U.S. patent application number 15/923771 was filed with the patent office on 2018-07-26 for method for in situ inhibition of regulatory t cells.
The applicant listed for this patent is CELLECTIS. Invention is credited to Philippe DUCHATEAU, Laurent POIROT.
Application Number | 20180208896 15/923771 |
Document ID | / |
Family ID | 50158998 |
Filed Date | 2018-07-26 |
United States Patent
Application |
20180208896 |
Kind Code |
A1 |
POIROT; Laurent ; et
al. |
July 26, 2018 |
METHOD FOR IN SITU INHIBITION OF REGULATORY T CELLS
Abstract
The present invention pertains to engineered T-cells, method for
their preparation and their use as medicament, particularly for
immunotherapy. The engineered T-cells of the invention are designed
to express both a Chimeric Antigen Receptor (CAR) directed against
at least one antigen expressed at the surface of a malignant or
infected cell, and a secreted inhibitor of regulatory T-cells
(Treg). Preferably, such secreted inhibitor is a peptide inhibitor
of forkhead/winged helix transcription factor 3 (FoxP3), a specific
factor involved into the differentiation of T-cells into regulatory
T-cells. The engineered T-cells of the invention direct their
immune activity towards specific malignant or infected cells, while
at the same time will prevent neighbouring regulatory T-cells from
modulating the immune response. The invention opens the way to
standard and affordable adoptive immunotherapy strategies,
especially for treating or preventing cancer, and bacterial or
viral infections.
Inventors: |
POIROT; Laurent; (Paris,
FR) ; DUCHATEAU; Philippe; (Draveil, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CELLECTIS |
Paris |
|
FR |
|
|
Family ID: |
50158998 |
Appl. No.: |
15/923771 |
Filed: |
March 16, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15120060 |
Aug 18, 2016 |
|
|
|
PCT/EP2015/053592 |
Feb 20, 2015 |
|
|
|
15923771 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 16/2866 20130101;
A61K 35/17 20130101; C07K 14/4703 20130101; C07K 2317/622 20130101;
C12N 9/16 20130101; A61P 35/02 20180101; C12N 2501/60 20130101;
C07K 2319/74 20130101; C07K 16/2803 20130101; C07K 14/7155
20130101; A61P 35/00 20180101; C07K 14/7051 20130101; C12N 5/0636
20130101; C12N 2510/00 20130101; A61P 31/12 20180101; C12N 5/0638
20130101 |
International
Class: |
C12N 5/0783 20060101
C12N005/0783; C07K 14/715 20060101 C07K014/715; C07K 16/28 20060101
C07K016/28; A61K 35/17 20060101 A61K035/17; C12N 9/16 20060101
C12N009/16; C07K 14/47 20060101 C07K014/47; C07K 14/725 20060101
C07K014/725 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 21, 2014 |
DK |
PA201470088 |
Claims
1. A method for preparing an engineered T-cell comprising the steps
of: a) providing a T-cell; b) introducing into said T-cell an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a first Chimeric Antigen Receptor (CAR) directed against
at least one antigen expressed at the surface of a malignant or
infected cell; and c) introducing into said T-cell an exogenous
nucleic acid molecule comprising a nucleotide sequence coding for
an inhibitor of regulatory T-cell activity.
2. The method according to claim 1, wherein the inhibitor of
regulatory T-cell activity is an inhibitor of FoxP3.
3. The method according to claim 2, wherein the inhibitor of FoxP3
is a cell penetrating peptide.
4. The method according to any one of claims 1 to 3, further
comprising the step of: d) introducing into said T-cell an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a second Chimeric Antigen Receptor directed against at
least one antigen expressed at the surface of a regulatory T-cell
(Treg).
5. The method according to any one of claims 1 to 4, further
comprising the step of: e) introducing into said T-cell an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a rare-cutting endonuclease able to selectively
inactivate by DNA cleavage at least one gene coding for one
component of the T-Cell receptor (TCR).
6. The method according to any one of claims 1 to 5, further
comprising the step of: f) introducing into said T-cell an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a rare-cutting endonuclease able to selectively
inactivate by DNA cleavage the gene coding for the surface antigen
CD25.
7. The method according to any one of claims 1 to 6, further
comprising the step of: g) expanding the resulting engineered
T-cell.
8. The method according to any one of claims 3 to 7, wherein the
cell-penetrating peptide inhibitor of FoxP3 is a polypeptide
comprising the amino acid sequence set forth in SEQ ID NO: 1 or a
variant thereof comprising an amino acid sequence that has at least
60%, such as at least 80% sequence identity with the amino acid
sequence set forth in SEQ ID NO: 1 over the entire length of SEQ ID
NO: 1.
9. The method according to any one of claims 1 to 8, wherein the
first Chimeric Antigen Receptor is directed against the
B-lymphocyte antigen CD19.
10. The method according to any one of claims 1 to 8, wherein the
first Chimeric Antigen Receptor is directed against an antigen
selected from a cluster of differentiation molecule, such as CD16,
CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123 and
CD138, a tumor-associated surface antigen, such as ErbB2
(HER2/neu), carcinoembryonic antigen (CEA), epithelial cell
adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR),
EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40,
disialoganglioside GD2, ductal-epithelial mucine, gp36, TAG-72,
glycosphingolipids, glioma-associated antigen, .beta.-human
chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive
AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse
transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut
hsp70-2, M-CSF, prostase, prostase specific antigen (PSA), PAP,
NY-ESO-1, LAGA-1a, p53, prostein, PSMA, surviving and telomerase,
prostate-carcinoma tumor antigen-1 (PCTA-1), MAGE, ELF2M,
neutrophil elastase, ephrin B2, CD22, insulin growth factor
(IGF1)-I, IGF-II, IGFI receptor, mesothelin, a major
histocompatibility complex (MHC) molecule presenting a
tumor-specific peptide epitope, 5T4, ROR1, Nkp30, NKG2D, tumor
stromal antigens, the extra domain A (EDA) and extra domain B (EDB)
of fibronectin and the A1 domain of tenascin-C (TnC A1) and
fibroblast associated protein (fap); a lineage-specific or tissue
specific antigen such as CD3, CD4, CD8, CD24, CD25, CD33, CD34,
CD133, CD138, CTLA-4, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine
receptors, endoglin, a major histocompatibility complex (MHC)
molecule, BCMA (CD269, TNFRSF 17), multiple myeloma or
lymphoblastic leukaemia antigen, such as one selected from TNFRSF17
(UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRCSD (UNIPROT Q9NZD1),
FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708), and FCRL5
(UNIPROT Q68SN8), a virus-specific surface antigen such as an
HIV-specific antigen (such as HIV gp120); an EBV-specific antigen,
a CMV-specific antigen, a HPV-specific antigen, a Lasse
Virus-specific antigen, an Influenza Virus-specific antigen as well
as any derivate or variant of these surface antigens.
11. The method according to any one of claims 1 to 10, wherein the
first or second Chimeric Antigen Receptor is a single chain
Chimeric Antigen Receptor.
12. The method according to any one of claims 1 to 10, wherein the
first or second Chimeric Antigen Receptor is a multi-chain Chimeric
Antigen Receptor.
13. The method according to any one of claims 4 to 13, wherein the
second Chimeric Antigen Receptor is directed against surface
antigen CD25.
14. The method according to any one of claims 4 to 13, wherein the
second Chimeric Antigen Receptor is directed against a first
surface antigen which is CD25 and a second surface antigen which is
selected from the group consisting of CD4, CD152, IL3R, CCR4, CCR6,
CD161 and CXR3.
15. The method according to any one of claims 5 to 14, wherein the
rare-cutting endonuclease according to e) selectively inactivates
the gene coding for TCR alpha or TCR beta.
16. The method according to any one of claims 1 to 15, wherein said
T-cell is derived from a cytotoxic T-lymphocyte.
17. An engineered, preferably isolated, T-cell comprising: a) an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a first Chimeric Antigen Receptor (CAR) directed against
at least one antigen expressed at the surface of a malignant or
infected cell; and b) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for an inhibitor of regulatory T-cell
activity.
18. The engineered T-cell according to claim 17, wherein the
inhibitor of regulatory T-cell activity is an inhibitor of
FoxP3.
19. The engineered T-cell according to claim 18, wherein the
inhibitor of FoxP3 is a cell penetrating peptide.
20. The engineered T-cell according to any one of claims 17 to 19,
wherein said first Chimeric Antigen Receptor and said inhibitor of
regulatory T-cell activity are expressed by said T-cell.
21. The engineered T-cell according to any one of claims 17 to 20,
further comprising: c) an exogenous nucleic acid molecule
comprising a nucleotide sequence coding for a second Chimeric
Antigen Receptor directed against at least one antigen expressed at
the surface of a regulatory T-cell (Treg).
22. The engineered T-cell according to claim 21, wherein said
second Chimeric Antigen Receptor is expressed by said T-cell.
23. The engineered T-cell according to any one of claims 17 to 22,
further comprising: d) an exogenous nucleic acid molecule
comprising a nucleotide sequence coding for a rare-cutting
endonuclease able to selectively inactivate by DNA cleavage at
least one gene coding for one component of the T-Cell receptor
(TCR).
24. The engineered T-cell according to any one of claims 17 to 23,
wherein said cell further comprises a deletion or a mutation into
at least one gene coding for one component of the T-Cell receptor
(TCR).
25. The engineered T-cell according to any one of claims 19 to 24,
wherein the cell-penetrating peptide inhibitor of FoxP3 is a
polypeptide comprising the amino acid sequence set forth in SEQ ID
NO: 1 or a variant thereof comprising an amino acid sequence that
has at least 60%, such as at least 80% sequence identity with the
amino acid sequence set forth in SEQ ID NO: 1 over the entire
length of SEQ ID NO: 1.
26. The engineered T-cell according to any one of claims 17 to 25,
wherein the first Chimeric Antigen Receptor is directed against the
B-lymphocyte antigen CD19.
27. The engineered T-cell according to any one of claims 17 to 25,
wherein the first Chimeric Antigen Receptor is directed against an
antigen selected from a cluster of differentiation molecule, such
as CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71,
CD123 and CD138, a tumor-associated surface antigen, such as ErbB2
(HER2/neu), carcinoembryonic antigen (CEA), epithelial cell
adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR),
EGFR variant III (EGFRvIII), CD19, CD20, CD30, CD40,
disialoganglioside GD2, ductal-epithelial mucine, gp36, TAG-72,
glycosphingolipids, glioma-associated antigen, .beta.-human
chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive
AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse
transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut
hsp70-2, M-CSF, prostase, prostase specific antigen (PSA), PAP,
NY-ESO-1, LAGA-1a, p53, prostein, PSMA, surviving and telomerase,
prostate-carcinoma tumor antigen-1 (PCTA-1), MAGE, ELF2M,
neutrophil elastase, ephrin B2, CD22, insulin growth factor
(IGF1)-I, IGF-II, IGFI receptor, mesothelin, a major
histocompatibility complex (MHC) molecule presenting a
tumor-specific peptide epitope, 5T4, ROR1, Nkp30, NKG2D, tumor
stromal antigens, the extra domain A (EDA) and extra domain B (EDB)
of fibronectin and the A1 domain of tenascin-C(TnC A1) and
fibroblast associated protein (fap); a lineage-specific or tissue
specific antigen such as CD3, CD4, CD8, CD24, CD25, CD33, CD34,
CD133, CD138, CTLA-4, B7-1 (CD80), B7-2 (CD86), GM-CSF, cytokine
receptors, endoglin, a major histocompatibility complex (MHC)
molecule, BCMA (CD269, TNFRSF 17), multiple myeloma or
lymphoblastic leukaemia antigen, such as one selected from TNFRSF17
(UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRC5D (UNIPROT Q9NZD1),
FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708), and FCRL5
(UNIPROT Q68SN8), a virus-specific surface antigen such as an
HIV-specific antigen (such as HIV gp120); an EBV-specific antigen,
a CMV-specific antigen, a HPV-specific antigen, a Lasse
Virus-specific antigen, an Influenza Virus-specific antigen as well
as any derivate or variant of these surface antigens.
28. The engineered T-cell according to any one of claims 17 to 27,
wherein the first or second Chimeric Antigen Receptor is a single
chain Chimeric Antigen Receptor.
29. The engineered T-cell according to any one of claims 17 to 27,
wherein the first or second Chimeric Antigen Receptor is a
multi-chain Chimeric Antigen Receptor.
30. The engineered T-cell according to any one of claims 17 to 29,
wherein the second Chimeric Antigen Receptor is mono-specific.
31. The engineered T-cell according to any one of claims 17 to 29,
wherein the second Chimeric Antigen Receptor is multi-specific.
32. The engineered T-cell according to any one of claims 17 to 31,
wherein the second Chimeric Antigen Receptor is directed against
surface antigen CD25.
33. The engineered T-cell according to claim 31, wherein the second
Chimeric Antigen Receptor is directed against a first surface
antigen which is CD25 and a second surface antigen which is
selected from the group consisting of CD4, CD152, IL3R, CCR4, CCR6,
CD161 and CXR3.
34. The engineered T-cell according to any one of claims 17 to 33,
wherein said T-cell expresses a rare-cutting endonuclease that
selectively inactivates the gene coding for TCR alpha or TCR
beta.
35. The engineered T-cell according to any one of claims 17 to 34,
wherein said T-cell is derived from a cytotoxic T-lymphocyte.
36. The engineered T-cell according to any one of claims 17 to 35
for use as a medicament.
37. The engineered T-cell according to any one of claims 17 to 35
for use in the treatment of a cancer or viral infection.
38. The engineered T-cell according to any one of claims 17 to 35
for use in the treatment of lymphoma.
39. A composition comprising at least one genetically engineered
T-cell according to any one of claims 17 to 35.
40. An isolated nucleic acid molecule comprising a nucleotide
sequence coding for a Chimeric Antigen Receptor (CAR) directed
against at least one antigen expressed at the surface of a
malignant or infected cell; and a nucleotide sequence coding for an
inhibitor of regulatory T-cell activity, such as a cell-penetrating
peptide inhibitor of FoxP3.
41. The isolated nucleic acid according to claim 40, wherein said
nucleotide sequence coding for said Chimeric Antigen Receptor (CAR)
and said nucleotide sequence coding for an inhibitor of regulatory
T-cell activity are operatively linked to each other by a
nucleotide sequence coding for ribosomal skip sequence, such as a
nucleotide sequence coding for a 2A peptide.
42. The isolated nucleic acid according to claim 40 or 41, which is
a vector, such as a viral vector or plasmid, and said nucleotide
sequences being operatively linked to one or more promoters
suitable for expression in a T-cell.
43. A composition comprising one or more nucleic acid molecules
comprising a nucleotide sequence coding for a first Chimeric
Antigen Receptor (CAR) directed against at least one antigen
expressed at the surface of a malignant or infected cell; and a
nucleotide sequence coding for an inhibitor of regulatory T-cell
activity, such as a cell-penetrating peptide inhibitor of
FoxP3.
44. The composition according to claim 43, comprising a nucleic
acid molecule comprising a nucleotide sequence coding for said
first Chimeric Antigen Receptor (CAR); and a nucleotide sequence
coding for said inhibitor of regulatory T-cell activity.
45. The composition according to claim 43, comprising a first
nucleic acid molecule comprising a nucleotide sequence coding for
said first Chimeric Antigen Receptor (CAR) directed against at
least one antigen expressed at the surface of a malignant or
infected cell; and a second nucleic acid molecule comprising a
nucleotide sequence coding for said inhibitor of regulatory T-cell
activity.
46. The composition according to any one of claims 43 to 45,
comprising a further nucleic acid molecule comprising a nucleotide
sequence coding for a second Chimeric Antigen Receptor directed
against at least one antigen expressed at the surface of a
regulatory T-cell (Treg).
47. The composition according to any one of claims 43 to 46,
wherein the nucleic acid molecules are vectors, such as viral
vectors or plasmids, and said nucleotide sequences being
operatively linked to one or more promoters suitable for expression
in a T-cell.
48. A kit comprising the isolated nucleic acid according to any one
of claims 40 to 42 or a composition according to any one of claims
43 to 47.
Description
FIELD OF THE INVENTION
[0001] The present invention pertains to engineered T-cells, method
for their preparation and their use as medicament, particularly for
immunotherapy. The engineered T-cells of the invention are designed
to express locally a secreted inhibitor of regulatory T-cells
(Treg). Preferably, such secreted inhibitor is a peptide inhibitor
of forkhead/winged helix transcription factor 3 (FoxP3), a specific
factor involved into the differentiation of T-cells into regulatory
T-cells. Said T-cells are preferably endowed with Chimeric Antigen
Receptors (CAR) directed against at least one antigen expressed at
the surface of a malignant or infected cell. The engineered T-cells
of the invention thereby direct their immune activity towards
specific malignant or infected cells, while at the same time
prevent neighbouring regulatory T-cells from modulating the immune
response. The invention opens the way to standard and affordable
adoptive immunotherapy strategies, especially for treating or
preventing cancer, and bacterial or viral infections.
BACKGROUND OF THE INVENTION
[0002] Cellular adaptive immunity is mediated by T-lymphocytes,
also known as T-cells, which upon recognition of a non-self or
tumoral antigen can either destroy the target cell or orchestrate
an immune response with other cells of the immune system.
[0003] Adoptive immunotherapy, which involves the transfer of
autologous antigen-specific T-cells generated ex vivo, is a
promising strategy to treat viral infections and cancer. The
T-cells used for adoptive immunotherapy can be generated either by
expansion of antigen-specific T-cells or redirection of T-cells
through genetic engineering (Park, Rosenberg et al. 2011). Transfer
of viral antigen specific T-cells is a well-established procedure
used for the treatment of transplant associated viral infections
and rare viral-related malignancies. Similarly, isolation and
transfer of tumor specific T-cells has been shown to be successful
in treating melanoma.
[0004] Novel specificities in T-cells have been successfully
generated through the genetic transfer of transgenic T-cell
receptors or chimeric antigen receptors (CARs) (Jena, Dotti et al.
2010). CARs are synthetic receptors consisting of a targeting
moiety that is associated with one or more signaling domains in a
single fusion molecule. In general, the binding moiety of a CAR
consists of an antigen-binding domain of a single-chain antibody
(scFv), comprising the light and variable fragments of a monoclonal
antibody joined by a flexible linker. Binding moieties based on
receptor or ligand domains have also been used successfully. The
signaling domains for first generation CARs are derived from the
cytoplasmic region of the CD3zeta or the Fc receptor gamma chains.
First generation CARs have been shown to successfully redirect T
cell cytotoxicity, however, they failed to provide prolonged
expansion and anti-tumor activity in vivo. Signaling domains from
co-stimulatory molecules including CD28, OX-40 (CD134), and 4-1BB
(CD137) have been added alone (second generation) or in combination
(third generation) to enhance survival and increase proliferation
of CAR modified T-cells. CARs have successfully allowed T-cells to
be redirected against antigens expressed at the surface of tumor
cells from various malignancies including lymphomas and solid
tumors (Jena, Dotti et al. 2010).
[0005] While cytotoxic T-lymphocyte (CTL; also known as cytotoxic
T-cells) and T helper cells play a central role in the cellular
immune response, regulatory T-cells (Tregs), formerly known as
suppressor T-cells, modulate or suppress immune responses,
particularly to prevent autoimmunity and maintain tolerance to
self-antigen. Because of their immune regulatory function, the
presence of regulatory T-cells at a cancer or infection site may
hinder the induction of an immune response against cancer or
infectious pathogens (Aandahl E. M. et al. (2004); Cabrera R. et
al. (2004); Viguier M. et al. (2004); Woo E. Y. et al (2001)).
Therefore, in certain pathogenic situations such as chronic
infectious diseases or cancer it may be desirable to suppress the
activity of regulatory T-cells to allow a more potent immune
response to occur. On another hand, vaccine strategies were
developed based on the finding that vaccine efficacy could be
improved by reducing the activity of regulatory T-cells, for
instance by controlling the activity of the forkhead/winged helix
transcription factor 3 (FoxP3). In particular, a peptide inhibitor
of FOXP3, called P60, was found to improve vaccine efficacy in mice
(Casares et al., 2010).
[0006] Dysfunction of FOXP3 is however associated with serious
autoimmune disorders such as systemic lupus erythematosus or
X-lined IPEX syndrome, such that systemic administration of
inhibitors directed against, e.g, FoxP3, is currently not deemed a
suitable option in immune therapy. The release of such inhibitors
in the blood stream or even locally may lead to toxic effects by
unleashing autoimmune reactions in organs not affected by the
primary disease.
[0007] Accordingly, new therapeutic strategies are needed to
facilitate an effective immune response while reducing possible
toxic side effects in non-affected areas of the body. This need is
addressed by the present invention by providing specific in-situ
inhibition of regulatory T-cells as part of a CAR
immunotherapy.
SUMMARY OF THE INVENTION
[0008] The present invention concerns methods for preparing
engineered T-cells able to neutralize the activity of regulatory
T-cells in the close environment of pathological cells by
heterologous expression of a factor inhibiting the activity of said
regulatory T-cells.
[0009] According to one aspect of the invention, the method can be
more particularly applied to tumor-infiltrating lymphocytes (TIL),
which are T-cells expressing endogenous antigen receptor specific
for tumor cells (i.e. upon natural clonal selection within the
patient). According to this aspect of the invention, the cells are
relieved from their inhibition by regulatory T-cells to help their
spread and action against patient's tumor cells. Particularly, TIL
are extracted from a patient's tumor, amplified, genetically
modified to express an inhibitor of regulatory T-cells, and then
re-introduced into the patient as a therapeutic product. Such TIL
engineered ex-vivo can be used to treat the original patient
(autologous strategy) or another patient who bears the same type of
tumor (allogeneic approach). Such method more particularly
comprises one or several of the steps of: [0010] a) extracting a
tumor-infiltrating lymphocyte from a patient's tumor; [0011] b)
expanding said tumor-infiltrating lymphocyte; and [0012] c)
introducing into said tumor-infiltrating lymphocyte an exogenous
nucleic acid molecule comprising a nucleotide sequence coding for
an inhibitor of regulatory T-cell activity.
[0013] According to another aspect of the invention, the method can
be more particularly applied to T-cells interacting with the
pathological cells through a chimeric antigen receptor. Such method
more particularly comprises one or several of the steps of:
[0014] a) providing a T-cell;
[0015] b) introducing into said T-cell an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for a first
Chimeric Antigen Receptor (CAR) directed against at least one
antigen expressed at the surface of a malignant or infected cell;
and
[0016] c) introducing into said T-cell an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for an inhibitor
of regulatory T-cells activity.
[0017] By "inhibitor of regulatory T-cells" is meant a molecule or
precursor of said molecule secreted by the T-cells and which allow
T-cells to escape the down regulation activity exercised by the
regulatory T-cells thereon. In general, such inhibitor of
regulatory T-cell activity has the effect of reducing FoxP3
transcriptional activity in said cells.
[0018] According to preferred embodiments, said inhibitor of
regulatory T-cell activity is an inhibitor of FoxP3, and more
preferably is a cell-penetrating peptide inhibitor of FoxP3, such
as that referred as P60 (Casares et al., 2010).
[0019] According to preferred embodiments, the engineered T-cell
concomitantly expresses a CAR on its surface that binds a surface
antigen marker of a pathological cell. This binding has the effect
of triggering an immune response by the T-cell directed against the
pathological cell, which result into degranulation of various
cytokine and degradation enzymes in the interspace between the
cells.
[0020] According to certain embodiments, the method comprises a
further step of introducing into said T-cell an exogenous nucleic
acid molecule comprising a nucleotide sequence coding for a second
Chimeric Antigen Receptor directed against at least one antigen
expressed at the surface of a regulatory T-cell (Treg). After
having introduced said nucleic acid, said second Chimeric Antigen
Receptor may then be expressed by said T-cell.
[0021] Said second CAR is directed against the regulatory T-cells
in order to primarily physically maintain said regulatory T-cells
in the close environment of the T-cells (and also of the
pathological cells) for obtaining in-situ inhibition of the
regulatory T-cells. The second CAR can also contribute to
activating the T-cells immune response.
[0022] According to optional embodiments, the method further
comprises the step of making the T-cells non-alloreactive by
inactivating at least one gene coding for one component of the
T-Cell receptor (TCR). This can be achieved by introducing into the
cells a specific rare-cutting endonuclease targeting this gene,
such as a TAL-nuclease, a CAS9 RNA guided endonuclease, a Zinc
Finger nuclease or a meganuclease.
[0023] The present invention thus preferably provides engineered
T-cells, in particular. genetically engineered isolated T-cells
comprising:
[0024] a) an exogenous nucleic acid molecule comprising a
nucleotide sequence coding for a first Chimeric Antigen Receptor
(CAR) directed against at least one antigen expressed at the
surface of a malignant or infected cell; and
[0025] b) an exogenous nucleic acid molecule comprising a
nucleotide sequence coding for an inhibitor of regulatory T-cell
activity, preferably a cell-penetrating peptide inhibitor of FoxP3,
such as that referred as P60 (Casares et al., 2010).
[0026] According to preferred embodiments, said first Chimeric
Antigen Receptor and said inhibitor of regulatory T-cell activity
are expressed by said T-cell.
[0027] According to other embodiments, the engineered T-cell
further comprises c) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for a second Chimeric Antigen Receptor
directed against at least one antigen expressed at the surface of a
regulatory T-cell (Treg). According to particular embodiments, said
second Chimeric Antigen Receptor is expressed by said T-cell.
[0028] According to further embodiments, the engineered T-cell
further comprises d) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for a rare-cutting endonuclease able
to selectively inactivate by DNA cleavage at least one gene coding
for one component of the T-Cell receptor (TCR). According to
particular embodiments, said rare-cutting endonuclease able to
selectively inactivate by DNA cleavage at least one gene coding for
one component of the T-Cell receptor (TCR) is expressed by said
T-cell. The disruption of TCR provides non-alloreactive T-cells
that can be used in allogeneic treatment strategies.
[0029] The present invention further provides isolated nucleic acid
molecules comprising a nucleotide sequence coding for a Chimeric
Antigen Receptor (CAR) directed against at least one antigen
expressed at the surface of a malignant or infected cell; and a
nucleotide sequence coding for an inhibitor of regulatory T-cell
activity, preferably a cell-penetrating peptide inhibitor of FoxP3,
such as that referred as P60 (Casares et al., 2010). According to
certain embodiments, said nucleic acid molecule is a vector, such
as a viral vector or plasmid. More particularly, said nucleic acid
molecule is a vector, such as a viral vector or plasmid, and said
nucleotide sequences being operatively linked to one or more
promoters suitable for expression in a T-cell.
[0030] The present invention further provides compositions
comprising one or more nucleic acid molecules comprising a
nucleotide sequence coding for a first Chimeric Antigen Receptor
(CAR) directed against at least one antigen expressed at the
surface of a malignant or infected cell; and a nucleotide sequence
coding for an inhibitor of regulatory T-cell activity, preferably a
cell-penetrating peptide inhibitor of FoxP3, such as that referred
as P60 (Casares et al., 2010). According to certain embodiments,
the composition comprises a nucleic acid molecule comprising a
nucleotide sequence coding for said first Chimeric Antigen Receptor
(CAR); and a nucleotide sequence coding for said an inhibitor of
regulatory T-cell activity. According to certain other embodiments,
the composition comprises a first nucleic acid molecule comprising
a nucleotide sequence coding for said first Chimeric Antigen
Receptor (CAR) directed against at least one antigen expressed at
the surface of a malignant or infected cell; and a second nucleic
acid molecule comprising a nucleotide sequence coding for an
inhibitor of regulatory T-cell activity, preferably a
cell-penetrating peptide inhibitor of FoxP3, such as that referred
as P60 (Casares et al., 2010). According to certain embodiments,
the composition comprises a further nucleic acid molecule
comprising a nucleotide sequence coding for a second Chimeric
Antigen Receptor directed against at least one antigen expressed at
the surface of a regulatory T-cell (Treg). According to certain
embodiments, said nucleic acid molecules are vectors, such as viral
vectors or plasmids. More particularly, said nucleic acid molecules
are vectors, such as viral vectors or plasmids, and said nucleotide
sequences being operatively linked to one or more promoters
suitable for expression in a T-cell.
[0031] The present invention further provides kits comprising one
or more isolated nucleic acid according to the present invention or
one or more compositions according to the present invention.
[0032] As a result of the present invention, engineered T-cells can
be used as therapeutic products, ideally as an "off the shelf"
product, for use in the treatment or prevention cancer, bacterial
or viral infections, or auto-immune diseases. Thus, the present
invention further provides an engineered T-cell or a composition,
such as a pharmaceutical composition, comprising same for use as a
medicament. According to certain embodiments, the engineered T-cell
or composition is for use in the treatment of a cancer, and more
particularly for use in the treatment of lymphoma. According to
certain other embodiments, the engineered T-cell or composition is
for use in the treatment of viral infection. According to certain
other embodiments, the engineered T-cell or composition is for use
in the treatment of bacterial infection.
[0033] It is understood that the details given herein with respect
to one aspect of the invention also apply to any of the other
aspects of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1: Schematic representation of the engineered T-cell
according the invention expressing both a Chimeric Antigen Receptor
(CAR) directed against at least one antigen expressed at the
surface of a malignant or infected cell, and a cell-penetrating
peptide inhibitor of FoxP3. The peptide inhibitor of FoxP3
expressed and secreted by the engineered T-cell will enter
neighbouring regulatory T-cells and prevent them from modulating
the anti-tumor or anti-infection response.
[0035] FIG. 2: Schematic representation of an engineered T-cell
according the invention expressing a Chimeric Antigen Receptor
(CAR) directed against at least one antigen expressed at the
surface of a malignant or infected cell, and a cell-penetrating
peptide inhibitor of FoxP3 as well as a rare-cutting endonuclease
able to selectively inactivate by DNA cleavage at least one gene
coding for one component of the T-Cell receptor (TCR). The
inactivation of at least one gene coding for a TCR component
renders the genetically engineered T-cell non-alloreactive.
[0036] FIG. 3: Schematic representation of an engineered T-cell
according the invention expressing a first Chimeric Antigen
Receptor directed against at least one antigen expressed at the
surface of a malignant or infected cell, a cell-penetrating peptide
inhibitor of FoxP3 as well as a second Chimeric Antigen Receptor
directed against at least one antigen expressed at the surface of a
regulatory T-cell (Treg) which allows the binding of a regulatory
T-cell by the engineered T-cell of the invention and facilitates
the entry of the peptide inhibitor of FoxP3 into the regulatory
T-cell.
[0037] FIG. 4: Schematic representation of an engineered T-cell
according the invention expressing a first Chimeric Antigen a first
Chimeric Antigen Receptor directed against at least one antigen
expressed at the surface of a malignant or infected cell, a
cell-penetrating peptide inhibitor of FoxP3 as well as a second
Chimeric Antigen Receptor directed against at least one antigen
expressed at the surface of a regulatory T-cell (Treg). In this
configuration, the engineered T-cell does not necessarily express a
transgene that codes for an inhibitor of Treg, but can neutralize
Treg by merely specifically binding to them (e.g. CD25 is a
specific Treg surface protein).
[0038] FIG. 5: Schematic representation of an engineered T-cell
expressing a first Chimeric Antigen a first Chimeric Antigen
Receptor, which cytotoxic activity is inhibited by a Treg.
[0039] FIG. 6: Schematic representation of an engineered T-cell
according to the invention expressing a first Chimeric Antigen a
first Chimeric Antigen Receptor and overexpressing p60 as a
cell-penetrating peptide inhibitor of FoxP3 with the effect that
the inhibition by the Treg is lifted and the T cells recovers
cytolytic activity against the tumor cells.
DETAILED DESCRIPTION OF THE INVENTION
[0040] Unless specifically defined herein, all technical and
scientific terms used have the same meaning as commonly understood
by a skilled artisan in the fields of gene therapy, biochemistry,
genetics, and molecular biology.
[0041] All methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, with suitable methods and materials being
described herein. All publications, patent applications, patents,
and other references mentioned herein are incorporated by reference
in their entirety. In case of conflict, the present specification,
including definitions, will prevail. Further, the materials,
methods, and examples are illustrative only and are not intended to
be limiting, unless otherwise specified.
[0042] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of cell biology, cell
culture, molecular biology, transgenic biology, microbiology,
recombinant DNA, and immunology, which are within the skill of the
art. Such techniques are explained fully in the literature. See,
for example, Current Protocols in Molecular Biology (Frederick M.
AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA);
Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et
al, 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et
al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Harries & S. J. Higgins eds. 1984); Transcription And
Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of
Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987);
Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A
Practical Guide To Molecular Cloning (1984); the series, Methods In
ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press,
Inc., New York), specifically, Vols. 154 and 155 (Wu et al. eds.)
and Vol. 185, "Gene Expression Technology" (D. Goeddel, ed.); Gene
Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos
eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods
In Cell And Molecular Biology (Mayer and Walker, eds., Academic
Press, London, 1987); Handbook Of Experimental Immunology, Volumes
I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating
the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1986).
[0043] Methods for Preparing Engineered T-Cells
[0044] In a general aspect, the present invention pertains to
methods for preparing engineered T-cells that have the ability to
lift their inhibition by Treg, preferably by heterologous
expression of an inhibitor of Treg, such as a penetrating peptide
inhibitor of FoxP3.
[0045] Because regulatory T-cells, also known as suppressor
T-cells, play a role in dampening immune responses, in particular
to prevent autoimmunity and maintaining tolerance of self-antigens,
it is desirable to suppress the activity of this cell type in
certain pathogenic situations, such as cancer or chronic infectious
diseases, to allow a more potent immune response to occur. In order
to allow a local suppression of regulatory T-cells, an inhibitor is
secreted by the engineered T-cell, preferably a peptide inhibitor
of FoxP3 into the environment of the engineered T-cell(s). This
later peptide inhibitor will enter neighbouring regulatory T-cells
and prevent them from modulating the immune response by inhibition
of FoxP3. The localized delivery of the peptide inhibitor of FoxP3
by the engineered T-cell(s) of the present invention has the great
advantage of reducing the possibility of toxic effects such
inhibitor would unfold elsewhere in the body.
[0046] According to a first aspect, the invention is applied to a
subset of T-cells called tumor-infiltrating lymphocytes (TIL),
which are found in tumors with the particularity of having
developed some affinity to at least a population of tumor cells
found in said tumors. Generally, these TILs remain active against
the tumor cells and thus are valuable in immunotherapy for treating
said tumors (Rosenberg, S A. et al. (1986) A new approach to the
adoptive immunotherapy of cancer with tumor-infiltrating
lymphocytes. Science. 233(4770):1318-1321). However, these cells
are generally in limited number and are confined to such tumors.
The invention allows enhancing their activities and helping their
proliferation by proceedings by one or several of the following
steps: [0047] Extracting TILs from one or several tumors from one
or several patients; [0048] Expanding the TILs to obtain a
significant number useful for immunotherapy, preferably up to at
least 105 cells, more preferably up to at least 106 cells; [0049]
Introducing into the cells a nucleic acid comprising a nucleotide
sequence coding for an inhibitor of regulatory T-cell activity;
[0050] Further activating and expanding the engineered TILs; and
[0051] Infusing the engineered TILs back into the patient or in
other patients.
[0052] According to another aspect, the T-cells are engineered to
express both a Chimeric Antigen Receptor (CAR) directed against at
least one antigen expressed at the surface of a malignant or
infected cell, herein denoted first CAR, and an inhibitor of
regulatory T-cell activity, in particular, a cell-penetrating
peptide inhibitor of FoxP3. The CAR will direct the engineered
T-cells to the tumor site or site of infection and allows the
T-cell(s) to kill the tumor or infected cells.
[0053] Accordingly, the present invention provides a method for
preparing an engineered T-cell comprising the steps of:
[0054] a) providing a T-cell;
[0055] b) introducing into said T-cell an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for a first
Chimeric Antigen Receptor (CAR) directed against at least one
antigen expressed at the surface of a malignant or infected cell;
and
[0056] c) introducing into said T-cell an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for an inhibitor
of regulatory T-cell activity, such as a cell-penetrating peptide
inhibitor of FoxP3.
[0057] As a result, an engineered T-cell is obtained which
expresses a first Chimeric Antigen Receptor (CAR) directed against
at least one antigen expressed at the surface of a malignant or
infected cell, and an inhibitor of regulatory T-cell activity, such
as a cell-penetrating peptide inhibitor of FoxP3.
[0058] In addition to the Chimeric Antigen Receptor (CAR) directed
against at least one antigen expressed at the surface of a
malignant or infected cell, it may be preferable to have a further
CAR expressed by the engineered T-cell which is directed against at
least one antigen expressed at the surface of a regulatory T-cell
(Treg), such as the surface antigen CD25. This will allow the
binding of a regulatory T-cell and facilitates the entry of the
inhibitor of regulatory T-cell activity. Accordingly, the method
may further comprise introducing into said T-cell an exogenous
nucleic acid molecule comprising a nucleotide sequence coding for a
second Chimeric Antigen Receptor directed against at least one
antigen expressed at the surface of a regulatory T-cell (Treg).
After having introduced said nucleic acid, said second Chimeric
Antigen Receptor may then be expressed by said T-cell.
[0059] As a result, an engineered T-cell is obtained which further
expresses a second Chimeric Antigen Receptor directed against at
least one antigen expressed at the surface of a regulatory T-cell
(Treg).
[0060] It is also contemplated by the present invention that the
engineered T-cell of the present invention further expresses a
rare-cutting endonuclease able to selectively inactivate by DNA
cleavage at least one gene coding for one component of the T-Cell
receptor (TCR). T-cell receptors are cell surface receptors that
participate in the activation of T cells in response to the
presentation of antigen. The TCR is generally made from two chains,
alpha and beta, which assemble to form a heterodimer and associates
with the CD3-transducing subunits to form the T-cell receptor
complex present on the cell surface. Each alpha and beta chain of
the TCR consists of an immunoglobulin-like N-terminal variable (V)
and constant (C) region, a hydrophobic transmembrane domain, and a
short cytoplasmic region. As for immunoglobulin molecules, the
variable region of the alpha and beta chains are generated by V(D)J
recombination, creating a large diversity of antigen specificities
within the population of T cells. However, in contrast to
immunoglobulins that recognize intact antigen, T cells are
activated by processed peptide fragments in association with an MHC
molecule, introducing an extra dimension to antigen recognition by
T cells, known as MHC restriction. Recognition of MHC disparities
between the donor and recipient through the T cell receptor leads
to T cell proliferation and the potential development of graft
versus host disease (GVHD). It has been shown that normal surface
expression of the TCR depends on the coordinated synthesis and
assembly of all seven components of the complex (Ashwell and
Klusner 1990). The inactivation of TCRalpha or TCRbeta can result
in the elimination of the TCR from the surface of T cells
preventing recognition of alloantigen and thus GVHD. The
inactivation of at least one gene coding for a TCR component thus
renders the genetically engineered T-cell non-alloreactive. By
"inactivating" or "inactivation of" a gene it is meant that the
gene of interest is not expressed in a functional protein form.
[0061] Accordingly, the method of the present invention may further
comprise introducing into said T-cell an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for a rare-cutting
endonuclease able to selectively inactivate by DNA cleavage,
preferably double-strand break, at least one gene coding for one
component of the T-Cell receptor (TCR). In particular embodiments,
the rare-cutting endonuclease is able to selectively inactivate by
DNA cleavage the gene coding for TCR alpha or TCR beta.
[0062] The term "rare-cutting endonuclease" refers to a wild type
or variant enzyme capable of catalyzing the hydrolysis (cleavage)
of bonds between nucleic acids within a DNA or RNA molecule,
preferably a DNA molecule. Particularly, said nuclease can be an
endonuclease, more preferably a rare-cutting endonuclease which is
highly specific, recognizing nucleic acid target sites ranging from
10 to 45 base pairs (bp) in length, usually ranging from 10 to 35
base pairs in length, more usually from 12 to 20 base pairs. The
endonuclease according to the present invention recognizes at
specific polynucleotide sequences, further referred to as "target
sequence" and cleaves nucleic acid inside these target sequences or
into sequences adjacent thereto, depending on the molecular
structure of said endonuclease. The rare-cutting endonuclease can
recognize and generate a single- or double-strand break at specific
polynucleotides sequences.
[0063] In a particular embodiment, said rare-cutting endonuclease
according to the present invention is a RNA-guided endonuclease
such as the Cas9/CRISPR complex. RNA guided endonucleases
constitute a new generation of genome engineering tool where an
endonuclease associates with a RNA molecule. In this system, the
RNA molecule nucleotide sequence determines the target specificity
and activates the endonuclease (Gasiunas, Barrangou et al. 2012;
Jinek, Chylinski et al. 2012; Cong, Ran et al. 2013; Mali, Yang et
al. 2013). Cas9, also named Csn1 is a large protein that
participates in both crRNA biogenesis and in the destruction of
invading DNA. Cas9 has been described in different bacterial
species such as S. thermophiles, Listeria innocua (Gasiunas,
Barrangou et al. 2012; Jinek, Chylinski et al. 2012) and S.
pyogenes (Deltcheva, Chylinski et al. 2011). The large Cas9 protein
(>1200 amino acids) contains two predicted nuclease domains,
namely HNH (McrA-like) nuclease domain that is located in the
middle of the protein and a splitted RuvC-like nuclease domain
(RNase H fold). Cas9 variant can be a Cas9 endonuclease that does
not naturally exist in nature and that is obtained by protein
engineering or by random mutagenesis. Cas9 variants according to
the invention can for example be obtained by mutations i.e.
deletions from, or insertions or substitutions of at least one
residue in the amino acid sequence of a S. pyogenes Cas9
endonuclease (COG3513).
[0064] In a particular embodiment, said rare-cutting endonuclease
can also be a homing endonuclease, also known under the name of
meganuclease. Such homing endonucleases are well-known to the art
(Stoddard 2005). Homing endonucleases are highly specific,
recognizing DNA target sites ranging from 12 to 45 base pairs (bp)
in length, usually ranging from 14 to 40 bp in length. The homing
endonuclease according to the invention may for example correspond
to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY-YIG
endonuclease. Preferred homing endonuclease according to the
present invention can be an I-CreI variant. A "variant"
endonuclease, i.e. an endonuclease that does not naturally exist in
nature and that is obtained by genetic engineering or by random
mutagenesis can bind DNA sequences different from that recognized
by wild-type endonucleases (see international application
WO2006/097854).
[0065] In a particular embodiment, said rare-cutting endonuclease
can be a "Zinc Finger Nucleases" (ZFNs), which are generally a
fusion between the cleavage domain of the type IIS restriction
enzyme, FokI, and a DNA recognition domain containing 3 or more
C2H2 zinc finger motifs. The heterodimerization at a particular
position in the DNA of two individual ZFNs in precise orientation
and spacing leads to a double-strand break (DSB) in the DNA. The
use of such chimeric endonucleases have been extensively reported
in the art as reviewed by Urnov et al. (Genome editing with
engineered zinc finger nucleases (2010) Nature reviews Genetics
11:636-646). Standard ZFNs fuse the cleavage domain to the
C-terminus of each zinc finger domain. In order to allow the two
cleavage domains to dimerize and cleave DNA, the two individual
ZFNs bind opposite strands of DNA with their C-termini a certain
distance apart. The most commonly used linker sequences between the
zinc finger domain and the cleavage domain requires the 5' edge of
each binding site to be separated by 5 to 7 bp. The most
straightforward method to generate new zinc-finger arrays is to
combine smaller zinc-finger "modules" of known specificity. The
most common modular assembly process involves combining three
separate zinc fingers that can each recognize a 3 base pair DNA
sequence to generate a 3-finger array that can recognize a 9 base
pair target site. Numerous selection methods have been used to
generate zinc-finger arrays capable of targeting desired sequences.
Initial selection efforts utilized phage display to select proteins
that bound a given DNA target from a large pool of partially
randomized zinc-finger arrays. More recent efforts have utilized
yeast one-hybrid systems, bacterial one-hybrid and two-hybrid
systems, and mammalian cells.
[0066] In a particular embodiment, said rare-cutting endonuclease
is a "TALE-nuclease" or a "MBBBD-nuclease" resulting from the
fusion of a DNA binding domain typically derived from Transcription
Activator Like Effector proteins (TALE) or from a Modular
Base-per-Base Binding domain (MBBBD), with a catalytic domain
having endonuclease activity. Such catalytic domain usually comes
from enzymes, such as for instance I-TevI, ColE7, NucA and Fok-I.
TALE-nuclease can be formed under monomeric or dimeric forms
depending of the selected catalytic domain (WO2012138927). Such
engineered TALE-nucleases are commercially available under the
trade name TALEN.TM. (Cellectis, 8 rue de la Croix Jarry, 75013
Paris, France). In general, the DNA binding domain is derived from
a Transcription Activator like Effector (TALE), wherein sequence
specificity is driven by a series of 33-35 amino acids repeats
originating from Xanthomonas or Ralstonia bacterial proteins
AvrBs3, PthXo1, AvrHah1, PthA, Tal1c as non-limiting examples.
These repeats differ essentially by two amino acids positions that
specify an interaction with a base pair (Boch, Scholze et al. 2009;
Moscou and Bogdanove 2009). Each base pair in the DNA target is
contacted by a single repeat, with the specificity resulting from
the two variant amino acids of the repeat (the so-called repeat
variable dipeptide, RVD). TALE binding domains may further comprise
an N-terminal translocation domain responsible for the requirement
of a first thymine base (T0) of the targeted sequence and a
C-terminal domain that containing a nuclear localization signals
(NLS). A TALE nucleic acid binding domain generally corresponds to
an engineered core TALE scaffold comprising a plurality of TALE
repeat sequences, each repeat comprising a RVD specific to each
nucleotides base of a TALE recognition site. In the present
invention, each TALE repeat sequence of said core scaffold is made
of 30 to 42 amino acids, more preferably 33 or 34 wherein two
critical amino acids (the so-called repeat variable dipeptide, RVD)
located at positions 12 and 13 mediates the recognition of one
nucleotide of said TALE binding site sequence; equivalent two
critical amino acids can be located at positions other than 12 and
13 specially in TALE repeat sequence taller than 33 or 34 amino
acids long. Preferably, RVDs associated with recognition of the
different nucleotides are HD for recognizing C, NG for recognizing
T, NI for recognizing A, NN for recognizing G or A. In another
embodiment, critical amino acids 12 and 13 can be mutated towards
other amino acid residues in order to modulate their specificity
towards nucleotides A, T, C and G and in particular to enhance this
specificity. A TALE nucleic acid binding domain usually comprises
between 8 and 30 TALE repeat sequences. More preferably, said core
scaffold of the present invention comprises between 8 and 20 TALE
repeat sequences; again more preferably 15 TALE repeat sequences.
It can also comprise an additional single truncated TALE repeat
sequence made of 20 amino acids located at the C-terminus of said
set of TALE repeat sequences, i.e. an additional C-terminal
half-TALE repeat sequence. Other modular base-per-base specific
nucleic acid binding domains (MBBBD) are described in WO
2014/018601. Said MBBBD can be engineered, for instance, from newly
identified proteins, namely EAV36_BURRH, E5AW43_BURRH, E5AW45_BURRH
and E5AW46_BURRH proteins from the recently sequenced genome of the
endosymbiont fungi Burkholderia Rhizoxinica. These nucleic acid
binding polypeptides comprise modules of about 31 to 33 amino acids
that are base specific. These modules display less than 40 sequence
identity with Xanthomonas TALE common repeats and present more
polypeptides sequence variability. The different domains from the
above proteins (modules, N and C-terminals) from Burkholderia and
Xanthomonas are useful to engineer new proteins or scaffolds having
binding properties to specific nucleic acid sequences and may be
combined to form chimeric TALE-MBBBD proteins. As a result, an
engineered T-cell is obtained which further expresses a
rare-cutting endonuclease able to selectively inactivate by DNA
cleavage at least one gene coding for one component of the T-Cell
receptor (TCR).
[0067] It is also contemplated by the present invention that the
engineered T-cell of the present invention further expresses a
rare-cutting endonuclease able to selectively inactivate by DNA
cleavage, preferably double-strand break, the gene coding for the
surface antigen CD25. By inactivating the gene coding for CD25 the
engineered T-cells are unlikely to self-associate or to
self-interact and prevented from targeting T-cells other than
Treg.
[0068] The T-cell to be modified according to the present invention
may be any suitable T-cell. For example, the T-cell can be an
inflammatory T-lymphocyte, cytotoxic T-lymphocyte, or helper
T-lymphocyte. Particularly, the T-cell is a cytotoxic T-lymphocyte.
In certain embodiments, said T-cell is selected from CD4+
T-lymphocytes and CD8+ T-lymphocytes. In particular embodiments,
the T-cell to be modified according to the present invention is a
human T-cell. Prior to expansion and genetic modification of the
cells of the invention, a source of cells can be obtained from a
subject, such as a patient, through a variety of non-limiting
methods. T-cell can be obtained from a number of non-limiting
sources, including peripheral blood mononuclear cells, bone marrow,
lymph node tissue, cord blood, thymus tissue, tissue from a site of
infection, ascites, pleural effusion, spleen tissue, and tumors. In
certain embodiments of the present invention, any number of T cell
lines available and known to those skilled in the art, may be used.
In another embodiment, said cell can be derived from a healthy
donor, from a patient diagnosed with cancer or from a patient
diagnosed with an infection. In another embodiment, said cell is
part of a mixed population of cells which present different
phenotypic characteristics.
[0069] In accordance with the present invention, the nucleic acid
molecules detailed herein may be introduced in the T-cell by any
suitable methods known in the art. Suitable, non-limiting methods
for introducing a nucleic acid molecule into a T-cell according
include stable transformation methods, wherein the nucleic acid
molecule is integrated into the genome of the cell, transient
transformation methods wherein the nucleic acid molecule is not
integrated into the genome of the cell and virus mediated methods.
Said nucleic acid molecule may be introduced into a cell by, for
example, a recombinant viral vector (e.g., retroviruses,
adenoviruses), liposome and the like. Transient transformation
methods include, for example, microinjection, electroporation or
particle bombardment. In certain embodiments, the nucleic acid
molecule is a vector, such as a viral vector or plasmid. Suitably,
said vector is an expression vector enabling the expression of the
respective polypeptide(s) or protein(s) detailed herein by the
T-cell.
[0070] A nucleic acid molecule introduced into the T-cell may be
DNA or RNA. In certain embodiments, a nucleic acid molecule
introduced into the T-cell is DNA. In certain embodiments, a
nucleic acid molecule introduced into the T-cell is RNA, and in
particular an mRNA encoding a polypeptide or protein detailed
herein, which mRNA is introduced directly into the T-cell, for
example by electroporation. A suitable electroporation technique is
described, for example, in International Publication WO2013/176915
(in particular the section titled "Electroporation" bridging pages
29 to 30). A particular nucleic acid molecule which may be an mRNA
is the nucleic acid molecule comprising a nucleotide sequence
coding for a rare-cutting endonuclease able to selectively
inactivate by DNA cleavage at least one gene coding for one
component of the T-Cell Receptor (TCR).
[0071] Peptide Inhibitor of FoxP3
[0072] The peptide inhibitor of FoxP3 in accordance with the
present invention may be any peptide or polypeptide capable of
inhibiting the activity of the forkhead/winged helix transcription
factor 3 (FoxP3, preferably human FoxP3), a transcription factor
specific for regulatory T-cells and required for their development
and function. With "inhibiting" is meant that the activity of FoxP3
in regulatory T-cells is reduced by at least 10%, such as at least
20%, at least 30%, at least 40%, at least 50%, at least 60%, at
least 70%, at least 80, at least 90%, at least 95%, at least 99% or
100%. In this respect, "activity of FoxP3" means transcriptional
activity.
[0073] Moreover, in addition to having a FoxP3 inhibitory activity,
the peptide inhibitor of FoxP3 in accordance of the present
invention, is capable of penetrating a cell membrane. This
functionality may be inherent to the peptide inhibitor of FoxP3 or
may be the result of fusing a known cell-penetrating peptide (CPP)
and a peptide or polypeptide having FoxP3 inhibitory activity. Said
CPP sequence may be N-terminally or C-terminally linked to the
amino acid sequence providing for the FoxP3 inhibitory activity.
Suitable examples for CPPs include, but are not limited to: Tat, a
nuclear transcriptional activator protein which is a 101 amino acid
protein required for viral replication by human immunodeficiency
virus type 1 (HIV-1), penetratin, which corresponds to the third
helix of the homeoprotein Antennapedia in Drosophila, Kaposi
fibroblast growth factor (FGF) signal peptide sequence, integrin
.beta.3 signal peptide sequence; Guanine rich-molecular
transporters, MPG, pep-1, sweet arrow peptide, dermaseptins,
transportan, pVEC, Human calcitonin, mouse prion protein (mPrPr),
polyarginine peptide Args sequence, VP22 protein from Herpes
Simplex Virus, antimicrobial peptides Buforin I and SynB
(US2013/0065314).
[0074] A non-limiting example of peptide inhibitor of FoxP3 in
accordance with the present invention is the polypeptide P60
described by Casares et al. (2010). In addition to its FoxP3
inhibitory activity, it has been shown that P60 is also able to
penetrate a cell membrane. This polypeptide has the amino acid
sequence: RDFQSFRKMWPFFAM [SEQ ID NO: 1]. An illustrative
nucleotide sequence coding for this polypeptide is represented by
CGCGACTTTCAAAGTTTCCGTAAGATGTGGCCGTTTTTTGCAATG [SEQ ID NO: 2].
However, it is understood that due to the degeneration of the
genetic code any other suitable nucleotide sequence coding for the
amino acid sequence set forth in SEQ ID NO: 1 is also encompassed
by the present disclosure.
[0075] Accordingly, in certain embodiments of the invention, the
cell-penetrating peptide inhibitor of FoxP3 is a polypeptide
comprising the amino acid sequence set forth in SEQ ID NO: 1 or a
variant thereof comprising an amino acid sequence that has at least
60%, such as at least 80%, at least 85%, at least 90% or at least
95%, sequence identity with the amino acid sequence set forth in
SEQ ID NO: 1 over the entire length of SEQ ID NO: 1. Hence, in
accordance with these embodiments, an exogenous nucleic acid
molecule comprising a nucleotide sequence coding for a polypeptide
comprising the amino acid sequence set forth in SEQ ID NO: 1 or a
variant thereof comprising an amino acid sequence that has at least
60%, such as at least 80%, at least 85%, at least 90% or at least
95%, sequence identity with the amino acid sequence set forth in
SEQ ID NO: 1 over the entire length of SEQ ID NO: 1 is introduced
into the T-cell. The variant may comprise an amino acid sequence
which has one or more, such as two, three, four, five or six amino
acid substitutions compared to SEQ ID NO: 1. Preferably, such amino
acid substitution is a conservative substitution which means that
one amino acid is replaced by another one that is similar in size
and chemical properties. Such conservative amino acid substitution
may thus have minor effects on the peptide structure and can thus
be tolerated without compromising function. Preferably, such
variant is capable of inhibiting the activity of FoxP3 and is
capable of penetrating a cell membrane.
[0076] In accordance with certain embodiments, the exogenous
nucleic acid molecule may thus comprise the nucleotide sequence set
forth in SEQ ID NO: 2 or any other nucleotide sequence which due to
the degeneration of the genetic code also codes for the amino acid
sequence set forth in SEQ ID NO: 1.
[0077] As a result, an engineered T-cell may be obtained which
expresses a polypeptide comprising the amino acid sequence set
forth in SEQ ID NO: 1 or a variant thereof comprising an amino acid
sequence that has at least 60%, such as at least 80%, at least 85%,
at least 90% or at least 95%, sequence identity with the amino acid
sequence set forth in SEQ ID NO: 1 over the entire length of SEQ ID
NO: 1.
[0078] According to certain embodiments of the invention, the
cell-penetrating peptide inhibitor of FoxP3 is a polypeptide
comprising the amino acid sequence MRDFQSFRKMWPFFAM [SEQ ID NO: 3]
or a variant thereof comprising an amino acid sequence that has at
least 60%, such as at least 80% sequence identity with the amino
acid sequence set forth in SEQ ID NO: 3 over the entire length of
SEQ ID NO: 3. Hence, in accordance with these embodiments, an
exogenous nucleic acid molecule comprising a nucleotide sequence
coding for a polypeptide comprising the amino acid sequence set
forth in SEQ ID NO: 3 or a variant thereof comprising an amino acid
sequence that has at least 60%, such as at least 62.5%, at least
75% or at least 87.5% sequence identity with the amino acid
sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID
NO: 3 is introduced into the T-cell. The polypeptide comprising an
amino acid sequence that has at least 60% sequence identify with
the amino acid sequence set forth in SEQ ID NO: 3 over the entire
length of SEQ ID NO: 3 may comprise an amino acid sequence which
has one or more, such as two, three, four, five or six amino acid
substitutions compared to SEQ ID NO: 3. Preferably, such amino acid
substitution is a conservative substitution which means that one
amino acid is replaced by another one that is similar in size and
chemical properties.
[0079] Such conservative amino acid substitution may thus have
minor effects on the peptide structure and can thus be tolerated
without compromising function. Preferably, such variant is capable
of inhibiting the activity of FoxP3 and is capable of penetrating a
cell membrane.
[0080] In accordance with certain embodiments, the exogenous
nucleic acid molecule may thus comprise the nucleotide sequence
ATGCGCGACTTTCAAAGTTTCCGTAAGATGTGG CCGTTTTTTGCAATG [SEQ ID NO: 4] or
any other nucleotide sequence which due to the degeneration of the
genetic code also codes for the amino acid sequence set forth in
SEQ ID NO: 3.
[0081] As a result, an engineered T-cell may be obtained which
expresses a polypeptide comprising the amino acid sequence set
forth in SEQ ID NO: 3 or a variant thereof comprising an amino acid
sequence that has at least 60%, such as at least 62.5%, at least
75% or at least 87.5% sequence identity with the amino acid
sequence set forth in SEQ ID NO: 3 over the entire length of SEQ ID
NO: 3.
[0082] Chimeric Antigen Receptors (CARs)
[0083] Adoptive immunotherapy, which involves the transfer of
autologous antigen-specific T-cells generated ex vivo, is a
promising strategy to treat cancer or viral infections. The T-cells
used for adoptive immunotherapy can be generated either by
expansion of antigen-specific T cells or redirection of T cells
through genetic engineering (Park, Rosenberg et al. 2011). Transfer
of viral antigen specific T-cells is a well-established procedure
used for the treatment of transplant associated viral infections
and rare viral-related malignancies. Similarly, isolation and
transfer of tumor specific T cells has been shown to be successful
in treating melanoma.
[0084] Novel specificities in T-cells have been successfully
generated through the genetic transfer of transgenic T-cell
receptors or chimeric antigen receptors (CARs) (Jena, Dotti et al.
2010). CARs are synthetic receptors consisting of a targeting
moiety that is associated with one or more signaling domains in a
single fusion molecule. In general, the binding moiety of a CAR
consists of an antigen-binding domain of a single-chain antibody
(scFv), comprising the light and variable fragments of a monoclonal
antibody joined by a flexible linker. Binding moieties based on
receptor or ligand domains have also been used successfully. The
signaling domains for first generation CARs are derived from the
cytoplasmic region of the CD3zeta or the Fc receptor gamma chains.
First generation CARs have been shown to successfully redirect T
cell cytotoxicity, however, they failed to provide prolonged
expansion and anti-tumor activity in vivo. Signaling domains from
co-stimulatory molecules including CD28, OX-40 (CD134), and 4-1BB
(CD137) have been added alone (second generation) or in combination
(third generation) to enhance survival and increase proliferation
of CAR modified T-cells. CARs have successfully allowed T-cells to
be redirected against antigens expressed at the surface of tumor
cells from various malignancies including lymphomas and solid
tumors (Jena, Dotti et al. 2010).
[0085] CD19 is an attractive target for immunotherapy because the
vast majority of B-acute lymphoblastic leukemia (B-ALL) uniformly
express CD19, whereas expression is absent on non hematopoietic
cells, as well as myeloid, erythroid, and T cells, and bone marrow
stem cells. Clinical trials targeting CD19 on B-cell malignancies
are underway with encouraging anti-tumor responses. Most infuse T
cells genetically modified to express a chimeric antigen receptor
(CAR) with specificity derived from the scFv region of a
CD19-specific mouse monoclonal antibody FMC63 (WO2013/126712).
[0086] Therefore, in accordance with certain embodiments, the first
Chimeric Antigen Receptor is directed against the B-lymphocyte
antigen CD19.
[0087] In accordance with certain embodiments, the first Chimeric
Antigen Receptor is a single chain Chimeric Antigen Receptor. As an
example of single-chain Chimeric Antigen Receptor to be expressed
in the engineered T-cells according to the present invention is a
single polypeptide that comprises at least one extracellular ligand
binding domain, a transmembrane domain and at least one signal
transducing domain, wherein said extracellular ligand binding
domain comprises a scFV derived from the specific anti-CD19
monoclonal antibody 4G7. Once transduced into the T-cell, for
instance by using retroviral or lentiviral transduction, this CAR
contributes to the recognition of CD19 antigen present at the
surface of malignant B-cells involved in lymphoma or leukemia.
[0088] In accordance with particular embodiments, the first
Chimeric Antigen Receptor is a polypeptide comprising the amino
acid sequence forth in SEQ ID NO: 5 or a variant thereof comprising
an amino acid sequence that has at least 70%, such as at least 80%,
at least 90%, at least 95%, or at least 99%, sequence identity with
the amino acid sequence set forth in SEQ ID NO: 5 over the entire
length of SEQ ID NO: 5. Preferably, the variant is capable of
binding CD19.
[0089] In accordance with other certain embodiments, the first
Chimeric Antigen Receptor may be directed against another antigen
expressed at the surface of a malignant or infected cell, such as a
cluster of differentiation molecule, such as CD16, CD64, CD78,
CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123 and CD138, a
tumor-associated surface antigen, such as ErbB2 (HER2/neu),
carcinoembryonic antigen (CEA), epithelial cell adhesion molecule
(EpCAM), epidermal growth factor receptor (EGFR), EGFR variant III
(EGFRvIII), CD19, CD20, CD30, CD40, disialoganglioside GD2,
ductal-epithelial mucine, gp36, TAG-72, glycosphingolipids,
glioma-associated antigen, .beta.-human chorionic gonadotropin,
alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1,
MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS),
intestinal carboxyl esterase, mut hsp70-2, M-CSF, prostase,
prostase specific antigen (PSA), PAP, NY-ESO-1, LAGA-1a, p53,
prostein, PSMA, surviving and telomerase, prostate-carcinoma tumor
antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2,
CD22, insulin growth factor (IGF1)-I, IGF-II, IGFI receptor,
mesothelin, a major histocompatibility complex (MHC) molecule
presenting a tumor-specific peptide epitope, 5T4, ROR1, Nkp30,
NKG2D, tumor stromal antigens, the extra domain A (EDA) and extra
domain B (EDB) of fibronectin and the A1 domain of tenascin-C(TnC
A1) and fibroblast associated protein (fap); a lineage-specific or
tissue specific antigen such as CD3, CD4, CD8, CD24, CD25, CD33,
CD34, CD133, CD138, CTLA-4, B7-1 (CD80), B7-2 (CD86), GM-CSF,
cytokine receptors, endoglin, a major histocompatibility complex
(MHC) molecule, BCMA (CD269, TNFRSF 17), multiple myeloma or
lymphoblastic leukaemia antigen, such as one selected from TNFRSF17
(UNIPROT Q02223), SLAMF7 (UNIPROT Q9NQ25), GPRCSD (UNIPROT Q9NZD1),
FKBP11 (UNIPROT Q9NYL4), KAMP3, ITGA8 (UNIPROT P53708), and FCRL5
(UNIPROT Q68SN8). a virus-specific surface antigen such as an
HIV-specific antigen (such as HIV gp120); an EBV-specific antigen,
a CMV-specific antigen, a HPV-specific antigen, a Lasse
Virus-specific antigen, an Influenza Virus-specific antigen as well
as any derivate or variant of these surface antigens.
[0090] In other certain embodiments, the first Chimeric Antigen
Receptor is a multi-chain Chimeric Antigen Receptor. Chimeric
Antigen Receptors from the prior art introduced in T-cells have
been formed of single chain polypeptides that necessitate serial
appending of signaling domains. However, by moving signaling
domains from their natural juxtamembrane position may interfere
with their function. To overcome this drawback, the applicant
recently designed a multi-chain CAR derived from Fc.epsilon.RI to
allow normal juxtamembrane position of all relevant signaling
domains. In this new architecture, the high affinity IgE binding
domain of Fc.epsilon.RI alpha chain is replaced by an extracellular
ligand-binding domain such as scFv to redirect T-cell specificity
against cell targets and the N and/or C-termini tails of
Fc.epsilon.RI beta chain are used to place costimulatory signals in
normal juxtamembrane positions as described in WO 2013/176916.
[0091] Accordingly, a CAR expressed by the genetically engineered
T-cell according to the invention can be a multi-chain chimeric
antigen receptor particularly adapted to the production and
expansion of engineered T-cells of the present invention. Such
multi-chain
[0092] CARs comprise at least two of the following components:
[0093] a) one polypeptide comprising the transmembrembrane domain
of Fc.epsilon.RI alpha chain and an extracellular ligand-binding
domain, [0094] b) one polypeptide comprising a part of N- and
C-terminal cytoplasmic tail and the transmembrane domain of
Fc.epsilon.RI beta chain and/or [0095] c) at least two polypeptides
comprising each a part of intracytoplasmic tail and the
transmembrane domain of Fc.epsilon.RI gamma chain, whereby
different polypeptides multimerize together spontaneously to form
dimeric, trimeric or tetrameric CAR.
[0096] According to such architectures, ligands binding domains and
signaling domains are born on separate polypeptides. The different
polypeptides are anchored into the membrane in a close proximity
allowing interactions with each other. In such architectures, the
signaling and co-stimulatory domains can be in juxtamembrane
positions (i.e. adjacent to the cell membrane on the internal side
of it), which is deemed to allow improved function of
co-stimulatory domains. The multi-subunit architecture also offers
more flexibility and possibilities of designing CARs with more
control on T-cell activation. For instance, it is possible to
include several extracellular antigen recognition domains having
different specificity to obtain a multi-specific CAR architecture.
It is also possible to control the relative ratio between the
different subunits into the multi-chain CAR. This type of
architecture has been recently detailed by the applicant in
PCT/US2013/058005.
[0097] The assembly of the different chains as part of a single
multi-chain CAR is made possible, for instance, by using the
different alpha, beta and gamma chains of the high affinity
receptor for IgE (Fc.epsilon.RI) (Metzger, Alcaraz et al. 1986) to
which are fused the signaling and co-stimulatory domains. The gamma
chain comprises a transmembrane region and cytoplasmic tail
containing one immunoreceptor tyrosine-based activation motif
(ITAM) (Cambier 1995).
[0098] The multi-chain CAR can comprise several extracellular
ligand-binding domains, to simultaneously bind different elements
in target thereby augmenting immune cell activation and function.
In one embodiment, the extracellular ligand-binding domains can be
placed in tandem on the same transmembrane polypeptide, and
optionally can be separated by a linker. In another embodiment,
said different extracellular ligand-binding domains can be placed
on different transmembrane polypeptides composing the multi-chain
CAR.
[0099] The signal transducing domain or intracellular signaling
domain of the multi-chain CAR(s) of the invention is responsible
for intracellular signaling following the binding of extracellular
ligand binding domain to the target resulting in the activation of
the immune cell and immune response. In other words, the signal
transducing domain is responsible for the activation of at least
one of the normal effector functions of the immune cell in which
the multi-chain CAR is expressed. For example, the effector
function of a T cell can be a cytolytic activity or helper activity
including the secretion of cytokines.
[0100] In the present application, the term "signal transducing
domain" refers to the portion of a protein which transduces the
effector signal function signal and directs the cell to perform a
specialized function.
[0101] Preferred examples of signal transducing domain for use in
single or multi-chain CAR can be the cytoplasmic sequences of the
Fc receptor or T cell receptor and co-receptors that act in concert
to initiate signal transduction following antigen receptor
engagement, as well as any derivate or variant of these sequences
and any synthetic sequence that as the same functional capability.
Signal transduction domain comprises two distinct classes of
cytoplasmic signaling sequence, those that initiate
antigen-dependent primary activation, and those that act in an
antigen-independent manner to provide a secondary or co-stimulatory
signal. Primary cytoplasmic signaling sequence can comprise
signaling motifs which are known as immunoreceptor tyrosine-based
activation motifs of ITAMs. ITAMs are well defined signaling motifs
found in the intracytoplasmic tail of a variety of receptors that
serve as binding sites for syk/zap70 class tyrosine kinases.
Examples of ITAM used in the invention can include as non-limiting
examples those derived from TCRzeta, FcRgamma, FcRbeta, FcRepsilon,
CD3gamma, CD3delta, CD3epsilon, CD5, CD22, CD79a, CD79b and CD66d.
According to particular embodiments, the signaling transducing
domain of the multi-chain CAR can comprise the CD3zeta signaling
domain, or the intracytoplasmic domain of the Fc.epsilon.RI beta or
gamma chains.
[0102] According to particular embodiments, the signal transduction
domain of multi-chain CARs of the present invention comprises a
co-stimulatory signal molecule. A co-stimulatory molecule is a cell
surface molecule other than an antigen receptor or their ligands
that is required for an efficient immune response.
[0103] Ligand binding-domains can be any antigen receptor
previously used, and referred to, with respect to single-chain CAR
referred to in the literature, in particular scFv from monoclonal
antibodies.
[0104] In accordance with particular embodiments, the first
Chimeric Antigen Receptor is a polypeptide comprising the amino
acid sequence set forth in SEQ ID NO: 6 (encoded by, e.g., SEQ ID
NO: 7) or a variant thereof comprising an amino acid sequence that
has at least 70%, such as at least 80%, at least 90%, at least 95%,
or at least 99%, sequence identity with the amino acid sequence set
forth in SEQ ID NO: 6 over the entire length of SEQ ID NO: 6.
Preferably, the variant is capable of binding CD19.
[0105] A particularly preferred first Chimeric Antigen Receptor is
a polypeptide comprising the amino acid sequence set forth in SEQ
ID NO: 8 or a variant thereof comprising an amino acid sequence
that has at least 80%, such as at least 90%, at least 95%, or at
least 99%, sequence identity with the amino acid sequence set forth
in SEQ ID NO: 8 over the entire length of SEQ ID NO: 8. Preferably,
said variant is capable of binding CD19.
[0106] Also encompassed by the present invention are bispecific or
multi-specific CARs as described, for instance, in International
Publication WO 2014/4011988. Such bi-specific or multi-specific
CARs are particularly contemplated with respect to the second CAR
which is directed against at least one antigen expressed at the
surface of a regulatory T-cell.
[0107] A suitable target antigen for the second CAR is the surface
antigen CD25, which is known to be expressed on the surface of
regulatory T-cells. This will allow the binding of a regulatory
T-cell by the engineered T-cell of the invention. Other exemplary
surface antigens may be CD4, CD152, IL3R, CCR4, CCR6, CD161 and
CXR3.
[0108] According to certain embodiments, the second Chimeric
Antigen Receptor is mono-specific and, preferably, is directed
against surface antigen CD25.
[0109] According to other certain embodiments, the second Chimeric
Antigen Receptor is bi-specific. According to particular
embodiments, such bi-specific second Chimeric Antigen Receptor is
directed against surface antigen CD25 and one other surface antigen
selected from the group consisting of CD4, CD152, IL3R, CCR4, CCR6,
CD161 and CXR3.
[0110] As with the first Chimeric Antigen Receptor, the second
Chimeric Antigen Receptor may be a single chain Chimeric Antigen
Receptor or a multi-chain CAR. The details provided above with
respect to the single chain and multi-chain CARs apply mutatis
mutandis.
[0111] Activation and Expansion of T-Cells
[0112] Whether prior to or after genetic modification of the
T-cell(s), the T-cell(s) can be activated and expanded generally
using methods as described, for example, in U.S. Pat. Nos.
6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466;
6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843;
5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent
Application Publication No. 20060121005. The T-cell(s) may be
expanded in vitro or in vivo.
[0113] Generally, the T-cell(s) of the invention is expanded by
contact with a surface having attached thereto an agent that
stimulates a CD3 TCR complex associated signal and a ligand that
stimulates a co-stimulatory molecule on the surface of the T cells.
In particular, T-cell populations may be stimulated in vitro such
as by contact with an anti-CD3 antibody, or antigen-binding
fragment thereof, or an anti-CD2 antibody immobilized on a surface,
or by contact with a protein kinase C activator (e.g., bryostatin)
in conjunction with a calcium ionophore. For co-stimulation of an
accessory molecule on the surface of the T-cells, a ligand that
binds the accessory molecule is used. For example, a T-cell or
population of T-cells can be contacted with an anti-CD3 antibody
and an anti-CD28 antibody, under conditions appropriate for
stimulating proliferation of the T-cells.
[0114] In further embodiments of the present invention, the
T-cells, are combined with agent-coated beads, the beads and the
cells are subsequently separated, and then the cells are cultured.
In an alternative embodiment, prior to culture, the agent-coated
beads and cells are not separated but are cultured together. Cell
surface proteins may be ligated by allowing paramagnetic beads to
which anti-CD3 and anti-CD28 are attached (3.times.28 beads) to
contact the T cells. According to one embodiment, the cells (for
example, 4 to 10 T-cells) and beads (for example, DYNABEADS.RTM.
M-450 CD3/CD28 T paramagnetic beads at a ratio of 1:1) are combined
in a buffer, preferably PBS (without divalent cations such as,
calcium and magnesium). Again, those of ordinary skill in the art
can readily appreciate any cell concentration may be used. The
mixture may be cultured for several hours (about 3 hours) to about
14 days or any hourly integer value in between. In another
embodiment, the mixture may be cultured for 21 days. Conditions
appropriate for T cell culture include an appropriate media (e.g.,
Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza))
that may contain factors necessary for proliferation and viability,
including serum (e.g., fetal bovine or human serum), interleukin-2
(IL-2), insulin, IFN-g, 1L-4, 1L-7, GM-CSF, -10, -2, 1L-15, TGFp,
and TNF- or any other additives for the growth of cells known to
the skilled artisan. Other additives for the growth of cells
include, but are not limited to, surfactant, plasmanate, and
reducing agents such as N-acetyl-cysteine and 2-mercaptoethanoi.
Media can include RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo
1, and X-Vivo 20, Optimizer, with added amino acids, sodium
pyruvate, and vitamins, either serum-free or supplemented with an
appropriate amount of serum (or plasma) or a defined set of
hormones, and/or an amount of cytokine(s) sufficient for the growth
and expansion of T cells. Antibiotics, e.g., penicillin and
streptomycin, are included only in experimental cultures, not in
cultures of cells that are to be infused into a subject. The target
cells are maintained under conditions necessary to support growth,
for example, an appropriate temperature (e.g., 37.degree. C.) and
atmosphere (e.g., air plus 5% C02). T cells that have been exposed
to varied stimulation times may exhibit different
characteristics.
[0115] In another particular embodiment, the T-cells may be
expanded by co-culturing with tissue or cells. Said T-cells may
also be expanded in vivo, for example in the subject's blood after
administrating said cell into the subject.
[0116] Engineered T-Cells
[0117] As a result of the present invention, engineered T-cells can
be obtained having improved characteristics. In particular, the
present invention provides an engineered, preferably isolated,
T-cell which is characterized by the expression of both a Chimeric
Antigen Receptor (CAR) directed against at least one antigen
expressed at the surface of a malignant or infected cell, herein
denoted first CAR, and an inhibitor of regulatory T-cell activity,
preferably a cell-penetrating peptide inhibitor of FoxP3.
[0118] More particularly, the present invention provides an
engineered, preferably isolated, T-cell which comprises:
[0119] a) an exogenous nucleic acid molecule comprising a
nucleotide sequence coding for a first Chimeric Antigen Receptor
(CAR) directed against at least one antigen expressed at the
surface of a malignant or infected cell; and
[0120] b) an exogenous nucleic acid molecule comprising a
nucleotide sequence coding for an inhibitor of regulatory T-cell
activity, preferably a cell-penetrating peptide inhibitor of
FoxP3.
[0121] According to certain embodiments, the engineered T-cell
further comprises c) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for a second Chimeric Antigen Receptor
directed against at least one antigen expressed at the surface of a
regulatory T-cell (Treg). According to particular embodiments, said
second Chimeric Antigen Receptor is expressed by said T-cell.
[0122] According to certain embodiments, the engineered T-cell
further comprises d) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for a rare-cutting endonuclease able
to selectively inactivate by DNA cleavage at least one gene coding
for one component of the T-Cell receptor (TCR). According to
particular embodiments, said rare-cutting endonuclease able to
selectively inactivate by DNA cleavage at least one gene coding for
one component of the T-Cell receptor (TCR) is expressed by said
T-cell.
[0123] According to certain embodiments, the engineered T-cell
further comprises e) an exogenous nucleic acid molecule comprising
a nucleotide sequence coding for a rare-cutting endonuclease able
to selectively inactivate by DNA cleavage the gene coding for the
surface antigen CD25. According to particular embodiments, said
rare-cutting endonuclease able to selectively inactivate by DNA
cleavage the gene coding for the surface antigen CD25 is expressed
by said T-cell.
[0124] It is understood that the details given herein in
particularly with respect to the first Chimeric Antigen Receptor,
the inhibitor of regulatory T-cell activity, especially the
cell-penetrating peptide inhibitor of FoxP3, the second Chimeric
Antigen Receptor, the rare-cutting endonuclease able to selectively
inactivate by DNA cleavage at least one gene coding for one
component of the T-Cell receptor (TCR) and the rare-cutting
endonuclease able to selectively inactivate by DNA cleavage the
gene coding for the surface antigen CD25 also apply to this aspect
of the invention.
[0125] Further, in the scope of the present invention is also
encompassed a cell line obtained from a genetically engineered
T-cell according to the invention.
[0126] Nucleic Acids, Compositions and Kits
[0127] In further aspects, the present invention provides nucleic
acid molecules suitable for expressing the various CARs, the
inhibitor of regulatory T-cell activity, especially the peptide
inhibitors FoxP3, and endonucleases in a T-cell as well as
compositions and kits comprising such nucleic acid molecules.
[0128] Accordingly, the present invention provides an isolated
nucleic acid molecule comprising a nucleotide sequence coding for a
Chimeric Antigen Receptor (CAR) directed against at least one
antigen expressed at the surface of a malignant or infected cell;
and a nucleotide sequence coding for an inhibitor of regulatory
T-cell activity, preferably a cell-penetrating peptide inhibitor of
FoxP3.
[0129] The nucleic acid molecule may be DNA or RNA. In certain
embodiments, the nucleic acid molecule is DNA. In certain other
embodiments, the nucleic acid molecule is RNA molecule, and in
particular an mRNA encoding said Chimeric Antigen Receptor and said
cell-penetrating peptide inhibitor of FoxP3. In accordance with
particular embodiments, the nucleotide sequence coding for said
Chimeric Antigen Receptor (CAR) and the nucleotide sequence coding
for an inhibitor of regulatory T-cell activity, preferably a
cell-penetrating peptide inhibitor of FoxP3, are operatively linked
to each other by a nucleotide sequence coding for ribosomal skip
sequence, such as a nucleotide sequence coding for a 2A peptide.
Such ribosomal skip mechanisms are well known in the art and are
known to be used by several vectors for the expression of several
proteins encoded by a single mRNA.
[0130] In accordance with certain embodiments, the nucleic acid is
a vector, such as a viral vector or plasmid. In order to allow
expression by the T-cell the nucleotide sequence coding for said
Chimeric Antigen Receptor (CAR) and the nucleotide sequence coding
for an inhibitor of regulatory T-cells activity, preferably a
cell-penetrating peptide inhibitor of FoxP3, are operatively linked
to one or more promoters suitable for expression in a T-cell. In
some cases it may be desirable to have the inhibitor of regulatory
T-cells activity, such as the cell-penetrating peptide inhibitor of
FoxP3, only expressed if the Chimeric Antigen Receptor recognizes
and binds the antigen to which it is specific. In such cases, the
expression of the cell-penetrating peptide inhibitor of FoxP3 is
preferably under the control of an inducible promoter, such as a
NFAT minimal promoter.
[0131] Also encompassed within the scope of the invention are
compositions which comprise one or more of the nucleic acid
molecules detailed herein. Particularly, the present invention
provides compositions comprising one or more nucleic acid molecules
comprising a nucleotide sequence coding for a first Chimeric
Antigen Receptor (CAR) directed against at least one antigen
expressed at the surface of a malignant or infected cell; and a
nucleotide sequence coding for a cell-penetrating peptide inhibitor
of FoxP3. In accordance with certain embodiments, a composition is
provided which comprises a nucleic acid molecule comprising a
nucleotide sequence coding for said first Chimeric Antigen Receptor
(CAR); and a nucleotide sequence coding for said an inhibitor of
regulatory T-cell activity, preferably said cell-penetrating
peptide inhibitor of FoxP3. In accordance with other certain
embodiments, a composition is provided which comprises a first
nucleic acid molecule comprising a nucleotide sequence coding for
said first Chimeric Antigen Receptor (CAR) directed against at
least one antigen expressed at the surface of a malignant or
infected cell; and a second nucleic acid molecule comprising a
nucleotide sequence coding for an inhibitor of regulatory T-cell
activity, preferably said cell-penetrating peptide inhibitor of
FoxP3. In accordance with particular embodiments, the composition
may comprise a further nucleic acid molecule comprising a
nucleotide sequence coding for a second Chimeric Antigen Receptor
directed against at least one antigen expressed at the surface of a
regulatory T-cell (Treg). In accordance with other particular
embodiments, composition may comprise a further nucleic acid
molecule comprising a nucleotide sequence coding for a rare-cutting
endonuclease able to selectively inactivate by DNA cleavage at
least one gene coding for one component of the T-Cell receptor
(TCR) and/or a nucleic acid molecule comprising a nucleotide
sequence coding for a rare-cutting endonuclease able to selectively
inactivate by DNA cleavage the gene coding for the surface antigen
CD25.
[0132] The nucleic acid molecule(s) comprised by the compositions
may be DNA or RNA. In certain embodiments, a nucleic acid molecule
is DNA. In certain other embodiments, a nucleic acid molecule is
RNA molecule. In accordance certain embodiments, the nucleic acid
molecule or nucleic acid molecules are vectors, such as viral
vectors or plasmids. In order to allow expression by the T-cell the
nucleotide sequence coding for said Chimeric Antigen Receptor (CAR)
and/or the nucleotide sequence coding for an inhibitor of
regulatory T-cell activity, preferably a cell-penetrating peptide
inhibitor of FoxP3, are operatively linked to one or more promoters
suitable for expression in a T-cell.
[0133] Also encompassed within the scope of the invention are kits
comprising one or more of the nucleic acid molecules or one or more
compositions detailed herein.
[0134] It is understood that the details given herein in
particularly with respect to the first Chimeric Antigen Receptor,
the inhibitor of regulatory T-cell activity, especially the
cell-penetrating peptide inhibitor of FoxP3, the second Chimeric
Antigen Receptor, the rare-cutting endonuclease able to selectively
inactivate by DNA cleavage at least one gene coding for one
component of the T-Cell receptor (TCR) and the rare-cutting
endonuclease able to selectively inactivate by DNA cleavage the
gene coding for the surface antigen CD25 also apply to these
aspects of the invention.
[0135] Therapeutic Applications
[0136] The T-cells obtainable in accordance with the present
invention are intended to be used as a medicament, and in
particular for treating, among others, cancer, infections (such
viral infections) or immune diseases in a patient in need thereof.
Accordingly, the present invention provides engineered T-cells for
use as a medicament. Particularly, the present invention provides
engineered T-cells for use in the treatment of a cancer, such as
lymphoma, or viral infection. Also provided are compositions,
particularly pharmaceutical compositions, which comprise at least
one genetically engineered T-cell of the present invention. In
certain embodiments, a composition may comprise a population of
engineered T-cell of the present invention.
[0137] The treatment can be ameliorating, curative or prophylactic.
It may be either part of an autologous immunotherapy or part of an
allogenic immunotherapy treatment. By autologous, it is meant that
cells, cell line or population of cells used for treating patients
are originating from said patient or from a Human Leucocyte Antigen
(HLA) compatible donor. By allogeneic is meant that the cells or
population of cells used for treating patients are not originating
from said patient but from a donor.
[0138] The invention is particularly suited for allogenic
immunotherapy, insofar as it enables the transformation of T-cells,
typically obtained from donors, into non-alloreactive cells. This
may be done under standard protocols and reproduced as many times
as needed. The resulted modified T-cells may be pooled and
administrated to one or several patients, being made available as
an "off the shelf" therapeutic product.
[0139] The treatments are primarily to treat patients diagnosed
with cancer. Cancers are preferably leukemias and lymphomas, which
have liquid tumors, but may also concern solid tumors. Types of
cancers to be treated with the genetically engineered T-cells of
the invention include, but are not limited to, carcinoma, blastoma,
and sarcoma, and certain leukemia or lymphoid malignancies, benign
and malignant tumors, and malignancies e.g., sarcomas, carcinomas,
and melanomas. Adult tumors/cancers and pediatric tumors/cancers
are also included.
[0140] The treatment can take place in combination with one or more
therapies selected from the group of antibodies therapy,
chemotherapy, cytokines therapy, dendritic cell therapy, gene
therapy, hormone therapy, laser light therapy and radiation
therapy.
[0141] According to certain embodiments, T-cells of the invention
can undergo robust in vivo T-cell expansion upon administration to
a patient, and can persist in the body fluids for an extended
amount of time, preferably for a week, more preferably for 2 weeks,
even more preferably for at least one month. Although the T-cells
according to the invention are expected to persist during these
periods, their life span into the patient's body are intended not
to exceed a year, preferably 6 months, more preferably 2 months,
and even more preferably one month.
[0142] The administration of the cells or population of cells
according to the present invention may be carried out in any
convenient manner, including by aerosol inhalation, injection,
ingestion, transfusion, implantation or transplantation. The
compositions described herein may be administered to a patient
subcutaneously, intradermaliy, intratumorally, intranodally,
intramedullary, intramuscularly, by intravenous or intralymphatic
injection, or intraperitoneally. In one embodiment, the cell
compositions of the present invention are preferably administered
by intravenous injection.
[0143] The administration of the cells or population of cells can
consist of the administration of 104-109 cells per kg body weight,
preferably 105 to 106 cells/kg body weight including all integer
values of cell numbers within those ranges. The cells or population
of cells can be administrated in one or more doses. In another
embodiment, said effective amount of cells are administrated as a
single dose. In another embodiment, said effective amount of cells
are administrated as more than one dose over a period time. Timing
of administration is within the judgment of managing physician and
depends on the clinical condition of the patient. The cells or
population of cells may be obtained from any source, such as a
blood bank or a donor. While individual needs vary, determination
of optimal ranges of effective amounts of a given cell type for a
particular disease or conditions within the skill of the art. An
effective amount means an amount which provides a therapeutic or
prophylactic benefit. The dosage administrated will be dependent
upon the age, health and weight of the recipient, kind of
concurrent treatment, if any, frequency of treatment and the nature
of the effect desired.
[0144] In other embodiments, said effective amount of cells or
composition comprising those cells are administrated parenterally.
Said administration can be an intravenous administration. Said
administration can be directly done by injection within a
tumor.
[0145] In certain embodiments, cells are administered to a patient
in conjunction with (e.g., before, simultaneously or following) any
number of relevant treatment modalities, including but not limited
to treatment with agents such as antiviral therapy, cidofovir and
interleukin-2, Cytarabine (also known as ARA-C) or nataliziimab
treatment for MS patients or efaliztimab treatment for psoriasis
patients or other treatments for PML patients. In further
embodiments, the T cells of the invention may be used in
combination with chemotherapy, radiation, immunosuppressive agents,
such as cyclosporin, azathioprine, methotrexate, mycophenolate, and
FK506, antibodies, or other immunoablative agents such as CAMPATH,
anti-CD3 antibodies or other antibody therapies, cytoxin,
fludaribine, cyclosporin, FK506, rapamycin, mycoplienolic acid,
steroids, FR901228, cytokines, and irradiation. These drugs inhibit
either the calcium dependent phosphatase calcineurin (cyclosporine
and FK506) or inhibit the p70S6 kinase that is important for growth
factor induced signaling (rapamycin) (Liu et al., Cell 66:807-815,
1 1; Henderson et al., Immun. 73:316-321, 1991; Bierer et al.,
Citrr. Opin. mm n. 5:763-773, 93). In a further embodiment, the
cell compositions of the present invention are administered to a
patient in conjunction with (e.g., before, simultaneously or
following) bone marrow transplantation, T cell ablative therapy
using either chemotherapy agents such as, fludarabine,
external-beam radiation therapy (XRT), cyclophosphamide, or
antibodies such as OKT3 or CAMPATH, In another embodiment, the cell
compositions of the present invention are administered following
B-cell ablative therapy such as agents that react with CD20, e.g.,
Rituxan. For example, in one embodiment, subjects may undergo
standard treatment with high dose chemotherapy followed by
peripheral blood stem cell transplantation. In certain embodiments,
following the transplant, subjects receive an infusion of the
expanded genetically engineered T-cells of the present invention.
In an additional embodiment, expanded cells are administered before
or following surgery.
[0146] Also encompassed within this aspect of the invention are
methods for treating a patient in need thereof, comprising a)
providing at least one engineered T-cell of the present invention,
preferably a population of said T-cell; and b) administering said
T-cell or population to said patient.
[0147] Also encompassed within this aspect of the invention are
methods for preparing a medicament using at least one engineered
T-cell of the present invention, and preferably a population of
said T-cell. Accordingly, the present invention provides the use of
at least one engineered T-cell of the present invention, and
preferably a population of said T-cell, in the manufacture of a
medicament. Preferably, such medicament is for use in the treatment
of a cancer, such as lymphoma, or viral infection.
Other Definitions
[0148] Amino acid residues in a polypeptide sequence are designated
herein according to the one-letter code, in which, for example, Q
means Gln or Glutamine residue, R means Arg or Arginine residue and
D means Asp or Aspartic acid residue. [0149] Amino acid
substitution means the replacement of one amino acid residue with
another, for instance the replacement of an Arginine residue with a
Glutamine residue in a peptide sequence is an amino acid
substitution. [0150] Nucleotides are designated as follows:
one-letter code is used for designating the base of a nucleoside: a
is adenine, t is thymine, c is cytosine, and g is guanine. For the
degenerated nucleotides, r represents g or a (purine nucleotides),
k represents g or t, s represents g or c, w represents a or t, m
represents a or c, y represents t or c (pyrimidine nucleotides), d
represents g, a or t, v represents g, a or c, b represents g, t or
c, h represents a, t or c, and n represents g, a, t or c. [0151]
"As used herein, "nucleic acid" or "polynucleotides" refers to
nucleotides and/or polynucleotides, such as deoxyribonucleic acid
(DNA) or ribonucleic acid (RNA), oligonucleotides, fragments
generated by the polymerase chain reaction (PCR), and fragments
generated by any of ligation, scission, endonuclease action, and
exonuclease action. Nucleic acid molecules can be composed of
monomers that are naturally-occurring nucleotides (such as DNA and
RNA), or analogs of naturally-occurring nucleotides (e.g.,
enantiomeric forms of naturally-occurring nucleotides), or a
combination of both. Modified nucleotides can have alterations in
sugar moieties and/or in pyrimidine or purine base moieties. Sugar
modifications include, for example, replacement of one or more
hydroxyl groups with halogens, alkyl groups, amines, and azido
groups, or sugars can be functionalized as ethers or esters.
Moreover, the entire sugar moiety can be replaced with sterically
and electronically similar structures, such as aza-sugars and
carbocyclic sugar analogs. Examples of modifications in a base
moiety include alkylated purines and pyrimidines, acylated purines
or pyrimidines, or other well-known heterocyclic substitutes.
Nucleic acid monomers can be linked by phosphodiester bonds or
analogs of such linkages. Nucleic acids can be either single
stranded or double stranded. [0152] By "delivery vector" or
"delivery vectors" is intended any delivery vector which can be
used in the present invention to put into cell contact (i.e
"contacting") or deliver inside cells or subcellular compartments
(i.e "introducing") agents/chemicals and molecules (proteins or
nucleic acids) needed in the present invention. It includes, but is
not limited to liposomal delivery vectors, viral delivery vectors,
drug delivery vectors, chemical carriers, polymeric carriers,
lipoplexes, polyplexes, dendrimers, microbubbles (ultrasound
contrast agents), nanoparticles, emulsions or other appropriate
transfer vectors. These delivery vectors allow delivery of
molecules, chemicals, macromolecules (genes, proteins), or other
vectors such as plasmids, or penetrating peptides. In these later
cases, delivery vectors are molecule carriers. [0153] The terms
"vector" or "vectors" refer to a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked. A
"vector" in the present invention includes, but is not limited to,
a viral vector, a plasmid, a RNA vector or a linear or circular DNA
or RNA molecule which may consists of a chromosomal,
non-chromosomal, semi-synthetic or synthetic nucleic acids.
Preferred vectors are those capable of autonomous replication
(episomal vector) and/or expression of nucleic acids to which they
are linked (expression vectors). Large numbers of suitable vectors
are known to those of skill in the art and commercially
available.
[0154] Viral vectors include retrovirus, adenovirus, parvovirus
(e.g. adenoassociated viruses), coronavirus, negative strand RNA
viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus
(e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g.
measles and Sendai), positive strand RNA viruses such as
picornavirus and alphavirus, and double-stranded DNA viruses
including adenovirus, herpesvirus (e.g., Herpes Simplex virus types
1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g.,
vaccinia, fowlpox and canarypox). Other viruses include Norwalk
virus, togavirus, flavivirus, reoviruses, papovavirus,
hepadnavirus, and hepatitis virus, for example. Examples of
retroviruses include: avian leukosis-sarcoma, mammalian C-type,
B-type viruses, D type viruses, HTLV-BLV group, lentivirus,
spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication, In Fundamental Virology, Third Edition, B. N. Fields,
et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
[0155] By "lentiviral vector" is meant HIV-Based lentiviral vectors
that are very promising for gene delivery because of their
relatively large packaging capacity, reduced immunogenicity and
their ability to stably transduce with high efficiency a large
range of different cell types. Lentiviral vectors are usually
generated following transient transfection of three (packaging,
envelope and transfer) or more plasmids into producer cells. Like
HIV, lentiviral vectors enter the target cell through the
interaction of viral surface glycoproteins with receptors on the
cell surface. On entry, the viral RNA undergoes reverse
transcription, which is mediated by the viral reverse transcriptase
complex. The product of reverse transcription is a double-stranded
linear viral DNA, which is the substrate for viral integration in
the DNA of infected cells. By "integrative lentiviral vectors (or
LV)", is meant such vectors as non limiting example, that are able
to integrate the genome of a target cell. At the opposite by "non
integrative lentiviral vectors (or NILV)" is meant efficient gene
delivery vectors that do not integrate the genome of a target cell
through the action of the virus integrase. [0156] Delivery vectors
and vectors can be associated or combined with any cellular
permeabilization techniques such as sonoporation or electroporation
or derivatives of these techniques. [0157] By cell or cells is
intended any eukaryotic living cells, primary cells and cell lines
derived from these organisms for in vitro cultures. Preferably, the
cell or cells are human cells. [0158] By "primary cell" or "primary
cells" are intended cells taken directly from living tissue (i.e.
biopsy material) and established for growth in vitro, that have
undergone very few population doublings and are therefore more
representative of the main functional components and
characteristics of tissues from which they are derived from, in
comparison to continuous tumorigenic or artificially immortalized
cell lines. [0159] by "mutation" is intended the substitution,
deletion, insertion of up to one, two, three, four, five, six,
seven, eight, nine, ten, eleven, twelve, thirteen, fourteen,
fifteen, twenty, twenty five, thirty, fourty, fifty, or more
nucleotides/amino acids in a polynucleotide (cDNA, gene) or a
polypeptide sequence. The mutation can affect the coding sequence
of a gene or its regulatory sequence. It may also affect the
structure of the genomic sequence or the structure/stability of the
encoded mRNA. [0160] by "variant(s)", it is intended a repeat
variant, a variant, a DNA binding variant, a TALE-nuclease variant,
a polypeptide variant obtained by mutation or replacement of at
least one residue in the amino acid sequence of the parent
molecule. [0161] by "functional variant" is intended an active
mutant of a protein, polypeptide or a protein domain; such mutant
may have the same activity compared to its parent protein,
polypeptide or protein domain or additional properties, or higher
or lower activity. [0162] By "gene" is meant the basic unit of
heredity, consisting of a segment of DNA arranged in a linear
manner along a chromosome, which codes for a specific protein or
segment of protein. A gene typically includes a promoter, a 5'
untranslated region, one or more coding sequences (exons),
optionally introns, a 3' untranslated region. The gene may further
comprise a terminator, enhancers and/or silencers. [0163] The term
"cleavage" refers to the breakage of the covalent backbone of a
polynucleotide. Cleavage can be initiated by a variety of methods
including, but not limited to, enzymatic or chemical hydrolysis of
a phosphodiester bond. Both single-stranded cleavage and
double-stranded cleavage are possible, and double-stranded cleavage
can occur as a result of two distinct single-stranded cleavage
events. Double stranded DNA, RNA, or DNA/RNA hybrid cleavage can
result in the production of either blunt ends or staggered ends.
[0164] By "fusion protein" is intended the result of a well-known
process in the art consisting in the joining of two or more genes
which originally encode for separate proteins or part of them, the
translation of said "fusion gene" resulting in a single polypeptide
with functional properties derived from each of the original
proteins. [0165] "identity" refers to sequence identity between two
nucleic acid molecules or polypeptides. Identity can be determined
by comparing a position in each sequence which may be aligned for
purposes of comparison. When a position in the compared sequence is
occupied by the same base or amino acid, then the molecules are
identical at that position. A degree of similarity or identity
between nucleic acid or amino acid sequences is a function of the
number of identical or matching nucleotides or amino acids at
positions shared by the nucleic acid or amino acid sequences,
respectively. Various alignment algorithms and/or programs may be
used to calculate the identity between two sequences, including
FASTA, or BLAST which are available as a part of the GCG sequence
analysis package (University of Wisconsin, Madison, Wis.), and can
be used with, e.g., default setting. For example, polypeptides
having at least 70%, 85%, 90%, 95%, 98% or 99% identity to specific
polypeptides described herein and preferably exhibiting
substantially the same functions, as well as polynucleotide
encoding such polypeptides, are contemplated. [0166]
"signal-transducing domain" or "co-stimulatory ligand" refers to a
molecule on an antigen presenting cell that specifically binds a
cognate co-stimulatory molecule on a T-cell, thereby providing a
signal which, in addition to the primary signal provided by, for
instance, binding of a TCR/CD3 complex with an MHC molecule loaded
with peptide, mediates a T cell response, including, but not
limited to, proliferation activation, differentiation and the like.
A co-stimulatory ligand can include but is not limited to CD7, B7-1
(CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible
costimulatory igand (ICOS-L), intercellular adhesion molecule
(ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, M1CB, HVEM,
lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, an agonist or
antibody that binds Toll ligand receptor and a ligand that
specifically binds with B7-H3. A co-stimulatory ligand also
encompasses, inter alia, an antibody that specifically binds with a
co-stimulatory molecule present on a T cell, such as but not
limited to, CD27, CD28, 4-IBB, OX40, CD30, CD40, PD-1, ICOS,
lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LTGHT,
NKG2C, B7-H3, a ligand that specifically binds with CD83. [0167] A
"co-stimulatory molecule" refers to the cognate binding partner on
a Tcell that specifically binds with a co-stimulatory ligand,
thereby mediating a co-stimulatory response by the cell, such as,
but not limited to proliferation. Co-stimulatory molecules include,
but are not limited to an MHC class I molecule, BTLA and Toll
ligand receptor. [0168] A "co-stimulatory signal" as used herein
refers to a signal, which in combination with primary signal, such
as TCR/CD3 ligation, leads to T cell proliferation and/or
upregulation or downregulation of key molecules. [0169] "bispecific
antibody" refers to an antibody that has binding sites for two
different antigens within a single antibody molecule. It will be
appreciated by those skilled in the art that other molecules in
addition to the canonical antibody structure may be constructed
with two binding specificities. It will further be appreciated that
antigen binding by bispecific antibodies may be simultaneous or
sequential. Bispecific antibodies can be produced by chemical
techniques (see e.g., Kranz et al. (1981) Proc. Natl. Acad. Sci.
USA 78, 5807), by "polydoma" techniques (See U.S. Pat. No.
4,474,893) or by recombinant DNA techniques, which all are known
per se. As a non-limiting example, each binding domain comprises at
least one variable region from an antibody heavy chain ("VH or H
region"), wherein the VH region of the first binding domain
specifically binds to the lymphocyte marker such as CD3, and the VH
region of the second binding domain specifically binds to tumor
antigen. [0170] The term "extracellular ligand-binding domain" as
used herein is defined as an oligo- or polypeptide that is capable
of binding a ligand. Preferably, the domain will be capable of
interacting with a cell surface molecule. For example, the
extracellular ligand-binding domain may be chosen to recognize a
ligand that acts as a cell surface marker on target cells
associated with a particular disease state. Thus examples of cell
surface markers that may act as ligands include those associated
with viral, bacterial and parasitic infections, autoimmune disease
and cancer cells. [0171] The term "subject" or "patient" as used
herein includes all members of the animal kingdom including
non-human primates and humans.
[0172] The above written description of the invention provides a
manner and process of making and using it such that any person
skilled in this art is enabled to make and use the same, this
enablement being provided in particular for the subject matter of
the appended claims, which make up a part of the original
description.
[0173] Where a numerical limit or range is stated herein, the
endpoints are included. Also, all values and subranges within a
numerical limit or range are specifically included as if explicitly
written out.
EXAMPLES
Example 1: Treg Inhibition Test
[0174] Human primary T cells were activated with anti-CD3/CD28
beads. At day 3, they were transfected with a messenger RNA coding
for foxp3 inhibitory peptide p60 (SEQ ID NO: 1) fused to a mutated
Chicken lysozyme signal peptide (3R CLSP--SEQ ID NO: 12)
(alternative SEQ ID NO. 13 to 17 displayed in Table 1 may also be
used). At day four, the transfected T cells were mixed with human
regulatory T cells (Treg) and their proliferation was followed
according to the assay described by Collison, L. W et al. (In vitro
Treg suppression assays, Methods Mol. Biol., 2011, 707:21-37). This
assay shows that the T-cells transfected with the p60 messenger
RNAs, proliferate faster than those transfected with the mock RNA
(scrambled p60--SEQ ID NO: 9), upon contact with the regulatory T
cells. It resulted that p60 peptide expression allowed T cells to
resist Treg inhibition.
Example 2: Cytotoxic Activity Test
[0175] Human primary T cells is activated with anti-CD3/CD28 beads.
At day 3, the activated T cells are transduced with a lentiviral
vector encoding the chimeric antigen receptor anti-CD19 set forth
as SEQ ID NO: 5 along with the Foxp3 inhibitory peptide p60 (SEQ ID
NO: 1) fused to a mutated Chicken lysozyme signal peptide (3R
CLSP--SEQ ID NO: 12) (alternative SEQ ID NO. 13 to 17 displayed in
Table 1 may also be used). At day 5, the cytotoxic activity of the
transduced T cells are assayed according to the method described by
Yang, Z. Z. et al. (Attenuation of CD8(+) T cell function by
CD4(+)CD25(+)regulatory T cells in B-cell non-Hodgkin's lymphoma,
2006, Cancer Res.) against a relevant target cell line in the
presence or absence of Tregs.
The assay shows that regulatory T cells usually have an inhibitory
effect on the cytotoxic capacity of CAR+ T cells, whereas p60
peptide expression by the T cell restores cytotoxic activity by
lifting this inhibition.
TABLE-US-00001 TABLE 1 Sequences used in the examples Polypeptide
Amino acid sequence SEQ ID NO # p60 RDFQSFRKMWPFFAM SEQ ID NO: 1
control (scrambled p60) MKMFFDAFPQRRSWF SEQ ID NO: 9 linker GSSSS
SEQ ID NO: 10 Chicken lysozyme signal peptide (CLSP)
MRSLLILVLCFLPLAALG SEQ ID NO: 11 3R CLSP MRRRSLLILVLCFLPLAALG SEQ
ID NO: 12 4R CLSP MRRRRSLLILVLCFLPLAALG SEQ ID NO: 13 Human
lysozyme signal peptide (HSLP) MKALIVLGLVLLSVTVQG SEQ ID NO: 14
Human interleukin 2 signal peptide (IL2SP) MYRMQLLSCIALSLALVTNS SEQ
ID NO: 15 3K HLSP MKKKALIVLGLVLLSVTVQG SEQ ID NO: 16 3R IL2SP
MYRRRMQLLSCIALSLALVTNS SEQ ID NO: 17
LIST OF REFERENCES CITED IN THE DESCRIPTION
[0176] Aandahl, E. M. et al. (2004) Human CD4+ CD25+ regulatory T
cells control T-cell responses to human immunodeficiency virus and
cytomegalovirus antigens." J Virol 78: 2454-9. [0177] Ashwell, J.
D. and R. D. Klusner (1990). "Genetic and mutational analysis of
the T-cell antigen receptor." Annu Rev Immunol 8: 139-67. [0178]
Bierer B. E. et al. (1993) "Cyclosporin A and FK506: molecular
mechanisms of immunosuppression and probes for transplantation
biology." Curr Opin Immunol 5(5): 763-73. [0179] Boch, J., H.
Scholze, et al. (2009). "Breaking the code of DNA binding
specificity of TAL-type III effectors." Science 326(5959): 1509-12.
[0180] Cabrera R. et al. (2004) "An immunomodulatory role for
CD4(+)CD25(+) regulatory T lymphocytes in hepatitis C virus
infection." Hepatology 40: 1062-71. [0181] Cambier, J. C. (1995).
"Antigen and Fc receptor signaling. The awesome power of the
immunoreceptor tyrosine-based activation motif (ITAM)." J Immunol
155(7): 3281-5. [0182] Casares N. et al. (2010) "A peptide
inhibitor of FoxP3 impairs regulatory T cell activity and improves
vaccine efficacy in mice." J Immunol 185(9):5150-9. [0183] Cooper,
L. J. N. (2003). "T-cell clones can be rendered specific for CD19:
toward the selective augmentation of the graft-versus-B-lineage
leukemia effect". Blood 101(4):1637-1644. [0184] Cooper, Jena et
al. (2012) "Good T cells for bad B cells". Blood. 119 (12):
2700-2702. [0185] Cong, L., F. A. Ran, et al. (2013). "Multiplex
genome engineering using CRISPR/Cas systems." Science 339(6121):
819-23. [0186] Deltcheva, E., K. Chylinski, et al. (2011). "CRISPR
RNA maturation by trans-encoded small RNA and host factor RNase
III." Nature 471(7340): 602-7. [0187] Gasiunas, G. et al. (2012).
"Cas9-crRNA ribonucleoprotein complex mediates specific DNA
cleavage for adaptive immunity in bacteria." Proc Natl Acad Sci USA
109(39): E2579-86. [0188] Hendersen D. J. et al. (1991) "Comparison
of the effects of FK-506, cyclosporin A and rapamycin on IL-2
production." Immun. 73(3): 316-321. [0189] Jena, B., G. Dotti, et
al. (2010). "Redirecting T-cell specificity by introducing a
tumor-specific chimeric antigen receptor." Blood 116(7): 1035-44.
[0190] Jinek, M., K. Chylinski, et al. (2012). "A programmable
dual-RNA-guided DNA endonuclease in adaptive bacterial immunity."
Science 337(6096): 816-21. [0191] Liu L. et al. (1991).
"Calcineurin is a common target of cyclophilin-cyclosporin A and
FKBP-FK506 complexes." Cell 66(4): 807-15. [0192] Mali, P., L.
Yang, et al. (2013). "RNA-guided human genome engineering via
Cas9." Science 339(6121): 823-6. [0193] Metzger, H., G. Alcaraz, et
al. (1986). "The receptor with high affinity for immunoglobulin E."
Annu Rev Immunol 4: 419-70. [0194] Moscou, M. J. and A. J.
Bogdanove (2009). "A simple cipher governs DNA recognition by TAL
effectors." Science 326(5959): 1501. [0195] Nicholson, I. C. (1997)
"Construction and characterisation of a functional CD19 specific
single chain Fv fragment for immunotherapy of B lineage leukaemia
and lymphoma". Molecular Immunology 34(16):1157-1165. [0196] Park
T. S., S. A. Rosenberg, et al. (2011). "Treating cancer with
genetically engineered T cells." Trends Biotechnol 29(11): 550-7.
[0197] Stoddard, B. L. (2005). "Homing endonuclease structure and
function." Q Rev Biophys 38(1): 49-95. [0198] Urnov F. D. et al.
(2010) "Genome editing with engineered zinc finger nucleases"
Nature reviews Genetics 11:636-646) [0199] Viguier M. et al. (2004)
"Foxp3 expressing CD4+CD25(high) regulatory T cells are
overrepresented in human metastatic melanoma lymph nodes and
inhibit the function of infiltrating T cells." J Immunol. 173:
1444-53. [0200] Woo E. Y. Et al. (2001) "Regulatory CD4(+) CD25(+)
T cells in tumors from patients with early-stage non-small cell
lung cancer and late-stage ovarian cancer." Cancer Res. 61:
4766-72.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 17 <210> SEQ ID NO 1 <211> LENGTH: 15 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: peptide inhibitor of FoxP3
<400> SEQUENCE: 1 Arg Asp Phe Gln Ser Phe Arg Lys Met Trp Pro
Phe Phe Ala Met 1 5 10 15 <210> SEQ ID NO 2 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
peptide inhibitor of FoxP3 <400> SEQUENCE: 2 cgcgactttc
aaagtttccg taagatgtgg ccgttttttg caatg 45 <210> SEQ ID NO 3
<211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: peptide inhibitor of FoxP3 <400> SEQUENCE: 3 Met
Arg Asp Phe Gln Ser Phe Arg Lys Met Trp Pro Phe Phe Ala Met 1 5 10
15 <210> SEQ ID NO 4 <211> LENGTH: 48 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: peptide inhibitor of FoxP3
<400> SEQUENCE: 4 atgcgcgact ttcaaagttt ccgtaagatg tggccgtttt
ttgcaatg 48 <210> SEQ ID NO 5 <211> LENGTH: 495
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: anti-CD19 CAR
<400> SEQUENCE: 5 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu
Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Glu Val Gln Leu Gln
Gln Ser Gly Pro Glu Leu Ile 20 25 30 Lys Pro Gly Ala Ser Val Lys
Met Ser Cys Lys Ala Ser Gly Tyr Thr 35 40 45 Phe Thr Ser Tyr Val
Met His Trp Val Lys Gln Lys Pro Gly Gln Gly 50 55 60 Leu Glu Trp
Ile Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr 65 70 75 80 Asn
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser 85 90
95 Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala
100 105 110 Val Tyr Tyr Cys Ala Arg Gly Thr Tyr Tyr Tyr Gly Ser Arg
Val Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
Ser Gly Gly Gly 130 135 140 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Asp Ile Val Met 145 150 155 160 Thr Gln Ala Ala Pro Ser Ile
Pro Val Thr Pro Gly Glu Ser Val Ser 165 170 175 Ile Ser Cys Arg Ser
Ser Lys Ser Leu Leu Asn Ser Asn Gly Asn Thr 180 185 190 Tyr Leu Tyr
Trp Phe Leu Gln Arg Pro Gly Gln Ser Pro Gln Leu Leu 195 200 205 Ile
Tyr Arg Met Ser Asn Leu Ala Ser Gly Val Pro Asp Arg Phe Ser 210 215
220 Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg Ile Ser Arg Val Glu
225 230 235 240 Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln His Leu
Glu Tyr Pro 245 250 255 Phe Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
Lys Arg Ser Asp Pro 260 265 270 Thr Thr Thr Pro Ala Pro Arg Pro Pro
Thr Pro Ala Pro Thr Ile Ala 275 280 285 Ser Gln Pro Leu Ser Leu Arg
Pro Glu Ala Cys Arg Pro Ala Ala Gly 290 295 300 Gly Ala Val His Thr
Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile 305 310 315 320 Trp Ala
Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val 325 330 335
Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe 340
345 350 Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp
Gly 355 360 365 Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys
Glu Leu Arg 370 375 380 Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala
Tyr Gln Gln Gly Gln 385 390 395 400 Asn Gln Leu Tyr Asn Glu Leu Asn
Leu Gly Arg Arg Glu Glu Tyr Asp 405 410 415 Val Leu Asp Lys Arg Arg
Gly Arg Asp Pro Glu Met Gly Gly Lys Pro 420 425 430 Arg Arg Lys Asn
Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp 435 440 445 Lys Met
Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg 450 455 460
Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr 465
470 475 480 Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro
Arg 485 490 495 <210> SEQ ID NO 6 <211> LENGTH: 848
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Multi-chain CAR
<400> SEQUENCE: 6 Met Ala Pro Ala Met Glu Ser Pro Thr Leu Leu
Cys Val Ala Leu Leu 1 5 10 15 Phe Phe Ala Pro Asp Gly Val Leu Ala
Glu Val Gln Leu Gln Gln Ser 20 25 30 Gly Pro Glu Leu Ile Lys Pro
Gly Ala Ser Val Lys Met Ser Cys Lys 35 40 45 Ala Ser Gly Tyr Thr
Phe Thr Ser Tyr Val Met His Trp Val Lys Gln 50 55 60 Lys Pro Gly
Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Tyr Asn 65 70 75 80 Asp
Gly Thr Lys Tyr Asn Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr 85 90
95 Ser Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr
100 105 110 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Gly Thr Tyr
Tyr Tyr 115 120 125 Gly Ser Arg Val Phe Asp Tyr Trp Gly Gln Gly Thr
Thr Leu Thr Val 130 135 140 Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly 145 150 155 160 Ser Asp Ile Val Met Thr Gln
Ala Ala Pro Ser Ile Pro Val Thr Pro 165 170 175 Gly Glu Ser Val Ser
Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu Asn 180 185 190 Ser Asn Gly
Asn Thr Tyr Leu Tyr Trp Phe Leu Gln Arg Pro Gly Gln 195 200 205 Ser
Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala Ser Gly Val 210 215
220 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg
225 230 235 240 Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Met Gln 245 250 255 His Leu Glu Tyr Pro Phe Thr Phe Gly Ala Gly
Thr Lys Leu Glu Leu 260 265 270 Lys Arg Ala Asp Thr Thr Thr Pro Ala
Pro Arg Pro Pro Thr Pro Ala 275 280 285 Pro Thr Ile Ala Ser Gln Pro
Leu Ser Leu Arg Pro Glu Ala Cys Arg 290 295 300 Pro Ala Ala Gly Gly
Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys 305 310 315 320 Asp Phe
Phe Ile Pro Leu Leu Val Val Ile Leu Phe Ala Val Asp Thr 325 330 335
Gly Leu Phe Ile Ser Thr Gln Gln Gln Val Thr Phe Leu Leu Lys Ile 340
345 350 Lys Arg Thr Arg Lys Gly Phe Arg Leu Leu Asn Pro His Pro Lys
Pro 355 360 365 Asn Pro Lys Asn Asn Arg Ala Glu Gly Arg Gly Ser Leu
Leu Thr Cys 370 375 380 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Asp
Thr Glu Ser Asn Arg 385 390 395 400 Arg Ala Asn Leu Ala Leu Pro Gln
Glu Pro Ser Ser Val Pro Ala Phe 405 410 415 Glu Val Leu Glu Ile Ser
Pro Gln Glu Val Ser Ser Gly Arg Leu Leu 420 425 430 Lys Ser Ala Ser
Ser Pro Pro Leu His Thr Trp Leu Thr Val Leu Lys 435 440 445 Lys Glu
Gln Glu Phe Leu Gly Val Thr Gln Ile Leu Thr Ala Met Ile 450 455 460
Cys Leu Cys Phe Gly Thr Val Val Cys Ser Val Leu Asp Ile Ser His 465
470 475 480 Ile Glu Gly Asp Ile Phe Ser Ser Phe Lys Ala Gly Tyr Pro
Phe Trp 485 490 495 Gly Ala Ile Phe Phe Ser Ile Ser Gly Met Leu Ser
Ile Ile Ser Glu 500 505 510 Arg Arg Asn Ala Thr Tyr Leu Val Arg Gly
Ser Leu Gly Ala Asn Thr 515 520 525 Ala Ser Ser Ile Ala Gly Gly Thr
Gly Ile Thr Ile Leu Ile Ile Asn 530 535 540 Leu Lys Lys Ser Leu Ala
Tyr Ile His Ile His Ser Cys Gln Lys Phe 545 550 555 560 Phe Glu Thr
Lys Cys Phe Met Ala Ser Phe Ser Thr Glu Ile Val Val 565 570 575 Met
Met Leu Phe Leu Thr Ile Leu Gly Leu Gly Ser Ala Val Ser Leu 580 585
590 Thr Ile Cys Gly Ala Gly Glu Glu Leu Lys Gly Asn Lys Val Pro Glu
595 600 605 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro
Phe Met 610 615 620 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys
Ser Cys Arg Phe 625 630 635 640 Pro Glu Glu Glu Glu Gly Gly Cys Glu
Leu Gly Ser Gly Val Lys Gln 645 650 655 Thr Leu Asn Phe Asp Leu Leu
Lys Leu Ala Gly Asp Val Glu Ser Asn 660 665 670 Pro Gly Pro Met Ile
Pro Ala Val Val Leu Leu Leu Leu Leu Leu Val 675 680 685 Glu Gln Ala
Ala Ala Leu Gly Glu Pro Gln Leu Cys Tyr Ile Leu Asp 690 695 700 Ala
Ile Leu Phe Leu Tyr Gly Ile Val Leu Thr Leu Leu Tyr Cys Arg 705 710
715 720 Leu Lys Ile Gln Val Arg Lys Ala Ala Ile Thr Ser Tyr Glu Lys
Ser 725 730 735 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr
Gln Gln Gly 740 745 750 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly
Arg Arg Glu Glu Tyr 755 760 765 Asp Val Leu Asp Lys Arg Arg Gly Arg
Asp Pro Glu Met Gly Gly Lys 770 775 780 Pro Arg Arg Lys Asn Pro Gln
Glu Gly Leu Tyr Asn Glu Leu Gln Lys 785 790 795 800 Asp Lys Met Ala
Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 805 810 815 Arg Arg
Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 820 825 830
Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 835
840 845 <210> SEQ ID NO 7 <211> LENGTH: 2547
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Multi-chain CAR
<400> SEQUENCE: 7 atggctcctg ccatggaatc ccctactcta ctgtgtgtag
ccttactgtt cttcgctcca 60 gatggcgtgt tagcagaggt gcagttgcag
cagtcagggc cagagttgat taagcccgga 120 gcctccgtca agatgtcctg
caaggccagc gggtacactt tcaccagcta cgtcatgcat 180 tgggtgaagc
agaagccagg ccaggggctt gagtggattg ggtacatcaa cccctacaac 240
gacgggacca aatacaacga gaaattcaag ggcaaagcca cactcacctc cgataagtcc
300 tcctctaccg cctacatgga gctcagctcc ctgacctccg aggatagcgc
tgtgtattac 360 tgcgcaaggg gcacatacta ctatggctct agggtgttcg
actactgggg gcagggcact 420 actctcacag tgagctcagg cggaggaggc
agtggcggag ggggaagtgg gggcggcggc 480 agcgatattg tcatgaccca
ggcagcccct agtatccctg tgactccagg cgagagcgtg 540 agcatcagct
gccggtccag caagagcctg ctgaacagta acggaaacac atacctctac 600
tggtttctgc agaggcccgg ccagagccct cagctgctga tttaccgcat gtcaaatctt
660 gcctctgggg tgcccgatag atttagtggg agcggatccg gcacagcttt
tacattgcgg 720 atctccagag tcgaggccga agacgtgggg gtctattact
gtatgcaaca cctggaatac 780 ccctttacct tcggagccgg cacaaagctg
gagctgaagc gggctgacac cacaaccccc 840 gctccaaggc cccctacccc
cgcaccaact attgcctccc agccactctc actgcggcct 900 gaggcctgtc
ggcccgctgc tggaggcgca gtgcatacaa ggggcctcga tttcgcctgc 960
gattttttta tcccattgtt ggtggtgatt ctgtttgctg tggacacagg attatttatc
1020 tcaactcagc agcaggtcac atttctcttg aagattaaga gaaccaggaa
aggcttcaga 1080 cttctgaacc cacatcctaa gccaaacccc aaaaacaaca
gagccgaggg cagaggcagc 1140 ctgctgacct gcggcgacgt ggaggagaac
ccaggcccca tggacacaga aagtaatagg 1200 agagcaaatc ttgctctccc
acaggagcct tccagtgtgc ctgcatttga agtcttggaa 1260 atatctcccc
aggaagtatc ttcaggcaga ctattgaagt cggcctcatc cccaccactg 1320
catacatggc tgacagtttt gaaaaaagag caggagttcc tgggggtaac acaaattctg
1380 actgctatga tatgcctttg ttttggaaca gttgtctgct ctgtacttga
tatttcacac 1440 attgagggag acattttttc atcatttaaa gcaggttatc
cattctgggg agccatattt 1500 ttttctattt ctggaatgtt gtcaattata
tctgaaagga gaaatgcaac atatctggtg 1560 agaggaagcc tgggagcaaa
cactgccagc agcatagctg ggggaacggg aattaccatc 1620 ctgatcatca
acctgaagaa gagcttggcc tatatccaca tccacagttg ccagaaattt 1680
tttgagacca agtgctttat ggcttccttt tccactgaaa ttgtagtgat gatgctgttt
1740 ctcaccattc tgggacttgg tagtgctgtg tcactcacaa tctgtggagc
tggggaagaa 1800 ctcaaaggaa acaaggttcc agagaaacgg ggccggaaga
agctcctcta catttttaag 1860 cagcctttca tgcggccagt gcagacaacc
caagaggagg atgggtgttc ctgcagattc 1920 cctgaggaag aggaaggcgg
gtgcgagctg ggttctggcg tgaaacagac tttgaatttt 1980 gaccttctca
agttggcggg agacgtggag tccaacccag ggcccatgat tccagcagtg 2040
gtcttgctct tactcctttt ggttgaacaa gcagcggccc tgggagagcc tcagctctgc
2100 tatatcctgg atgccatcct gtttctgtat ggaattgtcc tcaccctcct
ctactgtcga 2160 ctgaagatcc aagtgcgaaa ggcagctata accagctatg
agaaatcaag agtgaagttc 2220 tccaggagcg cagatgcccc cgcctatcaa
cagggccaga accagctcta caacgagctt 2280 aacctcggga ggcgcgaaga
atacgacgtg ttggataaga gaagggggcg ggaccccgag 2340 atgggaggaa
agccccggag gaagaaccct caggagggcc tgtacaacga gctgcagaag 2400
gataagatgg ccgaggccta ctcagagatc gggatgaagg gggagcggcg ccgcgggaag
2460 gggcacgatg ggctctacca ggggctgagc acagccacaa aggacacata
cgacgccttg 2520 cacatgcagg cccttccacc ccggtga 2547 <210> SEQ
ID NO 8 <211> LENGTH: 251 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Anti-CD19 CAR <400> SEQUENCE: 8 Glu Val
Gln Leu Gln Gln Ser Gly Pro Glu Leu Ile Lys Pro Gly Ala 1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20
25 30 Val Met His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp
Ile 35 40 45 Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn
Glu Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser
Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Ser Glu
Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Thr Tyr Tyr Tyr
Gly Ser Arg Val Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Thr Leu
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser
Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ala Ala 130 135 140 Pro
Ser Ile Pro Val Thr Pro Gly Glu Ser Val Ser Ile Ser Cys Arg 145 150
155 160 Ser Ser Lys Ser Leu Leu Asn Ser Asn Gly Asn Thr Tyr Leu Tyr
Trp 165 170 175 Phe Leu Gln Arg Pro Gly Gln Ser Pro Gln Leu Leu Ile
Tyr Arg Met 180 185 190 Ser Asn Leu Ala Ser Gly Val Pro Asp Arg Phe
Ser Gly Ser Gly Ser 195 200 205 Gly Thr Ala Phe Thr Leu Arg Ile Ser
Arg Val Glu Ala Glu Asp Val 210 215 220 Gly Val Tyr Tyr Cys Met Gln
His Leu Glu Tyr Pro Phe Thr Phe Gly 225 230 235 240 Ala Gly Thr Lys
Leu Glu Leu Lys Arg Ala Asp 245 250 <210> SEQ ID NO 9
<211> LENGTH: 15 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: scrambled p60 <400> SEQUENCE: 9 Met Lys Met Phe
Phe Asp Ala Phe Pro Gln Arg Arg Ser Trp Phe 1 5 10 15 <210>
SEQ ID NO 10 <211> LENGTH: 5 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: linker <400> SEQUENCE: 10 Gly
Ser Ser Ser Ser 1 5 <210> SEQ ID NO 11 <211> LENGTH: 18
<212> TYPE: PRT <213> ORGANISM: Gallus gallus
<400> SEQUENCE: 11 Met Arg Ser Leu Leu Ile Leu Val Leu Cys
Phe Leu Pro Leu Ala Ala 1 5 10 15 Leu Gly <210> SEQ ID NO 12
<211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: 3R CLSP <400> SEQUENCE: 12 Met Arg Arg Arg Ser
Leu Leu Ile Leu Val Leu Cys Phe Leu Pro Leu 1 5 10 15 Ala Ala Leu
Gly 20 <210> SEQ ID NO 13 <211> LENGTH: 21 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: 4R CLSP <400>
SEQUENCE: 13 Met Arg Arg Arg Arg Ser Leu Leu Ile Leu Val Leu Cys
Phe Leu Pro 1 5 10 15 Leu Ala Ala Leu Gly 20 <210> SEQ ID NO
14 <211> LENGTH: 18 <212> TYPE: PRT <213>
ORGANISM: Homo sapiens <400> SEQUENCE: 14 Met Lys Ala Leu Ile
Val Leu Gly Leu Val Leu Leu Ser Val Thr Val 1 5 10 15 Gln Gly
<210> SEQ ID NO 15 <211> LENGTH: 20 <212> TYPE:
PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 15 Met
Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu 1 5 10
15 Val Thr Asn Ser 20 <210> SEQ ID NO 16 <211> LENGTH:
20 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: 3K HLSP
<400> SEQUENCE: 16 Met Lys Lys Lys Ala Leu Ile Val Leu Gly
Leu Val Leu Leu Ser Val 1 5 10 15 Thr Val Gln Gly 20 <210>
SEQ ID NO 17 <211> LENGTH: 22 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: 3R IL2SP <400> SEQUENCE: 17
Met Tyr Arg Arg Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu 1 5
10 15 Ala Leu Val Thr Asn Ser 20
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 17 <210>
SEQ ID NO 1 <211> LENGTH: 15 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: peptide inhibitor of FoxP3
<400> SEQUENCE: 1 Arg Asp Phe Gln Ser Phe Arg Lys Met Trp Pro
Phe Phe Ala Met 1 5 10 15 <210> SEQ ID NO 2 <211>
LENGTH: 45 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
peptide inhibitor of FoxP3 <400> SEQUENCE: 2 cgcgactttc
aaagtttccg taagatgtgg ccgttttttg caatg 45 <210> SEQ ID NO 3
<211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: peptide inhibitor of FoxP3 <400> SEQUENCE: 3 Met
Arg Asp Phe Gln Ser Phe Arg Lys Met Trp Pro Phe Phe Ala Met 1 5 10
15 <210> SEQ ID NO 4 <211> LENGTH: 48 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: peptide inhibitor of FoxP3
<400> SEQUENCE: 4 atgcgcgact ttcaaagttt ccgtaagatg tggccgtttt
ttgcaatg 48 <210> SEQ ID NO 5 <211> LENGTH: 495
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: anti-CD19 CAR
<400> SEQUENCE: 5 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu
Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Glu Val Gln Leu Gln
Gln Ser Gly Pro Glu Leu Ile 20 25 30 Lys Pro Gly Ala Ser Val Lys
Met Ser Cys Lys Ala Ser Gly Tyr Thr 35 40 45 Phe Thr Ser Tyr Val
Met His Trp Val Lys Gln Lys Pro Gly Gln Gly 50 55 60 Leu Glu Trp
Ile Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr 65 70 75 80 Asn
Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser 85 90
95 Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala
100 105 110 Val Tyr Tyr Cys Ala Arg Gly Thr Tyr Tyr Tyr Gly Ser Arg
Val Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser
Ser Gly Gly Gly 130 135 140 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Asp Ile Val Met 145 150 155 160 Thr Gln Ala Ala Pro Ser Ile
Pro Val Thr Pro Gly Glu Ser Val Ser 165 170 175 Ile Ser Cys Arg Ser
Ser Lys Ser Leu Leu Asn Ser Asn Gly Asn Thr 180 185 190 Tyr Leu Tyr
Trp Phe Leu Gln Arg Pro Gly Gln Ser Pro Gln Leu Leu 195 200 205 Ile
Tyr Arg Met Ser Asn Leu Ala Ser Gly Val Pro Asp Arg Phe Ser 210 215
220 Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg Ile Ser Arg Val Glu
225 230 235 240 Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln His Leu
Glu Tyr Pro 245 250 255 Phe Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
Lys Arg Ser Asp Pro 260 265 270 Thr Thr Thr Pro Ala Pro Arg Pro Pro
Thr Pro Ala Pro Thr Ile Ala 275 280 285 Ser Gln Pro Leu Ser Leu Arg
Pro Glu Ala Cys Arg Pro Ala Ala Gly 290 295 300 Gly Ala Val His Thr
Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile 305 310 315 320 Trp Ala
Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val 325 330 335
Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe 340
345 350 Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp
Gly 355 360 365 Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys
Glu Leu Arg 370 375 380 Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala
Tyr Gln Gln Gly Gln 385 390 395 400 Asn Gln Leu Tyr Asn Glu Leu Asn
Leu Gly Arg Arg Glu Glu Tyr Asp 405 410 415 Val Leu Asp Lys Arg Arg
Gly Arg Asp Pro Glu Met Gly Gly Lys Pro 420 425 430 Arg Arg Lys Asn
Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp 435 440 445 Lys Met
Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg 450 455 460
Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr 465
470 475 480 Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro
Arg 485 490 495 <210> SEQ ID NO 6 <211> LENGTH: 848
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Multi-chain CAR
<400> SEQUENCE: 6 Met Ala Pro Ala Met Glu Ser Pro Thr Leu Leu
Cys Val Ala Leu Leu 1 5 10 15 Phe Phe Ala Pro Asp Gly Val Leu Ala
Glu Val Gln Leu Gln Gln Ser 20 25 30 Gly Pro Glu Leu Ile Lys Pro
Gly Ala Ser Val Lys Met Ser Cys Lys 35 40 45 Ala Ser Gly Tyr Thr
Phe Thr Ser Tyr Val Met His Trp Val Lys Gln 50 55 60 Lys Pro Gly
Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Tyr Asn 65 70 75 80 Asp
Gly Thr Lys Tyr Asn Glu Lys Phe Lys Gly Lys Ala Thr Leu Thr 85 90
95 Ser Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr
100 105 110 Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Gly Thr Tyr
Tyr Tyr 115 120 125 Gly Ser Arg Val Phe Asp Tyr Trp Gly Gln Gly Thr
Thr Leu Thr Val 130 135 140 Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly 145 150 155 160 Ser Asp Ile Val Met Thr Gln
Ala Ala Pro Ser Ile Pro Val Thr Pro 165 170 175 Gly Glu Ser Val Ser
Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu Asn 180 185 190 Ser Asn Gly
Asn Thr Tyr Leu Tyr Trp Phe Leu Gln Arg Pro Gly Gln 195 200 205 Ser
Pro Gln Leu Leu Ile Tyr Arg Met Ser Asn Leu Ala Ser Gly Val 210 215
220 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Ala Phe Thr Leu Arg
225 230 235 240 Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Met Gln 245 250 255 His Leu Glu Tyr Pro Phe Thr Phe Gly Ala Gly
Thr Lys Leu Glu Leu 260 265 270 Lys Arg Ala Asp Thr Thr Thr Pro Ala
Pro Arg Pro Pro Thr Pro Ala 275 280 285 Pro Thr Ile Ala Ser Gln Pro
Leu Ser Leu Arg Pro Glu Ala Cys Arg 290 295 300 Pro Ala Ala Gly Gly
Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys 305 310 315 320 Asp Phe
Phe Ile Pro Leu Leu Val Val Ile Leu Phe Ala Val Asp Thr 325 330 335
Gly Leu Phe Ile Ser Thr Gln Gln Gln Val Thr Phe Leu Leu Lys Ile 340
345 350 Lys Arg Thr Arg Lys Gly Phe Arg Leu Leu Asn Pro His Pro Lys
Pro 355 360 365 Asn Pro Lys Asn Asn Arg Ala Glu Gly Arg Gly Ser Leu
Leu Thr Cys 370 375 380 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Asp
Thr Glu Ser Asn Arg 385 390 395 400 Arg Ala Asn Leu Ala Leu Pro Gln
Glu Pro Ser Ser Val Pro Ala Phe 405 410 415 Glu Val Leu Glu Ile Ser
Pro Gln Glu Val Ser Ser Gly Arg Leu Leu 420 425 430 Lys Ser Ala Ser
Ser Pro Pro Leu His Thr Trp Leu Thr Val Leu Lys 435 440 445
Lys Glu Gln Glu Phe Leu Gly Val Thr Gln Ile Leu Thr Ala Met Ile 450
455 460 Cys Leu Cys Phe Gly Thr Val Val Cys Ser Val Leu Asp Ile Ser
His 465 470 475 480 Ile Glu Gly Asp Ile Phe Ser Ser Phe Lys Ala Gly
Tyr Pro Phe Trp 485 490 495 Gly Ala Ile Phe Phe Ser Ile Ser Gly Met
Leu Ser Ile Ile Ser Glu 500 505 510 Arg Arg Asn Ala Thr Tyr Leu Val
Arg Gly Ser Leu Gly Ala Asn Thr 515 520 525 Ala Ser Ser Ile Ala Gly
Gly Thr Gly Ile Thr Ile Leu Ile Ile Asn 530 535 540 Leu Lys Lys Ser
Leu Ala Tyr Ile His Ile His Ser Cys Gln Lys Phe 545 550 555 560 Phe
Glu Thr Lys Cys Phe Met Ala Ser Phe Ser Thr Glu Ile Val Val 565 570
575 Met Met Leu Phe Leu Thr Ile Leu Gly Leu Gly Ser Ala Val Ser Leu
580 585 590 Thr Ile Cys Gly Ala Gly Glu Glu Leu Lys Gly Asn Lys Val
Pro Glu 595 600 605 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys
Gln Pro Phe Met 610 615 620 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp
Gly Cys Ser Cys Arg Phe 625 630 635 640 Pro Glu Glu Glu Glu Gly Gly
Cys Glu Leu Gly Ser Gly Val Lys Gln 645 650 655 Thr Leu Asn Phe Asp
Leu Leu Lys Leu Ala Gly Asp Val Glu Ser Asn 660 665 670 Pro Gly Pro
Met Ile Pro Ala Val Val Leu Leu Leu Leu Leu Leu Val 675 680 685 Glu
Gln Ala Ala Ala Leu Gly Glu Pro Gln Leu Cys Tyr Ile Leu Asp 690 695
700 Ala Ile Leu Phe Leu Tyr Gly Ile Val Leu Thr Leu Leu Tyr Cys Arg
705 710 715 720 Leu Lys Ile Gln Val Arg Lys Ala Ala Ile Thr Ser Tyr
Glu Lys Ser 725 730 735 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro
Ala Tyr Gln Gln Gly 740 745 750 Gln Asn Gln Leu Tyr Asn Glu Leu Asn
Leu Gly Arg Arg Glu Glu Tyr 755 760 765 Asp Val Leu Asp Lys Arg Arg
Gly Arg Asp Pro Glu Met Gly Gly Lys 770 775 780 Pro Arg Arg Lys Asn
Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 785 790 795 800 Asp Lys
Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 805 810 815
Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 820
825 830 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro
Arg 835 840 845 <210> SEQ ID NO 7 <211> LENGTH: 2547
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Multi-chain CAR
<400> SEQUENCE: 7 atggctcctg ccatggaatc ccctactcta ctgtgtgtag
ccttactgtt cttcgctcca 60 gatggcgtgt tagcagaggt gcagttgcag
cagtcagggc cagagttgat taagcccgga 120 gcctccgtca agatgtcctg
caaggccagc gggtacactt tcaccagcta cgtcatgcat 180 tgggtgaagc
agaagccagg ccaggggctt gagtggattg ggtacatcaa cccctacaac 240
gacgggacca aatacaacga gaaattcaag ggcaaagcca cactcacctc cgataagtcc
300 tcctctaccg cctacatgga gctcagctcc ctgacctccg aggatagcgc
tgtgtattac 360 tgcgcaaggg gcacatacta ctatggctct agggtgttcg
actactgggg gcagggcact 420 actctcacag tgagctcagg cggaggaggc
agtggcggag ggggaagtgg gggcggcggc 480 agcgatattg tcatgaccca
ggcagcccct agtatccctg tgactccagg cgagagcgtg 540 agcatcagct
gccggtccag caagagcctg ctgaacagta acggaaacac atacctctac 600
tggtttctgc agaggcccgg ccagagccct cagctgctga tttaccgcat gtcaaatctt
660 gcctctgggg tgcccgatag atttagtggg agcggatccg gcacagcttt
tacattgcgg 720 atctccagag tcgaggccga agacgtgggg gtctattact
gtatgcaaca cctggaatac 780 ccctttacct tcggagccgg cacaaagctg
gagctgaagc gggctgacac cacaaccccc 840 gctccaaggc cccctacccc
cgcaccaact attgcctccc agccactctc actgcggcct 900 gaggcctgtc
ggcccgctgc tggaggcgca gtgcatacaa ggggcctcga tttcgcctgc 960
gattttttta tcccattgtt ggtggtgatt ctgtttgctg tggacacagg attatttatc
1020 tcaactcagc agcaggtcac atttctcttg aagattaaga gaaccaggaa
aggcttcaga 1080 cttctgaacc cacatcctaa gccaaacccc aaaaacaaca
gagccgaggg cagaggcagc 1140 ctgctgacct gcggcgacgt ggaggagaac
ccaggcccca tggacacaga aagtaatagg 1200 agagcaaatc ttgctctccc
acaggagcct tccagtgtgc ctgcatttga agtcttggaa 1260 atatctcccc
aggaagtatc ttcaggcaga ctattgaagt cggcctcatc cccaccactg 1320
catacatggc tgacagtttt gaaaaaagag caggagttcc tgggggtaac acaaattctg
1380 actgctatga tatgcctttg ttttggaaca gttgtctgct ctgtacttga
tatttcacac 1440 attgagggag acattttttc atcatttaaa gcaggttatc
cattctgggg agccatattt 1500 ttttctattt ctggaatgtt gtcaattata
tctgaaagga gaaatgcaac atatctggtg 1560 agaggaagcc tgggagcaaa
cactgccagc agcatagctg ggggaacggg aattaccatc 1620 ctgatcatca
acctgaagaa gagcttggcc tatatccaca tccacagttg ccagaaattt 1680
tttgagacca agtgctttat ggcttccttt tccactgaaa ttgtagtgat gatgctgttt
1740 ctcaccattc tgggacttgg tagtgctgtg tcactcacaa tctgtggagc
tggggaagaa 1800 ctcaaaggaa acaaggttcc agagaaacgg ggccggaaga
agctcctcta catttttaag 1860 cagcctttca tgcggccagt gcagacaacc
caagaggagg atgggtgttc ctgcagattc 1920 cctgaggaag aggaaggcgg
gtgcgagctg ggttctggcg tgaaacagac tttgaatttt 1980 gaccttctca
agttggcggg agacgtggag tccaacccag ggcccatgat tccagcagtg 2040
gtcttgctct tactcctttt ggttgaacaa gcagcggccc tgggagagcc tcagctctgc
2100 tatatcctgg atgccatcct gtttctgtat ggaattgtcc tcaccctcct
ctactgtcga 2160 ctgaagatcc aagtgcgaaa ggcagctata accagctatg
agaaatcaag agtgaagttc 2220 tccaggagcg cagatgcccc cgcctatcaa
cagggccaga accagctcta caacgagctt 2280 aacctcggga ggcgcgaaga
atacgacgtg ttggataaga gaagggggcg ggaccccgag 2340 atgggaggaa
agccccggag gaagaaccct caggagggcc tgtacaacga gctgcagaag 2400
gataagatgg ccgaggccta ctcagagatc gggatgaagg gggagcggcg ccgcgggaag
2460 gggcacgatg ggctctacca ggggctgagc acagccacaa aggacacata
cgacgccttg 2520 cacatgcagg cccttccacc ccggtga 2547 <210> SEQ
ID NO 8 <211> LENGTH: 251 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Anti-CD19 CAR <400> SEQUENCE: 8 Glu Val
Gln Leu Gln Gln Ser Gly Pro Glu Leu Ile Lys Pro Gly Ala 1 5 10 15
Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20
25 30 Val Met His Trp Val Lys Gln Lys Pro Gly Gln Gly Leu Glu Trp
Ile 35 40 45 Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Tyr Asn
Glu Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser
Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Ser Glu
Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Thr Tyr Tyr Tyr
Gly Ser Arg Val Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Thr Leu
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser
Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ala Ala 130 135 140 Pro
Ser Ile Pro Val Thr Pro Gly Glu Ser Val Ser Ile Ser Cys Arg 145 150
155 160 Ser Ser Lys Ser Leu Leu Asn Ser Asn Gly Asn Thr Tyr Leu Tyr
Trp 165 170 175 Phe Leu Gln Arg Pro Gly Gln Ser Pro Gln Leu Leu Ile
Tyr Arg Met 180 185 190 Ser Asn Leu Ala Ser Gly Val Pro Asp Arg Phe
Ser Gly Ser Gly Ser 195 200 205 Gly Thr Ala Phe Thr Leu Arg Ile Ser
Arg Val Glu Ala Glu Asp Val 210 215 220 Gly Val Tyr Tyr Cys Met Gln
His Leu Glu Tyr Pro Phe Thr Phe Gly 225 230 235 240 Ala Gly Thr Lys
Leu Glu Leu Lys Arg Ala Asp 245 250 <210> SEQ ID NO 9
<211> LENGTH: 15 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: scrambled p60 <400> SEQUENCE: 9 Met Lys Met Phe
Phe Asp Ala Phe Pro Gln Arg Arg Ser Trp Phe 1 5 10 15 <210>
SEQ ID NO 10 <211> LENGTH: 5 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: linker
<400> SEQUENCE: 10 Gly Ser Ser Ser Ser 1 5 <210> SEQ ID
NO 11 <211> LENGTH: 18 <212> TYPE: PRT <213>
ORGANISM: Gallus gallus <400> SEQUENCE: 11 Met Arg Ser Leu
Leu Ile Leu Val Leu Cys Phe Leu Pro Leu Ala Ala 1 5 10 15 Leu Gly
<210> SEQ ID NO 12 <211> LENGTH: 20 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: 3R CLSP <400> SEQUENCE: 12 Met
Arg Arg Arg Ser Leu Leu Ile Leu Val Leu Cys Phe Leu Pro Leu 1 5 10
15 Ala Ala Leu Gly 20 <210> SEQ ID NO 13 <211> LENGTH:
21 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: 4R CLSP
<400> SEQUENCE: 13 Met Arg Arg Arg Arg Ser Leu Leu Ile Leu
Val Leu Cys Phe Leu Pro 1 5 10 15 Leu Ala Ala Leu Gly 20
<210> SEQ ID NO 14 <211> LENGTH: 18 <212> TYPE:
PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 14 Met
Lys Ala Leu Ile Val Leu Gly Leu Val Leu Leu Ser Val Thr Val 1 5 10
15 Gln Gly <210> SEQ ID NO 15 <211> LENGTH: 20
<212> TYPE: PRT <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 15 Met Tyr Arg Met Gln Leu Leu Ser Cys Ile
Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser 20 <210>
SEQ ID NO 16 <211> LENGTH: 20 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: 3K HLSP <400> SEQUENCE: 16 Met
Lys Lys Lys Ala Leu Ile Val Leu Gly Leu Val Leu Leu Ser Val 1 5 10
15 Thr Val Gln Gly 20 <210> SEQ ID NO 17 <211> LENGTH:
22 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: 3R IL2SP
<400> SEQUENCE: 17 Met Tyr Arg Arg Arg Met Gln Leu Leu Ser
Cys Ile Ala Leu Ser Leu 1 5 10 15 Ala Leu Val Thr Asn Ser 20
* * * * *