U.S. patent application number 17/262421 was filed with the patent office on 2021-12-09 for dry powder formulations for messenger rna.
The applicant listed for this patent is Translate Bio, Inc.. Invention is credited to Frank DeRosa, Michael Heartlein, Shrirang Karve, Zarna Patel, Ashish Sarode.
Application Number | 20210378977 17/262421 |
Document ID | / |
Family ID | 1000005813083 |
Filed Date | 2021-12-09 |
United States Patent
Application |
20210378977 |
Kind Code |
A1 |
Karve; Shrirang ; et
al. |
December 9, 2021 |
Dry Powder Formulations for Messenger RNA
Abstract
The present invention provides stable, dry powder messenger RNA
formulations for therapeutic use, and methods of making and using
the same.
Inventors: |
Karve; Shrirang; (Lexington,
MA) ; DeRosa; Frank; (Lexington, MA) ;
Heartlein; Michael; (Lexington, MA) ; Patel;
Zarna; (Lexington, MA) ; Sarode; Ashish;
(Lexington, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Translate Bio, Inc. |
Lexington |
MA |
US |
|
|
Family ID: |
1000005813083 |
Appl. No.: |
17/262421 |
Filed: |
July 23, 2019 |
PCT Filed: |
July 23, 2019 |
PCT NO: |
PCT/US19/43074 |
371 Date: |
January 22, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62702193 |
Jul 23, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/177 20130101;
A61K 9/0075 20130101; A61K 9/0078 20130101; A61K 38/45 20130101;
A61K 9/5153 20130101; A61K 9/5089 20130101; A61K 9/5123 20130101;
A61K 48/0075 20130101 |
International
Class: |
A61K 9/51 20060101
A61K009/51; A61K 38/17 20060101 A61K038/17; A61K 48/00 20060101
A61K048/00; A61K 9/50 20060101 A61K009/50; A61K 38/45 20060101
A61K038/45; A61K 9/00 20060101 A61K009/00 |
Claims
1. A dry powder formulation for delivery of cystic fibrosis
conductance regulator (CFTR) messenger RNA (mRNA) comprising a
plurality of spray-dried particles comprising mRNA encoding a CFTR
protein; one or more lipids, and one or more polymers.
2. The dry powder formulation of claim 1, wherein the one or more
lipids are present in one or more lipid nanoparticles (LNPs)
encapsulating the mRNA encoding the CFTR protein.
3. The dry powder formulation of claim 1, wherein the one or more
lipids and the one or more polymers are present in one or more
lipid nanoparticles (LNPs) encapsulating the mRNA encoding the CFTR
protein.
4. The dry powder formulation of any one of the preceding claims,
wherein the CFTR mRNA has an integrity of 90% or greater.
5. The dry powder formulation of any one of the preceding claims,
wherein the mRNA maintains an integrity of 90% or greater upon
storage at or under room temperature for 6 months or longer.
6. The dry powder formulation of any one of the preceding claims,
wherein at least 20% of the plurality of spray-dried particles are
fine particles.
7. The dry powder formulation of claim 6, wherein the fine
particles have a volume median diameter of less than 5 .mu.m.
8. The dry powder formulation of any one of the preceding claims,
wherein the dry powder formulation is inhalable.
9. The dry powder formulation of any one of claims 1-7, wherein the
formulation is nebulizable upon reconstitution.
10. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers constitute at least 10%, at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, or at least 50% of the combined weight of
the lipids and polymers.
11. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers constitute about 10-90%, 10-80%,
10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%,
15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%,
15-70%, 15-75%, 15-80%, or 15-90% of the combined weight of the
lipids and polymers.
12. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers constitute no more than 90%, 80%,
70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the combined
weight of the lipids and polymers.
13. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers constitute are selected from a
group consisting of chitosan, poly(lactic acid) (PLA),
poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone (PCL),
poly amido amines, polyesters, polycarbonates, poly(hydroxyalkyl
L-asparagine), poly(hydroxyalkyl L-glutamine),
poly(2-alkyloxazoline) acrylates, modified acrylates and
polymethacrylate based polymers,
poly-N-(2-hydroxyl-propyl)methacrylamide,
poly-2-(methacryloyloxy)ethyl phosphorylcholines,
poly(2-(methacryloyloxy)ethyl phosphorylcholine), and
poly(dimethylaminoethyl methylacrylate) (pDMAEMA).
14. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers comprise a polymethacrylate based
polymer.
15. The dry powder formulation of any one of the preceding claims,
wherein the one or more polymers comprise Eudragit EPO.
16. The dry powder formulation of any one of claims 2-15, wherein
the one or more LNPs encapsulating mRNA have a lipid:mRNA (N/P)
ratio ranging from 1 to 20, 1-15, 1-10, 2-8, 2-6, or 2-4.
17. The dry powder formulation of claim 16, wherein the one or more
LNPs encapsulating mRNA have a lipid:mRNA (N/P) ratio of 2 or
4.
18. The dry powder formulation of any one of claims 2-17, wherein
the LNPs have an encapsulation efficiency of 80% or greater.
19. The dry powder formulation of any one of the preceding claims,
wherein the one or more lipids comprise a cationic lipid.
20. The dry powder formulation of claim 19, wherein the cationic
lipid is selected from the group consisting of C12-200, DOTAP
(1,2-dioleyl-3-trimethytammonium propane), DODAP
(1,2-dioleyl-3-dimethylammonium propane), DOTMA
(1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA,
DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.
21. The dry powder formulation of claim 20, wherein the cationic
lipid is cKK-E12.
22. The dry powder formulation of claim 20, wherein the cationic
lipid is ICE.
23. The dry powder formulation of any one of claims 19-22, wherein
the cationic lipid constitutes about 25-50% of the total lipids in
LNPs by molar.
24. The dry powder formulation of any one of the preceding claims,
wherein the one or more lipids comprise a PEG-modified lipid.
25. The dry powder formulation of claim 24, wherein the
PEG-modified lipid constitutes about 1-15% of the total lipids in
LNPs by molar.
26. The dry powder formulation of claim 24, wherein the
PEG-modified lipid constitutes at least 1%, 2%, 3%, 4%, 5%, 6%, 8%,
10%, or 12% of the total lipids in LNPs by molar.
27. The dry powder formulation of any one of claims 2-26, wherein
the LNPs are two-lipid component LNPs.
28. The dry powder formulation of any one of the preceding claims,
wherein the one or more lipids do not comprise a neutral lipid or a
cholesterol-based lipid.
29. The dry powder formulation of any one of the preceding claims,
wherein the one or more lipids further comprise a neutral lipid or
a cholesterol-based lipid.
30. The dry powder formulation of any one of the preceding claims,
wherein the one or more lipids further comprise a neutral
lipid.
31. The dry powder formulation of claim 29 or 30, wherein the LNPs
are three-lipid component LNPs.
32. The dry powder formulation of any one of the preceding claims,
further comprising at least one sugar selected from the group
consisting of monosaccharides, disaccharides, polysaccharides,
glucose, fructose, galactose, mannose, sorbose, lactose, sucrose,
cellobiose, trehalose, raffinose, starch, dextran, maltodextrin,
cyclodextrins, inulin, xylitol, sorbitol, lactitol, and
mannitol.
33. The dry powder formulation of claim 32, wherein the sugar is
mannitol.
34. The dry powder formulation of any one of the preceding claims,
further comprising a pharmaceutically acceptable excipient selected
from the group consisting of esters, urethanes, phosphoesters,
phosphazenes, amino acids, collagen, chitosan, polysaccharides,
albumin, surfactants, buffers, salts, and combinations thereof.
35. The dry powder formulation of claim 34, wherein the surfactant
is selected from the group consisting of CHAPS
(3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate),
phospholipids, phosphatidylserine, phosphatidylethanolamine,
phosphatidylcholine, sphingomyelins, Octaethylene glycol
monododecyl ether, Pentaethylene glycol monododecyl ether, Triton
X-100, Cocamide monoethanolamine, Cocamide diethanolamine, Glycerol
monostearate, Glycerol monolaurate, Sorbitan moonolaureate,
Sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80,
Alkyl polyglucosides, and a poloxamer.
36. The dry powder formulation of claim 35, wherein the surfactant
is poloxamer.
37. The dry powder formulation of any one of the preceding claims,
wherein the CFTR mRNA constitutes about 1-20%, 1-15%, 1-10%, 1-8%,
1-6%, 1-5%, 5-15%, or 5-10% of the total weight of the spray-dried
particles.
38. The dry powder formulation of any one of the preceding claims,
wherein the CFTR mRNA constitutes about 1%, 2%, 3%, 4%, 5%, 7.5%,
10%, 12.5%, or 15% of the total weight of the spray-dried
particles.
39. A method of delivering cystic fibrosis conductance regulator
(CFTR) messenger RNA (mRNA) for in vivo expression comprising a
step of administering to a subject in need thereof the dry powder
formulation of any one of the preceding claims.
40. The method of claim 39, wherein the dry powder formulation is
administered by pulmonary delivery.
41. The method of claim 39 or 40, wherein the dry powder
formulation is administered by inhalation.
42. A method of delivering cystic fibrosis conductance regulator
(CFTR) messenger RNA (mRNA) for in vivo expression comprising steps
of: reconstituting the dry powder formulation of any one of claims
1-38 into a liquid solution; and administering to a subject in need
thereof the reconstituted liquid solution.
43. The method of claim 42, wherein the reconstituted liquid
solution is administered by nebulization.
44. The method of any one of claims 39-43, wherein the subject is
suffering from cystic fibrosis.
45. A dry powder formulation for delivery of messenger RNA (mRNA)
comprising a plurality of spray-dried particles comprising mRNA
encoding a protein or a peptide; one or more lipids, and one or
more polymers.
46. A dry powder formulation for delivery of messenger RNA (mRNA)
comprising a plurality of spray-dried particles comprising a. one
or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a
peptide or polypeptide, and b. one or more polymers.
47. A dry powder formulation for delivery of messenger RNA (mRNA)
comprising a plurality of spray-dried particles comprising one or
more nanoparticles encapsulating mRNA encoding a peptide or
polypeptide, the nanoparticles comprising a. one or more lipids,
and b. one or more polymers.
48. The dry powder formulation of any one of claims 45-47, wherein
the mRNA has an integrity of 90% or greater.
49. The dry powder formulation of any one of claims 45-48, wherein
the mRNA maintains an integrity of 90% or greater after storage at
or under room temperature for 6 months or longer.
50. The dry powder formulation of any one of claims 45-48, wherein
the mRNA maintains an integrity of 90% or greater after storage at
or under 4.degree. C. for 6 months or longer.
51. The dry powder formulation of any one of claims 45-50, wherein
at least 20% of the plurality of spray-dried particles are fine
particles.
52. The dry powder formulation of claim 51, wherein the fine
particles have a volume median diameter of less than 5 .mu.m.
53. The dry powder formulation of any one of claims 45-52, wherein
the dry powder formulation is inhalable.
54. The dry powder formulation of any one of claims 45-52, wherein
the formulation is nebulizable upon reconstitution.
55. The dry powder formulation of any one of claims 46-54, wherein
the one or more LNPs encapsulating mRNA have a lipid:mRNA (N/P)
ratio ranging from 1 to 20, 1-15, 1-10, 2-8, 2-6, or 2-4.
56. The dry powder formulation of claim 55, wherein the one or more
LNPs encapsulating mRNA have a lipid:mRNA (N/P) ratio of 2 or
4.
57. The dry powder formulation of any one of claims 46-56, wherein
the mRNA-loaded lipid nanoparticles have an encapsulation
efficiency of 80% or greater.
58. The dry powder formulation of any one of claims 46-57, wherein
the one or more mRNA-loaded lipid nanoparticles comprise one or
more cationic lipids.
59. The dry powder formulation of claim 58, wherein the one or more
cationic lipids are selected from the group consisting of C12-200,
DOTAP (1,2-dioleyl-3-trimethytammonium propane), DODAP
(1,2-dioleyl-3-dimethylammonium propane), DOTMA
(1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA,
DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.
60. The dry powder formulation of any one of claims 46-59, wherein
the one or more mRNA-loaded lipid nanoparticles comprise one or
more PEG-modified lipids.
61. The dry powder formulation of any one of claims 46-60, wherein
the LNPs are two-lipid component LNPs.
62. The dry powder formulation of any one of claims 46-60, wherein
the one or more mRNA-loaded lipid nanoparticles further comprise
one or more neutral lipids or one or more cholesterol-based
lipids.
63. The dry powder formulation of claim 62, wherein the LNPs are
three-lipid component LNPs.
64. The dry powder formulation of any one of claims 45-63, wherein
the one or more polymers constitute less than 20%, 15%, 12%, 10%,
9%, 8%, 7%, 6% or 5% of total weight.
65. The dry powder formulation of any one of claims 45-64, wherein
the one or more polymers constitute at least 10%, at least 15%, at
least 20%, at least 25%, at least 30%, at least 35%, at least 40%,
at least 45%, or at least 50% of the combined weight of the lipids
and polymers.
66. The dry powder formulation of any one of claims 45-65, wherein
the one or more polymers constitute about 10-90%, 10-80%, 10-70%,
10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%,
15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%,
15-75%, 15-80%, or 15-90% of the combined weight of the lipids and
polymers.
67. The dry powder formulation of any one of claims 45-66, wherein
the one or more polymers constitute no more than 90%, 80%, 70%,
60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the combined
weight of the lipids and polymers.
68. The dry powder formulation of any one of claims 45-67, wherein
the one or more polymers are selected from a group consisting
chitosan, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid)
(PLGA), poly(q-caprolactone (PCL), poly amido amines, polyesters,
polycarbonates, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl
L-glutamine), poly(2-alkyloxazoline) acrylates, modified acrylates
and polymethacrylate based polymers,
poly-N-(2-hydroxyl-propyl)methacrylamide,
poly-2-(methacryloyloxy)ethyl phosphorylcholines,
poly(2-(methacryloyloxy)ethyl phosphorylcholine), and
poly(dimethylaminoethyl methylacrylate) (pDMAEMA).
69. The dry powder formulation of any one of claims 45-68, wherein
the one or more polymers comprise a polymethacrylate based
polymer.
70. The dry powder formulation of any one of claims 45-69, further
comprising at least one sugar selected from the group consisting of
monosaccharides, disaccharides, polysaccharides, glucose, fructose,
galactose, mannose, sorbose, lactose, sucrose, cellobiose,
trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrins,
inulin, xylitol, sorbitol, lactitol, and mannitol.
71. The dry powder formulation of claim 70, wherein the sugar is
mannitol.
72. The dry powder formulation of any one of claims 45-71, further
comprising a pharmaceutically acceptable excipient selected from
the group consisting of esters, urethanes, phosphoesters,
phosphazenes, amino acids, collagen, chitosan, polysaccharides,
albumin, surfactants, buffers, salts, and combination thereof.
73. The dry powder formulation of claim 72, wherein the surfactant
is selected from the group consisting of CHAPS
(3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate),
phospholipids, phosphatidylserine, phosphatidylethanolamine,
phosphatidylcholine, sphingomyelins, Octaethylene glycol
monododecyl ether, Pentaethylene glycol monododecyl ether, Triton
X-100, Cocamide monoethanolamine, Cocamide diethanolamine, Glycerol
monostearate, Glycerol monolaurate, Sorbitan moonolaureate,
Sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80,
Alkyl polyglucosides, a poloxamer and optionally poloxamer 407.
74. The dry powder formulation of claim 73, wherein the surfactant
is poloxamer.
75. The dry powder formulation of any one of claims 45-74, wherein
the mRNA encodes a peptide.
76. The dry powder formulation of any one of claims 45-74, wherein
the mRNA encodes a therapeutic protein.
77. The dry powder formulation of claim 76, wherein the therapeutic
protein is CFTR.
78. The dry powder formulation of claim 76, wherein the therapeutic
protein is OTC.
79. A method of delivering mRNA in vivo comprising administering to
a subject in need thereof a dry powder formulation of any one of
claims 45-78.
80. A method of treating a disease or disorder in a patient by
administering to the patient an effective dose of mRNA in a dry
powder formulation of any one of claims 45-78.
81. The method of claim 79 or 80, wherein the dry powder
formulation is administered by inhalation.
82. The method of claim 79 or 80, wherein the dry powder
formulation is administered by intranasal spray.
83. The method of claim 79 or 80, wherein the formulation is
administered by a metered-dose inhaler.
84. The method of any one of claims 80-83, wherein the disease or
disorder is selected from cystic fibrosis; asthma; COPD; emphysema;
primary ciliary dyskinesia (CILD1) with or without situs inversus,
or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube
syndrome; hereditary hemorrhagic telangiectasia; alpha-1
antitrypsin deficiency; Cytochrome b positive granulomatous
diseases (CGD, X-lined); Cytochrome b positive granulomatous
diseases, autosomal recessive; surfactant deficiency diseases,
Pulmonary Surfactant Metabolism Dysfunction 1, Pulmonary Surfactant
Metabolism Dysfunction 2, Pulmonary Surfactant Metabolism
Dysfunction 3; Respiratory distress syndrome of prematurity;
tuberculous tuberculosis, lung viral diseases, including influenza,
Respiratory Syncytial Virus (RSV).
85. A method for manufacturing a dry powder formulation, the method
comprising: providing a mixture comprising an mRNA, one or more
lipids and a polymer; and spray-drying the mixture to form a
plurality of particles.
86. The method of claim 85, wherein the one or more lipids are
first mixed with the mRNA to form mRNA-loaded lipid nanoparticles
before adding the polymer.
87. The method of claim 85, wherein the one or more lipids are
mixed with the mRNA and the polymer in a single step to form
mRNA-loaded lipid-polymer nanoparticles.
88. The method of any one of claims 85-87, further comprising
adding to the mixture one or more excipients prior to spray
drying.
89. The method of any one of claims 85-88, wherein the plurality of
spray dried particles are characterized by one or more of the
following: a) less than 10% moisture content; b) a fraction of fine
particles with a volume median diameter less than 5 .mu.m; c)
Z-average size range of 10-3000 nm; d) N/P ratio range from 1 to
20; e) mRNA encapsulation efficiency of 80% or greater; f) mRNA
integrity of 90% or greater.
90. The method of any one of claims 85-89, wherein the mRNA encodes
a protein or a peptide.
91. The method of any one of claims 85-90, wherein the mRNA encodes
a peptide.
92. The method of any one of claims 85-90, wherein the mRNA encodes
a therapeutic protein.
93. The method of claim 92, wherein the therapeutic protein is
CFTR.
94. The method of claim 92, wherein the therapeutic protein is
OTC.
95. A dry power formulation manufactured according to a method of
any one of claims 85-94.
96. A method of treating a disease or disorder in a patient by
administering to the patient an effective dose of mRNA in a dry
powder formulation of claim 95.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 62/702,193 filed Jul. 23, 2018; incorporated by
reference herein in its entirety.
SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been
submitted electronically in ASCII format and is hereby incorporated
by reference in its entirety. Said ASCII copy, created on Jul. 19,
2019, is named MRT_2008WO_SeqListing.txt and is 1137 byte in
size.
BACKGROUND
[0003] Messenger RNA therapy (MRT) is becoming an increasingly
important approach for the treatment of a variety of diseases.
Lipid encapsulated mRNA formulations, such as lipid nanoparticle
(LNP) compositions show high degree of cellular uptake and protein
expression. However, presently these formulations are typically in
liquid forms, and are required to be administered usually in the
form of injections, or via nebulizers. These modes of
administration are less desired by the patient than some less
invasive routes, for example, metered dose inhalers. Lyophilized
formulations sometimes do not offer reliable particle uniformity in
dry state, or ease of handling and distribution. Lyophilized powder
has to be dissolved in an appropriate solvent prior to dispensing
to a patient and can undergo degradation within a few hours.
Repeated freeze thawing of mRNA preparations is not recommended due
to the potential for mRNA and/or LNP instability.
SUMMARY OF THE INVENTION
[0004] The present invention provides, among other things, a dry
powder (i.e., spray-dried) formulation of mRNA encapsulated with
lipid based nanoparticles for more efficient mRNA delivery and more
efficacious mRNA therapy. Prior to the present invention, one of
the challenges of spray-drying lipid nanoparticle-encapsulated mRNA
arose from the fact that both mRNA and the lipid nanoparticle
components are structurally labile at the high temperatures and/or
pressures needed for adequate spray-drying. For example, an inlet
temperature of a spray-dryer ranges between 80.degree. C. to
98.degree. C. Lipids tend to melt and/or aggregate at the high
inlet temperature at or near the spray nozzle. This causes
hindrance to the flow of the formulation through the nozzle into
the drying chamber, disrupts uniform dispersion of the spray and
produces undesirable particle characteristics and poor yield. The
present invention has unexpectedly solved this problem with the
addition of a polymer to the mRNA and lipid nanoparticle mixture
before subjecting the mixture to the spray-drying process. As
described herein, the inventors observed that adding a polymer to
an mRNA and lipid mixture effectively prevents aggregation of lipid
nanoparticles and facilitates dry powder formation of fine
particles containing mRNA-loaded lipid nanoparticles suitable for
inhalation.
[0005] More surprisingly, despite the extremely unstable nature of
mRNA, dry powder formulations prepared according to the present
invention, even under high temperatures and/or high pressures
associated with spray-drying, are stable and able to maintain a
high degree of mRNA integrity even after long term storage at
various temperatures. In addition, a dry powder formulation
prepared according to the present invention is also characterized
with high LNP encapsulation efficiency of mRNA, resulting in high
cellular delivery of mRNA. Therefore, the present invention fulfils
a long-standing need in the mRNA therapy field for a stable dry
powder form of mRNA therapeutic, which can easily be stored,
transferred, and dispensed. Further, the dry powder formulations of
mRNA according to the present invention can be administered as dry
powder to a patient, e.g. in metered doses or weighed out and
reconstituted in single-use amounts, without the need for freezing
single-use aliquots of liquid.
[0006] In one aspect, the present invention provides a dry powder
formulation for delivery of messenger RNA (mRNA) containing a
plurality of spray-dried particles comprising mRNA encoding a
protein or a peptide, one or more lipids, and one or more
polymers.
[0007] In another aspect, the present invention provides a dry
powder formulation for delivery of messenger RNA (mRNA) containing
a plurality of spray-dried particles comprising one or more lipid
nanoparticles (LNPs) encapsulating mRNA encoding a peptide or
polypeptide, and one or more polymers.
[0008] In still another aspect, the present invention provides a
dry powder formulation for delivery of messenger RNA (mRNA)
containing a plurality of spray-dried particles comprising one or
more nanoparticles encapsulating mRNA encoding a peptide or
polypeptide, the nanoparticles comprising one or more lipids, and
one or more polymers.
[0009] In yet another aspect, the present invention provides a dry
powder formulation for delivery of cystic fibrosis conductance
regulator (CFTR) messenger RNA (mRNA) containing a plurality of
spray-dried particles comprising mRNA encoding a CFTR protein, one
or more lipids, and one or more polymers. In some embodiments, the
one or more lipids form one or more lipid nanoparticles (LNPs)
encapsulating the mRNA encoding the CFTR protein. In some
embodiments, the one or more lipids and the one or more polymers
form one or more nanoparticles encapsulating the mRNA encoding the
CFTR protein.
[0010] As used in this application, lipid nanoparticles (LNPs)
encompass nanoparticles formed with lipids, as well as
nanoparticles formed with both lipids and polymers. In some
embodiments, nanoparticles formed with both lipids and polymers are
referred to as lipid-polymer nanoparticles.
[0011] In some embodiments, mRNA (e.g., CFTR mRNA) has an integrity
of 80% or greater, 85% or greater, 90% or greater, 95% or greater,
96% or greater, 97% or greater, 98% or greater, or 99% or greater.
In some embodiments, mRNA (e.g., CFTR mRNA) has an integrity of 90%
or greater. In some embodiments, mRNA (e.g., CFTR mRNA) has an
integrity of 95% or greater. In some embodiments, mRNA (e.g., CFTR
mRNA) has an integrity of 98% or greater.
[0012] In some embodiments, the mRNA maintains an integrity of 90%
or greater upon storage at or under room temperature for 6 months
or longer. In some embodiments, the mRNA maintains an integrity of
95% or greater upon storage at or under room temperature for 6
months or longer. In some embodiments, the mRNA maintains an
integrity of 98% or greater upon storage at or under room
temperature for 6 months or longer.
[0013] In some embodiments, the mRNA maintains integrity of or
greater than 90% after spray-drying and storage at or under room
temperature for three months or longer. In some embodiments, the
mRNA maintains integrity of or greater than 90% after spray-drying
and storage at or under room temperature for six months or longer.
In some embodiments, the mRNA maintains integrity of or greater
than 90% after spray-drying and storage at or under room
temperature for nine months or longer. In some embodiments, the
mRNA maintains integrity of or greater than 90% after spray-drying
and storage at or under room temperature for twelve months or
longer. In some embodiments, the mRNA maintains integrity of or
greater than 90% after spray-drying and storage at or under
4.degree. C. for three months or longer. In some embodiments, the
mRNA maintains integrity of or greater than 90% after spray-drying
and storage at or under 4.degree. C. for six months or longer. In
some embodiments, the mRNA maintains integrity of or greater than
90% after spray-drying and storage at or under 4.degree. C. or
lower for nine months or longer. In some embodiments, the mRNA
maintains integrity of or greater than 90% after spray-drying and
storage at or under 4.degree. C. for twelve months or longer. In
some embodiments, the mRNA maintains integrity of or greater than
95% after storage at or under room temperature for 3 months or
longer, 6 months or longer, 9 months or longer, or 12 months or
longer. In some embodiments, the mRNA maintains integrity of or
greater than 95% after storage at or under 4.degree. C. for 3
months or longer, 6 months or longer, 9 months or longer, or 12
months or longer.
[0014] In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, or 50% of the plurality of spray-dried particles are
a fraction of fine particles. In some embodiments, at least 20% of
the plurality of spray-dried particles are a fraction of fine
particles.
[0015] In some embodiments, the fine particles have a volume median
diameter of 5 micrometers or less. In some embodiments, the fine
particles have a volume median diameter of 4 micrometers or less.
In some embodiments, the fine particles have a volume median
diameter of 3 micrometers or less. In some embodiments, the fine
particles have a volume median diameter of 2 micrometers or less.
In some embodiments, the fine particles have a volume median
diameter of 1 micrometer or less.
[0016] In some embodiments, the plurality of spray-dried particles
has an average sphericity of greater than 0.6, greater than 0.7,
greater than 0.8, or greater than 0.9. In some embodiments, the
plurality of spray-dried particles has a Z-average size of less
than 3,000 nm, 2,500 nm, 2,000 nm, 1,500 nm, 1,000 nm, or 500
nm.
[0017] In some embodiments, the plurality of spray-dried particles
comprise a residual moisture content of less than 20%, less than
18%, less than 16%, less than 14%, less than 12%, less than 10%,
less than 9%, less than 8%, less than 7%, less than 6%, less than
5%, less than 4%, less than 3%, less than 2%, less than 1%, less
than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less
than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less
than 0.1%.
[0018] In some embodiments, the dry powder formulation is
inhalable. In some embodiments, the dry-powder formulation is
inhaled as a dry powder in a metered dose inhaler. In some
embodiments, the dry-power formulation is reconstituted with a
diluent and administered by nebulization.
[0019] In some embodiments, the one or more polymers constitute at
least 10%, at least 15%, at least 20%, at least 25%, at least 30%,
at least 35%, at least 40%, at least 45%, or at least 50% of the
combined weight of the lipids and polymers. In some embodiments,
the one or more polymers constitute about 10-90%, 10-80%, 10-70%,
10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%,
15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%,
15-75%, 15-80%, or 15-90% of the combined weight of the lipids and
polymers. In some embodiments, the one or more polymers constitute
no more than 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%,
or 20% of the combined weight of the lipids and polymers.
[0020] In some embodiments, the one or more polymers constitute at
least 50% of the total weight of dry powder. In some embodiments,
the one or more polymers constitute at least 40% of the total
weight of dry powder. In some embodiments, the one or more polymers
constitute at least 30% of the total weight of dry powder. In some
embodiments, the one or more polymers constitute at least 20% of
the total weight of dry powder. In some embodiments, the one or
more polymers constitute at least 15% of the total weight of dry
powder. In some embodiments, the one or more polymers constitute at
least 12% of the total weight of dry powder. In some embodiments,
the one or more polymers constitute at least 10% of the total
weight of dry powder. In some embodiments, the one or more polymers
constitute at least 9% of the total weight of dry powder. In some
embodiments, the one or more polymers constitute at least 8% of the
total weight of dry powder. In some embodiments, the one or more
polymers constitute at least 7% of the total weight of dry powder.
In some embodiments, the one or more polymers constitute at least
6% of the total weight of dry powder. In some embodiments, the one
or more polymers constitute at least 5% of the total weight of dry
powder.
[0021] In some embodiments, the one or more polymers are selected
from the group consisting of chitosan, poly(lactic acid) (PLA),
poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone (PCL),
poly amido amines, polyesters, polycarbonates, poly(hydroxyalkyl
L-asparagine), poly(hydroxyalkyl L-glutamine),
poly(2-alkyloxazoline) acrylates, modified acrylates and
polymethacrylate based polymers,
poly-N-(2-hydroxyl-propyl)methacrylamide,
poly-2-(methacryloyloxy)ethyl phosphorylcholines,
poly(2-(methacryloyloxy)ethyl phosphorylcholine), and
poly(dimethylaminoethyl methylacrylate) (pDMAEMA).
[0022] In some embodiments, the one or more polymers include a
polymethacrylate based polymer. In some embodiments, the one or
more polymers include Eudragit EPO.
[0023] In some embodiments, the one or more LNPs encapsulating mRNA
(also referred to as mRNA-loaded LNPs) have a lipid:mRNA (N/P)
ratio ranging from 1-20, 1-15, 1-10, 2-8, 2-6, or 2-4. In some
embodiments, the one or more mRNA-loaded lipid nanoparticles have a
lipid:mRNA (N/P) ratio ranging from 1 to 20. In some embodiments,
the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA
(N/P) ratio ranging from 1 to 18. In some embodiments, the one or
more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 16. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 14. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 12. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 10. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 8. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 1 to 6. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 20. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 16. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 12. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 8. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 6. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 2 to 4. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 4 to 20. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 4 to 16. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 4 to 14. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 4 to 12. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles have a lipid:mRNA (N/P) ratio
ranging from 4 to 10. In some embodiments, the one or more
mRNA-loaded LNPs have a lipid:mRNA (N/P) ratio of 2 or 4. In some
embodiments, the one or more mRNA-loaded LNPs have a lipid:mRNA
(N/P) ratio of 2. In some embodiments, the one or more mRNA-loaded
LNPs have a lipid:mRNA (N/P) ratio of 4.
[0024] In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 70% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 75% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 80% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 85% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 90% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 92% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 94% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 95% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 96% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 97% or greater.
In some embodiments, the one or more mRNA-loaded lipid
nanoparticles have an encapsulation efficiency of 98% or
greater.
[0025] In some embodiments, the one or more lipids comprise a
cationic lipid. In some embodiments, the cationic lipid is selected
from the group consisting of C12-200, DOTAP
(1,2-dioleyl-3-trimethytammonium propane), DODAP
(1,2-dioleyl-3-dimethylammonium propane), DOTMA
(1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA,
DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.
[0026] In some embodiments, the one or more mRNA-loaded lipid
nanoparticles comprise one or more cationic lipids. In some
embodiments, the one or more cationic lipids comprises an ionizable
cationic lipid. In some embodiments, the one or more cationic
lipids comprises the cationic lipid C12-200. In some embodiments,
the one or more cationic lipids comprises the cationic lipid DOTAP
(1,2-dioleyl-3-trimethytammonium propane). In some embodiments, the
one or more cationic lipids comprises the cationic lipid DODAP
(1,2-dioleyl-3-dimethylammonium propane). In some embodiments, the
one or more cationic lipids comprises the cationic lipid DOTMA
(1,2-di-O-octadecenyl-3-trimethylammonium propane). In some
embodiments, the one or more cationic lipids comprises the cationic
lipid DLinDMA. In some embodiments, the one or more cationic lipids
comprises the cationic lipid DLin-KC2-DMA. In some embodiments, the
one or more cationic lipids comprises the cationic lipid HGT-5000.
In some embodiments, the one or more cationic lipids comprises the
cationic lipid HGT-5001. In some embodiments, the one or more
cationic lipids comprises the cationic lipid HGT-5002. In some
embodiments, the one or more cationic lipids comprises the cationic
lipid cKK-E12. In some embodiments, the one or more cationic lipids
comprises the cationic lipid OF-02. In some embodiments, the one or
more cationic lipids comprises the cationic lipid Target 23. In
some embodiments, the one or more cationic lipids comprises the
cationic lipid Compound 1. In some embodiments, the one or more
cationic lipids comprises the cationic lipid Compound 2. In some
embodiments, the one or more cationic lipids comprises the cationic
lipid Compound 3. In some embodiments, the one or more cationic
lipids comprises the cationic lipid HGT4001. In some embodiments,
the one or more cationic lipids comprises the cationic lipid
HGT4002. In some embodiments, the one or more cationic lipids
comprises the cationic lipid HGT4003. In some embodiments, the one
or more cationic lipids comprises the cationic lipid HGT4004. In
some embodiments, the one or more cationic lipids comprises the
cationic lipid HGT4005. In some embodiments, the one or more
cationic lipids comprises the cationic lipid 18:1 Carbon
tail-ribose lipid. In some embodiments, the one or more cationic
lipids comprises the cationic lipid ICE.
[0027] In some embodiments, the cationic lipid constitutes about
25-50% of the total lipids in LNPs by molar.
[0028] In some embodiments, the one or more lipids comprise a
PEG-modified lipid. In some embodiments, the one or more
mRNA-loaded lipid nanoparticles comprise one or more PEG-modified
lipids. In some embodiments, the one or more PEG-modified lipids
comprise a poly(ethylene) glycol chain of up to 5 kDa in length
covalently attached to a lipid comprising one or more alkyl chains
of C6-C20 in length. In some embodiments, the one or more
PEG-modified lipids constitute up to 20%, 15%, 12%, 10%, 9%, 8%,
7%, 6%, 5%, 4%, 3%, 2% or 1% of the total lipids in LNPs by molar.
In some embodiments, the PEG-modified lipid constitutes about 1-15%
of the total lipids in LNPs by molar. In some embodiments, the
PEG-modified lipid constitutes at least 1%, 2%, 3%, 4%, 5%, 6%, 8%,
10%, or 12% of the total lipids in LNPs by molar.
[0029] In some embodiments, suitable LNPs according to the present
invention are two-lipid component LNPs.
[0030] In some embodiments, the one or more lipids do not include a
neutral lipid or a cholesterol-based lipid.
[0031] In some embodiments, the one or more lipids further comprise
a neutral lipid and/or a cholesterol-based lipid. In some
embodiments, the one or more lipids further comprise a neutral
lipid.
[0032] In some embodiments, suitable LNPs according to the present
invention are three-lipid component LNPs.
[0033] In some embodiments, a dry powder formulation according to
the present invention further contains at least one sugar. In some
embodiments, the sugar is selected from the group consisting of
monosaccharides, disaccharides, polysaccharides, glucose, fructose,
galactose, mannose, sorbose, lactose, sucrose, cellobiose,
trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrins,
inulin, xylitol, sorbitol, lactitol, mannitol, and combination
thereof. In some embodiments, the sugar is mannitol. In some
embodiments, the sugar constitutes less than 30%, 25%, 20%, 15%,
10%, or 5% of total weight.
[0034] In some embodiments, a dry powder formulation according to
the present invention further comprises a pharmaceutically
acceptable excipient selected from the group consisting of esters,
urethanes, phosphoesters, phosphazenes, amino acids, collagen,
chitosan, polysaccharides, albumin, surfactants, buffers, salts,
and combinations thereof.
[0035] In some embodiments, a suitable surfactant is selected from
the group consisting of CHAPS
(3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate),
phospholipids, phosphatidylserine, phosphatidylethanolamine,
phosphatidylcholine, sphingomyelins, Octaethylene glycol
monododecyl ether, Pentaethylene glycol monododecyl ether, Triton
X-100, Cocamide monoethanolamine, Cocamide diethanolamine, Glycerol
monostearate, Glycerol monolaurate, Sorbitan moonolaureate,
Sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80,
Alkyl polyglucosides, and a poloxamer (e.g., poloxamer 407). In
some embodiments, a suitable surfactant is poloxamer.
[0036] In some embodiments, a dry powder formulation according to
the present invention further contains a pharmaceutically
acceptable excipient. In some embodiments, a pharmaceutically
acceptable excipient is selected from the group consisting of
esters, urethanes, phosphoesters, phosphazenes, amino acids,
collagen, chitosan, polysaccharides, albumin, surfactants, buffers,
salts, and combination thereof.
[0037] In some embodiments, a dry powder formulation according to
the present invention contains a surfactant. In some embodiments,
the surfactant is selected from the group consisting of CHAPS
(3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate),
phospholipids, phosphatidylserine, phosphatidylethanolamine,
phosphatidylcholine, sphingomyelins, Octaethylene glycol
monododecyl ether, Pentaethylene glycol monododecyl ether, Triton
X-100, Cocamide monoethanolamine, Cocamide diethanolamine, Glycerol
monostearate, Glycerol monolaurate, Sorbitan moonolaureate,
Sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80,
Alkyl polyglucosides, and copolymers. In some embodiments, the
surfactant is a poloxamer. In some embodiments, the surfactant is
poloxamer a triblock copolymer consisting of a central hydrophobic
block of polypropylene glycol flanked by two hydrophilic blocks of
polyethylene glycol (PEG). In some embodiments, the surfactant is
poloxamer 407.
[0038] In some embodiments, the mRNA constitutes up to 10% of the
total weight of dry powder. In some embodiments, the mRNA
constitutes up to 9% of the total weight of dry powder. In some
embodiments, the mRNA constitutes up to 8% of the total weight of
dry powder. In some embodiments, the mRNA constitutes up to 7% of
the total weight of dry powder. In some embodiments, the mRNA
constitutes up to 6% of the total weight of dry powder. In some
embodiments, the mRNA constitutes up to 5% of the total weight of
dry powder. In some embodiments, the mRNA constitutes up to 4% of
the total weight of dry powder. In some embodiments, the mRNA
constitutes up to 3% of the total weight of dry powder. In some
embodiments, the mRNA constitutes up to 2% of the total weight of
dry powder. In some embodiments, the mRNA constitutes 1-10% of the
total weight of dry powder. In some embodiments, the mRNA
constitutes 1-6% of the total weight of dry powder. In some
embodiments, the mRNA constitutes 1-5% of the total weight of dry
powder. In some embodiments, the mRNA constitutes 1-4% of the total
weight of dry powder. In some embodiments, the mRNA constitutes
1-3% of the total weight of dry powder. In some embodiments, the
mRNA constitutes 2-10% of the total weight of dry powder. In some
embodiments, the mRNA constitutes 2-9% of the total weight of dry
powder. In some embodiments, the mRNA constitutes 2-8% of the total
weight of dry powder. In some embodiments, the mRNA constitutes
2-7% of the total weight of dry powder. In some embodiments, the
mRNA constitutes 2-6% of the total weight of dry powder. In some
embodiments, the mRNA constitutes 2-5% of the total weight of dry
powder. In some embodiments, the mRNA is unmodified. In some
embodiments, the mRNA contains one or more modified
nucleotides.
[0039] In some embodiments, the mRNA encodes a peptide. In some
embodiments, the mRNA encodes a therapeutic protein. In some
embodiments, the therapeutic protein is CFTR.
[0040] In some embodiments, the CFTR mRNA constitutes about 1-20%,
1-15%, 1-10%, 1-8%, 1-6%, 1-5%, 5-15%, or 5-10% of the total weight
of the spray-dried particles. In some embodiments, the CFTR mRNA
constitutes about 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5%, or 15% of
the total weight of the spray-dried particles.
[0041] In another aspect, the present invention provides a method
of delivering cystic fibrosis conductance regulator (CFTR)
messenger RNA (mRNA) for in vivo expression comprising a step of
administering to a subject in need thereof a dry powder formulation
described herein. In some embodiments, a dry powder formulation
described herein is administered by pulmonary delivery. In some
embodiments, a dry powder formulation is administered by
inhalation.
[0042] In a further aspect, the present invention provides a method
of delivering cystic fibrosis conductance regulator (CFTR)
messenger RNA (mRNA) for in vivo expression comprising steps of:
reconstituting a dry powder formulation of described herein into a
liquid solution; and administering to a subject in need thereof the
reconstituted liquid solution. In some embodiments, the
reconstituted liquid solution is administered by nebulization. In
some embodiments, the subject is suffering from cystic
fibrosis.
[0043] In another aspect, the present invention provides a method
for manufacturing a dry powder formulation including providing a
mixture comprising an mRNA, one or more lipids and a polymer; and
spray-drying the mixture to form a plurality of particles.
[0044] In some embodiments, the one or more lipids are first mixed
with the mRNA to form mRNA-loaded lipid nanoparticles before adding
the polymer.
[0045] In some embodiments, a method according to the invention
further includes adding to the mixture one or more excipients prior
to spray drying.
[0046] In some embodiments, the plurality of spray dried particles
is characterized by one or more of the following: a) less than 10%
moisture content; b) a fraction of fine particles with a volume
median diameter less than 5 micrometers; c) Z-average size range of
10-3000 nm; d) N/P ratio range from 1 to 20; e) mRNA encapsulation
efficiency greater than 80%; and f) mRNA integrity greater than
95%.
[0047] In yet another aspect, the present invention provides a
method of delivering mRNA in vivo comprising administering to a
subject in need thereof a dry powder formulation described herein.
In some embodiments, the dry powder formulation is administered via
oral, nasal, tracheal, pulmonary or rectal routes. In some
embodiments, the dry powder formulation is administered by
inhalation. In some embodiments, the dry powder formulation is
administered by intranasal spray. In some embodiments, the
formulation is administered by a metered-dose inhaler. In some
embodiments, the formulation is administered by a nebulizer.
[0048] In still another aspect, the present invention provides a
method of delivering cystic fibrosis conductance regulator (CFTR)
messenger RNA (mRNA) for in vivo expression comprising a step of
administering to a subject in need thereof a dry powder formulation
described herein.
[0049] In still another aspect, the present invention provides a
method of treating a disease or disorder in a patient by
administering to the patient an effective dose of mRNA in a dry
powder formulation described herein. In some embodiments, the
disease or disorder is selected from cystic fibrosis; asthma; COPD;
emphysema; primary ciliary dyskinesia (CILD1) with or without situs
inversus, or Kartagener syndrome; pulmonary fibrosis;
Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia;
alpha-1 antitrypsin deficiency; Cytochrome b positive granulomatous
diseases (CGD, X-lined); Cytochrome b positive granulomatous
diseases, autosomal recessive; surfactant deficiency diseases,
Pulmonary Surfactant Metabolism Dysfunction 1, Pulmonary Surfactant
Metabolism Dysfunction 2, Pulmonary Surfactant Metabolism
Dysfunction 3; Respiratory distress syndrome of prematurity;
tuberculous tuberculosis, lung viral diseases, including influenza,
Respiratory Syncytial Virus (RSV).
[0050] Additional objects and advantages of the invention will be
set forth in part in the description which follows, and in part
will be obvious from the description, or may be learned by practice
of the invention. The objects and advantages of the invention will
be realized and attained by means of the elements and combinations
particularly pointed out in the appended claims.
[0051] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed.
[0052] The accompanying drawings, which are incorporated in and
constitute a part of this specification, illustrate several
embodiments of the invention and together with the description,
serve to explain the principles of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] The drawings are for illustration purposes only, not for
limitation.
[0054] FIG. 1 shows an exemplary graphical illustration of the
spray-drying technique of mRNA formulations.
[0055] FIG. 2 shows the percent recovery of LNP-encapsulated mRNA
material following spray-drying, without and with polymer in the
formulation.
[0056] FIG. 3 depicts spectrophotometric analysis of an mRNA
reference for integrity assessment.
[0057] FIG. 4 depicts exemplary data illustrating integrity of mRNA
upon extraction from a lipid nanoparticle.
[0058] FIG. 5 depicts exemplary data illustrating integrity of mRNA
encapsulated in a LNP in a formulation with polymer at two weeks
following spray-drying and storage at 4.degree. C.
[0059] FIG. 6 depicts exemplary data illustrating integrity of mRNA
encapsulated in a LNP in a formulation with polymer at two weeks
following spray-drying and storage at -20.degree. C.
[0060] FIG. 7 depicts exemplary data that shows no effect of
storage temperature on integrity of mRNA encapsulated in a LNP in a
formulation with polymer and stored for two weeks after
spray-drying.
[0061] FIG. 8 depicts exemplary data illustrating integrity of mRNA
encapsulated in a LNP in a formulation with polymer at four weeks
following spray-drying and storage at 4.degree. C.
[0062] FIG. 9 depicts exemplary data illustrating integrity of mRNA
encapsulated in a LNP in a formulation with polymer at four weeks
following spray-drying and storage at -20.degree. C.
[0063] FIG. 10 depicts exemplary data illustrating integrity of
mRNA in a formulation with polymer (without LNP) at three weeks
after spray-drying, stored at 4.degree. C.
[0064] FIG. 11 depicts exemplary data illustrating integrity of
mRNA in a formulation with polymer (without LNP) at three weeks
after spray-drying, stored at -20.degree. C.
[0065] FIG. 12 depicts exemplary data that shows no effect of
storage temperature on integrity of mRNA formulated with polymer
(without LNP) and stored for three weeks after spray-drying.
[0066] FIG. 13 depicts exemplary data illustrating integrity of
mRNA in a formulation with polymer (without LNP) at five weeks
after spray-drying, stored at 4.degree. C.
[0067] FIG. 14 depicts exemplary data illustrating integrity of
mRNA in a formulation with polymer (without LNP) at five weeks
after spray-drying, stored at -20.degree. C.
[0068] FIG. 15A and FIG. 15B shows exemplary mRNA expression in
vivo measured by bioluminescence after administering mRNA spray-dry
preparations in mice. Luciferase mRNA was administered using 1 mg.
For FIG. 15A, mRNA was administered as a dry-powder. For FIG. 15B,
mRNA was administered as liquid following dissolution of the dry
powder in water.
[0069] FIG. 16A1-A6 depicts exemplary capillary electrophoresis
chromatographs illustrating integrity of CFTR mRNA after
spray-drying. FIG. 16A1-A3 depicts control CFTR mRNA which was
neither spray dried nor encapsulated, while FIG. 16A4-A6 depicts
the CFTR mRNA extracted from the spray-dried formulation.
DEFINITIONS
[0070] In order for the present invention to be more readily
understood, certain terms are first defined below. Additional
definitions for the following terms and other terms are set forth
throughout the specification.
[0071] Animal: As used herein, the term "animal" refers to any
member of the animal kingdom. In some embodiments, "animal" refers
to humans, at any stage of development. In some embodiments,
"animal" refers to non-human animals, at any stage of development.
In certain embodiments, the non-human animal is a mammal (e.g., a
rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep,
cattle, a primate, and/or a pig). In some embodiments, animals
include, but are not limited to, mammals, birds, reptiles,
amphibians, fish, insects, and/or worms. In some embodiments, an
animal may be a transgenic animal, genetically-engineered animal,
and/or a clone.
[0072] Approximately or about: As used herein, the term
"approximately" or "about," as applied to one or more values of
interest, refers to a value that is similar to a stated reference
value. In certain embodiments, the term "approximately" or "about"
refers to a range of values that fall within 25%, 20%, 19%, 18%,
17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%,
2%, 1%, or less in either direction (greater than or less than) of
the stated reference value unless otherwise stated or otherwise
evident from the context (except where such number would exceed
100% of a possible value).
[0073] Delivery: As used herein, the term "delivery" encompasses
both local and systemic delivery. For example, delivery of mRNA
encompasses situations in which an mRNA is delivered to a target
tissue and the encoded protein is expressed and retained within the
target tissue (also referred to as "local distribution" or "local
delivery"), and situations in which an mRNA is delivered to a
target tissue and the encoded protein is expressed and secreted
into patient's circulation system (e.g., serum) and systematically
distributed and taken up by other tissues (also referred to as
"systemic distribution" or "systemic delivery).
[0074] Encapsulation: As used herein, the term "encapsulation," or
grammatical equivalent, refers to the process of confining an
individual mRNA molecule within a nanoparticle.
[0075] Expression: As used herein, "expression" of a nucleic acid
sequence refers to translation of an mRNA into a polypeptide,
assemble multiple polypeptides into an intact protein (e.g.,
enzyme) and/or post-translational modification of a polypeptide or
fully assembled protein (e.g., enzyme). In this application, the
terms "expression" and "production," and grammatical equivalent,
are used inter-changeably.
[0076] Improve, increase, or reduce: As used herein, the terms
"improve," "increase" or "reduce," or grammatical equivalents,
indicate values that are relative to a baseline measurement, such
as a measurement in the same individual prior to initiation of the
treatment described herein, or a measurement in a control subject
(or multiple control subject) in the absence of the treatment
described herein. A "control subject" is a subject afflicted with
the same form of disease as the subject being treated, who is about
the same age as the subject being treated.
[0077] In Vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, etc., rather than within
a multi-cellular organism.
[0078] In Vivo: As used herein, the term "in vivo" refers to events
that occur within a multi-cellular organism, such as a human and a
non-human animal. In the context of cell-based systems, the term
may be used to refer to events that occur within a living cell (as
opposed to, for example, in vitro systems).
[0079] Local distribution or delivery: As used herein, the terms
"local distribution," "local delivery," or grammatical equivalent,
refer to tissue specific delivery or distribution. Typically, local
distribution or delivery requires a protein (e.g., enzyme) encoded
by mRNAs be translated and expressed intracellularly or with
limited secretion that avoids entering the patient's circulation
system.
[0080] Messenger RNA (mRNA): As used herein, the term "messenger
RNA (mRNA)" refers to a polynucleotide that encodes at least one
polypeptide. mRNA as used herein encompasses both modified and
unmodified RNA. mRNA may contain one or more coding and non-coding
regions. mRNA can be purified from natural sources, produced using
recombinant expression systems and optionally purified, chemically
synthesized, etc. Where appropriate, e.g., in the case of
chemically synthesized molecules, mRNA can comprise nucleoside
analogs such as analogs having chemically modified bases or sugars,
backbone modifications, etc. An mRNA sequence is presented in the
5' to 3' direction unless otherwise indicated. In some embodiments,
an mRNA is or comprises natural nucleosides (e.g., adenosine,
guanosine, cytidine, uridine); nucleoside analogs (e.g.,
2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine,
3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5
propynyl-uridine, 2-aminoadenosine, C5-bromouridine,
C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine,
C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine,
7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine); chemically modified bases;
biologically modified bases (e.g., methylated bases); intercalated
bases; modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose); and/or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite
linkages).
[0081] N/P Ratio: As used herein, the term "N/P ratio" refers to a
molar ratio of positively charged molecular units in the cationic
lipids in a lipid nanoparticle relative to negatively charged
molecular units in the mRNA encapsulated within that lipid
nanoparticle. As such, N/P ratio is typically calculated as the
ratio of moles of amine groups in cationic lipids in a lipid
nanoparticle relative to moles of phosphate groups in mRNA
encapsulated within that lipid nanoparticle.
[0082] Patient: As used herein, the term "patient" or "subject"
refers to any organism to which a provided composition may be
administered, e.g., for experimental, diagnostic, prophylactic,
cosmetic, and/or therapeutic purposes. Typical patients include
animals (e.g., mammals such as mice, rats, rabbits, non-human
primates, and/or humans). In some embodiments, a patient is a
human. A human includes pre- and post-natal forms.
[0083] Pharmaceutically acceptable: As used herein, the term
"pharmaceutically acceptable" refers to substances that, within the
scope of sound medical judgment, are suitable for use in contact
with the tissues of human beings and animals without excessive
toxicity, irritation, allergic response, or other problem or
complication, commensurate with a reasonable benefit/risk
ratio.
[0084] Subcutaneous administration: As used herein, the term
"subcutaneous administration" or "subcutaneous injection" refers to
a bolus injection into the subcutis, which is the tissue layer
between the skin and the muscle.
[0085] Subject: As used herein, the term "subject" refers to a
human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat,
cattle, swine, sheep, horse or primate). A human includes pre- and
post-natal forms. In many embodiments, a subject is a human being.
A subject can be a patient, which refers to a human presenting to a
medical provider for diagnosis or treatment of a disease. The term
"subject" is used herein interchangeably with "individual" or
"patient." A subject can be afflicted with or is susceptible to a
disease or disorder but may or may not display symptoms of the
disease or disorder.
[0086] Therapeutically effective amount: As used herein, the term
"therapeutically effective amount" of a therapeutic agent means an
amount that is sufficient, when administered to a subject suffering
from or susceptible to a disease, disorder, and/or condition, to
treat, diagnose, prevent, and/or delay the onset of the symptom(s)
of the disease, disorder, and/or condition. It will be appreciated
by those of ordinary skill in the art that a therapeutically
effective amount is typically administered via a dosing regimen
comprising at least one unit dose.
[0087] Treating: As used herein, the term "treat," "treatment," or
"treating" refers to any method used to partially or completely
alleviate, ameliorate, relieve, inhibit, prevent, delay onset of,
reduce severity of and/or reduce incidence of one or more symptoms
or features of a particular disease, disorder, and/or condition.
Treatment may be administered to a subject who does not exhibit
signs of a disease and/or exhibits only early signs of the disease
for the purpose of decreasing the risk of developing pathology
associated with the disease.
DETAILED DESCRIPTION
[0088] The present invention provides stable dry powder
formulations containing mRNA loaded lipid nanoparticles (mRNA-LNP)
for therapeutic use. In particular, the present invention provides
a dry powder formulation for delivery of mRNA comprising a
plurality of spray-dried particles, each spray-dried particle
comprising one or more mRNA loaded lipid nanoparticles and a
polymer, and methods of making and using the same.
[0089] Various aspects of the invention are described in detail in
the following sections. The use of sections is not meant to limit
the invention. Each section can apply to any aspect of the
invention. In this application, the use of "or" means "and/or"
unless stated otherwise.
Spray-Drying Process
[0090] Various spray-drying processes may be used to practice the
present invention. The process involves, in general, removal of
moisture from a composition by passing a liquid form of the
composition through an apparatus; a simplified diagrammatic
depiction is provided as FIG. 1. In brief, a liquid formulation
comprising the composition of interest is passed through a narrow
inlet spray `atomizer` nozzle into a first chamber, which is the
drying chamber. Usually the liquid formulation is passed in a
steady stream. The liquid formulation is sprayed as tiny droplets
into the drying chamber. A stream of heated air or gas is also led
into the drying chamber to form an air current. Passage of the
formulation through this heated current disperses the incoming
droplets, dries them into the solid particulate form. This product
is led into a second chamber by flow through a connector or pipe.
The second chamber is the cyclone powder collector. Here, the air
circulation generates a cyclone, and the powder particles are
collected via a vortex stream into a collection vessel attached to
the outlet end. The cyclone chamber is attached to an exhaust fan,
which helps cool the components. The inlet and outlet temperatures
are operator adjustable. The respective inlet and outlet
temperatures, the chamber temperatures, the liquid feed flow rate
(aspirator %), pressure, nature of the heated air current and most
importantly, the composition of the liquid feed are suitably
adjusted for optimal drying of any particulate matter.
[0091] In some embodiments, the inlet temperature is adjustable
within a range of 40.degree. C. to 200.degree. C. In some
embodiments, the outlet temperature ranges between 20-70.degree. C.
The relative pressure of the pump and the aspirator is also
operator adjustable. In some embodiments, for spray-drying
mRNA-lipid nanoparticle, the inlet temperature is adjusted between
70.degree. C. and 200.degree. C. In some embodiments, the inlet
temperature is adjusted between 80.degree. C. and 200.degree. C. In
some embodiments, the inlet temperature is adjusted between
90.degree. C. and 200.degree. C. In some embodiments, the inlet
temperature is adjusted between 95.degree. C. and 180.degree. C. In
some embodiments, the inlet temperature is adjusted between
95.degree. C. and 160.degree. C. In some embodiments, the inlet
temperature is adjusted between 90.degree. C. and 150.degree. C. In
some embodiments, the inlet temperature is adjusted between
90.degree. C. and 120.degree. C. In some embodiments the inlet
temperature is adjusted between 90.degree. C. and 100.degree. C. In
some embodiments, the inlet temperature is 70.degree. C.,
75.degree. C., 80.degree. C., 85.degree. C., 90.degree. C.,
95.degree. C., or 100.degree. C.
[0092] The aspirator percentage into the drying chamber is
typically adjusted between 50% and 100%. In some embodiments, the
aspirator percentage into the drying chamber is adjusted between
50% and 100%. In some embodiments, the aspirator percentage into
the drying chamber is adjusted between 60% and 100%. In some
embodiments, the aspirator percentage into the drying chamber is
adjusted between 70% and 100%. In some embodiments, the aspirator
percentage into the drying chamber is adjusted between 80% and
100%. In certain embodiments the aspirator percentage is adjusted
between 80% and 90%. In some embodiments, the aspirator percentage
is or less than 100%, or, is or less than 95%, or, is or less than
90%, or is or less than 85%, or is or less than 80%.
[0093] In some embodiments, the liquid flow through the inlet into
the drying chamber is adjusted by a pump, set at a range between
10%-50%. In some embodiments, the pump is set at a range between
20% and 40%. In some embodiments, the pump is set at a range
between 10% and 30%. In some embodiments, the pump is set at a
range between 20% and 30%. In some embodiments, the pump is set at
a range between 30% and 50%. In some embodiments, the pump is set
at 25%.
[0094] In some embodiments, the outlet temperature ranges between
20.degree. C. to 70.degree. C. In some embodiments, the outlet
temperature is between 30.degree. C. to 60.degree. C. In some
embodiments, the outlet temperature is between 20.degree. C. to
50.degree. C. In some embodiments, the outlet temperature is
between 30.degree. C. to 50.degree. C. In some embodiments, the
outlet temperature is between 40.degree. C. to 50.degree. C. In
some embodiments, the outlet temperature is between 45.degree. C.
and 50.degree. C.
[0095] Spray drying of mRNA-LNP can be carried out using any
suitable spray-drying device. As is known to a person of ordinary
skill in the art, a variety of spray-drying instruments are
commercially available and can be used to practice the present
invention. Exemplary commercially available devices suitable for
the present invention include, but are not limited to the
following: Mini Spray Dryer B-290; Nano Spray Dryer B-90
(manufactured by Buchi); Anhydro MicraSpray Dryer GMP; Anhydro
MicraSpray Dryer Aseptic series (manufactured by SPX FLOW); MDL-50
and MDL-015 (manufactured by Fujisaki Electric); Versatile Mini
Sprayer Dryer GAS410 (manufactured by Yamato Scientific America);
LSD-1500 Mini spray dryer, MSD-8 Multi-functional laboratory spray
dryer; PSD-12 Precision pharmacy spray dryer; (manufactured by
Changzhou Xiandao Drying Equipment Co. Ltd); TALL FORM DRYER.TM.;
Multi-Stage Dryer; COMPACT DRYER.TM.; FILTERMAT Spray Dryer;
VERSATILE-SD.TM.; Fluidized Spray Dryer; MOBILE MINOR.TM.;
SDMICRO.TM.; PRODUCTION MINOR.TM. (manufactured by GEA Process
Engineering) and many others. Convenient scale up from laboratory
scale to industrial manufacturing scale is also available from
several of these manufacturers.
[0096] Spray-Drying mRNA-Loaded Nanoparticles
[0097] According to the present invention, spray drying mRNA-loaded
nanoparticles involves adding a polymer to an mRNA and lipids
mixture. In some embodiments, lipids and mRNA are mixed first to
pre-form mRNA-loaded lipid nanoparticles before adding the polymer.
In some embodiments, the lipids, mRNA and polymer are mixed at the
same time before spray drying. In some embodiments, a method
according to the invention further includes adding to the mixture
one or more excipients prior to spray drying.
[0098] mRNA-loaded Lipid Nanoparticles
[0099] Any desired lipids may be mixed at any ratios suitable for
encapsulating mRNAs. In some embodiments, a suitable lipid mixture
contains cationic lipids, non-cationic lipids, and/or PEGylated
lipids. In some embodiments, a suitable lipid mixture also contains
cholesterol-based lipids. In some embodiments, an mRNA-LNP is first
formed by mixing the mRNA and lipids before mixing with a polymer
or other excipients and subjecting the mixtures to spray
drying.
[0100] In some embodiments, mRNA-LNPs are formed by mixing an mRNA
solution with a lipid solution, wherein the mRNA solution and/or
the lipid solution are heated to a pre-determined temperature
greater than ambient temperature prior to mixing (see U.S. Pat. No.
9,668,980, entitled "Encapsulation of messenger RNA", the
disclosure of which is hereby incorporated in its entirety).
[0101] In some embodiments, mRNA-LNPs are formed by combining
pre-formed lipid nanoparticles with mRNA (see U.S. Patent
Application Publication No. 2018/0153822, the disclosure of which
is hereby incorporated by reference).
[0102] In some embodiments, encapsulation efficiency of mRNA by the
lipid nanoparticle before spray-draying is 70% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 75% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 80% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 85% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 86% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 87% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 88% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 89% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 90% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 91% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 92% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 93% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 94% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 95% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 96% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 97% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 98% or greater. In some
embodiments, encapsulation efficiency of mRNA by the lipid
nanoparticle before spray-draying is 99% or greater.
[0103] In some embodiments, encapsulation efficiency of mRNA by the
LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 70% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 75% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 80% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 85% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 86% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 87% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 88% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 89% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 90% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 91% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 92% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 93% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 94% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 95% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 96% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 97% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 98% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, after spray-draying a
formulation of a polymer and the LNP-encapsulated mRNA, is 99% or
greater.
[0104] In some embodiments, encapsulation efficiency of mRNA by the
LNP, both before and after spray-draying a formulation of a polymer
and the LNP-encapsulated mRNA, is 70% or greater. In some
embodiments, encapsulation efficiency of mRNA by the LNP, both
before and after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 75% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, both before and after
spray-draying a formulation of a polymer and the LNP-encapsulated
mRNA, is 80% or greater. In some embodiments, encapsulation
efficiency of mRNA by the LNP, both before and after spray-draying
a formulation of a polymer and the LNP-encapsulated mRNA, is 85% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, both before and after spray-draying a formulation of a
polymer and the LNP-encapsulated mRNA, is 86% or greater. In some
embodiments, encapsulation efficiency of mRNA by the LNP, both
before and after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 87% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, both before and after
spray-draying a formulation of a polymer and the LNP-encapsulated
mRNA, is 88% or greater. In some embodiments, encapsulation
efficiency of mRNA by the LNP, both before and after spray-draying
a formulation of a polymer and the LNP-encapsulated mRNA, is 89% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, both before and after spray-draying a formulation of a
polymer and the LNP-encapsulated mRNA, is 90% or greater. In some
embodiments, encapsulation efficiency of mRNA by the LNP, both
before and after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 91% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, both before and after
spray-draying a formulation of a polymer and the LNP-encapsulated
mRNA, is 92% or greater. In some embodiments, encapsulation
efficiency of mRNA by the LNP, both before and after spray-draying
a formulation of a polymer and the LNP-encapsulated mRNA, is 93% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, both before and after spray-draying a formulation of a
polymer and the LNP-encapsulated mRNA, is 94% or greater. In some
embodiments, encapsulation efficiency of mRNA by the LNP, both
before and after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 95% or greater. In some embodiments,
encapsulation efficiency of mRNA by the LNP, both before and after
spray-draying a formulation of a polymer and the LNP-encapsulated
mRNA, is 96% or greater. In some embodiments, encapsulation
efficiency of mRNA by the LNP, both before and after spray-draying
a formulation of a polymer and the LNP-encapsulated mRNA, is 97% or
greater. In some embodiments, encapsulation efficiency of mRNA by
the LNP, both before and after spray-draying a formulation of a
polymer and the LNP-encapsulated mRNA, is 98% or greater. In some
embodiments, encapsulation efficiency of mRNA by the LNP, both
before and after spray-draying a formulation of a polymer and the
LNP-encapsulated mRNA, is 99% or greater.
[0105] In some embodiments, the mass of a formulation of a polymer
and an LNP-encapsulated mRNA recovered from a spray-drying step is
10% or greater of the mass of the formulation prior to the
spray-drying step. In some embodiments, the mass of a formulation
of a polymer and an LNP-encapsulated mRNA recovered from a
spray-drying step is 15% or greater of the mass of the formulation
prior to the spray-drying step. In some embodiments, the mass of a
formulation of a polymer and an LNP-encapsulated mRNA recovered
from a spray-drying step is 20% or greater of the mass of the
formulation prior to the spray-drying step. In some embodiments,
the mass of a formulation of a polymer and an LNP-encapsulated mRNA
recovered from a spray-drying step is 25% or greater of the mass of
the formulation prior to the spray-drying step. In some
embodiments, the mass of a formulation of a polymer and an
LNP-encapsulated mRNA recovered from a spray-drying step is 30% or
greater of the mass of the formulation prior to the spray-drying
step. In some embodiments, the mass of a formulation of a polymer
and an LNP-encapsulated mRNA recovered from a spray-drying step is
35% or greater of the mass of the formulation prior to the
spray-drying step. In some embodiments, the mass of a formulation
of a polymer and an LNP-encapsulated mRNA recovered from a
spray-drying step is 40% or greater of the mass of the formulation
prior to the spray-drying step. In some embodiments, the mass of a
formulation of a polymer and an LNP-encapsulated mRNA recovered
from a spray-drying step is 41% or greater of the mass of the
formulation prior to the spray-drying step. In some embodiments,
the mass of a formulation of a polymer and an LNP-encapsulated mRNA
recovered from a spray-drying step is 42% or greater of the mass of
the formulation prior to the spray-drying step. In some
embodiments, the mass of a formulation of a polymer and an
LNP-encapsulated mRNA recovered from a spray-drying step is 43% or
greater of the mass of the formulation prior to the spray-drying
step. In some embodiments, the mass of a formulation of a polymer
and an LNP-encapsulated mRNA recovered from a spray-drying step is
44% or greater of the mass of the formulation prior to the
spray-drying step. In some embodiments, the mass of a formulation
of a polymer and an LNP-encapsulated mRNA recovered from a
spray-drying step is 45% or greater of the mass of the formulation
prior to the spray-drying step. In some embodiments, the mass of a
formulation of a polymer and an LNP-encapsulated mRNA recovered
from a spray-drying step is 46% or greater of the mass of the
formulation prior to the spray-drying step. In some embodiments,
the mass of a formulation of a polymer and an LNP-encapsulated mRNA
recovered from a spray-drying step is 47% or greater of the mass of
the formulation prior to the spray-drying step. In some
embodiments, the mass of a formulation of a polymer and an
LNP-encapsulated mRNA recovered from a spray-drying step is 48% or
greater of the mass of the formulation prior to the spray-drying
step. In some embodiments, the mass of a formulation of a polymer
and an LNP-encapsulated mRNA recovered from a spray-drying step is
49% or greater of the mass of the formulation prior to the
spray-drying step. In some embodiments, the mass of a formulation
of a polymer and an LNP-encapsulated mRNA recovered from a
spray-drying step is 50% or greater of the mass of the formulation
prior to the spray-drying step.
[0106] In some embodiments, mRNA and lipids are combined with pump
systems which maintain the lipid/mRNA (N/P) ratio constant
throughout the process and which also afford facile scale-up. In
some embodiments, the N/P ratio ranges between 1 to 20. In some
embodiments, the N/P ratio is greater than 2, or greater than 3, or
greater than 4, or greater than 5, or greater than 6, or greater
than 7, or greater than 8, or greater than 9, or greater than 10,
or greater than 11, or greater than 12, or greater than 13, or
greater than 14, or greater than 15. In some embodiments the N/P
ratio is 17, or 18, or 19, or 20.
[0107] Suitable mRNA loaded lipid nanoparticles may be made in
various sizes. In some embodiments, the size of an mRNA loaded
lipid nanoparticles pre-spray drying is determined by the length of
the largest diameter of the lipid nanoparticle. In some
embodiments, an mRNA loaded lipid nanoparticle has a size pre-spray
drying no greater than about 250 nm (e.g., no greater than about
225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm).
In some embodiments, a suitable liposome has a size ranging from
about 10-250 nm (e.g., ranging from about 10-225 nm, 10-200 nm,
10-175 nm, 10-150 nm, 10-125 nm, 10-100 nm, 10-75 nm, or 10-50 nm).
In some embodiments, an mRNA loaded lipid nanoparticle has a size
pre-spray drying ranging from about 100-250 nm (e.g., ranging from
about 100-225 nm, 100-200 nm, 100-175 nm, 100-150 nm). In some
embodiments, an mRNA loaded lipid nanoparticle has a size pre-spray
drying ranging from about 10-100 nm (e.g., ranging from about 10-90
nm, 10-80 nm, 10-70 nm, 10-60 nm, or 10-50 nm). In a particular
embodiment, an mRNA loaded lipid nanoparticle has a size pre-spray
drying less than about 100 nm.
[0108] A variety of alternative methods known in the art are
available for sizing of a population of liposomes. One such sizing
method is described in U.S. Pat. No. 4,737,323, incorporated herein
by reference. Sonicating a liposome suspension either by bath or
probe sonication produces a progressive size reduction down to
small ULV less than about 0.05 microns in diameter. Homogenization
is another method that relies on shearing energy to fragment large
liposomes into smaller ones. In a typical homogenization procedure,
MLV are recirculated through a standard emulsion homogenizer until
selected liposome sizes, typically between about 0.1 and 0.5
microns, are observed. The size of the liposomes may be determined
by quasi-electric light scattering (QELS) as described in
Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981),
incorporated herein by reference. Average liposome diameter may be
reduced by sonication of formed liposomes. Intermittent sonication
cycles may be alternated with QELS assessment to guide efficient
liposome synthesis.
[0109] Suitable mRNA-loaded lipid nanoparticles contain one or more
of cationic lipids, PEGylated lipids, non-cationic lipids, and
cholesterol-based lipids.
[0110] Cationic Lipids
[0111] As used herein, the term "cationic lipids" refers to any of
a number of lipid and lipidoid species that have a net positive
charge at a selected pH, such as at physiological pH. Several
cationic lipids have been described in the literature, many of
which are commercially available.
[0112] Suitable cationic lipids for use in the compositions and
methods of the invention include the cationic lipids as described
in International Patent Publication WO 2010/144740, which is
incorporated herein by reference. In certain embodiments, the
compositions and methods of the present invention include a
cationic lipid,
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino) butanoate, having a compound structure of:
##STR00001##
and pharmaceutically acceptable salts thereof.
[0113] Other suitable cationic lipids for use in the compositions
and methods of the present invention include ionizable cationic
lipids as described in International Patent Publication WO
2013/149140, which is incorporated herein by reference. In some
embodiments, the compositions and methods of the present invention
include a cationic lipid of one of the following formulas:
##STR00002##
or a pharmaceutically acceptable salt thereof, wherein R.sub.1 and
R.sub.2 are each independently selected from the group consisting
of hydrogen, an optionally substituted, variably saturated or
unsaturated C.sub.1-C.sub.20 alkyl and an optionally substituted,
variably saturated or unsaturated C.sub.6-C.sub.20 acyl; wherein
L.sub.1 and L.sub.2 are each independently selected from the group
consisting of hydrogen, an optionally substituted C.sub.1-C.sub.30
alkyl, an optionally substituted variably unsaturated
C.sub.1-C.sub.30 alkenyl, and an optionally substituted
C.sub.1-C.sub.30 alkynyl; wherein m and o are each independently
selected from the group consisting of zero and any positive integer
(e.g., where m is three); and wherein n is zero or any positive
integer (e.g., where n is one). In certain embodiments, the
compositions and methods of the present invention include the
cationic lipid (15Z,
18Z)--N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)
tetracosa-15,18-dien-1-amine ("HGT5000"), having a compound
structure of:
##STR00003##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include the cationic lipid (15Z,
18Z)--N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)
tetracosa-4,15,18-trien-l-amine ("HGT5001"), having a compound
structure of:
##STR00004##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include the cationic lipid and
(15Z,18Z)--N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)
tetracosa-5,15,18-trien-1-amine ("HGT5002"), having a compound
structure of:
##STR00005##
and pharmaceutically acceptable salts thereof.
[0114] Other suitable cationic lipids for use in the compositions
and methods of the invention include cationic lipids described as
aminoalcohol lipidoids in International Patent Publication WO
2010/053572, which is incorporated herein by reference. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00006##
and pharmaceutically acceptable salts thereof.
[0115] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2016/118725, which
is incorporated herein by reference. In certain embodiments, the
compositions and methods of the present invention include a
cationic lipid having a compound structure of:
##STR00007##
and pharmaceutically acceptable salts thereof.
[0116] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2016/118724, which
is incorporated herein by reference. In certain embodiments, the
compositions and methods of the present invention include a
cationic lipid having a compound structure of:
##STR00008##
and pharmaceutically acceptable salts thereof.
[0117] Other suitable cationic lipids for use in the compositions
and methods of the invention include a cationic lipid having the
formula of 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane,
and pharmaceutically acceptable salts thereof.
[0118] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publications WO 2013/063468 and
WO 2016/205691, each of which are incorporated herein by reference.
In some embodiments, the compositions and methods of the present
invention include a cationic lipid of the following formula:
##STR00009##
or pharmaceutically acceptable salts thereof, wherein each instance
of R.sup.L is independently optionally substituted C.sub.6-C.sub.40
alkenyl. In certain embodiments, the compositions and methods of
the present invention include a cationic lipid having a compound
structure of:
##STR00010##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00011##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00012##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00013##
and pharmaceutically acceptable salts thereof.
[0119] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2015/184256, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid of the following formula:
##STR00014##
or a pharmaceutically acceptable salt thereof, wherein each X
independently is O or S; each Y independently is O or S; each m
independently is 0 to 20; each n independently is 1 to 6; each
R.sub.A is independently hydrogen, optionally substituted C1-50
alkyl, optionally substituted C2-50 alkenyl, optionally substituted
C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally
substituted 3-14 membered heterocyclyl, optionally substituted
C6-14 aryl, optionally substituted 5-14 membered heteroaryl or
halogen; and each R.sub.B is independently hydrogen, optionally
substituted C1-50 alkyl, optionally substituted C2-50 alkenyl,
optionally substituted C2-50 alkynyl, optionally substituted C3-10
carbocyclyl, optionally substituted 3-14 membered heterocyclyl,
optionally substituted C6-14 aryl, optionally substituted 5-14
membered heteroaryl or halogen. In certain embodiments, the
compositions and methods of the present invention include a
cationic lipid, "Target 23", having a compound structure of:
##STR00015##
and pharmaceutically acceptable salts thereof.
[0120] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2016/004202, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00016##
or a pharmaceutically acceptable salt thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00017##
or a pharmaceutically acceptable salt thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00018##
or a pharmaceutically acceptable salt thereof.
[0121] Other suitable cationic lipids for use in the compositions
and methods of the present invention include cationic lipids as
described in U.S. Provisional Patent Application Ser. No.
62/758,179, which is incorporated herein by reference. In some
embodiments, the compositions and methods of the present invention
include a cationic lipid of the following formula:
##STR00019##
or a pharmaceutically acceptable salt thereof, wherein each R.sup.1
and R.sup.2 is independently H or C.sub.1-C.sub.6 aliphatic; each m
is independently an integer having a value of 1 to 4; each A is
independently a covalent bond or arylene; each L.sup.1 is
independently an ester, thioester, disulfide, or anhydride group;
each L.sup.2 is independently C.sub.2-C.sub.10 aliphatic; each
X.sup.1 is independently H or OH; and each R.sup.3 is independently
C.sub.6-C.sub.20 aliphatic. In some embodiments, the compositions
and methods of the present invention include a cationic lipid of
the following formula:
##STR00020##
or a pharmaceutically acceptable salt thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid of the following formula:
##STR00021##
or a pharmaceutically acceptable salt thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid of the following formula:
##STR00022##
or a pharmaceutically acceptable salt thereof.
[0122] Other suitable cationic lipids for use in the compositions
and methods of the present invention include the cationic lipids as
described in J. McClellan, M. C. King, Cell 2010, 141, 210-217 and
in Whitehead et al., Nature Communications (2014) 5:4277, which is
incorporated herein by reference. In certain embodiments, the
cationic lipids of the compositions and methods of the present
invention include a cationic lipid having a compound structure
of:
##STR00023##
and pharmaceutically acceptable salts thereof.
[0123] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2015/199952, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00024##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00025##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00026##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00027##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00028##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00029##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00030##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00031##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00032##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00033##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00034##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00035##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00036##
and pharmaceutically acceptable salts thereof.
[0124] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2017/004143, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00037##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00038##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00039##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00040##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00041##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00042##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00043##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00044##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00045##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00046##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00047##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00048##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00049##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00050##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00051##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00052##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00053##
and pharmaceutically acceptable salts thereof.
[0125] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2017/075531, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid of the following formula:
##STR00054##
or a pharmaceutically acceptable salt thereof, wherein one of
L.sup.1 or L.sup.2 is --O(C.dbd.O)--, --(C.dbd.O)O--,
--C(.dbd.O)--, --O--, --S(O).sub.x, --S--S--, --C(.dbd.O)S--,
--SC(.dbd.O)--, --NR.sup.aC(.dbd.O)--, --C(.dbd.O)NR.sup.a--,
NR.sup.aC(.dbd.O)NR.sup.a--, --OC(.dbd.O)NR.sup.a--, or
--NR.sup.aC(.dbd.O)O--; and the other of L.sup.1 or L.sup.2 is
--O(C.dbd.O)--, --(C.dbd.O)O--, --C(.dbd.O)--, --O--, --S(O).sub.x,
--S--S--, --C(.dbd.O)S--, SC(.dbd.O)--, --NR.sup.aC(.dbd.O)--,
--C(.dbd.O)NR.sup.a--, NR.sup.aC(.dbd.O)NR.sup.a--,
--OC(.dbd.O)NR.sup.a-- or --NR.sup.aC(.dbd.O)O-- or a direct bond;
G.sup.1 and G.sup.2 are each independently unsubstituted
C.sub.1-C.sub.12 alkylene or C.sub.1-C.sub.12 alkenylene; G.sup.3
is C.sub.1-C.sub.24 alkylene, C.sub.1-C.sub.24alkenylene,
C.sub.3-C.sub.8 cycloalkylene, C.sub.3-C.sub.8 cycloalkenylene;
R.sup.a is H or C.sub.1-C.sub.12 alkyl; R.sup.1 and R.sup.2 are
each independently C.sub.6-C.sub.24 alkyl or C.sub.6-C.sub.24
alkenyl; R.sup.3 is H, OR.sup.5, CN, --C(.dbd.O)OR.sup.4,
--OC(.dbd.O)R.sup.4 or --NR.sup.5C(.dbd.O)R.sup.4; R.sup.4 is
C.sub.1-C.sub.12 alkyl; R.sup.5 is H or C.sub.1-C.sub.6 alkyl; and
x is 0, 1 or 2.
[0126] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2017/117528, which
is incorporated herein by reference. In some embodiments, the
compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00055##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00056##
and pharmaceutically acceptable salts thereof. In some embodiments,
the compositions and methods of the present invention include a
cationic lipid having the compound structure:
##STR00057##
and pharmaceutically acceptable salts thereof.
[0127] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2017/049245, which
is incorporated herein by reference. In some embodiments, the
cationic lipids of the compositions and methods of the present
invention include a compound of one of the following formulas:
##STR00058##
and pharmaceutically acceptable salts thereof. For any one of these
four formulas, R.sub.4 is independently selected from
--(CH.sub.2).sub.nQ and --(CH.sub.2).sub.nCHQR; Q is selected from
the group consisting of --OR, --OH, --O(CH.sub.2).sub.nN(R).sub.2,
--OC(O)R, --CX.sub.3, --CN, --N(R)C(O)R, --N(H)C(O)R,
--N(R)S(O).sub.2R, --N(H)S(O).sub.2R, --N(R)C(O)N(R).sub.2,
--N(H)C(O)N(R).sub.2, --N(H)C(O)N(H)(R), --N(R)C(S)N(R).sub.2,
--N(H)C(S)N(R).sub.2, --N(H)C(S)N(H)(R), and a heterocycle; and n
is 1, 2, or 3. In certain embodiments, the compositions and methods
of the present invention include a cationic lipid having a compound
structure of:
##STR00059##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00060##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00061##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00062##
and pharmaceutically acceptable salts thereof.
[0128] Other suitable cationic lipids for use in the compositions
and methods of the invention include the cationic lipids as
described in International Patent Publication WO 2017/173054 and WO
2015/095340, each of which is incorporated herein by reference. In
certain embodiments, the compositions and methods of the present
invention include a cationic lipid having a compound structure
of:
##STR00063##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00064##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00065##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid having a compound structure of:
##STR00066##
and pharmaceutically acceptable salts thereof.
[0129] Other suitable cationic lipids for use in the compositions
and methods of the invention include cholesterol-based cationic
lipids. In certain embodiments, the compositions and methods of the
present invention include imidazole cholesterol ester or "ICE",
having a compound structure of:
##STR00067##
and pharmaceutically acceptable salts thereof.
[0130] Other suitable cationic lipids for use in the compositions
and methods of the present invention include cleavable cationic
lipids as described in International Patent Publication WO
2012/170889, which is incorporated herein by reference. In some
embodiments, the compositions and methods of the present invention
include a cationic lipid of the following formula:
##STR00068##
wherein R.sub.1 is selected from the group consisting of imidazole,
guanidinium, amino, imine, enamine, an optionally-substituted alkyl
amino (e.g., an alkyl amino such as dimethylamino) and pyridyl;
wherein R.sub.2 is selected from the group consisting of one of the
following two formulas:
##STR00069##
and wherein R.sub.3 and R.sub.4 are each independently selected
from the group consisting of an optionally substituted, variably
saturated or unsaturated C.sub.6-C.sub.20 alkyl and an optionally
substituted, variably saturated or unsaturated C.sub.6-C.sub.20
acyl; and wherein n is zero or any positive integer (e.g., one,
two, three, four, five, six, seven, eight, nine, ten, eleven,
twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen,
nineteen, twenty or more). In certain embodiments, the compositions
and methods of the present invention include a cationic lipid,
"HGT4001", having a compound structure of:
##STR00070##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid, "HGT4002", having a compound structure
of:
##STR00071##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid, "HGT4003", having a compound structure
of:
##STR00072##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid, "HGT&4", having a compound structure
of:
##STR00073##
and pharmaceutically acceptable salts thereof. In certain
embodiments, the compositions and methods of the present invention
include a cationic lipid "HGT4005", having a compound structure
of:
##STR00074##
and pharmaceutically acceptable salts thereof.
[0131] Other suitable cationic lipids for use in the compositions
and methods of the present invention include cleavable cationic
lipids as described in U.S. Provisional Application No. 62/672,194,
filed May 16, 2018, and incorporated herein by reference. In
certain embodiments, the compositions and methods of the present
invention include a cationic lipid that is any of general formulas
or any of structures (1a)-(21a) and (1b)-(21b) and (22)-(237)
described in U.S. Provisional Application No. 62/672,194. In
certain embodiments, the compositions and methods of the present
invention include a cationic lipid that has a structure according
to Formula (I'),
##STR00075##
wherein: [0132] RX is independently --H, -L1-R1, or -L5A-L5B--B';
[0133] each of L1, L2, and L3 is independently a covalent bond,
--C(O)--, --C(O)O--, --C(O)S--, or --C(O)NRL-; [0134] each L4A and
L5A is independently --C(O)--, --C(O)O--, or --C(O)NRL-; [0135]
each L4B and L5B is independently C1-C20 alkylene; C2-C20
alkenylene; or C2-C20 alkynylene; [0136] each B and B' is NR4R5 or
a 5- to 10-membered nitrogen-containing heteroaryl; [0137] each R1,
R2, and R3 is independently C6-C30 alkyl, C6-C30 alkenyl, or C6-C30
alkynyl; [0138] each R4 and R5 is independently hydrogen, C1-C10
alkyl; C2-C10 alkenyl; or C2-C10 alkynyl; and [0139] each RL is
independently hydrogen, C1-C20 alkyl, C2-C20 alkenyl, or C2-C20
alkynyl.
[0140] In certain embodiments, the compositions and methods of the
present invention include a cationic lipid that is Compound (139)
of 62/672,194, having a compound structure of:
##STR00076##
[0141] In some embodiments, the compositions and methods of the
present invention include the cationic lipid,
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride
("DOTMA"). (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987);
U.S. Pat. No. 4,897,355, which is incorporated herein by
reference). Other cationic lipids suitable for the compositions and
methods of the present invention include, for example,
5-carboxyspermylglycinedioctadecylamide ("DOGS");
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanamin-
ium ("DOSPA") (Behr et al. Proc. Nat.'l Acad. Sci. 86, 6982 (1989),
U.S. Pat. Nos. 5,171,678; 5,334,761);
1,2-Dioleoyl-3-Dimethylammonium-Propane ("DODAP");
1,2-Dioleoyl-3-Trimethylammonium-Propane ("DOTAP").
[0142] Additional exemplary cationic lipids suitable for the
compositions and methods of the present invention also include:
1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA");
1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA");
1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA");
1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA");
N-dioleyl-N,N-dimethylammonium chloride ("DODAC");
N,N-distearyl-N,N-dimethylarnrnonium bromide ("DDAB");
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide ("DMRIE");
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-oc-
tadecadienoxy)propane ("CLinDMA");
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy
l-l-(cis,cis-9', l-2'-octadecadienoxy)propane ("CpLinDMA");
N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA");
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP");
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP");
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP");
1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane ("DLinCDAP");
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane
("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,
N-dimethyl-3-[(9Z, 12Z)-octadeca-9, 12-dien-1-yloxy]propane-1-amine
("Octyl-CLinDMA");
(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,
N-dimethyl-3-[(9Z, 12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine
("Octyl-CLinDMA (2R)");
(2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,
fsl-dimethyh3-[(9Z, 12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine
("Octyl-CLinDMA (2S)");
2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane
("DLin-K-XTC2-DMA"); and
2-(2,2-di((9Z,12Z)-octadeca-9,l2-dien-1-yl)-l,3-dioxolan-4-yl)-N,N-di-
methylethanamine ("DLin-KC2-DMA") (see, WO 2010/042877, which is
incorporated herein by reference; Semple et al., Nature Biotech.
28: 172-176 (2010)). (Heyes, J., et al., J Controlled Release 107:
276-287 (2005); Morrissey, D V., et al., Nat. Biotechnol. 23(8):
1003-1007 (2005); International Patent Publication WO 2005/121348).
In some embodiments, one or more of the cationic lipids comprise at
least one of an imidazole, dialkylamino, or guanidinium moiety.
[0143] In some embodiments, one or more cationic lipids suitable
for the compositions and methods of the present invention include
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC");
(3aR,5s,6aS)--N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr-
o-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and/or
4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetr-
aazahexadecane-1,16-diamide ("NC98-5").
[0144] In some embodiments, the compositions of the present
invention include one or more cationic lipids that constitute at
least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
or 70%, measured by weight, of the total lipid content in the
composition, e.g., a lipid nanoparticle. In some embodiments, the
compositions of the present invention include one or more cationic
lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, or 80% measured as a mol %, of the
total lipid content in the composition, e.g., a lipid nanoparticle.
In some embodiments, the compositions of the present invention
include one or more cationic lipids that constitute about 30-70%
(e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%,
about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about
35-40%), measured by weight, of the total lipid content in the
composition, e.g., a lipid nanoparticle. In some embodiments, the
compositions of the present invention include one or more cationic
lipids that constitute about 30-70% (e.g., about 30-65%, about
30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%,
about 35-50%, about 35-45%, or about 35-40%), measured as mol %, of
the total lipid content in the composition, e.g., a lipid
nanoparticle.
[0145] In some embodiments, sterol-based cationic lipids may be use
instead or in addition to cationic lipids described herein.
Suitable sterol-based cationic lipids are dialkylamino-,
imidazole-, and guanidinium-containing sterol-based cationic
lipids. For example, certain embodiments are directed to a
composition comprising one or more sterol-based cationic lipids
comprising an imidazole, for example, the imidazole cholesterol
ester or "ICE" lipid (3S, 10R, 13R, 17R)-10,
13-dimethyl-17-((R)-6-methylheptan-2-yl)-2, 3, 4, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16,
17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl
3-(1H-imidazol-4-yl)propanoate, as represented by structure (I)
below. In certain embodiments, a lipid nanoparticle for delivery of
RNA (e.g., mRNA) encoding a functional protein may comprise one or
more imidazole-based cationic lipids, for example, the imidazole
cholesterol ester or "ICE" lipid (3S, 10R, 13R, 17R)-10,
13-dimethyl-17-((R)-6-methylheptan-2-yl)-2, 3, 4, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16,
17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl
3-(1H-imidazol-4-yl)propanoate, as represented by the following
structure:
##STR00077##
[0146] In some embodiments, the percentage of cationic lipid in a
liposome may be greater than 10%, greater than 20%, greater than
30%, greater than 40%, greater than 50%, greater than 60%, or
greater than 70%. In some embodiments, cationic lipid(s)
constitute(s) about 30-50% (e.g., about 30-45%, about 30-40%, about
35-50%, about 35-45%, or about 35-40%) of the liposome by weight.
In some embodiments, the cationic lipid (e.g., ICE lipid)
constitutes about 30%, about 35%, about 40%, about 45%, about 50%,
about 60%, about 70% or about 80% of the liposome by molar
ratio.
[0147] PEGylated Lipids
[0148] In some embodiments, a suitable lipid solution includes one
or more PEGylated lipids. For example, the use of polyethylene
glycol (PEG)-modified phospholipids and derivatized lipids such as
derivatized ceramides (PEG-CER), including
N-Octanoyl-Sphingosine-1-[Succinyl(Methoxy Polyethylene
Glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the
present invention. Contemplated PEG-modified lipids include, but
are not limited to, a polyethylene glycol chain of up to 5 kDa in
length covalently attached to a lipid with alkyl chain(s) of C6-C20
length. In some embodiments, a PEG-modified or PEGylated lipid is
PEGylated cholesterol or PEG-2K. In some embodiments, particularly
useful exchangeable lipids are PEG-ceramides having shorter acyl
chains (e.g., C.sub.14 or C.sub.18).
[0149] PEG-modified phospholipid and derivatized lipids may
constitute at least 1%, at least 2%, at least 3%, at least 4%, at
least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at
least 10%, at least 15% or at least 20% of the total lipids in the
liposome.
[0150] Non-Cationic/Helper Lipids
[0151] As used herein, the phrase "non-cationic lipid" refers to
any neutral, zwitterionic or anionic lipid. As used herein, the
phrase "anionic lipid" refers to any of a number of lipid species
that carry a net negative charge at a selected pH, such as
physiological pH. Non-cationic lipids include, but are not limited
to, distearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), or a mixture
thereof.
[0152] In some embodiments, non-cationic lipids may constitute at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65% or 70% of the total lipids in a suitable lipid solution by
weight or by molar. In some embodiments, non-cationic lipid(s)
constitute(s) about 20-50% (e.g., about 20-45%, about 20-40%, about
25-50%, about 25-45%, or about 25-40%) of the total lipids in a
suitable lipid solution by weight or by molar percent.
[0153] Cholesterol-Based Lipids
[0154] In some embodiments, a suitable lipid solution includes one
or more cholesterol-based lipids. For example, suitable
cholesterol-based cationic lipids include, for example, DC-Choi
(N,N-dimethyl-N-ethylcarboxamidocholesterol),
1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem.
Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23,
139 (1997); U.S. Pat. No. 5,744,335), or ICE. In some embodiments,
cholesterol-based lipid(s) constitute(s) at least about 1%, 5%,
10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a
suitable lipid solution by weight or by molar. In some embodiments,
cholesterol-based lipid(s) constitute(s) about 20-50% (e.g., about
20-45%, about 20-40%, about 25-50%, about 25-45%, or about 25-40%)
of the total lipids in a suitable lipid solution by weight or by
molar.
[0155] Exemplary combinations of cationic lipids, non-cationic
lipids, cholesterol-based lipids, and PEG-modified lipids are
described in the Examples section. For example, a suitable lipid
solution may contain cKK-E12, DOPE, cholesterol, and DMG-PEG2K;
C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE,
cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and
DMG-PEG2K; cKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200,
DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and
DMG-PEG2K; or HGT5001, DPPC, cholesterol, and DMG-PEG2K. The
selection of cationic lipids, non-cationic lipids and/or
PEG-modified lipids which comprise the lipid mixture as well as the
relative molar ratio of such lipids to each other, is based upon
the characteristics of the selected lipid(s) and the nature of the
and the characteristics of the mRNA to be encapsulated. Additional
considerations include, for example, the saturation of the alkyl
chain, as well as the size, charge, pH, pKa, fusogenicity and
toxicity of the selected lipid(s). Thus, the molar ratios may be
adjusted accordingly.
[0156] Typically, mRNA-loaded lipid nanoparticles make up from 0.1%
to 30% of the total solid content of the spray-drying mixture. In
some embodiments, the total solid content of the mRNA-loaded
nanoparticle compositions to be spray-dried is between 0.5-20%. In
some embodiments, the total solid content of the mRNA-loaded
nanoparticle compositions to be spray-dried is between 2-20%. In
some embodiments, the total solid content of the mRNA-loaded
nanoparticle compositions to be spray-dried is between 2-15%. In
some embodiments, the total solid content of the mRNA-loaded
nanoparticle compositions to be spray-dried is between 2-10%.
[0157] Polymer
[0158] Various polymers may be used in a spray-drying mRNA-LNP
according to the present invention. Typically, suitable polymers
have low toxicity and are well tolerated over a wide range of
concentrations. In some embodiments, suitable polymers are
positively charged. Exemplary polymers include, but are not limited
to, chitosan, polyesters, polyurethanes, polycarbonates,
poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA),
poly(q-caprolactone (PCL), poly amido amines, poly(hydroxyalkyl
L-asparagine), poly(hydroxyalkyl L-glutamine),
poly(2-alkyloxazoline) acrylates, modified acrylates and
methacrylate based polymers,
poly-N-(2-hydroxyl-propyl)methacrylamide,
poly-2-(methacryloyloxy)ethyl phosphorylcholines,
poly(2-(methacryloyloxy)ethyl phosphorylcholine), and
poly(dimethylaminoethyl methylacrylate) (pDMAEMA).
[0159] In some embodiments, a suitable polymer is a
polymethacrylate derivative, comprising repeat units of a monomer
of the following structure,
##STR00078##
wherein, R.sup.1 is independently C.sub.1-C.sub.6 alkyl, L.sup.1 is
independently C.sub.2-C.sub.6 alkylene, each of R.sup.1A and
R.sup.1B is independently C.sub.1-C.sub.6 alkyl, and a is an
integer of 1-500; R.sup.2 is independently C.sub.1-C.sub.6 alkyl,
R.sup.2A is independently C.sub.1-C.sub.6 alkyl, and b is an
integer of 1-500; and R.sup.3 is independently C.sub.1-C.sub.6
alkyl, R.sup.3A is independently C.sub.1-C.sub.6 alkyl, and c is an
integer of 1-500.
[0160] In some embodiments, the repeat units may be represented by
the following,
##STR00079##
wherein each R.sup.4 is independently R.sup.2 or R.sup.3; each
R.sup.4A is independently R.sup.2A or R.sup.3A; and d is an integer
of 1-500. In the above structures, L.sup.1 may be
--CH.sub.2CH.sub.2, and each R.sup.1A and R.sup.1B is methyl;
and/or each R.sup.1, R.sup.2, and R.sup.3 is methyl; and/or
R.sup.2A is butyl and R.sup.3A is methyl.
[0161] In some embodiments, an exemplary member of the polymer is
represented by the formula:
##STR00080##
[0162] An exemplary member of the group is known by the trade name
Eudragit. In some embodiments of the present invention, the polymer
that is included in the spray-dried mRNA-LNP formulation is a
Eudragit polymer. Eudragit forms a class of amorphous polymers or
copolymers are derived from esters of acrylic and methacrylic acid,
whose properties are determined by the functional groups. The
individual Eudragit grades differ in their proportion of neutral,
alkaline or acid groups and thus in terms of physicochemical
properties. Some available forms are anionic, some are cationic,
some are neutral. In some embodiments, polymers of this type used
with mRNA-LNP complex for spray-drying have positively charged
tertiary amine group with methacrylic back bone. They may form
complex with mRNA and encapsulate it. They have a higher Tg and
excellent thermoplastic properties which assist in spray drying.
These polymers are insoluble at higher pH and in surfactants
therefore may assist protecting mRNA from degradation. Eudragit
polymers have been approved by the Food and Drug Authority of the
United States of America (FDA) for oral use and have been used in
commercial oral products for decades. These polymers have low
toxicity and are well tolerated over a range of concentrations.
[0163] In some embodiments, the polymer used comprises the class of
Eudragit that is insoluble at pH 5 and above. In some embodiments,
this property of the polymer is used for oral delivery of the
active mRNA ingredient such that the mRNA is not released in the
saliva. One advantage of these polymers is that they powerfully
mask the taste and odor of the active ingredients and other
excipients because the functional polymer is insoluble in the
mouth.
[0164] Therefore, in some embodiments, these methacrylic acid
derivative polymers described above are used for preparing a
formulation for stable spray-dried mRNA-LNP dry powder. In some
embodiments, these methacrylic acid derivative polymers are used
for sustained release of the mRNA. In some embodiments, the
methacrylic acid derivative polymers insoluble at pH .gtoreq.5 are
used for delivery of the suitable mRNA to the gastrointestinal
tract (GI). In some embodiments, the methacrylic acid derivative
polymers are used for delivery of a suitable mRNA to the colon.
[0165] In some embodiments, the polymer constitutes less than 90%,
80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6% or
5% of the total weight of dry powder. In some embodiments, the
polymer constitutes from 1% to 60% of the total weight of dry
powder. In some embodiments, the polymer constitutes about 1-90%,
10-90%, 20-90%, 10-50%, 1-20%, 2-15%, 3-12%, 1-10%, 2-9%, 3-8%,
1-7%, 2-6% or 3-5% of the total weight of dry powder.
[0166] Other Excipients
[0167] In some embodiments, sugars and other excipients are added
to the mRNA-loaded nanoparticles and polymer mixture before spray
drying.
[0168] Sugars
[0169] Various sugars may be added to the mixture prior to spray
drying. It is contemplated that sugars provide stabilization during
dehydration. Exemplary sugars suitable for the formulation are
monosaccharides, disaccharides and polysaccharides, selected from a
group consisting of glucose, fructose, galactose, mannose, sorbose,
lactose, sucrose, cellobiose, trehalose, raffinose, starch,
dextran, maltodextrin, cyclodextrins, inulin, xylitol, sorbitol,
lactitol, and mannitol.
[0170] In some embodiments, a suitable sugar is lactose and/or
mannitol. In some embodiments, a suitable sugar is mannitol. In
some embodiments, the mannitol is added at a concentration of about
1-10%. In some embodiments, the mannitol is added at a
concentration of about 2-10%. In some embodiments, the mannitol is
added at a concentration of about 3-10%. In some embodiments, the
mannitol is added at a concentration of about 4-10%. In some
embodiments, the mannitol is added at a concentration of about
5-10%.
[0171] In some embodiments, a suitable sugar is trehalose. In some
embodiments, both mannitol and trehalose are added.
[0172] Surfactants
[0173] In some embodiments, surfactants are used as an excipient.
Surfactants increase the surface tension of a composition. In some
embodiments, the surfactants used in spray-drying mRNA lipid
compositions are selected from a group consisting of CHAPS
(3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate),
phospholipids, phosphatidylserine, phosphatidylethanolamine,
phosphatidylcholine, sphingomyelins, octaethylene glycol
monododecyl ether, pentaethylene glycol monododecyl ether, Triton
X-100, Cocamide monoethanolamine, Cocamide diethanolamine, Glycerol
monostearate, Glycerol monolaurate, Sorbitan moonolaureate,
Sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80,
Alkyl polyglucosides, and poloxamers. In some embodiments, the
surfactant used is poloxamer.
[0174] Various other excipients may be included in the spray-drying
formulations. These include but are not limited to various
Polyesters, Polyurethanes, Poly (ester amide), Poly (ortho esters),
Polyanhydrides, Poly (anhydride-co-imide), Polyphosphoesters,
Polyphosphazenes, Amino acids, Collagen, Chitosan, Cyclodextrins,
Polysaccharides, Maltodextrin, Albumin, various sugars,
surfactants, buffers and salts.
Dry Powders
[0175] Dry powders prepared according to the present invention
contain a plurality of spray-dried particles. Residual moisture
content, aerosol performance and physio-chemical stability are
important parameters for spray-dried pharmaceutical products. It is
determined by the sample weight loss after heating and drying,
using the equation:
Moisture content %=[(SW.sub.b-SW.sub.a)/SW.sub.b].times.100%,
[0176] wherein, SW.sub.b is the sample weight before heating and
SW.sub.a is the sample weight after heating. Perkin Elmer TGA 7
(Perkin Elmer) is an example of commercially used instrument with
associated software for the measurement of residual moisture in a
nanoparticle.
[0177] In general, an admissible range of particle size
distribution is maintained for uniformity of dosing of an active
pharmaceutical ingredient of the formulation. For pulmonary
delivery in particular, the particles of the dry powder formulation
affect distribution and deposition of an aerosol within the
respiratory system. In many cases, particle deposition to the large
conducting airways is preferred for effective absorption and
distribution of the therapeutic component. Aerosol of very fine
particles, for instance, particles having less than 1 micrometer
diameter may be deposited peripherally for effective absorption by
specific cells of the lung, such as smooth muscles for an active
pharmaceutical ingredient functioning as bronchodilator.
[0178] Primary particle size distributions of spray-dried particles
are measured by dynamic light scattering, which is expressed in
terms of Z-average. The Z-average is the mean, also known as the
cumulant size, calculated from the intensity-weighted distribution
of particle diameter and is given by the formula,
D.sub.z=.SIGMA.S.sub.i/.SIGMA.(S.sub.i/D.sub.i), where, S.sub.i is
the scattered intensity from the particle `i`, and D.sub.i is the
particle's diameter. In addition to these parameters, a fine and a
course fraction of the particles is defined.
[0179] Polydispersity index (PDI), on the other hand is the measure
of the distribution of molecular mass of a given particulate
sample.
[0180] Zeta potential is a measure of the magnitude of the
electrostatic or charge repulsion/attraction between particles and
is one of the fundamental parameters known to affect stability. Its
measurement brings detailed insight into the causes of dispersion,
aggregation or flocculation, and can be applied to improve the
formulation of dispersions, emulsions and suspensions. The ZP
indicates the degree of repulsion between close and similarly
charged particles in the dispersion. High ZP indicates highly
charged particles. Generally, high ZP (negative or positive)
prevents aggregation of the particles due to electric repulsion and
electrically stabilizes the nanoparticle dispersion. On the other
hand, in case of low ZP, attraction exceeds repulsion and the
dispersion coagulates or flocculates. Zeta potential can be
measured by photon correlation spectroscopy using available
equipment systems, for example, Zetasizer Nano (Malvern
Instruments).
[0181] Sphericity of a nanoparticle is a measure of how closely a
particle reassembles a sphere. It can be measured by Waddell's
equation, denoted by .PSI. is determined as:
surface .times. .times. area .times. .times. of .times. .times. a
.times. .times. sphere .times. .times. having .times. .times. a
same .times. .times. volume .times. .times. of .times. .times. a
.times. .times. given .times. .times. particle surface .times.
.times. area .times. .times. of .times. .times. the .times. .times.
particle ##EQU00001##
The size distribution as well as shape or sphericity of the
spray-dried mRNA-lipid formulation is measurable by scanning
electron microcopy (SEM), transmission electron microscope or a by
change in electrical resistance imposed by a particle in a fluid by
a Coulter counter.
[0182] Lastly, the content and/or integrity of the mRNA is assessed
by HPLC, or northern blot analysis. In some embodiments, mass
spectrometry and other related spectrophotochemical analysis are
carried on for the stability, integrity and quality assessment of
the mRNA-nanoparticle formulation.
[0183] Spray-dried mRNA lipid nanoparticles of the present
invention contain less than 10% of moisture (w/w). In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 9% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 8% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 7% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 6% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 5% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 4% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 3% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 2% of moisture. In some
embodiments, the spray-dried mRNA lipid nanoparticles of the
invention may retain less than about 1% of moisture. In some
embodiments the moisture content of the spray-dried mRNA-LNP
formulation is less than 5%.
[0184] Provided herein are spray-dried mRNA LNP formulations,
wherein the mRNA lipid nanoparticles are heterogeneous in size,
with fine fraction (fnfr) less than 10 .mu.m. In some embodiments,
the fnfr of the mRNA-LNP dry-powder particles of the invention
ranges between 1-10 .mu.m. An optimum Z-average for an mRNA-LNP
spray-dried sample could be .ltoreq.10 .mu.m. In some embodiments,
the Z-average of the mRNA-LNP spray-dried sample is .ltoreq.8
.mu.m. In some embodiments, the Z-average of the mRNA-LNP
spray-dried sample is .ltoreq.5 .mu.m. In some embodiments, the
Z-average of the mRNA-LNP spray-dried sample should be within a
range of 0.01-10 .mu.m. In some embodiments, the Z-average of the
mRNA-LNP spray-dried sample should be within a range of 0.1-10
.mu.m. In some embodiments, the Z-average of the mRNA-LNP
spray-dried sample should be within a range of 0.1-5 .mu.m. In some
embodiments, the Z-average of the mRNA-LNP spray-dried sample
should be within a range of 0.1-3 .mu.m. In some embodiments, the
Z-average of the mRNA-LNP spray-dried sample should be within a
range of 0.1-5 .mu.m.
[0185] In some embodiments, the mRNA-lipid nanoparticles comprise a
Z-average of less than 200 nm before spray-drying. In some
embodiments, the mRNA-lipid nanoparticles comprise a Z-average of
less than 180 nm before spray-drying. In some embodiments, the
mRNA-lipid nanoparticles comprise a Z-average of less than 150 nm
before spray-drying. In some embodiments, the mRNA-lipid
nanoparticles comprise a Z-average of less than 120 nm before
spray-drying. In some embodiments, the mRNA-lipid nanoparticles
comprise a Z-average of less than 100 nm before spray-drying. In
some embodiments, the mRNA-lipid nanoparticles comprise a Z-average
of less than 50 nm before spray-drying.
[0186] In some embodiments, mRNA-lipid nanoparticles comprise a
Z-average of less than 5000 nm after spray-drying. In some
embodiments, mRNA-lipid nanoparticles comprise a Z-average of less
than 4000 nm after spray-drying. In some embodiments, mRNA-lipid
nanoparticles comprise a Z-average of less than 3000 nm after
spray-drying. In some embodiments, mRNA-lipid nanoparticles
comprise a Z-average of less than 2000 nm after spray-drying. In
some embodiments, mRNA-lipid nanoparticles comprise a Z-average of
less than 1000 nm after spray-drying. In some embodiments,
mRNA-lipid nanoparticles comprise a Z-average of less than 500 nm
after spray-drying. In some embodiments, mRNA-lipid nanoparticles
comprise a Z-average of less than 500 nm after spray-drying. In
some embodiments, mRNA-lipid nanoparticles comprise a Z-average of
less than 300 nm after spray-drying. In some embodiments,
mRNA-lipid nanoparticles comprise a Z-average of less than 200 nm
after spray-drying. In some embodiments, mRNA-lipid nanoparticles
comprise a Z-average of less than 100 nm after spray-drying. In
some embodiments, mRNA-lipid nanoparticles comprise a Z-average of
less than 50 nm after spray-drying. In some embodiments, mRNA-lipid
nanoparticles comprise a Z-average of less than 10 nm after
spray-drying.
[0187] Provided herein are dry-powder formulations of mRNA-LNP,
wherein the average sphericity of the mRNA-LNP particle ranges from
0.7 to 1. In some embodiments, the average sphericity of mRNA lipid
nanoparticles is greater than 0.7, or greater than 0.8, or greater
than 0.9.
[0188] In some embodiments, the Zeta potential value for the
nanoparticles for present application is between +30 mV and -30 mV.
In some embodiments, the Zeta potential value for the nanoparticles
is between +20 mV and -30 mV. In some embodiments, the Zeta
potential value for the nanoparticles is between +10 mV and -30 mV.
In some embodiments, the Zeta potential value for the nanoparticles
is between 0 mV and -30 mV. In some embodiments, the Zeta potential
value for the nanoparticles is between -10 mV and -30 mV. In some
embodiments, the Zeta potential value for the nanoparticles is
between -20 mV and -30 mV. In some embodiments, the Zeta potential
value for the nanoparticles is between +20 mV and -30 mV. In some
embodiments, the Zeta potential value for the nanoparticles is
between -20 mV and -30 mV. In some embodiments, the Zeta potential
value for the nanoparticles is about -30 mV, and a polydispersity
index of less than, about 0.3.
[0189] In some embodiments, provided dry-powder formulations of
mRNA-LNP contain mRNA up to 30%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%,
4%, 3%, or 2% of the total weight of dry powder. In some
embodiments, the mRNA constitutes 1-6%, 1-5%, 1-4%, 1-3%, 2-10%,
2-9%, 2-8%, 2-7%, 2-6%, 2-5%, 2-10%, 2-15%, 2-20%, 2-30% of the
total weight of dry powder.
[0190] Stability
[0191] Provided are spray-dried mRNA-LNP formulations that are
stable when stored under various conditions. As used herein, the
term "stable" refers to mRNA retaining integrity of greater than
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% after storage.
In some embodiments, mRNA-LNP dry powder formulations provided
herein are stable when stored under frozen condition (-20.degree.
C.), at 4.degree. C. or at room temperature for greater than one
year. In some embodiments, mRNA-LNP dry powder formulations
provided herein are stable when stored under frozen condition
(-20.degree. C.), at 4.degree. C. or at room temperature for
greater than 11 months. In some embodiments, mRNA-LNP dry powder
formulations provided herein are stable when stored under frozen
condition (-20.degree. C.), at 4.degree. C. or at room temperature
for greater than 10 months. In some embodiments, mRNA-LNP dry
powder formulations provided herein are stable when stored under
frozen condition (-20.degree. C.), at 4.degree. C. or at room
temperature for greater than 9 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 8 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 7 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 6 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 5 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 4 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 3 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 2 months. In some embodiments,
mRNA-LNP dry powder formulations provided herein are stable when
stored under frozen condition (-20.degree. C.), at 4.degree. C. or
at room temperature for greater than 1 month.
[0192] In some embodiments, mRNA-LNP dry powder formulations
provided herein are stable when stored under frozen condition
(-20.degree. C.), at 4.degree. C. or at room temperature for
greater than 8 weeks. In some embodiments, mRNA-LNP dry powder
formulations provided herein are stable when stored under frozen
condition (-20.degree. C.), at 4.degree. C. or at room temperature
for greater than 7 weeks. In some embodiments, mRNA-LNP dry powder
formulations provided herein are stable when stored under frozen
condition (-20.degree. C.), at 4.degree. C. or at room temperature
for greater than 6 weeks. In some embodiments, mRNA-LNP dry powder
formulations provided herein are stable when stored under frozen
condition (-20.degree. C.), at 4.degree. C. or at room temperature
for greater than 5 weeks. In some embodiments, mRNA-LNP dry powder
formulations provided herein are stable when stored under frozen
condition (-20.degree. C.), at 4.degree. C. or at room temperature
for greater than 4 weeks.
Messenger RNA
[0193] The present invention may be used to formulate any mRNA. As
used herein, mRNA is the type of RNA that carries information from
DNA to the ribosome for translation of the encoded protein. mRNAs
may be synthesized according to any of a variety of known methods.
For example, mRNAs according to the present invention may be
synthesized via in vitro transcription (IVT). Briefly, IVT is
typically performed with a linear or circular DNA template
containing a promoter, a pool of ribonucleotide triphosphates, a
buffer system that may include DTT and magnesium ions, and an
appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase),
DNAse I, pyrophosphatase, and/or RNAse inhibitor. The exact
conditions will vary according to the specific application.
[0194] The present invention may be used to formulate mRNAs of a
variety of lengths. In some embodiments, the present invention may
be used to deliver in vitro synthesized mRNA of or greater than
about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb
6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb,
or 20 kb in length. In some embodiments, the present invention may
be used to deliver in vitro synthesized mRNA ranging from about
1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15
kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb
in length.
[0195] The present invention may be used to formulate mRNA that is
unmodified or mRNA containing one or more modifications that
typically enhance stability. In some embodiments, modifications are
selected from modified nucleotides, modified sugar phosphate
backbones, and 5' and/or 3' untranslated region (UTR).
[0196] In some embodiments, modifications of mRNA may include
modifications of the nucleotides of the RNA. A modified mRNA
according to the invention can include, for example, backbone
modifications, sugar modifications or base modifications. In some
embodiments, mRNAs may be synthesized from naturally occurring
nucleotides and/or nucleotide analogues (modified nucleotides)
including, but not limited to, purines (adenine (A), guanine (G))
or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as
modified nucleotides analogues or derivatives of purines and
pyrimidines, such as e.g. 1-methyl-adenine, 2-methyl-adenine,
2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine,
N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine,
4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine,
1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine,
7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil
(5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil,
5-carboxymethylaminomethyl-2-thio-uracil,
5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil,
5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil,
5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester,
5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil,
5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil,
uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v),
1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine,
wybutoxosine, and phosphoramidates, phosphorothioates, peptide
nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine
and inosine. The preparation of such analogues is known to a person
skilled in the art e.g. from the U.S. Pat. Nos. 4,373,071,
4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679,
5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, the
disclosure of which is included here in its full scope by
reference.
[0197] In some embodiments, mRNAs may contain RNA backbone
modifications. Typically, a backbone modification is a modification
in which the phosphates of the backbone of the nucleotides
contained in the RNA are modified chemically. Exemplary backbone
modifications typically include, but are not limited to,
modifications from the group consisting of methylphosphonates,
methylphosphoramidates, phosphoramidates, phosphorothioates (e.g.
cytidine 5'-O-(1-thiophosphate)), boranophosphates, positively
charged guanidinium groups etc., which means by replacing the
phosphodiester linkage by other anionic, cationic or neutral
groups.
[0198] In some embodiments, mRNAs may contain sugar modifications.
A typical sugar modification is a chemical modification of the
sugar of the nucleotides it contains including, but not limited to,
sugar modifications chosen from the group consisting of
2'-deoxy-2'-fluoro-oligoribonucleotide (2'-fluoro-2'-deoxycytidine
5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate),
2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine
5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate),
2'-O-alkyloligoribonucleotide,
2'-deoxy-2'-C-alkyloligoribonucleotide (2'-O-methylcytidine
5'-triphosphate, 2'-methyluridine 5'-triphosphate),
2'-C-alkyloligoribonucleotide, and isomers thereof (2'-aracytidine
5'-triphosphate, 2'-arauridine 5'-triphosphate), or
azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate,
2'-azido-2'-deoxyuridine 5'-triphosphate).
[0199] In some embodiments, mRNAs may contain modifications of the
bases of the nucleotides (base modifications). A modified
nucleotide which contains a base modification is also called a
base-modified nucleotide. Examples of such base-modified
nucleotides include, but are not limited to, 2-amino-6-chloropurine
riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate,
2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate,
4-thiouridine 5'-triphosphate, 5-aminoallylcytidine
5'-triphosphate, 5-aminoallyluridine 5'-triphosphate,
5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate,
5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate,
5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate,
6-azacytidine 5'-triphosphate, 6-azauridine 5'-triphosphate,
6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine
5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine
5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole
riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate,
N1-methylguanosine 5'-triphosphate, N6-methyladenosine
5'-triphosphate, 06-methylguanosine 5'-triphosphate, pseudouridine
5'-triphosphate, puromycin 5'-triphosphate or xanthosine
5'-triphosphate.
[0200] Typically, mRNA synthesis includes the addition of a "cap"
on the 5' end, and a "tail" on the 3' end. The presence of the cap
is important in providing resistance to nucleases found in most
eukaryotic cells. The presence of a "tail" serves to protect the
mRNA from exonuclease degradation.
[0201] Thus, in some embodiments, mRNAs include a 5' cap structure.
A 5' cap is typically added as follows: first, an RNA terminal
phosphatase removes one of the terminal phosphate groups from the
5' nucleotide, leaving two terminal phosphates; guanosine
triphosphate (GTP) is then added to the terminal phosphates via a
guanylyl transferase, producing a 5'-5' inverted triphosphate
linkage; and the 7-nitrogen of guanine is then methylated by a
methyltransferase. 2'-O-methylation may also occur at the first
base and/or second base following the 7-methyl guanosine
triphosphate residues. Examples of cap structures include, but are
not limited to, m7GpppNp-RNA, m7GpppNmp-RNA and m7GpppNmpNmp-RNA
(where m indicates 2'-O-methyl residues).
[0202] In some embodiments, mRNAs include a 3' tail structure.
Typically, a tail structure includes a poly(A) and/or poly(C) tail.
A poly-A or poly-C tail on the 3' terminus of mRNA typically
includes at least 50 adenosine or cytosine nucleotides, at least
150 adenosine or cytosine nucleotides, at least 200 adenosine or
cytosine nucleotides, at least 250 adenosine or cytosine
nucleotides, at least 300 adenosine or cytosine nucleotides, at
least 350 adenosine or cytosine nucleotides, at least 400 adenosine
or cytosine nucleotides, at least 450 adenosine or cytosine
nucleotides, at least 500 adenosine or cytosine nucleotides, at
least 550 adenosine or cytosine nucleotides, at least 600 adenosine
or cytosine nucleotides, at least 650 adenosine or cytosine
nucleotides, at least 700 adenosine or cytosine nucleotides, at
least 750 adenosine or cytosine nucleotides, at least 800 adenosine
or cytosine nucleotides, at least 850 adenosine or cytosine
nucleotides, at least 900 adenosine or cytosine nucleotides, at
least 950 adenosine or cytosine nucleotides, or at least 1 kb
adenosine or cytosine nucleotides, respectively. In some
embodiments, a poly-A or poly-C tail may be about 10 to 800
adenosine or cytosine nucleotides (e.g., about 10 to 200 adenosine
or cytosine nucleotides, about 10 to 300 adenosine or cytosine
nucleotides, about 10 to 400 adenosine or cytosine nucleotides,
about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550
adenosine or cytosine nucleotides, about 10 to 600 adenosine or
cytosine nucleotides, about 50 to 600 adenosine or cytosine
nucleotides, about 100 to 600 adenosine or cytosine nucleotides,
about 150 to 600 adenosine or cytosine nucleotides, about 200 to
600 adenosine or cytosine nucleotides, about 250 to 600 adenosine
or cytosine nucleotides, about 300 to 600 adenosine or cytosine
nucleotides, about 350 to 600 adenosine or cytosine nucleotides,
about 400 to 600 adenosine or cytosine nucleotides, about 450 to
600 adenosine or cytosine nucleotides, about 500 to 600 adenosine
or cytosine nucleotides, about 10 to 150 adenosine or cytosine
nucleotides, about 10 to 100 adenosine or cytosine nucleotides,
about 20 to 70 adenosine or cytosine nucleotides, or about 20 to 60
adenosine or cytosine nucleotides) respectively. In some
embodiments, a tail structure includes is a combination of poly(A)
and poly(C) tails with various lengths described herein. In some
embodiments, a tail structure includes at least 50%, 55%, 65%, 70%,
75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine
nucleotides. In some embodiments, a tail structure includes at
least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%,
97%, 98%, or 99% cytosine nucleotides.
[0203] In some embodiments, mRNAs include a 5' and/or 3'
untranslated region. In some embodiments, a 5' untranslated region
includes one or more elements that affect an mRNA's stability or
translation, for example, an iron responsive element.
[0204] In some embodiments, a 3' untranslated region includes one
or more of a polyadenylation signal, a binding site for proteins
that affect an mRNA's stability of location in a cell, or one or
more binding sites for miRNAs.
[0205] Exemplary 5' and/or 3' UTR sequences can be derived from
mRNA molecules which are stable (e.g., globin, actin, GAPDH,
tubulin, histone, or citric acid cycle enzymes) to increase the
stability of the sense mRNA molecule. For example, a 5' UTR
sequence may include a partial sequence of a CMV immediate-early 1
(IE1) gene, or a fragment thereof to improve the nuclease
resistance and/or improve the half-life of the polynucleotide. Also
contemplated is the inclusion of a sequence encoding human growth
hormone (hGH), or a fragment thereof to the 3' end or untranslated
region of the polynucleotide (e.g., mRNA) to further stabilize the
polynucleotide. Generally, these modifications improve the
stability and/or pharmacokinetic properties (e.g., half-life) of
the polynucleotide relative to their unmodified counterparts, and
include, for example modifications made to improve such
polynucleotides' resistance to in vivo nuclease digestion.
[0206] An mRNA construct design can be designated as X-Coding
Sequence-Y. Exemplary X and Y nucleotide sequences are as
follows:
TABLE-US-00001 X (5' UTR Sequence) = (SEQ ID NO: 1)
GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAG
ACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGC
GGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG Y (3' UTR Sequence) = (SEQ
ID NO: 2) CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAG
UUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC AAGCU OR (SEQ ID
NO: 3) GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGU
UGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCA AAGCU
[0207] While mRNA provided from in vitro transcription reactions
may be desirable in some embodiments, other sources of mRNA are
contemplated as within the scope of the invention including mRNA
produced from bacteria, fungi, plants, and/or animals.
[0208] In some embodiments, a suitable mRNA sequence is an mRNA
sequence encoding a human cystic fibrosis transmembrane receptor,
the Cystic Fibrosis Transmembrane Conductance Regulator CFTR
(hCFTR) protein. In some embodiments, a suitable mRNA sequence is
codon optimized for efficient expression human cells. A detailed
description embodying the preparation and optimization of CFTR mRNA
for therapeutic delivery is described in U.S. patent application
Ser. No. 15/981,757, filed May 16, 2018, the disclosure of which is
hereby incorporated in its entirety.
Pharmaceutical Formulations and Therapeutic Uses
[0209] Pharmaceutical compositions of the dry powder formulations
of the present invention may be used in various therapeutic
applications. To facilitate delivery in vivo, the dry powder
formulations as described herein may be combined with one or more
additional pharmaceutical carriers, targeting ligands or
stabilizing reagents. In some embodiments, one or more additional
pharmaceutical carriers may be added to the formulation prior to
spray-drying. In some embodiments, one or more additional
pharmaceutical carriers may be added to the formulation using
post-insertion techniques into dry powder formulation (i.e.,
following spray drying). Techniques for formulation and
administration of drugs may be found in "Remington's Pharmaceutical
Sciences," Mack Publishing Co., Easton, Pa., latest edition.
[0210] The dry powder formulations described herein can be
administered in vivo in powder form, or alternatively, following
reconstitution. Suitable routes of administration for the
formulations described herein include, oral, rectal, vaginal,
transmucosal, pulmonary including intratracheal or inhaled, or
intestinal administration; parenteral delivery, including
intradermal, transdermal (topical), intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intraperitoneal, or intranasal. In
particular embodiments, the intramuscular administration is to a
muscle selected from the group consisting of skeletal muscle,
smooth muscle and cardiac muscle. In some embodiments the
administration results in delivery of the nucleic acids to a muscle
cell. In some embodiments the administration results in delivery of
the nucleic acids to a hepatocyte (i.e., liver cell).
[0211] The pharmaceutical formulations of the invention may be
administered in a local rather than systemic manner, for example,
via injection of the pharmaceutical formulation directly into a
targeted tissue, preferably in a sustained release formulation.
Local delivery can be affected in various ways, depending on the
tissue to be targeted. Exemplary tissues in which delivered mRNA
may be delivered and/or expressed include, but are not limited to
the lungs, liver, kidney, heart, spleen, serum, brain, skeletal
muscle, lymph nodes, skin, and/or cerebrospinal fluid. In
embodiments, the tissue to be targeted in the liver. For example,
aerosols containing compositions of the present invention can be
inhaled (for nasal, tracheal, or bronchial delivery). In some
embodiments, compositions of the present invention can be delivered
using a metered dose inhaler. In some embodiments, compositions of
the present invention can be reconstituted and nebulized for
delivery. In some embodiments, compositions of the present
invention can be injected into the site of injury, disease
manifestation, or pain. In some embodiments, compositions of the
present invention can be provided in lozenges for oral, tracheal,
or esophageal applications. In some embodiments, compositions of
the present invention can be supplied in liquid, tablet or capsule
form for administration to the stomach or intestines. In some
embodiments, compositions of the present invention can be supplied
in suppository form for rectal or vaginal application. In some
embodiments, compositions of the present invention can be delivered
to the eye by use of creams, drops, or even injection.
[0212] In some embodiments, a dry powder formulation of the present
invention is reconstituted into a liquid solution and nebulized for
delivery. Nebulization can be achieved by any nebulizer known in
the art. A nebulizer transforms a liquid to a mist so that it can
be inhaled more easily into the lungs. Nebulizers are effective for
infants, children and adults. Nebulizers are able to nebulize large
doses of inhaled medications. Typically, a nebulizer for use with
the invention comprises a mouthpiece that is detachable.
[0213] In some embodiments, dry powder formulations as described
herein may be used to deliver a therapeutically effective amount of
mRNA for the treatment of various diseases or disorders. For
example, the dry powder formulation prepared by spray-drying
according to the present invention can be administered for
treatment of a lung-related disorder, such as cystic fibrosis, via
oral, nasal, tracheal, or pulmonary or routes. In some embodiments,
the dry powder formulation is administered by inhalation. In some
embodiments, the formulation is administered by a metered-dose
inhaler. In some embodiments, the dry powder formulation is
administered by intranasal spray. In some embodiments, the dry
powder formulation is rehydrated and administered as intravenous
infusions, injections, oral drops, nasal drops and any other
applications as easily conceivable by one of ordinary skill in the
art.
[0214] The present invention may be used to treat various other
lung-related diseases, disorders and conditions. In some
embodiments, the present invention of stable dry powder formulation
is useful in treating one or more of asthma; COPD; emphysema;
primary ciliary dyskinesia (CILD1) with or without situs inversus,
or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube
syndrome; hereditary hemorrhagic telangiectasia; alpha-1
antitrypsin deficiency; Cytochrome b positive granulomatous
diseases (CGD, X-lined); Cytochrome b positive granulomatous
diseases, autosomal recessive; surfactant deficiency diseases,
Pulmonary Surfactant Metabolism Dysfunction 1, Pulmonary Surfactant
Metabolism Dysfunction 2, Pulmonary Surfactant Metabolism
Dysfunction 3; Respiratory distress syndrome of prematurity;
tuberculous tuberculosis, lung viral diseases, including influenza,
and Respiratory Syncytial Virus (RSV).
[0215] Accordingly, in certain embodiments, the present invention
provides a method for producing a dry powder composition comprising
full-length mRNA that encodes a peptide or polypeptide for use in
the delivery to or treatment of the lung of a subject or a lung
cell. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for cystic fibrosis transmembrane conductance
regulator (CFTR) protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for ATP-binding cassette
sub-family A member 3 protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for dynein axonemal
intermediate chain 1 protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for dynein axonemal heavy
chain 5 (DNAH5) protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for alpha-1-antitrypsin
protein. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for forkhead box P3 (FOXP3) protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes one
or more surfactant protein, e.g., one or more of surfactant A
protein, surfactant B protein, surfactant C protein, and surfactant
D protein.
[0216] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the liver of a subject or a liver cell. Such
peptides and polypeptides can include those associated with a urea
cycle disorder, associated with a lysosomal storage disorder, with
a glycogen storage disorder, associated with an amino acid
metabolism disorder, associated with a lipid metabolism or fibrotic
disorder, associated with methylmalonic acidemia, or associated
with any other metabolic disorder for which delivery to or
treatment of the liver or a liver cell with enriched full-length
mRNA provides dry powder benefit.
[0217] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with a urea cycle
disorder. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for ornithine transcarbamylase (OTC) protein. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for arginosuccinate synthetase 1 protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
carbamoyl phosphate synthetase I protein. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for
arginosuccinate lyase protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for arginase protein.
[0218] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with a lysosomal storage
disorder. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for alpha galactosidase protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
glucocerebrosidase protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for iduronate-2-sulfatase
protein. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for iduronidase protein. In certain embodiments,
the present invention provides a method for producing a therapeutic
composition having full-length mRNA that encodes for
N-acetyl-alpha-D-glucosaminidase protein. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for heparan
N-sulfatase protein. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for galactosamine-6 sulfatase
protein. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for beta-galactosidase protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
lysosomal lipase protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for arylsulfatase B
(N-acetylgalactosamine-4-sulfatase) protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
transcription factor EB (TFEB).
[0219] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with a glycogen storage
disorder. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for acid alpha-glucosidase protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
glucose-6-phosphatase (G6PC) protein. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for liver glycogen
phosphorylase protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for muscle phosphoglycerate
mutase protein. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for glycogen debranching enzyme.
[0220] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with amino acid
metabolism. In certain embodiments, the present invention provides
a method for producing a dry powder composition having full-length
mRNA that encodes for phenylalanine hydroxylase enzyme. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
glutaryl-CoA dehydrogenase enzyme. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for propionyl-CoA
caboxylase enzyme. In certain embodiments the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for oxalase alanine-glyoxylate
aminotransferase enzyme.
[0221] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with a lipid metabolism
or fibrotic disorder. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for a mTOR inhibitor. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
ATPase phospholipid transporting 8B1 (ATP8B1) protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
one or more NF-kappa B inhibitors, such as one or more of I-kappa B
alpha, interferon-related development regulator 1 (IFRD1), and
Sirtuin 1 (SIRT1). In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for PPAR-gamma protein or an active
variant.
[0222] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein associated with methylmalonic
acidemia. For example, in certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for methylmalonyl CoA mutase
protein. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for methylmalonyl CoA epimerase protein.
[0223] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA for which delivery to or treatment of the liver can provide
dry powder benefit. In certain embodiments the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for ATP7B protein, also known as
Wilson disease protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for porphobilinogen deaminase
enzyme. In certain embodiments the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for one or clotting enzymes, such as Factor VIII,
Factor IX, Factor VII, and Factor X. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for human
hemochromatosis (HFE) protein.
[0224] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the cardiovasculature of a subject or a
cardiovascular cell. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for vascular endothelial growth
factor A protein. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for relaxin protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
bone morphogenetic protein-9 protein. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for bone
morphogenetic protein-2 receptor protein.
[0225] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the muscle of a subject or a muscle cell. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for dystrophin protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for frataxin protein. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes a peptide or polypeptide for use in the delivery to or
treatment of the cardiac muscle of a subject or a cardiac muscle
cell. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for a protein that modulates one or both of a
potassium channel and a sodium channel in muscle tissue or in a
muscle cell. In certain embodiments, the present invention provides
a method for producing a dry powder composition having full-length
mRNA that encodes for a protein that modulates a Kv7.1 channel in
muscle tissue or in a muscle cell. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for a protein that
modulates a Nav1.5 channel in muscle tissue or in a muscle
cell.
[0226] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the nervous system of a subject or a nervous
system cell. For example, in certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for survival motor neuron 1
protein. For example, in certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for survival motor neuron 2 protein.
In certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for frataxin protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for ATP binding cassette
subfamily D member 1 (ABCD1) protein. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for CLN3
protein.
[0227] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the blood or bone marrow of a subject or a blood
or bone marrow cell. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for beta globin protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
Bruton's tyrosine kinase protein. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for one or
clotting enzymes, such as Factor VIII, Factor IX, Factor VII, and
Factor X.
[0228] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the kidney of a subject or a kidney cell. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for collagen type IV alpha 5 chain (COL4A5) protein.
[0229] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
to or treatment of the eye of a subject or an eye cell. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
ATP-binding cassette sub-family A member 4 (ABCA4) protein. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for retinoschisin protein. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for retinal
pigment epithelium-specific 65 kDa (RPE65) protein. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
centrosomal protein of 290 kDa (CEP290).
[0230] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes a peptide or polypeptide for use in the delivery
of or treatment with a vaccine for a subject or a cell of a
subject. For example, in certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for an antigen from an infectious
agent, such as a virus. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for an antigen from influenza
virus. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an antigen from respiratory syncytial virus.
In certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for an antigen from rabies virus. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antigen
from cytomegalovirus. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for an antigen from rotavirus. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for an antigen from a hepatitis virus, such as hepatitis A
virus, hepatitis B virus, or hepatitis C virus. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
an antigen from human papillomavirus. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antigen
from a herpes simplex virus, such as herpes simplex virus 1 or
herpes simplex virus 2. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for an antigen from a human
immunodeficiency virus, such as human immunodeficiency virus type 1
or human immunodeficiency virus type 2. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antigen
from a human metapneumovirus. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for an antigen from a human
parainfluenza virus, such as human parainfluenza virus type 1,
human parainfluenza virus type 2, or human parainfluenza virus type
3. In certain embodiments, the present invention provides a method
for producing a dry powder composition having full-length mRNA that
encodes for an antigen from malaria virus. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antigen
from zika virus. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for an antigen from chikungunya
virus.
[0231] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an antigen associated with a cancer of a
subject or identified from a cancer cell of a subject. In certain
embodiments, the present invention provides a method for producing
a dry powder composition having full-length mRNA that encodes for
an antigen determined from a subject's own cancer cell, i.e., to
provide a personalized cancer vaccine. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antigen
expressed from a mutant KRAS gene.
[0232] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an antibody. In certain embodiments, the
antibody can be a bi-specific antibody. In certain embodiments, the
antibody can be part of a fusion protein. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antibody to
OX40. In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an antibody to VEGF. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an antibody to
tissue necrosis factor alpha. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for an antibody to CD3. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for an antibody to CD19.
[0233] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an immunomodulator. In certain embodiments,
the present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for Interleukin
12. In certain embodiments, the present invention provides a method
for producing a dry powder composition having full-length mRNA that
encodes for Interleukin 23. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for Interleukin 36 gamma. In
certain embodiments, the present invention provides a method for
producing a dry powder composition having full-length mRNA that
encodes for a constitutively active variant of one or more
stimulator of interferon genes (STING) proteins.
[0234] In certain embodiments, the present invention provides a
method for producing a dry powder composition having full-length
mRNA that encodes for an endonuclease. In certain embodiments, the
present invention provides a method for producing a dry powder
composition having full-length mRNA that encodes for an RNA-guided
DNA endonuclease protein, such as Cas 9 protein. In certain
embodiments the present invention provides a method for producing a
dry powder composition having full-length mRNA that encodes for a
meganuclease protein. In certain embodiments, the present invention
provides a method for producing a dry powder composition having
full-length mRNA that encodes for a transcription activator-like
effector nuclease protein. In certain embodiments, the present
invention provides a method for producing a dry powder composition
having full-length mRNA that encodes for a zinc finger nuclease
protein.
[0235] The present invention may be used to treat various other
diseases, disorders and conditions in which sustained release of
the mRNA formulation is required. These examples include diseases
where the mRNA delivery in the digestive tract is useful. Such
diseases include but are not limited to, Apolipoprotein E
deficiency disease; Inflammatory Bowel Disease, or Crohn's disease;
Adhesion G Protein-coupled Receptor VI deficiency disease; Type 2
Von Willebrand Disease; Nephrolithiasis, calcium oxalate CAON
related; Maturity Onset Diabetes of the Young, Type 8.
[0236] The present invention may be used to treat various other
diseases, disorders or conditions where targeted delivery of the
mRNA formulation to a tissue or organ may be beneficial. These may
be orchestrated by association of a polymer suitable for the
purpose, with or without association of specific targeting
moieties.
EXAMPLES
[0237] While certain compounds, compositions and methods of the
present invention have been described with specificity in
accordance with certain embodiments, the following examples serve
only to illustrate the present invention and are not intended to
limit the same.
Example 1. mRNA-LNP Dry Powder Formulations Recovered from
Spray-Drying
[0238] In this example, LNP-encapsulated mRNA formulations were
prepared with and without polymer and spray-dried. The results show
that the LNP-encapsulated mRNA formulations prepared with polymer
provides an unexpected high recovery from the spray-dry process, as
compared to the same mRNA-LNP formulations prepared without
polymer.
[0239] In particular, two of LNP-encapsulated mRNA formulations
(mRNA encoding Firefly Luciferase (FFL) and formulations referred
to as FFL-F1 an FFL-F2, respectively) each were prepared without
polymer or with polymer, with the individual compositions of each
described in Table 1. To prepare these formulations for
spray-drying, the FFL mRNA was first mixed with lipid nanoparticles
(LNPs) using a gear pump in order to encapsulate the mRNA within
the LNPs. Then, for the "With Polymer" samples, the polymer
solution then was mixed with mRNA-LNPs using a gear pump. The
solutions were then subjected to spray-drying as depicted in the
graphical representation of the instrumentation in FIG. 1. The
following conditions were used for the spray-drying: an inlet
temperature of 90.degree. C., an aspirator percentage of 85%, a
pump percentage of 25% and an outlet temperature of 46-50.degree.
C.
TABLE-US-00002 TABLE 1 mRNA formulation compositions and
characteristics for Example 1 Mass (g) FFL-F1 FFL-F1 FFL-F2 FFL-F2
Without With Without With Ingredient Polymer Polymer Polymer
Polymer mRNA 0.025 0.025 0.025 0.025 Lipid Nanoparticle DMG-PEG
lipid 0.0428 0.0428 0.0963 0.0963 cKK-E12 cationic lipid 0.1549
0.1549 0.3098 0.3098 DPPC lipid 0 0 0.3149 0.3149 Total lipids mass
0.1977 0.1977 0.721 0.721 Polymers Eudragit EPO polymer 0 0.187 0
0.187 Poloxamer 407 polymer 0 0.0625 0 0.0625 Total polymer mass 0
0.2325 0 0.2495 Other Components Citric Acid 0.089 0.089 0.089
0.089 Sodium Citrate 0.04756 0.04756 0.04756 0.04756 Mannitol 1.25
1.25 1.25 1.25 Characteristics mRNA Content (% w/w) 1.34 1.34 1.05
1.05 Total Polymer/Total Lipid n/a 1.18 n/a 0.35 (mass ratio) Total
Polymer/PEG Lipid n/a 5.43 n/a 2.59 (mass ratio) mRNA encapsulation
(%) 82.99 .+-. 0.55 82.99 .+-. 0.55 81.66 .+-. 0.15 81.66 .+-. 0.15
before spray-drying mRNA encapsulation (%) not measured 81.29 .+-.
0.43 not measured 84.77 .+-. 0.30 after spray-drying % Mass
Recovery from 1 .+-. 2% .sup. 43 .+-. 3% 2 .+-. 2% .sup. 45 .+-. 4%
spray-drying Z-average size (nm) 106.17 .+-. 1.86 106.17 .+-. 1.86
95.05 .+-. 1.66 95.05 .+-. 1.66 before spray-drying Z-average LNP
size (nm) not measured 1186 .+-. 313 not measured 207.97 .+-. 1.25
after spray-drying
Results
[0240] The spray-drying step on each LNP-mRNA formulation without
polymer was unsuccessful. In each case, the material aggregated in
the spray-dryer and clogged various compartments of the
spray-dryer, such there was little to no recovery of material, as
described in Table 1 (bottom) and as depicted in FIG. 2. However,
the same two LNP-mRNA formulations prepared with polymer each was
successfully spray-dried and yielded greater than 40% recovery of
material from the spray-drying step, as described in Table 1
(bottom) and as depicted in FIG. 2.
[0241] The effect of spray-drying on encapsulation efficiency and
nanoparticle size (Z-average) were measured before and after the
spray-drying step, with values provided in Table 1 (bottom). For
the LNP-mRNA formulations prepared with polymer, encapsulation
efficiency did not change appreciable in material before and after
spray-drying and nanoparticle size was found to increase from
before to after spray-drying. For the LNP-mRNA formulations
prepared without polymer, these measures could not be determined
due to the failure of the spray-drying step to produce any
substantial material.
Example 2. Integrity and Stability of mRNA Dry Powder
Formulations
[0242] In this example, two mRNA formulations encoding
argininosuccinate synthetase or ASS1 mRNA were prepared and
assessed for long-term stability. In particular, one mRNA
formulation was prepared that included no LNP but did include
polymer (ASS1-F1). A second mRNA formulation was prepared that
included LNP-encapsulated LNP plus polymer (ASS-F2). Each
formulation is described further in Table 2.
[0243] For the ASS1-F1 formulation, the mRNA was directly mixed
with the polymer using a gear pump. For the ASS1-F2 formulation,
the mRNA was first mixed with lipid nanoparticles (LNPs) using a
gear pump in order to encapsulate the mRNA within the LNPs and then
the polymer solution was mixed with the mRNA-LNPs using a gear
pump. The final formulations were concentrated, and mannitol was
added to each formulation. The solutions were then subjected to
spray-drying as depicted in the graphical representation of the
instrumentation in FIG. 1. The following conditions were used for
the spray-drying: an inlet temperature of 90.degree. C., an
aspirator percentage of 85%, a pump percentage of 25% and an outlet
temperature of 46-50.degree. C.
TABLE-US-00003 TABLE 2 mRNA formulation compositions and
characteristics for Example 2 Mass (g) Components ASS1-F1 ASS1-F2
mRNA 0.05 0.05 Lipids DMG-PEG lipid 0 0.0856 cKK-E12 cationic lipid
0 0.3098 Total lipid mass 0 0.3954 Polymers Eudragit EPO polymer
0.374 0.374 Poloxamer 407 polymer 0.050 0.125 Total polymer mass
0.424 0.499 Other Components Citric Acid 0.0712 Disregarded Sodium
Citrate 0.09805 Disregarded Mannitol 2.5 2.5 Characteristics mRNA
Content (% w/w) 1.62 1.45 Total Polymer/Total Lipid n/a 1.26 (mass
ratio) Total Polymer/PEG Lipid n/a 5.83 (mass ratio) mRNA
encapsulation (%) n/a 75.28 .+-. 1.43 before spray-drying mRNA
encapsulation (%) n/a 81.85 .+-. 0.44 after spray-drying Z-average
size (nm) n/a 99.4 .+-. 1.3 before spray-drying Z-average LNP size
(nm) n/a 426 .+-. 12 after spray-drying
[0244] Encapsulation efficiency and nanoparticle size. The effect
of spray-drying on encapsulation efficiency was measured before and
after the drying. In this example, encapsulation efficiency of the
LNP-encapsulated mRNA in a formulation with polymer was
75.28.+-.1.43 before the process and 81.85.+-.0.44 after,
indicating that the spray-drying process did not negatively impact
encapsulation efficiency. The average sizes of the nanoparticles
before and after spray drying were 99.4.+-.1.3 and 426.+-.12,
respectively.
[0245] Integrity and stability of mRNA dry powder. The
LNP-encapsulated mRNA in a formulation with polymer provided an
unexpected high integrity and stability of the mRNA following
spray-drying, even when stored at refrigeration temperature
(4.degree. C.) or frozen at -20.degree. C. for various time
periods. mRNA integrity and stability described below was assessed
by spectrophotometric analysis, e.g., capillary electrophoresis
(CE), as well as by gel electrophoresis, e.g., by northern blot
analysis.
[0246] FIG. 3 and FIG. 4 serve as exemplary controls for the
analysis of mRNA integrity. In particular, FIG. 3 shows intact mRNA
as assessed by CE (left-hand panel) and by gel electrophoresis
(right-hand panel). In the left-hand panel of the figure, the
intact mRNA appears as a single spectrophotometric peak (shaded)
and, in the right-hand panel of the figure, the intact mRNA appears
as a single band corresponding to the expected molecular size of
the mRNA, which single peak and single band each indicate intact
mRNA and absence of degradation products. Similarly, FIG. 4 shows
mRNA prior to spray drying and extracted from the LNP (i.e.,
extracted for the purpose of the conducting the CE and gel
electrophoresis analyses on the mRNA), to confirm that extraction
of the mRNA from the LNP does not produce significant mRNA
degradation products. Comparison of the CE peak and gel band in
FIG. 4 to those in FIG. 3 shows that the process used to extract
mRNA from the LNPs does not produce significant mRNA degradation
products.
[0247] Aliquots of the spray-dried ASS1-F1 formulation or the
spray-dried ASS1-F2 formulation were stored at either at 4.degree.
C. or at -20.degree. C., and at various time points samples were
removed, reconstituted and assessed for mRNA integrity by CE and
gel electrophoresis. In particular, the mRNA integrity of dry
powder ASS1 mRNA-LNP formulated with polymer (ASS1-F2) was assessed
at weeks 2 and 4 after spray-drying and storage at either at
4.degree. C. or at -20.degree. C.; and mRNA integrity of dry powder
ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1) was
assessed at weeks 3 and 5 after spray-drying and storage at either
at 4.degree. C. or at -20.degree. C.
[0248] FIG. 5 and FIG. 6 show mRNA integrity of dry powder ASS1
mRNA-LNP formulated with polymer (ASS1-F2) and stored for two weeks
at 4.degree. C. or at -20.degree. C., respectively. Each of FIG. 5
and FIG. 6 show a single CE peak (left-hand panel) and a single gel
band (right-hand panel) indicating that the ASS1 mRNA remains
intact, without degradation, at both temperature conditions. FIG. 7
further shows superimposition of the two peaks of ASS1 mRNA (from
FIG. 5 and FIG. 6), indicating that the mRNA remained intact
irrespective of the storage temperature. These data indicate that
spray-dried formulations of mRNA lipid nanoparticles with a polymer
remain stable for at least two weeks over a range of storage
temperatures, for example, at or up to about -20.degree. C. or at
or up to about 4.degree. C.
[0249] FIG. 8 and FIG. 9 show mRNA integrity of dry powder ASS1
mRNA-LNP formulated with polymer (ASS1-F2) and stored for four
weeks at 4.degree. C. or at -20.degree. C., respectively. Both FIG.
8 and FIG. 9 show a single CE peak (left-hand panel) and a single
gel band (right-hand panel) indicating that the ASS1 mRNA remains
intact, without degradation, at both temperature conditions. These
data indicate that spray-dried formulations of mRNA lipid
nanoparticles with a polymer remain stable for at least four weeks
over a wide range of storage temperatures, for example, at or up to
about -20.degree. C. or at or up to about 4.degree. C.
[0250] FIG. 10 and FIG. 11 show mRNA integrity of dry powder ASS1
mRNA (without LNP) formulated with polymer (ASS1-F1) and stored for
three weeks at 4.degree. C. or at -20.degree. C., respectively. As
shown in FIG. 10 and FIG. 11, the ASS1-F1 mRNA remained intact,
without degradation, at both temperature conditions. FIG. 12
depicts superimposition of the CE peaks of ASS1 mRNA (from FIG. 10
and FIG. 11), in which the complete alignment of the CE peaks
indicates absence of degradation of the mRNA. This shows that
spray-dried formulations of mRNA with a polymer (without LNP
encapsulation) remain stable for at least three weeks over a wide
range of storage temperatures, for example, at or up to about
-20.degree. C. or at or up to about 4.degree. C.
[0251] FIG. 13 and FIG. 14 show mRNA integrity of dry powder ASS1
mRNA (without LNP) formulated with polymer (ASS1-F1) and stored for
five weeks at 4.degree. C. or at -20.degree. C., respectively. As
shown in FIG. 13 and FIG. 14, the ASS1-F1 mRNA remained intact
without degradation at both temperature conditions. This shows that
spray-dried formulations of mRNA with a polymer (without LNP
encapsulation) remain stable for at least five weeks over a wide
range of storage temperatures, for example, at or up to about
-20.degree. C. or at or up to about 4.degree. C.
[0252] Surprisingly, for both dry powder ASS1 mRNA-LNP formulated
with polymer (ASS1-F2) and for dry powder ASS1 mRNA (without LNP)
formulated with polymer (ASS1-F1), the integrity of mRNA was
maintained for extended time periods at elevated storage
temperatures, e.g., refrigerated storage (about 4.degree. C.).
Example 3. One-Step Method of mRNA Encapsulation in Lipid-Polymer
Nanoparticle
[0253] In this example, lipids, mRNA and polymer were prepared in a
single step to produce lipid-polymer-encapsulated mRNA
nanoparticles (formulations ASS1-F3 With Polymer and ASS1-F4 With
Polymer). This is in contrast to Example 1 and Example 2 where
LNP-encapsulating mRNA nanoparticles were first prepared and then
polymer was added into the formulation. In addition, reference
formulations were prepared by the same process but without
including polymer in the nanoparticle or formulation (formulations
ASS1-F3 Without Polymer and ASS1-F4 Without Polymer).
[0254] In particular, lipids and polymer (or just lipids for the
control formulations) were dissolved in ethanol and together mixed
with mRNA solution using a gear pump. Four different formulations
were prepared. The first and second formulations (ASS1-F3 Without
Polymer and ASS1-F3 With Polymer) were prepared with cKK-E12 as the
cationic lipid, either without or with polymer. The third and
fourth formulations (ASS1-F4 Without Polymer and ASS1-F4 With
Polymer) were prepared with ICE (imidazole cholesterol ester) as
the cationic lipid, either without or with polymer. ASS1-F3 With
Polymer and ASS1-F4 With Polymer included Eudragit as the polymer.
All four formulations included mRNA encoding ASS1 as the
nanoparticle-encapsulated mRNA. Each formulation was concentrated,
and mannitol was added. All formulations are described further in
Table 3. Each formulation was subjected to spray drying using the
conditions described in Example 1.
TABLE-US-00004 TABLE 3 mRNA formulation compositions and
characteristics for Example 3 Mass (g) ASS1-F3 ASS1-F3 ASS1-F4
ASS1-F4 Without With Without With Ingredient Polymer Polymer
Polymer Polymer mRNA 0.05 0.05 0.05 0.05 Lipids DMG-PEG lipid
0.0856 0.0856 0.0856 0.0856 ckk-E12 lipid 0.3098 0.3098 0 0 ICE
lipid 0 0 0.1587 0.1587 Total lipid mass 0.3954 0.3954 0.2443
0.2443 Polymers Eudragit EPO polymer 0 0.374 0 0.374 Total polymer
mass 0 0.374 0 0.374 Other Components Mannitol 2.5 2.5 2.5 2.5
Characteristics mRNA Content (% w/w) 1.51 1.51 1.58 1.58 Total
Polymer/Total Lipid n/a 0.95 n/a 1.53 (mass ratio) Total
Polymer/PEG Lipid n/a 4.37 n/a 4.37 (mass ratio) mRNA encapsulation
(%) not measured 79.24 .+-. 0.14 not measured 76.25 .+-. 0.60
before spray-drying Z-average LNP size (nm) not measured 141.8 .+-.
1.6 not measured 106.6 .+-. 2.0 before spray-drying % Mass Recovery
from 1 .+-. 2% .sup. 39 .+-. 5% 1 .+-. 2% .sup. 38 .+-. 3%
spray-drying mRNA encapsulation (%) not measured 79.49 .+-. 0.37
not measured 80.49 .+-. 0.61 after spray-drying Z-average LNP size
(nm) not measured 471.7 .+-. 59 not measured 308.0 .+-. 7.2 after
spray-drying
Results
[0255] The spray-drying step for the formulations without polymer
(ASS1-F3 Without Polymer and ASS-F4 Without Polymer) was
unsuccessful. In each case, the material aggregated in the
spray-dryer and clogged various compartments of the spray-dryer,
such there was little to no recovery of material, as described in
Table 3 (bottom) showing a recovery of 1.+-.2% for each formulation
without polymer. However, those same two formulations prepared with
polymer in the nanoparticle (ASS1-F3 With Polymer and ASS-F4 With
Polymer) each were successfully spray-dried and yielded greater
than 35% and nearly 40% recovery of material from the spray-drying
step, as described in Table 3.
[0256] The effects of spray-drying on encapsulation efficiency and
nanoparticle size (Z-average) for formulations prepared with
polymer in the nanoparticle were measured before and after the
spray-drying step, with values provided in Table 3 (bottom). For
each lipid-polymer-mRNA nanoparticle, encapsulation efficiency did
not change appreciable before and after spray-drying and
nanoparticle size was found to increase from before to after
spray-drying. For the formulations prepared without polymer, these
measures could not be determined due to the failure of the
spray-drying step to produce any substantial material.
[0257] These results show, among other things, that polymer added
into a lipid nanoparticle that encapsulates mRNA allows for
successful spray-drying of the mRNA-encapsulated lipid
nanoparticle. This is in contrast to the same lipid nanoparticle
that does not include mRNA, which was not successfully
spray-dried.
Example 4. One-Step Method of mRNA Encapsulation in Lipid-Polymer
Nanoparticle
[0258] In this example, the polymer, PLGA, was mixed with lipids
and mRNA in a single step to produce lipid-PLGA-encapsulated mRNA
nanoparticles.
[0259] In particular, lipids and PLGA (or just lipids for the
control formulations) were dissolved in an ethanol and acetonitrile
(1:2) mixture and mixed with ASS1 mRNA solution using a gear pump.
The final formulation was concentrated in 5% mannitol, and then
spray dried. The following conditions were used for the
spray-drying: an inlet temperature of 90.degree. C., an aspirator
percentage of 85%, a pump percentage of 25% and an outlet
temperature of 46-50.degree. C. The formulations are described
further in Table 4.
TABLE-US-00005 TABLE 4 mRNA formulation compositions and
characteristics for Example 4 Ingredient Mass (g) mRNA 0.05 Lipids
DMG-PEG lipid 0.1283 ICE lipid 0.3175 DOPE lipid 0.27 Polymers PLGA
0.215 Other Components Mannitol 2.5 Characteristics mRNA Content (%
w/w) 1.44
Results
[0260] The spray-drying step for the formulation prepared with PLGA
polymer in the nanoparticle was successfully spray-dried and
yielded recovery of material from the spray-drying step.
Example 5. In Vivo Delivery of Spray-Dried mRNA Formulations
[0261] In this example, the spray dried formulation, FFL-F1 With
Polymer (as described in Example 1) was administered to mice both
as a dry powder and dissolved in liquid, and expression of the mRNA
in the administered formulations was detected in both
approaches.
[0262] In particular, in one approach the dry powder formulation of
FFL-F1 With Polymer was administered to mice at a dose of 1 mg,
using a Dry Powder Insufflator, Model DP-4M. At 24 hours following
dry powder administration, the FFL substrate, luciferin, was
administered with a microsprayer and luciferase expression in vivo
was detected by bioluminescence assay. The results are depicted in
FIG. 15A.
[0263] In a second approach, FFL-F1 With Polymer was dissolved in
water at a concentration of 20 mg/ml, and 50 microliters per mouse
was administered by microsprayer, for a dose of 1 mg. At 24 hours
following administration, the FFL substrate, luciferin, was
administered with a microsprayer and luciferase expression in vivo
was detected by bioluminescence assay. The results are depicted in
FIG. 15B.
[0264] These results demonstrate that mRNA encapsulated within an
LNP in a formulation with polymer remains active following
spray-drying. These results also show that spray-dried
LNP-encapsulated mRNA can be administered directly as dry powder to
provide expression of protein in vivo.
Example 6. CFTR mRNA Lipid-Polymer Nanoparticle Dry Powder
Formulation
[0265] In this example, mRNA encoding cystic fibrosis conductance
regulator protein (CFTR), or CFTR mRNA, was encapsulated within a
lipid-polymer nanoparticle and successfully spray-dried into a
stable dry powder.
[0266] In particular, to prepare the lipid-polymer nanoparticles
encapsulating CFTR-mRNA within them, a PEG-modified lipid, a
cationic lipid, and a polymer as described in Table 5 below were
dissolved in 150 mL ethanol and mixed with CFTR-mRNA (0.05 g in 600
mL, pH 4.5, 1 mM citrate buffer, 150 mM sodium chloride) using gear
pumps. Then, 37.5 g of mannitol was dissolved at 5% weight/volume
into that resultant 750 mL solution (20% ethanol) of CFTR-mRNA
encapsulated within lipid-polymer nanoparticles. The resulting
mixture then was spray dried on Buchi spray dryer using the
following spray-drying conditions: an inlet temperature of
90.degree. C., an aspirator percentage of 90%, a pump percentage of
25% and an outlet temperature of 46-50.degree. C.
TABLE-US-00006 TABLE 5 CFTR-mRNA lipid-polymer nanoparticle
dry-powder formulation Ingredient Mass (g) CFTR mRNA 0.05 Lipids
DMG-PEG lipid 0.0856 cKK-E12 lipid 0.3098 Polymer Eudragit EPO
0.215 Other Components Mannitol 37.5
[0267] To quantitatively determine integrity of the CFTR-mRNA in
the lipid-polymer nanoparticles following spray-drying, the
CFTR-mRNA was precipitated out from the nanoparticles by mixing and
dissolving the nanoparticles in ethanol with RNA precipitation
buffer comprising guanidine thiocyanate, N-lauroylsarcosine, and
sodium citrate, pH 6.5. The precipitated mRNA was further separated
and purified using a RNeasy silica membrane (Qiagen) and then
redissolved in RNAse free water. The purified mRNA was assessed by
capillary electrophoresis using a Fragment Analyzer (Agilent)
following manufacturer's published instructions. Briefly,
appropriate volumes of intercalating dye and RNA separation gel
were mixed and loaded onto the instrument. Capillary conditioning
buffer was diluted to required concentration and loaded on the
conditioning fluid line. Inlet buffer, rinse buffer, and storage
buffers were added to well plates and added to the designated
locations. The extracted mRNA and control mRNA were diluted to 150
ng/.mu.L by using formamide loading buffer followed by denaturation
by heating at 70.degree. C. for 5 minutes and cooling immediately.
The samples were diluted further using diluent marker according to
manufacturer's instructions and run on the fragment analyzer by the
relevant separation method.
[0268] As described in the Examples above, LNP-mRNA formulations
without additional polymer in the formulation could not be
spray-dried successfully. In particular, the LNP-mRNA material
aggregated in the spray-dryer and clogged various compartments of
the spray-dryer, such there was little to no recovery of LNP-mRNA
material. As the Examples above show, this failure to successfully
spray-dry LNP-mRNA material can be overcome with the addition of
polymer into the LNP formulation, either by including the polymer
with the lipids so that the polymer is present during the step of
creating the nanoparticle and encapsulating the mRNA, or
alternatively by adding polymer to the formulation following the
step of creating the lipid nanoparticle and encapsulating the
mRNA.
[0269] Here, CFTR-mRNA encapsulated within a lipid nanoparticle was
successfully spray-dried by addition of a polymer, in particular
Eudragit polymer. In particular, the Eudragit polymer was included
with the lipid mixture prior to the step of creating the
nanoparticle and encapsulating the mRNA, such that a CFTR-mRNA
encapsulated with a lipid-polymer nanoparticle was produced. The
successfully spray-dried CFTR-mRNA lipid-polymer nanoparticle also
was assessed for integrity using capillary electrophoresis (CE)
analysis. FIG. 16A1-A6 shows exemplary CE chromatographs of
CFTR-mRNA peak integrity before and after spray-drying, indicating
that the integrity of the CFTR-mRNA following spray-drying in a
lipid-polymer remains intact. FIG. 16A1-A3 depicts control CFTR
mRNA which was neither spray dried nor encapsulated, while FIG.
16A4-A6 depicts the CFTR mRNA extracted from the spray-dried
formulation.
Sequence CWU 1
1
31140RNAArtificial SequenceSynthetic polynucleotide 1ggacagaucg
ccuggagacg ccauccacgc uguuuugacc uccauagaag acaccgggac 60cgauccagcc
uccgcggccg ggaacggugc auuggaacgc ggauuccccg ugccaagagu
120gacucaccgu ccuugacacg 1402105RNAArtificial SequenceSynthetic
polynucleotide 2cggguggcau cccugugacc ccuccccagu gccucuccug
gcccuggaag uugccacucc 60agugcccacc agccuugucc uaauaaaauu aaguugcauc
aagcu 1053105RNAArtificial SequenceSynthetic polynucleotide
3ggguggcauc ccugugaccc cuccccagug ccucuccugg cccuggaagu ugccacucca
60gugcccacca gccuuguccu aauaaaauua aguugcauca aagcu 105
* * * * *