U.S. patent application number 17/539659 was filed with the patent office on 2022-07-21 for encapsulation of messenger rna.
The applicant listed for this patent is Translate Bio, Inc.. Invention is credited to Frank DeRosa, Michael Heartlein, Shrirang Karve.
Application Number | 20220226255 17/539659 |
Document ID | / |
Family ID | |
Filed Date | 2022-07-21 |
United States Patent
Application |
20220226255 |
Kind Code |
A1 |
DeRosa; Frank ; et
al. |
July 21, 2022 |
ENCAPSULATION OF MESSENGER RNA
Abstract
The present invention provides an improved process for lipid
nanoparticle formulation and mRNA encapsulation. In some
embodiments, the present invention provides a process of
encapsulating messenger RNA (mRNA) in lipid nanoparticles
comprising a step of mixing a mRNA solution and a lipid solution,
wherein the mRNA solution and/or the lipid solution are at a
pre-determined temperature greater than ambient temperature.
Inventors: |
DeRosa; Frank; (Lexington,
MA) ; Karve; Shrirang; (Lexington, MA) ;
Heartlein; Michael; (Lexington, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Translate Bio, Inc. |
Lexington |
MA |
US |
|
|
Appl. No.: |
17/539659 |
Filed: |
December 1, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15495157 |
Apr 24, 2017 |
|
|
|
17539659 |
|
|
|
|
14790562 |
Jul 2, 2015 |
9668980 |
|
|
15495157 |
|
|
|
|
62020163 |
Jul 2, 2014 |
|
|
|
International
Class: |
A61K 9/50 20060101
A61K009/50; A61K 9/127 20060101 A61K009/127; A61K 31/713 20060101
A61K031/713 |
Claims
1-50.(canceled)
51. A process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles comprising a step of mixing a buffered mRNA solution
and a lipid solution, wherein the buffered mRNA solution comprises
an mRNA stock solution and a buffer having a concentration of about
10 mM or greater, and wherein the buffered mRNA solution and the
lipid solution are at a pre-determined temperature from about
50-70.degree. C.
52. The process of claim 51, wherein the mRNA stock solution
comprises mRNA at a concentration of greater than about 1
mg/mL.
53. The process of claim 51, wherein the buffered mRNA solution has
a pH no greater than about 4.5.
54. The process of claim 51, wherein the buffer is a citrate
buffer.
55. The process of claim 51, wherein the lipid solution comprises
one or more cationic lipids, one or more helper lipids, and one or
more PEG-modified lipids.
56. The process of claim 55, wherein the one or more helper lipids
comprise non-cationic lipids and cholesterol-based lipids.
57. The process of claim 55, wherein the one or more cationic
lipids, one or more helper lipids, and one or more PEG-modified
lipids are dissolved in absolute ethanol.
58. The process of claim 57, wherein the lipid solution has a total
lipid concentration ranging from about 1.0-15 mg/mL.
59. The process of claim 56, wherein the one or more helper lipids
are selected from the group consisting of DSPC, DOPC, DPPC, DOPG,
DPPG, DOPE, POPC, POPE, DOPE-mal, DPPE, DMPE, DSPE, 16-O-monomethyl
PE, 16-O-dimethyl PE, 18-1-trans PE, SOPE, cholesterol, DC-Chol
(N,N-dimethyl-N-ethylcarboxamidocholesterol),
1,4-bis(3-N-oleylamino-propyl)piperazine, and combinations
thereof.
60. The process of claim 56, wherein the one or more PEG-modified
lipids comprise a poly(ethylene)glycol chain of up to 5 kDa in
length covalently attached to a lipid with alkyl chain(s) of
C.sub.6-C.sub.20 length.
61. The process of claim 51, wherein the mRNA solution is mixed at
a rate of at least 3.times. greater than the rate of the lipid
solution.
62. The process of claim 51, wherein the mRNA comprises one or more
modified nucleotides.
63. A process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles, comprising a. separately heating an mRNA solution
and a lipid solution to a pre-determined temperature from about
50-70.degree. C. to generate a heated mRNA solution and a heated
lipid solution; b. mixing the heated mRNA solution and the heated
lipid solution to generate a suspension of lipid nanoparticles,
wherein the heated mRNA solution is mixed at a rate of at least
3.times. greater than the rate of the heated lipid solution; and c.
purifying the lipid nanoparticles by tangential flow filtration
(TFF).
64. The process of claim 63, wherein the lipid solution comprises
one or more cationic lipids, one or more helper lipids, and
PEG-modified lipids.
65. The process of claim 63, wherein 95% of the purified lipid
nanoparticles have an individual particle size of less than about
100 nm.
66. A process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles, comprising a. mixing an mRNA stock solution and a
buffer solution at ambient temperature to form a buffered mRNA
solution, wherein the mRNA stock solution has an mRNA concentration
of greater than about 1 mg/mL, and wherein the buffer solution has
a buffer concentration of about 10 mM or greater; b. separately
heating the buffered mRNA solution and a lipid solution to a
pre-determined temperature from about 50-70.degree. C. to generate
a heated mRNA solution and a heated lipid solution, wherein the
lipid solution has a total lipid concentration ranging from about
1.0-15 mg/mL; c. mixing the heated mRNA solution and the heated
lipid solution to generate a suspension of lipid nanoparticles; and
d. purifying the lipid nanoparticles by tangential flow filtration
(TFF).
67. The process of claim 66, wherein the buffer solution has a pH
of about 4.5.
68. The process of claim 66, wherein the buffer solution is a
citrate buffer.
69. The process of claim 66, wherein the heated mRNA solution is
mixed at a rate of at least 3.times. greater than the rate of the
heated lipid solution.
70. The process of claim 66, wherein the lipid solution is in
absolute ethanol.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 15/495,157 filed Apr. 24, 2017, now
abandoned, which is a continuation application of U.S. application
Ser. No. 14/790,562, filed on Jul. 2, 2015, now issued as U.S. Pat.
No. 9,668,980, which claims priority to U.S. provisional patent
application Ser. No. 62/020,163, filed Jul. 2, 2014, each of which
are hereby incorporated by reference in their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Aug. 12, 2015, is named 2006685-1078_SL.txt and is 20,862 bytes
in size. The entire contents of the Sequence Listing are herein
incorporated by reference.
BACKGROUND
[0003] Messenger RNA therapy (MRT) is becoming an increasingly
important approach for the treatment of a variety of diseases. MRT
involves administration of messenger RNA (mRNA) into a patient in
need of the therapy for production of the protein encoded by the
mRNA within the patient body. Lipid nanoparticles are commonly used
to encapsulate mRNA for efficient in vivo delivery of mRNA.
However, current methods for producing mRNA-loaded lipid
nanoparticles suffer poor encapsulation efficiency, low mRNA
recovery and/or heterogeneous particle sizes.
SUMMARY OF INVENTION
[0004] The present invention provides, among other things, an
improved process for lipid nanoparticle formulation and mRNA
encapsulation. In particular, the present invention is based on the
surprising discovery that pre-heating a mRNA solution and/or a
lipid solution prior to mixing resulted in significantly improved
encapsulation efficiency, mRNA recovery rate, and more homogeneous
and smaller particle sizes (e.g., less than 100 nm).
[0005] Thus, in some embodiments, the present invention provides a
process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles comprising a step of mixing a mRNA solution and a
lipid solution, wherein the mRNA solution and/or the lipid solution
are at a pre-determined temperature greater than ambient
temperature. In some embodiments, a pre-determined temperature
suitable for the present invention is or is greater than about
30.degree. C., 37.degree. C., 40.degree. C., 45.degree. C.,
50.degree. C., 55.degree. C., 60.degree. C., 65.degree. C., or
70.degree. C. In some embodiments, a pre-determined temperature
suitable for the present invention ranges from about 25-70.degree.
C., about 30-70.degree. C., about 35-70.degree. C., about
40-70.degree. C., about 45-70.degree. C., about 50-70.degree. C.,
or about 60-70.degree. C. In particular embodiments, a
pre-determined temperature suitable for the present invention is
about 65.degree. C.
[0006] In some embodiments, the mRNA solution and the lipid
solution are heated to the pre-determined temperature separately
prior to the mixing. In some embodiments, the mRNA solution is
heated to the pre-determined temperature and the lipid solution is
at ambient temperature prior to the mixing. In some embodiments,
the mRNA solution is heated to the pre-determined temperature by
adding a mRNA stock solution at ambient temperature to a heated
buffering solution to the pre-determined temperature. In some
embodiments, the buffering solution has a pH no greater than about
4.5 (e.g., no greater than about 4.4, 4.2, 4.0 or 3.8).
[0007] In some embodiments, the mRNA solution and the lipid
solution are mixed by a pulse-less flow pump. In some embodiments,
a suitable pump is a gear pump. In some embodiments, a suitable
pump is a peristaltic pump. In some embodiments, a suitable pump is
a centrifugal pump.
[0008] In some embodiments, the mRNA solution is mixed at a flow
rate ranging from about 150-250 ml/minute, 250-500 ml/minute,
500-1000 ml/minute, 1000-2000 ml/minute, 2000-3000 ml/minute,
3000-4000 ml/minute, or 4000-5000 ml/minute. In some embodiments,
the mRNA solution is mixed at a flow rate of about 200 ml/minute,
about 500 ml/minute, about 1000 ml/minute, about 2000 ml/minute,
about 3000 ml/minute, about 4000 ml/minute, or about 5000
ml/minute.
[0009] In some embodiments, the lipid solution is mixed at a flow
rate ranging from about 25-75 ml/minute, about 75-200 ml/minute,
about 200-350 ml/minute, about 350-500 ml/minute, about 500-650
ml/minute, about 650-850 ml/minute, or about 850-1000 ml/minute. In
some embodiments, the lipid solution is mixed at a flow rate of
about 50 ml/minute, about 100 ml/minute, about 150 ml/minute, about
200 ml/minute, about 250 ml/minute, about 300 ml/minute, about 350
ml/minute, about 400 ml/minute, about 450 ml/minute, about 500
ml/minute, about 550 ml/minute, about 600 ml/minute, about 650
ml/minute, about 700 ml/minute, about 750 ml/minute, about 800
ml/minute, about 850 ml/minute, about 900 ml/minute, about 950
ml/minute, or about 1000 ml/minute.
[0010] In some embodiments, a process according to the present
invention includes a step of first generating the mRNA solution by
mixing a citrate buffer with a mRNA stock solution. In certain
embodiments, a suitable citrate buffer contains about 10 mM
citrate, about 150 mM NaCl, pH of about 4.5. In some embodiments, a
suitable mRNA stock solution contains the mRNA at a concentration
at or greater than about 0.10 mg/mL, 1 mg/ml, about 10 mg/ml, about
50 mg/ml, or about 100 mg/ml.
[0011] In some embodiments, the citrate buffer is mixed at a flow
rate ranging between about 100-300 ml/minute, 300-600 ml/minute,
600-1200 ml/minute, 1200-2400 ml/minute, 2400-3600 ml/minute,
3600-4800 ml/minute, or 4800-6000 ml/minute. In some embodiments,
the citrate buffer is mixed at a flow rate of about 220 ml/minute,
about 600 ml/minute, about 1200 ml/minute, about 2400 ml/minute,
about 3600 ml/minute, about 4800 ml/minute, or about 6000
ml/minute.
[0012] In some embodiments, the mRNA stock solution is mixed at a
flow rate ranging between about 10-30 ml/minute, about 30-60
ml/minute, about 60-120 ml/minute, about 120-240 ml/minute, about
240-360 ml/minute, about 360-480 ml/minute, or about 480-600
ml/minute. In some embodiments, the mRNA stock solution is mixed at
a flow rate of about 20 ml/minute, about 40 ml/minute, about 60
ml/minute, about 80 ml/minute, about 100 ml/minute, about 200
ml/minute, about 300 ml/minute, about 400 ml/minute, about 500
ml/minute, or about 600 ml/minute.
[0013] In some embodiments, the lipid solution contains one or more
cationic lipids, one or more helper lipids, one or more
cholesterol-based lipids and PEG lipids in ethanol. In some
embodiments, the mRNA solution and the lipid solution are mixed
into a 20% ethanol, resulting in a suspension of lipid
nanoparticles. In some embodiments, the lipid nanoparticles are
further purified by Tangential Flow Filtration.
[0014] In some embodiments, greater than about 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified
nanoparticles have a size less than about 100 nm (e.g., less than
about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm,
about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50
nm). In some embodiments, substantially all of the purified
nanoparticles have a size less than 100 nm (e.g., less than about
95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70
nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm).
[0015] In some embodiments, greater than about 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles have a
size ranging from about 40-90 nm (e.g., about 40-85 nm, about 40-80
nm, about 40-75 nm, about 40-70 nm, about 40-65 nm, or about 40-60
nm). In some embodiments, substantially all of the purified
nanoparticles have a size ranging from about 40-90 nm (e.g., about
40-85 nm, about 40-80 nm, about 40-75 nm, about 40-70 nm, about
40-65 nm, or about 40-60 nm).
[0016] In some embodiments, the purified nanoparticles have an
encapsulation efficiency of greater than about 80%, 85%, 90%, 95%,
96%, 97%, 98%, or 99%. In some embodiments, a process according to
the present invention results in greater than about 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% recovery of
mRNA.
[0017] In some embodiments, the present invention provides a
process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles, comprising (a) separately heating a mRNA solution
and/or a lipid solution to a pre-determined temperature greater
than ambient temperature; (b) mixing the heated mRNA solution
and/or the heated lipid solution to generate a suspension of lipid
nanoparticles; and (c) purifying the lipid nanoparticles.
[0018] In another aspect, the present invention provides a
composition of lipid nanoparticles generated by a process described
herein. In some embodiments, the present invention provides a
composition comprising purified lipid nanoparticles, wherein
greater than about 90% of the purified lipid nanoparticles have an
individual particle size of less than about 100 nm (e.g., less than
about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm,
about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm)
and greater than about 70% of the purified lipid nanoparticles
encapsulate a mRNA within each individual particle. In some
embodiments, greater than about 95%, 96%, 97%, 98%, or 99% of the
purified lipid nanoparticles have an individual particle size of
less than about 100 nm (e.g., less than about 95 nm, about 90 nm,
about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm,
about 60 nm, about 55 nm, or about 50 nm). In some embodiments,
substantially all of the purified lipid nanoparticles have an
individual particle size of less than about 100 nm (e.g., less than
about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm,
about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50
nm). In some embodiments, greater than about 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles
encapsulate a mRNA within each individual particle. In some
embodiments, substantially all of the purified lipid nanoparticles
encapsulate a mRNA within each individual particle. In some
embodiments, a composition according to the present invention
contains at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000
mg of encapsulated mRNA.
[0019] In some embodiments, each individual lipid nanoparticle
comprises one or more cationic lipids, one or more helper lipids,
one or more cholesterol-based lipids and PEG lipids. In some
embodiments, the one or more cationic lipids are selected from the
group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE
(Imidazol-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA,
DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA,
CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP,
KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.
[0020] In some embodiments, the one or more non-cationic lipids are
selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine),
DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE
(1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC
(1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE
(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE
(1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG
(,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).
[0021] In some embodiments, the one or more cholesterol-based
lipids is cholesterol or PEGylated cholesterol. In some
embodiments, the one or more PEG-modified lipids contain a
poly(ethylene) glycol chain of up to 5 kDa in length covalently
attached to a lipid with alkyl chain(s) of C.sub.6-C.sub.20
length.
[0022] In some embodiments, the present invention is used to
encapsulate mRNA containing one or more modified nucleotides. In
some embodiments, the present invention is used to encapsulate mRNA
that is unmodified.
[0023] Other features, objects, and advantages of the present
invention are apparent in the detailed description, drawings and
claims that follow. It should be understood, however, that the
detailed description, the drawings, and the claims, while
indicating embodiments of the present invention, are given by way
of illustration only, not limitation. Various changes and
modifications within the scope of the invention will become
apparent to those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The drawings are for illustration purposes only and not for
limitation.
[0025] FIG. 1: shows a schematic of an exemplary scaled-up lipid
nanoparticle encapsulated mRNA formulation process with homogenous
flow pumps.
[0026] FIG. 2: depicts an exemplary purification and buffer
exchange system for lipid nanoparticles.
[0027] FIG. 3: depicts a schematic of an exemplary scaled-up lipid
nanoparticle encapsulated mRNA formulation process with peristaltic
pumps.
[0028] FIG. 4: depicts an alternative exemplary tangential flow
filtration system for purification and buffer exchange.
[0029] FIG. 5: depicts an alternative schematic of an exemplary
scaled-up lipid nanoparticle encapsulated mRNA formulation process
with peristaltic pumps.
DEFINITIONS
[0030] In order for the present invention to be more readily
understood, certain terms are first defined below. Additional
definitions for the following terms and other terms are set forth
throughout the specification.
[0031] Approximately or about: As used herein, the term
"approximately" or "about," as applied to one or more values of
interest, refers to a value that is similar to a stated reference
value. In certain embodiments, the term "approximately" or "about"
refers to a range of values that fall within 25%, 20%, 19%, 18%,
17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%,
2%, 1%, or less in either direction (greater than or less than) of
the stated reference value unless otherwise stated or otherwise
evident from the context (except where such number would exceed
100% of a possible value).
[0032] Encapsulation: As used herein, the term "encapsulation," or
grammatical equivalent, refers to the process of confining an
individual mRNA molecule within a nanoparticle.
[0033] Improve, increase, or reduce: As used herein, the terms
"improve," "increase" or "reduce," or grammatical equivalents,
indicate values that are relative to a baseline measurement, such
as a measurement in the same individual prior to initiation of the
treatment described herein, or a measurement in a control subject
(or multiple control subject) in the absence of the treatment
described herein. A "control subject" is a subject afflicted with
the same form of disease as the subject being treated, who is about
the same age as the subject being treated.
[0034] Impurities: As used herein, the term "impurities" refers to
substances inside a confined amount of liquid, gas, or solid, which
differ from the chemical composition of the target material or
compound. Impurities are also referred to as contaminants.
[0035] In Vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, etc., rather than within
a multi-cellular organism.
[0036] In Vivo: As used herein, the term "in vivo" refers to events
that occur within a multi-cellular organism, such as a human and a
non-human animal. In the context of cell-based systems, the term
may be used to refer to events that occur within a living cell (as
opposed to, for example, in vitro systems).
[0037] Isolated: As used herein, the term "isolated" refers to a
substance and/or entity that has been (1) separated from at least
some of the components with which it was associated when initially
produced (whether in nature and/or in an experimental setting),
and/or (2) produced, prepared, and/or manufactured by the hand of
man. Isolated substances and/or entities may be separated from
about 10%, about 20%, about 30%, about 40%, about 50%, about 60%,
about 70%, about 80%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, about 99%,
or more than about 99% of the other components with which they were
initially associated. In some embodiments, isolated agents are
about 80%, about 85%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, about 99%,
or more than about 99% pure. As used herein, a substance is "pure"
if it is substantially free of other components. As used herein,
calculation of percent purity of isolated substances and/or
entities should not include excipients (e.g., buffer, solvent,
water, etc.).
[0038] messenger RNA (mRNA): As used herein, the term "messenger
RNA (mRNA)" refers to a polynucleotide that encodes at least one
polypeptide. mRNA as used herein encompasses both modified and
unmodified RNA. mRNA may contain one or more coding and non-coding
regions.
[0039] Nucleic acid: As used herein, the term "nucleic acid," in
its broadest sense, refers to any compound and/or substance that is
or can be incorporated into a polynucleotide chain. In some
embodiments, a nucleic acid is a compound and/or substance that is
or can be incorporated into a polynucleotide chain via a
phosphodiester linkage. In some embodiments, "nucleic acid" refers
to individual nucleic acid residues (e.g., nucleotides and/or
nucleosides). In some embodiments, "nucleic acid" refers to a
polynucleotide chain comprising individual nucleic acid residues.
In some embodiments, "nucleic acid" encompasses RNA as well as
single and/or double-stranded DNA and/or cDNA. Furthermore, the
terms "nucleic acid," "DNA," "RNA," and/or similar terms include
nucleic acid analogs, i.e., analogs having other than a
phosphodiester backbone. For example, the so-called "peptide
nucleic acids," which are known in the art and have peptide bonds
instead of phosphodiester bonds in the backbone, are considered
within the scope of the present invention. The term "nucleotide
sequence encoding an amino acid sequence" includes all nucleotide
sequences that are degenerate versions of each other and/or encode
the same amino acid sequence. Nucleotide sequences that encode
proteins and/or RNA may include introns. Nucleic acids can be
purified from natural sources, produced using recombinant
expression systems and optionally purified, chemically synthesized,
etc. Where appropriate, e.g., in the case of chemically synthesized
molecules, nucleic acids can comprise nucleoside analogs such as
analogs having chemically modified bases or sugars, backbone
modifications, etc. A nucleic acid sequence is presented in the 5'
to 3' direction unless otherwise indicated. In some embodiments, a
nucleic acid is or comprises natural nucleosides (e.g., adenosine,
thymidine, guanosine, cytidine, uridine, deoxyadenosine,
deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside
analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine,
pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5
propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine,
C5-bromouridine, C5-fluorouridine, C5-iodouridine,
C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine,
2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine,
8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and
2-thiocytidine); chemically modified bases; biologically modified
bases (e.g., methylated bases); intercalated bases; modified sugars
(e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and
hexose); and/or modified phosphate groups (e.g., phosphorothioates
and 5'-N-phosphoramidite linkages). In some embodiments, the
present invention is specifically directed to "unmodified nucleic
acids," meaning nucleic acids (e.g., polynucleotides and residues,
including nucleotides and/or nucleosides) that have not been
chemically modified in order to facilitate or achieve delivery.
[0040] Salt: As used herein the term "salt" refers to an ionic
compound that does or may result from a neutralization reaction
between an acid and a base.
[0041] Substantially: As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and chemical phenomena.
[0042] Yield: As used herein, the term "yield" refers to the
percentage of mRNA recovered after encapsulation as compared to the
total mRNA as starting material. In some embodiments, the term
"recovery" is used interchangeably with the term "yield".
DETAILED DESCRIPTION
[0043] The present invention provides an improved process for lipid
nanoparticle formulation and mRNA encapsulation. In some
embodiments, the present invention provides a process of
encapsulating messenger RNA (mRNA) in lipid nanoparticles
comprising a step of mixing a mRNA solution and a lipid solution,
wherein the mRNA solution and/or the lipid solution are at a
pre-determined temperature greater than ambient temperature.
[0044] Various aspects of the invention are described in detail in
the following sections. The use of sections is not meant to limit
the invention. Each section can apply to any aspect of the
invention. In this application, the use of "or" means "and/or"
unless stated otherwise.
mRNA
[0045] The present invention may be used to encapsulate any mRNA.
mRNA is typically thought of as the type of RNA that carries
information from DNA to the ribosome. The existence of mRNA is
typically very brief and includes processing and translation,
followed by degradation. Typically, in eukaryotic organisms, mRNA
processing comprises the addition of a "cap" on the N-terminal (5')
end, and a "tail" on the C-terminal (3') end. A typical cap is a
7-methylguanosine cap, which is a guanosine that is linked through
a 5'-5'-triphosphate bond to the first transcribed nucleotide. The
presence of the cap is important in providing resistance to
nucleases found in most eukaryotic cells. The tail is typically a
polyadenylation event whereby a polyadenylyl moiety is added to the
3' end of the mRNA molecule. The presence of this "tail" serves to
protect the mRNA from exonuclease degradation. Messenger RNA is
translated by the ribosomes into a series of amino acids that make
up a protein.
[0046] mRNAs may be synthesized according to any of a variety of
known methods. For example, mRNAs according to the present
invention may be synthesized via in vitro transcription (IVT).
Briefly, IVT is typically performed with a linear or circular DNA
template containing a promoter, a pool of ribonucleotide
triphosphates, a buffer system that may include DTT and magnesium
ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA
polymerase), DNAse I, pyrophosphatase, and/or RNAse inhibitor. The
exact conditions will vary according to the specific
application.
[0047] In some embodiments, in vitro synthesized mRNA may be
purified before formulation and encapsulation to remove undesirable
impurities including various enzymes and other reagents used during
mRNA synthesis.
[0048] The present invention may be used to formulate and
encapsulate mRNAs of a variety of lengths. In some embodiments, the
present invention may be used to formulate and encapsulate in vitro
synthesized mRNA of or greater than about 1 kb, 1.5 kb, 2 kb, 2.5
kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb 6 kb, 7 kb, 8 kb, 9 kb, 10 kb,
11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb in length. In some
embodiments, the present invention may be used to formulate and
encapsulate in vitro synthesized mRNA ranging from about 1-20 kb,
about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about
5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb in
length.
[0049] The present invention may be used to formulate and
encapsulate mRNA that is unmodified or mRNA containing one or more
modifications that typically enhance stability. In some
embodiments, modifications are selected from modified nucleotide,
modified sugar phosphate backbones, 5' and/or 3' untranslated
region.
[0050] In some embodiments, modifications of mRNA may include
modifications of the nucleotides of the RNA. An modified mRNA
according to the invention can include, for example, backbone
modifications, sugar modifications or base modifications. In some
embodiments, mRNAs may be synthesized from naturally occurring
nucleotides and/or nucleotide analogues (modified nucleotides)
including, but not limited to, purines (adenine (A), guanine (G))
or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as
modified nucleotides analogues or derivatives of purines and
pyrimidines, such as e.g. 1-methyl-adenine, 2-methyl-adenine,
2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine,
N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine,
4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine,
1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine,
7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil
(5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil,
5-carboxymethylaminomethyl-2-thio-uracil,
5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil,
5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil,
5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester,
5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil,
5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil,
uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v),
1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine,
wybutoxosine, and phosphoramidates, phosphorothioates, peptide
nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine
and inosine. The preparation of such analogues is known to a person
skilled in the art e.g. from the U.S. Pat. Nos. 4,373,071,
4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679,
5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, the
disclosure of which is included here in its full scope by
reference.
[0051] Typically, mRNA synthesis includes the addition of a "cap"
on the N-terminal (5') end, and a "tail" on the C-terminal (3')
end. The presence of the cap is important in providing resistance
to nucleases found in most eukaryotic cells. The presence of a
"tail" serves to protect the mRNA from exonuclease degradation.
[0052] Thus, in some embodiments, mRNAs include a 5' cap structure.
A 5' cap is typically added as follows: first, an RNA terminal
phosphatase removes one of the terminal phosphate groups from the
5' nucleotide, leaving two terminal phosphates; guanosine
triphosphate (GTP) is then added to the terminal phosphates via a
guanylyl transferase, producing a 5'5'5 triphosphate linkage; and
the 7-nitrogen of guanine is then methylated by a
methyltransferase. 2'-O-methylation may also occur at the first
base and/or second base following the 7-methyl guanosine
triphosphate residues. Examples of cap structures include, but are
not limited to, m7GpppNp-RNA, m7GpppNmp-RNA and m7GpppNmpNmp-RNA
(where m indicates 2'-Omethyl residues).
[0053] In some embodiments, mRNAs include a 5' and/or 3'
untranslated region. In some embodiments, a 5' untranslated region
includes one or more elements that affect a mRNA's stability or
translation, for example, an iron responsive element. In some
embodiments, a 5' untranslated region may be between about 50 and
500 nucleotides in length.
[0054] In some embodiments, a 3' untranslated region includes one
or more of a polyadenylation signal, a binding site for proteins
that affect a mRNA's stability of location in a cell, or one or
more binding sites for miRNAs. In some embodiments, a 3'
untranslated region may be between 50 and 500 nucleotides in length
or longer.
[0055] While mRNA provided from in vitro transcription reactions
may be desirable in some embodiments, other sources of mRNA are
contemplated as within the scope of the invention including mRNA
produced from bacteria, fungi, plants, and/or animals.
[0056] The present invention may be used to formulate and
encapsulate mRNAs encoding a variety of proteins. Non-limiting
examples of mRNAs suitable for the present invention include mRNAs
encoding spinal motor neuron 1 (SMN), alpha-galactosidase (GLA),
argininosuccinate synthetase (ASS1), firefly luciferase, Factor IX
(FIX), phenylalanine hydroxylase (PAH), and cystic fibrosis
transmembrane conductance receptor (CFTR). Exemplary mRNA sequences
are described in detail in the Examples section.
mRNA Solution
[0057] mRNA may be provided in a solution to be mixed with a lipid
solution such that the mRNA may be encapsulated in lipid
nanoparticles. A suitable mRNA solution may be any aqueous solution
containing mRNA to be encapsulated at various concentrations. For
example, a suitable mRNA solution may contain a mRNA at a
concentration of or greater than about 0.01 mg/ml, 0.05 mg/ml, 0.06
mg/ml, 0.07 mg/ml, 0.08 mg/ml, 0.09 mg/ml, 0.1 mg/ml, 0.15 mg/ml,
0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml,
0.8 mg/ml, 0.9 mg/ml, or 1.0 mg/ml. In some embodiments, a suitable
mRNA solution may contain a mRNA at a concentration ranging from
about 0.01-1.0 mg/ml, 0.01-0.9 mg/ml, 0.01-0.8 mg/ml, 0.01-0.7
mg/ml, 0.01-0.6 mg/ml, 0.01-0.5 mg/ml, 0.01-0.4 mg/ml, 0.01-0.3
mg/ml, 0.01-0.2 mg/ml, 0.01-0.1 mg/ml, 0.05-1.0 mg/ml, 0.05-0.9
mg/ml, 0.05-0.8 mg/ml, 0.05-0.7 mg/ml, 0.05-0.6 mg/ml, 0.05-0.5
mg/ml, 0.05-0.4 mg/ml, 0.05-0.3 mg/ml, 0.05-0.2 mg/ml, 0.05-0.1
mg/ml, 0.1-1.0 mg/ml, 0.2-0.9 mg/ml, 0.3-0.8 mg/ml, 0.4-0.7 mg/ml,
or 0.5-0.6 mg/ml. In some embodiments, a suitable mRNA solution may
contain a mRNA at a concentration up to about 5.0 mg/ml, 4.0 mg/ml,
3.0 mg/ml, 2.0 mg/ml, 1.0 mg/ml, 0.09 mg/ml, 0.08 mg/ml, 0.07
mg/ml, 0.06 mg/ml, or 0.05 mg/ml.
[0058] Typically, a suitable mRNA solution may also contain a
buffering agent and/or salt. Generally, buffering agents can
include HEPES, ammonium sulfate, sodium bicarbonate, sodium
citrate, sodium acetate, potassium phosphate and sodium phosphate.
In some embodiments, suitable concentration of the buffering agent
may range from about 0.1 mM to 100 mM, 0.5 mM to 90 mM, 1.0 mM to
80 mM, 2 mM to 70 mM, 3 mM to 60 mM, 4 mM to 50 mM, 5 mM to 40 mM,
6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 to 12 mM. In some
embodiments, suitable concentration of the buffering agent is or
greater than about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10
mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM.
[0059] Exemplary salts can include sodium chloride, magnesium
chloride, and potassium chloride. In some embodiments, suitable
concentration of salts in a mRNA solution may range from about 1 mM
to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM
to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM
to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM.
Salt concentration in a suitable mRNA solution is or greater than
about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM,
80 mM, 90 mM, or 100 mM.
[0060] In some embodiments, a suitable mRNA solution may have a pH
ranging from about 3.5-6.5, 3.5-6.0, 3.5-5.5., 3.5-5.0, 3.5-4.5,
4.0-5.5, 4.0-5.0, 4.0-4.9, 4.0-4.8, 4.0-4.7, 4.0-4.6, or 4.0-4.5.
In some embodiments, a suitable mRNA solution may have a pH of or
no greater than about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7,
4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5.
[0061] Various methods may be used to prepare a mRNA solution
suitable for the present invention. In some embodiments, mRNA may
be directly dissolved in a buffering solution described herein. In
some embodiments, a mRNA solution may be generated by mixing a mRNA
stock solution with a buffering solution prior to mixing with a
lipid solution for encapsulation. In some embodiments, a mRNA
solution may be generated by mixing a mRNA stock solution with a
buffering solution immediately before mixing with a lipid solution
for encapsulation. In some embodiments, a suitable mRNA stock
solution may contain mRNA in water at a concentration at or greater
than about 0.2 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.8 mg/ml,
1.0 mg/ml, 1.2 mg/ml, 1.4 mg/ml, 1.5 mg/ml, or 1.6 mg/ml, 2.0
mg/ml, 2.5 mg/ml, 3.0 mg/ml, 3.5 mg/ml, 4.0 mg/ml, 4.5 mg/ml, or
5.0 mg/ml.
[0062] In some embodiments, a mRNA stock solution is mixed with a
buffering solution using a pump. Exemplary pumps include but are
not limited to gear pumps, peristaltic pumps and centrifugal
pumps.
[0063] Typically, the buffering solution is mixed at a rate greater
than that of the mRNA stock solution. For example, the buffering
solution may be mixed at a rate at least 1.times., 2.times.,
3.times., 4.times., 5.times., 6.times., 7.times., 8.times.,
9.times., 10.times., 15.times., or 20.times. greater than the rate
of the mRNA stock solution. In some embodiments, a buffering
solution is mixed at a flow rate ranging between about 100-6000
ml/minute (e.g., about 100-300 ml/minute, 300-600 ml/minute,
600-1200 ml/minute, 1200-2400 ml/minute, 2400-3600 ml/minute,
3600-4800 ml/minute, 4800-6000 ml/minute, or 60-420 ml/minute). In
some embodiments, a buffering solution is mixed at a flow rate of
or greater than about 60 ml/minute, 100 ml/minute, 140 ml/minute,
180 ml/minute, 220 ml/minute, 260 ml/minute, 300 ml/minute, 340
ml/minute, 380 ml/minute, 420 ml/minute, 480 ml/minute, 540
ml/minute, 600 ml/minute, 1200 ml/minute, 2400 ml/minute, 3600
ml/minute, 4800 ml/minute, or 6000 ml/minute.
[0064] In some embodiments, a mRNA stock solution is mixed at a
flow rate ranging between about 10-600 ml/minute (e.g., about 5-50
ml/minute, about 10-30 ml/minute, about 30-60 ml/minute, about
60-120 ml/minute, about 120-240 ml/minute, about 240-360 ml/minute,
about 360-480 ml/minute, or about 480-600 ml/minute). In some
embodiments, a mRNA stock solution is mixed at a flow rate of or
greater than about 5 ml/minute, 10 ml/minute, 15 ml/minute, 20
ml/minute, 25 ml/minute, 30 ml/minute, 35 ml/minute, 40 ml/minute,
45 ml/minute, 50 ml/minute, 60 ml/minute, 80 ml/minute, 100
ml/minute, 200 ml/minute, 300 ml/minute, 400 ml/minute, 500
ml/minute, or 600 ml/minute.
Lipid Solution
[0065] According to the present invention, a lipid solution
contains a mixture of lipids suitable to form lipid nanoparticles
for encapsulation of mRNA. In some embodiments, a suitable lipid
solution is ethanol based. For example, a suitable lipid solution
may contain a mixture of desired lipids dissolved in pure ethanol
(i.e., 100% ethanol). In another embodiment, a suitable lipid
solution is isopropyl alcohol based. In another embodiment, a
suitable lipid solution is dimethylsulfoxide-based. In another
embodiment, a suitable lipid solution is a mixture of suitable
solvents including, but not limited to, ethanol, isopropyl alcohol
and dimethylsulfoxide.
[0066] A suitable lipid solution may contain a mixture of desired
lipids at various concentrations. For example, a suitable lipid
solution may contain a mixture of desired lipids at a total
concentration of or greater than about 0.1 mg/ml, 0.5 mg/ml, 1.0
mg/ml, 2.0 mg/ml, 3.0 mg/ml, 4.0 mg/ml, 5.0 mg/ml, 6.0 mg/ml, 7.0
mg/ml, 8.0 mg/ml, 9.0 mg/ml, 10 mg/ml, 15 mg/ml, 20 mg/ml, 30
mg/ml, 40 mg/ml, 50 mg/ml, or 100 mg/ml. In some embodiments, a
suitable lipid solution may contain a mixture of desired lipids at
a total concentration ranging from about 0.1-100 mg/ml, 0.5-90
mg/ml, 1.0-80 mg/ml, 1.0-70 mg/ml, 1.0-60 mg/ml, 1.0-50 mg/ml,
1.0-40 mg/ml, 1.0-30 mg/ml, 1.0-20 mg/ml, 1.0-15 mg/ml, 1.0-10
mg/ml, 1.0-9 mg/ml, 1.0-8 mg/ml, 1.0-7 mg/ml, 1.0-6 mg/ml, or 1.0-5
mg/ml. In some embodiments, a suitable lipid solution may contain a
mixture of desired lipids at a total concentration up to about 100
mg/ml, 90 mg/ml, 80 mg/ml, 70 mg/ml, 60 mg/ml, 50 mg/ml, 40 mg/ml,
30 mg/ml, 20 mg/ml, or 10 mg/ml.
[0067] Any desired lipids may be mixed at any ratios suitable for
encapsulating mRNAs. In some embodiments, a suitable lipid solution
contain a mixture of desired lipids including cationic lipids,
helper lipids (e.g. non cationic lipids and/or cholesterol lipids)
and/or PEGylated lipids. In some embodiments, a suitable lipid
solution contain a mixture of desired lipids including one or more
cationic lipids, one or more helper lipids (e.g. non cationic
lipids and/or cholesterol lipids) and one or more PEGylated
lipids.
Cationic Lipids
[0068] As used herein, the phrase "cationic lipids" refers to any
of a number of lipid species that have a net positive charge at a
selected pH, such as physiological pH. Several cationic lipids have
been described in the literature, many of which are commercially
available. Particularly suitable cationic lipids for use in the
compositions and methods of the invention include those described
in international patent publications WO 2010/053572 (and
particularly, C12-200 described at paragraph [00225]) and WO
2012/170930, both of which are incorporated herein by reference. In
certain embodiments, cationic lipids suitable for the compositions
and methods of the invention include an ionizable cationic lipid
described in U.S. provisional patent application 61/617,468, filed
Mar. 29, 2012 (incorporated herein by reference), such as, e.g,
(15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-
-dien-1-amine (HGT5000),
(15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15-
,18-trien-1-amine (HGT5001), and
(15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15-
,18-trien-1-amine (HGT5002).
[0069] In some embodiments, cationic lipids suitable for the
compositions and methods of the invention include a cationic lipid
described in WO 2013063468 and in U.S. provisional application
entitled "Lipid Formulations for Delivery of Messenger RNA" both of
which are incorporated by reference herein. In some embodiments, a
cationic lipid comprises a compound of formula I-c1-a:
##STR00001##
or a pharmaceutically acceptable salt thereof, wherein: each
R.sup.2 independently is hydrogen or C.sub.1-3 alkyl; each q
independently is 2 to 6; each R' independently is hydrogen or
C.sub.1-3 alkyl; and each R.sup.L independently is C.sub.8-12
alkyl.
[0070] In some embodiments, each R.sup.2 independently is hydrogen,
methyl or ethyl. In some embodiments, each R.sup.2 independently is
hydrogen or methyl. In some embodiments, each R.sup.2 is
hydrogen.
[0071] In some embodiments, each q independently is 3 to 6. In some
embodiments, each q independently is 3 to 5. In some embodiments,
each q is 4.
[0072] In some embodiments, each R' independently is hydrogen,
methyl or ethyl. In some embodiments, each R' independently is
hydrogen or methyl. In some embodiments, each R' independently is
hydrogen.
[0073] In some embodiments, each R.sup.L independently is
C.sub.8-12 alkyl. In some embodiments, each R.sup.L independently
is n-C.sub.8-12 alkyl. In some embodiments, each R.sup.L
independently is C.sub.9-11 alkyl. In some embodiments, each
R.sup.L independently is n-C.sub.9-11 alkyl. In some embodiments,
each R.sup.L independently is C.sub.10 alkyl. In some embodiments,
each R.sup.L independently is n-C.sub.10 alkyl.
[0074] In some embodiments, each R.sup.2 independently is hydrogen
or methyl; each q independently is 3 to 5; each R' independently is
hydrogen or methyl; and each R.sup.L independently is C.sub.8-12
alkyl.
[0075] In some embodiments, each R.sup.2 is hydrogen; each q
independently is 3 to 5; each R' is hydrogen; and each R.sup.L
independently is C.sub.8-12 alkyl.
[0076] In some embodiments, each R.sup.2 is hydrogen; each q is 4;
each R' is hydrogen; and each R.sup.L independently is C.sub.8-12
alkyl.
[0077] In some embodiments, a cationic lipid comprises a compound
of formula I-g:
##STR00002##
or a pharmaceutically acceptable salt thereof, wherein each R.sup.L
independently is C.sub.8-12 alkyl. In some embodiments, each
R.sup.L independently is n-C.sub.8-12 alkyl. In some embodiments,
each R.sup.L independently is C.sub.9-11 alkyl. In some
embodiments, each R.sup.L independently is n-C.sub.9-11 alkyl. In
some embodiments, each R.sup.L independently is C.sub.10 alkyl. In
some embodiments, each R.sup.L is n-C.sub.10 alkyl.
[0078] In particular embodiments, a suitable cationic lipid is
cKK-E12, or
(3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione).
Structure of cKK-E12 is shown below:
##STR00003##
[0079] In some embodiments, one or more cationic lipids suitable
for the present invention may be
N[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or
"DOTMA". (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987);
U.S. Pat. No. 4,897,355). Other suitable cationic lipids include,
for example, 5-carboxyspermylglycinedioctadecylamide or "DOGS,"
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
ium or "DOSPA" (Behr et al. Proc. Nat.'l Acad. Sci. 86, 6982
(1989); U.S. Pat. Nos. 5,171,678; 5,334,761),
1,2-Dioleoyl-3-Dimethylammonium-Propane or "DODAP",
1,2-Dioleoyl-3-Trimethylammonium-Propane or "DOTAP".
[0080] Additional exemplary cationic lipids also include
1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA",
1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA",
1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA",
1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA",
N-dioleyl-N,N-dimethylammonium chloride or "DODAC",
N,N-distearyl-N,N-dimethylarnrnonium bromide or "DDAB",
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide or "DMRIE",
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane or "CLinDMA",
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy
1-1-(cis,cis-9',1-2'-octadecadienoxy)propane or "CpLinDMA",
N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA",
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP",
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine or
"DLinDAP",1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane or
"DLincarbDAP", 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane or
"DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or
"DLin-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or
"DLin-K-XTC2-DMA", and
2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimeth-
ylethanamine (DLin-KC2-DMA)) (see, WO 2010/042877; Semple et al.,
Nature Biotech. 28: 172-176 (2010)), or mixtures thereof. (Heyes,
J., et al., J Controlled Release 107: 276-287 (2005); Morrissey, D
V., et al., Nat. Biotechnol. 23(8): 1003-1007 (2005); PCT
Publication WO2005/121348A1). In some embodiments, one or more of
the cationic lipids comprise at least one of an imidazole,
dialkylamino, or guanidinium moiety.
[0081] In some embodiments, one or more cationic lipids may be
chosen from XTC
(2,2-Dilinoley1-4-dimethylaminoethy1-[1,3]-dioxolane), MC3
(((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)-
butanoate), ALNY-100
((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr-
o-3aH-cyclopenta[d] [1,3]dioxol-5-amine)), NC98-5
(4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tet-
raazahexadecane-1,16-diamide), DODAP
(1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO 2012/170889,
the teachings of which are incorporated herein by reference in
their entirety), ICE (WO 2011/068810, the teachings of which are
incorporated herein by reference in their entirety), HGT5000 (U.S.
Provisional Patent Application No. 61/617,468, the teachings of
which are incorporated herein by reference in their entirety) or
HGT5001 (cis or trans) (Provisional Patent Application No.
61/617,468), aminoalcohol lipidoids such as those disclosed in
WO2010/053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane),
DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA
(Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid
saturation influences intracellular delivery of encapsulated
nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA
(Semple, S. C. et al. "Rational Design of Cationic Lipids for siRNA
Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, K. T.
et al. "Lipid-like materials for low-dose in vivo gene silencing"
PNAS 2010, 107, 1864-1869).
[0082] In some embodiments, cationic lipids constitute at least
about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%
of the total lipids in a suitable lipid solution by weight or by
molar. In some embodiments, cationic lipid(s) constitute(s) about
30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about
30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or
about 35-40%) of the total lipid mixture by weight or by molar.
Non-Cationic/Helper Lipids
[0083] As used herein, the phrase "non-cationic lipid" refers to
any neutral, zwitterionic or anionic lipid. As used herein, the
phrase "anionic lipid" refers to any of a number of lipid species
that carry a net negative charge at a selected H, such as
physiological pH. Non-cationic lipids include, but are not limited
to, distearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), or a mixture
thereof.
[0084] In some embodiments, non-cationic lipids may constitute at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65% or 70% of the total lipids in a suitable lipid solution by
weight or by molar. In some embodiments, non-cationic lipid(s)
constitute(s) about 30-50% (e.g., about 30-45%, about 30-40%, about
35-50%, about 35-45%, or about 35-40%) of the total lipids in a
suitable lipid solution by weight or by molar.
Cholesterol-Based Lipids
[0085] In some embodiments, a suitable lipid solution include one
or more cholesterol-based lipids. For example, suitable
cholesterol-based cationic lipids include, for example, DC-Choi
(N,N-dimethyl-N-ethylcarboxamidocholesterol),
1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem.
Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23,
139 (1997); U.S. Pat. No. 5,744,335), or ICE. In some embodiments,
cholesterol-based lipid(s) constitute(s) at least about 5%, 10%,
20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable
lipid solution by weight or by molar. In some embodiments,
cholesterol-based lipid(s) constitute(s) about 30-50% (e.g., about
30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%)
of the total lipids in a suitable lipid solution by weight or by
molar.
PEGylated Lipids
[0086] In some embodiments, a suitable lipid solution includes one
or more PEGylated lipids. For example, the use of polyethylene
glycol (PEG)-modified phospholipids and derivatized lipids such as
derivatized ceramides (PEG-CER), including
N-Octanoyl-Sphingosine-1-[Succinyl(Methoxy Polyethylene
Glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the
present invention. Contemplated PEG-modified lipids include, but
are not limited to, a polyethylene glycol chain of up to 5 kDa in
length covalently attached to a lipid with alkyl chain(s) of
C.sub.6-C.sub.20 length. In some embodiments, a PEG-modified or
PEGylated lipid is PEGylated cholesterol or PEG-2K. In some
embodiments, particularly useful exchangeable lipids are
PEG-ceramides having shorter acyl chains (e.g., C.sub.14 or
C.sub.18).
[0087] PEG-modified phospholipid and derivatized lipids may
constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70%
of the total lipids in a suitable lipid solution by weight or by
molar. In some embodiments, PEGylated lipid lipid(s) constitute(s)
about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about
35-45%, or about 35-40%) of the total lipids in a suitable lipid
solution by weight or by molar.
[0088] Exemplary combinations of cationic lipids, non-cationic
lipids, cholesterol-based lipids, and PEG-modified lipids are
described in the Examples section. For example, a suitable lipid
solution may contain cKK-E12, DOPE, chol, and DMG-PEG2K; C12-200,
DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, chol, and
DMG-PEG2K; HGT5001, DOPE, chol, and DMG-PEG2K; cKK-E12, DPPC, chol,
and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000,
DPPC, chol, and DMG-PEG2K; or HGT5001, DPPC, chol, and DMG-PEG2K.
The selection of cationic lipids, non-cationic lipids and/or
PEG-modified lipids which comprise the lipid mixture as well as the
relative molar ratio of such lipids to each other, is based upon
the characteristics of the selected lipid(s) and the nature of the
and the characteristics of the mRNA to be encapsulated. Additional
considerations include, for example, the saturation of the alkyl
chain, as well as the size, charge, pH, pKa, fusogenicity and
toxicity of the selected lipid(s). Thus the molar ratios may be
adjusted accordingly.
Mixing Process
[0089] The present invention is based on the discovery of
unexpected effect of temperature on the mRNA encapsulation
efficiency and recovery rate. Thus, in some embodiments, the
present invention provides a process of encapsulating messenger RNA
(mRNA) in lipid nanoparticles by mixing a mRNA solution and a lipid
solution, described herein, wherein the mRNA solution and/or the
lipid solution are heated to a pre-determined temperature greater
than ambient temperature. As used herein, the term "ambient
temperature" refers to the temperature in a room, or the
temperature which surrounds an object of interest (e.g., a mRNA
solution or lipid solution) without heating or cooling. In some
embodiments, the ambient temperature refers to temperature ranging
from about 20-25.degree. C.
[0090] Therefore, a pre-determined temperature greater than ambient
temperature is typically greater than about 25.degree. C. In some
embodiments, a pre-determined temperature suitable for the present
invention is or is greater than about 30.degree. C., 37.degree. C.,
40.degree. C., 45.degree. C., 50.degree. C., 55.degree. C.,
60.degree. C., 65.degree. C., or 70.degree. C. In some embodiments,
a pre-determined temperature suitable for the present invention
ranges from about 25-70.degree. C., about 30-70.degree. C., about
35-70.degree. C., about 40-70.degree. C., about 45-70.degree. C.,
about 50-70.degree. C., or about 60-70.degree. C. In particular
embodiments, a pre-determined temperature suitable for the present
invention is about 65.degree. C.
[0091] The mRNA solution, or the lipid solution, or both, may be
heated to a pre-determined temperature above the ambient
temperature prior to mixing. In some embodiments, the mRNA solution
and the lipid solution are heated to the pre-determined temperature
separately prior to the mixing. In some embodiments, the mRNA
solution and the lipid solution are mixed at the ambient
temperature but then heated to the pre-determined temperature after
the mixing. In some embodiments, the lipid solution is heated to
the pre-determined temperature and mixed with a mRNA solution at
the ambient temperature. In some embodiments, the mRNA solution is
heated to the pre-determined temperature and mixed with a lipid
solution at ambient temperature.
[0092] In some embodiments, the mRNA solution is heated to the
pre-determined temperature by adding a mRNA stock solution that is
at ambient temperature to a heated buffering solution to achieve
the desired pre-determined temperature.
[0093] A mRNA solution and a lipid solution may be mixed using a
pump. As the encapsulation procedure can occur on a wide range of
scales, different types of pumps may be used to accommodate desired
scale. It is however generally desired to use a pulse-less flow
pumps. As used herein, a pulse-less flow pump refers to any pump
that can establish a continuous flow with a stable flow rate. Types
of suitable pumps may include, but are not limited to, gear pumps
and centrifugal pumps. Exemplary gear pumps include, but are not
limited to, Cole-Parmer or Diener gear pumps. Exemplary centrifugal
pumps include, but are not limited to, those manufactured by
Grainger or Cole-Parmer.
[0094] A mRNA solution and a lipid solution may be mixed at various
flow rates. Typically, the mRNA solution may be mixed at a rate
greater than that of the lipid solution. For example, the mRNA
solution may be mixed at a rate at least 1.times., 2.times.,
3.times., 4.times., 5.times., 6.times., 7.times., 8.times.,
9.times., 10.times., 15.times., or 20.times. greater than the rate
of the lipid solution.
[0095] Suitable flow rates for mixing may be determined based on
the scales. In some embodiments, a mRNA solution is mixed at a flow
rate ranging from about 40-400 ml/minute, 60-500 ml/minute, 70-600
ml/minute, 80-700 ml/minute, 90-800 ml/minute, 100-900 ml/minute,
110-1000 ml/minute, 120-1100 ml/minute, 130-1200 ml/minute,
140-1300 ml/minute, 150-1400 ml/minute, 160-1500 ml/minute,
170-1600 ml/minute, 180-1700 ml/minute, 150-250 ml/minute, 250-500
ml/minute, 500-1000 ml/minute, 1000-2000 ml/minute, 2000-3000
ml/minute, 3000-4000 ml/minute, or 4000-5000 ml/minute. In some
embodiments, the mRNA solution is mixed at a flow rate of about 200
ml/minute, about 500 ml/minute, about 1000 ml/minute, about 2000
ml/minute, about 3000 ml/minute, about 4000 ml/minute, or about
5000 ml/minute.
[0096] In some embodiments, a lipid solution is mixed at a flow
rate ranging from about 25-75 ml/minute, 20-50 ml/minute, 25-75
ml/minute, 30-90 ml/minute, 40-100 ml/minute, 50-110 ml/minute,
75-200 ml/minute, 200-350 ml/minute, 350-500 ml/minute, 500-650
ml/minute, 650-850 ml/minute, or 850-1000 ml/minute. In some
embodiments, the lipid solution is mixed at a flow rate of about 50
ml/minute, about 100 ml/minute, about 150 ml/minute, about 200
ml/minute, about 250 ml/minute, about 300 ml/minute, about 350
ml/minute, about 400 ml/minute, about 450 ml/minute, about 500
ml/minute, about 550 ml/minute, about 600 ml/minute, about 650
ml/minute, about 700 ml/minute, about 750 ml/minute, about 800
ml/minute, about 850 ml/minute, about 900 ml/minute, about 950
ml/minute, or about 1000 ml/minute.
[0097] Typically, a mRNA solution and a lipid solution are mixed
into a solution such that the lipids can form nanoparticles
encapsulating mRNA. Such a solution is also referred to as a
formulation or encapsulation solution. A suitable formulation or
encapsulation solution may be based on a solvent such as ethanol.
For example, a suitable formulation or encapsulation solution may
be based on about 10% ethanol, about 15% ethanol, about 20%
ethanol, about 25% ethanol, about 30% ethanol, about 35% ethanol,
or about 40% ethanol.
[0098] A suitable formulation or encapsulation solution may be
based on a solvent such as isopropyl alcohol. For example, a
suitable formulation or encapsulation solution may be based on
about 10% isopropyl alcohol, about 15% isopropyl alcohol, about 20%
isopropyl alcohol, about 25% isopropyl alcohol, about 30% isopropyl
alcohol, about 35% isopropyl alcohol, or about 40% isopropyl
alcohol.
[0099] A suitable formulation or encapsulation solution may be
based on a solvent such as dimethyl sulfoxide. For example, a
suitable formulation or encapsulation solution may be based on
about 10% dimethyl sulfoxide, about 15% dimethyl sulfoxide, about
20% dimethyl sulfoxide, about 25% dimethyl sulfoxide, about 30%
dimethyl sulfoxide, about 35% dimethyl sulfoxide, or about 40%
dimethyl sulfoxide.
[0100] A suitable formulation or encapsulation solution may also
contain a buffering agent or salt. Exemplary buffering agent may
include HEPES, ammonium sulfate, sodium bicarbonate, sodium
citrate, sodium acetate, potassium phosphate and sodium phosphate.
Exemplary salt may include sodium chloride, magnesium chloride, and
potassium chloride.
Purification
[0101] Typically, subsequent to formulation and encapsulation,
lipid nanoparticles are purified and/or concentrated. Various
purification methods may be used. In some embodiments, lipid
nanoparticles are purified using Tangential Flow Filtration.
Tangential flow filtration (TFF), also referred to as cross-flow
filtration, is a type of filtration wherein the material to be
filtered is passed tangentially across a filter rather than through
it. In TFF, undesired permeate passes through the filter, while the
desired retentate passes along the filter and is collected
downstream. It is important to note that the desired material is
typically contained in the retentate in TFF, which is the opposite
of what one normally encounters in traditional-dead end
filtration.
[0102] Depending upon the material to be filtered, TFF is usually
used for either microfiltration or ultrafiltration. Microfiltration
is typically defined as instances where the filter has a pore size
of between 0.05 .mu.m and 1.0 .mu.m, inclusive, while
ultrafiltration typically involves filters with a pore size of less
than 0.05 .mu.m. Pore size also determines the nominal molecular
weight limits (NMWL), also referred to as the molecular weight cut
off (MWCO) for a particular filter, with microfiltration membranes
typically having NMWLs of greater than 1,000 kilodaltons (kDa) and
ultrafiltration filters having NMWLs of between 1 kDa and 1,000
kDa.
[0103] A principal advantage of tangential flow filtration is that
non-permeable particles that may aggregate in and block the filter
(sometimes referred to as "filter cake") during traditional
"dead-end" filtration, are instead carried along the surface of the
filter. This advantage allows tangential flow filtration to be
widely used in industrial processes requiring continuous operation
since down time is significantly reduced because filters do not
generally need to be removed and cleaned.
[0104] Tangential flow filtration can be used for several purposes
including concentration and diafiltration, among others.
Concentration is a process whereby solvent is removed from a
solution while solute molecules are retained. In order to
effectively concentrate a sample, a membrane having a NMWL or MWCO
that is substantially lower than the molecular weight of the solute
molecules to be retained is used. Generally, one of skill may
select a filter having a NMWL or MWCO of three to six times below
the molecular weight of the target molecule(s).
[0105] Diafiltration is a fractionation process whereby small
undesired particles are passed through a filter while larger
desired nanoparticles are maintained in the retentate without
changing the concentration of those nanoparticles in solution.
Diafiltration is often used to remove salts or reaction buffers
from a solution. Diafiltration may be either continuous or
discontinuous. In continuous diafiltration, a diafiltration
solution is added to the sample feed at the same rate that filtrate
is generated. In discontinuous diafiltration, the solution is first
diluted and then concentrated back to the starting concentration.
Discontinuous diafiltration may be repeated until a desired
concentration of nanoparticles is reached.
[0106] Purified and/or concentrated lipid nanoparticles may be
formulated in a desired buffer such as, for example, PBS.
Provided Nanoparticles Encapsulating mRNA
[0107] A process according to the present invention results in more
homogeneous and smaller particle sizes (e.g., less than 100 nm), as
well as significantly improved encapsulation efficiency and/or mRNA
recovery rate as compared to a prior art process.
[0108] Thus, the present invention provides a composition
comprising purified nanoparticles described herein. In some
embodiments, majority of purified nanoparticles in a composition,
i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have
a size less than about 100 nm (e.g., less than about 95 nm, about
90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65
nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments,
substantially all of the purified nanoparticles have a size less
than 100 nm (e.g., less than about 95 nm, about 90 nm, about 85 nm,
about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm,
about 55 nm, or about 50 nm).
[0109] In addition, more homogeneous nanoparticles with narrow
particle size range are achieved by a process of the present
invention. For example, greater than about 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99% of the purified nanoparticles in a
composition provided by the present invention have a size ranging
from about 40-90 nm (e.g., about 40-85 nm, about 40-80 nm, about
40-75 nm, about 40-70 nm, about 40-65 nm, or about 40-60 nm). In
some embodiments, substantially all of the purified nanoparticles
have a size ranging from about 40-90 nm (e.g., about 40-85 nm,
about 40-80 nm, about 40-75 nm, about 40-70 nm, about 40-65 nm, or
about 40-60 nm).
[0110] In some embodiments, the dispersity, or measure of
heterogeneity in size of molecules (PDI), of nanoparticles in a
composition provided by the present invention is less than about
0.16 (e.g., less than about 0.15, 0.14, 0.13, 0.12, 0.11, 0.10,
0.09, or 0.08).
[0111] In some embodiments, greater than about 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles in a
composition provided by the present invention encapsulate a mRNA
within each individual particle. In some embodiments, substantially
all of the purified lipid nanoparticles in a composition
encapsulate a mRNA within each individual particle.
[0112] In some embodiments, a composition according to the present
invention contains at least about 1 mg, 5 mg, 10 mg, 100 mg, 500
mg, or 1000 mg of encapsulated mRNA. In some embodiments, a process
according to the present invention results in greater than about
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%
recovery of mRNA.
EXAMPLES
[0113] While certain compounds, compositions and methods of the
present invention have been described with specificity in
accordance with certain embodiments, the following examples serve
only to illustrate the compounds of the invention and are not
intended to limit the same.
Example 1. Effect of Temperature on Nanoparticle Encapsulation
Process
[0114] This example demonstrates that an increase in temperature
during nanoparticle encapsulation process results in increased
yield and/or encapsulation efficiency.
Lipid Materials
[0115] The formulations described in the following Examples, unless
otherwise specified, contain a multi-component lipid mixture of
varying ratios employing one or more cationic lipids, helper lipids
(e.g., non-cationic lipids and/or cholesterol lipids) and PEGylated
lipids designed to encapsulate various nucleic acid materials.
Cationic lipids for the process can include but are not limited to
DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP
(1,2-dioleyl-3-dimethylammonium propane), DOTMA
(1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes,
J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid
saturation influences intracellular delivery of encapsulated
nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA
(Semple, S. C. et al. "Rational Design of Cationic Lipids for siRNA
Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, K. T.
et al. "Lipid-like materials for low-dose in vivo gene silencing"
PNAS 2010, 107, 1864-1869), cKK-E12
(3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione),
HGT5000, HGT5001, HGT4003, ICE, dialkylamino-based,
imidazole-based, guanidinium-based, etc. Helper lipids can include
but are not limited to DSPC
(1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC
(1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE
(1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC
(1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE
(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE
(1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG
(,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), cholesterol,
etc. The PEGylated lipids can include but are not limited to a
poly(ethylene) glycol chain of up to 5 kDa in length covalently
attached to a lipid with alkyl chain(s) of C6-C20 length.
Messenger RNA Material
[0116] Codon-optimized human spinal motor neuron 1 (SMN) messenger
RNA, argininosuccinate synthetase (ASS1) messenger RNA, modified
cystic fibrosis transmembrane conductance regulator (SNIM.RTM.
CFTR, 25% pseudouridine, 25% 5-methyl-cytidine) messenger RNA,
firefly luciferase (FFL) messenger RNA, Factor IX (FIX) messenger
RNA, phelyalanine hydroxylase (PAH) messenger RNA and
alpha-galactosidase (GLA) messenger RNA was synthesized by in vitro
transcription from a plasmid DNA template encoding the gene, which
was followed by the addition of a 5' cap structure (Cap 1)
(Fechter, P.; Brownlee, G. G. "Recognition of mRNA cap structures
by viral and cellular proteins" J. Gen. Virology 2005, 86,
1239-1249) and a 3' poly(A) tail of approximately 250 nucleotides
in length (SEQ ID NO: 1) as determined by gel electrophoresis. 5'
and 3' untranslated regions present in each mRNA product are
represented as X and Y, respectively and defined as stated (vide
infra).
TABLE-US-00001 Codon-Optimized Human Spinal Motor Neuron 1(SMN)
mRNA: (SEQ ID NO: 2)
XAUGGCCAUGAGCAGCGGAGGCAGCGGCGGAGGAGUGCCCGAGCAGGAGGACAG
CGUGCUGUUCAGGAGAGGCACCGGCCAGAGCGAUGACAGCGAUAUCUGGGACGA
UACCGCUCUGAUCAAGGCCUACGACAAGGCCGUGGCCAGCUUCAAGCACGCCCUG
AAAAACGGCGACAUCUGCGAGACCAGCGGCAAGCCCAAGACAACCCCCAAGAGAA
AGCCCGCCAAGAAGAAUAAGAGCCAGAAAAAGAACACCGCCGCCAGCCUGCAGCA
GUGGAAGGUGGGCGACAAGUGCAGCGCCAUCUGGAGCGAGGACGGCUGCAUCUA
CCCCGCCACCAUCGCCAGCAUCGACUUCAAGAGAGAGACCUGCGUGGUCGUGUAC
ACCGGCUACGGCAACAGAGAGGAGCAGAACCUGAGCGACCUGCUGAGCCCCAUUU
GUGAGGUGGCCAAUAACAUCGAACAGAACGCCCAGGAGAACGAGAAUGAAAGCC
AGGUGAGCACCGACGAGAGCGAGAACAGCAGAUCUCCUGGCAACAAGAGCGACAA
CAUCAAGCCUAAGUCUGCCCCUUGGAACAGCUUCCUGCCCCCUCCUCCACCCAUG
CCCGGACCCAGACUGGGACCCGGAAAACCUGGCCUGAAGUUCAACGGACCACCUC
CCCCUCCACCUCCUCCCCCACCUCAUCUCCUGAGCUGCUGGCUGCCACCCUUCCCC
AGCGGACCCCCUAUCAUCCCACCACCCCCUCCCAUCUGCCCCGACAGCCUGGACGA
CGCCGAUGCCCUGGGCAGCAUGCUGAUCAGCUGGUACAUGAGCGGCUACCACACA
GGAUACUACAUGGGCUUCAGACAGAACCAGAAGGAGGGCAGAUGCUCCCACUCCC UGAACUGAY
Human alpha-galactosidase (GLA) mRNA: (SEQ ID NO: 3)
XAUGCAGCUGAGGAACCCAGAACUACAUCUGGGCUGCGCGCUUGCGCUUCGCUUC
CUGGCCCUCGUUUCCUGGGACAUCCCUGGGGCUAGAGCACUGGACAAUGGAUUGG
CAAGGACGCCUACCAUGGGCUGGCUGCACUGGGAGCGCUUCAUGUGCAACCUUGA
CUGCCAGGAAGAGCCAGAUUCCUGCAUCAGUGAGAAGCUCUUCAUGGAGAUGGC
AGAGCUCAUGGUCUCAGAAGGCUGGAAGGAUGCAGGUUAUGAGUACCUCUGCAU
UGAUGACUGUUGGAUGGCUCCCCAAAGAGAUUCAGAAGGCAGACUUCAGGCAGA
CCCUCAGCGCUUUCCUCAUGGGAUUCGCCAGCUAGCUAAUUAUGUUCACAGCAAA
GGACUGAAGCUAGGGAUUUAUGCAGAUGUUGGAAAUAAAACCUGCGCAGGCUUC
CCUGGGAGUUUUGGAUACUACGACAUUGAUGCCCAGACCUUUGCUGACUGGGGA
GUAGAUCUGCUAAAAUUUGAUGGUUGUUACUGUGACAGUUUGGAAAAUUUGGCA
GAUGGUUAUAAGCACAUGUCCUUGGCCCUGAAUAGGACUGGCAGAAGCAUUGUG
UACUCCUGUGAGUGGCCUCUUUAUAUGUGGCCCUUUCAAAAGCCCAAUUAUACAG
AAAUCCGACAGUACUGCAAUCACUGGCGAAAUUUUGCUGACAUUGAUGAUUCCU
GGAAAAGUAUAAAGAGUAUCUUGGACUGGACAUCUUUUAACCAGGAGAGAAUUG
UUGAUGUUGCUGGACCAGGGGGUUGGAAUGACCCAGAUAUGUUAGUGAUUGGCA
ACUUUGGCCUCAGCUGGAAUCAGCAAGUAACUCAGAUGGCCCUCUGGGCUAUCAU
GGCUGCUCCUUUAUUCAUGUCUAAUGACCUCCGACACAUCAGCCCUCAAGCCAAA
GCUCUCCUUCAGGAUAAGGACGUAAUUGCCAUCAAUCAGGACCCCUUGGGCAAGC
AAGGGUACCAGCUUAGACAGGGAGACAACUUUGAAGUGUGGGAACGACCUCUCU
CAGGCUUAGCCUGGGCUGUAGCUAUGAUAAACCGGCAGGAGAUUGGUGGACCUC
GCUCUUAUACCAUCGCAGUUGCUUCCCUGGGUAAAGGAGUGGCCUGUAAUCCUGC
CUGCUUCAUCACACAGCUCCUCCCUGUGAAAAGGAAGCUAGGGUUCUAUGAAUGG
ACUUCAAGGUUAAGAAGUCACAUAAAUCCCACAGGCACUGUUUUGCUUCAGCUA
GAAAAUACAAUGCAGAUGUCAUUAAAAGACUUACUUUAAY Codon-Optimized Human
Argininosuccinate Synthetase (ASS1) mRNA: (SEQ ID NO: 4)
XAUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGC
UGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCA
ACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGG
CGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAU
CUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACC
AGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGG
GCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUU
CGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGC
AUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCA
AGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGA
GAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAG
GCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCC
CGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGU
GAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAG
GUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCG
GCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGC
CCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAG
GGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCG
AGUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAA
GGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCC
CUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAG
CCCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACC
ACCGCCUGCAGAGCAAGGUGACCGCCAAGUGAY Codon-Optimized Firefly
Luciferase mRNA: (SEQ ID NO: 5)
XAUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAA
GACGGGACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGC
CCGGCACCAUCGCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGA
GUACUUCGAGAUGAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAA
UACAAACCAUCGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCC
GUGUUGGGUGCCCUGUUCAUCGGUGUGGCUGUGGCCCCAGCUAACGACAUCUACA
ACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCCAGCCCACCGUCGUAUUCGU
GAGCAAGAAAGGGCUGCAAAAGAUCCUCAACGUGCAAAAGAAGCUACCGAUCAU
ACAAAAGAUCAUCAUCAUGGAUAGCAAGACCGACUACCAGGGCUUCCAAAGCAUG
UACACCUUCGUGACUUCCCAUUUGCCACCCGGCUUCAACGAGUACGACUUCGUGC
CCGAGAGCUUCGACCGGGACAAAACCAUCGCCCUGAUCAUGAACAGUAGUGGCAG
UACCGGAUUGCCCAAGGGCGUAGCCCUACCGCACCGCACCGCUUGUGUCCGAUUC
AGUCAUGCCCGCGACCCCAUCUUCGGCAACCAGAUCAUCCCCGACACCGCUAUCC
UCAGCGUGGUGCCAUUUCACCACGGCUUCGGCAUGUUCACCACGCUGGGCUACUU
GAUCUGCGGCUUUCGGGUCGUGCUCAUGUACCGCUUCGAGGAGGAGCUAUUCUU
GCGCAGCUUGCAAGACUAUAAGAUUCAAUCUGCCCUGCUGGUGCCCACACUAUUU
AGCUUCUUCGCUAAGAGCACUCUCAUCGACAAGUACGACCUAAGCAACUUGCACG
AGAUCGCCAGCGGCGGGGCGCCGCUCAGCAAGGAGGUAGGUGAGGCCGUGGCCAA
ACGCUUCCACCUACCAGGCAUCCGCCAGGGCUACGGCCUGACAGAAACAACCAGC
GCCAUUCUGAUCACCCCCGAAGGGGACGACAAGCCUGGCGCAGUAGGCAAGGUGG
UGCCCUUCUUCGAGGCUAAGGUGGUGGACUUGGACACCGGUAAGACACUGGGUG
UGAACCAGCGCGGCGAGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGU
UAACAACCCCGAGGCUACAAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGC
GGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCUUCAUCGUGGACCGGCUGA
AGAGCCUGAUCAAAUACAAGGGCUACCAGGUAGCCCCAGCCGAACUGGAGAGCAU
CCUGCUGCAACACCCCAACAUCUUCGACGCCGGGGUCGCCGGCCUGCCCGACGAC
GAUGCCGGCGAGCUGCCCGCCGCAGUCGUCGUGCUGGAACACGGUAAAACCAUGA
CCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCCAGGUUACAACCGCCAAGAAGCU
GCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAAAGGACUGACCGGCAAGUU
GGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAGAAGGGCGGCAAGAUC GCCGUGUAAY
Human Factor IX (FIX) mRNA: (SEQ ID NO: 6)
XAUGCAGCGCGUGAACAUGAUCAUGGCAGAAUCACCAGGCCUCAUCACCAUCUGC
CUUUUAGGAUAUCUACUCAGUGCUGAAUGUACAGUUUUUCUUGAUCAUGAAAAC
GCCAACAAAAUUCUGAGGCGGAGAAGGAGGUAUAAUUCAGGUAAAUUGGAAGAG
UUUGUUCAAGGGAACCUUGAGAGAGAAUGUAUGGAAGAAAAGUGUAGUUUUGAA
GAAGCACGAGAAGUUUUUGAAAACACUGAAAGAACAACUGAAUUUUGGAAGCAG
UAUGUUGAUGGAGAUCAGUGUGAGUCCAAUCCAUGUUUAAAUGGCGGCAGUUGC
AAGGAUGACAUUAAUUCCUAUGAAUGUUGGUGUCCCUUUGGAUUUGAAGGAAAG
AACUGUGAAUUAGAUGUAACAUGUAACAUUAAGAAUGGCAGAUGCGAGCAGUUU
UGUAAAAAUAGUGCUGAUAACAAGGUGGUUUGCUCCUGUACUGAGGGAUAUCGA
CUUGCAGAAAACCAGAAGUCCUGUGAACCAGCAGUGCCAUUUCCAUGUGGAAGA
GUUUCUGUUUCACAAACUUCUAAGCUCACCCGUGCUGAGGCUGUUUUUCCUGAUG
UGGACUAUGUAAAUUCUACUGAAGCUGAAACCAUUUUGGAUAACAUCACUCAAA
GCACCCAAUCAUUUAAUGACUUCACUCGGGUUGUUGGUGGAGAAGAUGCCAAAC
CAGGUCAAUUCCCUUGGCAGGUUGUUUUGAAUGGUAAAGUUGAUGCAUUCUGUG
GAGGCUCUAUCGUUAAUGAAAAAUGGAUUGUAACUGCUGCCCACUGUGUUGAAA
CUGGUGUUAAAAUUACAGUUGUCGCAGGUGAACAUAAUAUUGAGGAGACAGAAC
AUACAGAGCAAAAGCGAAAUGUGAUUCGAAUUAUUCCUCACCACAACUACAAUG
CAGCUAUUAAUAAGUACAACCAUGACAUUGCCCUUCUGGAACUGGACGAACCCUU
AGUGCUAAACAGCUACGUUACACCUAUUUGCAUUGCUGACAAGGAAUACACGAA
CAUCUUCCUCAAAUUUGGAUCUGGCUAUGUAAGUGGCUGGGGAAGAGUCUUCCA
CAAAGGGAGAUCAGCUUUAGUUCUUCAGUACCUUAGAGUUCCACUUGUUGACCG
AGCCACAUGUCUUCGAUCUACAAAGUUCACCAUCUAUAACAACAUGUUCUGUGCU
GGCUUCCAUGAAGGAGGUAGAGAUUCAUGUCAAGGAGAUAGUGGGGGACCCCAU
GUUACUGAAGUGGAAGGGACCAGUUUCUUAACUGGAAUUAUUAGCUGGGGUGAA
GAGUGUGCAAUGAAAGGCAAAUAUGGAAUAUAUACCAAGGUAUCCCGGUAUGUC
AACUGGAUUAAGGAAAAAACAAAGCUCACUUAAY Codon-Optimized Human
Phenylalanine Hydroxylase (PAH) mRNA: (SEQ ID NO: 7)
XAUGAGCACCGCCGUGCUGGAGAACCCCGGCCUGGGCCGCAAGCUGAGCGACUUC
GGCCAGGAGACCAGCUACAUCGAGGACAACUGCAACCAGAACGGCGCCAUCAGCC
UGAUCUUCAGCCUGAAGGAGGAGGUGGGCGCCCUGGCCAAGGUGCUGCGCCUGUU
CGAGGAGAACGACGUGAACCUGACCCACAUCGAGAGCCGCCCCAGCCGCCUGAAG
AAGGACGAGUACGAGUUCUUCACCCACCUGGACAAGCGCAGCCUGCCCGCCCUGA
CCAACAUCAUCAAGAUCCUGCGCCACGACAUCGGCGCCACCGUGCACGAGCUGAG
CCGCGACAAGAAGAAGGACACCGUGCCCUGGUUCCCCCGCACCAUCCAGGAGCUG
GACCGCUUCGCCAACCAGAUCCUGAGCUACGGCGCCGAGCUGGACGCCGACCACC
CCGGCUUCAAGGACCCCGUGUACCGCGCCCGCCGCAAGCAGUUCGCCGACAUCGC
CUACAACUACCGCCACGGCCAGCCCAUCCCCCGCGUGGAGUACAUGGAGGAGGAG
AAGAAGACCUGGGGCACCGUGUUCAAGACCCUGAAGAGCCUGUACAAGACCCACG
CCUGCUACGAGUACAACCACAUCUUCCCCCUGCUGGAGAAGUACUGCGGCUUCCA
CGAGGACAACAUCCCCCAGCUGGAGGACGUGAGCCAGUUCCUGCAGACCUGCACC
GGCUUCCGCCUGCGCCCCGUGGCCGGCCUGCUGAGCAGCCGCGACUUCCUGGGCG
GCCUGGCCUUCCGCGUGUUCCACUGCACCCAGUACAUCCGCCACGGCAGCAAGCC
CAUGUACACCCCCGAGCCCGACAUCUGCCACGAGCUGCUGGGCCACGUGCCCCUG
UUCAGCGACCGCAGCUUCGCCCAGUUCAGCCAGGAGAUCGGCCUGGCCAGCCUGG
GCGCCCCCGACGAGUACAUCGAGAAGCUGGCCACCAUCUACUGGUUCACCGUGGA
GUUCGGCCUGUGCAAGCAGGGCGACAGCAUCAAGGCCUACGGCGCCGGCCUGCUG
AGCAGCUUCGGCGAGCUGCAGUACUGCCUGAGCGAGAAGCCCAAGCUGCUGCCCC
UGGAGCUGGAGAAGACCGCCAUCCAGAACUACACCGUGACCGAGUUCCAGCCCCU
GUACUACGUGGCCGAGAGCUUCAACGACGCCAAGGAGAAGGUGCGCAACUUCGCC
GCCACCAUCCCCCGCCCCUUCAGCGUGCGCUACGACCCCUACACCCAGCGCAUCGA
GGUGCUGGACAACACCCAGCAGCUGAAGAUCCUGGCCGACAGCAUCAACAGCGAG
AUCGGCAUCCUGUGCAGCGCCCUGCAGAAGAUCAAGUAAY Codon-Optimized Cystic
Fibrosis Transmembrane Conductance Regulator (CFTR) mRNA: (SEQ ID
NO: 8) AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCAU
GGACUCGGCCUAUCCUUAGAAAGGGGUAUCGGCAGAGGCUUGAGUUGUCUGACA
UCUACCAGAUCCCCUCGGUAGAUUCGGCGGAUAACCUCUCGGAGAAGCUCGAACG
GGAAUGGGACCGCGAACUCGCGUCUAAGAAAAACCCGAAGCUCAUCAACGCACUG
AGAAGGUGCUUCUUCUGGCGGUUCAUGUUCUACGGUAUCUUCUUGUAUCUCGGG
GAGGUCACAAAAGCAGUCCAACCCCUGUUGUUGGGUCGCAUUAUCGCCUCGUACG
ACCCCGAUAACAAAGAAGAACGGAGCAUCGCGAUCUACCUCGGGAUCGGACUGUG
UUUGCUUUUCAUCGUCAGAACACUUUUGUUGCAUCCAGCAAUCUUCGGCCUCCAU
CACAUCGGUAUGCAGAUGCGAAUCGCUAUGUUUAGCUUGAUCUACAAAAAGACA
CUGAAACUCUCGUCGCGGGUGUUGGAUAAGAUUUCCAUCGGUCAGUUGGUGUCC
CUGCUUAGUAAUAACCUCAACAAAUUCGAUGAGGGACUGGCGCUGGCACAUUUC
GUGUGGAUUGCCCCGUUGCAAGUCGCCCUUUUGAUGGGCCUUAUUUGGGAGCUG
UUGCAGGCAUCUGCCUUUUGUGGCCUGGGAUUUCUGAUUGUGUUGGCAUUGUUU
CAGGCUGGGCUUGGGCGGAUGAUGAUGAAGUAUCGCGACCAGAGAGCGGGUAAA
AUCUCGGAAAGACUCGUCAUCACUUCGGAAAUGAUCGAAAACAUCCAGUCGGUCA
AAGCCUAUUGCUGGGAAGAAGCUAUGGAGAAGAUGAUUGAAAACCUCCGCCAAA
CUGAGCUGAAACUGACCCGCAAGGCGGCGUAUGUCCGGUAUUUCAAUUCGUCAGC
GUUCUUCUUUUCCGGGUUCUUCGUUGUCUUUCUCUCGGUUUUGCCUUAUGCCUUG
AUUAAGGGGAUUAUCCUCCGCAAGAUUUUCACCACGAUUUCGUUCUGCAUUGUA
UUGCGCAUGGCAGUGACACGGCAAUUUCCGUGGGCCGUGCAGACAUGGUAUGAC
UCGCUUGGAGCGAUCAACAAAAUCCAAGACUUCUUGCAAAAGCAAGAGUACAAG
ACCCUGGAGUACAAUCUUACUACUACGGAGGUAGUAAUGGAGAAUGUGACGGCU
UUUUGGGAAGAGGGUUUUGGAGAACUGUUUGAGAAAGCAAAGCAGAAUAACAAC
AACCGCAAGACCUCAAAUGGGGACGAUUCCCUGUUUUUCUCGAACUUCUCCCUGC
UCGGAACACCCGUGUUGAAGGACAUCAAUUUCAAGAUUGAGAGGGGACAGCUUC
UCGCGGUAGCGGGAAGCACUGGUGCGGGAAAAACUAGCCUCUUGAUGGUGAUUA
UGGGGGAGCUUGAGCCCAGCGAGGGGAAGAUUAAACACUCCGGGCGUAUCUCAU
UCUGUAGCCAGUUUUCAUGGAUCAUGCCCGGAACCAUUAAAGAGAACAUCAUUU
UCGGAGUAUCCUAUGAUGAGUACCGAUACAGAUCGGUCAUUAAGGCGUGCCAGU
UGGAAGAGGACAUUUCUAAGUUCGCCGAGAAGGAUAACAUCGUCUUGGGAGAAG
GGGGUAUUACAUUGUCGGGAGGGCAGCGAGCGCGGAUCAGCCUCGCGAGAGCGG
UAUACAAAGAUGCAGAUUUGUAUCUGCUUGAUUCACCGUUUGGAUACCUCGACG
UAUUGACAGAAAAAGAAAUCUUCGAGUCGUGCGUGUGUAAACUUAUGGCUAAUA
AGACGAGAAUCCUGGUGACAUCAAAAAUGGAACACCUUAAGAAGGCGGACAAGA
UCCUGAUCCUCCACGAAGGAUCGUCCUACUUUUACGGCACUUUCUCAGAGUUGCA
AAACUUGCAGCCGGACUUCUCAAGCAAACUCAUGGGGUGUGACUCAUUCGACCAG
UUCAGCGCGGAACGGCGGAACUCGAUCUUGACGGAAACGCUGCACCGAUUCUCGC
UUGAGGGUGAUGCCCCGGUAUCGUGGACCGAGACAAAGAAGCAGUCGUUUAAGC
AGACAGGAGAAUUUGGUGAGAAAAGAAAGAACAGUAUCUUGAAUCCUAUUAACU
CAAUUCGCAAGUUCUCAAUCGUCCAGAAAACUCCACUGCAGAUGAAUGGAAUUG
AAGAGGAUUCGGACGAACCCCUGGAGCGCAGGCUUAGCCUCGUGCCGGAUUCAGA
GCAAGGGGAGGCCAUUCUUCCCCGGAUUUCGGUGAUUUCAACCGGACCUACACUU
CAGGCGAGGCGAAGGCAAUCCGUGCUCAACCUCAUGACGCAUUCGGUAAACCAGG
GGCAAAACAUUCACCGCAAAACGACGGCCUCAACGAGAAAAGUGUCACUUGCACC
CCAGGCGAAUUUGACUGAACUCGACAUCUACAGCCGUAGGCUUUCGCAAGAAACC
GGACUUGAGAUCAGCGAAGAAAUCAAUGAAGAAGAUUUGAAAGAGUGUUUCUUU
GAUGACAUGGAAUCAAUCCCAGCGGUGACAACGUGGAACACAUACUUGCGUUAC
AUCACGGUGCACAAGUCCUUGAUUUUCGUCCUCAUCUGGUGUCUCGUGAUCUUUC
UCGCUGAGGUCGCAGCGUCACUUGUGGUCCUCUGGCUGCUUGGUAAUACGCCCUU
GCAAGACAAAGGCAAUUCUACACACUCAAGAAACAAUUCCUAUGCCGUGAUUAUC
ACUUCUACAAGCUCGUAUUACGUGUUUUACAUCUACGUAGGAGUGGCCGACACUC
UGCUCGCGAUGGGUUUCUUCCGAGGACUCCCACUCGUUCACACGCUUAUCACUGU
CUCCAAGAUUCUCCACCAUAAGAUGCUUCAUAGCGUACUGCAGGCUCCCAUGUCC
ACCUUGAAUACGCUCAAGGCGGGAGGUAUUUUGAAUCGCUUCUCAAAAGAUAUU
GCAAUUUUGGAUGACCUUCUGCCCCUGACGAUCUUCGACUUCAUCCAGUUGUUGC
UGAUCGUGAUUGGGGCUAUUGCAGUAGUCGCUGUCCUCCAGCCUUACAUUUUUG
UCGCGACCGUUCCGGUGAUCGUGGCGUUUAUCAUGCUGCGGGCCUAUUUCUUGCA
GACGUCACAGCAGCUUAAGCAACUGGAGUCUGAAGGGAGGUCGCCUAUCUUUAC
GCAUCUUGUGACCAGUUUGAAGGGAUUGUGGACGUUGCGCGCCUUUGGCAGGCA
GCCCUACUUUGAAACACUGUUCCACAAAGCGCUGAAUCUCCAUACGGCAAAUUGG
UUUUUGUAUUUGAGUACCCUCCGAUGGUUUCAGAUGCGCAUUGAGAUGAUUUUU
GUGAUCUUCUUUAUCGCGGUGACUUUUAUCUCCAUCUUGACCACGGGAGAGGGC
GAGGGACGGGUCGGUAUUAUCCUGACACUCGCCAUGAACAUUAUGAGCACUUUG
CAGUGGGCAGUGAACAGCUCGAUUGAUGUGGAUAGCCUGAUGAGGUCCGUUUCG
AGGGUCUUUAAGUUCAUCGACAUGCCGACGGAGGGAAAGCCCACAAAAAGUACG
AAACCCUAUAAGAAUGGGCAAUUGAGUAAGGUAAUGAUCAUCGAGAACAGUCAC
GUGAAGAAGGAUGACAUCUGGCCUAGCGGGGGUCAGAUGACCGUGAAGGACCUG
ACGGCAAAAUACACCGAGGGAGGGAACGCAAUCCUUGAAAACAUCUCGUUCAGCA
UUAGCCCCGGUCAGCGUGUGGGGUUGCUCGGGAGGACCGGGUCAGGAAAAUCGA
CGUUGCUGUCGGCCUUCUUGAGACUUCUGAAUACAGAGGGUGAGAUCCAGAUCG
ACGGCGUUUCGUGGGAUAGCAUCACCUUGCAGCAGUGGCGGAAAGCGUUUGGAG
UAAUCCCCCAAAAGGUCUUUAUCUUUAGCGGAACCUUCCGAAAGAAUCUCGAUCC
UUAUGAACAGUGGUCAGAUCAAGAGAUUUGGAAAGUCGCGGACGAGGUUGGCCU
UCGGAGUGUAAUCGAGCAGUUUCCGGGAAAACUCGACUUUGUCCUUGUAGAUGG
GGGAUGCGUCCUGUCGCAUGGGCACAAGCAGCUCAUGUGCCUGGCGCGAUCCGUC
CUCUCUAAAGCGAAAAUUCUUCUCUUGGAUGAACCUUCGGCCCAUCUGGACCCGG
UAACGUAUCAGAUCAUCAGAAGGACACUUAAGCAGGCGUUUGCCGACUGCACGG
UGAUUCUCUGUGAGCAUCGUAUCGAGGCCAUGCUCGAAUGCCAGCAAUUUCUUG
UCAUCGAAGAGAAUAAGGUCCGCCAGUACGACUCCAUCCAGAAGCUGCUUAAUGA
GAGAUCAUUGUUCCGGCAGGCGAUUUCACCAUCCGAUAGGGUGAAACUUUUUCC
ACACAGAAAUUCGUCGAAGUGCAAGUCCAAACCGCAGAUCGCGGCCUUGAAAGAA
GAGACUGAAGAAGAAGUUCAAGACACGCGUCUUUAA 5' and 3' UTR Sequences X =
(SEQ ID NO: 9)
GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACC
GGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCG
UGCCAAGAGUGACUCACCGUCCUUGACACG Y = (SEQ ID NO: 10)
CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCC
ACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU
Lipid Nanoparticle Formulations
[0117] Ethanolic solution of mixture of lipids (cationic lipid,
helper lipids, zwitterionic lipids, PEG lipids etc.) was prepared
to the reported volume and heated to the selected temperature.
Separately, an aqueous buffered solution (10 mM citrate/150 mM
NaCl, pH 4.5) of mRNA was prepared from a 1 mg/mL stock and heated
to the selected temperature for 5-10 minutes.
[0118] For small scale formulations, the lipid solution was
injected rapidly into the aqueous mRNA solution using a syringe
pump (3.71 mL/sec) and the resulting suspension was shaken to yield
the lipid nanoparticles in 20% ethanol. The resulting nanoparticle
suspension was dia-filtrated with 1.times.PBS (pH 7.4),
concentrated and stored at 2-8.degree. C.
Representative Example at 25.degree. C.
[0119] Aliquots of 50 mg/mL ethanolic solutions of cKK-E12, DOPE,
Chol and DMG-PEG2K were mixed and diluted with ethanol to 3 mL
final volume. Separately, an aqueous buffered solution (10 mM
citrate/150 mM NaCl, pH 4.5) of FFL mRNA was prepared from a 1
mg/mL stock. The lipid solution was injected rapidly into the
aqueous mRNA solution and shaken to yield a final suspension in 20%
ethanol. The resulting nanoparticle suspension was filtered,
diafiltrated with 1.times.PBS (pH 7.4), concentrated and stored at
2-8.degree. C. Final concentration=0.20 mg/mL FFL mRNA
(encapsulated). Z.sub.ave=91 nm PDI (0.16).
Formulation at 37.degree. C.
[0120] Aliquots of 50 mg/mL ethanolic solutions of cKK-E12, DOPE,
Chol and DMG-PEG2K were mixed and diluted with ethanol to 3 mL
final volume. Separately, an aqueous buffered solution (10 mM
citrate/150 mM NaCl, pH 4.5) of FIX mRNA was prepared from a 1
mg/mL stock. The lipid solution was injected rapidly into the
aqueous mRNA solution and shaken to yield a final suspension in 20%
ethanol. The resulting nanoparticle suspension was filtered,
diafiltrated with 1.times.PBS (pH 7.4), concentrated and stored at
2-8.degree. C. Final concentration=0.20 mg/mL FIX mRNA
(encapsulated). Z.sub.ave=64 nm; PDI (0.12).
Formulation at 65.degree. C.
[0121] Aliquots of 50 mg/mL ethanolic solutions of cKK-E12, DOPE,
Chol and DMG-PEG2K were mixed and diluted with ethanol to 3 mL
final volume. Separately, an aqueous buffered solution (10 mM
citrate/150 mM NaCl, pH 4.5) of FIX mRNA was prepared from a 1
mg/mL stock. The lipid solution was injected rapidly into the
aqueous mRNA solution and shaken to yield a final suspension in 20%
ethanol. The resulting nanoparticle suspension was filtered,
diafiltrated with 1.times.PBS (pH 7.4), concentrated and stored at
2-8.degree. C. Final concentration=0.20 mg/mL FIX mRNA
(encapsulated). Z.sub.ave=73 nm; PDI (0.13).
Effect of Temperature on the Nanoparticle Encapsulation Process
[0122] Both the ethanol lipid solution and the aqueous buffered
solution of mRNA (10 mM citrate/150 mM NaCl, pH 4.5) were heated at
different selected temperatures before the formulation process to
determine the effect of temperature on the final yield and the
encapsulation efficiency of the formulation.
[0123] The effect of temperature on the nanoparticle formulation
process was evaluated for size, size dispersity, encapsulation
efficiency and yield (or recovery). Exemplary data are shown in
Table 1. As can be seen, an increase in temperature (e.g., above
the ambient temperature) results in increased encapsulation
efficiency and/or yield/recover, as well as reduced particle size
and/or size dispersity.
TABLE-US-00002 TABLE 1 Effect of Temperature on Nanoparticle
Formation and mRNA Encapsulation Formulation # mRNA Temperature
Size PDI Encapsulation Recovery Formulation process at ambient
temperature (25.degree. C.): 1 FFL 25 91 0.16 71% 30% 2 FFL 25 88
0.14 76% 33% Formulation process at 37.degree. C.: 3 FIX 37 77 0.13
57% 29% 4 FIX 37 80 0.12 68% 36% 5 FIX 37 64 0.12 69% 37% 6 FIX 37
63 0.12 65% 51% Formulation process at 65.degree. C.: 7 ASS1 65 86
0.12 85% 64% 8 ASS1 65 84 0.11 96% 98% 9 ASS1 65 81 0.16 86% 64% 10
ASS1 65 84 0.11 96% 98% 11 PAH 65 79 0.12 82% 77% 12 FIX 65 73 0.13
81% 77% 13 FIX 65 79 0.14 92% 82% 14 FIX 65 85 0.13 95% 70% 15 FFL
65 68 0.10 92% 78% 16 FFL 65 83 0.12 91% 77% 17 FFL 65 80 0.11 91%
75% 18 FFL 65 83 0.11 88% 72% 19 FFL 65 80 0.16 90% 75% 20 FFL 65
78 0.11 81% 77% 21 FFL 65 86 0.12 82% 75%
Example 2. Scaled-Up Formulation Process
[0124] This example illustrates an exemplary scaled-up formulation
process for encapsulating mRNA at an increased temperature.
[0125] An exemplary scaled-up formulation process is shown in FIG.
1. Ismatec programmable digital drive pumps (Cole Parmer Model #CP
78008-10) were used. Micropump A-mount Suction Shoe Pump Head 316
SS body/graphite gears/PTFE seals, 0.084 mL/rev, w/out internal
bypass (Cole Parmer Model #07002-27) and Pharma Pure Tubing Size
14, 0.06'' ID, 1/16'' (Spectrum labs Part #ACTU-P14-25N) were
used.
[0126] Nanoparticle formulation and encapsulation of mRNA is
prepared by mixing an ethanol lipid solution with mRNA in citrate
buffer (10 mM citrate buffer, 150 mM NaCl, pH 4.5) using a `T`
junction (or "Y" junction). Exemplary flow rates for the mRNA in
citrate buffer and lipids in ethanol solution are 200 mL/minute and
50 mL/minute respectively. During this process, both pumps are
started simultaneously. Both the starting and the end fractions of
the formulations are discarded, only the intermediate formulation
is collected. Accurate flow rates and pulse less flow are two
important parameters of this process.
Purification and Buffer Exchange
[0127] Purification and buffer exchange of the formulation from the
above step is performed with KrosFlo.RTM. Research IIi Tangential
Flow Filtration system from Spectrum labs using the modified
polyethersulfone hollow fiber filter modules. Buffer exchange is
performed with 6.times. volumes of sterile PBS (pH 7.4) in a
continuous diafiltration form. See FIG. 2. Formulation is analyzed
for Size (PDI) and encapsulation (yield). Exemplary data is
presented in Table 2.
TABLE-US-00003 TABLE 2 Examples of scaled-up formulation
Formulation Batch Size (mg) N/P mRNA Size (nm) PDI Encapsulation 22
5 4 ASS1 59 0.09 88% 23 5 4 ASS1 60 0.12 81% 24 5 4 ASS1 59 0.11
92% 25 5 4 ASS1 62 0.12 91% 26 5 4 ASS1 59 0.11 89% 27 5 4 ASS1 62
0.07 97% 28 5 4 ASS1 57 0.12 91% 29 5 4 ASS1 62 0.07 97% 30 5 4
ASS1 67 0.12 88% 31 5 4 ASS1 60 0.15 82% 32 5 4 ASS1 75 0.09 92% 33
5 4 ASS1 67 0.12 91% 34 5 4 ASS1 71 0.13 92% 35 5 4 ASS1 69 0.11
92% 36 5 4 ASS1 66 0.13 94% 37 5 4 ASS1 72 0.11 94% 38 5 4 ASS1 82
0.13 96% 39 5 4 ASS1 62 0.12 90% 40 5 4 ASS1 60 0.11 86% 41 5 4
ASS1 67 0.15 91% 42 5 4 ASS1 69 0.14 94% 43 5 4 ASS1 65 0.16 90% 44
5 4 ASS1 63 0.12 89% 45 5 4 ASS1 65 0.08 86% 46 5 4 GLA 62 0.11 95%
47 5 4 GLA 57 0.16 89% 48 5 4 GLA 54 0.08 95% 49 5 4 GLA 62 0.12
88% 50 5 2 SMN 61 0.14 81% 51 5 4 25% s2U, 60 0.13 96% 25% 5mC CFTR
52 20 2 ASS1 72 0.10 90% 53 20 4 ASS1 75 0.12 92% 54 20 4 ASS1 81
0.11 82% 55 20 6 FFluc 82 0.11 94% 56 20 4 FFLuc 78 0.11 94% 57 20
4 CFTR 80 0.12 98% 58 30 4 CFTR 75 0.12 85% 59 50 4 CFTR 69 0.17
92% 60 50 2 ASS1 73 0.15 82% 61 60 4 ASS1 71 0.13 95% 62 300 2 ASS1
59 0.18 95% 63 300 4 ASS1 64 0.11 96% 64 1000 2 ASS1 51 0.18 89% 65
1000 4 ASS1 61 0.19 91% 66 1000 2 ASS1 56 0.18 81% 67 1000 4 ASS1
71 0.08 92% 68 1000 2 ASS1 51 0.12 90% 69 1000 4 ASS1 73 0.13 89%
AVERAGE 65.8 0.12 91%
[0128] Using this process, very narrow particle size range is
achieved as well as high encapsulation efficiency (e.g., >90%
average).
[0129] To test the importance of pulse-less homogeneous flow,
peristaltic pumps that have some degree of pulsating flow were used
for the formulation process. See FIG. 3. mRNA in citrate buffer and
lipids in pure ethanol were mixed at flow rate of 200 mL/minute and
50 mL/minute respectively. Exemplary results were shown in Table 3.
As can be seen, the use of peristaltic pumps within this process
results in the formulation of nanoparticles with larger size. This
is likely due to non-homogeneous mixing due to pulsating flow.
TABLE-US-00004 TABLE 3 Examples of formulations with peristaltic
pumps Formulation # mRNA Size(nm) PDI 70 CFTR 112 0.19 71 CFTR 116
0.17 72 FFL 128 0.14 73 FFL 134 0.16
EQUIVALENTS AND SCOPE
[0130] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. The scope of the present invention is not intended to be
limited to the above Description, but rather is as set forth in the
following claims:
Sequence CWU 1
1
101250DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotideSee specification as filed for detailed
description of substitutions and preferred embodiments 1aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
120aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 180aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 240aaaaaaaaaa 25021130RNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
2ggacagaucg ccuggagacg ccauccacgc uguuuugacc uccauagaag acaccgggac
60cgauccagcc uccgcggccg ggaacggugc auuggaacgc ggauuccccg ugccaagagu
120gacucaccgu ccuugacacg auggccauga gcagcggagg cagcggcgga
ggagugcccg 180agcaggagga cagcgugcug uucaggagag gcaccggcca
gagcgaugac agcgauaucu 240gggacgauac cgcucugauc aaggccuacg
acaaggccgu ggccagcuuc aagcacgccc 300ugaaaaacgg cgacaucugc
gagaccagcg gcaagcccaa gacaaccccc aagagaaagc 360ccgccaagaa
gaauaagagc cagaaaaaga acaccgccgc cagccugcag caguggaagg
420ugggcgacaa gugcagcgcc aucuggagcg aggacggcug caucuacccc
gccaccaucg 480ccagcaucga cuucaagaga gagaccugcg uggucgugua
caccggcuac ggcaacagag 540aggagcagaa ccugagcgac cugcugagcc
ccauuuguga gguggccaau aacaucgaac 600agaacgccca ggagaacgag
aaugaaagcc aggugagcac cgacgagagc gagaacagca 660gaucuccugg
caacaagagc gacaacauca agccuaaguc ugccccuugg aacagcuucc
720ugcccccucc uccacccaug cccggaccca gacugggacc cggaaaaccu
ggccugaagu 780ucaacggacc accucccccu ccaccuccuc ccccaccuca
ucuccugagc ugcuggcugc 840cacccuuccc cagcggaccc ccuaucaucc
caccaccccc ucccaucugc cccgacagcc 900uggacgacgc cgaugcccug
ggcagcaugc ugaucagcug guacaugagc ggcuaccaca 960caggauacua
caugggcuuc agacagaacc agaaggaggg cagaugcucc cacucccuga
1020acugacgggu ggcaucccug ugaccccucc ccagugccuc uccuggcccu
ggaaguugcc 1080acuccagugc ccaccagccu uguccuaaua aaauuaaguu
gcaucaagcu 113031535RNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 3ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
augcagcuga ggaacccaga acuacaucug ggcugcgcgc 180uugcgcuucg
cuuccuggcc cucguuuccu gggacauccc uggggcuaga gcacuggaca
240auggauuggc aaggacgccu accaugggcu ggcugcacug ggagcgcuuc
augugcaacc 300uugacugcca ggaagagcca gauuccugca ucagugagaa
gcucuucaug gagauggcag 360agcucauggu cucagaaggc uggaaggaug
cagguuauga guaccucugc auugaugacu 420guuggauggc uccccaaaga
gauucagaag gcagacuuca ggcagacccu cagcgcuuuc 480cucaugggau
ucgccagcua gcuaauuaug uucacagcaa aggacugaag cuagggauuu
540augcagaugu uggaaauaaa accugcgcag gcuucccugg gaguuuugga
uacuacgaca 600uugaugccca gaccuuugcu gacuggggag uagaucugcu
aaaauuugau gguuguuacu 660gugacaguuu ggaaaauuug gcagaugguu
auaagcacau guccuuggcc cugaauagga 720cuggcagaag cauuguguac
uccugugagu ggccucuuua uauguggccc uuucaaaagc 780ccaauuauac
agaaauccga caguacugca aucacuggcg aaauuuugcu gacauugaug
840auuccuggaa aaguauaaag aguaucuugg acuggacauc uuuuaaccag
gagagaauug 900uugauguugc uggaccaggg gguuggaaug acccagauau
guuagugauu ggcaacuuug 960gccucagcug gaaucagcaa guaacucaga
uggcccucug ggcuaucaug gcugcuccuu 1020uauucauguc uaaugaccuc
cgacacauca gcccucaagc caaagcucuc cuucaggaua 1080aggacguaau
ugccaucaau caggaccccu ugggcaagca aggguaccag cuuagacagg
1140gagacaacuu ugaagugugg gaacgaccuc ucucaggcuu agccugggcu
guagcuauga 1200uaaaccggca ggagauuggu ggaccucgcu cuuauaccau
cgcaguugcu ucccugggua 1260aaggaguggc cuguaauccu gccugcuuca
ucacacagcu ccucccugug aaaaggaagc 1320uaggguucua ugaauggacu
ucaagguuaa gaagucacau aaaucccaca ggcacuguuu 1380ugcuucagcu
agaaaauaca augcagaugu cauuaaaaga cuuacuuuaa cggguggcau
1440cccugugacc ccuccccagu gccucuccug gcccuggaag uugccacucc
agugcccacc 1500agccuugucc uaauaaaauu aaguugcauc aagcu
153541484RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 4ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
augagcagca agggcagcgu ggugcuggcc uacagcggcg 180gccuggacac
cagcugcauc cugguguggc ugaaggagca gggcuacgac gugaucgccu
240accuggccaa caucggccag aaggaggacu ucgaggaggc ccgcaagaag
gcccugaagc 300ugggcgccaa gaagguguuc aucgaggacg ugagccgcga
guucguggag gaguucaucu 360ggcccgccau ccagagcagc gcccuguacg
aggaccgcua ccugcugggc accagccugg 420cccgccccug caucgcccgc
aagcaggugg agaucgccca gcgcgagggc gccaaguacg 480ugagccacgg
cgccaccggc aagggcaacg accaggugcg cuucgagcug agcugcuaca
540gccuggcccc ccagaucaag gugaucgccc ccuggcgcau gcccgaguuc
uacaaccgcu 600ucaagggccg caacgaccug auggaguacg ccaagcagca
cggcaucccc auccccguga 660cccccaagaa ccccuggagc auggacgaga
accugaugca caucagcuac gaggccggca 720uccuggagaa ccccaagaac
caggcccccc ccggccugua caccaagacc caggaccccg 780ccaaggcccc
caacaccccc gacauccugg agaucgaguu caagaagggc gugcccguga
840aggugaccaa cgugaaggac ggcaccaccc accagaccag ccuggagcug
uucauguacc 900ugaacgaggu ggccggcaag cacggcgugg gccgcaucga
caucguggag aaccgcuuca 960ucggcaugaa gagccgcggc aucuacgaga
cccccgccgg caccauccug uaccacgccc 1020accuggacau cgaggccuuc
accauggacc gcgaggugcg caagaucaag cagggccugg 1080gccugaaguu
cgccgagcug guguacaccg gcuucuggca cagccccgag ugcgaguucg
1140ugcgccacug caucgccaag agccaggagc gcguggaggg caaggugcag
gugagcgugc 1200ugaagggcca gguguacauc cugggccgcg agagcccccu
gagccuguac aacgaggagc 1260uggugagcau gaacgugcag ggcgacuacg
agcccaccga cgccaccggc uucaucaaca 1320ucaacagccu gcgccugaag
gaguaccacc gccugcagag caaggugacc gccaagugac 1380ggguggcauc
ccugugaccc cuccccagug ccucuccugg cccuggaagu ugccacucca
1440gugcccacca gccuuguccu aauaaaauua aguugcauca agcu
148451898RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 5ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
auggaagaug ccaaaaacau uaagaagggc ccagcgccau 180ucuacccacu
cgaagacggg accgccggcg agcagcugca caaagccaug aagcgcuacg
240cccuggugcc cggcaccauc gccuuuaccg acgcacauau cgagguggac
auuaccuacg 300ccgaguacuu cgagaugagc guucggcugg cagaagcuau
gaagcgcuau gggcugaaua 360caaaccaucg gaucguggug ugcagcgaga
auagcuugca guucuucaug cccguguugg 420gugcccuguu caucggugug
gcuguggccc cagcuaacga caucuacaac gagcgcgagc 480ugcugaacag
caugggcauc agccagccca ccgucguauu cgugagcaag aaagggcugc
540aaaagauccu caacgugcaa aagaagcuac cgaucauaca aaagaucauc
aucauggaua 600gcaagaccga cuaccagggc uuccaaagca uguacaccuu
cgugacuucc cauuugccac 660ccggcuucaa cgaguacgac uucgugcccg
agagcuucga ccgggacaaa accaucgccc 720ugaucaugaa caguaguggc
aguaccggau ugcccaaggg cguagcccua ccgcaccgca 780ccgcuugugu
ccgauucagu caugcccgcg accccaucuu cggcaaccag aucauccccg
840acaccgcuau ccucagcgug gugccauuuc accacggcuu cggcauguuc
accacgcugg 900gcuacuugau cugcggcuuu cgggucgugc ucauguaccg
cuucgaggag gagcuauucu 960ugcgcagcuu gcaagacuau aagauucaau
cugcccugcu ggugcccaca cuauuuagcu 1020ucuucgcuaa gagcacucuc
aucgacaagu acgaccuaag caacuugcac gagaucgcca 1080gcggcggggc
gccgcucagc aaggagguag gugaggccgu ggccaaacgc uuccaccuac
1140caggcauccg ccagggcuac ggccugacag aaacaaccag cgccauucug
aucacccccg 1200aaggggacga caagccuggc gcaguaggca agguggugcc
cuucuucgag gcuaaggugg 1260uggacuugga caccgguaag acacugggug
ugaaccagcg cggcgagcug ugcguccgug 1320gccccaugau caugagcggc
uacguuaaca accccgaggc uacaaacgcu cucaucgaca 1380aggacggcug
gcugcacagc ggcgacaucg ccuacuggga cgaggacgag cacuucuuca
1440ucguggaccg gcugaagagc cugaucaaau acaagggcua ccagguagcc
ccagccgaac 1500uggagagcau ccugcugcaa caccccaaca ucuucgacgc
cggggucgcc ggccugcccg 1560acgacgaugc cggcgagcug cccgccgcag
ucgucgugcu ggaacacggu aaaaccauga 1620ccgagaagga gaucguggac
uauguggcca gccagguuac aaccgccaag aagcugcgcg 1680gugguguugu
guucguggac gaggugccua aaggacugac cggcaaguug gacgcccgca
1740agauccgcga gauucucauu aaggccaaga agggcggcaa gaucgccgug
uaacgggugg 1800caucccugug accccucccc agugccucuc cuggcccugg
aaguugccac uccagugccc 1860accagccuug uccuaauaaa auuaaguugc aucaagcu
189861631RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 6ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
augcagcgcg ugaacaugau cauggcagaa ucaccaggcc 180ucaucaccau
cugccuuuua ggauaucuac ucagugcuga auguacaguu uuucuugauc
240augaaaacgc caacaaaauu cugaggcgga gaaggaggua uaauucaggu
aaauuggaag 300aguuuguuca agggaaccuu gagagagaau guauggaaga
aaaguguagu uuugaagaag 360cacgagaagu uuuugaaaac acugaaagaa
caacugaauu uuggaagcag uauguugaug 420gagaucagug ugaguccaau
ccauguuuaa auggcggcag uugcaaggau gacauuaauu 480ccuaugaaug
uugguguccc uuuggauuug aaggaaagaa cugugaauua gauguaacau
540guaacauuaa gaauggcaga ugcgagcagu uuuguaaaaa uagugcugau
aacaaggugg 600uuugcuccug uacugaggga uaucgacuug cagaaaacca
gaaguccugu gaaccagcag 660ugccauuucc auguggaaga guuucuguuu
cacaaacuuc uaagcucacc cgugcugagg 720cuguuuuucc ugauguggac
uauguaaauu cuacugaagc ugaaaccauu uuggauaaca 780ucacucaaag
cacccaauca uuuaaugacu ucacucgggu uguuggugga gaagaugcca
840aaccagguca auucccuugg cagguuguuu ugaaugguaa aguugaugca
uucuguggag 900gcucuaucgu uaaugaaaaa uggauuguaa cugcugccca
cuguguugaa acugguguua 960aaauuacagu ugucgcaggu gaacauaaua
uugaggagac agaacauaca gagcaaaagc 1020gaaaugugau ucgaauuauu
ccucaccaca acuacaaugc agcuauuaau aaguacaacc 1080augacauugc
ccuucuggaa cuggacgaac ccuuagugcu aaacagcuac guuacaccua
1140uuugcauugc ugacaaggaa uacacgaaca ucuuccucaa auuuggaucu
ggcuauguaa 1200guggcugggg aagagucuuc cacaaaggga gaucagcuuu
aguucuucag uaccuuagag 1260uuccacuugu ugaccgagcc acaugucuuc
gaucuacaaa guucaccauc uauaacaaca 1320uguucugugc uggcuuccau
gaaggaggua gagauucaug ucaaggagau agugggggac 1380cccauguuac
ugaaguggaa gggaccaguu ucuuaacugg aauuauuagc uggggugaag
1440agugugcaau gaaaggcaaa uauggaauau auaccaaggu aucccgguau
gucaacugga 1500uuaaggaaaa aacaaagcuc acuuaacggg uggcaucccu
gugaccccuc cccagugccu 1560cuccuggccc uggaaguugc cacuccagug
cccaccagcc uuguccuaau aaaauuaagu 1620ugcaucaagc u
163171604RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
augagcaccg ccgugcugga gaaccccggc cugggccgca 180agcugagcga
cuucggccag gagaccagcu acaucgagga caacugcaac cagaacggcg
240ccaucagccu gaucuucagc cugaaggagg aggugggcgc ccuggccaag
gugcugcgcc 300uguucgagga gaacgacgug aaccugaccc acaucgagag
ccgccccagc cgccugaaga 360aggacgagua cgaguucuuc acccaccugg
acaagcgcag ccugcccgcc cugaccaaca 420ucaucaagau ccugcgccac
gacaucggcg ccaccgugca cgagcugagc cgcgacaaga 480agaaggacac
cgugcccugg uucccccgca ccauccagga gcuggaccgc uucgccaacc
540agauccugag cuacggcgcc gagcuggacg ccgaccaccc cggcuucaag
gaccccgugu 600accgcgcccg ccgcaagcag uucgccgaca ucgccuacaa
cuaccgccac ggccagccca 660ucccccgcgu ggaguacaug gaggaggaga
agaagaccug gggcaccgug uucaagaccc 720ugaagagccu guacaagacc
cacgccugcu acgaguacaa ccacaucuuc ccccugcugg 780agaaguacug
cggcuuccac gaggacaaca ucccccagcu ggaggacgug agccaguucc
840ugcagaccug caccggcuuc cgccugcgcc ccguggccgg ccugcugagc
agccgcgacu 900uccugggcgg ccuggccuuc cgcguguucc acugcaccca
guacauccgc cacggcagca 960agcccaugua cacccccgag cccgacaucu
gccacgagcu gcugggccac gugccccugu 1020ucagcgaccg cagcuucgcc
caguucagcc aggagaucgg ccuggccagc cugggcgccc 1080ccgacgagua
caucgagaag cuggccacca ucuacugguu caccguggag uucggccugu
1140gcaagcaggg cgacagcauc aaggccuacg gcgccggccu gcugagcagc
uucggcgagc 1200ugcaguacug ccugagcgag aagcccaagc ugcugccccu
ggagcuggag aagaccgcca 1260uccagaacua caccgugacc gaguuccagc
cccuguacua cguggccgag agcuucaacg 1320acgccaagga gaaggugcgc
aacuucgccg ccaccauccc ccgccccuuc agcgugcgcu 1380acgaccccua
cacccagcgc aucgaggugc uggacaacac ccagcagcug aagauccugg
1440ccgacagcau caacagcgag aucggcaucc ugugcagcgc ccugcagaag
aucaaguaac 1500ggguggcauc ccugugaccc cuccccagug ccucuccugg
cccuggaagu ugccacucca 1560gugcccacca gccuuguccu aauaaaauua
aguugcauca agcu 160484443RNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 8augcagcggu ccccgcucga
aaaggccagu gucgugucca aacucuucuu cucauggacu 60cggccuaucc uuagaaaggg
guaucggcag aggcuugagu ugucugacau cuaccagauc 120cccucgguag
auucggcgga uaaccucucg gagaagcucg aacgggaaug ggaccgcgaa
180cucgcgucua agaaaaaccc gaagcucauc aacgcacuga gaaggugcuu
cuucuggcgg 240uucauguucu acgguaucuu cuuguaucuc ggggagguca
caaaagcagu ccaaccccug 300uuguuggguc gcauuaucgc cucguacgac
cccgauaaca aagaagaacg gagcaucgcg 360aucuaccucg ggaucggacu
guguuugcuu uucaucguca gaacacuuuu guugcaucca 420gcaaucuucg
gccuccauca caucgguaug cagaugcgaa ucgcuauguu uagcuugauc
480uacaaaaaga cacugaaacu cucgucgcgg guguuggaua agauuuccau
cggucaguug 540gugucccugc uuaguaauaa ccucaacaaa uucgaugagg
gacuggcgcu ggcacauuuc 600guguggauug ccccguugca agucgcccuu
uugaugggcc uuauuuggga gcuguugcag 660gcaucugccu uuuguggccu
gggauuucug auuguguugg cauuguuuca ggcugggcuu 720gggcggauga
ugaugaagua ucgcgaccag agagcgggua aaaucucgga aagacucguc
780aucacuucgg aaaugaucga aaacauccag ucggucaaag ccuauugcug
ggaagaagcu 840auggagaaga ugauugaaaa ccuccgccaa acugagcuga
aacugacccg caaggcggcg 900uauguccggu auuucaauuc gucagcguuc
uucuuuuccg gguucuucgu ugucuuucuc 960ucgguuuugc cuuaugccuu
gauuaagggg auuauccucc gcaagauuuu caccacgauu 1020ucguucugca
uuguauugcg cauggcagug acacggcaau uuccgugggc cgugcagaca
1080ugguaugacu cgcuuggagc gaucaacaaa auccaagacu ucuugcaaaa
gcaagaguac 1140aagacccugg aguacaaucu uacuacuacg gagguaguaa
uggagaaugu gacggcuuuu 1200ugggaagagg guuuuggaga acuguuugag
aaagcaaagc agaauaacaa caaccgcaag 1260accucaaaug gggacgauuc
ccuguuuuuc ucgaacuucu cccugcucgg aacacccgug 1320uugaaggaca
ucaauuucaa gauugagagg ggacagcuuc ucgcgguagc gggaagcacu
1380ggugcgggaa aaacuagccu cuugauggug auuauggggg agcuugagcc
cagcgagggg 1440aagauuaaac acuccgggcg uaucucauuc uguagccagu
uuucauggau caugcccgga 1500accauuaaag agaacaucau uuucggagua
uccuaugaug aguaccgaua cagaucgguc 1560auuaaggcgu gccaguugga
agaggacauu ucuaaguucg ccgagaagga uaacaucguc 1620uugggagaag
gggguauuac auugucggga gggcagcgag cgcggaucag ccucgcgaga
1680gcgguauaca aagaugcaga uuuguaucug cuugauucac cguuuggaua
ccucgacgua 1740uugacagaaa aagaaaucuu cgagucgugc guguguaaac
uuauggcuaa uaagacgaga 1800auccugguga caucaaaaau ggaacaccuu
aagaaggcgg acaagauccu gauccuccac 1860gaaggaucgu ccuacuuuua
cggcacuuuc ucagaguugc aaaacuugca gccggacuuc 1920ucaagcaaac
ucauggggug ugacucauuc gaccaguuca gcgcggaacg gcggaacucg
1980aucuugacgg aaacgcugca ccgauucucg cuugagggug augccccggu
aucguggacc 2040gagacaaaga agcagucguu uaagcagaca ggagaauuug
gugagaaaag aaagaacagu 2100aucuugaauc cuauuaacuc aauucgcaag
uucucaaucg uccagaaaac uccacugcag 2160augaauggaa uugaagagga
uucggacgaa ccccuggagc gcaggcuuag ccucgugccg 2220gauucagagc
aaggggaggc cauucuuccc cggauuucgg ugauuucaac cggaccuaca
2280cuucaggcga ggcgaaggca auccgugcuc aaccucauga cgcauucggu
aaaccagggg 2340caaaacauuc accgcaaaac gacggccuca acgagaaaag
ugucacuugc accccaggcg 2400aauuugacug aacucgacau cuacagccgu
aggcuuucgc aagaaaccgg acuugagauc 2460agcgaagaaa ucaaugaaga
agauuugaaa gaguguuucu uugaugacau ggaaucaauc 2520ccagcgguga
caacguggaa cacauacuug cguuacauca cggugcacaa guccuugauu
2580uucguccuca ucuggugucu cgugaucuuu cucgcugagg ucgcagcguc
acuugugguc 2640cucuggcugc uugguaauac gcccuugcaa gacaaaggca
auucuacaca cucaagaaac 2700aauuccuaug ccgugauuau cacuucuaca
agcucguauu acguguuuua caucuacgua 2760ggaguggccg acacucugcu
cgcgaugggu uucuuccgag gacucccacu cguucacacg 2820cuuaucacug
ucuccaagau ucuccaccau aagaugcuuc auagcguacu gcaggcuccc
2880auguccaccu ugaauacgcu caaggcggga gguauuuuga aucgcuucuc
aaaagauauu 2940gcaauuuugg augaccuucu gccccugacg aucuucgacu
ucauccaguu guugcugauc 3000gugauugggg cuauugcagu agucgcuguc
cuccagccuu acauuuuugu cgcgaccguu 3060ccggugaucg uggcguuuau
caugcugcgg gccuauuucu ugcagacguc acagcagcuu 3120aagcaacugg
agucugaagg gaggucgccu aucuuuacgc aucuugugac caguuugaag
3180ggauugugga cguugcgcgc cuuuggcagg cagcccuacu uugaaacacu
guuccacaaa 3240gcgcugaauc uccauacggc aaauugguuu uuguauuuga
guacccuccg augguuucag 3300augcgcauug agaugauuuu ugugaucuuc
uuuaucgcgg ugacuuuuau cuccaucuug 3360accacgggag agggcgaggg
acgggucggu auuauccuga cacucgccau gaacauuaug 3420agcacuuugc
agugggcagu gaacagcucg auugaugugg auagccugau gagguccguu
3480ucgagggucu uuaaguucau cgacaugccg acggagggaa agcccacaaa
aaguacgaaa 3540cccuauaaga augggcaauu gaguaaggua augaucaucg
agaacaguca cgugaagaag 3600gaugacaucu ggccuagcgg gggucagaug
accgugaagg accugacggc aaaauacacc 3660gagggaggga acgcaauccu
ugaaaacauc ucguucagca uuagccccgg ucagcgugug 3720ggguugcucg
ggaggaccgg gucaggaaaa ucgacguugc ugucggccuu cuugagacuu
3780cugaauacag agggugagau ccagaucgac ggcguuucgu gggauagcau
caccuugcag 3840caguggcgga aagcguuugg aguaaucccc caaaaggucu
uuaucuuuag cggaaccuuc 3900cgaaagaauc ucgauccuua ugaacagugg
ucagaucaag agauuuggaa agucgcggac 3960gagguuggcc uucggagugu
aaucgagcag uuuccgggaa aacucgacuu uguccuugua 4020gaugggggau
gcguccuguc gcaugggcac aagcagcuca ugugccuggc gcgauccguc
4080cucucuaaag cgaaaauucu ucucuuggau gaaccuucgg cccaucugga
cccgguaacg 4140uaucagauca ucagaaggac acuuaagcag gcguuugccg
acugcacggu gauucucugu 4200gagcaucgua ucgaggccau gcucgaaugc
cagcaauuuc uugucaucga agagaauaag 4260guccgccagu acgacuccau
ccagaagcug cuuaaugaga gaucauuguu ccggcaggcg 4320auuucaccau
ccgauagggu gaaacuuuuu ccacacagaa auucgucgaa gugcaagucc
4380aaaccgcaga ucgcggccuu gaaagaagag acugaagaag aaguucaaga
cacgcgucuu 4440uaa 44439140RNAArtificial SequenceDescription of
Artificial Sequence
Synthetic polynucleotide 9ggacagaucg ccuggagacg ccauccacgc
uguuuugacc uccauagaag acaccgggac 60cgauccagcc uccgcggccg ggaacggugc
auuggaacgc ggauuccccg ugccaagagu 120gacucaccgu ccuugacacg
14010105RNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 10cggguggcau cccugugacc ccuccccagu
gccucuccug gcccuggaag uugccacucc 60agugcccacc agccuugucc uaauaaaauu
aaguugcauc aagcu 105
* * * * *