U.S. patent application number 17/245217 was filed with the patent office on 2021-12-23 for multiplexed signal amplified fish via splinted ligation amplification and sequencing.
The applicant listed for this patent is Massachusetts Institute of Technology. Invention is credited to Shahar Alon, Edward Stuart Boyden, Fei Chen, Adam Henry Marblestone, Andrew C. Payne, Anubhav Sinha, Asmamaw Wassie.
Application Number | 20210395796 17/245217 |
Document ID | / |
Family ID | 1000005825934 |
Filed Date | 2021-12-23 |
United States Patent
Application |
20210395796 |
Kind Code |
A1 |
Chen; Fei ; et al. |
December 23, 2021 |
Multiplexed Signal Amplified FISH Via Splinted Ligation
Amplification and Sequencing
Abstract
The present invention relates to a method for amplifying at
least one target RNA in a fixed and, optionally, expanded
biological sample. In an embodiment of the invention, the method
comprises incubating the fixed biological sample with a pair of
polynucleotides complementary to non-overlapping and proximal
sequences of a target RNA, wherein the polynucleotide pair
hybridizes to the target RNA; ligating the polynucleotide pair
using a ligase; and amplifying the ligation product. The invention
further provides methods for detecting and optionally quantifying
and/or sequencing the amplification product. As the method
comprises hybridizing polynucleotide pairs to a target RNA in a
fixed biological sample, the target RNA can be hybridized in
situ.
Inventors: |
Chen; Fei; (Cambridge,
MA) ; Wassie; Asmamaw; (Boston, MA) ; Alon;
Shahar; (Cambridge, MA) ; Marblestone; Adam
Henry; (Arlington, MA) ; Sinha; Anubhav;
(Cambridge, MA) ; Payne; Andrew C.; (Cambridge,
MA) ; Boyden; Edward Stuart; (Chestnut Hill,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Massachusetts Institute of Technology |
Cambridge |
MA |
US |
|
|
Family ID: |
1000005825934 |
Appl. No.: |
17/245217 |
Filed: |
April 30, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15876347 |
Jan 22, 2018 |
10995361 |
|
|
17245217 |
|
|
|
|
62449202 |
Jan 23, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6811 20130101;
C12Q 2600/166 20130101; C12Q 1/6841 20130101; C12Q 1/6806 20130101;
C12Q 1/6855 20130101; C12Q 2600/158 20130101; C12Q 1/682 20130101;
C12Q 2600/16 20130101 |
International
Class: |
C12Q 1/6806 20060101
C12Q001/6806; C12Q 1/6841 20060101 C12Q001/6841; C12Q 1/6811
20060101 C12Q001/6811; C12Q 1/682 20060101 C12Q001/682; C12Q 1/6855
20060101 C12Q001/6855 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with U.S. government support under
Grant Number NYSCF-R-NI10, awarded by NYSCF; Grant Number
5-DPI0NS087724M, awarded by National Institute of Health; Grant
Number 134062-5093041, awarded by Army Research Office, Synthetic
Brain Project; Grant Number 152772.5906243.0105, awarded by
National Institute of Health; Grant Number 4R01MH103910, awarded by
National Institute of Health; Grant Number FP053369-N, awarded by
University of Chicago; and Grant Number 5-025836-00001, awarded by
Life Sciences Research Foundation. The government has certain
rights in this invention.
Claims
1. A method for amplifying one or more target RNAs in a fixed
biological sample comprising: (a) incubating the biological sample
with a pair of polynucleotides complementary to non-overlapping and
proximal sequences of a target RNA wherein the polynucleotides
hybridize to the target RNA; (b) ligating the polynucleotide pair
using a ligase; and (c) amplifying the ligation product.
2. The method of claim 1, wherein the fixed biological sample is an
expandable biological sample.
3. The method of claim 2, wherein prior to step (a) the sample is:
(i) contacted with a small molecule linker or a nucleic acid
adaptor comprising a binding moiety and an anchor, wherein the
binding moiety binds to target nucleic acids in the sample; and
wherein the anchor comprises a polymerizable moiety; (ii) permeated
with a composition comprising precursors of a swellable material;
and (iii) polymerization of the precursors of the swellable
material is initiated to form a swellable material, wherein the
swellable material is bound to the small molecule linker or a
nucleic acid adaptor to form a sample-swellable material complex,
thereby providing an expandable sample.
4. The method of claim 3, further comprising expanding the
sample.
5. The method of claim 3, wherein expanding the sample comprises
adding an aqueous solvent or liquid to cause the sample-swellable
material complex to swell, thereby physically expanding the
complex.
6. The method of claim 5, wherein the biological sample is expanded
prior to step (c) or post step (c).
7. The method of claim 3, wherein the swellable material is a
hydrogel.
8. The method of claim 1, wherein the pair of polynucleotides is
hybridized to the target RNA in situ.
9. The method of claim 1, further comprising the step of sequencing
the amplified ligation product within the fixed biological
sample.
10. A method for detecting one or more target RNAs in a fixed
biological sample comprising: (a) incubating the biological sample
with a pair of polynucleotides complementary to non-overlapping and
proximal sequences of a target RNA wherein the polynucleotides
hybridize to the target RNA; (b) ligating the polynucleotide pair
using a ligase; (c) amplifying the ligation product; (d) detecting
the amplified product.
11. The method of claim 10, wherein the fixed biological sample is
an expandable sample.
12. The method of claim 11, wherein prior to step (a) the sample is
(i) contacted with a small molecule linker or a nucleic acid
adaptor comprising a binding moiety and an anchor, wherein the
binding moiety binds to target nucleic acids in the sample; and
wherein the anchor comprises a polymerizable moiety; (ii) permeated
with a composition comprising precursors of a swellable material;
and (iii) polymerization of the precursors of the swellable
material is initiated to form a swellable material, wherein the
swellable material is bound to the small molecule linker or a
nucleic acid adaptor to form a sample-swellable material complex,
thereby providing an expandable sample.
13. The method of claim 12, further comprising expanding the
sample.
14. The method of claim 13, wherein expanding the sample comprises
adding an aqueous solvent or liquid to cause the sample-swellable
material complex to swell, thereby physically expanding the
complex.
15. The method of claim 14, wherein the biological sample is
expanded prior to step (c) or post step (c).
16. The method of claim 12, wherein the swellable material is a
hydrogel.
17. The method of claim 10, wherein the pair of polynucleotides is
hybridized to the target RNA in situ.
18. The method of claim 10, further comprising the step of
localizing the amplified product within the fixed biological
sample.
19. The method of claim 10, further comprising the step of
sequencing the amplified ligation product within the fixed
biological sample.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 15/876,347, filed on Jan. 22, 2018, which claims the benefit of
U.S. Provisional Application No. 62/449,202, filed on Jan. 23,
2017. The entire teachings of the above applications are
incorporated herein by reference.
BACKGROUND
[0003] When biological material, such as, for example, a tissue
fragment or isolated cells, is removed from a living organism, the
cells die within a short period of time. The dead cells are then
broken down first by autolysis/fermentation and then bacterially,
so that the original cell and tissue structures, components or
molecules are destroyed. If cells or tissue fragments are to be
removed from an organism for histological examination, it is
recommended to fix the biological sample taken to prevent
degradation. Fixation leaves the structures of the sample
substantially unchanged to allow histological assessment thereof.
Additionally, fixation allows long-term preservation and archiving
of the samples. For these reasons, many morphological examinations
are only possible based on fixed material.
[0004] Fixation is regularly achieved by protein-precipitating or
protein-crosslinking compounds such as acids, alcohols, ketones or
other organic substances such as glutaraldehyde or formaldehyde.
Fixation with formaldehyde (employed e.g. in the form of a 35
percent by weight aqueous solution referred to as "formalin")
followed by embedding the fixed material in paraffin (called
"formalin-fixed, paraffin-embedded" (FFPE) material) has importance
in particular in pathology.
[0005] The disadvantage of fixation with cross-linking fixatives
such as formaldehyde is that it is very difficult to isolate
biomolecules such as, DNA, RNA or proteins from respectively fixed
material. Crosslinking occurs between the fixative, such as
formaldehyde, and proteins as well as other biomolecules, including
the nucleic acids, present in the sample making the release and
isolation of the nucleic acids (DNA or RNA) from fixed samples
difficult. For investigations on a molecular level, in particular
for clinical or diagnostic applications, analysis of the nucleic
acids is of great importance. Numerous methods have been developed
for releasing and isolating nucleic acids from fixed samples to
allow analysis. However, such methods do not allow for analyzing
nucleic acids or localizing them in situ within a cell or
tissue.
[0006] Therefore, it would be advantageous to analyze nucleic acids
in the native state of cells and tissues without the need to
release and isolate nucleic acids from fixed samples.
SUMMARY
[0007] The present invention further relates to a method for
amplifying at least one target RNA in a fixed and, optionally,
expanded biological sample. In an embodiment of the invention, the
method comprises incubating the fixed biological sample with a pair
of polynucleotides complementary to non-overlapping and proximal
sequences of a target RNA, wherein the polynucleotide pair
hybridizes to the target RNA; ligating the polynucleotide pair
using a ligase; and amplifying the ligation product.
[0008] The present invention further relates to a method for
detecting at least one target RNA in a fixed and, optionally,
expanded biological sample. In an embodiment of the invention, the
method comprises incubating the fixed biological sample with a pair
of polynucleotides complementary to non-overlapping and proximal
sequences of a target RNA, wherein the polynucleotide pair
hybridizes to the target RNA; ligating the polynucleotide pair
using a ligase; amplifying the ligation product; and detecting and
optionally quantifying the amplification product.
[0009] As the methods disclosed herein comprises hybridizing
polynucleotide pairs to a target RNA in a fixed biological sample,
the target RNA can be hybridized in situ.
[0010] The methods may further comprises localizing the target RNA
within the sample.
[0011] The methods may further comprises sequencing the target RNA
within the sample.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Other aspects, advantages and novel features of the
invention will become more apparent from the following detailed
description of the invention when considered in conjunction with
the accompanying drawings wherein:
[0013] FIGS. 1A through 1C depict an embodiment of an RCA based
multiplexed FISH workflow according to the invention. (A) Work flow
for RCA based multiplexing. (B) Wide-field image showing FISH
staining (green and red) in ExM-treated cultured primary
hippocampal neurons after targeting ActB transcripts with padlock
probes followed by SplintR ligase based ligation and RCA
amplification. Scale bar, 50 .mu.m. (C) Wide-field image showing
RCA based FISH staining (green and red) performed against ActB in
expanded Thy1-YFP (blue) cortical brain slices. Scale bars, 50
.mu.m. All images are maximum intensity projections.
[0014] FIG. 2. Measurement of emission and absorption spectra for
MiSeq dyes. (a) Absorption spectra for MiSeq dyes indicating four
unique colors. (b) Emission spectra for an excitation close to each
of the absorption maxima.
[0015] FIG. 3. Demonstration of sequencing by synthesis in situ.
(a) Representative region of interest of an initial base of
sequencing of an RNA sequencing library prepared in an expanded
sample. (b) Multiple bases of sequencing by synthesis. Individual
clusters change color from round-to-round.
[0016] FIG. 4. Intensity crosstalk plot for the first base of
sequencing for clusters detected in the 488 nm channel ("G") and
the 560 nm channel ("T"). The clusters separate into two distinct,
roughly orthogonal components, and the aggregate dataset shows low
correlation, both indicative of highly clonal clusters.
[0017] FIG. 5. Intensity crosstalk plot for the fifth base of
sequencing. The clusters have become significantly dimmer and more
correlated, indicating incomplete addition and an increase in
polyclonality.
[0018] FIG. 6. Crosstalk plot correlation over multiple sequencing
rounds. The correlation increases monotonically and roughly
linearly, indicating a steady accumulation of chemistry errors
(phasing).
[0019] FIG. 7. Analysis of phasing on a per-cluster basis, showing
the fraction of clusters that are sufficiently clonal to pass an
intensity threshold (i.e. a "chastity filter").
[0020] FIG. 8. Representative region of interest of an initial base
of sequencing of an RNA sequencing library prepared in an expanded
sample, with two rounds of synthesis before imaging.
[0021] FIG. 9. Crosstalk plot for the first base of sequencing,
with two rounds of synthesis before imaging. The two channels are
more correlated initially than in the analogous case for one round
of synthesis (see FIG. 4).
[0022] FIG. 10. Crosstalk plot for the seventh base of sequencing,
with two rounds of synthesis before imaging. The two channels have
not become significantly more correlated over seven cycles of
sequencing.
[0023] FIG. 11. Crosstalk plot correlation over multiple sequencing
rounds with two rounds of synthesis.
[0024] FIG. 12. Fraction of clusters passing the intensity
threshold. Unlike the analogous case in FIG. 7, a significant
fraction of clusters consistently pass the 0.6 threshold.
[0025] FIG. 13A through 13C. Conceptual illustration of SOLiD
sequencing by ligation. (a) A template strand is sequenced by
successive cycles of ligation and cleavage of fluorescent
dinucleotide probes. Multiple sequencing primers with different
starting positions are used; each base is ultimately assayed twice.
(b) Two-base encoding scheme used in SOLiD. (c) The true biological
sequence can be reconstructed from a "color space" two-base
encoding.
[0026] FIG. 14. Conceptual illustration of cyclic reversible
termination based sequencing by synthesis. A target strand,
typically a member of a micro-scale cluster of identical molecules
amplified from a template, is primed with a sequencing primer which
will initiate polymerase binding. A mixture of nucleotides modified
with a fluorophore and a 3'blocking group are added along with a
polymerase. The primer is extended by a single base and the cluster
is imaged. The dye and the 3'blocking group are then both cleaved,
and the cycle can be repeated.
[0027] FIG. 15. Measurement of emission and absorption spectra for
NextSeq dyes. (a) Absorption spectra for NextSeq dyes indicating
two unique colors. (b) Emission spectra for an excitation close to
each of the absorption maxima.
DETAILED DESCRIPTION
[0028] As used herein and in the appended claims, the singular
forms "a", "an", and "the" are defined to mean "one or more" and
include the plural unless the context clearly dictates otherwise.
It is further noted that the claims can be drafted to exclude any
optional element. As such, this statement is intended to serve as
antecedent basis for use of such exclusive terminology as "solely,"
"only" and the like in connection with the recitation of claim
elements, or use of a "negative" limitation. As will be apparent to
those of skill in the art upon reading this disclosure, each of the
individual embodiments described and illustrated herein has
discrete components and features which can be readily separated
from or combined with the features of any of the other several
embodiments without departing from the scope or spirit of the
present teachings. Any recited method can be carried out in the
order of events recited or in any other order which is logically
possible.
[0029] The present invention provides a method for amplifying at
least one target RNA in a fixed and, optionally, expanded
biological sample. In an embodiment of the invention, the method
comprises the steps: (a) fixing a biological sample; (b) optionally
expanding the biological sample, (c) incubating the biological
sample with a pair of polynucleotides complementary to
non-overlapping and proximal sequences of a target RNA, wherein the
polynucleotide pair hybridizes to the target RNA; (d) ligating the
polynucleotide pair using a ligase; and (e) amplifying the ligation
product.
[0030] The method disclosed herein may further comprise quantifying
the amplification product. The method disclosed herein may further
comprise sequencing the amplification product.
[0031] The present invention provides a method for amplifying at
least one target RNA in a fixed and, optionally, expanded
biological sample. In an embodiment of the invention, the method
comprises the steps: (a) incubating the biological sample with a
pair of polynucleotides complementary to non-overlapping and
proximal sequences of a target RNA, wherein the polynucleotide pair
hybridizes to the target RNA; (b) ligating the polynucleotide pair
using a ligase; and (c) amplifying the ligation product.
[0032] The method disclosed herein may further comprise quantifying
the amplification product. The method disclosed herein may further
comprise sequencing the amplification product.
[0033] The present invention further provides a method for
detecting at least one target RNA in a fixed and, optionally,
expanded biological sample. In an embodiment of the invention, the
method comprises the steps: (a) fixing a biological sample; (b)
optionally expanding the biological sample, (c) incubating the
biological sample with a pair of polynucleotides complementary to
non-overlapping and proximal sequences of a target RNA, wherein the
polynucleotide pair hybridizes to the target RNA; (d) ligating the
polynucleotide pair using a ligase; (e) amplifying the ligation
product; (f) detecting the amplification product (g) optionally
quantifying the amplification product. In one embodiment, the
method further comprises the step of (h) localizing the target RNA
within the sample.
[0034] The present invention provides a method for detecting at
least one target RNA in a fixed and, optionally, expanded
biological sample. In an embodiment of the invention, the method
comprises the steps: (a) incubating the biological sample with a
pair of polynucleotides complementary to non-overlapping and
proximal sequences of a target RNA, wherein the polynucleotide pair
hybridizes to the target RNA; (b) ligating the polynucleotide pair
using a ligase; (c) amplifying the ligation product; (d) detecting
the amplification product (e) optionally quantifying the
amplification product. In one embodiment, the method further
comprises the step of (f) localizing the target RNA within the
sample.
[0035] As the methods disclosed herein comprises hybridizing
polynucleotide pairs to a target RNA in a fixed biological sample,
the target RNA can be hybridized in situ. As used herein, the terms
"hybridized in situ" or "in situ hybridization" refer to a
technique for localizing specific nucleic acid targets within fixed
tissues and cells, providing temporal and spatial information about
gene expression and genetic loci.
[0036] The term "fixed biological sample" is used herein in a broad
sense and is intended to include sources that contain nucleic acids
and can be fixed. Exemplary biological samples include, but are not
limited to, tissues including but not limited to, liver, spleen,
kidney, lung, intestine, thymus, colon, tonsil, testis, skin,
brain, heart, muscle and pancreas tissue. Other exemplary
biological samples include, but are not limited to, biopsies, bone
marrow samples, organ samples, skin fragments and organisms.
Materials obtained from clinical or forensic settings are also
within the intended meaning of the term biological sample.
Preferably, the sample is derived from a human, animal or plant.
Preferably, the biological sample is a tissue sample, preferably an
organ tissue sample. Preferably, samples are human. The sample can
be obtained, for example, from autopsy, biopsy or from surgery. It
can be a solid tissue such as, for example, parenchyme, connective
or fatty tissue, heart or skeletal muscle, smooth muscle, skin,
brain, nerve, kidney, liver, spleen, breast, carcinoma (e.g. bowel,
nasopharynx, breast, lung, stomach etc.), cartilage, lymphoma,
meningioma, placenta, prostate, thymus, tonsil, umbilical cord or
uterus. The tissue can be a tumor (benign or malignant), cancerous
or precancerous tissue. The sample can be obtained from an animal
or human subject affected by disease or other pathology or
suspected of same (normal or diseased), or considered normal or
healthy. As used herein, the term "fixed biological sample,
explicitly excludes cell-free samples, for example cell extracts,
wherein cytoplasmic and/or nuclear components from cells are
isolated.
[0037] Fixation of the biological sample can be effected with
fixatives known to the person skilled in the art. In one
embodiment, the fixative, includes but is not limited to, acids,
alcohols, ketones or other organic substances, such as,
glutaraldehyde, formaldehyde or paraformaldehyde. Examples of
fixatives and uses thereof may be found in Sambrook et al. (2000);
Maniatis et al. (1989). Preferably, the used fixation also
preserves DNA and RNA. According to one embodiment of the process
according to the invention, a formaldehyde-fixed, paraffin-embedded
biological sample (FFPE sample) is used. Other fixatives and
fixation methods for providing a fixed biological sample are known
in the prior art. For example, the biological sample can be fresh
froze, wherein alcohol based fixed samples can be used. In one
embodiment, the fixed tissue may or may not be embedded in a
non-reactive substance such as paraffin. Embedding materials
include, but are not limited to, paraffin, mineral oil, non-water
soluble waxes, celloidin, polyethylene glycols, polyvinyl alcohol,
agar, gelatine, nitrocelluloses, methacrylate resins, epoxy resins
or other plastic media. Thereby, one can produce tissue sections of
the biological material suitable for histological examinations.
[0038] Alternatively or additionally, the fixed biological sample
can be an expandable biological sample. An expandable biological
sample can be effected by embedding the sample in a swellable
material that has been perfused throughout the sample as described
by Chen et al. (Chen et al., Science, 347, 543 (2015) and U.S.
Patent Publication Nos. US 2016-0116384-A1; US 2016-0305856-A1; US
2016-0304952-A1; and U.S. patent application Ser. Nos. 15/229,539
and 15/229,545 incorporated herein by reference in their entirety).
Briefly, a sample, such as tissue, can be permeabilized. A
permeabilized sample can be infused with monomers or precursors of
a swellable material and then causing the monomers or precursors to
undergo polymerization within the sample to form the swellable
material. During or after polymerization, the swellable material
can be anchored or cross-linked (e.g., covalently crosslinked) to
the sample. The sample-swellable material complex is optionally
treated with protease to homogenize the mechanical characteristics
of the sample. The sample-swellable material complex can then be
treated by dialysis in a solvent or liquid, such as in water,
resulting in isotropic physical expansion of the sample. In this
manner, the fixed biological sample is physically "enlarged", or
"expanded", as compared to the biological sample before
swelling.
[0039] An expandable biological sample can also be prepared by
contacting the sample with a bi-functional linker comprising a
binding moiety and an anchor, wherein the binding moiety binds to
target nucleic acids in the sample; permeating the sample with a
composition comprising precursors of a swellable material; and
initiating polymerization to form a swellable material, wherein the
swellable material is bound to the small molecule linker or a
nucleic acid adaptor to form a sample-swellable material
complex.
[0040] As used herein a bi-functional linker comprises reactive
groups to functional groups (e.g., primary amines or sulfhydryls)
on biomolecules within the sample. The bi-functional linker may be
used to chemically modify the amine group of biomolecules with a
swellable polymer functional group, which enables target nucleic
acids within the sample to be directly anchored to, or incorporated
into, the swellable polymer. In one embodiment, the bifunctional
linker is a hetero-bifunctional linker. Hetero-bifunctional linkers
possess different reactive groups at either end of a spacer arm,
i.e., atoms, spacers or linkers separating the reactive groups.
These reagents not only allow for single-step conjugation of
molecules that have the respective target functional group, but
they also allow for sequential (two-steps) conjugations that
minimize undesirable polymerization or self-conjugation. The
bi-functional linker may be a small molecule linker or a nucleic
acid adaptor.
[0041] The anchor may be a physical, biological, or chemical moiety
that attaches or crosslinks the sample to the composition, hydrogel
or other swellable material. This may be accomplished by
crosslinking the anchor with the swellable material, such as during
or after the polymerization, i.e., in situ formation of the
swellable material. The anchor may comprise a polymerizable moiety.
The anchor may include, but is not limited to, vinyl or vinyl
monomers such as styrene and its derivatives (e.g., divinyl
benzene), acrylamide and its derivatives, butadiene, acrylonitrile,
vinyl acetate, or acrylates and acrylic acid derivatives. The
polymerizable moiety may be, for example, an acrylamide modified
moiety that may be covalently fixed within a swellable
material.
[0042] As used herein, a "nucleic acid adaptor" is a nucleic acid
sequence having a binding moiety capable of attaching to a target
nucleic acid and an anchor moiety capable of attaching to the
swellable material. Attaching the nucleic acid adaptor to a target
nucleic acid may be accomplished by hybridization or by ligation in
situ. For example, DNA adaptors may be ligated to the 3' ends of
the RNAs in the sample with RNA ligases, such as T4 RNA ligase, or
may be attached via a chemical linker such as a reactive amine
group capable of reacting with target nucleic acid. Acrylamide
modified oligonucleotide primers may be covalently fixed within a
swellable material such as a polyacrylate gel. As used herein, the
term "acrylamide modified" in reference to an oligonucleotide means
that the oligonucleotide has an acrylamide moiety attached to the
5' end of the molecule.
[0043] As used herein, a "small molecule linker" is a small
molecule having a binding moiety capable of attaching to a target
nucleic acid and an anchor moiety capable of attaching to the
swellable material. Attaching the small molecule linker to the
target nucleic acid may be accomplished by hybridization or by a
chemical reactive group capable of covalently binding the target
nucleic acid. For example, Label-IT.RTM. Amine (MirusBio) is a
small molecule with alkylating group that primarily reacts to the
N7 of guanine, thereby allowing covalent binding of RNA and DNA.
The small molecule linker may be, for example, acrylamide modified
and therefore may be covalently fixed within a swellable material.
As used herein, the term "acrylamide modified" in reference to a
small molecule linker means that the small molecule linker has an
acrylamide moiety.
[0044] As used herein, the term "attach" or "attached" refers to
both covalent interactions and noncovalent interactions. In certain
embodiments of the invention, covalent attachment may be used, but
generally all that is required is that the bi-functional linker
remain attached to the target nucleic acid under conditions for
nucleic acid amplification and/or sequencing. Oligonucleotide
adaptors may be attached such that a 3' end is available for
enzymatic extension and at least a portion of the sequence is
capable of hybridizing to a complementary sequence. Attachment can
occur via hybridization to the target nucleic acid, in which case
the attached oligonucleotide may be in the 3'-5' orientation.
Alternatively, attachment can occur by means other than
base-pairing hybridization, such as the covalent attachment set
forth above. The term "attach" may be used interchangeably herein
with the terms, "anchor(ed)", affix(ed), link(ed) and
immobilize(d).
[0045] As used herein, the term "swellable material" generally
refers to a material that expands when contacted with a liquid,
such as water or other solvent. Preferably, the swellable material
uniformly expands in 3 dimensions, i.e., isotropically.
Additionally or alternatively, the material is transparent such
that, upon expansion, light can pass through the sample. The
swellable material may be a swellable polymer or hydrogel. The
swellable material may be formed in situ from precursors thereof.
One or more polymerizable materials, such as monomers or oligomers
can be used. For example, such as monomers may be selected from the
group consisting of water soluble groups containing a polymerizable
ethylenically unsaturated group. Monomers or oligomers can comprise
one or more substituted or unsubstituted methacrylates, acrylates,
acrylamides, methacrylamides, vinylalcohols, vinylamines,
allylamines, allylalcohols, including divinylic crosslinkers
thereof (e.g., N, N-alkylene bisacrylamides). Precursors can also
comprise polymerization initiators and crosslinkers. The precursors
of a swellable material may comprise at least one polyelectrolyte
monomer and a covalent crosslinker.
[0046] The swellable material may be formed in situ by chemically
crosslinking water soluble oligomers or polymers. Thus, the
invention envisions adding precursors of the swellable material to
the sample and rendering the precursors swellable in situ. The
sample may be permeated (such as, perfusing, infusing, soaking,
adding or other intermixing) with the precursors of the swellable
material, wherein the sample is saturated with precursors of the
swellable material, which flow between and around biomolecules
throughout the specimen.
[0047] Polymerizing and/or crosslinking the monomers or precursors
is initiated to form the swellable material or polymer in situ. In
this manner the biological sample is embedded in the swellable
material.
[0048] Following permeating the specimen, the swellable polymer
precursors are polymerized, i.e., covalently or physically
crosslinked, to form a polymer network. The polymer network is
formed within and throughout the specimen. In this manner, the
biological specimen is saturated with the swellable material, which
flow between and around biomolecules throughout the specimen.
[0049] Polymerization may be by any method including, but not
limited to, thermal crosslinking, chemical crosslinking, physical
crosslinking, ionic crosslinking, photo-crosslinking, irradiative
crosslinking (e.g., x-ray, electron beam), and the like, and may be
selected based on the type of hydrogel used and knowledge in the
art. In one embodiment, the polymer is a hydrogel. Once
polymerized, a polymer-embedded biological specimen is formed.
[0050] The swellable polymer may be a polyacrylate or
polyacrylamide and copolymers or crosslinked copolymers thereof.
For example, if the biological sample is to be embedded in sodium
polyacrylate, a solution comprising the monomers sodium acrylate
and acrylamide, and a crosslinker selected from
N,N-methylenebisacrylamide (BIS),
N,N'-(1,2-Dihydroxythylene)bisacrylamide), and (DHEBA)
N,N'-Bis(acryloyl)cystamine (BAC), are perfused throughout the
sample.
[0051] The swellable material may be a hydrogel. The hydrogel may
be a polyelectrolyte hydrogel. The polyelectrolyte may be a
polyacrylate.
[0052] The fixed, expandable biological sample may be expanded.
Expanding the sample may be accomplished by adding an aqueous
solvent or liquid to cause the sample-swellable material complex to
swell, thereby physically expanding the complex.
[0053] The biological sample may be expanded prior to or after the
incubation step, ligation step or amplification step. In other
words, the steps expanding the biological sample can be
independently performed before or after any of the other steps.
[0054] The biological sample can be expanded prior to or after the
incubation step, ligation step or amplification step. In other
words, the steps expanding the biological sample can be
independently performed before or after steps (a), (b), (c), (d),
and (e). It is understood that steps (a)-(e) are performed in
order. In view of the flexibility in the order of the performing
each step, the article "a" is used to describe the biological
sample in each step to ensure that, in each instance, the
biological sample is not necessarily the product produced by the
preceding step. For example, the product of step (a) can be the
result of incubating a biological sample as directly obtained from
a subject with a pair of polynucleotides. Alternatively, the
product of step (a) can be the result of incubating a previously
fixed biological sample with a pair of polynucleotides.
[0055] In one embodiment, the expandable biological sample can be
expanded. The biological sample can be fixed and/or expanded prior
to or after the incubation step, ligation step or amplification
step. In other words, the steps of fixing (a) and expanding (b) the
biological sample can be independently performed before or after
steps (c), (d), (e), (f), (g) and (h). It is understood that the
fixing step (a) are performed before the expanding step (b) and
steps (c)-(f) are also performed in order. In view of the
flexibility in the order of the performing each step, the article
"a" is used to describe the biological sample in each step to
ensure that, in each instance, the biological sample is not
necessarily the product produced by the preceding step. For
example, the product of step (c) can be the result of incubating a
biological sample as directly obtained from a subject with a pair
of polynucleotides. Alternatively, the product of step (c) can be
the result of incubating a biological sample produced by step (a)
and/or step (b) with a pair of polynucleotides.
[0056] The enlarged sample may be re-embedded in a non-swellable
material. "Re-embedding" comprises permeating (such as, perfusing,
infusing, soaking, adding or other intermixing) the sample with the
non-swellable material, preferably by adding precursors thereof.
Alternatively or additionally, embedding the sample in a
non-swellable material comprises permeating one or more monomers or
other precursors throughout the sample and polymerizing and/or
crosslinking the monomers or precursors to form the non-swellable
material or polymer. In this manner the first enlarged sample, for
example, is embedded in the non-swellable material. Embedding the
expanded sample in a non-swellable material prevents conformational
changes during sequencing despite salt concentration variation. The
non-swellable material can be charge-neutral hydrogels. For
example, it can be polyacrylamide hydrogel, composed of acrylamide
monomers, bisacrylamide crosslinker, ammonium persulfate (APS)
initiator and tetramethylethylenediamine (TEMED) accelerator.
[0057] The fixed biological sample may be subjected to passivation.
As used herein the term "passivation" refers to the process for
rendering the sample less reactive with the components contained
within the fixative such as by functionalizing the fixative with
chemical reagents to neutralize charges within. For example, the
carboxylic groups of acrylate, which may be used in the swellable
gel, can inhibit downstream enzymatic reactions. Treating the
swellable gel composed of acrylate with
1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and
N-Hydroxysuccinimide (NHS) allows primary amines to covalently bind
the carboxylic groups to form charge neutral amides and passivate
the swellable gel.
[0058] The expandable biological sample, can, optionally, be
treated with a detergent prior to being contacted with the
precursors of the swellable material. The use of a detergent can
improve the wettability of the sample or disrupt the sample to
allow the precursors of the swellable monomer to permeate
throughout sample.
[0059] The sample is attached or crosslinked to the swellable
material before expansion. This may be accomplished, for example,
by crosslinking the anchor with the swellable material, such as
during or after the polymerization, i.e., in situ formation of the
swellable material.
[0060] After the sample has been anchored to the swellable
material, the sample is, optionally, subjected to a disruption of
the endogenous biological molecules leaving the target nucleic
acids with a small molecule linker or nucleic acid adapter intact
and anchored to the swellable material. In this way, the mechanical
properties of the sample-swellable material complex are rendered
more spatially uniform, allowing isotropic expansion with minimal
artifacts.
[0061] As used herein, the "disruption of the endogenous physical
structure of the sample" or the term "disruption of the endogenous
biological molecules" of the biological sample generally refers to
the mechanical, physical, chemical, biochemical or, preferably,
enzymatic digestion, disruption or break up of the sample so that
it will not resist expansion. A protease enzyme may be used to
homogenize the sample-swellable material complex. The disruption
should not impact the structure of the swellable material but
disrupt the structure of the sample. Thus, the sample disruption
should be substantially inert to the swellable material. The degree
of digestion can be sufficient to compromise the integrity of the
mechanical structure of the sample or it can be complete to the
extent that the sample-swellable material complex is rendered
substantially free of the sample. The disruption of the physical
structure of the sample may be protein digestion of the proteins
contained in the biological sample.
[0062] The sample-swellable material complex may then be
isoptropically expanded. Expanding the sample may be accomplished
by adding a solvent or liquid to the complex, which is then
absorbed by the swellable material and causes swelling. Where the
swellable material is water swellable, an aqueous solution can be
used.
[0063] The biological sample may be labeled or tagged with a
detectable label. Typically, the label or tag will bind chemically
(e.g., covalently, hydrogen bonding or ionic bonding) to the
sample, or a component thereof. The detectable label can be
selective for a specific target (e.g., a biomarker or class of
molecule), as can be accomplished with an antibody or other target
specific binder. The detectable label preferably comprises a
visible component, as is typical of a dye or fluorescent molecule;
however, any signaling means used by the label is also
contemplated. A fluorescently labeled biological sample, for
example, is a biological sample labeled through techniques such as,
but not limited to, immunofluorescence, immunohistochemical or
immunocytochemical staining to assist in analysis. Thus, the
detectable label may be chemically attached to the biological
sample, or a targeted component thereof. The detectable label may
be an antibody and/or fluorescent dye wherein the antibody and/or
fluorescent dye further comprises a physical, biological, or
chemical anchor or moiety that attaches or crosslinks the sample to
the composition, hydrogel or other swellable material. The
detectable label may be attached to the bi-functional linker. The
detectable label may be attached to the nucleic acid adaptor or the
small molecule linker. The labeled sample may furthermore include
more than one label. For example, each label can have a particular
or distinguishable fluorescent property, e.g., distinguishable
excitation and emission wavelengths. Further, each label can have a
different target specific binder that is selective for a specific
and distinguishable target in, or component of the sample.
[0064] The term "polynucleotide" includes DNA, RNA or part DNA and
part RNA. The polynucleotides when used in a ligation reaction with
an RNA target (or target RNA) are preferably single stranded and
may be partially or wholly complementary to at least a portion of
the RNA target (or target RNA). Additionally, a polynucleotide can
be native to the sample (for example, present in the sample at the
time the sample is obtained from the original organism).
Alternatively, a polynucleotide can be artificial or synthetic,
such as when the polynucleotide is added to the sample to cause
hybridization to a target RNA. The term "polynucleotide" is
intended to include polynucleotides comprising naturally occurring
nucleotides and/or non-naturally occurring nucleotides.
Non-naturally occurring nucleotides can include chemical
modifications of natural nucleotides. In this case, it is preferred
that the synthetic polynucleotides can hybridize to the target
RNA.
[0065] The term "a pair of polynucleotides" refers to two
oligonucleotides that have complementary sequences to the target
RNA. Each polynucleotide of the pair is also referred to herein as
a "target-complementary polynucleotide". In one embodiment, the
pair of polynucleotides comprise two independent, linear
polynucleotides that are complementary to non-overlapping and
proximal sequences of the target RNA. The 5' end of one of the
polynucleotides and the 3' end of the other polynucleotide are
brought into juxtaposition by hybridization to a target sequence.
This juxtaposition allows the two polynucleotides to be covalently
joined by the action of a ligase.
[0066] In one embodiment, a pair of polynucleotides can refer to a
single pair of polynucleotides. In another embodiment, a pair of
polynucleotides can refer to a library of polynucleotide pairs,
wherein each independent pair comprises two polynucleotides
complementary to non-overlapping and proximal sequences of a target
RNA. For example, a library of polynucleotides pairs can comprise 2
or more polynucleotide pairs, 10 or more polynucleotide pairs, 100
or more polynucleotide pairs, 1000 or more polynucleotide pairs,
10,000 or more polynucleotide pairs, or more than 20,000
polynucleotide pairs, including any number in between. It is
important to note that a polynucleotide pair preferably consists of
two polynucleotides. However, it is possible that each "pair" have
three or more polynucleotides complementary to non-overlapping and
proximal sequences of a target RNA.
[0067] The term "complementary to non-overlapping and proximal
sequences of the target RNA" refers to a pair of polynucleotides
where one polynucleotide is complementary to a sequence of the
target RNA and the other polynucleotide(s) is/are complementary to
a different sequence of the target RNA, wherein the distance
between the ends of the two polynucleotides, also referred to as
the "ligation junction," as measured by nucleobases, is preferably
less than about 20 nucleobases. In one embodiment, the
polynucleotides are from 0 to about 20 nucleobases apart (e.g., the
ligation junction is less than 20 nucleobases). In one embodiment,
the polynucleotides are from 0 to about 15 nucleobases apart (e.g.,
the ligation junction is less than 15 nucleobases). In one
embodiment, the polynucleotides are from 0 to about 10 nucleobases
apart (e.g., the ligation junction is less than 10 nucleobases). In
one embodiment, the polynucleotides are from 0 to about 5
nucleobases apart (e.g., the ligation junction is less than 5
nucleobases). In one embodiment, the ligation junction is selected
form the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases. In one
embodiment, the ligation junction is 0 nucleobase. In a preferred
embodiment, the ligation junction is zero and the 5' end of one
polynucleotide abuts the 3' end of the other polynucleotide.
[0068] The nature of pair of polynucleotides and stringent
requirements for ligation make them especially useful for in situ
hybridization and detection of a target RNA. In situ hybridization
is a technique where the polynucleotides are hybridized with the
target RNA sequence that is to be detected, wherein this sequence
is present at its original place (in-situ), i.e., within the cell
or tissue, thereby aiding in localizing the target sequence.
[0069] The polynucleotides can comprise additional sequences that
can be used for amplification, for example, primer binding sites,
and/or identification via DNA tag or barcode.
[0070] Each polynucleotide of the pair of polynucleotides is
independently from about 8 to about 100 nucleotides in length. In
one embodiment, each polynucleotide is independently from about 8
to about 40 nucleotides long. In one embodiment, each
polynucleotide is independently from about 10 to about 100
nucleotides long. In one embodiment, each polynucleotide is
independently from about 10 to about 40 nucleotides long. In one
embodiment, each polynucleotide is independently from about 8 to
about 25 nucleotides long. In one embodiment, each polynucleotide
is independently from about 10 to about 25 nucleotides long. In one
embodiment, each polynucleotide is independently from about 15 to
about 23 nucleotides long. In one embodiment, each polynucleotide
is about 16 nucleotides long. In one embodiment, each
polynucleotide is the same number of nucleotides in length.
[0071] In one embodiment, the pair of polynucleotides are part of a
single, linear oligonucleotide comprising the two polynucleotides
complementary to non-overlapping and proximal sequences of the
target RNA connected by a polynucleotide linker, wherein one of the
target-complementary polynucleotides is at the 5' end of the
oligonucleotide and the other target-complementary polynucleotide
is at the 3' end of the oligonucleotide.
[0072] The 5' end and the 3' end of the oligonucleotide are brought
into juxtaposition by hybridization to a target sequence, forming a
circle above the target. This juxtaposition allows the ends of the
oligonucleotide to be covalently joined by the action of a
ligase.
[0073] The nature of pair of polynucleotides and stringent
requirements for ligation make them especially useful for in situ
hybridization and detection of a target RNA. In situ hybridization
is a technique where the polynucleotides are hybridized with the
target RNA sequence that is to be detected, wherein this sequence
is present at its original place (in-situ) within the cell or
tissue, thereby aiding in localizing the target sequence.
[0074] The oligonucleotide can comprise additional sequences that
can be used for amplification, for example, primer binding sites,
and/or identification via DNA tag or barcode. In one embodiment,
these additional sequences are located within the linker
sequence.
[0075] Each target-complementary polynucleotide of the
oligonucleotide is independently from about 8 to about 100
nucleotides in length. In one embodiment, each polynucleotide is
independently from about 8 to about 40 nucleotides long. In one
embodiment, each polynucleotide is independently from about 10 to
about 100 nucleotides long. In one embodiment, each polynucleotide
is independently from about 10 to about 40 nucleotides long. In one
embodiment, each polynucleotide is independently from about 8 to
about 25 nucleotides long. In one embodiment, each polynucleotide
is independently from about 10 to about 25 nucleotides long. In one
embodiment, each polynucleotide is independently from about 15 to
about 23 nucleotides long. In one embodiment, each polynucleotide
is about 16 nucleotides long. In one embodiment, each
polynucleotide is the same number of nucleotides in length.
[0076] The polynucleotide linker can be of any length sufficient to
allow both of the target-complementary polynucleotide ends of the
oligonucleotide to bind the target sequence.
[0077] In this respect, the polynucleotide linker is at least as
long as the length of the target-complementary polynucleotide ends
combined. For example, if the target-complementary polynucleotides
are each 8 nucleotides in length then the polynucleotide linker
comprises at least 16 nucleotides. In one embodiment, the
polynucleotide linker is from about 16 to about 200 nucleotides
long. In one embodiment, the polynucleotide linker is from about 20
to about 100 nucleotides long. In one embodiment, the
polynucleotide linker is from about 20 to about 60 nucleotides
long. In one embodiment, the polynucleotide linker is from about 20
to about 50 nucleotides long. In one embodiment, the polynucleotide
linker is about 42 nucleotides long.
[0078] The pair of polynucleotides, when exposed to a biological
sample, will bind with the target RNA, thereby forming a hybrid.
The biological sample is exposed to a ligase and upon recognition
of and hybridization to the target RNA by the 5' end of one of the
target-complementary polynucleotides and the 3' end of the other
target-complementary polynucleotide the polynucleotide pairs are
ligated to each other through the action of a ligase. The pair of
polynucleotides can hybridize the target with a high index of
specificity due to the fact that two arms are required to bind
target segments independently, which is subsequently ligated.
[0079] Where the pair of polynucleotides comprise two independent
linear polynucleotides complementary to adjacent sequences within
the target RNA (i.e., the ligation junction is 0), the
polynucleotides hybridize to the target RNA and are ligated by a
ligase into a single linear polynucleotide. The length of the
ligated polynucleotide is equal to the length of the two
target-complementary polynucleotides.
[0080] Where the pair of polynucleotides comprise two independent
linear polynucleotides complementary to proximal but non-adjacent
sequences within the target RNA (i.e., the ligation junction gap is
about 1-20 nucleotides in length), upon hybridization of the
polynucleotides to the target RNA the gap between the
polynucleotides must be filled prior ligation by the ligase. The
gap can be filled by any method known to one skilled in the art,
for example, but not limited to, using a DNA polymerase such as a
Reverse transcriptase and free nucleotides to fill the gap. Once
the gap is filled, the ends of the polynucleotides are ligated by a
ligase into a single linear polynucleotide. The length of the
ligated polynucleotide is equal to the length of the two
target-complementary polynucleotides plus the number of nucleotides
required to fill the gap.
[0081] Where the pair of polynucleotides are part of a single,
linear oligonucleotide comprising the two target-complementary
polynucleotides connected by a polynucleotide linker, both ends of
the oligonucleotide hybridize with the target DNA sequence facing
each other, forming a circular structure. In the presence of a DNA
ligase, the ends of the oligonucleotide are ligated, thus, a
circular closed structure is formed above the target RNA. Where the
pair of polynucleotides are complementary to adjacent sequences
within the target RNA (i.e., the ligation junction is 0), the
polynucleotides hybridize to the target RNA and are ligated by a
ligase into a single, circular oligonucleotide. The length of the
ligated polynucleotide is equal to the length of the
oligonucleotide.
[0082] Where the pair of polynucleotides are complementary to
proximal but non-adjacent sequences within the target RNA (i.e.,
the ligation junction gap is about 1-20 nucleotides in length),
upon hybridization of the polynucleotides to the target RNA the gap
between the polynucleotides must be filled prior ligation by the
ligase. The gap can be filled by any method known to one skilled in
the art, for example, but not limited to, using a DNA polymerase
such as a Reverse transcriptase and free nucleotides to fill the
gap. Once the gap is filled, the ends of the polynucleotides are
ligated by a ligase into a single, circular oligonucleotide. The
length of the ligated oligonucleotide is equal to the length of the
oligonucleotides plus the number of nucleotides required to fill
the gap.
[0083] The nature of the pair of polynucleotides and stringent
requirements for ligation are especially useful for in-situ
hybridization. In-situ hybridization is a technique where the probe
is hybridized with the target DNA or RNA sequence that is to be
detected, wherein the sequence is present at its original place
(in-situ), i.e., within the cell, tissue sections, thereby aiding
in localizing the target sequence at its original place.
[0084] Ligation can be accomplished either enzymatically or
chemically. "Ligation" means to form a covalent bond or linkage
between the termini of two or more nucleic acids, e.g.,
oligonucleotides and/or polynucleotides, in a template-driven
reaction. The nature of the bond or linkage may vary widely and the
ligation may be carried out enzymatically or chemically. As used
herein, ligations are usually carried out enzymatically to form a
phosphodiester linkage between a 5' carbon of a terminal nucleotide
of one oligonucleotide with 3' carbon of another
oligonucleotide.
[0085] A variety of template-driven ligation reactions are
described in the following references: Whitely et al., U.S. Pat.
No. 4,883,750; Letsinger et al., U.S. Pat. No. 5,476,930; Fung et
al., U.S. Pat. No. 5,593,826; Kool, U.S. Pat. No. 5,426,180;
Landegren et al., U.S. Pat. No. 5,871,921; Xu and Kool (1999) Nucl.
Acids Res. 27:875; Higgins et al., Meth. in Enzymol. (1979) 68:50;
Engler et al. (1982) The Enzymes, 15:3 (1982); and Namsaraev, U.S.
Patent Pub. 2004/0110213.
[0086] Chemical ligation methods are disclosed in Ferris et al.,
Nucleosides & Nucleotides, 8: 407-414 (1989) and Shabarova et
al., Nucleic Acids research, 19: 4247-4251 (1991). Enzymatic
ligation utilizes a ligase. Many ligases are known to those of
skill in the art as referenced in Lehman, Science, 186: 790-797
(1974); Engler et al., DNA ligases, pages 3-30 in Boyer, editor,
The Enzymes, Vol. 15B (Academic Press, New York, 1982); and the
like. Exemplary ligases include SplintR ligase, T4 DNA ligase, T7
DNA ligase, E. coli DNA ligase, Taq ligase, Pfu ligase and the
like. Certain protocols for using ligases are disclosed by the
manufacturer and also in Sambrook, Molecular Cloning: A Laboratory
manual, 2.sup.nd Edition (Cold Spring Harbor Laboratory, New York,
1989); barany, PCR Methods and Applications, 1:5-16 (1991); Marsh
et al., Strategies, 5:73-76 (1992). In one embodiment, the ligase
may be derived from algal viruses such as the Chlorella virus, for
example, PBCV-1 ligase, also known as SplintR ligase, as described
US Patent Publication No. 2014/0179539, incorporated herein by
reference in its entirety.
[0087] The expression "amplification" or "amplifying" refers to a
process by which extra or multiple copies of a particular
polynucleotide are formed. The term "amplification product" refers
to the nucleic acids, which are produced from the amplifying
process as defined herein.
[0088] Amplification includes methods generally known to one
skilled in the art such as, but not limited to, PCR, ligation
amplification (or ligase chain reaction, LCR), real time (rtPCR) or
quantitative PCR (qPCR), rolling circle amplification (RCA), and
other amplification methods. These methods are generally known.
See, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202 and Innis et al.,
"PCR protocols: a guide to method and applications" Academic Press,
Incorporated (1990) (for PCR); and Wu et al. (1989) Genomics
4:560-569 (for LCR). In one embodiment, the ligation product is
amplified using PCR. In general, the PCR procedure describes a
method of gene amplification which is comprised of (i)
sequence-specific hybridization of primers to specific genes within
a DNA sample (or library), (ii) subsequent amplification involving
multiple rounds of annealing, elongation, and denaturation using a
DNA polymerase, and (iii) screening the PCR products for a band of
the correct size. The primers used are oligonucleotides of
sufficient length and appropriate sequence to provide initiation of
polymerization, i.e. each primer is specifically designed to be
complementary to each strand of the genomic locus to be amplified.
In one embodiment, the ligation product is amplified using qPCR.
Quantitative polymerase chain reaction is used to simultaneously
detect a specific DNA sequence in a sample and determine the actual
copy number of this sequence relative to a standard. In one
embodiment, the ligation product is amplified using rtPCR. In
real-time PCR, the DNA copy number can be established after each
cycle of amplification. By using a fluorescent reporter in the
reaction, it is possible to measure DNA generation.
[0089] In one embodiment, the ligation product is amplified using
RCA. Rolling circle amplification describes a process of
unidirectional nucleic acid replication that can rapidly synthesize
multiple copies of circular molecules of DNA or RNA.
[0090] Through suitable design of a probe sequence outside the
target-complementary polynucleotides, detection may be performed
through various methods. One example is loop-mediated isothermal
amplification (LAMP), wherein probes are designed to form LAMP
target structures upon ligation (Notomi, et al., Nucleic Acids
Res., 28(12): e63 (2000)). Presence of target RNA is then detected
via LAMP amplification, enabling advantages such as isothermal
reaction conditions, rapid detection, and implementation in field
or point-of-care diagnostics. Upon successful ligation, detection
of amplification of target nucleic acid via may be performed with
traditional qPCR dyes and probes as described above, or with
additional methodologies: turbidity detection of precipitated
magnesium pyrophosphate (Mori, et. al., Biochem. Biophys. Res.
Commun., 289:150-154 (2001)); colorimetric detection using
metal-sensitive indicators (Tomita, et. al., Nat. Protocols,
3(5):877-82 (2008); Goto, et al., BioTechniques, 46(3):167-71
(2009)); bioluminescence through pyrophosphate conversion
(Gandelman, et al., PLoS One, 5:e14155 (2010)); or detection via
change in pH due to amplification in weakly-buffered conditions
(Pourmand, et. al., PNAS, 103(17):6466-70 (2006); U.S. Pat. No.
7,888,015; and U.S. patent application Ser. No. 13/799,995.
[0091] The term "sequencing," as used herein, refers to a method by
which the identity of at least 10 consecutive nucleotides (e.g.,
the identity of at least 20, at least 50, at least 100 or at least
200 or more consecutive nucleotides) of a polynucleotide is
obtained.
[0092] A Sequencing can be carried out by any method known in the
art including, but not limited to, sequencing by hybridization,
sequencing by ligation or sequencing by synthesis. Sequencing by
ligation includes, but is not limited to, fluorescent in situ
sequencing (FISSEQ). Sequencing by synthesis includes, but is not
limited to, reversible terminator chemistry (i.e. Illumina
SBS).
EXAMPLES
[0093] While a preferred embodiment is disclosed, many other
implementations will occur to one of ordinary skill in the art and
are all within the scope of the invention. Each of the various
embodiments described above may be combined with other described
embodiments in order to provide multiple features. Furthermore,
while the foregoing describes a number of separate embodiments of
the apparatus and method of the present invention, what has been
described herein is merely illustrative of the application of the
principles of the present invention. Other arrangements, methods,
modifications, and substitutions by one of ordinary skill in the
art are therefore also considered to be within the scope of the
present invention, which is not to be limited except by the claims
that follow.
[0094] A fixed sample was pre-hybridize by incubating with wash
buffer (WA-10, 10% formamide, 2.times.SSC) for 20 minutes at room
temperature. Polynucleotide pairs were prepared by diluting in wash
A-10 at the desired concentration and then vortexed to mix. The
polynucleotide pairs were diluted to between 2-20 nM per probe. The
sample was incubated with the polynucleotide pairs for more than 6
hours at 37 C. The sample was washed twice with excess volume
(e.g., 500 ul for 24-well plates) of WA-10 at 37 C for 30 mins per
wash. The sample was then washed once with excess volume
1.times.PBS at 37 C for 30 mins.
[0095] Following hybridization, the sample was preincubated with
SplintR ligase (1.times.) buffer for 20 mins. The sample was then
incubated with the following for more than 6 hours at room
temperature (RI):
TABLE-US-00001 Component Amount (.mu.l) Final concentration
Nuclease-free H2O 90 10x Buffer 20 1x SplintR ligase 10 1.25
units/uL Total 200
The sample was then washed twice with PBS for 15 min per wash.
[0096] Amplification of ligated product(s) was performed by rolling
circle amplification (RCA). The sample was incubated with the RCA
primer at 37 C for 2 hr:
TABLE-US-00002 Component Amount (.mu.l) Final concentration
Nuclease-free H2O 139 Formamide, 100% 40 20% SSC buffer, 20x 20 2x
RCA primer, 100 .mu.M 1 0.5 .mu.M Total 200
The sample as then washed once with for 30 min and then with PBS
for 30 min. The following was used to perform RCA:
TABLE-US-00003 Component Amount (.mu.l) Final concentration
Nuclease-free H2O 176 Phi29 buffer, 10x 20 1x dNTP, 25 mM 2 250
.mu.M Phi29 DNA polymerase 2 1 U/.mu.l Total 200
If the ligation products, or components thereof barcode(s)) are to
be sequenced, AA-dUTP is added at 40 uM. Without sequencing, do not
add the AA-duTP. The sample was then washed briefly with
1.times.PBS for 2.times.. Detection of rolonies, or RCA colonies,
was performed using Rolony Hybridization with the following for 1
hour at RT:
TABLE-US-00004 Component Amount (.mu.l) Final concentration
Nuclease-free H2O 140 Formamide, 100% 20 10% SSC buffer, 20x 40 4x
Rolonies hybridization 0.2 0.1 .mu.M probe, 100 .mu.M Total 200
The sample was then washed with 1.times.PBS, 3 times 15 min.
[0097] Following detection, the amplicons can be sequenced by any
method known in the art.
In Situ Sequencing
[0098] Incorporation mix ("IMT") was extracted from the cartridges
of, respectively, a MiSeq Reagent Kit v3 and a NextSeq 500/550
Reagent Kit v2, aliquoted, and frozen. Four template
oligonucleotides (see Table 2.1, each with a unique base downstream
of a primer binding site) were individually annealed with primer at
a concentration of 45 uM in 1.times. Annealing Buffer (1.times.TE
pH 7.5, 50 mM NaCl) in a thermal cycler. The annealing involved a 3
minute hold at 95 degrees followed by a -0.1.degree. C. ramp to 25
C. 500 pmol of each of the template-primer duplexes were separately
diluted 1:10 into MiSeq and NextSeq IMT. The dilutions were heated
at 65.degree. C. for 5 minutes, and then eluted in 20 uL of water
using a DNA oligonucleotide clean and concentrate kit (Zymo). The
elutant from each reaction was added to a well of a 384-well glass
bottom plate, and the absorption and emission spectra were measured
using a spectrophotometer.
TABLE-US-00005 TABLE 2.1 Oligonucleotides used in spectral
characterization Oligonucleotide Sequence Template (A)
GTACTGAACTGTCTCTTATACACATCTGAC GCTGCCGACGA (SEQ ID NO: 1) Template
(T) GTACTGTTCTGTCTCTTATACACATCTGAC GCTGCCGACGA (SEQ ID NO: 2)
Template (C) GTACTGCCCTGTCTCTTATACACATCTGAC GCTGCCGACGA (SEQ ID NO:
3) Template (G) GTACTGGGCTGTCTCTTATACACATCTGAC GCTGCCGACGA (SEQ ID
NO: 4) Primer TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAG (SEQ ID NO: 5)
[0099] Base-specific DNA template-primer duplexes were prepared
and, following a single base of synthesis using MiSeq or NextSeq
kit-specific fluorescent incorporation mix, the templates were
physically isolated from unreacted dyes, and their emission and
absorption spectra were measured via spectrophotometry.
[0100] The MiSeq absorption spectra is presented in FIG. 2. There
are distinct absorbance maxima for dTTP at 580 nm, dATP at 650 nm,
and dCTP at 700 nm. dGTP has two absorbance maxima: a larger one at
530 nm and a smaller one at 640 nm, although it should be noted
that both of these maxima are small compared to the maxima for the
other three fluorescent dNTPs. In order to relate the absorption
maxima to emission spectra, a full spectrum measurement emission
measurement was collected for each sample when excited 20-30 nm
away from an absorption maximum. There are distinct emission maxima
for dGTP at 550 nm, dTTP at 600 nm, dATP at 670 nm, and dCTP at 720
nm.
[0101] The NextSeq absorption spectra is presented in FIG. 2. There
are distinct absorbance maxima for dTTP at 560 nm, dCTP at 650 nm.
dATP has two absorbance maxima of roughly equal intensity at 530 nm
and at 660 nm. dGTP has two small absorbance maxima at similar
locations to dATP. A similar approach to the last section was used
to measure the emission spectra of these samples. There are
distinct emission maxima for dATP at 550 nm and 680 nm, dTTP at 580
nm, and dCTP at 670 nm. dGTP can be considered effectively dark
when compared to the other three dyes. The results from the
spectral measurements are summarized in two tables, Table 2.2 and
Table 2.3.
TABLE-US-00006 TABLE 2.1 Summary of MiSeq spectral measurements.
Absorbance Emission Fluorescent dNTP Maximum (nm) Maximum (nm) dGTP
530 550 dTTP 580 600 dATP 650 670 dCTP 700 720
TABLE-US-00007 TABLE 2.2 Summary of NextSeq spectral measurements.
Absorbance Emission Fluorescent dNTP Maximum (nm) Maximum (nm) dGTP
Effectively dark Effectively dark dTTP 560 580 dATP 650 670 dCTP
530 and 660 550 and 680
[0102] Having obtained spectra for all colors in each of the MiSeq
and NextSeq kits a biological sequence can be attributed to a
sequence of colors observed under a conventional fluorescence
microscope. The ability to attribute a base ("base call") to a
cluster depends on both the fidelity of the sequencing chemistry as
well as the properties of the lasers and filters used in a
particular microscope.
[0103] FISSEQ-like in situ RNA sequencing libraries were prepared
in hydrogel embedded and expanded rat neuron culture.
[0104] Incorporation mix ("IMT"), scan mix ("USM") and cleavage mix
("CMS") were extracted from the cartridges of a MiSeq Reagent Kit
v3, aliquoted, and frozen. To perform the sequencing reaction, a
sample of RNA sequencing library prepared hydrogel (approximately 3
microliters in volume) was washed twice with 300 uL (i.e.
100.times. sample volume) of PR2 buffer (supplied with MiSeq kit)
for five minutes each. The sample was next immersed in 300 uL IMT,
held at 4 C for 10 minutes, then held at 65 C for 30 minutes to
incorporate one base of fluorescent dNTP into the library. The
sample was then washed twice for 30 minutes with 300 uL of PR2
buffer and then exchanged into 300 uL of USM for imaging. Describe
confocal microscope here. Following imaging, the sample was washed
twice for 5 minutes with 300 uL of PR2 buffer and exchanged into
300 uL of CMS for 30 minutes at room temperature for cleavage. This
process was completed five times to generate five successive image
stacks of the region of interest.
[0105] To analyze the data, a maximum intensity projection was
first performed for each image stack, and each projection was then
separated into three images corresponding to each of the imaging
channels. For each of these images, maxima coordinates were
extracted using the Find Maxima process with manual noise
thresholding, generating lists of maxima for each of the three
channels for each of the rounds of sequencing.
[0106] Using a Python script, intensity tuples were generated from
these maxima coordinates. Briefly, for each maximum in a particular
channel, an intensity tuple was generated corresponding to the
local intensity of that maximum in each of the three channels
(rather than just the channel it was detected in), where local
intensity is defined as the average of the 3.times.3 pixel
neighborhood centered on the maximum. The local intensities for an
individual channel are exponentially distributed; the three
distributions were normalized to the intensity of the dimmest
channel (here, the 488 nm channel) by scaling the means of the
distributions. The normalized intensity tuples for each of the
maxima detected in the 488 nm channel and the 560 nm channel were
used to generate the crosstalk plots. Pearson's r was computed
using for each plot by first aggregating the two sets of intensity
tuples and then using the SciPy library of the same name. The
fraction of spots passing the threshold intensity was computed as
described below.
[0107] Sequencing by synthesis on an RNA sequencing library
generated in situ was demonstrated. A series of five successive
sequencing reactions were performed in situ using reagents
extracted from reagent cartridges supplied with a
commercially-available Illumina MiSeq kit. The cells were fixed and
subsequently embedded in an swellable hydrogel as described herein,
providing enhanced resolution and generating a quasi-in-vitro
environment in which enzymatic reactions can occur. The sequencing
library itself was prepared according to a method similar to FISSEQ
(i.e. the nucleic acid clusters are prepared via randomly primed
reverse transcription, followed by circularization and
phi29-mediated rolling circle amplification).
[0108] A representative region of interest (ROI) from the sequenced
sample, after the first base of sequencing, is shown in FIG. 3 (a).
Visual inspection indicates that individual clusters correspond to
one particular color (they are "clonal") rather than a blend of
colors ("polyclonal"). Individual clusters also change color from
round-to-round, as expected; this is illustrated in FIG. 3(b).
[0109] There are four dye colors in a MiSeq kit; however, due to
constraints on the lasers and filters available, all four bases
were not imaged independently. The dye corresponding to G can be
imaged independently using a standard 488 nm channel, and the dye
corresponding to T can be imaged independently using a 560 nm
channel; however, the dyes corresponding to A and C are both
excited and visible using a 640 nm channel. This can be
corroborated by examining the number of maxima in each channel
detected for the ROI. This degeneracy introduces ambiguity in
sequence reconstruction; however, the performance of the sequencing
reactions themselves in situ, and in particular with round-to-round
phasing, can proceed by only examining the 488 nm and 560 nm
channels, since, as demonstrated, only two independent channels are
required for this purpose.
[0110] In order to quantify the phasing, the images were processed
in order to generate pairs of cluster intensities; that is, for
each cluster identified as a maximum in the 488 channel or the 560
channel, the intensities of that cluster in both the 488 and 560
channels were extracted. The pairs of intensities for all clusters
(i.e. identified in either channel), for the first base of
sequencing, are plotted in aggregate as a crosstalk plot in FIG. 4,
with a color assigned to each set of clusters as a guide to the
eye.
[0111] A "perfect" dataset would be composed of two perfectly
orthogonal components (i.e. every dye cluster is monoclonal),
however any real cluster will have some degree of crosstalk due to
chemistry errors, noise, or experimental biases (i.e. excitation
crosstalk). It is clear from visual inspection of FIG. 4 that there
are two approximately orthogonal components corresponding to
monoclonal clusters, with a smaller set of polyclonal clusters
falling between the two arms of the crosstalk plot. The cluster
polyclonality increases over multiple sequencing rounds: FIG. 5
plots the cluster crosstalk for the fifth round of sequencing,
where the two components are highly correlated and difficult to
visually distinguish.
[0112] One facile method to quantify the cluster crosstalk over
sequencing cycles is to compute Pearson's correlation coefficient
(r) for both components in aggregate: as the two arms of the
crosstalk plot become less orthogonal due to phasing, they are
necessarily more correlated. As see in FIG. 6 that r increases
monotonically and roughly linearly with successive rounds of
sequencing.
[0113] The crosstalk correlation is useful but incomplete metric,
since individual clusters may still be "callable" if one color
remains dominant. To explore this possibility a second, threshold
intensity based metric similar to the CHASTITY metric used in
certain base calling methods was defined. A threshold intensity is
defined as:
I T = I highest .times. .times. channel I highest .times. .times.
channel + I second .times. .times. highest .times. .times. channel
##EQU00001##
and compute I.sub.T for each cluster in the crosstalk plot (there
are, of course, only two channels). The fraction of all clusters
passing the threshold for two different representative thresholds
in FIG. 7 were plotted, where a threshold of 0.6 is typical. A
majority of clusters pass this threshold for the first and second
rounds of sequencing, but the quality declines rapidly thereafter;
this effect is even more pronounced for a threshold of 0.8.
[0114] A naive use of MiSeq reagents in this in situ context
permits identification of the first few bases of a cluster, but the
sequencing fidelity falls rapidly with successive rounds of
sequencing. This is attributable to a high degree of round-to-round
phasing, as demonstrated by the steady increase in correlation
between the two intensity components of each cluster. These results
suggest that optimizations increasing the yield and fidelity of the
MiSeq sequencing reaction would be desirable in order to generate
long, biologically meaningful reads.
[0115] Methods were performed as described above, with the sole
exception of the IMT incubation step being repeated before each
round of imaging.
[0116] Seven cycles of imaging were performed, with two consecutive
rounds of synthesis before each imaging cycle, on in situ RNA
sequencing libraries prepared in hydrogel embedded and expanded rat
neuron culture. Without wishing to be bound to any particular
theory, it was hypothesized that multiple rounds of synthesis would
increase dye addition efficiency and decrease phasing. A
representative region of interest of a sample after the first
imaging cycle is shown in FIG. 8. A crosstalk plot for the first
base of sequencing is shown in FIG. 9. It was observed that the two
components are not as well resolved as in the analogous case in
Example Y: the two arms of the crosstalk plot have taken on a more
conical shape as opposed to the sharply defined arms of FIG. 4, and
the dataset is initially more correlated. However, after seven
rounds of sequencing, as shown in FIG. 10, the crosstalk plot
continues to maintain the same shape, and the correlation has not
significantly increased. FIG. 11 shows that the correlation over
all seven cycles of imaging is essentially constant. Similarly,
FIG. 12 shows that the number of spots that pass an intensity
threshold of 0.6 is also essentially constant over seven cycles of
sequencing.
[0117] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
5141DNAArtificial SequenceSynthetic Oligonucleotide 1gtactgaact
gtctcttata cacatctgac gctgccgacg a 41241DNAArtificial
SequenceSynthetic Oligonucleotide 2gtactgttct gtctcttata cacatctgac
gctgccgacg a 41341DNAArtificial SequenceSynthetic Oligonucleotide
3gtactgccct gtctcttata cacatctgac gctgccgacg a 41441DNAArtificial
SequenceSynthetic Oligonucleotide 4gtactgggct gtctcttata cacatctgac
gctgccgacg a 41533DNAArtificial SequenceSynthetic Oligonucleotide
5tcgtcggcag cgtcagatgt gtataagaga cag 33
* * * * *