu Arg 245 250 255Glu Leu Ala Glu Ile Glu Lys Leu Gln
Ala Gln Leu Arg Lys Asp Gly 260 265 270Leu Pro Asp Leu Lys Glu Ala
Asn Val Pro Tyr Val Asp Leu Tyr Ser 275 280 285Ile Phe Gln Asp Leu
Asp Gly Ile Gln Asn Pro Ser Ala Tyr Val Tyr 290 295 300Gly Phe Glu
Glu Thr Lys Ala Cys Cys Gly Tyr Gly Gly Arg Tyr Asn305 310 315
320Tyr Asn Arg Val Cys Gly Asn Ala Gly Leu Cys Lys Val Thr Ala Lys
325 330 335Ala Cys Asp Ala Ser Ser Tyr Leu Leu Ala Thr Leu Phe Trp
Asp Gly 340 345 350Phe His Pro Ser Glu Lys Gly Tyr Lys Ala Val Ala
Glu Ala Leu 355 360 36598367PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Pfam00657.11 consensus sequence 98Ile
Val Ala Phe Gly Asp Ser Leu Thr Asp Gly Gly Gly Ala Tyr Tyr 1 5 10
15Gly Asp Ser Asp Gly Gly Gly Trp Gly Ala Gly Leu Ala Asp Arg Leu
20 25 30Thr Ser Leu Ala Arg Leu Arg Ala Arg Gly Arg Gly Val Asp Val
Phe 35 40 45Asn Arg Gly Ile Ser Gly Arg Thr Ser Asp Gly Arg Leu Val
Val Asp 50 55 60Ala Arg Leu Val Ala Thr Leu Leu Phe Leu Ala Gln Phe
Leu Gly Leu 65 70 75 80Asn Leu Pro Pro Tyr Leu Ser Gly Asp Phe Leu
Arg Gly Ala Asn Phe 85 90 95Ala Ser Ala Gly Ala Thr Ile Leu Gly Thr
Ser Leu Ile Pro Phe Leu 100 105 110Asn Ile Gln Val Gln Phe Lys Asp
Phe Lys Ser Lys Val Leu Glu Leu 115 120 125Arg Gln Ala Leu Gly Leu
Leu Gln Glu Leu Leu Arg Leu Val Pro Val 130 135 140Leu Asp Ala Lys
Ser Pro Asp Leu Val Thr Ile Met Ile Gly Thr Asn145 150 155 160Asp
Leu Ile Thr Val Ala Lys Phe Gly Pro Lys Ser Thr Lys Ser Asp 165 170
175Arg Asn Val Ser Val Pro Glu Phe Arg Asp Asn Leu Arg Lys Leu Ile
180 185 190Lys Arg Leu Arg Ser Ala Asn Gly Ala Arg Ile Ile Ile Leu
Ile Thr 195 200 205Leu Val Leu Leu Asn Leu Pro Leu Pro Leu Gly Cys
Leu Pro Gln Lys 210 215 220Leu Ala Leu Ala Leu Ala Ser Ser Lys Asn
Val Asp Ala Thr Gly Cys225 230 235 240Leu Glu Arg Leu Asn Glu Ala
Val Ala Asp Tyr Asn Glu Ala Leu Arg 245 250 255Glu Leu Ala Glu Ile
Glu Lys Leu Gln Ala Gln Leu Arg Lys Asp Gly 260 265 270Leu Pro Asp
Leu Lys Glu Ala Asn Val Pro Tyr Val Asp Leu Tyr Ser 275 280 285Ile
Phe Gln Asp Leu Asp Gly Ile Gln Asn Pro Ser Ala Tyr Val Tyr 290 295
300Gly Phe Glu Glu Thr Lys Ala Cys Cys Gly Tyr Gly Gly Arg Tyr
Asn305 310 315 320Tyr Asn Arg Val Cys Gly Asn Ala Gly Leu Cys Lys
Val Thr Ala Lys 325 330 335Ala Cys Asp Ala Ser Ser Tyr Leu Leu Ala
Thr Leu Phe Trp Asp Gly 340 345 350Phe His Pro Ser Glu Lys Gly Tyr
Lys Ala Val Ala Glu Ala Leu 355 360 36599267PRTStreptomyces
thermosacchari 99Met Arg Leu Thr Arg Ser Leu Ser Ala Ala Ser Val
Ile Val Phe Ala 1 5 10 15Leu Leu Leu Ala Leu Leu Gly Ile Ser Pro
Ala Gln Ala Ala Gly Pro 20 25 30Ala Tyr Val Ala Leu Gly Asp Ser Tyr
Ser Ser Gly Asn Gly Ala Gly 35 40 45Ser Tyr Ile Asp Ser Ser Gly Asp
Cys His Arg Ser Asn Asn Ala Tyr 50 55 60Pro Ala Arg Trp Ala Ala Ala
Asn Ala Pro Ser Ser Phe Thr Phe Ala 65 70 75 80Ala Cys Ser Gly Ala
Val Thr Thr Asp Val Ile Asn Asn Gln Leu Gly 85 90 95Ala Leu Asn Ala
Ser Thr Gly Leu Val Ser Ile Thr Ile Gly Gly Asn 100 105 110Asp Ala
Gly Phe Ala Asp Ala Met Thr Thr Cys Val Thr Ser Ser Asp 115 120
125Ser Thr Cys Leu Asn Arg Leu Ala Thr Ala Thr Asn Tyr Ile Asn Thr
130 135 140Thr Leu Leu Ala Arg Leu Asp Ala Val Tyr Ser Gln Ile Lys
Ala Arg145 150 155 160Ala Pro Asn Ala Arg Val Val Val Leu Gly Tyr
Pro Arg Met Tyr Leu 165 170 175Ala Ser Asn Pro Trp Tyr Cys Leu Gly
Leu Ser Asn Thr Lys Arg Ala 180 185 190Ala Ile Asn Thr Thr Ala Asp
Thr Leu Asn Ser Val Ile Ser Ser Arg 195 200 205Ala Thr Ala His Gly
Phe Arg Phe Gly Asp Val Arg Pro Thr Phe Asn 210 215 220Asn His Glu
Leu Phe Phe Gly Asn Asp Trp Leu His Ser Leu Thr Leu225 230 235
240Pro Val Trp Glu Ser Tyr His Pro Thr Ser Thr Gly His Gln Ser Gly
245 250 255Tyr Leu Pro Val Leu Asn Ala Asn Ser Ser Thr 260
265100269PRTStreptomyces avermitilis 100Met Arg Arg Ser Arg Ile Thr
Ala Tyr Val Thr Ser Leu Leu Leu Ala 1 5 10 15Val Gly Cys Ala Leu
Thr Gly Ala Ala Thr Ala Gln Ala Ser Pro Ala 20 25 30Ala Ala Ala Thr
Gly Tyr Val Ala Leu Gly Asp Ser Tyr Ser Ser Gly 35 40 45Val Gly Ala
Gly Ser Tyr Leu Ser Ser Ser Gly Asp Cys Lys Arg Ser 50 55 60Ser Lys
Ala Tyr Pro Tyr Leu Trp Gln Ala Ala His Ser Pro Ser Ser 65 70 75
80Phe Ser Phe Met Ala Cys Ser Gly Ala Arg Thr Gly Asp Val Leu Ala
85 90 95Asn Gln Leu Gly Thr Leu Asn Ser Ser Thr Gly Leu Val Ser Leu
Thr 100 105 110Ile Gly Gly Asn Asp Ala Gly Phe Ser Asp Val Met Thr
Thr Cys Val 115 120 125Leu Gln Ser Asp Ser Ala Cys Leu Ser Arg Ile
Asn Thr Ala Lys Ala 130 135 140Tyr Val Asp Ser Thr Leu Pro Gly Gln
Leu Asp Ser Val Tyr Thr Ala145 150 155 160Ile Ser Thr Lys Ala Pro
Ser Ala His Val Ala Val Leu Gly Tyr Pro 165 170 175Arg Phe Tyr Lys
Leu Gly Gly Ser Cys Leu Ala Gly Leu Ser Glu Thr 180 185 190Lys Arg
Ser Ala Ile Asn Asp Ala Ala Asp Tyr Leu Asn Ser Ala Ile 195 200
205Ala Lys Arg Ala Ala Asp His Gly Phe Thr Phe Gly Asp Val Lys Ser
210 215 220Thr Phe Thr Gly His Glu Ile Cys Ser Ser Ser Thr Trp Leu
His Ser225 230 235 240Leu Asp Leu Leu Asn Ile Gly Gln Ser Tyr His
Pro Thr Ala Ala Gly 245 250 255Gln Ser Gly Gly Tyr Leu Pro Val Met
Asn Ser Val Ala 260 265101372PRTThermobifida fusca 101Val Gly Ser
Gly Pro Arg Ala Ala Thr Arg Arg Arg Leu Phe Leu Gly 1 5 10 15Ile
Pro Ala Leu Val Leu Val Thr Ala Leu Thr Leu Val Leu Ala Val 20 25
30Pro Thr Gly Arg Glu Thr Leu Trp Arg Met Trp Cys Glu Ala Thr Gln
35 40 45Asp Trp Cys Leu Gly Val Pro Val Asp Ser Arg Gly Gln Pro Ala
Glu 50 55 60Asp Gly Glu Phe Leu Leu Leu Ser Pro Val Gln Ala Ala Thr
Trp Gly 65 70 75 80Asn Tyr Tyr Ala Leu Gly Asp Ser Tyr Ser Ser Gly
Asp Gly Ala Arg 85 90 95Asp Tyr Tyr Pro Gly Thr Ala Val Lys Gly Gly
Cys Trp Arg Ser Ala 100 105 110Asn Ala Tyr Pro Glu Leu Val Ala Glu
Ala Tyr Asp Phe Ala Gly His 115 120 125Leu Ser Phe Leu Ala Cys Ser
Gly Gln Arg Gly Tyr Ala Met Leu Asp 130 135 140Ala Ile Asp Glu Val
Gly Ser Gln Leu Asp Trp Asn Ser Pro His Thr145 150 155 160Ser Leu
Val Thr Ile Gly Ile Gly Gly Asn Asp Leu Gly Phe Ser Thr 165 170
175Val Leu Lys Thr Cys Met Val Arg Val Pro Leu Leu Asp Ser Lys Ala
180 185 190Cys Thr Asp Gln Glu Asp Ala Ile Arg Lys Arg Met Ala Lys
Phe Glu 195 200 205Thr Thr Phe Glu Glu Leu Ile Ser Glu Val Arg Thr
Arg Ala Pro Asp 210 215 220Ala Arg Ile Leu Val Val Gly Tyr Pro Arg
Ile Phe Pro Glu Glu Pro225 230 235 240Thr Gly Ala Tyr Tyr Thr Leu
Thr Ala Ser Asn Gln Arg Trp Leu Asn 245 250 255Glu Thr Ile Gln Glu
Phe Asn Gln Gln Leu Ala Glu Ala Val Ala Val 260 265 270His Asp Glu
Glu Ile Ala Ala Ser Gly Gly Val Gly Ser Val Glu Phe 275 280 285Val
Asp Val Tyr His Ala Leu Asp Gly His Glu Ile Gly Ser Asp Glu 290 295
300Pro Trp Val Asn Gly Val Gln Leu Arg Asp Leu Ala Thr Gly Val
Thr305 310 315 320Val Asp Arg Ser Thr Phe His Pro Asn Ala Ala Gly
His Arg Ala Val 325 330 335Gly Glu Arg Val Ile Glu Gln Ile Glu Thr
Gly Pro Gly Arg Pro Leu 340 345 350Tyr Ala Thr Phe Ala Val Val Ala
Gly Ala Thr Val Asp Thr Leu Ala 355 360 365Gly Glu Val Gly
370102230PRTAspergillus aculeatus 102Thr Thr Val Tyr Leu Ala Gly
Asp Ser Thr Met Ala Lys Asn Gly Gly 1 5 10 15Gly Ser Gly Thr Asn
Gly Trp Gly Glu Tyr Leu Ala Ser Tyr Leu Ser 20 25 30Ala Thr Val Val
Asn Asp Ala Val Ala Gly Arg Ser Ala Arg Ser Tyr 35 40 45Thr Arg Glu
Gly Arg Phe Glu Asn Ile Ala Asp Val Val Thr Ala Gly 50 55 60Asp Tyr
Val Ile Val Glu Phe Gly His Asn Asp Gly Gly Ser Leu Ser 65 70 75
80Thr Asp Asn Gly Arg Thr Asp Cys Ser Gly Thr Gly Ala Glu Val Cys
85 90 95Tyr Ser Val Tyr Asp Gly Val Asn Glu Thr Ile Leu Thr Phe Pro
Ala 100 105 110Tyr Leu Glu Asn Ala Ala Lys Leu Phe Thr Ala Lys Gly
Ala Lys Val 115 120 125Ile Leu Ser Ser Gln Thr Pro Asn Asn Pro Trp
Glu Thr Gly Thr Phe 130 135 140Val Asn Ser Pro Thr Arg Phe Val Glu
Tyr Ala Glu Leu Ala Ala Glu145 150 155 160Val Ala Gly Val Glu Tyr
Val Asp His Trp Ser Tyr Val Asp Ser Ile 165 170 175Tyr Glu Thr Leu
Gly Asn Ala Thr Val Asn Ser Tyr Phe Pro Ile Asp 180 185 190His Thr
His Thr Ser Pro Ala Gly Ala Glu Val Val Ala Glu Ala Phe 195 200
205Leu Lys Ala Val Val Cys Thr Gly Thr Ser Leu Lys Ser Val Leu Thr
210 215 220Thr Thr Ser Phe Glu Gly225 230103184PRTEscherichia coli
103Ala Asp Thr Leu Leu Ile Leu Gly Asp Ser Leu Ser Ala Gly Tyr Arg
1 5 10 15Met Ser Ala Ser Ala Ala Trp Pro Ala Leu Leu Asn Asp Lys
Trp Gln 20 25 30Ser Lys Thr Ser Val Val Asn Ala Ser Ile Ser Gly Asp
Thr Ser Gln 35 40 45Gln Gly Leu Ala Arg Leu Pro Ala Leu Leu Lys Gln
His Gln Pro Arg 50 55 60Trp Val Leu Val Glu Leu Gly Gly Asn Asp Gly
Leu Arg Gly Phe Gln 65 70 75 80Pro Gln Gln Thr Glu Gln Thr Leu Arg
Gln Ile Leu Gln Asp Val Lys 85 90 95Ala Ala Asn Ala Glu Pro Leu Leu
Met Gln Ile Arg Leu Pro Ala Asn 100 105 110Tyr Gly Arg Arg Tyr Asn
Glu Ala Phe Ser Ala Ile Tyr Pro Lys Leu 115 120 125Ala Lys Glu Phe
Asp Val Pro Leu Leu Pro Phe Phe Met Glu Glu Val 130 135 140Tyr Leu
Lys Pro Gln Trp Met Gln Asp Asp Gly Ile His Pro Asn Arg145 150 155
160Asp Ala Gln Pro Phe Ile Ala Asp Trp Met Ala Lys Gln Leu Gln Pro
165 170 175Leu Val Asn His Asp Ser Leu Glu 180104308PRTAeromonas
hydrophila 104Ile Val Met Phe Gly Asp Ser Leu Ser Asp Thr Gly Lys
Met Tyr Ser 1 5 10 15Lys Met Arg Gly Tyr Leu Pro Ser Ser Pro Pro
Tyr Tyr Glu Gly Arg 20 25 30Phe Ser Asn Gly Pro Val Trp Leu Glu Gln
Leu Thr Asn Glu Phe Pro 35 40 45Gly Leu Thr Ile Ala Asn Glu Ala Glu
Gly Gly Pro Thr Ala Val Ala 50 55 60Tyr Asn Lys Ile Ser Trp Asn Pro
Lys Tyr Gln Val Ile Asn Asn Leu 65 70 75 80Asp Tyr Glu Val Thr Gln
Phe Leu Gln Lys Asp Ser Phe Lys Pro Asp 85 90 95Asp Leu Val Ile Leu
Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr Gly 100 105 110Trp Asn Thr
Glu Gln Asp Ala Lys Arg Val Arg Asp Ala Ile Ser Asp 115 120 125Ala
Ala Asn Arg Met Val Leu Asn Gly Ala Lys Glu Ile Leu Leu Phe 130 135
140Asn Leu Pro Asp Leu Gly Gln Asn Pro Ser Ala Arg Ser Gln Lys
Val145
150 155 160Val Glu Ala Ala Ser His Val Ser Ala Tyr His Asn Gln Leu
Leu Leu 165 170 175Asn Leu Ala Arg Gln Leu Ala Pro Thr Gly Met Val
Lys Leu Phe Glu 180 185 190Ile Asp Lys Gln Phe Ala Glu Met Leu Arg
Asp Pro Gln Asn Phe Gly 195 200 205Leu Ser Asp Gln Arg Asn Ala Cys
Tyr Gly Gly Ser Tyr Val Trp Lys 210 215 220Pro Phe Ala Ser Arg Ser
Ala Ser Thr Asp Ser Gln Leu Ser Ala Phe225 230 235 240Asn Pro Gln
Glu Arg Leu Ala Ile Ala Gly Asn Pro Leu Leu Ala Gln 245 250 255Ala
Val Ala Ser Pro Met Ala Ala Arg Ser Ala Ser Thr Leu Asn Cys 260 265
270Glu Gly Lys Met Phe Trp Asp Gln Val His Pro Thr Thr Val Val His
275 280 285Ala Ala Leu Ser Glu Pro Ala Ala Thr Phe Ile Glu Ser Gln
Tyr Glu 290 295 300Phe Leu Ala His305105232PRTAspergillus aculeatus
105Thr Thr Val Tyr Leu Ala Gly Asp Ser Thr Met Ala Lys Asn Gly Gly
1 5 10 15Gly Ser Gly Thr Asn Gly Trp Gly Glu Tyr Leu Ala Ser Tyr
Leu Ser 20 25 30Ala Thr Val Val Asn Asp Ala Val Ala Gly Arg Ser Ala
Arg Ser Tyr 35 40 45Thr Arg Glu Gly Arg Phe Glu Asn Ile Ala Asp Val
Val Thr Ala Gly 50 55 60Asp Tyr Val Ile Val Glu Phe Gly His Asn Asp
Gly Gly Ser Leu Ser 65 70 75 80Thr Asp Asn Gly Arg Thr Asp Cys Ser
Gly Thr Gly Ala Glu Val Cys 85 90 95Tyr Ser Val Tyr Asp Gly Val Asn
Glu Thr Ile Leu Thr Phe Pro Ala 100 105 110Tyr Leu Glu Asn Ala Ala
Lys Leu Phe Thr Ala Lys Gly Ala Lys Val 115 120 125Ile Leu Ser Ser
Gln Thr Pro Asn Asn Pro Trp Glu Thr Gly Thr Phe 130 135 140Val Asn
Ser Pro Thr Arg Phe Val Glu Tyr Ala Glu Leu Ala Ala Glu145 150 155
160Val Ala Gly Val Glu Tyr Val Asp His Trp Ser Tyr Val Asp Ser Ile
165 170 175Tyr Glu Thr Leu Gly Asn Ala Thr Val Asn Ser Tyr Phe Pro
Ile Asp 180 185 190His Thr His Thr Ser Pro Ala Gly Ala Glu Val Val
Ala Glu Ala Phe 195 200 205Leu Lys Ala Val Val Cys Thr Gly Thr Ser
Leu Lys Ser Val Leu Thr 210 215 220Thr Thr Ser Phe Glu Gly Thr
Cys225 230106184PRTEscherichia coli 106Ala Asp Thr Leu Leu Ile Leu
Gly Asp Ser Leu Ser Ala Gly Tyr Arg 1 5 10 15Met Ser Ala Ser Ala
Ala Trp Pro Ala Leu Leu Asn Asp Lys Trp Gln 20 25 30Ser Lys Thr Ser
Val Val Asn Ala Ser Ile Ser Gly Asp Thr Ser Gln 35 40 45Gln Gly Leu
Ala Arg Leu Pro Ala Leu Leu Lys Gln His Gln Pro Arg 50 55 60Trp Val
Leu Val Glu Leu Gly Gly Asn Asp Gly Leu Arg Gly Phe Gln 65 70 75
80Pro Gln Gln Thr Glu Gln Thr Leu Arg Gln Ile Leu Gln Asp Val Lys
85 90 95Ala Ala Asn Ala Glu Pro Leu Leu Met Gln Ile Arg Leu Pro Ala
Asn 100 105 110Tyr Gly Arg Arg Tyr Asn Glu Ala Phe Ser Ala Ile Tyr
Pro Lys Leu 115 120 125Ala Lys Glu Phe Asp Val Pro Leu Leu Pro Phe
Phe Met Glu Glu Val 130 135 140Tyr Leu Lys Pro Gln Trp Met Gln Asp
Asp Gly Ile His Pro Asn Arg145 150 155 160Asp Ala Gln Pro Phe Ile
Ala Asp Trp Met Ala Lys Gln Leu Gln Pro 165 170 175Leu Val Asn His
Asp Ser Leu Glu 180107308PRTAeromonas hydrophila 107Ile Val Met Phe
Gly Asp Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser 1 5 10 15Lys Met
Arg Gly Tyr Leu Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg 20 25 30Phe
Ser Asn Gly Pro Val Trp Leu Glu Gln Leu Thr Asn Glu Phe Pro 35 40
45Gly Leu Thr Ile Ala Asn Glu Ala Glu Gly Gly Pro Thr Ala Val Ala
50 55 60Tyr Asn Lys Ile Ser Trp Asn Pro Lys Tyr Gln Val Ile Asn Asn
Leu 65 70 75 80Asp Tyr Glu Val Thr Gln Phe Leu Gln Lys Asp Ser Phe
Lys Pro Asp 85 90 95Asp Leu Val Ile Leu Trp Val Gly Ala Asn Asp Tyr
Leu Ala Tyr Gly 100 105 110Trp Asn Thr Glu Gln Asp Ala Lys Arg Val
Arg Asp Ala Ile Ser Asp 115 120 125Ala Ala Asn Arg Met Val Leu Asn
Gly Ala Lys Glu Ile Leu Leu Phe 130 135 140Asn Leu Pro Asp Leu Gly
Gln Asn Pro Ser Ala Arg Ser Gln Lys Val145 150 155 160Val Glu Ala
Ala Ser His Val Ser Ala Tyr His Asn Gln Leu Leu Leu 165 170 175Asn
Leu Ala Arg Gln Leu Ala Pro Thr Gly Met Val Lys Leu Phe Glu 180 185
190Ile Asp Lys Gln Phe Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly
195 200 205Leu Ser Asp Gln Arg Asn Ala Cys Tyr Gly Gly Ser Tyr Val
Trp Lys 210 215 220Pro Phe Ala Ser Arg Ser Ala Ser Thr Asp Ser Gln
Leu Ser Ala Phe225 230 235 240Asn Pro Gln Glu Arg Leu Ala Ile Ala
Gly Asn Pro Leu Leu Ala Gln 245 250 255Ala Val Ala Ser Pro Met Ala
Ala Arg Ser Ala Ser Thr Leu Asn Cys 260 265 270Glu Gly Lys Met Phe
Trp Asp Gln Val His Pro Thr Thr Val Val His 275 280 285Ala Ala Leu
Ser Glu Pro Ala Ala Thr Phe Ile Glu Ser Gln Tyr Glu 290 295 300Phe
Leu Ala His305108167PRTEscherichia coli 108Leu Leu Ile Leu Gly Asp
Ser Leu Ser Ala Gly Tyr Arg Met Ser Ala 1 5 10 15Ser Ala Ala Trp
Pro Ala Leu Leu Asn Asp Lys Trp Gln Ser Lys Thr 20 25 30Ser Val Val
Asn Ala Ser Ile Ser Gly Asp Thr Ser Gln Gln Gly Leu 35 40 45Ala Arg
Leu Pro Ala Leu Leu Lys Gln His Gln Pro Arg Trp Val Leu 50 55 60Val
Glu Leu Gly Gly Asn Asp Gly Leu Arg Gly Phe Gln Pro Gln Gln 65 70
75 80Thr Glu Gln Thr Leu Arg Gln Ile Leu Gln Asp Val Lys Ala Ala
Asn 85 90 95Ala Glu Pro Leu Leu Met Gln Ile Arg Leu Pro Ala Asn Tyr
Gly Arg 100 105 110Arg Tyr Asn Glu Ala Phe Ser Ala Ile Tyr Pro Lys
Leu Ala Lys Glu 115 120 125Phe Asp Val Pro Leu Leu Pro Phe Phe Met
Glu Glu Val Tyr Leu Lys 130 135 140Pro Gln Trp Met Gln Asp Asp Gly
Ile His Pro Asn Arg Asp Ala Gln145 150 155 160Pro Phe Ile Ala Asp
Trp Met 165109295PRTAeromonas hydrophila 109Ile Val Met Phe Gly Asp
Ser Leu Ser Asp Thr Gly Lys Met Tyr Ser 1 5 10 15Lys Met Arg Gly
Tyr Leu Pro Ser Ser Pro Pro Tyr Tyr Glu Gly Arg 20 25 30Phe Ser Asn
Gly Pro Val Trp Leu Glu Gln Leu Thr Asn Glu Phe Pro 35 40 45Gly Leu
Thr Ile Ala Asn Glu Ala Glu Gly Gly Pro Thr Ala Val Ala 50 55 60Tyr
Asn Lys Ile Ser Trp Asn Pro Lys Tyr Gln Val Ile Asn Asn Leu 65 70
75 80Asp Tyr Glu Val Thr Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro
Asp 85 90 95Asp Leu Val Ile Leu Trp Val Gly Ala Asn Asp Tyr Leu Ala
Tyr Gly 100 105 110Trp Asn Thr Glu Gln Asp Ala Lys Arg Val Arg Asp
Ala Ile Ser Asp 115 120 125Ala Ala Asn Arg Met Val Leu Asn Gly Ala
Lys Glu Ile Leu Leu Phe 130 135 140Asn Leu Pro Asp Leu Gly Gln Asn
Pro Ser Ala Arg Ser Gln Lys Val145 150 155 160Val Glu Ala Ala Ser
His Val Ser Ala Tyr His Asn Gln Leu Leu Leu 165 170 175Asn Leu Ala
Arg Gln Leu Ala Pro Thr Gly Met Val Lys Leu Phe Glu 180 185 190Ile
Asp Lys Gln Phe Ala Glu Met Leu Arg Asp Pro Gln Asn Phe Gly 195 200
205Leu Ser Asp Gln Arg Asn Ala Cys Tyr Gly Gly Ser Tyr Val Trp Lys
210 215 220Pro Phe Ala Ser Arg Ser Ala Ser Thr Asp Ser Gln Leu Ser
Ala Phe225 230 235 240Asn Pro Gln Glu Arg Leu Ala Ile Ala Gly Asn
Pro Leu Leu Ala Gln 245 250 255Ala Val Ala Ser Pro Met Ala Ala Arg
Ser Ala Ser Thr Leu Asn Cys 260 265 270Glu Gly Lys Met Phe Trp Asp
Gln Val His Pro Thr Thr Val Val His 275 280 285Ala Ala Leu Ser Glu
Pro Ala 290 2951101225DNAArtificial SequenceDescription of
Artificial Sequence Synthetic construct 110gcttttcttt tggaagaaaa
tatagggaaa atggtacttg ttaaaaattc ggaatattta 60tacaatatca tatgtttcac
attgaaaggg gaggagaatc atg aaa caa caa aaa 115 Met Lys Gln Gln Lys 1
5cgg ctt tac gcc cga ttg ctg acg ctg tta ttt gcg ctc atc ttc ttg
163Arg Leu Tyr Ala Arg Leu Leu Thr Leu Leu Phe Ala Leu Ile Phe Leu
10 15 20ctg cct cat tct gca gct tca gca gca gat aca aga ccg gcg ttt
agc 211Leu Pro His Ser Ala Ala Ser Ala Ala Asp Thr Arg Pro Ala Phe
Ser 25 30 35cgg atc gtc atg ttt gga gat agc ctg agc gat acg ggc aaa
atg tat 259Arg Ile Val Met Phe Gly Asp Ser Leu Ser Asp Thr Gly Lys
Met Tyr 40 45 50agc aaa atg aga ggc tat ctt ccg tca agc ccg ccg tat
tat gaa ggc 307Ser Lys Met Arg Gly Tyr Leu Pro Ser Ser Pro Pro Tyr
Tyr Glu Gly 55 60 65cgc ttt agc aat gga ccg gtc tgg ctg gaa caa ctg
acg aaa caa ttt 355Arg Phe Ser Asn Gly Pro Val Trp Leu Glu Gln Leu
Thr Lys Gln Phe 70 75 80 85ccg gga ctg acg atc gct aat gaa gca gaa
gga gga gca aca gcg gtc 403Pro Gly Leu Thr Ile Ala Asn Glu Ala Glu
Gly Gly Ala Thr Ala Val 90 95 100gcc tat aac aaa atc agc tgg gac
ccg aaa tat cag gtc atc aac aac 451Ala Tyr Asn Lys Ile Ser Trp Asp
Pro Lys Tyr Gln Val Ile Asn Asn 105 110 115ctg gac tat gaa gtc aca
cag ttt ctt cag aaa gac agc ttt aaa ccg 499Leu Asp Tyr Glu Val Thr
Gln Phe Leu Gln Lys Asp Ser Phe Lys Pro 120 125 130gat gat ctg gtc
atc ctt tgg gtc ggc gcc aat gat tat ctg gcg tat 547Asp Asp Leu Val
Ile Leu Trp Val Gly Ala Asn Asp Tyr Leu Ala Tyr 135 140 145ggc tgg
aac aca gaa caa gat gcc aaa aga gtc aga gat gcc atc agc 595Gly Trp
Asn Thr Glu Gln Asp Ala Lys Arg Val Arg Asp Ala Ile Ser150 155 160
165gat gcc gct aat aga atg gtc ctg aac ggc gcc aaa caa atc ctg ctg
643Asp Ala Ala Asn Arg Met Val Leu Asn Gly Ala Lys Gln Ile Leu Leu
170 175 180ttt aac ctg ccg gat ctg gga caa aat ccg agc gcc aga agc
caa aaa 691Phe Asn Leu Pro Asp Leu Gly Gln Asn Pro Ser Ala Arg Ser
Gln Lys 185 190 195gtc gtc gaa gca gtc agc cat gtc agc gcc tat cat
aac aaa ctg ctg 739Val Val Glu Ala Val Ser His Val Ser Ala Tyr His
Asn Lys Leu Leu 200 205 210ctg aac ctg gca aga caa ttg gca ccg acg
gga atg gtt aaa ttg ttt 787Leu Asn Leu Ala Arg Gln Leu Ala Pro Thr
Gly Met Val Lys Leu Phe 215 220 225gaa att gac aaa cag ttt gcc gaa
atg ctg aga gat ccg caa aat ttt 835Glu Ile Asp Lys Gln Phe Ala Glu
Met Leu Arg Asp Pro Gln Asn Phe230 235 240 245ggc ctg agc gat gtc
gaa aac ccg tgc tat gat ggc gga tat gtc tgg 883Gly Leu Ser Asp Val
Glu Asn Pro Cys Tyr Asp Gly Gly Tyr Val Trp 250 255 260aaa ccg ttt
gcc aca aga agc gtc agc acg gat aga caa ctg tca gcg 931Lys Pro Phe
Ala Thr Arg Ser Val Ser Thr Asp Arg Gln Leu Ser Ala 265 270 275ttt
agc ccg caa gaa aga ctg gca atc gcc gga aat ccg ctt ttg gca 979Phe
Ser Pro Gln Glu Arg Leu Ala Ile Ala Gly Asn Pro Leu Leu Ala 280 285
290caa gca gtt gct tca ccg atg gca aga aga tca gca agc ccg ctg aat
1027Gln Ala Val Ala Ser Pro Met Ala Arg Arg Ser Ala Ser Pro Leu Asn
295 300 305tgc gaa ggc aaa atg ttt tgg gat cag gtc cat ccg aca aca
gtt gtc 1075Cys Glu Gly Lys Met Phe Trp Asp Gln Val His Pro Thr Thr
Val Val310 315 320 325cat gct gcc ctt tca gaa aga gcg gcg acg ttt
atc gaa aca cag tat 1123His Ala Ala Leu Ser Glu Arg Ala Ala Thr Phe
Ile Glu Thr Gln Tyr 330 335 340gaa ttt ctg gcc cat ggc tgagttaaca
gaggacggat ttcctgaagg 1171Glu Phe Leu Ala His Gly 345aaatccgttt
ttttatttta agcttggaga caaggtaaag gataaaacct cgag
1225111347PRTArtificial SequenceDescription of Artificial Sequence
Synthetic construct 111Met Lys Gln Gln Lys Arg Leu Tyr Ala Arg Leu
Leu Thr Leu Leu Phe 1 5 10 15Ala Leu Ile Phe Leu Leu Pro His Ser
Ala Ala Ser Ala Ala Asp Thr 20 25 30Arg Pro Ala Phe Ser Arg Ile Val
Met Phe Gly Asp Ser Leu Ser Asp 35 40 45Thr Gly Lys Met Tyr Ser Lys
Met Arg Gly Tyr Leu Pro Ser Ser Pro 50 55 60Pro Tyr Tyr Glu Gly Arg
Phe Ser Asn Gly Pro Val Trp Leu Glu Gln 65 70 75 80Leu Thr Lys Gln
Phe Pro Gly Leu Thr Ile Ala Asn Glu Ala Glu Gly 85 90 95Gly Ala Thr
Ala Val Ala Tyr Asn Lys Ile Ser Trp Asp Pro Lys Tyr 100 105 110Gln
Val Ile Asn Asn Leu Asp Tyr Glu Val Thr Gln Phe Leu Gln Lys 115 120
125Asp Ser Phe Lys Pro Asp Asp Leu Val Ile Leu Trp Val Gly Ala Asn
130 135 140Asp Tyr Leu Ala Tyr Gly Trp Asn Thr Glu Gln Asp Ala Lys
Arg Val145 150 155 160Arg Asp Ala Ile Ser Asp Ala Ala Asn Arg Met
Val Leu Asn Gly Ala 165 170 175Lys Gln Ile Leu Leu Phe Asn Leu Pro
Asp Leu Gly Gln Asn Pro Ser 180 185 190Ala Arg Ser Gln Lys Val Val
Glu Ala Val Ser His Val Ser Ala Tyr 195 200 205His Asn Lys Leu Leu
Leu Asn Leu Ala Arg Gln Leu Ala Pro Thr Gly 210 215 220Met Val Lys
Leu Phe Glu Ile Asp Lys Gln Phe Ala Glu Met Leu Arg225 230 235
240Asp Pro Gln Asn Phe Gly Leu Ser Asp Val Glu Asn Pro Cys Tyr Asp
245 250 255Gly Gly Tyr Val Trp Lys Pro Phe Ala Thr Arg Ser Val Ser
Thr Asp 260 265 270Arg Gln Leu Ser Ala Phe Ser Pro Gln Glu Arg Leu
Ala Ile Ala Gly 275 280 285Asn Pro Leu Leu Ala Gln Ala Val Ala Ser
Pro Met Ala Arg Arg Ser 290 295 300Ala Ser Pro Leu Asn Cys Glu Gly
Lys Met Phe Trp Asp Gln Val His305 310 315 320Pro Thr Thr Val Val
His Ala Ala Leu Ser Glu Arg Ala Ala Thr Phe 325 330 335Ile Glu Thr
Gln Tyr Glu Phe Leu Ala His Gly 340 345
* * * * *
References