U.S. patent application number 17/142192 was filed with the patent office on 2021-07-01 for oligonucleotide constructs and uses thereof.
The applicant listed for this patent is Janssen BioPharma, Inc.. Invention is credited to Leonid BEIGELMAN, Sergei GRYAZNOV, Theodore YUN.
Application Number | 20210196831 17/142192 |
Document ID | / |
Family ID | 1000005451049 |
Filed Date | 2021-07-01 |
United States Patent
Application |
20210196831 |
Kind Code |
A1 |
GRYAZNOV; Sergei ; et
al. |
July 1, 2021 |
OLIGONUCLEOTIDE CONSTRUCTS AND USES THEREOF
Abstract
Oligodeoxynucleotide-based immunostimulatory Toll-Like Receptor
9 (TLR9) agonists are described. Also described are compositions
comprising the TLR9 agonists, methods of making the TLR9 agonists,
and methods of using the TLR9 agonists to treat immune diseases,
disorders or conditions, such as viral infections or cancer.
Inventors: |
GRYAZNOV; Sergei; (San
Mateo, CA) ; BEIGELMAN; Leonid; (San Mateo, CA)
; YUN; Theodore; (Burlingame, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Janssen BioPharma, Inc. |
South San Francisco |
CA |
US |
|
|
Family ID: |
1000005451049 |
Appl. No.: |
17/142192 |
Filed: |
January 5, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16179786 |
Nov 2, 2018 |
10905767 |
|
|
17142192 |
|
|
|
|
62580924 |
Nov 2, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 47/543 20170801;
A61K 2039/58 20130101; A61K 2039/82 20180801; A61K 2039/6018
20130101; A61K 2039/585 20130101; A61K 9/0019 20130101; A61K
31/7088 20130101; A61K 2039/55561 20130101; A61K 47/22 20130101;
A61P 35/00 20180101; A61K 47/14 20130101; A61K 2039/6025 20130101;
A61K 47/545 20170801; A61P 31/20 20180101; A61K 47/26 20130101;
A61K 39/39 20130101; C12N 2730/10134 20130101; C12Q 1/6876
20130101 |
International
Class: |
A61K 47/54 20060101
A61K047/54; A61P 31/20 20060101 A61P031/20; A61P 35/00 20060101
A61P035/00; A61K 39/39 20060101 A61K039/39; A61K 47/22 20060101
A61K047/22; A61K 47/26 20060101 A61K047/26; C12Q 1/6876 20060101
C12Q001/6876; A61K 47/14 20060101 A61K047/14; A61K 9/00 20060101
A61K009/00; A61K 31/7088 20060101 A61K031/7088 |
Claims
1. A CpG ODN construct having a formula of: 5'M-L-[CpG ODN]3', or
Formula (IIa): 5'[CpG ODN]-L-M3' Formula (IIb): wherein: M
represents a lipid moiety, preferably the lipid moiety comprises at
least one lipid moiety selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl group; L
represents a linker comprising 10-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus, wherein L is covalently linked to the CpG ODN via a
cleavable linkage, preferably via an ester or an amide bond; and
CpG ODN comprises at least one CpG motif having a po
internucleotide linkage; optionally, the CpG ODN construct of
Formula (IIa) or (IIb) is further covalently conjugated to a
targeting moiety, which is preferably selected from the group
consisting of galactose, N-acetylgalactosamine (GalNAc), fucose,
mannose, sialic acid, N-acetyl neuraminic acid.
2. A CpG ODN construct having a structure of:
5'M.sub.1-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]-Y.sub.3-M.sub.23', or Formula (IIIa): 5'M.sub.2-Y.sub.3-[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M.sub.13'
Formula (IIIb): wherein: M.sub.1 represents a lipid moiety,
preferably the lipid moiety comprises at least one selected from
the group consisting of cholesterol, tocopherol, a palmitoyl group,
and a stearyl group, M.sub.2 represents a lipid moiety, a targeting
moiety, or is absent, Y.sub.1 is a bond or a linker, preferably
ethylene glycol having the formula ((CH.sub.2).sub.2O).sub.o,
wherein o is 1-15, covalently linked to
(((CH.sub.2).sub.2O).sub.m--X).sub.n via a phosphodiester (po)
linkage, a phosphorothioate (ps) linkage or a bond, X is
independently a bond, a po linkage or a ps linkage, each of Y.sub.2
and Y.sub.3 is independently a cleavable linkage, preferably
comprises an ester or an amide bond, more preferably comprises a po
linkage or a phosphoramidate linkage, most preferably a po linkage,
provided that when M.sub.2 is absent, Y.sub.3 is absent, CpG ODN
comprises at least one CpG motif having a po internucleotide
linkage, preferably comprises at least two, three or four CpG
motifs each having the po internucleotide linkage; m is an integer
from 1 to 15, and n is an integer from 1 to 5.
3. The ODN construct of claim 2, having a formula of:
5'M-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]3', or Formula (IVa): 5'[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M3'
Formula (IVb): wherein: M represents a lipid moiety, preferably the
lipid moiety comprises at least one lipid moiety selected from the
group consisting of cholesterol, tocopherol, a palmitoyl group, and
a stearyl group, Y.sub.1 is a bond or a linker, preferably ethylene
glycol having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is
1-15, covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via
a phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond, X is independently a bond, a phosphodiester (po) linkage or a
phosphorothioate (ps) linkage, Y.sub.2 is a cleavable linkage,
preferably comprises an ester or an amide bond, more preferably
comprises a po linkage or a phosphoramidate linkage, most
preferably a po linkage; CpG ODN comprises at least one CpG motif
having a po internucleotide linkage, preferably comprises at least
two, three or four CpG motifs each having the po internucleotide
linkage; m is an integer from 1 to 15, preferably 6; and n is an
integer from 1 to 5, preferably 2; optionally, the CpG ODN
construct of Formula (IVa) or (IVb) is further covalently
conjugated to a targeting moiety, which is preferably selected from
the group consisting of galactose, N-acetylgalactosamine (GalNAc),
fucose, mannose, sialic acid, N-acetyl neuraminic acid.
4. The ODN construct of claim 3, having a formula construct
selected from the group consisting of: 5'M-po(HEG)po(HEG)po-[CpG
ODN]3'; 5'M-ps(HEG)po(HEG)po-[CpG ODN]3', 5'M-ps(HEG)ps(HEG)po-[CpG
ODN]3', 5'M-po(HEG)ps(HEG)po-[CpG ODN]3', 5'[CpG
ODN]-po(HEG)po(HEG)po-M3', 5'[CpG ODN]-po(HEG)ps(HEG)po-M3', 5'[CpG
ODN]-po(HEG)ps(HEG)ps-M3', and 5'[CpG ODN]-po(HEG)po(HEG)ps-M3',
wherein: M represents a lipid moiety comprising at least one
selected from the group consisting of cholesterol, tocopherol, a
palmitoyl group, and a stearyl group; po represents a
phosphodiester linkage; HEG represents ((CH.sub.2).sub.2O).sub.6;
ps represents a phosphorothioate linkage; and CpG ODN comprises at
least one CpG motif having a po internucleotide linkage, preferably
comprises at least two, three or four CpG motifs each having the po
internucleotide linkage, wherein M is covalently linked to (HEG)
directly via a po or ps linkage, or indirectly via a second linker
that is linked to (HEG) directly via a po or ps linkage.
5. The ODN construct of claim 3, having a formula selected from the
group consisting of: 5'Toco-po(HEG)po(HEG)po-[CpG ODN]3', wherein
Toco represents tocopherol, 5'Chol-po(HEG)po(HEG)po-[CpG ODN]3',
wherein Chol represents cholesterol, 5'Palm-po(HEG)po(HEG)po-[CpG
ODN]3', wherein Palm represents a palmitoyl group, 5'[CpG
ODN]-po(HEG)ps-Chol3', wherein Chol represents cholesterol, 5'[CpG
ODN]-po(HEG)ps-Toco3', wherein Toco represents tocopherol, and
5'[CpG ODN]-po(HEG)ps-Palm3', wherein Palm represents a palmitoyl
group, wherein: po represents a phosphodiester linkage; HEG
represents ((CH.sub.2).sub.2O).sub.6; ps represents a
phosphorothioate linkage; and CpG ODN comprises at least one CpG
motif having a po internucleotide linkage, preferably comprises at
least two, three or four CpG motifs each having the po
internucleotide linkage, wherein the tocopherol, the cholesterol,
or the palmitoyl group is covalently linked to the (HEG) directly
via a po or ps linkage, or indirectly via a second linker that is
linked to (HEG) directly via a po or ps linkage.
6. The ODN construct of claim 1, wherein the CpG ODN has a
phosphorothioate (ps) internucleotide linkage.
7. The ODN construct of claim 1, wherein two to four of the CpG
dinucleotides in the CpG ODN each have a phosphodiester (po)
internucleotide linkage.
8. The ODN construct of claim 1, wherein the CpG ODN comprises a
polynucleotide sequence selected from the group consisting of:
TABLE-US-00012 (1) (SEQ ID NO: 1) 5' TCGTCGTTTTGTCGTTTTGTCGTT 3';
(2) (SEQ ID NO: 2) 5' GGGGGACGATCGTCGGGGGG 3'; (3) (SEQ ID NO: 3)
5' GGGGTCAACGTTGAGGGGGG 3'; (4) (SEQ ID NO: 4) 5'
TCCATGACGTTCCTGACGTT 3'; (5) (SEQ ID NO: 5) 5'
TCGTCGTTTTCGGCGCGCGCCG 3'; (6) (SEQ ID NO: 6) 5'
TCGTCGTTACGTAACGACGACGTT 3'; and (7) (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTGTCGT 3'.
9. The ODN construct of claim 1, wherein the CpG ODN comprises a
polynucleotide sequence selected from the group consisting of:
TABLE-US-00013 (1) (SEQ ID NO: 8) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO: 9) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO: 10) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (4) (SEQ ID NO: 11) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (5) (SEQ ID NO: 12) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO: 13) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (7) (SEQ ID NO: 14) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (8) (SEQ ID NO: 15) 5'
TpsCpsGpsTpsCpsGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (9) (SEQ ID NO: 16) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (10) (SEQ ID NO: 17) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (11) (SEQ ID NO: 18) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpsGpsApsCpsGpsTpsT 3'; (12) (SEQ ID NO: 19) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpoGpsApsCpsGpsTpsT 3'; (13) (SEQ ID NO: 20) 5'
GpsGpsGpsGpsGpsApsCpoGpsApsTpsCpoGpsTpsCpoGps GpsGpsGpsGpsG 3';
(14) (SEQ ID NO: 21) 5'
GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps GpsGpsGpsGpsG 3';
(15) (SEQ ID NO: 22) 5'
TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps ApsCpsGpsTpsT 3';
(16) (SEQ ID NO: 23) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsCpsGpsGpsCpsGps CpsGpsCpsGpsCpsCpsG
3'; (17) (SEQ ID NO: 24) 5'
TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; (18) (SEQ ID NO: 25) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; and (19) (SEQ ID NO: 26) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3';
wherein: po represents a phosphodiester internucleotide linkage;
and ps represents a phosphorothioate internucleotide linkage.
10. The ODN construct of claim 1, having the structure of:
TABLE-US-00014 (1) (SEQ ID NO: 27) 5'
Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO:
28) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO:
29) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT-(HEG)po(HEG)po-Toco 3'; (4) (SEQ ID NO:
30) 5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT-(HEG)po(HEG)po-Toco 3'; (5) (SEQ ID NO:
31) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO:
32) 5' Chol-po(HEG)po(HEG)poTpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (7) (SEQ ID NO:
33) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (8) (SEQ ID NO:
34) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (9) (SEQ ID NO:
35) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (10) (SEQ ID NO:
36) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (11) (SEQ ID NO:
37) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (12) (SEQ ID
NO: 38) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (13) (SEQ ID
NO: 39) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (14) (SEQ ID
NO: 40) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (15) (SEQ ID
NO: 41) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (16) (SEQ ID
NO: 42) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (17) (SEQ ID NO:
43) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (18) (SEQ ID
NO: 44) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (19) (SEQ ID
NO: 45) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (20) (SEQ ID
NO: 46) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (21) (SEQ ID
NO: 47) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (22) (SEQ ID NO:
48) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (23) (SEQ ID NO:
49) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (24) (SEQ ID NO:
50) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (25) (SEQ ID NO:
51) 5'-TpsCpoGpsTpsCGpsTpsTpsTpsTpsGpsTpsCGpsTpsTpsTps
TpsGpsTpsCpoGpsTpsTps-HEGps-Chol 3'; (26) (SEQ ID NO: 52)
5'-TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps(HEG)po(HEG)po-Chol 3'; (27) (SEQ ID NO:
53) 5'-GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps
GpsGpsGpsGpsGps-HEGps-Chol 3'; (28) (SEQ ID NO: 54)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Chol 3'; (29) (SEQ ID NO: 55)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Toco 3'; (30) (SEQ ID NO: 56) 5'
Palmitoyl-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGps
TpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGps TpsT 3';
wherein: Chol represents cholesterol; Toco represents tocopherol;
Palmitoyl represents a palmitoyl group; HEG represents
((CH.sub.2).sub.2O).sub.6; po represents a phosphodiester linkage;
and ps represents a phosphorothioate linkage, wherein the
tocopherol, the cholesterol, or the palmitoyl group is covalently
linked to the (HEG) directly via a po or ps linkage, or indirectly
via a second linker that is linked to (HEG) directly via a po or ps
linkage.
11. (canceled)
12. An ODN construct having a structure of: ##STR00005## or a
pharmaceutically acceptable salt thereof, wherein the
Oligonucleotides represents a CpG ODN comprising at least one CpG
motif having a po internucleotide liknage.
13. The ODN construct of claim 12, wherein the CpG ODN contains SEQ
ID NO:1.
14. The ODN construct of claim 13, wherein the CpG ODN consists of
5'TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT--
3'.
15. The ODN construct of claim 12, having the following structure:
##STR00006##
16. An ODN construct having a structure of: ##STR00007##
17. A pharmaceutical composition comprising the ODN construct of
claim 1 and a pharmaceutically acceptable carrier.
18. A method of preparing a pharmaceutical composition, comprising
combining the ODN construct of claim 1 with a pharmaceutically
acceptable carrier.
19. A method of stimulating an immune response in a subject in need
hereof, comprising administering to the subject the pharmaceutical
composition of claim 17.
20. A method of treating a disease in a subject in need thereof,
comprising administering to the subject the pharmaceutical
composition of claim 17, wherein the disease is selected from the
group consisting of Hepatitis B virus (HBV) and cancer.
21. The ODN construct of claim 1, wherein at least one CpG motif
comprises two, three or four CpG motifs each having the po
intemucleotide linkage.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is entitled to priority pursuant to 35
U.S.C. .sctn. 119(e) to U.S. Provisional Patent Application No.
62/580,924, filed Nov. 2, 2017, the disclosure of which is
incorporated by reference herein in its entirety.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] This application contains a sequence listing, which is
submitted electronically via EFS-Web as an ASCII formatted sequence
listing with a file name "ALP0043USCNT1_Sequence_Listing", creation
date of Dec. 18, 2020, and having a size of 11.1 KB. The sequence
listing submitted via EFS-Web is part of the specification and is
herein incorporated by reference in its entirety
FIELD OF THE INVENTION
[0003] The present disclosure relates to oligonucleotide
constructs, compositions comprising the oligonucleotide constructs,
and methods of making the oligonucleotide constructs. The
oligonucleotide constructs can act as immunomodulatory molecules
and, in particular, as Toll-Like Receptor 9 (TLR9) agonists.
Accordingly, the present disclosure also relates to methods of
using the oligonucleotide constructs as TLR9 agonists, alone or in
combination with other agents, to treat or prevent diseases in
which modulation of TLR9 activity would be beneficial, such as
immune diseases, disorders or conditions, viral infections, and
cancer.
BACKGROUND
[0004] Toll-Like Receptors (TLRs) are a class of pattern
recognition receptor (PRR) proteins that play a key role in the
innate immune response. TLRs recognize pathogen-associated
molecular patterns (PAMPs) from microbial pathogens, such as
bacteria, fungi, parasites and viruses, which can be distinguished
from host molecules. TLRs are membrane-spanning proteins that
typically function as dimers and are expressed by cells involved in
the innate immune response, including antigen-presenting dendritic
cells and phagocytic macrophages.
[0005] There are at least ten human TLR family members, TLR1 to
TLR10, and at least twelve murine TLR family members, TLR1 to TLR9
and TLR11 to TLR13, each differing in the types of antigens they
recognize. For example, TLR9 is a nucleotide-sensing TLR which is
activated by unmethylated cytosine-phosphate-guanosine (CpG)
dinucleotides, in which the cytosine is linked to a guanosine by a
phosphodiester or phosphorothioate linkage, in single-stranded or
double-stranded DNA, including viral DNA.
[0006] Activation of TLRs leads to a series of signaling events
resulting in the production of type I interferons (IFNs),
inflammatory cytokines, and chemokines, and the induction of immune
responses. Eventually, this inflammation also activates the
adaptive immune system, which then results in the clearance of the
invading pathogens and the infected cells.
[0007] TLR9 is expressed in B cells and plasmacytoid dendritic
cells of the immune system. Binding of CpG-containing DNA to TLR9
initiates a downstream signaling cascade that leads to activation
of the transcription factors NF-.kappa.B, MAPK and IRF7, which
ultimately results in induction of rapid inflammation,
characterized by increased expression of various interleukins and
cytokines (Yamamoto and Takeda, Gastroenterology Research and
Practice, vol. 2010). In particular, stimulation of TLR9 by
CpG-containing agonists results in increased production of
IFN-.alpha., TNF-.alpha., IL-6 and/or IL-1, depending on the class
of CpG.
[0008] Hepatitis B virus (HBV) is a double stranded DNA (dsDNA)
virus that causes diseases including hepatitis B, fibrosis,
cirrhosis, and hepatocellular carcinoma. About two billion people
are infected with HBV, and almost 400 million people have chronic
hepatitis B infection (chronic HBV), characterized by persistent
virus and subvirus particles in the blood for more than 6 months
(Xu et al., 2014, Gastrointest Tumors, 1(3): 135-145). Chronic HBV
is currently treated with IFN-.alpha. and nucleoside or nucleotide
analogs, but there is no ultimate cure due to the persistence of
covalently closed circular DNA (cccDNA) in infected hepatocytes.
The retained cccDNA plays an ongoing role as a template for viral
RNAs and new virions. It is thought that inducing virus-specific
B-cell responses through stimulation of the TLR9 signaling pathway
on B-cells using synthetic CpG oligodeoxyribonucleotides (CpG ODNs)
can effectively eliminate cccDNA-carrying hepatocytes (Isogawa et
al., 2005, J. Virology 79(11) 7269-7272).
[0009] Substantial evidence indicates that immunotherapy is a
feasible and effective approach for the treatment of numerous types
of cancers. Ligands that target Toll-like receptors and other
innate recognition pathways represent a potent strategy for
modulating innate immunity to generate antitumor immunity. TLR
agonists are currently under investigation as vaccine adjuvants in
anticancer therapies for their ability to activate immune cells and
promote inflammation (see, e.g., Kaczanowska et al., J Leukoc Biol.
2013 June; 93(6): 847-863 and references therein). For example, it
was reported that in addition to prolonging CD4.sup.+ T cell
survival and suppressing T.sub.Reg activity, TLR9 ligands increase
CD4.sup.+ and CD8.sup.+ T cell numbers by augmenting IL-2
production and IL-2R expression (Id. and references therein).
CpG-ODN stimulation of TLR9 on neuroblastoma cell lines has been
shown to decrease cell proliferation and increase caspase-dependent
apoptosis, resulting in increased survival of tumor-bearing mice
(Id.). However, it was also reported that engagement of TLRs on
tumor cells can promote tumor growth by contributing to the
maintenance of a chronically inflamed environment, inducing cancer
cell proliferation, and promoting cell survival. For example, it
was reported that human breast cancer and gastric carcinoma cells
expressing TLR9 have enhanced invasive capability as a result of
the increased secretion of MMP13 and COX-2 upon TLR9 stimulation in
tissue culture, while in the case of glioma, despite its
metastasis-inducing properties, TLR9 had no effect on cell
proliferation, highlighting the diverse effects that TLR9 signaling
can have on different tumor cell types (Id.).
[0010] Strategies used to facilitate in vivo delivery of
therapeutic oligonucleotides include chemical modification of the
oligonucleotide, use of lipid nanocarriers, linking the
oligonucleotide to receptor-targeting agents, and the use of small
molecules to enhance the effectiveness of the oligonucleotide.
However, nanoparticle delivery systems may have limited range of
therapeutic applications due to their inability to access most
tissues and potential toxicity concerns. In addition, unlike
antisense or siRNA, CpG-containing oligonucleotide agonists
function by directly binding to the TLR9. Steric hindrance must be
avoided when designing conjugate of the CpG-containing
oligonucleotide agonists with delivery molecules, such as
cholesterol.
[0011] Thus, there remains a need for effective therapeutics that
can effectively treat or prevent diseases in which modulation of
TLR9 activity would be beneficial, such as chronic HBV infections
and cancers.
SUMMARY
[0012] The present disclosure satisfies the need for effective
therapeutics that can effectively treat or prevent diseases in
which modulation of TLR9 activity would be beneficial by providing
oligodeoxynucleotide (ODN)-based constructs that stimulate an
immune response through binding to and activating TLR9. The present
disclosure is also directed to the use of these ODN constructs,
alone or in combination with other agents, for treating or
preventing diseases in which modulation of TLR9 activity would be
beneficial, such as immune diseases, disorders or conditions,
including viral infections or cancers.
[0013] The ODN constructs of the present disclosure comprise CpG
oligodeoxynucleotides conjugated, through linkers, to lipid
moieties.
[0014] The design of the ODN constructs includes, e.g., the number
and positioning of cytosine-guanine (CpG) motifs and their
internucleotide linkages, as well as the structure and location of
lipid moieties and the presence or absence of a linker. Lipid
moieties can include lipid molecules, such as cholesterol and
tocopherol, that are conjugated to the ODN construct. In addition,
the ODN constructs comprise phosphodiester internucleotide linkages
within one or more CpG motifs of the oligonucleotide.
[0015] ODN constructs according to embodiments of the present
disclosure have been shown to achieve an unexpected level of
enhanced bioavailability and efficacy as TLR9 agonists. While not
wishing to be bound by any particular theory, the enhanced TLR9
agonistic activity can effectively decrease or eliminate HBV
cccDNA-carrying hepatocytes by stimulating the re-expression of
latent virus while stimulating the immune system to recognize the
viral products. In particular, the immune system does not recognize
HBV virus in its latent state and the low-level inflammation
induced by the disclosed ODN constructs can cause the virus to
emerge from that latency. The resulting HBV re-expression and the
formation of newly formed viral expression products are then
recognized by the activated immune system to control circulating
virus and kill the infected cells, effectively eliminating HBV
cccDNA-carrying hepatocytes.
[0016] The disclosed ODN constructs according to embodiments of the
present disclosure can also be used to treat tumors, preferably
cancers, such as colorectal cancer. The disclosed CpG ODN
constructs induce immunity against tumor cells in vivo and
increased survival of tumor-bearing mice.
[0017] In one general aspect, the present disclosure relates to CpG
ODN constructs having a lipid moiety linked to a CpG ODN through a
linker. In an embodiment, the CpG ODN construct has a formula
of:
5'M.sub.1-L.sub.1-[CpG ODN]-L.sub.2-M.sub.23', Formula I:
[0018] wherein:
[0019] each of M.sub.1 and M.sub.2 independently represents a lipid
moiety, preferably the lipid moiety comprises at least one selected
from the group consisting of cholesterol, tocopherol, a palmitoyl
group, and a stearyl group, optionally one of M.sub.1 and M.sub.2
is absent;
[0020] each of L.sub.1 and L.sub.2 independently represents a
linker, preferably the linker comprises at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond,
optionally one of L.sub.1 and L.sub.2 is absent when the respective
M.sub.1 or M.sub.2 is absent; and
[0021] preferably, CpG ODN comprises at least one CpG motif having
a phosphodiester (po) internucleotide linkage;
[0022] optionally, the CpG ODN construct of formula (I) is further
covalently conjugated to a targeting moiety, which is preferably
selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0023] In one embodiment, the present disclosure relates to a CpG
ODN construct having a formula of:
5'M-L-[CpG ODN]3', or Formula (IIa):
5'[CpG ODN]-L-M3' Formula (IIb):
[0024] wherein:
[0025] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group;
[0026] L represents a linker comprising at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond;
and
[0027] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0028] optionally, the CpG ODN construct of Formula (IIa) or (IIb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0029] In an embodiment, the linker L in Formula (IIa) or (IIb)
comprises --((CH.sub.2).sub.2O).sub.m--X).sub.n--, wherein m is an
integer from 1 to 15, X is independently a phosphodiester (po) or
phosphorothioate (ps) linkage, and n is an integer from 1 to 5.
[0030] In another embodiment, the linker L in Formula (IIa) or (I
%) is linked to the lipid moiety M through a phosphodiester (po)
linkage or a phosphorothioate (ps) linkage.
[0031] In yet another embodiment, the linker L in Formula (IIa) or
(IIb) is linked to the CpG ODN via a phosphodiester (po) linkage or
a phosphoramidate linkage, preferably a po linkage.
[0032] In another aspect, the present disclosure relates to an ODN
construct having a structure of:
5'M.sub.1-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]-Y.sub.3-M.sub.23', or Formula (IIIa):
5'M.sub.2-Y.sub.3-[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M.sub.13'
Formula (IIIb):
[0033] wherein:
[0034] M.sub.1 represents a lipid moiety, preferably the lipid
moiety comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0035] M.sub.2 represents a lipid moiety, a targeting moiety, or is
absent,
[0036] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0037] X is independently a bond, a po linkage or a ps linkage,
[0038] each of Y.sub.2 and Y.sub.3 is independently a cleavable
linkage, preferably comprises an ester or an amide bond, more
preferably comprises a po linkage or a phosphoramidate linkage,
most preferably a po linkage, provided that when M.sub.2 is absent,
Y.sub.3 is absent,
[0039] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0040] m is an integer from 1 to 15, and
[0041] n is an integer from 1 to 5.
[0042] In one embodiment, the present disclosure relates to a CpG
ODN construct having a formula of:
5'M-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]3', or Formula (IVa):
5'[CpG
ODN]-Y.sub.2--O(CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M3'
Formula (IVb):
[0043] wherein:
[0044] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0045] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0046] X is independently a bond, a phosphodiester (po) linkage or
a phosphorothioate (ps) linkage,
[0047] Y.sub.2 is a cleavable linkage, preferably comprises an
ester or an amide bond, more preferably comprises a po linkage or a
phosphoramidate linkage, most preferably a po linkage;
[0048] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0049] m is an integer from 1 to 15, preferably 6; and
[0050] n is an integer from 1 to 5, preferably 2;
[0051] optionally, the CpG ODN construct of Formula (IVa) or (IVb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0052] According to particular embodiments, the lipid moiety
represents a cholesterol, tocopherol or a palmitoyl group.
[0053] According to particular embodiments, the CpG ODN in each of
Formula (I) to (IVb) has one or more phosphorothioate (ps)
internucleotide linkages. According to a more particular aspect,
all of the internucleotide linkages of the ODN construct in Formula
(I) are phosphorothioate (ps) linkages. According to a particular
aspect, at least one of the internucleotide linkages between the C
and G of a CpG dinucleotide in the ODN construct is a stereodefined
phosphorothioate (ps) internucleotide linkage. According to a
particular aspect, at least one of the internucleotide linkages
between the C and G of a CpG dinucleotide in the CpG ODN is a
phosphodiester (po) internucleotide linkage, and each of the
remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) linkages. According to a particular aspect,
the CpG ODN has a length of 19 to 24 nucleotides.
[0054] In another general aspect, the present disclosure relates to
a pharmaceutical composition comprising an ODN construct of the
present disclosure and a pharmaceutically acceptable carrier.
[0055] In another general aspect, the present disclosure relates to
a method of preparing a pharmaceutical composition of the present
disclosure, comprising combining an ODN construct of the present
disclosure with a pharmaceutically acceptable carrier.
[0056] In another general aspect, the present disclosure relates to
a method of stimulating an immune response in a subject in need
thereof, comprising administering to the subject a pharmaceutical
composition of the present disclosure.
[0057] In another general aspect, the present disclosure relates to
a method of treating a disease in a subject in need thereof,
comprising administering to the subject the pharmaceutical
composition of the present disclosure. Preferably, the disease is
selected from the group consisting of immune diseases, disorders or
conditions, such as viral infections or cancers. More preferably,
the disease is chronic HBV infection or a solid tumor cancer.
[0058] Other aspects, features and advantages of the present
disclosure will be apparent from the following disclosure,
including the detailed description present disclosure and its
preferred embodiments and the appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] The foregoing summary, as well as the following detailed
description of the present disclosure, will be better understood
when read in conjunction with the appended drawings. It should be
understood that the present disclosure is not limited to the
precise embodiments shown in the drawings.
[0060] In the drawings:
[0061] FIG. 1 shows TLR9 activation of a reporter cell line,
measured by OD630 level, by TLR9 agonists having
phosphodiester-linked CpG motifs at various positions;
[0062] FIG. 2 shows TLR9 activation of a reporter cell line,
measured by OD630 level, by ODN constructs according to embodiments
of the present disclosure comprising phosphodiester-linked CpG
motifs conjugated to cholesterol by a cleavable linker;
[0063] FIG. 3 shows activation of human (left panel) and mouse
(right panel) TLR9 in reporter cell lines, normalized to ODN2006,
by ODN constructs according to embodiments of the present
disclosure;
[0064] FIG. 4 shows in vivo cytokine induction in mice (IL-6, left
panel; TNF-.alpha., middle panel; MIP-1.beta., right panel) by ODN
constructs according to embodiments of the present disclosure at 4
h after the administration of the ODN constructs;
[0065] FIG. 5 shows a schematic of an experiment carried out to
analyze the effect of ODN constructs according to embodiments of
the present disclosure on HBV infection in mice;
[0066] FIG. 6 shows the levels of HBV DNA in mice upon treatment
with a single dose (left panel) or multiple doses (right panel) of
ODN constructs according to embodiments of the present
disclosure;
[0067] FIG. 7 shows the levels of HBsAg in mice upon treatment with
a single dose (left panel) or multiple doses (right panel) of ODN
constructs according to embodiments of the present disclosure;
[0068] FIG. 8 shows the levels of HBeAg in mice upon treatment with
a single dose (left panel) or multiple doses (right panel) of ODN
constructs of the present disclosure;
[0069] FIG. 9 shows in vivo cytokine induction (IL-12p40, left
panel; IL-6, middle panel; MIP-113, right panel) in mice by
subcutaneous injection of ODN constructs of the present
disclosure;
[0070] FIG. 10 shows in vivo cytokine induction (IL-12p40, left
panel; IL-6, middle panel; MIP-1.beta., right panel) in mice by
intravenous injection of an ODN construct of the present disclosure
referred to as AG8;
[0071] FIG. 11 shows the level of HBsAg specific IgG at Day 14 of
mice dosed intravenously (IV) or subcutaneously (SQ) with HBsAg and
an ODN construct;
[0072] FIG. 12 illustrates exemplary ODN constructs according to
embodiments of the present disclosure;
[0073] FIG. 13A shows the levels of HBsAg, anti-HBs antibody, and
HBV DNA in AAV-HBV mice upon subcutaneous administration of AG9, a
ODN construct according to an embodiment of the present
disclosure;
[0074] FIG. 13B shows the levels of HBsAg, anti-HBs antibody, and
HBV DNA in AAV-HBV mice upon intravenous administration of AG9;
[0075] FIG. 13C shows the levels of HBsAg, anti-HBs antibody, and
HBV DNA in AAV-HBV mice upon intravenous administration of AG19, a
ODN construct according to an embodiment of the present
disclosure;
[0076] FIG. 13D shows the levels of HBsAg specific T cells in
AAV-HBV mice upon administration of ODN constructs according to
embodiments of the present disclosure;
[0077] FIG. 14 shows a schematic of a pilot efficacy study with an
ODN construct according to embodiments of the present disclosure
dosed intratumorally (IT) and intravenously (IV) in MC-38
tumor-bearing mice (colorectal cancer model);
[0078] FIGS. 15A-15C show the tumor volume in naive C57BL/6 mice
implanted with MC-38 colon carcinoma cells after being dosed
intravenously with increasing amounts of ODN constructs according
to embodiments of the present disclosure, in particular,
[0079] FIG. 15A shows the tumor volume in the mice dosed
intravenously with the AG1 ODN construct;
[0080] FIG. 15B shows the tumor volume in the mice dosed
intravenously with the AG9 ODN construct; and
[0081] FIG. 15C shows the tumor volume in the mice dosed
intravenously with the AG17 ODN construct;
[0082] FIG. 16 shows a schematic of a Maximum Tolerated Dose
(MTD)/efficacy study with an ODN construct according to an
embodiment of the present disclosure in MC-38 tumor bearing
mice;
[0083] FIG. 17 illustrates a synthesis scheme for ODN constructs
according to embodiments of the present disclosure;
[0084] FIG. 18 shows CD40 levels in B cells purified from mouse
splenocytes isolated from C57BL/6 mice and stimulated with ODN
constructs according to embodiments of the present disclosure;
[0085] FIG. 19 shows activation of human TLR9 in a reporter cell
line, normalized to ProMune, by ODN constructs according to
embodiments of the present disclosure;
[0086] FIG. 20 shows activation of mouse TLR9, normalized to
ODN1826, by ODN constructs according to embodiments of the present
disclosure;
[0087] FIG. 21A shows that subcutaneous (SQ) administration of AG21
(AG9 conjugated to AlexaFluor-647) to mice resulted in oligo
accumulation in draining lymph nodes of the mice as compared to
AG20 (AG1 conjugated to AlexaFluor 647);
[0088] FIG. 21B shows that intravenous (IV) administration of AG21
to mice resulted in oligo accumulation in spleen of the mice as
compared to AG20;
[0089] FIG. 22A shows that tocopherol could facilitate binding of
the CpG ODN to serum proteins such as bovine serum albumin
(BSA);
[0090] FIG. 22B demonstrates that conjugating the CpG ODN to
palmitoyl facilitated the interaction of the ODN to serum proteins
within fetal bovine serum (FBS); and
[0091] FIG. 23 demonstrates that the tocopherol conjugation of the
CpG ODN imparted the property of micelle formation to the ODN.
[0092] FIG. 24 shows the structure of a CpG ODN.
[0093] FIG. 25 shows the structure of an ODN construct.
[0094] FIG. 26 shows the structure of an ODN construct.
[0095] FIG. 27 shows the structure of an ODN construct.
[0096] FIG. 28 shows the structure of an ODN construct.
[0097] FIG. 29 shows the structure of an ODN construct.
[0098] FIG. 30 shows the structure of an ODN construct.
[0099] FIG. 31 shows the structure of an ODN construct.
DETAILED DESCRIPTION
[0100] Various publications, articles and patents are cited or
described in the background and throughout the specification; each
of these references is herein incorporated by reference in its
entirety. Discussion of documents, acts, materials, devices,
articles or the like which has been included in the present
specification is for the purpose of providing context for the
present disclosure. Such discussion is not an admission that any or
all of these matters form part of the prior art with respect to any
inventions disclosed or claimed.
Definitions
[0101] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning commonly understood to one of
ordinary skill in the art to which the present disclosure pertains.
Otherwise, certain terms used herein have the meanings as set in
the specification. All patents, published patent applications and
publications cited herein are incorporated by reference as if set
forth fully herein. It must be noted that as used herein and in the
appended claims, the singular forms "a," "an," and "the" include
plural reference unless the context clearly dictates otherwise.
[0102] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated integer or step or group of
integers or steps but not the exclusion of any other integer or
step or group of integer or step. When used herein the term
"comprising" can be substituted with the term "containing" or
"including" or sometimes when used herein with the term
"having".
[0103] When used herein "consisting of" excludes any element, step,
or ingredient not specified in the claim element. When used herein,
"consisting essentially of" does not exclude materials or steps
that do not materially affect the basic and novel characteristics
of the claim. Any of the aforementioned terms of "comprising",
"containing", "including", and "having", whenever used herein in
the context of an aspect or embodiment of the invention can be
replaced with the term "consisting of" or "consisting essentially
of" to vary scopes of the disclosure.
[0104] As used herein, the term "TLR9" or "Toll like receptor 9",
also known as CD289, UNQ5798 or PRO19605, refers to a
nucleotide-sensing TLR that is activated by unmethylated
cytosine-phosphate-guanine (CpG) dinucleotides. Examples of TLR9
include, but are not limited to, a human TLR9 that is a 1032 amino
acid-long protein encoded by an mRNA transcript 3922 nucleotides
long (NM 017442.3). The amino acid sequence of the exemplified
human TLR9 is represented in GenBank Accession No. NP 059138.1. As
used herein, the term "TLR9" includes homologs of TLR9 from species
other than human, such as Macaca Fascicularis (cynomolgous monkey)
or Pan troglodytes (chimpanzee). As used herein, the term "TLR9"
includes proteins comprising mutations, e.g., point mutations,
fragments, insertions, deletions and splice variants of full length
wild type TLR9. The term "TLR9" also encompasses post-translational
modifications of the TLR9 amino acid sequence.
[0105] As used herein, the term "agonist" refers to a molecule that
binds to one or more TLRs and induces a receptor mediated response.
For example, an agonist can induce, stimulate, increase, activate,
facilitate, enhance, or up regulate the activity of the receptor.
Such activities are referred to as "agonistic activities." For
example, a TLR9 agonist can activate or increase cell signaling
through the bound receptor. Agonists include, but are not limited
to nucleic acids, small molecules, proteins, carbohydrates, lipids
or any other molecules that bind or interact with receptors.
Agonists can mimic the activity of a natural receptor ligand.
Agonists can be homologous to these natural receptor ligands in
respect to sequence, conformation, charge or other characteristics
such that they can be recognized by the receptors. This recognition
can result in physiologic and/or biochemical changes within the
cell, such that the cell reacts to the presence of the agonist in
the same manner as if the natural receptor ligand were present. As
used herein, the term "TLR9 agonist" refers to any compound that
acts as an agonist of TLR9.
[0106] As used herein, the terms "induce" and "stimulate" and
variations thereof refer to any measurable increase in cellular
activity. Induction of a TLR9-mediated cellular activity can
include, for example, activation, proliferation, or maturation of a
population of immune cells, increasing the production of a
cytokine, and/or another indicator of increased immune function. In
certain embodiments, induction of an immune response can include
increasing the proliferation of B cells, producing antigen-specific
antibodies, increasing the proliferation of antigen-specific T
cells, improving dendritic cell antigen presentation and/or an
increasing expression of certain cytokines, chemokines and
co-stimulatory markers.
[0107] As used herein, a "lipid moiety" refers to a moiety
containing a lipophilic structure. Lipid moieties, such as an alkyl
group, a fatty acid, a triglyceride, diglyceride, steroid,
sphingolipid, glycolipid or a phospholipid. For example, a lipid
moiety can include a sterol such as cholesterol, a methylated
chromanol ring with a methylated hydrophobic side chain such as
tocopherol, or a saturated fatty acid such as palmitic acid or an
ester thereof. Lipid moieties when attached to highly hydrophilic
molecules, such as nucleic acids, can substantially enhance plasma
protein binding and consequently circulation half-life of the
hydrophilic molecules. In addition, binding to certain plasma
proteins, such as lipoproteins, has been shown to increase uptake
in specific tissues expressing the corresponding lipoprotein
receptors (e.g., LDL-receptor HDL-receptor or the scavenger
receptor SR-B1). See, e.g., Bijsterbosch, M. K., et al. (2000)
Nucleic Acids Res. 28, 2717-25; Wolfrum, C., et al. (2007) Nat
Biotechnol 25:1149-57 25.
[0108] A lipid moiety can also be used in combination with a
targeting moiety in order to improve the intracellular trafficking
of the targeted delivery approach. The targeting moiety can be any
suitable moiety or ligand attached directly or indirectly to a CpG
ODN of the present disclosure that can direct the ODN construct to
in vivo targets such as macromolecules (e.g., receptors), cells
(e.g., macrophages, dendritic cells, hepatocytes, tumor cells) or
components thereof. Accordingly, a targeting moiety can include any
suitable naturally occurring or synthetic molecules such as lipids,
lipid acid derivatives, galactose, N-acetylgalactosamine (GalNAc),
fucose, mannose, sialic acid, N-acetyl neuraminic acid, antibodies,
liposomes, micelles, dendrimers, nanospheres, nanocapsules,
peptides, proteins, albumin and hormones.
[0109] As used herein, the term "linker" refers to a chemical
moiety that joins a nucleotide, such as the 5' or the 3' terminal
nucleotide of a CpG ODN, to a lipid moiety or a targeting moiety.
The term "cleavable linker" refers to a linker or portion thereof
that undergoes cleavage to remove the lipid moiety or the targeting
moiety from the nucleotide when desired under certain conditions
without altering the nucleotide or the nucleic acid molecule to
which it is attached. Depending upon the nature of the linkage,
cleavage can be accomplished in vitro or in vivo, for example, by
acid or base treatment (e.g. of hydrazone), by enzymatic cleavage
(e.g., by nucleases or proteases), by oxidation or reduction of the
linkage (e.g. of disulfide bridges), by light treatment (e.g., by
photobleaching). According to particular embodiments, the linker
comprises any flexible cleavable linker. The linkers include but
are not limited to, for example, a covalent bond, a substituted or
unsubstituted alkyl, a substituted or unsubstituted heteroalkyl
such as polyethylene glycol (PEG), one, two, or three abasic and/or
ribitol groups, ethylene glycol moieties, or a peptide. According
to embodiments of the present disclosure, the linker is covalently
linked to the CpG ODN via a cleavable linkage, such as a
phosphodiester (po), phosphoramidate linkage (np) or
phosphorothioate (ps) linkage, preferably via an ester or an amide
bond, such as a po linkage or an np linkage, most preferably a po
linkage. According to embodiments of the present disclosure, the
linker comprises ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, covalently linked to
the CpG ODN via a po, np, or ps linkage.
[0110] In an embodiment, the cleavable linkage such as a po linkage
is cleavable by a phosphodiesterase enzyme, such as, e.g., a cyclic
nucleotide phosphodiesterase, phospholipases C, phospholipases D,
autotaxin, sphingomyelin phosphodiesterase, DNase, RNase, or a
restriction endonuclease.
[0111] According to embodiments of the present disclosure, a linker
comprises ((CH.sub.2).sub.2O).sub.m, wherein m is an integer from 1
to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15.
According to particular embodiments, the linker comprises one or
more hexaethylene glycol (HEG) moieties having the following
molecular formula: ((CH.sub.2).sub.2O).sub.6.
[0112] In an embodiment, the linker comprises one or more HEG
moieties linked by one or more phosphodiester (po) or
phosphorothioate (ps) linkages. In an embodiment, the linker
comprises one HEG moiety linked to the CpG ODN via a po linkage. In
an embodiment, the linker comprises two HEG moieties linked
together by a po linkage and to the CpG ODN via a po linkage.
[0113] According to other embodiments, the linker comprises a
cleavable disulfide group. According to other embodiments, the
linker comprises a protease-cleavable peptide, such as, for
example, a peptide linker comprising a cleavage site for a protease
specific to a tumor microenvironment, such as uPA, legumain,
matriptase, or cathepsin.
[0114] According to embodiments of the invention, a lipid moiety
(M), such as a cholesterol, tocopherol, a palmitoyl group, or a
stearyl group, can be covalently linked to CpG ODN through a
linker. The linker can comprise one or more linker moieties such as
an ethylene glycol having the formula ((CH.sub.2).sub.2O).sub.m,
where m is 1-15. In embodiments, m is 6 and the linker moiety is a
hexaethylene glycol (HEG).
[0115] According to embodiments of the invention, a lipid moiety
(M), such as a cholesterol, tocopherol, a palmitoyl group, or a
stearyl group, can be covalently linked to a HEG moiety directly
via a bond, or indirectly via a second linker, such as a linker
comprising ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15. The second linker can
be covalently linked to the HEG via a bond, a phosphodiester (po)
linkage, phosphoramidate linkage (np) or a phosphorothioate (ps)
linkage.
[0116] Each linker moiety can be independently linked to the other
linker moieties by a linkage such as a linkage selected from the
group consisting of phosphodiester (po) linkage, phosphoramidate
linkage (np) or a phosphorothioate (ps) linkage. The linker can
further be joined to the CpG ODN through a cleavable linkage such
as a cleavable linkage selected form the group consisting of a
phosphodiester (po) linkage, phosphoramidate linkage (np) and a
phosphorothioate (ps) linkage. In embodiments, the linker comprises
one linker moiety between the lipid moiety and CpG ODN. In
embodiments, the linker comprises two linker moieties between the
lipid moiety and CpG ODN. In embodiments, each linker moiety is
joined to at least one other linker moiety through a po linkage. In
embodiments, each linker moiety is joined to at least one other
linker moiety through a ps linkage. In embodiments, each linker
moiety is joined to at least one other linker moiety through an np
linkage. In embodiments, the linker moiety is covalently linked to
the lipid moiety via a second linker, such as a linker comprising
ethylene glycol having the formula ((CH.sub.2).sub.2O).sub.o,
wherein o is 1-15, and the second linker is covalently lined to the
lipid moiety via a bond, a phosphodiester (po) linkage,
phosphoramidate linkage (np) or a phosphorothioate (ps) linkage. In
embodiments, the linker comprises two linker moieties joined by a
po linkage between the lipid moiety and CpG ODN. In embodiments,
the linker comprises two linker moieties joined by a ps linkage
between the lipid moiety and CpG ODN. In embodiments, the linker
comprises two linker moieties joined by an np linkage between the
lipid moiety and CpG ODN.
[0117] The lipid moiety (M) can be joined to the linker through a
bond or linkage such as a linkage selected from the group
consisting of phosphodiester (po) linkage, phosphoramidate linkage
(np) or a phosphorothioate (ps) linkage. As used herein,
"M-po(HEG)" or "(HEG)po-M" means that the lipid moiety M is
covalently linked to the HEG moiety directly via a phosphodiester
(po) linkage, or indirectly via a second linker, such as a linker
comprising ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, and the second linker
is covalently linked to the HEG moiety via a phosphodiester (po)
linkage. For example, as used herein, "Toco-ps(HEG)" can refer to a
tocopherol group covalently linked to CpG ODN via a second linker
such as ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, which is covalently
linked to a HEG moiety via a phosphodiester (po) linkage.
[0118] As used herein, "M-ps(HEG)" or "(HEG)ps-M" means that the
lipid moiety M is covalently linked to the HEG moiety directly via
a phosphorothioate (ps) linkage, or indirectly via a second linker,
such as a linker comprising ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, and the second linker
is covalently linked to the HEG moiety via a phosphorothioate (ps)
linkage. For example, as used herein, "Toco-ps(HEG)" can refer to a
tocopherol group covalently linked to CpG ODN via a second linker
such as ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, which is covalently
linked to a HEG moiety via a phosphorothioate (ps) linkage.
[0119] As used herein, the term "CpG" or "CpG motif" refers to a
dinucleotide sequence which contains unmethylated cytosine-guanine
(i.e., a cytosine (C) followed by a guanine (G), i.e., 5'-CG-3')
linked by a phosphate bond or a phosphorus-containing backbone such
as a phosphodiester (po) linkage.
[0120] As used herein, "oligonucleotide," "oligodeoxynucleotide" or
"ODN" refers to a polynucleotide formed from a plurality of linked
nucleotide units. Such oligonucleotides can be obtained from
existing nucleic acid sources or can be produced by synthetic
methods. In some embodiments, the oligonucleotides each have from
about 5 to about 30 nucleotide residues, preferably from about 10
to about 25 nucleotide residues, more preferably from about 19 to
about 24 nucleotide residues. In an embodiment, the ODN contains 19
nucleotide residues. In an embodiment, the ODN contains 20
nucleotide residues. In an embodiment, the ODN contains 21
nucleotide residues. In an embodiment, the ODN contains 22
nucleotide residues. In an embodiment, the ODN contains 23
nucleotide residues. In an embodiment, the ODN contains 24
nucleotide residues. ODNs of the present disclosure can be obtained
from existing nucleic acid sources (e.g. genomic or cDNA) but are
preferably synthetic (e.g. produced by oligonucleotide
synthesis).
[0121] As used herein, "nucleotide" includes any native or
naturally occurring nucleotides, which include a nitrogenous base
selected from the group consisting of adenine (A), thymidine (T),
cytosine (C), guanine (G) and uracil (U), a deoxyribose sugar, and
a phosphate group. Exemplary nucleotides include, but are not
limited to, naturally occurring nucleotide bases, e.g., adenine,
guanine, cytosine, uracil, and thymine.
[0122] As used herein, the terms "CpG oligonucleotide," "CpG
oligodeoxynucleotide" and "CpG ODN" are used interchangeably and
refer to an oligonucleotide comprising at least one CpG motif. CpG
ODNs of the present disclosure can include one or more classes of
CpG ODNs, such as a class A, class B, class C or class P ODN, as
described in Bode et al., 2011, Expert Rev Vaccines, 10(4):
499-511. Class A CpG ODNs, also referred to as D-type, contain a
central CpG-containing palindromic motif and poly-G motifs at the
5' and/or 3' ends. Class B CpG ODNs, also referred to as K-type,
are typically fully stabilized by a full phosphorothioate backbone
and include one or more CpG dinucleotides within certain preferred
base contexts. Class C CpG ODNs are typically fully stabilized by a
full phosphorothioate backbone and include a central palindromic
CpG motif as well as other CpG dinucleotides. Class P CpG ODNs are
typically fully stabilized by a full phosphorothioate backbone and
include two palindromes and multiple CpG dinucleotides.
[0123] As used herein, the term "internucleotide linkage" refers to
a chemical linkage to join two adjacent nucleotides through their
sugars consisting of a phosphorous atom and a charged or neutral
group between adjacent nucleosides. Examples of internucleotide
linkages include phosphodiester (po), phosphorothioate (ps),
phosphoramidate (np), phosphorodithioate (ps2), methylphosphonate
(mp), and methylphosphorothioate (rp). Phosphorothioate,
phosphoramidate, phosphorodithioate, methylphosphonate and
methylphosphorothioate are stabilizing internucleotide linkages,
while phosphodiester is a naturally-occurring internucleotide
linkage.
[0124] Oligonucleotide phosphorothioates are typically synthesized
as a random racemic mixture of Rp and Sp phosphorothioate linkages.
However, according to particular embodiments, the phosphorothioate
linkages of the disclosed ODN constructs contain a mixture of Rp
and Sp phosphorothioate linkages. According to particular
embodiments, the CpG ODN of the ODN construct has a stereodefined
ps internucleotide linkage, i.e. the ps linkage is either Rp or Sp
in at least 75%, such as at least 80%, or at least 85%, or at least
90%, or at least 95%, such as at least 99% of the oligonucleotide
molecules present in the CpG ODN.
[0125] According to particular embodiments, one to four, preferably
three or four, of the CpG dinucleotides in the CpG ODN each have a
phosphodiester (po) internucleotide linkage, and each of the
remaining internucleotide linkages of the CpG ODN are
phosphorothioate internucleotide linkages. In embodiments, each of
the CpG dinucleotides in the CpG ODN have a phosphodiester (po)
internucleotide linkage, and each of the remaining nucleotides in
the CpG ODN have a phosphorothioate (ps) internucleotide
linkage.
[0126] As used herein, the term "carrier" refers to any excipient,
diluent, filler, salt, buffer, stabilizer, solubilizer, oil, lipid,
lipid containing vesicle, microsphere, liposomal encapsulation, or
other material well known in the art for use in pharmaceutical
formulations. It will be understood that the characteristics of the
carrier, excipient or diluent will depend on the route of
administration for a particular application. As used herein, the
term "pharmaceutically acceptable carrier" refers to a non-toxic
material that does not interfere with the effectiveness of a
composition according to the present disclosure or the biological
activity of a composition according to the present disclosure.
According to particular embodiments, in view of the present
disclosure, any pharmaceutically acceptable carrier suitable for
use in a CpG ODN-based agonist pharmaceutical composition can be
used in the present disclosure.
[0127] As used herein, the term "subject" refers to an animal.
According to particular embodiments, the subject is a mammal
including a non-primate (e.g., a camel, donkey, zebra, cow, pig,
horse, goat, sheep, cat, dog, rat, rabbit, guinea pig or mouse) or
a primate (e.g., a monkey, chimpanzee, or human). In particular
embodiments, the subject is a human.
[0128] As used herein, the term "therapeutically effective amount"
refers to an amount of an active ingredient or component that
elicits the desired biological or medicinal response in a subject.
A therapeutically effective amount can be determined empirically
and in a routine manner, in relation to the stated purpose. For
example, in vitro assays can optionally be employed to help
identify optimal dosage ranges. Selection of a particular effective
dose can be determined (e.g., via clinical trials) by those skilled
in the art based upon the consideration of several factors,
including the disease to be treated or prevented, the symptoms
involved, the patient's body mass, the patient's immune status and
other factors known by the skilled artisan. The precise dose to be
employed in the formulation will also depend on the route of
administration, and the severity of disease, and should be decided
according to the judgment of the practitioner and each patient's
circumstances. Effective doses can be extrapolated from
dose-response curves derived from in vitro or animal model test
systems.
[0129] As used herein, the terms "treat," "treating," and
"treatment" are all intended to refer to an amelioration or
reversal of at least one measurable physical parameter related to a
disease in which modulation of TLR9 activity would be beneficial,
such as an immune disease, disorder or condition, which is not
necessarily discernible in the subject, but can be discernible in
the subject. The terms "treat," "treating," and "treatment," can
also refer to causing regression, preventing the progression, or at
least slowing down the progression of the disease, disorder, or
condition. In a particular embodiment, "treat," "treating," and
"treatment" refer to an alleviation, prevention of the development
or onset, or reduction in the duration of one or more symptoms
associated with the disease in which modulation of TLR9 activity
would be beneficial such as an immune disease, disorder or
condition, including a viral infection or a cancer. In a particular
embodiment, "treat," "treating," and "treatment" refer to
prevention of the recurrence of the disease, disorder, or
condition. In a particular embodiment, "treat," "treating," and
"treatment" refer to an increase in the survival of a subject
having the disease, disorder, or condition. In a particular
embodiment, "treat," "treating," and "treatment" refer to
elimination of the disease, disorder, or condition in the
subject.
[0130] As used herein a "disease in which modulation of TLR9
activity would be beneficial" include diseases in which stimulation
of TLR9 signaling would benefit the subject. For example, a disease
in which modulation of TLR9 activity would be beneficial can
include immune diseases, disorders or conditions. According to
particular embodiments, the disease, disorder or condition to be
treated is a cancer, an inflammatory disease, disorder or
condition, an autoimmune disease, disorder or condition, or a
disease, disorder or condition caused by a pathogen, such as a
viral infection.
[0131] According to particular embodiments, the viral infection is
an RNA or DNA virus such as adenovirus, cytomegalovirus, hepatitis
A virus (HAV), hepadnaviruses including HBV, chronic HBV,
flaviviruses including Yellow Fever virus, hepaciviruses including
hepatitis C virus (HCV), herpes simplex type 1 and 2, herpes
zoster, human herpesvirus 6, human immunodeficiency virus (HIV),
human papilloma virus (HPV), influenza A virus, influenza B virus,
measles, parainfluenza virus, pestivirus, poliovirus, poxvirus,
rhinovirus, coronovirus, respiratory syncytial virus (RSV),
multiple families of viruses that cause hemorrhagic fevers,
including the Arenaviruses, the Bunyaviruses and Filoviruses, and a
range of viral encephalitides caused by RNA and DNA viruses.
[0132] According to particular embodiments, the cancer or tumor is
a solid tumor or blood cancer. According to particular embodiments,
the cancer or tumor is a carcinoma, sarcoma, melanoma, lymphoma, or
leukemia. According to particular embodiments, the cancer or tumor
is a carcinoma, a sarcoma, a leukemia, or a cancer caused by a
virus. According to particular embodiments, the cancer is a
mammary, colon, bladder, lung, prostate, stomach, or pancreas
carcinoma or a lymphoblastic or myeloid leukemia.
[0133] As used herein, the term "in combination," in the context of
the administration of two or more therapies to a subject, refers to
the use of more than one therapy. The use of the term "in
combination" does not restrict the order in which therapies are
administered to a subject or the time between such administration.
For example, a first therapy (e.g., a composition described herein)
can be administered prior to (e.g., 5 minutes, 15 minutes, 30
minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours,
16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks,
3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before),
concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes,
30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12
hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2
weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks
after) the administration of a second therapy to a subject. ODN
Constructs
[0134] In an embodiment, the CpG ODN construct has a formula
of:
5'M.sub.1-L.sub.1-[CpG ODN]-L.sub.2-M.sub.23', Formula I:
[0135] wherein:
[0136] each of M.sub.1 and M.sub.2 independently represents a lipid
moiety, preferably the lipid moiety comprises at least one lipid
moiety selected from the group consisting of cholesterol,
tocopherol, a palmitoyl group, and a stearyl group, optionally one
of M.sub.1 and M.sub.2 is absent;
[0137] each of L.sub.1 and L.sub.2 independently represents a
linker, preferably the linker comprises at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond,
optionally one of L.sub.1 and L.sub.2 is absent when the respective
M.sub.1 or M.sub.2 is absent; and
[0138] preferably, CpG ODN comprises at least one CpG motif having
a phosphodiester (po) internucleotide linkage.
[0139] In one embodiment, the present disclosure relates to a CpG
ODN construct having a formula of:
5'M-L-[CpG ODN]3', or Formula (IIa):
5'[CpG ODN]-L-M3' Formula (IIb):
[0140] wherein:
[0141] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group;
[0142] L represents a linker comprising at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond;
and
[0143] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage.
[0144] According to particular aspects, the linker L comprises
5-100 atoms, more preferably 20-80 atoms, 20-40 atoms, or 30-60
atoms in length selected from the group consisting of carbon,
nitrogen, oxygen, hydrogen, sulfur and phosphorus. According to
particular aspects, the linker comprises a phosphodiester (po) or
phosphorothioate (ps) linkage, and comprises
((CH.sub.2).sub.2O).sub.m, wherein m is an integer from 1 to 15,
preferably 5 to 10, more preferably 6.
[0145] In an embodiment, the linker L in Formula (IIa) or (IIb)
comprises --((CH.sub.2).sub.2O).sub.m--X).sub.n--, wherein m is an
integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14 or 15, X is independently a phosphodiester (po) or
phosphorothioate (ps) linkage, and n is an integer from 1 to 5,
such as 1, 2, 3, 4, or 5.
[0146] In another embodiment, the linker L in Formula (IIa) or (I
%) is linked to the lipid moiety M through a phosphodiester (po)
linkage or a phosphorothioate (ps) linkage.
[0147] In yet another embodiment, the linker L in Formula (IIa) or
(IIb) is linked to the CpG ODN via a phosphodiester (po) linkage or
a phosphoramidate linkage, preferably a po linkage.
[0148] In an embodiment, L is
--Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2--; or L is
--Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1--,
wherein,
[0149] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond;
[0150] Y.sub.2 is a cleavable linkage comprising an ester or an
amide bond;
[0151] each X is independently a bond, a po linkage or a ps
linkage;
[0152] m is an integer from 1 to 15; and
[0153] n is an integer from 1 to 5.
[0154] In embodiments, Y.sub.2 is a po linkage or an np
linkage.
[0155] In another aspect, the present disclosure relates to an ODN
construct having a structure of:
5'M.sub.1-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]-Y.sub.3-M.sub.23', or Formula (IIIa):
5'M.sub.2-Y.sub.3-[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M.sub.13'
Formula (IIIb):
[0156] wherein:
[0157] M.sub.1 represents a lipid moiety, preferably the lipid
moiety comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0158] M.sub.2 represents a lipid moiety, a targeting moiety, or is
absent,
[0159] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0160] X is independently a bond, a po linkage or a ps linkage,
[0161] each of Y.sub.2 and Y.sub.3 is independently a cleavable
linkage, preferably comprises an ester or an amide bond, more
preferably comprises a po linkage or a phosphoramidate linkage,
most preferably a po linkage, provided that when M.sub.2 is absent,
Y.sub.3 is absent,
[0162] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having a po internucleotide linkage;
[0163] m is an integer from 1 to 15, and
[0164] n is an integer from 1 to 5.
[0165] In one embodiment, the present disclosure relates to a CpG
ODN construct having a formula of:
5'M-Y.sub.1--O(CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]3', or Formula (IVa):
5'[CpG
ODN]-Y.sub.2--O(CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M3'
Formula (IVb):
[0166] wherein:
[0167] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0168] Y.sub.1 is a bond or a linker, preferably 1-5 elthylene
glycol moieties, covalently linked to
(((CH.sub.2).sub.2O).sub.m--X).sub.n via a phosphodiester (po)
linkage, a phosphorothioate (ps) linkage or a bond,
[0169] X is independently a bond, a phosphodiester (po) linkage or
a phosphorothioate (ps) linkage, Y.sub.2 is a cleavable linkage,
preferably comprises an ester or an amide bond, more preferably
comprises a po linkage or a phosphoramidate linkage, most
preferably a po linkage;
[0170] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0171] m is an integer from 1 to 15, preferably 6; and
[0172] n is an integer from 1 to 5, preferably 2;
[0173] optionally, the CpG ODN construct of Formula (IVa) or (IVb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0174] According to a particular embodiment, X is independently a
phosphodiester (po) linkage or absent, Y is a po linkage, m is 6, n
is 2, M represents a lipid moiety comprising a tocopherol or a
palmitoyl group.
[0175] According to a particular embodiment, the ODN construct has
a structure selected from the group consisting of:
5'M-po(HEG)po(HEG)po-[CpG ODN]3';
5'M-ps(HEG)po(HEG)po-[CpG ODN]3',
5'M-ps(HEG)ps(HEG)po-[CpG ODN]3',
5'M-po(HEG)ps(HEG)po-[CpG ODN]3',
5'[CpG ODN]-po(HEG)po(HEG)po-M3',
5'[CpG ODN]-po(HEG)ps(HEG)po-M3',
5'[CpG ODN]-po(HEG)ps(HEG)ps-M3', and
5'[CpG ODN]-po(HEG)po(HEG)ps-M3',
wherein:
[0176] M represents a lipid moiety comprising at least one selected
from the group consisting of cholesterol, tocopherol, a palmitoyl
group, and a stearyl group;
[0177] po represents a phosphodiester linkage;
[0178] HEG represents ((CH.sub.2).sub.2O).sub.6;
[0179] ps represents a phosphorothioate linkage; and
[0180] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage,
[0181] wherein M is covalently linked to (HEG) directly via a po or
ps linkage, or indirectly via a second linker that is linked to
(HEG) directly via a po or ps linkage.
[0182] According to a particular embodiment, the ODN construct has
a structure selected from the group consisting of:
5'Toco-po(HEG)po(HEG)po-[CpG ODN]3', wherein Toco represents
tocopherol,
5'Chol-po(HEG)po(HEG)po-[CpG ODN]3', wherein Chol represents
cholesterol,
5'Palm-po(HEG)po(HEG)po-[CpG ODN]3', wherein Palm represents a
palmitoyl group,
5'[CpG ODN]-po(HEG)ps-Chol3', wherein Chol represents
cholesterol,
5'[CpG ODN]-po(HEG)ps-Toco3', wherein Toco represents tocopherol,
and
5'[CpG ODN]-po(HEG)ps-Palm3', wherein Palm represents a palmitoyl
group,
wherein:
[0183] po represents a phosphodiester linkage;
[0184] HEG represents ((CH.sub.2).sub.2O).sub.6;
[0185] ps represents a phosphorothioate linkage; and
[0186] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage,
[0187] wherein the tocopherol, the cholesterol, or the palmitoyl
group is covalently linked to the (HEG) directly via a po or ps
linkage, or indirectly via a second linker that is linked to (HEG)
directly via a po or ps linkage.
[0188] In an embodiment, the CpG ODN contains a number of CpG
dinucleotides suitable to activate TLR9. In an embodiment, the CpG
ODN contains at least one CpG dinucleotide. In an embodiment, the
CpG ODN contains at least two CpG dinucleotides. In an embodiment,
the CpG ODN contains at least three CpG dinucleotides. In an
embodiment, the CpG ODN contains at least four CpG dinucleotides.
In an embodiment, the CpG ODN contains one CpG dinucleotide. In an
embodiment, the CpG ODN contains two CpG dinucleotides. In an
embodiment, the CpG ODN contains three CpG dinucleotides. In an
embodiment, the CpG ODN contains four CpG dinucleotides.
[0189] In an embodiment, the CpG dinucleotides of the CpG ODN are
positioned within the CpG ODN to activate TLR9. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least one nucleotide. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least two nucleotides. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least three nucleotides. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least four nucleotides. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least five nucleotides. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by at least six nucleotides. In an embodiment, a
first CpG dinucleotide of the CpG ODN is separated from a second
CpG dinucleotide by one nucleotide. In an embodiment, a first CpG
dinucleotide of the CpG ODN is separated from a second CpG
dinucleotide by two nucleotides. In an embodiment, a first CpG
dinucleotide of the CpG ODN is separated from a second CpG
dinucleotide by three nucleotides. In an embodiment, a first CpG
dinucleotide of the CpG ODN is separated from a second CpG
dinucleotide by four nucleotides. In an embodiment, a first CpG
dinucleotide of the CpG ODN is separated from a second CpG
dinucleotide by five nucleotides. In an embodiment, a first CpG
dinucleotide of the CpG ODN is separated from a second CpG
dinucleotide by six nucleotides.
[0190] In an embodiment, a CpG dinucleotide is separated from the
3' end of the CpG ODN by at least one nucleotide. In an embodiment,
a CpG dinucleotide is separated from the 3' end of the CpG ODN by
at least two nucleotides. In an embodiment, a CpG dinucleotide is
separated from the 3' end of the CpG ODN by at least three
nucleotides. In an embodiment, a CpG dinucleotide is separated from
the 3' end of the CpG ODN by at least four nucleotides. In an
embodiment, a CpG dinucleotide is separated from the 3' end of the
CpG ODN by at least five nucleotides. In an embodiment, a CpG
dinucleotide is separated from the 3' end of the CpG ODN by one
nucleotide. In an embodiment, a CpG dinucleotide is separated from
the 3' end of the CpG ODN by two nucleotides. In an embodiment, a
CpG dinucleotide is separated from the 3' end of the CpG ODN by
three nucleotides. In an embodiment, a CpG dinucleotide is
separated from the 3' end of the CpG ODN by four nucleotides. In an
embodiment, a CpG dinucleotide is separated from the 3' end of the
CpG ODN by five nucleotides.
[0191] In an embodiment, a CpG dinucleotide is separated from the
5' end of the CpG ODN by at least one nucleotide. In an embodiment,
a CpG dinucleotide is separated from the 5' end of the CpG ODN by
at least two nucleotides. In an embodiment, a CpG dinucleotide is
separated from the 5' end of the CpG ODN by at least three
nucleotides. In an embodiment, a CpG dinucleotide is separated from
the 5' end of the CpG ODN by at least four nucleotides. In an
embodiment, a CpG dinucleotide is separated from the 5' end of the
CpG ODN by at least five nucleotides. In an embodiment, a CpG
dinucleotide is separated from the 5' end of the CpG ODN by one
nucleotide. In an embodiment, a CpG dinucleotide is separated from
the 5' end of the CpG ODN by two nucleotides. In an embodiment, a
CpG dinucleotide is separated from the 5' end of the CpG ODN by
three nucleotides. In an embodiment, a CpG dinucleotide is
separated from the 5' end of the CpG ODN by four nucleotides. In an
embodiment, a CpG dinucleotide is separated from the 5' end of the
CpG ODN by five nucleotides.
[0192] According to particular aspects, the CpG ODN of the ODN
construct has a phosphorothioate (ps) internucleotide linkage.
According to particular aspects, the CpG ODN of the ODN construct
has a stereodefined phosphorothioate (ps) internucleotide linkage.
According to particular aspects, one to four, preferably three or
four of the CpG dinucleotides in the CpG ODN of the ODN construct
each have a phosphodiester (po) internucleotide linkage, and each
of the remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) internucleotide linkages. According to other
particular aspects, two of the internucleotide linkages in the CpG
ODN each have a phosphodiester (po) internucleotide linkage, and
each of the remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) linkages. According to other particular
aspects, three of the internucleotide linkages in the CpG ODN each
have a phosphodiester (po) internucleotide linkage, and each of the
remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) linkages. According to other particular
aspects, four of the internucleotide linkages in the CpG ODN each
have a phosphodiester (po) internucleotide linkage, and each of the
remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) linkages. According to yet other particular
aspects, five or more of the internucleotide linkages in the CpG
ODN each have a phosphodiester (po) internucleotide linkage, and
each of the remaining internucleotide linkages of the CpG ODN are
phosphorothioate (ps) linkages.
[0193] According to some embodiments, an ODN construct of the
present disclosure comprises a TLR9 agonist comprising a CpG ODN
comprising, preferably consisting of a polynucleotide sequence
selected from the group consisting of:
TABLE-US-00001 (SEQ ID NO: 1) 5' TCGTCGTTTTGTCGTTTTGTCGTT 3'; (SEQ
ID NO: 2) 5' GGGGGACGATCGTCGGGGGG 3'; (SEQ ID NO: 3) 5'
GGGGTCAACGTTGAGGGGGG 3'; (SEQ ID NO: 4) 5' TCCATGACGTTCCTGACGTT 3';
(SEQ ID NO: 5) 5' TCGTCGTTTTCGGCGCGCGCCG 3'; (SEQ ID NO: 6) 5'
TCGTCGTTACGTAACGACGACGTT 3'; and (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTGTCGT 3'.
[0194] According to some embodiments, an ODN construct of the
present disclosure comprises a TLR9 agonist comprising a CpG ODN
comprising, preferably consisting of a polynucleotide sequence that
is, or is at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% identical, or any percentage
between such values, to one of SEQ ID NOs: 1-7.
[0195] According to particular aspects, an ODN construct of the
present disclosure comprises a CpG ODN comprising, preferably
consisting of a polynucleotide sequence selected from the group
consisting of:
TABLE-US-00002 (1) (SEQ ID NO: 8) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO: 9) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO: 10) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (4) (SEQ ID NO: 11) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (5) (SEQ ID NO: 12) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO: 13) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (7) (SEQ ID NO: 14) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (8) (SEQ ID NO: 15) 5'
TpsCpsGpsTpsCpsGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (9) (SEQ ID NO: 16) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (10) (SEQ ID NO: 17) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (11) (SEQ ID NO: 18) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpsGpsApsCpsGpsTpsT 3'; (12) (SEQ ID NO: 19) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpoGpsApsCpsGpsTpsT 3'; (13) (SEQ ID NO: 20) 5'
GpsGpsGpsGpsGpsApsCpoGpsApsTpsCpoGpsTpsCpoGps GpsGpsGpsGpsG 3';
(14) (SEQ ID NO: 21) 5'
GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps GpsGpsGpsGpsG 3';
(15) (SEQ ID NO: 22) 5'
TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps ApsCpsGpsTpsT 3';
(16) (SEQ ID NO: 23) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsCpsGpsGpsCpsGps CpsGpsCpsGpsCpsCpsG
3'; (17) (SEQ ID NO: 24) 5'
TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; (18) (SEQ ID NO: 25) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; and (19) (SEQ ID NO: 26) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3';
[0196] wherein:
[0197] po represents a phosphodiester internucleotide linkage;
and
[0198] ps represents a phosphorothioate internucleotide
linkage.
[0199] According to some embodiments, an ODN construct of the
present disclosure comprises a TLR9 agonist comprising a CpG ODN
comprising, preferably consisting of a polynucleotide sequence that
is, or is at least, about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or 100% identical, or any percentage
between such values, to one of SEQ ID NOs: 8-26.
[0200] According to particular aspects, an ODN construct of the
present disclosure comprises a structure selected from the group
consisting of:
TABLE-US-00003 (1) (SEQ ID NO: 27) 5'
Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO:
28) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO:
29) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT-(HEG)po(HEG)po-Toco 3'; (4) (SEQ ID NO:
30) 5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT-(HEG)po(HEG)po-Toco 3'; (5) (SEQ ID NO:
31) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO:
32) 5' Chol-po(HEG)po(HEG)poTpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (7) (SEQ ID NO:
33) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (8) (SEQ ID NO:
34) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (9) (SEQ ID NO:
35) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (10) (SEQ ID NO:
36) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (11) (SEQ ID NO:
37) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (12) (SEQ ID
NO: 38) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (13) (SEQ ID
NO: 39) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (14) (SEQ ID
NO: 40) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (15) (SEQ ID
NO: 41) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (16) (SEQ ID
NO: 42) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (17) (SEQ ID NO:
43) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (18) (SEQ ID
NO: 44) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (19) (SEQ ID
NO: 45) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (20) (SEQ ID
NO: 46) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (21) (SEQ ID
NO: 47) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (22) (SEQ ID NO:
48) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (23) (SEQ ID NO:
49) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (24) (SEQ ID NO:
50) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (25) (SEQ ID NO:
51) 5'-TpsCpoGpsTpsCGpsTpsTpsTpsTpsGpsTpsCGpsTpsTpsTps
TpsGpsTpsCpoGpsTpsTps-HEGps-Chol 3'; (26) (SEQ ID NO: 52)
5'-TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps(HEG)po(HEG)po-Chol 3'; (27) (SEQ ID NO:
53) 5'-GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps
GpsGpsGpsGpsGps-HEGps-Chol 3'; (28) (SEQ ID NO: 54)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Chol 3'; (29) (SEQ ID NO: 55)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Toco 3'; (30) (SEQ ID NO: 56) 5'
Palmitoyl-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGps
TpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGps TpsT 3';
[0201] wherein:
[0202] Chol represents cholesterol;
[0203] Toco represents tocopherol;
[0204] Palmitoyl represents a palmitoyl group;
[0205] HEG represents ((CH.sub.2).sub.2O).sub.6;
[0206] po represents a phosphodiester linkage; and
[0207] ps represents a phosphorothioate linkage.
[0208] wherein the tocopherol, the cholesterol, or the palmitoyl
group is covalently linked to the (HEG) directly via a po or ps
linkage, or indirectly via a second linker that is linked to (HEG)
directly via a po or ps linkage.
[0209] In an embodiment, the ODN construct has the following
structure:
##STR00001##
or a racemic or alternative chirality thereof, wherein
"Oligonucleotides" represents a CpG ODN having agonistic activity
for TLR9.
[0210] In an embodiment, the ODN construct has the following
structure:
##STR00002##
or a racemic or alternative chirality thereof, wherein
"Oligonucleotides" represents a CpG ODN having agonistic activity
for TLR9.
[0211] In an embodiment, CpG ODN contains SEQ ID NO:1, preferably
SEQ ID NO:8: 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoG-
psTpsT 3'.
[0212] In an embodiment, CpG ODN contains a structure as shown in
FIG. 24.
[0213] According to particular aspects, an ODN construct of the
present disclosure can be further conjugated to a targeting moiety.
As used herein, the term "targeting moiety" refers to any moiety
suitable for the delivery of its conjugated agonist to targeted
cells. Examples of targeting moiety include, e.g., a carbohydrate,
a peptide, a protein, a small molecule, a lipid moiety, or a toxin,
that is specifically recognized by a cell surface receptor. Useful
carbohydrate moieties include, but are not limited to, galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, and sialic acid
(N-acetyl neuraminic acid). According to particular embodiments,
the targeting moiety binds to receptors present on the particular
target cell types of interest. The targeting moiety helps in
targeting the ODN construct to the required target site. One way a
targeting moiety can improve delivery is by receptor mediated
endocytotic activity. This mechanism of uptake involves the
movement of the ODN construct bound to membrane receptors into the
interior of an area that is enveloped by the membrane via
invagination of the membrane structure or by fusion of the delivery
system with the cell membrane. This process is initiated via
activation of a cell-surface or membrane receptor following binding
of a specific ligand to the receptor. Many receptor-mediated
endocytotic systems are known and have been studied, including
those that recognize sugars such as galactose, mannose,
mannose-6-phosphate, peptides and proteins such as transferrin,
asialoglycoprotein, vitamin B12, insulin and epidermal growth
factor (EGF). The Asialoglycoprotein receptor (ASGP-R) is a high
capacity receptor, which is highly abundant on hepatocytes. The
ASGP-R shows a 50-fold higher affinity for
N-Acetyl-D-Galactosylamine (GalNAc) than D-Gal. Previous work has
shown that multivalency is required to achieve nM affinity, while
spacing among sugars is also crucial. The Mannose receptor, with
its high affinity to D-mannose represents another important
carbohydrate-based ligand-receptor pair. The mannose receptor is
highly expressed on specific cell types such as macrophages and
possibly dendritic cells Mannose conjugates as well as mannosylated
drug carriers have been successfully used to target drug molecules
to those cells. For examples, see Biessen et al. (1996) J. Biol.
Chem. 271, 28024-28030; Kinzel et al. (2003) J. Peptide Sci. 9,
375-385; Barratt et al. (1986) Biochim. Biophys. Acta 862, 153-64;
Diebold et al. (2002) Somat. Cell Mol. Genetics 27, 65-74.
According to embodiments, the targeting moiety is a lipid moiety.
For example, tocopherol can serve as a targeting moiety for vitamin
E receptors, and a palmitoyl group can serve as a targeting moiety
for LDL receptors.
[0214] According to particular embodiments, the targeting moiety
binds to receptors present on the particular target cell types of
interest
[0215] An ODN construct of the present disclosure can be conjugated
to a targeting moiety directly or indirectly via a linker.
[0216] Synthesis
[0217] ODN constructs of the present disclosure can be made using
methods known in the art in view of the present disclosure. For
example, the oligoribonucleotides and oligoribonucleosides used in
accordance with this present disclosure can be made with solid
phase synthesis, see for example "Oligonucleotide synthesis, a
practical approach", Ed. M. J. Gait, IRL Press, 1984;
"Oligonucleotides and Analogues, A Practical Approach", Ed. F.
Eckstein, IRL Press, 1991 (e.g. Chapter 1, Modern machine-aided
methods of ODN synthesis, Chapter 2, Oligoribonucleotide synthesis,
Chapter 4, Phosphorothioate oligonucleotides, Chapter 5, Synthesis
of oligonucleotide phosphorodithioates). Other particularly useful
synthetic procedures, reagents, blocking groups and reaction
conditions are described in Martin, P., Helv. Chico. Acta, 1995,
78, 486-504; Beaucage, S. L. and Iyer, R. P., Tetrahedron, 1992,
48, 2223-2311 and Beaucage, S. L. and Iyer, R. P., Tetrahedron,
1993, 49, 6123-6194, or references referred to therein. Mixed
backbone compounds having, as for instance, alternating PO or PS
linkages can be prepared as is described in U.S. Pat. Nos.
5,378,825, 5,386,023, 5,489,677 and in published PCT applications
PCT/US92/04294 and PCT/US92/04305 (published as WO 92/20822 WO and
92/20823, respectively).
[0218] An example of a synthesis scheme that can be used to make
ODN constructs of the present disclosure is illustrated in FIG. 17
and described in Example 1.
[0219] Pharmaceutical Compositions and Methods of Treatment
[0220] According to particular aspects, the present disclosure
relates to an ODN construct that induces the activity of TLR9. The
effect of an ODN construct with agonistic activity for TLR9 on a
TLR-dependent immune response can be determined in vitro by
measuring a response of immune cells (e.g., Peripheral Blood
Mononuclear Cells (PBMCs), mostly consisting of lymphocytes and
monocytes) or reporter cells (e.g., HEK293 cells expressing a
reporter construct for TLR9) contacted with the agonist. The effect
of an ODN construct with agonistic activity for TLR9 on a
TLR-dependent immune response can also be determined in vivo, e.g.
by measuring cytokine induction in an animal after injection with
the agonist. Exemplary methods are described herein, e.g., in the
Examples below.
[0221] ODN constructs of the present disclosure can be used to
treat immune diseases, disorders or conditions, such as viral
infections or cancer.
[0222] Thus, in another general aspect, the present disclosure
relates to a pharmaceutical composition comprising an ODN construct
of the present disclosure and a pharmaceutically acceptable
carrier.
[0223] In another general aspect, the present disclosure relates to
a method of stimulating an immune response in a subject in need
thereof, comprising administering to the subject a pharmaceutical
composition comprising an ODN construct of the present disclosure
and a pharmaceutically acceptable carrier.
[0224] In another general aspect, the present disclosure relates to
a method of treating or reducing symptoms of a disease, disorder or
condition, such as an immune disease, disorder or condition, such
as a viral infection or cancer, in a subject in need thereof,
comprising administering to the subject a pharmaceutical
composition of the present disclosure.
[0225] According to embodiments of the present disclosure, the
pharmaceutical composition comprises a therapeutically effective
amount of the an ODN construct. As used herein with reference to an
ODN constructs, a therapeutically effective amount means an amount
of an ODN construct that stimulates an immune response in a subject
in need thereof. Also as used herein with reference to an ODN
construct, a therapeutically effective amount means an amount of an
ODN construct that results in treatment of an immune disease,
disorder, or condition, such as viral infection or cancers;
prevents or slows the progression of the immune disease, disorder,
or condition, such as viral infection or cancer; reduces or
completely alleviates symptoms associated with the immune disease,
disorder, or condition, such as viral infection or cancer.
[0226] According to particular embodiments, a therapeutically
effective amount refers to the amount of therapy which is
sufficient to achieve one, two, three, four, or more of the
following effects: (i) reduce or ameliorate the severity of the
disease, disorder or condition to be treated or a symptom
associated therewith; (ii) reduce the duration of the disease,
disorder or condition to be treated, or a symptom associated
therewith; (iii) prevent the progression of the disease, disorder
or condition to be treated, or a symptom associated therewith; (iv)
cause regression of the disease, disorder or condition to be
treated, or a symptom associated therewith; (v) prevent the
development or onset of the disease, disorder or condition to be
treated, or a symptom associated therewith; (vi) prevent the
recurrence of the disease, disorder or condition to be treated, or
a symptom associated therewith; (vii) reduce hospitalization of a
subject having the disease, disorder or condition to be treated, or
a symptom associated therewith; (viii) reduce hospitalization
length of a subject having the disease, disorder or condition to be
treated, or a symptom associated therewith; (ix) increase the
survival of a subject with the disease, disorder or condition to be
treated, or a symptom associated therewith; (x) inhibit or reduce
the disease, disorder or condition to be treated, or a symptom
associated therewith in a subject; and/or (xi) enhance or improve
the prophylactic or therapeutic effect(s) of another therapy.
[0227] According to particular embodiments, the disease, disorder
or condition to be treated is an immune disease, disorder or
condition. According to particular embodiments, the disease,
disorder or condition to be treated is a cancer, an inflammatory
disease, disorder or condition, an autoimmune disease, disorder or
condition, or a disease, disorder or condition caused by a
pathogen, such as a viral infection. According to particular
embodiments, the cancer or tumor is a cancer caused by a virus, a
carcinoma, a sarcoma, or a leukemia. According to particular
embodiments, the cancer is a mammary, colon, bladder, lung,
prostate, stomach, or pancreas carcinoma or a lymphoblastic or
myeloid leukemia. According to particular embodiments, the viral
infection is an RNA or DNA virus such as adenovirus,
cytomegalovirus, hepatitis A virus (HAV), hepadnaviruses including
HBV, chronic HBV, flaviviruses including Yellow Fever virus,
hepaciviruses including hepatitis C virus (HCV), herpes simplex
type 1 and 2, herpes zoster, human herpesvirus 6, human
immunodeficiency virus (HIV), human papilloma virus (HPV),
influenza A virus, influenza B virus, measles, parainfluenza virus,
pestivirus, poliovirus, poxvirus, rhinovirus, coronovirus,
respiratory syncytial virus (RSV), multiple families of viruses
that cause hemorrhagic fevers, including the Arenaviruses, the
Bunyaviruses and Filoviruses, and a range of viral encephalitides
caused by RNA and DNA viruses. According to more particular
embodiments, the disease to be treated is HBV infection or chronic
HBV infection.
[0228] Chronic HBV is preferably characterized by the detectable
presence of HBV in a subject for more than 6 months. More
preferably, a chronic HBV infection referred to herein follows the
definition published by the Centers for Disease Control and
Prevention (CDC), according to which a chronic HBV infection is
characterized by the following laboratory criteria: (i) negative
for IgM antibodies to hepatitis B core antigen (IgM anti-HBc) and
positive for hepatitis B surface antigen (HBsAg), hepatitis B e
antigen (HBeAg), or nucleic acid test for hepatitis B virus DNA, or
(ii) positive for HBsAg or nucleic acid test for HBV DNA, or
positive for HBeAg two times at least 6 months apart.
[0229] According to particular embodiments, a therapeutically
effective amount refers to the amount of a therapy which is
sufficient to treat a chronic HBV infection. Accordingly, a
therapeutically effective amount refers to the amount of therapy
which is sufficient to achieve one, two, three, four, or more of
the following effects: (i) reduce or ameliorate the severity of an
HBV infection or a symptom associated therewith; (ii) reduce the
duration of an HBV infection or symptom associated therewith; (iii)
prevent the progression of an HBV infection or symptom associated
therewith; (iv) cause regression of an HBV infection or symptom
associated therewith; (v) prevent the development or onset of an
HBV infection, or symptom associated therewith; (vi) prevent the
recurrence of an HBV infection or symptom associated therewith;
(vii) reduce hospitalization of a subject having an HBV infection;
(viii) reduce hospitalization length of a subject having an HBV
infection; (ix) increase the survival of a subject with an HBV
infection; (x) eliminate an HBV infection in a subject; (xi)
inhibit or reduce HBV replication in a subject; and/or (xii)
enhance or improve the prophylactic or therapeutic effect(s) of
another therapy.
[0230] According to particular embodiments, a therapeutically
effective amount refers to the amount of a therapy which is
sufficient to achieve one, two, three or four of the following
effects: (i) reduce the amount of hepatitis B surface antigen
(HBsAg) in the subject by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95% or more; (ii) reduce the amount of hepatitis B e antigen
(HBeAg) in the subject by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95% or more; (iii) reduce the amount of hepatitis B virus DNA
in the subject by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%
or more; and/or (iv) reduce the amount of anti-HBsAg antibodies in
the subject by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or
more.
[0231] According to particular embodiments, a therapeutically
effective amount refers to the amount of a therapy which is
sufficient to treat a cancer. Accordingly, a therapeutically
effective amount refers to the amount of therapy which is
sufficient to achieve one, two, three, four, or more of the
following effects: (i) reduce or ameliorate the severity of a
cancer or a symptom associated therewith; (ii) reduce the duration
of a cancer or symptom associated therewith; (iii) prevent the
progression of a cancer or symptom associated therewith; (iv) cause
regression of a cancer or symptom associated therewith; (v) prevent
the development or onset of a cancer, or symptom associated
therewith; (vi) prevent the recurrence of a cancer or symptom
associated therewith; (vii) reduce hospitalization of a subject
having a cancer; (viii) reduce hospitalization length of a subject
having a cancer; (ix) increase the survival of a subject with a
cancer; (x) eliminate a cancer in a subject; and/or (xi) enhance or
improve the prophylactic or therapeutic effect(s) of another
therapy.
[0232] The therapeutically effective amount or dosage can vary
according to various factors, such as the means of administration,
the target site, the physiological state of the subject (including,
e.g., age, body weight, health), whether the subject is a human or
an animal, other medications administered, and whether the
treatment is prophylactic or therapeutic. Treatment dosages are
optimally titrated to optimize safety and efficacy.
[0233] The mode of administration for therapeutic use of the an ODN
constructs of the present disclosure can be any suitable route that
delivers the agent to the host. For example, the compositions
described herein can be formulated to be suitable for parenteral
administration, e.g., intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, intranasal or intracranial
administration, or they can be administered into the cerebrospinal
fluid of the brain or spine.
[0234] According to particular embodiments, the compositions
described herein are formulated to be suitable for the intended
route of administration to a subject. For example, the compositions
described herein can be formulated to be suitable for intravenous,
subcutaneous, intratumoral or intramuscular administration.
According to preferred embodiments, the compositions described
herein are formulated to be suitable for intravenous, subcutaneous,
or intratumoral administration.
[0235] The treatment can be given in a single dose schedule, or as
a multiple dose schedule in which a primary course of treatment can
be with 1-10 separate doses, followed by other doses given at
subsequent time intervals required to maintain and/or reinforce the
response, for example, at 1-4 months for a second dose, and if
needed, a subsequent dose(s) after several months. Examples of
suitable treatment schedules include: (i) 0, 1 month and 6 months,
(ii) 0, 7 days and 1 month, (iii) 0 and 1 month, (iv) 0 and 6
months, or other schedules sufficient to elicit the desired
responses expected to reduce disease symptoms or reduce severity of
disease.
[0236] According to particular embodiments, a composition used in
the treatment of an immune disease, disorder or condition, or a
viral disease, such as chronic HBV, or a cancer, can be used in
combination with other agents that are effective for treatment of
related diseases, disorders or conditions. Examples of such agents
include, but are not limited to, CAMs, DAAs, other TLRs, ASO/siRNA,
checkpoint inhibitors, other chemotherapeutics, CAR-T.
[0237] In another general aspect, the present disclosure relates to
a method of producing a pharmaceutical composition comprising an
ODN construct of the present disclosure, comprising combining an
ODN construct with a pharmaceutically acceptable carrier to obtain
the pharmaceutical composition.
[0238] In another general aspect, the present disclosure relates to
a method of treating chronic HBV infection in a subject in need
thereof, comprising administering to the subject a pharmaceutical
composition comprising an ODN construct of the present
disclosure.
[0239] In another general aspect, the present disclosure relates to
a method of treating a tumor, preferably a cancer, in a subject in
need thereof, comprising administering to the subject a
pharmaceutical composition comprising an ODN construct of the
present disclosure.
[0240] The contents of all cited references (including literature
references, issued patents, published patent applications, and
co-pending patent applications) cited throughout this application
are hereby expressly incorporated by reference.
EMBODIMENTS
[0241] The present disclosure provides also the following
non-limiting embodiments.
[0242] Embodiment 1 is an ODN construct having the formula of
Formula I:
5'M.sub.1-L.sub.1-[CpG ODN]-L.sub.2-M.sub.23',
wherein:
[0243] each of M.sub.1 and M.sub.2 independently represents a lipid
moiety, preferably the lipid moiety comprises at least one selected
from the group consisting of cholesterol, tocopherol, a palmitoyl
group, and a stearyl group, optionally one of M.sub.1 and M.sub.2
is absent;
[0244] each of L.sub.1 and L.sub.2 independently represents a
linker, preferably the linker comprises at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond,
optionally one of L.sub.1 and L.sub.2 is absent when the respective
M.sub.1 or M.sub.2 is absent; and
[0245] preferably, CpG ODN comprises at least one CpG motif having
a phosphodiester (po) internucleotide linkage;
[0246] optionally, the CpG ODN construct of formula (I) is further
covalently conjugated to a targeting moiety, which is preferably
selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0247] Embodiment 2 is a CpG ODN construct having a formula of:
5'M-L-[CpG ODN]3', or Formula (IIa):
5'[CpG ODN]-L-M3' Formula (IIb):
wherein:
[0248] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group;
[0249] L represents a linker comprising at least 1 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond;
and
[0250] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0251] optionally, the CpG ODN construct of Formula (IIa) or (IIb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0252] Embodiment 2a is the ODN construct of Embodiment 1 or 2,
wherein the linker comprises 10-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0253] Embodiment 2b is the ODN construct of Embodiment 2a, wherein
the linker comprises 20-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0254] Embodiment 2c is the ODN construct of Embodiment 2a, wherein
the linker comprises 30-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0255] Embodiment 2d is the ODN construct of Embodiment 2a, wherein
the linker comprises 40-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0256] Embodiment 2e is the ODN construct of Embodiment 2a, wherein
the linker comprises 50-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0257] Embodiment 2f is the ODN construct of Embodiment 2a, wherein
the linker comprises 60-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0258] Embodiment 2g is the ODN construct of Embodiment 2a, wherein
the linker comprises 70-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0259] Embodiment 2h is the ODN construct of Embodiment 2a, wherein
the linker comprises 80-100 atoms selected from the group
consisting of carbon, nitrogen, oxygen, hydrogen, sulfur and
phosphorus.
[0260] Embodiment 3 is the ODN construct of Embodiment 1 or 2,
wherein the linker comprises ((CH.sub.2).sub.2O).sub.m, wherein m
is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14 or 15.
[0261] Embodiment 4 is the ODN construct of Embodiment 3, wherein
the linker comprises (((CH.sub.2).sub.2O).sub.m--X).sub.n, wherein
n is an integer from 1 to 5, such as 1, 12, 3, 4, or 5, and X is
independently a phosphodiester (po) or phosphorothioate (ps)
linkage.
[0262] Embodiment 4a is the ODN construct of Embodiment 4, wherein
the linker comprises (((CH.sub.2).sub.2O).sub.6-X).sub.n.
[0263] Embodiment 4b is the ODN construct of Embodiment 4a, wherein
the linker comprises ((CH.sub.2).sub.2O).sub.6-po.
[0264] Embodiment 4c is the ODN construct of Embodiments 4a,
wherein the linker comprises
((CH.sub.2).sub.2O).sub.6-po-((CH.sub.2).sub.2O).sub.6-po.
[0265] Embodiment 4d is the ODN construct of Embodiments 4a,
wherein the linker comprises
((CH.sub.2).sub.2O).sub.6-ps-((CH.sub.2).sub.2O).sub.6-po.
[0266] Embodiment 5 is a CpG ODN construct having a structure
of:
5'M.sub.1-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]-Y.sub.3-M.sub.23', or Formula (IIIa):
5'M.sub.2-Y.sub.3-[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M.sub.13'
Formula (IIIb):
[0267] wherein:
[0268] M.sub.1 represents a lipid moiety, preferably the lipid
moiety comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0269] M.sub.2 represents a lipid moiety, a targeting moiety, or is
absent,
[0270] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0271] X is independently a bond, a po linkage or a ps linkage,
[0272] each of Y.sub.2 and Y.sub.3 is independently a cleavable
linkage, preferably comprises an ester or an amide bond, more
preferably comprises a po linkage or a phosphoramidate linkage,
most preferably a po linkage, provided that when M.sub.2 is absent,
Y.sub.3 is absent,
[0273] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0274] m is an integer from 1 to 15, and
[0275] n is an integer from 1 to 5.
[0276] Embodiment 6 is the ODN construct of embodiment 5, wherein
M.sub.2 is a targeting.
[0277] Embodiment 6a is the ODN construct of embodiment 6, wherein
M.sub.2 is the targeting selected from the group consisting of
galactose, N-acetylgalactosamine (GalNAc), fucose, mannose, sialic
acid, N-acetyl neuraminic acid.
[0278] Embodiment 6b is the ODN construct of embodiment 5, wherein
M.sub.2 and Y.sub.3 are absent.
[0279] Embodiment 7 is a CpG ODN construct having a formula of:
5'M-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]3', or Formula (IVa):
5'[CpG
ODN]-Y.sub.2--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M3'
Formula (IVb):
[0280] wherein:
[0281] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0282] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0283] X is independently a bond, a phosphodiester (po) linkage or
a phosphorothioate (ps) linkage, Y.sub.2 is a cleavable linkage,
preferably comprises an ester or an amide bond, more preferably
comprises a po linkage or a phosphoramidate linkage, most
preferably a po linkage;
[0284] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage;
[0285] m is an integer from 1 to 15, preferably 6; and
[0286] n is an integer from 1 to 5, preferably 2;
[0287] optionally, the CpG ODN construct of Formula (IVa) or (IVb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0288] Embodiment 8 is the ODN construct of any one of Embodiment 5
to 7, wherein Y.sub.2 comprises an ester bond.
[0289] Embodiment 8a is the ODN construct of Embodiment 8, wherein
Y.sub.2 is a phosphodiester (po) linkage.
[0290] Embodiment 8b is the ODN construct of any one of Embodiment
5 to 7, wherein Y.sub.2 comprises an amide bond.
[0291] Embodiment 8c is the ODN construct of Embodiment 8b, wherein
Y.sub.2 is a phosphoramidate linkage.
[0292] Embodiment 9 is the ODN construct of any one of Embodiment 5
to 8c, wherein Y.sub.1 comprises ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, covalently linked to
(((CH.sub.2).sub.2O).sub.m--X).sub.n via a bond.
[0293] Embodiment 9a is the ODN construct of Embodiment 9, wherein
Y.sub.1 comprises ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, covalently linked to
(((CH.sub.2).sub.2O).sub.m--X).sub.n via a po linkage.
[0294] Embodiment 9b is the ODN construct of Embodiment 9, wherein
Y.sub.1 comprises ethylene glycol having the formula
((CH.sub.2).sub.2O).sub.o, wherein o is 1-15, covalently linked to
(((CH.sub.2).sub.2O).sub.m--X).sub.n via a ps linkage.
[0295] Embodiment 10 is the ODN construct of any one of Embodiment
4 to 9b, wherein m is an integer of 1 to 15.
[0296] Embodiment 10a is the ODN construct of Embodiment 10,
wherein m is 1.
[0297] Embodiment 10b is the ODN construct of Embodiment 10,
wherein m is 2.
[0298] Embodiment 10c is the ODN construct of Embodiment 10,
wherein m is 3.
[0299] Embodiment 10d is the ODN construct of Embodiment 10,
wherein m is 4.
[0300] Embodiment 10e is the ODN construct of Embodiment 10,
wherein m is 5.
[0301] Embodiment 10f is the ODN construct of Embodiment 10,
wherein m is 6.
[0302] Embodiment 10g is the ODN construct of Embodiment 10,
wherein m is 7.
[0303] Embodiment 10h is the ODN construct of Embodiment 10,
wherein m is 8.
[0304] Embodiment 10i is the ODN construct of Embodiment 10,
wherein m is 9.
[0305] Embodiment 10j is the ODN construct of Embodiment 10,
wherein m is 10.
[0306] Embodiment 10k is the ODN construct of Embodiment 10,
wherein m is 11.
[0307] Embodiment 101 is the ODN construct of Embodiment 10,
wherein m is 12.
[0308] Embodiment 10m is the ODN construct of Embodiment 10,
wherein m is 11.
[0309] Embodiment 10n is the ODN construct of Embodiment 10,
wherein m is 14.
[0310] Embodiment 10o is the ODN construct of Embodiment 10,
wherein m is 15.
[0311] Embodiment 11 is the ODN construct of any one of Embodiments
4 to 10o, wherein n is an integer of 1 to 5.
[0312] Embodiment 11 a is the ODN construct of Embodiment 11,
wherein n is 1.
[0313] Embodiment 11b is the ODN construct of Embodiment 11 wherein
n is 2.
[0314] Embodiment 11c is the ODN construct of Embodiment 11 wherein
n is 3.
[0315] Embodiment 11d is the ODN construct of Embodiment 11,
wherein n is 4.
[0316] Embodiment 11e is the ODN construct of Embodiment 11,
wherein n is 5.
[0317] Embodiment 12 is the ODN construct of any one of Embodiments
4-10 and 11, wherein m is 6 and n is 2.
[0318] Embodiment 13 is an ODN construct having a structure
selected from the group consisting of:
5'M-po(HEG)po(HEG)po-[CpG ODN]3';
5'M-ps(HEG)po(HEG)po-[CpG ODN]3',
5'M-ps(HEG)ps(HEG)po-[CpG ODN]3',
5'M-po(HEG)ps(HEG)po-[CpG ODN]3',
5'[CpG ODN]-po(HEG)po(HEG)po-M3',
5'[CpG ODN]-po(HEG)ps(HEG)po-M3',
5'[CpG ODN]-po(HEG)ps(HEG)ps-M3', and
5'[CpG ODN]-po(HEG)po(HEG)ps-M3',
wherein:
[0319] M represents a lipid moiety comprising at least one selected
from the group consisting of cholesterol, tocopherol, a palmitoyl
group, and a stearyl group;
[0320] po represents a phosphodiester linkage;
[0321] HEG represents ((CH.sub.2).sub.2O).sub.6;
[0322] ps represents a phosphorothioate linkage; and
[0323] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage,
[0324] wherein M is covalently linked to (HEG) directly via a po or
ps linkage, or indirectly via a second linker that is linked to
(HEG) directly via a po or ps linkage.
[0325] Embodiment 14 is the ODN construct of any one of Embodiments
1 to 13, wherein the lipid moiety is cholesterol.
[0326] Embodiment 14a is the ODN construct of any one of
Embodiments 1 to 13, wherein the lipid moiety is tocopherol.
[0327] Embodiment 14b is the ODN construct of any one of
Embodiments 1 to 13, wherein the lipid moiety is a palmitoyl
group.
[0328] Embodiment 14c is the ODN construct of any one of
Embodiments 1 to 13, wherein the lipid moiety is a stearyl
group.
[0329] Embodiment 15 is an ODN construct having a structure
selected from the group consisting of:
5'Toco-po(HEG)po(HEG)po-[CpG ODN]3', wherein Toco represents
tocopherol,
5'Chol-po(HEG)po(HEG)po-[CpG ODN]3', wherein Chol represents
cholesterol,
5'Palm-po(HEG)po(HEG)po-[CpG ODN]3', wherein Palm represents a
palmitoyl group,
5'[CpG ODN]-po(HEG)ps-Chol3', wherein Chol represents
cholesterol,
5'[CpG ODN]-po(HEG)ps-Toco3', wherein Toco represents tocopherol,
and
5'[CpG ODN]-po(HEG)ps-Palm3', wherein Palm represents a palmitoyl
group,
[0330] wherein:
[0331] po represents a phosphodiester linkage;
[0332] HEG represents ((CH.sub.2).sub.2O).sub.6;
[0333] ps represents a phosphorothioate linkage; and
[0334] CpG ODN comprises at least one CpG motif having a po
internucleotide linkage, preferably comprises at least two, three
or four CpG motifs each having the po internucleotide linkage,
[0335] wherein the tocopherol, the cholesterol, or the palmitoyl
group is covalently linked to the (HEG) directly via a po or ps
linkage, or indirectly via a second linker that is linked to (HEG)
directly via a po or ps linkage.
[0336] Embodiment 15a is the ODN construct of embodiment 15,
wherein the tocopherol, the cholesterol, or the palmitoyl group is
covalently the second linker and the second linker is covalently
linked to the (HEG) directly via the po or ps linkage.
[0337] Embodiment 16 is an ODN construct having the following
structure:
##STR00003##
or a racemic or alternative chirality thereof, wherein
"Oligonucleotides" represents a CpG ODN comprising at least one CpG
motif having a po internucleotide linkage, preferably comprising at
least two, three or four CpG motifs each having the po
internucleotide linkage, optionally, the ODN construct is further
conjugated to a targeting moiety, directly or via a linker.
[0338] Embodiment 16a is an ODN construct having the following
structure:
##STR00004##
or a racemic or alternative chirality thereof, wherein
"Oligonucleotides" represents a CpG ODN comprising at least one CpG
motif having a po internucleotide linkage, preferably comprising at
least two, three or four CpG motifs each having the po
internucleotide linkage, optionally, the ODN construct is further
conjugated to a targeting moiety, directly or via a linker.
[0339] Embodiment 16b is an ODN construct having a structure as
shown in FIG. 25 or a racemic or alternative chirality thereof.
[0340] Embodiment 16c is an ODN construct having a structure as
shown in FIG. 26.
[0341] Embodiment 16d is an ODN construct having a structure as
shown in FIG. 27 or a racemic or alternative chirality thereof.
[0342] Embodiment 17 is the ODN construct of any of Embodiments 1
to 16, wherein the CpG ODN has a phosphorothioate (ps)
internucleotide linkage.
[0343] Embodiment 18 is the ODN construct of any of Embodiments 1
to 17, wherein the CpG ODN has a stereodefined phosphorothioate
(ps) internucleotide linkage.
[0344] Embodiment 19 is the ODN construct of any of Embodiments 1
to 18, wherein one to four of the CpG dinucleotides in the CpG ODN
each have a phosphodiester (po) internucleotide linkage.
[0345] Embodiment 19a is the ODN construct of Embodiment 19,
wherein the CpG ODN comprises at least two CpG motifs each having a
po internucleotide linkage.
[0346] Embodiment 19b is the ODN construct of Embodiment 19,
wherein the CpG ODN comprises at least three CpG motifs each having
a po internucleotide linkage.
[0347] Embodiment 19c is the ODN construct of Embodiment 19,
wherein the CpG ODN comprises at least four CpG motifs each having
a po internucleotide linkage.
[0348] Embodiment 20 is the ODN construct of any of Embodiments 19
to 19c, wherein each of the remaining internucleotide linkages of
the CpG ODN are phosphorothioate (ps) internucleotide linkages.
[0349] Embodiment 21 is the ODN construct of any one of Embodiments
1 to 20, wherein the CpG ODN comprises, preferably consists of, a
polynucleotide sequence selected from the group consisting of:
TABLE-US-00004 (1) (SEQ ID NO: 1) 5' TCGTCGTTTTGTCGTTTTGTCGTT 3';
(2) (SEQ ID NO: 2) 5' GGGGGACGATCGTCGGGGGG 3'; (3) (SEQ ID NO: 3)
5' GGGGTCAACGTTGAGGGGGG 3'; (4) (SEQ ID NO: 4) 5'
TCCATGACGTTCCTGACGTT 3'; (5) (SEQ ID NO: 5) 5'
TCGTCGTTTTCGGCGCGCGCCG 3'; (6) (SEQ ID NO: 6) 5'
TCGTCGTTACGTAACGACGACGTT 3'; and (7) (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTGTCGT 3'.
[0350] Embodiment 21a is the ODN construct of Embodiment 21,
wherein the CpG ODN comprises, preferably consists of, a
polynucleotide sequence that is, or is at least, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
identical to one of SEQ ID NOs: 1-7.
[0351] Embodiment 22 is the ODN construct of any one of Embodiments
1 to 21, wherein the CpG ODN comprises, preferably consists of, a
polynucleotide sequence selected from the group consisting of:
TABLE-US-00005 (1) (SEQ ID NO: 8) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO: 9) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO: 10) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (4) (SEQ ID NO: 11) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT 3'; (5) (SEQ ID NO: 12) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO: 13) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (7) (SEQ ID NO: 14) 5'
TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT 3'; (8) (SEQ ID NO: 15) 5'
TpsCpsGpsTpsCpsGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (9) (SEQ ID NO: 16) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpsGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (10) (SEQ ID NO: 17) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCps
GpsApsCpsGpsApsCpsGpsTpsT 3'; (11) (SEQ ID NO: 18) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpsGpsApsCpsGpsTpsT 3'; (12) (SEQ ID NO: 19) 5'
TpsCpsGpsTpsCpoGpsTpsTpsApsCpoGpsTpsApsApsCpo
GpsApsCpoGpsApsCpsGpsTpsT 3'; (13) (SEQ ID NO: 20) 5'
GpsGpsGpsGpsGpsApsCpoGpsApsTpsCpoGpsTpsCpoGps GpsGpsGpsGpsG 3';
(14) (SEQ ID NO: 21) 5'
GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps GpsGpsGpsGpsG 3';
(15) (SEQ ID NO: 22) 5'
TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps ApsCpsGpsTpsT 3';
(16) (SEQ ID NO: 23) 5'
TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsCpsGpsGpsCpsGps CpsGpsCpsGpsCpsCpsG
3'; (17) (SEQ ID NO: 24) 5'
TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; (18) (SEQ ID NO: 25) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3'; and (19) (SEQ ID NO: 26) 5'
TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsT 3';
[0352] wherein: [0353] po represents a phosphodiester
internucleotide linkage; and [0354] ps represents a
phosphorothioate internucleotide linkage.
[0355] Embodiment 22a is the ODN construct of Embodiment 22,
wherein the CpG ODN comprises, preferably consists of, a
polynucleotide sequence that is, or is at least, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
identical to one of SEQ ID NOs: 8-26.
[0356] Embodiment 23 is an ODN construct, having the structure
of:
TABLE-US-00006 (1) (SEQ ID NO: 27) 5'
Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (2) (SEQ ID NO:
28) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (3) (SEQ ID NO:
29) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsT-(HEG)po(HEG)po-Toco 3'; (4) (SEQ ID NO:
30) 5' TpsCpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsT-(HEG)po(HEG)po-Toco 3'; (5) (SEQ ID NO:
31) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (6) (SEQ ID NO:
32) 5' Chol-po(HEG)po(HEG)poTpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (7) (SEQ ID NO:
33) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (8) (SEQ ID NO:
34) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (9) (SEQ ID NO:
35) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (10) (SEQ ID NO:
36) 5' Chol-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (11) (SEQ ID NO:
37) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (12) (SEQ ID
NO: 38) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (13) (SEQ ID
NO: 39) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (14) (SEQ ID
NO: 40) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Chol 3'; (15) (SEQ ID
NO: 41) 5' TpsCpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (16) (SEQ ID
NO: 42) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTpsT 3'; (17) (SEQ ID NO:
43) 5' TpsCpoGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (18) (SEQ ID
NO: 44) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (19) (SEQ ID
NO: 45) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (20) (SEQ ID
NO: 46) 5' TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpoGpsTpsTps-(HEG)po(HEG)po- Toco 3'; (21) (SEQ ID
NO: 47) 5' Toco-po(HEG)po(HEG)po-TpsCpsGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (22) (SEQ ID NO:
48) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpsGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (23) (SEQ ID NO:
49) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpsGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (24) (SEQ ID NO:
50) 5' Toco-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGpsTpsTps
TpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpsGpsTpsT 3'; (25) (SEQ ID NO:
51) 5'-TpsCpoGpsTpsCGpsTpsTpsTpsTpsGpsTpsCGpsTpsTpsTps
TpsGpsTpsCpoGpsTpsTps-HEGps-Chol 3'; (26) (SEQ ID NO: 52)
5'-TpsCpoGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGpsTps
TpsTpsTpsGpsTpsCpsGpsTpsTps(HEG)po(HEG)po-Chol 3'; (27) (SEQ ID NO:
53) 5'-GpsGpsGpsGpsTpsCpsApsApsCpoGpsTpsTpsGpsApsGps
GpsGpsGpsGpsGps-HEGps-Chol 3'; (28) (SEQ ID NO: 54)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Chol 3'; (29) (SEQ ID NO: 55)
5'-TpsCpsCpsApsTpsGpsApsCpsGpsTpsTpsCpsCpsTpsGps
ApsCpsGpsTpsTps-HEGps-Toco 3'; (30) (SEQ ID NO: 56) 5'
Palmitoyl-po(HEG)po(HEG)po-TpsCpoGpsTpsCpoGps
TpsTpsTpsTpsGpsTpsCpoGpsTpsTpsTpsTpsGpsTpsCpoGps TpsT 3';
[0357] wherein: [0358] Chol represents cholesterol; [0359] Toco
represents tocopherol; [0360] Palmitoyl represents a palmitoyl
group; [0361] HEG represents ((CH.sub.2).sub.2O).sub.6; [0362] po
represents a phosphodiester linkage; and [0363] ps represents a
phosphorothioate linkage,
[0364] wherein the tocopherol, the cholesterol, or the palmitoyl
group is covalently linked to the (HEG) directly via a po or ps
linkage, or indirectly via a second linker that is linked to (HEG)
directly via a po or ps linkage.
[0365] Embodiment 23a is the ODN construct of embodiment 23,
wherein the tocopherol, the cholesterol, or the palmitoyl group is
covalently the second linker and the second linker is covalently
linked to the (HEG) directly via the po or ps linkage.
[0366] Embodiment 23b is the ODN construct of embodiment 23, having
a structure as shown in FIG. 28.
[0367] Embodiment 23c is the ODN construct of embodiment 23, having
a structure as shown in FIG. 29.
[0368] Embodiment 23d is the ODN construct of embodiment 23, having
a structure as shown in FIG. 30.
[0369] Embodiment 24 is a pharmaceutical composition comprising an
ODN construct of any of Embodiments 1 to 23c and a pharmaceutically
acceptable carrier.
[0370] Embodiment 25 is a method of preparing a pharmaceutical
composition, comprising combining an ODN construct of any of
Embodiments 1 to 23c with a pharmaceutically acceptable
carrier.
[0371] Embodiment 26 is a method of stimulating an immune response
in a subject in need thereof, comprising administering to the
subject the pharmaceutical composition of Embodiment 24.
[0372] Embodiment 27 is a method of treating a disease in a subject
in need thereof, comprising administering to the subject the
pharmaceutical composition of Embodiment 24, wherein the disease is
selected from the group consisting of Hepatitis B virus (HBV) and
cancer.
[0373] Embodiment 28 is an ODN construct comprising a CpG ODN,
wherein at least one of the CpG dinucleotides in the CpG ODN has a
stereodefined phosphorothioate internucleotide linkage.
[0374] Embodiment 29 is the ODN construct of Embodiment 28, wherein
two to four of the CpG dinucleotides in the CpG ODN each have a
stereodefined phosphorothioate internucleotide linkage.
[0375] Embodiment 30 is the ODN construct of Embodiment 28 or 29,
comprising a CpG ODN comprising a polynucleotide sequence selected
from the group consisting of:
TABLE-US-00007 (1) (SEQ ID NO: 1) 5' TCGTCGTTTTGTCGTTTTGTCGTT 3';
(2) (SEQ ID NO: 2) 5' GGGGGACGATCGTCGGGGGG 3'; (3) (SEQ ID NO: 3)
5' GGGGTCAACGTTGAGGGGGG 3'; (4) (SEQ ID NO: 4) 5'
TCCATGACGTTCCTGACGTT 3'; (5) (SEQ ID NO: 5) 5'
TCGTCGTTTTCGGCGCGCGCCG 3'; (6) (SEQ ID NO: 6) 5'
TCGTCGTTACGTAACGACGACGTT 3'; and (7) (SEQ ID NO: 7) 5'
TCGTCGTTTTGTCGTTTTGTCGT 3'.
[0376] Embodiment 31 is a ODN construct having the formula of
Formula I(s):
5'M.sub.1-L.sub.1-[CpG ODN]-L.sub.2-M.sub.23',
wherein:
[0377] each of M.sub.1 and M.sub.2 independently represents a lipid
moiety, preferably the lipid moiety comprises at least one selected
from the group consisting of cholesterol, tocopherol, a palmitoyl
group, and a stearyl group, optionally one of M.sub.1 and M.sub.2
is absent;
[0378] each of L.sub.1 and L.sub.2 independently represents a
linker, preferably the linker comprises at least 10 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond,
optionally one of L.sub.1 and L.sub.2 is absent when the respective
M.sub.1 or M.sub.2 is absent; and
[0379] CpG ODN represents the CpG ODN of any of claims 28 to
30;
[0380] optionally, the CpG ODN construct of formula (I) is further
covalently conjugated to a targeting moiety, which is preferably
selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0381] Embodiment 32 is a CpG ODN construct having a formula
of:
5'M-L-[CpG ODN]3', or Formula (IIa)(s):
5'[CpG ODN]-L-M3' Formula (IIb)(s):
wherein:
[0382] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group;
[0383] L represents a linker comprising at least 1 atoms selected
from the group consisting of carbon, nitrogen, oxygen, hydrogen,
sulfur and phosphorus, and L is covalently linked to the CpG ODN
via a cleavable linkage, preferably via an ester or an amide bond;
and
[0384] CpG ODN represents the CpG ODN of any of Embodiments 28 to
30;
[0385] optionally, the CpG ODN construct of Formula (IIa) or (IIb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0386] Embodiment 33 is a CpG ODN construct having a structure
of:
5'M.sub.1-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]-Y.sub.3-M.sub.23', or Formula (IIIa)(s):
5'M.sub.2-Y.sub.3-[CpG
ODN]-Y.sub.2-(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M.sub.13'
Formula (IIIb)(s):
wherein:
[0387] M.sub.1 represents a lipid moiety, preferably the lipid
moiety comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0388] M.sub.2 represents a lipid moiety, a targeting moiety, or is
absent,
[0389] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0390] X is independently a bond, a po linkage or a ps linkage,
[0391] each of Y.sub.2 and Y.sub.3 is independently a cleavable
linkage, preferably comprises an ester or an amide bond, more
preferably is a po linkage or a phosphoramidate linkage, most
preferably a po linkage, provided that when M.sub.2 is absent,
Y.sub.3 is absent,
[0392] CpG ODN represents the CpG ODN of any of embodiments 28 to
30;
[0393] m is an integer from 1 to 15, and
[0394] n is an integer from 1 to 5.
[0395] Embodiment 34 is a CpG ODN construct having a formula
of:
5'M-Y.sub.1--(((CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.2-[CpG
ODN]3', or Formula (IVa)(s):
5'[CpG
ODN]-Y.sub.2-0(CH.sub.2).sub.2O).sub.m--X).sub.n--Y.sub.1-M3'
Formula (IVb)(s):
[0396] wherein:
[0397] M represents a lipid moiety, preferably the lipid moiety
comprises at least one selected from the group consisting of
cholesterol, tocopherol, a palmitoyl group, and a stearyl
group,
[0398] Y.sub.1 is a bond or a linker, preferably ethylene glycol
having the formula ((CH.sub.2).sub.2O).sub.o, wherein o is 1-15,
covalently linked to (((CH.sub.2).sub.2O).sub.m--X).sub.n via a
phosphodiester (po) linkage, a phosphorothioate (ps) linkage or a
bond,
[0399] X is independently a bond, a phosphodiester (po) linkage or
a phosphorothioate (ps) linkage,
[0400] Y.sub.2 is a cleavable linkage, preferably comprises an
ester or an amide bond, more preferably comprises a po linkage or a
phosphoramidate linkage, most preferably a po linkage;
[0401] CpG ODN represents the CpG ODN of any of embodiments 28 to
30
[0402] n is an integer from 1 to 5, preferably 2;
[0403] optionally, the CpG ODN construct of Formula (IVa) or (IVb)
is further covalently conjugated to a targeting moiety, which is
preferably selected from the group consisting of galactose,
N-acetylgalactosamine (GalNAc), fucose, mannose, sialic acid,
N-acetyl neuraminic acid.
[0404] Embodiment 35 is a pharmaceutical composition comprising the
ODN construct of any of Embodiments of 28 to 34.
[0405] Embodiment 36 is a method of preparing a pharmaceutical
composition, comprising combining the ODN construct of any of
Embodiments of 28 to 24 with a pharmaceutically acceptable
carrier.
[0406] Embodiment 37 is a method of stimulating an immune response
in a subject in need thereof, comprising administering to the
subject the pharmaceutical composition of Embodiment 35.
[0407] Embodiment 37a is the method of embodiment 37, wherein the
subject is in need of treatment of an HBV infection.
[0408] Embodiment 37b is the method of embodiment 37, wherein the
subject is in need of treatment of a cancer.
[0409] Embodiment 37c is the method of embodiment 37, wherein the
subject is in need of treatment of a colorectal cancer.
[0410] Embodiment 38 is a method of treating a cancer in a subject
in need thereof, comprising administering to the subject the
pharmaceutical composition of Embodiment 35.
[0411] Embodiment 38a is the method of embodiment 38, wherein the
cancer is a gastrointestinal cancer.
[0412] Embodiment 38b is the method of embodiment 38, wherein the
cancer is a colorectal cancer.
[0413] Embodiment 39 is a method of treating an HBV infection in a
subject in need thereof, comprising administering to the subject
the pharmaceutical composition of Embodiment 35.
[0414] Embodiment 39a is the method of embodiment 39, wherein the
treatment results in a reduction of the copy numbers of the HBV DNA
in the subject.
[0415] Embodiment 39b is the method of embodiment 39 or 39a,
wherein the treatment results in an increase in the titer of
antibody specific to Hepatitis B surface antigen (HBSAg) in the
subject.
[0416] Embodiment 39c is the method of any one of embodiments 39 to
39b, wherein the treatment results in an increase in Hepatitis B
surface antigen (HBSAg) specific T cells.
EXAMPLES
[0417] The following examples of the present disclosure are to
further illustrate the nature of the present disclosure. It should
be understood that the following examples do not limit the present
disclosure and that the scope of the present disclosure is to be
determined by the appended claims.
[0418] The experimental methods used in the following examples,
unless otherwise indicated, are all ordinary methods. The reagents
used in the following embodiments, unless otherwise indicated, are
all purchased from ordinary reagent suppliers.
Example 1
Synthesis of AG9
[0419] AG9: Chemical Formula: C298H420N70O164P26S19, Molecular
Weight: 9021.42
(5'-Toco-(po)-HEG(po)-HEG(po)-TpsCGpsTpsCGpsTpsTpsTpsTpsGpsTpsCGp-
sTpsTpsTpsTpsGpsTpsCGpsTpsT-3') as shown in FIG. 31.
[0420] AG9 was synthesized using a synthesis scheme illustrated in
FIG. 17. More specifically, synthesis of AG9 was performed
utilizing solid phase synthesis technology and an automated
synthesizer. The synthesis was performed two times at a 218 umol
scale for a total scale of 436 umol. The synthesis was performed
using a fixed 6.3 ml column (GE healthcare). The OligoPilot 100 was
used for the synthesis of the compound. Unylinker NittoPhase
support with a loading of -303 .mu.mol/g was the solid support used
for this synthesis. The synthesis was executed by running a 4-step
iterative method specifically designed for the manufacture of AG9.
The four steps include detritylation, coupling, sulfurization, and
capping, and were repeated for 16 cycles using the specific
amidites to yield the desired product. After each step, an
appropriate wash of acetonitrile was performed to prevent unwanted
reactions. The detritylation of the solid support was performed
utilizing 3% dichloroacetic acid in toluene and monitored at 436
nm. Coupling was performed by mixing 40% (by volume) of a 0.1 M
amidite solution with 60% of the activator in-line prior to
addition to the column. The total of 2.5 equivalents of the amidite
added per coupling. After loading the activator/amidite mixture
onto the column, the coupling mixture was circulated via a
recycling loop for 5 minutes for DNA. The .alpha.-Tocopherol
phosphoramidites was dissolved in 10% DMF in Acetonitrile. An
extended coupling of 10 min were used for HEG linker and
.alpha.-Tocopherol phosphoramidites. To ensure high coupling
efficiency, the amidite and activator solutions remained over
molecular sieves for at least 4-6 hours after preparation. The
third step, sulphurization, was performed by the addition of 1.2
column volumes of a solution of 0.2 M Phenyl acetyl disulfide
(PADS) in lutidine: acetonitrile (1:1). The solution was allowed to
age at least 12 hours prior to use in the synthesis. A contact time
of 2.0 minutes with 2.0 CV for thiolation was performed. For
oxidation, the 0.05 M Iodine in Pyridine/Water 90/10 was used The
last step in the elongation cycle, capping, was performed by the
addition of one half the column volume of a mixture of the three
capping reagents (Capping A: Capping B1: Capping B2; 50/25/25;
v/v/v).
[0421] After the full-length AG9 sequence was synthesized, the
support was washed with 2.0 CV of 20% Diethylamine (DEA) in
acetonitrile. This step allowed for removal of the beta cyanoethyl
protecting groups from the product while the product was still
attached to the support.
TABLE-US-00008 TABLE 1 List of Synthesis Reagents and Vendors
Synthesis Reagent Vendor MST# dA 5'-O-DMT-.beta.-Cyanoethyl
Phosphoramidite Thermo 21-1732-75 dC 5'-O-DMT-.beta.-Cyanoethyl
Phosphoramidite Thermo 21-1727-75 dG 5'-O-DMT-.beta.-Cyanoethyl
Phosphoramidite Thermo 21-1734-75 T 5'-O-DMT-.beta.-Cyanoethyl
Phosphoramidite Thermo 21-1736-75 HEG-phosphoramidites Thermo
27-1786-02 .alpha.-Tocopherol phosphoramidites Chemgenes CLP-2706
NittoPhase Unylinker Support Kinnovate -- Acetonitrile (50 lit)
TEDIA UN1648 (AH3801-130) Cap A Solution Novabiochem BIO224-1005
20% Methylimidazole/80% ACN Cap B1 Solution Novabiochem BIO347-0505
40% Acetic Anhydride, 60% ACN Cap B2 Solution Novabiochem
BIO349-0505 60% 2,6 - Lutidine/40% ACN 0.2M PADS in Lutidine:
Acetonitrile (1:1) AIC Lutidine Sigma N/A* 20% Diethylamine (DEA)
Novabiochem NC0017-0505 3% Dichloroacetic Acid (DCA) in Toluene
Novabiochem BIO832-2505 Oxidizing agent (0.05 M Iodine in
Pyridine/Water Novabiochem BIO424-2505 90/10 Activator Solution:
0.3 M5- Novabiochem BIO166-1005 Benzylmercaptotetrazole (BTT) in
Acetonitrile Variables Value Column Volume (CV) 6.3 mL Amidites
(equiv./flow) 2.5 equiv Activator (flow) 300 mL/min DNA Thiolation
(equiv./flow) 2.5 equiv HEG coupling (equiv./time) 3.0 equiv/10 min
coupling Tocopherol Coupling (equiv./time) 3.0 equiv/10 min
coupling Capping solutions 0.5 CV, 0.5 min CT DEA Treatment 1.2.0
CV, 10 min CT
[0422] 0.7 g of the Unylinker.TM. resin was filled into the Akta
6.3 mL column and the column was placed into the column position 1.
The flow through the column and potential leakages of the column
were checked by the Flow Test.
[0423] Cleavage and deprotection of the synthesized oligonucleotide
was performed using concentrated ammonium hydroxide. Ammonium
hydroxide (.about.60 ml) was added to the oligonucleotide bound to
the solid support and gently stirred until the support was well
dispersed. The mixture was shaken at 55.degree. C. for
approximately 16 hours. After the allotted time elapsed, the solid
support was separated from the product containing solution by
filtering through a sintered glass filter. The solid support in the
filter was then washed (3.times.20 ml) with a solution of 50:50
(v/v) Ethanol: H.sub.2O. A small aliquot of the crude
oligonucleotide solution was removed for mass spectral, HPLC, and
UV analysis.
[0424] Purification was performed using Reverse phase
chromatography on a Akta Pur HPLC system (GE Healthcare) and a Luna
C8 phenomenox Column 250*21.2 with an internal diameter of 21.2
cm.
[0425] List of Purification Reagents and Vendors
TABLE-US-00009 Purification Reagent Vendor MST# Sodium Acetate
(NaCl) EMD Luna C8 phenomenox Column 250*21.2 phenomenox 00G-4249PO
20 mM Sod Acetate, 10% AcCN (Eluent A) Acetonitrile (Eluent B)
[0426] After sample loading, the column was equilibrated for 2
column volumes (CV) of Eluent A. The gradient consisted of an
initial segment in which 8% Eluent B was delivered over 2.0 CV in
order to wash off any unbound sample from the column and then the
gradient was run from 8% to 50% Eluent B over a length of 6.0 CV.
Fractions were collected in sterile 50 ml vials and then analyzed
by HPLC.
[0427] Purification Conditions
TABLE-US-00010 Variable Specification Column Luna C8 phenomenox
Column, 21.2 cm diameter Anion Exchange Resin C8, 100 .mu.m
particle size Column Bed Height 21.2 cm Column Volume 75 ml L
Eluent A 20 mM NaOAc, 10% AcCN Eluent B AcCN Inlet temperature RT
Outlet temperature RT Loading Flow Rate 30 ml/min Flow Rate 30
ml/min Gradient Wash 8% B for 1.0 CV Gradient 8% B to 50% B over
6.0 CV Fraction size ~30 ml
[0428] Once the fraction data was complete, mock pools were
prepared. The mock pools contained all fractions greater than 75%
FLP. After analysis, these same fractions were pooled for desalting
by ultrafiltration.
[0429] The crude product, fractions, mock pools, pools, desalted
product and final product were analyzed by RP-HPLC. The crude and
final product was also analyzed by LCMS. The methods were as
follows:
[0430] RP-HPLC Analysis of AG9
[0431] ESI/MS Analysis of AG9
[0432] The selected pools for each purified synthesis batch, which
had remained separate up to that point, were combined for the
ultrafiltration. The combined pools were subjected to concentration
and desalting using ultrafiltration with a total of three 0.1
m.sup.2 PES membranes (Pall Corp). The pools were concentrated to
approximately 2 liters at which point diafiltration was initiated.
Diafiltration continued until the conductivity of the permeate was
less than or equal to 50 .mu.S/cm.
[0433] Lyophilization was performed using a VirTis SP Scientific
Bench Top Pro Freeze Dryer System. The concentrated solution was
filtered through a 0.2-micron filter then evenly distributed into
50 ml vials and lyophilized. The final product was sampled by QC
and ready for in vivo testing.
Example 2
TLR9 Activation Assays
[0434] HEK293 Reporter Assay
[0435] HEK-Blue hTLR9 and HEK-Blue mTLR9 cell lines are commercial
cell lines (Invivogen, San Diego, Calif.) that are stably
transfected with a reporter construct NF-kB-SEAP (secreted
embryonic alkaline phosphatase), and either human TLR9 or mouse
TLR9.
[0436] 24 hours before starting the assay, a subconfluent layer of
cells is plated in a 96-well, flat bottom dish. On the day of the
assay, titrating concentrations of compound to be analyzed are
added to the cells, and the cultures are incubated overnight. In
these cells, the ability of the compound to activate the receptor
TLR9 is proportional to the concentration of the reporter molecule,
SEAP, in the supernatant. The concentration of SEAP can be
determined by a colorimetric assay where the substrate QUANTI-Blue
(Invivogen) is added to the culture supernatant for 3 hours.
Cleaved substrate is detected using a spectrophotometer at OD630
nm, and relative concentrations are compared.
[0437] PBMC Assay
[0438] PBMCs are isolated from whole blood by ficoll gradient
centrifugation. 1.times.10.sup.6 PBMC are seeded at the bottom of
96-well culture dishes, and titrating concentrations of compound to
be analyzed are added to the cells. Cultures are incubated for 48
hours, during which cellular targets are induced to express
cytokines. Cytokine levels are measured by sampling supernatant and
detecting individual cytokines using a Luminex assay. In addition,
PBMCs are harvested and stained using fluorochrome-conjugated
antibodies directed to individual receptors. Expression levels are
measured using a flow cytometer.
[0439] PHH Cell Assay
[0440] Primary human hepatocytes are cultured and infected with
Hepatitis B. On day 4 post infection, the media is exchanged for
media from PBMCs treated with compound (see above). After 4 days of
further incubation (day 8 post infection), the media is changed and
the supernatant is measured for HBsAg production. After 4 more days
(day 12 post infection), the supernatant is again measured for
HBsAg production.
[0441] In Vivo Cytokine Induction
[0442] C57BL/6 mice are injected subcutaneously or intravenously
with compound to be analyzed. Four hours later, mice are bled by
submandibular vein puncture. Serum cytokines are measured using a
Luminex assay.
[0443] AAV-HBV Model
[0444] C57BL/6 mice are infected with AAV-HBV particles.
Approximately 1 month after infection, mice are injected
subcutaneously or intravenously with compound to be analyzed.
Compound dosing is repeated biweekly (every two weeks) for a
specified period of time, typically over 8 weeks. Mice are bled
weekly. Serum is measured for various endpoints, such as
circulating HBsAg, HBV DNA and anti-HBs Ab.
[0445] MC38 Tumor Model
[0446] C57/BL6 mice are subcutaneously implanted with
0.5.times.10.sup.6 MC38 colon carcinoma cells, and tumor growth is
monitored. When the mean tumor volume reaches 100-200 mm.sup.3
(approximately 12 days past implantation), dosing is initiated.
Tumor size is monitored every 3-4 days.
[0447] ELISpot Procedure
[0448] Fresh spleen cells were isolated from treated mice that were
sacrificed on predetermined time points, approximately 1 month
after the final dose. Splenocytes were aliquoted in triplicate into
microtiter plate wells at a concentration of 2.times.10.sup.5
cells/well. Individual known HBV epitopes from core and surface and
15-mer overlapping peptides from HBV consensus B, C & D
(overlapping by 11 amino acids) were added to the wells at a final
concentration of 2 .mu.g/ml. Cells were incubated for varying
amounts of time, then activated cells were revealed by Mouse
IFN-.gamma. ELISpot kit (Mabtech 3321-2A) according to
manufacturer's instructions. Activated cells were quantified by
CTL-FluoroSpot Analyzer.
[0449] IVIS Imaging
[0450] For in vivo imaging, C57Bl/6 male mice between 7-8 weeks
were used. AF647-labeled CpG oligonucleotides (AG20 and AG21) were
injected via either intravenous or subcutaneous routes (20 nmol in
total volume of 100 .mu.l). 24 hours post injection, animals were
sacrificed and spleens, draining lymph nodes, livers, kidneys and
lungs were excised. The organs were imaged using IVIS (Ami HTX).
Image sets (Ex: 605, Em: 670, f 5, 10 Sec) were collected. Spectral
Instruments Imaging Software Aura was used to acquire and
quantitate the fluorescence imaging data sets. A Region of Interest
tool was used to measure the radiant efficiency from each
organ.
[0451] Immunofluorescence
[0452] C57Bl/6 male mice between 7-8 weeks were used. AF647-labeled
CpG oligonucleotides (AG20 and AG21) were injected via either
intravenous or subcutaneous routes (20 nmol in total volume of 100
.mu.l). 24 hours post injection, animals were sacrificed and
spleens, draining lymph nodes, livers, kidneys and lungs were
excised. Organs were formalin fixed, then sectioned on a microtome
using standard procedures. Immunofluorescence staining was
performed using Leica Bond automated immunostainer on
formalin-fixed paraffin-embedded (FFPE) mouse lymph node and
spleen. Heat induced antigen retrieval was performed using Leica
Bon Epitope Retrieval Buffer 2 (EDTA solution, pH9.0) for 20
minutes. Staining was performed with an overnight incubation for
primary antibodies, a rat anti-CD45R (B220) (RA3-6B2), eFluor 570
antibody and rabbit anti-CD3 antibody. A secondary antibody,
Goat-anti Rabbit IgG Alexa Fluor Plus 488 was applied and slides
were mounted with DAPI in Fluprogel II for nuclear
visualization.
[0453] HPLC and Serum Protein Binding
[0454] An Ultimate-3000 HPLC system equipped with both UV and
fluorescence detectors was used for the analysis. Samples of
oligonucleotides, proteins, and oligonucleotide--protein mixtures
were prepared in 1.times.PBS with 20 mM KCL and analyzed by
size-exclusion chromatography. For micelle formation assays,
oligonucleotides were prepared in a solution of 2M or 4M urea or
PBS. Samples were injected on a Superdex 75 Increase (GE
Healthcare). A mobile phase of 1.times.PBS with 20 mM. KCL at 0.075
ml/min was used for the chromatography and the size-exclusion
column was kept at room temperature. UV chromatograms were recorded
at 260, 280 and 500 nm. The excitation wavelength of 490 nm and
emission wavelength of 530 nm were used to obtain chromatograms by
the fluorescence detector.
Example 3
Phosphodiesters in a CpG ODN Potentiated Activity
[0455] Based on the literature, the prototypic
5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (ODN2006) can stimulate human and
mouse cells expressing TLR9. This sequence has a phosphorothioate
(ps) backbone for in vivo stability. The ps linkages at the CpG
motifs of ODN2006 (5'-TCGTCGTTTTGTCGTTTTGTCGTT-3') were replaced
with phosphodiester (po) linkages, and TLR9 activation was
assessed. The results, depicted in FIG. 1, demonstrate that
replacement of 3 or 4 of the CpG motifs' ps linkages with po
linkages resulted in highly active ODN constructs having agonistic
activity for TLR9. The version of ODN2006 having all four of the
CpG motifs' ps linkages replaced with po linkages (AG1) has an EC50
value 2-3.times. lower than that of ODN2006, and a maximum activity
20-35% greater than ODN2006. Similar activity to AG1 was observed
for AG2 and AG3 which have 3 CpG motifs' ps linkages replaced with
po linkages. This experiment demonstrates that substituting po at
the backbone of the CpG motifs enhances the agonistic properties of
the oligonucleotide.
Example 4
Direct Cholesterol Linkage to a CpG ODN Abrogated Activity
[0456] The oligonucleotides were conjugated to various moieties
that would allow for differential distribution of the oligo. For
example, cholesterol and tocopherol are lipophilic molecules that
are believed to localize to the liver. When cholesterol and
tocopherol were directly conjugated to either the 5' or 3' end of
the CpG ODN, the resulting molecule did not activate
TLR9-expressing cells (data not shown). These experiments
demonstrated that direct conjugation of a compound onto the end of
the oligonucleotide could impact its ability to agonize TLR9.
Example 5
[0457] Cholesterol Indirectly Conjugated Via a Cleavable Linker to
a CpG ODN Potentiated Activity
[0458] Due to possible steric effects, conjugation of a lipophilic
moiety proximal to the oligonucleotide may have abrogated the
ability of the molecule to bind to the TLR9 receptor. To explore
this possibility, cholesterol was conjugated to ODN constructs
having agonistic activity for TLR9, also referred to herein as a
TLR9 agonists, as a targeting moiety using a cleavable linker, and
TLR9 activation was assessed. The results, shown in FIG. 2,
indicate that conjugation of a targeting moiety to the TLR9
agonists via a cleavable linker preserves their agonistic
activity.
[0459] For example, a TLR9 agonist referred to as AG8 was designed
using a cleavable linker to separate cholesterol from the CpG ODN
of AG1. The linker for AG8 was (HEG)po(HEG)po-. When HEK-Blue hTLR9
cells were stimulated with AG8, the activity was potentiated,
relative to the unconjugated parent, AG1. AG8 had an EC50 value
2-3.times. lower than that of AG1, and more than 9.times. lower
than that of ODN2006. The maximum activity of AG8 was approximately
10% greater than that of AG1, and approximately 50% greater than
that of ODN2006. We tested analogs of AG1 that were linked to
cholesterol in the same manner as AG8. AB4, AG5, AG6 and AG7 have
0, 1, 2, and 3 (respectively) CpG motifs' ps replaced with po. As
shown in FIG. 2, the higher the number of CpG motifs with po
linkages, the greater the activity. AG4 has a full ps backbone and
is conjugated to cholesterol via an indirect linker. AG5 is similar
to AG4, but has 1 CpG motif replaced with a po linkage. These two
compounds have similar activity in the HEK-Blue hTLR9 cellular
assay, with their EC50 being 6.4-10 nM. AG6 and AG7 have 2 and 3
CpG motifs replaced with a po linkages, and their EC50's were
approximately 4.5 nM and 2.6 nM respectively. This experiment
demonstrated that by conjugated a targeting moiety indirectly
through a cleavable linker, the activity of the pharmacophore was
preserved.
Example 6
Tocopherol Indirectly Conjugated Via a Cleavable Linker a CpG ODN
Potentiated Activity
[0460] In order to test the versatility of the conjugation
strategy, tocopherol was conjugated to a TLR9 agonist using a
cleavable linker. For example, the TLR9 agonist referred to as AG9,
the synthesis of which is described in Example 1 above, was
designed using a cleavable linker to separate tocopherol from the
oligonucleotide of AG1. The linker for AG9 was (HEG)po(HEG)po-.
When HEK-Blue hTLR9 cells were stimulated with AG9, the activity
was equivalent to that of the cholesterol conjugate AG8 (data not
shown). These experiments demonstrated that different targeting
moieties could be conjugated to the CpG ODN, and the CpG ODN could
retain activity.
Example 7
Indirect Conjugation Using a Cleavable Linker on Either the 5' or
the 3' End of a CpG ODN Resulted in Equivalent Activity
[0461] In order to test the polarity of the conjugated moiety,
cholesterol or tocopherol was conjugated to the 3' end of a TLR9
ODN using a cleavable linker. For example, a TLR9 agonist referred
to as AG10 was designed using a cleavable linker, -po(HEG)po(HEG),
to separate cholesterol from the 3' end of the oligonucleotide of
AG1, and a TLR9 agonist referred to as AG11 was designed using a
cleavable linker, -po(HEG)po(HEG), to separate tocopherol from the
3' end of the oligonucleotide of AG1. The activity of the
conjugates was analyzed using the HEK-BLUE hTLR9. As shown in FIG.
3, AG8 and AG10, which had a cholesterol indirectly conjugated to
the 5'- or 3'-ends of the CpG ODN respectively, had equivalent
activity.
[0462] Interestingly, in HEK-BLUE hTLR9 cells, AG10 and AG11 had
similar activity as their 5' conjugate counterparts, AG8 and AG9,
respectively. However, they were not active on HEK-BLUE mTLR9
cells, indicating that the polarity of the conjugate is important
for recognition by the mouse TLR9 receptor but not for the human
TLR9 receptor (AG8 and AG10 are shown in FIG. 3, data not shown for
AG9 and AG11).
[0463] In order to test the effects of the cleavage sites within
the linker, analogs of AG9 were synthesized in which the
phosphodiester cleavage sites were replaced with phosphorothioate
bonds that are resistant to cleavage. As illustrated in FIG. 12,
AG12 has non-cleavable phosphorothioate linkages replacing the
cleavable phosphodiester linkages between the oligo and the linker,
between the tocopherol moiety and the linker, and between the HEG
molecules of the linker. It is thought that this molecule cannot be
efficiently cleaved, and the complete molecule will interact with
TLR9. AG13 has non-cleavable phosphorothioate linkers replacing the
cleavable phosphodiester linkages between the linker and oligo. It
is thought that after cleavage, part of the linker remains bound to
the oligo. AG14 has non-cleavable phosphorothioate linkers
replacing the cleavable phosphodiester linkages between the linker
and tocopherol. It is thought that after cleavage, tocopherol is
removed and the entire linker remains bound to the oligo. AG16 is a
variant of AG1 that is conjugated to tocopherol via a
phosphorothioate bond. AG15 is a variant of AG1 that is conjugated
to tocopherol via a phosphorothioate bond and that has a
phosphorothioate linkage between bases 21 and 22.
[0464] All analogs that retained any portion of the linker and/or
tocopherol had reduced activity in the HEK-Blue reporter assay, as
shown in FIGS. 19 and 20. In particular, it was shown that direct
conjugation of a targeting moiety (such as tocopherol) to an oligo
as represented by the constructs AG15 and AG16 abrogated the TLR9
agonist activity of the oligo (data not shown). Conjugation of the
oligo to tocopherol via a cleavable linker preserved the TLR9
agonist activity of the oligo, and optimal activity was obtained
when both tocopherol and the linker were cleaved (FIG. 19). The
data suggest that once endocytosed by the cell, the ODN is released
by cleavage from the linker and targeting moiety, and that this
release is require for full activity. Similar results were obtained
with cholesterol or palmitic acid were conjugated to the oligo by
this method. The results suggest that any molecule, such as a
peptide, protein, toxin, organic or inorganic molecule, etc., can
be conjugated to the oligo using this cleavable linker
strategy.
[0465] Using HEK-Blue mTLR9 reporter cells, it was found that AG9
also activated mouse TLR9 and achieved activity similar to
unconjugated parent AG1 and superior to ProMune, an unmodified,
full phosphorothioate containing ODN2006, in the reporter cells,
indicating that AG9 could be used in mouse in vivo models (FIG.
20). The results indicate that in a TLR9 agonist according to an
embodiment of the present disclosure, a cleavable linker is
preferred in order to optimize its TLR9 stimulatory capability.
Example 8
In Vivo Analysis of TLR9 Agonists
[0466] Mice were injected subcutaneously with 7.6-10.8 mg/kg of
TLR9 agonists AG8 and AG10 and bled 4 hours later. AG8 is
conjugated to cholesterol and a cleavable linker on the 5' end of
the oligo, and AG10 is conjugated to cholesterol and a cleavable
linker on the 3' end of the oligo. The collected samples were
analyzed for cytokine levels using a Luminex assay. The results,
shown in FIG. 4, indicate that the TLR9 agonists induced cytokine
production in vivo. These experiments indicated that, as observed
in vitro with the HEK-BLUE mTLR9 cells reporter assay, the polarity
of the linker and cholesterol was important in the ability of AG10
to agonize TLR9. While AG10 had little activity in vivo, AG8 could
induce proinflammatory cytokines such as IL-6, TNFa and MIP-1b
after dosing. Notably, the levels of cytokines produced were on
average higher than that of the control ODN2006, and on par with
ODN1826. Thus the cholesterol conjugated CpG ODN is active in
vivo.
Example 9
Analysis of the Effect of TLR9 Agonists on AAV-HBV Infected
Mice
[0467] A schematic of an experiment carried out to analyze the
effect of TLR9 agonists on HBV infection in mice is shown in FIG.
5.
[0468] Mice that had been injected with AAV-HBV virus on Day -28
were dosed with vehicle or TLR9 agonists and assessed for levels of
HBV indicators. Mice were either given a single dose on Day 0 or
multiple doses, on Days 7, 21, 35 and 49. As a benchmark, one group
of mice were dosed orally with GS9620, a small molecule agonist of
TLR7. All mice were assessed for the level of HBV DNA (see FIG. 6),
HBsAg (the surface antigen of HBV; see FIG. 7), and HBeAg (the
envelope antigen of HBV; see FIG. 8). The results indicated that
administration of the TLR9 agonists successfully suppressed HBV
DNA, HBsAg and HBeAg in AAV-HBV-administered mice.
[0469] Mice that were subcutaneously injected with the TLR9 agonist
AG8 were assessed for induced cytokine production. The results,
shown in FIG. 9, indicate that 3 nmol of the TLR9 agonist AG8,
which did not produce induction-site reactions, induced cytokine
levels similar to the TLR9 agonist AG10.
[0470] Mice that were intravenously (IV) injected with the TLR9
agonist AG8 were assessed for induced cytokine production. The
results, shown in FIG. 10, indicate that 15 nmol of the TLR9
agonist AG8 induced cytokine levels. The IV-injected mice were also
analyzed for their HBV viral load. As shown in FIG. 11, IV dosage
with AG8 reduced the HBV viral load.
[0471] These experiments demonstrated that AG8, either as a single
dose, or given QOW for 8 weeks could suppress viral load.
Example 10
TLR9 Agonists Induced a Differential Cytokine Profile
[0472] Naive C57BL/6 mice were injected with the TLR9 agonists AG1,
AG8 and AG9, respectively. Serum was sampled at 4 h post injection
and measured for cytokines by a Luminex assay.
[0473] As shown by the results in FIG. 9, both AG8 and AG9 had
increased activity in inducing cytokines IL-12p40, IL-6 and M1P1b,
and both activated a different cytokine profile than that of the
parent molecule, AG1 (data not shown). Similar pattern of induction
was also observed for other cytokines, e.g., IL-12p70, IL-10,
G-CSF, IFN-g, IFN-a, TNF-a (data not shown). The cytokine induction
was dosage dependent (FIG. 10).
Example 11
AG9 Induces Higher Levels of .alpha.-HBsAg than AG1
[0474] Mice were immunized subcutaneously or intravenously with 10
.mu.g of recombinant HBsAg in combination with 30 nmol of either
AG1 or AG9. Seven days later, mice were bled and serum
concentrations of HBsAg-specific antibodies were quantified by
ELISA.
[0475] As shown in FIG. 11, when dosed subcutaneously, there was a
on average a 1.65 foldincrease in the levels of .alpha.-HBsAg
between mice dosed with AG1 (0.332 AU) and AG9 (0.551 AU). When
dosed intravenously, the amount of HBsAg-specific antibodies
induced by AG9 (1.41 AU) was 2.5 fold more than the amount of
antibodies induced by AG1 (0.59 AU) (p<0.009). This suggests
that the tocopherol conjugation to the oligonucleotide augments the
immunostimulatory activity in order to amplify the immunization
process. In addition, intravenous administration of the tocopherol
conjugated CpG ODN was much more effective at inducing a humoral
response than subcutaneous administration, or intravenous
administration of the non conjugated parent, AG1. This result
suggests that tocopherol affects biodistribution of the CpG ODN
that results in enhanced activity on the humoral response.
Example 12
Conjugation of TLR Agonists to Lipophilic Moieties Via Cleavable
Linkers Achieved Functional Cures in AVV-HBV Mice
[0476] Naive C57BL/6 mice were infected with AAV-HBV. Once the
infection was established, mice were dosed intravenously or
subcutaneously every two weeks, with 15 or 30 nmol of the
tocopherol conjugate AG9 or the parent, AG1.
[0477] Although infected mice responded to subcutaneous
administration of either compound, a reduction in either
circulating HBV DNA or HBsAg was transient, and levels rebounded
after two weeks (FIG. 13 A&B).
[0478] Repeated intravenous administration of 15 nmol AG9 was more
potent than that of the parent AG1, as measured by the ability to
reduce circulating HBV DNA and HBsAg to below the lower level of
quantitation. In addition, after the treatment period, mice were
monitored for viral rebound. AG9-treated mice achieved a durable
response, with stable suppression of HBsAg and minimal rebound of
HBV DNA levels observed at 1 month post dose (FIG. 13 A&B).
This was accompanied by the induction of .alpha.-HBsAg Ab in the
majority of mice, and by the induction of HBsAg-specific CTLs in
some of the mice. In contrast, 3/5 mice treated with the parent,
AG1, achieved a durable response, and this was accompanied by
.alpha.-HBsAg Ab seroconversion and development of HBsAg-specific
CTLd. 2/5 AG1-treated mice did not seroconvert. Intravenous
administration appeared to be more efficacious than subcutaneous
administration.
[0479] Analysis of .alpha.-HBsAg Ab revealed that more mice treated
with AG9 had seroconverted, and on average had greater circulating
concentrations of .alpha.-HBsAg Ab compared to mice treated with
the parent, AG1. These results demonstrate that the tocopherol
conjugated CpG oligonucleotide AG9 had a greater ability to produce
functional cures in AAV-HBV infected mice than the unconjugated
parent, AG1.
[0480] To test whether the enhanced efficacy could be applied to
other lipophilic moieties, we synthesized AG19 in which we
substituted palmitoyl for tocopherol. In vitro experiments in the
HEK-hTLR9 line confirmed that AG19 had similar activity to AG9
(data not shown). We repeated the dosing regimen in AAV-HBV
infected mice as before, with AG19. Mice were dosed subcutaneously
or intravenously every 2 weeks for 14 weeks with 15 nmol of
compound. When dosed intravenously (FIG. 13C), AG19 was as
effective as AG9 at reducing circulating HBsAg and HBV DNA. After
the treatment period, levels of HBsAg remained below the limit of
quantification, and HBV-DNA levels were stably suppressed. Similar
to AG9 treated mice, suppression of viral load was accompanied by a
robust induction of .alpha.-HBsAg Ab.
[0481] At the end of the study, we measured the HBV-specific CTL
response by ELISpot. We quantified the number of CTL responding to
peptides from HBsAg and found that mice that were treated with AG9
and AG19 had significantly greater numbers of .alpha.-HBs CTL,
compared to PBS or parental AG1 treated mice (FIG. 13D). Thus
conjugating CpG ODNs to lipophilic moieties such as tocopherol or
palmitoyl enhanced the agonistic properties of the ODN. HBV
specific humoral and cellular responses were generated that
suppressed viral load even after drug was withdrawn. By definition,
AG9 and AG19 were able to establish a functional cure in subject
infected with HBV.
Example 13
AG9 Achieves Complete Tumor Regression and Tumor Control in the
MC-38 Tumor Model
[0482] Naive C57BL/6 mice were implanted with MC-38 colon carcinoma
cells, and tumor size was monitored. After the tumor was
established, mice were dosed intratumorally or intravenously with
increasing amounts of the tocopherol conjugate AG9 or the parent
AG1. AG14, another CpG ODN having the sequence of
TpsCpsGpsTpsCpoGpsTpsTpsApsCpsGpsTpsApsApsCpsGpsApsCpsGpsApsCpsGpsTpsT,
was also tested. The doses used were 40 .mu.g, 120 .mu.g and 360
.mu.g, corresponding to 1.6 mpk, 4.8 mpk and 14.4 mpk,
respectively. When the mice were treated intratumorally, they were
given 4 doses over 10 days (d12, d15, d19 and d22 post
implantation). When the mice were dosed intravenously, they were
given 2 doses, 7 days apart (d12, d19 post implantation). Tumor
growth was monitored every 3 days. See FIG. 14 for additional
information about the study.
[0483] Intratumoral dosing of either AG1 or AG9 had equivalent
efficacy (data not shown). At the 40 .mu.g dose of each group, one
mouse had complete tumor regression, and the remaining mice had
delayed tumor growth. In the 120 .mu.g dose of each group, three
mice had complete tumor regression, and two had delayed tumor
growth. In the 360 .mu.g AG1 dose, three mice had complete
regression and one mouse had delayed tumor growth. In the 360 .mu.g
AG9 dose, two mice had complete regression, and the remaining mice
had tumor stasis.
[0484] As shown by the results in FIG. 15B, when dosed
intravenously, AG9 was more efficacious than AG1 and AG14. At the
40 .mu.g dose of each group, three mice treated with AG9 had
delayed tumor growth, whereas two mice treated with AG1 had delayed
tumor growth. In the 120 .mu.g dose, three mice treated with AG9
had complete tumor regression and the other two mice had delayed
tumor growth. One mouse in the AG1-treated group had complete tumor
regression, and other four mice had delayed tumor growth. At the
highest dose of 360 .mu.g, all mice that received AG9 had complete
tumor regression. In mice treated with AG9, no tumor intake or
growth was observed even after the mice were re-challenged with
MC-38 tumor cells on Day 40 post implantation of the initial tumor.
Of the mice receiving AG1, four of the five mice had complete tumor
regression and one had delayed tumor growth. These data demonstrate
that administering CpG ODNs to activate TLR9 in vivo has
therapeutic benefits in treatment of cancer. Furthermore,
conjugation of tocopherol by a cleavable linker to the CpG ODN can
enhance its therapeutic benefit. In the context MC38, AG9
stimulated the immune response that resulted in tumor clearance and
a memory response that prevented tumor regraft. Immunomodulation
using AG9 was able to activate an anti-tumor response and allowed
formation of a memory response that provided protection against any
further recurrence of the tumor.
Example 14
MTD/Efficacy Study with AG9
[0485] Naive C57BL/6 mice are implanted with MC-38 colon carcinoma
cells, and tumor size was monitored. After the tumor is
established, e.g., with mean tumor volume of 100-200 mm.sup.3, the
mice are dosed intratumorally or intravenously with increasing
amounts of the tocopherol conjugate AG9 or the parent AG1 (FIG.
16). The mice are dosed intravenously once per week for two weeks
(qwk.times.2), e.g., on day 12 and day 19, or dosed once
intratumorally (qd.times.1) on day 12.
[0486] The primary objective of the study is to determine maximum
tolerated dose (MTD) of AG9, dosed qwk.times.2, in MC-38 tumor
bearing mice. The secondary objective of the study is to determine
efficacy of AG9, dosed qwk.times.2, on tumors.
[0487] The groups (qwk.times.2 and qd.times.1, n=5/group) and dose
are as the following:
TABLE-US-00011 Dose Group n Compound (mpk) Group n Compound Dose
(mpk) MTD/Efficacy 1 10 Vehicle 2 10 AG9 1.6 7 5 CPG7909 1.4 3 10
AG9 4.8 8 5 CPG7909 4.1 4 10 AG9 14.4 9 5 CPG7909 12.3 Cytokine
induction 5 5 AG9 28.9 10 5 CPG7909 24.6 6 5 AG9 43.3 11 5 CPG7909
36.9 12 3 Vehicle 13 3 AG9 1.6 14 3 AG9 4.8 15 3 AG9 14.4
[0488] The mice and the tumor growth are monitored.
Example 15
Other Tumor Models
[0489] AG9 was tested in the CT26 tumor mouse model of prostate
cancer. BALB/C mice were subcutaneously implanted with
3.times.10.sup.5 CT26 tumor cells in flank and tumor growth is
monitored every 3-4 days. When the mean tumor volume reaches 75-125
mm.sup.3 (approximately 12 days post implantation), dosing is
initiated. The mice were implanted with two doses, Q1W, of 40 nmol
of either AG1 or AG9. After 40 days of monitoring, all 8 mice dosed
with AG9 were tumor free. In contrast, 7/8 mice receiving AG1 or
8/8 mice receiving PBS had tumors and were euthanized when tumor
volumes exceeded 1000 mm.sup.3.
[0490] AG9 was tested in the A20 tumor mouse model of lymphoma.
BALB/C mice were subcutaneously implanted with 1.times.10.sup.6 A20
lymphoma tumor cells in flank and tumor growth is monitored every
3-4 days. When the mean tumor volume reaches 75-125 mm.sup.3
(approximately 19 days past implantation), dosing is initiated. The
mice were given two doses, Q1W, of 40 nmol of AG9. Mice were
monitored for 60 days. At the end of the monitoring period, 50% of
the mice were tumor free. In the other 5 subjects, tumor growth was
delayed. 2/10 mice experienced tumor burden of approximately 300
mm.sup.3 and were euthanized around day 30. One mouse experienced
tumor burden of approximately 1000 mm.sup.3 around day 40. One
mouse experienced tumor burden of approximately 300 mm.sup.3 and
was euthanized around day 50. One mouse experienced tumor burden of
approximately 1000 mm.sup.3 and was euthanized around day 50. In
contrast, 8/8 PBS treated mice experience tumor burdens exceeding
1500 mm.sup.3 before Day 20 and were euthanized.
[0491] In summary, these experiments demonstrate the effectiveness
of disclosed ODN constructs such as AG9 to treat various cancers
such as colorectal carcinoma, prostate cancer and lymphoma.
Example 16
B-Cell Assay
[0492] Mouse splenocytes were isolated from C57BL/6 mice, then B
cells were purified using a MACS magnetic bead cell separation
column, following manufacturer's protocol. 1.times.106 B cells were
stimulated with the indicated concentration of oligonucleotide at
37.degree. C. for 48 h. Cells were then stained with antibodies
specific for activation markers, such as CD40 for 30 min, then
washed thrice with FACS Buffer (PBS+3% FBS). Cells were then
analyzed by flow cytometry following standard methods. Surface
intensity of the markers were quantified by mean fluorescence
intensity. Results of this assay are presented in FIG. 18. We
compared AG9 and its parent AG1, and AG18, a tocopherol conjugated
via indirect linker to AG17, and its parent AG17. Mouse B cells
were responsive to all agonists tested, and CD40 upregulation was
observed upon stimulation by the agonists in a dose dependent
manner. Notably, at 0.016 .mu.M the tocopherol conjugated ODN AG9
and AG18 were more potent than their respective non-conjugated
parents, AG1 and AG17. This experiment demonstrated that B cells
could be directly stimulated by the tocopherol-conjugated ODNs, and
that tocopherol-conjugation potentiated the agonistic activity.
Example 17
Conjugation of TLR Agonists to Tocopherol Via Cleavable Linkers
Facilitates In Vivo Biodistribution to Specific Regions within
Secondary Lymphoid Organs
[0493] To determine if tocopherol conjugation would affect the in
vivo biodistribution properties of the CpG ODN, mice were injected
with AG21 (which is an analog of AG9 conjugated to AlexaFluor-647)
or AG20 (which is an analog of AG1 conjugated to AlexaFluor 647)
either subcutaneously or intravenously. 24 h post injection
spleens, draining lymph nodes, livers, kidneys and lungs were
excised and imaged using the IVIS imager. As shown in FIG. 21A,
when AG21 was injected subcutaneously, it localized to the draining
lymph node as compared to AG20. When quantified, there was more
than 2-fold difference between AG21 localization than AG20. In FIG.
21B, spleens were quantified 24 h post IV injection of either
compounds. After IV administration, tocopherol affected
biodistribution of the compound and using IVIS the majority of AG21
but not AG20 was visualized in the spleen, liver and to a lesser
extent, kidney (data not shown). In the spleen, there was nearly a
10-fold increase in the amount of AG21 localization compared to
AG20. After either subcutaneous or intravenous administration AG21
localized to secondary lymphoid organs such as the draining lymph
nodes or spleen, where it is positioned to activate immune cells.
These experiments demonstrate that tocopherol conjugation
dramatically affects its biodistribution.
[0494] To visualize distribution of AG21 within the secondary
lymphoid organs, we repeated the experiment, paraffin embedded the
lymph nodes and spleen, sectioned them, and visualized ODN
localization by immunofluorescence. The tissues were stain with
antibodies directed against T cells or B cells. After subcutaneous
injection we observed intense AG21 staining within the B cell
follicular region of the lymph node (data not shown). Interestingly
after intravenous injection, we observed intense AG21 staining
within extrafollicular regions. In AG1 treated mice, we observed
weak but detectable ODN staining. These results reaffirm that
tocopherol conjugation to the CpG ODN effectively localizes the ODN
in the secondary lymphoid organs, and more specifically to isolated
regions within the microenvironment.
[0495] In order to characterize the cell types that bound to AG21
in the spleen following intravenous injection, we harvested
spleens, dissociated them, then stained with fluorescently labeled
antibodies directed at specific cell markers in order to
differentiate them. Using flow cytometry, we observed that
Dendritic Cells and Macrophages, and to lesser extent, B cells were
all positive for AG21 (data not shown). T cells were negative for
AG21. Thus the cells that were positive for AG21 coincided with
cells that express TLR9. This experiment demonstrated that
administration of the tocopherol conjugated CpG ODN, the conjugate
preferentially directed localization to the secondary lymphoid
organs, and within those organs, the conjugate was preferentially
taken up by the desired cells, i.e., Dendritic cells, macrophages
and B cells.
Example 18
Conjugation of TLR Agonists to Lipophilic Moieties Via Cleavable
Linkers Facilitates Binding to Serum Proteins Such as Albumin
[0496] It was interesting to observe a skewed distribution pattern
of AG21 to some organs such as the liver and spleen, but not to
others, such as kidney and lung, both of which are vascularized. We
hypothesized that tocopherol could facilitate binding to serum
proteins, and based on the distribution of scavenger receptors,
that would determine the preferential localization of the
tocopherol conjugated CpG ODN. We tested this possibility in vitro.
FITC conjugated analogs of AG1 and AG9 were generated. AG22 is an
analog of AG1 with FITC conjugated at the 3' end. Similarly, AG23
is an analog of the tocopherol conjugate AG9 with FITC conjugated
at the 3' end. The compounds were loaded onto an HPLC, then
fluorescence from FITC was monitored (FIG. 22A). The compounds were
either alone or premixed with BSA. We observed that the tocopherol
conjugated AG23, but not AG22, had a retention time identical with
BSA when present. This experiment demonstrated that tocopherol
could facilitate binding of the CpG ODN to serum proteins such as
BSA. This complex could explain in part the preferential
distribution of the tocopherol-conjugated CpG ODN to secondary
lymphoid organs and the liver.
[0497] We next wondered if the ability to bind to serum proteins
was a unique feature of tocopherol conjugation. We synthesized an
analog of the palmitoylated compound AG19. AG24 is a CpG ODN that
is conjugated to palmitoyl via a cleavable linker on the 5' end,
and conjugated to FITC on the 3' end. We repeated the above
experiment by mixing AG24 or AG22 to fetal bovine serum (FBS) then
analyzing the mixture by HPLC and monitored the retention time of
the ODN by its fluorescent signal. As shown in FIG. 22B, the
retention time of AG24 but not AG22 was identical to FBS. This
demonstrated that conjugating the CpG ODN to palmitoyl facilitated
the interaction of the ODN to serum proteins.
Example 19
Conjugation of TLR Agonists to Tocopherol Via Cleavable Linkers
Facilitates Self-Formulation into Micelle Structures
[0498] Because of the lipophilic nature of tocopherol, we also
tested the ability of tocopherol conjugation to facilitate micelle
formation of the CpG ODN. By monitoring AG23 on the HPLC using the
FITC fluorescent signal, we found that in the presence of high
concentrations (2 or 4 M) of urea which disrupt micelle formation,
the retention time of AG23 altered, whereas the retention time of
AG22 was not affected (FIG. 23). These results demonstrated that
the tocopherol conjugation of the CpG ODN imparted the property of
micelle formation to the ODN.
[0499] While the present disclosure has been described in detail,
and with reference to specific embodiments thereof, it will be
apparent to one of ordinary skill in the art that various changes
and modifications can be made therein without departing from the
spirit and scope of the present disclosure.
Sequence CWU 1
1
56124DNAArtificial Sequencesynthetic oligonucleotide 1tcgtcgtttt
gtcgttttgt cgtt 24220DNAArtificial Sequencesynthetic
oligonucleotide 2gggggacgat cgtcgggggg 20320DNAArtificial
Sequencesynthetic oligonucleotide 3ggggtcaacg ttgagggggg
20420DNAArtificial Sequencesynthetic oligonucleotide 4tccatgacgt
tcctgacgtt 20522DNAArtificial Sequencesynthetic oligonucleotide
5tcgtcgtttt cggcgcgcgc cg 22624DNAArtificial Sequencesynthetic
oligonucleotide 6tcgtcgttac gtaacgacga cgtt 24723DNAArtificial
Sequencesynthetic oligonucleotide 7tcgtcgtttt gtcgttttgt cgt
23824DNAArtificial Sequencesynthetic oligonucleotide 8tcgtcgtttt
gtcgttttgt cgtt 24924DNAArtificial Sequencesynthetic
oligonucleotide 9tcgtcgtttt gtcgttttgt cgtt 241024DNAArtificial
Sequencesynthetic oligonucleotide 10tcgtcgtttt gtcgttttgt cgtt
241124DNAArtificial Sequencesynthetic oligonucleotide 11tcgtcgtttt
gtcgttttgt cgtt 241224DNAArtificial Sequencesynthetic
oligonucleotide 12tcgtcgtttt gtcgttttgt cgtt 241324DNAArtificial
Sequencesynthetic oligonucleotide 13tcgtcgtttt gtcgttttgt cgtt
241424DNAArtificial Sequencesynthetic oligonucleotide 14tcgtcgtttt
gtcgttttgt cgtt 241524DNAArtificial Sequencesynthetic
oligonucleotide 15tcgtcgttac gtaacgacga cgtt 241624DNAArtificial
Sequencesynthetic oligonucleotide 16tcgtcgttac gtaacgacga cgtt
241724DNAArtificial Sequencesynthetic oligonucleotide 17tcgtcgttac
gtaacgacga cgtt 241824DNAArtificial Sequencesynthetic
oligonucleotide 18tcgtcgttac gtaacgacga cgtt 241924DNAArtificial
Sequencesynthetic oligonucleotide 19tcgtcgttac gtaacgacga cgtt
242020DNAArtificial Sequencesynthetic oligonucleotide 20gggggacgat
cgtcgggggg 202120DNAArtificial Sequencesynthetic oligonucleotide
21ggggtcaacg ttgagggggg 202220DNAArtificial Sequencesynthetic
oligonucleotide 22tccatgacgt tcctgacgtt 202322DNAArtificial
Sequencesynthetic oligonucleotide 23tcgtcgtttt cggcgcgcgc cg
222423DNAArtificial Sequencesynthetic oligonucleotide 24tcgtcgtttt
gtcgttttgt cgt 232523DNAArtificial Sequencesynthetic
oligonucleotide 25tcgtcgtttt gtcgttttgt cgt 232623DNAArtificial
Sequencesynthetic oligonucleotide 26tcgtcgtttt gtcgttttgt cgt
232724DNAArtificial Sequencesynthetic oligonucleotide 27tcgtcgtttt
gtcgttttgt cgtt 242824DNAArtificial Sequencesynthetic
oligonucleotide 28tcgtcgtttt gtcgttttgt cgtt 242924DNAArtificial
Sequencesynthetic oligonucleotide 29tcgtcgtttt gtcgttttgt cgtt
243024DNAArtificial Sequencesynthetic oligonucleotide 30tcgtcgtttt
gtcgttttgt cgtt 243124DNAArtificial Sequencesynthetic
oligonucleotide 31tcgtcgtttt gtcgttttgt cgtt 243224DNAArtificial
Sequencesynthetic oligonucleotide 32tcgtcgtttt gtcgttttgt cgtt
243324DNAArtificial Sequencesynthetic oligonucleotide 33tcgtcgtttt
gtcgttttgt cgtt 243424DNAArtificial Sequencesynthetic
oligonucleotide 34tcgtcgtttt gtcgttttgt cgtt 243524DNAArtificial
Sequencesynthetic oligonucleotide 35tcgtcgtttt gtcgttttgt cgtt
243624DNAArtificial Sequencesynthetic oligonucleotide 36tcgtcgtttt
gtcgttttgt cgtt 243724DNAArtificial Sequencesynthetic
oligonucleotide 37tcgtcgtttt gtcgttttgt cgtt 243824DNAArtificial
Sequencesynthetic oligonucleotide 38tcgtcgtttt gtcgttttgt cgtt
243924DNAArtificial Sequencesynthetic oligonucleotide 39tcgtcgtttt
gtcgttttgt cgtt 244024DNAArtificial Sequencesynthetic
oligonucleotide 40tcgtcgtttt gtcgttttgt cgtt 244124DNAArtificial
Sequencesynthetic oligonucleotide 41tcgtcgtttt gtcgttttgt cgtt
244224DNAArtificial Sequencesynthetic oligonucleotide 42tcgtcgtttt
gtcgttttgt cgtt 244324DNAArtificial Sequencesynthetic
oligonucleotide 43tcgtcgtttt gtcgttttgt cgtt 244424DNAArtificial
Sequencesynthetic oligonucleotide 44tcgtcgtttt gtcgttttgt cgtt
244524DNAArtificial Sequencesynthetic oligonucleotide 45tcgtcgtttt
gtcgttttgt cgtt 244624DNAArtificial Sequencesynthetic
oligonucleotide 46tcgtcgtttt gtcgttttgt cgtt 244724DNAArtificial
Sequencesynthetic oligonucleotide 47tcgtcgtttt gtcgttttgt cgtt
244824DNAArtificial Sequencesynthetic oligonucleotide 48tcgtcgtttt
gtcgttttgt cgtt 244924DNAArtificial Sequencesynthetic
oligonucleotide 49tcgtcgtttt gtcgttttgt cgtt 245024DNAArtificial
Sequencesynthetic oligonucleotide 50tcgtcgtttt gtcgttttgt cgtt
245124DNAArtificial Sequencesynthetic oligonucleotide 51tcgtcgtttt
gtcgttttgt cgtt 245224DNAArtificial Sequencesynthetic
oligonucleotide 52tcgtcgtttt gtcgttttgt cgtt 245320DNAArtificial
Sequencesynthetic oligonucleotide 53ggggtcaacg ttgagggggg
205420DNAArtificial Sequencesynthetic oligonucleotide 54tccatgacgt
tcctgacgtt 205520DNAArtificial Sequencesynthetic oligonucleotide
55tccatgacgt tcctgacgtt 205624DNAArtificial Sequencesynthetic
oligonucleotide 56tcgtcgtttt gtcgttttgt cgtt 24
* * * * *