Compositions And Methods For Modulation Of Smn2 Splicing

Baker; Brenda F. ;   et al.

Patent Application Summary

U.S. patent application number 15/818073 was filed with the patent office on 2018-10-11 for compositions and methods for modulation of smn2 splicing. This patent application is currently assigned to Biogen MA Inc.. The applicant listed for this patent is Biogen MA Inc., Cold Spring Harbor Laboratory. Invention is credited to Brenda F. Baker, Yimin Hua, Adrian R. Krainer.

Application Number20180291376 15/818073
Document ID /
Family ID37595872
Filed Date2018-10-11

United States Patent Application 20180291376
Kind Code A1
Baker; Brenda F. ;   et al. October 11, 2018

COMPOSITIONS AND METHODS FOR MODULATION OF SMN2 SPLICING

Abstract

Disclosed herein are compounds, compositions and methods for modulating splicing of SMN2 mRNA in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders, including spinal muscular atrophy.


Inventors: Baker; Brenda F.; (Carlsbad, CA) ; Krainer; Adrian R.; (Huntington Station, NY) ; Hua; Yimin; (Jericho, NY)
Applicant:
Name City State Country Type

Biogen MA Inc.
Cold Spring Harbor Laboratory

Cambridge
Cold Spring Harbor

MA
NY

US
US
Assignee: Biogen MA Inc.
Cambridge
MA

Cold Spring Harbor Laboratory
Cold Spring Harbor
NY

Family ID: 37595872
Appl. No.: 15/818073
Filed: November 20, 2017

Related U.S. Patent Documents

Application Number Filing Date Patent Number
15267408 Sep 16, 2016
15818073
14584112 Dec 29, 2014
15267408
13720474 Dec 19, 2012 8946183
14584112
11993609 May 6, 2010 8361977
PCT/US2006/024469 Jun 23, 2006
13720474
60693542 Jun 23, 2005

Current U.S. Class: 1/1
Current CPC Class: C12N 2310/3341 20130101; C12N 15/113 20130101; C12N 2310/321 20130101; C12N 15/111 20130101; C07H 21/02 20130101; C12N 2320/33 20130101; A61K 48/00 20130101; C12N 2310/11 20130101; C12N 2310/321 20130101; C12N 2310/3525 20130101
International Class: C12N 15/113 20060101 C12N015/113; C12N 15/11 20060101 C12N015/11

Claims



1. An antisense oligonucleotide targeted to intron 6, exon 7 or intron 7 of a nucleic acid molecule encoding SMN2, wherein said oligonucleotide is 12 to 20 nucleotides in length and comprises a 2'-O-methoxyethyl sugar modification at each position.

2. The oligonucleotide of claim 1 which is 12 nucleotides in length.

3. The oligonucleotide of claim 1 which is 15 nucleotides in length.

4. The oligonucleotide of claim 1 which is 18 nucleotides in length.

5. The oligonucleotide of claim 1 which is targeted to an intronic splicing silencer element.

6. The oligonucleotide of claim 1 which is targeted to an exonic splicing silencer element.

7. The oligonucleotide of claim 1 which is targeted to intron 6.

8. The oligonucleotide of claim 7, wherein the target site of said oligonucleotide is nucleotide 5, 6, 7 or 8 of SEQ ID NO: 1.

9. The oligonucleotide of claim 7, wherein the nucleotide sequence of said oligonucleotide comprises at least an 8-nucleobase portion of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12 or 13.

10. The oligonucleotide of claim 1 which is targeted to exon 7.

11. The oligonucleotide of claim 10 wherein the target site of said oligonucleotide is nucleotide 64, 65, 66, 67, 68, 94, 95, 96 or 97 of SEQ ID NO: 1.

12. The oligonucleotide of claim 10, wherein the nucleotide sequence of said oligonucleotide comprises at least an 8-nucleobase portion of SEQ ID NO: 37, 38, 41, 59, 62, 63, 64, 66, 67 or 68.

13. The oligonucleotide of claim 1 which is targeted to intron 7.

14. The oligonucleotide of claim 13 wherein the target site of said oligonucleotide is nucleotide 121, 122, 123, 124, 125, 126, 127, 128 or 129 of SEQ ID NO: 1.

15. The oligonucleotide of claim 13, wherein the nucleotide sequence of said oligonucleotide comprises at least an 8-nucleobase portion of SEQ ID NO: 79, 80, 81, 82, 83, 84, 85, 86, 87, 89, 91 or 93.

16. A method of promoting inclusion of exon 7 in SMN2 transcripts in a cell, tissue or organ, comprising contacting said cell, tissue or organ with the antisense oligonucleotide of claim 1.

17. The method of claim 16 wherein said oligonucleotide is targeted to an intronic splicing silencer element.

18. The method of claim 16 wherein said oligonucleotide is targeted to an exonic splicing silencer element.

19.-22. (canceled)

23. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1.
Description



INCORPORATION OF SEQUENCE LISTING

[0001] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CORE0058USC3SEQ_ST25.txt, created on Sep. 14, 2016 which is 24 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] Newly synthesized eukaryotic mRNA molecules, also known as primary transcripts or pre-mRNA, made in the nucleus, are processed before or during transport to the cytoplasm for translation. Processing of the pre-mRNAs includes addition of a 5' methylated cap and an approximately 200-250 base poly(A) tail to the 3' end of the transcript.

[0003] The next step in mRNA processing is splicing of the pre-mRNA, which occurs in the maturation of 90-95% of mammalian mRNAs. Introns (or intervening sequences) are regions of a primary transcript (or the DNA encoding it) that are not included in the coding sequence of the mature mRNA. Exons are regions of a primary transcript that remain in the mature mRNA when it reaches the cytoplasm. The exons are spliced together to form the mature mRNA sequence. Splice junctions are also referred to as splice sites with the 5' side of the junction often called the "5' splice site," or "splice donor site" and the 3' side the "3' splice site" or "splice acceptor site." In splicing, the 3' end of an upstream exon is joined to the 5' end of the downstream exon. Thus the unspliced RNA (or pre-mRNA) has an exon/intron junction at the 5' end of an intron and an intron/exon junction at the 3' end of an intron. After the intron is removed, the exons are contiguous at what is sometimes referred to as the exon/exon junction or boundary in the mature mRNA. Cryptic splice sites are those which are less often used but may be used when the usual splice site is blocked or unavailable. Alternative splicing, defined as the splicing together of different combinations of exons, often results in multiple mRNA transcripts from a single gene.

[0004] Up to 50% of human genetic diseases resulting from a point mutation are caused by aberrant splicing. Such point mutations can either disrupt a current splice site or create a new splice site, resulting in mRNA transcripts comprised of a different combination of exons or with deletions in exons. Point mutations also can result in activation of a cryptic splice site or disrupt regulatory cis elements (i.e. splicing enhancers or silencers) (Cartegni et al., Nat. Rev. Genet., 2002, 3, 285-298; Drawczak et al., Hum. Genet., 1992, 90, 41-54).

[0005] Antisense oligonucleotides have been used to target mutations that lead to aberrant splicing in several genetic diseases in order to redirect splicing to give a desired splice product (Kole, Acta Biochimica Polonica, 1997, 44, 231-238). Such diseases include .beta.-thalassemia (Dominski and Kole, Proc. Natl. Acad. Sci. USA, 1993, 90, 8673-8677; Sierakowska et al., Nucleosides & Nucleotides, 1997, 16, 1173-1182; Sierakowska et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 12840-44; Lacerra et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 9591-9596); dystrophin Kobe (Takeshima et al., J. Clin. Invest., 1995, 95, 515-520); Duchenne muscular dystrophy (Dunckley et al. Nucleosides & Nucleotides, 1997, 16, 1665-1668; Dunckley et al. Human Mol. Genetics, 1998, 5, 1083-90); osteogenesis imperfecta (Wang and Marini, J. Clin Invest., 1996, 97, 448-454); and cystic fibrosis (Friedman et al., J. Biol. Chem., 1999, 274, 36193-36199).

[0006] Antisense compounds have also been used to alter the ratio of the long and short forms of Bcl-x pre-mRNA (U.S. Pat. No. 6,172,216; U.S. Pat. No. 6,214,986; Taylor et al., Nat. Biotechnol. 1999, 17, 1097-1100) or to force skipping of specific exons containing premature termination codons (Wilton et al., Neuromuscul. Disord., 1999, 9, 330-338). U.S. Pat. No. 5,627,274 and WO 94/26887 disclose compositions and methods for combating aberrant splicing in a pre-mRNA molecule containing a mutation using antisense oligonucleotides which do not activate RNAse H.

[0007] Proximal spinal muscular atrophy (SMA) is a genetic, neurodegenerative disorder characterized by the loss of spinal motor neurons. SMA is an autosomal recessive disease of early onset and is currently the leading cause of death among infants. The severity of SMA varies among patients and has thus been classified into three types. Type I SMA is the most severe form with onset at birth or within 6 months and typically results in death within 2 years. Children with type I SMA are unable to sit or walk. Type II SMA is the intermediate form and patients are able to sit, but cannot stand or walk. Patients with type III SMA, a chronic form of the disease, typically develop SMA after 18 months of age (Lefebvre et al., Hum. Mol. Genet., 1998, 7, 1531-1536).

[0008] SMA is caused by the loss of both copies of survival of motor neuron 1 (SMN1), a protein that is part of a multi-protein complex thought to be involved in snRNP biogenesis and recycling. A nearly identical gene, SMN2, exists in a duplicated region on chromosome 5q13. Although SMN1 and SMN2 have the potential to code for the same protein, SMN2 contains a translationally silent mutation at position +6 of exon 7, which results in inefficient inclusion of exon 7 in SMN2 transcripts. Thus, the predominant form of SMN2 is a truncated version, lacking exon 7, which is unstable and inactive (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384).

[0009] Chimeric peptide nucleic acid molecules designed to modulate splicing of SMN2 have been described (WO 02/38738; Cartegni and Krainer, Nat. Struct. Biol., 2003, 10, 120-125).

[0010] Antisense technology is an effective means for modulating the expression of one or more specific gene products, including alternative splice products, and is uniquely useful in a number of therapeutic, diagnostic, and research applications. The principle behind antisense technology is that an antisense compound, which hybridizes to a target nucleic acid, modulates gene expression activities such as transcription, splicing or translation through one of a number of antisense mechanisms. The sequence specificity of antisense compounds makes them extremely attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in disease.

[0011] Disclosed herein are antisense compounds useful for modulating gene expression and associated pathways via antisense mechanisms, which may include antisense mechanisms based on target occupancy. Provided herein are antisense compounds targeting SMN2 for use in modulation of SMN2 splicing. One having skill in the art, once armed with this disclosure will be able, without undue experimentation, to identify, prepare and exploit antisense compounds for these uses.

SUMMARY OF THE INVENTION

[0012] The present invention is directed to antisense compounds targeted to and hybridizable with a nucleic acid molecule encoding SMN2. Provided are antisense compounds targeted to intron, 6, exon 7 or intron 7 of SMN2 which modulate splicing of SMN2 pre-mRNAs. In one embodiment, modulation of splicing results in an increase in exon 7 inclusion. In another embodiment, modulation of splicing results in a decrease in exon 7 inclusion. Contemplated and provided herein are antisense compounds 12 to 20 nucleotides in length targeted to intron 6, exon 7 or intron 7 of SMN2, wherein the compounds comprise 2'-O-methoxyethyl sugar modifications.

[0013] In one aspect of the invention, the antisense compounds are targeted to cis splicing regulatory elements. Regulatory elements include exonic splicing enhancers, exonic splicing silencers, intronic splicing enhancers and intronic splicing silencers. Exonic and intronic splicing silencers are preferred targets.

[0014] In one embodiment, the antisense compounds comprise at least an 8-nucleobase portion of one of the exemplary compounds provided herein.

[0015] Also provided are methods for modulating splicing of SMN2 mRNA in a cell, tissue or organ using one or more of the compounds of the invention. In one embodiment, modulation of splicing is exon inclusion. In another embodiment, modulation of splicing is exon skipping. In one aspect, the compound is targeted to an intronic splicing silencer element. In another aspect, the compound is targeted to an exonic splicing silencer element.

[0016] Further provided are antisense compounds 10 to 50, 12 to 30 or 12 to 20 nucleotides in length targeted to intron 6, exon 7 or intron 7 of SMN2 comprising 2'-O-methoxyethyl sugar modifications for use in therapy. Also provided are pharmaceutical compositions comprising one or more of the compounds of the invention. Use of an antisense oligonucleotide provided herein for the preparation of a medicament for modulating splicing of an SMN2 pre-mRNA is also provided. In one aspect, modulation of splicing results in an increase in exon 7 inclusion. Use of an antisense oligonucleotide provided herein for the preparation of a medicament for the treatment of spinal muscular atrophy is further provided.

DETAILED DESCRIPTION OF THE INVENTION

[0017] Antisense technology is an effective means for modulating the expression of one or more specific gene products and is uniquely useful in a number of therapeutic, diagnostic, and research applications. Provided herein are antisense compounds useful for modulating gene expression via antisense mechanisms of action, including antisense mechanisms based on target occupancy. In one aspect, the antisense compounds provided herein modulate splicing of a target gene. Such modulation includes promoting or inhibiting exon inclusion. Further provided herein are antisense compounds targeted to cis splicing regulatory elements present in pre-mRNA molecules, including exonic splicing enhancers, exonic splicing silencers, intronic splicing enhancers and intronic splicing silencers. Disruption of cis splicing regulatory elements is thought to alter splice site selection, which may lead to an alteration in the composition of splice products.

[0018] Processing of eukaryotic pre-mRNAs is a complex process that requires a multitude of signals and protein factors to achieve appropriate mRNA splicing. Exon definition by the spliceosome requires more than the canonical splicing signals which define intron-exon boundaries. One such additional signal is provided by cis-acting regulatory enhancer and silencer sequences. Exonic splicing enhancers (ESE), exonic splicing silencers (ESS), intronic splicing enhancers (ISE) and intron splicing silencers (ISS) have been identified which either repress or enhance usage of splice donor sites or splice acceptor sites, depending on their site and mode of action (Yeo et al. 2004, Proc. Natl. Acad. Sci. U.S.A. 101(44):15700-15705). Binding of specific proteins (trans factors) to these regulatory sequences directs the splicing process, either promoting or inhibiting usage of particular splice sites and thus modulating the ratio of splicing products (Scamborova et al. 2004, Mol. Cell. Biol. 24(5):1855-1869; Hovhannisyan and Carstens, 2005, Mol. Cell. Biol. 25(1):250-263; Minovitsky et al. 2005, Nucleic Acids Res. 33(2):714-724). Little is known about the trans factors that interact with intronic splicing elements; however, several studies have provided information on exonic splicing elements. For example, ESEs are known to be involved in both alternative and constitutive splicing by acting as binding sites for members of the SR protein family. SR proteins bind to splicing elements via their RNA-binding domain and promote splicing by recruiting spliceosomal components with protein-protein interactions mediated by their RS domain, which is comprised of several Arg-Ser dipeptides (Cartegni and Krainer, 2003, Nat. Struct. Biol. 10(2):120-125; Wang et al. 2005, Nucleic Acids Res. 33(16):5053-5062). ESEs have been found to be enriched in regions of exons that are close to splice sites, particularly 80 to 120 bases from the ends of splice acceptor sites (Wu et al. 2005, Genomics 86:329-336). Consensus sequences have been determined for four members of the SR protein family, SF2/ASF, SC35, SRp40 and SRp55 (Cartegni et al. 2003, Nucleic Acids Res. 31(13):3568-3571).

[0019] Although the trans factors that bind intronic splicing regulatory elements have not been extensively studied, SR proteins and heterogeneous ribonucleoproteins (hnRNPs) have both been suggested to interact with these elements (Yeo et al. 2004, Proc. Natl. Acad. Sci. U.S.A. 101(44):15700-15705). Two intronic splicing enhancer elements (ISEs) have been identified in SMN2, one in intron 6 and the other in intron 7 (Miyajima et al. 2002, J. Biol. Chem. 22:23271-23277). Gel shift assays using the ISE in intron 7 showed formation of RNA-protein complexes, which suggests these trans proteins may be important for regulation of splicing (Miyaso et al. 2003, J. Biol. Chem. 278(18):15825-15831).

[0020] The role of SMN2 in diseases such as spinal muscular atrophy (SMA) makes it an important therapeutic target. SMA is a genetic disorder characterized by degeneration of spinal motor neurons. SMA is caused by the loss of both functional copies of SMN1. However, SMN2 has the potential to code for the same protein as SMN1 and thus overcome the genetic defect of SMA patients. SMN2 contains a translationally silent mutation (C.fwdarw.T) at position +6 of exon 7 (nucleotide 66 of SEQ ID NO: 1), which results in inefficient inclusion of exon 7 in SMN2 transcripts. Therefore, the predominant form of SMN2, one which lacks exon 7, is unstable and inactive. Thus, therapeutic compounds capable of modulating SMN2 splicing such that the percentage of SMN2 transcripts containing exon 7 is increased, would be useful for the treatment of SMA.

Overview

[0021] Disclosed herein are oligomeric compounds, including antisense oligonucleotides and other antisense compounds for use in modulating the expression of nucleic acid molecules encoding SMN2. This is accomplished by providing oligomeric compounds which hybridize with one or more target nucleic acid molecules encoding SMN2. As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding SMN2" have been used for convenience to encompass DNA encoding SMN2, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA.

[0022] Provided herein are antisense compounds for use in modulation of SMN2 pre-mRNA splicing. In one embodiment, the disclosed antisense compounds are targeted to exon 7 of SMN2 such that SMN mRNA splicing is modulated. In another embodiment, the antisense compounds are targeted to intron 6 of SMN2. In another embodiment, the antisense compounds are targeted to intron 7 of SMN2. Modulation of splicing may result in exon 7 inclusion or exon 7 skipping.

[0023] Also provided are antisense compounds targeted to cis regulatory elements. In one embodiment, the regulatory element is in an exon. In another embodiment, the regulatory element is an in intron.

Modulation of Splicing

[0024] As used herein, modulation of splicing refers to altering the processing of a pre-mRNA transcript such that the spliced mRNA molecule contains either a different combination of exons as a result of exon skipping or exon inclusion, a deletion in one or more exons, or additional sequence not normally found in the spliced mRNA (e.g., intron sequence). In the context of the present invention, modulation of splicing refers to altering splicing of SMN2 pre-mRNA to achieve exon skipping or exon inclusion. In one embodiment, exon skipping results in an SMN2 mRNA transcript lacking exon 7 and exon inclusion results in an SMN2 mRNA transcript containing exon 7.

[0025] As used herein, alternative splicing is defined as the splicing together of different combinations of exons, which may result in multiple mRNA transcripts from a single gene. In the context of the present invention, an SMN2 mRNA transcript containing exon 7 and an SMN2 mRNA transcript lacking exon 7 are two products of alternative splicing.

Compounds

[0026] The term "oligomeric compound" refers to a polymeric structure capable of hybridizing to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and chimeric combinations of these. An "antisense compound" or "antisense oligomeric compound" refers to an oligomeric compound that is at least partially complementary to the region of a nucleic acid molecule to which it hybridizes and which modulates its expression. Consequently, while all antisense compounds can be said to be oligomeric compounds, not all oligomeric compounds are antisense compounds. An "antisense oligonucleotide" is an antisense compound that is a nucleic acid-based oligomer. An antisense oligonucleotide can be chemically modified. Nonlimiting examples of oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs. As such, these compounds can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or terminal bulges or loops. Oligomeric double-stranded compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.

[0027] The oligomeric compounds in accordance with this invention may comprise a complementary oligomeric compound from about 10 to about 50 nucleobases (i.e. from about 10 to about 50 linked nucleosides). One having ordinary skill in the art will appreciate that this embodies antisense compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases.

[0028] In one embodiment, the antisense compounds of the invention are 12 to 30 nucleobases. One having ordinary skill in the art will appreciate that this embodies antisense compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases.

[0029] In one embodiment, the antisense compounds of the invention are 12 to 20 nucleobases. One having ordinary skill in the art will appreciate that this embodies antisense compounds of 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases.

[0030] In one embodiment, the antisense compounds of the invention have antisense portions of 20 nucleobases.

[0031] In one embodiment, the antisense compounds of the invention have antisense portions of 18 nucleobases.

[0032] In one embodiment, the antisense compounds of the invention have antisense portions of 15 nucleobases.

[0033] In one embodiment, the antisense compounds of the invention have antisense portions of 12 nucleobases.

[0034] Antisense compounds 10-50 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.

[0035] Compounds of the invention include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5'-terminus of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive stretch of nucleobases continuing upstream of the 5'-terminus of the antisense compound until the oligonucleotide contains about 10 to about 50 nucleobases). Other compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3'-terminus of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive stretch of nucleobases continuing downstream of the 3'-terminus of the antisense compound and continuing until the oligonucleotide contains about 10 to about 50 nucleobases). It is also understood that compounds may be represented by oligonucleotide sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative compound, and may extend in either or both directions until the oligonucleotide contains about 10 to about 50 nucleobases. The compounds described herein are specifically hybridizable to the target nucleic acid.

[0036] One having skill in the art armed with the antisense compounds illustrated herein will be able, without undue experimentation, to identify further antisense compounds.

Hybridization

[0037] As used herein, "hybridization" means the pairing of complementary strands of antisense compounds to their target sequence. While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is complementary to the natural nucleobases thymidine and uracil which pair through the formation of hydrogen bonds. The natural base guanine is complementary to the natural bases cytosine and 5-methyl cytosine. Hybridization can occur under varying circumstances.

[0038] An antisense compound is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

[0039] As used herein, "stringent hybridization conditions" or "stringent conditions" refers to conditions under which an antisense compound will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances, and "stringent conditions" under which antisense compounds hybridize to a target sequence are determined by the nature and composition of the antisense compounds and the assays in which they are being investigated.

Complementarity

[0040] "Complementarity," as used herein, refers to the capacity for precise pairing between two nucleobases on either two oligomeric compound strands or an antisense compound with its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position.

[0041] "Complementarity" can also be viewed in the context of an antisense compound and its target, rather than in a base by base manner. The antisense compound and the further DNA or RNA are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the antisense compound and a target nucleic acid. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the activity of the antisense compound. The invention is therefore directed to those antisense compounds that may contain up to about 20% nucleotides that disrupt base pairing of the antisense compound to the target. Preferably the compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches. The remaining nucleotides do not disrupt hybridization (e.g., universal bases).

[0042] It is understood in the art that incorporation of nucleotide affinity modifications may allow for a greater number of mismatches compared to an unmodified compound. Similarly, certain oligonucleotide sequences may be more tolerant to mismatches than other oligonucleotide sequences. One of the skill in the art is capable of determining an appropriate number of mismatches between oligonucleotides, or between an oligonucleotide and a target nucleic acid, such as by determining melting temperature.

Identity

[0043] Antisense compounds, or a portion thereof, may have a defined percent identity to a SEQ ID NO, or a compound having a specific Isis number. As used herein, a sequence is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in the disclosed sequences of the instant invention would be considered identical as they both pair with adenine. This identity may be over the entire length of the oligomeric compound, or in a portion of the antisense compound (e.g., nucleobases 1-20 of a 27-mer may be compared to a 20-mer to determine percent identity of the oligomeric compound to the SEQ ID NO.) It is understood by those skilled in the art that an antisense compound need not have an identical sequence to those described herein to function similarly to the antisense compound described herein. Shortened versions of antisense compound taught herein, or non-identical versions of the antisense compound taught herein fall within the scope of the invention. Non-identical versions are those wherein each base does not have the same pairing activity as the antisense compounds disclosed herein. Bases do not have the same pairing activity by being shorter or having at least one abasic site. Alternatively, a non-identical version can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T). Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the SEQ ID NO or antisense compound to which it is being compared. The non-identical bases may be adjacent to each other, dispersed through out the oligonucleotide, or both.

[0044] For example, a 16-mer having the same sequence as nucleobases 2-17 of a 20-mer is 80% identical to the 20-mer. Alternatively, a 20-mer containing four nucleobases not identical to the 20-mer is also 80% identical to the 20-mer. A 14-mer having the same sequence as nucleobases 1-14 of an 18-mer is 78% identical to the 18-mer. Such calculations are well within the ability of those skilled in the art.

[0045] The percent identity is based on the percent of nucleobases in the original sequence present in a portion of the modified sequence. Therefore, a 30 nucleobase antisense compound comprising the full sequence of the complement of a 20 nucleobase active target segment would have a portion of 100% identity with the complement of the 20 nucleobase active target segment, while further comprising an additional 10 nucleobase portion. In the context of the invention, the complement of an active target segment may constitute a single portion. In a preferred embodiment, the oligonucleotides of the instant invention are at least about 80%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least 95% identical to at least a portion of the complement of the active target segments presented herein.

[0046] It is well known by those skilled in the art that it is possible to increase or decrease the length of an antisense compound and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992, incorporated herein by reference), a series of ASOs 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA. ASOs 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the ASOs were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the ASOs that contained no mismatches. Similarly, target specific cleavage was achieved using a 13 nucleobase ASOs, including those with 1 or 3 mismatches. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988, incorporated herein by reference) tested a series of tandem 14 nucleobase ASOs, and a 28 and 42 nucleobase ASOs comprised of the sequence of two or three of the tandem ASOs, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase ASOs alone were able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase ASOs. It is understood that antisense compounds of the instant invention can vary in length and percent complementarity to the target provided that they maintain the desired activity. Methods to determine desired activity are disclosed herein and well known to those skilled in the art.

Target Nucleic Acids

[0047] As used herein, "targeting" or "targeted to" refer to the process of designing an oligomeric compound such that the compound specifically hybridizes with a selected nucleic acid molecule.

[0048] "Targeting" an oligomeric compound to a particular target nucleic acid molecule can be a multistep process. The process usually begins with the identification of a target nucleic acid whose expression is to be modulated. As used herein, the terms "target nucleic acid" and "nucleic acid encoding SMN2" encompass DNA encoding SMN2, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. As disclosed herein, the target nucleic acid encodes SMN2. In one preferred embodiment, the target nucleic acid is SMN2 pre-mRNA.

[0049] Target Regions, Segments, and Sites

[0050] The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect (e.g., modulation of splicing) will result. "Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Target regions may include an exon or an intron. Within regions of target nucleic acids are segments. "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid. "Sites," as used in the present invention, are defined as unique nucleobase positions within a target nucleic acid.

Kits, Research Reagents and Diagnostics

[0051] The antisense compounds of the present invention can be utilized for diagnostics, and as research reagents and kits. Furthermore, antisense compounds, which are able to inhibit gene expression or modulate gene expression (e.g., modulation of splicing) with specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.

[0052] For use in kits and diagnostics, the antisense compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues. Methods of gene expression analysis are well known to those skilled in the art.

Therapeutics

[0053] Antisense compounds of the invention can be used to modulate the expression of SMN2 in an animal, such as a human. In one non-limiting embodiment, the methods comprise the step of administering to said animal in need of therapy for a disease or condition associated with SMN2 an effective amount of an antisense compound that modulates expression of SMN2 (e.g. modulates splicing of SMN2). A disease or condition associated with SMN2 includes, but is not limited to, spinal muscular atrophy. In one embodiment, the antisense compounds of the present invention effectively modulate splicing of SMN2, resulting in an increase in exon 7 inclusion. Antisense compounds of the present invention that effectively modulate expression of SMN2 RNA or protein products of expression are considered active antisense compounds.

[0054] For example, modulation of expression of SMN2 can be measured in a bodily fluid, which may or may not contain cells; tissue; or organ of the animal. Methods of obtaining samples for analysis, such as body fluids (e.g., sputum, serum), tissues (e.g., biopsy), or organs, and methods of preparation of the samples to allow for analysis are well known to those skilled in the art. Methods for analysis of RNA and protein levels are discussed above and are well known to those skilled in the art. The effects of treatment can be assessed by measuring biomarkers associated with the target gene expression in the aforementioned fluids, tissues or organs, collected from an animal contacted with one or more compounds of the invention, by routine clinical methods known in the art. These biomarkers include but are not limited to: liver transaminases, bilirubin, albumin, blood urea nitrogen, creatine and other markers of kidney and liver function; interleukins, tumor necrosis factors, intracellular adhesion molecules, C-reactive protein, chemokines, cytokines, and other markers of inflammation.

[0055] The antisense compounds of the present invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Acceptable carriers and diluents are well known to those skilled in the art. Selection of a diluent or carrier is based on a number of factors, including, but not limited to, the solubility of the compound and the route of administration. Such considerations are well understood by those skilled in the art. In one aspect, the antisense compounds of the present invention modulate splicing of SMN2. The compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to SMN2.

[0056] Methods whereby bodily fluids, organs or tissues are contacted with an effective amount of one or more of the antisense compounds or compositions of the invention are also contemplated. Bodily fluids, organs or tissues can be contacted with one or more of the compounds of the invention resulting in modulation of SMN2 expression in the cells of bodily fluids, organs or tissues. An effective amount can be determined by monitoring the modulatory effect of the antisense compound or compounds or compositions on target nucleic acids or their products by methods routine to the skilled artisan.

[0057] Thus, provided herein is the use of an isolated antisense compound targeted to SMN2 in the manufacture of a medicament for the treatment of a disease or disorder by means of the method described above. In one embodiment, the antisense compound is targeted to exon 7 of SMN2. In another embodiment, the antisense compound is targeted to intron 6 of SMN2. In yet another embodiment, the antisense compound is targeted to intron 7 of SMN2.

Chemical Modifications

[0058] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base (sometimes referred to as a "nucleobase" or simply a "base"). The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage. It is often preferable to include chemical modifications in oligonucleotides to alter their activity. Chemical modifications can alter oligonucleotide activity by, for example: increasing affinity of an antisense oligonucleotide for its target RNA, increasing nuclease resistance, and/or altering the pharmacokinetics of the oligonucleotide. The use of chemistries that increase the affinity of an oligonucleotide for its target can allow for the use of shorter oligonucleotide compounds.

[0059] The term "nucleobase" or "heterocyclic base moiety" as used herein, refers to the heterocyclic base portion of a nucleoside. In general, a nucleobase is any group that contains one or more atom or groups of atoms capable of hydrogen bonding to a base of another nucleic acid. In addition to "unmodified" or "natural" nucleobases such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are amenable to the present invention. The terms modified nucleobase and nucleobase mimetic can overlap but generally a modified nucleobase refers to a nucleobase that is fairly similar in structure to the parent nucleobase, such as for example a 7-deaza purine, a 5-methyl cytosine, or a G-clamp, whereas a nucleobase mimetic would include more complicated structures, such as for example a tricyclic phenoxazine nucleobase mimetic. Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art.

[0060] Antisense compounds of the present invention may also contain one or more nucleosides having modified sugar moieties. The furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) and substitution of an atom or group such as --S--, --N(R)-- or --C(R.sub.1)(R.sub.2) for the ring oxygen at the 4'-position. Modified sugar moieties are well known and can be used to alter, typically increase, the affinity of the antisense compound for its target and/or increase nuclease resistance. A representative list of preferred modified sugars includes but is not limited to bicyclic modified sugars (BNA's), including LNA and ENA (4'-(CH.sub.2).sub.2--O-2' bridge); and substituted sugars, especially 2'-substituted sugars having a 2'-F, 2'-OCH.sub.2 or a 2'-O(CH.sub.2).sub.2--OCH.sub.3 substituent group. Sugars can also be replaced with sugar mimetic groups among others. Methods for the preparations of modified sugars are well known to those skilled in the art.

[0061] The present invention includes internucleoside linking groups that link the nucleosides or otherwise modified monomer units together thereby forming an antisense compound. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane (--O--Si(H)2-O--); and N,N'-dimethylhydrazine (--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Antisense compounds having non-phosphorus internucleoside linking groups are referred to as oligonucleosides. Modified internucleoside linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the antisense compound. Internucleoside linkages having a chiral atom can be prepared racemic, chiral, or as a mixture. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known to those skilled in the art.

[0062] As used herein the term "mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino. Representative examples of a mimetic for a sugar-internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.

[0063] As used herein the term "nucleoside" includes, nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and/or sugar groups.

[0064] In the context of this invention, the term "oligonucleotide" refers to an oligomeric compound which is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term includes oligonucleotides composed of naturally- and non-naturally-occurring nucleobases, sugars and covalent internucleoside linkages, possibly further including non-nucleic acid conjugates.

[0065] The present invention provides compounds having reactive phosphorus groups useful for forming internucleoside linkages including for example phosphodiester and phosphorothioate internucleoside linkages. Methods of preparation and/or purification of precursors or antisense compounds of the instant invention are not a limitation of the compositions or methods of the invention. Methods for synthesis and purification of DNA, RNA, and the antisense compounds of the instant invention are well known to those skilled in the art.

[0066] As used herein the term "chimeric antisense compound" refers to an antisense compound, having at least one sugar, nucleobase and/or internucleoside linkage that is differentially modified as compared to the other sugars, nucleobases and internucleoside linkages within the same oligomeric compound. The remainder of the sugars, nucleobases and internucleoside linkages can be independently modified or unmodified. In general a chimeric oligomeric compound will have modified nucleosides that can be in isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and or mimetic groups can comprise a chimeric oligomeric compound of the present invention.

[0067] Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0068] As used in the present invention the term "fully modified motif" refers to an antisense compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.

[0069] The compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or B, or as (D) or (L) such as for amino acids et al. The present invention is meant to include all such possible isomers, as well as their racemic and optically pure forms.

[0070] In one aspect of the present invention antisense compounds are modified by covalent attachment of one or more conjugate groups. Conjugate groups may be attached by reversible or irreversible attachments. Conjugate groups may be attached directly to anti sense compounds or by use of a linker. Linkers may be mono- or bifunctional linkers. Such attachment methods and linkers are well known to those skilled in the art. In general, conjugate groups are attached to antisense compounds to modify one or more properties. Such considerations are well known to those skilled in the art.

Oligomer Synthesis

[0071] Oligomerization of modified and unmodified nucleosides can be routinely performed according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713).

[0072] Antisense compounds of the present invention can be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The invention is not limited by the method of antisense compound synthesis.

Oligomer Purification and Analysis

[0073] Methods of oligonucleotide purification and analysis are known to those skilled in the art. Analysis methods include capillary electrophoresis (CE) and electrospray-mass spectroscopy. Such synthesis and analysis methods can be performed in multi-well plates. The method of the invention is not limited by the method of oligomer purification.

Salts, Prodrugs and Bioequivalents

[0074] The antisense compounds of the present invention comprise any pharmaceutically acceptable salts, esters, or salts of such esters, or any other functional chemical equivalent which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the antisense compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0075] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive or less active form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes, chemicals, and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S-acetyl-2-thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 or WO 94/26764. Prodrugs can also include antisense compounds wherein one or both ends comprise nucleobases that are cleaved (e.g., by incorporating phosphodiester backbone linkages at the ends) to produce the active compound.

[0076] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. In another embodiment, sodium salts of dsRNA compounds are also provided.

Formulations

[0077] The antisense compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds.

[0078] The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. In a preferred embodiment, administration is topical to the surface of the respiratory tract, particularly pulmonary, e.g., by nebulization, inhalation, or insufflation of powders or aerosols, by mouth and/or nose.

[0079] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, finely divided solid carriers, or both, and then, if necessary, shaping the product (e.g., into a specific particle size for delivery). In a preferred embodiment, the pharmaceutical formulations of the instant invention are prepared for pulmonary administration in an appropriate solvent, e.g., water or normal saline, possibly in a sterile formulation, with carriers or other agents to allow for the formation of droplets of the desired diameter for delivery using inhalers, nasal delivery devices, nebulizers, and other devices for pulmonary delivery. Alternatively, the pharmaceutical formulations of the instant invention may be formulated as dry powders for use in dry powder inhalers.

[0080] A "pharmaceutical carrier" or "excipient" can be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal and are known in the art. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.

Combinations

[0081] Compositions of the invention can contain two or more antisense compounds. In another related embodiment, compositions of the present invention can contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the present invention can contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Two or more combined compounds may be used together or sequentially. Compositions of the instant invention can also be combined with other non-antisense compound therapeutic agents.

NONLIMITING DISCLOSURE AND INCORPORATION BY REFERENCE

[0082] While certain compounds, compositions and methods of the present invention have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

Example 1

Design of Modified Antisense Compounds Targeting SMN2

[0083] In accordance with the present invention, antisense compounds were designed to target intron 6, exon 7 or intron 7 of SMN2 (SEQ ID NO: 1). In reference to SEQ ID NO:1, nucleotides 61-114 represent exon 7, while nucleotides 1-60 and 115-174 represent portions of intron 6 and intron 7, respectively. The compounds, listed in Table 1, are either 12, 15, 16 or 18 nucleotides in length and are composed of 2'-O-methoxyethyl nucleotides, also known as 2'-MOE nucleotides. The internucleoside (backbone) linkages are phosphodiester throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. Target site indicates the first (5'-most) nucleotide number of the target sequence (SEQ ID NO: 1) to which the oligonucleotide binds.

TABLE-US-00001 TABLE 1 2'-MOE Compounds Targeting SMN2 SEQ ISIS Target Target Sequence ID # Site Region Length (5' to 3') NO 390645 1 Intron 6 15 TAGATAGCTATATAT 2 393593 2 Intron 6 15 ATAGATAGCTATATA 3 393592 3 Intron 6 15 TATAGATAGCTATAT 4 393591 4 Intron 6 15 ATATAGATAGCTATA 5 393590 5 Intron 6 15 GATATAGATAGCTAT 6 393602 5 Intron 6 12 ATAGATAGCTAT 7 390644 6 Intron 6 15 AGATATAGATAGCTA 8 393601 6 Intron 6 12 TATAGATAGCTA 9 393589 7 Intron 6 15 TAGATATAGATAGCT 10 393600 7 Intron 6 12 ATATAGATAGCT 11 393588 8 Intron 6 15 ATAGATATAGATAGC 12 393599 8 Intron 6 12 GATATAGATAGC 13 393587 9 Intron 6 15 TATAGATATAGATAG 14 393598 9 Intron 6 12 AGATATAGATAG 15 393586 10 Intron 6 15 ATATAGATATAGATA 16 393597 10 Intron 6 12 TAGATATAGATA 17 390643 11 Intron 6 15 TATATAGATATAGAT 18 393596 11 Intron 6 12 ATAGATATAGAT 19 393595 12 Intron 6 12 TATAGATATAGA 20 393594 13 Intron 6 12 ATATAGATATAG 21 390642 16 Intron 6 15 ATAGCTATATAGATA 22 390641 21 Intron 6 15 AAAAAATAGCTATAT 23 390640 26 Intron 6 15 GTTAAAAAAAATAGC 24 390639 31 Intron 6 15 AGGAAGTTAAAAAAA 25 390638 36 Intron 6 15 AATAAAGGAAGTTAA 26 390637 41 Intron 6 15 AGGAAAATAAAGGAA 27 390636 46 Intron 6 15 CTGTAAGGAAAATAA 28 372641 61 Exon 7 15 ATTTTGTCTAAAACC 29 385909 62 Exon 7 15 GATTTTGTCTAAAAC 30 383497 63 Exon 7 12 TTTTGTCTAAAA 31 385908 63 Exon 7 15 TGATTTTGTCTAAAA 32 383496 64 Exon 7 12 ATTTTGTCTAAA 33 385907 64 Exon 7 15 TTGATTTTGTCTAAA 34 383495 65 Exon 7 12 GATTTTGTCTAA 35 385906 65 Exon 7 15 TTTGATTTTGTCTAA 36 385910 65 Exon 7 16 TTTTGATTTTGTCTA 37 A 372642 66 Exon 7 15 TTTTGATTTTGTCTA 38 383494 66 Exon 7 12 TGATTTTGTCTA 39 383493 67 Exon 7 12 TTGATTTTGTCT 40 385905 67 Exon 7 15 TTTTTGATTTTGTCT 41 383492 68 Exon 7 12 TTTGATTTTGTC 42 385904 68 Exon 7 15 CTTTTTGATTTTGTC 43 383491 69 Exon 7 12 TTTTGATTTTGT 44 383490 70 Exon 7 12 TTTTTGATTTTG 45 372643 71 Exon 7 15 CTTCTTTTTGATTTT 46 383489 71 Exon 7 12 CTTTTTGATTTT 47 383488 72 Exon 7 12 TCTTTTTGATTT 48 372644 76 Exon 7 15 CCTTCCTTCTTTTTG 49 372645 81 Exon 7 15 GAGCACCTTCCTTCT 50 372646 86 Exon 7 15 AATGTGAGCACCTTC 51 372647 91 Exon 7 15 TAAGGAATGTGAGCA 52 383470 92 Exon 7 18 AATTTAAGGAATGTG 53 AGC 383477 92 Exon 7 15 TTAAGGAATGTGAGC 54 383469 93 Exon 7 18 TAATTTAAGGAATGT 55 GAG 383476 93 Exon 7 15 TTTAAGGAATGTGAG 56 383487 93 Exon 7 12 AAGGAATGTGAG 57 383468 94 Exon 7 18 TTAATTTAAGGAATG 58 TGA 383475 94 Exon 7 15 ATTTAAGGAATGTGA 59 383486 94 Exon 7 12 TAAGGAATGTGA 60 383467 95 Exon 7 18 CTTAATTTAAGGAAT 61 GTG 383474 95 Exon 7 15 AATTTAAGGAATGTG 62 383485 95 Exon 7 12 TTAAGGAATGTG 63 372648 96 Exon 7 15 TAATTTAAGGAATGT 64 383466 96 Exon 7 18 CCTTAATTTAAGGAA 65 TGT 383484 96 Exon 7 12 TTTAAGGAATGT 66 383473 97 Exon 7 15 TTAATTTAAGGAATG 67 383483 97 Exon 7 12 ATTTAAGGAATG 68 383472 98 Exon 7 15 CTTAATTTAAGGAAT 69 383482 98 Exon 7 12 AATTTAAGGAAT 70 383471 99 Exon 7 15 CCTTAATTTAAGGAA 71 383481 99 Exon 7 12 TAATTTAAGGAA 72 372649 100 Exon 7 15 TCCTTAATTTAAGGA 73 383480 100 Exon 7 12 TTAATTTAAGGA 74 383479 101 Exon 7 12 CTTAATTTAAGG 75 383478 102 Exon 7 12 CCTTAATTTAAG 76 390646 115 Intron 7 15 TGCTGGCAGACTTAC 77 390647 120 Intron 7 15 CATAATGCTGGCAGA 78 393610 121 Intron 7 15 TCATAATGCTGGCAG 79 393609 122 Intron 7 15 TTCATAATGCTGGCA 80 393608 123 Intron 7 15 TTTCATAATGCTGGC 81 387949 124 Intron 7 20 ATTCACTTTCATAAT 82 GCTGG 393607 124 Intron 7 15 CTTTCATAATGCTGG 83 393619 124 Intron 7 12 TCATAATGCTGG 84 390648 125 Intron 7 15 ACTTTCATAATGCTG 85 393618 125 Intron 7 12 TTCATAATGCTG 86 393606 126 Intron 7 15 CACTTTCATAATGCT 87 393617 126 Intron 7 12 TTTCATAATGCT 88 393605 127 Intron 7 15 TCACTTTCATAATGC 89 393616 127 Intron 7 12 CTTTCATAATGC 90 393604 128 Intron 7 15 TTCACTTTCATAATG 91 393615 128 Intron 7 12 ACTTTCATAATG 92 393603 129 Intron 7 15 ATTCACTTTCATAAT 93 393614 129 Intron 7 12 CACTTTCATAAT 94 390649 130 Intron 7 15 GATTCACTTTCATAA 95 393613 130 Intron 7 12 TCACTTTCATAA 96 393612 131 Intron 7 12 TTCACTTTCATA 97 393611 132 Intron 7 12 ATTCACTTTCAT 98 390650 135 Intron 7 15 AGTAAGATTCACTTT 99 390651 140 Intron 7 15 ACAAAAGTAAGATTC 100 390652 145 Intron 7 15 GTTTTACAAAAGTAA 101 390653 150 Intron 7 15 ATAAAGTTTTACAAA 102 390654 155 Intron 7 15 AAACCATAAAGTTTT 103 390655 160 Intron 7 15 TCCACAAACCATAAA 104

[0084] Other nucleic acid sequences for SMN genes are publicly available and well known in the art. For example, Genbank Accession Nos. NM_000344, NM_022874, NM_022875, U43883, AC140134, AC139778, AC010237, AC022119 and AC004999 provide nucleotide sequences of SMN1 or SMN2.

Example 2

[0085] Treatment with Oligomeric Compounds

[0086] When cells reach appropriate confluency, they are treated with oligonucleotide using a transfection method as described.

LIPOFECTIN.TM.

[0087] When cells reach 65-75% confluency, they are treated with oligonucleotide. Oligonucleotide is mixed with LIPOFECTIN.TM. Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM.TM.-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of oligonucleotide and a LIPOFECTIN.TM. concentration of 2.5 or 3 .mu.g/mL per 100 nM oligonucleotide. This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 .mu.L OPTI-MEM.TM.-1 and then treated with 130 .mu.L of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligonucleotide. Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37.degree. C., the medium containing the transfection mixture is replaced with fresh culture medium.

Electroporation

[0088] When cells reach approximately 80% confluency, oligonucleotide is introduced via electroporation. Oligonucleotide concentrations used in electroporation experiments range from 0.1 to 40 .mu.M. Cells are harvested by routine trypsinization to produce a single cell suspension. Following cell counting using a hemocytometer and pelleting by centrifugation, cells are resuspended in OPTI-MEM.TM.-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve a density of 1.times.10.sup.7 cells/mL. Cells are mixed with the desired concentration of oligonucleotide and transferred to a 0.1 cm electroporation cuvette (BTX Molecular Delivery Systems, Hollister, Mass.). Cells are subjected to a single pulse using an electroporation apparatus (for example, the BTX Electro Square Porator T820 or the BTX HT300, BTX Molecular Delivery Systems, Hollister, Mass.), diluted into culture medium and plated into 24-well plates. Cells are treated and data were obtained in duplicate or triplicate.

Example 3

Minigenes for SMN2 Splicing Studies

[0089] All SMN constructs are derivatives of pCITel (Lorson and Androphy, Hum. Mol. Genet., 2000, 9, 259-265). The primers used to generate each SMN2 construct are shown in Table 2. Using a Quickchange kit (Stratagene, La Jolla, Calif.), an XbaI site was inserted by site-directed mutagenesis at nucleotide 7170 (in intron 7) to generate pCI-SMNx-wt. For in vitro transcription studies, intron 6 was shortened by overlap-extension PCR to generate pCISMNx.DELTA.6-wt, deleting 5,570 nt from position 1235 to the BclI site at nt 6805. Two sets of PCR were performed with Pfu polymerase and pCISMNx-wt as template. The first PCR was carried out with primers CIF1 and .DELTA.6-bclR, the second with primers smn.DELTA.6-vrlp and CIR. The PCR products were purified, combined and reamplified with the outer primers (CIF1 and CIR). The final product was digested with XhoI and NotI and subcloned it into pCISMNx-wt digested with the same enzymes. All the constructs were verified by direct sequencing. Templates were generated for in vitro transcription by PCR amplification of pCISMNx.DELTA.6-wt using primers CIF2 and smn8-75+5R. The final products contained a T7 promoter, exon 6 (124 nt), a shortened intron 6 (200 nt), exon 7 (54 nt), intron 7 (444 nt), and 75 nt of exon 8 followed by a consensus 5' splice site (GTAAGTACTT; SEQ ID NO: 22) (Cartegni and Krainer, Nature Genet., 2002, 30, 377-384; WO 02/38738).

TABLE-US-00002 TABLE 2 Primers used to generate SMN2 minigenes and templates SEQ Primer ID Construct Name Primer Sequence NO pCI-SMNx-wt smnI7xbaF AGATAAAAGGTTAATCTAGATCCC 106 TACTAGAATTCTC pCI-SMNx-wt smnI7xbaR GAGAATTCTAGTAGGGATCTAGAT 107 TAACCTTTTATCT pCISMNx.DELTA.6-wt CIF1 AATTGCTAACGCAGTCAGTGCTTC 108 pCISMNx.DELTA.6-wt .DELTA.6-bclR AATATGATCAGCAAAACAAAGTCA 109 CATAACTAC pCISMNx.DELTA.6-wt smn.DELTA.6- GTGACTTTGTTTTGCTGATCATAT 110 vrlp TTTGTTGAATAAAATAAG pCISMNx.DELTA.6-wt CIR AATGTATCTTATCATGTCTGCTCG 111 In vitro CIF2 AATGTATCTTATCATGTCTGCTCG 112 templates In vitro Smn8-75 + AAGTACTTACCTGTAACGCTTCAC 113 templates 5'R ATTCCAGATCTGTC

Example 4

Effect of Antisense Compounds on SMN2 Splicing in Cell-Free Extracts

[0090] 2'-MOE antisense compounds designed to target exon 7 of SMN2 were evaluated for their effect on splicing of SMN2. Templates for in vitro SMN2 splicing studies were generated as described in Example 3. 5'-capped T7 runoff transcripts from purified PCR products were uniformly labeled with [.alpha.-.sup.32P]-UTP and purified by denaturing polyacrylamide gel electrophoresis. Labeled in vitro transcripts were spliced in HeLa cell nuclear or S100 extracts (Mayeda and Krainer, Methods Mol. Biol., 1999, 118, 315-321; Mayeda and Krainer, Methods Mol. Biol., 1999, 118, 309-314) by incubating 10 fmol of transcript in 12.5 .mu.l standard splicing reactions containing 3 .mu.l of nuclear extract or 2 .mu.l of S100 extract. Extracts either contained no antisense oligonucleotide or were complemented with 1, 5, 10, 25, 50, 100, 200 or 400 nM of ISIS 372641, ISIS 372642, ISIS 372643, ISIS 372644, ISIS 372645, ISIS 372646, ISIS 372647, ISIS 372648 or ISIS 372649. Control oligonucleotide ISIS 372693 was also used in this study (TTGTATTCTATGTTT; SEQ ID NO: 114). The MgCl.sub.2 concentration of the splicing mixture was 1.6 mM. After incubation at 30.degree. C. for 4 h, RNA was extracted and analyzed on 8% denaturing polyacrylamide gels, followed by autoradiography and phosphorimager analysis. Exon inclusion was calculated as a percentage of the total amount of spliced mRNA (included mRNA.times.100/(included mRNA+skipped mRNA).

[0091] The results showed that several of the SMN2 antisense oligonucleotides altered splicing of SMN2 exon 7, while control oligonucleotide ISIS 372693 had no effect. ISIS 372641 promoted skipping of SMN2 exon 7 in a dose-dependent manner. Exon 7 was included in only 2% of SMN2 spliced transcripts incubated with 400 nM of ISIS 372641, compared with 26% of transcripts incubated with no oligonucleotide. Similarly, ISIS 372646 inhibited inclusion of exon 7 in a dose-dependent manner with 16% of SMN2 spliced transcripts containing exon 7, compared with 32% of transcripts incubated without oligonucleotide. In contrast, ISIS 372642 inhibited skipping of exon 7 in a dose-dependent manner. The percentage of SMN2 spliced transcripts containing exon 7 increased from 28% when incubated without oligonucleotide to 40% when incubated with 400 nM of ISIS 372642. ISIS 372648 also increased inclusion of exon 7 with 69% of SMN2 transcripts containing exon 7 when incubated with the highest concentration of oligonucleotide, compared with 42% of transcripts when incubated without oligonucleotide. Extracts containing ISIS 372643 also showed a slight increase in exon 7 inclusion at the higher oligonucleotide concentrations. Taken together, these results illustrate that antisense oligonucleotides targeting exon 7 of SMN2 are capable of altering splicing of transcripts to either promote or inhibit inclusion of exon 7.

Example 5

Effect of Antisense Compounds on SMN2 Splicing in HEK293 Cells

[0092] Antisense compounds targeting SMN2 exon 7 were evaluated for their effects on SMN2 splicing in cultured cells. HEK293 cells were electroporated with 10 .mu.g SMN2 minigene and 10 .mu.M of either SMN2 antisense oligonucleotide ISIS 372641, ISIS 372642, ISIS 372643, ISIS 372644, ISIS 372645, ISIS 372646, ISIS 372647, ISIS 372648 or ISIS 372649, or control oligonucleotide ISIS 372693. Sixty hours after transfection, total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, Calif.) following the manufacturer's directions. One .mu.g of DNAse-treated total RNA was used to generate first-strand cDNA sequences with oligo(dT) and Superscript II reverse transcriptase (Invitrogen), and the cDNA was amplified semi-quantitatively by 16 PCR cycles (94.degree. C. for 30 s, 57.5.degree. C. for 30 s, 72.degree. C. for 90 s) in the presence of [.alpha.-.sup.32P]dCTP (Lorson and Androphy, Hum. Mol. Genet., 2000, 9, 259-265). PCR products were analyzed by electrophoresis on 6% denaturing polyacrylamide gels, followed by autoradiography and phosphorimager analysis. Exon inclusion was calculated as a percentage of the total amount of spliced mRNA (included mRNA.times.100/(included mRNA+skipped mRNA). The percentage of SMN2 spliced transcripts containing exon 7 (% inclusion) is shown in Table 3. The target site of each oligonucleotide relative to SEQ ID NO: 1 is also indicated.

TABLE-US-00003 TABLE 3 Effect of SMN2 antisense compounds on exon 7 inclusion Target ISIS # Site % Inclusion 372641 61 6.4 372642 66 67.4 372643 71 34.9 372644 76 12.9 372645 81 7.8 372646 86 11.8 372647 91 9.5 372648 96 75.2 372649 100 55.1 372693 Control 57.7

[0093] Compared to control oligonucleotide, transfection with either ISIS 372642 or 372648 resulted in a greater percentage of SMN2 transcripts with exon 7 included, which is consistent with results obtained from in vitro assays. Treatment with ISIS 372641, ISIS 372644, ISIS 372645, ISIS 372646 and ISIS 372647 resulted in the most significant increase in exon 7 skipping.

[0094] SMN2 antisense oligonucleotides were further evaluated for their effects on endogenous SMN1 and SMN2 pre-mRNA splicing in cultured cells. HEK293 cells were electroporated with 10 .mu.M of either SMN2 antisense oligonucleotide ISIS 372641, ISIS 372642, ISIS 372643, ISIS 372644, ISIS 372645, ISIS 372646, ISIS 372647, ISIS 372648 or ISIS 372649, or control oligonucleotide ISIS 372693. Sixty hours after transfection, RNA was isolated and RT-PCR was performed as described above to examine splicing changes of both SMN1 and SMN2 pre-mRNAs. PCR products were digested with DdeI to distinguish between SMN1 and SMN2, separated by electrophoresis on 6% denaturing polyacrylamide gels and analyzed by autoradiography. The percentage of SMN1 and SMN2 spliced transcripts containing exon 7 (% inclusion) is shown in Table 4.

TABLE-US-00004 TABLE 4 Effect of SMN2 antisense oligonucleotides on SMN1 and SMN2 pre-mRNA splicing % Inclusion % Inclusion ISIS # SMN1 SMN2 372641 82.5 11.1 372642 96.2 69.5 372643 94.1 28.8 372644 68.5 23.8 372645 47.3 15.2 372646 57.7 20.2 372647 58.8 12.8 372648 93.1 52.2 372649 94.8 49.3 372693 95.1 50.1

[0095] In accordance with previous results, transfection with ISIS 372642 and ISIS 372648 led to the greatest level of exon 7 inclusion in SMN2 pre-mRNA transcripts. ISIS 372641, ISIS 372644, ISIS 372645, ISIS 372646 and ISIS 372647 significantly reduced the percentage of SMN1 transcripts containing exon 7. These oligonucleotides, along with ISIS 372643, also reduced exon 7 inclusion in SMN2 mRNAs.

[0096] Additional antisense oligonucleotides targeting the 3' end of SMN2 exon 7 (see Table 1) were evaluated for their effects on SMN2 pre-mRNA splicing. HEK293 cells were electroporated with 10 .mu.M of either SMN2 antisense oligonucleotide ISIS 383466, ISIS 383467, ISIS 383468, ISIS 383469, ISIS 383470, ISIS 383471, ISIS 383472, ISIS 383473, ISIS 383474, ISIS 383475, ISIS 383476, ISIS 383477 or ISIS 372648, or a control oligonucleotide. Fifty hours after transfection, RNA was isolated and RT-PCR was performed as described above to examine splicing changes of SMN2 pre-mRNA. PCR products were digested with DdeI to distinguish between SMN1 and SMN2, separated by electrophoresis on 6% denaturing polyacrylamide gels and analyzed by autoradiography. The percentage of SMN2 spliced transcripts containing exon 7 (% inclusion) is shown in Table 5. The length and target site of each oligonucleotide relative to SEQ ID NO: 1 are also indicated.

TABLE-US-00005 TABLE 5 Effect of SMN2 antisense oligonucleotides on SMN2 pre-mRNA splicing Target ISIS # Site Length % Inclusion 383470 92 18 4.9 383477 92 15 5.3 383469 93 18 18.9 383476 93 15 32.8 383468 94 18 18.7 383475 94 15 84.8 383467 95 18 8.1 383474 95 15 77.0 372648 96 15 59.6 383466 96 18 37.5 383473 97 15 42.2 383472 98 15 45.0 383471 99 15 37.1 Control N/A N/A 41.3 Vehicle N/A N/A 41.4

[0097] The results demonstrate that a number of SMN2 antisense oligonucleotides can alter splicing of SMN2 pre-mRNAs. ISIS 383467, ISIS 383468, ISIS 383469, ISIS 383470, ISIS 383476 and ISIS 383477 inhibited inclusion of exon 7; ISIS 383474, ISIS 383475 and ISIS 372648 significantly increased inclusion of exon 7; and ISIS 383466, ISIS 383471, ISIS 383472 and ISIS 383473 appeared to have little effect on SMN2 splicing, relative to oligonucleotide and vehicle controls. These results suggest that SMN2 oligonucleotides with a target site between nucleotides 94-96 are particularly effective at achieving inclusion of exon 7 during SMN2 pre-mRNA splicing, and further suggests oligonucleotides 15 nucleotides in length are more effective than those 18 nucleotides in length.

Example 6

Effect of Antisense Compounds on SMN2 Splicing in SMA Fibroblast Cells

[0098] In accordance with the present invention, SMN2 antisense oligonucleotides were tested in fibroblast cells derived from a patient with type I SMA (3813 cell line; Coovert et al., Human Mol. Genet., 1997, 6, 1205-1214). SMA fibroblasts contain SMN2, but do not express SMN1. SMA fibroblasts were lipofected with 200 nM of either SMN2 antisense oligonucleotide ISIS 372641, ISIS 372642, ISIS 372643, ISIS 372644, ISIS 372645, ISIS 372646, ISIS 372647, ISIS 372648 or ISIS 372649, or control oligonucleotide ISIS 372693. Seventy hours after transfection, RNA was isolated and RT-PCR was performed as described above to examine splicing changes of endogenous SMN2 pre-mRNAs. PCR products were separated by electrophoresis and analyzed by autoradiography. The percentage of SMN2 spliced transcripts containing exon 7 (% inclusion) is shown in Table 6. The target site of each oligonucleotide relative to SEQ ID NO: 1 is also indicated.

TABLE-US-00006 TABLE 6 Effect on SMN2 antisense oligonucleotides on exon 7 inclusion in SMA fibroblasts Target ISIS # Site % Inclusion 372641 61 41.8 372642 66 55.2 372643 71 40.9 372644 76 43.4 372645 81 43.7 372646 86 38.8 372647 91 43.6 372648 96 49.8 372649 100 48.8 372693 Control 48.7 PBS N/A 48.8

[0099] In accordance with previous findings, treatment with ISIS 372642 and ISIS 372648 generated a greater percentage of SMN2 splicing products containing exon 7.

[0100] A second experiment to further evaluate ISIS 372642 and ISIS 383475 in SMA fibroblasts was performed. SMA fibroblasts were lipofected with either 200 nM ISIS 372642, 200 nM ISIS 383475, or 100 nM ISIS 372642 in combination with 100 nM ISIS 383475. ISIS 372693 (200 nM) and vehicle only were also used as controls. Fifty hours after transfection, RNA was isolated and RT-PCR was performed. PCR products were separated by electrophoresis and analyzed by autoradiography. The percentage of SMN2 spliced transcripts containing exon 7 (% inclusion) is shown in Table 7.

TABLE-US-00007 TABLE 7 Effect of ISIS 372642 and ISIS 383475 on exon 7 inclusion in SMA fibroblasts Treatment (ISIS #) % Inclusion 372642 47.8 383475 53.9 372642 & 383475 49.2 372693 36.3 Vehicle 35.0

[0101] The results demonstrate that treatment with ISIS 372642 or ISIS 383475, either alone or in combination, leads to greater inclusion of exon 7 in SMA transcripts.

Example 7

Microwalk of ISIS 372642 and ISIS 372648 Target Sites

[0102] The studies shown above demonstrated that both ISIS 372642 and ISIS 372648 were effective in promoting SMN2 exon 7 inclusion. To further evaluate the target sites surrounding these compounds, additional compounds were designed as 1 nucleotide microwalks around each site (see Table 1 for sequences and target sites). Ten compounds 12 nucleotides in length were designed for each microwalk. Seven additional compounds 15 or 16 nucleotides in length were designed to target the region of ISIS 372642. The antisense compounds targeting the 3' end of exon 7 (ISIS 383466-382477), described above in Example 5, were included for comparison with the ISIS 372648 microwalk compounds. Each compound was evaluated in the SMN2 minigene splicing assay and the endogenous SMN1/SMN2 splicing assay in HEK293 cells. Both assays are described in previous examples herein. The results are in shown in Tables 8 and 9.

TABLE-US-00008 TABLE 8 ISIS 372642 Microwalk Compounds: Effect on Exon 7 Inclusion % Inclusion % Inclusion % Inclusion Target SMN2 Endogenous Endogenous ISIS # Site Length Minigene SMN2 SMN1 385909 62 15 44 43 81 383497 63 12 55 51 86 385908 63 15 49 53 85 383496 64 12 32 36 81 385907 64 15 56 54 86 383495 65 12 54 49 85 385906 65 15 56 57 87 385910 65 16 60 66 89 372642 66 15 66 74 89 383494 66 12 57 51 86 383493 67 12 57 52 85 385905 67 15 74 85 89 383492 68 12 60 56 85 385904 68 15 9 6 19 383491 69 12 38 41 81 383490 70 12 51 49 84 383489 71 12 13 27 76 383488 72 12 24 38 82 Control N/A N/A 52 51 86 Control N/A N/A 53 50 86

TABLE-US-00009 TABLE 9 ISIS 372648 Microwalk Compounds: Effect on Exon 7 Inclusion % Inclusion % Inclusion % Inclusion Target SMN2 Endogenous Endogenous ISIS # Site Length Minigene SMN2 SMN1 383470 92 18 8 12 63 383477 92 15 6 7 38 383469 93 18 29 26 89 383476 93 15 36 31 87 383487 93 12 11 16 79 383468 94 18 31 26 88 383475 94 15 85 88 96 383486 94 12 44 41 91 383467 95 18 14 13 82 383474 95 15 79 71 94 383485 95 12 63 60 93 372648 96 15 70 57 93 383466 96 18 38 43 92 383484 96 12 65 56 92 383473 97 15 62 53 94 383483 97 12 63 56 94 383472 98 15 41 46 93 383482 98 12 59 45 94 383471 99 15 38 47 92 383481 99 12 42 46 92 383480 100 12 39 48 91 383479 101 12 44 44 92 383478 102 12 47 41 93 Control N/A N/A 41 44 93 Control N/A N/A 44 48 92

[0103] In accordance with previous results, treatment with ISIS 372642, ISIS 372648 or ISIS 383475 led to a significant increase in exon 7 inclusion. In addition, ISIS 385905 was identified as a particularly effective compound for promoting exon 7 inclusion. To further evaluate ISIS 385905 and ISIS 383475, dose-response and duration of action studies were performed. To determine the effect of oligonucleotide dose, HEK293 cells were electroporated with either ISIS 385905 or ISIS 383475 at a concentration of 0, 0.2, 0.5, 1, 2, 5, 10 or 20 .mu.M. Sixty hours after electroporation, RNA was isolated and RT-PCR was performed as described above to determine the extent of exon 7 inclusion. The results, expressed as % inclusion of exon 7, are shown in Table 10.

TABLE-US-00010 TABLE 10 Dose-response of ISIS 385905 and ISIS 383475 0 0.2 0.5 1.0 2.0 5.0 10 20 ISIS # .mu.m .mu.m .mu.m .mu.m .mu.m .mu.m .mu.m .mu.m 385905 50 53 61 65 74 78 82 87 383475 51 57 65 72 77 83 87 89

[0104] The results show a dose-dependent increase in exon 7 inclusion following treatment with either compound. To assess duration of action, HEK293 cells were electroporated with 10 .mu.M of either compound and RNA was isolated and subjected to RT-PCR at day 0, 1, 2, 3, 4 and 5. The results, expressed as % inclusion of exon 7, are shown in Table 11.

TABLE-US-00011 TABLE 11 Duration of Action of ISIS 385905 and ISIS 383475 ISIS # Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 385905 49 80 83 82 85 79 383475 48 84 89 88 89 83

[0105] These results demonstrate a significant increase in exon 7 inclusion following treatment of either compound, and further show the compounds are effective for at least five days.

[0106] Taken together, the results of the experiments detailed above demonstrate that antisense compounds having a target site (5'-most nucleotide to which the compound binds) of nucleotides 64-68 or 94-97 of SEQ ID NO: 1 are most effective at promoting exon 7 inclusion in SMN2 transcripts. The target sites of these compounds overlap with predicted ESS (exonic splicing silencer) elements, without having significant overlap with predicted ESE (exonic splicing enhancer) elements. Thus, the antisense compounds described herein may function by blocking binding of trans splicing factors to particular cis regulatory elements, thereby influencing splice site selection and specifically, inclusion or exclusion of exon 7 from SMN2 mRNAs.

Example 8

Effect of Compounds Targeting Exon 7 or Intron 7 on Inclusion of Exon 7

[0107] In previous examples herein, antisense compounds ISIS 372642, ISIS 385905 and ISIS 383475, each of which target exon 7, were shown to significantly increase inclusion of SMN2 exon 7. These exon 7-targeted compounds and a compound targeting SMN2 intron 7 (ISIS 387949) were compared for their capacity to promote exon 7 inclusion. As described in previous examples herein, HEK293 cells were electroporated with 10 .mu.M of oligonucleotide and RT-PCR was performed after two days to examine splicing changes of endogenous SMN1 and SMN2. In comparison to control oligonucleotide, the compounds targeted to exon 7 exhibited a significant increase in exon 7 inclusion, as expected. In addition, the intron 7 targeted compound led to incorporation of exon 7 in nearly all SMN1 and SMN2 mRNAs. These results suggest antisense compounds targeted to intronic sequences also contribute to incorporation of SMN2 exon 7. Intronic sequences also are known to contain splicing regulatory elements (i.e. intronic splicing enhancers and intronic splicing silencers), providing a possible mechanism of action for ISIS 387949.

Example 9

Systematic Mapping of Intronic Splicing Silencers (ISSs)

[0108] To further investigate whether antisense compounds targeting the introns flanking exon 7 of SMN2 could alter inclusion of exon 7, such as by interfering with intronic splicing silencers, compounds were designed to target the 60 nucleotides of intron 6 (nucleotides 1-60 of SEQ ID NO: 1) or the 60 nucleotides of intron 7 (nucleotides 115-174 of SEQ ID NO: 1) immediately adjacent to exon 7. Antisense compounds targeting intron 6 (ISIS 390636, ISIS 390637, ISIS 390638, ISIS 390639, ISIS 390640, ISIS 390641, ISIS 390642, ISIS 390643, ISIS 390644 and ISIS 390645) or intron 7 (ISIS 390646, ISIS 390647, ISIS 390648, ISIS 390649, ISIS 390650, ISIS 390651, ISIS 390652, ISIS 390653, ISIS 390654 and ISIS 390655) are show above in Table 1. Each compound was tested in three different assays to evaluate their effect on exon 7 inclusion: SMN2 minigene splicing in cell-free extracts, SMN2 minigene splicing in transfected HEK293 cells and splicing of endogenous SMN2 in HEK293 cells. The results obtained from the three assays demonstrated that several antisense compounds were able to increase inclusion of exon 7. In particular, ISIS 390644 and ISIS 390648 were the most effect intron 6 and intron 7-targeted compounds, respectively.

[0109] To further investigate the regions targeted by ISIS 390644 and ISIS 390648, additional compounds were designed as microwalks around these target sequences (see Table 1 for sequences). For these experiments, compounds 12 and 15 nucleotides in length were designed and tested in accordance with the procedures detailed in previous examples herein. Compounds targeting the region of ISIS 390644 (intron 6) were tested in the in vitro SMN2 minigene assay and endogenous SMN1/SMN2 assay in HEK293 cells. The results are shown in Table 12.

TABLE-US-00012 TABLE 12 Results of Microwalk of Intron 6 Compound ISIS 390644 % Inclusion % Inclusion Target SMN2 Endogenous ISIS # Site Length minigene SMN2 393586 10 15 10 32 393587 9 15 18 44 393588 8 15 32 60 393589 7 15 59 79 390644 6 15 65 75 393590 5 15 49 67 393591 4 15 20 46 393592 3 15 22 44 393593 2 15 29 50 393594 13 12 20 44 393595 12 12 13 39 393596 11 12 15 44 393597 10 12 13 39 393598 9 12 17 48 393599 8 12 30 64 393600 7 12 28 62 393601 6 12 44 63 393602 5 12 29 46 Control N/A N/A 22 43

[0110] As shown in Table 12, antisense compounds having a target site of nucleotides 5-8 (SEQ ID NO: 1) results in the greatest percentage of transcripts containing exon 7. These findings suggest this region of intron 6 contains an intronic splicing silencer, which normally functions to inhibit inclusion of exon 7. Upon blockade of this regulatory element, splice site selection is altered to promote exon 7 inclusion.

[0111] Compounds targeting the region of 390648 (intron 7) were assayed using the SMN2 minigene in vitro and in transfected HEK293 cells and tested in the endogenous SMN2 splicing assay in HEK293 cells. The results are shown in Table 13.

TABLE-US-00013 TABLE 13 Results of Microwalk of Intron 7 Compound ISIS 390648 % Inclusion % Inclusion % Inclusion Target SMN2 in vitro SMN2 Endogenous ISIS # Site Length minigene minigene SMN2 393603 129 15 43 51 76 393604 128 15 46 75 97 393605 127 15 57 97 100 393606 126 15 56 97 100 390648 125 15 53 98 100 393607 124 15 67 100 100 393608 123 15 75 100 100 393609 122 15 60 97 100 393610 121 15 54 58 78 393611 132 12 41 17 40 393612 131 12 39 30 58 393613 130 12 42 43 64 393614 129 12 48 43 64 393615 128 12 38 36 44 393616 127 12 38 30 90 393617 126 12 36 30 92 393618 125 12 44 71 97 393619 124 12 69 92 97 Control N/A N/A 28 23 44

[0112] While all compounds led to an increase in exon 7 inclusion, compounds with target sites between nucleotides 121 and 129 (SEQ ID NO: 1) were most effective.

[0113] Select compounds targeting intron 7 were further evaluated for SMN2 exon 7 inclusion following transfection at a low oligonucleotide dose of 0.1 .mu.M. As previously described herein, HEK293 cells were electroporated with ISIS 393605, ISIS 393606, ISIS 390648, ISIS 393607, ISIS 393608, ISIS 393609, ISIS 393617, ISIS 393618 or ISIS 393619 and levels of endogenous SMN2 splice products were determined. The results are shown in Table 14.

TABLE-US-00014 TABLE 14 Effect on SMN2 Exon 7 Incorporation Following Low-Dose Treatment % Inclusion Target Endogenous ISIS # Site Length SMN2 393605 127 15 56 393606 126 15 58 390648 125 15 60 393607 124 15 60 393608 123 15 63 393609 122 15 53 393617 126 12 51 393618 125 12 51 393619 124 12 57 Control N/A N/A 49

[0114] As shown in Table 14, even at a very low dose, antisense compounds targeting intron 7 are effective at promoting inclusion of exon 7. Taken together, these results suggest the region near the 5' end of intron 7 (encompassing nucleotides 121-129 of SEQ ID NO: 1) contains an intronic splicing silencer.

Sequence CWU 1

1

1141174DNAHomo sapiens 1atatatagct atctatatct atatagctat tttttttaac ttcctttatt ttccttacag 60ggttttagac aaaatcaaaa agaaggaagg tgctcacatt ccttaaatta aggagtaagt 120ctgccagcat tatgaaagtg aatcttactt ttgtaaaact ttatggtttg tgga 174215DNAArtificial SequenceAntisense Compound 2tagatagcta tatat 15315DNAArtificial SequenceAntisense Compound 3atagatagct atata 15415DNAArtificial SequenceAntisense Compound 4tatagatagc tatat 15515DNAArtificial SequenceAntisense Compound 5atatagatag ctata 15615DNAArtificial SequenceAntisense Compound 6gatatagata gctat 15712DNAArtificial SequenceAntisense Compound 7atagatagct at 12815DNAArtificial SequenceAntisense Compound 8agatatagat agcta 15912DNAArtificial SequenceAntisense Compound 9tatagatagc ta 121015DNAArtificial SequenceAntisense Compound 10tagatataga tagct 151112DNAArtificial SequenceAntisense Compound 11atatagatag ct 121215DNAArtificial SequenceAntisense Compound 12atagatatag atagc 151312DNAArtificial SequenceAntisense Compound 13gatatagata gc 121415DNAArtificial SequenceAntisense Compound 14tatagatata gatag 151512DNAArtificial SequenceAntisense Compound 15agatatagat ag 121615DNAArtificial SequenceAntisense Compound 16atatagatat agata 151712DNAArtificial SequenceAntisense Compound 17tagatataga ta 121815DNAArtificial SequenceAntisense Compound 18tatatagata tagat 151912DNAArtificial SequenceAntisense Compound 19atagatatag at 122012DNAArtificial SequenceAntisense Compound 20tatagatata ga 122112DNAArtificial SequenceAntisense Compound 21atatagatat ag 122215DNAArtificial SequenceAntisense Compound 22atagctatat agata 152315DNAArtificial SequenceAntisense Compound 23aaaaaatagc tatat 152415DNAArtificial SequenceAntisense Compound 24gttaaaaaaa atagc 152515DNAArtificial SequenceAntisense Compound 25aggaagttaa aaaaa 152615DNAArtificial SequenceAntisense Compound 26aataaaggaa gttaa 152715DNAArtificial SequenceAntisense Compound 27aggaaaataa aggaa 152815DNAArtificial SequenceAntisense Compound 28ctgtaaggaa aataa 152915DNAArtificial SequenceAntisense Compound 29attttgtcta aaacc 153015DNAArtificial SequenceAntisense Compound 30gattttgtct aaaac 153112DNAArtificial SequenceAntisense Compound 31ttttgtctaa aa 123215DNAArtificial SequenceAntisense Compound 32tgattttgtc taaaa 153312DNAArtificial SequenceAntisense Compound 33attttgtcta aa 123415DNAArtificial SequenceAntisense Compound 34ttgattttgt ctaaa 153512DNAArtificial SequenceAntisense Compound 35gattttgtct aa 123615DNAArtificial SequenceAntisense Compound 36tttgattttg tctaa 153716DNAArtificial SequenceAntisense Compound 37ttttgatttt gtctaa 163815DNAArtificial SequenceAntisense Compound 38ttttgatttt gtcta 153912DNAArtificial SequenceAntisense Compound 39tgattttgtc ta 124012DNAArtificial SequenceAntisense Compound 40ttgattttgt ct 124115DNAArtificial SequenceAntisense Compound 41tttttgattt tgtct 154212DNAArtificial SequenceAntisense Compound 42tttgattttg tc 124315DNAArtificial SequenceAntisense Compound 43ctttttgatt ttgtc 154412DNAArtificial SequenceAntisense Compound 44ttttgatttt gt 124512DNAArtificial SequenceAntisense Compound 45tttttgattt tg 124615DNAArtificial SequenceAntisense Compound 46cttctttttg atttt 154712DNAArtificial SequenceAntisense Compound 47ctttttgatt tt 124812DNAArtificial SequenceAntisense Compound 48tctttttgat tt 124915DNAArtificial SequenceAntisense Compound 49ccttccttct ttttg 155015DNAArtificial SequenceAntisense Compound 50gagcaccttc cttct 155115DNAArtificial SequenceAntisense Compound 51aatgtgagca ccttc 155215DNAArtificial SequenceAntisense Compound 52taaggaatgt gagca 155318DNAArtificial SequenceAntisense Compound 53aatttaagga atgtgagc 185415DNAArtificial SequenceAntisense Compound 54ttaaggaatg tgagc 155518DNAArtificial SequenceAntisense Compound 55taatttaagg aatgtgag 185615DNAArtificial SequenceAntisense Compound 56tttaaggaat gtgag 155712DNAArtificial SequenceAntisense Compound 57aaggaatgtg ag 125818DNAArtificial SequenceAntisense Compound 58ttaatttaag gaatgtga 185915DNAArtificial SequenceAntisense Compound 59atttaaggaa tgtga 156012DNAArtificial SequenceAntisense Compound 60taaggaatgt ga 126118DNAArtificial SequenceAntisense Compound 61cttaatttaa ggaatgtg 186215DNAArtificial SequenceAntisense Compound 62aatttaagga atgtg 156312DNAArtificial SequenceAntisense Compound 63ttaaggaatg tg 126415DNAArtificial SequenceAntisense Compound 64taatttaagg aatgt 156518DNAArtificial SequenceAntisense Compound 65ccttaattta aggaatgt 186612DNAArtificial SequenceAntisense Compound 66tttaaggaat gt 126715DNAArtificial SequenceAntisense Compound 67ttaatttaag gaatg 156812DNAArtificial SequenceAntisense Compound 68atttaaggaa tg 126915DNAArtificial SequenceAntisense Compound 69cttaatttaa ggaat 157012DNAArtificial SequenceAntisense Compound 70aatttaagga at 127115DNAArtificial SequenceAntisense Compound 71ccttaattta aggaa 157212DNAArtificial SequenceAntisense Compound 72taatttaagg aa 127315DNAArtificial SequenceAntisense Compound 73tccttaattt aagga 157412DNAArtificial SequenceAntisense Compound 74ttaatttaag ga 127512DNAArtificial SequenceAntisense Compound 75cttaatttaa gg 127612DNAArtificial SequenceAntisense Compound 76ccttaattta ag 127715DNAArtificial SequenceAntisense Compound 77tgctggcaga cttac 157815DNAArtificial SequenceAntisense Compound 78cataatgctg gcaga 157915DNAArtificial SequenceAntisense Compound 79tcataatgct ggcag 158015DNAArtificial SequenceAntisense Compound 80ttcataatgc tggca 158115DNAArtificial SequenceAntisense Compound 81tttcataatg ctggc 158220DNAArtificial SequenceAntisense Compound 82attcactttc ataatgctgg 208315DNAArtificial SequenceAntisense Compound 83ctttcataat gctgg 158412DNAArtificial SequenceAntisense Compound 84tcataatgct gg 128515DNAArtificial SequenceAntisense Compound 85actttcataa tgctg 158612DNAArtificial SequenceAntisense Compound 86ttcataatgc tg 128715DNAArtificial SequenceAntisense Compound 87cactttcata atgct 158812DNAArtificial SequenceAntisense Compound 88tttcataatg ct 128915DNAArtificial SequenceAntisense Compound 89tcactttcat aatgc 159012DNAArtificial SequenceAntisense Compound 90ctttcataat gc 129115DNAArtificial SequenceAntisense Compound 91ttcactttca taatg 159212DNAArtificial SequenceAntisense Compound 92actttcataa tg 129315DNAArtificial SequenceAntisense Compound 93attcactttc ataat 159412DNAArtificial SequenceAntisense Compound 94cactttcata at 129515DNAArtificial SequenceAntisense Compound 95gattcacttt cataa 159612DNAArtificial SequenceAntisense Compound 96tcactttcat aa 129712DNAArtificial SequenceAntisense Compound 97ttcactttca ta 129812DNAArtificial SequenceAntisense Compound 98attcactttc at 129915DNAArtificial SequenceAntisense Compound 99agtaagattc acttt 1510015DNAArtificial SequenceAntisense Compound 100acaaaagtaa gattc 1510115DNAArtificial SequenceAntisense Compound 101gttttacaaa agtaa 1510215DNAArtificial SequenceAntisense Compound 102ataaagtttt acaaa 1510315DNAArtificial SequenceAntisense Compound 103aaaccataaa gtttt 1510415DNAArtificial SequenceAntisense Compound 104tccacaaacc ataaa 1510510DNAArtificial SequenceConsensus splice site 105gtaagtactt 1010637DNAArtificial SequencePrimer 106agataaaagg ttaatctaga tccctactag aattctc 3710737DNAArtificial SequencePrimer 107gagaattcta gtagggatct agattaacct tttatct 3710824DNAArtificial SequencePrimer 108aattgctaac gcagtcagtg cttc 2410933DNAArtificial SequencePrimer 109aatatgatca gcaaaacaaa gtcacataac tac 3311042DNAArtificial SequencePrimer 110gtgactttgt tttgctgatc atattttgtt gaataaaata ag 4211124DNAArtificial SequencePrimer 111aatgtatctt atcatgtctg ctcg 2411224DNAArtificial SequencePrimer 112aatgtatctt atcatgtctg ctcg 2411338DNAArtificial SequencePrimer 113aagtacttac ctgtaacgct tcacattcca gatctgtc 3811415DNAArtificial SequenceAntisense Compound 114ttgtattcta tgttt 15

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed