U.S. patent application number 17/528234 was filed with the patent office on 2022-06-30 for high density lipoprotein binding protein (hdlbp/vigilin) irna compositions and methods of use thereof.
This patent application is currently assigned to Alnylam Pharmaceuticals, Inc.. The applicant listed for this patent is Alnylam Pharmaceuticals, Inc., ETH Zurich. Invention is credited to Muthiah Manoharan, Mehrpouya Balaghy Mobin, Markus Stoffel.
Application Number | 20220202847 17/528234 |
Document ID | / |
Family ID | 1000006198456 |
Filed Date | 2022-06-30 |
United States Patent
Application |
20220202847 |
Kind Code |
A1 |
Manoharan; Muthiah ; et
al. |
June 30, 2022 |
HIGH DENSITY LIPOPROTEIN BINDING PROTEIN (HDLBP/VIGILIN) iRNA
COMPOSITIONS AND METHODS OF USE THEREOF
Abstract
The invention relates to double stranded ribonucleic acid
(dsRNA) agents and compositions targeting a High Density
Lipoprotein Binding Protein (Hdlbp/Vigilin) gene, as well as
methods of inhibiting expression of Hdlbp/Vigilin and methods of
treating subjects having a disorder of lipid metabolism, such as
mixed hyperlipidemia, hypertriglyceridemia or hypercholesterolemia,
using such dsRNA agents and compositions.
Inventors: |
Manoharan; Muthiah; (Weston,
MA) ; Stoffel; Markus; (Herrliberg, CH) ;
Mobin; Mehrpouya Balaghy; (Koln, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Alnylam Pharmaceuticals, Inc.
ETH Zurich |
Cambridge
Zurich |
MA |
US
CH |
|
|
Assignee: |
Alnylam Pharmaceuticals,
Inc.
Cambridge
MA
ETH Zurich
Zurich
|
Family ID: |
1000006198456 |
Appl. No.: |
17/528234 |
Filed: |
November 17, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16162705 |
Oct 17, 2018 |
11207342 |
|
|
17528234 |
|
|
|
|
PCT/US2017/028291 |
Apr 19, 2017 |
|
|
|
16162705 |
|
|
|
|
62324480 |
Apr 19, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 3/06 20180101; C12N
15/113 20130101; C12N 2310/315 20130101; C12N 2310/321 20130101;
C12N 2310/322 20130101; C12N 2310/3533 20130101; C12N 2310/3125
20130101; C12N 2310/351 20130101; C12N 2310/14 20130101; A61K
31/713 20130101; C12N 2310/3521 20130101 |
International
Class: |
A61K 31/713 20060101
A61K031/713; C12N 15/113 20060101 C12N015/113; A61P 3/06 20060101
A61P003/06 |
Claims
1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting
expression of a High Density Lipoprotein Binding Protein
(Hdlbp/Vigilin) gene, wherein said dsRNA agent comprises a sense
strand and an antisense strand, the antisense strand comprising a
region of complementarity which comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:11.
2. (canceled)
3. The dsRNA agent of claim 1, wherein said dsRNA agent comprises
at least one nucleotide comprising a nucleotide modification.
4. The dsRNA agent of a claim 1, wherein substantially all of the
nucleotides of said sense strand and substantially all of the
nucleotides of said antisense strand comprise a nucleotide
modification; or all of the nucleotides of said sense strand and
all of the nucleotides of said antisense strand comprise a
nucleotide modification.
5. (canceled)
6. (canceled)
7. (canceled)
8. The dsRNA agent of claim 1, wherein the region of
complementarity is at least 17 nucleotides in length.
9. The dsRNA agent of claim 1, wherein each strand is no more than
30 nucleotides in length.
10. The dsRNA agent of claim 1, wherein at least one strand
comprises a 3' overhang of at least 1 nucleotide; or at least one
strand comprises a 3' overhang of at least 2 nucleotides.
11. The dsRNA agent of claim 1, further comprising a ligand.
12. The dsRNA agent of claim 1, wherein said agent further
comprises at least one phosphorothioate or methylphosphonate
internucleotide linkage.
13. An isolated cell containing the double stranded RNAi agent of
claim 1.
14. A pharmaceutical composition for inhibiting expression of an
Hdlbp/Vigilin gene comprising the double stranded RNAi agent of
claim 1.
15. A method of inhibiting expression of a High Density Lipoprotein
Binding Protein (Hdlbp/Vigilin) gene in a cell, the method
comprising: (a) contacting the cell with the double stranded RNAi
agent of claim 1; and (b) maintaining the cell produced in step (a)
for a time sufficient to obtain degradation of the mRNA transcript
of an Hdlbp/Vigilin gene, thereby inhibiting epression of the
Hdlbp/Vigilin gene in the cell.
16. The method of claim 15, wherein said cell is within a
subject.
17. A method of treating a subject having a disorder that would
benefit from a reduction in expression of a High Density
Lipoprotein Binding Protein (Hdlbp/Vigilin) gene, comprising
administering to the subject a therapeutically effective amount of
the double stranded RNAi agent of claim 1, thereby treating said
subject.
18. The method of claim 17, wherein the subject is human.
19. The method of claim 17, wherein the disorder is a disorder of
lipid metabolism.
20. The method of claim 19, wherein the disorder of lipid
metabolism is a hyperlipidemia.
21. The method of claim 17, further comprising administering an
additional therapeutic agent to the subject.
22. The method of claim 17, wherein the double stranded RNAi agent
is administered to the subject at a dose of about 0.01 mg/kg to
about 50 mg/kg.
23. The method of claim 17, wherein the double stranded RNAi agent
is administered to the subject subcutaneously.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/162,705, filed on Oct. 17, 2018, which is a
35 .sctn. U.S.C. 111(a) continuation application which claims the
benefit of priority to PCT/US2017/028291, filed on Apr. 19, 2017,
which claims priority to U.S. Provisional Application No.
62/324,480, filed on Apr. 19, 2016. The entire contents of each of
the foregoing applications are hereby incorporated herein by
reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. The ASCII copy, created
on Nov. 2, 2021, is named 121301-06103_SL.txt and is 132,267 bytes
in size.
BACKGROUND OF THE INVENTION
[0003] High density lipoprotein binding protein (Hdlbp/Vigilin) is
the largest RNA-binding protein of the KH domain family with a
unique structure of 14 consecutively arranged RNA binding KH
domains that are conserved from human to yeast (Dodson &
Shapiro 1997; Weber et al., 1997; Cortes et al., 1999; Chen et al.,
2003; Brykailo et al., 2007). Vigilin is ubiquitously expressed
with the highest levels of expression in organs with preferential
epithelial cell origin, including the liver (FIG. 1A). Vigilin has
been implicated in diverse biological processes such as sterol
metabolism (Dodson & Shapiro, 1997), carcinogenesis (Molyneux
et al., 2013; Yang et al., 2014), control of translation
(Hirschmann et al., 2014), formation of heterochromatin (Wang et
al., 2005), nuclear export of tRNA (Kruse et al., 2000),
cytoplasmic transport of RNA (Gelin-Licht et al., 2012), and
metabolism of specific mRNAs (Weber et al., 1997; Baum et al.,
2004; Frey et al., 2001; Lang & Fridovich-Keil, 2000;
Mendelsohn et al., 2003).
[0004] Although the exact function of vigilin has not been
addressed in a systematical and unbiased manner, Viligin has been
implicated to function in the removal of excess cellular
cholesterol, and its expression in plaque macrophages suggests a
role for this molecule in atherogenesis (Chui et al., 1997,
Arterioscler Thromb Vasc Biol. 17(11):2350-8). As described in the
appended example below, it has been discovered that vigilin is
upregulated in the livers of insulin resistant obese mice. Gain and
loss of function studies revealed that Vigilin regulates VLDL
secretion through the modulation of ApoB mRNA translation.
Photoactivatable ribonucleoside-enhanced crosslinking and
immunoprecipitation (PAR-CLIP) analysis in primary hepatocytes
demonstrated that Vigilin predominantly binds to CU-rich regions in
coding sequences of transcripts of further metabolically relevant
secretory proteins such as Ahsg/Fetuin-A, ApoC3, Fn1/Fibronectin,
Orm1/Orosomucoid and Serpina1/Alpha-1-Antitrypsin. While mRNA
levels of these targets did not change, protein levels were
substantially decreased upon knockdown of Vigilin. Hepatic
long-term knockdown via GalNAc-conjugated siRNAs ameliorated
elevated VLDL/LDL levels and the formation of atherosclerotic
plaques in Ldlr-/- mice. These studies uncover a role for Vigilin
as a key regulator of hepatic ApoB translation and secretion
through binding to its mRNA and demonstrate the therapeutic
potential of inhibiting Vigilin for disorders of lipid
metabolism.
[0005] For example, disorders of lipid metabolism can lead to
elevated levels of serum lipids, such as triglycerides and/or
cholesterol. High cholesterol levels have been associated with an
increased risk of atherosclerosis and cardiovascular disease
(Lewington S, et al. (2007), Lancet 370 (9602): 1829-39). Elevated
cholesterol levels contribute to formation of atherosclerotic
plaque in the arteries which may lead to progressive narrowing or
blockage of the involved arteries. Occlusion of a coronary artery
can result in myocardial infarction or heart attack, while
occlusion of an artery supplying the brain may lead to stroke.
[0006] Statins are a widely known drug class of cholesterol
lowering drugs. Although statins have been found to reduce
cardiovacular disease and mortality in those who are at high risk,
some patients experience side effects of statins including muscle
pain, increased risk of diabetes mellitus, and abnormalities in
liver enzyme tests (Naci H, et al. (2013). Circ Cardiovasc Qual
Outcomes 6 (4): 390-9). Additionally, patients may experience rare
but severe adverse effects, particularly statin-induced myopathy
(Abd T T, et al. (2011) Expert opinion on drug safety 10 (3):
373-87). Accordingly, there is a need in the art for alternative
treatments for subjects having disorders of lipid metabolism.
SUMMARY OF THE INVENTION
[0007] The present invention provides iRNA compositions which
effect the RNA-induced silencing complex (RISC)-mediated cleavage
of RNA transcripts of a High Density Lipoprotein Binding Protein
(Hdlbp/Vigilin) gene. The Hdlbp/Vigilin gene may be within a cell,
e.g., a cell within a subject, such as a human. The present
invention also provides methods of using the iRNA compositions of
the invention for inhibiting the expression of an Hdlbp/Vigilin
gene and/or for treating a subject who would benefit from
inhibiting or reducing the expression of an Hdlbp/Vigilin gene,
e.g., a subject suffering or prone to suffering from a disorder of
lipid metabolism, such as a subject suffering or prone to suffering
from mixed hyperlipidemia, hypertriglyceridemia or
hypercholesterolemia.
[0008] Accordingly, in one aspect, the present invention provides
double stranded ribonucleic acid (RNAi) agents for inhibiting
expression of a High Density Lipoprotein Binding Protein
(Hdlbp/Vigilin) gene, wherein the dsRNA agents comprise a sense
strand and an antisense strand, wherein the sense strand comprises
at least 15 contiguous nucleotides differing by no more than 3
nucleotides from the nucleotide sequence of SEQ ID NO:5 and the
antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:11.
[0009] In another aspect, the present invention provides double
stranded ribonucleic acid (dsRNA) agents for inhibiting expression
of a High Density Lipoprotein Binding Protein (Hdlbp/Vigilin) gene,
wherein the dsRNA agents comprise a sense strand and an antisense
strand, the antisense strand comprising a region of complementarity
which comprises at least 15 contiguous nucleotides differing by no
more than 3 nucleotides from the nucleotide sequence of SEQ ID
NO:11.
[0010] In one embodiment, the antisense strand comprises at least
15 contiguous nucleotides differing by no more than 3 nucleotides
from the complement of the nucleotide sequence of any one of
nucleotides 373-395; 374-396; 381-403; 395-417; 440-462; 670-692;
852-874; 888-910; 905-927; 913-935; 1223-1245; 1246-1268;
1247-1269; 1248-1270; 1256-1278; 1267-1289; 1801-1823; 1903-1925;
1908-1930; 1916-1938; 1919-1941; 2023-2045; 2071-2093; 2127-2149;
2128-2150; 2136-2158; 2137-2159; 2138-2160; 2225-2247; 2231-2253;
2232-2254; 2240-2262; 2242-2264; 2243-2265; 2245-2267; 2543-2565;
2544-2566; 2549-2571; 3017-3039; 3088-3110; 4271-4293; 4404-4426;
4405-4427; 4408-4430; 4411-4433; or 4416-4438 of the nucleotide
sequence of SEQ ID NO:5.
[0011] In another embodiment, the antisense strand comprises any
one of the antisense nucleotide sequences in any one of Tables
2-4.
[0012] In one embodiment, the sense and antisense strands comprise
nucleotide sequences selected from the group consisting one of any
of the sense and antisense nucleotide sequences listed in any one
of Tables 2-4.
[0013] In one embodiment, the dsRNA agent comprises at least one
nucleotide comprising a nucleotide modification.
[0014] In one embodiment, substantially all of the nucleotides of
said sense strand and substantially all of the nucleotides of said
antisense strand comprise a nucleotide modification.
[0015] In another embodiment, all of the nucleotides of said sense
strand and all of the nucleotides of said antisense strand comprise
a nucleotide modification.
[0016] In one embodiment, the modified nucleotides are
independently selected from the group consisting of a
deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a
2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a
2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked
nucleotide, a conformationally restricted nucleotide, a constrained
ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified
nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified
nucleotide, 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl
modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino
nucleotide, a phosphoramidate, a non-natural base comprising
nucleotide, a tetrahydropyran modified nucleotide, a
1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified
nucleotide, a nucleotide comprising a phosphorothioate group, a
nucleotide comprising a methylphosphonate group, a nucleotide
comprising a 5'-phosphate, and a nucleotide comprising a
5'-phosphate mimic.
[0017] In one aspect, the present invention provides double
stranded ribonucleic acid (dsRNA) agents for inhibiting expression
of a High Density Lipoprotein Binding Protein (Hdlbp/Vigilin) gene,
wherein the dsRNA agents comprise a sense strand and an antisense
strand forming a double stranded region, the antisense strand
comprising a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
the nucleotide sequence of SEQ ID NO:11, wherein substantially all
of the nucleotides of the sense strand and substantially all of the
nucleotides of said antisense strand comprise a nucleotide
modification, and wherein the sense strand is conjugated to a
ligand attached at the 3'-terminus.
[0018] In one embodiment, the antisense strand comprises at least
15 contiguous nucleotides differing by no more than 3 nucleotides
from the complement of the nucleotide sequence of any one of
nucleotides 373-395; 374-396; 381-403; 395-417; 440-462; 670-692;
852-874; 888-910; 905-927; 913-935; 1223-1245; 1246-1268;
1247-1269; 1248-1270; 1256-1278; 1267-1289; 1801-1823; 1903-1925;
1908-1930; 1916-1938; 1919-1941; 2023-2045; 2071-2093; 2127-2149;
2128-2150; 2136-2158; 2137-2159; 2138-2160; 2225-2247; 2231-2253;
2232-2254; 2240-2262; 2242-2264; 2243-2265; 2245-2267; 2543-2565;
2544-2566; 2549-2571; 3017-3039; 3088-3110; 4271-4293; 4404-4426;
4405-4427; 4408-4430; 4411-4433; or 4416-4438 of the nucleotide
sequence of SEQ ID NO:5.
[0019] In one embodiment, all of the nucleotides of the sense
strand and all of the nucleotides of the antisense strand comprise
a nucleotide modification.
[0020] In one embodiment, the modified nucleotides are
independently selected from the group consisting of a
deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a
2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a
2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked
nucleotide, a conformationally restricted nucleotide, a constrained
ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified
nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified
nucleotide, 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl
modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino
nucleotide, a phosphoramidate, a non-natural base comprising
nucleotide, a tetrahydropyran modified nucleotide, a
1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified
nucleotide, a nucleotide comprising a phosphorothioate group, a
nucleotide comprising a methylphosphonate group, a nucleotide
comprising a 5'-phosphate, and a nucleotide comprising a
5'-phosphate mimic.
[0021] The region of complementarity may be at least 17 nucleotides
in length; 19 to 21 nucleotides in length; or 19 nucleotides in
length.
[0022] In one embodiment, each strand is no more than 30
nucleotides in length.
[0023] In one embodiment, at least one strand comprises a 3'
overhang of at least 1 nucleotide.
[0024] In another embodiment, at least one strand comprises a 3'
overhang of at least 2 nucleotides.
[0025] In one embodiment, the dsRNA agent further comprises a
ligand.
[0026] In one embodiment, the ligand is conjugated to the 3' end of
the sense strand of the dsRNA agent.
[0027] In one embodiment, the ligand is an N-acetylgalactosamine
(GalNAc) derivative.
[0028] In one embodiment, the ligand is one or more GalNAc
derivatives attached through a bivalent or trivalent branched
linker.
[0029] In one embodiment, the ligand is
##STR00001##
[0030] In one embodiment, the dsRNA agent is conjugated to the
ligand as shown in the following schematic
##STR00002##
[0031] and, wherein X is O or S.
[0032] In one embodiment, the X is O.
[0033] In one embodiment, the region of complementarity comprises
any one of the antisense nucleotide sequences of any one of Tables
2-4.
[0034] In another embodiment, the region of complementarity
consists of any one of the antisense nucleotide sequences of any
one of Tables 2-4.
[0035] In one embodiment, the modifications on the nucleotides are
2'-O-methyl or 2'-fluoro modifications.
[0036] In one embodiment, the agent further comprises at least one
phosphorothioate or methylphosphonate internucleotide linkage.
[0037] In one embodiment, the phosphorothioate or methylphosphonate
internucleotide linkage is at the 3'-terminus of one strand. In one
embodiment, the strand is the antisense strand. In another
embodiment, the strand is the sense strand.
[0038] In one embodiment, the phosphorothioate or methylphosphonate
internucleotide linkage is at the 5'-terminus of one strand. In one
embodiment, the strand is the antisense strand. In another
embodiment, the strand is the sense strand.
[0039] In one embodiment, the phosphorothioate or methylphosphonate
internucleotide linkage is at the both the 5'- and 3'-terminus of
one strand. In one embodiment, the strand is the antisense
strand.
[0040] In one embodiment, the dsRNA agent is selected from the
group of dsRNA agents listed in any one of Tables 2-4.
[0041] In one aspect, the present invention provides double
stranded ribonucleic acid (dsRNA) agents for inhibiting expression
of a High Density Lipoprotein Binding Protein (Hdlbp/Vigilin) gene
in a cell, wherein the dsRNA agent comprises a sense strand and an
antisense strand forming a double stranded region, the antisense
strand comprising a region of complementarity which comprises at
least 15 contiguous nucleotides differing by no more than 3
nucleotides from the nucleotide sequence of SEQ ID NO:11, wherein
substantially all of the nucleotides of the sense strand comprise a
modification selected from the group consisting of a 2'-O-methyl
modification and a 2'-fluoro modification, wherein the sense strand
comprises two phosphorothioate internucleotide linkages at the
5'-terminus, wherein substantially all of the nucleotides of the
antisense strand comprise a nucleotide modification selected from
the group consisting of a 2'-O-methyl modification and a 2'-fluoro
modification, wherein the antisense strand comprises two
phosphorothioate internucleotide linkages at the 5'-terminus and
two phosphorothioate internucleotide linkages at the 3'-terminus,
and wherein the sense strand is conjugated to one or more GalNAc
derivatives attached through a branched bivalent or trivalent
linker at the 3'-terminus.
[0042] In one aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a High Density Lipoprotein Binding Protein (Hdlbp/Vigilin) gene.
The double stranded RNAi agents include a sense strand and an
antisense strand, wherein the sense strand comprising the
nucleotide sequence of 5'-GfsasGfaUfcAfaCfAfUfuGfaCfcAfuAfaAf-3'
(SEQ ID NO: 1) and the antisense strand comprising the nucleotide
sequence of 5'-usUfsuAfuGfgUfcAfaugUfuGfaUfcUfcsusa-3' (SEQ ID NO:
2), wherein A, C, G, and U are ribose A, C, G, or U; a, c, g, and u
are 2'-O-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf, and Uf are
2'-fluoro A, C, G, or U; and s is a phosphorothioate linkage.
[0043] In another aspect, the present invention provides double
stranded ribonucleic acid (RNAi) agents for inhibiting expression
of a High Density Lipoprotein Binding Protein (Hdlbp/Vigilin) gene.
The double stranded RNAi agents include a sense strand and an
antisense strand, wherein the sense strand comprising the
nucleotide sequence of 5'-AfsgsGfaAfgAfuCfGfGfgCfuUfuAfaGfgAf-3'
(SEQ ID NO: 3) and the antisense strand comprising the nucleotide
sequence of 5'-usCfscUfuAfaAfgCfccgAfuCfuUfcCfusgsc-3' (SEQ ID NO:
4), wherein A, C, G, and U are ribose A, C, G, or U; a, c, g, and u
are 2'-O-methyl (2'-OMe) A, C, G, or U; Af, Cf, Gf, and Uf are
2'-fluoro A, C, G, or U; and s is a phosphorothioate linkage.
[0044] In certain embodiments, the double stranded RNAi agent
further comprises a ligand. In certain embodiments, the ligand is
conjugated to the 3' end of the sense strand of the double stranded
RNAi agent. In certain embodiments, the ligand is an
N-acetylgalactosamine (GalNAc) derivative. In certain embodiments,
the ligand is
##STR00003##
[0045] In certain embodiments, the double stranded RNAi agent is
conjugated to the ligand as shown in the following schematic
##STR00004##
and, wherein X is O or S.
[0046] In some embodiments, the X is O.
[0047] In another aspect, the present invention provides a cell
containing the double stranded RNAi agent as described herein.
[0048] In yet another aspect, the present invention provides a
pharmaceutical composition for inhibiting expression of an
Hdlbp/Vigilin gene comprising the double stranded RNAi agent as
described herein.
[0049] In some embodiments, the double stranded RNAi agent is
administered in an unbuffered solution. In other embodiments, the
unbuffered solution is saline or water.
[0050] In some embodiments, the double stranded RNAi agent is
administered with a buffer solution. In other embodiments, the
buffer solution comprises acetate, citrate, prolamine, carbonate,
or phosphate or any combination thereof. In certain embodiments,
the buffer solution is phosphate buffered saline (PBS).
[0051] In one aspect, the present invention provides a
pharmaceutical composition comprising the double stranded RNAi
agent as described herein and a lipid formulation. In some
embodiments, the lipid formulation comprises a LNP. In other
embodiments, the lipid formulation comprises a MC3.
[0052] The invention also provides methods of inhibiting
Hdlbp/Vigilin expression in a cell. The methods include contacting
the cell with the double stranded RNAi agent or the pharmaceutical
composition as described herein; and maintaining the cell for a
time sufficient to obtain degradation of the mRNA transcript of an
Hdlbp/Vigilin gene, thereby inhibiting expression of the
Hdlbp/Vigilin gene in the cell.
[0053] In certain embodiments, the cell is within a subject. In
certain embodiments, the subject is a human. In certain
embodiments, the human subject suffers from a disorder of lipid
metabolism. In certain embodiments, the disorder of lipid
metabolism is hyperlipidemia, such as hypercholesterolemia,
hypertriglyceridemia, and mixed hyperlipidemia.
[0054] In another aspect, the invention provides methods of
treating a subject having a disorder that would benefit from
reduction in expression of a High Density Lipoprotein Binding
Protein (Hdlbp/Vigilin) gene. The methods include administering to
the subject a therapeutically effective amount of any of the double
stranded RNAi agents or the pharmaceutical composition provided
herein, thereby treating the subject.
[0055] In certain embodiments, the subject is a human.
[0056] In certain embodiments, the disorder is a disorder of lipid
metabolism. In certain embodiments, the disorder of lipid
metabolism is a hyperlipidemia. In certain embodiments, the
disorder of lipid metabolism is hypercholesterolemia. In certain
embodiments, the disorder of lipid metabolism is
hypertriglyceridemia. In certain embodiments, the disorder of lipid
metabolism is mixed hyperlipidemia.
[0057] In certain embodiments, the methods of the present invention
further comprise administering an additional therapeutic agent.
[0058] In some embodiments, the double stranded RNAi agent is
administered at a dose of about 0.01 mg/kg to about 50 mg/kg. In
other embodiments, the dsRNA agent is administered to the subject
subcutaneously.
[0059] In certain embodiments, the methods of the present invention
further comprise measuring serum lipid levels, plasma glucose
levels, fasting blood glucose levels, plasma insulin levels, plasma
triglyceride levels, and/or plasma cholesterol levels in the
subject.
[0060] In some embodiments, following administration of the double
stranded RNAi agent to the subject Hdlbp/Vigilin protein
accumulation is decreased; the plasma cholesterol level in the
subject is decreased; the plasma triglyceride level in the subject
is decreased; the serum VLDL level in the subject is decreased; the
serum LDL level in the subject is decreased; the plasma insulin
level in the subject is decreased; insulin sensitivity in the
subject is increased; glucose tolerance in the subject is
increased; and/or atherosclerotic plaque formation in the subject
is decreased.
[0061] In a further aspect, the present invention also provides
methods of inhibiting the expression of Hdlbp/Vigilin in a subject.
The methods include administering to the subject a therapeutically
effective amount of any of the double stranded RNAi agents or the
pharmaceutical compositions provided herein, thereby inhibiting the
expression of Hdlbp/Vigilin in the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0062] FIGS. 1A-R depict that hepatic modulation of Vigilin
regulates lipid metabolism. Western blot analysis of Vigilin in
mouse tissues (FIG. 1A) as well as nuclear and cytoplasmic
fractions from primary hepatocytes (FIG. 1B). Immunoblot analysis
of hepatic Vigilin levels in chow fed wildtype (Chow), diet-induced
obese (DIO) and ob/ob mice (FIG. 1C). Correlation between hepatic
Vigilin expression quantified by densitometry from C (n=6 per
group) and plasma triglyceride, non-esterified fatty acid (NEFA)
and cholesterol levels (FIG. 1D) as well as HOMA IR (FIG. 1E).
Correlation between steatosis BMI, HOMA IR and hepatic Vigilin
expression quantified by immunoblotting and densitometry from human
liver biopsies including 5 healthy, 10 non-alcoholic fatty liver
disease (NAFLD) and 10 non-alcoholic steatohepatitis (NASH)
patients (FIGS. 1F-H). Relative expression of human Vigilin
(hVigilin) in livers of 10-week-old C57BL/6 mice injected with
Ad-GFP or Ad-hVigilin for gain of function (i; n=5 per group).
Values are densitometric readouts normalized to tubulin. Plasma
triglyceride (FIG. 1J), NEFA (FIG. 1K) and cholesterol (FIG. 1L)
levels of mice from i. Fractionated blood plasma from mice injected
with Ad-GFP or Ad-hVigilin into Very Low Density Lipoprotein
(VLDL), Low Density Lipoprotein (LDL) and High Density Lipoprotein
(HDL) particles that were quantified through measurements of
triglyceride and cholesterol levels in each fraction and used for
western blot analysis of VLDL/LDL (ApoB48/100) as well as HDL
(ApoA-I) markers (FIG. 1M). Relative expression of Vigilin in
livers of 10-week-old wildtype (WT) and DIO C57Bl/6 mice injected
with Ad-shCTRL (n=6 for WT, n=8 for DIO), Ad-shVIG (n=6 for WT, n=8
for DIO) or PBS (n=3 for WT, n=5 for DIO) for loss of function
(FIG. 1N). Values are densitometric readouts normalized to tubulin.
Plasma triglyceride (FIG. 1O), NEFA (FIG. 1P) and cholesterol (FIG.
1Q) levels of DIO mice treated as in FIG. 1N. Fractionated plasma
from DIO mice injected with Ad-shCTRL or Ad-shVIG into VLDL/LDL/HDL
particles that were quantified as in FIG. 1M (FIG. 1R). All values
are expressed as mean.+-.s.d. *P.ltoreq.0.05, **P.ltoreq.0.01,
***P.ltoreq.0.001; p-values and R.sup.2 were determined by
two-tailed Pearson's correlation test (FIGS. 1G and 1H), student's
t-test (FIGS. 1I-L) or ANOVA with Holm-Sidak post hoc analysis
(FIGS. 1N-Q).
[0063] FIGS. 2A-V depict additional metabolic parameters from mouse
models under study. Body weight, blood glucose and HOMA IR of chow
fed wildtype (Chow), diet-induced obese (DIO) and ob/ob mice (FIGS.
2A-C) under study (n=6 per group) in immunoblot (main figure) and
qPCR analysis (FIG. 2D) for hepatic Vigilin levels. Liver
triglyceride content (FIG. 2E), liver Oil-Red 0 stainings (FIG.
2F), blood glucose (FIG. 2G), insulin (FIG. 2H) and alanine
transaminase (ALT) levels (FIG. 2I) in gain of function (GOF) study
of 8-week-old C57BL/6 mice injected with Ad-GFP or Ad-hVigilin (n=5
per group) for 7 days. 8-week-old wildtype (WT) or 20-week old DIO
C57BL/6 mice were injected with either Ad-shCTRL (n=6 for WT, n=8
for DIO), Ad-shVIG (n=6 for WT, n=8 for DIO) or PBS (n=3 for WT,
n=5 for DIO) for 10 days for loss of function (LOF). Tissue panel
from LOF study indicating liver specific knockdown of Vigilin from
mice treated with Ad-shVIG as opposed to Ad-shCTRL or PBS treated
mice (FIG. 2J). Blood glucose, insulin and ALT levels in mice from
LOF study in chow fed wildtype (WT) and diet-induced obese (DIO)
mice (FIGS. 2K-P). qPCR analysis of inflammation markers from
livers in LOF study (FIG. 2Q). Liver triglyceride content (FIG.
2R), liver Oil-Red 0 stainings (FIG. 2S), blood triglyceride (FIG.
2T), non-esterified fatty acid (NEFA; FIG. 2U) and cholesterol
levels (FIG. 2V) in LOF study in wildtype mice. All values are
expressed as mean.+-.s.d. *P.ltoreq.0.05, **P.ltoreq.0.01,
***P.ltoreq.0.001; Student's t-test (FIGS. 2E, G-I) or ANOVA with
Holm-Sidak post hoc analysis (FIGS. 2A-D, K-R, T-V).
[0064] FIGS. 3A-I depict that Vigilin binds to CU-rich sequences in
ORFs and promotes translation of its targets. (FIG. 3A)
Autoradiograph of crosslinked, .sup.32P-labelled, hVigilin-RNA
immunoprecipitate separated by SDS-polyacrylamide gel
electrophoresis after PAR-CLIP and overlap of binding sites for the
two biological replicates. Distribution of PAR-CLIP binding sites
(overlap of replicates) identified by PARalyzer in various
RNA-species; (FIG. 3B) distribution of T-C reads along ORFs and
3'UTRs of mRNA targets (FIG. 3C). (FIG. 3D) kmer-plot and sequence
logo representation of the Vigilin RRE derived from PAR-CLIP
binding sites: CxxC and CxyC (x=A/C/U; y=C/U). (FIG. 3E)
Electrophoretic Mobility Shift Assays (EMSAs) validated affinity of
Vigilin to CU-rich sequences: synthetic RNAs representing 18-nt di-
or trinucleotide repeats were radiolabeled (10 nM), incubated with
2 .mu.M His6-tagged (SEQ ID NO: 21) recombinant human Vigilin and
separated on 1% agarose gel. (FIG. 3F) Enrichment analysis of
cluster fractions from PAR-CLIP containing tandem RREs from FIG. 3D
separated by 0-8 nt spacers compared to mouse ORF sequences
(background). Steady state mRNA expression changes in gain (FIG.
3G) and loss of function (FIG. 3H) of Vigilin were determined by
RNA-seq. The empirical cumulative distribution function (CDF) of
Vigilin PAR-CLIP targets (colored lines) was plotted and compared
to expressed non-targets (FPKM.gtoreq.1, black and grey lines).
(FIG. 3I) CDF of ribosome association changes of the top 100
PAR-CLIP-targets (based on cumulative T-to-C counts, red line)
compared to poor targets (remaining targets, blue line) and
non-targets (grey line) upon knockdown of Vigilin. The median
transcript abundance change is indicated by a dot on the x-axis.
***P.ltoreq.0.001. Significance and p-values were determined by the
Kolmogorov-Smirnov-test. FIG. 3F discloses SEQ ID NOS: 257-265,
261, and 266-274, respectively, in order of appearance.
[0065] FIGS. 4A-B depict autoradiographs of Electrophoretic
Mobility Shift Assays (EMSAs) using recombinant human Vigilin.
Synthetic RNAs representing various CCU trinucleotide repeats were
radiolabeled (10 nM), incubated with 2 .mu.M His6-tagged (SEQ ID
NO: 21) hVigilin recombinant protein and separated on 1% agarose
gel. Sequences of .gtoreq.18-nt containing .gtoreq.4 CCU were
required for efficient RNA binding (FIG. 4A). An 18-nt long RNA
sequence containing 5.times.CCU-repeats (SEQ ID NO: 287) was
systematically mutated at two adjacent sites with As (underlined)
and used for EMSAs. Shifts were only observed with sequences
containing a CyyC-2nt-CyyC RRE (in which y=C/U; FIG. 4B).
CyyC-2nt-CyyC RRE is indicated in bold letters. FIG. 4A discloses
SEQ ID NOS 275-286, respectively, in order of appearance. FIG. 4B
discloses SEQ ID NOS 261, 261, 287, 288, 263, 261, 289, 290, 263,
261, 287, and 288, respectively, in order of appearance.
[0066] FIGS. 5A-G depict that Vigilin promotes translation of mRNAs
coding for secretory proteins, including ApoB and Fetuin-A.
Secretome of primary hepatocytes isolated from mice injected with
either Ad-shCTRL or Ad-shVIG was collected from the medium and
quantified using label-free mass-spectrometry (MS-LFQ). (FIG. 5A)
CDF plot displaying fold changes in secretion upon knockdown of
Vigilin in primary hepatocytes of Top100 PAR-CLIP targets (based on
T-to-C counts, red line), poor targets (remaining targets, blue
line) and non-targets (grey line). (FIG. 5B) Volcano plot of
differentially secreted proteins upon Vigilin knockdown in primary
hepatocytes. x-axis: Log 2 fold change of intensities, y-axis:
-Log.sub.10 p-values. Significant hits among secreted Top100
PAR-CLIP targets (based on T-to-C counts) are indicated in red
dots, other significant targets in blue, non-targets and
non-significant hits in grey. Significance was determined via false
discovery rate (FDR)-corrected, permutation-based multiple t-tests
(250.times.) and curve bend s0. (FIG. 5C) Plot of differentially
secreted PAR-CLIP targets (x-axis) against T-to-C counts (y-axis)
indicates downregulation of more frequently bound targets. (FIG.
5D) Validation of MS-LFQ data using western blotting of 5 targets
from medium of primary hepatocytes and in vivo from blood plasma of
DIO mice injected with Ad-shCTRL or Ad-shVIG. (FIG. 5E) Vigilin
EMSAs representing binding sites on ApoB and Fetuin-A mRNAs
identified by PAR-CLIP. Upper panel: alignment of Vigilin PAR-CLIP
sequence reads to gene loci of ApoB and Fetuin-A mRNA ORFs. RREs
are highlighted in yellow. Lower panel: autoradiograph of EMSAs
performed using binding site sequences identified by PAR-CLIP,
mutated RREs (indicated in red) and scrambled sequences of these
sites. RNA sequences indicated below. (FIG. 5F) .sup.14C counts of
radiolabeled palmitic acid incorporated into triglycerides and
secreted into the medium by primary hepatocytes upon knockdown of
Vigilin. Primary hepatocytes were isolated from C57B16 mice
injected with either Ad-GFP versus Ad-hVigilin (for gain of
function) or Ad-shCTRL versus Ad-shVIG (for loss of function) and
pulse chased with .sup.14C-labeled palmitic acid for incorporation
into triglycerides. Lipids from the medium were extracted and
quantified using .sup.14C scintillation counting. (FIG. 5G)
Autoradiograph of in vitro translation assays using fresh liver
extracts from Ad-shCTRL or Ad-shVIG injected mice. Synthetic mRNAs
(scheme indicated in lower panel) of Fetuin-A and ApoM (as control
for non-target) were translated into V5-tagged and .sup.35S-Met
radiolabelled protein, immunoprecipitated and separated by
SDS-polyacrylamide gel electrophoresis. Fetuin-A mRNA with
premature stop-codon before C-terminal V5-tag (#3) was used as a
negative control for immunoprecipitation. FIG. 5E discloses SEQ ID
NOS 291-326, respectively, in order of appearance.
[0067] FIGS. 6A-F depict the characterization and regulation of
strongest Vigilin targets. (FIG. 6A) 82 of the top 100 Vigilin
targets identified by PAR-CLIP are secretory pathway proteins
either containing a signal peptide (SignalP; 34), .gtoreq.1
transmembrane domains (32) or both (16). qPCR analysis of secreted
mRNA targets among top 100 with highest downregulation of protein
levels upon knockdown of Vigilin in primary hepatocytes (FIG. 6B).
Immunoblot analysis of targets from FIG. 6B in blood plasma of chow
fed wildtype (Chow), diet-induced obese (DIO) and ob/ob mice (FIG.
6C) and their correlation with hepatic Vigilin expression (FIG.
6D). Primary hepatocytes were treated with cycloheximide for
translational stop and harvested at indicated time points for
half-life assessment of ApoB (FIG. 6E) and FetuinA (FIG. 6F).
*P.ltoreq.0.05, **P.ltoreq.0.01; p-values and R.sup.2 were
determined by two-tailed Pearson's correlation test (FIG. 6D).
[0068] FIGS. 7A-M depict that long-term knockdown of hepatic
Vigilin ameliorates elevated VLDL/LDL levels and reduces
atherosclerotic plaque size in aortic roots of Ldlr.sup.-/- mice.
(FIG. 7A) Quantification of hepatic Vigilin knockdown in male
Ldlr.sup.-/- mice with weekly injections of two different
GalNAc-conjugated siRNAs targeting Vigilin (siVIG-GalNAc #1: n=10,
siVIG-GalNAc #2: n=10) or PBS (n=9) for 18 weeks starting at 4
weeks of age. Values are shown relative to PBS injected mice
controls. (FIG. 7B) Western blot analysis of Vigilin targets from
blood plasma. Non-target ApoM and unregulated target ApoA-I were
used as controls for protein synthesis and secretion. Time course
of plasma cholesterol (FIG. 7C) and triglyceride (FIG. 7D) levels
throughout treatment period. Fractionated blood plasma from treated
mice indicating VLDL, LDL and HDL particles that were quantified
through cholesterol (FIG. 7E) and triglyceride (FIG. 7F) levels in
each fraction. Quantification of hepatic cholesterol (FIG. 7G) and
triglyceride (FIG. 7H) levels. Quantification of plasma bile acid
(FIG. 7I), insulin (FIG. 7J) and NEFA levels (FIG. 7K). (FIGS. 7L
and 7M) Characterization of atherosclerosis in mice from FIG. 1A.
H&E- and Oil-Red O stained aortic root sections (FIG. 7L) and
quantification of the lesion areas (FIG. 7M). *P<0.05,
**P<0.01 and .sup.#P<0.05, .sup.##P<0.01,
.sup.###P<0.001 determined by ANOVA with Tukey's (FIGS. 7C and
7D) or Holm-Sidak (FIGS. 7A, G-K and M) post hoc analysis. All data
are shown as the mean.+-.s.d.
[0069] FIGS. 8A-D depict additional characterization of long-term
knockdown of hepatic Vigilin ire Ldlr.sup.-/- mice. Tissue panel
indicating liver specific knockdown of Vigilin from mice treated
with siVIG-GalNAc #1 as opposed to PBS treated mice (FIG. 8A).
Blood alanine transaminase (ALT) levels after 18 weeks of treatment
(FIG. 8B). Intraperitoneal glucose tolerance test (IPGTT; FIG. 8C)
and intraperitoneal insulin tolerance test (ITT, FIG. 8D) were
performed after 17 weeks of treatment (n=8 per group). *P<0.05,
**P<0.01 determined by ANOVA with Tukey's post hoc analysis. All
data are shown as the mean.+-.s.d.
DETAILED DESCRIPTION OF THE INVENTION
[0070] The present invention provides iRNA compositions, which
effect the RNA-induced silencing complex (RISC)-mediated cleavage
of RNA transcripts of a High Density Lipoprotein Binding Protein
(Hdlbp/Vigilin) gene. The iRNA agents of the invention have been
designed to target an Hdlbp/Vigilin gene, including portions of the
gene that are conserved in the Hdlbp/Vigilin othologs of other
mammalian species. The Hdlbp/Vigilin gene may be within a cell,
e.g., a cell within a subject, such as a human. The use of these
iRNAs agents enable the targeted degradation of mRNAs of the
corresponding gene (Hdlbp/Vigilin) in mammals. Accordingly, the
present invention also provides methods of using the iRNA
compositions of the invention for inhibiting the expression of an
Hdlbp/Vigilin gene and/or for treating a subject having a disorder
that would benefit from inhibiting or reducing the expression of an
Hdlbp/Vigilin gene, e.g., a disorder of lipid metabolism, such as a
hyperlipidemia, e.g., mixed hyperlipidemia, hypertriglyceridemia
and hypercholesterolemia.
[0071] The iRNA agents of the invention may include an RNA strand
(the antisense strand) having a region which is about 30
nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27,
15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18,
15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23,
18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25,
19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27,
20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28,
21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length,
which region is substantially complementary to at least part of an
mRNA transcript of an Hdlbp/Vigilin gene.
[0072] In certain embodiments, the iRNAs of the invention include
an RNA strand (the antisense strand) which can include longer
lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36,
25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of
at least 19 contiguous nucleotides that is substantially
complementary to at least a part of an mRNA transcript of a
Hdlbp/Vigilin gene. These iRNAs with the longer length antisense
strands preferably include a second RNA strand (the sense strand)
of 20-60 nucleotides in length wherein the sense and antisense
strands form a duplex of 18-30 contiguous nucleotides.
[0073] The use of these iRNAs enables the targeted degradation of
mRNAs of an Hdlbp/Vigilin gene in mammals. Very low dosages of
Hdlbp/Vigilin iRNAs, in particular, can specifically and
efficiently mediate RNA interference (RNAi), resulting in
significant inhibition of expression of an Hdlbp/Vigilin gene.
Using cell-based assays, the present inventors have demonstrated
that iRNAs targeting Hdlbp/Vigilin can mediate RNAi, resulting in
significant inhibition of expression of an Hdlbp/Vigilin gene.
Thus, methods and compositions including these iRNAs are useful for
treating a subject who would benefit by a reduction in the levels
and/or activity of an Hdlbp/Vigilin protein, such as a subject
having a disorder of lipid metabolism, such as mixed
hyperlipidemia, hypertriglyceridemia or hypercholesterolemia.
[0074] The following detailed description discloses how to make and
use compositions containing iRNAs to inhibit the expression of an
Hdlbp/Vigilin gene, as well as compositions and methods for
treating subjects having diseases and disorders that would benefit
from inhibition and/or reduction of the expression of this
gene.
I. Definitions
[0075] In order that the present invention may be more readily
understood, certain terms are first defined. In addition, it should
be noted that whenever a value or range of values of a parameter
are recited, it is intended that values and ranges intermediate to
the recited values are also intended to be part of this
invention.
[0076] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element, e.g., a plurality of elements.
[0077] The term "including" is used herein to mean, and is used
interchangeably with, the phrase "including but not limited to".
The term "or" is used herein to mean, and is used interchangeably
with, the term "and/or," unless context clearly indicates
otherwise.
[0078] The term "about" is used herein to mean within the typical
ranges of tolerances in the art. For example, "about" can be
understood as about 2 standard deviations from the mean. In certain
embodiments, about means.+-.10%. In certain embodiments, about
means.+-.5%. When about is present before a series of numbers or a
range, it is understood that "about" can modify each of the numbers
in the series or range.
[0079] The term "Hdlbp/Vigilin" refers to High Density Lipoprotein
Binding Protein having an amino acid sequence from any vertebrate
or mammalian source, including, but not limited to, human, bovine,
chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and
guinea pig, unless specified otherwise. The term also refers to
fragments and variants of native Hdlbp/Vigilin that maintain at
least one in vivo or in vitro activity of a native Hdlbp/Vigilin.
The term encompasses full-length unprocessed precursor forms of
Hdlbp/Vigilin as well as mature forms resulting from
post-translational cleavage of the signal peptide. The nucleotide
and amino acid sequence of a human Hdlbp/Vigilin can be found at,
for example, GenBank Accession No. GI: 1004170703 (NM_005336.5; SEQ
ID NO:5), GenBank Accession No. GI: 1004170704 (NM_203346.4; SEQ ID
NO:6), and GenBank Accession No. GI: 1004170705 (NM_001243900.2;
SEQ ID NO:7). Additional examples of Hdlbp/Vigilin sequences are
readily available using publicly available databases, e.g.,
GenBank, UniProt, and OMIM.
[0080] The term"Hdlbp/Vigilin" as used herein also refers to a
particular polypeptide expressed in a cell by naturally occurring
DNA sequence variations of the Hdlbp/Vigilin gene, such as a single
nucleotide polymorphism in the Hdlbp/Vigilin gene. Numerous SNPs
within the Hdlbp/Vigilin gene have been identified and may be found
at, for example, NCBI dbSNP (see, e.g.,
www.ncbi.nlm.nih.gov/snp).
[0081] As used herein, "target sequence" refers to a contiguous
portion of the nucleotide sequence of an mRNA molecule formed
during the transcription of an Hdlbp/Vigilin gene, including mRNA
that is a product of RNA processing of a primary transcription
product. In one embodiment, the target portion of the sequence will
be at least long enough to serve as a substrate for iRNA-directed
cleavage at or near that portion of the nucleotide sequence of an
mRNA molecule formed during the transcription of an Hdlbp/Vigilin
gene.
[0082] The target sequence may be from about 9-36 nucleotides in
length, e.g., about 15-30 nucleotides in length. For example, the
target sequence can be from about 15-30 nucleotides, 15-29, 15-28,
15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19,
15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24,
18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26,
19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28,
20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29,
21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in
length. Ranges and lengths intermediate to the above recited ranges
and lengths are also contemplated to be part of the invention.
[0083] As used herein, the term "strand comprising a sequence"
refers to an oligonucleotide comprising a chain of nucleotides that
is described by the sequence referred to using the standard
nucleotide nomenclature.
[0084] "G," "C," "A," "T" and "U" each generally stand for a
nucleotide that contains guanine, cytosine, adenine, thymidine and
uracil as a base, respectively. However, it will be understood that
the term "ribonucleotide" or "nucleotide" can also refer to a
modified nucleotide, as further detailed below, or a surrogate
replacement moiety (see, e.g., Table 1). The skilled person is well
aware that guanine, cytosine, adenine, and uracil can be replaced
by other moieties without substantially altering the base pairing
properties of an oligonucleotide comprising a nucleotide bearing
such replacement moiety. For example, without limitation, a
nucleotide comprising inosine as its base can base pair with
nucleotides containing adenine, cytosine, or uracil. Hence,
nucleotides containing uracil, guanine, or adenine can be replaced
in the nucleotide sequences of dsRNA featured in the invention by a
nucleotide containing, for example, inosine. In another example,
adenine and cytosine anywhere in the oligonucleotide can be
replaced with guanine and uracil, respectively to form G-U Wobble
base pairing with the target mRNA. Sequences containing such
replacement moieties are suitable for the compositions and methods
featured in the invention.
[0085] The terms "iRNA", "RNAi agent," "iRNA agent," "RNA
interference agent" as used interchangeably herein, refer to an
agent that contains RNA as that term is defined herein, and which
mediates the targeted cleavage of an RNA transcript via an
RNA-induced silencing complex (RISC) pathway. iRNA directs the
sequence-specific degradation of mRNA through a process known as
RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the
expression of Hdlbp/Vigilin in a cell, e.g., a cell within a
subject, such as a mammalian subject.
[0086] In one embodiment, an RNAi agent of the invention includes a
single stranded RNAi that interacts with a target RNA sequence,
e.g., an Hdlbp/Vigilin target mRNA sequence, to direct the cleavage
of the target RNA. Without wishing to be bound by theory it is
believed that long double stranded RNA introduced into cells is
broken down into double stranded short interfering RNAs (siRNAs)
comprising a sense strand and an antisense strand by a Type III
endonuclease known as Dicer (Sharp et al. (2001) Genes Dev.
15:485). Dicer, a ribonuclease-III-like enzyme, processes these
dsRNA into 19-23 base pair short interfering RNAs with
characteristic two base 3' overhangs (Bernstein, et al., (2001)
Nature 409:363). These siRNAs are then incorporated into an
RNA-induced silencing complex (RISC) where one or more helicases
unwind the siRNA duplex, enabling the complementary antisense
strand to guide target recognition (Nykanen, et al., (2001) Cell
107:309). Upon binding to the appropriate target mRNA, one or more
endonucleases within the RISC cleave the target to induce silencing
(Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect
the invention relates to a single stranded RNA (ssRNA) (the
antisense strand of an siRNA duplex) generated within a cell and
which promotes the formation of a RISC complex to effect silencing
of the target gene, i.e., an Hdlbp/Vigilin gene. Accordingly, the
term "siRNA" is also used herein to refer to an RNAi as described
above.
[0087] In another embodiment, the RNAi agent may be a
single-stranded RNA that is introduced into a cell or organism to
inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC
endonuclease, Argonaute 2, which then cleaves the target mRNA. The
single-stranded siRNAs are generally 15-30 nucleotides and are
chemically modified. The design and testing of single-stranded RNAs
are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012)
Cell 150:883-894, the entire contents of each of which are hereby
incorporated herein by reference. Any of the antisense nucleotide
sequences described herein may be used as a single-stranded siRNA
as described herein or as chemically modified by the methods
described in Lima et al., (2012) Cell 150:883-894.
[0088] In another embodiment, an "iRNA" for use in the compositions
and methods of the invention is a double stranded RNA and is
referred to herein as a "double stranded RNAi agent," "double
stranded RNA (dsRNA) molecule," "dsRNA agent" or "dsRNA". The term
"dsRNA", refers to a complex of ribonucleic acid molecules, having
a duplex structure comprising two anti-parallel and substantially
complementary nucleic acid strands, referred to as having "sense"
and "antisense" orientations with respect to a target RNA, i.e., an
Hdlbp/Vigilin gene. In some embodiments of the invention, a double
stranded RNA (dsRNA) triggers the degradation of a target RNA,
e.g., an mRNA, through a post-transcriptional gene-silencing
mechanism referred to herein as RNA interference or RNAi.
[0089] In general, the majority of nucleotides of each strand of a
dsRNA molecule are ribonucleotides, but as described in detail
herein, each or both strands can also include one or more
non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified
nucleotide. In addition, as used in this specification, an "RNAi
agent" may include ribonucleotides with chemical modifications; an
RNAi agent may include substantial modifications at multiple
nucleotides. As used herein, the term "modified nucleotide" refers
to a nucleotide having, independently, a modified sugar moiety, a
modified internucleotide linkage, and/or a modified nucleobase.
Thus, the term modified nucleotide encompasses substitutions,
additions or removal of, e.g., a functional group or atom, to
internucleoside linkages, sugar moieties, or nucleobases. The
modifications suitable for use in the agents of the invention
include all types of modifications disclosed herein or known in the
art. Any such modifications, as used in a siRNA type molecule, are
encompassed by "RNAi agent" for the purposes of this specification
and claims.
[0090] The duplex region may be of any length that permits specific
degradation of a desired target RNA through a RISC pathway, and may
range from about 9 to 36 base pairs in length, e.g., about 15-30
base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29,
15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20,
15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25,
18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,
19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29,
20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30,
21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base
pairs in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0091] The two strands forming the duplex structure may be
different portions of one larger RNA molecule, or they may be
separate RNA molecules. Where the two strands are part of one
larger molecule, and therefore are connected by an uninterrupted
chain of nucleotides between the 3'-end of one strand and the
5'-end of the respective other strand forming the duplex structure,
the connecting RNA chain is referred to as a "hairpin loop." A
hairpin loop can comprise at least one unpaired nucleotide. In some
embodiments, the hairpin loop can comprise at least 2, at least 3,
at least 4, at least 5, at least 6, at least 7, at least 8, at
least 9, at least 10, at least 20, at least 23 or more unpaired
nucleotides.
[0092] In some embodiments, a dsRNA agent of the invention
comprises a tetraloop. As used herein, "tetraloop" in the context
of a dsRNA refers to a loop (a single stranded region) consisting
of four nucleotides that forms a stable secondary structure that
contributes to the stability of adjacent Watson-Crick hybridized
nucleotides. Without being limited to theory, a tetraloop may
stabilize an adjacent Watson-Crick base pair by stacking
interactions. In addition, interactions among the four nucleotides
in a tetraloop include but are not limited to non-Watson-Crick base
pairing, stacking interactions, hydrogen bonding, and contact
interactions (Cheong et al., Nature 1990 Aug. 16; 346(6285):680-2;
Heus and Pardi, Science 1991 Jul. 12; 253(5016): 191-4). A
tetraloop confers an increase in the melting temperature (Tm) of an
adjacent duplex that is higher than expected from a simple model
loop sequence consisting of four random bases. For example, a
tetraloop can confer a melting temperature of at least 55.degree.
C. in 10 mM NaHPO4 to a hairpin comprising a duplex of at least 2
base pairs in length. A tetraloop may contain ribonucleotides,
deoxyribonucleotides, modified nucleotides, and combinations
thereof. Examples of RNA tetraloops include the UNCG family of
tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g.,
GAAA), and the CUUG tetraloop. (Woese et al., Proc Natl Acad Sci
USA. 1990 November; 87(21):8467-71; Antao et al., Nucleic Acids
Res. 1991 Nov. 11; 19(21):5901-5). Examples of DNA tetraloops
include the d(GNNA) family of tetraloops (e.g., d(GTTA), the
d(GNRA)) family of tetraloops, the d(GNAB) family of tetraloops,
the d(CNNG) family of tetraloops, the d(TNCG) family of tetraloops
(e.g., d(TTCG)). (Nakano et al. Biochemistry, 41 (48), 14281-14292,
2002.; SHINJI et al. Nippon Kagakkai Koen Yokoshu VOL. 78th; NO. 2;
PAGE. 731 (2000).)
[0093] In certain embodiments of the invention, tetraloop- and
modified nucleotide-containing dsNAs are contemplated as described,
e.g., in US 2011/0288147, the entire contents of which are
incorporated by reference herein. In certain such embodiments, a
dsNA of the invention possesses a first strand and a second strand,
where the first strand and the second strand form a duplex region
of 19-25 nucleotides in length, wherein the first strand comprises
a 3' region that extends beyond the first strand-second strand
duplex region and comprises a tetraloop, and the dsNA comprises a
discontinuity between the 3' terminus of the first strand and the
5' terminus of the second strand.
[0094] Optionally, the discontinuity is positioned at a projected
dicer cleavage site of the tetraloop-containing dsNA. It is
contemplated that, as for any of the other duplexed
oligonucleotides of the invention, tetraloop-containing duplexes of
the invention can possess any range of modifications disclosed
herein or otherwise known in the art, including, e.g., 2'-O-methyl,
2'-fluoro, inverted base, GalNAc moieties, etc. Typically, every
nucleotide on both strands of the tetraloop-containing dsNA is
chemically modified if the tetraloop-containing dsNA is going to be
delivered without using lipid nanoparticles or some other delivery
method that protects the dsNA from degradation during the delivery
process. However, in certain embodiments, one or more nucleotides
are not modified.
[0095] Where the two substantially complementary strands of a dsRNA
are comprised by separate RNA molecules, those molecules need not,
but can be covalently connected. Where the two strands are
connected covalently by means other than an uninterrupted chain of
nucleotides between the 3'-end of one strand and the 5'-end of the
respective other strand forming the duplex structure, the
connecting structure is referred to as a "linker." The RNA strands
may have the same or a different number of nucleotides. The maximum
number of base pairs is the number of nucleotides in the shortest
strand of the dsRNA minus any overhangs that are present in the
duplex. In addition to the duplex structure, an RNAi may comprise
one or more nucleotide overhangs.
[0096] In one embodiment, an RNAi agent of the invention is a
dsRNA, interacts with a target RNA sequence, e.g., an Hdlbp/Vigilin
target mRNA sequence, to direct the cleavage of the target RNA.
Without wishing to be bound by theory, long double stranded RNA
introduced into cells is broken down into siRNA by a Type III
endonuclease known as Dicer (Sharp et al. (2001) Genes Dev.
15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA
into 19-23 base pair short interfering RNAs with characteristic two
base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The
siRNAs are then incorporated into an RNA-induced silencing complex
(RISC) where one or more helicases unwind the siRNA duplex,
enabling the complementary antisense strand to guide target
recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to
the appropriate target mRNA, one or more endonucleases within the
RISC cleave the target to induce silencing (Elbashir, et al.,
(2001) Genes Dev. 15:188).
[0097] As used herein, the term "nucleotide overhang" refers to at
least one unpaired nucleotide that protrudes from the duplex
structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of
one strand of a dsRNA extends beyond the 5'-end of the other
strand, or vice versa, there is a nucleotide overhang. A dsRNA can
comprise an overhang of at least one nucleotide; alternatively the
overhang can comprise at least two nucleotides, at least three
nucleotides, at least four nucleotides, at least five nucleotides
or more. A nucleotide overhang can comprise or consist of a
nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of a dsRNA.
[0098] In one embodiment, the antisense strand of a dsRNA has a
1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
nucleotide, overhang at the 3'-end and/or the 5'-end. In one
embodiment, the sense strand of a dsRNA has a 1-10 nucleotide,
e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at
the 3'-end and/or the 5'-end. In another embodiment, one or more of
the nucleotides in the overhang is replaced with a nucleoside
thiophosphate.
[0099] The terms "blunt" or "blunt ended" as used herein in
reference to a dsRNA mean that there are no unpaired nucleotides or
nucleotide analogs at a given terminal end of a dsRNA, i.e., no
nucleotide overhang. One or both ends of a dsRNA can be blunt.
Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt
ended. To be clear, a "blunt ended" dsRNA is a dsRNA that is blunt
at both ends, i.e., no nucleotide overhang at either end of the
molecule. Most often such a molecule will be double stranded over
its entire length.
[0100] The term "antisense strand" or "guide strand" refers to the
strand of an iRNA, e.g., a dsRNA, which includes a region that is
substantially complementary to a target sequence, e.g., an
Hdlbp/Vigilin mRNA.
[0101] As used herein, the term "region of complementarity" refers
to the region on the antisense strand that is substantially
complementary to a sequence, for example a target sequence, e.g.,
an Hdlbp/Vigilin nucleotide sequence, as defined herein. Where the
region of complementarity is not fully complementary to the target
sequence, the mismatches can be in the internal or terminal regions
of the molecule. Generally, the most tolerated mismatches are in
the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the
5'- and/or 3'-terminus of the iRNA.
[0102] The term "sense strand" or "passenger strand" as used
herein, refers to the strand of an iRNA that includes a region that
is substantially complementary to a region of the antisense strand
as that term is defined herein.
[0103] As used herein, the term "cleavage region" refers to a
region that is located immediately adjacent to the cleavage site.
The cleavage site is the site on the target at which cleavage
occurs. In some embodiments, the cleavage region comprises three
bases on either end of, and immediately adjacent to, the cleavage
site. In some embodiments, the cleavage region comprises two bases
on either end of, and immediately adjacent to, the cleavage site.
In some embodiments, the cleavage site specifically occurs at the
site bound by nucleotides 10 and 11 of the antisense strand, and
the cleavage region comprises nucleotides 11, 12 and 13.
[0104] As used herein, and unless otherwise indicated, the term
"complementary," when used to describe a first nucleotide sequence
in relation to a second nucleotide sequence, refers to the ability
of an oligonucleotide or polynucleotide comprising the first
nucleotide sequence to hybridize and form a duplex structure under
certain conditions with an oligonucleotide or polynucleotide
comprising the second nucleotide sequence, as will be understood by
the skilled person. Such conditions can, for example, be stringent
conditions, where stringent conditions can include: 400 mM NaCl, 40
mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for
12-16 hours followed by washing (see, e.g., "Molecular Cloning: A
Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor
Laboratory Press). Other conditions, such as physiologically
relevant conditions as can be encountered inside an organism, can
apply. The skilled person will be able to determine the set of
conditions most appropriate for a test of complementarity of two
sequences in accordance with the ultimate application of the
hybridized nucleotides.
[0105] Complementary sequences within an iRNA, e.g., within a dsRNA
as described herein, include base-pairing of the oligonucleotide or
polynucleotide comprising a first nucleotide sequence to an
oligonucleotide or polynucleotide comprising a second nucleotide
sequence over the entire length of one or both nucleotide
sequences. Such sequences can be referred to as "fully
complementary" with respect to each other herein. However, where a
first sequence is referred to as "substantially complementary" with
respect to a second sequence herein, the two sequences can be fully
complementary, or they can form one or more, but generally not more
than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a
duplex up to 30 base pairs, while retaining the ability to
hybridize under the conditions most relevant to their ultimate
application, e.g., inhibition of gene expression via a RISC
pathway. However, where two oligonucleotides are designed to form,
upon hybridization, one or more single stranded overhangs, such
overhangs shall not be regarded as mismatches with regard to the
determination of complementarity. For example, a dsRNA comprising
one oligonucleotide 21 nucleotides in length and another
oligonucleotide 23 nucleotides in length, wherein the longer
oligonucleotide comprises a sequence of 21 nucleotides that is
fully complementary to the shorter oligonucleotide, can yet be
referred to as "fully complementary" for the purposes described
herein.
[0106] "Complementary" sequences, as used herein, can also include,
or be formed entirely from, non-Watson-Crick base pairs and/or base
pairs formed from non-natural and modified nucleotides, in so far
as the above requirements with respect to their ability to
hybridize are fulfilled. Such non-Watson-Crick base pairs include,
but are not limited to, G:U Wobble or Hoogstein base pairing.
[0107] The terms "complementary," "fully complementary" and
"substantially complementary" herein can be used with respect to
the base matching between the sense strand and the antisense strand
of a dsRNA, or between the antisense strand of an iRNA agent and a
target sequence, as will be understood from the context of their
use.
[0108] As used herein, a polynucleotide that is "substantially
complementary to at least part of" a messenger RNA (mRNA) refers to
a polynucleotide that is substantially complementary to a
contiguous portion of the mRNA of interest (e.g., an mRNA encoding
Hdlbp/Vigilin). For example, a polynucleotide is complementary to
at least a part of an Hdlbp/Vigilin mRNA if the sequence is
substantially complementary to a non-interrupted portion of an mRNA
encoding Hdlbp/Vigilin.
[0109] Accordingly, in some embodiments, the antisense
polynucleotides disclosed herein are fully complementary to the
target Hdlbp/Vigilin sequence. In some embodiments, the sense
polynucleotides disclosed herein are fully complementary to the
antisense sequence of a target Hdlbp/Vigilin sequence.
[0110] In other embodiments, the antisense polynucleotides
disclosed herein are substantially complementary to the target
Hdlbp/Vigilin sequence and comprise a contiguous nucleotide
sequence which is at least about 80% complementary over its entire
length to the equivalent region of the nucleotide sequence of SEQ
ID NO:5, or a fragment of SEQ ID NO:5, such as about 85%, about
86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98%, or about 99% complementary.
[0111] In other embodiments, the sense polynucleotides disclosed
herein are substantially complementary to the antisense sequence of
a target Hdlbp/Vigilin sequence and comprise a contiguous
nucleotide sequence which is at least about 80% complementary over
its entire length to the equivalent region of the nucleotide
sequence of SEQ ID NO:11, or a fragment of SEQ ID NO:11, such as
about 85%, about 86%, about 87%, about 88%, about 89%, about 90%,
about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
about 97%, about 98%, or about 99% complementary.
[0112] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is complementary to a target
Hdlbp/Vigilin sequence and comprises a contiguous nucleotide
sequence which is at least about 80% complementary over its entire
length to any one of the sense strand nucleotide sequences in any
one of Tables 2-4, or a fragment of any one of the sense strand
nucleotide sequences in any one of Tables 2-4, such as about 85%,
about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%,
about 92%, about 93%, about 94%, about 95%, about 96%, about 97%,
about 98%, or about 99% complementary.
[0113] In some embodiments, an iRNA of the invention includes an
antisense strand that is substantially complementary to the target
Hdlbp/Vigilin sequence and comprises a contiguous nucleotide
sequence which is at least about 80% complementary over its entire
length to the equivalent region of the nucleotide sequence of any
one of the antisense strand nucleotide sequences in any one of
Tables 2-4, or a fragment of any one of the antisense strand
nucleotide sequences in any one of Tables 2-4, such as at least
85%, 90%, 95% complementary, or 100% complementary.
[0114] In other embodiments, the antisense strand polynucleotides
disclosed herein are substantially complementary to the target
Hdlbp/Vigilin sequence and comprise the nucleotide sequence of
5'-usUfsuAfuGfgUfcAfaugUfuGfaUfcUfcsusa-3' (SEQ ID NO: 2). In
certain embodiments, the antisense strand polynucleotides disclosed
herein are substantially complementary to the target Hdlbp/Vigilin
sequence and comprise the nucleotide sequence of
5'-usCfscUfuAfaAfgCfccgAfuCfuUfcCfusgsc-3' (SEQ ID NO: 4).
[0115] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is the same as a target
Hdlbp/Vigilin sequence. In some embodiments, and wherein the sense
strand polynucleotide comprises the nucleotide sequence of
5'-GfsasGfaUfcAfaCfAfUfuGfaCfcAfuAfaAf-3' (SEQ ID NO: 1). In
certain embodiments, the sense strand polynucleotides disclosed
herein comprise the nucleotide sequence of
5'-AfsgsGfaAfgAfuCfGfGfgCfuUfuAfaGfgAf-3' (SEQ ID NO: 3).
[0116] In one embodiment, at least partial suppression of the
expression of an Hdlbp/Vigilin gene, is assessed by a reduction of
the amount of Hdlbp/Vigilin mRNA which can be isolated from or
detected in a first cell or group of cells in which an
Hdlbp/Vigilin gene is transcribed and which has or have been
treated such that the expression of an Hdlbp/Vigilin gene is
inhibited, as compared to a second cell or group of cells
substantially identical to the first cell or group of cells but
which has or have not been so treated (control cells). The degree
of inhibition may be expressed in terms of:
( mRNA .times. .times. in .times. .times. control .times. .times.
cells ) - ( mRNA .times. .times. in .times. .times. treated .times.
.times. cells ) ( mRNA .times. .times. in .times. .times. control
.times. .times. cells ) 100 .times. % ##EQU00001##
[0117] The phrase "contacting a cell with an RNAi agent," such as a
dsRNA, as used herein, includes contacting a cell by any possible
means. Contacting a cell with an RNAi agent includes contacting a
cell in vitro with the iRNA or contacting a cell in vivo with the
iRNA. The contacting may be done directly or indirectly. Thus, for
example, the RNAi agent may be put into physical contact with the
cell by the individual performing the method, or alternatively, the
RNAi agent may be put into a situation that will permit or cause it
to subsequently come into contact with the cell.
[0118] Contacting a cell in vitro may be done, for example, by
incubating the cell with the RNAi agent. Contacting a cell in vivo
may be done, for example, by injecting the RNAi agent into or near
the tissue where the cell is located, or by injecting the RNAi
agent into another area, e.g., the bloodstream or the subcutaneous
space, such that the agent will subsequently reach the tissue where
the cell to be contacted is located. For example, the RNAi agent
may contain and/or be coupled to a ligand, e.g., GalNAc3, that
directs the RNAi agent to a site of interest, e.g., the liver.
Combinations of in vitro and in vivo methods of contacting are also
possible. For example, a cell may also be contacted in vitro with
an RNAi agent and subsequently transplanted into a subject.
[0119] In one embodiment, contacting a cell with an iRNA includes
"introducing" or "delivering the iRNA into the cell" by
facilitating or effecting uptake or absorption into the cell.
Absorption or uptake of an iRNA can occur through unaided diffusive
or active cellular processes, or by auxiliary agents or devices.
Introducing an iRNA into a cell may be in vitro and/or in vivo. For
example, for in vivo introduction, iRNA can be injected into a
tissue site or administered systemically. In vitro introduction
into a cell includes methods known in the art such as
electroporation and lipofection. Further approaches are described
herein below and/or are known in the art.
[0120] The term "lipid nanoparticle" or "LNP" is a vesicle
comprising a lipid layer encapsulating a pharmaceutically active
molecule, such as a nucleic acid molecule, e.g., an iRNA or a
plasmid from which an iRNA is transcribed. LNPs are described in,
for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and
8,058,069, the entire contents of which are hereby incorporated
herein by reference.
[0121] As used herein, a "subject" is an animal, such as a mammal,
including a primate (such as a human, a non-human primate, e.g., a
monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a
camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a
guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or
a bird (e.g., a duck or a goose). In an embodiment, the subject is
a human, such as a human being treated or assessed for a disease,
disorder or condition that would benefit from reduction in
Hdlbp/Vigilin expression; a human at risk for a disease, disorder
or condition that would benefit from reduction in Hdlbp/Vigilin
expression; a human having a disease, disorder or condition that
would benefit from reduction in Hdlbp/Vigilin expression; and/or
human being treated for a disease, disorder or condition that would
benefit from reduction in Hdlbp/Vigilin expression as described
herein.
[0122] As used herein, the terms "treating" or "treatment" refer to
a beneficial or desired result including, such as lowering levels
of triglycerides in a subject. The terms "treating" or "treatment"
also include, but are not limited to, alleviation or amelioration
of one or more symptoms of a disorder of lipid metabolism, such as,
e.g., a decrease in the size of atherosclerotic plaque. "Treatment"
can also mean prolonging survival as compared to expected survival
in the absence of treatment.
[0123] By "lower" in the context of a disease marker or symptom is
meant a statistically significant decrease in such level. The
decrease can be, for example, at least 10%, at least 20%, at least
30%, at least 40% or more, and is preferably down to a level
accepted as within the range of normal for an individual without
such disorder.
[0124] As used herein, "prevention" or "preventing," when used in
reference to a disease, disorder or condition thereof, that would
benefit from a reduction in expression of an Hdlbp/Vigilin gene,
such as a hyperlipidemia, refers to a reduction in the likelihood
that a subject will develop a symptom associated with such disease,
disorder, or condition, e.g., high triglyceride levels or large
atherosclerotic plaques. The likelihood of developing a high
tryglyceride level or large atherosclerotic plaque is reduced, for
example, when an individual having one or more risk factors for a
high tryglyceride level or a large atherosclerotic plaque either
fails to develop high tryglyceride levels or atherosclerotic
plaques or develops high tryglyceride levels or atherosclerotic
plaques with less severity relative to a population having the same
risk factors and not receiving treatment as described herein. The
failure to develop a disease, disorder or condition, or the
reduction in the development of a symptom associated with such a
disease, disorder or condition i (e.g., by at least about 10% on a
clinically accepted scale for that disease or disorder), or the
exhibition of delayed symptoms delayed (e.g., by days, weeks,
months or years) is considered effective prevention.
[0125] The interchangeably used terms "Hdlbp/Vigilin-associated
disease" and "disorder that would benefit from a reduction in
Hdlbp/Vigilin expression," as used herein, are intended to include
any disease, disorder, or condition associated with the
Hdlbp/Vigilin gene or protein. Exemplary Hdlbp/Vigilin-associated
diseases include acquired or inherited "disorders of lipid
metabolism" which include any disorder associated with or caused by
a disturbance in lipid metabolism. For example, this term includes
any disorder, disease or condition characterized by abnormal
elevation of levels of any or all lipids and/or lipoproteins in the
blood or a condition that can lead to abnormal elevation of levels
of any or all lipids and/or lipoproteins in the blood, such as a
hyperlipidemia, and other forms of lipid imbalance such as
hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia,
as well as the pathological conditions associated with these
disorders, e.g., congestive heart disease (CHD) and
atherosclerosis.
[0126] Exemplary disorders of lipid metabolism include, but are not
limited to, atherosclerosis, dyslipidemia, hypertriglyceridemia
(including drug-induced hypertriglyceridemia, diuretic-induced
hypertriglyceridemia, alcohol-induced hypertriglyceridemia,
.beta.-adrenergic blocking agent-induced hypertriglyceridemia,
estrogen-induced hypertriglyceridemia, glucocorticoid-induced
hypertriglyceridemia, retinoid-induced hypertriglyceridemia, and
cimetidine-induced hypertriglyceridemia, and familial
hypertriglyceridemia), acute pancreatitis associated with
hypertriglyceridemia, chylomicron syndrome, familial
chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or
hypoactivity, hyperlipidemia (including familial combined
hyperlipidemia), familial partial lipodystrophy type 1 (FPLD1),
hypercholesterolemia, mixed hyperlipidemia (or mixed
hyperlipoproteinemia familial, gout associated with
hypercholesterolemia, xanthomatosis (subcutaneous cholesterol
deposits), hyperlipidemia with heterogeneous LPL deficiency, and
hyperlipidemia with high LDL, heterogeneous LPL deficiency, and an
induced or acquired disorder, such as a disorder induced or
acquired as a result of a disease.
[0127] As used herein, the term "serum lipid" refers to any major
lipid present in the blood. Serum lipids may be present in the
blood either in free form or as a part of a protein complex, e.g.,
a lipoprotein complex. Non-limiting examples of serum lipids
include triglycerides, cholesterol, such as total cholesterol, low
density lipoprotein cholesterol (LDL-C), high-density lipoprotein
cholesterol (HDL-C), very low density lipoprotein cholesterol
(VLDL-C) and intermediate-density lipoprotein cholesterol
(IDL-C).
[0128] In some embodiments, the disorder of lipid metabolism is a
hyperlipidemia. As used herein, the term "hyperlipidemia" refers to
any disorder, disease or condition characterized by abnormal
elevation of levels of any or all lipids, such as cholesterol and
triglycerides, and/or lipoproteins in the blood or a condition that
can lead to abnormal elevation of levels of any or all lipids
and/or lipoproteins in the blood.
[0129] In one embodiment, the hyperlipidemia is
hypertriglyceridemia.
[0130] As used herein, the term "hypertriglyceridemia" refers to a
condition in which triglyceride levels are elevated, often caused
or exacerbated by uncontrolled diabetes mellitus, obesity, and
sedentary habits. This condition is a risk factor for coronary
artery disease. Hypertriglyceridemia is usually asymptomatic until
triglycerides are greater than 1000-2000 mg/dL. Signs and symptoms
may include the following: pain in the mid-epigastric, chest, or
back regions; nausea, vomiting, dyspnea, xanthomas, corneal arcus,
and/or xanthelasmas
[0131] In some embodiments, the hyperlipidemia is
hypercholesterolemia.
[0132] As used herein the term "hypercholesterolemia" refers to a
form of hyperlipidemia (elevated levels of lipids in the blood) in
which there are high levels of cholesterol in the serum of a
subject, e.g., at least about 240 mg/dL of total cholesterol.
[0133] In other embodiments, the hyperlipidemia is mixed
hyperlipidemia.
[0134] As used herein the term "mixed hyperlipidemia" also referred
to as type 5 hyperlipidemia refers to a form of hyperlipidemia in
which there are elevated levels of VLDL and chylomicrons found in
plasma in the serum of a subject, e.g., at least about 240 mg/dL of
total cholesterol.
[0135] Cardiovascular diseases associated with disorders of lipid
metabolism are also considered "disorders of lipid metabolism", as
defined herein. These diseases may include coronary artery disease
(also called ischemic heart disease), atherosclerosis, inflammation
associated with coronary artery disease, restenosis, peripheral
vascular diseases, and stroke.
[0136] Disorders related to body weight are also considered
"disorders of lipid metabolism", as defined herein. Such disorders
may include obesity, metabolic syndrome including independent
components of metabolic syndrome (e.g., central obesity,
FBG/pre-diabetes/diabetes, hypercholesterolemia,
hypertriglyceridemia, and hypertension), hypothyroidism, uremia,
and other conditions associated with weight gain (including rapid
weight gain), weight loss, maintenance of weight loss, or risk of
weight regain following weight loss.
[0137] Blood sugar disorders are further considered "disorders of
lipid metabolism", as defined herein. Such disorders may include
diabetes, hypertension, and polycystic ovarian syndrome related to
insulin resistance. Other exemplary disorders of lipid metabolism
may also include renal transplantation, nephrotic syndrome,
Cushing's syndrome, acromegaly, systemic lupus erythematosus,
dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's
disease.
[0138] "Therapeutically effective amount," as used herein, is
intended to include the amount of an RNAi agent that, when
administered to a subject having a disorder of lipid metabolism, is
sufficient to effect treatment of the disease (e.g., by
diminishing, ameliorating or maintaining the existing disease or
one or more symptoms of disease). The "therapeutically effective
amount" may vary depending on the RNAi agent, how the agent is
administered, the disease and its severity and the history, age,
weight, family history, genetic makeup, the types of preceding or
concomitant treatments, if any, and other individual
characteristics of the subject to be treated.
[0139] "Prophylactically effective amount," as used herein, is
intended to include the amount of an iRNA that, when administered
to a subject having a disorder of lipid metabolism, is sufficient
to prevent or ameliorate the disease or one or more symptoms of the
disease. Ameliorating the disease includes slowing the course of
the disease or reducing the severity of later-developing disease.
The "prophylactically effective amount" may vary depending on the
iRNA, how the agent is administered, the degree of risk of disease,
and the history, age, weight, family history, genetic makeup, the
types of preceding or concomitant treatments, if any, and other
individual characteristics of the patient to be treated.
[0140] A "therapeutically-effective amount" or "prophylacticaly
effective amount" also includes an amount of an RNAi agent that
produces some desired local or systemic effect at a reasonable
benefit/risk ratio applicable to any treatment. iRNA employed in
the methods of the present invention may be administered in a
sufficient amount to produce a reasonable benefit/risk ratio
applicable to such treatment.
[0141] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human subjects and
animal subjects without excessive toxicity, irritation, allergic
response, or other problem or complication, commensurate with a
reasonable benefit/risk ratio.
[0142] The phrase "pharmaceutically-acceptable carrier" as used
herein means a pharmaceutically-acceptable material, composition or
vehicle, such as a liquid or solid filler, diluent, excipient,
manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc
stearate, or steric acid), or solvent encapsulating material,
involved in carrying or transporting the subject compound from one
organ, or portion of the body, to another organ, or portion of the
body. Each carrier must be "acceptable" in the sense of being
compatible with the other ingredients of the formulation and not
injurious to the subject being treated. Some examples of materials
which can serve as pharmaceutically-acceptable carriers include:
(1) sugars, such as lactose, glucose and sucrose; (2) starches,
such as corn starch and potato starch; (3) cellulose, and its
derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt;
(6) gelatin; (7) lubricating agents, such as magnesium state,
sodium lauryl sulfate and talc; (8) excipients, such as cocoa
butter and suppository waxes; (9) oils, such as peanut oil,
cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and
soybean oil; (10) glycols, such as propylene glycol; (11) polyols,
such as glycerin, sorbitol, mannitol and polyethylene glycol; (12)
esters, such as ethyl oleate and ethyl laurate; (13) agar; (14)
buffering agents, such as magnesium hydroxide and aluminum
hydroxide; (15) alginic acid; (16) pyrogen-free water; (17)
isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20)
pH buffered solutions; (21) polyesters, polycarbonates and/or
polyanhydrides; (22) bulking agents, such as polypeptides and amino
acids (23) serum component, such as serum albumin, HDL and LDL; and
(22) other non-toxic compatible substances employed in
pharmaceutical formulations.
[0143] The term "sample," as used herein, includes a collection of
similar fluids, cells, or tissues isolated from a subject, as well
as fluids, cells, or tissues present within a subject. Examples of
biological fluids include blood, serum and serosal fluids, plasma,
cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the
like. Tissue samples may include samples from tissues, organs or
localized regions. For example, samples may be derived from
particular organs, parts of organs, or fluids or cells within those
organs. In certain embodiments, samples may be derived from the
liver (e.g., whole liver or certain segments of liver or certain
types of cells in the liver, such as, e.g., hepatocytes). In some
embodiments, a "sample derived from a subject" refers to blood or
plasma drawn from the subject.
II. iRNAs of the Invention
[0144] Described herein are iRNA agents which inhibit the
expression of an Hdlbp/Vigilin gene. In one embodiment, the iRNA
agent includes double stranded ribonucleic acid (dsRNA) molecules
for inhibiting the expression of an Hdlbp/Vigilin gene in a cell,
such as a cell within a subject, e.g., a mammal, such as a human
having a disorder of lipid metabolism, e.g., mixed hyperlipidemia,
hypertriglyceridemia or hypercholesterolemia. The dsRNA includes an
antisense strand having a region of complementarity which is
complementary to at least a part of an mRNA formed in the
expression of an Hdlbp/Vigilin gene. The region of complementarity
is about 30 nucleotides or less in length (e.g., about 30, 29, 28,
27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in
length). Upon contact with a cell expressing the Hdlbp/Vigilin
gene, the iRNA inhibits the expression of the Hdlbp/Vigilin gene
(e.g., a human Hdlbp/Vigilin gene) by at least about 10% as assayed
by, for example, a PCR or branched DNA (bDNA)-based method, or by a
protein-based method, such as by immunofluorescence analysis,
using, for example, Western Blotting or flow cytometric
techniques.
[0145] A dsRNA includes two RNA strands that are complementary and
hybridize to form a duplex structure under conditions in which the
dsRNA will be used. One strand of a dsRNA (the antisense strand)
includes a region of complementarity that is substantially
complementary, and generally fully complementary, to a target
sequence. The target sequence can be derived from the sequence of
an mRNA formed during the expression of an Hdlbp/Vigilin gene. The
other strand (the sense strand) includes a region that is
complementary to the antisense strand, such that the two strands
hybridize and form a duplex structure when combined under suitable
conditions. As described elsewhere herein and as known in the art,
the complementary sequences of a dsRNA can also be contained as
self-complementary regions of a single nucleic acid molecule, as
opposed to being on separate oligonucleotides.
[0146] Generally, the duplex structure is between 15 and 30 base
pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and
lengths intermediate to the above recited ranges and lengths are
also contemplated to be part of the invention.
[0147] Similarly, the region of complementarity to the target
sequence is between 15 and 30 nucleotides in length, e.g., between
15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21,
15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26,
18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28,
19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30,
20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21,
21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22
nucleotides in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0148] In some embodiments, the dsRNA is between about 15 and about
23 nucleotides in length, or between about 25 and about 30
nucleotides in length. In general, the dsRNA is long enough to
serve as a substrate for the Dicer enzyme. For example, it is well
known in the art that dsRNAs longer than about 21-23 nucleotides
can serve as substrates for Dicer. As the ordinarily skilled person
will also recognize, the region of an RNA targeted for cleavage
will most often be part of a larger RNA molecule, often an mRNA
molecule. Where relevant, a "part" of an mRNA target is a
contiguous sequence of an mRNA target of sufficient length to allow
it to be a substrate for RNAi-directed cleavage (i.e., cleavage
through a RISC pathway).
[0149] One of skill in the art will also recognize that the duplex
region is a primary functional portion of a dsRNA, e.g., a duplex
region of about 9 to 36 base pairs, e.g., about 10-36, 11-36,
12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35,
14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33,
10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32,
12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32,
14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24,
15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29,
18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20,
19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22,
19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,
20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25,
21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the
extent that it becomes processed to a functional duplex, of e.g.,
15-30 base pairs, that targets a desired RNA for cleavage, an RNA
molecule or complex of RNA molecules having a duplex region greater
than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan
will recognize that in one embodiment, a miRNA is a dsRNA. In
another embodiment, a dsRNA is not a naturally occurring miRNA. In
another embodiment, an iRNA agent useful to target Hdlbp/Vigilin
expression is not generated in the target cell by cleavage of a
larger dsRNA.
[0150] A dsRNA as described herein can further include one or more
single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4
nucleotides. dsRNAs having at least one nucleotide overhang can
have unexpectedly superior inhibitory properties relative to their
blunt-ended counterparts. A nucleotide overhang can comprise or
consist of a nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of a dsRNA.
[0151] A dsRNA can be synthesized by standard methods known in the
art as further discussed below, e.g., by use of an automated DNA
synthesizer, such as are commercially available from, for example,
Biosearch, Applied Biosystems, Inc.
[0152] iRNA compounds of the invention may be prepared using a
two-step procedure. First, the individual strands of the double
stranded RNA molecule are prepared separately. Then, the component
strands are annealed. The individual strands of the siRNA compound
can be prepared using solution-phase or solid-phase organic
synthesis or both. Organic synthesis offers the advantage that the
oligonucleotide strands comprising unnatural or modified
nucleotides can be easily prepared. Single-stranded
oligonucleotides of the invention can be prepared using
solution-phase or solid-phase organic synthesis or both.
[0153] In one aspect, a dsRNA of the invention includes at least
two nucleotide sequences, a sense sequence and an anti-sense
sequence. The sense strand sequence may be selected from the group
of sequences provided in any one of Tables 2-4, and the
corresponding nucleotide sequence of the antisense strand of the
sense strand may be selected from the group of sequences in any one
of Tables 2-4. In this aspect, one of the two sequences is
complementary to the other of the two sequences, with one of the
sequences being substantially complementary to a sequence of an
mRNA generated in the expression of an Hdlbp/Vigilin gene. As such,
in this aspect, a dsRNA will include two oligonucleotides, where
one oligonucleotide is described as the sense strand (passenger
strand) in any one of Tables 2-4, and the second oligonucleotide is
described as the corresponding antisense strand (guide strand) of
the sense strand in any one of Tables 2-4. In one embodiment, the
substantially complementary sequences of the dsRNA are contained on
separate oligonucleotides. In another embodiment, the substantially
complementary sequences of the dsRNA are contained on a single
oligonucleotide.
[0154] It will be understood that, although the sequences in Tables
2 and 4 are described as modified and/or conjugated sequences, the
RNA of the iRNA of the invention e.g., a dsRNA of the invention,
may comprise any one of the sequences set forth in any one of
Tables 2-4 that is un-modified, un-conjugated, and/or modified
and/or conjugated differently than described therein.
[0155] The skilled person is well aware that dsRNAs having a duplex
structure of between about 20 and 23 base pairs, e.g., 21, base
pairs have been hailed as particularly effective in inducing RNA
interference (Elbashir et al., (2001) EMBO J., 20:6877-6888).
However, others have found that shorter or longer RNA duplex
structures can also be effective (Chu and Rana (2007) RNA
14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the
embodiments described above, by virtue of the nature of the
oligonucleotide sequences provided herein, dsRNAs described herein
can include at least one strand of a length of minimally 21
nucleotides. It can be reasonably expected that shorter duplexes
minus only a few nucleotides on one or both ends can be similarly
effective as compared to the dsRNAs described above. Hence, dsRNAs
having a sequence of at least 15, 16, 17, 18, 19, 20, or more
contiguous nucleotides derived from one of the sequences provided
herein, and differing in their ability to inhibit the expression of
an Hdlbp/Vigilin gene by not more than about 5, 10, 15, 20, 25, or
30% inhibition from a dsRNA comprising the full sequence, are
contemplated to be within the scope of the present invention.
[0156] In addition, the RNAs described herein identify a site(s) in
an Hdlbp/Vigilin transcript that is susceptible to RISC-mediated
cleavage. As such, the present invention further features iRNAs
that target within this site(s). As used herein, an iRNA is said to
target within a particular site of an RNA transcript if the iRNA
promotes cleavage of the transcript anywhere within that particular
site. Such an iRNA will generally include at least about 15
contiguous nucleotides from one of the sequences provided herein
coupled to additional nucleotide sequences taken from the region
contiguous to the selected sequence in an Hdlbp/Vigilin gene.
[0157] While a target sequence is generally about 15-30 nucleotides
in length, there is wide variation in the suitability of particular
sequences in this range for directing cleavage of any given target
RNA. Various software packages and the guidelines set out herein
provide guidance for the identification of optimal target sequences
for any given gene target, but an empirical approach can also be
taken in which a "window" or "mask" of a given size (as a
non-limiting example, 21 nucleotides) is literally or figuratively
(including, e.g., in silico) placed on the target RNA sequence to
identify sequences in the size range that can serve as target
sequences. By moving the sequence "window" progressively one
nucleotide upstream or downstream of an initial target sequence
location, the next potential target sequence can be identified,
until the complete set of possible sequences is identified for any
given target size selected. This process, coupled with systematic
synthesis and testing of the identified sequences (using assays as
described herein or as known in the art) to identify those
sequences that perform optimally can identify those RNA sequences
that, when targeted with an iRNA agent, mediate the best inhibition
of target gene expression. Thus, while the sequences identified
herein represent effective target sequences, it is contemplated
that further optimization of inhibition efficiency can be achieved
by progressively "walking the window" one nucleotide upstream or
downstream of the given sequences to identify sequences with equal
or better inhibition characteristics.
[0158] Further, it is contemplated that for any sequence identified
herein, further optimization could be achieved by systematically
either adding or removing nucleotides to generate longer or shorter
sequences and testing those sequences generated by walking a window
of the longer or shorter size up or down the target RNA from that
point. Again, coupling this approach to generating new candidate
targets with testing for effectiveness of iRNAs based on those
target sequences in an inhibition assay as known in the art and/or
as described herein can lead to further improvements in the
efficiency of inhibition. Further still, such optimized sequences
can be adjusted by, e.g., the introduction of modified nucleotides
as described herein or as known in the art, addition or changes in
overhang, or other modifications as known in the art and/or
discussed herein to further optimize the molecule (e.g., increasing
serum stability or circulating half-life, increasing thermal
stability, enhancing transmembrane delivery, targeting to a
particular location or cell type, increasing interaction with
silencing pathway enzymes, increasing release from endosomes) as an
expression inhibitor.
[0159] An iRNA agent as described herein can contain one or more
mismatches to the target sequence. In one embodiment, an iRNA as
described herein contains no more than 3 mismatches. If the
antisense strand of the iRNA contains mismatches to a target
sequence, it is preferable that the area of mismatch is not located
in the center of the region of complementarity. If the antisense
strand of the iRNA contains mismatches to the target sequence, it
is preferable that the mismatch be restricted to be within the last
5 nucleotides from either the 5'- or 3'-end of the region of
complementarity. The methods described herein or methods known in
the art can be used to determine whether an iRNA containing a
mismatch to a target sequence is effective in inhibiting the
expression of an Hdlbp/Vigilin gene. Consideration of the efficacy
of iRNAs with mismatches in inhibiting expression of an
Hdlbp/Vigilin gene is important, especially if the particular
region of complementarity in an Hdlbp/Vigilin gene is known to have
polymorphic sequence variation within the population.
III. Modified iRNAs of the Invention
[0160] In one embodiment, the RNA of the iRNA of the invention
e.g., a dsRNA, is un-modified, and does not comprise, e.g.,
chemical modifications and/or conjugations known in the art and
described herein. In another embodiment, the RNA of an iRNA of the
invention, e.g., a dsRNA, is chemically modified to enhance
stability or other beneficial characteristics. In certain
embodiments of the invention, substantially all of the nucleotides
of an iRNA of the invention are modified. In other embodiments of
the invention, all of the nucleotides of an iRNA of the invention
are modified. iRNAs of the invention in which "substantially all of
the nucleotides are modified" are largely but not wholly modified
and can include not more than 5, 4, 3, 2, or 1 unmodified
nucleotides.
[0161] The nucleic acids featured in the invention can be
synthesized and/or modified by methods well established in the art,
such as those described in "Current protocols in nucleic acid
chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons,
Inc., New York, N.Y., USA, which is hereby incorporated herein by
reference. Modifications include, for example, end modifications,
e.g., 5'-end modifications (phosphorylation, conjugation, inverted
linkages) or 3'-end modifications (conjugation, DNA nucleotides,
inverted linkages, etc.); base modifications, e.g., replacement
with stabilizing bases, destabilizing bases, or bases that base
pair with an expanded repertoire of partners, removal of bases
(abasic nucleotides), or conjugated bases; sugar modifications
(e.g., at the 2'-position or 4'-position) or replacement of the
sugar; and/or backbone modifications, including modification or
replacement of the phosphodiester linkages. Specific examples of
iRNA compounds useful in the embodiments described herein include,
but are not limited to RNAs containing modified backbones or no
natural internucleoside linkages. RNAs having modified backbones
include, among others, those that do not have a phosphorus atom in
the backbone. For the purposes of this specification, and as
sometimes referenced in the art, modified RNAs that do not have a
phosphorus atom in their internucleoside backbone can also be
considered to be oligonucleosides. In some embodiments, a modified
iRNA will have a phosphorus atom in its internucleoside
backbone.
[0162] Modified RNA backbones include, for example,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates and chiral
phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates having normal
3'-5' linkages, 2'-5'-linked analogs of these, and those having
inverted polarity wherein the adjacent pairs of nucleoside units
are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed
salts and free acid forms are also included.
[0163] Representative U.S. patents that teach the preparation of
the above phosphorus-containing linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445;
6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199;
6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167;
6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933;
7,321,029; and RE39464, the entire contents of each of which are
hereby incorporated herein by reference.
[0164] Modified RNA backbones that do not include a phosphorus atom
therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts.
[0165] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and, 5,677,439, the entire contents of each of which are
hereby incorporated herein by reference.
[0166] In other embodiments, suitable RNA mimetics are contemplated
for use in iRNAs, in which both the sugar and the internucleoside
linkage, i.e., the backbone, of the nucleotide units are replaced
with novel groups. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an RNA mimetic that has been shown to have
excellent hybridization properties, is referred to as a peptide
nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA
is replaced with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative U.S. patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents
of each of which are hereby incorporated herein by reference.
Additional PNA compounds suitable for use in the iRNAs of the
invention are described in, for example, in Nielsen et al.,
Science, 1991, 254, 1497-1500.
[0167] Some embodiments featured in the invention include RNAs with
phosphorothioate backbones and oligonucleosides with heteroatom
backbones, and in particular --CH.sub.2--NH--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above-referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above-referenced U.S. Pat. No. 5,602,240. In some
embodiments, the RNAs featured herein have morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0168] Modified RNAs can also contain one or more substituted sugar
moieties. The iRNAs, e.g., dsRNAs, featured herein can include one
of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-,
S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein
the alkyl, alkenyl and alkynyl can be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Exemplary suitable modifications include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. In other embodiments, dsRNAs include one of
the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl,
substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl,
SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an iRNA, or a group for improving the
pharmacodynamic properties of an iRNA, and other substituents
having similar properties. In some embodiments, the modification
includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another
exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples herein below, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2. Further exemplary
modifications include: 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe
nucleotides, 5'-Me-2'-deoxynucleotides, (both R and S isomers in
these three families); 2'-alkoxyalkyl; and 2'-NMA
(N-methylacetamide).
[0169] Other modifications include 2'-methoxy (2'-OCH.sub.3),
2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH2) and 2'-fluoro
(2'-F). Similar modifications can also be made at other positions
on the RNA of an iRNA, particularly the 3' position of the sugar on
the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5'
position of 5' terminal nucleotide. iRNAs can also have sugar
mimetics such as cyclobutyl moieties in place of the pentofuranosyl
sugar. Representative U.S. patents that teach the preparation of
such modified sugar structures include, but are not limited to,
U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which
are commonly owned with the instant application. The entire
contents of each of the foregoing are hereby incorporated herein by
reference.
[0170] An iRNA of the invention can also include nucleobase (often
referred to in the art simply as "base") modifications or
substitutions. As used herein, "unmodified" or "natural"
nucleobases include the purine bases adenine (A) and guanine (G),
and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
Modified nucleobases include other synthetic and natural
nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine,
5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and
guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in Modified Nucleosides in Biochemistry,
Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008;
those disclosed in The Concise Encyclopedia Of Polymer Science And
Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley &
Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte
Chemie, International Edition, 30:613, and those disclosed by
Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages
289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
Certain of these nucleobases are particularly useful for increasing
the binding affinity of the oligomeric compounds featured in the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and 0-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research
and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are
exemplary base substitutions, even more particularly when combined
with 2'-O-methoxyethyl sugar modifications.
[0171] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066;
5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908;
5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091;
5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197;
6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438;
7,045,610; 7,427,672; and 7,495,088, the entire contents of each of
which are hereby incorporated herein by reference.
[0172] An iRNA of the invention can also be modified to include one
or more locked nucleic acids (LNA). A locked nucleic acid is a
nucleotide having a modified ribose moiety in which the ribose
moiety comprises an extra bridge connecting the 2' and 4' carbons.
This structure effectively "locks" the ribose in the 3'-endo
structural conformation. The addition of locked nucleic acids to
siRNAs has been shown to increase siRNA stability in serum, and to
reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids
Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther
6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research
31(12):3185-3193). In some embodiments, the iRNA of the invention
comprises one or more monomers that are UNA (unlocked nucleic acid)
nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of
the bonds of the sugar has been removed, forming an unlocked
"sugar" residue. In one example, UNA also encompasses monomer with
bonds between C1'-C4' have been removed (i.e. the covalent
carbon-oxygen-carbon bond between the C1' and C4' carbons). In
another example, the C2'-C3' bond (i.e. the covalent carbon-carbon
bond between the C2' and C3' carbons) of the sugar has been removed
(see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et
al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by
reference).
[0173] Representative US publications that teach the preparation of
UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and
US Patent Publication Nos. 2013/0096289; 2013/0011922; and
2011/0313020, the entire contents of each of which are hereby
incorporated herein by reference.
[0174] An iRNA of the invention can also be modified to include one
or more bicyclic sugar moities. A "bicyclic sugar" is a furanosyl
ring modified by the bridging of two atoms. A "bicyclic nucleoside"
("BNA") is a nucleoside having a sugar moiety comprising a bridge
connecting two carbon atoms of the sugar ring, thereby forming a
bicyclic ring system. In certain embodiments, the bridge connects
the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some
embodiments an agent of the invention may include one or more
locked nucleic acids (LNA). A locked nucleic acid is a nucleotide
having a modified ribose moiety in which the ribose moiety
comprises an extra bridge connecting the 2' and 4' carbons. In
other words, an LNA is a nucleotide comprising a bicyclic sugar
moiety comprising a 4'-CH2-O-2' bridge. This structure effectively
"locks" the ribose in the 3'-endo structural conformation. The
addition of locked nucleic acids to siRNAs has been shown to
increase siRNA stability in serum, and to reduce off-target effects
(Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447;
Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller,
A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
Examples of bicyclic nucleosides for use in the polynucleotides of
the invention include without limitation nucleosides comprising a
bridge between the 4' and the 2' ribosyl ring atoms. In certain
embodiments, the antisense polynucleotide agents of the invention
include one or more bicyclic nucleosides comprising a 4' to 2'
bridge. Examples of such 4' to 2' bridged bicyclic nucleosides,
include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2';
4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as
"constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs
thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2'
(and analogs thereof; see e.g., U.S. Pat. No. 8,278,283);
4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U.S. Pat. No.
8,278,425); 4'-CH2-O--N(CH3)-2' (see, e.g., U.S. Patent Publication
No. 2004/0171570); 4'-CH2-N(R)--O-2', wherein R is H, C1-C12 alkyl,
or a protecting group (see, e.g., U.S. Pat. No. 7,427,672);
4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org.
Chem., 2009, 74, 118-134); and 4'-CH2-C(.dbd.CH2)-2' (and analogs
thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents
of each of the foregoing are hereby incorporated herein by
reference.
[0175] Additional representative U.S. patents and US patent
Publications that teach the preparation of locked nucleic acid
nucleotides include, but are not limited to, the following: U.S.
Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499;
6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672;
7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426;
8,278,283; US 2008/0039618; and US 2009/0012281, the entire
contents of each of which are hereby incorporated herein by
reference.
[0176] Any of the foregoing bicyclic nucleosides can be prepared
having one or more stereochemical sugar configurations including
for example .alpha.-L-ribofuranose and f3-D-ribofuranose (see WO
99/14226).
[0177] An iRNA of the invention can also be modified to include one
or more constrained ethyl nucleotides. As used herein, a
"constrained ethyl nucleotide" or "cEt" is a locked nucleic acid
comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2'
bridge. In one embodiment, a constrained ethyl nucleotide is in the
S conformation referred to herein as "S-cEt."
[0178] An iRNA of the invention may also include one or more
"conformationally restricted nucleotides" ("CRN"). CRN are
nucleotide analogs with a linker connecting the C2' and C4' carbons
of ribose or the C3 and --C5' carbons of ribose. CRN lock the
ribose ring into a stable conformation and increase the
hybridization affinity to mRNA. The linker is of sufficient length
to place the oxygen in an optimal position for stability and
affinity resulting in less ribose ring puckering.
[0179] Representative publications that teach the preparation of
certain of the above noted CRN include, but are not limited to, US
Patent Publication No. 2013/0190383; and PCT publication WO
2013/036868, the entire contents of each of which are hereby
incorporated herein by reference.
[0180] Potentially stabilizing modifications to the ends of RNA
molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol
(Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6),
N-(acetyl-4-hydroxyprolinol (Hyp-NHAc),
thymidine-2'-O-deoxythymidine (ether),
N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino),
2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and
others. Disclosure of this modification can be found in PCT
Publication No. WO 2011/005861.
[0181] Other modifications of an iRNA of the invention include a 5'
phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or
phosphate mimic on the antisense strand of an RNAi agent. Suitable
phosphate mimics are disclosed in, for example US Patent
Publication No. 2012/0157511, the entire contents of which are
incorporated herein by reference.
[0182] In certain specific embodiments, the RNAi agent for use in
the methods of the invention is an agent selected from the group of
agents listed in Table 2. These agents may further comprise a
ligand.
IV. iRNAs Conjugated to Ligands
[0183] In one embodiment, the iRNA of the invention involves
chemically linking to one or more ligands, moieties or conjugates
that enhance the activity, cellular distribution or cellular uptake
of the iRNA. Such moieties include but are not limited to lipid
moieties such as a cholesterol moiety (Letsinger et al., (1989)
Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan
et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether,
e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad.
Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let.,
3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl.
Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., (1991) EMBO J,
10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330;
Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al.,
(1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl.
Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., (1995) Nucleosides & Nucleotides,
14:969-973), or adamantane acetic acid (Manoharan et al., (1995)
Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al.,
(1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine
or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996)
J. Pharmacol. Exp. Ther., 277:923-937).
[0184] In one embodiment, a ligand alters the distribution,
targeting or lifetime of an iRNA agent into which it is
incorporated. In some embodiments a ligand provides an enhanced
affinity for a selected target, e.g., molecule, cell or cell type,
compartment, e.g., a cellular or organ compartment, tissue, organ
or region of the body, as, e.g., compared to a species absent such
a ligand. Preferred ligands will not take part in duplex pairing in
a duplexed nucleic acid.
[0185] Ligands can include a naturally occurring substance, such as
a protein (e.g., human serum albumin (HSA), low-density lipoprotein
(LDL), or globulin); carbohydrate (e.g., a dextran, pullulan,
chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine,
N-acetylgalactosamine or hyaluronic acid); or a lipid. The ligand
can also be a recombinant or synthetic molecule, such as a
synthetic polymer, e.g., a synthetic polyamino acid. Examples of
polyamino acids include polyamino acid is a polylysine (PLL), poly
L-aspartic acid, poly L-glutamic acid, styrene-maleic acid
anhydride copolymer, poly(L-lactide-co-glycolied) copolymer,
divinyl ether-maleic anhydride copolymer,
N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene
glycol (PEG), polyvinyl alcohol (PVA), polyurethane,
poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or
polyphosphazine. Example of polyamines include: polyethylenimine,
polylysine (PLL), spermine, spermidine, polyamine,
pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer
polyamine, arginine, amidine, protamine, cationic lipid, cationic
porphyrin, quaternary salt of a polyamine, or an alpha helical
peptide.
[0186] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type
such as a kidney cell. A targeting group can be a thyrotropin,
melanotropin, lectin, glycoprotein, surfactant protein A, Mucin
carbohydrate, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose,
multivalent fucose, glycosylated polyaminoacids, multivalent
galactose, transferrin, bisphosphonate, polyglutamate,
polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate,
vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide
mimetic.
[0187] Other examples of ligands include dyes, intercalating agents
(e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C),
porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic
hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol,
cholic acid, adamantane acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl
group, hexadecylglycerol, borneol, menthol, 1,3-propanediol,
heptadecyl group, palmitic acid, myristic acid,
O3-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g.,
antennapedia peptide, Tat peptide), alkylating agents, phosphate,
amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino,
alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens
(e.g. biotin), transport/absorption facilitators (e.g., aspirin,
vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole,
bisimidazole, histamine, imidazole clusters, acridine-imidazole
conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl,
HRP, or AP.
[0188] Ligands can be proteins, e.g., glycoproteins, or peptides,
e.g., molecules having a specific affinity for a co-ligand, or
antibodies e.g., an antibody, that binds to a specified cell type
such as a hepatic cell. Ligands can also include hormones and
hormone receptors. They can also include non-peptidic species, such
as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent
lactose, multivalent galactose, N-acetyl-galactosamine,
N-acetyl-gulucosamine multivalent mannose, or multivalent
fucose.
[0189] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the iRNA agent into the cell, for example,
by disrupting the cell's cytoskeleton, e.g., by disrupting the
cell's microtubules, microfilaments, and/or intermediate filaments.
The drug can be, for example, taxon, vincristine, vinblastine,
cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin,
swinholide A, indanocine, or myoservin.
[0190] In some embodiments, a ligand attached to an iRNA as
described herein acts as a pharmacokinetic modulator (PK
modulator). PK modulators include lipophiles, bile acids, steroids,
phospholipid analogues, peptides, protein binding agents, PEG,
vitamins etc. Exemplary PK modulators include, but are not limited
to, cholesterol, fatty acids, cholic acid, lithocholic acid,
dialkylglycerides, diacylglyceride, phospholipids, sphingolipids,
naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that
comprise a number of phosphorothioate linkages are also known to
bind to serum protein, thus short oligonucleotides, e.g.,
oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases,
comprising multiple of phosphorothioate linkages in the backbone
are also amenable to the present invention as ligands (e.g. as PK
modulating ligands). In addition, aptamers that bind serum
components (e.g. serum proteins) are also suitable for use as PK
modulating ligands in the embodiments described herein.
[0191] Ligand-conjugated oligonucleotides of the invention may be
synthesized by the use of an oligonucleotide that bears a pendant
reactive functionality, such as that derived from the attachment of
a linking molecule onto the oligonucleotide (described below). This
reactive oligonucleotide may be reacted directly with
commercially-available ligands, ligands that are synthesized
bearing any of a variety of protecting groups, or ligands that have
a linking moiety attached thereto.
[0192] The oligonucleotides used in the conjugates of the present
invention may be conveniently and routinely made through the
well-known technique of solid-phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is also known to use similar techniques to prepare
other oligonucleotides, such as the phosphorothioates and alkylated
derivatives.
[0193] In the ligand-conjugated oligonucleotides and
ligand-molecule bearing sequence-specific linked nucleosides of the
present invention, the oligonucleotides and oligonucleosides may be
assembled on a suitable DNA synthesizer utilizing standard
nucleotide or nucleoside precursors, or nucleotide or nucleoside
conjugate precursors that already bear the linking moiety,
ligand-nucleotide or nucleoside-conjugate precursors that already
bear the ligand molecule, or non-nucleoside ligand-bearing building
blocks.
[0194] When using nucleotide-conjugate precursors that already bear
a linking moiety, the synthesis of the sequence-specific linked
nucleosides is typically completed, and the ligand molecule is then
reacted with the linking moiety to form the ligand-conjugated
oligonucleotide. In some embodiments, the oligonucleotides or
linked nucleosides of the present invention are synthesized by an
automated synthesizer using phosphoramidites derived from
ligand-nucleoside conjugates in addition to the standard
phosphoramidites and non-standard phosphoramidites that are
commercially available and routinely used in oligonucleotide
synthesis.
[0195] A. Lipid Conjugates
[0196] In one embodiment, the ligand or conjugate is a lipid or
lipid-based molecule. Such a lipid or lipid-based molecule
preferably binds a serum protein, e.g., human serum albumin (HSA).
An HSA binding ligand allows for distribution of the conjugate to a
target tissue, e.g., a non-kidney target tissue of the body. For
example, the target tissue can be the liver, including parenchymal
cells of the liver. Other molecules that can bind HSA can also be
used as ligands. For example, neproxin or aspirin can be used. A
lipid or lipid-based ligand can (a) increase resistance to
degradation of the conjugate, (b) increase targeting or transport
into a target cell or cell membrane, and/or (c) can be used to
adjust binding to a serum protein, e.g., HSA.
[0197] A lipid based ligand can be used to inhibit, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0198] In certain embodiments, the lipid based ligand binds HSA.
Preferably, it binds HSA with a sufficient affinity such that the
conjugate will be preferably distributed to a non-kidney tissue.
However, it is preferred that the affinity not be so strong that
the HSA-ligand binding cannot be reversed.
[0199] In another embodiment, the lipid based ligand binds HSA
weakly or not at all, such that the conjugate will be preferably
distributed to the kidney. Other moieties that target to kidney
cells can also be used in place of or in addition to the lipid
based ligand.
[0200] In another aspect, the ligand is a moiety, e.g., a vitamin,
which is taken up by a target cell, e.g., a proliferating cell.
These are particularly useful for treating disorders characterized
by unwanted cell proliferation, e.g., of the malignant or
non-malignant type, e.g., cancer cells. Exemplary vitamins include
vitamin A, E, and K. Other exemplary vitamins include are B
vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or
other vitamins or nutrients taken up by target cells such as liver
cells. Also included are HSA and low density lipoprotein (LDL).
[0201] B. Cell Permeation Agents
[0202] In another aspect, the ligand is a cell-permeation agent,
preferably a helical cell-permeation agent. Preferably, the agent
is amphipathic. An exemplary agent is a peptide such as tat or
antennopedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0203] The ligand can be a peptide or peptidomimetic. A
peptidomimetic (also referred to herein as an oligopeptidomimetic)
is a molecule capable of folding into a defined three-dimensional
structure similar to a natural peptide. The attachment of peptide
and peptidomimetics to iRNA agents can affect pharmacokinetic
distribution of the iRNA, such as by enhancing cellular recognition
and absorption. The peptide or peptidomimetic moiety can be about
5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40,
45, or 50 amino acids long.
[0204] A peptide or peptidomimetic can be, for example, a cell
permeation peptide, cationic peptide, amphipathic peptide, or
hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or
Phe). The peptide moiety can be a dendrimer peptide, constrained
peptide or crosslinked peptide. In another alternative, the peptide
moiety can include a hydrophobic membrane translocation sequence
(MTS). An exemplary hydrophobic MTS-containing peptide is RFGF
having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 9). An
RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:
10) containing a hydrophobic MTS can also be a targeting moiety.
The peptide moiety can be a "delivery" peptide, which can carry
large polar molecules including peptides, oligonucleotides, and
protein across cell membranes. For example, sequences from the HIV
Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 19) and the Drosophila
Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 20) have been
found to be capable of functioning as delivery peptides. A peptide
or peptidomimetic can be encoded by a random sequence of DNA, such
as a peptide identified from a phage-display library, or
one-bead-one-compound (OBOC) combinatorial library (Lam et al.,
Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic
tethered to a dsRNA agent via an incorporated monomer unit for cell
targeting purposes is an arginine-glycine-aspartic acid
(RGD)-peptide, or RGD mimic. A peptide moiety can range in length
from about 5 amino acids to about 40 amino acids. The peptide
moieties can have a structural modification, such as to increase
stability or direct conformational properties. Any of the
structural modifications described below can be utilized.
[0205] An RGD peptide for use in the compositions and methods of
the invention may be linear or cyclic, and may be modified, e.g.,
glyciosylated or methylated, to facilitate targeting to a specific
tissue(s). RGD-containing peptides and peptidiomimemtics may
include D-amino acids, as well as synthetic RGD mimics. In addition
to RGD, one can use other moieties that target the integrin ligand.
Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0206] A "cell permeation peptide" is capable of permeating a cell,
e.g., a microbial cell, such as a bacterial or fungal cell, or a
mammalian cell, such as a human cell. A microbial cell-permeating
peptide can be, for example, a .alpha.-helical linear peptide
(e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide
(e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a
peptide containing only one or two dominating amino acids (e.g.,
PR-39 or indolicidin). A cell permeation peptide can also include a
nuclear localization signal (NLS). For example, a cell permeation
peptide can be a bipartite amphipathic peptide, such as MPG, which
is derived from the fusion peptide domain of HIV-1 gp41 and the NLS
of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.
31:2717-2724, 2003).
[0207] C. Carbohydrate Conjugates
[0208] In some embodiments of the compositions and methods of the
invention, an iRNA oligonucleotide further comprises a
carbohydrate. The carbohydrate conjugated iRNA are advantageous for
the in vivo delivery of nucleic acids, as well as compositions
suitable for in vivo therapeutic use, as described herein. As used
herein, "carbohydrate" refers to a compound which is either a
carbohydrate per se made up of one or more monosaccharide units
having at least 6 carbon atoms (which can be linear, branched or
cyclic) with an oxygen, nitrogen or sulfur atom bonded to each
carbon atom; or a compound having as a part thereof a carbohydrate
moiety made up of one or more monosaccharide units each having at
least six carbon atoms (which can be linear, branched or cyclic),
with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
Representative carbohydrates include the sugars (mono-, di-, tri-
and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9
monosaccharide units), and polysaccharides such as starches,
glycogen, cellulose and polysaccharide gums. Specific
monosaccharides include C5 and above (e.g., C5, C6, C7, or C8)
sugars; di- and trisaccharides include sugars having two or three
monosaccharide units (e.g., C5, C6, C7, or C8).
[0209] In one embodiment, a carbohydrate conjugate for use in the
compositions and methods of the invention is a monosaccharide. In
one embodiment, the monosaccharide is an N-acetylgalactosamine,
such as
##STR00005##
[0210] In another embodiment, a carbohydrate conjugate for use in
the compositions and methods of the invention is selected from the
group consisting of:
##STR00006## ##STR00007## ##STR00008## ##STR00009##
[0211] Another representative carbohydrate conjugate for use in the
embodiments described herein includes, but is not limited to,
##STR00010##
when one of X or Y is an oligonucleotide, the other is a
hydrogen.
[0212] In certain embodiments of the invention, the GalNAc or
GalNAc derivative is attached to an iRNA agent of the invention via
a monovalent linker. In some embodiments, the GalNAc or GalNAc
derivative is attached to an iRNA agent of the invention via a
bivalent linker. In yet other embodiments of the invention, the
GalNAc or GalNAc derivative is attached to an iRNA agent of the
invention via a trivalent linker.
[0213] In one embodiment, the double stranded RNAi agents of the
invention comprise one GalNAc or GalNAc derivative attached to the
iRNA agent. In another embodiment, the double stranded RNAi agents
of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6)
GalNAc or GalNAc derivatives, each independently attached to a
plurality of nucleotides of the double stranded RNAi agent through
a plurality of monovalent linkers.
[0214] In some embodiments, for example, when the two strands of an
iRNA agent of the invention are part of one larger molecule
connected by an uninterrupted chain of nucleotides between the
3'-end of one strand and the 5'-end of the respective other strand
forming a hairpin loop comprising, a plurality of unpaired
nucleotides, each unpaired nucleotide within the hairpin loop may
independently comprise a GalNAc or GalNAc derivative attached via a
monovalent linker.
[0215] In some embodiments, the carbohydrate conjugate further
comprises one or more additional ligands as described above, such
as, but not limited to, a PK modulator and/or a cell permeation
peptide.
[0216] Additional carbohydrate conjugates (and linkers) suitable
for use in the present invention include those described in PCT
Publication Nos. WO 2014/179620 and WO 2014/179627, the entire
contents of each of which are incorporated herein by reference.
[0217] D. Linkers
[0218] In some embodiments, the conjugate or ligand described
herein can be attached to an iRNA oligonucleotide with various
linkers that can be cleavable or non cleavable.
[0219] The term "linker" or "linking group" means an organic moiety
that connects two parts of a compound, e.g., covalently attaches
two parts of a compound. Linkers typically comprise a direct bond
or an atom such as oxygen or sulfur, a unit such as NR8, C(O),
C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but
not limited to, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl,
heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl,
heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl,
heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl,
alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl,
alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl,
alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl,
alkylheteroarylalkenyl, alkylheteroarylalkynyl,
alkenylheteroarylalkyl, alkenylheteroarylalkenyl,
alkenylheteroarylalkynyl, alkynylheteroarylalkyl,
alkynylheteroarylalkenyl, alkynylheteroarylalkynyl,
alkylheterocyclylalkyl, alkylheterocyclylalkenyl,
alkylhererocyclylalkynyl, alkenylheterocyclylalkyl,
alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl,
alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl,
alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl,
alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or
more methylenes can be interrupted or terminated by O, S, S(O),
SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, substituted or
unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic
or substituted aliphatic. In one embodiment, the linker is between
about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18
atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.
[0220] A cleavable linking group is one which is sufficiently
stable outside the cell, but which upon entry into a target cell is
cleaved to release the two parts the linker is holding together. In
some embodiments, the cleavable linking group is cleaved at least
about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times,
70 times, 80 times, 90 times or more, or at least about 100 times
faster in a target cell or under a first reference condition (which
can, e.g., be selected to mimic or represent intracellular
conditions) than in the blood of a subject, or under a second
reference condition (which can, e.g., be selected to mimic or
represent conditions found in the blood or serum).
[0221] Cleavable linking groups are susceptible to cleavage agents,
e.g., pH, redox potential or the presence of degradative molecules.
Generally, cleavage agents are more prevalent or found at higher
levels or activities inside cells than in serum or blood. Examples
of such degradative agents include: redox agents which are selected
for particular substrates or which have no substrate specificity,
including, e.g., oxidative or reductive enzymes or reductive agents
such as mercaptans, present in cells, that can degrade a redox
cleavable linking group by reduction; esterases; endosomes or
agents that can create an acidic environment, e.g., those that
result in a pH of five or lower; enzymes that can hydrolyze or
degrade an acid cleavable linking group by acting as a general
acid, peptidases (which can be substrate specific), and
phosphatases.
[0222] A cleavable linkage group, such as a disulfide bond can be
susceptible to pH. The pH of human serum is 7.4, while the average
intracellular pH is slightly lower, ranging from about 7.1-7.3.
Endosomes have a more acidic pH, in the range of 5.5-6.0, and
lysosomes have an even more acidic pH at around 5.0. Some linkers
will have a cleavable linking group that is cleaved at a preferred
pH, thereby releasing a cationic lipid from the ligand inside the
cell, or into the desired compartment of the cell.
[0223] A linker can include a cleavable linking group that is
cleavable by a particular enzyme. The type of cleavable linking
group incorporated into a linker can depend on the cell to be
targeted. For example, a liver-targeting ligand can be linked to a
cationic lipid through a linker that includes an ester group. Liver
cells are rich in esterases, and therefore the linker will be
cleaved more efficiently in liver cells than in cell types that are
not esterase-rich. Other cell-types rich in esterases include cells
of the lung, renal cortex, and testis.
[0224] Linkers that contain peptide bonds can be used when
targeting cell types rich in peptidases, such as liver cells and
synoviocytes.
[0225] In general, the suitability of a candidate cleavable linking
group can be evaluated by testing the ability of a degradative
agent (or condition) to cleave the candidate linking group. It will
also be desirable to also test the candidate cleavable linking
group for the ability to resist cleavage in the blood or when in
contact with other non-target tissue. Thus, one can determine the
relative susceptibility to cleavage between a first and a second
condition, where the first is selected to be indicative of cleavage
in a target cell and the second is selected to be indicative of
cleavage in other tissues or biological fluids, e.g., blood or
serum. The evaluations can be carried out in cell free systems, in
cells, in cell culture, in organ or tissue culture, or in whole
animals. It can be useful to make initial evaluations in cell-free
or culture conditions and to confirm by further evaluations in
whole animals. In certain embodiments, useful candidate compounds
are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80,
90, or about 100 times faster in the cell (or under in vitro
conditions selected to mimic intracellular conditions) as compared
to blood or serum (or under in vitro conditions selected to mimic
extracellular conditions).
IV. Delivery of an iRNA of the Invention
[0226] The delivery of an iRNA of the invention to a cell e.g., a
cell within a subject, such as a human subject (e.g., a subject in
need thereof, such as a subject having a disorder of lipid
metabolism) can be achieved in a number of different ways. For
example, delivery may be performed by contacting a cell with an
iRNA of the invention either in vitro or in vivo. In vivo delivery
may also be performed directly by administering a composition
comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in
vivo delivery may be performed indirectly by administering one or
more vectors that encode and direct the expression of the iRNA.
These alternatives are discussed further below.
[0227] In general, any method of delivering a nucleic acid molecule
(in vitro or in vivo) can be adapted for use with an iRNA of the
invention (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell.
Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by
reference in their entireties). For in vivo delivery, factors to
consider in order to deliver an iRNA molecule include, for example,
biological stability of the delivered molecule, prevention of
non-specific effects, and accumulation of the delivered molecule in
the target tissue. The non-specific effects of an iRNA can be
minimized by local administration, for example, by direct injection
or implantation into a tissue or topically administering the
preparation. Local administration to a treatment site maximizes
local concentration of the agent, limits the exposure of the agent
to systemic tissues that can otherwise be harmed by the agent or
that can degrade the agent, and permits a lower total dose of the
iRNA molecule to be administered. Several studies have shown
successful knockdown of gene products when an iRNA is administered
locally. For example, intraocular delivery of a VEGF dsRNA by
intravitreal injection in cynomolgus monkeys (Tolentino, M J. et
al., (2004) Retina 24:132-138) and subretinal injections in mice
(Reich, S J. et al. (2003) Mol. Vis. 9:210-216) were both shown to
prevent neovascularization in an experimental model of age-related
macular degeneration. In addition, direct intratumoral injection of
a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol.
Ther. 11:267-274) and can prolong survival of tumor-bearing mice
(Kim, W J. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al.,
(2007) Mol. Ther. 15:515-523). RNA interference has also shown
success with local delivery to the CNS by direct injection (Dorn,
G. et al., (2004) Nucleic Acids 32:e49; Tan, P H. et al. (2005)
Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18;
Shishkina, G T., et al. (2004) Neuroscience 129:521-528; Thakker, E
R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275;
Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the
lungs by intranasal administration (Howard, K A. et al., (2006)
Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem.
279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55). For
administering an iRNA systemically for the treatment of a disease,
the RNA can be modified or alternatively delivered using a drug
delivery system; both methods act to prevent the rapid degradation
of the dsRNA by endo- and exo-nucleases in vivo. Modification of
the RNA or the pharmaceutical carrier can also permit targeting of
the iRNA composition to the target tissue and avoid undesirable
off-target effects. iRNA molecules can be modified by chemical
conjugation to lipophilic groups such as cholesterol to enhance
cellular uptake and prevent degradation. For example, an iRNA
directed against ApoB conjugated to a lipophilic cholesterol moiety
was injected systemically into mice and resulted in knockdown of
apoB mRNA in both the liver and jejunum (Soutschek, J. et al.,
(2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer
has been shown to inhibit tumor growth and mediate tumor regression
in a mouse model of prostate cancer (McNamara, J O. et al., (2006)
Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the
iRNA can be delivered using drug delivery systems such as a
nanoparticle, a dendrimer, a polymer, liposomes, or a cationic
delivery system. Positively charged cationic delivery systems
facilitate binding of an iRNA molecule (negatively charged) and
also enhance interactions at the negatively charged cell membrane
to permit efficient uptake of an iRNA by the cell. Cationic lipids,
dendrimers, or polymers can either be bound to an iRNA, or induced
to form a vesicle or micelle (see e.g., Kim S H. et al., (2008)
Journal of Controlled Release 129(2):107-116) that encases an iRNA.
The formation of vesicles or micelles further prevents degradation
of the iRNA when administered systemically. Methods for making and
administering cationic-iRNA complexes are well within the abilities
of one skilled in the art (see e.g., Sorensen, D R., et al. (2003)
J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer
Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens.
25:197-205, which are incorporated herein by reference in their
entirety). Some non-limiting examples of drug delivery systems
useful for systemic delivery of iRNAs include DOTAP (Sorensen, D
R., et al (2003), supra; Verma, U N. et al., (2003), supra),
Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T
S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et
al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005)
Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al.,
(2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006)
J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S.
(2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A.
et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al.,
(1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA
forms a complex with cyclodextrin for systemic administration.
Methods for administration and pharmaceutical compositions of iRNAs
and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is
herein incorporated by reference in its entirety.
[0228] A. Vector encoded iRNAs of the Invention
[0229] iRNA targeting the Hdlbp/Vigilin gene can be expressed from
transcription units inserted into DNA or RNA vectors (see, e.g.,
Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al.,
International PCT Publication No. WO 00/22113, Conrad,
International PCT Publication No. WO 00/22114, and Conrad, U.S.
Pat. No. 6,054,299). Expression can be transient (on the order of
hours to weeks) or sustained (weeks to months or longer), depending
upon the specific construct used and the target tissue or cell
type. These transgenes can be introduced as a linear construct, a
circular plasmid, or a viral vector, which can be an integrating or
non-integrating vector. The transgene can also be constructed to
permit it to be inherited as an extrachromosomal plasmid (Gassmann,
et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).
[0230] The individual strand or strands of an iRNA can be
transcribed from a promoter on an expression vector. Where two
separate strands are to be expressed to generate, for example, a
dsRNA, two separate expression vectors can be co-introduced (e.g.,
by transfection or infection) into a target cell. Alternatively
each individual strand of a dsRNA can be transcribed by promoters
both of which are located on the same expression plasmid. In one
embodiment, a dsRNA is expressed as inverted repeat polynucleotides
joined by a linker polynucleotide sequence such that the dsRNA has
a stem and loop structure.
[0231] iRNA expression vectors are generally DNA plasmids or viral
vectors. Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells, can be used to
produce recombinant constructs for the expression of an iRNA as
described herein. Eukaryotic cell expression vectors are well known
in the art and are available from a number of commercial sources.
Typically, such vectors are provided containing convenient
restriction sites for insertion of the desired nucleic acid
segment. Delivery of iRNA expressing vectors can be systemic, such
as by intravenous or intramuscular administration, by
administration to target cells ex-planted from the patient followed
by reintroduction into the patient, or by any other means that
allows for introduction into a desired target cell.
[0232] Viral vector systems which can be utilized with the methods
and compositions described herein include, but are not limited to,
(a) adenovirus vectors; (b) retrovirus vectors, including but not
limited to lentiviral vectors, moloney murine leukemia virus, etc.;
(c) adeno-associated virus vectors; (d) herpes simplex virus
vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g)
papilloma virus vectors; (h) picornavirus vectors; (i) pox virus
vectors such as an orthopox, e.g., vaccinia virus vectors or
avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or
gutless adenovirus. Replication-defective viruses can also be
advantageous. Different vectors will or will not become
incorporated into the cells' genome. The constructs can include
viral sequences for transfection, if desired. Alternatively, the
construct can be incorporated into vectors capable of episomal
replication, e.g. EPV and EBV vectors. Constructs for the
recombinant expression of an iRNA will generally require regulatory
elements, e.g., promoters, enhancers, etc., to ensure the
expression of the iRNA in target cells. Other aspects to consider
for vectors and constructs are known in the art.
V. Pharmaceutical Compositions of the Invention
[0233] The present invention also includes pharmaceutical
compositions and formulations which include the iRNAs of the
invention. In one embodiment, provided herein are pharmaceutical
compositions containing an iRNA, as described herein, and a
pharmaceutically acceptable carrier. The pharmaceutical
compositions containing the iRNA are useful for treating a disease
or disorder associated with the expression or activity of an
Hdlbp/Vigilin gene, e.g., a disorder of lipid metabolism, e.g.,
mixed hyperlipidemia, hypertriglyceridemia or
hypercholesterolemia.
[0234] Such pharmaceutical compositions are formulated based on the
mode of delivery. One example is compositions that are formulated
for systemic administration via parenteral delivery, e.g., by
intravenous (IV), intramuscular (IM), or for subcutaneous (subQ)
delivery. Another example is compositions that are formulated for
direct delivery into the liver, e.g., by infusion into the liver,
such as by continuous pump infusion.
[0235] The pharmaceutical compositions of the invention may be
administered in dosages sufficient to inhibit expression of an
Hdlbp/Vigilin gene. In general, a suitable dose of an iRNA of the
invention will be in the range of about 0.001 to about 200.0
milligrams per kilogram body weight of the recipient per day,
generally in the range of about 1 to 50 mg per kilogram body weight
per day. Typically, a suitable dose of an iRNA of the invention
will be in the range of about 0.1 mg/kg to about 5.0 mg/kg,
preferably about 0.3 mg/kg and about 3.0 mg/kg.
[0236] A repeat-dose regimine may include administration of a
therapeutic amount of iRNA on a regular basis, such as every other
day to once a year. In certain embodiments, the iRNA is
administered about once per month to about once per quarter (i.e.,
about once every three months).
[0237] After an initial treatment regimen, the treatments can be
administered on a less frequent basis.
[0238] The pharmaceutical composition can be administered once
daily, or the iRNA can be administered as two, three, or more
sub-doses at appropriate intervals throughout the day or even using
continuous infusion or delivery through a controlled release
formulation. In that case, the iRNA contained in each sub-dose must
be correspondingly smaller in order to achieve the total daily
dosage. The dosage unit can also be compounded for delivery over
several days, e.g., using a conventional sustained release
formulation which provides sustained release of the iRNA over a
several day period. Sustained release formulations are well known
in the art and are particularly useful for delivery of agents at a
particular site, such as could be used with the agents of the
present invention. In this embodiment, the dosage unit contains a
corresponding multiple of the daily dose.
[0239] In other embodiments, a single dose of the pharmaceutical
compositions can be long lasting, such that subsequent doses are
administered at not more than 3, 4, or 5 day intervals, or at not
more than 1, 2, 3, or 4 week intervals. In some embodiments of the
invention, a single dose of the pharmaceutical compositions of the
invention is administered once per week. In other embodiments of
the invention, a single dose of the pharmaceutical compositions of
the invention is administered bi-monthly.
[0240] The skilled artisan will appreciate that certain factors can
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the disease
or disorder, previous treatments, the general health and/or age of
the subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a composition
can include a single treatment or a series of treatments. Estimates
of effective dosages and in vivo half-lives for the individual
iRNAs encompassed by the invention can be made using conventional
methodologies or on the basis of in vivo testing using an
appropriate animal model, as described elsewhere herein.
[0241] Advances in mouse genetics have generated a number of mouse
models for the study of various human diseases, such as disorders
of lipid metabolism that would benefit from reduction in the
expression of Hdlbp/Vigilin. Such models can be used for in vivo
testing of iRNA, as well as for determining a therapeutically
effective dose. Suitable mouse models are known in the art and
include, for example, an obese (ob/ob) mouse containing a mutation
in the obese (ob) gene (Wiegman et al., (2003) Diabetes,
52:1081-1089); a mouse containing homozygous knock-out of an LDL
receptor (LDLR -/- mouse; Ishibashi et al., (1993) J Clin Invest
92(2):883-893); diet-induced artherosclerosis mouse model (Ishida
et al., (1991) J. Lipid. Res., 32:559-568); and heterozygous
lipoprotein lipase knockout mouse model (Weistock et al., (1995) J.
Clin. Invest. 96(6):2555-2568).
[0242] The pharmaceutical compositions of the present invention can
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration can be topical (e.g., by a transdermal patch),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal, oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; subdermal,
e.g., via an implanted device; or intracranial, e.g., by
intraparenchymal, intrathecal or intraventricular,
administration.
[0243] The iRNA can be delivered in a manner to target a particular
tissue, such as the liver (e.g., the hepatocytes of the liver).
[0244] Pharmaceutical compositions and formulations for topical
administration can include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like can be necessary or desirable.
Coated condoms, gloves and the like can also be useful. Suitable
topical formulations include those in which the iRNAs featured in
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Suitable lipids and liposomes
include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the
invention can be encapsulated within liposomes or can form
complexes thereto, in particular to cationic liposomes.
Alternatively, iRNAs can be complexed to lipids, in particular to
cationic lipids. Suitable fatty acids and esters include but are
not limited to arachidonic acid, oleic acid, eicosanoic acid,
lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S. Pat.
No. 6,747,014, which is incorporated herein by reference.
[0245] A. Lipid Particles
[0246] iRNAs, e.g., dsRNAs of in the invention may be fully
encapsulated in a lipid formulation, e.g., a LNP, or other nucleic
acid-lipid particle.
[0247] As used herein, the term "LNP" refers to a stable nucleic
acid-lipid particle. LNPs typically contain a cationic lipid, a
non-cationic lipid, and a lipid that prevents aggregation of the
particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful
for systemic applications, as they exhibit extended circulation
lifetimes following intravenous (i.v.) injection and accumulate at
distal sites (e.g., sites physically separated from the
administration site). LNPs include "pSPLP," which include an
encapsulated condensing agent-nucleic acid complex as set forth in
PCT Publication No. WO 00/03683. The particles of the present
invention typically have a mean diameter of about 50 nm to about
150 nm, more typically about 60 nm to about 130 nm, more typically
about 70 nm to about 110 nm, most typically about 70 nm to about 90
nm, and are substantially nontoxic. In addition, the nucleic acids
when present in the nucleic acid-lipid particles of the present
invention are resistant in aqueous solution to degradation with a
nuclease. Nucleic acid-lipid particles and their method of
preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567;
5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No.
2010/0324120 and PCT Publication No. WO 96/40964.
[0248] In one embodiment, the lipid to drug ratio (mass/mass ratio)
(e.g., lipid to dsRNA ratio) will be in the range of from about 1:1
to about 50:1, from about 1:1 to about 25:1, from about 3:1 to
about 15:1, from about 4:1 to about 10:1, from about 5:1 to about
9:1, or about 6:1 to about 9:1. Ranges intermediate to the above
recited ranges are also contemplated to be part of the
invention.
[0249] The cationic lipid can be, for example,
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),
1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),
1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP),
1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride
salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane
(DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP),
3-(N,N-Dioleylamino)-1,2-propanedio (DOAP),
1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane
(DLin-K-DMA) or analogs thereof,
(3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-
-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate (MC3),
1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-
no)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or
a mixture thereof. The cationic lipid can comprise from about 20
mol % to about 50 mol % or about 40 mol % of the total lipid
present in the particle.
[0250] In another embodiment, the compound
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to
prepare lipid-siRNA nanoparticles. Synthesis of
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in
U.S. provisional patent application No. 61/107,998 filed on Oct.
23, 2008, which is herein incorporated by reference.
[0251] In one embodiment, the lipid-siRNA particle includes 40%
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40%
Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of
63.0.+-.20 nm and a 0.027 siRNA/Lipid Ratio.
[0252] The ionizable/non-cationic lipid can be an anionic lipid or
a neutral lipid including, but not limited to,
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoylphosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or
a mixture thereof. The non-cationic lipid can be from about 5 mol %
to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol
is included, of the total lipid present in the particle.
[0253] The conjugated lipid that inhibits aggregation of particles
can be, for example, a polyethyleneglycol (PEG)-lipid including,
without limitation, a PEG-diacylglycerol (DAG), a
PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide
(Cer), or a mixture thereof. The PEG-DAA conjugate can be, for
example, a PEG-dilauryloxypropyl (Ci.sub.2), a
PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl
(Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated
lipid that prevents aggregation of particles can be from 0 mol % to
about 20 mol % or about 2 mol % of the total lipid present in the
particle.
[0254] In some embodiments, the nucleic acid-lipid particle further
includes cholesterol at, e.g., about 10 mol % to about 60 mol % or
about 48 mol % of the total lipid present in the particle.
[0255] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see
U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008,
which is incorporated herein by reference), Cholesterol
(Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be
used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles).
Stock solutions of each in ethanol can be prepared as follows:
ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100
mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions
can then be combined in a, e.g., 42:48:10 molar ratio. The combined
lipid solution can be mixed with aqueous dsRNA (e.g., in sodium
acetate pH 5) such that the final ethanol concentration is about
35-45% and the final sodium acetate concentration is about 100-300
mM. Lipid-dsRNA nanoparticles typically form spontaneously upon
mixing. Depending on the desired particle size distribution, the
resultant nanoparticle mixture can be extruded through a
polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a
thermobarrel extruder, such as Lipex Extruder (Northern Lipids,
Inc). In some cases, the extrusion step can be omitted. Ethanol
removal and simultaneous buffer exchange can be accomplished by,
for example, dialysis or tangential flow filtration. Buffer can be
exchanged with, for example, phosphate buffered saline (PBS) at
about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about
pH 7.2, about pH 7.3, or about pH 7.4.
##STR00011##
[0256] LNP01 formulations are described, e.g., in International
Application Publication No. WO 2008/042973, which is hereby
incorporated by reference.
[0257] Additional exemplary lipid-dsRNA formulations are described
in the table below.
TABLE-US-00001 cationic lipid/non-cationic
lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid
Lipid:siRNA ratio SNALP-1 1,2-Dilinolenyloxy-N,N-
DLinDMA/DPPC/Cholesterol/PEG- dimethylaminopropane cDMA (DLinDMA)
(57.1/7.1/34.4/1.4) lipid:siRNA ~7:1 2-XTC
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DPPC/Cholesterol/PEG-
[1,3]-dioxolane (XTC) cDMA 57.1/7.1/34.4/1.4 lipid:siRNA ~7:1 LNP05
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~6:1 LNP06
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~11:1 LNP07
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~6:1 LNP08
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~11:1 LNP09
2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG
[1,3]-dioxolane (XTC) 50/10/38.5/1.5 Lipid:siRNA 10:1 LNP10
(3aR,5s,6aS)-N,N-dimethyl-2,2- ALN100/DSPC/Cholesterol/PEG-DMG
di((9Z,12Z)-octadeca-9,12- 50/10/38.5/1.5 dienyl)tetrahydro-3aH-
Lipid:siRNA 10:1 cyclopenta[d][1,3]dioxol-5-amine (ALN100) LNP11
(6Z,9Z,28Z,31Z)-heptatriaconta- MC-3/DSPC/Cholesterol/PEG-DMG
6,9,28,31-tetraen-19-yl 4- 50/10/38.5/1.5 (dimethylamino)butanoate
(MC3) Lipid:siRNA 10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2- Tech
G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)(2-
50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)piperazin- Lipid:siRNA
10:1 1-yl)ethylazanediyl)didodecan-2-ol (Tech G1) LNP13 XTC
XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3
MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3
MC3/DSPC/Chol/PEG- DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA:
11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:
7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:
12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1
LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1
LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:
10:1 DSPC: distearoylphosphatidylcholine DPPC:
dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol
(C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG:
PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of
2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG
with avg mol wt of 2000) SNALP
(1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising
formulations are described in International Publication No.
WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by
reference.
[0258] XTC comprising formulations are described, e.g., in U.S.
Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S.
Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S.
Provisional Ser. No. filed Jun. 10, 2009; U.S. Provisional Ser. No.
61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No.
61/239,686, filed Sep. 3, 2009, and International Application No.
PCT/US2010/022614, filed Jan. 29, 2010, which are hereby
incorporated by reference.
[0259] MC3 comprising formulations are described, e.g., in U.S.
Publication No. 2010/0324120, filed Jun. 10, 2010, the entire
contents of which are hereby incorporated by reference.
[0260] ALNY-100 comprising formulations are described, e.g.,
International patent application number PCT/US09/63933, filed on
Nov. 10, 2009, which is hereby incorporated by reference.
[0261] C12-200 comprising formulations are described in U.S.
Provisional Ser. No. 61/175,770, filed May 5, 2009 and
International Application No. PCT/US10/33777, filed May 5, 2010,
which are hereby incorporated by reference.
[0262] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
can be desirable. In some embodiments, oral formulations are those
in which dsRNAs featured in the invention are administered in
conjunction with one or more penetration enhancer surfactants and
chelators. Suitable surfactants include fatty acids and/or esters
or salts thereof, bile acids and/or salts thereof. Suitable bile
acids/salts include chenodeoxycholic acid (CDCA) and
ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic
acid, deoxycholic acid, glucholic acid, glycholic acid,
glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid,
sodium tauro-24,25-dihydro-fusidate and sodium
glycodihydrofusidate. Suitable fatty acids include arachidonic
acid, undecanoic acid, oleic acid, lauric acid, caprylic acid,
capric acid, myristic acid, palmitic acid, stearic acid, linoleic
acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin,
glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an
acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or
a pharmaceutically acceptable salt thereof (e.g., sodium). In some
embodiments, combinations of penetration enhancers are used, for
example, fatty acids/salts in combination with bile acids/salts.
One exemplary combination is the sodium salt of lauric acid, capric
acid and UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
DsRNAs featured in the invention can be delivered orally, in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. DsRNA complexing agents include
poly-amino acids; polyimines; polyacrylates; polyalkylacrylates,
polyoxethanes, polyalkylcyanoacrylates; cationized gelatins,
albumins, starches, acrylates, polyethyleneglycols (PEG) and
starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines,
pollulans, celluloses and starches. Suitable complexing agents
include chitosan, N-trimethylchitosan, poly-L-lysine,
polyhistidine, polyornithine, polyspermines, protamine,
polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE),
polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate), poly(butylcyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide,
DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for dsRNAs and their
preparation are described in detail in U.S. Pat. No. 6,887,906, US
Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which
is incorporated herein by reference.
[0263] Compositions and formulations for parenteral,
intraparenchymal (into the brain), intrathecal, intraventricular or
intrahepatic administration can include sterile aqueous solutions
which can also contain buffers, diluents and other suitable
additives such as, but not limited to, penetration enhancers,
carrier compounds and other pharmaceutically acceptable carriers or
excipients.
[0264] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions can be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids. Particularly preferred are
formulations that target the liver when treating hepatic disorders
such as hepatic carcinoma.
[0265] The pharmaceutical formulations of the present invention,
which can conveniently be presented in unit dosage form, can be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0266] The compositions of the present invention can be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention can also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions can further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension can also contain stabilizers.
[0267] C. Additional Formulations
[0268] i. Emulsions
[0269] The iRNAs of the present invention can be prepared and
formulated as emulsions. Emulsions are typically heterogeneous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335;
Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising two immiscible liquid phases intimately
mixed and dispersed with each other. In general, emulsions can be
of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
When an aqueous phase is finely divided into and dispersed as
minute droplets into a bulk oily phase, the resulting composition
is called a water-in-oil (w/o) emulsion. Alternatively, when an
oily phase is finely divided into and dispersed as minute droplets
into a bulk aqueous phase, the resulting composition is called an
oil-in-water (o/w) emulsion. Emulsions can contain additional
components in addition to the dispersed phases, and the active drug
which can be present as a solution either in the aqueous phase,
oily phase or itself as a separate phase. Pharmaceutical excipients
such as emulsifiers, stabilizers, dyes, and anti-oxidants can also
be present in emulsions as needed. Pharmaceutical emulsions can
also be multiple emulsions that are comprised of more than two
phases such as, for example, in the case of oil-in-water-in-oil
(o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex
formulations often provide certain advantages that simple binary
emulsions do not. Multiple emulsions in which individual oil
droplets of an o/w emulsion enclose small water droplets constitute
a w/o/w emulsion. Likewise a system of oil droplets enclosed in
globules of water stabilized in an oily continuous phase provides
an o/w/o emulsion.
[0270] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
can be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that can be incorporated into either
phase of the emulsion. Emulsifiers can broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0271] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker,
Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are
typically amphiphilic and comprise a hydrophilic and a hydrophobic
portion. The ratio of the hydrophilic to the hydrophobic nature of
the surfactant has been termed the hydrophile/lipophile balance
(HLB) and is a valuable tool in categorizing and selecting
surfactants in the preparation of formulations. Surfactants can be
classified into different classes based on the nature of the
hydrophilic group: nonionic, anionic, cationic, and amphoteric (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
285).
[0272] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate, and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0273] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives, and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0274] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0275] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that can
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used can be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0276] The application of emulsion formulations via dermatological,
oral, and parenteral routes, and methods for their manufacture have
been reviewed in the literature (see e.g., Ansel's Pharmaceutical
Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G.,
and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.),
New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 199). Emulsion formulations for oral delivery
have been very widely used because of ease of formulation, as well
as efficacy from an absorption and bioavailability standpoint (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 199). Mineral-oil base laxatives, oil-soluble
vitamins, and high fat nutritive preparations are among the
materials that have commonly been administered orally as o/w
emulsions.
[0277] ii. Microemulsions
[0278] In one embodiment of the present invention, the iRNAs are
formulated as microemulsions. A microemulsion can be defined as a
system of water, oil, and amphiphile which is a single optically
isotropic and thermodynamically stable liquid solution (see e.g.,
Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems,
Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott
Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Typically microemulsions are systems that are prepared by first
dispersing an oil in an aqueous surfactant solution and then adding
a sufficient amount of a fourth component, generally an
intermediate chain-length alcohol to form a transparent system.
Therefore, microemulsions have also been described as
thermodynamically stable, isotropically clear dispersions of two
immiscible liquids that are stabilized by interfacial films of
surface-active molecules (Leung and Shah, in: Controlled Release of
Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0279] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0280] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij.RTM. 96, polyoxyethylene oleyl ethers,
polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310),
tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310),
hexaglycerol pentaoleate (PO500), decaglycerol monocaprate
(MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate
(SO750), decaglycerol decaoleate (DA0750), alone or in combination
with cosurfactants. The cosurfactant, usually a short-chain alcohol
such as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions can, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase can typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase can include, but is not limited to, materials
such as Captex.RTM. 300, Captex.RTM. 355, Capmul.RTM. MCM, fatty
acid esters, medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils, and silicone oil.
[0281] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802;
7,157,099; Constantinides et al., Pharmaceutical Research, 1994,
11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993,
13, 205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (see e.g., U.S.
Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099;
Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho
et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions
can form spontaneously when their components are brought together
at ambient temperature. This can be particularly advantageous when
formulating thermolabile drugs, peptides or iRNAs. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of iRNAs and nucleic acids from the gastrointestinal
tract, as well as improve the local cellular uptake of iRNAs and
nucleic acids.
[0282] Microemulsions of the present invention can also contain
additional components and additives such as sorbitan monostearate
(Grill.RTM. 3), Labrasol.RTM., and penetration enhancers to improve
the properties of the formulation and to enhance the absorption of
the iRNAs and nucleic acids of the present invention. Penetration
enhancers used in the microemulsions of the present invention can
be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0283] iii. Microparticles
[0284] An iRNA of the invention may be incorporated into a
particle, e.g., a microparticle. Microparticles can be produced by
spray-drying, but may also be produced by other methods including
lyophilization, evaporation, fluid bed drying, vacuum drying, or a
combination of these techniques.
[0285] iv. Penetration Enhancers
[0286] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly iRNAs, to the skin of animals. Most drugs are
present in solution in both ionized and nonionized forms. However,
usually only lipid soluble or lipophilic drugs readily cross cell
membranes. It has been discovered that even non-lipophilic drugs
can cross cell membranes if the membrane to be crossed is treated
with a penetration enhancer. In addition to aiding the diffusion of
non-lipophilic drugs across cell membranes, penetration enhancers
also enhance the permeability of lipophilic drugs.
[0287] Penetration enhancers can be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (see
e.g., Malmsten, M. Surfactants and polymers in drug delivery,
Informa Health Care, New York, N.Y., 2002; Lee et al., Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Such
compounds are well known in the art.
[0288] v. Carriers
[0289] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate dsRNA in hepatic tissue can be reduced
when it is coadministered with polyinosinic acid, dextran sulfate,
polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA
& Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0290] vi. Excipients
[0291] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent, or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
can be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc).
[0292] Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the
like.
[0293] Formulations for topical administration of nucleic acids can
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions can also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0294] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone, and the like.
[0295] vii. Other Components
[0296] The compositions of the present invention can additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions can contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or can contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings or aromatic substances and the like which do
not deleteriously interact with the nucleic acid(s) of the
formulation.
[0297] Aqueous suspensions can contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol, or dextran. The suspension can
also contain stabilizers.
[0298] In some embodiments, pharmaceutical compositions featured in
the invention include (a) one or more iRNA and (b) one or more
agents which function by a non-iRNA mechanism and which are useful
in treating a KHK-associated disorder.
[0299] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds that exhibit
high therapeutic indices are preferred.
[0300] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of compositions featured herein in the invention
lies generally within a range of circulating concentrations that
include the ED50 with little or no toxicity. The dosage can vary
within this range depending upon the dosage form employed and the
route of administration utilized. For any compound used in the
methods featured in the invention, the therapeutically effective
dose can be estimated initially from cell culture assays. A dose
can be formulated in animal models to achieve a circulating plasma
concentration range of the compound or, when appropriate, of the
polypeptide product of a target sequence (e.g., achieving a
decreased concentration of the polypeptide) that includes the IC50
(i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma can be measured, for example, by
high performance liquid chromatography.
[0301] In addition to their administration, as discussed above, the
iRNAs featured in the invention can be administered in combination
with other known agents effective in treatment of pathological
processes mediated by KHK expression. In any event, the
administering physician can adjust the amount and timing of iRNA
administration on the basis of results observed using standard
measures of efficacy known in the art or described herein.
VI. Methods for Inhibiting Hdlbp/Vigilin Expression
[0302] The present invention also provides methods of inhibiting
expression of a Hdlbp/Vigilin gene in a cell. The methods include
contacting a cell with an RNAi agent, e.g., double stranded RNAi
agent, in an amount effective to inhibit expression of
Hdlbp/Vigilin in the cell, thereby inhibiting expression of
Hdlbp/Vigilin in the cell. In certain embodiments of the invention,
Hdlbp/Vigilin is inhibited preferentially in liver cells.
[0303] Contacting of a cell with an iRNA, e.g., a double stranded
RNAi agent, may be done in vitro or in vivo. Contacting a cell in
vivo with the iRNA includes contacting a cell or group of cells
within a subject, e.g., a human subject, with the iRNA.
Combinations of in vitro and in vivo methods of contacting a cell
are also possible. Contacting a cell may be direct or indirect, as
discussed above. Furthermore, contacting a cell may be accomplished
via a targeting ligand, including any ligand described herein or
known in the art. In some embodiments, the targeting ligand is a
carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand
that directs the RNAi agent to a site of interest.
[0304] The term "inhibiting," as used herein, is used
interchangeably with "reducing," "silencing," "downregulating,"
"suppressing" and other similar terms, and includes any level of
inhibition.
[0305] The phrase "inhibiting expression of an Hdlbp/Vigilin," as
used herein, includes inhibition of expression of any Hdlbp/Vigilin
gene (such as, e.g., a human Hdlbp/Vigilin gene) as well as
variants or mutants of an Hdlbp/Vigilin gene that encode an
Hdlbp/Vigilin protein. Thus, the Hdlbp/Vigilin gene may be a
wild-type Hdlbp/Vigilin gene, a mutant Hdlbp/Vigilin gene, or a
transgenic Hdlbp/Vigilin gene in the context of a genetically
manipulated cell, group of cells, or organism.
[0306] "Inhibiting expression of a Hdlbp/Vigilin gene" includes any
level of inhibition of a Hdlbp/Vigilin gene, e.g., at least partial
suppression of the expression of a Hdlbp/Vigilin gene. The
expression of the Hdlbp/Vigilin gene may be assessed based on the
level, or the change in the level, of any variable associated with
Hdlbp/Vigilin gene expression, e.g., Hdlbp/Vigilin mRNA level or
Hdlbp/Vigilin protein level. This level may be assessed in an
individual cell or in a group of cells, including, for example, a
sample derived from a subject. It is understood that expression of
Hdlbp/Vigilin may be near or below the level of detection in a
normal subject in many cell types and body fluids. The expression
of an Hdlbp/Vigilin may also be assessed indirectly based on the
levels of a serum lipid, a triglyceride, cholesterol (including
LDL-C, HDL-C, VLDL-C, IDL-C and total cholesterol), or free fatty
acids. The expression of an Hdlbp/Vigilin may also be assessed
indirectly based on the levels of plasma glucose, fasting blood
glucose, plasma insulin, or the size of atherosclerotic plaque.
[0307] Inhibition may be assessed by a decrease in an absolute or
relative level of one or more variables that are associated with
Hdlbp/Vigilin expression compared with a control level. The control
level may be any type of control level that is utilized in the art,
e.g., a pre-dose baseline level, or a level determined from a
similar subject (e.g., historical control), cell, or sample that is
untreated or treated with a control (such as, e.g., buffer only
control or inactive agent control).
[0308] In certain embodiments, surrogate markers can be used to
detect inhibition of Hdlbp/Vigilin. For example, effective
treatment of a disorder of lipid metabolism as demonstrated by
acceptable diagnostic and monitoring criteria with an agent to
reduce Hdlbp/Vigilin expression can be understood to demonstrate a
clinically relevant reduction in Hdlbp/Vigilin.
[0309] In some embodiments of the methods of the invention,
expression of a Hdlbp/Vigilin gene is inhibited by at least 20%, a
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95%, or to below the level of detection of the assay. In
certain embodiments, the methods include a clinically relevant
inhibition of expression of Hdlbp/Vigilin, e.g. as demonstrated by
a clinically relevant outcome after treatment of a subject with an
agent to reduce the expression of Hdlbp/Vigilin.
[0310] Inhibition of the expression of a Hdlbp/Vigilin gene may be
manifested by a reduction of the amount of mRNA expressed by a
first cell or group of cells (such cells may be present, for
example, in a sample derived from a subject) in which a
Hdlbp/Vigilin gene is transcribed and which has or have been
treated (e.g., by contacting the cell or cells with an iRNA of the
invention, or by administering an iRNA of the invention to a
subject in which the cells are or were present) such that the
expression of a Hdlbp/Vigilin gene is inhibited, as compared to a
second cell or group of cells substantially identical to the first
cell or group of cells but which has not or have not been so
treated (control cell(s) not treated with an iRNA or not treated
with an iRNA targeted to the gene of interest). The degree of
inhibition may be expressed in terms of:
( mRNA .times. .times. in .times. .times. control .times. .times.
cells ) - ( mRNA .times. .times. in .times. .times. treated .times.
.times. cells ) ( mRNA .times. .times. in .times. .times. control
.times. .times. cells ) .times. .largecircle.100 .times. %
##EQU00002##
[0311] In other embodiments, inhibition of the expression of a
Hdlbp/Vigilin gene may be assessed in terms of a reduction of a
parameter that is functionally linked to Hdlbp/Vigilin gene
expression, e.g., Hdlbp/Vigilin protein expression or Hdlbp/Vigilin
signaling pathways. Hdlbp/Vigilin gene silencing may be determined
in any cell expressing Hdlbp/Vigilin, either endogenous or
heterologous from an expression construct, and by any assay known
in the art.
[0312] Inhibition of the expression of a Hdlbp/Vigilin protein may
be manifested by a reduction in the level of the Hdlbp/Vigilin
protein that is expressed by a cell or group of cells (e.g., the
level of protein expressed in a sample derived from a subject). As
explained above, for the assessment of mRNA suppression, the
inhibition of protein expression levels in a treated cell or group
of cells may similarly be expressed as a percentage of the level of
protein in a control cell or group of cells.
[0313] A control cell or group of cells that may be used to assess
the inhibition of the expression of a Hdlbp/Vigilin gene includes a
cell or group of cells that has not yet been contacted with an RNAi
agent of the invention. For example, the control cell or group of
cells may be derived from an individual subject (e.g., a human or
animal subject) prior to treatment of the subject with an RNAi
agent.
[0314] The level of Hdlbp/Vigilin mRNA that is expressed by a cell
or group of cells may be determined using any method known in the
art for assessing mRNA expression. In one embodiment, the level of
expression of Hdlbp/Vigilin in a sample is determined by detecting
a transcribed polynucleotide, or portion thereof, e.g., mRNA of the
Hdlbp/Vigilin gene. RNA may be extracted from cells using RNA
extraction techniques including, for example, using acid
phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis),
RNeasy.TM. RNA preparation kits (Qiagen.RTM.) or PAXgene
(PreAnalytix, Switzerland). Typical assay formats utilizing
ribonucleic acid hybridization include nuclear run-on assays,
RT-PCR, RNase protection assays, northern blotting, in situ
hybridization, and microarray analysis. Circulating Hdlbp/Vigilin
mRNA may be detected using methods the described in PCT Publication
WO2012/177906, the entire contents of which are hereby incorporated
herein by reference.
[0315] In some embodiments, the level of expression of
Hdlbp/Vigilin is determined using a nucleic acid probe. The term
"probe", as used herein, refers to any molecule that is capable of
selectively binding to a specific Hdlbp/Vigilin. Probes can be
synthesized by one of skill in the art, or derived from appropriate
biological preparations. Probes may be specifically designed to be
labeled. Examples of molecules that can be utilized as probes
include, but are not limited to, RNA, DNA, proteins, antibodies,
and organic molecules.
[0316] Isolated mRNA can be used in hybridization or amplification
assays that include, but are not limited to, Southern or northern
analyses, polymerase chain reaction (PCR) analyses and probe
arrays. One method for the determination of mRNA levels involves
contacting the isolated mRNA with a nucleic acid molecule (probe)
that can hybridize to Hdlbp/Vigilin mRNA. In one embodiment, the
mRNA is immobilized on a solid surface and contacted with a probe,
for example by running the isolated mRNA on an agarose gel and
transferring the mRNA from the gel to a membrane, such as
nitrocellulose. In an alternative embodiment, the probe(s) are
immobilized on a solid surface and the mRNA is contacted with the
probe(s), for example, in an Affymetrix gene chip array. A skilled
artisan can readily adapt known mRNA detection methods for use in
determining the level of Hdlbp/Vigilin mRNA.
[0317] An alternative method for determining the level of
expression of Hdlbp/Vigilin in a sample involves the process of
nucleic acid amplification and/or reverse transcriptase (to prepare
cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the
experimental embodiment set forth in Mullis, 1987, U.S. Pat. No.
4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad.
Sci. USA 88:189-193), self sustained sequence replication (Guatelli
et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878),
transcriptional amplification system (Kwoh et al. (1989) Proc.
Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et
al. (1988) Bio/Technology 6:1197), rolling circle replication
(Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid
amplification method, followed by the detection of the amplified
molecules using techniques well known to those of skill in the art.
These detection schemes are especially useful for the detection of
nucleic acid molecules if such molecules are present in very low
numbers. In particular aspects of the invention, the level of
expression of Hdlbp/Vigilin is determined by quantitative
fluorogenic RT-PCR (i.e., the TaqMan.TM. System) or the
Dual-Glo.RTM. Luciferase assay.
[0318] The expression levels of Hdlbp/Vigilin mRNA may be monitored
using a membrane blot (such as used in hybridization analysis such
as northern, Southern, dot, and the like), or microwells, sample
tubes, gels, beads or fibers (or any solid support comprising bound
nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305,
5,677,195 and 5,445,934, which are incorporated herein by
reference. The determination of Hdlbp/Vigilin expression level may
also comprise using nucleic acid probes in solution.
[0319] In some embodiments, the level of mRNA expression is
assessed using branched DNA (bDNA) assays or real time PCR (qPCR).
The use of this PCR method is described and exemplified in the
Examples presented herein. Such methods can also be used for the
detection of Hdlbp/Vigilin nucleic acids.
[0320] The level of Hdlbp/Vigilin protein expression may be
determined using any method known in the art for the measurement of
protein levels. Such methods include, for example, electrophoresis,
capillary electrophoresis, high performance liquid chromatography
(HPLC), thin layer chromatography (TLC), hyperdiffusion
chromatography, fluid or gel precipitin reactions, absorption
spectroscopy, a colorimetric assays, spectrophotometric assays,
flow cytometry, immunodiffusion (single or double),
immunoelectrophoresis, western blotting, radioimmunoassay (RIA),
enzyme-linked immunosorbent assays (ELISAs), immunofluorescent
assays, electrochemiluminescence assays, and the like. Such assays
can also be used for the detection of proteins indicative of the
presence or replication of Hdlbp/Vigilin proteins.
[0321] In some embodiments, the efficacy of the methods of the
invention in the treatment of a disease or disorder that would
benefit from reduction in the expression of Hdlbp/Vigilin is
assessed by a decrease in Hdlbp/Vigilin mRNA level (by liver
biopsy).
[0322] In some embodiments of the methods of the invention, the
iRNA is administered to a subject such that the iRNA is delivered
to a specific site within the subject. The inhibition of expression
of Hdlbp/Vigilin may be assessed using measurements of the level or
change in the level of Hdlbp/Vigilin mRNA or Hdlbp/Vigilin protein
in a sample derived from a specific site within the subject, e.g.,
the liver. In certain embodiments, the methods include a clinically
relevant inhibition of expression of Hdlbp/Vigilin, e.g. as
demonstrated by a clinically relevant outcome after treatment of a
subject with an agent to reduce the expression of
Hdlbp/Vigilin.
[0323] As used herein, the terms detecting or determining a level
of an analyte are understood to mean performing the steps to
determine if a material, e.g., protein, RNA, is present. As used
herein, methods of detecting or determining include detection or
determination of an analyte level that is below the level of
detection for the method used.
VII. Methods of Treating or Preventing Hdlbp/Vigilin-Associated
Diseases
[0324] The present invention also provides methods of using an iRNA
of the invention and/or a composition containing an iRNA of the
invention to reduce and/or inhibit Hdlbp/Vigilin expression in a
cell. The methods include contacting the cell with a dsRNA of the
invention and maintaining the cell for a time sufficient to obtain
degradation of the mRNA transcript of an Hdlbp/Vigilin gene,
thereby inhibiting expression of the Hdlbp/Vigilin gene in the
cell. Reduction in gene expression can be assessed by any methods
known in the art. For example, a reduction in the expression of
Hdlbp/Vigilin may be determined by determining the mRNA expression
level of Hdlbp/Vigilin using methods routine to one of ordinary
skill in the art, e.g., Northern blotting, qRT-PCR; by determining
the protein level of Hdlbp/Vigilin using methods routine to one of
ordinary skill in the art, such as Western blotting, immunological
techniques. A reduction in the expression of Hdlbp/Vigilin may also
be assessed indirectly by measuring a decrease in biological
activity of Hdlbp/Vigilin, e.g., a decrease in the level of serum
lipid, triglycerides, cholesterol, free fatty acids, plasma
glucose, fasting blood glucose, plasma insulin and/or the size of
atherosclerotic plaque.
[0325] The methods of the invention further comprise measuring
serum lipid levels, plasma glucose levels, fasting blood glucose
levels, plasma insulin levels, plasma triglyceride levels, and/or
plasma cholesterol levels in the subject. In certain embodiments,
following administration of the double stranded RNAi agent to the
subject, the Hdlbp/Vigilin protein accumulation is decreased; the
plasma cholesterol level in the subject is decreased; the plasma
triglyceride level in the subject is decreased; the serum VLDL
level in the subject is decreased; the serum LDL level in the
subject is decreased; the plasma insulin level in the subject is
decreased; insulin sensitivity in the subject is increased; glucose
tolerance in the subject is increased; and/or atherosclerotic
plaque formation in the subject is decreased.
[0326] In the methods of the invention the cell may be contacted in
vitro or in vivo, i.e., the cell may be within a subject.
[0327] A cell suitable for treatment using the methods of the
invention may be any cell that expresses an Hdlbp/Vigilin gene. A
cell suitable for use in the methods of the invention may be a
mammalian cell, e.g., a primate cell (such as a human cell or a
non-human primate cell, e.g., a monkey cell or a chimpanzee cell),
a non-primate cell (such as a cow cell, a pig cell, a camel cell, a
llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell,
a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a
mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo
cell), a bird cell (e.g., a duck cell or a goose cell), or a whale
cell. In one embodiment, the cell is a human cell, e.g., a human
liver cell.
[0328] Hdlbp/Vigilin expression is inhibited in the cell by at
least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In some
embodiments, Hdlbp/Vigilin expression is inhibited by at least
20%.
[0329] The in vivo methods of the invention may include
administering to a subject a composition containing an iRNA, where
the iRNA includes a nucleotide sequence that is complementary to at
least a part of an RNA transcript of the Hdlbp/Vigilin gene of the
mammal to be treated. When the organism to be treated is a mammal
such as a human, the composition can be administered by any means
known in the art including, but not limited to oral,
intraperitoneal, or parenteral routes, including intracranial
(e.g., intraventricular, intraparenchymal and intrathecal),
intravenous, intramuscular, subcutaneous, transdermal, airway
(aerosol), nasal, rectal, and topical (including buccal and
sublingual) administration. In certain embodiments, the
compositions are administered by intravenous infusion or injection.
In certain embodiments, the compositions are administered by
subcutaneous injection.
[0330] In some embodiments, the administration is via a depot
injection. A depot injection may release the iRNA in a consistent
way over a prolonged time period. Thus, a depot injection may
reduce the frequency of dosing needed to obtain a desired effect,
e.g., a desired inhibition of Hdlbp/Vigilin, or a therapeutic or
prophylactic effect. A depot injection may also provide more
consistent serum concentrations. Depot injections may include
subcutaneous injections or intramuscular injections. In some
embodiments, the depot injection is a subcutaneous injection.
[0331] In some embodiments, the administration is via a pump. The
pump may be an external pump or a surgically implanted pump. In
certain embodiments, the pump is a subcutaneously implanted osmotic
pump. In other embodiments, the pump is an infusion pump. An
infusion pump may be used for intravenous, subcutaneous, arterial,
or epidural infusions. In some embodiments, the infusion pump is a
subcutaneous infusion pump. In other embodiments, the pump is a
surgically implanted pump that delivers the iRNA to the liver.
[0332] The mode of administration may be chosen based upon whether
local or systemic treatment is desired and based upon the area to
be treated. The route and site of administration may be chosen to
enhance targeting.
[0333] In one aspect, the present invention also provides methods
for inhibiting the expression of an Hdlbp/Vigilin gene in a mammal.
The methods include administering to the mammal a composition
comprising a dsRNA that targets an Hdlbp/Vigilin gene in a cell of
the mammal and maintaining the mammal for a time sufficient to
obtain degradation of the mRNA transcript of the Hdlbp/Vigilin
gene, thereby inhibiting expression of the Hdlbp/Vigilin gene in
the cell. Reduction in gene expression can be assessed by any
methods known it the art and by methods, e.g. qRT-PCR, described
herein. Reduction in protein production can be assessed by any
methods known it the art and by methods, e.g. ELISA, described
herein. In one embodiment, a puncture liver biopsy sample serves as
the tissue material for monitoring the reduction in Hdlbp/Vigilin
gene and/or protein expression.
[0334] The present invention further provides methods of treatment
of a subject in need thereof. The treatment methods of the
invention include administering an iRNA of the invention to a
subject, e.g., a subject that would benefit from a reduction and/or
inhibition of Hdlbp/Vigilin expression, in a therapeutically
effective amount of an iRNA targeting an Hdlbp/Vigilin gene or a
pharmaceutical composition comprising an iRNA targeting an
Hdlbp/Vigilin gene.
[0335] An iRNA of the invention may be administered as a "free
iRNA." A free iRNA is administered in the absence of a
pharmaceutical composition. The naked iRNA may be in a suitable
buffer solution. The buffer solution may comprise acetate, citrate,
prolamine, carbonate, or phosphate, or any combination thereof. In
one embodiment, the buffer solution is phosphate buffered saline
(PBS). The pH and osmolarity of the buffer solution containing the
iRNA can be adjusted such that it is suitable for administering to
a subject.
[0336] Alternatively, an iRNA of the invention may be administered
as a pharmaceutical composition, such as a dsRNA liposomal
formulation.
[0337] Subjects that would benefit from a reduction and/or
inhibition of Hdlbp/Vigilin gene expression are those having a
disorder of lipid metabolism. In one embodiment, a subject having
disorder of lipid metabolism has a hyperlipidemia. In one
embodiment, a subject having the hyperlipidemia has
hypercholesterolemia. In certain embodiments, the hyperlipidemia is
hypertriglyceridemia. In certain embodiments, the hyperlipidemia is
mixed hyperlipidemia.
[0338] The invention further provides methods for the use of an
iRNA or a pharmaceutical composition thereof, e.g., for treating a
subject that would benefit from reduction and/or inhibition of
Hdlbp/Vigilin expression, e.g., a subject having a disorder of
lipid metabolism, in combination with other pharmaceuticals and/or
other therapeutic methods, e.g., with known pharmaceuticals and/or
known therapeutic methods, such as, for example, those which are
currently employed for treating these disorders. For example, in
certain embodiments, an iRNA targeting Hdlbp/Vigilin is
administered in combination with, e.g., an agent useful in treating
a disorder of lipid metabolism as described elsewhere herein. For
example, additional agents suitable for treating a subject that
would benefit from reduction in Hdlbp/Vigilin expression, e.g., a
subject having a disorder of lipid metabolism, may include agents
that lower one or more serum lipids. Non-limiting examples of such
agents may include cholesterol synthesis inhibitors, e.g., statins.
Statins may include atorvastatin (Lipitor), fluvastatin (Lescol),
lovastatin (Mevacor), lovastatin extended-release (Altoprev),
pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin
(Crestor), and simvastatin (Zocor). Other agents useful in treating
a disorder of lipid metabolism may include bile sequestering
agents, such as cholestyramine and other resins; VLDL secretion
inhibitors, such as niacin; lipophilic antioxidants, such as
Probucol; acyl-CoA cholesterol acyl transferase inhibitors;
farnesoid X receptor antagonists; sterol regulatory binding protein
cleavage activating protein (SCAP) activators; microsomal
triglyceride transfer protein (MTP) inhibitors; ApoE-related
peptide; and therapeutic antibodies against Hdlbp/Vigilin. The
additional therapeutic agents may also include agents that raise
high density lipoprotein (HDL), such as cholesteryl ester transfer
protein (CETP) inhibitors. Furthermore, the additional therapeutic
agents may also include dietary supplements, e.g., fish oil. The
iRNA and additional therapeutic agents may be administered at the
same time and/or in the same combination, e.g., parenterally, or
the additional therapeutic agent can be administered as part of a
separate composition or at separate times and/or by another method
known in the art or described herein.
[0339] In one embodiment, the method includes administering a
composition featured herein such that expression of the target
Hdlbp/Vigilin gene is decreased, such as for about 1, 2, 3, 4, 5,
6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one
embodiment, expression of the target Hdlbp/Vigilin gene is
decreased for an extended duration, e.g., at least about two,
three, four days or more, e.g., about one week, two weeks, three
weeks, or four weeks or longer.
[0340] Preferably, the iRNAs useful for the methods and
compositions featured herein specifically target RNAs (primary or
processed) of the target Hdlbp/Vigilin gene. Compositions and
methods for inhibiting the expression of these genes using iRNAs
can be prepared and performed as described herein.
[0341] Administration of the dsRNA according to the methods of the
invention may result in a reduction of the severity, signs,
symptoms, and/or markers of such diseases or disorders in a patient
with a disorder of lipid metabolism. By "reduction" in this context
is meant a statistically significant decrease in such level. The
reduction can be, for example, at least about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, or about 100%.
[0342] Efficacy of treatment or prevention of disease can be
assessed, for example by measuring disease progression, disease
remission, symptom severity, reduction in pain, quality of life,
dose of a medication required to sustain a treatment effect, level
of a disease marker or any other measurable parameter appropriate
for a given disease being treated or targeted for prevention. It is
well within the ability of one skilled in the art to monitor
efficacy of treatment or prevention by measuring any one of such
parameters, or any combination of parameters. For example, efficacy
of treatment of a disorder of lipid metabolism may be assessed, for
example, by periodic monitoring of one or more serum lipid levels.
Comparisons of the later readings with the initial readings provide
a physician an indication of whether the treatment is effective. It
is well within the ability of one skilled in the art to monitor
efficacy of treatment or prevention by measuring any one of such
parameters, or any combination of parameters. In connection with
the administration of an iRNA targeting Hdlbp/Vigilin or
pharmaceutical composition thereof, "effective against" a disorder
of lipid metabolism indicates that administration in a clinically
appropriate manner results in a beneficial effect for at least a
statistically significant fraction of patients, such as a
improvement of symptoms, a cure, a reduction in disease, extension
of life, improvement in quality of life, or other effect generally
recognized as positive by medical doctors familiar with treating
disorder of lipid metabolisms and the related causes.
[0343] A treatment or preventive effect is evident when there is a
statistically significant improvement in one or more parameters of
disease status, or by a failure to worsen or to develop symptoms
where they would otherwise be anticipated. As an example, a
favorable change of at least 10% in a measurable parameter of
disease, and preferably at least 20%, 30%, 40%, 50% or more can be
indicative of effective treatment. Efficacy for a given iRNA drug
or formulation of that drug can also be judged using an
experimental animal model for the given disease as known in the
art. When using an experimental animal model, efficacy of treatment
is evidenced when a statistically significant reduction in a marker
or symptom is observed.
[0344] Alternatively, the efficacy can be measured by a reduction
in the severity of disease as determined by one skilled in the art
of diagnosis based on a clinically accepted disease severity
grading scale, as but one example the Child-Pugh score (sometimes
the Child-Turcotte-Pugh score). Any positive change resulting in
e.g., lessening of severity of disease measured using the
appropriate scale, represents adequate treatment using an iRNA or
iRNA formulation as described herein.
[0345] Subjects can be administered a therapeutic amount of dsRNA,
such as about 0.01 mg/kg to about 200 mg/kg.
[0346] The iRNA can be administered by intravenous infusion over a
period of time, on a regular basis. In certain embodiments, after
an initial treatment regimen, the treatments can be administered on
a less frequent basis. Administration of the iRNA can reduce
Hdlbp/Vigilin levels, e.g., in a cell, tissue, blood, urine or
other compartment of the patient by at least about 5%, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
95, 96, 97, 98, or at least about 99% or more. In some embodiments,
administration of the iRNA can reduce Hdlbp/Vigilin levels, e.g.,
in a cell, tissue, blood, urine or other compartment of the patient
by at least 20%.
[0347] Before administration of a full dose of the iRNA, patients
can be administered a smaller dose, such as a 5% infusion reaction,
and monitored for adverse effects, such as an allergic reaction. In
another example, the patient can be monitored for unwanted
immunostimulatory effects, such as increased cytokine (e.g.,
TNF-alpha or INF-alpha) levels.
[0348] Alternatively, the iRNA can be administered subcutaneously,
i.e., by subcutaneous injection. One or more injections may be used
to deliver the desired daily dose of iRNA to a subject. The
injections may be repeated over a period of time. The
administration may be repeated on a regular basis. In certain
embodiments, after an initial treatment regimen, the treatments can
be administered on a less frequent basis. A repeat-dose regimine
may include administration of a therapeutic amount of iRNA on a
regular basis, such as every other day or to once a year. In
certain embodiments, the iRNA is administered about once per month
to about once per quarter (i.e., about once every three
months).
[0349] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the iRNAs and
methods featured in the invention, suitable methods and materials
are described below. All publications, patent applications,
patents, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control. In addition,
the materials, methods, and examples are illustrative only and not
intended to be limiting.
EXAMPLES
Example 1. iRNA Design, Synthesis, Selection, and In Vitro
Evaluation
[0350] This Example describes methods for the design, synthesis,
selection, and in vitro evaluation of Hdlbp/Vigilin iRNA
agents.
Source of Reagents
[0351] Where the source of a reagent is not specifically given
herein, such reagent can be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
Bioinformatics
[0352] A set of siRNA agents targeting the human Hdlbp/Vigilin,
"High Density Lipoprotein Binding Protein", (human: NCBI refseqID
NM_005336.5; NCBI GeneID: 3069) is designed using custom R and
Python scripts. The human NM_005336.5 REFSEQ mRNA, has a length of
6524 bases. The rationale and method for the set of siRNA designs
is as follows: the predicted efficacy for every potential 19mer
siRNA from position 10 through position 4620 is determined with a
linear model derived the direct measure of mRNA knockdown from more
than 20,000 distinct siRNA designs targeting a large number of
vertebrate genes. For each strand of the siRNA, a custom Python
script is used in a brute force search to measure the number and
positions of mismatches between the siRNA and all potential
alignments in the target species transcriptome. Extra weight is
given to mismatches in the seed region, defined here as positions
2-9 of the antisense oligonucleotide, as well the cleavage site of
the siRNA, defined here as positions 10-11 of the antisense
oligonucleotide. The relative weight of the mismatches is 2.8;
1.2:1 for seed mismatches, cleavage site, and other positions up
through antisense position 19. Mismatches in the first position are
ignored. A specificity score is calculated for each strand by
summing the value of each weighted mismatch. Preference is given to
siRNAs whose antisense score in human is >=2.0 and predicted
efficacy is >=50% knockdown of the Hdlbp/Vigilin transcript.
Synthesis of Hdlbp/Vigilin Single Strands and Duplexes
[0353] Hdlbp/Vigilin siRNA sequences are synthesized at 1 .mu.mol
scale on Mermade 192 synthesizer (BioAutomation) using the solid
support mediated phosphoramidite chemistry. The solid support is
controlled pore glass (500.degree. A) loaded with custom GalNAc
ligand or universal solid support (AM biochemical). Ancillary
synthesis reagents, 2'-F and 2'-O-Methyl RNA and deoxy
phosphoramidites are obtained from Thermo-Fisher (Milwaukee, Wis.)
and Hongene (China). 2'F, 2'-O-Methyl, RNA, DNA and other modified
nucleosides are introduced in the sequences using the corresponding
phosphoramidites. Synthesis of 3' GalNAc conjugated single strands
is performed on a GalNAc modified CPG support. Custom CPG universal
solid support is used for the synthesis of antisense single
strands. Coupling time for all phosphoramidites (100 mM in
acetonitrile) is 5 min employing 5-Ethylthio-1H-tetrazole (ETT) as
activator (0.6 M in acetonitrile). Phosphorothioate linkages are
generated using a 50 mM solution of
3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione
(DDTT, obtained from Chemgenes (Wilmington, Mass., USA) in
anhydrous acetonitrile/pyridine (1:1 v/v). Oxidation time was 3
minutes. All sequences are synthesized with final removal of the
DMT group ("DMT off").
[0354] Upon completion of the solid phase synthesis, single strands
are cleaved from the solid support and deprotected in sealed 96
deep well plates using 200 .mu.L Aqueous Methylamine reagent at
60.degree. C. for 20 minutes. For sequences containing 2' ribo
residues (2'-OH) that are protected with tert-butyl dimethyl silyl
(TBDMS) group, a second step deprotection is performed using
TEA.3HF (triethylamine trihydro fluoride) reagent. To the
methylamine deprotection solution, 200 uL of dimethyl sulfoxide
(DMSO) and 300 ul TEA.3HF reagent is added and the solution is
incubated for additional 20 min at 60.degree. C. At the end of
cleavage and deprotection step, the synthesis plate is allowed to
come to room temperature and is precipitated by addition of 1 mL of
acetontile:ethanol mixture (9:1). The plates are cooled at
-80.degree. C. for 2 hrs and the supernatant decanted carefully
with the aid of a multi-channel pipette. The oligonucleotide pellet
is re-suspended in 20 mM NaOAc buffer and is desalted using a 5 mL
HiTrap size exclusion column (GE Healthcare) on an AKTA Purifier
System equipped with an A905 autosampler and a Frac 950 fraction
collector. Desalted samples are collected in 96 well plates.
Samples from each sequence are analyzed by LC-MS to confirm the
identity, UV (260 nm) for quantification and a selected set of
samples by IEX chromatography to determine purity.
[0355] Annealing of Hdlbp/Vigilin single strands is performed on a
Tecan liquid handling robot. Equimolar mixture of sense and
antisense single strands are combined and annealed in 96 well
plates. After combining the complementary single strands, the 96
well plate is sealed tightly and heated in an oven at 100.degree.
C. for 10 minutes and allowed to come slowly to room temperature
over a period 2-3 hours. The concentration of each duplex is
normalized to 10 uM in 1.times.PBS and then submitted for in vitro
screening assays.
In Vitro Screening:
Cell Culture and Transfections:
[0356] Hep3b cells (ATCC, Manassas, Va.) are grown to near
confluence at 37.degree. C. in an atmosphere of 5% CO.sub.2 in
Eagle's Minimum Essential Medium (Gibco) supplemented with 10% FBS
(ATCC) before being released from the plate by trypsinization.
[0357] Primary mouse hepatocytes (PMH) are freshly isolated from a
C57BL/6 female mouse (Charles River Labortories International, Inc.
Willmington, Mass.) less than 1 hour prior to transfections and
grown in primary hepatocyte media. Cells are resuspended at
0.11.times.10.sup.6 cells/ml in InVitroGRO CP Rat (plating) medium
(Celsis In Vitro Technologies, catalog number S01494). During
transfections, cells are plated onto a BD BioCoat 96 well collagen
plate (BD, 356407) at 10,000 cells per well and incubated at
37.degree. C. in an atmosphere of 5% CO.sub.2.
[0358] Transfection is carried out by adding 4.9 .mu.l of Opti-MEM
plus 0.1 .mu.l of Lipofectamine RNAiMax per well (Invitrogen,
Carlsbad Calif. cat #13778-150) to 5 .mu.l of each siRNA duplex to
an individual well in a 384-well plate. The mixture is then
incubated at room temperature for 15 minutes. Forty .mu.l of
William's E Medium (Life Tech) containing about 5,000 Hep3b cells
are then added to the siRNA mixture. Cells are incubated for 24
hours prior to RNA purification.
[0359] Single dose experiments are performed at 10 nM and 0.1 nM
final duplex concentration in Hep3b cells and single dose
experiments are performed at 20 nM final duplex concentration in
PMH.
Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen,
Part #: 610-12):
[0360] RNA is isolated using an automated protocol on a
BioTek-EL406 platform using DYNABEADS (Invitrogen, cat #61012).
Fifty .mu.l of Lysis/Binding Buffer and 25 .mu.l of Lysis Buffer
containing 3 .mu.L of magnetic beads are added to the plate with
cells. Plates are incubated on an electromagnetic shaker for 10
minutes at room temperature and then magnetic beads are captured
and the supernatant is removed. Bead-bound RNA is then washed 2
times with 150 l Wash Buffer A and once with Wash Buffer B. Beads
are then washed with 150 .mu.l Elution Buffer, re-captured and
supernatant is removed.
[0361] cDNA Synthesis Using ABI High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems, Foster City, Calif., Cat
#4368813):
[0362] Ten .mu.l of a master mix containing 1 .mu.l 10.times.
Buffer, 0.4 .mu.l 25.times. dNTPs, 1 .mu.l Random primers, 0.5
.mu.l Reverse Transcriptase, 0.5 .mu.l RNase inhibitor and 6.6
.mu.l of H.sub.2O per reaction are added to RNA isolated per well.
Plates are sealed, mixed and incubated on an electromagnetic shaker
for 10 minutes at room temperature, and then incubated at
37.degree. C. for 2 hours. Plates are then incubated at 81.degree.
C. for 8 minutes.
Real Time PCR:
[0363] Two .mu.l of cDNA are added to a master mix containing 0.5
.mu.l of human GAPDH TaqMan Probe (4326317E), 0.5 .mu.l human
Hdlbp/Vigilin, and 5 .mu.l Lightcycler 480 probe master mix (Roche
Cat #04887301001) per well in a 384 well plates (Roche cat
#04887301001). Real time PCR is done in a LightCycler480 Real Time
PCR system (Roche) using the .DELTA..DELTA.Ct(RQ) assay. Each
duplex is tested in at least two times and data are normalized to
cells transfected with a non-targeting control siRNA.
[0364] To calculate relative fold change, real time data is
analyzed using the .DELTA..DELTA.Ct method and normalized to assays
performed with cells transfected with a non-targeting control
siRNA.
TABLE-US-00002 TABLE 1 Abbreviations of nucleotide monomers used in
nucleic acid sequence representation. It will be understood that
these monomers, when present in an oligonucleotide, are mutually
linked by 5'-3'-phosphodiester bonds. Abbreviation Nucleotide(s) A
Adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs
2'-fluoroadenosine-3'-phosphorothioate As
adenosine-3'-phosphorothioate C cytidine-3'-phosphate Cf
2'-fluorocytidine-3'-phosphate Cfs
2'-fluorocytidine-3'-phosphorothioate Cs
cytidine-3'-phosphorothioate G guanosine-3'-phosphate Gf
2'-fluoroguanosine-3'-phosphate Gfs
2'-fluoroguanosine-3'-phosphorothioate Gs
guanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tf
2'-fluoro-5-methyluridine-3'-phosphate Tfs
2'-fluoro-5-methyluridine-3'-phosphorothioate Ts
5-methyluridine-3'-phosphorothioate U Uridine-3'-phosphate Uf
2'-fluorouridine-3'-phosphate Ufs
2'-fluorouridine-3'-phosphorothioate Us uridine-3'-phosphorothioate
N any nucleotide (G, A, C, T or U) a
2'-O-methyladenosine-3'-phosphate as
2'-O-methyladenosine-3'-phosphorothioate c
2'-O-methylcytidine-3'-phosphate cs
2'-O-methylcytidine-3'-phosphorothioate g
2'-O-methylguanosine-3'-phosphate gs
2'-O-methylguanosine-3'-phosphorothioate t
2'-O-methyl-5-methyluridine-3'-phosphate ts
2'-O-methyl-5-methyluridine-3'-phosphorothioate u
2'-O-methyluridine-3'-phosphate us
2'-O-methyluridine-3'-phosphorothioate s phosphorothioate linkage
L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4- hydroxyprolinol
Hyp-(GalNAc-alkyl)3 dT 2'-deoxythymidine-3'-phosphate dC
2'-deoxycytidine-3'-phosphate P Phosphate VP Vinyl-phosphate
Example 2. Increased Expression of Hdlbp/Vigilin in Hepatic
Steatosis and Regulation of VLDL Secretion Through Modulation of
ApoB mRNA Translation by Hdlbp/Vigilin
Methods and Materials
TABLE-US-00003 [0365] TABLE 2 Hdlbp/Vigilin Modified Sequences
Duplex Name Sense Sequence (5` to 3`) Antisense Sequence (5` to 3`)
GalNAc#1 GfsasGfaUfcAfaCfAfUfuGfaCfc AfuAfaAfL96 (SEQ ID NO: 22)
usUfsuAfuGfgUfcAfaugUfuGfaUfc Ufcsusa (SEQ ID NO: 24) GalNAc#2
AfsgsGfaAfgAfuCfGfGfgCfuUfu AfaGfgAfL96 (SEQ ID NO: 23)
usCfscUfuAfaAfgCfccgAfuCfuUfc Cfusgsc (SEQ ID NO: 25) GalNAc#1
GfsasGfaUfcAfaCfAfUfuGfaCfc AfuAfaAfL96 (SEQ ID NO: 22)
usUfsuAfuGfgUfcAfaugUfuGfaUfc Ufcsusa (SEQ ID NO: 24) GalNAc#2
AfsgsGfaAfgAfuCfGfGfgCfuUfu AfaGfgAfL96 (SEQ ID NO: 23)
usCfscUfuAfaAfgCfccgAfuCfuUfc Cfusgsc (SEQ ID NO: 25)
Animal Experiments
[0366] All animal models shown were male and on a C57BL/6N
background and purchased from Janvier or Charles River. Mice were
housed in a pathogen-free animal facility at the Institute of
Molecular Health Sciences at ETH Zurich. The animals were
maintained in a temperature- and humidity controlled room on a 12 h
light-dark cycle (lights on from 6 a.m. to 6 p.m.). Mice were
either fed a standard laboratory chow, a high fat diet (for DIO
mice; fat, carbohydrate, protein content was 45, 35 and 20 kcal %,
respectively) (Research Diets, D12451) or chow diet AIN76
supplemented with 0.02% cholesterol (Teupser et al., 2003) (for
Ldlr.sup.-/- mice; Ssniff). All animal experiments were approved by
the Kantonale Veterinaramt Zurich.
Adenoviral Infections
[0367] The sequence of V5-tagged hVigilin was cloned into pVQAd CMV
K-NpA (Viraquest) using the restriction sites BamHI and XhoI (NEB).
Ad-CTRL was based on the same vector backbone (including GFP) but
lacked the insert transgene. shRNAs targeting Vigilin were cloned
under a U6 promoter into. All pVQAd plasmids constructs were sent
for adenovirus production to Viraquest Inc., USA. All adenoviruses
expressed GFP from an independent promoter. Mice were administered
adenovirus through a single tail-vein injection of 3.times.10.sup.9
plaque-forming units in a final volume of 0.2 ml diluted in PBS and
sacrificed 7 (for gain of function experiments) or 10 days (for
loss of function experiments) postinjection.
Primary Hepatocytes Isolation
[0368] Primary hepatocytes were isolated as described before (Zhang
et al., 2012) with the following modifications and conditions. Mice
were anesthetized by intraperitoneal injection of 150 .mu.l
pentobarbital (Esconarkon US vet) pre-diluted 1:5 in PBS. The liver
was perfused by cannulation of the hepatic portal vein with the
caudal vena cava as a drain. The liver was perfused with pre-warmed
Hank's Balanced Salt Solution (Life Technologies) containing 0.5 mM
EGTA followed by pre-warmed digestion medium [DMEM 1 g/l glucose
(Life Technologies), 1% Penicillin-Streptomycin (Life
Technologies), 15 mM HEPES (Life Technologies), 30 .mu.g/ml
Liberase.TM. Research Grade medium Thermolysin concentration
(Roche)] each for four minutes with a flow rate of 3 ml min.sup.-1.
The liver was surgically removed, hepatocytes released into 10 ml
digestion media by shaking and supplemented with 15 ml ice cold low
glucose media [DMEM 1 g/l glucose (Life Technologies), 1%
Penicillin-Streptomycin (Life Technologies), 10% heat-inactivated
fetal bovine serum (Sigma), 1% GlutaMax (Life Technologies)] and
filtered through a 100 .mu.m Cell Strainer (BD). The suspension was
then washed three times with 25 ml of ice-cold low glucose media at
50.times.g and 4.degree. C. for 2 min. Hepatocytes were counted and
plated at 4.times.10.sup.6 cells surface-treated P10 plates (BD
Primaria) in low glucose media. 3 hrs after plating, cells were
washed once with PBS and medium was changed to Williams E medium
(or methionine-free DMEM for cell extracts used for in vitro
translation; Life Technologies) supplemented with 1%
Penicillin-Streptomycin (Life Technologies), 1% GlutaMax (Life
Technologies) and harvested 16 hrs (or 2 hrs for in vitro
translation) after medium change. All cells were incubated at
37.degree. C. in a humidified atmosphere containing 5%
CO.sub.2.
Blood Glucose Measurements
[0369] Blood glucose was measured using a Contour glucometer
(Bayer). For intraperitoneal glucose tolerance tests, mice were
fasted for 4 h and then injected with of 2 g/kg body weight
D-glucose in PBS. For intraperitoneal insulin tolerance tests,
animals were injected with 0.75 U/kg body weight of a
5.times.10.sup.-2 U/ml insulin solution in PBS after a 3-h fasting
period.
Blood Plasma Collection and Measurements
[0370] For measuring blood plasma insulin, ALT, triglyceride,
cholesterol and NEFA levels, blood was collected from the
submandibular vein in non-heparinized capillary tubes. EDTA was
added to a final concentration of .about.5 mM as an anti-coagulant.
Plasma was then separated by centrifugation at 8,000.times.g for 4
min. Measurements were performed using commercial kits. Plasma
insulin was measured with the Rat Insulin ELISA Kit (Crystalchem).
Plasma cholesterol (Roche), triglycerides (Roche), NEFA (Wako) and
bile acids (Crystalchem) were measured by colorimetric assays,
according to the manufacturer's instructions.
Antibodies
[0371] The following antibodies were used in immunoblotting: rabbit
anti-Hdlbp/Vigilin (Abcam, #ab109324), mouse anti-.gamma.-Tubulin
(Sigma, #T6557), rabbit anti-Lamin B (Cell Signaling, #9087S),
rabbit anti-Gapdh (Santa Cruz, #2118S), rabbit anti-Rbm47 (abcam,
#ab167164), rabbit anti-HuR (Santa Cruz, #sc-20694), rabbit
anti-Histone H3 (Cell Signaling, #4499S), rabbit anti-ApoB
(Meridian, #K23300R), rabbit anti-ApoA-I (Meridian, #K23500R),
rabbit anti-Fibronectin (Abcam, #ab2413), goat anti-Fetuin-A (Santa
Cruz, #sc-9668), rabbit anti-Alpha-1-Antitrypsin (Proteintech,
#16382-1-AP), rabbit anti-Orosomucoid (Proteintech, #16439-1-AP),
rabbit anti-ApoM (home-made, #aa140-159), goat anti-Albumin
(Bethyl, #A90-134A).
PAR-CLIP in Primary Hepatocytes
[0372] For PAR-CLIP, primary hepatocytes from Ad-hVigilin injected
mice (for overexpression of V5-tagged human Vigilin) were isolated
and supplemented with 100 .mu.M 4SU for 16 hrs prior to
crosslinking. After decanting the growth medium, cells were
irradiated uncovered with 0.15 J/cm.sup.2 of 365 nm UV light.
V5-tagged-hVigilin was immunoprecipitated with a V5 antibody
conjugated to protein G Dynabeads (Life Technologies). The
radiolabeled band corresponding to the 155 kDa hVigilin-RNA complex
was excised and the associated RNA was isolated by
phenol-chloroform extraction following proteinase K treatment,
conversion to a cDNA library, and Illumina sequencing at the
Rockefeller University Genomics Center as described before (Hafner,
2010). Reads were adapter extracted, clipped with length of at
least 20 nts and mapped to the mm10 mouse genome with Bowtie 0.12.9
(Bowtie parameters "-v 1 -m 10 --all --best -strata"), allowing for
one mismatch. Processing and annotation of clusters to the ENCODE
GRCm38 genome annotation was performed using the PARalyzer software
as described in Corcoran et al. (2011)
(http://www.genome.duke.edu/labs/ohler/research/PARalyzer/).
Motif Analysis
[0373] Motif analysis was carried out calculating kmer enrichment
of PAR-CLIP clusters in protein-coding regions over the shuffled
(10,000 times) GRCm38 mouse protein-coding open reading frames.
Shuffled sequences were generated with the HMMER-3.0 suite. The
MEME suite, MEME (http://meme-suite.org/tools/meme) (DREME, 2011),
was used to define the motif of the top 759 protein-coding clusters
(5'UTR, CDS, 3'UTR) as defined by PARalyzer, which had at least 10
reads.
RNA Isolation and Quantification
[0374] RNA was extracted using Trizol (Life Technologies) according
to the manufacturer's instructions, except for a 30 min isopropanol
precipitation at -20.degree. C. RNA integrity was analyzed on an
Agilent 2100 Bioanalyzer for all samples that were sequenced. RNA
was subjected to DNase I treatment with the DNA-free kit
(Invitrogen), when necessary. RNA was reverse transcribed using the
High Capacity cDNA Reverse Transcription Kit (Applied Biosystems).
Quantitative PCR was performed in an LC480 II Lightcycler (Roche)
and using gene specific primers and Sybr Fast 2.times. Universal
Master mix (Kapa). Results were normalized to 36B4 or Actb mRNA
levels.
Illumina RNA Sequencing
[0375] The quality of the isolated RNA was determined with a Qubit
(1.0) Fluorometer (Life Technologies) and a Bioanalyzer 2100
(Agilent). Only those samples with a 260/280 nm ratio between 1.8
and 2.1 and a 28S/18S ratio within 1.5 and 2.0 were further
processed. The TruSeq RNA Sample Prep Kit v2 (Illumina) was used
for cDNA library preparation. Quality and quantity of the enriched
libraries were validated using Qubit (1.0) Fluorometer and the
Caliper GX LabChip GX (Caliper Life Sciences). Libraries were
normalized to 10 nM and sequenced on the Illumina HiSeq 2000 at the
Functional Genomics Center Zurich.
[0376] Data analysis. RNA-sequencing reads were quality checked
with FASTQC, adapter extracted, clipped with minimum size of at
least 20 bases length and aligned against the mouse mm10 genome
using TopHat 2. TopHat 2 was run with default options. On the basis
of these alignments, the distribution of the reads across genomic
features as well as isoform expression was quantified using
Cufflinks2 and with the GENCODE mm10 genome annotation. Ribosome
profiling reads were quality checked with FASTQC and reads with at
least 20 bases, a tail phred quality score greater than 15 and an
overall average phred quality score greater than 20 were selected
and aligned against the mouse mm10 genome with Bowtie2. Downstream
analysis was performed in R.
Western Blot Analysis
[0377] Cells and tissues (using the Tissue Lyser II, Qiagen) were
homogenized with 3 volumes of RIPA lysis buffer [50 mM Tris-HCl pH
8, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS and 1
tablet cOmplete EDTA-free protease inhibitor cocktail (Roche) per
50 ml buffer], incubated for 10 min on ice and centrifuged for 10
min at 20,000.times.g and 4.degree. C. Protein concentrations were
determined using the Bicinchoninic Acid Assay (Sigma-Aldrich).
Equal protein amounts were boiled in Laemmli buffer (1.7% SDS, 5%
glycerol, 0.002% bromophenol blue, 60 mM Tris-HCl pH 6.8, 100 mM
DTT) for 5 min at 95.degree. C., separated by SDS-PAGE and
transferred onto nitrocellulose membranes by electroblotting in a
wet chamber (Bio-Rad). The membranes were blocked for one hour with
5% non-fat dry milk TBS-0.1% Tween (Sigma-Aldrich), incubated with
the primary antibodies overnight at 4.degree. C., followed by
3.times. washes in TBS-0.1% Tween and incubation with a horseradish
peroxidase-conjugated secondary antibodies (Calbiochem) for 2-3
hrs. Blots were then developed by chemiluminescent detection with a
Fujifilm analyzer (LAS-4000) and signals quantified using
ImageJ.
Bacterial Recombinant Protein Expression And Purification
[0378] Three liter cultures of E. coli BL21 (DE3)pLysS competent
cells transformed with the pETM30-Vigilin-His6 (His6 disclosed as
SEQ ID NO: 21) construct were grown at 37.degree. C. and 180 rpm in
Terrific Broth medium containing 75 .mu.g/ml Kanamycin until the
OD600 reached 1.3. The culture was then incubated at 18.degree. C.
for 1 h and protein expression was induced with 0.2 mM
isopropyl-D-thiogalactopyranoside (IPTG). Incubation was then
continued at 18.degree. C. for 12 hrs. Cells were harvested by
centrifugation for 10 min at 6,000.times.g and 4.degree. C. All
subsequent procedures were performed at 4.degree. C. Bacterial
pellets were resuspended in chilled lysis buffer [50 mM Tris-HCl pH
7.5, 150 mM NaCl, 5 mM MgCl2, 10% Glycerol, 1 mM
beta-Mercaptoethanol, 1 mM PMSF, 1 tablet EDTA-free Protease
Inhibitor Cocktail (Roche) per 50 ml, 1 mg/ml Lysozyme ( ), 5
.mu.g/ml DNase (Company)] in a ratio of 1 g cell-wet weight to 1 ml
lysis buffer. The lysates were further sonicated in a pre-chilled
50 ml tube (Falcon) to reduce viscosity [5 sec on, 20 sec off, for
2 min, Amplitude: 28%], and insoluble material was removed by
centrifugation for 30 min at 20,000.times.g. The resulting
supernatant was filtered through 0.45 .mu.m polyethersulfone filter
membranes (Filtropur S 0.45, Sarstedt). The lysate was diluted in
50 ml HisTrap-Buffer [50 mM Tris-HCl pH 7.5, 1 M NaCl, 5 mM MgCl2,
10% Glycerol, 30 mM Imidazole pH 8.5, adjust buffer pH to 7.6 with
HCl conc.] prior to loading onto a 5 ml HisTrapTMHP column (GE
Healthcare Life Science) pre-equilibrated in HisTrap-Buffer and
attached to an AKTA Explorer FPLC. Diluted lysate was passed
through the column at 2 ml/min and then gradually eluted with
increasing concentrations of HisTrap-Buffer containing 500 mM
imidazole, collecting 1-ml-sized fractions. The peak of fractions
containing Vigilin were determined by SDS-PAGE and
Coomassie-staining of the gel (typically at 150-200 mM imidazole).
Vigilin containing fractions were pooled, diluted in 50 ml
Heparin-Buffer [50 mM Tris-HCl pH 7.6, 150 mM NaCl, 5 mM
MgCl.sub.2, 10% Glycerol, adjust buffer pH to 7.6] and loaded on a
5 ml HiTrap.TM. Heparin HP column (GE Healthcare Life Science).
RNA-depleted Vigilin was eluted gradually using increasing
concentrations of Heparin-Buffer containing 2 M NaCl and collected
in 1 ml fractions. Eluate fractions were monitored by SDS-PAGE and
Coomassie staining. Fractions containing Vigilin were pooled and
dialyzed overnight using a 50 kDa MWCO Pur-A-Lyzer.TM.
(Sigma-Aldrich) into storage buffer [20 mM Tris-HCl pH 7.6, 300 mM
KCl, 5 mM MgCl2, 50% glycerol, 1 mM DTT, 1 mM PMSF, 1 tablet
EDTA-free Protease Inhibitor Cocktail (Roche) per 50 ml]. Aliquots
of Vigilin were stored at -80.degree. C. Protein concentrations
were determined by Coomassie staining intensity in comparison to
bovine serum albumin.
Electrophoretic Mobility Shift Assays
[0379] Oligoribonucleotides were labeled with [.gamma.-.sup.32P]ATP
and T4 polynucleotide kinase using standard conditions. A total of
10 nM .sup.32P-labeled RNA was incubated with 0-10 .mu.M protein in
20-.mu.L reactions containing 250 mM KCl, 5 mM MgCl.sub.2, 25 mM
Tris-HCl pH 7.5, 10% glycerol, 1 mg/mL acetylated BSA (Ambion), 1.5
.mu.M of yeast tRNA (Invitrogen). Reactions were incubated at
25.degree. C. for 5 min and separated on 1.2% agarose gel for 1 h
at 130 V at room temperature using 1.times.TBE. Agarose gels were
dried under vacuum gel dryers at 60.degree. C. for 2-3 hrs, exposed
to a phosphoimager screen.
Ribosome Profiling
[0380] Immediately before sample collection, primary hepatocytes
were incubated with media containing 100 .mu.g.times.ml.sup.-1
cycloheximide for 15 min at 37.degree. C. to stop translation
elongation. Cells were washed twice with ice-cold 9.5 mM PBS, pH
7.3, containing 100 .mu.g ml.sup.-1 cycloheximide, and lysed by
adding lysis buffer (10 mM Tris-HCl, pH 7.4, 5 mM MgCl.sub.2, 100
mM KCl, 2 mM dithiothreitol, 100 .mu.g ml.sup.-1 cycloheximide, 1%
Triton X-100, 500 U ml.sup.-1 RNasin Plus, and protease inhibitor
(1.times. complete, EDTA-free, Roche)). Crude lysates were
centrifuged at 1,300 g for 10 min at 4.degree. C. and the
supernatant was transferred to a fresh tube. Ribosome profiling and
RNA-seq were performed on cleared lysates essentially as described
(Guo et al., 2010), using rRNA depleted RNAs with a detailed
protocol available at http://bartellab.wi.mit.edu/protocols.html.
Libraries for Illumina sequencing were prepared using the
NEBNext.RTM. Small RNA Library Prep Set according to the
manufacturer's instructions.
Data Analysis
[0381] Reads were quality-checked with FastQC. Reads at least 20
bases long, with a tail phred quality score greater than 15 and an
overall average phred quality score greater than 20 were aligned to
the reference genome and transcriptome (FASTA and GTF files,
respectively, downloaded from the UCSC, genome build mm10) with
Bowtie2 (Langmead et al., 2012) with default settings for single
end reads. Distribution of the reads across genomic isoform
expression was quantified using the R package GenomicRanges
(Lawrence et al., 2013) from Bioconductor Version 3.0.
Differentially expressed genes were identified using the R package
edgeR (Robinson et al., 2010) from Bioconductor Version 3.0.
Label-Free Mass-Spectrometry
[0382] Medium from primary hepatocytes was collected 24 hrs after
medium change and centrifuged at 14,000.times.g to pellet insoluble
remnants. 60-80 .mu.l supernatants were precipitated with 1 volume
of 20% TCA precipitation and washed twice with cold acetone. Dry
pellets were dissolved in 45 .mu.l buffer (10 mM Tris, 2 mM
CaCl.sub.2, pH 8.2) and trypsinized with 5 .mu.l of 100 ng/.mu.l
trypsin in 10 mM HCl for 30 min at 60.degree. C. Samples were
dried, dissolved in 20 .mu.l 0.1% formic acid and transferred to an
autosampler vial for LC/MS/MS. 2 .mu.l were injected. Label-free
quantification of MS-data was performed by matching raw data to the
Mouse Swiss-Prot database using MaxQuant. Statistical analysis was
then performed using Perseus.
Blood Plasma Fractionation
[0383] Lipoproteins from pooled plasma (200 .mu.l total) were
diluted in 1 mM EDTA-PBS and separated by FPLC using two Superose-6
FPLC columns in series (HR10/30) in 1 mM EDTA-PBS at 0.5 ml/min.
Columns were calibrated using high and low molecular weight
standards (GE Healthcare).
Liver Triglyceride and Cholesterol Content
[0384] Lipids from 50 mg liver were extracted with 1 ml
hexane:isopropanol (3:2) by homogenizing tissues using the tissue
lyzer. Lysates were centrifuged at 20,000.times.g for 3 min and the
supernatant was transferred to a fresh tube. The pellet was
re-extracted with 0.5 ml hexane:isopropanol, spun again and the
supernatants were combined. 0.5 ml of 0.5 M Na.sub.2SO.sub.4
solution was added and the tubes mixed. The samples were
centrifuged for 3 min at full speed and the upper organic phase was
transferred to a fresh tube, avoiding contamination with the
aqueous phase. The samples were spun again and the upper phase was
transferred to a fresh tube and evaporated overnight under the fume
hood. Lipids were dissolved in 1 ml of TritonX-100:methanol:butanol
(1:1:3) mixture. 5 .mu.l were used for lipid quantifications.
Oil Red O Stainings
[0385] Frozen OCT-embedded liver pieces were stained with Oil Red 0
as described before (Mehlem et al., 2013).
In Vitro Translation Assay
[0386] Full-length V5-tagged Fetuin-A and ApoM mRNAs were in vitro
transcribed from pcDNA3.1 vectors using the mMESSAGE mMACHINE kit
(Ambion). mRNAs were utilized for in vitro translation as described
before (Rakotondrafara et al., 2011) in 100 .mu.l reactions using
methionine-free amino acid mix and nuclease treated extracts from
primary hepatocytes isolated from mice injected with Ad-shCTRL or
Ad-shVIG. Proteins were co-translationally radiolabeled by addition
of 50 .mu.Ci [.sup.35S]-methionine (PerkinElmer) to the reaction.
V5-tagged protein products were immunoprecipitated with a
V5-antibody conjugated to protein G Dynabeads (Life Technologies),
washed 10.times. with IP wash buffer [50 mM HEPES-KOH pH 7.5, 500
mM KCl, 0.05% NP-40, 0.5 mM DTT, 1 tablet cOmplete EDTA-free
protease inhibitor cocktail (Roche) per 50 ml] separated by
SDS-PAGE and visualized by autoradiography using x-ray films
(Fuji).
Preparation of Nuclear/Cytoplasmic Extracts
[0387] Primary hepatocytes were permeabilized on ice in hypotonic
lysis buffer [10 mlvi HEPES-KOH, pH 7.5, 1.5 mM MgCl2, 10 mlvi KCl,
0.5 mM EDTA, 0.1% NP-40, 1 mm DTT, 1 tablet cOmplete pProtease
Inhibitor Cocktail] per 50 ml buffer (Roche)] for 30 sec, vortexed
briefly and immediately centrifuged for 30 sec at 8,000.times.g and
4.degree. C. After centrifugation, the supernatants (cytoplasmic
extracts) were collected, and nuclear pellets were washed 8 times
in nuclear wash buffer [50 mM HEPES-KOH pH 7.5, 150 mM KCl, 2 mM
EDTA, 0.5% NP-40, 1 mm DTT, 1 tablet cOmplete pProtease Inhibitor
Cocktail per 50 ml buffer (Roche)] by brief resuspension and
centrifugation at 8,000.times.g for 30 sec. Nuclear pellets were
resuspended in RIPA buffer [50 mM Tris-HCl pH 8, 150 mM NaCl, 1%
NP-40, 0.5% sodium deoxycholate, 0.1% SDS and 1 tablet cOmplete
EDTA-free protease inhibitor cocktail (Roche) per 50 ml
buffer].
Triglyceride Secretion Assay
[0388] Seeded primary mouse hepatocytes extracted from mice
injected with adenovirus were pulsed with 1 mM of prewarmed albumin
bound .sup.14C-palmitic acid for 1 h and then washed 3.times. with
PBS. Williams E medium (Life Technologies) supplemented with 1%
Penicillin-Streptomycin (Life Technologies), 1% GlutaMax (Life
Technologies) was re-added to the cells and harvested 4 hours after
medium change. Incorporation of palmitic acid into triglycerides
and subsequent secretion of radiolabeled triglycerides was
quantified by extraction of the lipid fraction from the medium
followed by liquid scintillation counting.
Quantification of Atherosclerotic Plaques
[0389] Atherosclerosis was quantified in aortic root cross-sections
from fresh-frozen optimal cutting temperature medium (OCT)-embedded
hearts. Serial 10 .mu.m frozen sections of the aortic root were
stained with Oil red 0 and H&E for visualization of
atherosclerotic lesions. Lesion areas were quantified using XY
software. Analysis of the aortic roots was performed blindly
without knowledge of the treatments.
Statistical Analysis
[0390] Numerical values are reported as average.+-.s.d. unless
stated otherwise. No statistical method was used to predetermine
sample size, but sample size was based on preliminary data and
previous publications as well as observed effect sizes. Outliers
that were two standard deviations outside of the mean were
routinely excluded from all analyses. Animals were sex- and
age-matched. Animal studies were performed without blinding of the
investigator. The data was assessed for normal distribution and
similar variance between groups using GraphPad Prism 6.0 if
applicable. Some data sets had a statistical difference in the
variation between groups. If not mentioned otherwise in the figure
legend, statistical significance (*P.ltoreq.0.05, **P.ltoreq.0.01,
***P.ltoreq.0.001) was determined by unpaired two-tailed t-test,
one-way ANOVA (when comparing .gtoreq.3 groups) or two-way ANOVA
(for repeated measurements and time courses) with relevant post hoc
tests (Holm-Sidak for=3 groups and Tukey's for repeated time
measurements and time courses). GraphPad Prism 6.0 software was
used for statistical analysis of all data sets.
Results and Discussion
[0391] The cellular localization of Vigilin in primary hepatocytes
was studied and it was found the predominant localization of
Vigilin is the cytoplasmic fractions (FIG. 1b). To investigate if
Vigilin is deregulated in obese, insulin resistant mice, its
expression in livers of diet induced obese C57Bl/6J (DIO) and ob/ob
mice was measured (FIGS. 2a-c). Hepatic protein levels of Vigilin,
but not those of other RBPs with high expression levels such as
Elavl1/HuR and Rbm47, were markedly increased in obese mice
compared to chow fed control animals (FIG. 1c), while Vigilin mRNA
levels were similar (FIG. 2d). Furthermore, cholesterol,
triglycerides, NEFA and HOMA IR all correlated significantly with
hepatic Vigilin expression (FIGS. 1d, e). Vigilin protein levels
were also measured in liver biopsies of a cohort of 5 healthy, 10
non-alcoholic fatty liver disease (NAFLD) and 10 non-alcoholic
steatohepatitis (NASH) patients. A strong positive correlation was
noted between the subjects' Vigilin expression levels and BMI as
well as liver steatosis (FIG. 1f), concomitant with insulin
resistance as measured by the HOMA IR index (FIG. 1g). Furthermore,
Vigilin levels were highest in liver biopsies of subjects with NASH
(FIG. 1h), indicating that Vigilin's expression may be regulated by
inflammatory mediators.
[0392] To investigate the functional consequence of elevated
Vigilin levels in livers of insulin resistant obese mice, a
recombinant adenovirus expressing human Vigilin (Ad-hVigilin) was
generated. Injection of male C57Bl/6J mice with Ad-hVigilin
resulted in a comparable overexpression as measured in ob/ob mice
of .about.3-fold (FIG. 1i). This gain of function was sufficient to
elevate plasma triglyceride, NEFA, as well as very low density
lipoprotein (VLDL) levels and lower triglyceride content in the
liver, when compared to Ad-GFP infected, age- and weight-matched
control mice (FIGS. 1j-m, FIGS. 2e, f). No changes in the levels of
plasma glucose, insulin, cholesterol and the liver damage marker
alanine transaminase (ALT) were observed (FIGS. 2g-i; FIG. 1l).
These data demonstrate that Vigilin expression is increased in
steatotic livers of insulin resistant subjects and that elevated
hepatic Vigilin levels increase triacylglycerol metabolism/VLDL
secretion from the liver.
[0393] The effect of silencing Vigilin by employing a recombinant
adenovirus expressing an shRNA (Ad-shVIG) targeting Vigilin mRNA
was studied. Injection of Ad-shVIG resulted in a >90% reduction
of Vigilin protein compared to injection of PBS or control
adenovirus expressing a nonfunctional shRNA (Ad-shCTRL) in both
wildtype and DIO mice (FIG. 1n). Knockdown of Vigilin was
restricted to the liver and did not reveal any significant changes
in blood glucose or insulin levels in chow and DIO mice under ad
libitum fed conditions (FIGS. 2j-n). ALT levels as well as
inflammation markers NFkB, IL-6 and TNF.alpha. remained in a normal
range in adenovirus and PBS-injected mice (FIGS. 2o-q). Silencing
of Vigilin in wildtype mice resulted in increased liver
triglycerides and decreased plasma triglycerides and NEFA levels,
whereas knockdown of Vigilin in DIO mice also lowered cholesterol
levels through VLDL and LDLs when compared to Ad-shCTRL injected
control mice (FIGS. 2r-v, FIGS. 1o-r).
[0394] To identify RNA targets of Vigilin, PAR-CLIP in primary
hepatocytes was performed. PAR-CLIP takes advantage of T-to-C
conversions that are created during reverse transcription as a
result of incorporated 4-thiouridine (4SU) being covalently
UV-crosslinked to the RBP (Hafner et al., 2010). Hence, RNA
sequences obtained from PAR-CLIP intrinsically contain the
information of specific crosslinking events and distinguish true
RNA-protein interactions from background RNA. PARalyzer, an
algorithm that calculates the density of T-C conversions in
PAR-CLIP reads, was used to detect binding sites in 2 biological
replicates (Corcoran et al., 2011). Keeping only targets found in
both replicates, Vigilin crosslinked to 867 gene transcripts of
which 793 were mRNAs, corresponding to .about.6% of the murine
liver transcriptome. A total of 1401 binding sites were identified,
1165 of which were in mature mRNAs. Vigilin binding sites
predominantly resided in the open reading frames (ORFs; 956)
comprising RNA recognition elements of CHHC or CHYC sequence
segments (H=A/C/U and Y=C/U; FIGS. 3a-d). Further in silico
analysis of the motif revealed a preferred binding of Vigilin to a
tandem of CHHC or CHYC 4mers spaced by 2, 5 or 8 nt (FIG. 3e). As
the PAR-CLIP protocol involves cleavage of protein-bound RNA
substrates with RNaseT1, an endoribonuclease that specifically
cleaves 3' of G nucleotides, binding sites within G-rich sequence
contexts may be underrepresented (Kishore et al., 2011). T
[0395] The RNA recognition element (RRE) was validated by
electrophoretic mobility shift assays (EMSAs) using recombinant
full-length human Vigilin and synthetic single-stranded RNAs
comprising a panel of 18-nt di- and trinucleotide repeats.
Consistent with the PAR-CLIP derived RRE, RNA shifts were observed
for CU-rich motifs, while insertions of A and G nucleotides
resulted in decreased binding affinity (FIG. 3f; FIG. 4a).
Furthermore, testing RNAs of different lengths, demonstrating that
oligonucleotides of .gtoreq.18 nt were required to observe
RNA-protein shifts, suggesting that, in addition to the RRE, RNA
backbone contacts outside of the RRE were necessary for binding in
vitro (FIG. 4b).
[0396] Notably, mRNA levels of the targets identified by PAR-CLIP
showed no significant variation upon adenovirus-mediated
overexpression or knockdown of Vigilin in the liver (FIGS. 3g, h).
To assess a putative role of Vigilin in translation of its targets,
ribosome profiling was carried out in primary hepatocytes depleted
of Vigilin. Ribosome profiling captured 345 of the identified 793
mRNA targets and 270 non-target mRNAs. Comparison of target to
non-target mRNA read counts revealed substantially reduced ribosome
association upon Vigilin knockdown, substantiating the requirement
of Vigilin for its targets to be efficiently translated (FIG.
3i).
[0397] Strikingly, 82 of the top 100 targets harbored signal
peptides, transmembrane domains or both, indicating a function in
the secretory pathway (FIG. 6a). This function is consistent with
the reported role of the yeast homologue SCP160 (Hirschmann et al.,
2014) but distinct from that of other RBPs recently proposed to
participate in translocation of alternative 3' UTRs to the cell
surface (Berkovits & Mayr, 2015). Overall, 436 of the
.about.2400 liver-expressed secretory pathway proteins (.about.18%)
were captured as targets with .gtoreq.1 T-to-C conversion in both
PAR-CLIP replicates (or 786 as total sum of both replicates;
.about.33%), indicating that only a specific subset of this class
of proteins was targeted by Vigilin. To assess Vigilin-dependent
regulation of these hits on the protein level, the secretome from
the medium of primary hepatocytes infected with Ad-shCTRL or
Ad-shVIG was harvested and label-free quantification by
mass-spectrometry was performed. Significant downregulation of
Vigilin targets identified by PAR-CLIP and Ribosome Profiling in
hepatocytes in which Vigilin was silenced was observed (FIGS. 5a,
b). The strongest regulation of these proteins was found in
PAR-CLIP targets with .gtoreq.250 T-to-C crosslinked reads (FIG.
5c). While reduced protein levels of 5 targets in the medium of
Ad-shVIG treated primary hepatocytes by immunoblotting was
validated, 4 of them were also significantly downregulated in blood
plasma of mice infected with Ad-shVIG, including ApoB, Fetuin-A,
Alpha-1-Antitrypsin and Orosomucoid without significant changes at
the mRNA level (FIG. 5d; FIG. 6b). Since primary hepatocytes were
used as an autonomous ex vivo system to study Vigilin in the liver,
the unchanged blood plasma levels of Fibronectin in mice with
reduced hepatic Vigilin expression is most likely due to
extrahepatic compensation from the reticuloendothelial system. One
target, ApoA1, was neither regulated in primary hepatocytes nor in
vivo.
[0398] ApoB is the core protein of VLDL and LDLs that are produced
and secreted from the liver and supply peripheral tissues with
triglycerides and cholesterol. With one copy per particle, ApoB is
an essential protein for the formation and secretion of VLDLs and
LDLs. Increased plasma VLDL and LDL levels are independent risk
factors for cardiovascular disease with further amplification when
both VLDL and LDL cholesterol are elevated (Ren J et al., 2010).
Fetuin-A is a hepatokine that is positively associated with
diabetes risk in humans (Mori et al., 2006; Stefan et al., 2008)
and inhibits insulin signaling by binding to the insulin receptors
(Auberger et al., 1989; Rauth et al., 1992; Srinivas et al., 1993).
Fetuin-A has also been reported to form a complex with free fatty
acids and to induce inflammatory cytokines from adipose tissue
through the TLR4 pathway (Pal et al., 2012). Increase of both ApoB
and Fetuin-A protein levels were strongly correlated with elevated
expression of Vigilin in DIO and ob/ob mice (FIGS. 6c, d). EMSAs
validated the affinity of Vigilin to their RNA sites identified by
PAR-CLIP, whereas mutation of the RRE and scrambled sequences of
these sites showed decreased or no binding affinity (FIG. 5e). To
rule out elevated ApoB and Fetuin-A degradation upon Vigilin
knockdown, half-lives of these proteins in primary hepatocytes were
monitored upon cycloheximide-mediated translational inhibition.
Half-lives of neither ApoB nor Fetuin-A were changed significantly
(FIGS. 6e, f). To confirm that Vigilin is a key regulator of lipid
secretion in hepatocytes, primary hepatocytes were pulse chased
with .sup.14C-palmitate and secretion of thereby radiolabeled
triglycerides into the medium was measured. While .sup.14C counts
were significantly higher in the medium of primary hepatocytes upon
overexpression, less .sup.14C was detected upon knockdown of
Vigilin (FIG. 5f).
[0399] To test if Vigilin was required for efficient translation of
its targets and reconstructed translation in vitro, using a
cell-free system from liver extracts, using Fetuin-A mRNA as a
model target followed by immunopurification of the translated
protein, in vitro transcribed mRNAs of V5-tagged Fetuin-A and ApoM
(as a non-Vigilin-target) were efficiently translated and purified
under wildtype conditions. However, liver extracts with
shRNA-mediated depletion of Vigilin showed decreased translation of
Fetuin-A, but not ApoM (FIG. 5g). In these extracts, Fetuin-A
production could be rescued by addition of recombinant human
Vigilin. In vitro translation of ApoB was technically not feasible
due to its .about.14 kb long mRNA. These results confirmed that
translation of Vigilin targets, including ApoB and Fetuin-A, was
directly affected by the amount of Vigilin protein present during
translation.
[0400] Since short term silencing of Vigilin revealed decreased de
novo expression of atherogenic proteins (ApoB, Fibronectin),
lowered VLDL, plasma triglyceride and NEFA levels, the long-term
effect of hepatic Vigilin knockdown were evaluated in
atherosclerosis prone Ldlr.sup.-/- mice that were fed a 0.02%
cholesterol enriched diet. Vigilin was silenced in the liver by two
different siRNAs that were chemically modified and covalently
conjugated to multivalent N-acetylgalactosamine (GalNAc), a highly
efficient ligand for clathrin-mediated endocytosis through the
Asialoglycoprotein Receptor (ASGPR). siVIG-GalNAc conjugates
(GalNAc #1 and GalNAc #2), weekly administered subcutaneously for
18 weeks, suppressed hepatic Vigilin by .about.80 and .about.30%,
respectively (FIG. 7a). Knockdown of Vigilin was specific for the
liver and was not observed in other tissues (FIG. 8a). No elevation
of transaminases or other signs of liver toxicity were noted (FIG.
8b). The expression of Vigilin targets in the plasma of
siVIG-GalNAc treated mice was measured by immunoblotting. The
Vigilin targets ApoB, Fetuin-A, Fibronectin, Alpha1-Antitrypsin,
Orosomucoid and the proatherogenic ApoC3 (which remained undetected
in mass-spectrometry) were decreased in siVIG-GalNAc #1 treated
mice compared to control animals with no changes in ApoA-I and ApoM
(FIG. 7b). Plasma cholesterol and triglycerides were decreased in
GalNAc #1 treated mice compared to PBS and GalNAc #2 injected
control animals (FIGS. 7c, d). Furthermore, lipid profiling of
FPLC-separated lipoprotein fractions in plasma of these mice
revealed decreased VLDL and LDL levels (FIGS. 7e, f). Liver
triglyceride and cholesterol content as well as plasma bile acids
were similar in knockdown and control mice (FIGS. 7g-i).
Interestingly, plasma insulin levels were decreased in siVIG-GalNAc
#1 treated mice compared to controls accompanied by lower NEFA
levels (FIGS. 7j, k). Increased insulin sensitivity upon hepatic
knockdown of Vigilin was also demonstrated by an augmented insulin
tolerance test (ITT), while a glucose tolerance test (GTT) revealed
improved glucose clearance following an intraperitoneal glucose
injection (FIGS. 8c, d). Lastly, characterization of
atherosclerosis in mice treated, with siVIG-GalNAc #1 revealed
smaller lesions in H&E- and Oil Red O-stained aortic root
sections (FIGS. 7l, m). Together, these data demonstrate that
long-term knockdown of Vigilin in the liver decreases VLDL and LDL
levels, improves insulin sensitivity and reduces atherosclerotic
plaque formation in mice.
[0401] Combining in vivo gain and loss of function studies with
PAR-CLIP, ribosome profiling and label-free mass-spectrometry
quantification, Vigilin was identified as a translational factor
for mRNAs coding for a subset of proteins of the secretory pathway
by binding to the CHHC motif. Given the potential bias of RNaseT1
recovered binding sites (Kishore et al., 2011), the motif was
validated through EMSAs and it was found Vigilin preferentially
binds to a tandem repeat of CHHC separated by 2-8 nt.
[0402] These data revealed ApoB among the strongest targets of
hepatic Vigilin. As the core protein of VLDL and LDL particles,
ApoB is of paramount importance for maintaining triglyceride
balance within the liver. Although regulation of apoB by
post-translational degradation pathways within the ER, post-ER
(Fisher et al., 2001), and by autophagy (Pan et al., 2008; Qiu et
al., 2011) is well established, translational regulatory mechanisms
that govern ApoB expression are poorly understood (Fisher et al.,
2014). This study demonstrates that Vigilin is a major determinant
of ApoB translation and VLDL secretion by hepatocytes and therefore
a regulator of net triglyceride production and secretion by the
liver. The increased expression of Vigilin in subjects with liver
steatosis may contribute to the overproduction and secretion of
VLDL in obese, insulin resistant subjects (Adiels et al., 2006;
Adiels et al., 2008). Short term and strong (.gtoreq.90%) hepatic
ApoB silencing (using Ad-shVIGILIN) in the liver was accompanied by
mild steatosis, consistent with studies in which apoB was silenced
using shRNAs (Maczuga et al., 2014). Long-term knockdown of Vigilin
via GalNAc-conjugated siRNAs did not result in a steatotic liver.
Protection against hepatic triglyceride accumulation is likely due
to other Vigilin targets and associated mechanisms, such as the
reduction of apoC3, which increases the catabolism of triglyceride
rich particles and lowers plasma triglyceride levels in mice and
humans (Maeda et al., 1994; Ginsberg et al., 1986; Pollin et al.,
2008; The TG and HDL Working Group of the Exome Sequencing Project,
2014). Long term silencing of hepatic Vigilin in Ldlr.sup.-/- mice
was also sufficient to lower VLDL and LDL levels, reduce
atherosclerotic plaque formation and improve glucose tolerance as
well as insulin sensitivity. Knockdown of Vigilin resulted in
substantially decreased protein levels of its targets without
affecting mRNA levels. In contrast, other highly expressed liver
secreted proteins that were not identified as targets in both
PAR-CLIP replicates such as Fetuin-B or the lipoprotein ApoE,
showed no significant perturbation upon Vigilin knockdown, further
substantiating Vigilin's specificity for a distinct subset of
metabolic transcripts. Hence, these findings support the emerging
view of RBPs organizing nascent RNA transcripts into functional
groups that are coordinately regulated, especially at the level of
mRNA stability and translation (Keene, 2007). Combinatorial binding
of additional RBI's to these mRNAs and controlled proteosomal
degradation provides a mechanism for multi-dimensional regulation
of protein fates and explain the general poor correlation between
the mRNA and protein pools in eukaryotic cells (De Sousa et al.,
2009; Vogel et al., 2010; Moore et al., 2005) and the low
susceptibility of some targets towards a Vigilin knockdown ex and
in vivo as observed for ApoA1. Targets that remained unchanged upon
Vigilin silencing is subject to further regulatory mechanisms
controlling their protein levels or be due to secondary effects of
the resulting phenotype. Taken together, this study provides the
first evidence that the mammalian Vigilin is involved in
translational regulation of mRNA targets encoding for proteins of
the secretory pathway, including the atherogenic proteins ApoB,
ApoC3 and Fibronectin as well as the insulin inhibitor Fetuin-A,
and thereby serves as an important regulator of protein production
and secretion from the liver.
Example 3. iRNA Design, Synthesis, Selection, and In Vitro
Evaluation of Additional Agents Targeting Hdlbp/Vigilin
[0403] This Example describes methods for the design, synthesis,
selection, and in vitro evaluation of additional Hdlbp/Vigilin iRNA
agents (see Tables 3 and 4).
Bioinformatics
[0404] A set of siRNAs targeting the human HDLBP, "high density
lipoprotein binding protein" (human: NCBI refseqID NM_005336; NCBI
GeneID: 3069; SEQ ID NO:5) were designed using custom R and Python
scripts. The human NM_005336 REFSEQ mRNA, version 5, has a length
of 6524 bases. The rationale and method for the set of siRNA
designs is as follows: the predicted efficacy for every potential
23mer siRNA from position 10 through the end was determined with a
random forest algorithm derived from the direct measure of mRNA
knockdown from several thousand distinct siRNA designs targeting a
variety of human genes. Subsets of the HDLBP siRNAs were designed
with perfect or near-perfect matches to the human transcript. For
each strand of the siRNA, a custom Python script was used in a
brute force search to measure the number and positions of
mismatches between the siRNA and all potential alignments in the
human transcriptome. Extra weight was given to mismatches in the
seed region, defined here as positions 2-9 of the antisense
oligonucleotide, as well the cleavage site of the siRNA, defined
here as positions 10-11 of the antisense oligonucleotide. The
relative weight of the mismatches was 2.8; 1.2:1 for seed
mismatches, cleavage site, and other positions up through antisense
position 19. Mismatches in the first position were ignored. A
specificity score was calculated for each strand by summing the
value of each weighted mismatch. Preference was given to siRNAs
whose antisense score in human was >=2.2 and predicted efficacy
was >=50% knockdown of the transcript.
In Vitro Screening
[0405] Cell Culture and Transfections
[0406] Hep3B cells (ATCC, Manassas, Va.) were grown to near
confluence at 37.degree. C. in an atmosphere of 5% CO2 in EMEM
(ATCC.RTM. 30-2003.TM.) supplemented with 10% FBS, before being
released from the T-75 flask by trypsinization. The siRNA's against
the target HDLBP were diluted from the original deepwell (DW897 at
10 uM) in two different 96 well duplex plates at 100 nM and 1 nM
stock concentrations using the Janus duplex dilution machine. The
reverse transfection of the siRNA's was performed using
Lipofectamine RNAiMax (Invitrogen, Carlsbad Calif. cat #13778-150).
For each well of a 384 well plate, 5 .mu.l of mixture containing
Opti-MEM (Cat #31985-062) and RNAiMax was added to 5 .mu.l of siRNA
using the viaFlow 384 and allowed to complex at room temperature
for 15 minutes. One duplex is added to 4 wells (A1 of 96 well plate
goes to A1, A2, B1 and B2 of the 384 well plate). The Hep3B cells
were counted on the Vi-cell counter and seeded at 5000 cells/well
in a 384 well cell culture plate containing the mixture to make the
final volume of cell suspension to 50 .mu.L/well. Cells were
incubated the 37.degree. C. incubator with 5% CO2 for 24 hours
before carrying out lysis of cells and isolating RNA. Screen was
performed at 10 nM and 0.1 nM final duplex concentration.
[0407] RNA Isolation, cDNA Synthesis and qPCR
[0408] After the 24 hours, the supernatant was discarded by
inverting the plate over the sink and gently tapping on a paper
towel to dry the remaining of the media from the side of the wells.
Briefly 50 .mu.l of the lysis buffer was added to each well using
viaflo384. The Dynabeads (Lifetech dynabeads oligodt25; Cat #10902D
(SEQ ID NO: 26)) were prepared in the 50 ml falcon tube containing
lysis buffer and 25 .mu.l beads were added to each well using the
viaflo384. The plates were kept on the vibratranslator for 10 mins
and then stacked in the Biotek machine to run program current wash
multiple V6c.LHC.
[0409] cDNA synthesis was performed using the Applied biosystems
high capacity cDNA reverse transcriptase kit (Cat #4368813).
Briefly 12 .mu.l of the cDNA synthesis mix was added to each well
using an integra multichannel pipettor. The plates were sealed and
spun briefly (5-10 secs) and incubated at 37 C for 2 hours. After
the 2 hours incubation, the qPCR assay was ran to screen for
expression of HDLBP gene. Briefly the qPCR master mix was prepared
by adding the probe against HDLBP (Hs00245546_m1) and GAPDH
control. Two .mu.l of the cDNA was added using Viaflo384 into the
qPCR plates to which 8 .mu.l of this mix was added using an integra
multichannel pipettor. The plates were sealed with the PCR film and
ran on Roche Light Cycler.
[0410] Table 5 shows the results of a single dose screen in Hep3B
cells transfected with the indicated iRNAs.
TABLE-US-00004 TABLE 3 Additional HDLBP unmodified sequences SEQ ID
SEQ ID Range in Duplex Name Sense Sequence (5` to 3`) NO Antisense
Sequence (5` to 3`) NO SEQ ID NO: 5 AD-93225 CAUGAGUUCCGUUGCAGUUUU
27 AAAACUGCAACGGAACUCAUGGU 73 373-395 AD-93226
AUGAGUUCCGUUGCAGUUUUA 28 UAAAACUGCAACGGAACUCAUGG 74 374-396
AD-93233 CCGUUGCAGUUUUGACCCAAA 29 UUUGGGUCAAAACUGCAACGGAA 75
381-403 AD-93247 ACCCAAGAGAGUUUUGCUGAA 30 UUCAGCAAAACUCUCUUGGGUCA
76 395-417 AD-93292 CAAAUCAAAGUUGCCACUCUA 31
UAGAGUGGCAACUUUGAUUUGUU 77 440-462 AD-93483 ACAAGCAAAAAUCUGCCUUGA
32 UCAAGGCAGAUUUUUGCUUGUUC 78 670-692 AD-93665
AACACCAUCGCUUUGUUAUUA 33 UAAUAACAAAGCGAUGGUGUUCU 79 852-874
AD-93701 AACUGCAAGACUUGGAGCUAA 34 UUAGCUCCAAGUCUUGCAGUUUC 80
888-910 AD-93718 CUAAAAACUGCAACCAAAAUA 35 UAUUUUGGUUGCAGUUUUUAGCU
81 905-927 AD-93726 UGCAACCAAAAUCCAGAUCCA 36
UGGAUCUGGAUUUUGGUUGCAGU 82 913-935 AD-93974 AUCAAGAAGAUUUAUGAGGAA
37 UUCCUCAUAAAUCUUCUUGAUGC 83 1223-1245 AD-93991
GAAAAAGAAGACUACAACCAU 38 AUGGUUGUAGUCUUCUUUUUCUU 84 1246-1268
AD-93992 AAAAAGAAGACUACAACCAUU 39 AAUGGUUGUAGUCUUCUUUUUCU 85
1247-1269 AD-93993 AAAAGAAGACUACAACCAUUA 40 UAAUGGUUGUAGUCUUCUUUUUC
86 1248-1270 AD-94001 ACUACAACCAUUGCAGUGGAA 41
UUCCACUGCAAUGGUUGUAGUCU 87 1256-1278 AD-94012 UGCAGUGGAAGUGAAGAAAUA
42 UAUUUCUUCACUUCCACUGCAAU 88 1267-1289 AD-94526
GAAGAGCAAUUUGAUCCGCAU 43 AUGCGGAUCAAAUUGCUCUUCUC 89 1801-1823
AD-94608 GGAUCUAAUCAUUGAGCAAAG 44 CUUUGCUCAAUGAUUAGAUCCUU 90
1903-1925 AD-94613 UAAUCAUUGAGCAAAGAUUUA 45 UAAAUCUUUGCUCAAUGAUUAGA
91 1908-1930 AD-94621 GAGCAAAGAUUUCAUCGCACA 46
UGUGCGAUGAAAUCUUUGCUCAA 92 1916-1938 AD-94624 CAAAGAUUUCAUCGCACAAUA
47 UAUUGUGCGAUGAAAUCUUUGCU 93 1919-1941 AD-94710
AAGUGACAUUGUCCAGCUCAA 48 UUGAGCUGGACAAUGUCACUUUU 94 2023-2045
AD-94758 CACAAAAUACAUGCAGAAGAU 49 AUCUUCUGCAUGUAUUUUGUGCA 95
2071-2093 AD-94813 CUGUUCCGAUCUUCAAACAGU 50 ACUGUUUGAAGAUCGGAACAGAA
96 2127-2149 AD-94814 UGUUCCGAUCUUCAAACAGUU 51
AACUGUUUGAAGAUCGGAACAGA 97 2128-2150 AD-94822 UCUUCAAACAGUUUCACAAGA
52 UCUUGUGAAACUGUUUGAAGAUC 98 2136-2158 AD-94823
CUUCAAACAGUUUCACAAGAA 53 UUCUUGUGAAACUGUUUGAAGAU 99 2137-2159
AD-94824 UUCAAACAGUUUCACAAGAAU 54 AUUCUUGUGAAACUGUUUGAAGA 100
2138-2160 AD-94909 CCAGCAGAGAAUAGCAAUUCA 55 UGAAUUGCUAUUCUCUGCUGGAA
101 2225-2247 AD-94915 GAGAAUAGCAAUUCAGAGACA 56
UGUCUCUGAAUUGCUAUUCUCUG 102 2231-2253 AD-94916
AGAAUAGCAAUUCAGAGACCA 57 UGGUCUCUGAAUUGCUAUUCUCU 103 2232-2254
AD-94924 AAUUCAGAGACCAUUAUCAUA 58 UAUGAUAAUGGUCUCUGAAUUGC 104
2240-2262 AD-94926 UUCAGAGACCAUUAUCAUCAA 59 UUGAUGAUAAUGGUCUCUGAAUU
105 2242-2264 AD-94927 UCAGAGACCAUUAUCAUCACA 60
UGUGAUGAUAAUGGUCUCUGAAU 106 2243-2265 AD-94929
AGAGACCAUUAUCAUCACAGA 61 UCUGUGAUGAUAAUGGUCUCUGA 107 2245-2267
AD-95191 CAAACCAAGAGUUUCACUGUU 62 AACAGUGAAACUCUUGGUUUGCU 108
2543-2565 AD-95192 AAACCAAGAGUUUCACUGUUA 63 UAACAGUGAAACUCUUGGUUUGC
109 2544-2566 AD-95197 AAGAGUUUCACUGUUGACAUA 64
UAUGUCAACAGUGAAACUCUUGG 110 2549-2571 AD-95586
CAGAAAUUCCAUCGAUCUGUA 65 UACAGAUCGAUGGAAUUUCUGGG 111 3017-3039
AD-95637 UCAAAUUAAAUUCCCAGACAA 66 UUGUCUGGGAAUUUAAUUUGAAC 112
3088-3110 AD-96564 CCGUAAAUUGUUGACGCUCUU 67 AAGAGCGUCAACAAUUUACGGAG
113 4271-4293 AD-96641 GGUCAUGAGCAUUCGUGCUAA 68
UUAGCACGAAUGCUCAUGACCUU 114 4404-4426 AD-96642
GUCAUGAGCAUUCGUGCUAAA 69 UUUAGCACGAAUGCUCAUGACCU 115 4405-4427
AD-96645 AUGAGCAUUCGUGCUAAGAUA 70 UAUCUUAGCACGAAUGCUCAUGA 116
4408-4430 AD-96648 AGCAUUCGUGCUAAGAUAACA 71 UGUUAUCUUAGCACGAAUGCUCA
117 4411-4433 AD-96653 UCGUGCUAAGAUAACAGACUA 72
UAGUCUGUUAUCUUAGCACGAAU 118 4416-4438
TABLE-US-00005 TABLE 4 Additional HDLBP modified sequences SEQ SEQ
SEQ Duplex ID ID ID Name Sense Sequence (5` to 3`) NO Antisense
Sequence (5` to 3`) NO mRNA Target Sequence NO AD-93225
csasugagUfuCfCfGfuugcaguuuuL96 119
asAfsaacUfgCfAfacggAfaCfucaugsgsu 165 ACCAUGAGUUCCGUUGCAGUUUU 211
AD-93226 asusgaguUfcCfGfUfugcaguuuuaL96 120
usAfsaaaCfuGfCfaacgGfaAfcucausgsg 166 CCAUGAGUUCCGUUGCAGUUUUG 212
AD-93233 cscsguugCfaGfUfUfuugacccaaaL96 121
usUfsuggGfuCfAfaaacUfgCfaacggsasa 167 UUCCGUUGCAGUUUUGACCCAAG 213
AD-93247 ascsccaaGfaGfAfGfuuuugcugaaL96 122
usUfscagCfaAfAfacucUfcUfuggguscsa 168 UGACCCAAGAGAGUUUUGCUGAA 214
AD-93292 csasaaucAfaAfGfUfugccacucuaL96 123
usAfsgagUfgGfCfaacuUfuGfauuugsusu 169 AACAAAUCAAAGUUGCCACUCUA 215
AD-93483 ascsaagcAfaAfAfAfucugccuugaL96 124
usCfsaagGfcAfGfauuuUfuGfcuugususc 170 GAACAAGCAAAAAUCUGCCUUGA 216
AD-93665 asascaccAfuCfGfCfuuuguuauuaL96 125
usAfsauaAfcAfAfagcgAfuGfguguuscsu 171 AGAACACCAUCGCUUUGUUAUUG 217
AD-93701 asascugcAfaGfAfCfuuggagcuaaL96 126
usUfsagcUfcCfAfagucUfuGfcaguususc 172 GAAACUGCAAGACUUGGAGCUAA 218
AD-93718 csusaaaaAfcUfGfCfaaccaaaauaL96 127
usAfsuuuUfgGfUfugcaGfuUfuuuagscsu 173 AGCUAAAAACUGCAACCAAAAUC 219
AD-93726 usgscaacCfaAfAfAfuccagauccaL96 128
usGfsgauCfuGfGfauuuUfgGfuugcasgsu 174 ACUGCAACCAAAAUCCAGAUCCC 220
AD-93974 asuscaagAfaGfAfUfuuaugaggaaL96 129
usUfsccuCfaUfAfaaucUfuCfuugausgsc 175 GCAUCAAGAAGAUUUAUGAGGAG 221
AD-93991 gsasaaaaGfaAfGfAfcuacaaccauL96 130
asUfsgguUfgUfAfgucuUfcUfuuuucsusu 176 AAGAAAAAGAAGACUACAACCAU 222
AD-93992 asasaaagAfaGfAfCfuacaaccauuL96 131
asAfsuggUfuGfUfagucUfuCfuuuuuscsu 177 AGAAAAAGAAGACUACAACCAUU 223
AD-93993 asasaagaAfgAfCfUfacaaccauuaL96 132
usAfsaugGfuUfGfuaguCfuUfcuuuususc 178 GAAAAAGAAGACUACAACCAUUG 224
AD-94001 ascsuacaAfcCfAfUfugcaguggaaL96 133
usUfsccaCfuGfCfaaugGfuUfguaguscsu 179 AGACUACAACCAUUGCAGUGGAA 225
AD-94012 usgscaguGfgAfAfGfugaagaaauaL96 134
usAfsuuuCfuUfCfacuuCfcAfcugcasasu 180 AUUGCAGUGGAAGUGAAGAAAUC 226
AD-94526 gsasagagCfaAfUfUfugauccgcauL96 135
asUfsgcgGfaUfCfaaauUfgCfucuucsusc 181 GAGAAGAGCAAUUUGAUCCGCAU 227
AD-94608 gsgsaucuAfaUfCfAfuugagcaaagL96 136
csUfsuugCfuCfAfaugaUfuAfgauccsusu 182 AAGGAUCUAAUCAUUGAGCAAAG 228
AD-94613 usasaucaUfuGfAfGfcaaagauuuaL96 137
usAfsaauCfuUfUfgcucAfaUfgauuasgsa 183 UCUAAUCAUUGAGCAAAGAUUUC 229
AD-94621 gsasgcaaAfgAfUfUfucaucgcacaL96 138
usGfsugcGfaUfGfaaauCfuUfugcucsasa 184 UUGAGCAAAGAUUUCAUCGCACA 230
AD-94624 csasaagaUfuUfCfAfucgcacaauaL96 139
usAfsuugUfgCfGfaugaAfaUfcuuugscsu 185 AGCAAAGAUUUCAUCGCACAAUC 231
AD-94710 asasgugaCfaUfUfGfuccagcucaaL96 140
usUfsgagCfuGfGfacaaUfgUfcacuususu 186 AAAAGUGACAUUGUCCAGCUCAG 232
AD-94758 csascaaaAfuAfCfAfugcagaagauL96 141
asUfscuuCfuGfCfauguAfuUfuugugscsa 187 UGCACAAAAUACAUGCAGAAGAU 233
AD-94813 csusguucCfgAfUfCfuucaaacaguL96 142
asCfsuguUfuGfAfagauCfgGfaacagsasa 188 UUCUGUUCCGAUCUUCAAACAGU 234
AD-94814 usgsuuccGfaUfCfUfucaaacaguuL96 143
asAfscugUfuUfGfaagaUfcGfgaacasgsa 189 UCUGUUCCGAUCUUCAAACAGUU 235
AD-94822 uscsuucaAfaCfAfGfuuucacaagaL96 144
usCfsuugUfgAfAfacugUfuUfgaagasusc 190 GAUCUUCAAACAGUUUCACAAGA 236
AD-94823 csusucaaAfcAfGfUfuucacaagaaL96 145
usUfscuuGfuGfAfaacuGfuUfugaagsasu 191 AUCUUCAAACAGUUUCACAAGAA 237
AD-94824 ususcaaaCfaGfUfUfucacaagaauL96 146
asUfsucuUfgUfGfaaacUfgUfuugaasgsa 192 UCUUCAAACAGUUUCACAAGAAU 238
AD-94909 cscsagcaGfaGfAfAfuagcaauucaL96 147
usGfsaauUfgCfUfauucUfcUfgcuggsasa 193 UUCCAGCAGAGAAUAGCAAUUCA 239
AD-94915 gsasgaauAfgCfAfAfuucagagacaL96 148
usGfsucuCfuGfAfauugCfuAfuucucsusg 194 CAGAGAAUAGCAAUUCAGAGACC 240
AD-94916 asgsaauaGfcAfAfUfucagagaccaL96 149
usGfsgucUfcUfGfaauuGfcUfauucuscsu 195 AGAGAAUAGCAAUUCAGAGACCA 241
AD-94924 asasuucaGfaGfAfCfcauuaucauaL96 150
usAfsugaUfaAfUfggucUfcUfgaauusgsc 196 GCAAUUCAGAGACCAUUAUCAUC 242
AD-94926 ususcagaGfaCfCfAfuuaucaucaaL96 151
usUfsgauGfaUfAfauggUfcUfcugaasusu 197 AAUUCAGAGACCAUUAUCAUCAC 243
AD-94927 uscsagagAfcCfAfUfuaucaucacaL96 152
usGfsugaUfgAfUfaaugGfuCfucugasasu 198 AUUCAGAGACCAUUAUCAUCACA 244
AD-94929 asgsagacCfaUfUfAfucaucacagaL96 153
usCfsuguGfaUfGfauaaUfgGfucucusgsa 199 UCAGAGACCAUUAUCAUCACAGG 245
AD-95191 csasaaccAfaGfAfGfuuucacuguuL96 154
asAfscagUfgAfAfacucUfuGfguuugscsu 200 AGCAAACCAAGAGUUUCACUGUU 246
AD-95192 asasaccaAfgAfGfUfuucacuguuaL96 155
usAfsacaGfuGfAfaacuCfuUfgguuusgsc 201 GCAAACCAAGAGUUUCACUGUUG 247
AD-95197 asasgaguUfuCfAfCfuguugacauaL96 156
usAfsuguCfaAfCfagugAfaAfcucuusgsg 202 CCAAGAGUUUCACUGUUGACAUC 248
AD-95586 csasgaaaUfuCfCfAfucgaucuguaL96 157
usAfscagAfuCfGfauggAfaUfuucugsgsg 203 CCCAGAAAUUCCAUCGAUCUGUC 249
AD-95637 uscsaaauUfaAfAfUfucccagacaaL96 158
usUfsgucUfgGfGfaauuUfaAfuuugasasc 204 GUUCAAAUUAAAUUCCCAGACAG 250
AD-96564 cscsguaaAfuUfGfUfugacgcucuuL96 159
asAfsgagCfgUfCfaacaAfuUfuacggsasg 205 CUCCGUAAAUUGUUGACGCUCUU 251
AD-96641 gsgsucauGfaGfCfAfuucgugcuaaL96 160
usUfsagcAfcGfAfaugcUfcAfugaccsusu 206 AAGGUCAUGAGCAUUCGUGCUAA 252
AD-96642 gsuscaugAfgCfAfUfucgugcuaaaL96 161
usUfsuagCfaCfGfaaugCfuCfaugacscsu 207 AGGUCAUGAGCAUUCGUGCUAAG 253
AD-96645 asusgagcAfuUfCfGfugcuaagauaL96 162
usAfsucuUfaGfCfacgaAfuGfcucausgsa 208 UCAUGAGCAUUCGUGCUAAGAUA 254
AD-96648 asgscauuCfgUfGfCfuaagauaacaL96 163
usGfsuuaUfcUfUfagcaCfgAfaugcuscsa 209 UGAGCAUUCGUGCUAAGAUAACA 255
AD-96653 uscsgugcUfaAfGfAfuaacagacuaL96 164
usAfsgucUfgUfUfaucuUfaGfcacgasasu 210 AUUCGUGCUAAGAUAACAGACUC
256
TABLE-US-00006 TABLE 5 HDLBP in vito 10 nM and 0.1 nM Screen Duplex
Name 10 nM_Avg 10 nM _SD 0.1 nM_Avg 0.1 nM_SD AD-93225 7.42 0.77
46.76 13.77 AD-93226 7.81 1.60 39.90 8.79 AD-93233 7.11 1.71 38.07
10.35 AD-93247 5.54 0.70 55.64 29.86 AD-93292 11.87 0.79 49.56 4.71
AD-93483 12.52 1.05 116.97 15.10 AD-93665 6.40 0.77 46.90 20.56
AD-93701 6.68 0.70 65.92 5.55 AD-93718 14.58 2.06 104.82 12.89
AD-93726 8.75 1.55 75.18 17.96 AD-93974 7.76 3.66 55.33 12.23
AD-93991 7.57 2.60 66.18 11.90 AD-93992 7.80 0.86 25.08 10.43
AD-93993 10.61 2.71 62.57 28.14 AD-94001 12.28 3.15 60.04 18.55
AD-94012 10.14 3.00 48.34 2.34 AD-94526 9.41 0.63 69.18 9.86
AD-94608 10.72 0.81 101.60 12.29 AD-94613 11.00 1.43 58.18 14.80
AD-94621 10.74 1.08 105.71 12.52 AD-94624 5.39 1.72 26.26 9.85
AD-94710 9.89 1.46 71.01 10.55 AD-94758 8.88 2.93 81.47 7.22
AD-94813 5.68 2.12 41.31 19.27 AD-94814 6.64 1.14 33.57 7.62
AD-94822 7.58 1.51 72.99 17.32 AD-94823 11.56 5.11 68.16 17.23
AD-94824 6.37 0.70 33.58 8.86 AD-94909 7.18 1.57 47.93 8.87
AD-94915 8.45 1.02 81.72 3.88 AD-94916 13.68 3.04 81.34 31.66
AD-94924 5.07 2.27 14.84 7.35 AD-94926 8.42 2.97 40.74 12.46
AD-94927 9.05 1.97 77.95 15.79 AD-94929 12.29 2.45 97.93 26.77
AD-95191 7.45 1.12 49.21 5.60 AD-95192 7.09 0.58 51.36 9.58
AD-95197 6.10 2.35 23.82 9.15 AD-95586 10.53 2.41 86.25 4.60
AD-95637 10.85 1.48 78.48 17.48 AD-96564 6.49 0.78 34.44 14.04
AD-96641 20.01 5.33 119.42 15.36 AD-96642 14.37 1.37 87.12 3.76
AD-96645 13.04 3.42 80.69 10.13 AD-96648 10.01 0.80 66.04 3.34
AD-96653 14.35 1.04 93.18 14.71
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 326 <210> SEQ ID NO 1 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 1 gagaucaaca uugaccauaa a 21
<210> SEQ ID NO 2 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 2 uuuaugguca auguugaucu cua
23 <210> SEQ ID NO 3 <211> LENGTH: 21 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 3 aggaagaucg ggcuuuaagg a 21
<210> SEQ ID NO 4 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 4 uccuuaaagc ccgaucuucc ugc
23 <210> SEQ ID NO 5 <211> LENGTH: 6524 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
5 tttgccaact gcttcctggc tcagtgcgac ctggccttct tcccctcccc catgcggccg
60 gcttccgagt gcgcaagccc agagtcgtcc gcgttgtccg cctctgcgca
agcgccgtgc 120 tcctcccacg gcagttggcc atatagaggc tgggggtggg
gggggaggtc aagcgtagcc 180 tcttctcctt taccaagatg gcggcttgtc
cctgtttcgc cacagttcct accttatgag 240 ctcggttttc ttatgcttat
aagagtggaa cagcaaaagc tggcaggctg acagaggcgg 300 cctcaggacg
gaccttctgg ctactgaccg ttttgctgtg gttttcccgg attgtgtgta 360
ggtgtgagat caaccatgag ttccgttgca gttttgaccc aagagagttt tgctgaacac
420 cgaagtgggc tggttccgca acaaatcaaa gttgccactc taaattcaga
agaggagagc 480 gaccctccaa cctacaagga tgccttccct ccacttcctg
agaaagctgc ttgcctggaa 540 agtgcccagg aacccgctgg agcctggggg
aacaagatcc gacccatcaa ggcttctgtc 600 atcactcagg tgttccatgt
acccctggag gagagaaaat acaaggatat gaaccagttt 660 ggagaaggtg
aacaagcaaa aatctgcctt gagatcatgc agagaactgg tgctcacttg 720
gagctgtctt tggccaaaga ccaaggcctc tccatcatgg tgtcaggaaa gctggatgct
780 gtcatgaaag ctcggaagga cattgttgct agactgcaga ctcaggcctc
agcaactgtt 840 gccattccca aagaacacca tcgctttgtt attggcaaaa
atggagagaa actgcaagac 900 ttggagctaa aaactgcaac caaaatccag
atcccacgcc cagatgaccc cagcaatcag 960 atcaagatca ctggcaccaa
agagggcatc gagaaagctc gccatgaagt cttactcatc 1020 tctgccgagc
aggacaaacg tgctgtggag aggctagaag tagaaaaggc attccacccc 1080
ttcatcgctg ggccgtataa tagactggtt ggcgagatca tgcaggagac aggcacgcgc
1140 atcaacatcc ccccacccag cgtgaaccgg acagagattg tcttcactgg
agagaaggaa 1200 cagttggctc aggctgtggc tcgcatcaag aagatttatg
aggagaagaa aaagaagact 1260 acaaccattg cagtggaagt gaagaaatcc
caacacaagt atgtcattgg gcccaagggc 1320 aattcattgc aggagatcct
tgagagaact ggagtttccg ttgagatccc accctcagac 1380 agcatctctg
agactgtaat acttcgaggc gaacctgaaa agttaggtca ggcgttgact 1440
gaagtctatg ccaaggccaa tagcttcacc gtctcctctg tcgccgcccc ttcctggctt
1500 caccgtttca tcattggcaa gaaagggcag aacctggcca aaatcactca
gcagatgcca 1560 aaggttcaca tcgagttcac agagggcgaa gacaagatca
ccctggaggg ccctacagag 1620 gatgtcaatg tggcccagga acagatagaa
ggcatggtca aagatttgat taaccggatg 1680 gactatgtgg agatcaacat
cgaccacaag ttccacaggc acctcattgg gaagagcggt 1740 gccaacataa
acagaatcaa agaccagtac aaggtgtccg tgcgcatccc tcctgacagt 1800
gagaagagca atttgatccg catcgagggg gacccacagg gcgtgcagca ggccaagcga
1860 gagctgctgg agcttgcatc tcgcatggaa aatgagcgta ccaaggatct
aatcattgag 1920 caaagatttc atcgcacaat cattgggcag aagggtgaac
ggatccgtga aattcgtgac 1980 aaattcccag aggtcatcat taactttcca
gacccagcac aaaaaagtga cattgtccag 2040 ctcagaggac ctaagaatga
ggtggaaaaa tgcacaaaat acatgcagaa gatggtggca 2100 gatctggtgg
aaaatagcta ttcaatttct gttccgatct tcaaacagtt tcacaagaat 2160
atcattggga aaggaggcgc aaacattaaa aagattcgtg aagaaagcaa caccaaaatc
2220 gaccttccag cagagaatag caattcagag accattatca tcacaggcaa
gcgagccaac 2280 tgcgaagctg cccggagcag gattctgtct attcagaaag
acctggccaa catagccgag 2340 gtagaggtct ccatccctgc caagctgcac
aactccctca ttggcaccaa gggccgtctg 2400 atccgctcca tcatggagga
gtgcggcggg gtccacattc actttcccgt ggaaggttca 2460 ggaagcgaca
ccgttgttat caggggccct tcctcggatg tggagaaggc caagaagcag 2520
ctcctgcatc tggcggagga gaagcaaacc aagagtttca ctgttgacat ccgcgccaag
2580 ccagaatacc acaaattcct catcggcaag gggggcggca aaattcgcaa
ggtgcgcgac 2640 agcactggag cacgtgtcat cttccctgcg gctgaggaca
aggaccagga cctgatcacc 2700 atcattggaa aggaggacgc cgtccgagag
gcacagaagg agctggaggc cttgatccaa 2760 aacctggata atgtggtgga
agactccatg ctggtggacc ccaagcacca ccgccacttc 2820 gtcatccgca
gaggccaggt cttgcgggag attgctgaag agtatggcgg ggtgatggtc 2880
agcttcccac gctctggcac acagagcgac aaagtcaccc tcaagggcgc caaggactgt
2940 gtggaggcag ccaagaaacg cattcaggag atcattgagg acctggaagc
tcaggtgaca 3000 ttagaatgtg ctatacccca gaaattccat cgatctgtca
tgggccccaa aggttccaga 3060 atccagcaga ttactcggga tttcagtgtt
caaattaaat tcccagacag agaggagaac 3120 gcagttcaca gtacagagcc
agttgtccag gagaatgggg acgaagctgg ggaggggaga 3180 gaggctaaag
attgtgaccc cggctctcca aggaggtgtg acatcatcat catctctggc 3240
cggaaagaaa agtgtgaggc tgccaaggaa gctctggagg cattggttcc tgtcaccatt
3300 gaagtagagg tgccctttga ccttcaccgt tacgttattg ggcagaaagg
aagtgggatc 3360 cgcaagatga tggatgagtt tgaggtgaac atacatgtcc
cggcacctga gctgcagtct 3420 gacatcatcg ccatcacggg cctcgctgca
aatttggacc gggccaaggc tggactgctg 3480 gagcgtgtga aggagctaca
ggccgagcag gaggaccggg ctttaaggag ttttaagctg 3540 agtgtcactg
tagaccccaa ataccatccc aagattatcg ggagaaaggg ggcagtaatt 3600
acccaaatcc ggttggagca tgacgtgaac atccagtttc ctgataagga cgatgggaac
3660 cagccccagg accaaattac catcacaggg tacgaaaaga acacagaagc
tgccagggat 3720 gctatactga gaattgtggg tgaacttgag cagatggttt
ctgaggacgt cccgctggac 3780 caccgcgttc acgcccgcat cattggtgcc
cgcggcaaag ccattcgcaa aatcatggac 3840 gaattcaagg tggacattcg
cttcccacag agcggagccc cagaccccaa ctgcgtcact 3900 gtgacggggc
tcccagagaa tgtggaggaa gccatcgacc acatcctcaa tctggaggag 3960
gaatacctag ctgacgtggt ggacagtgag gcgctgcagg tatacatgaa acccccagca
4020 cacgaagagg ccaaggcacc ttccagaggc tttgtggtgc gggacgcacc
ctggaccgcc 4080 agcagcagtg agaaggctcc tgacatgagc agctctgagg
aatttcccag ctttggggct 4140 caggtggctc ccaagaccct cccttggggc
cccaaacgat aatgatcaaa aagaacagaa 4200 ccctctccag cctgctgacc
caaacccaac cacacaatgg tttgtctcaa tctgacccag 4260 cggctggacc
ctccgtaaat tgttgacgct cttccccctt cccgaggtcc cgcagggagc 4320
ctagcgcctg gctgtgtgtg cggccgctcc tccaggcctg gccgtgcccg ctcaggacct
4380 gctccactgt ttaacactaa accaaggtca tgagcattcg tgctaagata
acagactcca 4440 gctcctggtc cacccggcat gtcagtcagc actctggcct
tcatcacgag agctccgcag 4500 ccgtggctag gattccactt cctgtgtcat
gacctcagga aataaacgtc cttgacttta 4560 taaaagccaa acgtttgccc
tcttcctttc ccacctccct cctgccagtt tcccttggtc 4620 cagacagtcc
tgtttgtgga gtgcaatcag cctcctccag ctgccagagc gcctcagcac 4680
aggtgtcagg gtgcaaggaa gacctggcaa tggacagcag gaggcaggtt cctggagctg
4740 gggggtgacc tgagaggcag agggtgacgg gttctcaggc agtcctgatt
ttacctgccg 4800 tggggtctga aagcaccaag ggtccctgcc cctacctcca
ctgccagacc ctcagcctga 4860 ggtctggtga gtggagcctg gaggcaaggt
ggtaggcacc atctgggtcc cctgtggccg 4920 tcacagtgtc tgctgtgatt
gagatgcgca caggttgggg gaggtagggc cttacgcttg 4980 tcctcagtgg
gggcagtttg ccttagatga cagctgggct cttcttcaca ccacctgcag 5040
cccctccctg cccctgccct agctgctgtg tgttcagttg ccttctttct acctcagccg
5100 gcgtggagtg gtctctgtgc agttagtgcc accccacaca cccgtctctt
gattgagatg 5160 tttctggtgg ttatgggttt cccgtggagc tgggggtggg
cgccgtgtac ctaagctgga 5220 ggctggcgct ctccctcagc acaggtgggt
cagtggccag caggcccatc tggagtggga 5280 gtgggcactt ccaccccgcc
cacaggccat ccggctgtgc aggccagccc ctaggagcag 5340 gtcccgggtg
actggcagtt ttcacggtct agggccgaga cgatggcatg gggcctagag 5400
catgaggtag agcagaatgc agaccacgcc gctggatgcc gagagaccct gctctccgag
5460 ggaggcatct gtgtcatgct gtgagggctg aggacggggc cctagtctct
ggttttctgg 5520 tcttaacatc cttatctgtg tccgccacgg aggtgactga
gctgctagcg agttgtcctg 5580 tcccaggtac ttgagttttg gaaaagctga
ctcacgccca tccatctcac agcccttccc 5640 tggggacagt cgcttccgcc
ttgacacctc actctcagtt gaataactca agcttggtca 5700 tcttcagact
cgaattcttg agtagaccca gacggcttag cccaagtcta gttgcagctg 5760
cctcggcaag tccccatttg ctcaggcagc cctgaatggg cctgtttaca ggaatggtaa
5820 attgggattg gaaggaatat agcttccagc ttcataggct agggtgacca
cggcttagga 5880 aacagggaaa gaaagcaagg cccttttcct gcctttcccg
ggatctgtct actccacctc 5940 cacgggggag gccagtgggg aagggctgtc
acctcttccc catctgcatg agttctggaa 6000 ctctgtcctg ttggctgctt
gcttccagct ccccccaatc tccatcgcag cgggttcctc 6060 ctgtcttttc
tacagtgtca taaaacatcc tgcccctacc ctctcccaaa ggtcaatttt 6120
aattctcacc aagttttgca catctctgta tgtcgcttga tgtcttagac gcgagccctt
6180 tcctaaactg ttcagcgctc tcttttcctt tgggtggttg ttgcaagggt
gatgacatga 6240 ctgtccccag gcctgtctcc ctgaagcgtc tgtgctgtca
ggacagccct gggcagagat 6300 gaggcagggg tgaggcgtgc gtgtgctttt
cctccttgtt ggatgtcttc catatcatct 6360 gtttccatag ctacaatcca
tcccttggcc ttaactttgg aatttggaga ttatatgcaa 6420 acatgtgtaa
aggctcatga atatggatga cactggaatt ttataaattc taaaataaaa 6480
cccgaaacca gatgtagcat gctgggactc attttgtcaa aaaa 6524 <210>
SEQ ID NO 6 <211> LENGTH: 6377 <212> TYPE: DNA
<213> ORGANISM: Homo sapiens <400> SEQUENCE: 6
aggcgggatt gggccgccgc cctatatagc agccggggcc cgggcgccgc gcctcggagc
60 gtcccggctt ctcccgcgcg gggggcgagt aagccagcgg caggaccagc
gggcgggggc 120 ccacgacaaa agctggcagg ctgacagagg cggcctcagg
acggaccttc tggctactga 180 ccgttttgct gtggttttcc cggattgtgt
gtaggtgtga gatcaaccat gagttccgtt 240 gcagttttga cccaagagag
ttttgctgaa caccgaagtg ggctggttcc gcaacaaatc 300 aaagttgcca
ctctaaattc agaagaggag agcgaccctc caacctacaa ggatgccttc 360
cctccacttc ctgagaaagc tgcttgcctg gaaagtgccc aggaacccgc tggagcctgg
420 gggaacaaga tccgacccat caaggcttct gtcatcactc aggtgttcca
tgtacccctg 480 gaggagagaa aatacaagga tatgaaccag tttggagaag
gtgaacaagc aaaaatctgc 540 cttgagatca tgcagagaac tggtgctcac
ttggagctgt ctttggccaa agaccaaggc 600 ctctccatca tggtgtcagg
aaagctggat gctgtcatga aagctcggaa ggacattgtt 660 gctagactgc
agactcaggc ctcagcaact gttgccattc ccaaagaaca ccatcgcttt 720
gttattggca aaaatggaga gaaactgcaa gacttggagc taaaaactgc aaccaaaatc
780 cagatcccac gcccagatga ccccagcaat cagatcaaga tcactggcac
caaagagggc 840 atcgagaaag ctcgccatga agtcttactc atctctgccg
agcaggacaa acgtgctgtg 900 gagaggctag aagtagaaaa ggcattccac
cccttcatcg ctgggccgta taatagactg 960 gttggcgaga tcatgcagga
gacaggcacg cgcatcaaca tccccccacc cagcgtgaac 1020 cggacagaga
ttgtcttcac tggagagaag gaacagttgg ctcaggctgt ggctcgcatc 1080
aagaagattt atgaggagaa gaaaaagaag actacaacca ttgcagtgga agtgaagaaa
1140 tcccaacaca agtatgtcat tgggcccaag ggcaattcat tgcaggagat
ccttgagaga 1200 actggagttt ccgttgagat cccaccctca gacagcatct
ctgagactgt aatacttcga 1260 ggcgaacctg aaaagttagg tcaggcgttg
actgaagtct atgccaaggc caatagcttc 1320 accgtctcct ctgtcgccgc
cccttcctgg cttcaccgtt tcatcattgg caagaaaggg 1380 cagaacctgg
ccaaaatcac tcagcagatg ccaaaggttc acatcgagtt cacagagggc 1440
gaagacaaga tcaccctgga gggccctaca gaggatgtca atgtggccca ggaacagata
1500 gaaggcatgg tcaaagattt gattaaccgg atggactatg tggagatcaa
catcgaccac 1560 aagttccaca ggcacctcat tgggaagagc ggtgccaaca
taaacagaat caaagaccag 1620 tacaaggtgt ccgtgcgcat ccctcctgac
agtgagaaga gcaatttgat ccgcatcgag 1680 ggggacccac agggcgtgca
gcaggccaag cgagagctgc tggagcttgc atctcgcatg 1740 gaaaatgagc
gtaccaagga tctaatcatt gagcaaagat ttcatcgcac aatcattggg 1800
cagaagggtg aacggatccg tgaaattcgt gacaaattcc cagaggtcat cattaacttt
1860 ccagacccag cacaaaaaag tgacattgtc cagctcagag gacctaagaa
tgaggtggaa 1920 aaatgcacaa aatacatgca gaagatggtg gcagatctgg
tggaaaatag ctattcaatt 1980 tctgttccga tcttcaaaca gtttcacaag
aatatcattg ggaaaggagg cgcaaacatt 2040 aaaaagattc gtgaagaaag
caacaccaaa atcgaccttc cagcagagaa tagcaattca 2100 gagaccatta
tcatcacagg caagcgagcc aactgcgaag ctgcccggag caggattctg 2160
tctattcaga aagacctggc caacatagcc gaggtagagg tctccatccc tgccaagctg
2220 cacaactccc tcattggcac caagggccgt ctgatccgct ccatcatgga
ggagtgcggc 2280 ggggtccaca ttcactttcc cgtggaaggt tcaggaagcg
acaccgttgt tatcaggggc 2340 ccttcctcgg atgtggagaa ggccaagaag
cagctcctgc atctggcgga ggagaagcaa 2400 accaagagtt tcactgttga
catccgcgcc aagccagaat accacaaatt cctcatcggc 2460 aaggggggcg
gcaaaattcg caaggtgcgc gacagcactg gagcacgtgt catcttccct 2520
gcggctgagg acaaggacca ggacctgatc accatcattg gaaaggagga cgccgtccga
2580 gaggcacaga aggagctgga ggccttgatc caaaacctgg ataatgtggt
ggaagactcc 2640 atgctggtgg accccaagca ccaccgccac ttcgtcatcc
gcagaggcca ggtcttgcgg 2700 gagattgctg aagagtatgg cggggtgatg
gtcagcttcc cacgctctgg cacacagagc 2760 gacaaagtca ccctcaaggg
cgccaaggac tgtgtggagg cagccaagaa acgcattcag 2820 gagatcattg
aggacctgga agctcaggtg acattagaat gtgctatacc ccagaaattc 2880
catcgatctg tcatgggccc caaaggttcc agaatccagc agattactcg ggatttcagt
2940 gttcaaatta aattcccaga cagagaggag aacgcagttc acagtacaga
gccagttgtc 3000 caggagaatg gggacgaagc tggggagggg agagaggcta
aagattgtga ccccggctct 3060 ccaaggaggt gtgacatcat catcatctct
ggccggaaag aaaagtgtga ggctgccaag 3120 gaagctctgg aggcattggt
tcctgtcacc attgaagtag aggtgccctt tgaccttcac 3180 cgttacgtta
ttgggcagaa aggaagtggg atccgcaaga tgatggatga gtttgaggtg 3240
aacatacatg tcccggcacc tgagctgcag tctgacatca tcgccatcac gggcctcgct
3300 gcaaatttgg accgggccaa ggctggactg ctggagcgtg tgaaggagct
acaggccgag 3360 caggaggacc gggctttaag gagttttaag ctgagtgtca
ctgtagaccc caaataccat 3420 cccaagatta tcgggagaaa gggggcagta
attacccaaa tccggttgga gcatgacgtg 3480 aacatccagt ttcctgataa
ggacgatggg aaccagcccc aggaccaaat taccatcaca 3540 gggtacgaaa
agaacacaga agctgccagg gatgctatac tgagaattgt gggtgaactt 3600
gagcagatgg tttctgagga cgtcccgctg gaccaccgcg ttcacgcccg catcattggt
3660 gcccgcggca aagccattcg caaaatcatg gacgaattca aggtggacat
tcgcttccca 3720 cagagcggag ccccagaccc caactgcgtc actgtgacgg
ggctcccaga gaatgtggag 3780 gaagccatcg accacatcct caatctggag
gaggaatacc tagctgacgt ggtggacagt 3840 gaggcgctgc aggtatacat
gaaaccccca gcacacgaag aggccaaggc accttccaga 3900 ggctttgtgg
tgcgggacgc accctggacc gccagcagca gtgagaaggc tcctgacatg 3960
agcagctctg aggaatttcc cagctttggg gctcaggtgg ctcccaagac cctcccttgg
4020 ggccccaaac gataatgatc aaaaagaaca gaaccctctc cagcctgctg
acccaaaccc 4080 aaccacacaa tggtttgtct caatctgacc cagcggctgg
accctccgta aattgttgac 4140 gctcttcccc cttcccgagg tcccgcaggg
agcctagcgc ctggctgtgt gtgcggccgc 4200 tcctccaggc ctggccgtgc
ccgctcagga cctgctccac tgtttaacac taaaccaagg 4260 tcatgagcat
tcgtgctaag ataacagact ccagctcctg gtccacccgg catgtcagtc 4320
agcactctgg ccttcatcac gagagctccg cagccgtggc taggattcca cttcctgtgt
4380 catgacctca ggaaataaac gtccttgact ttataaaagc caaacgtttg
ccctcttcct 4440 ttcccacctc cctcctgcca gtttcccttg gtccagacag
tcctgtttgt ggagtgcaat 4500 cagcctcctc cagctgccag agcgcctcag
cacaggtgtc agggtgcaag gaagacctgg 4560 caatggacag caggaggcag
gttcctggag ctggggggtg acctgagagg cagagggtga 4620 cgggttctca
ggcagtcctg attttacctg ccgtggggtc tgaaagcacc aagggtccct 4680
gcccctacct ccactgccag accctcagcc tgaggtctgg tgagtggagc ctggaggcaa
4740 ggtggtaggc accatctggg tcccctgtgg ccgtcacagt gtctgctgtg
attgagatgc 4800 gcacaggttg ggggaggtag ggccttacgc ttgtcctcag
tgggggcagt ttgccttaga 4860 tgacagctgg gctcttcttc acaccacctg
cagcccctcc ctgcccctgc cctagctgct 4920 gtgtgttcag ttgccttctt
tctacctcag ccggcgtgga gtggtctctg tgcagttagt 4980 gccaccccac
acacccgtct cttgattgag atgtttctgg tggttatggg tttcccgtgg 5040
agctgggggt gggcgccgtg tacctaagct ggaggctggc gctctccctc agcacaggtg
5100 ggtcagtggc cagcaggccc atctggagtg ggagtgggca cttccacccc
gcccacaggc 5160 catccggctg tgcaggccag cccctaggag caggtcccgg
gtgactggca gttttcacgg 5220 tctagggccg agacgatggc atggggccta
gagcatgagg tagagcagaa tgcagaccac 5280 gccgctggat gccgagagac
cctgctctcc gagggaggca tctgtgtcat gctgtgaggg 5340 ctgaggacgg
ggccctagtc tctggttttc tggtcttaac atccttatct gtgtccgcca 5400
cggaggtgac tgagctgcta gcgagttgtc ctgtcccagg tacttgagtt ttggaaaagc
5460 tgactcacgc ccatccatct cacagccctt ccctggggac agtcgcttcc
gccttgacac 5520 ctcactctca gttgaataac tcaagcttgg tcatcttcag
actcgaattc ttgagtagac 5580 ccagacggct tagcccaagt ctagttgcag
ctgcctcggc aagtccccat ttgctcaggc 5640 agccctgaat gggcctgttt
acaggaatgg taaattggga ttggaaggaa tatagcttcc 5700 agcttcatag
gctagggtga ccacggctta ggaaacaggg aaagaaagca aggccctttt 5760
cctgcctttc ccgggatctg tctactccac ctccacgggg gaggccagtg gggaagggct
5820 gtcacctctt ccccatctgc atgagttctg gaactctgtc ctgttggctg
cttgcttcca 5880 gctcccccca atctccatcg cagcgggttc ctcctgtctt
ttctacagtg tcataaaaca 5940 tcctgcccct accctctccc aaaggtcaat
tttaattctc accaagtttt gcacatctct 6000 gtatgtcgct tgatgtctta
gacgcgagcc ctttcctaaa ctgttcagcg ctctcttttc 6060 ctttgggtgg
ttgttgcaag ggtgatgaca tgactgtccc caggcctgtc tccctgaagc 6120
gtctgtgctg tcaggacagc cctgggcaga gatgaggcag gggtgaggcg tgcgtgtgct
6180 tttcctcctt gttggatgtc ttccatatca tctgtttcca tagctacaat
ccatcccttg 6240 gccttaactt tggaatttgg agattatatg caaacatgtg
taaaggctca tgaatatgga 6300 tgacactgga attttataaa ttctaaaata
aaacccgaaa ccagatgtag catgctggga 6360 ctcattttgt caaaaaa 6377
<210> SEQ ID NO 7 <211> LENGTH: 6301 <212> TYPE:
DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 7
aggcgggatt gggccgccgc cctatatagc agccggggcc cgggcgccgc gcctcggagc
60 gtcccggctt ctcccgcgcg gggggcgagt aagccagcgg caggaccagc
gggcgggggc 120 ccacgacaaa agctggcagg ctgacagagg cggcctcagg
acggaccttc tggctactga 180 ccgttttgct gctaccactt ataaccacct
ggttaagtcg agatttggag gtggtttagt 240 ttggggcctg gatgcacctt
gcagagagag accgctggct ttttgtagca actgtcatga 300 tgcattttgt
aagcattaag agtggttttc ccggattgtg tgtaggtgtg agatcaacca 360
tgagttccgt tgcagttttg acccaagaga gttttgctga acaccgaagt gggctggttc
420 cgcaacaaat caaagttgcc actctaaatt cagaagagga gagcgaccct
ccaacctaca 480 aggatgcctt ccctccactt cctgagaaag ctgcttgcct
ggaaagtgcc caggaacccg 540 ctggagcctg ggggaacaag atccgaccca
tcaaggcttc tgtcatcact caggtgttcc 600 atgtacccct ggaggagaga
aaatacaagg atatgaacca gtttggagaa ggtgaacaag 660 caaaaatctg
ccttgagatc atgcagagaa ctggtgctca cttggagctg tctttggcca 720
aagaccaagg cctctccatc atggtgtcag gaaagctgga tgctgtcatg aaagctcgga
780 aggacattgt tgctagactg cagactcagg cctcagcaac tgttgccatt
cccaaagaac 840 accatcgctt tgttattggc aaaaatggag agaaactgca
agacttggag ctaaaaactg 900 caaccaaaat ccagatccca cgcccagatg
accccagcaa tcagatcaag atcactggca 960 ccaaagaggg catcgagaaa
gctcgccatg aagtcttact catctctgcc gagcaggaca 1020 aacgtgctgt
ggagaggcta gaagtagaaa aggcattcca ccccttcatc gctgggccgt 1080
ataatagact ggttggcgag atcatgcagg agacaggcac gcgcatcaac atccccccac
1140 ccagcgtgaa ccggacagag attgtcttca ctggagagaa ggaacagttg
gctcaggctg 1200 tggctcgcat caagaagatt tatgaggaga aggccaatag
cttcaccgtc tcctctgtcg 1260 ccgccccttc ctggcttcac cgtttcatca
ttggcaagaa agggcagaac ctggccaaaa 1320 tcactcagca gatgccaaag
gttcacatcg agttcacaga gggcgaagac aagatcaccc 1380 tggagggccc
tacagaggat gtcaatgtgg cccaggaaca gatagaaggc atggtcaaag 1440
atttgattaa ccggatggac tatgtggaga tcaacatcga ccacaagttc cacaggcacc
1500 tcattgggaa gagcggtgcc aacataaaca gaatcaaaga ccagtacaag
gtgtccgtgc 1560 gcatccctcc tgacagtgag aagagcaatt tgatccgcat
cgagggggac ccacagggcg 1620 tgcagcaggc caagcgagag ctgctggagc
ttgcatctcg catggaaaat gagcgtacca 1680 aggatctaat cattgagcaa
agatttcatc gcacaatcat tgggcagaag ggtgaacgga 1740 tccgtgaaat
tcgtgacaaa ttcccagagg tcatcattaa ctttccagac ccagcacaaa 1800
aaagtgacat tgtccagctc agaggaccta agaatgaggt ggaaaaatgc acaaaataca
1860 tgcagaagat ggtggcagat ctggtggaaa atagctattc aatttctgtt
ccgatcttca 1920 aacagtttca caagaatatc attgggaaag gaggcgcaaa
cattaaaaag attcgtgaag 1980 aaagcaacac caaaatcgac cttccagcag
agaatagcaa ttcagagacc attatcatca 2040 caggcaagcg agccaactgc
gaagctgccc ggagcaggat tctgtctatt cagaaagacc 2100 tggccaacat
agccgaggta gaggtctcca tccctgccaa gctgcacaac tccctcattg 2160
gcaccaaggg ccgtctgatc cgctccatca tggaggagtg cggcggggtc cacattcact
2220 ttcccgtgga aggttcagga agcgacaccg ttgttatcag gggcccttcc
tcggatgtgg 2280 agaaggccaa gaagcagctc ctgcatctgg cggaggagaa
gcaaaccaag agtttcactg 2340 ttgacatccg cgccaagcca gaataccaca
aattcctcat cggcaagggg ggcggcaaaa 2400 ttcgcaaggt gcgcgacagc
actggagcac gtgtcatctt ccctgcggct gaggacaagg 2460 accaggacct
gatcaccatc attggaaagg aggacgccgt ccgagaggca cagaaggagc 2520
tggaggcctt gatccaaaac ctggataatg tggtggaaga ctccatgctg gtggacccca
2580 agcaccaccg ccacttcgtc atccgcagag gccaggtctt gcgggagatt
gctgaagagt 2640 atggcggggt gatggtcagc ttcccacgct ctggcacaca
gagcgacaaa gtcaccctca 2700 agggcgccaa ggactgtgtg gaggcagcca
agaaacgcat tcaggagatc attgaggacc 2760 tggaagctca ggtgacatta
gaatgtgcta taccccagaa attccatcga tctgtcatgg 2820 gccccaaagg
ttccagaatc cagcagatta ctcgggattt cagtgttcaa attaaattcc 2880
cagacagaga ggagaacgca gttcacagta cagagccagt tgtccaggag aatggggacg
2940 aagctgggga ggggagagag gctaaagatt gtgaccccgg ctctccaagg
aggtgtgaca 3000 tcatcatcat ctctggccgg aaagaaaagt gtgaggctgc
caaggaagct ctggaggcat 3060 tggttcctgt caccattgaa gtagaggtgc
cctttgacct tcaccgttac gttattgggc 3120 agaaaggaag tgggatccgc
aagatgatgg atgagtttga ggtgaacata catgtcccgg 3180 cacctgagct
gcagtctgac atcatcgcca tcacgggcct cgctgcaaat ttggaccggg 3240
ccaaggctgg actgctggag cgtgtgaagg agctacaggc cgagcaggag gaccgggctt
3300 taaggagttt taagctgagt gtcactgtag accccaaata ccatcccaag
attatcggga 3360 gaaagggggc agtaattacc caaatccggt tggagcatga
cgtgaacatc cagtttcctg 3420 ataaggacga tgggaaccag ccccaggacc
aaattaccat cacagggtac gaaaagaaca 3480 cagaagctgc cagggatgct
atactgagaa ttgtgggtga acttgagcag atggtttctg 3540 aggacgtccc
gctggaccac cgcgttcacg cccgcatcat tggtgcccgc ggcaaagcca 3600
ttcgcaaaat catggacgaa ttcaaggtgg acattcgctt cccacagagc ggagccccag
3660 accccaactg cgtcactgtg acggggctcc cagagaatgt ggaggaagcc
atcgaccaca 3720 tcctcaatct ggaggaggaa tacctagctg acgtggtgga
cagtgaggcg ctgcaggtat 3780 acatgaaacc cccagcacac gaagaggcca
aggcaccttc cagaggcttt gtggtgcggg 3840 acgcaccctg gaccgccagc
agcagtgaga aggctcctga catgagcagc tctgaggaat 3900 ttcccagctt
tggggctcag gtggctccca agaccctccc ttggggcccc aaacgataat 3960
gatcaaaaag aacagaaccc tctccagcct gctgacccaa acccaaccac acaatggttt
4020 gtctcaatct gacccagcgg ctggaccctc cgtaaattgt tgacgctctt
cccccttccc 4080 gaggtcccgc agggagccta gcgcctggct gtgtgtgcgg
ccgctcctcc aggcctggcc 4140 gtgcccgctc aggacctgct ccactgttta
acactaaacc aaggtcatga gcattcgtgc 4200 taagataaca gactccagct
cctggtccac ccggcatgtc agtcagcact ctggccttca 4260 tcacgagagc
tccgcagccg tggctaggat tccacttcct gtgtcatgac ctcaggaaat 4320
aaacgtcctt gactttataa aagccaaacg tttgccctct tcctttccca cctccctcct
4380 gccagtttcc cttggtccag acagtcctgt ttgtggagtg caatcagcct
cctccagctg 4440 ccagagcgcc tcagcacagg tgtcagggtg caaggaagac
ctggcaatgg acagcaggag 4500 gcaggttcct ggagctgggg ggtgacctga
gaggcagagg gtgacgggtt ctcaggcagt 4560 cctgatttta cctgccgtgg
ggtctgaaag caccaagggt ccctgcccct acctccactg 4620 ccagaccctc
agcctgaggt ctggtgagtg gagcctggag gcaaggtggt aggcaccatc 4680
tgggtcccct gtggccgtca cagtgtctgc tgtgattgag atgcgcacag gttgggggag
4740 gtagggcctt acgcttgtcc tcagtggggg cagtttgcct tagatgacag
ctgggctctt 4800 cttcacacca cctgcagccc ctccctgccc ctgccctagc
tgctgtgtgt tcagttgcct 4860 tctttctacc tcagccggcg tggagtggtc
tctgtgcagt tagtgccacc ccacacaccc 4920 gtctcttgat tgagatgttt
ctggtggtta tgggtttccc gtggagctgg gggtgggcgc 4980 cgtgtaccta
agctggaggc tggcgctctc cctcagcaca ggtgggtcag tggccagcag 5040
gcccatctgg agtgggagtg ggcacttcca ccccgcccac aggccatccg gctgtgcagg
5100 ccagccccta ggagcaggtc ccgggtgact ggcagttttc acggtctagg
gccgagacga 5160 tggcatgggg cctagagcat gaggtagagc agaatgcaga
ccacgccgct ggatgccgag 5220 agaccctgct ctccgaggga ggcatctgtg
tcatgctgtg agggctgagg acggggccct 5280 agtctctggt tttctggtct
taacatcctt atctgtgtcc gccacggagg tgactgagct 5340 gctagcgagt
tgtcctgtcc caggtacttg agttttggaa aagctgactc acgcccatcc 5400
atctcacagc ccttccctgg ggacagtcgc ttccgccttg acacctcact ctcagttgaa
5460 taactcaagc ttggtcatct tcagactcga attcttgagt agacccagac
ggcttagccc 5520 aagtctagtt gcagctgcct cggcaagtcc ccatttgctc
aggcagccct gaatgggcct 5580 gtttacagga atggtaaatt gggattggaa
ggaatatagc ttccagcttc ataggctagg 5640 gtgaccacgg cttaggaaac
agggaaagaa agcaaggccc ttttcctgcc tttcccggga 5700 tctgtctact
ccacctccac gggggaggcc agtggggaag ggctgtcacc tcttccccat 5760
ctgcatgagt tctggaactc tgtcctgttg gctgcttgct tccagctccc cccaatctcc
5820 atcgcagcgg gttcctcctg tcttttctac agtgtcataa aacatcctgc
ccctaccctc 5880 tcccaaaggt caattttaat tctcaccaag ttttgcacat
ctctgtatgt cgcttgatgt 5940 cttagacgcg agccctttcc taaactgttc
agcgctctct tttcctttgg gtggttgttg 6000 caagggtgat gacatgactg
tccccaggcc tgtctccctg aagcgtctgt gctgtcagga 6060 cagccctggg
cagagatgag gcaggggtga ggcgtgcgtg tgcttttcct ccttgttgga 6120
tgtcttccat atcatctgtt tccatagcta caatccatcc cttggcctta actttggaat
6180 ttggagatta tatgcaaaca tgtgtaaagg ctcatgaata tggatgacac
tggaatttta 6240 taaattctaa aataaaaccc gaaaccagat gtagcatgct
gggactcatt ttgtcaaaaa 6300 a 6301 <210> SEQ ID NO 8
<400> SEQUENCE: 8 000 <210> SEQ ID NO 9 <211>
LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Unknown
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Unknown: RFGF peptide"
<400> SEQUENCE: 9 Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro 1 5 10 15 <210> SEQ ID NO 10 <211>
LENGTH: 11 <212> TYPE: PRT <213> ORGANISM: Unknown
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Unknown: RFGF analogue peptide"
<400> SEQUENCE: 10 Ala Ala Leu Leu Pro Val Leu Leu Ala Ala
Pro 1 5 10 <210> SEQ ID NO 11 <211> LENGTH: 6524
<212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 11 ttttttgaca aaatgagtcc cagcatgcta
catctggttt cgggttttat tttagaattt 60 ataaaattcc agtgtcatcc
atattcatga gcctttacac atgtttgcat ataatctcca 120 aattccaaag
ttaaggccaa gggatggatt gtagctatgg aaacagatga tatggaagac 180
atccaacaag gaggaaaagc acacgcacgc ctcacccctg cctcatctct gcccagggct
240 gtcctgacag cacagacgct tcagggagac aggcctgggg acagtcatgt
catcaccctt 300 gcaacaacca cccaaaggaa aagagagcgc tgaacagttt
aggaaagggc tcgcgtctaa 360 gacatcaagc gacatacaga gatgtgcaaa
acttggtgag aattaaaatt gacctttggg 420 agagggtagg ggcaggatgt
tttatgacac tgtagaaaag acaggaggaa cccgctgcga 480 tggagattgg
ggggagctgg aagcaagcag ccaacaggac agagttccag aactcatgca 540
gatggggaag aggtgacagc ccttccccac tggcctcccc cgtggaggtg gagtagacag
600 atcccgggaa aggcaggaaa agggccttgc tttctttccc tgtttcctaa
gccgtggtca 660 ccctagccta tgaagctgga agctatattc cttccaatcc
caatttacca ttcctgtaaa 720 caggcccatt cagggctgcc tgagcaaatg
gggacttgcc gaggcagctg caactagact 780 tgggctaagc cgtctgggtc
tactcaagaa ttcgagtctg aagatgacca agcttgagtt 840 attcaactga
gagtgaggtg tcaaggcgga agcgactgtc cccagggaag ggctgtgaga 900
tggatgggcg tgagtcagct tttccaaaac tcaagtacct gggacaggac aactcgctag
960 cagctcagtc acctccgtgg cggacacaga taaggatgtt aagaccagaa
aaccagagac 1020 tagggccccg tcctcagccc tcacagcatg acacagatgc
ctccctcgga gagcagggtc 1080 tctcggcatc cagcggcgtg gtctgcattc
tgctctacct catgctctag gccccatgcc 1140 atcgtctcgg ccctagaccg
tgaaaactgc cagtcacccg ggacctgctc ctaggggctg 1200 gcctgcacag
ccggatggcc tgtgggcggg gtggaagtgc ccactcccac tccagatggg 1260
cctgctggcc actgacccac ctgtgctgag ggagagcgcc agcctccagc ttaggtacac
1320 ggcgcccacc cccagctcca cgggaaaccc ataaccacca gaaacatctc
aatcaagaga 1380 cgggtgtgtg gggtggcact aactgcacag agaccactcc
acgccggctg aggtagaaag 1440 aaggcaactg aacacacagc agctagggca
ggggcaggga ggggctgcag gtggtgtgaa 1500 gaagagccca gctgtcatct
aaggcaaact gcccccactg aggacaagcg taaggcccta 1560 cctcccccaa
cctgtgcgca tctcaatcac agcagacact gtgacggcca caggggaccc 1620
agatggtgcc taccaccttg cctccaggct ccactcacca gacctcaggc tgagggtctg
1680 gcagtggagg taggggcagg gacccttggt gctttcagac cccacggcag
gtaaaatcag 1740 gactgcctga gaacccgtca ccctctgcct ctcaggtcac
cccccagctc caggaacctg 1800 cctcctgctg tccattgcca ggtcttcctt
gcaccctgac acctgtgctg aggcgctctg 1860 gcagctggag gaggctgatt
gcactccaca aacaggactg tctggaccaa gggaaactgg 1920 caggagggag
gtgggaaagg aagagggcaa acgtttggct tttataaagt caaggacgtt 1980
tatttcctga ggtcatgaca caggaagtgg aatcctagcc acggctgcgg agctctcgtg
2040 atgaaggcca gagtgctgac tgacatgccg ggtggaccag gagctggagt
ctgttatctt 2100 agcacgaatg ctcatgacct tggtttagtg ttaaacagtg
gagcaggtcc tgagcgggca 2160 cggccaggcc tggaggagcg gccgcacaca
cagccaggcg ctaggctccc tgcgggacct 2220 cgggaagggg gaagagcgtc
aacaatttac ggagggtcca gccgctgggt cagattgaga 2280 caaaccattg
tgtggttggg tttgggtcag caggctggag agggttctgt tctttttgat 2340
cattatcgtt tggggcccca agggagggtc ttgggagcca cctgagcccc aaagctggga
2400 aattcctcag agctgctcat gtcaggagcc ttctcactgc tgctggcggt
ccagggtgcg 2460 tcccgcacca caaagcctct ggaaggtgcc ttggcctctt
cgtgtgctgg gggtttcatg 2520 tatacctgca gcgcctcact gtccaccacg
tcagctaggt attcctcctc cagattgagg 2580 atgtggtcga tggcttcctc
cacattctct gggagccccg tcacagtgac gcagttgggg 2640 tctggggctc
cgctctgtgg gaagcgaatg tccaccttga attcgtccat gattttgcga 2700
atggctttgc cgcgggcacc aatgatgcgg gcgtgaacgc ggtggtccag cgggacgtcc
2760 tcagaaacca tctgctcaag ttcacccaca attctcagta tagcatccct
ggcagcttct 2820 gtgttctttt cgtaccctgt gatggtaatt tggtcctggg
gctggttccc atcgtcctta 2880 tcaggaaact ggatgttcac gtcatgctcc
aaccggattt gggtaattac tgcccccttt 2940 ctcccgataa tcttgggatg
gtatttgggg tctacagtga cactcagctt aaaactcctt 3000 aaagcccggt
cctcctgctc ggcctgtagc tccttcacac gctccagcag tccagccttg 3060
gcccggtcca aatttgcagc gaggcccgtg atggcgatga tgtcagactg cagctcaggt
3120 gccgggacat gtatgttcac ctcaaactca tccatcatct tgcggatccc
acttcctttc 3180 tgcccaataa cgtaacggtg aaggtcaaag ggcacctcta
cttcaatggt gacaggaacc 3240 aatgcctcca gagcttcctt ggcagcctca
cacttttctt tccggccaga gatgatgatg 3300 atgtcacacc tccttggaga
gccggggtca caatctttag cctctctccc ctccccagct 3360 tcgtccccat
tctcctggac aactggctct gtactgtgaa ctgcgttctc ctctctgtct 3420
gggaatttaa tttgaacact gaaatcccga gtaatctgct ggattctgga acctttgggg
3480 cccatgacag atcgatggaa tttctggggt atagcacatt ctaatgtcac
ctgagcttcc 3540 aggtcctcaa tgatctcctg aatgcgtttc ttggctgcct
ccacacagtc cttggcgccc 3600 ttgagggtga ctttgtcgct ctgtgtgcca
gagcgtggga agctgaccat caccccgcca 3660 tactcttcag caatctcccg
caagacctgg cctctgcgga tgacgaagtg gcggtggtgc 3720 ttggggtcca
ccagcatgga gtcttccacc acattatcca ggttttggat caaggcctcc 3780
agctccttct gtgcctctcg gacggcgtcc tcctttccaa tgatggtgat caggtcctgg
3840 tccttgtcct cagccgcagg gaagatgaca cgtgctccag tgctgtcgcg
caccttgcga 3900 attttgccgc cccccttgcc gatgaggaat ttgtggtatt
ctggcttggc gcggatgtca 3960 acagtgaaac tcttggtttg cttctcctcc
gccagatgca ggagctgctt cttggccttc 4020 tccacatccg aggaagggcc
cctgataaca acggtgtcgc ttcctgaacc ttccacggga 4080 aagtgaatgt
ggaccccgcc gcactcctcc atgatggagc ggatcagacg gcccttggtg 4140
ccaatgaggg agttgtgcag cttggcaggg atggagacct ctacctcggc tatgttggcc
4200 aggtctttct gaatagacag aatcctgctc cgggcagctt cgcagttggc
tcgcttgcct 4260 gtgatgataa tggtctctga attgctattc tctgctggaa
ggtcgatttt ggtgttgctt 4320 tcttcacgaa tctttttaat gtttgcgcct
cctttcccaa tgatattctt gtgaaactgt 4380 ttgaagatcg gaacagaaat
tgaatagcta ttttccacca gatctgccac catcttctgc 4440 atgtattttg
tgcatttttc cacctcattc ttaggtcctc tgagctggac aatgtcactt 4500
ttttgtgctg ggtctggaaa gttaatgatg acctctggga atttgtcacg aatttcacgg
4560 atccgttcac ccttctgccc aatgattgtg cgatgaaatc tttgctcaat
gattagatcc 4620 ttggtacgct cattttccat gcgagatgca agctccagca
gctctcgctt ggcctgctgc 4680 acgccctgtg ggtccccctc gatgcggatc
aaattgctct tctcactgtc aggagggatg 4740 cgcacggaca ccttgtactg
gtctttgatt ctgtttatgt tggcaccgct cttcccaatg 4800 aggtgcctgt
ggaacttgtg gtcgatgttg atctccacat agtccatccg gttaatcaaa 4860
tctttgacca tgccttctat ctgttcctgg gccacattga catcctctgt agggccctcc
4920 agggtgatct tgtcttcgcc ctctgtgaac tcgatgtgaa cctttggcat
ctgctgagtg 4980 attttggcca ggttctgccc tttcttgcca atgatgaaac
ggtgaagcca ggaaggggcg 5040 gcgacagagg agacggtgaa gctattggcc
ttggcataga cttcagtcaa cgcctgacct 5100 aacttttcag gttcgcctcg
aagtattaca gtctcagaga tgctgtctga gggtgggatc 5160 tcaacggaaa
ctccagttct ctcaaggatc tcctgcaatg aattgccctt gggcccaatg 5220
acatacttgt gttgggattt cttcacttcc actgcaatgg ttgtagtctt ctttttcttc
5280 tcctcataaa tcttcttgat gcgagccaca gcctgagcca actgttcctt
ctctccagtg 5340 aagacaatct ctgtccggtt cacgctgggt ggggggatgt
tgatgcgcgt gcctgtctcc 5400 tgcatgatct cgccaaccag tctattatac
ggcccagcga tgaaggggtg gaatgccttt 5460 tctacttcta gcctctccac
agcacgtttg tcctgctcgg cagagatgag taagacttca 5520 tggcgagctt
tctcgatgcc ctctttggtg ccagtgatct tgatctgatt gctggggtca 5580
tctgggcgtg ggatctggat tttggttgca gtttttagct ccaagtcttg cagtttctct
5640 ccatttttgc caataacaaa gcgatggtgt tctttgggaa tggcaacagt
tgctgaggcc 5700 tgagtctgca gtctagcaac aatgtccttc cgagctttca
tgacagcatc cagctttcct 5760 gacaccatga tggagaggcc ttggtctttg
gccaaagaca gctccaagtg agcaccagtt 5820 ctctgcatga tctcaaggca
gatttttgct tgttcacctt ctccaaactg gttcatatcc 5880 ttgtattttc
tctcctccag gggtacatgg aacacctgag tgatgacaga agccttgatg 5940
ggtcggatct tgttccccca ggctccagcg ggttcctggg cactttccag gcaagcagct
6000 ttctcaggaa gtggagggaa ggcatccttg taggttggag ggtcgctctc
ctcttctgaa 6060 tttagagtgg caactttgat ttgttgcgga accagcccac
ttcggtgttc agcaaaactc 6120 tcttgggtca aaactgcaac ggaactcatg
gttgatctca cacctacaca caatccggga 6180 aaaccacagc aaaacggtca
gtagccagaa ggtccgtcct gaggccgcct ctgtcagcct 6240 gccagctttt
gctgttccac tcttataagc ataagaaaac cgagctcata aggtaggaac 6300
tgtggcgaaa cagggacaag ccgccatctt ggtaaaggag aagaggctac gcttgacctc
6360 cccccccacc cccagcctct atatggccaa ctgccgtggg aggagcacgg
cgcttgcgca 6420 gaggcggaca acgcggacga ctctgggctt gcgcactcgg
aagccggccg catgggggag 6480 gggaagaagg ccaggtcgca ctgagccagg
aagcagttgg caaa 6524 <210> SEQ ID NO 12 <211> LENGTH:
6377 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 12 ttttttgaca aaatgagtcc cagcatgcta
catctggttt cgggttttat tttagaattt 60 ataaaattcc agtgtcatcc
atattcatga gcctttacac atgtttgcat ataatctcca 120 aattccaaag
ttaaggccaa gggatggatt gtagctatgg aaacagatga tatggaagac 180
atccaacaag gaggaaaagc acacgcacgc ctcacccctg cctcatctct gcccagggct
240 gtcctgacag cacagacgct tcagggagac aggcctgggg acagtcatgt
catcaccctt 300 gcaacaacca cccaaaggaa aagagagcgc tgaacagttt
aggaaagggc tcgcgtctaa 360 gacatcaagc gacatacaga gatgtgcaaa
acttggtgag aattaaaatt gacctttggg 420 agagggtagg ggcaggatgt
tttatgacac tgtagaaaag acaggaggaa cccgctgcga 480 tggagattgg
ggggagctgg aagcaagcag ccaacaggac agagttccag aactcatgca 540
gatggggaag aggtgacagc ccttccccac tggcctcccc cgtggaggtg gagtagacag
600 atcccgggaa aggcaggaaa agggccttgc tttctttccc tgtttcctaa
gccgtggtca 660 ccctagccta tgaagctgga agctatattc cttccaatcc
caatttacca ttcctgtaaa 720 caggcccatt cagggctgcc tgagcaaatg
gggacttgcc gaggcagctg caactagact 780 tgggctaagc cgtctgggtc
tactcaagaa ttcgagtctg aagatgacca agcttgagtt 840 attcaactga
gagtgaggtg tcaaggcgga agcgactgtc cccagggaag ggctgtgaga 900
tggatgggcg tgagtcagct tttccaaaac tcaagtacct gggacaggac aactcgctag
960 cagctcagtc acctccgtgg cggacacaga taaggatgtt aagaccagaa
aaccagagac 1020 tagggccccg tcctcagccc tcacagcatg acacagatgc
ctccctcgga gagcagggtc 1080 tctcggcatc cagcggcgtg gtctgcattc
tgctctacct catgctctag gccccatgcc 1140 atcgtctcgg ccctagaccg
tgaaaactgc cagtcacccg ggacctgctc ctaggggctg 1200 gcctgcacag
ccggatggcc tgtgggcggg gtggaagtgc ccactcccac tccagatggg 1260
cctgctggcc actgacccac ctgtgctgag ggagagcgcc agcctccagc ttaggtacac
1320 ggcgcccacc cccagctcca cgggaaaccc ataaccacca gaaacatctc
aatcaagaga 1380 cgggtgtgtg gggtggcact aactgcacag agaccactcc
acgccggctg aggtagaaag 1440 aaggcaactg aacacacagc agctagggca
ggggcaggga ggggctgcag gtggtgtgaa 1500 gaagagccca gctgtcatct
aaggcaaact gcccccactg aggacaagcg taaggcccta 1560 cctcccccaa
cctgtgcgca tctcaatcac agcagacact gtgacggcca caggggaccc 1620
agatggtgcc taccaccttg cctccaggct ccactcacca gacctcaggc tgagggtctg
1680 gcagtggagg taggggcagg gacccttggt gctttcagac cccacggcag
gtaaaatcag 1740 gactgcctga gaacccgtca ccctctgcct ctcaggtcac
cccccagctc caggaacctg 1800 cctcctgctg tccattgcca ggtcttcctt
gcaccctgac acctgtgctg aggcgctctg 1860 gcagctggag gaggctgatt
gcactccaca aacaggactg tctggaccaa gggaaactgg 1920 caggagggag
gtgggaaagg aagagggcaa acgtttggct tttataaagt caaggacgtt 1980
tatttcctga ggtcatgaca caggaagtgg aatcctagcc acggctgcgg agctctcgtg
2040 atgaaggcca gagtgctgac tgacatgccg ggtggaccag gagctggagt
ctgttatctt 2100 agcacgaatg ctcatgacct tggtttagtg ttaaacagtg
gagcaggtcc tgagcgggca 2160 cggccaggcc tggaggagcg gccgcacaca
cagccaggcg ctaggctccc tgcgggacct 2220 cgggaagggg gaagagcgtc
aacaatttac ggagggtcca gccgctgggt cagattgaga 2280 caaaccattg
tgtggttggg tttgggtcag caggctggag agggttctgt tctttttgat 2340
cattatcgtt tggggcccca agggagggtc ttgggagcca cctgagcccc aaagctggga
2400 aattcctcag agctgctcat gtcaggagcc ttctcactgc tgctggcggt
ccagggtgcg 2460 tcccgcacca caaagcctct ggaaggtgcc ttggcctctt
cgtgtgctgg gggtttcatg 2520 tatacctgca gcgcctcact gtccaccacg
tcagctaggt attcctcctc cagattgagg 2580 atgtggtcga tggcttcctc
cacattctct gggagccccg tcacagtgac gcagttgggg 2640 tctggggctc
cgctctgtgg gaagcgaatg tccaccttga attcgtccat gattttgcga 2700
atggctttgc cgcgggcacc aatgatgcgg gcgtgaacgc ggtggtccag cgggacgtcc
2760 tcagaaacca tctgctcaag ttcacccaca attctcagta tagcatccct
ggcagcttct 2820 gtgttctttt cgtaccctgt gatggtaatt tggtcctggg
gctggttccc atcgtcctta 2880 tcaggaaact ggatgttcac gtcatgctcc
aaccggattt gggtaattac tgcccccttt 2940 ctcccgataa tcttgggatg
gtatttgggg tctacagtga cactcagctt aaaactcctt 3000 aaagcccggt
cctcctgctc ggcctgtagc tccttcacac gctccagcag tccagccttg 3060
gcccggtcca aatttgcagc gaggcccgtg atggcgatga tgtcagactg cagctcaggt
3120 gccgggacat gtatgttcac ctcaaactca tccatcatct tgcggatccc
acttcctttc 3180 tgcccaataa cgtaacggtg aaggtcaaag ggcacctcta
cttcaatggt gacaggaacc 3240 aatgcctcca gagcttcctt ggcagcctca
cacttttctt tccggccaga gatgatgatg 3300 atgtcacacc tccttggaga
gccggggtca caatctttag cctctctccc ctccccagct 3360 tcgtccccat
tctcctggac aactggctct gtactgtgaa ctgcgttctc ctctctgtct 3420
gggaatttaa tttgaacact gaaatcccga gtaatctgct ggattctgga acctttgggg
3480 cccatgacag atcgatggaa tttctggggt atagcacatt ctaatgtcac
ctgagcttcc 3540 aggtcctcaa tgatctcctg aatgcgtttc ttggctgcct
ccacacagtc cttggcgccc 3600 ttgagggtga ctttgtcgct ctgtgtgcca
gagcgtggga agctgaccat caccccgcca 3660 tactcttcag caatctcccg
caagacctgg cctctgcgga tgacgaagtg gcggtggtgc 3720 ttggggtcca
ccagcatgga gtcttccacc acattatcca ggttttggat caaggcctcc 3780
agctccttct gtgcctctcg gacggcgtcc tcctttccaa tgatggtgat caggtcctgg
3840 tccttgtcct cagccgcagg gaagatgaca cgtgctccag tgctgtcgcg
caccttgcga 3900 attttgccgc cccccttgcc gatgaggaat ttgtggtatt
ctggcttggc gcggatgtca 3960 acagtgaaac tcttggtttg cttctcctcc
gccagatgca ggagctgctt cttggccttc 4020 tccacatccg aggaagggcc
cctgataaca acggtgtcgc ttcctgaacc ttccacggga 4080 aagtgaatgt
ggaccccgcc gcactcctcc atgatggagc ggatcagacg gcccttggtg 4140
ccaatgaggg agttgtgcag cttggcaggg atggagacct ctacctcggc tatgttggcc
4200 aggtctttct gaatagacag aatcctgctc cgggcagctt cgcagttggc
tcgcttgcct 4260 gtgatgataa tggtctctga attgctattc tctgctggaa
ggtcgatttt ggtgttgctt 4320 tcttcacgaa tctttttaat gtttgcgcct
cctttcccaa tgatattctt gtgaaactgt 4380 ttgaagatcg gaacagaaat
tgaatagcta ttttccacca gatctgccac catcttctgc 4440 atgtattttg
tgcatttttc cacctcattc ttaggtcctc tgagctggac aatgtcactt 4500
ttttgtgctg ggtctggaaa gttaatgatg acctctggga atttgtcacg aatttcacgg
4560 atccgttcac ccttctgccc aatgattgtg cgatgaaatc tttgctcaat
gattagatcc 4620 ttggtacgct cattttccat gcgagatgca agctccagca
gctctcgctt ggcctgctgc 4680 acgccctgtg ggtccccctc gatgcggatc
aaattgctct tctcactgtc aggagggatg 4740 cgcacggaca ccttgtactg
gtctttgatt ctgtttatgt tggcaccgct cttcccaatg 4800 aggtgcctgt
ggaacttgtg gtcgatgttg atctccacat agtccatccg gttaatcaaa 4860
tctttgacca tgccttctat ctgttcctgg gccacattga catcctctgt agggccctcc
4920 agggtgatct tgtcttcgcc ctctgtgaac tcgatgtgaa cctttggcat
ctgctgagtg 4980 attttggcca ggttctgccc tttcttgcca atgatgaaac
ggtgaagcca ggaaggggcg 5040 gcgacagagg agacggtgaa gctattggcc
ttggcataga cttcagtcaa cgcctgacct 5100 aacttttcag gttcgcctcg
aagtattaca gtctcagaga tgctgtctga gggtgggatc 5160 tcaacggaaa
ctccagttct ctcaaggatc tcctgcaatg aattgccctt gggcccaatg 5220
acatacttgt gttgggattt cttcacttcc actgcaatgg ttgtagtctt ctttttcttc
5280 tcctcataaa tcttcttgat gcgagccaca gcctgagcca actgttcctt
ctctccagtg 5340 aagacaatct ctgtccggtt cacgctgggt ggggggatgt
tgatgcgcgt gcctgtctcc 5400 tgcatgatct cgccaaccag tctattatac
ggcccagcga tgaaggggtg gaatgccttt 5460 tctacttcta gcctctccac
agcacgtttg tcctgctcgg cagagatgag taagacttca 5520 tggcgagctt
tctcgatgcc ctctttggtg ccagtgatct tgatctgatt gctggggtca 5580
tctgggcgtg ggatctggat tttggttgca gtttttagct ccaagtcttg cagtttctct
5640 ccatttttgc caataacaaa gcgatggtgt tctttgggaa tggcaacagt
tgctgaggcc 5700 tgagtctgca gtctagcaac aatgtccttc cgagctttca
tgacagcatc cagctttcct 5760 gacaccatga tggagaggcc ttggtctttg
gccaaagaca gctccaagtg agcaccagtt 5820 ctctgcatga tctcaaggca
gatttttgct tgttcacctt ctccaaactg gttcatatcc 5880 ttgtattttc
tctcctccag gggtacatgg aacacctgag tgatgacaga agccttgatg 5940
ggtcggatct tgttccccca ggctccagcg ggttcctggg cactttccag gcaagcagct
6000 ttctcaggaa gtggagggaa ggcatccttg taggttggag ggtcgctctc
ctcttctgaa 6060 tttagagtgg caactttgat ttgttgcgga accagcccac
ttcggtgttc agcaaaactc 6120 tcttgggtca aaactgcaac ggaactcatg
gttgatctca cacctacaca caatccggga 6180 aaaccacagc aaaacggtca
gtagccagaa ggtccgtcct gaggccgcct ctgtcagcct 6240 gccagctttt
gtcgtgggcc cccgcccgct ggtcctgccg ctggcttact cgccccccgc 6300
gcgggagaag ccgggacgct ccgaggcgcg gcgcccgggc cccggctgct atatagggcg
6360 gcggcccaat cccgcct 6377 <210> SEQ ID NO 13 <211>
LENGTH: 6301 <212> TYPE: DNA <213> ORGANISM: Homo
sapiens <400> SEQUENCE: 13 ttttttgaca aaatgagtcc cagcatgcta
catctggttt cgggttttat tttagaattt 60 ataaaattcc agtgtcatcc
atattcatga gcctttacac atgtttgcat ataatctcca 120 aattccaaag
ttaaggccaa gggatggatt gtagctatgg aaacagatga tatggaagac 180
atccaacaag gaggaaaagc acacgcacgc ctcacccctg cctcatctct gcccagggct
240 gtcctgacag cacagacgct tcagggagac aggcctgggg acagtcatgt
catcaccctt 300 gcaacaacca cccaaaggaa aagagagcgc tgaacagttt
aggaaagggc tcgcgtctaa 360 gacatcaagc gacatacaga gatgtgcaaa
acttggtgag aattaaaatt gacctttggg 420 agagggtagg ggcaggatgt
tttatgacac tgtagaaaag acaggaggaa cccgctgcga 480 tggagattgg
ggggagctgg aagcaagcag ccaacaggac agagttccag aactcatgca 540
gatggggaag aggtgacagc ccttccccac tggcctcccc cgtggaggtg gagtagacag
600 atcccgggaa aggcaggaaa agggccttgc tttctttccc tgtttcctaa
gccgtggtca 660 ccctagccta tgaagctgga agctatattc cttccaatcc
caatttacca ttcctgtaaa 720 caggcccatt cagggctgcc tgagcaaatg
gggacttgcc gaggcagctg caactagact 780 tgggctaagc cgtctgggtc
tactcaagaa ttcgagtctg aagatgacca agcttgagtt 840 attcaactga
gagtgaggtg tcaaggcgga agcgactgtc cccagggaag ggctgtgaga 900
tggatgggcg tgagtcagct tttccaaaac tcaagtacct gggacaggac aactcgctag
960 cagctcagtc acctccgtgg cggacacaga taaggatgtt aagaccagaa
aaccagagac 1020 tagggccccg tcctcagccc tcacagcatg acacagatgc
ctccctcgga gagcagggtc 1080 tctcggcatc cagcggcgtg gtctgcattc
tgctctacct catgctctag gccccatgcc 1140 atcgtctcgg ccctagaccg
tgaaaactgc cagtcacccg ggacctgctc ctaggggctg 1200 gcctgcacag
ccggatggcc tgtgggcggg gtggaagtgc ccactcccac tccagatggg 1260
cctgctggcc actgacccac ctgtgctgag ggagagcgcc agcctccagc ttaggtacac
1320 ggcgcccacc cccagctcca cgggaaaccc ataaccacca gaaacatctc
aatcaagaga 1380 cgggtgtgtg gggtggcact aactgcacag agaccactcc
acgccggctg aggtagaaag 1440 aaggcaactg aacacacagc agctagggca
ggggcaggga ggggctgcag gtggtgtgaa 1500 gaagagccca gctgtcatct
aaggcaaact gcccccactg aggacaagcg taaggcccta 1560 cctcccccaa
cctgtgcgca tctcaatcac agcagacact gtgacggcca caggggaccc 1620
agatggtgcc taccaccttg cctccaggct ccactcacca gacctcaggc tgagggtctg
1680 gcagtggagg taggggcagg gacccttggt gctttcagac cccacggcag
gtaaaatcag 1740 gactgcctga gaacccgtca ccctctgcct ctcaggtcac
cccccagctc caggaacctg 1800 cctcctgctg tccattgcca ggtcttcctt
gcaccctgac acctgtgctg aggcgctctg 1860 gcagctggag gaggctgatt
gcactccaca aacaggactg tctggaccaa gggaaactgg 1920 caggagggag
gtgggaaagg aagagggcaa acgtttggct tttataaagt caaggacgtt 1980
tatttcctga ggtcatgaca caggaagtgg aatcctagcc acggctgcgg agctctcgtg
2040 atgaaggcca gagtgctgac tgacatgccg ggtggaccag gagctggagt
ctgttatctt 2100 agcacgaatg ctcatgacct tggtttagtg ttaaacagtg
gagcaggtcc tgagcgggca 2160 cggccaggcc tggaggagcg gccgcacaca
cagccaggcg ctaggctccc tgcgggacct 2220 cgggaagggg gaagagcgtc
aacaatttac ggagggtcca gccgctgggt cagattgaga 2280 caaaccattg
tgtggttggg tttgggtcag caggctggag agggttctgt tctttttgat 2340
cattatcgtt tggggcccca agggagggtc ttgggagcca cctgagcccc aaagctggga
2400 aattcctcag agctgctcat gtcaggagcc ttctcactgc tgctggcggt
ccagggtgcg 2460 tcccgcacca caaagcctct ggaaggtgcc ttggcctctt
cgtgtgctgg gggtttcatg 2520 tatacctgca gcgcctcact gtccaccacg
tcagctaggt attcctcctc cagattgagg 2580 atgtggtcga tggcttcctc
cacattctct gggagccccg tcacagtgac gcagttgggg 2640 tctggggctc
cgctctgtgg gaagcgaatg tccaccttga attcgtccat gattttgcga 2700
atggctttgc cgcgggcacc aatgatgcgg gcgtgaacgc ggtggtccag cgggacgtcc
2760 tcagaaacca tctgctcaag ttcacccaca attctcagta tagcatccct
ggcagcttct 2820 gtgttctttt cgtaccctgt gatggtaatt tggtcctggg
gctggttccc atcgtcctta 2880 tcaggaaact ggatgttcac gtcatgctcc
aaccggattt gggtaattac tgcccccttt 2940 ctcccgataa tcttgggatg
gtatttgggg tctacagtga cactcagctt aaaactcctt 3000 aaagcccggt
cctcctgctc ggcctgtagc tccttcacac gctccagcag tccagccttg 3060
gcccggtcca aatttgcagc gaggcccgtg atggcgatga tgtcagactg cagctcaggt
3120 gccgggacat gtatgttcac ctcaaactca tccatcatct tgcggatccc
acttcctttc 3180 tgcccaataa cgtaacggtg aaggtcaaag ggcacctcta
cttcaatggt gacaggaacc 3240 aatgcctcca gagcttcctt ggcagcctca
cacttttctt tccggccaga gatgatgatg 3300 atgtcacacc tccttggaga
gccggggtca caatctttag cctctctccc ctccccagct 3360 tcgtccccat
tctcctggac aactggctct gtactgtgaa ctgcgttctc ctctctgtct 3420
gggaatttaa tttgaacact gaaatcccga gtaatctgct ggattctgga acctttgggg
3480 cccatgacag atcgatggaa tttctggggt atagcacatt ctaatgtcac
ctgagcttcc 3540 aggtcctcaa tgatctcctg aatgcgtttc ttggctgcct
ccacacagtc cttggcgccc 3600 ttgagggtga ctttgtcgct ctgtgtgcca
gagcgtggga agctgaccat caccccgcca 3660 tactcttcag caatctcccg
caagacctgg cctctgcgga tgacgaagtg gcggtggtgc 3720 ttggggtcca
ccagcatgga gtcttccacc acattatcca ggttttggat caaggcctcc 3780
agctccttct gtgcctctcg gacggcgtcc tcctttccaa tgatggtgat caggtcctgg
3840 tccttgtcct cagccgcagg gaagatgaca cgtgctccag tgctgtcgcg
caccttgcga 3900 attttgccgc cccccttgcc gatgaggaat ttgtggtatt
ctggcttggc gcggatgtca 3960 acagtgaaac tcttggtttg cttctcctcc
gccagatgca ggagctgctt cttggccttc 4020 tccacatccg aggaagggcc
cctgataaca acggtgtcgc ttcctgaacc ttccacggga 4080 aagtgaatgt
ggaccccgcc gcactcctcc atgatggagc ggatcagacg gcccttggtg 4140
ccaatgaggg agttgtgcag cttggcaggg atggagacct ctacctcggc tatgttggcc
4200 aggtctttct gaatagacag aatcctgctc cgggcagctt cgcagttggc
tcgcttgcct 4260 gtgatgataa tggtctctga attgctattc tctgctggaa
ggtcgatttt ggtgttgctt 4320 tcttcacgaa tctttttaat gtttgcgcct
cctttcccaa tgatattctt gtgaaactgt 4380 ttgaagatcg gaacagaaat
tgaatagcta ttttccacca gatctgccac catcttctgc 4440 atgtattttg
tgcatttttc cacctcattc ttaggtcctc tgagctggac aatgtcactt 4500
ttttgtgctg ggtctggaaa gttaatgatg acctctggga atttgtcacg aatttcacgg
4560 atccgttcac ccttctgccc aatgattgtg cgatgaaatc tttgctcaat
gattagatcc 4620 ttggtacgct cattttccat gcgagatgca agctccagca
gctctcgctt ggcctgctgc 4680 acgccctgtg ggtccccctc gatgcggatc
aaattgctct tctcactgtc aggagggatg 4740 cgcacggaca ccttgtactg
gtctttgatt ctgtttatgt tggcaccgct cttcccaatg 4800 aggtgcctgt
ggaacttgtg gtcgatgttg atctccacat agtccatccg gttaatcaaa 4860
tctttgacca tgccttctat ctgttcctgg gccacattga catcctctgt agggccctcc
4920 agggtgatct tgtcttcgcc ctctgtgaac tcgatgtgaa cctttggcat
ctgctgagtg 4980 attttggcca ggttctgccc tttcttgcca atgatgaaac
ggtgaagcca ggaaggggcg 5040 gcgacagagg agacggtgaa gctattggcc
ttctcctcat aaatcttctt gatgcgagcc 5100 acagcctgag ccaactgttc
cttctctcca gtgaagacaa tctctgtccg gttcacgctg 5160 ggtgggggga
tgttgatgcg cgtgcctgtc tcctgcatga tctcgccaac cagtctatta 5220
tacggcccag cgatgaaggg gtggaatgcc ttttctactt ctagcctctc cacagcacgt
5280 ttgtcctgct cggcagagat gagtaagact tcatggcgag ctttctcgat
gccctctttg 5340 gtgccagtga tcttgatctg attgctgggg tcatctgggc
gtgggatctg gattttggtt 5400 gcagttttta gctccaagtc ttgcagtttc
tctccatttt tgccaataac aaagcgatgg 5460 tgttctttgg gaatggcaac
agttgctgag gcctgagtct gcagtctagc aacaatgtcc 5520 ttccgagctt
tcatgacagc atccagcttt cctgacacca tgatggagag gccttggtct 5580
ttggccaaag acagctccaa gtgagcacca gttctctgca tgatctcaag gcagattttt
5640 gcttgttcac cttctccaaa ctggttcata tccttgtatt ttctctcctc
caggggtaca 5700 tggaacacct gagtgatgac agaagccttg atgggtcgga
tcttgttccc ccaggctcca 5760 gcgggttcct gggcactttc caggcaagca
gctttctcag gaagtggagg gaaggcatcc 5820 ttgtaggttg gagggtcgct
ctcctcttct gaatttagag tggcaacttt gatttgttgc 5880 ggaaccagcc
cacttcggtg ttcagcaaaa ctctcttggg tcaaaactgc aacggaactc 5940
atggttgatc tcacacctac acacaatccg ggaaaaccac tcttaatgct tacaaaatgc
6000 atcatgacag ttgctacaaa aagccagcgg tctctctctg caaggtgcat
ccaggcccca 6060 aactaaacca cctccaaatc tcgacttaac caggtggtta
taagtggtag cagcaaaacg 6120 gtcagtagcc agaaggtccg tcctgaggcc
gcctctgtca gcctgccagc ttttgtcgtg 6180 ggcccccgcc cgctggtcct
gccgctggct tactcgcccc ccgcgcggga gaagccggga 6240 cgctccgagg
cgcggcgccc gggccccggc tgctatatag ggcggcggcc caatcccgcc 6300 t 6301
<210> SEQ ID NO 14 <400> SEQUENCE: 14 000 <210>
SEQ ID NO 15 <400> SEQUENCE: 15 000 <210> SEQ ID NO 16
<400> SEQUENCE: 16 000 <210> SEQ ID NO 17 <400>
SEQUENCE: 17 000 <210> SEQ ID NO 18 <400> SEQUENCE: 18
000 <210> SEQ ID NO 19 <211> LENGTH: 13 <212>
TYPE: PRT <213> ORGANISM: Human immunodeficiency virus
<400> SEQUENCE: 19 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg
Pro Pro Gln 1 5 10 <210> SEQ ID NO 20 <211> LENGTH: 16
<212> TYPE: PRT <213> ORGANISM: Drosophila sp.
<400> SEQUENCE: 20 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg
Arg Met Lys Trp Lys Lys 1 5 10 15 <210> SEQ ID NO 21
<211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic 6xHis tag" <400> SEQUENCE: 21
His His His His His His 1 5 <210> SEQ ID NO 22 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 22
gagaucaaca uugaccauaa a 21 <210> SEQ ID NO 23 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 23
aggaagaucg ggcuuuaagg a 21 <210> SEQ ID NO 24 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 24
uuuaugguca auguugaucu cua 23 <210> SEQ ID NO 25 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 25
uccuuaaagc ccgaucuucc ugc 23 <210> SEQ ID NO 26 <211>
LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 26
tttttttttt tttttttttt ttttt 25 <210> SEQ ID NO 27 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 27
caugaguucc guugcaguuu u 21 <210> SEQ ID NO 28 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 28
augaguuccg uugcaguuuu a 21 <210> SEQ ID NO 29 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 29
ccguugcagu uuugacccaa a 21 <210> SEQ ID NO 30 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 30
acccaagaga guuuugcuga a 21 <210> SEQ ID NO 31 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 31
caaaucaaag uugccacucu a 21 <210> SEQ ID NO 32 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 32
acaagcaaaa aucugccuug a 21 <210> SEQ ID NO 33 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 33
aacaccaucg cuuuguuauu a 21 <210> SEQ ID NO 34 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 34
aacugcaaga cuuggagcua a 21 <210> SEQ ID NO 35 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 35
cuaaaaacug caaccaaaau a 21 <210> SEQ ID NO 36 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 36
ugcaaccaaa auccagaucc a 21 <210> SEQ ID NO 37 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 37
aucaagaaga uuuaugagga a 21 <210> SEQ ID NO 38 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 38
gaaaaagaag acuacaacca u 21 <210> SEQ ID NO 39 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 39
aaaaagaaga cuacaaccau u 21 <210> SEQ ID NO 40 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 40
aaaagaagac uacaaccauu a 21 <210> SEQ ID NO 41 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 41
acuacaacca uugcagugga a 21 <210> SEQ ID NO 42 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 42
ugcaguggaa gugaagaaau a 21 <210> SEQ ID NO 43 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 43
gaagagcaau uugauccgca u 21 <210> SEQ ID NO 44 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 44
ggaucuaauc auugagcaaa g 21 <210> SEQ ID NO 45 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 45
uaaucauuga gcaaagauuu a 21 <210> SEQ ID NO 46 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 46
gagcaaagau uucaucgcac a 21 <210> SEQ ID NO 47 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 47
caaagauuuc aucgcacaau a 21 <210> SEQ ID NO 48 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 48
aagugacauu guccagcuca a 21 <210> SEQ ID NO 49 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 49
cacaaaauac augcagaaga u 21 <210> SEQ ID NO 50 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 50
cuguuccgau cuucaaacag u 21 <210> SEQ ID NO 51 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 51
uguuccgauc uucaaacagu u 21 <210> SEQ ID NO 52 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 52
ucuucaaaca guuucacaag a 21 <210> SEQ ID NO 53 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 53
cuucaaacag uuucacaaga a 21 <210> SEQ ID NO 54 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 54
uucaaacagu uucacaagaa u 21 <210> SEQ ID NO 55 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 55
ccagcagaga auagcaauuc a 21 <210> SEQ ID NO 56 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 56
gagaauagca auucagagac a 21 <210> SEQ ID NO 57 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 57
agaauagcaa uucagagacc a 21 <210> SEQ ID NO 58 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 58
aauucagaga ccauuaucau a 21 <210> SEQ ID NO 59 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 59
uucagagacc auuaucauca a 21 <210> SEQ ID NO 60 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 60
ucagagacca uuaucaucac a 21 <210> SEQ ID NO 61 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 61
agagaccauu aucaucacag a 21 <210> SEQ ID NO 62 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 62
caaaccaaga guuucacugu u 21 <210> SEQ ID NO 63 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 63
aaaccaagag uuucacuguu a 21 <210> SEQ ID NO 64 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 64
aagaguuuca cuguugacau a 21 <210> SEQ ID NO 65 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 65
cagaaauucc aucgaucugu a 21 <210> SEQ ID NO 66 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 66
ucaaauuaaa uucccagaca a 21 <210> SEQ ID NO 67 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 67
ccguaaauug uugacgcucu u 21 <210> SEQ ID NO 68 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 68
ggucaugagc auucgugcua a 21 <210> SEQ ID NO 69 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 69
gucaugagca uucgugcuaa a 21 <210> SEQ ID NO 70 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 70
augagcauuc gugcuaagau a 21 <210> SEQ ID NO 71 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 71
agcauucgug cuaagauaac a 21 <210> SEQ ID NO 72 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 72
ucgugcuaag auaacagacu a 21 <210> SEQ ID NO 73 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 73
aaaacugcaa cggaacucau ggu 23 <210> SEQ ID NO 74 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 74
uaaaacugca acggaacuca ugg 23 <210> SEQ ID NO 75 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 75
uuugggucaa aacugcaacg gaa 23 <210> SEQ ID NO 76 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 76
uucagcaaaa cucucuuggg uca 23 <210> SEQ ID NO 77 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 77
uagaguggca acuuugauuu guu 23 <210> SEQ ID NO 78 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 78
ucaaggcaga uuuuugcuug uuc 23 <210> SEQ ID NO 79 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 79
uaauaacaaa gcgauggugu ucu 23 <210> SEQ ID NO 80 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 80
uuagcuccaa gucuugcagu uuc 23 <210> SEQ ID NO 81 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 81
uauuuugguu gcaguuuuua gcu 23 <210> SEQ ID NO 82 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 82
uggaucugga uuuugguugc agu 23 <210> SEQ ID NO 83 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 83
uuccucauaa aucuucuuga ugc 23 <210> SEQ ID NO 84 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 84
augguuguag ucuucuuuuu cuu 23 <210> SEQ ID NO 85 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 85
aaugguugua gucuucuuuu ucu 23 <210> SEQ ID NO 86 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 86
uaaugguugu agucuucuuu uuc 23 <210> SEQ ID NO 87 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 87
uuccacugca augguuguag ucu 23 <210> SEQ ID NO 88 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 88
uauuucuuca cuuccacugc aau 23 <210> SEQ ID NO 89 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 89
augcggauca aauugcucuu cuc 23 <210> SEQ ID NO 90 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 90
cuuugcucaa ugauuagauc cuu 23 <210> SEQ ID NO 91 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 91
uaaaucuuug cucaaugauu aga 23 <210> SEQ ID NO 92 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 92
ugugcgauga aaucuuugcu caa 23 <210> SEQ ID NO 93 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 93
uauugugcga ugaaaucuuu gcu 23 <210> SEQ ID NO 94 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 94
uugagcugga caaugucacu uuu 23 <210> SEQ ID NO 95 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 95
aucuucugca uguauuuugu gca 23 <210> SEQ ID NO 96 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 96
acuguuugaa gaucggaaca gaa 23 <210> SEQ ID NO 97 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 97
aacuguuuga agaucggaac aga 23 <210> SEQ ID NO 98 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 98
ucuugugaaa cuguuugaag auc 23 <210> SEQ ID NO 99 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 99
uucuugugaa acuguuugaa gau 23 <210> SEQ ID NO 100 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 100
auucuuguga aacuguuuga aga 23 <210> SEQ ID NO 101 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 101
ugaauugcua uucucugcug gaa 23 <210> SEQ ID NO 102 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 102
ugucucugaa uugcuauucu cug 23 <210> SEQ ID NO 103 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 103
uggucucuga auugcuauuc ucu 23 <210> SEQ ID NO 104 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 104
uaugauaaug gucucugaau ugc 23 <210> SEQ ID NO 105 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 105
uugaugauaa uggucucuga auu 23 <210> SEQ ID NO 106 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 106
ugugaugaua auggucucug aau 23 <210> SEQ ID NO 107 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 107
ucugugauga uaauggucuc uga 23 <210> SEQ ID NO 108 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 108
aacagugaaa cucuugguuu gcu 23 <210> SEQ ID NO 109 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 109
uaacagugaa acucuugguu ugc 23 <210> SEQ ID NO 110 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 110
uaugucaaca gugaaacucu ugg 23 <210> SEQ ID NO 111 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 111
uacagaucga uggaauuucu ggg 23 <210> SEQ ID NO 112 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 112
uugucuggga auuuaauuug aac 23 <210> SEQ ID NO 113 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 113
aagagcguca acaauuuacg gag 23 <210> SEQ ID NO 114 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 114
uuagcacgaa ugcucaugac cuu 23 <210> SEQ ID NO 115 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 115
uuuagcacga augcucauga ccu 23 <210> SEQ ID NO 116 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 116
uaucuuagca cgaaugcuca uga 23 <210> SEQ ID NO 117 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 117
uguuaucuua gcacgaaugc uca 23 <210> SEQ ID NO 118 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 118
uagucuguua ucuuagcacg aau 23 <210> SEQ ID NO 119 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 119
caugaguucc guugcaguuu u 21 <210> SEQ ID NO 120 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 120
augaguuccg uugcaguuuu a 21 <210> SEQ ID NO 121 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 121
ccguugcagu uuugacccaa a 21 <210> SEQ ID NO 122 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 122
acccaagaga guuuugcuga a 21 <210> SEQ ID NO 123 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 123
caaaucaaag uugccacucu a 21 <210> SEQ ID NO 124 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 124
acaagcaaaa aucugccuug a 21 <210> SEQ ID NO 125 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 125
aacaccaucg cuuuguuauu a 21 <210> SEQ ID NO 126 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 126
aacugcaaga cuuggagcua a 21 <210> SEQ ID NO 127 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 127
cuaaaaacug caaccaaaau a 21 <210> SEQ ID NO 128 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 128
ugcaaccaaa auccagaucc a 21 <210> SEQ ID NO 129 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 129
aucaagaaga uuuaugagga a 21 <210> SEQ ID NO 130 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 130
gaaaaagaag acuacaacca u 21 <210> SEQ ID NO 131 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 131
aaaaagaaga cuacaaccau u 21 <210> SEQ ID NO 132 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 132
aaaagaagac uacaaccauu a 21 <210> SEQ ID NO 133 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 133
acuacaacca uugcagugga a 21 <210> SEQ ID NO 134 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 134
ugcaguggaa gugaagaaau a 21 <210> SEQ ID NO 135 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 135
gaagagcaau uugauccgca u 21 <210> SEQ ID NO 136 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 136
ggaucuaauc auugagcaaa g 21 <210> SEQ ID NO 137 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 137
uaaucauuga gcaaagauuu a 21 <210> SEQ ID NO 138 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 138
gagcaaagau uucaucgcac a 21 <210> SEQ ID NO 139 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 139
caaagauuuc aucgcacaau a 21 <210> SEQ ID NO 140 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 140
aagugacauu guccagcuca a 21 <210> SEQ ID NO 141 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 141
cacaaaauac augcagaaga u 21 <210> SEQ ID NO 142 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 142
cuguuccgau cuucaaacag u 21 <210> SEQ ID NO 143 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 143
uguuccgauc uucaaacagu u 21 <210> SEQ ID NO 144 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 144
ucuucaaaca guuucacaag a 21 <210> SEQ ID NO 145 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 145
cuucaaacag uuucacaaga a 21 <210> SEQ ID NO 146 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 146
uucaaacagu uucacaagaa u 21 <210> SEQ ID NO 147 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 147
ccagcagaga auagcaauuc a 21 <210> SEQ ID NO 148 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 148
gagaauagca auucagagac a 21 <210> SEQ ID NO 149 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 149
agaauagcaa uucagagacc a 21 <210> SEQ ID NO 150 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 150
aauucagaga ccauuaucau a 21 <210> SEQ ID NO 151 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 151
uucagagacc auuaucauca a 21 <210> SEQ ID NO 152 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 152
ucagagacca uuaucaucac a 21 <210> SEQ ID NO 153 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 153
agagaccauu aucaucacag a 21 <210> SEQ ID NO 154 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 154
caaaccaaga guuucacugu u 21 <210> SEQ ID NO 155 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 155
aaaccaagag uuucacuguu a 21 <210> SEQ ID NO 156 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 156
aagaguuuca cuguugacau a 21 <210> SEQ ID NO 157 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 157
cagaaauucc aucgaucugu a 21 <210> SEQ ID NO 158 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 158
ucaaauuaaa uucccagaca a 21 <210> SEQ ID NO 159 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 159
ccguaaauug uugacgcucu u 21 <210> SEQ ID NO 160 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 160
ggucaugagc auucgugcua a 21 <210> SEQ ID NO 161 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 161
gucaugagca uucgugcuaa a 21 <210> SEQ ID NO 162 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 162
augagcauuc gugcuaagau a 21 <210> SEQ ID NO 163 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 163
agcauucgug cuaagauaac a 21 <210> SEQ ID NO 164 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 164
ucgugcuaag auaacagacu a 21 <210> SEQ ID NO 165 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 165
aaaacugcaa cggaacucau ggu 23 <210> SEQ ID NO 166 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 166
uaaaacugca acggaacuca ugg 23 <210> SEQ ID NO 167 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 167
uuugggucaa aacugcaacg gaa 23 <210> SEQ ID NO 168 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 168
uucagcaaaa cucucuuggg uca 23 <210> SEQ ID NO 169 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 169
uagaguggca acuuugauuu guu 23 <210> SEQ ID NO 170 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 170
ucaaggcaga uuuuugcuug uuc 23 <210> SEQ ID NO 171 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 171
uaauaacaaa gcgauggugu ucu 23 <210> SEQ ID NO 172 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 172
uuagcuccaa gucuugcagu uuc 23 <210> SEQ ID NO 173 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 173
uauuuugguu gcaguuuuua gcu 23 <210> SEQ ID NO 174 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 174
uggaucugga uuuugguugc agu 23 <210> SEQ ID NO 175 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 175
uuccucauaa aucuucuuga ugc 23 <210> SEQ ID NO 176 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 176
augguuguag ucuucuuuuu cuu 23 <210> SEQ ID NO 177 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 177
aaugguugua gucuucuuuu ucu 23 <210> SEQ ID NO 178 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 178
uaaugguugu agucuucuuu uuc 23 <210> SEQ ID NO 179 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 179
uuccacugca augguuguag ucu 23 <210> SEQ ID NO 180 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 180
uauuucuuca cuuccacugc aau 23 <210> SEQ ID NO 181 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 181
augcggauca aauugcucuu cuc 23 <210> SEQ ID NO 182 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 182
cuuugcucaa ugauuagauc cuu 23 <210> SEQ ID NO 183 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 183
uaaaucuuug cucaaugauu aga 23 <210> SEQ ID NO 184 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 184
ugugcgauga aaucuuugcu caa 23 <210> SEQ ID NO 185 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 185
uauugugcga ugaaaucuuu gcu 23 <210> SEQ ID NO 186 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 186
uugagcugga caaugucacu uuu 23 <210> SEQ ID NO 187 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 187
aucuucugca uguauuuugu gca 23 <210> SEQ ID NO 188 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 188
acuguuugaa gaucggaaca gaa 23 <210> SEQ ID NO 189 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 189
aacuguuuga agaucggaac aga 23 <210> SEQ ID NO 190 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 190
ucuugugaaa cuguuugaag auc 23 <210> SEQ ID NO 191 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 191
uucuugugaa acuguuugaa gau 23 <210> SEQ ID NO 192 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 192
auucuuguga aacuguuuga aga 23 <210> SEQ ID NO 193 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 193
ugaauugcua uucucugcug gaa 23 <210> SEQ ID NO 194 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 194
ugucucugaa uugcuauucu cug 23 <210> SEQ ID NO 195 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 195
uggucucuga auugcuauuc ucu 23 <210> SEQ ID NO 196 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 196
uaugauaaug gucucugaau ugc 23 <210> SEQ ID NO 197 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 197
uugaugauaa uggucucuga auu 23 <210> SEQ ID NO 198 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 198
ugugaugaua auggucucug aau 23 <210> SEQ ID NO 199 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 199
ucugugauga uaauggucuc uga 23 <210> SEQ ID NO 200 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 200
aacagugaaa cucuugguuu gcu 23 <210> SEQ ID NO 201 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 201
uaacagugaa acucuugguu ugc 23 <210> SEQ ID NO 202 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 202
uaugucaaca gugaaacucu ugg 23 <210> SEQ ID NO 203 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 203
uacagaucga uggaauuucu ggg 23 <210> SEQ ID NO 204 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 204
uugucuggga auuuaauuug aac 23 <210> SEQ ID NO 205 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 205
aagagcguca acaauuuacg gag 23 <210> SEQ ID NO 206 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 206
uuagcacgaa ugcucaugac cuu 23 <210> SEQ ID NO 207 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 207
uuuagcacga augcucauga ccu 23 <210> SEQ ID NO 208 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 208
uaucuuagca cgaaugcuca uga 23 <210> SEQ ID NO 209 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 209
uguuaucuua gcacgaaugc uca 23 <210> SEQ ID NO 210 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 210
uagucuguua ucuuagcacg aau 23 <210> SEQ ID NO 211 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 211
accaugaguu ccguugcagu uuu 23 <210> SEQ ID NO 212 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 212
ccaugaguuc cguugcaguu uug 23 <210> SEQ ID NO 213 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 213
uuccguugca guuuugaccc aag 23 <210> SEQ ID NO 214 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 214
ugacccaaga gaguuuugcu gaa 23 <210> SEQ ID NO 215 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 215
aacaaaucaa aguugccacu cua 23 <210> SEQ ID NO 216 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 216
gaacaagcaa aaaucugccu uga 23 <210> SEQ ID NO 217 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 217
agaacaccau cgcuuuguua uug 23 <210> SEQ ID NO 218 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 218
gaaacugcaa gacuuggagc uaa 23 <210> SEQ ID NO 219 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 219
agcuaaaaac ugcaaccaaa auc 23 <210> SEQ ID NO 220 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 220
acugcaacca aaauccagau ccc 23 <210> SEQ ID NO 221 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 221
gcaucaagaa gauuuaugag gag 23 <210> SEQ ID NO 222 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 222
aagaaaaaga agacuacaac cau 23 <210> SEQ ID NO 223 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 223
agaaaaagaa gacuacaacc auu 23 <210> SEQ ID NO 224 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 224
gaaaaagaag acuacaacca uug 23 <210> SEQ ID NO 225 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 225
agacuacaac cauugcagug gaa 23 <210> SEQ ID NO 226 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 226
auugcagugg aagugaagaa auc 23 <210> SEQ ID NO 227 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 227
gagaagagca auuugauccg cau 23 <210> SEQ ID NO 228 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 228
aaggaucuaa ucauugagca aag 23 <210> SEQ ID NO 229 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 229
ucuaaucauu gagcaaagau uuc 23 <210> SEQ ID NO 230 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 230
uugagcaaag auuucaucgc aca 23 <210> SEQ ID NO 231 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 231
agcaaagauu ucaucgcaca auc 23 <210> SEQ ID NO 232 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 232
aaaagugaca uuguccagcu cag 23 <210> SEQ ID NO 233 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 233
ugcacaaaau acaugcagaa gau 23 <210> SEQ ID NO 234 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 234
uucuguuccg aucuucaaac agu 23 <210> SEQ ID NO 235 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 235
ucuguuccga ucuucaaaca guu 23 <210> SEQ ID NO 236 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 236
gaucuucaaa caguuucaca aga 23 <210> SEQ ID NO 237 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 237
aucuucaaac aguuucacaa gaa 23 <210> SEQ ID NO 238 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 238
ucuucaaaca guuucacaag aau 23 <210> SEQ ID NO 239 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 239
uuccagcaga gaauagcaau uca 23 <210> SEQ ID NO 240 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 240
cagagaauag caauucagag acc 23 <210> SEQ ID NO 241 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 241
agagaauagc aauucagaga cca 23 <210> SEQ ID NO 242 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 242
gcaauucaga gaccauuauc auc 23 <210> SEQ ID NO 243 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 243
aauucagaga ccauuaucau cac 23 <210> SEQ ID NO 244 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 244
auucagagac cauuaucauc aca 23 <210> SEQ ID NO 245 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 245
ucagagacca uuaucaucac agg 23 <210> SEQ ID NO 246 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 246
agcaaaccaa gaguuucacu guu 23 <210> SEQ ID NO 247 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 247
gcaaaccaag aguuucacug uug 23 <210> SEQ ID NO 248 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 248
ccaagaguuu cacuguugac auc 23 <210> SEQ ID NO 249 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 249
cccagaaauu ccaucgaucu guc 23 <210> SEQ ID NO 250 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 250
guucaaauua aauucccaga cag 23 <210> SEQ ID NO 251 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 251
cuccguaaau uguugacgcu cuu 23 <210> SEQ ID NO 252 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 252
aaggucauga gcauucgugc uaa 23 <210> SEQ ID NO 253 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 253
aggucaugag cauucgugcu aag 23 <210> SEQ ID NO 254 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 254
ucaugagcau ucgugcuaag aua 23 <210> SEQ ID NO 255 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 255
ugagcauucg ugcuaagaua aca 23 <210> SEQ ID NO 256 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 256
auucgugcua agauaacaga cuc 23 <210> SEQ ID NO 257 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 257
aaaaaaaaaa aaaaaaaa 18 <210> SEQ ID NO 258 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 258
uuuuuuuuuu uuuuuuuu 18 <210> SEQ ID NO 259 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 259
cccccccccc cccccccc 18 <210> SEQ ID NO 260 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 260
cucucucucu cucucucu 18 <210> SEQ ID NO 261 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 261
ccuccuccuc cuccuccu 18 <210> SEQ ID NO 262 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 262
cuucuucuuc uucuucuu 18 <210> SEQ ID NO 263 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 263
acuacuacua cuacuacu 18 <210> SEQ ID NO 264 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 264
uuccucuucu uccucuuc 18 <210> SEQ ID NO 265 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 265
uuacuuuaau uacuuuaa 18 <210> SEQ ID NO 266 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 266
caacaacaac aacaacaa 18 <210> SEQ ID NO 267 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 267
ggugguggug gugguggu 18 <210> SEQ ID NO 268 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 268
guuguuguug uuguuguu 18 <210> SEQ ID NO 269 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 269
caucaucauc aucaucau 18 <210> SEQ ID NO 270 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 270
gaugaugaug augaugau 18 <210> SEQ ID NO 271 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 271
caccaccacc accaccac 18 <210> SEQ ID NO 272 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 272
guaguaguag uaguagua 18 <210> SEQ ID NO 273 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 273
gccgccgccg ccgccgcc 18 <210> SEQ ID NO 274 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 274
auuauuauua uuauuauu 18 <210> SEQ ID NO 275 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 275
aacaaccucc uccuccua 18 <210> SEQ ID NO 276 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 276
aaccaacucc uccuccua 18 <210> SEQ ID NO 277 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 277
aaccuaaucc uccuccua 18 <210> SEQ ID NO 278 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 278
aaccucaacc uccuccua 18 <210> SEQ ID NO 279 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 279
aaccuccaac uccuccua 18 <210> SEQ ID NO 280 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 280
aaccuccuaa uccuccua 18 <210> SEQ ID NO 281 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 281
aaccuccuca accuccua 18 <210> SEQ ID NO 282 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 282
aaccuccucc aacuccua 18 <210> SEQ ID NO 283 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 283
aaccuccucc uaauccua 18 <210> SEQ ID NO 284 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 284
aaccuccucc ucaaccua 18 <210> SEQ ID NO 285 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 285
aaccuccucc uccaacua 18 <210> SEQ ID NO 286 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 286
aaccuccucc uccuaaua 18 <210> SEQ ID NO 287 <211>
LENGTH: 15 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 287
ccuccuccuc cuccu 15 <210> SEQ ID NO 288 <211> LENGTH:
12 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 288 ccuccuccuc cu 12
<210> SEQ ID NO 289 <211> LENGTH: 24 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 289 ccuccuccuc cuccuccucc
uccu 24 <210> SEQ ID NO 290 <211> LENGTH: 30
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 290 ccuccuccuc cuccuccucc
uccuccuccu 30 <210> SEQ ID NO 291 <211> LENGTH: 37
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 291 gagatttaac tccacctact
tccagggcac caaccag 37 <210> SEQ ID NO 292 <211> LENGTH:
22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 292 atttaactcc acctactccc ag
22 <210> SEQ ID NO 293 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 293 atttaactcc acctacctcc ag
22 <210> SEQ ID NO 294 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 294 atttaactcc acccacttcc ag
22 <210> SEQ ID NO 295 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 295 atttaactcc acctacctcc a
21 <210> SEQ ID NO 296 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 296 atttaacccc acctacttcc ag
22 <210> SEQ ID NO 297 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 297 atctaactcc acctacttcc ag
22 <210> SEQ ID NO 298 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 298 atctaactcc acctacttcc 20
<210> SEQ ID NO 299 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 299 atttaactcc acctactccc a
21 <210> SEQ ID NO 300 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 300 attcaactcc acctacttcc ag
22 <210> SEQ ID NO 301 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 301 attcaactcc acctacttcc 20
<210> SEQ ID NO 302 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 302 atttaactcc acctacctcc 20
<210> SEQ ID NO 303 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 303 atttaacccc acctacttcc 20
<210> SEQ ID NO 304 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 304 atttaactcc acccacttcc a
21 <210> SEQ ID NO 305 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 305 atctaactcc acctacttcc a
21 <210> SEQ ID NO 306 <211> LENGTH: 26 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 306 gatttaactc cacctacttc
cagggc 26 <210> SEQ ID NO 307 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 307 gatttaaatc aacctaatta
cagggc 26 <210> SEQ ID NO 308 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 308 ccggcaatca tgccttacga
ttatcc 26 <210> SEQ ID NO 309 <211> LENGTH: 37
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 309 gtggactacc tcaataatca
tcttcttcag ggattca 37 <210> SEQ ID NO 310 <211> LENGTH:
26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 310 actacctcaa taaccatctt
cttcag 26 <210> SEQ ID NO 311 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 311 actacctcaa taatcacctt
cttcag 26 <210> SEQ ID NO 312 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 312 actacctcaa caatcatctt
cttcag 26 <210> SEQ ID NO 313 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 313 actacctcaa taatcatcct
cttcag 26 <210> SEQ ID NO 314 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 314 actacctcaa taatcatctt
cctcag 26 <210> SEQ ID NO 315 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 315 actacctcaa taatcatctt
ctccag 26 <210> SEQ ID NO 316 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 316 actacctcaa taaccatctt 20
<210> SEQ ID NO 317 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 317 actaccccaa taatcatctt
cttcag 26 <210> SEQ ID NO 318 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 318 actacctcaa taatcacctt 20
<210> SEQ ID NO 319 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 319 accacctcaa taatcatctt
cttcag 26 <210> SEQ ID NO 320 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 320 ctcaataacc atcttcttca g
21 <210> SEQ ID NO 321 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 321 actacctcaa taatcacctt c
21 <210> SEQ ID NO 322 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 322 actacctcaa taaccatctt
cttca 25 <210> SEQ ID NO 323 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 323 actacctcaa taatcatctc
cttcag 26 <210> SEQ ID NO 324 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 324 ctacctcaat aatcatcttc
ttcagg 26 <210> SEQ ID NO 325 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 325 ctaactaaat aataatatta
ttaagg 26 <210> SEQ ID NO 326 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 326 cgcaactttt acattctatc
atagcc 26
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 326
<210> SEQ ID NO 1 <211> LENGTH: 21 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 1 gagaucaaca uugaccauaa a 21
<210> SEQ ID NO 2 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 2 uuuaugguca auguugaucu cua
23 <210> SEQ ID NO 3 <211> LENGTH: 21 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 3 aggaagaucg ggcuuuaagg a 21
<210> SEQ ID NO 4 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 4 uccuuaaagc ccgaucuucc ugc
23 <210> SEQ ID NO 5 <211> LENGTH: 6524 <212>
TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE:
5 tttgccaact gcttcctggc tcagtgcgac ctggccttct tcccctcccc catgcggccg
60 gcttccgagt gcgcaagccc agagtcgtcc gcgttgtccg cctctgcgca
agcgccgtgc 120 tcctcccacg gcagttggcc atatagaggc tgggggtggg
gggggaggtc aagcgtagcc 180 tcttctcctt taccaagatg gcggcttgtc
cctgtttcgc cacagttcct accttatgag 240 ctcggttttc ttatgcttat
aagagtggaa cagcaaaagc tggcaggctg acagaggcgg 300 cctcaggacg
gaccttctgg ctactgaccg ttttgctgtg gttttcccgg attgtgtgta 360
ggtgtgagat caaccatgag ttccgttgca gttttgaccc aagagagttt tgctgaacac
420 cgaagtgggc tggttccgca acaaatcaaa gttgccactc taaattcaga
agaggagagc 480 gaccctccaa cctacaagga tgccttccct ccacttcctg
agaaagctgc ttgcctggaa 540 agtgcccagg aacccgctgg agcctggggg
aacaagatcc gacccatcaa ggcttctgtc 600 atcactcagg tgttccatgt
acccctggag gagagaaaat acaaggatat gaaccagttt 660 ggagaaggtg
aacaagcaaa aatctgcctt gagatcatgc agagaactgg tgctcacttg 720
gagctgtctt tggccaaaga ccaaggcctc tccatcatgg tgtcaggaaa gctggatgct
780 gtcatgaaag ctcggaagga cattgttgct agactgcaga ctcaggcctc
agcaactgtt 840 gccattccca aagaacacca tcgctttgtt attggcaaaa
atggagagaa actgcaagac 900 ttggagctaa aaactgcaac caaaatccag
atcccacgcc cagatgaccc cagcaatcag 960 atcaagatca ctggcaccaa
agagggcatc gagaaagctc gccatgaagt cttactcatc 1020 tctgccgagc
aggacaaacg tgctgtggag aggctagaag tagaaaaggc attccacccc 1080
ttcatcgctg ggccgtataa tagactggtt ggcgagatca tgcaggagac aggcacgcgc
1140 atcaacatcc ccccacccag cgtgaaccgg acagagattg tcttcactgg
agagaaggaa 1200 cagttggctc aggctgtggc tcgcatcaag aagatttatg
aggagaagaa aaagaagact 1260 acaaccattg cagtggaagt gaagaaatcc
caacacaagt atgtcattgg gcccaagggc 1320 aattcattgc aggagatcct
tgagagaact ggagtttccg ttgagatccc accctcagac 1380 agcatctctg
agactgtaat acttcgaggc gaacctgaaa agttaggtca ggcgttgact 1440
gaagtctatg ccaaggccaa tagcttcacc gtctcctctg tcgccgcccc ttcctggctt
1500 caccgtttca tcattggcaa gaaagggcag aacctggcca aaatcactca
gcagatgcca 1560 aaggttcaca tcgagttcac agagggcgaa gacaagatca
ccctggaggg ccctacagag 1620 gatgtcaatg tggcccagga acagatagaa
ggcatggtca aagatttgat taaccggatg 1680 gactatgtgg agatcaacat
cgaccacaag ttccacaggc acctcattgg gaagagcggt 1740 gccaacataa
acagaatcaa agaccagtac aaggtgtccg tgcgcatccc tcctgacagt 1800
gagaagagca atttgatccg catcgagggg gacccacagg gcgtgcagca ggccaagcga
1860 gagctgctgg agcttgcatc tcgcatggaa aatgagcgta ccaaggatct
aatcattgag 1920 caaagatttc atcgcacaat cattgggcag aagggtgaac
ggatccgtga aattcgtgac 1980 aaattcccag aggtcatcat taactttcca
gacccagcac aaaaaagtga cattgtccag 2040 ctcagaggac ctaagaatga
ggtggaaaaa tgcacaaaat acatgcagaa gatggtggca 2100 gatctggtgg
aaaatagcta ttcaatttct gttccgatct tcaaacagtt tcacaagaat 2160
atcattggga aaggaggcgc aaacattaaa aagattcgtg aagaaagcaa caccaaaatc
2220 gaccttccag cagagaatag caattcagag accattatca tcacaggcaa
gcgagccaac 2280 tgcgaagctg cccggagcag gattctgtct attcagaaag
acctggccaa catagccgag 2340 gtagaggtct ccatccctgc caagctgcac
aactccctca ttggcaccaa gggccgtctg 2400 atccgctcca tcatggagga
gtgcggcggg gtccacattc actttcccgt ggaaggttca 2460 ggaagcgaca
ccgttgttat caggggccct tcctcggatg tggagaaggc caagaagcag 2520
ctcctgcatc tggcggagga gaagcaaacc aagagtttca ctgttgacat ccgcgccaag
2580 ccagaatacc acaaattcct catcggcaag gggggcggca aaattcgcaa
ggtgcgcgac 2640 agcactggag cacgtgtcat cttccctgcg gctgaggaca
aggaccagga cctgatcacc 2700 atcattggaa aggaggacgc cgtccgagag
gcacagaagg agctggaggc cttgatccaa 2760 aacctggata atgtggtgga
agactccatg ctggtggacc ccaagcacca ccgccacttc 2820 gtcatccgca
gaggccaggt cttgcgggag attgctgaag agtatggcgg ggtgatggtc 2880
agcttcccac gctctggcac acagagcgac aaagtcaccc tcaagggcgc caaggactgt
2940 gtggaggcag ccaagaaacg cattcaggag atcattgagg acctggaagc
tcaggtgaca 3000 ttagaatgtg ctatacccca gaaattccat cgatctgtca
tgggccccaa aggttccaga 3060 atccagcaga ttactcggga tttcagtgtt
caaattaaat tcccagacag agaggagaac 3120 gcagttcaca gtacagagcc
agttgtccag gagaatgggg acgaagctgg ggaggggaga 3180 gaggctaaag
attgtgaccc cggctctcca aggaggtgtg acatcatcat catctctggc 3240
cggaaagaaa agtgtgaggc tgccaaggaa gctctggagg cattggttcc tgtcaccatt
3300 gaagtagagg tgccctttga ccttcaccgt tacgttattg ggcagaaagg
aagtgggatc 3360 cgcaagatga tggatgagtt tgaggtgaac atacatgtcc
cggcacctga gctgcagtct 3420 gacatcatcg ccatcacggg cctcgctgca
aatttggacc gggccaaggc tggactgctg 3480 gagcgtgtga aggagctaca
ggccgagcag gaggaccggg ctttaaggag ttttaagctg 3540 agtgtcactg
tagaccccaa ataccatccc aagattatcg ggagaaaggg ggcagtaatt 3600
acccaaatcc ggttggagca tgacgtgaac atccagtttc ctgataagga cgatgggaac
3660 cagccccagg accaaattac catcacaggg tacgaaaaga acacagaagc
tgccagggat 3720 gctatactga gaattgtggg tgaacttgag cagatggttt
ctgaggacgt cccgctggac 3780 caccgcgttc acgcccgcat cattggtgcc
cgcggcaaag ccattcgcaa aatcatggac 3840 gaattcaagg tggacattcg
cttcccacag agcggagccc cagaccccaa ctgcgtcact 3900 gtgacggggc
tcccagagaa tgtggaggaa gccatcgacc acatcctcaa tctggaggag 3960
gaatacctag ctgacgtggt ggacagtgag gcgctgcagg tatacatgaa acccccagca
4020 cacgaagagg ccaaggcacc ttccagaggc tttgtggtgc gggacgcacc
ctggaccgcc 4080 agcagcagtg agaaggctcc tgacatgagc agctctgagg
aatttcccag ctttggggct 4140 caggtggctc ccaagaccct cccttggggc
cccaaacgat aatgatcaaa aagaacagaa 4200 ccctctccag cctgctgacc
caaacccaac cacacaatgg tttgtctcaa tctgacccag 4260 cggctggacc
ctccgtaaat tgttgacgct cttccccctt cccgaggtcc cgcagggagc 4320
ctagcgcctg gctgtgtgtg cggccgctcc tccaggcctg gccgtgcccg ctcaggacct
4380 gctccactgt ttaacactaa accaaggtca tgagcattcg tgctaagata
acagactcca 4440 gctcctggtc cacccggcat gtcagtcagc actctggcct
tcatcacgag agctccgcag 4500 ccgtggctag gattccactt cctgtgtcat
gacctcagga aataaacgtc cttgacttta 4560 taaaagccaa acgtttgccc
tcttcctttc ccacctccct cctgccagtt tcccttggtc 4620 cagacagtcc
tgtttgtgga gtgcaatcag cctcctccag ctgccagagc gcctcagcac 4680
aggtgtcagg gtgcaaggaa gacctggcaa tggacagcag gaggcaggtt cctggagctg
4740 gggggtgacc tgagaggcag agggtgacgg gttctcaggc agtcctgatt
ttacctgccg 4800 tggggtctga aagcaccaag ggtccctgcc cctacctcca
ctgccagacc ctcagcctga 4860 ggtctggtga gtggagcctg gaggcaaggt
ggtaggcacc atctgggtcc cctgtggccg 4920 tcacagtgtc tgctgtgatt
gagatgcgca caggttgggg gaggtagggc cttacgcttg 4980 tcctcagtgg
gggcagtttg ccttagatga cagctgggct cttcttcaca ccacctgcag 5040
cccctccctg cccctgccct agctgctgtg tgttcagttg ccttctttct acctcagccg
5100 gcgtggagtg gtctctgtgc agttagtgcc accccacaca cccgtctctt
gattgagatg 5160 tttctggtgg ttatgggttt cccgtggagc tgggggtggg
cgccgtgtac ctaagctgga 5220 ggctggcgct ctccctcagc acaggtgggt
cagtggccag caggcccatc tggagtggga 5280 gtgggcactt ccaccccgcc
cacaggccat ccggctgtgc aggccagccc ctaggagcag 5340 gtcccgggtg
actggcagtt ttcacggtct agggccgaga cgatggcatg gggcctagag 5400
catgaggtag agcagaatgc agaccacgcc gctggatgcc gagagaccct gctctccgag
5460
ggaggcatct gtgtcatgct gtgagggctg aggacggggc cctagtctct ggttttctgg
5520 tcttaacatc cttatctgtg tccgccacgg aggtgactga gctgctagcg
agttgtcctg 5580 tcccaggtac ttgagttttg gaaaagctga ctcacgccca
tccatctcac agcccttccc 5640 tggggacagt cgcttccgcc ttgacacctc
actctcagtt gaataactca agcttggtca 5700 tcttcagact cgaattcttg
agtagaccca gacggcttag cccaagtcta gttgcagctg 5760 cctcggcaag
tccccatttg ctcaggcagc cctgaatggg cctgtttaca ggaatggtaa 5820
attgggattg gaaggaatat agcttccagc ttcataggct agggtgacca cggcttagga
5880 aacagggaaa gaaagcaagg cccttttcct gcctttcccg ggatctgtct
actccacctc 5940 cacgggggag gccagtgggg aagggctgtc acctcttccc
catctgcatg agttctggaa 6000 ctctgtcctg ttggctgctt gcttccagct
ccccccaatc tccatcgcag cgggttcctc 6060 ctgtcttttc tacagtgtca
taaaacatcc tgcccctacc ctctcccaaa ggtcaatttt 6120 aattctcacc
aagttttgca catctctgta tgtcgcttga tgtcttagac gcgagccctt 6180
tcctaaactg ttcagcgctc tcttttcctt tgggtggttg ttgcaagggt gatgacatga
6240 ctgtccccag gcctgtctcc ctgaagcgtc tgtgctgtca ggacagccct
gggcagagat 6300 gaggcagggg tgaggcgtgc gtgtgctttt cctccttgtt
ggatgtcttc catatcatct 6360 gtttccatag ctacaatcca tcccttggcc
ttaactttgg aatttggaga ttatatgcaa 6420 acatgtgtaa aggctcatga
atatggatga cactggaatt ttataaattc taaaataaaa 6480 cccgaaacca
gatgtagcat gctgggactc attttgtcaa aaaa 6524 <210> SEQ ID NO 6
<211> LENGTH: 6377 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 6 aggcgggatt
gggccgccgc cctatatagc agccggggcc cgggcgccgc gcctcggagc 60
gtcccggctt ctcccgcgcg gggggcgagt aagccagcgg caggaccagc gggcgggggc
120 ccacgacaaa agctggcagg ctgacagagg cggcctcagg acggaccttc
tggctactga 180 ccgttttgct gtggttttcc cggattgtgt gtaggtgtga
gatcaaccat gagttccgtt 240 gcagttttga cccaagagag ttttgctgaa
caccgaagtg ggctggttcc gcaacaaatc 300 aaagttgcca ctctaaattc
agaagaggag agcgaccctc caacctacaa ggatgccttc 360 cctccacttc
ctgagaaagc tgcttgcctg gaaagtgccc aggaacccgc tggagcctgg 420
gggaacaaga tccgacccat caaggcttct gtcatcactc aggtgttcca tgtacccctg
480 gaggagagaa aatacaagga tatgaaccag tttggagaag gtgaacaagc
aaaaatctgc 540 cttgagatca tgcagagaac tggtgctcac ttggagctgt
ctttggccaa agaccaaggc 600 ctctccatca tggtgtcagg aaagctggat
gctgtcatga aagctcggaa ggacattgtt 660 gctagactgc agactcaggc
ctcagcaact gttgccattc ccaaagaaca ccatcgcttt 720 gttattggca
aaaatggaga gaaactgcaa gacttggagc taaaaactgc aaccaaaatc 780
cagatcccac gcccagatga ccccagcaat cagatcaaga tcactggcac caaagagggc
840 atcgagaaag ctcgccatga agtcttactc atctctgccg agcaggacaa
acgtgctgtg 900 gagaggctag aagtagaaaa ggcattccac cccttcatcg
ctgggccgta taatagactg 960 gttggcgaga tcatgcagga gacaggcacg
cgcatcaaca tccccccacc cagcgtgaac 1020 cggacagaga ttgtcttcac
tggagagaag gaacagttgg ctcaggctgt ggctcgcatc 1080 aagaagattt
atgaggagaa gaaaaagaag actacaacca ttgcagtgga agtgaagaaa 1140
tcccaacaca agtatgtcat tgggcccaag ggcaattcat tgcaggagat ccttgagaga
1200 actggagttt ccgttgagat cccaccctca gacagcatct ctgagactgt
aatacttcga 1260 ggcgaacctg aaaagttagg tcaggcgttg actgaagtct
atgccaaggc caatagcttc 1320 accgtctcct ctgtcgccgc cccttcctgg
cttcaccgtt tcatcattgg caagaaaggg 1380 cagaacctgg ccaaaatcac
tcagcagatg ccaaaggttc acatcgagtt cacagagggc 1440 gaagacaaga
tcaccctgga gggccctaca gaggatgtca atgtggccca ggaacagata 1500
gaaggcatgg tcaaagattt gattaaccgg atggactatg tggagatcaa catcgaccac
1560 aagttccaca ggcacctcat tgggaagagc ggtgccaaca taaacagaat
caaagaccag 1620 tacaaggtgt ccgtgcgcat ccctcctgac agtgagaaga
gcaatttgat ccgcatcgag 1680 ggggacccac agggcgtgca gcaggccaag
cgagagctgc tggagcttgc atctcgcatg 1740 gaaaatgagc gtaccaagga
tctaatcatt gagcaaagat ttcatcgcac aatcattggg 1800 cagaagggtg
aacggatccg tgaaattcgt gacaaattcc cagaggtcat cattaacttt 1860
ccagacccag cacaaaaaag tgacattgtc cagctcagag gacctaagaa tgaggtggaa
1920 aaatgcacaa aatacatgca gaagatggtg gcagatctgg tggaaaatag
ctattcaatt 1980 tctgttccga tcttcaaaca gtttcacaag aatatcattg
ggaaaggagg cgcaaacatt 2040 aaaaagattc gtgaagaaag caacaccaaa
atcgaccttc cagcagagaa tagcaattca 2100 gagaccatta tcatcacagg
caagcgagcc aactgcgaag ctgcccggag caggattctg 2160 tctattcaga
aagacctggc caacatagcc gaggtagagg tctccatccc tgccaagctg 2220
cacaactccc tcattggcac caagggccgt ctgatccgct ccatcatgga ggagtgcggc
2280 ggggtccaca ttcactttcc cgtggaaggt tcaggaagcg acaccgttgt
tatcaggggc 2340 ccttcctcgg atgtggagaa ggccaagaag cagctcctgc
atctggcgga ggagaagcaa 2400 accaagagtt tcactgttga catccgcgcc
aagccagaat accacaaatt cctcatcggc 2460 aaggggggcg gcaaaattcg
caaggtgcgc gacagcactg gagcacgtgt catcttccct 2520 gcggctgagg
acaaggacca ggacctgatc accatcattg gaaaggagga cgccgtccga 2580
gaggcacaga aggagctgga ggccttgatc caaaacctgg ataatgtggt ggaagactcc
2640 atgctggtgg accccaagca ccaccgccac ttcgtcatcc gcagaggcca
ggtcttgcgg 2700 gagattgctg aagagtatgg cggggtgatg gtcagcttcc
cacgctctgg cacacagagc 2760 gacaaagtca ccctcaaggg cgccaaggac
tgtgtggagg cagccaagaa acgcattcag 2820 gagatcattg aggacctgga
agctcaggtg acattagaat gtgctatacc ccagaaattc 2880 catcgatctg
tcatgggccc caaaggttcc agaatccagc agattactcg ggatttcagt 2940
gttcaaatta aattcccaga cagagaggag aacgcagttc acagtacaga gccagttgtc
3000 caggagaatg gggacgaagc tggggagggg agagaggcta aagattgtga
ccccggctct 3060 ccaaggaggt gtgacatcat catcatctct ggccggaaag
aaaagtgtga ggctgccaag 3120 gaagctctgg aggcattggt tcctgtcacc
attgaagtag aggtgccctt tgaccttcac 3180 cgttacgtta ttgggcagaa
aggaagtggg atccgcaaga tgatggatga gtttgaggtg 3240 aacatacatg
tcccggcacc tgagctgcag tctgacatca tcgccatcac gggcctcgct 3300
gcaaatttgg accgggccaa ggctggactg ctggagcgtg tgaaggagct acaggccgag
3360 caggaggacc gggctttaag gagttttaag ctgagtgtca ctgtagaccc
caaataccat 3420 cccaagatta tcgggagaaa gggggcagta attacccaaa
tccggttgga gcatgacgtg 3480 aacatccagt ttcctgataa ggacgatggg
aaccagcccc aggaccaaat taccatcaca 3540 gggtacgaaa agaacacaga
agctgccagg gatgctatac tgagaattgt gggtgaactt 3600 gagcagatgg
tttctgagga cgtcccgctg gaccaccgcg ttcacgcccg catcattggt 3660
gcccgcggca aagccattcg caaaatcatg gacgaattca aggtggacat tcgcttccca
3720 cagagcggag ccccagaccc caactgcgtc actgtgacgg ggctcccaga
gaatgtggag 3780 gaagccatcg accacatcct caatctggag gaggaatacc
tagctgacgt ggtggacagt 3840 gaggcgctgc aggtatacat gaaaccccca
gcacacgaag aggccaaggc accttccaga 3900 ggctttgtgg tgcgggacgc
accctggacc gccagcagca gtgagaaggc tcctgacatg 3960 agcagctctg
aggaatttcc cagctttggg gctcaggtgg ctcccaagac cctcccttgg 4020
ggccccaaac gataatgatc aaaaagaaca gaaccctctc cagcctgctg acccaaaccc
4080 aaccacacaa tggtttgtct caatctgacc cagcggctgg accctccgta
aattgttgac 4140 gctcttcccc cttcccgagg tcccgcaggg agcctagcgc
ctggctgtgt gtgcggccgc 4200 tcctccaggc ctggccgtgc ccgctcagga
cctgctccac tgtttaacac taaaccaagg 4260 tcatgagcat tcgtgctaag
ataacagact ccagctcctg gtccacccgg catgtcagtc 4320 agcactctgg
ccttcatcac gagagctccg cagccgtggc taggattcca cttcctgtgt 4380
catgacctca ggaaataaac gtccttgact ttataaaagc caaacgtttg ccctcttcct
4440 ttcccacctc cctcctgcca gtttcccttg gtccagacag tcctgtttgt
ggagtgcaat 4500 cagcctcctc cagctgccag agcgcctcag cacaggtgtc
agggtgcaag gaagacctgg 4560 caatggacag caggaggcag gttcctggag
ctggggggtg acctgagagg cagagggtga 4620 cgggttctca ggcagtcctg
attttacctg ccgtggggtc tgaaagcacc aagggtccct 4680 gcccctacct
ccactgccag accctcagcc tgaggtctgg tgagtggagc ctggaggcaa 4740
ggtggtaggc accatctggg tcccctgtgg ccgtcacagt gtctgctgtg attgagatgc
4800 gcacaggttg ggggaggtag ggccttacgc ttgtcctcag tgggggcagt
ttgccttaga 4860 tgacagctgg gctcttcttc acaccacctg cagcccctcc
ctgcccctgc cctagctgct 4920 gtgtgttcag ttgccttctt tctacctcag
ccggcgtgga gtggtctctg tgcagttagt 4980 gccaccccac acacccgtct
cttgattgag atgtttctgg tggttatggg tttcccgtgg 5040 agctgggggt
gggcgccgtg tacctaagct ggaggctggc gctctccctc agcacaggtg 5100
ggtcagtggc cagcaggccc atctggagtg ggagtgggca cttccacccc gcccacaggc
5160 catccggctg tgcaggccag cccctaggag caggtcccgg gtgactggca
gttttcacgg 5220 tctagggccg agacgatggc atggggccta gagcatgagg
tagagcagaa tgcagaccac 5280 gccgctggat gccgagagac cctgctctcc
gagggaggca tctgtgtcat gctgtgaggg 5340 ctgaggacgg ggccctagtc
tctggttttc tggtcttaac atccttatct gtgtccgcca 5400 cggaggtgac
tgagctgcta gcgagttgtc ctgtcccagg tacttgagtt ttggaaaagc 5460
tgactcacgc ccatccatct cacagccctt ccctggggac agtcgcttcc gccttgacac
5520 ctcactctca gttgaataac tcaagcttgg tcatcttcag actcgaattc
ttgagtagac 5580 ccagacggct tagcccaagt ctagttgcag ctgcctcggc
aagtccccat ttgctcaggc 5640 agccctgaat gggcctgttt acaggaatgg
taaattggga ttggaaggaa tatagcttcc 5700 agcttcatag gctagggtga
ccacggctta ggaaacaggg aaagaaagca aggccctttt 5760 cctgcctttc
ccgggatctg tctactccac ctccacgggg gaggccagtg gggaagggct 5820
gtcacctctt ccccatctgc atgagttctg gaactctgtc ctgttggctg cttgcttcca
5880 gctcccccca atctccatcg cagcgggttc ctcctgtctt ttctacagtg
tcataaaaca 5940 tcctgcccct accctctccc aaaggtcaat tttaattctc
accaagtttt gcacatctct 6000 gtatgtcgct tgatgtctta gacgcgagcc
ctttcctaaa ctgttcagcg ctctcttttc 6060 ctttgggtgg ttgttgcaag
ggtgatgaca tgactgtccc caggcctgtc tccctgaagc 6120 gtctgtgctg
tcaggacagc cctgggcaga gatgaggcag gggtgaggcg tgcgtgtgct 6180
tttcctcctt gttggatgtc ttccatatca tctgtttcca tagctacaat ccatcccttg
6240 gccttaactt tggaatttgg agattatatg caaacatgtg taaaggctca
tgaatatgga 6300 tgacactgga attttataaa ttctaaaata aaacccgaaa
ccagatgtag catgctggga 6360 ctcattttgt caaaaaa 6377 <210> SEQ
ID NO 7 <211> LENGTH: 6301 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 7 aggcgggatt
gggccgccgc cctatatagc agccggggcc cgggcgccgc gcctcggagc 60
gtcccggctt ctcccgcgcg gggggcgagt aagccagcgg caggaccagc gggcgggggc
120 ccacgacaaa agctggcagg ctgacagagg cggcctcagg acggaccttc
tggctactga 180 ccgttttgct gctaccactt ataaccacct ggttaagtcg
agatttggag gtggtttagt 240 ttggggcctg gatgcacctt gcagagagag
accgctggct ttttgtagca actgtcatga 300 tgcattttgt aagcattaag
agtggttttc ccggattgtg tgtaggtgtg agatcaacca 360 tgagttccgt
tgcagttttg acccaagaga gttttgctga acaccgaagt gggctggttc 420
cgcaacaaat caaagttgcc actctaaatt cagaagagga gagcgaccct ccaacctaca
480 aggatgcctt ccctccactt cctgagaaag ctgcttgcct ggaaagtgcc
caggaacccg 540 ctggagcctg ggggaacaag atccgaccca tcaaggcttc
tgtcatcact caggtgttcc 600 atgtacccct ggaggagaga aaatacaagg
atatgaacca gtttggagaa ggtgaacaag 660 caaaaatctg ccttgagatc
atgcagagaa ctggtgctca cttggagctg tctttggcca 720 aagaccaagg
cctctccatc atggtgtcag gaaagctgga tgctgtcatg aaagctcgga 780
aggacattgt tgctagactg cagactcagg cctcagcaac tgttgccatt cccaaagaac
840 accatcgctt tgttattggc aaaaatggag agaaactgca agacttggag
ctaaaaactg 900 caaccaaaat ccagatccca cgcccagatg accccagcaa
tcagatcaag atcactggca 960 ccaaagaggg catcgagaaa gctcgccatg
aagtcttact catctctgcc gagcaggaca 1020 aacgtgctgt ggagaggcta
gaagtagaaa aggcattcca ccccttcatc gctgggccgt 1080 ataatagact
ggttggcgag atcatgcagg agacaggcac gcgcatcaac atccccccac 1140
ccagcgtgaa ccggacagag attgtcttca ctggagagaa ggaacagttg gctcaggctg
1200 tggctcgcat caagaagatt tatgaggaga aggccaatag cttcaccgtc
tcctctgtcg 1260 ccgccccttc ctggcttcac cgtttcatca ttggcaagaa
agggcagaac ctggccaaaa 1320 tcactcagca gatgccaaag gttcacatcg
agttcacaga gggcgaagac aagatcaccc 1380 tggagggccc tacagaggat
gtcaatgtgg cccaggaaca gatagaaggc atggtcaaag 1440 atttgattaa
ccggatggac tatgtggaga tcaacatcga ccacaagttc cacaggcacc 1500
tcattgggaa gagcggtgcc aacataaaca gaatcaaaga ccagtacaag gtgtccgtgc
1560 gcatccctcc tgacagtgag aagagcaatt tgatccgcat cgagggggac
ccacagggcg 1620 tgcagcaggc caagcgagag ctgctggagc ttgcatctcg
catggaaaat gagcgtacca 1680 aggatctaat cattgagcaa agatttcatc
gcacaatcat tgggcagaag ggtgaacgga 1740 tccgtgaaat tcgtgacaaa
ttcccagagg tcatcattaa ctttccagac ccagcacaaa 1800 aaagtgacat
tgtccagctc agaggaccta agaatgaggt ggaaaaatgc acaaaataca 1860
tgcagaagat ggtggcagat ctggtggaaa atagctattc aatttctgtt ccgatcttca
1920 aacagtttca caagaatatc attgggaaag gaggcgcaaa cattaaaaag
attcgtgaag 1980 aaagcaacac caaaatcgac cttccagcag agaatagcaa
ttcagagacc attatcatca 2040 caggcaagcg agccaactgc gaagctgccc
ggagcaggat tctgtctatt cagaaagacc 2100 tggccaacat agccgaggta
gaggtctcca tccctgccaa gctgcacaac tccctcattg 2160 gcaccaaggg
ccgtctgatc cgctccatca tggaggagtg cggcggggtc cacattcact 2220
ttcccgtgga aggttcagga agcgacaccg ttgttatcag gggcccttcc tcggatgtgg
2280 agaaggccaa gaagcagctc ctgcatctgg cggaggagaa gcaaaccaag
agtttcactg 2340 ttgacatccg cgccaagcca gaataccaca aattcctcat
cggcaagggg ggcggcaaaa 2400 ttcgcaaggt gcgcgacagc actggagcac
gtgtcatctt ccctgcggct gaggacaagg 2460 accaggacct gatcaccatc
attggaaagg aggacgccgt ccgagaggca cagaaggagc 2520 tggaggcctt
gatccaaaac ctggataatg tggtggaaga ctccatgctg gtggacccca 2580
agcaccaccg ccacttcgtc atccgcagag gccaggtctt gcgggagatt gctgaagagt
2640 atggcggggt gatggtcagc ttcccacgct ctggcacaca gagcgacaaa
gtcaccctca 2700 agggcgccaa ggactgtgtg gaggcagcca agaaacgcat
tcaggagatc attgaggacc 2760 tggaagctca ggtgacatta gaatgtgcta
taccccagaa attccatcga tctgtcatgg 2820 gccccaaagg ttccagaatc
cagcagatta ctcgggattt cagtgttcaa attaaattcc 2880 cagacagaga
ggagaacgca gttcacagta cagagccagt tgtccaggag aatggggacg 2940
aagctgggga ggggagagag gctaaagatt gtgaccccgg ctctccaagg aggtgtgaca
3000 tcatcatcat ctctggccgg aaagaaaagt gtgaggctgc caaggaagct
ctggaggcat 3060 tggttcctgt caccattgaa gtagaggtgc cctttgacct
tcaccgttac gttattgggc 3120 agaaaggaag tgggatccgc aagatgatgg
atgagtttga ggtgaacata catgtcccgg 3180 cacctgagct gcagtctgac
atcatcgcca tcacgggcct cgctgcaaat ttggaccggg 3240 ccaaggctgg
actgctggag cgtgtgaagg agctacaggc cgagcaggag gaccgggctt 3300
taaggagttt taagctgagt gtcactgtag accccaaata ccatcccaag attatcggga
3360 gaaagggggc agtaattacc caaatccggt tggagcatga cgtgaacatc
cagtttcctg 3420 ataaggacga tgggaaccag ccccaggacc aaattaccat
cacagggtac gaaaagaaca 3480 cagaagctgc cagggatgct atactgagaa
ttgtgggtga acttgagcag atggtttctg 3540 aggacgtccc gctggaccac
cgcgttcacg cccgcatcat tggtgcccgc ggcaaagcca 3600 ttcgcaaaat
catggacgaa ttcaaggtgg acattcgctt cccacagagc ggagccccag 3660
accccaactg cgtcactgtg acggggctcc cagagaatgt ggaggaagcc atcgaccaca
3720 tcctcaatct ggaggaggaa tacctagctg acgtggtgga cagtgaggcg
ctgcaggtat 3780 acatgaaacc cccagcacac gaagaggcca aggcaccttc
cagaggcttt gtggtgcggg 3840 acgcaccctg gaccgccagc agcagtgaga
aggctcctga catgagcagc tctgaggaat 3900 ttcccagctt tggggctcag
gtggctccca agaccctccc ttggggcccc aaacgataat 3960 gatcaaaaag
aacagaaccc tctccagcct gctgacccaa acccaaccac acaatggttt 4020
gtctcaatct gacccagcgg ctggaccctc cgtaaattgt tgacgctctt cccccttccc
4080 gaggtcccgc agggagccta gcgcctggct gtgtgtgcgg ccgctcctcc
aggcctggcc 4140 gtgcccgctc aggacctgct ccactgttta acactaaacc
aaggtcatga gcattcgtgc 4200 taagataaca gactccagct cctggtccac
ccggcatgtc agtcagcact ctggccttca 4260 tcacgagagc tccgcagccg
tggctaggat tccacttcct gtgtcatgac ctcaggaaat 4320 aaacgtcctt
gactttataa aagccaaacg tttgccctct tcctttccca cctccctcct 4380
gccagtttcc cttggtccag acagtcctgt ttgtggagtg caatcagcct cctccagctg
4440 ccagagcgcc tcagcacagg tgtcagggtg caaggaagac ctggcaatgg
acagcaggag 4500 gcaggttcct ggagctgggg ggtgacctga gaggcagagg
gtgacgggtt ctcaggcagt 4560 cctgatttta cctgccgtgg ggtctgaaag
caccaagggt ccctgcccct acctccactg 4620 ccagaccctc agcctgaggt
ctggtgagtg gagcctggag gcaaggtggt aggcaccatc 4680 tgggtcccct
gtggccgtca cagtgtctgc tgtgattgag atgcgcacag gttgggggag 4740
gtagggcctt acgcttgtcc tcagtggggg cagtttgcct tagatgacag ctgggctctt
4800 cttcacacca cctgcagccc ctccctgccc ctgccctagc tgctgtgtgt
tcagttgcct 4860 tctttctacc tcagccggcg tggagtggtc tctgtgcagt
tagtgccacc ccacacaccc 4920 gtctcttgat tgagatgttt ctggtggtta
tgggtttccc gtggagctgg gggtgggcgc 4980 cgtgtaccta agctggaggc
tggcgctctc cctcagcaca ggtgggtcag tggccagcag 5040 gcccatctgg
agtgggagtg ggcacttcca ccccgcccac aggccatccg gctgtgcagg 5100
ccagccccta ggagcaggtc ccgggtgact ggcagttttc acggtctagg gccgagacga
5160 tggcatgggg cctagagcat gaggtagagc agaatgcaga ccacgccgct
ggatgccgag 5220 agaccctgct ctccgaggga ggcatctgtg tcatgctgtg
agggctgagg acggggccct 5280 agtctctggt tttctggtct taacatcctt
atctgtgtcc gccacggagg tgactgagct 5340 gctagcgagt tgtcctgtcc
caggtacttg agttttggaa aagctgactc acgcccatcc 5400 atctcacagc
ccttccctgg ggacagtcgc ttccgccttg acacctcact ctcagttgaa 5460
taactcaagc ttggtcatct tcagactcga attcttgagt agacccagac ggcttagccc
5520 aagtctagtt gcagctgcct cggcaagtcc ccatttgctc aggcagccct
gaatgggcct 5580 gtttacagga atggtaaatt gggattggaa ggaatatagc
ttccagcttc ataggctagg 5640 gtgaccacgg cttaggaaac agggaaagaa
agcaaggccc ttttcctgcc tttcccggga 5700 tctgtctact ccacctccac
gggggaggcc agtggggaag ggctgtcacc tcttccccat 5760 ctgcatgagt
tctggaactc tgtcctgttg gctgcttgct tccagctccc cccaatctcc 5820
atcgcagcgg gttcctcctg tcttttctac agtgtcataa aacatcctgc ccctaccctc
5880 tcccaaaggt caattttaat tctcaccaag ttttgcacat ctctgtatgt
cgcttgatgt 5940 cttagacgcg agccctttcc taaactgttc agcgctctct
tttcctttgg gtggttgttg 6000 caagggtgat gacatgactg tccccaggcc
tgtctccctg aagcgtctgt gctgtcagga 6060 cagccctggg cagagatgag
gcaggggtga ggcgtgcgtg tgcttttcct ccttgttgga 6120 tgtcttccat
atcatctgtt tccatagcta caatccatcc cttggcctta actttggaat 6180
ttggagatta tatgcaaaca tgtgtaaagg ctcatgaata tggatgacac tggaatttta
6240 taaattctaa aataaaaccc gaaaccagat gtagcatgct gggactcatt
ttgtcaaaaa 6300 a 6301 <210> SEQ ID NO 8 <400>
SEQUENCE: 8 000 <210> SEQ ID NO 9 <211> LENGTH: 16
<212> TYPE: PRT <213> ORGANISM: Unknown <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Unknown: RFGF peptide"
<400> SEQUENCE: 9 Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro 1 5 10 15
<210> SEQ ID NO 10 <211> LENGTH: 11 <212> TYPE:
PRT <213> ORGANISM: Unknown <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Unknown: RFGF analogue peptide" <400> SEQUENCE: 10 Ala Ala
Leu Leu Pro Val Leu Leu Ala Ala Pro 1 5 10 <210> SEQ ID NO 11
<211> LENGTH: 6524 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 11 ttttttgaca
aaatgagtcc cagcatgcta catctggttt cgggttttat tttagaattt 60
ataaaattcc agtgtcatcc atattcatga gcctttacac atgtttgcat ataatctcca
120 aattccaaag ttaaggccaa gggatggatt gtagctatgg aaacagatga
tatggaagac 180 atccaacaag gaggaaaagc acacgcacgc ctcacccctg
cctcatctct gcccagggct 240 gtcctgacag cacagacgct tcagggagac
aggcctgggg acagtcatgt catcaccctt 300 gcaacaacca cccaaaggaa
aagagagcgc tgaacagttt aggaaagggc tcgcgtctaa 360 gacatcaagc
gacatacaga gatgtgcaaa acttggtgag aattaaaatt gacctttggg 420
agagggtagg ggcaggatgt tttatgacac tgtagaaaag acaggaggaa cccgctgcga
480 tggagattgg ggggagctgg aagcaagcag ccaacaggac agagttccag
aactcatgca 540 gatggggaag aggtgacagc ccttccccac tggcctcccc
cgtggaggtg gagtagacag 600 atcccgggaa aggcaggaaa agggccttgc
tttctttccc tgtttcctaa gccgtggtca 660 ccctagccta tgaagctgga
agctatattc cttccaatcc caatttacca ttcctgtaaa 720 caggcccatt
cagggctgcc tgagcaaatg gggacttgcc gaggcagctg caactagact 780
tgggctaagc cgtctgggtc tactcaagaa ttcgagtctg aagatgacca agcttgagtt
840 attcaactga gagtgaggtg tcaaggcgga agcgactgtc cccagggaag
ggctgtgaga 900 tggatgggcg tgagtcagct tttccaaaac tcaagtacct
gggacaggac aactcgctag 960 cagctcagtc acctccgtgg cggacacaga
taaggatgtt aagaccagaa aaccagagac 1020 tagggccccg tcctcagccc
tcacagcatg acacagatgc ctccctcgga gagcagggtc 1080 tctcggcatc
cagcggcgtg gtctgcattc tgctctacct catgctctag gccccatgcc 1140
atcgtctcgg ccctagaccg tgaaaactgc cagtcacccg ggacctgctc ctaggggctg
1200 gcctgcacag ccggatggcc tgtgggcggg gtggaagtgc ccactcccac
tccagatggg 1260 cctgctggcc actgacccac ctgtgctgag ggagagcgcc
agcctccagc ttaggtacac 1320 ggcgcccacc cccagctcca cgggaaaccc
ataaccacca gaaacatctc aatcaagaga 1380 cgggtgtgtg gggtggcact
aactgcacag agaccactcc acgccggctg aggtagaaag 1440 aaggcaactg
aacacacagc agctagggca ggggcaggga ggggctgcag gtggtgtgaa 1500
gaagagccca gctgtcatct aaggcaaact gcccccactg aggacaagcg taaggcccta
1560 cctcccccaa cctgtgcgca tctcaatcac agcagacact gtgacggcca
caggggaccc 1620 agatggtgcc taccaccttg cctccaggct ccactcacca
gacctcaggc tgagggtctg 1680 gcagtggagg taggggcagg gacccttggt
gctttcagac cccacggcag gtaaaatcag 1740 gactgcctga gaacccgtca
ccctctgcct ctcaggtcac cccccagctc caggaacctg 1800 cctcctgctg
tccattgcca ggtcttcctt gcaccctgac acctgtgctg aggcgctctg 1860
gcagctggag gaggctgatt gcactccaca aacaggactg tctggaccaa gggaaactgg
1920 caggagggag gtgggaaagg aagagggcaa acgtttggct tttataaagt
caaggacgtt 1980 tatttcctga ggtcatgaca caggaagtgg aatcctagcc
acggctgcgg agctctcgtg 2040 atgaaggcca gagtgctgac tgacatgccg
ggtggaccag gagctggagt ctgttatctt 2100 agcacgaatg ctcatgacct
tggtttagtg ttaaacagtg gagcaggtcc tgagcgggca 2160 cggccaggcc
tggaggagcg gccgcacaca cagccaggcg ctaggctccc tgcgggacct 2220
cgggaagggg gaagagcgtc aacaatttac ggagggtcca gccgctgggt cagattgaga
2280 caaaccattg tgtggttggg tttgggtcag caggctggag agggttctgt
tctttttgat 2340 cattatcgtt tggggcccca agggagggtc ttgggagcca
cctgagcccc aaagctggga 2400 aattcctcag agctgctcat gtcaggagcc
ttctcactgc tgctggcggt ccagggtgcg 2460 tcccgcacca caaagcctct
ggaaggtgcc ttggcctctt cgtgtgctgg gggtttcatg 2520 tatacctgca
gcgcctcact gtccaccacg tcagctaggt attcctcctc cagattgagg 2580
atgtggtcga tggcttcctc cacattctct gggagccccg tcacagtgac gcagttgggg
2640 tctggggctc cgctctgtgg gaagcgaatg tccaccttga attcgtccat
gattttgcga 2700 atggctttgc cgcgggcacc aatgatgcgg gcgtgaacgc
ggtggtccag cgggacgtcc 2760 tcagaaacca tctgctcaag ttcacccaca
attctcagta tagcatccct ggcagcttct 2820 gtgttctttt cgtaccctgt
gatggtaatt tggtcctggg gctggttccc atcgtcctta 2880 tcaggaaact
ggatgttcac gtcatgctcc aaccggattt gggtaattac tgcccccttt 2940
ctcccgataa tcttgggatg gtatttgggg tctacagtga cactcagctt aaaactcctt
3000 aaagcccggt cctcctgctc ggcctgtagc tccttcacac gctccagcag
tccagccttg 3060 gcccggtcca aatttgcagc gaggcccgtg atggcgatga
tgtcagactg cagctcaggt 3120 gccgggacat gtatgttcac ctcaaactca
tccatcatct tgcggatccc acttcctttc 3180 tgcccaataa cgtaacggtg
aaggtcaaag ggcacctcta cttcaatggt gacaggaacc 3240 aatgcctcca
gagcttcctt ggcagcctca cacttttctt tccggccaga gatgatgatg 3300
atgtcacacc tccttggaga gccggggtca caatctttag cctctctccc ctccccagct
3360 tcgtccccat tctcctggac aactggctct gtactgtgaa ctgcgttctc
ctctctgtct 3420 gggaatttaa tttgaacact gaaatcccga gtaatctgct
ggattctgga acctttgggg 3480 cccatgacag atcgatggaa tttctggggt
atagcacatt ctaatgtcac ctgagcttcc 3540 aggtcctcaa tgatctcctg
aatgcgtttc ttggctgcct ccacacagtc cttggcgccc 3600 ttgagggtga
ctttgtcgct ctgtgtgcca gagcgtggga agctgaccat caccccgcca 3660
tactcttcag caatctcccg caagacctgg cctctgcgga tgacgaagtg gcggtggtgc
3720 ttggggtcca ccagcatgga gtcttccacc acattatcca ggttttggat
caaggcctcc 3780 agctccttct gtgcctctcg gacggcgtcc tcctttccaa
tgatggtgat caggtcctgg 3840 tccttgtcct cagccgcagg gaagatgaca
cgtgctccag tgctgtcgcg caccttgcga 3900 attttgccgc cccccttgcc
gatgaggaat ttgtggtatt ctggcttggc gcggatgtca 3960 acagtgaaac
tcttggtttg cttctcctcc gccagatgca ggagctgctt cttggccttc 4020
tccacatccg aggaagggcc cctgataaca acggtgtcgc ttcctgaacc ttccacggga
4080 aagtgaatgt ggaccccgcc gcactcctcc atgatggagc ggatcagacg
gcccttggtg 4140 ccaatgaggg agttgtgcag cttggcaggg atggagacct
ctacctcggc tatgttggcc 4200 aggtctttct gaatagacag aatcctgctc
cgggcagctt cgcagttggc tcgcttgcct 4260 gtgatgataa tggtctctga
attgctattc tctgctggaa ggtcgatttt ggtgttgctt 4320 tcttcacgaa
tctttttaat gtttgcgcct cctttcccaa tgatattctt gtgaaactgt 4380
ttgaagatcg gaacagaaat tgaatagcta ttttccacca gatctgccac catcttctgc
4440 atgtattttg tgcatttttc cacctcattc ttaggtcctc tgagctggac
aatgtcactt 4500 ttttgtgctg ggtctggaaa gttaatgatg acctctggga
atttgtcacg aatttcacgg 4560 atccgttcac ccttctgccc aatgattgtg
cgatgaaatc tttgctcaat gattagatcc 4620 ttggtacgct cattttccat
gcgagatgca agctccagca gctctcgctt ggcctgctgc 4680 acgccctgtg
ggtccccctc gatgcggatc aaattgctct tctcactgtc aggagggatg 4740
cgcacggaca ccttgtactg gtctttgatt ctgtttatgt tggcaccgct cttcccaatg
4800 aggtgcctgt ggaacttgtg gtcgatgttg atctccacat agtccatccg
gttaatcaaa 4860 tctttgacca tgccttctat ctgttcctgg gccacattga
catcctctgt agggccctcc 4920 agggtgatct tgtcttcgcc ctctgtgaac
tcgatgtgaa cctttggcat ctgctgagtg 4980 attttggcca ggttctgccc
tttcttgcca atgatgaaac ggtgaagcca ggaaggggcg 5040 gcgacagagg
agacggtgaa gctattggcc ttggcataga cttcagtcaa cgcctgacct 5100
aacttttcag gttcgcctcg aagtattaca gtctcagaga tgctgtctga gggtgggatc
5160 tcaacggaaa ctccagttct ctcaaggatc tcctgcaatg aattgccctt
gggcccaatg 5220 acatacttgt gttgggattt cttcacttcc actgcaatgg
ttgtagtctt ctttttcttc 5280 tcctcataaa tcttcttgat gcgagccaca
gcctgagcca actgttcctt ctctccagtg 5340 aagacaatct ctgtccggtt
cacgctgggt ggggggatgt tgatgcgcgt gcctgtctcc 5400 tgcatgatct
cgccaaccag tctattatac ggcccagcga tgaaggggtg gaatgccttt 5460
tctacttcta gcctctccac agcacgtttg tcctgctcgg cagagatgag taagacttca
5520 tggcgagctt tctcgatgcc ctctttggtg ccagtgatct tgatctgatt
gctggggtca 5580 tctgggcgtg ggatctggat tttggttgca gtttttagct
ccaagtcttg cagtttctct 5640 ccatttttgc caataacaaa gcgatggtgt
tctttgggaa tggcaacagt tgctgaggcc 5700 tgagtctgca gtctagcaac
aatgtccttc cgagctttca tgacagcatc cagctttcct 5760 gacaccatga
tggagaggcc ttggtctttg gccaaagaca gctccaagtg agcaccagtt 5820
ctctgcatga tctcaaggca gatttttgct tgttcacctt ctccaaactg gttcatatcc
5880 ttgtattttc tctcctccag gggtacatgg aacacctgag tgatgacaga
agccttgatg 5940 ggtcggatct tgttccccca ggctccagcg ggttcctggg
cactttccag gcaagcagct 6000 ttctcaggaa gtggagggaa ggcatccttg
taggttggag ggtcgctctc ctcttctgaa 6060 tttagagtgg caactttgat
ttgttgcgga accagcccac ttcggtgttc agcaaaactc 6120 tcttgggtca
aaactgcaac ggaactcatg gttgatctca cacctacaca caatccggga 6180
aaaccacagc aaaacggtca gtagccagaa ggtccgtcct gaggccgcct ctgtcagcct
6240 gccagctttt gctgttccac tcttataagc ataagaaaac cgagctcata
aggtaggaac 6300 tgtggcgaaa cagggacaag ccgccatctt ggtaaaggag
aagaggctac gcttgacctc 6360 cccccccacc cccagcctct atatggccaa
ctgccgtggg aggagcacgg cgcttgcgca 6420 gaggcggaca acgcggacga
ctctgggctt gcgcactcgg aagccggccg catgggggag 6480 gggaagaagg
ccaggtcgca ctgagccagg aagcagttgg caaa 6524 <210> SEQ ID NO 12
<211> LENGTH: 6377 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 12 ttttttgaca
aaatgagtcc cagcatgcta catctggttt cgggttttat tttagaattt 60
ataaaattcc agtgtcatcc atattcatga gcctttacac atgtttgcat ataatctcca
120 aattccaaag ttaaggccaa gggatggatt gtagctatgg aaacagatga
tatggaagac 180 atccaacaag gaggaaaagc acacgcacgc ctcacccctg
cctcatctct gcccagggct 240 gtcctgacag cacagacgct tcagggagac
aggcctgggg acagtcatgt catcaccctt 300 gcaacaacca cccaaaggaa
aagagagcgc tgaacagttt aggaaagggc tcgcgtctaa 360 gacatcaagc
gacatacaga gatgtgcaaa acttggtgag aattaaaatt gacctttggg 420
agagggtagg ggcaggatgt tttatgacac tgtagaaaag acaggaggaa cccgctgcga
480 tggagattgg ggggagctgg aagcaagcag ccaacaggac agagttccag
aactcatgca 540 gatggggaag aggtgacagc ccttccccac tggcctcccc
cgtggaggtg gagtagacag 600 atcccgggaa aggcaggaaa agggccttgc
tttctttccc tgtttcctaa gccgtggtca 660 ccctagccta tgaagctgga
agctatattc cttccaatcc caatttacca ttcctgtaaa 720 caggcccatt
cagggctgcc tgagcaaatg gggacttgcc gaggcagctg caactagact 780
tgggctaagc cgtctgggtc tactcaagaa ttcgagtctg aagatgacca agcttgagtt
840 attcaactga gagtgaggtg tcaaggcgga agcgactgtc cccagggaag
ggctgtgaga 900 tggatgggcg tgagtcagct tttccaaaac tcaagtacct
gggacaggac aactcgctag 960 cagctcagtc acctccgtgg cggacacaga
taaggatgtt aagaccagaa aaccagagac 1020 tagggccccg tcctcagccc
tcacagcatg acacagatgc ctccctcgga gagcagggtc 1080 tctcggcatc
cagcggcgtg gtctgcattc tgctctacct catgctctag gccccatgcc 1140
atcgtctcgg ccctagaccg tgaaaactgc cagtcacccg ggacctgctc ctaggggctg
1200 gcctgcacag ccggatggcc tgtgggcggg gtggaagtgc ccactcccac
tccagatggg 1260 cctgctggcc actgacccac ctgtgctgag ggagagcgcc
agcctccagc ttaggtacac 1320 ggcgcccacc cccagctcca cgggaaaccc
ataaccacca gaaacatctc aatcaagaga 1380 cgggtgtgtg gggtggcact
aactgcacag agaccactcc acgccggctg aggtagaaag 1440 aaggcaactg
aacacacagc agctagggca ggggcaggga ggggctgcag gtggtgtgaa 1500
gaagagccca gctgtcatct aaggcaaact gcccccactg aggacaagcg taaggcccta
1560 cctcccccaa cctgtgcgca tctcaatcac agcagacact gtgacggcca
caggggaccc 1620 agatggtgcc taccaccttg cctccaggct ccactcacca
gacctcaggc tgagggtctg 1680 gcagtggagg taggggcagg gacccttggt
gctttcagac cccacggcag gtaaaatcag 1740 gactgcctga gaacccgtca
ccctctgcct ctcaggtcac cccccagctc caggaacctg 1800 cctcctgctg
tccattgcca ggtcttcctt gcaccctgac acctgtgctg aggcgctctg 1860
gcagctggag gaggctgatt gcactccaca aacaggactg tctggaccaa gggaaactgg
1920 caggagggag gtgggaaagg aagagggcaa acgtttggct tttataaagt
caaggacgtt 1980 tatttcctga ggtcatgaca caggaagtgg aatcctagcc
acggctgcgg agctctcgtg 2040 atgaaggcca gagtgctgac tgacatgccg
ggtggaccag gagctggagt ctgttatctt 2100 agcacgaatg ctcatgacct
tggtttagtg ttaaacagtg gagcaggtcc tgagcgggca 2160 cggccaggcc
tggaggagcg gccgcacaca cagccaggcg ctaggctccc tgcgggacct 2220
cgggaagggg gaagagcgtc aacaatttac ggagggtcca gccgctgggt cagattgaga
2280 caaaccattg tgtggttggg tttgggtcag caggctggag agggttctgt
tctttttgat 2340 cattatcgtt tggggcccca agggagggtc ttgggagcca
cctgagcccc aaagctggga 2400 aattcctcag agctgctcat gtcaggagcc
ttctcactgc tgctggcggt ccagggtgcg 2460 tcccgcacca caaagcctct
ggaaggtgcc ttggcctctt cgtgtgctgg gggtttcatg 2520 tatacctgca
gcgcctcact gtccaccacg tcagctaggt attcctcctc cagattgagg 2580
atgtggtcga tggcttcctc cacattctct gggagccccg tcacagtgac gcagttgggg
2640 tctggggctc cgctctgtgg gaagcgaatg tccaccttga attcgtccat
gattttgcga 2700 atggctttgc cgcgggcacc aatgatgcgg gcgtgaacgc
ggtggtccag cgggacgtcc 2760 tcagaaacca tctgctcaag ttcacccaca
attctcagta tagcatccct ggcagcttct 2820 gtgttctttt cgtaccctgt
gatggtaatt tggtcctggg gctggttccc atcgtcctta 2880 tcaggaaact
ggatgttcac gtcatgctcc aaccggattt gggtaattac tgcccccttt 2940
ctcccgataa tcttgggatg gtatttgggg tctacagtga cactcagctt aaaactcctt
3000 aaagcccggt cctcctgctc ggcctgtagc tccttcacac gctccagcag
tccagccttg 3060 gcccggtcca aatttgcagc gaggcccgtg atggcgatga
tgtcagactg cagctcaggt 3120 gccgggacat gtatgttcac ctcaaactca
tccatcatct tgcggatccc acttcctttc 3180 tgcccaataa cgtaacggtg
aaggtcaaag ggcacctcta cttcaatggt gacaggaacc 3240 aatgcctcca
gagcttcctt ggcagcctca cacttttctt tccggccaga gatgatgatg 3300
atgtcacacc tccttggaga gccggggtca caatctttag cctctctccc ctccccagct
3360 tcgtccccat tctcctggac aactggctct gtactgtgaa ctgcgttctc
ctctctgtct 3420 gggaatttaa tttgaacact gaaatcccga gtaatctgct
ggattctgga acctttgggg 3480 cccatgacag atcgatggaa tttctggggt
atagcacatt ctaatgtcac ctgagcttcc 3540 aggtcctcaa tgatctcctg
aatgcgtttc ttggctgcct ccacacagtc cttggcgccc 3600 ttgagggtga
ctttgtcgct ctgtgtgcca gagcgtggga agctgaccat caccccgcca 3660
tactcttcag caatctcccg caagacctgg cctctgcgga tgacgaagtg gcggtggtgc
3720 ttggggtcca ccagcatgga gtcttccacc acattatcca ggttttggat
caaggcctcc 3780 agctccttct gtgcctctcg gacggcgtcc tcctttccaa
tgatggtgat caggtcctgg 3840 tccttgtcct cagccgcagg gaagatgaca
cgtgctccag tgctgtcgcg caccttgcga 3900 attttgccgc cccccttgcc
gatgaggaat ttgtggtatt ctggcttggc gcggatgtca 3960 acagtgaaac
tcttggtttg cttctcctcc gccagatgca ggagctgctt cttggccttc 4020
tccacatccg aggaagggcc cctgataaca acggtgtcgc ttcctgaacc ttccacggga
4080 aagtgaatgt ggaccccgcc gcactcctcc atgatggagc ggatcagacg
gcccttggtg 4140 ccaatgaggg agttgtgcag cttggcaggg atggagacct
ctacctcggc tatgttggcc 4200 aggtctttct gaatagacag aatcctgctc
cgggcagctt cgcagttggc tcgcttgcct 4260 gtgatgataa tggtctctga
attgctattc tctgctggaa ggtcgatttt ggtgttgctt 4320 tcttcacgaa
tctttttaat gtttgcgcct cctttcccaa tgatattctt gtgaaactgt 4380
ttgaagatcg gaacagaaat tgaatagcta ttttccacca gatctgccac catcttctgc
4440 atgtattttg tgcatttttc cacctcattc ttaggtcctc tgagctggac
aatgtcactt 4500 ttttgtgctg ggtctggaaa gttaatgatg acctctggga
atttgtcacg aatttcacgg 4560 atccgttcac ccttctgccc aatgattgtg
cgatgaaatc tttgctcaat gattagatcc 4620 ttggtacgct cattttccat
gcgagatgca agctccagca gctctcgctt ggcctgctgc 4680 acgccctgtg
ggtccccctc gatgcggatc aaattgctct tctcactgtc aggagggatg 4740
cgcacggaca ccttgtactg gtctttgatt ctgtttatgt tggcaccgct cttcccaatg
4800 aggtgcctgt ggaacttgtg gtcgatgttg atctccacat agtccatccg
gttaatcaaa 4860 tctttgacca tgccttctat ctgttcctgg gccacattga
catcctctgt agggccctcc 4920 agggtgatct tgtcttcgcc ctctgtgaac
tcgatgtgaa cctttggcat ctgctgagtg 4980 attttggcca ggttctgccc
tttcttgcca atgatgaaac ggtgaagcca ggaaggggcg 5040 gcgacagagg
agacggtgaa gctattggcc ttggcataga cttcagtcaa cgcctgacct 5100
aacttttcag gttcgcctcg aagtattaca gtctcagaga tgctgtctga gggtgggatc
5160 tcaacggaaa ctccagttct ctcaaggatc tcctgcaatg aattgccctt
gggcccaatg 5220 acatacttgt gttgggattt cttcacttcc actgcaatgg
ttgtagtctt ctttttcttc 5280 tcctcataaa tcttcttgat gcgagccaca
gcctgagcca actgttcctt ctctccagtg 5340 aagacaatct ctgtccggtt
cacgctgggt ggggggatgt tgatgcgcgt gcctgtctcc 5400 tgcatgatct
cgccaaccag tctattatac ggcccagcga tgaaggggtg gaatgccttt 5460
tctacttcta gcctctccac agcacgtttg tcctgctcgg cagagatgag taagacttca
5520 tggcgagctt tctcgatgcc ctctttggtg ccagtgatct tgatctgatt
gctggggtca 5580 tctgggcgtg ggatctggat tttggttgca gtttttagct
ccaagtcttg cagtttctct 5640 ccatttttgc caataacaaa gcgatggtgt
tctttgggaa tggcaacagt tgctgaggcc 5700 tgagtctgca gtctagcaac
aatgtccttc cgagctttca tgacagcatc cagctttcct 5760 gacaccatga
tggagaggcc ttggtctttg gccaaagaca gctccaagtg agcaccagtt 5820
ctctgcatga tctcaaggca gatttttgct tgttcacctt ctccaaactg gttcatatcc
5880 ttgtattttc tctcctccag gggtacatgg aacacctgag tgatgacaga
agccttgatg 5940 ggtcggatct tgttccccca ggctccagcg ggttcctggg
cactttccag gcaagcagct 6000 ttctcaggaa gtggagggaa ggcatccttg
taggttggag ggtcgctctc ctcttctgaa 6060 tttagagtgg caactttgat
ttgttgcgga accagcccac ttcggtgttc agcaaaactc 6120 tcttgggtca
aaactgcaac ggaactcatg gttgatctca cacctacaca caatccggga 6180
aaaccacagc aaaacggtca gtagccagaa ggtccgtcct gaggccgcct ctgtcagcct
6240 gccagctttt gtcgtgggcc cccgcccgct ggtcctgccg ctggcttact
cgccccccgc 6300 gcgggagaag ccgggacgct ccgaggcgcg gcgcccgggc
cccggctgct atatagggcg 6360 gcggcccaat cccgcct 6377 <210> SEQ
ID NO 13 <211> LENGTH: 6301 <212> TYPE: DNA <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 13 ttttttgaca
aaatgagtcc cagcatgcta catctggttt cgggttttat tttagaattt 60
ataaaattcc agtgtcatcc atattcatga gcctttacac atgtttgcat ataatctcca
120 aattccaaag ttaaggccaa gggatggatt gtagctatgg aaacagatga
tatggaagac 180 atccaacaag gaggaaaagc acacgcacgc ctcacccctg
cctcatctct gcccagggct 240 gtcctgacag cacagacgct tcagggagac
aggcctgggg acagtcatgt catcaccctt 300 gcaacaacca cccaaaggaa
aagagagcgc tgaacagttt aggaaagggc tcgcgtctaa 360 gacatcaagc
gacatacaga gatgtgcaaa acttggtgag aattaaaatt gacctttggg 420
agagggtagg ggcaggatgt tttatgacac tgtagaaaag acaggaggaa cccgctgcga
480 tggagattgg ggggagctgg aagcaagcag ccaacaggac agagttccag
aactcatgca 540 gatggggaag aggtgacagc ccttccccac tggcctcccc
cgtggaggtg gagtagacag 600 atcccgggaa aggcaggaaa agggccttgc
tttctttccc tgtttcctaa gccgtggtca 660 ccctagccta tgaagctgga
agctatattc cttccaatcc caatttacca ttcctgtaaa 720 caggcccatt
cagggctgcc tgagcaaatg gggacttgcc gaggcagctg caactagact 780
tgggctaagc cgtctgggtc tactcaagaa ttcgagtctg aagatgacca agcttgagtt
840 attcaactga gagtgaggtg tcaaggcgga agcgactgtc cccagggaag
ggctgtgaga 900 tggatgggcg tgagtcagct tttccaaaac tcaagtacct
gggacaggac aactcgctag 960
cagctcagtc acctccgtgg cggacacaga taaggatgtt aagaccagaa aaccagagac
1020 tagggccccg tcctcagccc tcacagcatg acacagatgc ctccctcgga
gagcagggtc 1080 tctcggcatc cagcggcgtg gtctgcattc tgctctacct
catgctctag gccccatgcc 1140 atcgtctcgg ccctagaccg tgaaaactgc
cagtcacccg ggacctgctc ctaggggctg 1200 gcctgcacag ccggatggcc
tgtgggcggg gtggaagtgc ccactcccac tccagatggg 1260 cctgctggcc
actgacccac ctgtgctgag ggagagcgcc agcctccagc ttaggtacac 1320
ggcgcccacc cccagctcca cgggaaaccc ataaccacca gaaacatctc aatcaagaga
1380 cgggtgtgtg gggtggcact aactgcacag agaccactcc acgccggctg
aggtagaaag 1440 aaggcaactg aacacacagc agctagggca ggggcaggga
ggggctgcag gtggtgtgaa 1500 gaagagccca gctgtcatct aaggcaaact
gcccccactg aggacaagcg taaggcccta 1560 cctcccccaa cctgtgcgca
tctcaatcac agcagacact gtgacggcca caggggaccc 1620 agatggtgcc
taccaccttg cctccaggct ccactcacca gacctcaggc tgagggtctg 1680
gcagtggagg taggggcagg gacccttggt gctttcagac cccacggcag gtaaaatcag
1740 gactgcctga gaacccgtca ccctctgcct ctcaggtcac cccccagctc
caggaacctg 1800 cctcctgctg tccattgcca ggtcttcctt gcaccctgac
acctgtgctg aggcgctctg 1860 gcagctggag gaggctgatt gcactccaca
aacaggactg tctggaccaa gggaaactgg 1920 caggagggag gtgggaaagg
aagagggcaa acgtttggct tttataaagt caaggacgtt 1980 tatttcctga
ggtcatgaca caggaagtgg aatcctagcc acggctgcgg agctctcgtg 2040
atgaaggcca gagtgctgac tgacatgccg ggtggaccag gagctggagt ctgttatctt
2100 agcacgaatg ctcatgacct tggtttagtg ttaaacagtg gagcaggtcc
tgagcgggca 2160 cggccaggcc tggaggagcg gccgcacaca cagccaggcg
ctaggctccc tgcgggacct 2220 cgggaagggg gaagagcgtc aacaatttac
ggagggtcca gccgctgggt cagattgaga 2280 caaaccattg tgtggttggg
tttgggtcag caggctggag agggttctgt tctttttgat 2340 cattatcgtt
tggggcccca agggagggtc ttgggagcca cctgagcccc aaagctggga 2400
aattcctcag agctgctcat gtcaggagcc ttctcactgc tgctggcggt ccagggtgcg
2460 tcccgcacca caaagcctct ggaaggtgcc ttggcctctt cgtgtgctgg
gggtttcatg 2520 tatacctgca gcgcctcact gtccaccacg tcagctaggt
attcctcctc cagattgagg 2580 atgtggtcga tggcttcctc cacattctct
gggagccccg tcacagtgac gcagttgggg 2640 tctggggctc cgctctgtgg
gaagcgaatg tccaccttga attcgtccat gattttgcga 2700 atggctttgc
cgcgggcacc aatgatgcgg gcgtgaacgc ggtggtccag cgggacgtcc 2760
tcagaaacca tctgctcaag ttcacccaca attctcagta tagcatccct ggcagcttct
2820 gtgttctttt cgtaccctgt gatggtaatt tggtcctggg gctggttccc
atcgtcctta 2880 tcaggaaact ggatgttcac gtcatgctcc aaccggattt
gggtaattac tgcccccttt 2940 ctcccgataa tcttgggatg gtatttgggg
tctacagtga cactcagctt aaaactcctt 3000 aaagcccggt cctcctgctc
ggcctgtagc tccttcacac gctccagcag tccagccttg 3060 gcccggtcca
aatttgcagc gaggcccgtg atggcgatga tgtcagactg cagctcaggt 3120
gccgggacat gtatgttcac ctcaaactca tccatcatct tgcggatccc acttcctttc
3180 tgcccaataa cgtaacggtg aaggtcaaag ggcacctcta cttcaatggt
gacaggaacc 3240 aatgcctcca gagcttcctt ggcagcctca cacttttctt
tccggccaga gatgatgatg 3300 atgtcacacc tccttggaga gccggggtca
caatctttag cctctctccc ctccccagct 3360 tcgtccccat tctcctggac
aactggctct gtactgtgaa ctgcgttctc ctctctgtct 3420 gggaatttaa
tttgaacact gaaatcccga gtaatctgct ggattctgga acctttgggg 3480
cccatgacag atcgatggaa tttctggggt atagcacatt ctaatgtcac ctgagcttcc
3540 aggtcctcaa tgatctcctg aatgcgtttc ttggctgcct ccacacagtc
cttggcgccc 3600 ttgagggtga ctttgtcgct ctgtgtgcca gagcgtggga
agctgaccat caccccgcca 3660 tactcttcag caatctcccg caagacctgg
cctctgcgga tgacgaagtg gcggtggtgc 3720 ttggggtcca ccagcatgga
gtcttccacc acattatcca ggttttggat caaggcctcc 3780 agctccttct
gtgcctctcg gacggcgtcc tcctttccaa tgatggtgat caggtcctgg 3840
tccttgtcct cagccgcagg gaagatgaca cgtgctccag tgctgtcgcg caccttgcga
3900 attttgccgc cccccttgcc gatgaggaat ttgtggtatt ctggcttggc
gcggatgtca 3960 acagtgaaac tcttggtttg cttctcctcc gccagatgca
ggagctgctt cttggccttc 4020 tccacatccg aggaagggcc cctgataaca
acggtgtcgc ttcctgaacc ttccacggga 4080 aagtgaatgt ggaccccgcc
gcactcctcc atgatggagc ggatcagacg gcccttggtg 4140 ccaatgaggg
agttgtgcag cttggcaggg atggagacct ctacctcggc tatgttggcc 4200
aggtctttct gaatagacag aatcctgctc cgggcagctt cgcagttggc tcgcttgcct
4260 gtgatgataa tggtctctga attgctattc tctgctggaa ggtcgatttt
ggtgttgctt 4320 tcttcacgaa tctttttaat gtttgcgcct cctttcccaa
tgatattctt gtgaaactgt 4380 ttgaagatcg gaacagaaat tgaatagcta
ttttccacca gatctgccac catcttctgc 4440 atgtattttg tgcatttttc
cacctcattc ttaggtcctc tgagctggac aatgtcactt 4500 ttttgtgctg
ggtctggaaa gttaatgatg acctctggga atttgtcacg aatttcacgg 4560
atccgttcac ccttctgccc aatgattgtg cgatgaaatc tttgctcaat gattagatcc
4620 ttggtacgct cattttccat gcgagatgca agctccagca gctctcgctt
ggcctgctgc 4680 acgccctgtg ggtccccctc gatgcggatc aaattgctct
tctcactgtc aggagggatg 4740 cgcacggaca ccttgtactg gtctttgatt
ctgtttatgt tggcaccgct cttcccaatg 4800 aggtgcctgt ggaacttgtg
gtcgatgttg atctccacat agtccatccg gttaatcaaa 4860 tctttgacca
tgccttctat ctgttcctgg gccacattga catcctctgt agggccctcc 4920
agggtgatct tgtcttcgcc ctctgtgaac tcgatgtgaa cctttggcat ctgctgagtg
4980 attttggcca ggttctgccc tttcttgcca atgatgaaac ggtgaagcca
ggaaggggcg 5040 gcgacagagg agacggtgaa gctattggcc ttctcctcat
aaatcttctt gatgcgagcc 5100 acagcctgag ccaactgttc cttctctcca
gtgaagacaa tctctgtccg gttcacgctg 5160 ggtgggggga tgttgatgcg
cgtgcctgtc tcctgcatga tctcgccaac cagtctatta 5220 tacggcccag
cgatgaaggg gtggaatgcc ttttctactt ctagcctctc cacagcacgt 5280
ttgtcctgct cggcagagat gagtaagact tcatggcgag ctttctcgat gccctctttg
5340 gtgccagtga tcttgatctg attgctgggg tcatctgggc gtgggatctg
gattttggtt 5400 gcagttttta gctccaagtc ttgcagtttc tctccatttt
tgccaataac aaagcgatgg 5460 tgttctttgg gaatggcaac agttgctgag
gcctgagtct gcagtctagc aacaatgtcc 5520 ttccgagctt tcatgacagc
atccagcttt cctgacacca tgatggagag gccttggtct 5580 ttggccaaag
acagctccaa gtgagcacca gttctctgca tgatctcaag gcagattttt 5640
gcttgttcac cttctccaaa ctggttcata tccttgtatt ttctctcctc caggggtaca
5700 tggaacacct gagtgatgac agaagccttg atgggtcgga tcttgttccc
ccaggctcca 5760 gcgggttcct gggcactttc caggcaagca gctttctcag
gaagtggagg gaaggcatcc 5820 ttgtaggttg gagggtcgct ctcctcttct
gaatttagag tggcaacttt gatttgttgc 5880 ggaaccagcc cacttcggtg
ttcagcaaaa ctctcttggg tcaaaactgc aacggaactc 5940 atggttgatc
tcacacctac acacaatccg ggaaaaccac tcttaatgct tacaaaatgc 6000
atcatgacag ttgctacaaa aagccagcgg tctctctctg caaggtgcat ccaggcccca
6060 aactaaacca cctccaaatc tcgacttaac caggtggtta taagtggtag
cagcaaaacg 6120 gtcagtagcc agaaggtccg tcctgaggcc gcctctgtca
gcctgccagc ttttgtcgtg 6180 ggcccccgcc cgctggtcct gccgctggct
tactcgcccc ccgcgcggga gaagccggga 6240 cgctccgagg cgcggcgccc
gggccccggc tgctatatag ggcggcggcc caatcccgcc 6300 t 6301 <210>
SEQ ID NO 14 <400> SEQUENCE: 14 000 <210> SEQ ID NO 15
<400> SEQUENCE: 15 000 <210> SEQ ID NO 16 <400>
SEQUENCE: 16 000 <210> SEQ ID NO 17 <400> SEQUENCE: 17
000 <210> SEQ ID NO 18 <400> SEQUENCE: 18 000
<210> SEQ ID NO 19 <211> LENGTH: 13 <212> TYPE:
PRT <213> ORGANISM: Human immunodeficiency virus <400>
SEQUENCE: 19 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln 1
5 10 <210> SEQ ID NO 20 <211> LENGTH: 16 <212>
TYPE: PRT <213> ORGANISM: Drosophila sp. <400>
SEQUENCE: 20 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys
Trp Lys Lys 1 5 10 15 <210> SEQ ID NO 21 <211> LENGTH:
6 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
6xHis tag" <400> SEQUENCE: 21 His His His His His His
1 5 <210> SEQ ID NO 22 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 22 gagaucaaca uugaccauaa a
21 <210> SEQ ID NO 23 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 23 aggaagaucg ggcuuuaagg a
21 <210> SEQ ID NO 24 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 24 uuuaugguca auguugaucu cua
23 <210> SEQ ID NO 25 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 25 uccuuaaagc ccgaucuucc ugc
23 <210> SEQ ID NO 26 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 26 tttttttttt tttttttttt
ttttt 25 <210> SEQ ID NO 27 <211> LENGTH: 21
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 27 caugaguucc guugcaguuu u
21 <210> SEQ ID NO 28 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 28 augaguuccg uugcaguuuu a
21 <210> SEQ ID NO 29 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 29 ccguugcagu uuugacccaa a
21 <210> SEQ ID NO 30 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 30 acccaagaga guuuugcuga a
21 <210> SEQ ID NO 31 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 31 caaaucaaag uugccacucu a
21 <210> SEQ ID NO 32 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 32 acaagcaaaa aucugccuug a
21 <210> SEQ ID NO 33 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 33 aacaccaucg cuuuguuauu a
21 <210> SEQ ID NO 34 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 34 aacugcaaga cuuggagcua a
21 <210> SEQ ID NO 35 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 35 cuaaaaacug caaccaaaau a
21 <210> SEQ ID NO 36 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 36 ugcaaccaaa auccagaucc a
21 <210> SEQ ID NO 37 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 37 aucaagaaga uuuaugagga a
21 <210> SEQ ID NO 38 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 38 gaaaaagaag acuacaacca u
21 <210> SEQ ID NO 39 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 39
aaaaagaaga cuacaaccau u 21 <210> SEQ ID NO 40 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 40
aaaagaagac uacaaccauu a 21 <210> SEQ ID NO 41 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 41
acuacaacca uugcagugga a 21 <210> SEQ ID NO 42 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 42
ugcaguggaa gugaagaaau a 21 <210> SEQ ID NO 43 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 43
gaagagcaau uugauccgca u 21 <210> SEQ ID NO 44 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 44
ggaucuaauc auugagcaaa g 21 <210> SEQ ID NO 45 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 45
uaaucauuga gcaaagauuu a 21 <210> SEQ ID NO 46 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 46
gagcaaagau uucaucgcac a 21 <210> SEQ ID NO 47 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 47
caaagauuuc aucgcacaau a 21 <210> SEQ ID NO 48 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 48
aagugacauu guccagcuca a 21 <210> SEQ ID NO 49 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 49
cacaaaauac augcagaaga u 21 <210> SEQ ID NO 50 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 50
cuguuccgau cuucaaacag u 21 <210> SEQ ID NO 51 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 51
uguuccgauc uucaaacagu u 21 <210> SEQ ID NO 52 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 52
ucuucaaaca guuucacaag a 21 <210> SEQ ID NO 53 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 53
cuucaaacag uuucacaaga a 21 <210> SEQ ID NO 54 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 54
uucaaacagu uucacaagaa u 21 <210> SEQ ID NO 55 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 55
ccagcagaga auagcaauuc a 21 <210> SEQ ID NO 56 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 56
gagaauagca auucagagac a 21 <210> SEQ ID NO 57 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide"
<400> SEQUENCE: 57 agaauagcaa uucagagacc a 21 <210> SEQ
ID NO 58 <211> LENGTH: 21 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 58 aauucagaga ccauuaucau a 21 <210> SEQ ID NO 59
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 59 uucagagacc auuaucauca a 21 <210> SEQ ID NO 60
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 60 ucagagacca uuaucaucac a 21 <210> SEQ ID NO 61
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 61 agagaccauu aucaucacag a 21 <210> SEQ ID NO 62
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 62 caaaccaaga guuucacugu u 21 <210> SEQ ID NO 63
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 63 aaaccaagag uuucacuguu a 21 <210> SEQ ID NO 64
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 64 aagaguuuca cuguugacau a 21 <210> SEQ ID NO 65
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 65 cagaaauucc aucgaucugu a 21 <210> SEQ ID NO 66
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 66 ucaaauuaaa uucccagaca a 21 <210> SEQ ID NO 67
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 67 ccguaaauug uugacgcucu u 21 <210> SEQ ID NO 68
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 68 ggucaugagc auucgugcua a 21 <210> SEQ ID NO 69
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 69 gucaugagca uucgugcuaa a 21 <210> SEQ ID NO 70
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 70 augagcauuc gugcuaagau a 21 <210> SEQ ID NO 71
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 71 agcauucgug cuaagauaac a 21 <210> SEQ ID NO 72
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 72 ucgugcuaag auaacagacu a 21 <210> SEQ ID NO 73
<211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 73 aaaacugcaa cggaacucau ggu 23 <210> SEQ ID NO 74
<211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 74 uaaaacugca acggaacuca ugg 23 <210> SEQ ID NO 75
<211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide"
<400> SEQUENCE: 75 uuugggucaa aacugcaacg gaa 23 <210>
SEQ ID NO 76 <211> LENGTH: 23 <212> TYPE: RNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 76 uucagcaaaa cucucuuggg uca
23 <210> SEQ ID NO 77 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 77 uagaguggca acuuugauuu guu
23 <210> SEQ ID NO 78 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 78 ucaaggcaga uuuuugcuug uuc
23 <210> SEQ ID NO 79 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 79 uaauaacaaa gcgauggugu ucu
23 <210> SEQ ID NO 80 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 80 uuagcuccaa gucuugcagu uuc
23 <210> SEQ ID NO 81 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 81 uauuuugguu gcaguuuuua gcu
23 <210> SEQ ID NO 82 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 82 uggaucugga uuuugguugc agu
23 <210> SEQ ID NO 83 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 83 uuccucauaa aucuucuuga ugc
23 <210> SEQ ID NO 84 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 84 augguuguag ucuucuuuuu cuu
23 <210> SEQ ID NO 85 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 85 aaugguugua gucuucuuuu ucu
23 <210> SEQ ID NO 86 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 86 uaaugguugu agucuucuuu uuc
23 <210> SEQ ID NO 87 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 87 uuccacugca augguuguag ucu
23 <210> SEQ ID NO 88 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 88 uauuucuuca cuuccacugc aau
23 <210> SEQ ID NO 89 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 89 augcggauca aauugcucuu cuc
23 <210> SEQ ID NO 90 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 90 cuuugcucaa ugauuagauc cuu
23 <210> SEQ ID NO 91 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 91 uaaaucuuug cucaaugauu aga
23 <210> SEQ ID NO 92 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 92 ugugcgauga aaucuuugcu caa
23 <210> SEQ ID NO 93 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence:
Synthetic oligonucleotide" <400> SEQUENCE: 93 uauugugcga
ugaaaucuuu gcu 23 <210> SEQ ID NO 94 <211> LENGTH: 23
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 94 uugagcugga caaugucacu uuu
23 <210> SEQ ID NO 95 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 95 aucuucugca uguauuuugu gca
23 <210> SEQ ID NO 96 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 96 acuguuugaa gaucggaaca gaa
23 <210> SEQ ID NO 97 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 97 aacuguuuga agaucggaac aga
23 <210> SEQ ID NO 98 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 98 ucuugugaaa cuguuugaag auc
23 <210> SEQ ID NO 99 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 99 uucuugugaa acuguuugaa gau
23 <210> SEQ ID NO 100 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 100 auucuuguga aacuguuuga
aga 23 <210> SEQ ID NO 101 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 101 ugaauugcua uucucugcug
gaa 23 <210> SEQ ID NO 102 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 102 ugucucugaa uugcuauucu
cug 23 <210> SEQ ID NO 103 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 103 uggucucuga auugcuauuc
ucu 23 <210> SEQ ID NO 104 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 104 uaugauaaug gucucugaau
ugc 23 <210> SEQ ID NO 105 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 105 uugaugauaa uggucucuga
auu 23 <210> SEQ ID NO 106 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 106 ugugaugaua auggucucug
aau 23 <210> SEQ ID NO 107 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 107 ucugugauga uaauggucuc
uga 23 <210> SEQ ID NO 108 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 108 aacagugaaa cucuugguuu
gcu 23 <210> SEQ ID NO 109 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 109 uaacagugaa acucuugguu
ugc 23 <210> SEQ ID NO 110 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 110 uaugucaaca gugaaacucu
ugg 23 <210> SEQ ID NO 111 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 111
uacagaucga uggaauuucu ggg 23 <210> SEQ ID NO 112 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 112
uugucuggga auuuaauuug aac 23 <210> SEQ ID NO 113 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 113
aagagcguca acaauuuacg gag 23 <210> SEQ ID NO 114 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 114
uuagcacgaa ugcucaugac cuu 23 <210> SEQ ID NO 115 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 115
uuuagcacga augcucauga ccu 23 <210> SEQ ID NO 116 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 116
uaucuuagca cgaaugcuca uga 23 <210> SEQ ID NO 117 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 117
uguuaucuua gcacgaaugc uca 23 <210> SEQ ID NO 118 <211>
LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 118
uagucuguua ucuuagcacg aau 23 <210> SEQ ID NO 119 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 119
caugaguucc guugcaguuu u 21 <210> SEQ ID NO 120 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 120
augaguuccg uugcaguuuu a 21 <210> SEQ ID NO 121 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 121
ccguugcagu uuugacccaa a 21 <210> SEQ ID NO 122 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 122
acccaagaga guuuugcuga a 21 <210> SEQ ID NO 123 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 123
caaaucaaag uugccacucu a 21 <210> SEQ ID NO 124 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 124
acaagcaaaa aucugccuug a 21 <210> SEQ ID NO 125 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 125
aacaccaucg cuuuguuauu a 21 <210> SEQ ID NO 126 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 126
aacugcaaga cuuggagcua a 21 <210> SEQ ID NO 127 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 127
cuaaaaacug caaccaaaau a 21 <210> SEQ ID NO 128 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 128
ugcaaccaaa auccagaucc a 21 <210> SEQ ID NO 129 <211>
LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 129 aucaagaaga uuuaugagga a
21 <210> SEQ ID NO 130 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 130 gaaaaagaag acuacaacca u
21 <210> SEQ ID NO 131 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 131 aaaaagaaga cuacaaccau u
21 <210> SEQ ID NO 132 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 132 aaaagaagac uacaaccauu a
21 <210> SEQ ID NO 133 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 133 acuacaacca uugcagugga a
21 <210> SEQ ID NO 134 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 134 ugcaguggaa gugaagaaau a
21 <210> SEQ ID NO 135 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 135 gaagagcaau uugauccgca u
21 <210> SEQ ID NO 136 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 136 ggaucuaauc auugagcaaa g
21 <210> SEQ ID NO 137 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 137 uaaucauuga gcaaagauuu a
21 <210> SEQ ID NO 138 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 138 gagcaaagau uucaucgcac a
21 <210> SEQ ID NO 139 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 139 caaagauuuc aucgcacaau a
21 <210> SEQ ID NO 140 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 140 aagugacauu guccagcuca a
21 <210> SEQ ID NO 141 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 141 cacaaaauac augcagaaga u
21 <210> SEQ ID NO 142 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 142 cuguuccgau cuucaaacag u
21 <210> SEQ ID NO 143 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 143 uguuccgauc uucaaacagu u
21 <210> SEQ ID NO 144 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 144 ucuucaaaca guuucacaag a
21 <210> SEQ ID NO 145 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 145 cuucaaacag uuucacaaga a
21 <210> SEQ ID NO 146 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 146 uucaaacagu uucacaagaa u
21 <210> SEQ ID NO 147 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 147 ccagcagaga auagcaauuc a
21 <210> SEQ ID NO 148 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 148 gagaauagca auucagagac a
21 <210> SEQ ID NO 149 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 149 agaauagcaa uucagagacc a
21 <210> SEQ ID NO 150 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 150 aauucagaga ccauuaucau a
21 <210> SEQ ID NO 151 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 151 uucagagacc auuaucauca a
21 <210> SEQ ID NO 152 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 152 ucagagacca uuaucaucac a
21 <210> SEQ ID NO 153 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 153 agagaccauu aucaucacag a
21 <210> SEQ ID NO 154 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 154 caaaccaaga guuucacugu u
21 <210> SEQ ID NO 155 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 155 aaaccaagag uuucacuguu a
21 <210> SEQ ID NO 156 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 156 aagaguuuca cuguugacau a
21 <210> SEQ ID NO 157 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 157 cagaaauucc aucgaucugu a
21 <210> SEQ ID NO 158 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 158 ucaaauuaaa uucccagaca a
21 <210> SEQ ID NO 159 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 159 ccguaaauug uugacgcucu u
21 <210> SEQ ID NO 160 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 160 ggucaugagc auucgugcua a
21 <210> SEQ ID NO 161 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 161 gucaugagca uucgugcuaa a
21 <210> SEQ ID NO 162 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 162 augagcauuc gugcuaagau a
21 <210> SEQ ID NO 163 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 163 agcauucgug cuaagauaac a
21 <210> SEQ ID NO 164 <211> LENGTH: 21 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 164 ucgugcuaag auaacagacu a
21 <210> SEQ ID NO 165 <211> LENGTH: 23 <212>
TYPE: RNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 165 aaaacugcaa cggaacucau
ggu 23 <210> SEQ ID NO 166 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 166 uaaaacugca acggaacuca
ugg 23 <210> SEQ ID NO 167 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 167 uuugggucaa aacugcaacg
gaa 23 <210> SEQ ID NO 168 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 168 uucagcaaaa cucucuuggg
uca 23 <210> SEQ ID NO 169 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 169 uagaguggca acuuugauuu
guu 23 <210> SEQ ID NO 170 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 170 ucaaggcaga uuuuugcuug
uuc 23 <210> SEQ ID NO 171 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 171 uaauaacaaa gcgauggugu
ucu 23 <210> SEQ ID NO 172 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 172 uuagcuccaa gucuugcagu
uuc 23 <210> SEQ ID NO 173 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 173 uauuuugguu gcaguuuuua
gcu 23 <210> SEQ ID NO 174 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 174 uggaucugga uuuugguugc
agu 23 <210> SEQ ID NO 175 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 175 uuccucauaa aucuucuuga
ugc 23 <210> SEQ ID NO 176 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 176 augguuguag ucuucuuuuu
cuu 23 <210> SEQ ID NO 177 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 177 aaugguugua gucuucuuuu
ucu 23 <210> SEQ ID NO 178 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 178 uaaugguugu agucuucuuu
uuc 23 <210> SEQ ID NO 179 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 179 uuccacugca augguuguag
ucu 23 <210> SEQ ID NO 180 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 180 uauuucuuca cuuccacugc
aau 23 <210> SEQ ID NO 181 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 181 augcggauca aauugcucuu
cuc 23 <210> SEQ ID NO 182 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 182 cuuugcucaa ugauuagauc
cuu 23 <210> SEQ ID NO 183 <211> LENGTH: 23
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 183 uaaaucuuug cucaaugauu
aga 23 <210> SEQ ID NO 184 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 184 ugugcgauga aaucuuugcu
caa 23 <210> SEQ ID NO 185 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 185 uauugugcga ugaaaucuuu
gcu 23 <210> SEQ ID NO 186 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 186 uugagcugga caaugucacu
uuu 23 <210> SEQ ID NO 187 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 187 aucuucugca uguauuuugu
gca 23 <210> SEQ ID NO 188 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 188 acuguuugaa gaucggaaca
gaa 23 <210> SEQ ID NO 189 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 189 aacuguuuga agaucggaac
aga 23 <210> SEQ ID NO 190 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 190 ucuugugaaa cuguuugaag
auc 23 <210> SEQ ID NO 191 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 191 uucuugugaa acuguuugaa
gau 23 <210> SEQ ID NO 192 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 192 auucuuguga aacuguuuga
aga 23 <210> SEQ ID NO 193 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 193 ugaauugcua uucucugcug
gaa 23 <210> SEQ ID NO 194 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 194 ugucucugaa uugcuauucu
cug 23 <210> SEQ ID NO 195 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 195 uggucucuga auugcuauuc
ucu 23 <210> SEQ ID NO 196 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 196 uaugauaaug gucucugaau
ugc 23 <210> SEQ ID NO 197 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 197 uugaugauaa uggucucuga
auu 23 <210> SEQ ID NO 198 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 198 ugugaugaua auggucucug
aau 23 <210> SEQ ID NO 199 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 199 ucugugauga uaauggucuc
uga 23 <210> SEQ ID NO 200 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 200 aacagugaaa cucuugguuu
gcu 23 <210> SEQ ID NO 201
<211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 201 uaacagugaa acucuugguu ugc 23 <210> SEQ ID NO
202 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 202 uaugucaaca gugaaacucu ugg 23 <210> SEQ ID NO
203 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 203 uacagaucga uggaauuucu ggg 23 <210> SEQ ID NO
204 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 204 uugucuggga auuuaauuug aac 23 <210> SEQ ID NO
205 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 205 aagagcguca acaauuuacg gag 23 <210> SEQ ID NO
206 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 206 uuagcacgaa ugcucaugac cuu 23 <210> SEQ ID NO
207 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 207 uuuagcacga augcucauga ccu 23 <210> SEQ ID NO
208 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 208 uaucuuagca cgaaugcuca uga 23 <210> SEQ ID NO
209 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 209 uguuaucuua gcacgaaugc uca 23 <210> SEQ ID NO
210 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 210 uagucuguua ucuuagcacg aau 23 <210> SEQ ID NO
211 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 211 accaugaguu ccguugcagu uuu 23 <210> SEQ ID NO
212 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 212 ccaugaguuc cguugcaguu uug 23 <210> SEQ ID NO
213 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 213 uuccguugca guuuugaccc aag 23 <210> SEQ ID NO
214 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 214 ugacccaaga gaguuuugcu gaa 23 <210> SEQ ID NO
215 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 215 aacaaaucaa aguugccacu cua 23 <210> SEQ ID NO
216 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 216 gaacaagcaa aaaucugccu uga 23 <210> SEQ ID NO
217 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 217 agaacaccau cgcuuuguua uug 23 <210> SEQ ID NO
218 <211> LENGTH: 23 <212> TYPE: RNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <221>
NAME/KEY: source <223> OTHER INFORMATION: /note="Description
of Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 218 gaaacugcaa gacuuggagc uaa 23
<210> SEQ ID NO 219 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 219 agcuaaaaac ugcaaccaaa
auc 23 <210> SEQ ID NO 220 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 220 acugcaacca aaauccagau
ccc 23 <210> SEQ ID NO 221 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 221 gcaucaagaa gauuuaugag
gag 23 <210> SEQ ID NO 222 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 222 aagaaaaaga agacuacaac
cau 23 <210> SEQ ID NO 223 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 223 agaaaaagaa gacuacaacc
auu 23 <210> SEQ ID NO 224 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 224 gaaaaagaag acuacaacca
uug 23 <210> SEQ ID NO 225 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 225 agacuacaac cauugcagug
gaa 23 <210> SEQ ID NO 226 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 226 auugcagugg aagugaagaa
auc 23 <210> SEQ ID NO 227 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 227 gagaagagca auuugauccg
cau 23 <210> SEQ ID NO 228 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 228 aaggaucuaa ucauugagca
aag 23 <210> SEQ ID NO 229 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 229 ucuaaucauu gagcaaagau
uuc 23 <210> SEQ ID NO 230 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 230 uugagcaaag auuucaucgc
aca 23 <210> SEQ ID NO 231 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 231 agcaaagauu ucaucgcaca
auc 23 <210> SEQ ID NO 232 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 232 aaaagugaca uuguccagcu
cag 23 <210> SEQ ID NO 233 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 233 ugcacaaaau acaugcagaa
gau 23 <210> SEQ ID NO 234 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 234 uucuguuccg aucuucaaac
agu 23 <210> SEQ ID NO 235 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 235 ucuguuccga ucuucaaaca
guu 23 <210> SEQ ID NO 236 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 236 gaucuucaaa caguuucaca
aga 23
<210> SEQ ID NO 237 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 237 aucuucaaac aguuucacaa
gaa 23 <210> SEQ ID NO 238 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 238 ucuucaaaca guuucacaag
aau 23 <210> SEQ ID NO 239 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 239 uuccagcaga gaauagcaau
uca 23 <210> SEQ ID NO 240 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 240 cagagaauag caauucagag
acc 23 <210> SEQ ID NO 241 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 241 agagaauagc aauucagaga
cca 23 <210> SEQ ID NO 242 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 242 gcaauucaga gaccauuauc
auc 23 <210> SEQ ID NO 243 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 243 aauucagaga ccauuaucau
cac 23 <210> SEQ ID NO 244 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 244 auucagagac cauuaucauc
aca 23 <210> SEQ ID NO 245 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 245 ucagagacca uuaucaucac
agg 23 <210> SEQ ID NO 246 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 246 agcaaaccaa gaguuucacu
guu 23 <210> SEQ ID NO 247 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 247 gcaaaccaag aguuucacug
uug 23 <210> SEQ ID NO 248 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 248 ccaagaguuu cacuguugac
auc 23 <210> SEQ ID NO 249 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 249 cccagaaauu ccaucgaucu
guc 23 <210> SEQ ID NO 250 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 250 guucaaauua aauucccaga
cag 23 <210> SEQ ID NO 251 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 251 cuccguaaau uguugacgcu
cuu 23 <210> SEQ ID NO 252 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 252 aaggucauga gcauucgugc
uaa 23 <210> SEQ ID NO 253 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 253 aggucaugag cauucgugcu
aag 23 <210> SEQ ID NO 254 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 254 ucaugagcau ucgugcuaag
aua 23
<210> SEQ ID NO 255 <211> LENGTH: 23 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 255 ugagcauucg ugcuaagaua
aca 23 <210> SEQ ID NO 256 <211> LENGTH: 23 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 256 auucgugcua agauaacaga
cuc 23 <210> SEQ ID NO 257 <211> LENGTH: 18 <212>
TYPE: RNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 257 aaaaaaaaaa aaaaaaaa 18
<210> SEQ ID NO 258 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 258 uuuuuuuuuu uuuuuuuu 18
<210> SEQ ID NO 259 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 259 cccccccccc cccccccc 18
<210> SEQ ID NO 260 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 260 cucucucucu cucucucu 18
<210> SEQ ID NO 261 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 261 ccuccuccuc cuccuccu 18
<210> SEQ ID NO 262 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 262 cuucuucuuc uucuucuu 18
<210> SEQ ID NO 263 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 263 acuacuacua cuacuacu 18
<210> SEQ ID NO 264 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 264 uuccucuucu uccucuuc 18
<210> SEQ ID NO 265 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 265 uuacuuuaau uacuuuaa 18
<210> SEQ ID NO 266 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 266 caacaacaac aacaacaa 18
<210> SEQ ID NO 267 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 267 ggugguggug gugguggu 18
<210> SEQ ID NO 268 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 268 guuguuguug uuguuguu 18
<210> SEQ ID NO 269 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 269 caucaucauc aucaucau 18
<210> SEQ ID NO 270 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 270 gaugaugaug augaugau 18
<210> SEQ ID NO 271 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 271 caccaccacc accaccac 18
<210> SEQ ID NO 272 <211> LENGTH: 18 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 272
guaguaguag uaguagua 18 <210> SEQ ID NO 273 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 273
gccgccgccg ccgccgcc 18 <210> SEQ ID NO 274 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 274
auuauuauua uuauuauu 18 <210> SEQ ID NO 275 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 275
aacaaccucc uccuccua 18 <210> SEQ ID NO 276 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 276
aaccaacucc uccuccua 18 <210> SEQ ID NO 277 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 277
aaccuaaucc uccuccua 18 <210> SEQ ID NO 278 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 278
aaccucaacc uccuccua 18 <210> SEQ ID NO 279 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 279
aaccuccaac uccuccua 18 <210> SEQ ID NO 280 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 280
aaccuccuaa uccuccua 18 <210> SEQ ID NO 281 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 281
aaccuccuca accuccua 18 <210> SEQ ID NO 282 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 282
aaccuccucc aacuccua 18 <210> SEQ ID NO 283 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 283
aaccuccucc uaauccua 18 <210> SEQ ID NO 284 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 284
aaccuccucc ucaaccua 18 <210> SEQ ID NO 285 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 285
aaccuccucc uccaacua 18 <210> SEQ ID NO 286 <211>
LENGTH: 18 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 286
aaccuccucc uccuaaua 18 <210> SEQ ID NO 287 <211>
LENGTH: 15 <212> TYPE: RNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <221> NAME/KEY: source
<223> OTHER INFORMATION: /note="Description of Artificial
Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 287
ccuccuccuc cuccu 15 <210> SEQ ID NO 288 <211> LENGTH:
12 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 288 ccuccuccuc cu 12
<210> SEQ ID NO 289 <211> LENGTH: 24 <212> TYPE:
RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 289 ccuccuccuc cuccuccucc
uccu 24 <210> SEQ ID NO 290 <211> LENGTH: 30
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 290
ccuccuccuc cuccuccucc uccuccuccu 30 <210> SEQ ID NO 291
<211> LENGTH: 37 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <221> NAME/KEY:
source <223> OTHER INFORMATION: /note="Description of
Artificial Sequence: Synthetic oligonucleotide" <400>
SEQUENCE: 291 gagatttaac tccacctact tccagggcac caaccag 37
<210> SEQ ID NO 292 <211> LENGTH: 22 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 292 atttaactcc acctactccc ag
22 <210> SEQ ID NO 293 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 293 atttaactcc acctacctcc ag
22 <210> SEQ ID NO 294 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 294 atttaactcc acccacttcc ag
22 <210> SEQ ID NO 295 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 295 atttaactcc acctacctcc a
21 <210> SEQ ID NO 296 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 296 atttaacccc acctacttcc ag
22 <210> SEQ ID NO 297 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 297 atctaactcc acctacttcc ag
22 <210> SEQ ID NO 298 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 298 atctaactcc acctacttcc 20
<210> SEQ ID NO 299 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 299 atttaactcc acctactccc a
21 <210> SEQ ID NO 300 <211> LENGTH: 22 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 300 attcaactcc acctacttcc ag
22 <210> SEQ ID NO 301 <211> LENGTH: 20 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 301 attcaactcc acctacttcc 20
<210> SEQ ID NO 302 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 302 atttaactcc acctacctcc 20
<210> SEQ ID NO 303 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 303 atttaacccc acctacttcc 20
<210> SEQ ID NO 304 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 304 atttaactcc acccacttcc a
21 <210> SEQ ID NO 305 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 305 atctaactcc acctacttcc a
21 <210> SEQ ID NO 306 <211> LENGTH: 26 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 306 gatttaactc cacctacttc
cagggc 26 <210> SEQ ID NO 307 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 307 gatttaaatc aacctaatta
cagggc 26 <210> SEQ ID NO 308 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide"
<400> SEQUENCE: 308 ccggcaatca tgccttacga ttatcc 26
<210> SEQ ID NO 309 <211> LENGTH: 37 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 309 gtggactacc tcaataatca
tcttcttcag ggattca 37 <210> SEQ ID NO 310 <211> LENGTH:
26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 310 actacctcaa taaccatctt
cttcag 26 <210> SEQ ID NO 311 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 311 actacctcaa taatcacctt
cttcag 26 <210> SEQ ID NO 312 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 312 actacctcaa caatcatctt
cttcag 26 <210> SEQ ID NO 313 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 313 actacctcaa taatcatcct
cttcag 26 <210> SEQ ID NO 314 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 314 actacctcaa taatcatctt
cctcag 26 <210> SEQ ID NO 315 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 315 actacctcaa taatcatctt
ctccag 26 <210> SEQ ID NO 316 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 316 actacctcaa taaccatctt 20
<210> SEQ ID NO 317 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 317 actaccccaa taatcatctt
cttcag 26 <210> SEQ ID NO 318 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 318 actacctcaa taatcacctt 20
<210> SEQ ID NO 319 <211> LENGTH: 26 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<221> NAME/KEY: source <223> OTHER INFORMATION:
/note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 319 accacctcaa taatcatctt
cttcag 26 <210> SEQ ID NO 320 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 320 ctcaataacc atcttcttca g
21 <210> SEQ ID NO 321 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 321 actacctcaa taatcacctt c
21 <210> SEQ ID NO 322 <211> LENGTH: 25 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 322 actacctcaa taaccatctt
cttca 25 <210> SEQ ID NO 323 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 323 actacctcaa taatcatctc
cttcag 26 <210> SEQ ID NO 324 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 324 ctacctcaat aatcatcttc
ttcagg 26 <210> SEQ ID NO 325 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide" <400> SEQUENCE: 325 ctaactaaat aataatatta
ttaagg 26 <210> SEQ ID NO 326 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <221> NAME/KEY: source <223> OTHER
INFORMATION: /note="Description of Artificial Sequence: Synthetic
oligonucleotide"
<400> SEQUENCE: 326 cgcaactttt acattctatc atagcc 26
* * * * *
References