U.S. patent application number 16/980389 was filed with the patent office on 2021-04-01 for modified oligonucleotides for use in treatment of tauopathies.
The applicant listed for this patent is Janssen Pharmaceutica NV. Invention is credited to Leonid BEIGELMAN, Andreas EBNETH, Sergei GRYAZNOV, Sa l MARTINEZ MONTERO, Vivek Kumar RAJWANSHI, Constantin VAN OUTRYVE D'YDEWALLE.
Application Number | 20210095284 16/980389 |
Document ID | / |
Family ID | 1000005286605 |
Filed Date | 2021-04-01 |
![](/patent/app/20210095284/US20210095284A1-20210401-C00001.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00002.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00003.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00004.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00005.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00006.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00007.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00008.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00009.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00010.png)
![](/patent/app/20210095284/US20210095284A1-20210401-C00011.png)
View All Diagrams
United States Patent
Application |
20210095284 |
Kind Code |
A1 |
EBNETH; Andreas ; et
al. |
April 1, 2021 |
MODIFIED OLIGONUCLEOTIDES FOR USE IN TREATMENT OF TAUOPATHIES
Abstract
Oligonucleotides comprising modifications at the 2 and/or 3'
positions(s) along with methods of making and use against Alzheimer
disease and other tauopathies are disclosed.
Inventors: |
EBNETH; Andreas; (Turnhout,
BE) ; VAN OUTRYVE D'YDEWALLE; Constantin; (Herent,
BE) ; GRYAZNOV; Sergei; (San Mateo, CA) ;
MARTINEZ MONTERO; Sa l; (San Bruno, CA) ; BEIGELMAN;
Leonid; (San Mateo, CA) ; RAJWANSHI; Vivek Kumar;
(Cupertino, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Janssen Pharmaceutica NV |
Beerse |
|
BE |
|
|
Family ID: |
1000005286605 |
Appl. No.: |
16/980389 |
Filed: |
March 13, 2019 |
PCT Filed: |
March 13, 2019 |
PCT NO: |
PCT/EP2019/056312 |
371 Date: |
September 12, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62642499 |
Mar 13, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/321 20130101;
C12N 2310/346 20130101; A61P 25/28 20180101; C12N 2310/315
20130101; C12N 2320/50 20130101; C12N 2310/3341 20130101; C12N
15/113 20130101; C12N 2310/11 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61P 25/28 20060101 A61P025/28 |
Claims
1-38. (canceled)
39. A chimeric oligonucleotide complimentary to at least a portion
of the MAPT gene represented by Formula (VI): 5' X-Y-Z 3' (VI),
wherein X-Y-Z is a chimeric oligonucleotide comprising a sequence
of 18 to 22 nucleosides, and is optionally conjugated at the 5'
and/or 3' end to a ligand targeting group; X is a domain comprising
a sequence of modified nucleosides that is 3-10 nucleosides in
length; Z is a domain comprising a sequence of modified nucleosides
that is 3-10 nucleosides in length; and Y is a domain comprising a
sequence of 2 to 10 2'-deoxy-nucleosides linked through
thiophosphate intersubunit linkages, and wherein the
oligonucleotide shows affinity to at least one of SEQ ID NO: 3, SEQ
ID NO: 4, SEQ ID NO:5 or SEQ ID NO: 6.
40. The chimeric oligonucleotide of claim 39, wherein the Y domain
is 6 to 10 nucleosides in length.
41. The chimeric oligonucleotide of claim 39, wherein the X and/or
Z domains comprise a sequence of modified nucleosides linked
through N3'.fwdarw.P5' phosphoramidate or N3'.fwdarw.P5'
thiophosphoramidate intersubunit linkages.
42. The chimeric oligonucleotide of claim 39, wherein the Y domain
comprises at least one phosphodiester intersubunit linkage.
43. The chimeric oligonucleotide of claim 39, wherein the Y domain
consists of 2'-deoxy-nucleosides linked through thiophosphate
intersubunit linkages, and optionally one or two phosphodiester
intersubunit linkage.
44. The chimeric oligonucleotide of claim 39, wherein the X domain
comprises modified nucleosides where the modification is
independently selected from the group consisting of 2'-F,
2'-F-N3'.fwdarw.P5', 2'-OMe, 2'-OMe-N3'.fwdarw.P5',
2'-O-methoxyethoxy, 2'-O-methoxyethoxy-N3'.fwdarw.P5',
conformationally restricted nucleosides,
2'-OH-N3'.fwdarw.P5'thiophosphoramidate and 2'-OH-N3'.fwdarw.P5'
phosphoramidate.
45. The chimeric oligonucleotide of claim 39, wherein the
functional domain of Z comprises modified nucleosides where the
modification is selected from the group consisting of 2'-F,
2'-F-N3'.fwdarw.P5', 2'-OMe, 2'-OMe-N3'.fwdarw.P5',
2'-O-methoxyethoxy, 2'-O-methoxyethoxy-N3'.fwdarw.P5',
conformationally restricted nucleosides, 2'-OH-N3'.fwdarw.P5'
thiophosphoramidate and 2'-OH-N3'.fwdarw.P5' phosphoramidate.
46. The chimeric oligonucleotide of claim 39, wherein the X and/or
Z domains comprise one or more 2'-deoxy-nucleosides linked through
a N3'.fwdarw.P5' phosphoramidate intersubunit linkage.
47. The chimeric oligonucleotide of claim 39, wherein the X and Z
domains comprise one or more 2'-arabino-F and/or 2'-ribo-F modified
nucleoside, wherein each said nucleoside is independently linked
through at least one of an N3'.fwdarw.P5' phosphoramidate or
N3'.fwdarw.P5' thiophosphoramidate intersubunit linkage.
48. The chimeric oligonucleotide of claim 39, wherein the X and Z
domains comprise one or more 2'-OMe modified nucleosides, wherein
each said nucleoside is independently linked through at least one
of N3'.fwdarw.P5' phosphoramidate, N3'.fwdarw.P5'
thiophosphoramidate, or thiophosphate intersubunit linkages.
49. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides in each of the X and Z domains are 2'-OMe modified
nucleosides linked through thiophosphate intersubunit linkages, and
wherein the modified nucleosides include 5-methylcytosine
nucleobases, but optionally not cytosine.
50. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides include 2,6-diaminopurine nucleobases, but optionally
not adenine.
51. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides include 5-methyluracil nucleobases, but optionally not
uracil.
52. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides include 2,6-diaminopurine nucleobases, but not adenine
and 5-methyluracil nucleobases, but optionally not uracil.
53. The chimeric oligonucleotide of claim 39, wherein the Y domain
comprises 6-8 2'-deoxy-nucleosides.
54. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides in each of the X and Z domains comprise 2'-OMe modified
nucleosides and conformationally restricted nucleosides optionally
linked through thiophosphate intersubunit linkages, and wherein the
2'-OMe modified nucleosides include 5-methylcytosine nucleobases,
but optionally not cytosine.
55. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides in each of the X and Z domains comprise 2'-OMe and
conformationally restricted nucleosides.
56. The chimeric oligonucleotide of claim 39, wherein the modified
nucleosides in each of the X and Z domains comprise
conformationally restricted nucleosides and, wherein at least one
modified nucleoside includes a N3'.fwdarw.P5' phosphoramidate or a
N3'.fwdarw.P5' thiophosphoramidate intersubunit linkage.
57. The chimeric oligonucleotide of claim 39, wherein the Y domain
comprises 7-8 2'-deoxy-nucleosides.
58. The chimeric oligonucleotide of claim 39, wherein the 2'-OMe
modified nucleosides include 5-methyluracil nucleobases, but
optionally not uracil.
59. The chimeric oligonucleotide of claim 39, wherein the Y domain
comprises 9-10 2'-deoxy-nucleosides.
60. The chimeric oligonucleotide of claim 39, wherein the X and Z
domains comprise nucleotides represented by the Formula (A1):
##STR00076## wherein A is independently in each instance NH or O; B
is independently in each instance an unmodified or modified
nucleobase; W is independently in each instance OR or SR, where R
is H or a positively charged counter ion; R' and R'' are each
independently in each instance selected from the group consisting
of H, F, Cl, OH, OMe, Me, and O-methoxyethoxy; R''' is H, or R' and
R''' together form --O--CH.sub.2-- or --O--(CH.sub.2).sub.2--, and
a is an integer of 3 to 9, wherein when R', R'' and R''' are each
H, then A is NH, and optionally when A is O, then W is SR.
61. The chimeric oligonucleotide of claim 39, wherein the X and/or
Z domain comprises one or more oligonucleotide where the
modification is 2'-O-methoxyethoxy-N3'.fwdarw.P5'.
62. The chimeric oligonucleotide of claim 39, wherein the X domain
comprises one or more oligonucleotide where the modification is
2'-O-methoxyethoxy-N3'.fwdarw.P5'.
63. The chimeric oligonucleotide of claim 39, wherein the Z domain
comprises one or more oligonucleotide where the modification is
2'-O-methoxyethoxy-N3'.fwdarw.P5'.
64. The chimeric oligonucleotide of claim 39, wherein the
nucleobase sequence of the oligonucleotide corresponds to SEQ ID
NO: 1, SEQ ID NO: 40, SEQ ID NO: 41 or SEQ ID NO: 42.
65-88. (canceled)
89. A pharmaceutical composition comprising an oligonucleotide of
claim 39 and a pharmaceutically acceptable excipient.
90. The pharmaceutical composition of claim 0, wherein the
composition is suitable for intrathecal or intracerebroventricular
delivery.
91. A method of inhibiting MAPT gene expression in a CNS cell
comprising contacting the cell with an oligonucleotide of claim
39.
92. A method of inhibiting transcription of MAPT mRNA in a CNS cell
comprising contacting the cell with an oligonucleotide of claim
39.
93. (canceled)
94. (canceled)
95. The oligonucleotide of claim 39, wherein said oligonucleotide
complexed with an MAPT gene has a melting temperature (Tm) of
>37.degree. C.
96. (canceled)
97. (canceled)
98. A method of inhibiting expression of a MAPT mRNA in a CNS cell
comprising contacting the cell with an oligonucleotide or
composition comprising an oligonucleotide of claim 39, wherein the
oligonucleotide contains a nucleobase sequence that is
complementary or hybridizes to at least a portion of the MAPT
mRNA.
99. (canceled)
100. (canceled)
101. A method of modulating expression of a MAPT gene by contacting
a target nucleic acid with an antisense compound comprising an
oligonucleotide of claim 39, wherein the oligonucleotide contains a
nucleobase sequence that is complementary or hybridizes to at least
a portion of the MAPT gene.
102. (canceled)
Description
BACKGROUND
[0001] Antisense oligonucleotide therapies have been considered for
treatment or prevention of various diseases and conditions such as
viral diseases, neurological diseases, neurodegenerative diseases,
fibrotic diseases and hyperproliferative diseases.
[0002] Neurodegenerative diseases associated with the pathological
aggregation of tau protein in neurofibrillary or gliofibrillary
tangles in the human brain are known as tauopathies. Tangles are
composed of hyperphosphorylated microtubule-associated protein tau,
aggregated in an insoluble form. Neurofibrillary tangles (NFT) may
lead to neuronal death and therefore be a primary causative factor
in tauopathies, including Alzheimer's disease.
[0003] Alzheimer's disease (AD) is a chronic neurodegenerative
brain disorder and accounts for 50-70% of all cases of dementia.
Approximately 47 million people worldwide live with dementia and
the number is expected to rise to 131 million by 2050. Only
symptomatic treatments are available illustrating the necessity to
find disease-modifying therapies which slow or even halt disease
progression.
[0004] Pathologically, AD is characterized by the abnormal
accumulation of extracellular amyloid p plaques and the
intracellular formation of NFTs consisting of hyperphosphorylated
tau proteins. tau is a microtubule-associated protein (MAP) encoded
by the MAPT gene. The location and intensity of NFT accumulation
strongly correlate with cognitive decline in AD, and mutations in
the MAPT gene cause frontotemporal dementia with Parkinsonism
(FTD). These facts support the development of tau-based therapies.
Reducing aggregation, removing intracellular aggregates, stopping
spreading, increasing intracellular clearance and altering
post-translational modifications are some therapeutic strategies
aiming to reduce tau pathology.
[0005] Antisense oligonucleotides (ASOs) are small single-stranded
nucleic acid molecules that bind to their RNA targets through
classical Watson-Crick basepairing resulting in an ASO:RNA duplex.
Depending on the chemical modifications of the phosphate-sugar
backbone, the formed ASO:RNA duplex can recruit RNase-H that will
cleave the RNA strand of the duplex leaving the ASO intact. The
cleaved RNA is then further degraded resulting in reduced mRNA and
protein expression levels of the target gene. The chemical
modifications of the ASO backbone can also change the binding
affinity, resistance to nuclease activity and binding capacity to
(serum) proteins.
[0006] Accordingly, there is a need in the art to discover and
develop new therapies with different mechanisms of action,
increased potency, increased affinity and/or decreased
side-effects.
SUMMARY
[0007] The present disclosure relates to compounds and compositions
containing oligonucleotides and their use in preventing or treating
diseases and conditions, e.g., tauopathies such as Alzheimer's
disease.
[0008] Some embodiments include an oligonucleotide comprising a
sequence complementary to at least a portion of the MAPT gene
sequence where one or more nucleotides of the oligonucleotide are
nucleotides of Formula (I):
##STR00001##
wherein R is H or a positively charged counter ion, B is a
nucleobase, R.sub.1 is --(CR'.sub.2).sub.2OCR'.sub.3, and R' is
independently in each instance H or F. In some embodiments, each
nucleotide of said oligonucleotide is a nucleotide of Formula (I).
In some embodiments, the oligonucleotide comprises 2 to 40
nucleotides. In some embodiments, the oligonucleotide comprises
2-26 nucleotides of Formula (I). In some embodiments, the
oligonucleotide comprises 5-10 nucleotides of Formula (I). In some
embodiments, B is an unmodified nucleobase in at least one
nucleotide of Formula (I). In some embodiments, B is a modified
nucleobase in at least one nucleotide of Formula (I). In some
embodiments, B is an unmodified nucleobase in each nucleotide of
Formula (I). In some embodiments, B is a modified nucleobase in
each nucleotide of Formula (I). In some embodiments, each R' is H
in at least one nucleotide of Formula (I). In some embodiments,
each R' is H in each nucleotide of Formula (I). In some
embodiments, R.sub.1 is --(CH.sub.2).sub.2OCH.sub.3 in at least one
nucleotide of Formula (I). In some embodiments, R.sub.1 is
--(CH.sub.2).sub.2OCH.sub.3 in each nucleotide of Formula (I).
[0009] In some embodiments, the oligonucleotide comprises one or
more nucleotides of Formula (II):
##STR00002##
wherein Y is S or O, R is H or a positively charged counter ion, B
is a nucleobase, R.sub.2 is --CR'.sub.3, --CR'.sub.2OCR'.sub.3,
--(CR'.sub.2).sub.3OCR'.sub.3 or --(CR'.sub.2).sub.1-2CR'.sub.3, or
R.sub.2 is --(CR'.sub.2).sub.2OCR'.sub.3 and Y is O, and R' is
independently in each instance H or F. In some embodiments, the
oligonucleotide comprises at least one nucleotide of Formula (II),
where R.sub.2 is --CR'.sub.3. In some embodiments, the
oligonucleotide comprises at least one nucleotide of Formula (II),
where R.sub.2 is --(CR'.sub.2).sub.1-2OCR'.sub.3. In some
embodiments, the oligonucleotide comprises at least one nucleotide
of Formula (II), where R.sub.2 is --(CR'.sub.2).sub.1-2CR'.sub.3.
In some embodiments, B is a modified nucleobase in at least one
nucleotide of Formula (II). In some embodiments, Y is S in at least
one nucleotide of Formula (II). In some embodiments, Y is O in at
least one nucleotide of Formula (II). In some embodiments, Y is S
in each nucleotide of Formula (II). In some embodiments, Y is O in
each nucleotide of Formula (II).
[0010] In some embodiments, the oligonucleotide further comprises
one or more nucleotides of Formula (IIIa) or Formula (IIIb):
##STR00003##
wherein Y is S or O, R is H or a positively charged counter ion,
and B is a nucleobase.
[0011] In some embodiments, the oligonucleotide further comprises
one or more nucleotides of Formula (V'):
##STR00004##
wherein Y is S or O, R is H or a positively charged counter ion, B
is independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, A is --(CR''R'').sub.1-2 and
R'' is independently in each instance H, F or Me.
[0012] In some embodiments, the oligonucleotide is arranged in a
construct of Formula (VI): 5'X-Y-Z 3' (VI), wherein each of X, Y
and Z is a domain comprising 2-14 nucleotides, at least one of the
X and Z domains comprising at least one nucleotide of Formula (I),
and wherein each of the nucleotides of the Y domain is a
2'-deoxynucleotide. In some embodiments, the oligonucleotide
comprises 18 to 22 nucleosides. In some embodiments, the X and Z
domains each comprise 5-10 nucleotides. In some embodiments, the Y
domain comprises 5-10 nucleotides. In some embodiments, the X and Z
domains each comprise 5-10 nucleotides, and the Y domain comprises
5-10 nucleotides. In some embodiments, the X and Z domains each
comprise 5 nucleotides, and the Y domain comprises 10 nucleotides.
In some embodiments, each nucleotide of the X and Z domains is a
nucleotide of Formula (I). In some embodiments, at least one
nucleotide of the X domain and at least one nucleotide of the Z
domain are each independently selected from the group consisting of
a nucleotide of Formula (II), a nucleotide of Formula (IIIa), and a
nucleotide of Formula (IIIb). In some embodiments, each of the at
least one nucleotide of the X and Z domains are the same
nucleotide. In some embodiments, each nucleotide of the Y domain is
linked through thiophosphate intersubunit linkages. In some
embodiments, the oligonucleotide is single stranded. In some
embodiments, the oligonucleotide is an antisense
oligonucleotide.
[0013] In embodiments, the oligonucleotide is complementary to at
least a portion of exon 5 of the human MAPT gene.
[0014] Other embodiments include a chimeric oligonucleotide
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotide are nucleotides of Formula (VI):
5'-X-Y-Z-3' (VI),
wherein X-Y-Z is a chimeric oligonucleotide comprising a sequence
of 18 to 22 nucleosides, and is optionally conjugated at the 5'
and/or 3' end to a ligand targeting group; X is a domain comprising
a sequence of modified nucleosides that is 3-10 nucleosides in
length; Z is a domain comprising a sequence of modified nucleosides
that is 3-10 nucleosides in length; and Y is a domain comprising a
sequence of 2 to 14 2'-deoxy-nucleosides linked through
thiophosphate intersubunit linkages. In some embodiments, the Y
domain is 6 to 10 nucleosides in length. In some embodiments, X
and/or Z domains comprise a sequence of modified nucleosides linked
through N3'.fwdarw.P5' phosphoramidate or N3'.fwdarw.P5'
thiophosphoramidate intersubunit linkages. In some embodiments, the
Y domain comprises at least one phosphodiester intersubunit
linkage. In some embodiments, the Y domain consists of
2'-deoxy-nucleosides linked through thiophosphate intersubunit
linkages, and optionally one or two phosphodiester intersubunit
linkage. In some embodiments, the X domain comprises modified
nucleosides where the modification is independently selected from
the group consisting of 2'-F, 2'-F-N3'.fwdarw.P5', 2'-OMe,
2'-OMe-N3'.fwdarw.P5', 2'-O-methoxyethoxy,
2'-O-methoxyethoxy-N3'.fwdarw.P5', conformationally restricted
nucleosides, 2'-OH-N3'.fwdarw.P5'thiophosphoramidate and
2'-OH-N3'.fwdarw.P5' phosphoramidate. In some embodiments, the
functional domain of Z comprises modified nucleosides where the
modification is selected from the group consisting of 2'-F,
2'-F-N3'.fwdarw.P5', 2'-OMe, 2'-OMe-N3'.fwdarw.P5',
2'-O-methoxyethoxy, 2'-O-methoxyethoxy-N3'.fwdarw.P5',
conformationally restricted nucleosides, 2'-OH-N3'.fwdarw.P5'
thiophosphoramidate and 2'-OH-N3'.fwdarw.P5' phosphoramidate. In
some embodiments, the X and/or Z domains comprise one or more
2'-deoxy-nucleosides linked through a N3'.fwdarw.P5'
phosphoramidate intersubunit linkage. In some embodiments, the X
and Z domains comprise one or more 2'-arabino-F and/or 2'-ribo-F
modified nucleoside, wherein each said nucleoside is independently
linked through at least one of an N3'.fwdarw.P5' phosphoramidate or
N3'.fwdarw.P5' thiophosphoramidate intersubunit linkage. In some
embodiments, the X and Z domains comprise one or more 2'-OMe
modified nucleosides, wherein each said nucleoside is independently
linked through at least one of N3'.fwdarw.P5' phosphoramidate,
N3'.fwdarw.P5' thiophosphoramidate, or thiophosphate intersubunit
linkages. In some embodiments, the modified nucleosides in each of
the X and Z domains are 2'-OMe modified nucleosides linked through
thiophosphate intersubunit linkages, and wherein the modified
nucleosides include 5-methylcytosine nucleobases, but optionally
not cytosine. In some embodiments, the modified nucleosides include
2,6-diaminopurine nucleobases, but optionally not adenine. In some
embodiments, the modified nucleosides include 5-methyluracil
nucleobases, but optionally not uracil. In some embodiments, the
modified nucleosides include 2,6-diaminopurine nucleobases, but not
adenine and 5-methyluracil nucleobases, but optionally not uracil.
In some embodiments, the Y domain comprises 6-8
2'-deoxy-nucleosides. In some embodiments, the modified nucleosides
in each of the X and Z domains comprise 2'-OMe modified nucleosides
and conformationally restricted nucleosides optionally linked
through thiophosphate intersubunit linkages, and wherein the 2'-OMe
modified nucleosides include 5-methylcytosine nucleobases, but
optionally not cytosine. In some embodiments, the modified
nucleosides in each of the X and Z domains comprise 2'-OMe and
conformationally restricted nucleosides. In some embodiments, the
modified nucleosides in each of the X and Z domains comprise
conformationally restricted nucleosides and, wherein at least one
modified nucleoside includes a N3'.fwdarw.P5' phosphoramidate or a
N3'.fwdarw.P5'thiophosphoramidate intersubunit linkage. In some
embodiments, the Y domain comprises 7-8 2'-deoxy-nucleosides. In
some embodiments, the 2'-OMe modified nucleosides include
5-methyluracil nucleobases, but optionally not uracil. In some
embodiments, the Y domain comprises 9-10 2'-deoxy-nucleosides.
[0015] In some embodiments, the X and Z domains comprise
nucleotides represented by the Formula (A1):
##STR00005##
wherein A is independently in each instance NH or O; B is
independently in each instance an unmodified or modified
nucleobase; W is independently in each instance OR or SR, where R
is H or a positively charged counter ion; R' and R'' are each
independently in each instance selected from the group consisting
of H, F, Cl, OH, OMe, Me, and O-methoxyethoxy; R''' is H, or R' and
R''' together form --O--CH.sub.2-- or --O--(CH.sub.2).sub.2--, and
a is an integer of 3 to 9, wherein when R', R'' and R''' are each
H, then A is NH, and optionally when A is O, then W is SR.
[0016] In some embodiments, the ligand targeting group is selected
from the group consisting of tocopherols, palmitic acid and lipoic
acid and combinations thereof.
[0017] In some embodiments, the X and/or Z domain comprises one or
more oligonucleotide where the modification is
2'-O-methoxyethoxy-N3'.fwdarw.P5'. In some embodiments, the X
domain comprises one or more oligonucleotide where the modification
is 2'-O-methoxyethoxy-N3'.fwdarw.P5'. In some embodiments, the Z
domain comprises one or more oligonucleotide where the modification
is 2'-O-methoxyethoxy-N3'.fwdarw.P5'. In some embodiments, the
construct of said oligonucleotide corresponds to a construct of
Table B.
[0018] Other embodiments include a chimeric oligonucleotide
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotide are nucleotides of Formula (VII):
5'-X'-Y'-Z'-3' (VII),
wherein X'-Y'-Z' is a chimeric oligonucleotide comprising a
sequence of 16 to 22 nucleosides, and is optionally conjugated at
the 5' and/or 3' end; X' is a domain comprising a sequence of
modified nucleosides that is 3-10 nucleosides in length; Z' is a
domain comprising a sequence of modified nucleosides that is 3-10
nucleosides in length; and Y' is a domain comprising a sequence of
2 to 4 2'-deoxy-nucleosides linked through intersubunit linkages,
wherein the X' and/or Z' domains comprise a sequence of modified
nucleosides linked through N3'.fwdarw.P5' phosphoramidate or
N3'.fwdarw.P5' thiophosphoramidate intersubunit linkages. In some
embodiments, the Y' domain consists of 2'-deoxy-nucleosides linked
through thiophosphate intersubunit linkages, and optionally one
phosphodiester intersubunit linkage. In some embodiments, the X'
domain is 9 or 10 nucleosides in length. In some embodiments, the
X' domain comprises modified nucleosides where the modification is
selected from the group consisting of 2'-F, 2'-F-N3'.fwdarw.P5',
2'-OMe, 2'-OMe-N3'.fwdarw.P5', 2'-O-methoxyethoxy,
2'-O-methoxyethoxy-N3'.fwdarw.P5', and conformationally restricted
nucleosides. In some embodiments, the Z' domain comprises modified
nucleosides where the modification is selected from the group
consisting of 2'-F, 2'-F-N3'.fwdarw.P5', 2'-OH, 2'-OMe,
2'-OMe-N3'.fwdarw.P5', 2'-O-methoxyethoxy,
2'-O-methoxyethoxy-N3'.fwdarw.P5', and conformationally restricted
nucleosides. In some embodiments, the X' and/or Z' domains comprise
one or more 2'-arabino-F and/or 2'-ribo-F modified nucleoside. In
some embodiments, the modified nucleosides in the X' and/or Z'
domains comprise 2'-OMe and conformationally restricted
nucleosides. In some embodiments, the modified nucleosides in the
X' and/or Z' domains comprise conformationally restricted
nucleosides and a N3'.fwdarw.P5' modification. In some embodiments,
the sequence is selected from those in Table B having a 2-4
nucleotide Y domain.
[0019] Other embodiments include a chimeric oligonucleotide
comprising a sequence complementary to at least a portion of the
MAPT gene sequence, wherein the nucleobase sequence of the
oligonucleotide corresponds to a sequence listed in Table D.
[0020] Other embodiments include an oligonucleotide comprising a
sequence complementary to at least a portion of the MAPT gene
sequence where one or more nucleotides of the oligonucleotide are
nucleotides of the following Formula (VIII):
##STR00006##
wherein X.sub.A is NH or O, Y is OR or SR, where R is H or a
positively charged counter ion, B.sub.A is independently in each
instance a natural or an unmodified nucleobase or a modified
nucleobase, R.sub.A' and R.sub.A'' are each independently in each
instance selected from H, F, OH, OMe, Me, O-methoxyethoxy, and
R.sub.A''' is H or R.sub.A' and R.sub.A''' together form
--O--CH.sub.2-- or --O--(CH.sub.2).sub.2--. In some embodiments,
R.sub.A' and R.sub.A''' are H; and R.sub.A'' is F. In some
embodiments, R.sub.A' and R.sub.A'' are H; and R.sub.A''' is F, OH,
H or OMe. In some embodiments, X.sub.A is NH; B.sub.A is an
unmodified or modified nucleobase; R.sub.A' and R.sub.A''' together
form a conformationally restricted nucleoside (e.g.,
--O--CH.sub.2-- or --O--(CH.sub.2).sub.2--); and R.sub.A'' is H. In
some embodiments, at least one of R.sub.A' and R.sub.A'' is H. In
some embodiments, when B.sub.A is a purine nucleobase at least one
of R.sub.A' and R.sub.A'' is OH or F, and/or when B.sub.A is a
pyrimidine nucleobase at least one of R.sub.A' and R.sub.A'' is
OMe, OH or F. In some embodiments, the modified nucleobase is
selected from 5-methylcytosine, 2,6-diaminopurine, 5-methyluracil,
and a g-clamp.
[0021] Other embodiments include an oligonucleotide comprising a
sequence complementary to at least a portion of the MAPT gene
sequence where ten or more nucleotides of the oligonucleotide are
nucleotides of the following Formula (IX):
##STR00007##
wherein R is H or a positively charged counter ion, B.sub.B is
independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, R.sub.B' and R.sub.B'' are
each independently in each instance selected from H, F, OMe, Me,
O-methoxyethoxy, and R.sub.B''' is H or R.sub.B' and R.sub.B'''
together form --O--CH.sub.2-- or --O--(CH.sub.2) 2-. In some
embodiments, R.sub.B' and R.sub.B''' are H; and R.sub.B'' is F. In
some embodiments, R.sub.B' and R.sub.B'' are H; and R.sub.B''' is
F, OH, H or OMe. In some embodiments, B.sub.B is an unmodified or
modified nucleobase; R.sub.B' and R.sub.B''' together form a
conformationally restricted nucleoside (e.g., --O--CH.sub.2-- or
--O--(CH.sub.2).sub.2--); and R.sub.B'' is H. In some embodiments,
at least one of R.sub.B' and R.sub.B'' is H. In some embodiments,
when B.sub.B is a purine nucleobase at least one of R.sub.B' and
R.sub.B'' is OH or F, and/or when B.sub.B is a pyrimidine
nucleobase at least one of R.sub.B' and R.sub.B'' is OMe, OH or F.
In some embodiments, the modified nucleobase is selected from
5-methylcytosine, 2,6-diaminopurine, 5-methyluracil, and a
g-clamp.
[0022] In some embodiments, the nucleotides of Formula (B) include
those in Table A where X.sub.A is NH. In some embodiments, the
nucleotide of Formula (B) are arranged and modified in accordance
with the constructs listed in Table B. In some embodiments, the
construct of Formula (B) includes a sequence 1, 2, 3, 4, or 5
nucleobases different from a sequence selected from those in Table
D. In some embodiments, every oligonucleotide is a nucleotide of
Formula (B).
[0023] In embodiments, the nucleobase sequence of the
oligonucleotide corresponds to SEQ ID NO: 1. In embodiments, the
sequence of SEQ ID NO: 1 is modified according to at least one of
the disclosed modifications. In embodiments, at least the first two
nucleotides from the 5' and 3' ends of the oligonucleotide having a
nucleobase sequence corresponding to SEQ ID NO: 1 are modified to
include a phosphoramidate linkage and further modified to include a
2'-methoxyethoxy (2'MOE) modification. In embodiments, at least the
first three nucleotides from the 5' and 3' ends of the
oligonucleotide having a nucleobase sequence corresponding to SEQ
ID NO: 1 are further modified to include a 2'MOE modification. In
embodiments, at least the first four nucleotides from the 5' and 3'
ends of the oligonucleotide having a nucleobase sequence
corresponding to SEQ ID NO: 1 are further modified to include a
2'MOE modification. In embodiments, at least the first five
nucleotides from the 5' and 3' ends of the oligonucleotide having a
nucleobase sequence corresponding to SEQ ID NO: 1 are further
modified to include a 2'MOE modification. In embodiments, at least
the first six nucleotides from the 5' and 3' ends of the
oligonucleotide having a nucleobase sequence corresponding to SEQ
ID NO: 1 are further modified to include a 2'MOE modification.
[0024] Other embodiments include a pharmaceutical composition
comprising an oligonucleotide of any of the preceding embodiments
and a pharmaceutically acceptable excipient. In some embodiments,
the composition is suitable for intrathecal or
intracerebroventricular delivery. Other embodiments include a
method of inhibiting MAPT gene expression in a central nervous
system (CNS) cell, such as a neuron, astrocyte, oligodendrocyte and
microglia, comprising contacting the cell with an oligonucleotide
or composition of any of the preceding embodiments. Other
embodiments include a method of inhibiting transcription or
translation of MAPT in a CNS cell comprising contacting the cell
with an oligonucleotide or composition of any of the preceding
embodiments. Other embodiments include a method of treating a
subject having tauopathy such as Alzheimer's disease (AD) and/or
any tauopathy-related disorder comprising administering to the
subject a therapeutically effective amount of an oligonucleotide or
composition of any of the preceding embodiments. Other embodiments
include an oligonucleotide of any of the preceding embodiments,
wherein said oligonucleotide complexed with at least a portion of
the MAPT gene sequence has a melting temperature (Tm) of
>37.degree. C. Other embodiments include a method of treating a
subject having tauopathy such as Alzheimer's disease (AD) and/or
any tauopathy-related disorder comprising administering to the
subject a therapeutically effective amount of an oligonucleotide or
composition of any of the preceding embodiments. Other embodiments
include a method of inhibiting expression of a target RNA in a CNS
cell comprising contacting the cell with an oligonucleotide or
composition comprising said oligonucleotide of any of the preceding
embodiments, wherein the chimeric oligonucleotide contains a
nucleobase sequence that is complementary or hybridizes to a
portion of the target RNA. Other embodiments include a method of
inhibiting transcription or translation of the MAPT gene in a CNS
cell comprising contacting the cell with an oligonucleotide or
composition comprising said oligonucleotide of any of the preceding
embodiments, comprising said oligonucleotide contains a nucleobase
sequence that is complementary or hybridizes to at least a portion
of the MAPT gene. Other embodiments include a method of treating a
subject having tauopathy such as Alzheimer's disease (AD) and/or
any tauopathy-related disorder, comprising administering to the
subject a therapeutically effective amount of an oligonucleotide or
composition comprising said oligonucleotide of any of the preceding
embodiments, wherein the oligonucleotide contains a nucleobase
sequence that is complementary or hybridizes to at least a portion
of the MAPT gene. Other embodiments include a method of modulating
expression of a target by contacting a target nucleic acid with an
antisense compound comprising an oligonucleotide or composition
comprising said oligonucleotide of any of the preceding
embodiments, wherein the oligonucleotide contains a nucleobase
sequence that is complementary to, or hybridizes to, a portion of
the target nucleic acid.
DETAILED DESCRIPTION
[0025] The present disclosure is directed to oligonucleotides
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotide are modified nucleotides and two or more
nucleotides contain modified linkages between the nucleotides. The
present disclosure is also directed to constructs of the
oligonucleotides, which include domains, regions or portions within
the oligonucleotide having common features and additional
components conjugated to the oligonucleotide such as targeting
moieties. The present disclosure is further directed to methods of
using and preparing the oligonucleotides and their constructs.
[0026] As known in the art and as set forth in the present
disclosure, a modified nucleotide is any nucleotide that is not a
deoxyribonucleotide. For example, the 2' carbon of the deoxyribose
may be substituted by a substituent other than the hydroxy (OH);
the 3' carbon of the deoxyribose may be substituted by a
substituent other than the oxygen atom (O). As known in the art and
as set forth in the present disclosure, a modified linkage between
two nucleotides is any linkage that is not a phosphodiester bond
between the 3' carbon of the deoxyribose of the first nucleotide
and the 5' carbon of the deoxyribose of the second nucleotide.
1. 2', 3'-Modified Nucleotides and Related Oligonucleotides
[0027] Compounds of the present disclosure include oligonucleotides
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotide are modified nucleotides with particular 2' and 3'
modifications. In embodiments, compounds of the present disclosure
include replacement of the hydroxy, or substitution, at the 2'
carbon of the deoxyribose sugar. In addition, these compounds of
the present disclosure include modifications of the linkage between
two nucleosides, which includes replacement of the oxygen atom, or
substitution, with a nitrogen atom (N) at the 3' carbon of the
deoxyribose sugar. Modifications of the linkage further include
replacement of another oxygen atom, or substitution, in the
phosphodiester bond.
[0028] These modified nucleotides may be used, e.g., in
oligonucleotides such as chimeric oligonucleotides allowing for
enzymatic cleavage of the genetic target by RNase H or modified
antisense oligonucleotides.
2', 3'-Modified Nucleotides
[0029] Accordingly, compounds of the present disclosure include
oligonucleotides comprising a sequence complementary to at least a
portion of the MAPT gene sequence where one or more nucleotides of
the oligonucleotides are nucleotides of Formula (I):
##STR00008##
wherein R is H or a positively charged counter ion, B is
independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, R.sub.1 is
--(CR'.sub.2).sub.2OCR'.sub.3, and R' is independently in each
instance H or F.
[0030] In nucleotides of Formula (I), R.sub.1 is
--(CR'.sub.2).sub.2OCR'.sub.3. In some embodiments, R' is H in each
instance. In other embodiments, at least one R' is F, for example,
1, 2, 3, 4, 5, 6, or 7 R's are F. In some embodiments, CR'.sub.3
contains 1, 2 or 3 F moieties. For example, in embodiments, R.sub.1
is selected from the group consisting of
--CH.sub.2CH.sub.2OCH.sub.3 (or MOE), --CF.sub.2CH.sub.2OCH.sub.3,
--CH.sub.2CF.sub.2OCH.sub.3, --CH.sub.2CH.sub.2OCF.sub.3,
--CF.sub.2CF.sub.2OCH.sub.3, --CH.sub.2CF.sub.2OCF.sub.3,
--CF.sub.2CH.sub.2OCF.sub.3, --CF.sub.2CF.sub.2OCF.sub.3,
--CHFCH.sub.2OCH.sub.3, --CHFCHFOCH.sub.3, --CHFCH.sub.2OCFH.sub.2,
--CHFCH.sub.2OCHF.sub.2 and --CH.sub.2CHFOCH.sub.3. In embodiments,
the nucleotide of Formula I is:
##STR00009##
[0031] In embodiments, compounds of the present disclosure include
oligonucleotides comprising a sequence complementary to at least a
portion of the MAPT gene sequence where one or more nucleotides of
the oligonucleotides are nucleotides of Formula (II):
##STR00010##
wherein Y is S or O, R is H or a positively charged counter ion, B
is a nucleobase, R.sub.2 is --CR'.sub.3, --CR'.sub.2OCR'.sub.3,
--(CR'.sub.2).sub.3CR'.sub.3 or --(CR'.sub.2).sub.2CR'.sub.3, or
R.sub.2 is --(CR'.sub.2).sub.2OCR'3 and Y is O and R' is
independently in each instance H or F.
[0032] In the nucleotide of Formula (II), R.sub.2 is --CR'.sub.3,
--(CR'.sub.2).sub.1-3OCR'.sub.3, or --(CR'.sub.2).sub.1-2CR'.sub.3.
In some embodiments, R.sub.2 is-CR'.sub.3 or --CR'.sub.2CR'.sub.3.
In some embodiments, R' is H in each instance. In other
embodiments, at least one R' is F, for example, 1, 2, 3, 4, or 5
R's are F. In some embodiments, CR'.sub.3 contains 1, 2 or 3 F
moieties. For example, in embodiments, R.sub.2 is selected from the
group consisting of --CH.sub.3 (or Me), --CFH.sub.2, --CHF.sub.2,
CF.sub.3, --CH.sub.2OCH.sub.3, --CFH.sub.2OCH.sub.3,
--CHF.sub.2OCH.sub.3, --CF.sub.3OCH.sub.3, --CH.sub.2OCFH.sub.2,
--CH.sub.2OCHF.sub.2, --CH.sub.2OCF.sub.3, --CFH.sub.2OCH.sub.3,
--CFH.sub.2OCFH.sub.2, --CFH.sub.2OCHF.sub.2, --CFH.sub.2OCF.sub.3,
--CHF.sub.2OCH.sub.3, --CHF.sub.2OCFH.sub.2, --CHF.sub.2OCHF.sub.2,
--CHF.sub.2OCF.sub.3, --(CR'.sub.2).sub.3OCR'.sub.3,
--CH.sub.2CH.sub.3 (or Et), --CFH.sub.2CH.sub.3,
--CHF.sub.2CH.sub.3, --CF.sub.3CH.sub.3, --CH.sub.2CFH.sub.2,
--CH.sub.2CHF.sub.2, --CH.sub.2CF.sub.3, --CFH.sub.2CH.sub.3,
--CFH.sub.2CFH.sub.2, --CFH.sub.2CHF.sub.2, --CFH.sub.2CF.sub.3,
--CHF.sub.2CH.sub.3, --CHF.sub.2CFH.sub.2, --CHF.sub.2CHF.sub.2,
--CHF.sub.2CF.sub.3, --CH.sub.2CH.sub.2CH.sub.3,
CF.sub.2CH.sub.2CH.sub.3, CH.sub.2CF.sub.2CH.sub.3,
CH.sub.2CH.sub.2CF.sub.3, CF.sub.2CF.sub.2CH.sub.3,
CH.sub.2CF.sub.2CF.sub.3, CF.sub.2CH.sub.2CF.sub.3,
CF.sub.2CF.sub.2CF.sub.3, CHFCH.sub.2CH.sub.3, CHFCHFOCH.sub.3,
CHFCH.sub.2CFH.sub.2, CHFCH.sub.2CHF.sub.2 and CH.sub.2CHFCH.sub.3.
In embodiments, R.sub.2 is --CH.sub.3 (or Me) or --CH.sub.2CH.sub.3
(or Et).
[0033] In embodiments, the nucleotides of Formula II are selected
from the group consisting of
##STR00011##
[0034] In compounds of Formulae (I) or (II), Y may be O or S. In
some embodiments, Y is S in at least one instance (e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30 etc.). In other embodiments, Y
is S in at least one instance and O in at least another instance.
In other embodiments, Y is S in each instance. In some embodiments,
Y is O in at least one instance (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30 etc.).
[0035] The disclosed oligonucleotides comprise at least one
nucleotide of Formula (I). In embodiments, the disclosed
oligonucleotides comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides of
Formula (I). In embodiments, the disclosed oligonucleotides
comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24 nucleotides of Formula (II). In some
embodiments, the oligonucleotide comprises from 2 to 40
nucleotides, for example, 8 to 26 nucleotides or integers
therebetween.
[0036] In embodiments where more than one nucleotide of Formula (I)
are included in the oligonucleotide, the nucleotide may be the same
or different. In some embodiments one or more nucleotides of
Formula (II) are included and may be the same or different. For
example, in some embodiments, the oligonucleotide comprises at
least one nucleotide of Formula (I) and at least one nucleotide of
Formula (II). In some embodiments, the oligonucleotide comprises at
least one nucleotide of Formula (I), wherein at least one R.sub.1
is MOE and at least one nucleotide of Formula (II), wherein R.sub.2
is Me or Et. In some embodiments, the oligonucleotide comprises at
least 2 alternating nucleotides of Formula (I) and Formula (II).
For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24 nucleotides with alternating 2'
modification (e.g., Me-MOE-Me-MOE . . . or Et-MOE-Et-MOE-Et-MOE . .
. ).
[0037] In some embodiments, the nucleotide of Formula (I) and/or
Formula (II) is represented by the following:
##STR00012##
[0038] In some embodiments, the oligonucleotide comprising the
nucleotide of Formula (I) further comprises a 2'-fluoronucleotide
of the Formula (IIIa) and/or (IIIb):
##STR00013##
wherein Y is S or O, R is H or a positively charged counter ion,
and B is a nucleobase.
[0039] In some embodiments, the oligonucleotide comprises at least
4 alternating nucleotides of Formulae (I) and (IIIa). For example,
the oligonucleotide comprises 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24 alternating nucleotides.
[0040] Certain embodiments include an oligonucleotide comprising
4-40 nucleotides, and comprising Formula (IV):
##STR00014##
wherein Y is S or O, R is H or a positively charged counter ion, B
is a nucleobase, R.sub.1 is --(CR'.sub.2).sub.2OCR'.sub.3, R.sub.2
is selected from --OCR'.sub.3, --OCR'.sub.2OCR'.sub.3,
--O(CR'.sub.2).sub.3OCR'.sub.3 or --O(CR'.sub.2).sub.1-2CR'3 and F,
R' is independently in each instance H or F, and a is an integer of
1-10 and b is an integer from 1-10, where the to 20, e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and
20.
[0041] Compounds of the present disclosure include oligonucleotides
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotides are nucleotides of Formula (III'):
##STR00015##
wherein Y is S or O, R is H or a positively charged counter ion,
and B is independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase; and optionally comprising one
or more of formula (I), (II), and/or (IV).
[0042] The nucleobases, B, of the nucleotides of Formulae (I),
(II), (IIIa), (IIIb), (IV) and (V) may each independently be a
natural or an unmodified nucleobase or a modified nucleobase. In
some embodiments, the modified nucleotides include
2,6-diaminopurine nucleobases, but optionally not adenine. In some
embodiments, the modified nucleotides include 5-methyluracil
nucleobases, but optionally not uracil. In some embodiments, the
modified nucleotides include 2,6-diaminopurine nucleobases, but not
adenine and 5-methyluracil nucleobases, but optionally not
uracil.
[0043] Y in each nucleotide of Formulae (II), (IIIa), (IIIb), (IV)
and (V) may be independently O or S. In some embodiments, Y is S in
at least one instance (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30 etc.). In other embodiments, Y is S in at least one instance and
O in at least another instance. In other embodiments, Y is S in
each instance. In some embodiments, Y is O in at least one instance
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 etc.).
[0044] In embodiments where more than one nucleotide of each of
Formulae (I), (II), (IIIa), (IIIb), (IV) and (V) are included, the
more than one nucleotide of such Formulae may be the same or
different. For example, in some embodiments, the nucleotide
comprises at least one nucleotide of Formula (II), (III), (IV), (V)
and/or (V') in addition to at least one nucleotide of Formula (I).
In some embodiments, the nucleotide comprises at least 2
alternating nucleotides of Formula (I) and/or Formula (II) and/or
(III) and/or (IV), (V) and/or (V'). For example, disclosed
oligonucleotides may include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides with
alternating 2' modifications.
[0045] In embodiments, the nucleotides of the oligonucleotide are
selected from the group consisting of:
##STR00016##
where B can be any natural or modified base.
[0046] Compounds of the present disclosure include oligonucleotides
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotides are nucleotides of Formula (V'):
##STR00017##
wherein Y is S or O, R is H or a positively charged counter ion, B
is independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, A is --(CR''R'').sub.1-2-- and
R'' is independently in each instance H, F or Me, and optionally
comprising one or more of Formulae (I), (II), (III), (IV) or
(V).
[0047] In the compound comprising formula (V'), A is
--(CR''R'').sub.1-2--. In some embodiments, A is --(CR''R'')-- in
other embodiments, A is --(CR''R'').sub.2--. R'' is independently
in each instance H or Me. In some embodiments, one R'' is Me and
remaining are H. In other embodiments, all R'' are H.
[0048] In some embodiments, when A is CH.sub.2, then Y is S. In
other embodiments, when A is CH.sub.2CH.sub.2, then Y is O or S. In
some embodiments, A is CH.sub.2CH(Me) or CH(Me) and Y is O or
S.
[0049] In the compound comprising formula (V'), Y is O or S. In
some embodiments, Y is S in at least one instance (e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30 etc.). In other embodiments, Y
is S in at least one instance and O in at least another instance.
In other embodiments, Y is S in each instance. In some embodiments,
Y is O in at least one instance (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30 etc.).
[0050] The compound of Formula (V') (and optionally Formulae (I),
(II), (III), (IV), (V) and/or (V') may be part of an
oligonucleotide. In some embodiments, the compound comprising
Formula (IV) (and optionally Formulae (I), (II), (III), (IV), (V)
and/or (V')) is an oligonucleotide comprising 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24
nucleotides of Formula (V') (and Formulae (I), (II), (III), (IV),
(V) and/or (V')). In some embodiments, the oligonucleotide
comprises from 2 to 40 nucleotides, for example, 8 to 26
nucleotides or integers there between.
[0051] In embodiments where more than one nucleotide of Formula
(V') are included, the more than one nucleotide of Formula (V') may
be the same or different. In some embodiments one or more
nucleotides of Formulae (I), (II), (III), (IV), (V) and/or (V') are
included and may be the same or different. For example, in some
embodiments, the nucleotide comprises at least one nucleotide of
Formula (V') and at least one nucleotide of Formulae (I), (II),
(III), (IV), (V) and/or (V'). In some embodiments, the nucleotide
comprises at least 2 alternating nucleotides of Formula (V') and
Formula (I) and/or (II). For example, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides
with alternating 2' modification.
[0052] In some embodiments, the nucleotide comprising the
nucleotide of Formula (V') (and optionally Formulae (I), (II),
(III), (IV), (V) and/or (V')) further comprises a
2-fluoronucleotide of the following structures:
##STR00018##
where Y, R and B are the same as for Formula (I). In some
embodiments, the nucleotide comprises at least 4 alternating
nucleotides of Formula (V') and 2-fluoronucleotides.
[0053] Compounds of the present disclosure include oligonucleotides
comprising a sequence complementary to at least a portion of the
MAPT gene sequence where one or more nucleotides of the
oligonucleotides are nucleotides of Formula (V):
##STR00019##
wherein Y is S or O, R is H or a positively charged counter ion,
and B is independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase; and optionally comprising one
or more of formula (I), (II), (III), (IV) and/or (V').
Chimeric Oligonucleotides
[0054] The present disclosure is directed to constructs of
oligonucleotides comprising a sequence complementary to at least a
portion of the MAPT gene sequence, which include domains, regions
or portions within the oligonucleotide having common features.
Oligonucleotides having these domains are referred to herein as
chimeric oligonucleotides. In some embodiments, chimeric
oligonucleotides are represented by Formula (VI):
5'-X-Y-Z-3' (VI),
wherein the chimeric oligonucleotide comprises a sequence of 14 to
22 nucleosides, wherein X is a domain comprising a sequence of
modified nucleotides that is 3-10 nucleotides in length; Z is a
domain comprising a sequence of modified nucleotides that is 3-10
nucleosides in length; and Y is a domain comprising a sequence of
2-10 2'-deoxy-nucleotides, or unmodified nucleotides. Each of the
nucleosides in each of the domains is linked through intersubunit
linkages.
[0055] In some embodiments, chimeric oligonucleotides comprising a
sequence complementary to at least a portion of the MAPT gene
sequence include one or more nucleotides of Formula (VI'):
5'-X-Y-Z-3' (VI'),
wherein the chimeric oligonucleotide comprises a sequence of 14 to
22 nucleosides, wherein X is a domain comprising a sequence of
modified nucleotides that is 2-10 nucleotides in length; Z is a
domain comprising a sequence of modified nucleotides that is 2-10
nucleosides in length; and Y is a domain comprising a sequence of
6-14 2'-deoxy-nucleotides, or unmodified nucleotides. Each of the
nucleosides in each of the domains is linked through intersubunit
linkages.
[0056] Nucleotides of formula (I), (II), (IIIa), (IIIb), (IV), (V)
and/or (V') may be present in the X and/or Z domain. Chimeric
oligonucleotide may be conjugated at the 5' and/or 3' end to a
ligand-targeting group.
[0057] In some embodiments, the Y domain contains
2'deoxy-nucleosides linked by thiophosphate intersubunit linkages.
In embodiments, the Y domain contains 2'deoxy-nucleosides linked by
at least one phosphodiester intersubunit linkage. In embodiments,
the Y domain contains 2'deoxy-nucleosides linked by two
phosphodiester intersubunit linkages. In embodiments, the Y domain
contains 2'deoxy-nucleosides linked by thiophosphate intersubunit
linkages and one or two phosphodiester intersubunit linkages. In
some embodiments, the Y domain is 6 to 10 nucleotides in
length.
[0058] In some embodiments, the X domain comprises nucleotides of
formulae (I), (II), (IIIa), (IIIb), (IV), (V) and/or (V'). In some
embodiments, the X domain comprises modified nucleotides where the
modification is independently selected from 2'-OMe, 2'-OEt,
2'-O-methoxyethoxy, and conformationally restricted nucleotides. In
some embodiments, the X domain is 9 or 10 nucleotides in
length.
[0059] In some embodiments, the Z domain comprises nucleotides of
formulae (I), (II), (IIIa), (IIIb), (IV), (V) and/or (V'). In some
embodiments, the Z domain comprises 2' modified nucleotides where
the modification is 2'-OMe, 2'-OEt or 2'-MOE. In some embodiments,
the Z domain is 9 or 10 nucleotides in length.
[0060] In embodiments, the chimeric oligonucleotide comprises a
sequence of 14 to 22 nucleotides. For example, the oligonucleotide
may include 14, 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides.
[0061] In embodiments, X is a domain consisting of a sequence
containing one or more modified nucleotides that is 3-10
nucleotides in length; Z is a domain consisting of a sequence
containing one or more modified nucleotides that is 3-10
nucleotides in length; and Y is a domain consisting of a sequence
of 2 to 10 2'-deoxy-nucleosides linked through thiophosphate
intersubunit linkages and optionally one or two phosphodiester
intersubunit linkages. In some embodiments, X is 5-9, Y is 6-10 and
Z is 5-9. In some embodiments, the number of nucleotides in each of
X, Y and Z, respectively is: 6/6/6, 6/6/7, 6/6/8, 6/7/6, 6/7/7,
6/7/8, 6/8/6, 6/8/7, 6/8/8, 3/10/3, 4/10/4, 5/10/5, 5/10/6, 2/12/2,
3/12/3, 2/14/2, 5/9/5, 5/9/6, 5/8/5, 5/8/6, 5/8/7, 7/5/7, 7/5/8,
7/5/9, 7/6/6, 7/6/7, 7/6/8, 7/6/9, 7/7/6, 7/7/7, 7/7/8, 7/7/9,
7/5/7, 7/5/8, 7/5/9, 7/4/7, 7/4/8, 7/4/9, 8/4/7, 8/4/8, 8/4/9,
7/3/7, 7/3/8, 7/3/9, 8/3/7, 8/3/8, 8/3/9, 8/3/10, 9/3/7, 9/3/8,
9/3/9, 9/3/10, 8/2/7, 8/2/8, 8/2/9, 8/2/10, 9/2/7, 9/2/8, 9/2/9,
9/2/10, 10/2/8, 10/2/9, 10/2/10. The X domain and the Z domain
each, respectively, comprise a sequence of modified nucleotides,
where the domain is 4-10 nucleotides in length. For example, the X
domain and/or Z domain may comprise a sequence of 4, 5, 6, 7, 8, 9,
or 10 nucleotides. One or more of these nucleotides is modified
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10). For example, in some
embodiments, all the nucleotides in each of the X domain and/or Z
domain are modified.
[0062] The nucleotides of the X and Z domains may be modified
according to Formulae (I), (II), (IIIa), (IIIb), (IV), (V) and/or
(V') with respect to one or more of their nucleobases, the 2'
and/or 3' positions on the ribose sugar and their intersubunit
linkages. Embodiments include wherein the 2' position is modified
with an F (ribo or arabino) and the 3' position is O or NH.
Embodiments also include wherein the 2' position is modified with
an OMe and the 3' position is O or NH. Embodiments include wherein
the 2' position is modified with an F (ribo or arabino) as well as
Me or OMe, and the 3' position is O or NH. Embodiments include
wherein the 2' position is modified with an F (ribo or arabino) and
the 3' position is O or NH. Embodiments include wherein the 2'
position is modified with an O-methoxyethoxy and the 3' position is
O or NH. Embodiments also include wherein the 2' position is
modified with an F (ribo or arabino) and the 3' position is O or
NH. Embodiments include wherein the 2' and 4' positions are
modified bridging group (as described elsewhere herein) to form a
conformationally restricted nucleotide and the 3' position is O or
NH. Each of these embodiments may include thiophosphate (or
thiophosphoramidate depending on the 3' substitution) and
phosphoramidate intersubunit linkages.
[0063] Embodiments also include oligonucleotides where the 2'
position of at least one nucleotide is H, and the 3' position is
NH. Each of these embodiments may include thiophosphoramidate
and/or phosphoramidate intersubunit linkages.
[0064] In some embodiments, the modified nucleotides of the X
domain and the Z domain each, respectively, include a modification
independently selected from at least one of 2'-F,
2'-F-N3'.fwdarw.P5', 2'-OMe, 2'-OMe-N3'.fwdarw.P5',
2'-O-methoxyethoxy, 2'-O-methoxyethoxy-N3'.fwdarw.P5',
conformationally restricted nucleotides.
[0065] In some embodiments, the modified nucleotide contains a
nucleoside represented by the following Formula (A):
##STR00020##
wherein A is independently in each instance NH or O, B is
independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, and R' and R'' are each
independently in each instance selected from H, F, OH, OMe, OEt,
-methoxyethoxy, and R''' is H, or R' and R''' together form a 2-4
atom bridge to form a conformationally restricted nucleoside (e.g.,
--O--CH.sub.2--, --O--CH(Me)-, or --O--(CH.sub.2).sub.2--).
[0066] In some embodiments, R' is selected from F, OH, --OMe, -OEt,
O-methoxyethoxy; R'' is H and F; and R''' is H, Me or --OMe. In
other embodiments, R'' and R''' are H; and R' is selected from F,
OMe, OEt and O-methoxyethoxy. In some embodiments, A is NH in each
instance.
[0067] Some embodiments include one or more modified nucleosides
represented by Formula (A), wherein A is NH; B is a G-clamp; R' is
F or OMe and R'' is H; or R' is H and R'' is H or F; and R''' is
H.
[0068] Some embodiments include one or more modified nucleosides
represented by Formula (A), wherein A is NH; B is an unmodified or
modified nucleobase; R' and R''' together form a conformationally
restricted nucleoside (e.g., --O--CH.sub.2--, --O--CH(Me)-, or
--O--(CH.sub.2).sub.2--); and R'' is H. In some embodiments, B is
an unmodified or a modified nucleobase selected from the group
consisting of 5-methylcytosine, 2,6-diaminopurine, and
5-methyluracil.
[0069] Some embodiments include one or more modified nucleosides
represented by Formula (A), wherein A is NH; B is an unmodified or
modified nucleobase; R' is F or OMe, R'' is H and R''' is H.
[0070] Some embodiments include one or more modified nucleosides
represented by Formula (A), wherein A is NH; B is an unmodified or
modified nucleobase; R' is H, R'' is F and R''' is H.
[0071] In some embodiments, the X and Z domains are represented by
the Formula (A1):
##STR00021##
wherein W is independently in each instance OR or SR, where R is H
or a positively charged counter ion; R', R'', R''', A and B are as
described for Formula (A). In other embodiments, A is O and R', R''
are independently H or OEt, where at least one of R', R'' is
OEt.
[0072] For example, in addition to at least one nucleotide in each
of the X and Z domains where A is NH, W is S, and R' is MOE, the
nucleotides of X and/or Z may include one or more nucleotides of
Formula A2 as described in Table A2 or one or more nucleotides of
Formula A3 as described in Table A3.
##STR00022##
TABLE-US-00001 TABLE A2 Nucleotide No. R' R'' R''' A W 1 F H H NH S
2 F H H NH O 3 F H H O S 4 F H H O O 5 H F H NH S 6 H F H NH O 7 H
F H O S 8 H F H O O 9 OMe H H NH S 10 OMe H H NH O 11 OMe H H O S
12 OMe H H O O 13 H F H NH S 14 H F H NH O 15 H F H O S 16 H F H O
O 17 O-methoxyethoxy H H NH S 18 O-methoxyethoxy H H NH O 19
O-methoxyethoxy H H O S 20 O-methoxyethoxy H H O O 21 H H H NH S 22
H H H NH O 23 OH H H NH S 24 OH H H NH O 25 OH H H O S 26 H OH H NH
O 27 H OH H NH S 28 H OEt H NH O 29 H OEt H NH S 30 H OEt H O O 31
H OEt H O S 32 OEt H H NH O 33 OEt H H NH S 34 OEt H H O O 35 OEt H
H O S
##STR00023##
TABLE-US-00002 TABLE A3 Nucleotide No. C A W 36 --O--CH.sub.2-- NH
S 37 --O--CH.sub.2-- NH O 38 --O--CH.sub.2-- O S 39 --O--CH.sub.2--
O O 40 --O--(CH.sub.2).sub.2-- NH S 41 --O--(CH.sub.2).sub.2-- NH O
42 --O--(CH.sub.2).sub.2-- O S 43 --O--(CH.sub.2).sub.2-- O O 44
--O--CH(Me)-- NH S 45 --O--CH(Me)-- NH O 46 --O--CH(Me)-- O S 47
--O--CH(Me)-- O O
[0073] In some embodiments, the X domain and Z domain each
independently comprise two, three or more different nucleotides
1-47.
[0074] The nucleosides of the X domain are linked through
intersubunit linkages, for example, N3'.fwdarw.P5'phosphoramidate,
N3'.fwdarw.P5'thiophosphoramidate, thiophosphate, phosphodiester
intersubunit linkages or combinations thereof. In some embodiments,
the X domain is linked through intersubunit linkages selected from
N3'.fwdarw.P5' phosphoramidate, N3'.fwdarw.P5' thiophosphoramidate,
and combinations thereof.
[0075] The X domain of the chimeric oligonucleotide may include a
certain arrangement of modified nucleotides. For example, in some
embodiments, the X domain comprises one or more conformationally
restricted nucleotides. Conformationally restricted nucleotides can
include BNA, such as, LNA and ENA. (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10 conformationally restricted nucleotides). In some
embodiments, the X domain comprises one or more 2'-F and/or 2'-OMe
modified nucleotides. In some embodiments, the X domain comprises
alternating conformationally restricted nucleotides, e.g., every
other nucleotide is a conformationally restricted nucleotide. In
some embodiments, the X domain comprises one or more 2'-F and/or
2'-OMe modified nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
2'-F and/or 2'-OMe modified nucleotides). In some embodiments, the
X domain comprises alternating 2'-F and 2'-OMe modified
nucleotides. In embodiments, the X domain comprises 2'-F or 2'-OMe
and conformationally restricted nucleotides, for example, in an
alternating sequence.
[0076] The Y domain comprises a sequence of 2 to 14
2'-deoxynucleotides. For example, the Y domain may comprise a
sequence of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14
2'-deoxynucleotides. One or more of the 2'-deoxynucleosides may be
linked through thiophosphate intersubunit linkages (e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 thiophosphate intersubunit
linkages). In some embodiments, each of the 2'-deoxynucleosides is
linked through a thiophosphate intersubunit linkage. In some
embodiments, the Y domain comprises at least one phosphodiester
intersubunit linkage (e.g., 1, 2 or 3 phosphodiester intersubunit
linkages). In other embodiments, the Y domain consists of
2'-deoxy-nucleosides linked through thiophosphate intersubunit
linkages, and optionally one or two phosphodiester intersubunit
linkages.
[0077] In embodiments, the Y domain comprises nucleotides that
induce RNase H cleavage.
[0078] In some embodiments, the nucleotides of Formula (A) include
those in Table A where X.sub.A is NH. In some embodiments, the
nucleotide of Formula (A) are arranged and modified in accordance
with the constructs listed in Table B. In some embodiments, the
construct of Formula (A) includes a sequence 1, 2, 3, 4, or 5
nucleobases different from a sequence selected from those in Table
D. In some embodiments, every nucleotide in an oligonucleotide is a
nucleotide of Formula (A).
[0079] In some embodiments, the 2'-deoxynucleoside linked through a
thiophosphate intersubunit linkage may be represented by the
following Formula (B):
##STR00024##
where B is independently in each instance an unmodified or modified
nucleobase. In some embodiments, B is an unmodified or a modified
nucleobase selected from the group consisting of 5-methylcytosine,
2,6-diaminopurine, and 5-methyluracil.
[0080] In other embodiments, the 2'-deoxynucleoside linked through
a thiophosphate intersubunit linkage comprises a modified
2'-deoxynucleoside, which may be modified in the same manner as in
the X and Z domain. For example, the modified 2'-deoxynucleoside
linked through a thiophosphate intersubunit linkage may be
represented by the following Formula (C):
##STR00025##
wherein B is independently in each instance an unmodified or
modified nucleobase, and R'' and R''' are each independently in
each instance selected from H, F, Cl, OH, OMe, Me, O-methoxyethoxy,
or R' and R''' together form a 2-4 atom bridge to form a
conformationally restricted nucleoside. In some embodiments, B is
an unmodified or a modified nucleobase selected from the group
consisting of 5-methylcytosine, 2,6-diaminopurine, and
5-methyluracil. [0081] The Z domain comprises a sequence of
modified nucleotides, where the Z domain is 4-10 nucleotides in
length. For example, the Z domain may comprise a sequence of 4, 5,
6, 7, 8, 9, or 10 nucleotides. One or more of these nucleotides is
modified (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21 or 22). For example, in some embodiments,
all the nucleotides in the Z domain are modified.
[0081] The modified nucleotides of the Z domain include, for
example, a modification independently selected from at least one of
2'-F, 2'-F-N3'.fwdarw.P5', 2'-OMe, 2'-OMe-N3'.fwdarw.P5',
2'-OEt-N3'.fwdarw.P5', 2'-O-methoxyethoxy,
2'-O-methoxyethoxy-N3'.fwdarw.P5', conformationally restricted
nucleotides, 2'-OH-N3'.fwdarw.P5'thiophosphoramidate and
2'-OH-N3'.fwdarw.P5' phosphoramidate.
[0082] The nucleotides of the Z domain may be linked through
intersubunit linkages such as, for example, N3'.fwdarw.P5'
phosphoramidate, N3'.fwdarw.P5' thiophosphoramidate, thiophosphate
or phosphodiester intersubunit linkages. In some embodiments, the Z
domain is linked through N3'.fwdarw.P5' phosphoramidate,
N3'.fwdarw.P5' thiophosphoramidate, intersubunit linkages, and
combinations thereof.
[0083] The Z domain of the chimeric oligonucleotide may include a
certain arrangement of modified nucleotides. For example, in some
embodiments, the Z domain comprises one or more (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9 or 10, or more) conformationally restricted
nucleotides (e.g., BNA, such as, LNA, ENA, each of which may be
optionally substituted). In some embodiments, the Z domain
comprises alternating conformationally restricted nucleotides,
e.g., every other nucleotide is a conformationally restricted
nucleotide (e.g., BNA, such as, LNA, ENA, each of which may be
optionally substituted). In some embodiments, the Z domain
comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, or
more) 2'-F and/or 2'-OMe modified nucleotide. For example, some
embodiments include where the Z domain comprises alternating 2'-F
and 2'-OMe modified nucleotides, or the Z domain comprises
alternating 2'-F or 2'-OMe and conformationally restricted
nucleotides.
[0084] In some embodiments, the modified nucleotides of Formula
(VI) or (VI') include 5-methylcytosine nucleobases, but not
cytosine. In some embodiments, the modified nucleotides of Formula
(VI) or (VI') include 2,6-diaminopurine nucleobases, but not
adenine. In some embodiments, the modified nucleotides of Formula
(VI) or (VI') include 5-methyluracil nucleobases, but not uracil.
In some embodiments, the modified nucleotides of Formula (VI) or
(VI') include 2'-OMe and conformationally restricted nucleotides,
and are linked through thiophosphate intersubunit linkages, and the
modified nucleotides include 5-methylcytosine nucleobases, but not
cytosine. In some embodiments, the modified nucleotides of Formula
(VI) or (VI') include the 2'-OMe modified nucleotides with
5-methyluracil nucleobases, but not uracil.
[0085] In certain embodiments, the nucleotides of Formula (VI) or
(VI') in the chimeric oligonucleotide comprising a sequence
complementary to at least a portion of the MAPT gene sequence are
arranged according to at least one of the constructs of Table B
where at least one intersubunit linkage in the X and Z domains is
an NPS linkage.
TABLE-US-00003 TABLE B X Domain Y Domain Z Domain Nucleo- Nucleo-
Inter- base Inter- Number Inter- base Number subunit Substi- Number
subunit Nucleo- of subunit Substi- of Nucs Linkages tutions of Nucs
Linkages base Nucs Linkages tutions 2, 3, 4, 5, np, nps, A, G, C,
2, 3, 4, 5, ps A, G, C, 2, 3, 4, 5, np, nps, A, G, C, 6, 7, 8, 9,
ps, PO T, U, 6, 7, 8, 9, T, U, 6, 7, 8, 9, ps, PO T, U 10, 11 DAP,
10, 11 10, 11, DAP, and 12 5meC, 12, 13 and 12 5meC, 5meU, G and 14
5meU, G clamp, clamp, DAP DAP
[0086] In Table B, the nucleotides in/5 each of the X and Z domains
can be one or more of the numbered nucleotides in Tables A2 and A3.
In some embodiments, the chimeric oligonucleotides of Table B
include at least 1, 2, 3, 4, 5, 6, 7, 8 or more of the modified
nucleotides in Table A. In some embodiments, all of the nucleotides
of X and/or Z are modified nucleotides. In some embodiments, the
nucleotides in Table B are selected from certain modified
nucleotides listed in Table A such as nucleotide numbers 1-4 or 5-8
or 9-12 or 13-16 or 17-20 or 21-24 or 25-28 or 29-30 or 31-32 or
33. In some embodiments the nucleotides in Table B are selected
from certain modified nucleotides listed in Table A such as
nucleotide numbers 9-12 and 21-28, or 9-12 and 21-24, or 1-4 and
21-28, or 1-4 and 21-24, or 5-8 and 21-28, or 5-8 and 21-24. In
some embodiments, the nucleotides in Table B are selected from one
or two or three modified nucleotides listed in Table A such as
nucleotide numbers 29-31 or 31-32 or 33. In some embodiments, the
nucleotides in Table B are selected from certain modified
nucleotides listed in Table A such as nucleotide numbers 29 or 31
or 33. The nucleotides in the Y domain of Table B can include
nucleotides of Formula B.
[0087] In some embodiments, the oligonucleotide of Table B is
conjugated at the 5' and/or 3' end to a ligand-targeting group
and/or lipid moiety.
[0088] In some embodiments, the oligonucleotide compounds of the
present disclosure include the following nucleobase sequences set
forth in Table C.
TABLE-US-00004 TABLE C Nucleobase Sequences (5'-3')
5'-GCTTTTACTGACCATGCGAG-3' (SEQ ID NO: 1)
[0089] In embodiments, the oligonucleotide includes the sequence of
SEQ ID NO: 1. In embodiments, the sequence of SEQ ID NO: 1 is
modified according to at least one of the disclosed modifications.
In embodiments, SEQ ID NO: 1 is modified having a
thiophosphoramidate linkage and 2'-methoxyethoxy (2'MOE)
modification in at least the first two nucleotides from the 5' and
3' ends of the oligonucleotide. In embodiments, SEQ ID NO: 1 is
modified having a 2'MOE modification in at least the first three
nucleotides from the 5' and 3' ends of the oligonucleotide. In
embodiments, SEQ ID NO: 1 is modified having a 2'MOE modification
in at least the first four nucleotides from the 5' and 3' ends of
the oligonucleotide. In embodiments, SEQ ID NO: 1 is modified
having a 2'MOE modification in at least the first five nucleotides
from the 5' and 3' ends of the oligonucleotide. In embodiments, SEQ
ID NO: 1 is modified having a 2'MOE modification in at least the
first six nucleotides from the 5' and 3' ends of the
oligonucleotide.
[0090] In some embodiments, the oligonucleotide comprising a
sequence complementary to at least a portion of the MAPT gene
sequence comprises a modified sequence in accordance with the
modified sequence of Table D where X is independently in each
instance a natural or an unmodified nucleobase or a modified
nucleobase. In some embodiments, each X is independently selected
from A, C, G, U, T, 2,6-diaminopurine, a 5-Me pyrimidine (e.g.,
5-methylcytosine, 5-methyluracil), and a g-clamp. In embodiments,
SEQ ID NO: 1 is modified in accordance with the modified sequences
of Table D such that each X in Table D corresponds to each of the
nucleobases of SEQ ID NO: 1.
TABLE-US-00005 TABLE D Modified Sequence (5'-3')
5'-moeXnpsmoeXnpsmoeXnpsmoeXnpsmoeXnpsXpsXpsXpsXps
XpsXpsXpsXpsXpsXpsmoeXnpsmoeXnpsmoeXnpsmoeXnpsmoe Xn-3'
5'-moeGnpsmoeCnps(5m)moeUnps(5m)moeUnps(5m)moeUnps
TpsApsCpsTpsGpsApsCpsCpsApsTpsmoeGnpsmoeCnpsmoe
GnpsmoeAnpsmoeGn-3'-NPS Modified SEQ ID NO: 1
[0091] In embodiments, each of the nucleotides of a domain are
modified. In embodiments, each of the nucleotides of a domain have
the same modifications. In embodiments, each of the nucleotides of
the X and Z domains are modified. In embodiments, each of the
nucleotides of the X and Z domains have the same modifications. In
embodiments, each of the nucleotides of a domain are modified with
2' MOE. In embodiments, each of the nucleotides of the X and Z
domains are modified with 2' MOE. In embodiments, each of the
nucleotides of a domain are modified with 2' OMe. In embodiments,
each of the nucleotides of the X and Z domains are modified with 2'
OMe. In embodiments, each of the nucleotides of a domain are
modified with 2' OEt. In embodiments, each of the nucleotides of
the X and Z domains are modified with 2' OEt. In embodiments, each
of the nucleotides of the X and Z domains are linked by an NPS
linkage. In embodiments, the X and Z domains have the same number
of nucleotides. In embodiments, the X and Z domains each have 4-8
nucleotides. In embodiments, the X and Z domains each have 5-6
nucleotides. In embodiments, the X and Z domains each have 5
nucleotides. In embodiments, the Y domain has at least twice the
number of nucleotides as each of the X and Z domains. In
embodiments, the Y domain has 8-12 nucleotides. In embodiments, the
Y domain has 10 nucleotides. In embodiments, each of the
nucleotides of the Y domain are linked by a PS linkage. In
embodiments, at least one nucleobase of the oligonucleotide is
modified. In embodiments, at least one nucleobase adjacent to the
3' terminal end of the oligonucleotide is modified. In embodiments,
at least one nucleobase in the Z domain of the oligonucleotide is
modified. In embodiments, at least one nucleobase in the Y domain
of the oligonucleotide is modified.
[0092] Oligonucleotides of the present disclosure also include an
oligonucleotide comprising a sequence that is at least 90%
identical to a nucleobase sequence selected from the sequences
listed in Table C, independent of the modifications of the
sequences listed in Table B and D. In some embodiments, 1, 2, 3, 4,
5 nucleobases are different from the sequences listed in Table C,
independent of the modifications of the sequences listed in Tables
B and D.
[0093] In embodiments, the disclosed oligonucleotides display an
increased affinity for a target nucleic acid sequence compared to
an unmodified oligonucleotide of the same sequence. For example, in
some sequences the disclosed oligonucleotide has a nucleobase
sequence that is complementary or hybridizes to a target nucleic
acid sequence at a higher affinity than an unmodified
oligonucleotide of the same sequence. In embodiments, the disclosed
oligonucleotide complexed with a complementary target nucleic acid
sequence has a melting temperature (Tm) of >37.degree. C. The
complex may be formed under physiological conditions or nearly
physiological conditions such as in phosphate-buffered saline
(PBS). In embodiments, the Tm of the complex is >50.degree. C.
In embodiments, the Tm of the complex is 50-100.degree. C. In
embodiments, the Tm of a disclosed oligonucleotide duplexed with a
target nucleic acid sequence under physiological conditions or
nearly physiological conditions is >50.degree. C.
[0094] In certain embodiments, the target nucleic acid sequence may
be selected from a nucleic acid sequence of a known DNA or RNA
sequence such as the MAPT gene. The MAPT gene may be a DNA or RNA
sequence such as exon 5, exon 10 or exon 12.
[0095] In embodiments, the disclosed oligonucleotides display an
affinity for at least a portion of the MAPT gene or its RNA
equivalents, such as MAPT mRNA, and/or display stability complexed
to at least a portion of the MAPT gene or its RNA equivalents. In
embodiments, the oligonucleotide complexed with a complementary
MAPT gene sequence has a melting temperature (Tm) of >37.degree.
C. The MAPT gene may include an RNA sequence such as exon 5, exon
10 or exon 12. The complex may be formed under physiological
conditions or nearly physiological conditions such as in
phosphate-buffered saline (PBS). In embodiments, the Tm of the
complex is >50.degree. C. In embodiments, the Tm of the complex
is 50-100.degree. C. In embodiments, the Tm of a disclosed
oligonucleotide duplexed with the MAPT gene under physiological
conditions or nearly physiological conditions is >50.degree.
C.
[0096] Compounds of the present disclosure include an
oligonucleotide construct having a nucleobase sequence
complimentary to at least a portion of the MAPT gene, the construct
having the following Formula (VII):
5'-X'-Y'-Z'-3' (VII)
wherein X'-Y'-Z' is a chimeric oligonucleotide comprising a
sequence of 14 to 22 nucleosides, and is optionally conjugated at
the 5' and/or 3' end to a ligand targeting group, X' is a domain
comprising a sequence of modified nucleosides that is 3-14
nucleosides in length; Y' is a domain comprising a sequence of 2 to
4 2'-deoxynucleosides linked through intersubunit linkages; and Z'
is a domain comprising a sequence of modified nucleosides that is
3-14 nucleosides in length, wherein the X' and/or Y' domains
comprise one or more modified nucleoside which is linked through a
N3'.fwdarw.P5' phosphoramidate or a N3'.fwdarw.P5'
thiophosphoramidate intersubunit linkage.
[0097] The chimeric oligonucleotide represented by X'-Y'-Z' of
Formula (VII) comprises a sequence of 14 to 22 nucleotides, for
example, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides. In some
embodiments, the number of nucleotides in each of X', Y' and Z',
respectively is: 8/2/10, 9/2/10, 10/2/10, 7/3/10, 8/3/10, 9/3/10,
8/4/8, 9/4/9, 6/4/8. In some embodiments, X' is 6-10, Y' is 2-4 and
Z' is 8-10.
[0098] In some embodiments, the compound of Formula (VII) consists
of the X'-Y'-Z' chimeric oligonucleotide consisting of a sequence
of 14 to 22 nucleotides, and is optionally conjugated at the 5'
and/or 3' end (e.g., 5' end, 3' end or both 5' and 3' ends) to a
ligand targeting group, where X' is a domain consisting of a
sequence containing one or more modified nucleotides that is 3-10
nucleotides in length; Z' is a domain consisting of a sequence
containing one or more modified nucleotides that is 3-10
nucleotides in length; and Y' is a domain consisting of a sequence
of 2 to 42'-deoxy-nucleotides linked through thiophosphate
intersubunit linkages and optionally one phosphodiester
intersubunit linkage, wherein the X' and/or Y' domains contain one
or more modified nucleotide which is linked through a
N3'.fwdarw.P5' phosphoramidate or a
N3'.fwdarw.P5'thiophosphoramidate intersubunit linkage.
[0099] The X' domain comprises a sequence of modified nucleotides,
where the X' domain is 4-10 nucleotides in length. For example, the
X' domain may comprise a sequence of 4, 5, 6, 7, 8, 9, or 10
nucleotides. One or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22) of these nucleotides
is modified. For example, in some embodiments, all the nucleotides
in the X' domain are modified.
[0100] The modified nucleotides of the X' domain may be the same as
disclosed for X in Formula (VI) or (VI'). For example, the
nucleotides of the X' domain may be modified with respect to one or
more of their nucleobases, the 2' and/or 3' positions on the ribose
sugar and their intersubunit linkages. Embodiments include wherein
the 2' position is modified with an F (ribo or arabino) and the 3'
position is O or NH. Embodiments also include wherein the 2'
position is modified with an OMe and the 3' position is O or NH.
Embodiments include wherein the 2' position is modified with an F
(ribo or arabino) as well as Me or OMe, and the 3' position is O or
NH. Embodiments include wherein the 2' position is modified with an
F (ribo or arabino) and the 3' position is O or NH. Embodiments
include wherein the 2' position is modified with an O-methoxyethoxy
and the 3' position is O or NH. Embodiments also include wherein
the 2' position is modified with an F (ribo or arabino) and the 3'
position is O or NH. Embodiments include wherein the 2' and 4'
positions are modified bridging group (as described elsewhere
herein) to form a conformationally restricted nucleotide and the 3'
position is O or NH. Each of these embodiments may include
thiophosphate (or thiophosphoramidate depending on the 3'
substitution) and phosphoramidate intersubunit linkages.
[0101] Embodiments also include where the 2' position is OH, and
the 3' position is NH, or where the 2' position is H, and the 3'
position is NH. Each of these embodiments may include
thiophosphoramidate and/or phosphoramidate intersubunit
linkages.
[0102] The nucleotides of the X' domain are linked through
intersubunit linkages, for example, N3'.fwdarw.P5' phosphoramidate,
N3'.fwdarw.P5' thiophosphoramidate, thiophosphate or phosphodiester
intersubunit linkages. In some embodiments, the X' domain is linked
through intersubunit linkages selected from N3'.fwdarw.P5'
phosphoramidate, N3'.fwdarw.P5' thiophosphoramidate, and
combinations thereof. In some embodiments, the X' domain comprises
at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 from N3'.fwdarw.P5'
phosphoramidate and/or N3'.fwdarw.P5'thiophosphoramidate
intersubunit linkages.
[0103] The Y' domain comprises a sequence of 2 to 4
2'-deoxynucleotides. For example, the Y' domain may comprise a
sequence of 2, 3, or 4 2'-deoxynucleotides. One or more of the
2'-deoxynucleotides may be linked through thiophosphate or
phosphodiester intersubunit linkages (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22). In some
embodiments, each of the 2'-deoxynucleotides is linked through a
thiophosphate intersubunit linkage. In other embodiments, each of
the 2'-deoxynucleotides is linked through a phosphodiester
intersubunit linkage. In other embodiments, the Y' domain consists
of 2'-deoxy-nucleotides linked through thiophosphate intersubunit
linkages, and optionally one phosphodiester intersubunit
linkage.
[0104] The Z' domain comprises a sequence of modified nucleotides,
where the Z' domain is 4-10 nucleotides in length. For example, the
Z' domain may comprise a sequence of 4, 5, 6, 7, 8, 9, or 10
nucleotides. One or more of these nucleotides is modified (e.g., 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21 or 22). For example, in some embodiments, all the nucleotides in
the Z' domain are modified.
[0105] The modified nucleotides of the Z' domain may be the same as
disclosed for Z in Formula (VI) or (VI'). For example, the
nucleotides of the Z' domain may be modified with respect to one or
more of their nucleobases, the 2' and/or 3' positions on the ribose
sugar and their intersubunit linkages. Embodiments include wherein
the 2' position is modified with an F (ribo or arabino) and the 3'
position is O or NH. Embodiments also include wherein the 2'
position is modified with an OMe and the 3' position is O or NH.
Embodiments include wherein the 2' position is modified with an F
(ribo or arabino) as well as Me or OMe, and the 3' position is O or
NH. Embodiments include wherein the 2' position is modified with an
F (ribo or arabino) and the 3' position is O or NH. Embodiments
include wherein the 2' position is modified with an O-methoxyethoxy
and the 3' position is O or NH. Embodiments also include wherein
the 2' position is modified with an F (ribo or arabino) and the 3'
position is O or NH. Embodiments include wherein the 2' and 4'
positions are modified bridging group (as described elsewhere
herein) to form a conformationally restricted nucleotide and the 3'
position is O or NH. Each of these embodiments may include
thiophosphate (or thiophosphoramidate depending on the 3'
substitution) and phosphoramidate intersubunit linkages.
[0106] Embodiments also include oligonucleotides comprising
nucleotides where the 2' position is OH, and the 3' position is NH,
or where the 2' position is H, and the 3' position is NH. Each of
these embodiments may include thiophosphoramidate and/or
phosphoramidate intersubunit linkages.
[0107] The nucleotides of the Z' domain are linked through
intersubunit linkages, for example, N3'.fwdarw.P5' phosphoramidate,
N3'.fwdarw.P5' thiophosphoramidate, thiophosphate or phosphodiester
intersubunit linkages. In some embodiments, the Z' domain is linked
through intersubunit linkages selected from N3'.fwdarw.P5'
phosphoramidate, N3'.fwdarw.P5' thiophosphoramidate, and
combinations thereof. In some embodiments, the Z' domain comprises
at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 from N3'.fwdarw.P5'
phosphoramidate and/or N3'.fwdarw.P5' thiophosphoramidate
intersubunit linkages.
[0108] Additional embodiments include an oligonucleotide
comprising:
(A) one or more nucleotides of the following formula:
##STR00026##
wherein R is H or a positively charged counter ion, B is a
nucleobase, R.sub.1 is --(CH.sub.2).sub.2OCH.sub.3 or --OCH.sub.3
and (B) a domain comprising a sequence of 2 to 10
2'-deoxy-nucleosides linked through thiophosphate intersubunit
linkages. In some embodiments, the oligonucleotide includes 20
nucleotides. In some embodiments, the oligonucleotide includes a
domain comprising a sequence of 10 2'-deoxy-nucleosides linked
through thiophosphate intersubunit linkages.
Modified Antisense Oligonucleotides
[0109] Other compounds include modified antisense oligonucleotides.
In some embodiments the ASO includes the nucleotide of formula (I),
(II), (IIIa), (IIIb), (IV), (V) and/or (V').
[0110] Other compounds of the present disclosure include an
oligonucleotide having a nucleobase sequence complimentary to at
least a portion of the MAPT gene, the oligonucleotide comprising at
least one nucleotide having the following Formula (VIII):
##STR00027##
wherein X.sub.A is NH or O, Y is OR SR, where R is H or a
positively charged counter ion, B.sub.A is independently in each
instance a natural or an unmodified nucleobase or a modified
nucleobase, R.sub.A' and R.sub.A'' are each independently in each
instance selected from H, F, OH, OMe, O-methoxyethoxy, and
R.sub.A''' is H or R.sub.A' and R.sub.A''' together form
--O--CH.sub.2--, --O--CH(Me)- or --O--(CH.sub.2).sub.2--.
[0111] In some embodiments, R.sub.A' and R.sub.A''' are H; and
R.sub.A'' is selected from F, OH, OMe, Me, O-methoxyethoxy. In
other embodiments, R.sub.A'' and R.sub.A''' are H; and R.sub.A' is
selected from F, OMe, Me, O-methoxyethoxy. In some embodiments,
X.sub.A is NH in each instance.
[0112] Some embodiments include one or more modified nucleotides
represented by Formula (VIII), wherein X.sub.A is NH; B.sub.A is a
G-clamp; R.sub.A' is F or OMe and R.sub.A'' is H; or R.sub.A' is H
and R.sub.A'' is H or F; and R.sub.A' is H.
[0113] Some embodiments include one or more modified nucleotides
represented by Formula (VIII), wherein X.sub.A is NH; B.sub.A is an
unmodified or modified nucleobase; R.sub.A' and R.sub.A''' together
form a conformationally restricted nucleotide (e.g.,
--O--CH.sub.2-- or --O--(CH.sub.2) 2-); and R.sub.A'' is H. In some
embodiments, B.sub.A is an unmodified or a modified nucleobase
selected from the group consisting of 5-methylcytosine,
2,6-diaminopurine, and 5-methyluracil.
[0114] Some embodiments include one or more modified nucleotides
represented by Formula (VIII), wherein X.sub.A is NH; B is an
unmodified or modified nucleobase; R.sub.A' is F or OMe, R.sub.A''
is H and R.sub.A''' is H.
[0115] Some embodiments include one or more modified nucleotides
represented by Formula (VIII), wherein X.sub.A is NH; B.sub.A is an
unmodified or modified nucleobase; R.sub.A' is H, R.sub.A'' is F
and R.sub.A''' is H.
[0116] In some embodiments, X.sub.A is NH. In other embodiments, Y
is O.sup.- or S.sup.- (with a positively charged counter ion). In
some embodiments, R.sub.A' or R.sub.A'' is H and the other is F,
OH, OMe, Me, O-methoxyethoxy (e.g. arabino-F or ribo-F or OMe).
[0117] In some embodiments, B.sub.A is selected from A, C, G, U and
T. In additional embodiments, B.sub.A is selected from A, C, G, U,
T, 2,6-diaminopurine, a 5-Me pyrimidine (e.g., 5-methylcytosine,
5-methyluracil). In some embodiments, at least one of R.sub.A' and
R.sub.A'' is H. For example, in some embodiments, R.sub.A' is F,
OH, OMe, Me, O-methoxyethoxy and R.sub.A'' is H. In other
embodiments, R.sub.A' is H and R.sub.A'' is F.
[0118] In some embodiments, when B.sub.A is a purine nucleobase at
least one of R.sub.A' and R.sub.A'' is OH or F, and/or when B.sub.A
is a pyrimidine nucleobase at least one of R.sub.A' and R.sub.A''
is OMe, OH or F.
[0119] In other embodiments, the nucleotides include one or more of
the nucleotides in Table E or Table F.
TABLE-US-00006 TABLE E ##STR00028## Nucleotide No. R' R'' R''' A W
48 F H H NH S 49 F H H NH O 50 F H H O S 51 F H H O O 52 H F H NH S
53 H F H NH O 54 H F H O S 55 H F H O O 56 OMe H H NH S 57 OMe H H
NH O 58 OMe H H O S 59 OMe H H O O 60 H F H NH S 61 H F H NH O 62 H
F H O S 63 H F H O O 64 O-methoxyethoxy H H NH S 65 O-methoxyethoxy
H H NH O 66 O-methoxyethoxy H H O S 67 O-methoxyethoxy H H O O 68 H
H H NH S 69 H H H NH O 70 OH H H NH S 71 OH H H NH O 72 OH H H O S
73 H OH H NH O 74 H OH H NH S 75 H OEt H NH O 76 H OEt H NH S 77 H
OEt H O O 78 H OEt H O S 79 OEt H H NH O 80 OEt H H NH S 81 OEt H H
O O 82 OEt H H O S
TABLE-US-00007 TABLE F ##STR00029## Nucleotide No. C A W 83
--O--CH.sub.2-- NH S 84 --O--CH.sub.2-- NH O 85 --O--CH.sub.2-- O S
86 --O--CH.sub.2-- O O 87 --O--(CH.sub.2).sub.2-- NH S 88
--O--(CH.sub.2).sub.2-- NH O 89 --O--(CH.sub.2).sub.2-- O S 90
--O--(CH.sub.2).sub.2-- O O 91 --O--CH(Me)-- NH S 92 --O--CH(Me)--
NH O 93 --O--CH(Me)-- O S 94 --O--CH(Me)-- O O
[0120] Compounds of the present disclosure also include an
oligonucleotide having a nucleobase sequence complimentary to at
least a portion of the MAPT gene, the oligonucleotide comprising at
least ten nucleotides having the following Formula (IX):
##STR00030##
wherein R is H or a positively charged counter ion, B.sub.B is
independently in each instance a natural or an unmodified
nucleobase or a modified nucleobase, R.sub.B' and R.sub.B'' are
each independently in each instance selected from H, F, OMe,
O-methoxyethoxy, and R.sub.B''' is H or R.sub.B' and R.sub.B'''
together form --O--CH.sub.2--, --O--CH(Me)-, or
--O--(CH.sub.2).sub.2--.
[0121] In some embodiments, every oligonucleotide is a nucleotide
of the Formula (IX).
[0122] In some embodiments, R.sub.B' and R.sub.B''' are H and
R.sub.B'' is selected from F, OH, OMe, Me, O-methoxyethoxy. In
other embodiments, R.sub.B'' and R.sub.B''' are H; and R.sub.B' is
selected from F, OMe, Me, O-methoxyethoxy.
[0123] Some embodiments include one or more modified nucleotides
represented by Formula (IX), wherein B.sub.A is a G-clamp; R.sub.B'
is F or OMe and R.sub.B'' is H; or R.sub.B' is H and R.sub.B'' is H
or F; and R.sub.B''' is H.
[0124] Some embodiments include one or more modified nucleotides
represented by Formula (IX), wherein B.sub.A is an unmodified or
modified nucleobase; R.sub.B' and R.sub.B''' together form a
conformationally restricted nucleotide (e.g., --O--CH.sub.2-- or
--O--(CH.sub.2).sub.2--); and R.sub.B'' is H. In some embodiments,
B.sub.A is an unmodified or a modified nucleobase selected from the
group consisting of 5-methylcytosine, 2,6-diaminopurine, and
5-methyluracil.
[0125] Some embodiments include one or more modified nucleotides
represented by Formula (IX), wherein B is an unmodified or modified
nucleobase; R.sub.B' is F or OMe, R.sub.B'' is H and R.sub.B''' is
H.
[0126] Some embodiments include one or more modified nucleotides
represented by Formula (IX), wherein B.sub.A is an unmodified or
modified nucleobase; R.sub.B' is H, R.sub.B'' is F and R.sub.B'''
is H.
[0127] In other embodiments, Y is S.sup.- (with a positively
charged counter ion). In some embodiments, R.sub.B' or R.sub.B'' is
H and the other is F, OH, OMe, Me, O-methoxyethoxy (e.g. arabino-F
or ribo-F or OMe).
[0128] In some embodiments, B.sub.B is selected from A, C, G, U and
T. In additional embodiments, B.sub.B is selected from A, C, G, U,
T, 2,6-diaminopurine, a 5-Me pyrimidine (e.g., 5-methylcytosine).
In some embodiments, at least one of R.sub.B' and R.sub.B'' is H.
For example, in some embodiments, R.sub.A' is F, OH, OMe, Me,
O-methoxyethoxy and R.sub.B'' is H. In other embodiments, R.sub.B'
is H and R.sub.B'' is F.
[0129] In some embodiments, when B.sub.B is a purine nucleobase at
least one of R.sub.B' and R.sub.B'' is OH or F, and/or when B.sub.B
is a pyrimidine nucleobase at least one of R.sub.B' and R.sub.B''
is OMe, OH or F.
[0130] In some embodiments, the nucleobase sequence of the
oligonucleotide of Formulae (VIII) or (IX) comprises a sequence
selected from those in Table A. In some embodiments, the nucleobase
sequence of the oligonucleotide of Formulae (VIII) or (IX)
comprises a sequence 1, 2, 3, 4, or 5 nucleobases different from a
sequence selected from those in Table D.
[0131] In embodiments, the disclosed oligonucleotides display an
affinity for at least a portion of the MAPT gene or its RNA
equivalents and/or display stability complexed to at least one of
the following six sequences of at least a portion of the MAPT gene
or its RNA equivalents. In embodiments, the oligonucleotide
complexed with a complementary MAPT gene sequence has a melting
temperature (Tm) of >37.degree. C. The MAPT gene may be an RNA
sequence such as exon 5, exon 10 or exon 12. The complex may be
formed under physiological conditions or nearly physiological
conditions such as in phosphate-buffered saline (PBS). In
embodiments, the Tm of the complex is >50.degree. C. In
embodiments, the Tm of the complex is 50-100.degree. C. In
embodiments, the Tm of a disclosed oligonucleotide duplexed with at
least a portion of the MAPT gene under physiological conditions or
nearly physiological conditions is >50.degree. C.
[0132] In some aspects of the disclosure, the nucleobase sequence
of the oligonucleotide of Formula (VIII) or (IX) comprises a
sequence of 12-22 nucleotides, for example, 14-20 nucleotides or
16-19 nucleotides. In some embodiments, the nucleobase sequence of
the oligonucleotide of Formula (VIII) or (IX) is 12, 13, 14, 15,
16, 17, 18, 19, 20, 21 or 22 nucleotides in length.
[0133] In another aspect of the disclosure, the oligonucleotides
described herein are conjugated or modified at one or more ends of
the oligonucleotide.
[0134] For example, in some embodiments, a terminal end of the
oligonucleotide is protected from hydrolytic cleavage by at least
one modified nucleotide at said terminal end. In some embodiments,
the modified nucleotide is a modified nucleotide comprising a
modified nucleotide comprising a 3'-N modification and may include
a thiophosphoramidate subunit linkage. In some embodiments, the
oligonucleotides of Formulae (VIII) and (IX) further comprise at
least one nucleotide (e.g. 1 or 2) at the 3' and/or 5' end that
contains a thiophosphate intersubunit linkage and a thymine
nucleobase. In some embodiments, the oligonucleotides of Formulae
(VIII) and (IX) further comprise at least one nucleotide (e.g. 1 or
2) at the 3' and/or 5' end that contains a 2'-OMe modified
nucleotide and a thymine nucleobase. In some embodiments, the
oligonucleotides of Formulae (VIII) and (IX) further comprise at
least one 2'-OMe modified nucleotide at the 3' and/or 5' end that
contains a thiophosphate intersubunit linkage and an uracil
nucleobase. In some embodiments, an inverted dT can be incorporated
at the 3'-end of the oligonucleotides of Formulae (VIII) and (IX),
leading to a 3'-3' linkage which may inhibit degradation by 3'
exonucleases and/or extension by DNA polymerases.
Conjugated Oligonucleotides
[0135] The present disclosure is also directed to additional
components conjugated to the oligonucleotide such as targeting
moieties and oligonucleotides modified at one or more ends.
[0136] In some embodiments, the oligonucleotides described herein
are conjugated to one or more ligand targeting group, optionally
through a linking moiety, such as a HEG linker or a C6 or C7 amino
linker. In some embodiments, oligonucleotides described herein
further comprises a ligand targeting group conjugated at the 5'
and/or 3' end through an optional linker. In preferred embodiments,
the oligonucleotides described herein further comprise a
ligand-targeting group conjugated at the 5' and/or 3' end through
an optional linker. In some embodiments, the conjugation is at the
3'-end of the oligonucleotides described herein.
[0137] In some embodiments, the ligand-targeting group enhances the
activity, cellular distribution or cellular uptake of the
oligonucleotide by a particular type of cell such as CNS cells.
[0138] In some embodiments, the ligand targeting group may be a
lipid moiety such as tocopherols and fatty acids such as
hexadecanoic acids (palmitic acid) and octanoic acids such as
dithiooctanoic acid (lipoic acid), a palmitoyl moiety.
[0139] In some embodiments, a terminal end of the oligonucleotide
is protected from hydrolytic cleavage by at least one modified
nucleotide at the terminal end. In some embodiments, the modified
nucleotide is a modified nucleotide comprising a modified
nucleotide comprising a 3'-N modification and may include a
thiophosphoramidate subunit linkage. In some embodiments, the
oligonucleotide strand further comprises at least one nucleotide
(e.g. 1 or 2) at the 3' and/or 5' end that contains a thiophosphate
intersubunit linkage and a thymine nucleobase. In some embodiments,
the oligonucleotide strand further comprises at least one
nucleotide (e.g. 1 or 2) at the 3' and/or 5' end that contains a
2'-F, 2'-OMe, 2'-OEt, or 2'-MOE modified nucleotide. In some
embodiments, the oligonucleotide strand further comprises at least
one 2'-OMe modified nucleotide at the 3' and/or 5' end that
contains a thiophosphate intersubunit linkage and an uracil
nucleobase. In embodiments, the 3' end of the ASO is attached
through an np or po linkage to a C6 amino linker further linked to
a targeting moiety.
[0140] In some embodiments, an inverted dT can be incorporated at
the 3'-end of the oligonucleotide strand, leading to a 3'-3'
linkage that may inhibit degradation by 3' exonucleases and/or
extension by DNA polymerases.
2. Compositions
[0141] The present disclosure also encompasses pharmaceutical
compositions comprising oligonucleotides of the present disclosure.
One embodiment is a pharmaceutical composition comprising an
oligonucleotide of Formula (I), (II), (III), (IV), (V), or (VI), or
other oligonucleotide of the present disclosure and a
pharmaceutically acceptable diluent or carrier.
[0142] In some embodiments, the pharmaceutical composition
containing the oligonucleotide of the present disclosure is
formulated for delivery to the central nervous system (CNS) such as
intrathecal or intracerebroventricular delivery. In other
embodiments, the pharmaceutical composition containing the
oligonucleotide of the present disclosure is formulated for
systemic administration via parenteral delivery. Parenteral
administration includes intravenous, intra-arterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; also,
subdermal administration, e.g., via an implanted device. In a
preferred embodiment, the pharmaceutical composition containing the
oligonucleotide of the present disclosure is formulated for
intrathecal or intracerebroventricular delivery. Formulations for
CNS administration may include sterile aqueous suspension, which
may also contain buffers, diluents and other pharmaceutically
acceptable additives as understood by the skilled artisan.
[0143] The pharmaceutical compositions containing the
oligonucleotide of the present disclosure are useful for treating a
disease or disorder, e.g., associated with the expression or
activity of an AD gene.
3. Methods of Use
[0144] One aspect of the present technology includes methods for
treating a subject diagnosed as having, suspected as having, or at
risk of having tauopathy such as Alzheimer's disease (AD) and/or
any other tau-related disorder. In therapeutic applications,
compositions comprising the oligonucleotides of the present
disclosure are administered to a subject suspected of, or already
suffering from tauopathy such as AD and/or any tauopathy-related
disorder in an amount sufficient to cure, or at least partially
arrest, the symptoms of the disease, including its complications
and intermediate pathological phenotypes in development of the
tauopathy.
In some embodiments the oligonucleotides of the present disclosure
show affinity to tau cDNA sequences including an exon and/or an
intronic region. In some embodiments the oligonucleotides of the
present disclosure show affinity to microglial targets such as
PLCG2, CD33, TREM2) or astroglial targets such as ApoE as well as
other neuronal targets such as APP. In some embodiments the
oligonucleotides of the present disclosure show affinity to at
least one of the following regions of the MAPT gene in Table G.
TABLE-US-00008 Table G Targeted MAPT Region gene sequences Tau
Proteins Affected Exon 5 CTCGCATGGTCAGTAAAAGC All 8 isoforms:
NP_058519.3, NP_00590I.2, NP_058518.1, NP_058525.1. NP_001116539.1,
NP_00116538.2, NP_00l 190180.1, NP_001190181.1 Exon 5
GGAAGCGATGACAAAAAAGC All 8 isoforms: NP_058519.3, NP_005901.2,
NP_058518.1, NP_058525.1, NP_001116539.1, NP_001165382,
NP_001190180.1, NP_001190181.1 Exon 10 GGCTCAAAGGATAATATCAA All 8
isoforms: NP_058519.3, NP_005901.2, NP_058518.1, NP_058525.1,
NP_001116539.1, NP_00116538.2, NP_001190180.1, NP_001190181.1 Exon
12 GGTCCCTGGACAATATCACC All 8 isoforms: NP_058519.3, NP_00590I.2,
NP_058518.1, NP_058525.1, NP_001116539.1, NP_001165382,
NP_001190180.1, NP_001190181.1
[0145] In an embodiment, the nucleotides of the present disclosure
show affinity to exon 10 or exon 12 of Tau mRNA.
[0146] In another general aspect, the present disclosure relates to
a method of treating or reducing symptoms of a disease, disorder or
condition, such as a tauopathy, in a subject in need thereof,
comprising administering to the subject a pharmaceutical
composition of the present disclosure.
[0147] In another general aspect, the present disclosure relates to
a method of reducing pathological tau aggregation or spreading of
tauopathy in a subject in need thereof, comprising administering to
the subject a pharmaceutical composition of the present
disclosure.
[0148] According to embodiments of the present disclosure, the
pharmaceutical composition comprises a therapeutically effective
amount of an oligonucleotide of the present disclosure. As used
herein with reference to oligonucleotides of the present
disclosure, a therapeutically effective amount means an amount of
the oligonucleotides of the present disclosure that results in
treatment of a disease, disorder, or condition; prevents or slows
the progression of the disease, disorder, or condition; or reduces
or completely alleviates symptoms associated with the immune
disease, disorder, or condition.
[0149] According to particular embodiments, a therapeutically
effective amount refers to the amount of therapy which is
sufficient to achieve one, two, three, four, or more of the
following effects: (i) reduce or ameliorate the severity of the
disease, disorder or condition to be treated or a symptom
associated therewith; (ii) reduce the duration of the disease,
disorder or condition to be treated, or a symptom associated
therewith; (iii) prevent the progression of the disease, disorder
or condition to be treated, or a symptom associated therewith; (iv)
cause regression of the disease, disorder or condition to be
treated, or a symptom associated therewith; (v) prevent the
development or onset of the disease, disorder or condition to be
treated, or a symptom associated therewith; (vi) prevent the
recurrence of the disease, disorder or condition to be treated, or
a symptom associated therewith; (vii) reduce hospitalization of a
subject having the disease, disorder or condition to be treated, or
a symptom associated therewith; (viii) reduce hospitalization
length of a subject having the disease, disorder or condition to be
treated, or a symptom associated therewith; (ix) increase the
survival of a subject with the disease, disorder or condition to be
treated, or a symptom associated therewith; (xi) inhibit or reduce
the disease, disorder or condition to be treated, or a symptom
associated therewith in a subject; and/or (xii) enhance or improve
the prophylactic or therapeutic effect(s) of another therapy.
[0150] According to particular embodiments, the disease, disorder
or condition to be treated is a tauopathy. According to more
particular embodiments, the disease, disorder or condition to be
treated, includes, but is not limited to, familial Alzheimer's
disease, sporadic Alzheimer's disease, frontotemporal dementia with
parkinsonism linked to chromosome 17 (FTDP-17), progressive
supranuclear palsy, corticobasal degeneration, Pick's disease,
progressive subcortical gliosis, tangle only dementia, diffuse
neurofibrillary tangles with calcification, argyrophilic grain
dementia, amyotrophic lateral sclerosis parkinsonism-dementia
complex, Down syndrome, Gerstmann-Straussler-Scheinker disease,
Hallervorden-Spatz disease, inclusion body myositis,
Creutzfeld-Jakob disease, multiple system atrophy, Niemann-Pick
disease type C, prion protein cerebral amyloid angiopathy, subacute
sclerosing panencephalitis, myotonic dystrophy, non-Guamanian motor
neuron disease with neurofibrillary tangles, postencephalitic
parkinsonism, chronic traumatic encephalopathy, or dementia
pugulistica (boxing disease).
[0151] A tauopathy-related behavioral phenotype includes, but is
not limited to, cognitive impairments, early personality change and
disinhibition, apathy, abulia, mutism, apraxia, perseveration,
stereotyped movements/behaviors, hyperorality, disorganization,
inability to plan or organize sequential tasks,
selfishness/callousness, antisocial traits, a lack of empathy,
halting, agrammatic speech with frequent paraphasic errors but
relatively preserved comprehension, impaired comprehension and
word-finding deficits, slowly progressive gait instability,
retropulsions, freezing, frequent falls, non-levodopa responsive
axial rigidity, supranuclear gaze palsy, square wave jerks, slow
vertical saccades, pseudobulbar palsy, limb apraxia, dystonia,
cortical sensory loss, and tremor.
[0152] Patients amenable to treatment include, but are not limited
to, asymptomatic individuals at risk of AD or other tauopathy, as
well as patients presently showing symptoms. Patients amenable to
treatment include individuals who have a known genetic risk of AD,
such as a family history of AD or presence of genetic risk factors
in the genome. Exemplary risk factors are mutations in the amyloid
precursor protein (APP), especially at position 717 and positions
670 and 671 (Hardy and Swedish mutations, respectively). Other risk
factors are mutations in the presenilin genes PS1 and PS2 and in
ApoE4, family history of hypercholesterolemia or atherosclerosis.
Individuals presently suffering from AD can be recognized from
characteristic dementia by the presence of risk factors described
above. In addition, a number of diagnostic tests are available to
identify individuals who have AD. These include measurement of
cerebrospinal fluid tau and Abeta 42 levels. Elevated tau and
decreased Abeta 42 levels signify the presence of AD. Individuals
suffering from AD can also be diagnosed by AD and Related Disorders
Association criteria.
[0153] Oligonucleotides of the present disclosure are suitable both
as therapeutic and prophylactic agents for treating or preventing
neurodegenerative diseases that involve pathological aggregation of
tau, such as AD or other tauopathies. In asymptomatic patients,
treatment can begin at any age (e.g., at about 10, 15, 20, 25, 30
years). Usually, however, it is not necessary to begin treatment
until a patient reaches about 40, 50, 60, or 70 years. Treatment
typically entails multiple dosages over a period of time.
[0154] In prophylactic applications, pharmaceutical compositions or
medicaments are administered to a patient susceptible to, or
otherwise at risk of, AD in an amount sufficient to eliminate or
reduce the risk, lessen the severity, or delay the outset of the
disease, including biochemical, histologic and/or behavioral
symptoms of the disease, its complications and intermediate
pathological phenotypes presented during development of the
disease. In therapeutic applications, compositions or medicaments
are administered to a patient suspected of, or already suffering
from, such a disease in an amount sufficient to reduce, arrest, or
delay any of the symptoms of the disease (biochemical, histologic
and/or behavioral). Administration of a therapeutic can reduce or
eliminate mild cognitive impairment in patients that have not yet
developed characteristic Alzheimer's pathology.
[0155] The therapeutically effective amount or dosage can vary
according to various factors, such as the disease, disorder or
condition to be treated, the means of administration, the target
site, the physiological state of the subject (including, e.g., age,
body weight, health), whether the subject is a human or an animal,
other medications administered, and whether the treatment is
prophylactic or therapeutic. Treatment dosages are optimally
titrated to optimize safety and efficacy.
[0156] The oligonucleotides of the present disclosure can be
prepared as pharmaceutical compositions containing a
therapeutically effective amount of the oligonucleotides of the
present disclosure as an active ingredient in a pharmaceutically
acceptable carrier. The carrier can be liquids, such as water and
oils, including those of petroleum, animal, vegetable or synthetic
origin, such as peanut oil, soybean oil, mineral oil, sesame oil
and the like. For example, 0.4% saline and 0.3% glycine can be
used. These solutions are sterile and generally free of particulate
matter. They can be sterilized by conventional, well-known
sterilization techniques (e.g., filtration). The compositions can
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions such as pH
adjusting and buffering agents, stabilizing, thickening,
lubricating and coloring agents, etc. The concentration of the
oligonucleotides of the present disclosure in such pharmaceutical
formulation can vary widely, i.e., from less than about 0.5%,
usually at or at least about 1% to as much as 15 or 20% by weight
and will be selected primarily based on required dose, fluid
volumes, viscosities, etc., according to the particular mode of
administration selected.
[0157] The mode of administration for therapeutic use of the
oligonucleotides of the present disclosure can be any suitable
route that delivers the agent to the host. For example, the
compositions described herein can be formulated to be suitable for
parenteral administration, e.g., intradermal, intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal or
intracranial administration, or they can be administered into the
cerebrospinal fluid of the brain or spine.
[0158] In some embodiments the injectable formulation in accordance
with the present disclosure may be administered directly to the
central nervous system (CNS). As herein defined the term "central
nervous system" is defined as the part of the nervous system which
in vertebrates consists of the brain and spinal cord, to which
sensory impulses are transmitted and from which motor impulses pass
out, and which coordinates the activity of the entire nervous
system.
[0159] Examples of direct administration into the CNS include
intrathecal (IT) administration, and direct administration into the
brain, such as intra-cerebral (IC), intra-ventricular,
intra-cerebroventricular (ICV), intra-cranial or subdural routes of
administration. Such routes of administration may be particularly
beneficial for diseases affecting the central nervous system.
[0160] Thus, in certain aspects and embodiments of the present
disclosure the non-systemic administration is selected from the
group consisting of intrathecal, intra-cerebral, intra-ventricular,
intra-cerebroventricular, intracranial, and subdural
administration.
[0161] In some embodiments the non-systemic administration as
herein defined is intrathecal administration. As known to a skilled
artisan the term "intrathecal administration" refers to the
introduction of a therapeutic substance by injection into the
subarachnoid space of the spinal cord, while bypassing the
blood-brain barrier.
[0162] In other embodiments the non-systemic administration as
herein defined is intra-cerebroventricular administration.
[0163] As known in the art, the ventricular system is a set of four
interconnected cavities (ventricles) in the brain, where the
cerebrospinal fluid (CSF) is produced. Within each ventricle there
is a region of choroid plexus, a network of ependymal cells
involved in the production of CSF. The ventricular system is
continuous with the central canal of the spinal cord allowing for
flow of CSF to circulate.
[0164] Despite the protective role that blood brain barrier plays
in shielding the brain, it limits access to the central nervous
system (CNS) of potential therapeutics designed for
neurodegenerative disorders. Neurodegenerative diseases such as but
not limited to Alzheimer's disease can benefit greatly from
introducing the therapeutic agents directly into the CNS. One of
the direct routes of administration into the CNS is injecting
directly into cerebral lateral ventricles, by
intracerebroventricular administration, which results in delivery
of materials into the CNS through the cerebrospinal fluid.
[0165] Therefore as known in the art and as used herein the term
"intra-cerebroventricular administration" refers to injecting
directly into cerebral lateral ventricles.
[0166] The term "injection" or "injectable" as used herein refers
to a bolus injection (administration of a discrete amount of an
agent for raising its concentration in a bodily fluid), slow bolus
injection over several minutes, or prolonged infusion, or several
consecutive injections/infusions that are given at spaced apart
intervals.
[0167] The treatment can be given in a single dose schedule, or as
a multiple dose schedule in which a primary course of treatment can
be with 1-10 separate doses, followed by other doses given at
subsequent time intervals required to maintain and or reinforce the
response, for example, at 1-4 months for a second dose, and if
needed, a subsequent dose(s) after several months. Examples of
suitable treatment schedules include: (i) 0, 1 month and 6 months,
(ii) 0, 7 days and 1 month, (iii) 0 and 1 month, (iv) 0 and 6
months, or other schedules sufficient to elicit the desired
responses expected to reduce disease symptoms or reduce severity of
disease.
[0168] According to particular embodiments, a composition used in
the treatment of a tauopathy can be used in combination with other
agents that are effective for treatment of related
neurodegenerative diseases. In the case of AD, oligonucleotides of
the present disclosure can be administered in combination with
agents that reduce or prevent the deposition of amyloid-beta
(Abeta). It is possible that PHF-tau and Abeta pathologies are
synergistic. Therefore, combination therapy targeting the clearance
of both PHF-tau and Abeta and Abeta-related pathologies at the same
time can be more effective than targeting each individually. In the
case of Parkinson's Disease and related neurodegenerative diseases,
immune modulation to clear aggregated forms of the alpha-synuclein
protein is also an emerging therapy. A combination therapy which
targets the clearance of both tau and alpha-synuclein proteins
simultaneously can be more effective than targeting either protein
individually.
[0169] In another general aspect, the present disclosure relates to
a method of producing a pharmaceutical composition comprising an
oligonucleotide of the present disclosure, comprising combining the
oligonucleotide with a pharmaceutically acceptable carrier to
obtain the pharmaceutical composition.
[0170] In some embodiments, subjects treated with the
oligonucleotide composition of the present disclosure will show
amelioration or elimination of one or more of the following
conditions or symptoms: familial Alzheimer's disease, sporadic
Alzheimer's disease, frontotemporal dementia with parkinsonism
linked to chromosome 17 (FTDP-17), progressive supranuclear palsy,
corticobasal degeneration, Pick's disease, progressive subcortical
gliosis, tangle only dementia, diffuse neurofibrillary tangles with
calcification, argyrophilic grain dementia, amyotrophic lateral
sclerosis parkinsonism-dementia complex, Down syndrome,
Gerstmann-Straussler-Scheinker disease, Hallervorden-Spatz disease,
inclusion body myositis, Creutzfeld-Jakob disease, multiple system
atrophy, Niemann-Pick disease type C, prion protein cerebral
amyloid angiopathy, subacute sclerosing panencephalitis, myotonic
dystrophy, non-Guamanian motor neuron disease with neurofibrillary
tangles, postencephalitic parkinsonism, chronic traumatic
encephalopathy, and dementia pugulistica (boxing disease).
[0171] In some embodiments, subjects treated with the
oligonucleotide composition of the present disclosure will show a
reduction in the expression levels of one or more biomarkers
selected from among tau protein and MAPT mRNA, compared to
untreated subjects suffering from tauopathy such as AD and/or any
other tau-associated disorder.
[0172] The present disclosure provides a method for treating a
subject diagnosed as having or suspected as having tauopathy such
as AD and/or any other tau-associated disorder comprising
administering to the subject an effective amount of an
oligonucleotide composition of the present disclosure.
[0173] The oligonucleotides and compositions of the present
disclosure may be used in antisense therapy. For example, the
oligonucleotide may contain a nucleobase sequence that is
complementary or hybridizes to a target nucleic acid sequence of a
known DNA or RNA sequence implicated in AD such as at least a
portion of the MAPT gene.
[0174] Some embodiments include a method of modulating expression
of a target by contacting a target nucleic acid with an antisense
compound comprising the oligonucleotide of the present disclosure.
In some embodiments, the target nucleic acid is in a cell, for
example, in an animal such as a human.
[0175] Some embodiments, include a method of inhibiting expression
of an MAPT gene in an animal, comprising administering to the
animal an antisense compound comprising the oligonucleotide of the
present disclosure. The oligonucleotide may be complementary or
hybridize to a portion of the MAPT gene.
[0176] Some embodiments include a method for reducing tau mRNA
expression or levels of tau protein in a subject with AD comprising
administering a therapeutically effective amount of a
oligonucleotide or a composition of the present disclosure to the
subject in need thereof thereby reducing tau mRNA expression or
levels of tau protein in the subject. The oligonucleotide may be
complementary or hybridize to a portion of the target RNA involved
in the expression of tau mRNA such as MAPT mRNA.
[0177] The oligonucleotides and compositions of the present
disclosure may be used, e.g., to inhibit or reduce tau or MAPT gene
expression or inhibit transcription or translation of tau or MAPT
for treatment of a subject having AD or for reducing tau or MAPT
protein levels in a subject having or diagnosed with AD. In
embodiments, the disclosed chimeric oligonucleotides are used to
induce RNase H activity at a target gene such as the MAPT gene.
[0178] The present disclosure is also directed to methods of
stabilizing an oligonucleotide for delivery to a subject.
Stabilization of an oligonucleotide is characterized [quantified]
herein as increasing the melting point or temperature, T.sub.m, of
an oligonucleotide.
[0179] The disclosed oligonucleotide constructs may be administered
alone or in combination with one or more additional treatments for
the targeted ailment. The disclosed oligonucleotide constructs may
be administered alone or in combination with one or more additional
treatments for AD. In combination therapies, the oligonucleotide
constructs and one or more additional treatments for AD may be
administered simultaneously in the same or separate compositions,
or administered separately, at the same time or sequentially.
[0180] In some embodiments, the disclosed oligonucleotide
constructs are administered in combination with tau or MAPT
transcription or translation inhibitors or in regimens that combine
anti-AD oligonucleotide agents with tau or MAPT transcription or
translation inhibitors. In embodiments, the disclosed
oligonucleotide constructs are administered in combination with
standard of care treatment for tauopathies such as AD. Standard of
care treatment for tauopathies such as AD can include acetylcholine
esterase inhibitors, NMDA receptor modulators, BACE inhibitors,
protein aggregation inhibitors, anti-tau antibodies, anti-Abeta
antibodies, tau vaccination, Abeta vaccination and other known
treatments for tauopathies. In embodiments, the disclosed
oligonucleotide constructs are administered in combination with one
or more oligonucleotides after either simultaneous
(co-administration) or sequential dosing. Oligonucleotides can
include siRNA oligonucleotides, antisense oligonucleotides such as
Tau.sup.ASO-12 (Devos et al., Sci Transl Med. 2017 Jan. 25;
9(374)), miRNA mimics or inhibitors, aptamers, steric blockers,
saRNA, shRNA, and/or immunomodulatory oligonucleotides.
[0181] Some embodiments include inhibition of MAPT gene expression
in a cell or subject comprising contacting the cell with an
oligonucleotide or composition of the present disclosure, or
administering a therapeutically effective amount of a
oligonucleotide or composition of the present disclosure to a
subject in need thereof.
[0182] Some embodiments include the treatment of a disease or
disorder associated with the expression or activity of the MAPT
gene comprising administering a therapeutically effective amount of
an oligonucleotide or composition of the present disclosure to a
subject in need thereof.
[0183] Some embodiments include a method for reducing tau mRNA
expression or levels of tau protein of a tauopathy such as
Alzheimer's disease (AD) in a subject having a tauopathy comprising
administering a therapeutically effective amount of an
oligonucleotide or composition of the present disclosure to the
subject in need thereof thereby tau mRNA expression or levels of
tau protein in the subject.
[0184] Some embodiments include a method for reducing MAPT mRNA
expression or levels of MAPT protein of a tauopathy such as
Alzheimer's disease (AD) in a subject having a tauopathy comprising
administering a therapeutically effective amount of an
oligonucleotide or composition of the present disclosure to the
subject in need thereof thereby reducing MAPT mRNA expression or
levels of MAPT protein in the subject.
[0185] In one embodiment, an oligonucleotide or composition of the
present disclosure targeting MAPT is administered to a subject
having a tauopathy such as Alzheimer's disease and/or any
tauopathy-related disorder such that the expression of the MAPT
gene and/or tau protein level, e.g., in a cell, tissue, blood or
other tissue or fluid of the subject are reduced by at least about
25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%,
38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,
51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%,
64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%
or more, or values between two of these numbers, upon
administration to the subject of the oligonucleotide or composition
of the present disclosure. In some embodiments, the tau protein
levels are decreased by the previously recited amount. In some
embodiments the expression of one or more genes, including the MAPT
gene, are decreased by the previously recited amount.
[0186] Administration of the oligonucleotide or composition of the
present disclosure according to the methods and uses of the
disclosure may result in a reduction of the severity, signs,
symptoms, and/or markers of such diseases or disorders in a patient
with tauopathy such as Alzheimer's disease and/or any
tauopathy-related disorder. By "reduction" in this context is meant
a statistically significant decrease in such level. The reduction
can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or
about 100%, or values between two of these numbers.
[0187] The amount of an oligonucleotide or composition of the
present disclosure may be determined by a medical professional. The
daily dosage of the products may be varied over a wide range from
0.001 to 1,000 mg per adult human per day, or any range therein.
For IT or ICV administration, the compositions are preferably
provided in the form of suspensions containing, 0.01, 0.05, 0.1,
0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 150, 200, 250, and
500 milligrams of the active ingredient for the symptomatic
adjustment of the dosage to the patient to be treated. An effective
amount of the drug is ordinarily supplied at a dosage level of from
about 0.01 mg/kg to about 100 mg/kg of body weight per day, or any
range therein. Preferably, the range is from about 0.01 to about
50.0 mg/kg of body weight per day, or any range therein. More
preferably, from about 0.01 to about 10.0 mg/kg of body weight per
day, or any range therein. More preferably, from about 0.01 to
about 1.0 mg/kg of body weight per day, or any range therein. The
oligonucleotides may be administered on a regimen of 1 to 4 times
per day. For example, the oligonucleotides of the present
disclosure may be administered at one or more doses of from about
0.1 mg/kg to about 100 mg/kg. For example, the disclosed
oligonucleotides may be administered at a dose of about 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,
1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3,
3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4,
4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8,
5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2,
7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6,
8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10,
10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5,
17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23,
23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5,
30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or about 100
mg/kg. Values and ranges intermediate to the recited values are
also intended to be part of this disclosure. These values may apply
to intrathecal or intracerebroventricular delivery. Other forms of
delivery described herein may also be administered at these doses.
The dosages may be varied depending upon the requirement of the
patients, the severity of the condition being treated, and the
oligonucleotides being employed. The use of either daily
administration or post-periodic dosing may be employed.
[0188] The oligonucleotides of the present disclosure can be
administered by intrathecal or intracerebroventricular infusion
over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or about a 25
minute period. The administration may be repeated, for example, on
a regular basis, such as weekly, biweekly (i.e., every two weeks)
for one month, two months, three months, four months, or longer.
After an initial treatment regimen, the treatments can be
administered on a less frequent basis. For example, after
administration weekly or biweekly for three months, administration
can be repeated once per month, for six months or a year or
longer.
[0189] Efficacy of treatment or prevention of disease can be
assessed, for example by measuring disease progression, disease
remission, symptom severity, cognitive measures, reduction in pain,
quality of life, dose of a medication required to sustain a
treatment effect, level of a disease marker or any other measurable
parameter appropriate for a given disease being treated or targeted
for prevention. It is well within the ability of one skilled in the
art to monitor efficacy of treatment or prevention by measuring any
one of such parameters, or any combination of parameters. For
example, efficacy of treatment of a tauopathy such as AD may be
assessed, for example, by periodic monitoring of expression of the
MAPT gene and/or tau protein levels. Comparison of the later
readings with the initial readings provides an indication of
whether the treatment is effective.
4. Definitions
[0190] It is to be understood that the terminology used herein is
for the purpose of describing particular embodiments only and is
not intended to limit the scope of the present invention. The
following definitions shall apply unless otherwise indicated.
[0191] As used herein, the terms "complementary" or
"complementarity" as used herein with reference to polynucleotides
(i.e., a sequence of nucleotides such as an oligonucleotide or a
target nucleic acid) refer to the base-pairing rules. The
complement of a nucleic acid sequence as used herein refers to an
oligonucleotide which, when aligned with the nucleic acid sequence
such that the 5' end of one sequence is paired with the 3' end of
the other, is in "antiparallel association." For example, the
sequence "5'-A-G-T-3'" is complementary to the sequence
"3'-T-C-A-5." Certain bases not commonly found in naturally
occurring nucleic acids may be included in the nucleic acids
described herein. These include, for example, inosine,
7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic
Acids (PNA). Complementarity need not be perfect; stable duplexes
may contain mismatched base pairs, degenerative, or unmatched
bases. Those skilled in the art of nucleic acid technology can
determine duplex stability empirically considering a number of
variables including, for example, the length of the
oligonucleotide, base composition, and sequence of the
oligonucleotide, ionic strength, and incidence of mismatched base
pairs. A complement sequence can also be an RNA sequence
complementary to the DNA sequence or its complement and can also be
a cDNA.
[0192] As used herein, the term "hybridize" as used herein refers
to a process where two substantially complementary nucleic acid
strands (at least about 65% complementary over a stretch of at
least 14 to 25 nucleotides, at least about 75%, or at least about
90% complementary) anneal to each other under appropriately
stringent conditions to form a duplex or heteroduplex through
formation of hydrogen bonds between complementary base pairs.
Hybridizations are typically, and preferably, conducted with
probe-length nucleic acid molecules, preferably 15-100 nucleotides
in length, more preferably 18-50 nucleotides in length. Nucleic
acid hybridization techniques are well known in the art. See, e.g.,
Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual,
Second Edition, Cold Spring Harbor Press, Plainview, N.Y.
Hybridization and the strength of hybridization (i.e., the strength
of the association between the nucleic acids) is influenced by such
factors as the degree of complementarity between the nucleic acids,
stringency of the conditions involved, and the thermal melting
point (Tm) of the formed hybrid. Those skilled in the art
understand how to estimate and adjust the stringency of
hybridization conditions such that sequences having at least a
desired level of complementarity will stably hybridize, while those
having lower complementarity will not. For examples of
hybridization conditions and parameters, see, e.g., Sambrook, et
al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition,
Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al.
1994, Current Protocols in Molecular Biology, John Wiley &
Sons, Secaucus, N.J. In some embodiments, specific hybridization
occurs under stringent hybridization conditions. An oligonucleotide
or polynucleotide (e.g., a probe or a primer) that is specific for
a target nucleic acid will "hybridize" to the target nucleic acid
under suitable conditions.
[0193] As used herein, the term "stringent hybridization
conditions" as used herein refers to hybridization conditions at
least as stringent as the following: hybridization in 50%
formamide, 5.times.SSC, 50 mM NaH.sub.2PO.sub.4, pH 6.8, 0.5% SDS,
0.1 mg/mL sonicated salmon sperm DNA, and 5.times. Denhart's
solution at 42.degree. C. overnight; washing with 2.times.SSC, 0.1%
SDS at 45.degree. C.; and washing with 0.2.times.SSC, 0.1% SDS at
45.degree. C. In another example, stringent hybridization
conditions should not allow for hybridization of two nucleic acids,
which differ over a stretch of 20 contiguous nucleotides by more
than two bases.
[0194] As used herein, the term "substantially complementary" as
used herein means that two sequences hybridize under stringent
hybridization conditions. The skilled artisan will understand that
substantially complementary sequences need not hybridize along
their entire length. In particular, substantially complementary
sequences may comprise a contiguous sequence of bases that do not
hybridize to a target sequence, positioned 3' or 5' to a contiguous
sequence of bases that hybridize under stringent hybridization
conditions to a target sequence.
[0195] As used herein, the term "pharmaceutically acceptable"
refers to a material that is not biologically or otherwise
undesirable, i.e., the material may be incorporated into a
pharmaceutical composition administered to a patient without
causing any undesirable biological effects or interacting in a
deleterious manner with any of the other components of the
composition in which it is contained. When the term
"pharmaceutically acceptable" is used to refer to a pharmaceutical
carrier or excipient, it is implied that the carrier or excipient
has met the required standards of toxicological and manufacturing
testing or that it is included on the Inactive Ingredient Guide
prepared by the U.S. and Drug administration.
[0196] As used herein, the term "construct" or "constructs" of the
oligonucleotides can refer to an oligonucleotide of the present
disclosure and, e.g., (1) a conjugated moiety, such as those
described herein (such as targeting moieties) or (2) domains of
modified/unmodified nucleotides, such as in some chimeric
oligonucleotides.
[0197] As used herein, the term "chimeric oligonucleotide" refers
to an oligonucleotide having more than one domain, for example, as
exemplified by Formulae (VI) and (VII). The chimeric
oligonucleotide may include additional components, e.g., a
ligand-targeting group or additional nucleotides, linkers, etc.
[0198] As used herein, the term "modified nucleoside" refers to a
nucleoside having, independently, a modified sugar moiety and/or
modified nucleobase. It is understood that nucleosides can be
linked through intersubunit linkages, such as phosphodiester
intersubunit linkages, thiophosphate intersubunit linkages,
phosphoramidate intersubunit linkages, and thiophosphoramidate
intersubunit linkages "Modified nucleotides" may refer to a
nucleoside and intersubunit linkage together.
[0199] As used herein, the terms "unmodified" or "natural"
nucleobases include the purine bases adenine (A) and guanine (G),
and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
"Modified nucleobases" include other synthetic and natural
nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and
other alkyl derivatives of adenine and guanine, 2-propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil,
2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,
5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine and other
alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-am-oelhoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3,2,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified
nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and
2-pyridone.
[0200] In some embodiments, the modified nucleobase is selected
from the group consisting of 5-methylcytosine, 2,6-diaminopurine,
5-methyluracil, and a g-clamp. In some embodiments, the g-clamp
is
##STR00031##
[0201] As used herein, the terms "ligand targeting group" or
"targeting moiety" refers to a moiety that promotes delivery of the
oligonucleotide to cells implicated in tauopathies enhancing
cellular uptake or improving pharmacokinetics including
bioavailability of the oligonucleotide to its target sequence.
These groups include receptor targeting ligands that target the
receptors on cell surfaces.
[0202] As used herein, the term "conformationally restricted
nucleoside" refers to nucleosides having a bridged or bicyclic
sugar structure wherein the conformation of the nucleoside may be
fixed in a particular configuration. For example, conformationally
restricted nucleosides include those with fixed C.sub.3'-endo sugar
puckering. Exemplary embodiments include bridged nucleic acids
(BNAs), e.g., 2', 4'-BNA nucleosides such as .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') LNA, .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2')
LNA, Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') ENA,
2',4'-BNA.sup.NC[NH], 2',4'-BNA.sup.NC[NMe], 2',4'-BNA.sup.NC[NBn],
aminooxy (4'-CH2-O--N(R)-2') BNA, and oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA. Other exemplary BNA structures
include but are not limited to, oligonucleotides having at least
one bridge between the 4' and the 2' position of the sugar wherein
each of the bridges independently comprises 1 or from 2 to 4 linked
groups independently selected from --[C(R.sub.1)(R.sub.2)].sub.n--,
--C(R.sub.1).dbd.C(R.sub.2)--, --C(R.sub.1).dbd.N--,
--C(.dbd.NR.sub.1)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x-- and --N(R.sub.1)--;
wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.1 and
R.sub.2 is, independently, H, a protecting group, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12alkenyl, substituted C.sub.2-C.sub.12alkenyl,
C.sub.2-C.sub.12alkynyl, substituted C.sub.2-C.sub.12alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7alicyclic radical,
substituted C.sub.5-C.sub.7alicyclic radical, halogen, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12alkenyl,
substituted C.sub.2-C.sub.12alkenyl, C.sub.2-C.sub.12alkynyl,
substituted C.sub.2-C.sub.12alkynyl, C.sub.5-C.sub.20 aryl,
substituted C.sub.5-C.sub.2aryl, acyl (C(.dbd.O)--H), substituted
acyl, a heterocycle radical, a substituted heterocycle radical,
C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl or a protecting group. Certain BNAs have been prepared
and disclosed in the patent literature as well as in scientific
literature (see for example: issued U.S. Pat. Nos. 7,053,207;
6,268,490; 6,770,748; 6,794,499; 7,034,133; 6,525,191; 7,696,345;
7,569,575; 7,314,923; 7,217,805; and 7,084,125, hereby incorporated
by reference herein in their entirety. "Conformationally restricted
nucleotide" refers to conformationally restricted nucleosides
linked through an intersubunit linkage.
[0203] In some embodiments, the conformationally restricted
nucleoside is selected from optionally substituted LNA or
optionally substituted ENA. The optionally substituted LNA or ENA
may be substituted by an alkyl moiety, for example a methyl or
ethyl on one of the --CH.sub.2-- moieties.
[0204] As used herein, the term "expression" refers to the
biosynthesis of a gene product. The term encompasses the
transcription of a gene into RNA. The term also encompasses
transcription of RNA into one or more polypeptides, and further
encompasses all naturally occurring post-transcriptional and
post-translational modifications. The oligonucleotides of the
present disclosure can be within the cytoplasm of a host cell, into
the extracellular milieu such as the growth medium of a cell
culture or anchored to the cell membrane.
[0205] As used herein, the term "inhibiting expression" refers to a
reduction or blockade of the expression or activity and does not
necessarily indicate a total elimination of expression or
activity.
[0206] As used herein, the term "reducing protein levels" refers to
reduction or blockade of transcription of mRNA to form a protein
encoded by the mRNA and does not necessarily indicate a total
elimination of transcription of mRNA or the protein.
[0207] As used herein, the term "subject" refers to mammals and
includes humans and non-human mammals. In some embodiments, the
subject is a human, such as an adult human.
[0208] As used herein, the term "tau" or "tau protein" refers to an
abundant central and peripheral nervous system protein having
multiple isoforms. In the human central nervous system (CNS), six
major tau isoforms ranging in size from 352 to 441 amino acids in
length exist due to alternative splicing (Hanger et al., Trends Mol
Med. 15:112-9, 2009). The isoforms differ from each other by the
regulated inclusion of 0-2 N-terminal inserts, and 3 or 4 tandemly
arranged microtubule-binding repeats and are referred to as 0N3R,
1N3R, 2N3R, 0N4R, 1N4R and 2N4R. As used herein, the term "control
tau" refers to the tau isoform that is devoid of phosphorylation
and other post-translational modifications. As used herein, the
term "tau" includes proteins comprising mutations, e.g., point
mutations, fragments, insertions, deletions and splice variants of
full length wild type tau. The term "tau" also encompasses
post-translational modifications of the tau amino acid sequence.
Post-translational modifications include, but are not limited to,
phosphorylation. Tau binds microtubules and regulates transport of
cargo through cells, a process that can be modulated by tau
phosphorylation. In AD and related disorders, abnormal
phosphorylation of tau is prevalent and thought to precede and/or
trigger aggregation of tau into fibrils, termed paired helical
filaments (PHF). The major constituent of PHF is
hyper-phosphorylated tau. As used herein, the term "paired helical
filament-tau" or "PHF-tau" refers to tau aggregates in paired
helical filaments. Two major regions in PHF structure are evident
in electron microscopy, the fuzzy coat and the core filament; the
fuzzy coat being sensitive to proteolysis and located outside of
the filaments, and the protease-resistant core of filaments forming
the backbone of PHFs (Wischik et al. Proc Natl Acad Sci USA.
85:4884-8, 1988).
[0209] As used herein a "tauopathy" encompasses any
neurodegenerative disease that involves the pathological
aggregation of tau within the brain. In addition to familial and
sporadic AD, other exemplary tauopathies are frontotemporal
dementia with parkinsonism linked to chromosome 17 (FTDP-17),
progressive supranuclear palsy, corticobasal degeneration, Pick's
disease, progressive subcortical gliosis, tangle only dementia,
diffuse neurofibrillary tangles with calcification, argyrophilic
grain dementia, amyotrophic lateral sclerosis parkinsonism-dementia
complex, Down syndrome, Gerstmann-Straussler-Scheinker disease,
Hallervorden-Spatz disease, inclusion body myositis,
Creutzfeld-Jakob disease, multiple system atrophy, Niemann-Pick
disease type C, prion protein cerebral amyloid angiopathy, subacute
sclerosing panencephalitis, myotonic dystrophy, non-Guamanian motor
neuron disease with neurofibrillary tangles, postencephalitic
parkinsonism, and chronic traumatic encephalopathy, such as
dementia pugulistica (boxing disease) (Morris et al., Neuron,
70:410-26, 2011).
[0210] As used herein, the terms "treat," "treating," and
"treatment" are all intended to refer to an amelioration or
reversal of at least one measurable physical parameter related to a
tauopathy which is not necessarily discernible in the subject, but
can be discernible in the subject. The terms "treat," "treating,"
and "treatment," can also refer to causing regression, preventing
the progression, or at least slowing down the progression of the
disease, disorder, or condition. In a particular embodiment,
"treat," "treating," and "treatment" refer to an alleviation,
prevention of the development or onset, or reduction in the
duration of one or more symptoms associated with the tauopathy. In
a particular embodiment, "treat," "treating," and "treatment" refer
to prevention of the recurrence of the disease, disorder, or
condition. In a particular embodiment, "treat," "treating," and
"treatment" refer to an increase in the survival of a subject
having the disease, disorder, or condition. In a particular
embodiment, "treat," "treating," and "treatment" refer to
elimination of the disease, disorder, or condition in the
subject.
[0211] As used herein, the term "therapeutically effective amount"
refers to an amount of an active ingredient or component that
elicits the desired biological or medicinal response in a subject.
A therapeutically effective amount can be determined empirically
and in a routine manner, in relation to the stated purpose. For
example, in vitro assays can optionally be employed to help
identify optimal dosage ranges. Selection of a particular effective
dose can be determined (e.g., via clinical trials) by those skilled
in the art based upon the consideration of several factors,
including the disease to be treated or prevented, the symptoms
involved, the patient's body mass, the patient's immune status and
other factors known by the skilled artisan. The precise dose to be
employed in the formulation will also depend on the route of
administration, and the severity of disease, and should be decided
according to the judgment of the practitioner and each patient's
circumstances. Effective doses can be extrapolated from
dose-response curves derived from in vitro or animal model test
systems.
[0212] As used herein, the term, "pharmaceutically acceptable salt"
means physiologically and pharmaceutically acceptable salts of the
compounds of the present disclosure, i.e., salts that retain the
desired biological activity of the parent oligonucleotide/compound
and do not impart undesired toxicological effects thereto.
[0213] The following abbreviations are used in this disclosure.
2'-H (deoxyribose) nucleosides are referred to by an uppercase
letter corresponding to the nucleobase, e.g., A, C, G, and T. 2'-OH
(ribose) nucleosides are referred to by a lowercase r and an
uppercase letter corresponding to the nucleobase, e.g., rA, rC, rG,
and rU. 2'-O-Me nucleosides are referred to by a lowercase m and an
uppercase letter corresponding to the nucleobase, e.g., mA, mC, mG
and mU. 2'-MOE nucleosides are referred to by a lowercase "moe" and
an uppercase letter corresponding to the nucleobase, e.g., moeA,
moeC, moeG and moeU. 2'-ribo-F nucleosides are referred to by a
lowercase "f" and an uppercase letter corresponding to the
nucleobase, e.g., fA, fC, fG and fU. 2'-arabino-F nucleosides are
referred to by a lowercase "af" and an uppercase letter
corresponding to the nucleobase, e.g., afA, afC, afG and afU. mA*
is 3'-amino-2'-OMe-2,6-Diaminopurine. A* is
3'-amino-2'-deoxy-2,6-Diaminopurine. fA* is
3'-amino-2'-F-2,6-Diaminopurine. LNA nucleosides are referred to by
an "L" and an uppercase letter corresponding to the nucleobase,
e.g., LA, LC, LG, LT.
[0214] For the backbone or intersubunit linkages of the
nucleotides, phosphodiester intersubunit linkages are referred to
as "PO" or are generally not included in sequence details;
thiophosphate intersubunit linkages are abbreviated as lowercase
"ps"; phosphoramidate intersubunit linkages are abbreviated as
lowercase "np"; and thiophosphoramidate intersubunit linkages are
abbreviated as lowercase "nps."
[0215] N3'.fwdarw.P5' refers to modified nucleotides having
intersubunit linkages where the 3' moiety contains N (e.g., NH) and
is linked through a P. For example, the following structure has a
N3'.fwdarw.P5' linkage:
##STR00032##
[0216] It is noted that, as used herein and in the appended claims,
the singular forms "a", "an", and "the" include plural referents
unless the context clearly dictates otherwise. It is further noted
that the claims may be drafted to exclude any optional element. As
such, this statement is intended to serve as antecedent basis for
use of such exclusive terminology as "solely", "only" and the like
in connection with the recitation of claim elements or use of a
"negative" limitation.
[0217] The term "about" will be understood by persons of ordinary
skill in the art and will vary to some extent depending upon the
context in which it is used. If there are uses of the term which
are not clear to persons of ordinary skill in the art given the
context in which it is used, "about" will mean up to plus or minus
10% of the particular term. Certain ranges are presented herein
with numerical values being preceded by the term "about". The term
"about" is used herein to provide literal support for the exact
number that it precedes, as well as a number that is near to or
approximately the number that the term precedes. In determining
whether a number is near to or approximately a specifically recited
number, the near or approximating unrecited number may be a number,
which, in the context in which it is presented, provides the
substantial equivalent of the specifically recited number.
[0218] It is also to be appreciated that the various modes of
treatment or prevention of the diseases or conditions described
herein are intended to mean "substantial," which includes total but
also less than total treatment or prevention, and wherein some
biologically or medically relevant result is achieved. The
treatment may be a continuous prolonged treatment for a chronic
disease or a single, or few time administrations for the treatment
of an acute condition.
[0219] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0220] This disclosure is not limited to particular embodiments
described, as such may vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular
embodiments only, and is not intended to be limiting, since the
scope of the present invention will be limited only by the appended
claims.
[0221] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention. Any recited
method can be carried out in the order of events recited or in any
other order that is logically possible.
[0222] All publications and patents cited in this specification are
herein incorporated by reference as if each individual publication
or patent were specifically and individually indicated to be
incorporated by reference and are incorporated herein by reference
to disclose and describe the methods and/or materials in connection
with which the publications are cited. The citation of any
publication is for its disclosure prior to the filing date and
should not be construed as an admission that the present invention
is not entitled to antedate such publication by virtue of prior
invention. Further, the dates of publication provided may be
different from the actual publication dates that may need to be
independently confirmed.
5. Examples
[0223] The following examples illustrate certain embodiments of the
present disclosure to aid the skilled person in practicing the
disclosure. Accordingly, the examples are in no way considered to
limit the scope of the disclosure.
[0224] Methods of Making
[0225] All the monomers were dried in vacuum desiccator with
desiccants (KOH and P.sub.2O.sub.5, RT 24 h). Synthesis solid
supports (CPG) attached to the first 5' residue were obtained from
commercially available sources. All other synthesis reagents and
solvents were obtained from commercially available sources and used
as such. The chemicals and solvents for post synthesis workflow
were purchased from commercially available sources and used without
any purification or treatment. Solvent (Acetonitrile) and solutions
(amidite and activator) were stored over molecular sieves during
synthesis.
[0226] The antisense oligonucleotides were synthesized on an
ABI-394 synthesizer using the standard 93-step cycle written by the
manufacturer. The solid support was controlled pore glass and the
monomers contained standard protecting groups. Each oligonucleotide
was individually synthesized using commercially available
5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl-N,N-diisopropyl) DNA
and or 2'-O-Me phosphoramidite monomers of 6-N-benzoyladenosine
(A.sup.Bz), 4-N-acetylcytidine (C.sup.Ac), 2-N-isobutyrylguanosine
(G.sup.iBu), and Thymidine (T), according to standard solid phase
oligonucleotide synthesis protocols. The phosphoramidites were
purchased from commercially available sources. The
2'-O-Me-2,6,diaminopurine phosphoramidite was purchased from
commercially available sources. The DDTT
((dimethylamino-methylidene) amino)-3H-1,2,4-dithiazaoline-3-thione
was used as the sulfur-transfer agent for the synthesis of
oligoribonucleotide phosphorothioates. Modified oligonucleotides
were obtained using an extended coupling of 0.1M solution of
phosphoramidite in CH.sub.3CN in the presence of
5-(ethylthio)-1H-tetrazole activator to a solid bound
oligonucleotide followed by standard capping, oxidation and
deprotection. The stepwise coupling efficiency of all modified
phosphoramidites was more than 98%. Oligonucleotide-bearing solid
supports were heated with aqueous ammonia/ethanol (3:1) solution at
55.degree. C. for 8 h to deprotect the base labile protecting
groups.
[0227] Tocopherol conjugated oligonucleotides may be obtained by
starting solid phase synthesis on tocopherol support attach on TEG
linker and final coupling of the phosphoramidite to the
support-bound oligonucleotide. The tocopherol conjugated sequences
may be purified by high-performance liquid chromatography (HPLC) on
an in-house packed RPC-Source15 reverse-phase column. The buffers
may be 20 mM NaOAc in 10% CH.sub.3CN (buffer A) and 20 mM NaOAc in
70% CH.sub.3CN (buffer B). Analytical HPLC and ES LC-MS establishes
the integrity of the oligonucleotides.
##STR00033##
[0228] Synthesis of Phosphoramidate (NP) and Thiophosphoramidate
(NPS) Modified Oligonucleotides
[0229] The NP and NPS modified oligonucleotides were synthesized on
an ABI-394 synthesizer using the 93-step cycle written with
modifications to deblock, coupling and wait steps. The solid
support was 3'-NHTr-5'-LCAA-CPG. Each oligonucleotide was
individually synthesized using
3'-NH-Tr-5'-O-(2-cyanoethyl-N,N-diisopropyl) DNA phosphoramidite
monomers of 6-N-benzoyladenosine (A.sup.Bz, 4-N-Benzylcytidine
(C.sup.Bz), 2-N-isobutyrylguanosine (G.sup.iBu), and Thymidine (T),
according to standard solid phase phosphoramidite chemistry
protocols by using the procedure described in Nucleic Acids
Research, 1995, Vol. 23, No. 14 2661-2668.
##STR00034##
3'-NHTr-DNA Building Blocks for Oligomer Synthesis
[0230] The 2'-F 3'-NH-MMTr-5'-O-(2-cyanoethyl-N,N-diisopropyl)
Uridine (U) and 4-N-benzoylcytidine (C.sup.Bz) phosphoramidite
monomers) were synthesized by using the procedure described in
Nucleic Acids Research, 1996, Vol. 24, No. 15, 2966-2973
##STR00035##
[0231] 2'-F 3'-NH-MMTr-5'-O-(2-cyanoethyl-N,N-diisopropyl)
6-N-benzoyladenosine (A.sup.Bz), 2-N-isobutyrylguanosine
(G.sup.iBu) were synthesized as the procedure described below
##STR00036## ##STR00037##
Preparation of PH-1
##STR00038##
[0233] To a solution of
(2R,3S,4S,5R)-2-(6-amino-9H-purin-9-yl)-5-(hydroxymethyl)oxolane-3,4-diol
(300 g, 1.123 mol, 1.00 equiv) in N,N-dimethylformamide (7500 mL)
with an inert atmosphere of nitrogen, was added triphenylphosphine
(735 g, 2.802 mol, 2.50 equiv). The resulting solution was stirred
for 15 min at 0.degree. C. This was followed by the addition of a
solution of diethyl azodicarboxylate (449.4 g, 2.581 mol, 2.54
equiv.) in N, N-dimethylformamide (7500 mL) dropwise with stirring
at 0.degree. C. in 60 min. The resulting solution was stirring, for
2 h at 25.degree. C. The resulting mixture was concentrated under
reduced pressure. The product was precipitated by the addition of
ether. The solids were collected by filtration. The crude product
was purified by re-crystallization from methanol. The solid was
dried in an oven under reduced pressure. This resulted in 186 g
(66%) of PH-1 as a white solid. 1H-NMR (DMSO-d.sub.6, 400 MHz):
8.34-8.07 (m, 2H), 7.44-7.26 (m, 2H), 6.30-6.21 (m, 1H), 5.07-4.95
(m, 1H), 4.33-4.20 (m, 1H), 4.15-4.03 (m, 2H), 3.71-3.50 (m,
2H).
Preparation of PH-2
##STR00039##
[0235] To a solution of PH-1 (100 g, 401.2 mmol, 1.00 equiv.) in
pyridine (1000 mL) with an inert atmosphere of nitrogen, was added
benzoyl chloride (175 g, 1.245 mol, 3.10 equiv.) dropwise with
stirring at 0.degree. C. in 30 min. The resulting solution was
stirred for 3 h at 25.degree. C. The resulting solution was diluted
with 400 mL of ethyl acetate. The resulting mixture was washed with
3.times.300 mL of water and 2.times.300 mL of saturated sodium
bicarbonate solution respectively. The resulting mixture was washed
with 1.times.300 mL of saturated sodium chloride solution. The
mixture was dried over anhydrous sodium sulfate, filtered, and
concentrated under reduced pressure. The residue was applied onto a
silica gel column with ethyl acetate/petroleum ether (2/1). This
resulted in 157 g (70%) of PH-2 as a white solid.
Preparation of PH-3
##STR00040##
[0237] To a solution of PH-2 (30 g, 53.42 mmol, 1.00 equiv) in
N,N-dimethylformamide (300 mL) with an inert atmosphere of
nitrogen, was added ammonium chloride (5.7 g, 106.56 mmol, 2.00
equiv) and sodium azide (34.8 g, 535.30 mmol, 10.00 equiv) in
order. The resulting solution was stirred for 5 h at 50.degree. C.
The resulting solution was diluted with 2000 mL of dichloromethane.
The resulting mixture was washed with 3.times.2000 mL of water,
1.times.2000 mL of saturated sodium bicarbonate solution and
1.times.2000 mL of saturated sodium chloride solution respectively.
The mixture was dried over anhydrous sodium sulfate, filtered, and
concentrated under reduced pressure. This resulted in 24 g (90%) of
PH-3 and PH-3S (5:1) as a white solid.
Preparation of PH-4
##STR00041##
[0239] To a solution of PH-3 and PH-3S (5:1) (10 g, 19.98 mmol,
1.00 equiv) in tetrahydrofuran (100 mL) with an inert atmosphere of
nitrogen, was added 1, 8-Diazabicyclo [5.4.0] undec-7-ene (10.69 g,
70.22 mmol, 3.50 equiv). This was followed by the addition of
perfluorobutylsulfonyl fluoride (12.69 g, 2.10 equiv) dropwise with
stirring at 0.degree. C. in 10 min. The resulting solution was
stirred for 1.5 h at 0.degree. C. The resulting solution was
diluted with 200 mL of dichloromethane. The resulting mixture was
washed with 3.times.200 mL of water, 1.times.200 mL of saturated
sodium bicarbonate solution and 1.times.200 mL of saturated sodium
chloride solution respectively. The mixture was dried over
anhydrous sodium sulfate, filtered, and concentrated under reduced
pressure. The crude product was re-crystallized from ethyl
acetate/petroleum ether in the ratio of 1:1. This resulted in 6 g
(60%) of PH-4 and PH-4S (5:1) as a white solid. MS m/z [M+H]+
(ESI): 503.
Preparation of PH-5
##STR00042##
[0241] To a solution of PH-4 and PH-4S (5:1) (10 g, 19.90 mmol,
1.00 equiv) in tetrahydrofuran (150 mL), was added 10% palladium
carbon (3.0 g). The flask was evacuated and flushed three times
with nitrogen, followed by flushing with hydrogen. The resulting
solution was stirred for 1 h at room temperature. The solids were
filtered out. The resulting mixture was concentrated under reduced
pressure. The crude product (10 g) was purified by Flash-Prep-HPLC
with the following conditions (IntelFlash-1): Column, C18; mobile
phase, waters and acetonitrile (30% acetonitrile up to 50% in 30
min); Detector, UV 254 nm. This resulted in 7 g (74%) of PH-5 as a
white solid and 1.0 g of PH-SS as a white solid. MS m/z [M+H]+
(ESI): 477.
Preparation of PH-6
##STR00043##
[0243] To a solution of PH-5 (4 g, 8.40 mmol, 1.00 equiv) in
pyridine (40 mL) with an inert atmosphere of nitrogen, was added
4-dimethylaminopyridine (1.5 g, 12.28 mmol, 1.50 equiv) and
4-methoxytriphenylmethyl chloride (10.3 g, 4.00 equiv) in order.
The resulting solution was stirred for 16 h at 25.degree. C. The
resulting solution was diluted with 300 mL of dichloromethane. The
resulting mixture was washed with 1.times.300 mL of water and
3.times.300 mL of saturated sodium bicarbonate solution. The
resulting mixture was washed with 1.times.300 mL of saturated
sodium chloride solution respectively. The mixture was dried over
anhydrous sodium sulfate, filtered, and concentrated under reduced
pressure. The residue was applied onto a silica gel column with
dichloromethane/methanol (100/1). This resulted in 5.7 g (91%) of
PH-6 as a white solid.
Preparation of PH-7
##STR00044##
[0245] To a solution of PH-6 (5 g, 6.68 mmol, 1.00 equiv) in
pyridine/methanol/water (32.2/14.7/2.4 mL), was added sodium
hydroxide (2 mol/L) (7.2 mL, 1.10 equiv) dropwise with stirring at
0.degree. C. in 5 min. The resulting solution was stirred for 20
min at 0.degree. C. The reaction was then quenched by the addition
of 200 mL of ice water. The resulting solution was extracted with
400 mL of dichloromethane and the organic layers combined. The
resulting mixture was washed with 1.times.300 mL of water and
1.times.300 mL of saturated sodium chloride solution. The mixture
was dried over anhydrous sodium sulfate, filtered, and concentrated
under reduced pressure. The residue was applied onto a silica gel
column with methanol/dichloromethane (1:100). This resulted in 4.3
g (100%) of PH-7 as a white solid. MS m/z [M+H]+ (ESI): 645.
Preparation of PH-8
##STR00045##
[0247] To a solution of PH-7 (19.4 g, 35.89 mmol, 1.00 equiv) in
dichloromethane (200 mL) with an inert atmosphere of nitrogen, was
added 3-([bis [bis (propan-2-yl) amino] phosphanyl] oxy)
propanenitrile (11.79 g, 39.12 mmol, 1.30 equiv). This was followed
by the addition of 4, 5-Dicyanoimidazole (4.26 g, 1.20 equiv) at
0.degree. C. The resulting solution was stirred for 30 min at room
temperature. The resulting solution was diluted with 1000 mL of
dichloromethane. The resulting mixture was washed with 3.times.800
mL of saturated sodium bicarbonate solution and 1.times.800 mL of
sodium chloride solution respectively. The mixture was dried over
anhydrous sodium sulfate, filtered, and concentrated under reduced
pressure. The crude product was purified by Flash-Prep-HPLC with
the following conditions: Column, C18; mobile phase, waters and
acetonitrile (40% acetonitrile up to 80% in 6 min); Detector, UV
254 nm. This resulted in 15.2 g (50%) of PH-8 as a white solid. MS
m/z [M+H]+ (ESI): 845.
##STR00046## ##STR00047## ##STR00048##
Preparation of PH-11
##STR00049##
[0249] To a solution of
2-amino-9-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-6,9--
dihydro-1H-purin-6-one (700 g, 2.47 mol, 1.00 equiv) in
N,N-dimethylformamide (7 L) with an inert atmosphere of nitrogen,
was added imidazole (504 g, 7.41 mol, 3.00 equiv). This was
followed by the addition of 1, 3-Dichloro-1, 1, 3,
3-tetraisopropyldisiloxane (770 g, 2.44 mol, 1.00 equiv) dropwise
with stirring at 20.degree. C. The resulting solution was stirred
for 16 h at 20.degree. C. The reaction solution was then poured
into 70 L of water/ice. The solids were collected by filtration.
This resulted in 1200 g (92%) of PH-11 as a white solid. MS m/z
[M+H]+ (ESI): 526.
Preparation of PH-12
##STR00050##
[0251] To a solution of PH-11 (530 g, 1.01 mol, 1.00 equiv) in
dichloromethane (5000 mL) with an inert atmosphere of nitrogen, was
added pyridine (725 g, 9.17 mol, 9.00 equiv) and
4-dimethylaminopyridine (147 g, 1.20 mol, 1.20 equiv) in order.
This was followed by the addition of trifluoromethanesulfonic
anhydride (426 g, 1.51 mol, 1.20 equiv) dropwise with stirring at
0.degree. C. The resulting solution was stirred for 15 min at
0.degree. C. Then the resulting solution was allowed to react with
stirring, for an additional 2 h at 20.degree. C. The resulting
solution was diluted with 5000 mL of dichloromethane. The resulting
solution was washed with 2.times.3000 mL of saturated sodium
bicarbonate and 1.times.3000 mL of saturated sodium chloride
respectively. The solution was dried over anhydrous sodium sulfate,
filtered, and concentrated under reduced pressure. This resulted in
600 g (90%) of PH-12 as a brown solid.
The product was used in the next step directly without further
purification.
Preparation of PH-13
##STR00051##
[0253] To a solution of PH-12 (200 g, 304.04 mmol, 1.00 equiv) in
N,N-dimethylformamide (1000 mL) with an inert atmosphere of argon,
was added sodium nitrite (115 g, 1.67 mol, 5.00 equiv). The
resulting mixture was stirred for 16 h at 25.degree. C. The
resulting solution was poured into 5000 ml water/ice. The solids
were collected by filtration. The crude product was re-crystallized
from dichloromethane/acetonitrile in the ratio of 1/4 (50 mUg).
This resulted in 78 g (49% over last two steps) of PH-13 as a
solid. MS m/z [M+H]+ (ESI): 526.
Preparation of PH-14
##STR00052##
[0255] To a solution of PH-13 (50 g, 95.10 mmol, 1.00 equiv) in
tetrahydrofuran (500 mL) with an inert atmosphere of nitrogen, was
added tetrabutylammonium fluoride (95 mL, 1.00 equiv, 1N in
tetrahydrofuran). The resulting mixture was stirred for 12 h at
20.degree. C. The resulting mixture was concentrated under reduced
pressure. The crude was re-crystallized from methanol/ethyl acetate
in the ratio of 1/5 (20 mg) three times. The solids were collected
by filtration, and then purified by Flash with the following
conditions: Column, C18 silica gel; mobile phase, waters and
acetonitrile (2% acetonitrile up to 10% in 10 min); Detector, UV
254 nm. This resulted in 16 g (59%) of PH-14 as a brown solid.
1H-NMR (DMSO-d.sub.6, 400 MHz): 10.44 (s, 1H), 6.49 (s, 2H), 6.02
(s, 1H), 5.55-5.65 (m, 2H), 5.10 (s, 1H), 4.08 (m, 2H), 3.76 (m,
1H), 3.64 (m, 1H).
Preparation of PH-15
##STR00053##
[0257] To solution of PH-14 (220 g, 776.72 mmol, 1.00 equiv) in
N,N-dimethylformamide (2000 mL) with an inert atmosphere of argon,
was added triphenylphosphine (509 g, 1.94 mol, 2.50 equiv). The
resulting solution was stirred for 1.5 h at 0.degree. C. To this
was added diethyl azodicarboxylate (338 g, 1.94 mol, 2.50 equiv)
dropwise with stirring at 0.degree. C. The resulting solution was
stirred for 2 h at room temperature. The resulting mixture was
poured into 20 L cold ethyl ether. The solids were collected by
filtration, then re-crystallized from methanol/ethyl acetate in the
ratio of 1/10 (10 mUg). This resulted in 100 g (49%) of PH-15 as a
brown solid. MS m/z [M+H]+ (ESI): 266.
Preparation of PH-16
##STR00054##
[0259] To a solution of PH-15 (100 g, 377.0 mmol, 1.00 equiv) in
N,N-dimethylformamide (1000 mL) with an inert atmosphere of
nitrogen, was added imidazole (77 g, 1.131 mol, 3.00 equiv). This
was followed by the addition of tert-butyldimethylsilyl chloride
(142 g, 942 mmol, 1.50 equiv.) dropwise with stirring at 0.degree.
C. The resulting solution was stirred for 2 h at room temperature.
The reaction was then quenched by the addition of methanol. The
resulting mixture was concentrated under reduced pressure. The
residue was applied onto a silica gel column with
dichloromethane/methanol (100:1.about.15:1). This resulted in 80 g
(85%) of PH-16 as a solid. MS m/z [M+H]+ (ESI): 380.
Preparation of PH-17
##STR00055##
[0261] To a solution of PH-16 (73 g, 192.37 mmol, 1.00 equiv) in
pyridine (730 mL) with an inert atmosphere of nitrogen, was added
4-dimethylaminopyridine (23.5 g, 192.35 mmol, 0.50 equiv). This was
followed by the addition of isobutyric anhydride (213 g, 1.35 mol,
5.00 equiv) dropwise with stirring. The resulting solution was
stirred for 3 h at 50.degree. C. The reaction was then quenched by
the addition of ice water. The resulting solution was extracted
with 3.times.2000 mL of dichloromethane and the organic layers
combined. The resulting mixture was washed with 3.times.2000 mL of
saturated sodium bicarbonate, 3.times.2000 mL of water and
3.times.2000 mL of saturated sodium chloride respectively. The
organic layers were dried over anhydrous sodium sulfate, filtered,
and concentrated under reduced pressure. The residue was applied
onto a silica gel column with dichloromethane/methanol
(100:1.about.20:1). This resulted in 52 g (60%) of PH-17 as a
yellow solid. MS m/z [M+H]+ (ESI): 450.
Preparation of PH-18
##STR00056##
[0263] To a solution of PH-17 (20 g, 44.4 mmol, 1.00 equiv) in N,
N-dimethylformamide (100 mL) with an inert atmosphere of nitrogen
was added sodium azide (18 g, 267 mmol, 6.00 equiv). The resulting
solution was stirred for 2 h at 80.degree. C. The resulting mixture
was diluted with 1000 mL of dichloromethane. The resulting solution
was washed with 3.times.1000 mL of saturated sodium bicarbonate,
3.times.1000 mL of water and 3.times.1000 mL of saturated sodium
chloride respectively. The solution was dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
applied onto a silica gel column with dichloromethane/methanol
(100/1.about.40/1). This resulted in 11 g (50%) of PH-18/PH-18S
(5.2:1) as a yellow solid. MS m/z [M+H]+ (ESI): 493
Preparation of PH-19
##STR00057##
[0265] To a solution of PH-18/PH-18S (5.2:1) (16 g, 37.87 mmol,
1.00 equiv) in dichloromethane (160 mL), was added pyridine (23 g,
290.77 mmol, 9.00 equiv) and dimethylaminopyridine (4.35 g, 35.66
mmol, 1.20 equiv). This was followed by the addition of 1, 3-bis
(trifluoromethylsulfonyl)trioxidane (11.9 g, 37.88 mmol, 1.20
equiv) dropwise with stirring at 0.degree. C. The resulting
solution was stirred for 2 h at 20.degree. C. The reaction was
quenched by the addition of water/ice. The resulting mixture was
extracted with 2.times.1000 mL of dichloromethane and the organic
layers combined. The resulting solution was washed with
1.times.1000 mL of saturated sodium chloride. The resulting
solution was concentrated under reduced pressure. This resulted in
16 g (68%) of PH-19/PH-19S as a brown solid. The product was used
in the next step directly without further purification.
Preparation of PH-20
##STR00058##
[0267] To a solution of PH-19/PH-19S (16 g, 25.61 mmol, 1.00 equiv)
in tetrahydrofuran (160 mL) with an inert atmosphere of argon, was
added tetrabutylammonium fluoride (100 mL, 5.00 equiv) dropwise
with stirring at 0.degree. C. The resulting solution was stirred
for 5 h at room temperature. The resulting solution was diluted
with 1000 mL of dichloromethane. The resulting solution was washed
with 1.times.500 mL of water and 1.times.500 mL of saturated sodium
chloride respectively. The resulting solution was concentrated
under reduced pressure. The residue was applied onto a silica gel
column with dichloromethane/methanol (100/1.about.20/1). This
resulted in 8 g (85%) of PH-20/PH-20S (7:1) a yellow solid. MS m/z
[M+H]+ (ESI): 381.
Preparation of PH-21
##STR00059##
[0269] To a solution of PH-20/PH-20S (3.4 g, 8.94 mmol, 1.00 equiv)
in methanol (50 mL) was added 10% palladium carbon (1.7 g). The
flask was evacuated and flushed three times with nitrogen, followed
by flushing with hydrogen. The resulting solution was stirred for 1
h at room temperature. The resulting solution was diluted with 100
mL of methanol. The solids were filtered out. The resulting
solution was concentrated under reduced pressure. The crude product
was purified by Flash-Prep-HPLC with the following conditions:
Column, C18 silica gel; mobile phase, waters and acetonitrile (5%
acetonitrile up to 50% in 35 min); Detector, UV 254 nm. This
resulted in 1.7 g (54%) of PH-21 as a white solid. 1H-NMR
(DMSO-d.sub.6, 400 MHz): 12.13 (s, 1H), 11.91 (s, 1H), 8.91 (s,
2H), 8.23 (s, 2H), 7.25 (m, 1H), 5.78 (m, 1H), 4.62-3.72 (m, 4H),
2.92 (m, 1H), 1.13 (s, 6H).
Preparation of PH-22
##STR00060##
[0271] To a solution of PH-21 (6.0 g, 16.95 mmol, 1.00 equiv) in
pyridine/N,N-diisopropylethylamine (100/20 mL) with an inert
atmosphere of argon, was added
1-(chlorodiphenylmethyl)-4-methoxybenzene (6.24 g, 20.34 mmol, 1.20
equiv). The resulting solution was stirred for 16 h at room
temperature. The resulting solution was diluted with 1000 ml of
dichloromethane. The resulting solution was washed with 1.times.250
mL of saturated sodium bicarbonate, 1.times.250 ml of water and
1.times.250 mL of saturated sodium chloride respectively. The
residue was applied onto a silica gel column with
dichloromethane/methanol (100/1.about.50/1). This resulted in 13 g
(74%) of PH-22 as a white solid. 1H-NMR (DMSO-d.sub.6, 400 MHz):
12.15 (s, 1H), 11.70 (s, 1H), 8.14 (s, 1H), 7.49 (m, 4H), 7.24 (m,
6H), 7.15 (m, 2H), 6.72 (m, 2H), 5.82 (m, 1H), 5.30 (m, 1H), 4.04
(m, 3H), 3.62 (s, 3H), 3.45 (m, 1H), 2.83-2.62 (m, 3H), 1.10 (m,
6H).
Preparation of PH-23
##STR00061##
[0273] To a solution of PH-22 (7.8 g, 12.45 mmol, 1.00 equiv.) in
dichloromethane (80 mL) with an inert atmosphere of argon, was
added 3-(bis[bis(propan-2-yl)amino]phosphanyloxy)propanenitrile
(7.5 g, 24.92 mmol, 2.00 equiv.) and 4,5-dicyanoimidazole (2.2 g,
18.63 mmol, 1.50 equiv.) in order. The resulting solution was
stirred for 2 h at room temperature. The resulting mixture was
diluted with 1000 mL of dichloromethane. The resulting solution was
washed with 3.times.250 mL of saturated sodium bicarbonate,
3.times.250 mL of water and 3.times.250 mL of saturated sodium
chloride respectively. The resulting solution was concentrated
under reduced pressure. The crude product was purified by
Flash-Prep-HPLC with the following conditions: Column, C18 silica
gel; mobile phase, waters and acetonitrile (40% acetonitrile up to
95% in 35 min); Detector, UV 254 nm. This resulted in 8.06 g (78%)
of PH-23 as a white solid. MS m/z [M+H]+ (ESI): 827.
2'-F-3'-NHTr Building Blocks for Oligomer Synthesis
[0274] The 2'-O-Me 3'-NH-MMTr-5'-O-(2-cyanoethyl-N,N-diisopropyl)
phosphoramidite monomers of 6-N-benzoyladenosine (A.sup.Bz),
4-N-Benzylcytidine (C.sup.Bz), 2-N-isobutyrylguanosine (G.sup.iBu),
and Uridine (U) as shown below were synthesized using the procedure
described in WO 200118015 A1
##STR00062##
2'-O-Me-3'-NHTr Building Blocks for Oligomer Synthesis
[0275] Exemplary phosphoroamidates include:
TABLE-US-00009 Raw material description 3'-NHTr-dA(Bz)
3'-NHTr-dC(Bz) 3'-NHTr-dG(iBu) 3'-NHTr-T: 3'-NHMMTr-2'-F-A(NH-Bz)
3'-NHMMTr-2'-F-C(NH-Bz) 3'-NHMMTr-2'-F-G(NH-iBu) 3'-NHMMTr-2'-F-U:
3'-NHMMTr-2'-OMe-A(NH-Bz) 3'-NHMMTr-2'-OMe-C(NH-Bz)
3'-NHMMTr-2'-OMe-G(NH-iBu) 3'-NHMMTr-2'-OMe U: 3'-NHTr (dA, dC, dG
and dT)-CPG 500 .ANG.: Loading: 64-83 .mu.mol/g
[0276] The reverse phosphoramidite 3'-O-DMT-deoxy Adenosine
(NH-Bz), 5'-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite,
3'-O-DMT-deoxy Guanosine (NH-ibu),
5'-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 3'-O-DMT-deoxy
Cytosine (NH-Bz), 5'-O-(2-cyanoethyl-N,N-diisopropyl
phosphoramidite, 3'-O-DMT-deoxy Thymidine (NH-Bz),
5'-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite and reverse
solid supports were purchased from commercially-available sources
(Chemgenes).
##STR00063##
Reverse DNA Building Blocks for Oligomer Synthesis
[0277] Exemplary reverse phosphoroamidites used for this disclosure
include:
TABLE-US-00010 Raw material description 3'-O-DMTr-2'-OMe-A(NH-Bz)
3'-O-DMTr-2'-OMe-C(NH-Bz) 3'-O-DMTr-2'-OMe-G(NH-iBu)
3'-O-DMTr-2'-OMe-U: 3'-ODMTr (dA, dC, dG and dT)-CPG 500 .ANG.:
Loading: 64-83 .mu.mol/g
[0278] For making the oligomers with the following modifications:
2'-F-NPS-PS-2'-F-NPS; 2'-F-NP-PS-2'-F-NP; 2'-OMe-NP-PS-2'-OMe-NP;
2'-OMe-NPS-DNA-PS-2'-OMe-NPS, the synthesis was carried out on a 1
.mu.M scale in a 5' to 3' direction with the 5'-phosphoramidite
monomers diluted to a concentration of 0.1 M in anhydrous
CH.sub.3CN in the presence of 5-(benzylthio)-1H-tetrazole activator
(coupling time 2.0-4.0 min) to a solid bound oligonucleotide
followed by standard capping, oxidation and deprotection afforded
modified oligonucleotides. The stepwise coupling efficiency of all
modified phosphoramidites was more than 98%. The DDTT
(dimethylamino-methylidene) amino)-3H-1, 2,
4-dithiazaoline-3-thione was used as the sulfur-transfer agent for
the synthesis of oligoribonucleotide phosphorothioates.
Oligonucleotide-bearing solid supports were heated at room
temperature with aqueous ammonia/Methylamine (1:1) solution for 3 h
in shaker to cleavage from support and deprotect the base labile
protecting groups.
Examples 1-4
##STR00064##
[0280] The appropriately protected 2'-O-methoxy
ethyl-3'-aminonucleoside-5'-phosphoramidite building blocks
(examples 1-4 were prepared after chemical transformations shown in
Schemes 1-4.
[0281] First for synthesis of uracil based
3'-NH-MMTr-2'-O-methoxyethyl phosphoramidites example 5, key
3'-azido-2'-methoxyethyl intermediate 3 was obtained in low yields
via an-hydro intermediate 2 as shown in scheme 1.
[0282] Due to low yielding alkylation, 3-1 was reacted with
BOMCl/DBU to give N-3 protected intermediate 3-4, which was
alkylated by using 2-bromoethyl methyl ether/Ag.sub.2O/NaI/DMF to
give 2'-O-methoxyethyl derivative 3-5 as shown below in scheme 1.
Deprotection of N-3-BOM group using hydrogenation condition
(Pd/C/H.sub.2) resulted in 10-20% desired 3'-amino intermediate
3-6a along with significant over reduced side product 3-6b.
##STR00065##
[0283] 2'-O-alkylation in high yield is obtained as shown below in
scheme 2. For this purpose, 3-1 was treated with PMBCl/DBU/DMF to
give N-3 protected intermediate 4-2, which was subjected for 2'-O
alkylation using 2-bromoethyl methyl ether/Ag.sub.2O/NaI/DMF to
give 2'-O-methoxyethyl derivative 4-3. Then, 5'-de-tritylation of
4-3 and re-protection of 5'-hydroxyl group using benzoyl chloride
afforded 4-5.
##STR00066## ##STR00067##
[0284] De-protection of PMB group of intermediate 4-5 in mild
conditions gives 4-6. 3'-Azido group of intermediate 4-6 was
reduced to an amine, which was then immediately protected, such as
reaction with 4-monomethoxytritylchloride, to give 4-8. The
5'-benzyl ester was then cleaved using an alkaline solution,
followed by phosphitylation using known protocols to give the
desired 2'-O-methoxyethoxy uridine phosphoramidite monomer
4-10.
[0285] Preparation of (4-2): To a solution of 3-1 (45.30 g, 88.56
mmol) in DMF (120.00 mL) was added PMBCl (20.80 g, 132.84 mmol) and
DBU (44.61 g, 177.12 mmol), the mixture was stirred at r.t. for 2
h. Water was added, extracted with EA. The organic layer was
concentrated and purified by column to give 4-2 (52.00 g, 82.32
mmol) as a white solid. ESI-LCMS: m/z 632.3 [M+H].sup.+.
[0286] Preparation of (4-3): To a solution of 4-2 (50.00 g, 79.15
mmol) in DMF (120.00 mL) was added 2-Bromoethyl methyl ether (16.50
g, 118.73 mmol) and Ag.sub.2O (18.34 g, 79.15 mmol, 2.57 mL), then
NaI (5.93 g, 39.58 mmol) was added. The reaction mixture was
stirred at r.t. for 12 h. LC-MS showed work well. Filtered and
added water and EA, the organic layer was concentrated and purified
by column to give 4-3 (52.00 g, 75.39 mmol) as a colorless oil.
ESI-LCMS: m/z 690.4 [M+H].sup.+.
[0287] Preparation of (4-4): To a solution of 4-3 (52.00 g, 75.39
mmol) in DCM (200.00 mL) was added TFA (150.00 mL). The mixture was
stirred at r.t. for 1 h. The reaction mixture was slowly added to
cold NH.sub.4OH, extracted with DCM. The organic layer was
concentrated and purified to give 4-4 (31.00 g, 69.28 mmol) as a
colorless oil. ESI-LCMS: m/z 448.2 [M+H].sup.+. .sup.1H-NMR
(DMSO-d.sub.6, 400 MHz): .delta. ppm 8.02 (d, J=8.12 Hz, 1H),
7.26-7.23 (m, 2H), 6.87-6.84 (m, 2H), 5.87-5.81 (m, 2H), 5.38 (t,
J=5.0 Hz, 1H), 4.96-4.85 (m, 2H), 4.36-4.34 (m, 1H), 4.17-4.14 (m,
1H), 4.00-3.97 (m, 1H), 3.83-3.77 (m, 1H), 3.75-3.72 (m, 1H), 3.71
(s, 3H), 3.70-3.68 (m, 1H), 3.61-3.56 (m, 1H), 3.45-3.43 (m, 2H),
3.18 (s, 3H).
[0288] Preparation of (4-5): To a solution of 4-4 (31.00 g, 69.28
mmol) in Pyridine (200.00 mL) was added BzCl (13.14 g, 93.87 mmol),
the reaction mixture was stirred at r.t. for 15 min and
concentrated and purified by column to give 4-5 (35.10 g, 63.8
mmol) as a white solid. ESI-LCMS: m/z 552.2 [M+H].sup.+.
[0289] Preparation of (4-6): To a solution of 4-5 (35.10 g, 63.8
mmol) in acetonitrile (300.00 mL) and water (100.00 mL) was added
Ceric ammonium nitrate (105 g, 191.40 mmol), the reaction mixture
was stirred at r.t. for 12 h and concentrated and extracted with
EA. The organic layer was concentrated and purified by column to
give 4-6 (27.5 g, 63.75 mmol) as a yellow solid. ESI-LCMS: m/z
432.2 [M+H].sup.+.
[0290] Preparation of (4-7): To a solution of 4-6 (27.50 g, 63.75
mmol) in THF (500.00 mL) was added Pd/C (3.00 g), the reaction
mixture was stirred at r.t. for 12 h and filtered and concentrated
to give 4-7 (25.00 g, 61.67 mmol) as a yellow solid. ESI-LCMS: m/z
406.2 [M+H].sup.+.
[0291] Preparation of (4-8): To a solution of 4-7 (25.00 g, 61.67
mmol) in DCM (300.00 mL) was added MMTrCl (28.49 g, 92.51 mmol) and
Collidine (14.95 g, 123.34 mmol), then AgNO.sub.3 (15.7 g, 92.5
mmol) was added. The reaction mixture was stirred at r.t. for 1 h.,
and filtered and the organic layer was washed water, dried over
Na.sub.2SO.sub.4 and purified by silica gel column to give 4-8
(33.00 g, 48.69 mmol) as a yellow solid.
[0292] Preparation of (4-9): To a solution of 4-8 (14.50 g, 21.39
mmol) was added 1 N NaOH in methanol (200 mL) in water (20 mL), the
reaction mixture was stirred at r.t. for 1 h. and concentrated and
extracted with DCM, the organic layer was concentrated and purified
by silica gel column to give 4-9 (11.50 g, 20.05 mmol) as a white
solid. .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. ppm 11.26 (s,
1H), 7.95 (d, J=8.4 Hz, 1H), 7.47-7.44 (m, 4H), 7.34-7.17 (m, 8H),
6.82 (d, J=8.8 Hz, 2H), 5.50-5.48 (m, 2H), 5.13 (t, J=3.6 Hz, 1H),
4.05-3.98 (m, 3H), 3.78 (s, 3H), 3.52-3.49 (m, 1H), 3.34-3.32 (m,
2H), 3.14 (s, 3H), 3.08-3.04 (m, 1H), 2.89-2.86 (m, 1H), 2.70 (d,
J=10.0 Hz, 1H), 1.51 (d, J=4.4 Hz, 1H).
[0293] Preparation of (4-10): To a solution of 4-9 (11.50 g, 20.05
mmol) in DCM (100.00 mL) was added DMAP (489.85 mg, 4.01 mmol) and
DIPEA (10.36 g, 80.19 mmol, 14.01 mL). Then CEPCl (5.70 g, 24.06
mmol) was added to the solution. The mixture was stirred at r.t.
for 30 min. The reaction was quenched with saturated NaHCO.sub.3.
The organic layer was washed with brine, dried over
Na.sub.2SO.sub.4, concentrated to give the crude product. The crude
product was purified by Flash-Prep-HPLC. The product was dissolved
in anhydrous toluene and concentrated for three times. Then the
product was dissolved anhydrous acetonitrile and concentrated for
three times. This resulted in 13 g to give 4-10 as a white solid.
MS m/z [M-H].sup.- (ESI): 772.3; .sup.1H-NMR (CDCl.sub.3, 400 MHz):
9.01 (s, 1H), 8.07-7.61 (m, 1H), 7.53-7.41 (m, 6H), 7.29-7.15 (m,
5H), 6.79-6.76 (m, 2H), 5.63-5.57 (m, 2H), 4.27-4.15 (m, 2H),
4.06-3.95 (m, 1H), 3.85-3.77 (m, 1H), 3.75 (s, 3H), 3.69-3.35 (m,
7H), 3.23 (d, J=4 Hz, 1H), 2.26-2.91 (m, 3H), 2.59 (t, J=6.4 Hz,
1H), 1.75-1.39 (m, 1H), 1.21-1.11 (m, 12H). .sup.31PNMR (162 MHz,
CDCl.sub.3): 149.10, 148.26.
Example 5
##STR00068##
[0295] The 2'-O-methoxyethoxy-NH-benzoyl-cytosine phosphoramidite
compound 5-4 was obtained by conversion of uridine intermediate 4-8
into 3'-amino cytidine analogue 5-1 followed by phosphitylation
using known protocols to give the desired 2'-O-methoxyethoxy
cytidine phosphoramidite monomer 5-4 as shown below in scheme
3.
##STR00069##
[0296] Preparation of (5-1): To a solution of 4-8 (18.50 g, 27.30
mmol) in acetonitrile (250.00 mL) was added TPSCl (16.49 g, 54.60
mmol) and DMAP (6.67 g, 54.60 mmol), then TEA (5.52 g, 54.60 mmol,
7.56 mL) was added to the solution. The reaction mixture was
stirred at r.t. for 5 h under N.sub.2. NH.sub.4OH (50.00 mL) was
added to the reaction mixture. The mixture was stirred at r.t. for
12 h. The solution was concentrated and extracted with EA. The
organic layer was washed by brine and dried over Na.sub.2SO.sub.4.
The organic layer was concentrated and purified by silica gel
column to give 5-1 (16.00 g, 23.64 mmol) as a yellow solid.
[0297] Preparation of (5-2): To a solution of 5-1 (16.00 g, 23.64
mmol) in Pyridine (100.00 mL) was added BzCl (4.96 g, 35.46 mmol)
at 0.degree. C. The mixture was stirred at r.t. for 1 h. The
solution was concentrated and purified by silica gel column to give
5-2 (17.40 g, 22.28 mmol) as a white solid.
[0298] Preparation of (5-3): Compound 5-2 (17.40 g, 22.28 mmol) was
added to 180 mL of 1 N NaOH solution in Pyridine/MeOH/H.sub.2O
(65/30/5) at 0.degree. C. The suspension was stirred at 0.degree.
C. for 15 min. The reaction mixture was quenched by addition of
sat. NH.sub.4Cl solution. The solution was extracted with EA and
the combined organic layers were washed with sat. NaHCO.sub.3
solution, brine, dried over Na.sub.2SO.sub.4, filtered, and
concentrated. The residue was purified by column to give 5-3 (12.50
g, 18.47 mmol) as white solid. 1H-NMR (DMSO-d.sub.6, 400 MHz):
.delta. ppm 12.25 (s, 1H), 8.53 (d, J=7.6 Hz, 1H), 8.01 (d, J=5.2
Hz, 2H), 7.64-7.60 (m, 1H), 7.52-7.42 (m, 6H), 7.31 (d, J=8.8 Hz,
2H), 7.26-7.14 (m, 7H), 6.79 (d, J=8.8 Hz, 2H), 5.55 (s, 1H), 5.23
(t, J=3.6 Hz, 1H), 4.09-3.97 (m, 3H), 3.73 (s, 3H), 3.70-3.66 (m,
1H), 3.38-3.34 (m, 2H), 3.17 (s, 3H), 3.11-3.05 (m, 1H), 2.96-2.91
(m, 1H), 2.68 (d, J=10.8 Hz, 1H), 1.49 (d, J=4 Hz, 1H).
[0299] Preparation of (5-4): To a solution of 5-3 (12.50 g, 18.47
mmol) in DCM (100.00 mL) was added DMAP (451.30 mg, 3.69 mmol) and
DIPEA (9.55 g, 73.88 mmol, 12.90 mL), then CEPCl (5.25 g, 22.16
mmol) was added. The mixture was stirred at r.t. for 30 min. The
reaction was quenched with saturated NaHCO.sub.3. The organic layer
was washed with brine, dried over Na.sub.2SO.sub.4, concentrated to
give the crude product. The crude was by Flash-Prep-HPLC. The
product was dissolved in anhydrous toluene and concentrated for
three times. Then the product was dissolved anhydrous acetonitrile
and concentrated for three times. This resulted in 13 g to give 5-4
as a white solid. MS m/z [M-H].sup.- (ESI): 875.4. .sup.1H-NMR (400
MHz, CDCl.sub.3): .delta. ppm 8.64-8.20 (m, 2H), 7.90-7.88 (m, 2H),
7.62-7.58 (m, 1H), 7.53-7.39 (m, 8H), 7.25-7.15 (m, 6H), 6.78-6.74
(m, 2H), 5.69 (d, J=1.72 Hz, 1H), 4.37-4.21 (m, 2H), 4.10-4.03 (m,
1H), 3.90-3.79 (m, 2H), 3.75 (d, J=1.64 Hz, 3H), 3.68-3.52 (m, 3H),
3.46-3.42 (m, 2H), 3.26 (d, J=1.2 Hz, 3H), 3.17-2.97 (m, 2H),
2.94-2.87 (m, 1H), 2.67-2.48 (m, 2H), 1.79-1.51 (m, 1H), 1.26-1.18
(m, 12H). .sup.31PNMR (162 MHz, CDCl.sub.3): 148.93, 148.03
Example 6
##STR00070##
[0301] The synthesis of the 2'-O-methoxyethyl adenosine analogue
6-10 was achieved as shown below in scheme 6. The intermediate 6-2
under basic condition (NH.sub.3/MeOH) resulted in diol 6-3, which
then upon protection of 5'-hydroxy group using TBDPSCl to give 6-4
Intermediate 6-4. Then, 2'-O alkylation of 6-4 using 2-bromoethyl
methyl ether/NaH/DMF to give 2'-O-methoxyethyl derivative 6-5
without the protection of C-6-exocyclic amine of 6-4. In an
inventive way selective alkylation of 2'-OH group of intermediate
6-4 was achieved.
##STR00071## ##STR00072##
[0302] 3'-Azido group of intermediate 6-5 was reduced to the amine
6-7, which was then immediately protected, such as reaction with
4-monomethoxytritylchloride, to give the precursor 6-8 after
de-protection of 5'-OTBDPS group using TBAF/THF. The
phosphitylation of 6-9 using known protocols is performed to give
the desired 2'-O-methoxyethoxy adenine-NH-benzoyl phosphoramidite
monomer 6-10.
[0303] Preparation of (6-2): To a solution of compound 1 (79.50 g,
210.68 mmol) in dry ACN (1.20 L) was added
N-(5H-Purin-6-yl)benzamide (100.80 g, 421.36 mmol) and BSA (180.07
g, 884.86 mmol). The resulting suspension was stirred at 50.degree.
C. until clear. Then the mixture was cooled at -20.degree. C. and
TMSOTf (93.54 g, 421.36 mmol) was added by syringe. Then the
mixture was stirred at 70.degree. C. for 72 h under N.sub.2 and
quenched with sat NaHCO.sub.3 and extracted with DCM. The organic
layer was dried over Na.sub.2SO.sub.4, then solvent was evaporated,
and the residue was purified on silica gel to afford compound 6-2
(107.50 g, 192.26 mmol, 91.26% yield) as a yellow solid.
.sup.1H-NMR (400 MHz, DMSO): .delta.=11.28 (s, 1H), 8.64 (d, J=6.4
Hz, 2H), 8.05 (d, J=8.0 Hz, 2H), 7.84 (d, J=8.0 Hz, 2H), 7.66 (t,
J=7.6 Hz, 1H), 7.56 (t, J=8.0 Hz, 2H), 7.33 (d, J=8.0 Hz, 2H), 6.37
(d, J=3.6 Hz, 1H), 6.17 (dd, J=6.0 Hz, 1H), 5.09 (t, J=6.8 Hz, 1H),
4.69-4.56 (m, 2H), 4.40-4.38 (m, 1H), 2.39 (s, 3H), 2.17 (s, 3H).
ESI-LCMS: m/z 557.2 [M+H].sup.+.
[0304] Preparation of (6-3): To a solution of compound 6-2 (107.50
g, 192.26 mmol) dissolved in 33 wt. % methylamine in ethanol
(600.00 mL), then the mixture were stirred at 20.degree. C. for 16
h, then solvent was evaporated, washed with 50% EtOAc in petroleum
ether (1.5 L), filtered to afford compound 6-3 (52.50 g, 179.64
mmol, 93.44% yield) as a slightly yellow solid. ESI-LCMS: m/z 293.1
[M+H].sup.+.
[0305] Preparation of (6-4): A solution of compound 6-3 (52.50 g,
179.64 mmol), imidazole (18.32 g, 269.46 mmol) and TBDPS-Cl (54.34
g, 197.60 mmol) in pyridine (500.00 mL) was stirred at 20.degree.
C. for 2 h, LC-MS showed 6-3 was consumed. Then quenched with MeOH
(30 mL), concentrated to give the crude product which was purified
on silica gel with to afford compound 6-4 (72.60 g, 136.81 mmol,
76.16% yield) as a white solid. .sup.1H-NMR (400 MHz, DMSO):
.delta.=8.29 (s, 1H), 8.10 (s, 1H), 7.63-7.59 (m, 4H), 7.48-7.33
(m, 8H), 6.36 (d, J=5.6 Hz, 1H), 5.97 (d, J=4.4 Hz, 1H), 5.10-5.06
(m, 1H), 4.47 (t, J=5.6 Hz, 1H), 4.14-4.11 (m, 1H), 3.94 (dd,
J=11.2 Hz, 1H), 3.83 (dd, J=11.6 Hz, 1H), 0.99 (s, 9H). ESI-LCMS:
m/z 531.3 [M+H].sup.+.
[0306] Preparation of (6-5): A solution of 6-4 (35.00 g, 65.96
mmol) and 1-Bromo-2-methoxyethane (18.33 g, 131.91 mmol) in dry DMF
(400.00 mL), was added NaI (19.77 g, 131.91 mmol) and Ag.sub.2O
(15.29 g, 65.96 mmol), the mixture was stirred at room temperature
for 5 h. Then the reaction was poured into ice water, extracted
with EA, washed with brine and dried over anhydrous
Na.sub.2SO.sub.4. The solvent was evaporated, and the residue was
purified on silica gel to give 6-5 (23.70 g, 40.26 mmol, 61.04%
yield) as a white solid and by-product of TBDPS lost 5.20 g, 9.81
mmol, 14.87% yield) as a white solid. .sup.1H-NMR (400 MHz, DMSO):
.delta.=8.31 (s, 1H), 8.11 (s, 1H), 7.63-7.60 (m, 4H), 7.47-7.44
(m, 2H), 7.40-7.36 (m, 6H), 6.10 (d, J=4.4 Hz, 1H), 5.02 (t, J=4.8
Hz, 1H), 4.69 (t, J=5.6 Hz, 1H), 4.18-4.14 (m, 1H), 3.95 (dd,
J=11.6 Hz, 1H), 3.84 (dd, J=11.6 Hz, 1H), 3.78-3.75 (m, 2H), 3.45
(t, J=4.8 Hz, 1H), 3.16 (s, 3H), 0.99 (s, 9H). ESI-LCMS: m/z 589.5
[M+H].sup.+.
[0307] Preparation of (6-6): To a solution of 6-5 (31.23 g, 53.04
mmol) in pyridine (300.00 mL) at 0.degree. C., was added BzCl
(11.22 g, 79.56 mmol) dropwise. The mixture was stirred at r.t. for
2 h. Then the solution was cooled to 0.degree. C., and ammonium
hydroxide (20 mL, 30%) was added and the mixture was allowed to
warm to r.t., then the solvent was evaporated, 300 mL H.sub.2O and
600 mL EA were added into separate the solution, the aqueous was
extracted by EA, combined the organic and washed with brine, dried
over anhydrous Na.sub.2SO.sub.4, the solvent was removed and the
residue was purified on silica gel to give 6-6 (28.70 g, 41.42
mmol, 78.09% yield) as a white solid. ESI-LCMS: m/z 693.4
[M+H].sup.+.
[0308] Preparation of (6-7): A solution of 6-6 (28.70 g, 41.42
mmol) in EA (150.00 mL) was added Pd/C (3.00 g) and MeOH (150.00
mL) under H.sub.2. The mixture was stirred at r.t. for 5 h. Then
the reaction was filtered and the filtrate concentrated to give 6-7
(25.49 g, 38.22 mmol, 92.27% yield) as a gray solid. ESI-LCMS: m/z
667.3 [M+H].sup.+.
[0309] Preparation of (6-8): To a solution of 6-7 (25.49 g, 38.22
mmol) and AgNO.sub.3 (12.98 g, 76.44 mmol) in DCM (300.00 mL) was
added collidine (13.89 g, 114.66 mmol) and MMTrCl (19.43 g, 57.33
mmol), the mixture was stirred at r.t. for 2 h. Then the reaction
was poured into ice water, the organic layer extracted with DCM,
washed with brine and dried over anhydrous Na.sub.2SO.sub.4, the
solvent was removed and the residue was purified on silica gel to
give 6-8 (32.79 g, 34.92 mmol, 91.36% yield) as a gray solid.
[0310] Preparation of (6-9): A solution of 6-8 (32.79 g, 34.92
mmol) in THF (300.00 mL) was added TBAF (1M, 35.00 mL), the mixture
was stirred at room temperature for 15 h. Then the solvent was
removed and the residue was purified on silica gel with EA to give
6-9 (22.22 g, 31.71 mmol, 90.82% yield) as a white solid.
.sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=8.68 (s, 1H), 8.32 (s,
1H), 8.04 (d, J=7.2 Hz, 2H), 7.61-7.57 (m, 1H), 7.53-7.48 (m, 6H),
7.40 (d, J=8.8 Hz, 2H), 7.21-7.12 (m, 6H), 6.73 (d, J=8.8 Hz, 2H),
6.09 (d, J=2.4 Hz, 2H), 4.08-4.02 (m, 2H), 3.93-3.87 (m, 1H), 3.72
(s, 3H), 3.58-3.53 (m, 1H), 3.43-3.39 (m, 3H), 3.24-3.19 (m, 4H),
2.19 (br, 1H).
[0311] Preparation of (6-10): To a solution of 6-9 (14.00 g, 19.98
mmol), DMAP (488.19 mg, 4.00 mmol) and DIPEA (6.46 g, 49.95 mmol,
8.73 mL) in dry DCM (100.00 mL) was added CEPCl (5.68 g, 23.98
mmol) dropwise under Ar. The mixture was stirred at room
temperature for 1 h. Then the reaction was wished with 10%
NaHCO.sub.3(aq) and brine, dried over Na.sub.2SO.sub.4, the solvent
was removed and the residue was purified by c.c. with the PE/EA
mixture, then concentrated to give the crude product. The crude
product (10 g, dissolved in 10 mL of ACN) was purified by
Flash-Prep-HPLC to obtain 6-10 (12.60 g, 13.98 mmol, 69.99% yield)
as a white solid. Then the product was dissolved in dry toluene (15
mL) and concentrated three times, and with dry ACN three times.
.sup.1H-NMR (400 MHz, CDCl.sub.3): .delta.=9.12 (d, J=46.8 Hz, 1H),
6=8.71 (d, J=11.6 Hz, 1H), 8.50 (s, 0.6H), 8.22 (s, 0.4H), 8.04 (t,
J=7.2 Hz, 2H), 7.63-7.59 (m, 1H), 7.55-7.46 (m, 6H), 7.40-7.37 (m,
2H), 7.19-7.06 (m, 6H), 6.69 (dd, J=8.8 Hz, 2H), 6.03 (d, J=3.2 Hz,
1H), 4.36-4.24 (m, 2H), 3.92-3.78 (m, 2H), 3.71 (d, J=11.6 Hz, 3H),
3.67-3.33 (m, 7H), 3.29 (d, J=11.2 Hz, 3H), 3.17-3.10 (m, 1H), 2.88
(dd, J=27.2 Hz, 1H), 2.65-2.50 (m, 2H), 2.38 (d, J=4.4 Hz, 0.4H),
1.80 (d, J=4.0 Hz, 0.6H), 1.23-1.15 (m, 12H). .sup.31PNMR (400 MHz,
CDCl.sub.3): 148.86, 148.22. ESI-LCMS: m/z 901.3 [M+H].sup.+.
Example 7
##STR00073##
[0313] The appropriately protected
2'-O-ethyl-3'-amino-5'-phosphoramidite (example 9, 10, 11, 12),
were prepared after chemical transformations shown in Scheme 5.
[0314] First for the synthesis of thymine based
3'-NH-MMtr-2'-O-ethyl phosphoramidites example 9, intermediate 2
was protected such as ethyl propynoate in the presence of
dimethylaminopyridine (Scheme 8) to give base N-3 protected
intermediate 8-4 to facilitate the 2'-O-alkylation in higher yield.
Further deacetylation of 8-4 to give C-2'-hydroxy intermediate
8-5.
##STR00074## ##STR00075##
[0315] Further alkylation using iodoethane afforded 2'O-ethyl
nucleoside 8-6. Intermediate 8-6 was converted to thymine base
2'-O-ethyl-3'-amino-5'-phosphoramidite 8-11 by following the
similar chemistry for compound 4-10 shown in previous Scheme 4.
[0316] Preparation of (8-4): To a solution of 8-2 (22.0 g, 49.62
mmol) in MeCN (400 mL) was added DMAP (1.2 g, 9.92 mmol). Then 3
(5.8 g, 419.5 mmol) was added, the mixture was stirred at r.t. for
2 h under N.sub.2, TLC showed 8-2 was consumed. Concentrated and
purified by a silica gel column by (PE:EA=6:1) to afford 8-4 (22.0
g, 40.63 mmol, 81.9% yield) as a yellow oil. ESI-LCMS: m/z 564
[M+Na].sup.+.
[0317] Preparation of (8-5): To a solution of 8-4 (28.0 g, 51.71
mmol) in MeOH (400 mL) was added con. NH.sub.4OH aqueous solution
(28 mL) at 0.degree. C. The reaction mixture was stirred at
0.degree. C. for 1.5 h, TLC showed 8-4 was consumed. Concentrated
and purified by a silica gel column by (PE:EA=10:1.about.2:1) to
afford 8-5 (21.0 g, 42.04 mmol, 81.3% yield) as a yellow oil.
ESI-LCMS: m/z 522 [M+Na].sup.+.
[0318] Preparation of (8-6): To a solution of 8-5 (20.0 g, 40.04
mmol) in iodoethane (100 mL) was added Ag.sub.2O (18.6 g, 80.08
mmol,). The reaction mixture was stirred at 50.degree. C. for 5 h,
after LC-MS show totally consumed of 8-5 filtered with diatomite
and concentrated to afford 8-6 (16.0, 30.33 mmol, 75.7% yield) as a
yellow oil which was used directly in next step. ESI-LCMS: m/z 528
[M+H].sup.+.
[0319] Preparation of (8-7): To a solution of 8-6 (16.0 g, 30.33
mmol) in MeCN (400 mL) was added pyrrolidine (8.63 g, 121.32 mol,
12 mL), the reaction mixture was stirred at r.t. overnight, TLC
showed 8-6 was totally consumed. Concentrated and purified by a
silica gel column by (DCM:MeOH=100:1.about.50:1) to afford 7 (12.0
g, 27.94 mmol, 92.1% yield) as a yellow oil. ESI-LCMS: m/z 430
[M+H].sup.+.
[0320] Preparation of (8-8): To a solution of 8-7 (12.0 g, 27.94
mmol) in THF (200 mL) was added Pd/C (1.2 g), the mixture was
stirred at r.t. under H.sub.2 overnight. LC-MS showed 7 was totally
consumed. Filtered and washed with DCM (100 mL*3), then
concentrated to afford 8-8 (11.0 g, 27.27 mmol, 97.6% yield) as a
gray solid which was used directly in next step. ESI-LCMS: m/z 404
[M+H].sup.+.
[0321] Preparation of (8-9): To a solution of 8-8 (10.0 g, 24.79
mmol) in DCM (80 mL) was added MMTrCl (11.4 g, 37.18 mmol),
2,4,6-collidine (2.0 g, 16.61 mmol, 6.5 mL) and AgNO.sub.3 (6.3 g,
37.18 mmol), the mixture was stirred at r.t. for 1.5 h. TLC showed
8-8 was totally consumed. Filtered and the organic layer was washed
with water and dried over Na.sub.2SO.sub.4, then concentrated and
purified by a silica gel column by (PE:EA=5:1:1) to afford 8-9
(16.0 g, 23.68 mmol, 95.5% yield) as a light-yellow solid.
[0322] Preparation of (8-10): 8-9 (4.0 g, 5.92 mmol) was added to
the solution of 1.0 N NaOH solution (20 mL, MeOH/H.sub.2O=9:1). The
reaction mixture was stirred at 40.degree. C. for 2 h, TLC showed
8-9 was consumed, concentrated and extracted with DCM (20 mL*2),
the organic layer was dried over Na.sub.2SO.sub.4 and concentrated,
the residue was purified by a silica gel column by
(DCM:MeOH=200:1.about.50:1) to afford 8-10 (3.0 g, 53.8 mmol, 90.9
yield) as a white solid.
[0323] Preparation of (8-11): To a solution of 8-10 (2.36 g, 4.23
mmol) in DCM (2.0 mL) was added DMAP (103 mg, 0.8 mmol) and DIPEA
(2.2 g, 16.92 mmol, 2.96 mL). Then CEPCl (1.0 g, 4.23 mmol) was
added. The reaction mixture was stirred at r.t. for 1 h. TLC showed
8-10 was consumed, washed with saturated NaHCO.sub.3 (5 mL),
separated the organic layer and washed the water layer with DCM (10
mL*2). The combined organic layer was washed with brine, dried over
Na.sub.2SO.sub.4, concentrated, and purified by Flash-Prep-HPLC to
afford 8-11 (2.45 g, 3.23 mmol, 76.36% yield) as a white solid.
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.62 (s, 1H), 7.74 (dd,
J=1.4 Hz, 0.5H), 7.60-7.50 (m, 4H), 7.51-7.41 (m, 2H), 7.34-7.16
(m, 7H), 7.12 (d, J=1.4 Hz, 0.5H), 6.88-6.76 (m, 2H), 5.66 (s, 1H),
4.37-4.23 (m, 1H), 4.16-4.05 (m, 1H), 4.05-3.94 (m, 0.5H),
3.88-3.74 (m, 4.5H), 3.72-3.35 (m, 3H), 3.22 (td, J=10.3, 4.7 Hz,
0.5H), 3.03-2.89 (m, 1.5H), 2.80-2.69 (m, 1H), 2.61 (t, J=6.5 Hz,
1H), 2.37 (td, J=6.6, 1.3 Hz, 1H), 1.97 (d, J=3.5 Hz, 0.5H), 1.91
(dd, J=11.4, 1.2 Hz, 3H), 1.52 (d, J=4.7 Hz, 0.5H), 1.29-1.17 (m,
12H), 1.08 (td, J=7.0, 4.9 Hz, 3H). .sup.31P NMR (162 MHz,
CDCl.sub.3) .delta. 149.31, 147.14. ESI-LCMS: m/z 576
[M+H].sup.+.
Quantitation of Crude Oligomer or Raw Analysis
[0324] Samples were dissolved in deionized water (1.0 mL) and
quantitated as follows: Blanking was first performed with water
alone (1.0 mL) 20 ul of sample and 980 .mu.L of water were mixed
well in a microfuge tube, transferred to cuvette and absorbance
reading obtained at 260 nm. The crude material is dried down and
stored at -20.degree. C.
Crude HPLC/LC-MS Analysis
[0325] The 0.1 OD of the crude samples were submitted for crude MS
analysis. After Confirming the crude LC-MS data then purification
step was performed.
HPLC Purification
[0326] The Phosphoramidate (NP) and Thiophosphoramidate (NPS)
modified oligonucleotides with and without conjugates were purified
by anion-exchange HPLC. The buffers were 20 mM sodium phosphate in
10% CH.sub.3CN, pH 8.5 (buffer A) and 20 mM sodium phosphate in 10%
CH.sub.3CN, 1.8 M NaBr, pH 8.5 (buffer B). Fractions containing
full-length oligonucleotides were pooled, desalted, and
lyophilized.
Desalting of Purified Oligomer
[0327] The purified dry oligomer was then desalted using Sephadex
G-25 M (Amersham Biosciences). The cartridge was conditioned with
10 mL of deionized water thrice. The purified oligomer dissolved
thoroughly in 2.5 mL RNAse free water was then applied to the
cartridge with very slow drop-wise elution. The salt free oligomer
was eluted with 3.5 ml deionized water directly into a screw cap
vial.
In Vitro Assay
[0328] Antisense oligonucleotides (ASOs) targeting exon 5 of human
MAPT were synthesized. An ASO with phosphorothioate linkage
chemistry and 2'-methoxyethyl (2'MOE) protecting groups in 5
nucleotide-long wings on either end of the molecule was
synthesized, and an ASO with the same sequence targeting exon 5 of
MAPT using the P5'-N3' phosphoramidate linkage ASO chemistry
(rather than the phosphorothioate chemistry) was also synthesized.
MAPT mRNA levels were evaluated in human neurons differentiated
from human induced pluripotent stem cells (iPSCs) following
treatment with either the phosphorothioate (OPS) or the
phosphoramidate (NPS) chemistry but with the same 2'MOE protecting
groups in the wings to determine if and to what extent these ASOs
effectively reduced tau mRNA and protein levels, as well their
effect on tau pathology in a transgenic mouse model of AD (DeVos et
al., Sci Transl Med, 2017).
iPSC Generation and Differentiation into Cortical Neurons.
[0329] The parental iPSC line (Sigma catalog #iPSC0028) was
generated by reprogramming epithelial cells from a 24-years old
female donor with the four Yamanaka factors (Oct3/4, Sox2, Klf4 and
c-Myc) using retroviral vectors. Human iPSCs were cultured
feeder-free and fed daily with fresh mTeSR medium (Stem Cell
Technologies). Cells were passaged with EDTA (Gibco) at confluency,
and differentiation into neural progenitor cells (NPCs) and
cortical neurons was performed using classic dual SMAD inhibition
protocol. This protocol mostly generates glutamatergic layer V
cortical neurons expressing TBR1 (approx. 20%) and CTIP2 (approx.
80%). Briefly, iPSCs were dissociated into single cell suspension
and neuronal induction was triggered by following treatment with
SB431542 and Dorsomorphin (neural induction media, see Table 1) for
a period of 12 days.
TABLE-US-00011 TABLE 1 N2B27 media (composition) Component (final
concentration) Vendor Cat No Neurobasal .RTM. Medium Gibco
21103-049 DMEM/F-12, GlutaMAX supplement Gibco 31331-028 B-27
Supplement, serum free (1%) Gibco 17504-044 N-2 (0.5%) Gibco
17502-048 MEM Non-Essential Amino Acids Solution (0.5%) Gibco
11140-035 Sodium Pyruvate (0.5 mM) Gibco 11360-070 GlutaMAX .TM.
Supplement (0.5%) Gibco 35050-038 Penicillin-Streptomycin (10 U/mL)
Gibco 15140-122 2-Mercaptoethanol (25 .mu.M) Gibco 31350-010
Insulin solution human (2.4 ug/mL) Sigma 19278
[0330] After induction, neuronal progenitor cells (NPCs) were
treated with dispase and subplated for amplification three more
times (at days 17, 20 and 25 approximately). Between day 25 and 30,
NPC frozen stocks were prepared in neuronal progenitor freezing
media (see Table 2) and kept in liquid nitrogen for subsequent
experiments. NPCs were thawed in NPC reconstitution media (see
Table 3) and kept during three days in culture before final
subplating for ASO treatment.
TABLE-US-00012 TABLE 2 Neural induction media (composition)
Component (final concentration) Vendor Cat No N2B27 media
Dorsomorphin (1 .mu.M) Tocris 3093 SB431542 (10 .mu.M) Sigma
S4317
TABLE-US-00013 TABLE 3 Neuronal reconstitution media (composition)
Component (final concentration) Vendor Cat No N2B27 media Rock
inhibitor Y-27632 (10 .mu.M) Sigma Y0503 FGF-Basic (AA 10-155)
Gibco PHG0024 Recombinant Human Protein (20 ng/mL)
[0331] NPCs were plated on N2B27 media (see table 3) at a density
of 15,000 cells per well in poly-ornithine/laminin (Sigma) coated
96-well plates.
[0332] To block cell proliferation cells received two treatments
with 10 .mu.M
N--[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl
ester (DAPT, Sigma) on days 7 and 11 post-subplating. 14 days post
thawing, N2B27 the media was replaced by final differentiation
media (see table 4) that was changed 2-3 times per week (50%) until
day 15 or 25, when ASO treatments were performed.
TABLE-US-00014 TABLE 4 Final neuronal differentiation media
(composition) Component (final concentration) Vendor Cat No N2B27
media Recombinant Hu/Mo/Rat/Can/Equi R & D 248-BD BDNF Protein
(20 ng/mL) Systems Recombinant Human GDNF Protein R & D 212-GD
(10 ng/mL) Systems N6,2'-O-Dibutyryladenosine 3',5'-cyclic Sigma
D0627 monophosphate sodium salt (500 .mu.M) L-Ascorbic acid (200
.mu.M) Sigma A5960 DAPT (10 .mu.M) Sigma D5942
Antisense Oligonucleotide (ASO) Treatment to Target MAPT mRNA.
[0333] ASOs were synthesized as full phosphorothioate (OPS) as
known in the art. The synthesis of thiophosphoramidate (NPS) ASOs
were made according to the present disclosure. NPS ASOs contained
nucleosides linked by NPS in the 5 nucleotides on either end of the
ASO and a central 10 nucleotides-long gap with OPS-linked
nucleotides. For both OPS and NPS ASOs, the 5 nucleotides-long
wings on either side of the ASO contained 2' methoxyethyl (MOE)
protecting groups. ASOs were reconstituted in phosphate-buffered
saline (PBS) (Sigma) and their final concentrations were determined
by the Beer-Lambert law by measuring their absorbance at 260 nm. A
20 nucleotide-long MAPT ASO with the following sequence:
GCTTTTACTGACCATGCGAG (SEQ ID NO: 1) was modified having 2' MOE
substitutions and phosphorothioate (OPS) linkages (OPS Modified
Control SEQ ID NO: 1) and was modified having 2' MOE substitutions
and thiophosphoramidate (NPS) linkages (NPS Modified SEQ ID NO: 1).
A non-targeting scrambled ASO with the following sequence was used
as negative control: CCTTCCCTGAAGGTTCCTCC (Non-MAPT Control). Human
iPSC-derived cortical neurons were treated by free delivery of the
ASOs at the indicated doses and for the indicated time periods.
TABLE-US-00015 TABLE 5 Sequence Sequences OPS Modified
5'-moeGps(5m)moeCps(5m)moeUps(5m)moe Control SEQ
Ups(5m)moeUpsTpsAps(5m)CpsTpsGpsAps ID NO: 1
(5m)Cps(5m)CpsApsTpsmoeGps(5m)moeCps moeGpsmoeApsmoeG-3' NPS
Modified 5'-moeGnpsmoeCnpsmoeUnpsmoeUnpsmoe SEQ ID NO: 1
UnpsTpsAps(5m)CpsTpsGpsAps(5m)Cps
(5m)CpsApsTpsmoeGnpsmoeCnpsmoeGnps moeAnpsmoeGn-3'
RNA Isolation and Real-Time Quantitative PCR.
[0334] RNA was isolated using the RNeasy96.RTM. kit (Qiagen)
according to manufacturer's instructions. Briefly, we lysed cells
by adding 150 .mu.L RLT buffer and shaking on an orbital shaker for
30 min followed by the addition of an equal volume of 70% (v/v)
ethanol. The mixture was subsequently transferred to columns and
the RNA was bound to the filter by centrifugation at 5,600.times.g
for 4 min at RT using a Sigma 4-18K centrifuge. Serial wash steps
with RW1 buffer (700 .mu.l, 4 min), RPE buffer (700 .mu.l, 4 min)
and a second RPE buffer step (700 .mu.l, 10 min) were all done at
5,600.times.g at RT. The RNA was eluted using 60 .mu.l
nuclease-free water by centrifugation at 5,600.times.g at RT for 4
min. The RNA concentration was determined by spectroscopy using the
Nanodrop.RTM. ND-8000 (ThermoFisher). Equal amounts of RNA were
reverse transcribed using the high-capacity cDNA reverse
transcription kit (ThermoFisher) in a 20 .mu.l final reaction
volume according to manufacturer's instructions. After a 10 min
incubation at 25.degree. C., reverse transcription occurred during
2 hours at 37.degree. C., followed by enzyme inactivation at
85.degree. C. for 5 min. To quantify total MAPT mRNA levels, cDNA
was diluted 1:10, mixed with 2.times. Power SYBR.TM. Green Plus
master mix (ThermoFisher) and DNA primers to a final reaction
volume of 10 .mu.l. The following primers were used to detect total
MAPT mRNA at a final concentration of 500 nM (table 6).
TABLE-US-00016 TABLE 6 Assay_id forward reverse MAPT_B01
CCTCCAAGTGTGGCTCA CAATCTTCGACTGGACTCTG TTA MAPT_B02
CAGTGGTCCGTACTCCA TGGACTTGACATTCTTCAGG MAPT_B04 ATTGAAACCCACAAGCT
GAGGAGACATTGCTGAGATG GAC MAPT_B06 TCAGGTGAACTTTGAAC
CTTCCATCACTTCGAACTCC CAG MAPT_JPNV-1 CCAAGTGTGGCTCATTA
CCAATCTTCGACTGGACTCT GGCA GT MAPT_JPNV-2 GAGTCCAGTCGAAGATT
GGCGAGTCTACCATGTCGAT GGGT G 3R MAPT AGGCGGGAAGGTGCAAA
GCCACCTCCTGGTTTATGAT TA G 4R MAPT CGGGAAGGTGCAGATAA
TATTTGCACACTGCCGCCT TTAA
Assays amplifying 8 different housekeeping genes using DNA primers
(see Table 8) were also run. All the DNA primers were purchased
from Integrated DNA Technologies. The RT-qPCR reactions were run on
a HT7900 thermal cycler (Applied Biosystems) using standard cycling
parameters. The specificity of the DNA primers was confirmed using
a melting curve analysis. GeNorm analysis was used to determine the
most stable housekeeping genes using qBase+ (Biogazelle). All the
data are normalized to the geometric mean of the most stable
housekeeping genes and calibrated to a control condition.
AlphaLISA.RTM. Immunoassay.
[0335] Cells were lysed during 30-60 min in 96-well culture plates
at room temperature (RT) in an orbital shaker using 40 .mu.L per
well of RIPA buffer (Sigma) containing phosphatase inhibitors
(PhosSTOP.TM., Roche) and protease inhibitors (cOmplete.TM.,
Roche). The combination of HT7 (ThermoFisher) and hTAU10 antibodies
(Janssen) was used for total tau quantification using
AlphaLISA.RTM. technology (PerkinElmer). Measurements were
performed in triplicates using 5 .mu.l of 1:3 diluted lysate each
time. Each sample was transferred to a 384-well assay plate for
AlphaLISA.RTM. reaction in which 5 .mu.l of cell extracts were
incubated for 2 hours at RT with a mixture of biotinylated antibody
and acceptor beads (see Table 7).
TABLE-US-00017 TABLE 7 Concentration of antibodies and beads used
on AlphaLISA .RTM. assay (final concentrations) Final Component
concentration Biotinylated Ab (HT7) 1.2 nM Acceptor beads (hTAU10)
10 .mu.g/ml Donor beads 30 .mu.g/ml
[0336] Subsequently, donor beads were added to the wells and
incubated at RT for 30 min before reading at 615 nm (upon
illumination at 680 nm) on the EnVision plate reader (Perkin
Elmer).
Total Protein Quantification.
[0337] Total protein quantification was performed using
Bicinchoninic Acid Kit (Sigma). In order to evaluate the
superiority of the NPS chemistry over the OPS chemistry, human
iPSC-derived cortical neurons were treated with various
concentrations of the MAPTASOs. MAPTASOs were added directly into
the culture medium on day 25 after initiation of the
differentiation process to final concentrations ranging from 1.25 M
to 10.0 .mu.M. Equimolar concentrations of anon-targeting control
ASO with the same chemistry was used as negative control. After 5
days, relative total MAPT mRNA levels was determined by RT-qPCR
(Table 8).
TABLE-US-00018 TABLE 8 DNA primers for housekeeping genes House-
Forward/ keeping reverse Primer sequence gene name primer (5' to
3') GAPDH Forward AAGGTGAAGGTCGGAGTCAAC Reverse
GGGGTCATTGATGGCAACAATA RNF20 Forward TTATCCCGGAAGCTAAACAGTGG
Reverse GTAGCCTCATATTCTCCTGTGC VIPAR Forward GGGAGACCCAAAGGGGAGTAT
Reverse GGAGCGGAATCTCTCTAGTGAG SCLY Forward ACTATAATGCAACGACTCCCCT
Reverse CTTCCTGCTGAATACGGGCTG PRDM4 Forward CACCTCCACAGTACATCCACC
Reverse TGATAGGGATCTAGTGCTGAAGG ENOX2 Forward
TCATTGTGGAAGTTTTCGAGCA Reverse TGCGGTAACCAGACAGATACA UBE4A Forward
TAGCCGCTCATTCCGATCAC Reverse GGGATGCCATTCCCGCTTT ERCC6 Forward
TCACGTCATGTACGACATCCC Reverse GTGGCAGCTTGAGGGCTAAG
[0338] Both negative control ASOs did not affect total MAPT mRNA
levels (Table 9).
TABLE-US-00019 TABLE 9 Relative total MAPT mRNA levels following
ASO treatment. Relative MAPT ASO mRNA levels ASO concentration
(mean .+-. SD) SEQ ID NO: Modification (.mu.M) (% versus 0 .mu.M)
OPS OPS 2'MOE 0.00 124.0 .+-. 40.7 Modified MAPT 1.25 130.7 .+-.
21.4 Control SEQ 2.5 131.0 .+-. 14.6 ID NO: 1 5.0 72.9 .+-. 8.0
10.0 42.3 .+-. 2.7 NPS NPS 2'MOE 0.00 97.5 .+-. 7.2 Modified MAPT
1.25 55.0 .+-. 3.3 SEQ ID 2.5 48.6 .+-. 7.0 NO: 1 5.0 40.5 .+-. 7.8
10.0 22.5 .+-. 2.5 OPS OPS 2'MOE 0.00 103.6 .+-. 14.2 Modified
non-MAPT 1.25 94.2 .+-. 7.2 Non-MAPT control 2.5 94.4 .+-. 9.2
Control 5.0 93.5 .+-. 11.4 10.0 83.6 .+-. 11.0 NPS NPS 2'MOE 0.00
97.3 .+-. 4.0 Modified non-MAPT 1.25 82.4 .+-. 13.7 Non-MAPT
control 2.5 87.6 .+-. 18.9 Control 5.0 105.6 .+-. 10.9 10.0 113.6
.+-. 13.2
[0339] NPS ASOs reduced total MAPT mRNA levels by 2.times. the
amount of OPS ASOs as depicted in table 8.
[0340] In order to assess whether NPS MAPT ASOs was also more
effective in reducing tau protein levels compared to OPS MAPT ASOs,
human iPSC-derived cortical neurons were treated starting on day 15
after initiation of differentiation and ASOs were added every 5
days for a total period of 15 days. This treatment paradigm was
necessary as the half-life of tau protein is thought to be very
long given its function in stabilizing microtubules, particularly
in neurons with their long axons. Following this prolonged ASO
treatment period, the cells were lysed and tau protein levels were
evaluated using bead-based immunoassays (Table 10).
TABLE-US-00020 TABLE 10 Relative total tau protein levels
determined by AlphaLISA .RTM. following ASO treatment. Relative Tau
ASO protein levels ASO concentration (mean .+-. SD) SEQ ID NO:
Modification (.mu.M) (% versus 0 .mu.M) OPS OPS 2'MOE 0.00 100.0
.+-. 19.9 Modified MAPT 1.25 73.1 .+-. 16.6 Control SEQ 2.5 77.9
.+-. 8.7 ID NO: 1 5.0 50.2 .+-. 10.1 10.0 39.9 .+-. 4.8 NPS NPS
2'MOE 0.00 100.0 .+-. 16.9 Modified MAPT 1.25 40.9 .+-. 12.7 SEQ ID
2.5 31.7 .+-. 6.3 NO: 1 5.0 17.6 .+-. 3.2 10.0 19.6 .+-. 1.6 0.00
100.0 .+-. 16.4 OPS OPS 2'MOE 1.25 81.7 .+-. 13.4 Modified non-MAPT
2.5 94.9 .+-. 16.3 Non-MAPT control 5.0 74.5 .+-. 8.5 Control 10.0
90.4 .+-. 17.4 NPS NPS 2'MOE 0.00 100.0 .+-. 11.3 Modified non-MAPT
1.25 104.9 .+-. 40.9 Non-MAPT control 2.5 86.3 .+-. 32.8 Control
5.0 55.7 .+-. 28.5 10.0 106.2 .+-. 19.9
[0341] The negative control ASOs did not affect tau protein levels.
However, MAPT NPS ASOs dose-dependently reduced tau protein levels
2.times. more than MAPT OPS ASOs as depicted in table 9.
[0342] From these examples, MAPT ASOs with NPS chemistry were
determined to be surprisingly superior in reducing total MAPT mRNA
and tau protein levels inhuman iPSC-derived neurons compared to an
ASO with the same sequence but with OPS chemistry.
IEX HPLC and Electrospray LC/MS Analysis
[0343] Stability Testing of Complexed Oligonucleotides
[0344] Approximately 0.10 OD of oligomer is dissolved in water and
then pipetted in special vials for IEX-HPLC and LC/MS analysis.
Analytical HPLC and ES LC-MS established the integrity of the
oligonucleotides.
[0345] In embodiments, the disclosed oligonucleotides display an
increased affinity for a target nucleic acid sequence compared to
an unmodified oligonucleotide of the same sequence. For example, in
some sequences the disclosed oligonucleotides have a nucleobase
sequence that is complementary and hybridizes to a target nucleic
acid sequence at a higher affinity than an unmodified
oligonucleotide of the same sequence. In embodiments, the disclosed
oligonucleotide complexed/hybridized with a complementary target
nucleic acid sequence has a melting temperature T.sub.m of
>37.degree. C. The duplex/complex may be formed under
physiological conditions or nearly physiological conditions such as
in phosphate-buffered saline (PBS). In embodiments, the Tm of the
duplex/complex is >50.degree. C. In embodiments, the Tm of the
duplex/complex is 50-100.degree. C. In embodiments, the T.sub.m of
the disclosed oligonucleotide duplexed with a target nucleic acid
sequence under physiological conditions or nearly physiological
conditions is >50.degree. C.
[0346] The duplex stability of disclosed oligonucleotides binding
with target RNA sequence were evaluated using the thermal
dissociation data of duplexes. The thermal dissociation studies
were performed by measuring the temperature dependent UV absorbance
at 260 nm of duplexes using Shimadzu UV2600 Spectrometer connected
to a Shimadzu Temperature Controller and Julabo F12-ED constant
temperature bath. The disclosed oligonucleotide and target nucleic
acid sequence were mixed in an equimolar ratio to give a final
duplex concentration of 2 .mu.M. All samples were prepared in
1.times.PBS buffer condition (137 mM NaCl, 2.7 mM KCl, 10 mM
Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, pH 7.2). The UV-Vis
absorbance at 260 nm was recorded and corrected using the
absorbance at 380 nm (UV cell path length=1 cm). The data were
recorded at a rate of 1.degree. C./min, in 1.degree. C. intervals,
for both the heating (20-95.degree. C.) and cooling (95-20.degree.
C.) runs. The T.sub.m values were determined by taking the first
derivative of the heating sigmoidal profiles, using LabSolutions
T.sub.m Analysis Software. Final T.sub.m is an average of three
independent trials, and errors represent the standard deviation. As
set forth in Table 11, NPS modified SEQ ID NO: 1 has a Tm of
.about.+0.8.degree. C. per 3'-NH.
TABLE-US-00021 TABLE 11 T.sub.m with RNA SEQ ID NO: ASO
Modification (.degree. C) OPS Modified Control OPS 2'MOE MAPT 62.4
(.+-.0.6) SEQ ID NO: 1 NPS Modified SEQ ID NO: 1 NPS 2'MOE MAPT
68.8 ((.+-.0.5)
Validation of TAU GAPmers
[0347] To evaluate the efficacy of the TAU GAPmers, a human
neuronal cell line (KELLY cells) were treated with various
concentrations ranging from 80 nM up to 20 .mu.M. Two versions of
the lead GAPmers: 2'-O-methyl (2'OMe) and 2'-O-methoxyethyl (2'MOE)
were evaluated. These GAPmers are in a 5-10-5 form, meaning that
the first and last 5 nucleotides include NPS and 2' chemistries,
and the middle 10 nucleotides are the "gap" having OPS chemistry.
Three days after treatment initiation, total RNA was collected and
evaluated for total Tau mRNA levels by RT-qPCR using 6 different
assays (see Table 6). The expression of 3R and 4R Tau mRNA was
evaluated in the treated cells by RT-qPCR (see Table 6).
TABLE-US-00022 TABLE 12 Bond chemistry ASO 2'-O target GAPmer
chemistry ASO sequence site A NPS-OPS-NPS GCUUUTTTGTCATCGCUUCC Exon
5 2'MOE B NPS-OPS-NPS 2'OMe C NPS-OPS-NPS UUGAUATTATCCTTTGAGCC Exon
10 2'MOE D NPS-OPS-NPS 2'OMe E NPS-OPS-NPS GGUGATATTGTCCAGGGACC
Exon 12 2'MOE F NPS-OPS-NPS 2'OMe
[0348] All GAPmers showed a dose-dependent reduction of total 3R
and 4R Tau mRNA in a dose-dependent manner. GAPmers C and D that
target exon 10 of Tau mRNA were more effective in reducing 4R Tau
mRNA levels compared to the other GAPmers.
To confirm that these GAPmers also reduce Tau mRNA levels in human
neurons, the same experiment was performed in human iPSC-derived
neurons and treated these cells for 72 hours with the same GAPmers.
Very similar results were obtained for each of the GAPmers in
iPSC-derived neurons compared to KELLY cell.
GAPmer Biodistribution
[0349] Additional ASO GAPmers were synthesized with unmodified
chemistry as well as with the NPS chemistry. The IDs, chemistry,
sequences and target site of these ASOs are listed in Table 13.
These GAPmers are in a 5-10-5 form, meaning that the first and last
5 nucleotides include the indicated bond and 2' chemistries, and
the middle 10 nucleotides are the "gap" having OPS chemistry. In
order to evaluate if the NPS TAU GAPmer had a different/superior
biodistribution profile, GAPmer E was radiolabeled it with
Iodine-125. A similar approach was followed to radioactively label
the GAPmer G with Iodine-125.
TABLE-US-00023 TABLE 13 Bond chemistry ASO 2'-O target GAPmer
chemistry ASO sequence site G OPS/OPO-OPS- CCGTTTTCTTACCACCCT
Intron 9 OPS/OPO 2'MOE H NPS/NPO-OPS- CCGUUTTCTTACCACCCU NPS/NPO
2'MOE I NPS-OPS-NPS CCGUUTTCTTACCACCCU 2'MOE
[0350] The radiolabeled compounds were into rats via an intrathecal
bolus injection and imaged the animals in 4.times. during the first
hour after the injection, followed by image acquisitions at 6 hours
and 24 hours, as well as 7 days and 14 days post injection using
single positron emission computed tomography (SPECT/CT). The
results of this biodistribution study indicated that the
comparative GAPmer G travels faster to the brain but quickly clears
out of the brain to reach steady state levels by 6-24 hours post
injection (Tables 14-15). GAPmer E appears to travel slower to the
brain but reaches higher steady state levels in the brain compared
to the comparative GAPmer G (Tables 14-15). In addition, GAPmer E
appears to be retained for a longer period in different CNS regions
(including deeper brain regions and the spinal cord) compared to
the comparative GAPmer G (Tables 14-15). In conclusion, this study
indicates that GAPmer E targeting TAU has longer retention times in
the rodent CNS compared to the comparative GAPmer G.
TABLE-US-00024 TABLE 14 Time (h) 0 0.25 0.5 0.75 6 24 168 336
GAPmer E CSF Cervical Mean 10.8321 8.47327 7.19433 6.66709 1.25181
0.865811 0.537386 0.284057 Percent ID (% ID) SEM 0.866516 0.97213
1.1427 1.15989 0.181687 0.200669 0.260395 0.193775 CSF Cervical
Mean 76.27 59.4654 50.4656 46.7394 9.35959 6.01616 3.29889 1.55895
Percent ID/g (% ID/g) SEM 5.46944 5.69153 7.4367 7.62121 1.20537
1.20406 1.55303 1.02219 CSF Lumbar Mean 0.578109 0.77805 0.723477
0.543578 0.357861 0.301755 0.205616 0.147592 Percent ID (% ID) SEM
0.083627 0.162685 0.065018 0.099339 0.089864 0.085314 0.072481
0.066745 CSF Lumbar Mean 9.35819 12.5983 11.6298 8.69566 5.99358
4.74398 2.40874 1.49488 Percent ID/g (% ID/g) SEM 1.63028 2.93894
1.32603 1.6503 1.66635 1.3636 1.00223 0.783811 CSF Mean 6.95045
7.05609 6.70884 6.29832 1.53496 0.770341 0.287605 0.064824 Thoracic
Percent ID (% ID) SEM 0.882792 0.607619 0.426338 0.308317 0.254473
0.100461 0.065515 0.036388 CSF Mean 40.8075 41.4428 39.4093 37.017
9.19442 4.52467 1.48717 0.316396 Thoracic Percent ID/g (% ID/g) SEM
4.87729 3.1295 1.91031 1.26842 1.46663 0.519338 0.352275 0.18884
Deep Cervical Mean 0.002162 0.015821 0.02634 0.027323 0.250848
0.304756 0.266843 0.259165 Lymph Nodes Percent ID (% ID) SEM
0.001526 0.010442 0.018233 0.016429 0.046625 0.020172 0.026647
0.053091 Deep Cervical Mean 0.078184 0.572226 0.952703 0.988237
9.07292 11.0227 9.65144 9.37372 Lymph Nodes Percent ID/g (% ID/g)
SEM 0.055195 0.37767 0.659483 0.594218 1.68638 0.729592 0.963801
1.92026 Heart Percent Mean 0 0 5.74E-05 5.98E-06 0.022633 0.003495
0.002469 0 ID (% ID) SEM 0 0 5.74E-05 3.85E-06 0.018774 0.001487
0.00104 0 Heart Percent Mean 0 0 3.41E-05 3.55E-06 0.013466
0.002102 0.00132 0 ID/g (% ID/g) SEM 0 0 3.41E-05 2.29E-06 0.01117
0.000884 0.000537 0 Left Kidney Mean 0 0.2285 1.48109 3.79931
13.2502 14.9802 14.8239 14.6498 Percent ID (% ID) SEM 0 0.2285
0.836824 0.946707 0.551601 0.182297 0.319957 0.404948 Left Kidney
Mean 0 0.120413 0.780397 2.00179 6.98143 7.89354 7.81194 7.71641
Percent ID/g (% ID/g) SEM 0 0.120413 0.440991 0.498757 0.29024
0.096685 0.171932 0.214333 Liver Percent Mean 0 6.83E-06 0.034992
0.427209 2.2748 2.27037 1.5343 0.577397 ID (% ID) SEM 0 6.83E-06
0.03359 0.225124 0.179946 0.130887 0.052462 0.214105 Liver Percent
Mean 0 6.62E-06 0.033893 0.413791 2.20335 2.19906 1.48612 0.559262
ID/g (% ID/g) SEM 0 6.62E-06 0.032535 0.218053 0.174294 0.126776
0.050804 0.207381 Right Kidney Mean 0 0.534098 2.54753 4.46871
13.0671 15.5683 14.6128 14.4735 Percent ID (% ID) SEM 0 0.534098
0.871366 0.684733 0.939278 0.407473 0.264569 0.543962 Right Kidney
Mean 0 0.278768 1.32942 2.33193 6.81815 8.12938 7.625 7.45214
Percent ID/g (% ID/g) SEM 0 0.278768 0.454796 0.357303 0.490355
0.212582 0.136791 0.246694 Superficial Mean 0 0.046892 0.076572
0.061611 0.145891 0.202045 0.1679 0.136729 Cervical Lymph Nodes
Percent ID (% ID) SEM 0 0.043098 0.061371 0.044305 0.030862
0.059684 0.02844 0.024512 Superficial Mean 0 3.41878 5.5827 4.49193
10.6365 14.7306 12.2412 9.96856 Cervical Lymph Nodes Percent ID/g
(% ID/g) SEM 0 3.14216 4.47443 3.23018 2.25008 4.35143 2.07352
1.78707 Whole Brain Mean 22.6306 18.8312 16.329 14.815 8.66836
7.84457 6.01653 5.66245 Percent ID (% ID) SEM 1.68624 1.35974
1.61868 1.73388 0.673152 0.358564 0.670171 0.594421 Whole Brain
Mean 13.6667 11.3745 9.8642 8.95243 5.23969 4.71044 3.37774 2.9616
Percent ID/g (% ID/g) SEM 1.05573 0.870626 1.01123 1.08442 0.4077
0.215852 0.355915 0.271713 Comparative GAPmer G CSF Cervical Mean
11.152 9.78028 9.14125 8.59638 1.9599 1.31077 1.13882 1.2578
1.00442 Percent ID (% ID) SEM 0.715641 0.795605 1.21719 1.38085
0.111631 0.099487 0.199524 0.079583 0.056467 CSF Cervical Mean
69.7207 61.0495 57.0796 53.7526 13.4481 9.02884 6.94062 7.68471
5.66153 Percent ID/g (% ID/g) SEM 5.26996 5.0583 7.88092 9.14163
1.06733 0.713906 0.927226 0.479601 0.223667 CSF Lumbar Mean 2.11315
2.30045 2.20845 2.08811 0.876204 0.635229 0.620964 0.614291
0.545859 Percent ID (% ID) SEM 0.618352 0.652777 1.03885 1.15341
0.412648 0.250849 0.310111 0.32343 0.308902 CSF Lumbar Mean 24.3213
26.6065 25.1407 23.8978 11.1123 8.07892 6.36672 5.77421 3.99638
Percent ID/g (% ID/g) SEM 3.8726 4.01662 8.94291 10.8027 4.14563
2.4462 2.55276 2.66268 1.97635 CSF Mean 10.9876 11.8052 11.3563
10.3865 3.01616 1.81053 1.62123 1.69423 1.29347 Thoracic Percent ID
(% ID) SEM 1.59735 2.20522 2.52628 2.30952 0.802764 0.513927
0.564767 0.637544 0.60702 CSF Mean 61.5725 66.1599 63.7407 58.4808
16.3486 9.67105 8.15431 7.78233 5.39928 Thoracic Percent ID/g (%
ID/g) SEM 8.52219 12.087 14.1188 13.1369 4.11143 2.56419 2.62432
2.70691 2.47457 Deep Cervical Mean 0.002608 0.003654 0.00735
0.01125 0.230341 0.309695 0.314805 0.297415 0.277717 Lymph Nodes
Percent ID (% ID) SEM 0.000961 0.002209 0.005015 0.004754 0.02465
0.015466 0.021357 0.029098 0.032069 Deep Cervical Mean 0.09433
0.132166 0.265826 0.406905 8.33121 11.2014 11.3862 10.7572 10.0447
Lymph Nodes Percent ID/g (% ID/g) SEM 0.034745 0.079915 0.18137
0.171952 0.891567 0.559385 0.772444 1.05244 1.15989 Heart Percent
Mean 0 0 0 2.83E-07 0.000858 0.000364 6.15E-05 1.19E-05 0 ID (% ID)
SEM 0 0 0 2.83E-07 0.000396 0.000262 5.77E-05 8.74E-06 0 Heart
Percent Mean 0 0 0 1.73E-07 0.000514 0.000219 3.66E-05 7.10E-06 0
ID/g (% ID/g) SEM 0 0 0 1.73E-07 0.000238 0.000159 3.43E-05
5.20E-06 0 Left Kidney Mean 0 0 0 1.98E-07 6.35087 9.57737 8.88356
8.41903 7.18053 Percent ID (% ID) SEM 0 0 0 1.98E-07 0.425138
0.291836 0.104607 0.091393 0.192997 Left Kidney Mean 0 0 0 1.04E-07
3.34559 5.04636 4.68152 4.43653 3.78354 Percent ID/g (% ID/g) SEM 0
0 0 1.04E-07 0.224155 0.15366 0.054821 0.048046 0.101955 Liver
Percent Mean 0 7.87E-07 0.049536 0.236671 2.22754 2.18954 2.15727
1.72129 0.679184 ID (% ID) SEM 0 7.87E-07 0.049536 0.236671
0.331124 0.179805 0.143902 0.194392 0.131306 Liver Percent Mean 0
7.62E-07 0.04798 0.229237 2.15758 2.12077 2.08951 1.66723 0.657853
ID/g (% ID/g) SEM 0 7.62E-07 0.04798 0.229237 0.320724 0.174158
0.139382 0.188287 0.127182 Right Kidney Mean 0 5.51E-07 0.03343
0.30096 6.55483 9.28232 9.07276 8.78883 7.03309 Percent ID (% ID)
SEM 0 5.51E-07 0.03343 0.30096 0.40552 0.237102 0.49812 0.135909
0.145122 Right Kidney Mean 0 2.87E-07 0.017443 0.157039 3.41996
4.84335 4.73405 4.58643 3.67066 Percent ID/g (% ID/g) SEM 0
2.87E-07 0.017443 0.157039 0.211939 0.124033 0.259718 0.070543
0.075382 Superficial Mean 0 0 0 0 0.083634 0.119283 0.089815
0.079562 0.065506 Cervical Lymph Nodes Percent ID (% ID) SEM 0 0 0
0 0.009542 0.003165 0.01099 0.009958 0.012893 Superficial Mean 0 0
0 0 6.09754 8.69663 6.54821 5.8007 4.77585 Cervical Lymph Nodes
Percent ID/g (% ID/g) SEM 0 0 0 0 0.695718 0.230759 0.801276
0.725998 0.939968 Whole Brain Mean 6.64123 9.64981 11.2795 12.5369
12.9323 11.3917 10.9299 10.5087 9.42048 Percent ID (% ID) SEM
2.56605 2.14697 1.5151 1.90975 1.21462 0.926368 1.03752 0.787061
0.878424 Whole Brain Mean 3.88961 5.63422 6.57098 7.29032 7.62932
6.62764 6.20152 5.81735 4.91559 Percent ID/g (% ID/g) SEM 1.53724
1.29676 0.901465 1.07932 0.683575 0.493438 0.519785 0.38773
0.393178
TABLE-US-00025 TABLE 15 Time (h) 0 0.25 0.5 0.75 6 24 168 336
GAPmer E Amyg- Mean 0.558254 0.465608 0.374387 0.363604 0.193671
0.145925 0.162403 0.132189 dala Percent ID (% ID) SEM 0.146486
0.085887 0.061355 0.06376 0.01351 0.019712 0.018415 0.03282 Amyg-
Mean 12.4998 10.4293 8.40708 8.20394 4.3689 3.30213 3.45771 2.5974
dala Percent ID/g (% ID/g) SEM 3.271 1.86942 1.3765 1.50888
0.219988 0.428221 0.34317 0.596509 Basal Mean 0.767519 0.62213
0.549693 0.510218 0.297928 0.264213 0.203043 0.225742 Ganglia
Percent ID (% ID) SEM 0.068608 0.083157 0.062964 0.055868 0.019889
0.007221 0.011892 0.017126 Basal Mean 7.25586 5.88199 5.19664
4.82425 2.82807 2.46257 1.77921 1.8301 Ganglia Percent ID/g (%
ID/g) SEM 0.67508 0.804694 0.611555 0.54622 0.229958 0.085794
0.115155 0.104202 Cere- Mean 2.25101 2.49838 2.55948 2.42798
1.57106 1.66827 0.814148 0.825403 bellum Percent ID (% ID) SEM
1.04215 1.01889 0.900513 0.90006 0.372103 0.229306 0.281224
0.239811 Cere- Mean 8.96768 9.93683 10.1651 9.64754 6.18103 6.58847
2.98996 2.83458 bellum Percent ID/g (% ID/g) SEM 4.22932 4.12692
3.65992 3.65352 1.44985 0.938476 1.02327 0.777901 Corpus Mean
0.139098 0.137391 0.165203 0.142788 0.201672 0.202275 0.181619
0.161023 Callo- sum Percent ID (% ID) SEM 0.063509 0.040645
0.030314 0.018416 0.006557 0.015083 0.014325 0.012048 Corpus Mean
2.52116 2.49178 3.00274 2.59406 3.59332 3.60851 3.05074 2.50267
Callo- sum Percent ID/g (% ID/g) SEM 1.15695 0.739006 0.558865
0.341001 0.064465 0.260085 0.1886 0.162241 Cortex Mean 1.84462
1.96281 2.07334 2.01485 2.27264 2.15832 1.53834 1.35196 Percent ID
(% ID) SEM 0.688596 0.505144 0.440341 0.311568 0.065798 0.138068
0.179699 0.159366 Cortex Mean 3.75097 3.99196 4.21446 4.09784
4.62061 4.35001 2.90653 2.37314 Percent ID/g (% ID/g) SEM 1.39426
1.02969 0.895021 0.647193 0.113702 0.272193 0.300372 0.222281
Hippo- Mean 1.67603 1.44975 1.3333 1.24861 0.753141 0.621775
0.655031 0.622615 campus Percent ID (% ID) SEM 0.395049 0.320656
0.247148 0.243271 0.042542 0.093431 0.051347 0.069541 Hippo- Mean
13.3312 11.5318 10.6079 9.93388 6.04367 4.96917 4.88174 4.32414
campus Percent ID/g (% ID/g) SEM 3.11226 2.52497 1.94088 1.91141
0.22641 0.739201 0.319607 0.503837 Hypo- Mean 1.79208 1.26239
0.822021 0.791454 0.309715 0.211226 0.232952 0.209212 thalamus
Percent ID (% ID) SEM 0.018149 0.044894 0.084551 0.084724 0.038108
0.02012 0.019585 0.00656 Hypo- Mean 31.8662 22.4567 14.6046 14.0554
5.4763 3.65892 3.80714 3.15945 thalamus Percent ID/g (% ID/g) SEM
0.622153 0.985153 1.47659 1.45413 0.653269 0.367921 0.285807
0.194668 Midbrain Mean 8.43844 6.14699 4.92599 4.21695 1.50607
1.25278 1.06369 1.03389 Percent ID (% ID) SEM 0.549632 0.264854
0.452126 0.348737 0.115545 0.117172 0.118459 0.088184 Midbrain Mean
29.2339 21.3004 17.0721 14.6209 5.22178 4.3333 3.41371 3.10658
Percent ID/g (% ID/g) SEM 1.78711 0.839541 1.54884 1.22482 0.371463
0.409401 0.363526 0.234564 Olfac- Mean 3.09383 2.72917 2.23702
1.91561 1.01767 0.868984 0.679099 0.624027 tory Percent ID (% ID)
SEM 0.423405 0.335251 0.27618 0.246519 0.119007 0.04595 0.047811
0.010891 Olfac- Mean 38.9729 34.3305 28.1563 24.1244 12.8281 10.802
7.93742 6.82911 tory Percent ID/g (% ID/g) SEM 5.78777 4.48914
3.75756 3.37889 1.61001 0.633288 0.584199 0.18264 Other Mean
0.343633 0.279426 0.239164 0.209768 0.100025 0.08652 0.085407
0.085755 (Vent- ricles) Percent ID (% ID) SEM 0.059376 0.046773
0.034903 0.025436 0.005734 0.009182 0.004352 0.009717 Other Mean
15.7006 12.7644 10.9255 9.58606 4.63014 3.97221 3.61689 3.41809
(Vent- ricles) Percent ID/g (% ID/g) SEM 2.70418 2.12314 1.58033
1.15794 0.165485 0.42827 0.121301 0.373455 Septal Mean 0.073996
0.058791 0.063152 0.050917 0.02835 0.026065 0.016707 0.018377 Area
Percent ID (% ID) SEM 0.045267 0.028474 0.016226 0.011536 0.002718
0.002504 0.001675 7.06E-05 Septal Mean 6.01601 4.78158 5.12945
4.13132 2.29807 2.04259 1.24867 1.33379 Area Percent ID/g (% ID/g)
SEM 3.70113 2.33093 1.33813 0.949408 0.276602 0.182851 0.154458
0.0225 Thal- Mean 0.355264 0.293372 0.267919 0.271126 0.16181
0.136424 0.194221 0.189016 amus Percent ID (% ID) SEM 0.107897
0.058708 0.039629 0.057802 0.017602 0.027896 0.006076 0.011428
Thal- Mean 5.2993 4.37887 4.00206 4.04775 2.40781 2.02639 2.69809
2.39589 amus Percent ID/g (% ID/g) SEM 1.59833 0.871224 0.598227
0.861554 0.226053 0.394538 0.073301 0.192872 White Mean 1.29678
0.924978 0.718283 0.651161 0.254615 0.201785 0.189864 0.183236
Matter Percent ID (% ID) SEM 0.078326 0.045632 0.010753 0.044752
0.018402 0.019568 0.008725 0.017793 White Mean 24.0762 17.1758
13.3413 12.1025 4.75988 3.7307 3.28689 2.97632 Matter Percent ID/g
(% ID/g) SEM 1.35368 0.787724 0.180212 0.879991 0.390942 0.330414
0.145634 0.272604 Whole Mean 22.6306 18.8312 16.329 14.815 8.66836
7.84457 6.01653 5.66245 Brain Percent ID (% ID) SEM 1.68624 1.35974
1.61868 1.73388 0.673152 0.358564 0.670171 0.594421 Whole Mean
13.6667 11.3745 9.8642 8.95243 5.23969 4.71044 3.37774 2.9616 Brain
Percent ID/g (% ID/g) SEM 1.05573 0.870626 1.01123 1.08442 0.4077
0.215852 0.355915 0.271713 Comparative GAPmer G Amyg- Mean 0.07025
0.157133 0.182216 0.204618 0.343688 0.239396 0.238917 0.269154
0.233677 dala Percent ID (% ID) SEM 0.063589 0.103704 0.085755
0.077849 0.030438 0.005162 0.01289 0.008577 0.01741 Amyg- Mean
1.59871 3.55317 4.09803 4.58765 7.5081 5.19617 5.055 5.67473
4.60241 dala Percent ID/g (% ID/g) SEM 1.45175 2.37755 1.9771
1.79353 0.641745 0.156614 0.257744 0.207565 0.250856 Basal Mean
0.117021 0.21681 0.26589 0.306323 0.381952 0.370599 0.337719
0.336959 0.313839 Ganglia Percent ID (% ID) SEM 0.076931 0.088946
0.044903 0.051348 0.066725 0.023366 0.027073 0.005895 0.040156
Basal Mean 1.0588 1.96201 2.40278 2.76795 3.51276 3.33342 2.95949
2.87515 2.55187 Ganglia Percent ID/g (% ID/g) SEM 0.696112 0.806687
0.414127 0.475621 0.611781 0.196289 0.218288 0.033142 0.308451
Cere- Mean 0.377037 1.0096 1.6223 1.9812 2.21016 2.45293 2.25788
1.87032 1.68511 bellum Percent
ID (% ID) SEM 0.190099 0.127709 0.076476 0.217865 0.397162 0.248084
0.392909 0.16277 0.129536 Cere- Mean 1.43098 3.80814 6.10942
7.43788 8.66211 9.3077 8.35519 6.85223 5.74023 bellum Percent ID/g
(% ID/g) SEM 0.73404 0.520186 0.338803 0.743845 1.65949 0.83535
1.37758 0.568067 0.397753 Corpus Mean 0.022238 0.055967 0.080598
0.09326 0.320271 0.284835 0.303873 0.289287 0.24998 Callo- sum
Percent ID (% ID) SEM 0.02222 0.041424 0.041437 0.037288 0.063501
0.024991 0.027853 0.028854 0.028791 Corpus Mean 0.39108 0.9794
1.40316 1.61839 5.59917 4.88872 5.14219 4.79623 3.87539 Callo- sum
Percent ID/g (% ID/g) SEM 0.39077 0.730546 0.730645 0.654849
1.08746 0.386997 0.447732 0.457439 0.399475 Cortex Mean 0.220028
0.633967 0.867894 1.11482 2.9228 2.62081 2.57875 2.38031 2.0868
Percent ID (% ID) SEM 0.20834 0.32453 0.269076 0.261392 0.426537
0.262245 0.251051 0.250084 0.291286 Cortex Mean 0.436481 1.2498
1.70512 2.18607 5.78025 5.13609 4.93298 4.41018 3.66582 Percent
ID/g (% ID/g) SEM 0.413775 0.648254 0.538842 0.519404 0.806778
0.471369 0.420487 0.441617 0.461271 Hippo- Mean 0.35119 0.748223
0.836605 1.01328 1.24774 0.976929 0.9861 1.09848 0.96287 campus
Percent ID (% ID) SEM 0.308774 0.413338 0.32756 0.327609 0.201253
0.042564 0.049536 0.086952 0.061749 Hippo- Mean 2.75325 5.82967
6.49002 7.83626 9.76959 7.54148 7.41702 8.09684 6.64111 campus
Percent ID/g (% ID/g) SEM 2.43034 3.26845 2.58722 2.55293 1.5319
0.392925 0.41303 0.588516 0.324495 Hypo- Mean 0.310676 0.556035
0.632061 0.647227 0.468645 0.316754 0.294092 0.307265 0.277475
thalamus Percent ID (% ID) SEM 0.19552 0.167087 0.086168 0.096156
0.072388 0.015545 0.029589 0.00855 0.052414 Hypo- Mean 5.45031
9.68302 10.9582 11.188 7.93032 5.33595 4.83903 4.86859 4.20649
thalamus Percent ID/g (% ID/g) SEM 3.45552 2.98698 1.56155 1.64189
1.23903 0.312465 0.488397 0.069093 0.753838 Midbrain Mean 4.33614
4.6489 4.70957 4.77253 2.81178 2.22989 2.22287 2.24199 2.04046
Percent ID (% ID) SEM 1.09108 0.472434 0.556198 0.860335 0.311395
0.227459 0.239223 0.196013 0.167723 Midbrain Mean 14.6252 15.6356
15.8197 16.0115 9.51511 7.46745 7.27228 7.12792 6.11257 Percent
ID/g (% ID/g) SEM 3.79365 1.65574 1.83494 2.81171 0.986306 0.733658
0.693298 0.567999 0.444177 Olfac- Mean 0.149962 0.632525 1.03599
1.26658 1.24326 1.13771 0.958425 0.900536 0.821473 tory Percent ID
(% ID) SEM 0.145638 0.32823 0.247651 0.241037 0.123074 0.089789
0.128224 0.064184 0.067165 Olfac- Mean 1.87276 7.74847 12.5673
15.3101 15.3729 13.899 11.474 10.5042 9.0143 tory Percent ID/g (%
ID/g) SEM 1.82129 4.07012 2.99221 2.78286 1.67593 0.859927 1.24418
0.559225 0.567696 Other Mean 0.103703 0.185432 0.194473 0.217117
0.197903 0.151701 0.149739 0.171693 0.151244 (Vent- ricles) Percent
ID (% ID) SEM 0.064701 0.053473 0.042229 0.048518 0.031704 0.012028
0.013804 0.020145 0.013969 Other Mean 4.78859 8.43852 8.78707
9.76454 8.6628 6.77372 6.44925 7.21803 5.96959 (Vent- ricles)
Percent ID/g (% ID/g) SEM 3.07256 2.59532 1.96278 2.10578 1.32337
0.539855 0.494456 0.807697 0.44098 Septal Mean 0.001539 0.006606
0.015932 0.018396 0.039833 0.035454 0.030647 0.032093 0.029051 Area
Percent ID (% ID) SEM 0.001539 0.003583 8.82E-05 0.003932 0.01193
0.003715 0.009077 0.001693 0.005864 Septal Mean 0.120801 0.527008
1.27118 1.46742 3.10952 2.7415 2.29345 2.38383 1.99012 Area Percent
ID/g (% ID/g) SEM 0.120767 0.282368 0.015955 0.309541 0.891273
0.298319 0.674918 0.108081 0.356811 Thal- Mean 0.092871 0.150887
0.196566 0.219307 0.330367 0.230327 0.239492 0.267022 0.259107 amus
Percent ID (% ID) SEM 0.087919 0.09502 0.106559 0.089875 0.103733
0.028211 0.016836 0.038453 0.035847 Thal- Mean 1.35285 2.1754
2.82156 3.12705 4.75564 3.29927 3.32141 3.61865 3.31424 amus
Percent ID/g (% ID/g) SEM 1.28417 1.39631 1.56503 1.3048 1.432
0.397001 0.246257 0.503694 0.400364 White Mean 0.488571 0.647725
0.639413 0.682258 0.413888 0.344319 0.331351 0.343591 0.309396
Matter Percent ID (% ID) SEM 0.165272 0.08416 0.056944 0.104846
0.047088 0.032138 0.028182 0.022572 0.029752 White Mean 8.95911
11.7844 11.5942 12.3289 7.60563 6.27336 5.76995 5.89313 4.99564
Matter Percent ID/g (% ID/g) SEM 3.18773 1.61296 0.885738 1.64353
0.721249 0.575411 0.454626 0.362268 0.449234 Whole Mean 6.64123
9.64981 11.2795 12.5369 12.9323 11.3917 10.9299 10.5087 9.42048
Brain Percent ID (% ID) SEM 2.56605 2.14697 1.5151 1.90975 1.21462
0.926368 1.03752 0.787061 0.878424 Whole Mean 3.88961 5.63422
6.57098 7.29032 7.62932 6.62764 6.20152 5.81735 4.91559 Brain
Percent ID/g (% ID/g) SEM 1.53724 1.29676 0.901465 1.07932 0.683575
0.493438 0.519785 0.38773 0.393178
Evaluation of TAU GAPmers in Human iPSC-Derived Neurons
[0351] Next, the efficacy of one of the lead GAPmers (GAPmer E) was
compared with the efficacy of the Ionis TAU GAPmer (GAPmer G) in
reducing TAU mRNA in human iPSC-derived neurons (iNeurons).
iNeurons were treated with various doses of both GAPmers for a
total period of 72 hours and collected total cellular RNA. TAU mRNA
was measured with 6 different assays as well as with 3R and 4R TAU
specific assays (Table 16). Both compounds dose-dependently reduced
TAU mRNA levels. However, GAPmer E consistently showed .about.0.4-5
times smaller IC.sub.50 values indicating that the GAPmer is more
potent than GAPmer G.
TABLE-US-00026 TABLE 16 Log GAPmer G GAPmer E Dose (mM) Avg SEM N
Avg SEM N total TAU mRNA assay JPNV-1 -4.41 100.00 5.26 2.00 100.00
8.90 2.00 -4.11 105.73 7.76 2.00 66.20 7.97 2.00 -3.81 76.81 3.49
2.00 57.05 0.89 2.00 -3.51 59.15 5.15 2.00 53.71 4.27 2.00 -3.20
73.86 3.19 2.00 56.45 3.76 2.00 -2.90 75.20 1.16 2.00 52.56 2.43
2.00 -2.60 60.12 3.61 2.00 42.05 2.25 2.00 -2.30 51.36 4.79 2.00
39.61 3.82 2.00 -2.00 43.01 2.99 2.00 30.64 1.39 2.00 -1.70 43.88
1.82 2.00 33.58 1.55 2.00 total TAU mRNA assay JPNV-2 -4.41 100.00
6.41 2.00 100.00 6.21 2.00 -4.11 24.84 1.80 2.00 20.00 1.19 2.00
-3.81 56.59 2.16 2.00 48.73 4.79 2.00 -3.51 51.51 3.69 2.00 35.98
1.63 2.00 -3.20 51.49 1.82 2.00 36.62 2.60 2.00 -2.90 53.65 1.19
2.00 37.02 0.96 2.00 -2.60 40.99 2.12 2.00 29.15 1.35 2.00 -2.30
39.59 1.79 2.00 29.71 2.44 2.00 -2.00 34.02 1.03 2.00 25.37 1.82
2.00 -1.70 29.58 2.78 2.00 24.24 0.94 2.00 3R TAU mRNA assay -4.41
100.00 5.06 2.00 100.00 6.68 2.00 -4.11 98.52 6.40 2.00 70.06 4.91
2.00 -3.81 67.36 2.95 2.00 51.92 1.81 2.00 -3.51 73.28 5.54 2.00
46.44 2.02 2.00 -3.20 78.75 7.03 2.00 54.94 4.38 2.00 -2.90 72.16
3.92 2.00 49.60 1.83 2.00 -2.60 55.58 6.73 2.00 36.87 3.68 2.00
-2.30 55.57 2.90 2.00 38.88 1.99 2.00 -2.00 46.08 3.19 2.00 31.61
3.47 2.00 -1.70 46.00 2.33 2.00 28.60 1.53 2.00 4R TAU mRNA assay
-4.41 100.00 8.07 2.00 100.00 8.66 2.00 -4.11 98.95 10.45 2.00
68.72 10.10 2.00 -3.81 71.44 7.35 2.00 66.14 9.41 2.00 -3.51 86.77
10.41 2.00 45.76 5.40 2.00 -3.20 89.66 4.77 2.00 59.82 4.93 2.00
-2.90 75.93 5.07 2.00 51.76 4.18 2.00 -2.60 74.03 5.98 2.00 44.10
5.51 2.00 -2.30 62.73 4.05 2.00 43.65 5.14 2.00 -2.00 60.46 5.68
2.00 38.37 4.26 2.00 -1.70 61.52 5.36 2.00 28.82 1.55 2.00 total
TAU mRNA assay B01 -4.41 100.00 4.14 2.00 100.00 5.90 2.00 -4.11
111.85 13.42 2.00 67.28 2.70 2.00 -3.81 58.26 1.91 2.00 45.92 1.66
2.00 -3.51 57.40 5.01 2.00 39.63 3.68 2.00 -3.20 51.69 1.20 2.00
37.51 1.63 2.00 -2.90 49.11 3.05 2.00 35.71 3.17 2.00 -2.60 43.08
2.04 2.00 29.67 1.24 2.00 -2.30 36.56 3.01 2.00 27.05 1.49 2.00
-2.00 33.47 1.85 2.00 25.92 1.70 2.00 -1.70 31.96 1.35 2.00 23.63
1.12 2.00 total TAU mRNA assay B02 -4.41 100.00 18.06 2.00 100.00
16.10 2.00 -4.11 89.43 13.92 2.00 86.50 6.39 2.00 -3.81 76.62 4.87
2.00 73.14 3.78 2.00 -3.51 76.28 5.80 2.00 70.26 5.44 2.00 -3.20
57.42 22.00 2.00 62.15 22.69 2.00 -2.90 56.07 17.26 2.00 66.44
25.75 2.00 -2.60 56.68 5.62 2.00 50.53 6.40 2.00 -2.30 56.02 5.75
2.00 54.94 3.18 2.00 -2.00 58.70 4.16 2.00 48.44 2.30 2.00 -1.70
60.05 4.55 2.00 50.47 2.71 2.00 total TAU mRNA assay B04 -4.41
100.00 6.21 2.00 100.00 9.22 2.00 -4.11 99.83 7.72 2.00 71.27 4.72
2.00 -3.81 91.52 9.34 2.00 59.20 3.96 2.00 -3.51 91.28 6.40 2.00
62.05 3.23 2.00 -3.20 96.69 3.34 2.00 65.94 4.10 2.00 -2.90 88.52
4.15 2.00 57.63 4.19 2.00 -2.60 73.91 6.53 2.00 47.11 1.37 2.00
-2.30 72.26 3.42 2.00 46.09 3.69 2.00 -2.00 71.32 2.46 2.00 43.76
2.19 2.00 -1.70 74.91 5.87 2.00 42.52 3.95 2.00 total TAU mRNA
assay B06 -4.41 100.00 105.59 2.00 100.00 110.27 2.00 -4.11 124.26
111.64 2.00 51.19 72.99 2.00 -3.81 150.32 81.10 2.00 42.93 62.90
2.00 -3.51 103.10 62.46 2.00 34.99 59.23 2.00 -3.20 53.75 77.99
2.00 44.52 62.24 2.00 -2.90 66.83 79.40 2.00 45.46 57.96 2.00 -2.60
105.07 63.48 2.00 14.83 46.37 2.00 -2.30 55.09 54.23 2.00 39.97
43.68 2.00 -2.00 39.68 45.41 2.00 23.71 33.79 2.00 -1.70 94.51
46.33 2.00 42.82 37.02 2.00
[0352] Method of Treatment
[0353] An adult human suffering from a tauopathy such as
Alzheimer's disease (AD) is administered via any suitable route of
administration such as intrathecal or intracerebroventricular route
of administration a therapeutically effective compound of an
oligonucleotide of the present disclosure, for example, an
oligonucleotide having a nucleobase sequence corresponding to SEQ
ID NO: 1 and modified according to the present disclosure. Suitable
routes of administration may include systemic administration such
as intravenous or subcutaneous routes of administration or
administration directly to the CNS via intrathecal or
intracerebroventricular routes of administration. Treatment is
continued until one or more symptoms of tauopathy such as AD is
ameliorated, or for example, tau protein levels are reduced.
Sequence CWU 1
1
44120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 1gcttttactg accatgcgag
20220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 2gcuuutactg
accatgcgag 20320DNAHomo sapiens 3ctcgcatggt cagtaaaagc 20420DNAHomo
sapiens 4ggaagcgatg acaaaaaagc 20520DNAHomo sapiens 5ggctcaaagg
ataatatcaa 20620DNAHomo sapiens 6ggtccctgga caatatcacc
20720DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 7ccttccctga aggttcctcc
20820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 8cctccaagtg tggctcatta
20917DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 9cagtggtccg tactcca 171020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 10attgaaaccc acaagctgac 201120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 11tcaggtgaac tttgaaccag 201221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 12ccaagtgtgg ctcattaggc a 211321DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 13gagtccagtc gaagattggg t 211419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 14aggcgggaag gtgcaaata 191521DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 15cgggaaggtg cagataatta a 211620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 16caatcttcga ctggactctg 201720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 17tggacttgac attcttcagg 201820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 18gaggagacat tgctgagatg 201920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 19cttccatcac ttcgaactcc 202022DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 20ccaatcttcg actggactct gt 222121DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 21ggcgagtcta ccatgtcgat g 212221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 22gccacctcct ggtttatgat g 212319DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 23tatttgcaca ctgccgcct 192421DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 24aaggtgaagg tcggagtcaa c 212522DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 25ggggtcattg atggcaacaa ta 222623DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 26ttatcccgga agctaaacag tgg 232722DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 27gtagcctcat attctcctgt gc 222821DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 28gggagaccca aaggggagta t 212922DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 29ggagcggaat ctctctagtg ag 223022DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 30actataatgc aacgactccc ct 223121DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 31cttcctgctg aatacgggct g 213221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 32cacctccaca gtacatccac c 213323DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 33tgatagggat ctagtgctga agg 233422DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 34tcattgtgga agttttcgag ca 223521DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 35tgcggtaacc agacagatac a 213620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 36tagccgctca ttccgatcac 203719DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 37gggatgccat tcccgcttt 193821DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 38tcacgtcatg tacgacatcc c 213920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 39gtggcagctt gagggctaag 204020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 40gcuuutttgt catcgcuucc
204120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 41uugauattat
cctttgagcc 204220DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 42ggugatattg tccagggacc
204318DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 43ccgttttctt accaccct
184418DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 44ccguuttctt
accacccu 18
* * * * *