U.S. patent application number 16/595924 was filed with the patent office on 2020-12-10 for modulation of signal transducer and activator of transcription 3 (stat3) expression.
The applicant listed for this patent is Susan M. FREIER, Youngsoo KIM, Robert A. MACLEOD, Eric E. SWAYZE. Invention is credited to Susan M. FREIER, Youngsoo KIM, Robert A. MACLEOD, Eric E. SWAYZE.
Application Number | 20200385716 16/595924 |
Document ID | / |
Family ID | 1000005039012 |
Filed Date | 2020-12-10 |
United States Patent
Application |
20200385716 |
Kind Code |
A1 |
SWAYZE; Eric E. ; et
al. |
December 10, 2020 |
MODULATION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3
(STAT3) EXPRESSION
Abstract
Disclosed herein are antisense compounds and methods for
decreasing STAT3 mRNA and protein expression. Such methods,
compounds, and compositions are useful to treat, prevent, or
ameliorate hyperproliferative diseases.
Inventors: |
SWAYZE; Eric E.; (Carlsbad,
CA) ; FREIER; Susan M.; (Carlsbad, CA) ;
MACLEOD; Robert A.; (Carlsbad, CA) ; KIM;
Youngsoo; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SWAYZE; Eric E.
FREIER; Susan M.
MACLEOD; Robert A.
KIM; Youngsoo |
Carlsbad
Carlsbad
Carlsbad
San Diego |
CA
CA
CA
CA |
US
US
US
US |
|
|
Family ID: |
1000005039012 |
Appl. No.: |
16/595924 |
Filed: |
October 8, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15149642 |
May 9, 2016 |
10479993 |
|
|
16595924 |
|
|
|
|
14338880 |
Jul 23, 2014 |
9359608 |
|
|
15149642 |
|
|
|
|
13436558 |
Mar 30, 2012 |
8816056 |
|
|
14338880 |
|
|
|
|
61558316 |
Nov 10, 2011 |
|
|
|
61558308 |
Nov 10, 2011 |
|
|
|
61471045 |
Apr 1, 2011 |
|
|
|
61471035 |
Apr 1, 2011 |
|
|
|
61471015 |
Apr 1, 2011 |
|
|
|
61471001 |
Apr 1, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2320/30 20130101;
C12N 15/113 20130101; C12N 2310/3341 20130101; C12N 2310/315
20130101; C12N 15/1135 20130101; C12N 15/00 20130101; C07H 21/00
20130101; C12N 2310/341 20130101; C12N 2310/346 20130101; C12N
2310/3231 20130101; C12N 2310/11 20130101; C12N 15/11 20130101;
C07H 21/04 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C07H 21/00 20060101 C07H021/00; C07H 21/04 20060101
C07H021/04; C12N 15/00 20060101 C12N015/00; C12N 15/11 20060101
C12N015/11 |
Claims
1-76. (canceled)
77. A sodium salt of a single stranded modified oligonucleotide
consisting of 12 to 30 linked nucleosides having a nucleobase
sequence comprising at least 12 contiguous nucleobases of the
nucleobase sequence of SEQ ID NO: 245.
78. The sodium salt of a single stranded modified oligonucleotide
of claim 77, wherein the nucleobase sequence of the modified
single-stranded oligonucleotide comprises the sequence of SEQ ID
NO: 245.
79. The sodium salt of a single stranded modified oligonucleotide
of claim 77, wherein the nucleobase sequence of the modified
single-stranded oligonucleotide consists of the sequence of SEQ ID
NO: 245.
80. A pharmaceutical composition comprising the sodium salt of a
single stranded modified oligonucleotide of claim 77, and a
pharmaceutically acceptable diluent or carrier.
81. A method of treating cancer in an animal, comprising
administering to the animal the pharmaceutical composition of claim
80.
82. The method of claim 81, wherein the cancer is chosen from lung
cancer, pancreatic cancer, colorectal cancer, multiple myeloma,
hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer,
osteosarcoma, head and neck cancer, breast cancer, epidermoid
carcinomas, intestinal adenomas, prostate cancer, and gastric
cancer.
83. The method of claim 82, wherein the cancer is non-small cell
lung cancer.
84. The method of claim 82, wherein the cancer is hepatocellular
carcinoma.
85. The method of claim 82, wherein the cancer is head and neck
cancer.
86. The sodium salt of a single stranded modified oligonucleotide
of claim 77, wherein the single-stranded modified oligonucleotide
consists of 16 linked nucleosides having a nucleobase sequence
consisting of SEQ ID NO: 245, and comprises: a gap segment
consisting often linked deoxynucleosides; a 5' wing segment
consisting of 3 linked nucleosides; and a 3' wing segment
consisting of 3 linked nucleosides; wherein the gap segment is
positioned between the 5' wing segment and the 3' wing segment;
wherein each nucleoside of each wing segment comprises a
constrained ethyl nucleoside; wherein each internucleoside linkage
of the modified oligonucleotide is a phosphorothioate linkage; and
wherein each cytosine of the modified oligonucleotide is a
5-methylcytosine.
87. A potassium salt of a single stranded modified oligonucleotide
consisting of 12 to 30 linked nucleosides having a nucleobase
sequence comprising at least 12 contiguous nucleobases of the
nucleobase sequence of SEQ ID NO: 245.
88. The potassium salt of a single stranded modified
oligonucleotide of claim 87, wherein the nucleobase sequence of the
modified single-stranded oligonucleotide comprises the sequence of
SEQ ID NO: 245.
89. The potassium salt of a single stranded modified
oligonucleotide of claim 87, wherein the nucleobase sequence of the
modified single-stranded oligonucleotide consists of the sequence
of SEQ ID NO: 245.
90. A pharmaceutical composition comprising a potassium salt of the
single stranded modified oligonucleotide of claim 87, and a
pharmaceutically acceptable diluent or carrier.
91. A method of treating cancer in an animal, comprising
administering to the animal the pharmaceutical composition of claim
90.
92. The method of claim 91, wherein the cancer is chosen from lung
cancer, pancreatic cancer, colorectal cancer, multiple myeloma,
hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer,
osteosarcoma, head and neck cancer, breast cancer, epidermoid
carcinomas, intestinal adenomas, prostate cancer, and gastric
cancer.
93. The method of claim 92, wherein the cancer is non-small cell
lung cancer.
94. The method of claim 92, wherein the cancer is hepatocellular
carcinoma.
95. The method of claim 92, wherein the cancer is head and neck
cancer.
96. The potassium salt of the single stranded modified
oligonucleotide of claim 87, wherein the single-stranded modified
oligonucleotide consists of 16 linked nucleosides having a
nucleobase sequence consisting of SEQ ID NO: 245 and comprises: a
gap segment consisting of ten linked deoxynucleosides; a 5' wing
segment consisting of 3 linked nucleosides; and a 3' wing segment
consisting of 3 linked nucleosides; wherein the gap segment is
positioned between the 5' wing segment and the 3' wing segment;
wherein each nucleoside of each wing segment comprises a
constrained ethyl nucleoside; wherein each internucleoside linkage
of the modified oligonucleotide is a phosphorothioate linkage; and
wherein each cytosine of the modified oligonucleotide is a
5-methylcytosine.
Description
RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 14/338,880, filed Jul. 23, 2014, which
is a continuation application of U.S. patent application Ser. No.
13/436,558, filed Mar. 30, 2012 (now U.S. Pat. No. 8,816,056,
issued Aug. 26, 2014), which claims priority under 35 USC 119(e) to
Provisional Patent Application No. 61/471,035, filed Apr. 1, 2011,
Provisional Patent Application No. 61/471,001, filed Apr. 1, 2011,
Provisional Patent Application No. 61/471,045, filed Apr. 1, 2011,
Provisional Patent Application No. 61/471,015, filed Apr. 1, 2011,
Provisional Patent Application No. 61/558,308, filed Nov. 10, 2011,
and Provisional Patent Application No. 61/558,316, filed Nov. 10,
2011, each of which is incorporated herein by reference in its
entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled 200152-US-CNT[2] Sequence Listing.txt created Apr.
18, 2016, which is 673 Kb in size. The information in the
electronic format of the sequence listing is incorporated herein by
reference in its entirety.
FIELD
[0003] In certain embodiments provided are methods, compounds, and
compositions for inhibiting expression of STAT3 mRNA and protein in
an animal. Such methods, compounds, and compositions are useful to
treat, prevent, or ameliorate hyperproliferative diseases.
BACKGROUND
[0004] The STAT (signal transducers and activators of
transcription) family of proteins are DNA-binding proteins that
play a dual role in signal transduction and activation of
transcription. Presently, there are six distinct members of the
STAT family (STAT1, STAT2, STAT3, STAT4, STAT5, and STATE) and
several isoforms (STAT1.alpha., STAT1.beta., STAT3 .alpha. and
STAT3.beta.). The activities of the STATs are modulated by various
cytokines and mitogenic stimuli. Binding of a cytokine to its
receptor results in the activation of Janus protein tyrosine
kinases (JAKs) associated with these receptors. This phosphorylates
STAT, resulting in translocation to the nucleus and transcriptional
activation of STAT responsive genes. Phosphorylation on a specific
tyrosine residue on the STATs results in their activation,
resulting in the formation of homodimers and/or heterodimers of
STAT which bind to specific gene promoter sequences. Events
mediated by cytokines through STAT activation include cell
proliferation and differentiation and prevention of apoptosis.
[0005] The specificity of STAT activation is due to specific
cytokines, i.e., each STAT is responsive to a small number of
specific cytokines. Other non-cytokine signaling molecules, such as
growth factors, have also been found to activate STATs. Binding of
these factors to a cell surface receptor associated with protein
tyrosine kinase also results in phosphorylation of STAT.
[0006] STAT3 (also acute phase response factor (APRF)), in
particular, has been found to be responsive to interleukin-6 (IL-6)
as well as epidermal growth factor (EGF) (Darnell, Jr., J. E., et
al., Science, 1994, 264, 1415-1421). In addition, STAT3 has been
found to have an important role in signal transduction by
interferons (Yang, C.-H., et al., Proc. Natl. Acad. Sci. USA, 1998,
95, 5568-5572). Evidence exists suggesting that STAT3 may be
regulated by the MAPK pathway. ERK2 induces serine phosphorylation
and also associates with STAT3 (Jain, N., et al., Oncogene, 1998,
17, 3157-3167).
[0007] STAT3 is expressed in most cell types (Zhong, Z., et al.,
Proc. Natl. Acad. Sci. USA, 1994, 91, 4806-4810). It induces the
expression of genes involved in response to tissue injury and
inflammation. STAT3 has also been shown to prevent apoptosis
through the expression of bcl-2 (Fukada, T., et al., Immunity,
1996, 5, 449-460).
[0008] Recently, STAT3 was detected in the mitochondria of
transformed cells, and was shown to facilitate glycolytic and
oxidative phosphorylation activities similar to that of cancer
cells (Gough, D. J., et al., Science, 2009, 324, 1713-1716). The
inhibition of STAT3 in the mitochondria impaired malignant
transformation by activated Ras. The data confirms a Ras-mediated
transformation function for STAT3 in the mitochondria in addition
to its nuclear roles.
[0009] Aberrant expression of or constitutive expression of STAT3
is associated with a number of disease processes.
SUMMARY
[0010] Provided herein are methods, compounds, and compositions for
modulating expression of STAT3 mRNA and protein. In certain
embodiments, compounds useful for modulating expression of STAT3
mRNA and protein are antisense compounds. In certain embodiments,
the antisense compounds are antisense oligonucleotides.
[0011] In certain embodiments, modulation can occur in a cell or
tissue. In certain embodiments, the cell or tissue is in an animal.
In certain embodiments, the animal is a human. In certain
embodiments, STAT3 mRNA levels are reduced. In certain embodiments,
STAT3 protein levels are reduced. Such reduction can occur in a
time-dependent manner or in a dose-dependent manner.
[0012] Also provided are methods, compounds, and compositions
useful for preventing, treating, and ameliorating diseases,
disorders, and conditions. In certain embodiments, such diseases,
disorders, and conditions are hyperproliferative diseases,
disorders, and conditions. In certain embodiments such
hyperproliferative diseases, disorders, and conditions include
cancer as well as associated malignancies and metastases. In
certain embodiments, such cancers include lung cancer, including
non small cell lung cancer (NSCLC), pancreatic cancer, colorectal
cancer, multiple myeloma, hepatocellular carcinoma (HCC),
glioblastoma, ovarian cancer, osteosarcoma, head and neck cancer,
breast cancer, epidermoid carcinomas, intestinal adenomas, prostate
cancer, and gastric cancer.
[0013] Such diseases, disorders, and conditions can have one or
more risk factors, causes, or outcomes in common. Certain risk
factors and causes for development of a hyperproliferative disease
include growing older; tobacco use; exposure to sunlight and
ionizing radiation; contact with certain chemicals; infection with
certain viruses and bacteria; certain hormone therapies; family
history of cancer; alcohol use; and certain lifestyle choices
including poor diet, lack of physical activity, and/or being
overweight. Certain symptoms and outcomes associated with
development of a hyperproliferative disease include a thickening or
lump in the breast or any other part of the body; a new mole or a
change in an existing mole; a sore that does not heal; hoarseness
or a cough that does not go away; changes in bowel or bladder
habits; discomfort after eating; difficulty in swallowing;
unexplained weight gain or loss; unusual bleeding or discharge;
fatigue; metastasis of one or more tumors throughout the body;
cardiovascular complications, including, cardiac arrest and stroke;
and death.
[0014] In certain embodiments, methods of treatment include
administering a STAT3 antisense compound to an individual in need
thereof. In certain embodiments, methods of treatment include
administering a STAT3 antisense oligonucleotide to an individual in
need thereof.
DETAILED DESCRIPTION
[0015] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0016] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference for the portions of the document
discussed herein, as well as in their entirety.
Definitions
[0017] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Where permitted, all
patents, applications, published applications and other
publications, GENBANK Accession Numbers and associated sequence
information obtainable through databases such as National Center
for Biotechnology Information (NCBI) and other data referred to
throughout in the disclosure herein are incorporated by reference
for the portions of the document discussed herein, as well as in
their entirety.
[0018] Unless otherwise indicated, the following terms have the
following meanings: "2'-deoxynucleoside" means a nucleoside
comprising 2'-H furanosyl sugar moiety, as found naturally
occurring in deoxyribonucleosides (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (e.g., uracil).
[0019] "2'-O-methoxyethyl" (also 2'-MOE and
2'-O(CH.sub.2).sub.2--OCH.sub.3) refers to an O-methoxyethyl
modification of the 2' position of a furosyl ring. A
2'-O-methoxyethyl modified sugar is a modified sugar.
[0020] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside)
means a nucleoside comprising a 2'-MOE modified sugar moiety.
[0021] "2'-substituted nucleoside" means a nucleoside comprising a
substituent at the 2'-position other than H or OH. Unless otherwise
indicated, a 2'-substituted nucleoside is not a bicyclic
nucleoside.
[0022] "5'-methylcytosine" means a cytosine modified with a methyl
group attached to the 5' position. A 5-methylcytosine is a modified
nucleobase.
[0023] "About" means within .+-.10% of a value. For example, if it
is stated, "the compounds affected at least about 70% inhibition of
STAT3", it is implied that the STAT3 levels are inhibited within a
range of 63% and 77%.
[0024] "Active pharmaceutical agent" means the substance or
substances in a pharmaceutical composition that provide a
therapeutic benefit when administered to an individual. For
example, in certain embodiments an antisense oligonucleotide
targeted to STAT3 is an active pharmaceutical agent.
[0025] "Active target region" or "target region" means a region to
which one or more active antisense compounds is targeted. "Active
antisense compounds" means antisense compounds that reduce target
nucleic acid levels or protein levels.
[0026] "Administered concomitantly" refers to the co-administration
of two agents in any manner in which the pharmacological effects of
both are manifest in the patient at the same time. Concomitant
administration does not require that both agents be administered in
a single pharmaceutical composition, in the same dosage form, or by
the same route of administration. The effects of both agents need
not manifest themselves at the same time. The effects need only be
overlapping for a period of time and need not be coextensive.
[0027] "Administering" means providing a pharmaceutical agent to an
individual, and includes, but is not limited to administering by a
medical professional and self-administering.
[0028] "Amelioration" refers to a lessening of at least one
indicator, sign, or symptom of an associated disease, disorder, or
condition. The severity of indicators may be determined by
subjective or objective measures, which are known to those skilled
in the art.
[0029] "Animal" refers to a human or non-human animal, including,
but not limited to, mice, rats, rabbits, dogs, cats, pigs, and
non-human primates, including, but not limited to, monkeys and
chimpanzees.
[0030] "Antibody" refers to a molecule characterized by reacting
specifically with an antigen in some way, where the antibody and
the antigen are each defined in terms of the other. Antibody may
refer to a complete antibody molecule or any fragment or region
thereof, such as the heavy chain, the light chain, Fab region, and
Fc region.
[0031] "Antisense activity" means any detectable or measurable
activity attributable to the hybridization of an antisense compound
to its target nucleic acid. In certain embodiments, antisense
activity is a decrease in the amount or expression of a target
nucleic acid or protein encoded by such target nucleic acid.
[0032] "Antisense compound" means an oligomeric compound that is is
capable of undergoing hybridization to a target nucleic acid
through hydrogen bonding. Examples of antisense compounds include
single-stranded and double-stranded compounds, such as, antisense
oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite
repeats.
[0033] "Antisense inhibition" means reduction of target nucleic
acid levels or target protein levels in the presence of an
antisense compound complementary to a target nucleic acid as
compared to target nucleic acid levels or target protein levels in
the absence of the antisense compound.
[0034] "Antisense oligonucleotide" means a single-stranded
oligonucleotide having a nucleobase sequence that permits
hybridization to a corresponding region or segment of a target
nucleic acid.
[0035] "Bicyclic sugar" means a furosyl ring modified by the
bridging of two atoms. A bicyclic sugar is a modified sugar.
[0036] "Bicyclic nucleoside" (also BNA) means a nucleoside having a
sugar moiety comprising a bridge connecting two carbon atoms of the
sugar ring, thereby forming a bicyclic ring system. In certain
embodiments, the bridge connects the 4'-carbon and the 2'-carbon of
the sugar ring.
[0037] "Cap structure" or "terminal cap moiety" means chemical
modifications, which have been incorporated at either terminus of
an antisense compound.
[0038] "cEt" or "constrained ethyl" means a bicyclic nucleoside
having a sugar moiety comprising a bridge connecting the 4'-carbon
and the 2'-carbon, wherein the bridge has the formula:
4'-CH(CH.sub.3)--O-2'.
[0039] "Constrained ethyl nucleoside" (also cEt nucleoside) means a
nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--O-2' bridge.
[0040] "Chemically distinct region" refers to a region of an
antisense compound that is in some way chemically different than
another region of the same antisense compound. For example, a
region having 2'-O-methoxyethyl nucleotides is chemically distinct
from a region having nucleotides without 2'-O-methoxyethyl
modifications.
[0041] "Chimeric antisense compound" means an antisense compound
that has at least two chemically distinct regions.
[0042] "Co-administration" means administration of two or more
pharmaceutical agents to an individual. The two or more
pharmaceutical agents may be in a single pharmaceutical
composition, or may be in separate pharmaceutical compositions.
Each of the two or more pharmaceutical agents may be administered
through the same or different routes of administration.
Co-administration encompasses parallel or sequential
administration.
[0043] "Complementarity" means the capacity for pairing between
nucleobases of a first nucleic acid and a second nucleic acid.
[0044] "Contiguous nucleobases" means nucleobases immediately
adjacent to each other.
[0045] "Diluent" means an ingredient in a composition that lacks
pharmacological activity, but is pharmaceutically necessary or
desirable. For example, the diluent in an injected composition may
be a liquid, e.g. saline solution.
[0046] "Dose" means a specified quantity of a pharmaceutical agent
provided in a single administration, or in a specified time period.
In certain embodiments, a dose may be administered in one, two, or
more boluses, tablets, or injections. For example, in certain
embodiments where subcutaneous administration is desired, the
desired dose requires a volume not easily accommodated by a single
injection, therefore, two or more injections may be used to achieve
the desired dose. In certain embodiments, the pharmaceutical agent
is administered by infusion over an extended period of time or
continuously. Doses may be stated as the amount of pharmaceutical
agent per hour, day, week, or month.
[0047] "Effective amount" means the amount of active pharmaceutical
agent sufficient to effectuate a desired physiological outcome in
an individual in need of the agent. The effective amount may vary
among individuals depending on the health and physical condition of
the individual to be treated, the taxonomic group of the
individuals to be treated, the formulation of the composition,
assessment of the individual's medical condition, and other
relevant factors.
[0048] "Fully complementary" or "100% complementary" means each
nucleobase of a first nucleic acid has a complementary nucleobase
in a second nucleic acid. In certain embodiments, a first nucleic
acid is an antisense compound and a target nucleic acid is a second
nucleic acid.
[0049] "Gapmer" means a chimeric antisense compound in which an
internal region having a plurality of nucleosides that support
RNase H cleavage is positioned between external regions having one
or more nucleosides, wherein the nucleosides comprising the
internal region are chemically distinct from the nucleoside or
nucleosides comprising the external regions. The internal region
may be referred to as the "gap" and the external regions may be
referred to as the "wings."
[0050] "Gap-widened" means a chimeric antisense compound having a
gap segment of 12 or more contiguous 2'-deoxyribonucleosides
positioned between and immediately adjacent to 5' and 3' wing
segments having from one to six nucleosides.
[0051] "Hybridization" means the annealing of complementary nucleic
acid molecules. In certain embodiments, complementary nucleic acid
molecules include an antisense compound and a target nucleic
acid.
[0052] "Hyperproliferative disease" means a disease characterized
by rapid or excessive growth and reproduction of cells. Examples of
hyperproliferative diseases include cancer, e.g., carcinomas,
sarcomas, lymphomas, and leukemias as well as associated
malignancies and metastases.
[0053] "Identifying an animal at risk for hyperproliferative
disease" means identifying an animal having been diagnosed with a
hyperproliferative disease or identifying an animal predisposed to
develop a hyperproliferative disease. Individuals predisposed to
develop a hyperproliferative disease include those having one or
more risk factors for hyperproliferative disease including older
age; history of other hyperproliferative diseases; history of
tobacco use; history of exposure to sunlight and/or ionizing
radiation; prior contact with certain chemicals, especially
continuous contact; past or current infection with certain viruses
and bacteria; prior or current use of certain hormone therapies;
genetic predisposition; alcohol use; and certain lifestyle choices
including poor diet, lack of physical activity, and/or being
overweight. Such identification may be accomplished by any method
including evaluating an individual's medical history and standard
clinical tests or assessments.
[0054] "Immediately adjacent" means there are no intervening
elements between the immediately adjacent elements.
[0055] "Inhibiting STAT3" means reducing expression of STAT3 mRNA
and/or protein levels in the presence of a STAT3 antisense
compound, including a STAT3 antisense oligonucleotide, as compared
to expression of STAT3 mRNA and/or protein levels in the absence of
a STAT3 antisense compound, such as an antisense
oligonucleotide.
[0056] "Individual" means a human or non-human animal selected for
treatment or therapy.
[0057] "Internucleoside linkage" refers to the chemical bond
between nucleosides.
[0058] "Linked nucleosides" means adjacent nucleosides which are
bonded together.
[0059] "Mismatch" or "non-complementary nucleobase" refers to the
case when a nucleobase of a first nucleic acid is not capable of
pairing with the corresponding nucleobase of a second or target
nucleic acid.
[0060] "Modified internucleoside linkage" refers to a substitution
or any change from a naturally occurring internucleoside bond (i.e.
a phosphodiester internucleoside bond).
[0061] "Modified nucleobase" refers to any nucleobase other than
adenine, cytosine, guanine, thymidine, or uracil. An "unmodified
nucleobase" means the purine bases adenine (A) and guanine (G), and
the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0062] "Modified nucleotide" means a nucleotide having,
independently, a modified sugar moiety, modified internucleoside
linkage, or modified nucleobase. A "modified nucleoside" means a
nucleoside having, independently, a modified sugar moiety or
modified nucleobase.
[0063] "Modified oligonucleotide" means an oligonucleotide
comprising a modified internucleoside linkage, a modified sugar,
and/or a modified nucleobase.
[0064] "Modified sugar" refers to a substitution or change from a
natural sugar.
[0065] "Motif" means the pattern of chemically distinct regions in
an antisense compound.
[0066] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage.
[0067] "Natural sugar moiety" means a sugar found in DNA (2'-H) or
RNA (2'-OH).
[0068] "Nucleic acid" refers to molecules composed of monomeric
nucleotides. A nucleic acid includes ribonucleic acids (RNA),
deoxyribonucleic acids (DNA), single-stranded nucleic acids,
double-stranded nucleic acids, small interfering ribonucleic acids
(siRNA), and microRNAs (miRNA).
[0069] "Nucleobase" means a heterocyclic moiety capable of pairing
with a base of another nucleic acid.
[0070] "Nucleobase sequence" means the order of contiguous
nucleobases independent of any sugar, linkage, or nucleobase
modification.
[0071] "Nucleoside" means a nucleobase linked to a sugar.
[0072] "Nucleoside mimetic" includes those structures used to
replace the sugar or the sugar and the base and not necessarily the
linkage at one or more positions of an oligomeric compound such as
for example nucleoside mimetics having morpholino, cyclohexenyl,
cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics,
e.g., non furanose sugar units. Nucleotide mimetic includes those
structures used to replace the nucleoside and the linkage at one or
more positions of an oligomeric compound such as for example
peptide nucleic acids or morpholinos (morpholinos linked by
--N(H)--C(.dbd.O)--O-- or other non-phosphodiester linkage). Sugar
surrogate overlaps with the slightly broader term nucleoside
mimetic but is intended to indicate replacement of the sugar unit
(furanose ring) only. The tetrahydropyranyl rings provided herein
are illustrative of an example of a sugar surrogate wherein the
furanose sugar group has been replaced with a tetrahydropyranyl
ring system.
[0073] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of the nucleoside.
[0074] "Off-target effect" refers to an unwanted or deleterious
biological effect associated with modulation of RNA or protein
expression of a gene other than the intended target nucleic
acid.
[0075] "Oligomeric compound" or "oligomer" means a polymer of
linked monomeric subunits which is capable of hybridizing to at
least a region of a nucleic acid molecule.
[0076] "Oligonucleotide" means a polymer of linked nucleosides each
of which can be modified or unmodified, independent one from
another.
[0077] "Parenteral administration" means administration through
injection (e.g., bolus injection) or infusion. Parenteral
administration includes subcutaneous administration, intravenous
administration, intramuscular administration, intraarterial
administration, intraperitoneal administration, or intracranial
administration, e.g., intrathecal or intracerebroventricular
administration.
[0078] "Peptide" means a molecule formed by linking at least two
amino acids by amide bonds. Peptide refers to polypeptides and
proteins.
[0079] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual. For example, a
pharmaceutical composition may comprise one or more active
pharmaceutical agents and a sterile aqueous solution. In certain
embodiments, a pharmaceutical composition shows activity in free
uptake assay in certain cell lines.
[0080] "Pharmaceutically acceptable derivative" encompasses
pharmaceutically acceptable salts, conjugates, prodrugs or isomers
of the compounds described herein. "Pharmaceutically acceptable
salts" means physiologically and pharmaceutically acceptable salts
of antisense compounds, i.e., salts that retain the desired
biological activity of the parent oligonucleotide and do not impart
undesired toxicological effects thereto.
[0081] "Phosphorothioate linkage" means a linkage between
nucleosides where the phosphodiester bond is modified by replacing
one of the non-bridging oxygen atoms with a sulfur atom. A
phosphorothioate linkage (P.dbd.S) is a modified internucleoside
linkage.
[0082] "Portion" means a defined number of contiguous (i.e.,
linked) nucleobases of a nucleic acid. In certain embodiments, a
portion is a defined number of contiguous nucleobases of a target
nucleic acid. In certain embodiments, a portion is a defined number
of contiguous nucleobases of an antisense compound.
[0083] "Prevent" refers to delaying or forestalling the onset or
development of a disease, disorder, or condition for a period of
time from minutes to indefinitely. Prevent also means reducing risk
of developing a disease, disorder, or condition.
[0084] "Prodrug" means a therapeutic agent that is prepared in an
inactive form that is converted to an active form within the body
or cells thereof by the action of endogenous enzymes or other
chemicals or conditions.
[0085] "Side effects" means physiological responses attributable to
a treatment other than the desired effects. In certain embodiments,
side effects include injection site reactions, liver function test
abnormalities, renal function abnormalities, liver toxicity, renal
toxicity, central nervous system abnormalities, myopathies, and
malaise. For example, increased aminotransferase levels in serum
may indicate liver toxicity or liver function abnormality. For
example, increased bilirubin may indicate liver toxicity or liver
function abnormality.
[0086] "Signal Transducer and Activator of Transcription 3 nucleic
acid" or "STAT3 nucleic acid" means any nucleic acid encoding
STAT3. For example, in certain embodiments, a STAT3 nucleic acid
includes a DNA sequence encoding STAT3, an RNA sequence transcribed
from DNA encoding STAT3 (including genomic DNA comprising introns
and exons), and an mRNA sequence encoding STAT3. "STAT3 mRNA" means
an mRNA encoding a STAT3 protein.
[0087] "Single-stranded oligonucleotide" means an oligonucleotide
which is not hybridized to a complementary strand.
[0088] "Specifically hybridizable" refers to an antisense compound
having a sufficient degree of complementarity between an antisense
oligonucleotide and a target nucleic acid to induce a desired
effect, while exhibiting minimal or no effects on non-target
nucleic acids under conditions in which specific binding is
desired, i.e., under physiological conditions in the case of in
vivo assays and therapeutic treatments.
[0089] "Targeting" or "targeted" means the process of design and
selection of an antisense compound that will specifically hybridize
to a target nucleic acid and induce a desired effect.
[0090] "Target nucleic acid," "target RNA," "target mRNA," and
"target RNA transcript" all refer to a nucleic acid capable of
being targeted by antisense compounds.
[0091] "Target segment" means the sequence of nucleotides of a
target nucleic acid to which an antisense compound is targeted. "5'
target site" refers to the 5'-most nucleotide of a target segment.
"3' target site" refers to the 3'-most nucleotide of a target
segment.
[0092] "Therapeutically effective amount" means an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
individual.
[0093] "Treat" refers to administering a pharmaceutical composition
to effect an alteration or improvement of a disease, disorder, or
condition.
[0094] "Unmodified nucleotide" means a nucleotide composed of
naturally occurring nucleobases, sugar moieties, and
internucleoside linkages. In certain embodiments, an unmodified
nucleotide is an RNA nucleotide (i.e. .beta.-D-ribonucleosides) or
a DNA nucleotide (i.e. .beta.-D-deoxyribonucleoside).
Certain Embodiments
[0095] In certain embodiments provided are methods, compounds, and
compositions for inhibiting STAT3 mRNA or protein expression.
[0096] In certain embodiments provided are methods for preventing
tumor growth and tumor volume. In certain embodiments provided are
methods for reducing tumor growth and tumor volume.
[0097] In certain embodiments provided are methods, compounds, and
compositions for the treatment, prevention, or amelioration of
diseases, disorders, and conditions associated with STAT3 in an
individual in need thereof. Also contemplated are methods and
compounds for the preparation of a medicament for the treatment,
prevention, or amelioration of a disease, disorder, or condition
associated with STAT3. STAT3 associated diseases, disorders, and
conditions include hyperproliferative diseases, e.g., cancer,
carcinomas, sarcomas, lymphomas, and leukemias as well as
associated malignancies and metastases.
[0098] In certain embodiments provided are STAT3 antisense
compounds for use in treating, preventing, or ameliorating a STAT3
associated disease. In certain embodiments, STAT3 antisense
compounds are STAT3 antisense oligonucleotides, which are capable
of inhibiting the expression of STAT3 mRNA and/or STAT3 protein in
a cell, tissue, or animal.
[0099] In certain embodiments provided are a STAT3 antisense
compound as described herein for use in treating or preventing lung
cancer, including non small cell lung cancer (NSCLC), pancreatic
cancer, colorectal cancer, multiple myeloma, hepatocellular
carcinoma (HCC), glioblastoma, ovarian cancer, osteosarcoma, head
and neck cancer, breast cancer, epidermoid carcinomas, intestinal
adenomas, prostate cancer, and gastric cancer.
[0100] In certain embodiments provided are a STAT3 antisense
compound as described herein for use in treating or preventing
cancer from metastasizing.
[0101] In certain embodiments provided are a STAT3 antisense
compound, as described herein, for use in treating, preventing, or
ameliorating hyperproliferative diseases, e.g., cancer, carcinomas,
sarcomas, lymphomas, and leukemias as well as associated
malignancies and metastases.
[0102] In certain embodiments provided are antisense compounds
targeted to a STAT3 nucleic acid. In certain embodiments, the STAT3
nucleic acid is any of the sequences set forth in GENBANK Accession
No. NM_139276.2 (incorporated herein as SEQ ID NO: 1) or the
complement of GENBANK Accession No. NT_010755.14 truncated from
nucleotides 4185000 to U.S. Pat. No. 4,264,000 (incorporated herein
as SEQ ID NO: 2).
[0103] In certain embodiments, the antisense compounds provided
herein are targeted to any one of the following regions of SEQ ID
NO 1: 250-286; 250-285; 264-285; 264-282; 728-745; 729-745;
729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920;
1899-1920; 1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963;
1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696;
2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033,
3015-3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499;
3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612;
3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012;
4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252;
4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558;
4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847;
4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; 4842-4859.
[0104] In certain embodiments, the antisense compounds provided
herein are complementary within any one of the following regions of
SEQ ID NO 1: 250-286; 250-285; 264-285; 264-282; 728-745;
729-745;
[0105] 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920;
1899-1920; 1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963;
1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696;
2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033,
3015-3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499;
3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612;
3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012;
4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252;
4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558;
4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847;
4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; 4842-4859.
In certain embodiments, provided are compounds comprising: [0106] a
modified antisense oligonucleotide consisting of 12 to 22 linked
nucleosides, wherein the modified antisense oligonucleotide
comprises: [0107] a 5'-wing consisting of 1 to 5 linked
nucleosides; [0108] a 3'-wing consisting of 1 to 5 linked
nucleosides; [0109] a gap between the 5'-wing and the 3'-wing
consisting of 8 to 12 linked 2'-deoxynucleosides; and [0110]
wherein at least one of the 5'-wing and the 3'-wing comprises at
least one bicyclic nucleoside or 2'-substituted nucleoside; [0111]
wherein the nucleobase sequence of the modified antisense
oligonucleotide is complementary to an equal length portion of any
of nucleobases 250-286; 250-285; 264-285; 264-282; 728-745;
729-745; 729-744; 787-803; 867-883; 955-978; 1146-1170; 1896-1920;
1899-1920; 1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963;
1947-1963; 2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696;
2699-2716; 3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033,
3015-3032, 3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499;
3460-3476; 3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612;
3675-3706; 3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012;
4067-4100; 4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252;
4306-4341; 4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558;
4539-4572; 4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847;
4813-4859; 4813-4815; 4813-4831; 4827-4859; 4827-4844; 4842-4859 of
the nucleobase sequence of SEQ ID NO: 1.
[0112] In certain embodiments, the antisense compounds provided
herein are targeted to any one of the following regions of SEQ ID
NO 2: 2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697-5722;
5699-5716; 6475-6490; 6475-6491; 6476-6491; 7682-7705; 8078-8097;
8079-8095; 9862-9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893;
11699-11719; 12342-12366; 12345-12364; 12346-12364; 12347-12364;
12353-12380; 12357-12376; 12358-12376; 12358-12373; 12360-12376;
14128-14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709;
50693-50708; 61325-61349; 66133-66157; 66136-66157; 66136-66155;
66136-66153; 66138-66153; 66184-66200; 67067-67083; 4171-74220;
74199-74220; 74202-74220; 74171-74219; 74199-74219; 74202-74219;
74171-74218; 74199-74218; 74202-74218; 74723-74768; 74764-74803;
74782-74802; 74782-74801; 74782-74800; 74782-74799; 74783-74802;
74783-74801; 74783-74800; 74783-74799; 74862-74893; 74900-74977;
74902-74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287;
75412-75443; 75421-75439; 75422-75439; 75422-75438; 75423-75439;
75423-75438; 75493-75528; 75616-75643; 75626-75641; 75658-75699;
75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727-75745;
75728-75745; 75831-75988; 75852-75969; 75969-75984; 75987-76056;
76000-76046; 76000-76032; 76000-76018; 76014-76046; 76014-76032;
76029-76046; and 76031-76046.
[0113] In certain embodiments, the antisense compounds provided
herein are complementary within any one of the following regions of
SEQ ID NO 2: 2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697-5722;
5699-5716; 6475-6490; 6475-6491; 6476-6491; 7682-7705; 8078-8097;
8079-8095; 9862-9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893;
11699-11719; 12342-12366; 12345-12364; 12346-12364; 12347-12364;
12353-12380; 12357-12376; 12358-12376; 12358-12373; 12360-12376;
14128-14148; 16863-16883; 46091-46111; 50692-50709; 50693-50709;
50693-50708; 61325-61349; 66133-66157; 66136-66157; 66136-66155;
66136-66153; 66138-66153; 66184-66200; 67067-67083; 4171-74220;
74199-74220; 74202-74220; 74171-74219; 74199-74219; 74202-74219;
74171-74218; 74199-74218; 74202-74218; 74723-74768; 74764-74803;
74782-74802; 74782-74801; 74782-74800; 74782-74799; 74783-74802;
74783-74801; 74783-74800; 74783-74799; 74862-74893; 74900-74977;
74902-74922; 74902-74920; 75070-75119; 75164-75199; 75254-75287;
75412-75443; 75421-75439; 75422-75439; 75422-75438; 75423-75439;
75423-75438; 75493-75528; 75616-75643; 75626-75641; 75658-75699;
75676-75692; 75717-75745; 75726-75759; 75726-75745; 75727-75745;
75728-75745; 75831-75988; 75852-75969; 75969-75984; 75987-76056;
76000-76046; 76000-76032; 76000-76018; 76014-76046; 76014-76032;
76029-76046; and 76031-76046.
[0114] In certain embodiments, provided are compounds comprising:
[0115] a modified antisense oligonucleotide consisting of 12 to 22
linked nucleosides, wherein the modified antisense oligonucleotide
comprises: [0116] a 5'-wing consisting of 1 to 5 linked
nucleosides; [0117] a 3'-wing consisting of 1 to 5 linked
nucleosides; [0118] a gap between the 5'-wing and the 3'-wing
consisting of 8 to 12 linked 2'-deoxynucleosides; and [0119]
wherein at least one of the 5'-wing and the 3'-wing comprises at
least one bicyclic nucleoside or 2'-substituted nucleoside; [0120]
wherein the nucleobase sequence of the modified antisense
oligonucleotide is complementary to an equal length portion of any
of nucleobases 2668-2688; 2703-2720; 5000-5021; 5001-5017;
5697-5722; 5699-5716; 6475-6490; 6475-6491; 6476-6491; 7682-7705;
8078-8097; 8079-8095; 9862-9811; 9870-9897; 9875-9893; 9875-9891;
9877-9893; 11699-11719; 12342-12366; 12345-12364; 12346-12364;
12347-12364; 12353-12380; 12357-12376; 12358-12376; 12358-12373;
12360-12376; 14128-14148; 16863-16883; 46091-46111; 50692-50709;
50693-50709; 50693-50708; 61325-61349; 66133-66157; 66136-66157;
66136-66155; 66136-66153; 66138-66153; 66184-66200; 67067-67083;
4171-74220; 74199-74220; 74202-74220; 74171-74219; 74199-74219;
74202-74219; 74171-74218; 74199-74218; 74202-74218; 74723-74768;
74764-74803; 74782-74802; 74782-74801; 74782-74800; 74782-74799;
74783-74802; 74783-74801; 74783-74800; 74783-74799; 74862-74893;
74900-74977; 74902-74922; 74902-74920; 75070-75119; 75164-75199;
75254-75287; 75412-75443; 75421-75439; 75422-75439; 75422-75438;
75423-75439; 75423-75438; 75493-75528; 75616-75643; 75626-75641;
75658-75699; 75676-75692; 75717-75745; 75726-75759; 75726-75745;
75727-75745; 75728-75745; 75831-75988; 75852-75969; 75969-75984;
75987-76056; 76000-76046; 76000-76032; 76000-76018; 76014-76046;
76014-76032; 76029-76046; and 76031-76046 of the nucleobase
sequence of SEQ ID NO: 2.
[0121] Certain embodiments provide compounds comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 12 contiguous
nucleobases complementary to an equal length portion of nucleobases
3008 to 3033 of SEQ ID NO: 1, wherein the nucleobase sequence is
complementary to SEQ ID NO: 1.
[0122] Certain embodiments provide compounds comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 12 contiguous
nucleobases complementary to an equal length portion of nucleobases
3016 to 3031 of SEQ ID NO: 1, wherein the nucleobase sequence is
complementary to SEQ ID NO: 1.
[0123] Certain embodiments provide compounds comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 12 contiguous
nucleobases complementary to an equal length portion of nucleobases
6476 to 6491 of SEQ ID NO: 2, wherein the nucleobase sequence is
complementary to SEQ ID NO: 2.
[0124] Certain embodiments provide compounds comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 12 contiguous
nucleobases complementary to an equal length portion of nucleobases
250-286; 250-285; 264-285; 264-282; 728-745; 729-745; 729-744;
787-803; 867-883; 955-978; 1146-1170; 1896-1920; 1899-1920;
1899-1919; 1899-1918; 1899-1916; 1901-1916; 1946-1963; 1947-1963;
2155-2205; 2155-2187; 2156-2179; 2204-2221; 2681-2696; 2699-2716;
3001-3033; 3008-3033, 3010-3033, 3010-3032, 3015-3033, 3015-3032,
3015-3031, 3016-3033, 3016-3032, 3016-3033; 3452-3499; 3460-3476;
3583-3608; 3591-3616; 3595-3615; 3595-3614; 3595-3612; 3675-3706;
3713-3790; 3715-3735; 3833-3878; 3889-3932; 3977-4012; 4067-4100;
4225-4256; 4234-4252; 4235-4252; 4235-4251; 4236-4252; 4306-4341;
4431-4456; 4439-4454; 4471-4510; 4488-4505; 4530-4558; 4539-4572;
4541-4558; 4636-4801; 4782-4796; 4800-4823; 4811-4847; 4813-4859;
4813-4815; 4813-4831; 4827-4859; 4827-4844; or 4842-4859 of SEQ ID
NO: 1, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to SEQ ID NO: 1.
[0125] Certain embodiments provide compounds comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides having a
nucleobase sequence comprising a portion of at least 12 contiguous
nucleobases complementary to an equal length portion of nucleobases
2668-2688; 2703-2720; 5000-5021; 5001-5017; 5697-5722; 5699-5716;
6475-6490; 6475-6491; 6476-6491; 7682-7705; 8078-8097; 8079-8095;
9862-9811; 9870-9897; 9875-9893; 9875-9891; 9877-9893; 11699-11719;
12342-12366; 12345-12364; 12346-12364; 12347-12364; 12353-12380;
12357-12376; 12358-12376; 12358-12373; 12360-12376; 14128-14148;
16863-16883; 46091-46111; 50692-50709; 50693-50709; 50693-50708;
61325-61349; 66133-66157; 66136-66157; 66136-66155; 66136-66153;
66138-66153; 66184-66200; 67067-67083; 4171-74220; 74199-74220;
74202-74220; 74171-74219; 74199-74219; 74202-74219; 74171-74218;
74199-74218; 74202-74218; 74723-74768; 74764-74803; 74782-74802;
74782-74801; 74782-74800; 74782-74799; 74783-74802; 74783-74801;
74783-74800; 74783-74799; 74862-74893; 74900-74977; 74902-74922;
74902-74920; 75070-75119; 75164-75199; 75254-75287; 75412-75443;
75421-75439; 75422-75439; 75422-75438; 75423-75439; 75423-75438;
75493-75528; 75616-75643; 75626-75641; 75658-75699; 75676-75692;
75717-75745; 75726-75759; 75726-75745; 75727-75745; 75728-75745;
75831-75988; 75852-75969; 75969-75984; 75987-76056; 76000-76046;
76000-76032; 76000-76018; 76014-76046; 76014-76032; 76029-76046; or
76031-76046 of SEQ ID NO: 2, wherein the nucleobase sequence of the
modified oligonucleotide is complementary to SEQ ID NO: 2.
[0126] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide comprises the sequence of SEQ ID NO:
245.
[0127] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide consists of the sequence of SEQ ID NO:
245.
[0128] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide comprises the sequence of SEQ ID NO:
413.
[0129] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide consists of the sequence of SEQ ID NO:
413.
[0130] In certain embodiments, the modified oligonucleotide is 100%
complementary to SEQ ID NO: 1 or 2.
[0131] In certain embodiments, the modified oligonucleotide
consists of a single-stranded modified oligonucleotide.
[0132] In certain embodiments, the modified oligonucleotide has at
least one modified internucleoside linkage.
[0133] In certain embodiments, each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0134] In certain embodiments, at least one nucleoside comprises a
modified sugar.
[0135] In certain embodiments, at least one modified sugar is a
bicyclic sugar.
[0136] In certain embodiments, the bicyclic sugar comprises a
4'-CH.sub.2--O-2' bridge.
[0137] In certain embodiments, the bicyclic sugar comprises a
4'-CH(CH.sub.3)--O-2' bridge.
[0138] In certain embodiments, the modified sugar comprises a
2'-O(CH.sub.2).sub.2--OCH.sub.3 group.
[0139] In certain embodiments, the modified sugar comprises a
2'-O--CH.sub.3 group.
[0140] In certain embodiments, at least one nucleoside of the
modified oligonucleotide comprises a modified nucleobase.
[0141] In certain embodiments, the modified nucleobase is a
5'-methylcytosine.
[0142] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 1 to 5 linked nucleosides; a 3'-wing
consisting of 1 to 5 linked nucleosides; a gap between the 5'-wing
and the 3'-wing consisting of 8 to 12 linked 2'-deoxynucleosides;
and wherein at least one of the 5'-wing and the 3'-wing comprises
at least one bicyclic nucleoside or one 2'-substituted
nucleoside.
[0143] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 1 to 5 linked nucleosides; a 3'-wing
consisting of 1 to 5 linked nucleosides; a gap between the 5'-wing
and the 3'-wing consisting of 8 to 12 linked 2'-deoxynucleosides;
and wherein at least one of the 5'-wing and the 3'-wing comprises
at least one bicyclic nucleoside and at least one 2'-substituted
nucleoside.
[0144] In certain embodiments, the 2'-substituted nucleoside
comprises any of the group consisting of a
2'-O(CH.sub.2).sub.2--OCH.sub.3 group or a 2'-O--CH.sub.3
group.
[0145] In certain embodiments, the bicyclic nucleoside comprises
any of the group consisting of a 4'-CH.sub.2--O-2' bridge and a
4'-CH(CH.sub.3)--O-2' bridge.
[0146] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 3 linked nucleosides; a 3'-wing consisting
of 3 linked nucleosides; a gap between the 5'-wing and the 3'-wing
consisting of 10 linked 2'-deoxynucleosides; wherein each
nucleoside of each of the 5'-wing and the 3'-wing comprises a
constrained ethyl nucleoside; wherein each internucleoside linkage
is a phosphorothioate linkage; and wherein each cytosine is a
5'-methylcytosine.
[0147] Certain embodiments provide compounds, comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of the nucleobase sequence of SEQ ID NO: 245.
[0148] Certain embodiments provide compounds, comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of the nucleobase sequence of SEQ ID NO: 413.
[0149] Certain embodiment provide compounds, comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
9-426, 430-442, 445-464, 471-498, 500-1034, 1036-1512, and
1541-2757.
[0150] In certain embodiments, the modified oligonucleotide
consists of a single-stranded modified oligonucleotide.
[0151] In certain embodiments, at least one internucleoside linkage
of the modified oligonucleotide is a modified internucleoside
linkage.
[0152] In certain embodiments, each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0153] In certain embodiments, at least one nucleoside comprises a
modified sugar.
[0154] In certain embodiments, at least one modified sugar is a
bicyclic sugar.
[0155] In certain embodiments, the bicyclic sugar comprises a
4'-CH.sub.2--O-2' bridge.
[0156] In certain embodiments, the bicyclic sugar comprises a
4'-CH(CH.sub.3)--O-2' bridge.
[0157] In certain embodiments, the modified sugar comprises a
2'-O(CH.sub.2).sub.2--OCH.sub.3 group.
[0158] In certain embodiments, the modified sugar comprises a
2'-O--CH.sub.3 group.
[0159] In certain embodiments, at least one nucleoside of the
modified oligonucleotide comprises a modified nucleobase.
[0160] In certain embodiments, the modified nucleobase is a
5'-methylcytosine.
[0161] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 1 to 5 linked nucleosides; a 3'-wing
consisting of 1 to 5 linked nucleosides; a gap between the 5'-wing
and the 3'-wing consisting of 8 to 12 linked 2'-deoxynucleosides;
and wherein at least one of the 5'-wing and the 3'-wing comprises
at least one bicyclic nucleoside or 2'-substituted nucleoside.
[0162] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 1 to 5 linked nucleosides; a 3'-wing
consisting of 1 to 5 linked nucleosides; a gap between the 5'-wing
and the 3'-wing consisting of 8 to 12 linked 2'-deoxynucleosides;
and wherein at least one of the 5'-wing and the 3'-wing comprises
at least one bicyclic nucleoside and at least one 2'-substituted
nucleoside.
[0163] In certain embodiments, the 2'-substituted nucleoside
comprises any of the group consisting of a
2'-O(CH.sub.2).sub.2--OCH.sub.3 group or a 2'-O--CH.sub.3
group.
[0164] In certain embodiments, the bicyclic nucleoside comprises
any of the group consisting of a 4'-CH.sub.2--O-2' bridge and a
4'-CH(CH.sub.3)--O-2' bridge.
[0165] In certain embodiments, the modified oligonucleotide
comprises:
a 5'-wing consisting of 3 linked nucleosides; a 3'-wing consisting
of 3 linked nucleosides; a gap between the 5'-wing and the 3'-wing
consisting of 10 linked 2'-deoxynucleosides; wherein each
nucleoside of each of the 5'-wing and the 3'-wing comprises a
constrained ethyl nucleoside; wherein each internucleoside linkage
is a phosphorothioate linkage; and wherein each cytosine is a
5'-methylcytosine.
[0166] Certain embodiments provide compounds comprising: [0167] a
modified oligonucleotide consisting of 12 to 22 linked nucleosides,
wherein the modified oligonucleotide comprises: [0168] a 5'-wing
consisting of 1 to 5 linked nucleosides; [0169] a 3'-wing
consisting of 1 to 5 linked nucleosides; [0170] a gap between the
5'-wing and the 3'-wing consisting of 8 to 12 linked
2'-deoxynucleosides; [0171] wherein at least one of the 5'-wing and
the 3'-wing comprises at least one bicyclic nucleoside or a
2'-substituted nucleoside; [0172] wherein the nucleobase sequence
of the modified oligonucleotide is complementary to an equal length
portion of nucleobases 3016 to 3031 of the nucleobase sequence of
SEQ ID NO: 1; and [0173] wherein the compound inhibits expression
of STAT3 mRNA expression.
[0174] Certain embodiments provide compounds comprising: [0175] a
modified oligonucleotide consisting of 12 to 22 linked nucleosides,
wherein the modified oligonucleotide comprises: [0176] a 5'-wing
consisting of 1 to 5 linked nucleosides; [0177] a 3'-wing
consisting of 1 to 5 linked nucleosides; [0178] a gap between the
5'-wing and the 3'-wing consisting of 8 to 12 linked
2'-deoxynucleosides; [0179] wherein at least one of the 5'-wing and
the 3'-wing comprises at least one bicyclic nucleoside or a
2'-substituted nucleoside; [0180] wherein the nucleobase sequence
of the modified oligonucleotide is complementary to an equal length
portion of nucleobases 6476 to 6491 of the nucleobase sequence of
SEQ ID NO: 2; and [0181] wherein the compound inhibits expression
of STAT3 mRNA expression.
[0182] In certain embodiments, at least one of the 5'-wing and the
3'-wing comprises at least one 2'-deoxynucleoside.
[0183] In certain embodiments, the modified oligonucleotide
consists of a single-stranded modified oligonucleotide.
[0184] In certain embodiments, the modified oligonucleotide
comprises at least one bicyclic nucleoside.
[0185] In certain embodiments, at least one bicyclic nucleoside
comprises a 4'-CH(CH.sub.3)--O-2' bridge.
[0186] In certain embodiments, each bicyclic nucleoside comprises a
4'-CH(CH.sub.3)--O-2' bridge.
[0187] In certain embodiments, at least one bicyclic nucleoside
comprises a 4'-CH.sub.2--O-2' bridge.
[0188] In certain embodiments, each bicyclic nucleoside comprises a
4'-CH.sub.2--O-2' bridge.
[0189] In certain embodiments, the modified oligonucleotide
comprises at least one 2'-substituted nucleoside.
[0190] In certain embodiments, at least one 2'-substituted
nucleoside comprises a 2'-O(CH.sub.2).sub.2--OCH.sub.3 group.
[0191] In certain embodiments, each 2'-substituted nucleoside
comprises a 2'-O(CH.sub.2).sub.2--OCH.sub.3 group.
[0192] In certain embodiments, at least one 2'-substituted
nucleoside comprises a 2'-O--CH.sub.3 group.
[0193] In certain embodiments, each 2'-substituted nucleoside
comprises a 2'-O--CH.sub.3 group.
[0194] In certain embodiments, at least one internucleoside linkage
is a modified internucleoside linkage.
[0195] In certain embodiments, each modified internucleoside
linkage is a phosphorothioate linkage.
[0196] In certain embodiments, at least one nucleoside of the
modified oligonucleotide comprises a modified nucleobase.
[0197] In certain embodiments, the modified nucleobase is a
5'-methylcytosine.
[0198] In certain embodiments, the modified oligonucleotide has a
sugar motif described by Formula A as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).sub.v-(B-
).sub.w-(J).sub.x-(B).sub.y-(J).sub.z [0199] wherein: [0200] each A
is independently a 2'-substituted nucleoside; [0201] each B is
independently a bicyclic nucleoside; [0202] each J is independently
either a 2'-substituted nucleoside or a 2'-deoxynucleoside; [0203]
each D is a 2'-deoxynucleoside; [0204] m is 0-4; n is 0-2; p is
0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z
is 0-4; g is 6-14; provided that: [0205] at least one of m, n, and
r is other than 0; [0206] at least one of w and y is other than 0;
[0207] the sum of m, n, p, r, and t is from 2 to 5; and [0208] the
sum of v, w, x, y, and z is from 2 to 5.
[0209] In certain embodiments, the modified oligonucleotide has a
sugar motif of any of the group consisting of: [0210] k-d(10)-k
[0211] e-d(10)-k [0212] k-d(10)-e [0213] k-k-d(10)-k-k [0214]
k-k-d(10)-e-e [0215] e-e-d(10)-k-k [0216] k-k-k-d(10)-k-k-k [0217]
e-e-e-d(10)-k-k-k [0218] k-k-k-d(10)-e-e-e [0219] k-k-k-d(10)-k-k-k
[0220] e-k-k-d(10)-k-k-e [0221] e-e-k-d(10)-k-k-e [0222]
e-d-k-d(10)-k-k-e [0223] e-k-d(10)-k-e-k-e [0224] k-d(10)-k-e-k-e-e
[0225] e-e-k-d(10)-k-e-k-e [0226] e-d-d-k-d(9)-k-k-e [0227]
e-e-e-e-d(9)-k-k-e wherein, k is a constrained ethyl nucleoside, e
is a 2'-MOE substituted nucleoside, and d is a
2'-deoxynucleoside.
[0228] Certain embodiments provide methods of treating a
hyperproliferative disease in an animal, comprising administering
to an animal in need thereof a compound comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of any of the nucleobase sequences of SEQ ID NOs:
9-426, 430-442, 445-464, 471-498, 500-1034, 1036-1512, and
1541-2757.
[0229] Certain embodiments provide methods of treating a
hyperproliferative disease in an animal, comprising administering
to an animal in need thereof a compound comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of SEQ ID NO: 245.
[0230] Certain embodiments provide methods of treating a
hyperproliferative disease in an animal, comprising administering
to an animal in need thereof a compound comprising a modified
oligonucleotide consisting of 12 to 30 linked nucleosides and
having a nucleobase sequence comprising at least 12 contiguous
nucleobases of SEQ ID NO: 413.
[0231] In certain embodiments, the administering reduces tumor size
in the animal.
[0232] In certain embodiments, the administering reduces tumor
volume in the animal.
[0233] In certain embodiments, the administering prevents
metastasis in the animal.
[0234] In certain embodiments, the administering prolongs survival
of the animal.
[0235] In certain embodiments, the administering reduces cachaxia
in the animal.
[0236] Certain embodiments provide methods of reducing expression
of STAT3 in an animal, comprising administering to an animal in
need thereof a compound comprising a modified oligonucleotide
consisting of 12 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 12 contiguous nucleobases of any of
the nucleobase sequences of SEQ ID NOs: 9-426, 430-442, 445-464,
471-498, 500-1034, 1036-1512, and 1541-2757.
[0237] Certain embodiments provide methods of reducing expression
of STAT3 in an animal, comprising administering to an animal in
need thereof a compound comprising a modified oligonucleotide
consisting of 12 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 12 contiguous nucleobases of SEQ ID
NO: 245.
[0238] Certain embodiments provide methods of reducing expression
of STAT3 in an animal, comprising administering to an animal in
need thereof a compound comprising a modified oligonucleotide
consisting of 12 to 30 linked nucleosides and having a nucleobase
sequence comprising at least 12 contiguous nucleobases of SEQ ID
NO: 413.
[0239] In certain embodiments, the compound does not have the
wing-gap-wing motif of 2-10-2.
Antisense Compounds
[0240] Oligomeric compounds include, but are not limited to,
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, antisense compounds, antisense
oligonucleotides, and siRNAs. An oligomeric compound may be
"antisense" to a target nucleic acid, meaning that is is capable of
undergoing hybridization to a target nucleic acid through hydrogen
bonding.
[0241] In certain embodiments, an antisense compound has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted. In certain such embodiments,
an antisense oligonucleotide has a nucleobase sequence that, when
written in the 5' to 3' direction, comprises the reverse complement
of the target segment of a target nucleic acid to which it is
targeted.
[0242] In certain embodiments, an antisense compound targeted to a
STAT3 nucleic acid is 12 to 30 subunits in length. In certain
embodiments, an antisense compound targeted to a STAT3 nucleic acid
is 14 to 30 subunits in length. In certain embodiments, an
antisense compound targeted to a STAT3 nucleic acid is 12 to 22
subunits in length. In other words, such antisense compounds are
from 12 to 30 linked subunits, 14 to 30 linked subunits, or 12 to
22 linked subunits, respectively. In other embodiments, the
antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to
30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17
to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30,
19 to 50, or 20 to 30 linked subunits. In certain such embodiments,
the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits
in length, or a range defined by any two of the above values. In
some embodiments the antisense compound is an antisense
oligonucleotide, and the linked subunits are nucleotides.
[0243] In certain embodiments antisense oligonucleotides targeted
to a STAT3 nucleic acid may be shortened or truncated. For example,
a single subunit may be deleted from the 5' end (5' truncation), or
alternatively from the 3' end (3' truncation). A shortened or
truncated antisense compound targeted to a STAT3 nucleic acid may
have two subunits deleted from the 5' end, or alternatively may
have two subunits deleted from the 3' end, of the antisense
compound. Alternatively, the deleted nucleosides may be dispersed
throughout the antisense compound, for example, in an antisense
compound having one nucleoside deleted from the 5' end and one
nucleoside deleted from the 3' end.
[0244] When a single additional subunit is present in a lengthened
antisense compound, the additional subunit may be located at the 5'
or 3' end of the antisense compound. When two or more additional
subunits are present, the added subunits may be adjacent to each
other, for example, in an antisense compound having two subunits
added to the 5' end (5' addition), or alternatively to the 3' end
(3' addition), of the antisense compound. Alternatively, the added
subunits may be dispersed throughout the antisense compound, for
example, in an antisense compound having one subunit added to the
5' end and one subunit added to the 3' end.
[0245] It is possible to increase or decrease the length of an
antisense compound, such as an antisense oligonucleotide, and/or
introduce mismatch bases without eliminating activity. For example,
in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a
series of antisense oligonucleotides 13-25 nucleobases in length
were tested for their ability to induce cleavage of a target RNA in
an oocyte injection model. Antisense oligonucleotides 25
nucleobases in length with 8 or 11 mismatch bases near the ends of
the antisense oligonucleotides were able to direct specific
cleavage of the target mRNA, albeit to a lesser extent than the
antisense oligonucleotides that contained no mismatches. Similarly,
target specific cleavage was achieved using 13 nucleobase antisense
oligonucleotides, including those with 1 or 3 mismatches.
[0246] Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March
2001) demonstrated the ability of an oligonucleotide having 100%
complementarity to the bcl-2 mRNA and having 3 mismatches to the
bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in
vitro and in vivo. Furthermore, this oligonucleotide demonstrated
potent anti-tumor activity in vivo.
[0247] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988)
tested a series of tandem 14 nucleobase antisense oligonucleotides,
and a 28 and 42 nucleobase antisense oligonucleotides comprised of
the sequence of two or three of the tandem antisense
oligonucleotides, respectively, for their ability to arrest
translation of human DHFR in a rabbit reticulocyte assay. Each of
the three 14 nucleobase antisense oligonucleotides alone was able
to inhibit translation, albeit at a more modest level than the 28
or 42 nucleobase antisense oligonucleotides.
[0248] In certain embodiments, the compounds as described herein
are efficacious by virtue of having at least one of an in vitro
IC.sub.50 of less than 20 uM, less than 19 uM, less than 18 uM,
less than 17 uM, less than 16 uM, less than 15 uM, less than 14 uM,
less than 13 uM, less than 12 uM, less than 11 uM, less than 10 uM,
less than 9 uM, less than 8 uM, less than 7 uM, less than 6 uM,
less than 5 uM, less than 4 uM, less than 3 uM, less than 2 uM,
less than 1 uM when delivered to HuVEC cells as described
herein.
[0249] In certain embodiments, the compounds as described herein
are efficacious by virtue of having at least one of an in vitro
IC.sub.50 of less than 1.0 uM, less than 0.9 uM, less than 0.8 uM,
less than 0.7 uM, less than 0.6 uM, less than 0.5 uM, less than 0.4
uM, less than 0.3 uM, less than 0.2 uM, less than 0.1 uM when
delivered to HuVEC cells as described herein.
[0250] In certain embodiments, the compounds as described herein
are efficacious by virtue of having at least one of an in vitro
IC.sub.50 of less than 0.95 uM, less than 0.90 uM, less than 0.85
uM, less than 0.80 uM, less than 0.75 uM, less than 0.70 uM, less
than 0.65 uM, less than 0.60 uM, less than 0.55 uM, less than 0.50
uM, less than 0.45 uM, less than 0.40 uM, less than 0.35 uM, less
than 0.30 uM, less than 0.25 uM, less than 0.20 uM, less than 0.15
uM, less than 0.10 uM, less than 0.05 uM, less than 0.04 uM, less
than 0.03 uM, less than 0.02 uM, less than 0.01 uM when delivered
to HuVEC cells as described herein.
[0251] In certain embodiments, the compound as described herein are
efficacious by virtue of having at least one of an in vitro
IC.sub.50 of less of less than 20 uM, less than 15 uM, less than 10
uM, less than 5 uM, less than 2 uM when delivered by free uptake
methods to cancer cell lines as described herein.
[0252] In certain embodiments, the compounds as described herein
are highly tolerable as demonstrated by having at least one of an
increase an ALT or AST value of no more than 4 fold, 3 fold, or 2
fold over saline treated animals or an increase in liver, spleen,
or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or
2%. In certain embodiments, the compounds as described herein are
highly tolerable as demonstrated by having no increase of ALT or
AST over saline treated animals. In certain embodiments, the
compounds as described herein are highly tolerable as demonstrated
by having no increase in liver, spleen, or kidney weight over
saline treated animals. In certain embodiments, these compounds
include ISIS 455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS
455291, ISIS 455371, ISIS 455394, ISIS 455703, ISIS 455429, ISIS
455471, ISIS 455527, ISIS 455530, ISIS 455536, ISIS 455548, ISIS
455611, ISIS 465236, ISIS 465237, ISIS 465588, ISIS 465740, ISIS
465754, ISIS 465830, ISIS 466670, ISIS 466720; ISIS 481374, ISIS
481390, ISIS 481420, ISIS 481431, ISIS 481453, ISIS 481464, ISIS
481475, ISIS 481495, ISIS 481500, ISIS 481501, ISIS 481525, ISIS
481548, ISIS 481549, ISIS 481597, ISIS 481695, ISIS 481700, ISIS
481702, ISIS 481710, ISIS 481725, ISIS 481750, and ISIS 481763. In
certain embodiments, such compounds include compounds comprising
the sequence of any one of SEQ ID NOs 57, 90, 90, 175, 223, 245,
267, 307, 317, 318, 366, 411, 413, 54, 258, 268, 272, 288, 464,
367, 393, 1564, 1568, 1571, 1572, 1590, 1670, 1693, 1728, 1770,
1826, 1829, 1835, 1847, 1910, 1997, 2168, 2198, 2325, 2339, 2720,
2731, 2732, and 2756.
Antisense Compound Motifs
[0253] In certain embodiments, antisense compounds targeted to a
STAT3 nucleic acid have chemically modified subunits arranged in
patterns, or motifs, to confer to the antisense compounds
properties such as enhanced inhibitory activity, increased binding
affinity for a target nucleic acid, or resistance to degradation by
in vivo nucleases.
[0254] Chimeric antisense compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, increased binding affinity
for the target nucleic acid, and/or increased inhibitory activity.
A second region of a chimeric antisense compound may optionally
serve as a substrate for the cellular endonuclease RNase H, which
cleaves the RNA strand of an RNA:DNA duplex.
[0255] Antisense compounds having a gapmer motif are considered
chimeric antisense compounds. In a gapmer an internal region having
a plurality of nucleotides that supports RNaseH cleavage is
positioned between external regions having a plurality of
nucleotides that are chemically distinct from the nucleosides of
the internal region. In the case of an antisense oligonucleotide
having a gapmer motif, the gap segment generally serves as the
substrate for endonuclease cleavage, while the wing segments
comprise modified nucleosides. In certain embodiments, the regions
of a gapmer are differentiated by the types of sugar moieties
comprising each distinct region. The types of sugar moieties that
are used to differentiate the regions of a gapmer may in some
embodiments include .beta.-D-ribonucleosides,
.beta.-D-deoxyribonucleosides, 2'-modified nucleosides (such
2'-modified nucleosides may include 2'-MOE and 2'-O--CH.sub.3,
among others), and bicyclic sugar modified nucleosides (such
bicyclic sugar modified nucleosides may include those having a
constrained ethyl). In certain embodiments, wings may include
several modified sugar moieties, including, for example 2'-MOE and
constrained ethyl. In certain embodiments, wings may include
several modified and unmodified sugar moieties. In certain
embodiments, wings may include various combinations of 2'-MOE
nucleosides, constrained ethyl nucleosides, and
2'-deoxynucleosides.
[0256] Each distinct region may comprise uniform sugar moieties,
variant, or alternating sugar moieties. The wing-gap-wing motif is
frequently described as "X--Y--Z", where "X" represents the length
of the 5'-wing, "Y" represents the length of the gap, and "Z"
represents the length of the 3'-wing. "X" and "Z" may comprise
uniform, variant, or alternating sugar moieties. In certain
embodiments, "X" and "Y" may include one or more
2'-deoxynucleosides. "Y" may comprise 2'-deoxynucleosides. As used
herein, a gapmer described as "X--Y--Z" has a configuration such
that the gap is positioned immediately adjacent to each of the
5'-wing and the 3' wing. Thus, no intervening nucleotides exist
between the 5'-wing and gap, or the gap and the 3'-wing. Any of the
antisense compounds described herein can have a gapmer motif. In
certain embodiments, "X" and "Z" are the same, in other embodiments
they are different. In certain embodiments, "Y" is between 8 and 15
nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more
nucleosides.
[0257] In certain embodiments, gapmers provided herein include, for
example, 11-mers having a motif of 1-9-1.
[0258] In certain embodiments, gapmers provided herein include, for
example, 12-mers having a motif of 1-9-2, 2-9-1, or 1-10-1.
[0259] In certain embodiments, gapmers provided herein include, for
example, 13-mers having a motif of 1-9-3, 2-9-2, 3-9-1, 1-10-2, or
2-10-1.
[0260] In certain embodiments, gapmers provided herein include, for
example, 14-mers having a motif of 1-9-4, 2-9-3, 3-9-2, 4-9-1,
1-10-3, 2-10-2, or 3-10-1.
[0261] In certain embodiments, gapmers provided herein include, for
example, 15-mers having a motif of 1-9-5, 2-9-4, 3-9-3, 4-9-2,
5-9-1, 1-10-4, 2-10-3, 3-10-2, or 4-10-1.
[0262] In certain embodiments, gapmers provided herein include, for
example, 16-mers having a motif of 2-9-5, 3-9-4, 4-9-3, 5-9-2,
1-10-5, 2-10-4, 3-10-3, 4-10-2, or 5-10-1.
[0263] In certain embodiments, gapmers provided herein include, for
example, 17-mers having a motif of 3-9-5, 4-9-4, 5-9-3, 2-10-5,
3-10-4, 4-10-3, or 5-10-2.
[0264] In certain embodiments, gapmers provided herein include, for
example, 18-mers having a motif of 4-9-5, 5-9-4, 3-10-5, 4-10-4, or
5-10-3.
[0265] In certain embodiments, gapmers provided herein include, for
example, 19-mers having a motif of 5-9-5, 4-10-5, or 5-10-4.
[0266] In certain embodiments, gapmers provided herein include, for
example, 20-mers having a motif of 5-10-5.
[0267] In certain embodiments, the antisense compound has a
"wingmer" motif, having a wing-gap or gap-wing configuration, i.e.
an X-Y or Y-Z configuration as described above for the gapmer
configuration. Thus, wingmer configurations provided herein
include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4,
3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or
6-8.
[0268] In certain embodiments, antisense compound targeted to a
STAT3 nucleic acid has a 2-10-2 gapmer motif.
[0269] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 3-10-3 gapmer motif.
[0270] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 5-10-5 gapmer motif.
[0271] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 1-10-5 gapmer motif.
[0272] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 3-10-4 gapmer motif.
[0273] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 2-10-4 gapmer motif.
[0274] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a 4-9-3 gapmer motif.
[0275] In certain embodiments, the antisense compound targeted to a
STAT3 nucleic acid has a gap-widened motif.
[0276] In certain embodiments, the antisense compounds targeted to
a STAT3 nucleic acid has any of the following sugar motifs: [0277]
k-d(10)-k [0278] e-d(10)-k [0279] k-d(10)-e [0280] k-k-d(10)-k-k
[0281] k-k-d(10)-e-e [0282] e-e-d(10)-k-k [0283] k-k-k-d(10)-k-k-k
[0284] e-e-e-d(10)-k-k-k [0285] k-k-k-d(10)-e-e-e [0286]
k-k-k-d(10)-k-k-k [0287] e-k-k-d(10)-k-k-e [0288] e-e-k-d(10)-k-k-e
[0289] e-d-k-d(10)-k-k-e [0290] e-k-d(10)-k-e-k-e [0291]
k-d(10)-k-e-k-e-e [0292] e-e-k-d(10)-k-e-k-e [0293]
e-d-d-k-d(9)-k-k-e [0294] e-e-e-e-d(9)-k-k-e wherein, k is a
constrained ethyl nucleoside, e is a 2'-MOE substituted nucleoside,
and d is a 2'-deoxynucleoside.
[0295] In certain embodiments, the antisense oligonucleotide has a
sugar motif described by Formula A as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).sub.v-(B)-
.sub.w-(J).sub.x-(B).sub.y-(J).sub.z [0296] wherein: [0297] each A
is independently a 2'-substituted nucleoside; [0298] each B is
independently a bicyclic nucleoside; [0299] each J is independently
either a 2'-substituted nucleoside or a 2'-deoxynucleoside; [0300]
each D is a 2'-deoxynucleoside; [0301] m is 0-4; n is 0-2; p is
0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z
is 0-4; g is 6-14; provided that: [0302] at least one of m, n, and
r is other than 0; [0303] at least one of w and y is other than 0;
[0304] the sum of m, n, p, r, and t is from 2 to 5; and [0305] the
sum of v, w, x, y, and z is from 2 to 5.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0306] Nucleotide sequences that encode STAT3 include, without
limitation, the following: GENBANK Accession No. NM_139276.2
(incorporated herein as SEQ ID NO: 1) and the complement of GENBANK
Accession No. NT_010755.14 truncated from nucleotides 4185000 to
U.S. Pat. No. 4,264,000 (incorporated herein as SEQ ID NO: 2).
[0307] It is understood that the sequence set forth in each SEQ ID
NO in the Examples contained herein is independent of any
modification to a sugar moiety, an internucleoside linkage, or a
nucleobase. As such, antisense compounds defined by a SEQ ID NO may
comprise, independently, one or more modifications to a sugar
moiety, an internucleoside linkage, or a nucleobase. Antisense
compounds described by Isis Number (Isis No) indicate a combination
of nucleobase sequence and motif.
[0308] In certain embodiments, a target region is a structurally
defined region of the target nucleic acid. For example, a target
region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an
exon/intron junction, a coding region, a translation initiation
region, translation termination region, or other defined nucleic
acid region. The structurally defined regions for STAT3 can be
obtained by accession number from sequence databases such as NCBI
and such information is incorporated herein by reference. In
certain embodiments, a target region may encompass the sequence
from a 5' target site of one target segment within the target
region to a 3' target site of another target segment within the
same target region.
[0309] Targeting includes determination of at least one target
segment to which an antisense compound hybridizes, such that a
desired effect occurs. In certain embodiments, the desired effect
is a reduction in mRNA target nucleic acid levels. In certain
embodiments, the desired effect is reduction of levels of protein
encoded by the target nucleic acid or a phenotypic change
associated with the target nucleic acid.
[0310] A target region may contain one or more target segments.
Multiple target segments within a target region may be overlapping.
Alternatively, they may be non-overlapping. In certain embodiments,
target segments within a target region are separated by no more
than about 300 nucleotides. In certain embodiments, target segments
within a target region are separated by a number of nucleotides
that is, is about, is no more than, is no more than about, 250,
200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on
the target nucleic acid, or is a range defined by any two of the
preceeding values. In certain embodiments, target segments within a
target region are separated by no more than, or no more than about,
5 nucleotides on the target nucleic acid. In certain embodiments,
target segments are contiguous. Contemplated are target regions
defined by a range having a starting nucleic acid that is any of
the 5' target sites or 3' target sites listed herein.
[0311] Suitable target segments may be found within a 5' UTR, a
coding region, a 3' UTR, an intron, an exon, or an exon/intron
junction. Target segments containing a start codon or a stop codon
are also suitable target segments. A suitable target segment may
specifically exclude a certain structurally defined region such as
the start codon or stop codon.
[0312] The determination of suitable target segments may include a
comparison of the sequence of a target nucleic acid to other
sequences throughout the genome. For example, the BLAST algorithm
may be used to identify regions of similarity amongst different
nucleic acids. This comparison can prevent the selection of
antisense compound sequences that may hybridize in a non-specific
manner to sequences other than a selected target nucleic acid
(i.e., non-target or off-target sequences).
[0313] There may be variation in activity (e.g., as defined by
percent reduction of target nucleic acid levels) of the antisense
compounds within an active target region. In certain embodiments,
reductions in STAT3 mRNA levels are indicative of inhibition of
STAT3 expression. Reductions in levels of a STAT3 protein are also
indicative of inhibition of target mRNA expression. Further,
phenotypic changes are indicative of inhibition of STAT3
expression. In certain embodiments, reduced cellular growth,
reduced tumor growth, and reduced tumor volume can be indicative of
inhibition of STAT3 expression. In certain embodiments,
amelioration of symptoms associated with cancer can be indicative
of inhibition of STAT3 expression. In certain embodiments,
reduction of cachexia is indicative of inhibition of STAT3
expression. In certain embodiments, reduction of cancer markers can
be indicative of inhibition of STAT3 expression.
Hybridization
[0314] In some embodiments, hybridization occurs between an
antisense compound disclosed herein and a STAT3 nucleic acid. The
most common mechanism of hybridization involves hydrogen bonding
(e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding) between complementary nucleobases of the nucleic acid
molecules.
[0315] Hybridization can occur under varying conditions. Stringent
conditions are sequence-dependent and are determined by the nature
and composition of the nucleic acid molecules to be hybridized.
Methods of determining whether a sequence is specifically
hybridizable to a target nucleic acid are well known in the art. In
certain embodiments, the antisense compounds provided herein are
specifically hybridizable with a STAT3 nucleic acid.
Complementarity
[0316] An antisense compound and a target nucleic acid are
complementary to each other when a sufficient number of nucleobases
of the antisense compound can hydrogen bond with the corresponding
nucleobases of the target nucleic acid, such that a desired effect
will occur (e.g., antisense inhibition of a target nucleic acid,
such as a STAT3 nucleic acid).
[0317] Non-complementary nucleobases between an antisense compound
and a STAT3 nucleic acid may be tolerated provided that the
antisense compound remains able to specifically hybridize to a
target nucleic acid. Moreover, an antisense compound may hybridize
over one or more segments of a STAT3 nucleic acid such that
intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure, mismatch or hairpin
structure).
[0318] In certain embodiments, the antisense compounds provided
herein, or a specified portion thereof, are, or are at least, 70%,
80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, or 100% complementary to a STAT3 nucleic acid, a
target region, target segment, or specified portion thereof.
Percent complementarity of an antisense compound with a target
nucleic acid can be determined using routine methods.
[0319] For example, an antisense compound in which 18 of 20
nucleobases of the antisense compound are complementary to a target
region, and would therefore specifically hybridize, would represent
90 percent complementarity. In this example, the remaining
noncomplementary nucleobases may be clustered or interspersed with
complementary nucleobases and need not be contiguous to each other
or to complementary nucleobases. As such, an antisense compound
which is 18 nucleobases in length having four noncomplementary
nucleobases which are flanked by two regions of complete
complementarity with the target nucleic acid would have 77.8%
overall complementarity with the target nucleic acid and would thus
fall within the scope of the present invention. Percent
complementarity of an antisense compound with a region of a target
nucleic acid can be determined routinely using BLAST programs
(basic local alignment search tools) and PowerBLAST programs known
in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410;
Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology,
sequence identity or complementarity, can be determined by, for
example, the Gap program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research
Park, Madison Wis.), using default settings, which uses the
algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482
489).
[0320] In certain embodiments, the antisense compounds provided
herein, or specified portions thereof, are fully complementary
(i.e. 100% complementary) to a target nucleic acid, or specified
portion thereof. For example, an antisense compound may be fully
complementary to a STAT3 nucleic acid, or a target region, or a
target segment or target sequence thereof. As used herein, "fully
complementary" means each nucleobase of an antisense compound is
capable of precise base pairing with the corresponding nucleobases
of a target nucleic acid. For example, a 20 nucleobase antisense
compound is fully complementary to a target sequence that is 400
nucleobases long, so long as there is a corresponding 20 nucleobase
portion of the target nucleic acid that is fully complementary to
the antisense compound. Fully complementary can also be used in
reference to a specified portion of the first and/or the second
nucleic acid. For example, a 20 nucleobase portion of a 30
nucleobase antisense compound can be "fully complementary" to a
target sequence that is 400 nucleobases long. The 20 nucleobase
portion of the 30 nucleobase oligonucleotide is fully complementary
to the target sequence if the target sequence has a corresponding
20 nucleobase portion wherein each nucleobase is complementary to
the 20 nucleobase portion of the antisense compound. At the same
time, the entire 30 nucleobase antisense compound may or may not be
fully complementary to the target sequence, depending on whether
the remaining 10 nucleobases of the antisense compound are also
complementary to the target sequence.
[0321] The location of a non-complementary nucleobase may be at the
5' end or 3' end of the antisense compound. Alternatively, the
non-complementary nucleobase or nucleobases may be at an internal
position of the antisense compound. When two or more
non-complementary nucleobases are present, they may be contiguous
(i.e. linked) or non-contiguous. In one embodiment, a
non-complementary nucleobase is located in the wing segment of a
gapmer antisense oligonucleotide.
[0322] In certain embodiments, antisense compounds that are, or are
up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in
length comprise no more than 4, no more than 3, no more than 2, or
no more than 1 non-complementary nucleobase(s) relative to a target
nucleic acid, such as a STAT3 nucleic acid, or specified portion
thereof.
[0323] In certain embodiments, antisense compounds that are, or are
up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, or 30 nucleobases in length comprise no more than
6, no more than 5, no more than 4, no more than 3, no more than 2,
or no more than 1 non-complementary nucleobase(s) relative to a
target nucleic acid, such as a STAT3 nucleic acid, or specified
portion thereof.
[0324] The antisense compounds provided herein also include those
which are complementary to a portion of a target nucleic acid. As
used herein, "portion" refers to a defined number of contiguous
(i.e. linked) nucleobases within a region or segment of a target
nucleic acid. A "portion" can also refer to a defined number of
contiguous nucleobases of an antisense compound. In certain
embodiments, the antisense compounds, are complementary to at least
an 8 nucleobase portion of a target segment. In certain
embodiments, the antisense compounds are complementary to at least
a 9 nucleobase portion of a target segment. In certain embodiments,
the antisense compounds are complementary to at least a 10
nucleobase portion of a target segment. In certain embodiments, the
antisense compounds are complementary to at least an 11 nucleobase
portion of a target segment. In certain embodiments, the antisense
compounds are complementary to at least a 12 nucleobase portion of
a target segment. In certain embodiments, the antisense compounds
are complementary to at least a 13 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 14 nucleobase portion of a target
segment. In certain embodiments, the antisense compounds are
complementary to at least a 15 nucleobase portion of a target
segment. Also contemplated are antisense compounds that are
complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, or more nucleobase portion of a target segment, or a range
defined by any two of these values.
Identity
[0325] The antisense compounds provided herein may also have a
defined percent identity to a particular nucleotide sequence, SEQ
ID NO, or compound represented by a specific Isis number, or
portion thereof. As used herein, an antisense compound is identical
to the sequence disclosed herein if it has the same nucleobase
pairing ability. For example, a RNA which contains uracil in place
of thymidine in a disclosed DNA sequence would be considered
identical to the DNA sequence since both uracil and thymidine pair
with adenine. Shortened and lengthened versions of the antisense
compounds described herein as well as compounds having
non-identical bases relative to the antisense compounds provided
herein also are contemplated. The non-identical bases may be
adjacent to each other or dispersed throughout the antisense
compound. Percent identity of an antisense compound is calculated
according to the number of bases that have identical base pairing
relative to the sequence to which it is being compared.
[0326] In certain embodiments, the antisense compounds, or portions
thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,
99% or 100% identical to one or more of the antisense compounds or
SEQ ID NOs, or a portion thereof, disclosed herein.
[0327] In certain embodiments, a portion of the antisense compound
is compared to an equal length portion of the target nucleic acid.
In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to
an equal length portion of the target nucleic acid.
[0328] In certain embodiments, a portion of the antisense
oligonucleotide is compared to an equal length portion of the
target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase
portion is compared to an equal length portion of the target
nucleic acid.
Modifications
[0329] A nucleoside is a base-sugar combination. The nucleobase
(also known as base) portion of the nucleoside is normally a
heterocyclic base moiety. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to the 2', 3' or 5'
hydroxyl moiety of the sugar. Oligonucleotides are formed through
the covalent linkage of adjacent nucleosides to one another, to
form a linear polymeric oligonucleotide. Within the oligonucleotide
structure, the phosphate groups are commonly referred to as forming
the internucleoside linkages of the oligonucleotide.
[0330] Modifications to antisense compounds encompass substitutions
or changes to internucleoside linkages, sugar moieties, or
nucleobases. Modified antisense compounds are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for nucleic acid
target, increased stability in the presence of nucleases, or
increased inhibitory activity.
[0331] Chemically modified nucleosides may also be employed to
increase the binding affinity of a shortened or truncated antisense
oligonucleotide for its target nucleic acid. Consequently,
comparable results can often be obtained with shorter antisense
compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
[0332] The naturally occurring internucleoside linkage of RNA and
DNA is a 3' to 5' phosphodiester linkage. Antisense compounds
having one or more modified, i.e. non-naturally occurring,
internucleoside linkages are often selected over antisense
compounds having naturally occurring internucleoside linkages
because of desirable properties such as, for example, enhanced
cellular uptake, enhanced affinity for target nucleic acids, and
increased stability in the presence of nucleases.
[0333] Oligonucleotides having modified internucleoside linkages
include internucleoside linkages that retain a phosphorus atom as
well as internucleoside linkages that do not have a phosphorus
atom. Representative phosphorus containing internucleoside linkages
include, but are not limited to, phosphodiesters, phosphotriesters,
methylphosphonates, phosphoramidate, and phosphorothioates. Methods
of preparation of phosphorous-containing and
non-phosphorous-containing linkages are well known.
[0334] In certain embodiments, antisense compounds targeted to a
STAT3 nucleic acid comprise one or more modified internucleoside
linkages. In certain embodiments, the modified internucleoside
linkages are phosphorothioate linkages. In certain embodiments,
each internucleoside linkage of an antisense compound is a
phosphorothioate internucleoside linkage.
Modified Sugar Moieties
[0335] Antisense compounds provided herein can optionally contain
one or more nucleosides wherein the sugar group has been modified.
Such sugar modified nucleosides may impart enhanced nuclease
stability, increased binding affinity, or some other beneficial
biological property to the antisense compounds. In certain
embodiments, nucleosides comprise a chemically modified
ribofuranose ring moiety. Examples of chemically modified
ribofuranose rings include, without limitation, addition of
substitutent groups (including 5' and 2' substituent groups);
bridging of non-geminal ring atoms to form bicyclic nucleic acids
(BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or
C(R1)(R)2 (R.dbd.H, C.sub.1-C.sub.12 alkyl or a protecting group);
and combinations thereof. Examples of chemically modified sugars
include, 2'-F-5'-methyl substituted nucleoside (see, PCT
International Application WO 2008/101157, published on Aug. 21,
2008 for other disclosed 5', 2'-bis substituted nucleosides),
replacement of the ribosyl ring oxygen atom with S with further
substitution at the 2'-position (see, published U.S. Patent
Application US2005/0130923, published on Jun. 16, 2005), or,
alternatively, 5'-substitution of a BNA (see, PCT International
Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA
is substituted with, for example, a 5'-methyl or a 5'-vinyl
group).
[0336] Examples of nucleosides having modified sugar moieties
include, without limitation, nucleosides comprising 5'-vinyl,
5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH.sub.3, and
2'-O(CH.sub.2).sub.2OCH.sub.3 substituent groups. The substituent
at the 2' position can also be selected from allyl, amino, azido,
thio, O-allyl, O--C.sub.1-C.sub.10 alkyl, OCF.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O--N(Rm)(Rn), and
O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C.sub.1-C.sub.10
alkyl.
[0337] As used herein, "bicyclic nucleosides" refer to modified
nucleosides comprising a bicyclic sugar moiety. Examples of
bicyclic nucleosides include, without limitation, nucleosides
comprising a bridge between the 4' and the 2' ribosyl ring atoms.
In certain embodiments, antisense compounds provided herein include
one or more bicyclic nucleosides wherein the bridge comprises a 4'
to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic
nucleosides, include, but are not limited to, one of the formulae:
4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2;
4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' and
4'-CH(CH.sub.2OCH.sub.3)--O-2', and analogs thereof (see, U.S. Pat.
No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2', and analogs thereof (see, published
PCT International Application WO2009/006478, published Jan. 8,
2009); 4'-CH.sub.2--N(OCH.sub.3)-2', and analogs thereof (see,
published PCT International Application WO2008/150729, published
Dec. 11, 2008); 4'-CH.sub.2--O--N(CH.sub.3)-2' (see, published U.S.
Patent Application US2004/0171570, published Sep. 2, 2004);
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, Chattopadhyaya, et
al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2', and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008). Also see, for example: Singh et al., Chem.
Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54,
3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,
2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039;
Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4,
2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2,
558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al.,
Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos.
6,670,461, 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133,
6,525,191, 7,399,845; published PCT International applications WO
2004/106356, WO 94/14226, WO 2005/021570, and WO 2007/134181; U.S.
Patent Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; and U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Application Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922. Each
of the foregoing bicyclic nucleosides can be prepared having one or
more stereochemical sugar configurations including for example
.alpha.-L-ribofuranose and .beta.-D-ribofuranose (see PCT
international application PCT/DK98/00393, published on Mar. 25,
1999 as WO 99/14226).
[0338] In certain embodiments, bicyclic sugar moieties of BNA
nucleosides include, but are not limited to, compounds having at
least one bridge between the 4' and the 2' position of the
pentofuranosyl sugar moiety wherein such bridges independently
comprises 1 or from 2 to 4 linked groups independently selected
from --[C(R.sub.a)(R.sub.b)].sub.n--,
--C(R.sub.a).dbd.C(R.sub.b)--, --C(R.sub.a).dbd.N--,
--C(.dbd.NR.sub.a)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--, and --N(R.sub.a)--;
[0339] wherein:
[0340] x is 0, 1, or 2;
[0341] n is 1, 2, 3, or 4;
[0342] each R.sub.a and R.sub.b, is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0343] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0344] In certain embodiments, the bridge of a bicyclic sugar
moiety is, --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--. In certain embodiments, the
bridge is 4'-CH.sub.2-2', 4'--(CH.sub.2).sub.2-2',
4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2',
4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0345] In certain embodiments, bicyclic nucleosides are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the 13-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's have been
incorporated into antisense oligonucleotides that showed antisense
activity (Frieden et al., Nucleic Acids Research, 2003, 21,
6365-6372).
[0346] In certain embodiments, bicyclic nucleosides include, but
are not limited to, (A) .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, (B) .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, (C)
Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA, (G) methylene thio (4'-CH.sub.2--S-2')
BNA, (H) methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl
carbocyclic (4'-CH.sub.2--CH(CH.sub.3)-2') BNA, and (J) propylene
carbocyclic (4'-(CH.sub.2).sub.3-2') BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is the base moiety and R is, independently, H, a
protecting group or C.sub.1-C.sub.12 alkyl.
[0347] In certain embodiments, bicyclic nucleoside having Formula
I:
##STR00003##
wherein:
[0348] Bx is a heterocyclic base moiety;
[0349] -Q.sub.a-Q.sub.b-Q.sub.c- is
--CH.sub.2--N(R.sub.c)--CH.sub.2--,
--C(.dbd.O)--N(R.sub.c)--CH.sub.2--, --CH.sub.2--O--N(R.sub.c)--,
--CH.sub.2--N(R.sub.c)--O--, or --N(R.sub.c)--O--CH.sub.2;
[0350] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting
group; and
[0351] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium.
[0352] In certain embodiments, bicyclic nucleoside having Formula
II:
##STR00004##
wherein:
[0353] Bx is a heterocyclic base moiety;
[0354] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0355] Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, substituted amide, thiol, or
substituted thio.
[0356] In one embodiment, each of the substituted groups is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.c,
NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(.dbd.X)J.sub.c, and
NJ.sub.cC(.dbd.X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d,
and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or
substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.e.
[0357] In certain embodiments, bicyclic nucleoside having Formula
III:
##STR00005##
wherein:
[0358] Bx is a heterocyclic base moiety;
[0359] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0360] Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, or substituted acyl (C(.dbd.O)--).
[0361] In certain embodiments, bicyclic nucleoside having Formula
IV:
##STR00006##
wherein:
[0362] Bx is a heterocyclic base moiety;
[0363] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0364] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl;
[0365] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is,
independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted
C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6
aminoalkyl, or substituted C.sub.1-C.sub.6 aminoalkyl;
[0366] In certain embodiments, bicyclic nucleoside having Formula
V:
##STR00007##
wherein:
[0367] Bx is a heterocyclic base moiety;
[0368] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0369] q.sub.a, q.sub.b, q.sub.e and q.sub.f are each,
independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl,
substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl,
substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl,
substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy,
substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
[0370] or q.sub.e and q.sub.f together are
.dbd.C(q.sub.g)(q.sub.h);
[0371] q.sub.g and q.sub.h are each, independently, H, halogen,
C.sub.1-C.sub.12 alkyl, or substituted C.sub.1-C.sub.12 alkyl.
[0372] The synthesis and preparation of the methyleneoxy
(4'-CH.sub.2--O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine, and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (see, e.g., Koshkin et al., Tetrahedron, 1998, 54,
3607-3630). BNAs and preparation thereof are also described in WO
98/39352 and WO 99/14226.
[0373] Analogs of methyleneoxy (4'-CH.sub.2--O-2') BNA,
methyleneoxy (4'-CH.sub.2--O-2') BNA, and 2'-thio-BNAs, have also
been prepared (see, e.g., Kumar et al., Bioorg. Med. Chem. Lett.,
1998, 8, 2219-2222). Preparation of locked nucleoside analogs
comprising oligodeoxyribonucleotide duplexes as substrates for
nucleic acid polymerases has also been described (see, e.g., Wengel
et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a
novel comformationally restricted high-affinity oligonucleotide
analog, has been described in the art (see, e.g., Singh et al., J.
Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and
2'-methylamino-BNA's have been prepared and the thermal stability
of their duplexes with complementary RNA and DNA strands has been
previously reported.
[0374] In certain embodiments, bicyclic nucleoside having Formula
VI:
##STR00008##
wherein:
[0375] Bx is a heterocyclic base moiety;
[0376] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0377] each q.sub.i, q.sub.j, q.sub.k and q.sub.l is,
independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted
C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)O.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k, or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
and
[0378] q.sub.i and q.sub.j or q.sub.l and q.sub.k together are
.dbd.C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each,
independently, H, halogen, C.sub.1-C.sub.12 alkyl, or substituted
C.sub.1-C.sub.12 alkyl.
[0379] One carbocyclic bicyclic nucleoside having a
4'-(CH.sub.2).sub.3-2' bridge and the alkenyl analog, bridge
4'-CH.dbd.CH--CH.sub.2-2', have been described (see, e.g., Freier
et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek
et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and
preparation of carbocyclic bicyclic nucleosides along with their
oligomerization and biochemical studies have also been described
(see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26),
8362-8379).
[0380] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2'
bicyclic nucleoside" refers to a bicyclic nucleoside comprising a
furanose ring comprising a bridge connecting the 2' carbon atom and
the 4' carbon atom.
[0381] As used herein, "monocylic nucleosides" refer to nucleosides
comprising modified sugar moieties that are not bicyclic sugar
moieties. In certain embodiments, the sugar moiety, or sugar moiety
analogue, of a nucleoside may be modified or substituted at any
position.
[0382] As used herein, "2'-modified sugar" means a furanosyl sugar
modified at the 2' position. In certain embodiments, such
modifications include substituents selected from: a halide,
including, but not limited to substituted and unsubstituted alkoxy,
substituted and unsubstituted thioalkyl, substituted and
unsubstituted amino alkyl, substituted and unsubstituted alkyl,
substituted and unsubstituted allyl, and substituted and
unsubstituted alkynyl. In certain embodiments, 2' modifications are
selected from substituents including, but not limited to:
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2,
OCH.sub.2C(.dbd.O)N(H)CH.sub.3, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other 2'-substituent groups can also be
selected from: C.sub.1-C.sub.12 alkyl; substituted alkyl; alkenyl;
alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH.sub.3;
OCN; Cl; Br; CN; CF.sub.3; OCF.sub.3; SOCH.sub.3; SO.sub.2CH.sub.3;
ONO.sub.2; NO.sub.2; N.sub.3; NH.sub.2; heterocycloalkyl;
heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted
silyl; an RNA cleaving group; a reporter group; an intercalator; a
group for improving pharmacokinetic properties; and a group for
improving the pharmacodynamic properties of an antisense compound,
and other substituents having similar properties. In certain
embodiments, modified nucleosides comprise a 2'-MOE side chain
(see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000).
Such 2'-MOE substitution have been described as having improved
binding affinity compared to unmodified nucleosides and to other
modified nucleosides, such as 2'-O-methyl, O-propyl, and
O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also
have been shown to be antisense inhibitors of gene expression with
promising features for in vivo use (see, e.g., Martin, P., Helv.
Chico. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50,
168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637;
and Altmann et al., Nucleosides Nucleotides, 1997, 16,
917-926).
[0383] As used herein, a "modified tetrahydropyran nucleoside" or
"modified THP nucleoside" means a nucleoside having a six-membered
tetrahydropyran "sugar" substituted in for the pentofuranosyl
residue in normal nucleosides (a sugar surrogate). Modified THP
nucleosides include, but are not limited to, what is referred to in
the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA),
manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med.
Chem. (2002) 10:841-854), fluoro HNA (F-HNA), or those compounds
having Formula X:
##STR00009##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula X:
[0384] Bx is a heterocyclic base moiety;
[0385] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5' or 3'-terminal group;
[0386] q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and
q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or
substituted C.sub.2-C.sub.6 alkynyl; and
[0387] one of R.sub.1 and R.sub.2 is hydrogen and the other is
selected from halogen, substituted or unsubstituted alkoxy,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and
CN, wherein X is O, S, or NJ.sub.1, and each J.sub.1, J.sub.2, and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0388] In certain embodiments, the modified THP nucleosides of
Formula X are provided wherein q.sub.m, q.sub.n, q.sub.p, q.sub.r,
q.sub.s, q.sub.t, and q.sub.u are each H. In certain embodiments,
at least one of q.sub.m, q.sub.n, q.sub.p, q.sub.r, q.sub.s,
q.sub.t, and q.sub.u is other than H. In certain embodiments, at
least one of q.sub.m, q.sub.n, q.sub.p, q.sub.r, q.sub.s, q.sub.t
and q.sub.u is methyl. In certain embodiments, THP nucleosides of
Formula X are provided wherein one of R.sub.1 and R.sub.2 is F. In
certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is
methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2
is H.
[0389] As used herein, "2'-modified" or "2'-substituted" refers to
a nucleoside comprising a sugar comprising a substituent at the 2'
position other than H or OH. 2'-modified nucleosides, include, but
are not limited to, bicyclic nucleosides wherein the bridge
connecting two carbon atoms of the sugar ring connects the 2'
carbon and another carbon of the sugar ring and nucleosides with
non-bridging 2' substituents, such as allyl, amino, azido, thio,
O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'--O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. 2'-modified nucleosides may further
comprise other modifications, for example, at other positions of
the sugar and/or at the nucleobase.
[0390] As used herein, "2'-F" refers to a sugar comprising a fluoro
group at the 2' position.
[0391] As used herein, "2'-OMe" or "2'-OCH.sub.3" or "2'-O-methyl"
each refers to a nucleoside comprising a sugar comprising an
--OCH.sub.3 group at the 2' position of the sugar ring.
[0392] As used herein, "oligonucleotide" refers to a compound
comprising a plurality of linked nucleosides. In certain
embodiments, one or more of the plurality of nucleosides is
modified. In certain embodiments, an oligonucleotide comprises one
or more ribonucleosides (RNA) and/or deoxyribonucleosides
(DNA).
[0393] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see, e.g., review
article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002,
10, 841-854).
Such ring systems can undergo various additional substitutions to
enhance activity.
[0394] Methods for the preparations of modified sugars are well
known to those skilled in the art.
[0395] In nucleotides having modified sugar moieties, the
nucleobase moieties (natural, modified, or a combination thereof)
are maintained for hybridization with an appropriate nucleic acid
target.
[0396] In certain embodiments, antisense compounds comprise one or
more nucleotides having modified sugar moieties. In certain
embodiments, the modified sugar moiety is 2'-MOE. In certain
embodiments, the 2'-MOE modified nucleotides are arranged in a
gapmer motif. In certain embodiments, the modified sugar moiety is
a cEt. In certain embodiments, the cEt modified nucleotides are
arranged throughout the wings of a gapmer motif.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0397] Antisense oligonucleotides may be admixed with
pharmaceutically acceptable active or inert substances for the
preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions are dependent upon a number of criteria, including,
but not limited to, route of administration, extent of disease, or
dose to be administered.
[0398] An antisense compound targeted to a STAT3 nucleic acid can
be utilized in pharmaceutical compositions by combining the
antisense compound with a suitable pharmaceutically acceptable
diluent or carrier. A pharmaceutically acceptable diluent includes
phosphate-buffered saline (PBS). PBS is a diluent suitable for use
in compositions to be delivered parenterally. Accordingly, in one
embodiment, employed in the methods described herein is a
pharmaceutical composition comprising an antisense compound
targeted to a STAT3 nucleic acid and a pharmaceutically acceptable
diluent. In certain embodiments, the pharmaceutically acceptable
diluent is PBS. In certain embodiments, the antisense compound is
an antisense oligonucleotide.
[0399] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters, or any other oligonucleotide which, upon
administration to an animal, including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0400] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an antisense compound which are
cleaved by endogenous nucleases within the body, to form the active
antisense compound.
Conjugated Antisense Compounds
[0401] Antisense compounds may be covalently linked to one or more
moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting antisense
oligonucleotides. Typical conjugate groups include cholesterol
moieties and lipid moieties. Additional conjugate groups include
carbohydrates, phospholipids, biotin, phenazine, folate,
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines,
coumarins, and dyes.
[0402] Antisense compounds can also be modified to have one or more
stabilizing groups that are generally attached to one or both
termini of antisense compounds to enhance properties such as, for
example, nuclease stability. Included in stabilizing groups are cap
structures. These terminal modifications protect the antisense
compound having terminal nucleic acid from exonuclease degradation,
and can help in delivery and/or localization within a cell. The cap
can be present at the 5' terminus (5'-cap), or at the 3' terminus
(3'-cap), or can be present on both termini. Cap structures are
well known in the art and include, for example, inverted deoxy
abasic caps. Further 3' and 5'-stabilizing groups that can be used
to cap one or both ends of an antisense compound to impart nuclease
stability include those disclosed in WO 03/004602 published on Jan.
16, 2003.
Cell Culture and Antisense Compounds Treatment
[0403] The effects of antisense compounds on the level, activity or
expression of STAT3 nucleic acids can be tested in vitro in a
variety of cell types. Cell types used for such analyses are
available from commerical vendors (e.g. American Type Culture
Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park,
NC; Clonetics Corporation, Walkersville, Md.) and are cultured
according to the vendor's instructions using commercially available
reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.).
Illustrative cell types include, but are not limited to, HuVEC
cells, b.END cells, HepG2 cells, Hep3B cells, and primary
hepatocytes.
In Vitro Testing of Antisense Oligonucleotides
[0404] Described herein are methods for treatment of cells with
antisense oligonucleotides, which can be modified appropriately for
treatment with other antisense compounds.
[0405] Cells may be treated with antisense oligonucleotides when
the cells reach approximately 60-80% confluency in culture.
[0406] One reagent commonly used to introduce antisense
oligonucleotides into cultured cells includes the cationic lipid
transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.).
Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM
1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final
concentration of antisense oligonucleotide and a LIPOFECTIN
concentration that may range from 2 to 12 ug/mL per 100 nM
antisense oligonucleotide.
[0407] Another reagent used to introduce antisense oligonucleotides
into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad,
Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in
OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to
achieve the desired concentration of antisense oligonucleotide and
a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per
100 nM antisense oligonucleotide.
[0408] Another technique used to introduce antisense
oligonucleotides into cultured cells includes electroporation.
[0409] Cells are treated with antisense oligonucleotides by routine
methods. Cells may be harvested 16-24 hours after antisense
oligonucleotide treatment, at which time RNA or protein levels of
target nucleic acids are measured by methods known in the art and
described herein. In general, when treatments are performed in
multiple replicates, the data are presented as the average of the
replicate treatments.
[0410] The concentration of antisense oligonucleotide used varies
from cell line to cell line. Methods to determine the optimal
antisense oligonucleotide concentration for a particular cell line
are well known in the art. Antisense oligonucleotides are typically
used at concentrations ranging from 1 nM to 300 nM when transfected
with LIPOFECTAMINE. Antisense oligonucleotides are used at higher
concentrations ranging from 625 to 20,000 nM when transfected using
electroporation.
Free Uptake Assays
[0411] In certain embodiments, transfection-independent activity
(i.e., free uptake) of antisense oligonucleotides in cancer cell
lines is a measure of potency. Free uptake may be measured in
cancer cell lines such as, for example, SK-BR-3 cells, U251-MG
cells, MDA-MB-231 cells, H460 cells, A431 cells, colo205 cells,
SNB-19 cells, SK-OV3 cells, H1993 lung cancer cells, H358 lung
cancer cells, PC-9 lung cancer cells, KHM-35 lung cancer cells,
Capan-1 pancreatic cancer cells, HPAF-11 pancreatic cancer cells,
and Colo 201colorectal cancer cells.
[0412] In free uptake assays, antisense oligonucleotides are
administered to cells lines without the aid of a transfection agent
or electroporation. Antisense oligonucleotides are administered to
cell lines at one or more doses and percent inhibition of target
mRNA or protein expression is measured. Where multiple doses are
administered, IC50 may be measured. In certain embodiments,
antisense oligonucleotides exhibiting a high degree of potency, as
measured by percent inhibition after single dose or multiple doses,
are preferred over antisense oligonucleotides exhibiting a lower
degree of potency. Those antisense oligonucleotides exhibiting a
high degree of in vitro potency are more likely to exhibit in vivo
potency.
RNA Isolation
[0413] RNA analysis can be performed on total cellular RNA or
poly(A)+mRNA. Methods of RNA isolation are well known in the art.
RNA is prepared using methods well known in the art, for example,
using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according
to the manufacturer's recommended protocols.
Analysis of Inhibition of Target Levels or Expression
[0414] Inhibition of levels or expression of a STAT3 nucleic acid
can be assayed in a variety of ways known in the art. For example,
target nucleic acid levels can be quantitated by, e.g., Northern
blot analysis, competitive polymerase chain reaction (PCR), or
quantitaive real-time PCR. RNA analysis can be performed on total
cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well
known in the art. Northern blot analysis is also routine in the
art. Quantitative real-time PCR can be conveniently accomplished
using the commercially available ABI PRISM 7600, 7700, or 7900
Sequence Detection System, available from PE-Applied Biosystems,
Foster City, Calif. and used according to manufacturer's
instructions.
Quantitative Real-Time PCR Analysis of Target RNA Levels
[0415] Quantitation of target RNA levels may be accomplished by
quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900
Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. Methods of
quantitative real-time PCR are well known in the art.
[0416] Prior to real-time PCR, the isolated RNA is subjected to a
reverse transcriptase (RT) reaction, which produces complementary
DNA (cDNA) that is then used as the substrate for the real-time PCR
amplification. The RT and real-time PCR reactions are performed
sequentially in the same sample well. RT and real-time PCR reagents
may be obtained from Invitrogen (Carlsbad, Calif.). RT
real-time-PCR reactions are carried out by methods well known to
those skilled in the art.
[0417] Gene (or RNA) target quantities obtained by real time PCR
are normalized using either the expression level of a gene whose
expression is constant, such as cyclophilin A, or by quantifying
total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.).
Cyclophilin A expression is quantified by real time PCR, by being
run simultaneously with the target, multiplexing, or separately.
Total RNA is quantified using RIBOGREEN RNA quantification reagent
(Invetrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by
RIBOGREEN are taught in Jones, L. J., et al, (Analytical
Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE
Applied Biosystems) is used to measure RIBOGREEN fluorescence.
[0418] Probes and primers are designed to hybridize to a STAT3
nucleic acid. Methods for designing real-time PCR probes and
primers are well known in the art, and may include the use of
software such as PRIMER EXPRESS Software (Applied Biosystems,
Foster City, Calif.).
Analysis of Protein Levels
[0419] Antisense inhibition of STAT3 nucleic acids can be assessed
by measuring STAT3 protein levels. Protein levels of STAT3 can be
evaluated or quantitated in a variety of ways well known in the
art, such as immunoprecipitation, Western blot analysis
(immunoblotting), enzyme-linked immunosorbent assay (ELISA),
quantitative protein assays, protein activity assays (for example,
caspase activity assays), immunohistochemistry, immunocytochemistry
or fluorescence-activated cell sorting (FACS). Antibodies directed
to a target can be identified and obtained from a variety of
sources, such as the MSRS catalog of antibodies (Aerie Corporation,
Birmingham, Mich.), or can be prepared via conventional monoclonal
or polyclonal antibody generation methods well known in the art.
Antibodies useful for the detection of mouse, rat, monkey, and
human STAT3 are commercially available.
In Vivo Testing of Antisense Compounds
[0420] Antisense compounds, for example, antisense
oligonucleotides, are tested in animals to assess their ability to
inhibit expression of STAT3 and produce phenotypic changes, such
as, reduced cellular growth, amelioration of symptoms associated
with cancer, reduction of cachexia, and reduction of cancer
markers. Testing may be performed in normal animals, or in
experimental disease models. For administration to animals,
antisense oligonucleotides are formulated in a pharmaceutically
acceptable diluent, such as phosphate-buffered saline.
Administration includes parenteral routes of administration, such
as intraperitoneal, intravenous, subcutaneous, intrathecal, and
intracerebroventricular. Calculation of antisense oligonucleotide
dosage and dosing frequency is within the abilities of those
skilled in the art, and depends upon factors such as route of
administration and animal body weight. Following a period of
treatment with antisense oligonucleotides, RNA is isolated from
liver tissue and changes in STAT3 nucleic acid expression are
measured. Changes in STAT3 protein levels are also measured.
[0421] In certain embodiments, xenograft tumor models are used to
measure the effect of antisense oligonucleotides on tumor growth
and metastasis. In xenograft tumor model described herein, cells
from a cancerous cell line are inoculated into an animal. Such cell
lines may include, for example, human breast cancer cells,
MDA-MB-231, A431 human epidermoid carcinoma, U251 human glioma
tumor cells, and human NCI-H460 non-small cell lung carcinoma
cells. Certain compounds described herein and used in xenograft
models described herein may target human STAT3, mouse STAT3, rat
STAT3, and/or monkey STAT3. Certain compounds described herein and
used in xenograft models described herein may cross-react with one
or more species STAT3. In certain embodiments, compounds described
herein and used in xenograft models described herein may be more
potent inhibitors of tumor growth and tumor volume than the data
suggests wherein endogenous STAT3 is not reduced (due to lack of
cross-reactivity).
Certain Indications
[0422] In certain embodiments, provided are methods, compounds, and
compositions of treating an individual comprising administering one
or more pharmaceutical compositions provided herein. In certain
embodiments, the individual has a hyperproliferative disease. In
certain embodiments, the hyperproliferative disease is cancer,
e.g., carcinomas, sarcomas, lymphomas, and leukemias as well as
associated malignancies and metastases. In certain embodiments, the
type of cancer is lung cancer, including non small cell lung cancer
(NSCLC), pancreatic cancer, colorectal cancer, multiple myeloma,
hepatocellular carcinoma (HCC), glioblastoma, ovarian cancer,
osteosarcoma, head and neck cancer, breast cancer, epidermoid
carcinomas, intestinal adenomas, prostate cancer, and gastric
cancer. In certain embodiments, the individual is at risk for a
hyperproliferative disease, including, cancer, e.g., carcinomas,
sarcomas, lymphomas, and leukemias as well as associated
malignancies and metastases. This includes individuals having one
or more risk factors for developing a hyperproliferative disease,
including, growing older; tobacco use; exposure to sunlight and
ionizing radiation; contact with certain chemicals; infection with
certain viruses and bacteria; certain hormone therapies; genetic
predisposition; alcohol use; and certain lifestyle choices
including poor diet, lack of physical activity, and/or being
overweight. In certain embodiments, the individual has been
identified as in need of treatment for a hyperproliferative
disease. In certain embodiments, are provided methods for
prophylactically reducing STAT3 expression in an individual.
Certain embodiments include treating an individual in need thereof
by administering to an individual a therapeutically effective
amount of an antisense compound targeted to a STAT3 nucleic
acid.
[0423] In certain embodiments, treatment with the methods,
compounds, and compositions described herein is useful for
preventing metastasis of a cancer associated with the upregulation
of certain genes, such as STAT3, at the tumor bone interface to
bone. In certain embodiments, treatment with the methods,
compounds, and compositions described herein is useful for
preventing cancer from metastasizing to bone. In certain
embodiments, treatment with the methods, compounds, and
compositions described herein is useful for preventing renal cell
carcinoma, breast cancer, non small cell lung carcinoma, and
prostate cancer from metastasizing to bone.
[0424] In one embodiment, administration of a therapeutically
effective amount of an antisense compound targeted to a STAT3
nucleic acid is accompanied by monitoring of STAT3 levels in the
serum of an individual to determine an individual's response to
administration of the antisense compound. An individual's response
to administration of the antisense compound is used by a physician
to determine the amount and duration of therapeutic
intervention.
[0425] In certain embodiments, administration of an antisense
compound targeted to a STAT3 nucleic acid results in reduction of
STAT3 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55,
60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any
two of these values. In certain embodiments, administration of an
antisense compound targeted to a STAT3 nucleic acid results in
reduced cellular growth, reduced tumor growth, reduced tumor
volume, amelioration of symptoms associated with cancer, and
reduction of cancer markers. In certain embodiments, administration
of a STAT3 antisense compound decreases cellular growth, tumor
growth, and tumor volume by at least 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined
by any two of these values.
[0426] In certain embodiments, pharmaceutical compositions
comprising an antisense compound targeted to STAT3 are used for the
preparation of a medicament for treating a patient suffering or
susceptible to a hyperproliferative disease.
Certain Combination Therapies
[0427] In certain embodiments, one or more pharmaceutical
compositions provided herein are co-administered with one or more
other pharmaceutical agents. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat the same
disease, disorder, or condition as the one or more pharmaceutical
compositions provided herein. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat a different
disease, disorder, or condition as the one or more pharmaceutical
compositions provided herein. In certain embodiments, such one or
more other pharmaceutical agents are designed to treat an undesired
side effect of one or more pharmaceutical compositions provided
herein. In certain embodiments, one or more pharmaceutical
compositions provided herein are co-administered with another
pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more
pharmaceutical compositions provided herein are co-administered
with another pharmaceutical agent to produce a combinational
effect. In certain embodiments, one or more pharmaceutical
compositions provided herein are co-administered with another
pharmaceutical agent to produce a synergistic effect.
[0428] In certain embodiments, one or more pharmaceutical
compositions provided herein and one or more other pharmaceutical
agents are administered at the same time. In certain embodiments,
one or more pharmaceutical compositions provided herein and one or
more other pharmaceutical agents are administered at different
times. In certain embodiments, one or more pharmaceutical
compositions provided herein and one or more other pharmaceutical
agents are prepared together in a single formulation. In certain
embodiments, one or more pharmaceutical compositions provided
herein and one or more other pharmaceutical agents are prepared
separately. In certain embodiments, one or more other
pharmaceutical agents include all-trans retinoic acid, azacitidine,
azathioprine, bleomycin, carboplatin, capecitabine, cisplatin,
chlorambucil, cyclophosphamide, cytarabine, daunorubicin,
docetaxel, doxifluridine, doxorubicin, epirubicin, epothilone,
etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin,
imatinib, mechlorethamine, mercaptopurine, methotrexate,
mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide,
tioguanine, valrubicin, vinblastine, vincristine, vindesine, or
vinorelbine. In certain embodiments, one or more other
pharmaceutical agents include another antisense oligonucleotide. In
certain embodiments, another antisense oligonucleotide is a second
STAT3 antisense oligonucleotide.
[0429] In certain embodiments, one or more other pharmaceutical
agents include molecular targeted therapies. In certain
embodiments, the molecular targeted therapy is an EGFR inhibitor, a
mTOR inhibitor, a HER2 inhibitor, or a VEGF/VEGFR inhibitor. In
certain embodiments, EGFR inhibitors include gefitinib, erlotinib,
lapatinib, cetuximab, panitumumbo. In certain embodiments, mTOR
inhibitors include everolimus and temsirolimus. In certain
embodiments, HER2 inhibitors include trastuzumab and lapatinib. In
certain embodiments, VEGF/VEGFR inhibitors include pazopanib,
bevacizumab, sunitinib, and sorafenib.
[0430] In certain embodiments, one more pharmaceutical compositions
provided herein are administered with radiation therapy. In certain
embodiments, one or more pharmaceutical compositions are
administered at the same time as radiation therapy. In certain
embodiments, one or more pharmaceutical compositions are
administered before radiation therapy. In certain embodiments, one
or more pharmaceutical compositions are administered after
radiation therapy. In certain embodiments, one or more
pharmaceutical compositions are administered at various time points
throughout a radiation therapy regimen.
[0431] In certain embodiments, radiation therapy is useful for
inhibiting tumor growth. In certain embodiments, radiation therapy
is useful for increasing overall survival. In certain embodiments,
radiation therapy used in conjunction with administration of one or
more pharmaceuticals provided herein is advantageous over using
either therapy alone because both radiation therapy and
administration with one or more pharmaceuticals can be limited to
achieve effective antiproliferative response with limited
toxicity.
[0432] In certain embodiments, a physician designs a therapy
regimen including both radiation therapy and administration of one
more pharmaceutical compositions provided herein. In certain
embodiments, a physician designs a therapy regimen including
radiation therapy, administration of one or more pharmaceutical
compositions provided herein, and administration of one or more
other chemotherapeutic agents.
Tolerability
[0433] In certain embodiments, the compounds provided herein
display minimal side effects. Side effects include responses to the
administration of the antisense compound that are typically
unrelated to the targeting of STAT3, such as an inflammatory
response in the animal. In certain embodiments compounds are well
tolerated by the animal. Increased tolerability can depend on a
number of factors, including, but not limited to, the nucleotide
sequence of the antisense compound, chemical modifications to the
nucleotides, the particular motif of unmodified and modified
nucleosides in the antisense compound, or combinations thereof.
Tolerability may be determined by a number of factors. Such factors
include body weight, organ weight, liver function, kidney function,
platelet count, white blood cell count.
[0434] In certain embodiments, the compounds provided herein
demonstrate minimal effect on organ weight. In certain embodiments,
the compounds demonstrate less than a 7-fold, 6-fold, 5-fold,
4-fold, 3-fold, 2-fold or no significant increase in spleen and/or
liver weight.
[0435] In certain embodiments, the compounds provided herein
demonstrate minimal effect on liver function. Factors for the
evaluation of liver function include ALT levels, AST levels, plasma
bilirubin levels and plasma albumin levels. In certain embodiments
the compounds provided herein demonstrate less than a 7-fold, less
than a 6-fold, less than a 5-fold, less than a 4-fold, less than a
3-fold or less than a 2-fold or no significant increase in ALT or
AST. In certain embodiments the compounds provided herein
demonstrate less than a 3-fold, less than a 2-fold or no
significant increase in plasma bilirubin levels.
[0436] In certain embodiments, the compounds provided herein
demonstrate minimal effect on kidney function. In certain
embodiments, the compounds provided herein demonstrate less than a
3-fold, less than a 2-fold, or no significant increase in plasma
concentrations of blood urea nitrogen (BUN). In certain
embodiments, the compounds provided herein demonstrate less than a
6-fold, 5-fold, 4-fold, 3-fold, 2-fold, or no significant increase
in the ratio of urine protein to creatinine. In certain
embodiments, the compounds provided herein demonstrate minimal
effect on hematological factors. In certain embodiments, the
compounds provided herein demonstrate less than a 60%, 50%, 40%,
30%, 20%, 10% or 5% decrease in platelet count. In certain
embodiments, the compounds provided herein demonstrate less than a
4-fold, less than a 3-fold, less than a 2-fold or no significant
increase in monocyte count.
[0437] In certain embodiments compounds further display favorable
pharmacokinetics. In certain embodiments, antisense compounds
exhibit relatively high half-lives in relevant biological fluids or
tissues.
[0438] In certain embodiments, compounds or compositions further
display favorable viscosity. In certain embodiments, the viscosity
of the compound or composition is no more than 40 cP at a
concentration of 165-185 mg/mL.
[0439] In other embodiments, the compounds display combinations of
the characteristics above and reduce STAT3 mRNA expression in an
animal model with high efficiency.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0440] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references recited in the present
application is incorporated herein by reference in its
entirety.
Example 1: Antisense Inhibition of Human STAT3 in HuVEC Cells
[0441] Antisense oligonucleotides were designed targeting a human
STAT3 nucleic acid and were tested for their effect on human STAT3
mRNA expression in vitro. The chimeric antisense oligonucleotides
presented in Tables 1 and 2 were designed as either 2-10-2 cEt
gapmers or 3-10-3 cEt gapmers. The 2-10-2 cEt gapmers are 14
nucleotides in length, wherein the central gap segment comprises
ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and
3' directions) by wings comprising two nucleosides each. The 3-10-3
cEt gapmers are 16 nucleosides in length, wherein the central gap
segment comprises ten 2'-deoxynucleosides and is flanked on both
sides (in the 5' and 3' directions) by wings comprising three
nucleosides each. Each nucleoside in the 5' wing segment and each
nucleoside in the 3' wing segment has an cEt sugar modification.
The internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5'-methylcytosines.
[0442] Potency of cEt gapmers was compared to ISIS 337332, ISIS
337333, and ISIS 345785, which are 5-10-5 MOE gapmers targeting
human STAT3 and are further described in U.S. Pat. No. 7,307,069,
incorporated herein by reference.
[0443] Cultured HuVEC cells at a density of 20,000 cells per well
were transfected using electroporation with 1,000 nM antisense
oligonucleotide. After a treatment period of approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human primer probe set
RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA, designated
herein as SEQ ID NO: 6; reverse sequence
TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7;
probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as
SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels
were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
STAT3, relative to untreated control cells. All cEt gapmers and MOE
gapmers were tested under the same conditions.
[0444] "Human Target start site" indicates the 5'-most nucleoside
to which the gapmer is targeted in the human gene sequence. "Human
Target stop site" indicates the 3'-most nucleoside to which the
gapmer is targeted human gene sequence. Each gapmer listed in Table
1 is targeted to human STAT3 mRNA, designated herein as SEQ ID NO:
1 (GENBANK Accession No. NM_139276.2). Each gapmer listed in Table
2 is targeted to the human STAT3 genomic sequence, designated
herein as SEQ ID NO: 2 (the complement of GENBANK Accession No.
NT_010755.14 truncated from nucleotides 4185000 to 4264000).
TABLE-US-00001 TABLE 1 Inhibition of human STAT3 mRNA levels by cEt
and MOE chimeric antisense oligonucleotides targeted to SEQ ID NO:
1 Human Human SEQ ISIS Start Stop Wing % ID NO Site Site Sequence
Motif Chem inhibition NO 481350 76 91 TCCAGGATCCGGTTGG 3-10-3 cEt
52 9 481575 77 90 CCAGGATCCGGTTG 2-10-2 cEt 41 10 481351 132 147
GGCCGAAGGGCCTCTC 3-10-3 cEt 14 11 481576 133 146 GCCGAAGGGCCTCT
2-10-2 cEt 8 12 481352 225 240 CCTGCTAAAATCAGGG 3-10-3 cEt 15 13
481577 226 239 CTGCTAAAATCAGG 2-10-2 cEt 12 14 481353 240 255
ATTCCATTGGGCCATC 3-10-3 cEt 78 15 481578 241 254 TTCCATTGGGCCAT
2-10-2 cEt 51 16 481354 264 279 CCGTGTGTCAAGCTGC 3-10-3 cEt 98 17
481579 265 278 CGTGTGTCAAGCTG 2-10-2 cEt 91 18 481355 322 337
ACTGCCGCAGCTCCAT 3-10-3 cEt 95 19 481580 323 336 CTGCCGCAGCTCCA
2-10-2 cEt 76 20 481356 346 361 GACTCTCAATCCAAGG 3-10-3 cEt 83 21
481581 347 360 ACTCTCAATCCAAG 2-10-2 cEt 31 22 481357 375 390
TTCTTTGCTGGCCGCA 3-10-3 cEt 97 23 481582 376 389 TCTTTGCTGGCCGC
2-10-2 cEt 87 24 481358 403 418 GATTATGAAACACCAA 3-10-3 cEt 85 25
481583 404 417 ATTATGAAACACCA 2-10-2 cEt 20 26 481359 429 444
ATACTGCTGGTCAATC 3-10-3 cEt 90 27 481584 430 443 TACTGCTGGTCAAT
2-10-2 cEt 42 28 481360 459 474 GAGAACATTCGACTCT 3-10-3 cEt 75 29
481585 460 473 AGAACATTCGACTC 2-10-2 cEt 77 30 481361 474 489
TAGATTGTGCTGATAG 3-10-3 cEt 90 31 481586 475 488 AGATTGTGCTGATA
2-10-2 cEt 81 32 481362 490 505 ACTGCTTGATTCTTCG 3-10-3 cEt 59 33
481587 491 504 CTGCTTGATTCTTC 2-10-2 cEt 23 34 481363 511 526
CAAGATACCTGCTCTG 3-10-3 cEt 84 35 481588 512 525 AAGATACCTGCTCT
2-10-2 cEt 58 36 481364 542 557 GCCACAATCCGGGCAA 3-10-3 cEt 36 37
481589 543 556 CCACAATCCGGGCA 2-10-2 cEt 69 38 481365 589 604
CAGTGGCTGCAGTCTG 3-10-3 cEt 36 39 481590 590 603 AGTGGCTGCAGTCT
2-10-2 cEt 30 40 481366 607 622 GGCCCCCTTGCTGGGC 3-10-3 cEt 1 41
481591 608 621 GCCCCCTTGCTGGG 2-10-2 cEt 0 42 481367 638 653
GTCACCACGGCTGCTG 3-10-3 cEt 70 43 481592 639 652 TCACCACGGCTGCT
2-10-2 cEt 48 44 481368 659 674 TCCAGCATCTGCTGCT 3-10-3 cEt 81 45
481593 660 673 CCAGCATCTGCTGC 2-10-2 cEt 46 46 481369 675 690
ATCCTGAAGGTGCTGC 3-10-3 cEt 29 47 481594 676 689 TCCTGAAGGTGCTG
2-10-2 cEt 16 48 481370 701 716 TCTAGATCCTGCACTC 3-10-3 cEt 79 49
481595 702 715 CTAGATCCTGCACT 2-10-2 cEt 47 50 481371 709 724
TTTTCTGTTCTAGATC 3-10-3 cEt 83 51 481596 710 723 TTTCTGTTCTAGAT
2-10-2 cEt 48 52 481372 730 745 GGAGATTCTCTACCAC 3-10-3 cEt 85 53
481597 731 744 GAGATTCTCTACCA 2-10-2 cEt 80 54 481373 751 766
AGTTGAAATCAAAGTC 3-10-3 cEt 87 55 481598 752 765 GTTGAAATCAAAGT
2-10-2 cEt 6 56 481374 788 803 AGATCTTGCATGTCTC 3-10-3 cEt 92 57
481599 789 802 GATCTTGCATGTCT 2-10-2 cEt 51 58 481375 799 814
TGTTTCCATTCAGATC 3-10-3 cEt 65 59 481600 800 813 GTTTCCATTCAGAT
2-10-2 cEt 42 60 481376 868 883 TCCGCATCTGGTCCAG 3-10-3 cEt 82 61
481601 869 882 CCGCATCTGGTCCA 2-10-2 cEt 70 62 481785 872 885
TCTCCGCATCTGGT 2-10-2 cEt 28 63 481377 884 899 TCACTCACGATGCTTC
3-10-3 cEt 85 64 481602 885 898 CACTCACGATGCTT 2-10-2 cEt 55 65
481378 892 907 CCGCCAGCTCACTCAC 3-10-3 cEt 89 66 481603 893 906
CGCCAGCTCACTCA 2-10-2 cEt 60 67 481379 955 970 TCCAGTCAGCCAGCTC
3-10-3 cEt 91 68 481604 956 969 CCAGTCAGCCAGCT 2-10-2 cEt 70 69
481380 963 978 CCGCCTCTTCCAGTCA 3-10-3 cEt 73 70 481605 964 977
CGCCTCTTCCAGTC 2-10-2 cEt 55 71 481381 1010 1025 CGATCTAGGCAGATGT
3-10-3 cEt 26 72 481606 1011 1024 GATCTAGGCAGATG 2-10-2 cEt 35 73
481382 1045 1060 GAGATTCTGCTAATGA 3-10-3 cEt 81 74 481607 1046 1059
AGATTCTGCTAATG 2-10-2 cEt 51 75 481383 1053 1068 CTGAAGTTGAGATTCT
3-10-3 cEt 84 76 481608 1054 1067 TGAAGTTGAGATTC 2-10-2 cEt 26 77
481384 1098 1113 AACTTTTTGCTGCAAC 3-10-3 cEt 76 78 481609 1099 1112
ACTTTTTGCTGCAA 2-10-2 cEt 34 79 481385 1113 1128 GTCCCCTTTGTAGGAA
3-10-3 cEt 41 80 481610 1114 1127 TCCCCTTTGTAGGA 2-10-2 cEt 37 81
481386 1186 1201 AGGCACTTTTCATTAA 3-10-3 cEt 45 82 481611 1187 1200
GGCACTTTTCATTA 2-10-2 cEt 32 83 481387 1225 1240 CAGGATGCATGGGCAT
3-10-3 cEt 92 84 481612 1226 1239 AGGATGCATGGGCA 2-10-2 cEt 86 85
481388 1269 1284 TTTAGTAGTGAACTGG 3-10-3 cEt 74 86 481613 1270 1283
TTAGTAGTGAACTG 2-10-2 cEt 22 87 481389 1282 1297 CCAGCAACCTGACTTT
3-10-3 cEt 66 88 481614 1283 1296 CAGCAACCTGACTT 2-10-2 cEt 34 89
481390 1305 1320 ATAATTCAACTCAGGG 3-10-3 cEt 92 90 481615 1306 1319
TAATTCAACTCAGG 2-10-2 cEt 48 91 481391 1314 1329 TTTAAGCTGATAATTC
3-10-3 cEt 44 92 481616 1315 1328 TTAAGCTGATAATT 2-10-2 cEt 0 93
481392 1326 1341 GCACACTTTAATTTTA 3-10-3 cEt 49 94 481617 1327 1340
CACACTTTAATTTT 2-10-2 cEt 1 95 481393 1347 1362 GTCCCCAGAGTCTTTG
3-10-3 cEt 39 96 481618 1348 1361 TCCCCAGAGTCTTT 2-10-2 cEt 41 97
481394 1437 1452 GAGGCTGCCGTTGTTG 3-10-3 cEt 62 98 481619 1438 1451
AGGCTGCCGTTGTT 2-10-2 cEt 29 99 481395 1468 1483 CCCTCAGGGTCAAGTG
3-10-3 cEt 72 100 481620 1469 1482 CCTCAGGGTCAAGT 2-10-2 cEt 37 101
481396 1480 1495 CACATCTCTGCTCCCT 3-10-3 cEt 92 102 481621 1481
1494 ACATCTCTGCTCCC 2-10-2 cEt 74 103 481397 1517 1532
ATCAGGGAAGCATCAC 3-10-3 cEt 59 104 481622 1518 1531 TCAGGGAAGCATCA
2-10-2 cEt 49 105 481398 1542 1557 GATCAGGTGCAGCTCC 3-10-3 cEt 73
106 481623 1543 1556 ATCAGGTGCAGCTC 2-10-2 cEt 40 107 481399 1563
1578 ATACACCTCGGTCTCA 3-10-3 cEt 73 108 481624 1564 1577
TACACCTCGGTCTC 2-10-2 cEt 43 109 481400 1579 1594 TCTTGAGGCCTTGGTG
3-10-3 cEt 47 110 481625 1580 1593 CTTGAGGCCTTGGT 2-10-2 cEt 16 111
481401 1589 1604 TCTAGGTCAATCTTGA 3-10-3 cEt 74 112 481626 1590
1603 CTAGGTCAATCTTG 2-10-2 cEt 54 113 481402 1599 1614
GGAGTGGGTCTCTAGG 3-10-3 cEt 52 114 481627 1600 1613 GAGTGGGTCTCTAG
2-10-2 cEt 13 115 481789 1604 1617 CAAGGAGTGGGTCT 2-10-2 cEt 10 116
481403 1607 1622 ACTGGCAAGGAGTGGG 3-10-3 cEt 58 117 481628 1608
1621 CTGGCAAGGAGTGG 2-10-2 cEt 38 118 481404 1633 1648
TCTGACAGATGTTGGA 3-10-3 cEt 50 119 481629 1634 1647 CTGACAGATGTTGG
2-10-2 cEt 64 120 481405 1641 1656 ATTTGGCATCTGACAG 3-10-3 cEt 75
121 481630 1642 1655 TTTGGCATCTGACA 2-10-2 cEt 39 122 481406 1691
1706 TTCTTGGGATTGTTGG 3-10-3 cEt 72 123 481631 1692 1705
TCTTGGGATTGTTG 2-10-2 cEt 33 124 481407 1729 1744 CCCAGGTTCCAATTGG
3-10-3 cEt 50 125 481632 1730 1743 CCAGGTTCCAATTG 2-10-2 cEt 32 126
481408 1780 1795 CTCGCTTGGTGGTGGA 3-10-3 cEt 53 127 481633 1781
1794 TCGCTTGGTGGTGG 2-10-2 cEt 35 128 481409 1795 1810
GCTCGATGCTCAGTCC 3-10-3 cEt 86 129
481634 1796 1809 CTCGATGCTCAGTC 2-10-2 cEt 43 130 481410 1825 1840
CCAAGAGTTTCTCTGC 3-10-3 cEt 91 131 481635 1826 1839 CAAGAGTTTCTCTG
2-10-2 cEt 43 132 481411 1840 1855 AATTCACACCAGGTCC 3-10-3 cEt 72
133 481636 1841 1854 ATTCACACCAGGTC 2-10-2 cEt 42 134 481412 1858
1873 TGATCTGACACCCTGA 3-10-3 cEt 90 135 481637 1859 1872
GATCTGACACCCTG 2-10-2 cEt 79 136 481413 1866 1881 AGCCCATGTGATCTGA
3-10-3 cEt 80 137 481638 1867 1880 GCCCATGTGATCTG 2-10-2 cEt 64 138
481414 1888 1903 CCATGTTTTCTTTGCA 3-10-3 cEt 69 139 481639 1889
1902 CATGTTTTCTTTGC 2-10-2 cEt 16 140 481415 1896 1911
CTTGCCAGCCATGTTT 3-10-3 cEt 88 141 481640 1897 1910 TTGCCAGCCATGTT
2-10-2 cEt 57 142 337332 1898 1917 GAAGCCCTTGCCAGCCATGT 5-10-5 MOE
63 143 481416 1901 1916 AAGCCCTTGCCAGCCA 3-10-3 cEt 87 144 481641
1902 1915 AGCCCTTGCCAGCC 2-10-2 cEt 68 145 337333 1903 1922
AAGGAGAAGCCCTTGCCAGC 5-10-5 MOE 49 146 481417 1903 1918
AGAAGCCCTTGCCAGC 3-10-3 cEt 97 147 481418 1904 1919
GAGAAGCCCTTGCCAG 3-10-3 cEt 92 148 481642 1904 1917 GAAGCCCTTGCCAG
2-10-2 cEt 67 149 481419 1905 1920 GGAGAAGCCCTTGCCA 3-10-3 cEt 83
150 481643 1905 1918 AGAAGCCCTTGCCA 2-10-2 cEt 58 151 481644 1906
1919 GAGAAGCCCTTGCC 2-10-2 cEt 45 152 481420 1948 1963
ACTTTTTCACAAGGTC 3-10-3 cEt 94 153 481645 1949 1962 CTTTTTCACAAGGT
2-10-2 cEt 50 154 481421 2021 2036 CTCAAGATGGCCCGCT 3-10-3 cEt 86
155 481646 2022 2035 TCAAGATGGCCCGC 2-10-2 cEt 41 156 481422 2036
2051 CCTGGAGGCTTAGTGC 3-10-3 cEt 80 157 481647 2037 2050
CTGGAGGCTTAGTG 2-10-2 cEt 0 158 481423 2077 2092 CTCCTTCTTTGCTGCT
3-10-3 cEt 69 159 481648 2078 2091 TCCTTCTTTGCTGC 2-10-2 cEt 51 160
481424 2093 2108 CAAGTGAAAGTGACGC 3-10-3 cEt 70 161 481649 2094
2107 AAGTGAAAGTGACG 2-10-2 cEt 25 162 481425 2115 2130
ACCGCTGATGTCCTTC 3-10-3 cEt 78 163 481650 2116 2129 CCGCTGATGTCCTT
2-10-2 cEt 79 164 481426 2131 2146 ACTGGATCTGGGTCTT 3-10-3 cEt 80
165 481651 2132 2145 CTGGATCTGGGTCT 2-10-2 cEt 64 166 481427 2155
2170 GCTGCTTTGTGTATGG 3-10-3 cEt 75 167 481652 2156 2169
CTGCTTTGTGTATG 2-10-2 cEt 82 168 481428 2164 2179 TGTTCAGCTGCTGCTT
3-10-3 cEt 77 169 481653 2165 2178 GTTCAGCTGCTGCT 2-10-2 cEt 79 170
481429 2172 2187 TGACATGTTGTTCAGC 3-10-3 cEt 84 171 481654 2173
2186 GACATGTTGTTCAG 2-10-2 cEt 70 172 481430 2190 2205
CATGATGATTTCAGCA 3-10-3 cEt 67 173 481655 2191 2204 ATGATGATTTCAGC
2-10-2 cEt 31 174 481431 2206 2221 CCATGATCTTATAGCC 3-10-3 cEt 91
175 481656 2207 2220 CATGATCTTATAGC 2-10-2 cEt 0 176 481432 2233
2248 GTGGAGACACCAGGAT 3-10-3 cEt 55 177 481657 2234 2247
TGGAGACACCAGGA 2-10-2 cEt 58 178 481433 2256 2271 AATGTCAGGATAGAGA
3-10-3 cEt 73 179 481658 2257 2270 ATGTCAGGATAGAG 2-10-2 cEt 62 180
481434 2266 2281 CCTCCTTGGGAATGTC 3-10-3 cEt 73 181 345785 2267
2286 TGCCTCCTCCTTGGGAATGT 5-10-5 MOE 50 182 481659 2267 2280
CTCCTTGGGAATGT 2-10-2 cEt 51 183 481435 2269 2284 CCTCCTCCTTGGGAAT
3-10-3 cEt 49 184 481660 2270 2283 CTCCTCCTTGGGAA 2-10-2 cEt 54 185
481436 2275 2290 CGAATGCCTCCTCCTT 3-10-3 cEt 82 186 481661 2276
2289 GAATGCCTCCTCCT 2-10-2 cEt 76 187 481437 2296 2311
TCTCTGGCCGACAATA 3-10-3 cEt 49 188 481662 2297 2310 CTCTGGCCGACAAT
2-10-2 cEt 43 189 481438 2353 2368 ACTTGGTCTTCAGGTA 3-10-3 cEt 51
190 481663 2354 2367 CTTGGTCTTCAGGT 2-10-2 cEt 52 191 481439 2371
2386 TTGGTGTCACACAGAT 3-10-3 cEt 82 192 481664 2372 2385
TGGTGTCACACAGA 2-10-2 cEt 89 193 481440 2387 2402 GTATTGCTGCAGGTCG
3-10-3 cEt 79 194 481665 2388 2401 TATTGCTGCAGGTC 2-10-2 cEt 43 195
481441 2395 2410 GGTCAATGGTATTGCT 3-10-3 cEt 55 196 481666 2396
2409 GTCAATGGTATTGC 2-10-2 cEt 36 197 481442 2403 2418
CATCGGCAGGTCAATG 3-10-3 cEt 44 198 481667 2404 2417 ATCGGCAGGTCAAT
2-10-2 cEt 31 199 481443 2423 2438 GAATCTAAAGTGCGGG 3-10-3 cEt 78
200 481668 2424 2437 AATCTAAAGTGCGG 2-10-2 cEt 41 201 481444 2431
2446 GCATCAATGAATCTAA 3-10-3 cEt 66 202 481669 2432 2445
CATCAATGAATCTA 2-10-2 cEt 0 203 481445 2439 2454 TCCAAACTGCATCAAT
3-10-3 cEt 70 204 481670 2440 2453 CCAAACTGCATCAA 2-10-2 cEt 60 205
481446 2460 2475 TTCAGCACCTTCACCA 3-10-3 cEt 44 206 481671 2461
2474 TCAGCACCTTCACC 2-10-2 cEt 41 207 481447 2476 2491
GCCCTCCTGCTGAGGG 3-10-3 cEt 10 208 481672 2477 2490 CCCTCCTGCTGAGG
2-10-2 cEt 15 209 481448 2484 2499 CTCAAACTGCCCTCCT 3-10-3 cEt 29
210 481797 2484 2497 CAAACTGCCCTCCT 2-10-2 cEt 11 211 481673 2485
2498 TCAAACTGCCCTCC 2-10-2 cEt 33 212 481449 2503 2518
CCATGTCAAAGGTGAG 3-10-3 cEt 77 213 481674 2504 2517 CATGTCAAAGGTGA
2-10-2 cEt 31 214 481450 2530 2545 GGGAGGTAGCGCACTC 3-10-3 cEt 53
215 481675 2531 2544 GGAGGTAGCGCACT 2-10-2 cEt 41 216 481451 2592
2607 GAATGCAGGTAGGCGC 3-10-3 cEt 55 217 481676 2593 2606
AATGCAGGTAGGCG 2-10-2 cEt 39 218 481452 2631 2646 TTTCAGATGATCTGGG
3-10-3 cEt 71 219 481677 2632 2645 TTCAGATGATCTGG 2-10-2 cEt 38 220
481574 2650 2665 GGAACCACAAAGTTAG 3-10-3 cEt 69 221 481799 2651
2664 GAACCACAAAGTTA 2-10-2 cEt 50 222 481453 2681 2696
GATAGCAGAAGTAGGA 3-10-3 cEt 92 223 481678 2682 2695 ATAGCAGAAGTAGG
2-10-2 cEt 78 224 481454 2702 2717 AAAGTGCCCAGATTGC 3-10-3 cEt 85
225 481679 2703 2716 AAGTGCCCAGATTG 2-10-2 cEt 69 226 481455 2722
2737 CACTCATTTCTCTATT 3-10-3 cEt 74 227 481680 2723 2736
ACTCATTTCTCTAT 2-10-2 cEt 39 228 481456 2767 2782 AACACATCCTTATTTG
3-10-3 cEt 48 229 481681 2768 2781 ACACATCCTTATTT 2-10-2 cEt 47 230
481457 2779 2794 TGGGTCTCAGAGAACA 3-10-3 cEt 88 231 481682 2780
2793 GGGTCTCAGAGAAC 2-10-2 cEt 77 232 481458 2832 2847
CAAGACATTTCCTTTT 3-10-3 cEt 54 233 481683 2833 2846 AAGACATTTCCTTT
2-10-2 cEt 29 234 481459 2908 2923 GGAGGCACTTGTCTAA 3-10-3 cEt 76
235 481684 2909 2922 GAGGCACTTGTCTA 2-10-2 cEt 89 236 481460 2943
2958 TTACAGAAACAGGCAG 3-10-3 cEt 83 237 481685 2944 2957
TACAGAAACAGGCA 2-10-2 cEt 36 238 481461 2969 2984 AGCTATAGGTGGCCTG
3-10-3 cEt 75 239 481686 2970 2983 GCTATAGGTGGCCT 2-10-2 cEt 70 240
481462 2984 2999 ATGCCAGGAGTATGTA 3-10-3 cEt 89 241 481687 2985
2998 TGCCAGGAGTATGT 2-10-2 cEt 80 242 481463 3001 3016
CAAGGTTAAAAAGTGC 3-10-3 cEt 88 243 481688 3002 3015 AAGGTTAAAAAGTG
2-10-2 cEt 13 244 481464 3016 3031 CTATTTGGATGTCAGC 3-10-3 cEt 97
245 481689 3017 3030 TATTTGGATGTCAG 2-10-2 cEt 40 246 481465 3032
3047 TAGATAGTCCTATCTT 3-10-3 cEt 51 247 481690 3033 3046
AGATAGTCCTATCT 2-10-2 cEt 64 248 481466 3047 3062 AAGAAACCTAGGGCTT
3-10-3 cEt 74 249 481691 3048 3061 AGAAACCTAGGGCT 2-10-2 cEt 77 250
481467 3097 3112 GCTGATACAGTGTTTT 3-10-3 cEt 74 251 481692 3098
3111 CTGATACAGTGTTT 2-10-2 cEt 74 252 481468 3112 3127
ATACAGAAAGGCTATG 3-10-3 cEt 71 253 481693 3113 3126 TACAGAAAGGCTAT
2-10-2 cEt 25 254 481469 3127 3142 GCTTAAGTTTCTTAAA 3-10-3 cEt 61
255
481694 3128 3141 CTTAAGTTTCTTAA 2-10-2 cEt 0 256 481470 3461 3476
AGCACCAAGGAGGCTG 3-10-3 cEt 49 257 481695 3462 3475 GCACCAAGGAGGCT
2-10-2 cEt 83 258 481471 3476 3491 AAGCTGAATGCTTAAA 3-10-3 cEt 36
259 481696 3477 3490 AGCTGAATGCTTAA 2-10-2 cEt 33 260 481472 3491
3506 TTACCAGCCTGAAGGA 3-10-3 cEt 76 261 481697 3492 3505
TACCAGCCTGAAGG 2-10-2 cEt 63 262 481473 3506 3521 CAGGGATTATATAAAT
3-10-3 cEt 53 263 481698 3507 3520 AGGGATTATATAAA 2-10-2 cEt 15 264
481474 3521 3536 ACCTGAAGCCCGTTTC 3-10-3 cEt 80 265 481699 3522
3535 CCTGAAGCCCGTTT 2-10-2 cEt 57 266 481475 3536 3551
TGTCTTAAGGGTTTGA 3-10-3 cEt 93 267 481700 3537 3550 GTCTTAAGGGTTTG
2-10-2 cEt 89 268 481476 3551 3566 GGTTGCAGCTTCAGAT 3-10-3 cEt 92
269 481701 3552 3565 GTTGCAGCTTCAGA 2-10-2 cEt 60 270 481477 3567
3582 TCAACACCAAAGGCCA 3-10-3 cEt 95 271 481702 3568 3581
CAACACCAAAGGCC 2-10-2 cEt 89 272 481478 3585 3600 TCCTTAAACCTTCCTA
3-10-3 cEt 84 273 481703 3586 3599 CCTTAAACCTTCCT 2-10-2 cEt 57 274
481479 3600 3615 AAAATGCTTAGATTCT 3-10-3 cEt 80 275 481704 3601
3614 AAATGCTTAGATTC 2-10-2 cEt 32 276 481480 3628 3643
AAATAAGTCTATTTAT 3-10-3 cEt 5 277 481705 3629 3642 AATAAGTCTATTTA
2-10-2 cEt 25 278 481481 3648 3663 GGCCAATACATTACAA 3-10-3 cEt 63
279 481706 3649 3662 GCCAATACATTACA 2-10-2 cEt 56 280 481482 3670
3685 TGCCCAGCCTTACTCA 3-10-3 cEt 55 281 481707 3671 3684
GCCCAGCCTTACTC 2-10-2 cEt 43 282 481483 3685 3700 GTTGTAAGCACCCTCT
3-10-3 cEt 1 283 481708 3686 3699 TTGTAAGCACCCTC 2-10-2 cEt 56 284
481484 3700 3715 AGAAAGGGAGTCAAGG 3-10-3 cEt 60 285 481709 3701
3714 GAAAGGGAGTCAAG 2-10-2 cEt 27 286 481485 3717 3732
GCAGATCAAGTCCAGG 3-10-3 cEt 90 287 481710 3718 3731 CAGATCAAGTCCAG
2-10-2 cEt 88 288 481486 3730 3745 AGCCTCTGAAACAGCA 3-10-3 cEt 75
289 481711 3731 3744 GCCTCTGAAACAGC 2-10-2 cEt 74 290 481487 3746
3761 CCCACAGAAACAACCT 3-10-3 cEt 66 291 481712 3747 3760
CCACAGAAACAACC 2-10-2 cEt 45 292 481488 3761 3776 AGCCCTGATAAGGCAC
3-10-3 cEt 23 293 481713 3762 3775 GCCCTGATAAGGCA 2-10-2 cEt 18 294
481489 3776 3791 AATCAGAAGTATCCCA 3-10-3 cEt 60 295 481714 3777
3790 ATCAGAAGTATCCC 2-10-2 cEt 43 296 481490 3833 3848
GCCTCTAGCAGGATCA 3-10-3 cEt 78 297 481715 3834 3847 CCTCTAGCAGGATC
2-10-2 cEt 79 298 481491 3848 3863 CACGCAAGGAGACATG 3-10-3 cEt 70
299 481716 3849 3862 ACGCAAGGAGACAT 2-10-2 cEt 68 300 481492 3863
3878 TGAGGGACCTTTAGAC 3-10-3 cEt 61 301 481717 3864 3877
GAGGGACCTTTAGA 2-10-2 cEt 44 302 481493 3886 3901 CAGGATTCCTAAAACA
3-10-3 cEt 43 303 481718 3887 3900 AGGATTCCTAAAAC 2-10-2 cEt 7 304
481494 3901 3916 ATGAGGTCCTGAGACC 3-10-3 cEt 60 305 481719 3902
3915 TGAGGTCCTGAGAC 2-10-2 cEt 29 306 481495 3940 3955
CATCATGTCCAACCTG 3-10-3 cEt 92 307 481720 3941 3954 ATCATGTCCAACCT
2-10-2 cEt 63 308 481496 3955 3970 GGGCCCCATAGTGTGC 3-10-3 cEt 29
309 481721 3956 3969 GGCCCCATAGTGTG 2-10-2 cEt 19 310 481497 3977
3992 AGCTCAACCAGACACG 3-10-3 cEt 67 311 481722 3978 3991
GCTCAACCAGACAC 2-10-2 cEt 69 312 481498 3992 4007 GAACCATATTCCCTGA
3-10-3 cEt 90 313 481723 3993 4006 AACCATATTCCCTG 2-10-2 cEt 49 314
481499 4007 4022 CAAGAAACTGGCTAAG 3-10-3 cEt 43 315 481724 4008
4021 AAGAAACTGGCTAA 2-10-2 cEt 17 316 481500 4022 4037
GCCACTGGATATCACC 3-10-3 cEt 92 317 481501 4048 4063
AACTGAATGAAGACGC 3-10-3 cEt 91 318 481726 4049 4062 ACTGAATGAAGACG
2-10-2 cEt 56 319 481502 4063 4078 CCTTTGCCCTGCATGA 3-10-3 cEt 85
320 481727 4064 4077 CTTTGCCCTGCATG 2-10-2 cEt 70 321 481503 4078
4093 AAGTTTATCAGTAAGC 3-10-3 cEt 57 322 481728 4079 4092
AGTTTATCAGTAAG 2-10-2 cEt 22 323 481504 4093 4108 TACGAGGGCAGACTCA
3-10-3 cEt 60 324 481729 4094 4107 ACGAGGGCAGACTC 2-10-2 cEt 22 325
481505 4108 4123 AGGTATACACCCTCAT 3-10-3 cEt 45 326 481730 4109
4122 GGTATACACCCTCA 2-10-2 cEt 47 327 481506 4123 4138
CCTCAGAGGGAGGCCA 3-10-3 cEt 32 328 481731 4124 4137 CTCAGAGGGAGGCC
2-10-2 cEt 0 329 481507 4138 4153 GGGAGGAGTCACCAGC 3-10-3 cEt 64
330 481732 4139 4152 GGAGGAGTCACCAG 2-10-2 cEt 59 331 481508 4205
4220 TAGCCAGCCAAGGCGG 3-10-3 cEt 33 332 481733 4206 4219
AGCCAGCCAAGGCG 2-10-2 cEt 50 333 481509 4220 4235 ACAGGAGAGGCGAGCT
3-10-3 cEt 46 334 481734 4221 4234 CAGGAGAGGCGAGC 2-10-2 cEt 28 335
481510 4237 4252 TAGGTGTTCCCATACG 3-10-3 cEt 95 336 481735 4238
4251 AGGTGTTCCCATAC 2-10-2 cEt 22 337 481511 4258 4273
GGCAGCCCATCCAGCA 3-10-3 cEt 43 338 481736 4259 4272 GCAGCCCATCCAGC
2-10-2 cEt 54 339 481512 4275 4290 CATGCCTCTGAGTCAG 3-10-3 cEt 30
340 481737 4276 4289 ATGCCTCTGAGTCA 2-10-2 cEt 31 341 481513 4290
4305 GTTGCCAAATCCGGCC 3-10-3 cEt 85 342 481738 4291 4304
TTGCCAAATCCGGC 2-10-2 cEt 70 343 481514 4305 4320 GCAAGGTGGTTTTGAG
3-10-3 cEt 85 344 481739 4306 4319 CAAGGTGGTTTTGA 2-10-2 cEt 60 345
481515 4325 4340 AGAAACTCTGATCAGC 3-10-3 cEt 88 346 481740 4326
4339 GAAACTCTGATCAG 2-10-2 cEt 71 347 481516 4364 4379
CAGAGACCAGCTAATT 3-10-3 cEt 78 348 481741 4365 4378 AGAGACCAGCTAAT
2-10-2 cEt 80 349 481517 4394 4409 ATCTTAGAGAAGGTCG 3-10-3 cEt 87
350 481742 4395 4408 TCTTAGAGAAGGTC 2-10-2 cEt 64 351 481518 4425
4440 CCAGGCAGGAGGACTG 3-10-3 cEt 67 352 481743 4426 4439
CAGGCAGGAGGACT 2-10-2 cEt 75 353 481519 4437 4452 CATCAACTGTCTCCAG
3-10-3 cEt 29 354 481744 4438 4451 ATCAACTGTCTCCA 2-10-2 cEt 69 355
481520 4439 4454 CACATCAACTGTCTCC 3-10-3 cEt 73 356 481745 4440
4453 ACATCAACTGTCTC 2-10-2 cEt 74 357 481521 4459 4474
GAAGTAAGAGCTCTGC 3-10-3 cEt 86 358 481746 4460 4473 AAGTAAGAGCTCTG
2-10-2 cEt 67 359 481522 4474 4489 AAGAGTGTTGCTGGAG 3-10-3 cEt 92
360 481747 4475 4488 AGAGTGTTGCTGGA 2-10-2 cEt 95 361 481523 4489
4504 GCTTATTATGTACTGA 3-10-3 cEt 95 362 481748 4490 4503
CTTATTATGTACTG 2-10-2 cEt 15 363 481524 4530 4545 GCCCAAGTCTCACCTT
3-10-3 cEt 70 364 481749 4531 4544 CCCAAGTCTCACCT 2-10-2 cEt 70 365
481525 4541 4556 CCCAATGGTAAGCCCA 3-10-3 cEt 93 366 481750 4542
4555 CCAATGGTAAGCCC 2-10-2 cEt 94 367 481526 4543 4558
AACCCAATGGTAAGCC 3-10-3 cEt 82 368 481751 4544 4557 ACCCAATGGTAAGC
2-10-2 cEt 54 369 481527 4560 4575 TAGGTCCCTATGATTT 3-10-3 cEt 55
370 481752 4561 4574 AGGTCCCTATGATT 2-10-2 cEt 62 371 481528 4579
4594 AAGCCCTGAACCCTCG 3-10-3 cEt 77 372 481753 4580 4593
AGCCCTGAACCCTC 2-10-2 cEt 71 373 481529 4615 4630 CCTAAGGCCATGAACT
3-10-3 cEt 64 374 481754 4616 4629 CTAAGGCCATGAAC 2-10-2 cEt 53 375
481530 4630 4645 ACCAGATACATGCTAC 3-10-3 cEt 87 376 481755 4631
4644 CCAGATACATGCTA 2-10-2 cEt 84 377 481531 4646 4661
TACAATCAGAGTTAAG 3-10-3 cEt 66 378 481756 4647 4660 ACAATCAGAGTTAA
2-10-2 cEt 5 379 481532 4664 4679 TCCTCTCAGAACTTTT 3-10-3 cEt 65
380
481757 4665 4678 CCTCTCAGAACTTT 2-10-2 cEt 81 381 481533 4666 4681
GCTCCTCTCAGAACTT 3-10-3 cEt 80 382 481758 4667 4680 CTCCTCTCAGAACT
2-10-2 cEt 62 383 481534 4693 4708 TTCTTTAATGGGCCAC 3-10-3 cEt 79
384 481759 4694 4707 TCTTTAATGGGCCA 2-10-2 cEt 74 385 481535 4767
4782 ACGGGATTCCCTCGGC 3-10-3 cEt 78 386 481760 4768 4781
CGGGATTCCCTCGG 2-10-2 cEt 78 387 481536 4782 4797 GTAGGTAAGCAACCCA
3-10-3 cEt 91 388 481761 4783 4796 TAGGTAAGCAACCC 2-10-2 cEt 78 389
481537 4830 4845 GAATTTGAATGCAGTG 3-10-3 cEt 84 390 481762 4831
4844 AATTTGAATGCAGT 2-10-2 cEt 2 391 481538 4844 4859
TGAAGTACACATTGGA 3-10-3 cEt 92 392 481763 4845 4858 GAAGTACACATTGG
2-10-2 cEt 96 393 481539 4860 4875 ATAAATTTTTACACTA 3-10-3 cEt 19
394 481764 4861 4874 TAAATTTTTACACT 2-10-2 cEt 1 395 481765 4869
4882 CAATAATATAAATT 2-10-2 cEt 0 396 481541 4934 4949
CTGGAAGTTAAAGTAG 3-10-3 cEt 71 397 481766 4935 4948 TGGAAGTTAAAGTA
2-10-2 cEt 10 398
TABLE-US-00002 TABLE 2 Inhibition of human STAT3 mRNA levels by cEt
and MOE chimeric antisense oligonucleotides targeted to SEQ ID NO:
2 Human Human SEQ ISIS Start Stop Wing % ID NO Site Site Sequence
Motif Chem inhibition NO 481350 1065 1080 TCCAGGATCCGGTTGG 3-10-3
cEt 52 9 481575 1066 1079 CCAGGATCCGGTTG 2-10-2 cEt 41 10 481351
1121 1136 GGCCGAAGGGCCTCTC 3-10-3 cEt 14 11 481576 1122 1135
GCCGAAGGGCCTCT 2-10-2 cEt 8 12 481542 1988 2003 GGCTCAATTATTTATC
3-10-3 cEt 64 399 481767 1989 2002 GCTCAATTATTTAT 2-10-2 cEt 0 400
481543 1996 2011 AATGCAATGGCTCAAT 3-10-3 cEt 84 401 481768 1997
2010 ATGCAATGGCTCAA 2-10-2 cEt 95 402 481544 2004 2019
ATCCAGTAAATGCAAT 3-10-3 cEt 58 403 481769 2005 2018 TCCAGTAAATGCAA
2-10-2 cEt 55 404 481545 2061 2076 AGAAAACTCCCACTCT 3-10-3 cEt 36
405 481770 2062 2075 GAAAACTCCCACTC 2-10-2 cEt 42 406 481546 2113
2128 CTGTCTTTGTTTCCCT 3-10-3 cEt 70 407 481771 2114 2127
TGTCTTTGTTTCCC 2-10-2 cEt 75 408 481547 2121 2136 AGGCCAGCCTGTCTTT
3-10-3 cEt 87 409 481772 2122 2135 GGCCAGCCTGTCTT 2-10-2 cEt 53 410
481548 2705 2720 CTAATGGTTCTTTGTG 3-10-3 cEt 78 411 481773 2706
2719 TAATGGTTCTTTGT 2-10-2 cEt 9 412 481549 6476 6491
GAAATTCATTCTTCCA 3-10-3 cEt 96 413 481774 6477 6490 AAATTCATTCTTCC
2-10-2 cEt 56 414 481550 10001 10016 ACACACACAGATGTGA 3-10-3 cEt 48
415 481775 10002 10015 CACACACAGATGTG 2-10-2 cEt 35 416 481551
10337 10352 CTACCCAAACATCCCC 3-10-3 cEt 69 417 481776 10338 10351
TACCCAAACATCCC 2-10-2 cEt 62 418 481552 10345 10360
TACAAAAACTACCCAA 3-10-3 cEt 30 419 481777 10346 10359
ACAAAAACTACCCA 2-10-2 cEt 1 420 481553 10364 10379 AGTTTTCAGAAATGGC
3-10-3 cEt 96 421 481778 10365 10378 GTTTTCAGAAATGG 2-10-2 cEt 47
422 481554 15469 15484 CAAGCTTTTCTATGAA 3-10-3 cEt 86 423 481779
15470 15483 AAGCTTTTCTATGA 2-10-2 cEt 60 424 481555 24588 24603
TTATTCAGGTCACTTT 3-10-3 cEt 73 425 481780 24589 24602
TATTCAGGTCACTT 2-10-2 cEt 60 426 481352 40953 40968
CCTGCTAAAATCAGGG 3-10-3 cEt 15 13 481577 40954 40967 CTGCTAAAATCAGG
2-10-2 cEt 12 14 481353 40968 40983 ATTCCATTGGGCCATC 3-10-3 cEt 78
15 481578 40969 40982 TTCCATTGGGCCAT 2-10-2 cEt 51 16 481354 40992
41007 CCGTGTGTCAAGCTGC 3-10-3 cEt 98 17 481579 40993 41006
CGTGTGTCAAGCTG 2-10-2 cEt 91 18 481355 41050 41065 ACTGCCGCAGCTCCAT
3-10-3 cEt 95 19 481580 41051 41064 CTGCCGCAGCTCCA 2-10-2 cEt 76 20
481356 41074 41089 GACTCTCAATCCAAGG 3-10-3 cEt 83 21 481581 41075
41088 ACTCTCAATCCAAG 2-10-2 cEt 31 22 481556 42765 42780
GCATATGCCCTAGGAA 3-10-3 cEt 23 430 481781 42766 42779
CATATGCCCTAGGA 2-10-2 cEt 15 431 481357 42778 42793
TTCTTTGCTGGCCGCA 3-10-3 cEt 97 23 481582 42779 42792 TCTTTGCTGGCCGC
2-10-2 cEt 87 24 481358 42806 42821 GATTATGAAACACCAA 3-10-3 cEt 85
25 481583 42807 42820 ATTATGAAACACCA 2-10-2 cEt 20 26 481359 42832
42847 ATACTGCTGGTCAATC 3-10-3 cEt 90 27 481584 42833 42846
TACTGCTGGTCAAT 2-10-2 cEt 42 28 481360 42862 42877 GAGAACATTCGACTCT
3-10-3 cEt 75 29 481585 42863 42876 AGAACATTCGACTC 2-10-2 cEt 77 30
481361 42877 42892 TAGATTGTGCTGATAG 3-10-3 cEt 90 31 481586 42878
42891 AGATTGTGCTGATA 2-10-2 cEt 81 32 481362 42893 42908
ACTGCTTGATTCTTCG 3-10-3 cEt 59 33 481587 42894 42907 CTGCTTGATTCTTC
2-10-2 cEt 23 34 481557 43043 43058 GCTAATTACTTCTCCT 3-10-3 cEt 57
432 481782 43044 43057 CTAATTACTTCTCC 2-10-2 cEt 25 433 481588
43826 43839 AAGATACCTGCTCT 2-10-2 cEt 58 36 481364 43856 43871
GCCACAATCCGGGCAA 3-10-3 cEt 36 37 481589 43857 43870 CCACAATCCGGGCA
2-10-2 cEt 69 38 481365 43903 43918 CAGTGGCTGCAGTCTG 3-10-3 cEt 36
39 481590 43904 43917 AGTGGCTGCAGTCT 2-10-2 cEt 30 40 481558 50069
50084 GCCCCCTTGCTGCCAA 3-10-3 cEt 0 434 481783 50070 50083
CCCCCTTGCTGCCA 2-10-2 cEt 39 435 481367 50101 50116
GTCACCACGGCTGCTG 3-10-3 cEt 70 43 481592 50102 50115 TCACCACGGCTGCT
2-10-2 cEt 48 44 481368 50122 50137 TCCAGCATCTGCTGCT 3-10-3 cEt 81
45 481593 50123 50136 CCAGCATCTGCTGC 2-10-2 cEt 46 46 481369 50138
50153 ATCCTGAAGGTGCTGC 3-10-3 cEt 29 47 481594 50139 50152
TCCTGAAGGTGCTG 2-10-2 cEt 16 48 481559 50668 50683 TGTTCTAGATCCTGTT
3-10-3 cEt 72 436 481784 50669 50682 GTTCTAGATCCTGT 2-10-2 cEt 79
437 481371 50673 50688 TTTTCTGTTCTAGATC 3-10-3 cEt 83 51 481596
50674 50687 TTTCTGTTCTAGAT 2-10-2 cEt 48 52 481372 50694 50709
GGAGATTCTCTACCAC 3-10-3 cEt 85 53 481597 50695 50708 GAGATTCTCTACCA
2-10-2 cEt 80 54 481373 50715 50730 AGTTGAAATCAAAGTC 3-10-3 cEt 87
55 481598 50716 50729 GTTGAAATCAAAGT 2-10-2 cEt 6 56 481599 51626
51639 GATCTTGCATGTCT 2-10-2 cEt 51 58 481375 51636 51651
TGTTTCCATTCAGATC 3-10-3 cEt 65 59 481600 51637 51650 GTTTCCATTCAGAT
2-10-2 cEt 42 60 481376 51705 51720 TCCGCATCTGGTCCAG 3-10-3 cEt 82
61 481601 51706 51719 CCGCATCTGGTCCA 2-10-2 cEt 70 62 481560 51708
51723 CTCTCCGCATCTGGTC 3-10-3 cEt 63 438 481785 51709 51722
TCTCCGCATCTGGT 2-10-2 cEt 28 63 481378 51905 51920 CCGCCAGCTCACTCAC
3-10-3 cEt 89 66 481603 51906 51919 CGCCAGCTCACTCA 2-10-2 cEt 60 67
481379 51968 51983 TCCAGTCAGCCAGCTC 3-10-3 cEt 91 68 481604 51969
51982 CCAGTCAGCCAGCT 2-10-2 cEt 70 69 481380 51976 51991
CCGCCTCTTCCAGTCA 3-10-3 cEt 73 70 481605 51977 51990 CGCCTCTTCCAGTC
2-10-2 cEt 55 71 481381 52023 52038 CGATCTAGGCAGATGT 3-10-3 cEt 26
72 481606 52024 52037 GATCTAGGCAGATG 2-10-2 cEt 35 73 481382 55443
55458 GAGATTCTGCTAATGA 3-10-3 cEt 81 74 481607 55444 55457
AGATTCTGCTAATG 2-10-2 cEt 51 75 481383 55451 55466 CTGAAGTTGAGATTCT
3-10-3 cEt 84 76 481608 55452 55465 TGAAGTTGAGATTC 2-10-2 cEt 26 77
481384 55496 55511 AACTTTTTGCTGCAAC 3-10-3 cEt 76 78 481609 55497
55510 ACTTTTTGCTGCAA 2-10-2 cEt 34 79 481385 55511 55526
GTCCCCTTTGTAGGAA 3-10-3 cEt 41 80 481610 55512 55525 TCCCCTTTGTAGGA
2-10-2 cEt 37 81 481387 55748 55763 CAGGATGCATGGGCAT 3-10-3 cEt 92
84 481612 55749 55762 AGGATGCATGGGCA 2-10-2 cEt 86 85 481388 55792
55807 TTTAGTAGTGAACTGG 3-10-3 cEt 74 86 481613 55793 55806
TTAGTAGTGAACTG 2-10-2 cEt 22 87 481561 57949 57964 TGACCAGCAACCTATT
3-10-3 cEt 43 439 481786 57950 57963 GACCAGCAACCTAT 2-10-2 cEt 59
440 481390 57969 57984 ATAATTCAACTCAGGG 3-10-3 cEt 92 90 481615
57970 57983 TAATTCAACTCAGG 2-10-2 cEt 48 91 481391 57978 57993
TTTAAGCTGATAATTC 3-10-3 cEt 44 92 481616 57979 57992 TTAAGCTGATAATT
2-10-2 cEt 0 93 481392 57990 58005 GCACACTTTAATTTTA 3-10-3 cEt 49
94 481617 57991 58004 CACACTTTAATTTT 2-10-2 cEt 1 95 481562 59703
59718 CCCAGAGTCTCTGTAA 3-10-3 cEt 36 441 481787 59704 59717
CCAGAGTCTCTGTA 2-10-2 cEt 22 442 481394 59895 59910
GAGGCTGCCGTTGTTG 3-10-3 cEt 62 98 481619 59896 59909 AGGCTGCCGTTGTT
2-10-2 cEt 29 99 481396 60034 60049 CACATCTCTGCTCCCT 3-10-3 cEt 92
102 481621 60035 60048 ACATCTCTGCTCCC 2-10-2 cEt 74 103 481563
60064 60079 TTACATCACAATTGGC 3-10-3 cEt 24 445
481788 60065 60078 TACATCACAATTGG 2-10-2 cEt 3 446 481398 63306
63321 GATCAGGTGCAGCTCC 3-10-3 cEt 73 106 481623 63307 63320
ATCAGGTGCAGCTC 2-10-2 cEt 40 107 481399 63327 63342
ATACACCTCGGTCTCA 3-10-3 cEt 73 108 481624 63328 63341
TACACCTCGGTCTC 2-10-2 cEt 43 109 481400 63343 63358
TCTTGAGGCCTTGGTG 3-10-3 cEt 47 110 481625 63344 63357
CTTGAGGCCTTGGT 2-10-2 cEt 16 111 481401 63353 63368
TCTAGGTCAATCTTGA 3-10-3 cEt 74 112 481626 63354 63367
CTAGGTCAATCTTG 2-10-2 cEt 54 113 481564 64421 64436
GCAAGGAGTGGGTCTG 3-10-3 cEt 33 446 481789 64422 64435
CAAGGAGTGGGTCT 2-10-2 cEt 10 116 481403 64425 64440
ACTGGCAAGGAGTGGG 3-10-3 cEt 58 117 481628 64426 64439
CTGGCAAGGAGTGG 2-10-2 cEt 38 118 481404 64451 64466
TCTGACAGATGTTGGA 3-10-3 cEt 50 119 481629 64452 64465
CTGACAGATGTTGG 2-10-2 cEt 64 120 481405 64459 64474
ATTTGGCATCTGACAG 3-10-3 cEt 75 121 481630 64460 64473
TTTGGCATCTGACA 2-10-2 cEt 39 122 481407 64663 64678
CCCAGGTTCCAATTGG 3-10-3 cEt 50 125 481632 64664 64677
CCAGGTTCCAATTG 2-10-2 cEt 32 126 481408 64714 64729
CTCGCTTGGTGGTGGA 3-10-3 cEt 53 127 481633 64715 64728
TCGCTTGGTGGTGG 2-10-2 cEt 35 128 481409 64729 64744
GCTCGATGCTCAGTCC 3-10-3 cEt 86 129 481634 64730 64743
CTCGATGCTCAGTC 2-10-2 cEt 43 130 481410 64759 64774
CCAAGAGTTTCTCTGC 3-10-3 cEt 91 131 481635 64760 64773
CAAGAGTTTCTCTG 2-10-2 cEt 43 132 481411 65859 65874
AATTCACACCAGGTCC 3-10-3 cEt 72 133 481636 65860 65873
ATTCACACCAGGTC 2-10-2 cEt 42 134 481412 65877 65892
TGATCTGACACCCTGA 3-10-3 cEt 90 135 481637 65878 65891
GATCTGACACCCTG 2-10-2 cEt 79 136 481413 65885 65900
AGCCCATGTGATCTGA 3-10-3 cEt 80 137 481638 65886 65899
GCCCATGTGATCTG 2-10-2 cEt 64 138 481565 66119 66134
TTTCCTGGAGAAAAGA 3-10-3 cEt 4 447 481790 66120 66133 TTCCTGGAGAAAAG
2-10-2 cEt 3 448 481566 66127 66142 AGCCATGTTTTCCTGG 3-10-3 cEt 62
449 481791 66128 66141 GC CATGTTTTCCTG 2-10-2 cEt 73 450 481415
66133 66148 CTTGCCAGCCATGTTT 3-10-3 cEt 88 141 481640 66134 66147
TTGCCAGCCATGTT 2-10-2 cEt 57 142 337332 66135 66154
GAAGCCCTTGCCAGCCATGT 5-10-5 MOE 63 143 481416 66138 66153
AAGCCCTTGCCAGCCA 3-10-3 cEt 87 144 481641 66139 66152
AGCCCTTGCCAGCC 2-10-2 cEt 68 145 337333 66140 66159
AAGGAGAAGCCCTTGCCAGC 5-10-5 MOE 49 146 481417 66140 66155
AGAAGCCCTTGCCAGC 3-10-3 cEt 97 147 481418 66141 66156
GAGAAGCCCTTGCCAG 3-10-3 cEt 92 148 481642 66141 66154
GAAGCCCTTGCCAG 2-10-2 cEt 67 149 481419 66142 66157
GGAGAAGCCCTTGCCA 3-10-3 cEt 83 150 481643 66142 66155
AGAAGCCCTTGCCA 2-10-2 cEt 58 151 481644 66143 66156 GAGAAGCCCTTGCC
2-10-2 cEt 45 152 481420 66185 66200 ACTTTTTCACAAGGTC 3-10-3 cEt 94
153 481645 66186 66199 CTTTTTCACAAGGT 2-10-2 cEt 50 154 481421
66374 66389 CTCAAGATGGCCCGCT 3-10-3 cEt 86 155 481646 66375 66388
TCAAGATGGCCCGC 2-10-2 cEt 41 156 481422 66389 66404
CCTGGAGGCTTAGTGC 3-10-3 cEt 80 157 481647 66390 66403
CTGGAGGCTTAGTG 2-10-2 cEt 0 158 481423 66430 66445 CTCCTTCTTTGCTGCT
3-10-3 cEt 69 159 481648 66431 66444 TCCTTCTTTGCTGC 2-10-2 cEt 51
160 481424 66446 66461 CAAGTGAAAGTGACGC 3-10-3 cEt 70 161 481649
66447 66460 AAGTGAAAGTGACG 2-10-2 cEt 25 162 481425 66468 66483
ACCGCTGATGTCCTTC 3-10-3 cEt 78 163 481650 66469 66482
CCGCTGATGTCCTT 2-10-2 cEt 79 164 481426 66993 67008
ACTGGATCTGGGTCTT 3-10-3 cEt 80 165 481651 66994 67007
CTGGATCTGGGTCT 2-10-2 cEt 64 166 481427 67017 67032
GCTGCTTTGTGTATGG 3-10-3 cEt 75 167 481652 67018 67031
CTGCTTTGTGTATG 2-10-2 cEt 82 168 481428 67026 67041
TGTTCAGCTGCTGCTT 3-10-3 cEt 77 169 481653 67027 67040
GTTCAGCTGCTGCT 2-10-2 cEt 79 170 481429 67034 67049
TGACATGTTGTTCAGC 3-10-3 cEt 84 171 481654 67035 67048
GACATGTTGTTCAG 2-10-2 cEt 70 172 481430 67052 67067
CATGATGATTTCAGCA 3-10-3 cEt 67 173 481655 67053 67066
ATGATGATTTCAGC 2-10-2 cEt 31 174 481431 67068 67083
CCATGATCTTATAGCC 3-10-3 cEt 91 175 481656 67069 67082
CATGATCTTATAGC 2-10-2 cEt 0 176 481432 67095 67110 GTGGAGACACCAGGAT
3-10-3 cEt 55 177 481657 67096 67109 TGGAGACACCAGGA 2-10-2 cEt 58
178 481433 67118 67133 AATGTCAGGATAGAGA 3-10-3 cEt 73 179 481658
67119 67132 ATGTCAGGATAGAG 2-10-2 cEt 62 180 481434 67128 67143
CCTCCTTGGGAATGTC 3-10-3 cEt 73 181 345785 67129 67148
TGCCTCCTCCTTGGGAATGT 5-10-5 MOE 50 182 481659 67129 67142
CTCCTTGGGAATGT 2-10-2 cEt 51 183 481435 67131 67146
CCTCCTCCTTGGGAAT 3-10-3 cEt 49 184 481660 67132 67145
CTCCTCCTTGGGAA 2-10-2 cEt 54 185 481436 67137 67152
CGAATGCCTCCTCCTT 3-10-3 cEt 82 186 481661 67138 67151
GAATGCCTCCTCCT 2-10-2 cEt 76 187 481437 67158 67173
TCTCTGGCCGACAATA 3-10-3 cEt 49 188 481662 67159 67172
CTCTGGCCGACAAT 2-10-2 cEt 43 189 481567 67194 67209
AACAACTACCTGGGTC 3-10-3 cEt 20 451 481792 67195 67208
ACAACTACCTGGGT 2-10-2 cEt 0 452 481438 72272 72287 ACTTGGTCTTCAGGTA
3-10-3 cEt 51 190 481663 72273 72286 CTTGGTCTTCAGGT 2-10-2 cEt 52
191 481568 72290 72305 ACGGTGTCACACAGAT 3-10-3 cEt 85 453 481793
72291 72304 CGGTGTCACACAGA 2-10-2 cEt 93 454 481569 72430 72445
AACACACAAGGTCACT 3-10-3 cEt 62 455 481794 72431 72444
ACACACAAGGTCAC 2-10-2 cEt 81 456 481570 72438 72453
GCTTTTTAAACACACA 3-10-3 cEt 79 457 481795 72439 72452
CTTTTTAAACACAC 2-10-2 cEt 0 458 481571 72528 72543 TGACAAGACACAATGG
3-10-3 cEt 12 459 481796 72529 72542 GACAAGACACAATG 2-10-2 cEt 36
460 481440 72586 72601 GTATTGCTGCAGGTCG 3-10-3 cEt 79 194 481665
72587 72600 TATTGCTGCAGGTC 2-10-2 cEt 43 195 481441 72594 72609
GGTCAATGGTATTGCT 3-10-3 cEt 55 196 481666 72595 72608
GTCAATGGTATTGC 2-10-2 cEt 36 197 481442 72602 72617
CATCGGCAGGTCAATG 3-10-3 cEt 44 198 481667 72603 72616
ATCGGCAGGTCAAT 2-10-2 cEt 31 199 481443 72622 72637
GAATCTAAAGTGCGGG 3-10-3 cEt 78 200 481668 72623 72636
AATCTAAAGTGCGG 2-10-2 cEt 41 201 481444 72630 72645
GCATCAATGAATCTAA 3-10-3 cEt 66 202 481669 72631 72644
CATCAATGAATCTA 2-10-2 cEt 0 203 481445 72638 72653 TCCAAACTGCATCAAT
3-10-3 cEt 70 204 481670 72639 72652 CCAAACTGCATCAA 2-10-2 cEt 60
205 481446 72659 72674 TTCAGCACCTTCACCA 3-10-3 cEt 44 206 481671
72660 72673 TCAGCACCTTCACC 2-10-2 cEt 41 207 481447 72675 72690
GCCCTCCTGCTGAGGG 3-10-3 cEt 10 208 481672 72676 72689
CCCTCCTGCTGAGG 2-10-2 cEt 15 209 481572 72682 72697
CCAAACTGCCCTCCTG 3-10-3 cEt 51 461 481797 72683 72696
CAAACTGCCCTCCT 2-10-2 cEt 11 211 481573 73535 73550
GGTCAGAAAAGCCAGA 3-10-3 cEt 55 462 481798 73536 73549
GTCAGAAAAGCCAG 2-10-2 cEt 59 463 481449 73690 73705
CCATGTCAAAGGTGAG 3-10-3 cEt 77 213 481674 73691 73704
CATGTCAAAGGTGA 2-10-2 cEt 31 214 481450 73717 73732
GGGAGGTAGCGCACTC 3-10-3 cEt 53 215 481675 73718 73731
GGAGGTAGCGCACT 2-10-2 cEt 41 216 481451 73779 73794
GAATGCAGGTAGGCGC 3-10-3 cEt 55 217 481676 73780 73793
AATGCAGGTAGGCG 2-10-2 cEt 39 218 481452 73818 73833
TTTCAGATGATCTGGG 3-10-3 cEt 71 219 481677 73819 73832
TTCAGATGATCTGG 2-10-2 cEt 38 220 481574 73837 73852
GGAACCACAAAGTTAG 3-10-3 cEt 69 221 481799 73838 73851
GAACCACAAAGTTA 2-10-2 cEt 50 222
481453 73868 73883 GATAGCAGAAGTAGGA 3-10-3 cEt 92 223 481678 73869
73882 ATAGCAGAAGTAGG 2-10-2 cEt 78 224 481454 73889 73904
AAAGTGCCCAGATTGC 3-10-3 cEt 85 225 481679 73890 73903
AAGTGCCCAGATTG 2-10-2 cEt 69 226 481455 73909 73924
CACTCATTTCTCTATT 3-10-3 cEt 74 227 481680 73910 73923
ACTCATTTCTCTAT 2-10-2 cEt 39 228 481456 73954 73969
AACACATCCTTATTTG 3-10-3 cEt 48 229 481681 73955 73968
ACACATCCTTATTT 2-10-2 cEt 47 230 481457 73966 73981
TGGGTCTCAGAGAACA 3-10-3 cEt 88 231 481682 73967 73980
GGGTCTCAGAGAAC 2-10-2 cEt 77 232 481458 74019 74034
CAAGACATTTCCTTTT 3-10-3 cEt 54 233 481683 74020 74033
AAGACATTTCCTTT 2-10-2 cEt 29 234 481459 74095 74110
GGAGGCACTTGTCTAA 3-10-3 cEt 76 235 481684 74096 74109
GAGGCACTTGTCTA 2-10-2 cEt 89 236 481460 74130 74145
TTACAGAAACAGGCAG 3-10-3 cEt 83 237 481685 74131 74144
TACAGAAACAGGCA 2-10-2 cEt 36 238 481461 74156 74171
AGCTATAGGTGGCCTG 3-10-3 cEt 75 239 481686 74157 74170 GCTATAGGTGGC
CT 2-10-2 cEt 70 240 481462 74171 74186 ATGCCAGGAGTATGTA 3-10-3 cEt
89 241 481687 74172 74185 TGCCAGGAGTATGT 2-10-2 cEt 80 242 481463
74188 74203 CAAGGTTAAAAAGTGC 3-10-3 cEt 88 243 481688 74189 74202
AAGGTTAAAAAGTG 2-10-2 cEt 13 244 481464 74203 74218
CTATTTGGATGTCAGC 3-10-3 cEt 97 245 481689 74204 74217
TATTTGGATGTCAG 2-10-2 cEt 40 246 481465 74219 74234
TAGATAGTCCTATCTT 3-10-3 cEt 51 247 481690 74220 74233
AGATAGTCCTATCT 2-10-2 cEt 64 248 481466 74234 74249
AAGAAACCTAGGGCTT 3-10-3 cEt 74 249 481691 74235 74248
AGAAACCTAGGGCT 2-10-2 cEt 77 250 481467 74284 74299
GCTGATACAGTGTTTT 3-10-3 cEt 74 251 481692 74285 74298
CTGATACAGTGTTT 2-10-2 cEt 74 252 481468 74299 74314
ATACAGAAAGGCTATG 3-10-3 cEt 71 253 481693 74300 74313
TACAGAAAGGCTAT 2-10-2 cEt 25 254 481469 74314 74329
GCTTAAGTTTCTTAAA 3-10-3 cEt 61 255 481694 74315 74328
CTTAAGTTTCTTAA 2-10-2 cEt 0 256 481470 74648 74663 AGCACCAAGGAGGCTG
3-10-3 cEt 49 257 481695 74649 74662 GCACCAAGGAGGCT 2-10-2 cEt 83
258 481471 74663 74678 AAGCTGAATGCTTAAA 3-10-3 cEt 36 259 481696
74664 74677 AGCTGAATGCTTAA 2-10-2 cEt 33 260 481472 74678 74693
TTACCAGCCTGAAGGA 3-10-3 cEt 76 261 481697 74679 74692
TACCAGCCTGAAGG 2-10-2 cEt 63 262 481473 74693 74708
CAGGGATTATATAAAT 3-10-3 cEt 53 263 481698 74694 74707
AGGGATTATATAAA 2-10-2 cEt 15 264 481474 74708 74723
ACCTGAAGCCCGTTTC 3-10-3 cEt 80 265 481699 74709 74722
CCTGAAGCCCGTTT 2-10-2 cEt 57 266 481475 74723 74738
TGTCTTAAGGGTTTGA 3-10-3 cEt 93 267 481700 74724 74737
GTCTTAAGGGTTTG 2-10-2 cEt 89 268 481476 74738 74753
GGTTGCAGCTTCAGAT 3-10-3 cEt 92 269 481701 74739 74752
GTTGCAGCTTCAGA 2-10-2 cEt 60 270 481477 74754 74769
TCAACACCAAAGGCCA 3-10-3 cEt 95 271 481702 74755 74768
CAACACCAAAGGCC 2-10-2 cEt 89 272 481478 74772 74787
TCCTTAAACCTTCCTA 3-10-3 cEt 84 273 481703 74773 74786
CCTTAAACCTTCCT 2-10-2 cEt 57 274 481479 74787 74802
AAAATGCTTAGATTCT 3-10-3 cEt 80 275 481704 74788 74801
AAATGCTTAGATTC 2-10-2 cEt 32 276 481480 74815 74830
AAATAAGTCTATTTAT 3-10-3 cEt 5 277 481705 74816 74829 AATAAGTCTATTTA
2-10-2 cEt 25 278 481481 74835 74850 GGCCAATACATTACAA 3-10-3 cEt 63
279 481706 74836 74849 GCCAATACATTACA 2-10-2 cEt 56 280 481482
74857 74872 TGCCCAGCCTTACTCA 3-10-3 cEt 55 281 481707 74858 74871
GCCCAGCCTTACTC 2-10-2 cEt 43 282 481483 74872 74887
GTTGTAAGCACCCTCT 3-10-3 cEt 1 283 481708 74873 74886 TTGTAAGCACCCTC
2-10-2 cEt 56 284 481484 74887 74902 AGAAAGGGAGTCAAGG 3-10-3 cEt 60
285 481709 74888 74901 GAAAGGGAGTCAAG 2-10-2 cEt 27 286 481485
74904 74919 GCAGATCAAGTCCAGG 3-10-3 cEt 90 287 481710 74905 74918
CAGATCAAGTCCAG 2-10-2 cEt 88 288 481486 74917 74932
AGCCTCTGAAACAGCA 3-10-3 cEt 75 289 481711 74918 74931
GCCTCTGAAACAGC 2-10-2 cEt 74 290 481487 74933 74948
CCCACAGAAACAACCT 3-10-3 cEt 66 291 481712 74934 74947
CCACAGAAACAACC 2-10-2 cEt 45 292 481488 74948 74963
AGCCCTGATAAGGCAC 3-10-3 cEt 23 293 481713 74949 74962
GCCCTGATAAGGCA 2-10-2 cEt 18 294 481489 74963 74978
AATCAGAAGTATCCCA 3-10-3 cEt 60 295 481714 74964 74977
ATCAGAAGTATCCC 2-10-2 cEt 43 296 481490 75020 75035
GCCTCTAGCAGGATCA 3-10-3 cEt 78 297 481715 75021 75034
CCTCTAGCAGGATC 2-10-2 cEt 79 298 481491 75035 75050
CACGCAAGGAGACATG 3-10-3 cEt 70 299 481716 75036 75049
ACGCAAGGAGACAT 2-10-2 cEt 68 300 481492 75050 75065
TGAGGGACCTTTAGAC 3-10-3 cEt 61 301 481717 75051 75064
GAGGGACCTTTAGA 2-10-2 cEt 44 302 481493 75073 75088
CAGGATTCCTAAAACA 3-10-3 cEt 43 303 481718 75074 75087
AGGATTCCTAAAAC 2-10-2 cEt 7 304 481494 75088 75103 ATGAGGTCCTGAGACC
3-10-3 cEt 60 305 481719 75089 75102 TGAGGTCCTGAGAC 2-10-2 cEt 29
306 481495 75127 75142 CATCATGTCCAACCTG 3-10-3 cEt 92 307 481720
75128 75141 ATCATGTCCAACCT 2-10-2 cEt 63 308 481496 75142 75157
GGGCCCCATAGTGTGC 3-10-3 cEt 29 309 481721 75143 75156
GGCCCCATAGTGTG 2-10-2 cEt 19 310 481497 75164 75179
AGCTCAACCAGACACG 3-10-3 cEt 67 311 481722 75165 75178
GCTCAACCAGACAC 2-10-2 cEt 69 312 481498 75179 75194
GAACCATATTCCCTGA 3-10-3 cEt 90 313 481723 75180 75193
AACCATATTCCCTG 2-10-2 cEt 49 314 481499 75194 75209
CAAGAAACTGGCTAAG 3-10-3 cEt 43 315 481724 75195 75208
AAGAAACTGGCTAA 2-10-2 cEt 17 316 481500 75209 75224
GCCACTGGATATCACC 3-10-3 cEt 92 317 481725 75210 75223
CCACTGGATATCAC 2-10-2 cEt 88 464 481501 75235 75250
AACTGAATGAAGACGC 3-10-3 cEt 91 318 481726 75236 75249
ACTGAATGAAGACG 2-10-2 cEt 56 319 481502 75250 75265
CCTTTGCCCTGCATGA 3-10-3 cEt 85 320 481727 75251 75264
CTTTGCCCTGCATG 2-10-2 cEt 70 321 481503 75265 75280
AAGTTTATCAGTAAGC 3-10-3 cEt 57 322 481728 75266 75279
AGTTTATCAGTAAG 2-10-2 cEt 22 323 481504 75280 75295
TACGAGGGCAGACTCA 3-10-3 cEt 60 324 481729 75281 75294
ACGAGGGCAGACTC 2-10-2 cEt 22 325 481505 75295 75310
AGGTATACACCCTCAT 3-10-3 cEt 45 326 481730 75296 75309
GGTATACACCCTCA 2-10-2 cEt 47 327 481506 75310 75325
CCTCAGAGGGAGGCCA 3-10-3 cEt 32 328 481731 75311 75324
CTCAGAGGGAGGCC 2-10-2 cEt 0 329 481507 75325 75340 GGGAGGAGTCACCAGC
3-10-3 cEt 64 330 481732 75326 75339 GGAGGAGTCACCAG 2-10-2 cEt 59
331 481508 75392 75407 TAGCCAGCCAAGGCGG 3-10-3 cEt 33 332 481733
75393 75406 AGCCAGCCAAGGCG 2-10-2 cEt 50 333 481509 75407 75422
ACAGGAGAGGCGAGCT 3-10-3 cEt 46 334 481734 75408 75421
CAGGAGAGGCGAGC 2-10-2 cEt 28 335 481510 75424 75439
TAGGTGTTCCCATACG 3-10-3 cEt 95 336 481735 75425 75438
AGGTGTTCCCATAC 2-10-2 cEt 22 337 481511 75445 75460
GGCAGCCCATCCAGCA 3-10-3 cEt 43 338 481736 75446 75459
GCAGCCCATCCAGC 2-10-2 cEt 54 339 481512 75462 75477
CATGCCTCTGAGTCAG 3-10-3 cEt 30 340 481737 75463 75476
ATGCCTCTGAGTCA 2-10-2 cEt 31 341 481513 75477 75492
GTTGCCAAATCCGGCC 3-10-3 cEt 85 342 481738 75478 75491
TTGCCAAATCCGGC 2-10-2 cEt 70 343 481514 75492 75507
GCAAGGTGGTTTTGAG 3-10-3 cEt 85 344 481739 75493 75506
CAAGGTGGTTTTGA 2-10-2 cEt 60 345 481515 75512 75527
AGAAACTCTGATCAGC 3-10-3 cEt 88 346
481740 75513 75526 GAAACTCTGATCAG 2-10-2 cEt 71 347 481516 75551
75566 CAGAGACCAGCTAATT 3-10-3 cEt 78 348 481741 75552 75565
AGAGACCAGCTAAT 2-10-2 cEt 80 349 481517 75581 75596
ATCTTAGAGAAGGTCG 3-10-3 cEt 87 350 481742 75582 75595
TCTTAGAGAAGGTC 2-10-2 cEt 64 351 481518 75612 75627
CCAGGCAGGAGGACTG 3-10-3 cEt 67 352 481743 75613 75626
CAGGCAGGAGGACT 2-10-2 cEt 75 353 481519 75624 75639
CATCAACTGTCTCCAG 3-10-3 cEt 29 354 481744 75625 75638
ATCAACTGTCTCCA 2-10-2 cEt 69 355 481520 75626 75641
CACATCAACTGTCTCC 3-10-3 cEt 73 356 481745 75627 75640
ACATCAACTGTCTC 2-10-2 cEt 74 357 481521 75646 75661
GAAGTAAGAGCTCTGC 3-10-3 cEt 86 358 481746 75647 75660
AAGTAAGAGCTCTG 2-10-2 cEt 67 359 481522 75661 75676
AAGAGTGTTGCTGGAG 3-10-3 cEt 92 360 481747 75662 75675
AGAGTGTTGCTGGA 2-10-2 cEt 95 361 481523 75676 75691
GCTTATTATGTACTGA 3-10-3 cEt 95 362 481748 75677 75690
CTTATTATGTACTG 2-10-2 cEt 15 363 481524 75717 75732
GCCCAAGTCTCACCTT 3-10-3 cEt 70 364 481749 75718 75731
CCCAAGTCTCACCT 2-10-2 cEt 70 365 481525 75728 75743
CCCAATGGTAAGCCCA 3-10-3 cEt 93 366 481750 75729 75742
CCAATGGTAAGCCC 2-10-2 cEt 94 367 481526 75730 75745
AACCCAATGGTAAGCC 3-10-3 cEt 82 368 481751 75731 75744
ACCCAATGGTAAGC 2-10-2 cEt 54 369 481527 75747 75762
TAGGTCCCTATGATTT 3-10-3 cEt 55 370 481752 75748 75761
AGGTCCCTATGATT 2-10-2 cEt 62 371 481528 75766 75781
AAGCCCTGAACCCTCG 3-10-3 cEt 77 372 481753 75767 75780
AGCCCTGAACCCTC 2-10-2 cEt 71 373 481529 75802 75817
CCTAAGGCCATGAACT 3-10-3 cEt 64 374 481754 75803 75816
CTAAGGCCATGAAC 2-10-2 cEt 53 375 481530 75817 75832
ACCAGATACATGCTAC 3-10-3 cEt 87 376 481755 75818 75831
CCAGATACATGCTA 2-10-2 cEt 84 377 481531 75833 75848
TACAATCAGAGTTAAG 3-10-3 cEt 66 378 481756 75834 75847
ACAATCAGAGTTAA 2-10-2 cEt 5 379 481532 75851 75866 TCCTCTCAGAACTTTT
3-10-3 cEt 65 380 481757 75852 75865 CCTCTCAGAACTTT 2-10-2 cEt 81
381 481533 75853 75868 GCTCCTCTCAGAACTT 3-10-3 cEt 80 382 481758
75854 75867 CTCCTCTCAGAACT 2-10-2 cEt 62 383 481534 75880 75895
TTCTTTAATGGGCCAC 3-10-3 cEt 79 384 481759 75881 75894
TCTTTAATGGGCCA 2-10-2 cEt 74 385 481535 75954 75969
ACGGGATTCCCTCGGC 3-10-3 cEt 78 386 481760 75955 75968
CGGGATTCCCTCGG 2-10-2 cEt 78 387 481536 75969 75984
GTAGGTAAGCAACCCA 3-10-3 cEt 91 388 481761 75970 75983
TAGGTAAGCAACCC 2-10-2 cEt 78 389 481537 76017 76032
GAATTTGAATGCAGTG 3-10-3 cEt 84 390 481762 76018 76031
AATTTGAATGCAGT 2-10-2 cEt 2 391 481538 76031 76046 TGAAGTACACATTGGA
3-10-3 cEt 92 392 481763 76032 76045 GAAGTACACATTGG 2-10-2 cEt 96
393 481539 76047 76062 ATAAATTTTTACACTA 3-10-3 cEt 19 394 481764
76048 76061 TAAATTTTTACACT 2-10-2 cEt 1 395 481765 76056 76069
CAATAATATAAATT 2-10-2 cEt 0 396 481541 76121 76136 CTGGAAGTTAAAGTAG
3-10-3 cEt 71 397 481766 76122 76135 TGGAAGTTAAAGTA 2-10-2 cEt 10
398
Example 2: Antisense Inhibition of Murine STAT3 in b.END Cells
[0445] Antisense oligonucleotides tested in the study described in
Example 1 were also tested for their effects on STAT3 mRNA in b.END
cells. Cultured b.END cells at a density of 20,000 cells per well
were transfected using electroporation with 7,000 nM antisense
oligonucleotide. After a treatment period of approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Murine primer probe set
RTS2381 (forward sequence GCCACGTTGGTGTTTCATAATCT, designated
herein as SEQ ID NO: 465; reverse sequence
GATAGAGGACATTGGACTCTTGCA, designated herein as SEQ ID NO: 466;
probe sequence TTGGGTGAAATTGACCAGCAATATAGCCG, designated herein as
SEQ ID NO: 467) was used to measure RNA. STAT3 mRNA levels were
adjusted according to total RNA content, as measured by
RIBOGREEN.RTM..
[0446] Certain sequences complementary to the STAT3 mouse gene
sequence showed good inhibition in b. END cells. Results are
presented in Table 3 as percent inhibition of STAT3, relative to
untreated control cells. The human oligonucleotides in Table 3 were
compared to the mouse STAT-3 genomic sequence, designated herein as
SEQ ID NO: 3 (the complement of GENBANK Accession No. NT_165773.2
truncated from nucleotides 12286001 to Ser. No. 12/344,000). "Mouse
Target start site" indicates the 5'-most nucleotide to which the
gapmer is targeted in the murine sequence. "Mouse Target stop site"
indicates the 3'-most nucleotide to which the gapmer is targeted
murine sequence.
TABLE-US-00003 TABLE 3 Inhibition of human STAT3 mRNA levels by
certain cEt chimeric antisense oligonucleotides complementary to
SEQ ID NO: 1 and SEQ ID NO: 3 Mouse Mouse Start Stop % SEQ ID ISIS
NO Site Site inhibition NO 481549 5283 5298 96 413 481553 9913 9928
94 421 481768 3189 3202 91 402 481356 30356 30371 83 21 481548 4045
4060 82 411 481554 14662 14677 82 423 481426 48328 48343 82 165
481580 30333 30346 81 20 481412 47413 47428 81 135 481417 47636
47651 81 147 481418 47637 47652 80 148 481355 30332 30347 79 19
481396 43120 43135 79 443 481416 47634 47649 79 144 481420 47681
47696 79 153 481358 32842 32857 78 25 481363 33520 33535 78 35
481570 51870 51885 78 457 481382 37857 37872 77 74 481378 36560
36575 76 66 481431 48403 48418 76 175 481453 53034 53049 76 223
481621 43121 43134 75 444 481641 47635 47648 75 145 481637 47414
47427 74 136 481380 36631 36646 73 70 481574 53000 53015 73 221
481601 36392 36405 71 62 481419 47638 47653 71 150 481371 35938
35953 70 51 481642 47637 47650 70 149 481542 3180 3195 69 399
481547 3313 3328 69 409 481772 3314 3327 69 410 481362 32929 32944
69 33 481653 48362 48375 69 170 481786 38812 38825 68 440 481415
47629 47644 68 141 481543 3188 3203 67 401 481793 51714 51727 67
454 481443 52060 52075 67 200 481684 53229 53242 67 236 481398
45226 45241 66 106 481560 36394 36409 65 438 481643 47638 47651 65
151 481430 48387 48402 65 173 481440 52024 52039 65 194
Example 3: Tolerability of Antisense Oligonucleotides Targeting
STAT3 in BALB/c Mice
[0447] Forty antisense oligonucleotides exhibiting a high level of
potency, selected from among the 452 compounds evaluated in Example
1, were further tested for in vivo tolerability.
[0448] Groups of 2-4 male BALB/c mice were injected subcutaneously
twice a week for 3 weeks with 25 mg/kg of ISIS antisense
oligonucleotides. One group of 4 male BALB/c mice was injected
subcutaneously twice a week for 3 weeks with PBS. This group of
mice was utilized as a control group to which the treatment groups
were compared. One day after the last dose, body weights were
taken, mice were euthanized, and organs and plasma were harvested
for further analysis.
[0449] The body weights of the mice were measured pre-dose and at
the end of the treatment period. Percent increase over the initial
body weight was calculated. Liver, spleen, and kidney weights were
measured at the end of the study and were compared to PBS treated
mice.
[0450] To evaluate the effect of ISIS oligonucleotides on metabolic
function, plasma concentrations of transaminases and BUN were
measured using an automated clinical chemistry analyzer (Hitachi
Olympus AU400e, Melville, N.Y.). Plasma concentrations of ALT
(alanine transaminase), AST (aspartate transaminase), and BUN were
measured.
[0451] Among the forty antisense oligonucleotides tested, certain
antisense oligonucleotides, including ISIS 481374, ISIS 481390,
ISIS 481420, ISIS 481431, ISIS 481453, ISIS 481464, ISIS 481475,
ISIS 481495, ISIS 481500, ISIS 481501, ISIS 481525, ISIS 481548,
ISIS 481549, ISIS 481597, ISIS 481695, ISIS 481700, ISIS 481702,
ISIS 481710, ISIS 481725, ISIS 481750, and ISIS 481763 met
tolerability thresholds for body weight, organ weight, ALT, AST,
and BUN parameters.
Example 4: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0452] Gapmers from Examples 1 and 2 exhibiting significant in
vitro inhibition of STAT3 were tested at various doses in HuVEC
cells. Cells were plated at a density of 20,000 cells per well and
transfected using electroporation with 31.25 nM, 62.5 nM, 125 nM,
250 nM, 500 nM, and 1,0000 nM concentrations of antisense
oligonucleotide, as specified in Table 4. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199 (forward sequence
ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6;
reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as
SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA,
designated herein as SEQ ID NO: 8) was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0453] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 4 and was
calculated by plotting the concentrations of oligonucleotides used
versus the percent inhibition of STAT3 mRNA expression achieved at
each concentration and noting the concentration of oligonucleotide
at which 50% inhibition of STAT3 mRNA expression was achieved
compared to the control. As illustrated in Table 4, STAT3 mRNA
levels were significantly reduced in a dose-dependent manner in
antisense oligonucleotide treated cells.
TABLE-US-00004 TABLE 4 Dose-dependent antisense inhibition of human
STAT3 in HuVEC cells using electroporation 31.25 62.5 125.0 250.0
500.0 1000.0 IC.sub.50 ISIS No nM nM nM nM nM nM (.mu.M) 481355 19
15 36 61 75 89 0.18 481374 25 42 52 72 82 88 0.10 481390 17 37 44
60 73 86 0.15 481420 23 20 40 60 81 92 0.16 481453 21 37 52 69 79
88 0.12 481464 57 73 81 90 94 94 <0.03 481475 22 46 54 78 83 92
0.10 481500 25 37 42 75 83 90 0.12 481501 32 57 69 82 94 94 0.05
481523 35 60 74 85 90 93 0.04 481525 36 53 60 79 89 92 0.06 481549
0 16 60 81 90 96 0.15 481554 0 15 28 49 70 86 0.25 481597 8 18 39
48 64 83 0.24 481695 15 27 39 50 64 80 0.22 481700 0 17 44 58 80 88
0.20 481710 12 39 65 79 86 90 0.11 481715 11 26 32 44 53 69 0.36
481725 27 40 56 77 89 93 0.09 481750 7 24 46 63 83 89 0.16 481755
17 28 30 54 68 80 0.20 481768 7 21 27 44 67 85 0.26
Example 5: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in SK-BR-3 Cells
[0454] Gapmers from Example 4 were tested at various doses in
SK-BR-3 cells. Cells were plated at a density of 4,000 cells per
well. Cells were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 1
.mu.M. 2.5 .mu.M, and 10 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 5. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0455] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 5. As illustrated
in Table 5, most of the ISIS oligonucleotides were able to
penetrate the cell membrane and STAT3 mRNA levels were
significantly reduced in a dose-dependent manner in antisense
oligonucleotide treated cells.
TABLE-US-00005 TABLE 5 Dose-dependent antisense inhibition of human
STAT3 by free-uptake of ISIS oligonucleotide by SK-BR-3 cells 0.02
0.1 0.5 1 2.5 10 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M
.mu.M (.mu.M) 481374 10 18 18 16 8 25 15.9 481390 0 10 11 12 40 72
3.2 481453 14 13 27 45 58 79 1.3 481464 23 32 57 70 85 93 0.5
481475 0 0 35 49 72 88 1.0 481500 7 9 26 45 49 75 1.7 481501 0 0 4
5 53 65 2.7 481523 9 24 56 67 83 92 0.5 481525 0 17 13 15 32 68 4.4
481549 0 0 0 16 33 54 8.2 481597 1 0 11 14 22 44 10.6 481710 5 0 10
13 27 66 6.0 481725 29 45 47 39 39 63 2.6 481750 19 24 36 42 71 80
1.1 481763 30 38 51 63 81 89 0.6 481768 12 5 34 25 32 35 12.4
Example 6: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in U251-MG Cells
[0456] Gapmers from Example 5 were further tested at various doses
in U251-MG cells. Cells were plated at a density of 4,000 cells per
well. Cells were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 1
.mu.M. 2.5 .mu.M, and 10 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 6. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0457] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 6. As illustrated
in Table 6, most of the ISIS oligonucleotides were able to
penetrate the cell membrane and STAT3 mRNA levels were
significantly reduced in a dose-dependent manner in antisense
oligonucleotide treated cells.
TABLE-US-00006 TABLE 6 Dose-dependent antisense inhibition of STAT3
mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG cells
0.02 0.1 0.5 1 2.5 10 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481374 0 0 10 0 12 25 15.7 481390 0 4 10 8 16
31 13.9 481453 4 3 15 16 20 42 11.0 481464 13 11 41 42 54 79 1.3
481475 3 13 26 37 41 67 2.6 481500 2 12 14 12 25 38 11.7 481501 0 0
2 1 14 47 10.3 481523 22 27 39 45 63 83 1.1 481525 1 1 17 17 35 60
6.3 481549 0 0 0 0 9 29 14.5 481597 3 3 12 18 18 47 10.1 481695 0
14 12 22 25 33 12.9 481710 0 0 0 0 6 23 16.8 481725 0 0 5 7 20 38
11.8 481750 4 15 18 18 17 33 13.2 481763 15 16 25 36 36 64 3.2
481768 22 16 18 22 21 37 12.2
Example 7: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in U251-MG Cells
[0458] ISIS 481464 and ISIS 481549, from the studies described
above, were further tested at different doses in U251-MG cells.
Cells were plated at a density of 4,000 cells per well. Cells were
incubated with 0.1 .mu.M, 1 .mu.M, 5 .mu.M, 10 .mu.M, and 20 .mu.M
concentrations of antisense oligonucleotide, as specified in Table
7. After approximately 24 hours, RNA was isolated from the cells
and STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0459] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 7. As illustrated
in Table 7, both the ISIS oligonucleotides were able to penetrate
the cell membrane.
TABLE-US-00007 TABLE 7 Dose-dependent antisense inhibition of STAT3
mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG cells
0.1 1 5 10 20 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M .mu.M
(.mu.M) 481464 0 30 69 80 79 2.3 481549 0 0 26 35 38 >20
Example 8: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in MDA-MB-231 Cells
[0460] ISIS 481464 and ISIS 481549 were further tested at different
doses in MDA-MB-231 cells. Cells were plated at a density of 4,000
cells per well. Cells were incubated with 0.02 .mu.M, 0.2 .mu.M,
1.0 .mu.M, 5.0 .mu.M, and 10.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 8. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0461] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 8. As illustrated
in Table 8, both the ISIS oligonucleotides were able to penetrate
the cell membrane and significantly reduce STAT3 mRNA levels in a
dose-dependent manner.
TABLE-US-00008 TABLE 8 Dose-dependent antisense inhibition of STAT3
mRNA levels by free-uptake of ISIS oligonucleotide by MDA-MB-231
cells 0.02 0.2 1.0 5.0 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 0 25 71 85 87 0.6 481549 0 2 33 49 66
4.4
Example 9: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in A431 Cells
[0462] ISIS 481464 and ISIS 481549 were further tested at different
doses in A431 cells. Cells were plated at a density of 4,000 cells
per well. Cells were incubated with 0.02 .mu.M, 0.2 .mu.M, 1.0
.mu.M, 5.0 .mu.M, and 10.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 9. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0463] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 9. As illustrated
in Table 9, both the ISIS oligonucleotides were able to penetrate
the cell membrane and significantly reduce STAT3 mRNA levels in a
dose-dependent manner.
TABLE-US-00009 TABLE 9 Dose-dependent antisense inhibition of STAT3
mRNA levels by free-uptake of ISIS oligonucleotide by A431 cells
0.02 0.2 1.0 5.0 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M
.mu.M (.mu.M) 481464 79 93 98 98 98 <0.02 481549 0 38 68 82 84
0.6
Example 10: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in H460 Cells
[0464] ISIS 481464 and ISIS 481549 were further tested at different
doses in H460 cells. Cells were plated at a density of 4,000 cells
per well. Cells were incubated with 0.02 .mu.M, 0.2 .mu.M, 1.0
.mu.M, 5.0 .mu.M, and 10.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 10. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0465] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 10. As illustrated
in Table 10, both the ISIS oligonucleotides were able to penetrate
the cell membrane and significantly reduce STAT3 mRNA levels in a
dose-dependent manner.
TABLE-US-00010 TABLE 10 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H460
cells 0.02 0.2 1.0 5.0 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 46 89 96 97 98 0.01 481549 8 53 78 96 98
0.23
Example 11: Antisense Inhibition of Human STAT3 in HuVEC Cells
[0466] Antisense oligonucleotides were designed targeting a human
STAT3 nucleic acid and were tested for their effect on human STAT3
mRNA expression in vitro. Cultured HuVEC cells at a density of
20,000 cells per well were transfected using electroporation with
1,000 nM antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and STAT3
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS199 (forward sequence ACATGCCACTTTGGTGTTTCATAA,
designated herein as SEQ ID NO: 6; reverse sequence
TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as SEQ ID NO: 7;
probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA, designated herein as
SEQ ID NO: 8) was used to measure mRNA levels. STAT3 mRNA levels
were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
STAT3, relative to untreated control cells.
[0467] The chimeric antisense oligonucleotides in Table 11 were
designed as 3-10-3 MOE, deoxy, and cEt gapmers. The gapmers are 16
nucleotides in length, wherein the central gap segment comprises of
ten 2'-deoxynucleosides and is flanked on both sides (in the 5' and
3' directions) by wings comprising three nucleosides each. Each
nucleoside in the 5'-wing segment has a 2'-MOE sugar modification.
Each nucleoside in the 3'-wing segment has a cEt sugar
modification. The internucleoside linkages throughout each gapmer
are phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5'-methylcytosines. The chemistry column
of Table 11 presents the sugar motif of each gapmer, wherein `e`
indicates a 2'-MOE nucleoside, `k(` indicates a constrained ethyl
(cEt) nucleoside, and indicates a 2'-deoxynucleoside.
[0468] "Human Target start site" indicates the 5'-most nucleoside
to which the gapmer is targeted in the human gene sequence. "Human
Target stop site" indicates the 3'-most nucleoside to which the
gapmer is targeted in the human gene sequence. Each gapmer listed
in Table 11 is targeted to human STAT3 mRNA, designated herein as
SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2).
TABLE-US-00011 TABLE 11 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human
Human Start Stop ISIS % SEQ Site Site No Sequence Chemistry
inhibition ID NO 1 16 528170 CGCAGCTCCGGAAACC
e-e-e-d.sub.(10)-k-k-k 12 471 2 17 528171 CCGCAGCTCCGGAAAC
e-e-e-d.sub.(10)-k-k-k 11 472 4 19 528172 CGCCGCAGCTCCGGAA
e-e-e-d.sub.(10)-k-k-k 10 473 5 20 528173 CCGCCGCAGCTCCGGA
e-e-e-d.sub.(10)-k-k-k 22 474 32 47 528174 ACCCCCGGCTCCCCCT
e-e-e-d.sub.(10)-k-k-k 18 475 34 49 528175 GAACCCCCGGCTCCCC
e-e-e-d.sub.(10)-k-k-k 17 476 35 50 528176 GGAACCCCCGGCTCCC
e-e-e-d.sub.(10)-k-k-k 23 477 36 51 528177 CGGAACCCCCGGCTCC
e-e-e-d.sub.(10)-k-k-k 15 478 38 53 528178 GTCGGAACCCCCGGCT
e-e-e-d.sub.(10)-k-k-k 21 479 39 54 528179 CGTCGGAACCCCCGGC
e-e-e-d.sub.(10)-k-k-k 19 480 57 72 528180 TTGTTCCCTCGGCTGC
e-e-e-d.sub.(10)-k-k-k 40 481 58 73 528181 CTTGTTCCCTCGGCTG
e-e-e-d.sub.(10)-k-k-k 28 482 60 75 528182 GGCTTGTTCCCTCGGC
e-e-e-d.sub.(10)-k-k-k 25 483 61 76 528183 GGGCTTGTTCCCTCGG
e-e-e-d.sub.(10)-k-k-k 34 484 75 90 528184 CCAGGATCCGGTTGGG
e-e-e-d.sub.(10)-k-k-k 34 485 76 91 528185 TCCAGGATCCGGTTGG
e-e-e-d.sub.(10)-k-k-k 15 9 77 92 528186 GTCCAGGATCCGGTTG
e-e-e-d.sub.(10)-k-k-k 28 486 78 93 528187 TGTCCAGGATCCGGTT
e-e-e-d.sub.(10)-k-k-k 27 487 79 94 528188 CTGTCCAGGATCCGGT
e-e-e-d.sub.(10)-k-k-k 33 488 81 96 528189 GCCTGTCCAGGATCCG
e-e-e-d.sub.(10)-k-k-k 63 489 83 98 528190 GTGCCTGTCCAGGATC
e-e-e-d.sub.(10)-k-k-k 36 490 189 204 528191 AGAGGCCGAGAGGCCG
e-e-e-d.sub.(10)-k-k-k 2 491 210 225 528192 GGTCCCAACTGTTTCT
e-e-e-d.sub.(10)-k-k-k 11 492 232 247 528193 GGGCCATCCTGCTAAA
e-e-e-d.sub.(10)-k-k-k 14 493 233 248 528194 TGGGCCATCCTGCTAA
e-e-e-d.sub.(10)-k-k-k 16 494 234 249 528195 TTGGGCCATCCTGCTA
e-e-e-d.sub.(10)-k-k-k 9 495 236 251 528196 CATTGGGCCATCCTGC
e-e-e-d.sub.(10)-k-k-k 39 496 237 252 528197 CCATTGGGCCATCCTG
e-e-e-d.sub.(10)-k-k-k 38 497 239 254 528198 TTCCATTGGGCCATCC
e-e-e-d.sub.(10)-k-k-k 19 498 240 255 528199 ATTCCATTGGGCCATC
e-e-e-d.sub.(10)-k-k-k 27 15 244 259 528200 GCTGATTCCATTGGGC
e-e-e-d.sub.(10)-k-k-k 18 500 245 260 528201 AGCTGATTCCATTGGG
e-e-e-d.sub.(10)-k-k-k 20 501 246 261 528202 TAGCTGATTCCATTGG
e-e-e-d.sub.(10)-k-k-k 41 502 247 262 528203 GTAGCTGATTCCATTG
e-e-e-d.sub.(10)-k-k-k 37 503 250 265 528204 GCTGTAGCTGATTCCA
e-e-e-d.sub.(10)-k-k-k 83 504 251 266 528205 TGCTGTAGCTGATTCC
e-e-e-d.sub.(10)-k-k-k 72 505 252 267 528206 CTGCTGTAGCTGATTC
e-e-e-d.sub.(10)-k-k-k 44 506 253 268 528207 GCTGCTGTAGCTGATT
e-e-e-d.sub.(10)-k-k-k 49 507 263 278 528208 CGTGTGTCAAGCTGCT
e-e-e-d.sub.(10)-k-k-k 73 508 264 279 528209 CCGTGTGTCAAGCTGC
e-e-e-d.sub.(10)-k-k-k 81 17 265 280 528210 ACCGTGTGTCAAGCTG
e-e-e-d.sub.(10)-k-k-k 78 509 266 281 528211 TACCGTGTGTCAAGCT
e-e-e-d.sub.(10)-k-k-k 72 510 267 282 528212 GTACCGTGTGTCAAGC
e-e-e-d.sub.(10)-k-k-k 81 511 268 283 528213 GGTACCGTGTGTCAAG
e-e-e-d.sub.(10)-k-k-k 46 512 270 285 528214 CAGGTACCGTGTGTCA
e-e-e-d.sub.(10)-k-k-k 80 513 271 286 528215 CCAGGTACCGTGTGTC
e-e-e-d.sub.(10)-k-k-k 69 514 272 287 528216 TCCAGGTACCGTGTGT
e-e-e-d.sub.(10)-k-k-k 41 515 273 288 528217 CTCCAGGTACCGTGTG
e-e-e-d.sub.(10)-k-k-k 44 516 274 289 528218 GCTCCAGGTACCGTGT
e-e-e-d.sub.(10)-k-k-k 32 517 275 290 528219 TGCTCCAGGTACCGTG
e-e-e-d.sub.(10)-k-k-k 50 518 291 306 528220 GTAGAGCTGATGGAGC
e-e-e-d.sub.(10)-k-k-k 12 519 292 307 528221 TGTAGAGCTGATGGAG
e-e-e-d.sub.(10)-k-k-k 0 520 295 310 528222 CACTGTAGAGCTGATG
e-e-e-d.sub.(10)-k-k-k 0 521 297 312 528223 GTCACTGTAGAGCTGA
e-e-e-d.sub.(10)-k-k-k 44 522 302 317 528224 AAGCTGTCACTGTAGA
e-e-e-d.sub.(10)-k-k-k 20 523 303 318 528225 GAAGCTGTCACTGTAG
e-e-e-d.sub.(10)-k-k-k 24 524 307 322 528226 TTGGGAAGCTGTCACT
e-e-e-d.sub.(10)-k-k-k 35 525 308 323 528227 ATTGGGAAGCTGTCAC
e-e-e-d.sub.(10)-k-k-k 29 526 310 325 528228 CCATTGGGAAGCTGTC
e-e-e-d.sub.(10)-k-k-k 33 527 322 337 519639 ACTGCCGCAGCTCCAT
e-e-e-d.sub.(10)-k-k-k 37 19 329 344 528229 GCCAGAAACTGCCGCA
e-e-e-d.sub.(10)-k-k-k 20 528 330 345 528230 GGCCAGAAACTGCCGC
e-e-e-d.sub.(10)-k-k-k 1 529 331 346 528231 GGGCCAGAAACTGCCG
e-e-e-d.sub.(10)-k-k-k 1 530 345 360 528232 ACTCTCAATCCAAGGG
e-e-e-d.sub.(10)-k-k-k 14 531 346 361 528233 GACTCTCAATCCAAGG
e-e-e-d.sub.(10)-k-k-k 10 21 347 362 528234 TGACTCTCAATCCAAG
e-e-e-d.sub.(10)-k-k-k 6 532 351 366 528235 ATCTTGACTCTCAATC
e-e-e-d.sub.(10)-k-k-k 38 533 353 368 528236 CAATCTTGACTCTCAA
e-e-e-d.sub.(10)-k-k-k 29 534 354 369 528237 CCAATCTTGACTCTCA
e-e-e-d.sub.(10)-k-k-k 60 535 355 370 528238 CCCAATCTTGACTCTC
e-e-e-d.sub.(10)-k-k-k 37 536 356 371 528239 GCCCAATCTTGACTCT
e-e-e-d.sub.(10)-k-k-k 48 537 357 372 528240 TGCCCAATCTTGACTC
e-e-e-d.sub.(10)-k-k-k 40 538 358 373 528241 ATGCCCAATCTTGACT
e-e-e-d.sub.(10)-k-k-k 21 539 359 374 528242 TATGCCCAATCTTGAC
e-e-e-d.sub.(10)-k-k-k 27 540 362 377 528243 GCATATGCCCAATCTT
e-e-e-d.sub.(10)-k-k-k 16 541 363 378 528244 CGCATATGCCCAATCT
e-e-e-d.sub.(10)-k-k-k 50 542 367 382 528245 TGGCCGCATATGCCCA
e-e-e-d.sub.(10)-k-k-k 67 543 368 383 528246 CTGGCCGCATATGCCC
e-e-e-d.sub.(10)-k-k-k 47 544 369 384 528247 GCTGGCCGCATATGCC
e-e-e-d.sub.(10)-k-k-k 54 545 370 385 528248 TGCTGGCCGCATATGC
e-e-e-d.sub.(10)-k-k-k 35 546 371 386 528249 TTGCTGGCCGCATATG
e-e-e-d.sub.(10)-k-k-k 22 547 372 387 528250 TTTGCTGGCCGCATAT
e-e-e-d.sub.(10)-k-k-k 19 548 373 388 528251 CTTTGCTGGCCGCATA
e-e-e-d.sub.(10)-k-k-k 27 549 374 389 528252 TCTTTGCTGGCCGCAT
e-e-e-d.sub.(10)-k-k-k 34 550 375 390 528253 TTCTTTGCTGGCCGCA
e-e-e-d.sub.(10)-k-k-k 59 23 376 391 528254 ATTCTTTGCTGGCCGC
e-e-e-d.sub.(10)-k-k-k 63 551 378 393 528255 TGATTCTTTGCTGGCC
e-e-e-d.sub.(10)-k-k-k 30 552 379 394 528256 GTGATTCTTTGCTGGC
e-e-e-d.sub.(10)-k-k-k 47 553 383 398 528257 GCATGTGATTCTTTGC
e-e-e-d.sub.(10)-k-k-k 43 554 384 399 528258 GGCATGTGATTCTTTG
e-e-e-d.sub.(10)-k-k-k 47 555 388 403 528259 AAGTGGCATGTGATTC
e-e-e-d.sub.(10)-k-k-k 43 556 391 406 528260 CCAAAGTGGCATGTGA
e-e-e-d.sub.(10)-k-k-k 46 557 393 408 528261 CACCAAAGTGGCATGT
e-e-e-d.sub.(10)-k-k-k 32 558 395 410 528262 AACACCAAAGTGGCAT
e-e-e-d.sub.(10)-k-k-k 41 559 397 412 528263 GAAACACCAAAGTGGC
e-e-e-d.sub.(10)-k-k-k 69 560 427 442 528264 ACTGCTGGTCAATCTC
e-e-e-d.sub.(10)-k-k-k 27 561 428 443 528265 TACTGCTGGTCAATCT
e-e-e-d.sub.(10)-k-k-k 32 562 430 445 528266 TATACTGCTGGTCAAT
e-e-e-d.sub.(10)-k-k-k 27 563 431 446 528267 CTATACTGCTGGTCAA
e-e-e-d.sub.(10)-k-k-k 38 564 432 447 528268 GCTATACTGCTGGTCA
e-e-e-d.sub.(10)-k-k-k 58 565 433 448 528269 GGCTATACTGCTGGTC
e-e-e-d.sub.(10)-k-k-k 69 566 434 449 528270 CGGCTATACTGCTGGT
e-e-e-d.sub.(10)-k-k-k 73 567 435 450 528271 GCGGCTATACTGCTGG
e-e-e-d.sub.(10)-k-k-k 71 568 436 451 528272 AGCGGCTATACTGCTG
e-e-e-d.sub.(10)-k-k-k 54 569 437 452 528273 AAGCGGCTATACTGCT
e-e-e-d.sub.(10)-k-k-k 36 570 439 454 528274 GGAAGCGGCTATACTG
e-e-e-d.sub.(10)-k-k-k 27 571 440 455 528275 AGGAAGCGGCTATACT
e-e-e-d.sub.(10)-k-k-k 21 572 441 456 528276 CAGGAAGCGGCTATAC
e-e-e-d.sub.(10)-k-k-k 12 573 442 457 528277 GCAGGAAGCGGCTATA
e-e-e-d.sub.(10)-k-k-k 14 574 443 458 528278 TGCAGGAAGCGGCTAT
e-e-e-d.sub.(10)-k-k-k 21 575 444 459 528279 TTGCAGGAAGCGGCTA
e-e-e-d.sub.(10)-k-k-k 31 576 445 460 528280 CTTGCAGGAAGCGGCT
e-e-e-d.sub.(10)-k-k-k 44 577 463 478 528281 GATAGAGAACATTCGA
e-e-e-d.sub.(10)-k-k-k 25 578 464 479 528282 TGATAGAGAACATTCG
e-e-e-d.sub.(10)-k-k-k 39 579 469 484 528283 TGTGCTGATAGAGAAC
e-e-e-d.sub.(10)-k-k-k 41 580 471 486 528284 ATTGTGCTGATAGAGA
e-e-e-d.sub.(10)-k-k-k 38 581 472 487 528285 GATTGTGCTGATAGAG
e-e-e-d.sub.(10)-k-k-k 50 582 473 488 528286 AGATTGTGCTGATAGA
e-e-e-d.sub.(10)-k-k-k 49 583 475 490 528287 GTAGATTGTGCTGATA
e-e-e-d.sub.(10)-k-k-k 14 584 476 491 528288 CGTAGATTGTGCTGAT
e-e-e-d.sub.(10)-k-k-k 8 585 490 505 528289 ACTGCTTGATTCTTCG
e-e-e-d.sub.(10)-k-k-k 9 33
511 526 528290 CAAGATACCTGCTCTG e-e-e-d.sub.(10)-k-k-k 48 35 512
527 528291 TCAAGATACCTGCTCT e-e-e-d.sub.(10)-k-k-k 34 586 513 528
528292 CTCAAGATACCTGCTC e-e-e-d.sub.(10)-k-k-k 19 587 514 529
528293 TCTCAAGATACCTGCT e-e-e-d.sub.(10)-k-k-k 31 588 517 532
528294 GCTTCTCAAGATACCT e-e-e-d.sub.(10)-k-k-k 42 589 519 534
528295 TGGCTTCTCAAGATAC e-e-e-d.sub.(10)-k-k-k 37 590 522 537
528296 CATTGGCTTCTCAAGA e-e-e-d.sub.(10)-k-k-k 11 591 523 538
528297 CCATTGGCTTCTCAAG e-e-e-d.sub.(10)-k-k-k 23 592 530 545
528298 GCAATCTCCATTGGCT e-e-e-d.sub.(10)-k-k-k 46 593 531 546
528299 GGCAATCTCCATTGGC e-e-e-d.sub.(10)-k-k-k 37 594 532 547
528300 GGGCAATCTCCATTGG e-e-e-d.sub.(10)-k-k-k 24 595 533 548
528301 CGGGCAATCTCCATTG e-e-e-d.sub.(10)-k-k-k 15 596 534 549
528302 CCGGGCAATCTCCATT e-e-e-d.sub.(10)-k-k-k 30 597 535 550
528303 TCCGGGCAATCTCCAT e-e-e-d.sub.(10)-k-k-k 29 598 536 551
528304 ATCCGGGCAATCTCCA e-e-e-d.sub.(10)-k-k-k 32 599 537 552
528305 AATCCGGGCAATCTCC e-e-e-d.sub.(10)-k-k-k 32 600 538 553
528306 CAATCCGGGCAATCTC e-e-e-d.sub.(10)-k-k-k 24 601 539 554
528307 ACAATCCGGGCAATCT e-e-e-d.sub.(10)-k-k-k 21 602 540 555
528308 CACAATCCGGGCAATC e-e-e-d.sub.(10)-k-k-k 14 603 541 556
528309 CCACAATCCGGGCAAT e-e-e-d.sub.(10)-k-k-k 13 604 543 558
528310 GGCCACAATCCGGGCA e-e-e-d.sub.(10)-k-k-k 27 605 546 561
528311 CCGGGCCACAATCCGG e-e-e-d.sub.(10)-k-k-k 27 606 547 562
528312 ACCGGGCCACAATCCG e-e-e-d.sub.(10)-k-k-k 58 607 548 563
528313 CACCGGGCCACAATCC e-e-e-d.sub.(10)-k-k-k 25 608 549 564
528314 GCACCGGGCCACAATC e-e-e-d.sub.(10)-k-k-k 18 609 550 565
528315 GGCACCGGGCCACAAT e-e-e-d.sub.(10)-k-k-k 33 610 551 566
528316 AGGCACCGGGCCACAA e-e-e-d.sub.(10)-k-k-k 42 611 558 573
528317 TTCCCACAGGCACCGG e-e-e-d.sub.(10)-k-k-k 47 612 586 601
528318 TGGCTGCAGTCTGTAG e-e-e-d.sub.(10)-k-k-k 12 613 592 607
528319 CCGCAGTGGCTGCAGT e-e-e-d.sub.(10)-k-k-k 10 614 599 614
528320 TGCTGGGCCGCAGTGG e-e-e-d.sub.(10)-k-k-k 14 615 601 616
528321 CTTGCTGGGCCGCAGT e-e-e-d.sub.(10)-k-k-k 0 616 603 618 528322
CCCTTGCTGGGCCGCA e-e-e-d.sub.(10)-k-k-k 6 617 604 619 528323
CCCCTTGCTGGGCCGC e-e-e-d.sub.(10)-k-k-k 21 618 605 620 528324
CCCCCTTGCTGGGCCG e-e-e-d.sub.(10)-k-k-k 8 619 608 623 528325
TGGCCCCCTTGCTGGG e-e-e-d.sub.(10)-k-k-k 0 620 615 630 528326
GTTGGCCTGGCCCCCT e-e-e-d.sub.(10)-k-k-k 31 621 616 631 528327
GGTTGGCCTGGCCCCC e-e-e-d.sub.(10)-k-k-k 47 622 617 632 528328
TGGTTGGCCTGGCCCC e-e-e-d.sub.(10)-k-k-k 36 623 646 661 528329
GCTTCTCCGTCACCAC e-e-e-d.sub.(10)-k-k-k 28 624 647 662 528330
TGCTTCTCCGTCACCA e-e-e-d.sub.(10)-k-k-k 22 625 649 664 528331
GCTGCTTCTCCGTCAC e-e-e-d.sub.(10)-k-k-k 35 626 667 682 528332
GGTGCTGCTCCAGCAT e-e-e-d.sub.(10)-k-k-k 21 627 678 693 528333
GACATCCTGAAGGTGC e-e-e-d.sub.(10)-k-k-k 0 628 682 697 528334
TCCGGACATCCTGAAG e-e-e-d.sub.(10)-k-k-k 1 629 683 698 528335
TTCCGGACATCCTGAA e-e-e-d.sub.(10)-k-k-k 0 630 684 699 528336
CTTCCGGACATCCTGA e-e-e-d.sub.(10)-k-k-k 0 631 685 700 528337
TCTTCCGGACATCCTG e-e-e-d.sub.(10)-k-k-k 0 632 686 701 528338
CTCTTCCGGACATCCT e-e-e-d.sub.(10)-k-k-k 19 633 687 702 528339
TCTCTTCCGGACATCC e-e-e-d.sub.(10)-k-k-k 21 634 688 703 528340
CTCTCTTCCGGACATC e-e-e-d.sub.(10)-k-k-k 17 635 689 704 528341
ACTCTCTTCCGGACAT e-e-e-d.sub.(10)-k-k-k 37 636 727 742 528342
GATTCTCTACCACTTT e-e-e-d.sub.(10)-k-k-k 33 637 730 745 528343
GGAGATTCTCTACCAC e-e-e-d.sub.(10)-k-k-k 40 53 731 746 528344
TGGAGATTCTCTACCA e-e-e-d.sub.(10)-k-k-k 32 638 732 747 528345
CTGGAGATTCTCTACC e-e-e-d.sub.(10)-k-k-k 18 639 733 748 528346
CCTGGAGATTCTCTAC e-e-e-d.sub.(10)-k-k-k 12 640 738 753 528347
GTCATCCTGGAGATTC e-e-e-d.sub.(10)-k-k-k 54 641 764 779 528348
TTGAGGGTTTTATAGT e-e-e-d.sub.(10)-k-k-k 0 642 775 790 528349
CTCCTTGACTCTTGAG e-e-e-d.sub.(10)-k-k-k 21 643 781 796 528350
GCATGTCTCCTTGACT e-e-e-d.sub.(10)-k-k-k 29 644 782 797 528351
TGCATGTCTCCTTGAC e-e-e-d.sub.(10)-k-k-k 30 645 783 798 528352
TTGCATGTCTCCTTGA e-e-e-d.sub.(10)-k-k-k 17 646 787 802 528353
GATCTTGCATGTCTCC e-e-e-d.sub.(10)-k-k-k 61 647 788 803 518346
AGATCTTGCATGTCTC e-e-e-d.sub.(10)-k-k-k 36 57 790 805 528354
TCAGATCTTGCATGTC e-e-e-d.sub.(10)-k-k-k 43 648 792 807 528355
ATTCAGATCTTGCATG e-e-e-d.sub.(10)-k-k-k 9 649 794 809 528356
CCATTCAGATCTTGCA e-e-e-d.sub.(10)-k-k-k 37 650 795 810 528357
TCCATTCAGATCTTGC e-e-e-d.sub.(10)-k-k-k 55 651 796 811 528358
TTCCATTCAGATCTTG e-e-e-d.sub.(10)-k-k-k 17 652 803 818 528359
TGGTTGTTTCCATTCA e-e-e-d.sub.(10)-k-k-k 33 653 804 819 528360
CTGGTTGTTTCCATTC e-e-e-d.sub.(10)-k-k-k 18 654 806 821 528361
GACTGGTTGTTTCCAT e-e-e-d.sub.(10)-k-k-k 23 655 807 822 528362
TGACTGGTTGTTTCCA e-e-e-d.sub.(10)-k-k-k 33 656 813 828 528363
GGTCACTGACTGGTTG e-e-e-d.sub.(10)-k-k-k 43 657 814 829 528364
TGGTCACTGACTGGTT e-e-e-d.sub.(10)-k-k-k 62 658 848 863 528365
GTGAGCATCTGTTCCA e-e-e-d.sub.(10)-k-k-k 41 659 852 867 528366
CGCAGTGAGCATCTGT e-e-e-d.sub.(10)-k-k-k 0 660 853 868 528367
GCGCAGTGAGCATCTG e-e-e-d.sub.(10)-k-k-k 0 661 854 869 528368
AGCGCAGTGAGCATCT e-e-e-d.sub.(10)-k-k-k 7 662 855 870 528369
CAGCGCAGTGAGCATC e-e-e-d.sub.(10)-k-k-k 6 663 857 872 528370
TCCAGCGCAGTGAGCA e-e-e-d.sub.(10)-k-k-k 12 664 858 873 528371
GTCCAGCGCAGTGAGC e-e-e-d.sub.(10)-k-k-k 11 665 859 874 528372
GGTCCAGCGCAGTGAG e-e-e-d.sub.(10)-k-k-k 8 666 860 875 528373
TGGTCCAGCGCAGTGA e-e-e-d.sub.(10)-k-k-k 12 667 862 877 528374
TCTGGTCCAGCGCAGT e-e-e-d.sub.(10)-k-k-k 9 668 863 878 528375
ATCTGGTCCAGCGCAG e-e-e-d.sub.(10)-k-k-k 8 669 864 879 528376
CATCTGGTCCAGCGCA e-e-e-d.sub.(10)-k-k-k 0 670 865 880 528377
GCATCTGGTCCAGCGC e-e-e-d.sub.(10)-k-k-k 28 671 867 882 528378
CCGCATCTGGTCCAGC e-e-e-d.sub.(10)-k-k-k 72 672 868 883 528379
TCCGCATCTGGTCCAG e-e-e-d.sub.(10)-k-k-k 43 61 869 884 528380
CTCCGCATCTGGTCCA e-e-e-d.sub.(10)-k-k-k 34 673 870 885 528381
TCTCCGCATCTGGTCC e-e-e-d.sub.(10)-k-k-k 42 674 871 886 528382
TTCTCCGCATCTGGTC e-e-e-d.sub.(10)-k-k-k 37 675 872 887 528383
CTTCTCCGCATCTGGT e-e-e-d.sub.(10)-k-k-k 23 676 873 888 528384
GCTTCTCCGCATCTGG e-e-e-d.sub.(10)-k-k-k 36 677 875 890 528385
ATGCTTCTCCGCATCT e-e-e-d.sub.(10)-k-k-k 45 678 876 891 528386
GATGCTTCTCCGCATC e-e-e-d.sub.(10)-k-k-k 14 679 877 892 528387
CGATGCTTCTCCGCAT e-e-e-d.sub.(10)-k-k-k 25 680 878 893 528388
ACGATGCTTCTCCGCA e-e-e-d.sub.(10)-k-k-k 39 681 879 894 528389
CACGATGCTTCTCCGC e-e-e-d.sub.(10)-k-k-k 46 682 880 895 528390
TCACGATGCTTCTCCG e-e-e-d.sub.(10)-k-k-k 17 683 881 896 528391
CTCACGATGCTTCTCC e-e-e-d.sub.(10)-k-k-k 20 684 882 897 528392
ACTCACGATGCTTCTC e-e-e-d.sub.(10)-k-k-k 16 685 883 898 528393
CACTCACGATGCTTCT e-e-e-d.sub.(10)-k-k-k 39 686 885 900 528394
CTCACTCACGATGCTT e-e-e-d.sub.(10)-k-k-k 45 687 886 901 528395
GCTCACTCACGATGCT e-e-e-d.sub.(10)-k-k-k 37 688 888 903 528396
CAGCTCACTCACGATG e-e-e-d.sub.(10)-k-k-k 24 689 889 904 528397
CCAGCTCACTCACGAT e-e-e-d.sub.(10)-k-k-k 25 690 890 905 528398
GCCAGCTCACTCACGA e-e-e-d.sub.(10)-k-k-k 18 691 891 906 528399
CGCCAGCTCACTCACG e-e-e-d.sub.(10)-k-k-k 4 692 1068 1083 528477
AATTTGTTGACGGGTC e-e-e-d.sub.(10)-k-k-k 37 693 1069 1084 528478
TAATTTGTTGACGGGT e-e-e-d.sub.(10)-k-k-k 35 694 1070 1085 528479
TTAATTTGTTGACGGG e-e-e-d.sub.(10)-k-k-k 40 695 1072 1087 528480
TCTTAATTTGTTGACG e-e-e-d.sub.(10)-k-k-k 6 696 1087 1102 528481
GCAACTCCTCCAGTTT e-e-e-d.sub.(10)-k-k-k 42 697 1088 1103 528482
TGCAACTCCTCCAGTT e-e-e-d.sub.(10)-k-k-k 28 698 1094 1109 528483
TTTTGCTGCAACTCCT e-e-e-d.sub.(10)-k-k-k 49 699 1095 1110 528484
TTTTTGCTGCAACTCC e-e-e-d.sub.(10)-k-k-k 58 700 1114 1129 528485
GGTCCCCTTTGTAGGA e-e-e-d.sub.(10)-k-k-k 35 701 1115 1130 528486
GGGTCCCCTTTGTAGG e-e-e-d.sub.(10)-k-k-k 31 702 1129 1144 528487
GGTGCTGTACAATGGG e-e-e-d.sub.(10)-k-k-k 61 703 1130 1145 528488
CGGTGCTGTACAATGG e-e-e-d.sub.(10)-k-k-k 61 704 1131 1146 528489
CCGGTGCTGTACAATG e-e-e-d.sub.(10)-k-k-k 37 705 1132 1147 528490
GCCGGTGCTGTACAAT e-e-e-d.sub.(10)-k-k-k 33 706 1133 1148 528491
GGCCGGTGCTGTACAA e-e-e-d.sub.(10)-k-k-k 39 707
1134 1149 528492 CGGCCGGTGCTGTACA e-e-e-d.sub.(10)-k-k-k 38 708
1136 1151 528493 ATCGGCCGGTGCTGTA e-e-e-d.sub.(10)-k-k-k 29 709
1137 1152 528494 CATCGGCCGGTGCTGT e-e-e-d.sub.(10)-k-k-k 43 710
1138 1153 528495 GCATCGGCCGGTGCTG e-e-e-d.sub.(10)-k-k-k 41 711
1139 1154 528496 AGCATCGGCCGGTGCT e-e-e-d.sub.(10)-k-k-k 18 712
1140 1155 528497 CAGCATCGGCCGGTGC e-e-e-d.sub.(10)-k-k-k 15 713
1141 1156 528498 CCAGCATCGGCCGGTG e-e-e-d.sub.(10)-k-k-k 39 714
1142 1157 528499 TCCAGCATCGGCCGGT e-e-e-d.sub.(10)-k-k-k 50 715
1144 1159 528500 CCTCCAGCATCGGCCG e-e-e-d.sub.(10)-k-k-k 58 716
1146 1161 528501 CTCCTCCAGCATCGGC e-e-e-d.sub.(10)-k-k-k 67 717
1147 1162 528502 TCTCCTCCAGCATCGG e-e-e-d.sub.(10)-k-k-k 76 718
1153 1168 528503 CGATTCTCTCCTCCAG e-e-e-d.sub.(10)-k-k-k 68 719
1154 1169 528504 ACGATTCTCTCCTCCA e-e-e-d.sub.(10)-k-k-k 69 720
1155 1170 528505 CACGATTCTCTCCTCC e-e-e-d.sub.(10)-k-k-k 68 721
1156 1171 528506 CCACGATTCTCTCCTC e-e-e-d.sub.(10)-k-k-k 45 722
1157 1172 528507 TCCACGATTCTCTCCT e-e-e-d.sub.(10)-k-k-k 42 723
1158 1173 528508 CTCCACGATTCTCTCC e-e-e-d.sub.(10)-k-k-k 41 724
1159 1174 528509 GCTCCACGATTCTCTC e-e-e-d.sub.(10)-k-k-k 32 725
1160 1175 528510 AGCTCCACGATTCTCT e-e-e-d.sub.(10)-k-k-k 7 726 1161
1176 528511 CAGCTCCACGATTCTC e-e-e-d.sub.(10)-k-k-k 5 727 1162 1177
528512 ACAGCTCCACGATTCT e-e-e-d.sub.(10)-k-k-k 0 728 1163 1178
528513 AACAGCTCCACGATTC e-e-e-d.sub.(10)-k-k-k 8 729 1184 1199
528514 GCACTTTTCATTAAGT e-e-e-d.sub.(10)-k-k-k 14 730 1185 1200
528515 GGCACTTTTCATTAAG e-e-e-d.sub.(10)-k-k-k 15 731 1199 1214
528516 CGCTCCACCACAAAGG e-e-e-d.sub.(10)-k-k-k 46 732 1205 1220
528517 GGCTGCCGCTCCACCA e-e-e-d.sub.(10)-k-k-k 55 733 1206 1221
528518 GGGCTGCCGCTCCACC e-e-e-d.sub.(10)-k-k-k 80 734 1207 1222
528519 AGGGCTGCCGCTCCAC e-e-e-d.sub.(10)-k-k-k 61 735 1208 1223
528520 CAGGGCTGCCGCTCCA e-e-e-d.sub.(10)-k-k-k 63 736 1211 1226
528521 ATGCAGGGCTGCCGCT e-e-e-d.sub.(10)-k-k-k 37 737 1212 1227
528522 CATGCAGGGCTGCCGC e-e-e-d.sub.(10)-k-k-k 38 738 1221 1236
528523 ATGCATGGGCATGCAG e-e-e-d.sub.(10)-k-k-k 26 739 1222 1237
528524 GATGCATGGGCATGCA e-e-e-d.sub.(10)-k-k-k 42 740 1223 1238
528525 GGATGCATGGGCATGC e-e-e-d.sub.(10)-k-k-k 43 741 1252 1267
528526 CGCCGGTCTTGATGAC e-e-e-d.sub.(10)-k-k-k 11 742 1253 1268
528527 ACGCCGGTCTTGATGA e-e-e-d.sub.(10)-k-k-k 0 743 1265 1280
528528 GTAGTGAACTGGACGC e-e-e-d.sub.(10)-k-k-k 10 744 1284 1299
528529 GACCAGCAACCTGACT e-e-e-d.sub.(10)-k-k-k 22 745 1285 1300
528530 TGACCAGCAACCTGAC e-e-e-d.sub.(10)-k-k-k 31 746 1288 1303
528531 ATTTGACCAGCAACCT e-e-e-d.sub.(10)-k-k-k 48 747 1289 1304
528532 AATTTGACCAGCAACC e-e-e-d.sub.(10)-k-k-k 22 748 1290 1305
528533 GAATTTGACCAGCAAC e-e-e-d.sub.(10)-k-k-k 11 749 1293 1308
528534 AGGGAATTTGACCAGC e-e-e-d.sub.(10)-k-k-k 67 750 1294 1309
528535 CAGGGAATTTGACCAG e-e-e-d.sub.(10)-k-k-k 50 751 1295 1310
528536 TCAGGGAATTTGACCA e-e-e-d.sub.(10)-k-k-k 38 752 1296 1311
528537 CTCAGGGAATTTGACC e-e-e-d.sub.(10)-k-k-k 17 753 1336 1351
528539 CTTTGTCAATGCACAC e-e-e-d.sub.(10)-k-k-k 67 754 1338 1353
528540 GTCTTTGTCAATGCAC e-e-e-d.sub.(10)-k-k-k 61 755 1339 1354
528541 AGTCTTTGTCAATGCA e-e-e-d.sub.(10)-k-k-k 65 756 1343 1358
528542 CCAGAGTCTTTGTCAA e-e-e-d.sub.(10)-k-k-k 10 757 1345 1360
528543 CCCCAGAGTCTTTGTC e-e-e-d.sub.(10)-k-k-k 7 758 1371 1386
528544 CCGGGATCCTCTGAGA e-e-e-d.sub.(10)-k-k-k 12 759 1372 1387
528545 TCCGGGATCCTCTGAG e-e-e-d.sub.(10)-k-k-k 11 760 1373 1388
528546 TTCCGGGATCCTCTGA e-e-e-d.sub.(10)-k-k-k 7 761 1374 1389
528547 TTTCCGGGATCCTCTG e-e-e-d.sub.(10)-k-k-k 14 762 1375 1390
528548 ATTTCCGGGATCCTCT e-e-e-d.sub.(10)-k-k-k 14 763 1376 1391
528549 AATTTCCGGGATCCTC e-e-e-d.sub.(10)-k-k-k 19 764 1377 1392
528550 AAATTTCCGGGATCCT e-e-e-d.sub.(10)-k-k-k 14 765 1379 1394
528551 TTAAATTTCCGGGATC e-e-e-d.sub.(10)-k-k-k 1 766 1380 1395
528552 GTTAAATTTCCGGGAT e-e-e-d.sub.(10)-k-k-k 9 767 1381 1396
528553 TGTTAAATTTCCGGGA e-e-e-d.sub.(10)-k-k-k 0 768 1382 1397
528554 ATGTTAAATTTCCGGG e-e-e-d.sub.(10)-k-k-k 12 769 1384 1399
528555 GAATGTTAAATTTCCG e-e-e-d.sub.(10)-k-k-k 13 770 1392 1407
528556 TGTGCCCAGAATGTTA e-e-e-d.sub.(10)-k-k-k 18 771 1435 1450
528557 GGCTGCCGTTGTTGGA e-e-e-d.sub.(10)-k-k-k 48 772 1436 1451
528558 AGGCTGCCGTTGTTGG e-e-e-d.sub.(10)-k-k-k 38 773 1437 1452
528559 GAGGCTGCCGTTGTTG e-e-e-d.sub.(10)-k-k-k 24 98 1438 1453
528560 AGAGGCTGCCGTTGTT e-e-e-d.sub.(10)-k-k-k 27 774 1439 1454
528561 GAGAGGCTGCCGTTGT e-e-e-d.sub.(10)-k-k-k 10 775 1440 1455
528562 AGAGAGGCTGCCGTTG e-e-e-d.sub.(10)-k-k-k 17 776 1441 1456
528563 CAGAGAGGCTGCCGTT e-e-e-d.sub.(10)-k-k-k 27 777 1461 1476
528564 GGTCAAGTGTTTGAAT e-e-e-d.sub.(10)-k-k-k 7 778 1471 1486
528565 GCTCCCTCAGGGTCAA e-e-e-d.sub.(10)-k-k-k 48 779 1496 1511
528566 GCTCGGCCCCCATTCC e-e-e-d.sub.(10)-k-k-k 42 780 1497 1512
528567 GGCTCGGCCCCCATTC e-e-e-d.sub.(10)-k-k-k 45 781 1498 1513
528568 TGGCTCGGCCCCCATT e-e-e-d.sub.(10)-k-k-k 34 782 1499 1514
528569 TTGGCTCGGCCCCCAT e-e-e-d.sub.(10)-k-k-k 49 783 1517 1532
528570 ATCAGGGAAGCATCAC e-e-e-d.sub.(10)-k-k-k 22 104 1519 1534
528571 CAATCAGGGAAGCATC e-e-e-d.sub.(10)-k-k-k 13 784 1523 1538
528572 GTCACAATCAGGGAAG e-e-e-d.sub.(10)-k-k-k 30 785 1525 1540
528573 CAGTCACAATCAGGGA e-e-e-d.sub.(10)-k-k-k 27 786 1526 1541
528574 TCAGTCACAATCAGGG e-e-e-d.sub.(10)-k-k-k 51 787 1529 1544
528575 TCCTCAGTCACAATCA e-e-e-d.sub.(10)-k-k-k 14 788 1537 1552
528576 GGTGCAGCTCCTCAGT e-e-e-d.sub.(10)-k-k-k 28 789 1543 1558
528577 TGATCAGGTGCAGCTC e-e-e-d.sub.(10)-k-k-k 30 790 1544 1559
528578 GTGATCAGGTGCAGCT e-e-e-d.sub.(10)-k-k-k 36 791 1545 1560
528579 GGTGATCAGGTGCAGC e-e-e-d.sub.(10)-k-k-k 39 792 1576 1591
528580 TGAGGCCTTGGTGATA e-e-e-d.sub.(10)-k-k-k 10 793 1578 1593
528581 CTTGAGGCCTTGGTGA e-e-e-d.sub.(10)-k-k-k 5 794 1579 1594
528582 TCTTGAGGCCTTGGTG e-e-e-d.sub.(10)-k-k-k 15 110 1580 1595
528583 ATCTTGAGGCCTTGGT e-e-e-d.sub.(10)-k-k-k 5 795 1581 1596
528584 AATCTTGAGGCCTTGG e-e-e-d.sub.(10)-k-k-k 15 796 1582 1597
528585 CAATCTTGAGGCCTTG e-e-e-d.sub.(10)-k-k-k 7 797 1583 1598
528586 TCAATCTTGAGGCCTT e-e-e-d.sub.(10)-k-k-k 9 798 1584 1599
528587 GTCAATCTTGAGGCCT e-e-e-d.sub.(10)-k-k-k 25 799 1585 1600
528588 GGTCAATCTTGAGGCC e-e-e-d.sub.(10)-k-k-k 26 800 1586 1601
528589 AGGTCAATCTTGAGGC e-e-e-d.sub.(10)-k-k-k 31 801 1587 1602
528590 TAGGTCAATCTTGAGG e-e-e-d.sub.(10)-k-k-k 27 802 1588 1603
528591 CTAGGTCAATCTTGAG e-e-e-d.sub.(10)-k-k-k 24 803 1590 1605
528592 CTCTAGGTCAATCTTG e-e-e-d.sub.(10)-k-k-k 33 804 1592 1607
528593 GTCTCTAGGTCAATCT e-e-e-d.sub.(10)-k-k-k 30 805 1594 1609
528594 GGGTCTCTAGGTCAAT e-e-e-d.sub.(10)-k-k-k 25 806 1595 1610
528595 TGGGTCTCTAGGTCAA e-e-e-d.sub.(10)-k-k-k 28 807 1596 1611
528596 GTGGGTCTCTAGGTCA e-e-e-d.sub.(10)-k-k-k 34 808 1597 1612
528597 AGTGGGTCTCTAGGTC e-e-e-d.sub.(10)-k-k-k 19 809 1599 1614
528598 GGAGTGGGTCTCTAGG e-e-e-d.sub.(10)-k-k-k 31 114 1600 1615
528599 AGGAGTGGGTCTCTAG e-e-e-d.sub.(10)-k-k-k 10 810 1601 1616
528600 AAGGAGTGGGTCTCTA e-e-e-d.sub.(10)-k-k-k 14 811 1602 1617
528601 CAAGGAGTGGGTCTCT e-e-e-d.sub.(10)-k-k-k 11 812 1609 1624
528602 CAACTGGCAAGGAGTG e-e-e-d.sub.(10)-k-k-k 17 813 1629 1644
528603 ACAGATGTTGGAGATC e-e-e-d.sub.(10)-k-k-k 8 814 1632 1647
528604 CTGACAGATGTTGGAG e-e-e-d.sub.(10)-k-k-k 11 815 1633 1648
528605 TCTGACAGATGTTGGA e-e-e-d.sub.(10)-k-k-k 25 119 1650 1665
528606 CGCCCAGGCATTTGGC e-e-e-d.sub.(10)-k-k-k 18 816 1651 1666
528607 ACGCCCAGGCATTTGG e-e-e-d.sub.(10)-k-k-k 36 817 1677 1692
528608 GGTCAGCATGTTGTAC e-e-e-d.sub.(10)-k-k-k 11 818 1678 1693
528609 TGGTCAGCATGTTGTA e-e-e-d.sub.(10)-k-k-k 9 819 1680 1695
528610 GTTGGTCAGCATGTTG e-e-e-d.sub.(10)-k-k-k 19 820 1682 1697
528611 TTGTTGGTCAGCATGT e-e-e-d.sub.(10)-k-k-k 27 821 1711 1726
528612 GCTTGGTAAAAAAGTT e-e-e-d.sub.(10)-k-k-k 0 822 1712 1727
528613 GGCTTGGTAAAAAAGT e-e-e-d.sub.(10)-k-k-k 0 823 1713 1728
528614 GGGCTTGGTAAAAAAG e-e-e-d.sub.(10)-k-k-k 0 824 1736 1751
528615 ACTTGATCCCAGGTTC e-e-e-d.sub.(10)-k-k-k 26 825 1741 1756
528616 CGGCCACTTGATCCCA e-e-e-d.sub.(10)-k-k-k 41 826 1742 1757
528617 TCGGCCACTTGATCCC e-e-e-d.sub.(10)-k-k-k 40 827
1743 1758 528618 CTCGGCCACTTGATCC e-e-e-d.sub.(10)-k-k-k 27 828
1744 1759 528619 CCTCGGCCACTTGATC e-e-e-d.sub.(10)-k-k-k 10 829
1745 1760 528620 ACCTCGGCCACTTGAT e-e-e-d.sub.(10)-k-k-k 16 830
1746 1761 528621 GACCTCGGCCACTTGA e-e-e-d.sub.(10)-k-k-k 31 831
1747 1762 528622 GGACCTCGGCCACTTG e-e-e-d.sub.(10)-k-k-k 59 832
1748 1763 528623 AGGACCTCGGCCACTT e-e-e-d.sub.(10)-k-k-k 49 833
1749 1764 528624 CAGGACCTCGGCCACT e-e-e-d.sub.(10)-k-k-k 32 834
1753 1768 528625 AGCTCAGGACCTCGGC e-e-e-d.sub.(10)-k-k-k 28 835
1754 1769 528626 CAGCTCAGGACCTCGG e-e-e-d.sub.(10)-k-k-k 58 836
1755 1770 528627 CCAGCTCAGGACCTCG e-e-e-d.sub.(10)-k-k-k 56 837
1778 1793 528628 CGCTTGGTGGTGGAGG e-e-e-d.sub.(10)-k-k-k 15 838
1779 1794 528629 TCGCTTGGTGGTGGAG e-e-e-d.sub.(10)-k-k-k 9 839 1780
1795 528630 CTCGCTTGGTGGTGGA e-e-e-d.sub.(10)-k-k-k 14 127 1781
1796 528631 CCTCGCTTGGTGGTGG e-e-e-d.sub.(10)-k-k-k 26 840 1782
1797 528632 TCCTCGCTTGGTGGTG e-e-e-d.sub.(10)-k-k-k 24 841 1783
1798 528633 GTCCTCGCTTGGTGGT e-e-e-d.sub.(10)-k-k-k 40 842 1784
1799 528634 AGTCCTCGCTTGGTGG e-e-e-d.sub.(10)-k-k-k 38 843 1785
1800 528635 CAGTCCTCGCTTGGTG e-e-e-d.sub.(10)-k-k-k 20 844 1786
1801 528636 TCAGTCCTCGCTTGGT e-e-e-d.sub.(10)-k-k-k 23 845 1787
1802 528637 CTCAGTCCTCGCTTGG e-e-e-d.sub.(10)-k-k-k 33 846 1788
1803 528638 GCTCAGTCCTCGCTTG e-e-e-d.sub.(10)-k-k-k 15 847 1789
1804 528639 TGCTCAGTCCTCGCTT e-e-e-d.sub.(10)-k-k-k 15 848 1791
1806 528640 GATGCTCAGTCCTCGC e-e-e-d.sub.(10)-k-k-k 43 849 1792
1807 528641 CGATGCTCAGTCCTCG e-e-e-d.sub.(10)-k-k-k 46 850 1793
1808 528642 TCGATGCTCAGTCCTC e-e-e-d.sub.(10)-k-k-k 39 851 1794
1809 528643 CTCGATGCTCAGTCCT e-e-e-d.sub.(10)-k-k-k 32 852 1795
1810 528644 GCTCGATGCTCAGTCC e-e-e-d.sub.(10)-k-k-k 43 129 1796
1811 528645 TGCTCGATGCTCAGTC e-e-e-d.sub.(10)-k-k-k 22 853 1797
1812 528646 CTGCTCGATGCTCAGT e-e-e-d.sub.(10)-k-k-k 38 854 1799
1814 528647 AGCTGCTCGATGCTCA e-e-e-d.sub.(10)-k-k-k 40 855 1800
1815 528648 CAGCTGCTCGATGCTC e-e-e-d.sub.(10)-k-k-k 39 856 1802
1817 528649 GTCAGCTGCTCGATGC e-e-e-d.sub.(10)-k-k-k 32 857 1803
1818 528650 AGTCAGCTGCTCGATG e-e-e-d.sub.(10)-k-k-k 10 858 1804
1819 528651 TAGTCAGCTGCTCGAT e-e-e-d.sub.(10)-k-k-k 4 859 1805 1820
528652 GTAGTCAGCTGCTCGA e-e-e-d.sub.(10)-k-k-k 17 860 1806 1821
528653 TGTAGTCAGCTGCTCG e-e-e-d.sub.(10)-k-k-k 28 861 1807 1822
528654 GTGTAGTCAGCTGCTC e-e-e-d.sub.(10)-k-k-k 31 862 1808 1823
528655 AGTGTAGTCAGCTGCT e-e-e-d.sub.(10)-k-k-k 30 863 1809 1824
528656 CAGTGTAGTCAGCTGC e-e-e-d.sub.(10)-k-k-k 30 864 1810 1825
528657 CCAGTGTAGTCAGCTG e-e-e-d.sub.(10)-k-k-k 23 865 1811 1826
528658 GCCAGTGTAGTCAGCT e-e-e-d.sub.(10)-k-k-k 30 866 1832 1847
528659 CCAGGTCCCAAGAGTT e-e-e-d.sub.(10)-k-k-k 12 867 1852 1867
528660 GACACCCTGAATAATT e-e-e-d.sub.(10)-k-k-k 10 868 1853 1868
528661 TGACACCCTGAATAAT e-e-e-d.sub.(10)-k-k-k 10 869 1856 1871
528662 ATCTGACACCCTGAAT e-e-e-d.sub.(10)-k-k-k 12 870 1857 1872
528663 GATCTGACACCCTGAA e-e-e-d.sub.(10)-k-k-k 22 871 1859 1874
528664 GTGATCTGACACCCTG e-e-e-d.sub.(10)-k-k-k 61 872 1861 1876
528665 ATGTGATCTGACACCC e-e-e-d.sub.(10)-k-k-k 36 873 1865 1880
528666 GCCCATGTGATCTGAC e-e-e-d.sub.(10)-k-k-k 46 874 1866 1881
528667 AGCCCATGTGATCTGA e-e-e-d.sub.(10)-k-k-k 36 137 1867 1882
528668 TAGCCCATGTGATCTG e-e-e-d.sub.(10)-k-k-k 44 875 1869 1884
528669 TTTAGCCCATGTGATC e-e-e-d.sub.(10)-k-k-k 12 876 1907 1922
528670 AAGGAGAAGCCCTTGC e-e-e-d.sub.(10)-k-k-k 35 877 1925 1940
528671 TTGTCCAGCCAGACCC e-e-e-d.sub.(10)-k-k-k 40 878 1926 1941
528672 ATTGTCCAGCCAGACC e-e-e-d.sub.(10)-k-k-k 36 879 1927 1942
528673 TATTGTCCAGCCAGAC e-e-e-d.sub.(10)-k-k-k 23 880 1928 1943
528674 ATATTGTCCAGCCAGA e-e-e-d.sub.(10)-k-k-k 24 881 1929 1944
528675 GATATTGTCCAGCCAG e-e-e-d.sub.(10)-k-k-k 52 882 1931 1946
528676 ATGATATTGTCCAGCC e-e-e-d.sub.(10)-k-k-k 41 883 1933 1948
528677 CAATGATATTGTCCAG e-e-e-d.sub.(10)-k-k-k 23 884 1935 1950
528678 GTCAATGATATTGTCC e-e-e-d.sub.(10)-k-k-k 32 885 1936 1951
528679 GGTCAATGATATTGTC e-e-e-d.sub.(10)-k-k-k 26 886 1941 1956
528680 CACAAGGTCAATGATA e-e-e-d.sub.(10)-k-k-k 5 887 1942 1957
528681 TCACAAGGTCAATGAT e-e-e-d.sub.(10)-k-k-k 9 888 1948 1963
518340 ACTTTTTCACAAGGTC e-e-e-d.sub.(10)-k-k-k 52 153 1950 1965
528682 GTACTTTTTCACAAGG e-e-e-d.sub.(10)-k-k-k 21 889 1954 1969
528683 GGATGTACTTTTTCAC e-e-e-d.sub.(10)-k-k-k 0 890 1958 1973
528684 GCCAGGATGTACTTTT e-e-e-d.sub.(10)-k-k-k 0 891 1962 1977
528685 AAGGGCCAGGATGTAC e-e-e-d.sub.(10)-k-k-k 0 892 1963 1978
528686 AAAGGGCCAGGATGTA e-e-e-d.sub.(10)-k-k-k 0 893 2004 2019
528687 CCGCTCCTTACTGATA e-e-e-d.sub.(10)-k-k-k 21 894 2010 2025
528688 CCGCTCCCGCTCCTTA e-e-e-d.sub.(10)-k-k-k 32 895 2014 2029
528689 TGGCCCGCTCCCGCTC e-e-e-d.sub.(10)-k-k-k 52 896 2015 2030
528690 ATGGCCCGCTCCCGCT e-e-e-d.sub.(10)-k-k-k 41 897 2017 2032
528691 AGATGGCCCGCTCCCG e-e-e-d.sub.(10)-k-k-k 51 898 2018 2033
528692 AAGATGGCCCGCTCCC e-e-e-d.sub.(10)-k-k-k 45 899 2019 2034
528693 CAAGATGGCCCGCTCC e-e-e-d.sub.(10)-k-k-k 46 900 2020 2035
528694 TCAAGATGGCCCGCTC e-e-e-d.sub.(10)-k-k-k 27 901 2022 2037
528695 GCTCAAGATGGCCCGC e-e-e-d.sub.(10)-k-k-k 54 902 2023 2038
528696 TGCTCAAGATGGCCCG e-e-e-d.sub.(10)-k-k-k 46 903 2024 2039
528697 GTGCTCAAGATGGCCC e-e-e-d.sub.(10)-k-k-k 60 904 2041 2056
528698 AGGTGCCTGGAGGCTT e-e-e-d.sub.(10)-k-k-k 17 905 2093 2108
528699 CAAGTGAAAGTGACGC e-e-e-d.sub.(10)-k-k-k 2 161 2094 2109
528700 CCAAGTGAAAGTGACG e-e-e-d.sub.(10)-k-k-k 13 906 2095 2110
528701 CCCAAGTGAAAGTGAC e-e-e-d.sub.(10)-k-k-k 14 907 2128 2143
528702 GGATCTGGGTCTTACC e-e-e-d.sub.(10)-k-k-k 22 908 2129 2144
528703 TGGATCTGGGTCTTAC e-e-e-d.sub.(10)-k-k-k 22 909 2131 2146
528704 ACTGGATCTGGGTCTT e-e-e-d.sub.(10)-k-k-k 21 165 2133 2148
528705 GGACTGGATCTGGGTC e-e-e-d.sub.(10)-k-k-k 38 910 2138 2153
528706 TCCACGGACTGGATCT e-e-e-d.sub.(10)-k-k-k 13 911 2139 2154
528707 TTCCACGGACTGGATC e-e-e-d.sub.(10)-k-k-k 19 912 2140 2155
528708 GTTCCACGGACTGGAT e-e-e-d.sub.(10)-k-k-k 2 913 2141 2156
528709 GGTTCCACGGACTGGA e-e-e-d.sub.(10)-k-k-k 42 914 2142 2157
528710 TGGTTCCACGGACTGG e-e-e-d.sub.(10)-k-k-k 63 915 2143 2158
528711 ATGGTTCCACGGACTG e-e-e-d.sub.(10)-k-k-k 62 916 2144 2159
528712 TATGGTTCCACGGACT e-e-e-d.sub.(10)-k-k-k 35 917 2146 2161
528713 TGTATGGTTCCACGGA e-e-e-d.sub.(10)-k-k-k 40 918 2147 2162
528714 GTGTATGGTTCCACGG e-e-e-d.sub.(10)-k-k-k 48 919 2193 2208
528715 GCCCATGATGATTTCA e-e-e-d.sub.(10)-k-k-k 36 920 2194 2209
528716 AGCCCATGATGATTTC e-e-e-d.sub.(10)-k-k-k 25 921 2195 2210
528717 TAGCCCATGATGATTT e-e-e-d.sub.(10)-k-k-k 27 922 2196 2211
528718 ATAGCCCATGATGATT e-e-e-d.sub.(10)-k-k-k 19 923 2197 2212
528719 TATAGCCCATGATGAT e-e-e-d.sub.(10)-k-k-k 14 924 2198 2213
528720 TTATAGCCCATGATGA e-e-e-d.sub.(10)-k-k-k 14 925 2199 2214
528721 CTTATAGCCCATGATG e-e-e-d.sub.(10)-k-k-k 21 926 2200 2215
528722 TCTTATAGCCCATGAT e-e-e-d.sub.(10)-k-k-k 0 927 2201 2216
528723 ATCTTATAGCCCATGA e-e-e-d.sub.(10)-k-k-k 17 928 2202 2217
528724 GATCTTATAGCCCATG e-e-e-d.sub.(10)-k-k-k 35 929 2203 2218
528725 TGATCTTATAGCCCAT e-e-e-d.sub.(10)-k-k-k 45 930 2204 2219
528726 ATGATCTTATAGCCCA e-e-e-d.sub.(10)-k-k-k 67 931 2205 2220
528727 CATGATCTTATAGCCC e-e-e-d.sub.(10)-k-k-k 45 932 2206 2221
528728 CCATGATCTTATAGCC e-e-e-d.sub.(10)-k-k-k 38 175 2207 2222
528729 TCCATGATCTTATAGC e-e-e-d.sub.(10)-k-k-k 0 933 2208 2223
528730 ATCCATGATCTTATAG e-e-e-d.sub.(10)-k-k-k 12 934 2213 2228
528731 GTAGCATCCATGATCT e-e-e-d.sub.(10)-k-k-k 14 935 2214 2229
528732 GGTAGCATCCATGATC e-e-e-d.sub.(10)-k-k-k 25 936 2217 2232
528733 ATTGGTAGCATCCATG e-e-e-d.sub.(10)-k-k-k 22 937 2218 2233
528734 TATTGGTAGCATCCAT e-e-e-d.sub.(10)-k-k-k 15 938 2219 2234
528735 ATATTGGTAGCATCCA e-e-e-d.sub.(10)-k-k-k 28 939 2264 2279
528736 TCCTTGGGAATGTCAG e-e-e-d.sub.(10)-k-k-k 30 940 2266 2281
528737 CCTCCTTGGGAATGTC e-e-e-d.sub.(10)-k-k-k 30 181 2275 2290
528738 CGAATGCCTCCTCCTT e-e-e-d.sub.(10)-k-k-k 29 186 2277 2292
528739 TCCGAATGCCTCCTCC e-e-e-d.sub.(10)-k-k-k 33 941 2278 2293
528740 TTCCGAATGCCTCCTC e-e-e-d.sub.(10)-k-k-k 27 942 2279 2294
528741 TTTCCGAATGCCTCCT e-e-e-d.sub.(10)-k-k-k 20 943 2280 2295
528742 CTTTCCGAATGCCTCC e-e-e-d.sub.(10)-k-k-k 25 944
2281 2296 528743 ACTTTCCGAATGCCTC e-e-e-d.sub.(10)-k-k-k 39 945
2283 2298 528744 ATACTTTCCGAATGCC e-e-e-d.sub.(10)-k-k-k 44 946
2285 2300 528745 CAATACTTTCCGAATG e-e-e-d.sub.(10)-k-k-k 0 947 2286
2301 528746 ACAATACTTTCCGAAT e-e-e-d.sub.(10)-k-k-k 0 948 2288 2303
528747 CGACAATACTTTCCGA e-e-e-d.sub.(10)-k-k-k 11 949 2289 2304
528748 CCGACAATACTTTCCG e-e-e-d.sub.(10)-k-k-k 31 950 2290 2305
528749 GCCGACAATACTTTCC e-e-e-d.sub.(10)-k-k-k 18 951 2291 2306
528750 GGCCGACAATACTTTC e-e-e-d.sub.(10)-k-k-k 16 952 2293 2308
528751 CTGGCCGACAATACTT e-e-e-d.sub.(10)-k-k-k 18 953 2294 2309
528752 TCTGGCCGACAATACT e-e-e-d.sub.(10)-k-k-k 8 954 2295 2310
528753 CTCTGGCCGACAATAC e-e-e-d.sub.(10)-k-k-k 0 955 2296 2311
528754 TCTCTGGCCGACAATA e-e-e-d.sub.(10)-k-k-k 6 188 2297 2312
528755 CTCTCTGGCCGACAAT e-e-e-d.sub.(10)-k-k-k 18 956 2298 2313
528756 GCTCTCTGGCCGACAA e-e-e-d.sub.(10)-k-k-k 35 957 2299 2314
528757 GGCTCTCTGGCCGACA e-e-e-d.sub.(10)-k-k-k 57 958 2300 2315
528758 TGGCTCTCTGGCCGAC e-e-e-d.sub.(10)-k-k-k 64 959 2301 2316
528759 CTGGCTCTCTGGCCGA e-e-e-d.sub.(10)-k-k-k 12 960 2326 2341
528760 TACCTGGGTCAGCTTC e-e-e-d.sub.(10)-k-k-k 21 961 2328 2343
528761 GCTACCTGGGTCAGCT e-e-e-d.sub.(10)-k-k-k 18 962 2329 2344
528762 CGCTACCTGGGTCAGC e-e-e-d.sub.(10)-k-k-k 28 963 2330 2345
528763 GCGCTACCTGGGTCAG e-e-e-d.sub.(10)-k-k-k 26 964 2349 2364
528764 GGTCTTCAGGTATGGG e-e-e-d.sub.(10)-k-k-k 38 965 2350 2365
528765 TGGTCTTCAGGTATGG e-e-e-d.sub.(10)-k-k-k 12 966 2352 2367
528766 CTTGGTCTTCAGGTAT e-e-e-d.sub.(10)-k-k-k 0 967 2353 2368
528767 ACTTGGTCTTCAGGTA e-e-e-d.sub.(10)-k-k-k 10 190 2358 2373
528768 GATAAACTTGGTCTTC e-e-e-d.sub.(10)-k-k-k 9 968 2360 2375
528769 CAGATAAACTTGGTCT e-e-e-d.sub.(10)-k-k-k 15 969 2361 2376
528770 ACAGATAAACTTGGTC e-e-e-d.sub.(10)-k-k-k 7 970 2369 2384
528771 GGTGTCACACAGATAA e-e-e-d.sub.(10)-k-k-k 35 971 2373 2388
528772 CGTTGGTGTCACACAG e-e-e-d.sub.(10)-k-k-k 52 972 2387 2402
528773 GTATTGCTGCAGGTCG e-e-e-d.sub.(10)-k-k-k 49 194 2388 2403
528774 GGTATTGCTGCAGGTC e-e-e-d.sub.(10)-k-k-k 48 973 2389 2404
528775 TGGTATTGCTGCAGGT e-e-e-d.sub.(10)-k-k-k 35 974 2390 2405
528776 ATGGTATTGCTGCAGG e-e-e-d.sub.(10)-k-k-k 20 975 2392 2407
528777 CAATGGTATTGCTGCA e-e-e-d.sub.(10)-k-k-k 24 976 2393 2408
528778 TCAATGGTATTGCTGC e-e-e-d.sub.(10)-k-k-k 15 977 2394 2409
528779 GTCAATGGTATTGCTG e-e-e-d.sub.(10)-k-k-k 16 978 2395 2410
528780 GGTCAATGGTATTGCT e-e-e-d.sub.(10)-k-k-k 34 196 2396 2411
528781 AGGTCAATGGTATTGC e-e-e-d.sub.(10)-k-k-k 26 979 2397 2412
528782 CAGGTCAATGGTATTG e-e-e-d.sub.(10)-k-k-k 16 980 2398 2413
528783 GCAGGTCAATGGTATT e-e-e-d.sub.(10)-k-k-k 10 981 2399 2414
528784 GGCAGGTCAATGGTAT e-e-e-d.sub.(10)-k-k-k 32 982 2400 2415
528785 CGGCAGGTCAATGGTA e-e-e-d.sub.(10)-k-k-k 39 983 2401 2416
528786 TCGGCAGGTCAATGGT e-e-e-d.sub.(10)-k-k-k 51 984 2403 2418
528787 CATCGGCAGGTCAATG e-e-e-d.sub.(10)-k-k-k 26 198 2404 2419
528788 ACATCGGCAGGTCAAT e-e-e-d.sub.(10)-k-k-k 20 985 2405 2420
528789 GACATCGGCAGGTCAA e-e-e-d.sub.(10)-k-k-k 42 986 2406 2421
528790 GGACATCGGCAGGTCA e-e-e-d.sub.(10)-k-k-k 58 987 2407 2422
528791 GGGACATCGGCAGGTC e-e-e-d.sub.(10)-k-k-k 68 988 2423 2438
528792 GAATCTAAAGTGCGGG e-e-e-d.sub.(10)-k-k-k 46 200 2424 2439
528793 TGAATCTAAAGTGCGG e-e-e-d.sub.(10)-k-k-k 43 989 2427 2442
528794 CAATGAATCTAAAGTG e-e-e-d.sub.(10)-k-k-k 20 990 2462 2477
528795 GGTTCAGCACCTTCAC e-e-e-d.sub.(10)-k-k-k 13 991 2463 2478
528796 GGGTTCAGCACCTTCA e-e-e-d.sub.(10)-k-k-k 24 992 2464 2479
528797 AGGGTTCAGCACCTTC e-e-e-d.sub.(10)-k-k-k 23 993 2465 2480
528798 GAGGGTTCAGCACCTT e-e-e-d.sub.(10)-k-k-k 18 994 2466 2481
528799 TGAGGGTTCAGCACCT e-e-e-d.sub.(10)-k-k-k 24 995 2490 2505
528800 GAGGGACTCAAACTGC e-e-e-d.sub.(10)-k-k-k 28 996 2492 2507
528801 GTGAGGGACTCAAACT e-e-e-d.sub.(10)-k-k-k 22 997 2493 2508
528802 GGTGAGGGACTCAAAC e-e-e-d.sub.(10)-k-k-k 20 998 2494 2509
528803 AGGTGAGGGACTCAAA e-e-e-d.sub.(10)-k-k-k 13 999 2495 2510
528804 AAGGTGAGGGACTCAA e-e-e-d.sub.(10)-k-k-k 20 1000 2497 2512
528805 CAAAGGTGAGGGACTC e-e-e-d.sub.(10)-k-k-k 20 1001 2498 2513
528806 TCAAAGGTGAGGGACT e-e-e-d.sub.(10)-k-k-k 18 1002 2506 2521
528807 ACTCCATGTCAAAGGT e-e-e-d.sub.(10)-k-k-k 54 1003 2510 2525
528808 GTCAACTCCATGTCAA e-e-e-d.sub.(10)-k-k-k 39 1004 2511 2526
528809 GGTCAACTCCATGTCA e-e-e-d.sub.(10)-k-k-k 56 1005 2513 2528
528810 GAGGTCAACTCCATGT e-e-e-d.sub.(10)-k-k-k 41 1006 2514 2529
528811 CGAGGTCAACTCCATG e-e-e-d.sub.(10)-k-k-k 45 1007 2515 2530
528812 CCGAGGTCAACTCCAT e-e-e-d.sub.(10)-k-k-k 45 1008 2517 2532
528813 CTCCGAGGTCAACTCC e-e-e-d.sub.(10)-k-k-k 58 1009 2518 2533
528814 ACTCCGAGGTCAACTC e-e-e-d.sub.(10)-k-k-k 40 1010 2519 2534
528815 CACTCCGAGGTCAACT e-e-e-d.sub.(10)-k-k-k 30 1011 2551 2566
528816 CGTTCTCAGCTCCTCA e-e-e-d.sub.(10)-k-k-k 54 1012 2554 2569
528817 TTCCGTTCTCAGCTCC e-e-e-d.sub.(10)-k-k-k 53 1013 2555 2570
528818 CTTCCGTTCTCAGCTC e-e-e-d.sub.(10)-k-k-k 27 1014 2556 2571
528819 GCTTCCGTTCTCAGCT e-e-e-d.sub.(10)-k-k-k 35 1015 2557 2572
528820 AGCTTCCGTTCTCAGC e-e-e-d.sub.(10)-k-k-k 38 1016 2558 2573
528821 CAGCTTCCGTTCTCAG e-e-e-d.sub.(10)-k-k-k 53 1017 2559 2574
528822 GCAGCTTCCGTTCTCA e-e-e-d.sub.(10)-k-k-k 66 1018 2614 2629
528823 TTTGGCTGTGTGAGGG e-e-e-d.sub.(10)-k-k-k 62 1019 2615 2630
528824 GTTTGGCTGTGTGAGG e-e-e-d.sub.(10)-k-k-k 50 1020 2616 2631
528825 GGTTTGGCTGTGTGAG e-e-e-d.sub.(10)-k-k-k 15 1021 2641 2656
528826 AAGTTAGTAGTTTCAG e-e-e-d.sub.(10)-k-k-k 20 1022 2677 2692
528827 GCAGAAGTAGGAGATT e-e-e-d.sub.(10)-k-k-k 28 1023 2690 2705
528828 TTGCTCAAAGATAGCA e-e-e-d.sub.(10)-k-k-k 39 1024 2691 2706
528829 ATTGCTCAAAGATAGC e-e-e-d.sub.(10)-k-k-k 37 1025 2692 2707
528830 GATTGCTCAAAGATAG e-e-e-d.sub.(10)-k-k-k 22 1026 2694 2709
528831 CAGATTGCTCAAAGAT e-e-e-d.sub.(10)-k-k-k 26 1027 2695 2710
528832 CCAGATTGCTCAAAGA e-e-e-d.sub.(10)-k-k-k 41 1028 2699 2714
528833 GTGCCCAGATTGCTCA e-e-e-d.sub.(10)-k-k-k 77 1029 2738 2753
528834 GCAGATCACCCACATT e-e-e-d.sub.(10)-k-k-k 49 1030 2743 2758
528835 TAAAAGCAGATCACCC e-e-e-d.sub.(10)-k-k-k 40 1031 2809 2824
528836 CTAGCCACCCCCCGCC e-e-e-d.sub.(10)-k-k-k 19 1032 2810 2825
528837 TCTAGCCACCCCCCGC e-e-e-d.sub.(10)-k-k-k 9 1033 2811 2826
528838 CTCTAGCCACCCCCCG e-e-e-d.sub.(10)-k-k-k 16 1034 2908 2923
528839 GGAGGCACTTGTCTAA e-e-e-d.sub.(10)-k-k-k 56 235 2909 2924
528840 AGGAGGCACTTGTCTA e-e-e-d.sub.(10)-k-k-k 62 1036 2910 2925
528841 CAGGAGGCACTTGTCT e-e-e-d.sub.(10)-k-k-k 52 1037 2911 2926
528842 CCAGGAGGCACTTGTC e-e-e-d.sub.(10)-k-k-k 59 1038 2932 2947
528843 GGCAGAAGGATGCCGC e-e-e-d.sub.(10)-k-k-k 35 1039 2945 2960
528844 GCTTACAGAAACAGGC e-e-e-d.sub.(10)-k-k-k 62 1040 2980 2995
528845 CAGGAGTATGTAGCTA e-e-e-d.sub.(10)-k-k-k 65 1041 2981 2996
528846 CCAGGAGTATGTAGCT e-e-e-d.sub.(10)-k-k-k 80 1042 2982 2997
528847 GCCAGGAGTATGTAGC e-e-e-d.sub.(10)-k-k-k 72 1043 2983 2998
528848 TGCCAGGAGTATGTAG e-e-e-d.sub.(10)-k-k-k 46 1044 2984 2999
528849 ATGCCAGGAGTATGTA e-e-e-d.sub.(10)-k-k-k 59 241 3001 3016
528850 CAAGGTTAAAAAGTGC e-e-e-d.sub.(10)-k-k-k 10 243 3008 3023
528851 ATGTCAGCAAGGTTAA e-e-e-d.sub.(10)-k-k-k 61 1045 3010 3025
528852 GGATGTCAGCAAGGTT e-e-e-d.sub.(10)-k-k-k 88 1046 3012 3027
528853 TTGGATGTCAGCAAGG e-e-e-d.sub.(10)-k-k-k 91 1047 3016 3031
518349 CTATTTGGATGTCAGC e-e-e-d.sub.(10)-k-k-k 85 245 3030 3045
528854 GATAGTCCTATCTTCT e-e-e-d.sub.(10)-k-k-k 42 1048 3091 3106
528855 ACAGTGTTTTTTGCCC e-e-e-d.sub.(10)-k-k-k 59 1049 3108 3123
528856 AGAAAGGCTATGCTGA e-e-e-d.sub.(10)-k-k-k 56 1050 3452 3467
528857 GAGGCTGTTAACTGAA e-e-e-d.sub.(10)-k-k-k 40 1051 3458 3473
528858 ACCAAGGAGGCTGTTA e-e-e-d.sub.(10)-k-k-k 26 1052 3474 3489
528859 GCTGAATGCTTAAAGC e-e-e-d.sub.(10)-k-k-k 36 1053 4022 4037
518344 GCCACTGGATATCACC e-e-e-d.sub.(10)-k-k-k 55 317
Example 12: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0469] Gapmers from the study described in Example 11, above,
exhibiting significant in vitro inhibition of STAT3 were tested at
various doses in HuVEC cells. Cells were plated at a density of
20,000 cells per well and transfected using electroporation with
23.4375 nM, 93.75 nM, 375.0 nM, and 1,500.0 nM concentrations of
antisense oligonucleotide, as specified in Table 12. After a
treatment period of approximately 16 hours, RNA was isolated from
the cells and STAT3 mRNA levels were measured by quantitative
real-time PCR. Human STAT3 primer probe set RTS199, described
hereinabove, was used to measure mRNA levels. STAT3 mRNA levels
were adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
STAT3, relative to untreated control cells.
[0470] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 12 and was
calculated by plotting the concentrations of oligonucleotides used
versus the percent inhibition of STAT3 mRNA expression achieved at
each concentration, and noting the concentration of oligonucleotide
at which 50% inhibition of STAT3 mRNA expression was achieved
compared to the control. As illustrated in Table 12, STAT3 mRNA
levels were significantly reduced in a dose-dependent manner in
antisense oligonucleotide treated cells.
TABLE-US-00012 TABLE 12 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells 23.4375 93.75 375.0 1500.0 IC.sub.50
ISIS No nM nM nM nM (.mu.M) 518340 0 8 28 63 1.0 518349 13 30 68 90
0.2 528189 8 13 43 71 0.5 528204 4 24 53 79 0.3 528205 0 9 59 80
0.4 528208 0 19 56 84 0.3 528209 0 28 58 90 0.3 528210 0 16 49 87
0.3 528211 0 10 47 86 0.4 528212 0 16 42 83 0.4 528214 0 25 55 88
0.3 528215 3 16 53 82 0.3 528237 13 19 33 73 0.6 528245 3 16 53 78
0.4 528263 0 3 32 76 0.6 528264 9 0 19 50 >1.5 528268 0 7 25 63
1.0 528269 0 11 39 77 0.5 528270 5 9 48 79 0.4 528271 0 14 37 81
0.5 528327 0 0 26 72 0.8 528347 0 2 25 69 0.9 528357 0 17 36 69 0.6
528389 0 3 19 82 0.7 528501 0 17 40 69 0.6 528502 0 10 35 76 0.6
528503 3 1 38 70 0.7 528504 0 19 45 72 0.5 528505 0 7 41 73 0.6
528518 0 24 51 81 0.3 528534 0 8 32 72 0.7 528539 0 7 39 73 0.6
528557 0 9 26 53 >1.5 528565 4 12 31 57 1.3 528567 8 13 25 54
>1.5 528569 9 19 37 60 0.8 528574 5 17 32 62 0.9 528622 10 4 29
68 0.9 528623 0 13 24 62 1.1 528626 1 0 34 68 0.8 528627 22 19 30
64 1.0 528664 0 14 37 74 0.5 528675 0 10 28 62 1.0 528689 0 16 33
65 0.7 528691 0 3 34 61 0.9 528695 1 4 36 66 0.8 528697 3 15 39 72
0.5 528710 13 16 28 63 1.0 528711 8 13 14 62 >1.5 528726 0 8 36
72 0.6 528757 4 10 29 76 0.6 528758 1 5 28 62 1.1 528772 0 2 21 63
1.2 528773 9 8 28 70 0.8 528791 4 9 41 69 0.6 528822 0 0 40 46
>1.5 528833 0 23 47 82 0.4 528846 10 19 49 85 0.3 528847 0 19 45
75 0.4 528852 5 33 66 93 0.2 528853 19 46 77 95 0.1
Example 13: Antisense Inhibition of Human STAT3 in HuVEC Cells
[0471] Antisense oligonucleotides were designed targeting a human
STAT3 nucleic acid and were tested for their effect on human STAT3
mRNA expression in vitro. The chimeric antisense oligonucleotides
in Tables 13 and 14 are gapmers16 or 17 nucleotides in length
having various chemical modifications. Each gapmer comprises a
central gap segment consisting of nine or ten 2'-deoxynucleosides
and is flanked on both sides (in the 5' and 3' directions) by wings
comprising 1, 2, 3, 4, or 5 nucleotides each. Each of the
nucleotides in the wings comprise a 2'-MOE sugar modification or a
cEt sugar modification. Gapmer motifs include 3-10-3, 4-9-3,
2-10-4, 1-10-5, and 3-10-4. The chemistry column of Tables 13 and
14 provides the sugar motif of each gapmer, wherein `e` indicates a
2'-MOE nucleoside, 1' indicates a constrained ethyl (cEt)
nucleoside, and `d` indicates a 2'-deoxynucleoside. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5'-methylcytosines.
[0472] Potency of the chimeric antisense oligonucleotides was
compared to ISIS 481464, ISIS 518344, and ISIS 518349 (described
previously herein).
[0473] Cultured HuVEC cells at a density of 20,000 cells per well
were transfected using electroporation with 1,000 nM antisense
oligonucleotide. After a treatment period of approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human primer probe set
RTS199, described hereinabove, was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0474] "Human Target start site" indicates the 5'-most nucleoside
to which the gapmer is targeted in the human gene sequence. "Human
Target stop site" indicates the 3'-most nucleoside to which the
gapmer is targeted in the human gene sequence. Each gapmer listed
in Table 13 is targeted to human STAT3 mRNA, designated herein as
SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer
listed in Table 14 is targeted to human STAT3 genomic sequence,
designated herein as SEQ ID NO: 2 (the complement of GENBANK
Accession No. NT_010755.14 truncated from nucleotides 4185000 to
4264000).
TABLE-US-00013 TABLE 13 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human
Human Start Stop ISIS % SEQ Site Site No Sequence Chemistry
inhibition ID NO 728 743 530423 AGATTCTCTACCACTT k-d(10)-k-e-k-e-e
70 1054 729 745 530053 GGAGATTCTCTACCACT e-e-k-d(10)-k-e-k-e 84
1055 729 744 530373 GAGATTCTCTACCACT e-k-d(10)-k-e-k-e 85 1056 730
745 530121 GGAGATTCTCTACCAC e-k-k-d(10)-k-k-e 77 53 730 745 530168
GGAGATTCTCTACCAC e-e-k-d(10)-k-k-e 75 53 730 745 530218
GGAGATTCTCTACCAC e-d-k-d(10)-k-k-e 61 53 730 745 530268
GGAGATTCTCTACCAC e-d-d-k-d(9)-k-k-e 76 53 730 745 530318
GGAGATTCTCTACCAC e-e-e-e-d(9)-k-k-e 27 53 786 801 530424
ATCTTGCATGTCTCCT k-d(10)-k-e-k-e-e 42 1057 787 803 530058
AGATCTTGCATGTCTCC e-e-k-d(10)-k-e-k-e 73 1058 787 802 530374
GATCTTGCATGTCTCC e-k-d(10)-k-e-k-e 71 647 788 803 530122
AGATCTTGCATGTCTC e-k-k-d(10)-k-k-e 80 57 788 803 530169
AGATCTTGCATGTCTC e-e-k-d(10)-k-k-e 72 57 788 803 530219
AGATCTTGCATGTCTC e-d-k-d(10)-k-k-e 55 57 788 803 530269
AGATCTTGCATGTCTC e-d-d-k-d(9)-k-k-e 76 57 788 803 530319
AGATCTTGCATGTCTC e-e-e-e-d(9)-k-k-e 30 57 892 907 528400
CCGCCAGCTCACTCAC e-e-e-d(10)-k-k-k 57 66 893 908 528401
CCCGCCAGCTCACTCA e-e-e-d(10)-k-k-k 57 1059 894 909 528402
CCCCGCCAGCTCACTC e-e-e-d(10)-k-k-k 42 1060 897 912 528403
AAGCCCCGCCAGCTCA e-e-e-d(10)-k-k-k 72 1061 898 913 528404
AAAGCCCCGCCAGCTC e-e-e-d(10)-k-k-k 52 1062 899 914 528405
AAAAGCCCCGCCAGCT e-e-e-d(10)-k-k-k 27 1063 900 915 528406
CAAAAGCCCCGCCAGC e-e-e-d(10)-k-k-k 29 1064 901 916 528407
ACAAAAGCCCCGCCAG e-e-e-d(10)-k-k-k 9 1065 903 918 528408
TGACAAAAGCCCCGCC e-e-e-d(10)-k-k-k 10 1066 904 919 528409
CTGACAAAAGCCCCGC e-e-e-d(10)-k-k-k 31 1067 905 920 528410
GCTGACAAAAGCCCCG e-e-e-d(10)-k-k-k 39 1068 906 921 528411
CGCTGACAAAAGCCCC e-e-e-d(10)-k-k-k 49 1069 907 922 528412
TCGCTGACAAAAGCCC e-e-e-d(10)-k-k-k 39 1070 908 923 528413
ATCGCTGACAAAAGCC e-e-e-d(10)-k-k-k 20 1071 909 924 528414
CATCGCTGACAAAAGC e-e-e-d(10)-k-k-k 10 1072 911 926 528415
TCCATCGCTGACAAAA e-e-e-d(10)-k-k-k 11 1073 912 927 528416
CTCCATCGCTGACAAA e-e-e-d(10)-k-k-k 15 1074 913 928 528417
ACTCCATCGCTGACAA e-e-e-d(10)-k-k-k 22 1075 914 929 528418
TACTCCATCGCTGACA e-e-e-d(10)-k-k-k 19 1076 915 930 528419
GTACTCCATCGCTGAC e-e-e-d(10)-k-k-k 37 1077 916 931 528420
CGTACTCCATCGCTGA e-e-e-d(10)-k-k-k 35 1078 930 945 528421
GAGAGTTTTCTGCACG e-e-e-d(10)-k-k-k 36 1079 932 947 528422
GTGAGAGTTTTCTGCA e-e-e-d(10)-k-k-k 22 1080 951 966 528423
GTCAGCCAGCTCCTCG e-e-e-d(10)-k-k-k 49 1081 962 977 528424
CGCCTCTTCCAGTCAG e-e-e-d(10)-k-k-k 42 1082 964 979 528425
GCCGCCTCTTCCAGTC e-e-e-d(10)-k-k-k 44 1083 965 980 528426
TGCCGCCTCTTCCAGT e-e-e-d(10)-k-k-k 15 1084 970 985 528427
TCTGTTGCCGCCTCTT e-e-e-d(10)-k-k-k 9 1085 971 986 528428
ATCTGTTGCCGCCTCT e-e-e-d(10)-k-k-k 30 1086 972 987 528429
AATCTGTTGCCGCCTC e-e-e-d(10)-k-k-k 23 1087 973 988 528430
CAATCTGTTGCCGCCT e-e-e-d(10)-k-k-k 12 1088 974 989 528431
GCAATCTGTTGCCGCC e-e-e-d(10)-k-k-k 48 1089 975 990 528432
GGCAATCTGTTGCCGC e-e-e-d(10)-k-k-k 18 1090 976 991 528433
AGGCAATCTGTTGCCG e-e-e-d(10)-k-k-k 0 1091 977 992 528434
CAGGCAATCTGTTGCC e-e-e-d(10)-k-k-k 8 1092 978 993 528435
GCAGGCAATCTGTTGC e-e-e-d(10)-k-k-k 13 1093 982 997 528436
CAATGCAGGCAATCTG e-e-e-d(10)-k-k-k 9 1094 983 998 528437
CCAATGCAGGCAATCT e-e-e-d(10)-k-k-k 26 1095 984 999 528438
TCCAATGCAGGCAATC e-e-e-d(10)-k-k-k 10 1096 985 1000 528439
CTCCAATGCAGGCAAT e-e-e-d(10)-k-k-k 2 1097 986 1001 528440
CCTCCAATGCAGGCAA e-e-e-d(10)-k-k-k 28 1098 1003 1018 528441
GGCAGATGTTGGGCGG e-e-e-d(10)-k-k-k 8 1099 1004 1019 528442
AGGCAGATGTTGGGCG e-e-e-d(10)-k-k-k 0 1100 1005 1020 528443
TAGGCAGATGTTGGGC e-e-e-d(10)-k-k-k 1 1101 1006 1021 528444
CTAGGCAGATGTTGGG e-e-e-d(10)-k-k-k 0 1102 1007 1022 528445
TCTAGGCAGATGTTGG e-e-e-d(10)-k-k-k 7 1103 1008 1023 528446
ATCTAGGCAGATGTTG e-e-e-d(10)-k-k-k 3 1104 1010 1025 528447
CGATCTAGGCAGATGT e-e-e-d(10)-k-k-k 9 72 1011 1026 528448
CCGATCTAGGCAGATG e-e-e-d(10)-k-k-k 13 1105 1013 1028 528449
AGCCGATCTAGGCAGA e-e-e-d(10)-k-k-k 4 1106 1014 1029 528450
TAGCCGATCTAGGCAG e-e-e-d(10)-k-k-k 11 1107 1015 1030 528451
CTAGCCGATCTAGGCA e-e-e-d(10)-k-k-k 5 1108 1016 1031 528452
TCTAGCCGATCTAGGC e-e-e-d(10)-k-k-k 5 1109 1017 1032 528453
TTCTAGCCGATCTAGG e-e-e-d(10)-k-k-k 24 1110 1018 1033 528454
TTTCTAGCCGATCTAG e-e-e-d(10)-k-k-k 29 1111 1019 1034 528455
TTTTCTAGCCGATCTA e-e-e-d(10)-k-k-k 28 1112 1020 1035 528456
GTTTTCTAGCCGATCT e-e-e-d(10)-k-k-k 42 1113 1022 1037 528457
CAGTTTTCTAGCCGAT e-e-e-d(10)-k-k-k 50 1114 1023 1038 528458
CCAGTTTTCTAGCCGA e-e-e-d(10)-k-k-k 70 1115 1024 1039 528459
TCCAGTTTTCTAGCCG e-e-e-d(10)-k-k-k 56 1116 1025 1040 528460
ATCCAGTTTTCTAGCC e-e-e-d(10)-k-k-k 42 1117 1029 1044 528461
CGTTATCCAGTTTTCT e-e-e-d(10)-k-k-k 47 1118 1043 1058 528462
GATTCTGCTAATGACG e-e-e-d(10)-k-k-k 42 1119 1044 1059 528463
AGATTCTGCTAATGAC e-e-e-d(10)-k-k-k 38 1120 1048 1063 528464
GTTGAGATTCTGCTAA e-e-e-d(10)-k-k-k 30 1121 1049 1064 528465
AGTTGAGATTCTGCTA e-e-e-d(10)-k-k-k 48 1122 1056 1071 528466
GGTCTGAAGTTGAGAT e-e-e-d(10)-k-k-k 27 1123 1058 1073 528467
CGGGTCTGAAGTTGAG e-e-e-d(10)-k-k-k 44 1124 1059 1074 528468
ACGGGTCTGAAGTTGA e-e-e-d(10)-k-k-k 41 1125 1060 1075 528469
GACGGGTCTGAAGTTG e-e-e-d(10)-k-k-k 45 1126 1061 1076 528470
TGACGGGTCTGAAGTT e-e-e-d(10)-k-k-k 34 1127 1062 1077 528471
TTGACGGGTCTGAAGT e-e-e-d(10)-k-k-k 19 1128 1063 1078 528472
GTTGACGGGTCTGAAG e-e-e-d(10)-k-k-k 21 1129 1064 1079 528473
TGTTGACGGGTCTGAA e-e-e-d(10)-k-k-k 37 1130 1065 1080 528474
TTGTTGACGGGTCTGA e-e-e-d(10)-k-k-k 55 1131 1066 1081 528475
TTTGTTGACGGGTCTG e-e-e-d(10)-k-k-k 63 1132 1067 1082 528476
ATTTGTTGACGGGTCT e-e-e-d(10)-k-k-k 65 1133 1899 1914 530425
GCCCTTGCCAGCCATG k-d(10)-k-e-k-e-e 73 1134 1900 1916 530054
AAGCCCTTGCCAGCCAT e-e-k-d(10)-k-e-k-e 75 1135 1900 1915 530375
AGCCCTTGCCAGCCAT e-k-d(10)-k-e-k-e 77 1136 1901 1916 530123
AAGCCCTTGCCAGCCA e-k-k-d(10)-k-k-e 86 144 1901 1916 530170
AAGCCCTTGCCAGCCA e-e-k-d(10)-k-k-e 87 144 1901 1916 530220
AAGCCCTTGCCAGCCA e-d-k-d(10)-k-k-e 74 144 1901 1916 530270
AAGCCCTTGCCAGCCA e-d-d-k-d(9)-k-k-e 87 144 1901 1916 530320
AAGCCCTTGCCAGCCA e-e-e-e-d(9)-k-k-e 17 144 1946 1961 530426
TTTTTCACAAGGTCAA k-d(10)-k-e-k-e-e 55 1137 1947 1963 530059
ACTTTTTCACAAGGTCA e-e-k-d(10)-k-e-k-e 73 1138 1947 1962 530376
CTTTTTCACAAGGTCA e-k-d(10)-k-e-k-e 77 1139 1948 1963 530124
ACTTTTTCACAAGGTC e-k-k-d(10)-k-k-e 79 153 1948 1963 530171
ACTTTTTCACAAGGTC e-e-k-d(10)-k-k-e 69 153 1948 1963 530221
ACTTTTTCACAAGGTC e-d-k-d(10)-k-k-e 64 153 1948 1963 530271
ACTTTTTCACAAGGTC e-d-d-k-d(9)-k-k-e 73 153 1948 1963 530321
ACTTTTTCACAAGGTC e-e-e-e-d(9)-k-k-e 44 153 2204 2219 530427
ATGATCTTATAGCCCA k-d(10)-k-e-k-e-e 43 931 2205 2221 530060
CCATGATCTTATAGCCC e-e-k-d(10)-k-e-k-e 77 1140 2205 2220 530377
CATGATCTTATAGCCC e-k-d(10)-k-e-k-e 66 932 2206 2221 530125
CCATGATCTTATAGCC e-k-k-d(10)-k-k-e 65 175 2206 2221 530172
CCATGATCTTATAGCC e-e-k-d(10)-k-k-e 59 175 2206 2221 530222
CCATGATCTTATAGCC e-d-k-d(10)-k-k-e 48 175 2206 2221 530272
CCATGATCTTATAGCC e-d-d-k-d(9)-k-k-e 63 175 2206 2221 530322
CCATGATCTTATAGCC e-e-e-e-d(9)-k-k-e 55 175 2679 2694 530428
TAGCAGAAGTAGGAGA k-d(10)-k-e-k-e-e 49 1141 2680 2696 530061
GATAGCAGAAGTAGGAG e-e-k-d(10)-k-e-k-e 49 1142 2680 2695 530378
ATAGCAGAAGTAGGAG e-k-d(10)-k-e-k-e 48 1143 2681 2696 530126
GATAGCAGAAGTAGGA e-k-k-d(10)-k-k-e 70 223
2681 2696 530173 GATAGCAGAAGTAGGA e-e-k-d(10)-k-k-e 62 223 2681
2696 530223 GATAGCAGAAGTAGGA e-d-k-d(10)-k-k-e 44 223 2681 2696
530273 GATAGCAGAAGTAGGA e-d-d-k-d(9)-k-k-e 63 223 2681 2696 530323
GATAGCAGAAGTAGGA e-e-e-e-d(9)-k-k-e 63 223 3012 3027 530513
TTGGATGTCAGCAAGG k-d(10)-k-e-k-e-e 88 1047 3013 3028 530507
TTTGGATGTCAGCAAG e-k-d(10)-k-e-k-e 86 1144 3013 3028 530514
TTTGGATGTCAGCAAG k-d(10)-k-e-k-e-e 80 1144 3014 3029 530430
ATTTGGATGTCAGCAA k-d(10)-k-e-k-e-e 87 1145 3014 3029 530468
ATTTGGATGTCAGCAA e-k-k-d(10)-k-k-e 81 1145 3014 3029 530476
ATTTGGATGTCAGCAA e-e-k-d(10)-k-k-e 82 1145 3014 3029 530484
ATTTGGATGTCAGCAA e-d-k-d(10)-k-k-e 74 1145 3014 3029 530492
ATTTGGATGTCAGCAA e-d-d-k-d(9)-k-k-e 83 1145 3014 3029 530500
ATTTGGATGTCAGCAA e-e-e-e-d(9)-k-k-e 56 1145 3014 3029 530508
ATTTGGATGTCAGCAA e-k-d(10)-k-e-k-e 83 1145 3015 3031 530062
CTATTTGGATGTCAGCA e-e-k-d(10)-k-e-k-e 94 1146 3015 3030 530380
TATTTGGATGTCAGCA e-k-d(10)-k-e-k-e 94 1147 3015 3030 530469
TATTTGGATGTCAGCA e-k-k-d(10)-k-k-e 91 1147 3015 3030 530477
TATTTGGATGTCAGCA e-e-k-d(10)-k-k-e 87 1147 3015 3030 530485
TATTTGGATGTCAGCA e-d-k-d(10)-k-k-e 87 1147 3015 3030 530493
TATTTGGATGTCAGCA e-d-d-k-d(9)-k-k-e 81 1147 3015 3030 530501
TATTTGGATGTCAGCA e-e-e-e-d(9)-k-k-e 74 1147 3015 3030 530515
TATTTGGATGTCAGCA k-d(10)-k-e-k-e-e 87 1147 3016 3031 481464
CTATTTGGATGTCAGC k-k-k-d(10)-k-k-k 93 245 3016 3031 518349
CTATTTGGATGTCAGC e-e-e-d(10)-k-k-k 58 245 3016 3031 519637
CTATTTGGATGTCAGC e-k-k-d(10)-k-k-e 96 245 3016 3031 530175
CTATTTGGATGTCAGC e-e-k-d(10)-k-k-e 93 245 3016 3031 530225
CTATTTGGATGTCAGC e-d-k-d(10)-k-k-e 85 245 3016 3031 530275
CTATTTGGATGTCAGC e-d-d-k-d(9)-k-k-e 91 245 3016 3031 530325
CTATTTGGATGTCAGC e-e-e-e-d(9)-k-k-e 91 245 3017 3032 530470
TCTATTTGGATGTCAG e-k-k-d(10)-k-k-e 91 1148 3017 3032 530478
TCTATTTGGATGTCAG e-e-k-d(10)-k-k-e 87 1148 3017 3032 530486
TCTATTTGGATGTCAG e-d-k-d(10)-k-k-e 84 1148 3017 3032 530494
TCTATTTGGATGTCAG e-d-d-k-d(9)-k-k-e 60 1148 3017 3032 530502
TCTATTTGGATGTCAG e-e-e-e-d(9)-k-k-e 64 1148 3017 3032 530509
TCTATTTGGATGTCAG e-k-d(10)-k-e-k-e 80 1148 3018 3033 530471
TTCTATTTGGATGTCA e-k-k-d(10)-k-k-e 83 1149 3018 3033 530479
TTCTATTTGGATGTCA e-e-k-d(10)-k-k-e 74 1149 3018 3033 530487
TTCTATTTGGATGTCA e-d-k-d(10)-k-k-e 71 1149 3018 3033 530495
TTCTATTTGGATGTCA e-d-d-k-d(9)-k-k-e 68 1149 3018 3033 530503
TTCTATTTGGATGTCA e-e-e-e-d(9)-k-k-e 53 1149 3459 3474 530431
CACCAAGGAGGCTGTT k-d(10)-k-e-k-e-e 44 1150 3460 3476 530055
AGCACCAAGGAGGCTGT e-e-k-d(10)-k-e-k-e 45 1151 3460 3475 530381
GCACCAAGGAGGCTGT e-k-d(10)-k-e-k-e 74 1152 3461 3476 530128
AGCACCAAGGAGGCTG e-k-k-d(10)-k-k-e 52 257 3461 3476 530176
AGCACCAAGGAGGCTG e-e-k-d(10)-k-k-e 66 257 3461 3476 530226
AGCACCAAGGAGGCTG e-d-k-d(10)-k-k-e 51 257 3461 3476 530276
AGCACCAAGGAGGCTG e-d-d-k-d(9)-k-k-e 70 257 3461 3476 530326
AGCACCAAGGAGGCTG e-e-e-e-d(9)-k-k-e 52 257 3527 3542 528860
GGTTTGACCTGAAGCC e-e-e-d(10)-k-k-k 58 1153 3528 3543 528861
GGGTTTGACCTGAAGC e-e-e-d(10)-k-k-k 42 1154 3529 3544 528862
AGGGTTTGACCTGAAG e-e-e-d(10)-k-k-k 57 1155 3530 3545 528863
AAGGGTTTGACCTGAA e-e-e-d(10)-k-k-k 43 1156 3531 3546 528864
TAAGGGTTTGACCTGA e-e-e-d(10)-k-k-k 50 1157 3532 3547 528865
TTAAGGGTTTGACCTG e-e-e-d(10)-k-k-k 32 1158 3547 3562 528866
GCAGCTTCAGATGTCT e-e-e-d(10)-k-k-k 60 1159 3548 3563 528867
TGCAGCTTCAGATGTC e-e-e-d(10)-k-k-k 47 1160 3583 3598 530388
CTTAAACCTTCCTATT k-d(10)-k-e-k-e-e 14 1161 3584 3599 530338
CCTTAAACCTTCCTAT e-k-d(10)-k-e-k-e 47 1162 3585 3600 530086
TCCTTAAACCTTCCTA e-k-k-d(10)-k-k-e 58 273 3585 3600 530133
TCCTTAAACCTTCCTA e-e-k-d(10)-k-k-e 53 273 3585 3600 530183
TCCTTAAACCTTCCTA e-d-k-d(10)-k-k-e 52 273 3585 3600 530233
TCCTTAAACCTTCCTA e-d-d-k-d(9)-k-k-e 29 273 3585 3600 530283
TCCTTAAACCTTCCTA e-e-e-e-d(9)-k-k-e 32 273 3590 3605 528868
GATTCTCCTTAAACCT e-e-e-d(10)-k-k-k 45 1163 3591 3606 530389
AGATTCTCCTTAAACC k-d(10)-k-e-k-e-e 44 1164 3592 3607 530339
TAGATTCTCCTTAAAC e-k-d(10)-k-e-k-e 41 1165 3593 3608 530087
TTAGATTCTCCTTAAA e-k-k-d(10)-k-k-e 43 1166 3593 3608 530134
TTAGATTCTCCTTAAA e-e-k-d(10)-k-k-e 28 1166 3593 3608 530184
TTAGATTCTCCTTAAA e-d-k-d(10)-k-k-e 13 1166 3593 3608 530234
TTAGATTCTCCTTAAA e-d-d-k-d(9)-k-k-e 15 1166 3593 3608 530284
TTAGATTCTCCTTAAA e-e-e-e-d(9)-k-k-e 14 1166 3595 3610 530390
GCTTAGATTCTCCTTA k-d(10)-k-e-k-e-e 83 1167 3596 3611 530340
TGCTTAGATTCTCCTT e-k-d(10)-k-e-k-e 89 1168 3597 3612 528869
ATGCTTAGATTCTCCT e-e-e-d(10)-k-k-k 83 1169 3597 3612 530088
ATGCTTAGATTCTCCT e-k-k-d(10)-k-k-e 90 1169 3597 3612 530135
ATGCTTAGATTCTCCT e-e-k-d(10)-k-k-e 91 1169 3597 3612 530185
ATGCTTAGATTCTCCT e-d-k-d(10)-k-k-e 85 1169 3597 3612 530235
ATGCTTAGATTCTCCT e-d-d-k-d(9)-k-k-e 28 1169 3597 3612 530285
ATGCTTAGATTCTCCT e-e-e-e-d(9)-k-k-e 86 1169 3597 3612 530391
ATGCTTAGATTCTCCT k-d(10)-k-e-k-e-e 79 1169 3598 3614 530021
AAATGCTTAGATTCTCC e-e-k-d(10)-k-e-k-e 87 1170 3598 3613 530341
AATGCTTAGATTCTCC e-k-d(10)-k-e-k-e 88 1171 3599 3614 530089
AAATGCTTAGATTCTC e-k-k-d(10)-k-k-e 71 1172 3599 3614 530136
AAATGCTTAGATTCTC e-e-k-d(10)-k-k-e 66 1172 3599 3614 530186
AAATGCTTAGATTCTC e-d-k-d(10)-k-k-e 51 1172 3599 3614 530236
AAATGCTTAGATTCTC e-d-d-k-d(9)-k-k-e 74 1172 3599 3614 530286
AAATGCTTAGATTCTC e-e-e-e-d(9)-k-k-e 56 1172 3682 3697 528870
GTAAGCACCCTCTGCC e-e-e-d(10)-k-k-k 26 1173 3684 3699 528871
TTGTAAGCACCCTCTG e-e-e-d(10)-k-k-k 14 1174 3686 3701 528872
GGTTGTAAGCACCCTC e-e-e-d(10)-k-k-k 47 1175 3687 3702 528873
AGGTTGTAAGCACCCT e-e-e-d(10)-k-k-k 40 1176 3688 3703 528874
AAGGTTGTAAGCACCC e-e-e-d(10)-k-k-k 54 1177 3690 3705 528875
TCAAGGTTGTAAGCAC e-e-e-d(10)-k-k-k 15 1178 3691 3706 528876
GTCAAGGTTGTAAGCA e-e-e-d(10)-k-k-k 28 1179 3692 3707 528877
AGTCAAGGTTGTAAGC e-e-e-d(10)-k-k-k 28 1180 3694 3709 528878
GGAGTCAAGGTTGTAA e-e-e-d(10)-k-k-k 6 1181 3695 3710 528879
GGGAGTCAAGGTTGTA e-e-e-d(10)-k-k-k 22 1182 3714 3729 530392
GATCAAGTCCAGGGAG k-d(10)-k-e-k-e-e 47 1183 3715 3731 530022
CAGATCAAGTCCAGGGA e-e-k-d(10)-k-e-k-e 80 1184 3715 3730 530342
AGATCAAGTCCAGGGA e-k-d(10)-k-e-k-e 70 1185 3715 3730 530393
AGATCAAGTCCAGGGA k-d(10)-k-e-k-e-e 46 1185 3716 3732 530023
GCAGATCAAGTCCAGGG e-e-k-d(10)-k-e-k-e 74 1186 3716 3731 530090
CAGATCAAGTCCAGGG e-k-k-d(10)-k-k-e 78 1187 3716 3731 530137
CAGATCAAGTCCAGGG e-e-k-d(10)-k-k-e 76 1187 3716 3731 530187
CAGATCAAGTCCAGGG e-d-k-d(10)-k-k-e 68 1187 3716 3731 530237
CAGATCAAGTCCAGGG e-d-d-k-d(9)-k-k-e 36 1187 3716 3731 530287
CAGATCAAGTCCAGGG e-e-e-e-d(9)-k-k-e 56 1187 3716 3731 530343
CAGATCAAGTCCAGGG e-k-d(10)-k-e-k-e 68 1187 3716 3731 530394
CAGATCAAGTCCAGGG k-d(10)-k-e-k-e-e 49 1187 3717 3732 518343
GCAGATCAAGTCCAGG e-e-e-d(10)-k-k-k 5 1188 3717 3733 530024
AGCAGATCAAGTCCAGG e-e-k-d(10)-k-e-k-e 79 1189 3717 3732 530091
GCAGATCAAGTCCAGG e-k-k-d(10)-k-k-e 81 1188 3717 3732 530138
GCAGATCAAGTCCAGG e-e-k-d(10)-k-k-e 81 1188 3717 3732 530188
GCAGATCAAGTCCAGG e-d-k-d(10)-k-k-e 78 1188 3717 3732 530238
GCAGATCAAGTCCAGG e-d-d-k-d(9)-k-k-e 29 1188 3717 3732 530288
GCAGATCAAGTCCAGG e-e-e-e-d(9)-k-k-e 69 1188 3717 3732 530344
GCAGATCAAGTCCAGG e-k-d(10)-k-e-k-e 85 1188 3718 3733 530092
AGCAGATCAAGTCCAG e-k-k-d(10)-k-k-e 85 1190 3718 3733 530139
AGCAGATCAAGTCCAG e-e-k-d(10)-k-k-e 79 1190 3718 3733 530189
AGCAGATCAAGTCCAG e-d-k-d(10)-k-k-e 77 1190 3718 3733 530239
AGCAGATCAAGTCCAG e-d-d-k-d(9)-k-k-e 61 1190 3718 3733 530289
AGCAGATCAAGTCCAG e-e-e-e-d(9)-k-k-e 75 1190 3720 3735 528880
ACAGCAGATCAAGTCC e-e-e-d(10)-k-k-k 65 1191 3721 3736 528881
AACAGCAGATCAAGTC e-e-e-d(10)-k-k-k 44 1192 3737 3752 528882
ACAACCTAGCCTCTGA e-e-e-d(10)-k-k-k 39 1193
3738 3753 528883 AACAACCTAGCCTCTG e-e-e-d(10)-k-k-k 46 1194 3740
3755 528884 GAAACAACCTAGCCTC e-e-e-d(10)-k-k-k 37 1195 3741 3756
528885 AGAAACAACCTAGCCT e-e-e-d(10)-k-k-k 20 1196 3742 3757 528886
CAGAAACAACCTAGCC e-e-e-d(10)-k-k-k 21 1197 3755 3770 528887
GATAAGGCACCCACAG e-e-e-d(10)-k-k-k 25 1198 3756 3771 528888
TGATAAGGCACCCACA e-e-e-d(10)-k-k-k 12 1199 3757 3772 528889
CTGATAAGGCACCCAC e-e-e-d(10)-k-k-k 25 1200 3759 3774 528890
CCCTGATAAGGCACCC e-e-e-d(10)-k-k-k 42 1201 3760 3775 528891
GCCCTGATAAGGCACC e-e-e-d(10)-k-k-k 49 1202 3765 3780 528892
TCCCAGCCCTGATAAG e-e-e-d(10)-k-k-k 0 1203 3767 3782 528893
TATCCCAGCCCTGATA e-e-e-d(10)-k-k-k 0 1204 3770 3785 528894
AAGTATCCCAGCCCTG e-e-e-d(10)-k-k-k 25 1205 3771 3786 528895
GAAGTATCCCAGCCCT e-e-e-d(10)-k-k-k 39 1206 3772 3787 528896
AGAAGTATCCCAGCCC e-e-e-d(10)-k-k-k 22 1207 3773 3788 528897
CAGAAGTATCCCAGCC e-e-e-d(10)-k-k-k 36 1208 3892 3907 528898
TGAGACCAGGATTCCT e-e-e-d(10)-k-k-k 41 1209 3896 3911 528899
GTCCTGAGACCAGGAT e-e-e-d(10)-k-k-k 19 1210 3977 3992 528900
AGCTCAACCAGACACG e-e-e-d(10)-k-k-k 54 311 3979 3994 528901
TGAGCTCAACCAGACA e-e-e-d(10)-k-k-k 40 1211 3984 3999 528902
TTCCCTGAGCTCAACC e-e-e-d(10)-k-k-k 32 1212 3992 4007 528903
GAACCATATTCCCTGA e-e-e-d(10)-k-k-k 30 313 3995 4010 528904
TAAGAACCATATTCCC e-e-e-d(10)-k-k-k 27 1213 4022 4037 518344
GCCACTGGATATCACC e-e-e-d(10)-k-k-k 89 317 4067 4082 528905
TAAGCCTTTGCCCTGC e-e-e-d(10)-k-k-k 64 1214 4068 4083 528906
GTAAGCCTTTGCCCTG e-e-e-d(10)-k-k-k 53 1215 4069 4084 528907
AGTAAGCCTTTGCCCT e-e-e-d(10)-k-k-k 45 1216 4070 4085 528908
CAGTAAGCCTTTGCCC e-e-e-d(10)-k-k-k 40 1217 4072 4087 528909
ATCAGTAAGCCTTTGC e-e-e-d(10)-k-k-k 53 1218 4073 4088 528910
TATCAGTAAGCCTTTG e-e-e-d(10)-k-k-k 47 1219 4077 4092 528911
AGTTTATCAGTAAGCC e-e-e-d(10)-k-k-k 58 1220 4083 4098 528912
GACTCAAGTTTATCAG e-e-e-d(10)-k-k-k 37 1221 4085 4100 528913
CAGACTCAAGTTTATC e-e-e-d(10)-k-k-k 39 1222 4086 4101 528914
GCAGACTCAAGTTTAT e-e-e-d(10)-k-k-k 0 1223 4087 4102 528915
GGCAGACTCAAGTTTA e-e-e-d(10)-k-k-k 1 1224 4088 4103 528916
GGGCAGACTCAAGTTT e-e-e-d(10)-k-k-k 0 1225 4089 4104 528917
AGGGCAGACTCAAGTT e-e-e-d(10)-k-k-k 9 1226 4091 4106 528918
CGAGGGCAGACTCAAG e-e-e-d(10)-k-k-k 2 1227 4093 4108 528919
TACGAGGGCAGACTCA e-e-e-d(10)-k-k-k 20 324 4094 4109 528920
ATACGAGGGCAGACTC e-e-e-d(10)-k-k-k 14 1228 4095 4110 528921
CATACGAGGGCAGACT e-e-e-d(10)-k-k-k 0 1229 4096 4111 528922
TCATACGAGGGCAGAC e-e-e-d(10)-k-k-k 8 1230 4098 4113 528923
CCTCATACGAGGGCAG e-e-e-d(10)-k-k-k 2 1231 4099 4114 528924
CCCTCATACGAGGGCA e-e-e-d(10)-k-k-k 2 1232 4100 4115 528925
ACCCTCATACGAGGGC e-e-e-d(10)-k-k-k 0 1233 4225 4240 528926
TACGCACAGGAGAGGC e-e-e-d(10)-k-k-k 20 1233 4226 4241 528927
ATACGCACAGGAGAGG e-e-e-d(10)-k-k-k 0 1234 4227 4242 528928
CATACGCACAGGAGAG e-e-e-d(10)-k-k-k 6 1235 4228 4243 528929
CCATACGCACAGGAGA e-e-e-d(10)-k-k-k 4 1236 4229 4244 528930
CCCATACGCACAGGAG e-e-e-d(10)-k-k-k 36 1237 4230 4245 528931
TCCCATACGCACAGGA e-e-e-d(10)-k-k-k 22 1238 4231 4246 528932
TTCCCATACGCACAGG e-e-e-d(10)-k-k-k 32 1239 4232 4247 528933
GTTCCCATACGCACAG e-e-e-d(10)-k-k-k 45 1240 4233 4248 528934
TGTTCCCATACGCACA e-e-e-d(10)-k-k-k 36 1241 4234 4249 528935
GTGTTCCCATACGCAC e-e-e-d(10)-k-k-k 20 1242 4234 4249 530395
GTGTTCCCATACGCAC k-d(10)-k-e-k-e-e 71 1242 4235 4250 528936
GGTGTTCCCATACGCA e-e-e-d(10)-k-k-k 71 1243 4235 4251 530025
AGGTGTTCCCATACGCA e-e-k-d(10)-k-e-k-e 90 1244 4235 4250 530345
GGTGTTCCCATACGCA e-k-d(10)-k-e-k-e 93 1243 4235 4250 530396
GGTGTTCCCATACGCA k-d(10)-k-e-k-e-e 71 1243 4236 4251 528937
AGGTGTTCCCATACGC e-e-e-d(10)-k-k-k 73 1245 4236 4252 530026
TAGGTGTTCCCATACGC e-e-k-d(10)-k-e-k-e 87 1246 4236 4251 530093
AGGTGTTCCCATACGC e-k-k-d(10)-k-k-e 95 1245 4236 4251 530140
AGGTGTTCCCATACGC e-e-k-d(10)-k-k-e 89 1245 4236 4251 530190
AGGTGTTCCCATACGC e-d-k-d(10)-k-k-e 82 1245 4236 4251 530240
AGGTGTTCCCATACGC e-d-d-k-d(9)-k-k-e 50 1245 4236 4251 530290
AGGTGTTCCCATACGC e-e-e-e-d(9)-k-k-e 69 1245 4236 4251 530346
AGGTGTTCCCATACGC e-k-d(10)-k-e-k-e 89 1245 4237 4252 528938
TAGGTGTTCCCATACG e-e-e-d(10)-k-k-k 72 336 4237 4252 530094
TAGGTGTTCCCATACG e-k-k-d(10)-k-k-e 88 336 4237 4252 530141
TAGGTGTTCCCATACG e-e-k-d(10)-k-k-e 80 336 4237 4252 530191
TAGGTGTTCCCATACG e-d-k-d(10)-k-k-e 74 336 4237 4252 530241
TAGGTGTTCCCATACG e-d-d-k-d(9)-k-k-e 53 336 4237 4252 530291
TAGGTGTTCCCATACG e-e-e-e-d(9)-k-k-e 68 336 4238 4253 528939
CTAGGTGTTCCCATAC e-e-e-d(10)-k-k-k 39 1247 4239 4254 528940
GCTAGGTGTTCCCATA e-e-e-d(10)-k-k-k 62 1248 4240 4255 528941
TGCTAGGTGTTCCCAT e-e-e-d(10)-k-k-k 49 1249 4242 4257 528942
CGTGCTAGGTGTTCCC e-e-e-d(10)-k-k-k 77 1250 4304 4319 528943
CAAGGTGGTTTTGAGT e-e-e-d(10)-k-k-k 25 1251 4305 4320 528944
GCAAGGTGGTTTTGAG e-e-e-d(10)-k-k-k 28 344 4320 4335 528945
CTCTGATCAGCTGAGG e-e-e-d(10)-k-k-k 74 1252 4321 4336 528946
ACTCTGATCAGCTGAG e-e-e-d(10)-k-k-k 56 1253 4362 4377 528947
GAGACCAGCTAATTTG e-e-e-d(10)-k-k-k 36 1254 4395 4410 528948
CATCTTAGAGAAGGTC e-e-e-d(10)-k-k-k 59 1255 4435 4450 528949
TCAACTGTCTCCAGGC e-e-e-d(10)-k-k-k 67 1256 4435 4450 530397
TCAACTGTCTCCAGGC k-d(10)-k-e-k-e-e 60 1256 4436 4451 528950
ATCAACTGTCTCCAGG e-e-e-d(10)-k-k-k 57 1257 4436 4452 530027
CATCAACTGTCTCCAGG e-e-k-d(10)-k-e-k-e 56 1258 4436 4451 530347
ATCAACTGTCTCCAGG e-k-d(10)-k-e-k-e 49 1257 4437 4452 530095
CATCAACTGTCTCCAG e-k-k-d(10)-k-k-e 40 354 4437 4452 530142
CATCAACTGTCTCCAG e-e-k-d(10)-k-k-e 43 354 4437 4452 530192
CATCAACTGTCTCCAG e-d-k-d(10)-k-k-e 42 354 4437 4452 530242
CATCAACTGTCTCCAG e-d-d-k-d(9)-k-k-e 0 354 4437 4452 530292
CATCAACTGTCTCCAG e-e-e-e-d(9)-k-k-e 36 354 4437 4452 530398
CATCAACTGTCTCCAG k-d(10)-k-e-k-e-e 28 354 4438 4454 530028
CACATCAACTGTCTCCA e-e-k-d(10)-k-e-k-e 57 1259 4438 4453 530348
ACATCAACTGTCTCCA e-k-d(10)-k-e-k-e 58 1260 4439 4454 530096
CACATCAACTGTCTCC e-k-k-d(10)-k-k-e 72 356 4439 4454 530143
CACATCAACTGTCTCC e-e-k-d(10)-k-k-e 74 356 4439 4454 530193
CACATCAACTGTCTCC e-d-k-d(10)-k-k-e 62 356 4439 4454 530243
CACATCAACTGTCTCC e-d-d-k-d(9)-k-k-e 34 356 4439 4454 530293
CACATCAACTGTCTCC e-e-e-e-d(9)-k-k-e 59 356 4441 4456 528951
GACACATCAACTGTCT e-e-e-d(10)-k-k-k 16 1261 4475 4490 528952
GAAGAGTGTTGCTGGA e-e-e-d(10)-k-k-k 57 1262 4477 4492 528953
CTGAAGAGTGTTGCTG e-e-e-d(10)-k-k-k 46 1263 4479 4494 528954
TACTGAAGAGTGTTGC e-e-e-d(10)-k-k-k 42 1264 4485 4500 530510
ATTATGTACTGAAGAG k-d(10)-k-e-k-e-e 53 1265 4486 4501 530504
TATTATGTACTGAAGA e-k-d(10)-k-e-k-e 25 1266 4486 4501 530511
TATTATGTACTGAAGA k-d(10)-k-e-k-e-e 31 1266 4487 4502 530432
TTATTATGTACTGAAG k-d(10)-k-e-k-e-e 15 1267 4487 4502 530463
TTATTATGTACTGAAG e-k-k-d(10)-k-k-e 20 1267 4487 4502 530472
TTATTATGTACTGAAG e-e-k-d(10)-k-k-e 17 1267 4487 4502 530480
TTATTATGTACTGAAG e-d-k-d(10)-k-k-e 4 1267 4487 4502 530488
TTATTATGTACTGAAG e-d-d-k-d(9)-k-k-e 13 1267 4487 4502 530496
TTATTATGTACTGAAG e-e-e-e-d(9)-k-k-e 0 1267 4487 4502 530505
TTATTATGTACTGAAG e-k-d(10)-k-e-k-e 37 1267 4488 4504 530063
GCTTATTATGTACTGAA e-e-k-d(10)-k-e-k-e 74 1268 4488 4503 530382
CTTATTATGTACTGAA e-k-d(10)-k-e-k-e 17 1269 4488 4503 530465
CTTATTATGTACTGAA e-k-k-d(10)-k-k-e 63 1269 4488 4503 530473
CTTATTATGTACTGAA e-e-k-d(10)-k-k-e 45 1269 4488 4503 530481
CTTATTATGTACTGAA e-d-k-d(10)-k-k-e 14 1269 4488 4503 530489
CTTATTATGTACTGAA e-d-d-k-d(9)-k-k-e 13 1269 4488 4503 530497
CTTATTATGTACTGAA e-e-e-e-d(9)-k-k-e 7 1269 4488 4503 530512
CTTATTATGTACTGAA k-d(10)-k-e-k-e-e 21 1269 4489 4504 519638
GCTTATTATGTACTGA e-k-k-d(10)-k-k-e 86 362 4489 4504 530177
GCTTATTATGTACTGA e-e-k-d(10)-k-k-e 71 362 4489 4504 530227
GCTTATTATGTACTGA e-d-k-d(10)-k-k-e 51 362
4489 4504 530277 GCTTATTATGTACTGA e-d-d-k-d(9)-k-k-e 70 362 4489
4504 530327 GCTTATTATGTACTGA e-e-e-e-d(9)-k-k-e 61 362 4490 4505
530466 AGCTTATTATGTACTG e-k-k-d(10)-k-k-e 82 1270 4490 4505 530474
AGCTTATTATGTACTG e-e-k-d(10)-k-k-e 62 1270 4490 4505 530482
AGCTTATTATGTACTG e-d-k-d(10)-k-k-e 53 1270 4490 4505 530490
AGCTTATTATGTACTG e-d-d-k-d(9)-k-k-e 42 1270 4490 4505 530498
AGCTTATTATGTACTG e-e-e-e-d(9)-k-k-e 45 1270 4490 4505 530506
AGCTTATTATGTACTG e-k-d(10)-k-e-k-e 70 1270 4491 4506 530467
AAGCTTATTATGTACT e-k-k-d(10)-k-k-e 50 1271 4491 4506 530475
AAGCTTATTATGTACT e-e-k-d(10)-k-k-e 26 1271 4491 4506 530483
AAGCTTATTATGTACT e-d-k-d(10)-k-k-e 19 1271 4491 4506 530491
AAGCTTATTATGTACT e-d-d-k-d(9)-k-k-e 13 1271 4491 4506 530499
AAGCTTATTATGTACT e-e-e-e-d(9)-k-k-e 15 1271 4492 4507 528955
TAAGCTTATTATGTAC e-e-e-d(10)-k-k-k 0 1272 4499 4514 528956
TATCAGTTAAGCTTAT e-e-e-d(10)-k-k-k 0 1273 4502 4517 528957
GTTTATCAGTTAAGCT e-e-e-d(10)-k-k-k 31 1274 4539 4554 530433
CAATGGTAAGCCCAAG k-d(10)-k-e-k-e-e 62 1275 4540 4555 528958
CCAATGGTAAGCCCAA e-e-e-d(10)-k-k-k 66 1276 4540 4556 530056
CCCAATGGTAAGCCCAA e-e-k-d(10)-k-e-k-e 73 1277 4540 4555 530383
CCAATGGTAAGCCCAA e-k-d(10)-k-e-k-e 64 1276 4541 4556 518345
CCCAATGGTAAGCCCA e-e-e-d(10)-k-k-k 80 366 4541 4556 519636
CCCAATGGTAAGCCCA e-k-k-d(10)-k-k-e 90 366 4541 4556 530178
CCCAATGGTAAGCCCA e-e-k-d(10)-k-k-e 86 366 4541 4556 530228
CCCAATGGTAAGCCCA e-d-k-d(10)-k-k-e 77 366 4541 4556 530278
CCCAATGGTAAGCCCA e-d-d-k-d(9)-k-k-e 86 366 4541 4556 530328
CCCAATGGTAAGCCCA e-e-e-e-d(9)-k-k-e 80 366 4542 4557 528959
ACCCAATGGTAAGCCC e-e-e-d(10)-k-k-k 73 1277 4544 4559 528960
AAACCCAATGGTAAGC e-e-e-d(10)-k-k-k 43 1278 4545 4560 528961
TAAACCCAATGGTAAG e-e-e-d(10)-k-k-k 18 1279 4546 4561 528962
TTAAACCCAATGGTAA e-e-e-d(10)-k-k-k 13 1280 4547 4562 528963
TTTAAACCCAATGGTA e-e-e-d(10)-k-k-k 2 1281 4554 4569 528964
CCTATGATTTAAACCC e-e-e-d(10)-k-k-k 17 1282 4558 4573 528965
GGTCCCTATGATTTAA e-e-e-d(10)-k-k-k 31 1283 4559 4574 528966
AGGTCCCTATGATTTA e-e-e-d(10)-k-k-k 22 1284 4615 4630 528967
CCTAAGGCCATGAACT e-e-e-d(10)-k-k-k 19 374 4616 4631 528968
ACCTAAGGCCATGAAC e-e-e-d(10)-k-k-k 25 1285 4617 4632 528969
TACCTAAGGCCATGAA e-e-e-d(10)-k-k-k 41 1286 4618 4633 528970
CTACCTAAGGCCATGA e-e-e-d(10)-k-k-k 55 1287 4619 4634 528971
GCTACCTAAGGCCATG e-e-e-d(10)-k-k-k 66 1288 4620 4635 528972
TGCTACCTAAGGCCAT e-e-e-d(10)-k-k-k 56 1289 4621 4636 528973
ATGCTACCTAAGGCCA e-e-e-d(10)-k-k-k 71 1290 4622 4637 528974
CATGCTACCTAAGGCC e-e-e-d(10)-k-k-k 58 1291 4623 4638 528975
ACATGCTACCTAAGGC e-e-e-d(10)-k-k-k 34 1292 4636 4651 528976
GTTAAGACCAGATACA e-e-e-d(10)-k-k-k 45 1293 4637 4652 528977
AGTTAAGACCAGATAC e-e-e-d(10)-k-k-k 40 1294 4638 4653 528978
GAGTTAAGACCAGATA e-e-e-d(10)-k-k-k 40 1295 4639 4654 528979
AGAGTTAAGACCAGAT e-e-e-d(10)-k-k-k 62 1296 4644 4659 530399
CAATCAGAGTTAAGAC k-d(10)-k-e-k-e-e 36 1297 4645 4661 530029
TACAATCAGAGTTAAGA e-e-k-d(10)-k-e-k-e 29 1298 4645 4660 530349
ACAATCAGAGTTAAGA e-k-d(10)-k-e-k-e 33 1299 4646 4661 528980
TACAATCAGAGTTAAG e-e-e-d(10)-k-k-k 0 378 4646 4661 530097
TACAATCAGAGTTAAG e-k-k-d(10)-k-k-e 41 378 4646 4661 530144
TACAATCAGAGTTAAG e-e-k-d(10)-k-k-e 16 378 4646 4661 530194
TACAATCAGAGTTAAG e-d-k-d(10)-k-k-e 28 378 4646 4661 530244
TACAATCAGAGTTAAG e-d-d-k-d(9)-k-k-e 0 378 4646 4661 530294
TACAATCAGAGTTAAG e-e-e-e-d(9)-k-k-e 7 378 4648 4663 528981
GCTACAATCAGAGTTA e-e-e-d(10)-k-k-k 52 1300 4649 4664 528982
TGCTACAATCAGAGTT e-e-e-d(10)-k-k-k 47 1301 4650 4665 528983
TTGCTACAATCAGAGT e-e-e-d(10)-k-k-k 44 1302 4662 4677 530400
CTCTCAGAACTTTTGC k-d(10)-k-e-k-e-e 65 1303 4663 4679 530030
TCCTCTCAGAACTTTTG e-e-k-d(10)-k-e-k-e 47 1304 4663 4678 530350
CCTCTCAGAACTTTTG e-k-d(10)-k-e-k-e 54 1305 4664 4679 530098
TCCTCTCAGAACTTTT e-k-k-d(10)-k-k-e 42 380 4664 4679 530145
TCCTCTCAGAACTTTT e-e-k-d(10)-k-k-e 38 380 4664 4679 530195
TCCTCTCAGAACTTTT e-d-k-d(10)-k-k-e 43 380 4664 4679 530245
TCCTCTCAGAACTTTT e-d-d-k-d(9)-k-k-e 28 380 4664 4679 530295
TCCTCTCAGAACTTTT e-e-e-e-d(9)-k-k-e 39 380 4770 4785 528984
CCCACGGGATTCCCTC e-e-e-d(10)-k-k-k 39 1306 4771 4786 528985
ACCCACGGGATTCCCT e-e-e-d(10)-k-k-k 36 1307 4772 4787 528986
AACCCACGGGATTCCC e-e-e-d(10)-k-k-k 47 1308 4773 4788 528987
CAACCCACGGGATTCC e-e-e-d(10)-k-k-k 39 1309 4774 4789 528988
GCAACCCACGGGATTC e-e-e-d(10)-k-k-k 48 1310 4775 4790 528989
AGCAACCCACGGGATT e-e-e-d(10)-k-k-k 40 1311 4777 4792 528990
TAAGCAACCCACGGGA e-e-e-d(10)-k-k-k 27 1312 4778 4793 528991
GTAAGCAACCCACGGG e-e-e-d(10)-k-k-k 47 1313 4779 4794 528992
GGTAAGCAACCCACGG e-e-e-d(10)-k-k-k 42 1314 4780 4795 528993
AGGTAAGCAACCCACG e-e-e-d(10)-k-k-k 54 1315 4780 4795 530434
AGGTAAGCAACCCACG k-d(10)-k-e-k-e-e 51 1315 4781 4796 528994
TAGGTAAGCAACCCAC e-e-e-d(10)-k-k-k 53 1316 4781 4797 530064
GTAGGTAAGCAACCCAC e-e-k-d(10)-k-e-k-e 53 1317 4781 4796 530384
TAGGTAAGCAACCCAC e-k-d(10)-k-e-k-e 48 1316 4782 4797 528995
GTAGGTAAGCAACCCA e-e-e-d(10)-k-k-k 64 388 4782 4797 530129
GTAGGTAAGCAACCCA e-k-k-d(10)-k-k-e 79 388 4782 4797 530179
GTAGGTAAGCAACCCA e-e-k-d(10)-k-k-e 74 388 4782 4797 530229
GTAGGTAAGCAACCCA e-d-k-d(10)-k-k-e 64 388 4782 4797 530279
GTAGGTAAGCAACCCA e-d-d-k-d(9)-k-k-e 55 388 4782 4797 530329
GTAGGTAAGCAACCCA e-e-e-e-d(9)-k-k-e 61 388 4784 4799 528996
AGGTAGGTAAGCAACC e-e-e-d(10)-k-k-k 21 1318 4788 4803 528997
TTATAGGTAGGTAAGC e-e-e-d(10)-k-k-k 10 1319 4792 4807 528998
CACCTTATAGGTAGGT e-e-e-d(10)-k-k-k 22 1320 4794 4809 528999
ACCACCTTATAGGTAG e-e-e-d(10)-k-k-k 15 1321 4797 4812 529000
TAAACCACCTTATAGG e-e-e-d(10)-k-k-k 0 1322 4798 4813 529001
ATAAACCACCTTATAG e-e-e-d(10)-k-k-k 7 1323 4810 4825 529002
GGACAGCAGCTTATAA e-e-e-d(10)-k-k-k 12 1324 4811 4826 529003
AGGACAGCAGCTTATA e-e-e-d(10)-k-k-k 40 1325 4811 4826 530401
AGGACAGCAGCTTATA k-d(10)-k-e-k-e-e 41 1325 4812 4827 529004
CAGGACAGCAGCTTAT e-e-e-d(10)-k-k-k 38 1326 4812 4828 530031
CCAGGACAGCAGCTTAT e-e-k-d(10)-k-e-k-e 58 1327 4812 4827 530351
CAGGACAGCAGCTTAT e-k-d(10)-k-e-k-e 58 1326 4812 4827 530402
CAGGACAGCAGCTTAT k-d(10)-k-e-k-e-e 60 1326 4813 4829 530032
GCCAGGACAGCAGCTTA e-e-k-d(10)-k-e-k-e 74 1328 4813 4828 530099
CCAGGACAGCAGCTTA e-k-k-d(10)-k-k-e 73 1329 4813 4828 530146
CCAGGACAGCAGCTTA e-e-k-d(10)-k-k-e 70 1329 4813 4828 530196
CCAGGACAGCAGCTTA e-d-k-d(10)-k-k-e 67 1329 4813 4828 530246
CCAGGACAGCAGCTTA e-d-d-k-d(9)-k-k-e 39 1329 4813 4828 530296
CCAGGACAGCAGCTTA e-e-e-e-d(9)-k-k-e 67 1329 4813 4828 530352
CCAGGACAGCAGCTTA e-k-d(10)-k-e-k-e 67 1329 4814 4829 530100
GCCAGGACAGCAGCTT e-k-k-d(10)-k-k-e 77 1330 4814 4829 530147
GCCAGGACAGCAGCTT e-e-k-d(10)-k-k-e 84 1330 4814 4829 530197
GCCAGGACAGCAGCTT e-d-k-d(10)-k-k-e 71 1330 4814 4829 530247
GCCAGGACAGCAGCTT e-d-d-k-d(9)-k-k-e 53 1330 4814 4829 530297
GCCAGGACAGCAGCTT e-e-e-e-d(9)-k-k-e 75 1330 4814 4829 530403
GCCAGGACAGCAGCTT k-d(10)-k-e-k-e-e 77 1330 4815 4831 530033
TGGCCAGGACAGCAGCT e-e-k-d(10)-k-e-k-e 65 1331 4815 4830 530353
GGCCAGGACAGCAGCT e-k-d(10)-k-e-k-e 83 1332 4816 4831 530101
TGGCCAGGACAGCAGC e-k-k-d(10)-k-k-e 59 1333 4816 4831 530148
TGGCCAGGACAGCAGC e-e-k-d(10)-k-k-e 79 1333 4816 4831 530198
TGGCCAGGACAGCAGC e-d-k-d(10)-k-k-e 54 1333 4816 4831 530248
TGGCCAGGACAGCAGC e-d-d-k-d(9)-k-k-e 32 1333 4816 4831 530298
TGGCCAGGACAGCAGC e-e-e-e-d(9)-k-k-e 73 1333 4827 4842 530404
TTTGAATGCAGTGGCC k-d(10)-k-e-k-e-e 67 1334 4828 4844 530034
AATTTGAATGCAGTGGC e-e-k-d(10)-k-e-k-e 69 1335 4828 4843 530354
ATTTGAATGCAGTGGC e-k-d(10)-k-e-k-e 85 1336 4828 4843 530405
ATTTGAATGCAGTGGC k-d(10)-k-e-k-e-e 55 1336 4829 4845 530035
GAATTTGAATGCAGTGG e-e-k-d(10)-k-e-k-e 69 1337
4829 4844 530102 AATTTGAATGCAGTGG e-k-k-d(10)-k-k-e 71 1338 4829
4844 530149 AATTTGAATGCAGTGG e-e-k-d(10)-k-k-e 70 1338 4829 4844
530199 AATTTGAATGCAGTGG e-d-k-d(10)-k-k-e 58 1338 4829 4844 530249
AATTTGAATGCAGTGG e-d-d-k-d(9)-k-k-e 47 1338 4829 4844 530299
AATTTGAATGCAGTGG e-e-e-e-d(9)-k-k-e 47 1338 4829 4844 530355
AATTTGAATGCAGTGG e-k-d(10)-k-e-k-e 72 1338 4830 4845 530103
GAATTTGAATGCAGTG e-k-k-d(10)-k-k-e 77 390 4830 4845 530150
GAATTTGAATGCAGTG e-e-k-d(10)-k-k-e 73 390 4830 4845 530200
GAATTTGAATGCAGTG e-d-k-d(10)-k-k-e 63 390 4830 4845 530250
GAATTTGAATGCAGTG e-d-d-k-d(9)-k-k-e 59 390 4830 4845 530300
GAATTTGAATGCAGTG e-e-e-e-d(9)-k-k-e 65 390 4842 4857 530435
AAGTACACATTGGAAT k-d(10)-k-e-k-e-e 62 1339 4843 4859 530057
TGAAGTACACATTGGAA e-e-k-d(10)-k-e-k-e 69 1340 4843 4858 530385
GAAGTACACATTGGAA e-k-d(10)-k-e-k-e 70 1341 4844 4859 529005
TGAAGTACACATTGGA e-e-e-d(10)-k-k-k 64 392 4844 4859 530130
TGAAGTACACATTGGA e-k-k-d(10)-k-k-e 85 392 4844 4859 530180
TGAAGTACACATTGGA e-e-k-d(10)-k-k-e 82 392 4844 4859 530230
TGAAGTACACATTGGA e-d-k-d(10)-k-k-e 65 392 4844 4859 530280
TGAAGTACACATTGGA e-d-d-k-d(9)-k-k-e 75 392 4844 4859 530330
TGAAGTACACATTGGA e-e-e-e-d(9)-k-k-e 52 392 4852 4867 529006
TTACACTATGAAGTAC e-e-e-d(10)-k-k-k 16 1342 4929 4944 529007
AGTTAAAGTAGATACA e-e-e-d(10)-k-k-k 0 1343 4934 4949 529008
CTGGAAGTTAAAGTAG e-e-e-d(10)-k-k-k 30 397 4943 4958 529009
CGTTTATTTCTGGAAG e-e-e-d(10)-k-k-k 52 1344 4957 4972 529010
CGGTTCCTATATAACG e-e-e-d(10)-k-k-k 21 1345 4958 4973 529011
ACGGTTCCTATATAAC e-e-e-d(10)-k-k-k 10 1346
TABLE-US-00014 TABLE 14 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Human
Human SEQ Start Stop ISIS % inhi- ID Site Site No Sequence
Chemistry bition NO 1359 1374 529012 GTCATCCCGAAGAGTC
e-e-e-d(10)-k-k-k 34 1347 1386 1401 529013 CCCGAGTCCCTTCCGA
e-e-e-d(10)-k-k-k 18 1348 1390 1405 529014 GCGCCCCGAGTCCCTT
e-e-e-d(10)-k-k-k 53 1349 1412 1427 529015 CGAAGAACGAAACTTC
e-e-e-d(10)-k-k-k 8 1350 1418 1433 529016 TTTCTCCGAAGAACGA
e-e-e-d(10)-k-k-k 31 1351 1461 1476 529017 CGAGTGCGCCCTCGCC
e-e-e-d(10)-k-k-k 52 1352 1548 1563 529018 GTGACAGTCGCTCCGG
e-e-e-d(10)-k-k-k 30 1353 1549 1564 529019 CGTGACAGTCGCTCCG
e-e-e-d(10)-k-k-k 31 1354 1590 1605 529020 GCGCTTTCCGACCCCC
e-e-e-d(10)-k-k-k 45 1355 1790 1805 529021 GTACCGGTCTGTCAAT
e-e-e-d(10)-k-k-k 23 1356 1794 1809 529022 AAGAGTACCGGTCTGT
e-e-e-d(10)-k-k-k 69 1357 1796 1811 529023 GAAAGAGTACCGGTCT
e-e-e-d(10)-k-k-k 72 1358 1906 1921 529024 CTGGCTTGACGGGTTG
e-e-e-d(10)-k-k-k 64 1359 1907 1922 529025 GCTGGCTTGACGGGTT
e-e-e-d(10)-k-k-k 73 1360 1966 1981 529026 CCGACTTTACCAGGTA
e-e-e-d(10)-k-k-k 78 1361 1968 1983 529027 GGCCGACTTTACCAGG
e-e-e-d(10)-k-k-k 92 1362 1972 1987 529028 TTCTGGCCGACTTTAC
e-e-e-d(10)-k-k-k 13 1363 2031 2046 529029 CGTCCTATGCAATTAA
e-e-e-d(10)-k-k-k 24 1364 2039 2054 529030 GTTCATTCCGTCCTAT
e-e-e-d(10)-k-k-k 41 1365 2198 2213 529031 GACGGTTTGAATCTTG
e-e-e-d(10)-k-k-k 40 1366 2201 2216 529032 GGCGACGGTTTGAATC
e-e-e-d(10)-k-k-k 37 1367 2204 2219 529033 TTGGGCGACGGTTTGA
e-e-e-d(10)-k-k-k 31 1368 2207 2222 529034 AACTTGGGCGACGGTT
e-e-e-d(10)-k-k-k 54 1369 2253 2268 529035 CGACCTGATATGGCAC
e-e-e-d(10)-k-k-k 56 1370 2255 2270 529036 AACGACCTGATATGGC
e-e-e-d(10)-k-k-k 52 1371 2257 2272 529037 ACAACGACCTGATATG
e-e-e-d(10)-k-k-k 24 1372 2338 2353 530406 ATACAGTAAGACCAGC
k-d(10)-k-e-k-e-e 65 1373 2339 2355 530036 ACATACAGTAAGACCAG
e-e-k-d(10)-k-e-k-e 58 1374 2339 2354 530356 CATACAGTAAGACCAG
e-k-d(10)-k-e-k-e 65 1375 2340 2355 530104 ACATACAGTAAGACCA
e-k-k-d(10)-k-k-e 67 1376 2340 2355 530151 ACATACAGTAAGACCA
e-e-k-d(10)-k-k-e 64 1376 2340 2355 530201 ACATACAGTAAGACCA
e-d-k-d(10)-k-k-e 42 1376 2340 2355 530251 ACATACAGTAAGACCA
e-d-d-k-d(9)-k-k-e 58 1376 2340 2355 530301 ACATACAGTAAGACCA
e-e-e-e-d(9)-k-k-e 56 1376 2383 2398 530407 AAAATTTACAACCCAT
k-d(10)-k-e-k-e-e 9 1377 2384 2400 530037 CAAAAATTTACAACCCA
e-e-k-d(10)-k-e-k-e 42 1378 2384 2399 530357 AAAAATTTACAACCCA
e-k-d(10)-k-e-k-e 34 1379 2385 2400 530105 CAAAAATTTACAACCC
e-k-k-d(10)-k-k-e 40 1380 2385 2400 530152 CAAAAATTTACAACCC
e-e-k-d(10)-k-k-e 33 1380 2385 2400 530202 CAAAAATTTACAACCC
e-d-k-d(10)-k-k-e 10 1380 2385 2400 530252 CAAAAATTTACAACCC
e-d-d-k-d(9)-k-k-e 29 1380 2385 2400 530302 CAAAAATTTACAACCC
e-e-e-e-d(9)-k-k-e 14 1380 2408 2423 530408 AATGCTTTATCAGCAC
k-d(10)-k-e-k-e-e 36 1381 2409 2425 530038 CCAATGCTTTATCAGCA
e-e-k-d(10)-k-e-k-e 71 1382 2409 2424 530358 CAATGCTTTATCAGCA
e-k-d(10)-k-e-k-e 46 1383 2410 2425 530106 CCAATGCTTTATCAGC
e-k-k-d(10)-k-k-e 70 1384 2410 2425 530153 CCAATGCTTTATCAGC
e-e-k-d(10)-k-k-e 50 1384 2410 2425 530203 CCAATGCTTTATCAGC
e-d-k-d(10)-k-k-e 43 1384 2410 2425 530253 CCAATGCTTTATCAGC
e-d-d-k-d(9)-k-k-e 33 1384 2410 2425 530303 CCAATGCTTTATCAGC
e-e-e-e-d(9)-k-k-e 40 1384 2669 2684 530409 ACTAAAATCAAGGCTC
k-d(10)-k-e-k-e-e 42 1385 2670 2686 530039 AGACTAAAATCAAGGCT
e-e-k-d(10)-k-e-k-e 73 1386 2670 2685 530359 GACTAAAATCAAGGCT
e-k-d(10)-k-e-k-e 82 1387 2671 2686 530107 AGACTAAAATCAAGGC
e-k-k-d(10)-k-k-e 77 1388 2671 2686 530154 AGACTAAAATCAAGGC
e-e-k-d(10)-k-k-e 57 1388 2671 2686 530204 AGACTAAAATCAAGGC
e-d-k-d(10)-k-k-e 28 1388 2671 2686 530254 AGACTAAAATCAAGGC
e-d-d-k-d(9)-k-k-e 3 1388 2671 2686 530304 AGACTAAAATCAAGGC
e-e-e-e-d(9)-k-k-e 22 1388 2703 2718 530429 AATGGTTCTTTGTGAT
k-d(10)-k-e-k-e-e 60 1389 2704 2720 530065 CTAATGGTTCTTTGTGA
e-e-k-d(10)-k-e-k-e 70 1390 2704 2719 530379 TAATGGTTCTTTGTGA
e-k-d(10)-k-e-k-e 54 1391 2705 2720 530127 CTAATGGTTCTTTGTG
e-k-k-d(10)-k-k-e 80 411 2705 2720 530174 CTAATGGTTCTTTGTG
e-e-k-d(10)-k-k-e 69 411 2705 2720 530224 CTAATGGTTCTTTGTG
e-d-k-d(10)-k-k-e 32 411 2705 2720 530274 CTAATGGTTCTTTGTG
e-d-d-k-d(9)-k-k-e 38 411 2705 2720 530324 CTAATGGTTCTTTGTG
e-e-e-e-d(9)-k-k-e 32 411 5000 5015 530410 CTGAAATTCCTTGGTC
k-d(10)-k-e-k-e-e 53 1392 5001 5017 530040 AACTGAAATTCCTTGGT
e-e-k-d(10)-k-e-k-e 67 1393 5001 5016 530360 ACTGAAATTCCTTGGT
e-k-d(10)-k-e-k-e 70 1394 5002 5017 530108 AACTGAAATTCCTTGG
e-k-k-d(10)-k-k-e 70 1395 5002 5017 530155 AACTGAAATTCCTTGG
e-e-k-d(10)-k-k-e 53 1395 5002 5017 530205 AACTGAAATTCCTTGG
e-d-k-d(10)-k-k-e 44 1395 5002 5017 530255 AACTGAAATTCCTTGG
e-d-d-k-d(9)-k-k-e 33 1395 5002 5017 530305 AACTGAAATTCCTTGG
e-e-e-e-d(9)-k-k-e 22 1395 5699 5714 530411 ACTCTTTCAGTGGTTT
k-d(10)-k-e-k-e-e 91 1396 5700 5716 530041 GTACTCTTTCAGTGGTT
e-e-k-d(10)-k-e-k-e 89 1397 5700 5715 530361 TACTCTTTCAGTGGTT
e-k-d(10)-k-e-k-e 88 1398 5701 5716 530109 GTACTCTTTCAGTGGT
e-k-k-d(10)-k-k-e 89 1399 5701 5716 530156 GTACTCTTTCAGTGGT
e-e-k-d(10)-k-k-e 91 1399 5701 5716 530206 GTACTCTTTCAGTGGT
e-d-k-d(10)-k-k-e 89 1399 5701 5716 530256 GTACTCTTTCAGTGGT
e-d-d-k-d(9)-k-k-e 33 1399 5701 5716 530306 GTACTCTTTCAGTGGT
e-e-e-e-d(9)-k-k-e 83 1399 5883 5898 529038 CTACACTTTACGCTTA
e-e-e-d(10)-k-k-k 9 1400 6474 6489 530436 AATTCATTCTTCCATA
k-d(10)-k-e-k-e-e 49 1401 6475 6491 530066 GAAATTCATTCTTCCAT
e-e-k-d(10)-k-e-k-e 82 1402 6475 6490 530386 AAATTCATTCTTCCAT
e-k-d(10)-k-e-k-e 53 1403 6476 6491 530131 GAAATTCATTCTTCCA
e-k-k-d(10)-k-k-e 97 413 6476 6491 530181 GAAATTCATTCTTCCA
e-e-k-d(10)-k-k-e 82 413 6476 6491 530231 GAAATTCATTCTTCCA
e-d-k-d(10)-k-k-e 75 413 6476 6491 530281 GAAATTCATTCTTCCA
e-d-d-k-d(9)-k-k-e 69 413 6476 6491 530331 GAAATTCATTCTTCCA
e-e-e-e-d(9)-k-k-e 53 413 6846 6861 529039 TTAAAGAGTTGCGGTA
e-e-e-d(10)-k-k-k 31 1404 6847 6862 529040 ATTAAAGAGTTGCGGT
e-e-e-d(10)-k-k-k 34 1405 8078 8093 530412 AGATTTACCTTCCTTA
k-d(10)-k-e-k-e-e 50 1406 8079 8095 530042 GCAGATTTACCTTCCTT
e-e-k-d(10)-k-e-k-e 78 1407 8079 8094 530362 CAGATTTACCTTCCTT
e-k-d(10)-k-e-k-e 76 1408 8080 8095 530110 GCAGATTTACCTTCCT
e-k-k-d(10)-k-k-e 84 1409 8080 8095 530157 GCAGATTTACCTTCCT
e-e-k-d(10)-k-k-e 69 1409 8080 8095 530207 GCAGATTTACCTTCCT
e-d-k-d(10)-k-k-e 55 1409 8080 8095 530257 GCAGATTTACCTTCCT
e-d-d-k-d(9)-k-k-e 39 1409 8080 8095 530307 GCAGATTTACCTTCCT
e-e-e-e-d(9)-k-k-e 77 1409 9123 9138 530413 GCCCCTATGTATAAGC
k-d(10)-k-e-k-e-e 73 1410 9124 9140 530043 CTGCCCCTATGTATAAG
e-e-k-d(10)-k-e-k-e 42 1411 9124 9139 530363 TGCCCCTATGTATAAG
e-k-d(10)-k-e-k-e 25 1412 9125 9140 530111 CTGCCCCTATGTATAA
e-k-k-d(10)-k-k-e 35 1413 9125 9140 530158 CTGCCCCTATGTATAA
e-e-k-d(10)-k-k-e 36 1413 9125 9140 530208 CTGCCCCTATGTATAA
e-d-k-d(10)-k-k-e 14 1413 9125 9140 530258 CTGCCCCTATGTATAA
e-d-d-k-d(9)-k-k-e 5 1413 9125 9140 530308 CTGCCCCTATGTATAA
e-e-e-e-d(9)-k-k-e 25 1413 9862 9877 530414 TTCTTCCTGAGACACA
k-d(10)-k-e-k-e-e 61 1414 9863 9879 530044 GCTTCTTCCTGAGACAC
e-e-k-d(10)-k-e-k-e 78 1415 9863 9878 530364 CTTCTTCCTGAGACAC
e-k-d(10)-k-e-k-e 59 1416 9864 9879 530112 GCTTCTTCCTGAGACA
e-k-k-d(10)-k-k-e 84 1417 9864 9879 530159 GCTTCTTCCTGAGACA
e-e-k-d(10)-k-k-e 69 1417 9864 9879 530209 GCTTCTTCCTGAGACA
e-d-k-d(10)-k-k-e 54 1417 9864 9879 530259 GCTTCTTCCTGAGACA
e-d-d-k-d(9)-k-k-e 57 1417 9864 9879 530309 GCTTCTTCCTGAGACA
e-e-e-e-d(9)-k-k-e 46 1417 9864 9879 530415 GCTTCTTCCTGAGACA
k-d(10)-k-e-k-e-e 51 1417 9865 9881 530045 TGGCTTCTTCCTGAGAC
e-e-k-d(10)-k-e-k-e 73 1418 9865 9880 530365 GGCTTCTTCCTGAGAC
e-k-d(10)-k-e-k-e 78 1419 9866 9881 530113 TGGCTTCTTCCTGAGA
e-k-k-d(10)-k-k-e 60 1420
9866 9881 530160 TGGCTTCTTCCTGAGA e-e-k-d(10)-k-k-e 54 1420 9866
9881 530210 TGGCTTCTTCCTGAGA e-d-k-d(10)-k-k-e 28 1420 9866 9881
530260 TGGCTTCTTCCTGAGA e-d-d-k-d(9)-k-k-e 0 1420 9866 9881 530310
TGGCTTCTTCCTGAGA e-e-e-e-d(9)-k-k-e 26 1420 9873 9888 530416
CTCCTGTTGGCTTCTT k-d(10)-k-e-k-e-e 57 1421 9874 9890 530046
TCCTCCTGTTGGCTTCT e-e-k-d(10)-k-e-k-e 76 1422 9874 9889 530366
CCTCCTGTTGGCTTCT e-k-d(10)-k-e-k-e 75 1423 9874 9889 530417
CCTCCTGTTGGCTTCT k-d(10)-k-e-k-e-e 66 1423 9875 9891 530047
TTCCTCCTGTTGGCTTC e-e-k-d(10)-k-e-k-e 75 1424 9875 9890 530114
TCCTCCTGTTGGCTTC e-k-k-d(10)-k-k-e 80 1425 9875 9890 530161
TCCTCCTGTTGGCTTC e-e-k-d(10)-k-k-e 81 1425 9875 9890 530211
TCCTCCTGTTGGCTTC e-d-k-d(10)-k-k-e 73 1425 9875 9890 530261
TCCTCCTGTTGGCTTC e-d-d-k-d(9)-k-k-e 78 1425 9875 9890 530311
TCCTCCTGTTGGCTTC e-e-e-e-d(9)-k-k-e 82 1425 9875 9890 530367
TCCTCCTGTTGGCTTC e-k-d(10)-k-e-k-e 80 1425 9876 9891 530115
TTCCTCCTGTTGGCTT e-k-k-d(10)-k-k-e 74 1426 9876 9891 530162
TTCCTCCTGTTGGCTT e-e-k-d(10)-k-k-e 68 1426 9876 9891 530212
TTCCTCCTGTTGGCTT e-d-k-d(10)-k-k-e 58 1426 9876 9891 530262
TTCCTCCTGTTGGCTT e-d-d-k-d(9)-k-k-e 23 1426 9876 9891 530312
TTCCTCCTGTTGGCTT e-e-e-e-d(9)-k-k-e 52 1426 9876 9891 530418
TTCCTCCTGTTGGCTT k-d(10)-k-e-k-e-e 59 1426 9877 9893 530048
GGTTCCTCCTGTTGGCT e-e-k-d(10)-k-e-k-e 82 1427 9877 9892 530368
GTTCCTCCTGTTGGCT e-k-d(10)-k-e-k-e 85 1428 9878 9893 530116
GGTTCCTCCTGTTGGC e-k-k-d(10)-k-k-e 90 1429 9878 9893 530163
GGTTCCTCCTGTTGGC e-e-k-d(10)-k-k-e 79 1429 9878 9893 530213
GGTTCCTCCTGTTGGC e-d-k-d(10)-k-k-e 72 1429 9878 9893 530263
GGTTCCTCCTGTTGGC e-d-d-k-d(9)-k-k-e 73 1429 9878 9893 530313
GGTTCCTCCTGTTGGC e-e-e-e-d(9)-k-k-e 61 1429 9964 9979 529041
GTAATGTGCAGCAATC e-e-e-d(10)-k-k-k 53 1430 9991 10006 530711
ATGTGAGGGCACATTT e-e-e-d(10)-k-k-k 25 1431 10286 10301 529042
CCAAGCCGTTTATTTC e-e-e-d(10)-k-k-k 44 1432 10291 10306 529043
GGAAGCCAAGCCGTTT e-e-e-d(10)-k-k-k 39 1433 11261 11276 530413
GCCCCTATGTATAAGC k-d(10)-k-e-k-e-e 73 1410 11262 11278 530043
CTGCCCCTATGTATAAG e-e-k-d(10)-k-e-k-e 42 1411 11262 11277 530363
TGCCCCTATGTATAAG e-k-d(10)-k-e-k-e 25 1412 11263 11278 530111
CTGCCCCTATGTATAA e-k-k-d(10)-k-k-e 35 1413 11263 11278 530158
CTGCCCCTATGTATAA e-e-k-d(10)-k-k-e 36 1413 11263 11278 530208
CTGCCCCTATGTATAA e-d-k-d(10)-k-k-e 14 1413 11263 11278 530258
CTGCCCCTATGTATAA e-d-d-k-d(9)-k-k-e 5 1413 11263 11278 530308
CTGCCCCTATGTATAA e-e-e-e-d(9)-k-k-e 25 1413 12345 12360 530414
TTCTTCCTGAGACACA k-d(10)-k-e-k-e-e 61 1414 12346 12362 530044
GCTTCTTCCTGAGACAC e-e-k-d(10)-k-e-k-e 78 1415 12346 12361 530364
CTTCTTCCTGAGACAC e-k-d(10)-k-e-k-e 59 1416 12347 12362 530112
GCTTCTTCCTGAGACA e-k-k-d(10)-k-k-e 84 1417 12347 12362 530159
GCTTCTTCCTGAGACA e-e-k-d(10)-k-k-e 69 1417 12347 12362 530209
GCTTCTTCCTGAGACA e-d-k-d(10)-k-k-e 54 1417 12347 12362 530259
GCTTCTTCCTGAGACA e-d-d-k-d(9)-k-k-e 57 1417 12347 12362 530309
GCTTCTTCCTGAGACA e-e-e-e-d(9)-k-k-e 46 1417 12347 12362 530415
GCTTCTTCCTGAGACA k-d(10)-k-e-k-e-e 51 1417 12348 12364 530045
TGGCTTCTTCCTGAGAC e-e-k-d(10)-k-e-k-e 73 1418 12348 12363 530365
GGCTTCTTCCTGAGAC e-k-d(10)-k-e-k-e 78 1419 12349 12364 530113
TGGCTTCTTCCTGAGA e-k-k-d(10)-k-k-e 60 1420 12349 12364 530160
TGGCTTCTTCCTGAGA e-e-k-d(10)-k-k-e 54 1420 12349 12364 530210
TGGCTTCTTCCTGAGA e-d-k-d(10)-k-k-e 28 1420 12349 12364 530260
TGGCTTCTTCCTGAGA e-d-d-k-d(9)-k-k-e 0 1420 12349 12364 530310
TGGCTTCTTCCTGAGA e-e-e-e-d(9)-k-k-e 26 1420 12356 12371 530416
CTCCTGTTGGCTTCTT k-d(10)-k-e-k-e-e 57 1421 12357 12373 530046
TCCTCCTGTTGGCTTCT e-e-k-d(10)-k-e-k-e 76 1422 12357 12372 530366
CCTCCTGTTGGCTTCT e-k-d(10)-k-e-k-e 75 1423 12357 12372 530417
CCTCCTGTTGGCTTCT k-d(10)-k-e-k-e-e 66 1423 12358 12374 530047
TTCCTCCTGTTGGCTTC e-e-k-d(10)-k-e-k-e 75 1424 12358 12373 530114
TCCTCCTGTTGGCTTC e-k-k-d(10)-k-k-e 80 1425 12358 12373 530161
TCCTCCTGTTGGCTTC e-e-k-d(10)-k-k-e 81 1425 12358 12373 530211
TCCTCCTGTTGGCTTC e-d-k-d(10)-k-k-e 73 1425 12358 12373 530261
TCCTCCTGTTGGCTTC e-d-d-k-d(9)-k-k-e 78 1425 12358 12373 530311
TCCTCCTGTTGGCTTC e-e-e-e-d(9)-k-k-e 82 1425 12358 12373 530367
TCCTCCTGTTGGCTTC e-k-d(10)-k-e-k-e 80 1425 12359 12374 530115
TTCCTCCTGTTGGCTT e-k-k-d(10)-k-k-e 74 1426 12359 12374 530162
TTCCTCCTGTTGGCTT e-e-k-d(10)-k-k-e 68 1426 12359 12374 530212
TTCCTCCTGTTGGCTT e-d-k-d(10)-k-k-e 58 1426 12359 12374 530262
TTCCTCCTGTTGGCTT e-d-d-k-d(9)-k-k-e 23 1426 12359 12374 530312
TTCCTCCTGTTGGCTT e-e-e-e-d(9)-k-k-e 52 1426 12359 12374 530418
TTCCTCCTGTTGGCTT k-d(10)-k-e-k-e-e 59 1426 12360 12376 530048
GGTTCCTCCTGTTGGCT e-e-k-d(10)-k-e-k-e 82 1427 12360 12375 530368
GTTCCTCCTGTTGGCT e-k-d(10)-k-e-k-e 85 1428 12361 12376 530116
GGTTCCTCCTGTTGGC e-k-k-d(10)-k-k-e 90 1429 12361 12376 530163
GGTTCCTCCTGTTGGC e-e-k-d(10)-k-k-e 79 1429 12361 12376 530213
GGTTCCTCCTGTTGGC e-d-k-d(10)-k-k-e 72 1429 12361 12376 530263
GGTTCCTCCTGTTGGC e-d-d-k-d(9)-k-k-e 73 1429 12361 12376 530313
GGTTCCTCCTGTTGGC e-e-e-e-d(9)-k-k-e 61 1429 12586 12601 530710
TACAATTCCTGCCTGT e-e-e-d(10)-k-k-k 18 1434 15467 15482 530437
AGCTTTTCTATGAAAA k-d(10)-k-e-k-e-e 5 1435 15468 15484 530067
CAAGCTTTTCTATGAAA e-e-k-d(10)-k-e-k-e 53 1436 15468 15483 530387
AAGCTTTTCTATGAAA e-k-d(10)-k-e-k-e 24 1437 15469 15484 530132
CAAGCTTTTCTATGAA e-k-k-d(10)-k-k-e 74 423 15469 15484 530182
CAAGCTTTTCTATGAA e-e-k-d(10)-k-k-e 48 423 15469 15484 530232
CAAGCTTTTCTATGAA e-d-k-d(10)-k-k-e 21 423 15469 15484 530282
CAAGCTTTTCTATGAA e-d-d-k-d(9)-k-k-e 19 423 15469 15484 530332
CAAGCTTTTCTATGAA e-e-e-e-d(9)-k-k-e 20 423 16863 16878 530419
TAATTGTGTACTGGCA k-d(10)-k-e-k-e-e 75 1438 16864 16880 530049
TATAATTGTGTACTGGC e-e-k-d(10)-k-e-k-e 88 1439 16864 16879 530369
ATAATTGTGTACTGGC e-k-d(10)-k-e-k-e 92 1440 16865 16880 530117
TATAATTGTGTACTGG e-k-k-d(10)-k-k-e 73 1441 16865 16880 530164
TATAATTGTGTACTGG e-e-k-d(10)-k-k-e 65 1441 16865 16880 530214
TATAATTGTGTACTGG e-d-k-d(10)-k-k-e 37 1441 16865 16880 530264
TATAATTGTGTACTGG e-d-d-k-d(9)-k-k-e 48 1441 16865 16880 530314
TATAATTGTGTACTGG e-e-e-e-d(9)-k-k-e 42 1441 17385 17400 530709
TGGAGTAACAGGAACT e-e-e-d(10)-k-k-k 25 1442 21456 21471 530720
AAAGTTTCCCAATAGA e-e-e-d(10)-k-k-k 17 1443 22061 22076 529044
AGTCCTACCACGGCCC e-e-e-d(10)-k-k-k 27 1444 24514 24529 529045
TGACGATGCTTGGATA e-e-e-d(10)-k-k-k 37 1445 24515 24530 529046
CTGACGATGCTTGGAT e-e-e-d(10)-k-k-k 8 1446 24579 24594 529047
TCACTTTCCCTATACG e-e-e-d(10)-k-k-k 18 1447 25105 25120 530717
GTAGGTTGAGCAAGCA e-e-e-d(10)-k-k-k 77 1448 26061 26076 530420
ACTTTAGCCCCTTCCA k-d(10)-k-e-k-e-e 44 1449 26062 26078 530050
CAACTTTAGCCCCTTCC e-e-k-d(10)-k-e-k-e 64 1450 26062 26077 530370
AACTTTAGCCCCTTCC e-k-d(10)-k-e-k-e 55 1451 26063 26078 530118
CAACTTTAGCCCCTTC e-k-k-d(10)-k-k-e 58 1452 26063 26078 530165
CAACTTTAGCCCCTTC e-e-k-d(10)-k-k-e 38 1452 26063 26078 530215
CAACTTTAGCCCCTTC e-d-k-d(10)-k-k-e 29 1452 26063 26078 530265
CAACTTTAGCCCCTTC e-d-d-k-d(9)-k-k-e 3 1452 26063 26078 530315
CAACTTTAGCCCCTTC e-e-e-e-d(9)-k-k-e 30 1452 26767 26782 529048
AATTCATCGAGCTAAT e-e-e-d(10)-k-k-k 0 1453 37758 37773 529049
TGCCCCAATTAGGCCA e-e-e-d(10)-k-k-k 32 1454 37759 37774 529050
TTGCCCCAATTAGGCC e-e-e-d(10)-k-k-k 21 1455 41484 41499 530714
CCCTGTGGCTCCTTCC e-e-e-d(10)-k-k-k 27 1456 41760 41775 529051
TACTGTCCTCGAGACA e-e-e-d(10)-k-k-k 2 1457 42754 42769 530719
AGGAAAAGGAAGAATG e-e-e-d(10)-k-k-k 2 1458 42766 42781 529052
CGCATATGCCCTAGGA e-e-e-d(10)-k-k-k 7 1459 42768 42783 529053
GCCGCATATGCCCTAG e-e-e-d(10)-k-k-k 41 1460 42769 42784 529054
GGCCGCATATGCCCTA e-e-e-d(10)-k-k-k 51 1461 43072 43087 529055
CGGGTAAGTATACAGA e-e-e-d(10)-k-k-k 18 1462 43074 43089 529056
CACGGGTAAGTATACA e-e-e-d(10)-k-k-k 4 1463 43075 43090 529057
TCACGGGTAAGTATAC e-e-e-d(10)-k-k-k 5 1464 43077 43092 529058
GCTCACGGGTAAGTAT e-e-e-d(10)-k-k-k 15 1465
45633 45648 529059 GTATACAATGGCCTTT e-e-e-d(10)-k-k-k 59 1466 46633
46648 529060 CGACCCAATCAGATGC e-e-e-d(10)-k-k-k 34 1467 47430 47445
530708 GGATAAAATACAAAGG e-e-e-d(10)-k-k-k 14 1468 47617 47632
529061 GTTCCGAAAAAACCTC e-e-e-d(10)-k-k-k 59 1469 47619 47634
529062 GGGTTCCGAAAAAACC e-e-e-d(10)-k-k-k 16 1470 47752 47767
530712 TGCAAACTTTTTCTCT e-e-e-d(10)-k-k-k 21 1471 48092 48107
529063 ACCCGCTATCCACTCA e-e-e-d(10)-k-k-k 20 1472 48402 48417
530421 CACTTTCCATTCTAGT k-d(10)-k-e-k-e-e 20 1473 48403 48419
530051 CACACTTTCCATTCTAG e-e-k-d(10)-k-e-k-e 48 1474 48403 48418
530371 ACACTTTCCATTCTAG e-k-d(10)-k-e-k-e 36 1475 48404 48419
530119 CACACTTTCCATTCTA e-k-k-d(10)-k-k-e 47 1476 48404 48419
530166 CACACTTTCCATTCTA e-e-k-d(10)-k-k-e 53 1476 48404 48419
530216 CACACTTTCCATTCTA e-d-k-d(10)-k-k-e 34 1476 48404 48419
530266 CACACTTTCCATTCTA e-d-d-k-d(9)-k-k-e 31 1476 48404 48419
530316 CACACTTTCCATTCTA e-e-e-e-d(9)-k-k-e 34 1476 48429 48444
529064 AGCCCCTATGGTTACC e-e-e-d(10)-k-k-k 32 1477 48567 48582
529065 GTCTAGAGGCCTATCC e-e-e-d(10)-k-k-k 14 1478 48568 48583
529066 GGTCTAGAGGCCTATC e-e-e-d(10)-k-k-k 17 1479 49762 49777
530718 AGATGTTGGATGTCTA e-e-e-d(10)-k-k-k 46 1480 50692 50707
530423 AGATTCTCTACCACTT k-d(10)-k-e-k-e-e 70 1054 50693 50709
530053 GGAGATTCTCTACCACT e-e-k-d(10)-k-e-k-e 84 1055 50693 50708
530373 GAGATTCTCTACCACT e-k-d(10)-k-e-k-e 85 1056 50694 50709
530121 GGAGATTCTCTACCAC e-k-k-d(10)-k-k-e 77 53 50694 50709 530168
GGAGATTCTCTACCAC e-e-k-d(10)-k-k-e 75 53 50694 50709 530218
GGAGATTCTCTACCAC e-d-k-d(10)-k-k-e 61 53 50694 50709 530268
GGAGATTCTCTACCAC e-d-d-k-d(9)-k-k-e 76 53 50694 50709 530318
GGAGATTCTCTACCAC e-e-e-e-d(9)-k-k-e 73 53 50838 50853 529067
CCGCCTTAAGATCTAA e-e-e-d(10)-k-k-k 5 1481 51714 51729 529068
CCCTTACTCTCCGCAT e-e-e-d(10)-k-k-k 15 1482 51734 51749 529069
GGGAAGTGGTCCGACC e-e-e-d(10)-k-k-k 22 1483 51757 51772 529070
CCGCAAGTGAGCGAGA e-e-e-d(10)-k-k-k 6 1484 51760 51775 529071
ATCCCGCAAGTGAGCG e-e-e-d(10)-k-k-k 11 1485 51763 51778 529072
GAAATCCCGCAAGTGA e-e-e-d(10)-k-k-k 0 1486 51905 51920 528400
CCGCCAGCTCACTCAC e-e-e-d(10)-k-k-k 57 66 51906 51921 528401
CCCGCCAGCTCACTCA e-e-e-d(10)-k-k-k 57 1059 51907 51922 528402
CCCCGCCAGCTCACTC e-e-e-d(10)-k-k-k 42 1060 51910 51925 528403
AAGCCCCGCCAGCTCA e-e-e-d(10)-k-k-k 72 1060 51911 51926 528404
AAAGCCCCGCCAGCTC e-e-e-d(10)-k-k-k 52 1062 51912 51927 528405
AAAAGCCCCGCCAGCT e-e-e-d(10)-k-k-k 27 1063 51913 51928 528406
CAAAAGCCCCGCCAGC e-e-e-d(10)-k-k-k 29 1064 51914 51929 528407
ACAAAAGCCCCGCCAG e-e-e-d(10)-k-k-k 9 1065 51916 51931 528408
TGACAAAAGCCCCGCC e-e-e-d(10)-k-k-k 10 1066 51917 51932 528409
CTGACAAAAGCCCCGC e-e-e-d(10)-k-k-k 31 1067 51918 51933 528410
GCTGACAAAAGCCCCG e-e-e-d(10)-k-k-k 39 1068 51919 51934 528411
CGCTGACAAAAGCCCC e-e-e-d(10)-k-k-k 49 1069 51920 51935 528412
TCGCTGACAAAAGCCC e-e-e-d(10)-k-k-k 39 1070 51921 51936 528413
ATCGCTGACAAAAGCC e-e-e-d(10)-k-k-k 20 1071 51922 51937 528414
CATCGCTGACAAAAGC e-e-e-d(10)-k-k-k 10 1072 51924 51939 528415
TCCATCGCTGACAAAA e-e-e-d(10)-k-k-k 11 1073 51925 51940 528416
CTCCATCGCTGACAAA e-e-e-d(10)-k-k-k 15 1074 51926 51941 528417
ACTCCATCGCTGACAA e-e-e-d(10)-k-k-k 22 1075 51927 51942 528418
TACTCCATCGCTGACA e-e-e-d(10)-k-k-k 19 1076 51928 51943 528419
GTACTCCATCGCTGAC e-e-e-d(10)-k-k-k 37 1077 51929 51944 528420
CGTACTCCATCGCTGA e-e-e-d(10)-k-k-k 35 1078 51943 51958 528421
GAGAGTTTTCTGCACG e-e-e-d(10)-k-k-k 36 1079 51945 51960 528422
GTGAGAGTTTTCTGCA e-e-e-d(10)-k-k-k 22 1080 51964 51979 528423
GTCAGCCAGCTCCTCG e-e-e-d(10)-k-k-k 49 1081 51975 51990 528424
CGCCTCTTCCAGTCAG e-e-e-d(10)-k-k-k 42 1082 51977 51992 528425
GCCGCCTCTTCCAGTC e-e-e-d(10)-k-k-k 44 1083 51978 51993 528426
TGCCGCCTCTTCCAGT e-e-e-d(10)-k-k-k 15 1084 51983 51998 528427
TCTGTTGCCGCCTCTT e-e-e-d(10)-k-k-k 9 1085 51984 51999 528428
ATCTGTTGCCGCCTCT e-e-e-d(10)-k-k-k 30 1086 51985 52000 528429
AATCTGTTGCCGCCTC e-e-e-d(10)-k-k-k 23 1087 51986 52001 528430
CAATCTGTTGCCGCCT e-e-e-d(10)-k-k-k 12 1088 51987 52002 528431
GCAATCTGTTGCCGCC e-e-e-d(10)-k-k-k 48 1089 51988 52003 528432
GGCAATCTGTTGCCGC e-e-e-d(10)-k-k-k 18 1090 51989 52004 528433
AGGCAATCTGTTGCCG e-e-e-d(10)-k-k-k 0 1091 51990 52005 528434
CAGGCAATCTGTTGCC e-e-e-d(10)-k-k-k 8 1092 51991 52006 528435
GCAGGCAATCTGTTGC e-e-e-d(10)-k-k-k 13 1093 51995 52010 528436
CAATGCAGGCAATCTG e-e-e-d(10)-k-k-k 9 1094 51996 52011 528437
CCAATGCAGGCAATCT e-e-e-d(10)-k-k-k 26 1095 51997 52012 528438
TCCAATGCAGGCAATC e-e-e-d(10)-k-k-k 10 1096 51998 52013 528439
CTCCAATGCAGGCAAT e-e-e-d(10)-k-k-k 2 1097 51999 52014 528440
CCTCCAATGCAGGCAA e-e-e-d(10)-k-k-k 28 1098 52016 52031 528441
GGCAGATGTTGGGCGG e-e-e-d(10)-k-k-k 8 1099 52017 52032 528442
AGGCAGATGTTGGGCG e-e-e-d(10)-k-k-k 0 1100 52018 52033 528443
TAGGCAGATGTTGGGC e-e-e-d(10)-k-k-k 1 1101 52019 52034 528444
CTAGGCAGATGTTGGG e-e-e-d(10)-k-k-k 0 1102 52020 52035 528445
TCTAGGCAGATGTTGG e-e-e-d(10)-k-k-k 7 1103 52021 52036 528446
ATCTAGGCAGATGTTG e-e-e-d(10)-k-k-k 3 1104 52023 52038 528447
CGATCTAGGCAGATGT e-e-e-d(10)-k-k-k 9 72 52024 52039 528448
CCGATCTAGGCAGATG e-e-e-d(10)-k-k-k 13 1105 52026 52041 528449
AGCCGATCTAGGCAGA e-e-e-d(10)-k-k-k 4 1106 52027 52042 528450
TAGCCGATCTAGGCAG e-e-e-d(10)-k-k-k 11 1107 52028 52043 528451
CTAGCCGATCTAGGCA e-e-e-d(10)-k-k-k 5 1108 52029 52044 528452
TCTAGCCGATCTAGGC e-e-e-d(10)-k-k-k 5 1109 52030 52045 528453
TTCTAGCCGATCTAGG e-e-e-d(10)-k-k-k 24 1110 52031 52046 528454
TTTCTAGCCGATCTAG e-e-e-d(10)-k-k-k 29 1111 52032 52047 528455
TTTTCTAGCCGATCTA e-e-e-d(10)-k-k-k 28 1112 52033 52048 528456
GTTTTCTAGCCGATCT e-e-e-d(10)-k-k-k 42 1113 52035 52050 528457
CAGTTTTCTAGCCGAT e-e-e-d(10)-k-k-k 50 1114 52036 52051 528458
CCAGTTTTCTAGCCGA e-e-e-d(10)-k-k-k 70 1115 52083 52098 529073
TCAATCTAGCTTTCGA e-e-e-d(10)-k-k-k 33 1487 52084 52099 529074
TTCAATCTAGCTTTCG e-e-e-d(10)-k-k-k 36 1488 52119 52134 529075
GTACCAATTCTGTGGG e-e-e-d(10)-k-k-k 33 1489 55441 55456 528462
GATTCTGCTAATGACG e-e-e-d(10)-k-k-k 42 1119 55442 55457 528463
AGATTCTGCTAATGAC e-e-e-d(10)-k-k-k 38 1120 55446 55461 528464
GTTGAGATTCTGCTAA e-e-e-d(10)-k-k-k 30 1121 55447 55462 528465
AGTTGAGATTCTGCTA e-e-e-d(10)-k-k-k 48 1122 55454 55469 528466
GGTCTGAAGTTGAGAT e-e-e-d(10)-k-k-k 27 1123 55456 55471 528467
CGGGTCTGAAGTTGAG e-e-e-d(10)-k-k-k 44 1124 55457 55472 528468
ACGGGTCTGAAGTTGA e-e-e-d(10)-k-k-k 41 1125 55458 55473 528469
GACGGGTCTGAAGTTG e-e-e-d(10)-k-k-k 45 1126 55459 55474 528470
TGACGGGTCTGAAGTT e-e-e-d(10)-k-k-k 34 1127 55460 55475 528471
TTGACGGGTCTGAAGT e-e-e-d(10)-k-k-k 19 1128 55461 55476 528472
GTTGACGGGTCTGAAG e-e-e-d(10)-k-k-k 21 1129 55462 55477 528473
TGTTGACGGGTCTGAA e-e-e-d(10)-k-k-k 37 1130 55463 55478 528474
TTGTTGACGGGTCTGA e-e-e-d(10)-k-k-k 55 1131 55464 55479 528475
TTTGTTGACGGGTCTG e-e-e-d(10)-k-k-k 63 1132 55465 55480 528476
ATTTGTTGACGGGTCT e-e-e-d(10)-k-k-k 65 1133 56208 56223 529076
GTAACACCTCACCCTA e-e-e-d(10)-k-k-k 14 1490 58396 58411 530715
TCTGCCACCCAGGTTT e-e-e-d(10)-k-k-k 31 1491 59836 59851 529077
TAAATTTCCGGGATCT e-e-e-d(10)-k-k-k 13 1492 64187 64202 529078
CCGGTCCCTTGTAAAA e-e-e-d(10)-k-k-k 12 1493 64289 64304 529079
GCCAACTCTAGGCGAG e-e-e-d(10)-k-k-k 16 1494 64551 64566 529080
CGCAAGAGATCCCGGG e-e-e-d(10)-k-k-k 0 1495 64552 64567 529081
TCGCAAGAGATCCCGG e-e-e-d(10)-k-k-k 16 1496 64959 64974 529082
TGATCACCTCGACTGA e-e-e-d(10)-k-k-k 20 1497 66136 66151 530425
GCCCTTGCCAGCCATG k-d(10)-k-e-k-e-e 73 1134 66137 66153 530054
AAGCCCTTGCCAGCCAT e-e-k-d(10)-k-e-k-e 75 1135 66137 66152 530375
AGCCCTTGCCAGCCAT e-k-d(10)-k-e-k-e 77 1136 66138 66153 530123
AAGCCCTTGCCAGCCA e-k-k-d(10)-k-k-e 86 144 66138 66153 530170
AAGCCCTTGCCAGCCA e-e-k-d(10)-k-k-e 87 144 66138 66153 530220
AAGCCCTTGCCAGCCA e-d-k-d(10)-k-k-e 74 144 66138 66153 530270
AAGCCCTTGCCAGCCA e-d-d-k-d(9)-k-k-e 87 144 66138 66153 530320
AAGCCCTTGCCAGCCA e-e-e-e-d(9)-k-k-e 83 144
66183 66198 530426 TTTTTCACAAGGTCAA k-d(10)-k-e-k-e-e 55 1137 66184
66200 530059 ACTTTTTCACAAGGTCA e-e-k-d(10)-k-e-k-e 73 1138 66184
66199 530376 CTTTTTCACAAGGTCA e-k-d(10)-k-e-k-e 77 1139 66185 66200
530124 ACTTTTTCACAAGGTC e-k-k-d(10)-k-k-e 79 153 66185 66200 530171
ACTTTTTCACAAGGTC e-e-k-d(10)-k-k-e 69 153 66185 66200 530221
ACTTTTTCACAAGGTC e-d-k-d(10)-k-k-e 64 153 66185 66200 530271
ACTTTTTCACAAGGTC e-d-d-k-d(9)-k-k-e 73 153 66185 66200 530321
ACTTTTTCACAAGGTC e-e-e-e-d(9)-k-k-e 56 153 66875 66890 529083
GCCACCCTAGTGTTGA e-e-e-d(10)-k-k-k 27 1498 67066 67081 530427
ATGATCTTATAGCCCA k-d(10)-k-e-k-e-e 43 931 67067 67083 530060
CCATGATCTTATAGCCC e-e-k-d(10)-k-e-k-e 77 1140 67067 67082 530377
CATGATCTTATAGCCC e-k-d(10)-k-e-k-e 66 932 67068 67083 530125
CCATGATCTTATAGCC e-k-k-d(10)-k-k-e 65 175 67068 67083 530172
CCATGATCTTATAGCC e-e-k-d(10)-k-k-e 59 175 67068 67083 530222
CCATGATCTTATAGCC e-d-k-d(10)-k-k-e 48 175 67068 67083 530272
CCATGATCTTATAGCC e-d-d-k-d(9)-k-k-e 63 175 67068 67083 530322
CCATGATCTTATAGCC e-e-e-e-d(9)-k-k-e 45 175 67270 67285 530716
TTTGCCTATCTATCCT e-e-e-d(10)-k-k-k 11 1499 67346 67361 529084
CGGTCACCCCAACAAA e-e-e-d(10)-k-k-k 33 1500 69470 69485 529085
AAGGGCGATGGTAATG e-e-e-d(10)-k-k-k 4 1501 71614 71629 530422
GTACAATTGCTTCAAC k-d(10)-k-e-k-e-e 46 1502 71615 71631 530052
CAGTACAATTGCTTCAA e-e-k-d(10)-k-e-k-e 51 1503 71615 71630 530372
AGTACAATTGCTTCAA e-k-d(10)-k-e-k-e 51 1504 71616 71631 530120
CAGTACAATTGCTTCA e-k-k-d(10)-k-k-e 78 1505 71616 71631 530167
CAGTACAATTGCTTCA e-e-k-d(10)-k-k-e 69 1505 71616 71631 530217
CAGTACAATTGCTTCA e-d-k-d(10)-k-k-e 47 1505 71616 71631 530267
CAGTACAATTGCTTCA e-d-d-k-d(9)-k-k-e 64 1505 71616 71631 530317
CAGTACAATTGCTTCA e-e-e-e-d(9)-k-k-e 60 1505 72138 72153 530713
CTCATGCCAAGATTGT e-e-e-d(10)-k-k-k 26 1506 72299 72314 529086
AAGCCACTTACGGTGT e-e-e-d(10)-k-k-k 0 1507 72874 72889 529087
CGTCTATTTCCAGTGT e-e-e-d(10)-k-k-k 22 1508 73648 73663 529088
ACTAGTTCAGTTGTCC e-e-e-d(10)-k-k-k 0 1509 73866 73881 530428
TAGCAGAAGTAGGAGA k-d(10)-k-e-k-e-e 49 1141 73867 73883 530061
GATAGCAGAAGTAGGAG e-e-k-d(10)-k-e-k-e 49 1142 73867 73882 530378
ATAGCAGAAGTAGGAG e-k-d(10)-k-e-k-e 48 1143 73868 73883 530126
GATAGCAGAAGTAGGA e-k-k-d(10)-k-k-e 70 223 73868 73883 530173
GATAGCAGAAGTAGGA e-e-k-d(10)-k-k-e 62 223 73868 73883 530223
GATAGCAGAAGTAGGA e-d-k-d(10)-k-k-e 44 223 73868 73883 530273
GATAGCAGAAGTAGGA e-d-d-k-d(9)-k-k-e 63 223 73868 73883 530323
GATAGCAGAAGTAGGA e-e-e-e-d(9)-k-k-e 37 223 74199 74214 530513
TTGGATGTCAGCAAGG k-d(10)-k-e-k-e-e 88 1047 74200 74215 530507
TTTGGATGTCAGCAAG e-k-d(10)-k-e-k-e 86 1144 74200 74215 530514
TTTGGATGTCAGCAAG k-d(10)-k-e-k-e-e 80 1144 74201 74216 530430
ATTTGGATGTCAGCAA k-d(10)-k-e-k-e-e 87 1145 74201 74216 530468
ATTTGGATGTCAGCAA e-k-k-d(10)-k-k-e 81 1145 74201 74216 530476
ATTTGGATGTCAGCAA e-e-k-d(10)-k-k-e 82 1145 74201 74216 530484
ATTTGGATGTCAGCAA e-d-k-d(10)-k-k-e 74 1145 74201 74216 530492
ATTTGGATGTCAGCAA e-d-d-k-d(9)-k-k-e 83 1145 74201 74216 530500
ATTTGGATGTCAGCAA e-e-e-e-d(9)-k-k-e 56 1145 74201 74216 530508
ATTTGGATGTCAGCAA e-k-d(10)-k-e-k-e 83 1145 74202 74218 530062
CTATTTGGATGTCAGCA e-e-k-d(10)-k-e-k-e 94 1146 74202 74217 530380
TATTTGGATGTCAGCA e-k-d(10)-k-e-k-e 94 1147 74202 74217 530469
TATTTGGATGTCAGCA e-k-k-d(10)-k-k-e 91 1147 74202 74217 530477
TATTTGGATGTCAGCA e-e-k-d(10)-k-k-e 87 1147 74202 74217 530485
TATTTGGATGTCAGCA e-d-k-d(10)-k-k-e 87 1147 74202 74217 530493
TATTTGGATGTCAGCA e-d-d-k-d(9)-k-k-e 81 1147 74202 74217 530501
TATTTGGATGTCAGCA e-e-e-e-d(9)-k-k-e 74 1147 74202 74217 530515
TATTTGGATGTCAGCA k-d(10)-k-e-k-e-e 87 1147 74203 74218 481464
CTATTTGGATGTCAGC k-k-k-d(10)-k-k-k 93 245 74203 74218 518349
CTATTTGGATGTCAGC e-e-e-d(10)-k-k-k 58 245 74203 74218 519637
CTATTTGGATGTCAGC e-k-k-d(10)-k-k-e 96 245 74203 74218 530175
CTATTTGGATGTCAGC e-e-k-d(10)-k-k-e 93 245 74203 74218 530225
CTATTTGGATGTCAGC e-d-k-d(10)-k-k-e 85 245 74203 74218 530275
CTATTTGGATGTCAGC e-d-d-k-d(9)-k-k-e 91 245 74203 74218 530325
CTATTTGGATGTCAGC e-e-e-e-d(9)-k-k-e 91 245 74204 74219 530470
TCTATTTGGATGTCAG e-k-k-d(10)-k-k-e 91 1148 74204 74219 530478
TCTATTTGGATGTCAG e-e-k-d(10)-k-k-e 87 1148 74204 74219 530486
TCTATTTGGATGTCAG e-d-k-d(10)-k-k-e 84 1148 74204 74219 530494
TCTATTTGGATGTCAG e-d-d-k-d(9)-k-k-e 60 1148 74204 74219 530502
TCTATTTGGATGTCAG e-e-e-e-d(9)-k-k-e 64 1148 74204 74219 530509
TCTATTTGGATGTCAG e-k-d(10)-k-e-k-e 80 1148 74205 74220 530471
TTCTATTTGGATGTCA e-k-k-d(10)-k-k-e 83 1149 74205 74220 530479
TTCTATTTGGATGTCA e-e-k-d(10)-k-k-e 74 1149 74205 74220 530487
TTCTATTTGGATGTCA e-d-k-d(10)-k-k-e 71 1149 74205 74220 530495
TTCTATTTGGATGTCA e-d-d-k-d(9)-k-k-e 68 1149 74205 74220 530503
TTCTATTTGGATGTCA e-e-e-e-d(9)-k-k-e 53 1149 74646 74661 530431
CACCAAGGAGGCTGTT k-d(10)-k-e-k-e-e 44 1150 74647 74663 530055
AGCACCAAGGAGGCTGT e-e-k-d(10)-k-e-k-e 45 1151 74647 74662 530381
GCACCAAGGAGGCTGT e-k-d(10)-k-e-k-e 74 1152 74648 74663 530128
AGCACCAAGGAGGCTG e-k-k-d(10)-k-k-e 52 257 74648 74663 530176
AGCACCAAGGAGGCTG e-e-k-d(10)-k-k-e 66 257 74648 74663 530226
AGCACCAAGGAGGCTG e-d-k-d(10)-k-k-e 51 257 74648 74663 530276
AGCACCAAGGAGGCTG e-d-d-k-d(9)-k-k-e 70 257 74648 74663 530326
AGCACCAAGGAGGCTG e-e-e-e-d(9)-k-k-e 52 257 74714 74729 528860
GGTTTGACCTGAAGCC e-e-e-d(10)-k-k-k 58 1153 74715 74730 528861
GGGTTTGACCTGAAGC e-e-e-d(10)-k-k-k 42 1154 74716 74731 528862
AGGGTTTGACCTGAAG e-e-e-d(10)-k-k-k 57 1155 74717 74732 528863
AAGGGTTTGACCTGAA e-e-e-d(10)-k-k-k 43 1156 74718 74733 528864
TAAGGGTTTGACCTGA e-e-e-d(10)-k-k-k 50 1157 74719 74734 528865
TTAAGGGTTTGACCTG e-e-e-d(10)-k-k-k 32 1158 74734 74749 528866
GCAGCTTCAGATGTCT e-e-e-d(10)-k-k-k 60 1159 74735 74750 528867
TGCAGCTTCAGATGTC e-e-e-d(10)-k-k-k 47 1160 74770 74785 530388
CTTAAACCTTCCTATT k-d(10)-k-e-k-e-e 14 1161 74771 74786 530338
CCTTAAACCTTCCTAT e-k-d(10)-k-e-k-e 47 1162 74772 74787 530086
TCCTTAAACCTTCCTA e-k-k-d(10)-k-k-e 58 273 74772 74787 530133
TCCTTAAACCTTCCTA e-e-k-d(10)-k-k-e 53 273 74772 74787 530183
TCCTTAAACCTTCCTA e-d-k-d(10)-k-k-e 52 273 74772 74787 530233
TCCTTAAACCTTCCTA e-d-d-k-d(9)-k-k-e 29 273 74772 74787 530283
TCCTTAAACCTTCCTA e-e-e-e-d(9)-k-k-e 32 273 74777 74792 528868
GATTCTCCTTAAACCT e-e-e-d(10)-k-k-k 45 1163 74778 74793 530389
AGATTCTCCTTAAACC k-d(10)-k-e-k-e-e 44 1164 74779 74794 530339
TAGATTCTCCTTAAAC e-k-d(10)-k-e-k-e 41 1165 74780 74795 530087
TTAGATTCTCCTTAAA e-k-k-d(10)-k-k-e 43 1166 74780 74795 530134
TTAGATTCTCCTTAAA e-e-k-d(10)-k-k-e 28 1166 74780 74795 530184
TTAGATTCTCCTTAAA e-d-k-d(10)-k-k-e 13 1166 74780 74795 530234
TTAGATTCTCCTTAAA e-d-d-k-d(9)-k-k-e 15 1166 74780 74795 530284
TTAGATTCTCCTTAAA e-e-e-e-d(9)-k-k-e 14 1166 74782 74797 530390
GCTTAGATTCTCCTTA k-d(10)-k-e-k-e-e 83 1167 74783 74798 530340
TGCTTAGATTCTCCTT e-k-d(10)-k-e-k-e 89 1168 74784 74799 528869
ATGCTTAGATTCTCCT e-e-e-d(10)-k-k-k 83 1169 74784 74799 530088
ATGCTTAGATTCTCCT e-k-k-d(10)-k-k-e 90 1169 74784 74799 530135
ATGCTTAGATTCTCCT e-e-k-d(10)-k-k-e 91 1169 74784 74799 530185
ATGCTTAGATTCTCCT e-d-k-d(10)-k-k-e 85 1169 74784 74799 530235
ATGCTTAGATTCTCCT e-d-d-k-d(9)-k-k-e 28 1169 74784 74799 530285
ATGCTTAGATTCTCCT e-e-e-e-d(9)-k-k-e 86 1169 74784 74799 530391
ATGCTTAGATTCTCCT k-d(10)-k-e-k-e-e 79 1169 74785 74801 530021
AAATGCTTAGATTCTCC e-e-k-d(10)-k-e-k-e 87 1170 74785 74800 530341
AATGCTTAGATTCTCC e-k-d(10)-k-e-k-e 88 1171 74786 74801 530089
AAATGCTTAGATTCTC e-k-k-d(10)-k-k-e 71 1172 74786 74801 530136
AAATGCTTAGATTCTC e-e-k-d(10)-k-k-e 66 1172 74786 74801 530186
AAATGCTTAGATTCTC e-d-k-d(10)-k-k-e 51 1172 74786 74801 530236
AAATGCTTAGATTCTC e-d-d-k-d(9)-k-k-e 74 1172 74786 74801 530286
AAATGCTTAGATTCTC e-e-e-e-d(9)-k-k-e 56 1172 74869 74884 528870
GTAAGCACCCTCTGCC e-e-e-d(10)-k-k-k 26 1173 74871 74886 528871
TTGTAAGCACCCTCTG e-e-e-d(10)-k-k-k 14 1174
74873 74888 528872 GGTTGTAAGCACCCTC e-e-e-d(10)-k-k-k 47 1175 74874
74889 528873 AGGTTGTAAGCACCCT e-e-e-d(10)-k-k-k 40 1176 74875 74890
528874 AAGGTTGTAAGCACCC e-e-e-d(10)-k-k-k 54 1177 74877 74892
528875 TCAAGGTTGTAAGCAC e-e-e-d(10)-k-k-k 15 1178 74878 74893
528876 GTCAAGGTTGTAAGCA e-e-e-d(10)-k-k-k 28 1179 74879 74894
528877 AGTCAAGGTTGTAAGC e-e-e-d(10)-k-k-k 28 1180 74881 74896
528878 GGAGTCAAGGTTGTAA e-e-e-d(10)-k-k-k 6 1181 74882 74897 528879
GGGAGTCAAGGTTGTA e-e-e-d(10)-k-k-k 22 1182 74901 74916 530392
GATCAAGTCCAGGGAG k-d(10)-k-e-k-e-e 47 1183 74902 74918 530022
CAGATCAAGTCCAGGGA e-e-k-d(10)-k-e-k-e 80 1184 74902 74917 530342
AGATCAAGTCCAGGGA e-k-d(10)-k-e-k-e 70 1185 74902 74917 530393
AGATCAAGTCCAGGGA k-d(10)-k-e-k-e-e 46 1185 74903 74919 530023
GCAGATCAAGTCCAGGG e-e-k-d(10)-k-e-k-e 74 1186 74903 74918 530090
CAGATCAAGTCCAGGG e-k-k-d(10)-k-k-e 78 1187 74903 74918 530137
CAGATCAAGTCCAGGG e-e-k-d(10)-k-k-e 76 1187 74903 74918 530187
CAGATCAAGTCCAGGG e-d-k-d(10)-k-k-e 68 1187 74903 74918 530237
CAGATCAAGTCCAGGG e-d-d-k-d(9)-k-k-e 36 1187 74903 74918 530287
CAGATCAAGTCCAGGG e-e-e-e-d(9)-k-k-e 56 1187 74903 74918 530343
CAGATCAAGTCCAGGG e-k-d(10)-k-e-k-e 68 1187 74903 74918 530394
CAGATCAAGTCCAGGG k-d(10)-k-e-k-e-e 49 1187 74904 74919 518343
GCAGATCAAGTCCAGG e-e-e-d(10)-k-k-k 5 1188 74904 74920 530024
AGCAGATCAAGTCCAGG e-e-k-d(10)-k-e-k-e 79 1189 74904 74919 530091
GCAGATCAAGTCCAGG e-k-k-d(10)-k-k-e 81 1188 74904 74919 530138
GCAGATCAAGTCCAGG e-e-k-d(10)-k-k-e 81 1188 74904 74919 530188
GCAGATCAAGTCCAGG e-d-k-d(10)-k-k-e 78 1188 74904 74919 530238
GCAGATCAAGTCCAGG e-d-d-k-d(9)-k-k-e 29 1188 74904 74919 530288
GCAGATCAAGTCCAGG e-e-e-e-d(9)-k-k-e 69 1188 74904 74919 530344
GCAGATCAAGTCCAGG e-k-d(10)-k-e-k-e 85 1188 74905 74920 530092
AGCAGATCAAGTCCAG e-k-k-d(10)-k-k-e 85 1190 74905 74920 530139
AGCAGATCAAGTCCAG e-e-k-d(10)-k-k-e 79 1190 74905 74920 530189
AGCAGATCAAGTCCAG e-d-k-d(10)-k-k-e 77 1190 74905 74920 530239
AGCAGATCAAGTCCAG e-d-d-k-d(9)-k-k-e 61 1190 74905 74920 530289
AGCAGATCAAGTCCAG e-e-e-e-d(9)-k-k-e 75 1190 74907 74922 528880
ACAGCAGATCAAGTCC e-e-e-d(10)-k-k-k 65 1191 74908 74923 528881
AACAGCAGATCAAGTC e-e-e-d(10)-k-k-k 44 1192 74924 74939 528882
ACAACCTAGCCTCTGA e-e-e-d(10)-k-k-k 39 1193 74925 74940 528883
AACAACCTAGCCTCTG e-e-e-d(10)-k-k-k 46 1194 74927 74942 528884
GAAACAACCTAGCCTC e-e-e-d(10)-k-k-k 37 1195 74928 74943 528885
AGAAACAACCTAGCCT e-e-e-d(10)-k-k-k 20 1196 74929 74944 528886
CAGAAACAACCTAGCC e-e-e-d(10)-k-k-k 21 1197 74942 74957 528887
GATAAGGCACCCACAG e-e-e-d(10)-k-k-k 25 1198 74943 74958 528888
TGATAAGGCACCCACA e-e-e-d(10)-k-k-k 12 1199 74944 74959 528889
CTGATAAGGCACCCAC e-e-e-d(10)-k-k-k 25 1200 74946 74961 528890
CCCTGATAAGGCACCC e-e-e-d(10)-k-k-k 42 1201 74947 74962 528891
GCCCTGATAAGGCACC e-e-e-d(10)-k-k-k 49 1202 74952 74967 528892
TCCCAGCCCTGATAAG e-e-e-d(10)-k-k-k 0 1203 74954 74969 528893
TATCCCAGCCCTGATA e-e-e-d(10)-k-k-k 0 1204 74957 74972 528894
AAGTATCCCAGCCCTG e-e-e-d(10)-k-k-k 25 1205 74958 74973 528895
GAAGTATCCCAGCCCT e-e-e-d(10)-k-k-k 39 1206 74959 74974 528896
AGAAGTATCCCAGCCC e-e-e-d(10)-k-k-k 22 1207 74960 74975 528897
CAGAAGTATCCCAGCC e-e-e-d(10)-k-k-k 36 1208 75079 75094 528898
TGAGACCAGGATTCCT e-e-e-d(10)-k-k-k 41 1209 75083 75098 528899
GTCCTGAGACCAGGAT e-e-e-d(10)-k-k-k 19 1210 75164 75179 528900
AGCTCAACCAGACACG e-e-e-d(10)-k-k-k 54 311 75166 75181 528901
TGAGCTCAACCAGACA e-e-e-d(10)-k-k-k 40 1211 75171 75186 528902
TTCCCTGAGCTCAACC e-e-e-d(10)-k-k-k 32 1212 75179 75194 528903
GAACCATATTCCCTGA e-e-e-d(10)-k-k-k 30 313 75182 75197 528904
TAAGAACCATATTCCC e-e-e-d(10)-k-k-k 27 1213 75209 75224 518344
GCCACTGGATATCACC e-e-e-d(10)-k-k-k 89 317 75254 75269 528905
TAAGCCTTTGCCCTGC e-e-e-d(10)-k-k-k 64 1214 75255 75270 528906
GTAAGCCTTTGCCCTG e-e-e-d(10)-k-k-k 53 1215 75256 75271 528907
AGTAAGCCTTTGCCCT e-e-e-d(10)-k-k-k 45 1216 75257 75272 528908
CAGTAAGCCTTTGCCC e-e-e-d(10)-k-k-k 40 1217 75259 75274 528909
ATCAGTAAGCCTTTGC e-e-e-d(10)-k-k-k 53 1218 75260 75275 528910
TATCAGTAAGCCTTTG e-e-e-d(10)-k-k-k 47 1219 75264 75279 528911
AGTTTATCAGTAAGCC e-e-e-d(10)-k-k-k 58 1220 75270 75285 528912
GACTCAAGTTTATCAG e-e-e-d(10)-k-k-k 37 1221 75272 75287 528913
CAGACTCAAGTTTATC e-e-e-d(10)-k-k-k 39 1222 75273 75288 528914
GCAGACTCAAGTTTAT e-e-e-d(10)-k-k-k 0 1223 75274 75289 528915
GGCAGACTCAAGTTTA e-e-e-d(10)-k-k-k 1 1224 75275 75290 528916
GGGCAGACTCAAGTTT e-e-e-d(10)-k-k-k 0 1225 75276 75291 528917
AGGGCAGACTCAAGTT e-e-e-d(10)-k-k-k 9 1226 75278 75293 528918
CGAGGGCAGACTCAAG e-e-e-d(10)-k-k-k 2 1227 75280 75295 528919
TACGAGGGCAGACTCA e-e-e-d(10)-k-k-k 20 324 75281 75296 528920
ATACGAGGGCAGACTC e-e-e-d(10)-k-k-k 14 1228 75282 75297 528921
CATACGAGGGCAGACT e-e-e-d(10)-k-k-k 0 1229 75283 75298 528922
TCATACGAGGGCAGAC e-e-e-d(10)-k-k-k 8 1230 75285 75300 528923
CCTCATACGAGGGCAG e-e-e-d(10)-k-k-k 2 1231 75286 75301 528924
CCCTCATACGAGGGCA e-e-e-d(10)-k-k-k 2 1232 75287 75302 528925
ACCCTCATACGAGGGC e-e-e-d(10)-k-k-k 0 1233 75412 75427 528926
TACGCACAGGAGAGGC e-e-e-d(10)-k-k-k 20 1233 75413 75428 528927
ATACGCACAGGAGAGG e-e-e-d(10)-k-k-k 0 1234 75414 75429 528928
CATACGCACAGGAGAG e-e-e-d(10)-k-k-k 6 1235 75415 75430 528929
CCATACGCACAGGAGA e-e-e-d(10)-k-k-k 4 1236 75416 75431 528930
CCCATACGCACAGGAG e-e-e-d(10)-k-k-k 36 1237 75417 75432 528931
TCCCATACGCACAGGA e-e-e-d(10)-k-k-k 22 1238 75418 75433 528932
TTCCCATACGCACAGG e-e-e-d(10)-k-k-k 32 1239 75419 75434 528933
GTTCCCATACGCACAG e-e-e-d(10)-k-k-k 45 1240 75420 75435 528934
TGTTCCCATACGCACA e-e-e-d(10)-k-k-k 36 1241 75421 75436 528935
GTGTTCCCATACGCAC e-e-e-d(10)-k-k-k 20 1242 75421 75436 530395
GTGTTCCCATACGCAC k-d(10)-k-e-k-e-e 71 1242 75422 75437 528936
GGTGTTCCCATACGCA e-e-e-d(10)-k-k-k 71 1243 75422 75438 530025
AGGTGTTCCCATACGCA e-e-k-d(10)-k-e-k-e 90 1244 75422 75437 530345
GGTGTTCCCATACGCA e-k-d(10)-k-e-k-e 93 1243 75422 75437 530396
GGTGTTCCCATACGCA k-d(10)-k-e-k-e-e 71 1243 75423 75438 528937
AGGTGTTCCCATACGC e-e-e-d(10)-k-k-k 73 1245 75423 75439 530026
TAGGTGTTCCCATACGC e-e-k-d(10)-k-e-k-e 87 1246 75423 75438 530093
AGGTGTTCCCATACGC e-k-k-d(10)-k-k-e 95 1245 75423 75438 530140
AGGTGTTCCCATACGC e-e-k-d(10)-k-k-e 89 1245 75423 75438 530190
AGGTGTTCCCATACGC e-d-k-d(10)-k-k-e 82 1245 75423 75438 530240
AGGTGTTCCCATACGC e-d-d-k-d(9)-k-k-e 50 1245 75423 75438 530290
AGGTGTTCCCATACGC e-e-e-e-d(9)-k-k-e 69 1245 75423 75438 530346
AGGTGTTCCCATACGC e-k-d(10)-k-e-k-e 89 1245 75424 75439 528938
TAGGTGTTCCCATACG e-e-e-d(10)-k-k-k 72 336 75424 75439 530094
TAGGTGTTCCCATACG e-k-k-d(10)-k-k-e 88 336 75424 75439 530141
TAGGTGTTCCCATACG e-e-k-d(10)-k-k-e 80 336 75424 75439 530191
TAGGTGTTCCCATACG e-d-k-d(10)-k-k-e 74 336 75424 75439 530241
TAGGTGTTCCCATACG e-d-d-k-d(9)-k-k-e 53 336 75424 75439 530291
TAGGTGTTCCCATACG e-e-e-e-d(9)-k-k-e 68 336 75425 75440 528939
CTAGGTGTTCCCATAC e-e-e-d(10)-k-k-k 39 1247 75426 75441 528940
GCTAGGTGTTCCCATA e-e-e-d(10)-k-k-k 62 1248 75427 75442 528941
TGCTAGGTGTTCCCAT e-e-e-d(10)-k-k-k 49 1249 75429 75444 528942
CGTGCTAGGTGTTCCC e-e-e-d(10)-k-k-k 77 1250 75491 75506 528943
CAAGGTGGTTTTGAGT e-e-e-d(10)-k-k-k 25 1251 75492 75507 528944
GCAAGGTGGTTTTGAG e-e-e-d(10)-k-k-k 28 344 75507 75522 528945
CTCTGATCAGCTGAGG e-e-e-d(10)-k-k-k 74 1252 75508 75523 528946
ACTCTGATCAGCTGAG e-e-e-d(10)-k-k-k 56 1253 75549 75564 528947
GAGACCAGCTAATTTG e-e-e-d(10)-k-k-k 36 1254 75582 75597 528948
CATCTTAGAGAAGGTC e-e-e-d(10)-k-k-k 59 1255 75622 75637 528949
TCAACTGTCTCCAGGC e-e-e-d(10)-k-k-k 67 1256 75622 75637 530397
TCAACTGTCTCCAGGC k-d(10)-k-e-k-e-e 60 1256 75623 75638 528950
ATCAACTGTCTCCAGG e-e-e-d(10)-k-k-k 57 1257 75623 75639 530027
CATCAACTGTCTCCAGG e-e-k-d(10)-k-e-k-e 56 1258 75623 75638 530347
ATCAACTGTCTCCAGG e-k-d(10)-k-e-k-e 49 1257 75624 75639 530095
CATCAACTGTCTCCAG e-k-k-d(10)-k-k-e 40 354 75624 75639 530142
CATCAACTGTCTCCAG e-e-k-d(10)-k-k-e 43 354
75624 75639 530192 CATCAACTGTCTCCAG e-d-k-d(10)-k-k-e 42 354 75624
75639 530242 CATCAACTGTCTCCAG e-d-d-k-d(9)-k-k-e 0 354 75624 75639
530292 CATCAACTGTCTCCAG e-e-e-e-d(9)-k-k-e 36 354 75624 75639
530398 CATCAACTGTCTCCAG k-d(10)-k-e-k-e-e 28 354 75625 75641 530028
CACATCAACTGTCTCCA e-e-k-d(10)-k-e-k-e 57 1259 75625 75640 530348
ACATCAACTGTCTCCA e-k-d(10)-k-e-k-e 58 1260 75626 75641 530096
CACATCAACTGTCTCC e-k-k-d(10)-k-k-e 72 356 75626 75641 530143
CACATCAACTGTCTCC e-e-k-d(10)-k-k-e 74 356 75626 75641 530193
CACATCAACTGTCTCC e-d-k-d(10)-k-k-e 62 356 75626 75641 530243
CACATCAACTGTCTCC e-d-d-k-d(9)-k-k-e 34 356 75626 75641 530293
CACATCAACTGTCTCC e-e-e-e-d(9)-k-k-e 59 356 75628 75643 528951
GACACATCAACTGTCT e-e-e-d(10)-k-k-k 16 1261 75662 75677 528952
GAAGAGTGTTGCTGGA e-e-e-d(10)-k-k-k 57 1262 75664 75679 528953
CTGAAGAGTGTTGCTG e-e-e-d(10)-k-k-k 46 1263 75666 75681 528954
TACTGAAGAGTGTTGC e-e-e-d(10)-k-k-k 42 1264 75672 75687 530510
ATTATGTACTGAAGAG k-d(10)-k-e-k-e-e 53 1265 75673 75688 530504
TATTATGTACTGAAGA e-k-d(10)-k-e-k-e 25 1266 75673 75688 530511
TATTATGTACTGAAGA k-d(10)-k-e-k-e-e 31 1266 75674 75689 530432
TTATTATGTACTGAAG k-d(10)-k-e-k-e-e 15 1267 75674 75689 530463
TTATTATGTACTGAAG e-k-k-d(10)-k-k-e 20 1267 75674 75689 530472
TTATTATGTACTGAAG e-e-k-d(10)-k-k-e 17 1267 75674 75689 530480
TTATTATGTACTGAAG e-d-k-d(10)-k-k-e 4 1267 75674 75689 530488
TTATTATGTACTGAAG e-d-d-k-d(9)-k-k-e 13 1267 75674 75689 530496
TTATTATGTACTGAAG e-e-e-e-d(9)-k-k-e 0 1267 75674 75689 530505
TTATTATGTACTGAAG e-k-d(10)-k-e-k-e 37 1267 75675 75691 530063
GCTTATTATGTACTGAA e-e-k-d(10)-k-e-k-e 74 1268 75675 75690 530382
CTTATTATGTACTGAA e-k-d(10)-k-e-k-e 17 1269 75675 75690 530465
CTTATTATGTACTGAA e-k-k-d(10)-k-k-e 63 1269 75675 75690 530473
CTTATTATGTACTGAA e-e-k-d(10)-k-k-e 45 1269 75675 75690 530481
CTTATTATGTACTGAA e-d-k-d(10)-k-k-e 14 1269 75675 75690 530489
CTTATTATGTACTGAA e-d-d-k-d(9)-k-k-e 13 1269 75675 75690 530497
CTTATTATGTACTGAA e-e-e-e-d(9)-k-k-e 7 1269 75675 75690 530512
CTTATTATGTACTGAA k-d(10)-k-e-k-e-e 21 1269 75676 75691 519638
GCTTATTATGTACTGA e-k-k-d(10)-k-k-e 86 362 75676 75691 530177
GCTTATTATGTACTGA e-e-k-d(10)-k-k-e 71 362 75676 75691 530227
GCTTATTATGTACTGA e-d-k-d(10)-k-k-e 51 362 75676 75691 530277
GCTTATTATGTACTGA e-d-d-k-d(9)-k-k-e 70 362 75676 75691 530327
GCTTATTATGTACTGA e-e-e-e-d(9)-k-k-e 61 362 75677 75692 530466
AGCTTATTATGTACTG e-k-k-d(10)-k-k-e 82 1270 75677 75692 530474
AGCTTATTATGTACTG e-e-k-d(10)-k-k-e 62 1270 75677 75692 530482
AGCTTATTATGTACTG e-d-k-d(10)-k-k-e 53 1270 75677 75692 530490
AGCTTATTATGTACTG e-d-d-k-d(9)-k-k-e 42 1270 75677 75692 530498
AGCTTATTATGTACTG e-e-e-e-d(9)-k-k-e 45 1270 75677 75692 530506
AGCTTATTATGTACTG e-k-d(10)-k-e-k-e 70 1270 75678 75693 530467
AAGCTTATTATGTACT e-k-k-d(10)-k-k-e 50 1271 75678 75693 530475
AAGCTTATTATGTACT e-e-k-d(10)-k-k-e 26 1271 75678 75693 530483
AAGCTTATTATGTACT e-d-k-d(10)-k-k-e 19 1271 75678 75693 530491
AAGCTTATTATGTACT e-d-d-k-d(9)-k-k-e 13 1271 75678 75693 530499
AAGCTTATTATGTACT e-e-e-e-d(9)-k-k-e 15 1271 75679 75694 528955
TAAGCTTATTATGTAC e-e-e-d(10)-k-k-k 0 1272 75686 75701 528956
TATCAGTTAAGCTTAT e-e-e-d(10)-k-k-k 0 1273 75689 75704 528957
GTTTATCAGTTAAGCT e-e-e-d(10)-k-k-k 31 1274 75726 75741 530433
CAATGGTAAGCCCAAG k-d(10)-k-e-k-e-e 62 1275 75727 75742 528958
CCAATGGTAAGCCCAA e-e-e-d(10)-k-k-k 66 1276 75727 75743 530056
CCCAATGGTAAGCCCAA e-e-k-d(10)-k-e-k-e 73 1277 75727 75742 530383
CCAATGGTAAGCCCAA e-k-d(10)-k-e-k-e 64 1276 75728 75743 518345
CCCAATGGTAAGCCCA e-e-e-d(10)-k-k-k 80 366 75728 75743 519636
CCCAATGGTAAGCCCA e-k-k-d(10)-k-k-e 90 366 75728 75743 530178
CCCAATGGTAAGCCCA e-e-k-d(10)-k-k-e 86 366 75728 75743 530228
CCCAATGGTAAGCCCA e-d-k-d(10)-k-k-e 77 366 75728 75743 530278
CCCAATGGTAAGCCCA e-d-d-k-d(9)-k-k-e 86 366 75728 75743 530328
CCCAATGGTAAGCCCA e-e-e-e-d(9)-k-k-e 80 366 75729 75744 528959
ACCCAATGGTAAGCCC e-e-e-d(10)-k-k-k 73 1277 75731 75746 528960
AAACCCAATGGTAAGC e-e-e-d(10)-k-k-k 43 1278 75732 75747 528961
TAAACCCAATGGTAAG e-e-e-d(10)-k-k-k 18 1279 75733 75748 528962
TTAAACCCAATGGTAA e-e-e-d(10)-k-k-k 13 1280 75734 75749 528963
TTTAAACCCAATGGTA e-e-e-d(10)-k-k-k 2 1281 75741 75756 528964
CCTATGATTTAAACCC e-e-e-d(10)-k-k-k 17 1282 75745 75760 528965
GGTCCCTATGATTTAA e-e-e-d(10)-k-k-k 31 1283 75746 75761 528966
AGGTCCCTATGATTTA e-e-e-d(10)-k-k-k 22 1284 75802 75817 528967
CCTAAGGCCATGAACT e-e-e-d(10)-k-k-k 19 374 75803 75818 528968
ACCTAAGGCCATGAAC e-e-e-d(10)-k-k-k 25 1285 75804 75819 528969
TACCTAAGGCCATGAA e-e-e-d(10)-k-k-k 41 1286 75805 75820 528970
CTACCTAAGGCCATGA e-e-e-d(10)-k-k-k 55 1287 75806 75821 528971
GCTACCTAAGGCCATG e-e-e-d(10)-k-k-k 66 1288 75807 75822 528972
TGCTACCTAAGGCCAT e-e-e-d(10)-k-k-k 56 1289 75808 75823 528973
ATGCTACCTAAGGCCA e-e-e-d(10)-k-k-k 71 1290 75809 75824 528974
CATGCTACCTAAGGCC e-e-e-d(10)-k-k-k 58 1291 75810 75825 528975
ACATGCTACCTAAGGC e-e-e-d(10)-k-k-k 34 1292 75823 75838 528976
GTTAAGACCAGATACA e-e-e-d(10)-k-k-k 45 1293 75824 75839 528977
AGTTAAGACCAGATAC e-e-e-d(10)-k-k-k 40 1294 75825 75840 528978
GAGTTAAGACCAGATA e-e-e-d(10)-k-k-k 40 1295 75826 75841 528979
AGAGTTAAGACCAGAT e-e-e-d(10)-k-k-k 62 1296 75831 75846 530399
CAATCAGAGTTAAGAC k-d(10)-k-e-k-e-e 36 1297 75832 75848 530029
TACAATCAGAGTTAAGA e-e-k-d(10)-k-e-k-e 29 1298 75832 75847 530349
ACAATCAGAGTTAAGA e-k-d(10)-k-e-k-e 33 1299 75833 75848 528980
TACAATCAGAGTTAAG e-e-e-d(10)-k-k-k 0 378 75833 75848 530097
TACAATCAGAGTTAAG e-k-k-d(10)-k-k-e 41 378 75833 75848 530144
TACAATCAGAGTTAAG e-e-k-d(10)-k-k-e 16 378 75833 75848 530194
TACAATCAGAGTTAAG e-d-k-d(10)-k-k-e 28 378 75833 75848 530244
TACAATCAGAGTTAAG e-d-d-k-d(9)-k-k-e 0 378 75833 75848 530294
TACAATCAGAGTTAAG e-e-e-e-d(9)-k-k-e 7 378 75835 75850 528981
GCTACAATCAGAGTTA e-e-e-d(10)-k-k-k 52 1300 75836 75851 528982
TGCTACAATCAGAGTT e-e-e-d(10)-k-k-k 47 1301 75837 75852 528983
TTGCTACAATCAGAGT e-e-e-d(10)-k-k-k 44 1302 75849 75864 530400
CTCTCAGAACTTTTGC k-d(10)-k-e-k-e-e 65 1303 75850 75866 530030
TCCTCTCAGAACTTTTG e-e-k-d(10)-k-e-k-e 47 1304 75850 75865 530350
CCTCTCAGAACTTTTG e-k-d(10)-k-e-k-e 54 1305 75851 75866 530098
TCCTCTCAGAACTTTT e-k-k-d(10)-k-k-e 42 380 75851 75866 530145
TCCTCTCAGAACTTTT e-e-k-d(10)-k-k-e 38 380 75851 75866 530195
TCCTCTCAGAACTTTT e-d-k-d(10)-k-k-e 43 380 75851 75866 530245
TCCTCTCAGAACTTTT e-d-d-k-d(9)-k-k-e 28 380 75851 75866 530295
TCCTCTCAGAACTTTT e-e-e-e-d(9)-k-k-e 39 380 75957 75972 528984
CCCACGGGATTCCCTC e-e-e-d(10)-k-k-k 39 1306 75958 75973 528985
ACCCACGGGATTCCCT e-e-e-d(10)-k-k-k 36 1307 75959 75974 528986
AACCCACGGGATTCCC e-e-e-d(10)-k-k-k 47 1308 75960 75975 528987
CAACCCACGGGATTCC e-e-e-d(10)-k-k-k 39 1309 75961 75976 528988
GCAACCCACGGGATTC e-e-e-d(10)-k-k-k 48 1310 75962 75977 528989
AGCAACCCACGGGATT e-e-e-d(10)-k-k-k 40 1311 75964 75979 528990
TAAGCAACCCACGGGA e-e-e-d(10)-k-k-k 27 1312 75965 75980 528991
GTAAGCAACCCACGGG e-e-e-d(10)-k-k-k 47 1313 75966 75981 528992
GGTAAGCAACCCACGG e-e-e-d(10)-k-k-k 42 1314 75967 75982 528993
AGGTAAGCAACCCACG e-e-e-d(10)-k-k-k 54 1315 75967 75982 530434
AGGTAAGCAACCCACG k-d(10)-k-e-k-e-e 51 1315 75968 75983 528994
TAGGTAAGCAACCCAC e-e-e-d(10)-k-k-k 53 1316 75968 75984 530064
GTAGGTAAGCAACCCAC e-e-k-d(10)-k-e-k-e 53 1317 75968 75983 530384
TAGGTAAGCAACCCAC e-k-d(10)-k-e-k-e 48 1316 75969 75984 528995
GTAGGTAAGCAACCCA e-e-e-d(10)-k-k-k 64 388 75969 75984 530129
GTAGGTAAGCAACCCA e-k-k-d(10)-k-k-e 79 388 75969 75984 530179
GTAGGTAAGCAACCCA e-e-k-d(10)-k-k-e 74 388 75969 75984 530229
GTAGGTAAGCAACCCA e-d-k-d(10)-k-k-e 64 388 75969 75984 530279
GTAGGTAAGCAACCCA e-d-d-k-d(9)-k-k-e 55 388 75969 75984 530329
GTAGGTAAGCAACCCA e-e-e-e-d(9)-k-k-e 61 388 75971 75986 528996
AGGTAGGTAAGCAACC e-e-e-d(10)-k-k-k 21 1318 75975 75990 528997
TTATAGGTAGGTAAGC e-e-e-d(10)-k-k-k 10 1319
75979 75994 528998 CACCTTATAGGTAGGT e-e-e-d(10)-k-k-k 22 1320 75981
75996 528999 ACCACCTTATAGGTAG e-e-e-d(10)-k-k-k 15 1321 75984 75999
529000 TAAACCACCTTATAGG e-e-e-d(10)-k-k-k 0 1322 75985 76000 529001
ATAAACCACCTTATAG e-e-e-d(10)-k-k-k 7 1323 75997 76012 529002
GGACAGCAGCTTATAA e-e-e-d(10)-k-k-k 12 1324 75998 76013 529003
AGGACAGCAGCTTATA e-e-e-d(10)-k-k-k 40 1325 75998 76013 530401
AGGACAGCAGCTTATA k-d(10)-k-e-k-e-e 41 1325 75999 76014 529004
CAGGACAGCAGCTTAT e-e-e-d(10)-k-k-k 38 1326 75999 76015 530031
CCAGGACAGCAGCTTAT e-e-k-d(10)-k-e-k-e 58 1327 75999 76014 530351
CAGGACAGCAGCTTAT e-k-d(10)-k-e-k-e 58 1326 75999 76014 530402
CAGGACAGCAGCTTAT k-d(10)-k-e-k-e-e 60 1326 76000 76016 530032
GCCAGGACAGCAGCTTA e-e-k-d(10)-k-e-k-e 74 1328 76000 76015 530099
CCAGGACAGCAGCTTA e-k-k-d(10)-k-k-e 73 1329 76000 76015 530146
CCAGGACAGCAGCTTA e-e-k-d(10)-k-k-e 70 1329 76000 76015 530196
CCAGGACAGCAGCTTA e-d-k-d(10)-k-k-e 67 1329 76000 76015 530246
CCAGGACAGCAGCTTA e-d-d-k-d(9)-k-k-e 39 1329 76000 76015 530296
CCAGGACAGCAGCTTA e-e-e-e-d(9)-k-k-e 67 1329 76000 76015 530352
CCAGGACAGCAGCTTA e-k-d(10)-k-e-k-e 67 1329 76001 76016 530100
GCCAGGACAGCAGCTT e-k-k-d(10)-k-k-e 77 1330 76001 76016 530147
GCCAGGACAGCAGCTT e-e-k-d(10)-k-k-e 84 1330 76001 76016 530197
GCCAGGACAGCAGCTT e-d-k-d(10)-k-k-e 71 1330 76001 76016 530247
GCCAGGACAGCAGCTT e-d-d-k-d(9)-k-k-e 53 1330 76001 76016 530297
GCCAGGACAGCAGCTT e-e-e-e-d(9)-k-k-e 75 1330 76001 76016 530403
GCCAGGACAGCAGCTT k-d(10)-k-e-k-e-e 77 1330 76002 76018 530033
TGGCCAGGACAGCAGCT e-e-k-d(10)-k-e-k-e 65 1331 76002 76017 530353
GGCCAGGACAGCAGCT e-k-d(10)-k-e-k-e 83 1332 76003 76018 530101
TGGCCAGGACAGCAGC e-k-k-d(10)-k-k-e 59 1333 76003 76018 530148
TGGCCAGGACAGCAGC e-e-k-d(10)-k-k-e 79 1333 76003 76018 530198
TGGCCAGGACAGCAGC e-d-k-d(10)-k-k-e 54 1333 76003 76018 530248
TGGCCAGGACAGCAGC e-d-d-k-d(9)-k-k-e 32 1333 76003 76018 530298
TGGCCAGGACAGCAGC e-e-e-e-d(9)-k-k-e 73 1333 76014 76029 530404
TTTGAATGCAGTGGCC k-d(10)-k-e-k-e-e 67 1334 76015 76031 530034
AATTTGAATGCAGTGGC e-e-k-d(10)-k-e-k-e 69 1335 76015 76030 530354
ATTTGAATGCAGTGGC e-k-d(10)-k-e-k-e 85 1336 76015 76030 530405
ATTTGAATGCAGTGGC k-d(10)-k-e-k-e-e 55 1336 76016 76032 530035
GAATTTGAATGCAGTGG e-e-k-d(10)-k-e-k-e 69 1337 76016 76031 530102
AATTTGAATGCAGTGG e-k-k-d(10)-k-k-e 71 1338 76016 76031 530149
AATTTGAATGCAGTGG e-e-k-d(10)-k-k-e 70 1338 76016 76031 530199
AATTTGAATGCAGTGG e-d-k-d(10)-k-k-e 58 1338 76016 76031 530249
AATTTGAATGCAGTGG e-d-d-k-d(9)-k-k-e 47 1338 76016 76031 530299
AATTTGAATGCAGTGG e-e-e-e-d(9)-k-k-e 47 1338 76016 76031 530355
AATTTGAATGCAGTGG e-k-d(10)-k-e-k-e 72 1338 76017 76032 530103
GAATTTGAATGCAGTG e-k-k-d(10)-k-k-e 77 390 76017 76032 530150
GAATTTGAATGCAGTG e-e-k-d(10)-k-k-e 73 390 76017 76032 530200
GAATTTGAATGCAGTG e-d-k-d(10)-k-k-e 63 390 76017 76032 530250
GAATTTGAATGCAGTG e-d-d-k-d(9)-k-k-e 59 390 76017 76032 530300
GAATTTGAATGCAGTG e-e-e-e-d(9)-k-k-e 65 390 76029 76044 530435
AAGTACACATTGGAAT k-d(10)-k-e-k-e-e 62 1339 76030 76046 530057
TGAAGTACACATTGGAA e-e-k-d(10)-k-e-k-e 69 1340 76030 76045 530385
GAAGTACACATTGGAA e-k-d(10)-k-e-k-e 70 1341 76031 76046 529005
TGAAGTACACATTGGA e-e-e-d(10)-k-k-k 64 392 76031 76046 530130
TGAAGTACACATTGGA e-k-k-d(10)-k-k-e 85 392 76031 76046 530180
TGAAGTACACATTGGA e-e-k-d(10)-k-k-e 82 392 76031 76046 530230
TGAAGTACACATTGGA e-d-k-d(10)-k-k-e 65 392 76031 76046 530280
TGAAGTACACATTGGA e-d-d-k-d(9)-k-k-e 75 392 76031 76046 530330
TGAAGTACACATTGGA e-e-e-e-d(9)-k-k-e 52 392 76039 76054 529006
TTACACTATGAAGTAC e-e-e-d(10)-k-k-k 16 1342 76116 76131 529007
AGTTAAAGTAGATACA e-e-e-d(10)-k-k-k 0 1343 76121 76136 529008
CTGGAAGTTAAAGTAG e-e-e-d(10)-k-k-k 30 397 76130 76145 529009
CGTTTATTTCTGGAAG e-e-e-d(10)-k-k-k 52 1344 76144 76159 529010
CGGTTCCTATATAACG e-e-e-d(10)-k-k-k 21 1345 76145 76160 529011
ACGGTTCCTATATAAC e-e-e-d(10)-k-k-k 10 1346
Example 14: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0475] Gapmers from the study described in Example 13 exhibiting
significant in vitro inhibition of STAT3 were tested at various
doses in HuVEC cells. Cells were plated at a density of 20,000
cells per well and transfected using electroporation with 39.1 nM,
156.3 nM, 625.0 nM, and 2,500.0 nM concentrations of antisense
oligonucleotide, as specified in Table 15. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0476] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 15. As illustrated
in Table 15, STAT3 mRNA levels were significantly reduced in a
dose-dependent manner in antisense oligonucleotide treated
cells.
TABLE-US-00015 TABLE 15 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells 39.1 156.3 625.0 2500.0 IC.sub.50 ISIS
No nM nM nM nM (.mu.M) 481464 6 51 84 94 0.2 518345 0 9 56 84 0.6
518349 16 3 47 83 0.6 519636 16 41 75 89 0.2 519637 24 43 84 94 0.2
519638 6 34 70 92 0.3 528403 0 4 39 77 0.9 528458 0 15 46 81 0.7
528475 1 10 51 76 0.7 528476 0 11 42 80 0.7 528869 25 19 67 86 0.3
528880 0 3 45 76 0.8 528937 0 1 49 82 0.8 528938 0 9 50 82 0.7
528942 0 20 59 88 0.5 528959 0 4 55 79 0.7 529022 0 0 52 81 0.8
529023 0 0 53 90 0.6 529024 0 0 47 80 0.8 529025 0 11 50 90 0.6
529026 0 31 73 96 0.4 529027 0 7 36 80 0.9 530021 6 30 69 92 0.3
530025 10 33 73 92 0.3 530026 3 18 52 80 0.6 530041 0 28 72 91 0.4
530048 0 22 53 83 0.5 530049 2 16 69 92 0.4 530053 0 16 66 90 0.5
530062 4 56 85 94 0.2 530066 0 12 46 84 0.7 530088 2 39 77 93 0.3
530091 3 12 59 84 0.5 530092 7 27 65 85 0.4 530093 7 46 79 96 0.2
530094 0 17 63 89 0.5 530109 9 30 72 94 0.3 530110 0 23 61 83 0.5
530112 0 13 42 90 0.6 530114 0 21 62 79 0.6 530116 22 40 71 92 0.2
530123 8 19 72 93 0.3 530130 0 33 64 89 0.4 530131 4 34 81 93 0.3
530135 22 38 79 94 0.2 530138 6 23 57 86 0.4 530140 4 22 62 91 0.4
530147 0 15 51 83 0.6 530156 7 41 81 96 0.2 530161 0 20 46 78 0.7
530170 0 29 67 90 0.4 530175 37 52 84 95 0.1 530178 8 24 70 86 0.4
530180 0 0 61 82 0.6 530181 0 27 52 86 0.5 530185 0 22 54 86 0.5
530190 17 17 60 87 0.4 530206 8 29 73 93 0.3 530225 0 27 67 91 0.4
530228 11 16 64 86 0.4 530261 5 25 57 91 0.4 530270 7 11 62 91 0.4
530275 14 34 73 91 0.3 530278 1 27 60 85 0.4 530285 5 20 61 82 0.5
530306 3 14 66 85 0.5 530311 6 27 59 86 0.4 530320 3 17 56 85 0.5
530325 5 35 70 92 0.3 530328 4 34 61 87 0.4 530340 8 34 74 90 0.3
530341 2 23 77 89 0.4 530344 16 20 64 89 0.4 530345 15 35 77 94 0.2
530346 5 24 66 92 0.4 530353 7 25 57 83 0.5 530354 2 24 60 81 0.5
530359 0 4 44 89 0.7 530361 13 30 59 92 0.3 530365 0 0 45 88 0.7
530367 0 15 49 88 0.5 530368 0 27 64 89 0.4 530369 10 28 78 95 0.3
530373 13 29 64 92 0.3 530375 0 14 53 90 0.5 530380 8 40 80 94 0.2
530390 11 21 66 90 0.4 530391 20 7 49 86 0.5 530411 5 19 81 95 0.3
530430 0 8 53 91 0.6 530466 0 4 53 87 0.6 530468 4 17 65 90 0.4
530469 8 38 86 94 0.2 530470 5 39 78 91 0.3 530471 0 21 69 91 0.4
530476 7 9 32 89 0.7 530477 0 12 64 87 0.5 530478 0 14 59 90 0.5
530485 0 10 61 85 0.5 530486 0 17 64 80 0.5 530492 0 25 71 89 0.4
530493 4 23 58 88 0.4 530507 5 17 65 82 0.5 530508 0 14 56 89 0.5
530509 0 17 54 86 0.5 530513 6 24 74 91 0.3 530514 1 7 52 78 0.7
530515 0 19 73 89 0.4
Example 15: Antisense Inhibition of Human STAT3 in HuVEC Cells
[0477] Additional antisense oligonucleotides were designed
targeting a STAT3 nucleic acid and were tested for their effects on
STAT3 mRNA in vitro. Cultured HuVEC cells at a density of 20,000
cells per well were transfected using electroporation with 1,000 nM
antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and STAT3
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS199, described hereinabove, was used to measure
mRNA levels. STAT3 mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of STAT3, relative to untreated control
cells.
[0478] The chimeric antisense oligonucleotides in Table 16 are
3-10-3 deoxy, MOE and cEt gapmers or 3-10-4 deoxy, MOE and cEt
gapmers. The 3-10-3 gapmers are 16 nucleosides in length, wherein
the central gap segment comprises ten 2'-deoxynucleosides and is
flanked on both sides (in the 5' and 3' directions) by wings
comprising 3 nucleosides each. The 3-10-4 gapmers are 17
nucleosides in length, wherein the central gap segment comprises
ten 2'-deoxynucleosides and is flanked on the 5' directions by a
wing comprising 3 nucleosides and on the 3' direction by a wing
comprising 4 nucleosides. The internucleoside linkages throughout
each gapmer are phosphorothioate (P.dbd.S) linkages. All cytosine
residues throughout each gapmer are 5'-methylcytosines. The
chemistry column of Table 16 presents the sugar motif of each
gapmer, where `e` indicates a 2'-MOE nucleoside, 1' indicates a
constrained ethyl (cEt) nucleoside, and `d` indicates a
2'-deoxynucleoside.
[0479] "Human Target start site" indicates the 5'-most nucleoside
to which the gapmer is targeted in the human gene sequence. "Human
Target stop site" indicates the 3'-most nucleoside to which the
gapmer is targeted in the human gene sequence. Each gapmer listed
in Table 16 is targeted to human STAT3 mRNA, designated herein as
SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each gapmer
listed in Table 17 is targeted to human STAT3 genomic sequence,
designated herein as SEQ ID NO: 2 (the complement of GENBANK
Accession No. NT_010755.14 truncated from nucleotides 4185000 to
4264000).
TABLE-US-00016 TABLE 16 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 1 Human
Human SEQ Start Stop ISIS % inhi- ID Site Site No Sequence
Chemistry bition NO 730 745 530011 GGAGATTCTCTACCAC
k-k-k-d(10)-e-e-e 73 53 1901 1916 529974 AAGCCCTTGCCAGCCA
e-e-e-d(10)-k-k-k 83 144 1901 1916 530012 AAGCCCTTGCCAGCCA
k-k-k-d(10)-e-e-e 73 144 2206 2221 530015 CCATGATCTTATAGCC
k-k-k-d(10)-e-e-e 38 175 3016 3031 481464 CTATTTGGATGTCAGC
k-k-k-d(10)-k-k-k 94 245 3461 3476 529975 AGCACCAAGGAGGCTG
e-e-e-d(10)-k-k-k 54 257 3461 3476 530013 AGCACCAAGGAGGCTG
k-k-k-d(10)-e-e-e 58 257 3584 3600 530018 TCCTTAAACCTTCCTAT
e-e-k-d(10)-k-e-k-e 46 1510 3585 3600 529944 TCCTTAAACCTTCCTA
e-e-e-d(10)-k-k-k 44 273 3585 3600 529977 TCCTTAAACCTTCCTA
k-k-k-d(10)-e-e-e 66 273 3592 3608 530019 TTAGATTCTCCTTAAAC
e-e-k-d(10)-k-e-k-e 43 1511 3593 3608 529945 TTAGATTCTCCTTAAA
e-e-e-d(10)-k-k-k 22 1166 3593 3608 529978 TTAGATTCTCCTTAAA
k-k-k-d(10)-e-e-e 49 1166 3596 3612 530020 ATGCTTAGATTCTCCTT
e-e-k-d(10)-k-e-k-e 85 1512 3597 3612 529979 ATGCTTAGATTCTCCT
k-k-k-d(10)-e-e-e 86 1169 3599 3614 529946 AAATGCTTAGATTCTC
e-e-e-d(10)-k-k-k 46 1172 3599 3614 529980 AAATGCTTAGATTCTC
k-k-k-d(10)-e-e-e 25 1172 3716 3731 529947 CAGATCAAGTCCAGGG
e-e-e-d(10)-k-k-k 68 1187 3716 3731 529981 CAGATCAAGTCCAGGG
k-k-k-d(10)-e-e-e 83 1187 3718 3733 529948 AGCAGATCAAGTCCAG
e-e-e-d(10)-k-k-k 75 1190 3718 3733 529982 AGCAGATCAAGTCCAG
k-k-k-d(10)-e-e-e 84 1190 4236 4251 529983 AGGTGTTCCCATACGC
k-k-k-d(10)-e-e-e 96 1245 4237 4252 529984 TAGGTGTTCCCATACG
k-k-k-d(10)-e-e-e 91 336 4437 4452 529949 CATCAACTGTCTCCAG
e-e-e-d(10)-k-k-k 48 354 4437 4452 529985 CATCAACTGTCTCCAG
k-k-k-d(10)-e-e-e 37 354 4439 4454 529950 CACATCAACTGTCTCC
e-e-e-d(10)-k-k-k 58 356 4439 4454 529986 CACATCAACTGTCTCC
k-k-k-d(10)-e-e-e 72 356 4646 4661 529987 TACAATCAGAGTTAAG
k-k-k-d(10)-e-e-e 0 378 4664 4679 529951 TCCTCTCAGAACTTTT
e-e-e-d(10)-k-k-k 38 380 4664 4679 529988 TCCTCTCAGAACTTTT
k-k-k-d(10)-e-e-e 40 380 4782 4797 530016 GTAGGTAAGCAACCCA
k-k-k-d(10)-e-e-e 60 388 4813 4828 529952 CCAGGACAGCAGCTTA
e-e-e-d(10)-k-k-k 65 1329 4813 4828 529989 CCAGGACAGCAGCTTA
k-k-k-d(10)-e-e-e 63 1329 4814 4829 529953 GCCAGGACAGCAGCTT
e-e-e-d(10)-k-k-k 65 1330 4814 4829 529990 GCCAGGACAGCAGCTT
k-k-k-d(10)-e-e-e 75 1330 4816 4831 529954 TGGCCAGGACAGCAGC
e-e-e-d(10)-k-k-k 79 1333 4816 4831 529991 TGGCCAGGACAGCAGC
k-k-k-d(10)-e-e-e 52 1333 4829 4844 529955 AATTTGAATGCAGTGG
e-e-e-d(10)-k-k-k 52 1338 4829 4844 529992 AATTTGAATGCAGTGG
k-k-k-d(10)-e-e-e 23 1338 4830 4845 529956 GAATTTGAATGCAGTG
e-e-e-d(10)-k-k-k 60 390 4830 4845 529993 GAATTTGAATGCAGTG
k-k-k-d(10)-e-e-e 51 390 4844 4859 530014 TGAAGTACACATTGGA
k-k-k-d(10)-e-e-e 67 392
TABLE-US-00017 TABLE 17 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 Human
Human SEQ Start Stop ISIS % inhi- ID Site Site No Sequence
Chemistry bition NO 74203 74218 CTATTTGGATGTCAGC 481464
k-k-k-d(10)-k-k-k 94 245 74772 74787 TCCTTAAACCTTCCTA 529944
e-e-e-d(10)-k-k-k 44 273 74780 74795 TTAGATTCTCCTTAAA 529945
e-e-e-d(10)-k-k-k 22 1166 74786 74801 AAATGCTTAGATTCTC 529946
e-e-e-d(10)-k-k-k 46 1172 74903 74918 CAGATCAAGTCCAGGG 529947
e-e-e-d(10)-k-k-k 68 1187 74905 74920 AGCAGATCAAGTCCAG 529948
e-e-e-d(10)-k-k-k 75 1190 75624 75639 CATCAACTGTCTCCAG 529949
e-e-e-d(10)-k-k-k 48 354 75626 75641 CACATCAACTGTCTCC 529950
e-e-e-d(10)-k-k-k 58 356 75851 75866 TCCTCTCAGAACTTTT 529951
e-e-e-d(10)-k-k-k 38 380 76000 76015 CCAGGACAGCAGCTTA 529952
e-e-e-d(10)-k-k-k 65 1329 76001 76016 GCCAGGACAGCAGCTT 529953
e-e-e-d(10)-k-k-k 65 1330 76003 76018 TGGCCAGGACAGCAGC 529954
e-e-e-d(10)-k-k-k 79 1333 76016 76031 AATTTGAATGCAGTGG 529955
e-e-e-d(10)-k-k-k 52 1338 76017 76032 GAATTTGAATGCAGTG 529956
e-e-e-d(10)-k-k-k 60 390 2340 2355 ACATACAGTAAGACCA 529957
e-e-e-d(10)-k-k-k 21 1376 2385 2400 CAAAAATTTACAACCC 529958
e-e-e-d(10)-k-k-k 10 1380 2410 2425 CCAATGCTTTATCAGC 529959
e-e-e-d(10)-k-k-k 51 1384 2671 2686 AGACTAAAATCAAGGC 529960
e-e-e-d(10)-k-k-k 30 1388 5002 5017 AACTGAAATTCCTTGG 529961
e-e-e-d(10)-k-k-k 52 1395 5701 5716 GTACTCTTTCAGTGGT 529962
e-e-e-d(10)-k-k-k 91 1399 8080 8095 GCAGATTTACCTTCCT 529963
e-e-e-d(10)-k-k-k 55 1409 9125 9140 CTGCCCCTATGTATAA 529964
e-e-e-d(10)-k-k-k 18 1413 11263 11278 CTGCCCCTATGTATAA 529964
e-e-e-d(10)-k-k-k 18 1413 9864 9879 GCTTCTTCCTGAGACA 529965
e-e-e-d(10)-k-k-k 52 1417 12347 12362 GCTTCTTCCTGAGACA 529965
e-e-e-d(10)-k-k-k 52 1417 9866 9881 TGGCTTCTTCCTGAGA 529966
e-e-e-d(10)-k-k-k 51 1420 12349 12364 TGGCTTCTTCCTGAGA 529966
e-e-e-d(10)-k-k-k 51 1420 9875 9890 TCCTCCTGTTGGCTTC 529967
e-e-e-d(10)-k-k-k 80 1425 12358 12373 TCCTCCTGTTGGCTTC 529967
e-e-e-d(10)-k-k-k 80 1425 9876 9891 TTCCTCCTGTTGGCTT 529968
e-e-e-d(10)-k-k-k 56 1426 12359 12374 TTCCTCCTGTTGGCTT 529968
e-e-e-d(10)-k-k-k 56 1426 9878 9893 GGTTCCTCCTGTTGGC 529969
e-e-e-d(10)-k-k-k 69 1429 12361 12376 GGTTCCTCCTGTTGGC 529969
e-e-e-d(10)-k-k-k 69 1429 16865 16880 TATAATTGTGTACTGG 529970
e-e-e-d(10)-k-k-k 41 1441 26063 26078 CAACTTTAGCCCCTTC 529971
e-e-e-d(10)-k-k-k 32 1452 48404 48419 CACACTTTCCATTCTA 529972
e-e-e-d(10)-k-k-k 30 1476 71616 71631 CAGTACAATTGCTTCA 529973
e-e-e-d(10)-k-k-k 49 1505 66138 66153 AAGCCCTTGCCAGCCA 529974
e-e-e-d(10)-k-k-k 83 144 74648 74663 AGCACCAAGGAGGCTG 529975
e-e-e-d(10)-k-k-k 54 257 2705 2720 CTAATGGTTCTTTGTG 529976
e-e-e-d(10)-k-k-k 25 411 74772 74787 TCCTTAAACCTTCCTA 529977
k-k-k-d(10)-e-e-e 66 273 74780 74795 TTAGATTCTCCTTAAA 529978
k-k-k-d(10)-e-e-e 49 1166 74784 74799 ATGCTTAGATTCTCCT 529979
k-k-k-d(10)-e-e-e 86 1169 74786 74801 AAATGCTTAGATTCTC 529980
k-k-k-d(10)-e-e-e 25 1172 74903 74918 CAGATCAAGTCCAGGG 529981
k-k-k-d(10)-e-e-e 83 1187 74905 74920 AGCAGATCAAGTCCAG 529982
k-k-k-d(10)-e-e-e 84 1190 75423 75438 AGGTGTTCCCATACGC 529983
k-k-k-d(10)-e-e-e 96 1245 75424 75439 TAGGTGTTCCCATACG 529984
k-k-k-d(10)-e-e-e 91 336 75624 75639 CATCAACTGTCTCCAG 529985
k-k-k-d(10)-e-e-e 37 354 75626 75641 CACATCAACTGTCTCC 529986
k-k-k-d(10)-e-e-e 72 356 75833 75848 TACAATCAGAGTTAAG 529987
k-k-k-d(10)-e-e-e 0 378 75851 75866 TCCTCTCAGAACTTTT 529988
k-k-k-d(10)-e-e-e 40 380 76000 76015 CCAGGACAGCAGCTTA 529989
k-k-k-d(10)-e-e-e 63 1329 76001 76016 GCCAGGACAGCAGCTT 529990
k-k-k-d(10)-e-e-e 75 1330 76003 76018 TGGCCAGGACAGCAGC 529991
k-k-k-d(10)-e-e-e 52 1333 76016 76031 AATTTGAATGCAGTGG 529992
k-k-k-d(10)-e-e-e 23 1338 76017 76032 GAATTTGAATGCAGTG 529993
k-k-k-d(10)-e-e-e 51 390 2340 2355 ACATACAGTAAGACCA 529994
k-k-k-d(10)-e-e-e 44 1376 2385 2400 CAAAAATTTACAACCC 529995
k-k-k-d(10)-e-e-e 0 1380 2410 2425 CCAATGCTTTATCAGC 529996
k-k-k-d(10)-e-e-e 65 1384 2671 2686 AGACTAAAATCAAGGC 529997
k-k-k-d(10)-e-e-e 44 1388 5002 5017 AACTGAAATTCCTTGG 529998
k-k-k-d(10)-e-e-e 35 1395 5701 5716 GTACTCTTTCAGTGGT 529999
k-k-k-d(10)-e-e-e 91 1399 8080 8095 GCAGATTTACCTTCCT 530000
k-k-k-d(10)-e-e-e 80 1409 9125 9140 CTGCCCCTATGTATAA 530001
k-k-k-d(10)-e-e-e 21 1413 11263 11278 CTGCCCCTATGTATAA 530001
k-k-k-d(10)-e-e-e 21 1413 9864 9879 GCTTCTTCCTGAGACA 530002
k-k-k-d(10)-e-e-e 74 1417 12347 12362 GCTTCTTCCTGAGACA 530002
k-k-k-d(10)-e-e-e 74 1417 9866 9881 TGGCTTCTTCCTGAGA 530003
k-k-k-d(10)-e-e-e 67 1420 12349 12364 TGGCTTCTTCCTGAGA 530003
k-k-k-d(10)-e-e-e 67 1420 9875 9890 TCCTCCTGTTGGCTTC 530004
k-k-k-d(10)-e-e-e 83 1425 12358 12373 TCCTCCTGTTGGCTTC 530004
k-k-k-d(10)-e-e-e 83 1425 9876 9891 TTCCTCCTGTTGGCTT 530005
k-k-k-d(10)-e-e-e 77 1426 12359 12374 TTCCTCCTGTTGGCTT 530005
k-k-k-d(10)-e-e-e 77 1426 9878 9893 GGTTCCTCCTGTTGGC 530006
k-k-k-d(10)-e-e-e 89 1427 12361 12376 GGTTCCTCCTGTTGGC 530006
k-k-k-d(10)-e-e-e 89 1427 16865 16880 TATAATTGTGTACTGG 530007
k-k-k-d(10)-e-e-e 21 1441 26063 26078 CAACTTTAGCCCCTTC 530008
k-k-k-d(10)-e-e-e 58 1452 48404 48419 CACACTTTCCATTCTA 530009
k-k-k-d(10)-e-e-e 59 1476 71616 71631 CAGTACAATTGCTTCA 530010
k-k-k-d(10)-e-e-e 75 1505 50694 50709 GGAGATTCTCTACCAC 530011
k-k-k-d(10)-e-e-e 73 53 66138 66153 AAGCCCTTGCCAGCCA 530012
k-k-k-d(10)-e-e-e 73 144 74648 74663 AGCACCAAGGAGGCTG 530013
k-k-k-d(10)-e-e-e 58 257 76031 76046 TGAAGTACACATTGGA 530014
k-k-k-d(10)-e-e-e 67 392 67068 67083 CCATGATCTTATAGCC 530015
k-k-k-d(10)-e-e-e 38 175 75969 75984 GTAGGTAAGCAACCCA 530016
k-k-k-d(10)-e-e-e 60 388 2705 2720 CTAATGGTTCTTTGTG 530017
k-k-k-d(10)-e-e-e 46 411 74771 74787 TCCTTAAACCTTCCTAT 530018
e-e-k-d(10)-k-e-k-e 46 1510 74779 74795 TTAGATTCTCCTTAAAC 530019
e-e-k-d(10)-k-e-k-e 43 1511 74783 74799 ATGCTTAGATTCTCCTT 530020
e-e-k-d(10)-k-e-k-e 85 1512
Example 16: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0480] Gapmers from the study described in Example 15 exhibiting
significant in vitro inhibition of STAT3 were tested at various
doses in HuVEC cells. Cells were plated at a density of 20,000
cells per well and transfected using electroporation with 39.1 nM,
156.3 nM, 625.0 nM, and 2,500.0 nM concentrations of antisense
oligonucleotide, as specified in Table 18. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0481] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 18. As illustrated
in Table 18, STAT3 mRNA levels were significantly reduced in a
dose-dependent manner in antisense oligonucleotide treated
cells.
TABLE-US-00018 TABLE 18 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells 39.1 156.3 625.0 2500.0 IC.sub.50 ISIS
No nM nM nM nM (.mu.M) 481464 41 78 92 91 0.04 529962 30 51 86 95
0.12 529979 0 43 81 95 0.27 529982 0 0 70 90 0.56 529983 31 67 87
94 0.08 529984 17 44 83 97 0.19 529999 29 51 83 96 0.13 530006 18
38 77 94 0.22 530020 2 39 75 92 0.28
Example 17: Effect of ISIS Antisense Oligonucleotides Targeting
STAT3 in the Treatment of an MDA-MB-231 Human Breast Cancer
Xenograft Model
[0482] BALB/c nude mice inoculated with human breast cancer cells
MDA-MB-231 were treated with ISIS 481464 and ISIS 481549. ISIS
481549 is cross-reactive with the mouse sequence (i.e, hybridizes
to the mouse sequence). Tumor growth and tolerability of
oligonucleotides in the mice was evaluated.
Treatment
[0483] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. MDA-MB-231 human breast cancer cells were
maintained in vitro as a monolayer culture in Leibovitz's L-15
medium supplemented with 10% heat-inactivated fetal calf serum, 100
U/mL penicillin, 100 .mu.g/mL streptomycin, and 2 mM L-glutamine.
The cells were maintained at 37.degree. C. in an atmosphere of 5%
CO.sub.2 in air. The tumor cells were routinely sub-cultured twice
weekly with trypsin-EDTA treatment. Cells growing at exponential
growth phase were harvested and counted for tumor inoculation.
[0484] Three groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated in the right flank with the
MDA-MB-231 tumor fragments (3 mm.times.2 mm.times.2 mm, which were
generated from tumor inoculation passage) for tumor development.
Antisense oligonucleotide treatment started at day 11 after tumor
inoculation when the mean tumor size reached approximately 100
mm.sup.3. Two of the groups were injected intraperitoneally twice a
week for 3 weeks with 25 mg/kg of ISIS 481464 or ISIS 481549. A
control group of mice was injected intraperitoneally twice a week
for 3 weeks with PBS.
[0485] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). Animals
were routinely checked for any effects of tumor growth on normal
behavior, such as mobility, food consumption, body weight changes,
and any other abnormal effect.
RNA Analysis
[0486] RNA was extracted from tumor tissue for real-time PCR
analysis of human STAT3 mRNA levels using primer probe set RTS199,
described hereinabove. Murine STAT3 mRNA levels were also measured
using primer probe set mSTAT3_LTS00664 (forward sequence
CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse
sequence ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO:
1514; probe sequence CTGCGGCAGTTCCTGGCACCTT, designated herein as
SEQ ID NO: 1515). Results are presented as percent inhibition of
STAT3, relative to PBS control, normalized to cyclophilin. As shown
in Table 19, treatment with ISIS antisense oligonucleotides
resulted in reduction of both human and murine STAT3 mRNA in
comparison to the PBS control.
TABLE-US-00019 TABLE 19 Percent inhibition of STAT3 mRNA in the
treatment groups relative to the PBS control in the MDA-MB-231
xenograft model human murine ISIS No STAT3 STAT3 481464 25 16
481549 22 44
Effect on Tumor Growth
[0487] Tumor size was measured twice weekly in two dimensions using
a caliper. Tumor volumes were calculated using the formula:
V=0.536.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size (900
mm.sup.3), and C as the median time (in days) for the tumors in the
control group to reach the same size. The T.sub.V/C.sub.V value
(expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 32).
[0488] The results are presented in Tables 20 and 21. The data
indicates that treatment with ISIS 481464 and ISIS 481549
significantly impeded tumor growth.
TABLE-US-00020 TABLE 20 Effect of antisense inhibition of STAT3 on
tumor growth in the MDA-MB-231 xenograft model Day PBS ISIS 481464
ISIS 481549 11 103 104 104 15 185 142 158 18 292 200 205 22 519 305
326 25 745 430 436 29 1,332 643 688 32 1,741 921 984
TABLE-US-00021 TABLE 21 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the MDA-MB-231 xenograft model Tumor
Size (mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 32 (%) at 900
mm.sup.3 PBS 1,741 -- -- ISIS 481464 921 53 6 ISIS 481549 984 57
5
Body Weight Measurements
[0489] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 22 and indicate that treatment with either ISIS 481464 or
ISIS 481549 does not cause significant weight gain or loss.
TABLE-US-00022 TABLE 22 Body weight measurements of mice in the
MDA-MB-231 xenograft model Day Day Day Day Day Day Day 11 15 18 22
25 29 32 PBS 21.8 22.2 22.5 22.5 22.9 23.4 24.0 ISIS 481464 22.3
22.8 23.0 23.2 23.8 23.9 24.9 ISIS 481549 22.2 22.5 23.0 23.3 23.7
23.7 24.6
Example 18: Effect of ISIS Antisense Oligonucleotides Targeting
STAT3 in the Treatment of an A431 Human Epidermoid Carcinoma
Xenograft Model
[0490] BALB/c nude mice inoculated with human epidermoid cancer
cells A431 were treated with ISIS 481464 and ISIS 481549. ISIS
481549 is cross-reactive with the mouse sequence (i.e, hybridizes
to the mouse sequence). The effect of the treatment on tumor growth
and tolerability in the mice was evaluated.
Treatment
[0491] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. A431 human epidermoid carcinoma cells were
maintained in vitro as a monolayer culture in DMEM medium
supplemented with 10% heat-inactivated fetal calf serum, 100 U/mL
penicillin, 100 .mu.g/mL streptomycin, and 2 mM L-glutamine. The
cells were maintained at 37.degree. C. in an atmosphere of 5%
CO.sub.2 in air. The tumor cells were routinely sub-cultured twice
weekly with trypsin-EDTA treatment. Cells growing in an exponential
growth phase were harvested and counted for tumor inoculation.
[0492] Three groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated subcutaneously with
5.times.10.sup.6 A431 tumor cells for tumor development. Antisense
oligonucleotide treatment started at day 8 after tumor inoculation
when the mean tumor size reached approximately 95 mm.sup.3. Two of
the groups were injected intraperitoneally twice a week for 4 weeks
with 25 mg/kg of ISIS 481464 or ISIS 481549. A control group of
mice was injected intraperitoneally twice a week for 4 weeks with
PBS.
[0493] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). At the
time of routine monitoring, the animals were checked for any
effects of tumor growth on normal behavior, such as mobility, food
consumption, body weight changes and any other abnormal effect.
RNA Analysis
[0494] RNA was extracted from tumor tissue for real-time PCR
analysis of human STAT3 mRNA levels using primer probe set RTS199,
described hereinabove. Murine STAT3 mRNA levels were also measured
using primer probe set mSTAT3_LTS00664, described hereinabove.
Results are presented as percent inhibition of STAT3, relative to
PBS control, normalized to cyclophilin. As shown in Table 23,
treatment with ISIS antisense oligonucleotides resulted in
reduction of both human and murine STAT3 mRNA in comparison to the
PBS control.
TABLE-US-00023 TABLE 23 Inhibition of STAT3 mRNA in the treatment
groups relative to the PBS control in the A431 xenograft model
human murine ISIS No STAT3 STAT3 481464 63 26 481549 29 38
Protein Analysis
[0495] Protein was extracted from tumor lysates for western
analysis of human STAT3 protein levels with STAT3 monoclonal
antibody (Cell Signaling Technology, Cat #9135). Results are
presented as percent inhibition of STAT3, relative to PBS control,
normalized to the house-keeping protein, COX-II. As shown in Table
24, treatment with ISIS antisense oligonucleotides resulted in
reduction of STAT3 protein levels in comparison to the PBS
control.
TABLE-US-00024 TABLE 24 Inhibition of STAT3 protein levels in the
treatment groups relative to the PBS control in the A431 xenograft
model ISIS No % reduction 481464 99 481549 22
Effect on Tumor Growth
[0496] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.5.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size (800
mm.sup.3), and C as the median time (in days) for the tumors in the
control group to reach the same size. The T.sub.V/C.sub.V value
(expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 33).
[0497] The results are presented in Tables 25 and 26. The data
indicates that treatment with either ISIS 481464 or ISIS 481549
significantly impeded tumor growth.
TABLE-US-00025 TABLE 25 Effect of antisense inhibition of STAT3 on
tumor growth in the A431 xenograft model Days PBS ISIS 481464 ISIS
481549 8 94 95 95 14 178 157 132 17 308 261 202 21 528 412 304 24
682 552 426 28 875 698 555 31 1,071 898 716 33 1,210 1,030 858
TABLE-US-00026 TABLE 26 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the A431 xenograft model Tumor Size
(mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 33 (%) at 800
mm.sup.3 PBS 1,210 -- -- ISIS 481464 1,030 85 3 ISIS 481549 858 71
6
Body Weight Measurements
[0498] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 27 and indicate that treatment with either ISIS 481464 or
ISIS 481549 does not affect the overall health of the mice.
TABLE-US-00027 TABLE 27 Body weight measurements of mice in the
A431 xenograft model Day Day Day Day Day Day Day Day 8 14 17 21 24
28 31 33 PBS 20 20 20 21 21 21 22 22 ISIS 481464 20 21 21 21 21 22
22 23 ISIS 481549 20 20 21 21 21 22 22 22
Example 19: Effect of ISIS Antisense Oligonucleotides Targeting
STAT3 in the Treatment of an NCI-H460 Human Non-Small Cell Lung
Cancer (NSCLC) Xenograft Model
[0499] BALB/c nude mice inoculated with human NCI-H460 human NSCLC
were treated with ISIS 491464, which targets human STAT3, and ISIS
481549, which targets both human and murine STAT3. The effect of
the treatment on tumor growth and tolerability in the mice was
evaluated.
Treatment
[0500] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. NCI-H460 human NSCLC cells were maintained
in vitro as a monolayer culture in RPMI-1640 medium supplemented
with 10% heat-inactivated fetal calf serum, 100 U/mL penicillin,
100 .mu.g/mL streptomycin, and 2 mM L-glutamine. The cells were
maintained at 37.degree. C. in an atmosphere of 5% CO.sub.2 in air.
The tumor cells were routinely sub-cultured twice weekly with
trypsin-EDTA treatment. Cells growing in an exponential growth
phase were harvested and counted for tumor inoculation.
[0501] Three groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated subcutaneously with
2.times.10.sup.6 NCI-H460 tumor cells for tumor development.
Antisense oligonucleotide treatment started at day 6 after tumor
inoculation when the mean tumor size reached approximately 100
mm.sup.3. Two of the groups were injected intraperitoneally twice a
week for 3 weeks with 25 mg/kg of ISIS 481464 or ISIS 481549. The
third group of mice was injected intraperitoneally twice a week for
3 weeks with PBS, and served as the control group.
[0502] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). At the
time of routine monitoring, the animals were checked for any
effects of tumor growth on normal behavior, such as mobility, food
consumption, body weight changes and any other abnormal effect.
RNA Analysis
[0503] RNA was extracted from tumor tissue for real-time PCR
analysis of human STAT3 mRNA levels using primer probe set RTS199,
described hereinabove. Murine STAT3 mRNA levels were also measured
using primer probe set mSTAT3_LTS00664, described hereinabove.
Results are presented as percent inhibition of STAT3, relative to
PBS control, normalized to cyclophilin. As shown in Table 28,
treatment with ISIS antisense oligonucleotides resulted in
reduction of both human and murine STAT3 mRNA in comparison to the
PBS control.
TABLE-US-00028 TABLE 28 Inhibition of STAT3 mRNA in the treatment
groups relative to the PBS control in the NCI-H460 xenograft model
human murine ISIS No STAT3 STAT3 481464 34 0 481549 20 35
Effect on Tumor Growth
[0504] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.5.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size
(1,500 mm.sup.3), and C as the median time (in days) for the tumors
in the control group to reach the same size. The T.sub.V/C.sub.V
value (expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 20).
[0505] The results are presented in Tables 29 and 30. The data
indicates that treatment with either ISIS 481464 or ISIS 481549
significantly impeded tumor growth.
TABLE-US-00029 TABLE 29 Effect of antisense inhibition of STAT3 on
tumor growth in the NCI-H460 xenograft model Days PBS ISIS 481464
ISIS 481549 6 104 104 103 8 303 197 197 11 746 498 443 13 1,175 676
654 15 1,642 982 954 18 2,277 1,571 1,577 20 2,859 1,996 2,093 22
-- 2,609 2,679
TABLE-US-00030 TABLE 30 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the NCI-H460 xenograft model Tumor Size
(mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 20 (%) at 1,500
mm.sup.3 PBS 1,210 -- -- ISIS 481464 1,030 85 3 ISIS 481549 858 71
6
Body Weight Measurements
[0506] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 31 and indicate that treatment with either ISIS 481464 or
ISIS 481549 does not affect the overall health of the mice.
TABLE-US-00031 TABLE 31 Body weight measurements of mice in the
NCI-H460 xenograft model Day Day Day Day Day Day Day Day 6 8 11 13
15 18 20 22 PBS 20 20 20 20 20 20 21 -- ISIS 481464 20 20 20 20 19
19 20 20 ISIS 481549 20 20 20 20 20 19 20 20
Example 20: Effect of Antisense Inhibition of Human STAT3 in a
Human Glioblastoma Orthotopic Mouse Model
[0507] NU/J mice orthotopically implanted with human glioblastoma
cells were treated with ISIS 455291, a 5-10-5 MOE gapmer having a
sequence of CAGCAGATCAAGTCCAGGGA (SEQ ID NO: 1590). The effect of
the treatment on tumor growth and tolerability in the mice was
evaluated.
Treatment
[0508] Thirty NU/J mice were stereotactically implanted in the
right frontal lobe with 5.times.10.sup.5 U-87 MG-luc2 cells. On day
15 after tumor cell implantation, 15 of these mice were dosed
intracranially with a bolus injection at the site of tumor
implantation with 100 .mu.g of ISIS 455291, which was dissolved in
2 .mu.L of PBS. The remaining 15 mice were dosed intracranially
with a bolus injection at the site of tumor implantation with 2
.mu.L of PBS. The second group of mice served as the control
group.
Analysis
[0509] On day 18 after tumor transplantation, five mice from each
group were euthanized by CO.sub.2 inhalation and brain samples were
collected for RNA analysis. RNA was extracted from tumor tissue for
real-time PCR analysis of human STAT3 mRNA levels using primer
probe set RTS199, described hereinabove. Treatment with ISIS 455291
resulted in 27% reduction of human STAT3 mRNA in the tumor tissue
in comparison to the PBS control.
[0510] The remaining mice in each group were monitored regularly up
to 2 weeks for survival analysis. The median survival for the PBS
control group was 30.5 days. The medial survival for the ISIS
oligonucleotide-treated mice was 35 days. The P value was
0.2088.
Example 21: Effect of Treatment with ISIS 481549 in APC/Min.sup.+
Mice
[0511] The effect of treatment with ISIS 481549 on STAT3 mRNA
levels and intestinal adenoma numbers in the APC/Min.sup.+ mouse
model was evaluated. The APC/Min.sup.+ mice strain is predisposed
to spontaneous intestinal adenoma formation throughout the entire
intestinal tract at an early age (Moser A. R. et al., Science 1990.
247: 322-324).
Treatment
[0512] Two groups of 4 male nine-week-old APC/Min+ mice were
injected subcutaneously with 5 mg/kg or 25 mg/kg of ISIS 481549
administered five times a week (total weekly doses of 25 mg/kg and
125 mg/kg, respectively) for 4 weeks. A group of 4 male
nine-week-old APC/Min+ mice were injected subcutaneously with 50
mg/kg of control oligonucleotide, ISIS 141923, administered five
times a week (total weekly dose of 250 mg/kg) for 4 weeks. A
control group of 4 male nine-week-old APC/Min+ mice were injected
subcutaneously with PBS administered five times a week for 4 weeks.
Mice were euthanized with isoflurance followed by cervical
dislocation 48 hrs after the final injection.
[0513] Colons and intestines were removed, separated from each
other and cleaned. Approximately 5 cm of the upper intestinal tract
was excised and homogenized in 2.5 mL RLT buffer (Qiagen) with 1%
of 2-mercaptoethanol (RLT-BMe) and placed in dry ice. The colon was
cut in half and the proximal half of the tissue was homogenized in
2.5 mL RLT-BMe and placed in dry ice. A small piece of the liver
(0.2 g) was excised and homogenized in RLT-BMe and placed in dry
ice.
RNA Analysis
[0514] RNA was isolated from the tissues using PureLink.TM. Total
RNA Purification kit (Invitrogen; #12173-011A), according to the
manufacturer's protocol. RT-PCR was performed using the StepOnePlus
system (Applied Biosystems), according to the manufacturer's
protocol. Murine primer probe set mSTAT3_LTS000664 (forward primer
CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse
primer ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO:
1514; probe CTGCGGCAGTTCCTGGCACCTT, designated herein as SEQ ID NO:
1515) was used for measuring STAT3 mRNA levels. The mRNA level of
the housekeeping gene, Cyclophilin, was measured with the primer
probe set mcyclo_24 (forward primer TCGCCGCTTGCTGCA, designated
herein as SEQ ID NO: 1516; reverse primer ATCGGCCGTGATGTCGA,
designated herein as SEQ ID NO: 1517; probe
CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 1518) and
was used to normalize STAT3 mRNA levels.
[0515] Treatment with ISIS 481549 resulted in statistically
significant reduction in STAT3 mRNA expression in liver at 25
mg/kg/wk and 125 mg/kg/wk dosing in liver, small intestine and
colon (Table 32) compared to the PBS control. Significant
differences between the treatment and the control groups were
determined using the Student's two tailed t test (p<0.05).
TABLE-US-00032 TABLE 32 Percent inhibition of STAT3 mRNA expression
levels in APC/Min+ mice Treatment Small (mg/kg/week) Liver
intestine Colon ISIS 141923 (250) 0 0 0 ISIS 481549 (125) 98 73 82
ISIS 481549 (25) 79 41 32
Adenoma Number Analysis
[0516] Histological analysis of the small intestine was performed
to microscopically evaluate adenoma numbers. Treatment with ISIS
481549 at 125 mg/kg/week resulted in a statistically significant
decrease in tumor number compared to the PBS control (Table 33).
Significant differences between the treatment and the control
groups were determined using the Student's two-tailed t test
(p<0.05).
TABLE-US-00033 TABLE 33 Adenoma counts in APC/Min+ mice Treatment
Colon (mg/kg/week) count ISIS 141923 (250) 5 ISIS 481549 (125) 1
ISIS 481549 (25) 5 PBS 6
Example 22: Effect of Antisense Oligonucleotides Targeting STAT3 in
the Treatment of a PC-9 NSCLC Xenograft Model
[0517] BALB/c nude mice (Charles River) inoculated with the human
non-small cell lung cancer cell line, PC-9, were treated with ISIS
481549 and ISIS 481464. Tumor growth and STAT3 target reduction in
the mice were evaluated.
Treatment
[0518] Six- to eight-week old female BALB/c nude mice were
inoculated subcutaneously with 7.times.10.sup.6 PC-9 human NSCLC
cells. Mice that displayed a mean tumor volume of 150-200 mm.sup.3
were selected and randomized into different treatment groups. Two
groups of 7 mice were injected subcutaneously with 25 mg/kg of ISIS
481549 or ISIS 481464 administered five times a week (total weekly
doses of 125 mg/kg) for 6 weeks. A group of 7 mice were injected
subcutaneously with 25 mg/kg of ISIS 347526 (TCTTATGTTTCCGAACCGTT,
no known murine or human target, designated herein as SEQ ID NO:
1519) administered five times a week (total weekly doses of 125
mg/kg) for 6 weeks. A final dose of antisense oligonucleotide was
given 24 hrs before the mice were euthanized.
RNA Analysis
[0519] Tumors were harvested and RNA was isolated using Qiagen
RNAeasy Mini Kit (#74106), according to the manufacturer's
protocol. STAT3 mRNA levels were measured using an ABI StepOnePlus
RT-PCR instrument with human STAT3 primer probe set RTS2033
(forward primer GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse primer TTCTGCTAATGACGTTATCCAGTTTT, designated herein
as SEQ ID NO: 1521; probe CTGCCTAGATCGGC, designated herein as SEQ
ID NO: 1522). The mRNA levels of the housekeeping gene, GAPDH, was
measured with the human primer probe set (forward primer
GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 1523; reverse
primer GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 1524;
probe CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 1525)
and was used to normalize RNA levels. The results are presented in
Table 34 and indicate that the antisense oligonucleotides reduced
STAT3 mRNA levels.
TABLE-US-00034 TABLE 34 Percent inhibition of STAT3 mRNA expression
levels in the NSCLC xenograft model compared to the ASO control
Treatment (mg/kg) % inhibition ISIS 481464 (25) 40 ISIS 481549 (25)
22
Tumor Growth Analysis
[0520] Tumors were measured regularly throughout the study period.
Tumor growth inhibition (TGI) was calculated using the formula
TGI=[1-(Xof STAT3ASO group(final))-Xof STAT3 ASO group(day1))/(Xof
control ASO group(final)-Xof control ASO group(day1))].times.100%,
where X=mean tumor volume.
[0521] The difference of the treatment group from the control group
was evaluated using the ANOVA statistical test. The results are
presented in Table 35. The data indicates that tumor growth was
significantly inhibited by ISIS 481464 with TGI of 97% by day 52.
Treatment by ISIS 481549 inhibited PC-9 tumor growth by 78%.
TABLE-US-00035 TABLE 35 Tumor growth measurements in the NSCLC
xenograft model Day 10 13 18 20 25 28 31 34 38 42 45 48 52 ISIS
481464 233 241 267 240 229 201 201 254 218 222 221 236 255 ISIS
481549 233 217 239 188 237 299 326 318 328 410 341 389 398 ISIS
347526 240 279 295 344 295 354 383 407 540 573 655 890 940
Body Weight Analysis
[0522] Body weights were measured regularly throughout the study
period. The results are presented in Table 36 and indicate that
there were no significant changes in body weight of the treatment
groups compared to the control groups.
TABLE-US-00036 TABLE 36 Body weight measurements in the NSCLC
xenograft model Day 10 13 18 20 25 28 31 34 38 42 45 48 52 ISIS
481464 18.65 19.44 18.98 19.66 19.40 19.45 19.89 20.26 19.86 20.31
20.13 20.03 20.11 ISIS 481549 18.13 19.06 18.65 19.30 19.31 19.36
19.23 19.18 18.28 17.21 16.49 15.48 15.01 ISIS 347526 18.34 19.29
19.05 19.65 19.63 19.98 20.08 20.69 19.90 20.19 20.25 20.09
20.19
Example 23: Effect of ISIS 481464 in the Treatment of an LG-476
NSCLC Xenograft Model
[0523] NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wjl/SzJ mice (NSG; JAX
#5557), which are immunodeficient, were inoculated with the human
non-small cell lung cancer cell line, LG-476 (Jackson Laboratory)
and treated with ISIS 481464. Tumor growth and STAT3 target
reduction in the mice was evaluated.
Treatment
[0524] Four- to six-week old female NSG mice were inoculated
subcutaneously with LG-476 human NSCLC cells and monitored three
times weekly for clinical observations, body weights and tumor
volume. Once tumors reached 1,000 mm.sup.3, the tumors were
harvested and fragmented. Tumor fragments measuring 3-5 mm.sup.3
were implanted subcutaneously into the right hind flank of 30 NSG
mice. The mice were monitored three times a week. When individual
tumors reached a volume of 200-250 mm.sup.3, the mice were randomly
assigned to 2 groups and were injected with 25 mg/kg of ISIS 481464
or PBS administered 5 times a week (weekly doses of 125 mg/kg) for
3 weeks. Tumors were harvested 24 hrs after the last dose.
RNA Analysis
[0525] Lysates from tumors were prepared using an ABI StepOnePlus
RT-PCR instrument with a human-specific primer probe set RTS2033.
The mRNA levels of the housekeeping gene, Cyclophilin, was measured
with a human-specific primer probe set (forward primer
GACGGCGAGCCCTTGG, designated herein as SEQ ID NO: 1526; reverse
primer TGCTGTCTTTGGGACCTTGTC, designated herein as SEQ ID NO: 1527;
probe CCGCGTCTCCTTTGAGCTGTTTGC, designated herein as SEQ ID NO:
1528). Significant differences between the treatment and the
control groups were determined using the Student's two-tailed t
test (p<0.05).
[0526] Treatment with ISIS 481464 resulted in 43% reduction of
STAT3 mRNA levels in the tumor mass compared to the PBS control
(FIG. 8), which is statistically significant.
Protein Analysis
[0527] Total cell lysates were prepared by homogenizing tumor in
ice-cold radio-immunoprecipitation assay (RIPA) buffer containing
protease inhibitor cocktail. The lysates were analyzed by western
blotting using STAT3 antibody (Abcam Antibodies, #ab32500). The
house-keeping proteins, cytochrome oxidase II (COXII; #ab79393) and
survivin (#ab76424) were also probed. STAT3 levels were normalized
to either COXII protein or survivin protein and quantified using
ImageJ software.
[0528] Treatment with ISIS 481464 resulted in 50% reduction in
STAT3 protein levels in the tumor mass compared to the PBS control,
which is statistically significant.
Tumor Growth Analysis
[0529] Tumors were measured regularly throughout the study period.
Treatment with ISIS 481464 resulted in decrease in tumor volume of
approximately 39% compared to the PBS control.
Example 24: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in PC9 Cells
[0530] ISIS 481464, from the studies described above, was further
tested at different doses in PC9 cells, a non small cell lung
carcinoma cell line. Cells were plated at a density of 3,000 cells
per well. Cells were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5
.mu.M, 2.5 .mu.M, and 10.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 37. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS2033 (forward sequence GAGGCCCGCCCAACA, designated herein as
SEQ ID NO: 1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT,
designated herein as SEQ ID NO: 1521; probe sequence
CTGCCTAGATCGGC, designated herein as SEQ ID NO: 1522) was used to
measure mRNA levels. STAT3 mRNA levels were adjusted according to
content of beta-actin, a housekeeping gene, as measured by human
primer probe set HTS5002 (forward sequence
CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529;
reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID
NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated
herein as SEQ ID NO: 1531). Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0531] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 37. As illustrated
in Table 37, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00037 TABLE 37 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by PC9
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 20 51 84 94 96 0.19
Example 25: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in C42B Cells
[0532] ISIS 481464, from the studies described above, was further
tested at different doses in C42B cells, a prostate cancer cell
line. Cells were plated at a density of 3,000 cells per well. Cells
were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 2.5 .mu.M,
and 10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 38. After approximately 24 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0533] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 38. As illustrated
in Table 38, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00038 TABLE 38 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by C42B
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 21 38 75 87 96 0.45
Example 26: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in Colo201 Cells
[0534] ISIS 481464, from the studies described above, was further
tested at different doses in Colo201 cells, a colorectal cancer
cell line. Cells were plated at a density of 3,000 cells per well.
Cells were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 2.5 and
10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 39. After approximately 24 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0535] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 39. As illustrated
in Table 39, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00039 TABLE 39 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by Colo201
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 36 53 81 93 96 0.09
Example 27: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in BT474M1 Cells
[0536] ISIS 481464, from the studies described above, was further
tested at different doses in BT474M1 cells, a breast cancer cell
line. Cells were plated at a density of 3,000 cells per well. Cells
were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 2.5 .mu.M,
and 10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 40. After approximately 24 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0537] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 40. As illustrated
in Table 40, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00040 TABLE 40 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by BT474M1
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 481464 13 25 74 94 95 0.24
Example 28: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in H929 Cells
[0538] ISIS 481464, from the studies described above, was further
tested at different doses in H929 cells, a multiple myeloma cell
line. Cells were plated at a density of 10,000-12,000 cells per
well. Cells were incubated with 0.01 .mu.M, 0.5 .mu.M, 2.5 .mu.M,
and 10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 41. After approximately 72 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0539] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 41. As illustrated
in Table 41, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00041 TABLE 41 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H929
cells 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M
(.mu.M) 481464 91 95 95 95 0.04
Example 29: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in MM1R Cells
[0540] ISIS 481464, from the studies described above, was further
tested at different doses in MM1R cells, a multiple myeloma cell
line. Cells were plated at a density of 10,000-12,000 cells per
well. Cells were incubated with 0.01 .mu.M, 0.5 .mu.M, 2.5 .mu.M,
and 10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 42. After approximately 72 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0541] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 42. As illustrated
in Table 42, ISIS 481464 was able to penetrate the cell
membrane.
TABLE-US-00042 TABLE 42 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by MM1R
cells 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M
(.mu.M) 481464 91 96 95 95 0.04
Example 30: Effect of Antisense Oligonucleotides Targeting STAT3 in
the Treatment of an SK-OV3 Ovarian Cancer Xenograft Model
[0542] BALB/c nude mice were inoculated with the human ovarian
cancer cell line, SK-OV3 and treated with ISIS 481464 or ISIS
481549. ISIS 481549 is cross-reactive with the mouse sequence
(i.e., hybridizes to the mouse sequence).
Study 1
[0543] Human ovarian cancer SK-OV3 cells (approximately 100
mm.sup.3) were intraperitoneally injected into nude mice. Ten days
later, the mice were inoculated subcutaneously with 25 mg/kg of
ISIS 481464 or ISIS 481549, administered twice a week for 11 weeks.
The mice were euthanized 24 hrs after the final dose.
RNA Analysis
[0544] Lysates were prepared by using the RNA extraction kit
(Invitrogen) in for RT-PCR analysis of STAT3 mRNA levels, using
human primer probe set (RTS2033) and mouse primer probe set
(mSTAT3-LTS0664). The results are presented in Table 43. The
results are presented as percent inhibition of STAT3, relative to
the PBS control. The data indicates that treatment with ISIS
antisense oligonucleotides resulted in reduction of both human and
murine STAT3 mRNA in comparison to the PBS control.
TABLE-US-00043 TABLE 43 Percent inhibition of STAT3 mRNA in the
treatment groups relative to the PBS control in the SK-OV3
xenograft model human murine ISIS No STAT3 STAT3 481464 63 0 481549
21 61
Protein Analysis
[0545] Lysates were prepared with RIPA buffer for western blot
analysis of STAT3 protein levels, using an antibody against
phosphorylated STAT3 (Cell Signaling). The results are presented in
FIG. 1. The data indicates that treatment with ISIS 481549 resulted
in reduction of phosphorylated STAT3 protein in comparison to the
PBS control.
IL-6 Level Analysis
[0546] Lysates were prepared by using the RNA extraction kit
(Invitrogen) for RT-PCR analysis of IL-6 mRNA levels, using mouse
primer probe set mIL6-LTS00629. The results are presented in Table
44. The results are presented as percent inhibition of IL-6,
relative to the PBS control. The data indicates that treatment with
ISIS 481549 resulted in significant reduction of both IL-6 mRNA in
comparison to the PBS control.
TABLE-US-00044 TABLE 44 Percent inhibition of IL-6 mRNA in the
treatment groups relative to the PBS control in the SK-OV3
xenograft model Murine ISIS No IL-6 (%) 481464 8 481549 54
Tumor Weight Analysis
[0547] Tumors were harvested. Tumor weights were measured and the
results are presented in Table 45. The results are presented as
percent of the PBS control tumor weight. The data indicates that
treatment with ISIS 481549 resulted in significant reduction of
tumor weight in comparison to the PBS control.
TABLE-US-00045 TABLE 45 Percent decrease of tumor weight in the
treatment groups relative to the PBS control in the SK-OV3
xenograft model ISIS No Weight (%) 481464 58 481549 89
Study 2
[0548] Human ovarian cancer SK-OV3 cells (approximately 100
mm.sup.3) were subcutaneously inoculated into nude mice. Ten days
later, the mice were inoculated intraperitoneally with 50 mg/kg of
either ISIS 481464 or 50 mg/kg of ISIS 481464 and ISIS 481549 in
combination, administered five times a week for 6 weeks. The mice
were euthanized 24 hrs after the final dose.
Tumor Volume Analysis
[0549] Tumors were measured regularly using Vernier calipers and
tumor volumes were calculated using the formula, tumor
volume=1/2(length.times.width.sup.2). The results are presented in
FIG. 2. The data indicates that treatment of the mice with a
combination of ISIS 481464 and ISIS 481549 resulted in significant
inhibition of tumor growth.
Example 31: Tolerability Study of ISIS 481464 in Cynomolgus
Monkeys
[0550] The efficacy and tolerability of ISIS 481464 in cynomolgus
monkeys was evaluated.
Treatment
[0551] Male and female naive cynomolgus monkeys were assigned to
five treatment groups. Three groups of 5 monkeys each received
loading doses of 3 mg/kg, 10 mg/kg or 30 mg/kg every two days
during the first week of the study (on Days 1, 3, 5 and 7) followed
by once weekly administration thereafter (commencing on Day 14). A
control group of 5 monkeys received PBS every two days during the
first week of the study (on Days 1, 3, 5 and 7) as the loading
dose, followed by once weekly administration thereafter (commencing
on Day 14). These doses were administered via a one-hour
intravenous (i.v.) infusion. A fifth group of 5 monkeys received
loading doses of 30 mg/kg administered subcutaneously every two
days during the first week of the study (on Days 1, 3, 5 and 7)
followed by once weekly subcutaneous (s.c.) administration
thereafter (commencing on Day 14).
[0552] For the i.v. infusions, the animals were restrained, without
sedation, to a chair restraint. A catheter was placed in one of the
cephalic veins and ISIS 481464 solution at the appropriate dose was
infused at a constant rate over approximately 1 hour using a
calibrated syringe pump (Stoelting Co, USA). The dosing site was
rotated between right and left arms and the dosing time was
recorded. The infusion rate was selected to deliver the calculated
dose volume and the accuracy of the pumps was monitored and
recorded for each dose. At the end of infusion period, the dosing
solution was switched to PBS. In case of s.c. administration, the
injections were performed in clock-wise rotation at 4 sites on the
back. Injection sites were maintained by periodic shaving and
permanently numbered by tattooing.
[0553] Three monkeys from each group were sacrificed on day 44,
which was approximately 48 hrs following the last dose on day 42.
The other 2 monkeys from each group are being observed for
toxicological effects. Scheduled euthanasia of the animals was
conducted by exsanguination after ketamine/xylazine-induced
anesthesia and administration of sodium pentobarbital. The
protocols described in the Example were approved by the
Institutional Animal Care and Use Committee (IACUC).
RNA Analysis
[0554] Liver tissue was homogenized in 3 mL of RLT lysis buffer
(Qiagen) supplemented with 1% of 2-mercaptoethanol (Sigma). RNA was
purified from the resulting homogenate using Qiagen RNeasy 96-well
plate for RNA purification, according to the manufacturer's
protocol. After purification, the RNA samples were subjected to
RT-PCR analysis using Perkin-Elmer ABI Prism 7700 Sequence
Detection System and STAT3 primer probe set RTS3235 (forward primer
AAGTTTATCTGTGTGACACCAACGA, designated herein as SEQ ID NO: 1532;
reverse primer CTTCACCATTATTTCCAAACTGCAT, designated herein as SEQ
ID NO: 1533; probe TGCCGATGTCCCCCCGCA, designated herein as SEQ ID
NO: 1534). STAT3 mRNA levels were normalized to monkey
CyclophilinA, which was quantitated using primer probe set
mk_cycloA_2.sup.nd (forward primer TGCTGGACCCAACACAAATG, designated
herein as SEQ ID NO: 1535; reverse primer TGCCATCCAACCACTCAGTC,
designated herein as SEQ ID NO: 1536; probe
TTCCCAGTTTTTCATCTGCACTGCCAX, designated herein as SEQ ID NO:
1537).
[0555] Treatment with ISIS 481464 at 30 mg/kg dose concentrations
either via i.v. infusion or s.c. injection resulted in
statistically significant reduction in STAT3 mRNA expression in
liver (Table 46) compared to the PBS control. Significant
differences between the treatment and the control groups were
determined using the Student's t test (p<0.05).
TABLE-US-00046 TABLE 46 Percent inhibition of STAT3 mRNA levels in
cynomolgus monkeys Treatment % inhibition 3 mg i.v. 0 10 mg i.v. 7
30 mg i.v. 52 30 mg s.c. 51
Protein Analysis
[0556] Liver tissue was homogenized in 1 mL of ice-cold RIPA buffer
(Sigma) containing inhibitor cocktails of both proteases and
phosphatases (Roche). Total lysates were separated by Bis-Tris PAGE
(Invitrogen), transferred to a PVDF membrane, and immunoblotted
using primary antibodies for STAT3 (Cell Signaling, #9132) and
GAPDH (Advanced Immunochemicals, #06-1-G4-C5). Immunospecific bands
were detected with the Enhanced Chemiluminescence Plus detection
kit (Amersham Biosciences) after exposure to X-ray film. The
intensity of the bands was then scanned and quantified using ImageJ
software. Significant differences between the treatment and the
control groups were determined using the Student's t test
(p<0.05).
[0557] There was a dose-dependent decrease in STAT3 protein levels,
as shown in Table 47, with 33% and 82% reduction at 3 mg/kg/week
and 10 mg/kg/week respectively. STAT3 protein was undetectable at
30 mg/kg/week irrespective of the dosing route.
TABLE-US-00047 TABLE 47 Percent inhibition of STAT3 protein levels
in cynomolgus monkeys Treatment % inhibition 3 mg i.v. 33 10 mg
i.v. 82 30 mg i.v. 100 30 mg s.c. 100
Liver Function
[0558] To evaluate the effect of ISIS oligonucleotides on hepatic
function, blood samples were collected from all the study groups.
The blood samples were collected via femoral venipuncture on day
44, 48 hrs post-dosing. Blood samples (1 mL) were collected in
tubes without anticoagulant for serum separation. The tubes were
kept at room temperature for approximately 60 min and then
centrifuged at 3,000 rpm for 10 min to obtain serum. Levels of
various liver function markers were measured using a Toshiba 200FR
NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of ALT
and AST were measured and the results are presented in Table 48,
expressed in IU/L. Male and female monkey data is presented
separately. The results indicate that treatment with ISIS 481464
had no effect on liver function outside the expected range for
antisense oligonucleotides.
TABLE-US-00048 TABLE 48 Effect of antisense oligonucleotide
treatment on liver function markers in cynomolgus monkey plasma
Male Female Male Female ALT ALT AST AST (IU/L) (IU/L) (IU/L) (IU/L)
PBS 59 69 83 69 3 mg/kg i.v. 47 56 50 47 10 mg/kg i.v. 56 89 70 60
30 mg/kg i.v. 74 75 60 73 30 mg/kg s.c. 62 78 61 92
Kidney Function
[0559] To evaluate the effect of ISIS oligonucleotides on kidney
function, blood samples were collected from all the study groups.
The blood samples were collected via femoral venipuncture on day
44, 48 hrs post-dosing. Blood samples (1 mL) were collected in
tubes without anticoagulant for serum separation. The tubes were
kept at room temperature for approximately 60 min and then
centrifuged at 3,000 rpm for 10 min to obtain serum. Levels of
various kidney function markers were measured using a Toshiba 200FR
NEO chemistry analyzer (Toshiba Co., Japan). Results are presented
in Table 49, expressed in mg/dL. The plasma chemistry data indicate
that treatment with ISIS 481464 did not have any effect on the
kidney function outside the expected range for antisense
oligonucleotides.
TABLE-US-00049 TABLE 49 Effect of antisense oligonucleotide
treatment on plasma BUN and creatinine levels (mg/dL) in cynomolgus
monkeys Male Female Male Female BUN BUN Creatinine Creatinine PBS
19 30 0.68 0.88 3 mg/kg i.v. 23 28 0.85 0.86 10 mg/kg i.v. 26 27
0.89 0.94 30 mg/kg i.v. 25 26 0.91 0.86 30 mg/kg s.c. 27 28 0.97
0.85
Body Weight Measurements
[0560] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured and are
presented in Tables 50 and 51. The results indicate that effect of
treatment with ISIS 481464 on body weights was within the expected
range for antisense oligonucleotides.
TABLE-US-00050 TABLE 50 Effect of antisense oligonucleotide
treatment on body weights (g) in male cynomolgus monkeys Day Day
Day Day Day Day Day 1 7 14 21 28 35 42 PBS 2523 2463 2484 2471 2509
2523 2551 3 mg/kg i.v. 2604 2564 2594 2572 2589 2654 2687 10 mg/kg
i.v. 2603 2453 2581 2561 2591 2633 2655 30 mg/kg i.v. 2608 2583
2613 2644 2668 2713 2776 30 mg/kg s.c. 2533 2441 2470 2521 2554
2609 2619
TABLE-US-00051 TABLE 51 Effect of antisense oligonucleotide
treatment on body weights (g) in female cynomolgus monkeys Day Day
Day Day Day Day Day 1 7 14 21 28 35 42 PBS 2266 2252 2276 2237 2362
2365 2373 3 mg/kg i.v. 2253 2242 2283 2250 2346 2350 2377 10 mg/kg
i.v. 2293 2277 2318 2254 2358 2387 2361 30 mg/kg i.v. 2259 2261
2289 2268 2368 2412 2406 30 mg/kg s.c. 2293 2275 2322 2281 2385
2389 2394
Example 32: Antisense Inhibition of Human STAT3 in HuVEC Cells
[0561] Antisense oligonucleotides were designed targeting a STAT3
nucleic acid and were tested for their effects on STAT3 mRNA in
vitro. Cultured HuVEC cells at a density of 5,000 cells per well
were transfected using LipofectAMINE 2000.RTM. reagent with 30 nM
antisense oligonucleotide. After a treatment period of
approximately 24 hours, RNA was isolated from the cells and STAT3
mRNA levels were measured by quantitative real-time PCR. Human
primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA,
designated herein as SEQ ID NO: 5; reverse sequence
TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 6;
probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO: 7)
was used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0562] The chimeric antisense oligonucleotides in Tables 52 and 53
were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides
in length, wherein the central gap segment comprises of ten
2'-deoxynucleosides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising five nucleosides each. Each
nucleoside in the 5' wing segment and each nucleotide in the 3'
wing segment has a 2'-MOE modification. The internucleoside
linkages throughout each gapmer are phosphorothioate (P.dbd.S)
linkages. All cytosine residues throughout each gapmer are
5'-methylcytosines. "Human Target start site" indicates the 5'-most
nucleoside to which the gapmer is targeted in the human gene
sequence. "Human Target stop site" indicates the 3'-most nucleoside
to which the gapmer is targeted human gene sequence. Each gapmer
listed in Table 52 is targeted to human STAT3 mRNA, designated
herein as SEQ ID NO: 1 (GENBANK Accession No. NM_139276.2). Each
gapmer listed in Table 53 is targeted to human STAT3 genomic
sequence, designated herein as SEQ ID NO: 2 (the complement of
GENBANK Accession No. NT_010755.14 truncated from nucleotides
4185000 to 4264000).
[0563] The potency of the gapmers was compared to ISIS 337332, ISIS
337333, and ISIS 345785, which are also 5-10-5 MOE gapmers
targeting human STAT3, and which are further described in U.S. Pat.
No. 7,307,069, incorporated herein by reference.
TABLE-US-00052 TABLE 52 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides having 5-10-5 MOE wings and
deoxy gap targeted to SEQ ID NO: 1 Human Human % ISIS NO Start Site
Stop Site Sequence inhibition SEQ ID NO 337332 1898 1917
GAAGCCCTTGCCAGCCATGT 91 1541 337333 1903 1922 AAGGAGAAGCCCTTGCCAGC
87 1542 345785 2267 2286 TGCCTCCTCCTTGGGAATGT 82 1543 455860 2831
2850 ACACAAGACATTTCCTTTTT 64 1544 455246 3452 3471
CAAGGAGGCTGTTAACTGAA 84 1545 455247 3454 3473 ACCAAGGAGGCTGTTAACTG
78 1546 455248 3456 3475 GCACCAAGGAGGCTGTTAAC 69 1547 455249 3458
3477 AAGCACCAAGGAGGCTGTTA 83 1548 455250 3460 3479
TAAAGCACCAAGGAGGCTGT 77 1549 455251 3462 3481 CTTAAAGCACCAAGGAGGCT
78 1550 455252 3464 3483 TGCTTAAAGCACCAAGGAGG 80 1551 455253 3466
3485 AATGCTTAAAGCACCAAGGA 75 1552 455254 3468 3487
TGAATGCTTAAAGCACCAAG 80 1553 455255 3470 3489 GCTGAATGCTTAAAGCACCA
82 1554 455256 3472 3491 AAGCTGAATGCTTAAAGCAC 67 1555 455257 3474
3493 GGAAGCTGAATGCTTAAAGC 79 1556 455258 3476 3495
AAGGAAGCTGAATGCTTAAA 79 1557 455259 3478 3497 TGAAGGAAGCTGAATGCTTA
72 1558 455260 3480 3499 CCTGAAGGAAGCTGAATGCT 75 1559 455261 3527
3546 TAAGGGTTTGACCTGAAGCC 72 1560 455262 3577 3596
TAAACCTTCCTATTTCAACA 77 1561 455263 3579 3598 CTTAAACCTTCCTATTTCAA
64 1562 455264 3581 3600 TCCTTAAACCTTCCTATTTC 73 1563 455265 3583
3602 TCTCCTTAAACCTTCCTATT 87 1564 455266 3585 3604
ATTCTCCTTAAACCTTCCTA 80 1565 455267 3587 3606 AGATTCTCCTTAAACCTTCC
87 1566 455268 3589 3608 TTAGATTCTCCTTAAACCTT 84 1567 455269 3591
3610 GCTTAGATTCTCCTTAAACC 87 1568 455270 3593 3612
ATGCTTAGATTCTCCTTAAA 87 1569 455271 3595 3614 AAATGCTTAGATTCTCCTTA
89 1570 455272 3597 3616 TAAAATGCTTAGATTCTCCT 88 1571 455273 3639
3658 ATACATTACAAAGGAAAATA 12 1572 455274 3641 3660
CAATACATTACAAAGGAAAA 28 1573 455275 3673 3692 CACCCTCTGCCCAGCCTTAC
63 1574 455276 3675 3694 AGCACCCTCTGCCCAGCCTT 79 1575 455277 3677
3696 TAAGCACCCTCTGCCCAGCC 65 1576 455278 3679 3698
TGTAAGCACCCTCTGCCCAG 62 1577 455279 3681 3700 GTTGTAAGCACCCTCTGCCC
62 1578 455280 3683 3702 AGGTTGTAAGCACCCTCTGC 75 1579 455281 3685
3704 CAAGGTTGTAAGCACCCTCT 83 1580 455282 3687 3706
GTCAAGGTTGTAAGCACCCT 86 1581 455283 3689 3708 GAGTCAAGGTTGTAAGCACC
69 1582 455284 3691 3710 GGGAGTCAAGGTTGTAAGCA 37 1583 455285 3693
3712 AAGGGAGTCAAGGTTGTAAG 56 1584 455286 3695 3714
GAAAGGGAGTCAAGGTTGTA 61 1585 455287 3697 3716 GAGAAAGGGAGTCAAGGTTG
56 1586 455288 3709 3728 ATCAAGTCCAGGGAGAAAGG 55 1587 455289 3711
3730 AGATCAAGTCCAGGGAGAAA 69 1588 455290 3713 3732
GCAGATCAAGTCCAGGGAGA 80 1589 455291 3715 3734 CAGCAGATCAAGTCCAGGGA
90 1590 455292 3717 3736 AACAGCAGATCAAGTCCAGG 77 1591 455293 3719
3738 GAAACAGCAGATCAAGTCCA 81 1592 455294 3721 3740
CTGAAACAGCAGATCAAGTC 75 1593 455295 3723 3742 CTCTGAAACAGCAGATCAAG
76 1594 455296 3725 3744 GCCTCTGAAACAGCAGATCA 74 1595 455297 3727
3746 TAGCCTCTGAAACAGCAGAT 75 1596 455298 3729 3748
CCTAGCCTCTGAAACAGCAG 76 1597 455299 3731 3750 AACCTAGCCTCTGAAACAGC
83 1598 455300 3733 3752 ACAACCTAGCCTCTGAAACA 57 1599 455301 3735
3754 AAACAACCTAGCCTCTGAAA 72 1600 455302 3737 3756
AGAAACAACCTAGCCTCTGA 78 1601 455303 3739 3758 ACAGAAACAACCTAGCCTCT
69 1602 455304 3741 3760 CCACAGAAACAACCTAGCCT 70 1603 455305 3743
3762 ACCCACAGAAACAACCTAGC 80 1604 455306 3745 3764
GCACCCACAGAAACAACCTA 70 1605 455307 3747 3766 AGGCACCCACAGAAACAACC
75 1606 455308 3749 3768 TAAGGCACCCACAGAAACAA 70 1607 455309 3751
3770 GATAAGGCACCCACAGAAAC 65 1608 455310 3753 3772
CTGATAAGGCACCCACAGAA 66 1609 455311 3755 3774 CCCTGATAAGGCACCCACAG
81 1610 455312 3757 3776 AGCCCTGATAAGGCACCCAC 79 1611 455313 3759
3778 CCAGCCCTGATAAGGCACCC 74 1612 455314 3761 3780
TCCCAGCCCTGATAAGGCAC 74 1613 455315 3763 3782 TATCCCAGCCCTGATAAGGC
66 1614 455316 3765 3784 AGTATCCCAGCCCTGATAAG 48 1615 455317 3767
3786 GAAGTATCCCAGCCCTGATA 63 1616 455318 3769 3788
CAGAAGTATCCCAGCCCTGA 82 1617 455319 3771 3790 ATCAGAAGTATCCCAGCCCT
80 1618 455320 3879 3898 GATTCCTAAAACAAACAGGA 37 1619 455321 3881
3900 AGGATTCCTAAAACAAACAG 42 1620 455322 3883 3902
CCAGGATTCCTAAAACAAAC 72 1621 455323 3885 3904 GACCAGGATTCCTAAAACAA
71 1622 455324 3887 3906 GAGACCAGGATTCCTAAAAC 43 1623 455325 3889
3908 CTGAGACCAGGATTCCTAAA 77 1624 455326 3891 3910
TCCTGAGACCAGGATTCCTA 76 1625 455327 3893 3912 GGTCCTGAGACCAGGATTCC
69 1626 455328 3895 3914 GAGGTCCTGAGACCAGGATT 76 1627 455329 3897
3916 ATGAGGTCCTGAGACCAGGA 81 1628 455330 3899 3918
CCATGAGGTCCTGAGACCAG 84 1629 455331 3901 3920 TTCCATGAGGTCCTGAGACC
75 1630 455332 3903 3922 TCTTCCATGAGGTCCTGAGA 75 1631 455333 3905
3924 CTTCTTCCATGAGGTCCTGA 79 1632 455334 3907 3926
CTCTTCTTCCATGAGGTCCT 83 1633 455335 3909 3928 CCCTCTTCTTCCATGAGGTC
74 1634 455336 3911 3930 CCCCCTCTTCTTCCATGAGG 72 1635 455337 3913
3932 CTCCCCCTCTTCTTCCATGA 72 1636 455338 3977 3996
CCTGAGCTCAACCAGACACG 79 1637 455339 3979 3998 TCCCTGAGCTCAACCAGACA
73 1638 455340 3981 4000 ATTCCCTGAGCTCAACCAGA 75 1639 455341 3983
4002 ATATTCCCTGAGCTCAACCA 65 1640 455342 3985 4004
CCATATTCCCTGAGCTCAAC 78 1641 455343 3987 4006 AACCATATTCCCTGAGCTCA
81 1642 455344 3989 4008 AGAACCATATTCCCTGAGCT 77 1643 455345 3991
4010 TAAGAACCATATTCCCTGAG 73 1644 455346 3993 4012
GCTAAGAACCATATTCCCTG 81 1645 455347 4067 4086 TCAGTAAGCCTTTGCCCTGC
79 1646 455348 4069 4088 TATCAGTAAGCCTTTGCCCT 72 1647 455349 4071
4090 TTTATCAGTAAGCCTTTGCC 76 1648 455350 4073 4092
AGTTTATCAGTAAGCCTTTG 84 1649 455351 4075 4094 CAAGTTTATCAGTAAGCCTT
82 1650 455352 4077 4096 CTCAAGTTTATCAGTAAGCC 82 1651 455353 4079
4098 GACTCAAGTTTATCAGTAAG 70 1652 455354 4081 4100
CAGACTCAAGTTTATCAGTA 78 1653 455355 4083 4102 GGCAGACTCAAGTTTATCAG
67 1654 455356 4085 4104 AGGGCAGACTCAAGTTTATC 51 1655 455357 4087
4106 CGAGGGCAGACTCAAGTTTA 54 1656 455358 4089 4108
TACGAGGGCAGACTCAAGTT 56 1657 455359 4091 4110 CATACGAGGGCAGACTCAAG
59 1658 455360 4093 4112 CTCATACGAGGGCAGACTCA 74 1659 455361 4095
4114 CCCTCATACGAGGGCAGACT 67 1660 455362 4122 4141
CAGCCTCAGAGGGAGGCCAG 40 1661
455363 4124 4143 ACCAGCCTCAGAGGGAGGCC 34 1662 455364 4126 4145
TCACCAGCCTCAGAGGGAGG 49 1663 455365 4128 4147 AGTCACCAGCCTCAGAGGGA
50 1664 455366 4225 4244 CCCATACGCACAGGAGAGGC 81 1665 455367 4227
4246 TTCCCATACGCACAGGAGAG 72 1666 455368 4229 4248
TGTTCCCATACGCACAGGAG 80 1667 455369 4231 4250 GGTGTTCCCATACGCACAGG
76 1668 455370 4233 4252 TAGGTGTTCCCATACGCACA 87 1669 455371 4235
4254 GCTAGGTGTTCCCATACGCA 92 1670 455372 4237 4256
GTGCTAGGTGTTCCCATACG 81 1671 455373 4304 4323 GAGGCAAGGTGGTTTTGAGT
55 1672 455374 4306 4325 CTGAGGCAAGGTGGTTTTGA 74 1673 455375 4308
4327 AGCTGAGGCAAGGTGGTTTT 79 1674 455376 4310 4329
TCAGCTGAGGCAAGGTGGTT 80 1675 455377 4312 4331 GATCAGCTGAGGCAAGGTGG
77 1676 455378 4314 4333 CTGATCAGCTGAGGCAAGGT 60 1677 455379 4316
4335 CTCTGATCAGCTGAGGCAAG 74 1678 455380 4318 4337
AACTCTGATCAGCTGAGGCA 77 1679 455381 4320 4339 GAAACTCTGATCAGCTGAGG
78 1680 455382 4322 4341 CAGAAACTCTGATCAGCTGA 78 1681 455383 4360
4379 CAGAGACCAGCTAATTTGAT 69 1682 455384 4362 4381
TTCAGAGACCAGCTAATTTG 78 1683 455385 4364 4383 AATTCAGAGACCAGCTAATT
77 1684 455386 4366 4385 TTAATTCAGAGACCAGCTAA 83 1685 455387 4423
4442 CTCCAGGCAGGAGGACTGGG 79 1686 455388 4425 4444
GTCTCCAGGCAGGAGGACTG 65 1687 455389 4427 4446 CTGTCTCCAGGCAGGAGGAC
57 1688 455390 4429 4448 AACTGTCTCCAGGCAGGAGG 75 1689 455391 4431
4450 TCAACTGTCTCCAGGCAGGA 86 1690 455392 4433 4452
CATCAACTGTCTCCAGGCAG 80 1691 455393 4435 4454 CACATCAACTGTCTCCAGGC
86 1692 455394 4437 4456 GACACATCAACTGTCTCCAG 85 1693 455395 4471
4490 GAAGAGTGTTGCTGGAGAAG 73 1694 455396 4473 4492
CTGAAGAGTGTTGCTGGAGA 78 1695 455397 4475 4494 TACTGAAGAGTGTTGCTGGA
83 1696 455398 4477 4496 TGTACTGAAGAGTGTTGCTG 86 1697 455399 4479
4498 TATGTACTGAAGAGTGTTGC 74 1698 455400 4481 4500
ATTATGTACTGAAGAGTGTT 74 1699 455401 4483 4502 TTATTATGTACTGAAGAGTG
84 1700 455402 4485 4504 GCTTATTATGTACTGAAGAG 84 1701 455403 4487
4506 AAGCTTATTATGTACTGAAG 77 1702 455404 4489 4508
TTAAGCTTATTATGTACTGA 75 1703 455405 4491 4510 AGTTAAGCTTATTATGTACT
81 1704 455406 4493 4512 TCAGTTAAGCTTATTATGTA 58 1705 455407 4495
4514 TATCAGTTAAGCTTATTATG 65 1706 455408 4497 4516
TTTATCAGTTAAGCTTATTA 46 1707 455409 4499 4518 TGTTTATCAGTTAAGCTTAT
68 1708 455410 4501 4520 TCTGTTTATCAGTTAAGCTT 83 1709 455411 4539
4558 AACCCAATGGTAAGCCCAAG 87 1710 455412 4541 4560
TAAACCCAATGGTAAGCCCA 87 1711 455413 4543 4562 TTTAAACCCAATGGTAAGCC
78 1712 455414 4545 4564 GATTTAAACCCAATGGTAAG 31 1713 455415 4547
4566 ATGATTTAAACCCAATGGTA 71 1714 455416 4549 4568
CTATGATTTAAACCCAATGG 67 1715 455417 4551 4570 CCCTATGATTTAAACCCAAT
70 1716 455418 4553 4572 GTCCCTATGATTTAAACCCA 83 1717 455419 4555
4574 AGGTCCCTATGATTTAAACC 64 1718 455420 4589 4608
TATCTGCTCCAGAGAAGCCC 76 1719 455421 4591 4610 AATATCTGCTCCAGAGAAGC
78 1720 455422 4614 4633 CTACCTAAGGCCATGAACTT 74 1721 455423 4616
4635 TGCTACCTAAGGCCATGAAC 82 1722 455424 4618 4637
CATGCTACCTAAGGCCATGA 84 1723 455425 4636 4655 CAGAGTTAAGACCAGATACA
84 1724 455426 4638 4657 ATCAGAGTTAAGACCAGATA 83 1725 455427 4640
4659 CAATCAGAGTTAAGACCAGA 77 1726 455428 4642 4661
TACAATCAGAGTTAAGACCA 81 1727 455429 4644 4663 GCTACAATCAGAGTTAAGAC
86 1728 455430 4646 4665 TTGCTACAATCAGAGTTAAG 85 1729 455431 4648
4667 TTTTGCTACAATCAGAGTTA 85 1730 455432 4650 4669
ACTTTTGCTACAATCAGAGT 73 1731 455433 4652 4671 GAACTTTTGCTACAATCAGA
80 1732 455434 4654 4673 CAGAACTTTTGCTACAATCA 82 1733 455435 4656
4675 CTCAGAACTTTTGCTACAAT 79 1734 455436 4658 4677
CTCTCAGAACTTTTGCTACA 76 1735 455437 4660 4679 TCCTCTCAGAACTTTTGCTA
75 1736 455438 4662 4681 GCTCCTCTCAGAACTTTTGC 85 1737 455439 4664
4683 CAGCTCCTCTCAGAACTTTT 85 1738 455440 4666 4685
CTCAGCTCCTCTCAGAACTT 80 1739 455441 4668 4687 GGCTCAGCTCCTCTCAGAAC
75 1740 455442 4770 4789 GCAACCCACGGGATTCCCTC 82 1741 455443 4772
4791 AAGCAACCCACGGGATTCCC 77 1742 455444 4774 4793
GTAAGCAACCCACGGGATTC 74 1743 455445 4776 4795 AGGTAAGCAACCCACGGGAT
76 1744 455446 4778 4797 GTAGGTAAGCAACCCACGGG 82 1745 455447 4780
4799 AGGTAGGTAAGCAACCCACG 88 1746 455448 4782 4801
ATAGGTAGGTAAGCAACCCA 83 1747 455449 4784 4803 TTATAGGTAGGTAAGCAACC
59 1748 455450 4786 4805 CCTTATAGGTAGGTAAGCAA 65 1749 455451 4788
4807 CACCTTATAGGTAGGTAAGC 62 1750 455452 4790 4809
ACCACCTTATAGGTAGGTAA 57 1751 455453 4792 4811 AAACCACCTTATAGGTAGGT
75 1752 455454 4794 4813 ATAAACCACCTTATAGGTAG 35 1753 455455 4796
4815 TTATAAACCACCTTATAGGT 39 1754 455456 4798 4817
GCTTATAAACCACCTTATAG 58 1755 455457 4800 4819 CAGCTTATAAACCACCTTAT
86 1756 455458 4802 4821 AGCAGCTTATAAACCACCTT 86 1757 455459 4804
4823 ACAGCAGCTTATAAACCACC 80 1758 455460 4806 4825
GGACAGCAGCTTATAAACCA 69 1759 455461 4808 4827 CAGGACAGCAGCTTATAAAC
72 1760 455462 4810 4829 GCCAGGACAGCAGCTTATAA 76 1761 455463 4812
4831 TGGCCAGGACAGCAGCTTAT 89 1762 455464 4814 4833
AGTGGCCAGGACAGCAGCTT 80 1763 455465 4816 4835 GCAGTGGCCAGGACAGCAGC
78 1764 455466 4818 4837 ATGCAGTGGCCAGGACAGCA 85 1765 455467 4820
4839 GAATGCAGTGGCCAGGACAG 80 1766 455468 4822 4841
TTGAATGCAGTGGCCAGGAC 83 1767 455469 4824 4843 ATTTGAATGCAGTGGCCAGG
84 1768 455470 4826 4845 GAATTTGAATGCAGTGGCCA 81 1769 455471 4828
4847 TGGAATTTGAATGCAGTGGC 85 1770 455472 4830 4849
ATTGGAATTTGAATGCAGTG 64 1771 455473 4832 4851 ACATTGGAATTTGAATGCAG
80 1772 455474 4834 4853 ACACATTGGAATTTGAATGC 73 1773 455475 4836
4855 GTACACATTGGAATTTGAAT 80 1774 455476 4838 4857
AAGTACACATTGGAATTTGA 77 1775 455477 4840 4859 TGAAGTACACATTGGAATTT
68 1776 455478 4842 4861 TATGAAGTACACATTGGAAT 66 1777 455479 4844
4863 ACTATGAAGTACACATTGGA 83 1778 455480 4846 4865
ACACTATGAAGTACACATTG 76 1779 455481 4848 4867 TTACACTATGAAGTACACAT
78 1780 455482 4850 4869 TTTTACACTATGAAGTACAC 76 1781 455483 4852
4871 ATTTTTACACTATGAAGTAC 60 1782 455484 4854 4873
AAATTTTTACACTATGAAGT 35 1783 455485 4856 4875 ATAAATTTTTACACTATGAA
9 1784 455486 4858 4877 ATATAAATTTTTACACTATG 0 1785 455487 4860
4879 TAATATAAATTTTTACACTA 21 1786 455488 4862 4881
AATAATATAAATTTTTACAC 10 1787
455489 4864 4883 ACAATAATATAAATTTTTAC 7 1788 455490 4925 4944
AGTTAAAGTAGATACAGCAA 71 1789 455491 4927 4946 GAAGTTAAAGTAGATACAGC
63 1790 455492 4929 4948 TGGAAGTTAAAGTAGATACA 69 1791 455493 4931
4950 TCTGGAAGTTAAAGTAGATA 65 1792 455494 4933 4952
TTTCTGGAAGTTAAAGTAGA 55 1793 455495 4935 4954 TATTTCTGGAAGTTAAAGTA
57 1794 455496 4937 4956 TTTATTTCTGGAAGTTAAAG 36 1795 455497 4939
4958 CGTTTATTTCTGGAAGTTAA 77 1796
TABLE-US-00053 TABLE 53 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides having 5-10-5 MOE wings and
deoxy gap targeted to SEQ ID NO: 2 Human Human % ISIS NO Start Site
Stop Site Sequence inhibition SEQ ID NO 455498 917 936
CACGCCGTCATGCATAATTC 0 1797 455499 919 938 GGCACGCCGTCATGCATAAT 0
1798 455500 940 959 GCCCAGCCCCAGCCTGGCCG 35 1799 455501 962 981
ACAGCCCCTTCAGCCAATCC 15 1800 455502 964 983 TTACAGCCCCTTCAGCCAAT 14
1801 455503 966 985 AATTACAGCCCCTTCAGCCA 28 1802 455504 968 987
TGAATTACAGCCCCTTCAGC 6 1803 455505 970 989 GCTGAATTACAGCCCCTTCA 15
1804 455506 972 991 CCGCTGAATTACAGCCCCTT 4 1805 455507 974 993
AACCGCTGAATTACAGCCCC 8 1806 455508 976 995 GAAACCGCTGAATTACAGCC 16
1807 455509 978 997 CGGAAACCGCTGAATTACAG 24 1808 455510 980 999
TCCGGAAACCGCTGAATTAC 12 1809 455511 982 1001 GCTCCGGAAACCGCTGAATT
15 1810 455512 984 1003 CAGCTCCGGAAACCGCTGAA 23 1811 455513 986
1005 CGCAGCTCCGGAAACCGCTG 4 1812 455514 988 1007
GCCGCAGCTCCGGAAACCGC 13 1813 455515 1378 1397 AGTCCCTTCCGAGGCCCGCT
81 1814 455516 1408 1427 CGAAGAACGAAACTTCCCTC 68 1815 455517 1697
1716 CAGACACACCTATTCCTGCC 82 1816 455518 1748 1767
TTATGCAATAAAGCCTACCC 70 1817 455519 1795 1814 TTAGAAAGAGTACCGGTCTG
75 1818 455520 1987 2006 AATGGCTCAATTATTTATCT 59 1819 455521 2083
2102 TTTACCCAAGATCTTGGCTC 76 1820 455522 2175 2194
ACTTCAGTGCAACCACACCC 70 1821 455523 2205 2224 CCAACTTGGGCGACGGTTTG
67 1822 455524 2281 2300 CTAACCACTGATTTTGTCAC 56 1823 455525 2316
2335 GTACACACTATACACATTTT 85 1824 455526 2346 2365
CTTTAGTTGCACATACAGTA 80 1825 455527 2383 2402 GCCAAAAATTTACAACCCAT
86 1826 455528 2413 2432 TTCAAGCCCAATGCTTTATC 76 1827 455529 2561
2580 CTGGAACATGTAATAAGGAA 71 1828 455530 2669 2688
AGAGACTAAAATCAAGGCTC 87 1829 455531 2900 2919 TAGACTCTAGACCCAATTCC
77 1830 455532 3780 3799 GAAATGACCACTGATCAAGC 74 1831 455533 3867
3886 AAGTTGGTCACCACCTCTAC 81 1832 455534 4291 4310
AACTTATTCTTCATAGCAAC 58 1833 455535 4587 4606 TATTTGGGACCCAGTTGAAA
60 1834 455536 5000 5019 AGAACTGAAATTCCTTGGTC 88 1835 455537 5030
5049 AAGTTTTAAAAGCTTCCCCT 76 1836 455538 5554 5573
TCACCCAAAGTACCAAATCA 71 1837 455539 5667 5686 CAAAAGTTATGGTGAAATTT
44 1838 455540 5699 5718 AAGTACTCTTTCAGTGGTTT 88 1839 455541 6844
6863 AATTAAAGAGTTGCGGTAAT 68 1840 455542 6926 6945
GTTTCATGAAAACGGACAAT 78 1841 455543 7050 7069 AGGATTCAGTCCCAGATCTG
18 1842 455544 7282 7301 TCAATAATGATGACTTTCTC 72 1843 455545 7528
7547 TTAAACCCAATTATTAACAG 45 1844 455546 7624 7643
GTAAAACACACATTTTATAT 62 1845 455547 7682 7701 GTAAACAGAAAGGGCTGCAA
86 1846 455548 8078 8097 GGGCAGATTTACCTTCCTTA 89 1847 455549 8126
8145 GGGTAGCAGGAAGGAAAGCC 80 1848 455550 8214 8233
AATATAAGTTCTTTGGCTGA 60 1849 455551 8244 8263 TACAATAGCAATCACCTTAG
89 1850 455552 8284 8303 CCATGAAACCCTCAAACATA 75 1851 337332 66135
66154 GAAGCCCTTGCCAGCCATGT 91 1541 337333 66140 66159
AAGGAGAAGCCCTTGCCAGC 87 1542 345785 67129 67148
TGCCTCCTCCTTGGGAATGT 82 1543 455246 74639 74658
CAAGGAGGCTGTTAACTGAA 84 1545 455247 74641 74660
ACCAAGGAGGCTGTTAACTG 78 1546 455248 74643 74662
GCACCAAGGAGGCTGTTAAC 69 1547 455249 74645 74664
AAGCACCAAGGAGGCTGTTA 83 1548 455250 74647 74666
TAAAGCACCAAGGAGGCTGT 77 1549 455251 74649 74668
CTTAAAGCACCAAGGAGGCT 78 1550 455252 74651 74670
TGCTTAAAGCACCAAGGAGG 80 1551 455253 74653 74672
AATGCTTAAAGCACCAAGGA 75 1552 455254 74655 74674
TGAATGCTTAAAGCACCAAG 80 1553 455255 74657 74676
GCTGAATGCTTAAAGCACCA 82 1554 455256 74659 74678
AAGCTGAATGCTTAAAGCAC 67 1555 455257 74661 74680
GGAAGCTGAATGCTTAAAGC 79 1556 455258 74663 74682
AAGGAAGCTGAATGCTTAAA 79 1557 455259 74665 74684
TGAAGGAAGCTGAATGCTTA 72 1558 455260 74667 74686
CCTGAAGGAAGCTGAATGCT 75 1559 455261 74714 74733
TAAGGGTTTGACCTGAAGCC 72 1560 455262 74764 74783
TAAACCTTCCTATTTCAACA 77 1561 455263 74766 74785
CTTAAACCTTCCTATTTCAA 64 1562 455264 74768 74787
TCCTTAAACCTTCCTATTTC 73 1563 455265 74770 74789
TCTCCTTAAACCTTCCTATT 87 1564 455266 74772 74791
ATTCTCCTTAAACCTTCCTA 80 1565 455267 74774 74793
AGATTCTCCTTAAACCTTCC 87 1566 455268 74776 74795
TTAGATTCTCCTTAAACCTT 84 1567 455269 74778 74797
GCTTAGATTCTCCTTAAACC 87 1568 455270 74780 74799
ATGCTTAGATTCTCCTTAAA 87 1569 455271 74782 74801
AAATGCTTAGATTCTCCTTA 89 1570 455272 74784 74803
TAAAATGCTTAGATTCTCCT 88 1571 455273 74826 74845
ATACATTACAAAGGAAAATA 12 1572 455274 74828 74847
CAATACATTACAAAGGAAAA 28 1573 455275 74860 74879
CACCCTCTGCCCAGCCTTAC 63 1574 455276 74862 74881
AGCACCCTCTGCCCAGCCTT 79 1575 455277 74864 74883
TAAGCACCCTCTGCCCAGCC 65 1576 455278 74866 74885
TGTAAGCACCCTCTGCCCAG 62 1577 455279 74868 74887
GTTGTAAGCACCCTCTGCCC 62 1578 455280 74870 74889
AGGTTGTAAGCACCCTCTGC 75 1579 455281 74872 74891
CAAGGTTGTAAGCACCCTCT 83 1580 455282 74874 74893
GTCAAGGTTGTAAGCACCCT 86 1581 455283 74876 74895
GAGTCAAGGTTGTAAGCACC 69 1582 455284 74878 74897
GGGAGTCAAGGTTGTAAGCA 37 1583 455285 74880 74899
AAGGGAGTCAAGGTTGTAAG 56 1584 455286 74882 74901
GAAAGGGAGTCAAGGTTGTA 61 1585 455287 74884 74903
GAGAAAGGGAGTCAAGGTTG 56 1586 455288 74896 74915
ATCAAGTCCAGGGAGAAAGG 55 1587 455289 74898 74917
AGATCAAGTCCAGGGAGAAA 69 1588 455290 74900 74919
GCAGATCAAGTCCAGGGAGA 80 1589 455291 74902 74921
CAGCAGATCAAGTCCAGGGA 90 1590 455292 74904 74923
AACAGCAGATCAAGTCCAGG 77 1591 455293 74906 74925
GAAACAGCAGATCAAGTCCA 81 1592 455294 74908 74927
CTGAAACAGCAGATCAAGTC 75 1593 455295 74910 74929
CTCTGAAACAGCAGATCAAG 76 1594 455296 74912 74931
GCCTCTGAAACAGCAGATCA 74 1595 455297 74914 74933
TAGCCTCTGAAACAGCAGAT 75 1596 455298 74916 74935
CCTAGCCTCTGAAACAGCAG 76 1597 455299 74918 74937
AACCTAGCCTCTGAAACAGC 83 1598 455300 74920 74939
ACAACCTAGCCTCTGAAACA 57 1599 455301 74922 74941
AAACAACCTAGCCTCTGAAA 72 1600 455302 74924 74943
AGAAACAACCTAGCCTCTGA 78 1601 455303 74926 74945
ACAGAAACAACCTAGCCTCT 69 1602 455304 74928 74947
CCACAGAAACAACCTAGCCT 70 1603 455305 74930 74949
ACCCACAGAAACAACCTAGC 80 1604 455306 74932 74951
GCACCCACAGAAACAACCTA 70 1605 455307 74934 74953
AGGCACCCACAGAAACAACC 75 1606 455308 74936 74955
TAAGGCACCCACAGAAACAA 70 1607
455309 74938 74957 GATAAGGCACCCACAGAAAC 65 1608 455310 74940 74959
CTGATAAGGCACCCACAGAA 66 1609 455311 74942 74961
CCCTGATAAGGCACCCACAG 81 1610 455312 74944 74963
AGCCCTGATAAGGCACCCAC 79 1611 455313 74946 74965
CCAGCCCTGATAAGGCACCC 74 1612 455314 74948 74967
TCCCAGCCCTGATAAGGCAC 74 1613 455315 74950 74969
TATCCCAGCCCTGATAAGGC 66 1614 455316 74952 74971
AGTATCCCAGCCCTGATAAG 48 1615 455317 74954 74973
GAAGTATCCCAGCCCTGATA 63 1616 455318 74956 74975
CAGAAGTATCCCAGCCCTGA 82 1617 455319 74958 74977
ATCAGAAGTATCCCAGCCCT 80 1618 455320 75066 75085
GATTCCTAAAACAAACAGGA 37 1619 455321 75068 75087
AGGATTCCTAAAACAAACAG 42 1620 455322 75070 75089
CCAGGATTCCTAAAACAAAC 72 1621 455323 75072 75091
GACCAGGATTCCTAAAACAA 71 1622 455324 75074 75093
GAGACCAGGATTCCTAAAAC 43 1623 455325 75076 75095
CTGAGACCAGGATTCCTAAA 77 1624 455326 75078 75097
TCCTGAGACCAGGATTCCTA 76 1625 455327 75080 75099
GGTCCTGAGACCAGGATTCC 69 1626 455328 75082 75101
GAGGTCCTGAGACCAGGATT 76 1627 455329 75084 75103
ATGAGGTCCTGAGACCAGGA 81 1628 455330 75086 75105
CCATGAGGTCCTGAGACCAG 84 1629 455331 75088 75107
TTCCATGAGGTCCTGAGACC 75 1630 455332 75090 75109
TCTTCCATGAGGTCCTGAGA 75 1631 455333 75092 75111
CTTCTTCCATGAGGTCCTGA 79 1632 455334 75094 75113
CTCTTCTTCCATGAGGTCCT 83 1633 455335 75096 75115
CCCTCTTCTTCCATGAGGTC 74 1634 455336 75098 75117
CCCCCTCTTCTTCCATGAGG 72 1635 455337 75100 75119
CTCCCCCTCTTCTTCCATGA 72 1636 455338 75164 75183
CCTGAGCTCAACCAGACACG 79 1637 455339 75166 75185
TCCCTGAGCTCAACCAGACA 73 1638 455340 75168 75187
ATTCCCTGAGCTCAACCAGA 75 1639 455341 75170 75189
ATATTCCCTGAGCTCAACCA 65 1640 455342 75172 75191
CCATATTCCCTGAGCTCAAC 78 1641 455343 75174 75193
AACCATATTCCCTGAGCTCA 81 1642 455344 75176 75195
AGAACCATATTCCCTGAGCT 77 1643 455345 75178 75197
TAAGAACCATATTCCCTGAG 73 1644 455346 75180 75199
GCTAAGAACCATATTCCCTG 81 1645 455347 75254 75273
TCAGTAAGCCTTTGCCCTGC 79 1646 455348 75256 75275
TATCAGTAAGCCTTTGCCCT 72 1647 455349 75258 75277
TTTATCAGTAAGCCTTTGCC 76 1648 455350 75260 75279
AGTTTATCAGTAAGCCTTTG 84 1649 455351 75262 75281
CAAGTTTATCAGTAAGCCTT 82 1650 455352 75264 75283
CTCAAGTTTATCAGTAAGCC 82 1651 455353 75266 75285
GACTCAAGTTTATCAGTAAG 70 1652 455354 75268 75287
CAGACTCAAGTTTATCAGTA 78 1653 455355 75270 75289
GGCAGACTCAAGTTTATCAG 67 1654 455356 75272 75291
AGGGCAGACTCAAGTTTATC 51 1655 455357 75274 75293
CGAGGGCAGACTCAAGTTTA 54 1656 455358 75276 75295
TACGAGGGCAGACTCAAGTT 56 1657 455359 75278 75297
CATACGAGGGCAGACTCAAG 59 1658 455360 75280 75299
CTCATACGAGGGCAGACTCA 74 1659 455361 75282 75301
CCCTCATACGAGGGCAGACT 67 1660 455362 75309 75328
CAGCCTCAGAGGGAGGCCAG 40 1661 455363 75311 75330
ACCAGCCTCAGAGGGAGGCC 34 1662 455364 75313 75332
TCACCAGCCTCAGAGGGAGG 49 1663 455365 75315 75334
AGTCACCAGCCTCAGAGGGA 50 1664 455366 75412 75431
CCCATACGCACAGGAGAGGC 81 1665 455367 75414 75433
TTCCCATACGCACAGGAGAG 72 1666 455368 75416 75435
TGTTCCCATACGCACAGGAG 80 1667 455369 75418 75437
GGTGTTCCCATACGCACAGG 76 1668 455370 75420 75439
TAGGTGTTCCCATACGCACA 87 1669 455371 75422 75441
GCTAGGTGTTCCCATACGCA 92 1670 455372 75424 75443
GTGCTAGGTGTTCCCATACG 81 1671 455373 75491 75510
GAGGCAAGGTGGTTTTGAGT 55 1672 455374 75493 75512
CTGAGGCAAGGTGGTTTTGA 74 1673 455375 75495 75514
AGCTGAGGCAAGGTGGTTTT 79 1674 455376 75497 75516
TCAGCTGAGGCAAGGTGGTT 80 1675 455377 75499 75518
GATCAGCTGAGGCAAGGTGG 77 1676 455378 75501 75520
CTGATCAGCTGAGGCAAGGT 60 1677 455379 75503 75522
CTCTGATCAGCTGAGGCAAG 74 1678 455380 75505 75524
AACTCTGATCAGCTGAGGCA 77 1679 455381 75507 75526
GAAACTCTGATCAGCTGAGG 78 1680 455382 75509 75528
CAGAAACTCTGATCAGCTGA 78 1681 455383 75547 75566
CAGAGACCAGCTAATTTGAT 69 1682 455384 75549 75568
TTCAGAGACCAGCTAATTTG 78 1683 455385 75551 75570
AATTCAGAGACCAGCTAATT 77 1684 455386 75553 75572
TTAATTCAGAGACCAGCTAA 83 1685 455387 75610 75629
CTCCAGGCAGGAGGACTGGG 79 1686 455388 75612 75631
GTCTCCAGGCAGGAGGACTG 65 1687 455389 75614 75633
CTGTCTCCAGGCAGGAGGAC 57 1688 455390 75616 75635
AACTGTCTCCAGGCAGGAGG 75 1689 455391 75618 75637
TCAACTGTCTCCAGGCAGGA 86 1690 455392 75620 75639
CATCAACTGTCTCCAGGCAG 80 1691 455393 75622 75641
CACATCAACTGTCTCCAGGC 86 1692 455394 75624 75643
GACACATCAACTGTCTCCAG 85 1693 455395 75658 75677
GAAGAGTGTTGCTGGAGAAG 73 1694 455396 75660 75679
CTGAAGAGTGTTGCTGGAGA 78 1695 455397 75662 75681
TACTGAAGAGTGTTGCTGGA 83 1696 455398 75664 75683
TGTACTGAAGAGTGTTGCTG 86 1697 455399 75666 75685
TATGTACTGAAGAGTGTTGC 74 1698 455400 75668 75687
ATTATGTACTGAAGAGTGTT 74 1699 455401 75670 75689
TTATTATGTACTGAAGAGTG 84 1700 455402 75672 75691
GCTTATTATGTACTGAAGAG 84 1701 455403 75674 75693
AAGCTTATTATGTACTGAAG 77 1702 455404 75676 75695
TTAAGCTTATTATGTACTGA 75 1703 455405 75678 75697
AGTTAAGCTTATTATGTACT 81 1704 455406 75680 75699
TCAGTTAAGCTTATTATGTA 58 1705 455407 75682 75701
TATCAGTTAAGCTTATTATG 65 1706 455408 75684 75703
TTTATCAGTTAAGCTTATTA 46 1707 455409 75686 75705
TGTTTATCAGTTAAGCTTAT 68 1708 455410 75688 75707
TCTGTTTATCAGTTAAGCTT 83 1709 455411 75726 75745
AACCCAATGGTAAGCCCAAG 87 1710 455412 75728 75747
TAAACCCAATGGTAAGCCCA 87 1711 455413 75730 75749
TTTAAACCCAATGGTAAGCC 78 1712 455414 75732 75751
GATTTAAACCCAATGGTAAG 31 1713 455415 75734 75753
ATGATTTAAACCCAATGGTA 71 1714 455416 75736 75755
CTATGATTTAAACCCAATGG 67 1715 455417 75738 75757
CCCTATGATTTAAACCCAAT 70 1716 455418 75740 75759
GTCCCTATGATTTAAACCCA 83 1717 455419 75742 75761
AGGTCCCTATGATTTAAACC 64 1718 455420 75776 75795
TATCTGCTCCAGAGAAGCCC 76 1719 455421 75778 75797
AATATCTGCTCCAGAGAAGC 78 1720 455422 75801 75820
CTACCTAAGGCCATGAACTT 74 1721 455423 75803 75822
TGCTACCTAAGGCCATGAAC 82 1722 455424 75805 75824
CATGCTACCTAAGGCCATGA 84 1723 455425 75823 75842
CAGAGTTAAGACCAGATACA 84 1724 455426 75825 75844
ATCAGAGTTAAGACCAGATA 83 1725 455427 75827 75846
CAATCAGAGTTAAGACCAGA 77 1726 455428 75829 75848
TACAATCAGAGTTAAGACCA 81 1727 455429 75831 75850
GCTACAATCAGAGTTAAGAC 86 1728 455430 75833 75852
TTGCTACAATCAGAGTTAAG 85 1729 455431 75835 75854
TTTTGCTACAATCAGAGTTA 85 1730 455432 75837 75856
ACTTTTGCTACAATCAGAGT 73 1731 455433 75839 75858
GAACTTTTGCTACAATCAGA 80 1732 455434 75841 75860
CAGAACTTTTGCTACAATCA 82 1733
455435 75843 75862 CTCAGAACTTTTGCTACAAT 79 1734 455436 75845 75864
CTCTCAGAACTTTTGCTACA 76 1735 455437 75847 75866
TCCTCTCAGAACTTTTGCTA 75 1736 455438 75849 75868
GCTCCTCTCAGAACTTTTGC 85 1737 455439 75851 75870
CAGCTCCTCTCAGAACTTTT 85 1738 455440 75853 75872
CTCAGCTCCTCTCAGAACTT 80 1739 455441 75855 75874
GGCTCAGCTCCTCTCAGAAC 75 1740 455442 75957 75976
GCAACCCACGGGATTCCCTC 82 1741 455443 75959 75978
AAGCAACCCACGGGATTCCC 77 1742 455444 75961 75980
GTAAGCAACCCACGGGATTC 74 1743 455445 75963 75982
AGGTAAGCAACCCACGGGAT 76 1744 455446 75965 75984
GTAGGTAAGCAACCCACGGG 82 1745 455447 75967 75986
AGGTAGGTAAGCAACCCACG 88 1746 455448 75969 75988
ATAGGTAGGTAAGCAACCCA 83 1747 455449 75971 75990
TTATAGGTAGGTAAGCAACC 59 1748 455450 75973 75992
CCTTATAGGTAGGTAAGCAA 65 1749 455451 75975 75994
CACCTTATAGGTAGGTAAGC 62 1750 455452 75977 75996
ACCACCTTATAGGTAGGTAA 57 1751 455453 75979 75998
AAACCACCTTATAGGTAGGT 75 1752 455454 75981 76000
ATAAACCACCTTATAGGTAG 35 1753 455455 75983 76002
TTATAAACCACCTTATAGGT 39 1754 455456 75985 76004
GCTTATAAACCACCTTATAG 58 1755 455457 75987 76006
CAGCTTATAAACCACCTTAT 86 1756 455458 75989 76008
AGCAGCTTATAAACCACCTT 86 1757 455459 75991 76010
ACAGCAGCTTATAAACCACC 80 1758 455460 75993 76012
GGACAGCAGCTTATAAACCA 69 1759 455461 75995 76014
CAGGACAGCAGCTTATAAAC 72 1760 455462 75997 76016
GCCAGGACAGCAGCTTATAA 76 1761 455463 75999 76018
TGGCCAGGACAGCAGCTTAT 89 1762 455464 76001 76020
AGTGGCCAGGACAGCAGCTT 80 1763 455465 76003 76022
GCAGTGGCCAGGACAGCAGC 78 1764 455466 76005 76024
ATGCAGTGGCCAGGACAGCA 85 1765 455467 76007 76026
GAATGCAGTGGCCAGGACAG 80 1766 455468 76009 76028
TTGAATGCAGTGGCCAGGAC 83 1767 455469 76011 76030
ATTTGAATGCAGTGGCCAGG 84 1768 455470 76013 76032
GAATTTGAATGCAGTGGCCA 81 1769 455471 76015 76034
TGGAATTTGAATGCAGTGGC 85 1770 455472 76017 76036
ATTGGAATTTGAATGCAGTG 64 1771 455473 76019 76038
ACATTGGAATTTGAATGCAG 80 1772 455474 76021 76040
ACACATTGGAATTTGAATGC 73 1773 455475 76023 76042
GTACACATTGGAATTTGAAT 80 1774 455476 76025 76044
AAGTACACATTGGAATTTGA 77 1775 455477 76027 76046
TGAAGTACACATTGGAATTT 68 1776 455478 76029 76048
TATGAAGTACACATTGGAAT 66 1777 455479 76031 76050
ACTATGAAGTACACATTGGA 83 1778 455480 76033 76052
ACACTATGAAGTACACATTG 76 1779 455481 76035 76054
TTACACTATGAAGTACACAT 78 1780 455482 76037 76056
TTTTACACTATGAAGTACAC 76 1781 455483 76039 76058
ATTTTTACACTATGAAGTAC 60 1782 455484 76041 76060
AAATTTTTACACTATGAAGT 35 1783 455485 76043 76062
ATAAATTTTTACACTATGAA 9 1784 455486 76045 76064 ATATAAATTTTTACACTATG
0 1785 455487 76047 76066 TAATATAAATTTTTACACTA 21 1786 455488 76049
76068 AATAATATAAATTTTTACAC 10 1787 455489 76051 76070
ACAATAATATAAATTTTTAC 7 1788 455490 76112 76131 AGTTAAAGTAGATACAGCAA
71 1789 455491 76114 76133 GAAGTTAAAGTAGATACAGC 63 1790 455492
76116 76135 TGGAAGTTAAAGTAGATACA 69 1791 455493 76118 76137
TCTGGAAGTTAAAGTAGATA 65 1792 455494 76120 76139
TTTCTGGAAGTTAAAGTAGA 55 1793 455495 76122 76141
TATTTCTGGAAGTTAAAGTA 57 1794 455496 76124 76143
TTTATTTCTGGAAGTTAAAG 36 1795 455497 76126 76145
CGTTTATTTCTGGAAGTTAA 77 1796 455553 9123 9142 ACCTGCCCCTATGTATAAGC
89 1852 11261 11280 455554 9484 9503 TTTGTAATATCTAACAGATA 20 1853
455555 9630 9649 TATATGACAGCCTCAATTTC 68 1854 455556 9677 9696
GGCATTTGTGTAAACAGGAA 81 1855 455557 9746 9765 TGTTAAATATTACTTAAAAT
4 1856 455558 9776 9795 AATTCCTTGGGTGGTAATCC 81 1857 455559 10071
10090 GGAAAGTTACAGGACAGGAA 77 1858 455560 10352 10371
GAAATGGCTTCTACAAAAAC 47 1859 455561 10472 10491
GGTCAGAATACCACAAACTA 80 1860 455562 10634 10653
AGTCTAATGCTTTTAGATTC 59 1861 455563 11567 11586
CATTGGAAAACTTAGGGTAA 37 1862 455564 11597 11616
ATTCTCACTGGGTATAGAGG 72 1863 455565 11700 11719
TAGCATTAATCTTTCCTAGG 92 1864 455566 9886 9905 GACTCAAAATAAGGTTCCTC
86 1865 12369 12388 455567 12430 12449 ACAGATTTATTCATATAAGC 62 1866
455568 14060 14079 AGATCCATAGATTCTTTCTT 80 1867 455569 14129 14148
ATCTGAATCAGAATATCTGC 88 1868 455570 14190 14209
GAAGACTTTATATTCTATGG 59 1869 455571 14355 14374
TATCCTTAATATTCAGGTAC 82 1870 455572 14501 14520
TTATTAAGACATCTGAAATA 31 1871 455573 14701 14720
TTAAGTGACTACACATGGAT 76 1872 455574 14761 14780
GATAATGTAACAACCCTATC 42 1873 455575 14828 14847
CTGAAGCATGAATTCACATT 83 1874 455576 15316 15335
AAATTCCACTACTCATGAAA 62 1875 455577 15370 15389
CTTCAGAGAATATCTCATTT 83 1876 455578 15400 15419
CACATCATAGTTTTGCATGA 70 1877 455579 15525 15544
TCTGACCCATAAAGTTTAAA 70 1878 455580 16568 16587
TTGGTTAATAATAATGTATC 44 1879 455581 16832 16851
TCACACATTTGTCAAAATCC 89 1880 455582 16863 16882
TATATAATTGTGTACTGGCA 93 1881 455583 16930 16949
TGCCAGTGGTTCAGCAGAGG 77 1882 455584 17215 17234
AATGTTTATAGCAGCTTTAT 56 1883 455585 17330 17349
GTCACTTTGAATATAGTTTG 79 1884 455586 17426 17445
GGCTAAAATCCAAAACACTG 65 1885 455587 18449 18468
AACAGTATTTGAGAAAACTT 21 1886 455588 19883 19902
GGGCTACAACTCAATAACAA 63 1887 455589 20512 20531
AAGTCCTTATCATTTAGCTC 69 1888 455590 21035 21054
GATATTCCCAAAGTGACAGG 75 1889 455591 21188 21207
ATAATGAGACTTTAGCACTC 86 1890 455592 21422 21441
AATCTAAACTTCCAGCCAGG 78 1891 455593 21493 21512
ACAATAATGCATGCAAATGT 67 1892 455594 21675 21694
CACTGCTATTTCCCCAGCAA 89 1893 455595 21710 21729
CTTAAGCCCCATAAGAACAA 65 1894 455596 21823 21842
ATCTAAAACAGCAACATCTC 57 1895 455597 23917 23936
TAGTGATTGAATGTAGACTT 81 1896 455598 23980 23999
TTAGGCCACTAAGTCTGAGC 83 1897 455599 24178 24197
CAGCTGAAATCAGCCTTTGA 69 1898 455600 24345 24364
AATCTAGCTAAGTCCATAAC 43 1899 455601 24504 24523
TGCTTGGATATATAGAAGTC 80 1900 455602 24578 24597
AGGTCACTTTCCCTATACGA 81 1901 455603 24608 24627
AGAAGGAAGATTCTTTTCTC 73 1902 455604 24924 24943
CTAAGAGAGGCAACTGAAAT 60 1903 455605 25063 25082
GGCTCGAGGGCCACTGAAGG 59 1904 455606 25093 25112
AGCAAGCACATTGTCATGTC 83 1905 455607 25132 25151
GGCTGCCAAACTTTTCAAAA 76 1906 455608 25626 25645
TTTGTTCTTGCCTAAAATGC 45 1907 455609 25688 25707
TTCCTTCAAGTCAACTTATC 69 1908 455610 26031 26050
CCAGCCTACAGATGACTTTC 78 1909 455611 26061 26080
GCCAACTTTAGCCCCTTCCA 85 1910 455612 26104 26123
AATGCAAAATCTTTACCCTT 58 1911 455613 26139 26158
CCAGCTCAAAAACACACACT 80 1912
455614 26227 26246 GTTTGAAAAATTCAAGAATG 26 1913 455615 26388 26407
ATAGTGTCTGGCTCATAATA 48 1914 455616 26597 26616
TCAGGTCCTCAAAAACACCA 84 1915 455617 26648 26667
TGGCTGGTACCAGCTGGTGG 76 1916 455618 26766 26785
ACAAATTCATCGAGCTAATG 52 1917 455619 26908 26927
AGAATAGCATGGATTTGAAT 49 1918 455620 26999 27018
CACAAACTTGATCTTGCCAC 77 1919 455626 36534 36553
GAATGTAAAGTATCTTGTTC 47 1920 455627 36578 36597
TATAAAATACACACTGGATT 57 1921 455628 36614 36633
GAAATGTGGCTGCTTCAAAC 36 1922 455629 36649 36668
TGGAGTCACTAGCCACATGT 71 1923 455630 36691 36710
GCATACAAATTTACTGAAAC 58 1924 455631 36904 36923
CAAGTTAAAATCTGCCTCAC 62 1925 455632 36975 36994
GGCATGTATTGATTGCCCTC 68 1926 455633 37026 37045
AGTAAAAGCAGTGGCTGACG 60 1927 455634 37086 37105
CACCTGCCACAGGACAAATG 28 1928 455635 37755 37774
TTGCCCCAATTAGGCCAATA 76 1929 455636 37822 37841
AAGGGCTTAAATTCCACTGG 73 1930 455637 37873 37892
GTACTTTACATGTGCAGCAC 81 1931 455638 38268 38287
AATATATCCAAAATGTTATT 8 1932 455639 38694 38713 GCAGCATCCAACAGAAATAG
62 1933 455640 39294 39313 GAGACTGAACACACGCAAAC 65 1934 455641
39324 39343 GTTCTCTGGGATAGTGAGAA 49 1935 455642 39792 39811
GAGAAACCCAGCCAGCTAAT 69 1936 455643 39937 39956
GGAAGATCTGCCTGAGATTC 46 1937 455644 40132 40151
TACAGCATCCAGCTCAGTGC 63 1938 455645 40633 40652
CCCAGTTTAGAACAATACAA 65 1939 455646 40866 40885
GTAGCCATTGCCCAACACAG 63 1940 455647 40901 40920
CACCACAAGTCCCAGTAGGG 58 1941 455648 40923 40942
TAAACCAAAGTGTGCATATG 11 1942 455649 41087 41106
AAGGACTTACCAATCTTGAC 7 1943 455650 41114 41133 ACCTAACAATTTGGAGAGTC
44 1944 455651 41239 41258 TTACAAGACCAAAGGGTGCC 68 1945 455652
41329 41348 AAATCAACCTTCAAGACATC 13 1946 455653 41397 41416
AAAAATATGTCTACCACATC 52 1947 455654 41431 41450
AAGTTCTAGCTATGACAGAA 23 1948 455655 41575 41594
AGCCTGCAGAACTATGAGCC 48 1949 455656 41629 41648
ATTGGAAGCTTGCTGAGGCC 44 1950 455657 41644 41663
CTGCCTTCCGCCATGATTGG 48 1951 455658 41747 41766
CGAGACAGTGAGTTCTTGTG 64 1952 455659 42067 42086
CTGGCCCTTCACCAAATCAG 62 1953 455660 42139 42158
GGTCAGATTTATTAGTACAA 65 1954 455661 42904 42923
ATCATACCTGAAGAAACTGC 16 1955 455662 43059 43078
ATACAGAGCTTTGAGAAAGG 38 1956 455663 43194 43213
TGTAACAGTGAGAGTCATCT 71 1957 455664 43284 43303
TCTGAGTCTTTACACAGTAT 72 1958 455665 43724 43743
TTCATCAAGGAAAGCATTTA 31 1959 455666 43765 43784
TGGAGATGTGGACTGAACTG 19 1960 455667 43908 43927
CCTGGGCCGCAGTGGCTGCA 63 1961 455668 43926 43945
GTTTTGTCTCAGGTCTCACC 75 1962 455669 43941 43960
CCAGACCAGGGATTTGTTTT 34 1963 455670 43974 43993
CTCATTATAAAGTTGTTTGA 55 1964 455671 44507 44526
TGTACTATGAAAGTTTGTCA 80 1965 455672 44525 44544
AATGATATTGGAATAATCTG 26 1966 455673 44540 44559
CTTTGGAAAAGTTTGAATGA 26 1967 455674 44583 44602
CAGCCTCATAAAATAAGCTG 19 1968 455675 45414 45433
TACTGAGAATAGTGTTTCAC 71 1969 455676 45440 45459
AAGACATCCTTATCTTTTGC 75 1970 455677 45512 45531
TTCCAATATTTGTACCCTCA 87 1971 455678 45626 45645
TACAATGGCCTTTCTAAACC 64 1972 455679 45712 45731
AGATCTTTACTTTCATTACA 54 1973 455680 46058 46077
TATGCAAATTGCATACATTT 59 1974 455681 46091 46110
TTTCCAGATATTTTCCCATA 88 1975 455682 46241 46260
GTGTATTTCACCACAATTTT 78 1976 455683 46571 46590
TGTCTTTGAACATGATCTTC 67 1977 455684 46676 46695
GCATGACTAATTAAAACATC 58 1978 455685 46759 46778
CAGAGCAAGTGGCAGGGCTG 69 1979 455686 46791 46810
CAGAGAGAGTAAAAATTGTT 49 1980 455687 46905 46924
CAGCAGAAAGCAGTTAAATT 56 1981 455688 46941 46960
CAGTAATGGTGAGGGTGATG 28 1982 455689 46956 46975
GGTCCCCATTTCCTACAGTA 67 1983 455690 47307 47326
ACACCTGAGCATATCAGTTT 67 1984 455691 47400 47419
CAGAAAATCCTAGTGCTGCC 62 1985 455692 47424 47443
ATAAAATACAAAGGTTTTCC 23 1986 455693 47467 47486
TCCAAATTGACTTAAACCAC 74 1987 455694 47528 47547
TTGAAAACATCCTTGGGATA 44 1988 455695 47579 47598
CAGGCTGGATTTGGGCCACG 76 1989 455696 47649 47668
GCCACAGATAATGCATAAAT 39 1990 455697 47795 47814
CTGGGTTGAGGCCACAAATA 78 1991 455698 47929 47948
GTTTGTGTACTTATAATCCC 75 1992 455699 47974 47993
GACAAAATGACACACATCCT 72 1993 455700 48188 48207
TTTCACACAATTGATAACTT 57 1994 455701 48208 48227
CAGGCCAACACAGAAAGCTG 70 1995 455702 48277 48296
AGAAACCCACCTCTAATACC 31 1996 455703 48402 48421
GCCACACTTTCCATTCTAGT 90 1997 455704 48417 48436
TGGTTACCAGCTCAAGCCAC 72 1998 455705 48566 48585
CAGGTCTAGAGGCCTATCCC 73 1999 455706 48665 48684
TCTTCAAAGAACCCAGCACC 63 2000 455707 48697 48716
AGATGGAGAGAAAGACTCTG 61 2001 455708 48728 48747
CCCACAGTGACAGTGACTCA 89 2002 455709 48768 48787
CTTAGAAGTTTTGGGAAGGT 60 2003 455710 48802 48821
ATGGTCCCTATCCAAGCCCA 81 2004 455711 48828 48847
ATGGGCAACCATTCTCTTCC 80 2005 455712 49754 49773
GTTGGATGTCTACTTAAACG 63 2006 455713 49845 49864
GACCACATGTTCAGCTAAGA 68 2007 455714 49923 49942
AAACAGAGGCAGTGGTGCTG 62 2008 455715 50053 50072
CCAAAAAGGAGGTCAATGCA 30 2009 455716 50522 50541
GTATCCCCAAGAGAAGGCTC 59 2010 455717 50571 50590
TCAAATGAAGCCAAAACCTC 63 2011 455718 50774 50793
CACTTTCTAGAGATTTTAAC 1 2012 455719 51623 51642 TCAGATCTTGCATGTCTGCG
2 2013 455720 51753 51772 CCGCAAGTGAGCGAGACACA 49 2014 455721 51827
51846 CCACATTCTTTAGTCAACTC 59 2015 455722 51856 51875
CAGAAAACATTTCCTCAGAC 3 2016 455723 52033 52052 ACCAGTTTTCTAGCCGATCT
90 2017 455724 52056 52075 AGGAAAAGCTTCTTTCATCC 34 2018 455725
52071 52090 GCTTTCGAGAAAGAAAGGAA 44 2019 455726 53203 53222
TGGATGAAGGTAAAAGTGCA 42 2020 455727 53246 53265
TCACTATAGGGCCTTGCACA 53 2021 455728 53262 53281
AGCTGGTGCAACATGCTCAC 69 2022 455729 53329 53348
GCATTCTCATGTAGAGTTGC 0 2023 455730 53344 53363 GATATGAATAGACAGGCATT
63 2024 455731 53431 53450 ATTCCCAGAACTTAAGCTTC 40 2025 455732
53571 53590 ATTCCATCATTCTTTGATGG 47 2026 455733 53900 53919
TGCACAAGGAATAAGTGAAT 51 2027 455734 54378 54397
AGAAGGGCTTGAACTACATG 15 2028 455735 54577 54596
GAGCCCAGATATGCAGAACA 58 2029 455736 54592 54611
AAATGACAAGCATCTGAGCC 16 2030 455737 54632 54651
ATTTATACCACTAGGAGGCA 52 2031 455738 55241 55260
TTCAGTGACATTAAGAAAAG 28 2032 455739 55256 55275
ATCTTAAGTTTACAGTTCAG 64 2033 455740 55277 55296
GCATGAAATTTACAATTTTT 26 2034 455741 55418 55437
TCCTGCCAATAAATTAAGAA 0 2035 455742 55657 55676 GAAGTCAGCCCGCCTCTCAC
33 2036 455743 55841 55860 GTGTCCCTCAGTAAAATCTC 53 2037 455744
55877 55896 ATGACCCTGGCCACCAACTC 63 2038
455745 55961 55980 CAGAATCAGAGAGCAAGCAG 56 2039 455746 56125 56144
CCTTAAAATCCACAGGGAAG 5 2040 455747 56151 56170 TCCCCATCACTAAGCCTTAC
31 2041 455748 56203 56222 TAACACCTCACCCTACAGGC 56 2042 455749
56287 56306 ACACCATACTAAGTTTCTGA 68 2043 455750 57995 58014
CTTGTCAATGCACACTTTAA 80 2044 455751 58074 58093
TCTAGTTCAAATGATGTCTG 66 2045 455752 58089 58108
AATAAAGACAGAGTCTCTAG 30 2046 455753 58106 58125
CAAAATGAAGATCTCTGAAT 23 2047 455754 58173 58192
AGCTTTGTGGCTTTGTTCAG 60 2048 455755 58259 58278
TGAATGACATGTACAAGTAA 52 2049 455756 58377 58396
TGTGTAAGGACTATATACTC 64 2050 455757 58471 58490
TTCAGCACAGTAACATACTG 41 2051 455758 58496 58515
AGATGTGTTACAATTGCCTA 76 2052 455759 58696 58715
TTTACATCCTGAAAGGTATT 51 2053 455760 59471 59490
ATATGTACTTATTAAACCTA 18 2054 455761 59748 59767
ACAAAAGGAAGCCTCTAGGC 0 2055 455762 59913 59932 CCAAGTGTTTGAATTCTGCA
83 2056 455763 60155 60174 CAGGTTGATGTTTCTAATTC 60 2057 455764
60170 60189 CTACAGCTGAAAGAACAGGT 76 2058 455765 60249 60268
ATGTTCCAAGCCAGAGAGCT 54 2059 455766 60323 60342
GGTGTGGAGAACAACTCAGC 72 2060 455767 60373 60392
GGGAATTTGGAAAGCCCCAG 0 2061 455768 60392 60411 CAGCCGCAGGAGCTGGATGG
42 2062 455769 60407 60426 GGAGCCAAGCAGGGTCAGCC 73 2063 455770
60433 60452 GGAGAGAAAAACAGGGCACT 69 2064 455771 60448 60467
TATCCCACCTCAGTGGGAGA 1 2065 455772 60602 60621 TCTGAATCAATGAAAAGCAG
79 2066 455773 60703 60722 CATCACAATTTTTAAAAATG 0 2067 455774 61216
61235 GTATTTTTAAAACACATATA 0 2068 455775 61251 61270
CTTAATATACATATGAATAC 14 2069 455786 61340 61359
CAAATATCACAGAGACAGTC 88 2070 455787 61758 61777
GTACAGCAACCTTATTTTAA 5 2071 455788 61853 61872 TTAAATCCTGGGAATGGCAC
83 2072 455789 61959 61978 CTAATGTTGATGGGTATTTA 60 2073 455790
62043 62062 CATGGTTATGTGTATCTGCA 89 2074 455791 62067 62086
TTCACTTGATGTGAAATGAA 18 2075 455792 62500 62519
TGCCAGGGACACAACTTGCT 82 2076 455793 62595 62614
ATGGCATTCAGTACTAACAG 59 2077 455794 62610 62629
TTTTCCTCAGAGAGAATGGC 67 2078 455795 63284 63303
AGTCACAATCAGGGAAGCCT 77 2079 455796 63449 63468
AGTAATCATTCCACCTTCTC 70 2080 455797 63464 63483
CAGTGTTAAGCAAACAGTAA 41 2081 455798 63554 63573
ATACACACATCTTCTAAGCA 48 2082 455799 63576 63595
TCAAGTTTGCTGAAAGCTGA 48 2083 455800 63591 63610
ATAGAGATTTTCATATCAAG 41 2084 455801 64070 64089
ACAGGGAGGTCTCAGGAATC 77 2085 455802 64122 64141
TTTAAGACCTTGGAGGCATT 36 2086 455803 64586 64605
AGGGATGGTGCTCATTGTCT 20 2087 455804 64810 64829
GCCGGATCCCTTTTCTGGGC 64 2088 455805 64955 64974
TGATCACCTCGACTGAAAAC 65 2089 455806 65058 65077
GTGCCACCTTCCAACACACA 74 2090 455807 65530 65549
CAGACAGGTGTATTTGGTGG 65 2091 455808 65895 65914
ACTTTGCAAAATTTAGCCCA 77 2092 455809 65928 65947
TCCCATTCCCACGAGAATTT 76 2093 455810 65972 65991
GCCTTCAAGCCAGAGCCCTC 76 2094 455811 65987 66006
GACCAAGAGTTCAGGGCCTT 59 2095 455812 66099 66118
GTAATGGGAAAGCCAAGTCT 51 2096 455813 66128 66147
TTGCCAGCCATGTTTTCCTG 67 2097 455814 66283 66302
AGGGCATCCATCCCCTGCCA 7 2098 455815 66664 66683 TCACTGGAGCAAGCAAAACA
64 2099 455816 66775 66794 GGTCATAGAAAATAAACTTG 62 2100 455817
66863 66882 AGTGTTGAGACCCTGAACAC 53 2101 455818 66918 66937
AGAGAAAACTGCCCATTTTT 71 2102 455819 66948 66967
AGATCATGGAACCTACAGCT 18 2103 455820 66963 66982
GGACATGGGAAGGAAAGATC 27 2104 455821 67191 67210
CAACAACTACCTGGGTCAGC 51 2105 455822 67271 67290
AGGCATTTGCCTATCTATCC 58 2106 455823 67334 67353
CCAACAAAAGCACTCACTAC 56 2107 455824 67773 67792
TGAAATCTGGGCCTCAAACC 78 2108 455825 67843 67862
GAAACCCTTTCTTCAGACCA 79 2109 455826 68621 68640
TCAAAACAGCAAGTGCTGAA 60 2110 455827 69053 69072
AACCCTAAAGGATCACATTA 43 2111 455828 69357 69376
CAAAGAGCCGTGTGGCAGGG 65 2112 455829 69395 69414
GACCAGCCGTGGGACCCCAA 84 2113 455830 69473 69492
CCACAGGAAGGGCGATGGTA 58 2114 455831 69498 69517
GCAGGAAAGGACCTGGCCTC 45 2115 455832 70567 70586
TTAGGGAGCTGACACCCTAG 56 2116 455833 70645 70664
CAATTCAGTGCAGAATTCAA 80 2117 455834 70675 70694
TCTGAGTTTACTTTGGGCCA 75 2118 455835 70725 70744
CATGATGACCATGTGAAAGA 82 2119 455836 70890 70909
CTGAATGCTTACACCAAGAG 83 2120 455837 70973 70992
CCAATTTTCTATGAGCTTTG 85 2121 455838 71013 71032
CTTTTATGTATAAAATAAGA 6 2122 455839 71573 71592 CCAGGTACATCTTCAATAGC
75 2123 455840 71610 71629 GTACAATTGCTTCAACTAGA 87 2124 455841
71698 71717 ACATTTTTGGATGAGGGCAT 81 2125 455842 71750 71769
AAAGCCAAAGGTTATATCTC 77 2126 455843 71765 71784
AATGCTTGTGGTTCCAAAGC 79 2127 455844 71929 71948
TGTAAAAGTTTAACAGCCTC 70 2128 455845 71992 72011
CATAACCTTTTCCCACCTGA 79 2129 455846 72036 72055
CAGTTCTTTGCACAAAGCTG 76 2130 455847 72127 72146
CAAGATTGTCTGGAAAGCTC 76 2131 455848 72202 72221
TCGCATTCAGTAAGCAGAGC 47 2132 455849 72229 72248
AAACCAGTTTTCTTACTGAC 17 2133 455850 72285 72304
CGGTGTCACACAGATAAACT 73 2134 455851 72367 72386
TTAACTCTCACCCAGTGTCC 61 2135 455852 72406 72425
GTACTAAACATAGCCCAGGG 78 2136 455853 72687 72706
AAATACTCACCAAACTGCCC 4 2137 455854 72768 72787 GTGACCAGCTCTCGGTGTGT
10 2138 455855 73340 73359 GATTTGGTTTGTCCAAACTG 49 2139 455856
73530 73549 GTCAGAAAAGCCAGATTTAC 46 2140 455857 73621 73640
GCAACTGGCAGGCCACGCCC 39 2141 455858 73636 73655
AGTTGTCCACCCTCTGCAAC 0 2142 455859 73683 73702 TGTCAAAGGTGAGGGACTCT
57 2143 455860 74018 74037 ACACAAGACATTTCCTTTTT 64 1544
Example 33: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0564] Gapmers from the study described in Example 32 exhibiting
significant in vitro inhibition of STAT3 were tested at various
doses in HuVEC cells. Cells were plated at a density of 5,000 cells
per well and transfected using LipofectAMINE2000.RTM. reagent with
1.1 nM, 3.3 nM, 10.0 nM, and 30.0 nM concentrations of antisense
oligonucleotide, as specified in Table 54. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199 (forward sequence
ACATGCCACTTTGGTGTTTCATAA, designated herein as SEQ ID NO: 6;
reverse sequence TCTTCGTAGATTGTGCTGATAGAGAAC, designated herein as
SEQ ID NO: 7; probe sequence CAGTATAGCCGCTTCCTGCAAGAGTCGAA,
designated herein as SEQ ID NO: 8) was used to measure mRNA levels.
STAT3 mRNA levels were adjusted according to total RNA content, as
measured by RIBOGREEN.RTM.. Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0565] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 54 and was
calculated by plotting the concentrations of oligonucleotides used
versus the percent inhibition of STAT3 mRNA expression achieved at
each concentration, and noting the concentration of oligonucleotide
at which 50% inhibition of STAT3 mRNA expression was achieved
compared to the control. As illustrated in Table 54, STAT3 mRNA
levels were significantly reduced in a dose-dependent manner in
antisense oligonucleotide treated cells.
TABLE-US-00054 TABLE 54 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells ISIS No 1.1 nM 3.3 nM 10.0 nM 30.0 nM
IC.sub.50 (nM) 337332 7 19 46 80 10.4 345785 8 22 46 74 11.3 455265
20 43 64 85 5.0 455267 16 30 62 79 6.7 455269 23 49 72 84 4.0
455270 3 28 60 79 8.1 455271 16 40 71 86 4.9 455272 28 30 57 86 5.7
455282 18 28 55 80 7.4 455291 21 45 75 85 4.1 455370 6 23 53 78 9.0
455371 15 46 73 90 4.5 455391 10 30 54 75 8.5 455393 6 33 62 81 7.0
455394 5 33 63 85 6.7 455398 7 25 56 76 8.8 455411 10 21 58 82 7.9
455412 15 27 50 79 8.4 455429 17 43 67 81 5.2 455438 20 43 66 83
5.0 455439 10 41 67 84 5.7 455447 7 23 53 87 7.7 455457 9 24 52 79
8.8 455458 8 34 62 83 6.7 455463 6 37 63 85 6.3 455471 11 42 67 78
5.9 455525 0 9 42 72 13.4 455527 0 21 60 87 7.8 455530 11 26 62 83
7.1 455536 5 21 62 85 7.6 455540 8 28 65 87 6.5 455547 6 19 45 67
13.4 455548 0 41 68 90 5.8 455551 0 3 33 72 15.9 455553 0 29 64 87
7.2 455565 0 19 54 86 8.8 455566 13 28 45 76 9.6 455569 0 16 47 76
11.1 455581 0 19 62 85 8.6 455582 0 26 70 89 6.9 455591 7 17 47 68
12.8 455594 0 16 48 76 10.9 455611 14 43 68 81 5.4 455637 10 22 56
76 8.9 455677 0 18 46 72 11.9 455681 16 19 42 69 13.0 455703 9 40
72 92 5.1 455708 11 15 45 77 10.7 455723 3 9 33 68 17.0 455762 0 9
42 70 14.1 455786 21 32 50 79 7.4 455790 13 19 56 84 7.8 455840 17
30 52 77 7.9
Example 34: Antisense Inhibition of Human STAT3 in HuVEC Cells by
Oligonucleotides Designed by Microwalk
[0566] Additional gapmers were designed based on the gapmers
presented in Example 1 that demonstrated an inhibition of at least
50%. These gapmers were designed by creating gapmers shifted
slightly upstream and downstream (i.e., "microwalk") of the
original gapmers. These gapmers were tested in vitro. ISIS 337332
was also included in the assay as a comparator. Cultured HuVEC
cells at a density of 5,000 cells per well were transfected using
LipofectAMINE 2000.RTM. reagent with 30 nM antisense
oligonucleotide. After a treatment period of approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. The human primer probe set
RTS199, described hereinabove, was used to measure STAT3 mRNA
levels. STAT3 mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of STAT3, relative to untreated control cells.
The results are presented in Table 55.
[0567] The chimeric antisense oligonucleotides in Table 55 were
designed as 5-10-5 MOE gapmers. The gapmers designated with an
asterisk (*) in Table 55 are the original gapmers from which
gapmers, ISIS 465226-466744, were designed via microwalk. The
5-10-5 gapmers are 20 nucleosides in length, wherein the central
gap segment is comprised of ten 2'-deoxynucleosides and is flanked
on both sides (in the 5' and 3' directions) by wings comprising
five nucleosides each. Each nucleoside in the 5' wing segment and
each nucleoside in the 3' wing segment has a 2'-MOE modification.
The internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each gapmer are 5'-methylcytosines. "Target start site"
indicates the 5'-most nucleoside to which the gapmer is targeted.
"Target stop site" indicates the 3'-most nucleoside to which the
gapmer is targeted. Each gapmer listed in Table 55 is targeted to
the target region spanning nucleobases 2313-76017 of SEQ ID NO: 2
(the complement of GENBANK Accession No. NT_010755.14 truncated
from nucleotides 4185000 to 4264000).
TABLE-US-00055 TABLE 55 Inhibition of human STAT3 mRNA levels by
chimeric antisense oligonucleotides targeted to SEQ ID NO: 2 % ISIS
No Start Site Stop Site Sequence inhibition SEQ ID NO 466646 2313
2332 CACACTATACACATTTTTAA 3 2144 466647 2314 2333
ACACACTATACACATTTTTA 11 2145 466648 2315 2334 TACACACTATACACATTTTT
8 2146 455525* 2316 2335 GTACACACTATACACATTTT 47 1824 466649 2317
2336 GGTACACACTATACACATTT 46 2147 466650 2318 2337
AGGTACACACTATACACATT 46 2148 466651 2319 2338 CAGGTACACACTATACACAT
54 2149 466652 2320 2339 GCAGGTACACACTATACACA 68 2150 466653 2321
2340 AGCAGGTACACACTATACAC 43 2151 466654 2322 2341
CAGCAGGTACACACTATACA 56 2152 466655 2323 2342 CCAGCAGGTACACACTATAC
72 2153 466656 2324 2343 ACCAGCAGGTACACACTATA 52 2154 466657 2325
2344 GACCAGCAGGTACACACTAT 69 2155 466658 2326 2345
AGACCAGCAGGTACACACTA 15 2156 466659 2327 2346 AAGACCAGCAGGTACACACT
49 2157 466660 2328 2347 TAAGACCAGCAGGTACACAC 59 2158 466661 2329
2348 GTAAGACCAGCAGGTACACA 73 2159 466662 2330 2349
AGTAAGACCAGCAGGTACAC 65 2160 466663 2331 2350 CAGTAAGACCAGCAGGTACA
64 2161 466664 2332 2351 ACAGTAAGACCAGCAGGTAC 53 2162 466665 2333
2352 TACAGTAAGACCAGCAGGTA 67 2163 466666 2334 2353
ATACAGTAAGACCAGCAGGT 75 2164 466667 2335 2354 CATACAGTAAGACCAGCAGG
66 2165 466668 2336 2355 ACATACAGTAAGACCAGCAG 55 2166 466669 2337
2356 CACATACAGTAAGACCAGCA 71 2167 466670 2338 2357
GCACATACAGTAAGACCAGC 83 2168 466671 2339 2358 TGCACATACAGTAAGACCAG
28 2169 466672 2340 2359 TTGCACATACAGTAAGACCA 70 2170 466673 2341
2360 GTTGCACATACAGTAAGACC 39 2171 466674 2342 2361
AGTTGCACATACAGTAAGAC 53 2172 466675 2343 2362 TAGTTGCACATACAGTAAGA
43 2173 455527* 2383 2402 GCCAAAAATTTACAACCCAT 48 1826 465806 2384
2403 AGCCAAAAATTTACAACCCA 29 2174 465807 2385 2404
CAGCCAAAAATTTACAACCC 7 2175 465808 2386 2405 CCAGCCAAAAATTTACAACC
35 2176 465809 2387 2406 GCCAGCCAAAAATTTACAAC 10 2177 465810 2388
2407 AGCCAGCCAAAAATTTACAA 37 2178 465811 2389 2408
CAGCCAGCCAAAAATTTACA 29 2179 465812 2390 2409 ACAGCCAGCCAAAAATTTAC
3 2180 465813 2391 2410 CACAGCCAGCCAAAAATTTA 6 2181 465814 2392
2411 GCACAGCCAGCCAAAAATTT 35 2182 465815 2393 2412
AGCACAGCCAGCCAAAAATT 22 2183 465816 2394 2413 CAGCACAGCCAGCCAAAAAT
23 2184 465817 2395 2414 TCAGCACAGCCAGCCAAAAA 33 2185 465818 2396
2415 ATCAGCACAGCCAGCCAAAA 32 2186 465819 2397 2416
TATCAGCACAGCCAGCCAAA 48 2187 465820 2398 2417 TTATCAGCACAGCCAGCCAA
32 2188 465821 2399 2418 TTTATCAGCACAGCCAGCCA 0 2189 465822 2400
2419 CTTTATCAGCACAGCCAGCC 49 2190 465823 2401 2420
GCTTTATCAGCACAGCCAGC 69 2191 465824 2402 2421 TGCTTTATCAGCACAGCCAG
48 2192 465825 2403 2422 ATGCTTTATCAGCACAGCCA 74 2193 465826 2404
2423 AATGCTTTATCAGCACAGCC 62 2194 465827 2405 2424
CAATGCTTTATCAGCACAGC 67 2195 465828 2406 2425 CCAATGCTTTATCAGCACAG
71 2196 465829 2407 2426 CCCAATGCTTTATCAGCACA 47 2197 465830 2408
2427 GCCCAATGCTTTATCAGCAC 81 2198 465831 2409 2428
AGCCCAATGCTTTATCAGCA 75 2199 465832 2410 2429 AAGCCCAATGCTTTATCAGC
57 2200 465349 2655 2674 AGGCTCCAACCTCTAAAACA 41 2201 465350 2656
2675 AAGGCTCCAACCTCTAAAAC 34 2202 465351 2657 2676
CAAGGCTCCAACCTCTAAAA 43 2203 465352 2658 2677 TCAAGGCTCCAACCTCTAAA
51 2204 465353 2659 2678 ATCAAGGCTCCAACCTCTAA 38 2205 465354 2660
2679 AATCAAGGCTCCAACCTCTA 29 2206 465355 2661 2680
AAATCAAGGCTCCAACCTCT 56 2207 465356 2662 2681 AAAATCAAGGCTCCAACCTC
24 2208 465357 2663 2682 TAAAATCAAGGCTCCAACCT 46 2209 465358 2664
2683 CTAAAATCAAGGCTCCAACC 45 2210 465359 2665 2684
ACTAAAATCAAGGCTCCAAC 50 2211 465366 2666 2685 GACTAAAATCAAGGCTCCAA
51 2212 465367 2667 2686 AGACTAAAATCAAGGCTCCA 64 2213 465368 2668
2687 GAGACTAAAATCAAGGCTCC 76 2214 455530* 2669 2688
AGAGACTAAAATCAAGGCTC 74 1829 455536* 5000 5019 AGAACTGAAATTCCTTGGTC
52 1835 465833 5001 5020 CAGAACTGAAATTCCTTGGT 81 2215 465834 5002
5021 ACAGAACTGAAATTCCTTGG 81 2216 465835 5003 5022
AACAGAACTGAAATTCCTTG 48 2217 465836 5004 5023 GAACAGAACTGAAATTCCTT
46 2218 465837 5005 5024 AGAACAGAACTGAAATTCCT 39 2219 465838 5006
5025 AAGAACAGAACTGAAATTCC 22 2220 465839 5007 5026
AAAGAACAGAACTGAAATTC 3 2221 465840 5008 5027 AAAAGAACAGAACTGAAATT 0
2222 465841 5009 5028 CAAAAGAACAGAACTGAAAT 0 2223 465842 5010 5029
ACAAAAGAACAGAACTGAAA 0 2224 465843 5011 5030 TACAAAAGAACAGAACTGAA 3
2225 465844 5012 5031 CTACAAAAGAACAGAACTGA 0 2226 465845 5013 5032
CCTACAAAAGAACAGAACTG 13 2227 465846 5014 5033 CCCTACAAAAGAACAGAACT
0 2228 465847 5015 5034 CCCCTACAAAAGAACAGAAC 7 2229 465848 5016
5035 TCCCCTACAAAAGAACAGAA 33 2230 465849 5017 5036
TTCCCCTACAAAAGAACAGA 18 2231 465850 5018 5037 CTTCCCCTACAAAAGAACAG
0 2232 465851 5019 5038 GCTTCCCCTACAAAAGAACA 43 2233 465852 5020
5039 AGCTTCCCCTACAAAAGAAC 32 2234 465853 5021 5040
AAGCTTCCCCTACAAAAGAA 0 2235 465854 5022 5041 AAAGCTTCCCCTACAAAAGA
15 2236 465855 5023 5042 AAAAGCTTCCCCTACAAAAG 14 2237 465856 5024
5043 TAAAAGCTTCCCCTACAAAA 4 2238 465857 5025 5044
TTAAAAGCTTCCCCTACAAA 0 2239 465858 5026 5045 TTTAAAAGCTTCCCCTACAA
11 2240 465859 5027 5046 TTTTAAAAGCTTCCCCTACA 11 2241 465860 5688
5707 CAGTGGTTTTTATAAATGAC 29 2242 465861 5689 5708
TCAGTGGTTTTTATAAATGA 19 2243 465862 5690 5709 TTCAGTGGTTTTTATAAATG
4 2244 465863 5691 5710 TTTCAGTGGTTTTTATAAAT 0 2245 465864 5692
5711 CTTTCAGTGGTTTTTATAAA 0 2246 465865 5693 5712
TCTTTCAGTGGTTTTTATAA 0 2247 465866 5694 5713 CTCTTTCAGTGGTTTTTATA
35 2248 465867 5695 5714 ACTCTTTCAGTGGTTTTTAT 67 2249 465868 5696
5715 TACTCTTTCAGTGGTTTTTA 60 2250 465886 5697 5716
GTACTCTTTCAGTGGTTTTT 85 2251 465887 5698 5717 AGTACTCTTTCAGTGGTTTT
62 2252 455540* 5699 5718 AAGTACTCTTTCAGTGGTTT 76 1839 465888 5700
5719 CAAGTACTCTTTCAGTGGTT 80 2253 465906 5701 5720
TCAAGTACTCTTTCAGTGGT 74 2254 465926 5702 5721 CTCAAGTACTCTTTCAGTGG
80 2255 465927 5703 5722 CCTCAAGTACTCTTTCAGTG 71 2256 465928 5704
5723 CCCTCAAGTACTCTTTCAGT 54 2257 465929 5705 5724
TCCCTCAAGTACTCTTTCAG 33 2258 465930 5706 5725 GTCCCTCAAGTACTCTTTCA
56 2259 465931 5707 5726 TGTCCCTCAAGTACTCTTTC 43 2260
465932 5708 5727 ATGTCCCTCAAGTACTCTTT 33 2261 465486 7674 7693
AAAGGGCTGCAAAAAATCTG 39 2262 465487 7675 7694 GAAAGGGCTGCAAAAAATCT
11 2263 465488 7676 7695 AGAAAGGGCTGCAAAAAATC 28 2264 465489 7677
7696 CAGAAAGGGCTGCAAAAAAT 39 2265 465490 7678 7697
ACAGAAAGGGCTGCAAAAAA 29 2266 465506 7679 7698 AACAGAAAGGGCTGCAAAAA
36 2267 465507 7680 7699 AAACAGAAAGGGCTGCAAAA 35 2268 465508 7681
7700 TAAACAGAAAGGGCTGCAAA 47 2269 455547* 7682 7701
GTAAACAGAAAGGGCTGCAA 72 1846 465509 7683 7702 GGTAAACAGAAAGGGCTGCA
70 2270 465510 7684 7703 TGGTAAACAGAAAGGGCTGC 63 2271 465511 7685
7704 CTGGTAAACAGAAAGGGCTG 60 2272 465526 7686 7705
CCTGGTAAACAGAAAGGGCT 65 2273 465527 7687 7706 ACCTGGTAAACAGAAAGGGC
26 2274 465528 7688 7707 AACCTGGTAAACAGAAAGGG 53 2275 465529 7689
7708 TAACCTGGTAAACAGAAAGG 35 2276 465530 7690 7709
ATAACCTGGTAAACAGAAAG 3 2277 465531 7691 7710 GATAACCTGGTAAACAGAAA
17 2278 465532 7692 7711 AGATAACCTGGTAAACAGAA 14 2279 465533 7693
7712 AAGATAACCTGGTAAACAGA 26 2280 455548* 8078 8097
GGGCAGATTTACCTTCCTTA 77 1847 466722 8241 8260 AATAGCAATCACCTTAGGAA
53 2281 466723 8242 8261 CAATAGCAATCACCTTAGGA 62 2282 466724 8243
8262 ACAATAGCAATCACCTTAGG 48 2283 455551* 8244 8263
TACAATAGCAATCACCTTAG 65 1850 466725 8245 8264 CTACAATAGCAATCACCTTA
15 2284 466726 8246 8265 ACTACAATAGCAATCACCTT 45 2285 466727 8247
8266 AACTACAATAGCAATCACCT 42 2286 466728 8248 8267
AAACTACAATAGCAATCACC 26 2287 466729 8249 8268 AAAACTACAATAGCAATCAC
14 2288 466730 8250 8269 CAAAACTACAATAGCAATCA 0 2289 466731 8251
8270 TCAAAACTACAATAGCAATC 29 2290 466732 8252 8271
TTCAAAACTACAATAGCAAT 20 2291 466733 8253 8272 TTTCAAAACTACAATAGCAA
14 2292 466734 8254 8273 GTTTCAAAACTACAATAGCA 58 2293 466735 8255
8274 TGTTTCAAAACTACAATAGC 28 2294 466736 8256 8275
GTGTTTCAAAACTACAATAG 42 2295 466737 8257 8276 AGTGTTTCAAAACTACAATA
13 2296 466738 8258 8277 AAGTGTTTCAAAACTACAAT 18 2297 466739 8259
8278 CAAGTGTTTCAAAACTACAA 30 2298 466740 8260 8279
CCAAGTGTTTCAAAACTACA 49 2299 466741 8261 8280 ACCAAGTGTTTCAAAACTAC
46 2300 466742 8262 8281 AACCAAGTGTTTCAAAACTA 41 2301 466743 8263
8282 CAACCAAGTGTTTCAAAACT 13 2302 455553* 9123 9142
ACCTGCCCCTATGTATAAGC 75 1852 11261 11280 466744 9124 9143
CACCTGCCCCTATGTATAAG 67 2303 11262 11281 466745 9125 9144
CCACCTGCCCCTATGTATAA 69 2304 11263 11282 466746 9126 9145
TCCACCTGCCCCTATGTATA 68 2305 11264 11283 466747 9127 9146
TTCCACCTGCCCCTATGTAT 69 2306 11265 11284 466748 9128 9147
ATTCCACCTGCCCCTATGTA 58 2307 11266 11285 466749 9129 9148
TATTCCACCTGCCCCTATGT 38 2308 11267 11286 466750 9130 9149
TTATTCCACCTGCCCCTATG 47 2309 11268 11287 466751 9131 9150
TTTATTCCACCTGCCCCTAT 54 2310 466752 9132 9151 TTTTATTCCACCTGCCCCTA
50 2311 466753 9133 9152 GTTTTATTCCACCTGCCCCT 58 2312 466754 9134
9153 TGTTTTATTCCACCTGCCCC 53 2313 466755 9135 9154
ATGTTTTATTCCACCTGCCC 69 2314 466756 9136 9155 TATGTTTTATTCCACCTGCC
3 2315 466757 9137 9156 TTATGTTTTATTCCACCTGC 48 2316 466758 9138
9157 ATTATGTTTTATTCCACCTG 53 2317 466759 9139 9158
AATTATGTTTTATTCCACCT 24 2318 466760 9140 9159 TAATTATGTTTTATTCCACC
10 2319 466761 9141 9160 CTAATTATGTTTTATTCCAC 13 2320 466762 9142
9161 CCTAATTATGTTTTATTCCA 23 2321 466763 9143 9162
TCCTAATTATGTTTTATTCC 27 2322 466764 9144 9163 CTCCTAATTATGTTTTATTC
21 2323 466765 9145 9164 CCTCCTAATTATGTTTTATT 30 2324 465740 9862
9881 TGGCTTCTTCCTGAGACACA 81 2325 12345 12364 465741 9863 9882
TTGGCTTCTTCCTGAGACAC 68 2326 12346 12365 465742 9864 9883
GTTGGCTTCTTCCTGAGACA 81 2327 12347 12366 465743 9865 9884
TGTTGGCTTCTTCCTGAGAC 68 2328 12348 12367 465744 9866 9885
CTGTTGGCTTCTTCCTGAGA 44 2329 12349 12368 465745 9867 9886
CCTGTTGGCTTCTTCCTGAG 73 2330 12350 12369 465746 9868 9887
TCCTGTTGGCTTCTTCCTGA 61 2331 12351 12370 465747 9869 9888
CTCCTGTTGGCTTCTTCCTG 53 2332 12352 12371 465748 9870 9889
CCTCCTGTTGGCTTCTTCCT 78 2333 12353 12372 465749 9871 9890
TCCTCCTGTTGGCTTCTTCC 73 2334 12354 12373 465750 9872 9891
TTCCTCCTGTTGGCTTCTTC 70 2335 12355 12374 465751 9873 9892
GTTCCTCCTGTTGGCTTCTT 89 2336 12356 12375 465752 9874 9893
GGTTCCTCCTGTTGGCTTCT 86 2337 12357 12376 465753 9875 9894
AGGTTCCTCCTGTTGGCTTC 73 2338 12358 12377 465754 9876 9895
AAGGTTCCTCCTGTTGGCTT 85 2339 12359 12378 465755 9877 9896
TAAGGTTCCTCCTGTTGGCT 82 2340 12360 12379 465756 9878 9897
ATAAGGTTCCTCCTGTTGGC 72 2341 12361 12380 465757 9879 9898
AATAAGGTTCCTCCTGTTGG 61 2342 12362 12381 465758 9880 9899
AAATAAGGTTCCTCCTGTTG 40 2343 12363 12382 465759 9881 9900
AAAATAAGGTTCCTCCTGTT 41 2344 12364 12383 465760 9882 9901
CAAAATAAGGTTCCTCCTGT 20 2345 12365 12384 465761 9883 9902
TCAAAATAAGGTTCCTCCTG 57 2346 12366 12385 465762 9884 9903
CTCAAAATAAGGTTCCTCCT 48 2347 12367 12386 465763 9885 9904
ACTCAAAATAAGGTTCCTCC 52 2348 12368 12387 455566* 9886 9905
GACTCAAAATAAGGTTCCTC 59 1855 12369 12388 465764 9887 9906
TGACTCAAAATAAGGTTCCT 54 2349 12370 12389 465765 9888 9907
CTGACTCAAAATAAGGTTCC 47 2350 12371 12390 465766 9889 9908
CCTGACTCAAAATAAGGTTC 55 2351 12372 12391 465767 9890 9909
ACCTGACTCAAAATAAGGTT 48 2352 12373 12382 455553* 9123 9142
ACCTGCCCCTATGTATAAGC 75 1852 11261 11280 466744 9124 9143
CACCTGCCCCTATGTATAAG 67 2303 11262 11281 466745 9125 9144
CCACCTGCCCCTATGTATAA 69 2304 11263 11282 466746 9126 9145
TCCACCTGCCCCTATGTATA 68 2305 11264 11283 466747 9127 9146
TTCCACCTGCCCCTATGTAT 69 2306 11265 11284 466748 9128 9147
ATTCCACCTGCCCCTATGTA 58 2307 11266 11285 466749 9129 9148
TATTCCACCTGCCCCTATGT 38 2308
11267 11286 466750 9130 9149 TTATTCCACCTGCCCCTATG 47 2309 11268
11287 465726 11695 11714 TTAATCTTTCCTAGGCAAAG 19 2353 465727 11696
11715 ATTAATCTTTCCTAGGCAAA 22 2354 465728 11697 11716
CATTAATCTTTCCTAGGCAA 43 2355 465729 11698 11717
GCATTAATCTTTCCTAGGCA 68 2356 465730 11699 11718
AGCATTAATCTTTCCTAGGC 80 2357 455565* 11700 11719
TAGCATTAATCTTTCCTAGG 74 1864 465731 11701 11720
TTAGCATTAATCTTTCCTAG 42 2358 465732 11702 11721
ATTAGCATTAATCTTTCCTA 22 2359 465733 11703 11722
GATTAGCATTAATCTTTCCT 40 2360 465734 11704 11723
AGATTAGCATTAATCTTTCC 0 2361 465735 11705 11724 AAGATTAGCATTAATCTTTC
10 2362 465736 11706 11725 TAAGATTAGCATTAATCTTT 3 2363 465737 12342
12361 CTTCTTCCTGAGACACAGCC 71 2364 465738 12343 12362
GCTTCTTCCTGAGACACAGC 74 2365 465739 12344 12363
GGCTTCTTCCTGAGACACAG 83 2366 465740 9862 9881 TGGCTTCTTCCTGAGACACA
81 2325 12345 12364 465741 9863 9882 TTGGCTTCTTCCTGAGACAC 68 2326
12346 12365 465742 9864 9883 GTTGGCTTCTTCCTGAGACA 81 2327 12347
12366 465743 9865 9884 TGTTGGCTTCTTCCTGAGAC 68 2328 12348 12367
465744 9866 9885 CTGTTGGCTTCTTCCTGAGA 44 2329 12349 12368 465745
9867 9886 CCTGTTGGCTTCTTCCTGAG 73 2330 12350 12369 465746 9868 9887
TCCTGTTGGCTTCTTCCTGA 61 2331 12351 12370 465747 9869 9888
CTCCTGTTGGCTTCTTCCTG 53 2332 12352 12371 465748 9870 9889
CCTCCTGTTGGCTTCTTCCT 78 2333 12353 12372 465749 9871 9890
TCCTCCTGTTGGCTTCTTCC 73 2334 12354 12373 465750 9872 9891
TTCCTCCTGTTGGCTTCTTC 70 2335 12355 12374 465751 9873 9892
GTTCCTCCTGTTGGCTTCTT 89 2336 12356 12375 465752 9874 9893
GGTTCCTCCTGTTGGCTTCT 86 2337 12357 12376 465753 9875 9894
AGGTTCCTCCTGTTGGCTTC 73 2338 12358 12377 465754 9876 9895
AAGGTTCCTCCTGTTGGCTT 85 2339 12359 12378 465755 9877 9896
TAAGGTTCCTCCTGTTGGCT 82 2340 12360 12379 465756 9878 9897
ATAAGGTTCCTCCTGTTGGC 72 2341 12361 12380 465757 9879 9898
AATAAGGTTCCTCCTGTTGG 61 2342 12362 12381 465758 9880 9899
AAATAAGGTTCCTCCTGTTG 40 2343 12363 12382 465759 9881 9900
AAAATAAGGTTCCTCCTGTT 41 2344 12364 12383 465760 9882 9901
CAAAATAAGGTTCCTCCTGT 20 2345 12365 12384 465761 9883 9902
TCAAAATAAGGTTCCTCCTG 57 2346 12366 12385 465762 9884 9903
CTCAAAATAAGGTTCCTCCT 48 2347 12367 12386 465763 9885 9904
ACTCAAAATAAGGTTCCTCC 52 2348 12368 12387 455566* 9886 9905
GACTCAAAATAAGGTTCCTC 59 1865 12369 12388 465764 9887 9906
TGACTCAAAATAAGGTTCCT 54 2349 12370 12389 465765 9888 9907
CTGACTCAAAATAAGGTTCC 47 2350 12371 12390 465766 9889 9908
CCTGACTCAAAATAAGGTTC 55 2351 12372 12391 465767 9890 9909
ACCTGACTCAAAATAAGGTT 48 2352 12373 12392 465369 14101 14120
TGAGGATGACCCCAGATAAA 64 2367 465370 14102 14121
GTGAGGATGACCCCAGATAA 60 2368 465371 14103 14122
TGTGAGGATGACCCCAGATA 47 2369 465372 14104 14123
CTGTGAGGATGACCCCAGAT 68 2370 465373 14105 14124
CCTGTGAGGATGACCCCAGA 67 2371 465374 14106 14125
GCCTGTGAGGATGACCCCAG 70 2372 465375 14107 14126
TGCCTGTGAGGATGACCCCA 75 2373 465376 14108 14127
ATGCCTGTGAGGATGACCCC 72 2374 465377 14109 14128
TATGCCTGTGAGGATGACCC 58 2375 465378 14110 14129
CTATGCCTGTGAGGATGACC 56 2376 465379 14111 14130
GCTATGCCTGTGAGGATGAC 65 2377 465380 14112 14131
TGCTATGCCTGTGAGGATGA 23 2378 465386 14113 14132
CTGCTATGCCTGTGAGGATG 64 2379 465387 14114 14133
TCTGCTATGCCTGTGAGGAT 66 2380 465388 14115 14134
ATCTGCTATGCCTGTGAGGA 69 2381 465389 14116 14135
TATCTGCTATGCCTGTGAGG 59 2382 465390 14117 14136
ATATCTGCTATGCCTGTGAG 51 2383 465391 14118 14137
AATATCTGCTATGCCTGTGA 57 2384 465392 14119 14138
GAATATCTGCTATGCCTGTG 60 2385 465393 14120 14139
AGAATATCTGCTATGCCTGT 53 2386 465394 14121 14140
CAGAATATCTGCTATGCCTG 55 2387 465395 14122 14141
TCAGAATATCTGCTATGCCT 64 2388 465396 14123 14142
ATCAGAATATCTGCTATGCC 43 2389 465397 14124 14143
AATCAGAATATCTGCTATGC 37 2390 465398 14125 14144
GAATCAGAATATCTGCTATG 22 2391 465399 14126 14145
TGAATCAGAATATCTGCTAT 33 2392 465400 14127 14146
CTGAATCAGAATATCTGCTA 58 2393 465401 14128 14147
TCTGAATCAGAATATCTGCT 77 2394 455569* 14129 14148
ATCTGAATCAGAATATCTGC 67 1868 465406 14130 14149
CATCTGAATCAGAATATCTG 45 2395 465407 14131 14150
CCATCTGAATCAGAATATCT 47 2396 465408 14132 14151
ACCATCTGAATCAGAATATC 55 2397 465409 14133 14152
GACCATCTGAATCAGAATAT 72 2398 465410 14134 14153
GGACCATCTGAATCAGAATA 70 2399 465411 14135 14154
AGGACCATCTGAATCAGAAT 67 2400 465426 14136 14155
AAGGACCATCTGAATCAGAA 71 2401 465427 14137 14156
CAAGGACCATCTGAATCAGA 73 2402 465428 14138 14157
CCAAGGACCATCTGAATCAG 64 2403 465429 14139 14158
ACCAAGGACCATCTGAATCA 54 2404 465446 14140 14159
GACCAAGGACCATCTGAATC 65 2405 465447 14141 14160
GGACCAAGGACCATCTGAAT 72 2406 465448 14142 14161
AGGACCAAGGACCATCTGAA 68 2407 465449 14143 14162
AAGGACCAAGGACCATCTGA 78 2408 465450 14144 14163
TAAGGACCAAGGACCATCTG 37 2409 465451 14145 14164
CTAAGGACCAAGGACCATCT 73 2410 465452 14146 14165
ACTAAGGACCAAGGACCATC 65 2411 465453 14147 14166
AACTAAGGACCAAGGACCAT 54 2412 465454 14148 14167
AAACTAAGGACCAAGGACCA 49 2413 465455 14149 14168
CAAACTAAGGACCAAGGACC 61 2414 465456 14150 14169
TCAAACTAAGGACCAAGGAC 53 2415 465457 14151 14170
CTCAAACTAAGGACCAAGGA 59 2416 465534 16802 16821
CAACAGAGTGAAATGTAATG 16 2417 465535 16803 16822
TCAACAGAGTGAAATGTAAT 12 2418 465536 16804 16823
CTCAACAGAGTGAAATGTAA 52 2419 465537 16805 16824
GCTCAACAGAGTGAAATGTA 74 2420 465538 16806 16825
TGCTCAACAGAGTGAAATGT 17 2421 465539 16807 16826
ATGCTCAACAGAGTGAAATG 37 2422 465540 16808 16827
AATGCTCAACAGAGTGAAAT 14 2423 465541 16809 16828
GAATGCTCAACAGAGTGAAA 30 2424 465542 16810 16829
AGAATGCTCAACAGAGTGAA 23 2425 465543 16811 16830
TAGAATGCTCAACAGAGTGA 43 2426 465544 16812 16831
ATAGAATGCTCAACAGAGTG 38 2427 465545 16813 16832
CATAGAATGCTCAACAGAGT 38 2428 465546 16814 16833
CCATAGAATGCTCAACAGAG 56 2429 465547 16815 16834
TCCATAGAATGCTCAACAGA 37 2430
465548 16816 16835 ATCCATAGAATGCTCAACAG 48 2431 465549 16817 16836
AATCCATAGAATGCTCAACA 24 2432 465550 16818 16837
AAATCCATAGAATGCTCAAC 34 2433 465551 16819 16838
AAAATCCATAGAATGCTCAA 30 2434 465552 16820 16839
CAAAATCCATAGAATGCTCA 32 2435 465553 16821 16840
TCAAAATCCATAGAATGCTC 46 2436 465554 16822 16841
GTCAAAATCCATAGAATGCT 57 2437 465555 16823 16842
TGTCAAAATCCATAGAATGC 32 2438 465556 16824 16843
TTGTCAAAATCCATAGAATG 5 2439 465557 16825 16844 TTTGTCAAAATCCATAGAAT
2 2440 465558 16826 16845 ATTTGTCAAAATCCATAGAA 17 2441 465559 16827
16846 CATTTGTCAAAATCCATAGA 17 2442 465560 16828 16847
ACATTTGTCAAAATCCATAG 31 2443 465561 16829 16848
CACATTTGTCAAAATCCATA 43 2444 465562 16830 16849
ACACATTTGTCAAAATCCAT 42 2445 465563 16831 16850
CACACATTTGTCAAAATCCA 56 2446 455581* 16832 16851
TCACACATTTGTCAAAATCC 55 1880 465564 16833 16852
ATCACACATTTGTCAAAATC 34 2447 465565 16834 16853
CATCACACATTTGTCAAAAT 40 2448 465566 16835 16854
TCATCACACATTTGTCAAAA 41 2449 465567 16836 16855
ATCATCACACATTTGTCAAA 37 2450 465568 16837 16856
CATCATCACACATTTGTCAA 44 2451 465569 16838 16857
ACATCATCACACATTTGTCA 60 2452 465570 16839 16858
TACATCATCACACATTTGTC 9 2453 465571 16840 16859 ATACATCATCACACATTTGT
48 2454 465572 16841 16860 TATACATCATCACACATTTG 46 2455 465573
16842 16861 ATATACATCATCACACATTT 28 2456 455582* 16863 16882
TATATAATTGTGTACTGGCA 79 1881 465458 16864 16883
TTATATAATTGTGTACTGGC 83 2457 465459 16865 16884
TTTATATAATTGTGTACTGG 22 2458 465460 16866 16885
TTTTATATAATTGTGTACTG 8 2459 465461 16867 16886 ATTTTATATAATTGTGTACT
0 2460 465462 16868 16887 TATTTTATATAATTGTGTAC 1 2461 465463 16869
16888 CTATTTTATATAATTGTGTA 9 2462 465464 16870 16889
ACTATTTTATATAATTGTGT 0 2463 465465 16871 16890 AACTATTTTATATAATTGTG
7 2464 465466 16872 16891 AAACTATTTTATATAATTGT 13 2465 465606 21187
21206 TAATGAGACTTTAGCACTCT 67 2466 455591* 21188 21207
ATAATGAGACTTTAGCACTC 62 1890 465607 21189 21208
AATAATGAGACTTTAGCACT 41 2467 465608 21190 21209
CAATAATGAGACTTTAGCAC 54 2468 465609 21191 21210
GCAATAATGAGACTTTAGCA 6 2469 465610 21193 21212 CTGCAATAATGAGACTTTAG
77 2470 465611 21194 21213 ACTGCAATAATGAGACTTTA 53 2471 465612
21195 21214 AACTGCAATAATGAGACTTT 39 2472 465266 21638 21657
ATTTGAATAAATGAATGAAA 0 2473 465267 21639 21658 TATTTGAATAAATGAATGAA
0 2474 465268 21640 21659 ATATTTGAATAAATGAATGA 0 2475 465269 21641
21660 AATATTTGAATAAATGAATG 0 2476 465270 21642 21661
AAATATTTGAATAAATGAAT 0 2477 465271 21643 21662 CAAATATTTGAATAAATGAA
0 2478 465272 21644 21663 TCAAATATTTGAATAAATGA 0 2479 465273 21645
21664 CTCAAATATTTGAATAAATG 0 2480 465274 21646 21665
GCTCAAATATTTGAATAAAT 0 2481 465275 21647 21666 TGCTCAAATATTTGAATAAA
6 2482 465276 21648 21667 ATGCTCAAATATTTGAATAA 0 2483 465277 21649
21668 AATGCTCAAATATTTGAATA 0 2484 465278 21650 21669
GAATGCTCAAATATTTGAAT 19 2485 465279 21651 21670
AGAATGCTCAAATATTTGAA 0 2486 465280 21652 21671 CAGAATGCTCAAATATTTGA
5 2487 465281 21653 21672 ACAGAATGCTCAAATATTTG 9 2488 465282 21654
21673 TACAGAATGCTCAAATATTT 1 2489 465283 21655 21674
CTACAGAATGCTCAAATATT 0 2490 465284 21656 21675 ACTACAGAATGCTCAAATAT
0 2491 465285 21657 21676 AACTACAGAATGCTCAAATA 2 2492 465286 21658
21677 CAACTACAGAATGCTCAAAT 12 2493 465287 21659 21678
GCAACTACAGAATGCTCAAA 26 2494 465288 21660 21679
AGCAACTACAGAATGCTCAA 39 2495 465289 21661 21680
CAGCAACTACAGAATGCTCA 53 2496 465290 21662 21681
CCAGCAACTACAGAATGCTC 26 2497 465291 21663 21682
CCCAGCAACTACAGAATGCT 42 2498 465292 21664 21683
CCCCAGCAACTACAGAATGC 40 2499 465293 21665 21684
TCCCCAGCAACTACAGAATG 13 2500 465294 21666 21685
TTCCCCAGCAACTACAGAAT 30 2501 465295 21667 21686
TTTCCCCAGCAACTACAGAA 16 2502 465296 21668 21687
ATTTCCCCAGCAACTACAGA 5 2503 465297 21669 21688 TATTTCCCCAGCAACTACAG
7 2504 465298 21670 21689 CTATTTCCCCAGCAACTACA 20 2505 465299 21671
21690 GCTATTTCCCCAGCAACTAC 7 2506 465300 21672 21691
TGCTATTTCCCCAGCAACTA 25 2507 465301 21673 21692
CTGCTATTTCCCCAGCAACT 31 2508 465302 21674 21693
ACTGCTATTTCCCCAGCAAC 14 2509 455594* 21675 21694
CACTGCTATTTCCCCAGCAA 43 1893 465303 21676 21695
TCACTGCTATTTCCCCAGCA 23 2510 465304 21677 21696
TTCACTGCTATTTCCCCAGC 45 2511 465305 21678 21697
GTTCACTGCTATTTCCCCAG 11 2512 465306 21679 21698
AGTTCACTGCTATTTCCCCA 62 2513 465307 21680 21699
CAGTTCACTGCTATTTCCCC 52 2514 465308 21681 21700
TCAGTTCACTGCTATTTCCC 40 2515 465309 21682 21701
TTCAGTTCACTGCTATTTCC 29 2516 465310 21683 21702
CTTCAGTTCACTGCTATTTC 40 2517 465311 21684 21703
TCTTCAGTTCACTGCTATTT 25 2518 465312 21685 21704
TTCTTCAGTTCACTGCTATT 18 2519 465313 21686 21705
ATTCTTCAGTTCACTGCTAT 7 2520 465314 21687 21706 CATTCTTCAGTTCACTGCTA
33 2521 465315 21688 21707 ACATTCTTCAGTTCACTGCT 39 2522 465316
21689 21708 GACATTCTTCAGTTCACTGC 49 2523 465317 21690 21709
AGACATTCTTCAGTTCACTG 50 2524 465318 21691 21710
AAGACATTCTTCAGTTCACT 37 2525 465319 21692 21711
AAAGACATTCTTCAGTTCAC 26 2526 465320 21693 21712
CAAAGACATTCTTCAGTTCA 13 2527 465321 21694 21713
ACAAAGACATTCTTCAGTTC 0 2528 465322 21695 21714 AACAAAGACATTCTTCAGTT
11 2529 465323 21696 21715 GAACAAAGACATTCTTCAGT 10 2530 465324
21697 21716 AGAACAAAGACATTCTTCAG 14 2531 465325 21698 21717
AAGAACAAAGACATTCTTCA 7 2532 465326 21699 21718 TAAGAACAAAGACATTCTTC
13 2533 465327 21700 21719 ATAAGAACAAAGACATTCTT 1 2534 465328 21701
21720 CATAAGAACAAAGACATTCT 16 2535 465329 21702 21721
CCATAAGAACAAAGACATTC 38 2536 465330 21703 21722
CCCATAAGAACAAAGACATT 11 2537 465331 21704 21723
CCCCATAAGAACAAAGACAT 0 2538 465332 21705 21724 GCCCCATAAGAACAAAGACA
30 2539 465333 21706 21725 AGCCCCATAAGAACAAAGAC 22 2540 465334
21707 21726 AAGCCCCATAAGAACAAAGA 21 2541 465613 26034 26053
TCTCCAGCCTACAGATGACT 32 2542 465614 26035 26054
CTCTCCAGCCTACAGATGAC 31 2543 465615 26036 26055
TCTCTCCAGCCTACAGATGA 29 2544 465616 26037 26056
CTCTCTCCAGCCTACAGATG 22 2545 465617 26038 26057
CCTCTCTCCAGCCTACAGAT 44 2546 465618 26039 26058
TCCTCTCTCCAGCCTACAGA 41 2547 465619 26040 26059
TTCCTCTCTCCAGCCTACAG 32 2548 465620 26041 26060
GTTCCTCTCTCCAGCCTACA 0 2549 465621 26042 26061 AGTTCCTCTCTCCAGCCTAC
44 2550 465622 26043 26062 CAGTTCCTCTCTCCAGCCTA 39 2551
465623 26044 26063 CCAGTTCCTCTCTCCAGCCT 47 2552 465624 26045 26064
TCCAGTTCCTCTCTCCAGCC 49 2553 465625 26046 26065
TTCCAGTTCCTCTCTCCAGC 46 2554 465626 26047 26066
CTTCCAGTTCCTCTCTCCAG 47 2555 465627 26048 26067
CCTTCCAGTTCCTCTCTCCA 28 2556 465628 26049 26068
CCCTTCCAGTTCCTCTCTCC 28 2557 465629 26050 26069
CCCCTTCCAGTTCCTCTCTC 21 2558 465630 26051 26070
GCCCCTTCCAGTTCCTCTCT 65 2559 465631 26052 26071
AGCCCCTTCCAGTTCCTCTC 60 2560 465632 26053 26072
TAGCCCCTTCCAGTTCCTCT 56 2561 465633 26054 26073
TTAGCCCCTTCCAGTTCCTC 52 2562 465634 26055 26074
TTTAGCCCCTTCCAGTTCCT 53 2563 465635 26056 26075
CTTTAGCCCCTTCCAGTTCC 39 2564 465636 26057 26076
ACTTTAGCCCCTTCCAGTTC 31 2565 465637 26058 26077
AACTTTAGCCCCTTCCAGTT 46 2566 465638 26059 26078
CAACTTTAGCCCCTTCCAGT 37 2567 465639 26060 26079
CCAACTTTAGCCCCTTCCAG 48 2568 455611* 26061 26080
GCCAACTTTAGCCCCTTCCA 62 1870 465640 26062 26081
AGCCAACTTTAGCCCCTTCC 71 2569 465641 26063 26082
CAGCCAACTTTAGCCCCTTC 70 2570 465642 26064 26083
TCAGCCAACTTTAGCCCCTT 66 2571 465643 26065 26084
CTCAGCCAACTTTAGCCCCT 35 2572 465644 26066 26085
ACTCAGCCAACTTTAGCCCC 49 2573 465645 26067 26086
TACTCAGCCAACTTTAGCCC 33 2574 465646 26068 26087
CTACTCAGCCAACTTTAGCC 28 2575 465647 26069 26088
ACTACTCAGCCAACTTTAGC 12 2576 465648 26070 26089
AACTACTCAGCCAACTTTAG 34 2577 465649 26071 26090
TAACTACTCAGCCAACTTTA 26 2578 455637* 37873 37892
GTACTTTACATGTGCAGCAC 78 1931 465650 37874 37893
TGTACTTTACATGTGCAGCA 71 2579 465651 37875 37894
GTGTACTTTACATGTGCAGC 75 2580 465652 37876 37895
TGTGTACTTTACATGTGCAG 65 2581 465653 37877 37896
CTGTGTACTTTACATGTGCA 65 2582 465654 37878 37897
CCTGTGTACTTTACATGTGC 60 2583 465655 37879 37898
TCCTGTGTACTTTACATGTG 51 2584 465656 37880 37899
CTCCTGTGTACTTTACATGT 48 2585 465657 37881 37900
TCTCCTGTGTACTTTACATG 25 2586 465658 37882 37901
ATCTCCTGTGTACTTTACAT 33 2587 465659 37883 37902
AATCTCCTGTGTACTTTACA 23 2588 465660 37884 37903
AAATCTCCTGTGTACTTTAC 24 2589 465661 37885 37904
TAAATCTCCTGTGTACTTTA 26 2590 465666 37886 37905
CTAAATCTCCTGTGTACTTT 16 2591 465667 37887 37906
TCTAAATCTCCTGTGTACTT 27 2592 465668 37888 37907
TTCTAAATCTCCTGTGTACT 30 2593 465669 37889 37908
TTTCTAAATCTCCTGTGTAC 30 2594 465670 37890 37909
TTTTCTAAATCTCCTGTGTA 11 2595 465671 37891 37910
GTTTTCTAAATCTCCTGTGT 37 2596 465672 37892 37911
AGTTTTCTAAATCTCCTGTG 49 2597 465686 37893 37912
AAGTTTTCTAAATCTCCTGT 19 2598 465687 37894 37913
GAAGTTTTCTAAATCTCCTG 46 2599 465688 37895 37914
CGAAGTTTTCTAAATCTCCT 53 2600 465689 37896 37915
ACGAAGTTTTCTAAATCTCC 45 2601 465690 37897 37916
TACGAAGTTTTCTAAATCTC 9 2602 465706 37898 37917 CTACGAAGTTTTCTAAATCT
14 2603 465707 37899 37918 GCTACGAAGTTTTCTAAATC 32 2604 455677*
45512 45531 TTCCAATATTTGTACCCTCA 49 1971 465574 45513 45532
TTTCCAATATTTGTACCCTC 43 2605 465575 45514 45533
CTTTCCAATATTTGTACCCT 50 2606 465576 45515 45534
GCTTTCCAATATTTGTACCC 58 2607 465577 45516 45535
TGCTTTCCAATATTTGTACC 35 2608 465578 45517 45536
TTGCTTTCCAATATTTGTAC 31 2609 465579 45518 45537
CTTGCTTTCCAATATTTGTA 29 2610 465580 45519 45538
CCTTGCTTTCCAATATTTGT 35 2611 465581 45520 45539
CCCTTGCTTTCCAATATTTG 26 2612 465582 45521 45540
TCCCTTGCTTTCCAATATTT 34 2613 465583 45522 45541
GTCCCTTGCTTTCCAATATT 39 2614 465584 45523 45542
TGTCCCTTGCTTTCCAATAT 44 2615 465585 45524 45543
CTGTCCCTTGCTTTCCAATA 60 2616 465586 45525 45544
TCTGTCCCTTGCTTTCCAAT 59 2617 465587 45526 45545
TTCTGTCCCTTGCTTTCCAA 47 2618 455681* 46091 46110
TTTCCAGATATTTTCCCATA 48 1975 465335 46092 46111
GTTTCCAGATATTTTCCCAT 71 2619 465336 46093 46112
TGTTTCCAGATATTTTCCCA 53 2620 466676 48396 48415
CTTTCCATTCTAGTTTTACC 1 2621 466677 48397 48416 ACTTTCCATTCTAGTTTTAC
19 2622 466678 48398 48417 CACTTTCCATTCTAGTTTTA 23 2623 466679
48399 48418 ACACTTTCCATTCTAGTTTT 9 2624 466680 48400 48419
CACACTTTCCATTCTAGTTT 31 2625 466681 48401 48420
CCACACTTTCCATTCTAGTT 64 2626 455703* 48402 48421
GCCACACTTTCCATTCTAGT 75 1997 466682 48403 48422
AGCCACACTTTCCATTCTAG 56 2627 466683 48404 48423
AAGCCACACTTTCCATTCTA 40 2628 466684 48405 48424
CAAGCCACACTTTCCATTCT 24 2629 466685 48406 48425
TCAAGCCACACTTTCCATTC 39 2630 466686 48407 48426
CTCAAGCCACACTTTCCATT 38 2631 466687 48408 48427
GCTCAAGCCACACTTTCCAT 53 2632 466688 48409 48428
AGCTCAAGCCACACTTTCCA 59 2633 466689 48410 48429
CAGCTCAAGCCACACTTTCC 51 2634 466690 48411 48430
CCAGCTCAAGCCACACTTTC 43 2635 466691 48412 48431
ACCAGCTCAAGCCACACTTT 30 2636 466692 48413 48432
TACCAGCTCAAGCCACACTT 35 2637 466693 48414 48433
TTACCAGCTCAAGCCACACT 32 2638 466694 48415 48434
GTTACCAGCTCAAGCCACAC 53 2639 466695 48416 48435
GGTTACCAGCTCAAGCCACA 54 2640 455704* 48417 48436
TGGTTACCAGCTCAAGCCAC 61 1998 455708* 48728 48747
CCCACAGTGACAGTGACTCA 58 2002 465708 48729 48748
TCCCACAGTGACAGTGACTC 61 2641 465709 48730 48749
TTCCCACAGTGACAGTGACT 60 2642 465710 48731 48750
CTTCCCACAGTGACAGTGAC 55 2643 455723* 52033 52052
ACCAGTTTTCTAGCCGATCT 24 2017 466696 52034 52053
TACCAGTTTTCTAGCCGATC 54 2644 466697 52035 52054
TTACCAGTTTTCTAGCCGAT 41 2645 466698 52036 52055
TTTACCAGTTTTCTAGCCGA 37 2646 466699 52037 52056
CTTTACCAGTTTTCTAGCCG 17 2647 466700 52038 52057
CCTTTACCAGTTTTCTAGCC 11 2648 466701 52039 52058
TCCTTTACCAGTTTTCTAGC 24 2649 466702 52040 52059
ATCCTTTACCAGTTTTCTAG 1 2650 466703 52041 52060 CATCCTTTACCAGTTTTCTA
7 2651 466704 52042 52061 TCATCCTTTACCAGTTTTCT 0 2652 466705 52043
52062 TTCATCCTTTACCAGTTTTC 15 2653 466706 52044 52063
TTTCATCCTTTACCAGTTTT 0 2654 466707 52045 52064 CTTTCATCCTTTACCAGTTT
9 2655 466708 52046 52065 TCTTTCATCCTTTACCAGTT 0 2656 466709 52047
52066 TTCTTTCATCCTTTACCAGT 8 2657 466710 52048 52067
CTTCTTTCATCCTTTACCAG 11 2658 466711 52049 52068
GCTTCTTTCATCCTTTACCA 8 2659 466712 52050 52069 AGCTTCTTTCATCCTTTACC
6 2660 466713 52051 52070 AAGCTTCTTTCATCCTTTAC 0 2661 466714 52052
52071 AAAGCTTCTTTCATCCTTTA 18 2662 466715 52053 52072
AAAAGCTTCTTTCATCCTTT 2 2663 466716 52054 52073 GAAAAGCTTCTTTCATCCTT
9 2664 466717 52055 52074 GGAAAAGCTTCTTTCATCCT 1 2665 455724* 52056
52075 AGGAAAAGCTTCTTTCATCC 0 2018 455762* 59913 59932
CCAAGTGTTTGAATTCTGCA 36 2056 466766 59914 59933
ACCAAGTGTTTGAATTCTGC 58 2666 466767 59915 59934
TACCAAGTGTTTGAATTCTG 32 2667
466768 59916 59935 ATACCAAGTGTTTGAATTCT 21 2668 466769 59917 59936
CATACCAAGTGTTTGAATTC 9 2669 466770 59918 59937 ACATACCAAGTGTTTGAATT
14 2670 466771 59919 59938 CACATACCAAGTGTTTGAAT 26 2671 466772
59920 59939 CCACATACCAAGTGTTTGAA 8 2672 466773 59921 59940
CCCACATACCAAGTGTTTGA 19 2673 466774 59922 59941
TCCCACATACCAAGTGTTTG 5 2674 466775 59923 59942 CTCCCACATACCAAGTGTTT
25 2675 466776 59924 59943 CCTCCCACATACCAAGTGTT 32 2676 466777
59925 59944 TCCTCCCACATACCAAGTGT 12 2677 466778 59926 59945
CTCCTCCCACATACCAAGTG 10 2678 466779 59927 59946
GCTCCTCCCACATACCAAGT 15 2679 466780 59928 59947
AGCTCCTCCCACATACCAAG 5 2680 466781 59929 59948 GAGCTCCTCCCACATACCAA
23 2681 465768 61325 61344 CAGTCTAGAATAGCCATGGA 71 2682 465769
61326 61345 ACAGTCTAGAATAGCCATGG 72 2683 465770 61327 61346
GACAGTCTAGAATAGCCATG 78 2684 465771 61328 61347
AGACAGTCTAGAATAGCCAT 74 2685 465772 61329 61348
GAGACAGTCTAGAATAGCCA 70 2686 465773 61330 61349
AGAGACAGTCTAGAATAGCC 70 2687 465774 61331 61350
CAGAGACAGTCTAGAATAGC 63 2688 465775 61332 61351
ACAGAGACAGTCTAGAATAG 55 2689 465776 61333 61352
CACAGAGACAGTCTAGAATA 64 2690 465777 61334 61353
TCACAGAGACAGTCTAGAAT 71 2691 465778 61335 61354
ATCACAGAGACAGTCTAGAA 79 2692 465779 61336 61355
TATCACAGAGACAGTCTAGA 66 2693 465780 61337 61356
ATATCACAGAGACAGTCTAG 64 2694 465781 61338 61357
AATATCACAGAGACAGTCTA 48 2695 465782 61339 61358
AAATATCACAGAGACAGTCT 65 2696 455786* 61340 61359
CAAATATCACAGAGACAGTC 63 2070 465783 61341 61360
GCAAATATCACAGAGACAGT 69 2697 465786 61342 61361
TGCAAATATCACAGAGACAG 78 2698 465787 61343 61362
ATGCAAATATCACAGAGACA 72 2699 465788 61344 61363
AATGCAAATATCACAGAGAC 59 2700 465789 61345 61364
AAATGCAAATATCACAGAGA 23 2701 465790 61346 61365
AAAATGCAAATATCACAGAG 28 2702 465791 61347 61366
TAAAATGCAAATATCACAGA 0 2703 465792 61348 61367 TTAAAATGCAAATATCACAG
12 2704 465793 61349 61368 TTTAAAATGCAAATATCACA 3 2705 465794 61350
61369 GTTTAAAATGCAAATATCAC 2 2706 465795 61351 61370
AGTTTAAAATGCAAATATCA 0 2707 465796 61352 61371 CAGTTTAAAATGCAAATATC
13 2708 465797 61353 61372 TCAGTTTAAAATGCAAATAT 0 2709 465798 61354
61373 TTCAGTTTAAAATGCAAATA 0 2710 465799 61355 61374
ATTCAGTTTAAAATGCAAAT 1 2711 465800 61356 61375 TATTCAGTTTAAAATGCAAA
0 2712 465801 61357 61376 ATATTCAGTTTAAAATGCAA 0 2713 455790* 62043
62062 CATGGTTATGTGTATCTGCA 69 2074 465337 62044 62063
ACATGGTTATGTGTATCTGC 69 2714 465338 62045 62064
CACATGGTTATGTGTATCTG 40 2715 465339 62046 62065
CCACATGGTTATGTGTATCT 32 2716 337332 66135 66154
GAAGCCCTTGCCAGCCATGT 79 1541 455840* 71610 71629
GTACAATTGCTTCAACTAGA 81 2124 466782 71611 71630
AGTACAATTGCTTCAACTAG 54 2717 466783 71612 71631
CAGTACAATTGCTTCAACTA 68 2718 466784 71613 71632
GCAGTACAATTGCTTCAACT 72 2719 465588 71614 71633
GGCAGTACAATTGCTTCAAC 69 2720 455264* 74768 74787
TCCTTAAACCTTCCTATTTC 26 1563 465226 74769 74788
CTCCTTAAACCTTCCTATTT 45 2721 455265* 74770 74789
TCTCCTTAAACCTTCCTATT 57 1564 465227 74771 74790
TTCTCCTTAAACCTTCCTAT 54 2722 455266* 74772 74791
ATTCTCCTTAAACCTTCCTA 52 1565 465228 74773 74792
GATTCTCCTTAAACCTTCCT 64 2723 455267* 74774 74793
AGATTCTCCTTAAACCTTCC 60 1566 465229 74775 74794
TAGATTCTCCTTAAACCTTC 22 2724 455268* 74776 74795
TTAGATTCTCCTTAAACCTT 55 1567 465230 74777 74796
CTTAGATTCTCCTTAAACCT 69 2725 455269* 74778 74797
GCTTAGATTCTCCTTAAACC 84 1568 465231 74779 74798
TGCTTAGATTCTCCTTAAAC 64 2726 455270* 74780 74799
ATGCTTAGATTCTCCTTAAA 50 1569 465232 74781 74800
AATGCTTAGATTCTCCTTAA 71 2727 455271* 74782 74801
AAATGCTTAGATTCTCCTTA 69 1570 465233 74783 74802
AAAATGCTTAGATTCTCCTT 69 2728 455272* 74784 74803
TAAAATGCTTAGATTCTCCT 56 1571 455281* 74872 74891
CAAGGTTGTAAGCACCCTCT 63 1580 465234 74873 74892
TCAAGGTTGTAAGCACCCTC 54 2729 455282* 74874 74893
GTCAAGGTTGTAAGCACCCT 8 1581 465235 74875 74894 AGTCAAGGTTGTAAGCACCC
65 2730 455283* 74876 74895 GAGTCAAGGTTGTAAGCACC 48 1582 455290*
74900 74919 GCAGATCAAGTCCAGGGAGA 77 1589 465236 74901 74920
AGCAGATCAAGTCCAGGGAG 80 2731 455291* 74902 74921
CAGCAGATCAAGTCCAGGGA 82 1590 465237 74903 74922
ACAGCAGATCAAGTCCAGGG 82 2732 455292* 74904 74923
AACAGCAGATCAAGTCCAGG 69 1591 455369* 75418 75437
GGTGTTCCCATACGCACAGG 75 1668 465238 75419 75438
AGGTGTTCCCATACGCACAG 68 2733 455370* 75420 75439
TAGGTGTTCCCATACGCACA 67 1669 465239 75421 75440
CTAGGTGTTCCCATACGCAC 82 2734 455371* 75422 75441
GCTAGGTGTTCCCATACGCA 85 1670 465240 75423 75442
TGCTAGGTGTTCCCATACGC 77 2735 455372* 75424 75443
GTGCTAGGTGTTCCCATACG 72 1671 455390* 75616 75635
AACTGTCTCCAGGCAGGAGG 65 1689 465241 75617 75636
CAACTGTCTCCAGGCAGGAG 51 2736 455391* 75618 75637
TCAACTGTCTCCAGGCAGGA 52 1690 465242 75619 75638
ATCAACTGTCTCCAGGCAGG 76 2737 455392* 75620 75639
CATCAACTGTCTCCAGGCAG 63 1691 465243 75621 75640
ACATCAACTGTCTCCAGGCA 70 2738 455393* 75622 75641
CACATCAACTGTCTCCAGGC 75 1692 465244 75623 75642
ACACATCAACTGTCTCCAGG 61 2739 455394* 75624 75643
GACACATCAACTGTCTCCAG 69 1693 455397* 75662 75681
TACTGAAGAGTGTTGCTGGA 77 1696 465245 75663 75682
GTACTGAAGAGTGTTGCTGG 84 2740 455398* 75664 75683
TGTACTGAAGAGTGTTGCTG 76 1697 465246 75665 75684
ATGTACTGAAGAGTGTTGCT 72 2741 455399* 75666 75685
TATGTACTGAAGAGTGTTGC 70 1698 455411* 75726 75745
AACCCAATGGTAAGCCCAAG 77 1710 465247 75727 75746
AAACCCAATGGTAAGCCCAA 61 2742 455412* 75728 75747
TAAACCCAATGGTAAGCCCA 72 1711 465248 75729 75748
TTAAACCCAATGGTAAGCCC 69 2743 455413* 75730 75749
TTTAAACCCAATGGTAAGCC 38 1712 455428* 75829 75848
TACAATCAGAGTTAAGACCA 58 1727 465249 75830 75849
CTACAATCAGAGTTAAGACC 58 2744 455429* 75831 75850
GCTACAATCAGAGTTAAGAC 71 1728 465250 75832 75851
TGCTACAATCAGAGTTAAGA 59 2745 455430* 75833 75852
TTGCTACAATCAGAGTTAAG 47 1729 455437* 75847 75866
TCCTCTCAGAACTTTTGCTA 36 1736 465251 75848 75867
CTCCTCTCAGAACTTTTGCT 47 2746 455438* 75849 75868
GCTCCTCTCAGAACTTTTGC 75 1737 465252 75850 75869
AGCTCCTCTCAGAACTTTTG 71 2747 455439* 75851 75870
CAGCTCCTCTCAGAACTTTT 68 1738 465253 75852 75871
TCAGCTCCTCTCAGAACTTT 62 2748 455440* 75853 75872
CTCAGCTCCTCTCAGAACTT 58 1739 455446* 75965 75984
GTAGGTAAGCAACCCACGGG 69 1745 465254 75966 75985
GGTAGGTAAGCAACCCACGG 79 2749 455447* 75967 75986
AGGTAGGTAAGCAACCCACG 80 1476
465255 75968 75987 TAGGTAGGTAAGCAACCCAC 84 2750 455448* 75969 75988
ATAGGTAGGTAAGCAACCCA 71 1474 455456* 75985 76004
GCTTATAAACCACCTTATAG 37 1755 465256 75986 76005
AGCTTATAAACCACCTTATA 43 2751 455457* 75987 76006
CAGCTTATAAACCACCTTAT 57 1756 465257 75988 76007
GCAGCTTATAAACCACCTTA 73 2752 455458* 75989 76008
AGCAGCTTATAAACCACCTT 75 1757 465258 75990 76009
CAGCAGCTTATAAACCACCT 65 2753 455459* 75991 76010
ACAGCAGCTTATAAACCACC 46 1758 455462* 75997 76016
GCCAGGACAGCAGCTTATAA 70 1761 466718 75998 76017
GGCCAGGACAGCAGCTTATA 87 2754 455463* 75999 76018
TGGCCAGGACAGCAGCTTAT 83 1762 466719 76000 76019
GTGGCCAGGACAGCAGCTTA 76 2755 455464* 76001 76020
AGTGGCCAGGACAGCAGCTT 82 1763 455470* 76013 76032
GAATTTGAATGCAGTGGCCA 75 1769 466720 76014 76033
GGAATTTGAATGCAGTGGCC 87 2756 455471* 76015 76034
TGGAATTTGAATGCAGTGGC 75 1770 466721 76016 76035
TTGGAATTTGAATGCAGTGG 72 2757 455472* 76017 76036
ATTGGAATTTGAATGCAGTG 60 1771
Example 35: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0568] Gapmers from the study described in Example 3 exhibiting
significant in vitro inhibition of STAT3 were tested at various
doses in HuVEC cells. Cells were plated at a density of 5,000 cells
per well and transfected using LipofectAMINE2000.RTM. reagent with
8.8 nM, 17.5 nM, 35.0 nM, and 70.0 nM concentrations of antisense
oligonucleotide, as specified in Table 56. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0569] As illustrated in Table 56, STAT3 mRNA levels were reduced
in a dose-dependent manner in antisense oligonucleotide treated
cells.
TABLE-US-00056 TABLE 56 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells using LipofectAMINE 2000 .RTM. reagent
ISIS No 8.8 nM 17.5 nM 35.0 nM 70.0 nM 337332 50 71 81 88 455269 62
69 79 82 455291 72 81 87 88 455371 71 83 88 90 455447 53 70 81 79
455463 68 79 84 87 455464 69 78 84 86 455471 62 82 88 90 455547 43
64 75 87 455565 41 73 83 92 455582 50 67 81 87 455637 50 65 79 85
455703 45 65 81 85 455840 58 70 80 85 465236 62 76 81 85 465237 67
81 86 90 465239 64 77 85 92 465240 50 66 76 83 465245 70 81 87 87
465254 54 75 81 86 465255 63 74 84 85 465335 46 62 74 80 465449 49
71 84 84 465458 54 73 84 88 465509 66 80 86 83 465510 48 66 76 82
465511 56 68 75 79 465526 53 68 76 76 465537 41 60 77 85 465588 52
73 76 79 465610 35 57 71 79 465730 51 75 85 87 465739 72 81 88 90
465740 70 81 86 89 465742 63 76 87 88 465748 48 62 67 74 465751 70
81 87 87 465752 76 82 88 89 465754 70 83 86 87 465755 70 81 85 89
465770 52 69 77 77 465771 40 55 64 75 465778 40 69 75 77 465786 56
71 76 83 465830 66 77 83 82 465833 50 67 79 86 465834 42 67 77 81
465886 58 73 83 87 465888 49 68 82 12 465926 43 64 76 82 466661 47
63 80 84 466666 39 66 80 86 466670 73 83 89 90 466718 73 78 84 85
466719 63 73 83 83 466720 80 87 86 86
Example 36: Dose-Dependent Antisense Inhibition of Human STAT3 in
HuVEC Cells
[0570] Gapmers from the study described in Example 3 were further
tested at various doses in HuVEC cells. Cells were plated at a
density of 20,000 cells per well and transfected using
electroporation with 187.5 nM, 375.0 nM, 750.0 nM, 1,500.0 nM,
3,000.0 nM, and 6,000.0 nM concentrations of antisense
oligonucleotide, as specified in Table 57. After a treatment period
of approximately 16 hours, RNA was isolated from the cells and
STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0571] As illustrated in Table 57, STAT3 mRNA levels were
significantly reduced in a dose-dependent manner in antisense
oligonucleotide treated cells.
TABLE-US-00057 TABLE 57 Dose-dependent antisense inhibition of
human STAT3 in HuVEC cells using electroporation 187.5 375.0 750.0
1500.0 3000.0 6000.0 IC.sub.50 ISIS No nM nM nM nM nM nM (.mu.M)
337332 35 51 73 84 97 98 0.3 455269 64 76 87 89 92 90 <0.2
455291 63 79 88 90 90 93 <0.2 455371 50 81 90 94 96 95 <0.2
455447 37 49 61 91 94 96 0.3 455463 57 78 89 93 95 94 <0.2
455464 57 67 78 80 79 87 <0.2 455471 50 73 81 86 91 92 <0.2
455547 19 49 63 82 92 94 0.5 455582 42 62 82 92 97 97 0.2 455637 44
60 63 87 91 92 0.2 455840 39 58 75 81 88 89 0.2 465236 56 67 71 83
91 92 <0.2 465237 56 75 87 92 94 93 <0.2 465239 60 78 88 95
99 99 <0.2 465240 49 67 80 85 94 95 0.1 465245 54 67 81 86 90 90
<0.2 465254 28 50 63 76 91 92 0.4 465255 46 55 78 89 92 94 0.2
465335 25 52 65 89 95 95 0.4 465449 28 56 78 72 96 96 0.3 465458 19
68 84 91 96 97 0.3 465509 42 68 77 84 88 88 0.1 465510 15 43 60 73
85 88 0.6 465511 19 39 47 68 79 86 0.8 465526 15 39 54 64 82 84 0.8
465537 44 65 82 90 95 90 0.1 465565 12 45 62 80 93 97 0.6 465588 44
66 82 85 85 87 0.1 465610 33 56 72 89 96 97 0.3 465730 48 51 72 91
94 91 0.2 465739 42 78 85 93 96 92 0.9 465740 54 69 80 96 98 98
<0.2 465742 67 55 91 93 87 93 <0.2 465748 49 67 88 96 98 99
0.1 465751 56 63 82 91 98 98 0.1 465752 62 79 84 93 96 90 <0.2
465754 41 69 84 63 94 93 <0.2 465755 47 56 67 83 93 97 0.2
465770 52 54 70 85 88 83 0.2 465771 38 62 76 83 84 86 0.2 465778 40
58 79 84 96 96 0.2 465786 41 68 88 94 95 93 0.1 465830 50 73 89 93
88 92 <0.2 465833 27 44 76 89 88 97 0.4 465834 8 27 57 80 93 97
0.7 465886 58 79 90 97 98 96 <0.2 465888 39 60 65 90 94 97 0.3
465926 23 50 41 85 93 94 0.5 466661 31 58 76 90 95 96 0.3 466666 44
55 79 92 96 97 0.2 466670 50 54 82 96 96 96 0.2 466718 55 79 90 93
95 96 <0.2 466719 44 52 73 65 87 91 0.3 466720 48 78 90 90 90 90
<0.2
Example 37: Tolerability of Antisense Oligonucleotides Targeting
Human STAT3 in CD1 Mice
[0572] Thirty-nine antisense oligonucleotides exhibiting a high
level of potency were further tested for in vivo tolerability.
[0573] Groups of eight male CD1 mice were injected subcutaneously
twice a week for 6 weeks with 50 mg/kg of ISIS antisense
oligonucleotides. One group of eight male CD1 mice was injected
subcutaneously twice a week for 6 weeks with PBS. This group served
as the control group. Three days after the last dose mice were
euthanized and organs and plasma were harvested for further
analysis. Liver, spleen, and kidney weights were measured at the
end of the study and were compared to PBS treated mice.
[0574] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma concentrations of transaminases were measured
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma concentrations of ALT (alanine
transaminase) and AST (aspartate transaminase) were measured.
[0575] To evaluate the effect of ISIS oligonucleotides on kidney
function, plasma concentrations of blood urea nitrogen (BUN) were
measured using an automated clinical chemistry analyzer (Hitachi
Olympus AU400e, Melville, N.Y.).
[0576] Blood obtained from all mice groups were sent to Antech
Diagnostics for hematocrit (HCT), mean corpuscular volume (MCV),
mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin
concentration (MCHC) measurements and analyses, as well as
measurements of the differential blood cell counts, such as that of
WBC, RBC, and total hemoglobin content.
[0577] Among the 39 antisense oligonucleotides tested, certain
antisense oligonucleotides, including ISIS 455265, ISIS 455269,
ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS 455394,
ISIS 455703, ISIS 455429, ISIS 455471, ISIS 455527, ISIS 455530,
ISIS 455536, ISIS 455548, ISIS 455611, ISIS 465236, ISIS 465237,
ISIS 465588, ISIS 465740, ISIS 465754, ISIS 465830, ISIS 466670,
and ISIS 466720 met tolerability thresholds for organ weight, ALT,
AST, BUN, and hematological parameters.
Example 38: Measurement of Half-Life of Antisense Oligonucleotide
in CD1 Mouse Liver
[0578] CD1 mice were treated with ISIS antisense oligonucleotides
described and the oligonucleotide half-life in the liver was
evaluated.
Treatment
[0579] Groups of twelve CD1 mice each were injected subcutaneously
twice per week for 2 weeks with 50 mg/kg of ISIS 455265, ISIS
455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS 455371, ISIS
455393, ISIS 455553, ISIS 455582, ISIS 455703, ISIS 455394, ISIS
455429, ISIS 455438, ISIS 455471, ISIS 455527, ISIS 455530, ISIS
455536, ISIS 455540, ISIS 455548, ISIS 455611, ISIS 455429, ISIS
455463, ISIS 455464, ISIS 455471, ISIS 455527, ISIS 455611, ISIS
465236, ISIS 465237, ISIS 465239, ISIS 465588, ISIS 465740, ISIS
465742, ISIS 465751, ISIS 465752, ISIS 465754, ISIS 465830, ISIS
466670, ISIS 466718, and ISIS 466720. Four mice from each group
were sacrificed 3 days, 28 days, and 56 days following the final
dose. Livers were harvested for analysis.
Measurement of Oligonucleotide Concentration
[0580] The concentration of the full-length oligonucleotide as well
as the total oligonucleotide concentration (including the degraded
form) was measured. The method used is a modification of previously
published methods (Leeds et al., 1996; Geary et al., 1999), which
includes a phenol-chloroform (liquid-liquid) extraction followed by
a solid phase extraction. An internal standard (ISIS 355868, a
27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide,
GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 2758)
was added prior to extraction. Tissue sample concentrations were
calculated using calibration curves, with a lower limit of
quantitation (LLOQ) of approximately 1.14 .mu.g/g. Half-lives were
then calculated using WinNonlin software (PHARSIGHT).
[0581] The half-life of each oligonucleotide is presented in Table
58. Antisense oligonucleotides with half-lives within 11-34 days
were chosen for further studies.
TABLE-US-00058 TABLE 58 Half-life of ISIS oligonucleotides in the
liver of CD1 mice ISIS No Half-life (days) 455265 12 455269 48
455271 16 455272 16 455291 19 455371 28 455394 17 455703 27 455429
15 455471 15 455527 13 455530 12 455536 20 455548 13 455611 37
465236 22 465237 17 465588 14 465740 15 465754 23 465830 23 466670
11 466720 17
Example 39: Tolerability of Antisense Oligonucleotides Targeting
Human STAT3 in Sprague-Dawley Rats
[0582] Twenty-three antisense oligonucleotides exhibiting a high
level of potency were further tested for in vivo tolerability.
[0583] Groups of four Sprague-Dawley rats were injected
subcutaneously twice a week for 6 weeks with 50 mg/kg of ISIS
antisense oligonucleotides. One group of rats was injected
subcutaneously twice a week for 6 weeks with PBS. This group served
as the control group. Three days after the last dose rats were
euthanized and organs and plasma were harvested for further
analysis. Liver, spleen, and kidney weights were measured at the
end of the study and were compared to PBS treated rats
[0584] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma concentrations of transaminases were measured
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.). Plasma concentrations of AST (aspartate
transaminase) and total bilirubin were measured.
[0585] To evaluate the effect of ISIS oligonucleotides on kidney
function, BUN, total urine protein, and creatinine were measured
using an automated clinical chemistry analyzer (Hitachi Olympus
AU400e, Melville, N.Y.).
[0586] Among the 23 antisense oligonucleotides tested, certain
antisense oligonucleotides, including ISIS 455269, ISIS 455291,
ISIS 455371, ISIS 455703, ISIS 455429, ISIS 465236, ISIS 465237,
ISIS 465754, ISIS 465830, and ISIS 466670 met tolerability
thresholds for organ weight, AST, bilirubin, BUN, total urine
protein, and creatinine
Example 40: Measurement of Half-Life of Antisense Oligonucleotide
in Sprague-Dawley Rat Liver and Kidney
[0587] Sprague Dawley rats were treated with ISIS antisense
oligonucleotides and the oligonucleotide half-life as well as the
elapsed time for oligonucleotide degradation and elimination from
the liver and kidney was evaluated.
Treatment
[0588] Groups of four Sprague Dawley rats each were injected
subcutaneously twice a week for 2 weeks with 20 mg/kg of ISIS
455265, ISIS 455269, ISIS 455271, ISIS 455272, ISIS 455291, ISIS
455371, ISIS 455394, ISIS 455703, ISIS 455429, ISIS 455471, ISIS
455527, ISIS 455530, ISIS 455536, ISIS 455548, ISIS 455611, ISIS
465236, ISIS 465237, ISIS 465588, ISIS 465740, ISIS 465754, ISIS
465830, ISIS 466670, and ISIS 466720. Three days after the last
dose, the rats were sacrificed and livers and kidneys were
collected for analysis.
Measurement of Oligonucleotide Concentration
[0589] The concentration of the full-length oligonucleotide as well
as the total oligonucleotide concentration (including the degraded
form) was measured. The method used is a modification of previously
published methods (Leeds et al., 1996; Geary et al., 1999), which
includes a phenol-chloroform (liquid-liquid) extraction followed by
a solid phase extraction. An internal standard (ISIS 355868, a
27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide,
GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 2758)
was added prior to extraction. Tissue sample concentrations were
calculated using calibration curves, with a lower limit of
quantitation (LLOQ) of approximately 1.14 .mu.g/g. The kidney to
liver ratio of the full-length oligonucleotide concentration, as
well as that for the total oligonucleotide concentration were
calculated. The results are presented in Table 59.
TABLE-US-00059 TABLE 59 Kidney to liver ratio of full-length and
total oligonucleotide concentrations in Sprague-Dawley rats ISIS No
Full length Total 455265 3.6 3.8 455269 2.1 2.4 455271 3.1 3.0
455272 2.9 3.1 455291 2.7 3.3 455371 2.2 2.4 455394 1.8 2.2 455703
2.3 2.8 455429 3.8 3.9 455471 2.7 2.9 455527 5.0 3.9 455530 3.9 2.9
455536 3.5 3.6 455548 2.5 2.9 455611 2.3 2.3 465236 2.3 3.3 465237
2.4 2.7 465588 2.8 2.6 465740 2.4 2.6 465754 1.6 1.8 465830 5.1 2.6
466670 3.1 4.4 466720 2.3 2.6
Example 41: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in SK-BR-3 Cells
[0590] Gapmers from the rodent tolerability studies described in
Examples 6-9 were tested at various doses in SK-BR-3 cells. Cells
were plated at a density of 4,000 cells per well. Cells were
incubated without any transfection reagent with 0.02 .mu.M, 0.10
.mu.M, 0.50 .mu.M, 1.00 .mu.M, 2.50 .mu.M, and 10.00 .mu.M
concentrations of antisense oligonucleotide, as specified in Table
60. After approximately 24 hours, RNA was isolated from the cells
and STAT3 mRNA levels were measured by quantitative real-time PCR.
Human STAT3 primer probe set RTS199, as described hereinabove, was
used to measure mRNA levels. STAT3 mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of STAT3, relative to
untreated control cells.
[0591] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 60.
TABLE-US-00060 TABLE 60 Dose-dependent antisense inhibition of
human STAT3 by free-uptake of ISIS oligonucleotide by SK-BR-3 cells
0.02 0.1 0.5 1 2.5 10 IC.sub.50 ISIS No .mu.M .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455265 22 14 25 19 30 37 >10.0 455269 17 17
21 45 64 67 1.3 455271 0 0 0 11 16 53 9.0 455272 0 0 0 5 12 51 9.6
455291 9 15 31 45 58 76 1.2 455371 16 20 34 37 54 70 1.7 455394 0 2
14 6 30 55 8.3 455429 0 0 0 12 29 57 7.9 455471 0 16 28 24 42 58
2.9 455527 5 15 14 21 35 45 >10.0 455530 0 14 12 14 28 36
>10.0 455536 0 0 0 1 8 26 >10.0 455548 16 14 17 17 20 44
>10.0 455611 19 1 3 21 35 38 >10.0 455703 0 0 0 0 3 33
>10.0 465236 0 7 15 19 37 60 3.8 465237 2 13 22 29 50 67 2.3
465588 5 3 21 18 42 44 >10.0 465740 1 14 0 19 14 39 >10.0
465754 0 0 4 15 39 55 7.7 465830 6 18 23 17 42 67 3.0 466670 21 19
33 35 58 71 1.6 466720 0 0 11 13 27 53 8.7
Example 42: Measurement of Viscosity of ISIS Antisense
Oligonucleotides Targeting Human STAT3
[0592] The viscosity of antisense oligonucleotides selected from
the studies described in Examples 6-10 was measured with the aim of
screening out antisense oligonucleotides which have a viscosity
more than 40 cP. Oligonucleotides having a viscosity greater than
40 cP would be too viscous to be administered to any subject.
[0593] ISIS oligonucleotides (32-35 mg) were weighed into a glass
vial, 120 .mu.L of water was added and the antisense
oligonucleotide was dissolved into solution by heating the vial at
50.degree. C. Part of (75 .mu.L) the pre-heated sample was pipetted
to a micro-viscometer (Cambridge). The temperature of the
micro-viscometter was set to 25.degree. C. and the viscosity of the
sample was measured. Another part (20 .mu.L) of the pre-heated
sample was pipetted into 10 mL of water for UV reading at 260 nM at
85.degree. C. (Cary UV instrument). The results are presented in
Table 61 and indicate that all the antisense oligonucleotides
solutions are optimal in their viscosity under the criterion stated
above.
TABLE-US-00061 TABLE 61 Viscosity of ISIS antisense
oligonucleotides targeting human STAT3 ISIS No Viscosity 455269 6.1
455291 13.6 466371 7.2 455703 17.6 455429 9.3 465237 26.2 465754
19.7 465830 8.1 466670 15.9
Example 43: Effect of ISIS Antisense Oligonucleotides Targeting
Human STAT3 in Cynomolgus Monkeys
[0594] Nine antisense oligonucleotides exhibiting a high level of
potency were further tested for in cynomolgus monkeys. Antisense
oligonucleotide tolerability and pharmacokinetic profile in the
liver and kidney was evaluated.
[0595] The study was conducted at the Korea Institute of
Toxicology, Republic of Korea. Prior to the study, the monkeys were
kept in quarantine for a 30-day time period, during which standard
panels of serum chemistry and hematology, examination of fecal
samples for ova and parasites, and a tuberculosis test, were
conducted to screen out abnormal or ailing monkeys. Nine groups of
four randomly assigned male cynomolgus monkeys each were injected
subcutaneously thrice per week for the first week, and subsequently
twice a week for the next 7 weeks, with 25 mg/kg of ISIS antisense
oligonucleotides. A control group of 4 cynomolgus monkeys was
injected with PBS subcutaneously thrice per week for the first
week, and subsequently twice a week for the next 7 weeks. Terminal
sacrifices of all groups were conducted on day 55, which was 48
hours after the last dose.
[0596] During the study period, the monkeys were observed daily for
signs of illness or distress. Any animal showing adverse effects to
the treatment was removed and referred to the veterinarian and
Study Director.
[0597] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, spleen heart, kidney, liver, and
gall bladder weights were measured at day 55. Organ weights were
measured and treatment group weights were compared to the
corresponding PBS control weights
[0598] To evaluate the effect of ISIS oligonucleotides on hepatic
and kidney function, blood samples were collected from all the
study groups. The monkeys were fasted overnight prior to blood
collection. Approximately, 1 mL each of blood samples was collected
in tubes without any anticoagulant for serum separation. The tubes
were kept at room temperature for 90 min and then centrifuged (3000
rpm for 10 min at room temperature) to obtain serum. Concentrations
of transaminases were measured using a Toshiba 200FR NEO chemistry
analyzer (Toshiba Co., Japan). Plasma concentrations of ALT
(alanine transaminase), AST (aspartate transaminase), and BUN were
measured on day 55. C-reactive protein (CRP), which is synthesized
in the liver and which serves as a marker of inflammation, was also
similarly measured on day 55.
[0599] To evaluate the effect of ISIS oligonucleotides on factors
involved in inflammation, blood was collected on day 55 from all
animals for analyses of complement C3 levels, MIP-1.beta. cytokine
levels, and platelet number.
[0600] For complement C3 analysis, approximately 0.5 mL each of
blood sample was collected in tubes without anticoagulant for serum
separation. For cytokine level analyses, approximately 2 mL each of
blood sample was collected in tubes without anticoagulant for serum
separation. The tubes were kept at room temperature for 90 min and
then centrifuged (3000 rpm for 10 min at room temperature) to
obtain serum. Complement C3 was measured using an automatic
analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co.,
Japan). Serum was utilized for cytokine analysis using a nine-panel
Searchlight Multiplex Array.
[0601] For platelet count, approximately 0.5 mL each of blood
samples was collected in tubes containing potassium salt of EDTA.
Samples were analyzed for platelet count using an ADVIA120
hematology analyzer (Bayer, USA).
[0602] The concentration of oligonucleotide was measured in the
liver and kidney on day 55. The method used is a modification of
previously published methods (Leeds et al., 1996; Geary et al.,
1999), which includes a phenol-chloroform (liquid-liquid)
extraction followed by a solid phase extraction. An internal
standard (ISIS 355868, a 27-mer 2'-O-methoxyethyl modified
phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT,
designated herein as SEQ ID NO: 2758) was added prior to
extraction. Tissue sample concentrations were calculated using
calibration curves, with a lower limit of quantitation (LLOQ) of
approximately 1.14 .mu.g/g.
[0603] Among the 9 antisense oligonucleotides tested, certain
antisense oligonucleotides, including ISIS 455269, ISIS 455371,
ISIS 455429, and ISIS 455670 met tolerability thresholds for organ
weight, ALT, AST, BUN, and hematological parameters.
Example 44: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in MDA-MB-231 Cells
[0604] ISIS oligonucleotides from the study described in Example 12
were further tested at different doses in MDA-MB-231 cells. Cells
were plated at a density of 4,000 cells per well. Cells were
incubated without any transfection reagent with 0.02 .mu.M, 0.20
.mu.M, 1.00 .mu.M, 5.00 .mu.M, and 10.00 .mu.M concentrations of
antisense oligonucleotide, as specified in Table 62. After
approximately 24 hours, RNA was isolated from the cells and STAT3
mRNA levels were measured by quantitative real-time PCR. Human
STAT3 primer probe set RTS199, as described hereinabove, was used
to measure mRNA levels. STAT3 mRNA levels were adjusted according
to total RNA content, as measured by RIBOGREEN.RTM.. Results are
presented as percent inhibition of STAT3, relative to untreated
control cells. The half maximal inhibitory concentration
(IC.sub.50) of each oligonucleotide is also presented in Table
62.
TABLE-US-00062 TABLE 62 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by
MDA-MB-231 cells 0.02 0.20 1.00 5.00 10.00 IC.sub.50 ISIS No .mu.M
.mu.M .mu.M .mu.M .mu.M (.mu.M) 455269 0 3 30 47 59 6.4 455291 1 3
13 41 47 8.3 455371 5 0 10 34 43 >10.0 455429 0 0 22 31 43
>10.0 455703 0 5 13 28 39 >10.0 465237 0 0 22 39 41 >10.0
465754 5 1 22 30 46 >10.0 465830 0 0 17 43 52 7.5 466670 4 7 18
49 56 6.5
Example 45: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in U251-MG Cells
[0605] ISIS oligonucleotides from the study described in Example 12
were further tested at different doses in U251-MG cells. Cells were
plated at a density of 4,000 cells per well. Cells were incubated
without any transfection reagent with 0.1 .mu.M, 1.0 .mu.M, 5.0
.mu.M, 10.0 .mu.M, and 20.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 63. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, as described hereinabove, was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of STAT3, relative to untreated control cells.
The half maximal inhibitory concentration (IC.sub.50) of each
oligonucleotide is also presented in Table 63.
TABLE-US-00063 TABLE 63 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by U251-MG
cells 0.1 1.0 5.0 10.0 20.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455269 3 16 31 47 56 11.9 455291 0 11 29 42 51
14.1 455371 3 0 25 33 39 >20.0 455429 6 0 25 33 39 >20.0
455703 5 2 13 33 36 >20.0 465237 2 0 7 2 6 >20.0 465754 0 0 8
16 4 >20.0 465830 0 0 18 2 10 >20.0 466670 0 0 18 25 37
>20.0
Example 46: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in A431 Cells
[0606] ISIS oligonucleotides from the study described in Example 12
were further tested at different doses in A431 cells. Cells were
plated at a density of 4,000 cells per well. Cells were incubated
without any transfection reagent with 0.02 .mu.M, 0.2 .mu.M, 1.0
.mu.M, 5.0 .mu.M, and 10.0 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 64. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, as described hereinabove, was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of STAT3, relative to untreated control
cells.
[0607] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 64. As illustrated
in Table 64, the ISIS oligonucleotides were able to penetrate the
cell membrane and significantly reduce STAT3 mRNA levels in a
dose-dependent manner.
TABLE-US-00064 TABLE 64 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by A431
cells 0.02 0.2 1.0 5.0 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455269 41 64 86 86 89 0.15 455291 25 61 83 85
86 0.17 455371 30 65 82 88 92 0.15 455429 15 73 84 87 88 0.19
455703 12 55 72 82 82 0.13 465237 23 72 82 86 87 0.13 465754 0 67
73 79 83 0.15 465830 0 50 67 71 78 0.21 466670 36 79 88 93 94
0.03
Example 47: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in H460 Cells
[0608] ISIS oligonucleotides from the study described in Example 12
were further tested at different doses in H460 cells. Cells were
plated at a density of 4,000 cells per well. Cells were incubated
without any transfection reagent with 0.02 .mu.M, 0.20 .mu.M, 1.00
.mu.M, 5.00 .mu.M, and 10.00 .mu.M concentrations of antisense
oligonucleotide, as specified in Table 65. After approximately 24
hours, RNA was isolated from the cells and STAT3 mRNA levels were
measured by quantitative real-time PCR. Human STAT3 primer probe
set RTS199, as described hereinabove, was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to total RNA
content, as measured by RIBOGREEN.RTM.. Results are presented as
percent inhibition of STAT3, relative to untreated control
cells.
[0609] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 65. As illustrated
in Table 65, the ISIS oligonucleotides were able to penetrate the
cell membrane and significantly reduce STAT3 mRNA levels in a
dose-dependent manner.
TABLE-US-00065 TABLE 65 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by H460
cells 0.02 0.20 1.00 5.00 10.00 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455269 3 69 81 92 94 0.1 455291 0 29 79 88 92
0.3 455371 0 20 63 85 89 0.8 455429 3 37 75 87 88 0.6 455703 4 24
69 87 92 0.3 465237 0 20 72 87 89 0.6 465754 10 45 80 91 92 0.2
465830 10 28 65 82 89 0.7 466670 15 32 71 90 93 0.3
Example 48: Effect of ISIS Oligonucleotides Targeting STAT3 in the
Treatment of U251 Human Glioma Cancer Xenograft Model
[0610] BALB/c nude mice inoculated with human U251 glioma tumor
cells were treated with ISIS oligonucleotides from the study
described in Example 12. The effect of the treatment on tumor
growth in the mice was evaluated.
Treatment
[0611] BALB/c nude mice were subcutaneously implanted with
1.times.10.sup.6 tumor cells. On day 4 of the implantation, groups
of 4 mice each were administered 50 mg/kg injected
intraperitoneally five times a week for 3 and a half weeks of ISIS
455269, ISIS 455291, ISIS 455371, ISIS 455703, ISIS 455429, ISIS
465237, ISIS 465754, ISIS 465830, or ISIS 466670. One group of mice
was administered 50 mg/kg injected intraperitoneally five times a
week for 3 and a half weeks of the control oligonucleotide, ISIS
141923. One group of mice was administered PBS injected
intraperitoneally five times a week for 3 and a half weeks.
Effect on Tumor Growth
[0612] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.5.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The results are presented in
Table 66. The data indicates that treatment with ISIS
oligonucleotides significantly impeded tumor growth. `n/a`
indicates that the data points for that time point are not
available.
TABLE-US-00066 TABLE 66 Effect of antisense inhibition of STAT3 on
tumor growth in the U251 xenograft model Day Day Day Day Day Day
Day Day 10 14 17 21 23 29 32 35 PBS 205 216 285 381 519 771 937
1,141 ISIS 141923 175 178 296 404 544 719 923 1,027 ISIS 455269 157
151 227 307 349 418 486 542 ISIS 455291 149 169 193 238 297 429 635
610 ISIS 455371 141 169 253 379 375 598 838 912 ISIS 455429 180 160
251 337 427 546 807 897 ISIS 455703 156 161 246 342 414 615 872 991
ISIS 465237 149 166 245 326 350 551 703 744 ISIS 465830 173 205 287
346 383 696 844 825 ISIS 466670 112 172 208 254 274 492 462 669
Example 49: Effect of ISIS 455291 Targeting STAT3 in the Treatment
of an MDA-MB-231 Human Breast Cancer Xenograft Model
[0613] BALB/c nude mice inoculated with human breast cancer cells
MDA-MB-231 were treated with ISIS 455291. The effect of the
treatment on tumor growth and tolerability in the mice was
evaluated.
Treatment
[0614] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. MDA-MB-231 human breast cancer cells were
maintained in vitro as a monolayer culture in Leibovitz's L-15
medium supplemented with 10% heat-inactivated fetal calf serum, 100
U/mL penicillin, 100 .mu.g/mL streptomycin, and 2 mM L-glutamine.
The cells were maintained at 37.degree. C. in an atmosphere of 5%
CO.sub.2 in air. The tumor cells were routinely sub-cultured twice
weekly with trypsin-EDTA treatment. Cells growing an exponential
growth phase were harvested and counted for tumor inoculation.
[0615] Two groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated at the right flank with the
MDA-MB-231 tumor fragments (3 mm.times.2 mm.times.2 mm, which were
generated from tumor inoculation passage) for tumor development.
Antisense oligonucleotide treatment started at day 11 after tumor
inoculation when the mean tumor size reached approximately 100
mm.sup.3. One of the groups was injected intraperitoneally twice a
week for 3 weeks with 50 mg/kg of ISIS 455291. The other group of
mice was injected intraperitoneally twice a week for 3 weeks with
PBS, and served as the control group.
[0616] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). At the
time of routine monitoring, the animals were checked for any
effects of tumor growth on normal behavior, such as mobility, food
consumption, body weight changes and any other abnormal effect.
RNA Analysis
[0617] RNA was extracted from tumor tissue for real-time PCR
analysis of human STAT3 mRNA levels using primer probe set RTS199,
described hereinabove. Murine STAT3 mRNA levels were also measured
using primer probe set mSTAT3_LTS00664 (forward sequence
CGACAGCTTCCCCATGGA, designated herein as SEQ ID NO: 1513; reverse
sequence ATGCCCAGTCTTGACTCTCAATC, designated herein as SEQ ID NO:
1514; probe sequence CTGCGGCAGTTCCTGGCACCTT, designated herein as
SEQ ID NO: 1515). Results are presented as percent inhibition of
STAT3, relative to PBS control, normalized to cyclophilin. As shown
in Table 67, treatment with ISIS 455291 resulted in reduction of
both human and murine STAT3 mRNA in comparison to the PBS
control.
TABLE-US-00067 TABLE 67 Inhibition of STAT3 mRNA in the treatment
groups relative to the PBS control in the MDA-MB-231 xenograft
model % inhibition Human STAT3 91 Murine STAT3 94
Effect on Tumor Growth
[0618] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.536.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size (900
mm.sup.3), and C as the median time (in days) for the tumors in the
control group to reach the same size. The T.sub.V/C.sub.V value
(expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 32).
[0619] The results are presented in Tables 68 and 69. The data
indicates that inhibition of STAT3 mRNA significantly impeded tumor
growth.
TABLE-US-00068 TABLE 68 Effect of antisense inhibition of STAT3 on
tumor growth in the MDA-MB-231 xenograft model Days PBS ISIS 455291
11 103 103 15 185 156 18 292 205 22 519 320 25 745 437 29 1,332 792
32 1,741 1,075
TABLE-US-00069 TABLE 69 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the MDA-MB-231 xenograft model Tumor
Size (mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 32 (%) at 900
mm.sup.3 PBS 1,741 -- -- ISIS 455291 1,075 62 4
Body Weight Measurements
[0620] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 70 and indicate that treatment with ISIS 455291 does not
affect the overall body weight of the mice.
TABLE-US-00070 TABLE 70 Body weight measurements of mice in the
MDA-MB-231 xenograft model Day Day Day Day Day Day Day 11 15 18 22
25 29 32 PBS 22 22 23 23 23 23 24 ISIS 455291 22 22 23 23 24 24
25
Example 50: Effect of ISIS 455291 Targeting STAT3 in the Treatment
of an A431 Human Epidermoid Carcinoma Xenograft Model
[0621] BALB/c nude mice inoculated with human epidermoid cancer
cells A431 were treated with ISIS 455291. The effect of the
treatment on tumor growth and tolerability in the mice was
evaluated.
Treatment
[0622] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. A431 human epidermoid carcinoma cells were
maintained in vitro as a monolayer culture in DMEM medium
supplemented with 10% heat-inactivated fetal calf serum, 100 U/mL
penicillin, 100 .mu.g/mL streptomycin, and 2 mM L-glutamine. The
cells were maintained at 37.degree. C. in an atmosphere of 5%
CO.sub.2 in air. The tumor cells were routinely sub-cultured twice
weekly with trypsin-EDTA treatment. Cells growing in an exponential
growth phase were harvested and counted for tumor inoculation.
[0623] Two groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated subcutaneously with
5.times.10.sup.6 A431 tumor cells for tumor development. Antisense
oligonucleotide treatment started at day 8 after tumor inoculation
when the mean tumor size reached approximately 95 mm.sup.3. One of
the groups was injected intraperitoneally twice a week for 4 weeks
with 50 mg/kg of ISIS 455291. The other group of mice was injected
intraperitoneally twice a week for 3 weeks with PBS, and served as
the control group.
[0624] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). At the
time of routine monitoring, the animals were checked for any
effects of tumor growth on normal behavior, such as mobility, food
consumption, body weight changes and any other abnormal effect.
RNA Analysis
[0625] RNA was extracted from tumor tissue for real-time PCR
analysis of human STAT3 mRNA levels using primer probe set RTS199,
described hereinabove. Murine STAT3 mRNA levels were also measured
using primer probe set mSTAT3_LTS00664. Results are presented as
percent inhibition of STAT3, relative to PBS control, normalized to
cyclophilin. As shown in Table 71, treatment with ISIS 455291
resulted in reduction of both human and murine STAT3 mRNA in
comparison to the PBS control.
TABLE-US-00071 TABLE 71 Inhibition of STAT3 mRNA in the treatment
groups relative to the PBS control in the A431 xenograft model %
inhibition Human STAT3 67 Murine STAT3 92
Effect on Tumor Growth
[0626] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.5.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size (800
mm.sup.3), and C as the median time (in days) for the tumors in the
control group to reach the same size. The T.sub.V/C.sub.V value
(expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 33).
[0627] The results are presented in Tables 72 and 73. The data
indicates that inhibition of STAT3 mRNA impeded tumor growth.
TABLE-US-00072 TABLE 72 Effect of antisense inhibition of STAT3 on
tumor growth in the A431 xenograft model Days PBS ISIS 455291 8 94
95 14 178 173 17 308 242 21 528 393 24 682 572 28 875 759 31 1,071
984 33 1,210 1,112
TABLE-US-00073 TABLE 73 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the A431 xenograft model Tumor Size
(mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 33 (%) at 800
mm.sup.3 PBS 1,210 -- -- ISIS 455291 1,112 92 2
Body Weight Measurements
[0628] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 74 and indicate that treatment with ISIS 455291 does not
affect the overall body weight of the mice.
TABLE-US-00074 TABLE 74 Body weight measurements of mice in the
A431 xenograft model Day Day Day Day Day Day Day Day 8 14 17 21 24
28 31 33 PBS 20 20 20 21 21 21 22 22 ISIS 455291 20 21 21 22 22 22
23 23
Example 51: Effect of ISIS 455291 Targeting STAT3 in the Treatment
of an NCI-H460 Human Non-Small Cell Lung Cancer (NSCLC) Xenograft
Model
[0629] BALB/c nude mice inoculated with human NCI-H460 human NSCLC
were treated with ISIS 455291. The effect of the treatment on tumor
growth and tolerability in the mice was evaluated.
Treatment
[0630] The study was conducted at Pharmaron Inc (Beijing, P.R.
China). The BALB/c nude mice were obtained from Beijing HFK
Bio-Technology Co., Ltd. NCI-H460 human NSCLC cells were maintained
in vitro as a monolayer culture in RPMI-1640 medium supplemented
with 10% heat-inactivated fetal calf serum, 100 U/mL penicillin,
100 .mu.g/mL streptomycin, and 2 mM L-glutamine. The cells were
maintained at 37.degree. C. in an atmosphere of 5% CO.sub.2 in air.
The tumor cells were routinely sub-cultured twice weekly with
trypsin-EDTA treatment. Cells growing in an exponential growth
phase were harvested and counted for tumor inoculation.
[0631] Two groups of eight randomly assigned 6-8 week-old female
BALB/c nude mice each were inoculated subcutaneously with
2.times.10.sup.6 NCI-H460 tumor cells for tumor development.
Antisense oligonucleotide treatment started at day 6 after tumor
inoculation when the mean tumor size reached approximately 100
mm.sup.3. One of the groups was injected intraperitoneally twice a
week for 3 weeks with 50 mg/kg of ISIS 455291. The other group of
mice was injected intraperitoneally twice a week for 3 weeks with
PBS, and served as the control group.
[0632] All procedures related to animal handling, care, and
treatment, were performed according to the guidelines approved by
the Institutional Animal Care and Use Committee (IACUC). At the
time of routine monitoring, the animals were checked for any
effects of tumor growth on normal behavior, such as mobility, food
consumption, body weight changes and any other abnormal effect.
Effect on Tumor Growth
[0633] Tumor size was measured twice weekly in two dimensions using
a caliper, and tumor volumes were calculated using the formula:
V=0.5.times.a.times.b.sup.2, where a and b are the long and short
diameters of the tumor, respectively. The tumor size was utilized
for calculations of the T-C and T.sub.V/C.sub.V values. T-C was
calculated with T as the median time (in days) required for the
tumors in the treatment groups to reach a pre-determined size
(1,500 mm.sup.3), and C as the median time (in days) for the tumors
in the control group to reach the same size. The T.sub.V/C.sub.V
value (expressed as percentage) is an indication of the anti-tumor
effectiveness of the ISIS oligonucleotides, where T.sub.V and
C.sub.V were the mean volume of the treated and control groups,
respectively, on a given day (day 20).
[0634] The results are presented in Tables 75 and 76. The data
indicates that inhibition of STAT3 significantly impeded tumor
growth.
TABLE-US-00075 TABLE 75 Effect of antisense inhibition of STAT3 on
tumor growth in the NCI-H460 xenograft model Days PBS ISIS 455291 6
104 104 8 303 180 11 746 408 13 1,175 620 15 1,642 819 18 2,277
1,320 20 2,859 1,812 22 -- 2,330
TABLE-US-00076 TABLE 76 Effect of antisense inhibition of STAT3 on
tumor growth inhibition in the NCI-H460 xenograft model Tumor Size
(mm.sup.3) T.sub.V/C.sub.V T-C Treatment at day 20 (%) at 800
mm.sup.3 PBS 1,210 -- -- ISIS 455291 1,812 63 4
Body Weight Measurements
[0635] To evaluate the effect of ISIS oligonucleotides on the
overall health of the animals, body weights were measured on a
regular basis during the treatment period. The data is presented in
Table 77 and indicate that treatment with ISIS 455291 does not
affect the overall body weight of the mice.
TABLE-US-00077 TABLE 77 Body weight measurements of mice in the
NCI-H460 xenograft model Day Day Day Day Day Day Day Day 6 8 11 13
15 18 20 22 PBS 20 20 20 20 20 20 21 -- ISIS 455291 20 20 20 20 20
19 20 20
Example 52: Effect of Antisense Inhibition of Human STAT3 in a
Human Glioblastoma Orthotopic Mouse Model
[0636] NUJ mice orthotopically implanted with human glioblastoma
cells were treated with ISIS 455291, a 5-10-5 MOE gapmer having a
sequence of CAGCAGATCAAGTCCAGGGA (SEQ ID NO: 1590. The effect of
the treatment on tumor growth and tolerability in the mice was
evaluated.
Treatment
[0637] Thirty NUJ mice were stereotactically implanted in the right
frontal lobe with 5.times.10.sup.5U-87 MG-luc2 cells. On day 15
after tumor cell implantation, 15 of these mice were dosed
intracranially with a bolus injection at the site of tumor
implantation with 100 .mu.g of ISIS 455291, which was dissolved in
2 .mu.L of PBS. The remaining 15 mice were dosed intracranially
with a bolus injection at the site of tumor implantation with 2
.mu.L of PBS. The second group of mice served as the control
group.
Analysis
[0638] On day 18 after tumor transplantation, five mice from each
group were euthanized by CO.sub.2 inhalation and brain samples were
collected for RNA analysis. RNA was extracted from tumor tissue for
real-time PCR analysis of human STAT3 mRNA levels using primer
probe set RTS199, described hereinabove. Treatment with ISIS 455291
resulted in 27% reduction of human STAT3 mRNA in the tumor tissue
in comparison to the PBS control.
[0639] The remaining mice in each group were monitored regularly up
to 2 weeks for survival analysis. The median survival for the PBS
control group was 30.5 days. The medial survival for the ISIS
oligonucleotide-treated mice was 35 days. The P value was
0.2088.
Example 53: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in PC9 Cells
[0640] ISIS 455703 and ISIS 455291, from the studies described
above, were further tested at different doses in PC9 cells, a non
small cell lung carcinoma cell line. Cells were plated at a density
of 3,000 cells per well. Cells were incubated with 0.02 .mu.M, 0.1
.mu.M, 0.5 .mu.M, 2.5 .mu.M, and 10.0 .mu.M concentrations of
antisense oligonucleotide, as specified in Table 78. After
approximately 24 hours, RNA was isolated from the cells and STAT3
mRNA levels were measured by quantitative real-time PCR. Human
STAT3 primer probe set RTS2033 (forward sequence GAGGCCCGCCCAACA,
designated herein as SEQ ID NO: 1520; reverse sequence
TTCTGCTAATGACGTTATCCAGTTTT, designated herein as SEQ ID NO: 1521;
probe sequence CTGCCTAGATCGGC, designated herein as SEQ ID NO:
1522) was used to measure mRNA levels. STAT3 mRNA levels were
adjusted according to content of beta-actin, a housekeeping gene,
as measured by human primer probe set HTS5002 (forward sequence
CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO: 1529;
reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID
NO: 1530; probe sequence CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated
herein as SEQ ID NO: 1531). Results are presented as percent
inhibition of STAT3, relative to untreated control cells.
[0641] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 78. As illustrated
in Table 78, ISIS 455703 and ISIS 455291 were able to penetrate the
cell membrane.
TABLE-US-00078 TABLE 78 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by PC9
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455703 6 5 17 50 49 9.0 455291 0 0 42 67 75
1.2
Example 54: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in C42B Cells
[0642] ISIS 455291, from the studies described above, was further
tested at different doses in C42B cells, a prostate cancer cell
line. Cells were plated at a density of 3,000 cells per well. Cells
were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 2.5 .mu.M,
and 10.0 .mu.M concentrations of antisense oligonucleotide, as
specified in Table 79. After approximately 24 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0643] As illustrated in Table 79, ISIS 455291 was able to
penetrate the cell membrane.
TABLE-US-00079 TABLE 79 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by C42B
cells ISIS No 0.02 .mu.M 0.1 .mu.M 0.5 .mu.M 2.5 .mu.M 10.0 .mu.M
455291 0 0 17 10 41
Example 55: Dose-Dependent Antisense Inhibition of STAT3 Following
Free Uptake of Antisense Oligonucleotide in Colo201 Cells
[0644] ISIS 455291, from the studies described above, was further
tested at different doses in Colo201 cells, a colorectal cancer
cell line. Cells were plated at a density of 3,000 cells per well.
Cells were incubated with 0.02 .mu.M, 0.1 .mu.M, 0.5 .mu.M, 2.5
.mu.M and 10.0 .mu.M concentrations of antisense oligonucleotide,
as specified in Table 80. After approximately 24 hours, RNA was
isolated from the cells and STAT3 mRNA levels were measured by
quantitative real-time PCR. Human STAT3 primer probe set RTS2033
(forward sequence GAGGCCCGCCCAACA, designated herein as SEQ ID NO:
1520; reverse sequence TTCTGCTAATGACGTTATCCAGTTTT, designated
herein as SEQ ID NO: 1521; probe sequence CTGCCTAGATCGGC,
designated herein as SEQ ID NO: 1522) was used to measure mRNA
levels. STAT3 mRNA levels were adjusted according to content of
beta-actin, a housekeeping gene, as measured by human primer probe
set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated
herein as SEQ ID NO: 1529; reverse sequence GCCATGCCAATCTCATCTTGT,
designated herein as SEQ ID NO: 1530; probe sequence
CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO:
1531). Results are presented as percent inhibition of STAT3,
relative to untreated control cells.
[0645] The half maximal inhibitory concentration (IC.sub.50) of
each oligonucleotide is also presented in Table 80. As illustrated
in Table 29, ISIS 455291 was able to penetrate the cell
membrane.
TABLE-US-00080 TABLE 80 Dose-dependent antisense inhibition of
STAT3 mRNA levels by free-uptake of ISIS oligonucleotide by Colo201
cells 0.02 0.1 0.5 2.5 10.0 IC.sub.50 ISIS No .mu.M .mu.M .mu.M
.mu.M .mu.M (.mu.M) 455291 21 18 34 52 81 1.2
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200385716A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20200385716A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References