U.S. patent application number 15/425882 was filed with the patent office on 2017-12-28 for microarray system with improved sequence specificity.
The applicant listed for this patent is Mark Aaron Behlke, Kerry B. Gunning. Invention is credited to Mark Aaron Behlke, Kerry B. Gunning.
Application Number | 20170369936 15/425882 |
Document ID | / |
Family ID | 40351125 |
Filed Date | 2017-12-28 |
View All Diagrams
United States Patent
Application |
20170369936 |
Kind Code |
A1 |
Gunning; Kerry B. ; et
al. |
December 28, 2017 |
MICROARRAY SYSTEM WITH IMPROVED SEQUENCE SPECIFICITY
Abstract
The invention provides a novel array method for nucleic acid
sequence detection with improved specificity which allows for
detection of genetic variation, from simple SNPs (where the
variation occurs at a fixed position and is of limited allelic
number) to more complex sequence variation patterns (such as with
multigene families or multiple genetic strains of an organism where
the sequence variation between the individual members is neither
fixed nor consistent). The array is comprised of short, synthetic
oligonucleotide probes attached to a solid surface which are
hybridized to single-stranded targets. Single stranded targets can
be produced using a method that employs primers modified on the 5'
end to prohibit degradation by a 5'-exonuclease that is introduced
to degrade the unprotected strand. The invention further provides
for printing buffers/solutions for the immobilization of
oligonucleotide probes to an array surface. The invention also
provides hybridization and wash buffers and conditions to maximize
hybridization specificity and signal intensity, and reduce
hybridization times.
Inventors: |
Gunning; Kerry B.; (San
Diego, CA) ; Behlke; Mark Aaron; (Coralville,
IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Gunning; Kerry B.
Behlke; Mark Aaron |
|
|
US
US |
|
|
Family ID: |
40351125 |
Appl. No.: |
15/425882 |
Filed: |
February 6, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14576076 |
Dec 18, 2014 |
|
|
|
15425882 |
|
|
|
|
13911971 |
Jun 6, 2013 |
8945928 |
|
|
14576076 |
|
|
|
|
13650087 |
Oct 11, 2012 |
|
|
|
13911971 |
|
|
|
|
13294792 |
Nov 11, 2011 |
|
|
|
13650087 |
|
|
|
|
12190446 |
Aug 12, 2008 |
8067164 |
|
|
13294792 |
|
|
|
|
60955384 |
Aug 12, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12P 19/34 20130101;
C12Q 1/6806 20130101; B01J 2219/00608 20130101; Y10T 436/108331
20150115; B01J 2219/00626 20130101; B01J 19/0046 20130101; C12Q
1/6806 20130101; C12Q 2533/101 20130101; C12Q 2525/125 20130101;
B01J 2219/0059 20130101; B01J 2219/00722 20130101; C12Q 1/6837
20130101; C12Q 2521/319 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34; B01J 19/00 20060101
B01J019/00 |
Claims
1. An array comprising a surface comprising epoxide moieties and a
plurality of oligonucleotides each comprising a 5' hydrazide linker
attached to the surface of the array through a bond formed between
the linker and an epoxide moiety.
2. A method of forming a microarray on a surface comprising epoxide
moieties, comprising: depositing a plurality of samples onto the
surface in discrete domains, each sample comprising a spotting
buffer and an oligonucleotide comprising a 5' hydrazide linker,
under conditions that allow formation of a bond between the
hydrazide linker and the epoxide moiety.
3. The method of claim 2, wherein the spotting buffer has a pH of
less than about 8.5 and comprises monobasic sodium phosphate, an
ethylene oxide based nonionic detergent, and ethylene glycol.
4. The method of claim 3, wherein the nonionic detergent is Nonidet
P-40.
5. The method of claim 3, wherein the pH is between about 4.0 and
about 8.0.
6. The method of claim 3, wherein the pH is between about 4.5 and
about 5.5.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/576,076, filed Dec. 18, 2014, which is a
divisional of U.S. patent application Ser. No. 13/911,971, now U.S.
Pat. No. 8,945,928, issued Feb. 3, 2015, which is a continuation of
U.S. patent application Ser. No. 13/650,087 filed Oct. 11, 2012,
now abandoned, which is a continuation of U.S. application Ser. No.
13/294,792 filed Nov. 11, 2011, now abandoned, which is a
divisional of U.S. patent application Ser. No. 12/190,446, filed
Aug. 12, 2008, now U.S. Pat. No. 8,067,164, issued Nov. 29, 2011,
which claims the benefit of U.S. Provisional Application No.
60/955,384, filed Aug. 12, 2007. These applications are
incorporated herein by reference in their entirety.
STATEMENT REGARDING FEDERALLY SPONSORED R&D
[0002] Not applicable.
SEQUENCE LISTING
[0003] The sequence listing is filed with the application in
electronic format only and is incorporated by reference herein. The
sequence listing text file "CLULA_014C3.txt" was created on Feb. 6,
2017, and is 14.5 bytes in size.
BACKGROUND OF THE INVENTION
[0004] Methods that allow highly specific detection of nucleic
acids sequences, i.e., that permit discrimination between closely
related sequences, including similar or related sequences differing
by only a single base, are important in various applications,
including, for example, detecting or distinguishing between
multimember gene families, microRNAs (miRNAs), viral serotypes, or
genetic variation between individuals. Highly specific detection
methods are generally complex and require numerous steps, and
therefore, are not suitable for use in a high throughput format.
Methods that are amenable to high throughput, such as nucleic acid
microarrays, typically rely solely on nucleic acid hybridization
for specificity and therefore have a limited ability to distinguish
between closely related sequences.
[0005] There is a need in the art for a method of detecting or
discriminating between nucleic acid sequences having high
specificity and that is amenable to a high throughput format, such
as microarrays, The method would be generally useful in a variety
of applications requiring
SUMMARY OF THE INVENTION
[0006] In one aspect, the invention includes a method of preparing
a detectably labeled single-stranded polynucleotide target from a
double stranded DNA comprising the detectably labeled
polynucleotide target hybridized to a complementary polynucleotide.
The double stranded DNA is contacted with a 5' to 3' exonuclease
under suitable conditions to degrade at least a portion of the
complementary polynucleotide to form a detectably labeled
single-stranded polynucleotide target. The single-stranded
polynucleotide target includes one or more of: a cyanine dye moiety
positioned between the second and third nucleotides from the 5' end
of the polynucleotide target; a cyanine dye moiety positioned
between first and second nucleotides from the 5' end of the
polynucleotide target and a modified linkage between the second and
third nucleotides from the 5' end of the polynucleotide target; a
cyanine dye moiety attached at the 5' end of the polynucleotide
target, with the complementary strand modified with a 5'-phosphate
group or a primary amine with an aliphatic linker arm connected to
the polynucleotide via a phosphate linkage and the first 5'-residue
of said polynucleotide being an A or a T base; and a dye moiety
attached at the 5' end of the polynucleotide target and the first
5'-residue of said polynucleotide being a G or C base, with the
complementary strand modified with a 5'-phosphate group or a
primary amine with an aliphatic linker arm connected to the
polynucleotide via a phosphate linkage and the first 5'-residue of
said polynucleotide being an A or a T base.
[0007] In another aspect, the invention provides a method of
generating a double stranded DNA comprising a detectably labeled
polynucleotide target hybridized to a complementary polynucleotide
using primers that include modifications that render the target and
complementary polynucleotides differentially sensitive to a 5' to
3' exonuclease.
[0008] Also provided is an array comprising a surface comprising
epoxide moieties and a plurality of oligonucleotides each
comprising a 5' hydrazide linker attached to the surface of the
array through a bond formed between the linker and an epoxide
moiety, and methods of making such arrays.
[0009] The invention further provides a buffer that can be used to
make arrays. The buffer has a pH in the range of from about 4.0 to
about 8.0 and includes sodium phosphate (monobasic) in a
concentration in the range of from about 1 mM to about 1M, an
ethylene oxide based nonionic detergent in a concentration in the
range of from about 0.001% to about 1% (v/v), and ethylene glycol
in a concentration in the range of from about 10% to about 90%
(v/v).
[0010] In yet another aspect, the invention provides a method of
detecting the presence of a specific nucleic acid sequence within a
pool of detectably labeled target polynucleotides by hybridization
to one or more oligonucleotide probes attached to a support. The
support is contacted with the polynucleotides under high stringency
conditions in a buffer comprising a tertiary alkyl ammonium salt
and formamide. The unhybridized target polynucleotides are removed
by washing the support under conditions similar to those used
during the hybridization for a period about 30 minutes or less, the
presence or absence of labeled target polynucleotides is
detected.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 illustrates an array system design wherein the target
material consists of an antisense strand that is the product of a
reverse transcription of an RNA sample, and is subsequently
amplified through asymmetric PCR or PCR followed by enzymatic
digest of the sense strand prior to hybridization to immobilized
sense-strand probe material.
[0012] FIG. 2 illustrates an array system design with the opposite
target/probe strand orientation wherein the target material is the
sense strand and the probe material, which is immobilized on the
microarray slide surface, is the antisense strand.
[0013] FIG. 3 illustrates an array method that utilizes
multiplexing through the use of sequence tags, employing an RNA
virus model system as an example.
[0014] FIG. 4 illustrates the use of the array invention in tandem
with RNA linkers.
[0015] FIG. 5 illustrates the effectiveness of the improved
hybridization buffer and wash protocols (FIG. 5B) over conventional
buffer and wash protocols (FIG. 5A) and the improved discrimination
achieved using short "818" design oligonucleotide probes (FIG.
5B).
[0016] FIG. 6A shows differential migration of the individual
single-stranded DNA model oligos, and differential exonuclease
sensitivity of two fluorophores.
[0017] FIG. 6B illustrates sensitivity to exonuclease of DNA having
various 5'-end modifications.
[0018] FIG. 6C shows that the 5'-Cy3 modification confers
resistance to lambda exonuclease that is independent of the 5'-end
base composition.
[0019] FIG. 6D shows T7 Exonuclease protection using multiple
phosphorothioate internucleoside linkages between 5'-end
nucleotides.
[0020] FIG. 6E demonstrates T7 Exonuclease protection using one or
less phosphorothioate internucleoside linkage.
[0021] FIG. 7 demonstrates the improved sensitivity that is
achieved by using a single-stranded hybridization target compared
to the same hybridization target when it is double-stranded.
[0022] FIG. 8 illustrates that hybridization signals from the
5'-ILinker modified oligonucleotide probes are significantly
stronger than the hybridization signals from the same probes
printed as amino-modified or unmodified oligonucleotides when
hybridized to the same target under the same conditions.
[0023] FIG. 9 compares different epoxide spotting solutions.
Oligonucleotide probes (41mers) were spotted at 40 uM concentration
on an epoxide slide (Corning) using the Example 1 epoxide spotting
buffer formulation (ESB), 3.times.SSC, and three different
commercially available spotting solutions marketed as either
"specifically formulated for use on", or "compatible with" the
epoxide slide surface. The sub-arrays were then hybridized with
complementary Cy3.TM.-labeled oligonucleotide targets, washed, and
scanned using a ScanArray.RTM. 5000 (Perkin-Elmer) at 62/62 laser
(power/gain) settings.
[0024] FIG. 10 illustrates the effect of Nonidet P-40 as a
component of spotting buffer on probe spot size. Oligonucleotide
probes (70mers) were spotted at 40 uM concentration on an epoxide
slide (Coming) using the Example 1 epoxide spotting buffer
formulation supplemented with varying concentrations of NP-40. The
sub-arrays were then hybridized with Cy3.TM.-SpotQC, washed, and
scanned, using the ScanArray.RTM. 5000 (Perkin-Elmer) at 69/69
(optimal setting for the 50% GC probe) & 78/78 (optimal setting
for the 38.6% GC probe) laser (power/gain) settings.
[0025] FIG. 11 illustrates the results of Let7 model hybridizations
using a "traditional" DNA microarray format using the method of the
invention.
[0026] FIG. 12 illustrates the results of Let7 model hybridizations
using a "reverse" DNA microarray format using the method of the
invention.
[0027] FIG. 13 illustrates oligonucleotide probes (41mers) that
were spotted at 40 uM concentration on an epoxide slide (Corning)
using different spotting solution formulations that varied by
source of sodium (300 mM sodium phosphate, monobasic vs.
3.times.SSC) and pH. The sub-arrays were then hybridized with
complementary Cy3.TM.-labeled oligo targets and scanned, using the
ScanArray.RTM. 5000 (Perkin-Elmer) at 60/60 laser (power/gain)
settings.
DETAILED DESCRIPTION OF THE INVENTION
[0028] The invention provides a novel array system for nucleic acid
sequence detection having high specificity, capable of detecting
genetic variation and discriminating between variant sequences.
[0029] In one embodiment, the array comprises synthetic
oligonucleotide probes spotted on a solid surface that can be
hybridized to a single-stranded target that is modified to permit
detection. The labeled target can be prepared by PCR amplification
in which one of the primers modified at or near the 5'-end to
prevent degradation by a 5'- to 3'-exonuclease, thereby allowing
preferential exonuclease degradation of the unprotected
complementary strand, thus producing a final product comprising
single-stranded target from a double-stranded amplification
product. The invention is also intended to encompass applications
in which the final product formed is enriched with respect to the
single-stranded target, although some of the complementary strand
may remain.
[0030] The invention may include various aspects that enhance
sensitivity or specificity of detection of target oligonucleotides,
or reduce process time, or enhance throughput, which may be used
alone or in various combinations. Aspects of the invention include
probe design, probe attachment, probe spotting buffer composition,
preparation of labeled single-stranded targets, hybridization
buffer, and hybridization and wash conditions.
[0031] Probe Design.
[0032] Generally, shorter probes have a high specificity but a low
sensitivity with a greater chance of cross-hybridization. The
exception would be a very short sequence that could occur multiple
times in a genome, therefore being less specific (e.g., a 6-base
sequence occurs on average once every 4000 bases. Historically,
microarrays have employed probes of >20 bases to improve
sensitivity. Because all nucleic acid hybridization events on a
microarray occur simultaneously under identical conditions,
traditional methods use probes designed to normalize the Tm. In
other words, probes are designed such that the melting temperature
of the each probe is substantially the same, so that all probes can
be hybridized in parallel in the same buffer at the same
temperature. DNA base composition varies widely within localized
regions of a genome. The location of a SNP defines the sequence
context of a probe to detect that SNP, and the local GC content of
that sequence can vary widely. As a result, Tm normalized probes
will vary significantly in length. For example, keeping Tm fixed at
70.degree. C., probe length could vary from 14 bases to >50
bases, depending on relative GC content. When using this approach,
short probes will show superior mismatch discrimination compared to
long probes. Long probes, however, cannot be shortened without
lowering Tm, and lower Tm probes cannot be hybridized
simultaneously with other probe sequences having a higher Tm.
Affinity can be increased using modified bases, such as locked
nucleic acids (LNAS), however these modifying groups are expensive
and their use is unrealistic for high content arrays.
[0033] In the present invention, probe sequences are short (<20
bases) and all probes have the same, or substantially the same,
length. By substantially the same length, it is meant that at least
90% of the probes in the array vary by no more than plus or minus
two bases from the median probe length. Suitably, at least 90% of
the probes fall within plus or minus one base of the median probe
length. In one embodiment, the probe is 17 nucleotides in
length.
[0034] Tm normalization is achieved by employing hybridization
buffers that reduce the affinity differences between GC and AT base
pairs, thus reducing sequence dependence of the Tm. Hybridization
buffers and conditions according to the present invention are
described below.
[0035] In a further embodiment, when the probe is used for SNP
detection, the base corresponding to the SNP is positioned
centrally within the probe sequence. In the case of a 17mer probe,
there are 8 bases 5'- and 8 bases 3'- to the centrally located SNP
base. This design will be referred to as an "818" design hereafter.
If more than one polymorphism is present, the variable bases may be
positioned as near to the center of the probe as possible. In
another embodiment, probe length can be varied, and probes of 15-20
bases length can be used. In general, probes under 15 base length
will have reduced sensitivity and probes greater than 20 base
length will have reduced specificity.
[0036] Attachment Chemistry.
[0037] In another aspect, arrays are formed by applying probes to a
solid surface so as to enhance signal intensity following
hybridization. Sensitivity of detection is enhanced by improving
attachment of the oligonucleotide to the solid surface. In one
embodiment, a hydrazide-modified probe is attached to an epoxide
surface. The hydrazide improves attachment of the oligo probe to
the solid surface. For short 17 base probes, the use of a hydrazide
attachment to epoxide surfaces enhances signal intensity by greater
than 3-fold. This attachment can be used for probes of any length,
but is particularly helpful with shorter probes, because as oligo
length decreases, the number of available nucleo-base amine groups
available for attachment of the probe to epoxide also decreases.
Thus, hydrazide attachment chemistry is especially helpful when
using shorter probes.
[0038] Amino modified oligonucleotides react with active epoxide
slides, opening the epoxide ring and forming a stable amide bond.
Hydrazide modified oligonucleotides react in the same manner, but
the attachment is stronger because hydrazide is a stronger
nucleophile. The reaction also occurs at a lower pH whereas amines
are protonated at low to neutral pH conditions. As demonstrated in
Example 12, the hydrazide modified oligonucleotides demonstrate a
more intense signal compared to unmodified oligonucleotides and
amino-modified oligonucleotides, especially at lower pH conditions.
Preferably, the pH is less than 8.5. Suitably, the pH is in the
range of from about 4 to about 8.5. More preferably, the pH is in
the range of from about 4.5 to 5.5.
[0039] Spotting Buffer.
[0040] A spotting buffer formulation according to the present
invention can further increase signal intensity and improve spot
morphology. One aspect of the present invention is a spotting
buffer that improves the signal intensity and spot morphology of
oligonucleotides printed on epoxide surfaces, and is suitable for
use in conjunction with hydrazide attachment chemistry of the
invention. The epoxide spotting buffer (ESB) of the present
invention comprises a monobasic sodium phosphate (low pH), an
ethylene oxide based non-ionic detergent such as Nonidet P-40
(NP-40), and ethylene glycol. The ESB can be used to more
efficiently attach either unmodified or amino-modified oligo probes
through a covalent linkage to an epoxide-surface microarray slide.
The ESB also enables the immobilization of an oligo probe to the
epoxide surface through a covalent linkage utilizing a
hydrazide-modified oligonucleotide, allowing efficient
immobilization of very short oligonucleotide probes (16-17mers). In
addition, ESB can be made-up as a concentrated formulation (e.g., a
2.times. formulation) that can be used to "rescue" oligo probes
that have been previously resuspended in a variety of different
spotting solutions.
[0041] Nonidet P-40 (NP-40), which is currently available under the
name Igepal CA-630, is an ethylene oxide based non-ionic detergent,
which is more compatible with epoxide surfaces than are other
classes of detergents. It is also compatible with the
anti-evaporation additive ethylene glycol. It is expected that
other ethylene oxide based non-ionic detergents such as Triton
X-100, an ethylene oxide based non-ionic detergent, but differs
from NP-40 in the number of ethylene oxide units, could also be
used in the EBS of the present invention.
[0042] The use of monobasic sodium phosphate in the composition of
an epoxide spotting solution helps to attain maximal attachment of
the 5' hydrazide modified oligonucleotide probes to an epoxide
surface. Increasing the pH of the spotting solution by either
titrating in sodium hydroxide (NaOH) or by changing the source of
sodium (3.times.SSC) results in decreased hybridization signal,
suggesting decreased oligonucleotide probe attachment density
within the probe spot and also increases probe spot size (see FIG.
9). The factors showing the greatest impact on probe attachment
density seems to be pH, with slightly acidic pH being superior, and
use of the 5' hydrazide modifier instead of an amino-modifier or no
modification. The spotting buffer components that have the greatest
impact on spot size seems to be the source of sodium and the
detergent, with monobasic sodium phosphate and NP-40 being
preferred.
[0043] The composition of the final 1.times. spotting solution is
compatible with formulation as a 2.times. concentrate (all
components remain in solution). This, in turn, allows a 1:1
dilution with oligo probe material that has already been
resuspended in a different, sub-optimal spotting solution,
effectively rescuing the probe material for efficient
immobilization on epoxide microarray slides. For example, large
sets of oligonucleotide probes may exist in a laboratory which were
previously suspended in water, 3.times.SSC, or other sub-optimal
spotting solution. Use of a 2.times. concentrate of the new ESB can
improve spotting of these probes without requiring complete buffer
substitution, which may not be feasible for low concentration, low
yield probe sets.
[0044] Preparation of Labeled Targets.
[0045] The probes on a spotted microarray are hybridized to a
target nucleic acid that is labeled to facilitate detection. In
general, target sequences are seldom present in biological samples
in sufficient amounts to permit direct detection. It is therefore
envisioned that some amplification process will be performed on a
heterogeneous biological nucleic acid sample and that the amplified
product will be hybridized to the array. PCR based methods
resulting in exponential target amplification are powerful.
However, the products of exponential PCR are double-stranded, with
each strand being present in equimolar amounts. With denaturation
and subsequent hybridization, the complementary strands of the
amplified targets can re-hybridize to each other and compete with
probe hybridization. If the target nucleic acid is long, the
stability of the target-target duplex will be greater than the
target-probe duplex and this reaction will be favored, resulting in
a weak or absent hybridization signal on the array. It is therefore
preferable to use single-stranded targets such that the sole or
primary species is the strand complementary to the immobilized
probe sequence.
[0046] Many different amplification methods exist which can produce
single-stranded labeled targets. For example, linear amplification
can be performed using thermal cycling (similar to cycle
sequencing). While this method produces single-stranded targets,
the amplification power is low and typical yields are 30-100 fold
amplification. PCR based methods can give 10.sup.8 fold
amplification. Asymmetric PCR can be used which starts as
exponential PCR and then shifts to linear amplification after
consumption of a limiting primer. Although more powerful than
simple linear amplification this method still produced far less
amplification than true exponential PCR. As one aspect of the
present invention, an improved method of generating single-stranded
labeled template is described that employs full exponential PCR
followed by selective degradation of the undesired target
strand.
[0047] The array system and its methods of use include a method for
identifying or typing genetic strains by amplifying nucleic acid
molecules (DNA or RNA) of a sample with one or more primers that
are specific to a conserved region of a genetic strain being
assessed (e.g., PCR, asymmetric PCR, RT, or RT followed by either
PCR or asymmetric PCR), to thereby obtain an amplified nucleic acid
product. The methods also involve contacting the amplified nucleic
acid product with one or more genetic strain specific probes having
a nucleic acid sequence that is specific for only one genetic
variant in a group being assessed, wherein the nucleic acid
sequence includes between about 9 and 25 nucleic acid bases. The
presence of one or more hybridization complexes with a genetic
strain specific probe indicates the presence of one or more
specific genetic strain, and the absence of one or more
hybridization complexes with a genetic strain specific probe
indicates the absence of the specific genetic variant in the
sample. Amplification of the nucleic acid molecules can be obtained
using PCR, asymmetric PCR, RT, or RT followed by either PCR or
asymmetric PCR.
[0048] The target that is amplified can originate from any genetic
sample, including samples from the feces, saliva, sputum, aspirate,
blood, plasma, cerebrospinal fluid, aspirate, tissue, skin, urine,
mucus, etc. The methods of this invention can work with a sample
containing a vast amount of non-specific genetic material, which is
not related to the genetic material of interest.
[0049] When amplification occurs via PCR, asymmetric PCR, RT, or RT
followed by either PCR or asymmetric PCR, select primers containing
one or two phosphorothioate linkages can be utilized (PS-primer).
Preferably two linkages are PS modified. The resulting nucleic acid
strands generated from the PS-primers are protected from
degradation by a 5'-to-3' exonuclease that will degrade the
complementary strands generated by the unmodified (non-PS) primer,
thereby creating a single-stranded target that is suitable for use
in the array system. The PS-primer can be modified with a
fluorophore at the 5' end, said fluorophore can be optionally
attached via a phosphorothioate linkage but is not required.
Ideally the fluorophore will be suitable for direct detection by
microarray scanning fluorometers. Examples include Cy3 and Cy5
dyes. Other dyes can be used. In one embodiment, two
phosphorothioate bonds are positioned in the internucleoside
linkages between the first and second and second and third bases
from the 5'-end of the primer oligonucleotide. This configuration
provides substantially complete protection from degradation using
the enzyme T7 Exonuclease. If a 5'-fluorophore is present, the
linkage between the fluorophore and the first nucleotide at the 5'
end can employ a phosphodiester bond. It is not necessary to modify
this bond; however use of PS bond between the fluorophore and the
first base does not impair function and can be used. In addition,
there is partial protection when only a single PS bond is present
between the first and second nucleotide positions in conjunction
with the presence of a 5'-fluorophore; no partial protection is
evident when a single PS bond between the first and second
nucleotide positions is present in the absence of the
5'-fluorophore. However, a single PS bond placed between the second
and third nucleotide positions confers substantially complete
protection from T7 Exonuclease digestion if it is present in the
absence of a 5'-fluorophore. This is consistent with T7 Exonuclease
cleaving initially in a dinucleotide unit and then proceeding by
cleaving mononucleotides until it dissociates. The methods of
target preparation taught in the present invention enable use of
full exponential PCR, produces single-stranded target molecules,
and employs primers with the minimum modification necessary to
protect the desired target strand from exonuclease degradation.
Utility and use of single-stranded targets prepared using the
method of the invention is shown in Example 3, FIGS. 7 and 8.
[0050] Another embodiment of the invention employs an internally
placed fluorophore located near the 5'-end of the primer. If a Cy3
or other cyanine dye is positioned between the second and third
bases from the 5'-end of the primer oligonucleotide, this strand of
the resulting PCR product is resistant to degradation by T7
Exonuclease, even in the absence of phosphorothioate or other
nuclease-resistant modifications. Internal placement of the cyanine
dye between the first and second bases from the 5'-end of the
primer oligonucleotide provides for partial nuclease resistance; in
this case, incorporation of a single phosphorothioate bond or other
nuclease-resistant modification between bases 2 and 3 from the
5'-end will, together with the internal cyanine dye, protect that
strand of the resulting PCR product from degradation by T7
Exonuclease. The methods that allows T7 Exonuclease degradation of
a complementary strand to produce single-stranded targets is
described in Example 2, FIGS. 6D and 6B.
[0051] The methods above employ the enzyme T7 Exonuclease to
convert a detectably labeled double-stranded nucleic acid into a
detectably labeled single-stranded nucleic acid suitable for
hybridization to short probes oligonucleotides. In yet another
embodiment of the invention, a method to produce detectably labeled
single-stranded nucleic acid species using Lambda Exonuclease is
described. Lambda Exonuclease is a processive 5' to 3' nuclease
that removes 5; mononucleotides from duplexed DNA. Initiation of
degradation is typically thought to require a phosphate group at
the 5'-end. of the degraded strand. The present invention includes
novel methods to trigger strand degradation by Lambda Exonuclease
which do not require a 5'-phosphate. The presence of a variety of
non-phosphate modifying groups at the 5'-end of the nucleic acid
will trigger degradation of that strand of a double-stranded
nucleic acid by Lambda Exonuclease. A 5'-amino-modifier (primary
amine linked to the nucleic acid by a 6 carbon alkyl linker and a
phosphate bond) will trigger Lambda Exonuclease attack. Cyanine
dyes, such as Cy3 or Cy5, placed at the 5'-end of one strand of a
double-stranded nucleic acid are resistant to Lambda Exonuclease
degradation. Use of two differentially modified oligonucleotide
primers, one having a 5'-cyanine dye and the second having a
5'-amino-modifier, can be employed to generate a double-stranded
PCR product having a 5'-cyanine dye on one strand and a
5'-amino-modifier on the complementary strand. This double-stranded
nucleic acid will be a substrate for Lambda Exonuclease degradation
such that the amino-modified strand will be substantially degraded
while the cyanine dye labeled strand will remain intact, resulting
in a detectably labeled single-stranded nucleic acid that can be
employed in hybridization experiments.
[0052] Additional 5'-modifying groups can be used to trigger Lambda
Exonuclease attack. While cyanine dyes do not trigger degradation,
other fluorophores will trigger attack by Lambda Exonuclease. For
example, fluorescein will trigger degradation, but only if the
first 5' base of the nucleic acid is an A or a T residue. A
5'-fluorescein group adjacent to a C or G residue will be resistant
to attack by Lambda Exonuclease. It will be clear to one skilled in
the art that the differential reactivity of cyanine and fluorescein
dyes can be used to make a dual-labeled double-stranded nucleic
acid, one strand having a 5'-cyanine dye and the complementary
strand having a 5'-fluorescein dye, and that this double-stranded
nucleic acid will be reduced to a single-stranded cyanine-dye
labeled species if a 5'-A or 5'-T residue is adjacent to the
fluorescein modifier. This strategy permits control of degradation
based upon sequence context.
[0053] Hybridization Buffer.
[0054] Use of short oligonucleotide probes of identical length in a
traditional sodium based hybridization buffer will result in widely
variable hybridization results dependant upon the Tm of each probe.
One aspect of the invention is use of hybridization buffer that
minimizes the Tm difference between oligonucleotides of different
sequence. In the buffer system described herein, hybridization is
regulated more by the length of perfect base pairs present between
probe and target such that the effects of mismatches are magnified
while variations in sequence which do not contribute to mismatch
are minimized. In one embodiment, the hybridization buffer is a
combination of Tris at a pH around 8; EDTA; Sarkosyl; Ovalbumin;
CTAB; Ficoll Type 400; PVP-360; tetramethyl ammonium chloride
(TMAC); formamide; and Cot-1 DNA. In another embodiment, the
composition of the hybridization buffer is: 37.5 mM Tris pH 8, 3 mM
EDTA, 0.25% Sarkosyl, 0.4 mg/mL Ovalbumin, 1 mM CTAB, O.4 mg/mL
Ficoll Type 400, O.4 mg/mL PVP-360, 2.5M TMAC, 10% Fonnamide, 10
ug/mL Cot-1 DNA. The composition of the 1.times.SNP Wash Buffer 1
is: 2.5M TMAC, 0.2% Sarkosyl.
[0055] Typically, microarray hybridization is done under relatively
non-stringent conditions to maximize hybridization and thereby
maximize signal. The hybridization step is usually long, typically
overnight (>12 hours). This permits imperfect hybridization
events to take place, decreasing specificity. Specificity is then
improved by using stringent wash conditions. The method of the
present invention has reversed this approach and obtains greater
mismatch discrimination in shorter hybridization periods. Unlike
buffers described in the prior art (see U.S. Pat. No. 6,361,940),
the advantage of the proposed system is that it analyzes the
probe/target interaction at the hybridization (or ON) step. Post
hybridization wash steps are rapid and are less stringent than the
original hybridization conditions. Most hybridizations methods use
wash conditions that are more stringent than the hybridization
conditions and therefore analyze samples that have been hybridized
and then stripped off. Traditional approaches employ the concept
that mismatches can be preferentially stripped while leaving the
perfect-matched hybridization duplexes intact. The conditions
described herein achieve maximal signal at 2.25 hours hybridization
at 50.degree. C., then a 15 minute wash at 50.degree. C. in
1.times.SNP Wash buffer 1, followed by a 1 minute rinse in
2.times.SSC at room temperature, followed by a brief rinse (1-2
seconds) in 0.2.times.SSC at room temperature, spin dry the slide,
and then scan to visualize.
[0056] Traditional array hybridization protocols utilize a
stringent wash (the array is washed with a low-salt buffer at a
constant temperature) to remove non-specific pairs that have also
hybridized. There is often a first wash that is moderately
stringent followed by one or more higher stringency washes that
preferentially remove the non-specific hybridization targets.
However, specific and non-specific hybridization targets are
removed resulting in less signal while maintaining the same
differential hybridization.
[0057] The proposed hybridization and wash methods provide
hybridization conditions that enhance selective hybridization of
the specific target. A non-stringent wash step exploits the
variable of target concentration in the hybridization kinetics
equation; i.e., lower the concentration of the target and the
non-specific hybridization events are selected against while the
maintained salt concentration (or stringency) helps to stabilize
(or maintain) the hybridization of the specific target in the
lowered target concentration environment. Both improved specificity
and improved sensitivity (increased signal) result through use of
these new methods. Demonstration of the utility of the new
hybridization buffer, wash buffer compositions and hybridization
and wash protocols is shown in Example 1, FIG. 5.
[0058] Hybridizations using the new hybridization buffer can be
conducted for example, at 50.degree. C. for from 1-4 hours, of
similar with hybridizations of 2-2.5 hours being preferred. Washes
were performed in a buffer having an ionic strength similar to that
of the hybridization buffer, (2.5M TMAC, 0.2% Sarkosyl) and without
formamide at 50.degree. C. for 15 minutes, with washes of 10-30
also giving good results.
[0059] One suitable hybridization buffer includes 37.5 mM Tris pH
8, 3 mM EDTA, 0.25% Sarkosyl, 0.4 mg/mL Ovalbumin, 1 mM CTAB, 0.4
mg/mL Ficoll Type 400, 0.4 mg/mL PVP-360, 2.5M TMAC, 10% Formamide,
10 ug/mL Cot-1 DNA). However, as one of skill in the art will
appreciate, minor variations to this formulation can be made
without affecting its performance and are intended to fall within
the scope of the invention. For example, the buffer may include a
higher or lower concentration of Tris buffer at a pH range of from
7-8.5, from 1-10 mM EDTA, from 0.1 to 1% Sarkosyl from 0.1-1 mg/ml
ovalbumin, from 0.1-5 mM CTAB, from 0.1-1.0 mg/mL Ficoll Type 400,
00.1-1.0 mg/mL PVP-360, from 2.0-3.0M tetramethyl ammonium chloride
(TMAC), from 0.20% Formamide, and from 1-100 ug/mL Cot-1 DNA.
[0060] General categories of applications in which the methods of
the invention is useful include, but are not limited to,
genome-wide SNP analysis (or even subsets of the genome SNP set),
genetic strain typing, and miRNA sequence family detection and
discrimination. The specific strategy employed for the target
generation will most likely change depending on the specific
application. All three applications will have the basic requirement
that a sequence tag (or tags) would be introduced to allow for
amplification using either a simple primer pair (or a limited
primer pool) such that a specific strand can be labeled and
protected from the digestion step (such as T7 exonuclease
digestion). FIGS. 1-4 illustrate examples of the multiple labeling
strategies that could be employed, depending on the specific
application (or embodiment). The genetic strain typing application
would use a primer set that is contained within a sequence common
to all strains while being unique to the specific genetic organism
(see FIGS. 1 & 2). This would generate suitable target material
while limiting the amplification of non-specific genetic material.
FIG. 3 illustrates how universal-tag sequences could be implemented
in an embodiment for multiplexed analysis of genetic strains from
different genetic organisms. An embodiment for discriminating the
variation between closely related miRNAs, would also use a similar
"universal sequence tagging" method (see FIG. 4). Here the
"universal tagging sequences" would be introduced via a 3' and 5'
linker and the "universal primers" would be their complements.
Linkers of this kind are already employed for miRNA cloning and can
be directly adapted to this new application (see U.S. patent
application 60/946,922, which is incorporated by reference).
[0061] In one embodiment, the invention pertains to the use of
linkers used to attach specific and unique sequences to the 3'-end
of small RNAs, such-as miRNAs, which can be subsequently used as a
primer site for reverse transcription (RT) followed by
immobilization of the RT product onto a microarray slide. The
3'-linker can be adapted from designs described by Bartel (Science
2001; 294:858-62), which is incorporated by reference, and the
immobilization of the RT product onto a microarray slide as
described by Rogler et al. (Nucleic Acids Res., 2004; 32:e120),
which is incorporated by reference.
[0062] The current favored method for placing a suitable nucleic
acid sequence at the 3'-end of small RNAs for use as a reverse
transcription primer binding site is poly-A tailing. This method
utilizes the RNA poly-A polymerase (PAP) enzyme from yeast or E.
coli to add a sufficient number of adenosine ribonucleotides onto
the 3'-end of the small, non-poly A-containing, RNAs to allow the
use of oligo-dT as a reverse transcription primer (Martin and
Keller, RNA, 4, 226-230 (1998); Fu et al., 2006). The poly-A
tailing method was developed to overcome the shortcomings of using
random hexamer priming for reverse transcription on short RNA
templates (and other non-poly adenylated RNAs). Other specific
methods exist whereby the polynucleotide tailing adds a number of
other mononucleotides so that an RT primer different than poly-A
can be utilized (Cho 2007; Kwak and Wickens, RNA (2007),
13:860-867; Rissland, Mol. Cell Biology, 27: 3612-3624 (2007)).
[0063] In one embodiment, the 3' linker is attached to the 3'-end
of the small RNA sample, via a T4 RNA ligation reaction, followed
by an RT reaction using as primer a 5'-hydrazide modified
oligonucleotide that is complementary to the 3'-linker sequence.
Then the RT product is attached (spotted) onto a microarray glass
slide that would be suitable for hybridization with a
fluorophore-labeled synthetic oligonucleotide probe. In another
embodiment, this approach could be reversed where the RT primer is
modified with a 5'-fluorophore, instead of a 5'-hydrazide, and the
resulting product functions instead as labeled target, which can be
hybridized to a microarray containing immobilized synthetic oligo
probes ("traditional" array format).
[0064] The embodiment also provides a method to incorporate the
addition of a 5' linker after the 3'-linkering step and before the
RT step to provide a unique 5'-sequence tag that would be useful
for dual-labeled PCR assays of the same material immobilized on the
microarray glass slide (see FIG. 4), or for a general amplification
method of low (or limited) quantities of starting material.
[0065] This method is more efficient and potentially a more
sensitive method of generating suitable material for reverse
transcription from a small RNA pool fraction of a total RNA
isolation. The method could also be used for the integration of
multiple assays (microarray and dual-labeled PCR) of the same RNA
material from a sample of interest (i.e.; parallel assay formats on
both the mRNA and "small" RNAS fractions from the same RNA
isolation sample of interest). Universal PCR strategies employing
sequence-tagged primers are known in the art (see Lao et al 2007
(U.S. Pat. No. 7,176,002)).
[0066] The term "microarray" is used interchangeably with "array,
gene chip," "DNA chip," "biochip," and refers to a plurality of
spots of oligonucleotides on a solid support for use in probing a
biological sample to determine gene expression, marker pattern or
nucleotide sequence. Examples of supports include, but are not
limited to, glass, silica chips, nylon (polyamide) membrane,
polymer, plastic, ceramic, metal, coated on optical fibers, or
infused into a gel matrix.
[0067] The proposed methods could also be used in liquid array
platforms, such as with polystyrene beads, or with acid-etched
bar-coded fiber optic cable (see CyVera), gold nanoparticles,
transponders, or silicon-based beads. The methods could also be
utilized in in situ synthesis array platforms (see Affymetrix and
Nimblegen).
[0068] The solid support can also be coated to facilitate
attachment of the oligonucleotides to the surface of the solid
support. Any of a variety of methods known in the art may be used
to immobilize oligonucleotides to a solid support. The
oligonucleotides can be attached directly to the solid supports by
epoxide/amine coupling chemistry. See Eggers et al. Advances in DNA
Sequencing Technology, SPIE conference proceedings (1993). Another
commonly used method include the non-covalent coating of the solid
support with avidin or streptavidin and the immobilization of
biotinylated oligonucleotide probes.
[0069] In one embodiment, amplification includes or is optionally
followed by additional steps, such as labeling, sequencing,
purification, isolation, hybridization, size resolution,
expression, detecting and/or cloning.
[0070] In one embodiment, after a round of RT-PCR with a single
pair of primers of low degeneracy, the RT-PCR product is labeled
using an anti-sense primer (e.g., with Cy-3) during amplification.
Single stranded target DNA is obtained by enzymatic degradation of
the unlabeled sense stand followed by column purification of the
labeled antisense strand. Single stranded antisense target DNA can
also be obtained by asymmetric PCR, described herein, using excess
labeled sense primer. Conversely, the RT-PCR product can be labeled
with a sense primer when the probe is in the antisense
conformation.
[0071] Several labels exist to facilitate detection of a nucleic
acid molecule complex. Techniques for labeling and labels, that are
known in the art or developed in the future, can be used. In a
preferred embodiment, the label is simultaneously incorporated
during the amplification step in the preparation of the sample
[nucleic acids. For example, PCR with labeled primers or labeled
nucleotides will provide a labeled amplification product. The
nucleic acid (e.g., DNA) is amplified in the presence of labeled
deoxynucleotide triphosphates (dNTPs). In a preferred embodiment,
transcription amplification, as described above, using a labeled
nucleotide (e.g., fluorescein-labeled UTP and/or CTP) incorporates
a label into the transcribed nucleic acids.
[0072] Detectable labels suitable for use in the present invention
include any composition detectable by spectroscopic, photochemical,
biochemical, immunochemical, electrical, optical or chemical means.
The most frequently used labels are fluorochromes like Cy3, Cy5 and
Cy7 suitable for analyzing an array by using commercially available
array scanners (e.g., Axon, General Scanning, Genetic Microsystem,
and Perkin Elmer). Other labels that can be used in the present
invention include biotin for staining with labeled streptavidin
conjugate, magnetic beads (e.g., Dynabeads.TM.), dendrimers,
fluorescent proteins and dyes (e.g., fluorescein, Texas red,
rhodamine, green fluorescent protein, and the like, see, e.g.,
Molecular Probes, Eugene, Oreg., USA), radioactive labels (e.g.,
.sup.3H, .sup.125I, .sup.35S, .sup.14C, or .sup.32P), enzymes
(e.g., horse radish peroxidase, alkaline phosphatase and others
commonly used in an ELISA), and colorimetric labels such as
colloidal gold (e.g., gold particles in the 40-80 nm diameter size
range scatter green light with high efficiency) or colored glass or
plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
Patents teaching the use of such labels include WO 97/27317, and
U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149; and 4,366,241.
[0073] A fluorescent label provides a very strong signal with low
background. It is also optically detectable at high resolution and
sensitivity through a quick scanning procedure. The nucleic acid
samples can all be labeled with a single label, e.g., a single
fluorescent label. Alternatively, in another embodiment, different
nucleic acid samples can be simultaneously hybridized where each
nucleic acid sample has a different label. For instance, one target
could have a green fluorescent label and a second target could have
a red fluorescent label. The scanning step will distinguish cites
of binding of the red label from those binding the green
fluorescent label. Each nucleic acid sample (target nucleic acid)
can be analyzed independently from one another.
[0074] The sample can be purified to reduce the overall slide
background (i.e.; the inter-spot space area) that would be caused
by the "un-used" fluorophore-labeled primer. This in-turn would
impact the overall sensitivity of the array, affecting the
signal-to-noise ratio. It would not have any effect on the
selectivity of the array probe designs (i.e.; the
cross-hybridization signal). Once the sample is prepared, it can be
subjected to the nucleic acid molecules of the present invention
for hybridization. Hybridization refers to the association of
single strands of oligonucleotides through their specific
base-pairing properties to form a complementary double-stranded
molecule. With respect to the present invention, the labeled DNA of
the sample hybridizes with the oligonucleotides on the solid
support. Hybridization conditions include variables such `as
temperature, time, humidity, buffers and reagents added, salt
concentration and washing reagents. Preferably, hybridization
occurs at high stringency conditions and examples of suitable
stringency conditions are described herein. Methods for
hybridization are known, and such methods are provided in U.S. Pat.
No. 5,837,490, by Jacobs et al. The solid support can then be
washed one or more times with buffers to remove unhybridized
nucleic acid molecules. Hybridization forms a complex between the
nucleic acid of the present invention and nucleic acid of the
sample.
[0075] The methods of the present invention also involve
determining the level or percentage of a particular genetic variant
type in a sample (such as the expression levels of the various Let7
miRNA family members in a particular sample). Data can be generated
for mean detection levels or percentage of known quantities of a
genetic variant type and can be used to compare a sample of unknown
quantity to determine the level or percentage of the genetic
variant type in the sample. In one embodiment, threshold levels or
percentages (e.g., low, medium and high) of genetic variant types
can be established using known quantities of the variants, and
compared to an unknown level or percentages of variants in a
sample. Detection of one or more variant above the high threshold
level signifies high quantities of the particular variant,
detection of a medium threshold level indicates a mid-level
quantity of the variant in the sample, and detection-of variants
below the low threshold levels indicate low quantities of the
variant in the sample.
[0076] The present invention includes methods of making an array.
The method includes selecting a solid support, as described herein.
In one embodiment, epoxide slides are used. In particular, arrays
can be synthesized on a solid substrate by a variety of methods,
including, but not limited to, light-directed chemical coupling,
and mechanically directed coupling. See Pirrung et al., U.S. Pat.
No. 5,143,854 (see also PCT Application No. WO 90/15070) and Fodor
et al., PCT Publication Nos. WO 92/10092 and WO 93/09668 which
disclose methods of forming vast arrays. See also, Fodor et al.,
Science, 251, 767-77 (1991). One example of synthesizing a polymer
array includes the VLSIPSTM approach. Additionally, methods which
can be used to generate an array of oligonucleotides on a single
substrate can be used. For example, reagents are delivered to the
substrate by either (1) flowing within a channel defined on
predefined regions or (2) "spotting" on predefined regions.
However, other approaches, as well as combinations of spotting and
flowing, or other approaches can be employed.
[0077] The method further includes preparing the nucleic acid
molecules for attachment to the solid support. Optionally, a spacer
that provides a space between the support and the capture
nucleotide sequences can be used to increase sensitivity of the
array. A spacer that can be used with the present invention
includes any molecular group that allows the nucleic acid molecule
to remain off of or separated from the support. Another example of
a spacer is a hexaethylene glycol derivative for the binding of
small oligonucleotides upon a membrane. Patent publication No.:
EP-0511559. In one embodiment of the invention, the nucleic acid
probes of this invention comprise at least two parts, the specific
probe, and the spacer/linker section. The specific probe portion
comprises about 9-30 nucleic acids or nucleic acid mimetics (e.g.,
PNAs). The spacer/linker is comprised of anything that positions
the specific probe away from the substrate and that adheres or
attaches the specific probe to the substrate. Alternatively, probes
can be attached to a gel, in which case, a spacer/linker is not
necessary.
[0078] The nucleic acid molecules of the present invention can also
be prepared to promote attachment to the solid support chosen, or
to react with a coating placed on the support. The solid support
can be coated to promote adherence to the support, and once the
nucleic acid molecule is applied, in some cases ultraviolet
irradiation allows for DNA fixation. For example, the nucleic acid
molecules of the present invention or the solid support can be
modified to react with substrates including amine groups, aldehydes
or epoxides to promote attachment. Methods, now known or developed
later, for promoting attachment of the nucleic acid to the solid
support can be used.
[0079] The present invention includes kits. Kits can include the
array of the present invention, as described herein. Kits can also
include reagents that are used to carry out hybridization. Examples
of such regents include labeling reagents, primers that are
specific to a conserved region of the serotypes being assessed
(labeled and/or unlabeled), buffers and washing solutions. Labeling
reagents include labels, as described. herein (e.g., fluorescent
dyes, streptavidin conjugate, magnetic beads, dendrimers,
radiolabels, enzymes, colorimetric labels, nanoparticles, and/or
nanocrystals) including cyanine dyes such as Cy3 and Cy5. The kit
can also include software use to analyze the results, as described
herein.
[0080] As used herein, the terms "DNA molecule" or "nucleic acid
molecule" include both sense and anti-sense strands, cDNA,
complementary DNA, recombinant DNA, RNA, wholly or partially
synthesized nucleic acid molecules, PNA and other synthetic DNA
homologs. A nucleotide "variant" is a sequence that differs from
the recited nucleotide sequence in having one or more nucleotide
deletions, substitutions or
[0081] As used herein, an "isolated" gene or nucleotide sequence
which is not flanked by nucleotide sequences which normally (e.g.,
in nature) flank the gene or nucleotide sequence (e.g., as in
genomic sequences). Thus, an isolated gene or nucleotide sequence
can include a nucleotide sequence which is designed, synthesized
chemically or by recombinant means.
[0082] Also encompassed by the present invention are nucleic acid
sequences, DNA or RNA, PNA or other DNA analogues, which are
substantially complementary to the DNA sequences and which
specifically hybridize with their DNA sequences under conditions of
stringency known to those of skill in the art. As defined herein,
substantially complementary means that the nucleic acid need not
reflect the exact sequence of the sequences of the present
invention, but must be sufficiently similar in sequence to permit
hybridization with nucleic acid sequence of the present invention
under high stringency conditions. For example, non-complementary
bases can be interspersed in a nucleotide sequence, or the
sequences can be longer or shorter than the nucleic acid sequence
of the present invention, provided that the sequence has a
sufficient number of bases complementary to the DNA of the serotype
to be identified to allow hybridization therewith.
[0083] The following non-limiting examples are intended to be
purely illustrative, and should not be construed as in any way
limiting its scope.
Example 1
Probe Design, Attachment Chemistry & Hybridization Buffer
[0084] The following example describes attachment of
oligonucleotides to surfaces, including epoxide surfaces, hydrazide
attachment chemistry (and the increase sensitivity it affords), the
benefit of use of short nucleic acids probes to improve specificity
(specifically a 17mer having an "818" probe design), and use of new
hybridization and wash conditions and protocols to enhance
detection and specificity of nucleic acid sequence detection in an
array or microarray assay format.
[0085] Probes for several single nucleotide polymorphism (SNP)
sites within the cotton genome were designed using thermodynamic
algorithms to normalize melting temperatures (Tm) of perfect-match
hybridization events while simultaneously maximizing the predicted
Tm differences for allelic mismatches. Due to sequence content
variation in SNP sites, Tm normalized probes had lengths that
varied from 17 to 29 bases, as well as having variable SNP
locations within each probe design, although each SNP was more or
less centralized within the probe's design. An example of this can
be seen below with the "Tm Balanced" probe set. Oligonucleotide
probes were synthesized by Integrated DNA Technologies and provided
as unpurified, desalted preparations having either a 5'-OH
(unmodified) or a 5'-ILinker (or hydrazide) modification consisting
of the following moiety.
##STR00001##
[0086] For one probe, two sites of sequence variation or SNPs were
present within the selected sequence, representing "linked" SNPs
that are naturally encountered in the cotton genome.
[0087] Short 17mer probes were also designed at each SNP site,
without consideration for Tm. Instead, the SNP was simply
positioned centrally within the probe sequence with 8 bases of
sequence 5' to the SNP site and 8 bases of sequence 3' to the SNP
site. This collection is referred to as the "818" probe set.
Unmodified and 5'ILinker modified oligonucleotides were also
synthesized for this set by Integrated DNA Technologies and
provided as unpurified, desalted preparations.
[0088] The sequences of both probes sets are shown below, with
"Len" indicating length in bases, and "PM", "MM", and .DELTA.Tm
denoting the predicted Tm (in degrees Celsius) of the perfect match
hybridization (PM), the Tm of the mismatch allele hybridization
event (MM), and the calculated predicted differential (.DELTA.Tm)
between the Tm's of the perfect match and mismatch hybridization,
respectively. The program "HyTher" was employed to calculate Tm of
perfect match and mismatch pairs, using settings are 50 mM
monovalent; 0 molar Mg.sup.2+; 37 degrees C. hyb; and strand
concentrations of 200 nM.
TABLE-US-00001 Tm Balanced Probe Set: Name Len PM MM .DELTA.Tm SEQ
ID NO: 1 TAACACCGCCAATGTCACA Tm SNP 5-A 19 54.3 47.4 6.9 SEQ ID NO:
2 CTAACACCACCAATGTCAGAAG Tm SNP 5-D 22 53.9 46.9 7.0 SEQ ID NO: 3
TTAAAAAGGCGATACCGGGG Tm SNP 9-A 20 54.9 41.9 13.0 SEQ ID NO: 4
GAATTAAAAATGCGATACCAGGGA Tm SNP 9-D 24 53.8 40.1 13.7
TABLE-US-00002 ''818'' re-Designed Probe Set: SEQ ID NO: 5
CTAACACCGCCAATGTC 818 SNP 5-A 17 30.2 42.4 7.8 SEQ ID NO: 6
CTAACACCACCAATGTC 818 SNP 5-D 17 46.7 36.5 10.2 SEQ ID NO: 7
AAAAAGGCGATACCGGG 818 SNP 9-A 17 51.9 35.9 16.0 SEQ ID NO: 8
AAAAATGCGATACCAGG 818 SNP 9-D 17 46.8 24.6 22.2
[0089] The probe sets were then printed at 40 uM concentration in a
MES/betaine spotting buffer (300 mM MES at pH=4.5 and 1.5M betaine)
on Corning GAPSII slides at two different times and immobilized by
cross-linking by exposing the slides to 600mJ of UV. The first
print run was for comparison of the different syntheses of the "Tm
Balanced" probe set (unmodified vs. 5'-ILinker modified) and
spotted according to the probe spot layout given in Table 1. The
second print run was to evaluate hybridization of various
5'-ILinker modified probe designs (Tm Balance vs. 818) and spotted
according to the probe spot layout given in Table 2.
TABLE-US-00003 TABLE 1 Probe spot layout for different syntheses of
the Tm Balanced probe design. Tm SNP 5-A(unmod.) Tm SNP 5-D(unmod.)
Tm SNP 9-A(unmod.) Tm SNP 9-D(unmod.) Tm SNP 5-A(unmod.) Tm SNP
5-D(unmod.) Tm SNP 9-A(unmod.) Tm SNP 9-D(unmod.) Tm SNP
5-A(unmod.) Tm SNP 5-D(unmod.) Tm SNP 9-A(unmod.) Tm SNP
9-D(unmod.) Tm SNP 5-A(unmod.) Tm SNP 5-D(unmod.) Tm SNP
9-A(unmod.) Tm SNP 9-D(unmod.) Tm SNP 5-A(unmod.) Tm SNP
5-D(unmod.) Tm SNP 9-A(unmod.) Tm SNP 9-D(unmod.) Tm SNP
5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm SNP
9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm SNP
9-A(hydrazide) Tm SNP 9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm SNP
5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm SNP 9-D(hydrazide) Tm SNP
5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm SNP
9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm SNP
9-A(hydrazide) Tm SNP 9-D(hydrazide)
TABLE-US-00004 TABLE 2 Probe spot layout for different probe
designs comparison. Tm SNP 5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm
SNP 9-A(hydrazide) Tm SNP 9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm
SNP 5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm SNP 9-D(hydrazide) Tm
SNP 5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm
SNP 9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm SNP 5-D(hydrazide) Tm
SNP 9-A(hydrazide) Tm SNP 9-D(hydrazide) Tm SNP 5-A(hydrazide) Tm
SNP 5-D(hydrazide) Tm SNP 9-A(hydrazide) Tm SNP 9-D(hydrazide) 818
SNP 5-A(hydrazide) 818 SNP 5-D(hydrazide) 818 SNP 9-A(hydrazide)
818 SNP 9-D(hydrazide) 818 SNP 5-A(hydrazide) 818 SNP
5-D(hydrazide) 818 SNP 9-A(hydrazide) 818 SNP 9-D(hydrazide) 818
SNP 5-A(hydrazide) 818 SNP 5-D(hydrazide) 818 SNP 9-A(hydrazide)
818 SNP 9-D(hydrazide) 818 SNP 5-A(hydrazide) 818 SNP
5-D(hydrazide) 818 SNP 9-A(hydrazide) 818 SNP 9-D(hydrazide) 818
SNP 5-A(hydrazide) 818 SNP 5-D(hydrazide) 818 SNP 9-A(hydrazide)
818 SNP 9-D(hydrazide)
[0090] Allele-specific synthetic hybridization targets were
synthesized as 5'-Cy3 oligonucleotides for A-allele detection and
as 5'-Cy5 oligonucleotides for D-allele detection. Sequences are
shown below.
TABLE-US-00005 Allele-specific Hybridization Target Set: Name Len.
SEQ ID NO: 9 Cy3-AGCTCTTGTGACATTGGCGGTGTTAGTGTAA Cy3 5-A 31 SEQ ID
NO: 10 Cy5-AGCTCTTGTGACATTGGTGGTGTTAGTGTAA Cy5 5-D 31 SEQ ID NO: 11
Cy3-TTTTCCCCGGTATCGCCTTTTTAATTCTCAC Cy3 9-A 31 SEQ ID NO: 12
Cy5-TTTTCCCTGGTATCGCATTTTTAATTCTCAC Cy5 9-D 31
[0091] Allele-specific synthetic targets were hybridized at 50 nM
concentration in varying conditions with the cotton SNP array
slides described above. After hybridization the slides were washed,
dried, and scanned using the ScanArray.RTM. 5000 (Perkin-Elmer) and
laser (power/gain) settings of 69/69 for the Tm Balance probe
syntheses comparison (unmodified vs. 5'-ILinker) and 68/68 for the
different probe design comparison (Tm Balanced vs. 818 sets).
[0092] Initial hybridizations using a traditional microarray
hybridization/wash buffer composition and strategy (i.e.; overnight
hybridization at 50.degree. C. in 4.5.times.SSC and 0.25% Sarkosyl
followed by three stringent washes at RT.degree. C., consisting of
2.times.SSC/0.2% SDS for 5 mins for the 1.sup.st wash, 1.times.SSC
for 2 mins for the 2.sup.nd wash, and 0.2.times.SSC for 30 secs for
the 3.sup.rd wash) failed to discriminate between the cotton SNP
alleles using the Tm Balanced probe set. The Tm Balanced probes
were also subjected to a temperature gradient hybridization
strategy (FIG. 5A) to try to increase allele discrimination using a
TMAC-based hybridization buffer (i.e.; initial hybridization for 45
mins at 40.degree. C. and subsequently increased to 60.degree. C.
for an additional 1.5 hr in 37.5 mM Tris pH 8, 0.25% Sarkosyl, 1 mM
CTAB, and 1M TMAC followed by three stringent washes at RT.degree.
C., consisting of 2.times.SSC/0.2% SDS for 5 mins for the 1.sup.st
wash, 2.times.SSC for 2 mins for the 2.sup.nd wash, and
0.2.times.SSC for 30 secs for the 3.sup.rd wash) that also failed
to adequately discriminate between the cotton SNP alleles. The
5'-ILinker modified Tm Balanced and 818 designed probes were then
hybridized with the new and improved hybridization buffer and wash
strategy. The hybridization included a 2.25 hr hybridization at
50.degree. C. in a 1.times. buffer comprising 37.5 mM Tris pH 8, 3
mM EDTA, 0.25% Sarkosyl, 0.4 mg/mL ovalbumin, 1 mM CTAB, 0.4 mg/mL
Ficoll Type 400, 0.4 mg/mL PVP-360, 2.5M TMAC, 10% Formamide, 10
ug/mL Cot-1 DNA followed by a first wash for 15 mins at 50.degree.
C. consisting of 2.5M TMAC and 0.2% Sarkosyl, a second wash for 1
min at RT.degree. C. consisting of 2.times.SSC, and a quick dip
(.about.1-2 secs) in 0.2.times.SSC at RT.degree. C. This
hybridization and wash strategy showed improved SNP discrimination
over that obtained using the previous hybridization and wash
conditions, particularly when combined with use of short 818
designed oligonucleotide probes (FIG. 5B).
[0093] The results, which are presented in FIG. 5, demonstrate the
following important points: [0094] 1) The Tm normalized probe set
showed poor discrimination between the tested cotton SNP alleles.
[0095] 2) The new hybridization buffer and hybridization/wash
protocols developed improve ability of both the Tm normalized and
short 818 probe sets to detect or discriminate between targets
having sequence differences that are not detectable using
traditional hybridization conditions. [0096] 3) Short 17mer "818"
probes performed better than longer Tm normalized probes. Using the
new buffer/wash protocols developed, discrimination was effectively
100%, giving functional "On/Off" detection of alleles. [0097] 4)
Use of the 5'ILinker modification was shown to significantly
improve signal intensity and therefore assay sensitivity without
affecting specificity.
Example 2
Preparation of Single-Stranded Labeled Targets Using Either Lambda
or T7 Exonuclease Degradation of an Amplified Double-Stranded
Product.
[0098] The following example demonstrates a method to prepare
labeled single-stranded targets from a double-stranded product of
an exponential PCR reaction. Lambda exonuclease and T7 exonuclease
are both 5' to 3' exonucleases that require and utilize
double-stranded DNA (dsDNA) as a substrate. Modifications to the
5'-end of one strand in the duplex that confer sensitivity to or
protection against exonuclease activity result in that strand being
preferentially degraded by or protected from exonuclease activity,
while the opposite strand in the duplex is preferentially protected
or degraded. Thus, the exonuclease degradation reaction results in
a single-stranded target suitable for hybridization. Nuclease
sensitive or resistant modifications can be introduced by using
modified primers in amplification reactions (e.g., PCR). Typically,
one primer is modified and the second primer is unmodified.
[0099] The experiments described below determined that, contrary to
previous reports, a 5'-phosphate group is not necessarily required
for lambda exonuclease activity. Further, certain fluorophores
(e.g., Cy3) that are attached to the 5'-end of an oligo through
standard phophoramidite chemistry confer resistance to lambda
exonuclease digestion. Based on the results reported herein, it was
also discovered that T7 exonuclease digestion can be blocked by a
single phosphorothioate modified internucleoside linkage, resulting
in functionally complete protection of a target DNA strand. The
target DNA strand may contain another 5'-modification, such as a Cy
dye, linked to the target DNA through a phosphodiester or a
phosphorothioate linkage. In addition, it was determined that a
phosphorothioate modified internucleoside linkage is not required
to block T7 exonuclease activity if the fluorophore (Cy3) is
positioned between the second and third nucleotides from the 5'-end
of the primer.
[0100] In this example, an oligonucleotide having an A/T 5'-endbase
(5'-TCCT . . . -3'; sequence "a") was employed and hybridized with
a complementary oligonucleotide sequence having a G/C 5'-endbase
(5'-CCGA . . . -3'; sequence "b") to form dsDNA. Different versions
of each oligonucleotide sequence were synthesized to have various
5'-modifications, including 5'-OH (unmodified), 5'-Phos, 5'-AmMC6,
5'-6FAM, or 5'-Cy3, with 0, 1, 2, or 3 phosphorothioate
internucleoside bonds between the 5'-end bases. In addition,
different versions of one of the oligonucleotide sequences were
synthesized to include various internal Cy3 modifications with 0,
1, or 2 phosphorothioate internucleoside bonds between the 5'-end
nucleotides. Sequences are shown below, with "*" indicating a
position of phosphorothioate modified linkage.
TABLE-US-00006 SEQ ID NO: 13 T C C TCATTTCCAGAGAGAAGATCGG a- OH
(0PS) SEQ ID NO: 14 T*C C TCATTTCCAGAGAGAAGATCGG a- OH (1PS+) SEQ
ID NO: 15 T C*C TCATTTCCAGAGAGAAGATCGG a- OH (1PS+) SEQ ID NO: 16
T*C*C TCATTTCCAGAGAGAAGATCGG a- OH (2PS) SEQ ID NO: 17
T*C*C*TCATTTCCAGAGAGAAGATCGG a- OH (3PS) SEQ ID NO: 18 Phos-T C C
TCATTTCCAGAGAGAAGATCGG a- Phos (0PS) SEQ ID NO: 19
AmMC6-TCCTCATTTCCAGAGAGAAGATCGG a-Am (0PS) SEQ ID NO: 20 6FAM-T C C
TCATTTCCAGAGAGAAGATCGG a- FAM (0PS) SEQ ID NO: 21 Cy3-T C C
TCATTTCCAGAGAGAAGATCGG a- Cy3 (0PS) SEQ ID NO: 22
TCATTTCCAGAGAGAAGATCGG a- Cy3 (1PS) SEQ ID NO: 23 Cy3-T C* C
TCATTTCCAGAGAGAAGATCGG a- Cy3 (1PS+) SEQ ID NO: 24 Cy3-T*C8C
TCATTTCCAGAGAGAAGATCGG a- Cy3 (2PS) SEQ ID NO: 25 Cy3-T*C*C*
TCATTTCCAGAGAGAAGATCGG a- Cy3 (3PS) SEQ ID NO: 26 T-Cy3-C C
TCATTTCCAGAGAGAAGATCGG a- Cy3+ (0PS) SEQ ID NO: 27 T*Cy3-C C
TCATTTCCAGAGAGAAGATCGG a- Cy3+ (1PS) SEQ ID NO: 28 T-Cy3-C*C
TCATTTCCAGAGAGAAGATCGG a- Cy3+ (1PS+) SEQ ID NO: 29 T*Cy3-C*C
TCATTTCCAGAGAGAAGATCGG a- Cy3+ (2PS) SEQ ID NO: 30 T C-Cy3-C
TCATTTCCAGAGAGAAGATCGG a- Cy3+2 (OPS) SEQ ID NO: 31 T*C-Cy3-C
TCATTTCCAGAGAGAAGATCGG a- Cy3+2 (1PS) SEQ ID NO: 32 T C*Cy3-C
TCATTTCCAGAGAGAAGATCGG a- Cy3+2 (1PS+) SEQ ID NO: 33 T*C*Cy3-C
TCATTTCCAGAGAGAAGATCGG a- Cy3+2 (2PS) SEQ ID NO: 34
CCGATCTTCTCTCTGGAAATGAGGA b-OH (0PS) SEQ ID NO: 35
Phos-CCGATCTTCTCTCTGGAAATGAGGA b- Phos (0PS) SEQ ID NO: 36
AmMC6-CCGATCTTCTCTCTGGAAATGAGGA b- Am (0PS) SEQ ID NO: 37
6FAM-CCGATCTTCTCTCTGGAAATGAGGA b- FAM (0PS)
[0101] Each duplex reaction mixture includes an equal molar ratio
of each oligo required to form the duplex (oligo sequence "a" and
oligo sequence "b") in 1.times. NEBuffer 2 (50 mM NaCl from New
England BioLabs). The duplex reaction mixture was heated for 5
minutes at 95.degree. C. and allowed to cool to room temperature
and sit overnight before the duplex was over-digested relative to
both time and enzyme units. Specifically, 40 pmoles of each duplex
was then digested overnight (15-18 hours) with either 12.5 units of
lambda exonuclease in the supplied buffer at 1.times. (New England
BioLabs) or 25 units of T7 exonuclease in the supplied buffer at IX
(New England BioLabs) at the appropriate temperature (37.degree. C.
or 25.degree. C., respectively). All samples, along with a no
enzyme control for each duplex reaction, were then separated on a
17% (19:1) native acrylamide gel in 1.times.TBE run for .about.1
hour at 25 Watts, stained with GelStar, and visualized on a UV
transilluminator.
[0102] FIG. 6A shows that in this assay and under these gel
conditions, the individual single-stranded DNA oligos migrate
differentially. The various 5'-modifications (Cy3 and 6FAM) run as
larger molecules relative to the 5'-OH formulation of the same
sequence (OH<Cy3<FAM). The "a" strand has a faster migration
under these native acrylamide gel conditions and runs like a
smaller molecule relative to the "b" strand most likely due to the
slight conformational change defined by the sequence composition
differences between the two strands. The conformational difference
may, in fact, be caused by the stretch of A's in the "b" strand
that is not present in the "a" strand, which has been previously
demonstrated to cause bending in single-stranded DNA and slow the
migration in acrylamide gel electrophoresis. FIG. 6A also shows
that the 5'-6FAM modification is sensitive to lambda exonuclease,
but only when it is attached to either an A or T at the 5'-end. In
contrast, the 5'-Cy3 modification confers lambda exonuclease
resistance independent of the 5'-end sequence. This might be due to
the fact that the cyanine class of fluorescent dyes appears to
increase the end-base stability through base-stacking interactions
and thus interact with the nucleic acid in way that fluorescein
class dyes do not.
[0103] FIG. 6B shows that the 5'-AmMC6 modification is also
sensitive to lambda exonuclease but only when it is attached to an
A or T at the 5'-end. The 5'-Phos modification is independent of
the sequence and can initiate DNA digestion regardless of the
end-base composition. Surprisingly, this modified composition is
also partially sensitive to lambda exonuclease even when it is
unmodified (i.e., 5'-OH). This sensitivity is affected by digestion
time and enzyme concentration, longer digestion time and higher
enzyme concentration in the digestion reaction yields more complete
digestion of a DNA strand with an unmodified A/T 5'-end base. This
observation is contrary to previous reports that a 5'-Phos is
required for lambda exonuclease to initiate DNA digestion.
[0104] FIG. 6C shows that the 5'-Cy3 modification confers
resistance to lambda exonuclease that is independent of the 5'-end
base composition. However, there does seem to be a slight
sensitivity when the Cy3 modification is attached to a 5'-end with
an A/T end-base pair. This seems to be most heavily influenced by
the stability of the opposite strand in the duplex (or dsDNA); that
is, the 5'-Cy3 A/T end-base design is only slightly sensitive to
lambda exonuclease when duplexed with a more stable strand such as
one having a 5'-Cy3 G/C end-base. Therefore, generation of a
single-stranded target for microarray hybridization by lambda
exonuclease digestion of double stranded DNA could be enhanced by
using a primer having a 5'-cyanine dye attached to a G/C end-base
to generate the hybridization target strand and a primer having
either a 5'-AmMC6 or 5'-Phos attached to an A/T end-base to
generate the non-target strand.
[0105] FIG. 6D shows that T7 exonuclease completely degrades DNA
that is unmodified at its 5'-end (5'-OH). It also demonstrates that
a single phosphorothioate linkage can confer resistance to T7
exonuclease when it is placed in the penultimate internucleoside
bond position (between the second and third nucleotides from the
5'-end) of an otherwise unmodified oligo (5'-OH). When the oligo
also contains a 5'-Cy3 modification the single phosphorothioate
linkage confers only partial T7 exonuclease resistance when it is
located in the ultimate internucleoside bond position (between the
first and second nucleotides from the 5'-end) and leaves the 5'-Cy3
modification intact. When the phosphorothioate linkage is located
in the penultimate internucleoside bond position with the
additional 5'-Cy3 modification it appears that the resistant
product is missing the Cy3 dye. In addition, FIG. 6D shows that two
phosphorothioate linkages placed between the first three 5'-end
nucleotides is sufficient to confer functionally complete T7
exonuclease protection, whether the 5'-end of the PS modified
strand is left unmodified (5'-OH) or additionally modified with a
fluorophore (5'-Cy3). The results using the 5'-Cy3 modified 2PS
formulations demonstrate that the normal phosphodiester linkage
between the 5'-Cy3 and the first nucleotide is completely resistant
to T7 exonuclease. There is also no evidence that the T7
exonuclease is sensitive to the different phosphorothioate
stereoisomers, as is the case with lambda exonuclease.
[0106] FIG. 6E demonstrates that T7 exonuclease resistance can be
achieved utilizing a single phosphorothioate linkage in combination
with a Cy3 modification in this case, the Cy3 modification needs to
be internal and placed between the first and second nucleotides
from the 5-end, while the phosphorothioate linkage is placed in the
penultimate internucleoside bond position. No additional resistance
is achieved by adding a second PS linkage between the first
nucleotide at the 5'-end and the internal Cy3, presumably because
this is effectively the ultimate internucleoside bond position that
is already functionally modified with the internal Cy3-modification
(a detectable non-nucleoside modified internucleoside linkage). In
addition, FIG. 6E demonstrates that a single stranded DNA having an
internally positioned Cy3 modification has T7 exonuclease
resistance, even though it lacks a PS linkage. This single-stranded
DNA has a Cy3 modification between the second and third nucleotides
from the 5'-end, i.e., the penultimate internucleoside bond
position. No additional resistance is achieved by adding one or
more PS linkages. This is presumably because the penultimate
internucleoside bond is modified with the internal Cy3 in the
absence of an additional 5'-modification which is consistent with
the results in FIG. 6D using a single PS linkage in the penultimate
internucleoside bond position with an unmodified 5'-end (or 5'-OH).
Therefore, a single-stranded target suitable for microarray
hybridization could be generated using T7 exonuclease to degrade
the complementary strand of another strand made using a primer
having an internal dye (non-nucleoside based formulation such as
Cy3) placed in the penultimate internucleoside bond position or a
primer with an internal dye (non-nucleoside based formulation such
as Cy3) placed in the ultimate internucleoside bond position with a
single phosphorothioate linkage in the penultimate internucleoside
bond position.
Example 3
[0107] The following example illustrates the benefit of using
single-stranded nucleic acid targets over double-stranded nucleic
acid targets for microarray hybridizations, utilizing a synthetic
SNP model system. In addition, this example demonstrates the
greater sensitivity that can be achieved for sequence variation
detection using various elements of the method of the present
invention.
[0108] Without consideration of the local sequence (or
thermodynamic) environment of a SNP-site, the following short
oligonucleotide array probe set was synthesized as unmodified and
as 5'-hydrazide modified oligonucleotides; both unpurified
(desalted) and HPLC-purified preparations were tested. The 17mer
"818" design was employed.
TABLE-US-00007 p-101mer(C) SEQ ID NO: 38 TTCTGTGACTGGTGAGT
p-101mer(G) SEQ ID NO: 39 TTCTGTGAGTGGTGAGT p-101mer(A) SEQ ID NO:
40 TTCTGTGAATGGTGAGT p-101mer(T) SEQ ID NO: 41
TTCTGTGATTGGTGAGT
Underlined bases indicate the synthetic SNP site.
[0109] For this example, oligonucleotides were printed at 40 uM in
1.times. Oligo Spotting Buffer, OSB, (Integrated DNA Technologies,
Inc.) on Corning GAPSII slides and immobilized by UV cross-linking
with 600mJ using the StrataLinker 2400 (Stratagene). The
5'-hydrazide modified array probes were spotted in FIG. 7 according
to the probe spot layout given in Table 3, while the unmodified
desalted and 5'-hydrazide modified desalted array probes were
spotted in FIG. 8 according to the probe spot layout given in Table
4.
TABLE-US-00008 TABLE 3 Probe spot layout of the different purity
5'-hydrazide syntheses in FIG. 7. p-101mer(T) - HPLC p-101mer(T) -
HPLC p-101mer(T) - HPLC p-101mer(T) - HPLC p-101mer(A) - HPLC
p-101mer(A) - HPLC p-101mer(A) - HPLC p-101mer(A) - HPLC
p-101mer(C) - HPLC p-101mer(C) - HPLC p-101mer(C) - HPLC
p-101mer(C) - HPLC p-101mer(G) - HPLC p-101mer(G) - HPLC
p-101mer(G) - HPLC p-101mer(G) - HPLC p-101mer(T) - desalt
p-101mer(T) - desalt p-101mer(T) - desalt p-101mer(T) - desalt
p-101mer(A) - desalt p-101mer(A) - desalt p-101mer(A) - desalt
p-101mer(A) - desalt p-101mer(C) - desalt p-101mer(C) - desalt
p-101mer(C) - desalt p-101mer(C) - desalt p-101mer(G) - desalt
p-101mer(G) - desalt p-101mer(G) - desalt p-101mer(G) - desalt
TABLE-US-00009 TABLE 4 Probe spot layout of the desalted array
probes in FIG. 8. p-101mer(T) p-101mer(T) p-101mer(T) p-101mer(T)
(unmodified) (unmodified) (unmodified) (unmodified) p-101mer(A)
p-101mer(A) p-101mer(A) p-101mer(A) (unmodified) (unmodified)
(unmodified) (unmodified) OSB OSB OSB OSB p-101mer(C) p-101mer(C)
p-101mer(C) p-101mer(C) (unmodified) (unmodified) (unmodified)
(unmodified) p-101mer(G) p-101mer(G) p-101mer(G) p-101mer(G)
(unmodified) (unmodified) (unmodified) (unmodified) p-101mer(T)
p-101mer(T) p-101mer(T) p-101mer(T) (5'-hydrazide) (5'-hydrazide)
(5'-hydrazide) (5'-hydrazide) p-101mer(A) p-101mer(A) p-101mer(A)
p-101mer(A) (5'-hydrazide) (5'-hydrazide) (5'-hydrazide)
(5'-hydrazide) OSB OSB OSB OSB p-101mer(C) p-101mer(C) p-101mer(C)
p-101mer(C) (5'-hydrazide) (5'-hydrazide) (5'-hydrazide)
(5'-hydrazide) p-101mer(G) p-101mer(G) p-101mer(G) p-101mer(G)
(5'-hydrazide) (5'-hydrazide) (5'-hydrazide) (5'-hydrazide) Guide
Guide Guide Guide Light Light Light Light Note: Guide light
represents a control oligonucleotide that is Cy3 dye labeled for
the purpose of image orientation and does not participate in
hybridization reactions.
[0110] The following 101mer unmodified oligonucleotides were
synthesized for use as synthetic templates to generate
single-stranded vs. double-stranded labeled targets by PCR
amplification. These synthetic templates represent the target
strand that is complementary to the array probe sequences
above:
TABLE-US-00010 SEQ ID GCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAG
t-101mer(G) NO:42 TCACAGAACAGATGGTGCAGAGGGCCATGAAGGACCTGACCTAT
GCCTCCCTGTGC SEQ ID GCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAC
t-101mer(C) NO: 43 TCACAGAACAGATGGTGCAGAGGGCCATGAAGGACCTGACCTAT
GCCTCCCTGTGC SEQ ID GCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAT
t-101mer(T) NO: 44 TCACAGAACAGATGGTGCAGAGGGCCATGAAGGACCTGACCTAT
GCCTCCCTGTGC SEQ ID GCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAA
t-101mer(A) NO: 45 TCACAGAACAGATGGTGCAGAGGGCCATGAAGGACCTGACCTAT
GCCTCCCTGTGC Underlined bases indicate the synthetic SNP site.
[0111] Double-stranded target material was generated via
exponential PCR methods from .about.2.0E+05 copies of synthetic
101mer template (total) per 50 .mu.L reaction volume containing 200
nM each of a forward primer (Cy3-G*C*CGCATACACTATTCTCAG (SEQ ID
NO:46); * indicates position of a phosphorothioate linkage) and a
reverse primer (GCACAGGGAGGCATAGGT) (SEQ ID NO:47); utilizing the
following cycling conditions: initial melt @95.degree. C. for 9.5
mins followed by 35 cycles of 95.degree. C. for 30 secs, 59.degree.
C. for 20 secs, 72.degree. C. for 30 secs.
[0112] Single-stranded hybridization target material was generated
by digesting 20 .mu.L of the PCR reaction above in a 60 .mu.L
digestion volume using 10 units of T7 exonuclease and the supplied
exonuclease digestion buffer at IX (New England BioLabs) for 2
hours at room temperature, using the methods described in example 2
above. After digestion, the target material was column-purified
using the Promega Chip Shot membrane and protocol, followed by
lyophilization of the eluted target material. The double-stranded
hybridization target material (used in FIG. 7) was generated by
setting up a "mock" digestion using 20 .mu.L of the same PCR
reaction used for the single-stranded target generation (i.e.;
without the T7 exonuclease) immediately followed by the ChipShot
membrane purification and lyophilization.
[0113] The dried target was resuspended in 1.times.SNP
Hybridization Buffer and hybridized to the Microarray slide for
2.25 hours at 50.degree. C., followed by a 15 min wash at
50.degree. C. in 1.times.SNP Wash Buffer 1, a 1 min wash at
RT.degree. C. in 2.times.SSC, and a quick dip (1-2 secs.) in
0.2.times.SSC. For I.times.SNP Hyb Buffer, the composition is: 37.5
mM Tris pH 8, 3 mM EDTA, 0.25% Sarkosyl, 0.4 mg/mL Ovalbumin, 1 mM
CTAB, O.4 mg/mL Ficoll Type 400, 0.4 mg/mL PVP-360, 2.5M TMAC
(tetramethyl ammonium chloride), 10% Formamide, 10 ug/mL Cot-1 DNA.
The composition of the 1.times.SNP Wash Buffer 1 is: 2.5M TMAC,
0.2% Sarkosyl.
[0114] After washing the slides were dried and scanned using a
ScanArray.RTM. 5000 (Perkin-Elmer) with laser (power/gain) settings
of 89/89 for FIG. 7 and 85/85 for FIG. 8. After the specific-target
hybridization for the arrays in FIG. 7, the slides were
re-hybridized with SpotQC (Integrated DNA Technologies, Inc.) and
re-visualized using the ScanArray.RTM. 5000 (Perkin-Elmer) to help
orient the array images from the single-stranded and
double-stranded target hybridizations relative to the print
layout.
[0115] FIG. 7 demonstrates that improved sensitivity is achieved
using a single-stranded hybridization target compared to the same
hybridization target when it is double-stranded. In addition, the
results in FIG. 7 show that the hydrazide modification can also
attach to the amine-surface of the Coming GAPSII slides. The
efficiency of this attachment is sufficient that the typical
post-synthesis oligo purification (i.e.; HPLC purification) is not
necessary as it is with many other covalent attachment strategies
known in the art. The results shown in FIG. 8 further support this
conclusion since the hybridization signals from the 5'-hydrazide
modified unpurified desalted synthesis oligo probes are
significantly stronger than the hybridization signals from their
unmodified probe versions when hybridized to the same target under
the same conditions. In addition, these results demonstrate
complete specificity resulting in perfect discrimination of just a
single nucleotide difference even in this example that uses a G/T
mismatch, which is the most unfavorable of all possible mismatch
base-pairings for discrimination. Thus, the combination of probe
design, probe modification, hybridization buffer, and wash
conditions and protocols are sufficient to confer both increased
sensitivity and selectivity.
Example 4
Improved Buffer for Spotting Nucleic Acid Probes to an Epoxide
Surface
[0116] This example describes a spotting buffer for attaching
nucleic acid probes on epoxide surfaces. The spotting buffer is
compatible with use of unmodified, amino-modified, and hydrazide
modified nucleic acids. A combination of monobasic sodium phosphate
(low pH), Nonidet P-40 (NP-40), and ethylene glycol were used for
spotting oligo probes onto an epoxide-surface microarray slide. For
a 1.times. formulation, the composition of the Epoxide Spotting
Buffer is: 300 mM sodium phosphate (monobasic); 0.01% NP-40; 45%
ethylene glycol. The ranges can be from 1 mM to IM sodium phosphate
(monobasic), 0.001% to 1% NP-40, and from 10% to 90% ethylene
glycol. The pH range can be from 4 to 8.
[0117] Conventional spotting solutions that were considered
compatible with or specifically made for use on epoxide slides
produce probe spots that are either too small for analysis or too
large to allow high-density microarray printing. In both instances,
the hybridization signal is non-uniform. In addition, the "large"
spot phenotype often results in spot merger, which is dependent on
the oligonucleotide composition, making the merged probe areas
unpredictable and useless for microarray experiments. This problem
is illustrated in FIG. 9, which compares different epoxide spotting
solutions. Oligonucleotide probes (standard desalted 41mers) were
spotted at 40 .mu.M concentration on an epoxide slide (Corning)
using the above epoxide spotting buffer formulation (ESB),
3.times.SSC, and three different commercially available spotting
solutions marketed as either "specifically formulated for use on",
or "compatible with" the epoxide slide surface. The sub-arrays were
then hybridized with complementary Cy3.TM.-labeled oligo targets
and scanned, using the ScanArray.RTM. 5000 (Perkin-Elmer) at 62/62
laser (power/gain) settings. The need for additives to increase the
spot size to something larger than a "pin prick" is also
illustrated in FIG. 9 by the sub-panel where the oligo probes are
spotted in a solution containing just sodium chloride and sodium
citrate (3.times.SSC). These spotting problems, or spot morphology
issues, are primarily due to the incompatibility of the additives
that are typically used with the epoxide surface, which is
typically manufactured by the silanization of glass slides with
3-glycidoxypropyltrimethoxysilane. Since the epoxide surface is not
charged (i.e.; non-ionic), the use of ionic, or polar, detergents
(especially anionic such as SDS and Sarkosyl) result in non-uniform
hybridization spot signals characterized by either "rings" of
signal intensity or random "crystal-like" patterns. In addition,
the spot size is difficult to control with these types of
detergents since small amounts, or small changes in concentration,
dramatically affect the printed probe spot size. Consequently, very
little variation from the "best" amount typically results in
altered spot size/morphology. Evaporation of the water that
typically comprises the remaining volume of the spotting solution
causes increased detergent concentrations within the spotted
material resulting in oversized, merged probe spots.
[0118] The combination of these ethylene oxide based reagents for
spotting oligo probes onto an ethylene oxide based surface allows
for greater control of printed spot size and the ability to fine
tune the spot size by the addition of easily measured amounts, as
illustrated in FIG. 10. The oligonucleotide probes (desalted
70mers) were spotted at 40 .mu.M concentration on an epoxide slide
(Corning) using the above epoxide spotting buffer formulation
supplemented with varying concentrations of NP-40. The sub-arrays
were then hybridized with IDT's Cy3.TM.-SpotQC and scanned, using
the ScanArray.RTM. 5000 (Perkin-Elmer) at 69/69 (optimized for 50%
GC probe) & 78/78 (optimized for 38.6% GC probe) laser
(power/gain) settings.
[0119] Increasing the pH of the spotting solution by either
titrating in sodium hydroxide (NaOH) or by changing the source of
sodium (3.times.SSC) results in decreased hybridization signal,
suggesting decreased oligo probe attachment density within the
probe spot, and increased probe spot size. In FIG. 10,
oligonucleotide probes (unpurified 41 mers) were spotted at 40 uM
concentration on an epoxide slide (Coming). using different
spotting solution formulations that varied by source of sodium (300
mM sodium phosphate, monobasic vs. 3.times.SSC) and pH. The
sub-arrays were then hybridized with complementary Cy3.TM.-labeled
oligo targets and scanned, using the ScanArray.RTM. 5000
(Perkin-Elmer) at 60/60 laser (power/gain) settings. The lower % GC
results in smaller diameter printed probe spots.
Example 5
Functional Example of a Genetic Variation Discrimination Assay
[0120] The following example illustrates the design of a generic
variation discrimination assay utilizing both the "traditional"
microarray format and a "reverse" microarray format. The Let7 miRNA
family was used as a model system since it provides different
degrees of sequence variation within a single family of highly
similar and biologically relevant sequences. In addition, each
element of this model can be mimicked using synthetic
oligonucleotides and these mimics can be used to simulate
biological environments with known expression levels and patterns
to more effectively and efficiently characterize the specificity,
as well as the sensitivity, of this improved microarray system.
[0121] In an assay with an actual sample obtained from a biological
source, the small RNA fragments would first be isolated using a
product, or kit, such as the Ambion.RTM. mirVana column. A 3'
linker would then be attached to the small RNA, such as is used in
the miRCat cloning kit (Integrated DNA Technologies, Inc.), to
provide a reverse transcription (RT) priming site. After
post-linkering purification, the target strands are modified with a
5'-fluorophore using a fluorophore-labeled RT primer. Thus a
single-stranded hybridization target is obtained which can be
hybridized against short (16-17mer) 5'-hydrazided modified
oligonucleotide probes immobilized on an epoxide slide surface in a
"traditional" microarray format. The target strands can also be
modified with a 5'-hydrazide group using a hydrazide-modified RT
primer for immobilization on an epoxide slide surface and
subsequently hybridized with a fluorophore-labeled short (16-17mer)
synthetic oligo probe set. In this example, results of Let7 model
hybridizations using a "traditional" DNA microarray format are
illustrated in FIG. 11, and those using a "reverse" DNA microarray
format are illustrated in FIG. 12.
[0122] There are twelve Let7 microRNA loci in the human genome that
resolve into nine discrete mature Let7 miRNA sequences. There are
three loci where hsa-let-7a occurs (hsa-let-7a-1, -2, and -3) and
two loci for hsa-let-7f (hsa-let-7f-1 and -2).
[0123] The following 16-mer (in bold) and 17-mer Human Let7 oligo
probe sets were selected using miRBase (Release 8.0) and
synthesized as either 5'-hydrazide modified oligo probes for use in
the "traditional" array format or 5'-Cy3 modifiedoligo probes for
use in the "reverse" array format.
TABLE-US-00011 SEQ ID NO: 48 GTAGTAGGTTGTATAGT Let 7a (17mer) SEQ
ID NO: 49 TAGTAGGTTGTATAGT Let 7a (16mer) SEQ ID NO: 50
GTAGTAGGTTGTGTGGT Let 7b (17mer) SEQ ID NO: 51 TAGTAGGTTGTGTGGT Let
7b (16mer) SEQ ID NO: 52 GTAGTAGGTTGTATGGT Let 7c (17mer) SEQ ID
NO: 53 TAGTAGGTTGTATGGT Let 7c (17mer) SEQ ID NO: 54
GTAGTAGGTTGCATAGT Let 7d (17mer) SEQ ID NO: 55 TAGTAGGTTGCATAGT Let
7d (16mer) SEQ ID NO: 56 GTAGGAGGTTGTATAGT Let 7e (17mer) SEQ ID
NO: 57 TAGGAGGTTGTATAGT Let 7e (16mer) SEQ ID NO: 58
GTAGTAGATTGTATAGT Let 7f (17mer) SEQ ID NO: 59 TAGTAGATTGTATAGT Let
7f (16mer) SEQ ID NO: 60 GTAGTAGTTTGTACAGT Let 7g (17mer) SEQ ID
NO: 61 TAGTAGTTTGTACAGT Let 7g (16mer) SEQ ID NO: 62
GTAGTAGTTTGTGCTGT Let 7i (17mer) SE0 ID NO: 63 TAGTAGTTTGTGCTGT Let
7i (17mer) SEQ ID NO: 64 GTAGTAAGTTGTATTGT miR-78 (17mer) SEQ ID
NO: 65 TAGTAAGTTGTATTGT miR-98 (17mer) Underlined bases indicate
the variation relative to 7a.
[0124] The Let-7 target "mimics" and a partially "randomized"
miRCat-pool target mimic were synthesized as 5'-Cy3 oligos for
hybridization with the "traditional" array format or as
5'-hydrazide modified oligos for immobilization on an epoxide slide
surface with the "reverse" array format. The partially "randomized"
miRCat-pool target mimic was used to simulate the post-reverse
transcription "background complexity" that might be expected if
using real RNA isolated from a sample (or tissue) of interest.
TABLE-US-00012 SEQ ID NO: 66
GTCCTTGGTGCCCGAGTGTAACTATACAACCTACTACCTCA Let-7a SEQ ID NO: 67
GTCCTTGGTGCCCGAGTGTAACCACACAACCTACTACCTCA Let-7b SEQ ID NO: 68
GTCCTTGGTGCCCGAGTGTAACCATACAACCTACCTCA Let-7c SEQ ID NO: 69
GTCCTTGGTGCCCGAGTGTACTATGCAACCTACTACCTC Let-7d SEQ ID NO: 70
GTCCTTGGTGCCCGAGTGTACTATCAACCTCCTACCTCA Let-7e SEQ ID NO: 71
GTCCTTGGTGCCCGAGTGTAACTATACAATCTACTACCTA Let-7f SEQ ID NO: 72
GTCCTTGGTGCCCGAGTGTACTGTAAACTACCTA Let-7g SEQ ID NO: 73
GTCCTTGGTGCCCGAGTGTACAGCACAAACTACTACCTCA Let-7i SEQ ID NO: 74
GTCCTTGGTGCCCAGTGTAACAATACAACTTACTCCTCA miR9B SEQ ID NO: 75
GTCCTTGGTGCCCGAGTGTNNNNNNNNNNNNNNNNNNNNNNN miRCat- pool
[0125] For the "traditional" array format example, the 16mer and
17mer 5'-hydrazide modified oligo probe sets were each printed at a
40 .mu.M concentration in 1.times. epoxide spotting buffer (see
Example 4 for buffer composition) and immobilized on epoxide slides
(Corning), according to the probe spot layout given in Table 5.
TABLE-US-00013 TABLE 5 "Traditional" Array Format Probe Spot Layout
Guide Guide Light Light Let-7a Let-7a Let-7b Let-7b Let-7c Let-7c
(17mer) (17mer) (17mer) (17mer) (17mer) (17mer) Let-7d Let-7d
Let-7e Let-7e Let-7f Let-7f (17mer) (17mer) (17mer) (17mer) (17mer)
(17mer) Let-7g Let-7g Let-7i Let-7i miR98 miR98 (17mer) (17mer)
(17mer) (17mer) (17mer) (17mer) Let-7a Let-7a Let-7b Let-7b Let-7c
Let-7c (16mer) (16mer) (16mer) (16mer) (16mer) (16mer) Let-7d
Let-7d Let-7e Let-7e Let-7f Let-7f (16mer) (16mer) (16mer) (16mer)
(16mer) (16mer) Let-7g Let-7g Let-7i Let-7i miR98 miR98 (16mer)
(16mer) (16mer) (16mer) (16mer) (16mer) Guide Guide Light Light
[0126] The Cy3-labeled target mimics were then hybridized to the
"traditional" array format slide at 50.degree. C. for 2.25 hours.
One slide was hybridized with a pool of all nine Cy3-labeled Let7
target mimics (the positive control hyb) at a total concentration
of 10 nM; each individual Let7 target mimic was represented at 1.11
nM in this hybridization mix. A second slide was hybridized with
just the Cy3-labeled miRCat-pool target mimic (the negative control
hyb) at a concentration of 1O0 nM. Other slides were then
hybridized with a different specific Cy3-Let7 target mix with a
total target concentration of 10 nM; each specific Let7-target mix
contained just a single Cy3-Let7 target at 1.11 nM concentration
within the general Cy3-miRCat-pool target background. After
hybridization the slides were washed, dried, and scanned using the
same laser power/gain settings. FIG. 11 demonstrates that all probe
spots are easily detected when the appropriate hybridization target
is present at 1.11 nM and that the 17mer probe set has greater
hybridization signal strength compared to the 16mer probe set. It
also demonstrates the specificity of this microarray system since
none of the probe spots are detected when hybridized with an
unrelated target sequence (the negative control hybridized with the
Cy3-miRCat-pool target), and only the specific probe spots are
easily visualized when hybridized with the appropriate specific
Let7-target mix (example with Cy3-Let-7a). Only minimal
cross-hybridization is detected with the specific Let7-target
hybridization mixes which is limited to the most closely related
sequences within the Let7 family and is at the detection threshold,
or lowest sensitivity limit of the assay, of detection when the
specific probe spot hybridization signal is well above the signal
saturation limit comparison and alignment of the Let-7a target with
the cross-hybridizing probe spots Let-7c and Let-7e, which are
barely detectable in this example figure is below. A summary of the
hybridization results from all nine independent specific
Let7-target mixes is given in Table 6.
TABLE-US-00014 Let-7a Target
ACTCCATCATCCAACATATCAATGTGAGCCCGTGGTTCCTG/5Cy3/ SEQ ID NO: 66 in
reverse orientation, 3' to 5') Let-7c Probe
/5ILink12/GTAGTAGGTTGTATGGT (SEQ ID NO: 52) (T/G mismatch with 14
contiguous nt) Let-7e Probe /5ILink12/GTAGTAGGTTGTATGGT (SEQ ID NO:
56) (A/G mismatch with 12 contiguous nt)
TABLE-US-00015 TABLE 6 Specific Let7-target Hybridization Results
Probe Target: 7a 7b 7c 7d 7e 7f 7g 7i miR98 7a +++++ - - + - - - -
- 7b - +++++ - - - - - - - 7c + - +++++ - - - - - - 7d - - - +++++
- - - - - 7e + - - + +++++ - - - - 7f - - - - - ++++ - - - 7g - - -
- - - +++++ - - 7i - - - - - - - +++++ - miR98 - - - - - - - -
+++++
[0127] For the "reverse" array format example, the individual
5'-hydrazide modified Let7 target mimic sequences were sorted into
various mixes (detailed below) and subsequently mixed with the
5'-hydrazide modified miRCat-pool target mimic to simulate the
genetic complexity that one might expect from using a sample of
interest with these defined Let7 compositions. Each mix was printed
at a 40 .mu.M total oligo concentration (the individual Let7
sequences represent molecular ratios from .about.1:10 to
.about.1:10,000, relative to the total molecule composition) in
17.times. epoxide spotting buffer (see Example 4 for buffer
composition) and immobilized on epoxide slides (Corning), according
to the probe spot layout given in Table 7.
TABLE-US-00016 TABLE 7 "Reverse" Array Format Probe Spot Layout Mix
11 Mix 11 Mix 12 Mix 12 Buffer Buffer Guide Guide (1) (1) (1) (1)
(N) (N) Light Light Mix 7 Mix 7 Mix 8 Mix 8 Mix 9 Mix 9 Mix 10 Mix
10 (N) (N) (N) (N) (C) (C) (1) (1) Mix 3 Mix 3 Mix 4 Mix 4 Mix 5
Mix 5 Mix 6 Mix 6 (N) (N) (N) (N) (2) (2) (C) (C) Guide Guide
Buffer Buffer Mix 1 Mix 1 Mix 2 Mix 2 Light Light (N) (N) (1) (1)
(C) (C) Buffer = spotting buffer only Mix 1 = minus 7c, 7d Mix 2 =
minus 7a, 7d Mix 3 = minus 7a, 7c Mix 4 = minus 7a, 7c, 7d & 2X
7e Mix 5 = minus 7b, 7c, 7d & 2X 7a Mix 6 = minus 7a, 7d, 7e
& 2X 7b Mix 7 = minus 7a, 7c, 7f & 2X 7g Mix 8 = minus 7a,
7c, 7d, 7g & 2X 7f, 7i Mix 9 = minus 7a, 7b, 7f, 7i & 2X
7d, 98 Mix 10 = minus 7b, 7e, 7g, 98 & 2X 7c, 7f Mix 11 = minus
7b, 7c, 98 & 2X 7d Mix 12 = minus 7d, 7i (N) = expected
negative spot since it lacks 7a target and 7c (1) = expected
positive signal with 7a target (2) = expected 2X signal since it
contains twice the amount of 7a target (C) = possible
cross-hybridization since 7c is present
[0128] The Cy3-labeled Let-7a 16mer oligo probe was hybridized to
the "reverse" array format slide at 10 nM concentration at
50.degree. C. for 2.25 hours. Five array sets representing five
print, or spotting, dilutions were tested (see FIG. 12).
[0129] FIG. 12 shows that the expected signal pattern is clearly
visible at the 1/1,000 ratio and right at the lower limits of
detection at the 1/10,000 ratio, demonstrating a high degree of
sensitivity of this array system even in the "reverse" array
format. This level of sensitivity is similar to that achieved with
the "traditional" array format. The specificity is also maintained
with no evidence of Let-7a cross-reactive hybridization signal with
the probe spots containing Let-7c.
[0130] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0131] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0132] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
75119DNAArtificial SequenceOligonucleotide 1taacaccgcc aatgtcaca
19222DNAArtificial SequenceOligonucleotide 2ctaacaccac caatgtcaca
ag 22320DNAArtificial SequenceOligonucleotide 3ttaaaaaggc
gataccgggg 20424DNAArtificial SequenceOligonucleotide 4gaattaaaaa
tgcgatacca ggga 24517DNAArtificial SequenceOligonucleotide
5ctaacaccgc caatgtc 17617DNAArtificial SequenceOligonucleotide
6ctaacaccac caatgtc 17717DNAArtificial SequenceOligonucleotide
7aaaaaggcga taccggg 17817DNAArtificial SequenceOligonucleotide
8aaaaatgcga taccagg 17931DNAArtificial SequenceOligonucleotide
9agctcttgtg acattggcgg tgttagtgta a 311031DNAArtificial
SequenceOligonucleotide 10agctcttgtg acattggtgg tgttagtgta a
311131DNAArtificial SequenceOligonucleotide 11ttttccccgg tatcgccttt
ttaattctca c 311231DNAArtificial SequenceOligonucleotide
12ttttccctgg tatcgcattt ttaattctca c 311325DNAArtificial
SequenceOligonucleotide 13tcctcatttc cagagagaag atcgg
251425DNAArtificial SequenceOligonucleotide 14tcctcatttc cagagagaag
atcgg 251525DNAArtificial SequenceOligonucleotide 15tcctcatttc
cagagagaag atcgg 251625DNAArtificial SequenceOligonucleotide
16tcctcatttc cagagagaag atcgg 251725DNAArtificial
SequenceOligonucleotide 17tcctcatttc cagagagaag atcgg
251825DNAArtificial SequenceOligonucleotide 18tcctcatttc cagagagaag
atcgg 251925DNAArtificial SequenceOligonucleotide 19tcctcatttc
cagagagaag atcgg 252025DNAArtificial SequenceOligonucleotide
20tcctcatttc cagagagaag atcgg 252125DNAArtificial
SequenceOligonucleotide 21tcctcatttc cagagagaag atcgg
252225DNAArtificial SequenceOligonucleotide 22tcctcatttc cagagagaag
atcgg 252325DNAArtificial SequenceOligonucleotide 23tcctcatttc
cagagagaag atcgg 252425DNAArtificial SequenceOligonucleotide
24tcctcatttc cagagagaag atcgg 252525DNAArtificial
SequenceOligonucleotide 25tcctcatttc cagagagaag atcgg
252625DNAArtificial SequenceOligonucleotide 26tcctcatttc cagagagaag
atcgg 252725DNAArtificial SequenceOligonucleotide 27tcctcatttc
cagagagaag atcgg 252825DNAArtificial SequenceOligonucleotide
28tcctcatttc cagagagaag atcgg 252925DNAArtificial
SequenceOligonucleotide 29tcctcatttc cagagagaag atcgg
253025DNAArtificial SequenceOligonucleotide 30tcctcatttc cagagagaag
atcgg 253125DNAArtificial SequenceOligonucleotide 31tcctcatttc
cagagagaag atcgg 253225DNAArtificial SequenceOligonucleotide
32tcctcatttc cagagagaag atcgg 253325DNAArtificial
SequenceOligonucleotide 33tcctcatttc cagagagaag atcgg
253425DNAArtificial SequenceOligonucleotide 34ccgatcttct ctctggaaat
gagga 253525DNAArtificial SequenceOligonucleotide 35ccgatcttct
ctctggaaat gagga 253625DNAArtificial SequenceOligonucleotide
36ccgatcttct ctctggaaat gagga 253725DNAArtificial
SequenceOligonucleotide 37ccgatcttct ctctggaaat gagga
253817DNAArtificial SequenceOligonucleotide 38ttctgtgact ggtgagt
173917DNAArtificial SequenceOligonucleotide 39ttctgtgagt ggtgagt
174017DNAArtificial SequenceOligonucleotide 40ttctgtgaat ggtgagt
174117DNAArtificial SequenceOligonucleotide 41ttctgtgatt ggtgagt
1742101DNAArtificial SequenceOligonucleotide 42gccgcataca
ctattctcag aatgacttgg ttgagtactc accagtcaca gaacagatgg 60tgcagagggc
catgaaggac ctgacctatg cctccctgtg c 10143101DNAArtificial
SequenceOligonucleotide 43gccgcataca ctattctcag aatgacttgg
ttgagtactc accactcaca gaacagatgg 60tgcagagggc catgaaggac ctgacctatg
cctccctgtg c 10144101DNAArtificial SequenceOligonucleotide
44gccgcataca ctattctcag aatgacttgg ttgagtactc accattcaca gaacagatgg
60tgcagagggc catgaaggac ctgacctatg cctccctgtg c
10145101DNAArtificial SequenceOligonucleotide 45gccgcataca
ctattctcag aatgacttgg ttgagtactc accaatcaca gaacagatgg 60tgcagagggc
catgaaggac ctgacctatg cctccctgtg c 1014620DNAArtificial
SequenceOligonucleotide 46gccgcataca ctattctcag 204718DNAArtificial
SequenceOligonucleotide 47gcacagggag gcataggt 184817DNAArtificial
SequenceOligonucleotide 48gtagtaggtt gtatagt 174916DNAArtificial
SequenceOligonucleotide 49tagtaggttg tatagt 165017DNAArtificial
SequenceOligonucleotide 50gtagtaggtt gtgtggt 175116DNAArtificial
SequenceOligonucleotide 51tagtaggttg tgtggt 165217DNAArtificial
SequenceOligonucleotide 52gtagtaggtt gtatggt 175316DNAArtificial
SequenceOligonucleotide 53tagtaggttg tatggt 165417DNAArtificial
SequenceOligonucleotide 54gtagtaggtt gcatagt 175516DNAArtificial
SequenceOligonucleotide 55tagtaggttg catagt 165617DNAArtificial
SequenceOligonucleotide 56gtaggaggtt gtatagt 175716DNAArtificial
SequenceOligonucleotide 57taggaggttg tatagt 165817DNAArtificial
SequenceOligonucleotide 58gtagtagatt gtatagt 175916DNAArtificial
SequenceOligonucleotide 59tagtagattg tatagt 166017DNAArtificial
SequenceOligonucleotide 60gtagtagttt gtacagt 176116DNAArtificial
SequenceOligonucleotide 61tagtagtttg tacagt 166217DNAArtificial
SequenceOligonucleotide 62gtagtagttt gtgctgt 176316DNAArtificial
SequenceOligonucleotide 63tagtagtttg tgctgt 166417DNAArtificial
SequenceOligonucleotide 64gtagtaagtt gtattgt 176516DNAArtificial
SequenceOligonucleotide 65tagtaagttg tattgt 166641DNAArtificial
SequenceOligonucleotide 66gtccttggtg cccgagtgta actatacaac
ctactacctc a 416741DNAArtificial SequenceOligonucleotide
67gtccttggtg cccgagtgta accacacaac ctactacctc a 416841DNAArtificial
SequenceOligonucleotide 68gtccttggtg cccgagtgta accatacaac
ctactacctc a 416940DNAArtificial SequenceOligonucleotide
69gtccttggtg cccgagtgta ctatgcaacc tactacctct 407040DNAArtificial
SequenceOligonucleotide 70gtccttggtg cccgagtgta ctatacaacc
tcctacctca 407141DNAArtificial SequenceOligonucleotide 71gtccttggtg
cccgagtgta actatacaat ctactacctc a 417240DNAArtificial
SequenceOligonucleotide 72gtccttggtg cccgagtgta ctgtacaaac
tactacctca 407340DNAArtificial SequenceOligonucleotide 73gtccttggtg
cccgagtgta cagcacaaac tactacctca 407441DNAArtificial
SequenceOligonucleotide 74gtccttggtg cccgagtgta acaatacaac
ttactacctc a 417542DNAArtificial
SequenceOligonucleotidemisc_feature(20)..(42)n is a, c, g, or t
75gtccttggtg cccgagtgtn nnnnnnnnnn nnnnnnnnnn nn 42
* * * * *