U.S. patent application number 15/466956 was filed with the patent office on 2018-03-08 for pharmaceutical composition for treating posttraumatic stress disorder.
The applicant listed for this patent is POSTECH ACADEMY-INDUSTRY FOUNDATION. Invention is credited to Joung-Hun Kim, BumJin Ko, Oh-Bin Kwon, Joo Han Lee.
Application Number | 20180064707 15/466956 |
Document ID | / |
Family ID | 61282279 |
Filed Date | 2018-03-08 |
United States Patent
Application |
20180064707 |
Kind Code |
A1 |
Kim; Joung-Hun ; et
al. |
March 8, 2018 |
PHARMACEUTICAL COMPOSITION FOR TREATING POSTTRAUMATIC STRESS
DISORDER
Abstract
Provided are a posttraumatic stress disorder (PTSD) animal model
in which dopamine receptor subtype 4 (D4R) is damaged or deficient,
a method for preparing the same, a method for screening a drug for
treating PTSD using the same, and a pharmaceutical composition for
treating PTSD comprising a drug detected by the screening method.
As it is identified that a specific type of dopamine receptor is
associated with a mechanism for fear memory expression induced by
long-term depression (LTD), the understanding of pathogenesis of
PTSD may be heightened, the animal model exhibiting similar
clinical conditions of PTSD and the method for preparing the same
may be applied in analyses for stability and effectiveness of a
therapeutic agent for PTSD and screening of a therapeutic drug.
Further, an agonist of D4R contained in the composition has been
approved by the US FDA and clinically used for psychiatric diseases
such as schizophrenia, and thus may be immediately used for
clinical applications for PTSD symptoms.
Inventors: |
Kim; Joung-Hun; (Seoul,
KR) ; Lee; Joo Han; (Pohang, KR) ; Ko;
BumJin; (Pohang, KR) ; Kwon; Oh-Bin; (Daegu,
KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
POSTECH ACADEMY-INDUSTRY FOUNDATION |
Pohang |
|
KR |
|
|
Family ID: |
61282279 |
Appl. No.: |
15/466956 |
Filed: |
March 23, 2017 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2267/0356 20130101;
A01K 2217/206 20130101; A01K 2267/035 20130101; C12N 2750/14143
20130101; A61K 49/0008 20130101; A01K 2207/05 20130101; A01K
67/0276 20130101; A01K 2227/105 20130101; A61K 31/495 20130101 |
International
Class: |
A61K 31/495 20060101
A61K031/495; A61K 49/00 20060101 A61K049/00; A01K 67/027 20060101
A01K067/027 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 5, 2016 |
KR |
10-2016-0113603 |
Claims
1. A posttraumatic stress disorder (PTSD) animal model, excluding a
human, in which dopamine receptor subtype 4 (D4R) is damaged or
deficient.
2. The animal model of claim 1, wherein the damage or deficiency of
D4R occurs in the dorsal intercalated cell mass (ITC) of the
amygdala.
3. The animal model of claim 1, wherein the damage or deficiency of
D4R inhibits long-term depression (LTD).
4. The animal model of claim 3, wherein the inhibition of LTD
induces excessive fear responses.
5. A method for preparing the posttraumatic stress disorder (PTSD)
animal model of claim 1.
6. The method of claim 5, comprising: performing knock-down or
knock-out of a dopamine receptor subtype 4 (D4R) gene.
7. A method for screening a drug for preventing or treating
posttraumatic stress disorder (PTSD) using the animal model of
claim 1.
8. The screening method of claim 7, comprising: (a) treating the
PTSD animal model with a candidate drug; and (b) measuring dopamine
receptor subtype 4 (D4R) activity in the amygdala.
9. The screening method of claim 8, further comprising: (c)
selecting the treated drug as a therapeutic drug when the treated
drug serves to activate D4R.
10. The screening method of claim 9, wherein the D4R activation
induces long-term depression (LTD).
11. The screening method of claim 10, wherein the LTD inhibits fear
responses.
12. The screening method of claim 9, wherein the treated drug is a
D4R agonist.
13. The screening method of claim 12, wherein the agonist is
N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide
(PD-168077).
14. A pharmaceutical composition for preventing or treating
posttraumatic stress disorder (PTSD), which comprises the drug
detected by the screening method of claim 7 as an active
ingredient.
15. The pharmaceutical composition of claim 14, wherein the drug is
a dopamine receptor subtype 4 (D4R) agonist.
16. The pharmaceutical composition of claim 15, wherein the D4R
agonist is one or more selected from the group consisting of the
materials listed below:
N-(methyl-4-(2-cyanophenyl)piperazinyl-3-methylbenzamide maleate
(PD 168077 maleate),
N-(3-methylphenyl)-4-(2-pyridinyl)-1-piperidineacetamide (A 412997
dihydrochloride),
2-[[4-(2-pyridinyl)-1-piperazinyl]methyl]-1H-benzimidazole
trihydrochloride (ABT 724 trihydrochloride),
N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexaneca-
rboxamide maleate (WAY 100635 maleate), and
5-[(3,6-dihydro-4-phenyl-1(2H)-pyridinyl)methyl]-2-methyl-4-pyrimidineami-
ne dihydrochloride (Ro 10-5824 dihydrochloride)
17. The pharmaceutical composition of claim 15, wherein the D4R
agonist is
N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide
(PD-168077).
18. The pharmaceutical composition of claim 15, wherein the D4R
agonist serves to activate the receptor to induce long-term
depression (LTD).
19. The pharmaceutical composition of claim 18, wherein the LTD
occurs in the dorsal intercalated cell mass (ITC) of the
amygdala.
20. The pharmaceutical composition of claim 18, wherein the LTD
inhibits fear responses.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to and the benefit of
Korean Patent Application No. 2016-0113603, filed on Sep. 5, 2016,
the disclosure of which is incorporated herein by reference in its
entirety.
BACKGROUND
1. Field of the Invention
[0002] The present invention relates to a posttraumatic stress
disorder (PTSD) animal model in which dopamine receptor subtype 4
(D4R) is damaged or deficient, a method for preparing the same, a
method for screening a PTSD drug using the same, and a
pharmaceutical composition for treating PTSD, which comprises a
drug detected by the screening method.
2. Discussion of Related Art
[0003] As a component of limbic system, the amygdala is a brain
region critical for acquisition and expression of conditioned fear
and located at the end of hippocampus. It has nuclei more than ten,
including basolateral nuclei, corticomedial nuclei and central
nucleus (CeA). Among several nuclei that constitute the amygdala
complex, it is the lateral nucleus (LA) that receives sensory
inputs during fear conditioning, and after being associated in the
LA, the signals are transmitted to the central nucleus (CeA) either
directly or via the basal nucleus. The intercalated cell masses
(ITCs), which are situated between the amygdala nuclei encompassing
the dorsal, ventral, and lateral clusters, appear to play a
regulatory role in fear-related behavior by controlling the signal
transfer between those amygdala nuclei. Thus, saponin-mediated
lesions of ITCs or pharmacological inhibition of basolateral
amygdale (BLA) inputs to ITCs interferes with extinction of fear
memory. Although extinction of fear memory strengthens the
excitatory inputs from the BLA to the ventral ITC, it remains
unclear whether synaptic plasticity arising at the dorsal ITC can
modulate fear acquisition and expression.
[0004] The dorsal ITC residing between the LA and CeA receives
glutamatergic inputs from LA as well as from cortical regions, and
it provides GABAergic inhibitory outputs to the lateral sector of
the CeA and the ventral ITC. By contrast, the ventral ITC receives
its major inputs from the basal nucleus of the amygdala and sends
projections to the medial sector of the CeA. The differences in
connectivity of individual ITCs suggest that each ITC can play
distinct roles in the regulation of fear behavior. Indeed, it has
been proposed that the dorsal ITC regulates fear expression while
the ventral ITC controls fear extinction. This raises the
possibility that synaptic plasticity in the dorsal ITC could modify
fear-related signaling from the LA to the CeA and the ensuing
behavior and that deficit in the plastic capabilities of the dorsal
ITC could potentially contribute to fear-related psychiatric
diseases such as posttraumatic stress disorder (PTSD).
[0005] By modulating the activity of amygdala neurons, dopaminergic
neurons can control the expression of fear memory. Consistent with
this notion, a subset of dopaminergic neurons is robustly activated
on the presentation of aversive stimuli, and their firing rates
positively correlate with the intensity or salience of the
stimulus. Dopamine (DA) gates synaptic plasticity in the amygdala
and ultimately controls acquisition of fear memory by reducing
feed-forward inhibition to LA projection neurons by means of
DA-mediated increases in disynaptic inhibitory postsynaptic
currents (IPSCs) in the local interneurons. As with the local
interneurons within the BLA, the output of ITCs also can be
regulated by DA. Although the dorsal ITC receives potent
dopaminergic inputs, the DA-dependent long-term synaptic plasticity
in the dorsal ITC circuit has not been explored. Meanwhile,
although target-specific methods have been developed to reduce side
effects in treatment of diseases with drugs, techniques used for
the brain are still very limited. In current situation in which the
number of patients classified as having mental disorders continues
to grow, it is necessary to find a function/site-specific target in
order to minimize drug side effects.
[0006] In particular, Post-traumatic stress disorder (PTSD) is a
prevalent and highly debilitating psychiatric disorder that is
notoriously difficult to treat. PTSD is characterized by
flashbacks, emotional numbness, and insomnia, and is associated
with mental health comorbidities, such as depression. PTSD can
result from a catastrophic and threatening event, e.g., a natural
disaster, wartime situation, accident, domestic abuse, or violent
crime. Symptoms typically develop within three months, but can
emerge years after the initial trauma. Also, PTSD is particularly
prevalent among combat veterans, and it is reported that an
estimated 17% of Iraqi combat veterans developed PTSD. There has
been a growing demand for a medication showing a great treatment
effects and having fewer side effects than existing drugs, but so
far no such medication has been presented.
SUMMARY OF THE INVENTION
[0007] The inventors found that inhibitory synaptic plasticity
regulated by D4R serves to limit the expression of learned fear and
thus can regulate symptoms such as fear generalization which is one
of the core symptoms in PTSD, and PTSD symptoms can be reduced by
using an agonist of D4R.
[0008] Accordingly, the present invention is directed to providing
a dopamine receptor subtype 4-damaged or deficient PTSD animal
model, a method for preparing the same, a method for screening a
PTSD drug using the same, and a pharmaceutical composition for
treating PTSD, which comprises a drug detected by the screening
method.
[0009] However, technical problems to be solved in the present
invention are not limited to the above-described problems, and
other problems which are not described herein will be fully
understood by those of ordinary skill in the art from the following
descriptions.
[0010] The present invention provides a D4R-damaged or deficient
PTSD animal model, excluding humans.
[0011] In one embodiment of the present invention, the damage or
deficiency of D4R may occur in the dorsal intercalated cell masses
(ITCs) of the amygdala.
[0012] In another embodiment of the present invention, long-term
depression (LTD) is inhibited by D4R damage or deficiency.
[0013] In still another embodiment of the present invention,
excessive fear responses are induced by the LTD inhibition.
[0014] Also, the present invention provides a method for preparing
the PTSD animal model.
[0015] In one embodiment of the present invention, the preparation
method comprises performing knock-down or knock-out of a D4R
gene.
[0016] Also, the present invention provides a method for screening
a drug for preventing or treating PTSD using the animal model.
[0017] In one embodiment of the present invention, the screening
method comprises (a) treating the PTSD animal model with a
candidate drug; and (b) measuring D4R activity in the amygdala.
[0018] In another embodiment of the present invention, the method
further comprises (c) selecting the treated drug as a therapeutic
drug when D4R is activated.
[0019] In still another embodiment of the present invention, LTD is
induced by the D4R activation.
[0020] In yet another embodiment of the present invention, fear
responses are inhibited by the LTD.
[0021] In yet another embodiment of the present invention, the
therapeutic drug is a D4R agonist.
[0022] In yet another embodiment of the present invention, the
agonist is
N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide
(PD-168077).
[0023] Also, the present invention provides a pharmaceutical
composition for preventing or treating PTSD, which comprises the
drug detected by the screening method as an active ingredient.
[0024] In one embodiment of the present invention, the drug is a
D4R agonist.
[0025] In another embodiment of the present invention, the D4R
agonist is one or more selected from the group consisting of the
following. [0026] PD 168077 maleate:
N-(methyl-4-(2-cyanophenyl)piperazinyl-3-methylbenzamide maleate
[0027] A 412997 dihydrochloride:
N-(3-methylphenyl)-4-(2-pyridinyl)-1-piperidineacetamide [0028] ABT
724 trihydrochloride:
2-[[4-(2-pyridinyl)-1-piperazinyl]methyl]-1H-benzimidazole
trihydrochloride [0029] WAY 100635 maleate:
N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexaneca-
rboxamide maleate [0030] Ro 10-5824 dihydrochloride:
5-[(3,6-dihydro-4-phenyl-1(2H)-pyridinyl)methyl]-2-methyl-4-pyrimidinamin-
e dihydrochloride
[0031] In still another embodiment of the present invention, the
D4R agonist is
N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide
(PD-168077).
[0032] In yet another embodiment of the present invention, the D4R
agonist activates the receptor to induce LTD.
[0033] In yet another embodiment of the present invention, the LTD
takes place in the dorsal ITCs of the amygdala.
[0034] In yet another embodiment of the present invention, fear
responses are inhibited by the LTD.
[0035] Also, the present invention provides a method for treating
PTSD, which comprises administering a D4R agonist into a
subject.
[0036] Also, the present invention provides a use of a D4R agonist
to treat PTSD.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The above and other objects, features and advantages of the
present invention will become more apparent to those of ordinary
skill in the art by describing in detail exemplary embodiments
thereof with reference to the accompanying drawings, in which:
[0038] FIG. 1a to 1e show diagrams illustrating that synaptic
plasticity in the dorsal ITC synapses is controlled by fear
conditioning, in which
[0039] FIG. 1a shows the dorsal ITC neurons that are identified
spatially and morphologically;
[0040] FIG. 1b is a schematic diagram illustrating a process of
obtaining whole cell patch recordings of excitatory postsynaptic
potentials (EPSPs) while electrically stimulating the lateral
nucleus of the amygdala;
[0041] FIG. 1c shows synaptic plasticity in the amygdala assessed
according to a spike-timing dependent plasticity (STDP) protocol,
with respect to mice having no fear memories and mice that undergo
weak/strong fear conditioning;
[0042] FIG. 1d is a schematic diagram of optogenetic analysis for
evaluating synaptic plasticity in a specific pathway exhibiting
LTD; and
[0043] FIG. 1e shows synaptic plasticity in the lateral
nucleus-dorsal ITC pathway in the amygdala, assessed with STDP-like
light stimulation;
[0044] FIG. 2a to 2d show enhanced inhibition with respect to the
dorsal ITC neurons after weak fear conditioning, in which
[0045] FIG. 2a shows miniature inhibitory postsynaptic currents
(mIPSCs) measured after fear conditioning;
[0046] FIG. 2b shows miniature excitatory postsynaptic currents
(mEPSCs) measured after fear conditioning;
[0047] FIG. 2c shows biphasic PSPs (EPSP/IPSP) caused by
stimulation of the lateral nucleus in the amygdala; and
[0048] FIG. 2d shows the input-output curves for disynaptic IPSPs
after weak/strong fear conditioning;
[0049] FIG. 3a to 3h show dopamine (DA)-dependent LTD by activation
of D4R, in which
[0050] FIG. 3a shows DA-induced LTD during STDP stimulation in the
dorsal ITC neurons;
[0051] FIG. 3b shows DA-dependent LTD induced by light stimulation
after rAAV5-CamKII.alpha.-hChR2-eYFP is infused into the lateral
nucleus in the amygdala;
[0052] FIG. 3c shows assessment of DA-dependent LTD by treatment
with dopamine receptor subtype-specific antagonists;
[0053] FIG. 3d shows assessment of DA-dependent LTD by treatment
with dopamine receptor subtype-specific agonists;
[0054] FIG. 3e shows assessment of DA-dependent LTD in D4R-knockout
mice;
[0055] FIG. 3f shows that LTD induced after weak fear conditioning
is inhibited by treatment with D4R-specific antagonists;
[0056] FIG. 3g shows subcellular localization of D4R in wild-type
mice, observed by post-embedding immuno-gold transmission electron
microscopy; and
[0057] FIG. 3h shows subcellular localization of D4R in
D4R-knockout mice, observed by post-embedding immuno-gold
transmission electron microscopy;
[0058] FIG. 4a to 4h show feed-forward inhibition signals increased
by DA-dependent LTD in the dorsal ITC, in which
[0059] FIG. 4a shows that mIPSC frequency is increased by the
induction of DA-dependent LTD;
[0060] FIG. 4b shows that DA-dependent LTD does not affect
mEPSCs;
[0061] FIG. 4c shows that disynaptic IPSPs are increased by the
induction of DA-dependent LTD;
[0062] FIG. 4d shows synaptic responses from the dorsal ITC neurons
obtained by interleaving stimulation of the lateral nucleus or
dorsal ITC in the amygdala;
[0063] FIG. 4e shows that IPSCs are increased, but EPSCs are
decreased when DA-dependent LTD is induced;
[0064] FIG. 4f shows unitary IPSCs (uIPSCs) in the post-synaptic
neurons;
[0065] FIG. 4g shows that uIPSCs are increased in the post-synaptic
neurons after the induction of D4R-dependent LTD; and
[0066] FIG. 4h shows a positive correlation between the increase in
uIPSCs and LTD magnitude;
[0067] FIG. 5a to 5c show that fear behavior is regulated by D4R
activity in the dorsal ITC neurons, in which
[0068] FIG. 5a is an experimental schematic diagram for evaluating
the influence of the infusion of a D4R antagonist (L-745870) into
the dorsal ITC on the expression of fear behavior after weak fear
conditioning, and
[0069] FIG. 5b shows the experimental result;
[0070] FIG. 5c is an experimental scheme for evaluating the
influence on the expression of fear behavior after weak fear
conditioning using a genetic method for depleting D4R from
inhibitory neurons of the dorsal ITC, and
[0071] FIG. 5d shows the experimental result;
[0072] FIG. 6a to 6d show that the expression of fear memory is
increased when LTD is optogenetically inhibited, in which
[0073] FIG. 6a shows that LTD is inhibited in the dorsal ITC 24
hours after fear recall is given to fear-learned mice;
[0074] FIG. 6b shows that DA-dependent LTD is inhibited by
optogenetically manipulating the lateral nucleus-dorsal ITC pathway
of the amygdala after weak fear conditioning;
[0075] FIG. 6c is a schematic diagram illustrating in vivo
optogenetic manipulation and the design for behavior tests; and
[0076] FIG. 6d shows that, when the optogenetic TBS is applied to
the dorsal ITC, rAAV5-CamKII.alpha.-hChR2-eYFP-infused mice exhibit
significant increases in fear behavior responses, compared to the
control;
[0077] FIG. 7a to 7e show impaired LTD in the dorsal ITC of
PTSD-like animal models, in which
[0078] FIG. 7a shows cue-induced fear responses measured by
administering corticosterone (CORT) to mice undergoing weak fear
conditioning with respect to both cue and context in
individuals;
[0079] FIG. 7b shows context-induced fear responses measured by
administering CORT to mice undergoing weak fear conditioning with
respect to both cue and context in individuals;
[0080] FIG. 7c shows that LTD is not induced in the dorsal ITC of
mice to which CORT is administered after fear conditioning;
[0081] FIG. 7d shows that context-induced fear response levels are
increased after weak fearing conditioning subjected to cue in
Dlx5/6-Cre (+) mice in which the D4R expression is inhibited in the
dorsal ITC; and
[0082] FIG. 7e shows the input-output curves for disynaptic IPSPs
in the dorsal ITC; and
[0083] FIG. 8 shows that improved functions of a receptor result in
the decreases in fear behavior responses due to treatment of mice
exhibiting PTSD-like behavior with D4R agonists.
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0084] The amygdala of the brain is critical for expression of fear
behavior and learning of stimuli associated with fear, and is known
to store fear memories in neuronal circuits connected with the
lateral nucleus and the central nucleus. However, since an
inhibitory neuronal cell population regulating neuronal circuits
has a small size (0.0098 mm.sup.3 in mice), it is difficult to
investigate and thus its role and regulatory mechanism have not
been revealed.
[0085] In the present invention, the mechanism of operating the
neuronal circuits inhibiting and regulating an amygdala region in
which fear-associated stimulation occurs was investigated.
Specifically, it was revealed that LTD easily takes place in an
inhibitory cell population of weak fear-learned mice, and such
synaptic plasticity is eliminated from the mice by an optogenetic
method, resulting in excessive fear responses. Optogenetics is a
systemic neuroscience technique for enabling on/off of activity of
neurons by illumination of light with a specific wavelength range
after genes responding to light have been artificially expressed in
neurons.
[0086] In addition, in the present invention, it was confirmed
that, even after weak fear conditioning, strong fear responses were
exhibited from both of mice exhibiting PTSD and mice exhibiting
inhibited D4R expression in the dorsal ITC.
[0087] Therefore, it was established that activation of a DA
receptor by weak fear learning evokes LTD, thereby controlling
strong fear behavior, but when PTSD occurs or the DA receptor is
not properly functioning, LTD is not induced, which means that a
neural transmission signal may not be weakened, and excessive fear
responses are shown.
[0088] Specifically, in the present invention, synaptic plasticity
in the dorsal ITC was assessed using the STDP stimulation protocol.
STDP stimulation induced LTD in the lateral nucleus-dorsal ITC
pathway of the amygdala after weak fear conditioning, but not after
strong fear conditioning. Moreover, it was confirmed that induction
of LTD in the dorsal ITC depends on activation of D4R and an
increase in GABA release from neighboring ITC neurons.
Particularly, it was confirmed that selective blockade or
deficiency of D4R in the region of the amygdala centered on the
dorsal ITC or optogenetic manipulation that reverses the LTD in the
lateral nucleus-dorsal ITC pathway of the amygdala in vitro results
in increased fear responses in mice, and therefore it can be seen
that revealed that D4R-dependent LTD plays a critical role in the
control of fear expression.
[0089] In addition, in the present invention, as a result of LTD
analysis in a PTSD mouse model, LTD impairment was observed in the
dorsal ITC. That is, through the present invention, it was
confirmed that synaptic plasticity induced in the dorsal ITC is
involved in controlling learned fear expression, and its impairment
induces the occurrence of PTSD. These experimental results provide
new insights into functional roles of a specific inhibitory circuit
in the amygdala, which indicates that the range of emotional
stimuli that can be retained as long-term memory can be
distinguished.
[0090] As described above, in the present invention, not only the
mechanism for fear memory expression by a dopamine receptor and LTD
was revealed, but the association between PTSD and the inhibitory
neuronal circuit in the amygdala was also revealed, which will
significantly contribute to the development of a therapeutic agent
for fear-related psychiatric diseases.
[0091] The present invention provides a PTSD animal model in which
D4R is damaged or depleted in the dorsal ITC of the amygdala.
[0092] Dopamine (DA) is a neurotransmitter essential for neural
signal transmission found in the brain of animals including humans,
and a DA receptor is a 7-transmembrane (G protein-coupled) peptide
that transmits a DA-linked signal into cells. In the present
invention, it was confirmed that only subtype 4 (D4R) among DA
receptor subtypes 1 to 5 (D1R to D5R) induces LTD in the dorsal
ITC.
[0093] In the present invention, PTSD refers to a mental disease
that can occur after mental trauma due to a severe accident, and
has major symptoms such as hypersensitivity, re-experience of
shocks, or emotional avoidance or numbness.
[0094] In the present invention, intercalated cell masses (ITCs)
refer to a population of neurons regulating fear-related behavior
by adjusting a signal between nuclei in the amygdala, and the
dorsal ITC is located between the lateral nucleus and the central
nucleus in the amygdala, and receives a glutamatergic signal from
the lateral nucleus, and sends a GABAergic inhibitory signal to the
central nucleus and the lateral region of the ventral ITC.
[0095] In the present invention, long-term depression (LTD) refers
to a phenomenon in which signal transmission intensity of a
synapse, which links neurons, is consistently weakened.
[0096] Also, the present invention provides a method for preparing
a PTSD animal model in which D4R is impaired or depleted in the
dorsal ITC of the amygdala.
[0097] In the present invention, knock-down or knock-out of a D4R
gene may result in damage or depletion of a protein. Knock-down or
knock-out methods are not limited, and may employ various known
methods, for example, shRNA, siRNA, microRNA, antisense
oligonucleotides, PNA, aptamers, and CRISPER Cas9 techniques, which
target the gene.
[0098] Also, the present invention provides a method for screening
a drug for preventing or treating PTSD using the animal model.
[0099] In the present invention, a material for activating D4R may
be selected as a drug by treating a PTSD animal model with a
candidate drug and measuring D4R activity in the amygdala.
[0100] In the present invention, an agonist capable of activating
the D4R may be any material having activity similar to DA without
limits, for example, one or more selected from the group consisting
of materials listed below, such as
N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide
(PD-168077). [0101] PD 168077 maleate:
N-(methyl-4-(2-cyanophenyl)piperazinyl-3-methylbenzamide maleate
[0102] A 412997 dihydrochloride:
N-(3-methylphenyl)-4-(2-pyridinyl)-1-piperidineacetamide [0103] ABT
724 trihydrochloride:
2-[[4-(2-pyridinyl)-1-piperazinyl]methyl]-1H-benzimidazole
trihydrochloride [0104] WAY 100635 maleate:
N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexaneca-
rboxamide maleate [0105] Ro 10-5824 dihydrochloride:
5-[(3,6-dihydro-4-phenyl-1(2H)-pyridinyl)methyl]-2-methyl-4-pyrimidinamin-
e dihydrochloride
[0106] Also, the present invention provides a pharmaceutical
composition for preventing or treating PTSD, comprising a drug
detected by the screening method as an active ingredient.
[0107] The term "pharmaceutical composition" used herein may
further include a conventional therapeutic active ingredient, other
adjuvants, pharmaceutically acceptable carriers, etc. The
pharmaceutically acceptable carriers include a saline solution,
sterilized water, Ringer's solution, a buffered saline, a dextrose
solution, a maltodextrin solution, glycerol, and ethanol.
[0108] The composition may be used by being prepared in the form of
oral preparations such as powder, granules, tablets, capsules,
suspension, emulsion, syrup, aerosol, etc., external applications,
suppositories and sterilized injections according to individual
conventional methods.
[0109] The term "dose" used herein may vary according to a
patient's body weight, age, sex, health condition, diet, the number
of doses, an administration method, an excretion rate and severity
of a disease, which is obvious to those of ordinary skill in the
art.
[0110] The term "subject" used herein refers to a target needing
treatment for a disease, and more specifically, a mammal such as a
human or a non-human primate, a mouse, a rat, a dog, a cat, a horse
or a cow.
[0111] The term "pharmaceutically effective amount" used herein may
be determined by factors including a disease type, severity of a
disease, a patient's age and sex, sensitivity to a drug,
administration time, an administration route, an excretion rate,
treatment duration, and a simultaneously used drug, and other
factors well known in the medical field, and refers to an amount
capable of obtaining the maximum effect without side effects, in
consideration of all of the above factors, which may be easily
determined by those of ordinary skill in the art.
[0112] The composition of the present invention is not limited to
one administration method as long as it can reach target tissue.
For example, the administration method includes oral
administration, intraarterial injection, intravenous injection,
transdermal injection, intranasal administration, transbronchial or
intramuscular administration, etc. A daily dose may be
approximately 0.0001 to 100 mg/kg, and preferably 0.001 to 10
mg/kg, which is preferably administered daily once to several
times.
[0113] The D4R agonist of the present invention may induce LTD in
the dorsal ITC of the amygdala, thereby inhibiting fear responses,
and thus may be usefully applied in prevention or treatment of
PTSD.
[0114] Hereinafter, examples will be provided to help in
understanding the present invention. However, the following
examples are merely provided to more easily understand the present
invention, and the scope of the present invention is not limited to
the examples.
EXAMPLES
Example 1: Materials & Methods
[0115] 1-1. Animals
[0116] Male C57BL/6J, D4R-KO, and Dlx5/6-Cre and Ail4 reporter mice
from Jackson Laboratory (Bar Harbor, Me.) were housed under a
12-hour light/dark cycle and given ad libitum access to food and
water. All procedures for animal experiments were approved by the
ethical review committee of POSTECH (Pohang University of Science
& Technology), Korea and performed in accordance with the
relevant guidelines.
[0117] 1-2. Plasmid and Viral Vectors
[0118] pCMV6-AC-D4R-turboGFP was purchased from OriGene
Technologies (Rockville, Md.). shRNA sequences targeting D4R
(gctgctcatcggcttggtgtt) were also obtained from OriGene
Technologies and cloned into pLL3.7 construct. Then, the
effectiveness of shD4R sequence was verified with quantitative
RT-PCR using HEK-293 cells (GenTarget, San Diego, Calif.)
co-transfected with pCMV6-AC-D4R-turboGFP and pLL3.7-shD4R. To
achieve simultaneous Cre-dependent knock-down and eYFP expression
in the same cells, pAAV-EF1.alpha.-DIO-eYFP, was modified by
inserting U6 promoter and TATAlox and adding new sequences. The
resultant plasmids, cKDeYFP-shD4R
(pAAV-EF1.alpha.-DIO-TATAlox-eYFP-U6-shD4R) and control cKD-eYFP
(pAAV-EF1.alpha.-DIO-TATAlox-eYFP-U6) vectors were used for
production of the corresponding viruses.
[0119] Virus production was conducted in accordance to established
protocols. Briefly, HEK-293 cells were co-transfected with helper
plasmids and either cKD-eYFPshD4R or cKD-eYFP at an equal molar
ratio using Lipofector-Q transfection reagents (AptaBio, Korea). 72
hours after co-transfection, the cells were lysed through
freeze-thaw steps and resultant AAV particles were purified by
iodixanol-gradient ultracentrifugation at 340,000 g for 2 hours.
AAV particles were concentrated with Amicon Filter (100K,
Millipore, Bedford, Mass.) to achieve at least 5.0.times.10.sup.12
gc/ml.
[0120] 1-3. Western Blot
[0121] Normal HEK-293 and Cre-expressing HEK-293 were cultured in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
fetal bovine serum (Hyclone, South Logan, Utah) and 100 U/ml
penicillin and 100 g/ml streptomycin. They were incubated at
37.degree. C./5% CO2.
[0122] For heterologous expression of D4R, we transfected HEK-293
cells with pCMV-D4R-turboGFP using Lipofector-Q. D4R-transfected
cells were further treated with either rAAV2-cKD-eYFP or
rAAV2-cKD-eYFP-shD4R. 2 days after viral infection, total proteins
were extracted using HEPES lysis buffer (40 .mu.M HEPES, 120 mM
NaCl, 1 mM EDTA, 1% Triton X-100) containing protease inhibitor
cocktail (Roche, Indianapolis, Ind.), separated on 10% SDS PAGE gel
and then transferred onto PVDF membrane (0.45 .mu.m pore,
Millipore).
[0123] The membranes were blocked for 1 hour in TBST
(Tris-buffered-saline and Tween 20) containing 5% skim milk and
then individually incubated overnight at 4.degree. C. with anti-D4R
(sc-31481, 1:1000, Santa Cruz, Paso Robles, Calif.), anti-GFP
(LF-PA0043, 1:1000, AbFrontier, Korea) or anti-GAPDH (sc-25778,
1:1000, Santa Cruz) antibodies. HRP-conjugated anti-goat (sc-2020,
1:5000, Santa Cruz) or anti-rabbit (A120-201P, 1:5000, Bethyl
Laboratories, Montagomery, Tex.) antibodies were applied as
secondary antibodies and treated at room temperature (RT) for 1
hour. Western blots were visualized with ECL reagent (WBKLS0100,
Millipore) and scanned with LAS-4000 (GE Heath Care, Piscataway,
N.J.). Quantitative analysis was performed with ImageJ (NIH,
Bethesda, Md.).
[0124] 1-4. Immunocytochemistry
[0125] HEK-293 cells were plated onto 12-mm glass coverslips coated
with 0.1 mg/ml poly-L-lysine and then treated with either
rAAV2-cKD-eYFP-shD4R or rAAV2-cKD-eYFP. Following 3
days-incubation, the coverslips were fixed with a fixative solution
containing 4% paraformaldehyde in phosphate buffered saline (PBS)
at 4.degree. C. for 24 hours and permeabilized with 0.25% Triton
X-100 in PBS at 25.degree. C. for 10 minutes. Then the samples were
blocked with 1% BSA, 5% normal goat serum and 0.25% Triton X-100 in
PBS.
[0126] For Cre staining, anti-Cre (MAB3120, 1:500, Millipore)
antibody was applied at 4.degree. C. for 12 hours and then goat
antimouse Alexa Fluor 568 conjugated IgG (A11004, 1:500,
Invitrogen, Carlsbad, Calif.) antibody at RT for 1 hour. The
samples were mounted on glass slides with mounting medium (Santa
Cruz) containing DAPI.
[0127] 1-5. Immunohistochemistry
[0128] Mice were deeply anesthetized with tribromoethanol (250
mg/kg) and transcardially perfused with PBS and then a fixative
solution (4% paraformaldehyde in PBS). The isolated brains were
kept in the fixative solution for overnight at 4.degree. C. The
brains were embedded in 5% agarose and sliced into 50-.mu.m thick
coronal sections with a vibratome (VT1000S, Leica, Germany). Sliced
sections were blocked with 4% normal donkey serum and 0.4% Triton
X-100 in PBS at 4.degree. C. for 1 hour and then were incubated
with goat anti-D4R (sc-31481; 1:500, Santa Cruz), rabbit
anti-synaptophysin (04-1019; 1:1000, Millipore) or mouse
anti-gephyrin (sc-25311, 1:300, Santa Cruz) antibodies at 4.degree.
C. overnight. Donkey anti-goat DyLight 488 conjugated IgG (1:300,
Bethyl Laboratories) or donkey anti-goat Alexa Fluor 594 conjugated
IgG (1:300, Invitrogen), donkey anti-rabbit Alexa Fluor 568
conjugated IgG (1:300, Invitrogen) or DyLight 550 conjugated donkey
anti-mouse IgG (1:300, Bethyl Laboratories) antibodies were used as
secondary antibodies.
[0129] For c-Fos staining, we used rabbit anti-c-Fos (sc-52, 1:500,
Santa Cruz) as primary antibody and goat anti-rabbit Alexa Fluor
647 conjugated IgG (1:500, Invitrogen) as secondary antibody after
blocking with 4% normal goat serum in PBS. All tissues were mounted
on the slide glasses with UltraCruz mounting medium (Santa
Cruz).
[0130] 1-6. Cellular Imaging
[0131] We used laser scanning confocal microscopes (LSM 510, Zeiss,
Germany or Fluoview 1000, Olympus, Japan) for cellular imaging
experiments except for co-localization between D4R and synaptic
marker proteins. We also used a structured illumination microscope
(N-SIM, Nikon, Japan) to examine co-localization of D4R and
gephyrin/synaptophysin further precisely rather than conventional
confocal microscopy. Quantitative analysis of immunoreactive puncta
was performed using MetaMorph 7.7 software (Molecular Devices,
Sunnyvale, Calif.).
[0132] 1-7. Post-Embedding Immuno-Gold Electron Microscopy
[0133] Immuno-EM was conducted in accordance with established
protocols. Transcardial perfusion and preparation of brain slices
were identical to those used for the immunohistochemistry
experiments except thickness of slices being 200 .mu.m. The dorsal
ITC areas were isolated from the amygdala slices under a dissection
microscope (Olympus). The tissue was immersed into a 0.001% osmium
tetroxide (OsO4) solution on the ice for 1 hour to achieve the
membrane preservation and then rinsed with PBS. Then, the tissue
was kept in a 10% sucrose solution for cryoprotection.
High-pressure freezing system (HPM 100, Leica) was used to acutely
freeze the tissue while preserving the membrane and cellular
components. After acute freezing, sample tissue was kept in acetone
and embedded in Lowicryl HM20 resin (Electron microscopy sciences,
Hatfield, Pa.) at -45.degree. C. for 2 days and UVpolymerization
for 1 day with EM AFS2 (Leica). UV-polymerized blocks containing
the dorsal ITC tissues were sliced by an ultra-microtome (Leica).
These slices were then put on the Nickel grids (FCF200-Ni, Electron
microscopy sciences).
[0134] For immunostaining, goat anti-D4R (1:20, Millipore) and
mouse monoclonal anti-GAD67 (MAB5406, 1:20, Millipore) antibodies
were used as primary antibodies. Subsequently, 12-nm gold
particle-Donkey anti-goat or 6-nm gold particle-Donkey anti-mouse
(705-205-147 and 715-195-150, respectively, Jackson Immuno
Research, West Grove, Pa.) antibodies were used for labeling D4R or
GAD-67, respectively after blocking with 0.2% normal donkey serum
in detergent-free PBS at 4.degree. C. overnight. After antibody
application, we treated 1-2% uranyl acetate for 4 minutes and
Reynolds solution for 2 minutes to obtain a high-contrast image.
Images were obtained with a transmission electron microscope
(JEM-1011, Jeol, Japan).
[0135] 1-8. Virus Infusion and Implantation of Tungsten Electrodes
and Optic Fibers
[0136] After mice were anesthetized with ketamine and xylazine, the
head was fixed in a stereotaxic frame (Kopf, Tujunga, Calif.). For
viral infusion, .about.0.1 .mu.l of virus solution was infused
using horizontally pulled glass needles, into each hemisphere with
Nanoject II (Drummond scientific instrument, Broomall, Pa.) for 1
minute (4 injections per hemisphere were applied, 23.0 nl per
injection which had a rate of 46 nl/sec), and the injection needles
remained for additional 10 minutes to allow diffusion of AAV.
[0137] Single tungsten electrodes were ipsilaterally implanted to
reach the dorsal ITC for recording in vivo activity and IL for in
vivo stimulation in the aforementioned coordinates, and secured
with screws and dental cement. To ensure the recording electrodes
were placed correctly in the dorsal ITC, we electrically stimulated
IL (0.1 Hz) while neural activity was monitored from the dorsal
ITC. If burst-like spikes were observed earlier than 50 ms from
each IL stimulation, the recording electrodes were secured with
dental cement. Optic fibers (50-.mu.m core diameter, ThorLabs,
Newton, N.J.) were secured to a multi-mode zirconia ceramic ferrule
(Precision Fiber Products, Milpitas, Calif.) with adhesive and
epoxy, and then implanted to place its tip on the dorsal atop of
the dorsal ITC in the coordinate, AP-1.4 mm, ML.+-.3.2 mm, DV-4.0
mm from the bregma, and secured with dental cement.
[0138] 1-9. Drug Infusion
[0139] Guide cannulae were implanted bilaterally (26 gauge,
Plastics One, Roanoke, Va.) aimed into the dorsal ITC areas in the
coordinates, AP-1.4 mm, ML.+-.3.2 mm, DV-4.2 mm from the bregma,
and were fixed in the skull with dental cement. The cannulae
remained capped with internal dummy cannulae (33 gauges, Plastics
One) after surgery. Animals were individually housed and allowed to
recover at least for 1 week after surgery. The mice bilaterally
received 0.5 .mu.l of either L-745870 or vehicle through the
injection cannula (33 gauge, Plastics One) connected to a 10-.mu.l
Hamilton syringe for 5 minutes at a rate of 0.1 .mu.l/min using
microinfusion pump (Harvard Apparatus, Holliston, Mass.) 20 minutes
before fear conditioning. L-745870 was dissolved to 500 nM in 0.9%
saline just before the infusion. Mice were kept with injector
cannulae for additional 5 minutes after the end of infusion and
then were subjected to fear conditioning. To estimate the diffusion
range of L-745870, FITC (500 nM) was also included in the injectant
for certain experiments. The subject mice were transcardially
perfused right after the last behavioral tests and analyzed for the
injection loci. Data from the animals with wrong placement of
cannula tips were excluded from further analyses.
[0140] 1-10. Behavioral Tests
[0141] We used two different chambers (26 cm.times.26 cm.times.24
cm). Context A consisted of black opaque PVC walls and a grid
floor, which was swiped with 70% ethanol before each trial whereas
context B consisted of transparent plastic walls and a PVC floor
covered with cage bedding and was scented with peppermint odor.
[0142] Fear conditioning trainings were conducted in context A
within sound-attenuating conditions (Panlab, Spain). Tone CS
(conditioned stimulus) was delivered with a speaker while electric
foot shock US (unconditioned stimulus) was applied through a floor
grid attached to a shock generator (Panlab). The chambers were also
equipped with infrared webcams connected to a personal computer to
store animal behavior. Mice were placed in the context A for 2
minutes of acclimation and were then presented with auditory tone
(CS: 3 kHz, 80 dB for 30 sec) that were co-terminated with electric
foot shocks (US: 0.4 or 0.8 mA for 0.5 sec). Total 8 CS-US pairs
were presented in pseudorandom intertrial intervals (varied from 60
to 120 sec). 24 hours after fear conditioning, mice were placed in
context B to assess the recall of fear memory by being re-exposed
to CS, but without US for 2 minutes.
[0143] To induce PTSD-like memory impairment, corticosterone (CORT,
5 mg/kg) or vehicle (saline, 0.9% NaCl) was intraperitoneally
(i.p.) injected immediately after fear conditioning as previously
described. The cue-conditioning group underwent weak fear
conditioning with the previously-described CS-US pairing paradigm
in context A and was tested for fear recall toward the cue in
context B at the next day.
[0144] To assess contextual fear memory from cue conditioned
animals, the mice were placed again in context A 2 hours after
termination of the first recall test and then duration of freezing
was measured for 2 minutes without presentation of the auditory
cue. The mice were placed in context B 2 hours after termination of
the first recall test and the freezing time during presentation of
the auditory cue was measured for 2 minutes.
[0145] The D4 agonist (PD 168077, Tocris, 1 mg/kg) or Vehicle was
intraperitoneally (i.p.) injected 15 min only before the context A
exposure.
[0146] 1-11. ChR2-Mediated Optical Stimulation
[0147] rAAV5-CamKII.alpha.-hChR2(H134R)-eYFP and
rAAV5-CamKII.alpha.-eYFP from Vector Core of University of North
Carolina were used for optogenetic manipulation. Optical activation
of axon terminals of the dorsal ITC neurons for STDP induction was
performed by illuminating acute slices with 1-msec blue light
pulses from LED source (ThorLabs). The light intensity was adjusted
to evoke robust EPSPs. 473-nm DPSS blue laser (Shanghai Laser &
Optics Century, China) was utilized to apply in vivo optogenetic
TBS to the LA-dorsal ITC pathway. The optogenetic TBS was delivered
through a custom-made patch cable (50-.mu.m core diameter fiber
optics, ThorLabs). This TBS was composed of 10 sets of light pulses
at 0.1 Hz, each set of 10 pulse trains at 5 Hz, and a single train
had 4 light pulses at 50 Hz. The generation of optogenetic TBS was
controlled by Master-8 stimulator (AMPI, Israel). During
optogenetic TBS, the mice were allowed to freely move nearby their
home cage without any anesthetization. The putative light loss was
carefully compensated for attenuation through the implanted part,
which was measured prior to the surgery. Geometric light loss in
the brain was also predicted and compensated with the web-based
light transmission calculator (http://optogenetic.org/). After
transcardial perfusion, we validated that each optic fiber
withdrawn from the skull did not exhibit a significant difference
in light loss from the measurement prior to the surgery.
[0148] 1-12. Slice Electrophysiology
[0149] Acute brain slices were placed in recording chambers and
continuously superfused (2 ml/min) with a bathing solution
containing 119 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl2, 2 mM MgSO4, 1.25
mM NaH2PO4, 26 mM NaHCO3, and 10 mM D-glucose while equilibrated
with 95% 02 and 5% CO2 (pH 7.3-7.4) at RT. Whole-cell patch
recordings in current clamp mode or voltage clamp mode were made
with a MultiClamp 700B amplifier (Molecular Devices). Recording
electrodes (8-10 M) were filled with an internal solution
containing, for EPSP recordings: 120 mM K-gluconate, 5 mM NaCl, 1
mM MgCl2, 0.2 mM EGTA, 10 mM HEPES, 2 mM MgATP, and 0.1 mM NaGTP at
pH 7.2 adjusted with KOH, for EPSC recordings: 130 mM CsMeSO4, 8 mM
NaCl, 0.5 mM EGTA, 10 mM HEPES, 2 mM MgATP, 0.1 mM NaGTP, 5 mM
QX-314, 10 mM phosphocreatine at pH 7.2 adjusted with CsOH, for
IPSP recordings: 135 mM KCl, 10 mM NaCl, 2 mM MgCl2, 0.5 mM EGTA,
10 mM HEPES, 2 mM MgATP, 0.1 mM NaGTP at pH 7.2 adjusted with KOH,
and for IPSC recordings: 135 mM CsCl, 1 mM EGTA, 10 mM HEPES, 2 mM
MgATP, 0.1 mM NaGTP, and 5 mM QX-314 at pH 7.2 adjusted with
CsOH.
[0150] To compare mPSCs without or after STDP, KCl-based and
K-gluconate-based internal solutions were used for recording mIPSCs
and mEPSCs, respectively. K-gluconate based solution was also used
to record EPSCs and IPSCs evoked by interleaved stimulation. Series
resistance (10-30 M.OMEGA.) was monitored throughout all
experiments. mEPSCs were recorded at -70 mV holding potential in
the presence of 1 .mu.M tetrodotoxin (TTX) and 100 .mu.M picrotoxin
(Tocris, UK) while mIPSCs were measured at -70 mV in the presence
of 1 .mu.M TTX, 25 .mu.M NBQX, and 50 .mu.M
2-amino-5-phosphonovaleric acid (APV, Tocris). Miniature PSCs were
analyzed with MiniAnalysis (Synaptosoft, Fort Lee, N.J.) or
Clampfit 10.1 software (Molecular Devices). For PSC recordings with
interleaved stimulation, the holding potential was briefly
(.about.40 ms) changed from -70 mV to +10 mV to reach the reversal
potential of EPSC for isolation of putative IPSCs. For STDP
experiments, stimulus intensity was adjusted to elicit EPSPs
displaying 25%-30% of the maximum amplitudes. After obtaining
stable baseline recording, 80 presynaptic stimuli were delivered at
2 Hz via metal stimulating electrode placed in LA while paired with
action potentials induced by injection of depolarizing current to
postsynaptic neurons. Quantal contents were estimated by obtaining
the inverse square of the coefficient of variation (1/CV.sup.2).
Each 1/CV.sup.2 value was measured and calculated from 50 EPSCs or
50 IPSCs as previously described.
[0151] GDP.beta.S (0.5 mM) was included in the internal solution to
examine the presynaptic/postsynaptic contribution of D4R-mediated
signaling to DA-LTD. Liquid junction potential between K-gluconate
based internal solution and extracellular ACSF (13.3 mV) was
corrected for the representation of resting membrane potential. For
a subset of neurons, neurobiotin (0.5%, Vector Labs, CA) was
included in pipette solution for morphological characterization.
There was no significant difference between the
electrophysiological data from the neurons recorded with or without
neurobiotin, and thus those data were combined. The
neurobiotin-injected neurons were visualized by staining with Texas
Red conjugated avidin (Vector Labs) after overnight fixation.
[0152] 1-13. In Vivo Electrophysiology
[0153] Electrode-implanted mice were weakly anesthetized with
ketamine and xylazine for the stable recording of spontaneous
firings of the dorsal ITC neurons. Spontaneous firings were
recorded 1 hour after the habituation session (before fear
conditioning). Weak fear conditioning was conducted at 24 hours
after the first in vivo recording. 24 hours after fear
conditioning, spontaneous firings were recorded in the same manner
(after fear conditioning). Signals from recording electrodes were
amplified 10.sup.4 times and band-pass filtered between 10 kHz
(lowpass) and 300 Hz (high-pass) with DAM80 differential amplifier
(World Precision Instruments, Sarasota, Fla.), and digitized at 40
kHz using PowerLab/4sp (ADinstruments, Colorado Springs, Colo.).
Spontaneous firings were further processed and monitored with Chart
acquisition software (ADinstruments). Single units were sorted
using Spike2 software (Cambridge Electronic Design, UK), as
previously described. A single spike was initially detected by an
amplitude threshold. All detected spike traces were isolated by
comparing with template waveforms. If not matched with any existing
templates, a new template waveform was created based on the
waveform of the detected spike. The spike isolation was refined by
principle component analysis. Units showing inter-spike interval
less than 1 ms were discarded from further analysis. Total spike
numbers from each unit were used to calculate the spontaneous
firing frequency of the dorsal ITC neuron. The electrode placements
were thoroughly ascertained via post mortem examination.
Example 2: Results
[0154] 2-1. LTD Induction in the Dorsal ITC Synapses after Weak
Fear Conditioning
[0155] The dorsal ITC receives glutamatergic inputs from the LA and
the medial prefrontal cortex (mPFC), which adjust fear responses.
We have identified the dorsal ITC neurons spatially and
morphologically (FIG. 1A).
[0156] To assess synaptic properties in the LA dorsal ITC pathway
and other neuronal features, we obtained whole-cell patch
recordings of excitatory postsynaptic potentials (EPSPs) while
stimulating LA (FIG. 1B) and induced STDP by applying 80 pairs of
presynaptic stimulations and postsynaptic action potentials with
various time intervals from EPSP initiation.
[0157] Interestingly, long-term potentiation (LTP) arose at +4- and
+6-ms interval delays in the presence of the GABAA receptor
antagonist picrotoxin, but not in the absence of picrotoxin. These
data suggest that GABAergic transmission tightly regulates STDP in
the dorsal ITC neurons as in the BLA neurons.
[0158] To analyze the behavioral and physiological consequences of
different fear-conditioning protocols, we carried out Pavlovian
fear conditioning by pairing a tone with either a sub-threshold
(0.4 mA for 0.5 s, weak fear conditioning) or a supra-threshold US
(0.8 mA for 0.5 s, strong fear conditioning).
[0159] Weak fear conditioning resulted in reduced levels of
freezing at 24 hr after acquisition, which further decayed over the
course of several days, comparable to those of the unpaired CS-US
or the tone-only control groups. In contrast, strong fear
conditioning led to significantly greater levels of freezing that
remained elevated throughout the same time period (FIG. S1B). Thus,
the weak fear conditioning seems to entail less-salient experience
that could not be retained as long-lasting memory.
[0160] Importantly, LTD was induced in the dorsal ITC neurons by
the same STDP protocol in the absence of picrotoxin (+6-ms interval
at which GABAergic regulation was maximally effective for the
induction of synaptic plasticity) in the amygdala slices prepared
24 hr after weak fear conditioning. However, we failed to detect
any significant synaptic plasticity in slices from the animals that
had undergone either strong fear conditioning or no training
(naive) (FIG. 1C).
[0161] Although we elicited the synaptic responses in the dorsal
ITC neurons by stimulation of LA, the possible existence of
enpassant synapses projecting from the mPFC might have obscured
which pathway expressed LTD. To further assess synaptic plasticity
in distinct pathways, we infused adeno-associated virus (AAV)
encoding channel rhodopsin-2 and enhanced yellow fluorescence
protein (eYFP) into the LA or mPFC and then validated ChR2
expression with least retrograde infection (FIG. 1D).
[0162] After the monosynaptic nature of optogenetically induced
EPSPs was verified, we applied STDP-like optical stimuli. LTD was
readily induced by the repeated pairing of light-elicited EPSPs and
action potentials after weak fear conditioning when
rAAV5-CamKIIa-hChR2-eYFP was infused into LA, but not when it was
infused into the mPFC. The optical STDP also produced no synaptic
plasticity in the amygdala slices prepared from naive animals or
animals that underwent strong fear conditioning (FIG. 1E).
[0163] Therefore, LTD was induced at the synaptic connections from
the LA to the dorsal ITC after weak fear conditioning.
[0164] 2-2. Increased Inhibition to Dorsal ITC Neurons after Weak
Fear Conditioning
[0165] We monitored basal synaptic transmission and found that
miniature IPSCs (mIPSCs) significantly increased after weak fear
conditioning (FIG. 2A), whereas no significant change in miniature
EPSCs (mEPSCs) was observed despite apparent reduction of
excitatory transmission (FIG. 2B).
[0166] We also evoked disynaptic inhibitory postsynaptic potentials
(IPSPs) in dorsal ITC neurons, because they receive GABAergic
inputs from neighboring ITC neurons and glutamatergic inputs from
the LA.
[0167] We observed biphasic PSPs, which consist of fast EPSP and
slow IPSP, evoked by LA stimulation and confirmed the disynaptic
nature by applying DNQX, an antagonist for
a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and
kainate receptors (FIG. 2C). The input-output curves revealed that
the inhibitory drives to the dorsal ITC neurons significantly
increased after weak fear conditioning compared with those in other
groups (FIG. 2D). Thus, GABAergic inputs onto the dorsal ITC
neurons might become enhanced by weak fear conditioning and thereby
may contribute to the induction of LTD by shunting inhibition.
[0168] To examine whether neuronal activity of the dorsal ITC could
be upregulated, we attempted to analyze the spontaneous activity in
vivo before and after weak fear conditioning. To this end, we
carefully defined the dorsal ITC neurons with their responses to
electrical stimulation of the infralimbic regions of the mPFC of
live animals and then confirmed the recording sites within the
dorsal ITC through postmortem examination. However, we failed to
detect significant changes in single-unit activity of those
identified ITC neurons, suggesting that neuronal activity of the
dorsal ITC itself was not significantly affected by weak fear
conditioning.
[0169] 2-3. DA-Dependent LTD by Activation of D4R
[0170] To address possible roles of DA in the dorsal ITC neurons,
we analyzed their intrinsic properties in the presence of DA (30
mM) and detected only negligible changes in the resting membrane
potentials (RMPs) and excitability before and after DA application.
While bath application of DA alone did not alter synaptic
transmission, LTD was readily induced by the STDP protocol in the
presence of DA (30 mM) (FIG. 3A).
[0171] To specify the pathway expressing DA-dependent LTD (DA-LTD),
we infused rAAV5-CamKIIa-hChR2-eYFP into LA and then were able to
induce DA-LTD with photostimulation (FIG. 3B). These results
support the idea that DA enables the synapses between the LA and
dorsal ITC to undergo LTD, which is similar to what we had observed
with LTD after weak fear conditioning.
[0172] To identify which subtype of DA receptors plays a dominant
role in the induction of DA-LTD, we blocked individual DA receptors
with various antagonists in optimal concentrations selective for
each receptor. Only a D4R-specific antagonist (L-745870) abolished
DA-LTD, whereas antagonists of D1/5R (SCH-23390), D2R (L-741626),
or D3R (GR-103691) did not affect DA-LTD (FIG. 3C).
[0173] Consistent with the antagonist data, activation of D4R with
PD-168077 allowed for the induction of LTD at the dorsal ITC as
effectively as DA did, but the agonists for D1/5R (SKF-38393), D2R
(quinpirole), or D3R (PD-128907) did not (FIG. 3D).
[0174] To exclude possible cross-reactivity of the pharmacological
manipulation, we took advantage of a genetic model deficient in
D4R. In D4R knockout (KO) mice, the same STDP protocol could not
induce LTD despite the presence of DA (FIG. 3E). Importantly,
L-745870 also interfered with the induction of LTD that had been
normally induced after weak fear conditioning in wild-type (WT)
mice, supporting the involvement of D4R (FIG. 3F).
[0175] Taken together, D4R is a major subtype of DA receptors
required for the induction of DA-LTD, and its activation is likely
to permit LTD in the dorsal ITC after weak fear conditioning.
[0176] D4R is expressed throughout brain regions including the
amygdala, and the polymorphisms are implicated in various
psychiatric disorders. Indeed, our immunohistochemistry revealed
the presence of D4R in the dorsal ITC as well as other amygdale
nuclei.
[0177] We also used structured illumination microscopy (SIM) over
the dorsal ITC neurons to resolve colocalization of D4R with either
synaptophysin, a marker for synaptic vesicles, or gephyrin, a
marker for GABAergic postsynaptic density. This superresolution
imaging indicated that D4R exhibited higher co-localization with
synaptophysin than with gephyrin.
[0178] To analyze the subcellular localization of D4R, we performed
post-embedding immuno-gold transmission electron microscopy. We
detected D4R-bound gold particles in axon terminals of symmetric
inhibitory synapses that were labeled with GAD67 and contacting the
somas (FIG. 3G). In contrast, no D4R immunoreactivity was observed
in GAD67-containing presynaptic terminals of D4R KO mice (FIG. 3H),
as expected. Therefore, D4R appears to be present in the dorsal ITC
synapses and predominantly distributed in GABAergic presynaptic
terminals.
[0179] 2-4. Feed-Forward Inhibition in the Dorsal ITC Leads to
DA-LTD
[0180] To elucidate the mechanistic bases of DA-LTD, we monitored
basal transmission of the dorsal ITC synapses. After the induction
of DA-LTD, mIPSC frequency significantly increased, whereas mEPSCs
were unaffected (FIGS. 4A and 4B).
[0181] Interestingly, cumulative probability plots of mIPSCs
revealed that both frequency and amplitude increased after DA-LTD,
but those of mEPSCs did not change. We also detected significant
increases in disynaptic IPSPs after DA-LTD induction (FIG. 4C),
indicating enhanced feed-forward inhibition presumably from the
neighboring dorsal ITC neurons.
[0182] To corroborate an increase in GABAergic transmission within
the dorsal ITC, we recorded postsynaptic currents (PSCs) from
single ITC neurons while interleaving stimulation of LA or dorsal
ITC areas (every 5 s) (FIG. 4D). Due to the small size of the
dorsal ITC, monosynaptic IPSCs were evoked with glass electrodes,
whereas EPSCs were evoked by stimulating the LA with standard metal
electrodes.
[0183] Notably, the latencies of postsynaptic currents evoked by
stimulation of both the LA (2.78.+-.0.19 ms) and the dorsal ITC
(3.76.+-.0.17 ms) were consistent with latencies of previously
reported monosynaptic currents. Once DA-LTD was induced, IPSCs were
potentiated while EPSCs were depressed (FIG. 4E). Presynaptic
neurotransmitter release can be represented by the quantal content
proportional to the inverse square of the coefficient of variation
(1/CV.sup.2) of evoked responses. Consistent with the enhanced
presynaptic release of GABA, 1/CV.sup.2 increased for IPSCs, but
not for EPSCs.
[0184] After synaptically coupled ITC neurons were identified with
action potentials elicited by current injection and resultant
outward IPSCs, we analyzed the unitary IPSCs (uIPSCs) by paired
recording (FIG. 4F). The amplitude of uIPSCs markedly increased
when LTD was induced by injecting currents to the postsynaptic ITC
neurons while stimulating the LA in the presence of PD-168077 (FIG.
4G). Notably, the increase in the amplitude of uIPSCs was
positively correlated with LTD magnitude, consistent with the
causal role of GABA release for LTD (FIG. 4H).
[0185] Since D4R was enriched at presynaptic sites (FIG. 3G), we
asked: does the increment of GABA release resulting from activation
of presynaptic D4R contribute to LTD? To address this question, we
selectively included GDP.beta.S, an antagonist of G protein
signaling in either presynaptic or postsynaptic ITC neurons.
GDP.beta.S blocked an LTD-induced increment of uIPSC amplitude when
infused into the presynaptic ITC neurons, but not when infused into
the postsynaptic ITC neurons (FIG. 4G).
[0186] Collectively, DA-LTD arose from the potentiation of
GABAergic transmission in intrinsic circuits of the dorsal ITC,
most likely by activation of presynaptic D4R.
[0187] 2-5. Blockade of D4R or Reversal of LTD is Sufficient to
Increase the Expression of Fear
[0188] If DA-LTD at the dorsal ITC is a synaptic mechanism that
regulates neural circuits conveying fear memory, manipulation of
D4R activity or synaptic plasticity at the dorsal ITC should affect
fear memory. To test this hypothesis, we first examined the
behavioral consequences of DA-LTD by pharmacological inactivation
of D4R at the dorsal ITC. We injected either vehicle or L-745870
bilaterally into the dorsal ITC areas and then assessed acquisition
and expression of fear memory (FIG. 5A).
[0189] Animals that received either vehicle or L-745870 displayed
comparable freezing levels during acquisition, which increased as
the pairings of CS and US were repeatedly presented (FIG. 5B). When
assessed at 24 hr after weak fear conditioning, L-745870-infused
mice exhibited significantly higher levels of freezing compared
with vehicle-infused animals (FIG. 5B), indicating the involvement
of D4R activity for fear expression.
[0190] We next developed a new genetic method to deplete D4R in
GABAergic neurons of the dorsal ITC. This viral vector enables us
to knock down a given gene with small hairpin RNA (shRNA) and
simultaneously identify those infected/knocked down neurons with
expression of eYFP in a Cre-dependent manner. We infused the AAV
containing shRNA for D4R (rAAV2-cKDeYFP-shD4R) into the dorsal ITC
of Dlx5/6-Cre (-) or Dlx5/6-Cre (+) mice expressing Cre at
GABAergic neurons (FIG. 5C).
[0191] eYFP was expressed mainly in the dorsal ITC area, and D4R
was markedly depleted in the dorsal ITC of Dlx5/6-Cre (+) mice
compared to that of Dlx5/6-Cre (-) controls. Importantly,
Dlx5/6-Cre (+) mice that received rAAV2-cKD-eYFPshD4R displayed
higher levels of freezing than Dlx5/6-Cre (-) mice, whereas
freezing levels during the acquisition of fear memory were
indistinguishable (FIG. 5D). Interestingly, WT and D4R KO mice did
not differ in fear expression to weak fear conditioning,
highlighting the importance of the dorsal ITC circuits for
controlling fear expression.
[0192] The small size of the dorsal ITC makes it difficult to be
completely certain that we localized the region-specific knockdown
of D4R only to the dorsal ITC. However, it should be noted that we
employed both pharmacological and genetic approaches for local
manipulation of D4R with the same results.
[0193] Therefore, we provide evidence that D4R in the dorsal ITC
neurons could, at least in part, be a functional prerequisite for
limiting fear expression, especially to less-salient experience,
and thus might delineate the integrity of fear memory.
[0194] 2-6. Optogenetic Inhibition of LTD Induces Fear
Expression
[0195] If synaptic plasticity in the dorsal ITC circuit was
faithfully induced by the cues associated with weak fear
conditioning, fear recall by cue exposure prior to recordings would
affect the subsequent induction of LTD. Indeed, LTD was occluded
when CS-induced recall was given to the fear-conditioned mice (FIG.
6A).
[0196] We surmised that fear expression could be altered if LTD is
reversed in the LA-dorsal ITC pathway. We sought to optogenetically
manipulate the LA-dorsal ITC pathway in order to abrogate LTD that
normally arose after weak fear conditioning. In the amygdala slices
from WT mice that received rAAV5-CamKIIa-hChR2-eYFP in LA, DA-LTD
was abrogated by repeated light illumination mimicking theta burst
stimulation (TBS) (FIG. 6B). It was shown that TBS induced
N-methyl-Daspartic acid receptor (NMDAR)-dependent LTP in the
LA-dorsal ITC pathway. We explored how optical TBS could affect
DA-LTD and discovered that TBS-induced reversal of LTD also
depended on NMDAR activity using its antagonist,
2-amino-5-phosphonopentanoic acid (APV).
[0197] With optic fibers implanted at the top of the dorsal ITC, we
applied optogenetic TBS and detected increased activity of the
dorsal ITC neurons. When the optogenetic TBS was applied between
fear recall tests (FIG. 6C), rAAV5-CamKIIa-hChR2-eYFP-infused mice
displayed significant increases in freezing levels to the
conditioned cue in the second recall test compared to those in the
first test, whereas optogenetic TBS resulted in no behavioral
changes in rAAV5-CamKIIa-eYFP-infused mice (FIG. 6D).
[0198] These results suggest that LTD at the dorsal ITC would be a
critical cellular substrate that can limit learned fear.
[0199] 2-7. Impaired LTD at the Dorsal ITC in a PTSD-Like Animal
Model
[0200] Since both D4R blockade and reversal of LTD resulted in
increased levels of fear expression, LTD could be affected in the
dorsal ITC of PTSD models. While most of the animal models for PTSD
have been produced by exposure to a variety of stresses, PTSD
models can also be produced by administration of glucocorticoids.
The PTSD-like impairment of fear memory could be represented with
enhanced fear responses as well as incapability to discriminate
between threat- and safeness-predicting stimuli.
[0201] When we injected corticosterone (CORT; 5 mg/kg), a
predominant form of glucocorticoid, into mice that underwent weak
fear conditioning, PTSD-like impairment in fear memory was
obviously observed; 24 hr after weak fear conditioning, the
conditioned cue resulted in higher freezing levels in CORT-injected
mice than in vehicle-injected animals, regardless of pairing the
sub-threshold US with either the auditory cue or context (FIG. 7A).
Importantly, the context also increased freezing levels in
CORT-injected mice although they underwent only cue conditioning
(FIG. 7B).
[0202] Subsequent to verification of PTSD-like impairment of fear
memory in CORT-injected mice, we found that LTD could not be
triggered in the dorsal ITC of CORT-treated mice, regardless of
fear conditioning, whereas LTD was readily induced in
vehicle-treated mice (FIG. 7C).
[0203] Interestingly, a glucocorticoid receptor antagonist RU38486
blocked both DA-LTD in naive mice and LTD in mice that underwent
weak fear conditioning. These results prompted us to speculate that
D4R elicits downstream signaling pathway(s) of glucocorticoid
receptors.
[0204] Consistent with functional overlapping of CORT- and
D4R-triggered signaling, irrelevant context led to increased
freezing levels in Dlx5/6-Cre (+) mice in which D4R was depleted in
the dorsal ITC, compared with those in Dlx5/6-Cre (-) mice (FIG.
7D).
[0205] To obtain mechanistic insights into the LTD impairment, we
constructed the input-output curves of evoked disynaptic IPSPs. The
disynaptic IPSPs in CORT-treated mice were not altered after weak
fear conditioning, whereas those in vehicle-treated mice
significantly increased (FIG. 7E). Thus, the LTD deficit in
CORT-treated mice appears to result from the impaired augmentation
of inhibitory inputs to the dorsal ITC neurons.
[0206] 2-8. Proposition of Possibility of Treating Posttraumatic
Stress Disorder (PTSD)
[0207] The results of Examples 2-7 indicate that the abnormality of
D4R mediated signaling and synaptic plasticity loss of an amygdala
inhibitory circuit may cause post-traumatic stress disorder.
Therefore, in Example 8, whether PTSD may be mitigated by treatment
with an agonist of the dopamine receptor subtype 4 (D4R) in mice
with PTSD-like symptoms was examined.
[0208] As shown in FIG. 8, cue fear-conditioned mice were treated
with PD-168077
(N-([4-(2-cyanophenyl)piperazine-1-yl]methyl)-3-methylbenzamide- )
as an agonist of the D4R to increase the function of the receptor,
from which it can be seen that fear behavioral reactions (freezing)
was significantly reduced by 50% or more compared to a control
(vehicle).
[0209] Therefore, the D4R agonist of the present invention can
induce long-term synaptic depression (LTD) at the dorsal ITC of the
amygdala to suppress fear reactions, and thus can be usefully used
to prevent or treat PTSD.
[0210] According to the present invention, it has been revealed
that a specific type of dopamine receptor is associated with a
LTD-induced fear memory expression mechanism, and therefore the
understanding of the pathogenesis of PTSD can be improved.
[0211] In addition, the present invention provides an animal model
exhibiting PTSD-like clinical symptoms and a method for preparing
the same, which can be applied in analyses of stability and
effectiveness of a therapeutic agent for PTSD and screening of a
therapeutic drug.
[0212] Further, a target disclosed in the present invention, D4R,
is only expressed in a specific part of the brain at a low
expression level, and since it is also less expressed in the
amygdala, which is considered to be important in fear conditioning,
the D4R is regarded as one of the therapeutic targets that can
minimize side effects. Particularly, the D4R is a target based on a
molecular mechanism for synaptic plasticity generated specific to
circuits of an inhibitory neuronal cell population present in the
amygdala, and thus a drug targeting D4R has a higher understanding
of application thereof than those of conventional drugs.
[0213] Furthermore, since the D4R agonist of the present invention
has been approved by the US FDA and clinically used for psychiatric
diseases such as schizophrenia, it can be immediately used in
clinical applications for PTSD symptoms.
[0214] It will be apparent to those skilled in the art that various
modifications can be made to the above-described exemplary
embodiments of the present invention without departing from the
spirit or scope of the invention. Thus, it is intended that the
present invention covers all such modifications provided they come
within the scope of the appended claims and their equivalents.
* * * * *
References