U.S. patent application number 16/253077 was filed with the patent office on 2019-05-16 for monoclonal antibodies that neutralize anthrax protective antigen (pa) toxin.
The applicant listed for this patent is The USA, as represented by the Secretary, Department of Health and Human Services, The USA, as represented by the Secretary, Department of Health and Human Services. Invention is credited to Zhaochun CHEN, Suzanne U. EMERSON, Stephen H. LEPPLA, Mahtab MOAYERI, Robert H. PURCELL.
Application Number | 20190144527 16/253077 |
Document ID | / |
Family ID | 38261612 |
Filed Date | 2019-05-16 |
United States Patent
Application |
20190144527 |
Kind Code |
A1 |
CHEN; Zhaochun ; et
al. |
May 16, 2019 |
Monoclonal Antibodies that Neutralize Anthrax Protective Antigen
(PA) Toxin
Abstract
The present invention relates to monoclonal antibodies that bind
or neutralize anthrax protective antigen (PA) toxin. The invention
provides such antibodies, fragments of such antibodies retaining
anthrax PA toxin-binding ability, fully human or humanized
antibodies retaining anthrax PA toxin-binding ability, and
pharmaceutical compositions including such antibodies. The
invention further provides for isolated nucleic acids encoding the
antibodies of the invention and host cells transformed therewith.
Additionally, the invention provides for prophylactic, therapeutic,
and diagnostic methods employing the antibodies and nucleic acids
of the invention.
Inventors: |
CHEN; Zhaochun; (Potomac,
MD) ; LEPPLA; Stephen H.; (Bethesda, MD) ;
MOAYERI; Mahtab; (Bethesda, MD) ; EMERSON; Suzanne
U.; (Gaithersburg, MD) ; PURCELL; Robert H.;
(Gaithersburg, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The USA, as represented by the Secretary, Department of Health and
Human Services |
Bethesda |
MD |
US |
|
|
Family ID: |
38261612 |
Appl. No.: |
16/253077 |
Filed: |
January 21, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14181099 |
Feb 14, 2014 |
10227395 |
|
|
16253077 |
|
|
|
|
11793735 |
Dec 8, 2009 |
8685396 |
|
|
PCT/US2005/046790 |
Dec 21, 2005 |
|
|
|
14181099 |
|
|
|
|
60639074 |
Dec 22, 2004 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/150.1; 435/320.1; 435/340; 536/23.53 |
Current CPC
Class: |
C07K 2319/00 20130101;
C07K 16/1278 20130101; C07K 2317/24 20130101; C07K 2317/622
20130101; C07K 2317/21 20130101; C07K 2317/52 20130101; A61K
2039/505 20130101; C07K 2317/76 20130101; A61P 31/04 20180101 |
International
Class: |
C07K 16/12 20060101
C07K016/12 |
Claims
1-18. (canceled)
19. A method for the treatment of anthrax disease comprising
administering to a patient a therapeutically effective amount of a
pharmaceutical preparation comprising a monoclonal antibody that
binds anthrax protective antigen (PA) and a pharmaceutically
acceptable carrier.
20. A method for prophylaxis against anthrax disease comprising
administering to a patient a prophylactically effective amount of a
pharmaceutical preparation comprising a monoclonal antibody that
binds anthrax protective antigen (PA) and a pharmaceutically
acceptable carrier.
21-24. (canceled)
25. The method of claim 19, wherein said monoclonal antibody
comprises: a heavy chain CDR1 region consisting of the amino acid
sequence of SEQ ID NO:3, a heavy chain CDR 2 region consisting of
the amino acid sequence of SEQ ID NO:5, a heavy chain CDR3 region
consisting of the amino acid sequence of SEQ ID NO:7, a light chain
CDR1 region consisting of the amino acid sequence of SEQ ID NO:11,
a light chain CDR2 region consisting of the amino acid sequence of
SEQ ID NO:13, and a light chain CDR3 region consisting of the amino
acid sequence of SEQ ID NO:15; or a heavy chain CDR1 region
consisting of the amino acid sequence of SEQ ID NO:19, a heavy
chain CDR 2 region consisting of the amino acid sequence of SEQ ID
NO:21, a heavy chain CDR3 region consisting of the amino acid
sequence of SEQ ID NO:23, a light chain CDR1 region consisting of
the amino acid sequence of SEQ ID NO:27, a light chain CDR2 region
consisting of the amino acid sequence of SEQ ID NO:29, and a light
chain CDR3 region consisting of the amino acid sequence of SEQ ID
NO:31.
26. The method of claim 19, wherein said monoclonal antibody
comprises a heavy chain Fd region including the amino acid sequence
of SEQ ID NO: 1 (when heavy chain CDR3 region is SEQ ID NO: 7) or
SEQ ID NO: 17 (when heavy chain CDR3 region is SEQ ID NO: 23).
27. The method of claim 19, wherein said monoclonal antibody
comprises a light chain region having the amino acid sequence of
SEQ ID NO: 9 (when heavy chain CDR3 region is SEQ ID NO: 7) or SEQ
ID NO: 25 (when heavy chain CDR3 region is SEQ ID NO: 23).
28. The method of claim 20, wherein said monoclonal antibody
comprises: a heavy chain CDR1 region consisting of the amino acid
sequence of SEQ ID NO:3, a heavy chain CDR 2 region consisting of
the amino acid sequence of SEQ ID NO:5, a heavy chain CDR3 region
consisting of the amino acid sequence of SEQ ID NO:7, a light chain
CDR1 region consisting of the amino acid sequence of SEQ ID NO:11,
a light chain CDR2 region consisting of the amino acid sequence of
SEQ ID NO:13, and a light chain CDR3 region consisting of the amino
acid sequence of SEQ ID NO:15; or a heavy chain CDR1 region
consisting of the amino acid sequence of SEQ ID NO:19, a heavy
chain CDR 2 region consisting of the amino acid sequence of SEQ ID
NO:21, a heavy chain CDR3 region consisting of the amino acid
sequence of SEQ ID NO:23, a light chain CDR1 region consisting of
the amino acid sequence of SEQ ID NO:27, a light chain CDR2 region
consisting of the amino acid sequence of SEQ ID NO:29, and a light
chain CDR3 region consisting of the amino acid sequence of SEQ ID
NO:31.
29. The method of claim 20, wherein said monoclonal antibody
comprises a heavy chain Fd region including the amino acid sequence
of SEQ ID NO: 1 (when heavy chain CDR3 region is SEQ ID NO: 7) or
SEQ ID NO: 17 (when heavy chain CDR3 region is SEQ ID NO: 23).
30. The method of claim 20, wherein said monoclonal antibody
comprises a light chain region having the amino acid sequence of
SEQ ID NO: 9 (when heavy chain CDR3 region is SEQ ID NO: 7) or SEQ
ID NO: 25 (when heavy chain CDR3 region is SEQ ID NO: 23).
Description
FIELD OF THE INVENTION
[0001] This invention relates generally to the field of immunology
and specifically to monoclonal antibodies that bind or neutralize
anthrax protective antigen (PA) toxin.
BACKGROUND OF THE INVENTION
[0002] Anthrax has re-emerged as a serious bioterrorist threat.
Inhalational anthrax is usually fatal if not identified early
enough for antibiotics to be of use. The lethality is primarily due
to the effects of the toxins.
[0003] Anthrax toxin, which consists of three polypeptides
protective antigen (PA or PAw, 83 kDa), lethal factor (LF, 90 kDa)
and edema factor (EF, 89 kDa), is a major virulence factor of
Bacillus anthracis. The LF and EF components are enzymes that are
carried into the cell by PA. The combination of PA and LF forms
lethal toxin. Anthrax toxin enters cells via a receptor-mediated
endocytosis. PA binds to the receptor and is processed (PA, 63
kDa), which forms a heptameric ring that delivers the EF or LF to
the cytosol. The path leading from PA binding to cells via TEM-8 or
CMG2, furin processing, heptamer formation, LF or EF binding to
heptamer, or the translocation of EF/LF to the cytosol provides
multiple sites for molecular intervention.
[0004] Mouse monoclonal antibodies neutralize anthrax toxin in vivo
in rat (Little et al., 1990 Infect Immun 58:1606-1613). Rabbit
anti-PA given 24 hours post-infection protects 90% of the infected
guinea pigs (Kobiler et al. 2002 Infect Immun 70:544-550). Domain 4
of PA contains the dominant protective epitopes of PA (Flick-Smith
et al. 2002 Infect Immun 70:1653-1656). Protection against anthrax
toxin by anti-PA monoclonal antibodies correlates strongly with
affinity (Maynard et al. 2002 Nat Biotechnol 20:597-601).
SUMMARY OF THE INVENTION
[0005] The present invention relates to monoclonal antibodies that
bind or neutralize anthrax protective antigen (PA) toxin. The
invention provides such antibodies, fragments of such antibodies
retaining anthrax PA toxin-binding ability, fully human or
humanized antibodies retaining anthrax PA toxin-binding ability,
and pharmaceutical compositions including such antibodies. The
invention further provides for isolated nucleic acids encoding the
antibodies of the invention and host cells transformed
therewith.
[0006] Additionally, the invention provides for prophylactic,
therapeutic, and diagnostic methods employing the antibodies and
nucleic acids of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1A-B. Alignments of the deduced amino acid sequences of
the variable domains of the heavy chains (FIG. 1A) and kappa chains
(FIG. 1B) are shown for clones W1, W2, W5, A63-6, F3-6 and F5-1.
Substitutions relative to W1 are shown in single amino acid
letters. Identical residues are indicated by dashes. Absence of
corresponding residues relative to the longest sequence is
indicated by stars. Complementarity-determining regions (CDR1,
CDR2, and CDR3) and framework regions (FR1, FR2, FR3, and FR4) are
indicated above the sequence alignments. VH W1--SEQ ID NO: 1; VH
W2--SEQ ID NO: 17; VH W5--SEQ ID NO: 33; VH A63-6--SEQ ID NO: 34;
VH F3-6--SEQ ID NO: 35; VH F5-1--SEQ ID NO: 36; V.kappa. W1--SEQ ID
NO: 9; V.kappa. W2--SEQ ID NO: 25; V.kappa. W5--SEQ ID NO: 37;
V.kappa. A63-6--SEQ ID NO: 38; V.kappa. F3-6--SEQ ID NO: 39;
V.kappa. F5-1--SEQ ID NO: 40.
[0008] FIG. 2A-B. ELISA titration of anti-PA (FIG. 2A) and anti-LF
(FIG. 2B) single-chain Fvs (scFvs). Recombinant PA (FIG. 2A), LF
(FIG. 2B), or unrelated proteins, BSA, thyroglobulin, lysozyme, and
phosphorylase-b were used to coat the wells of an ELISA plate.
Wells were then incubated with various dilutions of scFvs. Bound
scFv was detected by the addition of peroxidase-conjugated anti-His
antibody followed by TMB substrate. The anti-PA and anti-LF scFvs
did not bind to the unrelated proteins as shown in FIG. 2A and FIG.
2B, respectively; only BSA is shown as an example.
[0009] FIG. 3. In vitro neutralization assay. Anti-PA IgG was mixed
with anthrax toxin and incubated at 37.degree. C. for 1 h. The
mixture was added to RAW264.7 cells in a 96-well plate and
incubated at 37.degree. C. for 4 h. After washing, the cells were
stained with MTT dye followed by lysis in a solution containing
0.5% SDS in 90% isopropanol, 0.05 M HCl. The plate was read at
OD.sub.570 with OD.sub.690 as a reference. Results were plotted and
analyzed with Prism software (Graphpad Software Inc, San Diego).
W1: .box-solid.; W2: ; 14B7: .quadrature..
[0010] FIG. 4. Competitive ELISA. Recombinant PA was coated onto
the wells of an ELISA plate. Wells were then incubated with anti-PA
W2 Fab at the concentrations indicated. After incubation at room
temperature for 1 h, anti-PA W2 Fab was removed from the wells and
mouse anti-PA MAbs 14B7 and 2D3 (Cook, G. P. & Tomlinson, I. M.
1995 Immunol Today 16:237-42; Petosa, C. et al. 1997 Nature
385:833-8) were added to the wells. Bound MAbs were detected by the
addition of peroxidase-conjugated anti-mouse antibody followed by
TMB substrate. The binding to PA was calculated by dividing the OD
value in the absence of W2 with that in the presence of W2.
[0011] FIG. 5. Summary of epitope mapping of anti-PA W2 antibody by
radioimmunoprecipitation assay (RIPA). .sup.35S-labeled PA
peptides, prepared in vitro, were incubated with anti-PA W2. The
immune complexes were captured by protein G-coupled agarose beads
and separated on SDS-PAGE. The PA peptide was detected by exposing
the dried gel to X-ray film. The numbers denote the starting and
ending amino acid. The peptides that reacted with antibody and
hence were detected on X-ray film were scored as positive (+).
Faint intensity of the band on X-ray film denoted partial reaction
and was scored as +/-.
[0012] FIG. 6. Inhibition of the binding of PA to RAW264.7 cells by
preincubation of toxin with mAbs. PA at concentration of 6 nM (500
ng/ml) was incubated with anti-PA 14B7 or W2 antibodies at 1:1 or
1:10 molar ratio for 5 min. The mixture was added to RAW264.7 cells
and incubated for 20 min at 37.degree. C. The cells were washed and
lysed, followed by separation on SDS-PAGE. The proteins were
transferred to a membrane and probed with anti-PA polyclonal
antibody.
[0013] FIG. 7. pComb 3H Cut Site Map.
BRIEF DESCRIPTION OF THE SEQ ID NOS
TABLE-US-00001 [0014] Heavy Chain Light Chain Anti-PA W1 Sequence
Anti-PA W1 Sequence Region SEQ ID NO: 1 SEQ ID NO: 9 FR1 SEQ ID NO:
2 SEQ ID NO: 10 CDR1 SEQ ID NO: 3 SEQ ID NO: 11 FR2 SEQ ID NO: 4
SEQ ID NO: 12 CDR2 SEQ ID NO: 5 SEQ ID NO: 13 FR3 SEQ ID NO: 6 SEQ
ID NO: 14 CDR3 SEQ ID NO: 7 SEQ ID NO: 15 FR4 SEQ ID NO: 8 SEQ ID
NO: 16 Heavy Chain Light Chain Anti-PA W2 Sequence Anti-PA W2
Sequence Region SEQ ID NO: 17 SEQ ID NO: 25 FR1 SEQ ID NO: 18 SEQ
ID NO: 26 CDR1 SEQ ID NO: 19 SEQ ID NO: 27 FR2 SEQ ID NO: 20 SEQ ID
NO: 28 CDR2 SEQ ID NO: 21 SEQ ID NO: 29 FR3 SEQ ID NO: 22 SEQ ID
NO: 30 CDR3 SEQ ID NO: 23 SEQ ID NO: 31 FR4 SEQ ID NO: 24 SEQ ID
NO: 32
Deposit of Biological Material
[0015] The following biological material has been deposited in
accordance with the terms of the Budapest Treaty with the American
Type Culture Collection (ATCC), Manassas, Va., on the date
indicated:
TABLE-US-00002 Biological material Designation No. Date Chimpanzee
Anti-Anthrax PTA-6293 Nov. 10, 2004 PAW1 Fab Fragment in pcomb3H
Vector
[0016] Chimpanzee Anti-Anthrax PAW1 Fab Fragment in pcomb3H Vector
was deposited as ATCC Accession No. PTA-6293 on Nov. 10, 2004 with
the American Type Culture Collection (ATCC), 10801 University
Blvd., Manassas, Va. 20110-2209, USA. This deposit was made under
the provisions of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for the Purposes of
Patent Procedure and the Regulations thereunder (Budapest Treaty).
This assures maintenance of a viable culture of the deposit for 30
years from date of deposit. The deposit will be made available by
ATCC under the terms of the Budapest Treaty, and subject to an
agreement between Applicant and ATCC which assures permanent and
unrestricted availability of the progeny of the culture of the
deposit to the public upon issuance of the pertinent U.S. patent or
upon laying open to the public of any U.S. or foreign patent
application, whichever comes first, and assures availability of the
progeny to one determined by the U.S. Commissioner of Patents and
Trademarks to be entitled thereto according to 35 USC .sctn. 122
and the Commissioner's rules pursuant thereto (including 37 CFR
.sctn. 1.14). Availability of the deposited biological material is
not to be construed as a license to practice the invention in
contravention of the rights granted under the authority of any
government in accordance with its patent laws.
TABLE-US-00003 Biological material Designation No. Date Chimpanzee
Anti-Anthrax PTA-6049 Jun. 4, 2004 PAW2 Fab Fragment in pcomb3H
Vector
[0017] Chimpanzee Anti-Anthrax PAW2 Fab Fragment in pcomb3H Vector
was deposited as ATCC Accession No. PTA-6049 on Jun. 4, 2004 with
the American Type Culture Collection (ATCC), 10801 University
Blvd., Manassas, Va. 20110-2209, USA. This deposit was made under
the provisions of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for the Purposes of
Patent Procedure and the Regulations thereunder (Budapest Treaty).
This assures maintenance of a viable culture of the deposit for 30
years from date of deposit. The deposit will be made available by
ATCC under the terms of the Budapest Treaty, and subject to an
agreement between Applicant and ATCC which assures permanent and
unrestricted availability of the progeny of the culture of the
deposit to the public upon issuance of the pertinent U.S. patent or
upon laying open to the public of any U.S. or foreign patent
application, whichever comes first, and assures availability of the
progeny to one determined by the U.S. Commissioner of Patents and
Trademarks to be entitled thereto according to 35 USC .sctn. 122
and the Commissioner's rules pursuant thereto (including 37 CFR
.sctn. 1.14). Availability of the deposited biological material is
not to be construed as a license to practice the invention in
contravention of the rights granted under the authority of any
government in accordance with its patent laws.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0018] Passive immunization using monoclonal antibodies from humans
or non-human primates represents an attractive alternative for
prevention of anthrax. Monoclonal antibodies to anthrax protective
antigen (PA) were recovered by repertoire cloning of bone marrow
mRNAs from an immune chimpanzee and analyzed for antigen binding
specificity. The V.sub.H and V.sub.L sequences and neutralizing
activity against the cytotoxicity of the anthrax toxin in vitro of
Fabs were analyzed. Two monoclonal antibodies shared an identical
HCDR3 sequence. Both Fabs neutralized the cytotoxicity of the
anthrax toxin. The neutralizing antibodies were found to have very
high binding affinity to PA with a Kd of 4-5.times.10.sup.-11 M,
which is 20-100 fold higher than the binding of receptor to PA. The
binding epitope was located at aa 614-735, the site for binding to
the cellular receptor (Petosa et al. 1997 Nature 385:833-838,
1997). A Fab was converted to full-length IgG1 by combining it with
human sequences. In vivo rat protection assay showed that both
anti-PA W1 and W2 protected rats from toxin challenge. In vitro
studies revealed that the mechanism of protection afforded by both
antibodies is inhibition of binding of PA to the cellular receptor.
The full-length IgG1 is predicted to be invaluable for prophylactic
and therapeutic application against anthrax in humans.
Definitions
[0019] As used herein, the term "antibody" means an immunoglobulin
molecule or a fragment of an immunoglobulin molecule having the
ability to specifically bind to a particular antigen. Antibodies
are well known to those of ordinary skill in the science of
immunology. As used herein, the term "antibody" means not only
full-length antibody molecules but also fragments of antibody
molecules retaining antigen binding ability. Such fragments are
also well known in the art and are regularly employed both in vitro
and in vivo. In particular, as used herein, the term "antibody"
means not only full-length immunoglobulin molecules but also
antigen binding active fragments such as the well-known active
fragments F(ab').sub.2, Fab, Fv, and Fd.
[0020] As used herein, the term "anthrax" means any disease caused,
directly or indirectly, by infection with Bacillus anthracis.
Inhalation: Initial symptoms may resemble a common cold--sore
throat, mild fever, muscle aches and malaise. After several days,
the symptoms may progress to severe breathing problems and shock.
Inhalation anthrax is usually fatal. Cutaneous: Anthrax infections
can occur when the bacterium enters a cut or abrasion on the skin,
such as when handling contaminated wool, hides, leather or hair
products (especially goat hair) of infected animals. Skin infection
begins as a raised itchy bump that resembles an insect bite but
within 1-2 days develops into a vesicle and then a painless ulcer,
usually 1-3 cm in diameter, with a characteristic black necrotic
(dying) area in the center. Lymph glands in the adjacent area may
swell. About 20% of untreated cases of cutaneous anthrax will
result in death. Gastrointestinal: The intestinal disease form of
anthrax may follow the consumption of contaminated meat and is
characterized by an acute inflammation of the intestinal tract.
Initial signs of nausea, loss of appetite, vomiting, fever are
followed by abdominal pain, vomiting of blood, and severe diarrhea.
Intestinal anthrax results in death in 25% to 60% of cases.
[0021] As used herein with respect to polypeptides, the term
"substantially pure" means that the polypeptides are essentially
free of other substances with which they may be found in nature or
in vivo systems to an extent practical and appropriate for their
intended use. In particular, the polypeptides are sufficiently pure
and are sufficiently free from other biological constituents of
their hosts cells so as to be useful in, for example, generating
antibodies, sequencing, or producing pharmaceutical preparations.
By techniques well known in the art, substantially pure
polypeptides may be produced in light of the nucleic acid and amino
acid sequences disclosed herein. Because a substantially purified
polypeptide of the invention may be admixed with a pharmaceutically
acceptable carrier in a pharmaceutical preparation, the polypeptide
may comprise only a certain percentage by weight of the
preparation. The polypeptide is nonetheless substantially pure in
that it has been substantially separated from the substances with
which it may be associated in living systems.
[0022] As used herein with respect to nucleic acids, the term
"isolated" means: (1) amplified in vitro by, for example,
polymerase chain reaction (PCR); (ii) recombinantly produced by
cloning; (iii) purified, as by cleavage and gel separation; or (iv)
synthesized by, for example, chemical synthesis. An isolated
nucleic acid is one which is readily manipulable by recombinant DNA
techniques well known in the art. Thus, a nucleotide sequence
contained in a vector in which 5' and 3' restriction sites are
known or for which polymerase chain reaction (PCR) primer sequences
have been disclosed is considered isolated but a nucleic acid
sequence existing in its native state in its natural host is not.
An isolated nucleic acid may be substantially purified, but need
not be. For example, a nucleic acid that is isolated within a
cloning or expression vector is not pure in that it may comprise
only a tiny percentage of the material in the cell in which it
resides. Such a nucleic acid is isolated, however, as the term is
used herein because it is readily manipulable by standard
techniques known to those of ordinary skill in the art.
[0023] As used herein, a coding sequence and regulatory sequences
are said to be "operably joined" when they are covalently linked in
such a way as to place the expression or transcription of the
coding sequence under the influence or control of the regulatory
sequences. If it is desired that the coding sequences be translated
into a functional protein, two DNA sequences are said to be
operably joined if induction of a promoter in the 5' regulatory
sequences results in the transcription of the coding sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the coding sequences, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a promoter region would be operably joined to a
coding sequence if the promoter region were capable of effecting
transcription of that DNA sequence such that the resulting
transcript might be translated into the desired protein or
polypeptide.
[0024] The precise nature of the regulatory sequences needed for
gene expression may vary between species or cell types, but shall
in general include, as necessary, 5' non-transcribing and 5'
non-translating sequences involved with initiation of transcription
and translation respectively, such as a TATA box, capping sequence,
CAAT sequence, and the like. Especially, such 5' non-transcribing
regulatory sequences will include a promoter region which includes
a promoter sequence for transcriptional control of the operably
joined gene. Regulatory sequences may also include enhancer
sequences or upstream activator sequences, as desired.
[0025] As used herein, a "vector" may be any of a number of nucleic
acids into which a desired sequence may be inserted by restriction
and ligation for transport between different genetic environments
or for expression in a host cell. Vectors are typically composed of
DNA although RNA vectors are also available. Vectors include, but
are not limited to, plasmids and phagemids. A cloning vector is one
which is able to replicate in a host cell, and which is further
characterized by one or more endonuclease restriction sites at
which the vector may be cut in a determinable fashion and into
which a desired DNA sequence may be ligated such that the new
recombinant vector retains its ability to replicate in the host
cell. In the case of plasmids, replication of the desired sequence
may occur many times as the plasmid increases in copy number within
the host bacterium or just a single time per host before the host
reproduces by mitosis. In the case of phage, replication may occur
actively during a lytic phase or passively during a lysogenic
phase. An expression vector is one into which a desired DNA
sequence may be inserted by restriction and ligation such that it
is operably joined to regulatory sequences and may be expressed as
an RNA transcript. Vectors may further contain one or more marker
sequences suitable for use in the identification and selection of
cells which have been transformed or transfected with the vector.
Markers include, for example, genes encoding proteins which
increase or decrease either resistance or sensitivity to
antibiotics or other compounds, genes which encode enzymes whose
activities are detectable by standard assays known in the art
(e.g., B-galactosidase or alkaline phosphatase), and genes which
visibly affect the phenotype of transformed or transfected cells,
hosts, colonies or plaques. Preferred vectors are those capable of
autonomous replication and expression of the structural gene
products present in the DNA segments to which they are operably
joined.
Novel Anti-Anthrax PA Monoclonal Antibodies
[0026] The present invention derives, in part, from the isolation
and characterization of a first and second novel chimpanzee Fab
fragment and its humanized monoclonal antibody that selectively
binds anthrax protective antigen and that we have designated
anti-anthrax PAw 1 and PAw 1, respectively. Additionally, these new
monoclonal antibodies have been shown to neutralize the
cytotoxicity of the anthrax toxin. The paratope of the anti-anthrax
PAw 1 and PAw 2 Fab fragment associated with the neutralization
epitope on the anthrax PA is defined by the amino acid (aa)
sequences of the immunoglobulin heavy and light chain V-regions
depicted in FIG. 1 and, for PAw 1, SEQ ID NO: 1 and SEQ ID NO: 9,
and for PAw 2, SEQ ID NO: 17 and SEQ ID NO: 25. The nucleic acid
sequences coding for these aa sequences were identified by
sequencing the Fab heavy chain and light chain fragments. Due to
the degeneracy of the DNA code, the paratope is more properly
defined by the derived aa sequences depicted in FIG. 1 and, for
Anti-PAw 1, SEQ ID NO: 1 and SEQ ID NO: 9, and for Anti-PAw 2, SEQ
ID NO: 17 and SEQ ID NO: 25.
[0027] In one set of embodiments, the present invention provides
the full-length, humanized monoclonal antibody of the anti-anthrax
PAw 1 antibody, or the anti-anthrax PAw 2 antibody or other
anti-anthrax PA antibody in isolated form and in pharmaceutical
preparations. Similarly, as described herein, the present invention
provides isolated nucleic acids, host cells transformed with
nucleic acids, and pharmaceutical preparations including isolated
nucleic acids, encoding the full-length, humanized monoclonal
antibody of the anti-anthrax PAw 1 antibody, or the anti-anthrax
PAw 2 antibody or other anti-anthrax PA antibody. Finally, the
present invention provides methods, as described more fully herein,
employing these antibodies and nucleic acids in the in vitro and in
vivo diagnosis, prevention and therapy of anthrax disease.
[0028] Significantly, as is well-known in the art, only a small
portion of an antibody molecule, the paratope, is involved in the
binding of the antibody to its epitope (see, in general, Clark, W.
R. 1986 The Experimental Foundations of Modern Immunology Wiley
& Sons, Inc., New York; Roitt, I. 1991 Essential Immunology,
7th Ed., Blackwell Scientific Publications, Oxford). The pFc' and
Fc regions, for example, are effectors of the complement cascade
but are not involved in antigen binding. An antibody from which the
pFc' region has been enzymatically cleaved, or which has been
produced without the pFc' region, designated an F(ab').sub.2
fragment, retains both of the antigen binding sites of a
full-length antibody. Similarly, an antibody from which the Fc
region has been enzymatically cleaved, or which has been produced
without the Fc region, designated an Fab fragment, retains one of
the antigen binding sites of a full-length antibody molecule.
Proceeding further, Fab fragments consist of a covalently bound
antibody light chain and a portion of the antibody heavy chain
denoted Fd. The Fd fragments are the major determinant of antibody
specificity (a single Fd fragment may be associated with up to ten
different light chains without altering antibody specificity) and
Fd fragments retain epitope-binding ability in isolation.
[0029] Within the antigen-binding portion of an antibody, as is
well-known in the art, there are complementarity determining
regions (CDRs), which directly interact with the epitope of the
antigen, and framework regions (FRs), which maintain the tertiary
structure of the paratope (see, in general, Clark, 1986, supra;
Roitt, 1991, supra). In both the heavy chain Fd fragment and the
light chain of IgG immunoglobulins, there are four framework
regions (FRI through FR4) separated respectively by three
complementarity determining regions (CDR1 through CDR3). The CDRs,
and in particular the CDR3 regions, and more particularly the heavy
chain CDR3, are largely responsible for antibody specificity.
[0030] The complete amino acid sequences of the antigen-binding Fab
portion of the anti-anthrax PAw 1 monoclonal antibody as well as
the relevant FR and CDR regions are disclosed herein. SEQ ID NO: 1
discloses the amino acid sequence of the Fd fragment of
anti-anthrax PAw 1. The amino acid sequences of the heavy chain
FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions are disclosed as
SEQ ID NO: 2 through SEQ ID NO: 8, respectively. SEQ ID NO: 9
discloses the amino acid sequence of the light chain of
anti-anthrax PAw 1. The amino acid sequences of the light chain
FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions are disclosed as
SEQ ID NO: 10 through SEQ ID NO: 16, respectively.
[0031] The complete amino acid sequences of the antigen-binding Fab
portion of the anti-anthrax PAw 2 monoclonal antibody as well as
the relevant FR and CDR regions are disclosed herein. SEQ ID NO: 17
discloses the amino acid sequence of the Fd fragment of
anti-anthrax PAw 2. The amino acid sequences of the heavy chain
FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions are disclosed as
SEQ ID NO: 18 through SEQ ID NO: 24, respectively. SEQ ID NO: 25
discloses the amino acid sequence of the light chain of
anti-anthrax PAw 2. The amino acid sequences of the light chain
FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4 regions are disclosed as
SEQ ID NO: 26 through SEQ ID NO: 32, respectively.
[0032] It is now well-established in the art that the non-CDR
regions of a mammalian antibody may be replaced with similar
regions of conspecific or heterospecific antibodies while retaining
the epitopic specificity of the original antibody. This is most
clearly manifested in the development and use of "humanized"
antibodies in which non-human CDRs are covalently joined to human
FR and/or Fc/pFc' regions to produce a functional antibody. Thus,
for example, PCT International Publication Number WO 92/04381
teaches the production and use of humanized murine RSV antibodies
in which at least a portion of the murine FR regions have been
replaced by FR regions of human origin. Such antibodies, including
fragments of full-length antibodies with antigen-binding ability,
are often referred to as "chimeric" antibodies.
[0033] Thus, as will be apparent to one of ordinary skill in the
art, the present invention also provides for F(ab').sub.2, Fab, Fv
and Fd fragments of the anti-anthrax PAw 1 antibody, or the
anti-anthrax PAw 2 antibody or other anti-anthrax PA antibody;
chimeric antibodies in which the Fc and/or FR and/or CDR1 and/or
CDR2 and/or light chain CDR3 regions of the anti-anthrax PAw 1
antibody, or the anti-anthrax PAw 2 antibody or other anti-anthrax
PA antibody, have been replaced by homologous human or non-human
sequences; chimeric F(ab').sub.2 fragment antibodies in which the
FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions of the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody, have been replaced by homologous
human or non-human sequences; chimeric Fab fragment antibodies in
which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3
regions have been replaced by homologous human or non-human
sequences; and chimeric Fd fragment antibodies in which the FR
and/or CDR1 and/or CDR2 regions have been replaced by homologous
human or non-human sequences. Thus, those skilled in the art may
alter the anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2
antibody or other anti-anthrax PA antibody, by the construction of
CDR grafted or chimeric antibodies or antibody fragments containing
all, or part thereof, of the disclosed heavy and light chain
V-region CDR aa sequences (Jones, P. T. et al. 1986 Nature 321:522;
Verhoeyen, M. et al. 1988 Science 39:1534; and Tempest, P. R. et
al. 1991 Bio/Technology 9:266), without destroying the specificity
of the antibodies for the anthrax PA epitope. Such CDR grafted or
chimeric antibodies or antibody fragments can be effective in
prevention and treatment of anthrax infection in animals (e.g.
cattle) and man.
[0034] In preferred embodiments, the chimeric antibodies of the
invention are fully human or humanized chimpanzee monoclonal
antibodies including at least the heavy chain CDR3 region of the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody. As noted above, such chimeric
antibodies may be produced in which some or all of the FR regions
of the anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2
antibody or other anti-anthrax PA antibody, have been replaced by
other homologous human FR regions. In addition, the Fc portions may
be replaced so as to produce IgA or IgM as well as IgG antibodies
bearing some or all of the CDRs of the anti-anthrax PAw 1 antibody,
or the anti-anthrax PAw 2 antibody or other anti-anthrax PA
antibody. Of particular importance is the inclusion of the heavy
chain CDR3 region and, to a lesser extent, the other CDRs of the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody. Such fully human or humanized
chimpanzee monoclonal antibodies will have particular utility in
that they will not evoke an immune response against the antibody
itself.
[0035] It is also possible, in accordance with the present
invention, to produce chimeric antibodies including non-human
sequences. Thus, one may use, for example, murine, ovine, equine,
bovine or other mammalian Fc or FR sequences to replace some or all
of the Fc or FR regions of the anti-anthrax PAw 1 antibody, or the
anti-anthrax PAw 2 antibody or other anti-anthrax PA antibody. Some
of the CDRs may be replaced as well. Again, however, it is
preferred that at least the heavy chain CDR3 of the anti-anthrax
PAw 1 antibody, or the anti-anthrax PAw 2 antibody or other
anti-anthrax PA antibody, be included in such chimeric antibodies
and, to a lesser extent, it is also preferred that some or all of
the other CDRs of the anti-anthrax PAw 1 antibody, or the
anti-anthrax PAw 2 antibody or other anti-anthrax PA antibody, be
included. Such chimeric antibodies bearing non-human immunoglobulin
sequences admixed with the CDRs of the anti-anthrax PAw 1 antibody,
or the anti-anthrax PAw 2 antibody or other anti-anthrax PA
antibody, are not preferred for use in humans and are particularly
not preferred for extended use because they may evoke an immune
response against the non-human sequences. They may, of course, be
used for brief periods or in immunosuppressed individuals but,
again, fully human or humanized chimpanzee monoclonal antibodies
are preferred. Because such antibodies may be used for brief
periods or in immunosuppressed subjects, chimeric antibodies
bearing non-human mammalian Fc and FR sequences but including at
least the heavy chain CDR3 of the anti-anthrax PAw 1 antibody, or
the anti-anthrax PAw 2 antibody or other anti-anthrax PA antibody,
are contemplated as alternative embodiments of the present
invention.
[0036] For inoculation or prophylactic uses, the antibodies of the
present invention are preferably full-length antibody molecules
including the Fc region. Such full-length antibodies will have
longer half-lives than smaller fragment antibodies (e.g. Fab) and
are more suitable for intravenous, intraperitoneal, intramuscular,
intracavity, subcutaneous, or transdermal administration.
[0037] In some embodiments, Fab fragments, including chimeric Fab
fragments, are preferred. Fabs offer several advantages over
F(ab').sub.2 and whole immunoglobulin molecules for this
therapeutic modality. First, because Fabs have only one binding
site for their cognate antigen, the formation of immune complexes
is precluded whereas such complexes can be generated when bivalent
F(ab').sub.2 s and whole immunoglobulin molecules encounter their
target antigen. This is of some importance because immune complex
deposition in tissues can produce adverse inflammatory reactions.
Second, because Fabs lack an Fc region they cannot trigger adverse
inflammatory reactions that are activated by Fc, such as activation
of the complement cascade. Third, the tissue penetration of the
small Fab molecule is likely to be much better than that of the
larger whole antibody. Fourth, Fabs can be produced easily and
inexpensively in bacteria, such as E. coli, whereas whole
immunoglobulin antibody molecules require mammalian cells for their
production in useful amounts. The latter entails transfection of
immunoglobulin sequences into mammalian cells with resultant
transformation. Amplification of these sequences must then be
achieved by rigorous selective procedures and stable transformants
must be identified and maintained. The whole immunoglobulin
molecules must be produced by stably transformed, high expression
mammalian cells in culture with the attendant problems of
serum-containing culture medium. In contrast, production of Fabs in
E. coli eliminates these difficulties and makes it possible to
produce these antibody fragments in large fermenters which are less
expensive than cell culture-derived products.
[0038] In addition to Fabs, smaller antibody fragments and
epitope-binding peptides having binding specificity for the epitope
defined by the anti-anthrax PAw 1 antibody, or the anti-anthrax PAw
2 antibody or other anti-anthrax PA antibody, are also contemplated
by the present invention and can also be used to bind or neutralize
the toxin. For example, single chain antibodies can be constructed
according to the method of U.S. Pat. No. 4,946,778, to Ladner et
al. Single chain antibodies comprise the variable regions of the
light and heavy chains joined by a flexible linker moiety. Yet
smaller is the antibody fragment known as the single domain
antibody or Fd, which comprises an isolated VH single domain.
Techniques for obtaining a single domain antibody with at least
some of the binding specificity of the full-length antibody from
which they are derived are known in the art.
[0039] It is possible to determine, without undue experimentation,
if an altered or chimeric antibody has the same specificity as the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody, of the invention by ascertaining
whether the former blocks the latter from binding to anthrax PA. If
the monoclonal antibody being tested competes with the anti-anthrax
PAw 1 antibody, or the anti-anthrax PAw 2 antibody or other
anti-anthrax PA antibody, as shown by a decrease in binding of the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody, then it is likely that the two
monoclonal antibodies bind to the same, or a closely spaced,
epitope. Still another way to determine whether a monoclonal
antibody has the specificity of the anti-anthrax PAw 1 antibody, or
the anti-anthrax PAw 2 antibody or other anti-anthrax PA antibody,
of the invention is to pre-incubate the anti-anthrax PAw 1
antibody, or the anti-anthrax PAw 2 antibody or other anti-anthrax
PA antibody, with anthrax PA with which it is normally reactive,
and then add the monoclonal antibody being tested to determine if
the monoclonal antibody being tested is inhibited in its ability to
bind anthrax PA. If the monoclonal antibody being tested is
inhibited then, in all likelihood, it has the same, or a
functionally equivalent, epitope and specificity as the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody, of the invention. Screening of
monoclonal antibodies of the invention also can be carried out
utilizing anthrax toxin and determining whether the monoclonal
antibody neutralizes cytotoxicity of the anthrax toxin.
[0040] By using the antibodies of the invention, it is now possible
to produce anti-idiotypic antibodies which can be used to screen
other monoclonal antibodies to identify whether the antibody has
the same binding specificity as an antibody of the invention. In
addition, such antiidiotypic antibodies can be used for active
immunization (Herlyn, D. et al. 1986 Science 232:100). Such
anti-idiotypic antibodies can be produced using well-known
hybridoma techniques (Kohler, G. and Milstein, C. 1975 Nature
256:495). An anti-idiotypic antibody is an antibody which
recognizes unique determinants present on the monoclonal antibody
produced by the cell line of interest. These determinants are
located in the hypervariable region of the antibody. It is this
region which binds to a given epitope and, thus, is responsible for
the specificity of the antibody.
[0041] An anti-idiotypic antibody can be prepared by immunizing an
animal with the monoclonal antibody of interest. The immunized
animal will recognize and respond to the idiotypic determinants of
the immunizing antibody and produce an antibody to these idiotypic
determinants. By using the anti-idiotypic antibodies of the
immunized animal, which are specific for the monoclonal antibodies
of the invention, it is possible to identify other clones with the
same idiotype as the antibody of the hybridoma used for
immunization. Idiotypic identity between monoclonal antibodies of
two cell lines demonstrates that the two monoclonal antibodies are
the same with respect to their recognition of the same epitopic
determinant. Thus, by using anti-idiotypic antibodies, it is
possible to identify other hybridomas expressing monoclonal
antibodies having the same epitopic specificity.
[0042] It is also possible to use the anti-idiotype technology to
produce monoclonal antibodies which mimic an epitope. For example,
an anti-idiotypic monoclonal antibody made to a first monoclonal
antibody will have a binding domain in the hypervariable region
which is the image of the epitope bound by the first monoclonal
antibody. Thus, the anti-idiotypic monoclonal antibody can be used
for immunization, since the anti-idiotype monoclonal antibody
binding domain effectively acts as an antigen.
Nucleic Acids Encoding Anti-Anthrax PA Antibodies
[0043] Given the disclosure herein of the amino acid sequences of
the heavy chain Fd and light chain variable domains of the
anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody or
other anti-anthrax PA antibody, one of ordinary skill in the art is
now enabled to produce nucleic acids which encode this antibody or
which encode the various fragment antibodies or chimeric antibodies
described above. It is contemplated that such nucleic acids will be
operably joined to other nucleic acids forming a recombinant vector
for cloning or for expression of the antibodies of the invention.
The present invention includes any recombinant vector containing
the coding sequences, or part thereof, whether for prokaryotic or
eukaryotic transformation, transfection or gene therapy. Such
vectors may be prepared using conventional molecular biology
techniques, known to those with skill in the art, and would
comprise DNA coding sequences for the immunoglobulin V-regions of
the anti-anthrax PAw 1 antibody, or the anti-anthrax PAw 2 antibody
or other anti-anthrax PA antibody, including framework and CDRs or
parts thereof, and a suitable promoter either with (Whittle, N. et
al. 1987 Protein Eng. 1:499 and Burton, D. R. et al. 1994 Science
266:1024) or without (Marasco, W. A. et al. 1993 PNAS USA 90:7889
and Duan, L. et al. 1994 PNAS USA 91:5075) a signal sequence for
export or secretion. Such vectors may be transformed or transfected
into prokaryotic (Huse, W. D. et al. 1989 Science 246:1275; Ward,
S. et al. 1989 Nature 341:544; Marks, J. D. et al. 1991 J Mol Biol
222:581; and Barbas, C. F. et al. 1991 PNAS USA 88:7987) or
eukaryotic (Whittle, N. et al. 1987 Protein Eng 1:499 and Burton,
D. R. et al. 1994 Science 266:1024) cells or used for gene therapy
(Marasco, W. A. et al. 1993 PNAS USA 90:7889 and Duan, L. et al.
1994 PNAS USA 91:5075) by conventional techniques, known to those
with skill in the art.
[0044] The expression vectors of the present invention include
regulatory sequences operably joined to a nucleotide sequence
encoding one of the antibodies of the invention. As used herein,
the term "regulatory sequences" means nucleotide sequences which
are necessary for or conducive to the transcription of a nucleotide
sequence which encodes a desired polypeptide and/or which are
necessary for or conducive to the translation of the resulting
transcript into the desired polypeptide. Regulatory sequences
include, but are not limited to, 5' sequences such as operators,
promoters and ribosome binding sequences, and 3' sequences such as
polyadenylation signals. The vectors of the invention may
optionally include 5' leader or signal sequences, 5' or 3'
sequences encoding fusion products to aid in protein purification,
and various markers which aid in the identification or selection of
transformants. The choice and design of an appropriate vector is
within the ability and discretion of one of ordinary skill in the
art. The subsequent purification of the antibodies may be
accomplished by any of a variety of standard means known in the
art.
[0045] A preferred vector for screening monoclonal antibodies, but
not necessarily preferred for the mass production of the antibodies
of the invention, is a recombinant DNA molecule containing a
nucleotide sequence that codes for and is capable of expressing a
fusion polypeptide containing, in the direction of amino- to
carboxy-terminus, (1) a prokaryotic secretion signal domain, (2) a
polypeptide of the invention, and, optionally, (3) a fusion protein
domain. The vector includes DNA regulatory sequences for expressing
the fusion polypeptide, preferably prokaryotic, regulatory
sequences. Such vectors can be constructed by those with skill in
the art and have been described by Smith, G. P. et al. (1985
Science 228:1315; Clackson, T. et al. 1991 Nature 352:624; Kang et
al. 1991 in: Methods: A Companion to Methods in Enzymology: Vol. 2,
R. A. Lerner and D. R. Burton, eds. Academic Press, NY, pp 111-118;
Barbas, C. F. et al. 1991 PNAS USA 88:7978; Roberts, B. L. et al.
1992 PNAS USA 89:2429).
[0046] A fusion polypeptide may be useful for purification of the
antibodies of the invention. The fusion domain may, for example,
include a poly-His tail which allows for purification on Ni+
columns or the maltose binding protein of the commercially
available vector pMAL (New England BioLabs, Beverly, Mass.). A
currently preferred, but by no means necessary, fusion domain is a
filamentous phage membrane anchor. This domain is particularly
useful for screening phage display libraries of monoclonal
antibodies but may be of less utility for the mass production of
antibodies. The filamentous phage membrane anchor is preferably a
domain of the cpIII or cpVIII coat protein capable of associating
with the matrix of a filamentous phage particle, thereby
incorporating the fusion polypeptide onto the phage surface, to
enable solid phase binding to specific antigens or epitopes and
thereby allow enrichment and selection of the specific antibodies
or fragments encoded by the phagemid vector.
[0047] The secretion signal is a leader peptide domain of a protein
that targets the protein to the membrane of the host cell, such as
the periplasmic membrane of Gram-negative bacteria. A preferred
secretion signal for E. coli is a pelB secretion signal. The leader
sequence of the pelB protein has previously been used as a
secretion signal for fusion proteins (Better, M. et al. 1988
Science 240:1041; Sastry, L. et al. 1989 PNAS USA 86:5728; and
Mullinax, R. L. et al., 1990 PNAS USA 87:8095). Amino acid residue
sequences for other secretion signal polypeptide domains from E.
coli useful in this invention can be found in Neidhard, F. C.
(ed.), 1987 Escherichia coli and Salmonella Typhimurium:
Typhimurium Cellular and Molecular Biology, American Society for
Microbiology, Washington, D.C.
[0048] To achieve high levels of gene expression in E. coli, it is
necessary to use not only strong promoters to generate large
quantities of mRNA, but also ribosome binding sites to ensure that
the mRNA is efficiently translated. In E. coli, the ribosome
binding site includes an initiation codon (AUG) and a sequence 3-9
nucleotides long located 3-11 nucleotides upstream from the
initiation codon (Shine et al. 1975 Nature 254:34). The sequence,
which is called the Shine-Dalgarno (SD) sequence, is complementary
to the 3' end of E. coli 16S rRNA. Binding of the ribosome to mRNA
and the sequence at the 3' end of the mRNA can be affected by
several factors: the degree of complementarity between the SD
sequence and 3' end of the 16S rRNA; the spacing lying between the
SD sequence and the AUG; and the nucleotide sequence following the
AUG, which affects ribosome binding. The 3' regulatory sequences
define at least one termination (stop) codon in frame with and
operably joined to the heterologous fusion polypeptide.
[0049] In preferred embodiments with a prokaryotic expression host,
the vector utilized includes a prokaryotic origin of replication or
replicon, i.e., a DNA sequence having the ability to direct
autonomous replication and maintenance of the recombinant DNA
molecule extrachromosomally in a prokaryotic host cell, such as a
bacterial host cell, transformed therewith. Such origins of
replication are well known in the art. Preferred origins of
replication are those that are efficient in the host organism. A
preferred host cell is E. coli. For use of a vector in E. coli, a
preferred origin of replication is ColEI found in pBR322 and a
variety of other common plasmids. Also preferred is the p15A origin
of replication found on pACYC and its derivatives. The ColEI and
p15A replicons have been extensively utilized in molecular biology,
are available on a variety of plasmids and are described by
Sambrook. et al. 1989 Molecular Cloning: A Laboratory Manual, 2nd
edition, Cold Spring Harbor Laboratory Press.
[0050] In addition, those embodiments that include a prokaryotic
replicon preferably also include a gene whose expression confers a
selective advantage, such as drug resistance, to a bacterial host
transformed therewith. Typical bacterial drug resistance genes are
those that confer resistance to ampicillin, tetracycline,
neomycin/kanamycin or chloramphenicol. Vectors typically also
contain convenient restriction sites for insertion of translatable
DNA sequences. Exemplary vectors are the plasmids pUC18 and pUC19
and derived vectors such as those commercially available from
suppliers such as Invitrogen, (San Diego, Calif.).
[0051] When the antibodies of the invention include both heavy
chain and light chain sequences, these sequences may be encoded on
separate vectors or, more conveniently, may be expressed by a
single vector. The heavy and light chain may, after translation or
after secretion, form the heterodimeric structure of natural
antibody molecules. Such a heterodimeric antibody may or may not be
stabilized by disulfide bonds between the heavy and light
chains.
[0052] A vector for expression of heterodimeric antibodies, such as
the full-length antibodies of the invention or the F(ab').sub.2,
Fab or Fv fragment antibodies of the invention, is a recombinant
DNA molecule adapted for receiving and expressing translatable
first and second DNA sequences. That is, a DNA expression vector
for expressing a heterodimeric antibody provides a system for
independently cloning (inserting) the two translatable DNA
sequences into two separate cassettes present in the vector, to
form two separate cistrons for expressing the first and second
polypeptides of a heterodimeric antibody. The DNA expression vector
for expressing two cistrons is referred to as a di-cistronic
expression vector.
[0053] Preferably, the vector comprises a first cassette that
includes upstream and downstream DNA regulatory sequences operably
joined via a sequence of nucleotides adapted for directional
ligation to an insert DNA. The upstream translatable sequence
preferably encodes the secretion signal as described above. The
cassette includes DNA regulatory sequences for expressing the first
antibody polypeptide that is produced when an insert translatable
DNA sequence (insert DNA) is directionally inserted into the
cassette via the sequence of nucleotides adapted for directional
ligation.
[0054] The dicistronic expression vector also contains a second
cassette for expressing the second antibody polypeptide. The second
cassette includes a second translatable DNA sequence that
preferably encodes a secretion signal, as described above, operably
joined at its 3' terminus via a sequence of nucleotides adapted for
directional ligation to a downstream DNA sequence of the vector
that typically defines at least one stop codon in the reading frame
of the cassette. The second translatable DNA sequence is operably
joined at its 5' terminus to DNA regulatory sequences forming the
5' elements. The second cassette is capable, upon insertion of a
translatable DNA sequence (insert DNA), of expressing the second
fusion polypeptide comprising a secretion signal with a polypeptide
coded by the insert DNA.
[0055] The antibodies of the present invention may additionally, of
course, be produced by eukaryotic cells such as CHO cells, human or
mouse hybridomas, immortalized B-lymphoblastoid cells, and the
like. In this case, a vector is constructed in which eukaryotic
regulatory sequences are operably joined to the nucleotide
sequences encoding the antibody polypeptide or polypeptides. The
design and selection of an appropriate eukaryotic vector is within
the ability and discretion of one of ordinary skill in the art. The
subsequent purification of the antibodies may be accomplished by
any of a variety of standard means known in the art.
[0056] The antibodies of the present invention may furthermore, of
course, be produced in plants. In 1989, Hiatt et al. (1989 Nature
342:76) first demonstrated that functional antibodies could be
produced in transgenic plants. Since then, a considerable amount of
effort has been invested in developing plants for antibody (or
"plantibody") production (for reviews see Giddings G. et al. 2000
Nat Biotechnol 18:1151; Fischer R. and Emans N. 2000 Transgenic Res
9:279). Recombinant antibodies can be targeted to seeds, tubers, or
fruits, making administration of antibodies in such plant tissues
advantageous for immunization programs in developing countries and
worldwide.
[0057] In another embodiment, the present invention provides host
cells, both prokaryotic and eukaryotic, transformed or transfected
with, and therefore including, the vectors of the present
invention.
Diagnostic and Pharmaceutical Anti-Anthrax PA Antibody
Preparations
[0058] The invention also relates to a method for preparing
diagnostic or pharmaceutical compositions comprising the monoclonal
antibodies of the invention or polynucleotide sequences encoding
the antibodies of the invention or part thereof, the pharmaceutical
compositions being used for immunoprophylaxis or immunotherapy of
anthrax disease. The pharmaceutical preparation includes a
pharmaceutically acceptable carrier. Such carriers, as used herein,
means a non-toxic material that does not interfere with the
effectiveness of the biological activity of the active ingredients.
The term "physiologically acceptable" refers to a non-toxic
material that is compatible with a biological system such as a
cell, cell culture, tissue, or organism. The characteristics of the
carrier will depend on the route of administration. Physiologically
and pharmaceutically acceptable carriers include diluents, fillers,
salts, buffers, stabilizers, solubilizers, and other materials
which are well known in the art.
[0059] A preferred embodiment of the invention relates to
monoclonal antibodies whose heavy chains comprise in CDR3 the
polypeptide having SEQ ID NO: 7, and/or whose light chains comprise
in CDR3 the polypeptide having SEQ ID NO: 15; whose heavy chains
comprise in CDR3 the polypeptide having SEQ ID NO: 23, and/or whose
light chains comprise in CDR3 the polypeptide having SEQ ID NO: 31;
and conservative variations of these peptides. Also encompassed by
the present invention are certain amino acid sequences that bind to
epitopic sequences in domain 4 of anthrax PA corresponding to aa
614-735 and that confer neutralization of anthrax toxin when bound
thereto. The term "conservative variation" as used herein denotes
the replacement of an amino acid residue by another, biologically
similar residue. Examples of conservative variations include the
substitution of one hydrophobic residue such as isoleucine, valine,
leucine or methionine for another, or the substitution of one polar
residue for another, such as the substitution of arginine for
lysine, glutamic for aspartic acids, or glutamine for asparagine,
and the like. The term "conservative variation" also includes the
use of a substituted amino acid in place of an unsubstituted parent
amino acid provided that antibodies having the substituted
polypeptide also bind or neutralize anthrax PA. Analogously,
another preferred embodiment of the invention relates to
polynucleotides which encode the above noted heavy chain
polypeptides and to polynucleotide sequences which are
complementary to these polynucleotide sequences. Complementary
polynucleotide sequences include those sequences that hybridize to
the polynucleotide sequences of the invention under stringent
hybridization conditions.
[0060] The anti-anthrax PA antibodies of the invention may be
labeled by a variety of means for use in diagnostic and/or
pharmaceutical applications. There are many different labels and
methods of labeling known to those of ordinary skill in the art.
Examples of the types of labels which can be used in the present
invention include enzymes, radioisotopes, fluorescent compounds,
colloidal metals, chemiluminescent compounds, and bioluminescent
compounds. Those of ordinary skill in the art will know of other
suitable labels for binding to the monoclonal antibodies of the
invention, or will be able to ascertain such, using routine
experimentation. Furthermore, the binding of these labels to the
monoclonal antibodies of the invention can be done using standard
techniques common to those of ordinary skill in the art.
[0061] Another labeling technique which may result in greater
sensitivity consists of coupling the antibodies to low molecular
weight haptens. These haptens can then be specifically altered by
means of a second reaction. For example, it is common to use
haptens such as biotin, which reacts with avidin, or dinitrophenol,
pyridoxal, or fluorescein, which can react with specific antihapten
antibodies.
[0062] The materials for use in the assay of the invention are
ideally suited for the preparation of a kit. Such a kit may
comprise a carrier means being compartmentalized to receive in
close confinement one or more container means such as vials, tubes,
and the like, each of the container means comprising one of the
separate elements to be used in the method. For example, one of the
container means may comprise a monoclonal antibody of the invention
that is, or can be, detectably labeled. The kit may also have
containers containing buffer(s) and/or a container comprising a
reporter-means, such as a biotin-binding protein, such as avidin or
streptavidin, bound to a reporter molecule, such as an enzymatic or
fluorescent label.
In Vitro Detection and Diagnostics
[0063] The monoclonal antibodies of the invention are suited for in
vitro use, for example, in immunoassays in which they can be
utilized in liquid phase or bound to a solid phase carrier. In
addition, the monoclonal antibodies in these immunoassays can be
detectably labeled in various ways. Examples of types of
immunoassays which can utilize the monoclonal antibodies of the
invention are competitive and non-competitive immunoassays in
either a direct or indirect format. Examples of such immunoassays
are the radioimmunoassay (MA) and the sandwich (immunometric)
assay. Detection of antigens using the monoclonal antibodies of the
invention can be done utilizing immunoassays which are run in
either the forward, reverse, or simultaneous modes, including
immunohistochemical assays on physiological samples. Those of skill
in the art will know, or can readily discern, other immunoassay
formats without undue experimentation.
[0064] The monoclonal antibodies of the invention can be bound to
many different carriers and used to detect the presence of anthrax
PA. Examples of well-known carriers include glass, polystyrene,
polypropylene, polyethylene, dextran, nylon, amylase, natural and
modified cellulose, polyacrylamide, agarose and magnetite. The
nature of the carrier can be either soluble or insoluble for
purposes of the invention. Those skilled in the art will know of
other suitable carriers for binding monoclonal antibodies, or will
be able to ascertain such, using routine experimentation.
[0065] For purposes of the invention, anthrax PA may be detected by
the monoclonal antibodies of the invention when present in
biological fluids and tissues. Any sample containing a detectable
amount of anthrax PA can be used. A sample can be a liquid such as
urine, saliva, cerebrospinal fluid, blood, serum or the like; a
solid or semi-solid such as tissues, feces, or the like; or,
alternatively, a solid tissue such as those commonly used in
histological diagnosis.
In Vivo Detection of Anthrax PA
[0066] In using the monoclonal antibodies of the invention for the
in vivo detection of antigen, the detectably labeled monoclonal
antibody is given in a dose which is diagnostically effective. The
term "diagnostically effective" means that the amount of detectably
labeled monoclonal antibody is administered in sufficient quantity
to enable detection of the site having the anthrax PA antigen for
which the monoclonal antibodies are specific.
[0067] The concentration of detectably labeled monoclonal antibody
which is administered should be sufficient such that the binding to
anthrax PA is detectable compared to the background. Further, it is
desirable that the detectably labeled monoclonal antibody be
rapidly cleared from the circulatory system in order to give the
best target-to-background signal ratio.
[0068] As a rule, the dosage of detectably labeled monoclonal
antibody for in vivo diagnosis will vary depending on such factors
as age, sex, and extent of disease of the individual. The dosage of
monoclonal antibody can vary from about 0.01 mg/kg to about 50
mg/kg, preferably 0.1 mg/kg to about 20 mg/kg, most preferably
about 0.1 mg/kg to about 2 mg/kg. Such dosages may vary, for
example, depending on whether multiple injections are given, on the
tissue being assayed, and other factors known to those of skill in
the art.
[0069] For in vivo diagnostic imaging, the type of detection
instrument available is a major factor in selecting an appropriate
radioisotope. The radioisotope chosen must have a type of decay
which is detectable for the given type of instrument. Still another
important factor in selecting a radioisotope for in vivo diagnosis
is that the half-life of the radioisotope be long enough such that
it is still detectable at the time of maximum uptake by the target,
but short enough such that deleterious radiation with respect to
the host is acceptable. Ideally, a radioisotope used for in vivo
imaging will lack a particle emission but produce a large number of
photons in the 140-250 keV range, which may be readily detected by
conventional gamma cameras.
[0070] For in vivo diagnosis, radioisotopes may be bound to
immunoglobulin either directly or indirectly by using an
intermediate functional group. Intermediate functional groups which
often are used to bind radioisotopes which exist as metallic ions
are the bifunctional chelating agents such as
diethylenetriaminepentacetic acid (DTPA) and
ethylenediaminetetra-acetic acid (EDTA) and similar molecules.
Typical examples of metallic ions which can be bound to the
monoclonal antibodies of the invention are .sup.111In, .sup.97Ru,
.sup.67Ga, .sup.68Ga, .sup.72As, .sup.89Zr and .sup.201Tl.
[0071] The monoclonal antibodies of the invention can also be
labeled with a paramagnetic isotope for purposes of in vivo
diagnosis, as in magnetic resonance imaging (MM) or electron spin
resonance (ESR). In general, any conventional method for
visualizing diagnostic imaging can be utilized. Usually gamma and
positron emitting radioisotopes are used for camera imaging and
paramagnetic isotopes for MRI. Elements which are particularly
useful in such techniques include .sup.157Gd, .sup.55Mn,
.sup.162Dy, .sup.52Cr and .sup.56Fe.
[0072] The monoclonal antibodies of the invention can be used in
vitro and in vivo to monitor the course of anthrax disease therapy.
Thus, for example, by measuring the increase or decrease in the
number of cells infected with anthrax or changes in the
concentration of anthrax PA present in the body or in various body
fluids, it would be possible to determine whether a particular
therapeutic regimen aimed at ameliorating anthrax disease is
effective.
Prophylaxis and Therapy of Anthrax Disease
[0073] The monoclonal antibodies can also be used in prophylaxis
and as therapy for anthrax disease in humans. The terms,
"prophylaxis" and "therapy" as used herein in conjunction with the
monoclonal antibodies of the invention denote both prophylactic as
well as therapeutic administration and both passive immunization
with substantially purified polypeptide products, as well as gene
therapy by transfer of polynucleotide sequences encoding the
product or part thereof. Thus, the monoclonal antibodies can be
administered to high-risk subjects in order to lessen the
likelihood and/or severity of anthrax disease or administered to
subjects already evidencing active anthrax infection. In the
present invention, Fab fragments also bind or neutralize anthrax PA
and therefore may be used to treat anthrax infection but
full-length antibody molecules are otherwise preferred.
[0074] As used herein, a "prophylactically effective amount" of the
monoclonal antibodies of the invention is a dosage large enough to
produce the desired effect in the protection of individuals against
anthrax infection for a reasonable period of time, such as one to
two months or longer following administration. A prophylactically
effective amount is not, however, a dosage so large as to cause
adverse side effects, such as hyperviscosity syndromes, pulmonary
edema, congestive heart failure, and the like. Generally, a
prophylactically effective amount may vary with the subject's age,
condition, and sex, as well as the extent of the disease in the
subject and can be determined by one of skill in the art. The
dosage of the prophylactically effective amount may be adjusted by
the individual physician or veterinarian in the event of any
complication. A prophylactically effective amount may vary from
about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg
to about 20 mg/kg, most preferably from about 0.2 mg/kg to about 2
mg/kg, in one or more administrations (priming and boosting).
[0075] As used herein, a "therapeutically effective amount" of the
monoclonal antibodies of the invention is a dosage large enough to
produce the desired effect in which the symptoms of anthrax disease
are ameliorated or the likelihood of infection is decreased. A
therapeutically effective amount is not, however, a dosage so large
as to cause adverse side effects, such as hyperviscosity syndromes,
pulmonary edema, congestive heart failure, and the like. Generally,
a therapeutically effective amount may vary with the subject's age,
condition, and sex, as well as the extent of the disease in the
subject and can be determined by one of skill in the art. The
dosage of the therapeutically effective amount may be adjusted by
the individual physician or veterinarian in the event of any
complication. A therapeutically effective amount may vary from
about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg
to about 20 mg/kg, most preferably from about 0.2 mg/kg to about 2
mg/kg, in one or more dose administrations daily, for one or
several days. Preferred is administration of the antibody for 2 to
5 or more consecutive days in order to avoid "rebound" of bacterial
replication from occurring.
[0076] The monoclonal antibodies of the invention can be
administered by injection or by gradual infusion over time. The
administration of the monoclonal antibodies of the invention may,
for example, be intravenous, intraperitoneal, intramuscular,
intracavity, subcutaneous, or transdermal. Techniques for preparing
injectate or infusate delivery systems containing antibodies are
well known to those of skill in the art. Generally, such systems
should utilize components which will not significantly impair the
biological properties of the antibodies, such as the paratope
binding capacity (see, for example, Remington's Pharmaceutical
Sciences, 18th edition, 1990, Mack Publishing). Those of skill in
the art can readily determine the various parameters and conditions
for producing antibody injectates or infusates without resort to
undue experimentation.
[0077] Preparations for parenteral administration include sterile
aqueous or non-aqueous solutions, suspensions, and emulsions.
Examples of non-aqueous solvents are propylene glycol, polyethylene
glycol, vegetable oils such as olive oil, and injectable organic
esters such as ethyl oleate. Aqueous carriers include water,
alcoholic/aqueous solutions, emulsions or suspensions, including
saline and buffered media. Parenteral vehicles include sodium
chloride solution, Ringer's dextrose, dextrose and sodium chloride,
lactated Ringer's or fixed oils. Intravenous vehicles include fluid
and nutrient replenishers, electrolyte replenishers (such as those
based on Ringer's dextrose), and the like. Preservatives and other
additives may also be present such as, for example, antimicrobials,
anti-oxidants, chelating agents, and the like.
Efficient Neutralization of Anthrax Toxin by Chimpanzee Monoclonal
Antibodies Against Protective Antigen
[0078] Four single-chain Fv (scFvs) against protective antigen (PA)
and two against lethal factor (LF) of anthrax were isolated from a
phage display library generated from immunized chimpanzees. Only
two scFvs recognizing PA (W1 and W2) neutralized the cytotoxicity
of lethal toxin in a macrophage lysis assay. Full-length IgGs of W1
and W2 efficiently protected rats from toxin challenge. The epitope
recognized by W1 and W2 was conformational and formed by C-terminal
amino acids 614-735 of PA. W1 and W2 each bound to PA with a
K.sub.d of 4-5.times.10.sup.11M, which is 20-100 fold higher
affinity than that for the interaction of receptor and PA. W1 and
W2 inhibited the binding of PA to the receptor, indicating that
this was the mechanism of protection. These data indicate that the
W1 and W2 chimpanzee MAbs are predicted to serve as PA
entry-inhibitors for use in the emergency prophylaxis and treatment
of anthrax.
Introduction
[0079] Anthrax has emerged as a serious bioterrorist threat.
Inhalational anthrax is usually fatal if treatment is delayed
(Jernigan J. A. et al. 2001 Emerg Infect Dis 7:933-44). The
lethality of anthrax is primarily due to the effects of anthrax
toxin, which has three components; a nontoxic, receptor-binding
protein, protective antigen (PA), and two toxic, catalytic
proteins, lethal factor (LF) and edema factor (EF). The entry of
the toxins into the cell is initiated by rapid binding of the 83
kDa PA to the cellular receptor whereupon the bound PA is cleaved
by a furin-like protease into an N-terminal 20 kDa protein, PA20,
and a C-terminal 63 kDa protein, PA63 (Collier R. J. & Young J.
A. 2003 Annu Rev Cell Dev Biol 19:45-70). The PA63 spontaneously
oligomerizes into an antigenically distinct heptameric ring that
can no longer be displaced from the cellular receptor. The heptamer
binds up to three molecules of LF or EF. The resulting complexes
enter the cell by endocytosis and a conformational change induced
by low pH results in the release of bound LF and EF into the
cytosol. Several steps in this process could be targets for
antibodies; for example, antibodies to PA might block receptor
binding, oligomerization, or binding of LF and EF, and antibodies
to LF and EF might prevent their binding to PA.
[0080] Passive immunization with polyclonal antibodies protects
laboratory animals from effects of anthrax toxins (Little S. F. et
al. 1997 Infect Immun 65:5171-5; Kobiler D. et al. 2002 Infect
Immun 70:544-60). Passive immunization of humans with anthrax
neutralizing antibodies may provide an effective treatment when
vaccination against anthrax is not practical or antibiotic
treatment is not effective. Antibody therapy in conjunction with
antibiotics would also be useful when the accumulated level of
toxin would be detrimental even if further bacterial growth was
inhibited. Recently, several recombinant monoclonal antibodies
against PA were shown to protect animals from challenge with
anthrax toxin (Maynard J. A. et al. 2002 Nat Biotechnol 20:597-601;
Wild M. A. et al. 2003 Nat Biotechnol 21:1305-6; Sawada-Hirai R. et
al. 2004 J Immune Based Ther Vaccines 2:5). Since chimpanzee
immunoglobulins are virtually identical to those of humans
(Schofield D. J. et al. 2002 Virology 292:127-36; Ehrlich P. H. et
al. 1988 Clin Chem 34:1681-8; Ehrlich P. H. et al. 1990 Hum
Antibodies Hybridomas 1:23-6), high-affinity chimpanzee antibodies
that neutralize anthrax toxins should have therapeutic value
comparable to that of human antibodies. Here, we report the
identification and characterization of potent neutralizing
chimpanzee monoclonal antibodies against PA.
Materials and Methods
[0081] Reagents.
[0082] Recombinant PA, PA63, LF and EF were obtained from List
Biologicals (Campbell, Calif.) or made in our laboratory. Enzymes
used in molecular cloning were purchased from New England BioLabs
(Beverly, Mass.). Oligonucleotides were synthesized by Invitrogen
(Carlsbad, Calif.). Anti-His horseradish peroxidase (HRP)
conjugate, anti-human Fab HRP conjugate and anti-human Fc agarose
were purchased from Sigma (St. Louis, Mo.). Nickel-agarose beads
were from Invitrogen.
[0083] Animals.
[0084] Chimpanzees 1603 and 1609 were immunized three times, two
weeks apart, with 50 .mu.g each of recombinant PA, LF and EF with
alum adjuvant. Bone marrow was aspirated from the iliac crest of
these animals eight weeks after the last immunization. Fischer 344
rats were purchased from Taconic Farms (Germantown, N.Y.). All
animal experiments were performed under protocols approved by the
NIAID Animal Care and Use Committee.
[0085] Library Construction and Selection.
[0086] Lymphocytes from the bone marrow aspirate were isolated on a
Ficoll gradient. mRNA was extracted from 10.sup.8 lymphocytes with
an mRNA purification kit (Amersham Biosciences, Piscataway, N.J.).
cDNA was synthesized with a first-strand cDNA synthesis kit from
Amersham Biosciences. The VH and V.kappa. genes were amplified by
PCR with 30 cycles of 95.degree. C., 1 min, 58.degree. C., 1 min,
and 72.degree. C. 1 min, using a mixture of primers for human
V-genes described earlier (Sblattero D. & Bradbury A. A. 1998
Immunotechnology 3:271-8). The single-chain variable Fragment
(scFv) was assembled from VH and V.kappa. via splicing by overlap
extension PCR (SOE-PCR). The gel-purified scFv DNA was digested
with SfiI and cloned into a pAK100 vector that also had been cut
with SfiI (Krebber A. et al. 1997 J Immunol Methods 201:35-55).
[0087] The recombinant plasmids were transformed into E. coli
XL1-blue (Stratagene, La Jolla, Calif.) by electroporation,
resulting in a library of 5.times.10.sup.7 individual clones. The
phagemid production, panning and screening were essentially the
same as described by Krebber et al. 1997 (Krebber A. et al. 1997 J
Immunol Methods 201:35-55). In brief, the phagemids were rescued by
superinfection with helper phage, VCS M13 (Stratagene), and
subjected to panning on PA, LF and EF proteins coated on ELISA
wells. Nonspecifically-adsorbed phages were removed by extensive
washing. Specifically bound phages were eluted with 100 mM
triethylamine, neutralized in pH, and amplified. After three rounds
of panning, randomly picked single phage-scFv clones were screened
for specific binding by phage ELISA (Harrison J. L. et al. 1996
Methods Enzymol 267:83-109). Clones that differentially bound to
specific antigens with A.sub.450 values of >1.0 were scored as
positive, whereas values of <0.2 were scored as negative. For
clones that bound specifically to PA, LF or EF, the variable region
of heavy (VH) and light (VL) chain genes were sequenced, and their
corresponding amino acid sequences were aligned.
[0088] Conversion of scFv to Fab and to Full-Length IgG.
[0089] To convert scFv to Fab, eight primers were designed as
follows:
TABLE-US-00004 Fab H-5': (SEQ ID NO: 41)
ACCGTCTCCTCAGCCTCCACCAAGGGCCCATCGGT; Fab H-3': (SEQ ID NO: 42)
AATGAGATCTGCGGCCGCTTAAATTAATTAAT; Fab L-5': (SEQ ID NO: 43)
GTGGAAATCAAACGAACTGTGGCTGCACCATCTGT; Fab L-3': (SEQ ID NO: 44)
AGGTATTTCATTTTAAATTCCTCCT; PA H-5': (SEQ ID NO: 45)
GAGGTGCAGCTGCTCGAGACTGGAGGAGGCTT; PA H-3': (SEQ ID NO: 46)
CTTGGTGGAGGCTGAGGAGACGGTGACCGTGGTCCCT; PA L-5': (SEQ ID NO: 47)
TGGAGGTGGATCCGAGCTCGTAATGACGCAGTCT; PA L-3': (SEQ ID NO: 48)
AGCCACAGTTCGTTTGATTTCCACCTTGGTCCCAGG.
[0090] First-strand cDNA of CH1 and C.kappa. gene fragments were
synthesized from human spleen cell total RNA (BD Biosciences,
Mountain View, Calif.) and amplified by PCR with primers of Fab
H-5'/-3' and Fab L-5'/-3', respectively. The VH and V.kappa. gene
fragments were amplified by PCR using anti-PA scFv DNA as a
template and PA H-5'/-3' and PA L-5'/-3' as primers. The Fd
(VH-CH1) and .kappa.-chain segments (V.kappa.-C.kappa.) were
produced through SOE-PCR of VH/CH1 and V.kappa./C.kappa., with PA
H-5'/Fab H-3' and PA L-5'/Fab L-3' as primers. The Fd region was
digested with XhoI and NotI and the .kappa.-chain region with XbaI
and SacI. The digested DNA fragments were cloned into pComb3H at
the matching restriction sites (Glamann J. et al. 1998 J Virol
72:585-92).
[0091] The Fab was converted to full-length IgG by digestion of Fd
with XhoI and ApaI and cloning into a pCDHC68b vector (Trill J. J.
et al. 1995 Curr Opin Biotechnol 6:553-60) that contains human
heavy chain constant region to yield plasmid pPAH. The
.kappa.-chain was digested with XbaI and SacI and cloned into a
pCNHLC vector (Trill J. J. et al. 1995 Curr Opin Biotechnol
6:553-60) to yield plasmid pPAK.
[0092] Expression and Purification of scFv, Fab and IgG.
[0093] Both scFv and Fab were expressed in E. coli. Briefly,
bacteria were cultured in 2.times.YT medium containing 2% glucose
and appropriate antibiotics at 30.degree. C. until the OD.sub.600
was 0.5-1. The culture was diluted 5-fold in 2.times.YT without
glucose and containing 0.2 mM IPTG and incubated at 27.degree. C.
for 20 h. The expressed proteins were purified by chromatography on
nickel-charged affinity resins (Invitrogen).
[0094] Full-length IgG plasmids pPAH and pPAK that contained
heavy-chain and light chain of anti-anthrax toxin components were
co-transfected into 293T cells for transient expression. The IgG
was purified by affinity chromatography on anti-human Fc agarose
(Sigma).
[0095] The purity of each antibody was determined by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Novex,
Invitrogen) and the protein concentration was determined by BCA
assay (Pierce Biotechnology, Rockford, Ill.) and ELISA with a
purified human IgG (Jackson ImmunoResearch, West Grove, Pa.) as a
standard.
[0096] ELISA Assay.
[0097] PA, LF and unrelated proteins (BSA, thyroglobulin, lysozyme,
phosphorylase b) were coated onto a 96-well plate by placing 100
.mu.l of protein at 5 .mu.g/ml in carbonate buffer, pH 9.5, in each
well and incubating the plate at room temperature overnight. Serial
dilutions of soluble scFv, Fab, IgG or phage were added to the
wells and plates were incubated for 2 h at room temperature (RT).
The plates were washed and the secondary antibody conjugate
(anti-His-HRP, anti-human Fab-HRP, or anti-M13-HRP) was added and
incubated for 1 h at RT. The plates were washed and the color was
developed by adding tetramethylbenzidine solution (TMB) (Sigma).
The plates were read at OD.sub.450 in an ELISA plate reader.
[0098] Competitive ELISA. Recombinant PA at a concentration of 5
.mu.g/ml in carbonate buffer, pH 9.5, was coated onto the wells of
an ELISA plate. Wells were then incubated at room temperature with
anti-PA W2 Fab at different concentrations for 1 h. Anti-PA W2 Fab
was removed from the wells and mouse anti-PA MAbs 14B7 and 2D3
(Little S. F. et al. 1996 Microbiology 142 (Pt 3):707-15)
respectively were added to the wells at 0.5 .mu.g/ml. Plates were
incubated for 1 h, washed and bound MAbs were detected by the
addition of HRP-conjugated anti-mouse antibody followed by TMB
substrate. The binding to PA by 14B7 and 2D3 was calculated by
dividing the OD value in the absence of W2 with that in the
presence of W2. Competition between W1 Fab vs. W2 IgG or W2 Fab vs.
W1 IgG was tested as described above except that HRP-conjugated
anti-human Fc was used as the secondary antibody.
[0099] Affinity Measurement.
[0100] Surface plasmon resonance (SPR) biosensor experiments were
conducted with a Biacore 3000 instrument (Biacore, Piscataway,
N.J.) using short carboxy-methylated dextran sensor surfaces (CM3,
Biacore) and standard amine coupling as described in detail
elsewhere (Schuck P. et al. In: Current Protocols in Protein
Science Vol. 2., Coligan J E, Dunn B M, Ploegh H L, Speicher D W
and Wingfield P T, eds. New York: John Wiley & Sons,
1999:20.2.1-20.2.21).
[0101] Experiments were conducted in two configurations: First,
antibodies were immobilized to the surface and the kinetics of
binding and dissociation of PA were recorded for 10 min and 2 h,
respectively, at PA concentrations of 1, 10, 100, and 1,000 nM. In
order to eliminate the effect of immobilization-induced surface
site heterogeneity and mass transport limitation in the
determination of the binding constants (Schuck P. 1997 Ann Rev
Biophys Biomol Struct 26:541-566), the kinetic traces were globally
fitted with a model for continuous ligand distributions (Svitel J.
et al. 2003 Biophys J 84:4062-4077) combined with two-compartment
approximation of mass transport. Second, solution competition
experiments were conducted, in which soluble Fab at different
concentrations was pre-incubated with PA for 24 h, and the
concentration of unbound PA was determined from the initial slope
of surface binding when passing the mixture over the
antibody-functionalized surface. Standard competition isotherms
were used for the analysis (Schuck P. et al. In: Current Protocols
in Protein Science Vol. 2., Coligan J E, Dunn B M, Ploegh H L,
Speicher D W and Wingfield PT, eds. New York: John Wiley &
Sons, 1999:20.2.1-20.2.21; Schuck P. 1997 Ann Rev Biophys Biomol
Struct 26:541-566).
[0102] Epitope Mapping.
[0103] A series of PA fragments differing in size were amplified
from a PA-encoding vector pPA26 (Welkos S. L. et al. 1988 Gene
69:287-300; GenBank Accession No.: M22589) by PCR as described
elsewhere (Schofield D. J. et al. 2003 Vaccine 22:257-67) and
inserted into pGEM-T vectors (Promega, Madison, Wis.).
.sup.35S-methionine (Amersham Biosciences) labeled PA peptides were
prepared with the TNT T7/SP6 coupled in vitro
transcription/translation system (Promega). A
radioimmunoprecipitation assay (RIPA) was performed essentially as
described previously (Schofield D. J. et al. 2003 Vaccine
22:257-67). Briefly, a mixture of a .sup.35S-labeled peptide and
anti-PA W2 was incubated at 4.degree. C. overnight and immune
complexes were collected with protein G-coupled agarose beads
(Amersham Biosciences). The precipitated complex was washed and
subjected to SDS-PAGE. The PA peptide was detected by exposing the
dried gel to X-ray film.
[0104] PA Binding Assays.
[0105] RAW264.7 cells (Varughese M. et al. 1998 Mol Med 4:87-95)
were grown in 6-well plates to 90% confluence. Ten microliters of
PA (10 .mu.g/ml) was mixed with neutralizing antibody 14B7 (Little
S. F. et al. 1988 Infect Immun 56:1807-13) or with W2 at 1:1 or
1:10 (PA: MAb) molar ratios in a 200 .mu.l final volume and
incubated for 5 min or 15 min. PBS was mixed with PA in control
samples. The mixture was added to the cells and incubated for 20
min at 37.degree. C. Medium was removed and cells were washed 5
times with ice-cold PBS followed by lysis in RIPA buffer (1%
Nonidet, 0.5% sodium deoxycholate, 0.1% SDS in PBS) plus EDTA-free
COMPLETE protease inhibitor cocktail (Roche Applied Science,
Indianapolis, Ind.). Equal amounts of protein (BCA assay (Pierce
Biotechnology)) were loaded onto SDS-PAGE gels. Western Blot
analysis was performed using anti-PA polyclonal antibody 5308
(1:3500) developed in our laboratory and HRP-conjugated
goat-anti-rabbit IgG secondary antibody (Santa Cruz Biotech, Santa
Cruz, Calif.) at 1:2000 dilution.
[0106] In Vitro Neutralization Assay.
[0107] An established RAW264.7 cells-based assay was used to
determine the antibody in vitro neutralization activity (Varughese
M. et al. 1998 Mol Med 4:87-95; Pitt M. L. et al. 2001 Vaccine
19:4768-73). Results were plotted and the effective concentration
for 50% neutralization (EC.sub.50) was calculated with Prism
software (Graphpad Software Inc, San Diego, Calif.).
[0108] In Vivo Neutralization Assay.
[0109] Groups of 3 Fischer 344 rats (Female, 150-170 g) were
injected via the tail vein with PBS or a mixture of antibody and
PA+LF (LT), at different molar ratios (1:3-4, Ab:LT), prepared in
sterile PBS. Injection volumes were 200 .mu.l/rat. Animals were
observed continuously for the first 8 h, then at 16 h and 24 h,
followed by twice daily checks for one week. Animals were monitored
for signs of malaise and mortality. When rats were pre-treated with
antibody, they were injected intravenously (IV) with PBS or
antibody at 5 min, 4 h, or 1 week prior to an IV injection with
PA+LF (7.5 .mu.g each).
Results
[0110] Isolation of Anti-PA and Anti-LF Clones.
[0111] Recombinant proteins were used as antigens to select
antibodies from a scFv library derived from immunized chimpanzees.
After three rounds of selection with PA, LF or EF, a total of 192
phagemid clones were screened for specific binding by ELISA. We did
not detect clones that bound specifically to EF protein. Ninety
percent of the clones recognized PA or LF proteins but not BSA
control protein. Four unique anti-PA and two unique anti-LF scFv
phagemid clones were identified (W1, W2, A63-6, W5, F3-6, and F5-1)
by sequence analysis (FIG. 1). Two clones, W1 and W2, had very
similar sequences in VH and V.kappa. regions (FIG. 1) with only 9
amino acid residue differences (three of them are located within
the primer region). The other four clones differed greatly in amino
acid sequences. As expected, the greatest divergence in terms of
sequence and length was in the CDR regions. Because there is
extensive homology between chimpanzee and human Igs (Schofield D.
J. et al. 2002 Virology 292:127-36), similarity searches of all
known human Ig genes on V-BASE database (Cook G. P. et al. 1995
Immunol Today 16:237-42) were conducted. The VH3 family of heavy
chain and the V.kappa. I and II families of kappa light chain were
preferentially used by anti-anthrax antibodies (Table 1). As
expected, W1 and W2 clones were derived from the same VH and
V.kappa. germ line genes.
[0112] The six scFvs were expressed in E. coli, purified by
affinity chromatography, and tested for binding activity and
specificity by ELISA. Clones W1, W2, A63-6, and W5 bound strongly
to PA antigen and clones F3-6 and F5-1 bound strongly to LF antigen
(FIG. 2); none bound to BSA, thyroglobulin, phosphorylase-b, or
lysozyme.
[0113] In Vitro Neutralizing Activity and Affinity of W1 and
W2.
[0114] The effect of anthrax toxin was strongly inhibited by the W1
and W2 scFvs, but not by A63-6, F3-6, F5-1 and W5 scFvs. The latter
scFvs were not further studied.
[0115] ScFv fragments have limited utilization in passive
immunotherapy because these monovalent fragments are rapidly
cleared from the blood. In most cases, bivalent full-length
immunoglobulin is more effective than the corresponding scFv
because of avidity effects, effector functions, and prolonged
half-life in the blood. Therefore, W1 and W2 scFvs were converted
to bivalent whole IgG1 s and compared for neutralization activity
in the RAW264.7 cell-based in vitro assay. Well-characterized mouse
anti-PA 14B7 was used as a comparison control (Little S. F. et al.
1988 Infect Immun 56:1807-13).
[0116] Neutralization by complete IgGs was five to twenty-fold
better than that by scFvs and five (W2) and fifteen (W1)-fold
higher than that by mouse anti-PA 14B7 (FIG. 3). The equilibrium
dissociation constant (K.sub.d) for W1 and W2 IgG1 respectively was
determined by Biacore analysis. W1 and W2 antibody displayed very
high affinity with a K.sub.d of 4.times.10.sup.-11 and
5.times.10.sup.-11 M, respectively compared to a K.sub.d of
4.times.10.sup.-9 M for 14B7 (this study) (Table 2). These
affinities compared favorably with those published for human
anti-PA MAbs (Table 2) and were the highest recorded against
anthrax PA (Wild M. A. et al. 2003 Nat Biotechnol 21:1305-6;
Sawada-Hirai R. et al. 2004 J Immune Based Ther Vaccines 2:5;
Cirino N. M. et al. 1999 Infect Immun 67:2957-63).
[0117] Characterization of the Neutralization Epitope and Mechanism
of Neutralization.
[0118] Competitive ELISA results indicated that W1 and W2 may
recognize the same epitope since they competed with each other in
binding to PA and the CDR regions of their VH chains are identical.
Therefore, only W2 was used to map the neutralization epitope.
Competition in ELISA was also observed between 14B7 and W2 but not
between 2D3 and W2 (FIG. 4). 14B7 binds to the site responsible for
binding to the cellular receptor while 2D3 does not compete 14B7
and binds to a distinct binding site (Little S. F. et al. 1996
Microbiology 142 (Pt 3):707-15). The binding site for W2 was mapped
by radioimmunoprecipitation assay (RIPA). The smallest peptide that
reacted with W2 antibody contained 121 aa, corresponding to amino
acid residues 614-735 at the C-terminus of PA (FIG. 5). This result
indicated that W2 bound to a conformational epitope that
encompassed almost the entire domain 4 of PA (Petosa C. et al. 1997
Nature 385:833-8). Since domain 4 of PA is responsible for cellular
receptor binding (Varughese M. et al. 1999 Infect Immun 67:1860-5;
Liu S. et al. 2003 J Biol Chem 278:5227-34), the results indicated
that W2 neutralizes the toxin by blocking binding of PA to the
cellular receptor. This conclusion was confirmed in a binding assay
by Western blot, which showed that W2 prevented the binding of PA
to RAW264.7 cells (FIG. 6). The affinity (K.sub.d) of binding of PA
to the receptor is 1-5.times.10.sup.-9 M (Singh Y. et al. 1989 J
Biol Chem 264:19103-7). Therefore, the affinity of W2 antibody
binding to PA is 20-100-fold higher than the affinity of PA for the
cellular receptor.
[0119] In Vivo Animal Protection.
[0120] Since affinity of anti-PA is strongly correlated with its
neutralization activity, it is reasonable to assume that anti-PA W1
and W2 are potent neutralizing antibodies. As has been reported for
other anti-PA MAbs (Wild M. A. et al. 2003 Nat Biotechnol
21:1305-6; Sawada-Hirai R. et al. 2004 J Immune Based Ther Vaccines
2:5), one remarkable feature of our antibodies is the very slow
off-rate, which is envisioned as providing a significant
physiological advantage for toxin neutralization in vivo.
[0121] To evaluate the neutralization of PA by W1 and W2 in vivo,
we measured protection against toxin challenge in the Fisher 344
rat model in two ways. First, MAb and toxin were mixed at different
molar ratios and the mixtures were injected into 3 rats each which
were observed for morbidity and mortality. Injection of 7.5 .mu.g
of LT (7.5 .mu.g PA+7.5 .mu.g LF) toxin alone killed all three rats
within 100-134 min (Table 3). W2 antibody conferred protection at
very low concentrations. Addition of W2 antibody at a molar ratio
of 1:4 (Ab:PA), the lowest concentration of antibody tested,
completely protected the rats from toxin challenge. In comparison,
14B7 mouse antibody protected only one of the three rats at this
ratio, probably reflecting the difference in affinity between W2
and 14B7.
[0122] Second, as a more stringent test, the MAb was injected 5
min, 4 h, and 1 week before injection of LT (7.5 .mu.g PA+7.5 .mu.g
LF) to investigate the duration of antibody protection. Single
administration of W1 and W2 antibodies at a 2:1 molar ratio of Ab
to PA protected 6 of 6 rats challenged with toxin 5 min, 4 h or 1
week later (Table 4). A lower dose of antibodies (0.5:1) still
protected all the rats (n=6) when they were challenged 5 min or 4 h
later, but not when they were challenged one week later (Table
4).
Discussion
[0123] We have identified two chimpanzee monoclonal antibodies, W1
and W2, which bind to PA with high affinity. These antibodies
neutralized cytotoxicity of anthrax toxin in the picomolar range in
vitro and efficiently protected animals from toxin challenge in
vivo, most likely by blocking binding to the cell receptor. Our two
neutralizing MAbs have the highest affinity of any human antibodies
for PA reported thus far. Antibody affinity has been shown to
correlate well with efficacy (Maynard J. A. et al. 2002 Nat
Biotechnol 20:597-601; Adams G. P. et al. 1998 Cancer Res
58:485-90; Bachmann M. F. et al. 1997 Science 276:2024-7; Jackson
H. et al. 1998 Br J Cancer 78:181-8; Lamarre A. et al. 1991 J
Immunol 147:4256-62; Lamarre A. & Talbot P. J. 1995 J Immuno
1154:3975-84).
[0124] The neutralization epitope recognized by W1 and W2 MAbs was
mapped to a region of PA comprising residues 614 to 735. So far,
three neutralization epitopes in PA have been proposed; the site
for binding to the cellular receptor, the site for binding to LF
(Little S. F. et al. 1996 Microbiology 142 (Pt 3):707-15; Brossier
F. et al. 2004 Infect Immun 72:6313-7), and the site for heptamer
formation (Brossier F. et al. 2004 Infect Immun 72:6313-7).
However, the locations of these putative epitopes have not been
precisely defined. For example, the epitope recognized by murine
MAb 14B7 was suggested to be between Asp-671 and Ile-721 based on
the differential binding of 14B7 to different PA fragments
generated through C-terminal deletions (Little S. F. et al. 1996
Microbiology 142 (Pt 3):707-15). Since N-terminally deleted PA
fragments were not tested, the epitope mapping for 14B7 could be
incomplete. The previous observation that a PA fragment
corresponding to residues 624-735 did not compete with PA for
binding to the cell receptor (Singh Y. et al. 1991 J Biol Chem
266:15493-7) indicates that the region between residues 624-735 was
not sufficient to generate the receptor recognition site. Some of
the residues in domain 4 of PA that are critical for binding to the
cellular receptor and to anti-PA 14B7 MAb have been determined by
alanine-scanning mutations (Rosovitz M. J. et al. 2003 J Biol Chem
278:30936-44).
[0125] Anthrax, whether resulting from natural or
bioterrorist-associated exposure, represents a constant threat to
human health. Although production of an efficient vaccine is an
ultimate goal, the benefits of vaccination can be expected only if
a large proportion of the population at risk is immunized. The low
incidence of anthrax suggests that large-scale vaccination may not
be the most efficient means of controlling this disease. In
contrast, passive administration of neutralizing human or
chimpanzee monoclonal antibody to an at-risk or exposed subject
could provide immediate efficacy for emergency prophylaxis or
therapy of anthrax. This is supported by a recent publication
(Mohamed N. et al. 2005 Infect Immun 73:795-802), which indicated
that passive immunization with affinity-improved, humanized murine
MAb 14B7 against PA, ETI-204, could efficiently protect rabbits
before or after challenge with aerosolized Bacillus anthracis
spores. However, humanized murine MAbs may retain some antigenic
components of the original murine sequences and elicit antibodies
to the MAb in humans. Human and chimpanzee derived MAbs would not
be expected to have this problem because the sequences of
chimpanzee immunoglobulin genes are virtually identical to those of
humans (Schofield D. J. et al. 2002 Virology 292:127-36; Ehrlich P.
H. et al. 1988 Clin Chem 34:1681-8; Ehrlich P. H. et al. 1990 Hum
Antibodies Hybridomas 1:23-6; Schofield D. J. et al. 2000 J Virol
74:5548-55). Furthermore, one would expect that the anti-PA
chimpanzee MAbs, W1 and W2 will provide better protection than
ETI-204, since these MAbs had higher affinity (K.sub.d) and lower
EC.sub.50 in in vitro neutralization experiments than did
ETI-204.
TABLE-US-00005 TABLE 1 Human Ig Germ Line Genes Most Closely
Related to Chimpanzee Heavy and Kappa Light Chains of Various
Anti-anthrax PA and LF Antibodies. VH VH D JH V.kappa. V.kappa.
J.kappa. MAb Family Segment Segment Segment Family Segment Segment
W1 VH3 DP-42 ND J6c V.kappa. II DPK-15 J.kappa.3 W2 VH3 DP-42 ND
J6c V.kappa. II DPK-15 J.kappa.1 W5 VH4 DP-78 D2-15 J5b V.kappa. II
A2b J.kappa.4 A63-6 VH3 DP-47 D1-14 J6c V.kappa. I HK 102 J.kappa.4
F3-6 VH3 DP-49 ND J4b V.kappa. I HK 102 J.kappa.5 F5-1 VH5 DP-73 ND
J6c V.kappa. I HK 102 J.kappa.1 The closest human VH and V.kappa.
germ line genes were identified by V-BASE database (Cook G. P. et
al. 1995 Immunol Today 16: 237-42). ND, not determined due to lack
of identifiable homologue.
TABLE-US-00006 TABLE 2 Affinity of Anti-anthrax PA W1 and W2
Antibodies Compared with Other Human Anti-PA MAbs Association
Dissociation Dissociation Rate Rate Constant Antibody k.sub.on
(M.sup.-1s.sup.-1) k.sub.off (s.sup.-1) K.sub.d (M) Reference W1
2.90 .times. 10.sup.5 1.15 .times. 10.sup.-5 3.97 .times.
10.sup.-11 this study W2 2.77 .times. 10.sup.5 1.52 .times.
10.sup.-5 5.49 .times. 10.sup.-11 this study AVP-21D9 1.8 .times.
10.sup.5 1.48 .times. 10.sup.-5 8.21 .times. 10.sup.-11
Sawada-Hirai R. et al. 2004 J Immune Based Ther Vaccines 2: 5
AVP-1C6 1.85 .times. 10.sup.5 1.31 .times. 10.sup.-4 7.11 .times.
10.sup.-10 Sawada-Hirai R. et al. 2004 J Immune Based Ther Vaccines
2: 5 AVP-4H7 1.74 .times. 10.sup.5 2.45 .times. 10.sup.-5 1.41
.times. 10.sup.-10 Sawada-Hirai R. et al. 2004 J Immune Based Ther
Vaccines 2: 5 AVP- 1.01 .times. 10.sup.5 5.17 .times. 10.sup.-5
5.12 .times. 10.sup.-10 Sawada-Hirai R. et al. 2004 J 22G12 Immune
Based Ther Vaccines 2: 5 83K7C 1.16 .times. 10.sup.5 4.26 .times.
10.sup.-4 3.67 .times. 10.sup.-9 Wild M. A. et al. 2003 Nat
Biotechnol 21: 1305-6 63L1D 1.50 .times. 10.sup.6 1.90 .times.
10.sup.-4 1.3 .times. 10.sup.-10 Wild M. A. et al. 2003 Nat
Biotechnol 21: 1305-6 scFv1 NA NA .sup. 1.9 .times. 10.sup.-7 Cook
G. P. et al. 1995 Immunol Today 16: 237-42 scFv4 NA NA .sup. 3.1
.times. 10.sup.-7 Cook G. P. et al. 1995 Immunol Today 16: 237-42
scFv1 NA NA .sup. 1.1 .times. 10.sup.-6 Cook G. P. et al. 1995
Immunol Today 16: 237-42 scFv24 NA NA .sup. 4.3 .times. 10.sup.-7
Cook G. P. et al. 1995 Immunol Today 16: 237-42 ETI-204.sup.a 4.57
.times. 10.sup.5 1.50 .times. 10.sup.-4 3.3 .times. 10.sup.-10
Mohamed N. et al. 2005 Infect Immun 73: 795-802 .sup.aETI-204 is an
affinity-improved, humanized MAb derived from murine MAb 14B7.
TABLE-US-00007 TABLE 3 Rat Protection Assay .sup.a Antibody Molar
ratios of MAb to PA.sup.b Rat surviving/rat injected -- LT only
(7.5 .mu.g) 0/5.sup.c 14B7 1:4 1/3.sup.d W2 1:4 3/3 14B7 1:3 3/3 W2
1:3 3/3 .sup.a Antibody and LT (PA + LF) was mixed at indicated
molar ratios and injected IV .sup.bThe amount of PA was kept
constant as 7.5 .mu.g. .sup.cTime to death was 100-134 min
.sup.dTime to death was 128 and 168 min
TABLE-US-00008 TABLE 4 Rat Protection Assay MAb: Interval between
injection of rats with MAb and injection with PA plus LF.sup.a
Molar ratio 5 min 4 h 1 week of MAb to PA W 1 W 2 Combined W 1 W 2
Combined W 1 W 2 Combined 2:1 .sup. 3/3.sup.b 3/3 6/6 3/3 3/3 6/6
3/3 3/3 6/6 0.5:1.sup. 3/3 3/3 6/6 3/3 3/3 6/6 0/3 0/2 0/5 0:1 0/3
0/3 0/6 0/3 0/3 0/6 0/3 0/3 0/6 .sup.a7.5 .mu.g of Protective
Antigen plus 7.5 .mu.g of Lethal Factor. Animals surviving/animals
injected
[0126] While the present invention has been described in some
detail for purposes of clarity and understanding, one skilled in
the art will appreciate that various changes in form and detail can
be made without departing from the true scope of the invention. All
figures, tables, and appendices, as well as patents, applications,
and publications, referred to above, are hereby incorporated by
reference.
Sequence CWU 1
1
481121PRTArtificial SequenceMonoclonal antibody 1Glu Val Gln Leu
Leu Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Arg Ser Tyr 20 25 30His Met
Ser Trp Val Arg Arg Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Val Ile Tyr Asp Gly Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys 50 55
60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65
70 75 80Gln Met Thr Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95Arg Ser Gly Arg Pro Leu Gln Asn Tyr Tyr Tyr Met Asp Val
Trp Gly 100 105 110Lys Gly Thr Thr Val Thr Val Ser Ser 115
120230PRTArtificial SequenceMonoclonal antibody 2Glu Val Gln Leu
Leu Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Arg 20 25 3035PRTArtificial
SequenceMonoclonal antibody 3Ser Tyr His Met Ser1 5414PRTArtificial
SequenceMonoclonal antibody 4Trp Val Arg Arg Ala Pro Gly Lys Gly
Leu Glu Trp Val Ser1 5 10516PRTArtificial SequenceMonoclonal
antibody 5Val Ile Tyr Asp Gly Gly Ser Thr Ser Tyr Ala Asp Ser Val
Lys Gly1 5 10 15632PRTArtificial SequenceMonoclonal antibody 6Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln1 5 10
15Met Thr Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
20 25 30713PRTArtificial SequenceMonoclonal antibody 7Ser Gly Arg
Pro Leu Gln Asn Tyr Tyr Tyr Met Asp Val1 5 10811PRTArtificial
SequenceMonoclonal antibody 8Trp Gly Lys Gly Thr Thr Val Thr Val
Ser Ser1 5 109113PRTArtificial SequenceMonoclonal antibody 9Glu Ile
Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu
Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25
30Asn Arg Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val
Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Phe Thr Phe Gly Pro Gly Thr
Lys Val Glu Ile Lys 100 105 110Arg1023PRTArtificial
SequenceMonoclonal antibody 10Glu Ile Val Met Thr Gln Ser Pro Leu
Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys
201116PRTArtificial SequenceMonoclonal antibody 11Arg Ser Ser Gln
Ser Leu Leu His Ser Asn Arg Tyr Asn Tyr Leu Asp1 5 10
151215PRTArtificial SequenceMonoclonal antibody 12Trp Tyr Leu Gln
Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr1 5 10
15137PRTArtificial SequenceMonoclonal antibody 13Leu Gly Ser Asn
Arg Ala Ser1 51432PRTArtificial SequenceMonoclonal antibody 14Gly
Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr1 5 10
15Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys
20 25 30159PRTArtificial SequenceMonoclonal antibody 15Met Gln Ala
Leu Gln Thr Pro Phe Thr1 51611PRTArtificial SequenceMonoclonal
antibody 16Phe Gly Pro Gly Thr Lys Val Glu Ile Lys Arg1 5
1017121PRTArtificial SequenceMonoclonal antibody 17Glu Val Gln Leu
Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Arg Ser Tyr 20 25 30His Met
Ser Trp Val Arg Lys Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Val Ile Tyr Asp Gly Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys 50 55
60Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu65
70 75 80Gln Met Thr Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala 85 90 95Arg Ser Gly Arg Pro Leu Gln Asn Tyr Tyr Tyr Met Asp Val
Trp Gly 100 105 110Lys Gly Thr Thr Val Thr Val Ser Ser 115
1201830PRTArtificial SequenceMonoclonal antibody 18Glu Val Gln Leu
Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Arg 20 25
30195PRTArtificial SequenceMonoclonal antibody 19Ser Tyr His Met
Ser1 52014PRTArtificial SequenceMonoclonal antibody 20Trp Val Arg
Lys Ala Pro Gly Lys Gly Leu Glu Trp Val Ser1 5 102116PRTArtificial
SequenceMonoclonal antibody 21Val Ile Tyr Asp Gly Gly Ser Thr Ser
Tyr Ala Asp Ser Val Lys Gly1 5 10 152232PRTArtificial
SequenceMonoclonal antibody 22Arg Phe Thr Ile Ser Arg Asp Asn Ser
Lys Asn Thr Leu Tyr Leu Gln1 5 10 15Met Thr Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys Ala Arg 20 25 302313PRTArtificial
SequenceMonoclonal antibody 23Ser Gly Arg Pro Leu Gln Asn Tyr Tyr
Tyr Met Asp Val1 5 102411PRTArtificial SequenceMonoclonal antibody
24Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser1 5
1025113PRTArtificial SequenceMonoclonal antibody 25Glu Ile Val Met
Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala
Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Thr
Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro
Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55
60Gly Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65
70 75 80Ser Arg Val Glu Ala Glu Asp Ile Gly Val Tyr Tyr Cys Met Gln
Ala 85 90 95Leu Gln Thr Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Lys
Ile Lys 100 105 110Ala2623PRTArtificial SequenceMonoclonal antibody
26Glu Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1
5 10 15Glu Pro Ala Ser Ile Ser Cys 202716PRTArtificial
SequenceMonoclonal antibody 27Arg Ser Ser Gln Ser Leu Leu His Ser
Asn Thr Tyr Asn Tyr Leu Asp1 5 10 152815PRTArtificial
SequenceMonoclonal antibody 28Trp Tyr Leu Gln Lys Pro Gly Gln Ser
Pro Gln Leu Leu Ile Tyr1 5 10 15297PRTArtificial SequenceMonoclonal
antibody 29Leu Gly Ser Asn Arg Ala Ser1 53032PRTArtificial
SequenceMonoclonal antibody 30Gly Val Pro Gly Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr1 5 10 15Leu Lys Ile Ser Arg Val Glu Ala
Glu Asp Ile Gly Val Tyr Tyr Cys 20 25 30319PRTArtificial
SequenceMonoclonal antibody 31Met Gln Ala Leu Gln Thr Pro Leu Thr1
53211PRTArtificial SequenceMonoclonal antibody 32Phe Gly Gln Gly
Thr Lys Val Lys Ile Lys Ala1 5 1033125PRTArtificial
SequenceMonoclonal antibody 33Gln Val Gln Leu Gln Glu Ser Gly Pro
Gly Leu Val Lys Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val
Ser Ala Asp Ser Ile Thr Ser Gly 20 25 30Tyr Tyr Tyr Trp Asn Trp Ile
Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45Trp Ile Ala Tyr Ile Asp
Tyr Arg Gly Thr Thr Thr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Val
Thr Met Ser Leu Asp Thr Ser Lys Asn Gln Phe65 70 75 80Ser Leu Lys
Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala
Arg Gly Gly Gly Tyr Pro Gln Tyr Gly Asp Tyr Ala Trp Phe 100 105
110Asp Pro Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120
12534125PRTArtificial SequenceMonoclonal antibody 34Glu Val Gln Leu
Val Glu Thr Gly Gly Gly Phe Val Lys Pro Gly Gly1 5 10 15Ser Leu Arg
Val Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30Ala Met
His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val 35 40 45Ser
Thr Ile Ser Gly Ser Gly Thr Ser Trp Thr Tyr Asn Pro Ser Leu 50 55
60Lys Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65
70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95Ala Arg Asn Pro Met Val Gly Val Pro Gln Phe Tyr Tyr Tyr
Tyr Ile 100 105 110Asp Pro Trp Gly Lys Gly Thr Thr Val Thr Val Ser
Ser 115 120 12535124PRTArtificial SequenceMonoclonal antibody 35Glu
Val Gln Leu Val Glu Thr Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Ala Phe Ile Ala Phe Asp Glu Gly Asn Gln His Tyr Asn Pro
Ser Leu 50 55 60Arg Ser Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr65 70 75 80Leu Gln Met Asn Arg Leu Arg Thr Glu Asp Thr
Ala Val Tyr Tyr Cys 85 90 95Val Arg Gly Arg Ala Ala Gly His Pro Gly
Ala Ser Tyr Tyr Phe Asp 100 105 110Tyr Trp Gly Gln Gly Thr Pro Val
Thr Val Ser Ser 115 12036129PRTArtificial SequenceMonoclonal
antibody 36Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro
Gly Glu1 5 10 15Ser Leu Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe
Thr Asn Tyr 20 25 30Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly
Leu Glu Trp Met 35 40 45Gly Ser Ile Tyr Pro Gly Asp Ser Asp Thr Arg
Tyr Ser Pro Ser Phe 50 55 60Gln Ser Gln Val Thr Ile Ser Ala Asp Lys
Ser Ile Asn Thr Ala Tyr65 70 75 80Leu Gln Trp Ser Ser Leu Lys Ala
Ser Asp Thr Ala Ile Tyr Tyr Cys 85 90 95Ala Arg Val Gly Ile Tyr Cys
Ser Gly Asn Thr Cys Leu Ala Pro Ser 100 105 110Gly Tyr Tyr Met Asp
Val Trp Gly Asn Gly Thr Thr Val Thr Val Ser 115 120
125Ser37113PRTArtificial SequenceMonoclonal antibody 37Asp Ile Val
Met Thr Gln Ser Pro Leu Ser Leu Ser Val Thr Pro Gly1 5 10 15Gln Pro
Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asp
Gly Asn Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45Pro Gln Leu Leu Ile Tyr Arg Val Ser Asn Arg Ala Ser Gly Val Pro
50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
Ile65 70 75 80Ser Gln Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys
Met Gln Gly 85 90 95Ile Gln Leu Pro Leu Thr Phe Gly Gly Gly Thr Lys
Val Glu Ile Lys 100 105 110Ala38108PRTArtificial SequenceMonoclonal
antibody 38Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile
Ser Asn Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
Lys Leu Leu Ile 35 40 45Tyr Tyr Ala Ser Lys Leu Glu Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Pro Asp Tyr Thr Leu Thr
Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Ser Ala Thr Tyr Phe Cys
Gln Gln Tyr Ser Thr Asn Pro Leu 85 90 95Ser Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys Ala 100 10539108PRTArtificial SequenceMonoclonal
antibody 39Asp Ile Arg Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile
Ser Thr Trp 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Arg Ala Pro
Lys Pro Leu Ile 35 40 45Tyr Ala Ala Ser Asn Leu Gln Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys
Gln Gln Tyr Asn Ser Tyr Pro Ile 85 90 95Thr Phe Gly Gln Gly Thr Arg
Leu Glu Ile Lys Arg 100 10540108PRTArtificial SequenceMonoclonal
antibody 40Asp Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Leu Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Trp Ala Ser Gln Gly Ile
Thr Thr Arg 20 25 30Leu Asn Trp Tyr Gln His Lys Pro Gly Lys Pro Pro
Lys Leu Leu Ile 35 40 45Tyr Asp Ala Ser Arg Leu Gly Ser Gly Val Pro
Ser His Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Asn Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Phe Cys
Gln Gln Phe Lys Met Tyr Pro Pro 85 90 95Thr Phe Gly Gln Gly Thr Lys
Val Asp Ile Lys Ala 100 1054135DNAArtificial Sequencesynthetic
primer 41accgtctcct cagcctccac caagggccca tcggt 354232DNAArtificial
Sequencesynthetic primer 42aatgagatct gcggccgctt aaattaatta at
324335DNAArtificial Sequencesynthetic primer 43gtggaaatca
aacgaactgt ggctgcacca tctgt 354425DNAArtificial Sequencesynthetic
primer 44aggtatttca ttttaaattc ctcct 254532DNAArtificial
Sequencesynthetic primer 45gaggtgcagc tgctcgagac tggaggaggc tt
324637DNAArtificial Sequencesynthetic primer 46cttggtggag
gctgaggaga cggtgaccgt ggtccct 374734DNAArtificial Sequencesynthetic
primer 47tggaggtgga tccgagctcg taatgacgca gtct 344836DNAArtificial
Sequencesynthetic primer 48agccacagtt cgtttgattt ccaccttggt cccagg
36
* * * * *