U.S. patent application number 15/735532 was filed with the patent office on 2019-01-17 for combination therapy of transcription inhibitors and kinase inhibitors.
This patent application is currently assigned to Dana-Farber Cancer Institute, Inc.. The applicant listed for this patent is Dana-Farber Cancer Institute, Inc.. Invention is credited to Nathanael S. Gray, Peter Hammerman, Kwok-kin Wong.
Application Number | 20190015411 15/735532 |
Document ID | / |
Family ID | 57504581 |
Filed Date | 2019-01-17 |
![](/patent/app/20190015411/US20190015411A9-20190117-C00001.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00002.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00003.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00004.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00005.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00006.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00007.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00008.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00009.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00010.png)
![](/patent/app/20190015411/US20190015411A9-20190117-C00011.png)
View All Diagrams
United States Patent
Application |
20190015411 |
Kind Code |
A9 |
Hammerman; Peter ; et
al. |
January 17, 2019 |
COMBINATION THERAPY OF TRANSCRIPTION INHIBITORS AND KINASE
INHIBITORS
Abstract
The present disclosure provides combination therapy of a
transcription inhibitor and a kinase inhibitor. The combination of
the transcription inhibitor and the kinase inhibitor may be useful
in treating and/or preventing in a subject a proliferative disease,
such as proliferative a disease that is resistant to the
transcription inhibitor alone or the kinase inhibitor alone. In
certain embodiments, the proliferative disease is a cancer. The
combination of the transcription inhibitor and the kinase inhibitor
is expected to be synergistic.
Inventors: |
Hammerman; Peter; (Newton,
MA) ; Wong; Kwok-kin; (Arlington, MA) ; Gray;
Nathanael S.; (Boston, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dana-Farber Cancer Institute, Inc. |
Boston |
MA |
US |
|
|
Assignee: |
Dana-Farber Cancer Institute,
Inc.
Boston
MA
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20180169097 A1 |
June 21, 2018 |
|
|
Family ID: |
57504581 |
Appl. No.: |
15/735532 |
Filed: |
June 10, 2016 |
PCT Filed: |
June 10, 2016 |
PCT NO: |
PCT/US16/37086 PCKC 00 |
371 Date: |
December 11, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62175077 |
Jun 12, 2015 |
|
|
|
62175035 |
Jun 12, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/519 20130101;
A61P 35/00 20180101; A61K 31/53 20130101; A61K 31/4162 20130101;
A61K 31/506 20130101; A61K 31/52 20130101; A61K 45/06 20130101;
A61K 31/69 20130101; A61K 31/551 20130101; A61K 31/5517 20130101;
A61K 31/506 20130101; A61K 2300/00 20130101; A61K 31/52 20130101;
A61K 2300/00 20130101; A61K 31/551 20130101; A61K 2300/00 20130101;
A61K 31/5517 20130101; A61K 2300/00 20130101; A61K 31/69 20130101;
A61K 2300/00 20130101 |
International
Class: |
A61K 31/506 20060101
A61K031/506; A61K 31/519 20060101 A61K031/519; A61K 31/4162
20060101 A61K031/4162; A61K 31/551 20060101 A61K031/551; A61K 45/06
20060101 A61K045/06; A61K 31/52 20060101 A61K031/52; A61K 31/53
20060101 A61K031/53; A61P 35/00 20060101 A61P035/00 |
Claims
1. A method of treating a proliferative disease in a subject in
need thereof, the method comprising administering to the subject an
effective amount of: a transcription inhibitor; and a kinase
inhibitor; wherein the transcription inhibitor and the kinase
inhibitor are not the same.
2-3. (canceled)
4. A method of reducing, delaying, or preventing in a subject in
need thereof the resistance of a proliferative disease to a kinase
inhibitor, the method comprising administering to the subject an
effective amount of: a transcription inhibitor; and the kinase
inhibitor; wherein the transcription inhibitor and the kinase
inhibitor are not the same.
5. (canceled)
6. The method of claim 1, wherein the transcription inhibitor is a
cyclin-dependent kinase (CDK) inhibitor.
7. (canceled)
8. The method of claim 1, wherein the transcription inhibitor is a
bromodomain-containing protein inhibitor.
9. (canceled)
10. The method of claim 1, wherein the transcription inhibitor is
of Formula (I): ##STR00267## or a pharmaceutically acceptable salt
thereof, wherein: Ring A is an optionally substituted heteroaryl
ring of any one of the Formulae (i-1)-(i-5): ##STR00268## each
instance of V.sup.1, V.sup.2, V.sup.3, V.sup.4, V.sup.5, V.sup.6,
V.sup.7, V.sup.8, V.sup.9, V.sup.10, V.sup.11, V.sup.12, V.sup.13,
and V.sup.14 is independently O, S, N, NR.sup.A1, C, or CR.sup.A2;
each instance of R.sup.A1 is independently selected from the group
consisting of hydrogen, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, and a nitrogen protecting group; each
instance of R.sup.A2 is independently selected from the group
consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.A2a,
--N(R.sup.A2a).sub.2, and --SR.sup.A2a, wherein each occurrence of
R.sup.A2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.A2a groups are joined to form an optionally substituted
heterocyclic ring; optionally any two of R.sup.A1, R.sup.A2, and
R.sup.A2a groups are joined to form an optionally substituted
carbocyclic, optionally substituted heterocyclic, optionally
substituted aryl, or optionally substituted heteroaryl ring; Ring B
is of the formula: ##STR00269## R.sup.B1 is selected from the group
consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, and --SR.sup.B1a, wherein each occurrence of
R.sup.B1a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.B1a groups are joined to form an optionally substituted
heterocyclic ring; W.sub.B is N or CR.sup.B2, wherein R.sup.B2 is
selected from the group consisting of hydrogen, halogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, optionally substituted heteroaryl,
--OR.sup.B2a, --N(R.sup.B2a).sub.2, and --SR.sup.B2a, wherein each
occurrence of R.sup.B2a is independently selected from the group
consisting of hydrogen, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, and a sulfur protecting group when attached to a
sulfur atom, or two R.sup.B2a groups are joined to form an
optionally substituted heterocyclic ring; optionally R.sup.B1 and
R.sup.B2 are joined to form an optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted
heteroaryl, or optionally substituted aryl ring; X is an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain is replaced with --O--,
--S--, or --NR.sup.X--, wherein R.sup.X is hydrogen, C.sub.1-6
alkyl, or a nitrogen protecting group; L.sup.2 is a bond, --O--,
--S--, --NR.sup.L2a--, --NR.sup.L2aC(.dbd.O)--,
--C(.dbd.O)NR.sup.L2a--, --SC(.dbd.O)--, --C(.dbd.O)S--,
--OC(.dbd.O)--, --C(.dbd.O)O--, --NR.sup.L2aC(.dbd.S)--,
--C(.dbd.S)NR.sup.L2a--, trans-CR.sup.L2b.dbd.CR.sup.L2b--,
cis-CR.sup.L2b.dbd.CR.sup.L2b--, --C.ident.C--,
--OC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2O--,
--NR.sup.L2aC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2NR.sup.L2a--,
--SC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2S--,
--S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L2a--, --NR.sup.L2aS(.dbd.O).sub.2--, or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the hydrocarbon chain is
replaced with --O--, --S--, --NR.sup.L2a--,
--NR.sup.L2aC(.dbd.O)--, --C(.dbd.O)NR.sup.L2a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L2aC(.dbd.S)--, --C(.dbd.S)NR.sup.L2a--,
trans-CR.sup.L2b.dbd.CR.sup.L2b--, cis-CR.sup.L2b.dbd.CR.sup.L2b
C.ident.C--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L2a--, or --NR.sup.L2aS(.dbd.O).sub.2--,
wherein R.sup.L2a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L2b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or two
R.sup.L2b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; each
instance of R.sup.C is independently selected from the group
consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.C1,
--N(R.sup.C1).sub.2, and --SR.sup.C1, wherein each occurrence of
R.sup.C1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.C1 groups are joined to form an optionally substituted
heterocyclic ring; n is 0, 1, 2, 3, or 4; each instance of R.sup.D
is independently selected from the group consisting of hydrogen,
halogen, optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --OR.sup.D1, --N(R.sup.D1).sub.2, and --SR.sup.D1,
wherein each occurrence of R.sup.D1 is independently selected from
the group consisting of hydrogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, a nitrogen protecting group when
attached to a nitrogen atom, an oxygen protecting group when
attached to an oxygen atom, and a sulfur protecting group when
attached to a sulfur atom, or two R.sup.D1 groups are joined to
form an optionally substituted heterocyclic ring; p is 0, 1, 2, 3,
or 4; R.sup.E is any one of the Formulae (ii-1)-(ii-17):
##STR00270## ##STR00271## ##STR00272## R.sup.E and L.sup.2 are para
or meta to each other; L.sup.3 is a bond, --O--, --S--,
--NR.sup.L3a--, or an optionally substituted C.sub.1-4 hydrocarbon
chain, optionally wherein one or more carbon units of the
hydrocarbon chain is replaced with --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L3b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or two
R.sup.L3b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; L.sup.4 is
a bond or an optionally substituted C.sub.1-4 hydrocarbon chain;
R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E1a, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.E1a, --OR.sup.E1a, --N(R.sup.E1a).sub.2, and
--SR.sup.E1a, wherein each occurrence of R.sup.E1a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E1a groups are
joined to form an optionally substituted heterocyclic ring;
R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E2a groups are
joined to form an optionally substituted heterocyclic ring;
R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E3a groups are
joined to form an optionally substituted heterocyclic ring;
optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or
R.sup.E1 and R.sup.E2 are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; R.sup.E4
is a leaving group; Y is O, S, or NR.sup.E5, wherein R.sup.E5 is
hydrogen, C.sub.1-6 alkyl, or a nitrogen protecting group; a is 1
or 2; and z is 0, 1, 2, 3, 4, 5, or 6.
11. The method of claim 10, wherein the transcription inhibitor is
of the formula: ##STR00273## or a pharmaceutically acceptable salt
thereof.
12. (canceled)
13. The method of claim 1, wherein the transcription inhibitor is
of Formula (II): ##STR00274## or a pharmaceutically acceptable salt
thereof, wherein: G is group of atoms ranging a total length
between 20 to 30 .ANG.; R.sup.E is an electrophile with any one of
the Formulae (ii-1)-(ii-17): ##STR00275## ##STR00276## ##STR00277##
L.sup.3 is a bond, --O--, --S--, --NR.sup.L3a--, or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain is replaced with --O--,
--S--, --NR.sup.L3a--, --NR.sup.L3aC(.dbd.O)--,
--C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--, --C(.dbd.O)S--,
--OC(.dbd.O)--, --C(.dbd.O)O--, --NR.sup.L3aC(.dbd.S)--,
--C(.dbd.S)NR.sup.L3a--, trans-CR.sup.L3b.dbd.CR.sup.L3b--,
cis-CR.sup.L3b.dbd.CR.sup.L3b--, --C.ident.C--,
--S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L3b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or two
R.sup.L3b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; L.sup.4 is
a bond or an optionally substituted C.sub.1-4 hydrocarbon chain;
R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E1a, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.E1a, --OR.sup.E1a, --N(R.sup.E1a).sub.2, and
--SR.sup.E1a, wherein each occurrence of R.sup.E1a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E1a groups are
joined to form an optionally substituted heterocyclic ring;
R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E2a groups are
joined to form an optionally substituted heterocyclic ring;
R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E3a groups are
joined to form an optionally substituted heterocyclic ring;
optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or
R.sup.E1 and R.sup.E2 are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; R.sup.E4
is a leaving group; Y is O, S, or NR.sup.E5, wherein R.sup.E5 is
hydrogen, C.sub.1-6 alkyl, or a nitrogen protecting group; a is 1
or 2; and z is 0, 1 or 2; L.sup.1e is a linker ranging between 0 to
3 atoms in length; L.sup.x is a linker ranging between 0 to 5 atoms
in length; optionally, the IC.sub.50 for CDK7 is less than
approximately 100 nM; and optionally, the CDK inhibitor is
selective for CDK7.
14. The method of claim 1, wherein the transcription inhibitor is
of Formula (III): ##STR00278## or a pharmaceutically acceptable
salt thereof, wherein: Ring A is an optionally substituted
heteroaryl ring of any one of the Formulae (i-1)-(i-6):
##STR00279## wherein: each instance of V.sup.1, V.sup.2, V.sup.3,
V.sup.4, V.sup.5, V.sup.6, V.sup.7, V.sup.8, V.sup.9, V.sup.10,
V.sup.11, V.sup.12, V.sup.13, V.sup.14, and V.sup.15 is
independently O, S, N, NR.sup.A1, C, or CR.sup.A2; each instance of
R.sup.A1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, and a nitrogen protecting group; each instance of
R.sup.A2 is independently selected from the group consisting of
hydrogen, halogen, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, --CN, --OR.sup.A2a, --N(R.sup.A2a).sub.2,
and --SR.sup.A2a, wherein each occurrence of R.sup.A2a is
independently selected from the group consisting of hydrogen,
optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.A2a groups are joined to form an optionally substituted
heterocyclic ring; and optionally any two of R.sup.A1, R.sup.A2,
and R.sup.A2a groups are joined to form an optionally substituted
carbocyclic, optionally substituted heterocyclic, optionally
substituted aryl, or optionally substituted heteroaryl ring;
R.sup.B1 is selected from the group consisting of hydrogen,
halogen, optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, and --SR.sup.B1a, wherein each occurrence of
R.sup.B1a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
R.sup.B1 and R.sup.B2 are joined to form an optionally substituted
carbocyclic, optionally substituted heterocyclic, optionally
substituted aryl, or optionally substituted heteroaryl ring;
W.sub.B is N or CR.sup.B2, wherein R.sup.B2 is selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B2a,
--N(R.sup.B2a).sub.2, and --SR.sup.B2a, or R.sup.B2 and R.sup.B1
are joined to form an optionally substituted carbocyclic,
optionally substituted heterocyclic, optionally substituted aryl,
or optionally substituted heteroaryl ring, wherein each occurrence
of R.sup.B2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.B2a groups are joined to form an optionally substituted
heterocyclic ring; L.sup.1 is a bond or an optionally substituted
C.sub.1-4 hydrocarbon chain, optionally wherein one or more carbon
units of the optionally substituted C.sub.1-4 hydrocarbon chain are
independently replaced with --O--, --S--, --NR.sup.L1--,
--S(.dbd.O)--, or --S(.dbd.O).sub.2--, wherein R.sup.L1 is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group, and optionally wherein two substituents
on the optionally substituted C.sub.1-4 hydrocarbon chain are taken
together to form an optionally substituted carbocyclic or
optionally substituted heterocyclic ring; L.sup.2 is a bond or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the optionally substituted
C.sub.1-4 hydrocarbon chain are independently replaced with --O--,
--S--, --NR.sup.L2--, --S(.dbd.O)--, or --S(.dbd.O).sub.2--,
wherein R.sup.L2 is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and optionally
wherein two substituents on the optionally substituted C.sub.1-4
hydrocarbon chain are taken together to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring; each instance of R.sup.C is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, .dbd.O, --CN, --OR.sup.C1,
--N(R.sup.C1).sub.2, and --SR.sup.C1; or two R.sup.C groups are
taken together to form an optionally substituted, carbocyclic,
heterocyclic, aryl, or heteroaryl ring, wherein two substituents on
the substituted heterocyclic ring or substituted carbocyclic ring,
or one substituent on the substituted heterocyclic ring or
substituted carbocyclic ring and a third R.sup.C group, are taken
together to form another optionally substituted heterocyclic ring
or optionally substituted carbocyclic ring; wherein each occurrence
of R.sup.C1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.C1 groups are joined to form an optionally substituted
heterocyclic ring; n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each
instance of R.sup.D is independently selected from the group
consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.D1,
--N(R.sup.D1).sub.2, and --SR.sup.D1, wherein each occurrence of
R.sup.D1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
two R.sup.D1 groups are joined to form an optionally substituted
heterocyclic ring; p is 0, 1, 2, 3, or 4; R.sup.E is of any one of
the Formulae (ii-1)-(ii-20): ##STR00280## ##STR00281## ##STR00282##
L.sup.3 is a bond, --O--, --S--, --NR.sup.L3a--, or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain are independently
replaced with --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently selected from the group
consisting of hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or two R.sup.L3b groups are joined to form
an optionally substituted carbocyclic or optionally substituted
heterocyclic ring; L.sup.4 is a bond or an optionally substituted
C.sub.1-4 hydrocarbon chain; R.sup.E1 is selected from the group
consisting of hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --CN, --CH.sub.2OR.sup.E1a,
--CH.sub.2N(R.sup.E1a).sub.2, --CH.sub.2SR.sup.E1a, --OR.sup.E1a,
--N(R.sup.E1a).sub.2, --Si(R.sup.E1a).sub.3, and --SR.sup.E1a,
wherein each occurrence of R.sup.E1a is independently selected from
the group consisting of hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or two R.sup.E1a groups are joined to form
an optionally substituted heterocyclic ring; R.sup.E2 is selected
from the group consisting of hydrogen, halogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, --CN, --CH.sub.2OR.sup.E2a,
--CH.sub.2N(R.sup.E2a).sub.2, --CH.sub.2SR.sup.E2a, --OR.sup.E2a,
--N(R.sup.E2a).sub.2, and --SR.sup.E2a, wherein each occurrence of
R.sup.E2a is independently selected from the group consisting of
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or two
R.sup.E2a groups are joined to form an optionally substituted
heterocyclic ring; R.sup.E3 is selected from the group consisting
of hydrogen, halogen, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, optionally substituted heteroaryl,
--CN, --CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E3a groups are
joined to form an optionally substituted heterocyclic ring;
optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or
R.sup.E1 and R.sup.E2 are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; R.sup.E4
is a leaving group; R.sup.E5 is halogen; Y is O, S, or NR.sup.E6,
wherein R.sup.E6 is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group; a is 1 or 2; and z
is 0, 1, 2, 3, 4, 5, or 6.
15. (canceled)
16. The method of claim 1, wherein the transcription inhibitor is
of Formula (IV): ##STR00283## or a pharmaceutically acceptable
salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein:
Ring A is an optionally substituted heteroaryl ring of any one of
the Formulae (i-1)-(i-6): ##STR00284## wherein: each instance of
V.sup.1, V.sup.2, V.sup.3, V.sup.4, V.sup.5, V.sup.6, V.sup.7,
V.sup.8, V.sup.9, V.sup.10, V.sup.11, V.sup.12, V.sup.13, V.sup.14
and V.sup.15 is independently O, S, N, N(R.sup.A1), C, or
C(R.sup.A2); each instance of R.sup.A1 is independently selected
from hydrogen, deuterium, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl; each instance of R.sup.A2 is
independently selected from hydrogen, deuterium, halogen, --CN,
optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --OR.sup.A2a, --N(R.sup.A2a).sub.2, and --SR.sup.A2a,
wherein each occurrence of R.sup.A2a is independently selected from
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or any two R.sup.A1, any two R.sup.A2, or
one R.sup.A1 and one R.sup.A2 are joined to form an optionally
substituted carbocyclic, optionally substituted heterocyclic,
optionally substituted aryl, or optionally substituted heteroaryl
ring; each X is independently selected from N and CH, wherein at
least one X is N; W is selected from N and C(R.sup.1a); each of
R.sup.1a, if present, and R.sup.1b is independently selected from
hydrogen, deuterium, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, and --SR.sup.B1a, wherein each occurrence of
R.sup.B1a is independently selected from hydrogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, and optionally substituted heteroaryl,
or R.sup.1a and R.sup.1b are joined to form an optionally
substituted carbocyclic, optionally substituted heterocyclic,
optionally substituted aryl, or optionally substituted heteroaryl
ring; R.sup.2 is an optionally substituted C.sub.1-C.sub.4 alkylene
or an optionally substituted C.sub.2-C.sub.4 alkenylene or
alkynylene, wherein one or more methylene units of the alkylene,
alkenylene or alkynylene are optionally and independently replaced
with --O--, --S--, or --N(R.sup.6)--; each instance of R.sup.3, if
present, is independently selected from deuterium, halogen,
optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --OR.sup.C1, --N(R.sup.C1).sub.2, and --SR.sup.C1,
wherein each occurrence of R.sup.C1 is independently selected from
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or two R.sup.3 groups bound to the same
ring carbon atom are taken together to form .dbd.O, or two R.sup.3
groups bound to the same or different ring carbon atoms are joined
to form an optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl ring; R.sup.4 is selected from a
bond, an optionally substituted C.sub.1-C.sub.4 alkylene, and an
optionally substituted C.sub.2-C.sub.4 alkenylene or alkynylene,
wherein: one or more methylene units of the alkylene, alkenylene or
alkynylene other than a methylene unit bound to a nitrogen atom is
optionally and independently replaced with --O--, --S--,
--N(R.sup.6)--, or --S(.dbd.O).sub.2--, and two substituents on
either the same or adjacent carbon atoms in the alkylene,
alkenylene or alkynylene are taken together to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring; each R.sup.6 is independently selected from hydrogen, and
--C.sub.1-C.sub.6 alkyl; R.sup.7 is any one of the Formulae
(ii-1)-(ii-20): ##STR00285## ##STR00286## ##STR00287## wherein:
L.sup.3 is a bond, an optionally substituted C.sub.1-C.sub.4
alkylene, or an optionally substituted C.sub.2-C.sub.4 alkenylene
or alkynylene, wherein one or more methylene units of the alkylene,
alkenylene or alkynylene are optionally and independently replaced
with --O--, --S--, or --N(R.sup.6)--; L.sup.4 is a bond, an
optionally substituted C.sub.1-C.sub.4 alkylene, or an optionally
substituted C.sub.2-C.sub.4 alkenylene or alkynylene; R.sup.E1 is
selected from the group consisting of hydrogen, halogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, --CN, --CH.sub.2OR.sup.E1a,
--CH.sub.2N(R.sup.E1a).sub.2, --CH.sub.2SR.sup.E1a, --OR.sup.E1a,
--N(R.sup.E1a).sub.2, --Si(R.sup.E1a).sub.3, and --SR.sup.E1a,
wherein each occurrence of R.sup.E1a is independently selected from
the group consisting of hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or two R.sup.E1a groups are joined to form
an optionally substituted heterocyclic ring; R.sup.E2 is selected
from the group consisting of hydrogen, halogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, --CN, --CH.sub.2OR.sup.E2a,
--CH.sub.2N(R.sup.E2a).sub.2, --CH.sub.2SR.sup.E2a, --OR.sup.E2a,
--N(R.sup.E2a).sub.2, and --SR.sup.E2a, wherein each occurrence of
R.sup.E2a is independently selected from the group consisting of
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or two
R.sup.E2a groups are joined to form an optionally substituted
heterocyclic ring; R.sup.E3 is selected from the group consisting
of hydrogen, halogen, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, optionally substituted heteroaryl,
--CN, --CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or two R.sup.E3a groups are
joined to form an optionally substituted heterocyclic ring;
optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or
R.sup.E1 and R.sup.E2 are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; R.sup.E4
is a leaving group; R.sup.E5 is halogen; Y is O, S, or NR.sup.E6,
wherein R.sup.E6 is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group; a is 1 or 2; z is
0, 1, 2, 3, 4, 5, or 6; each instance of R.sup.8, if present, is
independently selected from deuterium, halogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, optionally substituted heteroaryl,
--OR.sup.D1, --N(R.sup.D1).sub.2, and --SR.sup.D1, wherein each
occurrence of R.sup.D1 is independently selected from hydrogen,
optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, and optionally substituted aryl, optionally
substituted heteroaryl, or two R.sup.8 groups are joined to form an
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl ring; m is 0, 1, 2, 3 or 4; and n is 0, 1,
2, 3, 4, 5 or 6.
17-18. (canceled)
19. The method of claim 1, wherein the transcription inhibitor is
of Formula (V): ##STR00288## or a pharmaceutically acceptable salt
thereof, wherein: R.sup.1 is --NR.sup.aR.sup.b, --CHR.sup.aR.sup.b
or --OR.sup.a, wherein each of R.sup.a and R.sup.b is independently
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, a nitrogen
protecting group when attached to a nitrogen atom, or an oxygen
protecting group when attached to an oxygen atom, or R.sup.a and
R.sup.b are joined to form an optionally substituted carbocyclic,
optionally substituted heterocyclic, optionally substituted aryl,
or optionally substituted heteroaryl ring; each of R.sup.3 and
R.sup.4 is independently hydrogen, halogen, or optionally
substituted C.sub.1-C.sub.6 alkyl, or R.sup.3 and R.sup.4 are
joined to form an optionally substituted C.sub.3-C.sub.6
carbocyclyl ring; R.sup.5 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group; L.sup.1 is
--NR.sup.L1--, --NR.sup.L1C(.dbd.O)--, --C(.dbd.O)NR.sup.L1--,
--O--, or --S--, wherein R.sup.L1 is hydrogen, optionally
substituted C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group;
Ring A is optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; L.sup.2 is a bond,
--C(.dbd.O)--, --NR.sup.L2--, --C(.dbd.O)NR.sup.L2--,
--NR.sup.L2C(.dbd.O)--, --O--, or --S--, wherein R.sup.L2 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protection group; Ring B is absent, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, or optionally substituted heteroaryl; and R.sup.2
is any of Formulae (i-1)-(i-46): ##STR00289## ##STR00290##
##STR00291## ##STR00292## ##STR00293## ##STR00294## ##STR00295##
wherein: L.sup.3 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain, optionally wherein one or more carbon units of
the hydrocarbon chain are independently replaced with --C.dbd.O--,
--O--, --S--, --NR.sup.L3a--, --NR.sup.L3aC(.dbd.O)--,
--C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--, --C(.dbd.O)S--,
--OC(.dbd.O)--, --C(.dbd.O)O--, --NR.sup.L3aC(.dbd.S)--,
--C(.dbd.S)NR.sup.L3a--, trans-CR.sup.L3b.dbd.CR.sup.L3b--,
cis-CR.sup.L3b.dbd.CR.sup.L3b--, --C.ident.C--, --S(.dbd.O)--,
--S(.dbd.O)O--, --OS(.dbd.O)--, --S(.dbd.O)NR.sup.L3a--,
--NR.sup.L3aS(.dbd.O)--, --S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--,
--OS(.dbd.O).sub.2--, --S(.dbd.O).sub.2NR.sup.L3a--, or
--NR.sup.L3aS(.dbd.O).sub.2--, wherein R.sup.L3a is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L3b is
independently hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl, or two R.sup.L3b groups are joined to form
an optionally substituted carbocyclic or optionally substituted
heterocyclic ring; L.sup.4 is a bond or an optionally substituted,
branched or unbranched C.sub.1-6 hydrocarbon chain; each of
R.sup.E1, R.sup.E2, and R.sup.E3 is independently hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.EE groups are
joined to form an optionally substituted heterocyclic ring; or
R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and
R.sup.E2 are joined to form an optionally substituted carbocyclic
or optionally substituted heterocyclic ring; R.sup.E4 is a leaving
group; R.sup.E5 is halogen; R.sup.E6 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
instance of Y is independently O, S, or NR.sup.E7, wherein R.sup.E7
is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; a is 1 or 2; and each instance of z is
independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
20-21. (canceled)
22. The method of claim 1, wherein the transcription inhibitor is
of Formula (VI): ##STR00296## or a pharmaceutically acceptable salt
thereof, wherein: R.sup.1 is optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted
heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b, --SR.sup.b,
--C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
R.sup.3 is hydrogen, halogen, or optionally substituted
C.sub.1-C.sub.6 alkyl; R.sup.5 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group; L.sup.1 is a
bond, --NR.sup.L1--(CH.sub.2).sub.t--, --O--, or --S--; R.sup.L1 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protecting group; t is 0 or an integer between 1 and 5,
inclusive; Ring A is optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; L.sup.2 is a bond, optionally
substituted C.sub.1-4 alkylene, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.L2C(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group; Ring B is
absent, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl; and R.sup.2 is any of Formulae
(i-1)-(i-46): ##STR00297## ##STR00298## ##STR00299## ##STR00300##
##STR00301## ##STR00302## ##STR00303## wherein: L.sup.3 is a bond
or an optionally substituted C.sub.1-4 hydrocarbon chain,
optionally wherein one or more carbon units of the hydrocarbon
chain are independently replaced with --C.dbd.O--, --O--, --S--,
--NR.sup.L3a--, --NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--,
--SC(.dbd.O)--, --C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; L.sup.4 is a bond or an optionally
substituted, branched or unbranched C.sub.1-6 hydrocarbon chain;
each of R.sup.E1, R.sup.E2, and R.sup.E3 is independently hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.EE groups are
joined to form an optionally substituted heterocyclic ring; or
R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and
R.sup.E2 are joined to form an optionally substituted carbocyclic
or optionally substituted heterocyclic ring; R.sup.E4 is a leaving
group; R.sup.E5 is halogen; R.sup.E6 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
instance of Y is independently O, S, or NR.sup.E7, wherein R.sup.E7
is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; a is 1 or 2; and each instance of z is
independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
23. (canceled)
24. The method of claim 1, wherein the transcription inhibitor is
of Formula (VII): ##STR00304## or a pharmaceutically acceptable
salt thereof, wherein: R.sup.1 is optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted
heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b, --SR.sup.b,
--C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
each of R.sup.3 and R.sup.4 is independently hydrogen, halogen, or
optionally substituted C.sub.1-C.sub.6 alkyl; L.sup.1 is a bond,
--NR.sup.L1--(CH.sub.2).sub.t--, --O--, or --S--; R.sup.L1 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protecting group; t is 0 or an integer between 1 and 5,
inclusive; Ring A is optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; L.sup.2 is a bond, optionally
substituted C.sub.1-4 alkylene, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.L2C(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group; Ring B is
absent, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl; and R.sup.2 is any of Formulae
(i-1)-(i-46): ##STR00305## ##STR00306## ##STR00307## ##STR00308##
##STR00309## ##STR00310## ##STR00311## wherein: L.sup.3 is a bond
or an optionally substituted C.sub.1-4 hydrocarbon chain,
optionally wherein one or more carbon units of the hydrocarbon
chain are independently replaced with --C.dbd.O--, --O--, --S--,
--NR.sup.L3a--, --NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--,
--SC(.dbd.O)--, --C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; L.sup.4 is a bond or an optionally
substituted, branched or unbranched C.sub.1-6 hydrocarbon chain;
each of R.sup.E1, R.sup.E2, and R.sup.E3 is independently hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.EE, --CH.sub.2N(RE).sub.2, --CH.sub.2SR.sup.EE,
--OR.sup.EE, --N(R.sup.EE).sub.2, --Si(R.sup.EE).sub.3, and
--SR.sup.EE, wherein each occurrence of R.sup.EE is independently
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl, or two R.sup.EE groups are joined to form
an optionally substituted heterocyclic ring; or R.sup.E1 and
R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and R.sup.E2 are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; R.sup.E4 is a leaving group;
R.sup.E5 is halogen; R.sup.E6 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
instance of Y is independently O, S, or NR.sup.E7, wherein R.sup.E7
is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; a is 1 or 2; and each instance of z is
independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
25. The method of claim 1, wherein the transcription inhibitor is
of Formula (VIII): ##STR00312## or a pharmaceutically acceptable
salt thereof, wherein: R.sup.1 is optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted
heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b, --SR.sup.b,
--C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
each of R.sup.3 and R.sup.4 is independently hydrogen, halogen, or
optionally substituted C.sub.1-C.sub.6 alkyl; R.sup.5 is hydrogen,
optionally substituted C.sub.1-C.sub.6 alkyl, or a nitrogen
protecting group; L.sup.1 is a bond,
--NR.sup.L1--(CH.sub.2).sub.t--, --O--, or --S--; R.sup.L1 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protecting group; t is 0 or an integer between 1 and 5,
inclusive; Ring A is optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; L.sup.2 is a bond, optionally
substituted C.sub.1-4 alkylene, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.L2C(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group; Ring B is
absent, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl; and R.sup.2 is any of Formulae
(i-1)-(i-46): ##STR00313## ##STR00314## ##STR00315## ##STR00316##
##STR00317## ##STR00318## ##STR00319## wherein: L.sup.3 is a bond
or an optionally substituted C.sub.1-4 hydrocarbon chain,
optionally wherein one or more carbon units of the hydrocarbon
chain are independently replaced with --C.dbd.O--, --O--, --S--,
--NR.sup.L3a--, --NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--,
--SC(.dbd.O)--, --C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; L.sup.4 is a bond or an optionally
substituted, branched or unbranched C.sub.1-6 hydrocarbon chain;
each of R.sup.E1, R.sup.E2, and R.sup.E3 is independently hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.EE, --CH.sub.2N(RE).sub.2, --CH.sub.2SR.sup.EE,
--OR.sup.EE, --N(R.sup.EE).sub.2, --Si(R.sup.EE).sub.3, and
--SR.sup.EE, wherein each occurrence of R.sup.EE is independently
hydrogen, optionally substituted alkyl, optionally substituted
alkoxy, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl, or two R.sup.EE groups are joined to form
an optionally substituted heterocyclic ring; or R.sup.E1 and
R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and R.sup.E2 are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; R.sup.E4 is a leaving group;
R.sup.E5 is halogen; R.sup.E6 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
instance of Y is independently O, S, or NR.sup.E7, wherein R.sup.E7
is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; a is 1 or 2; and each instance of z is
independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
26-27. (canceled)
28. The method of claim 1, wherein the transcription inhibitor is
of Formula (IX): ##STR00320## or a pharmaceutically acceptable salt
thereof, wherein: X.sup.A is C(R.sup.D) or N; X.sup.B is C(R.sup.D)
or N; X.sup.C is C(R.sup.D) or N; wherein no more than two of
X.sup.A, X.sup.B, and X.sup.C can be N; ##STR00321## L is a bond or
of the formula: ##STR00322## each instance of R.sup.A is
independently hydrogen, halogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.A1, --N(R.sup.A1).sub.2,
--SR.sup.A1, --CN, --SCN, --C(.dbd.NR.sup.A1)R.sup.A1,
--C(.dbd.NR.sup.A1)OR.sup.A1, --C(.dbd.NR.sup.A1)N(R.sup.A1).sub.2,
--C(.dbd.O)R.sup.A1, --C(.dbd.O)OR.sup.A1,
--C(.dbd.O)N(R.sup.A1).sub.2, --NO.sub.2,
--NR.sup.A1C(.dbd.O)R.sup.A1, --NR.sup.A1C(.dbd.O)OR.sup.A1,
--NR.sup.A1C(.dbd.O)N(R.sup.A1).sub.2, --OC(.dbd.O)R.sup.A1,
--OC(.dbd.O)OR.sup.A1, or --OC(.dbd.O)N(R.sup.A1).sub.2, or two
instances of R.sup.A are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.A1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two instances of R.sup.A1 are joined to form a substituted
or unsubstituted heterocyclic ring; R.sup.B is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--C(.dbd.O)R.sup.B1, --C(.dbd.O)OR.sup.B1,
--C(.dbd.O)N(R.sup.B1).sub.2, or a nitrogen protecting group, or
R.sup.B and R.sup.C are joined to form a substituted or
unsubstituted heterocyclic ring; each instance of R.sup.B1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, or an oxygen protecting group when attached to
an oxygen atom, or two instances of R.sup.B1 are joined to form a
substituted or unsubstituted heterocyclic ring; R.sup.C is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--C(.dbd.O)R.sup.C1, --C(.dbd.O)OR.sup.C1,
--C(.dbd.O)N(R.sup.C1).sub.2, or a nitrogen protecting group, or
R.sup.C and R.sup.B are joined to form a substituted or
unsubstituted heterocyclic ring; each instance of R.sup.C1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, or an oxygen protecting group when attached to
an oxygen atom, or two instances of R.sup.C1 are joined to form a
substituted or unsubstituted heterocyclic ring; each instance of
R.sup.D is independently hydrogen, halogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.D1,
--N(R.sup.D1).sub.2, --SR.sup.D1, --CN, --SCN,
--C(.dbd.NR.sup.D1)R.sup.D1, --C(.dbd.NR.sup.D1)OR.sup.D1,
--C(.dbd.NR.sup.D1)N(R.sup.D1).sub.2, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, --NO.sub.2,
--NR.sup.D1C(.dbd.O)R.sup.D1, --NR.sup.D1C(.dbd.O)OR.sup.D1,
--NR.sup.D1C(.dbd.O)N(R.sup.D1).sub.2, --OC(.dbd.O)R.sup.D1,
--OC(.dbd.O)OR.sup.D1, or --OC(.dbd.O)N(R.sup.D1).sub.2, or two
instances of R.sup.D are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two instances of R.sup.D1 are joined to form a substituted
or unsubstituted heterocyclic ring; R.sup.E is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--C(.dbd.O)R.sup.E1, --C(.dbd.O)OR.sup.E1,
--C(.dbd.O)N(R.sup.E1).sub.2, or a nitrogen protecting group; each
instance of R.sup.E1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, or an oxygen protecting
group when attached to an oxygen atom, or two instances of R.sup.E1
are joined to form a substituted or unsubstituted heterocyclic
ring; each instance of R.sup.F is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.F1, --N(R.sup.F1).sub.2, --SR.sup.F1, --CN, --SCN,
--C(.dbd.NR.sup.F1)R.sup.F1, --C(.dbd.NR.sup.F1)OR.sup.F1,
--C(.dbd.NR.sup.F1)N(R.sup.F1).sub.2, --C(.dbd.O)R.sup.F1,
--C(.dbd.O)OR.sup.F1, --C(.dbd.O)N(R.sup.F1).sub.2, --NO.sub.2,
--NR.sup.F1C(.dbd.O)R.sup.F1, --NR.sup.F1C(.dbd.O)OR.sup.F1,
--NR.sup.F1C(.dbd.O)N(R.sup.F1).sub.2, --OC(.dbd.O)R.sup.F1,
--OC(.dbd.O)OR.sup.F1, or --OC(.dbd.O)N(R.sup.F1).sub.2, or two
instances of R.sup.F are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.F1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two instances of R.sup.F1 are joined to form a substituted
or unsubstituted heterocyclic ring; a is 0, 1, 2, 3, 4, or 5; d is
0, 1, or 2; f is 0, 1, 2, 3 or 4; and g is 0, 1, 2, or 3.
29-30. (canceled)
31. The method of claim 1, wherein the transcription inhibitor is
of Formula (X): ##STR00323## or a pharmaceutically acceptable salt
thereof, wherein: is a single or double bond; X.sup.1 is --O--,
--S--, or --C(R.sup.X1).sub.2--, wherein each instance of R.sup.X1
is independently hydrogen, halogen, or substituted or unsubstituted
C.sub.1-6 alkyl; Y.sup.1 is N or CR.sup.Y1, wherein R.sup.Y1 is
hydrogen, halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
Z.sup.1 is --O--, --N(R.sup.Z1)-- or --C(R.sup.Z1).sub.2--, wherein
each instance of R.sup.Z1 is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, or a
nitrogen protecting group when attached to a nitrogen atom, or two
instances of R.sup.Z1 are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring; each instance of R.sup.A1 is independently
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.A1a,
--N(R.sup.A1a).sub.2, --SR.sup.A1a, --CN, --SCN,
--C(.dbd.NR.sup.A1a)R.sup.A1a, --C(.dbd.NR.sup.A1a)OR.sup.A1a,
--C(.dbd.NR.sup.A1a)N(R.sup.A1a).sub.2, --C(.dbd.O)R.sup.A1a,
--C(.dbd.O)OR.sup.A1a, --C(.dbd.O)N(R.sup.A1a).sub.2, --NO.sub.2,
--NR.sup.A1aC(.dbd.O)R.sup.A1a, --NR.sup.A1aC(.dbd.O)OR.sup.A1a,
--NR.sup.A1aC(.dbd.O)N(R.sup.A1a).sub.2, --OC(.dbd.O)R.sup.A1a,
--OC(.dbd.O)OR.sup.A1a, or --OC(.dbd.O)N(R.sup.A1a).sub.2, wherein
each instance of R.sup.A1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.A1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; a is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
each instance of R.sup.B1 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.B1a, --N(R.sup.B1a).sub.2,
--SR.sup.B1a, --CN, --SCN, --C(.dbd.NR.sup.B1a)R.sup.B1a,
--C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; b is 0, 1, 2, or 3; R.sup.C1 is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
an oxygen protecting group; R.sup.D1 is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.D1a, --N(R.sup.D1a).sub.2,
--SR.sup.D1a, --CN, --SCN, --C(.dbd.NR.sup.D1a)R.sup.D1a,
--C(.dbd.NR.sup.D1a)OR.sup.D1a,
--C(.dbd.NR.sup.D1a)N(R.sup.D1a).sub.2, --C(.dbd.O)R.sup.D1a,
--C(.dbd.O)OR.sup.D1a, --C(.dbd.O)N(R.sup.D1a).sub.2, --NO.sub.2,
--NR.sup.D1aC(.dbd.O)R.sup.D1a, --NR.sup.D1aC(.dbd.O)OR.sup.D1a,
--NR.sup.D1aC(.dbd.O)N(R.sup.D1a).sub.2, --OC(.dbd.O)R.sup.D1a,
--OC(.dbd.O)OR.sup.D1a, or --OC(.dbd.O)N(R.sup.D1a).sub.2, wherein
each instance of R.sup.D1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.D1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; R.sup.E1 is hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group; R.sup.F1 is hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group; R.sup.G1 is hydrogen, halogen, or
substituted or unsubstituted C.sub.1-6 alkyl; and R.sup.H1 is
hydrogen, halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
or R.sup.G1 and R.sup.H1 are joined to form a substituted or
unsubstituted phenyl ring.
32. (canceled)
33. The method of claim 1, wherein the transcription inhibitor is
of Formula (XI): ##STR00324## or a pharmaceutically acceptable salt
thereof, wherein: is a single or double bond; W.sup.2 is
--S(.dbd.O)OR.sup.W2, --S(.dbd.O)N(R.sup.2).sub.2,
--S(.dbd.O).sub.2OR.sup.W2, --S(.dbd.O).sub.2N(R.sup.W2).sub.2,
##STR00325## each instance of R.sup.W2 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, an
oxygen protecting group when attached to an oxygen atom, or a
nitrogen protecting group when attached to a nitrogen atom, or two
instances of R.sup.W2 are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring; and R.sup.V2 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group;
U.sup.2 is R.sup.B2 or --OR.sup.C2; X.sup.2 is --O--, --S--,
--N(R.sup.X2)--, or --C(R.sup.X2).sub.2--, wherein each instance of
R.sup.X2 is independently hydrogen, halogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group when
attached to a nitrogen atom; Z.sup.2 is --O--, --N(R.sup.Z2)-- or
--C(R.sup.Z2).sub.2--, wherein each instance of R.sup.Z2 is
independently hydrogen, halogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or a nitrogen protecting group when
attached to a nitrogen atom, or two instances of R.sup.Z2 are
joined to form a substituted or unsubstituted carbocyclic or
substituted or unsubstituted heterocyclic ring; each instance of
R.sup.A2 is independently hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.A2a, --N(R.sup.A2a).sub.2, --SR.sup.A2a, --CN, --SCN,
--C(.dbd.NR.sup.A2a)R.sup.A2a, --C(.dbd.NR.sup.A2a)OR.sup.A2a,
--C(.dbd.NR.sup.A2a)N(R.sup.A2a).sub.2, --C(.dbd.O)R.sup.A2a,
--C(.dbd.O)OR.sup.A2a, --C(.dbd.O)N(R.sup.A2a).sub.2, --NO.sub.2,
--NR.sup.A2aC(.dbd.O)R.sup.A2a, --NR.sup.A2aC(.dbd.O)OR.sup.A2a,
--NR.sup.A2aC(.dbd.O)N(R.sup.A2a).sub.2, --OC(.dbd.O)R.sup.A2a,
--OC(.dbd.O)OR.sup.A2a, or --OC(.dbd.O)N(R.sup.A2a).sub.2, wherein
each instance of R.sup.A2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.A2a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; k is 0, 1, 2, 3, 4, 5, 6, 7, 8, or
9; each instance of R.sup.B2 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.B2a, --N(R.sup.B2a).sub.2,
--SR.sup.B2a, --CN, --SCN, --C(.dbd.NR.sup.B2a)R.sup.B2a,
--C(.dbd.NR.sup.B2a)OR.sup.B2a,
--C(.dbd.NR.sup.B2a)N(R.sup.B2a).sub.2, --C(.dbd.O)R.sup.B2a,
--C(.dbd.O)OR.sup.B2a, --C(.dbd.O)N(R.sup.B2a).sub.2, --NO.sub.2,
--NR.sup.B2aC(.dbd.O)R.sup.B2a, --NR.sup.B2aC(.dbd.O)OR.sup.B2a,
--NR.sup.B2aC(.dbd.O)N(R.sup.B2a).sub.2, --OC(.dbd.O)R.sup.B2a,
--OC(.dbd.O)OR.sup.B2a, or --OC(.dbd.O)N(R.sup.B2a).sub.2, wherein
each instance of R.sup.B2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B2a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; m is 0, 1, 2, or 3; R.sup.C2 is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
an oxygen protecting group; each instance of R.sup.D2 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.D2a, --N(R.sup.D2a).sub.2, --SR.sup.D2a, --CN, --SCN,
--C(.dbd.NR.sup.D2a)R.sup.D2a, --C(.dbd.NR.sup.D2a)OR.sup.D2a,
--C(.dbd.NR.sup.D2a)N(R.sup.D2a).sub.2, --C(.dbd.O)R.sup.D2a,
--C(.dbd.O)OR.sup.D2a, --C(.dbd.O)N(R.sup.D2a).sub.2, --NO.sub.2,
--NR.sup.D2aC(.dbd.O)R.sup.D2a, --NR.sup.D2aC(.dbd.O)OR.sup.D2a,
--NR.sup.D2aC(.dbd.O)N(R.sup.D2a).sub.2, --OC(.dbd.O)R.sup.D2a,
--OC(.dbd.O)OR.sup.D2a, or --OC(.dbd.O)N(R.sup.D2a).sub.2, wherein
each instance of R.sup.D2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.D2a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; n is 0, 1, or 2; R.sup.E2 is
hydrogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; R.sup.F2 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; R.sup.G2 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; and R.sup.H2 is hydrogen, halogen,
or substituted or unsubstituted C.sub.1-6 alkyl; or R.sup.G2 and
R.sup.H2 are joined to form a substituted or unsubstituted phenyl
ring.
34. (canceled)
35. The method of claim 1, wherein the transcription inhibitor is
of Formula (XII): ##STR00326## or a pharmaceutically acceptable
salt thereof, wherein: each instance of is indecently a single or
double bond; X.sup.3 is --O--, --S--, --N(R.sup.X3)--, or
--C(R.sup.X3).sub.2--, wherein each instance of R.sup.X3 is
independently hydrogen, halogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group when attached to a
nitrogen atom; Y.sup.3 is N or CR.sup.Y3, wherein R.sup.Y3 is
hydrogen, halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
Z.sup.3 is --O--, --N(R.sup.Z3)-- or --C(R.sup.Z3).sub.2--, wherein
each instance of R.sup.Z3 is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, or a
nitrogen protecting group when attached to a nitrogen atom, or two
instances of R.sup.Z3 are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring; each instance of R.sup.A3 is independently
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.A3a,
--N(R.sup.A3a).sub.2, --SR.sup.A3a, --CN, --SCN,
--C(.dbd.NR.sup.A3a)R.sup.A3a, --C(.dbd.NR.sup.A3a)OR.sup.A3a,
--C(.dbd.NR.sup.A3a)N(R.sup.A3a).sub.2, --C(.dbd.O)R.sup.A3a,
--C(.dbd.O)OR.sup.A3a, --C(.dbd.O)N(R.sup.A3a).sub.2, --NO.sub.2,
--NR.sup.A3aC(.dbd.O)R.sup.A3a, --NR.sup.A3aC(.dbd.O)OR.sup.A3a,
--NR.sup.A3aC(.dbd.O)N(R.sup.A3a).sub.2, --OC(.dbd.O)R.sup.A3a,
--OC(.dbd.O)OR.sup.A3a, or --OC(.dbd.O)N(R.sup.A3a).sub.2, wherein
each instance of R.sup.A3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.A3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; p is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
each instance of R.sup.B3 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.B3a, --N(R.sup.B3a).sub.2,
--SR.sup.B3a, --CN, --SCN, --C(.dbd.NR.sup.B3a)R.sup.B3a,
--C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; q is 0, 1, 2, or 3; R.sup.C3 is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
an oxygen protecting group; R.sup.D3 is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.D3a, --N(R.sup.D3a).sub.2,
--SR.sup.D3a, --CN, --SCN, --C(.dbd.NR.sup.D3a)R.sup.D3a,
--C(.dbd.NR.sup.D3a)OR.sup.D3a,
--C(.dbd.NR.sup.D3a)N(R.sup.D3a).sub.2, --C(.dbd.O)R.sup.D3a,
--C(.dbd.O)OR.sup.D3a, --C(.dbd.O)N(R.sup.D3a).sub.2, --NO.sub.2,
--NR.sup.D3aC(.dbd.O)R.sup.D3a, --NR.sup.D3aC(.dbd.O)OR.sup.D3a,
--NR.sup.D3aC(.dbd.O)N(R.sup.D3a).sub.2, --OC(.dbd.O)R.sup.D3a,
--OC(.dbd.O)OR.sup.D3a, or --OC(.dbd.O)N(R.sup.D3a).sub.2, wherein
each instance of R.sup.D3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.D3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; Ring A is substituted or
unsubstituted, 5- to 6-membered, monocyclic, heterocyclic or
heteroaryl ring; each instance of R.sup.J3 is independently
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.J3a,
--N(R.sup.J3a).sub.2, --SR.sup.J3a, --CN, --SCN,
--C(.dbd.NR.sup.J3a)R.sup.J3a, --C(.dbd.NR.sup.J3a)OR.sup.J3a,
--C(.dbd.NR.sup.J3a)N(R.sup.J3a).sub.2, --C(.dbd.O)R.sup.J3a,
--C(.dbd.O)OR.sup.J3a, --C(.dbd.O)N(R.sup.J3a).sub.2, --NO.sub.2,
--NR.sup.J3aC(.dbd.O)R.sup.J3a, --NR.sup.J3aC(.dbd.O)OR.sup.J3a,
--NR.sup.J3aC(.dbd.O)N(R.sup.J3a).sub.2, --OC(.dbd.O)R.sup.J3a,
--OC(.dbd.O)OR.sup.J3a, --OC(.dbd.O)N(R.sup.J3a).sub.2, or a
nitrogen protecting group when attached to a nitrogen atom, wherein
each instance of R.sup.J3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.J3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; r is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
R.sup.F3 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; R.sup.G3 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; and R.sup.H3 is hydrogen, halogen,
or substituted or unsubstituted C.sub.1-6 alkyl; or R.sup.G3 and
R.sup.H3 are joined to form a substituted or unsubstituted phenyl
ring.
36. (canceled)
37. The method of claim 1, wherein the transcription inhibitor is
of Formula (XIII): ##STR00327## or pharmaceutically acceptable salt
thereof, wherein: A is .dbd.N-- or .dbd.C(R.sup.B4); A.sup.1 is
--N(R.sup.4)-- or --C(R4).sub.2--; R.sup.1 is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl; R.sup.2 and R.sup.3 are each
independently hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, or a nitrogen
protecting group, wherein each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.D1 groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring, or a nitrogen protecting group when attached to a
nitrogen atom; R.sup.4 is hydrogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--C(.dbd.O)R.sup.D1, --C(.dbd.O)OR.sup.D1, or
--C(.dbd.O)N(R.sup.D1).sub.2, wherein each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.D1 groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring, or a nitrogen protecting group when attached to a
nitrogen atom; each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.B2 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B2a, --N(R.sup.B2a).sub.2, --SR.sup.B2a, --CN, --SCN,
--C(.dbd.NR.sup.B2a)R.sup.B2a, --C(.dbd.NR.sup.B2a)OR.sup.B2a,
--C(.dbd.NR.sup.B2a)N(R.sup.B2a).sub.2, --C(.dbd.O)R.sup.B2a,
--C(.dbd.O)OR.sup.B2a, --C(.dbd.O)N(R.sup.B2a).sub.2, --NO.sub.2,
--NR.sup.B2aC(.dbd.O)R.sup.B2a, --NR.sup.B2aC(.dbd.O)OR.sup.B2a,
--NR.sup.B2aC(.dbd.O)N(R.sup.B2a).sub.2, --OC(.dbd.O)R.sup.B2a,
--OC(.dbd.O)OR.sup.B2a, or --OC(.dbd.O)N(R.sup.B2a).sub.2, wherein
each instance of R.sup.B2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B2a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.B3 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B3a, --N(R.sup.B3a).sub.2, --SR.sup.B3a, --CN, --SCN,
--C(.dbd.NR.sup.B3a)R.sup.B3a, --C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.B4 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B4a, --N(R.sup.B4a).sub.2, --SR.sup.B4a, --CN, --SCN,
--C(.dbd.NR.sup.B4a)R.sup.B4a, --C(.dbd.NR.sup.B4a)OR.sup.B4a,
--C(.dbd.NR.sup.B4a)N(R.sup.B4a).sub.2, --C(.dbd.O)R.sup.B4a,
--C(.dbd.O)OR.sup.B4a, --C(.dbd.O)N(R.sup.B4a).sub.2, --NO.sub.2,
--NR.sup.B4aC(.dbd.O)R.sup.B4a, --NR.sup.B4aC(.dbd.O)OR.sup.B4a,
--NR.sup.B4aC(.dbd.O)N(R.sup.B4a).sub.2, --OC(.dbd.O)R.sup.B4a,
--OC(.dbd.O)OR.sup.B4a, or --OC(.dbd.O)N(R.sup.B4a).sub.2, wherein
each instance of R.sup.B4a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B4a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; m is 0 or an integer between 1 and
8, inclusive; p is 0 or an integer between 1 and 4, inclusive; each
of L.sup.1 and L.sup.2 is independently a bond, ##STR00328## each
instance of R.sup.a1 is independently hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group; or, if L.sup.1 is ##STR00329## then
R.sup.a1 of L.sup.1 and one instance of R.sup.B1 that is ortho to
L.sup.1 are joined to form a substituted or unsubstituted
heterocyclic ring or substituted or unsubstituted heteroaryl ring;
and each instance of R.sup.C1 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.c1a, --N(R.sup.c1a).sub.2,
--SR.sup.c1a, --CN, --C(.dbd.O)R.sup.c1a, --C(.dbd.O)OR.sup.c1a,
--C(.dbd.O)N(R.sup.c1a).sub.2, --NR.sup.c1aC(.dbd.O)R.sup.c1a,
--NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2--OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.c1a groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring.
38. (canceled)
39. The method of claim 1, wherein the transcription inhibitor is
of Formula (XIV): ##STR00330## or pharmaceutically acceptable salt
thereof, wherein: R.sup.1 is hydrogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, or a
nitrogen protecting group when attached to a nitrogen atom; R.sup.2
is hydrogen, halogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.D1,
--N(R.sup.D1).sub.2, --SR.sup.D1, --CN, --SCN,
--C(.dbd.NR.sup.D1)R.sup.D1, --C(.dbd.NR.sup.D1)OR.sup.D1,
--C(.dbd.NR.sup.D1)N(R.sup.D1).sub.2, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, --NO.sub.2,
--NR.sup.D1C(.dbd.O)R.sup.D1, --NR.sup.D1C(.dbd.O)OR.sup.D1,
--NR.sup.D1C(.dbd.O)N(R.sup.D1).sub.2, --OC(.dbd.O)R.sup.D1,
--OC(.dbd.O)OR.sup.D1, or --OC(.dbd.O)N(R.sup.D1).sub.2, wherein
each instance of R.sup.D1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.D1 groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; R.sup.3 and R.sup.4 are each
independently hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; or R.sup.3 and R.sup.4 groups are joined to form an
substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.5 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl;
each instance of R.sup.6 is independently halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B1a, --N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2; q is 0,
1, 2, 3, or 4; A is .dbd.N-- or .dbd.C(R.sup.2)--; each instance of
R.sup.B1 is independently hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B1a, --N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2; each
instance of R.sup.B1a is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; p is 0 or an integer between 1 and
4, inclusive; n is 0, 1, 2, 3, 4, 5, or 6; L.sup.1, L.sup.2, and
L.sup.4 are each independently a bond, ##STR00331## L.sup.3 is
##STR00332## R.sup.a1 is hydrogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, or a
nitrogen protecting group; and each instance of R.sup.c1 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.c1a, --N(R.sup.c1a).sub.2, --SR.sup.c1a, --CN,
--C(.dbd.O)R.sup.c1a, --C(.dbd.O)OR.sup.c1a,
--C(.dbd.O)N(R.sup.c1a).sub.2, --NR.sup.c1aC(.dbd.O)R.sup.c1a,
--NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2, --OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.c1a groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring.
40. (canceled)
41. The method of claim 1, wherein the transcription inhibitor is
of Formula (XV): ##STR00333## or a pharmaceutically acceptable salt
thereof, wherein: is a single or double bond; W is
--C(.dbd.O)OR.sup.Z1, --C(.dbd.O)N(R.sup.Z1).sub.2,
--S(.dbd.O)OR.sup.Z1, --S(.dbd.O)N(R.sup.Z1).sub.2,
--S(.dbd.O).sub.2OR.sup.Z1, --S(.dbd.O).sub.2N(R.sup.Z1).sup.2, or
##STR00334## Z is --O--, --N(R.sup.Z)-- or --C(R.sup.Z).sub.2--,
wherein each instance of R.sup.Z is independently hydrogen,
halogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.Z1, --SR.sup.Z1, --N(R.sup.Z1).sub.2, or a nitrogen
protecting group when attached to a nitrogen atom, or two instances
of R.sup.Z are joined to form a substituted or unsubstituted
carbocyclic or substituted or unsubstituted heterocyclic ring; each
instance of R.sup.Z1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, an oxygen protecting group
when attached to an oxygen atom, a sulfur protecting group when
attached to a sulfur atom, or a nitrogen protecting group when
attached to a nitrogen atom, or two instances of R.sup.Z1 are
joined to form a substituted or unsubstituted heterocyclic or
substituted or unsubstituted heteroaryl ring; each instance of
R.sup.A is independently hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.A1, --N(R.sup.A1).sub.2, --SR.sup.A1, --CN, --SCN,
--C(.dbd.NR.sup.A1)R.sup.A1, --C(.dbd.NR.sup.A1)OR.sup.A1,
--C(.dbd.NR.sup.A1)N(R.sup.A1).sub.2, --C(.dbd.O)R.sup.A1,
--C(.dbd.O)OR.sup.A1, --C(.dbd.O)N(R.sup.A1).sub.2, --NO.sub.2,
--NR.sup.A1C(.dbd.O)R.sup.A1, --NR.sup.A1C(.dbd.O)OR.sup.A1,
--NR.sup.A1C(.dbd.O)N(R.sup.A1).sub.2, --OC(.dbd.O)R.sup.A1,
--OC(.dbd.O)OR.sup.A1, or --OC(.dbd.O)N(R.sup.A1).sub.2, wherein
each instance of R.sup.A1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.A1 groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; n is 0, 1, 2, 3, 4, 5, 6, 7, or 8; X
is absent, --C(.dbd.O)--, or --C(R.sup.X).sub.2--, wherein each
instance of R.sup.X is independently hydrogen, halogen, or
substituted or unsubstituted C.sub.1-6 alkyl; each instance of
R.sup.B is independently hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B1, --N(R.sup.B1).sub.2, --SR.sup.B1, --CN, --SCN,
--C(.dbd.NR.sup.B1)R.sup.B1, --C(.dbd.NR.sup.B1)OR.sup.B1,
--C(.dbd.NR.sup.B1)N(R.sup.B1).sub.2, --C(.dbd.O)R.sup.B1,
--C(.dbd.O)OR.sup.B1, --C(.dbd.O)N(R.sup.B1).sub.2, --NO.sub.2,
--NR.sup.B1C(.dbd.O)R.sup.B1, --NR.sup.B1C(.dbd.O)OR.sup.B1,
--NR.sup.B1C(.dbd.O)N(R.sup.B1).sub.2, --OC(.dbd.O)R.sup.B1,
--OC(.dbd.O)OR.sup.B1, or --OC(.dbd.O)N(R.sup.B1).sub.2, wherein
each instance of R.sup.B1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B1 groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; m is 0, 1, 2, 3, or 4; R.sup.C is
hydrogen or substituted or unsubstituted C.sub.1-6 alkyl; R.sup.D
is hydrogen or substituted or unsubstituted alkyl; R.sup.E is
hydrogen or substituted or unsubstituted alkyl; R.sup.F is
hydrogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl;
R.sup.G is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, or substituted or unsubstituted heteroaryl;
and R.sup.H is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, or substituted or unsubstituted heteroaryl;
or R.sup.G and R.sup.H are joined to form a substituted or
unsubstituted phenyl ring.
42. (canceled)
43. The method of claim 1, wherein the transcription inhibitor is
of Formula (XVI): ##STR00335## or a salt, solvate or hydrate
thereof, wherein: X is N or CR.sub.5; R.sub.5 is H, alkyl,
cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is
optionally substituted; R.sub.B is H, alkyl, hydroxylalkyl,
aminoalkyl, alkoxyalkyl, haloalkyl, hydroxy, alkoxy, or
--C(.dbd.O)O--R.sub.3, each of which is optionally substituted;
Ring A is aryl or heteroaryl; each R.sub.A is independently alkyl,
cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is
optionally substituted; or any two R.sub.A together with the atoms
to which each is attached, form a fused aryl or heteroaryl group; R
is alkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; each
of which is optionally substituted; R.sub.1 is
--(CH.sub.2).sub.n-L, wherein n is 0, 1, 2, or 3, and L is H,
--C(.dbd.O)O--R.sub.3, --C(.dbd.O)--R.sub.3,
--C(.dbd.O)--N(R.sub.3R4), --S(.dbd.O).sub.2--R.sub.3,
--S(.dbd.O).sub.2--N(R.sub.3R4), --N(R.sub.3R4),
--N(R.sub.4)C(.dbd.O)R.sub.3, optionally substituted aryl, or
optionally substituted heteroaryl; R.sub.2 is H, D, halogen, or
optionally substituted alkyl; each R.sub.3 is independently
selected from the group consisting of: (i) H, aryl, substituted
aryl, heteroaryl, or substituted heteroaryl; (ii) heterocycloalkyl
or substituted heterocycloalkyl; (iii) C.sub.1-8 alkyl, C.sub.2-8
alkenyl, or C.sub.2-8 alkynyl, each containing 0, 1, 2, or 3
heteroatoms selected from O, S, and N; C.sub.3-12 cycloalkyl,
substituted C.sub.3-12 cycloalkyl, C.sub.3-12 cycloalkenyl, or
substituted C.sub.3-12 cycloalkenyl, each of which is optionally
substituted; and (iv) --NH.sub.2, --N.dbd.CR.sub.4R.sub.6; each
R.sub.4 is independently H, alkyl, alkyl, cycloalkyl,
heterocycloalkyl, aryl, or heteroaryl, each of which is optionally
substituted; or R.sub.3 and R.sub.4 are taken together with the
nitrogen atom to which they are attached to form a 4- to
10-membered ring; and R.sub.6 is alkyl, alkenyl, cycloalkyl,
cycloalkenyl, heterocycloalkyl, aryl, or heteroaryl, each of which
is optionally substituted; or R.sub.4 and R.sub.6 are taken
together with the carbon atom to which they are attached to form a
4- to 10-membered ring; m is 0, 1, 2, or 3; provided that: (a) if
Ring A is thienyl, X is N, R is phenyl or substituted phenyl,
R.sub.2 is H, R.sub.B is methyl, R.sub.1 is --(CH.sub.2).sub.n-L, n
is 1, and L is --C(.dbd.O)--N(R.sub.3R.sub.4), then R.sub.3 and
R.sub.4 are not taken together with the nitrogen atom to which they
are attached to form a morpholino ring; (b) if Ring A is thienyl, X
is N, R is substituted phenyl, R.sub.2 is H, R.sub.B is methyl,
R.sub.1 is --(CH.sub.2).sub.n-L, n is 1, L is
--C(.dbd.O)--N(R.sub.3R4), and one of R.sub.3 and R.sub.4 is H,
then the other of R.sub.3 and R.sub.4 is not methyl, hydroxyethyl,
alkoxy, phenyl, substituted phenyl, pyridyl or substituted pyridyl;
and (c) if Ring A is thienyl, X is N, R is substituted phenyl,
R.sub.2 is H, R.sub.B is methyl, R.sub.1 is --(CH.sub.2).sub.n-L, n
is 1, and L is --C(.dbd.O)O--R.sub.3, then R.sub.3 is not methyl or
ethyl.
44-45. (canceled)
46. The method of claim 1, wherein the transcription inhibitor is
of Formula (XVII): ##STR00336## or a pharmaceutically acceptable
salt thereof, wherein: R.sup.A is hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl, or
substituted or unsubstituted heteroaryl; R.sup.B is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl; or
R.sup.A and R.sup.B are joined to form a substituted or
unsubstituted, carbocyclic ring, or a substituted or unsubstituted,
heterocyclic ring; R.sup.C is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
instance of R.sup.D is independently halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; each
instance of R.sup.a is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.a groups are joined to form
a substituted or unsubstituted, heterocyclic ring, or a substituted
or unsubstituted, heteroaryl ring; m is 0, 1, 2, 3, or 4; X is
--O--, --S--, --N(R.sup.X1)--, or --C(R.sup.X2).sub.2--, wherein
R.sup.X1 is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group, and wherein each instance of
R.sup.X2 is independently hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; R.sup.E is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; R.sup.F is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; R.sup.G is hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted phenyl, or a nitrogen protecting
group; each instance of R.sup.H is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and n is 0,
1, 2, 3, or 4.
47-49. (canceled)
50. The method of claim 1, wherein the transcription inhibitor is
of Formula (XVIII): ##STR00337## or pharmaceutically acceptable
salt thereof, wherein: R.sup.A is hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl, or
substituted or unsubstituted heteroaryl; R.sup.B is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl; or
R.sup.A and R.sup.B are joined to form a substituted or
unsubstituted, carbocyclic ring, or a substituted or unsubstituted,
heterocyclic ring; R.sup.C is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group;
R.sup.1 is hydrogen, halogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl, or
substituted or unsubstituted heteroaryl; R.sup.2 and R.sup.3 are
each independently hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, or a nitrogen
protecting group, wherein each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.D1 groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring, or a nitrogen protecting group when attached to a
nitrogen atom; each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B1a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.B3 is
independently hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.B3a, --N(R.sup.B3a).sub.2, --SR.sup.B3a, --CN, --SCN,
--C(.dbd.NR.sup.B3a)R.sup.B3a, --C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.B3a groups are joined to
form a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; p is 0 or an integer between 1 and
4, inclusive; L.sup.1 is a bond, ##STR00338## R.sup.a1 is hydrogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or a nitrogen protecting group; and each
instance of R.sup.c1 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.c1a, --N(R.sup.c1a).sub.2,
--SR.sup.c1a, --CN, --C(.dbd.O)R.sup.1a, --C(.dbd.O)OR.sup.c1a,
--C(.dbd.O)N(R.sup.c1a).sub.2, --NR.sup.c1aC(.dbd.O)R.sup.c1a,
--NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2, --OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.c1a groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring.
51-57. (canceled)
58. The method of claim 1, wherein the kinase inhibitor is a
receptor tyrosine kinase (RTK) inhibitor, a fibroblast growth
factor receptor (FGFR) inhibitor, an epidermal growth factor
receptor (EGFR) inhibitor, a mitogen-activated protein kinase (MEK)
inhibitor, a phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)
inhibitor, a receptor tyrosine-protein kinase erbB-2 (HER2)
inhibitor, a mammalian target of rapamycin (mTOR) inhibitor, or an
anaplastic lymphoma kinase (ALK) inhibitor.
59-82. (canceled)
83. The method of claim 1, wherein the proliferative disease is
cancer.
84-96. (canceled)
97. A pharmaceutical composition comprising: a transcription
inhibitor recited in claim 6; a kinase inhibitor recited in claim
58; and optionally a pharmaceutically acceptable excipient; wherein
the transcription inhibitor and the kinase inhibitor are not the
same.
98-99. (canceled)
100. A method of treating a proliferative disease in a subject in
need thereof, the method comprising administering to the subject an
effective amount of: a transcription inhibitor; and radiation
therapy.
101-106. (canceled)
Description
RELATED APPLICATIONS
[0001] The present application claims priority under 35 U.S.C.
.sctn. 119(e) to U.S. provisional applications, U.S. Ser. No.
62/175,077, filed Jun. 12, 2015, and U.S. Ser. No. 62/175,035,
filed Jun. 12, 2015, each of which is incorporated herein by
reference.
BACKGROUND
[0002] Kinase inhibitor therapy against genomically selected cancer
cell lines can result in death of a substantial proportion of
cells, but in nearly all cases resistance to targeted cancer
therapies is observed. This resistance can be observed with
different kinetics and can be due to a variety of cellular
mechanisms but ultimately results in treatment failure. This
phenomenon is observed both in pre-clinical cellular and animal
models and in patients treated with these classes of drugs. Prior
work has shown that cancer cell lines dependent on Fibroblast
Growth Factor Receptor (FGFR) amplifications, mutations, and
fusions readily acquire resistance when treated with selective FGFR
inhibitors, such as BGJ398 and AZD4547, and less selective FGFR
inhibitors, such as ponatinib and pazopanib (Wang et al., Oncogene,
2015, 34(17):2167-77). There is a need to find new treatments for
proliferative diseases that are or may become resistant to kinase
inhibitors.
SUMMARY
[0003] The present disclosure provides combination therapies for
the treatment of proliferative diseases using combinations of
transcription inhibitors and kinase inhibitors. It has been found
that a combination of a transcription inhibitor and a kinase
inhibitor may be useful in treating and/or preventing proliferative
diseases in a subject, and in particular proliferative diseases
that are resistant to transcription inhibition alone or kinase
inhibition alone. In certain embodiments, the combination of a
transcription inhibitor and a kinase inhibitor is synergistic in
treating a proliferative disease (e.g., cancer).
[0004] Without wishing to be bound by any particular theory, the
ability of a cell, in particular a cancer cell, to persist in the
presence of kinase inhibition is thought to require new gene
transcription, specifically the transcription of ligands that
activate parallel kinase pathways. Therefore, blunting new gene
transcription in the context of kinase inhibition is expected to
delay and/or prevent the resistance to kinase inhibitors.
[0005] In one aspect, the present disclosure provides
pharmaceutical compositions that comprise a transcription inhibitor
and a kinase inhibitor, wherein the transcription inhibitor and
kinase inhibitor are not the same, and optionally a
pharmaceutically acceptable excipient.
[0006] The transcription inhibitor useful in the present disclosure
may be any transcription inhibitor known in the art or developed in
the future. In certain embodiments, the transcription inhibitor is
a cyclin-dependent kinase (CDK) inhibitor (e.g., CDK1, CDK2, CDK3,
CDK4, CDK5, CDK6, CDK7, CDK8, CDK9, CDK10, CDK11, or CDK12
inhibitor). In certain embodiments, the CDK inhibitor is THZ1, E9,
YKL-01-116, THZ5-31-1, dinaciclib, DCA, or palbociclib. In certain
embodiments, the transcription inhibitor is a
bromodomain-containing protein inhibitor (e.g.,
bromodomain-containing protein 2 (BRD2) inhibitor,
bromodomain-containing protein 3 (BRD3) inhibitor,
bromodomain-containing protein 4 (BRD4) inhibitor, TBP (TATA box
binding protein)-associated factor protein (TAF) inhibitor,
CREB-binding protein (CBP) inhibitor, or E1A binding protein p300
(EP300) inhibitor). In certain embodiments, the
bromodomain-containing protein inhibitor is JQ1.
##STR00001## ##STR00002##
[0007] In certain embodiments, the transcription inhibitor is a
compound of the formula:
##STR00003## ##STR00004## ##STR00005##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0008] A pharmaceutical composition of the present disclosure
further includes a kinase inhibitor, in combination with a
transcription inhibitor. Any kinase inhibitor known in the art or
developed in the future may be used in the present disclosure. In
certain embodiments, the kinase inhibitor is not a CDK inhibitor.
In certain embodiments, the kinase inhibitor is a receptor tyrosine
kinase (RTK) inhibitor, fibroblast growth factor receptor (FGFR)
inhibitor (e.g., BGJ398), epidermal growth factor receptor (EGFR)
inhibitor (e.g., erlotinib (Tarceva), AZD8931, or WZ4002),
mitogen-activated protein kinase (MEK) inhibitor (e.g.,
trametinib), phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)
inhibitor (e.g., BKM120 (buparlisib) or BEZ235 (dactolisib)),
receptor tyrosine-protein kinase erbB-2 (HER-2) inhibitor (e.g.,
lapatinib), mammalian target of rapamycin (mTOR) inhibitor (e.g.,
Torin2), or anaplastic lymphoma kinase (ALK) inhibitor (e.g.,
crizotinib).
[0009] In certain embodiments, the kinase inhibitor is a
platelet-derived growth factor receptor (PDGFR) inhibitor (e.g.,
imatinib). In certain embodiments the kinase inhibitor is a or
B-Raf enzyme inhibitor or MEK inhibitor (e.g., vemurafenib).
##STR00006## ##STR00007## ##STR00008##
[0010] In certain embodiments, the molar ratio of the transcription
inhibitor to the kinase inhibitor used in the present disclosure is
between 0.00001:1 and 100:1.
[0011] In another aspect, the present disclosure provides methods
of treating a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., therapeutically effective amount) of a transcription
inhibitor and a kinase inhibitor, such as those described
herein.
[0012] In another aspect, the present disclosure provides methods
of treating a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., therapeutically effective amount) of a pharmaceutical
composition described herein.
[0013] In certain embodiments, the subject is a human. In certain
embodiments, the subject is with a proliferative disease and has
failed therapy of the proliferative disease with a kinase inhibitor
alone and/or transcription inhibitor alone. In certain embodiments,
the transcription inhibitor and kinase inhibitor are administered
to the subject at the same time. In certain embodiments, the
transcription inhibitor and kinase inhibitor are administered to
the subject at different times.
[0014] In certain embodiments, the proliferative disease is cancer,
such as a cancer that is associated with a mutation (e.g., T790M
mutation, L858R mutation, and/or exon 19 deletion mutation) in an
epidermal growth factor receptor (EGFR) gene, a cancer that is
associated with fibroblast growth factor-2 (FGF2)-fibroblast growth
factor receptor (FGFR, e.g., FGFR1) activation through
amplification, FGFR3-TACC3 fusion, EML4-ALK fusion, HER2
amplification, or KRAS codons 12, 13 or 61 mutations, a cancer that
is associated with a mutation (e.g., Q61R mutation) in
neuroblastoma RAS viral oncogene homolog (NRAS), a cancer that is
associated with mesenchymal-epithelial transition (MET)
amplification, or a cancer that is associated with feedback
activation of signal transducer and activator of transcription 3
(STAT3).
[0015] In another aspect, the present disclosure provides methods
of preventing a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., prophylactically effective amount) of a transcription
inhibitor and a kinase inhibitor described herein.
[0016] In another aspect, the present disclosure provides methods
of preventing a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., prophylactically effective amount) of a
pharmaceutical composition described herein.
[0017] In another aspect, the present disclosure provides methods
of reducing, delaying, and/or preventing in a subject in need
thereof the resistance of a proliferative disease to a
transcription inhibitor or kinase inhibitor, the methods comprising
administering to the subject an effective amount of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein.
[0018] In another aspect, the present disclosure provides methods
of inhibiting the proliferation of a cell, the methods comprising
contacting the cell with an effective amount of (1) a transcription
inhibitor and a kinase inhibitor described herein, or (2) a
pharmaceutical composition described herein.
[0019] In another aspect, the present disclosure provides methods
of reducing, delaying, and/or preventing the resistance of a cell
to a transcription inhibitor or kinase inhibitor, the methods
comprising contacting the cell with an effective amount of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein.
[0020] In certain embodiments, the cell is in vitro. In certain
embodiments, the cell is in vivo. In certain embodiments, the
transcription inhibitor and kinase inhibitor are contacted with the
cell at the same time. In certain embodiments, the transcription
inhibitor and kinase inhibitor are contacted with the cell at
different times.
[0021] In another aspect, the present disclosure provides the
transcription inhibitors and kinase inhibitors described herein for
use in a method described herein.
[0022] In still another aspect, the present disclosure provides the
pharmaceutical compositions described herein for use in a method
described herein.
Definitions
[0023] Definitions of specific functional groups and chemical terms
are described in more detail below. The chemical elements are
identified in accordance with the Periodic Table of the Elements,
CAS version, Handbook of Chemistry and Physics, 75.sup.th Ed.,
inside cover, and specific functional groups are generally defined
as described therein. Additionally, general principles of organic
chemistry, as well as specific functional moieties and reactivity,
are described in Thomas Sorrell, Organic Chemistry, University
Science Books, Sausalito, 1999; Smith and March, March's Advanced
Organic Chemistry, 5.sup.th Edition, John Wiley & Sons, Inc.,
New York, 2001; Larock, Comprehensive Organic Transformations, VCH
Publishers, Inc., New York, 1989; and Carruthers, Some Modern
Methods of Organic Synthesis, 3.sup.rd Edition, Cambridge
University Press, Cambridge, 1987. The disclosure is not intended
to be limited in any manner by the exemplary listing of
substituents described
[0024] Compounds (e.g., transcription inhibitors and kinase
inhibitors) described herein can comprise one or more asymmetric
centers, and thus can exist in various isomeric forms, e.g.,
enantiomers and/or diastereomers. For example, the compounds
described herein can be in the form of an individual enantiomer,
diastereomer or geometric isomer, or can be in the form of a
mixture of stereoisomers, including racemic mixtures and mixtures
enriched in one or more stereoisomer. Isomers can be isolated from
mixtures by methods known to those skilled in the art, including
chiral high pressure liquid chromatography (HPLC) and the formation
and crystallization of chiral salts; or preferred isomers can be
prepared by asymmetric syntheses. See, for example, Jacques et al.,
Enantiomers, Racemates and Resolutions (Wiley Interscience, New
York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel,
Stereochemistry of Carbon Compounds (McGraw-Hill, N Y, 1962); and
Wilen, Tables of Resolving Agents and Optical Resolutions p. 268
(E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, Ind.
1972). The disclosure additionally encompasses compounds described
herein as individual isomers substantially free of other isomers,
and alternatively, as mixtures of various isomers.
[0025] When a range of values is listed, it is intended to
encompass each value and sub-range within the range. For example
"C.sub.1-6" is intended to encompass, C.sub.1, C.sub.2, C.sub.3,
C.sub.4, C.sub.5, C.sub.6, C.sub.1-6, C.sub.1-5, C.sub.1,
C.sub.1-3, C.sub.1-2, C.sub.2-6, C.sub.2-5, C.sub.2-4, C.sub.2-3,
C.sub.3-6, C.sub.3-5, C.sub.3-4, C.sub.4-6, C.sub.4-5, and
C.sub.5-6.
[0026] The term "aliphatic" includes both saturated and
unsaturated, straight chain (i.e., unbranched), branched, acyclic,
cyclic, or polycyclic aliphatic hydrocarbons, which are optionally
substituted with one or more functional groups. As will be
appreciated by one of ordinary skill in the art, "aliphatic" is
intended herein to include, but is not limited to, alkyl, alkenyl,
alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties. Thus,
the term "alkyl" includes straight, branched and cyclic alkyl
groups. An analogous convention applies to other generic terms such
as "alkenyl", "alkynyl", and the like. Furthermore, the terms
"alkyl", "alkenyl", "alkynyl", and the like encompass both
substituted and unsubstituted groups. In certain embodiments,
"lower alkyl" is used to indicate those alkyl groups (cyclic,
acyclic, substituted, unsubstituted, branched or unbranched) having
1-6 carbon atoms.
[0027] In certain embodiments, the alkyl, alkenyl, and alkynyl
groups employed in the disclosure contain 1-20 aliphatic carbon
atoms. In certain other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the disclosure contain 1-10 aliphatic
carbon atoms. In yet other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the disclosure contain 1-8 aliphatic
carbon atoms. In still other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the disclosure contain 1-6 aliphatic
carbon atoms. In yet other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the disclosure contain 1-4 carbon atoms.
Illustrative aliphatic groups thus include, but are not limited to,
for example, methyl, ethyl, n-propyl, isopropyl, cyclopropyl,
--CH.sub.2-cyclopropyl, vinyl, allyl, n-butyl, sec-butyl, isobutyl,
tert-butyl, cyclobutyl, --CH.sub.2-cyclobutyl, n-pentyl,
sec-pentyl, isopentyl, tert-pentyl, cyclopentyl,
--CH.sub.2-cyclopentyl, n-hexyl, sec-hexyl, cyclohexyl,
--CH.sub.2-cyclohexyl moieties and the like, which again, may bear
one or more substituents. Alkenyl groups include, but are not
limited to, for example, ethenyl, propenyl, butenyl,
1-methyl-2-buten-1- and the like. Representative alkynyl groups
include, but are not limited to, ethynyl, 2-propynyl (propargyl),
1-propynyl, and the like.
[0028] The term "alkyl" refers to a radical of a straight-chain or
branched saturated hydrocarbon group having from 1 to 10 carbon
atoms ("C.sub.1-10 alkyl"). In some embodiments, an alkyl group has
1 to 9 carbon atoms ("C.sub.1-9 alkyl"). In some embodiments, an
alkyl group has 1 to 8 carbon atoms ("C.sub.1-8 alkyl"). In some
embodiments, an alkyl group has 1 to 7 carbon atoms ("C.sub.1-7
alkyl"). In some embodiments, an alkyl group has 1 to 6 carbon
atoms ("C.sub.1-6 alkyl"). In some embodiments, an alkyl group has
1 to 5 carbon atoms ("C.sub.1-5 alkyl"). In some embodiments, an
alkyl group has 1 to 4 carbon atoms ("C.sub.1-4 alkyl"). In some
embodiments, an alkyl group has 1 to 3 carbon atoms ("C.sub.1-3
alkyl"). In some embodiments, an alkyl group has 1 to 2 carbon
atoms ("C.sub.1-2 alkyl"). In some embodiments, an alkyl group has
1 carbon atom ("C.sub.1 alkyl"). In some embodiments, an alkyl
group has 2 to 6 carbon atoms ("C.sub.2-6 alkyl"). Examples of
C.sub.1-6 alkyl groups include methyl (C.sub.1), ethyl (C.sub.2),
propyl (C.sub.3) (e.g., n-propyl, isopropyl), butyl (C.sub.4)
(e.g., n-butyl, tert-butyl, sec-butyl, iso-butyl), pentyl (C.sub.5)
(e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl,
tertiary amyl), and hexyl (C.sub.6) (e.g., n-hexyl). Additional
examples of alkyl groups include n-heptyl (C.sub.7), n-octyl
(C.sub.8), and the like. Unless otherwise specified, each instance
of an alkyl group is independently unsubstituted (an "unsubstituted
alkyl") or substituted (a "substituted alkyl") with one or more
substituents (e.g., halogen, such as F). In certain embodiments,
the alkyl group is an unsubstituted C.sub.1-10 alkyl (such as
unsubstituted C.sub.1-6 alkyl, e.g., --CH.sub.3 (Me), unsubstituted
ethyl (Et), unsubstituted propyl (Pr, e.g., unsubstituted n-propyl
(n-Pr), unsubstituted isopropyl (i-Pr)), unsubstituted butyl (Bu,
e.g., unsubstituted n-butyl (n-Bu), unsubstituted tert-butyl
(tert-Bu or t-Bu), unsubstituted sec-butyl (sec-Bu), unsubstituted
isobutyl (i-Bu)). In certain embodiments, the alkyl group is a
substituted C.sub.1-10 alkyl (such as substituted C.sub.1-6 alkyl,
e.g., --CF.sub.3, Bn).
[0029] "Alkenyl" refers to a radical of a straight-chain or
branched hydrocarbon group having from 2 to 20 carbon atoms, one or
more carbon-carbon double bonds, and no triple bonds ("C.sub.2-20
alkenyl"). In some embodiments, an alkenyl group has 2 to 10 carbon
atoms ("C.sub.2-10 alkenyl"). In some embodiments, an alkenyl group
has 2 to 9 carbon atoms ("C.sub.2-9 alkenyl"). In some embodiments,
an alkenyl group has 2 to 8 carbon atoms ("C.sub.2-8 alkenyl"). In
some embodiments, an alkenyl group has 2 to 7 carbon atoms
("C.sub.2-7 alkenyl"). In some embodiments, an alkenyl group has 2
to 6 carbon atoms ("C.sub.2-6 alkenyl"). In some embodiments, an
alkenyl group has 2 to 5 carbon atoms ("C.sub.2-5 alkenyl"). In
some embodiments, an alkenyl group has 2 to 4 carbon atoms
("C.sub.2-4 alkenyl"). In some embodiments, an alkenyl group has 2
to 3 carbon atoms ("C.sub.2-3 alkenyl"). In some embodiments, an
alkenyl group has 2 carbon atoms ("C.sub.2 alkenyl"). The one or
more carbon-carbon double bonds can be internal (such as in
2-butenyl) or terminal (such as in 1-butenyl). Examples of
C.sub.2-4 alkenyl groups include ethenyl (C.sub.2), 1-propenyl
(C.sub.3), 2-propenyl (C.sub.3), 1-butenyl (C.sub.4), 2-butenyl
(C.sub.4), butadienyl (C.sub.4), and the like. Examples of
C.sub.2-6 alkenyl groups include the aforementioned C.sub.2-4
alkenyl groups as well as pentenyl (C.sub.5), pentadienyl
(C.sub.5), hexenyl (C.sub.6), and the like. Additional examples of
alkenyl include heptenyl (C.sub.7), octenyl (C.sub.8), octatrienyl
(C.sub.8), and the like. Unless otherwise specified, each instance
of an alkenyl group is independently optionally substituted, i.e.,
unsubstituted (an "unsubstituted alkenyl") or substituted (a
"substituted alkenyl") with one or more substituents. In certain
embodiments, the alkenyl group is unsubstituted C.sub.2-10 alkenyl.
In certain embodiments, the alkenyl group is substituted C.sub.2-10
alkenyl. In an alkenyl group, a C.dbd.C double bond for which the
stereochemistry is not specified (e.g., --CH.dbd.CHCH.sub.3 or
##STR00009##
may be an (E)- or (Z)-double bond.
[0030] "Alkynyl" refers to a radical of a straight-chain or
branched hydrocarbon group having from 2 to 20 carbon atoms, one or
more carbon-carbon triple bonds, and optionally one or more double
bonds ("C.sub.2-20 alkynyl"). In some embodiments, an alkynyl group
has 2 to 10 carbon atoms ("C.sub.2-10 alkynyl"). In some
embodiments, an alkynyl group has 2 to 9 carbon atoms ("C.sub.2-9
alkynyl"). In some embodiments, an alkynyl group has 2 to 8 carbon
atoms ("C.sub.2-8 alkynyl"). In some embodiments, an alkynyl group
has 2 to 7 carbon atoms ("C.sub.2-7 alkynyl"). In some embodiments,
an alkynyl group has 2 to 6 carbon atoms ("C.sub.2-6 alkynyl"). In
some embodiments, an alkynyl group has 2 to 5 carbon atoms
("C.sub.2-5 alkynyl"). In some embodiments, an alkynyl group has 2
to 4 carbon atoms ("C.sub.2-4 alkynyl"). In some embodiments, an
alkynyl group has 2 to 3 carbon atoms ("C.sub.2-3 alkynyl"). In
some embodiments, an alkynyl group has 2 carbon atoms ("C.sub.2
alkynyl"). The one or more carbon-carbon triple bonds can be
internal (such as in 2-butynyl) or terminal (such as in 1-butynyl).
Examples of C.sub.2-4 alkynyl groups include, without limitation,
ethynyl (C.sub.2), 1-propynyl (C.sub.3), 2-propynyl (C.sub.3),
1-butynyl (C.sub.4), 2-butynyl (C.sub.4), and the like. Examples of
C.sub.2-6 alkenyl groups include the aforementioned C.sub.2-4
alkynyl groups as well as pentynyl (C.sub.5), hexynyl and the like.
Additional examples of alkynyl include heptynyl (C.sub.7), octynyl
(C.sub.8), and the like. Unless otherwise specified, each instance
of an alkynyl group is independently optionally substituted, i.e.,
unsubstituted (an "unsubstituted alkynyl") or substituted (a
"substituted alkynyl") with one or more substituents. In certain
embodiments, the alkynyl group is unsubstituted C.sub.2-10 alkynyl.
In certain embodiments, the alkynyl group is substituted C.sub.2-10
alkynyl.
[0031] "Carbocyclyl" or "carbocyclic" refers to a radical of a
non-aromatic cyclic hydrocarbon group having from 3 to 10 ring
carbon atoms ("C.sub.3-10 carbocyclyl") and zero heteroatoms in the
non-aromatic ring system. In some embodiments, a carbocyclyl group
has 3 to 8 ring carbon atoms ("C.sub.3-8 carbocyclyl"). In some
embodiments, a carbocyclyl group has 3 to 6 ring carbon atoms
("C.sub.3-6 carbocyclyl"). In some embodiments, a carbocyclyl group
has 3 to 6 ring carbon atoms ("C.sub.3-6 carbocyclyl"). In some
embodiments, a carbocyclyl group has 5 to 10 ring carbon atoms
("C.sub.5 10 carbocyclyl"). Exemplary C.sub.3-6 carbocyclyl groups
include, without limitation, cyclopropyl (C.sub.3), cyclopropenyl
(C.sub.3), cyclobutyl (C.sub.4), cyclobutenyl (C.sub.4),
cyclopentyl (C.sub.5), cyclopentenyl (C.sub.5), cyclohexyl
(C.sub.6), cyclohexenyl (C.sub.6), cyclohexadienyl (C.sub.6), and
the like. Exemplary C.sub.3-8 carbocyclyl groups include, without
limitation, the aforementioned C.sub.3-6 carbocyclyl groups as well
as cycloheptyl (C.sub.7), cycloheptenyl (C.sub.7), cycloheptadienyl
(C.sub.7), cycloheptatrienyl (C.sub.7), cyclooctyl (C.sub.8),
cyclooctenyl (C.sub.8), bicyclo[2.2.1]heptanyl (C.sub.7),
bicyclo[2.2.2]octanyl (C.sub.8), and the like. Exemplary C.sub.3-10
carbocyclyl groups include, without limitation, the aforementioned
C.sub.3-8 carbocyclyl groups as well as cyclononyl (C.sub.9),
cyclononenyl (C.sub.9), cyclodecyl (C.sub.10), cyclodecenyl
(C.sub.10), octahydro-1H-indenyl (C.sub.9), decahydronaphthalenyl
(C.sub.10), spiro[4.5]decanyl (C.sub.10), and the like. As the
foregoing examples illustrate, in certain embodiments, the
carbocyclyl group is either monocyclic ("monocyclic carbocyclyl")
or contain a fused, bridged or spiro ring system such as a bicyclic
system ("bicyclic carbocyclyl") and can be saturated or can be
partially unsaturated. "Carbocyclyl" also includes ring systems
wherein the carbocyclic ring, as defined above, is fused with one
or more aryl or heteroaryl groups wherein the point of attachment
is on the carbocyclic ring, and in such instances, the number of
carbons continue to designate the number of carbons in the
carbocyclic ring system. Unless otherwise each instance of a
carbocyclyl group is independently optionally substituted, i.e.,
unsubstituted (an "unsubstituted carbocyclyl") or substituted (a
"substituted carbocyclyl") with one or more substituents. In
certain embodiments, the carbocyclyl group is unsubstituted
C.sub.3-10 carbocyclyl. In certain embodiments, the carbocyclyl
group is substituted C.sub.3-10 carbocyclyl.
[0032] In some embodiments, "carbocyclyl" is a monocyclic,
saturated carbocyclyl group having from 3 to 10 ring carbon atoms
("C.sub.3-10 cycloalkyl"). In some embodiments, a cycloalkyl group
has 3 to 8 ring carbon atoms ("C.sub.3-8 cycloalkyl"). In some
embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms
("C.sub.3-6 cycloalkyl"). In some embodiments, a cycloalkyl group
has 5 to 6 ring carbon atoms ("C.sub.5-6 cycloalkyl"). In some
embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms
("C.sub.5-10 cycloalkyl"). Examples of C.sub.5-6 cycloalkyl groups
include cyclopentyl (C.sub.5) and cyclohexyl (C.sub.5). Examples of
C.sub.3-6 cycloalkyl groups include the aforementioned C.sub.5-6
cycloalkyl groups as well as cyclopropyl (C.sub.3) and cyclobutyl
(C.sub.4). Examples of C.sub.3-8 cycloalkyl groups include the
aforementioned C.sub.3-cycloalkyl groups as well as cycloheptyl
(C.sub.7) and cyclooctyl (C.sub.8). Unless otherwise specified,
each instance of a cycloalkyl group is independently unsubstituted
(an "unsubstituted cycloalkyl") or substituted (a "substituted
cycloalkyl") with one or more substituents. In certain embodiments,
the cycloalkyl group is unsubstituted C.sub.3-10 cycloalkyl. In
certain embodiments, the cycloalkyl group is substituted C.sub.3-10
cycloalkyl.
[0033] "Heterocyclyl" or "heterocyclic" refers to a radical of a 3-
to 10-membered non-aromatic ring system having ring carbon atoms
and 1 to 4 ring heteroatoms, wherein each heteroatom is
independently selected from nitrogen, oxygen, sulfur, boron,
phosphorus, and silicon ("3-10 membered heterocyclyl"). In
heterocyclyl groups that contain one or more nitrogen atoms, the
point of attachment can be a carbon or nitrogen atom, as valency
permits. A heterocyclyl group can either be monocyclic ("monocyclic
heterocyclyl") or a fused, bridged, or spiro ring system, such as a
bicyclic system ("bicyclic heterocyclyl"), and can be saturated or
can be partially unsaturated. Heterocyclyl bicyclic ring systems
can include one or more heteroatoms in one or both rings.
"Heterocyclyl" also includes ring systems wherein the heterocyclic
ring, as defined above, is fused with one or more carbocyclyl
groups wherein the point of attachment is either on the carbocyclyl
or heterocyclic ring, or ring systems wherein the heterocyclic
ring, as defined above, is fused with one or more aryl or
heteroaryl groups, wherein the point of attachment is on the
heterocyclic ring, and in such instances, the number of ring
members continue to designate the number of ring members in the
heterocyclic ring system. Unless otherwise specified, each instance
of heterocyclyl is independently optionally substituted, i.e.,
unsubstituted (an "unsubstituted heterocyclyl") or substituted (a
"substituted heterocyclyl") with one or more substituents. In
certain embodiments, the heterocyclyl group is unsubstituted 3-10
membered heterocyclyl. In certain embodiments, the heterocyclyl
group is substituted 3-10 membered heterocyclyl.
[0034] In some embodiments, a heterocyclyl group is a 5-10 membered
non-aromatic ring system having ring carbon atoms and 1-4 ring
heteroatoms, wherein each heteroatom is independently selected from
nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("5-10
membered heterocyclyl"). In some embodiments, a heterocyclyl group
is a 5-8 membered non-aromatic ring system having ring carbon atoms
and 1-4 ring heteroatoms, wherein each heteroatom is independently
selected from nitrogen, oxygen, and sulfur ("5-8 membered
heterocyclyl"). In some embodiments, a heterocyclyl group is a 5-6
membered non-aromatic ring system having ring carbon atoms and 1-4
ring heteroatoms, wherein each heteroatom is independently selected
from nitrogen, oxygen, and sulfur ("5-6 membered heterocyclyl"). In
some embodiments, the 5-6 membered heterocyclyl has 1-3 ring
heteroatoms selected from nitrogen, oxygen, and sulfur. In some
embodiments, the 5-6 membered heterocyclyl has 1-2 ring heteroatoms
selected from nitrogen, oxygen, and sulfur. In some embodiments,
the 5-6 membered heterocyclyl has one ring heteroatom selected from
nitrogen, oxygen, and sulfur.
[0035] Exemplary 3-membered heterocyclyl groups containing one
heteroatom include, without limitation, azirdinyl, oxiranyl,
thiiranyl. Exemplary 4-membered heterocyclyl groups containing one
heteroatom include, without limitation, azetidinyl, oxetanyl and
thietanyl. Exemplary 5-membered heterocyclyl groups containing one
heteroatom include, without limitation, tetrahydrofuranyl,
dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl,
pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary
5-membered heterocyclyl groups containing two heteroatoms include,
without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and
oxazolidin-2-one. Exemplary 5-membered heterocyclyl groups
containing three heteroatoms include, without limitation,
triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary
6-membered heterocyclyl groups containing one heteroatom include,
without limitation, piperidinyl, tetrahydropyranyl,
dihydropyridinyl, and thianyl. Exemplary 6-membered heterocyclyl
groups containing two heteroatoms include, without limitation,
piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary
6-membered heterocyclyl groups containing two heteroatoms include,
without limitation, triazinanyl. Exemplary 7-membered heterocyclyl
groups containing one heteroatom include, without limitation,
azepanyl, oxepanyl and thiepanyl. Exemplary 8-membered heterocyclyl
groups containing one heteroatom include, without limitation,
azocanyl, oxecanyl and thiocanyl. Exemplary 5-membered heterocyclyl
groups fused to a C.sub.6 aryl ring (also referred to herein as a
5,6-bicyclic heterocyclic ring) include, without limitation,
indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl,
benzoxazolinonyl, and the like. Exemplary 6-membered heterocyclyl
groups fused to an aryl ring (also referred to herein as a
6,6-bicyclic heterocyclic ring) include, without limitation,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like.
[0036] "Aryl" refers to a radical of a monocyclic or polycyclic
(e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g.,
having 6, 10, or 14 pi electrons shared in a cyclic array) having
6-14 ring carbon atoms and zero heteroatoms provided in the
aromatic ring system ("C.sub.6-14 aryl"). In some embodiments, an
aryl group has six ring carbon atoms ("C.sub.6 aryl"; e.g.,
phenyl). In some embodiments, an aryl group has ten ring carbon
atoms ("C.sub.10 aryl"; e.g., naphthyl such as 1-naphthyl and
2-naphthyl). In some embodiments, an aryl group has fourteen ring
carbon atoms ("C.sub.14 aryl"; e.g., anthracyl). "Aryl" also
includes ring systems wherein the aryl ring, as defined above, is
fused with one or more carbocyclyl or heterocyclyl groups wherein
the radical or point of attachment is on the aryl ring, and in such
instances, the number of carbon atoms continue to designate the
number of carbon atoms in the aryl ring system. Unless otherwise
specified, each instance of an aryl group is independently
optionally substituted, i.e., unsubstituted (an "unsubstituted
aryl") or substituted (a "substituted aryl") with one or more
substituents. In certain embodiments, the aryl group is
unsubstituted C.sub.61.sub.4 aryl. In certain embodiments, the aryl
group is substituted C.sub.61.sub.4 aryl.
[0037] "Aralkyl" is a subset of alkyl and aryl and refers to an
optionally substituted alkyl group substituted by an optionally
substituted aryl group. In certain embodiments, the aralkyl is
optionally substituted benzyl. In certain embodiments, the aralkyl
is benzyl. In certain embodiments, the aralkyl is optionally
substituted phenethyl. In certain embodiments, the aralkyl is
phenethyl.
[0038] "Heteroaryl" refers to a radical of a 5-10 membered
monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or
10 pi electrons shared in a cyclic array) having ring carbon atoms
and 1-4 ring heteroatoms provided in the aromatic ring system,
wherein each heteroatom is independently selected from nitrogen,
oxygen and sulfur ("5-10 membered heteroaryl"). In heteroaryl
groups that contain one or more nitrogen atoms, the point of
attachment can be a carbon or nitrogen atom, as valency permits.
Heteroaryl bicyclic ring systems can include one or more
heteroatoms in one or both rings. "Heteroaryl" includes ring
systems wherein the heteroaryl ring, as defined above, is fused
with one or more carbocyclyl or heterocyclyl groups wherein the
point of attachment is on the heteroaryl ring, and in such
instances, the number of ring members continue to designate the
number of ring members in the heteroaryl ring system. "Heteroaryl"
also includes ring systems wherein the heteroaryl ring, as defined
above, is fused with one or more aryl groups wherein the point of
attachment is either on the aryl or heteroaryl ring, and in such
instances, the number of ring members designates the number of ring
members in the fused (aryl/heteroaryl) ring system. Bicyclic
heteroaryl groups wherein one ring does not contain a heteroatom
(e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of
attachment can be on either ring, i.e., either the ring bearing a
heteroatom (e.g., 2-indolyl) or the ring that does not contain a
heteroatom (e.g., 5-indolyl).
[0039] In some embodiments, a heteroaryl group is a 5-10 membered
aromatic ring system having ring carbon atoms and 1-4 ring
heteroatoms provided in the aromatic ring system, wherein each
heteroatom is independently selected from nitrogen, oxygen, and
sulfur ("5-10 membered heteroaryl"). In some embodiments, a
heteroaryl group is a 5-8 membered aromatic ring system having ring
carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring
system, wherein each heteroatom is independently selected from
nitrogen, oxygen, and sulfur ("5-8 membered heteroaryl"). In some
embodiments, a heteroaryl group is a 5-6 membered aromatic ring
system having ring carbon atoms and 1-4 ring heteroatoms provided
in the aromatic ring system, wherein each heteroatom is
independently selected from nitrogen, oxygen, and sulfur ("5-6
membered heteroaryl"). In some embodiments, the 5-6 membered
heteroaryl has 1-3 ring heteroatoms selected from nitrogen, oxygen,
and sulfur. In some embodiments, the 5-6 membered heteroaryl has
1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In
some embodiments, the 5-6 membered heteroaryl has 1 ring heteroatom
selected from nitrogen, oxygen, and sulfur. Unless otherwise
specified, each instance of a heteroaryl group is independently
optionally substituted, i.e., unsubstituted (an "unsubstituted
heteroaryl") or substituted (a "substituted heteroaryl") with one
or more substituents. In certain embodiments, the heteroaryl group
is unsubstituted 5-14 membered heteroaryl. In certain embodiments,
the heteroaryl group is substituted 5-14 membered heteroaryl.
[0040] Exemplary 5-membered heteroaryl groups containing one
heteroatom include, without limitation, pyrrolyl, furanyl, and
thiophenyl. Exemplary 5-membered heteroaryl groups containing two
heteroatoms include, without limitation, imidazolyl, pyrazolyl,
oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary
5-membered heteroaryl groups containing three heteroatoms include,
without limitation, triazolyl, oxadiazolyl, and thiadiazolyl.
Exemplary 5-membered heteroaryl groups containing four heteroatoms
include, without limitation, tetrazolyl. Exemplary 6-membered
heteroaryl groups containing one heteroatom include, without
limitation, pyridinyl. Exemplary 6-membered heteroaryl groups
containing two heteroatoms include, without limitation,
pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered
heteroaryl groups containing three or four heteroatoms include,
without limitation, triazinyl and tetrazinyl, respectively.
Exemplary 7-membered heteroaryl groups containing one heteroatom
include, without limitation, azepinyl, oxepinyl, and thiepinyl.
Exemplary 5,6-bicyclic heteroaryl groups include, without
limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl,
benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl,
benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl,
benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and
purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, without
limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl,
cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.
[0041] "Heteroaralkyl" is a subset of alkyl and heteroaryl and
refers to an optionally substituted alkyl group substituted by an
optionally substituted heteroaryl group.
[0042] "Unsaturated" or "partially unsaturated" refers to a group
that includes at least one double or triple bond. A "partially
unsaturated" ring system is further intended to encompass rings
having multiple sites of unsaturation, but is not intended to
include aromatic groups (e.g., aryl or heteroaryl groups).
Likewise, "saturated" refers to a group that does not contain a
double or triple bond, i.e., contains all single bonds.
[0043] Alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl,
and heteroaryl groups, which are divalent bridging groups, are
further referred to using the suffix -ene, e.g., alkylene,
alkenylene, alkynylene, carbocyclylene, heterocyclylene, arylene,
and arylene. An atom, moiety, or group described herein may be
unsubstituted or substituted, as valency permits, unless otherwise
provided expressly. The term "optionally substituted" refers to
substituted or unsubstituted.
[0044] A group is optionally substituted unless expressly provided
otherwise. The term "optionally substituted" refers to being
substituted or unsubstituted. In certain embodiments, alkyl,
alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl
groups are optionally substituted (e.g., "substituted" or
"unsubstituted" alkyl, "substituted" or "unsubstituted" alkenyl,
"substituted" or "unsubstituted" alkynyl, "substituted" or
"unsubstituted" carbocyclyl, "substituted" or "unsubstituted"
heterocyclyl, "substituted" or "unsubstituted" aryl or
"substituted" or "unsubstituted" heteroaryl group). In general, the
term "substituted", whether preceded by the term "optionally" or
not, means that at least one hydrogen present on a group (e.g., a
carbon or nitrogen atom) is replaced with a permissible
substituent, e.g., a substituent which upon substitution results in
a stable compound, e.g., a compound which does not spontaneously
undergo transformation such as by rearrangement, cyclization,
elimination, or other reaction. Unless otherwise indicated, a
"substituted" group has a substituent at one or more substitutable
positions of the group, and when more than one position in any
given structure is substituted, the substituent is either the same
or different at each position. The term "substituted" is
contemplated to include substitution with all permissible
substituents of organic compounds, any of the substituents
described herein that results in the formation of a stable
compound. The present disclosure contemplates any and all such
combinations in order to arrive at a stable compound. For purposes
of this disclosure, heteroatoms such as nitrogen may have hydrogen
substituents and/or any suitable substituent as described herein
which satisfy the valencies of the heteroatoms and results in the
formation of a stable moiety. In certain embodiments, the
substituent is a carbon atom substituent. In certain embodiments,
the substituent is a nitrogen atom substituent. In certain
embodiments, the substituent is an oxygen atom substituent. In
certain embodiments, the substituent is a sulfur atom
substituent.
[0045] Exemplary carbon atom substituents include, but are not
limited to, halogen, --CN, --NO.sub.2, --N.sub.3, --SO.sub.2H,
--SO.sub.3H, --OH, --OR.sup.aa, --ON(R.sup.bb).sub.2,
--N(R.sup.bb).sub.2, --N(R.sup.bb).sub.3.sup.+X.sup.-,
--N(OR.sup.cc)R.sup.bb, --SH, --SR.sup.aa, --SSR.sup.cc,
--C(.dbd.O)R.sup.aa, --CO.sub.2H, --CHO, --C(OR.sup.cc).sub.2,
--CO.sub.2R.sup.aa, --OC(.dbd.O)R.sup.aa, --OCO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --OC(.dbd.O)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.O)R.sup.aa, --NR.sup.bbCO.sub.2R.sup.aa,
--NR.sup.bbC(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --OC(.dbd.NR.sup.bb)R.sup.aa,
--OC(.dbd.NR.sup.bb)OR.sup.aa,
--C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--C(.dbd.O)NR.sup.bbSO.sub.2R.sup.aa, --NR.sup.bbSO.sub.2R.sup.aa,
--SO.sub.2N(R.sup.bb).sub.2, --SO.sub.2R.sup.aa,
--SO.sub.2OR.sup.aa, --OSO.sub.2R.sup.aa, --S(.dbd.O)R.sup.aa,
--OS(.dbd.O)R.sup.aa, --Si(R.sup.aa).sub.3,
--OSi(R.sup.aa).sub.3--C(.dbd.S)N(R.sup.bb).sub.2,
--C(.dbd.O)SR.sup.aa, --C(.dbd.S)SR.sup.aa, --SC(.dbd.S)SR.sup.aa,
--SC(.dbd.O)SR.sup.aa, --OC(.dbd.O)SR.sup.aa,
--SC(.dbd.O)OR.sup.aa, --SC(.dbd.O)R.sup.aa,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2,
--OP(.dbd.O)(R.sup.aa).sub.2, --OP(.dbd.O)(OR.sup.cc).sub.2,
--P(.dbd.O)(N(R.sup.bb).sub.2).sub.2,
--OP(.dbd.O)(N(R.sup.bb).sub.2).sub.2,
--NR.sup.bbP(.dbd.O)(R.sup.aa).sub.2,
--NR.sup.bbP(.dbd.O)(OR.sup.cc).sub.2,
--NR.sup.bbP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, --P(R.sup.cc).sub.2,
--P(OR.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.3.sup.+X.sup.-, --P(R.sup.cc).sub.4,
--P(OR.sup.cc).sub.4, --OP(R.sup.cc).sub.2,
--OP(R.sup.cc).sub.3.sup.+X.sup.-, --OP(OR.sup.cc).sub.2,
--OP(OR.sup.cc).sub.3.sup.+X.sup.-, --OP(R.sup.cc).sub.4,
--OP(OR.sup.cc).sub.4, --B(R.sup.aa).sub.2, --B(OR.sup.cc).sub.2,
--BR.sup.aa(OR.sup.cc), C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl,
C.sub.2-10 alkenyl, C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10 alkenyl, heteroC.sub.2-10 alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, wherein each alkyl, alkenyl, alkynyl,
heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl,
heterocyclyl, aryl, and heteroaryl is independently substituted
with 0, 1, 2, 3, 4, or 5 R.sup.dd groups; wherein X.sup.- is a
counterion;
[0046] or two geminal hydrogens on a carbon atom are replaced with
the group .dbd.O, .dbd.S, .dbd.NN(R.sup.bb).sub.2,
.dbd.NNR.sup.bbC(.dbd.O)R.sup.aa,
.dbd.NNR.sup.bbC(.dbd.O)OR.sup.aa,
.dbd.NNR.sup.bbS(.dbd.O).sub.2R.sup.aa, .dbd.NR.sup.bb, or
.dbd.NOR.sup.cc; each instance of R.sup.aa is, independently,
selected from C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl, C.sub.2-10
alkenyl, C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10alkenyl, heteroC.sub.2-10alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, or two R.sup.aa groups are joined to form a
3-14 membered heterocyclyl or 5-14 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd
groups;
[0047] each instance of R.sup.bb is, independently, selected from
hydrogen, --OH, --OR.sup.aa, --N(R.sup.cc).sub.2, --CN,
--C(.dbd.O)R.sup.aa, --C(.dbd.O)N(R.sup.cc).sub.2,
--CO.sub.2R.sup.aa, --SO.sub.2R.sup.aa,
--C(.dbd.NR.sup.cc)OR.sup.aa, --C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2,
--SO.sub.2N(R.sup.cc).sub.2, --SO.sub.2R.sup.cc,
--SO.sub.2OR.sup.cc, --SOR.sup.aa, --C(.dbd.S)N(R.sup.cc).sub.2,
--C(.dbd.O)SR.sup.cc, --C(.dbd.S)SR.sup.cc,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2,
--P(.dbd.O)(N(R.sup.cc).sub.2).sub.2, C.sub.1-10 alkyl, C.sub.1-10
perhaloalkyl, C.sub.2-10 alkenyl, C.sub.2-10 alkynyl,
heteroC.sub.1-10alkyl, heteroC.sub.2-10alkenyl, heteroC.sub.2-10
alkynyl, C.sub.3-10 carbocyclyl, 3-14 membered heterocyclyl,
C.sub.6-14 aryl, and 5-14 membered heteroaryl, or two R.sup.bb
groups are joined to form a 3-14 membered heterocyclyl or 5-14
membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl,
heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl,
heterocyclyl, aryl, and heteroaryl is independently substituted
with 0, 1, 2, 3, 4, or 5 R.sup.dd groups; wherein X.sup.- is a
counterion.
[0048] each instance of R.sup.cc is, independently, selected from
hydrogen, C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl, C.sub.2-10
alkenyl, C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10 alkenyl, heteroC.sub.2-10 alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, or two R.sup.cc groups are joined to form a
3-14 membered heterocyclyl or 5-14 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd
groups;
[0049] each instance of R.sup.dd is, independently, selected from
halogen, --CN, --NO.sub.2, --N.sub.3, --SO.sub.2H, --SO.sub.3H,
--OH, --OR.sup.ee, --ON(R.sup.ff).sub.2, --N(R.sup.ff).sub.2,
--N(R.sup.ff).sub.3.sup.+X.sup.-, --N(OR.sup.ee)R.sup.ff, --SH,
--SR.sup.ee, --SSR.sup.ee, --C(.dbd.O)R.sup.ee, --CO.sub.2H,
--CO.sub.2R.sup.ee, --OC(.dbd.O)R.sup.ee, --OCO.sub.2R.sup.ee,
--C(.dbd.O)N(R.sup.ff).sub.2, --OC(.dbd.O)N(R).sub.2,
--NR.sup.ffC(.dbd.O)R.sup.ee, --NR.sup.ffCO.sub.2R.sup.ee,
--NR.sup.ffC(.dbd.O)N(R).sub.2, --C(.dbd.NR.sup.ff)OR.sup.ee,
--OC(.dbd.NR.sup.ff)R.sup.ee, --OC(.dbd.NR.sup.ff)OR.sup.ee,
--C(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--OC(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--NR.sup.ffC(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--NR.sup.ffSO.sub.2R.sup.ee, --SO.sub.2N(R.sup.ff).sub.2,
--SO.sub.2R.sup.ee, --SO.sub.2OR.sup.ee, --OSO.sub.2R.sup.ee,
--S(.dbd.O)R.sup.ee, --Si(R.sup.ee).sub.3, --OSi(R.sup.ee).sub.3,
--C(.dbd.S)N(R.sup.ff).sub.2, --C(.dbd.O)SR.sup.ee,
--C(.dbd.S)SR.sup.ee, --SC(.dbd.S)SR.sup.ee,
--P(.dbd.O)(OR.sup.ee).sub.2, --P(.dbd.O)(R.sup.ee).sub.2,
--OP(.dbd.O)(R.sup.ee).sub.2, --OP(.dbd.O)(OR.sup.ee).sub.2,
C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl,
C.sub.2-6 alkynyl, heteroC.sub.1-6alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6alkynyl, C.sub.3-10 carbocyclyl, 3-10 membered
heterocyclyl, C.sub.6-10 aryl, 5-10 membered heteroaryl, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg groups,
or two geminal R.sup.dd substituents can be joined to form .dbd.O
or .dbd.S; wherein X.sup.- is a counterion;
[0050] each instance of R.sup.ee is, independently, selected from
C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl,
C.sub.2-6 alkynyl, heteroC.sub.1-6 alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6 alkynyl, C.sub.3-10 carbocyclyl, C.sub.6-10 aryl,
3-10 membered heterocyclyl, and 3-10 membered heteroaryl, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg
groups;
[0051] each instance of R.sup.ff is, independently, selected from
hydrogen, C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6
alkenyl, C.sub.2-6 alkynyl, heteroC.sub.1-6alkyl,
heteroC.sub.2-6alkenyl, heteroC.sub.2-6alkynyl, C.sub.3-10
carbocyclyl, 3-10 membered heterocyclyl, C.sub.6-10 aryl and 5-10
membered heteroaryl, or two R.sup.ff groups are joined to form a
3-10 membered heterocyclyl or 5-10 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg groups;
and
[0052] each instance of R.sup.gg is, independently, halogen, --CN,
--NO.sub.2, --N.sub.3, --SO.sub.2H, --SO.sub.3H, --OH, --OC.sub.1-6
alkyl, --ON(C.sub.1-6 alkyl).sub.2, --N(C.sub.1-6 alkyl).sub.2,
--N(C.sub.1-6 alkyl).sub.3.sup.+X.sup.-, --NH(C.sub.1-6
alkyl).sub.2.sup.+X.sup.-, --NH.sub.2(C.sub.1-6
alkyl).sup.+X.sup.-, --NH.sub.3.sup.+X.sup.-, --N(OC.sub.1-6
alkyl)(C.sub.1-6 alkyl), --N(OH)(C.sub.1-6 alkyl), --NH(OH), --SH,
--SC.sub.1-6 alkyl, --SS(C.sub.1-6 alkyl), --C(.dbd.O)(C.sub.1-6
alkyl), --CO.sub.2H, --CO.sub.2(C.sub.1-6 alkyl),
--OC(.dbd.O)(C.sub.1-6 alkyl), --OCO.sub.2(C.sub.1-6 alkyl),
--C(.dbd.O)NH.sub.2, --C(.dbd.O)N(C.sub.1-6 alkyl).sub.2,
--OC(.dbd.O)NH(C.sub.1-6 alkyl), --NHC(.dbd.O)(C.sub.1-6 alkyl),
--N(C.sub.1-6 alkyl)C(.dbd.O)(C.sub.1-6 alkyl),
--NHCO.sub.2(C.sub.1-6 alkyl), --NHC(.dbd.O)N(C.sub.1-6
alkyl).sub.2, --NHC(.dbd.O)NH(C.sub.1-6 alkyl),
--NHC(.dbd.O)NH.sub.2, --C(.dbd.NH)O(C.sub.1-6 alkyl),
--OC(.dbd.NH)(C.sub.1-6 alkyl), --OC(.dbd.NH)OC.sub.1-6 alkyl,
--C(.dbd.NH)N(C.sub.1-6 alkyl).sub.2, --C(.dbd.NH)NH(C.sub.1-6
alkyl), --C(.dbd.NH)NH.sub.2, --OC(.dbd.NH)N(C.sub.1-6
alkyl).sub.2, --OC(NH)NH(C.sub.1-6 alkyl), --OC(NH)NH.sub.2,
--NHC(NH)N(C.sub.1-6 alkyl).sub.2, --NHC(.dbd.NH)NH.sub.2,
--NHSO.sub.2(C.sub.1-6 alkyl), --SO.sub.2N(C.sub.1-6 alkyl).sub.2,
--SO.sub.2NH(C.sub.1-6 alkyl), --SO.sub.2NH.sub.2,
--SO.sub.2C.sub.1-6 alkyl, --SO.sub.2OC.sub.1-6 alkyl,
--OSO.sub.2C.sub.1-6 alkyl, --SOC.sub.1-6 alkyl, --Si(C.sub.1-6
alkyl).sub.3, --OSi(C.sub.1-6 alkyl).sub.3-C(.dbd.S)N(C.sub.1-6
alkyl).sub.2, C(.dbd.S)NH(C.sub.1-6 alkyl), C(.dbd.S)NH.sub.2,
--C(.dbd.O)S(C.sub.1-6 alkyl), --C(.dbd.S)SC.sub.1-6 alkyl,
--SC(.dbd.S)SC.sub.1-6 alkyl, --P(.dbd.O)(OC.sub.1-6 alkyl).sub.2,
--P(.dbd.O)(C.sub.1-6 alkyl).sub.2, --OP(.dbd.O)(C.sub.1-6
alkyl).sub.2, --OP(.dbd.O)(OC.sub.1-6 alkyl).sub.2, C.sub.1-6
alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl, C.sub.2-6
alkynyl, heteroC.sub.1-6alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6alkynyl, C.sub.3-10 carbocyclyl, C.sub.6-10 aryl,
3-10 membered heterocyclyl, 5-10 membered heteroaryl; or two
geminal R.sup.gg substituents can be joined to form .dbd.O or
.dbd.S; wherein X.sup.- is a counterion.
[0053] A "counterion" or "anionic counterion" is a negatively
charged group associated with a positively charged group in order
to maintain electronic neutrality. An anionic counterion may be
monovalent (i.e., including one formal negative charge). An anionic
counterion may also be multivalent (i.e., including more than one
formal negative charge), such as divalent or trivalent. Exemplary
counterions include halide ions (e.g., F.sup.-, Cl.sup.-, Br.sup.-,
I.sup.-), NO.sub.3.sup.-, ClO.sub.4.sup.-, OH.sup.-,
H.sub.2PO.sub.4.sup.-, HCO.sub.3.sup.-, HSO.sub.4.sup.-, sulfonate
ions (e.g., methansulfonate, trifluoromethanesulfonate,
p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate,
naphthalene-2-sulfonate, naphthalene-1-sulfonic acid-5-sulfonate,
ethan-1-sulfonic acid-2-sulfonate, and the like), carboxylate ions
(e.g., acetate, propanoate, benzoate, glycerate, lactate, tartrate,
glycolate, gluconate, and the like), BF.sub.4.sup.-,
PF.sub.4.sup.-, PF.sub.6.sup.-, AsF.sub.6.sup.-, SbF.sub.6.sup.-,
B[3,5-(CF.sub.3).sub.2C.sub.6H.sub.3].sub.4].sup.-,
B(C.sub.6F.sub.5).sub.4.sup.-, BPh.sub.4.sup.-,
Al(OC(CF.sub.3).sub.3).sub.4.sup.-, and carborane anions (e.g.,
CB.sub.11H.sub.12.sup.- or (HCB.sub.11Me.sub.5Br.sub.6).sup.-).
Exemplary counterions which may be multivalent include
CO.sub.3.sup.2-, HPO.sub.4.sup.2-, PO.sub.4.sup.3-,
B.sub.4O.sub.7.sup.2-, SO.sub.4.sup.2-, S.sub.2O.sub.3.sup.2-,
carboxylate anions (e.g., tartrate, citrate, fumarate, maleate,
malate, malonate, gluconate, succinate, glutarate, adipate,
pimelate, suberate, azelate, sebacate, salicylate, phthalates,
aspartate, glutamate, and the like), and carboranes.
[0054] "Halo" or "halogen" refers to fluorine (fluoro, --F),
chlorine (chloro, --Cl), bromine (bromo, --Br), or iodine (iodo,
--I).
[0055] The term "hydroxyl" or "hydroxy" refers to the group --OH.
The term "substituted hydroxyl" or "substituted hydroxyl," by
extension, refers to a hydroxyl group wherein the oxygen atom
directly attached to the parent molecule is substituted with a
group other than hydrogen, and includes groups selected from
--OR.sup.aa, --ON(R.sup.bb).sub.2, --OC(.dbd.O)SR.sup.aa,
--OC(.dbd.O)R.sup.aa, --OCO.sub.2R.sup.aa,
--OC(.dbd.O)N(R.sup.bb).sub.2, --OC(.dbd.NR.sup.bb)R.sup.aa,
--OC(.dbd.NR.sup.bb)OR.sup.aa,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --OS(.dbd.O)R.sup.aa,
--OSO.sub.2R.sup.aa, --OSi(R.sup.aa).sub.3, --OP(R.sup.cc).sub.2,
--OP(R.sup.cc).sub.3.sup.+X.sup.-, --OP(OR.sup.cc).sub.2,
--OP(OR.sup.cc).sub.3.sup.+X.sup.-, --OP(.dbd.O)(R.sup.aa).sub.2,
--OP(.dbd.O)(OR.sup.cc).sub.2, and --OP(.dbd.O)(N(R.sup.bb)).sub.2,
wherein X.sup.-, R.sup.aa, R.sup.bb, and R.sup.cc are as defined
herein.
[0056] The term "amino" refers to the group --NH.sub.2. The term
"substituted amino," by extension, refers to a monosubstituted
amino, a disubstituted amino, or a trisubstituted amino. In certain
embodiments, the "substituted amino" is a monosubstituted amino or
a disubstituted amino group.
[0057] The term "monosubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with one hydrogen and one group other than hydrogen,
and includes groups selected from --NH(R.sup.bb),
--NHC(.dbd.O)R.sup.aa, --NHCO.sub.2R.sup.aa,
--NHC(.dbd.O)N(R.sup.bb).sub.2,
--NHC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --NHSO.sub.2R.sup.aa,
--NHP(.dbd.O)(OR.sup.cc).sub.2, and
--NHP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein R.sup.aa, R.sup.bb
and R.sup.cc are as defined herein, and wherein R.sup.bb of the
group --NH(R.sup.bb) is not hydrogen.
[0058] The term "disubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with two groups other than hydrogen, and includes
groups selected from --N(R.sup.bb).sub.2, --NR.sup.bb
C(.dbd.O)R.sup.aa, --NR.sup.bbCO.sub.2R--,
--NR.sup.bbC(.dbd.O)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--NR.sup.bbSO.sub.2R.sup.aa, --NR.sup.bbP(.dbd.O)(OR.sup.cc).sub.2,
and --NR.sup.bbP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein
R.sup.aa, R.sup.bb, and R.sup.cc are as defined herein, with the
proviso that the nitrogen atom directly attached to the parent
molecule is not substituted with hydrogen.
[0059] The term "trisubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with three groups, and includes groups selected from
--N(R.sup.bb).sub.3 and --N(R.sup.bb).sub.3.sup.+X.sup.-, wherein
R.sup.bb and X.sup.- are as defined herein.
[0060] The term "sulfonyl" refers to a group selected from
--SO.sub.2N(R.sup.bb).sub.2, --SO.sub.2R.sup.aa, and
--SO.sub.2OR.sup.aa, wherein R.sup.aa and R.sup.bb are as defined
herein.
[0061] "Acyl" refers to a moiety selected from the group consisting
of --C(.dbd.O)R.sup.aa, --CHO, --CO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--C(.dbd.O)NR.sup.bbSO.sub.2R.sup.aa, --C(.dbd.S)N(R.sup.bb).sub.2,
--C(.dbd.O)SR.sup.aa, or --C(.dbd.S)SR.sup.aa, wherein R.sup.aa and
R.sup.bb are as defined herein.
[0062] The term "carbonyl" refers a group wherein the carbon
directly attached to the parent molecule is sp.sup.2 hybridized,
and is substituted with an oxygen, nitrogen or sulfur atom, e.g., a
group selected from ketones (--C(.dbd.O)R.sup.aa), carboxylic acids
(--CO.sub.2H), aldehydes (--CHO), esters (--CO.sub.2R.sup.aa,
--C(.dbd.O)SR.sup.aa, --C(.dbd.S)SR.sup.aa), amides
(--C(.dbd.O)N(R.sup.bb).sub.2,
--C(.dbd.O)NR.sup.bbSO.sub.2R.sup.aa,
--C(.dbd.S)N(R.sup.bb).sub.2), and imines
(--C(.dbd.NR.sup.bb)R.sup.aa, --C(.dbd.NR.sup.bb)OR.sup.aa),
C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2), wherein R.sup.aa and R.sup.bb
are as defined herein.
[0063] Nitrogen atoms can be substituted or unsubstituted as
valency permits, and include primary, secondary, tertiary, and
quaternary nitrogen atoms. Exemplary nitrogen atom substituents
include, but are not limited to, hydrogen, --OH, --OR.sup.aa,
--N(R.sup.cc).sub.2, --CN, --C(.dbd.O)R.sup.aa,
--C(.dbd.O)N(R.sup.cc).sub.2, --CO.sub.2R.sup.aa,
--SO.sub.2R.sup.aa, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.cc)OR.sup.aa, --C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2,
--SO.sub.2N(R.sup.cc).sub.2, --SO.sub.2R.sup.cc,
--SO.sub.2OR.sup.cc, --SOR.sup.aa, --C(.dbd.S)N(R.sup.cc).sub.2,
--C(.dbd.O)SR.sup.cc, --C(.dbd.S)SR.sup.cc,
--P(.dbd.O)(OR.sup.cc).sub.2, --P(.dbd.O)(R.sup.aa).sub.2,
--P(.dbd.O)(N(R.sup.cc).sub.2).sub.2, C.sub.1-10 alkyl, C.sub.1-10
perhaloalkyl, C.sub.2-10 alkenyl, C.sub.2-10 alkynyl,
heteroC.sub.1-10alkyl, heteroC.sub.2-10alkenyl,
heteroC.sub.2-10alkynyl, C.sub.3-10 carbocyclyl, 3-14 membered
heterocyclyl, C.sub.6-14 aryl, and 5-14 membered heteroaryl, or two
R.sup.cc groups attached to an N atom are joined to form a 3-14
membered heterocyclyl or 5-14 membered heteroaryl ring, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd groups,
and wherein R.sup.aa, R.sup.bb, R.sup.cc and R.sup.dd are as
defined above.
[0064] In certain embodiments, the substituent present on a
nitrogen atom is a nitrogen protecting group (also referred to as
an amino protecting group). Nitrogen protecting groups include, but
are not limited to, --OH, --OR.sup.aa, --N(R.sup.cc).sub.2,
--C(.dbd.O)R.sup.aa, --C(.dbd.O)N(R.sup.cc).sub.2,
--CO.sub.2R.sup.aa, --SO.sub.2R.sup.aa,
--C(.dbd.NR.sup.cc)R.sup.aa, --C(.dbd.NR.sup.cc)OR.sup.aa,
--C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2, --SO.sub.2N(R.sup.cc).sub.2,
--SO.sub.2R.sup.cc, --SO.sub.2OR.sup.cc, --SOR.sup.aa,
--C(.dbd.S)N(R.sup.cc).sub.2, --C(.dbd.O)SR.sup.cc,
--C(.dbd.S)SR.sup.cc, C.sub.1-10 alkyl (e.g., aralkyl,
heteroaralkyl), C.sub.2-10 alkenyl, C.sub.2-10 alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl groups, wherein each alkyl, alkenyl, alkynyl,
carbocyclyl, heterocyclyl, aralkyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd groups,
and wherein R.sup.aa, R.sup.bb, R.sup.cc and R.sup.dd are as
defined herein. Nitrogen protecting groups are well known in the
art and include those described in detail in Protecting Groups in
Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3.sup.rd
edition, John Wiley & Sons, 1999, incorporated herein by
reference.
[0065] For example, nitrogen protecting groups such as amide groups
(e.g., --C(.dbd.O)R.sup.aa) include, but are not limited to,
formamide, acetamide, chloroacetamide, trichloroacetamide,
trifluoroacetamide, phenylacetamide, 3-phenylpropanamide,
picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl
derivative, benzamide, p-phenylbenzamide, o-nitophenylacetamide,
o-nitrophenoxyacetamide, acetoacetamide,
(N'-dithiobenzyloxyacylamino)acetamide,
3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide,
2-methyl-2-(o-nitrophenoxy)propanamide,
2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide,
3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine
derivative, o-nitrobenzamide, and
o-(benzoyloxymethyl)benzamide.
[0066] Nitrogen protecting groups such as carbamate groups (e.g.,
--C(.dbd.O)OR.sup.aa) include, but are not limited to, methyl
carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc),
9-(2-sulfo)fluorenylmethyl carbamate,
9-(2,7-dibromo)fluoroenylmethyl carbamate,
2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl
carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc),
2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl
carbamate (Teoc), 2-phenylethyl carbamate (hZ),
1-(1-adamantyl)-1-methylethyl carbamate (Adpoc),
1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl
carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate
(TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc),
1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'-
and 4'-pyridyl)ethyl carbamate (Pyoc),
2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate
(BOC or Boc), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc),
allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc),
cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc),
8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio
carbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz),
p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl
carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl
carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl
carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl
carbamate, 2-(p-toluenesulfonyl)ethyl carbamate,
[2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl
carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc),
2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl
carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate,
m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl
carbamate, 5-benzisoxazolylmethyl carbamate,
2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc),
m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate,
o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate,
phenyl(o-nitrophenyl)methyl carbamate, t-amyl carbamate, S-benzyl
thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate,
cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl
carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxyacylvinyl
carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate,
1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate,
1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate,
2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl
carbamate, isobutyl carbamate, isonicotinyl carbamate,
p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl
carbamate, 1-methylcyclohexyl carbamate,
1-methyl-1-cyclopropylmethyl carbamate,
1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate,
1-methyl-1-(p-phenylazophenyl)ethyl carbamate,
1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl
carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate,
2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl
carbamate, and 2,4,6-trimethylbenzyl carbamate.
[0067] Nitrogen protecting groups such as sulfonamide groups (e.g.,
--S(.dbd.O).sub.2R.sup.aa) include, but are not limited to,
p-toluenesulfonamide (Ts), benzenesulfonamide,
2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr),
2,4,6-trimethoxybenzenesulfonamide (Mtb),
2,6-dimethyl-4-methoxybenzenesulfonamide (Pme),
2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte),
4-methoxybenzenesulfonamide (Mbs),
2,4,6-trimethylbenzenesulfonamide (Mts),
2,6-dimethoxy-4-methylbenzenesulfonamide (iMds),
2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc),
methanesulfonamide (Ms), .beta.-trimethylsilylethanesulfonamide
(SES), 9-anthracenesulfonamide,
4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS),
benzylsulfonamide, trifluoromethylsulfonamide, and
phenacylsulfonamide.
[0068] Other nitrogen protecting groups include, but are not
limited to, phenothiazinyl-(10)-acyl derivative,
N'-p-toluenesulfonylaminoacyl derivative, N'-phenylaminothioacyl
derivative, N-benzoylphenylalanyl derivative, N-acetylmethionine
derivative, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide,
N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide,
N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilylazacyclopentane
adduct (STABASE), 5-substituted
1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted
1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted
3,5-dinitro-4-pyridone, N-methylamine, N-allylamine,
N-[2-(trimethylsilyl)ethoxy]methylamine (SEM),
N-3-acetoxypropylamine,
N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary
ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine,
N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr),
N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr),
N-9-phenylfluorenylamine (PhF),
N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino
(Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine,
N-benzylideneamine, N-p-methoxybenzylideneamine,
N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine,
N--(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine,
N-p-nitrobenzylideneamine, N-salicylideneamine,
N-5-chlorosalicylideneamine,
N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine,
N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine,
N-borane N-diphenylborinic acid derivative,
N-[phenyl(pentaacylchromium- or tungsten)acyl]amine, N-copper
chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine
N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide
(Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates,
dibenzyl phosphoramidate, diphenyl phosphoramidate,
benzenesulfenamide, o-nitrobenzenesulfenamide (Nps),
2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide,
2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide,
and 3-nitropyridinesulfenamide (Npys).
[0069] In certain embodiments, the substituent present on an oxygen
atom is an oxygen protecting group (also referred to herein as an
"hydroxyl protecting group"). Oxygen protecting groups include, but
are not limited to, --R.sup.aa, --N(R.sup.bb).sub.2,
--C(.dbd.O)SR.sup.aa, --C(.dbd.O)R.sup.aa, --CO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--S(.dbd.O)R.sup.aa, --SO.sub.2R.sup.aa, --Si(R.sup.aa).sub.3,
--P(R.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.2, --P(OR.sup.cc).sub.3.sup.+X.sup.-,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2, and
--P(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein X.sup.-, R.sup.aa,
R.sup.bb, and R.sup.cc are as defined herein. Oxygen protecting
groups are well known in the art and include those described in
detail in Protecting Groups in Organic Synthesis, T. W. Greene and
P. G. M. Wuts, 3.sup.rd edition, John Wiley & Sons, 1999,
incorporated herein by reference.
[0070] Exemplary oxygen protecting groups include, but are not
limited to, methyl, t-butyloxycarbonyl (BOC or Boc), methoxylmethyl
(MOM), methylthiomethyl (MTM), t-butylthiomethyl,
(phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM),
p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM),
guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM),
siloxymethyl, 2-methoxyethoxymethyl (MEM),
2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl,
2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP),
3-bromotetrahydropyranyl, tetrahydrothiopyranyl,
1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP),
4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl
S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl
(CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl,
2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl,
1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl,
1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl,
2,2,2-trichloroethyl, 2-trimethylsilylethyl,
2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl,
p-methoxyphenyl, 2,4-dinitrophenyl, benzyl (Bn), p-methoxybenzyl,
3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl,
2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl,
4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl,
p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl,
o-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl,
di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl,
4-(4'-bromophenacyloxyphenyl)diphenylmethyl,
4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl,
4,4',4''-tris(levulinoyloxyphenyl)methyl,
4,4',4''-tris(benzoyloxyphenyl)methyl,
3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl,
1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl,
9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl,
1,3-benzodisulfuran-2-yl, benzisothiazolyl S,S-dioxido,
trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl
(TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl
(DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS),
t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl,
triphenylsilyl, diphenylmethylsilyl (DPMS),
t-butylmethoxyphenylsilyl (TBMPS), formate, acetate, chloroacetate,
dichloroacetate, trichloroacetate, trifluoroacetate,
methoxyacetate, triphenylmethoxyacetate, phenoxyacetate,
p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate
(levulinate), 4,4-(ethylenedithio)pentanoate
(levulinoyldithioacetal), adamantoate, crotonate,
4-methoxycrotonate, benzoate, p-phenylbenzoate,
2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate,
9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl
2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl
carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec),
2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl
carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl
p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl
p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate,
alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl
S-benzyl thiocarbonate, 4-ethoxy-1-napththyl carbonate, methyl
dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate,
4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate,
2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl,
4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate,
2,6-dichloro-4-methylphenoxyacetate,
2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate,
2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate,
isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate,
o-(methoxyacyl)benzoate, a-naphthoate, nitrate, alkyl
N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate,
borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate,
sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate
(Ts).
[0071] In certain embodiments, the substituent present on a sulfur
atom is a sulfur protecting group (also referred to as a "thiol
protecting group"). Sulfur protecting groups include, but are not
limited to, --R.sup.aa, --N(R.sup.bb).sub.2, --C(.dbd.O)SR.sup.aa,
--C(.dbd.O)R.sup.aa, --CO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--S(.dbd.O)R.sup.aa, --SO.sub.2R.sup.aa, --Si(R.sup.aa).sub.3,
--P(R.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.2, --P(OR.sup.cc).sub.3.sup.+X.sup.-,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2, and
--P(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein R.sup.aa, R.sup.bb,
and R.sup.cc are as defined herein. Sulfur protecting groups are
well known in the art and include those described in detail in
Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M.
Wuts, 3.sup.rd edition, John Wiley & Sons, 1999, incorporated
herein by reference.
[0072] A "leaving group" (LG) is an art-understood term referring
to a molecular fragment that departs with a pair of electrons in
heterolytic bond cleavage, wherein the molecular fragment is an
anion or neutral molecule. As used herein, a leaving group can be
an atom or a group capable of being displaced by a nucleophile.
See, for example, Smith, March Advanced Organic Chemistry 6th ed.
(501-502). Exemplary leaving groups include, but are not limited
to, halo (e.g., chloro, bromo, iodo) and activated substituted
hydroxyl groups (e.g., --OC(.dbd.O)SR.sup.aa, --OC(.dbd.O)R.sup.aa,
--OCO.sub.2R.sup.aa, --OC(.dbd.O)N(R.sup.bb).sub.2,
--OC(.dbd.NR.sup.bb)R.sup.aa, --OC(.dbd.NR.sup.bb)OR.sup.aa,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --OS(.dbd.O)R.sup.aa,
--OSO.sub.2R.sup.aa, --OP(R.sup.cc).sub.2, --OP(R.sup.cc).sub.3,
--OP(.dbd.O).sub.2R.sup.aa, --OP(.dbd.O)(R.sup.aa).sub.2,
--OP(.dbd.O)(OR.sup.cc).sub.2, --OP(.dbd.O).sub.2N(R.sup.bb).sub.2,
and --OP(.dbd.O)(NR.sup.bb).sub.2 wherein R.sup.aa, R.sup.bb, and
R.sup.cc are as defined herein).
[0073] A "hydrocarbon chain" refers to a substituted or
unsubstituted divalent alkyl, alkenyl, or alkynyl group. A
hydrocarbon chain includes (1) one or more chains of carbon atoms
immediately between the two radicals of the hydrocarbon chain; (2)
optionally one or more hydrogen atoms on the chain(s) of carbon
atoms; and (3) optionally one or more substituents ("non-chain
substituents," which are not hydrogen) on the chain(s) of carbon
atoms. A chain of carbon atoms consists of consecutively connected
carbon atoms ("chain atoms") and does not include hydrogen atoms or
heteroatoms. However, a non-chain substituent of a hydrocarbon
chain may include any atoms, including hydrogen atoms, carbon
atoms, and heteroatoms. For example, hydrocarbon chain
--C.sup.AH(C.sup.BH.sub.2C.sup.CH.sub.3)-- includes one chain atom
C.sup.A, one hydrogen atom on C.sup.A, and non-chain substituent
--(C.sup.BH.sub.2C.sup.CH.sub.3). The term "C.sub.x hydrocarbon
chain," wherein x is a positive integer, refers to a hydrocarbon
chain that includes x number of chain atom(s) between the two
radicals of the hydrocarbon chain. If there is more than one
possible value of x, the smallest possible value of x is used for
the definition of the hydrocarbon chain. For example,
--CH(C.sub.2H.sub.5)-- is a C.sub.1 hydrocarbon chain, and
##STR00010##
is a C.sub.3 hydrocarbon chain. When a range of values is used, the
meaning of the range is as described herein. For example, a
C.sub.3-10 hydrocarbon chain refers to a hydrocarbon chain where
the number of chain atoms of the shortest chain of carbon atoms
immediately between the two radicals of the hydrocarbon chain is 3,
4, 5, 6, 7, 8, 9, or 10. A hydrocarbon chain may be saturated
(e.g., --(CH.sub.2).sub.4--). A hydrocarbon chain may also be
unsaturated and include one or more C.dbd.C and/or C.ident.C bonds
anywhere in the hydrocarbon chain. For instance,
--CH.dbd.CH--(CH.sub.2).sub.2--, --CH.sub.2--C.ident.C--CH.sub.2--,
and --C.ident.C--CH.dbd.CH-- are all examples of a unsubstituted
and unsaturated hydrocarbon chain. In certain embodiments, the
hydrocarbon chain is unsubstituted (e.g., --C.ident.C-- or
--(CH.sub.2).sub.4--). In certain embodiments, the hydrocarbon
chain is substituted (e.g., --CH(C.sub.2H.sub.5)-- and
--CF.sub.2--). Any two substituents on the hydrocarbon chain may be
joined to form an optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl ring. For instance,
##STR00011##
are all examples of a hydrocarbon chain. In contrast, in certain
embodiments,
##STR00012##
are not within the scope of the hydrocarbon chains described
herein. When a chain atom of a C.sub.x hydrocarbon chain is
replaced with a heteroatom, the resulting group is referred to as a
C.sub.x hydrocarbon chain wherein a chain atom is replaced with a
heteroatom, as opposed to a C.sub.x-1 hydrocarbon chain. For
example,
##STR00013##
is a C.sub.3 hydrocarbon chain wherein one chain atom is replaced
with an oxygen atom.
[0074] The term "pharmaceutically acceptable salt" refers to those
salts which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of humans and lower
animals without undue toxicity, irritation, allergic response, and
the like, and are commensurate with a reasonable benefit/risk
ratio. Pharmaceutically acceptable salts are well known in the art.
For example, Berge et al., describe pharmaceutically acceptable
salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19,
incorporated herein by Pharmaceutically acceptable salts of the
compounds described herein include those derived from suitable
inorganic and organic acids and bases. Examples of pharmaceutically
acceptable, nontoxic acid addition salts are salts of an amino
group formed with inorganic acids such as hydrochloric acid,
hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric
acid or with organic acids such as acetic acid, oxalic acid, maleic
acid, tartaric citric acid, succinic acid, or malonic acid or by
using other methods known in the art such as ion exchange. Other
pharmaceutically acceptable salts include adipate, alginate,
ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate,
borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Salts derived from appropriate bases include alkali metal, alkaline
earth metal, ammonium and N.sup.+(C.sub.1-4 alkyl).sub.4.sup.-
salts. Representative alkali or alkaline earth metal salts include
sodium, lithium, potassium, calcium, magnesium, and the like.
Further pharmaceutically acceptable salts include, when
appropriate, nontoxic ammonium, quaternary ammonium, and amine
cations formed using counterions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate,
and aryl sulfonate.
[0075] The term "solvate" refers to forms of the compound, or a
salt thereof, that are associated with a solvent, usually by a
solvolysis reaction. This physical association may include hydrogen
bonding. Conventional solvents include water, methanol, ethanol,
acetic acid, DMSO, THF, diethyl ether, and the like. The compounds
described herein may be prepared, e.g., in crystalline form, and
may be solvated. Suitable solvates include pharmaceutically
acceptable solvates and further include both stoichiometric
solvates and non-stoichiometric solvates. In certain instances, the
solvate will be capable of isolation, for example, when one or more
solvent molecules are incorporated in the crystal lattice of a
crystalline solid. "Solvate" encompasses both solution-phase and
isolatable solvates. Representative solvates include hydrates,
ethanolates, and methanolates.
[0076] The term "hydrate" refers to a compound that is associated
with water. Typically, the number of the water molecules contained
in a hydrate of a compound is in a definite ratio to the number of
the compound molecules in the hydrate. Therefore, a hydrate of a
compound may be represented, for example, by the general formula
R.x H.sub.2O, wherein R is the compound, and x is a number greater
than 0. A given compound may form more than one type of hydrate,
including, e.g., monohydrates (x is 1), lower hydrates (x is a
number greater than 0 and smaller than 1, e.g., hemihydrates (R.0.5
H.sub.2O)), and polyhydrates (x is a number greater than 1, e.g.,
dihydrates (R.2 H.sub.2O) and hexahydrates (R.6 H.sub.2O)).
[0077] The term "tautomers" or "tautomeric" refers to two or more
interconvertable compounds resulting from at least one formal
migration of a hydrogen atom and at least one change in valency
(e.g., a single bond to a double bond, a triple bond to a single
bond, or vice versa). The exact ratio of the tautomers depends on
several factors, including temperature, solvent, and pH.
Tautomerizations (i.e., the reaction interconverting a tautomeric
pair) may be catalyzed by acid or base. Exemplary tautomerizations
include keto-to-enol, amide-to-imide, lactam-to-lactim,
enamine-to-imine, and enamine-to-(a different enamine)
tautomerizations.
[0078] It is also to be understood that compounds that have the
same molecular formula but differ in the nature or sequence of
bonding of their atoms or the arrangement of their atoms in space
are termed "isomers". Isomers that differ in the arrangement of
their atoms in space are termed "stereoisomers".
[0079] Stereoisomers that are not mirror images of one another are
termed "diastereomers" and those that are non-superimposable mirror
images of each other are termed "enantiomers". When a compound has
an asymmetric center, for example, it is bonded to four different
groups, a pair of enantiomers is possible. An enantiomer can be
characterized by the absolute configuration of its asymmetric
center and is described by the R- and S-sequencing rules of Cahn
and Prelog, or by the manner in which the molecule rotates the
plane of polarized light and designated as dextrorotatory or
levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral
compound can exist as either individual enantiomer or as a mixture
thereof. A mixture containing equal proportions of the enantiomers
is called a "racemic mixture".
[0080] The term "polymorphs" refers to a crystalline form of a
compound (or a salt, hydrate, or solvate thereof). All polymorphs
have the same elemental composition. Different crystalline forms
usually have different X-ray diffraction patterns, infrared
spectra, melting points, density, hardness, crystal shape, optical
and electrical properties, stability, and solubility.
Recrystallization solvent, rate of crystallization, storage
temperature, and other factors may cause one crystal form to
dominate. Various polymorphs of a compound can be prepared by
crystallization under different conditions.
[0081] The term "prodrugs" refers to compounds that have cleavable
groups and become by solvolysis or under physiological conditions
the compounds described herein, which are pharmaceutically active
in vivo. Such examples include, but are not limited to, choline
ester derivatives and the like, N-alkylmorpholine esters and the
like. Other derivatives of the compounds described herein have
activity in both their acid and acid derivative forms, but in the
acid sensitive form often offer advantages of solubility, tissue
compatibility, or delayed release in the mammalian organism (see,
Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier,
Amsterdam 1985). Prodrugs include acid derivatives well known to
practitioners of the art, such as, for example, esters prepared by
reaction of the parent acid with a suitable alcohol, or amides
prepared by reaction of the parent acid compound with a substituted
or unsubstituted amine, or acid anhydrides, or mixed Simple
aliphatic or aromatic esters, amides, and anhydrides derived from
acidic groups pendant on the compounds described herein are
particular prodrugs. In some cases it is desirable to prepare
double ester type prodrugs such as (acyloxy)alkyl esters or
((alkoxycarbonyl)oxy)alkylesters. C.sub.1-C.sub.8 alkyl,
C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8 alkynyl, aryl,
C.sub.7-C.sub.12 substituted aryl, and C.sub.7-C.sub.12 arylalkyl
esters of the compounds described herein may be preferred.
[0082] The term "small molecule" refers to molecules, whether
naturally-occurring or artificially created (e.g., via chemical
synthesis) that have a relatively low molecular weight.
[0083] Typically, a small molecule is an organic compound (i.e., it
contains carbon). The small molecule may contain multiple
carbon-carbon bonds, stereocenters, and other functional groups
(e.g., amines, hydroxyl, carbonyls, and heterocyclic rings, etc.).
In certain embodiments, the molecular weight of a small molecule is
not more than about 1,000 g/mol, not more than about 900 g/mol, not
more than about 800 g/mol, not more than about 700 g/mol, not more
than about 600 g/mol, not more than about 500 g/mol, not more than
about 400 g/mol, not more than about 300 g/mol, not more than about
200 g/mol, or not more than about 100 g/mol. In certain
embodiments, the molecular weight of a small molecule is at least
about 100 g/mol, at least about 200 g/mol, at least about 300
g/mol, at least about 400 g/mol, at least about 500 g/mol, at least
about 600 g/mol, at least about 700 g/mol, at least about 800
g/mol, or at least about 900 g/mol, or at least about 1,000 g/mol.
Combinations of the above ranges (e.g., at least about 200 g/mol
and not more than about 500 g/mol) are also possible. In certain
embodiments, the small molecule is a therapeutically active agent
such as a drug (e.g., a molecule approved by the U.S. Food and Drug
Administration as provided in the Code of Federal Regulations
(C.F.R.)). The small molecule may also be complexed with one or
more metal atoms and/or metal ions. In this instance, the small
molecule is also referred to as a "small organometallic molecule."
Preferred small molecules are biologically active in that they
produce a biological effect in animals, preferably mammals, more
preferably humans. Small molecules include, but are not limited to,
radionuclides and imaging agents. In certain embodiments, the small
molecule is a drug. Preferably, though not necessarily, the drug is
one that has already been deemed safe and effective for use in
humans or animals by the appropriate governmental agency or
regulatory body. For example, drugs approved for human use are
listed by the FDA under 21 C.F.R. .sctn..sctn. 330.5, 331 through
361, and 440 through 460, incorporated herein by reference; drugs
for veterinary use are listed by the FDA under 21 C.F.R.
.sctn..sctn. 500 through 589, incorporated herein by reference. All
listed drugs are considered acceptable for use in accordance with
the present invention.
[0084] A "protein," "peptide," or "polypeptide" comprises a polymer
of amino acid residues linked together by peptide bonds. The term
refers to proteins, polypeptides, and peptides of any size,
structure, or function. Typically, a protein will be at least three
amino acids long. A protein may refer to an individual protein or a
collection of proteins. Inventive proteins preferably contain only
natural amino acids, although non-natural amino acids (i.e.,
compounds that do not occur in nature but that can be incorporated
into a polypeptide chain) and/or amino acid analogs as are known in
the art may alternatively be employed. Also, one or more of the
amino acids in a protein may be modified, for example, by the
addition of a chemical entity such as a carbohydrate group, a
hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl
group, a fatty acid group, a linker for conjugation or
functionalization, or other modification. A protein may also be a
single molecule or may be a multi-molecular complex. A protein may
be a fragment of a naturally occurring protein or peptide. A
protein may be naturally occurring, recombinant, synthetic, or any
combination of these.
[0085] "Transcription" is the first step of gene expression, in
which a particular segment of DNA is copied into RNA by an RNA
polymerase. During transcription, a DNA sequence is read by an RNA
polymerase, which produces a complementary, antiparallel RNA strand
called a primary transcript. Transcription may proceed in the
following steps: [0086] One or more sigma factor protein binds to
the RNA polymerase holoenzyme, allowing it to bind to promoter DNA.
[0087] RNA polymerase creates a transcription bubble, which
separates the two strands of the DNA helix. This is done by
breaking the hydrogen bonds between complementary DNA nucleotides.
[0088] RNA polymerase adds matching RNA nucleotides to the
complementary nucleotides of one DNA strand. [0089] RNA
sugar-phosphate backbone forms with assistance from RNA polymerase
to form an RNA strand. [0090] Hydrogen bonds of the untwisted
RNA-DNA helix break, freeing the newly synthesized RNA strand.
[0091] If the cell has a nucleus, the RNA may be further processed.
This may include polyadenylation, capping, and splicing. [0092] The
RNA may remain in the nucleus or exit to the cytoplasm through the
nuclear pore complex. A "transcription inhibitor" is a substance
(e.g., a compound) that inhibits one or more of the steps of
transcription.
[0093] The term "inhibition", "inhibiting", "inhibit," or
"inhibitor" refer to the ability of a compound to reduce, slow,
halt, and/or prevent activity of a particular biological process in
a cell relative to vehicle.
[0094] The terms "composition" and "formulation" are used
interchangeably.
[0095] A "subject" to which administration is contemplated refers
to a human (i.e., male or female of any age group, e.g., pediatric
subject (e.g., infant, child, or adolescent) or adult subject
(e.g., young adult, middle-aged adult, or senior adult)) or
non-human animal. In certain embodiments, the non-human animal is a
mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey),
commercially relevant mammal (e.g., cattle, pig, horse, sheep,
goat, cat, or dog), or bird (e.g., commercially relevant bird, such
as chicken, duck, goose, or turkey)). In certain embodiments, the
non-human animal is a fish, reptile, or amphibian. The non-human
animal may be a male or female at any stage of development. The
non-human animal may be a transgenic animal or genetically
engineered animal. A "patient" refers to a human subject in need of
treatment of a disease. The subject may also be a plant. In certain
embodiments, the plant is a land plant. In certain embodiments, the
plant is a non-vascular land plant. In certain embodiments, the
plant is a vascular land plant. In certain embodiments, the plant
is a seed plant. In certain embodiments, the plant is a cultivated
plant. In certain embodiments, the plant is a dicot. In certain
embodiments, the plant is a monocot. In certain embodiments, the
plant is a flowering plant. In some embodiments, the plant is a
cereal plant, e.g., maize, corn, wheat, rice, oat, barley, rye, or
millet. In some embodiments, the plant is a legume, e.g., a bean
plant, e.g., soybean plant. In some embodiments, the plant is a
tree or shrub.
[0096] The term "biological sample" refers to any sample including
tissue samples (such as tissue sections and needle biopsies of a
tissue); cell samples (e.g., cytological smears (such as Pap or
blood smears) or samples of cells obtained by microdissection);
samples of whole organisms (such as samples of yeasts or bacteria);
or cell fractions, fragments or organelles (such as obtained by
lysing cells and separating the components thereof by
centrifugation or otherwise). Other examples of biological samples
include blood, serum, urine, semen, fecal matter, cerebrospinal
fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied
tissue (e.g., obtained by a surgical biopsy or needle biopsy),
nipple aspirates, milk, vaginal fluid, saliva, swabs (such as
buccal swabs), or any material containing biomolecules that is
derived from a first biological sample.
[0097] The terms "administer," "administering," or "administration"
refers to implanting, absorbing, ingesting, injecting, inhaling, or
otherwise introducing a compound described herein, or a composition
thereof, in or on a subject.
[0098] The terms "treatment," "treat," and "treating" refer to
reversing, alleviating, delaying the onset of, or inhibiting the
progress of a disease described herein. In some embodiments,
treatment may be administered after one or more signs or symptoms
of the disease have developed or have been observed. In other
embodiments, treatment may be administered in the absence of signs
or symptoms of the disease. For example, treatment may be
administered to a susceptible subject prior to the onset of
symptoms (e.g., in light of a history of symptoms and/or in light
of exposure to a pathogen). Treatment may also be continued after
symptoms have resolved, for example, to delay and/or prevent
recurrence.
[0099] The term "prevent," "preventing," or "prevention" refers to
a prophylactic treatment of a subject who is not and was not with a
disease but is at risk of developing the disease or who was with a
disease, is not with the disease, but is at risk of regression of
the disease. In certain embodiments, the subject is at a higher
risk of developing the disease or at a higher risk of regression of
the disease than an average healthy member of a population.
[0100] The terms "condition," "disease," and "disorder" are used
interchangeably.
[0101] An "effective amount" of a compound described herein refers
to an amount sufficient to elicit the desired biological response.
An effective amount of a compound described herein may vary
depending on such factors as the desired biological endpoint, the
pharmacokinetics of the compound, the condition being treated, the
mode of administration, and the age and health of the subject. In
certain embodiments, an effective amount is a therapeutically
effective amount. In certain embodiments, an effective amount is a
prophylactic treatment. In certain embodiments, an effective amount
is the amount of a compound described herein in a single dose. In
certain embodiments, an effective amount is the combined amounts of
a compound described herein in multiple doses.
[0102] A "therapeutically effective amount" of a compound described
herein is an amount sufficient to provide a therapeutic benefit in
the treatment of a condition or to delay or minimize one or more
symptoms associated with the condition. A therapeutically effective
amount of a compound means an amount of therapeutic agent, alone or
in combination with other therapies, which provides a therapeutic
benefit in the treatment of the condition. The term
"therapeutically effective amount" can encompass an amount that
improves overall therapy, reduces or avoids symptoms, signs, or
causes of the condition, and/or enhances the therapeutic efficacy
of another therapeutic agent.
[0103] A "prophylactically effective amount" of a compound
described herein is an amount effective to prevent a condition, or
one or more symptoms associated with the condition and/or prevent
its recurrence. A prophylactically effective amount of a compound
means an amount of a therapeutic agent, alone or in combination
with other agents, which provides a prophylactic benefit in the
prevention of the condition. The term "prophylactically effective
amount" can encompass an amount that improves overall prophylaxis
or enhances the prophylactic efficacy of another prophylactic
agent.
[0104] A "proliferative disease" refers to a disease that occurs
due to abnormal growth or extension by the multiplication of cells
(Walker, Cambridge Dictionary of Biology; Cambridge University
Press: Cambridge, UK, 1990). A proliferative disease may be
associated with: 1) the pathological proliferation of normally
quiescent cells; 2) the pathological migration of cells from their
normal location (e.g., metastasis of neoplastic cells); 3) the
pathological expression of proteolytic enzymes such as the matrix
metalloproteinases (e.g., collagenases, gelatinases, and
elastases); or 4) the pathological angiogenesis as in proliferative
retinopathy and tumor metastasis. Exemplary proliferative diseases
include cancers (i.e., "malignant neoplasms"), benign neoplasms,
angiogenesis, inflammatory diseases, and autoimmune diseases.
[0105] The term "angiogenesis" refers to the physiological process
through which new blood vessels form from pre-existing vessels.
Angiogenesis is distinct from vasculogenesis, which is the de novo
formation of endothelial cells from mesoderm cell precursors. The
first vessels in a developing embryo form through vasculogenesis,
after which angiogenesis is responsible for most blood vessel
growth during normal or abnormal development. Angiogenesis is a
vital process in growth and development, as well as in wound
healing and in the formation of granulation tissue. However,
angiogenesis is also a fundamental step in the transition of tumors
from a benign state to a malignant one, leading to the use of
angiogenesis inhibitors in the treatment of cancer. Angiogenesis
may be chemically stimulated by angiogenic proteins, such as growth
factors (e.g., VEGF). "Pathological angiogenesis" refers to
abnormal (e.g., excessive or insufficient) angiogenesis that
amounts to and/or is associated with a disease.
[0106] The terms "neoplasm" and "tumor" are used herein
interchangeably and refer to an abnormal mass of tissue wherein the
growth of the mass surpasses and is not coordinated with the growth
of a normal tissue. A neoplasm or tumor may be "benign" or
"malignant," depending on the following characteristics: degree of
cellular differentiation (including morphology and functionality),
rate of growth, local invasion, and metastasis. A "benign neoplasm"
is generally well differentiated, has characteristically slower
growth than a malignant neoplasm, and remains localized to the site
of origin. In addition, a benign neoplasm does not have the
capacity to infiltrate, invade, or metastasize to distant
sites.
[0107] Exemplary benign neoplasms include, but are not limited to,
lipoma, chondroma, adenomas, acrochordon, senile angiomas,
seborrheic keratoses, lentigos, and sebaceous hyperplasias. In some
cases, certain "benign" tumors may later give rise to malignant
neoplasms, which may result from additional genetic changes in a
subpopulation of the tumor's neoplastic cells, and these tumors are
referred to as "pre-malignant neoplasms." An exemplary
pre-malignant neoplasm is a teratoma. In contrast, a "malignant
neoplasm" is generally poorly differentiated (anaplasia) and has
characteristically rapid growth accompanied by progressive
infiltration, invasion, and destruction of the surrounding tissue.
Furthermore, a malignant neoplasm generally has the capacity to
metastasize to distant sites. The term "metastasis," "metastatic,"
or "metastasize" refers to the spread or migration of cancerous
cells from a primary or original tumor to another organ or tissue
and is typically identifiable by the presence of a "secondary
tumor" or "secondary cell mass" of the tissue type of the primary
or original tumor and not of that of the organ or tissue in which
the secondary (metastatic) tumor is located. For example, a
prostate cancer that has migrated to bone is said to be
metastasized prostate cancer and includes cancerous prostate cancer
cells growing in bone tissue.
[0108] The term "cancer" refers to a class of diseases
characterized by the development of abnormal cells that proliferate
uncontrollably and have the ability to infiltrate and destroy
normal body tissues. See, e.g., Stedman's Medical Dictionary, 25th
ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990.
Exemplary cancers include, but are not limited to, hematological
malignancies. The term "hematological malignancy" refers to tumors
that affect blood, bone marrow, and/or lymph nodes. Exemplary
hematological malignancies include, but are not limited to,
leukemia, such as acute lymphocytic leukemia (ALL) (e.g., B-cell
ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell
AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell
CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g.,
B-cell CLL, T-cell CLL)); lymphoma, such as Hodgkin lymphoma (HL)
(e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g.,
B-cell NHL, such as diffuse large cell lymphoma (DLCL) (e.g.,
diffuse large B-cell lymphoma (DLBCL, e.g., activated B-cell (ABC)
DLBCL (ABC-DLBCL))), follicular lymphoma, chronic lymphocytic
leukemia/small lymphocytic lymphoma (CLL/SLL), mantle cell lymphoma
(MCL), marginal zone B-cell lymphoma (e.g., mucosa-associated
lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell
lymphoma, splenic marginal zone B-cell lymphoma), primary
mediastinal B-cell lymphoma, Burkitt lymphoma, Waldenstrim's
macroglobulinemia (WM, lymphoplasmacytic lymphoma), hairy cell
leukemia (HCL), immunoblastic large cell lymphoma, precursor
B-lymphoblastic lymphoma, central nervous system (CNS) lymphoma
(e.g., primary CNS lymphoma and secondary CNS lymphoma); and T-cell
NHL, such as precursor T-lymphoblastic lymphomalleukemia,
peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma
(CTCL) (e.g., mycosis fungoides, Sezary syndrome),
angioimmunoblastic T-cell lymphoma, extranodal natural killer
T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous
panniculitis-like T-cell lymphoma, and anaplastic large cell
lymphoma); lymphoma of an immune privileged site (e.g., cerebral
lymphoma, ocular lymphoma, lymphoma of the placenta, lymphoma of
the fetus, testicular lymphoma); a mixture of one or more
leukemiallymphoma as described above; myelodysplasia; and multiple
myeloma (MM). Additional exemplary cancers include, but are not
limited to, lung cancer (e.g., bronchogenic carcinoma, small cell
lung cancer (SCLC), non-small cell lung cancer (NSCLC),
adenocarcinoma of the lung); kidney cancer (e.g., nephroblastoma,
a.k.a. Wilms' tumor, renal cell carcinoma); acoustic neuroma;
adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma
(e.g., lymphangiosarcoma, lymphangioendotheliosarcoma,
hemangiosarcoma); appendix cancer; benign monoclonal gammopathy;
biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast
cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of
the breast, mammary cancer, medullary carcinoma of the breast);
brain cancer (e.g., meningioma, glioblastomas, glioma (e.g.,
astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer;
carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma);
choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer
(e.g., colon cancer, rectal cancer, colorectal adenocarcinoma);
connective tissue cancer; epithelial carcinoma; ependymoma;
endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic
hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer,
uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the
esophagus, Barrett's adenocarcinoma); Ewing's sarcoma; ocular
cancer (e.g., intraocular melanoma, retinoblastoma); familiar
hypereosinophilia; gall bladder cancer; gastric cancer (e.g.,
stomach adenocarcinoma); gastrointestinal stromal tumor (GIST);
germ cell cancer; head and neck cancer (e.g., head and neck
squamous cell carcinoma, oral cancer (e.g., oral squamous cell
carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal
cancer, nasopharyngeal cancer, oropharyngeal cancer)); heavy chain
disease (e.g., alpha chain disease, gamma chain disease, mu chain
disease; hemangioblastoma; hypopharynx cancer; inflammatory
myofibroblastic tumors; immunocytic amyloidosis; liver cancer
(e.g., hepatocellular cancer (HCC), malignant hepatoma);
leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis);
muscle cancer; myelodysplastic syndrome (MDS); mesothelioma;
myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV),
essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM)
a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis,
chronic myelocytic leukemia (CML), chronic neutrophilic leukemia
(CNL), hypereosinophilic syndrome (HES)); neuroblastoma;
neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2,
schwannomatosis); neuroendocrine cancer (e.g.,
gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid
tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g.,
cystadenocarcinoma, ovarian embryonal carcinoma, ovarian
adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g.,
pancreatic andenocarcinoma, intraductal papillary mucinous neoplasm
(IPMN), Islet cell tumors); penile cancer (e.g., Paget's disease of
the penis and scrotum); pinealoma; primitive neuroectodermal tumor
(PNT); plasma cell neoplasia; paraneoplastic syndromes;
intraepithelial neoplasms; prostate cancer (e.g., prostate
adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland
cancer; skin cancer (e.g., squamous cell carcinoma (SCC),
keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small
bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g.,
malignant fibrous histiocytoma (MFH), liposarcoma, malignant
peripheral nerve sheath tumor (MPNST), chondrosarcoma,
fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small
intestine cancer; sweat gland carcinoma; synovioma; testicular
cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid
cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid
carcinoma (PTC), medullary thyroid cancer); urethral cancer;
vaginal cancer; and vulvar cancer (e.g., Paget's disease of the
vulva).
[0109] The term "inflammatory disease" refers to a disease caused
by, resulting from, or resulting in inflammation. The term
"inflammatory disease" may also refer to a dysregulated
inflammatory reaction that causes an exaggerated response by
macrophages, granulocytes, and/or T-lymphocytes leading to abnormal
tissue damage and/or cell death. An inflammatory disease can be
either an acute or chronic inflammatory condition and can result
from infections or non-infectious causes. Inflammatory diseases
include, without limitation, atherosclerosis, arteriosclerosis,
autoimmune disorders, multiple sclerosis, systemic lupus
erythematosus, polymyalgia rheumatica (PMR), gouty arthritis,
degenerative arthritis, tendonitis, bursitis, psoriasis, cystic
fibrosis, arthrosteitis, rheumatoid arthritis, inflammatory
arthritis, Sjogren's syndrome, giant cell arteritis, progressive
systemic sclerosis (scleroderma), ankylosing spondylitis,
polymyositis, dermatomyositis, pemphigus, pemphigoid, diabetes
(e.g., Type I), myasthenia gravis, Hashimoto's thyroiditis, Graves'
disease, Goodpasture's disease, mixed connective tissue disease,
sclerosing cholangitis, inflammatory bowel disease, Crohn's
disease, ulcerative colitis, pernicious anemia, inflammatory
dermatoses, usual interstitial pneumonitis (UIP), asbestosis,
silicosis, bronchiectasis, berylliosis, talcosis, pneumoconiosis,
sarcoidosis, desquamative interstitial pneumonia, lymphoid
interstitial pneumonia, giant cell interstitial pneumonia, cellular
interstitial pneumonia, extrinsic allergic alveolitis, Wegener's
granulomatosis and related forms of angiitis (temporal arteritis
and polyarteritis nodosa), inflammatory dermatoses, hepatitis,
delayed-type hypersensitivity reactions (e.g., poison ivy
dermatitis), pneumonia, respiratory tract inflammation, Adult
Respiratory Distress Syndrome (ARDS), encephalitis, immediate
hypersensitivity reactions, asthma, hayfever, allergies, acute
anaphylaxis, rheumatic fever, glomerulonephritis, pyelonephritis,
cellulitis, cystitis, chronic cholecystitis, ischemia (ischemic
injury), reperfusion injury, appendicitis, arteritis, blepharitis,
bronchiolitis, bronchitis, cervicitis, cholangitis,
chorioamnionitis, conjunctivitis, dacryoadenitis, dermatomyositis,
endocarditis, endometritis, enteritis, enterocolitis,
epicondylitis, epididymitis, fasciitis, fibrositis, gastritis,
gastroenteritis, gingivitis, ileitis, iritis, laryngitis, myelitis,
myocarditis, nephritis, omphalitis, oophoritis, orchitis, osteitis,
otitis, pancreatitis, parotitis, pericarditis, pharyngitis,
pleuritis, phlebitis, pneumonitis, proctitis, prostatitis,
rhinitis, salpingitis, sinusitis, stomatitis, synovitis, testitis,
tonsillitis, urethritis, urocystitis, uveitis, vaginitis,
vasculitis, vulvitis, vulvovaginitis, angitis, chronic bronchitis,
osteomyelitis, optic neuritis, temporal arteritis, transverse
myelitis, necrotizing fasciitis, and necrotizing enterocolitis. An
ocular inflammatory disease includes, but is not limited to,
post-surgical inflammation.
[0110] An "autoimmune disease" refers to a disease arising from an
inappropriate immune response of the body of a subject against
substances and tissues normally present in the body. In other
words, the immune system mistakes some part of the body as a
pathogen and attacks its own cells. This may be restricted to
certain organs (e.g., in autoimmune thyroiditis) or involve a
particular tissue in different places (e.g., Goodpasture's disease
which may affect the basement membrane in both the lung and
kidney). The treatment of autoimmune diseases is typically with
immunosuppression, e.g., medications which decrease the immune
response. Exemplary autoimmune diseases include, but are not
limited to, glomerulonephritis, Goodpasture's syndrome, necrotizing
vasculitis, lymphadenitis, peri-arteritis nodosa, systemic lupus
erythematosis, rheumatoid arthritis, psoriatic arthritis, systemic
lupus erythematosis, psoriasis, ulcerative colitis, systemic
sclerosis, dermatomyositis/polymyositis, anti-phospholipid antibody
syndrome, scleroderma, pemphigus vulgaris, ANCA-associated
vasculitis (e.g., Wegener's granulomatosis, microscopic
polyangiitis), uveitis, Sjogren's syndrome, Crohn's disease,
Reiter's syndrome, ankylosing spondylitis, Lyme disease,
Guillain-Barr6 syndrome, Hashimoto's thyroiditis, and
cardiomyopathy.
BRIEF DESCRIPTION OF THE DRAWINGS
[0111] FIG. 1 shows that a treatment with BGJ398 led to resistance
emergence in RT112 cells. One mechanism of resistance may be
through the upregulation of NRG1 due to signaling via ERBB2/ERBB3
and is rapid (a matter of days) and reversible (Wang et al.,
Oncogene, 2015, 34(17):2167-77). The resistance may also be
associated with EMT.
[0112] FIG. 2 shows the time to develop resistance under the
treatment of various drugs or different combinations of various
drugs. Each drug was administered at a concentration of 1 .mu.M.
RT112: RT112 cells. H2077: H2077 cells. BGJ: BGJ398. GSK:
GSK1120212. BKM: BKM120. AZD: AZD8931.
[0113] FIG. 3 shows the RT112 cell viability after the RT112 cells
were treated with THZ1 or a combination of THZ1 and BGJ398. The
concentration of BGJ398 was kept constant at 1 nM. [Agonist]:
concentration of THZ1 in .mu.M.
[0114] FIG. 4 shows the RT112 colony formation assay. RT112 cells
were treated for two, three, or four weeks with each of DMSO
(control), THZ1, BGJ398, and a combination of THZ1 and BGJ398. uM:
.mu.M.
[0115] FIG. 5A shows images of stained RT112 cell colonies after
treating RT112 cells for four weeks with DMSO (control), THZ1,
BGJ398, and a combination of THZ1 and BGJ398. FIG. 5B shows the
drug resistant colonies expressed as a percentage of the control,
according to the results in FIG. 5A.
[0116] FIG. 6 shows PC9 cell viability after the PC9 cells were
treated with erlotinib (top graph); and PC9 cell viability after
the PC9 cells were treated with THZ1 or a combination of THZ1 and
erlotinib (bottom graph). The concentration of erlotinib was kept
constant at 100 nM in the bottom graph. The treatment of a
combination of THZ1 and erlotinib prevented resistance emergence in
PC9 cells. The mechanism of the acquired resistance to EGFR
inhibition may be through a T790M EGFR mutation, through the
FGF2-FGFR1 autocrine pathway, or through other RTK pathways.
[0117] FIG. 7 shows the results of a PC9 colony formation assay.
PC9 cells were treated for two, three, or four weeks with each of
DMSO (control), THZ1, erlotinib, and a combination of THZ1 and
erlotinib. Erlot: erlotinib. uM: .mu.M.
[0118] FIG. 8A shows images of stained PC9 cell colonies after
treating PC9 cells for four weeks with DMSO (control), THZ1,
erlotinib, and a combination of THZ1 and erlotinib. FIG. 8B shows
the drug resistant colonies expressed as a percentage of the
control, according to the results in FIG. 8A.
[0119] FIG. 9 shows the cell viability of H2077 (FGFR1 amplified)
cells after the H2077 cells were treated with BGJ398 (top graph);
and the cell viability of H2077 (FGFR1 amplified) cells after the
H2077 cells were treated with THZ1 or a combination of THZ1 and
BGJ398 (bottom graph). The concentration of BGJ398 was kept
constant at 1 nM in the bottom graph. The mechanism of resistance
to BGJ398 may be through an NRAS mutation (Q61R), or MET
amplification and/or increased expression.
[0120] FIG. 10 shows the results of a H2077 colony formation assay.
H2077 cells were treated for two, three, or four weeks with each of
DMSO (control), THZ1, BGJ398, and a combination of THZ1 and BGJ398.
uM: .mu.M.
[0121] FIG. 11A shows the images of stained H2077 cell colonies
after the H2077 cells were treated four weeks with DMSO (control),
THZ1, BGJ398, or a combination of THZ1 and BGJ398. FIG. 11B shows
the staining of the H2077 cells after the treatments of FIG. 11A.
FIG. 11C shows the drug resistant colonies as a percentage of the
control, according to the results in FIG. 11A.
[0122] FIG. 12 shows the cell viability of H1792 cells (KRAS-mutant
NSCLC cell line) after treatment with THZ1, GSK1120212, erlotinib,
or BEZ235. [Agonist]: concentration of THZ1, GSK1120212, erlotinib,
or BEZ235, in .mu.M.
[0123] FIG. 13 shows the cell viability of H1792 cells after
treatment with THZ1, GSK1120212, or a combination of THZ1 and
GSK1120212. The concentration of GSK1120212 was kept constant at 50
nM. [Agonist]: concentration of THZ1 in .mu.M. GSK: GSK1120212.
[0124] FIG. 14A shows images of stained H1792 cell colonies after
treating H1792 cells for four weeks with DMSO (control),
GSK1120212, THZ1, or a combination of GSK1120212 and THZ1. GSK:
GSK1120212. FIG. 14B shows the drug resistant colonies as a
percentage of the control, according to the results in FIG. 14A.
GSK: GSK1120212.
[0125] FIG. 15 shows the cell viability of H23 cells (KRAS-mutant
NSCLC cell line) after treatment with THZ1, GSK1120212, erlotinib,
or BEZ235. [Agonist]: concentration of THZ1, GSK1120212, erlotinib,
or BEZ235, in .mu.M.
[0126] FIG. 16 shows the cell viability of H23 cells treated with
THZ1, GSK1120212, or a combination of THZ1 and GSK1120212. The
concentration of GSK112012 was kept constant at 25 nM. [Agonist]:
concentration of THZ1 in .mu.M.
[0127] FIG. 17A shows images of stained H23 cell colonies after
treating H23 cells for four weeks with DMSO (control), GSK1120212,
THZ1, or a combination of THZ1 and GSK1120212. GSK: GSK1120212.
FIG. 17B shows the drug resistant colonies as a percentage of the
control, according to the results in FIG. 17A.
[0128] FIG. 18 shows the cell viability of A549 cells (KRAS-mutant
NSCLC cell line) after treatment with GSK1120212, THZ1, BGJ398, or
erlotinib. [Agonist]: concentration of GSK1120212, THZ1, BGJ398, or
erlotinib, in .mu.M.
[0129] FIG. 19 shows the cell viability of A549 cells treated with
GSK1120212, THZ1, or a combination of GSK1120212 and THZ1. The
concentration of GSK112012 was kept constant at 1 .mu.M. [Agonist]:
concentration of THZ1 in .mu.M.
[0130] FIG. 20A shows the confluence of A549 cells treated for two
or four weeks with THZ1, a low dose of GSK1120212, a combination of
THZ1 and a low dose of GSK1120212, or DMSO (control).. FIG. 20B
shows the confluence of A549 cells treated for two or four weeks
with THZ1, an intermediate dose of GSK1120212, a combination of
THZ1 and an intermediate dose of GSK1120212, or DMSO (control).
FIG. 20C shows the confluence of A549 cells treated for two or four
weeks with THZ1, a high dose of GSK1120212, a combination of THZ1
and a high dose of GSK1120212, or DMSO (control). In FIGS. 20A to
20C, GSK: GSK1120212.
[0131] FIG. 21A shows images of stained A549 cell colonies after
treating A549 cells for four weeks with DMSO (control), GSK1120212,
or a combination of GSK1120212 and THZ1. GSK: GSK1120212. FIG. 21B
shows the drug resistant colonies as a percentage of the control,
according to the results in FIG. 21A. GSK: GSK1120212.
[0132] FIGS. 22A to 22C show the tumor volume in LSL-EGFR-T790M
mice (n=2 per group) treated with a combination of WZ4002 and THZ-1
(THZ1, FIG. 22A), THZ-1 (FIG. 22B), and WZ4002 (FIG. 22C).
[0133] FIG. 23 shows the cell viability of HSC4 (HSC-4) cell lines
treated with different drugs. The concentrations of the drugs are
in molar.
[0134] FIG. 24 shows the cell viability of YD8 cell lines treated
with different drugs. The concentrations of the drugs are in
molar.
[0135] FIG. 25 shows the half maximal inhibitory concentrations of
four different cell lines under different treatments.
[0136] FIG. 26 shows the confluence of HSC4 and YD8 cell lines
treated for one to four weeks with a combination of THZ1 and
GSK1120212, a combination of THZ1 and BEZ235, or THZ1 alone.
[0137] FIG. 27 shows stained cells after the specified treatments
in the HCS4 and YD8 cell lines.
[0138] FIG. 28 shows that the feedback activation of STAT3 mediates
the resistance and that THZ1 does not inhibit the feedback
activation of STAT3 in the PC9 (EGFR-driven) and RT112
(FGFR-driven) cell lines. Treatment with a combination of erlotinib
and THZ1 or a combination of BGJ398 and THZ1, for 24 hours,
strongly activated STAT3.
[0139] FIG. 29 shows that the feedback activation of STAT3 mediates
the resistance and that THZ1 (100 nM, left panel; 50 nM, right
panel) does not inhibit feedback activation of STAT3 with regard to
cells undergoing morphologic changes. Combined RTK and CDK7
inhibition strongly activates STAT3 at 24 hours after
treatment.
[0140] FIG. 30 shows a proposed mechanism that a combination of
THZ1 and an RTK inhibitor (RTKi) or a combination of THZ1 and a MEK
inhibitor (MEKi) prevents the emergence of drug resistance.
[0141] FIG. 31 shows the cell viability of RT 112 cells using a
CELLTITER-GLO assay. RT112 cells were treated for 96 hours with
YKL-01-116, THZ5-31-1, JQ1, E9, dinaciclib, DCA, or THZ1.
[Agonist]: concentration of YKL-01-116, THZ5-31-1, JQ1, E9,
dinaciclib, DCA, or THZ1, in .mu.M.
[0142] FIG. 32 shows the cell viability of PC9 cells using a
CELLTITER-GLO assay. PC9 cells were treated for 96 hours with
YKL-01-116, THZ5-31-1, or THZ1. [Agonist]: concentration of
YKL-01-116, THZ5-31-1, or THZ1, in .mu.M.
[0143] FIG. 33 shows the cell viability of A549 cells using a
CELLTITER-GLO assay. A549 cells were treated for 96 hours with
YKL-01-116, THZ5-31-1, or THZ1. [Agonist]: concentration of
YKL-01-116, THZ5-31-1, or THZ1, in .mu.M.
[0144] FIG. 34 shows images of stained RT112 cell colonies after
treating RT112 cells for one week with THZ1, BGJ398, or a
combination of THZ1 and BGJ398.
[0145] FIG. 35 shows the results of a colony formation assay. RT112
cells in a 24-well plate were treated for one week with THZ1, a
combination of THZ1 and BGJ398, dinaciclib, a combination of
dinaciclib and BGJ398, E9, a combination of E9 and BGJ398, JQ1, a
combination of JQ1 and BGJ398, DCA, or a combination of DCA and
BGJ398. BGJ: BGJ398.
[0146] FIG. 36 shows images of the stained RT112 cell colonies in
FIG. 35. BGJ: BGJ398.
[0147] FIG. 37 shows the percentage of apoptotic (annexin-positive)
and necrotic (double-positive) PC9 cells after 24 and 48 hours of
the indicated treatments. A statistically significant increase was
observed at 24 hours for the cells treated with a combination of
erlotinib and THZ1, compared with the cells treated with erlotinib
alone or THZ1 alone, and such increase was more apparent at 48
hours.
[0148] FIG. 38 shows the percentage of apoptotic (annexin-positive)
and necrotic (double-positive) RT112 cells after 24 and 48 hours of
the indicated treatments.
[0149] FIG. 39 shows the percentage of apoptotic (annexin-positive)
and necrotic (double-positive) A549 cells after 24 and 48 hours of
the indicated treatments. A statistically significant increase in
cell death was overserved for the combination treatment, compared
with the treatments that did not involve a combination.
[0150] FIG. 40 shows the relative proliferation for the various
guides. For CDK7, guides 2, 3, and 5 had the greatest effect, and
for CDK12, guides 1, 3, and 5 had the greatest effect.
[0151] FIG. 41 shows the increased cell death after treatment with
erlotinib alone or erlotinib with the various guides for CDK7 (left
graph) and CDK12 (right graph). n was 2 for each group in the CDK7
experiment, and n was 3 for each group in the CDK12 experiment.
[0152] FIG. 42 shows in vivo xenograft studies in PC9, an
EGFR-dependent cell line. A significant increase in survival with
the combination treatment was observed. The time until the maximum
tumor volume was reached was significantly higher in the combined
treatment group compared with the control and each treatment alone.
The increase in survival between the MEK inhibitor and the
combination treatment did not become apparent until after week
7.
[0153] FIG. 43A shows the results of an experiment in a GEM model
dependent on EGFR, where the EGFR allele has two mutations: an
L858R and a T790M. The mice receiving the combination treatment
(diamond symbols) show substantially smaller tumor volumes at both
two and four weeks, as compared to mice treated with the individual
components of the treatment.
[0154] FIG. 43B shows the percent tumor volume change at the
indicated time points (represented graphically after transformation
to the tumor volume index in FIG. 43A). One mouse under the
combination treatment has survived for at least 16 weeks.
[0155] FIG. 44A shows Western blot results for the PC9 and RT112
cell lines. After 24 hours of no treatment, treatment with 1 .mu.M
erlotinib, treatment with 100 nM THZ1, or treatment with a
combination of 1 .mu.M erlotinib and 100 nM THZ1, signaling
pathways were characterized. The doses used were identical to those
used in the colony formation assays and RNAseq and ChlPseq
experiments. Notably, p-STAT3 increases with erlotinib treatment,
as expected based on what is disclosed in Sharma et al. (Cell,
2010, 141(1):69-80) and increases further with the combination
treatment in PC9 cells. The same trend was also observed in the
RT112 line. The data show that THZ1 is not blocking the activation
of p-STAT3, but still may be blocking the activation of STAT3
targets. With erlotinib treatment, FGFR, a known bypass mechanism
in PC9, is activated. The activation is not seen with THZ1 or with
the combination treatment. Similar results are shown in the RT112
cell line with ERBB2. Therefore, the combination treatment blocks
the potential bypass mechanism. In addition, a decrease in p-ERK in
both the PC9 and RT112 cell lines was noted from the combination
treatment. There was also an increase in RNAPII phosphorylation at
24 hours, which was decreased somewhat by the combination
treatment. This is unexpected, given that THZ1 should block
CDK7-mediated RNAPII phosphorylation. The finding may be related to
the dose or time point assayed.
[0156] FIG. 44B shows Western blot results for the A549 and H23
cell lines under the same conditions as in FIG. 44A. p-STAT3 was
increased with MEK inhibition and with the combination treatment.
Both the A549 and H23 cell lines were shown to employ the STAT3
feedback loop in Sharma et al., Cell, 2010, 141(1):69-80. p-ERK was
decreased with the combination treatment in both cell lines. RNAPII
phosphorylation was increased with THZ1 treatment.
[0157] FIG. 45A shows RNAseq results at 24 hours to look for
differences between cells treated with a TKI (tyrosine kinase
inhibitor, e.g., erlotinib (E) or BGJ398 (B)), cells treated with
THZ1 (T), and cells treated with a combination of a TKI or THZ1
(e.g., a combination of erlotinib and THZ1 (ET) or a combination of
BGJ398 and THZ1 (BT)). This is a global overview of the data
showing only the upregulated genes and the downregulated genes with
the TKI, and the corresponding changes with the combination
treatment and the THZ1 treatment. Overall, what was seen includes
attenuation of the genes upregulated with erlotinib or BGJ398, with
the combination treatment. There are also important differences in
the genes that are downregulated for example MAPK repressors, such
as SPRY and SPRED, are downregulated with the TKI treatment but
much less so with the combination treatment. Similarly, cell cycle
genes that are downregulated with the TKI are much less affected by
the combination treatment.
[0158] FIGS. 45B and 45C show the drug tolerant state for PC9 cells
treated with erlotinib using RNAseq at 7 days of treatment (with 1
.mu.M erlotinib). FIG. 45B: the data are log 2 values for three
replicates for each condition. The data also show the log 2-fold
change between erlotinib vs. control (DMSO). It was found that, not
surprisingly, the drug tolerant cells were transcriptionally
distinct form the parental population. There were changes in STAT3
pathway members, for example, NFKBIZ and IGFBP5 were upregulated,
which is interesting given the work reported in Sharma et al.,
Cell, 2010, 141(1):69-80, which suggested that acute STAT3
activation in response to erlotinib was important to the
establishment of resitsance. FOSL1 is downregulated, which is
consistent with the findings from the Massague group on the
importance of FRA-1 downregulation in the tumor secretome and
establishment of resistance. See, e.g., Obenauf et al., Nature.
2015, 520, 368-72. There were a number of stress response proteins
that were highly upregulated, such as NUPR1. A number of repressors
of the MAPK pathway were down regulated for example DUSPS and
SPRYs. Multiple autophagy related genes were upregulated, as were
several TGF-beta pathway members, and a number of
stemness-associated factors. Lastly, a number of cell cycle genes
were downregulated, and some senescence-associated genes were
upregulated, which suggests that these tolerant cells are switching
to a senescent phenotype. This shows transcriptional regulators
that were either upregulated or downregulated in the data described
herein, and for which a large number of downstream genes were also
significantly activated or inhibited. FIG. 45C: the analysis was
done using INGENUITY. A number of stress response programs,
stemness regulators, and cell cycle regulators were seen to come up
on the list.
[0159] FIGS. 45D and 45E show the data for RT112 cells treated for
7 days with BGJ398 at 1 .mu.M. FIG. 45D: the drug tolerant cells
are transcriptionally distinct from the parental population. Some
important differences were upregulation of innate immunity genes,
in the interferon/NFKB family. This could be analogous to the STAT3
signature that was seen in the PC9 cells, with STAT2 and STAT5A
activation in this cell line instead. What was also seen includes a
number of autophagy genes being upregulated and stemness factors.
There were a number of WNT/hedgehog family members that were
upregulated in this cell line. What was also seen includes cell
cycle genes being downregulated, as well of the MAP kinase
repressors as seen in PC9 as well. As in the papers from the
Massague group, e.g., Obenauf et al., Nature. 2015, 520, 368-72,
FOSL1 downregulation was observed. What was also seen includes drug
metabolism genes being upregulated in the BGJ398-treated cells.
This shows various regulators in the data described herein that
were either upregulated with BGJ398 or downregulated and shows that
many of their downstream targets were also either activated or
inhibited. Multiple interferon family genes come up here, and in
the inhibited group a number of cell cycle regulators. FIG. 45E:
the analysis was done using INGENUITY.
[0160] FIG. 46 shows an exemplary JAK-STAT signaling pathway.
[0161] FIG. 47 shows the results of a ChipSeq assay (K27Ac). PC9
cells were treated for 7 days with erlotinib or THZ1. RT112 cells
were treated for 7 days with BGJ398 (BGJ) or THZ1. The data show
that SERPINB1, B2, B3, and B 10 were increased, while SPRY4/EVT4
was decreased, relative to the control (DMSO).
[0162] FIG. 48 shows the results of a ChipSeq assay. RT112 cells
were treated for 7 days with BGJ398 (BGJ), THZ1, or a combination
of BGJ398 and THZ1.
[0163] FIG. 49A shows the results of colony formation assays for
receptor tyrosine kinase-dependent cell lines, RT112 (FGFR), PC9
(EGFR), and H3122 (ALK) that were treated with DMSO, the
corresponding tyrosine kinase inhibitor (TKI: BGJ398 (BGJ),
erlotinib (Erlot), or crizotinib (Criz)), THZ1, or THZ1 in
combination with the corresponding TKI. Colony formation was
assayed by crystal violet staining at 4 weeks. Two representative
wells from a minimum of three biological replicates are shown per
condition. (RT 112: BGJ398 1 .mu.M, THZ1 100 nM, PC9: erlotinib 1
.mu.M, THZ1 100 nM, H3122: crizotinib 250 nM, THZ1 50 nM).
[0164] FIG. 49B shows a graph of the quantification of the colony
formation described in FIG. 49A as percentage of the control. Mean
(2 biological replicates)+/-standard deviation (SD) shown (*
p-value <0.05, ** <0.005, *** <0.0005, two-sided t-test).
ND=not detectable.
[0165] FIG. 49C shows the results of a cell death analysis of cells
treated as in FIG. 49A by flow cytometry with Annexin V/PI
staining, following 48 hours of treatment. Mean (3 biological
replicates)+/-SD shown (* p-value <0.05, ** <0.005, ***
<0.0005, two-sided t-test). Left panel: RT112, middle panel:
PC9, right panel: H3122.
[0166] FIG. 49D shows the results of colony formation assays for
KRAS-mutant cell lines, A549, H23, H1792 that were treated with
DMSO, trametinib (Tram), THZ1, or a combination of THZ1 and
trametinib. Colony formation was assayed by crystal violet staining
at 4 weeks. Two representative wells from a minimum of three
independent biological replicates are shown per condition. (A549:
trametinib 200 nM, THZ1 150 nM, H23: trametinib 500 nM, THZ1 100
nM, H1792: trametinib 500 nM, THZ1 500 nM).
[0167] FIG. 49E shows a graph of the quantification of the colony
formation described in FIG. 49D as a percentage of the control.
Mean (2 biological replicates)+/-SD shown (* p-value <0.05, **
<0.005, *** <0.0005, two-sided t-test). ND=not
detectable.
[0168] FIG. 49F shows the results of a cell death analysis of cells
treated as in FIG. 49D by flow cytometry with Annexin V/PI
staining, following 48 hours of treatment. Mean (3 biological
replicates)+/-SD shown (* p-value <0.05, ** <0.005, ***
<0.0005, two-sided t-test). Left panel: A549, middle panel: H23,
right panel: H1792.
[0169] FIG. 50A shows the results of xenograft studies on RT112 and
PC9 tumors that were treated with the indicated drugs for eight
weeks (n=5 mice in each treatment group, equivalent to 10 tumours
in each group). Survival over time is shown as a percentage for
each treatment group. P-values are based on log-rank (Mantel-Cox)
test analysis (* p-value <0.05, ** <0.005, ***
<0.0005).
[0170] FIG. 50B shows a schematic of a novel non-small cell lung
cancer genetically-engineered mouse model (GEMM) containing
lox-stop-lox (LSL) EGFR-T790M-L858R and LSL p53-R172H dominant
negative (DN) alleles (TLP mice). Mice were induced by intranasal
administration at 6 weeks of age with Adenovirus-Cre recombinase.
Upon determination of lung tumor growth by MRI, mice were
randomized into treatment groups and imaged biweekly until
end-stage disease to determine tumor response.
[0171] FIG. 50C shows a tumor volume index, normalized to
pre-treatment volume, for TLP mice treated with the indicated drugs
at 2 and 4 weeks (left panel). Mean (n=3 for vehicle, 2 for WZ4002,
2 for THZ1, 5 for WZ4002+THZ1)+/-standard error of the mean is
shown (* p-value <0.05, ** <0.005, *** <0.0005, two-sided
t-test)). Combination treated mice had long term tumor-regression
(right panel). Tumor volume index for combination-treated mice is
shown up to 14 weeks.
[0172] FIG. 50D shows representative MRI images for mice treated
with THZ1, WZ4002 or the combination of the two, pre-treatment and
at week 4, showing significant tumor regression with combination
treatment. Heart and tumor areas are drawn up and marked with
yellow and red lines respectively.
[0173] FIG. 50E shows survival curves for TLP mice treated with the
indicated drugs. P-value determined by log-rank (Mantel-Cox) test
analysis (* p-value <0.05, ** <0.005, *** <0.0005).
[0174] FIG. 51A shows heat maps of gene expression in
BGJ398-tolerant RT112 cells and erlotinib-tolerant PC9 cells
following 7 days of drug treatment (1 .mu.M) compared to control.
Heat maps display log 2-normalized fragments per kilobase of
transcript per million mapped reads (FPKM) (3 biological replicates
included per condition).
[0175] FIG. 51B shows the results of an immunoblot analysis in
RT112 and PC9 at 24 hours treated with BGJ398 or erlotinib (1
.mu.M), respectively, THZ1 (100 nM), or these in combination as
indicated.
[0176] FIG. 51C shows graphs of IL-6 levels. Left panel: IL-6
levels in PC9-derived cell culture supernatants with control,
erlotinib (Erlot), THZ1, or erlotinib+THZ1 (Erlot+THZ1), at the
doses used in FIG. 51B, at 24 and 72 hours as determined by ELISA.
Mean+/-SD from three biological replicates is shown. Right panel:
IL-6 levels in FRA1-deficient PC9 cells at 24 and 72 hours as
determined by ELISA. Mean+/-SD from three biological replicates is
shown.
[0177] FIG. 51D shows heat maps of gene expression in RT112 and PC9
following treatment with BGJ398 (BGJ) or erlotinib (Erlot) compared
to control (at day 1 and day 7). The third column compares gene
expression in cells treated with targeted therapy alone versus THZ1
in combination with targeted therapy (Combo) at day 7. Log
2-normalized fold-changes are shown (mean of 3 biological
replicates). The green-orange bar to the right of the heat map
indicates whether combination treatment repressed or enhanced the
effects of targeted therapy (green=repressed, orange=enhanced).
[0178] FIG. 51E shows a graph of select transcripts that were
differentially expressed between targeted therapy and combination
treatment with THZ1. Log 2-normalized fold-change is shown for
RT112 (top panel) and PC9 cells (bottom panel) treated with the
indicated drugs, relative to control-treated cells (mean of 3
biological replicates for each treatment group).
[0179] FIG. 51F shows the H3K27Ac ChIP-Seq signal in control and
targeted therapy-treated cells. Color-coded horizontal lines denote
the median enhancer signal in the distributions. Groups are
compared by two-tailed t-test. Top panel: BGJ398 induces a
significant increase in H3K27Ac signal at enhancers associated with
genes that correspondingly have increased expression upon BGJ398
treatment in RT112 cells. H3K27Ac signal is shown for the top 200
most up-regulated genes for DMSO and BGJ398-treated RT112 cells.
Bottom panel: Erlotinib induces a significant increase in H3K27Ac
signal at enhancers associated with genes that correspondingly have
increased expression upon erlotinib treatment in PC9 cells. H3K27Ac
signal is shown for the top 200 most up-regulated genes for DMSO
and erlotinib-treated PC9 cells.
[0180] FIG. 51G shows the RNA-Seq expression in control, targeted
therapy-treated, and combination therapy-treated cells. Genes whose
expression is induced by targeted therapy are significantly less
induced by targeted therapy in combination with THZ1. Color-coded
horizontal lines denote the median log 2-normalized FPKM values (3
biological replicates per treatment group). Top panel: Gene
expression of the top 200 up-regulated genes with BGJ398 treatment
in RT112 cells treated with DMSO, BGJ398, or combined THZ1+BGJ398
treatment is shown. Treatment with BGJ398 induces a significant
increase in gene expression (two tailed t-test,
p=4.13.times.10-46), but combined THZ1 and BGJ398 treatment
significantly reduces this increase (two-tailed t-test,
p=4.90.times.10-19). Bottom panel: Similarly, gene expression of
the top 200 up-regulated genes with erlotinib treatment in PC9
cells treated with DMSO, erlotinib, and combined THZ1+erlotinib
treatment. Treatment with erlotinib induces a significant increase
in gene expression (two-tailed t-test, p=4.81.times.10-70), but
combined THZ1 and erlotinib treatment significantly reduces this
increase (two-tailed t-test, p=8.58.times.10-6).
[0181] FIG. 51H shows H3K27Ac gene tracks in control and targeted
therapy-treated cells for TNFSF10 (RT112), SERPINB2 (PC9), and
NFKBIZ (PC9). Signal of ChIP-seq occupancy is in units of reads per
million (rpm). Solid bars indicate super-enhancers.
[0182] FIG. 52 shows the cell viability with Cell TiterGlo (96
hours) for the indicated oncogene-addicted cellular models used in
colony formation assays (FIGS. 49A, 49D, and 53A) with targeted
therapy, THZ1 or the combination of the two. Mean (3 biological
replicates)+/-SD shown. Dose response curves for combination
treatment were normalized to targeted therapy alone at the
indicated dose. IC50 values are shown in parentheses.
[0183] FIG. 53A shows the results of colony formation assays for
receptor tyrosine kinase-dependent cell lines, OE19 (HER2), H2077
(FGFR1), and H1975 (EGFR) were treated with DMSO, THZ1, the
corresponding TKI (lapatinib, BGJ398, or WZ4002), or a combination
of THZ1 with TKI. Colony formation was assayed by crystal violet
staining at 4 weeks. Two representative wells from a minimum of
three biological replicates are shown per condition. (OE19:
lapatinib 150 nM, THZ1 125 nM; H2077: BGJ398 1 .mu.M, THZ1 10 nM;
H1975: WZ4002 1 .mu.M, THZ1 500 nM).
[0184] FIG. 53B shows a graph of the quantification of colony
formation described in FIG. 53A shown as a percentage of the
control. Mean (2 biological replicates)+/-standard deviation (SD)
shown (* p-value <0.05, ** <0.005, *** <0.0005, two-sided
t-test). ND=not detectable.
[0185] FIG. 53C shows the results of a cell death analysis with
cells treated as in FIG. 53A by flow cytometry with Annexin
V/Plstaining, following 48 hours of treatment (H2077 shown at 24
hours, due to differences in response to drug time-course). Mean (3
biological replicates)+/-SD shown (* p-value <0.05, **
<0.005, *** <0.0005, two-tailed t-test). Left panel: OE19,
middle panel: H2077, right panel: H1975.
[0186] FIG. 53D shows the cell viability with Cell TiterGlo (96
hours), for drug tolerant populations that remain with dual kinase
inhibition targeting known resistance mechanisms in RT112 and PC9
(BGJ=BGJ398 (FGFR inhibitor), Erlot=erlotinib (EGFR inhibitor),
Tram=trametinib/GSK1120212 (MEK1/2 inhibitor), BKM=BKM120 (pan-PI3K
inhibitor), AZD=AZD8931 (pan-ERBB inhibitor), all at 1 .mu.M). Mean
(3 biological replicates)+/-SD shown.
[0187] FIG. 53E shows a graph of the quantification of colony
formation at 4 weeks with single or rational dual kinase inhibition
in RT112 and PC9. Mean (2 biological replicates)+/-SD shown.
[0188] FIG. 54A shows the relative CDK7 and CDK12 expression
(qRT-PCR) following knockdown with three different CDK7 or CDK12
single guide RNAs (sgRNA) and a dummy guide in PC9 cells. Mean (3
biological replicates)+/-SD shown. Corresponding immunoblot showing
decreased expression with CDK7 or CDK12 knockdown for the three
different sgRNAs compared to the dummy guide.
[0189] FIG. 54B shows the relative proliferation of PC9 cells
following knockdown of CDK7 or CDK12 for the sgRNAs in FIG. 54A
compared to the dummy guide. Mean (3 biological replicates)+/-SD
shown.
[0190] FIG. 54C shows the results of a cell death analysis by flow
cytometry with Annexin V/PI staining in CDK7 and CDK12-deficient
PC9 cells, following 48 hours of treatment with vehicle or
erlotinib (1 .mu.M). Mean (3 biological replicates)+/-SD shown (*
p-value <0.05, ** <0.005, *** <0.0005, two-tailed t-test,
red asterix=compared to CDK7 or CDK12 sgRNA untreated, black
asterix=compared to CDK7_12 dummy_Erlotinib).
[0191] FIG. 55A shows dose response curves for PC9 cells, assayed
by Cell TiterGlo (96 hours), for THZ1, palbociclib (CDK4/6
inhibitor) and JQ1 (BRD4 inhibitor). Mean (3 biological
replicates)+/-SD shown. IC50 values are shown in parentheses.
[0192] FIG. 55B shows the results of a colony formation assay in
PC9 cells, assayed at 4 weeks by crystal violet with compounds in
FIG. 55A. Mean (2 biological replicates)+/-standard deviation (SD)
shown. ND=not detectable.
[0193] FIG. 55C shows dose response curves for RT112 cells, assayed
by Cell TiterGlo (96 hours), with compounds as in FIG. 55A. Mean (3
biological replicates)+/-SD shown. IC50 values are shown in
brackets.
[0194] FIG. 55D shows the results of a colony formation assay in
RT112 cells, assayed at 4 weeks by crystal violet with compounds in
FIG. 55C. Mean (2 biological replicates)+/-standard deviation (SD)
shown. ND=not detectable.
[0195] FIG. 56A shows a tumor volume index normalized to
pre-treatment volume for mice bearing RT112 tumors treated with the
indicated drugs for 8 weeks (n=5 mice in each treatment group,
equivalent to 10 tumours in each group).
[0196] FIG. 56B shows a tumor volume index normalized to
pre-treatment volume for mice bearing PC9 tumors, treated with the
indicated drugs for 8 weeks (n=5 mice in each treatment group,
equivalent to 10 tumours in each group).
[0197] FIG. 56C shows survival curves for mice bearing H23 tumors
that were treated with the indicated drugs for 8 weeks (n=5 mice in
each treatment group, equivalent to 10 tumours in each group).
Survival over time is shown as a percentage for each treatment
group. P-value is based on log-rank (Mantel-Cox) test analysis.
[0198] FIG. 56D shows a tumor volume index for mice with H23 tumors
treated with the indicated drugs for weeks (n=5 mice in each
treatment group, equivalent to 10 tumours in each group).
[0199] FIG. 57A shows the results of gene ontology term (Go-term)
analysis of biological processes enriched based on gene expression
data following 7 days of treatment with BGJ398 (RT112 cells) or
erlotinib (PC9).
[0200] FIG. 57B shows the results of Ingenuity upstream regulator
analysis of gene expression profiles from RT112 and PC9 cells
treated with BGJ398 (RT112) or erlotinib (PC9) for 7 days.
[0201] FIG. 58A shows immunoblot analyses in A549 and H23 at 24
hours treated with trametinib (250 nM and 500 nM, respectively),
THZ1 (150 nM, and 100 nM, respectively), or these in combination as
indicated.
[0202] FIG. 58B shows a graph of IL-6 levels in PC9-derived cell
culture supernatants with control, erlotinib (1 .mu.M), THZ1 (100
nM), or erlotinib and THZ1 combined, at 24 and 72 hours as
determined by Luminex-based cytokine analysis. Mean (2 technical
replicates)+/-SD shown. (* p value <0.05, ** <0.005, ***
<0.0005, two-tailed t-test).
[0203] FIG. 58C shows an immunoblot analysis of total FRA1 protein
levels in parental PC9 cells and PC9 cells transduced with sgRNAs
targeting FRA1.
[0204] FIG. 58D shows a graph of the relative IL-6 expression
(qRT-PCR) in PC9 parental cells and FRA1-deficient PC9 cells with
sgRNA#1 and sgRNA#3. Mean (3 biological replicates)+/-SD shown.
[0205] FIG. 58E are immunoblot analyses showing signaling changes
in PC9 cells transduced with sgRNA#3 targeting FRA1, compared to
PC9 parental cells. Cells were treated with erlotinib (1 .mu.M),
THZ1 (100 nM), or erlotinib and THZ1 combined for 24 hours as
indicated.
[0206] FIG. 58F shows gene tracks of H3K27Ac ChIP-seq occupancy a t
the TLR5 gene locus in RT112 cells and FGF18 and IL-6 loci in PC9
following 7-day treatment with DMSO, BGJ398 (RT112) or erlotinib
(PC9). Signal of ChIP-seq occupancy is in units of reads per
million (rpm). Solid bars indicate super-enhancers.
[0207] FIG. 59A shows a tumor volume index after 2 and 4 weeks
normalized to pre-treatment volume for an EML4-ALK-mutant
genetically engineered mouse model in which the floxed EML4-ALK
fusion oncogene is induced in the lung by installation of Cre
recombinase by adenovirus. Cells were treated with either vehicle,
crizotinib, THZ1, or THZ1 and crizotinib.
[0208] FIG. 59B shows the progression free survival for the
ALK-mutant genetically engineered mouse model in FIG. 59A during
treatment with vehicle, crizotinib, THZ1, or THZ1 and
crizotinib.
[0209] FIG. 60 shows synergy among genetic depletion of CDK and
cyclin genes using CRISPR in combination with erlotinib. Genes
which show negative enrichment (e.g. CDK7, CDK9 and CDK12
demonstrate synergy with erlotinib).
[0210] FIG. 61 shows the results of colony formation assays PC9
cells treated with DMSO, THZ5-31-1, erlotinib, or a combination of
THZ5-31-1 and erlotinib, at the nM concentrations of THZ5-31-1
indicated.
[0211] FIG. 62 shows the results of colony formation assays at 4
weeks for receptor tyrosine kinase-dependent cell lines, OE19
(HER2), H2077 (FGFR1), H1975 (EGFR), HCC827 (EGFR), N87 (HER2),
EBC-1 (MET), and H1703 (PDGFR) that were treated with DMSO, the
corresponding tyrosine kinase inhibitor (lapatinib (Lapa), BGJ398
(BGJ), WZ4002 (WZ), erlotinib (Erlot), crizotinib (Criz), imatinib
(Imat)), THZ1, or THZ1 in combination with the corresponding TKI.
Two representative wells from a minimum of three biological
replicates are shown per condition.
[0212] FIG. 63A the results of colony formation assays at 4 weeks
for KRAS and BRAF-driven models, H2009 (KRAS), GSU (KRAS), A375
(BRAF), that were treated with DMSO, the corresponding kinase
inhibitor (trametinib (Tram) or vemurafenib (Vem)), THZ1, or THZ1
in combination with the corresponding kinase inhibitor. Two
representative wells from a minimum of three biological replicates
are shown per condition. GSU and A375 are semi-adherent cell lines
for which the effect is better depicted in FIG. 63B.
[0213] FIG. 63B shows graphs quantifying the colony formation
described in FIG. 63A as a percentage of the control at 4 weeks.
GSK=trametinib.
[0214] FIG. 64A the results of colony formation assays at 3 months
for oncogene-dependent models RT112 (FGFR), PC9 (EGFR), H3122
(ALK), and A549 (KRAS), treated with DMSO, the corresponding kinase
inhibitor (BGJ398 (BGJ), erlotinib (Erlot), crizotinib (Criz), or
trametinib (Tram)), THZ1, or THZ1 in combination with the
corresponding kinase inhibitor. Two representative wells from a
minimum of three biological replicates are shown per condition.
[0215] FIG. 64B shows a graph quantifying the colony formation
described in FIG. 64A as a percentage of the control at 3 months.
ND=not detectable.
[0216] FIG. 65A shows the results of colony formation assays at 4
weeks for oncogene-dependent models RT112 (FGFR), PC9 (EGFR), and
A549 (KRAS), treated with DMSO, a non-corresponding kinase
inhibitor (vemurafenib (Vem) or crizotinib (Criz)), THZ1, or THZ1
in combination with the non-corresponding kinase inhibitor. Two
representative wells from a minimum of three biological replicates
are shown per condition. The non-corresponding kinase inhibitors
for these assays were selected to not correspond with the cell line
mutation, as shown: a BRAF inhibitor (vemurafenib) does not show
effectiveness on an FGFR mutant cell line (RT112) or EGFR mutant
cell line (PC9), and an ALK inhibitor (crizotinib) is ineffective
against a KRAS mutant cell line (A549).
[0217] FIG. 65B shows a graph quantifying the colony formation
described in FIG. 65A as a percentage of the control at 4
weeks.
[0218] FIG. 66 shows the cell viability for PC9 (EGFR), A549
(KRAS), and A375 (BRAF) cells after pretreatment with either DMSO,
a corresponding kinase inhibitor (erlotinib, trametinib (GSK), or
vemurafenib), or a non-corresponding kinase inhibitor (imatinib,
crizotinib, or BGJ398), followed by treatment with THZ1.
[0219] FIG. 67 shows Western blot results for the RT112, PC9,
H3122, N87, H1703, EBC-1, A549, H23, GSU, H2009, and A375 cell
lines, after either no treatment, treatment with a kinase inhibitor
(labeled TKI or vemurafenib), treatment with THZ1, or treatment
with the kinase inhibitor and THZ1. Notably, p-ERK is suppressed
with the combination treatment of kinase inhibitor and THZ1.
[0220] FIG. 68 shows the results of colony formation assays for
HSC4 cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either
DMSO or transcription inhibitor THZ1 (IC25, IC50, or IC75).
[0221] FIG. 69 shows the results of colony formation assays for
HSC4 cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either
DMSO or transcription inhibitor THZ5-31-1 (IC25, IC50, or
IC75).
[0222] FIG. 70 shows the results of colony formation assays for
SNU1041 cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either
DMSO or transcription inhibitor THZ1 (IC25, IC50, or IC75).
[0223] FIG. 71 shows the results of colony formation assays for
SNU1041 cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either
DMSO or transcription inhibitor THZ5-31-1 (IC25, IC50, or
IC75).
[0224] FIG. 72 shows the results of colony formation assays for YD8
cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either DMSO or
transcription inhibitor THZ1 (IC25, IC50, or IC75).
[0225] FIG. 73 shows the results of colony formation assays for YD8
cells treated with radiation (0 Gy, 3 Gy, 6 Gy) and either DMSO or
transcription inhibitor THZ5-31-1 (IC25, IC50, or IC75).
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0226] The present disclosure provides combination therapy of
transcription inhibitors and kinase inhibitors. It has been found
that a combination of a transcription inhibitor and a kinase
inhibitor may be useful in treating and/or preventing in a subject
in need thereof proliferative diseases, such as proliferative
diseases that are resistant to the transcription inhibitor alone or
kinase inhibitor alone. The combination of a transcription
inhibitor and a kinase inhibitor is expected to be synergistic.
Pharmaceutical Compositions, Kits, and Administration
[0227] One aspect of the present disclosure relates to
pharmaceutical compositions that comprise a transcription inhibitor
and a kinase inhibitor, and optionally a pharmaceutically
acceptable excipient, wherein the transcription inhibitor and the
kinase inhibitor are not the same. The pharmaceutical compositions
described herein may be useful in treating and/or preventing in a
subject in need thereof proliferative diseases, such as
proliferative diseases that are resistant to or are at risk of
becoming resistant to a transcription inhibitor or a kinase
inhibitor. The pharmaceutical compositions described herein may
also be useful in reducing, delaying, and/or preventing in a
subject in need thereof the resistance of a proliferative disease
to treatment with a transcription inhibitor or kinase inhibitor.
The pharmaceutical compositions described herein may further be
useful in inhibiting the proliferation of a cell, and/or reducing,
delaying, and/or preventing the resistance of a cell to a
transcription inhibitor or kinase inhibitor. The pharmaceutical
compositions described herein are expected to be synergistic in
treating and/or preventing in the subject the proliferative
diseases, in reducing, delaying, and/or preventing in the subject
the resistance of proliferative diseases to a transcription
inhibitor or kinase inhibitor, in inhibiting the proliferation of
the cell, and/or reducing, delaying, and/or preventing the
resistance of the cell to a transcription inhibitor or kinase
inhibitor, compared to the transcription inhibitor or the kinase
inhibitor alone. In certain embodiments, the kinase inhibitor
included in a pharmaceutical composition is the same as the kinase
inhibitor to which a proliferative disease or cell shows
resistance.
[0228] A pharmaceutical composition described herein comprises a
transcription inhibitor. In certain embodiments, the transcription
inhibitor is a cyclin-dependent kinase (CDK) inhibitor (e.g., CDK1,
CDK2, CDK3, CDK4, CDK5, CDK6, CDK7, CDK8, CDK9, CDK10, CDK11, or
CDK12 inhibitor). In certain embodiments, the transcription
inhibitor is a bromodomain-containing protein inhibitor (e.g.,
bromodomain-containing protein 2 (BRD2) inhibitor,
bromodomain-containing protein 3 (BRD3) inhibitor,
bromodomain-containing protein 4 (BRD4) inhibitor, TBP (TATA box
binding protein)-associated factor protein (TAF) inhibitor,
CREB-binding protein (CBP) inhibitor, or E1A binding protein p300
(EP300) inhibitor).
[0229] In certain embodiments, the transcription inhibitor is of
Formula (I):
##STR00014##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0230] Ring A is an optionally substituted heteroaryl ring of any
one of the Formulae (i-1)-(i-5):
##STR00015##
[0231] each instance of V.sup.1, V.sup.2, V.sup.3, V.sup.4,
V.sup.5, V.sup.6, V.sup.7, V.sup.8, V.sup.9, V.sup.10, V.sup.11,
V.sup.12, V.sup.13, and V.sup.14 is independently O, S, N,
NR.sup.A1, C, or CR.sup.A2;
[0232] each instance of R.sup.A1 is independently selected from the
group consisting of hydrogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, and a nitrogen protecting
group;
[0233] each instance of R.sup.A2 is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.A2a,
--N(R.sup.A2a).sub.2, and --SR.sup.A2a, wherein each occurrence of
R.sup.A2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.A2a groups are joined to form an optionally
substituted heterocyclic ring;
[0234] optionally any about two of R.sup.A1, R.sup.A2, and
R.sup.A2a groups are joined to form an optionally substituted
carbocyclic, optionally substituted heterocyclic, optionally
substituted aryl, or optionally substituted heteroaryl ring;
[0235] Ring B is of the formula:
##STR00016##
[0236] R.sup.B1 is selected from the group consisting of hydrogen,
halogen, optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --OR.sup.B1a, --N(R.sup.B1a).sub.2, and --SR.sup.B1a,
wherein each occurrence of R.sup.B1a is independently selected from
the group consisting of hydrogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, a nitrogen protecting group when
attached to a nitrogen atom, an oxygen protecting group when
attached to an oxygen atom, and a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B1a groups are joined
to form an optionally substituted heterocyclic ring;
[0237] W.sub.B is N or CR.sup.B2, wherein R.sup.B2 is selected from
the group consisting of hydrogen, halogen, optionally substituted
acyl, optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.B2a,
--N(R.sup.B2a).sub.2, and --SR.sup.B2a, wherein each occurrence of
R.sup.B2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.B2a groups are joined to form an optionally
substituted heterocyclic ring;
[0238] optionally R.sup.B1 and R.sup.B2 are joined to form an
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted heteroaryl, or optionally
substituted aryl ring;
[0239] X is an optionally substituted C.sub.1-4 hydrocarbon chain,
optionally wherein one or more carbon units of the hydrocarbon
chain is replaced with --O--, --S--, or --NR.sup.X--, wherein
R.sup.X is hydrogen, C.sub.1-6 alkyl, or a nitrogen protecting
group;
[0240] L.sup.2 is a bond, --O--, --S--, --NR.sup.L2a--,
--NR.sup.L2aC(.dbd.O)--, --C(.dbd.O)NR.sup.L2a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L2aC(.dbd.S)--, --C(.dbd.S)NR.sup.L2a--,
trans-CR.sup.L2b.dbd.CR.sup.L2b--, cis-CR.sup.L2b.dbd.CR.sup.L2b--,
--C.ident.C--, --OC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2O--,
--NR.sup.L2aC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2NR.sup.L2a
SC(R.sup.L2b).sub.2--, --C(R.sup.L2b).sub.2S--,
--S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L2a--, --NR.sup.L2aS(.dbd.O).sub.2--, or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the hydrocarbon chain is
replaced with --O--, --S--, --NR.sup.L2a--,
--NR.sup.L2aC(.dbd.O)--, --C(.dbd.O)NR.sup.L2a, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.LaC(.dbd.S)--, --C(.dbd.S)NR.sup.L2a--,
trans-CR.sup.L2b.dbd.CR.sup.L2b--, cis-CR.sup.L2b.dbd.CR.sup.L2b--,
--C.ident.C--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L2a--, or --NR.sup.L2aS(.dbd.O).sub.2--,
wherein R.sup.L2a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L2b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or about
two R.sup.L2b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring;
[0241] each instance of R.sup.C is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.C1,
--N(R.sup.C1).sub.2, and --SR.sup.C1, wherein each occurrence of
R.sup.C1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.C1 groups are joined to form an optionally
substituted heterocyclic ring;
[0242] n is 0, 1, 2, 3, or 4;
[0243] each instance of R.sup.D is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.D1,
--N(R.sup.D1).sub.2, and --SR.sup.D1, wherein each occurrence of
R.sup.D1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.D1 groups are joined to form an optionally
substituted heterocyclic ring;
[0244] p is 0, 1, 2, 3, or 4;
[0245] R.sup.E is any one of the Formulae (ii-1)-(ii-17):
##STR00017## ##STR00018## ##STR00019##
[0246] R.sup.E and L.sup.2 are para or meta to each other;
[0247] L.sup.3 is a bond, --O--, --S--, --NR.sup.L3a--, or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the hydrocarbon chain is
replaced with --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L3b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or about
two R.sup.L3b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring;
[0248] L.sup.4 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain;
[0249] R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E1a, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.E1a, --OR.sup.E1a, --N(R.sup.E1a).sub.2, and
--SR.sup.E1a, wherein each occurrence of R.sup.E1a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E1a groups
are joined to form an optionally substituted heterocyclic ring;
[0250] R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E2a groups
are joined to form an optionally substituted heterocyclic ring;
[0251] R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl,
--CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E3a groups
are joined to form an optionally substituted heterocyclic ring;
[0252] optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3,
or R.sup.E1 and R.sup.E2 are joined to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring;
[0253] R.sup.E4 is a leaving group;
[0254] Y is O, S, or NR.sup.E5, wherein R.sup.E5 is hydrogen,
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0255] a is 1 or 2; and
[0256] z is 0, 1, 2, 3, 4, 5, or 6.
[0257] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00020##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0258] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00021## ##STR00022## ##STR00023## ##STR00024## ##STR00025##
##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030##
##STR00031## ##STR00032## ##STR00033##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0259] In certain embodiments, the transcription inhibitor is of
Formula (II):
##STR00034##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0260] G is group of atoms ranging a total length between 20 to 30
.ANG.;
[0261] R.sup.E is an electrophile with any one of the Formulae
(ii-1)-(ii-17):
##STR00035## ##STR00036##
[0262] L.sup.3 is a bond, --O--, --S--, --NR.sup.L3a--, or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the hydrocarbon chain is
replaced with --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, C.sub.1-6 alkyl, or a nitrogen
protecting group, and wherein each occurrence of R.sup.L3b is
independently selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or about
two R.sup.L3b groups are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring;
[0263] L.sup.4 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain;
[0264] R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E1a, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.E1a, --OR.sup.E1a, --N(R.sup.E1a).sub.2, and
--SR.sup.E1a, wherein each occurrence of R.sup.E1a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E1a groups
are joined to form an optionally substituted heterocyclic ring;
[0265] R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E2a groups
are joined to form an optionally substituted heterocyclic ring;
[0266] R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.3a, --OR.sup.3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E3a groups
are joined to form an optionally substituted heterocyclic ring;
[0267] optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3,
or R.sup.E1 and R.sup.E2 are joined to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring;
[0268] R.sup.E4 is a leaving group;
[0269] Y is O, S, or NR.sup.E5, wherein R.sup.E5 is hydrogen,
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0270] a is 1 or 2; and
[0271] z is 0, 1 or 2;
[0272] L.sup.1e is a linker ranging between 0 to 3 atoms in
length;
[0273] L.sup.x is a linker ranging between 0 to 5 atoms in
length;
[0274] optionally, the IC.sub.50 for CDK7 is less than
approximately 100 nM; and
[0275] optionally, the CDK inhibitor is selective for CDK7.
[0276] In certain embodiments, the transcription inhibitor is of
Formula (III):
##STR00037##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0277] Ring A is an optionally substituted heteroaryl ring of any
one of the Formulae (i-1)-(i-6):
##STR00038##
[0278] wherein: [0279] each instance of V.sup.1, V.sup.2, V.sup.3,
V.sup.4, V.sup.5, V.sup.6, V.sup.7, V.sup.8, V.sup.9, V.sup.10,
V.sup.11, V.sup.12, V.sup.13, V.sup.14, and V.sup.15 is
independently O, S, N, NR.sup.A1, C, or CR.sup.A2; [0280] each
instance of R.sup.A1 is independently selected from the group
consisting of hydrogen, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, optionally
substituted heteroaryl, and a nitrogen protecting group; [0281]
each instance of R.sup.A2 is independently selected from the group
consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.A2a,
--N(R.sup.A2a).sub.2, and --SR.sup.A2a, wherein each occurrence of
R.sup.A2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.A2a groups are joined to form an optionally
substituted heterocyclic ring; and [0282] optionally any about two
of R.sup.A1, R.sup.A2, and R.sup.A2a groups are joined to form an
optionally substituted carbocyclic, optionally substituted
heterocyclic, optionally substituted aryl, or optionally
substituted heteroaryl ring;
[0283] R.sup.B1 is selected from the group consisting of hydrogen,
halogen, optionally substituted acyl, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, and --SR.sup.B1a, wherein each occurrence of
R.sup.B1a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
R.sup.B1 and R.sup.B2 are joined to form an optionally substituted
carbocyclic, optionally substituted heterocyclic, optionally
substituted aryl, or optionally substituted heteroaryl ring;
[0284] W.sub.B is N or CR.sup.B2, wherein R.sup.B2 is selected from
the group consisting of hydrogen, halogen, optionally substituted
acyl, optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B2a,
--N(R.sup.B2a).sub.2, and --SR.sup.B2a, or R.sup.B2 and R.sup.B1
are joined to form an optionally substituted carbocyclic,
optionally substituted heterocyclic, optionally substituted aryl,
or optionally substituted heteroaryl ring, wherein each occurrence
of R.sup.B2a is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.B2a groups are joined to form an optionally
substituted heterocyclic ring;
[0285] L.sup.1 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain, optionally wherein one or more carbon units of
the optionally substituted C.sub.1-4 hydrocarbon chain are
independently replaced with --O--, --S--, --NR--, --S(.dbd.O)--, or
--S(.dbd.O).sub.2--, wherein R.sup.L1 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group, and
optionally wherein about two substituents on the optionally
substituted C.sub.1-4 hydrocarbon chain are taken together to form
an optionally substituted carbocyclic or optionally substituted
heterocyclic ring;
[0286] L.sup.2 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain, optionally wherein one or more carbon units of
the optionally substituted C.sub.1-4 hydrocarbon chain are
independently replaced with --O--, --S--, --NR.sup.L2--,
--S(.dbd.O)--, or --S(.dbd.O).sub.2--, wherein R.sup.L2 is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group, and optionally wherein about two
substituents on the optionally substituted C.sub.1-4 hydrocarbon
chain are taken together to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring;
[0287] each instance of R.sup.C is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, .dbd.O, --CN, --OR.sup.C1,
--N(R.sup.C1).sub.2, and --SR.sup.C1; or about two R.sup.C groups
are taken together to form an optionally substituted, carbocyclic,
heterocyclic, aryl, or heteroaryl ring, wherein about two
substituents on the substituted heterocyclic ring or substituted
carbocyclic ring, or one substituent on the substituted
heterocyclic ring or substituted carbocyclic ring and a third
R.sup.c group, are taken together to form another optionally
substituted heterocyclic ring or optionally substituted carbocyclic
ring; wherein each occurrence of R.sup.C1 is independently selected
from the group consisting of hydrogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, a nitrogen protecting group when
attached to a nitrogen atom, an oxygen protecting group when
attached to an oxygen atom, and a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.C1 groups are joined
to form an optionally substituted heterocyclic ring;
[0288] n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0289] each instance of R.sup.D is independently selected from the
group consisting of hydrogen, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.D1,
--N(R.sup.D1).sub.2, and --SR.sup.D1, wherein each occurrence of
R.sup.D1 is independently selected from the group consisting of
hydrogen, optionally substituted acyl, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, a nitrogen protecting group when attached to a nitrogen
atom, an oxygen protecting group when attached to an oxygen atom,
and a sulfur protecting group when attached to a sulfur atom, or
about two R.sup.D1 groups are joined to form an optionally
substituted heterocyclic ring;
[0290] p is 0, 1,2,3, or 4;
[0291] R.sup.E is of any one of the Formulae (ii-1)-(ii-20):
##STR00039## ##STR00040## ##STR00041##
[0292] L.sup.3 is a bond, --O--, --S--, --NR.sup.L3a--, or an
optionally substituted C.sub.1-4 hydrocarbon chain, optionally
wherein one or more carbon units of the hydrocarbon chain are
independently replaced with --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently selected from the group
consisting of hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, and optionally
substituted heteroaryl, or about two R.sup.L3b groups are joined to
form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring;
[0293] L.sup.4 is a bond or an optionally substituted C.sub.1-4
hydrocarbon chain;
[0294] R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.Ela, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.Ela, --OR.sup.Ela, --N(R.sup.E1a).sub.2,
--Si(R.sup.E1a).sub.3, and --SR.sup.E1a, wherein each occurrence of
R.sup.Ela is independently selected from the group consisting of
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or about
two R.sup.E1a groups are joined to form an optionally substituted
heterocyclic ring;
[0295] R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E2a groups
are joined to form an optionally substituted heterocyclic ring;
[0296] R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E3a groups
are joined to form an optionally substituted heterocyclic ring;
[0297] optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3,
or R.sup.E1 and R.sup.E2 are joined to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring;
[0298] R.sup.E4 is a leaving group;
[0299] R.sup.E5 is halogen;
[0300] Y is O, S, or NR.sup.E6, wherein R.sup.E6 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0301] a is 1 or 2; and
[0302] z is 0, 1, 2, 3, 4, 5, or 6.
[0303] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00042## ##STR00043##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0304] In certain embodiments, the transcription inhibitor is of
Formula (IV):
##STR00044##
or a pharmaceutically acceptable salt, solvate, hydrate, tautomer,
or stereoisomer thereof, wherein:
[0305] Ring A is an optionally substituted heteroaryl ring of any
one of the Formulae (i-1)-(i-6):
##STR00045##
[0306] (i-6), wherein:
[0307] each instance of V.sup.1, V.sup.2, V.sup.3, V.sup.4,
V.sup.5, V.sup.6, V.sup.7, V.sup.8, V.sup.9, V.sup.10, V.sup.11,
V.sup.12, V.sup.13, V.sup.14 and V.sup.15 is independently O, S, N,
N(R.sup.A1), C, or C(R.sup.A2);
[0308] each instance of R.sup.A1 is independently selected from
hydrogen, deuterium, optionally substituted acyl, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl;
[0309] each instance of R.sup.A2 is independently selected from
hydrogen, deuterium, halogen, --CN, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.A2a,
--N(R.sup.A2a).sub.2, and --SR.sup.A2a, wherein each occurrence of
R.sup.A2a is independently selected from hydrogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, and optionally substituted heteroaryl,
or
[0310] any about two R.sup.A1, any about two R.sup.A2, or one
R.sup.A1 and one R.sup.A2 are joined to form an optionally
substituted carbocyclic, optionally substituted heterocyclic,
optionally substituted aryl, or optionally substituted heteroaryl
ring;
[0311] each X is independently selected from N and CH, wherein at
least one X is N;
[0312] W is selected from N and C(R.sup.1a);
[0313] each of R.sup.1a, if present, and R.sup.1b is independently
selected from hydrogen, deuterium, halogen, optionally substituted
acyl, optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --CN, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, and --SR.sup.B1a, wherein each occurrence of
R.sup.B1a is independently selected from hydrogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, and optionally substituted heteroaryl,
or
[0314] R.sup.1a and R.sup.1b are joined to form an optionally
substituted carbocyclic, optionally substituted heterocyclic,
optionally substituted aryl, or optionally substituted heteroaryl
ring;
[0315] R.sup.2 is an optionally substituted C.sub.1-C.sub.4
alkylene or an optionally substituted C.sub.2-C.sub.4 alkenylene or
alkynylene, wherein one or more methylene units of the alkylene,
alkenylene or alkynylene are optionally and independently replaced
with --O--, --S--, or --N(R.sup.6)--;
[0316] each instance of R.sup.3, if present, is independently
selected from deuterium, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.C1,
--N(R.sup.C1).sub.2, and --SR.sup.C1, wherein each occurrence of
R.sup.C1 is independently selected from hydrogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, and optionally substituted heteroaryl,
or
[0317] about two R.sup.3 groups bound to the same ring carbon atom
are taken together to form .dbd.O, or
[0318] about two R.sup.3 groups bound to the same or different ring
carbon atoms are joined to form an optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, or optionally substituted heteroaryl ring;
[0319] R.sup.4 is selected from a bond, an optionally substituted
C.sub.1-C.sub.4 alkylene, and an optionally substituted
C.sub.2-C.sub.4 alkenylene or alkynylene, wherein: [0320] one or
more methylene units of the alkylene, alkenylene or alkynylene
other than a methylene unit bound to a nitrogen atom is optionally
and independently replaced with --O--, --S--, --N(R.sup.6)--, or
--S(.dbd.O).sub.2--, and [0321] about two substituents on either
the same or adjacent carbon atoms in the alkylene, alkenylene or
alkynylene are taken together to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring;
[0322] each R.sup.6 is independently selected from hydrogen, and
--C.sub.1-C.sub.6 alkyl;
[0323] R.sup.7 is any one of the Formulae (ii-1)-(ii-20):
##STR00046## ##STR00047## ##STR00048##
[0324] wherein:
[0325] L.sup.3 is a bond, an optionally substituted C.sub.1-C.sub.4
alkylene, or an optionally substituted C.sub.2-C.sub.4 alkenylene
or alkynylene, wherein one or more methylene units of the alkylene,
alkenylene or alkynylene are optionally and independently replaced
with --O--, --S--, or --N(R.sup.6)--;
[0326] L.sup.4 is a bond, an optionally substituted C.sub.1-C.sub.4
alkylene, or an optionally substituted C.sub.2-C.sub.4 alkenylene
or alkynylene;
[0327] R.sup.E1 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.Ela, --CH.sub.2N(R.sup.E1a).sub.2,
--CH.sub.2SR.sup.Ela, --OR.sup.Ela, --N(R.sup.E1a).sub.2,
--Si(R.sup.E1a).sub.3, and --SR.sup.E1a, wherein each occurrence of
R.sup.E1a is independently selected from the group consisting of
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, and optionally substituted heteroaryl, or about
two R.sup.E1a groups are joined to form an optionally substituted
heterocyclic ring;
[0328] R.sup.E2 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E2a, --CH.sub.2N(R.sup.E2a).sub.2,
--CH.sub.2SR.sup.E2a, --OR.sup.E2a, --N(R.sup.E2a).sub.2, and
--SR.sup.E2a, wherein each occurrence of R.sup.E2a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E2a groups
are joined to form an optionally substituted heterocyclic ring;
[0329] R.sup.E3 is selected from the group consisting of hydrogen,
halogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, --CN,
--CH.sub.2OR.sup.E3a, --CH.sub.2N(R.sup.E3a).sub.2,
--CH.sub.2SR.sup.E3a, --OR.sup.E3a, --N(R.sup.E3a).sub.2, and
--SR.sup.E3a, wherein each occurrence of R.sup.E3a is independently
selected from the group consisting of hydrogen, optionally
substituted alkyl, optionally substituted alkenyl, optionally
substituted alkynyl, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, and
optionally substituted heteroaryl, or about two R.sup.E3a groups
are joined to form an optionally substituted heterocyclic ring;
[0330] optionally R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3,
or R.sup.E1 and R.sup.E2 are joined to form an optionally
substituted carbocyclic or optionally substituted heterocyclic
ring;
[0331] R.sup.E4 is a leaving group;
[0332] R.sup.E5 is halogen;
[0333] Y is O, S, or NR.sup.E6, wherein R.sup.E6 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0334] a is 1 or 2;
[0335] z is 0, 1, 2, 3, 4, 5, or 6;
[0336] each instance of R.sup.8, if present, is independently
selected from deuterium, halogen, optionally substituted acyl,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, --OR.sup.D1,
--N(R.sup.D1).sub.2, and --SR.sup.D1, wherein each occurrence of
R.sup.D1 is independently selected from hydrogen, optionally
substituted acyl, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted carbocyclyl, optionally substituted heterocyclyl, and
optionally substituted aryl, optionally substituted heteroaryl,
or
[0337] about two R.sup.8 groups are joined to form an optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, or optionally substituted heteroaryl
ring;
[0338] m is 0, 1, 2, 3 or 4; and
[0339] n is 0, 1, 2, 3, 4, 5 or 6.
[0340] In certain embodiments, the transcription inhibitor is of
formula:
##STR00049##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0341] In certain embodiments, the transcription inhibitor is of
formula:
##STR00050##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0342] In certain embodiments, the transcription inhibitor is of
Formula (V):
##STR00051##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0343] R.sup.1 is --NR.sup.aR.sup.b, --CHR.sup.aR.sup.b or
--OR.sup.a, wherein each of R.sup.a and R.sup.b is independently
hydrogen, optionally substituted alkyl, optionally substituted
alkenyl, optionally substituted alkynyl, optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, optionally substituted heteroaryl, a nitrogen
protecting group when attached to a nitrogen atom, or an oxygen
protecting group when attached to an oxygen atom, or R.sup.a and
R.sup.b are joined to form an optionally substituted carbocyclic,
optionally substituted heterocyclic, optionally substituted aryl,
or optionally substituted heteroaryl ring;
[0344] each of R.sup.3 and R.sup.4 is independently hydrogen,
halogen, or optionally substituted C.sub.1-C.sub.6 alkyl, or
R.sup.3 and R.sup.4 are joined to form an optionally substituted
C.sub.3-C.sub.6 carbocyclyl ring;
[0345] R.sup.5 is hydrogen, optionally substituted C.sub.1-C.sub.6
alkyl, or a nitrogen protecting group;
[0346] L.sup.1 is --NR.sup.L1, --NR.sup.L1C(.dbd.O)--,
--C(.dbd.O)NR.sup.L1--, --O--, or --S--, wherein R.sup.L1 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protecting group;
[0347] Ring A is optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl;
[0348] L.sup.2 is a bond, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.L2C(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group;
[0349] Ring B is absent, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl; and
[0350] R.sup.2 is any of Formulae (i-1)-(i-46):
##STR00052## ##STR00053## ##STR00054## ##STR00055## ##STR00056##
##STR00057##
[0351] wherein: [0352] L.sup.3 is a bond or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain are independently
replaced with --C.dbd.O--, --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or about two R.sup.L3b groups
are joined to form an optionally substituted carbocyclic or
optionally substituted heterocyclic ring; [0353] L.sup.4 is a bond
or an optionally substituted, branched or unbranched C.sub.1-6
hydrocarbon chain; [0354] each of R.sup.E1, R.sup.E2, and R.sup.E3
is independently hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --CN, --CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or about two R.sup.EE groups
are joined to form an optionally substituted heterocyclic ring;
[0355] or R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or
R.sup.E1 and R.sup.E2 are joined to form an optionally substituted
carbocyclic or optionally substituted heterocyclic ring; [0356]
R.sup.E4 is a leaving group; [0357] R.sup.E5 is halogen; [0358]
R.sup.E6 is hydrogen, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group; [0359] each instance of Y is
independently O, S, or NR.sup.E7, wherein R.sup.E7 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; [0360] a is 1 or 2; and [0361] each instance of z
is independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
[0362] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00058##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0363] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00059## ##STR00060## ##STR00061## ##STR00062## ##STR00063##
##STR00064## ##STR00065## ##STR00066## ##STR00067##
##STR00068##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0364] In certain embodiments, the transcription inhibitor is of
Formula (VI):
##STR00069##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein: [0365] R.sup.1 is
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted aryl, optionally substituted heterocyclyl,
optionally substituted heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b,
--SR.sup.b, --C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
[0366] R.sup.3 is hydrogen, halogen, or optionally substituted
C.sub.1-C.sub.6 alkyl; [0367] R.sup.5 is hydrogen, optionally
substituted C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group;
[0368] L.sup.1 is a bond, --NR.sup.L1--(CH.sub.2).sub.t--, --O--,
or --S--; [0369] R.sup.L1 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group; [0370] t is
0 or an integer between 1 and 5, inclusive; [0371] Ring A is
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl; [0372] L.sup.2 is a bond, optionally
substituted C.sub.1-4 alkylene, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.LC(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group; [0373] Ring
B is absent, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; and [0374] R.sup.2 is any of
Formulae (i-1)-(i-46):
##STR00070## ##STR00071## ##STR00072## ##STR00073## ##STR00074##
##STR00075##
[0374] wherein: [0375] L.sup.3 is a bond or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain are independently
replaced with --C.dbd.O--, --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; [0376] L.sup.4 is a bond or an
optionally substituted, branched or unbranched C.sub.1-6
hydrocarbon chain; [0377] each of R.sup.E1, R.sup.E2, and R.sup.E3
is independently hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --CN, --CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.EE groups are
joined to form an optionally substituted heterocyclic ring; [0378]
or R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and
R.sup.E2 are joined to form an optionally substituted carbocyclic
or optionally substituted heterocyclic ring; [0379] R.sup.E4 is a
leaving group; [0380] R.sup.E5 is halogen; [0381] R.sup.E6 is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; [0382] each instance of Y is
independently O, S, or NR.sup.E7, wherein R.sup.E7 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; [0383] a is 1 or 2; and [0384] each instance of z
is independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
[0385] In certain embodiments, the transcription inhibitor of
Formula (VI) is not of the formula:
##STR00076##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0386] In certain embodiments, the transcription inhibitor of
Formula (VI) is of the formula:
##STR00077##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0387] In certain embodiments, the transcription inhibitor is of
Formula (VII):
##STR00078##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein: [0388] R.sup.1 is
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted aryl, optionally substituted heterocyclyl,
optionally substituted heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b,
--SR.sup.b, --C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
[0389] each of R.sup.3 and R.sup.4 is independently hydrogen,
halogen, or optionally substituted C.sub.1-C.sub.6 alkyl; [0390]
L.sup.1 is a bond, --NR.sup.L1--(CH.sub.2).sub.t--, --O--, or
--S--; [0391] R.sup.L1 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protecting group; [0392] t is
0 or an integer between 1 and 5, inclusive; [0393] Ring A is
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, or optionally
substituted heteroaryl; [0394] L.sup.2 is a bond, optionally
substituted C.sub.1-4 alkylene, --C(.dbd.O)--, --NR.sup.L2--,
--C(.dbd.O)NR.sup.L2--, --NR.sup.L2C(.dbd.O)--, --O--, or --S--,
wherein R.sup.L2 is hydrogen, optionally substituted
C.sub.1-C.sub.6 alkyl, or a nitrogen protection group; [0395] Ring
B is absent, optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl; and [0396] R.sup.2 is any of
Formulae (i-1)-(i-46):
##STR00079## ##STR00080## ##STR00081## ##STR00082## ##STR00083##
##STR00084##
[0396] wherein: [0397] L.sup.3 is a bond or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain are independently
replaced with --C.dbd.O--, --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; [0398] L.sup.4 is a bond or an
optionally substituted, branched or unbranched C.sub.1-6
hydrocarbon chain; [0399] each of R.sup.E1, R.sup.E2, and R.sup.E3
is independently hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --CN, --CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.EE groups are
joined to form an optionally substituted heterocyclic ring; [0400]
or R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and
R.sup.E2 are joined to form an optionally substituted carbocyclic
or optionally substituted heterocyclic ring; [0401] R.sup.E4 is a
leaving group; [0402] R.sup.E5 is halogen; [0403] R.sup.E6 is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; [0404] each instance of Y is
independently O, S, or NR.sup.E7, wherein R.sup.E7 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; [0405] a is 1 or 2; and each instance of z is
independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
[0406] In certain embodiments, the transcription inhibitor is of
Formula (VIII):
##STR00085##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein: [0407] R.sup.1 is
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted aryl, optionally substituted heterocyclyl,
optionally substituted heteroaryl, --NR.sup.aR.sup.b, --OR.sup.b,
--SR.sup.b, --C(.dbd.O)R.sup.b, --C(.dbd.O)OR.sup.b, or
--C(.dbd.O)NR.sup.aR.sup.b, wherein each instance of R.sup.a and
R.sup.b is independently hydrogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted aryl,
optionally substituted heterocyclyl, optionally substituted aryl,
optionally substituted heteroaryl, or a nitrogen protecting group
when attached to nitrogen, or an oxygen protecting group when
attached to oxygen, or a sulfur protecting group when attached to
sulfur; or R.sup.a and R.sup.b are joined to form an optionally
substituted heterocyclic or optionally substituted heteroaryl ring;
[0408] each of R.sup.3 and R.sup.4 is independently hydrogen,
halogen, or optionally substituted C.sub.1-C.sub.6 alkyl; [0409]
R.sup.5 is hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl,
or a nitrogen protecting group; [0410] L.sup.1 is a bond,
--NR.sup.L1--(CH.sub.2).sub.t--, --O--, or --S--; [0411] R.sup.L1
is hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protecting group; [0412] t is 0 or an integer between 1
and 5, inclusive; [0413] Ring A is optionally substituted
carbocyclyl, optionally substituted heterocyclyl, optionally
substituted aryl, or optionally substituted heteroaryl; [0414]
L.sup.2 is a bond, optionally substituted C.sub.1-4 alkylene,
--C(.dbd.O)--, --NR.sup.L2--, --C(.dbd.O)NR.sup.L2--,
--NR.sup.L2C(.dbd.O)--, --O--, or --S--, wherein R.sup.L2 is
hydrogen, optionally substituted C.sub.1-C.sub.6 alkyl, or a
nitrogen protection group; [0415] Ring B is absent, optionally
substituted carbocyclyl, optionally substituted heterocyclyl,
optionally substituted aryl, or optionally substituted heteroaryl;
and [0416] R.sup.2 is any of Formulae (i-1)-(i-46):
##STR00086## ##STR00087## ##STR00088## ##STR00089## ##STR00090##
##STR00091##
[0416] wherein: [0417] L.sup.3 is a bond or an optionally
substituted C.sub.1-4 hydrocarbon chain, optionally wherein one or
more carbon units of the hydrocarbon chain are independently
replaced with --C.dbd.O--, --O--, --S--, --NR.sup.L3a--,
--NR.sup.L3aC(.dbd.O)--, --C(.dbd.O)NR.sup.L3a--, --SC(.dbd.O)--,
--C(.dbd.O)S--, --OC(.dbd.O)--, --C(.dbd.O)O--,
--NR.sup.L3aC(.dbd.S)--, --C(.dbd.S)NR.sup.L3a--,
trans-CR.sup.L3b.dbd.CR.sup.L3b--, cis-CR.sup.L3b.dbd.CR.sup.L3b--,
--C.ident.C--, --S(.dbd.O)--, --S(.dbd.O)O--, --OS(.dbd.O)--,
--S(.dbd.O)NR.sup.L3a--, --NR.sup.L3aS(.dbd.O)--,
--S(.dbd.O).sub.2--, --S(.dbd.O).sub.2O--, --OS(.dbd.O).sub.2--,
--S(.dbd.O).sub.2NR.sup.L3a--, or --NR.sup.L3aS(.dbd.O).sub.2--,
wherein R.sup.L3a is hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group, and wherein each
occurrence of R.sup.L3b is independently hydrogen, halogen,
optionally substituted alkyl, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.L3b groups are
joined to form an optionally substituted carbocyclic or optionally
substituted heterocyclic ring; [0418] L.sup.4 is a bond or an
optionally substituted, branched or unbranched C.sub.1-6
hydrocarbon chain; [0419] each of R.sup.E1, R.sup.E2, and R.sup.E3
is independently hydrogen, halogen, optionally substituted alkyl,
optionally substituted alkenyl, optionally substituted alkynyl,
optionally substituted carbocyclyl, optionally substituted
heterocyclyl, optionally substituted aryl, optionally substituted
heteroaryl, --CN, --CH.sub.2OR.sup.EE, --CH.sub.2N(R.sup.EE).sub.2,
--CH.sub.2SR.sup.EE, --OR.sup.EE, --N(R.sup.EE).sub.2,
--Si(R.sup.EE).sub.3, and --SR.sup.EE, wherein each occurrence of
R.sup.EE is independently hydrogen, optionally substituted alkyl,
optionally substituted alkoxy, optionally substituted alkenyl,
optionally substituted alkynyl, optionally substituted carbocyclyl,
optionally substituted heterocyclyl, optionally substituted aryl,
or optionally substituted heteroaryl, or two R.sup.EE groups are
joined to form an optionally substituted heterocyclic ring; [0420]
or R.sup.E1 and R.sup.E3, or R.sup.E2 and R.sup.E3, or R.sup.E1 and
R.sup.E2 are joined to form an optionally substituted carbocyclic
or optionally substituted heterocyclic ring; [0421] R.sup.E4 is a
leaving group; [0422] R.sup.E5 is halogen; [0423] R.sup.E6 is
hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a
nitrogen protecting group; [0424] each instance of Y is
independently O, S, or NR.sup.E7, wherein R.sup.E7 is hydrogen,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; [0425] a is 1 or 2; and [0426] each instance of z
is independently 0, 1, 2, 3, 4, 5, or 6, as valency permits.
[0427] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00092##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0428] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00093## ##STR00094## ##STR00095## ##STR00096## ##STR00097##
##STR00098## ##STR00099## ##STR00100## ##STR00101## ##STR00102##
##STR00103## ##STR00104## ##STR00105## ##STR00106## ##STR00107##
##STR00108## ##STR00109##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0429] In certain embodiments, the transcription inhibitor is of
Formula (IX):
##STR00110##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein: [0430] X.sup.A is
C(R.sup.D) or N; [0431] X.sup.B is C(R.sup.D) or N; [0432] X.sup.C
is C(R.sup.D) or N; [0433] wherein no more than about two of
X.sup.A, X.sup.B, and X.sup.C can be N; [0434] Ring A is of the
formula:
[0434] ##STR00111## [0435] L is a bond or of the formula:
##STR00112##
[0436] each instance of R.sup.A is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.A1, --N(R.sup.A1).sub.2, --SR.sup.A1, --CN, --SCN,
--C(.dbd.NR.sup.A1)R.sup.A1, --C(.dbd.NR.sup.A1)OR.sup.A1,
--C(.dbd.NR.sup.A1)N(R.sup.A1).sub.2, --C(.dbd.O)R.sup.A1,
--C(.dbd.O)OR.sup.A1, --C(.dbd.O)N(R.sup.A1).sub.2, --NO.sub.2,
--NR.sup.A1C(.dbd.O)R.sup.A1, --NR.sup.A1C(.dbd.O)OR.sup.A1,
--NR.sup.A1C(.dbd.O)N(R.sup.A1).sub.2, --OC(.dbd.O)R.sup.A1,
--OC(.dbd.O)OR.sup.A1, or --OC(.dbd.O)N(R.sup.A1).sub.2, or about
two instances of R.sup.A are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring;
[0437] each instance of R.sup.A1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or about
two instances of R.sup.A1 are joined to form a substituted or
unsubstituted heterocyclic ring;
[0438] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --C(.dbd.O)R.sup.B1,
--C(.dbd.O)OR.sup.B1, --C(.dbd.O)N(R.sup.B1).sub.2, or a nitrogen
protecting group, or R.sup.B and R.sup.C are joined to form a
substituted or unsubstituted heterocyclic ring;
[0439] each instance of R.sup.B1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, or an
oxygen protecting group when attached to an oxygen atom, or about
two instances of R.sup.B1 are joined to form a substituted or
unsubstituted heterocyclic ring;
[0440] R.sup.C is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --C(.dbd.O)R.sup.C1,
--C(.dbd.O)OR.sup.C1, --C(.dbd.O)N(R.sup.C1).sub.2, or a nitrogen
protecting group, or R.sup.C and R.sup.B are joined to form a
substituted or unsubstituted heterocyclic ring;
[0441] each instance of R.sup.C1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, or an
oxygen protecting group when attached to an oxygen atom, or about
two instances of R.sup.C1 are joined to form a substituted or
unsubstituted heterocyclic ring;
[0442] each instance of R.sup.D is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.D1, --N(R.sup.D1).sub.2, --SR.sup.D1, --CN, --SCN,
--C(.dbd.NR.sup.D1)R.sup.D1, --C(.dbd.NR.sup.D1)OR.sup.D1,
--C(.dbd.NR.sup.D1)N(R.sup.D1).sub.2, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, --NO.sub.2,
--NR.sup.D1C(.dbd.O)R.sup.D1, --NR.sup.D1C(.dbd.O)OR.sup.D1
NR.sup.D1C(.dbd.O)N(R.sup.D1).sub.2, --OC(.dbd.O)R.sup.D1,
--OC(.dbd.O)OR.sup.D1, or --OC(.dbd.O)N(R.sup.D1).sub.2, or about
two instances of R.sup.D are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring;
[0443] each instance of R.sup.D1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or about
two instances of R.sup.D1 are joined to form a substituted or
unsubstituted heterocyclic ring;
[0444] R.sup.E is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --C(.dbd.O)R.sup.E1,
--C(.dbd.O)OR.sup.E1, --C(.dbd.O)N(R.sup.E1).sub.2, or a nitrogen
protecting group;
[0445] each instance of R.sup.E1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, or an
oxygen protecting group when attached to an oxygen atom, or about
two instances of R.sup.E1 are joined to form a substituted or
unsubstituted heterocyclic ring;
[0446] each instance of R.sup.F is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.F1, --N(R.sup.F1).sub.2, --SR.sup.F1, --CN, --SCN,
--C(.dbd.NR.sup.F1)R.sup.F1, --C(.dbd.NR.sup.F1)OR.sup.F1,
--C(.dbd.NR.sup.F1)N(R.sup.F1).sub.2, --C(.dbd.O)R.sup.F1,
--C(.dbd.O)OR.sup.F1, --C(.dbd.O)N(R.sup.F1).sub.2, --NO.sub.2,
--NR.sup.F1C(.dbd.O)R.sup.F1, --NR.sup.F1C(.dbd.O)OR.sup.F1,
--NR.sup.F1C(.dbd.O)N(R.sup.F1).sub.2, --OC(.dbd.O)R.sup.F1,
--OC(.dbd.O)OR.sup.F1, or --OC(.dbd.O)N(R.sup.F1).sub.2, or about
two instances of RF are joined to form a substituted or
unsubstituted carbocyclic, substituted or unsubstituted
heterocyclic, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl ring;
[0447] each instance of R.sup.F1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or about
two instances of R.sup.F1 are joined to form a substituted or
unsubstituted heterocyclic ring; [0448] a is 0, 1, 2, 3, 4, or 5;
[0449] d is 0, 1, or 2; [0450] f is 0, 1, 2, 3 or 4; and [0451] g
is 0, 1, 2, or 3.
[0452] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00113## ##STR00114## ##STR00115## ##STR00116## ##STR00117##
##STR00118## ##STR00119## ##STR00120##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0453] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00121##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0454] In certain embodiments, the transcription inhibitor is of
Formula (X):
##STR00122##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0455] is a single or double bond;
[0456] X.sup.1 is --O--, --S--, or --C(R.sup.X1).sub.2--, wherein
each instance of R.sup.X1 is independently hydrogen, halogen, or
substituted or unsubstituted C.sub.1-6 alkyl;
[0457] Y.sup.1 is N or CR.sup.Y1, wherein R.sup.Y1 is hydrogen,
halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
[0458] Z.sup.1 is --O--, --N(R.sup.Z1)-- or --C(R.sup.Z1).sub.2--,
wherein each instance of R.sup.Z1 is independently hydrogen,
halogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group when attached to a nitrogen atom, or
about two instances of R.sup.Z1 are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring;
[0459] each instance of R.sup.A1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.A1a,
--N(R.sup.A1a).sub.2, --SR.sup.A1a, --CN, --SCN,
--C(.dbd.NR.sup.A1a)R.sup.A1a, --C(.dbd.NR.sup.A1a)OR.sup.A1a,
--C(.dbd.NR.sup.A1a)N(R.sup.A1a).sub.2, --C(.dbd.O)R.sup.A1a,
--C(.dbd.O)OR.sup.A1a, --C(.dbd.O)N(R.sup.A1a).sub.2, --NO.sub.2,
--NR.sup.A1aC(.dbd.O)R.sup.A1a, --NR.sup.A1aC(.dbd.O)OR.sup.A1a,
--NR.sup.A1aC(.dbd.O)N(R.sup.A1a).sub.2, --OC(.dbd.O)R.sup.A1a,
--OC(.dbd.O)OR.sup.A1a, or --OC(.dbd.O)N(R.sup.A1a).sub.2, wherein
each instance of R.sup.A1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.A1a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0460] a is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
[0461] each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B1a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0462] b is 0, 1, 2, or 3;
[0463] R.sup.C1 is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or an oxygen protecting group;
[0464] R.sup.D1 is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.D1a, --N(R.sup.D1a).sub.2, --SR.sup.D1a, --CN, --SCN,
--C(.dbd.NR.sup.D1a)R.sup.D1a, --C(.dbd.NR.sup.D1a)OR.sup.D1a,
--C(.dbd.NR.sup.D1a)N(R.sup.D1a).sub.2, --C(.dbd.O)R.sup.D1a,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1a).sub.2, --NO.sub.2,
--NR.sup.D1aC(.dbd.O)R.sup.D1a, --NR.sup.D1aC(.dbd.O)OR.sup.D1a,
--NR.sup.D1aC(.dbd.O)N(R.sup.D1a).sub.2, --OC(.dbd.O)R.sup.D1a,
--OC(.dbd.O)OR.sup.D1a, or --OC(.dbd.O)N(R.sup.D1a).sub.2, wherein
each instance of R.sup.D1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.D1a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0465] R.sup.E1 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0466] R.sup.F1 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0467] R.sup.G1 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; and
[0468] R.sup.H1 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl;
[0469] or R.sup.G1 and R.sup.H1 are joined to form a substituted or
unsubstituted phenyl ring.
[0470] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00123##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0471] In certain embodiments, the transcription inhibitor is of
Formula (XI):
##STR00124##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0472] is a single or double bond;
[0473] W.sup.2 is --S(.dbd.O)OR.sup.W2,
--S(.dbd.O)N(R.sup.W2).sub.2, --S(.dbd.O).sub.2OR.sup.W2,
--S(.dbd.O).sub.2N(R.sup.W2).sub.2,
##STR00125##
[0474] each instance of R.sup.W2 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, an
oxygen protecting group when attached to an oxygen atom, or a
nitrogen protecting group when attached to a nitrogen atom, or
about two instances of R.sup.W2 are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring; and
[0475] R.sup.V2 is hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, or a nitrogen protecting group;
[0476] U.sup.2 is R.sup.B2 or --OR.sup.C2;
[0477] X.sup.2 is --O--, --S--, --N(R.sup.X2)--, or
--C(R.sup.X2).sub.2--, wherein each instance of R.sup.X2 is
independently hydrogen, halogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group when attached to a
nitrogen atom;
[0478] Z.sup.2 is --O--, --N(R.sup.Z2)-- or --C(R.sup.Z2).sub.2--,
wherein each instance of R.sup.Z2 is independently hydrogen,
halogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group when attached to a nitrogen atom, or
about two instances of R.sup.Z2 are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring;
[0479] each instance of R.sup.A2 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.A2a,
--N(R.sup.A2a).sub.2, --SR.sup.A2a, --CN, --SCN,
--C(.dbd.NR.sup.A2a)R.sup.A2a, --C(.dbd.NR.sup.A2a)OR.sup.A2a,
--C(.dbd.NR.sup.A2a)N(R.sup.A2a).sub.2, --C(.dbd.O)R.sup.A2a,
--C(.dbd.O)OR.sup.A2a, --C(.dbd.O)N(R.sup.A2a).sub.2, --NO.sub.2,
--NR.sup.A2aC(.dbd.O)R.sup.A2a, --NR.sup.A2aC(.dbd.O)OR.sup.A2a,
--NR.sup.A2aC(.dbd.O)N(R.sup.A2a).sub.2, --OC(.dbd.O)R.sup.A2a,
--OC(.dbd.O)OR.sup.A2a, or --OC(.dbd.O)N(R.sup.A2a).sub.2, wherein
each instance of R.sup.A2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.A2a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0480] k is 0, 1, 2, 3, 4, 5, 6, 7, 8, or 9;
[0481] each instance of R.sup.B2 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B2a,
--N(R.sup.B2a).sub.2, --SR.sup.B2a, --CN, --SCN,
--C(.dbd.NR.sup.B2a)R.sup.B2a, --C(.dbd.NR.sup.B2a)OR.sup.B2a,
--C(.dbd.NR.sup.B2a)N(R.sup.B2a).sub.2, --C(.dbd.O)R.sup.B2a,
--C(.dbd.O)OR.sup.B2a, --C(.dbd.O)N(R.sup.B2a).sub.2, --NO.sub.2,
--NR.sup.B2aC(.dbd.O)R.sup.B2a, --NR.sup.B2aC(.dbd.O)OR.sup.B2a,
--NR.sup.B2aC(.dbd.O)N(R.sup.B2a).sub.2, --OC(.dbd.O)R.sup.B2a,
--OC(.dbd.O)OR.sup.B2a, or --OC(.dbd.O)N(R.sup.B2a).sub.2, wherein
each instance of R.sup.B2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B2a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0482] m is 0, 1, 2, or 3;
[0483] R.sup.C2 is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or an oxygen protecting group;
[0484] each instance of R.sup.D2 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.D2a,
--N(R.sup.D2a).sub.2, --SR.sup.D2a, --CN, --SCN,
--C(.dbd.NR.sup.D2a)R.sup.D2a, --C(.dbd.NR.sup.D2a)OR.sup.D2a,
--C(.dbd.NR.sup.D2a)N(R.sup.D2a).sub.2, --C(.dbd.O)R.sup.D2a,
--C(.dbd.O)OR.sup.D2a, --C(.dbd.O)N(R.sup.D2a).sub.2, --NO.sub.2,
--NR.sup.D2aC(.dbd.O)R.sup.D2a, --NR.sup.D2aC(.dbd.O)OR.sup.D2a,
--NR.sup.D2aC(.dbd.O)N(R.sup.D2a).sub.2, --OC(.dbd.O)R.sup.D2a,
--OC(.dbd.O)OR.sup.D2a, or --OC(.dbd.O)N(R.sup.D2a).sub.2, wherein
each instance of R.sup.D2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.D2a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0485] n is 0, 1, or 2;
[0486] R.sup.E2 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0487] R.sup.F2 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0488] R.sup.G2 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; and
[0489] R.sup.H2 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl;
[0490] or R.sup.G2 and R.sup.H2 are joined to form a substituted or
unsubstituted phenyl ring.
[0491] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00126##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0492] In certain embodiments, the transcription inhibitor is of
Formula (XII):
##STR00127##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0493] each instance of is independently a single or double
bond;
[0494] X.sup.3 is --O--, --S--, --N(R.sup.X3)--, or
--C(R.sup.X3).sub.2--, wherein each instance of R.sup.X3 is
independently hydrogen, halogen, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group when attached to a
nitrogen atom;
[0495] Y.sup.3 is N or CR.sup.Y3, wherein R.sup.Y3 is hydrogen,
halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
[0496] Z.sup.3 is --O--, --N(R.sup.Z3)-- or --C(R.sup.Z3).sub.2--,
wherein each instance of R.sup.Z3 is independently hydrogen,
halogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group when attached to a nitrogen atom, or
about two instances of R.sup.Z3 are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring;
[0497] each instance of R.sup.A3 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.A3a,
--N(R.sup.A3a).sub.2, --SR.sup.A3a, --CN, --SCN,
--C(.dbd.NR.sup.A3a)R.sup.A3a, --C(.dbd.NR.sup.A3a)OR.sup.A3a,
--C(.dbd.NR.sup.A3a)N(R.sup.A3a).sub.2, --C(.dbd.O)R.sup.A3a,
--C(.dbd.O)OR.sup.A3a, --C(.dbd.O)N(R.sup.A3a).sub.2, --NO.sub.2,
--NR.sup.A3aC(.dbd.O)R.sup.A3a, --NR.sup.A3aC(.dbd.O)OR.sup.A3a,
--NR.sup.A3aC(.dbd.O)N(R.sup.A3a).sub.2, --OC(.dbd.O)R.sup.A3a,
--OC(.dbd.O)OR.sup.A3a, or --OC(.dbd.O)N(R.sup.A3a).sub.2, wherein
each instance of R.sup.A3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.A3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0498] p is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
[0499] each instance of R.sup.B3 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B3a,
--N(R.sup.B3a).sub.2, --SR.sup.B3a, --CN, --SCN,
--C(.dbd.NR.sup.B3a)R.sup.B3a, --C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0500] q is 0, 1, 2, or 3;
[0501] R.sup.C3 is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or an oxygen protecting group;
[0502] R.sup.D3 is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.D3a, --N(R.sup.D3a).sub.2, --SR.sup.D3a, --CN, --SCN,
--C(.dbd.NR.sup.D3a)R.sup.D3a, --C(.dbd.NR.sup.D3a)OR.sup.D3a,
--C(.dbd.NR.sup.D3a)N(R.sup.D3a).sub.2, --C(.dbd.O)R.sup.D3a,
--C(.dbd.O)OR.sup.D3a, --C(.dbd.O)N(R.sup.D3a).sub.2, --NO.sub.2,
--NR.sup.D3aC(.dbd.O)R.sup.D3a, --NR.sup.D3aC(.dbd.O)OR.sup.D3a,
--NR.sup.D3aC(.dbd.O)N(R.sup.D3a).sub.2, --OC(.dbd.O)R.sup.D3a,
--OC(.dbd.O)OR.sup.D3a, or --OC(.dbd.O)N(R.sup.D3a).sub.2, wherein
each instance of R.sup.D3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.D3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0503] Ring A is substituted or unsubstituted, 5- to 6-membered,
monocyclic, heterocyclic or heteroaryl ring;
[0504] each instance of R.sup.J3 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.J3a,
--N(R.sup.J3a).sub.2, --SR.sup.J3a, --CN, --SCN,
--C(.dbd.NR.sup.J3a)R.sup.J3a, --C(.dbd.NR.sup.J3a)OR.sup.J3a,
--C(.dbd.NR.sup.J3a)N(R.sup.J3a).sub.2, --C(.dbd.O)R.sup.J3a,
--C(.dbd.O)OR.sup.J3a, --C(.dbd.O)N(R.sup.J3a).sub.2, --NO.sub.2,
--NR.sup.J3aC(.dbd.O)R.sup.J3a, --NR.sup.J3aC(.dbd.O)OR.sup.J3a,
--NR.sup.J3aC(.dbd.O)N(R.sup.J3a).sub.2, --OC(.dbd.O)R.sup.J3a,
--OC(.dbd.O)OR.sup.J3a, --OC(.dbd.O)N(R.sup.J3a).sub.2, or a
nitrogen protecting group when attached to a nitrogen atom, wherein
each instance of R.sup.J3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.J3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0505] r is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
[0506] R.sup.F3 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0507] R.sup.G3 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl; and
[0508] R.sup.H3 is hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl;
[0509] or R.sup.G3 and R.sup.H3 are joined to form a substituted or
unsubstituted phenyl ring.
[0510] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00128##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0511] In certain embodiments, the transcription inhibitor is of
Formula (XIII):
##STR00129##
or pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0512] A is .dbd.N-- or .dbd.C(R.sup.B4)--;
[0513] A.sup.1 is --N(R.sup.4)-- or --C(R.sup.4).sub.2--;
[0514] R.sup.1 is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl;
[0515] R.sup.2 and R.sup.3 are each independently hydrogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, or a nitrogen
protecting group, wherein each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or about two R.sup.D1 groups are joined to form a substituted
or unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring, or a nitrogen protecting group when attached to a
nitrogen atom;
[0516] R.sup.4 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, or --C(.dbd.O)N(R.sup.D1).sub.2, wherein each
instance of RD is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.D1 groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring, or a nitrogen protecting group
when attached to a nitrogen atom;
[0517] each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B1a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0518] each instance of R.sup.B2 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B2a,
--N(R.sup.B2a).sub.2, --SR.sup.B2a, --CN, --SCN,
--C(.dbd.NR.sup.B2a)R.sup.B2a, --C(.dbd.NR.sup.B2a)OR.sup.B2a,
--C(.dbd.NR.sup.B2a)N(R.sup.B2a).sub.2, --C(.dbd.O)R.sup.B2a,
--C(.dbd.O)OR.sup.B2a, --C(.dbd.O)N(R.sup.B2a).sub.2, --NO.sub.2,
--NR.sup.B2aC(.dbd.O)R.sup.B2a, --NR.sup.B2aC(.dbd.O)OR.sup.B2a,
--NR.sup.B2aC(.dbd.O)N(R.sup.B2a).sub.2, --OC(.dbd.O)R.sup.B2a,
--OC(.dbd.O)OR.sup.B2a, or --OC(.dbd.O)N(R.sup.B2a).sub.2, wherein
each instance of R.sup.B2a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B2a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0519] each instance of R.sup.B3 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B3a,
--N(R.sup.B3a).sub.2, --SR.sup.B3a, --CN, --SCN,
--C(.dbd.NR.sup.B3a)R.sup.B3a, --C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0520] each instance of R.sup.B4 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B4a,
--N(R.sup.B4a).sub.2, --SR.sup.B4a, --CN, --SCN,
--C(.dbd.NR.sup.B4a)R.sup.B4a, --C(.dbd.NR.sup.B4a)OR.sup.B4a,
--C(.dbd.NR.sup.B4a)N(R.sup.B4a).sub.2, --C(.dbd.O)R.sup.B4a,
--C(.dbd.O)OR.sup.B4a, --C(.dbd.O)N(R.sup.B4a).sub.2, --N.sub.2,
--NR.sup.B4aC(.dbd.O)R.sup.B4a, --NR.sup.B4aC(.dbd.O)OR.sup.B4a,
--NR.sup.B4aC(.dbd.O)N(R.sup.B4a).sub.2, --OC(.dbd.O)R.sup.B4a,
--OC(.dbd.O)OR.sup.B4a, or --OC(.dbd.O)N(R.sup.B4a).sub.2, wherein
each instance of R.sup.B4a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B4a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0521] m is 0 or an integer between 1 and 8, inclusive;
[0522] p is 0 or an integer between 1 and 4, inclusive;
[0523] each of L.sup.1 and L.sup.2 is independently a bond,
##STR00130##
[0524] each instance of R.sup.a1 is independently hydrogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or a nitrogen protecting group; or, if
L.sup.1 is
##STR00131##
then R.sup.a1 of L.sup.1 and one instance of R.sup.B1 that is ortho
to L.sup.1 are joined to form a substituted or unsubstituted
heterocyclic ring or substituted or unsubstituted heteroaryl ring;
and
[0525] each instance of R.sup.c1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.c1a,
--N(R.sup.c1a).sub.2, --SR.sup.c1a, --CN, --C(.dbd.O)R.sup.c1a,
--C(.dbd.O)OR.sup.c1a, --C(.dbd.O)N(R.sup.c1a).sub.2,
--NR.sup.c1aC(.dbd.O)R.sup.c1a, --NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2, --OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or about two R.sup.c1a groups are joined to form a
substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring.
[0526] In certain embodiments, the transcription inhibitor is of
the formula
##STR00132## ##STR00133## ##STR00134## ##STR00135##
##STR00136##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0527] In certain embodiments, the transcription inhibitor is of
Formula (XIV):
##STR00137##
or pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0528] R.sup.1 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group when attached to a nitrogen atom;
[0529] R.sup.2 is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.D1, --N(R.sup.D1).sub.2, --SR.sup.D1, --CN, --SCN,
--C(.dbd.NR.sup.D1)R.sup.D1, --C(.dbd.NR.sup.D1)OR.sup.D1,
--C(.dbd.NR.sup.D1)N(R.sup.D1).sub.2, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, --NO.sub.2,
--NR.sup.D1C(.dbd.O)R.sup.D1, --NR.sup.D1C(.dbd.O)OR.sup.D1,
--NR.sup.D1C(.dbd.O)N(R.sup.D1).sub.2, --OC(.dbd.O)R.sup.D1,
--OC(.dbd.O)OR.sup.D1, or --OC(.dbd.O)N(R.sup.D1).sub.2, wherein
each instance of R.sup.D1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.D1 groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0530] R.sup.3 and R.sup.4 are each independently hydrogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or a nitrogen protecting group; or
R.sup.3 and R.sup.4 groups are joined to form an substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring;
[0531] each instance of R.sup.5 is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl;
[0532] each instance of R.sup.6 is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.B1a, --N(R.sup.B1a).sub.2,
--SR.sup.B1a, --CN, --SCN, --C(.dbd.NR.sup.B1a)R.sup.B1a,
--C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2;
[0533] q is 0, 1, 2, 3, or 4;
[0534] A is .dbd.N-- or .dbd.C(R.sup.2)--;
[0535] each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2;
[0536] each instance of R.sup.B1a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or about
two R.sup.B1a groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring;
[0537] p is 0 or an integer between 1 and 4, inclusive;
[0538] n is 0, 1, 2, 3, 4, 5, or 6;
[0539] L.sup.1, L.sup.2, and L.sup.4 are each independently a
bond,
##STR00138##
[0540] L.sup.3 is
##STR00139##
[0541] R.sup.a1 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; and
[0542] each instance of R.sup.c1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.c1a,
--N(R.sup.c1a).sub.2, --SR.sup.c1a, --CN, --C(.dbd.O)R.sup.c1a,
--C(.dbd.O)OR.sup.c1a, --C(.dbd.O)N(R.sup.c1a).sub.2,
--NR.sup.c1aC(.dbd.O)R.sup.c1a, --NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2, --OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or about two R.sup.c1a groups are joined to form a
substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring.
[0543] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00140## ##STR00141##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0544] In certain embodiments, the transcription inhibitor is of
Formula (XV):
##STR00142##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0545] is a single or double bond;
[0546] W is --C(.dbd.O)OR.sup.Z1, --C(.dbd.O)N(R.sup.Z1).sub.2,
--S(.dbd.O)OR.sup.Z1, --S(.dbd.O)N(R.sup.Z1).sub.2,
--S(.dbd.O).sub.2OR.sup.Z1, --S(.dbd.O).sub.2N(R.sup.Z1).sub.2,
or
##STR00143##
[0547] Z is --O--, --N(R.sup.Z)-- or --C(R.sup.Z).sub.2--, wherein
each instance of R.sup.Z is independently hydrogen, halogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.Z1, --SR.sup.Z1, --N(R.sup.Z1).sub.2, or a nitrogen
protecting group when attached to a nitrogen atom, or about two
instances of R.sup.Z are joined to form a substituted or
unsubstituted carbocyclic or substituted or unsubstituted
heterocyclic ring;
[0548] each instance of R.sup.Z1 is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, an
oxygen protecting group when attached to an oxygen atom, a sulfur
protecting group when attached to a sulfur atom, or a nitrogen
protecting group when attached to a nitrogen atom, or about two
instances of R.sup.Z1 are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring;
[0549] each instance of R.sup.A is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.A1, --N(R.sup.A1).sub.2,
--SR.sup.A1, --CN, --SCN, --C(.dbd.NR.sup.A1)R.sup.A1,
--C(.dbd.NR.sup.A1)OR.sup.A1, --C(.dbd.NR.sup.A1)N(R.sup.A1).sub.2,
--C(.dbd.O)R.sup.A1, --C(.dbd.O)OR.sup.A1,
--C(.dbd.O)N(R.sup.A1).sub.2, --NO.sub.2,
--NR.sup.A1C(.dbd.O)R.sup.A1, --NR.sup.A1C(.dbd.O)OR.sup.A1,
--NR.sup.A1C(.dbd.O)N(R.sup.A1).sub.2, --OC(.dbd.O)R.sup.A1,
--OC(.dbd.O)OR.sup.A1, or --OC(.dbd.O)N(R.sup.A1).sub.2, wherein
each instance of R.sup.A1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.A1 groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0550] n is 0, 1, 2, 3, 4, 5, 6, 7, or 8;
[0551] X is absent, --C(.dbd.O)--, or --C(R.sup.X).sub.2--, wherein
each instance of R.sup.X is independently hydrogen, halogen, or
substituted or unsubstituted C.sub.1-6 alkyl;
[0552] each instance of R.sup.B is independently hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.B1, --N(R.sup.B1).sub.2,
--SR.sup.B1, --CN, --SCN, --C(.dbd.NR.sup.B1)R.sup.B1,
--C(.dbd.NR.sup.B1)OR.sup.B1, --C(.dbd.NR.sup.B1)N(R.sup.B1).sub.2,
--C(.dbd.O)R.sup.B1, --C(.dbd.O)OR.sup.B1,
--C(.dbd.O)N(R.sup.B1).sub.2, --NO.sub.2,
--NR.sup.B1C(.dbd.O)R.sup.B1, --NR.sup.B1C(.dbd.O)OR.sup.B1,
--NR.sup.B1C(.dbd.O)N(R.sup.B1).sub.2, --OC(.dbd.O)R.sup.B1,
--OC(.dbd.O)OR.sup.B1, or --OC(.dbd.O)N(R.sup.B1).sub.2, wherein
each instance of R.sup.B1 is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B1 groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0553] m is 0, 1, 2, 3, or 4;
[0554] R.sup.C is hydrogen or substituted or unsubstituted
C.sub.1-6 alkyl;
[0555] R.sup.D is hydrogen or substituted or unsubstituted
alkyl;
[0556] R.sup.E is hydrogen or substituted or unsubstituted
alkyl;
[0557] R.sup.F is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, or substituted or unsubstituted
heteroaryl;
[0558] R.sup.G is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, or substituted or unsubstituted heteroaryl;
and
[0559] R.sup.H is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, or substituted or unsubstituted
heteroaryl;
[0560] or R.sup.G and R.sup.H are joined to form a substituted or
unsubstituted phenyl ring.
[0561] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00144## ##STR00145## ##STR00146##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0562] In certain embodiments, the transcription inhibitor is of
Formula (XVI):
##STR00147##
or a salt, solvate or hydrate thereof, wherein:
[0563] X is N or CR.sub.5;
[0564] R.sub.5 is H, alkyl, cycloalkyl, heterocycloalkyl, aryl, or
heteroaryl, each of which is optionally substituted;
[0565] R.sub.B is H, alkyl, hydroxylalkyl, aminoalkyl, alkoxyalkyl,
haloalkyl, hydroxy, alkoxy, or --C(.dbd.O)O--R.sub.3, each of which
is optionally substituted;
[0566] Ring A is aryl or heteroaryl;
[0567] each R.sub.A is independently alkyl, cycloalkyl,
heterocycloalkyl, aryl, or heteroaryl, each of which is optionally
substituted; or any about two R.sub.A together with the atoms to
which each is attached, form a fused aryl or heteroaryl group;
[0568] R is alkyl, cycloalkyl, heterocycloalkyl, aryl, or
heteroaryl; each of which is optionally substituted;
[0569] R.sub.1 is --(CH.sub.2).sub.n-L, wherein n is 0, 1, 2, or 3,
and L is H, --C(.dbd.O)O--R.sub.3, --C(.dbd.O)--R.sub.3,
--C(.dbd.O)--N(R.sub.3R.sub.4), --S(.dbd.O).sub.2--R.sub.3,
--S(.dbd.O).sub.2--N(R.sub.3R.sub.4), --N(R.sub.3R.sub.4),
--N(R.sub.4)C(.dbd.O)R.sub.3, optionally substituted aryl, or
optionally substituted heteroaryl;
[0570] R.sub.2 is H, D, halogen, or optionally substituted
alkyl;
[0571] each R.sub.3 is independently selected from the group
consisting of: [0572] (i) H, aryl, substituted aryl, heteroaryl, or
substituted heteroaryl; [0573] (ii) heterocycloalkyl or substituted
heterocycloalkyl; [0574] (iii) C.sub.1-8 alkyl, C.sub.2-8 alkenyl,
or C.sub.2-8 alkynyl, each containing 0, 1, 2, or 3 heteroatoms
selected from O, S, and N; C.sub.3-12 cycloalkyl, substituted
C.sub.3-12 cycloalkyl, C.sub.3-12 cycloalkenyl, or substituted
C.sub.3-12 cycloalkenyl, each of which is optionally substituted;
and [0575] (iv) --NH.sub.2, --N.dbd.CR.sub.4R.sub.6;
[0576] each R.sub.4 is independently H, alkyl, alkyl, cycloalkyl,
heterocycloalkyl, aryl, or heteroaryl, each of which is optionally
substituted;
[0577] or R.sub.3 and R.sub.4 are taken together with the nitrogen
atom to which they are attached to form a 4- to 10-membered ring;
and
[0578] R.sub.6 is alkyl, alkenyl, cycloalkyl, cycloalkenyl,
heterocycloalkyl, aryl, or heteroaryl, each of which is optionally
substituted;
[0579] or R.sub.4 and R.sub.6 are taken together with the carbon
atom to which they are attached to form a 4- to 10-membered
ring;
[0580] m is 0, 1, 2, or 3;
[0581] provided that: [0582] (a) if Ring A is thienyl, X is N, R is
phenyl or substituted phenyl, R.sub.2 is H, R.sub.B is methyl,
R.sub.1 is --(CH.sub.2).sub.n-L, n is 1, and L is
--C(.dbd.O)--N(R.sub.3R.sub.4), then R.sub.3 and R.sub.4 are not
taken together with the nitrogen atom to which they are attached to
form a morpholino ring; [0583] (b) if Ring A is thienyl, X is N, R
is substituted phenyl, R.sub.2 is H, R.sub.B is methyl, R.sub.1 is
--(CH.sub.2).sub.n-L, n is 1, L is --C(.dbd.O)--N(R.sub.3R.sub.4),
and one of R.sub.3 and R.sub.4 is H, then the other of R.sub.3 and
R.sub.4 is not methyl, hydroxyethyl, alkoxy, phenyl, substituted
phenyl, pyridyl or substituted pyridyl; and [0584] (c) if Ring A is
thienyl, X is N, R is substituted phenyl, R.sub.2 is H, R.sub.B is
methyl, R.sub.1 is --(CH.sub.2).sub.n-L, n is 1, and L is
--C(.dbd.O)O--R.sub.3, then R.sub.3 is not methyl or ethyl.
[0585] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00148##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0586] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00149## ##STR00150## ##STR00151## ##STR00152## ##STR00153##
##STR00154## ##STR00155## ##STR00156## ##STR00157##
##STR00158##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0587] In certain embodiments, the transcription inhibitor is of
Formula (XVII):
##STR00159##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0588] R.sup.A is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl;
[0589] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl;
[0590] or R.sup.A and R.sup.B are joined to form a substituted or
unsubstituted, carbocyclic ring, or a substituted or unsubstituted,
heterocyclic ring;
[0591] R.sup.C is hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, or a nitrogen protecting group;
[0592] each instance of R.sup.D is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0593] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or about
two R.sup.a groups are joined to form a substituted or
unsubstituted, heterocyclic ring, or a substituted or
unsubstituted, heteroaryl ring;
[0594] m is 0, 1, 2, 3, or 4;
[0595] X is --O--, --S--, --N(R.sup.X1)--, or
--C(R.sup.X2).sub.2--, wherein R.sup.X1 is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group, and
wherein each instance of R.sup.X2 is independently hydrogen,
halogen, or substituted or unsubstituted C.sub.1-6 alkyl;
[0596] R.sup.E is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0597] R.sup.F is hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, or a nitrogen protecting group;
[0598] R.sup.G is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted phenyl, or a nitrogen protecting group;
[0599] each instance of R.sup.H is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and
[0600] n is 0, 1, 2, 3, or 4.
[0601] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00160##
wherein R.sup.A is
##STR00161## ##STR00162## ##STR00163## ##STR00164## ##STR00165##
##STR00166## ##STR00167## ##STR00168## ##STR00169## ##STR00170##
##STR00171## ##STR00172## ##STR00173## ##STR00174## ##STR00175##
##STR00176## ##STR00177## ##STR00178## ##STR00179##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0602] In certain embodiments, the transcription inhibitor is of
the formula:
TABLE-US-00001 ##STR00180## R.sup.A R.sup.B ##STR00181##
##STR00182## ##STR00183## ##STR00184## ##STR00185## ##STR00186##
##STR00187## ##STR00188## ##STR00189## ##STR00190## ##STR00191##
##STR00192## ##STR00193## ##STR00194## ##STR00195## ##STR00196##
##STR00197## ##STR00198## ##STR00199## ##STR00200## ##STR00201##
##STR00202## ##STR00203## ##STR00204## ##STR00205## ##STR00206##
##STR00207## ##STR00208## ##STR00209## ##STR00210##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0603] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00211##
wherein
##STR00212## ##STR00213##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0604] In certain embodiments, the transcription inhibitor is of
Formula (XVIII):
##STR00214##
or pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0605] R.sup.A is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl;
[0606] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, or substituted or
unsubstituted heteroaryl;
[0607] or R.sup.A and R.sup.B are joined to form a substituted or
unsubstituted, carbocyclic ring, or a substituted or unsubstituted,
heterocyclic ring;
[0608] R.sup.C is hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, or a nitrogen protecting group;
[0609] R.sup.1 is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, or substituted or unsubstituted heteroaryl;
[0610] R.sup.2 and R.sup.3 are each independently hydrogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --C(.dbd.O)R.sup.D1,
--C(.dbd.O)OR.sup.D1, --C(.dbd.O)N(R.sup.D1).sub.2, or a nitrogen
protecting group, wherein each instance of R.sup.D1 is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or about two R.sup.D1 groups are joined to form a substituted
or unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring, or a nitrogen protecting group when attached to a
nitrogen atom;
[0611] each instance of R.sup.B1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B1a,
--N(R.sup.B1a).sub.2, --SR.sup.B1a, --CN, --SCN,
--C(.dbd.NR.sup.B1a)R.sup.B1a, --C(.dbd.NR.sup.B1a)OR.sup.B1a,
--C(.dbd.NR.sup.B1a)N(R.sup.B1a).sub.2, --C(.dbd.O)R.sup.B1a,
--C(.dbd.O)OR.sup.B1a, --C(.dbd.O)N(R.sup.B1a).sub.2, --NO.sub.2,
--NR.sup.B1aC(.dbd.O)R.sup.B1a, --NR.sup.B1aC(.dbd.O)OR.sup.B1a,
--NR.sup.B1aC(.dbd.O)N(R.sup.B1a).sub.2, --OC(.dbd.O)R.sup.B1a,
--OC(.dbd.O)OR.sup.B1a, or --OC(.dbd.O)N(R.sup.B1a).sub.2, wherein
each instance of R.sup.B1a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B1a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0612] each instance of R.sup.B3 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.B3a,
--N(R.sup.B3a).sub.2, --SR.sup.B3a, --CN, --SCN,
--C(.dbd.NR.sup.B3a)R.sup.B3a, --C(.dbd.NR.sup.B3a)OR.sup.B3a,
--C(.dbd.NR.sup.B3a)N(R.sup.B3a).sub.2, --C(.dbd.O)R.sup.B3a,
--C(.dbd.O)OR.sup.B3a, --C(.dbd.O)N(R.sup.B3a).sub.2, --NO.sub.2,
--NR.sup.B3aC(.dbd.O)R.sup.B3a, --NR.sup.B3aC(.dbd.O)OR.sup.B3a,
--NR.sup.B3aC(.dbd.O)N(R.sup.B3a).sub.2, --OC(.dbd.O)R.sup.B3a,
--OC(.dbd.O)OR.sup.B3a, or --OC(.dbd.O)N(R.sup.B3a).sub.2, wherein
each instance of R.sup.B3a is independently hydrogen, substituted
or unsubstituted acyl, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or about two R.sup.B3a groups are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring;
[0613] p is 0 or an integer between 1 and 4, inclusive;
[0614] L is a bond,
##STR00215##
[0615] R.sup.a1 is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl is hydrogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group; and
[0616] each instance of R.sup.c1 is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.c1a,
--N(R.sup.c1a).sub.2, --SR.sup.c1a, --CN, --C(.dbd.O)R.sup.c1a,
--C(.dbd.O)OR.sup.c1a, --C(.dbd.O)N(R.sup.c1a).sub.2,
--NR.sup.c1aC(.dbd.O)R.sup.c1a, --NR.sup.c1aC(.dbd.O)OR.sup.c1a,
--NR.sup.c1aC(.dbd.O)N(R.sup.c1a).sub.2, --OC(.dbd.O)R.sup.c1a, or
--OC(.dbd.O)N(R.sup.c1a).sub.2, wherein each instance of R.sup.c1a
is independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or about two R.sup.c1a groups are joined to form a
substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring.
[0617] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00216##
wherein R.sup.A is
##STR00217## ##STR00218## ##STR00219## ##STR00220## ##STR00221##
##STR00222## ##STR00223## ##STR00224## ##STR00225## ##STR00226##
##STR00227## ##STR00228## ##STR00229## ##STR00230## ##STR00231##
##STR00232##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0618] In certain embodiments, the transcription inhibitor is of
the formula:
TABLE-US-00002 ##STR00233## R.sup.A or R.sup.B R.sup.B or R.sup.A
##STR00234## ##STR00235## ##STR00236## ##STR00237## ##STR00238##
##STR00239## ##STR00240## ##STR00241## ##STR00242## ##STR00243##
##STR00244## ##STR00245## ##STR00246## ##STR00247## ##STR00248##
##STR00249## ##STR00250## ##STR00251## ##STR00252## ##STR00253##
##STR00254## ##STR00255## ##STR00256## ##STR00257## ##STR00258##
##STR00259## ##STR00260## ##STR00261## ##STR00262##
##STR00263##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0619] In certain embodiments, the transcription inhibitor is of
the formula:
##STR00264##
wherein
##STR00265## ##STR00266##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0620] In certain embodiments, the transcription inhibitor is a CDK
inhibitor, such as dinaciclib, DCA, palbociclib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the
transcription inhibitor is dinaciclib, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof.
In certain embodiments, the transcription inhibitor is DCA, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the
transcription inhibitor is palbociclib, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof.
In certain embodiments, the transcription inhibitor is a CDK
inhibitor, such as AT7519M, P1446A-05, AG-024322, (R)-roscovitine,
P276-00, SNS-032, LEE011, PD 0332991, GT28-01, NSC 638850,
aminopurvalanol A, arcyriaflavin A, AZD 5438, (R)--CR8, (R)-DRF053,
dihydrochloride, flavopiridol, 10Z-hymenialdisine,
irdirubin-3'-oxime, kenpaullone, NSC 625987, NSC 663284, NSC
693868, NU 2058, NU 6140, olomoucine, PHA 767491, purvalanol A,
purvalanol B, RO 3306, ryuvidine, senexin A, SNS 032, SU 9516, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the
transcription inhibitor is a CDK inhibitor, such as p16 protein,
p15 protein, p18 protein, p19 protein, p21/WAF1 protein, p27
protein, or p57 protein. In certain embodiments, the transcription
inhibitor is a bromodomain-containing protein inhibitor, such as
I-BET 151, I-BET 762, OTX-015, TEN-010, CPI-203, CPI-0610, RVX-208,
LY294002, BMS-986158, GSK525762, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug
thereof.
[0621] A pharmaceutical composition described herein may include
two or more different transcription inhibitors described
herein.
[0622] A pharmaceutical composition described herein further
includes a kinase inhibitor, wherein the transcription inhibitor
and the kinase inhibitor are not the same. In certain embodiments,
the kinase inhibitor is not a CDK inhibitor.
[0623] In certain embodiments, the kinase inhibitor is a receptor
tyrosine kinase (RTK) inhibitor (e.g., afatinib, axitinib,
cediranib, erlotinib, gefitinib, grandinin, lapatinib,
lestaurtinib, neratinib, pazopanib, quizartinib, regorafenib,
semaxanib, sorafenib, sunitinib, tivozanib, toceranib, vandetanib,
or a pharmaceutically acceptable salt thereof).
[0624] In certain embodiments, the kinase inhibitor is a fibroblast
growth factor receptor (FGFR) inhibitor. In certain embodiments,
the FGFR inhibitor is BGJ398, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof.
In certain embodiments, the FGFR inhibitor is PD173074, pazopanib,
masatinib, dovitinib, ponatinib, regorafenib, pirfenidone,
nintedanib, brivanib, lenvatinib, cediranib, AZD4547, SU6668,
BGJ398, ENMD2076, picropodophyllin, RG1507, dalotuzumab,
figitumumab, cixutumumab, BIIB022, AMG479, FP1039, IMCA1, PRO001,
R3Mab, MK-2461, SSR128129E, tyrphostin AG 1296, CH5183284,
LY2874455, JNJ-42756493, lucitanib, orantinib, danusertib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0625] In certain embodiments, the kinase inhibitor is an epidermal
growth factor receptor (EGFR) inhibitor. In certain embodiments,
the EGFR inhibitor is erlotinib, lapatinib, AZD8931, WZ4002, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the EGFR
inhibitor is panitumumab, vandetanib, icotinib, afatinib,
brigatinib, CO-1688, AZD-4769, poziotinib, CUDC-101, S-222611,
AC-480, imgatuzumab, sapitinib, TAS-2913, theiiatinib, XGFR-2421,
HM-61713B, epitinib, NRC-2694, MLBS-42, JRP-890, cetuximab,
AL-6802, TAK-285, BGB-102, AEE788, gefitinib, DMS-3008, TX-2036,
KI-6783, KI-6896, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0626] In certain embodiments, the kinase inhibitor is a
mitogen-activated protein kinase (MEK) inhibitor. In certain
embodiments, the MEK inhibitor is trametinib, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof.
In certain embodiments, the MEK inhibitor is selumetinib, MEK162,
PD325901, PD98059, XL518, CI-1040, antroquinonol, AS-1940477,
AS-703988, BI-847325, E-6201, GDC-0623, GDC-0973, RG422, RO4987655,
RO5126766, SL327, WX-554, U0126, BAY869766, vemurafenib, TAK-733,
pimasertib, binimetinib, YopJ polypeptide, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug
thereof.
[0627] In certain embodiments, the kinase inhibitor is vemurafenib,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the MEK
inhibitor is vemurafenib, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0628] In certain embodiments, the kinase inhibitor is a
phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) inhibitor. In
certain embodiments, the PI3K inhibitor is BKM120, BEZ235, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the PI3K
inhibitor is GDC0941, tozasertib, GSK1059615, PX866, LY294002,
SF1126, XL147, XL765, BGT226, BYL719, BAY80946, BAY841236,
GDC-0941, GDC-0032, GDC-0980, GDC-0941, PX-866, GSK2126458,
CAL-101, INK1117, ZSTK474, PWT33597, AEZS-136, PKI-587, PF-4691502,
PF-05212384, wortmannin, demethoxyviridin, pictilisib, idelalisib,
IPI-145, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0629] In certain embodiments, the kinase inhibitor is a receptor
tyrosine-protein kinase erbB-2 (HER2) inhibitor. In certain
embodiments, the HER2 inhibitor is lapatinib, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof.
In certain embodiments, the HER2 inhibitor is trastuzumab,
ado-trastuzumab emtansine, pertuzumab, neratinib, BMS690514,
BIBW-2992, BMS 599626, canertinib, XL647, ertumaxomab, gefitinib,
erlotinib, pelitinib, CP-654577, CP-724714, HKI-272, neratinib,
PKI166, AEE788, BMS-599626, HKI-727, HKI-357, BIBW 2992, AG1478,
ARRY-380, ARRY-334543, BAY846, D69491, DXL-702, JNJ-26483327, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0630] In certain embodiments, the kinase inhibitor is a mammalian
target of rapamycin (mTOR) inhibitor. In certain embodiments, the
mTOR inhibitor is Torin2, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the mTOR inhibitor is GDC-0980, OSI-027, AZD8055,
INK-128, sirolimus, temsirolimus, everolimus, ridaforolimus,
AP23573, rapamycin, simapimod, AZD8055, PF04691502, deforolimus,
intercellular protein FKBP38, wortmannin, SF1126, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0631] In certain embodiments, the kinase inhibitor is an
anaplastic lymphoma kinase (ALK) inhibitor (e.g., crizotinib,
AP26113, LDK378, TAE-684, CEP-14083, CEP-14513, CEP-11988,
WHI-P131, ceritinib, alectinib, staurosporine, CH5424802
(R05424802), ASP3026, TSR-011, X-396, WHI-P154, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof).
[0632] In certain embodiments, the kinase inhibitor is a
platelet-derived growth factor receptor (PDGFR) inhibitor. In
certain embodiments, the kinase inhibitor is a platelet-derived
growth factor receptor alpha (PDGFR.alpha.) inhibitor. In certain
embodiments, the kinase inhibitor is a platelet-derived growth
factor receptor beta (PDGFR.beta.) inhibitor. In certain
embodiments, the kinase inhibitor is imantinib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the kinase
inhibitor is tyrphostin A23, tyrphostin AG 1295, AG-494, masitinib,
AP-24534, motesanib, DMPQ, oxindole I, AG-370, tivozanib, PP121,
sunitinib, pazopanib, PD-161570, dovitinib, sorafenib, ponatinib,
axitinib, nintedanib, AZD2932, MK-2461, sennoside B, TSU-68,
amuvantinib, KRN633, linifanib, telatinib, cernolanib, or
tyrphostin 47, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0633] In certain embodiments, the kinase inhibitor is an inhibitor
of AAK1, ABL, ACK, ACTR2, ACTR2B, AKT1, AKT2, AKT3, AMPKa1, AMPKa2,
ANKRD3, ANPa, ANPb, ARAF, ARAFps, ARG, AurA, AurAps1, AurAps2,
AurB, AurBpsl, AurC, AXL, BARK1, BARK2, BIKE, BLK, BMPR1A,
BMPR1Aps1, BMPR1Aps2, BMPR1B, BMPR2, BMX, BRAF, BRAFps, BRK, BRSK1,
BRSK2, BTK, BUB1, BUBR1, CaMK1a, CaMK1b, CaMK1d, CaMK1g, CaMK2a,
CaMK2b, CaMK2d, CaMK2g, CaMK4, CaMKK1, CaMKK2, caMLCK, CASK, CCK4,
CCRK, CDC2, CDC7, CDK10, CDK11, CDK2, CDK3, CDK4, CDK4ps, CDK5,
CDK5ps, CDK6, CDK7, CDK7ps, CDK8, CDK8ps, CDK9, CDKL1, CDKL2,
CDKL3, CDKL4, CDKL5, CGDps, CHED, CHK1, CHK2, CHK2ps1, CHK2ps2,
CK1a, CK1a2, CK1aps1, CK1aps2, CK1aps3, CK1d, CK1e, CK1g1, CK1g2,
CK1g2ps, CK1g3, CK2a1, CK2a1-rs, CK2a2, CLIK1, CLIKIL, CLK1, CLK2,
CLK2ps, CLK3, CLK3ps, CLK4, COT, CRIK, CRK7, CSK, CTK, CYGD, CYGF,
DAPK1, DAPK2, DAPK3, DCAMKL1, DCAMKL2, DCAMKL3, DDR1, DDR2, DLK,
DMPK1, DMPK2, DRAK1, DRAK2, DYRKIA, DYRKIB, DYRK2, DYRK3, DYRK4,
EphA1, EphA10, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8,
EphB 1, EphB2, EphB3, EphB4, EphB6, Erk1, Erk2, Erk3, Erk3ps1,
Erk3ps2, Erk3ps3, Erk3ps4, Erk4, Erk5, Erk7, FAK, FER, FERps, FES,
FGR, FLT1, FLT1ps, FLT3, FLT4, FMS, FRK, Fused, FYN, GAK, GCK,
GCN2, GCN22, GPRK4, GPRK5, GPRK6, GPRK6ps, GPRK7, GSK3A, GSK3B,
Haspin, HCK, ErbB2, HER3/ErbB3, HER4/ErbB4, HH498, HIPK1, HIPK2,
HIPK3, HIPK4, HPK1, HRI, HRIps, HSER, HUNK, ICK, IGF1R, IKKa, IKKb,
IKKe, ILK, INSR, IRAK1, IRAK2, IRAK3, IRAK4, IRE1, IRE2, IRR, ITK,
JAK1, JAK2, JAK3, JNK1, JNK2, JNK3, KDR, KHS 1, KHS2, KIS, KIT,
KSGCps, KSR1, KSR2, LATS 1, LATS2, LCK, LIMK1, LIMK2, LIMK2ps,
LKB1, LMR1, LMR2, LMR3, LOK, LRRK1, LRRK2, LTK, LYN, LZK, MAK,
MAP3K1, MAP3K2, MAP3K3, MAP3K4, MAP3K5, MAP3K6, MAP3K7, MAP3K8,
MAPKAPK2, MAPKAPK3, MAPKAPK5, MAPKAPKpsl, MARK1, MARK2, MARK3,
MARK4, MARKps01, MARKps02, MARKps03, MARKps04, MARKps05, MARKps07,
MARKps08, MARKps09, MARKps10, MARKps11, MARKps12, MARKps13,
MARKps15, MARKps16, MARKps17, MARKps18, MARKps19, MARKps20,
MARKps21, MARKps22, MARKps23, MARKps24, MARKps25, MARKps26,
MARKps27, MARKps28, MARKps29, MARKps30, MAST1, MAST2, MAST3, MAST4,
MASTL, MELK, MER, MET, MISR2, MLK1, MLK2, MLK3, MLK4, MLKL, MNK1,
MNK1ps, MNK2, MOK, MOS, MPSK1, MPSK1ps, MRCKa, MRCKb, MRCKps, MSK1,
MSK12, MSK2, MSK22, MSSK1, MST1, MST2, MST3, MST3ps, MST4, MUSK,
MYO3A, MYO3B, MYT1, NDR1, NDR2, NEK1, NEK10, NEK11, NEK2, NEK2ps1,
NEK2ps2, NEK2ps3, NEK3, NEK4, NEK4ps, NEK5, NEK6, NEK7, NEK8, NEK9,
NIK, NIM1, NLK, NRBP1, NRBP2, NuaK1, NuaK2, Obscn, Obscn2, OSR1,
p38a, p38b, p38d, p38g, p70S6K, p70S6Kb, p70S6Kps1, p70S6Kps2,
PAK1, PAK2, PAK2ps, PAK3, PAK4, PAK5, PAK6, PASK, PBK, PCTAIRE1,
PCTAIRE2, PCTAIRE3, PDGFRa, PDGFRb, PDK1, PEK, PFTAIRE1, PFTAIRE2,
PHKg1, PHKg1ps1, PHKglps2, PHKglps3, PHKg2, PIK3R4, PIM1, PIM2,
PIM3, PINK1, PITSLRE, PKACa, PKACb, PKACg, PKCa, PKCb, PKCd, PKCe,
PKCg, PKCh, PKCi, PKCips, PKCt, PKCz, PKD1, PKD2, PKD3, PKG1, PKG2,
PKN1, PKN2, PKN3, PKR, PLK1, PLK1ps1, PLK1ps2, PLK2, PLK3, PLK4,
PRKX, PRKXps, PRKY, PRP4, PRP4ps, PRPK, PSKH1, PSKH1ps, PSKH2,
PYK2, QIK, QSK, RAF1, RAFlps, RET, RHOK, RIPK1, RIPK2, RIPK3,
RNAseL, ROCK1, ROCK2, RON, ROR1, ROR2, ROS, RSK1, RSK12, RSK2,
RSK22, RSK3, RSK32, RSK4, RSK42, RSKL1, RSKL2, RYK, RYKps, SAKps,
SBK, SCYL1, SCYL2, SCYL2ps, SCYL3, SGK, SgK050ps, SgK069, SgK071,
SgK085, SgK110, SgK196, SGK2, SgK223, SgK269, SgK288, SGK3, SgK307,
SgK384ps, SgK396, SgK424, SgK493, SgK494, SgK495, SgK496, SIK(e.g.,
SIK1, SIK2), skMLCK, SLK, Slob, smMLCK, SNRK, SPEG, SPEG2, SRC,
SRM, SRPK1, SRPK2, SRPK2ps, SSTK, STK33, STK33ps, STLK3, STLK5,
STLK6, STLK6ps1, STLK6-rs, SuRTK106, SYK, TAK1, TAO1, TAO2, TAO3,
TBCK, TBK1, TEC, TESK1, TESK2, TGFbR1, TGFbR2, TIE1, TIE2, TLK1,
TLK1ps, TLK2, TLK2ps1, TLK2ps2, TNK1, Trad, Trb1, Trb2, Trb3, Trio,
TRKA, TRKB, TRKC, TSSK1, TSSK2, TSSK3, TSSK4, TSSKps1, TSSKps2,
TTBK1, TTBK2, TTK, TTN, TXK, TYK2, TYK22, TYRO3, TYRO3ps, ULK1,
ULK2, ULK3, ULK4, VACAMKL, VRK1, VRK2, VRK3, VRK3ps, Weel, WeelB,
WeelBps, Weelps1, Weelps2, Wnk1, Wnk2, Wnk3, Wnk4, YANK1, YANK2,
YANK3, YES, YESps, YSK1, ZAK, ZAP70, ZC 1/HGK, ZC2/TNIK, ZC3/MINK,
ZC4/NRK, or a combination thereof.
[0634] A pharmaceutical composition described herein may include
two or more different kinase inhibitors described herein.
[0635] In certain embodiments, the transcription inhibitor is a CDK
inhibitor; and the kinase inhibitor is an RTK inhibitor. In certain
embodiments, the transcription inhibitor is a CDK inhibitor; and
the kinase inhibitor is an FGFR inhibitor (e.g., BGJ398), MEK
inhibitor (e.g., trametinib), PI3K inhibitor (e.g., BKM120 or
BEZ235), EGFR inhibitor (e.g., erlotinib, AZD8931, or WZ4002), HER2
inhibitor (e.g., lapatinib), mTOR inhibitor (e.g., Torin2), or ALK
inhibitor (e.g., crizotinib). In certain embodiments, the
transcription inhibitor is a bromodomain-containing protein
inhibitor; and the kinase inhibitor is an RTK inhibitor. In certain
embodiments, the transcription inhibitor is a
bromodomain-containing protein inhibitor; and the kinase inhibitor
is an FGFR inhibitor (e.g., BGJ398), MEK inhibitor (e.g.,
trametinib), PI3K inhibitor (e.g., BKM120 or BEZ235), EGFR
inhibitor (e.g., erlotinib, AZD8931, or WZ4002), HER2 inhibitor
(e.g., lapatinib), mTOR inhibitor (e.g., Torin2), or ALK inhibitor
(e.g., crizotinib). In certain embodiments, the transcription
inhibitor is THZ1, E9, YKL-01-116, THZ5-31-1, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof;
and the kinase inhibitor is an FGFR inhibitor (e.g., BGJ398), MEK
inhibitor (e.g., trametinib), PI3K inhibitor (e.g., BKM120 or
BEZ235), EGFR inhibitor (e.g., erlotinib, AZD8931, or WZ4002), HER2
inhibitor (e.g., lapatinib), mTOR inhibitor (e.g., Torin2), or ALK
inhibitor (e.g., crizotinib). In certain embodiments, the
transcription inhibitor is JQ1, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof;
and the kinase inhibitor is an FGFR inhibitor (e.g., BGJ398), MEK
inhibitor (e.g., trametinib), PI3K inhibitor (e.g., BKM120 or
BEZ235), EGFR inhibitor (e.g., erlotinib, AZD8931, or WZ4002), HER2
inhibitor (e.g., lapatinib), mTOR inhibitor (e.g., Torin2), or ALK
inhibitor (e.g., crizotinib). In certain embodiments, the
transcription inhibitor is dinaciclib, DCA, palbociclib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof; and the kinase inhibitor is an FGFR
inhibitor (e.g., BGJ398), MEK inhibitor (e.g., trametinib), PI3K
inhibitor (e.g., BKM120 or BEZ235), EGFR inhibitor (e.g.,
erlotinib, AZD8931, or WZ4002), HER2 inhibitor (e.g., lapatinib),
mTOR inhibitor (e.g., Torin2), or ALK inhibitor (e.g.,
crizotinib).
[0636] In certain embodiments, the transcription inhibitor is a CDK
inhibitor; and the kinase inhibitor is a PGDFR inhibitor (e.g.,
imatinib). In certain embodiments, the transcription inhibitor is a
CDK inhibitor; and the kinase inhibitor is a MEK inhibitor (e.g.,
trametinib, vemurafenib).
[0637] In certain embodiments, the transcription inhibitor is a
bromodomain-containing protein inhibitor; and the kinase inhibitor
is an PDGFR inhibitor (e.g., imatinib). In certain embodiments, the
transcription inhibitor is a bromodomain-containing protein
inhibitor; and the kinase inhibitor is a MEK inhibitor (e.g.,
trametinib, vemurafenib). In certain embodiments, the transcription
inhibitor is THZ1, E9, YKL-01-116, THZ5-31-1, or a pharmaceutically
acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof;
and the kinase inhibitor is a PDGFR inhibitor (e.g., imatinib) or
MEK inhibitor (e.g., trametinib, vemurafenib). In certain
embodiments, the transcription inhibitor is JQ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof; and the kinase inhibitor is a PDGFR
inhibitor (e.g., imatinib) or MEK inhibitor (e.g., trametinib,
vemurafenib). In certain embodiments, the transcription inhibitor
is dinaciclib, DCA, palbociclib, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof;
and the kinase inhibitor is a PDGFR inhibitor (e.g., imatinib) or
MEK inhibitor (e.g., trametinib, vemurafenib).
[0638] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is BGJ398,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0639] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
erlotinib, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0640] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
GSK1120212, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0641] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is BEZ235,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0642] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is WZ4002,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0643] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
lapatinib, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0644] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
imatinib, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0645] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
trametinib, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0646] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
vemurafenib, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0647] In certain embodiments, the transcription inhibitor is THZ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is
crizotinib, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0648] In certain embodiments, the transcription inhibitor is
dinaciclib, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof, and the kinase
inhibitor is BGJ398, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0649] In certain embodiments, the transcription inhibitor is E9,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is BGJ398,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0650] In certain embodiments, the transcription inhibitor is JQ1,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is BGJ398,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0651] In certain embodiments, the transcription inhibitor is DCA,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, and the kinase inhibitor is BGJ398,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0652] In certain embodiments, the molar ratio of the transcription
inhibitor to the kinase inhibitor is between 0.00001:1 and 100:1
(e.g., between 0.0001:1 and 100:1, between 0.001:1 and 100:1,
between 0.01:1 and 100:1, between 0.1:1 and 100:1, between 1:1 and
100:1, between 0.0001:1 and 10:1, between 0.001:1 and 10:1, between
0.01:1 and 10:1, between 0.1:1 and 10:1, between 1:1 and 10:1,
between 0.00001:1 and 1:1, between 0.0001:1 and 1:1, between
0.001:1 and 1:1, between 0.01:1 and 1:1, between 0.1:1 and 1:1,
between 0.00001:1 and 0.1:1, between 0.0001:1 and 0.1:1, between
0.001:1 and 0.1:1, or between 0.01:1 and 0.1:1), inclusive. In
certain embodiments, the molar ratio of the transcription inhibitor
to the kinase inhibitor is between 0.001:1 and 1:1, inclusive.
[0653] In certain embodiments, a transcription inhibitor and a
kinase inhibitor described herein are not the same. In certain
embodiments, a kinase inhibitor that is or is to be combined with a
transcription inhibitor is the same as the kinase inhibitor to
which a proliferative disease or cell shows resistance.
[0654] In certain embodiments, the transcription inhibitor and the
kinase inhibitor are provided in an effective amount in the
pharmaceutical composition. In certain embodiments, the effective
amount is a therapeutically effective amount. In certain
embodiments, a therapeutically effective amount is an amount
effective for treating a proliferative disease in a subject in need
thereof. In certain embodiments, therapeutically effective amount
is an amount effective for reducing, delaying, and/or preventing in
a subject in need thereof the resistance of a proliferative disease
to a transcription inhibitor or kinase inhibitor. In certain
embodiments, the effective amount is a prophylactically effective
amount (e.g., amount effective for preventing a proliferative
disease in a subject in need thereof).
[0655] In certain embodiments, the subject is an animal. The animal
may be of either sex and may be at any stage of development. In
certain embodiments, the subject described herein is a human. In
certain embodiments, the subject is a non-human animal. In certain
embodiments, the subject is a mammal. In certain embodiments, the
subject is a non-human mammal. In certain embodiments, the subject
is a domesticated animal, such as a dog, cat, cow, pig, horse,
sheep, or goat. In certain embodiments, the subject is a companion
animal, such as a dog or cat. In certain embodiments, the subject
is a livestock animal, such as a cow, pig, horse, sheep, or goat.
In certain embodiments, the subject is a zoo animal. In another
embodiment, the subject is a research animal, such as a rodent
(e.g., mouse, rat), dog, pig, or non-human primate. In certain
embodiments, the animal is a genetically engineered animal. In
certain embodiments, the animal is a transgenic animal (e.g.,
transgenic mice and transgenic pigs). In certain embodiments, the
subject is a fish or reptile. In certain embodiments, the subject
is with a proliferative disease. In certain embodiments, the
subject is with a proliferative disease and has failed therapy of
the proliferative disease with a kinase inhibitor alone. In certain
embodiments, the subject is with a proliferative disease and has
failed therapy of the proliferative disease with a transcription
inhibitor alone.
[0656] In certain embodiments, the cell is in vitro. In certain
embodiments, the cell is in vivo. In certain embodiments, the cell
is a cell of a tissue or biological sample. In certain embodiments,
the cell is a cancer cell.
[0657] In certain embodiments, the proliferative disease is
resistant to the transcription inhibitor or kinase inhibitor. In
certain embodiments, the proliferative disease is a cancer. In
certain embodiments, the cancer is bladder cancer, optionally
wherein: the transcription inhibitor is a CDK inhibitor (e.g.,
THZ1, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a FGFR
inhibitor (e.g., BGJ398, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof); the
transcription inhibitor is a CDK inhibitor (e.g., THZ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is an
EGFR inhibitor (e.g., erlotinib, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof);
the transcription inhibitor is a CDK inhibitor (e.g., dinaciclib,
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a FGFR
inhibitor (e.g., BGJ398, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof); the
transcription inhibitor is a CDK inhibitor (e.g., E9, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a FGFR
inhibitor (e.g., BGJ398, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof); the
transcription inhibitor is a bromodomain-containing protein
inhibitor (e.g., JQ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a FGFR inhibitor (e.g., BGJ398, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof); or the transcription inhibitor is
a CDK inhibitor (e.g., DCA, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a FGFR inhibitor (e.g., BGJ398, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof).
[0658] In certain embodiments, the cancer is lung cancer (e.g.,
bronchogenic carcinoma, small cell lung cancer (SCLC), non-small
cell lung cancer (NSCLC), adenocarcinoma of the lung), optionally
wherein: the transcription inhibitor is a CDK inhibitor (e.g.,
THZ1, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a FGFR
inhibitor (e.g., BGJ398, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof); the
transcription inhibitor is a CDK inhibitor (e.g., THZ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is an
EGFR inhibitor (e.g., erlotinib, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof);
or the transcription inhibitor is a CDK inhibitor (e.g., THZ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a MEK
inhibitor (e.g., GSK1120212, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof).
[0659] In certain embodiments, the cancer is lung cancer (e.g.,
bronchogenic carcinoma, small cell lung cancer (SCLC), non-small
cell lung cancer (NSCLC), adenocarcinoma of the lung), optionally
wherein: the transcription inhibitor is a RTK inhibitor (e.g.,
THZ1, or a pharmaceutically acceptable salt, solvate, hydrate,
polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a MET
inhibitor (e.g., crizotinib, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof). In certain
embodiments, the cancer is lung cancer (e.g., bronchogenic
carcinoma, small cell lung cancer (SCLC), non-small cell lung
cancer (NSCLC), adenocarcinoma of the lung), optionally wherein:
the transcription inhibitor is a RTK inhibitor (e.g., THZ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof), and the kinase inhibitor is a
PDGFR inhibitor (e.g., imatinib, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug
thereof).
[0660] In certain embodiments, the cancer is esophageal cancer
(e.g., adenocarcinoma of the esophagus, Barrett's
adenocarcinoma).
[0661] In certain embodiments, the cancer is esophageal cancer
(e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma),
optionally wherein: the transcription inhibitor is a CDK inhibitor
(e.g., THZ1, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is an RTK inhibitor (e.g., lapatinib).
[0662] In certain embodiments, the cancer is stomach cancer (e.g.,
gastric carcinoma), optionally wherein: the transcription inhibitor
is a CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable
salt, solvate, hydrate, polymorph, co-crystal, tautomer,
stereoisomer, isotopically labeled derivative, or prodrug thereof),
and the kinase inhibitor is an MEK inhibitor (e.g., trametinib,
vemurafenib).
[0663] In certain embodiments, the cancer is skin cancer (e.g.,
squamous cell carcinoma (SCC) (e.g., oral SCC or tongue SCC),
keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)),
optionally wherein: the transcription inhibitor is a CDK inhibitor
(e.g., THZ1, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a MEK inhibitor (e.g., GSK1120212, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof); the transcription inhibitor is a
CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a PI3K inhibitor (e.g., BEZ235, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof); the transcription inhibitor is a
CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is an EGFR inhibitor (e.g., erlotinib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof); or the transcription inhibitor is
a CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a FGFR inhibitor (e.g., BGJ398, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof).
[0664] In certain embodiments, the cancer is skin cancer (e.g.,
squamous cell carcinoma (SCC) (e.g., oral SCC or tongue SCC),
keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)),
optionally wherein: the transcription inhibitor is a CDK inhibitor
(e.g., THZ1, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a MEK inhibitor (e.g., vemurafenib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof).
[0665] In certain embodiments, the cancer is a throat cancer (e.g.,
laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer,
oropharyngeal cancer). In certain embodiments, the cancer is
associated with a mutation in an epidermal growth factor receptor
(EGFR) gene, optionally wherein the transcription inhibitor is a
CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is an EGFR inhibitor (e.g., WZ4002, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof). In certain embodiments, the cancer
is associated with a T790M mutation in an EGFR gene. In certain
embodiments, the cancer is associated with an L858R mutation in an
EGFR gene. In certain embodiments, the cancer is associated with an
exon 19 deletion mutation in an EGFR gene. In certain embodiments,
the cancer is associated with fibroblast growth factor-2
(FGF2)-fibroblast growth factor receptor (FGFR, e.g., FGFR1)
activation through amplification, FGFR3-TACC3 fusion, EML4-ALK
fusion, HER2 amplification, or KRAS codons 12, 13 or 61 mutations.
In certain embodiments, the cancer is associated with a mutation
(e.g., Q61R mutation) in neuroblastoma RAS viral oncogene homolog
(NRAS). In certain embodiments, the cancer is associated with
mesenchymal-epithelial transition (MET) amplification. In certain
embodiments, the cancer is associated with feedback activation of
signal transducer and activator of transcription 3 (STAT3),
optionally wherein: the transcription inhibitor is a CDK inhibitor
(e.g., THZ1, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is an EGFR inhibitor (e.g., erlotinib, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof); or the transcription inhibitor is
a CDK inhibitor (e.g., THZ1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof), and the
kinase inhibitor is a FGFR inhibitor (e.g., BGJ398, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof). In certain embodiments, the
proliferative disease is a benign neoplasm. In certain embodiments,
the proliferative disease is associated with pathological
angiogenesis. In certain embodiments, the proliferative disease is
an inflammatory disease. In certain embodiments, the proliferative
disease is an autoimmune disease.
[0666] Pharmaceutical compositions described herein can be prepared
by any method known in the art of pharmacology. In general, such
preparatory methods include bringing the transcription inhibitors
and/or kinase inhibitors described herein (i.e., the "active
ingredients") into association with a carrier or excipient, and/or
one or more other accessory ingredients, and then, if necessary
and/or desirable, shaping, and/or packaging the product into a
desired single- or multi-dose unit.
[0667] Pharmaceutical compositions can be prepared, packaged,
and/or sold in bulk, as a single unit dose, and/or as a plurality
of single unit doses. A "unit dose" is a discrete amount of the
pharmaceutical composition comprising a predetermined amount of the
active ingredient. The amount of the active ingredient is generally
equal to the dosage of the active ingredient which would be
administered to a subject and/or a convenient fraction of such a
dosage, such as one-half or one-third of such a dosage.
[0668] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition described herein will
vary, depending upon the identity, size, and/or condition of the
subject treated and further depending upon the route by which the
composition is to be administered. The composition may comprise
between 0.1% and 100% (w/w) active ingredient.
[0669] Pharmaceutically acceptable excipients used in the
manufacture of provided pharmaceutical compositions include inert
diluents, dispersing and/or granulating agents, surface active
agents and/or emulsifiers, disintegrating agents, binding agents,
preservatives, buffering agents, lubricating agents, and/or oils.
Excipients such as cocoa butter and suppository waxes, coloring
agents, coating agents, sweetening, flavoring, and perfuming agents
may also be present in the composition.
[0670] Exemplary diluents include calcium carbonate, sodium
carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate,
calcium hydrogen phosphate, sodium phosphate lactose, sucrose,
cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol,
inositol, sodium chloride, dry starch, cornstarch, powdered sugar,
and mixtures thereof.
[0671] Exemplary granulating and/or dispersing agents include
potato starch, corn starch, tapioca starch, sodium starch
glycolate, clays, alginic acid, guar gum, citrus pulp, agar,
bentonite, cellulose, and wood products, natural sponge,
cation-exchange resins, calcium carbonate, silicates, sodium
carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone),
sodium carboxymethyl starch (sodium starch glycolate),
carboxymethyl cellulose, cross-linked sodium carboxymethyl
cellulose (croscarmellose), methylcellulose, pregelatinized starch
(starch 1500), microcrystalline starch, water insoluble starch,
calcium carboxymethyl cellulose, magnesium aluminum silicate
(Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and
mixtures thereof.
[0672] Exemplary surface active agents and/or emulsifiers include
natural emulsifiers (e.g., acacia, agar, alginic acid, sodium
alginate, tragacanth, chondrux, cholesterol, xanthan, pectin,
gelatin, egg yolk, casein, wool fat, cholesterol, wax, and
lecithin), colloidal clays (e.g., bentonite (aluminum silicate) and
Veegum (magnesium aluminum silicate)), long chain amino acid
derivatives, high molecular weight alcohols (e.g., stearyl alcohol,
cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene
glycol distearate, glyceryl monostearate, and propylene glycol
monostearate, polyvinyl alcohol), carbomers (e.g., carboxy
polymethylene, polyacrylic acid, acrylic acid polymer, and
carboxyvinyl polymer), carrageenan, cellulosic derivatives (e.g.,
carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl
cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose,
methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene
sorbitan monolaurate (Tween.RTM. 20), polyoxyethylene sorbitan
(Tween.RTM. 60), polyoxyethylene sorbitan monooleate (Tween.RTM.
80), sorbitan monopalmitate (Span.RTM. 40), sorbitan monostearate
(Span.RTM. 60), sorbitan tristearate (Span.RTM. 65), glyceryl
monooleate, sorbitan monooleate (Span.RTM. 80), polyoxyethylene
esters (e.g., polyoxyethylene monostearate (Myrj.RTM. 45),
polyoxyethylene hydrogenated castor oil, polyethoxylated castor
oil, polyoxymethylene stearate, and Solutol.RTM.), sucrose fatty
acid esters, polyethylene glycol fatty acid esters (e.g.,
Cremophor.RTM.), polyoxyethylene ethers, (e.g., polyoxyethylene
lauryl ether (Brij.RTM. 30)), poly(vinyl-pyrrolidone), diethylene
glycol monolaurate, triethanolamine oleate, sodium oleate,
potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium
lauryl sulfate, Pluronic.RTM. F-68, poloxamer P-188, cetrimonium
bromide, cetylpyridinium chloride, benzalkonium chloride, docusate
sodium, and/or mixtures thereof.
[0673] Exemplary binding agents include starch (e.g., cornstarch
and starch paste), gelatin, sugars (e.g., sucrose, glucose,
dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.),
natural and synthetic gums (e.g., acacia, sodium alginate, extract
of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks,
carboxymethylcellulose, methylcellulose, ethylcellulose,
hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl
methylcellulose, microcrystalline cellulose, cellulose acetate,
poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum.RTM.),
and larch arabogalactan), alginates, polyethylene oxide,
polyethylene glycol, inorganic calcium salts, silicic acid,
polymethacrylates, waxes, water, alcohol, and/or mixtures
thereof.
[0674] Exemplary preservatives include antioxidants, chelating
agents, antimicrobial preservatives, antifungal preservatives,
antiprotozoan preservatives, alcohol preservatives, acidic
preservatives, and other preservatives. In certain embodiments, the
preservative is an antioxidant. In other embodiments, the
preservative is a chelating agent.
[0675] Exemplary antioxidants include alpha tocopherol, ascorbic
acid, acorbyl palmitate, butylated hydroxyanisole, butylated
hydroxytoluene, monothioglycerol, potassium metabisulfite,
propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite,
sodium metabisulfite, and sodium sulfite.
[0676] Exemplary chelating agents include
ethylenediaminetetraacetic acid (EDTA) and salts and hydrates
thereof (e.g., sodium edetate, disodium edetate, trisodium edetate,
calcium disodium edetate, dipotassium edetate, and the like),
citric acid and salts and hydrates thereof (e.g., citric acid
monohydrate), fumaric acid and salts and hydrates thereof, malic
acid and salts and hydrates thereof, phosphoric acid and salts and
hydrates thereof, and tartaric acid and salts and hydrates thereof.
Exemplary antimicrobial preservatives include benzalkonium
chloride, benzethonium chloride, benzyl alcohol, bronopol,
cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol,
chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin,
hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol,
phenylmercuric nitrate, propylene glycol, and thimerosal.
[0677] Exemplary antifungal preservatives include butyl paraben,
methyl paraben, ethyl paraben, propyl paraben, benzoic acid,
hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium
benzoate, sodium propionate, and sorbic acid.
[0678] Exemplary alcohol preservatives include ethanol,
polyethylene glycol, phenol, phenolic compounds, bisphenol,
chlorobutanol, hydroxybenzoate, and phenylethyl alcohol.
[0679] Exemplary acidic preservatives include vitamin A, vitamin C,
vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic
acid, ascorbic acid, sorbic acid, and phytic acid.
[0680] Other preservatives include tocopherol, tocopherol acetate,
deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA),
butylated hydroxytoluened (BHT), ethylenediamine, sodium lauryl
sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium
bisulfite, sodium metabisulfite, potassium sulfite, potassium
metabisulfite, Glydant.RTM. Plus, Phenonip.RTM., methylparaben,
Germall.RTM. 115, Germaben.RTM. II, Neolone.RTM., Kathon.RTM., and
Euxyl.RTM..
[0681] Exemplary buffering agents include citrate buffer solutions,
acetate buffer solutions, phosphate buffer solutions, ammonium
chloride, calcium carbonate, calcium chloride, calcium citrate,
calcium glubionate, calcium gluceptate, calcium gluconate,
D-gluconic acid, calcium glycerophosphate, calcium lactate,
propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium
phosphate, phosphoric acid, tribasic calcium phosphate, calcium
hydroxide phosphate, potassium acetate, potassium chloride,
potassium gluconate, potassium mixtures, dibasic potassium
phosphate, monobasic potassium phosphate, potassium phosphate
mixtures, sodium acetate, sodium bicarbonate, sodium chloride,
sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic
sodium phosphate, sodium phosphate mixtures, tromethamine,
magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free
water, isotonic saline, Ringer's solution, ethyl alcohol, and
mixtures thereof.
[0682] Exemplary lubricating agents include magnesium stearate,
calcium stearate, stearic acid, silica, talc, malt, glyceryl
behanate, hydrogenated vegetable oils, polyethylene glycol, sodium
benzoate, sodium acetate, sodium chloride, leucine, magnesium
lauryl sulfate, sodium lauryl sulfate, and mixtures thereof.
[0683] Exemplary natural oils include almond, apricot kernel,
avocado, babassu, bergamot, black current seed, borage, cade,
camomile, canola, caraway, carnauba, castor, cinnamon, cocoa
butter, coconut, cod liver, coffee, corn, cotton seed, emu,
eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd,
grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui
nut, lavandin, lavender, lemon, litsea cubeba, macademia nut,
mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange,
orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed,
pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood,
sasquana, savoury, sea buckthorn, sesame, shea butter, silicone,
soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut,
and wheat germ oils. Exemplary synthetic oils include, but are not
limited to, butyl stearate, caprylic triglyceride, capric
triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360,
isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol,
silicone oil, and mixtures thereof.
[0684] Liquid dosage forms for oral and parenteral administration
include pharmaceutically acceptable emulsions, microemulsions,
solutions, suspensions, syrups and elixirs. In addition to the
active ingredients, the liquid dosage forms may comprise inert
diluents commonly used in the art such as, for example, water or
other solvents, solubilizing agents and emulsifiers such as ethyl
alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl
alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol,
dimethylformamide, oils (e.g., cottonseed, groundnut, corn, germ,
olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl
alcohol, polyethylene glycols and fatty acid esters of sorbitan,
and mixtures thereof. Besides inert diluents, the oral compositions
can include adjuvants such as wetting agents, emulsifying and
suspending agents, sweetening, flavoring, and perfuming agents. In
certain embodiments for parenteral administration, the conjugates
described herein are mixed with solubilizing agents such as
Cremophor.RTM., alcohols, oils, modified oils, glycols,
polysorbates, cyclodextrins, polymers, and mixtures thereof.
[0685] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions can be formulated according to
the known art using suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation can be a
sterile injectable solution, suspension, or emulsion in a nontoxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that can be employed are water, Ringer's solution, U.S.P.,
and isotonic sodium chloride solution. In addition, sterile, fixed
oils are conventionally employed as a solvent or suspending medium.
For this purpose any bland fixed oil can be employed including
synthetic mono- or di-glycerides. In addition, fatty acids such as
oleic acid are used in the preparation of injectables.
[0686] The injectable formulations can be sterilized, for example,
by filtration through a bacterial-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0687] In order to prolong the effect of a drug, it is often
desirable to slow the absorption of the drug from subcutaneous or
intramuscular injection. This can be accomplished by the use of a
liquid suspension of crystalline or amorphous material with poor
water solubility. The rate of absorption of the drug then depends
upon its rate of dissolution, which, in turn, may depend upon
crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered drug form may be
accomplished by dissolving or suspending the drug in an oil
vehicle.
[0688] Compositions for rectal or vaginal administration are
typically suppositories which can be prepared by mixing the
conjugates described herein with suitable non-irritating excipients
or carriers such as cocoa butter, polyethylene glycol, or a
suppository wax which are solid at ambient temperature but liquid
at body temperature and therefore melt in the rectum or vaginal
cavity and release the active ingredient.
[0689] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
the active ingredient is mixed with at least one inert,
pharmaceutically acceptable excipient or carrier such as sodium
citrate or dicalcium phosphate and/or (a) fillers or extenders such
as starches, lactose, sucrose, glucose, mannitol, and silicic acid,
(b) binders such as, for example, carboxymethylcellulose,
alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia,
(c) humectants such as glycerol, (d) disintegrating agents such as
agar, calcium carbonate, potato or tapioca starch, alginic acid,
certain silicates, and sodium carbonate, (e) solution retarding
agents such as paraffin, (f) absorption accelerators such as
quaternary ammonium compounds, (g) wetting agents such as, for
example, cetyl alcohol and glycerol monostearate, (h) absorbents
such as kaolin and bentonite clay, and (i) lubricants such as talc,
calcium stearate, magnesium stearate, solid polyethylene glycols,
sodium lauryl sulfate, and mixtures thereof. In the case of
capsules, tablets, and pills, the dosage form may include a
buffering agent.
[0690] Solid compositions of a similar type can be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like. The solid dosage forms of
tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings and other
coatings well known in the art of pharmacology. They may optionally
comprise opacifying agents and can be of a composition that they
release the active ingredient(s) only, or preferentially, in a
certain part of the intestinal tract, optionally, in a delayed
manner. Examples of encapsulating compositions which can be used
include polymeric substances and waxes. Solid compositions of a
similar type can be employed as fillers in soft and hard-filled
gelatin capsules using such excipients as lactose or milk sugar as
well as high molecular weight polethylene glycols and the like.
[0691] The active ingredient can be in a micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings, release
controlling coatings, and other coatings well known in the
pharmaceutical formulating art. In such solid dosage forms the
active ingredient can be admixed with at least one inert diluent
such as sucrose, lactose, or starch. Such dosage forms may
comprise, as is normal practice, additional substances other than
inert diluents, e.g., tableting lubricants and other tableting aids
such a magnesium stearate and microcrystalline cellulose. In the
case of capsules, tablets and pills, the dosage forms may comprise
buffering agents. They may optionally comprise opacifying agents
and can be of a composition that they release the active
ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in a delayed manner. Examples of
encapsulating agents which can be used include polymeric substances
and waxes.
[0692] Dosage forms for topical and/or transdermal administration
of a transcription inhibitor and/or kinase inhibitor described
herein may include ointments, pastes, creams, lotions, gels,
powders, solutions, sprays, inhalants, and/or patches. Generally,
the active ingredient is admixed under sterile conditions with a
pharmaceutically acceptable carrier or excipient and/or any needed
preservatives and/or buffers as can be required. Additionally, the
present disclosure contemplates the use of transdermal patches,
which often have the added advantage of providing controlled
delivery of an active ingredient to the body. Such dosage forms can
be prepared, for example, by dissolving and/or dispensing the
active ingredient in the proper medium. Alternatively or
additionally, the rate can be controlled by either providing a rate
controlling membrane and/or by dispersing the active ingredient in
a polymer matrix and/or gel.
[0693] Suitable devices for use in delivering intradermal
pharmaceutical compositions described herein include short needle
devices. Intradermal compositions can be administered by devices
which limit the effective penetration length of a needle into the
skin. Alternatively or additionally, conventional syringes can be
used in the classical mantoux method of intradermal administration.
Jet injection devices which deliver liquid formulations to the
dermis via a liquid jet injector and/or via a needle which pierces
the stratum corneum and produces a jet which reaches the dermis are
suitable. Ballistic powder/particle delivery devices which use
compressed gas to accelerate the transcription inhibitor and/or
kinase inhibitor in powder form through the outer layers of the
skin to the dermis are suitable.
[0694] Formulations suitable for topical administration include,
but are not limited to, liquid and/or semi-liquid preparations such
as liniments, lotions, oil-in-water and/or water-in-oil emulsions
such as creams, ointments, and/or pastes, and/or solutions and/or
suspensions. Topically administrable formulations may, for example,
comprise from about 1% to about 10% (w/w) active ingredient,
although the concentration of the active ingredient can be as high
as the solubility limit of the active ingredient in the solvent.
Formulations for topical administration may further comprise one or
more of the additional ingredients described herein.
[0695] A pharmaceutical composition described herein can be
prepared, packaged, and/or sold in a formulation suitable for
pulmonary administration via the buccal cavity. Such a formulation
may comprise dry particles which comprise the active ingredient and
which have a diameter in the range from about 0.5 to about 7
nanometers, or from about 1 to about 6 nanometers. Such
compositions are conveniently in the form of dry powders for
administration using a device comprising a dry powder reservoir to
which a stream of propellant can be directed to disperse the powder
and/or using a self-propelling solvent/powder dispensing container
such as a device comprising the active ingredient dissolved and/or
suspended in a low-boiling propellant in a sealed container. Such
powders comprise particles wherein at least 98% of the particles by
weight have a diameter greater than 0.5 nanometers and at least 95%
of the particles by number have a diameter less than 7 nanometers.
Alternatively, at least 95% of the particles by weight have a
diameter greater than 1 nanometer and at least 90% of the particles
by number have a diameter less than 6 nanometers. Dry powder
compositions may include a solid fine powder diluent such as sugar
and are conveniently provided in a unit dose form.
[0696] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50 to 99.9% (w/w)
of the composition, and the active ingredient may constitute 0.1 to
20% (w/w) of the composition. The propellant may further comprise
additional ingredients such as a liquid non-ionic and/or solid
anionic surfactant and/or a solid diluent (which may have a
particle size of the same order as particles comprising the active
ingredient).
[0697] Pharmaceutical compositions described herein formulated for
pulmonary delivery may provide the active ingredient in the form of
droplets of a solution and/or suspension. Such formulations can be
prepared, packaged, and/or sold as aqueous and/or dilute alcoholic
solutions and/or suspensions, optionally sterile, comprising the
active ingredient, and may conveniently be administered using any
nebulization and/or atomization device. Such formulations may
further comprise one or more additional ingredients including, but
not limited to, a flavoring agent such as saccharin sodium, a
volatile oil, a buffering agent, a surface active agent, and/or a
preservative such as methylhydroxybenzoate. The droplets provided
by this route of administration may have an average diameter in the
range from about 0.1 to about 200 nanometers.
[0698] Formulations described herein as being useful for pulmonary
delivery are useful for intranasal delivery of a pharmaceutical
composition described herein. Another formulation suitable for
intranasal administration is a coarse powder comprising the active
ingredient and having an average particle from about 0.2 to 500
micrometers. Such a formulation is administered by rapid inhalation
through the nasal passage from a container of the powder held close
to the nares.
[0699] Formulations for nasal administration may, for example,
comprise from about as little as 0.1% (w/w) to as much as 100%
(w/w) of the active ingredient, and may comprise one or more of the
additional ingredients described herein. A pharmaceutical
composition described herein can be prepared, packaged, and/or sold
in a formulation for buccal administration. Such formulations may,
for example, be in the form of tablets and/or lozenges made using
conventional methods, and may contain, for example, 0.1 to 20%
(w/w) active ingredient, the balance comprising an orally
dissolvable and/or degradable composition and, optionally, one or
more of the additional ingredients described herein. Alternately,
formulations for buccal administration may comprise a powder and/or
an aerosolized and/or atomized solution and/or suspension
comprising the active ingredient. Such powdered, aerosolized,
and/or aerosolized formulations, when dispersed, may have an
average particle and/or droplet size in the range from about 0.1 to
about 200 nanometers, and may further comprise one or more of the
additional ingredients described herein.
[0700] A pharmaceutical composition described herein can be
prepared, packaged, and/or sold in a formulation for ophthalmic
administration. Such formulations may, for example, be in the form
of eye drops including, for example, a 0.1-1.0% (w/w) solution
and/or suspension of the active ingredient in an aqueous or oily
liquid carrier or excipient. Such drops may further comprise
buffering agents, salts, and/or one or more other of the additional
ingredients described herein. Other opthalmically-administrable
formulations which are useful include those which comprise the
active ingredient in microcrystalline form and/or in a liposomal
preparation. Ear drops and/or eye drops are also contemplated as
being within the scope of this disclosure.
[0701] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for administration to humans, it
will be understood by the skilled artisan that such compositions
are generally suitable for administration to animals of all sorts.
Modification of pharmaceutical compositions suitable for
administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design
and/or perform such modification with ordinary experimentation.
[0702] The transcription inhibitors and/or kinase inhibitors
provided herein are typically formulated in dosage unit form for
ease of administration and uniformity of dosage. It will be
understood, however, that the total daily usage of the compositions
described herein will be decided by a physician within the scope of
sound medical judgment. The specific therapeutically effective dose
level for any particular subject or organism will depend upon a
variety of factors including the disease being treated and the
severity of the disorder; the activity of the specific active
ingredient employed; the specific composition employed; the age,
body weight, general health, sex, and diet of the subject; the time
of administration, route of administration, and rate of excretion
of the specific active ingredient employed; the duration of the
treatment; drugs used in combination or coincidental with the
specific active ingredient employed; and like factors well known in
the medical arts.
[0703] The transcription inhibitors, kinase inhibitors, and
compositions provided herein can be administered by any route,
including enteral (e.g., oral), parenteral, intravenous,
intramuscular, intra-arterial, intramedullary, intrathecal,
subcutaneous, intraventricular, transdermal, interdermal, rectal,
intravaginal, intraperitoneal, topical (as by powders, ointments,
creams, and/or drops), mucosal, nasal, bucal, sublingual; by
intratracheal instillation, bronchial instillation, and/or
inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
Specifically contemplated routes are oral administration,
intravenous administration (e.g., systemic intravenous injection),
regional administration via blood and/or lymph supply, and/or
direct administration to an affected site. In general, the most
appropriate route of administration will depend upon a variety of
factors including the nature of the agent (e.g., its stability in
the environment of the gastrointestinal tract), and/or the
condition of the subject (e.g., whether the subject is able to
tolerate oral administration). In certain embodiments, the
transcription inhibitors, kinase inhibitors, and pharmaceutical
compositions described herein are suitable for topical
administration to the eye of a subject.
[0704] The exact amount (e.g., combined amount) of a transcription
inhibitor and a kinase inhibitor required to achieve an effective
amount will vary from subject to subject, depending, for example,
on species, age, and general condition of a subject, severity of
the side effects or disorder, identity of the particular
transcription inhibitor, identity of the particular kinase
inhibitor, mode of administration, and the like. An effective
amount may be included in a single dose (e.g., single oral dose) or
multiple doses (e.g., multiple oral doses). Each dose is a
combination of the transcription inhibitor and the kinase
inhibitor. For each dose, the transcription inhibitor and the
kinase inhibitor may be independently administered at the same time
or administered separately at different times in any order. In
certain embodiments, the duration between an administration of the
transcription inhibitor and an administration of the kinase
inhibitor is about one hour, about two hours, about six hours,
about twelve hours, about one day, about two days, about four days,
or about one week, wherein the administration of the transcription
inhibitor and the administration of the kinase inhibitor are
consecutive administrations. The transcription inhibitor in each
dose may be independently administered at the same time or
administered separately at different times. The kinase inhibitor in
each dose may also be independently administered at the same time
or administered separately at different times. For example, in the
following administrations: the kinase inhibitor in amount A,
followed by the transcription inhibitor in amount B 1, and followed
by the transcription inhibitor in amount B2, the dose is the kinase
inhibitor in amount A plus the transcription inhibitor in amount (B
1+B2). In certain embodiments, when multiple doses (e.g., multiple
combinations of the transcription inhibitor and the kinase
inhibitor) are administered to a subject or applied to a biological
sample, tissue, or cell, any about two doses of the multiple doses
include different or substantially the same amounts of a
transcription inhibitor and/or kinase inhibitor described herein.
In certain embodiments, when multiple doses are administered to a
subject or applied to a biological sample, tissue, or cell, the
frequency of administering the multiple doses to the subject or
applying the multiple doses to the biological sample, tissue, or
cell is about three doses a day, about two doses a day, about one
dose a day, about one dose every other day, about one dose every
third day, about one dose every week, about one dose every about
two weeks, about one dose every about three weeks, or about one
dose every about four weeks. In certain embodiments, the frequency
of administering the multiple doses to the subject or applying the
multiple doses to the biological sample, tissue, or cell is about
one dose per day. In certain embodiments, the frequency of
administering the multiple doses to the subject or applying the
multiple doses to the biological sample, tissue, or cell is about
two doses per day. In certain embodiments, the frequency of
administering the multiple doses to the subject or applying the
multiple doses to the biological sample, tissue, or cell is about
three doses per day. In certain embodiments, when multiple doses
are administered to a subject or applied to a biological sample,
tissue, or cell, the duration between the first dose and last dose
of the multiple doses is about one day, about two days, about four
days, about one week, about two weeks, about three weeks, about one
month, about two months, about three months, about four months,
about six months, about nine months, about one year, about two
years, about three years, about four years, about five years, about
seven years, about ten years, fifteen years, twenty years, or the
lifetime of the subject, tissue, or cell. In certain embodiments,
the duration between the first dose and last dose of the multiple
doses is about three months, about six months, or about one year.
In certain embodiments, the duration between the first dose and
last dose of the multiple doses is the lifetime of the subject,
tissue, or cell. In certain embodiments, a dose (e.g., a single
dose, or any dose of multiple doses) described herein includes
independently between 0.1 .mu.g and 1 .mu.g, between 0.001 mg and
0.01 mg, between 0.01 mg and 0.1 mg, between 0.1 mg and 1 mg,
between 1 mg and 3 mg, between 3 mg and 10 mg, between 10 mg and 30
mg, between 30 mg and 100 mg, between 100 mg and 300 mg, between
300 mg and 1,000 mg, or between 1 g and 10 g, inclusive, as the
combined weight of a transcription inhibitor and a kinase inhibitor
described herein. In certain embodiments, a dose described herein
includes independently between 1 mg and 3 mg, inclusive, as the
combined weight of a transcription inhibitor and a kinase inhibitor
described herein. In certain embodiments, a dose described herein
includes independently between 3 mg and 10 mg, inclusive, as the
combined weight of a transcription inhibitor and a kinase inhibitor
described herein. In certain embodiments, a dose described herein
includes independently between 10 mg and 30 mg, inclusive, as the
combined weight of a transcription inhibitor and a kinase inhibitor
described herein. In certain embodiments, a dose described herein
includes independently between 30 mg and 100 mg, inclusive, as the
combined weight of a transcription inhibitor and a kinase inhibitor
described herein.
[0705] Doses and dose ranges described herein provide guidance for
the administration of provided pharmaceutical compositions to an
adult (e.g., an adult whose body weight is 70 kg). The amount to be
administered to, for example, a child or an adolescent can be
determined by a medical practitioner or person skilled in the art
and can be lower or the same as that administered to an adult.
[0706] The combinations of the transcription inhibitor and the
kinase inhibitor are expected to be synergistic in treating and/or
preventing in the subject the proliferative diseases, in reducing,
delaying, and/or preventing in the subject the resistance of
proliferative diseases to a transcription inhibitor or kinase
inhibitor, in inhibiting the proliferation of the cell, and/or
reducing, delaying, and/or preventing the resistance of the cell to
a transcription inhibitor or kinase inhibitor, compared to the
transcription inhibitor alone or the kinase inhibitor alone. To
result in the same effect in treating and/or preventing in the
subject the proliferative diseases, in reducing, delaying, and/or
preventing in the subject the resistance of proliferative diseases
to a transcription inhibitor or kinase inhibitor, in inhibiting the
proliferation of the cell, and/or reducing, delaying, and/or
preventing the resistance of the cell to a transcription inhibitor
or kinase inhibitor, a dose of a combination of the transcription
inhibitor and the kinase inhibitor may be lower than (e.g., lower
than 0.1%, lower than 1%, lower than 10%, or lower than 30%) a dose
of the transcription inhibitor alone and lower than a dose of the
kinase inhibitor alone. To result in the same effect in treating
and/or preventing in the subject the proliferative diseases, in
reducing, delaying, and/or preventing in the subject the resistance
of proliferative diseases to a transcription inhibitor or kinase
inhibitor, in inhibiting the proliferation of the cell, and/or
reducing, delaying, and/or preventing the resistance of the cell to
a transcription inhibitor or kinase inhibitor, the frequency of
multiple doses of a combination of the transcription inhibitor and
the kinase inhibitor may be lower than (e.g., lower than 0.1%,
lower than 1%, lower than 10%, or lower than 30%) the frequency of
multiple doses of the transcription inhibitor alone and lower than
a dose of the kinase inhibitor alone. To result in the same effect
in treating and/or preventing in the subject the proliferative
diseases, in reducing, delaying, and/or preventing in the subject
the resistance of proliferative diseases to a transcription
inhibitor or kinase inhibitor, in inhibiting the proliferation of
the cell, and/or reducing, delaying, and/or preventing the
resistance of the cell to a transcription inhibitor or kinase
inhibitor, the total amount of multiple doses of a combination of
the transcription inhibitor and the kinase inhibitor may be lower
than (e.g., lower than 0.1%, lower than 1%, lower than 10%, or
lower than 30%) the total amount of multiple doses of the
transcription inhibitor alone and lower than a dose of the kinase
inhibitor alone.
[0707] A transcription inhibitor, kinase inhibitor, or composition,
as described herein, can be administered in combination with one or
more additional pharmaceutical agents (e.g., therapeutically and/or
prophylactically active agents). The transcription inhibitor,
kinase inhibitor, or composition can be administered in combination
with additional pharmaceutical agents that improve their activity
(e.g., activity (e.g., potency and/or efficacy) in treating a
proliferative disease in a subject in need thereof, in preventing a
proliferative disease in a subject in need thereof, in reducing,
delaying, and/or preventing in a subject in need thereof the
resistance of proliferative diseases to a transcription inhibitor
or kinase inhibitor, in inhibiting the proliferation of a cell, in
reducing, delaying, and/or preventing the resistance of a cell to a
transcription inhibitor or kinase inhibitor), improve
bioavailability, improve safety, reduce drug resistance, reduce
and/or modify metabolism, inhibit excretion, and/or modify
distribution in a subject, biological sample, tissue, or cell. It
will also be appreciated that the therapy employed may achieve a
desired effect for the same disorder, and/or it may achieve
different effects. In certain embodiments, a pharmaceutical
composition described herein including (1) a transcription
inhibitor and a kinase inhibitor described herein, and (2) an
additional pharmaceutical agent shows a synergistic effect,
compared with a pharmaceutical composition including one of (1) and
(2), but not both (1) and (2).
[0708] The transcription inhibitor, kinase inhibitor, or
composition can be independently administered concurrently with,
prior to, or subsequent to one or more additional pharmaceutical
agents. In certain embodiments, the additional pharmaceutical
agents and the transcription inhibitor are not the same, and the
additional pharmaceutical agents and the kinase inhibitor are not
the same. Pharmaceutical agents include therapeutically active
agents. Pharmaceutical agents also include prophylactically active
agents. Pharmaceutical agents include small organic molecules such
as drug compounds (e.g., compounds approved for human or veterinary
use by the U.S. Food and Drug Administration as provided in the
Code of Federal Regulations (CFR)), peptides, proteins,
carbohydrates, monosaccharides, oligosaccharides, polysaccharides,
nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides
or proteins, small molecules linked to proteins, glycoproteins,
steroids, nucleic acids, DNAs, RNAs, nucleotides, nucleosides,
oligonucleotides, antisense oligonucleotides, lipids, hormones,
vitamins, and cells. In certain embodiments, the additional
pharmaceutical agent is a pharmaceutical agent useful for treating
and/or preventing a disease (e.g., proliferative disease,
inflammatory disease, autoimmune disease, genetic disease,
hematological disease, neurological disease, painful condition,
psychiatric disorder, or metabolic disorder). Each additional
pharmaceutical agent may be administered at a dose and/or on a time
schedule determined for that pharmaceutical agent. The additional
pharmaceutical agents may also be administered together with each
other and/or with the transcription inhibitor, kinase inhibitor, or
composition described herein at the same time or administered
separately at different times. The particular combination to employ
in a regimen will take into account compatibility of the
transcription inhibitor and/or kinase inhibitor described herein
with the additional pharmaceutical agent(s), and/or the desired
therapeutic and/or prophylactic effect to be achieved. In general,
it is expected that the additional pharmaceutical agent(s) in
combination be utilized at levels that do not exceed the levels at
which they are utilized individually. In some embodiments, the
levels utilized in combination will be lower than those utilized
individually.
[0709] The additional pharmaceutical agents include, but are not
limited to, anti-proliferative agents, anti-cancer agents,
anti-angiogenesis agents, anti-inflammatory agents,
immunosuppressants, anti-bacterial agents, anti-viral agents,
cardiovascular agents, cholesterol-lowering agents, anti-diabetic
agents, anti-allergic agents, contraceptive agents, pain-relieving
agents, and a combination thereof. In certain embodiments, the
additional pharmaceutical agent is an anti-proliferative agent
(e.g., anti-cancer agent, cytotoxic agent). In certain embodiments,
the additional pharmaceutical agent is abiraterone acetate (e.g.,
ZYTIGA), ABVD, ABVE, ABVE-PC, AC, AC-T, ADE, ado-trastuzumab
emtansine (e.g., KADCYLA), afatinib dimaleate (e.g., GILOTRIF),
aldesleukin (e.g., PROLEUKIN), alemtuzumab (e.g., CAMPATH),
anastrozole (e.g., ARIMIDEX), arsenic trioxide (e.g., TRISENOX),
asparaginase erwinia chrysanthemi (e.g., ERWINAZE), axitinib (e.g.,
INLYTA), azacitidine (e.g., MYLOSAR, VIDAZA), BEACOPP, belinostat
(e.g., BELEODAQ), bendamustine hydrochloride (e.g., TREANDA), BEP,
bevacizumab (e.g., AVASTIN), bicalutamide (e.g., CASODEX),
bleomycin (e.g., BLENOXANE), blinatumomab (e.g., BLINCYTO),
bortezomib (e.g., VELCADE), bosutinib (e.g., BOSULIF), brentuximab
vedotin (e.g., ADCETRIS), busulfan (e.g., BUSULFEX, MYLERAN),
cabazitaxel (e.g., JEVTANA), cabozantinib-s-malate (e.g.,
COMETRIQ), CAF, capecitabine (e.g., XELODA), CAPOX, carboplatin
(e.g., PARAPLAT, PARAPLATIN), carboplatin-taxol, carfilzomib (e.g.,
KYPROLIS), carmustine (e.g., BECENUM, BICNU, CARMUBRIS), carmustine
implant (e.g., GLIADEL WAFER, GLIADEL), ceritinib (e.g., ZYKADIA),
cetuximab (e.g., ERBITUX), chlorambucil (e.g., AMBOCHLORIN,
AMBOCLORIN, LEUKERAN, LINFOLIZIN), chlorambucil-prednisone, CHOP,
cisplatin (e.g., PLATINOL, PLATINOL-AQ), clofarabine (e.g.,
CLOFAREX, CLOLAR), CMF, COPP, COPP-ABV, crizotinib (e.g., XALKORI),
CVP, cyclophosphamide (e.g., CLAFEN, CYTOXAN, NEOSAR), cytarabine
(e.g., CYTOSAR-U, TARABINE PFS), dabrafenib (e.g., TAFINLAR),
dacarbazine (e.g., DTIC-DOME), dactinomycin (e.g., COSMEGEN),
dasatinib (e.g., SPRYCEL), daunorubicin hydrochloride (e.g.,
CERUBIDINE), decitabine (e.g., DACOGEN), degarelix, denileukin
diftitox (e.g., ONTAK), denosumab (e.g., PROLIA, XGEVA),
Dinutuximab (e.g., UNITUXIN), docetaxel (e.g., TAXOTERE),
doxorubicin hydrochloride (e.g., ADRIAMYCIN PFS, ADRIAMYCIN RDF),
doxorubicin hydrochloride liposome (e.g., DOXIL, DOX-SL, EVACET,
LIPODOX), enzalutamide (e.g., XTANDI), epirubicin hydrochloride
(e.g., ELLENCE), EPOCH, erlotinib hydrochloride (e.g., TARCEVA),
etoposide (e.g., TOPOSAR, VEPESID), etoposide phosphate (e.g.,
ETOPOPHOS), everolimus (e.g., AFINITOR DISPERZ, AFINITOR),
exemestane (e.g., AROMASIN), FEC, fludarabine phosphate (e.g.,
FLUDARA), fluorouracil (e.g., ADRUCIL, EFUDEX, FLUOROPLEX),
FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI-CETUXIMAB, FOLFIRINOX,
FOLFOX, FU-LV, fulvestrant (e.g., FASLODEX), gefitinib (e.g.,
IRESSA), gemcitabine hydrochloride (e.g., GEMZAR),
gemcitabine-cisplatin, gemcitabine-oxaliplatin, goserelin acetate
(e.g., ZOLADEX), Hyper-CVAD, ibritumomab tiuxetan (e.g., ZEVALIN),
ibrutinib (e.g., IMBRUVICA), ICE, idelalisib (e.g., ZYDELIG),
ifosfamide (e.g., CYFOS, IFEX, IFOSFAMIDUM), imatinib mesylate
(e.g., GLEEVEC), imiquimod (e.g., ALDARA), ipilimumab (e.g.,
YERVOY), irinotecan hydrochloride (e.g., CAMPTOSAR), ixabepilone
(e.g., IXEMPRA), lanreotide acetate (e.g., SOMATULINE DEPOT),
lapatinib ditosylate (e.g., TYKERB), lenalidomide (e.g., REVLIMID),
lenvatinib (e.g., LENVIMA), letrozole (e.g., FEMARA), leucovorin
calcium (e.g., WELLCOVORIN), leuprolide acetate (e.g., LUPRON
DEPOT, LUPRON DEPOT-3 MONTH, LUPRON DEPOT-4 MONTH, LUPRON
DEPOT-PED, LUPRON, VIADUR), liposomal cytarabine (e.g., DEPOCYT),
lomustine (e.g., CEENU), mechlorethamine hydrochloride (e.g.,
MUSTARGEN), megestrol acetate (e.g., MEGACE), mercaptopurine (e.g.,
PURINETHOL, PURIXAN), methotrexate (e.g., ABITREXATE, FOLEX PFS,
FOLEX, METHOTREXATE LPF, MEXATE, MEXATE-AQ), mitomycin c (e.g.,
MITOZYTREX, MUTAMYCIN), mitoxantrone hydrochloride, MOPP,
nelarabine (e.g., ARRANON), nilotinib (e.g., TASIGNA), nivolumab
(e.g., OPDIVO), obinutuzumab (e.g., GAZYVA), OEPA, ofatumumab
(e.g., ARZERRA), OFF, olaparib (e.g., LYNPARZA), omacetaxine
mepesuccinate (e.g., SYNRIBO), OPPA, oxaliplatin (e.g., ELOXATIN),
paclitaxel (e.g., TAXOL), paclitaxel albumin-stabilized
nanoparticle formulation (e.g., ABRAXANE), PAD, palbociclib (e.g.,
IBRANCE), pamidronate disodium (e.g., AREDIA), panitumumab (e.g.,
VECTIBIX), panobinostat (e.g., FARYDAK), pazopanib hydrochloride
(e.g., VOTRIENT), pegaspargase (e.g., ONCASPAR), peginterferon
alfa-2b (e.g., PEG-INTRON), peginterferon alfa-2b (e.g., SYLATRON),
pembrolizumab (e.g., KEYTRUDA), pemetrexed disodium (e.g., ALIMTA),
pertuzumab (e.g., PERJETA), plerixafor (e.g., MOZOBIL),
pomalidomide (e.g., POMALYST), ponatinib hydrochloride (e.g.,
ICLUSIG), pralatrexate (e.g., FOLOTYN), prednisone, procarbazine
hydrochloride (e.g., MATULANE), radium 223 dichloride (e.g.,
XOFIGO), raloxifene hydrochloride (e.g., EVISTA, KEOXIFENE),
ramucirumab (e.g., CYRAMZA), R-CHOP, recombinant HPV bivalent
vaccine (e.g., CERVARIX), recombinant human papillomavirus (e.g.,
HPV) nonavalent vaccine (e.g., GARDASIL 9), recombinant human
papillomavirus (e.g., HPV) quadrivalent vaccine (e.g., GARDASIL),
recombinant interferon alfa-2b (e.g., INTRON A), regorafenib (e.g.,
STIVARGA), rituximab (e.g., RITUXAN), romidepsin (e.g., ISTODAX),
ruxolitinib phosphate (e.g., JAKAFI), siltuximab (e.g., SYLVANT),
sipuleucel-t (e.g., PROVENGE), sorafenib tosylate (e.g., NEXAVAR),
STANFORD V, sunitinib malate (e.g., SUTENT), TAC, tamoxifen citrate
(e.g., NOLVADEX, NOVALDEX), temozolomide (e.g., METHAZOLASTONE,
TEMODAR), temsirolimus (e.g., TORISEL), thalidomide (e.g., SYNOVIR,
THALOMID), thiotepa, topotecan hydrochloride (e.g., HYCAMTIN),
toremifene (e.g., FARESTON), tositumomab and iodine I 131
tositumomab (e.g., BEXXAR), TPF, trametinib (e.g., MEKINIST),
trastuzumab (e.g., HERCEPTIN), VAMP, vandetanib (e.g., CAPRELSA),
VEIP, vemurafenib (e.g., ZELBORAF), vinblastine sulfate (e.g.,
VELBAN, VELSAR), vincristine sulfate (e.g., VINCASAR PFS),
vincristine sulfate liposome (e.g., MARQIBO), vinorelbine tartrate
(e.g., NAVELBINE), vismodegib (e.g., ERIVEDGE), vorinostat (e.g.,
ZOLINZA), XELIRI, XELOX, ziv-aflibercept (e.g., ZALTRAP),
zoledronic acid (e.g., ZOMETA), or a combination thereof. In
certain embodiments, the additional pharmaceutical agent is
selected from the group consisting of epigenetic or transcriptional
modulators (e.g., DNA methyltransferase inhibitors, histone
deacetylase inhibitors (HDAC inhibitors), lysine methyltransferase
inhibitors), antimitotic drugs (e.g., taxanes and vinca alkaloids),
hormone receptor modulators (e.g., estrogen receptor modulators and
androgen receptor modulators), cell signaling pathway inhibitors,
modulators of protein stability (e.g., proteasome inhibitors),
Hsp90 inhibitors, glucocorticoids, all-trans retinoic acids, and
other agents that promote differentiation.
[0710] Also encompassed by the disclosure are kits (e.g.,
pharmaceutical packs). The kits provided may comprise a
transcription inhibitor and a kinase inhibitor described herein, or
a pharmaceutical composition described herein. The kits may
comprise a transcription inhibitor and a kinase inhibitor in a
first container. The kits may comprise a transcription inhibitor in
a first container and a kinase inhibitor in a second container. The
kits may comprise a pharmaceutical composition in a first
container. In some embodiments, the kits further include a third
container comprising a pharmaceutical excipient for dilution or
suspension of the transcription inhibitor, kinase inhibitor, and/or
pharmaceutical composition.
[0711] In some embodiments, the transcription inhibitor, kinase
inhibitor, or pharmaceutical composition provided in the first
container, optionally the second container, and optionally the
third container are combined to form one unit dosage form. Each of
the first container, second container, and third container may
independently be a vial, ampule, bottle, syringe, and/or dispenser
package, or other suitable container. In certain embodiments, the
kits are useful for treating a proliferative disease (e.g.,
proliferative disease that is resistant to a transcription
inhibitor or kinase inhibitor) in a subject in need thereof. In
certain embodiments, the kits are useful for preventing a
proliferative disease (e.g., proliferative disease that is
resistant to a transcription inhibitor or kinase inhibitor) in a
subject in need thereof. In certain embodiments, the kits are
useful for reducing, delaying, and/or preventing in a subject in
need thereof the resistance of a proliferative disease to a
transcription inhibitor or kinase inhibitor. In certain
embodiments, the kits are useful in inhibiting the proliferation of
a cell. In certain embodiments, the kits are useful in reducing,
delaying, and/or preventing the resistance of a cell to a
transcription inhibitor or kinase inhibitor. In certain
embodiments, a kit described herein further includes instructions
for using the transcription inhibitor and kinase inhibitor included
in the kit, or for using the pharmaceutical composition included in
the kit. A kit described herein may also include information as
required by a regulatory agency such as the U.S. Food and Drug
Administration (FDA). In certain embodiments, the information
included in the kits is prescribing information. In certain
embodiments, the kits and instructions provide for treating a
proliferative disease (e.g., proliferative disease that is
resistant to a transcription inhibitor or kinase inhibitor) in a
subject in need thereof. In certain embodiments, the kits and
instructions provide for preventing a proliferative disease (e.g.,
proliferative disease that is resistant to a transcription
inhibitor or kinase inhibitor) in a subject in need thereof. In
certain embodiments, the kits and instructions provide for
reducing, delaying, and/or preventing in a subject in need thereof
the resistance of a proliferative disease to a transcription
inhibitor or kinase inhibitor. In certain embodiments, the kits and
instructions provide for inhibiting the proliferation of a cell. In
certain embodiments, the kits and instructions provide for
reducing, delaying, and/or preventing the resistance of a cell to a
transcription inhibitor or kinase inhibitor. A kit described herein
may include one or more additional pharmaceutical agents described
herein as a separate composition.
Methods of Treatment and Uses
[0712] The transcription inhibitors and kinase inhibitors described
herein may be useful as combination therapies. The present
disclosure thus also provides methods of treating and/or preventing
a proliferative disease in a subject in need thereof, methods of
reducing, delaying, and/or preventing in a subject in need thereof
the resistance of a proliferative disease to a transcription
inhibitor or kinase inhibitor, methods of inhibiting the
proliferation of a cell, and methods of delaying and/or preventing
the resistance of a cell to a transcription inhibitor or kinase
inhibitor, using the transcription inhibitor and/or kinase
inhibitor, or pharmaceutical composition thereof.
[0713] In another aspect, the present disclosure provides methods
of treating a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., therapeutically effective amount) of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein. In certain
embodiments, the transcription inhibitor and kinase inhibitor are
synergistic in treating the proliferative disease, compared to the
transcription inhibitor alone or kinase inhibitor alone.
[0714] In another aspect, the present disclosure provides methods
of preventing a proliferative disease in a subject in need thereof,
the methods comprising administering to the subject an effective
amount (e.g., prophylactically effective amount) of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein. In certain
embodiments, the transcription inhibitor and kinase inhibitor are
synergistic in preventing the proliferative disease, compared to
the transcription inhibitor alone or kinase inhibitor alone.
[0715] In another aspect, the present disclosure provides methods
of reducing, delaying, and/or preventing in a subject in need
thereof the resistance of a proliferative disease to a
transcription inhibitor or kinase inhibitor, the methods comprising
administering to the subject an effective amount of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein. In certain
embodiments, the transcription inhibitor and kinase inhibitor are
synergistic in reducing, delaying, and/or preventing the resistance
of the proliferative disease to the transcription inhibitor or
kinase inhibitor, compared to the transcription inhibitor alone or
kinase inhibitor alone.
[0716] In certain embodiments, the transcription inhibitor and
kinase inhibitor are administered to the subject at the same time.
In certain embodiments, the transcription inhibitor and kinase
inhibitor are administered to the subject at different times.
[0717] In another aspect, the present disclosure provides methods
of inhibiting the proliferation of a cell, the methods comprising
contacting the cell with an effective amount of (1) a transcription
inhibitor and a kinase inhibitor described herein, or (2) a
pharmaceutical composition described herein. In certain
embodiments, the transcription inhibitor and kinase inhibitor are
synergistic in inhibiting the proliferation of the cell, compared
to the transcription inhibitor alone or kinase inhibitor alone.
[0718] In another aspect, the present disclosure provides methods
of reducing, delaying, and/or preventing the resistance of a cell
to a transcription inhibitor or kinase inhibitor, the methods
comprising contacting the cell with an effective amount of (1) a
transcription inhibitor and a kinase inhibitor described herein, or
(2) a pharmaceutical composition described herein. In certain
embodiments, the transcription inhibitor and kinase inhibitor are
synergistic in reducing, delaying, and/or preventing the resistance
of the cell to the transcription inhibitor or kinase inhibitor,
compared to the transcription inhibitor alone or kinase inhibitor
alone.
[0719] In certain embodiments, the transcription inhibitor and
kinase inhibitor are contacted with the cell at the same time. In
certain embodiments, the transcription inhibitor and kinase
inhibitor are contacted with the cell at different times.
[0720] In another aspect, the present disclosure provides the
transcription inhibitors and kinase inhibitors described herein for
use in a method described herein (e.g., a method of treating a
proliferative disease in a subject in need thereof, a method of
preventing a proliferative disease in a subject in need thereof, a
method of reducing, delaying, and/or preventing in a subject in
need thereof the resistance of a proliferative disease to a
transcription inhibitor or kinase inhibitor, a method of inhibiting
the proliferation of a cell, or a method of reducing, delaying,
and/or preventing the resistance of a cell to a transcription
inhibitor or kinase inhibitor). In certain embodiments, the present
disclosure provides the transcription inhibitors and kinase
inhibitors for use in treating a proliferative disease in a subject
in need thereof. In certain embodiments, the present disclosure
provides a combination of the transcription inhibitors and kinase
inhibitors for use in treating a proliferative disease in a subject
in need thereof.
[0721] In still another aspect, the present disclosure provides the
pharmaceutical compositions described herein for use in a method
described herein (e.g., a method of treating a proliferative
disease in a subject in need thereof, a method of preventing a
proliferative disease in a subject in need thereof, a method of
reducing, delaying, and/or preventing in a subject in need thereof
the resistance of a proliferative disease to a transcription
inhibitor or kinase inhibitor, a method of inhibiting the
proliferation of a cell, or a method of reducing, delaying, and/or
preventing the resistance of a cell to a transcription inhibitor or
kinase inhibitor). In certain embodiments, the present disclosure
provides the pharmaceutical compositions for use in treating a
proliferative disease in a subject in need thereof.
[0722] In certain embodiments, the transcription inhibitors and
kinase inhibitors, or pharmaceutical compositions thereof, can be
administered in combination with an anti-cancer therapy including,
but not limited to, surgery, radiation therapy, transplantation
(e.g., stem cell transplantation, bone marrow transplantation),
immunotherapy, and chemotherapy. In certain embodiments the
transcription inhibitors and kinase inhibitors, or pharmaceutical
compositions thereof, can be administered in combination with
radiation therapy.
[0723] In certain embodiments, the combination of administering
transcription inhibitors and kinase inhibitors, or pharmaceutical
compositions thereof, and radiation therapy is synergistic in
treating a proliferative disease, compared to treatment with
transcription inhibitors and kinase inhibitors, or pharmaceutical
compositions thereof, alone, or compared to treatment with
radiation therapy alone. The combination of transcription
inhibitor, kinase inhibitor, and radiation may be useful in
treating proliferative diseases that are resistant to transcription
inhibitor alone, kinase inhibitor alone, and/or radiation alone.
The combination of transcription inhibitor, kinase inhibitor, and
radiation may be useful in treating a subject with a proliferative
disease that has failed therapy of the proliferative disease with
transcription inhibitor alone, kinase inhibitor alone, and/or
radiation alone. The transcription inhibitors, kinase inhibitors,
and radiation therapy may be administered at the same time or
administered separately at different times in any order. In some
embodiments, the transcription inhibitor and kinase inhibitor are
administered before radiation therapy. In some embodiments, the
transcription inhibitor and kinase inhibitor and administered after
radiation therapy. In some embodiments, the transcription inhibitor
and kinase inhibitor are administered concurrently with radiation
therapy, e.g., on the same day. In some embodiments, the
transcription inhibitor and kinase inhibitor are administered on an
alternating basis, e.g., inhibitors one day and radiation therapy
the next and so on.
[0724] In another aspect, the transcription inhibitor, or a
pharmaceutical composition thereof, can be administered in
combination with an anti-cancer therapy including, but not limited
to, surgery, radiation therapy, transplantation (e.g., stem cell
transplantation, bone marrow transplantation), immunotherapy, and
chemotherapy. In certain embodiments, provided herein are methods
for treating a proliferative disease in a subject in need thereof,
comprising administering to the subject an effective amount of a
transcription inhibitor, and radiation therapy. In some
embodiments, the transcription inhibitor and radiation therapy are
synergistic in treating the proliferative disease, compared to the
transcription inhibitor alone or radiation therapy alone. In
certain embodiments, provided herein are methods for treating a
proliferative disease in a subject in need thereof, comprising
administering to the subject an effective amount of a transcription
inhibitor, and radiation therapy. In some embodiments, the
transcription inhibitor and radiation therapy are synergistic in
treating the proliferative disease, compared to the transcription
inhibitor alone or radiation therapy alone. In certain embodiments,
the transcription inhibitor combined with radiation therapy is a
compound of Formula (I). In certain embodiments, the transcription
inhibitor combined with radiation therapy is THZ1, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the
transcription inhibitor combined with radiation therapy is a
compound of Formula (IV), or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is THZ5-31-1, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is a compound of Formulae (II), (III), (V), (VI), (VII),
(VIII), (IX), (X), (XI), (XII), (XIII), (XIV), (XV), (XVI), (XVII),
or (XVIII), or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is a cyclin-dependent kinase (CDK) inhibitor (e.g., CDK1,
CDK2, CDK3, CDK4, CDK5, CDK6, CDK7, CDK8, CDK9, CDK10, CDK11, or
CDK12 inhibitor), or a or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is E9, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is YKL-01-116, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is dinaciclib, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is DCA, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is palbociclib, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is JQ1, or a pharmaceutically acceptable salt, solvate,
hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof. In certain
embodiments, the transcription inhibitor combined with radiation
therapy is a CDK inhibitor, such as AT7519M, P1446A-05, AG-024322,
(R)-roscovitine, P276-00, SNS-032, LEE011, PD 0332991, GT28-01, NSC
638850, aminopurvalanol A, arcyriaflavin A, AZD 5438, (R)--CR8,
(R)-DRF053, dihydrochloride, flavopiridol, 10Z-hymenialdisine,
irdirubin-3'-oxime, kenpaullone, NSC 625987, NSC 663284, NSC
693868, NU 2058, NU 6140, olomoucine, PHA 767491, purvalanol A,
purvalanol B, RO 3306, ryuvidine, senexin A, SNS 032, SU 9516, or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, the
transcription inhibitor combined with radiation therapy is a CDK
inhibitor, such as p16 protein, p15 protein, p18 protein, p19
protein, p21/WAF1 protein, p27 protein, or p57 protein. In certain
embodiments, the transcription inhibitor is a
bromodomain-containing protein inhibitor, such as I-BET 151, I-BET
762, OTX-015, TEN-010, CPI-203, CPI-0610, RVX-208, LY294002,
BMS-986158, GSK525762, or a pharmaceutically acceptable salt,
solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer,
isotopically labeled derivative, or prodrug thereof.
[0725] Radiation therapy includes external beam radiation therapy,
brachytherapy, and administration of a radioisotope-containing
agent (e.g., by infusion or ingestion). The dose of radiation
depends on numerous factors as is well known in the art. Such
factors include the organ being treated, the healthy organs in the
path of the radiation that might inadvertently be adversely
affected, the tolerance of the patient for radiation therapy, and
the area of the body in need of treatment. The dose will typically
be between 1 Gy and 100 Gy, and more particularly between 2 Gy and
80 Gy. It should be emphasized, however, that the methods described
herein are not limited to any particular dose. The dose will be
determined by the treating physician in accordance with the
particular factors in a given situation, including the factors
mentioned above. In some embodiments, the dose is between 1 Gy and
100 Gy, 2 Gy and 80 Gy, 5 Gy and 60 Gy, or 10 and 50 Gy.
[0726] In certain embodiments, the combination of administering the
transcription inhibitor, or pharmaceutical composition thereof, and
radiation therapy is synergistic in treating a proliferative
disease, compared to treatment with transcription inhibitor, or
pharmaceutical composition thereof, alone, or compared to treatment
with radiation therapy alone. The combination of transcription
inhibitor and radiation may be useful in treating proliferative
diseases that are resistant to transcription inhibitor alone or
radiation alone. The combination of transcription inhibitor and
radiation may be useful in treating a subject with a proliferative
disease that has failed therapy of the proliferative disease with
transcription inhibitor alone or radiation alone. The transcription
inhibitors and radiation therapy may be administered at the same
time or administered separately at different times in any order. In
some embodiments, the transcription inhibitor is administered
before radiation therapy. In some embodiments, the transcription
inhibitor is administered after radiation therapy. In some
embodiments, the transcription inhibitor is administered
concurrently with radiation therapy, e.g., on the same day. In some
embodiments, the transcription inhibitor and radiation therapy are
administered on an alternating basis, e.g., inhibitors one day and
radiation therapy the next and so on.
[0727] The combination therapy with transcription inhibitor and
radiation therapy (or transcription inhibitor, kinase inhibitor and
radiation therapy) may be used to treat any proliferative disease.
In certain embodiments, the proliferative disease is cancer. In
certain embodiments, the cancer is a cancer that is commonly
treated with radiation therapy. In some embodiments, the cancer is
a cancer of the head, neck, or throat. In some embodiments, the
cancer is head and neck cancer (e.g., head and neck squamous cell
carcinoma). In some embodiments, the cancer is tongue cancer (e.g.,
tongue squamous cell carcinoma). In some embodiments, the cancer is
hypopharyngeal cancer (e.g., hypopharyngeal squamous cell
carcinoma). In some embodiments, the cancer is laryngeal cancer. In
some embodiments, the cancer is nasopharyngeal cancer. In some
embodiments, the cancer is lip cancer or oral cavity cancer (e.g.,
oral squamous cell carcinoma). In some embodiments, the cancer is
metastatic squamous neck cancer. In some embodiments, the cancer is
oropharyngeal cancer. In some embodiments, the cancer is paranasal
sinus cancer or nasal cavity cancer. In some embodiments, the
cancer is salivary gland cancer. In some embodiments, the cancer is
thyroid cancer. In some embodiments, the cancer is parathyroid
cancer. In some embodiments, the cancer is thyroid cancer. In some
embodiments, the cancer is brain cancer (e.g., meningioma,
glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma),
medulloblastoma).
EXAMPLES
[0728] In order that the present disclosure may be more fully
understood, the following examples are set forth. The synthetic and
biological examples described in this application are offered to
illustrate the transcription inhibitors, kinase inhibitors,
pharmaceutical compositions, and methods provided herein and are
not to be construed in any way as limiting their scope.
Preparation of the Transcription Inhibitors and Kinase Inhibitors
Described Herein
[0729] The transcription inhibitors and kinase inhibitors provided
herein can be prepared from readily available starting materials
using the methods and procedures known in the art, for example,
methods and procedures described in international PCT Application
Publications, WO 2014/063068 and WO 2015/013635; international PCT
Applications, PCT/US2014/061232, PCT/US2015/014109,
PCT/US2015/014044, PCT/US2015/014039, and PCT/US2015/014120; U.S.
Patent Application Publication, US 2013/0184264; and U.S.
Provisional Patent Application, U.S. Ser. No. 61/892,842; each of
which is incorporated herein by reference in its entirety. Where
typical or preferred process conditions (e.g., reaction
temperatures, times, mole ratios of reactants, solvents, pressures)
are given, other process conditions can also be used unless
otherwise stated. Optimum reaction conditions may vary with the
particular reactants or solvents used, but such conditions can be
determined by those skilled in the art by routine optimization
procedures.
Biological Assays
[0730] Acquired drug resistance is a major factor limiting the
effectiveness of targeted therapies in cancer.sup.1-3. Resistance
often emerges following an initial period of drug responsiveness
lasting several months through clonal evolution of the cancer cell
population. This may entail acquisition of treatment-refractory
mutations in the original target,.sup.11,12 bypass reactivation of
key downstream effectors of the targeted pathway,.sup.13,14
activation of alternative pathways,.sup.15,16 or cell state
changes,.sup.17 which render the cell population indifferent to the
original therapy. The emergence of acquired resistance is
facilitated by the rapid induction of a complex network of
pro-survival and pro-proliferative pathways upon exposure to
targeted therapy,.sup.5-7 collectively promoting the persistence of
a fraction of the original population in a drug-tolerant
state.sup.4 and leading to the eventual outgrowth of resistant
clones.
[0731] Repression of the transcriptional changes induced by
targeted therapy may interfere with the adaptive pro-survival and
pro-proliferative responses, and hence, with the establishment of
the drug tolerant state, leading to improved therapeutic efficacy.
This would be advantageous clinically as it would circumvent having
to anticipate, elucidate, and target the myriad of potential drug
resistance mechanisms that might arise in a particular patient.
THZ1 is an exemplary transcriptional repressor that is a covalent
CDK7 inhibitor, and additionally targets CDK12 at higher
doses..sup.8 CDK7 is a key regulator of the cell cycle,.sup.18-20
and together with CDK12, regulates RNA polymerase II
(RNAPII)-mediated transcription..sup.21-25
[0732] To determine whether THZ1 can suppress the emergence of
resistant cell populations, colony formation assays were performed
in vitro in human RT112 bladder carcinoma cells (FGFR3-dependent)
treated with vehicle, a clinically-relevant FGFR inhibitor, BGJ398,
THZ1, or BGJ398 in combination with THZ1 (FIGS. 49A, 49B, and 52).
RT112 cells are known to rapidly develop resistance to FGFR
inhibitors,.sup.15 thereby providing a suitable model for assessing
the effect of THZ1 on resistance emergence. At four weeks, colony
formation with THZ1 or BGJ398 was comparable to control.
Combination treatment however, yielded few, or no, colonies
depending on the dose of THZ1 used (FIGS. 49A, 49B, 55A, and 55B).
Findings were confirmed in an additional FGFR-dependent model
(NCI-H2077, a non-small cell lung cancer (NSCLC) cell line
dependent on amplified FGFR1) (FIGS. 52, 53A, and 53B) and extended
to additional well-established oncogene-dependency models,
including two EGFR-dependent NSCLC models (PC9, NCI-H1975), a
HER2-dependent esophageal carcinoma model (OE19), and an
ALK-dependent NSCLC model (NCI93 H3122) (FIGS. 49A, 49B, 52, 53A,
and 53B). We observed an equally striking effect when treating with
THZ1 in combination with a MEK-inhibitor (GSK1120212; trametinib)
in three NSCLC KRAS-mutant cellular models (A549, NCI96 H23,
NCI-H1792) (FIGS. 49D, 49E, and 52). Combination treatment
significantly enhanced cell death compared to either single agent
alone (FIGS. 49C, 49F, and 52C) in the majority of cell lines.
Taken together these data suggest that THZ1 broadly has the ability
to prevent resistance emergence in diverse genetic contexts and
lineages.
[0733] These results were compared with one of the current
prominent approaches to address resistance, namely rational
combination therapy employing two or more kinase inhibitors to
simultaneously target both the driver-oncogene and previously
identified resistance mechanisms..sup.3,26-28 We tested rational
combination therapies in RT112 and in PC9 cells, using BGJ398 and
erlotinib respectively, in combination with agents targeting known
resistance mechanisms for these cell lines (pan-ERBB inhibitor,
AZD8931; MEK inhibitor, trametinib; pan-PI3K inhibitor, BKM120; and
FGFR inhibitor, BGJ398). Rational combination therapy decreased the
proportion of cells surviving acute treatment at 96 hours (FIG.
53D), and reduced the outgrowth of resistant clones with variable
success at four weeks (FIG. 53E). Nevertheless, drug resistance
eventually developed for these rational combinations (FIG. 53E),
suggesting that the addition of THZ1 to targeted therapy is able to
suppress resistance emergence to a greater degree compared to
rational targeted combination approaches.
[0734] To determine whether CDK7 and/or CDK12 depletion mimics the
effects of THZ1, CDK7 and CDK12-deficient PC9 cells were generated
using CRISPR-Cas gene editing (FIGS. 54A and 54B). Both CDK7 and
CDK12-deficient PC9 cells displayed enhanced sensitivity to
erlotinib at 48 hours as compared to PC9 cells with a control RNA
guide (CDK7_12_dummy). CDK12 depletion, however, had more modest
effects (FIG. 54C). Colony formation assays were also performed
with the CDK7 and 12-deficient PC9 cells. The cytotoxicity of CDK7
or CDK12 depletion, however, prevented long-term experiments. To
consider whether inhibition of the cell cycle contributes to the
activity of THZ1 additional colony formation assays were performed
with palbociclib, a CDK4/6 inhibitor and potent antagonist of the
cell cycle..sup.29 Palbociclib showed a more modest effect compared
to THZ1, suggesting that the effect of THZ1 is not mediated by
inhibition of the cell cycle alone (FIGS. 55B and 55D). JQ1.sup.30
was also tested. JQ1 is a transcriptional inhibitor that exerts its
effects by inhibition of BRD4, a factor that indirectly promotes
RNAPII phosphorylation and transcription. JQ1 has been shown to
enhance sensitivity to lapatinib in HER-2 dependent models.31 JQ1
did not enhance sensitivity to erlotinib in PC9 cells, however did
enhance sensitivity to BGJ398 in RT112, although less so than THZ1
(FIGS. 55B and 55D).
[0735] To assess the efficacy and toxicity of targeted therapy in
combination with THZ1 in vivo, xenograft studies were performed
using cell-line models of FGFR (RT112), EGFR (PC9), and KRAS mutant
(NCI-H23) carcinomas (FIGS. 50A and 56). Tumor bearing mice were
treated with a) vehicle, b) BGJ398 (RT112), erlotinib (PC9) or
trametinib (NCI-H23), c) THZ1, or d) combination treatment with the
appropriate targeted therapy and THZ1. THZ1 in combination with
targeted therapy retarded tumor growth compared to THZ1 or targeted
therapy alone (FIGS. 56A, 56B, and 56D), and significantly improved
survival (FIGS. 50A and 56C). Importantly, combination therapy was
well tolerated, with no weight loss or behavioral changes
observed.
[0736] In addition, THZ1 was tested in combination with the
covalent T790M-mutant-EGFR selective inhibitor WZ4002,.sup.32 in a
novel EGFR-T790M-L858R.sup.LSL/-; p53-R172H.sup.LSL/- (TLP)
genetically-engineered mouse model (GEMM) of NSCLC (FIG. 50B). This
autochthonous preclinical model more closely mimics the stochastic
nature of cancer progression and the tumor microenvironment in
human NSCLC, as compared to xenograft models; p53 mutations are
found in 38% of EGFR-mutant NSCLC and are associated with more
advanced, aggressive disease..sup.33 Upon detectable tumor-burden
by Magnetic Resonance Imaging (MRI) mice were randomized into
treatment groups (FIG. 50B). Thereafter tumor growth was evaluated
by MRI biweekly. Treatment with WZ4002 resulted in initial response
at two weeks (p=0.0117, two-tailed t-test), however tumors rapidly
developed resistance and rebounded by four weeks, reaching
end-stage disease by five weeks of treatment, emphasizing the
aggressive nature of this EGFR-mutant, p53-mutant GEMM. In stark
contrast, combined THZ1-WZ4002 treatment, resulted in a dramatic
response with extensive long-term tumor regression (FIGS. 50C and
50D). Mice in the combination arms continued to have significant
tumor regression at 14 weeks of treatment (FIG. 50C). Furthermore,
combination-treated mice had 100% survival vs. 0% survival for
single-agent treated mice at 14 weeks (p=0.0019, log-rank test)
(FIG. 50E). Consistent with xenograft studies, no overt toxicity
was evident in the combination-treated animals despite long-term
treatment.
[0737] To investigate the mechanisms by which THZ1 may suppress
resistance emergence, THZ1 was evaluated for whether it blocks the
adaptive response to targeted therapy by examining gene expression
by RNAseq, global enhancer status by H3K27Ac ChIP-seq and
immunoblotting of core signaling molecules with described roles in
adaptive responses to cancer therapies in RT112 and PC9 cells. For
the RNAseq experiments RT112 and PC9 cells were treated with BGJ398
and erlotinib, respectively, for one or seven days, alone or in
combination with THZ1. Consistent with prior work.sup.5,6 targeted
therapy up-regulated the expression of genes involved in
pro-survival programs, including NF--KB and STAT171 driven
transcription programs, which were maintained in the drug tolerant
population at seven days (FIG. 51A). In addition, both cell lines
exhibited downregulation of negative regulators of the MAPK
pathway, such as DUSP and SPRY family members (FIG. 51A). Both cell
lines furthermore had FRA1 (FOSL1) downregulation consistent with
activation of the previously described tumor secretome,.sup.7 and
upregulation of stemness factors, such as WNT/Hedgehog family
members in RT112, and ALDH1A and CD38 in PC9. Downregulation of
cell cycle genes and upregulation of cell senescence programs in
these cells further suggested transition to a quiescent cell state
(FIG. 51A). Gene Ontology analysis and upstream regulator analysis
of gene expression profiles further corroborated the involvement of
these transcriptional programs (FIG. 57). Importantly, the specific
genes altered were generally distinct between the two cell lines,
but highlighted programs serving similar functions. These programs
have previously been implicated in
drug-resistance..sup.5-7,34-36
[0738] Consistent with these transcriptional changes it was found
that targeted therapy increased STAT1 phosphorylation in RT112 and
PC9, as well as STAT3 phosphorylation in PC9
cells, and decreased FRA1 protein levels in both lines (FIG. 51B).
Similar findings were obtained in two KRAS-dependent lines, A549
and H23 (FIG. 58A). Luminex-based cytokine analysis further
supported the activation of STAT3, as IL-6, a key factor in the
NF-.kappa.B/STAT3-mediated adaptive response to erlotinib,.sup.5,6
significantly increased in cell culture supernatants with erlotinib
treatment (FIG. 58B). These results were confirmed using IL-6 ELISA
(FIG. 51C). Also tested was the hypothesis that FRA1-deficient PC9
cells would parallel the erlotinib-induced tumor secretome and thus
have an increase in IL-6 levels. Indeed, CRISPR depletion of FRA1
in PC9 cells led to elevated IL-6 levels, compared to parental
cells, as shown by RT-PCR (FIG. 58D) and ELISA (FIG. 51C).
[0739] The addition of THZ1 to targeted therapy suppressed the
increase in IL-6 levels in PC9 cells (FIG. 51C). THZ1 furthermore
blocked ERBB2 activation in RT112 cells and FGFR activation in PC9
cells (FIG. 51B). This additionally suggests repression of secreted
growth factors, as PC9 has previously been shown to secrete
fibroblast growth factors in response to erlotinib as an acute
survival mechanism.sup.5 and to switch dependencies from EGFR to
FGFR as a resistance mechanism..sup.37 Similarly, in RT112,
resistance has been associated with a converse switch from FGFR to
ERBB2/3 via NRG secretion..sup.15 THZ1 however, did not affect the
phosphorylation status of STAT3, nor did it restore FRA1 levels,
suggesting that THZ1 may be acting downstream of these factors.
Interestingly, however, the addition of THZ1 to targeted therapy
blocked STAT1 phosphorylation.
[0740] The effect of THZ1 on AKT and ERK activation was also
explored. Combination treatment with THZ1 and targeted therapy
resulted in enhanced ERK suppression in all cell lines tested
(FIGS. 51B and 58A). Combination treatment also inhibited ERK
activation in FRA1-deficient PC9 cells (FIG. 58E). These data,
along with the finding that MAPK pathway repressors (e.g., DUSPs,
SPRYs) are downregulated with targeted therapy (FIG. 51A), suggests
that the transcriptional reprogramming engaged by targeted therapy
alone may converge on MAPK reactivation. It further suggests that
repression of this transcriptional reprogramming by THZ1 results in
more complete ERK inhibition.
[0741] The effect of THZ1 on the transcriptional programs engaged
by targeted therapy alone was also examined, and it was found that
THZ1 led to an attenuation of these programs (FIG. 51D). This
attenuation was present early on (24 hours), and was more profound
at seven days (FIG. 51D). RT112 transcripts that were
differentially expressed with combination treatment compared to
targeted therapy alone included genes implicated in the
NF-.kappa.B/STAT pathway (e.g., IGFBP5, TNFSF10, MX1, MX2) (FIG.
51E), suggesting that THZ1 may be directly interfering with the
transcription of NF-.kappa.B/STAT target genes. Similar results
were obtained in PC9 (FIG. 51E). A number of stemness-associated
genes were, similarly, downregulated in the presence of THZ1 (FIG.
51E), suggesting that THZ1 may be preventing a cell-state change to
a more drug-resistant phenotype. In line with the greater ERK
inhibition noted with THZ1 in combination with targeted therapy, it
was observed that negative regulators of the MAPK were more highly
expressed in the presence of THZ1 (FIG. 51E).
[0742] Given that tumor cells acquire enhancers and super-enhancers
at genes that control tumor cell identity,.sup.38-41 and that THZ1
has been shown to disproportionally affect super enhancer driven
transcription,.sup.8-10 it was examined whether the targeted
therapy-induced transcriptional activation of signaling pathways,
such as NF-.kappa.B/STAT, coincided with changes in the enhancer
landscape. Indeed, ChIP-Seq targeting a mark of active enhancers,
H3K27Ac,.sup.42 following seven days of treatment with targeted
therapy, showed changes in the enhancer landscape, which paralleled
differences in gene expression (FIGS. 51F, 51G, 51H, and 58F).
Specifically, genes whose expression was increased after targeted
therapy showed a concurrent increase in H3K27Ac signal at their
associated enhancers leading to the formation of larger enhancers
and super-enhancers (FIGS. 51F, 51H, and 58F). Genes gaining both
enhancer signal and expression showed a relative lack of
upregulation with combination therapy as compared to targeted
therapy alone, consistent with THZ1 interfering with the adaptive
up-regulation of targeted therapy-induced transcriptional programs
(FIG. 51G). Thus, the changes observed in gene expression can be,
at least in part, explained by the changes in enhancer landscape,
suggesting that THZ1 may impinge on the ability of tumor cells to
evolve enhancers that allow them to escape tyrosine kinase
inhibition.
Preparation of Cell Lines.
[0743] PC9, RT112, NCI-H3122, OE19, NCI-H2077, NCI-H1975, A549,
NCI-H23, NCI-H1792 were cultured in RPMI media, supplemented with
10% FBS, and penicillin/streptomycin/L-glutamine. All cell lines
were cultured at 37.degree. C. in a humidified chamber in the
presence of 5% CO.sub.2. Cell lines were obtained from ATCC and not
further authenticated. PC9 and RT112 were additionally mycoplasma
tested and negative.
Cell Viability Assays.
[0744] 1500 cells were seeded in 96-well plates, allowed to adhere
overnight, and then incubated with media containing vehicle or drug
as indicated for 96 hours. Following 96 hours, cell viability was
assessed using the CellTiter-Glo Luminescent Cell Viability assay
(Promega). Plates were read on a Tecan Infinite M200 Pro plate
reader. All conditions were tested in triplicate, unless otherwise
noted. Drug curves and IC50 values were generated using GraphPad
Prism 6 (GraphPad Software).
Colony Formation Assays.
[0745] 100,000 cells were seeded in 6-well plates, allowed to
adhere overnight, and then incubated with media containing vehicle
or drug as indicated for 4 weeks. Media (and drug) were replaced
weekly. At 4 weeks plates were, fixed with 1% paraformaldehyde, and
then stained with 0.1% crystal violet as previously described
(medicine.yale.edu/lab/kim/resources/protocols/cell/crystal_violet_stain.-
aspx) to assess colony formation. Results were quantified using an
ImageJ Colony Area PlugIn..sup.44
Apoptosis/Cell Death Analysis.
[0746] 100,000 cells were seeded in 6-well plates, allowed to
adhere overnight, and then incubated with media containing vehicle
or drug as indicated for 24 or 48 hours. Cell death was quantified
using the Alexa Fluor 488 Annexin V/Dead Cell Apoptosis kit for
flow cytometry (Invitrogen), according to the manufacturer's
protocol. All conditions were assayed in triplicate. Data were
acquired using a BD LSRFortessa X-20 (BD Biosciences), and analyzed
in FlowJo.
Xenograft Tumor Studies.
[0747] RT112, PC9, H23 and A549 xenograft models were established
by subcutanoues (s.c.) injection of 2.times.10.sup.6 cells in
Matrigel (Corning) into both flanks of nude mice (NU/NU, #088
Charles River) when animals were 8-10 weeks of age. When tumors
reached between 100-200 mm.sup.3, as measured by caliper, mice were
randomized to four groups of five female mice each, for each cell
line: 1) vehicle, 2) BGJ398 (RT112), erlotinib (PC9) or trametinib
(H23, A549), 3) THZ1, or 4) combination treatment with THZ1 plus
BGJ398 (RT112), erlotinib (PC9) or trametinib (H23, A549).
Investigators were not blinded to group allocation. The following
dosing regimens were employed: BGJ398 15 mg/kg once daily (QD) by
oral gavage, erlotinib 25 mg/kg QD by oral gavage, trametinib 2.5
mg/kg QD by oral gavage, and THZ1 10 mg/kg twice daily (BID) by
intraperitoneal (i.p.) injection. Caliper measurements were then
performed weekly and continued for eight weeks. A549 xenografts had
severe ulcerations therefore were excluded from the study. H23
xenografts had one mouse in the trametinib-treated group that was
censored at week 4, and two in the combination-treated group
censored at weeks 6 and 7, due to ulcerations.
Genetically-Engineered EGFR-p53-Mutant NSCLC 660 Mouse Model.
[0748] Mice (both male and female) bred to contain conditional
EGFR-T790M-L858R lox-stop-lox (LSL) allele and the p53-dominant
negative R172H LSL allele to a final genotype of
EGFR-T790M-L858R.sup.LSL/-; p53-R172H.sup.LSL/- maintained on a
mixed background, were induced at 6 weeks of age with
Adenovirus-Cre recombinase by intranasal administration.sup.45 to
allow for mediated recombination of lox-stop-lox modified
mutant-EGFR and p53 alleles. Upon clinical signs of disease,
magnetic resonance imaging (MRI) was performed to establish
pre-treatment tumor burden in the lungs (generally 16-20 weeks of
age). Mice were imaged using a 7 Tesla BioSpec (Bruker Biospin)
optimized for image requisition of pulmonary parenchyma and vessels
in mice. Animals were anesthetized with 2% isoflurane IsoFlo;
Abbott) in 100% oxygen via a nose cone. Respiratory and cardiac
gating was applied to minimize motion artifacts during imaging. 24
slices (1 mm) were collected. Tumor volume per animal was
quantified manually, based on a minimum of eight consecutive axial
image sequences, using the 3D Slicer. Upon determination of the
pre-treatment volume, mice were randomized into treatment groups as
follows: 1) vehicle, 2) WZ4002 (covalent T790M-mutant-EGFR
selective inhibitor, 50 mg/kg QD by oral gavage) 3) THZ1 (10 mg/kg,
BID, i.p.) or 4) THZ1+WZ4002. Investigators were not blinded to
group allocation. Mice were imaged biweekly by MRI until end-stage
disease to determine tumor volume. Mice weights and signs of
toxicity were monitored daily during the course of treatment.
End-stage disease was reached when animals acquired clinical
symptoms secondary to their lung tumors, in accordance with Dana
Farber Cancer Institute Animal Care and Use Committee
regulations.
RNA-Seq Analysis.
[0749] RNA was isolated from untreated RT112 cells and RT112 cells
treated with 1 .mu.M BGJ398, 100 nM THZ1, or combination treatment
with THZ1 plus BGJ398, and similarly, untreated PC9 cells and PC9
cells treated with 1 .mu.M erlotinib, 100 nM THZ1, or THZ1 plus
erlotinib. Both cell lines were harvested at two time-points:
following one day or seven days of treatment. Cell number was
determined and total RNA was isolated using the RNeasy micro kit
(Qiagen). Ambion.RTM. ERCC RNA Spike-In Mix (Life technology) was
added to total RNA. cDNA libraries were prepared using the
NEBNext.RTM. Ultra.TM. RNA Library Prep Kit for Illumina (New
England Biolabs) according to the manufacturer's instructions.
Library integrity was assessed on an Agilent 2100 Bioanalyzer
(Agilent). Sequencing was performed on the Hiseq 2000 platform
(Illumina) to a minimum depth of 30 million reads per sample.
[0750] QC-passed reads were aligned to the human reference genome
(hg19) using PRADA..sup.46 Transcript per million (TPM) values were
determined using RSEM..sup.47 TPM values were normalized with the
voom transformation..sup.48 Expression changes for each gene in
treated cells compared to untreated controls was determined using
the limma package.sup.49 as log 2-transformed fold change and a
multiple-testing adjusted p-value. Heatmap visualization was
performed using R. Log 2-transformed fold changes were not scaled
and were colored on a blue-red scale.
[0751] Differentially expressed genes (defined as log 2-fold change
value greater than 1.5 or less than -1.5, and p-value less than
0.01) were input into Ingenuity Pathway Analysis
(www.ingenuity.com), to identify a) enriched pathways, 2) upstream
regulators, andd 3) downstream effectors. Pathways were considered
significantly enriched if the multiple-testing adjusted p-value of
enrichment was less than [0.1]. We considered an activation z-score
of greater than [2] to be activated, and less than [-2] to be
inhibited. Gene ontology term (GO-term) enrichment analysis was
performed using the Database for Annotation, Visualization and
Integrated Discovery (DAVID) v6.7 (david.abcc.ncifcrf.gov/).
Chromatin Immunoprecipitation.
[0752] RT112 and PC9 cells treated for seven days with vehicle, 1
.mu.M BGJ398 and erlotinib (respectively), 100 nM THZ1, or
BGJ398/erlotinib in combination with THZ1. H3K27Ac ChIP-Seq was
performed using Abcam antibody (cat# AB4729, lot#GR183922-1) as
previously described,.sup.8 with minor modifications (cells were
crosslinked for 20 min, Dynal magnetic beads (Sigma) were bound
with 10 .mu.g of the indicated antibody).
ChIP-Seq Analysis.
[0753] Illumina sequencing libraries were generated and data was
processed as described elsewhere..sup.50 In brief, libraries were
generated for ChIP samples following the Illumina TruSeq.TM. DNA
Sample Preparation v2 kit protocol with minor changes. All ChIP-Seq
data sets were aligned using bowtie 1.0.1 to build NCBI36/hg19 of
the human genome with -p 4 --best -k 2 -m 2 --sam -1 40. Wiggle
files for gene tracks were created using Macs 1.4.2 with options -w
-S -space=50 to count reads in 50 bp bins. These were divided by
the number of treatment reads to normalize to mapped-reads-per
million, and were displayed in the UCSC genome browser.
[0754] Regions enriched in H3K27Ac were identified using
SICER.sup.51 with corresponding input DNA control, and parameters
-t 1 (max 1 read per position), -w 200 (window size 200), -i 150
(fragment size), -g 200 (gap size 200; 1 window), -t 0.74
(interrogable genome fraction), -e 200 (e-value), -p 1e-9
(significance p value cutoff). H3K27Ac islands were associated with
the single RefSeq transcript whose transcription start site was
nearest the center of the island. RefSeq transcripts were converted
to Ensembl gene IDs for ChIP-seq vs. expression analysis using
Ensembl BioMart. Super-enhancers were identified using SICER
islands as input enhancers for the ROSE super-enhancer-identifying
algorithm (github.com/BradnerLab/pipeline) with input DNA control
parameters -s 12500 -t 1000. 0
[0755] Density of H3K27Ac ChIP-Seq signal (FIG. 51F) was calculated
using bamToGFF (github.com/BradnerLab/pipeline). Islands of H3K27Ac
identified in RT112 BGJ398-treated cells or PC9 erlotinib-treated
cells were treated as one bin (-m 1), reads were extended to be 200
bp (default) and the reads-per-million (-r) normalized density (-d)
of reads was calculated therein.
Cytokine and ELISA Assays.
[0756] A Luminex Multiplex Custom Cytokine assay was used to assay
cytokines in RT112 and PC9 cell culture supernatants treated with
vehicle, 1 .mu.M BGJ398 or erlotinib respectively, 100 nM THZ1, or
THZ1 in combination with BGJ398 or erlotinib, at 24 and 72 hours.
Cytokines assayed for were: CCL2/MCP-1, CCL5/RANTES, CXLC5, IL-1
alpha and beta, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-17a,
GM-CSF, TNF-alpha, VEGF, INF-gamma. IL-6 was also assayed in cell
culture supernatants using the Quantikine IL-6 ELISA kit (D6050,
R&D Systems) as per the manufacturer's protocol.
Immunoblotting.
[0757] Cells were lysed in RIPA buffer (Roche) containing protease
inhibitors (Roche) and Phosphatase Inhibitor Cocktails I and II
(CalBioChem). Protein concentrations were determined using a
Bradford assay (Bio-Rad). Proteins were separated by SDS gel
electrophoresis using NuPAGE 4-12% Bis-Tris gels (Life
Technologies) in MOPS buffer. Resolved protein was transferred to
nitrocellulose membranes, blocked in 10% milk and probed with
primary antibodies recognizing EGFR (2232S), p-EGFR (2234S), FGFR3
(4574S), p-FGFR (3471S), HER2/ERBB2 (2165), p-ERBB2 (2243S), STAT1
(9172), p-STAT1 (9167), STAT3 (4904S), p-STAT3 (9145S), AKT
(9272S), p-AKT (4060P), ERK (4695S), p-ERK (4370S), FRA1 (5281S),
CDK12 (11973) (all from Cell Signaling Technology), CDK7 (sc-723,
Santa Cruz), actin (A5441, Sigma-Aldrich) and vinculin (V9131,
Sigma-Aldrich) in 5% milk or 3% bovine serum albumin as recommended
by the manufacturer. After incubation with the appropriate
secondary antibody (Pierce anti-mouse IgG/IgM (31444, Thermo
Scientific) and anti-rabbit IgG (31460, Thermo Scientific)), blots
were imaged on film.
CRISPR-CAS.
[0758] Target sequences for CRISPR interference were designed using
the sgRNA designer
(www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design)
and CRISPR Design tool (crispr.mit.edu), provided by the Broad
Institute, MIT and Feng Zhang lab, MIT, respectively. Off-target
effects were considered using www.genome-engineering.org. A
non-targeting sgRNA from the Gecko library v2 was used as a dummy
sgRNA for control..sup.52
[0759] Sequences were as follows:
TABLE-US-00003 dummy guide: (SEQ ID NO: 1) ATCGTTTCGCTTAACGGCG CDK7
sgRNA#1: (SEQ ID NO: 2) TGTGATGCAAAGGTATTCCA CDK7 sgRNA#2: (SEQ ID
NO: 3) ATACACATCAGGTTGTAACC CDK7 sgRNA#3: (SEQ ID NO: 4)
TGAGAAGCTGGACTTCCTTG CDK12 sgRNA#1: (SEQ ID NO: 5)
GCTTGTGCTTCGATACCAAG CDK12 sgRNA #2: (SEQ ID NO: 6)
GCTCCCAGACTGGAATTAAG CDK12 sgRNA #3: (SEQ ID NO: 7)
GTAGGAGTCATAATTGCTCG FRA1 sgRNA #1: (SEQ ID NO: 8)
TATTCCTTAGAAGTTCCACC FRA1 sgRNA #3: (SEQ ID NO: 9)
TCACCCCCAGATCAGCCCGG
[0760] Lenti CRISPRv2 vectors were cloned as previously
described..sup.52,53 Briefly, HEK-293T cells were transduced with
lentiCRISPRv2 using X-treme Gene 9 (Roche) according to the
manufacturer's instructions. On day 2, PC9 cells were seeded, and
allowed to adhere overnight. On day 3 the supernatant of transduced
HEK293T cells was collected and added to the PC9 cells through a
0.45 .mu.m filter. Supernatant from transduced HEK293T cells was
again collected and added to PC9 cells on day 4. On day 5,
puromycin (1 mg/ml) was added to select infected cells (for four
days).
RT-PCR.
[0761] Total cellular RNA was isolated from cells using an RNeasy
Mini Ki (Qiagen) and 1.0 .mu.g was then reverse transcribed to cDNA
using the High Capacity RNA to c-DNA kit (Life Technologies).
Quantitative PCR reactions were performed on an ABI Prism 7300
platform (Life Technologies). CDK7 expression was checked using the
following forward primer: 5'-GGGACAGTTTGCCACCGTTT-3' (SEQ ID NO:
10) and reverse primer: 5'-ATGTCCAAAAGCATCAAGGAGAC-3' (SEQ ID NO:
11). CDK12 expression was checked using the following forward
primer: 5'-GAGGAGGCAGCAGAGAAGAG-3' (SEQ ID NO: 12) and reverse
primer: 5'-TAAAAGTTGCAGCAAGGCGG-3' (SEQ ID NO: 13). CDK7 and CDK12
primers were designed using Primer 3 software. IL-6 expression was
checked using the following forward primer:
5'-AATAACCACCCCTGACCCAAC-3' (SEQ ID NO: 14), and reverse primer:
5'-ACATTTGCCGAAGAGCCCT-3' (SEQ ID NO: 15)..sup.54 Relative gene
expression was normalized to human glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) using the following forward primer:
5'-TTAGGAAAGCCTGCCGGTGACTAA-3' (SEQ ID NO: 16) and reverse primer:
5'-AAAGCATCACCC GGAGGAGAAATC-3' (SEQ ID NO: 17)..sup.55
Statistical Analysis.
[0762] Data are expressed as mean+/-standard deviation. Statistical
significance was determined using Student's t-test. For survival
analyses log-rank test (Mantel-Cox) was used. Statistical analyses
were performed in Prism 6 (GraphPad Software). Significance was set
at p=0.05.
[0763] The cells used in the following in vitro experiments fell
broadly into three categories: the TKI sensitive, rapidly adaptive
(less than two weeks) cells, which included RT 112 cells (bladder,
FGFR3 amplified and with FGFR3-TACC3 fusion); the TKI sensitive,
intermediately adaptive (approximately four weeks or longer)
category, which contained the following cell lines: PC9 (NSCLC,
EGFR exon 19 deletion), H2077 (NSCLC, FGFR1 amplified), OE-19
(esophageal, HER-2 amplified), and H3122 (NSCLC, EML4-ALK fusion);
and the MEK/M inhibition sensitive (less TKI sensitive/insensitive
than the other categories), which included the following: HSC-4
(HNSCC; co-dominant drivers), YD-8 (HNSCC; co-dominant drivers),
and A549, H23, and H1792 (the latter three which are NSCLC KRAS
mutant lines).
[0764] The OE-19 (HER2-dependent) and H3122 (ALK-dependent) cell
lines showed similar results to those of the RT112, PC9, and H2077
cell lines.
[0765] The RNAseq libraries for PC9 and RT112 are complete. PC9 has
been treated for 24 hours with the following: erlotinib, THZ1,
erlotinib and THZ1, and DMSO. After 24 hours the effects of BGJ398
versus THZ1 versus the combination of the two versus DMSO in RT 112
cells were examined.
[0766] E9, a CDK12 inhibitor, works as well as THZ1. Dinaciclib was
also found to be very potent, both alone and in combination with
BGJ398 in RT112 cells. In comparison, DCA and JQ1 showed modest
results, even in combination, in RT112 cells. A colony formation
assay with THZ5-31-1 and YKL-01-116 still need to be undertaken and
the compounds (at least JQ1) should be screened in an additional
test.
Quantification of the Replicates at 24 and 48 Hours
[0767] In PC9 cells treated with erlotinib, THZ1, erlotinib and
THZ1 ("combination treatment"), or untreated, there are
statistically significant increases in the combination treatment
group as compared to erlotinib alone or THZ alone (FIG. 37). This
difference is even more pronounced after 48 hours of treatment
(FIG. 37). The same trend is found in RT112 cells treated with
BGJ398 and THZ1 (FIG. 38) and A549 cells treated with GSK and THZ1
(FIG. 39).
Proliferation of Guides
[0768] For CDK7, guides 2, 3 and 5 showed the greatest effect on
proliferation, and for CDK12, guides 1, 3, and 5 had the strongest
effect on proliferation (FIG. 40). Under the same conditions used
in the initial apoptosis analysis, apoptosis with erlotinib and
erlotinib with the various guides for CDK7 and CDK12 was examined
(FIG. 41). The data is similar to the effect seen with THZ1, both
with the CDK7 CRISPR, and with the CDK12 CRISPR.
Xenograft Studies
[0769] The effects of the combination therapy were further studying
in vivo in a number of xenograft models. First, PC9, an
EGFR-dependent cell line, was used. There was a significant
increase in survival in the combination treatment group and in the
time to reach the maximum tumor volume (FIG. 42). The increase in
survival between the MEK inhibitor and the combination treatment
was not readily apparent until after week 7 (FIG. 42).
[0770] The therapy was next tested in a GEM model, which is also
dependent on EGFR, where the EGFR allele has two mutations: the
L858R mutation and T790M mutation. The mice receiving the
combination treatment showed lower tumor volume indices (tumor
volume normalized to pre-treatment volume) than the mice that
received THZ1 only or WZ4002 only at 2 weeks and 4 weeks (FIG.
43A). One mouse is doing particularly well 16 weeks into the
combination treatment (FIG. 43B).
Involved Signaling Pathways
[0771] Western blots were used to characterize the signaling
pathways in selected cell lines. The assays were performed at 24
hours under the following conditions: untreated, treated with 1
.mu.M erlotinib, treated with 100 nM THZ1, or treated with a
combination of erlotinib and THZ1, in PC9 and RT112 cells. These
doses were also used in the colony formation assays and the RNAseq
and ChlPseq experiments. It was observed that p-STAT3 increases
with erlotinib treatment, as expected based on what is disclosed in
Sharma et al., Cell, 2010, 141(1):69-80, and also that p-STAT3
levels were further increased with the combination (FIG. 44A). This
is somewhat true in RT112 cells as well, so THZ1 is not blocking
the activation of p-STAT3. However, it could be blocking the
activation of downstream STAT3 targets. With erlotinib treatment,
the activation of FGFR was also observed. FGFR is known to be a
bypass mechanism in PC9, but this was not seen with THZ1 treatment
or with the combination treatment. Similar findings were revealed
in RT 112 with ERBB2: with the combination treatment, the potential
bypass mechanism is blocked.--In addition, in both the PC9 and
RT112 cell lines, there was a decrease in p-ERK in the combination
treatment. Also, there is an increase in RNAPII phosphorylation
with THZ1 at this time point, while the combination treatment
yields a slight decrease. This is unexpected, given that THZ1
should block CDK7-mediated RNAPII phosphorylation. This may be due
to the dose or the time point assayed.
[0772] Two KRAS lines, A549 and H23 were also screened (FIG. 44B),
with similar results. p-STAT3 was increased with MEK inhibition and
further increased with dual treatment. These two lines were both
shown in Sharma et al. (Cell, 2010, 141(1):69-80) to employ the
STAT3 feedback loop. p-ERK was decreased in the combination
treatment arm. RNAPII phosphorylation was again increased with
THZ1. Therefore, there are some generalizable findings across the
four lines.
REFERENCES
[0773] 1. Ramos, P. & Bentires-Alj, M. Mechanism-based cancer
therapy: resistance to therapy, therapy for resistance. Oncogene,
doi:10.1038/onc.2014.314 (2014). [0774] 2. Housman, G. et al. Drug
resistance in cancer: an overview. Cancers 6, 1769-1792,
doi:10.3390/cancers6031769 (2014). [0775] 3. Holohan, C., Van
Schaeybroeck, S., Longley, D. B. & Johnston, P. G. Cancer drug
resistance: an evolving paradigm. Nature reviews. Cancer 13,
714-726, doi:10.1038/nrc3599 (2013). [0776] 4. Sharma, S. V. et al.
A chromatin-mediated reversible drug-tolerant state in cancer cell
subpopulations. Cell 141, 69-80, doi:10.1016/j.cell.2010.02.027
(2010). [0777] 5. Lee, H. J. et al. Drug resistance via feedback
activation of Stat3 in oncogene addicted cancer cells. Cancer cell
26, 207-221, doi:10.1016/j.ccr.2014.05.019 (2014). [0778] 6.
Blakely, C. M. et al. NF-kappaB-activating complex engaged in
response to EGFR oncogene inhibition drives tumor cell survival and
residual disease in lung cancer. Cell reports 11, 98-110,
doi:10.1016/j.celrep.2015.03.012 (2015). [0779] 7. Obenauf, A. C.
et al. Therapy-induced tumour secretomes promote resistance and
tumour progression. Nature 520, 368-372, doi:10.1038/naturel4336
(2015). [0780] 8. Kwiatkowski, N. et al. Targeting transcription
regulation in cancer with a covalent CDK7 inhibitor. Nature 511,
616-620, doi:10.1038/naturel3393 (2014). [0781] 9. Christensen, C.
L. et al. Targeting Transcriptional Addictions in Small Cell Lung
Cancer with a Covalent CDK7 Inhibitor. Cancer cell 26, 909-922,
doi:10.1016/j.ccell.2014.10.019 (2014). [0782] 10. Chipumuro, E. et
al. CDK7 inhibition suppresses super-enhancer-linked oncogenic
transcription in MYCN-driven cancer. Cell 159, 1126-1139,
doi:10.1016/j.cell.2014.10.024 (2014). [0783] 11. Chell, V. et al.
Tumour cell responses to new fibroblast growth factor receptor
tyrosine kinase inhibitors and identification of a gatekeeper
mutation in FGFR3 as a mechanism of acquired resistance. Oncogene
32, 3059-3070, doi:10.1038/onc.2012.319 (2013). [0784] 12. Yun, C.
H. et al. The T790M mutation in EGFR kinase causes drug resistance
by increasing the affinity for ATP. Proceedings of the National
Academy of Sciences of the United States of America 105, 2070-2075,
doi:10.1073/pnas.0709662105 (2008). [0785] 13. Wilson, T. R. et al.
Widespread potential for growth-factor-driven resistance to
anticancer kinase inhibitors. Nature 487, 505-509,
doi:10.1038/nature 11249 (2012). [0786] 14. Johannessen, C. M. et
al. A melanocyte lineage program confers resistance to MAP kinase
pathway inhibition. Nature 504, 138-142, doi:10.1038/nature12688
(2013). [0787] 15. Wang, J. et al. Ligand-associated ERBB2/3
activation confers acquired resistance to FGFR inhibition in
FGFR3-dependent cancer cells. Oncogene, doi:10.1038/onc.2014.161
(2014). [0788] 16. Pettazzoni, P. et al. Genetic events that limit
the efficacy of MEK and RTK inhibitor therapies in a mouse model of
KRAS-driven pancreatic cancer. Cancer research 75, 1091-1101,
doi:10.1158/0008-5472.CAN-14-1854 (2015). [0789] 17. Singh, A.
& Settleman, J. EMT, cancer stem cells and drug resistance: an
emerging axis of evil in the war on cancer. Oncogene 29, 4741-4751,
doi:10.1038/onc.2010.215 (2010). [0790] 18. Fisher, R. P. &
Morgan, D. O. A novel cyclin associates with MO15/CDK7 to form the
CDK-activating kinase. Cell 78, 713-724 (1994). [0791] 19.
Larochelle, S. et al. Requirements for Cdk7 in the assembly of
Cdk1/cyclin B and activation of Cdk2 revealed by chemical genetics
in human cells. Molecular cell 25, 839-850,
doi:10.1016/j.molcel.2007.02.003 (2007). [0792] 20. Schachter, M.
M. et al. A Cdk7-Cdk4 T-loop phosphorylation cascade promotes G1
progression. Molecular cell 50, 250-260,
doi:10.1016/j.molcel.2013.04.003 (2013). [0793] 21. Akhtar, M. S.
et al. TFIIH kinase places bivalent marks on the carboxy-terminal
domain of RNA polymerase II. Molecular cell 34, 387-393,
doi:10.1016/j.molcel.2009.04.016 (2009). [0794] 22. Drapkin, R., Le
Roy, G., Cho, H., Akoulitchev, S. & Reinberg, D. Human cyclin
dependent kinase-activating kinase exists in three distinct
complexes. Proceedings of the National Academy of Sciences of the
United States of America 93, 6488-6493 (1996). [0795] 23.
Glover-Cutter, K. et al. TFIIH-associated Cdk7 kinase functions in
phosphorylation of C-terminal domain Ser7 residues,
promoter-proximal pausing, and termination by RNA polymerase II.
Molecular and cellular biology 29, 5455-5464,
doi:10.1128/MCB.00637-09 (2009). [0796] 24. Larochelle, S. et al.
Cyclin-dependent kinase control of the initiation-to-elongation
switch of RNA polymerase II. Nature structural & molecular
biology 19, 1108-1115, doi:10.1038/nsmb.2399 (2012). [0797] 25.
Kelso, T. W. et al. Cyclin-dependent kinase 7 controls mRNA
synthesis by affecting stability of preinitiation complexes,
leading to altered gene expression, cell cycle progression, and
survival of tumor cells. Molecular and cellular biology 34,
3675-3688, doi:10.1128/MCB.00595-14 (2014). [0798] 26. Kwong, L. N.
& Davies, M. A. Targeted therapy for melanoma: rational
combinatorial approaches. Oncogene 33, 1-9, doi:10.1038/onc.2013.34
(2014). [0799] 27. A1-Lazikani, B., Banerji, U. & Workman, P.
Combinatorial drug therapy for cancer in the post-genomic era.
Nature biotechnology 30, 679-692, doi:10.1038/nbt.2284 (2012).
[0800] 28. Crystal, A. S. et al. Patient-derived models of acquired
resistance can identify effective drug combinations for cancer.
Science 346, 1480-1486, doi:10.1126/science.1254721 (2014). [0801]
29. Fry, D. W. et al. Specific inhibition of cyclin-dependent
kinase 4/6 by PD 0332991 and associated antitumor activity in human
tumor xenografts. Molecular cancer therapeutics 3, 1427-1438
(2004). [0802] 30. Filippakopoulos, P. et al. Selective inhibition
of BET bromodomains. Nature 68, 1067-1073, doi:10.1038/nature09504
(2010). [0803] 31. Stuhlmiller, T. J. et al. Inhibition of
Lapatinib-Induced Kinome Reprogramming in ERBB2-Positive Breast
Cancer by Targeting BET Family Bromodomains. Cell reports 11,
390-404, doi:10.1016/j.celrep.2015.03.037 (2015). [0804] 32. Zhou,
W. et al. Novel mutant-selective EGFR kinase inhibitors against
EGFR T790M. Nature 462, 1070-1074, doi:10.1038/nature08622 (2009).
[0805] 33. Yamaguchi, F., Kugawa, S., Tateno, H., Kokubu, F. &
Fukuchi, K. Analysis of EGFR, KRAS and P53 mutations in lung cancer
using cells in the curette lavage fluid obtained by bronchoscopy.
Lung cancer 78, 201-206, doi:10.1016/j.lungcan.2012.08.014 (2012).
[0806] 34. Ramsdale, R. et al. The transcription cofactor c-JUN
mediates phenotype switching and BRAF inhibitor resistance in
melanoma. Science signaling 8, ra82, doi:10.1126/scisignal.aab1111
(2015). [0807] 35. Della Corte, C. M. et al. SMO gene amplification
and activation of the hedgehog pathway as novel mechanisms of
resistance to anti-epidermal growth factor receptor drugs in human
lung cancer. Clinical cancer research: an official journal of the
American Association for Cancer Research,
doi:10.1158/1078-0432.CCR-14-3319 (2015). [0808] 36. Ercan, D. et
al. Reactivation of ERK signaling causes resistance to EGFR kinase
inhibitors. Cancer discovery 2, 934-947,
doi:10.1158/2159-8290.CD-12-0103 (2012). [0809] 37. Terai, H. et
al. Activation of the FGF2-FGFR1 autocrine pathway: a novel
mechanism of acquired resistance to gefitinib in NSCLC. Molecular
cancer research: MCR 11, 759-767, doi:10.1158/1541-7786.MCR-12-0652
(2013). [0810] 38. Mansour, M. R. et al. Oncogene regulation. An
oncogenic super-enhancer formed through somatic mutation of a
noncoding intergenic element. Science 346, 1373-1377,
doi:10.1126/science.1259037 (2014). [0811] 39. Whyte, W. A. et al.
Master transcription factors and mediator establish super enhancers
at key cell identity genes. Cell 153, 307-319,
doi:10.1016/j.cell.2013.03.035 (2013). [0812] 40. Hnisz, D. et al.
Super-enhancers in the control of cell identity and disease. Cell
155, 934-947, doi:10.1016/j.cell.2013.09.053 (2013). [0813] 41.
Hnisz, D. et al. Convergence of developmental and oncogenic
signaling athways at transcriptional super-enhancers. Molecular
cell 58, 362-370, doi:10.1016/j.molcel.2015.02.014 (2015). [0814]
42. Creyghton, M. P. et al. Histone H.sub.3K27Ac separates active
from poised enhancers and predicts developmental state. Proceedings
of the National Academy of Sciences of the United States of America
107, 21931-21936, doi:10.1073/pnas.1016071107 (2010). [0815] 43.
Wilson, F. H. et al. A functional landscape of resistance to ALK
inhibition in lung cancer. Cancer cell 27, 397-408,
doi:10.1016/j.ccell.2015.02.005 (2015). [0816] 44. Guzman, C.,
Bagga, M., Kaur, A., Westermarck, J. & Abankwa, D. ColonyArea:
an ImageJ plugin to automatically quantify colony formation in
clonogenic assays. PloS one 9, e92444,
doi:10.1371/journal.pone.0092444 (2014). [0817] 45. DuPage, M.,
Dooley, A. L. & Jacks, T. Conditional mouse lung cancer models
using adenoviral or lentiviral delivery of Cre recombinase. Nature
protocols 4, 1064-1072, doi:10.1038/nprot.2009.95 (2009). [0818]
46. Torres-Garcia, W. et al. PRADA: pipeline for RNA sequencing
data analysis. Bioinformatics 30, 2224-2226,
doi:10.1093/bioinformatics/btu169 (2014). [0819] 47. Li B, D. C.
RSEM:accurate transcript quantification from RNA-Seq data with or
without a reference genome. . BMC Bioinformatics, 323,
doi:10.1186/1471-2105-12-323. (2011). [0820] 48. Law, C. W., Chen,
Y., Shi, W. & Smyth, G. K. voom: Precision weights unlock
linear model analysis tools for RNA-seq read counts. Genome biology
15, R29, doi:10.1186/gb-2014-15-2-r29 (2014). [0821] 49. Ritchie,
M. E. et al. limma powers differential expression analyses for RNA
sequencing and microarray studies. Nucleic acids research,
doi:10.1093/nar/gkv007 (2015). [0822] 50. Lin, C. Y. et al.
Transcriptional amplification in tumor cells with elevated c-Myc.
Cell 151, 56-67, doi:10.1016/j.cell.2012.08.026 (2012). [0823] 51.
Zang, C. et al. A clustering approach for identification of
enriched domains from histone modification ChIP-Seq data.
Bioinformatics 25, 1952-1958, doi:10.1093/bioinformatics/btp340
(2009). [0824] 52. Sanjana, N. E., Shalem, O. & Zhang, F.
Improved vectors and genome-wide libraries for CRISPR screening.
Nature methods 11, 783-784, doi:10.1038/nmeth.3047 (2014). [0825]
53. Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening
in human cells. Science 343, 84-87, doi:10.1126/science.1247005
(2014). [0826] 54. Chen, J. et al. CCL18 from tumor-associated
macrophages promotes breast cancer metastasis via PITPNM3. Cancer
cell 19, 541-555, doi:10.1016/j.ccr.2011.02.006 (2011). [0827] 55.
Baranwal, S. et al. Molecular characterization of the
tumor-suppressive function of nischarin in breast cancer. Journal
of the National Cancer Institute 103, 1513-1528,
doi:10.1093/jnci/djr350 (2011).
EQUIVALENTS AND SCOPE
[0828] In the claims articles such as "a," "an," and "the" may mean
one or more than one unless indicated to the contrary or otherwise
evident from the context. Claims or descriptions that include "or"
between one or more members of a group are considered satisfied if
one, more than one, or all of the group members are present in,
employed in, or otherwise relevant to a given product or process
unless indicated to the contrary or otherwise evident from the
context. The invention includes embodiments in which exactly one
member of the group is present in, employed in, or otherwise
relevant to a given product or process. The invention includes
embodiments in which more than one, or all of the group members are
present in, employed in, or otherwise relevant to a given product
or process.
[0829] Furthermore, the invention encompasses all variations,
combinations, and permutations in which one or more limitations,
elements, clauses, and descriptive terms from one or more of the
listed claims is introduced into another claim. For example, any
claim that is dependent on another claim can be modified to include
one or more limitations found in any other claim that is dependent
on the same base claim. Where elements are presented as lists,
e.g., in Markush group format, each subgroup of the elements is
also disclosed, and any element(s) can be removed from the group.
It should it be understood that, in general, where the invention,
or aspects of the invention, is/are referred to as comprising
particular elements and/or features, certain embodiments of the
invention or aspects of the invention consist, or consist
essentially of, such elements and/or features. For purposes of
simplicity, those embodiments have not been specifically set forth
in haec verba herein. It is also noted that the terms "comprising"
and "containing" are intended to be open and permits the inclusion
of additional elements or steps. Where ranges are given, endpoints
are included. Furthermore, unless otherwise indicated or otherwise
evident from the context and understanding of one of ordinary skill
in the art, values that are expressed as ranges can assume any
specific value or sub-range within the stated ranges in different
embodiments of the invention, to the tenth of the unit of the lower
limit of the range, unless the context clearly dictates
otherwise.
[0830] This application refers to various issued patents, published
patent applications, journal articles, and other publications, all
of which are incorporated herein by reference. If there is a
conflict between any of the incorporated references and the instant
specification, the specification shall control. In addition, any
particular embodiment of the present invention that falls within
the prior art may be explicitly excluded from any one or more of
the claims. Because such embodiments are deemed to be known to one
of ordinary skill in the art, they may be excluded even if the
exclusion is not set forth explicitly herein. Any particular
embodiment of the invention can be excluded from any claim, for any
reason, whether or not related to the existence of prior art.
[0831] Those skilled in the art will recognize or be able to
ascertain using no more than routine experimentation many
equivalents to the specific embodiments described herein. The scope
of the present embodiments described herein is not intended to be
limited to the above Description, but rather is as set forth in the
appended claims. Those of ordinary skill in the art will appreciate
that various changes and modifications to this description may be
made without departing from the spirit or scope of the present
invention, as defined in the following claims.
Sequence CWU 1
1
17119DNAArtificial SequenceSynthetic Polynucleotide 1atcgtttcgc
ttaacggcg 19220DNAArtificial SequenceSynthetic Polynucleotide
2tgtgatgcaa aggtattcca 20320DNAArtificial SequenceSynthetic
Polynucleotide 3atacacatca ggttgtaacc 20420DNAArtificial
SequenceSynthetic Polynucleotide 4tgagaagctg gacttccttg
20520DNAArtificial SequenceSynthetic Polynucleotide 5gcttgtgctt
cgataccaag 20620DNAArtificial SequenceSynthetic Polynucleotide
6gctcccagac tggaattaag 20720DNAArtificial SequenceSynthetic
Polynucleotide 7gtaggagtca taattgctcg 20820DNAArtificial
SequenceSynthetic Polynucleotide 8tattccttag aagttccacc
20920DNAArtificial SequenceSynthetic Polynucleotide 9tcacccccag
atcagcccgg 201020DNAArtificial SequenceSynthetic Polynucleotide
10gggacagttt gccaccgttt 201123DNAArtificial SequenceSynthetic
Polynucleotide 11atgtccaaaa gcatcaagga gac 231220DNAArtificial
SequenceSynthetic Polynucleotide 12gaggaggcag cagagaagag
201320DNAArtificial SequenceSynthetic Polynucleotide 13taaaagttgc
agcaaggcgg 201421DNAArtificial SequenceSynthetic Polynucleotide
14aataaccacc cctgacccaa c 211519DNAArtificial SequenceSynthetic
Polynucleotide 15acatttgccg aagagccct 191624DNAArtificial
SequenceSynthetic Polynucleotide 16ttaggaaagc ctgccggtga ctaa
241724DNAArtificial SequenceSynthetic Polynucleotide 17aaagcatcac
ccggaggaga aatc 24
* * * * *
References