U.S. patent application number 15/809680 was filed with the patent office on 2018-06-07 for process of preparing mrna-loaded lipid nanoparticles.
The applicant listed for this patent is Translate Bio, Inc.. Invention is credited to Zarna Bhavsar, Frank DeRosa, Michael Heartlein, Shrirang Karve.
Application Number | 20180153822 15/809680 |
Document ID | / |
Family ID | 60782328 |
Filed Date | 2018-06-07 |
United States Patent
Application |
20180153822 |
Kind Code |
A1 |
Karve; Shrirang ; et
al. |
June 7, 2018 |
Process of Preparing mRNA-Loaded Lipid Nanoparticles
Abstract
The present invention provides an improved process for lipid
nanoparticle formulation and mRNA encapsulation. In some
embodiments, the present invention provides a process of
encapsulating messenger RNA (mRNA) in lipid nanoparticles
comprising a step of mixing a solution of pre-formed lipid
nanoparticles and mRNA.
Inventors: |
Karve; Shrirang; (Cambridge,
MA) ; DeRosa; Frank; (Cambridge, MA) ;
Bhavsar; Zarna; (Cambridge, MA) ; Heartlein;
Michael; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Translate Bio, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
60782328 |
Appl. No.: |
15/809680 |
Filed: |
November 10, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62580155 |
Nov 1, 2017 |
|
|
|
62420413 |
Nov 10, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/1816 20130101;
A61K 47/28 20130101; C12N 15/88 20130101; A61K 38/177 20130101;
A61K 47/22 20130101; A61K 9/1272 20130101; C12Y 201/03003 20130101;
A61K 9/5192 20130101; A61K 38/45 20130101; A61K 38/53 20130101;
A61K 9/5123 20130101; A61K 38/44 20130101; A61P 43/00 20180101;
C12Y 114/16001 20130101; C12Y 603/04005 20130101 |
International
Class: |
A61K 9/51 20060101
A61K009/51; A61K 38/53 20060101 A61K038/53; A61K 38/44 20060101
A61K038/44; A61K 38/18 20060101 A61K038/18; A61K 38/17 20060101
A61K038/17; A61K 38/45 20060101 A61K038/45 |
Claims
1. A process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles comprising: mixing a solution comprising pre-formed
lipid nanoparticles and mRNA such that lipid nanoparticles
encapsulating mRNA are formed.
2. The process of claim 1, wherein the solution comprising
pre-formed lipid nanoparticles and mRNA comprises less than 10 mM
citrate.
3. The process of claim 1, wherein the solution comprising
pre-formed lipid nanoparticles and mRNA comprises less than 25%
non-aqueous solvent.
4-5. (canceled)
6. The process of claim 1, comprising heating the lipid
nanoparticles and mRNA to a temperature greater than ambient
temperature before or after the mixing, and wherein the temperature
is or is greater than about 30.degree. C., 37.degree. C.,
40.degree. C., 45.degree. C., 50.degree. C., 55.degree. C.,
60.degree. C., 65.degree. C., or 70.degree. C.
7-8. (canceled)
9. The process of claim 1, wherein the pre-formed lipid
nanoparticles are formed by mixing lipids dissolved in ethanol with
an aqueous solution.
10. The process of claim 1, wherein the lipids comprise one or more
cationic lipids, one or more helper lipids, one or more
cholesterol-based lipids and PEG lipids.
11. The process of claim 10, wherein the one or more cationic
lipids are selected from the group consisting of cKK-E12, OF-02,
C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (Imidazol-based), HGT5000,
HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and
DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP,
DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA,
3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydrox-
yundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23),
3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2--
hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target
24), and combinations thereof.
12-14. (canceled)
15. The process of claim 10, wherein the one or more non-cationic
lipids are selected from DSPC
(1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC
(1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE
(1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC
(1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE
(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE
(1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG
(1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).
16-17. (canceled)
18. The process of claim 1, wherein the pre-formed lipid
nanoparticles are purified by a Tangential Flow Filtration (TFF)
process and wherein greater than about 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified
nanoparticles have a size ranging from 75-150 nm.
19-21. (canceled)
22. The process of claim 1, wherein the process results in an
encapsulation rate of greater than about 90%, 95%, 96%, 97%, 98%,
or 99%.
23. The process of claim 1, wherein the process results in greater
than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,
or 99% recovery of mRNA.
24. The process of claim 1, wherein the pre-formed lipid
nanoparticles and mRNA are mixed using a pump system.
25-26. (canceled)
27. The process of claim 24, wherein the solution comprising
pre-formed lipid nanoparticles is mixed at a flow rate ranging from
about 25-75 ml/minute, about 75-200 ml/minute, about 200-350
ml/minute, about 350-500 ml/minute, about 500-650 ml/minute, about
650-850 ml/minute, or about 850-1000 ml/minute.
28-30. (canceled)
31. The process of claim 1, wherein the process comprises a step of
first generating an mRNA solution by mixing a citrate buffer with
an mRNA stock solution, wherein the citrate buffer comprises about
10 mM citrate, about 150 mM NaCl, pH of about 4.5.
32. (canceled)
33. The process of claim 31, wherein the mRNA stock solution
comprises the mRNA at a concentration at or greater than about 1
mg/ml, about 10 mg/ml, about 50 mg/ml, about 100 mg/ml.
34. The process claim 31, wherein the citrate buffer is mixed at a
flow rate ranging between about 100-300 ml/minute, 300-600
ml/minute, 600-1200 ml/minute, 1200-2400 ml/minute, 2400-3600
ml/minute, 3600-4800 ml/minute, or 4800-6000 ml/minute.
35-37. (canceled)
38. The process of claim 1, wherein the lipid nanoparticles
encapsulating mRNA are prepared with the pre-formed lipid
nanoparticles in a trehalose solution.
39. (canceled)
40. A composition of lipid nanoparticles encapsulating mRNA
generated by a process of claim 1, wherein the mRNA comprises one
or more modified nucleotides.
41-45. (canceled)
46. A method of delivering mRNA for in vivo protein production
comprising administering into a subject a composition of lipid
nanoparticles encapsulating mRNA generated by claim 1, wherein the
mRNA encodes a protein of interest.
47. (canceled)
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 62/420,413, filed Nov. 10, 2016 and U.S.
Provisional Application Ser. No. 62/580,155, filed Nov. 1, 2017,
the disclosures of which are hereby incorporated by reference.
SEQUENCE LISTING
[0002] The present specification makes reference to a Sequence
Listing (submitted electronically as a .txt file named
"MRT-1246US_SL" on Nov. 10, 2017). The .txt file was generated Nov.
10, 2017 and is 17,482 bytes in size. The entire contents of the
Sequence Listing are herein incorporated by reference.
BACKGROUND
[0003] Messenger RNA therapy (MRT) is becoming an increasingly
important approach for the treatment of a variety of diseases. MRT
involves administration of messenger RNA (mRNA) to a patient in
need of the therapy for production of the protein encoded by the
mRNA within the patient's body. Lipid nanoparticles are commonly
used to encapsulate mRNA for efficient in vivo delivery of
mRNA.
[0004] To improve lipid nanoparticle delivery, much effort has
focused on identifying novel lipids or particular lipid
compositions that can affect intracellular delivery and/or
expression of mRNA, e.g., in various types of mammalian tissue,
organs and/or cells (e.g., mammalian liver cells). However, these
existing approaches are costly, time consuming and
unpredictable.
SUMMARY OF INVENTION
[0005] The present invention provides, among other things, an
improved process for preparing mRNA-loaded lipid nanoparticles. In
particular, the present invention is based on the surprising
discovery that encapsulating mRNA by combining pre-formed lipid
nanoparticles with mRNA results in formulated particles that
exhibit unexpectedly efficient in vivo delivery of the mRNA and
surprisingly potent expression of protein(s) and/or peptide(s) that
the mRNA encodes.
[0006] As compared to conventional processes, the inventive process
described herein provides higher potency and better efficacy of
lipid nanoparticle delivered mRNA, thereby shifting the therapeutic
index in a positive direction and providing additional advantages,
such as lower cost, better patient compliance, and more patient
friendly dosing regimens. mRNA-loaded lipid nanoparticle
formulations provided by the present invention may be successfully
delivered in vivo for more potent and efficacious protein
expression via different routes of administration such as
intravenous, intramuscular, intra-articular, intrathecal,
inhalation (respiratory), subcutaneous, intravitreal, and
ophthalmic.
[0007] This inventive process can be performed using a pump system
and is therefore scalable, allowing for improved particle
formation/formulation in amounts sufficient for, e.g., performance
of clinical trials and/or commercial sale. Various pump systems may
be used to practice the present invention including, but not
limited to, pulse-less flow pumps, gear pumps, peristaltic pumps,
and centrifugal pumps.
[0008] This inventive process also results in superior
encapsulation efficiency, mRNA recovery rate, and homogeneous
particle sizes.
[0009] Thus, in one aspect, the present invention provides a
process of encapsulating messenger RNA (mRNA) in lipid
nanoparticles comprising a step of mixing a solution comprising
pre-formed lipid nanoparticles and a solution comprising mRNA such
that lipid nanoparticles encapsulating mRNA are formed. As used
herein, pre-formed lipid nanoparticles are substantially free of
mRNA. In some embodiments, preformed lipid nanoparticles are
referred to as empty lipid nanoparticles.
[0010] In some embodiments, the process according to the present
invention includes a step of heating one or more of the solutions
(i.e., applying heat from a heat source to the solution) to a
temperature (or to maintain at a temperature) greater than ambient
temperature, the one more solutions being the solution comprising
the pre-formed lipid nanoparticles, the solution comprising the
mRNA and the mixed solution comprising the lipid nanoparticle
encapsulated mRNA. In some embodiments, the process includes the
step of heating one or both of the mRNA solution and the pre-formed
lipid nanoparticle solution, prior to the mixing step. In some
embodiments, the process includes heating one or more one or more
of the solution comprising the pre-formed lipid nanoparticles, the
solution comprising the mRNA and the solution comprising the lipid
nanoparticle encapsulated mRNA, during the mixing step. In some
embodiments, the process includes the step of heating the lipid
nanoparticle encapsulated mRNA, after the mixing step. In some
embodiments, the temperature to which one or more of the solutions
is heated (or at which one or more of the solutions is maintained)
is or is greater than about 30.degree. C., 37.degree. C.,
40.degree. C., 45.degree. C., 50.degree. C., 55.degree. C.,
60.degree. C., 65.degree. C., or 70.degree. C. In some embodiments,
the temperature to which one or more of the solutions is heated
ranges from about 25-70.degree. C., about 30-70.degree. C., about
35-70.degree. C., about 40-70.degree. C., about 45-70.degree. C.,
about 50-70.degree. C., or about 60-70.degree. C. In some
embodiments, the temperature greater than ambient temperature to
which one or more of the solutions is heated is about 65.degree.
C.
[0011] In some embodiments, the process according to the present
invention includes maintaining at ambient temperature (i.e., not
applying heat from a heat source to the solution) one or more of
the solution comprising the pre-formed lipid nanoparticles, the
solution comprising the mRNA and the mixed solution comprising the
lipid nanoparticle encapsulated mRNA. In some embodiments, the
process includes the step of maintaining at ambient temperature one
or both of the mRNA solution and the pre-formed lipid nanoparticle
solution, prior to the mixing step. In some embodiments, the
process includes maintaining at ambient temperature one or more one
or more of the solution comprising the pre-formed lipid
nanoparticles, the solution comprising the mRNA and the solution
comprising the lipid nanoparticle encapsulated mRNA, during the
mixing step. In some embodiments, the process includes the step of
maintaining at ambient temperature the lipid nanoparticle
encapsulated mRNA, after the mixing step. In some embodiments, the
ambient temperature at which one or more of the solutions is
maintained is or is less than about 35.degree. C., 30.degree. C.,
25.degree. C., 20.degree. C., or 16.degree. C. In some embodiments,
the ambient temperature at which one or more of the solutions is
maintained ranges from about 15-35.degree. C., about 15-30.degree.
C., about 15-25.degree. C., about 15-20.degree. C., about
20-35.degree. C., about 25-35.degree. C., about 30-35.degree. C.,
about 20-30.degree. C., about 25-30.degree. C. or about
20-25.degree. C. In some embodiments, the ambient temperature at
which one or more of the solutions is maintained is 20-25.degree.
C.
[0012] In some embodiments, the process according to the present
invention includes performing at ambient temperature the step of
mixing the solution comprising pre-formed lipid nanoparticles and
the solution comprising mRNA to form lipid nanoparticles
encapsulating mRNA.
[0013] In some embodiments, the pre-formed lipid nanoparticles are
formed by mixing lipids dissolved in ethanol with an aqueous
solution. In some embodiments, the lipids contain one or more
cationic lipids, one or more helper lipids, and one or more PEG
lipids. In some embodiments, the lipids also contain one or more
cholesterol lipids. The pre-formed lipid nanoparticles are formed
by the mixing of those lipids. Accordingly, in some embodiments,
the pre-formed lipid nanoparticles comprise one or more cationic
lipids, one or more helper lipids, and one or more PEG lipids. In
some embodiments, the pre-formed lipid nanoparticles also contain
one or more cholesterol lipids.
[0014] In some embodiments, the one or more cationic lipids are
selected from the group consisting of cKK-E12, OF-02, C12-200, MC3,
DLinDMA, DLinkC2DMA, ICE (Imidazol-based), HGT5000, HGT5001,
HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA,
DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP,
DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA,
3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydrox-
yundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23),
3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2--
hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target
24), N1GL, N2GL, V1GL and combinations thereof.
[0015] In some embodiments, the one or more cationic lipids are
amino lipids. Amino lipids suitable for use in the invention
include those described in WO2017180917, which is hereby
incorporated by reference. Exemplary aminolipids in WO2017180917
include those described at paragraph [0744] such as DLin-MC3-DMA
(MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine
(L608), and Compound 18. Other amino lipids include Compound 2,
Compound 23, Compound 27, Compound 10, and Compound 20. Further
amino lipids suitable for use in the invention include those
described in WO2017112865, which is hereby incorporated by
reference. Exemplary amino lipids in WO2017112865 include a
compound according to one of formulae (I), (Ial)-(Ia6), (lb), (II),
(Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1),
and compounds of paragraphs [00185], [00201], [0276]. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118725, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL22 and KL25. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118724, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL10,
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and
KL25.
[0016] In some embodiments, the one or more non-cationic lipids are
selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine),
DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE
(1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC
(1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE
(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE
(1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG
(1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).
[0017] In some embodiments, the one or more PEG-modified lipids
comprise a poly(ethylene) glycol chain of up to 5 kDa in length
covalently attached to a lipid with alkyl chain(s) of
C.sub.6-C.sub.20 length.
[0018] In some embodiments, the pre-formed lipid nanoparticles are
purified by a Tangential Flow Filtration (TFF) process. In some
embodiments, greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles
have a size less than about 150 nm (e.g., less than about 145 nm,
about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120
nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about
95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70
nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some
embodiments, substantially all of the purified nanoparticles have a
size less than 150 nm (e.g., less than about 145 nm, about 140 nm,
about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115
nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90
nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65
nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments,
greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%
of the purified nanoparticles have a size ranging from 50-150 nm.
In some embodiments, substantially all of the purified
nanoparticles have a size ranging from 50-150 nm. In some
embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% of the purified nanoparticles have a size ranging
from 80-150 nm. In some embodiments, substantially all of the
purified nanoparticles have a size ranging from 80-150 nm.
[0019] In some embodiments, a process according to the present
invention results in an encapsulation rate of greater than about
90%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, a process
according to the present invention results in greater than about
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%
recovery of mRNA.
[0020] In some embodiments, the pre-formed lipid nanoparticles and
mRNA are mixed using a pump system. In some embodiments, the pump
system comprises a pulse-less flow pump. In some embodiments, the
pump system is a gear pump. In some embodiments, a suitable pump is
a peristaltic pump. In some embodiments, a suitable pump is a
centrifugal pump. In some embodiments, the process using a pump
system is performed at large scale. For example, in some
embodiments, the process includes using pumps as described herein
to mix a solution of at least about 1 mg, 5 mg, 10 mg, 50 mg, 100
mg, 500 mg, or 1000 mg of mRNA with a solution of pre-formed lipid
nanoparticles, to produce mRNA encapsulated in lipid nanoparticles.
In some embodiments, the process of mixing mRNA with pre-formed
lipid nanoparticles provides a composition according to the present
invention that contains at least about 1 mg, 5 mg, 10 mg, 50 mg,
100 mg, 500 mg, or 1000 mg of encapsulated mRNA.
[0021] In some embodiments, the solution comprising pre-formed
lipid nanoparticles is mixed at a flow rate ranging from about
25-75 ml/minute, about 75-200 ml/minute, about 200-350 ml/minute,
about 350-500 ml/minute, about 500-650 ml/minute, about 650-850
ml/minute, or about 850-1000 ml/minute. In some embodiments, the
solution comprising pre-formed lipid nanoparticles is mixed at a
flow rate of about 50 ml/minute, about 100 ml/minute, about 150
ml/minute, about 200 ml/minute, about 250 ml/minute, about 300
ml/minute, about 350 ml/minute, about 400 ml/minute, about 450
ml/minute, about 500 ml/minute, about 550 ml/minute, about 600
ml/minute, about 650 ml/minute, about 700 ml/minute, about 750
ml/minute, about 800 ml/minute, about 850 ml/minute, about 900
ml/minute, about 950 ml/minute, or about 1000 ml/minute.
[0022] In some embodiments, the mRNA is mixed in a solution at a
flow rate ranging from about 25-75 ml/minute, about 75-200
ml/minute, about 200-350 ml/minute, about 350-500 ml/minute, about
500-650 ml/minute, about 650-850 ml/minute, or about 850-1000
ml/minute. In some embodiments, the mRNA is mixed in a solution at
a flow rate of about 50 ml/minute, about 100 ml/minute, about 150
ml/minute, about 200 ml/minute, about 250 ml/minute, about 300
ml/minute, about 350 ml/minute, about 400 ml/minute, about 450
ml/minute, about 500 ml/minute, about 550 ml/minute, about 600
ml/minute, about 650 ml/minute, about 700 ml/minute, about 750
ml/minute, about 800 ml/minute, about 850 ml/minute, about 900
ml/minute, about 950 ml/minute, or about 1000 ml/minute.
[0023] In some embodiments, a process according to the present
invention includes a step of first generating pre-formed lipid
nanoparticle solution by mixing a citrate buffer with lipids
dissolved in ethanol.
[0024] In some embodiments, a process according to the present
invention includes a step of first generating an mRNA solution by
mixing a citrate buffer with an mRNA stock solution. In certain
embodiments, a suitable citrate buffer contains about 10 mM
citrate, about 150 mM NaCl, pH of about 4.5. In some embodiments, a
suitable mRNA stock solution contains the mRNA at a concentration
at or greater than about 1 mg/ml, about 10 mg/ml, about 50 mg/ml,
or about 100 mg/ml.
[0025] In some embodiments, the citrate buffer is mixed at a flow
rate ranging between about 100-300 ml/minute, 300-600 ml/minute,
600-1200 ml/minute, 1200-2400 ml/minute, 2400-3600 ml/minute,
3600-4800 ml/minute, or 4800-6000 ml/minute. In some embodiments,
the citrate buffer is mixed at a flow rate of about 220 ml/minute,
about 600 ml/minute, about 1200 ml/minute, about 2400 ml/minute,
about 3600 ml/minute, about 4800 ml/minute, or about 6000
ml/minute.
[0026] In some embodiments, the mRNA stock solution is mixed at a
flow rate ranging between about 10-30 ml/minute, about 30-60
ml/minute, about 60-120 ml/minute, about 120-240 ml/minute, about
240-360 ml/minute, about 360-480 ml/minute, or about 480-600
ml/minute. In some embodiments, the mRNA stock solution is mixed at
a flow rate of about 20 ml/minute, about 40 ml/minute, about 60
ml/minute, about 80 ml/minute, about 100 ml/minute, about 200
ml/minute, about 300 ml/minute, about 400 ml/minute, about 500
ml/minute, or about 600 ml/minute.
[0027] In some embodiments, the lipid nanoparticles encapsulating
mRNA are prepared with the pre-formed lipid nanoparticles by mixing
an aqueous solution containing the mRNA with an aqueous solution
containing the pre-formed lipid nanoparticles. In some embodiments,
the aqueous solution containing the mRNA and/or the aqueous
solution containing the pre-formed lipid nanoparticles is an
aqueous solution comprising pharmaceutically acceptable excipients,
including, but not limited to, one or more of trehalose, sucrose,
lactose, and mannitol.
[0028] In some embodiments, one or both of a non-aqueous solvent,
such as ethanol, and citrate are absent (i.e., below detectable
levels) from one or both of the solution containing the mRNA and
the solution containing the pre-formed lipid nanoparticles during
the mixing addition of the mRNA to the pre-formed lipid
nanoparticles. In some embodiments, one or both of the solution
containing the mRNA and the solution containing the pre-formed
lipid nanoparticles are buffer exchanged to remove one or both of
non-aqueous solvents, such as ethanol, and citrate prior to the
mixing addition of the mRNA to the pre-formed lipid nanoparticles.
In some embodiments, one or both of the solution containing the
mRNA and the solution containing the pre-formed lipid nanoparticles
include only residual citrate during the mixing addition of mRNA to
the pre-formed lipid nanoparticles. In some embodiments, one or
both of the solution containing the mRNA and the solution
containing the pre-formed lipid nanoparticles include only residual
non-aqueous solvent, such as ethanol. In some embodiments, one or
both of the solution containing the mRNA and the solution
containing the pre-formed lipid nanoparticles contains less than
about 10 mM (e.g., less than about 9 mM, about 8 mM, about 7 mM,
about 6 mM, about 5 mM, about 4 mM, about 3 mM, about 2 mM, or
about 1 mM) of citrate present during the addition of mRNA to the
pre-formed lipid nanoparticles. In some embodiments, one or both of
the solution containing the mRNA and the solution containing the
pre-formed lipid nanoparticles contains less than about 25% (e.g.,
less than about 20%, about 15%, about 10%, about 5%, about 4%,
about 3%, about 2%, or about 1%) of non-aqueous solvents, such as
ethanol, present during the addition of mRNA to the pre-formed
lipid nanoparticles. In some embodiments, the solution comprising
the lipid nanoparticles encapsulating mRNA does not require any
further downstream processing (e.g., buffer exchange and/or further
purification steps) after the pre-formed lipid nanoparticles and
mRNA are mixed to form that solution.
[0029] In another aspect, the present invention provides a
composition of lipid nanoparticles encapsulating mRNA generated by
a process described herein. In some embodiments, a substantial
amount of the lipid nanoparticles are pre-formed. In some
embodiments, at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of the lipid
nanoparticles are pre-formed. In some embodiments, the present
invention provides a composition comprising purified lipid
nanoparticles, wherein greater than about 90% of the purified lipid
nanoparticles have an individual particle size of less than about
150 nm (e.g., less than about 145 nm, about 140 nm, about 135 nm,
about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110
nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85
nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60
nm, about 55 nm, or about 50 nm) and greater than about 70% of the
purified lipid nanoparticles encapsulate an mRNA within each
individual particle. In some embodiments, greater than about 95%,
96%, 97%, 98%, or 99% of the purified lipid nanoparticles have an
individual particle size of less than about 150 nm (e.g., less than
about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125
nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about
100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about
75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about
50 nm). In some embodiments, substantially all of the purified
lipid nanoparticles have an individual particle size of less than
about 150 nm (e.g., less than about 145 nm, about 140 nm, about 135
nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about
110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about
85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60
nm, about 55 nm, or about 50 nm). In some embodiments, greater than
about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the
purified nanoparticles have a size ranging from 50-150 nm. In some
embodiments, substantially all of the purified nanoparticles have a
size ranging from 50-150 nm. In some embodiments, greater than
about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the
purified nanoparticles have a size ranging from 80-150 nm. In some
embodiments, substantially all of the purified nanoparticles have a
size ranging from 80-150 nm.
[0030] In some embodiments, greater than about 90%, 95%, 96%, 97%,
98%, or 99% of the purified lipid nanoparticles encapsulate an mRNA
within each individual particle. In some embodiments, substantially
all of the purified lipid nanoparticles encapsulate an mRNA within
each individual particle. In some embodiments, a composition
according to the present invention contains at least about 1 mg, 5
mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA.
[0031] In some embodiments, a pre-formed lipid nanoparticle
comprises one or more cationic lipids, one or more helper lipids
and one or more PEG lipids. In some embodiments, each individual
lipid nanoparticle also comprises one or more cholesterol based
lipids. In some embodiments, the one or more cationic lipids are
selected from the group consisting of cKK-E12, OF-02, C12-200, MC3,
DLinDMA, DLinkC2DMA, ICE (Imidazol-based), HGT5000, HGT5001,
HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA,
DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP,
DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA,
3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydrox-
yundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23),
3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2--
hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target
24), N1GL, N2GL, V1GL and combinations thereof.
[0032] In some embodiments, the one or more cationic lipids are
amino lipids. Amino lipids suitable for use in the invention
include those described in WO2017180917, which is hereby
incorporated by reference. Exemplary aminolipids in WO2017180917
include those described at paragraph [0744] such as DLin-MC3-DMA
(MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine
(L608), and Compound 18. Other amino lipids include Compound 2,
Compound 23, Compound 27, Compound 10, and Compound 20. Further
amino lipids suitable for use in the invention include those
described in WO2017112865, which is hereby incorporated by
reference. Exemplary amino lipids in WO2017112865 include a
compound according to one of formulae (I), (Ial)-(Ia6), (lb), (II),
(Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1),
and compounds of paragraphs [00185], [00201], [0276]. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118725, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL22 and KL25. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118724, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL10,
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and
KL25.
[0033] In some embodiments, the one or more non-cationic lipids are
selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine),
DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE
(1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC
(1,2-dioleyl-sn-glycero-3-phosphotidylcholine) DPPE
(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE
(1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG
(1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).
[0034] In some embodiments, the one or more cholesterol-based
lipids is cholesterol or PEGylated cholesterol. In some
embodiments, the one or more PEG-modified lipids contain a
poly(ethylene) glycol chain of up to 5 kDa in length covalently
attached to a lipid with alkyl chain(s) of C.sub.6-C.sub.20
length.
[0035] In some embodiments, the present invention is used to
encapsulate mRNA containing one or more modified nucleotides. In
some embodiments, one or more nucleotides is modified to a
pseudouridine. In some embodiments, one or more nucleotides is
modified to a 5-methylcytidine. In some embodiments, the present
invention is used to encapsulate mRNA that is unmodified.
[0036] In yet another aspect, the present invention provides a
method of delivering mRNA for in vivo protein production comprising
administering into a subject a composition of lipid nanoparticles
encapsulating mRNA generated by the process described herein,
wherein the mRNA encodes one or more protein(s) or peptide(s) of
interest.
[0037] In another aspect, the present invention provides a method
for encapsulating messenger RNA (mRNA) in lipid nanoparticles
wherein the method is performed without use of ethanol. In some
embodiments, the method comprises a step of mixing a solution
comprising one or more cationic lipids, one or more non-cationic
lipids and one or more PEG-modified lipids with a solution
comprising mRNA. In some embodiments, in the solution comprising
the one or more cationic lipids, one or more non-cationic lipids
and one or more PEG-modified lipids, at least a portion of the one
or more cationic lipids, one or more non-cationic lipids and one or
more PEG-modified lipids are present as pre-formed lipid
nanoparticles. In some embodiments, the method is performed also
without the use of citrate.
[0038] In certain embodiments, the method is performed without the
use of any non-aqueous solvent. In some embodiments, there is no
detectable ethanol and/or no detectable non-aqueous solvent. In
some embodiments, there is no detectable citrate. In some
embodiments, there is only a residual amount of ethanol and/or
non-aqueous solvent that is present at less than about 25% (e.g.,
less than about 20%, about 15%, about 10%, about 5%, about 4%,
about 3%, about 2%, or about 1%) of the solution. In some
embodiments, there is only a residual amount of citrate that is
less than 10 mM (e.g., less than about 9 mM, about 8 mM, about 7
mM, about 6 mM, about 5 mM, about 4 mM, about 3 mM, about 2 mM, or
about 1 mM).
[0039] In this application, the use of "or" means "and/or" unless
stated otherwise. As used in this disclosure, the term "comprise"
and variations of the term, such as "comprising" and "comprises,"
are not intended to exclude other additives, components, integers
or steps. As used in this application, the terms "about" and
"approximately" are used as equivalents. Both terms are meant to
cover any normal fluctuations appreciated by one of ordinary skill
in the relevant art.
[0040] Other features, objects, and advantages of the present
invention are apparent in the detailed description, drawings and
claims that follow. It should be understood, however, that the
detailed description, the drawings, and the claims, while
indicating embodiments of the present invention, are given by way
of illustration only, not limitation. Various changes and
modifications within the scope of the invention will become
apparent to those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The drawings are for illustration purposes only and not for
limitation.
[0042] FIG. 1 shows a schematic of an exemplary lipid nanoparticle
mRNA encapsulation process (Process A) that involves mixing lipids
dissolved in ethanol with mRNA dissolved in an aqueous buffer,
using a pump system.
[0043] FIG. 2 shows a schematic of an exemplary lipid nanoparticle
mRNA encapsulation process (Process B) that involves mixing
pre-formed empty lipid nanoparticles with mRNA dissolved in an
aqueous buffer, using a pump system.
[0044] FIG. 3 depicts exemplary activity of expressed human
ornithine transcarbamylase (hOTC) protein (in terms of citrulline
production) in livers of OTC spf.sup.ash mice 24 hours after a
single 0.5 mg/kg dose of hOTC mRNA encapsulated in lipid
nanoparticle formulations made by Process A or Process B. Before
use, lipid nanoparticle formulations made by Process A and Process
B were stored in the frozen form at -80.degree. C. for (i) T=0
months (fresh without freezing), or (ii) T=2.5 months.
[0045] FIG. 4 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of female OTC
spf.sup.ash mice 24 hours after a single 0.5 mg/kg dose of hOTC
mRNA encapsulated in lipid nanoparticle formulations made by
Process A or by Process B using different pump combinations. Lipid
nanoparticle formulations made by Process B were prepared (1) using
gear pumps, (2) using peristaltic pumps, (3) using peristaltic
pumps at lower flow rates, and (4) using peristaltic pumps at
different flow rates of mRNA and empty pre-formed lipid
nanoparticles.
[0046] FIG. 5 depicts exemplary human argininosuccinate synthetase
(ASS1) protein expression in 293T cells 16 hours post-transfection
with either naked hASS1 mRNA (with lipofectamine) or hASS1
mRNA-encapsulated lipid nanoparticles (without lipofectamine)
produced by Process A or Process B.
[0047] FIG. 6 shows exemplary immunohistochemical detection of
human cystic fibrosis transmembrane conductance receptor (hCFTR)
protein in rat lungs 24 hours after nebulization of hCFTR mRNA
lipid nanoparticles prepared by Process B using different cationic
lipids. Protein was detected in both the bronchial epithelial cells
as well as the alveolar regions. Positive (brown) staining was
observed in all mRNA lipid nanoparticles test article groups, as
compared to saline-treated control rat lungs.
[0048] FIG. 7 shows exemplary immunohistochemical detection of
hCFTR protein in mouse lungs 24 hours after nebulization of hCFTR
mRNA lipid nanoparticles prepared by Process B. Protein was
detected in both the bronchial epithelial cells as well as the
alveolar regions. Positive (brown) staining was observed for the
mRNA lipid nanoparticle test article group, as compared to
saline-treated control mice lungs.
[0049] FIG. 8 shows exemplary bioluminescent imaging of wild type
mice 24 hours after intravitreal administration of Firefly
Luciferase (FFL) mRNA encapsulated in lipid nanoparticles prepared
by Process B.
[0050] FIG. 9 shows exemplary bioluminescent imaging of wild type
mice 24 hours after topical application of eye drops containing FFL
mRNA-encapsulated lipid nanoparticles formulated with polyvinyl
alcohol and prepared by Process B.
[0051] FIG. 10 depicts exemplary serum phenylalanine levels in
phenylalanine hydroxylase (PAH) knockout (KO) mice pre- and
post-treatment of human PAH (hPAH) mRNA encapsulated in lipid
nanoparticles prepared by Process B. Serum samples were measured 24
hours after a single subcutaneous administration.
[0052] FIG. 11 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in the livers of OTC KO
spf.sup.ash mice 24 hours after a single subcutaneous
administration of hOTC mRNA-encapsulated lipid nanoparticles
prepared by Process B.
[0053] FIG. 12 depicts exemplary human ASS1 protein levels measured
in the livers of ASS1 KO mice 24 hours after a single subcutaneous
administration of hASS1 mRNA-encapsulated lipid nanoparticles
prepared by Process B.
[0054] FIG. 13 depicts exemplary human erythropoietin (hEPO)
protein levels measured in serum of treated mice at 6 hours and 24
hours after a single administration of different doses of hEPO
mRNA-encapsulated lipid nanoparticles prepared by Process B. The
routes of administration used were intradermal, subcutaneous and
intramuscular delivery.
[0055] FIG. 14 shows a comparison of hEPO protein levels measured
in the serum of treated mice 6 hours and 24 hours after a single
intradermal dose of hEPO mRNA encapsulated in a lipid nanoparticle
formulation made by Process A or by Process B.
[0056] FIG. 15 depicts a comparison of hEPO protein levels measured
in the serum of treated mice 6 hours and 24 hours after a single
intramuscular dose of hEPO mRNA encapsulated in lipid nanoparticle
formulation made by Process A or by Process B.
[0057] FIG. 16 depicts an exemplary dosing and testing scheme in
Spf.sup.ash mice that involved an ammonia challenge.
[0058] FIG. 17 depicts exemplary plasma ammonia levels in
Spf.sup.ash mice after treatment with different dose levels of hOTC
mRNA-loaded lipid nanoparticles, each prepared via Process B,
following an ammonia challenge with NH.sub.4Cl.
[0059] h FIG. 18 shows hOTC protein expression in Spf.sup.ash mouse
livers 24 hours after a single intravenous dose (i.e., 0.5 mg/kg,
0.16 mg/kg, 0.05 mg/kg, or 0.016 mg/kg) of hOTC mRNA encapsulated
in lipid nanoparticle formulations made by Process A or by Process
B.
[0060] FIG. 19 shows a comparison of hOTC mRNA copy number in liver
tissue of OTC spf.sup.ash mice 24 hours after a single intravenous
a dose (i.e., 0.5 mg/kg, 0.16 mg/kg, 0.05 mg/kg, or 0.016 mg/kg) of
hOTC mRNA encapsulated in lipid nanoparticle formulation made by
Process A or by Process B.
[0061] FIG. 20 shows a comparison of hOTC mRNA copy number in RNA
tested of OTC spf.sup.ash mice 24 hours after a single intravenous
dose (i.e., 0.5 mg/kg, 0.16 mg/kg, 0.05 mg/kg, and 0.016 mg/kg) of
hOTC mRNA encapsulated in lipid nanoparticle formulations made by
Process A or by Process B.
[0062] FIG. 21 shows plasma ammonia results 40 minutes after being
subjected to an ammonia challenge in each of wildtype mice (WT),
untreated spf.sup.ash mice (Untreated), and spf.sup.ash mice at 24
hours (Day 2), 48 hours (Day 3), 72 hours (Day 4), 96 hours (Day
5), 8 days (Day 8), 11 days (Day 11), and 15 days (Day 15)
following administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles
produced by Process B.
[0063] FIG. 22 shows hOTC protein activity as measured by
citrulline production in each of wildtype mice (WT), untreated
spf.sup.ash mice (Untreated), and spf.sup.ash mice at 24 hours (Day
2), 48 hours (Day 3), 72 hours (Day 4), 96 hours (Day 5), 8 days
(Day 8), 11 days (Day 11), and 15 days (Day 15) following
administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles produced
by Process B.
[0064] FIG. 23 shows hOTC protein activity as measured by
maintained low levels of urinary orotic acid production in each of
untreated spf.sup.ash mice (Untreated), spf.sup.ash mice at 24
hours (Day 2), 48 hours (Day 3), 72 hours (Day 4), 96 hours (Day
5), 8 days (Day 8), 11 days (Day 11), and 15 days (Day 15)
following administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles
produced by Process B, and untreated wildtype mice (Untreated
C57BL/6).
[0065] FIG. 24 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single intravenous dose at different dose
levels of hOTC mRNA encapsulated in lipid nanoparticle formulations
made by Process A or by Process B.
[0066] FIG. 25 depicts the immunohistochemical detection of
expressed hOTC protein in the mice livers by Western blot after a
single intravenous dose of hOTC mRNA encapsulated in lipid
nanoparticle formulations made by Process A or by Process B at
various dosing levels.
[0067] FIG. 26 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single intravenous 0.5 mg/kg dose of hOTC
mRNA encapsulated in lipid nanoparticle formulations made by
Process B, as compared to those made by Process A.
[0068] FIG. 27(a)-(d) shows the immunohistochemical detection of
hOTC protein in mouse liver tissue 24 hours after dosing of hOTC
mRNA lipid nanoparticles prepared by Process A or by Process B via
immunohistochemical staining. FIG. 27(a)-(b) depicts results from
mRNA lipid nanoparticles produced by Process B. FIG. 27(c)-(d)
depicts results from mRNA lipid nanoparticles produced by Process
A.
[0069] FIG. 28 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using HGT 5001 as the cationic lipid.
[0070] FIG. 29 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using ICE as the cationic lipid.
[0071] FIG. 30 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using cKK-E12 as the cationic lipid.
[0072] FIG. 31 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using C12-200 as the cationic lipid.
[0073] FIG. 32 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using HGT 4003 as the cationic lipid.
DEFINITIONS
[0074] In order for the present invention to be more readily
understood, certain terms are first defined below. Additional
definitions for the following terms and other terms are set forth
throughout the specification.
[0075] Alkyl: As used herein, "alkyl" refers to a radical of a
straight-chain or branched saturated hydrocarbon group having from
1 to 20 carbon atoms ("C.sub.1-20 alkyl"). In some embodiments, an
alkyl group has 1 to 3 carbon atoms ("C.sub.1-3 alkyl"). Examples
of C.sub.1-3 alkyl groups include methyl (C.sub.1), ethyl
(C.sub.2), n-propyl (C.sub.3), and isopropyl (C.sub.3). In some
embodiments, an alkyl group has 8 to 12 carbon atoms ("C.sub.8-12
alkyl"). Examples of C.sub.8-12 alkyl groups include, without
limitation, n-octyl (C.sub.8), n-nonyl (C.sub.9), n-decyl
(C.sub.10), n-undecyl (C.sub.11), n-dodecyl (C.sub.12) and the
like. The prefix "n-" (normal) refers to unbranched alkyl groups.
For example, n-C.sub.8 alkyl refers to --(CH.sub.2).sub.7CH.sub.3,
n-C.sub.10 alkyl refers to --(CH.sub.2).sub.9CH.sub.3, etc.
[0076] Amino acid: As used herein, term "amino acid," in its
broadest sense, refers to any compound and/or substance that can be
incorporated into a polypeptide chain. In some embodiments, an
amino acid has the general structure H.sub.2N--C(H)(R)--COOH. In
some embodiments, an amino acid is a naturally occurring amino
acid. In some embodiments, an amino acid is a synthetic amino acid;
in some embodiments, an amino acid is a d-amino acid; in some
embodiments, an amino acid is an 1-amino acid. "Standard amino
acid" refers to any of the twenty standard 1-amino acids commonly
found in naturally occurring peptides. "Nonstandard amino acid"
refers to any amino acid, other than the standard amino acids,
regardless of whether it is prepared synthetically or obtained from
a natural source. As used herein, "synthetic amino acid"
encompasses chemically modified amino acids, including but not
limited to salts, amino acid derivatives (such as amides), and/or
substitutions. Amino acids, including carboxy- and/or
amino-terminal amino acids in peptides, can be modified by
methylation, amidation, acetylation, protecting groups, and/or
substitution with other chemical groups that can change the
peptide's circulating half-life without adversely affecting their
activity. Amino acids may participate in a disulfide bond. Amino
acids may comprise one or posttranslational modifications, such as
association with one or more chemical entities (e.g., methyl
groups, acetate groups, acetyl groups, phosphate groups, formyl
moieties, isoprenoid groups, sulfate groups, polyethylene glycol
moieties, lipid moieties, carbohydrate moieties, biotin moieties,
etc.). The term "amino acid" is used interchangeably with "amino
acid residue," and may refer to a free amino acid and/or to an
amino acid residue of a peptide. It will be apparent from the
context in which the term is used whether it refers to a free amino
acid or a residue of a peptide.
[0077] Animal: As used herein, the term "animal" refers to any
member of the animal kingdom. In some embodiments, "animal" refers
to humans, at any stage of development. In some embodiments,
"animal" refers to non-human animals, at any stage of development.
In certain embodiments, the non-human animal is a mammal (e.g., a
rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep,
cattle, a primate, and/or a pig). In some embodiments, animals
include, but are not limited to, mammals, birds, reptiles,
amphibians, fish, insects, and/or worms. In some embodiments, an
animal may be a transgenic animal, genetically-engineered animal,
and/or a clone.
[0078] Approximately or about: As used herein, the term
"approximately" or "about," as applied to one or more values of
interest, refers to a value that is similar to a stated reference
value. In certain embodiments, the term "approximately" or "about"
refers to a range of values that fall within 25%, 20%, 19%, 18%,
17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%,
2%, 1%, or less in either direction (greater than or less than) of
the stated reference value unless otherwise stated or otherwise
evident from the context (except where such number would exceed
100% of a possible value).
[0079] Delivery: As used herein, the term "delivery" encompasses
both local and systemic delivery. For example, delivery of mRNA
encompasses situations in which an mRNA is delivered to a target
tissue and the encoded protein or peptide is expressed and retained
within the target tissue (also referred to as "local distribution"
or "local delivery"), and situations in which an mRNA is delivered
to a target tissue and the encoded protein or peptide is expressed
and secreted into patient's circulation system (e.g., serum) and
systematically distributed and taken up by other tissues (also
referred to as "systemic distribution" or "systemic delivery).
[0080] Efficacy: As used herein, the term "efficacy," or
grammatical equivalents, refers to an improvement of a biologically
relevant endpoint, as related to delivery of mRNA that encodes a
relevant protein or peptide. In some embodiments, the biological
endpoint is protecting against an ammonium chloride challenge at
certain timepoints after administration.
[0081] Encapsulation: As used herein, the term "encapsulation," or
grammatical equivalent, refers to the process of confining an
individual mRNA molecule within a nanoparticle.
[0082] Expression: As used herein, "expression" of a mRNA refers to
translation of an mRNA into a peptide (e.g., an antigen),
polypeptide, or protein (e.g., an enzyme) and also can include, as
indicated by context, the post-translational modification of the
peptide, polypeptide or fully assembled protein (e.g., enzyme). In
this application, the terms "expression" and "production," and
grammatical equivalent, are used inter-changeably.
[0083] Improve, increase, or reduce: As used herein, the terms
"improve," "increase" or "reduce," or grammatical equivalents,
indicate values that are relative to a baseline measurement, such
as a measurement in the same individual prior to initiation of the
treatment described herein, or a measurement in a control sample or
subject (or multiple control samples or subjects) in the absence of
the treatment described herein. A "control sample" is a sample
subjected to the same conditions as a test sample, except for the
test article. A "control subject" is a subject afflicted with the
same form of disease as the subject being treated, who is about the
same age as the subject being treated.
[0084] Impurities: As used herein, the term "impurities" refers to
substances inside a confined amount of liquid, gas, or solid, which
differ from the chemical composition of the target material or
compound. Impurities are also referred to as contaminants.
[0085] In Vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, etc., rather than within
a multi-cellular organism.
[0086] In Vivo: As used herein, the term "in vivo" refers to events
that occur within a multi-cellular organism, such as a human and a
non-human animal. In the context of cell-based systems, the term
may be used to refer to events that occur within a living cell (as
opposed to, for example, in vitro systems).
[0087] Isolated: As used herein, the term "isolated" refers to a
substance and/or entity that has been (1) separated from at least
some of the components with which it was associated when initially
produced (whether in nature and/or in an experimental setting),
and/or (2) produced, prepared, and/or manufactured by the hand of
man. Isolated substances and/or entities may be separated from
about 10%, about 20%, about 30%, about 40%, about 50%, about 60%,
about 70%, about 80%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, about 99%,
or more than about 99% of the other components with which they were
initially associated. In some embodiments, isolated agents are
about 80%, about 85%, about 90%, about 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, about 99%,
or more than about 99% pure. As used herein, a substance is "pure"
if it is substantially free of other components. As used herein,
calculation of percent purity of isolated substances and/or
entities should not include excipients (e.g., buffer, solvent,
water, etc.).
[0088] Local distribution or delivery: As used herein, the terms
"local distribution," "local delivery," or grammatical equivalent,
refer to tissue specific delivery or distribution. Typically, local
distribution or delivery requires a peptide or protein (e.g.,
enzyme) encoded by mRNAs be translated and expressed
intracellularly or with limited secretion that avoids entering the
patient's circulation system.
[0089] messenger RNA (mRNA): As used herein, the term "messenger
RNA (mRNA)" refers to a polynucleotide that encodes at least one
peptide, polypeptide or protein. mRNA as used herein encompasses
both modified and unmodified RNA. mRNA may contain one or more
coding and non-coding regions. mRNA can be purified from natural
sources, produced using recombinant expression systems and
optionally purified, chemically synthesized, etc. Where
appropriate, e.g., in the case of chemically synthesized molecules,
mRNA can comprise nucleoside analogs such as analogs having
chemically modified bases or sugars, backbone modifications, etc.
An mRNA sequence is presented in the 5' to 3' direction unless
otherwise indicated. In some embodiments, an mRNA is or comprises
natural nucleosides (e.g., adenosine, guanosine, cytidine,
uridine); nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine,
2-aminoadenosine, C5-bromouridine, C5-fluorouridine,
C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine,
C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine,
7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, 2-thiocytidine, pseudouridine, and
5-methylcytidine); chemically modified bases; biologically modified
bases (e.g., methylated bases); intercalated bases; modified sugars
(e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and
hexose); and/or modified phosphate groups (e.g., phosphorothioates
and 5'-N-phosphoramidite linkages).
[0090] Nucleic acid: As used herein, the term "nucleic acid," in
its broadest sense, refers to any compound and/or substance that is
or can be incorporated into a polynucleotide chain. In some
embodiments, a nucleic acid is a compound and/or substance that is
or can be incorporated into a polynucleotide chain via a
phosphodiester linkage. In some embodiments, "nucleic acid" refers
to individual nucleic acid residues (e.g., nucleotides and/or
nucleosides). In some embodiments, "nucleic acid" refers to a
polynucleotide chain comprising individual nucleic acid residues.
In some embodiments, "nucleic acid" encompasses RNA as well as
single and/or double-stranded DNA and/or cDNA. Furthermore, the
terms "nucleic acid," "DNA," "RNA," and/or similar terms include
nucleic acid analogs, i.e., analogs having other than a
phosphodiester backbone.
[0091] Patient: As used herein, the term "patient" or "subject"
refers to any organism to which a provided composition may be
administered, e.g., for experimental, diagnostic, prophylactic,
cosmetic, and/or therapeutic purposes. Typical patients include
animals (e.g., mammals such as mice, rats, rabbits, non-human
primates, and/or humans). In some embodiments, a patient is a
human. A human includes pre- and post-natal forms.
[0092] Pharmaceutically acceptable: The term "pharmaceutically
acceptable" as used herein, refers to substances that, within the
scope of sound medical judgment, are suitable for use in contact
with the tissues of human beings and animals without excessive
toxicity, irritation, allergic response, or other problem or
complication, commensurate with a reasonable benefit/risk
ratio.
[0093] Pharmaceutically acceptable salt: Pharmaceutically
acceptable salts are well known in the art. For example, S. M.
Berge et al., describes pharmaceutically acceptable salts in detail
in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically
acceptable salts of the compounds of this invention include those
derived from suitable inorganic and organic acids and bases.
Examples of pharmaceutically acceptable, nontoxic acid addition
salts are salts of an amino group formed with inorganic acids such
as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric
acid and perchloric acid or with organic acids such as acetic acid,
oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid
or rnalonic acid or by using other methods used in the art such as
ion exchange. Other pharmaceutically acceptable salts include
adipate, alginate, ascorbate, aspartate, benzenesulfonate,
benzoate, bisulfate, borate, butyrate, camphorate,
camphorsulfonate, citrate, cyclopentanepropionate, digluconate,
dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Salts derived from appropriate bases include alkali metal, alkaline
earth metal, ammonium and N.sup.+(C.sub.1-4 alkyl).sub.4 salts.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium. quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, sulfonate and aryl sulfonate. Further
pharmaceutically acceptable salts include salts formed from the
quarternization of an amine using an appropriate electrophile,
e.g., an alkyl halide, to form a quarternized alkylated amino
salt.
[0094] Potency: As used herein, the term "potency," or grammatical
equivalents, refers to expression of protein(s) or peptide(s) that
the mRNA encodes and/or the resulting biological effect.
[0095] Salt: As used herein the term "salt" refers to an ionic
compound that does or may result from a neutralization reaction
between an acid and a base.
[0096] Systemic distribution or delivery: As used herein, the terms
"systemic distribution," "systemic delivery," or grammatical
equivalent, refer to a delivery or distribution mechanism or
approach that affect the entire body or an entire organism.
Typically, systemic distribution or delivery is accomplished via
body's circulation system, e.g., blood stream. Compared to the
definition of "local distribution or delivery."
[0097] Subject: As used herein, the term "subject" refers to a
human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat,
cattle, swine, sheep, horse or primate). A human includes pre- and
post-natal forms. In many embodiments, a subject is a human being.
A subject can be a patient, which refers to a human presenting to a
medical provider for diagnosis or treatment of a disease. The term
"subject" is used herein interchangeably with "individual" or
"patient." A subject can be afflicted with or is susceptible to a
disease or disorder but may or may not display symptoms of the
disease or disorder.
[0098] Substantially: As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and chemical phenomena.
[0099] Target tissues: As used herein, the term "target tissues"
refers to any tissue that is affected by a disease to be treated.
In some embodiments, target tissues include those tissues that
display disease-associated pathology, symptom, or feature.
[0100] Treating: As used herein, the term "treat," "treatment," or
"treating" refers to any method used to partially or completely
alleviate, ameliorate, relieve, inhibit, prevent, delay onset of,
reduce severity of and/or reduce incidence of one or more symptoms
or features of a particular disease, disorder, and/or condition.
Treatment may be administered to a subject who does not exhibit
signs of a disease and/or exhibits only early signs of the disease
for the purpose of decreasing the risk of developing pathology
associated with the disease.
[0101] Yield: As used herein, the term "yield" refers to the
percentage of mRNA recovered after encapsulation as compared to the
total mRNA as starting material. In some embodiments, the term
"recovery" is used interchangeably with the term "yield".
DETAILED DESCRIPTION
[0102] The present invention provides an improved process for lipid
nanoparticle formulation and mRNA encapsulation. In some
embodiments, the present invention provides a process of
encapsulating messenger RNA (mRNA) in lipid nanoparticles
comprising the steps of forming lipids into pre-formed lipid
nanoparticles (i.e., formed in the absence of mRNA) and then
combining the pre-formed lipid nanoparticles with mRNA. In some
embodiments, the novel formulation process results in an mRNA
formulation with higher potency (peptide or protein expression) and
higher efficacy (improvement of a biologically relevant endpoint)
both in vitro and in vivo with potentially better tolerability as
compared to the same mRNA formulation prepared without the step of
preforming the lipid nanoparticles (e.g., combining the lipids
directly with the mRNA). The higher potency and/or efficacy of such
a formulation can provide for lower and/or less frequent dosing of
the drug product. In some embodiments, the invention features an
improved lipid formulation comprising a cationic lipid, a helper
lipid and a PEG or PEG-modified lipid.
[0103] In some embodiments, the resultant encapsulation
efficiencies for the present lipid nanoparticle formulation and
preparation method are around 90%. For the delivery of nucleic
acids, achieving high encapsulation efficiencies is critical to
attain protection of the drug substance and reduce loss of activity
in vivo. In addition, a surprising result for the lipid
nanoparticle formulation prepared by the novel method in the
current invention is the significantly higher transfection
efficiency observed in vitro.
[0104] Various aspects of the invention are described in detail in
the following sections. The use of sections is not meant to limit
the invention. Each section can apply to any aspect of the
invention.
Messenger RNA (mRNA)
[0105] The present invention may be used to encapsulate any mRNA.
mRNA is typically thought of as the type of RNA that carries
information from DNA to the ribosome. Typically, in eukaryotic
organisms, mRNA processing comprises the addition of a "cap" on the
5' end, and a "tail" on the 3' end. A typical cap is a
7-methylguanosine cap, which is a guanosine that is linked through
a 5'-5'-triphosphate bond to the first transcribed nucleotide. The
presence of the cap is important in providing resistance to
nucleases found in most eukaryotic cells. The additional of a tail
is typically a polyadenylation event whereby a polyadenylyl moiety
is added to the 3' end of the mRNA molecule. The presence of this
"tail" serves to protect the mRNA from exonuclease degradation.
Messenger RNA is translated by the ribosomes into a series of amino
acids that make up a protein.
[0106] mRNAs may be synthesized according to any of a variety of
known methods. For example, mRNAs according to the present
invention may be synthesized via in vitro transcription (IVT).
Briefly, IVT is typically performed with a linear or circular DNA
template containing a promoter, a pool of ribonucleotide
triphosphates, a buffer system that may include DTT and magnesium
ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA
polymerase), DNAse I, pyrophosphatase, and/or RNAse inhibitor. The
exact conditions will vary according to the specific
application.
[0107] In some embodiments, in vitro synthesized mRNA may be
purified before formulation and encapsulation to remove undesirable
impurities including various enzymes and other reagents used during
mRNA synthesis.
[0108] The present invention may be used to formulate and
encapsulate mRNAs of a variety of lengths. In some embodiments, the
present invention may be used to formulate and encapsulate in vitro
synthesized mRNA of or greater than about 1 kb, 1.5 kb, 2 kb, 2.5
kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb 6 kb, 7 kb, 8 kb, 9 kb, 10 kb,
11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb in length. In some
embodiments, the present invention may be used to formulate and
encapsulate in vitro synthesized mRNA ranging from about 1-20 kb,
about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about
5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb in
length.
[0109] The present invention may be used to formulate and
encapsulate mRNA that is unmodified or mRNA containing one or more
modifications that typically enhance stability. In some
embodiments, modifications are selected from modified nucleotides,
modified sugar phosphate backbones, and 5' and/or 3' untranslated
region.
[0110] In some embodiments, modifications of mRNA may include
modifications of the nucleotides of the RNA. A modified mRNA
according to the invention can include, for example, backbone
modifications, sugar modifications or base modifications. In some
embodiments, mRNAs may be synthesized from naturally occurring
nucleotides and/or nucleotide analogues (modified nucleotides)
including, but not limited to, purines (adenine (A), guanine (G))
or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as
modified nucleotides analogues or derivatives of purines and
pyrimidines, such as e.g. 1-methyl-adenine, 2-methyl-adenine,
2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine,
N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine,
4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine,
1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine,
7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil
(5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil,
5-carboxymethylaminomethyl-2-thio-uracil,
5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil,
5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil,
5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester,
5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil,
5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil,
uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v),
1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine,
wybutoxosine, and phosphoramidates, phosphorothioates, peptide
nucleotides, methylphosphonates, 7-deazaguanosine,
5-methylcytosine, pseudouridine, 5-methylcytidine and inosine. The
preparation of such analogues is known to a person skilled in the
art e.g. from the U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796,
U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No.
4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S.
Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No.
5,153,319, U.S. Pat. Nos. 5,262,530 and 5,700,642, the disclosure
of which is included here in its full scope by reference.
[0111] Typically, mRNA synthesis includes the addition of a "cap"
on the 5' end, and a "tail" on the 3' end. The presence of the cap
is important in providing resistance to nucleases found in most
eukaryotic cells. The presence of a "tail" serves to protect the
mRNA from exonuclease degradation.
[0112] Thus, in some embodiments, mRNAs include a 5' cap structure.
A 5' cap is typically added as follows: first, an RNA terminal
phosphatase removes one of the terminal phosphate groups from the
5' nucleotide, leaving two terminal phosphates; guanosine
triphosphate (GTP) is then added to the terminal phosphates via a
guanylyl transferase, producing a 5'5'5 triphosphate linkage; and
the 7-nitrogen of guanine is then methylated by a
methyltransferase. 2'-O-methylation may also occur at the first
base and/or second base following the 7-methyl guanosine
triphosphate residues. Examples of cap structures include, but are
not limited to, m7GpppNp-RNA, m7GpppNmp-RNA and m7GpppNmpNmp-RNA
(where m indicates 2'-Omethyl residues).
[0113] In some embodiments, mRNAs include a 5' and/or 3'
untranslated region. In some embodiments, a 5' untranslated region
includes one or more elements that affect an mRNA's stability or
translation, for example, an iron responsive element. In some
embodiments, a 5' untranslated region may be between about 50 and
500 nucleotides in length.
[0114] In some embodiments, a 3' untranslated region includes one
or more of a polyadenylation signal, a binding site for proteins
that affect an mRNA's stability of location in a cell, or one or
more binding sites for miRNAs. In some embodiments, a 3'
untranslated region may be between 50 and 500 nucleotides in length
or longer.
[0115] While mRNA provided from in vitro transcription reactions
may be desirable in some embodiments, other sources of mRNA are
contemplated as within the scope of the invention including mRNA
produced from bacteria, fungi, plants, and/or animals.
[0116] The present invention may be used to formulate and
encapsulate mRNAs encoding a variety of proteins. Non-limiting
examples of mRNAs suitable for the present invention include mRNAs
encoding spinal motor neuron 1 (SMN), alpha-galactosidase (GLA),
argininosuccinate synthetase (ASS1), ornithine transcarbamylase
(OTC), Factor IX (FIX), phenylalanine hydroxylase (PAH),
erythropoietin (EPO), cystic fibrosis transmembrane conductance
receptor (CFTR) and firefly luciferase (FFL). Exemplary mRNA
sequences as disclosed herein are listed below:
TABLE-US-00001 Codon-Optimized Human OTC Coding Sequence (SEQ ID
NO: 1) AUGCUGUUCAACCUUCGGAUCUUGCUGAACAACGCUGCGUUCCGGAAUGGUCACA
ACUUCAUGGUCCGGAACUUCAGAUGCGGCCAGCCGCUCCAGAACAAGGUGCAGCU
CAAGGGGAGGGACCUCCUCACCCUGAAAAACUUCACCGGAGAAGAGAUCAAGUAC
AUGCUGUGGCUGUCAGCCGACCUCAAAUUCCGGAUCAAGCAGAAGGGCGAAUACC
UUCCUUUGCUGCAGGGAAAGUCCCUGGGGAUGAUCUUCGAGAAGCGCAGCACUCG
CACUAGACUGUCAACUGAAACCGGCUUCGCGCUGCUGGGAGGACACCCCUGCUUC
CUGACCACCCAAGAUAUCCAUCUGGGUGUGAACGAAUCCCUCACCGACACAGCGC
GGGUGCUGUCGUCCAUGGCAGACGCGGUCCUCGCCCGCGUGUACAAGCAGUCUGA
UCUGGACACUCUGGCCAAGGAAGCCUCCAUUCCUAUCAUUAAUGGAUUGUCCGAC
CUCUACCAUCCCAUCCAGAUUCUGGCCGAUUAUCUGACUCUGCAAGAACAUUACA
GCUCCCUGAAGGGGCUUACCCUUUCGUGGAUCGGCGACGGCAACAACAUUCUGCA
CAGCAUUAUGAUGAGCGCUGCCAAGUUUGGAAUGCACCUCCAAGCAGCGACCCCG
AAGGGAUACGAGCCAGACGCCUCCGUGACGAAGCUGGCUGAGCAGUACGCCAAGG
AGAACGGCACUAAGCUGCUGCUCACCAACGACCCUCUCGAAGCCGCCCACGGUGG
CAACGUGCUGAUCACCGAUACCUGGAUCUCCAUGGGACAGGAGGAGGAAAAGAA
GAAGCGCCUGCAAGCAUUUCAGGGGUACCAGGUGACUAUGAAAACCGCCAAGGUC
GCCGCCUCGGACUGGACCUUCUUGCACUGUCUGCCCAGAAAGCCCGAAGAGGUGG
ACGACGAGGUGUUCUACAGCCCGCGGUCGCUGGUCUUUCCGGAGGCCGAAAACAG
GAAGUGGACUAUCAUGGCCGUGAUGGUGUCCCUGCUGACCGAUUACUCCCCGCAG
CUGCAGAAACCAAAGUUCUGA Codon-Optimized Human AS1 Coding Sequence
(SEQ ID NO: 2)
AUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCU
GCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAA
CAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGC
GCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUC
UGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCA
GCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGG
CGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUC
GAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCA
UGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCAA
GCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAG
AACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGG
CCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCC
GACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUG
AAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGG
UGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGG
CAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCC
CACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGG
GCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGA
GUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAG
GUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCC
UGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGC
CCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACCA
CCGCCUGCAGAGCAAGGUGACCGCCAAGUGA Codon-Optimized Human CFTR Coding
Sequence (SEQ ID NO: 3)
AUGCAACGCUCUCCUCUUGAAAAGGCCUCGGUGGUGUCCAAGCUCUUCUUCUCGU
GGACUAGACCCAUCCUGAGAAAGGGGUACAGACAGCGCUUGGAGCUGUCCGAUA
UCUAUCAAAUCCCUUCCGUGGACUCCGCGGACAACCUGUCCGAGAAGCUCGAGAG
AGAAUGGGACAGAGAACUCGCCUCAAAGAAGAACCCGAAGCUGAUUAAUGCGCU
UAGGCGGUGCUUUUUCUGGCGGUUCAUGUUCUACGGCAUCUUCCUCUACCUGGGA
GAGGUCACCAAGGCCGUGCAGCCCCUGUUGCUGGGACGGAUUAUUGCCUCCUACG
ACCCCGACAACAAGGAAGAAAGAAGCAUCGCUAUCUACUUGGGCAUCGGUCUGUG
CCUGCUUUUCAUCGUCCGGACCCUCUUGUUGCAUCCUGCUAUUUUCGGCCUGCAU
CACAUUGGCAUGCAGAUGAGAAUUGCCAUGUUUUCCCUGAUCUACAAGAAAACU
CUGAAGCUCUCGAGCCGCGUGCUUGACAAGAUUUCCAUCGGCCAGCUCGUGUCCC
UGCUCUCCAACAAUCUGAACAAGUUCGACGAGGGCCUCGCCCUGGCCCACUUCGU
GUGGAUCGCCCCUCUGCAAGUGGCGCUUCUGAUGGGCCUGAUCUGGGAGCUGCUG
CAAGCCUCGGCAUUCUGUGGGCUUGGAUUCCUGAUCGUGCUGGCACUGUUCCAGG
CCGGACUGGGGCGGAUGAUGAUGAAGUACAGGGACCAGAGAGCCGGAAAGAUUU
CCGAACGGCUGGUGAUCACUUCGGAAAUGAUCGAAAACAUCCAGUCAGUGAAGG
CCUACUGCUGGGAAGAGGCCAUGGAAAAGAUGAUUGAAAACCUCCGGCAAACCG
AGCUGAAGCUGACCCGCAAGGCCGCUUACGUGCGCUAUUUCAACUCGUCCGCUUU
CUUCUUCUCCGGGUUCUUCGUGGUGUUUCUCUCCGUGCUCCCCUACGCCCUGAUU
AAGGGAAUCAUCCUCAGGAAGAUCUUCACCACCAUUUCCUUCUGUAUCGUGCUCC
GCAUGGCCGUGACCCGGCAGUUCCCAUGGGCCGUGCAGACUUGGUACGACUCCCU
GGGAGCCAUUAACAAGAUCCAGGACUUCCUUCAAAAGCAGGAGUACAAGACCCUC
GAGUACAACCUGACUACUACCGAGGUCGUGAUGGAAAACGUCACCGCCUUUUGGG
AGGAGGGAUUUGGCGAACUGUUCGAGAAGGCCAAGCAGAACAACAACAACCGCA
AGACCUCGAACGGUGACGACUCCCUCUUCUUUUCAAACUUCAGCCUGCUCGGGAC
GCCCGUGCUGAAGGACAUUAACUUCAAGAUCGAAAGAGGACAGCUCCUGGCGGU
GGCCGGAUCGACCGGAGCCGGAAAGACUUCCCUGCUGAUGGUGAUCAUGGGAGA
GCUUGAACCUAGCGAGGGAAAGAUCAAGCACUCCGGCCGCAUCAGCUUCUGUAGC
CAGUUUUCCUGGAUCAUGCCCGGAACCAUUAAGGAAAACAUCAUCUUCGGCGUGU
CCUACGAUGAAUACCGCUACCGGUCCGUGAUCAAAGCCUGCCAGCUGGAAGAGGA
UAUUUCAAAGUUCGCGGAGAAAGAUAACAUCGUGCUGGGCGAAGGGGGUAUUAC
CUUGUCGGGGGGCCAGCGGGCUAGAAUCUCGCUGGCCAGAGCCGUGUAUAAGGAC
GCCGACCUGUAUCUCCUGGACUCCCCCUUCGGAUACCUGGACGUCCUGACCGAAA
AGGAGAUCUUCGAAUCGUGCGUGUGCAAGCUGAUGGCUAACAAGACUCGCAUCC
UCGUGACCUCCAAAAUGGAGCACCUGAAGAAGGCAGACAAGAUUCUGAUUCUGC
AUGAGGGGUCCUCCUACUUUUACGGCACCUUCUCGGAGUUGCAGAACUUGCAGCC
CGACUUCUCAUCGAAGCUGAUGGGUUGCGACAGCUUCGACCAGUUCUCCGCCGAA
AGAAGGAACUCGAUCCUGACGGAAACCUUGCACCGCUUCUCUUUGGAAGGCGACG
CCCCUGUGUCAUGGACCGAGACUAAGAAGCAGAGCUUCAAGCAGACCGGGGAAUU
CGGCGAAAAGAGGAAGAACAGCAUCUUGAACCCCAUUAACUCCAUCCGCAAGUUC
UCAAUCGUGCAAAAGACGCCACUGCAGAUGAACGGCAUUGAGGAGGACUCCGACG
AACCCCUUGAGAGGCGCCUGUCCCUGGUGCCGGACAGCGAGCAGGGAGAAGCCAU
CCUGCCUCGGAUUUCCGUGAUCUCCACUGGUCCGACGCUCCAAGCCCGGCGGCGG
CAGUCCGUGCUGAACCUGAUGACCCACAGCGUGAACCAGGGCCAAAACAUUCACC
GCAAGACUACCGCAUCCACCCGGAAAGUGUCCCUGGCACCUCAAGCGAAUCUUAC
CGAGCUCGACAUCUACUCCCGGAGACUGUCGCAGGAAACCGGGCUCGAAAUUUCC
GAAGAAAUCAACGAGGAGGAUCUGAAAGAGUGCUUCUUCGACGAUAUGGAGUCG
AUACCCGCCGUGACGACUUGGAACACUUAUCUGCGGUACAUCACUGUGCACAAGU
CAUUGAUCUUCGUGCUGAUUUGGUGCCUGGUGAUUUUCCUGGCCGAGGUCGCGG
CCUCACUGGUGGUGCUCUGGCUGUUGGGAAACACGCCUCUGCAAGACAAGGGAAA
CUCCACGCACUCGAGAAACAACAGCUAUGCCGUGAUUAUCACUUCCACCUCCUCU
UAUUACGUGUUCUACAUCUACGUCGGAGUGGCGGAUACCCUGCUCGCGAUGGGU
UUCUUCAGAGGACUGCCGCUGGUCCACACCUUGAUCACCGUCAGCAAGAUUCUUC
ACCACAAGAUGUUGCAUAGCGUGCUGCAGGCCCCCAUGUCCACCCUCAACACUCU
GAAGGCCGGAGGCAUUCUGAACAGAUUCUCCAAGGACAUCGCUAUCCUGGACGAU
CUCCUGCCGCUUACCAUCUUUGACUUCAUCCAGCUGCUGCUGAUCGUGAUUGGAG
CAAUCGCAGUGGUGGCGGUGCUGCAGCCUUACAUUUUCGUGGCCACUGUGCCGGU
CAUUGUGGCGUUCAUCAUGCUGCGGGCCUACUUCCUCCAAACCAGCCAGCAGCUG
AAGCAACUGGAAUCCGAGGGACGAUCCCCCAUCUUCACUCACCUUGUGACGUCGU
UGAAGGGACUGUGGACCCUCCGGGCUUUCGGACGGCAGCCCUACUUCGAAACCCU
CUUCCACAAGGCCCUGAACCUCCACACCGCCAAUUGGUUCCUGUACCUGUCCACC
CUGCGGUGGUUCCAGAUGCGCAUCGAGAUGAUUUUCGUCAUCUUCUUCAUCGCGG
UCACAUUCAUCAGCAUCCUGACUACCGGAGAGGGAGAGGGACGGGUCGGAAUAA
UCCUGACCCUCGCCAUGAACAUUAUGAGCACCCUGCAGUGGGCAGUGAACAGCUC
GAUCGACGUGGACAGCCUGAUGCGAAGCGUCAGCCGCGUGUUCAAGUUCAUCGAC
AUGCCUACUGAGGGAAAACCCACUAAGUCCACUAAGCCCUACAAAAAUGGCCAGC
UGAGCAAGGUCAUGAUCAUCGAAAACUCCCACGUGAAGAAGGACGAUAUUUGGC
CCUCCGGAGGUCAAAUGACCGUGAAGGACCUGACCGCAAAGUACACCGAGGGAGG
AAACGCCAUUCUCGAAAACAUCAGCUUCUCCAUUUCGCCGGGACAGCGGGUCGGC
CUUCUCGGGCGGACCGGUUCCGGGAAGUCAACUCUGCUGUCGGCUUUCCUCCGGC
UGCUGAAUACCGAGGGGGAAAUCCAAAUUGACGGCGUGUCUUGGGAUUCCAUUA
CUCUGCAGCAGUGGCGGAAGGCCUUCGGCGUGAUCCCCCAGAAGGUGUUCAUCUU
CUCGGGUACCUUCCGGAAGAACCUGGAUCCUUACGAGCAGUGGAGCGACCAAGAA
AUCUGGAAGGUCGCCGACGAGGUCGGCCUGCGCUCCGUGAUUGAACAAUUUCCUG
GAAAGCUGGACUUCGUGCUCGUCGACGGGGGAUGUGUCCUGUCGCACGGACAUA
AGCAGCUCAUGUGCCUCGCACGGUCCGUGCUCUCCAAGGCCAAGAUUCUGCUGCU
GGACGAACCUUCGGCCCACCUGGAUCCGGUCACCUACCAGAUCAUCAGGAGGACC
CUGAAGCAGGCCUUUGCCGAUUGCACCGUGAUUCUCUGCGAGCACCGCAUCGAGG
CCAUGCUGGAGUGCCAGCAGUUCCUGGUCAUCGAGGAGAACAAGGUCCGCCAAUA
CGACUCCAUUCAAAAGCUCCUCAACGAGCGGUCGCUGUUCAGACAAGCUAUUUCA
CCGUCCGAUAGAGUGAAGCUCUUCCCGCAUCGGAACAGCUCAAAGUGCAAAUCGA
AGCCGCAGAUCGCAGCCUUGAAGGAAGAGACUGAGGAAGAGGUGCAGGACACCC GGCUUUAA
Comparison Codon-Optimized Human CFTR mRNA Coding Sequence (SEQ ID
NO: 4) AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCAU
GGACUCGGCCUAUCCUUAGAAAGGGGUAUCGGCAGAGGCUUGAGUUGUCUGACA
UCUACCAGAUCCCCUCGGUAGAUUCGGCGGAUAACCUCUCGGAGAAGCUCGAACG
GGAAUGGGACCGCGAACUCGCGUCUAAGAAAAACCCGAAGCUCAUCAACGCACUG
AGAAGGUGCUUCUUCUGGCGGUUCAUGUUCUACGGUAUCUUCUUGUAUCUCGGG
GAGGUCACAAAAGCAGUCCAACCCCUGUUGUUGGGUCGCAUUAUCGCCUCGUACG
ACCCCGAUAACAAAGAAGAACGGAGCAUCGCGAUCUACCUCGGGAUCGGACUGUG
UUUGCUUUUCAUCGUCAGAACACUUUUGUUGCAUCCAGCAAUCUUCGGCCUCCAU
CACAUCGGUAUGCAGAUGCGAAUCGCUAUGUUUAGCUUGAUCUACAAAAAGACA
CUGAAACUCUCGUCGCGGGUGUUGGAUAAGAUUUCCAUCGGUCAGUUGGUGUCC
CUGCUUAGUAAUAACCUCAACAAAUUCGAUGAGGGACUGGCGCUGGCACAUUUC
GUGUGGAUUGCCCCGUUGCAAGUCGCCCUUUUGAUGGGCCUUAUUUGGGAGCUG
UUGCAGGCAUCUGCCUUUUGUGGCCUGGGAUUUCUGAUUGUGUUGGCAUUGUUU
CAGGCUGGGCUUGGGCGGAUGAUGAUGAAGUAUCGCGACCAGAGAGCGGGUAAA
AUCUCGGAAAGACUCGUCAUCACUUCGGAAAUGAUCGAAAACAUCCAGUCGGUCA
AAGCCUAUUGCUGGGAAGAAGCUAUGGAGAAGAUGAUUGAAAACCUCCGCCAAA
CUGAGCUGAAACUGACCCGCAAGGCGGCGUAUGUCCGGUAUUUCAAUUCGUCAGC
GUUCUUCUUUUCCGGGUUCUUCGUUGUCUUUCUCUCGGUUUUGCCUUAUGCCUUG
AUUAAGGGGAUUAUCCUCCGCAAGAUUUUCACCACGAUUUCGUUCUGCAUUGUA
UUGCGCAUGGCAGUGACACGGCAAUUUCCGUGGGCCGUGCAGACAUGGUAUGAC
UCGCUUGGAGCGAUCAACAAAAUCCAAGACUUCUUGCAAAAGCAAGAGUACAAG
ACCCUGGAGUACAAUCUUACUACUACGGAGGUAGUAAUGGAGAAUGUGACGGCU
UUUUGGGAAGAGGGUUUUGGAGAACUGUUUGAGAAAGCAAAGCAGAAUAACAAC
AACCGCAAGACCUCAAAUGGGGACGAUUCCCUGUUUUUCUCGAACUUCUCCCUGC
UCGGAACACCCGUGUUGAAGGACAUCAAUUUCAAGAUUGAGAGGGGACAGCUUC
UCGCGGUAGCGGGAAGCACUGGUGCGGGAAAAACUAGCCUCUUGAUGGUGAUUA
UGGGGGAGCUUGAGCCCAGCGAGGGGAAGAUUAAACACUCCGGGCGUAUCUCAU
UCUGUAGCCAGUUUUCAUGGAUCAUGCCCGGAACCAUUAAAGAGAACAUCAUUU
UCGGAGUAUCCUAUGAUGAGUACCGAUACAGAUCGGUCAUUAAGGCGUGCCAGU
UGGAAGAGGACAUUUCUAAGUUCGCCGAGAAGGAUAACAUCGUCUUGGGAGAAG
GGGGUAUUACAUUGUCGGGAGGGCAGCGAGCGCGGAUCAGCCUCGCGAGAGCGG
UAUACAAAGAUGCAGAUUUGUAUCUGCUUGAUUCACCGUUUGGAUACCUCGACG
UAUUGACAGAAAAAGAAAUCUUCGAGUCGUGCGUGUGUAAACUUAUGGCUAAUA
AGACGAGAAUCCUGGUGACAUCAAAAAUGGAACACCUUAAGAAGGCGGACAAGA
UCCUGAUCCUCCACGAAGGAUCGUCCUACUUUUACGGCACUUUCUCAGAGUUGCA
AAACUUGCAGCCGGACUUCUCAAGCAAACUCAUGGGGUGUGACUCAUUCGACCAG
UUCAGCGCGGAACGGCGGAACUCGAUCUUGACGGAAACGCUGCACCGAUUCUCGC
UUGAGGGUGAUGCCCCGGUAUCGUGGACCGAGACAAAGAAGCAGUCGUUUAAGC
AGACAGGAGAAUUUGGUGAGAAAAGAAAGAACAGUAUCUUGAAUCCUAUUAACU
CAAUUCGCAAGUUCUCAAUCGUCCAGAAAACUCCACUGCAGAUGAAUGGAAUUG
AAGAGGAUUCGGACGAACCCCUGGAGCGCAGGCUUAGCCUCGUGCCGGAUUCAGA
GCAAGGGGAGGCCAUUCUUCCCCGGAUUUCGGUGAUUUCAACCGGACCUACACUU
CAGGCGAGGCGAAGGCAAUCCGUGCUCAACCUCAUGACGCAUUCGGUAAACCAGG
GGCAAAACAUUCACCGCAAAACGACGGCCUCAACGAGAAAAGUGUCACUUGCACC
CCAGGCGAAUUUGACUGAACUCGACAUCUACAGCCGUAGGCUUUCGCAAGAAACC
GGACUUGAGAUCAGCGAAGAAAUCAAUGAAGAAGAUUUGAAAGAGUGUUUCUUU
GAUGACAUGGAAUCAAUCCCAGCGGUGACAACGUGGAACACAUACUUGCGUUAC
AUCACGGUGCACAAGUCCUUGAUUUUCGUCCUCAUCUGGUGUCUCGUGAUCUUUC
UCGCUGAGGUCGCAGCGUCACUUGUGGUCCUCUGGCUGCUUGGUAAUACGCCCUU
GCAAGACAAAGGCAAUUCUACACACUCAAGAAACAAUUCCUAUGCCGUGAUUAUC
ACUUCUACAAGCUCGUAUUACGUGUUUUACAUCUACGUAGGAGUGGCCGACACUC
UGCUCGCGAUGGGUUUCUUCCGAGGACUCCCACUCGUUCACACGCUUAUCACUGU
CUCCAAGAUUCUCCACCAUAAGAUGCUUCAUAGCGUACUGCAGGCUCCCAUGUCC
ACCUUGAAUACGCUCAAGGCGGGAGGUAUUUUGAAUCGCUUCUCAAAAGAUAUU
GCAAUUUUGGAUGACCUUCUGCCCCUGACGAUCUUCGACUUCAUCCAGUUGUUGC
UGAUCGUGAUUGGGGCUAUUGCAGUAGUCGCUGUCCUCCAGCCUUACAUUUUUG
UCGCGACCGUUCCGGUGAUCGUGGCGUUUAUCAUGCUGCGGGCCUAUUUCUUGCA
GACGUCACAGCAGCUUAAGCAACUGGAGUCUGAAGGGAGGUCGCCUAUCUUUAC
GCAUCUUGUGACCAGUUUGAAGGGAUUGUGGACGUUGCGCGCCUUUGGCAGGCA
GCCCUACUUUGAAACACUGUUCCACAAAGCGCUGAAUCUCCAUACGGCAAAUUGG
UUUUUGUAUUUGAGUACCCUCCGAUGGUUUCAGAUGCGCAUUGAGAUGAUUUUU
GUGAUCUUCUUUAUCGCGGUGACUUUUAUCUCCAUCUUGACCACGGGAGAGGGC
GAGGGACGGGUCGGUAUUAUCCUGACACUCGCCAUGAACAUUAUGAGCACUUUG
CAGUGGGCAGUGAACAGCUCGAUUGAUGUGGAUAGCCUGAUGAGGUCCGUUUCG
AGGGUCUUUAAGUUCAUCGACAUGCCGACGGAGGGAAAGCCCACAAAAAGUACG
AAACCCUAUAAGAAUGGGCAAUUGAGUAAGGUAAUGAUCAUCGAGAACAGUCAC
GUGAAGAAGGAUGACAUCUGGCCUAGCGGGGGUCAGAUGACCGUGAAGGACCUG
ACGGCAAAAUACACCGAGGGAGGGAACGCAAUCCUUGAAAACAUCUCGUUCAGCA
UUAGCCCCGGUCAGCGUGUGGGGUUGCUCGGGAGGACCGGGUCAGGAAAAUCGA
CGUUGCUGUCGGCCUUCUUGAGACUUCUGAAUACAGAGGGUGAGAUCCAGAUCG
ACGGCGUUUCGUGGGAUAGCAUCACCUUGCAGCAGUGGCGGAAAGCGUUUGGAG
UAAUCCCCCAAAAGGUCUUUAUCUUUAGCGGAACCUUCCGAAAGAAUCUCGAUCC
UUAUGAACAGUGGUCAGAUCAAGAGAUUUGGAAAGUCGCGGACGAGGUUGGCCU
UCGGAGUGUAAUCGAGCAGUUUCCGGGAAAACUCGACUUUGUCCUUGUAGAUGG
GGGAUGCGUCCUGUCGCAUGGGCACAAGCAGCUCAUGUGCCUGGCGCGAUCCGUC
CUCUCUAAAGCGAAAAUUCUUCUCUUGGAUGAACCUUCGGCCCAUCUGGACCCGG
UAACGUAUCAGAUCAUCAGAAGGACACUUAAGCAGGCGUUUGCCGACUGCACGG
UGAUUCUCUGUGAGCAUCGUAUCGAGGCCAUGCUCGAAUGCCAGCAAUUUCUUG
UCAUCGAAGAGAAUAAGGUCCGCCAGUACGACUCCAUCCAGAAGCUGCUUAAUGA
GAGAUCAUUGUUCCGGCAGGCGAUUUCACCAUCCGAUAGGGUGAAACUUUUUCC
ACACAGAAAUUCGUCGAAGUGCAAGUCCAAACCGCAGAUCGCGGCCUUGAAAGAA
GAGACUGAAGAAGAAGUUCAAGACACGCGUCUUUAA Codon-Optimized Human PAH
Coding Sequence (SEQ ID NO: 5)
AUGAGCACCGCCGUGCUGGAGAACCCCGGCCUGGGCCGCAAGCUGAGCGACUUCG
GCCAGGAGACCAGCUACAUCGAGGACAACUGCAACCAGAACGGCGCCAUCAGCCU
GAUCUUCAGCCUGAAGGAGGAGGUGGGCGCCCUGGCCAAGGUGCUGCGCCUGUUC
GAGGAGAACGACGUGAACCUGACCCACAUCGAGAGCCGCCCCAGCCGCCUGAAGA
AGGACGAGUACGAGUUCUUCACCCACCUGGACAAGCGCAGCCUGCCCGCCCUGAC
CAACAUCAUCAAGAUCCUGCGCCACGACAUCGGCGCCACCGUGCACGAGCUGAGC
CGCGACAAGAAGAAGGACACCGUGCCCUGGUUCCCCCGCACCAUCCAGGAGCUGG
ACCGCUUCGCCAACCAGAUCCUGAGCUACGGCGCCGAGCUGGACGCCGACCACCC
CGGCUUCAAGGACCCCGUGUACCGCGCCCGCCGCAAGCAGUUCGCCGACAUCGCC
UACAACUACCGCCACGGCCAGCCCAUCCCCCGCGUGGAGUACAUGGAGGAGGAGA
AGAAGACCUGGGGCACCGUGUUCAAGACCCUGAAGAGCCUGUACAAGACCCACGC
CUGCUACGAGUACAACCACAUCUUCCCCCUGCUGGAGAAGUACUGCGGCUUCCAC
GAGGACAACAUCCCCCAGCUGGAGGACGUGAGCCAGUUCCUGCAGACCUGCACCG
GCUUCCGCCUGCGCCCCGUGGCCGGCCUGCUGAGCAGCCGCGACUUCCUGGGCGG
CCUGGCCUUCCGCGUGUUCCACUGCACCCAGUACAUCCGCCACGGCAGCAAGCCC
AUGUACACCCCCGAGCCCGACAUCUGCCACGAGCUGCUGGGCCACGUGCCCCUGU
UCAGCGACCGCAGCUUCGCCCAGUUCAGCCAGGAGAUCGGCCUGGCCAGCCUGGG
CGCCCCCGACGAGUACAUCGAGAAGCUGGCCACCAUCUACUGGUUCACCGUGGAG
UUCGGCCUGUGCAAGCAGGGCGACAGCAUCAAGGCCUACGGCGCCGGCCUGCUGA
GCAGCUUCGGCGAGCUGCAGUACUGCCUGAGCGAGAAGCCCAAGCUGCUGCCCCU
GGAGCUGGAGAAGACCGCCAUCCAGAACUACACCGUGACCGAGUUCCAGCCCCUG
UACUACGUGGCCGAGAGCUUCAACGACGCCAAGGAGAAGGUGCGCAACUUCGCCG
CCACCAUCCCCCGCCCCUUCAGCGUGCGCUACGACCCCUACACCCAGCGCAUCGAG
GUGCUGGACAACACCCAGCAGCUGAAGAUCCUGGCCGACAGCAUCAACAGCGAGA
UCGGCAUCCUGUGCAGCGCCCUGCAGAAGAUCAAGUAA
[0117] In some embodiments, an mRNA suitable for the present
invention has a nucleotide sequence at least 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or more identical SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 or
SEQ ID NO: 4. In some embodiments, an mRNA suitable for the present
invention comprises a nucleotide sequence identical to SEQ ID NO:
1, SEQ ID NO: 2, SEQ ID NO:3 or SEQ ID NO: 4.
mRNA Solution
[0118] mRNA may be provided in a solution to be mixed with a lipid
solution such that the mRNA may be encapsulated in lipid
nanoparticles. A suitable mRNA solution may be any aqueous solution
containing mRNA to be encapsulated at various concentrations. For
example, a suitable mRNA solution may contain an mRNA at a
concentration of or greater than about 0.01 mg/ml, 0.05 mg/ml, 0.06
mg/ml, 0.07 mg/ml, 0.08 mg/ml, 0.09 mg/ml, 0.1 mg/ml, 0.15 mg/ml,
0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml,
0.8 mg/ml, 0.9 mg/ml, or 1.0 mg/ml. In some embodiments, a suitable
mRNA solution may contain an mRNA at a concentration ranging from
about 0.01-1.0 mg/ml, 0.01-0.9 mg/ml, 0.01-0.8 mg/ml, 0.01-0.7
mg/ml, 0.01-0.6 mg/ml, 0.01-0.5 mg/ml, 0.01-0.4 mg/ml, 0.01-0.3
mg/ml, 0.01-0.2 mg/ml, 0.01-0.1 mg/ml, 0.05-1.0 mg/ml, 0.05-0.9
mg/ml, 0.05-0.8 mg/ml, 0.05-0.7 mg/ml, 0.05-0.6 mg/ml, 0.05-0.5
mg/ml, 0.05-0.4 mg/ml, 0.05-0.3 mg/ml, 0.05-0.2 mg/ml, 0.05-0.1
mg/ml, 0.1-1.0 mg/ml, 0.2-0.9 mg/ml, 0.3-0.8 mg/ml, 0.4-0.7 mg/ml,
or 0.5-0.6 mg/ml. In some embodiments, a suitable mRNA solution may
contain an mRNA at a concentration up to about 5.0 mg/ml, 4.0
mg/ml, 3.0 mg/ml, 2.0 mg/ml, 1.0 mg/ml, 0.09 mg/ml, 0.08 mg/ml,
0.07 mg/ml, 0.06 mg/ml, or 0.05 mg/ml.
[0119] Typically, a suitable mRNA solution may also contain a
buffering agent and/or salt. Generally, buffering agents can
include HEPES, ammonium sulfate, sodium bicarbonate, sodium
citrate, sodium acetate, potassium phosphate and sodium phosphate.
In some embodiments, suitable concentration of the buffering agent
may range from about 0.1 mM to 100 mM, 0.5 mM to 90 mM, 1.0 mM to
80 mM, 2 mM to 70 mM, 3 mM to 60 mM, 4 mM to 50 mM, 5 mM to 40 mM,
6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 to 12 mM. In some
embodiments, suitable concentration of the buffering agent is or
greater than about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10
mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM.
[0120] Exemplary salts can include sodium chloride, magnesium
chloride, and potassium chloride. In some embodiments, suitable
concentration of salts in an mRNA solution may range from about 1
mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20
mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50
mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM.
Salt concentration in a suitable mRNA solution is or greater than
about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM,
80 mM, 90 mM, or 100 mM.
[0121] In some embodiments, a suitable mRNA solution may have a pH
ranging from about 3.5-6.5, 3.5-6.0, 3.5-5.5, 3.5-5.0, 3.5-4.5,
4.0-5.5, 4.0-5.0, 4.0-4.9, 4.0-4.8, 4.0-4.7, 4.0-4.6, or 4.0-4.5.
In some embodiments, a suitable mRNA solution may have a pH of or
no greater than about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7,
4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5.
[0122] Various methods may be used to prepare an mRNA solution
suitable for the present invention. In some embodiments, mRNA may
be directly dissolved in a buffer solution described herein. In
some embodiments, an mRNA solution may be generated by mixing an
mRNA stock solution with a buffer solution prior to mixing with a
lipid solution for encapsulation. In some embodiments, an mRNA
solution may be generated by mixing an mRNA stock solution with a
buffer solution immediately before mixing with a lipid solution for
encapsulation. In some embodiments, a suitable mRNA stock solution
may contain mRNA in water at a concentration at or greater than
about 0.2 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.8 mg/ml, 1.0
mg/ml, 1.2 mg/ml, 1.4 mg/ml, 1.5 mg/ml, or 1.6 mg/ml, 2.0 mg/ml,
2.5 mg/ml, 3.0 mg/ml, 3.5 mg/ml, 4.0 mg/ml, 4.5 mg/ml, or 5.0
mg/ml.
[0123] In some embodiments, an mRNA stock solution is mixed with a
buffer solution using a pump. Exemplary pumps include but are not
limited to gear pumps, peristaltic pumps and centrifugal pumps.
[0124] Typically, the buffer solution is mixed at a rate greater
than that of the mRNA stock solution. For example, the buffer
solution may be mixed at a rate at least 1.times., 2.times.,
3.times., 4.times., 5.times., 6.times., 7.times., 8.times.,
9.times., 10.times., 15.times., or 20.times. greater than the rate
of the mRNA stock solution. In some embodiments, a buffer solution
is mixed at a flow rate ranging between about 100-6000 ml/minute
(e.g., about 100-300 ml/minute, 300-600 ml/minute, 600-1200
ml/minute, 1200-2400 ml/minute, 2400-3600 ml/minute, 3600-4800
ml/minute, 4800-6000 ml/minute, or 60-420 ml/minute). In some
embodiments, a buffer solution is mixed at a flow rate of or
greater than about 60 ml/minute, 100 ml/minute, 140 ml/minute, 180
ml/minute, 220 ml/minute, 260 ml/minute, 300 ml/minute, 340
ml/minute, 380 ml/minute, 420 ml/minute, 480 ml/minute, 540
ml/minute, 600 ml/minute, 1200 ml/minute, 2400 ml/minute, 3600
ml/minute, 4800 ml/minute, or 6000 ml/minute.
[0125] In some embodiments, an mRNA stock solution is mixed at a
flow rate ranging between about 10-600 ml/minute (e.g., about 5-50
ml/minute, about 10-30 ml/minute, about 30-60 ml/minute, about
60-120 ml/minute, about 120-240 ml/minute, about 240-360 ml/minute,
about 360-480 ml/minute, or about 480-600 ml/minute). In some
embodiments, an mRNA stock solution is mixed at a flow rate of or
greater than about 5 ml/minute, 10 ml/minute, 15 ml/minute, 20
ml/minute, 25 ml/minute, 30 ml/minute, 35 ml/minute, 40 ml/minute,
45 ml/minute, 50 ml/minute, 60 ml/minute, 80 ml/minute, 100
ml/minute, 200 ml/minute, 300 ml/minute, 400 ml/minute, 500
ml/minute, or 600 ml/minute.
Lipid Solution
[0126] According to the present invention, a lipid solution
contains a mixture of lipids suitable to form lipid nanoparticles
for encapsulation of mRNA. In some embodiments, a suitable lipid
solution is ethanol based. For example, a suitable lipid solution
may contain a mixture of desired lipids dissolved in pure ethanol
(i.e., 100% ethanol). In another embodiment, a suitable lipid
solution is isopropyl alcohol based. In another embodiment, a
suitable lipid solution is dimethylsulfoxide-based. In another
embodiment, a suitable lipid solution is a mixture of suitable
solvents including, but not limited to, ethanol, isopropyl alcohol
and dimethylsulfoxide.
[0127] A suitable lipid solution may contain a mixture of desired
lipids at various concentrations. For example, a suitable lipid
solution may contain a mixture of desired lipids at a total
concentration of or greater than about 0.1 mg/ml, 0.5 mg/ml, 1.0
mg/ml, 2.0 mg/ml, 3.0 mg/ml, 4.0 mg/ml, 5.0 mg/ml, 6.0 mg/ml, 7.0
mg/ml, 8.0 mg/ml, 9.0 mg/ml, 10 mg/ml, 15 mg/ml, 20 mg/ml, 30
mg/ml, 40 mg/ml, 50 mg/ml, or 100 mg/ml. In some embodiments, a
suitable lipid solution may contain a mixture of desired lipids at
a total concentration ranging from about 0.1-100 mg/ml, 0.5-90
mg/ml, 1.0-80 mg/ml, 1.0-70 mg/ml, 1.0-60 mg/ml, 1.0-50 mg/ml,
1.0-40 mg/ml, 1.0-30 mg/ml, 1.0-20 mg/ml, 1.0-15 mg/ml, 1.0-10
mg/ml, 1.0-9 mg/ml, 1.0-8 mg/ml, 1.0-7 mg/ml, 1.0-6 mg/ml, or 1.0-5
mg/ml. In some embodiments, a suitable lipid solution may contain a
mixture of desired lipids at a total concentration up to about 100
mg/ml, 90 mg/ml, 80 mg/ml, 70 mg/ml, 60 mg/ml, 50 mg/ml, 40 mg/ml,
30 mg/ml, 20 mg/ml, or 10 mg/ml.
[0128] Any desired lipids may be mixed at any ratios suitable for
encapsulating mRNAs. In some embodiments, a suitable lipid solution
contains a mixture of desired lipids including cationic lipids,
helper lipids (e.g. non cationic lipids and/or cholesterol lipids)
and/or PEGylated lipids. In some embodiments, a suitable lipid
solution contains a mixture of desired lipids including one or more
cationic lipids, one or more helper lipids (e.g. non cationic
lipids and/or cholesterol lipids) and one or more PEGylated
lipids.
[0129] Cationic Lipids
[0130] As used herein, the phrase "cationic lipids" refers to any
of a number of lipid species that have a net positive charge at a
selected pH, such as physiological pH. Several cationic lipids have
been described in the literature, many of which are commercially
available. Particularly suitable cationic lipids for use in the
compositions and methods of the invention include those described
in international patent publications WO 2010/053572 (and
particularly, C12-200 described at paragraph [00225]) and WO
2012/170930, both of which are incorporated herein by reference. In
certain embodiments, cationic lipids suitable for the compositions
and methods of the invention include an ionizable cationic lipid
described in U.S. provisional patent application 61/617,468, filed
Mar. 29, 2012 (incorporated herein by reference), such as, e.g,
(15Z, 18Z)-N,N-dimethyl-6-(9Z, 12Z)-octadeca-9,
12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,
18Z)-N,N-dimethyl-6-((9Z, 12Z)-octadeca-9,
12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001), and
(15Z,18Z)-N,N-dimethyl-6-((9Z, 12Z)-octadeca-9,
12-dien-1-yl)tetracosa-5, 15, 18-trien-1-amine (HGT5002).
[0131] In some embodiments, cationic lipids suitable for the
compositions and methods of the invention include cationic lipids
such as
3,6-bis(4-(bis((9Z,12Z)-2-hydroxyoctadeca-9,12-dien-1-yl)amino)butyl)pipe-
razine-2,5-dione (OF-02).
[0132] In some embodiments, cationic lipids suitable for the
compositions and methods of the invention include a cationic lipid
described in WO 2015/184256 A2 entitled "Biodegradable lipids for
delivery of nucleic acids" which is incorporated by reference
herein such as
3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydrox-
yundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23),
3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2--
hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target
24).
[0133] In some embodiments, cationic lipids suitable for the
compositions and methods of the invention include a cationic lipid
described in WO 2013/063468 and in U.S. provisional application
entitled "Lipid Formulations for Delivery of Messenger RNA", both
of which are incorporated by reference herein. In some embodiments,
a cationic lipid comprises a compound of formula I-c1-a:
##STR00001##
or a pharmaceutically acceptable salt thereof, wherein: each
R.sup.2 independently is hydrogen or C.sub.1-3 alkyl; each q
independently is 2 to 6; each R' independently is hydrogen or
C.sub.1-3 alkyl; and each R.sup.L independently is C.sub.8-12
alkyl.
[0134] In some embodiments, each R.sup.2 independently is hydrogen,
methyl or ethyl. In some embodiments, each R.sup.2 independently is
hydrogen or methyl. In some embodiments, each R.sup.2 is
hydrogen.
[0135] In some embodiments, each q independently is 3 to 6. In some
embodiments, each q independently is 3 to 5. In some embodiments,
each q is 4.
[0136] In some embodiments, each R' independently is hydrogen,
methyl or ethyl. In some embodiments, each R' independently is
hydrogen or methyl. In some embodiments, each R' independently is
hydrogen.
[0137] In some embodiments, each R.sup.L independently is
C.sub.8-12 alkyl. In some embodiments, each R.sup.L independently
is n-C.sub.8-12 alkyl. In some embodiments, each R.sup.L
independently is C.sub.9-11 alkyl. In some embodiments, each
R.sup.L independently is n-C.sub.9-11 alkyl. In some embodiments,
each R.sup.L independently is C.sub.10 alkyl. In some embodiments,
each R.sup.L independently is n-C.sub.10 alkyl.
[0138] In some embodiments, each R.sup.2 independently is hydrogen
or methyl; each q independently is 3 to 5; each R' independently is
hydrogen or methyl; and each R.sup.L independently is C.sub.8-12
alkyl.
[0139] In some embodiments, each R.sup.2 is hydrogen; each q
independently is 3 to 5; each R' is hydrogen; and each R.sup.L
independently is C.sub.8-12 alkyl.
[0140] In some embodiments, each R.sup.2 is hydrogen; each q is 4;
each R' is hydrogen; and each R.sup.L independently is C.sub.8-12
alkyl.
[0141] In some embodiments, a cationic lipid comprises a compound
of formula I-g:
##STR00002##
or a pharmaceutically acceptable salt thereof, wherein each R.sup.L
independently is C.sub.8-12 alkyl. In some embodiments, each
R.sup.L independently is n-C.sub.8-12 alkyl. In some embodiments,
each R.sup.L independently is C.sub.9-11 alkyl. In some
embodiments, each R.sup.L independently is n-C.sub.9-11 alkyl. In
some embodiments, each R.sup.L independently is C.sub.10 alkyl. In
some embodiments, each R.sup.L is n-C.sub.10 alkyl.
[0142] In particular embodiments, a suitable cationic lipid is
cKK-E12, or
(3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione).
Structure of cKK-E12 is shown below:
##STR00003##
[0143] Additional exemplary cationic lipids include those of
formula I:
##STR00004##
and pharmaceutically acceptable salts thereof, wherein,
[0144] R is
##STR00005##
[0145] R is
##STR00006##
[0146] R is or
##STR00007##
[0147] R is
##STR00008##
(see, e.g., Fenton, Owen S., et al. "Bioinspired Alkenyl Amino
Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA
Delivery." Advanced materials (2016)).
[0148] In some embodiments, one or more cationic lipids suitable
for the present invention may be
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or
"DOTMA". (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987);
U.S. Pat. No. 4,897,355). Other suitable cationic lipids include,
for example, 5-carboxyspermylglycinedioctadecylamide or "DOGS,"
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanamin-
ium or "DOSPA" (Behr et al. Proc. Nat.'1 Acad. Sci. 86, 6982
(1989); U.S. Pat. No. 5,171,678; U.S. Pat. No. 5,334,761),
1,2-Dioleoyl-3-Dimethylammonium-Propane or "DODAP",
1,2-Dioleoyl-3-Trimethylammonium-Propane or "DOTAP".
[0149] Additional exemplary cationic lipids also include
1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA",
1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA",
1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA",
1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA",
N-dioleyl-N,N-dimethylammonium chloride or "DODAC",
N,N-distearyl-N,N-dimethylarnrnonium bromide or "DDAB",
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide or "DMRIE",
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane or "CLinDMA",
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',
1-2'-octadecadienoxy)propane or "CpLinDMA",
N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA",
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP",
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP",
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane or
"DLincarbDAP", 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane or
"DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or
"DLin-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or
"DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,1
2-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine
(DLin-KC2-DMA)) (see, WO 2010/042877; Semple et al., Nature
Biotech. 28: 172-176 (2010)), or mixtures thereof. (Heyes, J., et
al., J Controlled Release 107: 276-287 (2005); Morrissey, D V., et
al., Nat. Biotechnol. 23(8): 1003-1007 (2005); PCT Publication
WO2005/121348A1). In some embodiments, one or more of the cationic
lipids comprise at least one of an imidazole, dialkylamino, or
guanidinium moiety.
[0150] In some embodiments, one or more cationic lipids may be
chosen from XTC
(2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3
(((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl
4-(dimethylamino)butanoate), ALNY-100
((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr-
o-3aH-cyclopenta[d] [1,3]dioxol-5-amine)), NC98-5
(4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tet-
raazahexadecane-1,16-diamide), DODAP
(1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO 2012/170889,
the teachings of which are incorporated herein by reference in
their entirety), ICE (WO 2011/068810, the teachings of which are
incorporated herein by reference in their entirety), HGT5000 (U.S.
Provisional Patent Application No. 61/617,468, the teachings of
which are incorporated herein by reference in their entirety) or
HGT5001 (cis or trans) (Provisional Patent Application No.
61/617,468), aminoalcohol lipidoids such as those disclosed in
WO2010/053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane),
DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA
(Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid
saturation influences intracellular delivery of encapsulated
nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA
(Semple, S. C. et al. "Rational Design of Cationic Lipids for siRNA
Delivery" Nature Biotech. 2010, 28, 172-176), C12-200 (Love, K. T.
et al. "Lipid-like materials for low-dose in vivo gene silencing"
PNAS 2010, 107, 1864-1869), N1GL, N2GL, V1GL and combinations
thereof.
[0151] In some embodiments, the one or more cationic lipids are
amino lipids. Amino lipids suitable for use in the invention
include those described in WO2017180917, which is hereby
incorporated by reference. Exemplary aminolipids in WO2017180917
include those described at paragraph [0744] such as DLin-MC3-DMA
(MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine
(L608), and Compound 18. Other amino lipids include Compound 2,
Compound 23, Compound 27, Compound 10, and Compound 20. Further
amino lipids suitable for use in the invention include those
described in WO2017112865, which is hereby incorporated by
reference. Exemplary amino lipids in WO2017112865 include a
compound according to one of formulae (I), (Ial)-(Ia6), (lb), (II),
(Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1),
and compounds of paragraphs [00185], [00201], [0276]. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118725, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL22 and KL25. In some
embodiments, cationic lipids suitable for use in the invention
include those described in WO2016118724, which is hereby
incorporated by reference. Exemplary cationic lipids in
WO2016118725 include those such as KL10,
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and
KL25.
[0152] In some embodiments, cationic lipids constitute at least
about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%
of the total lipids in a suitable lipid solution by weight or by
molar. In some embodiments, cationic lipid(s) constitute(s) about
30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about
30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or
about 35-40%) of the total lipid mixture by weight or by molar.
[0153] Non-Cationic/Helper Lipids
[0154] As used herein, the phrase "non-cationic lipid" refers to
any neutral, zwitterionic or anionic lipid. As used herein, the
phrase "anionic lipid" refers to any of a number of lipid species
that carry a net negative charge at a selected pH, such as
physiological pH. Non-cationic lipids include, but are not limited
to, distearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), or a mixture
thereof.
[0155] In some embodiments, non-cationic lipids may constitute at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65% or 70% of the total lipids in a suitable lipid solution by
weight or by molar. In some embodiments, non-cationic lipid(s)
constitute(s) about 30-50% (e.g., about 30-45%, about 30-40%, about
35-50%, about 35-45%, or about 35-40%) of the total lipids in a
suitable lipid solution by weight or by molar.
[0156] Cholesterol-Based Lipids
[0157] In some embodiments, a suitable lipid solution includes one
or more cholesterol-based lipids. For example, suitable
cholesterol-based cationic lipids include, for example, DC-Choi
(N,N-dimethyl-N-ethylcarboxamidocholesterol),
1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem.
Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23,
139 (1997); U.S. Pat. No. 5,744,335), or ICE. In some embodiments,
cholesterol-based lipid(s) constitute(s) at least about 5%, 10%,
20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable
lipid solution by weight or by molar. In some embodiments,
cholesterol-based lipid(s) constitute(s) about 30-50% (e.g., about
30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%)
of the total lipids in a suitable lipid solution by weight or by
molar.
[0158] PEGylated Lipids
[0159] In some embodiments, a suitable lipid solution includes one
or more PEGylated lipids. For example, the use of polyethylene
glycol (PEG)-modified phospholipids and derivatized lipids such as
derivatized ceramides (PEG-CER), including
N-Octanoyl-Sphingosine-1-[Succinyl(Methoxy Polyethylene
Glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the
present invention. Contemplated PEG-modified lipids include, but
are not limited to, a polyethylene glycol chain of up to 2 kDa, up
to 3 kDa, up to 4 kDa or up to 5 kDa in length covalently attached
to a lipid with alkyl chain(s) of C.sub.6-C.sub.20 length. In some
embodiments, a PEG-modified or PEGylated lipid is PEGylated
cholesterol or PEG-2K. In some embodiments, particularly useful
exchangeable lipids are PEG-ceramides having shorter acyl chains
(e.g., C.sub.14 or C.sub.18).
[0160] PEG-modified phospholipid and derivatized lipids may
constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70%
of the total lipids in a suitable lipid solution by weight or by
molar. In some embodiments, PEGylated lipid lipid(s) constitute(s)
about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about
35-45%, or about 35-40%) of the total lipids in a suitable lipid
solution by weight or by molar.
[0161] Various combinations of lipids, i.e., cationic lipids,
non-cationic lipids, PEG-modified lipids and optionally
cholesterol, that can used to prepare, and that are comprised in,
pre-formed lipid nanoparticles are described in the literature and
herein. For example, a suitable lipid solution may contain cKK-E12,
DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and
DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001,
DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DPPC, cholesterol, and
DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000,
DPPC, chol, and DMG-PEG2K; HGT5001, DPPC, cholesterol, and
DMG-PEG2K; or ICE, DOPE and DMG-PEG2K. Additional combinations of
lipids are described in the art, e.g., U.S. Ser. No. 62/420,421
(filed on Nov. 10, 2016), U.S. Ser. No. 62/421,021 (filed on Nov.
11, 2016), U.S. Ser. No. 62/464,327 (filed on Feb. 27, 2017), and
PCT Application entitled "Novel ICE-based Lipid Nanoparticle
Formulation for Delivery of mRNA," filed on Nov. 10, 2017, the
disclosures of which are included here in their full scope by
reference. The selection of cationic lipids, non-cationic lipids
and/or PEG-modified lipids which comprise the lipid mixture as well
as the relative molar ratio of such lipids to each other, is based
upon the characteristics of the selected lipid(s) and the nature of
the and the characteristics of the mRNA to be encapsulated.
Additional considerations include, for example, the saturation of
the alkyl chain, as well as the size, charge, pH, pKa, fusogenicity
and toxicity of the selected lipid(s). Thus the molar ratios may be
adjusted accordingly.
Pre-Formed Nanoparticle Formation and Mixing Process
[0162] The present invention is based on the discovery of the
surprisingly unexpected effect that mixing empty pre-formed lipid
nanoparticles (i.e., lipid nanoparticles formed in the absence of
mRNA) and mRNA has on the resulting encapsulated mRNA potency and
efficacy.
[0163] In some previously disclosed processes, see U.S. patent
application Ser. No. 14/790,562 entitled "Encapsulation of
messenger RNA", filed Jul. 2, 2015 and its provisional U.S. patent
application Ser. No. 62/020,163, filed Jul. 2, 2014, the disclosure
of which are hereby incorporated in their entirety, in some
embodiments, the previous invention provides a process of
encapsulating messenger RNA (mRNA) in lipid nanoparticles by mixing
an mRNA solution and a lipid solution, wherein the mRNA solution
and/or the lipid solution are heated to a pre-determined
temperature greater than ambient temperature prior to mixing, to
form lipid nanoparticles that encapsulate mRNA.
[0164] The present invention relates to a novel method of
formulating mRNA-containing lipid nanoparticles. In the present
invention, a novel process for preparing a lipid nanoparticle
containing mRNA has been identified, which involves combining
pre-formed lipid nanoparticles with mRNA under conditions which,
due to the order of addition of such components, the resultant
formulated particles show improved potency and efficacy. The mixing
of the components is achieved with pump systems which maintain the
lipid/mRNA (N/P) ratio constant throughout the process and which
also afford facile scale-up. In some embodiments, the process is
performed at large scale. For example, in some embodiments, a
composition according to the present invention contains at least
about 1 mg, 5 mg, 10 mg, 50 mg, 100 mg, 500 mg, or 1000 mg of
encapsulated mRNA.
[0165] For certain cationic lipid nanoparticle formulations of
mRNA, in order to achieve high encapsulation of mRNA, which is
essential for protection and delivery of mRNA, the mRNA in citrate
buffer has to be heated. In those processes or methods, the heating
is required to occur before the formulation process (i.e. heating
the separate components) as heating post-formulation
(post-formation of nanoparticles) does not increase the
encapsulation efficiency of the mRNA in the lipid nanoparticles. In
contrast, in some embodiments of the novel processes of the present
invention, the order of heating of mRNA does not appear to affect
the mRNA encapsulation percentage. In some embodiments, no heating
(i.e., maintaining at ambient temperature) of one or more of the
solution comprising the pre-formed lipid nanoparticles, the
solution comprising the mRNA and the mixed solution comprising the
lipid nanoparticle encapsulated mRNA is required to occur before or
after the formulation process. This potentially provides a huge
advantage for precisely scaling up, as controlled temperature
change post-mixing is easier to achieve.
[0166] With this novel process, in some embodiments, encapsulating
mRNA by using a step of mixing the mRNA with empty (i.e., empty of
mRNA) pre-formed lipid nanoparticles (Process B) results in
remarkably higher potency as compared to encapsulating mRNA by
mixing the mRNA with just the lipid components (i.e., that are not
pre-formed into lipid nanoparticles)(Process A). As described in
the Examples below, for example in Tables 3 and 4, the potency of
any mRNA encapsulated lipid nanoparticles tested is from more than
100% to more than 1000% more potent when prepared by Process B as
compared to Process A.
[0167] In some embodiments, the empty (i.e., empty of mRNA) lipid
nanoparticles without mRNA are formed by mixing a lipid solution
containing dissolved lipids in a solvent, and an aqueous/buffer
solution. In some embodiments, the solvent can be ethanol. In some
embodiments, the aqueous solution can be a citrate buffer.
[0168] As used herein, the term "ambient temperature" refers to the
temperature in a room, or the temperature which surrounds an object
of interest (e.g., a pre-formed empty lipid nanoparticle solution,
an mRNA solution, or a lipid nanoparticle solution containing mRNA)
without heating or cooling. In some embodiments, the ambient
temperature at which one or more of the solutions is maintained is
or is less than about 35.degree. C., 30.degree. C., 25.degree. C.,
20.degree. C., or 16.degree. C. In some embodiments, the ambient
temperature at which one or more of the solutions is maintained
ranges from about 15-35.degree. C., about 15-30.degree. C., about
15-25.degree. C., about 15-20.degree. C., about 20-35.degree. C.,
about 25-35.degree. C., about 30-35.degree. C., about 20-30.degree.
C., about 25-30.degree. C. or about 20-25.degree. C. In some
embodiments, the ambient temperature at which one or more of the
solutions is maintained is 20-25.degree. C.
[0169] Therefore, a pre-determined temperature greater than ambient
temperature is typically greater than about 25.degree. C. In some
embodiments, a pre-determined temperature suitable for the present
invention is or is greater than about 30.degree. C., 37.degree. C.,
40.degree. C., 45.degree. C., 50.degree. C., 55.degree. C.,
60.degree. C., 65.degree. C., or 70.degree. C. In some embodiments,
a pre-determined temperature suitable for the present invention
ranges from about 25-70.degree. C., about 30-70.degree. C., about
35-70.degree. C., about 40-70.degree. C., about 45-70.degree. C.,
about 50-70.degree. C., or about 60-70.degree. C. In particular
embodiments, a pre-determined temperature suitable for the present
invention is about 65.degree. C.
[0170] In some embodiments, the mRNA, or pre-formed empty (i.e.,
empty of mRNA) lipid nanoparticle solution, or both, may be heated
to a pre-determined temperature above the ambient temperature prior
to mixing. In some embodiments, the mRNA and the pre-formed empty
lipid nanoparticle solution are heated to the pre-determined
temperature separately prior to the mixing. In some embodiments,
the mRNA and the pre-formed empty lipid nanoparticle solution are
mixed at the ambient temperature but then heated to the
pre-determined temperature after the mixing. In some embodiments,
the pre-formed empty lipid nanoparticle solution is heated to the
pre-determined temperature and mixed with mRNA at the ambient
temperature. In some embodiments, the mRNA solution is heated to
the pre-determined temperature and mixed with a pre-formed empty
lipid nanoparticle solution at ambient temperature.
[0171] In some embodiments, the mRNA solution is heated to the
pre-determined temperature by adding an mRNA stock solution that is
at ambient temperature to a heated buffer solution to achieve the
desired pre-determined temperature.
[0172] In some embodiments, the lipid solution containing dissolved
lipids, or the aqueous/buffer solution, or both, may be heated to a
pre-determined temperature above the ambient temperature prior to
mixing. In some embodiments, the lipid solution containing
dissolved lipids and the aqueous solution are heated to the
pre-determined temperature separately prior to the mixing. In some
embodiments, the lipid solution containing dissolved lipids and the
aqueous solution are mixed at the ambient temperature but then
heated to the pre-determined temperature after the mixing. In some
embodiments, the lipid solution containing dissolved lipids is
heated to the pre-determined temperature and mixed with an aqueous
solution at the ambient temperature. In some embodiments, the
aqueous solution is heated to the pre-determined temperature and
mixed with a lipid solution containing dissolved lipids at ambient
temperature. In some embodiments, no heating of one or more of the
solution comprising the pre-formed lipid nanoparticles, the
solution comprising the mRNA and the mixed solution comprising the
lipid nanoparticle encapsulated mRNA occurs before or after the
formulation process.
[0173] In some embodiments, the lipid solution and an aqueous or
buffer solution may be mixed using a pump. In some embodiments, an
mRNA solution and a pre-formed empty lipid nanoparticle solution
may be mixed using a pump. As the encapsulation procedure can occur
on a wide range of scales, different types of pumps may be used to
accommodate desired scale. It is however generally desired to use a
pulse-less flow pumps. As used herein, a pulse-less flow pump
refers to any pump that can establish a continuous flow with a
stable flow rate. Types of suitable pumps may include, but are not
limited to, gear pumps and centrifugal pumps. Exemplary gear pumps
include, but are not limited to, Cole-Parmer or Diener gear pumps.
Exemplary centrifugal pumps include, but are not limited to, those
manufactured by Grainger or Cole-Parmer.
[0174] An mRNA solution and a pre-formed empty lipid nanoparticle
solution may be mixed at various flow rates. Typically, the mRNA
solution may be mixed at a rate greater than that of the lipid
solution. For example, the mRNA solution may be mixed at a rate at
least 1.times., 2.times., 3.times., 4.times., 5.times., 6.times.,
7.times., 8.times., 9.times., 10.times., 15.times., or 20.times.
greater than the rate of the lipid solution.
[0175] Suitable flow rates for mixing may be determined based on
the scales. In some embodiments, an mRNA solution is mixed at a
flow rate ranging from about 40-400 ml/minute, 60-500 ml/minute,
70-600 ml/minute, 80-700 ml/minute, 90-800 ml/minute, 100-900
ml/minute, 110-1000 ml/minute, 120-1100 ml/minute, 130-1200
ml/minute, 140-1300 ml/minute, 150-1400 ml/minute, 160-1500
ml/minute, 170-1600 ml/minute, 180-1700 ml/minute, 150-250
ml/minute, 250-500 ml/minute, 500-1000 ml/minute, 1000-2000
ml/minute, 2000-3000 ml/minute, 3000-4000 ml/minute, or 4000-5000
ml/minute. In some embodiments, the mRNA solution is mixed at a
flow rate of about 200 ml/minute, about 500 ml/minute, about 1000
ml/minute, about 2000 ml/minute, about 3000 ml/minute, about 4000
ml/minute, or about 5000 ml/minute.
[0176] In some embodiments, a lipid solution or a pre-formed lipid
nanoparticle solution is mixed at a flow rate ranging from about
25-75 ml/minute, 20-50 ml/minute, 25-75 ml/minute, 30-90 ml/minute,
40-100 ml/minute, 50-110 ml/minute, 75-200 ml/minute, 200-350
ml/minute, 350-500 ml/minute, 500-650 ml/minute, 650-850 ml/minute,
or 850-1000 ml/minute. In some embodiments, the lipid solution is
mixed at a flow rate of about 50 ml/minute, about 100 ml/minute,
about 150 ml/minute, about 200 ml/minute, about 250 ml/minute,
about 300 ml/minute, about 350 ml/minute, about 400 ml/minute,
about 450 ml/minute, about 500 ml/minute, about 550 ml/minute,
about 600 ml/minute, about 650 ml/minute, about 700 ml/minute,
about 750 ml/minute, about 800 ml/minute, about 850 ml/minute,
about 900 ml/minute, about 950 ml/minute, or about 1000
ml/minute.
[0177] Typically, in some embodiments, a lipid solution containing
dissolved lipids, and an aqueous or buffer solution are mixed into
a solution such that the lipids can form nanoparticles without mRNA
(or empty pre-formed lipid nanoparticles). In some embodiments, an
mRNA solution and a pre-formed lipid nanoparticle solution are
mixed into a solution such that the mRNA becomes encapsulated in
the lipid nanoparticle. Such a solution is also referred to as a
formulation or encapsulation solution. A suitable formulation or
encapsulation solution includes a solvent such as ethanol. For
example, a suitable formulation or encapsulation solution includes
about 10% ethanol, about 15% ethanol, about 20% ethanol, about 25%
ethanol, about 30% ethanol, about 35% ethanol, or about 40%
ethanol.
[0178] In some embodiments, a suitable formulation or encapsulation
solution includes a solvent such as isopropyl alcohol. For example,
a suitable formulation or encapsulation solution includes about 10%
isopropyl alcohol, about 15% isopropyl alcohol, about 20% isopropyl
alcohol, about 25% isopropyl alcohol, about 30% isopropyl alcohol,
about 35% isopropyl alcohol, or about 40% isopropyl alcohol.
[0179] In some embodiments, a suitable formulation or encapsulation
solution includes a solvent such as dimethyl sulfoxide. For
example, a suitable formulation or encapsulation solution includes
about 10% dimethyl sulfoxide, about 15% dimethyl sulfoxide, about
20% dimethyl sulfoxide, about 25% dimethyl sulfoxide, about 30%
dimethyl sulfoxide, about 35% dimethyl sulfoxide, or about 40%
dimethyl sulfoxide.
[0180] In some embodiments, a suitable formulation or encapsulation
solution may also contain a buffering agent or salt. Exemplary
buffering agent may include HEPES, ammonium sulfate, sodium
bicarbonate, sodium citrate, sodium acetate, potassium phosphate
and sodium phosphate. Exemplary salt may include sodium chloride,
magnesium chloride, and potassium chloride. In some embodiments, an
empty pre-formed lipid nanoparticle formulation used in making this
novel nanoparticle formulation can be stably frozen in 10%
trehalose solution.
[0181] In some embodiments, an empty (i.e., empty of mRNA)
pre-formed lipid nanoparticle formulation used in making this novel
nanoparticle formulation can be stably frozen in about 5%, about
10%, about 15%, about 20%, about 25%, about 30%, about 35%, about
40%, about 45%, or about 50% trehalose solution. In some
embodiments, addition of mRNA to empty lipid nanoparticles can
result in a final formulation that does not require any downstream
purification or processing and can be stably stored in frozen
form.
[0182] In some embodiments, ethanol, citrate buffer, and other
destabilizing agents are absent during the addition of mRNA and
hence the formulation does not require any further downstream
processing. In some embodiments, the lipid nanoparticle formulation
prepared by this novel process consists of pre-formed lipid
nanoparticles in trehalose solution. The lack of destabilizing
agents and the stability of trehelose solution increase the ease of
scaling up the formulation and production of mRNA-encapsulated
lipid nanoparticles.
Purification
[0183] In some embodiments, the empty pre-formed lipid
nanoparticles or the lipid nanoparticles containing mRNA are
purified and/or concentrated. Various purification methods may be
used. In some embodiments, lipid nanoparticles are purified using
Tangential Flow Filtration. Tangential flow filtration (TFF), also
referred to as cross-flow filtration, is a type of filtration
wherein the material to be filtered is passed tangentially across a
filter rather than through it. In TFF, undesired permeate passes
through the filter, while the desired retentate passes along the
filter and is collected downstream. It is important to note that
the desired material is typically contained in the retentate in
TFF, which is the opposite of what one normally encounters in
traditional-dead end filtration.
[0184] Depending upon the material to be filtered, TFF is usually
used for either microfiltration or ultrafiltration. Microfiltration
is typically defined as instances where the filter has a pore size
of between 0.05 .mu.m and 1.0 .mu.m, inclusive, while
ultrafiltration typically involves filters with a pore size of less
than 0.05 .mu.m. Pore size also determines the nominal molecular
weight limits (NMWL), also referred to as the molecular weight cut
off (MWCO) for a particular filter, with microfiltration membranes
typically having NMWLs of greater than 1,000 kilodaltons (kDa) and
ultrafiltration filters having NMWLs of between 1 kDa and 1,000
kDa.
[0185] A principal advantage of tangential flow filtration is that
non-permeable particles that may aggregate in and block the filter
(sometimes referred to as "filter cake") during traditional
"dead-end" filtration, are instead carried along the surface of the
filter. This advantage allows tangential flow filtration to be
widely used in industrial processes requiring continuous operation
since down time is significantly reduced because filters do not
generally need to be removed and cleaned.
[0186] Tangential flow filtration can be used for several purposes
including concentration and diafiltration, among others.
Concentration is a process whereby solvent is removed from a
solution while solute molecules are retained. In order to
effectively concentrate a sample, a membrane having a NMWL or MWCO
that is substantially lower than the molecular weight of the solute
molecules to be retained is used. Generally, one of skill may
select a filter having a NMWL or MWCO of three to six times below
the molecular weight of the target molecule(s).
[0187] Diafiltration is a fractionation process whereby small
undesired particles are passed through a filter while larger
desired nanoparticles are maintained in the retentate without
changing the concentration of those nanoparticles in solution.
Diafiltration is often used to remove salts or reaction buffers
from a solution. Diafiltration may be either continuous or
discontinuous. In continuous diafiltration, a diafiltration
solution is added to the sample feed at the same rate that filtrate
is generated. In discontinuous diafiltration, the solution is first
diluted and then concentrated back to the starting concentration.
Discontinuous diafiltration may be repeated until a desired
concentration of nanoparticles is reached.
[0188] Purified and/or concentrated lipid nanoparticles may be
formulated in a desired buffer such as, for example, PBS.
Provided Nanoparticles Encapsulating mRNA
[0189] A process according to the present invention results in
higher potency and efficacy thereby allowing for lower doses
thereby shifting the therapeutic index in a positive direction. In
some embodiments, the process according to the present invention
results in homogeneous and small particle sizes (e.g., less than
150 nm), as well as significantly improved encapsulation efficiency
and/or mRNA recovery rate as compared to a prior art process.
[0190] Thus, the present invention provides a composition
comprising purified nanoparticles described herein. In some
embodiments, majority of purified nanoparticles in a composition,
i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have
a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135
nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about
110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about
85 nm, or about 80 nm). In some embodiments, substantially all of
the purified nanoparticles have a size of about 150 nm (e.g., about
145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm,
about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100
nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).
[0191] In addition, more homogeneous nanoparticles with narrow
particle size range are achieved by a process of the present
invention. For example, greater than about 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99% of the purified nanoparticles in a
composition provided by the present invention have a size ranging
from about 75-150 nm (e.g., about 75-145 nm, about 75-140 nm, about
75-135 nm, about 75-130 nm, about 75-125 nm, about 75-120 nm, about
75-115 nm, about 75-110 nm, about 75-105 nm, about 75-100 nm, about
75-95 nm, about 75-90 nm, or 75-85 nm). In some embodiments,
substantially all of the purified nanoparticles have a size ranging
from about 75-150 nm (e.g., about 75-145 nm, about 75-140 nm, about
75-135 nm, about 75-130 nm, about 75-125 nm, about 75-120 nm, about
75-115 nm, about 75-110 nm, about 75-105 nm, about 75-100 nm, about
75-95 nm, about 75-90 nm, or 75-85 nm).
[0192] In some embodiments, the dispersity, or measure of
heterogeneity in size of molecules (PDI), of nanoparticles in a
composition provided by the present invention is less than about
0.23 (e.g., less than about 0.23, 0.22, 0.21, 0.20, 0.19, 0.18,
0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.09, or 0.08). In
a particular embodiment, the PDI is less than about 0.16.
[0193] In some embodiments, greater than about 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles in a
composition provided by the present invention encapsulate an mRNA
within each individual particle. In some embodiments, substantially
all of the purified lipid nanoparticles in a composition
encapsulate an mRNA within each individual particle.
[0194] In some embodiments, a composition according to the present
invention contains at least about 1 mg, 5 mg, 10 mg, 100 mg, 500
mg, or 1000 mg of encapsulated mRNA. In some embodiments, a process
according to the present invention results in greater than about
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%
recovery of mRNA.
[0195] In some embodiments, a composition according to the present
invention is formulated so as to administer doses to a subject. In
some embodiments, a composition of mRNA lipid nanoparticles as
described herein is formulated at a dose concentration of less than
1.0 mg/kg mRNA lipid nanoparticles (e.g., 0.6 mg/kg, 0.5 mg/kg, 0.3
mg/kg, 0.016 mg/kg. 0.05 mg/kg, and 0.016 mg/kg. In some
embodiments, the dose is decreased due to the unexpected finding
that lower doses yield high potency and efficacy. In some
embodiments, the dose is decreased by about 70%, 65%, 60%, 55%,
50%, 45% or 40%.
[0196] In some embodiments, the potency of mRNA encapsulated lipid
nanoparticles produced by Process B is from more than 100% (i.e.,
more than 200%, more than 300%, more than 400%, more than 500%,
more than 600%, more than 700%, more than 800%, or more than 900%)
to more than 1000% more potent when prepared by Process B as
compared to Process A.
EXAMPLES
[0197] While certain compounds, compositions and methods of the
present invention have been described with specificity in
accordance with certain embodiments, the following examples serve
only to illustrate the invention and are not intended to limit the
same.
[0198] Lipid Materials
[0199] The formulations described in the following Examples, unless
otherwise specified, contain a multi-component lipid mixture of
varying ratios employing one or more cationic lipids, helper lipids
(e.g., non-cationic lipids and/or cholesterol lipids) and PEGylated
lipids designed to encapsulate various nucleic acid materials, as
discussed previously.
Example 1. Lipid Nanoparticle Formulation Process A
[0200] This example illustrates an exemplary lipid nanoparticle
formulation process for encapsulating mRNA. As used herein, Process
A refers to a conventional method of encapsulating mRNA by mixing
mRNA with a mixture of lipids, without first pre-forming the lipids
into lipid nanoparticles. As compared to Process B described below,
Process A does not involve pre-formation of lipid
nanoparticles.
[0201] An exemplary formulation Process A is shown in FIG. 1. In
this process, in some embodiments, the ethanol lipid solution and
the aqueous buffered solution of mRNA were prepared separately. A
solution of mixture of lipids (cationic lipid, helper lipids,
zwitterionic lipids, PEG lipids etc.) was prepared by dissolving
lipids in ethanol. The mRNA solution was prepared by dissolving the
mRNA in citrate buffer, resulting in mRNA at a concentration of
0.0833 mg/ml in citrate buffer with a pH of 4.5. As shown in FIG.
1, the mixtures were then both heated to 65.degree. C. prior to
mixing. Then, these two solutions were mixed using a pump system.
In some instances, the two solutions were mixed using a gear pump
system. In certain embodiments, the two solutions were mixing using
a `T` junction (or "Y" junction). The mixture was then purified by
diafiltration with a TFF process. The resultant formulation
concentrated and stored at 2-8.degree. C. until further use.
Example 2. Lipid Nanoparticle Formulation Process B with Pre-Formed
Lipid Nanoparticles
[0202] This example illustrates an exemplary Process B for
encapsulating mRNA. As used herein, Process B refers to a process
of encapsulating messenger RNA (mRNA) by mixing pre-formed lipid
nanoparticles with mRNA. A range of different conditions, such as
varying temperatures (i.e., heating or not heating the mixture),
buffers, and concentrations, may be employed in Process B. The
exemplary conditions described in this and other examples are for
illustration purposes only.
[0203] An exemplary formulation Process B is shown in FIG. 2. In
this process, in some embodiments, lipids dissolved in ethanol and
citrate buffer were mixed using a pump system. The instantaneous
mixing of the two streams resulted in the formation of empty lipid
nanoparticles, which was a self-assembly process. The resultant
formulation mixture was empty lipid nanoparticles in citrate buffer
containing alcohol. The formulation was then subjected to a TFF
purification process wherein buffer exchange occurred. The
resulting suspension of pre-formed empty lipid nanoparticles was
then mixed with mRNA using a pump system. For certain cationic
lipids, heating the solution post-mixing resulted in a higher
percentage of lipid nanoparticles containing mRNA and a higher
total yield of mRNA.
[0204] In addition, the effects of the presence of citrate buffer
during the addition of mRNA in the Process B were studied. Table 1
shows exemplary encapsulation efficiencies for lipid nanoparticle
formulation Process B with and without citrate buffer (pH 4.5).
Decreases in the encapsulation efficiency of mRNA were observed
when citrate buffer was present during the mixing of pre-formed
empty lipid nanoparticles and mRNA. In the presence of citrate
buffer, the encapsulation efficiencies for the lipid nanoparticle
formulation Process B were less than 60%. The encapsulation
efficiencies for the lipid nanoparticle formulation prepared by
Process B without citrate buffer were around or above 90%.
TABLE-US-00002 TABLE 1 Encapsulation efficiencies for lipid
nanoparticle formulation using Process B with and without citrate
buffer. Lipid nanoparticle Lipid nanoparticle formulation - Process
formulation - Process B in the absence of B in the presence of
Formulation citrate buffer citrate buffer 1 96 56 2 94 48 3 90 52 4
93 51
Example 3. In Vivo Activity of the Expressed hOTC in spf.sup.ash
Mice
[0205] This example illustrates that mRNA delivered via lipid
nanoparticles produced by Process B were unexpectedly more
effective than those produced by Process A.
[0206] In this example, OTC spf.sup.ash mice were administered a
single 0.5 mg/kg dose of hOTC mRNA encapsulated in lipid
nanoparticles prepared by Process A or Process B. The liver tissues
from these mice were analyzed 24 hours after administration for
citrulline production. The formulations were first tested directly
after mixing without storing, as well as tested after the mixture
of the formulation was stored for a period of 2.5 months at
-80.degree. C.
[0207] FIG. 3 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single 0.5 mg/kg dose of hOTC mRNA
encapsulated in lipid nanoparticle formulations made by Process A
or Process B.
[0208] Generally, the production of citrulline can be used to
evaluate the activity of the expressed hOTC protein. As shown in
FIG. 3, citrulline activity due to expressed hOTC protein in OTC
spf.sup.ash mice liver was measured 24 hours after the single dose
of the lipid nanoparticle mRNA formulation made by Process A and
Process B, respectively. The graph (i) in FIG. 3 illustrates the
citrulline activity due to expressed hOTC after the delivery of the
lipid nanoparticle mRNA formulation by Process A and Process B,
respectively, right after the mixture of the formulation and
without the storing time. Graph (ii) in FIG. 3 illustrates the
citrulline activity due to expressed hOTC after the delivery of the
lipid nanoparticle mRNA formulation by Process A and Process B,
respectively, after the mixture of the formulation was stored for a
period of 2.5 months at -80.degree. C.
[0209] The results shown in FIG. 3 indicate that the formulation
prepared by Process B with pre-formed empty lipid nanoparticles
resulted in about 3 times the citrulline activity of hOTC protein
when compared to the formulation prepared by Process A. As
evidenced by the similarity in the results shown in graphs (i) and
(ii), formulations produced by both Process A and by Process B
exhibited stability and functionality after extended storage at
-80.degree. C.
Example 4. In Vivo Activity of the Expressed hOTC in Spf.sup.ash
Mice Under Different Process B Parameters
[0210] This example illustrates that lipid nanoparticles produced
by Process B with different parameters, when delivered to
spf.sup.ash mice, lead to citrulline activity comparable to that
seen in wild type mice.
[0211] In this example, OTC spf.sup.ash mice were administered a
single 0.5 mg/kg dose of hOTC mRNA encapsulated in lipid
nanoparticles prepared by Process A or Process B. The liver tissues
from these mice were analyzed 24 hours after administration for
citrulline production. Four different lipid nanoparticle
formulations were produced by Process B, each prepared using a
different type of pump.
[0212] FIG. 4 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single 0.5 mg/kg dose of hOTC mRNA
encapsulated in lipid nanoparticle formulations made by Process A
or Process B. Lipid nanoparticle formulations made by Process B
were prepared (1) using gear pumps, (2) using peristaltic pumps,
(3) using peristaltic pumps at lower flow rates, and (4) using
peristaltic pumps at different flow rates of mRNA and empty
pre-formed lipid nanoparticles.
[0213] In some embodiments, the lipid nanoparticle formulations by
Process B can be prepared under different process parameters, as
shown in Table 2.
TABLE-US-00003 TABLE 2 Flow Rate of Empty Flow Rate Lipid
Nanoparticle of mRNA Process B Solution Solution Formulation Pump
System (mL/minute) (mL/minute) 1 Gear Pump 50 50 2 Peristaltic Pump
50 50 3 Peristaltic Pump 10 10 4 Peristaltic Pump 50 10
[0214] In some embodiments, different formulations prepared by
Process A and Process B formulations numbered 1-4 were tested in
vivo.
[0215] Generally, the production of citrulline can be used to
evaluate the activity of the expressed hOTC protein. As shown in
FIG. 4, citrulline activity of hOTC protein in OTC spf.sup.ash mice
liver was measured 24 hours after the single dose of a lipid
nanoparticle mRNA formulation made by either Process A or Process B
with different parameters.
[0216] As shown in FIG. 4, the exemplary data demonstrate that when
different lipid nanoparticle formulations made by Process B
(numbered 1-4) were administered to spf.sup.ash mice, the treatment
led to surprisingly high levels of citrulline activity of hOTC
protein that was comparable to that of wild type mice. At the same
dosage level (0.5 mg/kg) of OTC mRNA, the lipid nanoparticle
formulations prepared by Process B showed 2-4 times as much in vivo
activity as the formulation prepared by Process A.
Example 5. In Vitro ASS1 Expression in 293T Cells
[0217] This example illustrates that the lipid nanoparticles
prepared by Process B resulted in unexpectedly high protein
expression in transfected cells.
[0218] FIG. 5 depicts exemplary human ASS1 protein expression in
293T cells 16 hours post-transfection with either naked hASS1 mRNA
(with lipofectamine) or hASS1 mRNA-encapsulated lipid nanoparticles
(without lipofectamine) produced by Process A or Process B.
[0219] In this example, 293T cells were transfected with ASS1 mRNA
lipid nanoparticle formulations prepared by Process A or by Process
B. Either 1 .mu.g of ASS1 mRNA was transfected using lipofectamine
or 10 .mu.g of ASS1 mRNA encapsulated in lipid nanoparticle
formulations were transfected per 10.sup.6 cells for 24 hours. ASS1
protein expression was determined by ELISA.
[0220] As shown in FIG. 5, the lipid nanoparticle formulation
prepared by Process B lead to much higher levels of ASS1 protein
expression than the formulation prepared by Process A. The levels
of ASS1 protein expression resulting from transfection with lipid
nanoparticles prepared by Process B was comparable to the levels
resulting from transfection with an ASS1 mRNA-lipofectamine
complex. The ASS1 protein level per 10.sup.6 cells for the
mRNA-lipofectamine complex, lipid nanoparticle formulation--Process
A and lipid nanoparticle formulation--Process B was 12.43, 0.43 and
12.11 .mu.g respectively. The ASS1 protein level resulting from
transfection with a lipid nanoparticle formulation prepared by
Process B was 28 times that from transfection with a lipid
nanoparticle formulation prepared by Process A.
Example 6. In Vivo Expression of hCFTR in Rat Lungs
[0221] FIG. 6 shows exemplary immunohistochemical detection of
hCFTR protein in rat lungs 24 hours after nebulization of hCFTR
mRNA lipid nanoparticles prepared by Process B using different
cationic lipids.
[0222] Male Sprague-Dawley rats were administered, via
nebulization, lipid nanoparticle formulations containing hCFTR mRNA
prepared by Process B. The lipid nanoparticle formulations were
made using cKK-E12, ICE or Target 24 lipid as the cationic lipid.
The fixed lung tissues from these rats were analyzed for the
presence of hCFTR protein by immunohistochemical staining.
[0223] Protein was detected in both the bronchial epithelial cells
as well as the alveolar regions. Positive (brown) staining was
observed in all mRNA lipid nanoparticle test article groups, as
compared to the lack of brown staining in the lungs of
saline-treated control rats. Rats were dosed via nebulization with
(i) saline, (ii) lipid nanoparticle formulation of cKK-E12 lipid
prepared by Process B, (iii) lipid nanoparticle formulation of ICE
lipid prepared by Process B, or (iv) lipid nanoparticle formulation
of Target 24 lipid prepared by Process B.
Example 7. In Vivo Expression of hCFTR in Mice Lungs
[0224] FIG. 7 shows exemplary immunohistochemical detection of
hCFTR protein in mouse lungs 24 hours after nebulization of hCFTR
mRNA lipid nanoparticles prepared by Process B.
[0225] In this example, C57BL mice were administered, via
nebulization, lipid nanoparticles prepared by Process B that
comprised cKK-E12 and contained hCFTR mRNA. The fixed lung tissues
from these mice were analyzed for the presence of hCFTR protein by
immunohistochemical staining.
[0226] Protein was detected in both the bronchial epithelial cells
as well as the alveolar regions. Positive (brown) staining was
observed for the mRNA lipid nanoparticle test article group, as
compared to the lack of brown staining in the lungs of
saline-treated control mice.
Example 8. In Vivo Expression of Firefly Luciferase Protein in Mice
after Intravitreal Administration
[0227] This example illustrates exemplary methods of administering
firefly luciferase (FFL) mRNA-loaded lipid nanoparticles produced
by Process B and methods for analyzing firefly luciferase in target
tissues in vivo.
[0228] FIG. 8 depicts bioluminescent imaging of wild type mice 24
hours after intravitreal administration of FFL mRNA encapsulated in
lipid nanoparticles.
[0229] In this example, wild type mice were treated with lipid
nanoparticles encapsulating mRNA encoding FFL produced by Process B
via intravitreal administration. A solution containing 5 .mu.g of
FFL mRNA lipid nanoparticles was injected into the left eye of
mice. Luminescence was monitored 24 hours after injection.
[0230] The results shown in FIG. 8 indicate that significant
luminescence was observed, representing the successful production
of active FFL protein in the eyes of these mice. Furthermore,
sustained FFL activity was maintained for at least 24 hours.
Example 9. In Vivo Expression of Firefly Luciferase Protein in Mice
after Topical Ocular Application
[0231] This example illustrates exemplary methods of administering
firefly luciferase (FFL) mRNA-loaded lipid nanoparticles produced
by Process B and methods for analyzing firefly luciferase in target
tissues in vivo.
[0232] FIG. 9 depicts bioluminescent imaging of wild type mice 24
hours after topical application of eye drops containing FFL mRNA
encapsulated in a lipid nanoparticle formulated with polyvinyl
alcohol.
[0233] In this example, wild type mice were treated with lipid
nanoparticles encapsulating mRNA encoding FFL produced by Process B
via topical application (eye drops). A solution containing 5 .mu.g
of FFL mRNA lipid nanoparticles formulated with polyvinyl alcohol
was applied to the right eye of mice. Luminescence was monitored 24
hours after application.
[0234] The results shown in FIG. 9 indicate that significant
luminescence was observed, representing the successful production
of active FFL protein in the eyes of these mice. Furthermore,
sustained FFL activity was maintained for at least 24 hours.
Example 10. In Vivo Activity of PAH Expressed in Mice
[0235] In this example, phenylalanine hydroxylase (PAH) knockout
(KO) mice were administered a single subcutaneous injection of 20.0
mg/kg hPAH lipid nanoparticles produced by Process B. Phenylalanine
levels in the mice serum were measured 24 hours after
administration.
[0236] FIG. 10 shows exemplary serum phenylalanine levels in PAH KO
mice pre- and post-treatment with human PAH (hPAH) mRNA
encapsulated in lipid nanoparticles produced by Process B. Serum
samples were measured 24 hours after a single subcutaneous
administration.
[0237] The mRNA-derived hPAH protein was shown to be enzymatically
active, as demonstrated by measuring levels of serum phenylalanine
reduction using a custom ex vivo activity assay. Generally, the
reduction of serum phenylalanine can be used to evaluate the
activity of the potency (i.e., expressed PAH protein) and the
efficacy of the delivery method. As shown in FIG. 10, exemplary
serum phenylalanine levels in PAH KO mice were measured before and
24 hours after the single dose of the lipid nanoparticle
encapsulating hPAH mRNA formulation prepared by Process B that was
delivered subcutaneously. As a comparison, serum phenylalanine
levels in saline treated PAH KO mice were also measured.
[0238] The results shown in FIG. 10 indicate that the
subcutaneously injected lipid nanoparticle hPAH mRNA formulation
resulted in significant phenylalanine level reduction. There was
not a significant difference in phenylalanine levels in
saline-treated PAH KO mice before and after the dose.
Example 11. In Vivo Activity of OTC Expressed in Mice
[0239] This example shows a comparison of levels of OTC protein
activity in the livers of saline treated OTC KO spf.sup.ash mice
and OTC KO spf.sup.ash mice treated with subcutaneous
administration of hOTC mRNA-loaded lipid nanoparticles made by
Process B.
[0240] As shown in FIG. 11, exemplary citrulline production as a
result of expressed hOTC protein in the livers of OTC KO
spf.sup.ash mice was measured 24 hours after the single
subcutaneous dose of the lipid nanoparticle encapsulating hOTC mRNA
formulation made by Process B. In addition, as a comparison,
citrulline production in livers of OTC KO spf.sup.ash mice was
measured after saline was injected.
[0241] The results shown in FIG. 11 indicate that the
subcutaneously injected lipid nanoparticle hOTC mRNA formulation
made by Process B resulted in significant activity of the expressed
hOTC protein 24 hours post-dose compared with saline treated
diseased mice.
Example 12. In Vivo Expression of ASS1 in Mice
[0242] FIG. 12 depicts exemplary human ASS1 protein levels measured
in ASS1 KO mice liver 24 hours after a single subcutaneous
administration of lipid nanoparticle formulation encapsulating
hASS1 mRNA made by Process B.
[0243] Generally, the expressed hASS1 protein levels can be used to
evaluate the efficiency of the delivery method. As shown in FIG.
12, exemplary hASS1 protein level in ASS1 KO mice was measured 24
hours after the single subcutaneous dose of the lipid nanoparticle
encapsulating hASS1 mRNA formulation made by Process B. In
addition, as a comparison, hASS1 protein level in ASS1 KO mice
treated with saline was also measured.
[0244] The results shown in FIG. 12 indicate that subcutaneously
injected hASS1 mRNA lipid nanoparticle formulation made by Process
B resulted in significant hASS1 protein level in hASS1 KO mice 24
hours post-dose when compared with saline-treated hASS1 KO
mice.
Example 13. In Vivo Expression of hEPO in Mice Via Various Routes
of Administration
[0245] This example shows a comparison of expressed human EPO
(hEPO) in wild type mice after administration of hEPO mRNA
encapsulated in lipid nanoparticles made by Process B by various
routes. This example further illustrates a comparison of potency of
mRNA delivered via lipid nanoparticles produced by Process A and
Process B for intradermal and intramuscular administration at
various dose levels. It is shown that mRNA delivered via lipid
nanoparticles produced by process B were substantially more potent
than those produced by Process A at all dosages and time points,
whether delivered by intradermal or intramuscular routes of
administration assessed.
[0246] In this example, wild type mice were administered via
intradermal, subcutaneous, or intramuscular routes a single dose at
varying concentrations (i.e., 1 .mu.g, 10 .mu.g, or 50 .mu.g) of
hEPO mRNA encapsulated lipid nanoparticles produced by Process B.
Serum levels of hEPO protein were measured 6 hours and 24 hours
after administration. Additionally, wild type mice were
administered via intradermal or intramuscular routes a single dose
at varying concentrations (i.e., 1 .mu.g, 10 .mu.g, or 50 .mu.g) of
hEPO mRNA encapsulated lipid nanoparticles produced by Process A or
Process B. Serum levels of hEPO protein were measured 6 hours and
24 hours after administration.
[0247] FIG. 13 depicts exemplary hEPO protein levels measured in
the serum of treated mice 6 hours and 24 hours after a single
administration of hEPO mRNA formulation made by Process B. The
routes compared were administration by intradermal, subcutaneous or
intramuscular injection.
[0248] The levels of hEPO protein in the serum of mice after
treatment can be used to evaluate the potency of mRNA via the
different delivery methods. As shown in FIG. 13, exemplary hEPO
protein levels protein in mice sera were evaluated by ELISA 6 hours
and 24 hours after the single dose of the hEPO mRNA lipid
nanoparticle formulation made by Process B at 1 .mu.g, 10 .mu.g and
50 .mu.g. In addition, hEPO protein levels from intradermal,
subcutaneous and intramuscular routes of administration were
compared.
[0249] The results shown in FIG. 13 indicate that the hEPO mRNA
lipid nanoparticle formulation intramuscularly injected generally
resulted in highest levels of hEPO protein when compared to the
intradermal and subcutaneous routes. At 6 hours post-dose, hEPO
protein levels were slightly higher from subcutaneous
administration than from intradermal administration.
Comparison of mRNA Lipid Nanoparticles Produced by Process a and
Process B for Intradermal and Intramuscular Administration at
Various Dose Levels
[0250] FIG. 14 depicts a comparison of hEPO protein levels measured
in the serum of treated mice 6 hours and 24 hours after a single
intradermal dose of hEPO mRNA encapsulated in lipid nanoparticle
formulation made by Process A or Process B. FIG. 14 indicates that,
at all doses, the formulation prepared by Process B resulted in
about 2-4 times higher hEPO protein level expression as compared to
the formulation prepared by Process A.
[0251] FIG. 15 depicts a comparison of hEPO protein levels measured
in the serum of treated mice 6 hours and 24 hours after a single
intramuscular dose of hEPO mRNA encapsulated in lipid nanoparticle
formulation made by Process A or Process B. FIG. 15 indicates that,
at all doses, the formulation prepared by Process B resulted in
about 2-4 times higher hEPO protein level expression as compared to
the formulation prepared by Process A.
[0252] As shown in FIG. 14 and FIG. 15, hEPO protein levels protein
in mice sera were evaluated by ELISA 6 hours and 24 hours after the
single dose of the hEPO mRNA lipid nanoparticle formulation made by
Process A or Process B at 1 .mu.g, 10 .mu.g and 50 .mu.g via
intradermal and intramuscular administration, respectively. The
results show substantially higher potency of the mRNA encapsulated
lipid nanoparticles produced by Process B. It also was observed
that higher potency of the Process B formulation was associated
with various cells of the integumentary system (i.e., myocytes,
fibroblasts, macrophages, adipocytes, etc.).
Example 14. Protein Expression from mRNA Lipid Nanoparticles in an
Animal Model
[0253] This example illustrates significantly improved in vivo
protein expression with mRNA delivered via lipid nanoparticles
produced by Process B as compared to Process A, across a range of
dose levels.
[0254] In this study, male spf.sup.ash mice were treated with hOTC
mRNA lipid nanoparticles produced by Process A or by Process B, in
each case at four different dose levels (0.50 mg/kg, 0.16 mg/kg,
0.05 mg/kg, and 0.016 mg/kg). The test articles used throughout the
study were the same except for the noted differences in the lipid
nanoparticle production process (Process A versus Process B) and
dose.
[0255] The test articles were administered as a single dose via
tail vein injection. At 24 hours post administration mice were
presented with an ammonia challenge wherein a bolus injection of
ammonium chloride (5 mmol/kg NH.sub.4C1) was administered
intraperitoneally. Blood was collected 40 minutes after the
NH.sub.4Cl challenge by collecting aliquots of whole blood into
lithium heparin plasma tubes, which were processed to plasma and
plasma ammonia was analyzed using an IDEXX Catalyst Dx analyzer.
Then the animals were sacrificed, and their livers were harvested
and assessed for hOTC expression using sandwich ELISA.
[0256] FIG. 16 depicts a schematic of the ammonia challenge portion
of the study, which was performed to represent a hyperammonemic
episode that a patient suffering from OTC deficiency could
experience.
[0257] FIG. 17 shows the plasma ammonia levels of each of the
ammonia-challenged mice, particularly the wild-type mice having
normal murine OTC (WT), spf.sup.ash mice that received no hOTC mRNA
lipid nanoparticles (KO), and spf.sup.ash mice that received a
single dose of 0.5, 0.16, 0.05 or 0.016 mg/kg mRNA lipid
nanoparticles produced by Process B. As shown by the figure, a
statistically significant protection of the model hyperammonemic
episode was achieved at the 0.5 mg/kg and at the 0.16 mg/kg doses
of the hOTC mRNA lipid nanoparticles produced by Process B, as
compared to the marked elevations in plasma ammonia under identical
conditions for the spf.sup.ash mice that received no hOTC mRNA
lipid nanoparticles (KO). This data illustrates that mRNA lipid
nanoparticles produced by Process B and administered at doses of
0.5 mg/kg and at 0.16 mg/kg was effective for at least 24 hours
following administration in protecting against an ammonium chloride
challenge.
[0258] FIG. 18 and Table 3 show the hOTC protein levels from the
livers of the animals sacrificed at 24 hours post administration of
the hOTC mRNA lipid nanoparticles, as measured by sandwich ELISA.
As these results show, the hOTC protein expressed from livers of
mice treated with the mRNA lipid nanoparticles prepared by Process
B was nearly 1000% (i.e., ten times) higher than that from livers
of mice treated with the same mRNA lipid nanoparticles prepared by
Process A. Table 3 provides the particular amounts of hOTC protein
(as a percent of total protein) expressed from livers of mice
treated with the mRNA lipid nanoparticles prepared by Process A and
by Process B for all doses 24 hours following administration.
TABLE-US-00004 TABLE 3 In vivo hOTC protein expression measured 24
hours following administration of different doses (as shown) of
hOTC mRNA lipid nanoparticles formulated by Process A or Process B.
Avg. increase in .mu.g hOTC/mg .mu.g hOTC/mg hOTC expression Dose
protein protein from Process A (mg/kg) Process A Process B to
Process B 0.5 4.26 .+-. 1.90 35.12 .+-. 14.94 724% (8.2x) 0.16 0.73
.+-. 0.46 6.90 .+-. 1.61 845% (9.35x) 0.05 0.18 .+-. 0.19 2.01 .+-.
1.19 1016% (11.04x) 0.016 0.012 .+-. 0.006 0.126 .+-. 0.077 950%
(10.01x) Average across all doses 884% (9.65x)
[0259] As shown by Table 3, the amount of hOTC protein expressed
(as a percent of total protein) from livers of mice treated with
the mRNA lipid nanoparticles prepared by Process B exceeded by more
than about 700% (about 8.times.) and by up to about 1000% (about
11.times.) the amount of hOTC protein expressed (as a percent of
total protein) from livers of mice treated with the mRNA lipid
nanoparticles prepared by Process A, across all dosages at 24 hours
following administration. The overall average increase in the
amount of hOTC protein expressed (as a percent of total protein)
from livers of mice treated with the mRNA lipid nanoparticles
prepared by Process B versus by Process A was 884% (9.65.times.),
across all dosages at 24 hours following administration. This data
illustrates that mRNA lipid nanoparticles produced by Process B
were significantly more potent than the same mRNA lipid
nanoparticles produced by Process A, at all doses, at 24 hours
following administration.
[0260] FIG. 19 shows a comparison of hOTC protein amount in liver
tissue of OTC spf.sup.ash mice 24 hours after a single intravenous
injection of hOTC mRNA at various doses (i.e., 0.5 mg/kg, 0.16
mg/kg, 0.05 mg/kg, and 0.016 mg/kg) encapsulated in lipid
nanoparticle formulations made by Process A or Process B. As can be
seen in the figure, the formulation doses produced by Process B
resulted in more copies of hOTC mRNA per mg tissue than did the
formulation produced by Process A. FIG. 20 shows a comparison of
hOTC protein amount in RNA tested of OTC spf.sup.ash mice 24 hours
after a single intravenous injection of hOTC mRNA at various doses
(i.e., 0.5 mg/kg, 0.16 mg/kg, 0.05 mg/kg, and 0.016 mg/kg)
encapsulated in lipid nanoparticle formulations made by Process A
or Process B. As can be seen in the figure, the formulation doses
produced by Process B resulted in more copies of hOTC mRNA per
.mu.g RNA tested than did the formulation produced by Process
A.
Example 15. Duration of Activity by Protein Expressed from mRNA
Lipid Nanoparticles in an Animal Model
[0261] In this example, the activity of an exemplary protein
expressed in vivo from an mRNA lipid nanoparticle persisted for an
extended duration of at least 15 days.
[0262] In this study, male spf.sup.ash mice were administered via
single intravenous tail vein injection a dose of 1.0 mg/kg hOTC
mRNA lipid nanoparticles produced by Process B. At each timepoint
of 24 hours (Day 2), 48 hours (Day 3), 72 hours (Day 4), 96 hours
(Day 5), 8 days (Day 8), 11 days (Day 11), and 15 days (Day 15)
following administration a cohort of the mice were removed.
[0263] For each removed cohort, animals were subjected to an
ammonia challenge after which blood was collected for plasma
ammonia (.mu.mol/L) measurements. Then the animals were sacrificed
and citrulline (.mu.mol citrulline/hr/mg of total protein) and
urinary orotic acid (.mu.mol/mmol creatinine) were measured.
[0264] For the ammonia challenge and plasma ammonia measurements,
see FIG. 16 for a general schematic and Example 14 for a
description of this test.
[0265] For the citrulline measurements, mouse liver homogenate was
prepared and diluted in 1.times. DPBS then added into UltraPure
water. Citrulline standard was added in predetermined amounts to
serve as an internal reference. A reaction mix containing carbamoyl
phosphate, ornithine and triethanolamine was added and the reaction
was allowed to proceed at 37.degree. C. for 30 minutes. The
reaction was stopped with a mix of phosphoric and sulfuric acid,
and diacetylmonoxime was added. The sample was incubated at 85
degrees Celsius for 30 minutes, cooled briefly, and read at 490 nm
to quantify the citrulline against the citrulline standard.
[0266] For the urinary orotic acid measurements, orotic acid
quantification from animal urine samples was performed via Ultra
Performance Liquid Chromatography (UPLC) using an ion exchange
column. Briefly, urine samples were diluted two-fold using
RNase-free water and a portion was loaded onto a ThermoScientific
100.times. column. The mobile phase comprising acetonitrile and 25
mM ammonium acetate afforded separation and quantification of
orotic acid with detection based on absorbance at 280 nm.
[0267] FIG. 21 shows the plasma ammonia in animals 40 minutes after
being subjected to an ammonia challenge, for each of wildtype mice
(WT), untreated spf.sup.ash mice (Untreated), and spf.sup.ash mice
at 24 hours (Day 2), 48 hours (Day 3), 72 hours (Day 4), 96 hours
(Day 5), 8 days (Day 8), 11 days (Day 11), and 15 days (Day 15)
following administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles
produced by Process B. The dashed line represents the average
plasma ammonia level of the wild-type control group (WT). As can be
seen by the results depicted in the figure, a single dose of the
hOTC mRNA lipid nanoparticles provides significant protection
against hyperammonemia for at least 15 days. Specifically, the
plasma ammonia levels post challenge are comparable to wild type
levels (WT) or far less than untreated levels (Untreated) at all
the time points assessed out to 15 days.
[0268] FIG. 22 shows the hOTC protein activity as measured by
citrulline production in each of wildtype mice (WT), untreated
spf.sup.ash mice (Untreated), and spf.sup.ash mice at 24 hours (Day
2), 48 hours (Day 3), 72 hours (Day 4), 96 hours (Day 5), 8 days
(Day 8), 11 days (Day 11), and 15 days (Day 15) following
administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles produced
by Process B. As can be seen by the results depicted in the figure,
a single dose of hOTC mRNA lipid nanoparticles provides a resulting
citrulline level that exceeds or is comparable to the wild type
control (WT) and far exceeds the untreated control (Untreated) at
all the time points assessed out to 15 days.
[0269] FIG. 23 shows the hOTC protein activity as measured by
maintained low levels of urinary orotic acid production in each of
untreated spf.sup.ash mice (Untreated), spf.sup.ash mice at 24
hours (Day 2), 48 hours (Day 3), 72 hours (Day 4), 96 hours (Day
5), 8 days (Day 8), 11 days (Day 11), and 15 days (Day 15)
following administration of 1.0 mg/kg hOTC mRNA lipid nanoparticles
produced by Process B, and untreated wildtype mice (Untreated
C57BL/6). As can be seen by the results depicted in the figure, a
single dose of hOTC mRNA lipid nanoparticles provides a resulting
low level of urinary orotic acid that is less than or is comparable
to the wild type control (Untreated C57BL/6) and is far less than
the untreated spf.sup.ash mice (Untreated) at all the time points
assessed out to 15 days.
[0270] Taken together, the data in this example shows that a single
intravenous administration of an exemplary mRNA lipid nanoparticle
produced by Process B yields active protein that is active across
several measures for at least 15 days.
Example 16. In Vivo Activity of the Expressed hOTC in Spf.sup.ash
Mice at Various Doses
[0271] This example illustrates that hOTC mRNA, at three different
dose levels (1.0 mg/kg, 0.6 mg/kg, and 0.3 mg/kg), delivered via
lipid nanoparticles produced by Process B were unexpectedly more
potent than those produced by Process A at each dose evaluated.
[0272] In this example, OTC spf.sup.ash mice were administered a
single intravenous dose (at varying concentrations, i.e., 1 mg/kg,
0.6 mg/kg, or 0.3 mg/kg) of hOTC mRNA encapsulated in lipid
nanoparticles produced by Process A or Process B. The liver tissues
from these mice were analyzed 24 hours after administration for
citrulline production.
[0273] FIG. 24 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single intravenous dose of hOTC mRNA
encapsulated in lipid nanoparticle formulations made by Process A
or Process B. The hOTC mRNA was administered at different dosing
levels of 1.0 mg/kg, 0.6 mg/kg, and 0.3 mg/kg.
[0274] Generally, the production of citrulline can be used to
evaluate the activity of the expressed hOTC protein. As shown in
FIG. 24, citrulline activity due to expressed hOTC protein in OTC
spf.sup.ash mice liver was measured 24 hours after the single dose
of the lipid nanoparticle mRNA formulation made by Process A and
Process B, respectively, at various dose levels. The graph in FIG.
24 illustrates the citrulline activity due to expressed hOTC after
the delivery of the lipid nanoparticle mRNA formulation by Process
A and Process B, formulated per the processes described above.
[0275] The results shown in FIG. 24 indicate that the formulation
prepared by Process B with pre-formed empty lipid nanoparticles
resulted in higher citrulline activity of hOTC protein when
compared to the formulation prepared by Process A.
[0276] FIG. 25 depicts the immunohistochemical detection of hOTC
protein in the mice livers by Western blot images after the single
intravenous dose of hOTC mRNA encapsulated in lipid nanoparticle
formulations made by Process A or Process B at various dosing
levels (i.e., 1.0 mg/kg, 0.6 mg/kg, and 0.3 mg/kg). As shown in the
Figure, at all three doses, the hOTC protein expressed was higher
for the group dosed by lipid nanoparticle formulation made by
Process B as compared to Process A, as evidenced by intensity of
the bands.
Example 17. In Vivo Activity of the Expressed hOTC in spf.sup.ash
Mice
[0277] This example illustrates that hOTC mRNA delivered via lipid
nanoparticles produced by Process B were unexpectedly more
effective than those produced by Process A.
[0278] FIG. 26 depicts exemplary activity of expressed hOTC protein
(in terms of citrulline production) in livers of OTC spf.sup.ash
mice 24 hours after a single intravenous 0.5 mg/kg dose of hOTC
mRNA encapsulated in lipid nanoparticle formulations made by
Process A or Process B.
[0279] Generally, the production of citrulline can be used to
evaluate the activity of the expressed hOTC protein. As shown in
FIG. 26, citrulline activity due to expressed hOTC protein in OTC
spf.sup.ash mice liver was measured 24 hours after the dose was
administered and the results indicate that, at equal doses, the
formulation prepared by Process B resulted in higher citrulline
activity of hOTC protein as compared to the formulation prepared by
Process A.
[0280] FIG. 27(a)-(d) shows the immunohistochemical detection of
hOTC protein in mouse livers 24 hours after dosing of hOTC mRNA
lipid nanoparticles prepared by Process A or Process B via
immunohistochemical staining. As can be seen in the Figure, the
staining of hOTC protein is stronger for the mice group dosed with
LMP formulation prepared by Process B (FIG. 27(a)-(b)), as compared
to Process A (FIG. 27(c)-(d)). The results shown in FIG. 27(a)-(d)
agree with the higher citrulline production of the dose of the
formulation prepared by Process B as compared to Process A, as
depicted in FIG. 26.
Example 18. In Vivo Expression of mRNA Lipid Nanoparticle
Formulations Prepared by Process B and Process A Using Different
Cationic Lipids
[0281] This example illustrates that EPO mRNA delivered via lipid
nanoparticles (consisting of a variety of different cationic
lipids) produced by Process B were unexpectedly more effective than
those produced by Process A.
[0282] In this study, male CD1 mice were administered on Day 1 a
single intravenous tail vein injection at a dose of 1.0 mg/kg hEPO
mRNA lipid nanoparticles each prepared using one of five different
cationic lipids and produced by Process A or by Process B (as
described earlier).
[0283] Table 4 provides the particular hEPO protein expression
levels as measured in the serum of the animals sacrificed at 6
hours post administration of the hEPO mRNA lipid nanoparticles each
prepared using one of five different cationic lipids and produced
by Process A or by Process B, as measured by ELISA. As these
results show, the hEPO protein expressed, as measured in the serum
of the mice, from the mRNA lipid nanoparticles prepared by Process
B was substantially higher than the same mRNA lipid nanoparticles
prepared by Process A, across all the different cationic lipids
evaluated. The percent increase ranged from 133% to 603%, with a
consistent increase of greater than 100% potency observed across
the 5 different lipids tested in the study.
[0284] FIG. 28 depicts hEPO protein expression after the delivery
of the lipid nanoparticle mRNA formulation produced by Process A
and Process B, formulated using HGT 5001 as the cationic lipid.
FIG. 29 depicts hEPO protein expression after the delivery of the
lipid nanoparticle mRNA formulation produced by Process A and
Process B, formulated using ICE as the cationic lipid. FIG. 30
depicts hEPO protein expression after the delivery of the lipid
nanoparticle mRNA formulation produced by Process A and Process B,
formulated using cKK-E12 as the cationic lipid. FIG. 31 depicts
hEPO protein expression after the delivery of the lipid
nanoparticle mRNA formulation produced by Process A and Process B,
formulated using C12-200 as the cationic lipid. FIG. 32 depicts
hEPO protein expression after the delivery of the lipid
nanoparticle mRNA formulation produced by Process A and Process B,
formulated using HGT 4003 as the cationic lipid. As the results in
each of these FIGS. 28-32 graphs show, the hEPO protein expressed,
as measured in the serum of the mice, from the mRNA lipid
nanoparticles prepared by Process B was substantially higher than
the same mRNA lipid nanoparticles prepared by Process A, across all
five different cationic lipids evaluated.
TABLE-US-00005 TABLE 4 In vivo Human EPO protein expression
measured in mouse serum 6 hours following administration of hEPO
mRNA lipid nanoparticles (across a variety of cationic lipids)
formulated by Process A or Process B. Human EPO protein measured in
mouse serum 6 hours post dosing (.mu.g/mL) Lipid Process A Process
B % increase HGT 5001 1.33 .+-. 0.56 8.83 .+-. 4.63 565% ICE 0.0048
.+-. 0.002 0.0181 .+-. 0.008 279% cKK-E12 16.82 .+-. 5.92 118.4
.+-. 21.3 603% C12-200 25.7 .+-. 4.9 71.3 .+-. 11.3 176% HGT 4003
0.073 .+-. 0.008 0.172 .+-. 0.027 133%
[0285] Table 5 depicts structural details of hEPO lipid
nanoparticles prepared by Process A or Process B, using various
cationic lipids. In particular, Table 5 depicts nanoparticle size
(nm) and PdI of hEPO lipid nanoparticles when different cationic
lipids are employed, as prepared by Process A or Process B. As
shown in the Table, the nanoparticle sizes of hEPO mRNA lipid
nanoparticles prepared by Process B were between about 90 nm and
150 nm across all nanoparticles prepared using the five different
cationic lipids evaluated whereas those prepared by Process A were
between about 75 nm and 95 nm across all nanoparticles prepared
using the five cationic lipids evaluated.
TABLE-US-00006 TABLE 5 Concentration Size Group # Cationic Lipid
(mg/ml) Type (nm) PdI 1 N/A (Saline) N/A N/A N/A N/A 2 HGT5001 0.2
Process A 85.21 0.26 3 HGT 5001 0.2 Process B 128.3 0.16 4 ICE 0.2
Process A 79.02 0.27 5 ICE 0.2 Process B 147.4 0.23 6 cKK-E12 0.2
Process A 91.55 0.19 7 cKK-E12 0.2 Process B 126 0.16 8 C12-200 0.2
Process A 77.12 0.204 9 C12-200 0.2 Process B 116 0.18 10 HGT4003
0.2 Process A 89.31 0.2 11 HGT4003 0.2 Process B 91.05 0.16
[0286] Taken together, the data in this example shows that there is
a substantial increase in potency for mRNA lipid nanoparticles
produced by Process B as compared to by Process A, across lipid
nanoparticles comprising various different lipid components.
EQUIVALENTS
[0287] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. The scope of the present invention is not intended to be
limited to the above Description, but rather is as set forth in the
following claims:
Sequence CWU 1
1
511065RNAArtificial Sequencechemically synthesized oligonucleotide
1augcuguuca accuucggau cuugcugaac aacgcugcgu uccggaaugg ucacaacuuc
60augguccgga acuucagaug cggccagccg cuccagaaca aggugcagcu caaggggagg
120gaccuccuca cccugaaaaa cuucaccgga gaagagauca aguacaugcu
guggcuguca 180gccgaccuca aauuccggau caagcagaag ggcgaauacc
uuccuuugcu gcagggaaag 240ucccugggga ugaucuucga gaagcgcagc
acucgcacua gacugucaac ugaaaccggc 300uucgcgcugc ugggaggaca
ccccugcuuc cugaccaccc aagauaucca ucugggugug 360aacgaauccc
ucaccgacac agcgcgggug cugucgucca uggcagacgc gguccucgcc
420cgcguguaca agcagucuga ucuggacacu cuggccaagg aagccuccau
uccuaucauu 480aauggauugu ccgaccucua ccaucccauc cagauucugg
ccgauuaucu gacucugcaa 540gaacauuaca gcucccugaa ggggcuuacc
cuuucgugga ucggcgacgg caacaacauu 600cugcacagca uuaugaugag
cgcugccaag uuuggaaugc accuccaagc agcgaccccg 660aagggauacg
agccagacgc cuccgugacg aagcuggcug agcaguacgc caaggagaac
720ggcacuaagc ugcugcucac caacgacccu cucgaagccg cccacggugg
caacgugcug 780aucaccgaua ccuggaucuc caugggacag gaggaggaaa
agaagaagcg ccugcaagca 840uuucaggggu accaggugac uaugaaaacc
gccaaggucg ccgccucgga cuggaccuuc 900uugcacuguc ugcccagaaa
gcccgaagag guggacgacg agguguucua cagcccgcgg 960ucgcuggucu
uuccggaggc cgaaaacagg aaguggacua ucauggccgu gauggugucc
1020cugcugaccg auuacucccc gcagcugcag aaaccaaagu ucuga
106521239RNAArtificial Sequencechemically synthesized
oligonucleotide 2augagcagca agggcagcgu ggugcuggcc uacagcggcg
gccuggacac cagcugcauc 60cugguguggc ugaaggagca gggcuacgac gugaucgccu
accuggccaa caucggccag 120aaggaggacu ucgaggaggc ccgcaagaag
gcccugaagc ugggcgccaa gaagguguuc 180aucgaggacg ugagccgcga
guucguggag gaguucaucu ggcccgccau ccagagcagc 240gcccuguacg
aggaccgcua ccugcugggc accagccugg cccgccccug caucgcccgc
300aagcaggugg agaucgccca gcgcgagggc gccaaguacg ugagccacgg
cgccaccggc 360aagggcaacg accaggugcg cuucgagcug agcugcuaca
gccuggcccc ccagaucaag 420gugaucgccc ccuggcgcau gcccgaguuc
uacaaccgcu ucaagggccg caacgaccug 480auggaguacg ccaagcagca
cggcaucccc auccccguga cccccaagaa ccccuggagc 540auggacgaga
accugaugca caucagcuac gaggccggca uccuggagaa ccccaagaac
600caggcccccc ccggccugua caccaagacc caggaccccg ccaaggcccc
caacaccccc 660gacauccugg agaucgaguu caagaagggc gugcccguga
aggugaccaa cgugaaggac 720ggcaccaccc accagaccag ccuggagcug
uucauguacc ugaacgaggu ggccggcaag 780cacggcgugg gccgcaucga
caucguggag aaccgcuuca ucggcaugaa gagccgcggc 840aucuacgaga
cccccgccgg caccauccug uaccacgccc accuggacau cgaggccuuc
900accauggacc gcgaggugcg caagaucaag cagggccugg gccugaaguu
cgccgagcug 960guguacaccg gcuucuggca cagccccgag ugcgaguucg
ugcgccacug caucgccaag 1020agccaggagc gcguggaggg caaggugcag
gugagcgugc ugaagggcca gguguacauc 1080cugggccgcg agagcccccu
gagccuguac aacgaggagc uggugagcau gaacgugcag 1140ggcgacuacg
agcccaccga cgccaccggc uucaucaaca ucaacagccu gcgccugaag
1200gaguaccacc gccugcagag caaggugacc gccaaguga
123934443RNAArtificial Sequencechemically synthesized
oligonucleotide 3augcaacgcu cuccucuuga aaaggccucg guggugucca
agcucuucuu cucguggacu 60agacccaucc ugagaaaggg guacagacag cgcuuggagc
uguccgauau cuaucaaauc 120ccuuccgugg acuccgcgga caaccugucc
gagaagcucg agagagaaug ggacagagaa 180cucgccucaa agaagaaccc
gaagcugauu aaugcgcuua ggcggugcuu uuucuggcgg 240uucauguucu
acggcaucuu ccucuaccug ggagagguca ccaaggccgu gcagccccug
300uugcugggac ggauuauugc cuccuacgac cccgacaaca aggaagaaag
aagcaucgcu 360aucuacuugg gcaucggucu gugccugcuu uucaucgucc
ggacccucuu guugcauccu 420gcuauuuucg gccugcauca cauuggcaug
cagaugagaa uugccauguu uucccugauc 480uacaagaaaa cucugaagcu
cucgagccgc gugcuugaca agauuuccau cggccagcuc 540gugucccugc
ucuccaacaa ucugaacaag uucgacgagg gccucgcccu ggcccacuuc
600guguggaucg ccccucugca aguggcgcuu cugaugggcc ugaucuggga
gcugcugcaa 660gccucggcau ucugugggcu uggauuccug aucgugcugg
cacuguucca ggccggacug 720gggcggauga ugaugaagua cagggaccag
agagccggaa agauuuccga acggcuggug 780aucacuucgg aaaugaucga
aaacauccag ucagugaagg ccuacugcug ggaagaggcc 840auggaaaaga
ugauugaaaa ccuccggcaa accgagcuga agcugacccg caaggccgcu
900uacgugcgcu auuucaacuc guccgcuuuc uucuucuccg gguucuucgu
gguguuucuc 960uccgugcucc ccuacgcccu gauuaaggga aucauccuca
ggaagaucuu caccaccauu 1020uccuucugua ucgugcuccg cauggccgug
acccggcagu ucccaugggc cgugcagacu 1080ugguacgacu cccugggagc
cauuaacaag auccaggacu uccuucaaaa gcaggaguac 1140aagacccucg
aguacaaccu gacuacuacc gaggucguga uggaaaacgu caccgccuuu
1200ugggaggagg gauuuggcga acuguucgag aaggccaagc agaacaacaa
caaccgcaag 1260accucgaacg gugacgacuc ccucuucuuu ucaaacuuca
gccugcucgg gacgcccgug 1320cugaaggaca uuaacuucaa gaucgaaaga
ggacagcucc uggcgguggc cggaucgacc 1380ggagccggaa agacuucccu
gcugauggug aucaugggag agcuugaacc uagcgaggga 1440aagaucaagc
acuccggccg caucagcuuc uguagccagu uuuccuggau caugcccgga
1500accauuaagg aaaacaucau cuucggcgug uccuacgaug aauaccgcua
ccgguccgug 1560aucaaagccu gccagcugga agaggauauu ucaaaguucg
cggagaaaga uaacaucgug 1620cugggcgaag gggguauuac cuugucgggg
ggccagcggg cuagaaucuc gcuggccaga 1680gccguguaua aggacgccga
ccuguaucuc cuggacuccc ccuucggaua ccuggacguc 1740cugaccgaaa
aggagaucuu cgaaucgugc gugugcaagc ugauggcuaa caagacucgc
1800auccucguga ccuccaaaau ggagcaccug aagaaggcag acaagauucu
gauucugcau 1860gagggguccu ccuacuuuua cggcaccuuc ucggaguugc
agaacuugca gcccgacuuc 1920ucaucgaagc ugauggguug cgacagcuuc
gaccaguucu ccgccgaaag aaggaacucg 1980auccugacgg aaaccuugca
ccgcuucucu uuggaaggcg acgccccugu gucauggacc 2040gagacuaaga
agcagagcuu caagcagacc ggggaauucg gcgaaaagag gaagaacagc
2100aucuugaacc ccauuaacuc cauccgcaag uucucaaucg ugcaaaagac
gccacugcag 2160augaacggca uugaggagga cuccgacgaa ccccuugaga
ggcgccuguc ccuggugccg 2220gacagcgagc agggagaagc cauccugccu
cggauuuccg ugaucuccac ugguccgacg 2280cuccaagccc ggcggcggca
guccgugcug aaccugauga cccacagcgu gaaccagggc 2340caaaacauuc
accgcaagac uaccgcaucc acccggaaag ugucccuggc accucaagcg
2400aaucuuaccg agcucgacau cuacucccgg agacugucgc aggaaaccgg
gcucgaaauu 2460uccgaagaaa ucaacgagga ggaucugaaa gagugcuucu
ucgacgauau ggagucgaua 2520cccgccguga cgacuuggaa cacuuaucug
cgguacauca cugugcacaa gucauugauc 2580uucgugcuga uuuggugccu
ggugauuuuc cuggccgagg ucgcggccuc acugguggug 2640cucuggcugu
ugggaaacac gccucugcaa gacaagggaa acuccacgca cucgagaaac
2700aacagcuaug ccgugauuau cacuuccacc uccucuuauu acguguucua
caucuacguc 2760ggaguggcgg auacccugcu cgcgaugggu uucuucagag
gacugccgcu gguccacacc 2820uugaucaccg ucagcaagau ucuucaccac
aagauguugc auagcgugcu gcaggccccc 2880auguccaccc ucaacacucu
gaaggccgga ggcauucuga acagauucuc caaggacauc 2940gcuauccugg
acgaucuccu gccgcuuacc aucuuugacu ucauccagcu gcugcugauc
3000gugauuggag caaucgcagu gguggcggug cugcagccuu acauuuucgu
ggccacugug 3060ccggucauug uggcguucau caugcugcgg gccuacuucc
uccaaaccag ccagcagcug 3120aagcaacugg aauccgaggg acgauccccc
aucuucacuc accuugugac gucguugaag 3180ggacugugga cccuccgggc
uuucggacgg cagcccuacu ucgaaacccu cuuccacaag 3240gcccugaacc
uccacaccgc caauugguuc cuguaccugu ccacccugcg gugguuccag
3300augcgcaucg agaugauuuu cgucaucuuc uucaucgcgg ucacauucau
cagcauccug 3360acuaccggag agggagaggg acgggucgga auaauccuga
cccucgccau gaacauuaug 3420agcacccugc agugggcagu gaacagcucg
aucgacgugg acagccugau gcgaagcguc 3480agccgcgugu ucaaguucau
cgacaugccu acugagggaa aacccacuaa guccacuaag 3540cccuacaaaa
auggccagcu gagcaagguc augaucaucg aaaacuccca cgugaagaag
3600gacgauauuu ggcccuccgg aggucaaaug accgugaagg accugaccgc
aaaguacacc 3660gagggaggaa acgccauucu cgaaaacauc agcuucucca
uuucgccggg acagcggguc 3720ggccuucucg ggcggaccgg uuccgggaag
ucaacucugc ugucggcuuu ccuccggcug 3780cugaauaccg agggggaaau
ccaaauugac ggcgugucuu gggauuccau uacucugcag 3840caguggcgga
aggccuucgg cgugaucccc cagaaggugu ucaucuucuc ggguaccuuc
3900cggaagaacc uggauccuua cgagcagugg agcgaccaag aaaucuggaa
ggucgccgac 3960gaggucggcc ugcgcuccgu gauugaacaa uuuccuggaa
agcuggacuu cgugcucguc 4020gacgggggau guguccuguc gcacggacau
aagcagcuca ugugccucgc acgguccgug 4080cucuccaagg ccaagauucu
gcugcuggac gaaccuucgg cccaccugga uccggucacc 4140uaccagauca
ucaggaggac ccugaagcag gccuuugccg auugcaccgu gauucucugc
4200gagcaccgca ucgaggccau gcuggagugc cagcaguucc uggucaucga
ggagaacaag 4260guccgccaau acgacuccau ucaaaagcuc cucaacgagc
ggucgcuguu cagacaagcu 4320auuucaccgu ccgauagagu gaagcucuuc
ccgcaucgga acagcucaaa gugcaaaucg 4380aagccgcaga ucgcagccuu
gaaggaagag acugaggaag aggugcagga cacccggcuu 4440uaa
444344443RNAArtificial Sequencechemically synthesized
oligonucleotide 4augcagcggu ccccgcucga aaaggccagu gucgugucca
aacucuucuu cucauggacu 60cggccuaucc uuagaaaggg guaucggcag aggcuugagu
ugucugacau cuaccagauc 120cccucgguag auucggcgga uaaccucucg
gagaagcucg aacgggaaug ggaccgcgaa 180cucgcgucua agaaaaaccc
gaagcucauc aacgcacuga gaaggugcuu cuucuggcgg 240uucauguucu
acgguaucuu cuuguaucuc ggggagguca caaaagcagu ccaaccccug
300uuguuggguc gcauuaucgc cucguacgac cccgauaaca aagaagaacg
gagcaucgcg 360aucuaccucg ggaucggacu guguuugcuu uucaucguca
gaacacuuuu guugcaucca 420gcaaucuucg gccuccauca caucgguaug
cagaugcgaa ucgcuauguu uagcuugauc 480uacaaaaaga cacugaaacu
cucgucgcgg guguuggaua agauuuccau cggucaguug 540gugucccugc
uuaguaauaa ccucaacaaa uucgaugagg gacuggcgcu ggcacauuuc
600guguggauug ccccguugca agucgcccuu uugaugggcc uuauuuggga
gcuguugcag 660gcaucugccu uuuguggccu gggauuucug auuguguugg
cauuguuuca ggcugggcuu 720gggcggauga ugaugaagua ucgcgaccag
agagcgggua aaaucucgga aagacucguc 780aucacuucgg aaaugaucga
aaacauccag ucggucaaag ccuauugcug ggaagaagcu 840auggagaaga
ugauugaaaa ccuccgccaa acugagcuga aacugacccg caaggcggcg
900uauguccggu auuucaauuc gucagcguuc uucuuuuccg gguucuucgu
ugucuuucuc 960ucgguuuugc cuuaugccuu gauuaagggg auuauccucc
gcaagauuuu caccacgauu 1020ucguucugca uuguauugcg cauggcagug
acacggcaau uuccgugggc cgugcagaca 1080ugguaugacu cgcuuggagc
gaucaacaaa auccaagacu ucuugcaaaa gcaagaguac 1140aagacccugg
aguacaaucu uacuacuacg gagguaguaa uggagaaugu gacggcuuuu
1200ugggaagagg guuuuggaga acuguuugag aaagcaaagc agaauaacaa
caaccgcaag 1260accucaaaug gggacgauuc ccuguuuuuc ucgaacuucu
cccugcucgg aacacccgug 1320uugaaggaca ucaauuucaa gauugagagg
ggacagcuuc ucgcgguagc gggaagcacu 1380ggugcgggaa aaacuagccu
cuugauggug auuauggggg agcuugagcc cagcgagggg 1440aagauuaaac
acuccgggcg uaucucauuc uguagccagu uuucauggau caugcccgga
1500accauuaaag agaacaucau uuucggagua uccuaugaug aguaccgaua
cagaucgguc 1560auuaaggcgu gccaguugga agaggacauu ucuaaguucg
ccgagaagga uaacaucguc 1620uugggagaag gggguauuac auugucggga
gggcagcgag cgcggaucag ccucgcgaga 1680gcgguauaca aagaugcaga
uuuguaucug cuugauucac cguuuggaua ccucgacgua 1740uugacagaaa
aagaaaucuu cgagucgugc guguguaaac uuauggcuaa uaagacgaga
1800auccugguga caucaaaaau ggaacaccuu aagaaggcgg acaagauccu
gauccuccac 1860gaaggaucgu ccuacuuuua cggcacuuuc ucagaguugc
aaaacuugca gccggacuuc 1920ucaagcaaac ucauggggug ugacucauuc
gaccaguuca gcgcggaacg gcggaacucg 1980aucuugacgg aaacgcugca
ccgauucucg cuugagggug augccccggu aucguggacc 2040gagacaaaga
agcagucguu uaagcagaca ggagaauuug gugagaaaag aaagaacagu
2100aucuugaauc cuauuaacuc aauucgcaag uucucaaucg uccagaaaac
uccacugcag 2160augaauggaa uugaagagga uucggacgaa ccccuggagc
gcaggcuuag ccucgugccg 2220gauucagagc aaggggaggc cauucuuccc
cggauuucgg ugauuucaac cggaccuaca 2280cuucaggcga ggcgaaggca
auccgugcuc aaccucauga cgcauucggu aaaccagggg 2340caaaacauuc
accgcaaaac gacggccuca acgagaaaag ugucacuugc accccaggcg
2400aauuugacug aacucgacau cuacagccgu aggcuuucgc aagaaaccgg
acuugagauc 2460agcgaagaaa ucaaugaaga agauuugaaa gaguguuucu
uugaugacau ggaaucaauc 2520ccagcgguga caacguggaa cacauacuug
cguuacauca cggugcacaa guccuugauu 2580uucguccuca ucuggugucu
cgugaucuuu cucgcugagg ucgcagcguc acuugugguc 2640cucuggcugc
uugguaauac gcccuugcaa gacaaaggca auucuacaca cucaagaaac
2700aauuccuaug ccgugauuau cacuucuaca agcucguauu acguguuuua
caucuacgua 2760ggaguggccg acacucugcu cgcgaugggu uucuuccgag
gacucccacu cguucacacg 2820cuuaucacug ucuccaagau ucuccaccau
aagaugcuuc auagcguacu gcaggcuccc 2880auguccaccu ugaauacgcu
caaggcggga gguauuuuga aucgcuucuc aaaagauauu 2940gcaauuuugg
augaccuucu gccccugacg aucuucgacu ucauccaguu guugcugauc
3000gugauugggg cuauugcagu agucgcuguc cuccagccuu acauuuuugu
cgcgaccguu 3060ccggugaucg uggcguuuau caugcugcgg gccuauuucu
ugcagacguc acagcagcuu 3120aagcaacugg agucugaagg gaggucgccu
aucuuuacgc aucuugugac caguuugaag 3180ggauugugga cguugcgcgc
cuuuggcagg cagcccuacu uugaaacacu guuccacaaa 3240gcgcugaauc
uccauacggc aaauugguuu uuguauuuga guacccuccg augguuucag
3300augcgcauug agaugauuuu ugugaucuuc uuuaucgcgg ugacuuuuau
cuccaucuug 3360accacgggag agggcgaggg acgggucggu auuauccuga
cacucgccau gaacauuaug 3420agcacuuugc agugggcagu gaacagcucg
auugaugugg auagccugau gagguccguu 3480ucgagggucu uuaaguucau
cgacaugccg acggagggaa agcccacaaa aaguacgaaa 3540cccuauaaga
augggcaauu gaguaaggua augaucaucg agaacaguca cgugaagaag
3600gaugacaucu ggccuagcgg gggucagaug accgugaagg accugacggc
aaaauacacc 3660gagggaggga acgcaauccu ugaaaacauc ucguucagca
uuagccccgg ucagcgugug 3720ggguugcucg ggaggaccgg gucaggaaaa
ucgacguugc ugucggccuu cuugagacuu 3780cugaauacag agggugagau
ccagaucgac ggcguuucgu gggauagcau caccuugcag 3840caguggcgga
aagcguuugg aguaaucccc caaaaggucu uuaucuuuag cggaaccuuc
3900cgaaagaauc ucgauccuua ugaacagugg ucagaucaag agauuuggaa
agucgcggac 3960gagguuggcc uucggagugu aaucgagcag uuuccgggaa
aacucgacuu uguccuugua 4020gaugggggau gcguccuguc gcaugggcac
aagcagcuca ugugccuggc gcgauccguc 4080cucucuaaag cgaaaauucu
ucucuuggau gaaccuucgg cccaucugga cccgguaacg 4140uaucagauca
ucagaaggac acuuaagcag gcguuugccg acugcacggu gauucucugu
4200gagcaucgua ucgaggccau gcucgaaugc cagcaauuuc uugucaucga
agagaauaag 4260guccgccagu acgacuccau ccagaagcug cuuaaugaga
gaucauuguu ccggcaggcg 4320auuucaccau ccgauagggu gaaacuuuuu
ccacacagaa auucgucgaa gugcaagucc 4380aaaccgcaga ucgcggccuu
gaaagaagag acugaagaag aaguucaaga cacgcgucuu 4440uaa
444351359RNAArtificial Sequencechemically synthesized
oligonucleotide 5augagcaccg ccgugcugga gaaccccggc cugggccgca
agcugagcga cuucggccag 60gagaccagcu acaucgagga caacugcaac cagaacggcg
ccaucagccu gaucuucagc 120cugaaggagg aggugggcgc ccuggccaag
gugcugcgcc uguucgagga gaacgacgug 180aaccugaccc acaucgagag
ccgccccagc cgccugaaga aggacgagua cgaguucuuc 240acccaccugg
acaagcgcag ccugcccgcc cugaccaaca ucaucaagau ccugcgccac
300gacaucggcg ccaccgugca cgagcugagc cgcgacaaga agaaggacac
cgugcccugg 360uucccccgca ccauccagga gcuggaccgc uucgccaacc
agauccugag cuacggcgcc 420gagcuggacg ccgaccaccc cggcuucaag
gaccccgugu accgcgcccg ccgcaagcag 480uucgccgaca ucgccuacaa
cuaccgccac ggccagccca ucccccgcgu ggaguacaug 540gaggaggaga
agaagaccug gggcaccgug uucaagaccc ugaagagccu guacaagacc
600cacgccugcu acgaguacaa ccacaucuuc ccccugcugg agaaguacug
cggcuuccac 660gaggacaaca ucccccagcu ggaggacgug agccaguucc
ugcagaccug caccggcuuc 720cgccugcgcc ccguggccgg ccugcugagc
agccgcgacu uccugggcgg ccuggccuuc 780cgcguguucc acugcaccca
guacauccgc cacggcagca agcccaugua cacccccgag 840cccgacaucu
gccacgagcu gcugggccac gugccccugu ucagcgaccg cagcuucgcc
900caguucagcc aggagaucgg ccuggccagc cugggcgccc ccgacgagua
caucgagaag 960cuggccacca ucuacugguu caccguggag uucggccugu
gcaagcaggg cgacagcauc 1020aaggccuacg gcgccggccu gcugagcagc
uucggcgagc ugcaguacug ccugagcgag 1080aagcccaagc ugcugccccu
ggagcuggag aagaccgcca uccagaacua caccgugacc 1140gaguuccagc
cccuguacua cguggccgag agcuucaacg acgccaagga gaaggugcgc
1200aacuucgccg ccaccauccc ccgccccuuc agcgugcgcu acgaccccua
cacccagcgc 1260aucgaggugc uggacaacac ccagcagcug aagauccugg
ccgacagcau caacagcgag 1320aucggcaucc ugugcagcgc ccugcagaag
aucaaguaa 1359
* * * * *