U.S. patent application number 15/502287 was filed with the patent office on 2017-08-10 for uses of salt-inducible kinase (sik) inhibitors.
This patent application is currently assigned to Dana-Farber Cancer Institute, Inc.. The applicant listed for this patent is The Broad Institute, Inc., Dana-Farber Cancer Institute, Inc., The General Hospital Corporation d/b/a Massachusetts General Hospital, The General Hospital Corporation d/b/a Massachusetts General Hospital, President and Fellows of Harvard College. Invention is credited to Hwan Geun Choi, Nathanael S. Gray, Yanke Liang, Stuart L. Schreiber, Alykhan Shamji, Thomas Sundberg, Ramnik Xavier.
Application Number | 20170224700 15/502287 |
Document ID | / |
Family ID | 55264789 |
Filed Date | 2017-08-10 |
United States Patent
Application |
20170224700 |
Kind Code |
A1 |
Shamji; Alykhan ; et
al. |
August 10, 2017 |
USES OF SALT-INDUCIBLE KINASE (SIK) INHIBITORS
Abstract
The present disclosure provides methods of treating and/or
preventing inflammatory bowel disease (IBD) and graft-versus-host
disease (GVHD) using salt-inducible kinase (SIK) inhibitors, such
as macrocyclic SIK inhibitors of Formula (I), imidazolyl SIK
inhibitors of Formula (II), and urea and carbamate SIK inhibitors
of Formula (III-A) (e.g., urea and carbamate SIK inhibitors of
Formula (III)). ##STR00001##
Inventors: |
Shamji; Alykhan;
(Somerville, MA) ; Sundberg; Thomas; (Boston,
MA) ; Gray; Nathanael S.; (Boston, MA) ;
Xavier; Ramnik; (Brookline, MA) ; Schreiber; Stuart
L.; (Boston, MA) ; Choi; Hwan Geun; (Chestnut
Hill, MA) ; Liang; Yanke; (Brookline, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dana-Farber Cancer Institute, Inc.
The Broad Institute, Inc.
President and Fellows of Harvard College
The General Hospital Corporation d/b/a Massachusetts General
Hospital |
Boston
Cambridge
Cambridge
Boston |
MA
MA
MA
MA |
US
US
US
US |
|
|
Assignee: |
Dana-Farber Cancer Institute,
Inc.
Boston
MA
The Broad Institute, Inc.
Cambridge
MA
President and Fellows of Harvard College
Cambridge
MA
The General Hospital Corporation d/b/a Massachusetts General
Hospital
Boston
MA
|
Family ID: |
55264789 |
Appl. No.: |
15/502287 |
Filed: |
August 8, 2015 |
PCT Filed: |
August 8, 2015 |
PCT NO: |
PCT/US2015/044387 |
371 Date: |
February 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62035332 |
Aug 8, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/5377 20130101;
A61K 45/06 20130101; A61K 31/519 20130101; A61P 37/00 20180101;
A61K 31/506 20130101; A61P 1/00 20180101 |
International
Class: |
A61K 31/5377 20060101
A61K031/5377; A61K 31/506 20060101 A61K031/506; A61K 31/519
20060101 A61K031/519 |
Claims
1. A method of treating a disease in a subject in need thereof, the
method comprising administering to the subject a therapeutically
effective amount of a salt-inducible kinase (SIK) inhibitor of any
one of Formulae (I), (II), and (III-A), or a pharmaceutically
acceptable salt thereof, wherein the disease is inflammatory bowel
disease or graft-versus-host disease.
2. (canceled)
3. The method of claim 1, wherein the disease is inflammatory bowel
disease.
4. The method of claim 3, wherein the inflammatory bowel disease is
Crohn's disease or ulcerative colitis.
5. (canceled)
6. The method of claim 1, wherein the disease is graft-versus-host
disease.
7. (canceled)
8. A method of inhibiting the activity of a salt-inducible kinase
(SIK) in a subject, the method comprising administering to the
subject an effective amount of a SIK inhibitor of any one of
Formulae (I), (II), and (III-A), or a pharmaceutically acceptable
salt thereof.
9. (canceled)
10. A method of increasing the level of interleukin 10 (IL-10) in a
subject, the method comprising administering to the subject an
effective amount of a salt-inducible kinase (SIK) inhibitor of any
one of Formulae (I), (II), and (III-A), or a pharmaceutically
acceptable salt thereof.
11. (canceled)
12. A method of decreasing the level of a pro-inflammatory cytokine
in a subject, the method comprising administering to the subject an
effective amount of a salt-inducible kinase (SIK) inhibitor of any
one of Formulae (I), (II), and (III-A), or a pharmaceutically
acceptable salt thereof.
13. (canceled)
14. The method of 12, wherein the pro-inflammatory cytokine is
IL-1.beta., IL-6, IL-12, or TNF-.alpha..
15. A method of converting bone marrow-derived dentritic cells
(BMDCs) to an anti-inflammatory phenotype in a subject, the method
comprising administering to the subject an effective amount of a
salt-inducible kinase (SIK) inhibitor of any one of Formulae (I),
(II), and (III-A), or a pharmaceutically acceptable salt
thereof.
16-20. (canceled)
21. The method of claim 1, wherein the SIK inhibitor is of Formula
(I): ##STR00278## or a pharmaceutically acceptable salt thereof,
wherein: Ring A is a substituted or unsubstituted phenyl ring or a
substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl ring, wherein one, two, three, or four atoms in the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur; each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; each
instance of R.sup.a is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.a groups are joined to form
a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; k is 0, 1, 2, 3, or 4; L is a
substituted or unsubstituted, saturated or unsaturated C.sub.3-10
hydrocarbon chain, optionally wherein one or more chain atoms of
the hydrocarbon chain are independently replaced with --O--, --S--,
--NR.sup.N--, --N.dbd., or .dbd.N--, wherein each instance of
R.sup.N is independently hydrogen, substituted or unsubstituted
acyl, substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; R.sup.B is hydrogen, substituted or unsubstituted
acyl, substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; each of X.sup.A, X.sup.B, and X.sup.C is
independently N or CR.sup.X, wherein R.sup.X is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; Y is --O--
or --NR.sup.Y--, wherein R.sup.Y is hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group; or when Y is --NR.sup.Y-- and
X.sup.A is CR.sup.X, R.sup.Y and R.sup.X of X.sup.A are joined to
form a substituted or unsubstituted, monocyclic, 5- to 7-membered
heterocyclic ring that is fused with Ring B; each instance of
R.sup.C is independently halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; m is 0, 1,
2, 3, 4, or 5; and R.sup.D is hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
22-77. (canceled)
78. The method of claim 21, wherein the SIK inhibitor is of the
formula: ##STR00279## or a pharmaceutically acceptable salt
thereof.
79. The method of claim 21, wherein the SIK inhibitor is of the
formula: ##STR00280## ##STR00281## ##STR00282## or a
pharmaceutically acceptable salt thereof.
80. The method of claim 1, wherein the SIK inhibitor is of Formula
(II): ##STR00283## or a pharmaceutically acceptable salt thereof,
wherein: each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; each
instance of R.sup.a is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two instances of R.sup.a are joined
to form a substituted or unsubstituted heterocyclic or substituted
or unsubstituted heteroaryl ring; j is 0, 1, or 2; R.sup.B is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl, or
a nitrogen protecting group; R.sup.C is hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group; each instance of R.sup.D is
independently halogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; m is 0, 1,
or 2; R.sup.E is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; each instance of R.sup.F is independently
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and n is 0,
1, 2, 3, 4, or 5.
81. The method of claim 80, wherein the SIK inhibitor is of Formula
(II-A): ##STR00284## or a pharmaceutically acceptable salt thereof,
wherein: each instance of R.sup.G is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and k is 0,
1, 2, 3, 4, or 5.
82-88. (canceled)
89. The method of claim 80, wherein the SIK inhibitor is of Formula
(II-B): ##STR00285## or a pharmaceutically acceptable salt thereof,
wherein: R.sup.H is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group; each instance of R.sup.J is independently
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; q is 0, 1,
2, 3, or 4; and R.sup.K is hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
90-127. (canceled)
128. The method of claim 80, wherein the SIK inhibitor is of the
formula: ##STR00286## ##STR00287## or a pharmaceutically acceptable
salt thereof.
129-130. (canceled)
131. The method of claim 1, wherein the SIK inhibitor is of Formula
(III-A): ##STR00288## or a pharmaceutically acceptable salt
thereof, wherein: R.sup.G is hydrogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted heteroaryl, or of the formula: ##STR00289## each
instance of R.sup.A is independently halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2, or two
R.sup.A groups are joined to form a substituted or unsubstituted
carbocyclic ring, substituted or unsubstituted heterocyclic ring,
substituted or unsubstituted aryl ring, or substituted or
unsubstituted heteroaryl ring; each instance of R.sup.a is
independently hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, a nitrogen protecting group when attached
to a nitrogen atom, an oxygen protecting group when attached to an
oxygen atom, or a sulfur protecting group when attached to a sulfur
atom, or two R.sup.a groups are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring; k is 0, 1, 2, 3, 4, or 5; R.sup.B is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group; each of X.sup.A,
X.sup.B, and X.sup.C is independently N or CR.sup.X, wherein each
instance of R.sup.X is independently hydrogen, halogen, substituted
or unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; or: X.sup.B
is CR.sup.X, and R.sup.G and R.sup.X of X.sup.B are joined to form
a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; R.sup.C is hydrogen, halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; R.sup.D is
hydrogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group; Z is a bond or
--C(R.sup.Z).sub.2--, wherein each instance of R.sup.Z is
independently hydrogen, halogen, or substituted or unsubstituted
C.sub.1-6 alkyl; each instance of R.sup.E is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aS(.dbd.O)R.sup.a,
--NR.sup.aS(.dbd.O)OR.sup.a, --NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and m is 0,
1, 2, 3, 4, or 5.
132. The method of claim 131, wherein the SIK inhibitor is of
Formula (III): ##STR00290## or a pharmaceutically acceptable salt
thereof, wherein: each instance of R.sup.A is independently
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; each
instance of R.sup.a is independently hydrogen, substituted or
unsubstituted acyl, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, a nitrogen protecting
group when attached to a nitrogen atom, an oxygen protecting group
when attached to an oxygen atom, or a sulfur protecting group when
attached to a sulfur atom, or two R.sup.a groups are joined to form
a substituted or unsubstituted heterocyclic or substituted or
unsubstituted heteroaryl ring; k is 0, 1, 2, 3, 4, or 5; R.sup.B is
hydrogen, substituted or unsubstituted acyl, substituted or
unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each
of X.sup.A, X.sup.B, and X.sup.C is independently N or CR.sup.X,
wherein each instance of R.sup.X is independently hydrogen,
halogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; R.sup.C is
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; R.sup.D is
hydrogen, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group; Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group; each instance of
R.sup.E is independently halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and m is 0,
1, 2, 3, 4, or 5.
133-217. (canceled)
218. The method of claim 131, wherein the SIK inhibitor is of the
formula: ##STR00291## or a pharmaceutically acceptable salt
thereof.
219. The method of claim 131, wherein the SIK inhibitor is of the
formula: ##STR00292## ##STR00293## ##STR00294## ##STR00295##
##STR00296## ##STR00297## ##STR00298## ##STR00299## ##STR00300##
##STR00301## or a pharmaceutically acceptable salt thereof.
220. (canceled)
Description
RELATED APPLICATIONS
[0001] The present application claims priority under 35 U.S.C.
.sctn.119(e) to U.S. provisional application, U.S. Ser. No.
62/035,332, filed Aug. 8, 2014, which is incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0002] Inflammatory bowel disease (IBD) is a group of inflammatory
conditions of the colon and small intestine, principally including
Crohn's disease and ulcerative colitis, with other forms of IBD
representing far fewer cases (e.g., collagenous colitis,
lymphocytic colitis, diversion colitis, Behcet's disease and
indeterminate colitis). Pathologically, Crohn's disease affects the
full thickness of the bowel wall (e.g., transmural lesions) and can
affect any part of the gastrointestinal tract, while ulcerative
colitis is restricted to the mucosa (epithelial lining) of the
colon and rectum. Graft-versus-host disease (GVHD) is an
immune-related disease that can occur following an allogeneic
tissue transplant. It is commonly associated with stem cell or bone
marrow transplants, but GVHD also applies to other forms of tissue
graft. In GVHD immune cells of the tissue graft recognize the
recipient host as foreign and attack the host's cells.
[0003] It has long been recognized that IBD and GVHD are diseases
associated with increased immune activity. The causes of IBD, while
not well understood, may be related to an aberrant immune response
to the microbiota in genetically susceptible individuals. IBD
affects over 1.4 million people in the United States and over 2.2
million in Europe and is on the increase. With both environmental
and genetic factors playing a role in the development and
progression of IBD, response to current treatments (e.g.,
anti-inflammatory drugs, immune system suppressors, antibiotics,
surgery, and other symptom specific medications) are
unpredictable.
[0004] Similarly, a fundamental feature of GVHD is increased immune
activity. As yet, the pathophysiology underlying GVHD is not well
understood. It is a significant cause of morbidity and mortality
following allogenic haematopoietic stem-cell transplantation and
thus the focus of much ongoing research. Despite the advances in
understanding the pathophysiology (e.g., predisposing factors), a
standardized therapeutic strategy is still lacking. Currently both
acute and chronic forms of GVHD are treated using corticosteroids
(e.g., anti-inflammatory treatments). There is a need for new
approaches to treating IBD and GVHD.
SUMMARY OF THE INVENTION
[0005] In one aspect, described herein are novel uses of several
compound classes as salt-inducible kinase (SIK) inhibitors. The
described SIK inhibitors include macrocyclic compounds of Formula
(I), imidazolyl compounds of Formula (II), urea and carbamate
compounds of Formula (III-A) (e.g., urea and carbamate compounds of
Formula (III)), and pharmaceutically acceptable salts, solvates,
hydrates, polymorphs, co-crystals, tautomers, stereoisomers,
isotopically labeled derivatives, and prodrugs thereof. The
described SIK inhibitors are able to inhibit the activity of a SIK
(e.g., SIK1, SIK2, SIK3), to enhance interleukin 10 (IL-10)
production, and/or to treat and/or prevent inflammatory bowel
disease (IBD) and/or graft-versus-host disease (GVHD) in a subject
in need thereof.
[0006] In certain embodiments, the SIK inhibitor for use in the
invention described herein is a compound of Formula (I):
##STR00002##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0007] Exemplary compounds of Formula (I) include, but are not
limited to:
##STR00003## ##STR00004##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0008] Additional exemplary compounds of Formula (I) include, but
are not limited to:
##STR00005## ##STR00006## ##STR00007##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0009] In certain embodiments, the SIK inhibitor for use in the
invention described herein is a compound of Formula (II):
##STR00008##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0010] Exemplary compounds of Formula (II) include, but are not
limited to:
##STR00009## ##STR00010##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0011] In certain embodiments, the SIK inhibitor for use in the
invention described herein is a compound of Formula (III-A):
##STR00011##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0012] In certain embodiments, the SIK inhibitor of Formula (III-A)
is a compound of Formula (III):
##STR00012##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0013] Exemplary compounds of Formula (III-A) include, but are not
limited to:
##STR00013## ##STR00014##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0014] Additional exemplary compounds of Formula (III-A) include,
but are not limited to:
##STR00015## ##STR00016## ##STR00017## ##STR00018## ##STR00019##
##STR00020## ##STR00021## ##STR00022## ##STR00023## ##STR00024##
##STR00025##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0015] Additional exemplary compounds of Formula (III-A) also
include, but are not limited to:
##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030##
##STR00031## ##STR00032## ##STR00033##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof.
[0016] In another aspect, the present disclosure provides methods
of treating IBD in a subject in need thereof.
[0017] In another aspect, the present disclosure provides methods
of preventing IBD in a subject in need thereof.
[0018] In another aspect, the present disclosure provides methods
of treating GVHD in a subject in need thereof.
[0019] In another aspect, the present disclosure provides methods
of preventing GVHD in a subject in need thereof.
[0020] Another aspect of the disclosure relates to methods of
inhibiting the activity of a SIK in a subject.
[0021] Another aspect of the disclosure relates to methods of
inhibiting the activity of a SIK in a cell.
[0022] Another aspect of the disclosure relates to methods of
increasing the level of IL-10 in a subject.
[0023] Another aspect of the disclosure relates to methods of
increasing the level of IL-10 in a cell.
[0024] In another aspect, the present disclosure provides methods
of decreasing the level of a pro-inflammatory cytokine (e.g.,
IL-1.beta., IL-6, IL-12, or TNF-.alpha.) in a subject.
[0025] In another aspect, the present disclosure provides methods
of decreasing the level of a pro-inflammatory cytokine (e.g.,
IL-1.beta., IL-6, IL-12, or TNF-.alpha.) in a cell.
[0026] In still another aspect, the present disclosure provides
methods of converting bone marrow-derived dendritic cells (BMDCs)
to an anti-inflammatory phenotype in a subject.
[0027] In certain embodiments, a method described herein includes
administering to the subject an effective amount of a SIK inhibitor
described herein. In certain embodiments, the subject is a human.
In certain embodiments, a method described herein includes
contacting the cell an effective amount of a SIK inhibitor
described herein. In certain embodiments, the cell is in vitro.
[0028] In further another aspect, the present disclosure provides
the SIK inhibitors for use in a method described herein.
[0029] The present disclosure refers to various issued patents,
published patent applications, journal articles, and other
publications, all of which are incorporated herein by reference.
The details of one or more embodiments of the invention are set
forth herein. Other features, objects, and advantages of the
invention will be apparent from the Detailed Description, the
Figures, the Examples, and the Claims.
Definitions
[0030] Definitions of specific functional groups and chemical terms
are described in more detail below. The chemical elements are
identified in accordance with the Periodic Table of the Elements,
CAS version, Handbook of Chemistry and Physics, 75.sup.th Ed.,
inside cover, and specific functional groups are generally defined
as described therein. Additionally, general principles of organic
chemistry, as well as specific functional moieties and reactivity,
are described in Organic Chemistry, Thomas Sorrell, University
Science Books, Sausalito, 1999; Smith and March March's Advanced
Organic Chemistry, 5.sup.th Edition, John Wiley & Sons, Inc.,
New York, 2001; Larock, Comprehensive Organic Transformations, VCH
Publishers, Inc., New York, 1989; and Carruthers, Some Modern
Methods of Organic Synthesis, 3.sup.rd Edition, Cambridge
University Press, Cambridge, 1987.
[0031] Compounds described herein can comprise one or more
asymmetric centers, and thus can exist in various stereoisomeric
forms, e.g., enantiomers and/or diastereomers. For example, the
compounds described herein can be in the form of an individual
enantiomer, diastereomer or geometric isomer, or can be in the form
of a mixture of stereoisomers, including racemic mixtures and
mixtures enriched in one or more stereoisomer. Isomers can be
isolated from mixtures by methods known to those skilled in the
art, including chiral high pressure liquid chromatography (HPLC)
and the formation and crystallization of chiral salts; or preferred
isomers can be prepared by asymmetric syntheses. See, for example,
Jacques et al., Enantiomers, Racemates and Resolutions (Wiley
Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725
(1977); Eliel, E. L. Stereochemistry of Carbon Compounds
(McGraw-Hill, N Y, 1962); and Wilen, S. H. Tables of Resolving
Agents and Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ. of
Notre Dame Press, Notre Dame, Ind. 1972). The disclosure
additionally encompasses compounds as individual isomers
substantially free of other isomers, and alternatively, as mixtures
of various isomers.
[0032] In a formula, - - - is absent or a single bond, and or is a
single or double bond. In a formula, is a single bond where the
stereochemistry of the moieties immediately attached thereto is not
specified. Such a bond may be or .
[0033] The term "heteroatom" refers to an atom that is not hydrogen
or carbon. In certain embodiments, the heteroatom is nitrogen. In
certain embodiments, the heteroatom is oxygen. In certain
embodiments, the heteroatom is sulfur.
[0034] When a range of values is listed, it is intended to
encompass each value and sub-range within the range. For example
"C.sub.1-6 alkyl" is intended to encompass, C.sub.1, C.sub.2,
C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.1-6, C.sub.1-5,
C.sub.1-4, C.sub.1-3, C.sub.1-2, C.sub.2-6, C.sub.2-5, C.sub.2-4,
C.sub.2-3, C.sub.3-6, C.sub.3-5, C.sub.3-4, C.sub.4-6, C.sub.4-5,
and C.sub.5-6 alkyl.
[0035] The term "aliphatic" refers to alkyl, alkenyl, alkynyl, and
carbocyclic groups. Likewise, the term "heteroaliphatic" refers to
heteroalkyl, heteroalkenyl, heteroalkynyl, and heterocyclic
groups.
[0036] The term "alkyl" refers to a radical of a straight-chain or
branched saturated hydrocarbon group having from 1 to 10 carbon
atoms ("C.sub.1-10 alkyl"). In some embodiments, an alkyl group has
1 to 9 carbon atoms ("C.sub.1-9 alkyl"). In some embodiments, an
alkyl group has 1 to 8 carbon atoms ("C.sub.1-8 alkyl"). In some
embodiments, an alkyl group has 1 to 7 carbon atoms ("C.sub.1-7
alkyl"). In some embodiments, an alkyl group has 1 to 6 carbon
atoms ("C.sub.1-6 alkyl"). In some embodiments, an alkyl group has
1 to 5 carbon atoms ("C.sub.1-5 alkyl"). In some embodiments, an
alkyl group has 1 to 4 carbon atoms ("C.sub.1-4 alkyl"). In some
embodiments, an alkyl group has 1 to 3 carbon atoms ("C.sub.1-3
alkyl"). In some embodiments, an alkyl group has 1 to 2 carbon
atoms ("C.sub.1-2 alkyl"). In some embodiments, an alkyl group has
1 carbon atom ("C.sub.1 alkyl"). In some embodiments, an alkyl
group has 2 to 6 carbon atoms ("C.sub.2-6 alkyl"). Examples of
C.sub.1-6 alkyl groups include methyl (C.sub.1), ethyl (C.sub.2),
propyl (C.sub.3) (e.g., n-propyl, isopropyl), butyl (C.sub.4)
(e.g., n-butyl, tert-butyl, sec-butyl, iso-butyl), pentyl (C.sub.5)
(e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl,
tertiary amyl), and hexyl (C.sub.6) (e.g., n-hexyl). Additional
examples of alkyl groups include n-heptyl (C.sub.7), n-octyl
(C.sub.8), and the like. Unless otherwise specified, each instance
of an alkyl group is independently unsubstituted (an "unsubstituted
alkyl") or substituted (a "substituted alkyl") with one or more
substituents (e.g., halogen, such as F). In certain embodiments,
the alkyl group is an unsubstituted C.sub.1-10 alkyl (such as
unsubstituted C.sub.1-6 alkyl, e.g., --CH.sub.3 (Me), unsubstituted
ethyl (Et), unsubstituted propyl (Pr, e.g., unsubstituted n-propyl
(n-Pr), unsubstituted isopropyl (i-Pr)), unsubstituted butyl (Bu,
e.g., unsubstituted n-butyl (n-Bu), unsubstituted tert-butyl
(tert-Bu or t-Bu), unsubstituted sec-butyl (sec-Bu), unsubstituted
isobutyl (i-Bu)). In certain embodiments, the alkyl group is a
substituted C.sub.1-10 alkyl (such as substituted C.sub.1-6 alkyl,
e.g., --CF.sub.3, Bn).
[0037] The term "haloalkyl" is a substituted alkyl group, wherein
one or more of the hydrogen atoms are independently replaced by a
halogen, e.g., fluoro, bromo, chloro, or iodo. "Perhaloalkyl" is a
subset of haloalkyl, and refers to an alkyl group wherein all of
the hydrogen atoms are independently replaced by a halogen, e.g.,
fluoro, bromo, chloro, or iodo. In some embodiments, the haloalkyl
moiety has 1 to 8 carbon atoms ("C.sub.1-8 haloalkyl"). In some
embodiments, the haloalkyl moiety has 1 to 6 carbon atoms
("C.sub.1-6 haloalkyl"). In some embodiments, the haloalkyl moiety
has 1 to 4 carbon atoms ("C.sub.1-4 haloalkyl"). In some
embodiments, the haloalkyl moiety has 1 to 3 carbon atoms
("C.sub.1-3 haloalkyl"). In some embodiments, the haloalkyl moiety
has 1 to 2 carbon atoms ("C.sub.1-2 haloalkyl"). In some
embodiments, all of the haloalkyl hydrogen atoms are replaced with
fluoro to provide a perfluoroalkyl group. In some embodiments, all
of the haloalkyl hydrogen atoms are replaced with chloro to provide
a "perchloroalkyl" group. Examples of haloalkyl groups include
--CF.sub.3, --CF.sub.2CF.sub.3, --CF.sub.2CF.sub.2CF.sub.3,
--CCl.sub.3, --CFCl.sub.2, --CF.sub.2Cl, and the like.
[0038] The term "heteroalkyl" refers to an alkyl group, which
further includes at least one heteroatom (e.g., 1, 2, 3, or 4
heteroatoms) selected from oxygen, nitrogen, or sulfur within
(i.e., inserted between adjacent carbon atoms of) and/or placed at
one or more terminal position(s) of the parent chain. In certain
embodiments, a heteroalkyl group refers to a saturated group having
from 1 to 10 carbon atoms and 1 or more heteroatoms within the
parent chain ("heteroC.sub.1-10 alkyl"). In some embodiments, a
heteroalkyl group is a saturated group having 1 to 9 carbon atoms
and 1 or more heteroatoms within the parent chain ("heteroC.sub.1-9
alkyl"). In some embodiments, a heteroalkyl group is a saturated
group having 1 to 8 carbon atoms and 1 or more heteroatoms within
the parent chain ("heteroC.sub.1-8 alkyl"). In some embodiments, a
heteroalkyl group is a saturated group having 1 to 7 carbon atoms
and 1 or more heteroatoms within the parent chain ("heteroC.sub.1-7
alkyl"). In some embodiments, a heteroalkyl group is a saturated
group having 1 to 6 carbon atoms and 1 or more heteroatoms within
the parent chain ("heteroC.sub.1-6 alkyl"). In some embodiments, a
heteroalkyl group is a saturated group having 1 to 5 carbon atoms
and 1 or 2 heteroatoms within the parent chain ("heteroC.sub.1-5
alkyl"). In some embodiments, a heteroalkyl group is a saturated
group having 1 to 4 carbon atoms and 1 or 2 heteroatoms within the
parent chain ("heteroC.sub.1-4 alkyl"). In some embodiments, a
heteroalkyl group is a saturated group having 1 to 3 carbon atoms
and 1 heteroatom within the parent chain ("heteroC.sub.1-3 alkyl").
In some embodiments, a heteroalkyl group is a saturated group
having 1 to 2 carbon atoms and 1 heteroatom within the parent chain
("heteroC.sub.1-2 alkyl"). In some embodiments, a heteroalkyl group
is a saturated group having 1 carbon atom and 1 heteroatom
("heteroC.sub.1 alkyl"). In some embodiments, a heteroalkyl group
is a saturated group having 2 to 6 carbon atoms and 1 or 2
heteroatoms within the parent chain ("heteroC.sub.2-6 alkyl").
Unless otherwise specified, each instance of a heteroalkyl group is
independently unsubstituted (an "unsubstituted heteroalkyl") or
substituted (a "substituted heteroalkyl") with one or more
substituents. In certain embodiments, the heteroalkyl group is an
unsubstituted heteroC.sub.1-10 alkyl. In certain embodiments, the
heteroalkyl group is a substituted heteroC.sub.1-10 alkyl.
[0039] The term "alkenyl" refers to a radical of a straight-chain
or branched hydrocarbon group having from 2 to 10 carbon atoms and
one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double
bonds). In some embodiments, an alkenyl group has 2 to 9 carbon
atoms ("C.sub.2-9 alkenyl"). In some embodiments, an alkenyl group
has 2 to 8 carbon atoms ("C.sub.2-8 alkenyl"). In some embodiments,
an alkenyl group has 2 to 7 carbon atoms ("C.sub.2-7 alkenyl"). In
some embodiments, an alkenyl group has 2 to 6 carbon atoms
("C.sub.2-6 alkenyl"). In some embodiments, an alkenyl group has 2
to 5 carbon atoms ("C.sub.2-5 alkenyl"). In some embodiments, an
alkenyl group has 2 to 4 carbon atoms ("C.sub.2-4 alkenyl"). In
some embodiments, an alkenyl group has 2 to 3 carbon atoms
("C.sub.2-3 alkenyl"). In some embodiments, an alkenyl group has 2
carbon atoms ("C.sub.2 alkenyl"). The one or more carbon-carbon
double bonds can be internal (such as in 2-butenyl) or terminal
(such as in 1-butenyl). Examples of C.sub.2-4 alkenyl groups
include ethenyl (C.sub.2), 1-propenyl (C.sub.3), 2-propenyl
(C.sub.3), 1-butenyl (C.sub.4), 2-butenyl (C.sub.4), butadienyl
(C.sub.4), and the like. Examples of C.sub.2-6 alkenyl groups
include the aforementioned C.sub.2-4 alkenyl groups as well as
pentenyl (C.sub.5), pentadienyl (C.sub.5), hexenyl (C.sub.6), and
the like. Additional examples of alkenyl include heptenyl
(C.sub.7), octenyl (C.sub.8), octatrienyl (C.sub.8), and the like.
Unless otherwise specified, each instance of an alkenyl group is
independently unsubstituted (an "unsubstituted alkenyl") or
substituted (a "substituted alkenyl") with one or more
substituents. In certain embodiments, the alkenyl group is an
unsubstituted C.sub.2-10 alkenyl. In certain embodiments, the
alkenyl group is a substituted C.sub.2-10 alkenyl. In an alkenyl
group, a C.dbd.C double bond for which the stereochemistry is
unspecified (e.g., --CH.dbd.CHCH.sub.3 or
##STR00034##
may be an (E)- or (Z)-double bond.
[0040] The term "heteroalkenyl" refers to an alkenyl group, which
further includes at least one heteroatom (e.g., 1, 2, 3, or 4
heteroatoms) selected from oxygen, nitrogen, or sulfur within
(i.e., inserted between adjacent carbon atoms of) and/or placed at
one or more terminal position(s) of the parent chain. In certain
embodiments, a heteroalkenyl group refers to a group having from 2
to 10 carbon atoms, at least one double bond, and 1 or more
heteroatoms within the parent chain ("heteroC.sub.2-10 alkenyl").
In some embodiments, a heteroalkenyl group has 2 to 9 carbon atoms
at least one double bond, and 1 or more heteroatoms within the
parent chain ("heteroC.sub.2-9 alkenyl"). In some embodiments, a
heteroalkenyl group has 2 to 8 carbon atoms, at least one double
bond, and 1 or more heteroatoms within the parent chain
("heteroC.sub.2-8 alkenyl"). In some embodiments, a heteroalkenyl
group has 2 to 7 carbon atoms, at least one double bond, and 1 or
more heteroatoms within the parent chain ("heteroC.sub.2-7
alkenyl"). In some embodiments, a heteroalkenyl group has 2 to 6
carbon atoms, at least one double bond, and 1 or more heteroatoms
within the parent chain ("heteroC.sub.2-6 alkenyl"). In some
embodiments, a heteroalkenyl group has 2 to 5 carbon atoms, at
least one double bond, and 1 or 2 heteroatoms within the parent
chain ("heteroC.sub.2-5 alkenyl"). In some embodiments, a
heteroalkenyl group has 2 to 4 carbon atoms, at least one double
bond, and 1 or 2 heteroatoms within the parent chain
("heteroC.sub.2-4 alkenyl"). In some embodiments, a heteroalkenyl
group has 2 to 3 carbon atoms, at least one double bond, and 1
heteroatom within the parent chain ("heteroC.sub.2-3 alkenyl"). In
some embodiments, a heteroalkenyl group has 2 to 6 carbon atoms, at
least one double bond, and 1 or 2 heteroatoms within the parent
chain ("heteroC.sub.2-6 alkenyl"). Unless otherwise specified, each
instance of a heteroalkenyl group is independently unsubstituted
(an "unsubstituted heteroalkenyl") or substituted (a "substituted
heteroalkenyl") with one or more substituents. In certain
embodiments, the heteroalkenyl group is an unsubstituted
heteroC.sub.2-10 alkenyl. In certain embodiments, the heteroalkenyl
group is a substituted heteroC.sub.2-10 alkenyl.
[0041] The term "alkynyl" refers to a radical of a straight-chain
or branched hydrocarbon group having from 2 to 10 carbon atoms and
one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple
bonds) ("C.sub.2-10 alkynyl"). In some embodiments, an alkynyl
group has 2 to 9 carbon atoms ("C.sub.2-9 alkynyl"). In some
embodiments, an alkynyl group has 2 to 8 carbon atoms ("C.sub.2-8
alkynyl"). In some embodiments, an alkynyl group has 2 to 7 carbon
atoms ("C.sub.2-7 alkynyl"). In some embodiments, an alkynyl group
has 2 to 6 carbon atoms ("C.sub.2-6 alkynyl"). In some embodiments,
an alkynyl group has 2 to 5 carbon atoms ("C.sub.2-5 alkynyl"). In
some embodiments, an alkynyl group has 2 to 4 carbon atoms
("C.sub.2-4 alkynyl"). In some embodiments, an alkynyl group has 2
to 3 carbon atoms ("C.sub.2-3 alkynyl"). In some embodiments, an
alkynyl group has 2 carbon atoms ("C.sub.2 alkynyl"). The one or
more carbon-carbon triple bonds can be internal (such as in
2-butynyl) or terminal (such as in 1-butynyl). Examples of
C.sub.2-4 alkynyl groups include, without limitation, ethynyl
(C.sub.2), 1-propynyl (C.sub.3), 2-propynyl (C.sub.3), 1-butynyl
(C.sub.4), 2-butynyl (C.sub.4), and the like. Examples of C.sub.2-6
alkenyl groups include the aforementioned C.sub.2-4 alkynyl groups
as well as pentynyl (C.sub.5), hexynyl (C.sub.6), and the like.
Additional examples of alkynyl include heptynyl (C.sub.7), octynyl
(C.sub.8), and the like. Unless otherwise specified, each instance
of an alkynyl group is independently unsubstituted (an
"unsubstituted alkynyl") or substituted (a "substituted alkynyl")
with one or more substituents. In certain embodiments, the alkynyl
group is an unsubstituted C.sub.2-10 alkynyl. In certain
embodiments, the alkynyl group is a substituted C.sub.2-10
alkynyl.
[0042] The term "heteroalkynyl" refers to an alkynyl group, which
further includes at least one heteroatom (e.g., 1, 2, 3, or 4
heteroatoms) selected from oxygen, nitrogen, or sulfur within
(i.e., inserted between adjacent carbon atoms of) and/or placed at
one or more terminal position(s) of the parent chain. In certain
embodiments, a heteroalkynyl group refers to a group having from 2
to 10 carbon atoms, at least one triple bond, and 1 or more
heteroatoms within the parent chain ("heteroC.sub.2-10 alkynyl").
In some embodiments, a heteroalkynyl group has 2 to 9 carbon atoms,
at least one triple bond, and 1 or more heteroatoms within the
parent chain ("heteroC.sub.2-9 alkynyl"). In some embodiments, a
heteroalkynyl group has 2 to 8 carbon atoms, at least one triple
bond, and 1 or more heteroatoms within the parent chain
("heteroC.sub.2-8 alkynyl"). In some embodiments, a heteroalkynyl
group has 2 to 7 carbon atoms, at least one triple bond, and 1 or
more heteroatoms within the parent chain ("heteroC.sub.2-7
alkynyl"). In some embodiments, a heteroalkynyl group has 2 to 6
carbon atoms, at least one triple bond, and 1 or more heteroatoms
within the parent chain ("heteroC.sub.2-6 alkynyl"). In some
embodiments, a heteroalkynyl group has 2 to 5 carbon atoms, at
least one triple bond, and 1 or 2 heteroatoms within the parent
chain ("heteroC.sub.2-5 alkynyl"). In some embodiments, a
heteroalkynyl group has 2 to 4 carbon atoms, at least one triple
bond, and 1 or 2 heteroatoms within the parent chain
("heteroC.sub.2-4 alkynyl"). In some embodiments, a heteroalkynyl
group has 2 to 3 carbon atoms, at least one triple bond, and 1
heteroatom within the parent chain ("heteroC.sub.2-3 alkynyl"). In
some embodiments, a heteroalkynyl group has 2 to 6 carbon atoms, at
least one triple bond, and 1 or 2 heteroatoms within the parent
chain ("heteroC.sub.2-6 alkynyl"). Unless otherwise specified, each
instance of a heteroalkynyl group is independently unsubstituted
(an "unsubstituted heteroalkynyl") or substituted (a "substituted
heteroalkynyl") with one or more substituents. In certain
embodiments, the heteroalkynyl group is an unsubstituted
heteroC.sub.2-10 alkynyl. In certain embodiments, the heteroalkynyl
group is a substituted heteroC.sub.2-10 alkynyl.
[0043] The term "carbocyclyl" or "carbocyclic" refers to a radical
of a non-aromatic cyclic hydrocarbon group having from 3 to 14 ring
carbon atoms ("C.sub.3-14 carbocyclyl") and zero heteroatoms in the
non-aromatic ring system. In some embodiments, a carbocyclyl group
has 3 to 10 ring carbon atoms ("C.sub.3-10 carbocyclyl"). In some
embodiments, a carbocyclyl group has 3 to 8 ring carbon atoms
("C.sub.3-8 carbocyclyl"). In some embodiments, a carbocyclyl group
has 3 to 7 ring carbon atoms ("C.sub.3-7 carbocyclyl"). In some
embodiments, a carbocyclyl group has 3 to 6 ring carbon atoms
("C.sub.3-6 carbocyclyl"). In some embodiments, a carbocyclyl group
has 4 to 6 ring carbon atoms ("C.sub.4-6 carbocyclyl"). In some
embodiments, a carbocyclyl group has 5 to 6 ring carbon atoms
("C.sub.5-6 carbocyclyl"). In some embodiments, a carbocyclyl group
has 5 to 10 ring carbon atoms ("C.sub.5-10 carbocyclyl"). Exemplary
C.sub.3-6 carbocyclyl groups include, without limitation,
cyclopropyl (C.sub.3), cyclopropenyl (C.sub.3), cyclobutyl
(C.sub.4), cyclobutenyl (C.sub.4), cyclopentyl (C.sub.5),
cyclopentenyl (C.sub.5), cyclohexyl (C.sub.6), cyclohexenyl
(C.sub.6), cyclohexadienyl (C.sub.6), and the like. Exemplary
C.sub.3-8 carbocyclyl groups include, without limitation, the
aforementioned C.sub.3-6 carbocyclyl groups as well as cycloheptyl
(C.sub.7), cycloheptenyl (C.sub.7), cycloheptadienyl (C.sub.7),
cycloheptatrienyl (C.sub.7), cyclooctyl (C.sub.8), cyclooctenyl
(C.sub.8), bicyclo[2.2.1]heptanyl (C.sub.7), bicyclo[2.2.2]octanyl
(C.sub.8), and the like. Exemplary C.sub.3-10 carbocyclyl groups
include, without limitation, the aforementioned C.sub.3-8
carbocyclyl groups as well as cyclononyl (C.sub.9), cyclononenyl
(C.sub.9), cyclodecyl (C.sub.10), cyclodecenyl (C.sub.10),
octahydro-1H-indenyl (C.sub.9), decahydronaphthalenyl (C.sub.10),
spiro[4.5]decanyl (C.sub.10), and the like. As the foregoing
examples illustrate, in certain embodiments, the carbocyclyl group
is either monocyclic ("monocyclic carbocyclyl") or polycyclic
(e.g., containing a fused, bridged or spiro ring system such as a
bicyclic system ("bicyclic carbocyclyl") or tricyclic system
("tricyclic carbocyclyl")) and can be saturated or can contain one
or more carbon-carbon double or triple bonds. "Carbocyclyl" also
includes ring systems wherein the carbocyclyl ring, as defined
above, is fused with one or more aryl or heteroaryl groups wherein
the point of attachment is on the carbocyclyl ring, and in such
instances, the number of carbons continue to designate the number
of carbons in the carbocyclic ring system. Unless otherwise
specified, each instance of a carbocyclyl group is independently
unsubstituted (an "unsubstituted carbocyclyl") or substituted (a
"substituted carbocyclyl") with one or more substituents. In
certain embodiments, the carbocyclyl group is an unsubstituted
C.sub.3-14 carbocyclyl. In certain embodiments, the carbocyclyl
group is a substituted C.sub.3-14 carbocyclyl.
[0044] In some embodiments, "carbocyclyl" is a monocyclic,
saturated carbocyclyl group having from 3 to 14 ring carbon atoms
("C.sub.3-14 cycloalkyl"). In some embodiments, a cycloalkyl group
has 3 to 10 ring carbon atoms ("C.sub.3-10 cycloalkyl"). In some
embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms
("C.sub.3-8 cycloalkyl"). In some embodiments, a cycloalkyl group
has 3 to 6 ring carbon atoms ("C.sub.3-6 cycloalkyl"). In some
embodiments, a cycloalkyl group has 4 to 6 ring carbon atoms
("C.sub.4-6 cycloalkyl"). In some embodiments, a cycloalkyl group
has 5 to 6 ring carbon atoms ("C.sub.5-6 cycloalkyl"). In some
embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms
("C.sub.5-10 cycloalkyl"). Examples of C.sub.5-6 cycloalkyl groups
include cyclopentyl (C.sub.5) and cyclohexyl (C.sub.5). Examples of
C.sub.3-6 cycloalkyl groups include the aforementioned C.sub.5-6
cycloalkyl groups as well as cyclopropyl (C.sub.3) and cyclobutyl
(C.sub.4). Examples of C.sub.3-8 cycloalkyl groups include the
aforementioned C.sub.3-6 cycloalkyl groups as well as cycloheptyl
(C.sub.7) and cyclooctyl (C.sub.8). Unless otherwise specified,
each instance of a cycloalkyl group is independently unsubstituted
(an "unsubstituted cycloalkyl") or substituted (a "substituted
cycloalkyl") with one or more substituents. In certain embodiments,
the cycloalkyl group is an unsubstituted C.sub.3-14 cycloalkyl. In
certain embodiments, the cycloalkyl group is a substituted
C.sub.3-14 cycloalkyl.
[0045] The term "heterocyclyl" or "heterocyclic" refers to a
radical of a 3- to 14-membered non-aromatic ring system having ring
carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom
is independently selected from nitrogen, oxygen, and sulfur ("3-14
membered heterocyclyl"). In heterocyclyl groups that contain one or
more nitrogen atoms, the point of attachment can be a carbon or
nitrogen atom, as valency permits. A heterocyclyl group can either
be monocyclic ("monocyclic heterocyclyl") or polycyclic (e.g., a
fused, bridged or spiro ring system such as a bicyclic system
("bicyclic heterocyclyl") or tricyclic system ("tricyclic
heterocyclyl")), and can be saturated or can contain one or more
carbon-carbon double or triple bonds. Heterocyclyl polycyclic ring
systems can include one or more heteroatoms in one or both rings.
"Heterocyclyl" also includes ring systems wherein the heterocyclyl
ring, as defined above, is fused with one or more carbocyclyl
groups wherein the point of attachment is either on the carbocyclyl
or heterocyclyl ring, or ring systems wherein the heterocyclyl
ring, as defined above, is fused with one or more aryl or
heteroaryl groups, wherein the point of attachment is on the
heterocyclyl ring, and in such instances, the number of ring
members continue to designate the number of ring members in the
heterocyclyl ring system. Unless otherwise specified, each instance
of heterocyclyl is independently unsubstituted (an "unsubstituted
heterocyclyl") or substituted (a "substituted heterocyclyl") with
one or more substituents. In certain embodiments, the heterocyclyl
group is an unsubstituted 3-14 membered heterocyclyl. In certain
embodiments, the heterocyclyl group is a substituted 3-14 membered
heterocyclyl.
[0046] In some embodiments, a heterocyclyl group is a 5-10 membered
non-aromatic ring system having ring carbon atoms and 1-4 ring
heteroatoms, wherein each heteroatom is independently selected from
nitrogen, oxygen, and sulfur ("5-10 membered heterocyclyl"). In
some embodiments, a heterocyclyl group is a 5-8 membered
non-aromatic ring system having ring carbon atoms and 1-4 ring
heteroatoms, wherein each heteroatom is independently selected from
nitrogen, oxygen, and sulfur ("5-8 membered heterocyclyl"). In some
embodiments, a heterocyclyl group is a 5-6 membered non-aromatic
ring system having ring carbon atoms and 1-4 ring heteroatoms,
wherein each heteroatom is independently selected from nitrogen,
oxygen, and sulfur ("5-6 membered heterocyclyl"). In some
embodiments, the 5-6 membered heterocyclyl has 1-3 ring heteroatoms
selected from nitrogen, oxygen, and sulfur. In some embodiments,
the 5-6 membered heterocyclyl has 1-2 ring heteroatoms selected
from nitrogen, oxygen, and sulfur. In some embodiments, the 5-6
membered heterocyclyl has 1 ring heteroatom selected from nitrogen,
oxygen, and sulfur.
[0047] Exemplary 3-membered heterocyclyl groups containing 1
heteroatom include, without limitation, azirdinyl, oxiranyl, and
thiiranyl. Exemplary 4-membered heterocyclyl groups containing 1
heteroatom include, without limitation, azetidinyl, oxetanyl, and
thietanyl. Exemplary 5-membered heterocyclyl groups containing 1
heteroatom include, without limitation, tetrahydrofuranyl,
dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl,
pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary
5-membered heterocyclyl groups containing 2 heteroatoms include,
without limitation, dioxolanyl, oxathiolanyl and dithiolanyl.
Exemplary 5-membered heterocyclyl groups containing 3 heteroatoms
include, without limitation, triazolinyl, oxadiazolinyl, and
thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing
1 heteroatom include, without limitation, piperidinyl,
tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary
6-membered heterocyclyl groups containing 2 heteroatoms include,
without limitation, piperazinyl, morpholinyl, dithianyl, and
dioxanyl. Exemplary 6-membered heterocyclyl groups containing 2
heteroatoms include, without limitation, triazinanyl. Exemplary
7-membered heterocyclyl groups containing 1 heteroatom include,
without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary
8-membered heterocyclyl groups containing 1 heteroatom include,
without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary
bicyclic heterocyclyl groups include, without limitation,
indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl,
tetrahydrobenzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl,
decahydroisoquinolinyl, octahydrochromenyl, octahydroisochromenyl,
decahydronaphthyridinyl, decahydro-1,8-naphthyridinyl,
octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthalimidyl,
naphthalimidyl, chromanyl, chromenyl, 1H-benzo[e][1,4]diazepinyl,
1,4,5,7-tetrahydropyrano[3,4-b]pyrrolyl,
5,6-dihydro-4H-furo[3,2-b]pyrrolyl,
6,7-dihydro-5H-furo[3,2-b]pyranyl,
5,7-dihydro-4H-thieno[2,3-c]pyranyl,
2,3-dihydro-1H-pyrrolo[2,3-b]pyridinyl,
2,3-dihydrofuro[2,3-b]pyridinyl,
4,5,6,7-tetrahydro-1H-pyrrolo[2,3-b]pyridinyl,
4,5,6,7-tetra-hydrofuro[3,2-c]pyridinyl,
4,5,6,7-tetrahydrothieno[3,2-b]pyridinyl,
1,2,3,4-tetrahydro-1,6-naphthyridinyl, and the like.
[0048] The term "aryl" refers to a radical of a monocyclic or
polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system
(e.g., having 6, 10, or 14 .pi. electrons shared in a cyclic array)
having 6-14 ring carbon atoms and zero heteroatoms provided in the
aromatic ring system ("C.sub.6-14 aryl"). In some embodiments, an
aryl group has 6 ring carbon atoms ("C.sub.6 aryl"; e.g., phenyl).
In some embodiments, an aryl group has 10 ring carbon atoms
("C.sub.10 aryl"; e.g., naphthyl such as 1-naphthyl and
2-naphthyl). In some embodiments, an aryl group has 14 ring carbon
atoms ("C.sub.14 aryl"; e.g., anthracyl). "Aryl" also includes ring
systems wherein the aryl ring, as defined above, is fused with one
or more carbocyclyl or heterocyclyl groups wherein the radical or
point of attachment is on the aryl ring, and in such instances, the
number of carbon atoms continue to designate the number of carbon
atoms in the aryl ring system. Unless otherwise specified, each
instance of an aryl group is independently unsubstituted (an
"unsubstituted aryl") or substituted (a "substituted aryl") with
one or more substituents. In certain embodiments, the aryl group is
an unsubstituted C.sub.6-14 aryl. In certain embodiments, the aryl
group is a substituted C.sub.6-14 aryl.
[0049] "Aralkyl" is a subset of "alkyl" and refers to an alkyl
group substituted by an aryl group, wherein the point of attachment
is on the alkyl moiety.
[0050] The term "heteroaryl" refers to a radical of a 5-14 membered
monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic
ring system (e.g., having 6, 10, or 14 .pi. electrons shared in a
cyclic array) having ring carbon atoms and 1-4 ring heteroatoms
provided in the aromatic ring system, wherein each heteroatom is
independently selected from nitrogen, oxygen, and sulfur ("5-14
membered heteroaryl"). In heteroaryl groups that contain one or
more nitrogen atoms, the point of attachment can be a carbon or
nitrogen atom, as valency permits. Heteroaryl polycyclic ring
systems can include one or more heteroatoms in one or both rings.
"Heteroaryl" includes ring systems wherein the heteroaryl ring, as
defined above, is fused with one or more carbocyclyl or
heterocyclyl groups wherein the point of attachment is on the
heteroaryl ring, and in such instances, the number of ring members
continue to designate the number of ring members in the heteroaryl
ring system. "Heteroaryl" also includes ring systems wherein the
heteroaryl ring, as defined above, is fused with one or more aryl
groups wherein the point of attachment is either on the aryl or
heteroaryl ring, and in such instances, the number of ring members
designates the number of ring members in the fused polycyclic
(aryl/heteroaryl) ring system. Polycyclic heteroaryl groups wherein
one ring does not contain a heteroatom (e.g., indolyl, quinolinyl,
carbazolyl, and the like) the point of attachment can be on either
ring, i.e., either the ring bearing a heteroatom (e.g., 2-indolyl)
or the ring that does not contain a heteroatom (e.g.,
5-indolyl).
[0051] In some embodiments, a heteroaryl group is a 5-10 membered
aromatic ring system having ring carbon atoms and 1-4 ring
heteroatoms provided in the aromatic ring system, wherein each
heteroatom is independently selected from nitrogen, oxygen, and
sulfur ("5-10 membered heteroaryl"). In some embodiments, a
heteroaryl group is a 5-8 membered aromatic ring system having ring
carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring
system, wherein each heteroatom is independently selected from
nitrogen, oxygen, and sulfur ("5-8 membered heteroaryl"). In some
embodiments, a heteroaryl group is a 5-6 membered aromatic ring
system having ring carbon atoms and 1-4 ring heteroatoms provided
in the aromatic ring system, wherein each heteroatom is
independently selected from nitrogen, oxygen, and sulfur ("5-6
membered heteroaryl"). In some embodiments, the 5-6 membered
heteroaryl has 1-3 ring heteroatoms selected from nitrogen, oxygen,
and sulfur. In some embodiments, the 5-6 membered heteroaryl has
1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In
some embodiments, the 5-6 membered heteroaryl has 1 ring heteroatom
selected from nitrogen, oxygen, and sulfur. Unless otherwise
specified, each instance of a heteroaryl group is independently
unsubstituted (an "unsubstituted heteroaryl") or substituted (a
"substituted heteroaryl") with one or more substituents. In certain
embodiments, the heteroaryl group is an unsubstituted 5-14 membered
heteroaryl. In certain embodiments, the heteroaryl group is a
substituted 5-14 membered heteroaryl.
[0052] Exemplary 5-membered heteroaryl groups containing 1
heteroatom include, without limitation, pyrrolyl, furanyl, and
thiophenyl. Exemplary 5-membered heteroaryl groups containing 2
heteroatoms include, without limitation, imidazolyl, pyrazolyl,
oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary
5-membered heteroaryl groups containing 3 heteroatoms include,
without limitation, triazolyl, oxadiazolyl, and thiadiazolyl.
Exemplary 5-membered heteroaryl groups containing 4 heteroatoms
include, without limitation, tetrazolyl. Exemplary 6-membered
heteroaryl groups containing 1 heteroatom include, without
limitation, pyridinyl. Exemplary 6-membered heteroaryl groups
containing 2 heteroatoms include, without limitation, pyridazinyl,
pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups
containing 3 or 4 heteroatoms include, without limitation,
triazinyl and tetrazinyl, respectively. Exemplary 7-membered
heteroaryl groups containing 1 heteroatom include, without
limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary
5,6-bicyclic heteroaryl groups include, without limitation,
indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl,
isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl,
benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl,
benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl.
Exemplary 6,6-bicyclic heteroaryl groups include, without
limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl,
cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary
tricyclic heteroaryl groups include, without limitation,
phenanthridinyl, dibenzofuranyl, carbazolyl, acridinyl,
phenothiazinyl, phenoxazinyl and phenazinyl.
[0053] "Heteroaralkyl" is a subset of "alkyl" and refers to an
alkyl group substituted by a heteroaryl group, wherein the point of
attachment is on the alkyl moiety.
[0054] The term "unsaturated bond" refers to a double or triple
bond.
[0055] The term "unsaturated" or "partially unsaturated" refers to
a moiety that includes at least one double or triple bond.
[0056] The term "saturated" refers to a moiety that does not
contain a double or triple bond, i.e., the moiety only contains
single bonds.
[0057] Affixing the suffix "-ene" to a group indicates the group is
a divalent moiety, e.g., alkylene is the divalent moiety of alkyl,
alkenylene is the divalent moiety of alkenyl, alkynylene is the
divalent moiety of alkynyl, heteroalkylene is the divalent moiety
of heteroalkyl, heteroalkenylene is the divalent moiety of
heteroalkenyl, heteroalkynylene is the divalent moiety of
heteroalkynyl, carbocyclylene is the divalent moiety of
carbocyclyl, heterocyclylene is the divalent moiety of
heterocyclyl, arylene is the divalent moiety of aryl, and
heteroarylene is the divalent moiety of heteroaryl.
[0058] A group is optionally substituted unless expressly provided
otherwise. In certain embodiments, alkyl, alkenyl, alkynyl,
heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl,
heterocyclyl, aryl, and heteroaryl groups are optionally
substituted. "Optionally substituted" refers to a group which may
be substituted or unsubstituted (e.g., "substituted" or
"unsubstituted" alkyl, "substituted" or "unsubstituted" alkenyl,
"substituted" or "unsubstituted" alkynyl, "substituted" or
"unsubstituted" heteroalkyl, "substituted" or "unsubstituted"
heteroalkenyl, "substituted" or "unsubstituted" heteroalkynyl,
"substituted" or "unsubstituted" carbocyclyl, "substituted" or
"unsubstituted" heterocyclyl, "substituted" or "unsubstituted" aryl
or "substituted" or "unsubstituted" heteroaryl group). In general,
the term "substituted" means that at least one hydrogen present on
a group is replaced with a permissible substituent, e.g., a
substituent which upon substitution results in a stable compound,
e.g., a compound which does not spontaneously undergo
transformation such as by rearrangement, cyclization, elimination,
or other reaction. Unless otherwise indicated, a "substituted"
group has a substituent at one or more substitutable positions of
the group, and when more than one position in any given structure
is substituted, the substituent is either the same or different at
each position. The term "substituted" is contemplated to include
substitution with all permissible substituents of organic
compounds, and includes any of the substituents described herein
that results in the formation of a stable compound. The present
disclosure contemplates any and all such combinations in order to
arrive at a stable compound. For purposes of this disclosure,
heteroatoms such as nitrogen may have hydrogen substituents and/or
any suitable substituent as described herein which satisfy the
valencies of the heteroatoms and results in the formation of a
stable moiety.
[0059] Exemplary carbon atom substituents include, but are not
limited to, halogen, --CN, --NO.sub.2, --N.sub.3, --SO.sub.2H,
--SO.sub.3H, --OH, --OR.sup.aa, --ON(R.sup.bb).sub.2,
--N(R.sup.bb).sub.2, --N(R.sup.bb).sub.3.sup.+X.sup.-,
--N(OR.sup.cc)R.sup.bb, --SH, --SR.sup.aa, --SSR.sup.cc,
--C(.dbd.O)R.sup.aa, --CO.sub.2H, --CHO, --C(OR.sup.cc).sub.2,
--CO.sub.2R.sup.aa, --OC(.dbd.O)R.sup.aa, --OCO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --OC(.dbd.O)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.O)R.sup.aa, --NR.sup.bbCO.sub.2R.sup.aa,
--NR.sup.bbC(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --OC(.dbd.NR.sup.bb)R.sup.aa,
--OC(.dbd.NR.sup.bb)OR.sup.aa,
--C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--C(.dbd.O)NR.sup.bbSO.sub.2R.sup.aa, --NR.sup.bbSO.sub.2R.sup.aa,
--SO.sub.2N(R.sup.bb).sub.2, --SO.sub.2R.sup.aa,
--SO.sub.2OR.sup.aa, --OSO.sub.2R.sup.aa, --S(.dbd.O)R.sup.aa,
--OS(.dbd.O)R.sup.aa, --Si(R.sup.aa).sub.3,
--OSi(R.sup.aa).sub.3--C(.dbd.S)N(R.sup.bb).sub.2,
--C(.dbd.O)SR.sup.a, --C(.dbd.S)SR.sup.aa, --SC(.dbd.S)SR.sup.aa,
--SC(.dbd.O)SR.sup.aa, --OC(.dbd.O)SR.sup.aa,
--SC(.dbd.O)OR.sup.aa, --SC(.dbd.O)R.sup.aa,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2,
--OP(.dbd.O)(R.sup.aa).sub.2, --OP(.dbd.O)(OR.sup.cc).sub.2,
--P(.dbd.O)(N(R.sup.bb).sub.2).sub.2,
--OP(.dbd.O)(N(R.sup.bb).sub.2).sub.2,
--NR.sup.bbP(.dbd.O)(R.sup.aa).sub.2,
--NR.sup.bbP(.dbd.O)(OR.sup.cc).sub.2,
--NR.sup.bbP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, --P(R.sup.cc).sub.2,
--P(OR.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.3.sup.+X.sup.-, --P(R.sup.cc).sub.4,
--P(OR.sup.cc).sub.4, --OP(R.sup.cc).sub.2,
--OP(R.sup.cc).sub.3.sup.+X.sup.-, --OP(OR.sup.cc).sub.2,
--OP(OR.sup.cc).sub.3.sup.+X.sup.-, --OP(R.sup.cc).sub.4,
--OP(OR.sup.cc).sub.4, --B(R.sup.aa).sub.2, --B(OR.sup.cc).sub.2,
--BR.sup.aa(OR.sup.cc), C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl,
C.sub.2-10 alkenyl, C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10 alkenyl, heteroC.sub.2-10 alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, wherein each alkyl, alkenyl, alkynyl,
heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl,
heterocyclyl, aryl, and heteroaryl is independently substituted
with 0, 1, 2, 3, 4, or 5 R.sup.dd groups; wherein X.sup.- is a
counterion;
[0060] or two geminal hydrogens on a carbon atom are replaced with
the group .dbd.O, .dbd.S, .dbd.NN(R.sup.bb).sub.2,
.dbd.NNR.sup.bbC(.dbd.O)R.sup.aa,
.dbd.NNR.sup.bbC(.dbd.O)OR.sup.aa,
.dbd.NNR.sup.bbS(.dbd.O).sub.2R.sup.aa, .dbd.NR.sup.bb, or
.dbd.NOR.sup.cc;
[0061] each instance of R.sup.aa is, independently, selected from
C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl, C.sub.2-10 alkenyl,
C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10alkenyl, heteroC.sub.2-10alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, or two R.sup.aa groups are joined to form a
3-14 membered heterocyclyl or 5-14 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd
groups;
[0062] each instance of R.sup.bb is, independently, selected from
hydrogen, --OH, --OR.sup.aa, --N(R.sup.cc).sub.2, --CN,
--C(.dbd.O)R.sup.aa, --C(.dbd.O)N(R.sup.cc).sub.2,
--CO.sub.2R.sup.aa, --SO.sub.2R.sup.aa,
--C(.dbd.NR.sup.cc)OR.sup.aa, --C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2,
--SO.sub.2N(R.sup.cc).sub.2, --SO.sub.2R.sup.cc,
--SO.sub.2OR.sup.cc, --SOR.sup.aa, --C(.dbd.S)N(R.sup.cc).sub.2,
--C(.dbd.O)SR.sup.cc, --C(.dbd.S)SR.sup.cc,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2,
--P(.dbd.O)(N(R.sup.cc).sub.2).sub.2, C.sub.1-10 alkyl, C.sub.1-10
perhaloalkyl, C.sub.2-10 alkenyl, C.sub.2-10 alkynyl,
heteroC.sub.1-10alkyl, heteroC.sub.2-10alkenyl,
heteroC.sub.2-10alkynyl, C.sub.3-10 carbocyclyl, 3-14 membered
heterocyclyl, C.sub.6-14 aryl, and 5-14 membered heteroaryl, or two
R.sup.bb groups are joined to form a 3-14 membered heterocyclyl or
5-14 membered heteroaryl ring, wherein each alkyl, alkenyl,
alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl,
heterocyclyl, aryl, and heteroaryl is independently substituted
with 0, 1, 2, 3, 4, or 5 R.sup.dd groups; wherein X.sup.- is a
counterion;
[0063] each instance of R.sup.cc is, independently, selected from
hydrogen, C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl, C.sub.2-10
alkenyl, C.sub.2-10 alkynyl, heteroC.sub.1-10 alkyl,
heteroC.sub.2-10 alkenyl, heteroC.sub.2-10 alkynyl, C.sub.3-10
carbocyclyl, 3-14 membered heterocyclyl, C.sub.6-14 aryl, and 5-14
membered heteroaryl, or two R.sup.cc groups are joined to form a
3-14 membered heterocyclyl or 5-14 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd
groups;
[0064] each instance of R.sup.dd is, independently, selected from
halogen, --CN, --NO.sub.2, --N.sub.3, --SO.sub.2H, --SO.sub.3H,
--OH, --OR.sup.ee, --ON(R.sup.ff).sub.2, --N(R.sup.ff).sub.2,
--N(R.sup.ff).sub.3.sup.+X.sup.-, --N(OR.sup.ee)R.sup.ff, --SH,
--SR.sup.ee, --SSR.sup.ee, --C(.dbd.O)R.sup.ee, --CO.sub.2H,
--CO.sub.2R.sup.ee, --OC(.dbd.O)R.sup.ee, --OCO.sub.2R.sup.ee,
--C(.dbd.O)N(R.sup.ff).sub.2, --OC(.dbd.O)N(R.sup.ff).sub.2,
--NR.sup.ffC(.dbd.O)R.sup.ee, --NR.sup.ffCO.sub.2R.sup.ee,
--NR.sup.ffC(.dbd.O)N(R.sup.ff).sub.2,
--C(.dbd.NR.sup.ff)OR.sup.ee, --OC(.dbd.NR.sup.ff)R.sup.ee,
--OC(.dbd.NR.sup.ff)OR.sup.ee,
--C(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--OC(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--NR.sup.ffC(.dbd.NR.sup.ff)N(R.sup.ff).sub.2,
--NR.sup.ffSO.sub.2R.sup.ee, --SO.sub.2N(R.sup.ff).sub.2,
--SO.sub.2R.sup.ee, --SO.sub.2OR.sup.ee, --OSO.sub.2R.sup.ee,
--S(.dbd.O)R.sup.ee, --Si(R.sup.ee).sub.3, --OSi(R.sup.ee).sub.3,
--C(.dbd.S)N(R.sup.ff).sub.2, --C(.dbd.O)SR.sup.ee,
--C(.dbd.S)SR.sup.ee, --SC(.dbd.S)SR.sup.ee,
--P(.dbd.O)(OR.sup.ee).sub.2, --P(.dbd.O)(R.sup.ee).sub.2,
--OP(.dbd.O)(R.sup.ee).sub.2, --OP(.dbd.O)(OR.sup.ee).sub.2,
C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl,
C.sub.2-6 alkynyl, heteroC.sub.1-6alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6alkynyl, C.sub.3-10 carbocyclyl, 3-10 membered
heterocyclyl, C.sub.6-10 aryl, 5-10 membered heteroaryl, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg groups,
or two geminal R.sup.dd substituents can be joined to form .dbd.O
or .dbd.S; wherein X.sup.- is a counterion;
[0065] each instance of R.sup.ee is, independently, selected from
C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl,
C.sub.2-6 alkynyl, heteroC.sub.1-6 alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6 alkynyl, C.sub.3-10 carbocyclyl, C.sub.6-10 aryl,
3-10 membered heterocyclyl, and 3-10 membered heteroaryl, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg
groups;
[0066] each instance of R.sup.ff is, independently, selected from
hydrogen, C.sub.1-6 alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6
alkenyl, C.sub.2-6 alkynyl, heteroC.sub.1-6alkyl,
heteroC.sub.2-6alkenyl, heteroC.sub.2-6alkynyl, C.sub.3-10
carbocyclyl, 3-10 membered heterocyclyl, C.sub.6-10 aryl and 5-10
membered heteroaryl, or two R.sup.ff groups are joined to form a
3-10 membered heterocyclyl or 5-10 membered heteroaryl ring,
wherein each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.gg groups;
and
[0067] each instance of R.sup.gg is, independently, halogen, --CN,
--NO.sub.2, --N.sub.3, --SO.sub.2H, --SO.sub.3H, --OH, --OC.sub.1-6
alkyl, --ON(C.sub.1-6 alkyl).sub.2, --N(C.sub.1-6 alkyl).sub.2,
--N(C.sub.1-6 alkyl).sub.3.sup.+X.sup.-, --NH(C.sub.1-6
alkyl).sub.2.sup.+X.sup.-, --NH.sub.2(C.sub.1-6
alkyl).sup.+X.sup.-, --NH.sub.3.sup.+X.sup.-, --N(OC.sub.1-6
alkyl)(C.sub.1-6 alkyl), --N(OH)(C.sub.1-6 alkyl), --NH(OH), --SH,
--SC.sub.1-6 alkyl, --SS(C.sub.1-6 alkyl), --C(.dbd.O)(C.sub.1-6
alkyl), --CO.sub.2H, --CO.sub.2(C.sub.1-6 alkyl),
--OC(.dbd.O)(C.sub.1-6 alkyl), --OCO.sub.2(C.sub.1-6 alkyl),
--C(.dbd.O)NH.sub.2, --C(.dbd.O)N(C.sub.1-6 alkyl).sub.2,
--OC(.dbd.O)NH(C.sub.1-6 alkyl), --NHC(.dbd.O)(C.sub.1-6 alkyl),
--N(C.sub.1-6 alkyl)C(.dbd.O)(C.sub.1-6 alkyl),
--NHCO.sub.2(C.sub.1-6 alkyl), --NHC(.dbd.O)N(C.sub.1-6
alkyl).sub.2, --NHC(.dbd.O)NH(C.sub.1-6 alkyl),
--NHC(.dbd.O)NH.sub.2, --C(.dbd.NH)O(C.sub.1-6 alkyl),
--OC(.dbd.NH)(C.sub.1-6 alkyl), --OC(.dbd.NH)OC.sub.1-6 alkyl,
--C(.dbd.NH)N(C.sub.1-6 alkyl).sub.2, --C(.dbd.NH)NH(C.sub.1-6
alkyl), --C(.dbd.NH)NH.sub.2, --OC(.dbd.NH)N(C.sub.1-6
alkyl).sub.2, --OC(NH)NH(C.sub.1-6 alkyl), --OC(NH)NH.sub.2,
--NHC(NH)N(C.sub.1-6 alkyl).sub.2, --NHC(.dbd.NH)NH.sub.2,
--NHSO.sub.2(C.sub.1-6 alkyl), --SO.sub.2N(C.sub.1-6 alkyl).sub.2,
--SO.sub.2NH(C.sub.1-6 alkyl), --SO.sub.2NH.sub.2,
--SO.sub.2C.sub.1-6 alkyl, --SO.sub.2OC.sub.1-6 alkyl,
--OSO.sub.2C.sub.1-6 alkyl, --SOC.sub.1-6 alkyl, --Si(C.sub.1-6
alkyl).sub.3, --OSi(C.sub.1-6 alkyl).sub.3-C(.dbd.S)N(C.sub.1-6
alkyl).sub.2, C(.dbd.S)NH(C.sub.1-6 alkyl), C(.dbd.S)NH.sub.2,
--C(.dbd.O)S(C.sub.1-6 alkyl), --C(.dbd.S)SC.sub.1-6 alkyl,
--SC(.dbd.S)SC.sub.1-6 alkyl, --P(.dbd.O)(OC.sub.1-6 alkyl).sub.2,
--P(.dbd.O)(C.sub.1-6 alkyl).sub.2, --OP(.dbd.O)(C.sub.1-6
alkyl).sub.2, --OP(.dbd.O)(OC.sub.1-6 alkyl).sub.2, C.sub.1-6
alkyl, C.sub.1-6 perhaloalkyl, C.sub.2-6 alkenyl, C.sub.2-6
alkynyl, heteroC.sub.1-6alkyl, heteroC.sub.2-6alkenyl,
heteroC.sub.2-6alkynyl, C.sub.3-10 carbocyclyl, C.sub.6-10 aryl,
3-10 membered heterocyclyl, 5-10 membered heteroaryl; or two
geminal R.sup.gg substituents can be joined to form .dbd.O or
.dbd.S; wherein X.sup.- is a counterion.
[0068] A "counterion" or "anionic counterion" is a negatively
charged group associated with a positively charged group in order
to maintain electronic neutrality. An anionic counterion may be
monovalent (i.e., including one formal negative charge). An anionic
counterion may also be multivalent (i.e., including more than one
formal negative charge), such as divalent or trivalent. Exemplary
counterions include halide ions (e.g., F.sup.-, Cl.sup.-, Br.sup.-,
I.sup.-), NO.sub.3.sup.-, ClO.sub.4.sup.-, OH.sup.-,
H.sub.2PO.sub.4.sup.-, HCO.sub.3.sup.-, HSO.sub.4.sup.-, sulfonate
ions (e.g., methansulfonate, trifluoromethanesulfonate,
p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate,
naphthalene-2-sulfonate, naphthalene-1-sulfonic acid-5-sulfonate,
ethan-1-sulfonic acid-2-sulfonate, and the like), carboxylate ions
(e.g., acetate, propanoate, benzoate, glycerate, lactate, tartrate,
glycolate, gluconate, and the like), BF.sub.4.sup.-,
PF.sub.4.sup.-, PF.sub.6.sup.-, AsF.sub.6.sup.-, SbF.sub.6.sup.-,
B[3,5-(CF.sub.3).sub.2C.sub.6H.sub.3].sub.4].sup.-,
B(C.sub.6F.sub.5).sub.4.sup.-, BPh.sub.4.sup.-,
Al(OC(CF.sub.3).sub.3).sub.4.sup.-, and carborane anions (e.g.,
CB.sub.11H.sub.12.sup.- or (HCB.sub.11Me.sub.5Br.sub.6).sup.-).
Exemplary counterions which may be multivalent include
CO.sub.3.sup.2-, HPO.sub.4.sup.2-, PO.sub.4.sup.3-,
B.sub.4O.sub.7.sup.2-, SO.sub.4.sup.2-, S.sub.2O.sub.3.sup.2-,
carboxylate anions (e.g., tartrate, citrate, fumarate, maleate,
malate, malonate, gluconate, succinate, glutarate, adipate,
pimelate, suberate, azelate, sebacate, salicylate, phthalates,
aspartate, glutamate, and the like), and carboranes.
[0069] The term "halo" or "halogen" refers to fluorine (fluoro,
--F), chlorine (chloro, --Cl), bromine (bromo, --Br), or iodine
(iodo, --I).
[0070] The term "hydroxyl" or "hydroxy" refers to the group --OH.
The term "substituted hydroxyl" or "substituted hydroxyl," by
extension, refers to a hydroxyl group wherein the oxygen atom
directly attached to the parent molecule is substituted with a
group other than hydrogen, and includes groups selected from
--OR.sup.aa, --ON(R.sup.bb).sub.2, --OC(.dbd.O)SR.sup.aa,
--OC(.dbd.O)R.sup.aa, --OCO.sub.2R.sup.aa,
--OC(.dbd.O)N(R.sup.bb).sub.2, --OC(.dbd.NR.sup.bb)R.sup.aa,
--OC(.dbd.NR.sup.bb)OR.sup.aa,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --OS(.dbd.O)R.sup.aa,
--OSO.sub.2R, --OSi(R.sup.aa).sub.3, --OP(R.sup.cc).sub.2,
--OP(R.sup.cc).sub.3.sup.+X.sup.-, --OP(OR.sup.cc).sub.2,
--OP(OR.sup.cc).sub.3.sup.+X.sup.-, --OP(.dbd.O)(R.sup.aa).sub.2,
--OP(.dbd.O)(OR.sup.cc).sub.2, and --OP(.dbd.O)(N(R.sup.bb)).sub.2,
wherein X.sup.-, R.sup.aa, R.sup.bb, and R.sup.cc are as defined
herein.
[0071] The term "thiol" or "thio" refers to the group --SH. The
term "substituted thiol" or "substituted thio," by extension,
refers to a thiol group wherein the sulfur atom directly attached
to the parent molecule is substituted with a group other than
hydrogen, and includes groups selected from --SR.sup.aa,
--S.dbd.SR.sup.cc, --SC(.dbd.S)SR.sup.aa, --SC(.dbd.O)SR.sup.aa,
--SC(.dbd.O)OR.sup.aa, and --SC(.dbd.O)R.sup.aa, wherein R.sup.aa
and R.sup.cc are as defined herein.
[0072] The term "amino" refers to the group --NH.sub.2. The term
"substituted amino," by extension, refers to a monosubstituted
amino, a disubstituted amino, or a trisubstituted amino. In certain
embodiments, the "substituted amino" is a monosubstituted amino or
a disubstituted amino group.
[0073] The term "monosubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with one hydrogen and one group other than hydrogen,
and includes groups selected from --NH(R.sup.bb),
--NHC(.dbd.O)R.sup.aa, --NHCO.sub.2R.sup.aa,
--NHC(.dbd.O)N(R.sup.bb).sub.2,
--NHC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --NHSO.sub.2R.sup.aa,
--NHP(.dbd.O)(OR.sup.cc).sub.2, and
--NHP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein R.sup.aa, R.sup.bb
and R.sup.cc are as defined herein, and wherein R.sup.bb of the
group --NH(R.sup.bb) is not hydrogen.
[0074] The term "disubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with two groups other than hydrogen, and includes
groups selected from --N(R.sup.bb).sub.2, --NR.sup.bb
C(.dbd.O)R.sup.aa, --NR.sup.bbCO.sub.2R.sup.aa,
--NR.sup.bbC(.dbd.O)N(R.sup.bb).sub.2,
--NR.sup.bbC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--NR.sup.bbSO.sub.2R.sup.aa, --NR.sup.bbP(.dbd.O)(OR.sup.cc).sub.2,
and --NR.sup.bbP(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein
R.sup.aa, R.sup.bb, and R.sup.cc are as defined herein, with the
proviso that the nitrogen atom directly attached to the parent
molecule is not substituted with hydrogen.
[0075] The term "trisubstituted amino" refers to an amino group
wherein the nitrogen atom directly attached to the parent molecule
is substituted with three groups, and includes groups selected from
--N(R.sup.bb).sub.3 and --N(R.sup.bb).sub.3.sup.+X.sup.-, wherein
R.sup.bb and X.sup.- are as defined herein.
[0076] The term "sulfonyl" refers to a group selected from
--SO.sub.2N(R.sup.bb).sub.2, --SO.sub.2R.sup.aa, and
--SO.sub.2OR.sup.aa, wherein R.sup.a and R.sup.bb are as defined
herein.
[0077] The term "sulfinyl" refers to the group --S(.dbd.O)R.sup.aa,
wherein R.sup.aa is as defined herein.
[0078] The term "carbonyl" refers a group wherein the carbon
directly attached to the parent molecule is sp.sup.2 hybridized,
and is substituted with an oxygen, nitrogen or sulfur atom, e.g., a
group selected from ketones (--C(.dbd.O)R.sup.aa), carboxylic acids
(--CO.sub.2H), aldehydes (--CHO), esters (--CO.sub.2R.sup.aa,
--C(.dbd.O)SR.sup.aa, --C(.dbd.S)SR.sup.aa), amides
(--C(.dbd.O)N(R.sup.bb).sub.2,
--C(.dbd.O)NR.sup.bbSO.sub.2R.sup.aa,
--C(.dbd.S)N(R.sup.bb).sub.2), and imines
(--C(.dbd.NR.sup.bb)R.sup.aa, --C(.dbd.NR.sup.bb)OR.sup.aa),
--C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2), wherein R.sup.aa and
R.sup.bb are as defined herein.
[0079] The term "silyl" refers to the group --Si(R.sup.aa).sub.3,
wherein R.sup.aa is as defined herein.
[0080] The term "oxo" refers to the group .dbd.O, and the term
"thiooxo" refers to the group .dbd.S.
[0081] Nitrogen atoms can be substituted or unsubstituted as
valency permits, and include primary, secondary, tertiary, and
quaternary nitrogen atoms. Exemplary nitrogen atom substituents
include, but are not limited to, hydrogen, --OH, --OR.sup.aa,
--N(R.sup.cc).sub.2, --CN, --C(.dbd.O)R.sup.aa,
--C(.dbd.O)N(R.sup.cc).sub.2, --CO.sub.2R.sup.aa, --SO.sub.2R,
--C(.dbd.NR.sup.bb)R, --C(.dbd.NR.sup.cc)OR.sup.aa,
--C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2, --SO.sub.2N(R.sup.cc).sub.2,
--SO.sub.2R.sup.cc, --SO.sub.2OR.sup.cc, --SOR.sup.aa,
--C(.dbd.S)N(R.sup.cc).sub.2, --C(.dbd.O)SR.sup.cc,
--C(.dbd.S)SR.sup.cc, --P(.dbd.O)(OR.sup.cc).sub.2,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(N(R.sup.cc).sub.2).sub.2,
C.sub.1-10 alkyl, C.sub.1-10 perhaloalkyl, C.sub.2-10 alkenyl,
C.sub.2-10 alkynyl, heteroC.sub.1-10alkyl, heteroC.sub.2-10alkenyl,
heteroC.sub.2-10alkynyl, C.sub.3-10 carbocyclyl, 3-14 membered
heterocyclyl, C.sub.6-14 aryl, and 5-14 membered heteroaryl, or two
R.sup.cc groups attached to an N atom are joined to form a 3-14
membered heterocyclyl or 5-14 membered heteroaryl ring, wherein
each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl,
heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd groups,
and wherein R.sup.aa, R.sup.bb, R.sup.cc and R.sup.dd are as
defined above.
[0082] In certain embodiments, the substituent present on the
nitrogen atom is an nitrogen protecting group (also referred to
herein as an "amino protecting group"). Nitrogen protecting groups
include, but are not limited to, --OH, --OR.sup.aa,
--N(R.sup.cc).sub.2, --C(.dbd.O)R.sup.aa,
--C(.dbd.O)N(R.sup.cc).sub.2, --CO.sub.2R.sup.aa,
--SO.sub.2R.sup.aa, --C(.dbd.NR.sup.cc)R.sup.aa,
--C(.dbd.NR.sup.cc)OR.sup.aa, --C(.dbd.NR.sup.cc)N(R.sup.cc).sub.2,
--SO.sub.2N(R.sup.cc).sub.2, --SO.sub.2R.sup.cc,
--SO.sub.2OR.sup.cc, --SOR.sup.aa, --C(.dbd.S)N(R.sup.cc).sub.2,
--C(.dbd.O)SR.sup.cc, --C(.dbd.S)SR.sup.cc, C.sub.1-10 alkyl (e.g.,
aralkyl, heteroaralkyl), C.sub.2-10 alkenyl, C.sub.2-10 alkynyl,
heteroC.sub.1-10 alkyl, heteroC.sub.2-10 alkenyl, heteroC.sub.2-10
alkynyl, C.sub.3-10 carbocyclyl, 3-14 membered heterocyclyl,
C.sub.6-14 aryl, and 5-14 membered heteroaryl groups, wherein each
alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl,
carbocyclyl, heterocyclyl, aralkyl, aryl, and heteroaryl is
independently substituted with 0, 1, 2, 3, 4, or 5 R.sup.dd groups,
and wherein R.sup.aa, R.sup.bb, R.sup.cc and R.sup.dd are as
defined herein. Nitrogen protecting groups are well known in the
art and include those described in detail in Protecting Groups in
Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3.sup.rd
edition, John Wiley & Sons, 1999, incorporated herein by
reference.
[0083] For example, nitrogen protecting groups such as amide groups
(e.g., --C(.dbd.O)R.sup.aa) include, but are not limited to,
formamide, acetamide, chloroacetamide, trichloroacetamide,
trifluoroacetamide, phenylacetamide, 3-phenylpropanamide,
picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl
derivative, benzamide, p-phenylbenzamide, o-nitophenylacetamide,
o-nitrophenoxyacetamide, acetoacetamide,
(N'-dithiobenzyloxyacylamino)acetamide,
3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide,
2-methyl-2-(o-nitrophenoxy)propanamide,
2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide,
3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine
derivative, o-nitrobenzamide and o-(benzoyloxymethyl)benzamide.
[0084] Nitrogen protecting groups such as carbamate groups (e.g.,
--C(.dbd.O)OR.sup.aa) include, but are not limited to, methyl
carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc),
9-(2-sulfo)fluorenylmethyl carbamate,
9-(2,7-dibromo)fluoroenylmethyl carbamate,
2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl
carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc),
2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl
carbamate (Teoc), 2-phenylethyl carbamate (hZ),
1-(1-adamantyl)-1-methylethyl carbamate (Adpoc),
1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl
carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate
(TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc),
1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'-
and 4'-pyridyl)ethyl carbamate (Pyoc),
2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate
(BOC or Boc), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc),
allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc),
cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc),
8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio
carbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz),
p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl
carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl
carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl
carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl
carbamate, 2-(p-toluenesulfonyl)ethyl carbamate,
[2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl
carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc),
2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl
carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate,
m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl
carbamate, 5-benzisoxazolylmethyl carbamate,
2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc),
m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate,
o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate,
phenyl(o-nitrophenyl)methyl carbamate, t-amyl carbamate, S-benzyl
thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate,
cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl
carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxyacylvinyl
carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate,
1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate,
1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate,
2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl
carbamate, isobutyl carbamate, isonicotinyl carbamate,
p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl
carbamate, 1-methylcyclohexyl carbamate,
1-methyl-1-cyclopropylmethyl carbamate,
1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate,
1-methyl-1-(p-phenylazophenyl)ethyl carbamate,
1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl
carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate,
2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl
carbamate, and 2,4,6-trimethylbenzyl carbamate.
[0085] Nitrogen protecting groups such as sulfonamide groups (e.g.,
--S(.dbd.O).sub.2R.sup.aa) include, but are not limited to,
p-toluenesulfonamide (Ts), benzenesulfonamide,
2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr),
2,4,6-trimethoxybenzenesulfonamide (Mtb),
2,6-dimethyl-4-methoxybenzenesulfonamide (Pme),
2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte),
4-methoxybenzenesulfonamide (Mbs),
2,4,6-trimethylbenzenesulfonamide (Mts),
2,6-dimethoxy-4-methylbenzenesulfonamide (iMds),
2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc),
methanesulfonamide (Ms), .beta.-trimethylsilylethanesulfonamide
(SES), 9-anthracenesulfonamide,
4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS),
benzylsulfonamide, trifluoromethylsulfonamide, and
phenacylsulfonamide.
[0086] Other nitrogen protecting groups include, but are not
limited to, phenothiazinyl-(10)-acyl derivative,
N'-p-toluenesulfonylaminoacyl derivative, N'-phenylaminothioacyl
derivative, N-benzoylphenylalanyl derivative, N-acetylmethionine
derivative, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide,
N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide,
N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilylazacyclopentane
adduct (STABASE), 5-substituted
1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted
1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted
3,5-dinitro-4-pyridone, N-methylamine, N-allylamine,
N-[2-(trimethylsilyl)ethoxy]methylamine (SEM),
N-3-acetoxypropylamine,
N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary
ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine,
N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr),
N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr),
N-9-phenylfluorenylamine (PhF),
N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino
(Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine,
N-benzylideneamine, N-p-methoxybenzylideneamine,
N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine,
N--(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine,
N-p-nitrobenzylideneamine, N-salicylideneamine,
N-5-chlorosalicylideneamine,
N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine,
N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine,
N-borane derivative, N-diphenylborinic acid derivative,
N-[phenyl(pentaacylchromium- or tungsten)acyl]amine, N-copper
chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine
N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide
(Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates,
dibenzyl phosphoramidate, diphenyl phosphoramidate,
benzenesulfenamide, o-nitrobenzenesulfenamide (Nps),
2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide,
2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide,
and 3-nitropyridinesulfenamide (Npys).
[0087] In certain embodiments, the substituent present on an oxygen
atom is an oxygen protecting group (also referred to herein as an
"hydroxyl protecting group"). Oxygen protecting groups include, but
are not limited to, --R.sup.aa, --N(R.sup.bb).sub.2,
--C(.dbd.O)SR.sup.aa, --C(.dbd.O)R.sup.aa, --CO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --C(.dbd.NR.sup.bb)R.sup.aa,
--C(.dbd.NR.sup.bb)OR.sup.aa, --C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--S(.dbd.O)R.sup.aa, --SO.sub.2R.sup.aa, --Si(R.sup.aa).sub.3,
--P(R.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.2, --P(OR.sup.cc).sub.3.sup.+X.sup.-,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2, and
--P(.dbd.O)(N(R.sup.bb) 2).sub.2, wherein X.sup.-, R.sup.aa,
R.sup.bb, and R.sup.cc are as defined herein. Oxygen protecting
groups are well known in the art and include those described in
detail in Protecting Groups in Organic Synthesis, T. W. Greene and
P. G. M. Wuts, 3.sup.rd edition, John Wiley & Sons, 1999,
incorporated herein by reference.
[0088] Exemplary oxygen protecting groups include, but are not
limited to, methyl, methoxylmethyl (MOM), methylthiomethyl (MTM),
t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM),
benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM),
(4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM),
t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl,
2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl,
bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR),
tetrahydropyranyl (THP), 3-bromotetrahydropyranyl,
tetrahydrothiopyranyl, 1-methoxycyclohexyl,
4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl,
4-methoxytetrahydrothiopyranyl S,S-dioxide,
1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP),
1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl,
2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl,
1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl,
1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl,
2,2,2-trichloroethyl, 2-trimethylsilylethyl,
2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl,
p-methoxyphenyl, 2,4-dinitrophenyl, benzyl (Bn), p-methoxybenzyl,
3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl,
2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl,
4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl,
p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl,
a-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl,
di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl,
4-(4'-bromophenacyloxyphenyl)diphenylmethyl,
4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl,
4,4',4''-tris(levulinoyloxyphenyl)methyl,
4,4',4''-tris(benzoyloxyphenyl)methyl,
3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl,
1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl,
9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl,
1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido,
trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl
(TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl
(DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS),
t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl,
triphenylsilyl, diphenylmethylsilyl (DPMS),
t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate,
acetate, chloroacetate, dichloroacetate, trichloroacetate,
trifluoroacetate, methoxyacetate, triphenylmethoxyacetate,
phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate,
4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate
(levulinoyldithioacetal), pivaloate, adamantoate, crotonate,
4-methoxycrotonate, benzoate, p-phenylbenzoate,
2,4,6-trimethylbenzoate (mesitoate), methyl carbonate,
9-fluorenylmethyl carbonate (Fmoc), ethyl carbonate,
2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl
carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec),
2-(triphenylphosphonio) ethyl carbonate (Peoc), isobutyl carbonate,
vinyl carbonate, allyl carbonate, t-butyl carbonate (BOC or Boc),
p-nitrophenyl carbonate, benzyl carbonate, p-methoxybenzyl
carbonate, 3,4-dimethoxybenzyl carbonate, o-nitrobenzyl carbonate,
p-nitrobenzyl carbonate, S-benzyl thiocarbonate,
4-ethoxy-1-napththyl carbonate, methyl dithiocarbonate,
2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate,
o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate,
2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate,
2-(methylthiomethoxymethyl)benzoate,
2,6-dichloro-4-methylphenoxyacetate,
2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate,
2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate,
isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate,
o-(methoxyacyl)benzoate, a-naphthoate, nitrate, alkyl
N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate,
borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate,
sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate
(Ts).
[0089] In certain embodiments, the substituent present on a sulfur
atom is a sulfur protecting group (also referred to as a "thiol
protecting group"). Sulfur protecting groups include, but are not
limited to, --R.sup.aa, --N(R.sup.bb).sub.2, --C(.dbd.O)SR.sup.aa,
--C(.dbd.O)R.sup.aa, --CO.sub.2R.sup.aa,
--C(.dbd.O)N(R.sup.bb).sub.2, --C(NR.sup.bb)R(.dbd.NR.sup.bb),
--C(.dbd.NR.sup.bbOR, --C(.dbd.NR.sup.bb)N(R.sup.bb).sub.2,
--S(.dbd.O)R.sup.aa, --SO.sub.2R.sup.aa, --Si(R.sup.aa).sub.3,
--P(R.sup.cc).sub.2, --P(R.sup.cc).sub.3.sup.+X.sup.-,
--P(OR.sup.cc).sub.2, --P(OR.sup.cc).sub.3.sup.+X.sup.-,
--P(.dbd.O)(R.sup.aa).sub.2, --P(.dbd.O)(OR.sup.cc).sub.2, and
--P(.dbd.O)(N(R.sup.bb).sub.2).sub.2, wherein R.sup.aa, R.sup.bb,
and R.sup.cc are as defined herein. Sulfur protecting groups are
well known in the art and include those described in detail in
Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M.
Wuts, 3.sup.rd edition, John Wiley & Sons, 1999, incorporated
herein by reference.
[0090] A "hydrocarbon chain" refers to a substituted or
unsubstituted divalent alkyl, alkenyl, or alkynyl group. A
hydrocarbon chain includes (1) one or more chains of carbon atoms
immediately between the two radicals of the hydrocarbon chain; (2)
optionally one or more hydrogen atoms on the chain(s) of carbon
atoms; and (3) optionally one or more substituents ("non-chain
substituents," which are not hydrogen) on the chain(s) of carbon
atoms. A chain of carbon atoms consists of consecutively connected
carbon atoms ("chain atoms") and does not include hydrogen atoms or
heteroatoms. However, a non-chain substituent of a hydrocarbon
chain may include any atoms, including hydrogen atoms, carbon
atoms, and heteroatoms. For example, hydrocarbon chain
--C.sup.AH(C.sup.BH.sub.2C.sup.CH.sub.3)-- includes one chain atom
C.sup.A, one hydrogen atom on C.sup.A, and non-chain substituent
--(C.sup.BH.sub.2C.sup.CH.sub.3). The term "C.sub.x hydrocarbon
chain," wherein x is a positive integer, refers to a hydrocarbon
chain that includes x number of chain atom(s) between the two
radicals of the hydrocarbon chain. If there is more than one
possible value of x, the smallest possible value of x is used for
the definition of the hydrocarbon chain. For example,
--CH(C.sub.2H.sub.5)-- is a C.sub.1 hydrocarbon chain, and
##STR00035##
is a C.sub.3 hydrocarbon chain. When a range of values is used, the
meaning of the range is as described herein. For example, a
C.sub.3-10 hydrocarbon chain refers to a hydrocarbon chain where
the number of chain atoms of the shortest chain of carbon atoms
immediately between the two radicals of the hydrocarbon chain is 3,
4, 5, 6, 7, 8, 9, or 10. A hydrocarbon chain may be saturated
(e.g., --(CH.sub.2).sub.4--). A hydrocarbon chain may also be
unsaturated and include one or more C.dbd.C and/or C.ident.C bonds
anywhere in the hydrocarbon chain. For instance,
--CH.dbd.CH--(CH.sub.2).sub.2--, --CH.sub.2--C.ident.C--CH.sub.2--,
and --C.ident.C--CH.dbd.CH-- are all examples of a unsubstituted
and unsaturated hydrocarbon chain. In certain embodiments, the
hydrocarbon chain is unsubstituted (e.g., --C.ident.C-- or
--(CH.sub.2).sub.4--). In certain embodiments, the hydrocarbon
chain is substituted (e.g., --CH(C.sub.2H.sub.5)-- and
--CF.sub.2--). Any two substituents on the hydrocarbon chain may be
joined to form an optionally substituted carbocyclyl, optionally
substituted heterocyclyl, optionally substituted aryl, or
optionally substituted heteroaryl ring. For instance,
##STR00036##
are all examples of a hydrocarbon chain. In contrast, in certain
embodiments,
##STR00037##
are not within the scope of the hydrocarbon chains described
herein. When a chain atom of a C.sub.x hydrocarbon chain is
replaced with a heteroatom, the resulting group is referred to as a
C.sub.x hydrocarbon chain wherein a chain atom is replaced with a
heteroatom, as opposed to a C.sub.x-1 hydrocarbon chain. For
example,
##STR00038##
is a C.sub.3 hydrocarbon chain wherein one chain atom is replaced
with an oxygen atom.
[0091] The term "leaving group" is given its ordinary meaning in
the art of synthetic organic chemistry and refers to an atom or a
group capable of being displaced by a nucleophile. Examples of
suitable leaving groups include, but are not limited to, halogen
(such as F, Cl, Br, or I (iodine)), alkoxycarbonyloxy,
aryloxycarbonyloxy, alkanesulfonyloxy, arenesulfonyloxy,
alkyl-carbonyloxy (e.g., acetoxy), arylcarbonyloxy, aryloxy,
methoxy, N,O-dimethylhydroxylamino, pixyl, and haloformates. In
some cases, the leaving group is a sulfonic acid ester, such as
toluenesulfonate (tosylate, --OTs), methanesulfonate (mesylate,
--OMs), p-bromobenzenesulfonyloxy (brosylate, --OBs), or
trifluoromethanesulfonate (triflate, --OTf). In some cases, the
leaving group is a brosylate, such as p-bromobenzenesulfonyloxy. In
some cases, the leaving group is a nosylate, such as
2-nitrobenzenesulfonyloxy. In some embodiments, the leaving group
is a sulfonate-containing group. In some embodiments, the leaving
group is a tosylate group. The leaving group may also be a
phosphineoxide (e.g., formed during a Mitsunobu reaction) or an
internal leaving group such as an epoxide or cyclic sulfate. Other
non-limiting examples of leaving groups are water, ammonia,
alcohols, ether moieties, thioether moieties, zinc halides,
magnesium moieties, diazonium salts, and copper moieties. In
certain embodiments, the leaving group is an activated substituted
hydroxyl group (e.g., --OC(.dbd.O)SR.sup.aa, --OC(.dbd.O)R.sup.aa,
--OCO.sub.2R.sup.aa, --OC(.dbd.O)N(R.sup.bb).sub.2,
--OC(.dbd.NR.sup.bb)R.sup.aa, --OC(.dbd.NR.sup.bb)OR.sup.aa,
--OC(.dbd.NR.sup.bb)N(R.sup.bb).sub.2, --OS(.dbd.O)R.sup.aa,
--OSO.sub.2R.sup.aa, --OP(R.sup.cc).sub.2, --OP(R.sup.cc).sub.3,
--OP(.dbd.O).sub.2R.sup.aa, --OP(.dbd.O)(R.sup.aa).sub.2,
--OP(.dbd.O)(OR.sup.cc).sub.2, --OP(.dbd.O).sub.2N(R.sup.bb).sub.2,
or --OP(.dbd.O)(NR.sup.bb).sub.2, wherein R.sup.aa, R.sup.bb, and
R.sup.cc are as defined herein).
[0092] The term "pharmaceutically acceptable salt" refers to those
salts which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of humans and lower
animals without undue toxicity, irritation, allergic response and
the like, and are commensurate with a reasonable benefit/risk
ratio. Pharmaceutically acceptable salts are well known in the art.
For example, Berge et al., describe pharmaceutically acceptable
salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19,
incorporated herein by reference. Pharmaceutically acceptable salts
of the compounds of this disclosure include those derived from
suitable inorganic and organic acids and bases. Examples of
pharmaceutically acceptable, nontoxic acid addition salts are salts
of an amino group formed with inorganic acids such as hydrochloric
acid, hydrobromic acid, phosphoric acid, sulfuric acid, and
perchloric acid or with organic acids such as acetic acid, oxalic
acid, maleic acid, tartaric acid, citric acid, succinic acid, or
malonic acid or by using other methods known in the art such as ion
exchange. Other pharmaceutically acceptable salts include adipate,
alginate, ascorbate, aspartate, benzenesulfonate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Salts derived from appropriate bases include alkali metal, alkaline
earth metal, ammonium, and N.sup.+(C.sub.1-4 alkyl).sub.4.sup.-
salts. Representative alkali or alkaline earth metal salts include
sodium, lithium, potassium, calcium, magnesium, and the like.
Further pharmaceutically acceptable salts include, when
appropriate, nontoxic ammonium, quaternary ammonium, and amine
cations formed using counterions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate,
and aryl sulfonate.
[0093] The term "solvate" refers to forms of the compound, or salt
thereof, that are associated with a solvent, usually by a
solvolysis reaction. This physical association may include hydrogen
bonding. Conventional solvents include water, methanol, ethanol,
acetic acid, DMSO, THF, diethyl ether, and the like. The compounds
described herein may be prepared, e.g., in crystalline form, and
may be solvated. Suitable solvates include pharmaceutically
acceptable solvates and further include both stoichiometric
solvates and non-stoichiometric solvates. In certain instances, the
solvate will be capable of isolation, for example, when one or more
solvent molecules are incorporated in the crystal lattice of a
crystalline solid. "Solvate" encompasses both solution-phase and
isolatable solvates. Representative solvates include hydrates,
ethanolates, and methanolates.
[0094] The term "hydrate" refers to a compound that is associated
with water. Typically, the number of the water molecules contained
in a hydrate of a compound is in a definite ratio to the number of
the compound molecules in the hydrate. Therefore, a hydrate of a
compound may be represented, for example, by the general formula
R.x H.sub.2O, wherein R is the compound, and x is a number greater
than 0. A given compound may form more than one type of hydrate,
including, e.g., monohydrates (x is 1), lower hydrates (x is a
number greater than 0 and smaller than 1, e.g., hemihydrates
(R.0.5H.sub.2O)), and polyhydrates (x is a number greater than 1,
e.g., dihydrates (R.2H.sub.2O) and hexahydrates (R.6H.sub.2O)).
[0095] The term "tautomers" or "tautomeric" refers to two or more
interconvertible compounds resulting from at least one formal
migration of a hydrogen atom and at least one change in valency
(e.g., a single bond to a double bond, a triple bond to a single
bond, or vice versa). The exact ratio of the tautomers depends on
several factors, including temperature, solvent, and pH.
Tautomerizations (i.e., the reaction providing a tautomeric pair)
may catalyzed by acid or base. Exemplary tautomerizations include
keto-to-enol, amide-to-imide, lactam-to-lactim, enamine-to-imine,
and enamine-to-(a different enamine) tautomerizations.
[0096] It is also to be understood that compounds that have the
same molecular formula but differ in the nature or sequence of
bonding of their atoms or the arrangement of their atoms in space
are termed "isomers". Isomers that differ in the arrangement of
their atoms in space are termed "stereoisomers".
[0097] Stereoisomers that are not mirror images of one another are
termed "diastereomers" and those that are non-superimposable mirror
images of each other are termed "enantiomers". When a compound has
an asymmetric center, for example, it is bonded to four different
groups, a pair of enantiomers is possible. An enantiomer can be
characterized by the absolute configuration of its asymmetric
center and is described by the R- and S-sequencing rules of Cahn
and Prelog, or by the manner in which the molecule rotates the
plane of polarized light and designated as dextrorotatory or
levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral
compound can exist as either individual enantiomer or as a mixture
thereof. A mixture containing equal proportions of the enantiomers
is called a "racemic mixture".
[0098] The term "polymorphs" refers to a crystalline form of a
compound (or a salt, hydrate, or solvate thereof). All polymorphs
have the same elemental composition. Different crystalline forms
usually have different X-ray diffraction patterns, infrared
spectra, melting points, density, hardness, crystal shape, optical
and electrical properties, stability, and solubility.
Recrystallization solvent, rate of crystallization, storage
temperature, and other factors may cause one crystal form to
dominate. Various polymorphs of a compound can be prepared by
crystallization under different conditions.
[0099] The term "prodrugs" refers to compounds that have cleavable
groups and become by solvolysis or under physiological conditions
the compounds described herein, which are pharmaceutically active
in vivo. Such examples include, but are not limited to, choline
ester derivatives and the like, N-alkylmorpholine esters and the
like. Other derivatives of the compounds described herein have
activity in both their acid and acid derivative forms, but in the
acid sensitive form often offer advantages of solubility, tissue
compatibility, or delayed release in the mammalian organism (see,
Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier,
Amsterdam 1985). Prodrugs include acid derivatives well known to
practitioners of the art, such as, for example, esters prepared by
reaction of the parent acid with a suitable alcohol, or amides
prepared by reaction of the parent acid compound with a substituted
or unsubstituted amine, or acid anhydrides, or mixed anhydrides.
Simple aliphatic or aromatic esters, amides, and anhydrides derived
from acidic groups pendant on the compounds described herein are
particular prodrugs. In some cases it is desirable to prepare
double ester type prodrugs such as (acyloxy)alkyl esters or
((alkoxycarbonyl)oxy)alkylesters. C.sub.1-C.sub.8 alkyl,
C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8 alkynyl, aryl,
C.sub.7-C.sub.12 substituted aryl, and C.sub.7-C.sub.12 arylalkyl
esters of the compounds described herein may be preferred.
[0100] The "molecular weight" of a monovalent moiety --R is
calculated by subtracting 1 from the molecular weight of the
compound R--H. The "molecular weight" of a divalent moiety -L- is
calculated by subtracting 2 from the molecular weight of the
compound H-L-H.
[0101] The terms "composition" and "formulation" are used
interchangeably.
[0102] A "subject" to which administration is contemplated
includes, but is not limited to, humans (i.e., a male or female of
any age group, e.g., a pediatric subject (e.g., infant, child,
adolescent) or adult subject (e.g., young adult, middle-aged adult,
or senior adult)) and/or other non-human animals, for example,
mammals (e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys);
commercially relevant mammals such as cattle, pigs, horses, sheep,
goats, cats, and/or dogs) and birds (e.g., commercially relevant
birds such as chickens, ducks, geese, and/or turkeys). In certain
embodiments, the animal is a mammal. The animal may be a male or
female at any stage of development. The animal may be a transgenic
animal or genetically engineered animal. In certain embodiments,
the subject is a non-human animal. In certain embodiments, the
animal is a fish or reptile. A "patient" refers to a human subject
in need of treatment of a disease described herein.
[0103] The term "administer," "administering," or "administration"
refers to implanting, absorbing, ingesting, injecting, inhaling, or
otherwise introducing a compound described herein, or a composition
thereof, in or on a subject.
[0104] The terms "treatment," "treat," and "treating" refer to
reversing, alleviating, delaying the onset of, or inhibiting the
progress of a disease described herein. In some embodiments,
treatment may be administered after one or more signs or symptoms
of the disease have developed or have been observed. In other
embodiments, treatment may be administered in the absence of signs
or symptoms of the disease. For example, treatment may be
administered to a susceptible subject prior to the onset of
symptoms (e.g., in light of a history of symptoms and/or in light
of exposure to a pathogen). Treatment may also be continued after
symptoms have resolved, for example, to delay and/or prevent
recurrence.
[0105] The term "prevent" refers to a prophylactic treatment of a
subject who is not and was not with a disease but is at risk of
developing the disease or who was with a disease, is not with the
disease, but is at risk of regression of the disease. In certain
embodiments, the subject is at a higher risk of developing the
disease or at a higher risk of regression of the disease than an
average healthy member of a population.
[0106] The terms "condition," "disease," and "disorder" are used
interchangeably.
[0107] An "effective amount" of a compound described herein refers
to an amount sufficient to elicit the desired biological response.
An effective amount of a compound described herein may vary
depending on such factors as the desired biological endpoint, the
pharmacokinetics of the compound, the condition being treated, the
mode of administration, and the age and health of the subject. In
certain embodiments, an effective amount is a therapeutically
effective amount. In certain embodiments, an effective amount is a
prophylactically effective treatment. In certain embodiments, an
effective amount is the amount of a compound or pharmaceutical
composition described herein in a single dose. In certain
embodiments, an effective amount is the combined amounts of a
compound or pharmaceutical composition described herein in multiple
doses.
[0108] A "therapeutically effective amount" of a compound described
herein is an amount sufficient to provide a therapeutic benefit in
the treatment of a condition or to delay or minimize one or more
symptoms associated with the condition. A therapeutically effective
amount of a compound means an amount of therapeutic agent, alone or
in combination with other therapies, which provides a therapeutic
benefit in the treatment of the condition. The term
"therapeutically effective amount" can encompass an amount that
improves overall therapy, reduces or avoids symptoms, signs, or
causes of the condition, and/or enhances the therapeutic efficacy
of another therapeutic agent.
[0109] A "prophylactically effective amount" of a compound
described herein is an amount sufficient to prevent a condition, or
one or more symptoms associated with the condition or prevent its
recurrence. A prophylactically effective amount of a compound means
an amount of a therapeutic agent, alone or in combination with
other agents, which provides a prophylactic benefit in the
prevention of the condition. The term "prophylactically effective
amount" can encompass an amount that improves overall prophylaxis
or enhances the prophylactic efficacy of another prophylactic
agent.
[0110] A "kinase" is a type of enzyme that transfers phosphate
groups from high energy donor molecules, such as ATP, to specific
substrates, referred to as phosphorylation. Kinases are part of the
larger family of phosphotransferases. One of the largest groups of
kinases are protein kinases, which act on and modify the activity
of specific proteins. Kinases are used extensively to transmit
signals and control complex processes in cells. Various other
kinases act on small molecules such as lipids, carbohydrates, amino
acids, and nucleotides, either for signaling or to prime them for
metabolic pathways. Kinases are often named after their substrates.
More than 500 different protein kinases have been identified in
humans. These exemplary human protein kinases include, but are not
limited to, salt-inducible kinase (SIK, e.g., salt-inducible kinase
1 (SIK1), salt-inducible kinase 2 (SIK2), salt-inducible kinase 3
(SIK3)).
[0111] The term "salt-inducible kinase" or "SIK" refers to a
subfamily of serine/threonine protein kinases including SIK1, SIK2,
and SIK3 that belong to an .DELTA.MP-activated protein kinase
family.
[0112] The term "inhibition", "inhibiting", "inhibit," or
"inhibitor" refer to the ability of a compound to reduce, slow,
halt, and/or prevent activity of a particular biological process
(e.g., kinase activity) in a cell relative to vehicle.
[0113] When a compound, pharmaceutical composition, method, or use
is referred to as "selectively" or "specifically" modulating (e.g.,
increasing or inhibiting) the activity of a first protein kinase,
the compound, pharmaceutical composition, method, or use modulates
the activity of the first protein kinase to a greater extent (e.g.,
not less than about 2-fold, not less than about 5-fold, not less
than about 10-fold, not less than about 30-fold, not less than
about 100-fold, not less than about 1,000-fold, or not less than
about 10,000-fold) than the activity of at least a second protein
kinase that is different from the first protein kinase.
BRIEF DESCRIPTION OF THE DRAWINGS
[0114] FIG. 1A. Targeted small-molecule screen identifies SIK
inhibition as a common activity of multi-kinase inhibitors that
up-regulate IL-10 production by inflammatory dendritic cells DCs.
Screening strategy for identification of small-molecule enhancers
of IL-10 production.
[0115] FIG. 1B. IL-10-potentiating activity and reported targets of
hit compounds. Data are mean of two independent experiments.
[0116] FIG. 1C. Correlation of IL-10-potentiating activity of
kinase inhibitors in this screen with their high affinity targets
(K.sub.d<500 nM) identifies common targets of active compounds
potentially accounting for the observed effects on IL-10.
[0117] FIG. 1D. Bone marrow derived-dendritic cells (BMDCs) treated
with DMSO, prostaglandin E2 (PGE.sub.2), (5 .mu.M, gray
bars=mean.+-.SD, n=12 from one independent experiment) or the
indicated concentrations of the SIK inhibitor HG-9-91-01 in
duplicate for 2 days followed by stimulation with zymosan. After 18
hr, secreted IL-10 was detected by ELISA. Data are representative
of >5 independent experiments.
[0118] FIG. 1E. Cell surface abundance of Il10-Thy1.1 reporter gene
in 10BiT BMDCs treated with DMSO or HG-9-91-01(HG) (0.5 .mu.M) for
2 days prior to stimulation with zymosan (Zym) for 18 hr.
[0119] FIG. 1F. Black bars are mean frequency of Il10-Thy1.1.sup.+
cells from 10BiT BMDCs from three individual mice treated and
analyzed as in (E). Zymosan abbreviated (Zym).
[0120] FIG. 2A. Activity of HG-9-91-01 analogs suggests specific
role for SIK2 inhibition in IL-10 up-regulation. Inhibitory
activity of HG-9-91-01 analogs on recombinant SIKs as well as their
effects on IL-10 production and viability of zymosan-stimulated
BMDCs. N.D. (not determined). Data are mean of two independent
experiments.
[0121] FIG. 2B. Comparison of IL-10-potentiating activity versus
SIK inhibitory potencies of HG-9-91-01 analogs retaining the phenyl
piperazine moiety. Curved lines indicate 95% confidence intervals
for linear regression.
[0122] FIG. 3A. SIK inhibition converts activated BMDCs to an
anti-inflammatory phenotype distinct from that induced by
prostaglandin E2 (PGE.sub.2). BMDCs were treated with DMSO,
PGE.sub.2 (5 .mu.M) or HG-9-91-01 (HG) (0.5 .mu.M) for 2 days
followed by stimulation with LPS, R848 or zymosan (Zym) for 4 hr.
Abundance of actin-normalized transcripts in PGE.sub.2- or
HG-9-91-01-treated samples is expressed relative to the mean of the
DMSO-treated samples for each microbial stimulus and clustered
using One-minus Pearson's correlation. N=2, data are representative
of two independent experiments.
[0123] FIG. 3B. BMDCs were treated with DMSO, HG-9-91-01 (0.5
.mu.M), or prostaglandin E2 PGE.sub.2) (5 .mu.M) for 2 days
followed by stimulation with LPS, R848, or zymosan (Zym) for 18 hr.
Effect of HG-9-91-01 (top panel) or PGE.sub.2 (bottom panel) on
cytokine (CBA assays) and nitric oxide (NO) production (Greiss
assay) is expressed relative to DMSO-treated samples for each
microbial stimulus. Error bars=mean.+-.SD, n=3 from 1 independent
experiment. Data are representative of two independent experiments.
*p<0.05, **p<0.01, N.S.=not significant, unpaired Student's t
test (HG-9-91-01 versus PGE.sub.2).
[0124] FIG. 4A. SIK inhibition enhances IL-10 production by gut
myeloid cells. FACS-based isolation of
CD11c.sup.+CX.sub.3CR1.sup.hi myeloid cells and
CD11c.sup.+CX.sub.3CR1.sup.- DCs from the small intestine of
Cx3cr1.sup.eGF/+ mice.
[0125] FIG. 4B. CD11c.sup.+CX.sub.3CR1.sup.hi myeloid cells and
CD11c.sup.+CX.sub.3CR1.sup.- DCs were treated with vehicle or
HG-9-91-01 (0.3 .mu.M) for 30 min prior to stimulation with LPS or
zymosan (Zym). After 18 hr, abundance of the indicated cytokines in
the resulting supernatants was quantified by cytokine bead array.
Error bars=mean.+-.SD, n=3 from one independent experiment. Data
are representative of three independent experiments. *p<0.05,
unpaired Student's t test.
[0126] FIG. 5A. Development of high a throughput screen for small
molecule enhancers of IL-10 production. Murine bone marrow was
differentiated into BMDCs for 7 days in the presence of DMSO or
PGE.sub.2 (5 .mu.M) followed by either mock stimulation (no stim.),
or treatment with LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan
(Zym) (4 .mu.g/mL). After 18 hr, IL-10 secreted into the culture
media was quantified by ELISA. For panels (5A) and (5B), error
bars=mean.+-.SD, n=3 from one independent experiment. Data are
representative of two independent experiments.
[0127] FIG. 5B. BMDCs were differentiated in the presence of DMSO
(white bar) or PGE.sub.2 (5 .mu.M; black bar) for 7 days.
Alternatively, PGE.sub.2 (5 .mu.M) was added during the final 2
days of differentiation (grey bar). In all conditions, mock
stimulation (no stim.), zymosan (Zym) stimulation and IL-10
detection was conducted as in (5A). For panels (5A) and (5B), error
bars=mean.+-.SD, n=3 from one independent experiment. Data are
representative of two independent experiments.
[0128] FIG. 5C. After 5 days of differentiation, BMDCs were
harvested and cultured in 384-well plates in the presence of DMSO
(blue or black circles) or PGE.sub.2 (5 .mu.M; red or grey circles)
followed by stimulation with zymosan (4 .mu.g/mL). After 18 hr,
IL-10 secreted into the culture media was quantified by AlphaLISA.
Error bars represent mean.+-.SD, n=32 for one independent
experiment that is representative of >5 independent
experiments.
[0129] FIG. 5D. After 5 days of differentiation, BMDCs were
harvested and cultured in 384-well plates in the presence of DMSO
(yellow or white circles), PGE.sub.2 (5 .mu.M; red or grey circles)
or test compounds (blue or black circles) for 2 d. Zymosan
stimulation and IL-10 detection was conducted as in (C). Compound
activity is expressed at % of the PGE.sub.2 response on per plate
basis for 2 replicates.
[0130] FIG. 6. Concentration response curves for effects of hits
compounds on IL-10 production and viability. BMDCs were treated
with DMSO, PGE.sub.2 (5 .mu.M) or the indicated concentrations of
hit compounds for 2 days followed by stimulation with zymosan (4
.mu.g/mL). After 18 hr, secreted IL-10 was measured via AlphaLISA
in an aliquot of culture media and is expressed as a percent of the
IL-10 potentiation response induced by PGE.sub.2. Viability was
estimated in terms of change in total cellular ATP levels relative
to DMSO-treated cells from the same experiment. Error
bars=mean.+-.SD, n=3 from one independent experiment. Data are
representative of two independent experiments.
[0131] FIG. 7A. Extended pre-treatment enhances the IL-10
potentiating effects of SIK inhibition. BMDCs were treated with
DMSO (white bars) or HG-9-91-01 (0.5 .mu.M; black bars) for 2 days
followed by either mock stimulation (no stim.) or treatment with
LPS (100 ng/mL), R848 (10 .mu.g/mL) or zymosan (Zym) (4 .mu.g/mL).
After 18 hr, IL-10 secreted into the culture media was detected by
ELISA. Dashed line indicates maximum IL-10 concentration induced 2
days of HG-9-91-01 pre-incubation prior to zymosan stimulation.
Error bars=mean.+-.SD, n=3 from one independent experiment. Data
are representative of two independent experiments.
[0132] FIG. 7B. BMDCs were treated with DMSO (white bars) or
HG-9-91-01 (0.5 .mu.M; black bars) for 1 day followed by either
mock stimulation (no stim.) or treatment with LPS (100 ng/mL), R848
(10 .mu.g/mL) or zymosan (Zym) (4 .mu.g/mL). After 18 hr, IL-10
secreted into the culture media was detected by ELISA. Dashed line
indicates maximum IL-10 concentration induced 2 days of HG-9-91-01
pre-incubation prior to zymosan stimulation. Error bars=mean.+-.SD,
n=3 from 1 independent experiment. Data are representative of 2
independent experiments.
[0133] FIG. 7C. BMDCs were treated with DMSO (white bars) or
HG-9-91-01 (0.5 .mu.M; black bars) for 2 h. followed by either mock
stimulation (No stim.) or treatment with LPS (100 ng/mL), R848 (10
.mu.g/mL) or zymosan (Zym) (4 .mu.g/mL). After 18 hr, IL-10
secreted into the culture media was detected by ELISA. Dashed line
indicates maximum IL-10 concentration induced 2 d of HG-9-91-01
pre-incubation prior to zymosan stimulation. Error bars=mean.+-.SD,
n=3 from 1 independent experiment. Data are representative of 2
independent experiments.
[0134] FIG. 8A. Dasatinib and bosutinib up-regulate IL-10
production by a mechanism involving enhanced CREB/CRTC3 signaling.
Activity of CREB-dependent luciferase reporter construct was
determined in BMDCs treated with DMSO or the indicated
concentrations of dasatinib or bosutinib for 24 hr followed by
stimulation with zymosan for 5 hr. Error bars=mean.+-.SD, n=4 from
1 independent experiment. Data are representative of 2 independent
experiments.
[0135] FIG. 8B. Whole cell lysates from BMDCs treated with the
indicated concentrations of bosutinib for 24 hr were separated by
SDS-PAGE followed by immunoblotting with specific antibodies as
indicated.
[0136] FIG. 8C. CRTC3 levels in whole cell lysates from BMDCs
stably transduced with shRNA constructs targeting CRTC3, RFP of
LacZ were detected by immunoblotting.
[0137] FIG. 8D. BMDCs stably transduced with shRNA constructs
targeting RFP, LacZ or CRTC3 were treated with the indicated
concentrations of dasatinib for 2 days followed by stimulation with
zymosan for 18 hr. IL-10 production in the resulting supernatants
was detected by AlphaLISA and is expressed as % of the PGE.sub.2
response normalized to cellular ATP levels to account for
differences in transduction efficiency of individual lentiviral
shRNA preparations. Error bars=mean.+-.SD, n=3 from one independent
experiment. Data are representative of two independent
experiments.
[0138] FIG. 8E. BMDCs stably transduced with shRNA constructs
targeting RFP, LacZ or CRTC3 were treated with the indicated
concentrations of bosutinib for 2 days followed by stimulation with
zymosan for 18 hr. IL-10 production in the resulting supernatants
was detected by AlphaLISA and is expressed as % of the PGE.sub.2
response normalized to cellular ATP levels to account for
differences in transduction efficiency of individual lentiviral
shRNA preparations. Error bars=mean.+-.SD, n=3 from one independent
experiment. Data are representative of 2 independent
experiments.
[0139] FIG. 9A. Activity of HG-9-91-01 analogs suggests specific
role for SIK2 inhibition in IL-10 up-regulation. (A) General
synthetic scheme for preparation of HG-9-91-01 and related analogs.
NAS, nucleophilic aromatic substitution.
[0140] FIG. 9B. Inhibitory activity of HG-9-91-01 analogs on
recombinant SIKs as well as their effects on IL-10 production and
viability of zymosan-stimulated BMDCs. N.D., not determined. Data
are mean of two independent experiments.
[0141] FIG. 10A. PGE.sub.2 and SIK inhibition induce differential
transcriptional responses. BMDCs were treated with DMSO, PGE.sub.2
(5 .mu.M) or HG-9-91-01 (0.5 .mu.M) for 2 days followed by
stimulation with LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan
(Zym) (4 .mu.g/mL) for 4 hours. After cells lysis and total RNA
extraction, expression of indicated transcripts was determined by
multiplex RT-PCR array. Abundance of actin-normalized 1110 (Fold
unstim.=Fold unstimulated).
[0142] FIG. 10B. BMDCs were treated with DMSO, PGE.sub.2 (5 .mu.M)
or HG-9-91-01 (0.5 .mu.M) for 2 days followed by stimulation with
LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan (Zym) (4 .mu.g/mL)
for 4 hours. After cells lysis and total RNA extraction, expression
of indicated transcripts was determined by multiplex RT-PCR array.
Abundance of actin-normalized Il12b (Fold unstim.=Fold
unstimulated).
[0143] FIG. 10C. BMDCs were treated with DMSO, PGE.sub.2 (5 .mu.M)
or HG-9-91-01 (0.5 .mu.M) for 2 days followed by stimulation with
LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan (Zym) (4 .mu.g/mL)
for 4 hours. After cells lysis and total RNA extraction, expression
of indicated transcripts was determined by multiplex RT-PCR array.
Abundance of actin-normalized Il1b (Fold unstim.=Fold
unstimulated).
[0144] FIG. 10D. BMDCs were treated with DMSO, PGE.sub.2 (5 .mu.M)
or HG-9-91-01 (0.5 .mu.M) for 2 days followed by stimulation with
LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan (Zym) (4 .mu.g/mL)
for 4 hours. After cells lysis and total RNA extraction, expression
of indicated transcripts was determined by multiplex RT-PCR array.
Abundance of actin-normalized Il23a (Fold unstim.=Fold
unstimulated).
[0145] FIG. 10E. BMDCs were treated with DMSO, PGE.sub.2 (5 .mu.M),
or HG-9-91-01 (0.5 .mu.M) for 2 days followed by stimulation with
LPS (100 ng/mL), R848 (10 .mu.g/mL), or zymosan (Zym) (4 .mu.g/mL)
for 4 hours. After cells lysis and total RNA extraction, expression
of indicated transcripts was determined by multiplex RT-PCR array.
Abundance of actin-normalized 1133 (Fold unstim.=Fold
unstimulated).
[0146] FIG. 10F. BMDCs were treated with DMSO, PGE.sub.2 (5 .mu.M),
or HG-9-91-01 (0.5 .mu.M) for 2 days followed by stimulation with
LPS (100 ng/mL), R848 (10 .mu.g/mL) or zymosan (Zym) (4 .mu.g/mL)
for 4 hours. After cells lysis and total RNA extraction, expression
of indicated transcripts was determined by multiplex RT-PCR array.
Abundance of actin-normalized Arg1 (Fold unstim.=Fold
unstimulated).
[0147] FIG. 10G. Nos2 mRNA in PGE.sub.2- or HG-9-91-01-treated
samples are expressed as fold-change versus untreated, unstimulated
(Fold unstim.) control samples. White bars, DMSO; Black bars,
HG-9-91-01; Grey bars, PGE.sub.2. Error bars=mean.+-.SD, n=4 pooled
from two independent experiments. *, p<0.05, ** p<0.01,
unpaired Student's t.
[0148] FIG. 11A. SIK inhibition up-regulates IL-10 and suppresses
inflammatory cytokine production by human myeloid cells.
Macrophages differentiated from PBMCs were treated with DMSO (white
bars) or HG-9-91-01 (0.5 .mu.M; black bars) for 24 hr followed by
stimulation with the indicated concentrations of zymosan (Zym) for
18 hr. Secreted IL-10 or IL-12p70 was quantified in the resulting
culture medium using ELISAs. Error bars=mean.+-.SD, n=3 from one
independent experiment. Data are representative of three
independent experiments.
[0149] FIG. 11B. Dendritic cells differentiated from PBMCs were
treated with DMSO (white bars) or HG-9-91-01 (0.5 .mu.M; black
bars) for 24 hr followed by stimulation with the indicated
concentrations of zymosan (Zym) for 18 hr. Secreted IL-10 or
IL-12p70 was quantified in the resulting culture medium using
ELISAs. Error bars=mean.+-.SD, n=3 from one independent experiment.
Data are representative of three independent experiments.
[0150] FIG. 12A. SIK inhibition does not promote IL-10 production
by regulatory T (T.sub.reg) cells. Numbers of viable, CD4.sup.+ T
cells were quantified in cultures of naive splenic CD4.sup.+ T
cells differentiated towards the T.sub.reg lineage for 4 days in
the presence of the concentrations of HG-9-91-01 as indicated.
[0151] FIG. 12B. After 4 days of culture in the presence of DMSO or
HG-9-91-01, levels of FoxP3 protein were determined by
intracellular staining and flow cytometric analysis. Data are
representative of two independent experiments.
[0152] FIG. 12C. After 4 days of culture in the presence of DMSO
(white bar) or HG-9-91-01 (HG) (100 nM; black bar), abundance of
IL-10 in the culture medium was quantified by ELISA. Error
bars=mean.+-.SD, n=3 from one independent experiment. Data are
representative of two independent experiments.
[0153] FIG. 13A. SIK inhibition does not promote IL-10 production
by Type 1 regulatory (Tr1) cells. Numbers of viable, CD4.sup.+ T
cells were quantified in cultures of naive splenic CD4.sup.+ T
cells differentiated under Th0 (open circles) or Tr1 (closed
circles) conditions for 4 days in the presence of the indicated
concentrations of HG-9-91-01.
[0154] FIG. 13B. Naive splenic CD4.sup.+ T cells were
differentiated under Th0 (white bars) or Tr1 (black bars)
conditions in the presence of DMSO of HG-9-91-01 (100 nM) and
levels of IL-10 in the resulting supernatants was quantified by
ELISA. Error bars=mean.+-.SD, n=3 from one independent experiment.
Data are representative of two independent experiments.
[0155] FIG. 14. Model for the differential cellular responses to
EP2/EP4 receptor stimulation versus SIK inhibition. Stimulation of
EP2/EP4 prostanoid receptors with PGE.sub.2 increases intracellular
cAMP, which promotes IL-10 transcription via CRTC3/CREB complexes
downstream of PKA activation. In addition to activating the
PKA/CRTC3/CREB axis, cAMP binding to EPAC scaffolding proteins
activates Rap1 leading to pleiotropic cellular effects. In
contract, inhibition of SIKs up-regulates IL-10 expression by
reducing inhibitory phosphorylation of CRTC3 in the absence of a
cAMP flux.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION
[0156] Described herein are macrocyclic compounds of Formula (I),
imidazolyl compounds of Formula (II), urea or carbamate compounds
of Formula (III-A), and pharmaceutically acceptable salts,
solvates, hydrates, polymorphs, co-crystals, tautomers,
stereoisomers, isotopically labeled derivatives, and prodrugs
thereof. The described compounds are able to inhibit the activity
(e.g., increased activity) of a salt-inducible kinase (SIK, e.g.,
SIK1, SIK2, SIK3). The described compounds are also able to enhance
interleukin 10 (IL-10) production by macrophages and dendritic
cells of the gut, to decrease the level of a pro-inflammatory
cytokine in a subject or cell, and/or to convert bone
marrow-derived dendritic cells (BMDCs) to an anti-inflammatory
phenotype. Also provided in the present disclosure are methods of
treating and/or preventing inflammatory bowel disease (IBD) and/or
graft-versus-host disease (GVHD) in a subject in need thereof using
the described compounds.
Compounds for Use in the Invention
Compounds of Formula (I)
[0157] In one aspect, the present disclosure provides macrocyclic
compounds of Formula (I) for use in the present invention:
##STR00039##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof, wherein:
[0158] Ring A is a substituted or unsubstituted phenyl ring or a
substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl ring, wherein one, two, three, or four atoms in the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur;
[0159] each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0160] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or two
R.sup.a groups are joined to form a substituted or unsubstituted
heterocyclic or substituted or unsubstituted heteroaryl ring;
[0161] k is 0, 1, 2, 3, or 4;
[0162] L is a substituted or unsubstituted, saturated or
unsaturated C.sub.3-10 hydrocarbon chain, optionally wherein one or
more chain atoms of the hydrocarbon chain are independently
replaced with --O--, --S--, --NR.sup.N--, --N.dbd., or .dbd.N--,
wherein each instance of R.sup.N is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0163] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0164] each of X.sup.A, X.sup.B, and X.sup.C is independently N or
CR.sup.X, wherein R.sup.X is hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0165] Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0166] or when Y is --NR.sup.Y-- and X.sup.A is CR.sup.X, R.sup.Y
and R.sup.X of X.sup.A are joined to form a substituted or
unsubstituted, monocyclic, 5- to 7-membered heterocyclic ring that
is fused with Ring B;
[0167] each instance of R.sup.C is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0168] m is 0, 1, 2, 3, 4, or 5; and
[0169] R.sup.D is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0170] In certain embodiments, a macrocyclic compound of Formula
(I) for use in the present invention is of the formula:
##STR00040##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0171] Ring A is a substituted or unsubstituted phenyl ring or a
substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl ring, wherein one, two, three, or four atoms in the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur;
[0172] each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0173] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or two
R.sup.a groups are joined to form a substituted or unsubstituted
heterocyclic or substituted or unsubstituted heteroaryl ring;
[0174] k is 0, 1, 2, 3, or 4;
[0175] L is a substituted or unsubstituted, saturated or
unsaturated C.sub.3-10 hydrocarbon chain, optionally wherein one or
more chain atoms of the hydrocarbon chain are independently
replaced with --O--, --S--, --NR.sup.N-, --N.dbd., or .dbd.N--,
wherein each instance of R.sup.N is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0176] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0177] each of X.sup.A, X.sup.B, and X.sup.C is independently N or
CR.sup.X, wherein R.sup.X is hydrogen, halogen, substituted or
unsubstituted alkyl, substituted or unsubstituted alkenyl,
substituted or unsubstituted alkynyl, substituted or unsubstituted
carbocyclyl, substituted or unsubstituted heterocyclyl, substituted
or unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0178] Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0179] each instance of R.sup.C is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0180] m is 0, 1, 2, 3, 4, or 5; and
[0181] R.sup.D is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0182] All embodiments of Ring A, Ring B, Ring C, L, X.sup.A,
X.sup.B, X.sup.C, Y, R.sup.A, R.sup.a, R.sup.B, R.sup.C, R.sup.D,
R.sup.E, R.sup.N, R.sup.X, R.sup.Y, k, and m recited in subsection
Compounds of Formula (I) apply only to Formula (I).
[0183] Formula (I) includes Ring A that is unsubstituted (e.g.,
when k is 0) or substituted with one or more substituents R.sup.A
(e.g., when k is 1, 2, 3, or 4). In certain embodiments, Ring A is
an unsubstituted phenyl ring. In certain embodiments, Ring A is a
substituted phenyl ring. In certain embodiments, Ring A is a
substituted or unsubstituted, monocyclic, 5-membered heteroaryl
ring (e.g., furanyl, thienyl, pyrrolyl, imidazolyl, pyrazolyl,
oxazolyl, isoxazolyl, thiazolyl, or isothiazolyl ring), wherein
one, two, three, or four atoms in the heteroaryl ring system are
independently nitrogen, oxygen, or sulfur. In certain embodiments,
Ring A is a substituted or unsubstituted, monocyclic, 6-membered
heteroaryl ring (e.g., a pyridyl, pyrazinyl, pyrimidinyl, or
pyridazinyl ring), wherein one, two, three, or four atoms in the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur. In certain embodiments, Ring A is of the formula:
##STR00041##
wherein the radical marked with "*" is directly attached to
N(R.sup.B), and the radical marked with "**" is directly attached
to L.
[0184] In Formula (I), Ring A may include one or more substituents
R.sup.A. In certain embodiments, at least two instances of R.sup.A
are different. In certain embodiments, all instances of R.sup.A are
the same. In certain embodiments, at least one instance of R.sup.A
is halogen. In certain embodiments, at least one instance of
R.sup.A is F. In certain embodiments, at least one instance of
R.sup.A is Cl. In certain embodiments, at least one instance of
R.sup.A is Br. In certain embodiments, at least one instance of
R.sup.A is I (iodine). In certain embodiments, at least one
instance of R.sup.A is substituted alkyl. In certain embodiments,
at least one instance of R.sup.A is unsubstituted alkyl. In certain
embodiments, at least one instance of R.sup.A is unsubstituted
C.sub.1-6 alkyl. In certain embodiments, all instances of R.sup.A
are unsubstituted C.sub.1-6 alkyl. In certain embodiments, at least
one instance of R.sup.A is substituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.A is C.sub.1-6 alkyl
substituted with at least one halogen. In certain embodiments, at
least one instance of R.sup.A is --CH.sub.3. In certain
embodiments, all instances of R.sup.A are --CH.sub.3. In certain
embodiments, at least one instance of R.sup.A is substituted
methyl. In certain embodiments, at least one instance of R.sup.A is
--CH.sub.2F. In certain embodiments, at least one instance of
R.sup.A is --CHF.sub.2. In certain embodiments, at least one
instance of R.sup.A is --CF.sub.3. In certain embodiments, at least
one instance of R.sup.A is ethyl. In certain embodiments, at least
one instance of R.sup.A is propyl. In certain embodiments, at least
one instance of R.sup.A is butyl. In certain embodiments, at least
one instance of R.sup.A is pentyl. In certain embodiments, at least
one instance of R.sup.A is hexyl. In certain embodiments, at least
one instance of R.sup.A is Bn. In certain embodiments, at least one
instance of R.sup.A is substituted alkenyl. In certain embodiments,
at least one instance of R.sup.A is unsubstituted alkenyl. In
certain embodiments, at least one instance of R.sup.A is
substituted alkynyl. In certain embodiments, at least one instance
of R.sup.A is unsubstituted alkynyl. In certain embodiments, at
least one instance of R.sup.A is substituted carbocyclyl. In
certain embodiments, at least one instance of R.sup.A is
unsubstituted carbocyclyl. In certain embodiments, at least one
instance of R.sup.A is saturated carbocyclyl. In certain
embodiments, at least one instance of R.sup.A is unsaturated
carbocyclyl. In certain embodiments, at least one instance of
R.sup.A is monocyclic carbocyclyl. In certain embodiments, at least
one instance of R.sup.A is 3- to 7-membered, monocyclic
carbocyclyl. In certain embodiments, at least one instance of
R.sup.A is substituted heterocyclyl. In certain embodiments, at
least one instance of R.sup.A is unsubstituted heterocyclyl. In
certain embodiments, at least one instance of R.sup.A is saturated
heterocyclyl. In certain embodiments, at least one instance of
R.sup.A is unsaturated heterocyclyl. In certain embodiments, at
least one instance of R.sup.A is heterocyclyl, wherein one, two, or
three atoms in the heterocyclic ring system are independently
selected from the group consisting of nitrogen, oxygen, and sulfur.
In certain embodiments, at least one instance of R.sup.A is
monocyclic heterocyclyl. In certain embodiments, at least one
instance of R.sup.A is 3- to 7-membered, monocyclic heterocyclyl.
In certain embodiments, at least one instance of R.sup.A is
substituted or unsubstituted, monocyclic, 3- to 7-membered
heterocyclyl, wherein one, two, or three atoms in the heterocyclic
ring system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, at least one
instance of R.sup.A is substituted or unsubstituted oxetanyl,
substituted or unsubstituted tetrahydrofuranyl, substituted or
unsubstituted pyrrolidinyl, substituted or unsubstituted
tetrahydropyranyl, substituted or unsubstituted piperidinyl,
substituted or unsubstituted morpholinyl, or substituted or
unsubstituted piperazinyl. In certain embodiments, at least one
instance of R is of the formula:
##STR00042##
such as
##STR00043##
(e.g.,
##STR00044##
In certain embodiments, at least one instance of R.sup.A is
substituted aryl. In certain embodiments, at least one instance of
R.sup.A is unsubstituted aryl. In certain embodiments, at least one
instance of R.sup.A is 6- to 10-membered aryl. In certain
embodiments, at least one instance of R.sup.A is substituted
phenyl. In certain embodiments, at least one instance of R.sup.A is
unsubstituted phenyl. In certain embodiments, at least one instance
of R.sup.A is substituted heteroaryl. In certain embodiments, at
least one instance of R.sup.A is unsubstituted heteroaryl. In
certain embodiments, at least one instance of R.sup.A is
heteroaryl, wherein one, two, three, or four atoms in the
heteroaryl ring system are independently selected from the group
consisting of nitrogen, oxygen, and sulfur. In certain embodiments,
at least one instance of R.sup.A is monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.A is
5-membered, monocyclic heteroaryl. In certain embodiments, at least
one instance of R.sup.A is 6-membered, monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.A is bicyclic
heteroaryl, wherein the point of attachment may be on any atom of
the bicyclic heteroaryl ring system, as valency permits. In certain
embodiments, at least one instance of R.sup.A is 9- or 10-membered,
bicyclic heteroaryl. In certain embodiments, at least one instance
of R.sup.A is --OR.sup.a. In certain embodiments, at least one
instance of R.sup.A is --OH. In certain embodiments, at least one
instance of R.sup.A is --O(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, at least one instance of R.sup.A is
--OMe. In certain embodiments, at least one instance of R.sup.A is
--OEt. In certain embodiments, at least one instance of R.sup.A is
--OPr. In certain embodiments, at least one instance of R.sup.A is
--OBu. In certain embodiments, at least one instance of R.sup.A is
--OBn. In certain embodiments, at least one instance of R.sup.A is
--OPh. In certain embodiments, at least one instance of R.sup.A is
of the formula:
##STR00045##
[0185] In certain embodiments, at least one instance of R.sup.A is
of the formula:
##STR00046##
In certain embodiments, k is 1; and R.sup.A is of the formula:
##STR00047##
In certain embodiments, at least one instance of R.sup.A is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.A is --SH. In certain embodiments, at least one instance of
R.sup.A is --SMe. In certain embodiments, at least one instance of
R.sup.A is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.A is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.A is --NHMe. In certain embodiments, at least
one instance of R.sup.A is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.A is --CN. In certain embodiments, at
least one instance of R.sup.A is --SCN. In certain embodiments, at
least one instance of R.sup.A is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.A is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.A is --C(.dbd.O)N(R.sup.a).sub.2. In
certain embodiments, at least one instance of R.sup.A is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.A is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.A is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.A is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0186] Each instance of R.sup.A, R.sup.C, R.sup.D, and R.sup.X may
independently include one or more substituents R.sup.a. In certain
embodiments, all instances of R.sup.a are the same. In certain
embodiments, at least two instances of R.sup.a are different. In
certain embodiments, at least one instance of R.sup.a is H. In
certain embodiments, each instance of R.sup.a is H. In certain
embodiments, at least one instance of R.sup.a is substituted acyl.
In certain embodiments, at least one instance of R.sup.a is
unsubstituted acyl. In certain embodiments, at least one instance
of R.sup.a is acetyl. In certain embodiments, at least one instance
of R.sup.a is substituted alkyl. In certain embodiments, at least
one instance of R.sup.a is unsubstituted alkyl. In certain
embodiments, at least one instance of R.sup.a is unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.a is methyl. In certain embodiments, at least one instance of
R.sup.a is ethyl. In certain embodiments, at least one instance of
R.sup.a is propyl. In certain embodiments, at least one instance of
R.sup.a is butyl. In certain embodiments, at least one instance of
R.sup.a is pentyl. In certain embodiments, at least one instance of
R.sup.a is hexyl. In certain embodiments, at least one instance of
R.sup.a is Bn. In certain embodiments, at least one instance of
R.sup.a is substituted alkenyl. In certain embodiments, at least
one instance of R.sup.a is unsubstituted alkenyl. In certain
embodiments, at least one instance of R.sup.a is substituted
alkynyl. In certain embodiments, at least one instance of R.sup.a
is unsubstituted alkynyl. In certain embodiments, at least one
instance of R.sup.a is substituted or unsubstituted carbocyclyl. In
certain embodiments, at least one instance of R.sup.a is saturated
carbocyclyl. In certain embodiments, at least one instance of
R.sup.a is unsaturated carbocyclyl. In certain embodiments, at
least one instance of R.sup.a is 3- to 7-membered, monocyclic
carbocyclyl. In certain embodiments, at least one instance of
R.sup.a is substituted or unsubstituted heterocyclyl. In certain
embodiments, at least one instance of R.sup.a is saturated
heterocyclyl. In certain embodiments, at least one instance of
R.sup.a is unsaturated heterocyclyl. In certain embodiments, at
least one instance of R.sup.a is heterocyclyl, wherein one, two, or
three atoms of the heterocyclic ring system are independently
selected from the group consisting of nitrogen, oxygen, and sulfur.
In certain embodiments, at least one instance of R.sup.a is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.a is substituted or unsubstituted aryl.
In certain embodiments, at least one instance of R.sup.a is 6- to
10-membered aryl. In certain embodiments, at least one instance of
R.sup.a is monocyclic aryl. In certain embodiments, at least one
instance of R.sup.a is substituted phenyl. In certain embodiments,
at least one instance of R.sup.a is unsubstituted phenyl. In
certain embodiments, at least one instance of R.sup.a is bicyclic
aryl. In certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted heteroaryl. In certain embodiments, at
least one instance of R.sup.a is heteroaryl, wherein one, two,
three, or four atoms of the heteroaryl ring system are
independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, at least one instance
of R.sup.a is monocyclic heteroaryl. In certain embodiments, at
least one instance of R.sup.a is 5- or 6-membered, monocyclic
heteroaryl. In certain embodiments, at least one instance of
R.sup.a is bicyclic heteroaryl, wherein the point of attachment may
be on any atom of the bicyclic heteroaryl ring system, as valency
permits. In certain embodiments, at least one instance of R.sup.a
is a nitrogen protecting group when attached to a nitrogen atom. In
certain embodiments, at least one instance of R.sup.a is Bn, Boc,
Cbz, Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts when
attached to a nitrogen atom. In certain embodiments, R.sup.a is an
oxygen protecting group when attached to an oxygen atom. In certain
embodiments, R.sup.a is silyl, TBDPS, TBDMS, TIPS, TES, TMS, MOM,
THP, t-Bu, Bn, allyl, acetyl, pivaloyl, or benzoyl when attached to
an oxygen atom. In certain embodiments, R.sup.a is a sulfur
protecting group when attached to a sulfur atom. In certain
embodiments, R.sup.a is acetamidomethyl, t-Bu, 3-nitro-2-pyridine
sulfenyl, 2-pyridine-sulfenyl, or triphenylmethyl when attached to
a sulfur atom. In certain embodiments, two instances of R.sup.a are
joined to form a substituted or unsubstituted heterocyclic ring. In
certain embodiments, two instances of R.sup.a are joined to form a
saturated or unsaturated heterocyclic ring. In certain embodiments,
two instances of R.sup.a are joined to form a heterocyclic ring,
wherein one, two, or three atoms of the heterocyclic ring system
are independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, two instances of
R.sup.a are joined to form a 3- to 7-membered, monocyclic
heterocyclic ring. In certain embodiments, two instances of R.sup.a
are joined to form a substituted or unsubstituted heteroaryl ring.
In certain embodiments, two instances of R.sup.a are joined to form
a substituted or unsubstituted, 5- to 6-membered, monocyclic
heteroaryl ring, wherein one, two, three, or four atoms of the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur.
[0187] In certain embodiments, k is 0. In certain embodiments, k is
1. In certain embodiments, k is 2. In certain embodiments, k is 3.
In certain embodiments, k is 4.
[0188] In certain embodiments, k is 1; and R.sup.A is --OR.sup.a.
In certain embodiments, k is 1; and R.sup.A is --O(substituted or
unsubstituted C.sub.1-6 alkyl).
[0189] Formula (I) includes divalent linker L. L consists of a
chain, and optionally one or more hydrogen atoms and/or one or more
substituents (e.g., .dbd.O) on the chain, where any two
substituents may optionally be joined to form a ring. In certain
embodiments, the molecular weight of L is not more than about 300
g/mol, not more than about 200 g/mol, not more than about 150
g/mol, not more than about 100 g/mol, or not more than 80 g/mol. In
certain embodiments, the molecular weight of L is between 50 and
150 g/mol, inclusive. In certain embodiments, L consists of not
more than about 70 atoms, not more than about 50 atoms, not more
than about 30 atoms, not more than about 20 atoms, or not more than
15 atoms. In certain embodiments, L consists of between 10 and 30
atoms, inclusive. In certain embodiments, L does not include
unsaturated bonds in the chain. In certain embodiments, L consists
of one unsaturated bond in the chain. In certain embodiments, L
consists of 2, 3, or 4 unsaturated bonds in the chain. In certain
embodiments, L is a substituted or unsubstituted, saturated or
unsaturated C.sub.3-10 hydrocarbon chain (e.g., a C.sub.5-6
hydrocarbon chain). In certain embodiments, L is a substituted or
unsubstituted, saturated or unsaturated C.sub.3-10 hydrocarbon
chain (e.g., a C.sub.5-6 hydrocarbon chain), wherein one chain atom
of the hydrocarbon chain is replaced with --O--, --S--,
--NR.sup.N--, --N.dbd., or .dbd.N--. In certain embodiments, L is a
substituted or unsubstituted, saturated or unsaturated, C.sub.3-10
hydrocarbon chain (e.g., a C.sub.5-6 hydrocarbon chain), wherein 2,
3, 4, or 5 chain atoms of the hydrocarbon chain are independently
replaced with --O--, --S--, --NR.sup.N--, --N.dbd., or .dbd.N--. In
certain embodiments, L is a substituted or unsubstituted, saturated
or unsaturated C.sub.5-6 hydrocarbon chain, wherein one or two
chain atoms of the hydrocarbon chain are independently replaced
with --O--, --S--, or --NR.sup.N--. In certain embodiments, L is of
the formula:
##STR00048##
In certain embodiments, L is of the formula:
##STR00049##
In certain embodiments, L is of the formula:
##STR00050##
In certain embodiments, L is of the formula:
##STR00051##
In certain embodiments, L is of the formula:
##STR00052##
In certain embodiments, L is of the formula:
##STR00053##
In certain embodiments, L is of the formula:
##STR00054##
In certain embodiments, L is of the formula:
##STR00055##
In certain embodiments, L is of the formula:
##STR00056##
[0190] In certain embodiments, at least two instances of R.sup.N
are different. In certain embodiments, all instances of R.sup.N are
the same. In certain embodiments, at least one instance of R.sup.N
is H. In certain embodiments, each instance of R.sup.N is H. In
certain embodiments, at least one instance of R.sup.N is
substituted acyl. In certain embodiments, at least one instance of
R.sup.N is unsubstituted acyl. In certain embodiments, at least one
instance of R.sup.N is acetyl. In certain embodiments, at least one
instance of R.sup.N is unsubstituted C.sub.1-6 alkyl. In certain
embodiments, each instance of R.sup.N is independently
unsubstituted C.sub.1-6 alkyl. In certain embodiments, at least one
instance of R.sup.N is substituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.N is C.sub.1-6 alkyl
substituted with at least one halogen. In certain embodiments, at
least one instance of R.sup.N is unsubstituted methyl. In certain
embodiments, at least one instance of R.sup.N is substituted
methyl. In certain embodiments, at least one instance of R.sup.N is
--CH.sub.2F. In certain embodiments, at least one instance of
R.sup.N is --CHF.sub.2. In certain embodiments, at least one
instance of R.sup.N is --CF.sub.3. In certain embodiments, at least
one instance of R.sup.N is ethyl. In certain embodiments, at least
one instance of R.sup.N is propyl. In certain embodiments, at least
one instance of R.sup.N is butyl. In certain embodiments, at least
one instance of R.sup.N is pentyl. In certain embodiments, at least
one instance of R.sup.N is hexyl. In certain embodiments, at least
one instance of R.sup.N is Bn. In certain embodiments, at least one
instance of R.sup.N is a nitrogen protecting group. In certain
embodiments, at least one instance of R.sup.N is Bn, Boc, Cbz,
Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts.
[0191] Formula (I) includes substituent R.sup.B on a nitrogen atom.
In certain embodiments, R.sup.B is H. In certain embodiments,
R.sup.B is substituted acyl. In certain embodiments, R.sup.B is
unsubstituted acyl. In certain embodiments, R.sup.B is acetyl. In
certain embodiments, R.sup.B is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.B is substituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.B is C.sub.1-6 alkyl substituted with at
least one halogen. In certain embodiments, R.sup.B is unsubstituted
methyl. In certain embodiments, R.sup.B is substituted methyl. In
certain embodiments, R.sup.B is --CH.sub.2F. In certain
embodiments, R.sup.B is --CHF.sub.2. In certain embodiments,
R.sup.B is --CF.sub.3. In certain embodiments, R.sup.B is ethyl. In
certain embodiments, R.sup.B is propyl. In certain embodiments,
R.sup.B is butyl. In certain embodiments, R.sup.B is pentyl. In
certain embodiments, R.sup.B is hexyl. In certain embodiments,
R.sup.B is Bn. In certain embodiments, R.sup.B is a nitrogen
protecting group. In certain embodiments, R.sup.B is Bn, Boc, Cbz,
Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts.
[0192] Formula (I) includes Ring B that includes moieties X.sup.A,
X.sup.B, and X.sup.C in the ring system. In certain embodiments,
X.sup.A is CR.sup.X, and each of X.sup.B and X.sup.C is N. In
certain embodiments, X.sup.A is CH, and each of X.sup.B and X.sup.C
is N. In certain embodiments, X.sup.B is CR.sup.x, and each of
X.sup.A and X.sup.C is N. In certain embodiments, X.sup.B is CH,
and each of X.sup.A and X.sup.C is N. In certain embodiments,
X.sup.C is CR.sup.X, and each of X.sup.A and X.sup.B is N. In
certain embodiments, X.sup.C is CH, and each of X.sup.A and X.sup.B
is N. In certain embodiments, X.sup.A is N, and each of X.sup.B and
X.sup.C is independently CR.sup.X. In certain embodiments, X.sup.A
is N, and each of X.sup.B and X.sup.C is CH. In certain
embodiments, X.sup.B is N, and each of X.sup.A and X.sup.C is
independently CR.sup.X. In certain embodiments, X.sup.B is N, and
each of X.sup.A and X.sup.C is CH. In certain embodiments, X.sup.C
is N, and each of X.sup.A and X.sup.B is independently CR.sup.X. In
certain embodiments, X.sup.C is N, and each of X.sup.A and X.sup.B
is CH. In certain embodiments, each of X.sup.A, X.sup.B, and
X.sup.C is independently CR.sup.X. In certain embodiments, each of
X.sup.A, X.sup.B, and X.sup.C is CH.
[0193] In certain embodiments, when X.sup.A, X.sup.B, or X.sup.C is
CR.sup.X, R.sup.X is H. In certain embodiments, R.sup.X is halogen.
In certain embodiments, R.sup.X is F. In certain embodiments,
R.sup.X is Cl. In certain embodiments, R.sup.X is Br. In certain
embodiments, R.sup.X is I (iodine). In certain embodiments, R.sup.X
is substituted alkyl. In certain embodiments, R.sup.X is
unsubstituted alkyl. In certain embodiments, R.sup.X is
unsubstituted C.sub.1-6 alkyl. In certain embodiments, R.sup.X is
substituted C.sub.1-6 alkyl. In certain embodiments, R.sup.X is
C.sub.1-6 alkyl substituted with at least one halogen. In certain
embodiments, R.sup.X is --CH.sub.3. In certain embodiments, R.sup.X
is substituted methyl. In certain embodiments, R.sup.X is
--CH.sub.2F. In certain embodiments, R.sup.X is --CHF.sub.2. In
certain embodiments, R.sup.X is --CF.sub.3. In certain embodiments,
R.sup.X is ethyl. In certain embodiments, R.sup.X is propyl. In
certain embodiments, R.sup.X is butyl. In certain embodiments, Rx
is pentyl. In certain embodiments, R.sup.X is hexyl. In certain
embodiments, R.sup.X is Bn. In certain embodiments, R.sup.X is
substituted alkenyl. In certain embodiments, R.sup.X is
unsubstituted alkenyl. In certain embodiments, R.sup.X is
substituted alkynyl. In certain embodiments, R.sup.X is
unsubstituted alkynyl. In certain embodiments, R.sup.X is
substituted carbocyclyl. In certain embodiments, R.sup.X is
unsubstituted carbocyclyl. In certain embodiments, R.sup.X is
saturated carbocyclyl. In certain embodiments, R.sup.X is
unsaturated carbocyclyl. In certain embodiments, R.sup.X is
monocyclic carbocyclyl. In certain embodiments, R.sup.X is 3- to
7-membered, monocyclic carbocyclyl. In certain embodiments, R.sup.X
is substituted heterocyclyl. In certain embodiments, R.sup.X is
unsubstituted heterocyclyl. In certain embodiments, R.sup.X is
saturated heterocyclyl. In certain embodiments, R.sup.X is
unsaturated heterocyclyl. In certain embodiments, R.sup.X is
heterocyclyl, wherein one, two, or three atoms in the heterocyclic
ring system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, R.sup.X is
monocyclic heterocyclyl. In certain embodiments, R.sup.X is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments,
R.sup.X is substituted aryl. In certain embodiments, R.sup.X is
unsubstituted aryl. In certain embodiments, R.sup.X is 6- to
10-membered aryl. In certain embodiments, R.sup.X is substituted
phenyl. In certain embodiments, R.sup.X is unsubstituted phenyl. In
certain embodiments, R.sup.X is substituted heteroaryl. In certain
embodiments, R.sup.X is unsubstituted heteroaryl. In certain
embodiments, R.sup.X is heteroaryl, wherein one, two, three, or
four atoms in the heteroaryl ring system are independently selected
from the group consisting of nitrogen, oxygen, and sulfur. In
certain embodiments, R.sup.X is monocyclic heteroaryl. In certain
embodiments, R.sup.X is 5-membered, monocyclic heteroaryl. In
certain embodiments, R.sup.X is 6-membered, monocyclic heteroaryl.
In certain embodiments, R.sup.X is bicyclic heteroaryl, wherein the
point of attachment may be on any atom of the bicyclic heteroaryl
ring system, as valency permits. In certain embodiments, R.sup.X is
--OR.sup.a. In certain embodiments, R.sup.X is --OH. In certain
embodiments, R.sup.X is --O(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, R.sup.X is --OMe. In certain
embodiments, R.sup.X is --OEt. In certain embodiments, R.sup.X is
--OPr. In certain embodiments, R.sup.X is --OBu. In certain
embodiments, R.sup.X is --OBn. In certain embodiments, R.sup.X is
--OPh. In certain embodiments, Rx is --SR.sup.a. In certain
embodiments, R.sup.X is --SH. In certain embodiments, R.sup.X is
--SMe. In certain embodiments, R.sup.X is --N(R.sup.a).sub.2. In
certain embodiments, R.sup.X is --NH.sub.2. In certain embodiments,
R.sup.X is --NHMe. In certain embodiments, R.sup.X is --NMe.sub.2.
In certain embodiments, R.sup.X is --CN. In certain embodiments,
R.sup.X is --SCN. In certain embodiments, R.sup.X is
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a, or
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2. In certain embodiments, R.sup.X
is --C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain
embodiments, R.sup.X is --C(.dbd.O)N(R.sup.a).sub.2. In certain
embodiments, R.sup.X is --C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or
--C(.dbd.O)NH.sub.2. In certain embodiments, R.sup.X is --NO.sub.2.
In certain embodiments, R.sup.X is --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments,
R.sup.X is --OC(.dbd.O)R.sup.a, --OC(.dbd.O)OR.sup.a, or
--OC(.dbd.O)N(R.sup.a).sub.2.
[0194] Formula (I) includes divalent moiety Y. In certain
embodiments, Y is --O--. In certain embodiments, Y is --NR.sup.Y--.
In certain embodiments, Y is --NH--. In certain embodiments, Y is
--NR.sup.Y--; X.sup.A is CR.sup.X; and R.sup.Y and R.sup.X of
X.sup.A are joined to form a substituted or unsubstituted,
monocyclic, 5- to 7-membered heterocyclic ring that is fused with
Ring B, optionally wherein there are 2 or 3 nitrogen atoms, 0 or 1
oxygen atom, and 0 or 1 sulfur atom, in the monocyclic heterocyclic
ring system. The monocyclic heterocyclic ring formed by joining
R.sup.Y and R.sup.X of X.sup.A is fused with Ring B to form a
substituted or unsubstituted, bicyclic, 9- to 11-membered ring. In
certain embodiments, Y is --NR.sup.Y--; X.sup.A is CR.sup.X; and
R.sup.Y and R.sup.X of X.sup.A are joined to form a substituted or
unsubstituted, monocyclic, 6-membered heterocyclic ring that is
fused with Ring B.
[0195] In certain embodiments, when Y is --NR.sup.Y--, R.sup.Y is
H. In certain embodiments, R.sup.Y is substituted acyl. In certain
embodiments, R.sup.Y is unsubstituted acyl. In certain embodiments,
R.sup.Y is acetyl. In certain embodiments, R.sup.Y is unsubstituted
C.sub.1-6 alkyl. In certain embodiments, R.sup.Y is substituted
C.sub.1-6 alkyl. In certain embodiments, R.sup.Y is C.sub.1-6 alkyl
substituted with at least one halogen. In certain embodiments,
R.sup.Y is unsubstituted methyl. In certain embodiments, R.sup.Y is
substituted methyl. In certain embodiments, R.sup.Y is --CH.sub.2F.
In certain embodiments, R.sup.Y is --CHF.sub.2. In certain
embodiments, R.sup.Y is --CF.sub.3. In certain embodiments, R.sup.Y
is ethyl. In certain embodiments, R.sup.Y is propyl. In certain
embodiments, R.sup.Y is butyl. In certain embodiments, R.sup.Y is
pentyl. In certain embodiments, R.sup.Y is hexyl. In certain
embodiments, R.sup.Y is Bn. In certain embodiments, R.sup.Y is a
nitrogen protecting group. In certain embodiments, R.sup.Y is Bn,
Boc, Cbz, Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or
Ts.
[0196] In Formula (I), Ring B includes substituent R.sup.D. In
certain embodiments, R.sup.D is H. In certain embodiments, R.sup.D
is halogen. In certain embodiments, R.sup.D is F. In certain
embodiments, R.sup.D is Cl. In certain embodiments, R.sup.D is Br.
In certain embodiments, R.sup.D is I (iodine). In certain
embodiments, R.sup.D is substituted alkyl. In certain embodiments,
R.sup.D is unsubstituted alkyl. In certain embodiments, R.sup.D is
unsubstituted C.sub.1-6 alkyl. In certain embodiments, R.sup.D is
substituted C.sub.1-6 alkyl. In certain embodiments, R.sup.D is
C.sub.1-6 alkyl substituted with at least one halogen. In certain
embodiments, R.sup.D is --CH.sub.3. In certain embodiments, R.sup.D
is substituted methyl. In certain embodiments, R.sup.D is
--CH.sub.2F. In certain embodiments, R.sup.D is --CHF.sub.2. In
certain embodiments, R.sup.D is --CF.sub.3. In certain embodiments,
R.sup.D is ethyl. In certain embodiments, R.sup.D is propyl. In
certain embodiments, R.sup.D is butyl. In certain embodiments,
R.sup.D is pentyl. In certain embodiments, R.sup.D is hexyl. In
certain embodiments, R.sup.D is Bn. In certain embodiments, R.sup.D
is substituted alkenyl. In certain embodiments, R.sup.D is
unsubstituted alkenyl. In certain embodiments, R.sup.D is
substituted alkynyl. In certain embodiments, R.sup.D is
unsubstituted alkynyl. In certain embodiments, R.sup.D is
substituted carbocyclyl. In certain embodiments, R.sup.D is
unsubstituted carbocyclyl. In certain embodiments, R.sup.D is
saturated carbocyclyl. In certain embodiments, R.sup.D is
unsaturated carbocyclyl. In certain embodiments, R.sup.D is
monocyclic carbocyclyl. In certain embodiments, R.sup.D is 3- to
7-membered, monocyclic carbocyclyl. In certain embodiments, R.sup.D
is substituted heterocyclyl. In certain embodiments, R.sup.D is
unsubstituted heterocyclyl. In certain embodiments, R.sup.D is
saturated heterocyclyl. In certain embodiments, R.sup.D is
unsaturated heterocyclyl. In certain embodiments, R.sup.D is
heterocyclyl, wherein one, two, or three atoms in the heterocyclic
ring system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, R.sup.D is
monocyclic heterocyclyl. In certain embodiments, R.sup.D is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments,
R.sup.D is substituted aryl. In certain embodiments, R.sup.D is
unsubstituted aryl. In certain embodiments, R.sup.D is 6- to
10-membered aryl. In certain embodiments, R.sup.D is substituted
phenyl. In certain embodiments, R.sup.D is unsubstituted phenyl. In
certain embodiments, R.sup.D is substituted heteroaryl. In certain
embodiments, R.sup.D is unsubstituted heteroaryl. In certain
embodiments, R.sup.D is heteroaryl, wherein one, two, three, or
four atoms in the heteroaryl ring system are independently selected
from the group consisting of nitrogen, oxygen, and sulfur. In
certain embodiments, R.sup.D is monocyclic heteroaryl. In certain
embodiments, R.sup.D is 5-membered, monocyclic heteroaryl. In
certain embodiments, R.sup.D is 6-membered, monocyclic heteroaryl.
In certain embodiments, R.sup.D is bicyclic heteroaryl, wherein the
point of attachment may be on any atom of the bicyclic heteroaryl
ring system, as valency permits. In certain embodiments, R.sup.D is
9- or 10-membered, bicyclic heteroaryl. In certain embodiments,
R.sup.D is --OR.sup.a. In certain embodiments, R.sup.D is --OH. In
certain embodiments, R.sup.D is --O(substituted or unsubstituted
C.sub.1-6 alkyl). In certain embodiments, R.sup.D is --OMe. In
certain embodiments, R.sup.D is --OEt. In certain embodiments,
R.sup.D is --OPr. In certain embodiments, R.sup.D is --OBu. In
certain embodiments, R.sup.Dis --OBn. In certain embodiments,
R.sup.D is --OPh. In certain embodiments, R.sup.D is --SR.sup.a. In
certain embodiments, R.sup.D is --SH. In certain embodiments,
R.sup.D is --SMe. In certain embodiments, R.sup.D is
--N(R.sup.a).sub.2. In certain embodiments, R.sup.D is --NH.sub.2.
In certain embodiments, R.sup.D is --NHMe. In certain embodiments,
R.sup.D is --NMe.sub.2. In certain embodiments, R.sup.D is --CN. In
certain embodiments, R.sup.D is --SCN. In certain embodiments,
R.sup.D is --C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2. In certain embodiments,
R.sup.D is --C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain
embodiments, R.sup.D is --C(.dbd.O)N(R.sup.a).sub.2. In certain
embodiments, R.sup.D is --C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or
--C(.dbd.O)NH.sub.2. In certain embodiments, R.sup.D is --NO.sub.2.
In certain embodiments, R.sup.D is --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments,
R.sup.D is --OC(.dbd.O)R.sup.a, --OC(.dbd.O)OR.sup.a, or
--OC(.dbd.O)N(R.sup.a).sub.2.
[0197] Formula (I) includes Ring C that is unsubstituted (e.g.,
when m is 0) or substituted with one or more substituents R.sup.C
(e.g., when m is 1, 2, 3, 4, or 5). In certain embodiments, Ring C
is of the formula:
##STR00057##
In certain embodiments, Ring C is of the formula:
##STR00058##
In certain embodiments, Ring C is of the formula:
##STR00059##
In certain embodiments, Ring C is of the formula:
##STR00060##
In certain embodiments, Ring C is of the formula:
##STR00061##
wherein each instance of R.sup.C is independently substituted or
unsubstituted C.sub.1-6 alkyl. In certain embodiments, Ring C is of
the formula:
##STR00062##
In certain embodiments, Ring C is of the formula:
##STR00063##
In certain embodiments, Ring C is of the formula:
##STR00064##
In certain embodiments, Ring C is of the formula:
##STR00065##
In certain embodiments, at least two instances of R.sup.C are
different. In certain embodiments, all instances of R.sup.C are the
same. In certain embodiments, at least one instance of R.sup.C is
halogen. In certain embodiments, at least one instance of R.sup.C
is F. In certain embodiments, at least one instance of R.sup.C is
Cl. In certain embodiments, at least one instance of R.sup.C is Br.
In certain embodiments, at least one instance of R.sup.C is I
(iodine). In certain embodiments, at least one instance of R.sup.C
is substituted alkyl. In certain embodiments, at least one instance
of R.sup.C is unsubstituted alkyl. In certain embodiments, at least
one instance of R.sup.C is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, all instances of R.sup.C are unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.C is substituted C.sub.1-6 alkyl. In certain embodiments, at
least one instance of R.sup.C is C.sub.1-6 alkyl substituted with
at least one halogen. In certain embodiments, at least one instance
of R.sup.C is --CH.sub.3. In certain embodiments, all instances of
R.sup.C are --CH.sub.3. In certain embodiments, at least one
instance of R.sup.C is substituted methyl. In certain embodiments,
at least one instance of R.sup.C is --CH.sub.2F. In certain
embodiments, at least one instance of R.sup.C is --CHF.sub.2. In
certain embodiments, at least one instance of R.sup.C is
--CF.sub.3. In certain embodiments, at least one instance of
R.sup.C is ethyl. In certain embodiments, at least one instance of
R.sup.C is propyl. In certain embodiments, at least one instance of
R.sup.C is butyl. In certain embodiments, at least one instance of
R.sup.C is pentyl. In certain embodiments, at least one instance of
R.sup.C is hexyl. In certain embodiments, at least one instance of
R.sup.C is Bn. In certain embodiments, each instance of R.sup.C is
independently halogen (e.g., Cl) or substituted or unsubstituted
C.sub.1-6 alkyl (e.g., unsubstituted C.sub.1-6 alkyl (e.g., Me)).
In certain embodiments, at least one instance of R.sup.C is
substituted alkenyl. In certain embodiments, at least one instance
of R.sup.C is unsubstituted alkenyl. In certain embodiments, at
least one instance of R.sup.C is substituted alkynyl. In certain
embodiments, at least one instance of R.sup.C is unsubstituted
alkynyl. In certain embodiments, at least one instance of R.sup.C
is substituted carbocyclyl. In certain embodiments, at least one
instance of R.sup.C is unsubstituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.C is saturated
carbocyclyl. In certain embodiments, at least one instance of
R.sup.C is unsaturated carbocyclyl. In certain embodiments, at
least one instance of R.sup.C is monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.C is 3- to 7-membered,
monocyclic carbocyclyl. In certain embodiments, at least one
instance of R.sup.C is substituted heterocyclyl. In certain
embodiments, at least one instance of R.sup.C is unsubstituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.C is saturated heterocyclyl. In certain embodiments, at least
one instance of R.sup.C is unsaturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.C is heterocyclyl,
wherein one, two, or three atoms in the heterocyclic ring system
are independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, at least one instance
of R.sup.C is monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.C is 3- to 7-membered, monocyclic
heterocyclyl. In certain embodiments, at least one instance of
R.sup.C is substituted aryl. In certain embodiments, at least one
instance of R.sup.C is unsubstituted aryl. In certain embodiments,
at least one instance of R.sup.C is 6- to 10-membered aryl. In
certain embodiments, at least one instance of R.sup.C is
substituted phenyl. In certain embodiments, at least one instance
of R.sup.C is unsubstituted phenyl. In certain embodiments, at
least one instance of R.sup.C is substituted heteroaryl. In certain
embodiments, at least one instance of R.sup.C is unsubstituted
heteroaryl. In certain embodiments, at least one instance of
R.sup.C is heteroaryl, wherein one, two, three, or four atoms in
the heteroaryl ring system are independently selected from the
group consisting of nitrogen, oxygen, and sulfur. In certain
embodiments, at least one instance of R.sup.C is monocyclic
heteroaryl. In certain embodiments, at least one instance of
R.sup.C is 5-membered, monocyclic heteroaryl. In certain
embodiments, at least one instance of R.sup.C is 6-membered,
monocyclic heteroaryl. In certain embodiments, at least one
instance of R.sup.C is bicyclic heteroaryl, wherein the point of
attachment may be on any atom of the bicyclic heteroaryl ring
system, as valency permits. In certain embodiments, at least one
instance of R.sup.C is 9- or 10-membered, bicyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.C is
--OR.sup.a. In certain embodiments, at least one instance of
R.sup.C is --OH. In certain embodiments, at least one instance of
R.sup.C is --O(substituted or unsubstituted C.sub.1-6 alkyl). In
certain embodiments, at least one instance of R.sup.C is --OMe. In
certain embodiments, at least one instance of R.sup.C is --OEt. In
certain embodiments, at least one instance of R.sup.C is --OPr. In
certain embodiments, at least one instance of R.sup.C is --OBu. In
certain embodiments, at least one instance of R.sup.C is --OBn. In
certain embodiments, at least one instance of R.sup.C is --OPh. In
certain embodiments, at least one instance of R.sup.C is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.C is --SH. In certain embodiments, at least one instance of
R.sup.C is --SMe. In certain embodiments, at least one instance of
R.sup.C is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.C is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.C is --NHMe. In certain embodiments, at least
one instance of R.sup.C is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.C is --CN. In certain embodiments, at
least one instance of R.sup.C is --SCN. In certain embodiments, at
least one instance of R.sup.C is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.C is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.C is --C(.dbd.O)N(R.sup.a).sub.2. In
certain embodiments, at least one instance of R.sup.C is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.C is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.C is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.C is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0198] In certain embodiments, m is 0. In certain embodiments, m is
1. In certain embodiments, m is 2. In certain embodiments, m is 3.
In certain embodiments, m is 4. In certain embodiments, m is 5.
[0199] In certain embodiments, m is 2; and each instance of R.sup.C
is halogen (e.g., Cl). In certain embodiments, m is 2; and each
instance of R.sup.C is substituted or unsubstituted C.sub.1-6
alkyl. In certain embodiments, m is 2; and each instance of R.sup.C
is methyl. In certain embodiments, m is 2; and each instance of
R.sup.C is independently halogen (e.g., Cl) or substituted or
unsubstituted C.sub.1-6 alkyl (e.g., unsubstituted C.sub.1-6 alkyl
(e.g., Me)).
[0200] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00066##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0201] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00067##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0202] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00068##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0203] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00069##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0204] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00070##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0205] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00071##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0206] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00072##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0207] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00073##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0208] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00074##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0209] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00075##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0210] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00076##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0211] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00077##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0212] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00078##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0213] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00079##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0214] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00080##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0215] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00081##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0216] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00082##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0217] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00083##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein each instance of R.sup.E is
independently hydrogen, halogen, or substituted or unsubstituted
C.sub.1-6 alkyl. In certain embodiments, the two instances of
R.sup.E are the same. In certain embodiments, the two instances of
R.sup.E are not the same. In certain embodiments, at least one
instance of R.sup.E is hydrogen. In certain embodiments, each
instance of R.sup.E is hydrogen. In certain embodiments, at least
one instance of R.sup.E is halogen (e.g., F, Cl, Br, or I). In
certain embodiments, at least one instance of R.sup.E is
substituted or unsubstituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.E is Me. In certain
embodiments, at least one instance of R.sup.E is substituted methyl
(e.g., --CF.sub.3 or Bn), Et, substituted ethyl (e.g.,
perfluoroethyl), Pr, substituted propyl (e.g., perfluoropropyl),
Bu, or substituted butyl (e.g., perfluorobutyl).
[0218] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00084##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0219] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00085##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0220] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00086##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0221] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00087##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0222] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00088##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0223] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00089##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0224] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00090##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0225] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00091##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0226] In certain embodiments, the compound of Formula (I) is of
the formula:
##STR00092## ##STR00093## ##STR00094##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
Compounds of Formula (II)
[0227] In another aspect, the present disclosure provides
imidazolyl compounds of Formula (II) for use in the invention:
##STR00095##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof, wherein:
[0228] each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0229] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or two
instances of R.sup.a are joined to form a substituted or
unsubstituted heterocyclic or substituted or unsubstituted
heteroaryl ring;
[0230] j is 0, 1, or 2;
[0231] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, or a nitrogen protecting group;
[0232] R.sup.C is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0233] each instance of R.sup.D is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0234] m is 0, 1, or 2;
[0235] R.sup.E is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0236] each instance of R.sup.F is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and
[0237] n is 0, 1, 2, 3, 4, or 5.
[0238] All embodiments of Ring A, Ring B, Ring C, Ring D, Ring E,
Ring F, Ring G, R.sup.A, R.sup.a, R.sup.B, R.sup.C, R.sup.D,
R.sup.E, R.sup.F, R.sup.G, R.sup.H, R.sup.J, R.sup.K, j, k, m, n,
and q recited in subsection Compounds of Formula (II) apply only to
Formula (II).
[0239] Formula (II) includes as Ring A a pyrimidinyl ring that is
unsubstituted (e.g., when j is 0) or substituted with one or two
substituents R.sup.A (e.g., when j is 1 or 2). In certain
embodiments, the two instances of R.sup.A are different. In certain
embodiments, both instances of R.sup.A are the same. In certain
embodiments, at least one instance of R.sup.A is halogen. In
certain embodiments, at least one instance of R.sup.A is F. In
certain embodiments, at least one instance of R.sup.A is Cl. In
certain embodiments, at least one instance of R.sup.A is Br. In
certain embodiments, at least one instance of R.sup.A is I
(iodine). In certain embodiments, at least one instance of R.sup.A
is substituted alkyl. In certain embodiments, at least one instance
of R.sup.A is unsubstituted alkyl. In certain embodiments, at least
one instance of R.sup.A is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, both instances of R.sup.A are unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.A is substituted C.sub.1-6 alkyl. In certain embodiments, at
least one instance of R.sup.A is C.sub.1-6 alkyl substituted with
at least one halogen. In certain embodiments, at least one instance
of R.sup.A is --CH.sub.3. In certain embodiments, at least one
instance of R.sup.A is substituted methyl. In certain embodiments,
at least one instance of R.sup.A is --CH.sub.2F. In certain
embodiments, at least one instance of R.sup.A is --CHF.sub.2. In
certain embodiments, at least one instance of R.sup.A is
--CF.sub.3. In certain embodiments, at least one instance of
R.sup.A is ethyl. In certain embodiments, at least one instance of
R.sup.A is propyl. In certain embodiments, at least one instance of
R.sup.A is butyl. In certain embodiments, at least one instance of
R.sup.A is pentyl. In certain embodiments, at least one instance of
R.sup.A is hexyl. In certain embodiments, at least one instance of
R.sup.A is Bn. In certain embodiments, at least one instance of
R.sup.A is halogen or substituted or unsubstituted C.sub.1-6 alkyl.
In certain embodiments, at least one instance of R.sup.A is
substituted alkenyl. In certain embodiments, at least one instance
of R.sup.A is unsubstituted alkenyl. In certain embodiments, at
least one instance of R.sup.A is substituted alkynyl. In certain
embodiments, at least one instance of R.sup.A is unsubstituted
alkynyl. In certain embodiments, at least one instance of R.sup.A
is substituted carbocyclyl. In certain embodiments, at least one
instance of R.sup.A is unsubstituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.A is saturated
carbocyclyl. In certain embodiments, at least one instance of
R.sup.A is unsaturated carbocyclyl. In certain embodiments, at
least one instance of R.sup.A is monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.A is 3- to 7-membered,
monocyclic carbocyclyl. In certain embodiments, at least one
instance of R.sup.A is substituted heterocyclyl. In certain
embodiments, at least one instance of R.sup.A is unsubstituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.A is saturated heterocyclyl. In certain embodiments, at least
one instance of R.sup.A is unsaturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.A is heterocyclyl,
wherein one, two, or three atoms of the heterocyclic ring system
are independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, at least one instance
of R.sup.A is monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.A is 3- to 7-membered, monocyclic
heterocyclyl. In certain embodiments, at least one instance of
R.sup.A is substituted aryl. In certain embodiments, at least one
instance of R.sup.A is unsubstituted aryl. In certain embodiments,
at least one instance of R.sup.A is 6- to 10-membered aryl. In
certain embodiments, at least one instance of R.sup.A is
substituted phenyl. In certain embodiments, at least one instance
of R.sup.A is unsubstituted phenyl. In certain embodiments, at
least one instance of R.sup.A is substituted heteroaryl. In certain
embodiments, at least one instance of R.sup.A is unsubstituted
heteroaryl. In certain embodiments, at least one instance of
R.sup.A is heteroaryl, wherein one, two, three, or four atoms of
the heteroaryl ring system are independently selected from the
group consisting of nitrogen, oxygen, and sulfur. In certain
embodiments, at least one instance of R.sup.A is monocyclic
heteroaryl. In certain embodiments, at least one instance of
R.sup.A is 5-membered, monocyclic heteroaryl. In certain
embodiments, at least one instance of R.sup.A is 6-membered,
monocyclic heteroaryl. In certain embodiments, at least one
instance of R.sup.A is bicyclic heteroaryl, wherein the point of
attachment may be on any atom of the bicyclic heteroaryl ring
system, as valency permits. In certain embodiments, at least one
instance of R.sup.A is 9- or 10-membered, bicyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.A is
--OR.sup.a. In certain embodiments, at least one instance of
R.sup.A is --OH. In certain embodiments, at least one instance of
R.sup.A is --O(substituted or unsubstituted C.sub.1-6 alkyl). In
certain embodiments, at least one instance of R.sup.A is --OMe. In
certain embodiments, at least one instance of R.sup.A is --OEt. In
certain embodiments, at least one instance of R.sup.A is --OPr. In
certain embodiments, at least one instance of R.sup.A is --OBu. In
certain embodiments, at least one instance of R.sup.A is --OBn. In
certain embodiments, at least one instance of R.sup.A is --OPh. In
certain embodiments, at least one instance of R.sup.A is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.A is --SH. In certain embodiments, at least one instance of
R.sup.A is --SMe. In certain embodiments, at least one instance of
R.sup.A is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.A is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.A is --NHMe. In certain embodiments, at least
one instance of R.sup.A is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.A is --CN. In certain embodiments, at
least one instance of R.sup.A is --SCN. In certain embodiments, at
least one instance of R.sup.A is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.A is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.A is --C(.dbd.O)N(R.sup.a).sub.2. In
certain embodiments, at least one instance of R.sup.A is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.A is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.A is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.A is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0240] Each instance of R.sup.A, R.sup.D, R.sup.F, R.sup.G,
R.sup.J, and R.sup.K may independently include one or more
substituents R.sup.a. In certain embodiments, all instances of
R.sup.a are the same. In certain embodiments, at least two
instances of R.sup.a are different. In certain embodiments, at
least one instance of R.sup.a is H. In certain embodiments, each
instance of R.sup.a is H. In certain embodiments, at least one
instance of R.sup.a is substituted acyl. In certain embodiments, at
least one instance of R.sup.a is unsubstituted acyl. In certain
embodiments, at least one instance of R.sup.a is acetyl. In certain
embodiments, at least one instance of R.sup.a is substituted alkyl.
In certain embodiments, at least one instance of R.sup.a is
unsubstituted alkyl. In certain embodiments, at least one instance
of R.sup.a is unsubstituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.a is methyl. In certain
embodiments, at least one instance of R.sup.a is ethyl. In certain
embodiments, at least one instance of R.sup.a is propyl. In certain
embodiments, at least one instance of R.sup.a is butyl. In certain
embodiments, at least one instance of R.sup.a is pentyl. In certain
embodiments, at least one instance of R.sup.a is hexyl. In certain
embodiments, at least one instance of R.sup.a is Bn. In certain
embodiments, at least one instance of R.sup.a is substituted
alkenyl. In certain embodiments, at least one instance of R.sup.a
is unsubstituted alkenyl. In certain embodiments, at least one
instance of R.sup.a is substituted alkynyl. In certain embodiments,
at least one instance of R.sup.a is unsubstituted alkynyl. In
certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted carbocyclyl. In certain embodiments,
at least one instance of R.sup.a is saturated carbocyclyl. In
certain embodiments, at least one instance of R.sup.a is
unsaturated carbocyclyl. In certain embodiments, at least one
instance of R.sup.a is 3- to 7-membered, monocyclic carbocyclyl. In
certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted heterocyclyl. In certain embodiments,
at least one instance of R.sup.a is saturated heterocyclyl. In
certain embodiments, at least one instance of R.sup.a is
unsaturated heterocyclyl. In certain embodiments, at least one
instance of R.sup.a is heterocyclyl, wherein one, two, or three
atoms of the heterocyclic ring system are independently selected
from the group consisting of nitrogen, oxygen, and sulfur. In
certain embodiments, at least one instance of R.sup.a is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.a is substituted or unsubstituted aryl.
In certain embodiments, at least one instance of R.sup.a is 6- to
10-membered aryl. In certain embodiments, at least one instance of
R.sup.a is monocyclic aryl. In certain embodiments, at least one
instance of R.sup.a is substituted phenyl. In certain embodiments,
at least one instance of R.sup.a is unsubstituted phenyl. In
certain embodiments, at least one instance of R.sup.a is bicyclic
aryl. In certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted heteroaryl. In certain embodiments, at
least one instance of R.sup.a is heteroaryl, wherein one, two,
three, or four atoms of the heteroaryl ring system are
independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, at least one instance
of R.sup.a is monocyclic heteroaryl. In certain embodiments, at
least one instance of R.sup.a is 5- or 6-membered, monocyclic
heteroaryl. In certain embodiments, at least one instance of
R.sup.a is bicyclic heteroaryl, wherein the point of attachment may
be on any atom of the bicyclic heteroaryl ring system, as valency
permits. In certain embodiments, at least one instance of R.sup.a
is a nitrogen protecting group when attached to a nitrogen atom. In
certain embodiments, at least one instance of R.sup.a is Bn, Boc,
Cbz, Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts when
attached to a nitrogen atom. In certain embodiments, R.sup.a is an
oxygen protecting group when attached to an oxygen atom. In certain
embodiments, R.sup.a is silyl, TBDPS, TBDMS, TIPS, TES, TMS, MOM,
THP, t-Bu, Bn, allyl, acetyl, pivaloyl, or benzoyl when attached to
an oxygen atom. In certain embodiments, R.sup.a is a sulfur
protecting group when attached to a sulfur atom. In certain
embodiments, R.sup.a is acetamidomethyl, t-Bu, 3-nitro-2-pyridine
sulfenyl, 2-pyridine-sulfenyl, or triphenylmethyl when attached to
a sulfur atom. In certain embodiments, two instances of R.sup.a are
joined to form a substituted or unsubstituted heterocyclic ring. In
certain embodiments, two instances of R.sup.a are joined to form a
saturated or unsaturated heterocyclic ring. In certain embodiments,
two instances of R.sup.a are joined to form a heterocyclic ring,
wherein one, two, or three atoms of the heterocyclic ring system
are independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, two instances of
R.sup.a are joined to form a 3- to 7-membered, monocyclic
heterocyclic ring. In certain embodiments, two instances of R.sup.a
are joined to form a substituted or unsubstituted heteroaryl ring.
In certain embodiments, two instances of R.sup.a are joined to form
a substituted or unsubstituted, 5- to 6-membered, monocyclic
heteroaryl ring, wherein one, two, three, or four atoms of the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur.
[0241] In certain embodiments, j is 0. In certain embodiments, j is
1. In certain embodiments, j is 2.
[0242] Formula (II) includes substituent R.sup.B on a nitrogen
atom. In certain embodiments, R.sup.B is H. In certain embodiments,
R.sup.B is substituted acyl. In certain embodiments, R.sup.B is
unsubstituted acyl. In certain embodiments, R.sup.B is acetyl. In
certain embodiments, R.sup.B is substituted alkyl. In certain
embodiments, R.sup.B is unsubstituted alkyl. In certain
embodiments, R.sup.B is unsubstituted C.sub.1-6 alkyl. In certain
embodiments, R.sup.B is substituted C.sub.1-6 alkyl. In certain
embodiments, R.sup.B is C.sub.1-6 alkyl substituted with at least
one halogen. In certain embodiments, R.sup.B is --CH.sub.3. In
certain embodiments, R.sup.B is substituted methyl. In certain
embodiments, R.sup.B is --CH.sub.2F. In certain embodiments,
R.sup.B is --CHF.sub.2. In certain embodiments, R.sup.B is
--CF.sub.3. In certain embodiments, R.sup.B is ethyl. In certain
embodiments, R.sup.B is propyl. In certain embodiments, R.sup.B is
butyl. In certain embodiments, R.sup.B is pentyl. In certain
embodiments, R.sup.B is hexyl. In certain embodiments, R.sup.B is
Bn. In certain embodiments, R.sup.B is --(CH.sub.2).sub.1-4-(Ring
F), wherein Ring F is a substituted or unsubstituted, 3- to
7-membered, monocyclic heterocyclic ring. In certain embodiments,
R.sup.B is --(CH.sub.2).sub.1-4-(substituted or unsubstituted
pyrrolidinyl). In certain embodiments, R.sup.B is of the
formula:
##STR00096##
wherein R.sup.4 is H, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group. In certain embodiments, R.sup.B is
of the formula:
##STR00097##
In certain embodiments, R.sup.B is --(CH.sub.2).sub.1-4-(Ring F),
wherein Ring F is a substituted or unsubstituted oxetanyl,
substituted or unsubstituted azetidinyl, substituted or
unsubstituted tetrahydrofuranyl, substituted or unsubstituted
tetrahydropyranyl, substituted or unsubstituted piperidinyl,
substituted or unsubstituted piperazinyl, or substituted or
unsubstituted morpholinyl ring. In certain embodiments, R.sup.B is
substituted alkenyl. In certain embodiments, R.sup.B is
unsubstituted alkenyl. In certain embodiments, R.sup.B is
substituted alkynyl. In certain embodiments, R.sup.B is
unsubstituted alkynyl. In certain embodiments, R.sup.B is
substituted carbocyclyl. In certain embodiments, R.sup.B is
unsubstituted carbocyclyl. In certain embodiments, R.sup.B is
saturated carbocyclyl. In certain embodiments, R.sup.B is
unsaturated carbocyclyl. In certain embodiments, R.sup.B is
monocyclic carbocyclyl. In certain embodiments, R.sup.B is 3- to
7-membered, monocyclic carbocyclyl. In certain embodiments, R.sup.B
is unsubstituted cyclopropyl. In certain embodiments, R.sup.B is
substituted cyclopropyl. In certain embodiments, R.sup.B is
substituted heterocyclyl. In certain embodiments, R.sup.B is
unsubstituted heterocyclyl. In certain embodiments, R.sup.B is
saturated heterocyclyl. In certain embodiments, R.sup.B is
unsaturated heterocyclyl. In certain embodiments, R.sup.B is
heterocyclyl, wherein one, two, or three atoms of the heterocyclic
ring system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, R.sup.B is
monocyclic heterocyclyl. In certain embodiments, R.sup.B is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments,
R.sup.B is substituted aryl. In certain embodiments, R.sup.B is
unsubstituted aryl. In certain embodiments, R.sup.B is 6- to
10-membered aryl. In certain embodiments, R.sup.B is substituted
phenyl. In certain embodiments, R.sup.B is unsubstituted phenyl. In
certain embodiments, R.sup.B is substituted or unsubstituted, 5- to
6-membered, monocyclic heteroaryl, wherein one, two, three, or four
atoms of the heteroaryl ring system are independently nitrogen,
oxygen, or sulfur. In certain embodiments, R.sup.B is substituted
or unsubstituted pyrazolyl. In certain embodiments, R.sup.B is of
the formula:
##STR00098##
wherein R.sup.1 is H, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group. In certain embodiments, R.sup.B is
of the formula:
##STR00099##
In certain embodiments, R.sup.B is substituted or unsubstituted
furanyl, substituted or unsubstituted thienyl, substituted or
unsubstituted pyrrolyl, substituted or unsubstituted imidazolyl,
substituted or unsubstituted oxazolyl, substituted or unsubstituted
isoxazolyl, substituted or unsubstituted thiazolyl, or substituted
or unsubstituted isothiazolyl. In certain embodiments, R.sup.B is
substituted or unsubstituted pyridyl, substituted or unsubstituted
pyrazinyl, substituted or unsubstituted pyrimidinyl, or substituted
or unsubstituted pyridazinyl. In certain embodiments, R.sup.B is
substituted or unsubstituted, 9- to 10-membered, bicyclic
heteroaryl, wherein one, two, three, or four atoms of the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur. In certain embodiments, R.sup.B is a nitrogen protecting
group. In certain embodiments, R.sup.B is Bn, Boc, Cbz, Fmoc,
trifluoroacetyl, triphenylmethyl, acetyl, or Ts.
[0243] Formula (II) includes substituent R.sup.C on a nitrogen
atom. In certain embodiments, R.sup.C is H. In certain embodiments,
R.sup.C is substituted acyl. In certain embodiments, R.sup.C is
unsubstituted acyl. In certain embodiments, R.sup.C is acetyl. In
certain embodiments, R.sup.C is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.C is substituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.C is C.sub.1-6 alkyl substituted with at
least one halogen. In certain embodiments, R.sup.C is unsubstituted
methyl. In certain embodiments, R.sup.C is substituted methyl. In
certain embodiments, R.sup.C is --CH.sub.2F. In certain
embodiments, R.sup.C is --CHF.sub.2. In certain embodiments,
R.sup.C is --CF.sub.3. In certain embodiments, R.sup.C is ethyl. In
certain embodiments, R.sup.C is propyl. In certain embodiments,
R.sup.C is butyl. In certain embodiments, R.sup.C is pentyl. In
certain embodiments, R.sup.C is hexyl. In certain embodiments,
R.sup.C is Bn. In certain embodiments, R.sup.C is a nitrogen
protecting group. In certain embodiments, R.sup.C is Bn, Boc, Cbz,
Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts.
[0244] In certain embodiments, R.sup.B is substituted or
unsubstituted C.sub.1-6 alkyl, and R.sup.C is H. In certain
embodiments, R.sup.B is --(CH.sub.2).sub.1-4-(Ring F), wherein Ring
F is a substituted or unsubstituted, 3- to 7-membered, monocyclic
heterocyclic ring; and R.sup.C is H. In certain embodiments,
R.sup.B is substituted or unsubstituted phenyl (e.g.,
para-substituted phenyl), and R.sup.C is H. In certain embodiments,
R.sup.B is substituted or unsubstituted, 5- to 6-membered,
monocyclic heteroaryl, wherein one, two, three, or four atoms of
the heteroaryl ring system are independently nitrogen, oxygen, or
sulfur; and R.sup.C is H. In certain embodiments, R.sup.B is
substituted or unsubstituted pyrazolyl, and R.sup.C is H. In
certain embodiments, R.sup.B is substituted or unsubstituted, 3- to
7-membered, monocyclic carbocyclyl; and R.sup.C is H. In certain
embodiments, R.sup.B is substituted or unsubstituted cyclopropyl,
and R.sup.C is H.
[0245] Formula (II) includes as Ring B an imidazolyl ring that is
unsubstituted (e.g., when m is 0) or substituted with one or two
substituents R.sup.D (e.g., when m is 1 or 2). In certain
embodiments, Ring B does not include substituents R.sup.D, that is,
m is 0. In certain embodiments, the two instances of R.sup.D are
different. In certain embodiments, both instances of R.sup.D are
the same. In certain embodiments, at least one instance of R.sup.D
is halogen. In certain embodiments, at least one instance of
R.sup.D is F. In certain embodiments, at least one instance of
R.sup.D is Cl. In certain embodiments, at least one instance of
R.sup.D is Br. In certain embodiments, at least one instance of
R.sup.D is I (iodine). In certain embodiments, at least one
instance of R.sup.D is substituted alkyl. In certain embodiments,
at least one instance of R.sup.D is unsubstituted alkyl. In certain
embodiments, at least one instance of R.sup.D is unsubstituted
C.sub.1-6 alkyl. In certain embodiments, both instances of R.sup.D
are unsubstituted C.sub.1-6 alkyl. In certain embodiments, at least
one instance of R.sup.D is substituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.D is C.sub.1-6 alkyl
substituted with at least one halogen. In certain embodiments, at
least one instance of R.sup.D is --CH.sub.3. In certain
embodiments, at least one instance of R.sup.D is substituted
methyl. In certain embodiments, at least one instance of R.sup.D is
--CH.sub.2F. In certain embodiments, at least one instance of
R.sup.D is --CHF.sub.2. In certain embodiments, at least one
instance of R.sup.D is --CF.sub.3. In certain embodiments, at least
one instance of R.sup.D is ethyl. In certain embodiments, at least
one instance of R.sup.D is propyl. In certain embodiments, at least
one instance of R.sup.D is butyl. In certain embodiments, at least
one instance of R.sup.D is pentyl. In certain embodiments, at least
one instance of R.sup.D is hexyl. In certain embodiments, at least
one instance of R.sup.D is Bn. In certain embodiments, at least one
instance of R.sup.D is halogen or substituted or unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.D is substituted alkenyl. In certain embodiments, at least
one instance of R.sup.D is unsubstituted alkenyl. In certain
embodiments, at least one instance of R.sup.D is substituted
alkynyl. In certain embodiments, at least one instance of R.sup.D
is unsubstituted alkynyl. In certain embodiments, at least one
instance of R.sup.D is substituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.D is unsubstituted
carbocyclyl. In certain embodiments, at least one instance of
R.sup.D is saturated carbocyclyl. In certain embodiments, at least
one instance of R.sup.D is unsaturated carbocyclyl. In certain
embodiments, at least one instance of R.sup.D is monocyclic
carbocyclyl. In certain embodiments, at least one instance of
R.sup.D is 3- to 7-membered, monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.D is substituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.D is unsubstituted heterocyclyl. In certain embodiments, at
least one instance of R.sup.D is saturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.D is unsaturated
heterocyclyl. In certain embodiments, at least one instance of
R.sup.D is heterocyclyl, wherein one, two, or three atoms of the
heterocyclic ring system are independently selected from the group
consisting of nitrogen, oxygen, and sulfur. In certain embodiments,
at least one instance of R.sup.D is monocyclic heterocyclyl. In
certain embodiments, at least one instance of R.sup.D is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.D is 3- to 7-substituted aryl. In
certain embodiments, at least one instance of R.sup.D is
unsubstituted aryl. In certain embodiments, at least one instance
of R.sup.D is 6- to 10-membered aryl. In certain embodiments, at
least one instance of R.sup.D is substituted phenyl. In certain
embodiments, at least one instance of R.sup.D is unsubstituted
phenyl. In certain embodiments, at least one instance of R.sup.D is
substituted heteroaryl. In certain embodiments, at least one
instance of R.sup.D is unsubstituted heteroaryl. In certain
embodiments, at least one instance of R.sup.D is heteroaryl,
wherein one, two, three, or four atoms of the heteroaryl ring
system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, at least one
instance of R.sup.D is monocyclic heteroaryl. In certain
embodiments, at least one instance of R.sup.D is 5-membered,
monocyclic heteroaryl. In certain embodiments, at least one
instance of R.sup.D is 6-membered, monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.D is bicyclic
heteroaryl, wherein the point of attachment may be on any atom of
the bicyclic heteroaryl ring system, as valency permits. In certain
embodiments, at least one instance of R.sup.D is 9- or 10-membered,
bicyclic heteroaryl. In certain embodiments, at least one instance
of R.sup.D is --OR.sup.a. In certain embodiments, at least one
instance of R.sup.D is --OH. In certain embodiments, at least one
instance of R.sup.D is --O(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, at least one instance of R.sup.D is
--OMe. In certain embodiments, at least one instance of R.sup.D is
--OEt. In certain embodiments, at least one instance of R.sup.D is
--OPr. In certain embodiments, at least one instance of R.sup.D is
--OBu. In certain embodiments, at least one instance of R.sup.D is
--OBn. In certain embodiments, at least one instance of R.sup.D is
--OPh. In certain embodiments, at least one instance of R.sup.D is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.D is --SH. In certain embodiments, at least one instance of
R.sup.D is --SMe. In certain embodiments, at least one instance of
R.sup.D is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.D is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.D is --NHMe. In certain embodiments, at least
one instance of R.sup.D is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.D is --CN. In certain embodiments, at
least one instance of R.sup.D is --SCN. In certain embodiments, at
least one instance of R.sup.D is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.D is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.D is --C(.dbd.O)N(R.sup.a).sub.2. In
certain embodiments, at least one instance of R.sup.D is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.D is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.D is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.D is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0246] In certain embodiments, m is 0. In certain embodiments, m is
1. In certain embodiments, m is 2.
[0247] Formula (II) includes substituent R.sup.E on a nitrogen
atom. In certain embodiments, R.sup.E is H. In certain embodiments,
R.sup.E is substituted acyl. In certain embodiments, R.sup.E is
unsubstituted acyl. In certain embodiments, R.sup.E is acetyl. In
certain embodiments, R.sup.E is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.E is substituted C.sub.1-6 alkyl. In
certain embodiments, R.sup.E is C.sub.1-6 alkyl substituted with at
least one halogen. In certain embodiments, R.sup.E is unsubstituted
methyl. In certain embodiments, R.sup.E is substituted methyl. In
certain embodiments, R.sup.E is --CH.sub.2F. In certain
embodiments, R.sup.E is --CHF.sub.2. In certain embodiments,
R.sup.E is --CF.sub.3. In certain embodiments, R.sup.E is ethyl. In
certain embodiments, R.sup.E is propyl. In certain embodiments,
R.sup.E is butyl. In certain embodiments, R.sup.E is pentyl. In
certain embodiments, R.sup.E is hexyl. In certain embodiments,
R.sup.E is Bn. In certain embodiments, R.sup.E is a nitrogen
protecting group. In certain embodiments, R.sup.E is Bn, Boc, Cbz,
Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts.
[0248] In certain embodiments, each of R.sup.C and R.sup.E is
H.
[0249] Formula (II) includes as Ring C a phenyl ring that is
unsubstituted (e.g., when n is 0) or substituted with one or more
substituents R.sup.F (e.g., when n is 1, 2, 3, 4, or 5). In certain
embodiments, Ring C is of the formula:
##STR00100##
In certain embodiments, Ring C is of the formula:
##STR00101##
In certain embodiments, Ring C is of the formula:
##STR00102##
In certain embodiments, Ring C is of the formula:
##STR00103##
In certain embodiments, Ring C is of the formula:
##STR00104##
wherein each instance of R.sup.F is independently halogen or
substituted or unsubstituted C.sub.1-6 alkyl. In certain
embodiments, Ring C is of the formula:
##STR00105##
In certain embodiments, Ring C is of the formula:
##STR00106##
In certain embodiments, Ring C is of the formula:
##STR00107##
In certain embodiments, Ring C is of the formula:
##STR00108##
In certain embodiments, at least two instances of R.sup.F are
different. In certain embodiments, all instances of R.sup.F are the
same. In certain embodiments, at least one instance of R.sup.F is
halogen. In certain embodiments, at least one instance of R.sup.F
is F. In certain embodiments, at least one instance of R.sup.F is
Cl. In certain embodiments, at least one instance of R.sup.F is Br.
In certain embodiments, at least one instance of R.sup.F is I
(iodine). In certain embodiments, at least one instance of R.sup.F
is substituted alkyl. In certain embodiments, at least one instance
of R.sup.F is unsubstituted alkyl. In certain embodiments, at least
one instance of R.sup.F is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, all instances of R.sup.F are unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.F is substituted C.sub.1-6 alkyl. In certain embodiments, at
least one instance of R.sup.F is C.sub.1-6 alkyl substituted with
at least one halogen. In certain embodiments, at least one instance
of R.sup.F is --CH.sub.3. In certain embodiments, all instances of
R.sup.F are --CH.sub.3. In certain embodiments, at least one
instance of R.sup.F is substituted methyl. In certain embodiments,
at least one instance of R.sup.F is --CH.sub.2F. In certain
embodiments, at least one instance of R.sup.F is --CHF.sub.2. In
certain embodiments, at least one instance of R.sup.F is
--CF.sub.3. In certain embodiments, at least one instance of
R.sup.F is ethyl. In certain embodiments, at least one instance of
R.sup.F is propyl. In certain embodiments, at least one instance of
R.sup.F is butyl. In certain embodiments, at least one instance of
R.sup.F is pentyl. In certain embodiments, at least one instance of
R.sup.F is hexyl. In certain embodiments, at least one instance of
R.sup.F is Bn. In certain embodiments, at least one instance of
R.sup.F is substituted alkenyl. In certain embodiments, at least
one instance of R.sup.F is unsubstituted alkenyl. In certain
embodiments, at least one instance of R.sup.F is substituted
alkynyl. In certain embodiments, at least one instance of R.sup.F
is unsubstituted alkynyl. In certain embodiments, at least one
instance of R.sup.F is substituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.F is unsubstituted
carbocyclyl. In certain embodiments, at least one instance of
R.sup.F is saturated carbocyclyl. In certain embodiments, at least
one instance of R.sup.F is unsaturated carbocyclyl. In certain
embodiments, at least one instance of R.sup.F is monocyclic
carbocyclyl. In certain embodiments, at least one instance of
R.sup.F is 3- to 7-membered, monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.F is substituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.F i s unsubstituted heterocyclyl. In certain embodiments, at
least one instance of R.sup.F is saturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.F i s unsaturated
heterocyclyl. In certain embodiments, at least one instance of
R.sup.F is heterocyclyl, wherein one, two, or three atoms of the
heterocyclic ring system are independently selected from the group
consisting of nitrogen, oxygen, and sulfur. In certain embodiments,
at least one instance of R.sup.F is monocyclic heterocyclyl. In
certain embodiments, at least one instance of R.sup.F is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments, at
least one instance of R is substituted aryl. In certain
embodiments, at least one instance of R.sup.F is unsubstituted
aryl. In certain embodiments, at least one instance of R.sup.F is
6- to 10-membered aryl. In certain embodiments, at least one
instance of R.sup.F is substituted phenyl. In certain embodiments,
at least one instance of R.sup.F is unsubstituted phenyl. In
certain embodiments, at least one instance of R.sup.F is
unsubstituted heteroaryl. In certain embodiments, at least one
instance of R.sup.F is unsubstituted heteroaryl. In certain
embodiments, at least one instance of R.sup.F is heteroaryl,
wherein one, two, three, or four atoms of the heteroaryl ring
system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, at least one
instance of R.sup.F is monocyclic heteroaryl. In certain
embodiments, at least one instance of R.sup.F is 5-membered,
monocyclic heteroaryl. In certain embodiments, at least one
instance of R.sup.F is 6-membered, monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.F is bicyclic
heteroaryl, wherein the point of attachment may be on any atom of
the bicyclic heteroaryl ring system, as valency permits. In certain
embodiments, at least one instance of R.sup.F is 9- or 10-membered,
bicyclic heteroaryl. In certain embodiments, at least one instance
of R.sup.F is --OR.sup.a. In certain embodiments, at least one
instance of R.sup.F is --OH. In certain embodiments, at least one
instance of R.sup.F is --O(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, at least one instance of R.sup.F is
--OMe. In certain embodiments, at least one instance of R.sup.F is
--OEt. In certain embodiments, at least one instance of R.sup.F is
--OPr. In certain embodiments, at least one instance of R.sup.F is
--OBu. In certain embodiments, at least one instance of R.sup.F is
--OBn. In certain embodiments, at least one instance of R.sup.F is
--OPh. In certain embodiments, at least one instance of R.sup.F is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.F is --SH. In certain embodiments, at least one instance of
R.sup.F is --SMe. In certain embodiments, at least one instance of
R.sup.F is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.F is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.F is --NHMe. In certain embodiments, at least
one instance of R.sup.F is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.F is --CN. In certain embodiments, at
least one instance of R.sup.F is --SCN. In certain embodiments, at
least one instance of R.sup.F is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.F is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.F is
--C(.dbd.O)N(R.sup.a).sub.2.
[0250] In certain embodiments, at least one instance of R.sup.F is
--C(.dbd.O)N(R.sup.a).sub.2, wherein each instance of R.sup.a is
independently hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, substituted or unsubstituted phenyl, or a nitrogen
protecting group. In certain embodiments, at least one instance of
R.sup.F is --C(.dbd.O)NHR.sup.a, wherein R.sup.a is substituted or
unsubstituted phenyl. In certain embodiments, at least one instance
of R.sup.F is --C(.dbd.O)NHR.sup.a, wherein R.sup.a is phenyl
substituted with one, two, three, four, or five substituents
independently selected from the group consisting of halogen and
substituted or unsubstituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.F is
--C(.dbd.O)NMeR.sup.a, wherein R.sup.a is substituted or
unsubstituted phenyl. In certain embodiments, at least one instance
of R.sup.F is --C(.dbd.O)NMeR.sup.a, wherein R.sup.a is phenyl
substituted with one, two, three, four, or five substituents
independently selected from the group consisting of halogen and
substituted or unsubstituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.F is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.F is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.F is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.F is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0251] In certain embodiments, at least one instance of R.sup.F is
halogen, substituted or unsubstituted C.sub.1-6 alkyl, or
--OR.sup.a. In certain embodiments, at least one instance of
R.sup.F is halogen, substituted or unsubstituted C.sub.1-6 alkyl,
or --OR.sup.a, wherein R.sup.a is hydrogen, substituted or
unsubstituted C.sub.1-6 alkyl, or an oxygen protecting group. In
certain embodiments, at least one instance of R.sup.F is halogen,
unsubstituted C.sub.1-6 alkyl, or --OR.sup.a, wherein R.sup.a is
unsubstituted C.sub.1-6 alkyl. In certain embodiments, at least one
instance of R.sup.F is --CH.sub.3 or Cl.
[0252] In certain embodiments, n is 0. In certain embodiments, n is
1. In certain embodiments, n is 2. In certain embodiments, n is 3.
In certain embodiments, n is 4. In certain embodiments, n is 5.
[0253] In certain embodiments, n is 1; and R.sup.F is
--C(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, n is 1; and
R.sup.F is --C(.dbd.O)N(R.sup.a).sub.2, wherein each instance of
R.sup.a is independently hydrogen, substituted or unsubstituted
C.sub.1-6 alkyl, substituted or unsubstituted phenyl, or a nitrogen
protecting group. In certain embodiments, n is 2; and each instance
of R.sup.F is independently halogen or substituted or unsubstituted
C.sub.1-6 alkyl. In certain embodiments, n is 2; and each instance
of R.sup.F is independently halogen or unsubstituted C.sub.1-6
alkyl (e.g., --CH.sub.3). In certain embodiments, n is 2; and each
instance of R.sup.F is independently halogen, substituted or
unsubstituted C.sub.1-6 alkyl, --OR.sup.a, or
--C(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, n is 2; and
each instance of R.sup.F is independently halogen, substituted or
unsubstituted C.sub.1-6 alkyl, --OR.sup.a, or
--C(.dbd.O)N(R.sup.a).sub.2, wherein each instance of R.sup.a is
independently hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, substituted or unsubstituted phenyl, an oxygen protecting
group when attached to an oxygen atom, or a nitrogen protecting
group when attached to a nitrogen atom.
[0254] In certain embodiments, the compound of Formula (II) is of
Formula (II-A):
##STR00109##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0255] each instance of R.sup.G is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and
[0256] k is 0, 1, 2, 3, 4, or 5.
[0257] Formula (II-A) includes as Ring D a phenyl ring that is
unsubstituted (e.g., when k is 0) or substituted with one or more
substituents R.sup.G (e.g., when k is 1, 2, 3, 4, or 5). In certain
embodiments, Ring D is of the formula:
##STR00110##
In certain embodiments, Ring D is the formula:
##STR00111##
In certain embodiments, Ring D is of the formula:
##STR00112##
In certain embodiments, Ring D is of the formula:
##STR00113##
In certain embodiments, at least two instances of R.sup.G are
different. In certain embodiments, all instances of R.sup.G are the
same. In certain embodiments, at least one instance of R.sup.G is
halogen. In certain embodiments, at least one instance of R.sup.G
is F. In certain embodiments, at least one instance of R.sup.G is
Cl. In certain embodiments, at least one instance of R.sup.G is Br.
In certain embodiments, at least one instance of R.sup.G is I
(iodine). In certain embodiments, at least one instance of R.sup.G
is substituted alkyl. In certain embodiments, at least one instance
of R.sup.G is unsubstituted alkyl. In certain embodiments, at least
one instance of R.sup.G is unsubstituted C.sub.1-6 alkyl. In
certain embodiments, all instances of R.sup.G are unsubstituted
C.sub.1-6 alkyl. In certain embodiments, at least one instance of
R.sup.G is substituted C.sub.1-6 alkyl. In certain embodiments, at
least one instance of R.sup.G is C.sub.1-6 alkyl substituted with
at least one halogen. In certain embodiments, at least one instance
of R.sup.G is --CH.sub.3. In certain embodiments, all instances of
R.sup.G are --CH.sub.3. In certain embodiments, at least one
instance of R.sup.G is substituted methyl. In certain embodiments,
at least one instance of R.sup.G is --CH.sub.2F. In certain
embodiments, at least one instance of R.sup.G is --CHF.sub.2. In
certain embodiments, at least one instance of R.sup.G is
--CF.sub.3. In certain embodiments, at least one instance of
R.sup.G is ethyl. In certain embodiments, at least one instance of
R.sup.G is propyl. In certain embodiments, at least one instance of
R.sup.G is butyl. In certain embodiments, at least one instance of
R.sup.G is pentyl. In certain embodiments, at least one instance of
R.sup.G is hexyl. In certain embodiments, at least one instance of
R.sup.G is Bn. In certain embodiments, at least one instance of
R.sup.G is substituted alkenyl. In certain embodiments, at least
one instance of R.sup.G is unsubstituted alkenyl. In certain
embodiments, at least one instance of R.sup.G is substituted
alkynyl. In certain embodiments, at least one instance of R.sup.G
is unsubstituted alkynyl. In certain embodiments, at least one
instance of R.sup.G is substituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.G is unsubstituted
carbocyclyl. In certain embodiments, at least one instance of
R.sup.G is saturated carbocyclyl. In certain embodiments, at least
one instance of R.sup.G is unsaturated carbocyclyl. In certain
embodiments, at least one instance of R.sup.G is monocyclic
carbocyclyl. In certain embodiments, at least one instance of
R.sup.G is 3- to 7-membered, monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.G is substituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.G is unsubstituted heterocyclyl. In certain embodiments, at
least one instance of R.sup.G is saturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.G is unsaturated
heterocyclyl. In certain embodiments, at least one instance of
R.sup.G is heterocyclyl, wherein one, two, or three atoms of the
heterocyclic ring system are independently selected from the group
consisting of nitrogen, oxygen, and sulfur. In certain embodiments,
at least one instance of R.sup.G is monocyclic heterocyclyl. In
certain embodiments, at least one instance of R.sup.G is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.G is substituted or unsubstituted
piperazinyl. In certain embodiments, at least one instance of
R.sup.G is of the formula:
##STR00114##
wherein R.sup.2 is H, substituted or unsubstituted C.sub.1-6 alkyl,
or a nitrogen protecting group. In certain embodiments, at least
one instance of R.sup.G is of the formula:
##STR00115##
In certain embodiments, at least one instance of R.sup.G is
substituted aryl. In certain embodiments, at least one instance of
R.sup.G is unsubstituted aryl. In certain embodiments, at least one
instance of R.sup.G is 6- to 10-membered aryl. In certain
embodiments, at least one instance of R.sup.G is substituted
phenyl. In certain embodiments, at least one instance of R.sup.G is
unsubstituted phenyl. In certain embodiments, at least one instance
of R.sup.G is substituted heteroaryl. In certain embodiments, at
least one instance of R.sup.G is unsubstituted heteroaryl. In
certain embodiments, at least one instance of R.sup.G is
heteroaryl, wherein one, two, three, or four atoms of the
heteroaryl ring system are independently selected from the group
consisting of nitrogen, oxygen, and sulfur. In certain embodiments,
at least one instance of R.sup.G is monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.G is
5-membered, monocyclic heteroaryl. In certain embodiments, at least
one instance of R.sup.G is 6-membered, monocyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.G is bicyclic
heteroaryl, wherein the point of attachment may be on any atom of
the bicyclic heteroaryl ring system, as valency permits. In certain
embodiments, at least one instance of R.sup.G is 9- or 10-membered,
bicyclic heteroaryl. In certain embodiments, at least one instance
of R.sup.G is --OR.sup.a. In certain embodiments, at least one
instance of R.sup.G is --OH. In certain embodiments, at least one
instance of R.sup.G is --O(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, at least one instance of R.sup.G is
--O--(CH.sub.2).sub.2-4--O-(substituted or unsubstituted C.sub.1-6
alkyl). In certain embodiments, at least one instance of R.sup.G is
--O--(CH.sub.2).sub.2--OMe. In certain embodiments, at least one
instance of R.sup.G is --OMe. In certain embodiments, at least one
instance of R.sup.G is --OEt. In certain embodiments, at least one
instance of R.sup.G is --OPr. In certain embodiments, at least one
instance of R.sup.G is --OBu. In certain embodiments, at least one
instance of R.sup.G is --OBn. In certain embodiments, at least one
instance of R.sup.G is --OPh. In certain embodiments, at least one
instance of R.sup.G is --SR.sup.a. In certain embodiments, at least
one instance of R.sup.G is --SH. In certain embodiments, at least
one instance of R.sup.G is --SMe. In certain embodiments, at least
one instance of R.sup.G is --N(R.sup.a).sub.2. In certain
embodiments, at least one instance of R.sup.G is
--N(R.sup.a).sub.2, wherein each instance of R.sup.a is
independently hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, or a nitrogen protecting group, or two instances of R.sup.a
are joined to form a substituted or unsubstituted, 3- to
7-membered, monocyclic heterocyclic ring. In certain embodiments,
at least one instance of R.sup.G is --NH.sub.2. In certain
embodiments, at least one instance of R.sup.G is --NHMe. In certain
embodiments, at least one instance of R.sup.G is --NMe.sub.2. In
certain embodiments, at least one instance of R.sup.G is --CN. In
certain embodiments, at least one instance of R.sup.G is --SCN. In
certain embodiments, at least one instance of R.sup.G is
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a, or
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.G is --C(.dbd.O)R.sup.a or
--C(.dbd.O)OR.sup.a. In certain embodiments, at least one instance
of R.sup.G is --C(.dbd.O)N(R.sup.a).sub.2. In certain embodiments,
at least one instance of R.sup.G is --C(.dbd.O)NMe.sub.2,
--C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In certain embodiments, at
least one instance of R.sup.G is --NO.sub.2. In certain
embodiments, at least one instance of R.sup.G is
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.G is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0258] In certain embodiments, at least one instance of R.sup.G is
--OR.sup.a, --N(R.sup.a).sub.2, or substituted or unsubstituted, 3-
to 7-membered, monocyclic heterocyclyl, wherein one, two, or three
atoms of the heterocyclic ring system are independently nitrogen,
oxygen, or sulfur.
[0259] In certain embodiments, k is 0. In certain embodiments, k is
1. In certain embodiments, k is 2. In certain embodiments, k is 3.
In certain embodiments, k is 4. In certain embodiments, k is 5.
[0260] In certain embodiments, k is 1; and R.sup.G is --OR.sup.a,
--N(R.sup.a).sub.2, or substituted or unsubstituted, 3- to
7-membered, monocyclic heterocyclyl, wherein one, two, or three
atoms of the heterocyclic ring system are independently nitrogen,
oxygen, or sulfur. In certain embodiments, k is 1; and R.sup.G is
--OR.sup.a, --N(R.sup.a).sub.2, or substituted or unsubstituted, 3-
to 7-membered, monocyclic heterocyclyl, wherein one, two, or three
atoms of the heterocyclic ring system are independently nitrogen,
oxygen, or sulfur; and each instance of R.sup.a is independently H,
substituted or unsubstituted C.sub.1-6 alkyl, an oxygen protecting
group when attached to an oxygen atom, or a nitrogen protecting
group when attached to a nitrogen group.
[0261] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00116##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0262] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00117##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0263] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00118##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0264] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00119##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0265] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00120##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0266] In certain embodiments, the compound of Formula II is of
Formula (II-B):
##STR00121##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0267] R.sup.H is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0268] each instance of R.sup.J is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0269] q is 0, 1, 2, 3, or 4; and
[0270] R.sup.K is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0271] In certain embodiments, a compound of Formula (II) is of
Formula (II-B), wherein when R.sup.C is hydrogen, R.sup.B is not
unsubstituted cyclopropyl or
##STR00122##
[0272] Formula (II-B) includes substituent R.sup.H on a nitrogen
atom. In certain embodiments, R.sup.H is H. In certain embodiments,
R.sup.H is not H. In certain embodiments, R.sup.H is substituted
acyl. In certain embodiments, R.sup.H is unsubstituted acyl. In
certain embodiments, R.sup.H is acetyl. In certain embodiments,
R.sup.H is unsubstituted C.sub.1-6 alkyl. In certain embodiments,
R.sup.H is substituted C.sub.1-6 alkyl. In certain embodiments,
R.sup.H is C.sub.1-6 alkyl substituted with at least one halogen.
In certain embodiments, R.sup.H is unsubstituted methyl. In certain
embodiments, R.sup.H is substituted methyl. In certain embodiments,
R.sup.H is --CH.sub.2F. In certain embodiments, R.sup.H is
--CHF.sub.2. In certain embodiments, R.sup.H is --CF.sub.3. In
certain embodiments, R.sup.H is ethyl. In certain embodiments,
R.sup.H is propyl. In certain embodiments, R.sup.H is butyl. In
certain embodiments, R.sup.H is pentyl. In certain embodiments,
R.sup.H is hexyl. In certain embodiments, R.sup.H is Bn. In certain
embodiments, R.sup.H is a nitrogen protecting group. In certain
embodiments, R.sup.H is Bn, Boc, Cbz, Fmoc, trifluoroacetyl,
triphenylmethyl, acetyl, or Ts. In certain embodiments, R.sup.H is
hydrogen or unsubstituted C.sub.1-6 alkyl.
[0273] Formula (II-B) includes as Ring E a phenyl ring that is
substituted with R.sup.K and optionally one or more substituents
R.sup.J. In certain embodiments, Ring E is of the formula:
##STR00123##
In certain embodiments, Ring E is of the formula:
##STR00124##
In certain embodiments, Ring E is of the formula:
##STR00125##
In certain embodiments, Ring E is of the formula:
##STR00126##
In certain embodiments, Ring E is of the formula:
##STR00127##
In certain embodiments, Ring E is of the formula:
##STR00128##
In certain embodiments, Ring E is of the formula:
##STR00129##
In certain embodiments, R.sup.K is H. In certain embodiments,
R.sup.K is halogen. In certain embodiments, R.sup.K is F. In
certain embodiments, R.sup.K is Cl. In certain embodiments, R.sup.K
is Br. In certain embodiments, R.sup.K is I (iodine). In certain
embodiments, R.sup.K is substituted alkyl. In certain embodiments,
R.sup.K is unsubstituted alkyl. In certain embodiments, R.sup.K is
unsubstituted C.sub.1-6 alkyl. In certain embodiments, R.sup.K is
substituted C.sub.1-6 alkyl. In certain embodiments, R.sup.K is
C.sub.1-6 alkyl substituted with at least one halogen. In certain
embodiments, R.sup.K is --CH.sub.3. In certain embodiments, R.sup.K
is substituted methyl. In certain embodiments, R.sup.K is
--CH.sub.2F. In certain embodiments, R.sup.K is --CHF.sub.2. In
certain embodiments, R.sup.K is --CF.sub.3. In certain embodiments,
R.sup.K is ethyl. In certain embodiments, R.sup.K is propyl. In
certain embodiments, R.sup.K is butyl. In certain embodiments,
R.sup.K is pentyl. In certain embodiments, R.sup.K is hexyl. In
certain embodiments, R.sup.K is Bn. In certain embodiments, R.sup.K
is substituted alkenyl. In certain embodiments, R.sup.K is
unsubstituted alkenyl. In certain embodiments, R.sup.K is
substituted alkynyl. In certain embodiments, R.sup.K is
unsubstituted alkynyl. In certain embodiments, R.sup.K is
substituted carbocyclyl. In certain embodiments, R.sup.K is
unsubstituted carbocyclyl. In certain embodiments, R.sup.K is
saturated carbocyclyl. In certain embodiments, R.sup.K is
unsaturated carbocyclyl. In certain embodiments, R.sup.K is
monocyclic carbocyclyl. In certain embodiments, R.sup.K is 3- to
7-membered, monocyclic carbocyclyl. In certain embodiments, R.sup.K
is substituted heterocyclyl. In certain embodiments, R.sup.K is
unsubstituted heterocyclyl. In certain embodiments, R.sup.K is
saturated heterocyclyl. In certain embodiments, R.sup.K is
unsaturated heterocyclyl. In certain embodiments, R.sup.K is
heterocyclyl, wherein one, two, or three atoms of the heterocyclic
ring system are independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In certain embodiments, R.sup.K is
monocyclic heterocyclyl. In certain embodiments, R.sup.K is 3- to
7-membered, monocyclic heterocyclyl. In certain embodiments,
R.sup.K is substituted aryl. In certain embodiments, R.sup.K is
unsubstituted aryl. In certain embodiments, R.sup.K is 6- to
10-membered aryl. In certain embodiments, R.sup.K is substituted
phenyl. In certain embodiments, R.sup.K is unsubstituted phenyl. In
certain embodiments, R.sup.K is substituted heteroaryl. In certain
embodiments, R.sup.K is unsubstituted heteroaryl. In certain
embodiments, R.sup.K is heteroaryl, wherein one, two, three, or
four atoms of the heteroaryl ring system are independently selected
from the group consisting of nitrogen, oxygen, and sulfur. In
certain embodiments, R.sup.K is monocyclic heteroaryl. In certain
embodiments, R.sup.K is 5-membered, monocyclic heteroaryl. In
certain embodiments, R.sup.K is not substituted imidazolyl. In
certain embodiments, R.sup.K is 6-membered, monocyclic heteroaryl.
In certain embodiments, R.sup.K is bicyclic heteroaryl, wherein the
point of attachment may be on any atom of the bicyclic heteroaryl
ring system, as valency permits. In certain embodiments, R.sup.K is
9- or 10-membered, bicyclic heteroaryl. In certain embodiments,
R.sup.K is --OR.sup.a. In certain embodiments, R.sup.K is --OH. In
certain embodiments, R.sup.K is --O(substituted or unsubstituted
C.sub.1-6 alkyl). In certain embodiments, R.sup.K is --OMe. In
certain embodiments, R.sup.K is --OEt. In certain embodiments,
R.sup.K is --OPr. In certain embodiments, R.sup.K is --OBu. In
certain embodiments, R.sup.K is --OBn. In certain embodiments,
R.sup.K is --OPh. In certain embodiments, R.sup.K is --SR.sup.a. In
certain embodiments, R.sup.K is --SH. In certain embodiments,
R.sup.K is --SMe. In certain embodiments, R.sup.K is
--N(R.sup.a).sub.2. In certain embodiments, R.sup.K is --NH.sub.2.
In certain embodiments, R.sup.K is --NHMe. In certain embodiments,
R.sup.K is --NMe.sub.2. In certain embodiments, R.sup.K is --CN. In
certain embodiments, R.sup.K is --SCN. In certain embodiments,
R.sup.K is --C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2. In certain embodiments,
R.sup.K is --C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain
embodiments, R.sup.K is --C(.dbd.O)N(R.sup.a).sub.2. In certain
embodiments, R.sup.K is --C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or
--C(.dbd.O)NH.sub.2. In certain embodiments, R.sup.K is --NO.sub.2.
In certain embodiments, R.sup.K is --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments,
R.sup.K is --OC(.dbd.O)R.sup.a, --OC(.dbd.O)OR.sup.a, or
--OC(.dbd.O)N(R.sup.a).sub.2.
[0274] In certain embodiments, R.sup.K is
--(CH.sub.2).sub.1-3-(Ring G), wherein Ring G is a substituted or
unsubstituted, 3- to 7-membered, monocyclic heterocyclic ring. In
certain embodiments, R.sup.K is --(CH.sub.2).sub.1-3-(substituted
or unsubstituted piperazinyl). In certain embodiments, R.sup.K is
of the formula:
##STR00130##
wherein R.sup.3 is H, substituted or unsubstituted C.sub.2-6 alkyl,
substituted methyl, or a nitrogen protecting group. In certain
embodiments, R.sup.K is of the formula:
##STR00131##
In certain embodiments, R.sup.K is not of the formula:
##STR00132##
In certain embodiments, R.sup.K is --(CH.sub.2).sub.1-3-(Ring G),
wherein Ring G is a substituted or unsubstituted oxetanyl,
substituted or unsubstituted azetidinyl, substituted or
unsubstituted tetrahydrofuranyl, substituted or unsubstituted
pyrrolidinyl, substituted or unsubstituted tetrahydropyranyl,
substituted or unsubstituted piperidinyl, or substituted or
unsubstituted morpholinyl ring.
[0275] Ring E of Formula (II-B) may include one or more
substituents R.sup.J. In certain embodiments, at least two
instances of R.sup.J are different. In certain embodiments, all
instances of R.sup.J are the same. In certain embodiments, at least
one instance of R.sup.J is halogen. In certain embodiments, at
least one instance of R.sup.J is F. In certain embodiments, at
least one instance of R.sup.J is Cl. In certain embodiments, at
least one instance of R.sup.J is Br. In certain embodiments, at
least one instance of R.sup.J is I (iodine). In certain
embodiments, at least one instance of R.sup.J is substituted alkyl.
In certain embodiments, at least one instance of R.sup.J is
unsubstituted alkyl. In certain embodiments, at least one instance
of R.sup.J is unsubstituted C.sub.1-6 alkyl. In certain
embodiments, all instances of R.sup.J are unsubstituted C.sub.1-6
alkyl. In certain embodiments, at least one instance of R.sup.J is
substituted C.sub.1-6 alkyl. In certain embodiments, at least one
instance of R.sup.J is C.sub.1-6 alkyl substituted with at least
one halogen. In certain embodiments, at least one instance of
R.sup.J is --CH.sub.3. In certain embodiments, all instances of
R.sup.J are --CH.sub.3. In certain embodiments, at least one
instance of R.sup.J is substituted methyl. In certain embodiments,
at least one instance of R.sup.J is --CH.sub.2F. In certain
embodiments, at least one instance of R.sup.J is --CHF.sub.2. In
certain embodiments, at least one instance of R.sup.J is
--CF.sub.3. In certain embodiments, at least one instance of
R.sup.J is ethyl. In certain embodiments, at least one instance of
R.sup.J is propyl. In certain embodiments, at least one instance of
R.sup.J is butyl. In certain embodiments, at least one instance of
R.sup.J is pentyl. In certain embodiments, at least one instance of
R.sup.J is hexyl. In certain embodiments, at least one instance of
R.sup.J is Bn. In certain embodiments, at least one instance of
R.sup.J is halogen or substituted or unsubstituted C.sub.1-6 alkyl.
In certain embodiments, at least one instance of R.sup.J is
substituted alkenyl. In certain embodiments, at least one instance
of R.sup.J is unsubstituted alkenyl. In certain embodiments, at
least one instance of R.sup.J is substituted alkynyl. In certain
embodiments, at least one instance of R.sup.J is unsubstituted
alkynyl. In certain embodiments, at least one instance of R.sup.J
is substituted carbocyclyl. In certain embodiments, at least one
instance of R.sup.J is unsubstituted carbocyclyl. In certain
embodiments, at least one instance of R.sup.J is saturated
carbocyclyl. In certain embodiments, at least one instance of
R.sup.J is unsaturated carbocyclyl. In certain embodiments, at
least one instance of R.sup.J is monocyclic carbocyclyl. In certain
embodiments, at least one instance of R.sup.J is 3- to 7-membered,
monocyclic carbocyclyl. In certain embodiments, at least one
instance of R.sup.J is substituted heterocyclyl. In certain
embodiments, at least one instance of R.sup.J is unsubstituted
heterocyclyl. In certain embodiments, at least one instance of
R.sup.J is saturated heterocyclyl. In certain embodiments, at least
one instance of R.sup.J is unsaturated heterocyclyl. In certain
embodiments, at least one instance of R.sup.J is heterocyclyl,
wherein one, two, or three atoms of the heterocyclic ring system
are independently selected from the group consisting of nitrogen,
oxygen, and sulfur. In certain embodiments, at least one instance
of R.sup.J is monocyclic heterocyclyl. In certain embodiments, at
least one instance of R.sup.J is 3- to 7-membered, monocyclic
heterocyclyl. In certain embodiments, at least one instance of
R.sup.J is substituted aryl. In certain embodiments, at least one
instance of R.sup.J is unsubstituted aryl. In certain embodiments,
at least one instance of R.sup.J is 6- to 10-membered aryl. In
certain embodiments, at least one instance of R.sup.J is
substituted phenyl. In certain embodiments, at least one instance
of R.sup.J is unsubstituted phenyl. In certain embodiments, at
least one instance of R.sup.J is substituted heteroaryl. In certain
embodiments, at least one instance of R.sup.J is unsubstituted
heteroaryl. In certain embodiments, at least one instance of
R.sup.J is heteroaryl, wherein one, two, three, or four atoms of
the heteroaryl ring system are independently selected from the
group consisting of nitrogen, oxygen, and sulfur. In certain
embodiments, at least one instance of R.sup.J is monocyclic
heteroaryl. In certain embodiments, at least one instance of
R.sup.J is 5-membered, monocyclic heteroaryl. In certain
embodiments, no instance of R.sup.J is substituted imidazolyl. In
certain embodiments, at least one instance of R.sup.J is
6-membered, monocyclic heteroaryl. In certain embodiments, at least
one instance of R.sup.J is bicyclic heteroaryl, wherein the point
of attachment may be on any atom of the bicyclic heteroaryl ring
system, as valency permits. In certain embodiments, at least one
instance of R.sup.J is 9- or 10-membered, bicyclic heteroaryl. In
certain embodiments, at least one instance of R.sup.J is
--OR.sup.a. In certain embodiments, at least one instance of
R.sup.J is --OH. In certain embodiments, at least one instance of
R.sup.J is --O(substituted or unsubstituted C.sub.1-6 alkyl). In
certain embodiments, at least one instance of R.sup.J is --OMe. In
certain embodiments, at least one instance of R.sup.J is --OEt. In
certain embodiments, at least one instance of R.sup.J is --OPr. In
certain embodiments, at least one instance of R.sup.J is --OBu. In
certain embodiments, at least one instance of R.sup.J is --OBn. In
certain embodiments, at least one instance of R.sup.J is --OPh. In
certain embodiments, at least one instance of R.sup.J is
--SR.sup.a. In certain embodiments, at least one instance of
R.sup.J is --SH. In certain embodiments, at least one instance of
R.sup.J is --SMe. In certain embodiments, at least one instance of
R.sup.J is --N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.J is --NH.sub.2. In certain embodiments, at least
one instance of R.sup.J is --NHMe. In certain embodiments, at least
one instance of R.sup.J is --NMe.sub.2. In certain embodiments, at
least one instance of R.sup.J is --CN. In certain embodiments, at
least one instance of R.sup.J is --SCN. In certain embodiments, at
least one instance of R.sup.J is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.J is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.J is --C(.dbd.O)N(R.sup.a).sub.2. In
certain embodiments, at least one instance of R.sup.J is
--C(.dbd.O)NMe.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NH.sub.2. In
certain embodiments, at least one instance of R.sup.J is
--NO.sub.2. In certain embodiments, at least one instance of
R.sup.J is --NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.J is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0276] In certain embodiments, at least one instance of R.sup.J is
halogen or substituted or unsubstituted C.sub.1-6 alkyl. In certain
embodiments, at least one instance of R.sup.J is halogen,
unsubstituted C.sub.1-6 alkyl, or C.sub.1-6 alkyl substituted with
at least one halogen.
[0277] In certain embodiments, q is 0. In certain embodiments, q is
1. In certain embodiments, q is 2. In certain embodiments, q is 3.
In certain embodiments, q is 4.
[0278] In certain embodiments, no instance of R.sup.J and R.sup.K
is substituted or unsubstituted heteroaryl. In certain embodiments,
no instance of R.sup.J and R.sup.K is substituted or unsubstituted
imidazolyl. In certain embodiments, no instance of R.sup.J and
R.sup.K is substituted imidazolyl.
[0279] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00133##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0280] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00134##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0281] In certain embodiments, the compound of Formula (II) is of
the formula:
##STR00135## ##STR00136##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0282] In certain embodiments, a compound of Formula (II) is not of
the formula:
##STR00137## ##STR00138##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, or tautomer thereof.
Compounds of Formula (III-A)
[0283] In another aspect, the present disclosure provides urea or
carbamate compounds of Formula (III-A) for use in the present
invention:
##STR00139##
and pharmaceutically acceptable salts, solvates, hydrates,
polymorphs, co-crystals, tautomers, stereoisomers, isotopically
labeled derivatives, and prodrugs thereof, wherein:
[0284] R.sup.G is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted
heteroaryl, or of the formula:
##STR00140##
[0285] each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2, or two
R.sup.A groups are joined to form a substituted or unsubstituted
carbocyclic ring, substituted or unsubstituted heterocyclic ring,
substituted or unsubstituted aryl ring, or substituted or
unsubstituted heteroaryl ring;
[0286] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or two
R.sup.a groups are joined to form a substituted or unsubstituted
heterocyclic or substituted or unsubstituted heteroaryl ring;
[0287] k is 0, 1, 2, 3, 4, or 5;
[0288] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0289] each of X.sup.A, X.sup.B, and X.sup.C is independently N or
CR.sup.X, wherein each instance of R.sup.X is independently
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0290] or: X.sup.B is CR.sup.X, and R.sup.G and R.sup.X of X.sup.B
are joined to form a substituted or unsubstituted heterocyclic or
substituted or unsubstituted heteroaryl ring;
[0291] R.sup.C is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0292] R.sup.D is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0293] Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0294] Z is a bond or --C(R.sup.Z).sub.2-, wherein each instance of
R.sup.Z is independently hydrogen, halogen, or substituted or
unsubstituted C.sub.1-6 alkyl;
[0295] each instance of R.sup.E is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aS(.dbd.O)R.sup.a,
--NR.sup.aS(.dbd.O)OR.sup.a, --NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and
[0296] m is 0, 1, 2, 3, 4, or 5.
[0297] In certain embodiments, a compound of Formula (III-A) is of
Formula (III):
##STR00141##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof, wherein:
[0298] each instance of R.sup.A is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0299] each instance of R.sup.a is independently hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl, a
nitrogen protecting group when attached to a nitrogen atom, an
oxygen protecting group when attached to an oxygen atom, or a
sulfur protecting group when attached to a sulfur atom, or two
R.sup.a groups are joined to form a substituted or unsubstituted
heterocyclic or substituted or unsubstituted heteroaryl ring;
[0300] k is 0, 1, 2, 3, 4, or 5;
[0301] R.sup.B is hydrogen, substituted or unsubstituted acyl,
substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen
protecting group;
[0302] each of X.sup.A, X.sup.B, and X.sup.C is independently N or
CR.sup.X, wherein each instance of R.sup.X is independently
hydrogen, halogen, substituted or unsubstituted alkyl, substituted
or unsubstituted alkenyl, substituted or unsubstituted alkynyl,
substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, --OR.sup.a,
--N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0303] R.sup.C is hydrogen, halogen, substituted or unsubstituted
alkyl, substituted or unsubstituted alkenyl, substituted or
unsubstituted alkynyl, substituted or unsubstituted carbocyclyl,
substituted or unsubstituted heterocyclyl, substituted or
unsubstituted aryl, substituted or unsubstituted heteroaryl,
--OR.sup.a, --N(R.sup.a).sub.2, --SR.sup.a, --CN, --SCN,
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a,
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, --C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2;
[0304] R.sup.D is hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, substituted or unsubstituted carbocyclyl, substituted or
unsubstituted heterocyclyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, or a nitrogen protecting
group;
[0305] Y is --O-- or --NR.sup.Y--, wherein R.sup.Y is hydrogen,
substituted or unsubstituted acyl, substituted or unsubstituted
C.sub.1-6 alkyl, or a nitrogen protecting group;
[0306] each instance of R.sup.E is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and
[0307] m is 0, 1, 2, 3, 4, or 5.
[0308] All embodiments of Ring A, Ring B, Ring C, X.sup.A, X.sup.B,
X.sup.C, Y, Z, R.sup.A, R.sup.B, R.sup.C, R.sup.D, R.sup.E,
R.sup.F, R.sup.G, R.sup.X, R.sup.Y, R.sup.Z, R.sup.a, k, m, and n
recited in subsection Compounds of Formula (III-A) (e.g., compounds
of Formula (III)) apply only to Formula (III-A) (e.g., Formula
(III)).
[0309] Formula (III-A) includes substituent R.sup.G. In certain
embodiments, R.sup.G is hydrogen. In certain embodiments, R.sup.G
is substituted or unsubstituted alkyl. In certain embodiments,
R.sup.G is substituted C.sub.1-6 alkyl (e.g., --CF.sub.3,
perfluoroethyl, perfluoropropyl, perfluorobutyl, Bn, or C.sub.1-6
alkyl substituted with at least one instance of halogen and/or
--OR.sup.a)). In certain embodiments, R.sup.G is C.sub.1-6 alkyl
substituted with at least one instance of --OR.sup.a, optionally
wherein R.sup.a is hydrogen or substituted or unsubstituted
C.sub.1-6 alkyl. In certain embodiments, R.sup.G is of the
formula:
##STR00142##
In certain embodiments, R.sup.G is unsubstituted C.sub.1-6 alkyl
(e.g., Me, Et, Pr, or Bu). In certain embodiments, R.sup.G is
substituted or unsubstituted alkenyl (e.g., substituted or
unsubstituted C.sub.1-6 alkenyl). In certain embodiments, R.sup.G
is substituted or unsubstituted alkynyl (e.g., substituted or
unsubstituted C.sub.1-6 alkynyl). In certain embodiments, R.sup.G
is substituted or unsubstituted carbocyclyl (e.g., substituted or
unsubstituted, monocyclic, 3- to 7-membered carbocyclyl). In
certain embodiments, R.sup.G is substituted or unsubstituted
heterocyclyl (e.g., substituted or unsubstituted, monocyclic, 5- to
6-membered heterocyclyl, wherein one, two, or three atoms in the
heterocyclic ring system are independently nitrogen, oxygen, or
sulfur). In certain embodiments, R.sup.G is substituted or
unsubstituted heteroaryl (e.g., substituted or unsubstituted,
monocyclic, 5- to 6-membered heteroaryl, wherein one, two, three,
or four atoms in the heteroaryl ring system are independently
nitrogen, oxygen, or sulfur). In certain embodiments, R.sup.G is
substituted or unsubstituted 2-pyridyl. In certain embodiments,
R.sup.G is substituted or unsubstituted 3-pyridyl. In certain
embodiments, R.sup.G is of the formula:
##STR00143##
wherein R.sup.a is hydrogen, halogen, substituted or unsubstituted
C.sub.1-6 alkyl, --OH, --O(substituted or unsubstituted C.sub.1-6
alkyl), or substituted or unsubstituted, monocyclic, 5- to
6-membered heterocyclyl, wherein one, two, or three atoms in the
heterocyclic ring system are independently nitrogen, oxygen, or
sulfur; and each instance of R.sup.b is independently hydrogen,
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OH, or
--O(substituted or unsubstituted C.sub.1-6 alkyl). In certain
embodiments, R.sup.G is of the formula:
##STR00144##
In certain embodiments, R is substituted or unsubstituted
4-pyridyl. In certain embodiments, R.sup.G is substituted or
unsubstituted 1-pyrazolyl. In certain embodiments, R.sup.G is
substituted or unsubstituted 3-pyrazolyl. In certain embodiments,
R.sup.G is substituted or unsubstituted 4-pyrazolyl. In certain
embodiments, R.sup.G is of the formula:
##STR00145##
wherein R.sup.a is hydrogen, substituted or unsubstituted C.sub.1-6
alkyl, a nitrogen protecting group, or -(substituted or
unsubstituted C.sub.1-6 alkylene)-(substituted or unsubstituted,
monocyclic, 5- to 6-membered heterocyclyl, wherein one, two, or
three atoms in the heterocyclic ring system are independently
nitrogen, oxygen, or sulfur); and each instance of R.sup.b is
independently hydrogen, halogen, substituted or unsubstituted
C.sub.1-6 alkyl, --OH, or --O(substituted or unsubstituted
C.sub.1-6 alkyl). In certain embodiments, R.sup.G is of the
formula:
##STR00146##
In certain embodiments, R.sup.G is substituted or unsubstituted
furanyl, substituted or unsubstituted thienyl, substituted or
unsubstituted pyrrolyl, substituted or unsubstituted imidazolyl,
substituted or unsubstituted oxazolyl, substituted or unsubstituted
isoxazolyl, substituted or unsubstituted thiazolyl, substituted or
unsubstituted isothiazolyl, or substituted or unsubstituted
tetrazolyl. In certain embodiments, R.sup.G is substituted or
unsubstituted pyrazinyl, substituted or unsubstituted pyrimidinyl,
or substituted or unsubstituted pyridazinyl. In certain
embodiments, R.sup.G is substituted or unsubstituted, bicyclic, 9-
to 10-membered heteroaryl, wherein one, two, three, or four atoms
in the heteroaryl ring system are independently nitrogen, oxygen,
or sulfur.
[0310] In certain embodiments, R.sup.G is of the formula:
##STR00147##
Ring A is unsubstituted (e.g., when k is 0) or substituted with one
or more substituents R.sup.A (e.g., when k is 1, 2, 3, 4, or 5). In
certain embodiments, Ring A is an unsubstituted phenyl ring. In
certain embodiments, Ring A is a substituted phenyl ring. In
certain embodiments, Ring A is of the formula:
##STR00148##
optionally wherein R.sup.A is substituted or unsubstituted,
monocyclic, 5- to 6-membered heterocyclic ring, wherein one or two
atoms in the heterocyclic ring system are independently nitrogen,
oxygen, or sulfur. In certain embodiments, Ring A is of the
formula:
##STR00149##
e.g., or
##STR00150##
In certain embodiments, Ring A is of the formula:
##STR00151##
In certain embodiments, Ring A is of the formula:
##STR00152##
optionally wherein R.sup.A is halogen, substituted or unsubstituted
C.sub.1-6 alkyl, or --OR.sup.a. In certain embodiments, Ring A is
of the formula:
##STR00153##
In certain embodiments, Ring A is of the formula:
##STR00154##
In certain embodiments, Ring A is of the formula:
##STR00155##
optionally wherein R.sup.A is halogen, substituted or unsubstituted
C.sub.1-6 alkyl, or --OR.sup.a. In certain embodiments, Ring A is
of the formula:
##STR00156##
In certain embodiments, Ring A is of the formula:
##STR00157##
optionally wherein each instance of R.sup.A is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, or substituted or unsubstituted,
monocyclic, 5- to 6-membered heterocyclic ring, wherein one or two
atoms in the heterocyclic ring system are independently nitrogen,
oxygen, or sulfur. In certain embodiments, Ring A is of the
formula:
##STR00158##
In certain embodiments, Ring A is of the formula:
##STR00159##
In certain embodiments, Ring A is of the formula:
##STR00160##
optionally wherein each instance of R.sup.A is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
or substituted or unsubstituted, monocyclic, 5- to 6-membered
heterocyclic ring, wherein one or two atoms in the heterocyclic
ring system are independently nitrogen, oxygen, or sulfur. In
certain embodiments, Ring A is of the formula:
##STR00161##
In certain embodiments, Ring A is of the formula:
##STR00162##
wherein the two instances of R.sup.A are joined to form a
substituted or unsubstituted carbocyclic ring (e.g., substituted or
unsubstituted, 3- to 7-membered, monocyclic carbocyclic ring),
substituted or unsubstituted heterocyclic ring (e.g., substituted
or unsubstituted, monocyclic, 5- to 6-membered heterocyclic ring,
wherein one or two atoms in the heterocyclic ring system are
independently nitrogen, oxygen, or sulfur), substituted or
unsubstituted aryl ring (e.g., substituted or unsubstituted phenyl
ring), or substituted or unsubstituted heteroaryl ring (e.g.,
substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl ring, wherein one or two atoms in the heteroaryl ring
system are independently nitrogen, oxygen, or sulfur). In certain
embodiments, Ring A is of the formula:
##STR00163##
In certain embodiments, Ring A is of the formula:
##STR00164##
optionally wherein each instance of R.sup.A is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
or substituted or unsubstituted, monocyclic, 5- to 6-membered
heterocyclic ring, wherein one or two atoms in the heterocyclic
ring system are independently nitrogen, oxygen, or sulfur. In
certain embodiments, Ring A is of the formula:
##STR00165##
In certain embodiments, Ring A is of the formula:
##STR00166##
wherein each instance of R.sup.A is independently --OR.sup.a. In
certain embodiments, Ring A is of the formula:
##STR00167##
wherein each instance of R.sup.A is independently --O(substituted
or unsubstituted alkyl). In certain embodiments, Ring A is of the
formula:
##STR00168##
In certain embodiments, Ring A is of the formula:
##STR00169##
[0311] In Formula (III-A), Ring A may include one or more
substituents R.sup.A. In certain embodiments, all instances of
R.sup.A are the same. In certain embodiments, at least two
instances of R.sup.A are different. In certain embodiments, at
least one instance of R.sup.A is halogen (e.g., F, Cl, Br, or I).
In certain embodiments, at least one instance of R.sup.A is
substituted or unsubstituted alkyl (e.g., substituted or
unsubstituted C.sub.1-6 alkyl). In certain embodiments, at least
one instance of R.sup.A is --CH.sub.3. In certain embodiments, at
least one instance of R.sup.A is --CF.sub.3, unsubstituted ethyl,
perfluoroethyl, unsubstituted propyl, perfluoropropyl,
unsubstituted butyl, perfluorobutyl, or Bn. In certain embodiments,
at least one instance of R.sup.A is substituted or unsubstituted
alkenyl (e.g., substituted or unsubstituted C.sub.1-6 alkenyl). In
certain embodiments, at least one instance of R.sup.A is
substituted or unsubstituted alkynyl (e.g., substituted or
unsubstituted C.sub.1-6 alkynyl). In certain embodiments, at least
one instance of R.sup.A is substituted or unsubstituted carbocyclyl
(e.g., substituted or unsubstituted, monocyclic, 3- to 7-membered
carbocyclyl). In certain embodiments, at least one instance of
R.sup.A is substituted or unsubstituted heterocyclyl (e.g.,
substituted or unsubstituted, monocyclic, 5- to 6-membered
heterocyclyl, wherein one, two, or three atoms in the heterocyclic
ring system are independently nitrogen, oxygen, or sulfur). In
certain embodiments, at least one instance of R.sup.A is of the
formula:
##STR00170##
In certain embodiments, at least one instance of R.sup.A is of the
formula:
##STR00171##
In certain embodiments, at least one instance of R is substituted
or unsubstituted aryl (e.g., substituted or unsubstituted, 6- to
10-membered aryl). In certain embodiments, at least one instance of
R.sup.A is substituted or unsubstituted phenyl. In certain
embodiments, at least one instance of R is substituted or
unsubstituted heteroaryl (e.g., substituted or unsubstituted,
monocyclic, 5- to 6-membered heteroaryl, wherein one, two, three,
or four atoms in the heteroaryl ring system are independently
nitrogen, oxygen, or sulfur). In certain embodiments, at least one
instance of R.sup.A is --OR.sup.a. In certain embodiments, at least
one instance of R.sup.A is --OH. In certain embodiments, at least
one instance of R.sup.A is --O(substituted or unsubstituted alkyl),
such as --O(substituted or unsubstituted C.sub.1-6 alkyl) (e.g.,
--OMe, --OEt, --OPr, --OBu, --OBn, or
##STR00172##
In certain embodiments, at least one instance of R.sup.A is
--O(substituted or unsubstituted phenyl) (e.g., --OPh)). In certain
embodiments, at least one instance of R.sup.A is --SR.sup.a (e.g.,
--SH, --S(substituted or unsubstituted C.sub.1-6 alkyl) (e.g.,
--SMe, --SEt, --SPr, --SBu, or --SBn), or --S(substituted or
unsubstituted phenyl) (e.g., --SPh)). In certain embodiments, at
least one instance of R.sup.A is --N(R.sup.a).sub.2 (e.g.,
--NH.sub.2, --NH(substituted or unsubstituted C.sub.1-6 alkyl)
(e.g., --NHMe), or --N(substituted or unsubstituted C.sub.1-6
alkyl)-(substituted or unsubstituted C.sub.1-6 alkyl) (e.g.,
--NMe.sub.2)). In certain embodiments, at least one instance of
R.sup.A is --CN, --SCN, or --NO.sub.2. In certain embodiments, at
least one instance of R.sup.A is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.A is
--C(.dbd.O)R.sup.a or --C(.dbd.O)OR.sup.a. In certain embodiments,
at least one instance of R.sup.A is --C(.dbd.O)N(R.sup.a).sub.2
(e.g., --C(.dbd.O)NH.sub.2, --C(.dbd.O)NHMe, --C(.dbd.O)NMe.sub.2,
or
##STR00173##
In certain embodiments, at least one instance of R.sup.A is
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.A is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0312] Each instance of R.sup.A, R.sup.C, R.sup.E, and R.sup.X may
independently include one or more substituents R.sup.a. In certain
embodiments, all instances of R.sup.a are the same. In certain
embodiments, at least two instances of R.sup.a are different. In
certain embodiments, at least one instance of R.sup.a is H. In
certain embodiments, each instance of R.sup.a is H. In certain
embodiments, at least one instance of R.sup.a is substituted or
unsubstituted acyl (e.g., acetyl). In certain embodiments, at least
one instance of R.sup.a is substituted or unsubstituted alkyl
(e.g., substituted or unsubstituted C.sub.1-6 alkyl). In certain
embodiments, at least one instance of R.sup.a is --CH.sub.3. In
certain embodiments, at least one instance of R.sup.a is
--CF.sub.3, unsubstituted ethyl, perfluoroethyl, unsubstituted
propyl, perfluoropropyl, unsubstituted butyl, perfluorobutyl, or
Bn. In certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted alkenyl (e.g., substituted or
unsubstituted C.sub.1-6 alkenyl). In certain embodiments, at least
one instance of R.sup.a is substituted or unsubstituted alkynyl
(e.g., substituted or unsubstituted C.sub.1-6 alkynyl). In certain
embodiments, at least one instance of R.sup.a is substituted or
unsubstituted carbocyclyl (e.g., substituted or unsubstituted,
monocyclic, 3- to 7-membered carbocyclyl). In certain embodiments,
at least one instance of R.sup.a is substituted or unsubstituted
heterocyclyl (e.g., substituted or unsubstituted, monocyclic, 5- to
6-membered heterocyclyl, wherein one, two, or three atoms in the
heterocyclic ring system are independently nitrogen, oxygen, or
sulfur). In certain embodiments, at least one instance of R.sup.a
is substituted or unsubstituted aryl (e.g., substituted or
unsubstituted, 6- to 10-membered aryl). In certain embodiments, at
least one instance of R.sup.a is substituted or unsubstituted
phenyl. In certain embodiments, at least one instance of R.sup.a is
substituted or unsubstituted heteroaryl (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heteroaryl, wherein
one, two, three, or four atoms in the heteroaryl ring system are
independently nitrogen, oxygen, or sulfur). In certain embodiments,
at least one instance of R.sup.a is a nitrogen protecting group
(e.g., Bn, Boc, Cbz, Fmoc, trifluoroacetyl, triphenylmethyl,
acetyl, or Ts) when attached to a nitrogen atom. In certain
embodiments, at least one instance of R.sup.a is an oxygen
protecting group (e.g., silyl, TBDPS, TBDMS, TIPS, TES, TMS, MOM,
THP, t-Bu, Bn, allyl, acetyl, pivaloyl, or benzoyl) when attached
to an oxygen atom. In certain embodiments, at least one instance of
R.sup.a is a sulfur protecting group (e.g., acetamidomethyl, t-Bu,
3-nitro-2-pyridine sulfenyl, 2-pyridine-sulfenyl, or
triphenylmethyl) when attached to a sulfur atom. In certain
embodiments, two instances of R.sup.a are joined to form a
substituted or unsubstituted heterocyclic ring (e.g., substituted
or unsubstituted, monocyclic, 5- to 6-membered heterocyclic ring,
wherein one, two, or three atoms in the heterocyclic ring system
are independently nitrogen, oxygen, or sulfur). In certain
embodiments, two instances of R.sup.a are joined to form a
substituted or unsubstituted heteroaryl ring (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heteroaryl ring,
wherein one, two, three, or four atoms in the heteroaryl ring
system are independently nitrogen, oxygen, or sulfur).
[0313] In certain embodiments, k is 0. In certain embodiments, k is
1. In certain embodiments, k is 2. In certain embodiments, k is 3.
In certain embodiments, k is 4. In certain embodiments, k is 5.
[0314] Formula (III-A) includes substituent R.sup.B on the nitrogen
atom that connects Rings A and B. In certain embodiments, R.sup.B
is hydrogen. In certain embodiments, R.sup.B is substituted or
unsubstituted acyl (e.g., acetyl). In certain embodiments, R.sup.B
is substituted or unsubstituted C.sub.1-6 alkyl (e.g., --CH.sub.3,
--CF.sub.3, unsubstituted ethyl, perfluoroethyl, unsubstituted
propyl, perfluoropropyl, unsubstituted butyl, perfluorobutyl, or
Bn). In certain embodiments, R.sup.B is a nitrogen protecting group
(e.g., Bn, Boc, Cbz, Fmoc, trifluoroacetyl, triphenylmethyl,
acetyl, or Ts).
[0315] Formula (III-A) includes a heteroaryl ring as Ring B that
includes moieties X.sup.A, X.sup.B, and X.sup.C in the heteroaryl
ring system. In certain embodiments, X.sup.A is CR.sup.X, and each
of X.sup.B and X.sup.C is N. In certain embodiments, X.sup.A is CH,
and each of X.sup.B and X.sup.C is N. In certain embodiments,
X.sup.B is CR.sup.X, and each of X.sup.A and X.sup.C is N. In
certain embodiments, X.sup.B is CH, and each of X.sup.A and X.sup.C
is N. In certain embodiments, X.sup.C is CR.sup.X, and each of
X.sup.A and X.sup.B is N. In certain embodiments, X.sup.C is CH,
and each of X.sup.A and X.sup.B is N. In certain embodiments,
X.sup.A is N, and each of X.sup.B and X.sup.C is independently
CR.sup.X. In certain embodiments, X.sup.A is N, and each of X.sup.B
and X.sup.C is CH. In certain embodiments, X.sup.B is N, and each
of X.sup.A and X.sup.C is independently CR.sup.X. In certain
embodiments, X.sup.B is N, and each of X.sup.A and X.sup.C is CH.
In certain embodiments, X.sup.C is N, and each of X.sup.A and
X.sup.B is independently CR.sup.X. In certain embodiments, X.sup.C
is N, and each of X.sup.A and X.sup.B is CH. In certain
embodiments, each of X.sup.A, X.sup.B, and X.sup.C is independently
CR.sup.X. In certain embodiments, each of X.sup.A, X.sup.B, and
X.sup.C is CH.
[0316] In certain embodiments, X.sup.B is CR.sup.X, and R.sup.G and
R.sup.X of X.sup.B are joined to form a substituted or
unsubstituted heterocyclic ring (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heterocyclic ring,
wherein one or two atoms in the heterocyclic ring system are
independently nitrogen, oxygen, or sulfur, further wherein at least
one atom in the heterocyclic ring system is nitrogen). In certain
embodiments, X.sup.B is CR.sup.X, and R and R.sup.X of X.sup.B are
joined to form a substituted or unsubstituted heteroaryl ring
(e.g., substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl ring, wherein one or two atoms in the heterocyclic ring
system are independently nitrogen, oxygen, or sulfur, further
wherein at least one atom in the heteroaryl ring system is
nitrogen). In certain embodiments, X.sup.B is CR.sup.X, and R.sup.G
and R.sup.X of X.sup.B are joined to form substituted or
unsubstituted pyrrolyl ring.
[0317] In certain embodiments, all instances of R.sup.X are the
same. In certain embodiments, at least two instances of R.sup.X are
different. In certain embodiments, at least one instance of R.sup.X
is hydrogen. In certain embodiments, at least one instance of
R.sup.X is halogen (e.g., F, Cl, Br, or I). In certain embodiments,
at least one instance of R.sup.X is substituted or unsubstituted
alkyl (e.g., substituted or unsubstituted C.sub.1-6 alkyl). In
certain embodiments, at least one instance of R.sup.X is
--CH.sub.3. In certain embodiments, at least one instance of
R.sup.X is --CF.sub.3, unsubstituted ethyl, perfluoroethyl,
unsubstituted propyl, perfluoropropyl, unsubstituted butyl,
perfluorobutyl, or Bn. In certain embodiments, at least one
instance of R.sup.X is substituted or unsubstituted alkenyl (e.g.,
substituted or unsubstituted C.sub.1-6 alkenyl). In certain
embodiments, at least one instance of R.sup.X is substituted or
unsubstituted alkynyl (e.g., substituted or unsubstituted C.sub.1-6
alkynyl). In certain embodiments, at least one instance of Rx is
substituted or unsubstituted carbocyclyl (e.g., substituted or
unsubstituted, monocyclic, 3- to 7-membered carbocyclyl). In
certain embodiments, at least one instance of R.sup.X is
substituted or unsubstituted heterocyclyl (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heterocyclyl, wherein
one, two, or three atoms in the heterocyclic ring system are
independently nitrogen, oxygen, or sulfur). In certain embodiments,
at least one instance of R.sup.X is substituted or unsubstituted
aryl (e.g., substituted or unsubstituted, 6- to 10-membered aryl).
In certain embodiments, at least one instance of R.sup.X is
substituted or unsubstituted phenyl. In certain embodiments, at
least one instance of R.sup.X is substituted or unsubstituted
heteroaryl (e.g., substituted or unsubstituted, monocyclic, 5- to
6-membered heteroaryl, wherein one, two, three, or four atoms in
the heteroaryl ring system are independently nitrogen, oxygen, or
sulfur). In certain embodiments, at least one instance of R.sup.X
is --OR.sup.a (e.g., --OH, --O(substituted or unsubstituted
C.sub.1-6 alkyl) (e.g., --OMe, --OEt, --OPr, --OBu, or --OBn), or
--O(substituted or unsubstituted phenyl) (e.g., --OPh)). In certain
embodiments, at least one instance of R.sup.X is --SR.sup.a (e.g.,
--SH, --S(substituted or unsubstituted C.sub.1-6 alkyl) (e.g.,
--SMe, --SEt, --SPr, --SBu, or --SBn), or --S(substituted or
unsubstituted phenyl) (e.g., --SPh)). In certain embodiments, at
least one instance of R.sup.X is --N(R.sup.a).sub.2 (e.g.,
--NH.sub.2, --NH(substituted or unsubstituted C.sub.1-6 alkyl)
(e.g., --NHMe), or --N(substituted or unsubstituted C.sub.1-6
alkyl)-(substituted or unsubstituted C.sub.1-6 alkyl) (e.g.,
--NMe.sub.2)). In certain embodiments, at least one instance of
R.sup.X is --CN, --SCN, or --NO.sub.2. In certain embodiments, at
least one instance of R.sup.X is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.X is
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a, or
--C(.dbd.O)N(R.sup.a).sub.2 (e.g., --C(.dbd.O)NH.sub.2,
--C(.dbd.O)NHMe, or --C(.dbd.O)NMe.sub.2). In certain embodiments,
at least one instance of R.sup.X is --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.X is --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2.
[0318] Formula (III-A) includes substituent R.sup.C on Ring B. In
certain embodiments, R.sup.C is hydrogen. In certain embodiments,
R.sup.C is halogen (e.g., F, Cl, Br, or I). In certain embodiments,
R.sup.C is substituted or unsubstituted alkyl (e.g., substituted or
unsubstituted C.sub.1-6 alkyl). In certain embodiments, R.sup.C is
--CH.sub.3. In certain embodiments, R.sup.C is --CF.sub.3,
unsubstituted ethyl, perfluoroethyl, unsubstituted propyl,
perfluoropropyl, unsubstituted butyl, perfluorobutyl, or Bn. In
certain embodiments, R.sup.C is substituted or unsubstituted
alkenyl (e.g., substituted or unsubstituted C.sub.1-6 alkenyl). In
certain embodiments, R.sup.C is substituted or unsubstituted
alkynyl (e.g., substituted or unsubstituted C.sub.1-6 alkynyl). In
certain embodiments, R.sup.C is substituted or unsubstituted
carbocyclyl (e.g., substituted or unsubstituted, monocyclic, 3- to
7-membered carbocyclyl). In certain embodiments, R.sup.C is
substituted or unsubstituted heterocyclyl (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heterocyclyl, wherein
one, two, or three atoms in the heterocyclic ring system are
independently nitrogen, oxygen, or sulfur). In certain embodiments,
R.sup.C is substituted or unsubstituted aryl (e.g., substituted or
unsubstituted, 6- to 10-membered aryl). In certain embodiments,
R.sup.C is substituted or unsubstituted phenyl. In certain
embodiments, R.sup.C is substituted or unsubstituted heteroaryl
(e.g., substituted or unsubstituted, monocyclic, 5- to 6-membered
heteroaryl, wherein one, two, three, or four atoms in the
heteroaryl ring system are independently nitrogen, oxygen, or
sulfur). In certain embodiments, R.sup.C is --OR.sup.a (e.g., --OH,
--O(substituted or unsubstituted C.sub.1-6 alkyl) (e.g., --OMe,
--OEt, --OPr, --OBu, or --OBn), or --O(substituted or unsubstituted
phenyl) (e.g., --OPh)). In certain embodiments, R.sup.C is
--SR.sup.a(e.g., --SH, --S(substituted or unsubstituted C.sub.1-6
alkyl) (e.g., --SMe, --SEt, --SPr, --SBu, or --SBn), or
--S(substituted or unsubstituted phenyl) (e.g., --SPh)). In certain
embodiments, R.sup.C is --N(R.sup.a).sub.2 (e.g., --NH.sub.2,
--NH(substituted or unsubstituted C.sub.1-6 alkyl) (e.g., --NHMe),
or --N(substituted or unsubstituted C.sub.1-6 alkyl)-(substituted
or unsubstituted C.sub.1-6 alkyl) (e.g., --NMe.sub.2)). In certain
embodiments, R.sup.C is --CN, --SCN, or --NO.sub.2. In certain
embodiments, R.sup.C is --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, or --C(.dbd.NR.sup.a)N(R.sup.a).sub.2.
In certain embodiments, R.sup.C is --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, or --C(.dbd.O)N(R.sup.a).sub.2 (e.g.,
--C(.dbd.O)NH.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NMe.sub.2). In
certain embodiments, R.sup.C is --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, or
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments,
R.sup.C is --OC(.dbd.O)R.sup.a, --OC(.dbd.O)OR.sup.a, or
--OC(.dbd.O)N(R.sup.a).sub.2.
[0319] Formula (III-A) includes substituent R.sup.D on a nitrogen
atom of the urea or carbamate moiety. In certain embodiments,
R.sup.D is hydrogen. In certain embodiments, R.sup.D is substituted
or unsubstituted alkyl, such as substituted or unsubstituted
C.sub.1-6 alkyl (e.g., --CH.sub.3, --CF.sub.3, unsubstituted ethyl,
perfluoroethyl, unsubstituted propyl, perfluoropropyl,
unsubstituted butyl, perfluorobutyl, or Bn). In certain
embodiments, R.sup.D is substituted or unsubstituted alkenyl (e.g.,
substituted or unsubstituted C.sub.1-6 alkenyl). In certain
embodiments, R.sup.D is substituted or unsubstituted alkynyl (e.g.,
substituted or unsubstituted C.sub.1-6 alkynyl). In certain
embodiments, R.sup.D is substituted or unsubstituted carbocyclyl
(e.g., substituted or unsubstituted, monocyclic, 3- to 7-membered
carbocyclyl). In certain embodiments, R.sup.D is substituted or
unsubstituted heterocyclyl (e.g., substituted or unsubstituted,
monocyclic, 5- to 6-membered heterocyclyl, wherein one, two, or
three atoms in the heterocyclic ring system are independently
nitrogen, oxygen, or sulfur). In certain embodiments, R.sup.D is
substituted or unsubstituted oxetanyl, substituted or unsubstituted
azetidinyl, substituted or unsubstituted tetrahydrofuranyl,
substituted or unsubstituted tetrahydropyranyl, substituted or
unsubstituted pyrrolidinyl, substituted or unsubstituted
piperidinyl, substituted or unsubstituted piperazinyl, or
substituted or unsubstituted morpholinyl. In certain embodiments,
R.sup.D is of the formula:
##STR00174##
In certain embodiments, R.sup.D is substituted or unsubstituted
aryl (e.g., substituted or unsubstituted, 6- to 10-membered aryl).
In certain embodiments, R.sup.D is substituted or unsubstituted
phenyl. In certain embodiments, R.sup.D is of the formula:
##STR00175##
wherein each instance of R.sup.F is independently halogen,
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, substituted or
unsubstituted carbocyclyl, substituted or unsubstituted
heterocyclyl, substituted or unsubstituted aryl, substituted or
unsubstituted heteroaryl, --OR.sup.a, --N(R.sup.a).sub.2,
--SR.sup.a, --CN, --SCN, --C(.dbd.NR.sup.a)R.sup.a,
--C(.dbd.NR.sup.a)OR.sup.a, --C(.dbd.NR.sup.a)N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NO.sub.2,
--NR.sup.aC(.dbd.O)R.sup.a, --NR.sup.aC(.dbd.O)OR.sup.a,
--NR.sup.aC(.dbd.O)N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, or --OC(.dbd.O)N(R.sup.a).sub.2; and n is 0,
1, 2, 3, 4, or 5. In certain embodiments, R.sup.D is of the
formula:
##STR00176##
(e.g.,
##STR00177##
In certain embodiments, R.sup.D is of the formula:
##STR00178##
(e.g.,
##STR00179##
In certain embodiments, R.sup.D is of the formula:
##STR00180##
e.g.,
##STR00181##
(e.g.,
##STR00182##
In certain embodiments, R.sup.D is substituted or unsubstituted
heteroaryl (e.g., substituted or unsubstituted, monocyclic, 5- to
6-membered heteroaryl, wherein one, two, three, or four atoms in
the heteroaryl ring system are independently nitrogen, oxygen, or
sulfur). In certain embodiments, R is substituted or unsubstituted
1-pyrazolyl, substituted or unsubstituted 3-pyrazolyl, or
substituted or unsubstituted 4-pyrazolyl (e.g.,
##STR00183##
In certain embodiments, R.sup.D is substituted or unsubstituted
furanyl, substituted or unsubstituted thienyl, substituted or
unsubstituted pyrrolyl, substituted or unsubstituted imidazolyl,
substituted or unsubstituted oxazolyl, substituted or unsubstituted
isoxazolyl, substituted or unsubstituted thiazolyl, substituted or
unsubstituted isothiazolyl, or substituted or unsubstituted
tetrazolyl. In certain embodiments, R.sup.D is substituted or
unsubstituted pyridyl, substituted or unsubstituted pyrazinyl,
substituted or unsubstituted pyrimidinyl, or substituted or
unsubstituted pyridazinyl.
[0320] In certain embodiments, R.sup.D is a nitrogen protecting
group (e.g., Bn, Boc, Cbz, Fmoc, trifluoroacetyl, triphenylmethyl,
acetyl, or Ts).
[0321] Formula (III-A) includes divalent moiety Y. In certain
embodiments, Y is --O--. In certain embodiments, Y is --NR.sup.Y--.
In certain embodiments, Y is --NH--.
[0322] In certain embodiments, R.sup.Y is hydrogen. In certain
embodiments, R.sup.Y is substituted or unsubstituted acyl (e.g.,
acetyl). In certain embodiments, R is substituted or unsubstituted
C.sub.1-6 alkyl (e.g., --CH.sub.3, --CF.sub.3, unsubstituted ethyl,
perfluoroethyl, unsubstituted propyl, perfluoropropyl,
unsubstituted butyl, perfluorobutyl, or Bn). In certain
embodiments, R.sup.Y is a nitrogen protecting group (e.g., Bn, Boc,
Cbz, Fmoc, trifluoroacetyl, triphenylmethyl, acetyl, or Ts).
[0323] Formula (III-A) includes divalent moiety Z. In certain
embodiments, Z is a bond. In certain embodiments, Z is
--C(R.sup.Z).sub.2--. In certain embodiments, Z is --CH.sub.2--. In
certain embodiments, Z is --CHF-- or --CF.sub.2--.
[0324] In certain embodiments, the two instances of R.sup.Z are the
same. In certain embodiments, the two instances of R.sup.Z are not
the same. In certain embodiments, at least one instance of R.sup.Z
is hydrogen. In certain embodiments, each instance of R.sup.Z is
hydrogen. In certain embodiments, at least one instance of R.sup.Z
is halogen (e.g., F, Cl, Br, or I). In certain embodiments, at
least one instance of R.sup.Z is substituted or unsubstituted
C.sub.1-6 alkyl (e.g., --CH.sub.3, --CF.sub.3, unsubstituted ethyl,
perfluoroethyl, unsubstituted propyl, perfluoropropyl,
unsubstituted butyl, perfluorobutyl, or Bn).
[0325] In certain embodiments, --Y--Z-- is --N(R.sup.Y)--. In
certain embodiments, --Y--Z-- is --NH--. In certain embodiments,
--Y--Z-- is --N(Me)-. In certain embodiments, --Y--Z-- is --O--. In
certain embodiments, --Y--Z-- is --N(R.sup.Y)--C(R.sup.Z).sub.2--
(e.g., --N(R.sup.Y)--CH.sub.2--). In certain embodiments, --Y--Z--
is --NH--CH.sub.2--. In certain embodiments, --Y--Z-- is
--N(Me)-CH.sub.2--. In certain embodiments, --Y--Z-- is
--O--C(R.sup.Z).sub.2-- (e.g., --O--CH.sub.2--).
[0326] Formula (III-A) includes a phenyl ring as Ring C, which is
unsubstituted (e.g., when m is 0) or substituted with one or more
substituents R.sup.E (e.g., when m is 1, 2, 3, 4, or 5). In certain
embodiments, Ring C is an unsubstituted phenyl ring. In certain
embodiments, Ring C is a substituted phenyl ring. In certain
embodiments, Ring C is of the formula:
##STR00184##
optionally wherein R.sup.E is halogen, substituted or unsubstituted
C.sub.1-6 alkyl, --OR.sup.a, --N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00185##
In certain embodiments, Ring C is of the formula:
##STR00186##
optionally wherein R.sup.E is halogen, substituted or unsubstituted
C.sub.1-6 alkyl, --OR.sup.a, --N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00187##
In certain embodiments, Ring C is of the formula:
##STR00188##
optionally wherein R.sup.E is halogen, substituted or unsubstituted
C.sub.1-6 alkyl, --OR.sup.a, --N(R.sup.a).sub.2,
--C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00189##
In certain embodiments, Ring C is of the formula:
##STR00190##
In certain embodiments, Ring C is of the formula:
##STR00191##
optionally wherein each instance of R.sup.E is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
--N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00192##
In certain embodiments, Ring C is of the formula:
##STR00193##
optionally wherein each instance of R.sup.E is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
--N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00194##
In certain embodiments, Ring C is of the formula:
##STR00195##
In certain embodiments, Ring C is of the formula:
##STR00196##
wherein each instance of R.sup.E is independently substituted or
unsubstituted alkyl. In certain embodiments, Ring C is of the
formula:
##STR00197##
wherein each instance of R.sup.E is independently halogen,
substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
--N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00198##
In certain embodiments, Ring C is of the formula:
##STR00199##
In certain embodiments, Ring C is of the formula:
##STR00200##
In certain embodiments, Ring C is of the formula:
##STR00201##
In certain embodiments, Ring C is of the formula:
##STR00202##
In certain embodiments, Ring C is of the formula:
##STR00203##
In certain embodiments, Ring C is of the formula:
##STR00204##
optionally wherein each instance of R.sup.E is independently
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OR.sup.a,
--N(R.sup.a).sub.2, --C(.dbd.O)R.sup.a, --C(.dbd.O)OR.sup.a,
--C(.dbd.O)N(R.sup.a).sub.2, --NR.sup.aC(.dbd.O)R.sup.a,
--NR.sup.aC(.dbd.O)OR.sup.a, --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O)R.sup.a, --NR.sup.aS(.dbd.O)OR.sup.a,
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2,
--NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a,
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, --OC(.dbd.O)R.sup.a,
--OC(.dbd.O)OR.sup.a, --OC(.dbd.O)N(R.sup.a).sub.2, --CN, --SCN, or
--NO.sub.2. In certain embodiments, Ring C is of the formula:
##STR00205##
In certain embodiments, Ring C is of the formula:
##STR00206##
[0327] In Formula (III-A), Ring C may include one or more
substituents R.sup.E. In certain embodiments, all instances of
R.sup.E are the same. In certain embodiments, at least two
instances of R.sup.E are different. In certain embodiments, at
least one instance of R.sup.E is halogen (e.g., F, Cl, Br, or I).
In certain embodiments, at least one instance of R.sup.E is
substituted or unsubstituted alkyl (e.g., substituted or
unsubstituted C.sub.1-6 alkyl). In certain embodiments, at least
one instance of R.sup.E is --CH.sub.3. In certain embodiments, at
least one instance of R.sup.E is --CF.sub.3, unsubstituted ethyl,
perfluoroethyl, unsubstituted propyl, perfluoropropyl,
unsubstituted butyl, perfluorobutyl, or Bn. In certain embodiments,
at least one instance of R.sup.E is substituted or unsubstituted
alkenyl (e.g., substituted or unsubstituted C.sub.1-6 alkenyl). In
certain embodiments, at least one instance of R.sup.E is
substituted or unsubstituted alkynyl (e.g., substituted or
unsubstituted C.sub.1-6 alkynyl). In certain embodiments, at least
one instance of R.sup.E is substituted or unsubstituted carbocyclyl
(e.g., substituted or unsubstituted, monocyclic, 3- to 7-membered
carbocyclyl). In certain embodiments, at least one instance of
R.sup.E is substituted or unsubstituted heterocyclyl (e.g.,
substituted or unsubstituted, monocyclic, 5- to 6-membered
heterocyclyl, wherein one, two, or three atoms in the heterocyclic
ring system are independently nitrogen, oxygen, or sulfur). In
certain embodiments, at least one instance of R.sup.E is
substituted or unsubstituted aryl (e.g., substituted or
unsubstituted, 6- to 10-membered aryl). In certain embodiments, at
least one instance of R.sup.E is substituted or unsubstituted
phenyl. In certain embodiments, at least one instance of R.sup.E is
substituted or unsubstituted heteroaryl (e.g., substituted or
unsubstituted, monocyclic, 5- to 6-membered heteroaryl, wherein
one, two, three, or four atoms in the heteroaryl ring system are
independently nitrogen, oxygen, or sulfur). In certain embodiments,
at least one instance of R.sup.E is --OR.sup.a (e.g., --OH,
--O(substituted or unsubstituted C.sub.1-6 alkyl) (e.g., --OMe,
--OEt, --OPr, --OBu, or --OBn), or --O(substituted or unsubstituted
phenyl) (e.g., --OPh)). In certain embodiments, at least one
instance of R.sup.E is --SR.sup.a (e.g., --SH, --S(substituted or
unsubstituted C.sub.1-6 alkyl) (e.g., --SMe, --SEt, --SPr, --SBu,
or -SBn), or --S(substituted or unsubstituted phenyl) (e.g.,
--SPh)). In certain embodiments, at least one instance of R.sup.E
is --N(R.sup.a).sub.2 (e.g., --NH.sub.2, --NH(substituted or
unsubstituted C.sub.1-6 alkyl) (e.g., --NHMe), or --N(substituted
or unsubstituted C.sub.1-6 alkyl)-(substituted or unsubstituted
C.sub.1-6 alkyl) (e.g., --NMe.sub.2)). In certain embodiments, at
least one instance of R.sup.E is --CN, --SCN, or --NO.sub.2. In
certain embodiments, at least one instance of R.sup.E is
--C(.dbd.NR.sup.a)R.sup.a, --C(.dbd.NR.sup.a)OR.sup.a, or
--C(.dbd.NR.sup.a)N(R.sup.a).sub.2. In certain embodiments, at
least one instance of R.sup.E is --C(.dbd.O)R.sup.a,
--C(.dbd.O)OR.sup.a, or --C(.dbd.O)N(R.sup.a).sub.2 (e.g.,
--C(.dbd.O)NH.sub.2, --C(.dbd.O)NHMe, or --C(.dbd.O)NMe.sub.2). In
certain embodiments, at least one instance of R.sup.E is
--NR.sup.aC(.dbd.O)R.sup.a, optionally wherein each instance of
R.sup.a is independently H, substituted or unsubstituted C.sub.1-6
alkyl, substituted or unsubstituted phenyl, or a nitrogen
protecting group when attached to a nitrogen atom. In certain
embodiments, at least one instance of R.sup.E is
--NHC(.dbd.O)R.sup.a, wherein R.sup.a is substituted or
unsubstituted phenyl. In certain embodiments, at least one instance
of R.sup.E is of the formula:
##STR00207##
optionally wherein each instance of R.sup.C is independently H,
halogen, substituted or unsubstituted C.sub.1-6 alkyl, --OH, or
--O(substituted or unsubstituted C.sub.1-6 alkyl). In certain
embodiments, at least one instance of R.sup.E is of the
formula:
##STR00208##
(e.g.,
##STR00209##
In certain embodiments, at least one instance of R.sup.E is
--NR.sup.aC(.dbd.O)OR.sup.a or --NR.sup.aC(.dbd.O)N(R.sup.a).sub.2.
In certain embodiments, at least one instance of R.sup.E is
--OC(.dbd.O)R.sup.a, --OC(.dbd.O)OR.sup.a, or
--OC(.dbd.O)N(R.sup.a).sub.2. In certain embodiments, at least one
instance of R.sup.E is --NR.sup.aS(.dbd.O)R.sup.a,
--NR.sup.aS(.dbd.O)OR.sup.a, or
--NR.sup.aS(.dbd.O)N(R.sup.a).sub.2, optionally wherein each
instance of R.sup.a is independently H, substituted or
unsubstituted C.sub.1-6 alkyl, nitrogen protecting group when
attached to a nitrogen atom, or an oxygen protecting group when
attached to an oxygen atom. In certain embodiments, at least one
instance of R.sup.E is --NR.sup.aS(.dbd.O).sub.2R.sup.a,
--NR.sup.aS(.dbd.O).sub.2OR.sup.a, or
--NR.sup.aS(.dbd.O).sub.2N(R.sup.a).sub.2, optionally wherein each
instance of R.sup.a is independently H, substituted or
unsubstituted C.sub.1-6 alkyl, nitrogen protecting group when
attached to a nitrogen atom, or an oxygen protecting group when
attached to an oxygen atom. In certain embodiments, at least one
instance of R.sup.E is --NHS(.dbd.O).sub.2R.sup.a, optionally
wherein R.sup.a is substituted or unsubstituted C.sub.1-6 alkyl. In
certain embodiments, at least one instance of R.sup.E is
--NHS(.dbd.O).sub.2Me.
[0328] In certain embodiments, m is 0. In certain embodiments, m is
1. In certain embodiments, m is 2. In certain embodiments, m is 3.
In certain embodiments, m is 4. In certain embodiments, m is 5.
[0329] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00210##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0330] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00211##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0331] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00212##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0332] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00213##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0333] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00214##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0334] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00215##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0335] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00216##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0336] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00217##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0337] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00218##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0338] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00219##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0339] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00220##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0340] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00221##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0341] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00222##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0342] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00223##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0343] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00224##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0344] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00225##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0345] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00226##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0346] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00227##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0347] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00228##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0348] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00229##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0349] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00230##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0350] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00231##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0351] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00232##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0352] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00233##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0353] In certain embodiments, the compound of Formula (III-A) is
not of the formula:
##STR00234##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0354] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00235##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0355] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00236## ##STR00237##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0356] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00238## ##STR00239## ##STR00240## ##STR00241## ##STR00242##
##STR00243## ##STR00244## ##STR00245## ##STR00246## ##STR00247##
##STR00248## ##STR00249##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
[0357] In certain embodiments, the compound of Formula (III-A) is
of the formula:
##STR00250## ##STR00251## ##STR00252## ##STR00253## ##STR00254##
##STR00255## ##STR00256## ##STR00257##
or a pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof.
SIK Inhibitors
[0358] In certain embodiments, a SIK inhibitor for use in the
invention described herein is a compound of Formula (I), or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, a SIK
inhibitor for use in the invention described herein is a compound
of Formula (I), or a pharmaceutically acceptable salt thereof. In
certain embodiments, a SIK inhibitor for use in the invention
described herein is a compound of Formula (II), or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, a SIK
inhibitor for use in the invention described herein is a compound
of Formula (II), or a pharmaceutically acceptable salt thereof. In
certain embodiments, a SIK inhibitor for use in the invention
described herein is a compound of Formula (III-A), or a
pharmaceutically acceptable salt, solvate, hydrate, polymorph,
co-crystal, tautomer, stereoisomer, isotopically labeled
derivative, or prodrug thereof. In certain embodiments, a SIK
inhibitor for use in the invention described herein is a compound
of Formula (III-A), or a pharmaceutically acceptable salt
thereof.
[0359] The SIK inhibitors described herein may be able to bind a
SIK (e.g., SIK1, SIK2, or SIK3). In certain embodiments, the SIK
inhibitor covalently binds to a SIK. In certain embodiments, the
SIK inhibitor non-covalently binds to a SIK. In certain
embodiments, the SIK inhibitor reversibly binds to a SIK. In
certain embodiments, the SIK inhibitor non-reversibly binds to the
SIK. In certain embodiments, the SIK inhibitor modulates (e.g.,
inhibit) the activity (e.g., aberrant activity, such as increased
activity) of a SIK. In certain embodiments, the SIK inhibitor
inhibits the activity of a SIK. The inhibition of SIK may be in the
context of a disease associated with aberrant or increased SIK
activity.
[0360] The binding affinity of a SIK inhibitor described herein to
a SIK may be measured by the dissociation constant (K.sub.d) value
of an adduct of the SIK inhibitor and the SIK using methods known
in the art (e.g., isothermal titration calorimetry (ITC)). In
certain embodiments, the adduct comprises the SIK inhibitor and the
SIK, which are bound (e.g., non-covalently bound) to each other. In
certain embodiments, the K.sub.d value of the adduct is not more
than about 100 .mu.M, not more than about 10 .mu.M, not more than
about 1 .mu.M, not more than about 100 nM, not more than about 10
nM, or not more than about 1 nM. In certain embodiments, the
K.sub.d value of the adduct is at least about 1 nM, at least about
10 nM, at least about 100 nM, at least about 1 .mu.M, at least
about 10 .mu.M, or at least about 100 .mu.M. Combinations of the
above-referenced ranges are also within the scope of the
disclosure.
[0361] In certain embodiments, the activity of a SIK is inhibited
by a SIK inhibitor described herein. The inhibition of the activity
of a SIK by a SIK inhibitor described herein may be measured by the
half maximal inhibitory concentration (IC.sub.50) value of the SIK
inhibitor when the SIK inhibitor, or a pharmaceutical composition
thereof, is contacted with the SIK. The IC.sub.50 values may be
obtained using methods known in the art (e.g., by a competition
binding assay). In certain embodiments, the IC.sub.50 value of a
SIK inhibitor described herein is not more than about 1 mM, not
more than about 100 .mu.M, not more than about 10 .mu.M, not more
than about 1 .mu.M, not more than about 100 nM, not more than about
10 nM, or not more than about 1 nM. In certain embodiments, the
IC.sub.50 value of a SIK inhibitor described herein is at least
about 1 nM, at least about 10 nM, at least about 100 nM, at least
about 1 .mu.M, at least about 10 .mu.M, at least about 100 .mu.M,
or at least about 1 mM. Combinations of the above-referenced ranges
are also within the scope of the disclosure.
[0362] The SIK inhibitors described herein may selectively modulate
the activity of a SIK. In certain embodiments, the SIK inhibitors
selectively inhibit the activity of a SIK, compared to a different
SIK or a protein kinase that is not a SIK.
[0363] The selectivity of a SIK inhibitor described herein in
inhibiting the activity of a first SIK over a second SIK or a
protein kinase that is not a SIK (e.g., the
serine/threonine-protein kinase SGK1, SGK2, or SGK3) may be
measured by the quotient of the IC.sub.50 value of the SIK
inhibitor in inhibiting the activity of the second SIK or the
protein kinase that is not a SIK over the IC.sub.50 value of the
SIK inhibitor in inhibiting the activity of the first SIK. The
selectivity of a SIK inhibitor described herein in modulating the
activity of a first SIK over a second SIK or a protein kinase that
is not a SIK may also be measured by the quotient of the K.sub.d
value of an adduct of the SIK inhibitor and the second SIK or the
protein kinase that is not a SIK over the K.sub.d value of an
adduct of the SIK inhibitor and the first SIK. In certain
embodiments, the selectivity is at least about 1-fold, at least
about 3-fold, at least about 5-fold, at least about 10-fold, at
least about 30-fold, at least about 100-fold, at least about
300-fold, at least about 1,000-fold, at least about 3,000-fold, at
least about 10,000-fold, at least about 30,000-fold, or at least
about 100,000-fold.
[0364] In certain embodiments, the SIK inhibitors described herein
are useful in treating and/or preventing inflammatory bowel disease
(IBD) and/or graft-versus-host disease (GVHD) in a subject in need
thereof.
Pharmaceutical Compositions, Kits, and Administration
[0365] The present disclosure provides pharmaceutical compositions
comprising a SIK inhibitor described herein, or a pharmaceutically
acceptable salt thereof, and optionally a pharmaceutically
acceptable excipient for use in treating and/or preventing IBD or
GVHD. In certain embodiments, the pharmaceutical composition
described herein comprises a SIK inhibitor described herein, or a
pharmaceutically acceptable salt thereof, and a pharmaceutically
acceptable excipient.
[0366] In certain embodiments, the SIK inhibitor described herein
is provided in an effective amount in the pharmaceutical
composition. In certain embodiments, the effective amount is a
therapeutically effective amount (e.g., amount effective for
treating IBD or GVHD). In certain embodiments, the effective amount
is a prophylactically effective amount (e.g., amount effective for
preventing IBD or GVHD). In certain embodiments, the effective
amount is an amount effective for inhibiting the activity (e.g.,
aberrant activity, increased activity) of a SIK in a subject or
cell.
[0367] In certain embodiments, the subject is an animal. The animal
may be of either sex and may be at any stage of development. In
certain embodiments, the subject described herein is a human. In
certain embodiments, the subject is a non-human animal. In certain
embodiments, the subject is a mammal. In certain embodiments, the
subject is a non-human mammal. In certain embodiments, the subject
is a domesticated animal, such as a dog, cat, cow, pig, horse,
sheep, or goat. In certain embodiments, the subject is a companion
animal such as a dog or cat. In certain embodiments, the subject is
a livestock animal such as a cow, pig, horse, sheep, or goat. In
certain embodiments, the subject is a zoo animal. In another
embodiment, the subject is a research animal such as a rodent
(e.g., mouse, rat), dog, pig, or non-human primate. In certain
embodiments, the animal is a genetically engineered animal. In
certain embodiments, the animal is a transgenic animal (e.g.,
transgenic mice and transgenic pigs). In certain embodiments, the
subject is a fish or reptile.
[0368] In certain embodiments, the cell is in vitro. In certain
embodiments, the cell is ex vivo. In certain embodiments, the cell
is in vivo.
[0369] An effective amount of a SIK inhibitor may vary from about
0.001 mg/kg to about 1000 mg/kg in one or more dose administrations
for one or several days (depending on the mode of administration).
In certain embodiments, the effective amount per dose varies from
about 0.001 mg/kg to about 1000 mg/kg, from about 0.01 mg/kg to
about 750 mg/kg, from about 0.1 mg/kg to about 500 mg/kg, from
about 1.0 mg/kg to about 250 mg/kg, and from about 10.0 mg/kg to
about 150 mg/kg.
[0370] In certain embodiments, the effective amount is an amount
effective for inhibiting the activity of a SIK by at least about
10%, at least about 20%, at least about 30%, at least about 40%, at
least about 50%, at least about 60%, at least about 70%, at least
about 80%, at least about 90%, at least about 95%, or at least
about 98%. In certain embodiments, the effective amount is an
amount effective for inhibiting the activity of a SIK by not more
than 10%, not more than 20%, not more than 30%, not more than 40%,
not more than 50%, not more than 60%, not more than 70%, not more
than 80%, not more than 90%, not more than 95%, or not more than
98%. In certain embodiments, the effective amount is an amount
effective for inhibiting the activity of a SIK by a range between a
percentage described in this paragraph and another percentage
described in this paragraph, inclusive.
[0371] Pharmaceutical compositions described herein can be prepared
by any method known in the art of pharmacology. In general, such
preparatory methods include bringing the SIK inhibitor described
herein (i.e., the "active ingredient") into association with a
carrier or excipient, and/or one or more other accessory
ingredients, and then, if necessary and/or desirable, shaping,
and/or packaging the product into a desired single- or multi-dose
unit.
[0372] Pharmaceutical compositions can be prepared, packaged,
and/or sold in bulk, as a single unit dose, and/or as a plurality
of single unit doses. A "unit dose" is a discrete amount of the
pharmaceutical composition comprising a predetermined amount of the
active ingredient. The amount of the active ingredient is generally
equal to the dosage of the active ingredient which would be
administered to a subject and/or a convenient fraction of such a
dosage, such as one-half or one-third of such a dosage.
[0373] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition described herein will
vary, depending upon the identity, size, and/or condition of the
subject treated and further depending upon the route by which the
composition is to be administered. The composition may comprise
between 0.1% and 100% (w/w) active ingredient.
[0374] Pharmaceutically acceptable excipients used in the
manufacture of provided pharmaceutical compositions include inert
diluents, dispersing and/or granulating agents, surface active
agents and/or emulsifiers, disintegrating agents, binding agents,
preservatives, buffering agents, lubricating agents, and/or oils.
Excipients such as cocoa butter and suppository waxes, coloring
agents, coating agents, sweetening, flavoring, and perfuming agents
may also be present in the composition.
[0375] Exemplary diluents include calcium carbonate, sodium
carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate,
calcium hydrogen phosphate, sodium phosphate lactose, sucrose,
cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol,
inositol, sodium chloride, dry starch, cornstarch, powdered sugar,
and mixtures thereof.
[0376] Exemplary granulating and/or dispersing agents include
potato starch, corn starch, tapioca starch, sodium starch
glycolate, clays, alginic acid, guar gum, citrus pulp, agar,
bentonite, cellulose, and wood products, natural sponge,
cation-exchange resins, calcium carbonate, silicates, sodium
carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone),
sodium carboxymethyl starch (sodium starch glycolate),
carboxymethyl cellulose, cross-linked sodium carboxymethyl
cellulose (croscarmellose), methylcellulose, pregelatinized starch
(starch 1500), microcrystalline starch, water insoluble starch,
calcium carboxymethyl cellulose, magnesium aluminum silicate
(Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and
mixtures thereof.
[0377] Exemplary surface active agents and/or emulsifiers include
natural emulsifiers (e.g., acacia, agar, alginic acid, sodium
alginate, tragacanth, chondrux, cholesterol, xanthan, pectin,
gelatin, egg yolk, casein, wool fat, cholesterol, wax, and
lecithin), colloidal clays (e.g., bentonite (aluminum silicate) and
Veegum (magnesium aluminum silicate)), long chain amino acid
derivatives, high molecular weight alcohols (e.g., stearyl alcohol,
cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene
glycol distearate, glyceryl monostearate, and propylene glycol
monostearate, polyvinyl alcohol), carbomers (e.g., carboxy
polymethylene, polyacrylic acid, acrylic acid polymer, and
carboxyvinyl polymer), carrageenan, cellulosic derivatives (e.g.,
carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl
cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose,
methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene
sorbitan monolaurate (Tween.RTM. 20), polyoxyethylene sorbitan
(Tween.RTM. 60), polyoxyethylene sorbitan monooleate (Tween.RTM.
80), sorbitan monopalmitate (Span.RTM. 40), sorbitan monostearate
(Span.RTM. 60), sorbitan tristearate (Span.RTM. 65), glyceryl
monooleate, sorbitan monooleate (Span.RTM. 80), polyoxyethylene
esters (e.g., polyoxyethylene monostearate (Myrj.RTM. 45),
polyoxyethylene hydrogenated castor oil, polyethoxylated castor
oil, polyoxymethylene stearate, and Solutol.RTM.), sucrose fatty
acid esters, polyethylene glycol fatty acid esters (e.g.,
Cremophor.RTM.), polyoxyethylene ethers, (e.g., polyoxyethylene
lauryl ether (Brij.RTM. 30)), poly(vinyl-pyrrolidone), diethylene
glycol monolaurate, triethanolamine oleate, sodium oleate,
potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium
lauryl sulfate, Pluronic.RTM. F-68, poloxamer P-188, cetrimonium
bromide, cetylpyridinium chloride, benzalkonium chloride, docusate
sodium, and/or mixtures thereof.
[0378] Exemplary binding agents include starch (e.g., cornstarch
and starch paste), gelatin, sugars (e.g., sucrose, glucose,
dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.),
natural and synthetic gums (e.g., acacia, sodium alginate, extract
of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks,
carboxymethylcellulose, methylcellulose, ethylcellulose,
hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl
methylcellulose, microcrystalline cellulose, cellulose acetate,
poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum.RTM.),
and larch arabogalactan), alginates, polyethylene oxide,
polyethylene glycol, inorganic calcium salts, silicic acid,
polymethacrylates, waxes, water, alcohol, and/or mixtures
thereof.
[0379] Exemplary preservatives include antioxidants, chelating
agents, antimicrobial preservatives, antifungal preservatives,
antiprotozoan preservatives, alcohol preservatives, acidic
preservatives, and other preservatives. In certain embodiments, the
preservative is an antioxidant. In other embodiments, the
preservative is a chelating agent.
[0380] Exemplary antioxidants include alpha tocopherol, ascorbic
acid, acorbyl palmitate, butylated hydroxyanisole, butylated
hydroxytoluene, monothioglycerol, potassium metabisulfite,
propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite,
sodium metabisulfite, and sodium sulfite.
[0381] Exemplary chelating agents include
ethylenediaminetetraacetic acid (EDTA) and salts and hydrates
thereof (e.g., sodium edetate, disodium edetate, trisodium edetate,
calcium disodium edetate, dipotassium edetate, and the like),
citric acid and salts and hydrates thereof (e.g., citric acid
monohydrate), fumaric acid and salts and hydrates thereof, malic
acid and salts and hydrates thereof, phosphoric acid and salts and
hydrates thereof, and tartaric acid and salts and hydrates thereof.
Exemplary antimicrobial preservatives include benzalkonium
chloride, benzethonium chloride, benzyl alcohol, bronopol,
cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol,
chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin,
hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol,
phenylmercuric nitrate, propylene glycol, and thimerosal.
[0382] Exemplary antifungal preservatives include butyl paraben,
methyl paraben, ethyl paraben, propyl paraben, benzoic acid,
hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium
benzoate, sodium propionate, and sorbic acid.
[0383] Exemplary alcohol preservatives include ethanol,
polyethylene glycol, phenol, phenolic compounds, bisphenol,
chlorobutanol, hydroxybenzoate, and phenylethyl alcohol.
[0384] Exemplary acidic preservatives include vitamin A, vitamin C,
vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic
acid, ascorbic acid, sorbic acid, and phytic acid.
[0385] Other preservatives include tocopherol, tocopherol acetate,
deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA),
butylated hydroxytoluened (BHT), ethylenediamine, sodium lauryl
sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium
bisulfite, sodium metabisulfite, potassium sulfite, potassium
metabisulfite, Glydant.RTM. Plus, Phenonip.RTM., methylparaben,
Germall.RTM. 115, Germaben.RTM. II, Neolone.RTM., Kathon.RTM., and
Euxyl.RTM..
[0386] Exemplary buffering agents include citrate buffer solutions,
acetate buffer solutions, phosphate buffer solutions, ammonium
chloride, calcium carbonate, calcium chloride, calcium citrate,
calcium glubionate, calcium gluceptate, calcium gluconate,
D-gluconic acid, calcium glycerophosphate, calcium lactate,
propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium
phosphate, phosphoric acid, tribasic calcium phosphate, calcium
hydroxide phosphate, potassium acetate, potassium chloride,
potassium gluconate, potassium mixtures, dibasic potassium
phosphate, monobasic potassium phosphate, potassium phosphate
mixtures, sodium acetate, sodium bicarbonate, sodium chloride,
sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic
sodium phosphate, sodium phosphate mixtures, tromethamine,
magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free
water, isotonic saline, Ringer's solution, ethyl alcohol, and
mixtures thereof.
[0387] Exemplary lubricating agents include magnesium stearate,
calcium stearate, stearic acid, silica, talc, malt, glyceryl
behanate, hydrogenated vegetable oils, polyethylene glycol, sodium
benzoate, sodium acetate, sodium chloride, leucine, magnesium
lauryl sulfate, sodium lauryl sulfate, and mixtures thereof.
[0388] Exemplary natural oils include almond, apricot kernel,
avocado, babassu, bergamot, black current seed, borage, cade,
camomile, canola, caraway, carnauba, castor, cinnamon, cocoa
butter, coconut, cod liver, coffee, corn, cotton seed, emu,
eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd,
grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui
nut, lavandin, lavender, lemon, litsea cubeba, macademia nut,
mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange,
orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed,
pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood,
sasquana, savoury, sea buckthorn, sesame, shea butter, silicone,
soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut,
and wheat germ oils. Exemplary synthetic oils include, but are not
limited to, butyl stearate, caprylic triglyceride, capric
triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360,
isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol,
silicone oil, and mixtures thereof.
[0389] Liquid dosage forms for oral and parenteral administration
include pharmaceutically acceptable emulsions, microemulsions,
solutions, suspensions, syrups and elixirs. In addition to the
active ingredients, the liquid dosage forms may comprise inert
diluents commonly used in the art such as, for example, water or
other solvents, solubilizing agents and emulsifiers such as ethyl
alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl
alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol,
dimethylformamide, oils (e.g., cottonseed, groundnut, corn, germ,
olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl
alcohol, polyethylene glycols and fatty acid esters of sorbitan,
and mixtures thereof. Besides inert diluents, the oral compositions
can include adjuvants such as wetting agents, emulsifying and
suspending agents, sweetening, flavoring, and perfuming agents. In
certain embodiments for parenteral administration, the conjugates
described herein are mixed with solubilizing agents such as
Cremophor.RTM., alcohols, oils, modified oils, glycols,
polysorbates, cyclodextrins, polymers, and mixtures thereof.
[0390] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions can be formulated according to
the known art using suitable dispersing or wetting agents and
suspending agents. The sterile injectable preparation can be a
sterile injectable solution, suspension, or emulsion in a nontoxic
parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that can be employed are water, Ringer's solution, U.S.P.,
and isotonic sodium chloride solution. In addition, sterile, fixed
oils are conventionally employed as a solvent or suspending medium.
For this purpose any bland fixed oil can be employed including
synthetic mono- or di-glycerides. In addition, fatty acids such as
oleic acid are used in the preparation of injectables.
[0391] The injectable formulations can be sterilized, for example,
by filtration through a bacterial-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0392] In order to prolong the effect of a drug, it is often
desirable to slow the absorption of the drug from subcutaneous or
intramuscular injection. This can be accomplished by the use of a
liquid suspension of crystalline or amorphous material with poor
water solubility. The rate of absorption of the drug then depends
upon its rate of dissolution, which, in turn, may depend upon
crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered drug form may be
accomplished by dissolving or suspending the drug in an oil
vehicle.
[0393] Compositions for rectal or vaginal administration are
typically suppositories which can be prepared by mixing the
conjugates described herein with suitable non-irritating excipients
or carriers such as cocoa butter, polyethylene glycol, or a
suppository wax which are solid at ambient temperature but liquid
at body temperature and therefore melt in the rectum or vaginal
cavity and release the active ingredient.
[0394] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
the active ingredient is mixed with at least one inert,
pharmaceutically acceptable excipient or carrier such as sodium
citrate or dicalcium phosphate and/or (a) fillers or extenders such
as starches, lactose, sucrose, glucose, mannitol, and silicic acid,
(b) binders such as, for example, carboxymethylcellulose,
alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia,
(c) humectants such as glycerol, (d) disintegrating agents such as
agar, calcium carbonate, potato or tapioca starch, alginic acid,
certain silicates, and sodium carbonate, (e) solution retarding
agents such as paraffin, (f) absorption accelerators such as
quaternary ammonium compounds, (g) wetting agents such as, for
example, cetyl alcohol and glycerol monostearate, (h) absorbents
such as kaolin and bentonite clay, and (i) lubricants such as talc,
calcium stearate, magnesium stearate, solid polyethylene glycols,
sodium lauryl sulfate, and mixtures thereof. In the case of
capsules, tablets, and pills, the dosage form may include a
buffering agent.
[0395] Solid compositions of a similar type can be employed as
fillers in soft and hard-filled gelatin capsules using such
excipients as lactose or milk sugar as well as high molecular
weight polyethylene glycols and the like. The solid dosage forms of
tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings and other
coatings well known in the art of pharmacology. They may optionally
comprise opacifying agents and can be of a composition that they
release the active ingredient(s) only, or preferentially, in a
certain part of the intestinal tract, optionally, in a delayed
manner. Examples of encapsulating compositions which can be used
include polymeric substances and waxes. Solid compositions of a
similar type can be employed as fillers in soft and hard-filled
gelatin capsules using such excipients as lactose or milk sugar as
well as high molecular weight polethylene glycols and the like.
[0396] The active ingredient can be in a micro-encapsulated form
with one or more excipients as noted above. The solid dosage forms
of tablets, dragees, capsules, pills, and granules can be prepared
with coatings and shells such as enteric coatings, release
controlling coatings, and other coatings well known in the
pharmaceutical formulating art. In such solid dosage forms the
active ingredient can be admixed with at least one inert diluent
such as sucrose, lactose, or starch. Such dosage forms may
comprise, as is normal practice, additional substances other than
inert diluents, e.g., tableting lubricants and other tableting aids
such a magnesium stearate and microcrystalline cellulose. In the
case of capsules, tablets and pills, the dosage forms may comprise
buffering agents. They may optionally comprise opacifying agents
and can be of a composition that they release the active
ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in a delayed manner. Examples of
encapsulating agents which can be used include polymeric substances
and waxes.
[0397] Dosage forms for topical and/or transdermal administration
of a SIK inhibitor described herein may include ointments, pastes,
creams, lotions, gels, powders, solutions, sprays, inhalants,
and/or patches. Generally, the active ingredient is admixed under
sterile conditions with a pharmaceutically acceptable carrier or
excipient and/or any needed preservatives and/or buffers as can be
required. Additionally, the present disclosure contemplates the use
of transdermal patches, which often have the added advantage of
providing controlled delivery of an active ingredient to the body.
Such dosage forms can be prepared, for example, by dissolving
and/or dispensing the active ingredient in the proper medium.
Alternatively or additionally, the rate can be controlled by either
providing a rate controlling membrane and/or by dispersing the
active ingredient in a polymer matrix and/or gel.
[0398] Suitable devices for use in delivering intradermal
pharmaceutical compositions described herein include short needle
devices. Intradermal compositions can be administered by devices
which limit the effective penetration length of a needle into the
skin. Alternatively or additionally, conventional syringes can be
used in the classical mantoux method of intradermal administration.
Jet injection devices which deliver liquid formulations to the
dermis via a liquid jet injector and/or via a needle which pierces
the stratum corneum and produces a jet which reaches the dermis are
suitable. Ballistic powder/particle delivery devices which use
compressed gas to accelerate the SIK inhibitor in powder form
through the outer layers of the skin to the dermis are
suitable.
[0399] Formulations suitable for topical administration include,
but are not limited to, liquid and/or semi-liquid preparations such
as liniments, lotions, oil-in-water and/or water-in-oil emulsions
such as creams, ointments, and/or pastes, and/or solutions and/or
suspensions. Topically administrable formulations may, for example,
comprise from about 1% to about 10% (w/w) active ingredient,
although the concentration of the active ingredient can be as high
as the solubility limit of the active ingredient in the solvent.
Formulations for topical administration may further comprise one or
more of the additional ingredients described herein.
[0400] A pharmaceutical composition described herein can be
prepared, packaged, and/or sold in a formulation suitable for
pulmonary administration via the buccal cavity. Such a formulation
may comprise dry particles which comprise the active ingredient and
which have a diameter in the range from about 0.5 to about 7
nanometers, or from about 1 to about 6 nanometers. Such
compositions are conveniently in the form of dry powders for
administration using a device comprising a dry powder reservoir to
which a stream of propellant can be directed to disperse the powder
and/or using a self-propelling solvent/powder dispensing container
such as a device comprising the active ingredient dissolved and/or
suspended in a low-boiling propellant in a sealed container. Such
powders comprise particles wherein at least 98% of the particles by
weight have a diameter greater than 0.5 nanometers and at least 95%
of the particles by number have a diameter less than 7 nanometers.
Alternatively, at least 95% of the particles by weight have a
diameter greater than 1 nanometer and at least 90% of the particles
by number have a diameter less than 6 nanometers. Dry powder
compositions may include a solid fine powder diluent such as sugar
and are conveniently provided in a unit dose form.
[0401] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50 to 99.9% (w/w)
of the composition, and the active ingredient may constitute 0.1 to
20% (w/w) of the composition. The propellant may further comprise
additional ingredients such as a liquid non-ionic and/or solid
anionic surfactant and/or a solid diluent (which may have a
particle size of the same order as particles comprising the active
ingredient).
[0402] Pharmaceutical compositions described herein formulated for
pulmonary delivery may provide the active ingredient in the form of
droplets of a solution and/or suspension. Such formulations can be
prepared, packaged, and/or sold as aqueous and/or dilute alcoholic
solutions and/or suspensions, optionally sterile, comprising the
active ingredient, and may conveniently be administered using any
nebulization and/or atomization device. Such formulations may
further comprise one or more additional ingredients including, but
not limited to, a flavoring agent such as saccharin sodium, a
volatile oil, a buffering agent, a surface active agent, and/or a
preservative such as methylhydroxybenzoate. The droplets provided
by this route of administration may have an average diameter in the
range from about 0.1 to about 200 nanometers.
[0403] Formulations described herein as being useful for pulmonary
delivery are useful for intranasal delivery of a pharmaceutical
composition described herein. Another formulation suitable for
intranasal administration is a coarse powder comprising the active
ingredient and having an average particle from about 0.2 to 500
micrometers. Such a formulation is administered by rapid inhalation
through the nasal passage from a container of the powder held close
to the nares.
[0404] Formulations for nasal administration may, for example,
comprise from about as little as 0.1% (w/w) to as much as 100%
(w/w) of the active ingredient, and may comprise one or more of the
additional ingredients described herein. A pharmaceutical
composition described herein can be prepared, packaged, and/or sold
in a formulation for buccal administration. Such formulations may,
for example, be in the form of tablets and/or lozenges made using
conventional methods, and may contain, for example, 0.1 to 20%
(w/w) active ingredient, the balance comprising an orally
dissolvable and/or degradable composition and, optionally, one or
more of the additional ingredients described herein. Alternately,
formulations for buccal administration may comprise a powder and/or
an aerosolized and/or atomized solution and/or suspension
comprising the active ingredient. Such powdered, aerosolized,
and/or aerosolized formulations, when dispersed, may have an
average particle and/or droplet size in the range from about 0.1 to
about 200 nanometers, and may further comprise one or more of the
additional ingredients described herein.
[0405] A pharmaceutical composition described herein can be
prepared, packaged, and/or sold in a formulation for ophthalmic
administration. Such formulations may, for example, be in the form
of eye drops including, for example, a 0.1-1.0% (w/w) solution
and/or suspension of the active ingredient in an aqueous or oily
liquid carrier or excipient. Such drops may further comprise
buffering agents, salts, and/or one or more other of the additional
ingredients described herein. Other opthalmically-administrable
formulations which are useful include those which comprise the
active ingredient in microcrystalline form and/or in a liposomal
preparation. Ear drops and/or eye drops are also contemplated as
being within the scope of this disclosure.
[0406] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for administration to humans, it
will be understood by the skilled artisan that such compositions
are generally suitable for administration to animals of all sorts.
Modification of pharmaceutical compositions suitable for
administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design
and/or perform such modification with ordinary experimentation.
[0407] SIK inhibitors provided herein are typically formulated in
dosage unit form for ease of administration and uniformity of
dosage. It will be understood, however, that the total daily usage
of the compositions described herein will be decided by a physician
within the scope of sound medical judgment. The specific
therapeutically effective dose level for any particular subject or
organism will depend upon a variety of factors including the
disease being treated and the severity of the disorder; the
activity of the specific active ingredient employed; the specific
composition employed; the age, body weight, general health, sex,
and diet of the subject; the time of administration, route of
administration, and rate of excretion of the specific active
ingredient employed; the duration of the treatment; drugs used in
combination or coincidental with the specific active ingredient
employed; and like factors well known in the medical arts.
[0408] The SIK inhibitors and compositions provided herein can be
administered by any route, including enteral (e.g., oral),
parenteral, intravenous, intramuscular, intra-arterial,
intramedullary, intrathecal, subcutaneous, intraventricular,
transdermal, interdermal, rectal, intravaginal, intraperitoneal,
topical (as by powders, ointments, creams, and/or drops), mucosal,
nasal, bucal, sublingual; by intratracheal instillation, bronchial
instillation, and/or inhalation; and/or as an oral spray, nasal
spray, and/or aerosol. Specifically contemplated routes are oral
administration, intravenous administration (e.g., systemic
intravenous injection), regional administration via blood and/or
lymph supply, and/or direct administration to an affected site. In
general, the most appropriate route of administration will depend
upon a variety of factors including the nature of the agent (e.g.,
its stability in the environment of the gastrointestinal tract),
and/or the condition of the subject (e.g., whether the subject is
able to tolerate oral administration). In certain embodiments, the
SIK inhibitor or pharmaceutical composition described herein is
suitable for topical administration to the eye of a subject.
[0409] The exact amount of a SIK inhibitor required to achieve an
effective amount will vary from subject to subject, depending, for
example, on species, age, and general condition of a subject,
severity of the side effects or disorder, identity of the
particular SIK inhibitor, mode of administration, and the like. The
desired dosage can be delivered three times a day, two times a day,
once a day, every other day, every third day, every week, every two
weeks, every three weeks, or every four weeks. In certain
embodiments, the desired dosage can be delivered using multiple
administrations (e.g., two, three, four, five, six, seven, eight,
nine, ten, eleven, twelve, thirteen, fourteen, or more
administrations).
[0410] In certain embodiments, an effective amount of a SIK
inhibitor for administration one or more times a day to a 70 kg
adult human may comprise about 0.0001 mg to about 3000 mg, about
0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg, about
0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about
0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to
about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to
about 1000 mg, of a SIK inhibitor per unit dosage form.
[0411] In certain embodiments, the SIK inhibitors described herein
may be at dosage levels sufficient to deliver from about 0.001
mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg,
preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from
about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about
10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more
preferably from about 1 mg/kg to about 25 mg/kg, of subject body
weight per day, one or more times a day, to obtain the desired
therapeutic and/or prophylactic effect.
[0412] Dose ranges as described herein provide guidance for the
administration of provided pharmaceutical compositions to an adult.
The amount to be administered to, for example, a child or an
adolescent can be determined by a medical practitioner or person
skilled in the art and can be lower or the same as that
administered to an adult.
[0413] A SIK inhibitor or composition, as described herein, can be
administered in combination with one or more additional
pharmaceutical agents (e.g., therapeutically and/or
prophylactically active agents) useful in treating and/or
preventing IBD or GVHD. The SIK inhibitors or compositions can be
administered in combination with additional pharmaceutical agents
that improve their activity (e.g., activity (e.g., potency and/or
efficacy) in treating IBD or GVHD in a subject in need thereof, in
preventing IBD or GVHD in a subject in need thereof, and/or in
inhibiting the activity of a SIK in a subject or cell), improve
bioavailability, improve safety, reduce drug resistance, reduce
and/or modify metabolism, inhibit excretion, and/or modify
distribution in a subject or cell. It will also be appreciated that
the therapy employed may achieve a desired effect for the same
disorder, and/or it may achieve different effects. In certain
embodiments, a pharmaceutical composition described herein
including a SIK inhibitor described herein and an additional
pharmaceutical agent shows a synergistic effect that is absent in a
pharmaceutical composition including one of the SIK inhibitor and
the additional pharmaceutical agent, but not both.
[0414] The SIK inhibitor or composition can be administered
concurrently with, prior to, or subsequent to one or more
additional pharmaceutical agents, which may be useful as, e.g.,
combination therapies in treating IBD or GVHD. Pharmaceutical
agents include therapeutically active agents. Pharmaceutical agents
also include prophylactically active agents. Pharmaceutical agents
include small organic molecules such as drug compounds (e.g.,
compounds approved for human or veterinary use by the U.S. Food and
Drug Administration as provided in the Code of Federal Regulations
(CFR)), peptides, proteins, carbohydrates, monosaccharides,
oligosaccharides, polysaccharides, nucleoproteins, mucoproteins,
lipoproteins, synthetic polypeptides or proteins, small molecules
linked to proteins, glycoproteins, steroids, nucleic acids, DNAs,
RNAs, nucleotides, nucleosides, oligonucleotides, antisense
oligonucleotides, lipids, hormones, vitamins, and cells. In certain
embodiments, the additional pharmaceutical agent is a
pharmaceutical agent useful for treating and/or preventing IBD or
GVHD. In certain embodiments, the additional pharmaceutical agent
is a pharmaceutical agent approved by a regulatory agency (e.g.,
the US FDA) for treating and/or preventing IBD or GVHD. Each
additional pharmaceutical agent may be administered at a dose
and/or on a time schedule determined for that pharmaceutical agent.
The additional pharmaceutical agents may also be administered
together with each other and/or with the compound or composition
described herein in a single dose or administered separately in
different doses. The particular combination to employ in a regimen
will take into account compatibility of the SIK inhibitor described
herein with the additional pharmaceutical agent(s) and/or the
desired therapeutic and/or prophylactic effect to be achieved. In
general, it is expected that the additional pharmaceutical agent(s)
in combination be utilized at levels that do not exceed the levels
at which they are utilized individually. In some embodiments, the
levels utilized in combination will be lower than those utilized
individually.
[0415] In certain embodiments, the additional pharmaceutical agent
is an anti-inflammatory agent (e.g., an anti-inflammatory agent for
treating IBD or GVHD, such as sulfasalazine (AZULFIDINE),
mesalamine (APRISO, ASACOL, or LIALDA), balsalazide (COLAZAL),
olsalazine (DIPENTUM), a corticosteroid (e.g., prednisone,
methylprednisolone, budesonide, or beclomethasone dipropionate), or
a combination thereof). In certain embodiments, the additional
pharmaceutical agent is an immunosuppressant (e.g.,
immunosuppressant for treating IBD or GVHD, such as azathioprine
(AZASAN or IMURAN), mercaptopurine (PURINETHOL), cyclosporine
(GENGRAF, NEORAL, or SANDIMMUNE), infliximab (REMICADE), adalimumab
(HUMIRA), certolizumab pegol (CIMZIA), methotrexate (RHEUMATREX),
natalizumab (TYSABRI), mycophenolate mofetil (CELLCEPT), sirolimus
(RAPAMUNE), tacrolimus (PROGRAF), thalidomide (THALOMID), or a
combination thereof). In certain embodiments, the additional
pharmaceutical agent is antithymocyte globulin (e.g., antithymocyte
globulin for treating IBD or GVHD, such as rabbit ATG or
THYMOGLOBULIN), daclizumab (ZENAPAX), infliximab (REMICADE),
alemtuzumab (CAMPATH), etanercept (ENBREL), rituximab (RITUXAN), or
a combination thereof. In certain embodiments, the additional
pharmaceutical agent is an antibiotic (e.g., antibiotic for
treating IBD or GVHD, such as metronidazole (FLAGYL) or
ciprofloxacin (CIPRO)). In certain embodiments, the additional
pharmaceutical agent is a protein kinase inhibitor (e.g., protein
kinase inhibitor for treating IBD or GVHD, such as BCR-Abl
inhibitor, c-Kit inhibitor, Raf inhibitor, Alk inhibitor, Wee1
inhibitor, JAK inhibitor, or GSK3 inhibitor). In certain
embodiments, the additional pharmaceutical agent is dasatinib,
DGC-0879, bosutinib, dabrafenib, TAE-684 (Tae684), MK 1775,
vemurafenib, ruxolitinib, CHIR-99021, saracatinib, imatinib, or a
combination thereof. Examples of the additional pharmaceutical
agents also include, but are not limited to, anti-diarrheal agents,
laxatives, pain relievers, iron supplements, vitamin B-12, and
calcium and vitamin D supplements. Examples of the additional
pharmaceutical agents further include, but are not limited to,
anti-proliferative agents, anti-cancer agents (e.g., denileukin
diftitox (ONTAK), pentostatin (NIPENT), imatinib mesylate
(GLEEVEC)), anti-angiogenesis agents, cardiovascular agents,
cholesterol-lowering agents, anti-diabetic agents, and
anti-allergic agents. In certain embodiments, the additional
pharmaceutical agent is a binder or inhibitor of a SIK. In certain
embodiments, the additional pharmaceutical agent is selected from
the group consisting of epigenetic or transcriptional modulators
(e.g., DNA methyltransferase inhibitors, histone deacetylase
inhibitors (HDAC inhibitors), lysine methyltransferase inhibitors),
antimitotic drugs (e.g., taxanes and vinca alkaloids), hormone
receptor modulators (e.g., estrogen receptor modulators and
androgen receptor modulators), cell signaling pathway inhibitors
(e.g., tyrosine SIK inhibitors), modulators of protein stability
(e.g., proteasome inhibitors), Hsp90 inhibitors, glucocorticoids,
all-trans retinoic acids, and other agents that promote
differentiation. In certain embodiments, the SIK inhibitors
described herein or pharmaceutical compositions can be administered
in combination with an anti-cancer therapy including, but not
limited to, surgery, radiation therapy, and chemotherapy.
[0416] Also encompassed by the disclosure are kits (e.g.,
pharmaceutical packs). The kits provided may comprise a
pharmaceutical composition or compound described herein and a
container (e.g., a vial, ampule, bottle, syringe, and/or dispenser
package, or other suitable container). In some embodiments,
provided kits may optionally further include a second container
comprising a pharmaceutical excipient for dilution or suspension of
a pharmaceutical composition or compound described herein. In some
embodiments, the pharmaceutical composition or compound described
herein provided in the first container and the second container are
combined to form one unit dosage form.
[0417] Thus, in one aspect, provided are kits including a first
container comprising a compound or pharmaceutical composition
described herein. In certain embodiments, the kits are useful for
treating IBD or GVHD in a subject in need thereof. In certain
embodiments, the kits are useful for preventing IBD or GVHD in a
subject in need thereof. In certain embodiments, the kits are
useful for inhibiting the activity of a SIK in a subject or cell.
In certain embodiments, the kits are useful for increasing the
level of IL-10 in a subject or cell. In certain embodiments, the
kits are useful for decreasing the level of a pro-inflammatory
cytokine (e.g., IL-1.beta., IL-6, IL-12, or TNF-.alpha.) in a
subject or cell. In certain embodiments, the kits are useful for
converting bone marrow-derived dendritic cells (BMDCs) to an
anti-inflammatory phenotype in a subject.
[0418] In certain embodiments, a kit described herein further
includes instructions for using the compound or pharmaceutical
composition included in the kit. A kit described herein may also
include information as required by a regulatory agency such as the
U.S. Food and Drug Administration (FDA). In certain embodiments,
the information included in the kits is prescribing information. In
certain embodiments, the kits and instructions provide for treating
IBD and/or GVHD in a subject in need thereof, for preventing IBD
and/or GVHD in a subject in need thereof, for inhibiting the
activity of a SIK in a subject or cell, for increasing the level of
IL-10 in a subject or cell, for decreasing the level of a
pro-inflammatory cytokine (e.g., IL-1.beta., IL-6, IL-12, or
TNF-.alpha.) in a subject or cell, for converting bone
marrow-derived dendritic cells (BMDCs) to an anti-inflammatory
phenotype in a subject. A kit described herein may include one or
more additional pharmaceutical agents described herein as a
separate composition.
Methods of Treatment
[0419] The present disclosure provides methods for the treatment
and prevention of inflammatory bowel disease (IBD) and
graft-versus-host disease (GVHD).
[0420] Recent research has established a rationale for modulating
IL-10 (e.g., increasing) in both IBD and GVHD. Although the
etiology of IBD is complex, impaired function of anti-inflammatory
immune mechanisms is observed in many patients. For instance,
single nucleotide polymorphisms (SNPs) in genetic loci containing
IL10 or its receptor (IL10RA) are associated with an increased risk
of Crohn's disease and ulcerative colitis, and rare
loss-of-function mutations in the coding regions of IL10 or IL10RA
lead to severe, pediatric-onset enterocolitis. The link between gut
inflammation and defective IL-10 signaling in humans is
recapitulated in Il10-/- and Il10ra-/- mice, which both develop
spontaneous colitis. Conversely, prophylactic administration of
recombinant IL-10 partially alleviates gut inflammation and weight
loss in murine models of chemically induced colitis. Unfortunately,
well-tolerated doses of recombinant IL-10 therapy did not show
efficacy in clinical trials for Crohn's disease. Potential
explanations of this lack of efficacy include insufficient delivery
of IL-10 to the gut mucosa by systemic administration and/or the
need to combine IL-10 supplementation with neutralization of
inflammatory cytokines. Of note, disease activity is reduced in
Crohn's disease patients following oral administration of L. lactis
engineered to express IL-10, which suggests that specifically
increasing IL-10 levels in the gut microenvironment can be
therapeutically beneficial in the absence of toxicities (e.g.,
headache, anemia and thrombocytopenia) that limit systemic
treatment.
[0421] As with IBD, recent research has also established a
compelling rationale for treating GVHD by enhancing IL-10. For
example, certain IL-10 promoter-region halotypes had a protective
effect against GVHD. Recipients of allogenic bone marrow who have
the interleukin-10 (IL-10)-592A/A genotype (having high level of
IL-10 production) have a lower risk of severe acute GVHD than
recipients who have the -592C/C genotype. Studies using
IL-10-deficient donor or host mice (BALB/c or C57BL/6,
respectively) in a MHC-mismatched model for acute GVHD, found a
strongly aggravated course of the disease with increased mortality
when either donor or host cells could not produce IL-10. Notably,
IL-10 is a potent suppressor of TNF-a, interleukin-1a,
interleukin-1b, interleukin-6, interleukin-12, and interferon-gamma
production and may facilitate the induction of tolerance after
allogeneic transplantation. Indeed, clinical studies suggest that
elevated levels of endogenous IL-10 may be associated with
immunologic tolerance. These observations underscore the utility
and therapeutic potential of enhancing IL-10 production in both IBD
(e.g., Crohn's disease and ulcerative colitis) and GVHD.
[0422] The present disclosure is based in part on the discovery
that inhibiting salt-inducible kinases (SIKs) using the SIK
inhibitors described herein enhanced IL-10 production by
macrophages and dendritic cells of the gut.
[0423] In another aspect, the present disclosure provides methods
of inhibiting the activity of a salt-inducible kinase (SIK) in a
subject or cell. In certain embodiments, the SIK is a member of the
serine/threonine SIK kinase subfamily (e.g., SIK1, SIK2, SIK3). In
certain embodiments, the activity of a SIK in a subject or cell is
inhibited by the SIK inhibitors or pharmaceutical compositions
described herein. In certain embodiments, the activity of a SIK in
a subject or cell is inhibited by the methods described herein by
at least about 10%, at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, or at least
about 95%. In certain embodiments, the activity of a SIK in a
subject or cell is inhibited by the methods described herein by at
most about 90%, at most about 80%, at most about 70%, at most about
60%, at most about 50%, at most about 40%, at most about 30%, at
most about 20%, at most about 10%, at most about 3%, or at most
about 1%. Combinations of the above-referenced ranges (e.g., at
least about 10% and at most about 50%) are also within the scope of
the disclosure. Other ranges are also possible. In some
embodiments, the activity of a SIK in a subject or cell is
selectively inhibited by the methods described herein. In certain
embodiments, a SIK is inhibited by a method described herein to a
greater extent, compared to a protein kinase that is not a SIK. In
certain embodiments, a SIK (e.g., SIK1, SIK2, or SIK3) is inhibited
by a method described herein to a greater extent, compared to a
different SIK. In certain embodiments, SIK1 is selectively
inhibited by the methods described herein, compared to SIK2, SIK3,
or a protein kinase that is not a SIK. In certain embodiments, SIK2
is selectively inhibited by the methods described herein, compared
to SIK1, SIK3, or a protein kinase that is not a SIK. In certain
embodiments, SIK3 is selectively inhibited by the methods described
herein, compared to SIK1, SIK2, or a protein kinase that is not a
SIK. In some embodiments, the activity of a SIK in a subject or
cell is non-selectively inhibited by the methods described herein.
In certain embodiments, the level of interleukin 10 (IL-10) is
reduced. In certain embodiments, the level of IL-10 is reduced by
at least about 10%, at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, or at least
about 95%. In some embodiments, bone marrow derived cells (BDMCs)
are converted to an anti-inflammatory phenotype. For example, the
BDMCs produce reduced levels of pro-inflammatory cytokines (e.g.,
IL-1.beta., IL-6, IL-12 and TNF-.alpha.). In some embodiments, the
BDMCs are macrophages or dendritic cells.
[0424] In certain embodiments, the activity of a SIK is an aberrant
activity of the SIK. In certain embodiments, the activity of a SIK
is an increased activity of the SIK.
[0425] In another aspect, the present disclosure provides methods
of increasing the level of IL-10 in a subject.
[0426] In another aspect, the present disclosure provides methods
of increasing the level of IL-10 in a cell.
[0427] In certain embodiments, the level of IL-10 in a subject or
cell is at an aberrant level before treatment by the inventive
methods. In certain embodiments, the level of IL-10 in a subject or
cell is decreased by the inventive method. In certain embodiments,
the level of IL-10 in a subject or cell is normal.
[0428] Another aspect of the present disclosure relates to methods
of decreasing the level of a pro-inflammatory cytokine in a
subject.
[0429] Another aspect of the present disclosure relates to methods
of decreasing the level of a pro-inflammatory cytokine in a
cell.
[0430] In some embodiments, the pro-inflammatory cytokine is
IL-1.beta., IL-6, IL-12, or TNF-.alpha.. In certain embodiments,
the level of the pro-inflammatory cytokine is reduced (e.g.,
reduced by at least about 10%, at least about 20%, at least about
30%, at least about 40%, at least about 50%, at least about 60%, at
least about 70%, at least about 80%, at least about 90%, or at
least about 95%) by a method described herein. In certain
embodiments, the level of the pro-inflammatory cytokine is measured
by an enzyme-linked immunosorbent assay (ELISA). In certain
embodiments, the level of the pro-inflammatory cytokine is measured
by a bead-based multiplex assay (e.g., a luminex assay). In certain
embodiments, the level of the pro-inflammatory cytokine is measured
transcriptionally. In certain embodiments, the level of a
pro-inflammatory cytokine in a subject or cell is normal.
[0431] In another aspect, the present disclosure provides methods
of converting bone marrow-derived dendritic cells (BMDCs) to an
anti-inflammatory phenotype in a subject. In certain embodiments,
the BMDCs are immune cells. In certain embodiments, the BMDCs are
dendritic cells or macrophages. In certain embodiments, the BMDCs
have a pro-inflammatory phenotype. For example, the
pro-inflammatory phenotype may include the production of a
pro-inflammatory cytokine (e.g., IL-1.beta., IL-6, IL-12, or
TNF-.alpha.). In certain embodiments, converting BDMCs to an
anti-inflammatory phenotype comprises decreasing the production of
a pro-inflammatory cytokine (e.g., IL-1.beta., IL-6, IL-12, or
TNF-.alpha.). In certain embodiments, a method of converting BDMCs
to an anti-inflammatory phenotype decreases the production of a
pro-inflammatory cytokine by at least about 10%, at least about
20%, at least about 30%, at least about 40%, at least about 50%, at
least about 60%, at least about 70%, at least about 80%, at least
about 90%, or at least about 95%.
[0432] Another aspect of the present disclosure relates to methods
of treating IBD or GVHD in a subject in need thereof.
[0433] Another aspect of the present disclosure relates to methods
of preventing IBD or GVHD in a subject in need thereof.
[0434] In certain embodiments, the IBD is Crohn's disease or
ulcerative colitis. In certain embodiments, the IBD is collagenous
colitis, lymphocytic colitis, diversion colitis, Behcet's disease,
or indeterminate colitis. In certain embodiments, the GVHD is acute
graft-versus-host disease (aGVHD) or chronic graft-versus-host
disease (cGVHD).
[0435] In certain embodiments, the methods of the disclosure
include administering to a subject in need thereof an effective
amount (e.g., therapeutically effective amount or prophylactically
effective amount) of a SIK inhibitor or pharmaceutical composition
described herein. In certain embodiments, the methods of the
disclosure further include performing a surgery on the subject. In
certain embodiments, the surgery is strictureplasty, resection
(e.g., bowel resection, colon resection), colectomy, surgery for
abscesses and fistulas, proctocolectomy, restorative
proctocolectomy, vaginal surgery, cataract surgery, or a
combination thereof. In certain embodiments, the methods of the
disclosure include contacting a cell with an effective amount
(e.g., therapeutically effective amount or prophylactically
effective amount) of a SIK inhibitor or pharmaceutical composition
described herein.
Uses
[0436] In another aspect, the present disclosure provides the SIK
inhibitors described herein for use in a method described herein
(e.g., a method of treating IBD and/or GVHD, method of preventing
IBD and/or GVHD, method of inhibiting the activity of a SIK, method
of increasing the level of IL-10, method of decreasing the level of
a pro-inflammatory cytokine, or method of converting bone
marrow-derived dendritic cells (BMDCs) to an anti-inflammatory
phenotype).
[0437] In still another aspect, the present disclosure provides the
pharmaceutical compositions described herein for use in a method
described herein (e.g., a method of treating IBD and/or GVHD,
method of preventing IBD and/or GVHD, method of inhibiting the
activity of a SIK, method of increasing the level of IL-10, method
of decreasing the level of a pro-inflammatory cytokine, or method
of converting bone marrow-derived dendritic cells (BMDCs) to an
anti-inflammatory phenotype).
EXAMPLES
[0438] In order that the disclosure may be more fully understood,
the following examples are set forth. The synthetic and biological
examples described in this application are offered to illustrate
the SIK inhibitors, pharmaceutical compositions, uses, and methods
provided herein and are not to be construed in any way as limiting
their scope.
Example 1. Preparation of the SIK Inhibitors
[0439] The SIK inhibitors of any one of Formulae (I), (II), and
(III-A) can be prepared from readily available starting materials
using the following general methods and procedures (e.g., the
methods shown in Schemes 1 to 9). It will be appreciated that where
typical or preferred process conditions (i.e., reaction
temperatures, times, mole ratios of reactants, solvents, pressures,
etc.) are given, other process conditions can also be used unless
otherwise stated. Optimum reaction conditions may vary with the
particular reactants or solvents used, but such conditions can be
determined by those skilled in the art by routine optimization.
[0440] A SIK inhibitor of Formula (I) can be prepared according to
the methods shown in Scheme 1.
##STR00258##
[0441] In Scheme 1, each of Z.sup.A, Z.sup.B, and Z.sup.C is
independently a leaving group. In certain embodiments, each of
Z.sup.A, Z.sup.B, and Z.sup.C is independently halogen (e.g., F,
Cl, Br, or I (iodine)), --OTs, --OMs, --OBs, or --OTf. In certain
embodiments, each of Z.sup.A and Z.sup.B is Cl. In certain
embodiments, Z.sup.C is --OR.sup.ZC or of the formula:
##STR00259##
wherein R.sup.ZC is substituted or unsubstituted C.sub.1-6 alkyl
(e.g., --CH.sub.3) or an oxygen protecting group.
[0442] When Y is --NR.sup.Y--, X.sup.A is CR.sup.X, and R.sup.Y and
R.sup.X of X.sup.A are joined to form a substituted or
unsubstituted, 5- to 7-membered heterocyclic ring that is fused
with Ring B, the SIK inhibitors of Formula (I) can be prepared
using the methods known in the art, such as the methods described
in U.S. patent application Publication, US 2006/0258687, which is
incorporated herein by reference.
[0443] A SIK inhibitor of Formula (II) can be prepared according to
the methods shown in Scheme 2.
##STR00260##
[0444] A SIK inhibitor of Formula (III) can be prepared according
to the methods shown in Schemes 3A and 3B.
##STR00261##
##STR00262##
[0445] A SIK inhibitor of Formula (III-A) can be prepared using
methods similar to the methods of preparing a compound of Formula
(III).
[0446] General. The urea formation was performed using a
Biotage.RTM. Initiator.sup.+ Microwave Synthesizer. All reactions
were monitored by thin layer chromatography (TLC) with 0.25 mm E.
Merck pre-coated silica gel plates (60 F.sub.254) and Waters LC/MS
system (Waters 2489 UV/Visible Detector, Waters 3100 Mass, Waters
515 HPLC pump, Waters 2545 Binary Gradient Module, Waters Reagent
Manager, Waters 2767 Sample Manager) using SunFire.TM. C.sub.18
column (4.6.times.50 mm, 5 .mu.m particle size) (solvent
gradient=97% A at 0 min, 0% A at 5 min; solvent A=0.035% TFA in
water; solvent B=0.035% TFA in acetonitrile; flow rate=2.5 mL/min).
Retention time (Rt) was determined using the above Waters LC/MS
system. Purification of reaction products was carried out by flash
chromatography using CombiFlash.RTM.Rf with Teledyne Isco
RediSep.RTM.Rf High Performance Gold or Silicycle SiliaSep.TM. High
Performance columns (4 g, 12 g, 24 g, 40 g, 80 g, or 120 g). The
purity of all compounds was over 95% and was analyzed with Waters
LCMS system. .sup.1H NMR and 13C NMR spectra were obtained using a
Varian Inova-600 (600 MHz for .sup.1H and 125 MHz for 13C) or
Varian Inova-400 (400 MHz for .sup.1H) spectrometer. Chemical
shifts are reported relative to chloroform (6=7.24 ppm) or dimethyl
sulfoxide (6=2.50 ppm) for 1H NMR and relative to dimethyl
sulfoxide (6=39.51 ppm) for 13C NMR. Data are reported as
(br=broad, s=singlet, d=doublet, t=triplet, q=quartet,
m=multiplet).
Example 1.1. Preparation of SIK Inhibitor I-7
[0447] In an exemplary experiment, SIK inhibitor I-7 was prepared
according to the methods shown in Scheme 4.
##STR00263##
1-(Allyloxy)-3-nitrobenzene (1)
##STR00264##
[0449] To a solution of 3-nitrophenol (5.0 g, 33.79 mmol) and
K.sub.2CO.sub.3 (14.9 g, 107.88 mmol) in acetone (50 mL) was added
allyl bromide. The reaction mixture was refluxed for 6 h and
partitioned between ethyl acetate and water. The organic layer was
dried over anhydrous sodium sulfate, filtered through a pad of
CELITE, and concentrated under reduced pressure. The residue was
purified by column chromatography on silica gel (0/100 to 20/80,
ethyl acetate:hexane) to afford 1-(allyloxy)-3-nitrobenzene (4.3 g,
66% yield) as a yellow oil.
3-(Allyloxy)aniline (2)
##STR00265##
[0451] To a solution 1-(allyloxy)-3-nitrobenzene (3.0 g, 16.75
mmol) and fine iron powder (2.81 g, 50.26 mmol) in EtOH (30 mL) was
added NH.sub.4Cl solution (5.4 g, 100.52 mmol, in 6 mL water). The
reaction mixture was refluxed for 6 h, and EtOH was removed from
the reaction mixture under reduced pressure. The residue was
basified with a NaHCO.sub.3 solution until pH 7-8 and extracted
with CH.sub.2Cl.sub.2. The organic layer was dried over anhydrous
sodium sulfate, filtered through a pad of CELITE, and concentrated
under reduced pressure. The residue was purified by column
chromatography on silica gel (10/100 to 40/60, ethyl
acetate:hexane) to afford 3-(allyloxy)aniline (2.3 g; yield, 92%)
as a brown oil. Rt: 1.53 min; MS m/z: 149.92 [M+1].sup.+.
N-(3-(Allyloxy)phenyl)-6-chloropyrimidin-4-amine (4)
##STR00266##
[0453] To a solution of 4,6-dichloropyrimidine (1.2 g, 8.05 mmol)
in 2-propanol (IPA, 34 mL) was added 2,4-dimethoxyaniline (1.0 g,
6.71 mmol) and N,N-diisopropylethylamine (DIEA, 2.82 ml, 16.22
mmol). The reaction mixture was stirred at 50.degree. C. for 24 h
and partitioned between ethyl acetate and a saturated aqueous
sodium bicarbonate solution. The organic layer was washed with
brine, dried over anhydrous sodium sulfate, filtered through a pad
of CELITE, and concentrated under reduced pressure. The residue was
purified by column chromatography on silica gel (1:9 to 3:7, ethyl
acetate/hexane) to afford
N-(3-(allyloxy)phenyl)-6-chloropyrimidin-4-amine (1.1 g, 63% yield)
as a violet solid. Rt: 3.37 min; MS m/z: 262.29 [M+1].sup.+.
N4-Allyl-N6-(3-(allyloxy)phenyl)pyrimidine-4,6-diamine (5)
##STR00267##
[0455] To a solution of
N-(3-(allyloxy)phenyl)-6-chloropyrimidin-4-amine (1.0 g, 3.82 mmol)
in 2-propanol (10 mL) was added allylamine (0.428 mL, 5.73 mmol)
and N,N-diisopropylethylamine (1.39 ml, 7.64 mmol). The reaction
mixture was stirred at 100.degree. C. for 24 h and partitioned
between ethyl acetate and a saturated aqueous sodium bicarbonate
solution. The organic layer was washed with brine, dried over
anhydrous sodium sulfate, filtered through a pad of CELITE, and
concentrated under reduced pressure. The residue was purified by
column chromatography on silica gel (1:9 to 5:5, ethyl
acetate/hexane) to afford
N4-allyl-N6-(3-(allyloxy)phenyl)pyrimidine-4,6-diamine (830 mg, 77%
yield).
1-Allyl-1-(6-((3-(allyloxy)phenyl)amino)pyrimidin-4-yl)-3-(2,6-dimethylphe-
nyl)urea (7)
##STR00268##
[0457] To a solution of
N4-allyl-N6-(3-(allyloxy)phenyl)pyrimidine-4,6-diamine (200 mg,
0.71 mmol) in toluene (2 mL) was added 2,6-dimethylphenyl
isocyanate (0.11 mL, 0.85 mmol) and heated at 80.degree. C. for 6
h. The reaction mixture was concentrated under reduced pressure.
The residue was purified by column chromatography on silica gel
(0:100 to 3:97, methanol/dichloromethane) to afford
1-allyl-1-(6-((3-(allyloxy)phenyl)amino)pyrimidin-4-yl)-3-(2,6-dim-
ethylphenyl)urea (160 mg, 53% yield) as an off-white solid.
SIK Inhibitor I-7
[0458] To a solution of
1-allyl-1-(6-((3-(allyloxy)phenyl)amino)pyrimidin-4-yl)-3-(2,6-dimethylph-
enyl)urea (100 mg, 0.23 mmol) in dichloromethane (10 mL) was added
6 N HCl solution (1 mL) and degassed. Zhan catalyst-1B (17 mg, 0.02
mmol) was added in two portions at 2 h intervals. The resulting
mixture was heated at 40.degree. C. for 8 h and partitioned between
methylene chloride and water. The organic layer was washed with
brine, dried over anhydrous sodium sulfate, filtered through a pad
of CELITE, and concentrated under reduced pressure. The crude
product was purified by preparative HPLC to afford SIK inhibitor
I-7 (36 mg, 39% yield) as an off-white solid. Rt: 3.63 min; .sup.1H
NMR 400 MHz (DMSO-d.sub.6) .delta. 12.29 (s, 1H), 9.84 (s, 1H),
8.51 (s, 1H), 7.29 (t, J=8.0 Hz, 1H), 7.15 (m, 3H), 6.88 (m, 1H),
6.74 (m, 2H), 6.41 (s, 1H), 5.85 (m, 1H), 5.66 (m, 1H), 4.95 (m,
2H), 4.16 (m, 2H), 2.57 (s, 6H) ppm; MS m/z: 402.45
[M+1].sup.+.
Example 1.2. Preparation of SIK Inhibitors I-2 to I-6
[0459] In another set of experiments, SIK inhibitors I-2 to I-6
were prepared using methods similar to the ones of Example 1.1.
Exemplary analytical data of these SIK inhibitors are shown in
Table 1. Exemplary analytical data of additional SIK inhibitors o
Formula (I) are also shown in Table 1.
TABLE-US-00001 TABLE 1 Exemplary analytical data of select SIK
inhibitors of Formula (I) LC/MS .sup.1H NMR chemical shift, SIK
retention 400 MHz or 500 MHz.sup.a, DMSO-d.sub.6 or
CDCl.sub.3.sup.b MS m/z, inhibitor time (min) (ppm) [M + 1].sup.+
I-2 2.10 9.57 (s, 1H), 8.41 (d, J = 6.0 Hz, 1H), 7.87 (d, J =
573.65 2.0 Hz, 1H), 7.29 (d, J = 5.6 Hz, 1H), 7.19 (m, 3H), 7.04
(dd, J = 2.8 Hz, J = 8.4 Hz, 1H), 6.98 (d, J = 8.4 Hz, 1H), 5.96
(m, 1H), 5.80 (m, 1H), 4.71 (m, 2H), 4.51 (m, 2H), 4.26 (t, 2H),
4.23 (d, J = 6.4 Hz, 2H), 3.63 (m, 2H), 3.29 (m, 4H), 3.22 (m, 6H),
2.21 (s, 6H), 1.29 (t, J = 6.8 Hz, 3H) I-3 2.15 9.56 (s, 1H), 8.39
(d, J = 5.6 Hz, 1H), 7.87 (d, J = 573.63 2.4 Hz, 1H), 7.53 (d, J =
6.0 Hz, 1H), 7.21 (m, 3H), 7.10 (m, 2H), 5.86 (m, 2H), 4.96 (m,
2H), 4.65 (m, 2H), 4.28 (t, 2H), 4.17 (d, J = 6.4 Hz, 2H), 3.60 (m,
2H), 3.28 (m, 4H), 3.22 (m, 6H), 2.22 (s, 6H), 1.27 (t, J = 6.8 Hz,
3H) I-4 2.22 560.65 I-5 2.28 560.58 I-6 2.37 9.66 (s, 1H), 8.42 (d,
J = 2.4 Hz, 1H), 8.39 (d, J = 548.61 5.6 Hz, 1H), 7.51 (d, J = 6.0
Hz, 1H), 7.23 (m, 3H), 7.10 (dd, J = 2.8 Hz, J = 8.4 Hz, 1H), 7.06
(d, J = 8.4 Hz, 1H), 4.86 (s, 2H), 4.37 (m, 2H), 4.32 (m, 2H), 4.03
(m, 2H), 3.80 (m, 4H), 3.65 (m, 2H), 3.35 (m, 4H), 2.21 (s, 6H),
2.13 (m, 2H), 1.80 (m, 2H) YKL-05- .sup.a 9.82 (s, 1H), 9.34 (s,
1H), 8.16 (s, 1H), 7.18 (m, 414.3 120 3H), 7.06 (t, J = 6.5 Hz,
1H), 6.67 (d, J = 7.0 Hz, 1H), 6.41 (dd, J.sub.1 = 8.0 Hz, J.sub.2
= 2.0 Hz, 1H), 5.58 (m, 2H), 5.10 (dd, J.sub.1 = 14.0 Hz, J.sub.2 =
10.0 Hz, 1H), 4.78-4.86 (m, 1H), 4.62-4.70 (m, 2H), 4.55 (d, J =
14.5 Hz, 1H), 4.44 (d, J = 15.0 Hz, 1H), 2.23 (s, 3H), 2.16 (s, 3H)
YKL-05- 9.60 (s, 1H), 8.14 (s, 1H), 7.88 (s, 1H), 7.26 (t, 428.4
200-1 J = 7.6 Hz, 1H), 7.18-7.15 (m, 3H), 6.98 (d, J = 8.0 Hz, 1H),
6.85 (d, J = 7.6 Hz, 1H), 5.80-5.74 (m, 1H), 5.60-5.54 (m, 1H),
4.61 (s, 2H), 4.56 (d, J = 3.6 Hz, 2H), 4.52 (s, 2H), 4.17 (d, J =
6.0 Hz, 2H), 2.20 (s, 6H) YKL-05- .sup.b 7.75 (s, 1H), 7.62 (s,
1H), 7.36 (t, J = 7.6 Hz, 1H), 428.4 200-2 7.25-7.14 (m, 4H),
7.07(d, J = 7.6 Hz, 3H), 5.75- 5.59 (m, 2H), 4.79 (s, 2H), 4.51 (s,
2H), 4.46 (d, J = 5.6 Hz, 2H), 4.20 (d, J = 6.8 Hz, 4H), 2.28 (s,
6H) YKL-05- 9.69 (s, 1H), 8.17 (s, 1H), 7.86 (s, 1H), 7.46 (dd,
448.3 201-1 J.sub.1 = 6.8 Hz, J.sub.2 = 2.8 Hz, 1H), 7.36-7.31 (m,
2H), 7.27 (t, J = 8.0 Hz, 1H), 6.98 (d, J = 9.2 Hz, 1H), 6.86 (d, J
= 7.6 Hz, 1H), 5.79-5.74 (m, 1H), 5.58- 5.54 (m, 1H), 4.61 (s, 2H),
4.57 (s, 4H), 4.16 (d, J = 6.0 Hz, 2H), 2.27 (s, 3H) YKL-05- 9.58
(s, 1H), 8.17 (s, 1H), 7.74 (s, 1H), 7.45 (dd, 448.3 201-2 J.sub.1
= 6.4 Hz, J.sub.2 = 2.8 Hz, 1H), 7.36-7.31 (m, 2H), 7.20 (t, J =
8.0 Hz, 1H), 6.91 (d, J = 8.8 Hz, 1H), 6.82 (d, J = 7.2 Hz, 1H),
5.82-5.75 (m, 1H), 5.66- 5.60 (m, 1H), 4.69 (s, 2H), 4.57 (s, 2H),
4.33 (d, J = 5.6 Hz, 2H), 4.11 (d, J = 6.8 Hz, 2H), 2.27 (s, 3H)
YKL-05- 9.64 (s, 1H), 9.21 (s, 1H), 8.15 (s, 1H), 7.46-7.44 532.4
202-1 (m, 1H), 7.34-7.33 (m, 2H), 6.74 (d, J = 8.4 Hz, 1H), 6.62
(dd, J.sub.1 = 8.4 Hz, J.sub.2 = 2.0 Hz, 1H), 5.66- 5.49 (m, 2H),
5.11-5.04 (m, 1H), 4.86-4.78 (m, 1H), 4.72-4.59 (m, 3H), 4.46 (dd,
J.sub.1 = 14.0 Hz, J.sub.2 = 5.2 Hz, 1H), 2.93 (s, 4H), 2.46 (s,
4H), 2.30-2.22 (m, 6H) YKL-05- 8.12 (s, 1H), 7.52 (d, J = 2.0 Hz,
1H), 7.43-7.41 532.4 202-2 (m, 1H), 7.32-7.28 (m, 2H), 6.75 (d, J =
8.4 Hz, 1H), 6.53 (dd, J.sub.1 = 8.4 Hz, J.sub.2 = 2.0 Hz, 1H),
5.80 (dt, J.sub.1 = 16 Hz, J.sub.2 = 4.0 Hz, 1H), 5.49-5.45 (m,
1H), 4.80 (d, J = 5.2 Hz, 2H), 4.55-4.47 (m, 4H), 2.95 (s, 4H),
2.62 (s, 4H), 2.32 (s, 3H), 2.22 (s, 3H) YKL-05- 9.81 (s, 1H), 9.32
(s, 1H), 8.19 (s, 1H), 7.46-7.45 434.3 203-1 (m, 1H), 7.35-7.33 (m,
2H), 7.06 (t, J = 8.0 Hz, 1H), 6.68 (d, J = 8.0 Hz, 1H), 6.42 (dd,
J.sub.1 = 8.8 Hz, J.sub.2 = 1.6 Hz, 1H), 5.65-5.50 (m, 2H),
5.13-5.07 (m, 1H), 4.89-4.81 (m, 1H), 4.74-4.63 (m, 2H), 4.57-4.47
(m, 2H), 2.31 (s, 1.5H), 2.24 (s, 1.5H) YKL-05- 9.72 (s, 1H), 8.18
(s, 1H), 7.64 (s, 1H), 7.44 (dd, J.sub.1 = 434.3 203-2 6.4 Hz,
J.sub.2 = 4.0 Hz, 1H), 7.34-7.32 (m, 2H), 7.06 (t, J = 8.4 Hz, 1H),
6.59 (d, J = 7.6 Hz, 1H), 6.47 (d, J = 8.4 Hz, 1H), 5.86 (dt,
J.sub.1 = 15.6 Hz, J.sub.2 = 4.4 Hz, 1H), 5.52 (dt, J.sub.1 = 16.4
Hz, J.sub.2 = 6.4 Hz, 1H), 4.77 (d, J = 4.8 Hz, 2H), 4.55 (dd,
J.sub.1 = 18.4 Hz, J.sub.2 = 14.4 Hz, 4H), 2.25 (s, 3H) YKL-05-
9.61 (s, 1H), 9.23 (d, J = 2.0 Hz 1H), 8.39 (s, 1H), 512.4 204-1
8.12 (s, 1H), 7.17(m, 3H), 6.73 (d, J = 8.4 Hz, 1H), 6.61(dd,
J.sub.1 = 8.4 Hz, J.sub.2 = 2.0 Hz, 1H), 5.63 (t, J = 10.8 Hz, 1H),
5.54 (t, J = 9.6 Hz, 1H), 5.07 (dd, J.sub.1 = 14 Hz, J.sub.2 = 10.8
Hz, 1H), 4.80 (dd, J.sub.1 = 16 Hz, J.sub.2 = 9.6 Hz, 1H),
4.67-4.61 (m, 3H), 4.40 (d, J = 14.4 Hz, 1H), 2.92 (s, 4H), 2.45
(s, 4H), 2.22 (d, J = 5.6 Hz, 6H), 2.15 (s, 3H) YKL-05- 9.47 (s,
1H), 8.41 (s, 1H), 8.12 (s, 1H), 7.57 (d, J = 512.4 204-2 1.6 Hz,
1H), 7.16 (s, 3H), 6.73 (d, J = 8.4 Hz, 1H), 6.53 (dd, J.sub.1 =
8.4 Hz, J.sub.2 = 1.6 Hz, 1H), 5.84 (dt, J.sub.1 = 16.4 Hz, J.sub.2
= 4.8 Hz, 1H), 5.48 (dt, J.sub.1 = 16.4 Hz, J.sub.2 = 5.6 Hz, 1H),
4.81 (d, J = 5.6 Hz, 2H), 4.51-4.47 (m, 4H), 2.92 (m, 4H), 2.45 (m,
4H), 2.21 (s, 3H), 2.18 (s, 6H) YKL-05- 416.4 205
Example 1.3. Preparation of SIK Inhibitor II-1
[0460] In an exemplary experiment, SIK inhibitor II-1 was prepared
according to the method shown in Scheme 2.
N-(2,6-dimethylphenyl)-1H-imidazol-2-amine
##STR00269##
[0462] To a solution of cyanogen bromide (25 g, 236.03 mmol) in
hexane (80 mL) was added a solution of the amino-acetaldehyde
diethyl acetal (34.3 mL, 236.03 mmol) in diethyl ether (80 mL) at
room temperature. The resulting mixture was stirred overnight. A
white solid was formed and was removed by filtration and washed
with diethyl ether. The filtrate was concentrated and purified by
flash chromatography on silica gel (eluted with 0/100 to 5/95
methanol/dichloromethane) to afford
N-(2,2-diethyloxyethyl)carbodiimide (27 g, 72% yield) as a bright
yellow oil. Rt (retention time)=1.82 min; MS m/z: 159.20 [M+1].
[0463] To a solution of 2,6-dimethylaniline (5.0 g, 41.29 mmol) and
N-(2,2-diethyloxyethyl)carbodiimide (7.8 g, 49.55 mmol) in ethanol
(100 mL) was added methanesulfonic acid (3.2 mL, 49.55 mL). The
resulting mixture was refluxed for 20 h, concentrated, and
dissolved in a 6.0 N HCl solution (30 mL). After stirring for 8 h,
the resulting mixture was neutralized with a 10 N NaOH solution at
0.degree. C. to pH 6. A saturated sodium carbonate solution was
added so that the pH of the resulting mixture was about 13. A solid
was produced and was filtered and dried to afford
N-(2,6-dimethylphenyl)-1H-imidazol-2-amine (3.8 g, 49% yield).
Rt=1.57 min; .sup.1H NMR (600 MHz; DMSO-d.sub.6) .delta. 10.25 (s,
1H), 7.28 (s, 1H), 6.97 (m, 2H), 6.92 (m, 1H), 6.49 (s, 1H), 6.36
(s, 1H), 2.07 (s, 6H) ppm; MS m/z: 188.23 [M+1].
1-(6-Chloropyrimidin-4-yl)-N-(2,6-dimethylphenyl)-1H-imidazol-2-amine
##STR00270##
[0465] To a solution of N-(2,6-dimethylphenyl)-1H-imidazol-2-amine
(1.0 g, 5.34 mmol) and N,N-diisopropylethylamine (1.8 mL, 10.69
mmol) in 2-butanol (10 mL) was added 4,6-dichloropyrimidine (1.2 g,
8.02 mmol). The resulting mixture was heated at 120.degree. C.
overnight, cooled, and partitioned between a saturated aqueous
potassium carbonate solution and a mixed solvents of
CHCl.sub.3/2-propanol (4/1). The organic phase was separated, dried
over anhydrous sodium sulfate, filtered through a pad of CELITE,
and concentrated. The residue was purified by flash chromatography
on silica gel (eluted with 1/99 to 5/95 ammonia (7.0 N in methanol)
in methanol/dichloromethane) to afford
1-(6-chloropyrimidin-4-yl)-N-(2,6-dimethylphenyl)-1H-imidazol-2-amine
(1.3 g, 81% yield) as an off-white solid. Rt=1.97 min, .sup.1H NMR
(600 MHz; DMSO-d.sub.6) .delta. 9.46 (s, 1H), 9.01 (d, J=4.2 Hz,
1H), 8.15 (d, J=4.2 Hz, 1H), 7.71 (m, 1H), 7.16 (m, 3H), 6.70 (s,
1H), 2.25 (m, 6H) ppm; MS m/z: 300.19 [M+1].
SIK Inhibitor II-1
[0466] To a solution of
1-(6-chloropyrimidin-4-yl)-N-(2,6-dimethylphenyl)-1H-imidazol-2-amine
(100 mg, 0.33 mmol) and 4-(4-ethylpiperazin-1-yl)aniline (68 mg,
0.33 mmol) in 2-butanol (1 mL) was added trifluoroacetic acid (TFA,
0.1 mL). The resulting mixture was stirred at 120.degree. C. for 4
h, concentrated, and diluted with dimethyl sulfoxide (6 mL). The
resulting mixture was purified with preparative HPLC to afford
6-(2-((2,6-dimethylphenyl)amino)-1H-imidazol-1-yl)-N-(4-(4-ethylpiperazin-
-1-yl)phenyl)pyrimidin-4-amine TFA salt (78 mg, 41% yield) as an
off-white solid. Rt=1.93 min; .sup.1H NMR (600 MHz; DMSO-d.sub.6)
.delta. 10.71 (br, 1H), 10.02 (s, 1H), 9.97 (br, 1H), 8.54 (s, 1H),
7.65 (s, 1H), 7.48 (d, J=6.6 Hz, 2H), 7.20 (m, 4H), 7.10 (s, 1H),
7.01 (d, J=9.0 Hz, 2H), 6.95 (s, 1H), 3.78 (m, 2H), 3.56 (m, 2H),
3.17 (m, 2H), 3.09 (m, 2H), 2.94 (m, 2H), 2.18 (s, 6H), 1.23 (m,
3H) ppm; MS m/z: 469.46 [M+1].
Example 1.4. Preparation of SIK Inhibitors II-2 to II-12
[0467] In another set of experiments, SIK inhibitors 11-2 to 11-12
were prepared using methods similar to the ones of Example 1.3.
Exemplary analytical data of these SIK inhibitors are shown in
Table 2.
TABLE-US-00002 TABLE 2 Exemplary analytical data of SIK inhibitors
II-2 to II-12 SIK LC/MS retention time MS m/z, inhibitor (min) [M +
1].sup.+ II-2 3.05 451.31 II-3 3.02 431.40 II-4 2.73 381.31 II-5
581.7 II-6 567.7 II-7 594.7 II-8 581.6 II-9 537.7 II-10 606.7 II-11
636.6 II-12 552.7
Example 1.5. Preparation of SIK Inhibitor III-1
[0468] In an exemplary experiment, SIK inhibitor III-1 was prepared
according to the methods shown in Scheme 5.
##STR00271## ##STR00272##
6-Chloro-N-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-4-amine
(8)
[0469] To a solution of 4-(4-methylpiperazin-1-yl)aniline (5.0 g,
26.16 mmol) and N,N-diisopropylethylamine (6.8 g, 39.24 mmol) in
2-propanol (50 mL) was added 4,6-dichloropyrimidine (5.8 g, 39.24
mmol) and stirred at room temperature for 24 h. The reaction
mixture was partitioned between saturated aqueous potassium
carbonate solution and CHCl.sub.3/2-propanol (4/1) solvents. The
organic phase was separated, dried over anhydrous sodium sulfate,
filtered through a pad of CELITE, and concentrated. The residue was
purified by column chromatography on silica gel (1/99 to 7/93,
ammonia solution 7.0 N in methanol/dichloromethane) to afford
6-chloro-N-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-4-amine (6.2
g, 78% yield) as a dark violet solid. Rt=1.68 min, .sup.1H NMR 600
MHz (CDCl.sub.3) .delta. 8.32 (s, 1H), 7.09 (d, J=9.0 Hz, 2H), 6.91
(br, 1H), 6.89 (d, J=9.0 Hz, 2H), 6.44 (s, 1H), 3.17 (m, 4H), 2.53
(m, 4H), 2.30 (s, 3H) ppm; MS m/z: 304.16 [M+1].
tert-Butyl
(6-chloropyrimidin-4-yl)(4-(4-methylpiperazin-1-yl)phenyl)carba-
mate (9)
[0470] To a solution of
6-chloro-N-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-4-amine (6.0
g, 19.79 mmol) and 4-dimethylaminopyridine (3.6 g, 29.69 mmol) in
dichloromethane (60 mL) was added di-tert-butyl dicarbonate (5.2 g,
23.75 mmol). The mixture was stirred at room temperature for 4 h
and partitioned between ethyl acetate and water. The organic layer
was washed with brine, dried over anhydrous sodium sulfate,
filtered through a pad of CELITE, and concentrated under reduced
pressure. The residue was purified by column chromatography on
silica gel (1/99 to 15/85, methanol/dichloromethane) to afford
tert-butyl
(6-chloropyrimidin-4-yl)(4-(4-methylpiperazin-1-yl)phenyl)carbamate
(7.1 g, 89% yield) as an off-white solid. Rt=2.45 min, .sup.1H NMR
600 MHz (CDCl.sub.3) .delta. 8.51 (s, 1H), 7.94 (s, 1H). 6.91 (d,
J=7.8 Hz, 2H), 6.87 (d, J=8.4 Hz, 2H), 3.19 (m, 4H), 2.51 (m, 4H),
2.29 (s, 3H), 1.35 (s, 9H) ppm; MS m/z: 404.47 [M+1].
tert-Butyl
(6-((2,4-dimethoxyphenyl)amino)pyrimidin-4-yl)(4-(4-methylpiper-
azin-1-yl)phenyl)carbamate (10)
[0471] A mixture of tert-butyl
(6-chloropyrimidin-4-yl)(4-(4-methylpiperazin-1-yl)phenyl)carbamate
(3.0 g, 7.44 mmol), 2,4-dimethoxyaniline (2.3 g, 14.88 mmol), and
K.sub.2CO.sub.3 (4.1 g, 29.76 mmol) in 2-butanlol (30 mL) was
degassed for 10 min. To the reaction mixture were added
Pd.sub.2(dba).sub.3 (408 mg, 0.45 mmol) and X-phos
(2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl, 319 mg,
0.67 mmol). The resulting mixture was heated at 100.degree. C. for
4 hours and filtered with a pad of CELITE. The filtrate was
concentrated under reduced pressure. The residue was purified by
column chromatography on silica gel (3/97 to 15/85,
methanol/dichloromethane) to afford tert-butyl
(6-((2,4-dimethoxyphenyl)amino)pyrimidin-4-yl)(4-(4-methylpiperazin-1-yl)-
phenyl)carbamate (2.2 g, 57% yield) as a yellow solid. Rt=2.13 min;
MS m/z: 521.43 [M+1].
tert-Butyl
(6-(1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)ureido)pyrimi-
din-4-yl)(4-(4-methylpiperazin-1-yl)phenyl)carbamate (11)
[0472] A 5 mL microwave vial was charged with tert-butyl
(6-((2,4-dimethoxyphenyl)amino)pyrimidin-4-yl)
(4-(4-methylpiperazin-1-yl)phenyl)carbamate (300 mg, 0.58 mmol),
2,6-dimethylphenyl isocyanate (0.32 mL, 2.31 mmol), and toluene (2
mL). The vial was sealed and heated at 130.degree. C. for 1 h. To
the vial was additionally added 2,6-dimethylphenyl isocyanate (0.16
mL, 2.35 mmol), and the resulting mixture was heated at 130.degree.
C. for 1 h. The reaction mixture was concentrated under reduced
pressure. The residue was purified by column chromatography on
silica gel (1/99 to 10/90, methanol/dichloromethane) to afford
tert-butyl
(6-(1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)ureido)pyrimidin-4-yl)(-
4-(4-methylpiperazin-1-yl)phenyl)carbamate (290 mg, 75% yield) as
an off-white solid. Rt=2.85 min; MS m/z: 668.48 [M+1].
1-(2,4-Dimethoxyphenyl)-3-(2,6-dimethylphenyl)-1-(6-((4-(4-methylpiperazin-
-1-yl)phenyl)amino)pyrimidin-4-yl)urea (III-1)
[0473] To a solution of tert-butyl
(6-(1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)ureido)pyrimidin-4-yl)(-
4-(4-methylpiperazin-1-yl)phenyl)carbamate (200 mg, 0.30 mmol) in
dichloromethane (2 mL) was added trifluoroacetic acid (0.11 mL,
1.50 mmol). The resulting mixture was stirred for 4 h,
concentrated, and diluted with dimethyl sulfoxide (6 mL). The
resulting mixture was purified with preparative HPLC to afford
1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)-1-(6-((4-(4-methylpiperazi-
n-1-yl)phenyl)amino)pyrimidin-4-yl)urea (186 mg, 93% yield) as an
off-white TFA salt. Rt=2.25 min; .sup.1H NMR 600 MHz (DMSO-d.sub.6)
.delta. 11.54 (s, 1H), 9.19 (s, 1H), 8.38 (s, 1H), 7.29 (m, 2H),
7.15 (d, J=9.0 Hz, 1H), 7.07 (m, 3H), 6.85 (d, J=8.4 Hz, 2H), 6.74
(d, J=2.4 Hz, 1H), 6.63 (dd, J=8.4 Hz, J=2.4 Hz, 1H), 5.70 (s, 1H),
3.82 (s, 3H), 3.74 (s, 3H), 3.05 (m, 4H), 2.44 (m, 4H), 2.23 (s,
6H), 2.22 (s, 3H) ppm; 13C NMR 125 MHz (DMSO-d.sub.6) .delta.
161.24, 160.34, 160.28, 156.51, 156.03, 152.59, 146.88, 135.46,
134.90, 131.38, 127.64, 125.99, 121.43, 120.62, 115.76, 105.42,
99.68, 55.75, 55.41, 48.57, 45.68, 18.30 ppm; MS m/z: 568.41
[M+1].
Example 1.6. Preparation of SIK Inhibitor III-2
[0474] In an exemplary experiment, SIK inhibitor III-2 was prepared
according to the methods shown in Scheme 6.
##STR00273## ##STR00274##
6-Chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (12)
[0475] To a solution of 4,6-dichloropyrimidine (1.2 g, 8.11 mmol)
in 2-propanol (34 mL) was added 2,4-dimethoxyaniline (1.03 g, 6.75
mmol) and N,N-diisopropylethylamine (2.82 ml, 16.22 mmol). The
reaction mixture was stirred at 50.degree. C. for 24 h and
partitioned between ethyl acetate and saturated aqueous sodium
bicarbonate solution. The organic layer was washed with brine,
dried over anhydrous sodium sulfate, filtered through a pad of
CELITE, and concentrated under reduced pressure. The residue was
purified by column chromatography on silica gel (1:9 to 3:7, ethyl
acetate/hexane) to afford
6-chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (1.4 g, 78%
yield) as a violet solid. Rt=2.88 min; .sup.1H NMR 600 MHz
(CDCl.sub.3) .delta. 8.39 (s, 1H), 7.44 (bs, 1H), 7.37 (bs, 1H),
6.49-6.52 (m, 3H), 3.81 (m, 6H) ppm; .sup.1H NMR 600 MHz
(DMSO-d.sub.6) .delta. 9.02 (s, 1H), 8.23 (s, 1H), 7.36 (bs, 1H),
6.60 (d, J=2.4 Hz, 1H), 6.47 (m, 1H), 3.68 (m, 6H) ppm; MS m/z:
266.13 [M+1].
N4-(2,4-Dimethoxyphenyl)-N6-(4-(4-ethylpiperazin-1-yl)phenyl)pyrimidine-4,-
6-diamine (13)
[0476] A mixture of
6-chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (1.24 g, 4.68
mmol), 4-(4-ethylpiperazin-1-yl)aniline (800 mg, 3.90 mmol), and
K.sub.2CO.sub.3 (1.6 g, 11.70 mmol) in 2-butanlol (10 mL) was
degassed for 10 min. To the reaction mixture were added
Pd.sub.2(dba).sub.3 (214 mg, 0.23 mmol) and X-phos
(2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl, 167 mg,
0.35 mmol), and the resulting mixture was heated at 100.degree. C.
for 4 hours after which and filtered with a pad of CELITE. The
filtrate was concentrated under reduced pressure. The residue was
purified by column chromatography on silica gel (3/97 to 15/85,
methanol/dichloromethane) to afford
N4-(2,4-dimethoxyphenyl)-N6-(4-(4-ethylpiperazin-1-yl)phenyl)pyrim-
idine-4,6-diamine (1.3 g, 77% yield) as a violet solid. Rt=1.68
min; .sup.1H NMR 600 MHz (DMSO-d.sub.6) .delta. 8.63 (s, 1H), 8.04
(s, 1H), 7.99 (s, 1H), 7.35 (d, J=7.8 Hz, 1H), 7.27 (d, J=9.0 Hz,
2H), 6.84 (d, J=8.4 Hz, 2H), 6.61 (d, J=2.4 Hz, 1H), 6.48 (m, 1H),
5.68 (s, 1H), 3.75 (s, 3H), 3.74 (s, 3H), 3.03 (m, 4H), 2.48 (m,
4H), 2.36 (q, 2H), 1.01 (t, J=6.6 Hz, 3H) ppm; MS m/z: 435.49
[M+1].
1-(2,4-Dimethoxyphenyl)-3-(2,6-dimethylphenyl)-1-(6-((4-(4-ethylpiperazin--
1-yl)phenyl)amino)pyrimidin-4-yl)urea (III-2)
[0477] A 5 mL microwave vial was charged with
N4-(2,4-dimethoxyphenyl)-N6-(4-(4-ethylpiperazin-1-yl)phenyl)pyrimidine-4-
,6-diamine (200 mg, 0.46 mmol), 2,6-dimethylphenyl isocyanate (338
mg, 2.30 mmol) and toluene (2 mL). The vial was sealed and heated
at 130.degree. C. for 1 h. To the vial was additionally added
2,6-dimethylphenyl isocyanate (338 mg, 2.30 mmol), and the
resulting mixture was heated at 130.degree. C. for 1 h. Two
regioisomers,
1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)-1-(6-((4-(4-ethylpiperazin-
-1-yl)phenyl)amino)pyrimidin-4-yl)urea and
1-(6-((2,4-dimethoxyphenyl)amino)pyrimidin-4-yl)-3-(2,6-dimethylphenyl)-1-
-(4-(4-ethylpiperazin-1-yl)phenyl)urea were generated in a ratio of
1:1, as indicated by HPLC analysis. The reaction mixture was
concentrated under reduced pressure. The residue was purified by
column chromatography on silica gel (1:99 to 7:93,
methanol/dichloromethane) and additionally purified with HPLC to
afford
1-(2,4-dimethoxyphenyl)-3-(2,6-dimethylphenyl)-1-(6-((4-(4-ethylpiperazin-
-1-yl)phenyl)amino)pyrimidin-4-yl)urea (72 mg, 23% yield) as an
off-white solid. Rt=2.28 min; .sup.1H NMR 600 MHz (DMSO-d.sub.6)
.delta. 9.44 (br, 1H), 9.36 (br, 1H), 8.39 (s, 1H), 7.38 (m, 2H),
7.17 (d, J=8.4 Hz, 1H), 7.06 (m, 3H), 6.93 (d, J=8.4 Hz, 2H), 6.74
(m, 1H), 6.63 (d, J=6.6 Hz, 1H), 5.76 (s, 1H), 3.90 (m, 2H), 3.72
(s, 3H), 3.69 (s, 3H), 3.61 (m, 2H), 3.22 (m, 2H), 3.11 (m, 2H),
3.00 (m, 2H), 2.20 (s, 6H), 1.23 (m, 3H) ppm; MS m/z: 582.64
[M+1].
1-(6-((2,4-Dimethoxyphenyl)amino)pyrimidin-4-yl)-3-(2,6-dimethylphenyl)-1--
(4-(4-ethylpiperazin-1-yl)phenyl)urea
[0478] Rt=2.38 min; 1H NMR 600 MHz (DMSO-d.sub.6) .delta. 9.65 (br,
1H), 9.35 (br, 1H), 8.32 (s, 1H), 8.31 (s, 1H), 7.24 (br, 1H), 7.18
(d, J=7.8 Hz, 2H), 7.11 (d, J=7.8 Hz, 2H), 7.06 (m, 3H), 6.54 (s,
1H), 6.45 (d, J=8.4 Hz, 1H), 5.56 (br, 1H), 3.90 (m, 2H), 3.72 (s,
3H), 3.69 (s, 3H), 3.61 (m, 2H), 3.28 (m, 2H), 3.11 (m, 2H), 3.00
(m, 2H), 2.20 (s, 6H), 1.25 (m, 3H) ppm; MS m/z: 582.64 [M+1].
Example 1.7. Preparation of SIK Inhibitor III-3
[0479] In an exemplary experiment, SIK inhibitor III-3 was prepared
according to the methods shown in Scheme 7.
##STR00275##
6-Chloro-N-methylpyrimidin-4-amine (16)
[0480] To a solution of 4,6-dichloropyrimidine (5.0 g, 33.79 mmol)
in anhydrous THF (50 mL) was slowly added 2.0 M methylamine
solution in THF (42.2 mL, 84.48 mmol) at -40.degree. C. The
reaction mixture was stirred at 0.degree. C. for 4 h and
partitioned between CHCl.sub.3/2-propanol (4/1) and water. The
organic layer was dried over anhydrous sodium sulfate, filtered
through a pad of CELITE, and concentrated under reduced pressure.
The white solid 6-chloro-N-methylpyrimidin-4-amine (4.2 g, 87%
yield) was used in the next reaction without purification. Rt=1.55
min; .sup.1H NMR 600 MHz (CDCl.sub.3) .delta. 8.13 (br, 1H), 6.54
(m, 1H), 5.37 (br, 1H), 2.99 (m, 3H) ppm; MS m/z: 144.05 [M+1].
N4-Methyl-N6-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidine-4,6-diamine
(17)
[0481] A mixture of 4-(4-methylpiperazin-1-yl)aniline (500 mg, 2.62
mmol), 6-chloro-N-methylpyrimidin-4-amine (580 mg, 3.92 mmol), and
K.sub.2CO.sub.3 (1.8 g, 13.08 mmol) in 2-butanlol (5 mL) was
degassed for 10 min. To the resulting mixture were added
Pd.sub.2(dba).sub.3 (143 mg, 0.16 mmol) and X-phos
(2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl, 112 mg,
0.24 mmol), and the resulting mixture was heated at 100.degree. C.
for 4 hours and filtered with a pad of CELITE. The filtrate was
concentrated under reduced pressure. The residue was purified by
column chromatography on silica gel (1/99 to 7/93, ammonia solution
7.0 N in methanol/dichloromethane) to afford
N4-methyl-N6-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidine-4,6-diamine
(680 mg, 87% yield) as a brown solid. Rt=1.23 min; .sup.1H NMR 600
MHz (CDCl.sub.3) .delta. 8.11 (m, 1H), 7.15 (m, 2H), 6.92 (m, 2H),
6.60 (m, 1H), 5.49 (m, 1H), 4.78 (m, 1H), 3.17 (m, 4H), 2.77 (m,
3H), 2.56 (m, 4H), 2.33 (s, 3H) ppm; MS m/z: 299.43 [M+1].
3-(2,6-Dimethylphenyl)-1-methyl-1-(6-((4-(4-methylpiperazin-1-yl)phenyl)am-
ino)pyrimidin-4-yl)urea (III-3)
[0482] To a solution of
N4-methyl-N6-(4-(4-methylpiperazin-1-yl)phenyl)pyrimidine-4,6-diamine
(200 mg, 0.67 mmol) in toluene (2 mL) was added 2,6-dimethylphenyl
isocyanate (0.11 mL, 0.80 mmol). The resulting mixture was heated
at 80.degree. C. for 6 h and concentrated under reduced pressure.
The residue was purified by column chromatography on silica gel
(1:99 to 15:85, methanol/dichloromethane) and additionally purified
with preparative HPLC to afford
3-(2,6-dimethylphenyl)-1-methyl-1-(6-((4-(4-methylpiperazin-1-yl)phenyl)a-
mino)pyrimidin-4-yl)urea (110 mg, 30% yield) as an off-white TFA
salt. Rt=2.52 min; .sup.1H NMR 600 MHz (DMSO-d.sub.6) .delta. 11.47
(s, 1H), 9.96 (br, 1H), 9.48 (s, 1H), 8.37 (s, 1H), 7.44 (m, 2H),
7.05 (m, 3H), 7.01 (m, 2H), 6.41 (s, 1H), 3.74 (m, 2H), 3.49 (m,
2H), 3.28 (s, 3H), 3.13 (m, 2H), 2.90 (m, 2H), 2.82 (s, 3H), 2.15
(s, 6H) ppm; MS m/z: 446.33 [M+1].
Example 1.8. Preparation of SIK Inhibitor III-4
[0483] In an exemplary experiment, SIK inhibitor III-4 was prepared
according to the methods shown in Scheme 8.
##STR00276##
2-Chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (14)
[0484] To a solution of 2,4-dichloropyrimidine (6.0 g, 40 mmol) and
N,N-diisopropylethylamine (15.6 g, 120 mmol) in 2-propanol (40 mL)
was added 2,4-dimethoxyaniline (6.2 g, 40 mmol). The resulting
mixture was stirred at room temperature for 2 days. The reaction
mixture was partitioned between saturated aqueous potassium
carbonate solution and CHCl.sub.3/2-propanol (4/1) solvents. The
organic phase was separated, dried over anhydrous sodium sulfate,
filtered through a pad of CELITE, and concentrated to afford crude
2-chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (9.3 g, 87%
yield) as a violet solid. The product was used without further
purification. Rt=2.82 min; .sup.1H NMR 600 MHz (CDCl.sub.3) .delta.
8.11 (m, 1H), 7.32 (m, 1H), 6.99 (br, 1H), 6.57 (m, 2H), 6.46 (m,
1H), 3.89 (s, 3H), 3.87 (s, 3H) ppm; MS m/z: 266.20 [M+I].
2,6-Dimethylphenyl
(2-chloropyrimidin-4-yl)(2,4-dimethoxyphenyl)carbamate (15)
[0485] To a solution of 2,6-dimethylphenol (3.44 g, 28.18 mmol) in
dichloromethane (140 mL) was added slowly a solution of 15 wt. %
phosgene in toluene (20 mL, 28.18 mmol) at 0.degree. C. Pyridine
(2.30 mL, 28.18 mmol) was added dropwise and the reaction was
allowed to warm to room temperature overnight. The reaction mixture
was diluted with ethyl acetate and partitioned between ethyl
acetate and 1 N HCl solution. The organic layer was separated and
washed with 1 N HCl solution and brine, dried over anhydrous sodium
sulfate, filtered with a pad of CELITE, and concentrated to afford
2,6-dimethylphenyl chloroformate (4.8 g, 93% yield) as a yellow
oil. The product used without further purification.
[0486] To a solution
2-chloro-N-(2,4-dimethoxyphenyl)pyrimidin-4-amine (2.0 g, 7.55
mmol) and N,N-diisopropylethylamine (3.94 mL, 22.64 mmol) in
tetrahydrofuran (20 mL) was added 2,6-dimethylphenyl chloroformate
(1.52 g, 8.30 mmol). The resulting mixture was stirred at room
temperature for 24 h and diluted with ethyl acetate. The resulting
mixture was partitioned between ethyl acetate and saturated aqueous
sodium carbonate solution. The organic layer was washed with brine,
dried over anhydrous sodium sulfate, filtered with a pad of CELITE,
and concentrated under reduced pressure. The residue was purified
by column chromatography on silica gel (0/100 to 3/97,
methanol/dichloromethane) to afford 2,6-dimethylphenyl
(2-chloropyrimidin-4-yl)(2,4-dimethoxyphenyl)carbamate (2.7 g, 87%
yield) as an orange solid. Rt=3.95 min; .sup.1H NMR 600 MHz
(CDCl.sub.3) .delta. 8.38 (d, J=6.0 Hz, 1H), 8.09 (d, J=6.0 Hz,
1H), 7.12 (d, J=9.0 Hz, 1H), 6.95 (m, 3H), 6.51 (m, 2H), 6.46 (m,
1H), 3.78 (s, 3H), 3.71 (s, 3H), 2.08 (s, 6H) ppm; MS m/z: 414.31
[M+1].
2,6-Dimethylphenyl
(2,4-dimethoxyphenyl)(2-((3,4,5-trimethoxyphenyl)amino)pyrimidin-4-yl)car-
bamate (III-4)
[0487] To a solution of 2,6-dimethylphenyl
(2-chloropyrimidin-4-yl)(2,4-dimethoxyphenyl)carbamate (100 mg,
0.24 mmol) in 2-butanol (1 mL) was added trifluoroacetic acid (0.1
mL). The resulting mixture was stirred at 120.degree. C. for 8 h,
concentrated, and diluted with dimethyl sulfoxide (6 mL). The
resulting mixture was purified with preparative HPLC to afford
2,6-dimethylphenyl
(2,4-dimethoxyphenyl)(2-((3,4,5-trimethoxyphenyl)amino)pyrimidin-4-yl)car-
bamate (121 mg, 76% yield) as an off-white TFA salt. Rt=3.40 min;
.sup.1H NMR 600 MHz (DMSO-d.sub.6) .delta. 9.12 (s, 1H), 8.29 (m,
1H), 7.26 (m, 1H), 7.06 (m, 1H), 7.00 (m, 3H), 6.86 (m, 2H), 6.65
(m, 1H), 6.53 (m, 1H), 3.72 (m, 6H), 3.57 (m, 6H), 3.51 (m, 3H),
2.01 (m, 6H) ppm; MS m/z: 561.53 [M+1].
Example 1.9. Preparation of SIK Inhibitor III-5
[0488] In an exemplary experiment, SIK inhibitor III-5 was prepared
according to the methods shown in Scheme 9.
##STR00277##
2-Chloro-N-methylpyrimidin-4-amine (18)
[0489] To a solution of 2,4-dichloropyrimidine (5.0 g, 33.79 mmol)
in anhydrous THF (50 mL) was slowly added 2.0 M methylamine
solution in THF (42.2 mL, 84.48 mmol) at -40.degree. C. The
reaction mixture was stirred at 0.degree. C. for 4 h and
partitioned between CHCl.sub.3/2-propanol (4/1) and water. The
organic layer was dried over anhydrous sodium sulfate, filtered
through a pad of CELITE, and concentrated under reduced pressure.
The residue was purified by column chromatography on silica gel
(100% dichloromethane) to afford 2-chloro-N-methylpyrimidin-4-amine
(2.8 g, 58% yield) as a white solid. Rt=1.15 min; .sup.1H NMR 600
MHz (DMSO-d.sub.6) .delta. 8.02 (s, 1H), 6.22 (m, 1H), 2.86 (d,
J=4.8 Hz, 3H) ppm; MS m/z: 144.12 [M+1].
2,6-Dimethylphenyl (2-chloropyrimidin-4-yl)(methyl)carbamate
(19)
[0490] To a solution 2-chloro-N-methylpyrimidin-4-amine (1.0 g,
6.99 mmol) and N,N-diisopropylethylamine (3.65 mL, 20.97 mmol) in
tetrahydrofuran (10 mL) was added 2,6-dimethylphenyl chloroformate
(1.92 g, 10.49 mmol). The resulting mixture was stirred at room
temperature for 24 h and diluted with ethyl acetate. The resulting
mixture was partitioned between ethyl acetate and saturated aqueous
sodium carbonate solution. The organic layer was washed with brine,
dried over anhydrous sodium sulfate, filtered with a pad of CELITE,
and concentrated under reduced pressure. The residue was purified
by column chromatography on silica gel (0/100 to 1/97,
methanol/dichloromethane) to afford 2,6-dimethylphenyl
(2-chloropyrimidin-4-yl)(methyl)carbamate (1.65 g, 81% yield) as a
white solid. Rt=3.87 min; .sup.1H NMR 600 MHz (CDCl.sub.3) .delta.
8.36 (d, J=6.0 Hz, 1H), 8.06 (d, J=6.0 Hz, 1H), 7.03 (m, 3H), 3.68
(s, 3H), 2.14 (s, 6H) ppm; MS m/z: 292.24 [M+1].
2,6-Dimethylphenyl
methyl(2-((4-(4-methylpiperazin-1-yl)phenyl)amino)pyrimidin-4-yl)carbamat-
e (III-5)
[0491] To a solution of 2,6-dimethylphenyl
(2-chloropyrimidin-4-yl)(methyl)carbamate (100 mg, 0.34 mmol) and
4-(4-methylpiperazin-1-yl)aniline (98 mg, 0.52 mmol) in 2-butanol
(1 mL) was added trifluoroacetic acid (0.1 mL). The resulting
mixture was stirred at 120.degree. C. for 8 h, concentrated, and
diluted with dimethyl sulfoxide (6 mL). The resulting mixture was
purified with preparative HPLC to afford 2,6-dimethylphenyl
methyl(2-((4-(4-methylpiperazin-1-yl)phenyl)amino)pyrimidin-4-yl)carbamat-
e (123 mg, 66% yield) as an off-white TFA salt. Rt=2.50 min;
.sup.1H NMR 600 MHz (DMSO-d.sub.6) .delta. 10.14 (s, 1H), 9.50 (s,
1H), 8.28 (m, 1H), 7.57 (m, 2H), 7.29 (m, 1H), 7.10 (m, 3H), 6.94
(m, 2H), 3.71 (m, 2H), 3.59 (s, 3H), 3.38 (m, 2H), 3.13 (m, 2H),
2.91 (m, 2H), 2.81 (s, 3H), 2.12 (m, 6H) ppm; MS m/z: 447.52
[M+1].
[0492] Exemplary preparations and analytical data of additional
exemplary compounds of Formula (III-A) are shown in Tables 2A and
2B.
TABLE-US-00003 TABLE 2A Exemplary preparations and analytical data
of additional exemplary compounds of Formula (III-A) Preparation
method; retention time (Rt); Compound MS m/z HG-9-96-01 Scheme 6;
Rt = 2.49 min; MS m/z: 568.71 [M + 1] HG-9-148-02 Scheme 7; MS m/z:
466.99 [M + 1] HG-10-8-01 Scheme 6; Rt = 1.90 min; MS m/z: 504.69
[M + 1] HG-10-8-02 Scheme 6; Rt = 2.27 min; MS m/z: 504.69 [M + 1]
HG-10-9-01 Scheme 7; Rt = 2.02 min; MS m/z: 530.65 [M + 1]
HG-10-15-02 Rt = 2.34 min; MS m/z: 568.71 [M + 1] HG-10-15-03
Scheme 6; Rt = 2.27 min; MS m/z: 588.81 [M + 1] HG-10-15-04 Scheme
6; Rt = 2.45 min; MS m/z: 588.81 [M + 1] HG-10-27-01 Scheme 6; MS
m/z: 669.77 [M + 1] HG-10-27-02 Scheme 6; MS m/z: 669.77 [M + 1]
HG-10-28-01 Scheme 7; Rt = 2.25 min; MS m/z: 547.53 [M + 1]
HG-10-31-01 Scheme 6; Rt = 2.45 min; MS m/z: 565.69 [M + 1]
HG-10-31-02 Scheme 6; Rt = 2.48 min; MS m/z: 565.69 [M + 1]
HG-10-36-01 Scheme 6; Rt = 2.23 min; MS m/z: 582.76 [M + 1]
HG-10-36-02 Scheme 6; Rt = 2.32 min; MS m/z: 582.76 [M + 1] HG
10-59-02 Scheme 6; Rt = 2.22 min; MS m/z: 588.69 [M + 1] HG
10-60-01 Scheme 6; Rt = 2.10 min; MS m/z: 572.62 [M + 1] HG
10-60-02 Scheme 6; Rt = 2.20 min; MS m/z: 572.62 [M + 1] HG
10-61-01 Scheme 6; Rt = 2.65 min; MS m/z: 574.70 [M + 1] HG
10-61-02 Scheme 6; Rt = 2.53 min; MS m/z: 574.70 [M + 1] HG
10-62-01 Scheme 6; Rt = 2.40 min; MS m/z: 554.72 [M + 1] HG
10-62-02 Scheme 6; Rt = 2.53 min; MS m/z: 554.72 [M + 1] HG
10-63-01 Scheme 6; Rt = 2.48 min; MS m/z: 609.72 [M + 1] HG
10-63-02 Scheme 6; Rt = 2.75 min; MS m/z: 609.72 [M + 1] HG
10-64-01 Scheme 6; Rt = 2.44 min; MS m/z: 596.82 [M + 1] HG
10-64-02 Scheme 6; Rt = 2.68 min; MS m/z: 596.82 [M + 1] HG
10-65-01 Scheme 6; Rt = 2.62 min; MS m/z: 624.79 [M + 1] HG
10-65-02 Scheme 6; Rt = 2.73 min; MS m/z: 624.79 [M + 1]
HG-10-149-01 Scheme 6; Rt = 2.18 min; MS m/z: 554.79 [M + 1]
HG-10-149-02 Scheme 6; Rt = 2.27 min; MS m/z: 554.79 [M + 1]
HG-10-150-01 Scheme 6; Rt = 2.28 min; MS m/z: 566.76 [M + 1]
HG-10-150-02 Scheme 6; Rt = 2.45 min; MS m/z: 566.76 [M + 1]
HG-11-18-01 Scheme 7; Rt = 2.67 min; MS m/z: 497.57 [M + 1]
HG-11-18-02 Rt = 1.80 min; MS m/z: 467.57 [M + 1] HG-11-21-01 Rt =
2.92 min; MS m/z: 639.66 [M + 1] HG-11-22-01 Scheme 7; Rt = 2.25
min; MS m/z: 545.71 [M + 1]
TABLE-US-00004 TABLE 2B Exemplary analytical data of additional
exemplary compounds of Formula (III-A) Compound Retention time
(Rt); .sup.1H NMR; MS m/z HG-3-09-01 MS m/z: 470.52 [M + 1].
HG-9-87-02 Rt = 3.13 min; MS m/z: 556.61 [M + 1]. HG-9-87-03 Rt =
3.43 min; MS m/z: 556.61 [M + 1]. HG-9-87-04 Rt = 2.77 min; MS m/z:
557.37 [M + 1]. HG-9-88-02 Rt = 2.70 min; MS m/z: 486.22 [M + 1].
HG-9-88-03 Rt = 2.55 min; MS m/z: 600.60 [M + 1]. HG-9-88-04 Rt =
2.73 min; MS m/z: 600.60 [M + 1]. HG-9-88-05 Rt = 2.48 min; MS m/z:
574.64 [M + 1]. HG-9-90-01 Rt = 2.53 min; .sup.1H NMR 600 MHz
(DMSO-d.sub.6) .delta. 9.67 (s, 1H), 9.43 (s, 1H), 8.23 (s, 1H),
7.44 (d, J = 7.8 Hz, 2H), 7.31 (s, 1H), 7.24 (d, J = 9.0 Hz, 1H),
7.05 (m, 2H), 6.96 (d, J = 9.0 Hz, 2H), 6.68 (d, J = 2.4 Hz, 1H),
6.57 (dd, J = 3.0 Hz, J = 8.4 Hz, 1H), 3.78 (s, 3H), 3.76 (s, 3H),
3.74 (m, 4H), 3.12 (m, 2H), 2.98 (m, 2H), 2.83 (s, 3H), 2.06 (s,
6H); MS m/z: 569.72 [M + 1]. HG-9-90-02 Rt = 2.53 min; .sup.1H NMR
600 MHz (DMSO-d.sub.6) 8.22 (s, 1H), 7.38 (s, 1H), 7.20 (m, 3H),
7.04 (m, 6H), 6.67 (d, J = 2.4 Hz, 1H), 6.57 (dd, J = 2.4 Hz, J =
7.8 Hz, 1H), 3.78 (s, 3H), 3.75 (s, 3H), 3.72 (m, 4H), 3.27 (m,
4H), 2.06 (s, 6H); MS m/z: 565.61 [M + 1]. HG-9-90-03 Rt = 3.18
min; .sup.1H NMR 600 MHz (DMSO-d.sub.6) 9.65 (s, 1H), 8.37 (s, 1H),
7.54 (m, 2H), 7.40 (m, 2H), 7.17 (m, 5H), 6.80 (d, 1H), 6.71 (dd,
1H), 3.91 (s, 3H), 3.86 (s, 3H), 3.81 (m, 4H), 3.22 (m, 4H), 2.10
(s, 6H); MS m/z: 566.61 [M + 1]. HG-9-139-02 Rt = 2.75 min; .sup.1H
NMR 600 MHz (DMSO-d.sub.6) 10.19 (s, 1H), 8.63 (s, 1H), 8.11 (m,
1H), 7.36 (m, 3H), 7.06 (m, 3H), 6.80 (d, 1H), 6.71 (dd, 1H), 3.84
(s, 3H), 3.76 (s, 3H), 2.56 (s, 3H), 2.38 (s, 3H), 2.07 (s, 6H); MS
m/z: 500.57 [M + 1]. HG-9-139-03 Rt = 2.72 min; .sup.1H NMR 600 MHz
(DMSO-d.sub.6) 9.44 (s, 1H), 7.34 (m, 1H), 7.30 (d, J = 7.8 Hz,
1H), 7.07 (m, 3H), 6.97 (d, J = 7.8 Hz, 1H), 6.85 (s, 1H), 6.79 (d,
1H), 6.77 (d, 1H), 6.65 (dd, 1H), 6.49 (dd, 1H), 4.23 (m, 2H), 3.95
(m, 2H), 3.83 (S, 3H), 3.74 (s, 3H), 3.67 (m, 2H), 3.51 (m, 2H),
3.14 (m, 4H), 2.33 (s, 3H), 2.07 (s, 6H); MS m/z: 614.71 [M + 1].
HG-9-139-04 Rt = 2.53 min; MS m/z: 613.71 [M + 1]. HG-9-139-05 Rt =
2.47 min; MS m/z: 588.69 [M + 1]. HG-9-140-01 Rt = 2.47 min;
.sup.1H NMR 600 MHz (DMSO-d.sub.6) 9.49 (s, 1H), 8.07 (s, 1H), 7.58
(s, 1H), 7.23 (m, 1H), 7.06 (d, J = 8.4 Hz, 1H), 6.84 (m, 3H), 6.54
(m, 2H), 6.38 (m, 1H), 6.36 (m, 1H), 3.59 (s, 3H), 3.52 (s, 3H),
3.48 (s, 3H), 3.44 (m, 4H), 2.87 (m, 4H), 2.60 (s, 3H), 1.84 (s,
6H); MS m/z: 599.71 [M + 1]. HG-9-144-01 Rt = 2.45 min; .sup.1H NMR
600 MHz (DMSO-d.sub.6) 9.80 (s, 1H), 9.32 (s, 1H), 8.32 (d, 1H),
7.54 (d, 1H), 7.32 (d, 1H), 7.07 (m, 3H), 6.79 (m, 1H), 6.68 (d,
1H), 6.61 (m, 1H), 4.00 (m, 2H), 3.86 (s, 3H), 3.82 (m, 2H), 3.74
(s, 3H), 3.66 (m, 4H), 3.33 (m, 2H), 3.15 (m, 5H), 2.64 (m, 2H),
2.15 (m, 2H), 2.07 (s, 6H), 1.71 (m, 2H); MS m/z: 639.72 [M + 1].
HG-9-144-02 Rt = 2.45 min; .sup.1H NMR 600 MHz (DMSO-d.sub.6) 9.80
(s, 1H), 9.32 (s, 1H), 8.33 (d, 1H), 7.92 (s, 1H), 7.52 (d, 1H),
7.32 (d, 1H), 7.07 (m, 5H), 6.77 (m, 1H), 6.66 (dd, 1H), 6.58 (d,
1H), 6.05 (m, 1H), 4.00 (m, 2H), 3.85 (s, 3H), 3.78 (s, 3H), 3.75
(m, 2H), 3.66 (m, 4H), 3.34 (m, 4H), 3.15 (m, 2H), 2.90 (m, 1H),
2.68 (m, 2H), 2.15 (m, 2H), 2.06 (s, 6H), 1.70 (m, 2H); MS m/z:
669.71 [M + 1]. HG-9-144-03 Rt = 2.17 min; MS m/z: 683.76 [M + 1].
HG-9-144-04 Rt = 2.45 min; MS m/z: 710.73 [M + 1]. HG-9-144-05 Rt =
2.65 min; MS m/z: 628.82 [M + 1]. HG-9-150-02 Rt = 2.53 min; MS
m/z: 583.65 [M + 1]. HG-11-6-01 Rt = 3.13 min; MS m/z: 641.55 [M +
1]. HG-11-6-02 Rt = 2.53 min; MS m/z: 654.72 [M + 1]. WH-4-023 Rt =
2.48 min; MS m/z: 569.66 [M + 1]. WH-4-025 MS m/z: 742.71 [M + 1].
WH4-113 MS m/z: 748.76 [M + 1]. WH4-124-1 MS m/z: 756.79 [M + 1].
WH4-124-2 Rt = 2.27 min; MS m/z: 854.66 [M + 1]. WH4-199-1 MS m/z:
680.70 [M + 1]. WH4-199-2 MS m/z: 693.71 [M + 1]. WH4-200-1 MS m/z:
680.76 [M + 1]. WH4-200-2 MS m/z: 694.73 [M + 1].
Example 2. Materials and Methods Involved in Examples 3 to 24
[0493] Bone marrow-derived DCs were differentiated from C57BL/6
bone marrow in the presence of GM-CSF-conditioned media.
CD11c.sup.+CX.sub.3CR1.sup.hi myeloid cells and
CD11c.sup.+CX.sub.3CR1.sup.- DCs were isolated from the small
intestine lamina propria of Cx3cr1.sup.eGFP/+ mice (12). Detection
of cell-surface Thy1.1 expression on BMDCs from 10BiT reporter mice
was conducted as described previously (24). Cell viability was
estimated by change in total cellular ATP levels using CellTiterGlo
assays (Promega). Preparation of recombinant SIK proteins and
IC.sub.50 measurements were conducted as described previously (21).
Total RNA was extracted using a NucleoSpin 96 RNA isolation kit
(Macherey-Nagel) followed by cDNA synthesis and multiplex RT-PCR
using a microfluidic dynamic array (Fluidigm). The concentrations
of TNF-.alpha., IL-6, IL-10, IL-12p40, IL-1.beta. and RANTES in
culture supernatants were detected using a FlexSet Cytometric bead
array (BD Biosciences). Alternatively, IL-10 secretion was
quantified using ELISA (BD Biosciences) or AlphaLISA (PerkinElmer)
assays. NO production was estimated based on nitrate content in
culture medium using the Greiss reagent.
Example 3. Protein Kinase Assays of the SIK Inhibitors
[0494] In another set of experiments, the activities of the SIK
inhibitors described herein against SIK were determined according
to the methods reported in Hastie et al., Nature Protocols, 2006,
1, 968-971.
Materials
[0495] Enzyme Dilution Buffer.
[0496] This buffer consisted of 50 mM Tris-HCl, pH 7.5, 0.1 mM
EGTA, 1 mg ml.sup.-1 bovine serum albumin and 0.1% (vol/vol)
2-mercaptoethanol.
[0497] 10.times. Concentrated Assay Buffer.
[0498] An assay buffer of 500 mM Tris-HCl, pH 7.5, 1 mM EGTA, and
100 mM magnesium acetate was used for the protein kinase assay. In
some cases, the pH of the buffer was changed (e.g., phosphorylase
kinase had an optimum pH of 8.6).
[0499] 1 mM [.gamma.-.sup.32P] ATP.
[0500] The specific activity of the [.gamma.-.sup.32P] ATP solution
was 1.times.10.sup.5 to 1.times.10.sup.6 c.p.m. per nmol depending
on what was needed to produce an optimal signal/noise ratio. Stocks
of nonradioactive ("cold") ATP were dissolved in 10 mM HEPES, and
the pH of the resulting stock solutions was adjusted to 7.4. To
measure the concentration of ATP, a sample of such a stock solution
was diluted to 20 .mu.M, and the absorbance of the diluted sample
was measured at 259 nm. The absorbance of a 20-.mu.M stock solution
of ATP at 259 nm was about 0.31. The 1-mM solution of cold ATP was
"spiked" with [.gamma.-.sup.32P] ATP to produce a radioactivity of
1.times.10.sup.5 to 1.times.10.sup.6 c.p.m. per nmol.
Procedure
[0501] 1) The number of assay samples needed was determined based
on, e.g., the following considerations: (i) each condition was
assayed in duplicate; (ii) two controls containing peptide or
protein substrate and ATP but no SIK were included to assess
contamination by any free ATP not incorporated into substrate,
alongside two controls lacking a peptide or protein substrate but
containing ATP and SIK to correct for any incorporation of
phosphate into the kinase itself (e.g., autophosphorylation); and
(iii) a maximum of 40 samples were assayed manually at one time by
a single person. Microcentrifuge tubes were label distinctly and
were placed on ice.
[0502] 2) Suspend a wire mesh basket in a beaker containing a
magnetic stir bar and not less than 5 ml of 75 mM phosphoric acid
per assay sample or a minimum volume of 100 ml. Place this on a
magnetic stirrer behind a plexiglass shield.
[0503] 3) Label 2 cm.times.2 cm squares of phosphocellulose paper
corresponding to the samples to be pipetted into each
microcentrifuge tube. Label the phosphocellulose paper using
pencil, which was not affected by the solvents used to wash the
papers at the end of the assay.
[0504] 4) Dilute the SIK in enzyme dilution buffer and place on
ice.
[0505] 5) Pipette 5 .mu.l of 10.times. concentrated assay buffer, 5
.mu.l peptide or protein substrate (the two "no-substrate" control
tubes had 5 .mu.l water added instead of peptide or protein
substrate), and 30 .mu.l distilled water into each tube. Keep the
tubes on ice.
[0506] 6) Add 5 .mu.l diluted SIK to each tube, except for the two
"no-enzyme" control tubes, which had 5 .mu.l enzyme dilution buffer
added, and still keeping the tubes on ice. In some cases, premixed
"cocktails" of assay components were prepared containing peptide or
protein substrate, assay buffer, and distilled water to limit the
number of additions to each assay tube.
Each of steps 7 to 14 was done behind a plexiglass shield.
[0507] 7) Insert each tube into the water bath at intervals of 15 s
to allow the assay mixture to reach 30.degree. C. Begin the SIK
reactions by adding 5 .mu.l of 1 mM [.gamma.-.sup.32P] ATP to each
tube at intervals of 15 s. Close each tube, vortex for 1 s to mix
the contents and immediately replace in a rack in the water bath.
Incubate for 10 min at 30.degree. C.
[0508] 8) At 10 min after the addition of ATP, remove each tube
from the water bath at intervals of 15 s.
[0509] 9) "Spot" 40 .mu.l of each reaction mixture onto the center
of a 2-cm square of P81 phosphocellulose paper using forceps to
handle the paper squares. Immediately immerse the paper into the 75
mM phosphoric acid contained in the wire mesh basket suspended in
the beaker that is being stirred continuously with a magnetic
stirrer. This was be done within 1 to 2 s, as this step terminated
the reaction.
[0510] 10) After 5 min, remove the wire mesh basket from the
beaker, and discard the phosphoric acid in the beaker and replace
it with fresh phosphoric acid. Replace the wire mesh basket in the
beaker and repeat this washing procedure three times (with 5 min
between each wash). This step removes the [.gamma.-.sup.32P] ATP
that has not been incorporated into the peptide or protein
substrate.
[0511] 11) After the final wash in phosphoric acid, rinse the
papers briefly with acetone to remove the phosphoric acid and
either air-dry or dry with a hair dryer.
[0512] 12) Transfer each paper to a new, distinctly labeled, 1.5-ml
microcentrifuge tube.
[0513] 13) Measure radioactivity in the samples by Cerenkov
counting (e.g., without liquid scintillation fluid) in a liquid
scintillation counter using a ".sup.32P program". Also measure the
radioactivity of 1-.mu.l aliquots of the stock of 1 mM
[.gamma.-.sup.32P] ATP in triplicate to determine the specific
radioactivity of the ATP in terms of c.p.m. per nanomol ATP (1
.mu.l of 1 mM ATP corresponds to 1 nmol ATP).
[0514] 14) Calculate the activity of the SIK. One unit (U) of SIK
activity is that amount that catalyzes the incorporation of 1 nmol
phosphate into the standard peptide or protein substrate in 1 min.
In the assay described herein, the activity of the undiluted SIK
solution in U ml.sup.-1 is
[(r-b/sa).times.d.times.1.25.times.200]/10, where r is the c.p.m.
incorporated into the substrate in the SIK reaction, b is the
average c.p.m. associated with the phosphocellulose paper in the
reaction "blanks", sa is the specific radioactivity of the ATP
(c.p.m. nmol), d is the "fold dilution" of the SIK before assay,
1.25 is a correction for transfer of only 80% of the reaction to
the phosphocellulose paper (40 .mu.l of a 50-.mu.l assay volume),
200 corrects for the addition of only 5 .mu.l of diluted SIK to
each assay, and 10 is the incubation time in min. In some cases, if
the protein concentration of the assay was known, the activity was
converted from U ml.sup.-1 to U mg.sup.-1 of protein.
[0515] In some experiments of determining the inhibitory activities
of a SIK inhibitor described herein against SIK (e.g, experiments
yielding the data in Table 3), DMSO was used as a control. The
activity of a SIK when treated with DMSO, but not with a SIK
inhibitor described herein, was set to 100%. SIK inhibitors
resulting in less than 100% activity of a SIK are deemed to be
inhibitors of the SIK.
Results
[0516] Exemplary results of the protein kinase assays of the SIK
inhibitors described herein are shown in Table 3.
TABLE-US-00005 TABLE 3 Exemplary inhibitory activities of select
SIK inhibitors against SIK. SIK inhib- IL-10 induction Viability
loss Enzyme Inhibition IC.sub.50 (.mu.M) itor EC.sub.50 (.mu.M)
EC.sub.50 (.mu.M) SIK1 SIK2 SIK3 I-1 5.61531E-06 0.00001 N/A
0.009725 0.0891 I-2 N/A 0.00000658 N/A 0.087845 0.4453 I-3
1.23736E-05 0.00000361 N/A 0.013877 0.07891 I-4 1.05263E-05
0.000005 N/A 0.093765 0.40875 I-5 2.37844E-05 0.00000612 N/A
0.011964 0.07366 I-6 2.6E-05 N/A N/A 0.01889 0.1764 II-1
1.45949E-06 1.95E-08 0.036185 0.06514 0.12 Activity of protein
kinase Activity of protein kinase treated with 1 .mu.M of I-1
treated with 0.1 .mu.M of I-1 SIK (% control (DMSO)) (% control
(DMSO)) inhibitor SIK1 SIK2 SIK3 SGK SIK1 SIK2 SIK3 SGK I-1 5 13
100 10 33 96 I-2 15.9 15 II-1 9 16 37 45 N/A: not available.
Example 4. Molecular Biology Methods
[0517] The lentiviral luciferase reporter construct for the
cAMP-responsive transcription factor CREB was created by combining
the pLenti7.3/V5-DEST vector from Life Technologies (Cat #
V534-06), the minimal promoter and luc2P open reading frame from
Promega's pGL4.29 [luc2P/CRE/Hygro], and an optimized synthetic
cAMP-regulated enhancer that contains multiple nonoverlapping
binding sites for CREB (Melnikov A, et al. (2012) Systematic
dissection and optimization of inducible enhancers in human cells
using a massively parallel reporter assay. Nature biotechnology
30(3):271-277). The CMV-Gateway-V5 stretch from pLenti7.3/V5-DEST
was removed by digestion with BspDI and Mlul. The minimal promoter
and luc2P open reading frame of pGL4.29 was PCR amplified with
Gibson cloning complementary sequence to the digested
pLenti7.3/V5-DEST backbone using the primer pair:
F_TTCAAAATTTTATCGATCGCACCAGCGTGTGGATCCGAGAACAGATCTGGCCT CGG,
R_ACTAACCGGTACGCGTTCTAGAGTCGCGGCCTTAGAC. Clontech's Infusion enzyme
mix (Cat #638916) was used to insert the minimal promoter and luc2P
into the digested pLenti7.3/V5-DEST. The synthetic cAMP-regulated
enhancer ACACCAGACATTGACGTAAGCTGCCAGATCCCATTCCCGTCATACTCTGACGTCT
TTCAGACACCCCATTGACGTCAATGGGAGAAC was synthesized as a standard
desalted Ultramer from Integrated DNA Technologies and made double
stranded with HercII fusion polymerase (Agilent) and Gibson cloning
complementary sequence using the primer pair: F_GCACCAGCGTGTGGATC,
R_GCCAGATCTGTTCTCGGATC. The pLenti7.3 backbone containing a minimal
promoter and luc2P was then digested with BamHI and the synthetic
cAMP-regulated enhancer was inserted in front of the minimal
promoter using Infusion enzyme mix (Clontech). pLKO shRNAs
targeting CRTC3 (TRCN0000241211 or TRCN0000241214), RFP
(TRCN0000072206) or LacZ (TRCN0000072256) were obtained from the
Broad Institute's Genetic Perturbation Platform. For production of
lentiviral particles, 293T cells were transfected with the CREB
lentiviral reporter construct or pLKO shRNA plasmids and packaging
plasmids dR8.91 and VSV-G using Lipofectamine 2000. The 293T media
was changed 24 hr post-transfection to DMEM+30% FBS and Pen/Strep.
Media containing lentiviral particles was collected 48 hr
post-transfection and stored at -80.degree. C.
Example 5. Mouse Models
[0518] C57BL/6 and Balb/c mice were obtained from Jackson
Laboratory. CX3CR1GFP/+ and 10BiT mice have been described
previously (Jung S, et al. (2000) Analysis of fractalkine receptor
CX(3)CR1 function by targeted deletion and green fluorescent
protein reporter gene insertion. Molecular and cellular biology
20(11):4106-4114; Maynard C L, et al. (2007) Regulatory T cells
expressing interleukin 10 develop from Foxp3+ and Foxp3- precursor
cells in the absence of interleukin 10. Nature immunology
8(9):931-941). Mouse maintenance and cell isolation was performed
under protocols approved by the Massachusetts General Hospital
Subcommittee on Research Animal Care (SRAC), in conformance with
the National Institutes of Health Guide for the Care and Use of
Laboratory Animals.
Example 6. Bone Marrow-Derived Cell Culture Methods
[0519] C57BL/6 mice were euthanized and bone marrow harvested from
femurs and tibias as described previously (Graham D B, et al.
(2007) An ITAM-signaling pathway controls cross-presentation of
particulate but not soluble antigens in dendritic cells. The
Journal of experimental medicine 204(12):2889-2897). BMDCs were
differentiated DMEM supplemented with 2 mM GlutaMAX, 10% (vol/vol)
FBS, penicillin, streptomycin and 2% mouse GM-CSF conditioned media
derived from TOPO cells. Cultures were differentiated for 7 days
and routinely analyzed for >90% CD11c (APC anti-CD11c clone HL3;
BD Biosciences) positivity by flow cytometry before use in
experiments. Lentiviral transduction of bone marrow cultures was
conducted by addition of 293T culture supernatants containing
lentiviral particles encoding the CREB dependent luciferase
reporter construct or CRTC3 targeting or control shRNAs one day
post-isolation. Stable integration of lentiviral shRNA constructs
was selected by addition of puromycin (3 .mu.g/mL) on day 4
post-transduction. After 2 days, stably transduced BMDCs were
released from selection and used in subsequent assays. Unless
otherwise indicated, cells were treated for 2 days with PGE2 (5
.mu.M) or HG-9-91-01 (0.5 .mu.M) or an equivalent concentration of
DMSO (<0.5%) and then stimulated for 18 hr with LPS (100 ng/mL),
R848 (10 .mu.g/mL) or zymosan (4 .mu.g/mL).
Example 7. Human Myeloid Cell Culture Methods
[0520] Heparinized blood from healthy donors was obtained from
Research Blood Components. Peripheral blood mononuclear cells
(PBMCs) were obtained by density centrifugation of blood diluted
50% (vol/vol) with PBS over Ficoll-Paque (Pharmacia Biotech). PBMCs
were further purified by plastic adherence for 1 hr and washed
5.times. with PBS. Monocytes within the PBMC pool were
differentiated towards DCs in X-VIVO media (Lonza) supplemented
with IL-4 (50 ng/mL, R&D Systems) and GM-CSF (50 ng/mL, R&D
Systems) or macrophages in X-VIVO media supplemented with GM-CSF (5
ng/mL) and IFN-.gamma. (5 ng/mL; PeproTech) for 7 days as described
previously (Smeekens S P, et al. (2013) Functional genomics
identifies type I interferon pathway as central for host defense
against Candida albicans. Nature communications 4:1342). After
third day, half of the culture medium was replaced by fresh
DC/macrophages differentiation medium.
Example 8. Methods of High-Throughput Detection of IL-10
Up-Regulation and Cell Viability
[0521] BMDCs were seeded into black 384-well plates (Corning) at
20,000 cells/well in 40 .mu.L complete DMEM using a Multidrop COMBI
(Thermal Scientific) followed by incubation at 37.degree. C. for 2
hr to allow for plate adherence. SIK inhibitors (100 nL/well) were
pin-transferred from concentrated DMSO stocks using CyBi-Well Vario
(CyBio) into duplicate plates. For each treatment plate, 32 out of
384 wells were pinned with DMSO as negative control and 32 out of
384 wells were pinned with PGE2 (5 .mu.M final concentration). Two
days after SIK inhibitor treatment, BMDCs were stimulated with
zymosan (4 .mu.g/mL final concentration) dispersed in culture
medium (20 .mu.L/well) using a Multidrop COMBI. After 18 hr, 5
.mu.L of resulting supernatant was transferred from the culture
plate to white 384-well AlphaLISA plates (Perkin Elmer) using a
CyBi-Well Vario. IL-10 abundance in the supernatants was determined
using an AlphaLISA assay (PerkinElmer) according to the
manufacture's protocol and signal intensity measured using an
EnVision multimode plate reader. SIK inhibitor activity was
expressed as a % of the differences between the mean abundance of
IL-10 in PGE2 versus DMSO wells on a per plate basis. Cell
viability assays were conducted on the same tissue culture plates
as the IL-10 assay. First media was removed and replaced by
solution of 50% (vol/vol) CellTiter-Glo (Promega) in PBS.
Luminescence was read using an Envision multimode plate reader, and
signal intensity calculated relative to DMSO control wells on a per
plate basis.
Example 9. Reporter Gene Assay Methods
[0522] Six days post transduction with lentiviral particles
encoding the CREB-luciferase reporter construct, BMDCs were seeded
into black 384-well plates (Corning) at 20,000 cells/well in 40
.mu.L complete DMEM using a Multidrop COMBI (Thermal Scientific)
followed by incubation at 37.degree. C. for 2 hr to allow for plate
adherence. SIK inhibitors (100 nL/well) or DMSO (vehicle) were
pin-transferred from concentrated DMSO stocks using CyBi-Well Vario
(CyBio) into triplicate plates. After incubation with SIK
inhibitors for 24 hr, BMDCs were stimulated with zymosan (4
.mu.g/mL) dispersed using a Multidrop COMBI. After 5 hr, media was
removed and replaced by solution of 50% (vol/vol) Steadylite Plus
(PerkinElmer) in PBS and incubated at room temperature for 10 min.
Luminescence was read using an Envision multimode plate reader, and
SIK inhibitor activity was expressed fold DMSO treated wells on per
plate basis.
Example 10. Methods of Detecting il10-Thy1.1 Reporter Gene
[0523] Preparation of BMDCs from 10BiT reporter mice expressing an
il10-Thy1.1 transgene, SIK inhibitor treatment and zymosan
stimulation was conducted as described above. After 18 hr of
stimulation, 10BiT BMDCs were collected by scraping, washed with
PBS and stained with LIVE/DEADGreen (Invitrogen) to identify viable
cells as well as APC anti-Thy1.1 (clone OX-7; BD Biosciences).
Stained cells were then fixed with 4% paraformaldehyde and data
acquired on a FACSVerse (BD Biosciences).
Example 11. Multiplex qPCR Methods
[0524] Total RNA was extracted using a NucleoSpin 96 RNA isolation
kit (Macherey-Nagel). 5 ng of total RNA was used for cDNA synthesis
and multiplex RT-PCR using a microfluidic dynamic array (Fluidigm;
(Spurgeon S L, Jones R C, & Ramakrishnan R (2008) High
throughput gene expression measurement with real time PCR in a
microfluidic dynamic array. PloS one 3(2):e1662)). Relative gene
expression was calculated from Ct values and normalized against
ACTB mRNA levels as described previously (Pfaffl M W (2001) A new
mathematical model for relative quantification in real-time RT-PCR.
Nucleic acids research 29(9):e45). The fold-change in gene
expression induced by SIK inhibitor treatment is reported relative
to DMSO-treated samples exposed to the same microbial stimulus
unless otherwise indicated. Genes and corresponding primers used in
the multiplex qPCR are available in Table 4. The heat map
representing multiplex qPCR data was generated for genes with
significantly different expression (p<0.5) between DMSO versus
PGE2 or HG-9-91-01-treated samples. One-minus Pearson's based
hierarchical clustering of gene expression profiles was conducted
using the Gene-E software suite (www.broadinstitute.
org/cancer/software/GENE-E/download.html).
TABLE-US-00006 TABLE 4 Genes and corresponding primers used in the
multiplex qPCR. Design RefSeq (design reference Target FP (forward
primer) RP (reverse primer) sequence) Arg1 GGATTGGCAAGGTGATGGAA
CGACATCAAAGCTCAGGTG NM_007482.3 AA B2m CTGGTGCTTGTCTCACTGAC
GGTGGGTGGCGTGAGTATA NM_009735.3 Batf3 TCAGCGTGCTGCAGAGAA
TCTCCTTCGAACTTTCCTGT NM_030060.2 CA Bcl2 ATTGCCGAGAAGAAGGGAGAA
CGGCGGCAGATGAATTACA NM_177410.2 A Bcl211 AGCCTTGGATCCAGGAGAAC
GGCTGCTGCATTGTTCCC NM_009743.4 Bcl2111 TCGGAGACGAGTTCAACGAA
ACCATTTGAGGGTGGTCTTC NM_207680.2 A Ccl17 CAGGAAGTTGGTGAGCTGGTA
CTTGCCCTGGACAGTCAGA NM_011332.3 A Ccl19 CTGTGGCCTGCCTCAGATTA
CAGTCTTCCGCATCATTAGC NM_011888.2 A Ccl22 CCTTCTTGCTGTGGCAATTCA
GGCAGCAGATACTGTCTTCC NM_009137.2 A Cd69 GTGGTCCTCATCACGTCCTTA
ACAAGCCTGGGCAATTGTA NM_001033122.3 C Cdkn1b CAGTGTCCAGGGATGAGGAA
TTCGGGGAACCGTCTGAAA NM_009875.4 Cebpa ATGGCAGTGTGCACGTCTA
TGGCAAGAATCAGAGCAAA NM_007678.3 ACC Ciita GCCATCCGGGACCTTAAGAA
ATCTTTGCCAGTGTGGGGAA NM_007575.2 Cish AGCCAAGACGTTCTCCTACC
CCCTCCGGCATCTTCTGTA NM_009895.3 Cxcl1 CCTGAAGCTCCCTTGGTTCA
TTCTCCGTTACTTGGGGACA NM_008176.3 C Cxcl10 ATCCGGAATCTAAGACCATCA
GCTCTCTGCTGTCCATCCA NM_021274.1 AGAA Cxcl11 GAACAGGAAGGTCACAGCCAT
AGCGCCCCTGTTTGAACATA NM_019494.1 A Cxcr5 GGACATGGGCTCCATCACATA
TCCCTCGACTGTAGAGCAG NM_007551.2 AA Cybb CCCAACTGGGATAACGAGTTC
TTCAGGGCCACACAGGAAA NM_007807.4 A A Ebi3 AAGTACCGACTCCGCTACC
GGTGAAAGTCGTGGCTTCA NM_015766.2 A Egr2 GCCCCTTTGACCAGATGAAC
GGAGCGAAGCTACTCGGAT NM_010118.3 A Egr3 CGACTCGGTAGCCCATTACAA
GTCAGACCGATGTCCATCAC NM_018781.2 A Eomes GCGGCAAAGCGGACAATAAC
ATCCAGTGGGAGCCAGTGT NM_010136.3 TA Fas1 CGAGGAGTGTGGCCCATTTA
AGCGGTTCCATATGTGTCTT NM_010177.3 CC Fos ATGGGCTCTCCTGTCAACAC
GCTGTCACCGTGGGGATAA NM_010234.2 Foxp3 GACGAGACTTGGAAGACAGTC
TGGGCATTGGGTTCTTGTCA NM_054039.1 A Gata3 CCTACCGGGTTCGGATGTAA
CCGCAGTTCACACACTCC NM_008091.3 Gfi1 TGAGCCTGGAGCAACACA
AGCGTGGATGACCTCTTGA NM_010278.2 A Hes1 TGAAGCACCTCCGGAACC
CGCGGTATTTCCCCAACAC NM_008235.2 Hif1a TCGACACAGCCTCGATATGAA
TTCCGGCTCATAACCCATCA NM_010431.2 Hk2 AGAACCAGATCTACGCCATTCC
GCATTCGGCAATGTGGTCA NM_013820.3 A Hmox1 TCAAGCACAGGGTGACAGAA
ATCACCTGCAGCTCCTCAAA NM_010442.2 Id2 GAACACGGACATCAGCATCC
AGCCACAGAGTACTTTGCTA NM_010496.3 TCA Ifit2 TGCTTTGAGCGCTTTGACA
GCAGATTGCTCTCCAGTGAC NM_008332.3 Ifnb1 AGCTCCAAGAAAGGACGAACA
TGGATGGCAAAGGCAGTGT NM_010510.1 A Ifng GGCACAGTCATTGAAAGCCTA
GCCAGTTCCTCCAGATATCC NM_008337.3 A Ikzf1 GCATAAAGAGCGATGCCACAA
TCTGCCATCTCGTTGTGGTT NM_001025597.1 A I110 AAAGGACCAGCTGGACAACA
TAAGGCTTGGCAACCCAAG NM_010548.2 TA I112a AAACCAGCACATTGAAGACC
GGAAGAAGTCTCTCTAGTA NM_001159424.1 GCC I112b ATCGTTTTGCTGGTGTCTCC
GGAGTCCAGTCCACCTCTAC NM_008352.2 I113 AGCTTATTGAGGAGCTGAGCA
CCAGGTCCACACTCCATACC NM_008355.3 A I115 CGTGCTCTACCTTGCAAACA
TTTCTCCTCCAGCTCCTCAC NM_008357.1 I117a TGAGTCCAGGGAGAGCTTCA
CGCTGCTGCCTTCACTGTA NM_010552.3 I117f AAGCAGCCATTGGAGAAACC
GGCAAGTCCCAACATCAAC NM_145856.2 A I118 CAAAGAAAGCCGCCTCAAAC
GACGCAAGAGTCTTCTGAC NM_008360.1 A I11b TGGCAACTGTTCCTGAACTCA
GGGTCCGTCAACTTCAAAG NM_008361.3 AAC I12 CCCAGGATGCTCACCTTCAAA
CCGCAGAGGTCCAAGTTCA NM_008366.3 I120 GTGGGGAAGAAGCAATGGAGA
CTTTACCACCGCTGCCTGAA NM_021380.1 A I121 GATCCTGAACTTCTATCAGCTC
GGCCTTCTGAAAACAGGCA NM_021782.2 CA AA I122 TGGTGCCTTTCCTGACCAAA
TCTGGATGTTCTGGTCGTCA NM_016971.2 C I123a CTGCATGCTAGCCTGGAAC
ACTGGATACGGGGCACATT NM_031252.2 A I127 CCCAATGTTTCCCTGACTTTCC
CGAAGTGTGGTAGCGAGGA NM_145636.1 A I12ra TGCGTTGCTTAGGAAACTCC
CTGGTGTTCAAGTTGAGCTG NM_008367.3 TA I13 ACTCAAAACTGATGATGAAGG
TCTCCTTGGCTTTCCACGAA NM_010556.4 AC I133 GGTCCCGCCTTGCAAAATA
AGAACGGAGTCTCATGCAG NM_133775.2 TA I14 ACGGAGATGGATGTGCCAAA
GCACCTTGGAAGCCCTACA NM_021283.2 I15 GATGAGGCTTCCTGTCCCTA
TTCAGTATGTCTAGCCCCTG NM_010558.1 AA I16 CCAGAAACCGCTATGAAGTTCC
GTTGTCACCAGCATCAGTCC NM_031168.1 I19 CAGCTGCTTGTGTCTCTCC
TGGCATTGGTCAGCTGTAAC NM_008373.1 Irf4 TCCCCATTGAGCCAAGCATA
CGAGGATGTCCCGGTAATA NM_013674.1 CA Irf8 TGCCACTGGTGACCGGATA
AGCTGATGACCATCTGGGA NM_008320.3 GAA Isg15 TTCCAGGGGACCTAGAGCTA
GACACCAGGAAATCGTTAC NM_015783.3 CC Ldha16b AGGAAGACGCATCCAGTTACC
ATACAAGGCACGCTGAGGA NM_175349.2 A Lef1 ACACATCCCGTCAGATGTCA
GGGTAGAAGGTGGGGATTT NM_010703.3 CA Mafb TGATCCGCCTGAAGCAGAA
CTGCTGGACGCGTTTATACC NM_010658.3 Mcl1 AAACGGGACTGGCTTGTCA
CCGCCTTCTAGGTCCTGTAC NM_008562.3 Myc AGTGCTGCATGAGGAGACA
TCTCCACAGACACCACATCA NM_010849.4 A Ncf1 GTGCCCAAAGATGGCAAGAA
AGTCAGCAATGGCCCGATA NM_010876.3 Nfil3 TACAGCCGCCCTTTCTTTTCC
GTTGTCCGGCACAGGGTAA NM_017373.3 A Nos2 GAGGAGCAGGTGGAAGACTA
GGAAAAGACTGCACCGAAG NM_010927.3 ATA Notch1 GGACGGCGTGAATACCTACA
GACATTCGTCCACATCCTCT NM_008714.3 GTA Nqo1 AAGCTGCAGACCTGGTGATA
ACGAGCACTCTCTCAAACC NM_008706.5 A Pdia4 TTGACTATGATGGCTCCAGGAC
CAGGTGGAGGTGTCCAATC NM_009787.2 A Ptgs2 CTTCTCCCTGAAGCCGTACA
TGTCACTGTAGAGGGCTTTC NM_011198.3 AA Rorc TGGAGCTCTGCCAGAATGAC
GGCCCTGCACATTCTGACTA NM_011281.2 Runx3 AACCAAGTGGCCAGGTTCAA
ACGGTGATTGTGAGCGTGA NM_019732.2 A Sfpi1 AACAGATGCACGTCCTCGATA
CATCCGGGGCATGTAGGAA NM_011355.1 Slc2a1 GCTGTGCTGTGCTCATGAC
GATGGCCACGATGCTCAGA NM_011400.3 TA Socs1 ATCCGCGTGCACTTCCA
AGCTCGAAAAGGCAGTCGA NM_009896.2 A Socs3 GCCGGAGATTTCGCTTCG
ACTTGCTGTGGGTGACCAT NM_007707.3 Sod2 AAGGAGCAAGGTCGCTTACA
AATCCCCAGCAGCGGAATA NM_013671.3 A Spib CTGGATGGCCCACACTTAA
CCCCATCTGAATCTGGGTAA NM_019866.1 C Sqstm1 GCTGAAGGAAGCTGCCCTATA
TCTGGGAGAGGGACTCAAT NM_011018.2 CA Tbx21 CAAGTTCAACCAGCACCAGAC
CCACGGTGAAGGACAGGAA NM_019507.2 Tcf7 AAGAGGCGGTCAAGGGAAAA
GGCCTTCTCCGGGTAAGTAC NM_009331.3 Tcf712 CAGCTGACGTAGACCCCAAA
GGGCGACAGCGGGTAATA NM_009333.3 Xbp1 CAGCAAGTGGTGGATTTGGAA
CAAGGCCGTGAGTTTTCTCC NM_013842.2 Zbtb10 CTGAAGCCTGCAGTGGTCAA
AAGTGCCAGGCATCAAACC NM_177660.3 A Zbtb46 GCTCTCCAGTACCTTCATTCC
CTCAGTGACCGTCAGGTCTA NM_028125.3 Zbtb7b GGACGCGCTTCTTCCTACA
TGGGATTCCAATCAGGTCAT NM_009565.4 CC
Zfpml ATTCTACGGGAGCATCCAGAC CATCCACCATCAGGGTCAC NM_009569.3 A
Target symbol Blast hit Gene Gene full name Arg1 NM_007482.3 Arg1
arginase, liver B2m NM_009735.3 B2m beta-2 microglobulin Batf3
NM_030060.2 Batf3 basic leucine zipper transcription factor,
ATF-like 3 Bcl2 NM_177410.2|NM_009741.3 Bcl2 B-cell
leukemia/lymphoma 2 Bcl211 NM_009743.4 Bcl211 BCL2-like 1 Bcl2111
NM_009754.3|NM_207681.2| Bcl2111 BCL2-like 11 (apoptosis
facilitator) NM_207680.2 Ccl17 NM_011332.3 Ccl17 chemokine (C-C
motif) ligand 17 Ccl19 NM_011888.2 Ccl19 chemokine (C-C motif)
ligand 19 Ccl22 NM_009137.2 Ccl22 chemokine (C-C motif) ligand 22
Cd69 NM_001033122.3 Cd69 CD69 antigen Cdkn1b NM_009875.4 Cdkn1b
cyclin-dependent kinase inhibitor 1B Cebpa NM_007678.3 Cebpa
CCAAT/enhancer binding protein (C/EBP), alpha Ciita NM_007575.2
Ciita class II transactivator Cish NM_009895.3 Cish cytokine
inducible SH2-containing protein Cxcl1 NM_008176.3 Cxcl1 chemokine
(C-X-C motif) ligand 1 Cxcl10 NM_021274.1 Cxcl10 chemokine (C-X-C
motif) ligand 10 Cxcl11 NM_019494.1 Cxcl11 chemokine (C-X-C motif)
ligand 11 Cxcr5 NM_007551.2 Cxcr5 chemochine (C-X-C motif) receptor
5 Cybb NM_007807.4 Cybb cytochrome b-245, beta polypeptide Ebi3
NM_015766.2 Ebi3 Epstein-Barr virus induced gene 3 Egr2 NM_010118.3
Egr2 early growth response 2 Egr3 NM_018781.2 Egr3 early growth
response 3 Eomes NM_010136.3| Eomes eomesodermin homolog (Xenopus
NM_001164789.1 laevis) Fas1 NM_010177.3 Fas1 Fas ligand (TNF
superfamily, member 6) Fos NM_010234.2 Fos FBJ osteosarcoma
oncogene Foxp3 NM_054039.1 Foxp3 forkhead box P3 Gata3 NM_008091.3
Gata3 GATA binding protein 3 Gfi1 NM_010278.2 Gfi1 growth factor
independent 1 Hes1 NM_008235.2 Hes1 hairy and enhancer of split 1
(Drosophila) Hifla NM_010431.2 Hif1a hypoxia inducible factor 1,
alpha subunit Hk2 NM_013820.3 Hk2 hexokinase 2 Hmox1 NM_010442.2
Hmoxl heme oxygenase (decycling) 1 Id2 NM_010496.3 Id2 inhibitor of
DNA binding 2 Ifit2 NM_008332.3 Ifit2 interferon-induced protein
with tetratricopeptide repeats 2 Ifnb1 NM_010510.1 Ifnb1 interferon
beta 1, fibroblast Ifng NM_008337.3 Ifng interferon gamma Ikzf1
NM_001025597.1| Ikzf1 IKAROS family zinc finger 1 NM_009578.2 I110
NM_010548.2 I110 interleukin 10 I112a NM_001159424.1| I112a
interleukin 12a NM_008351.2 I112b NM_008352.2 I112b interleukin 12b
I113 NM_008355.3 I113 interleukin 13 I115 NM_008357.1 I115
interleukin 15 I117a NM_010552.3 I117a interleukin 17A I117f
NM_145856.2 I117f interleukin 17F I118 NM_008360.1 I118 interleukin
18 I11b NM_008361.3 I11b interleukin 1 beta I12 NM_008366.3 I12
interleukin 2 I120 NM_021380.1 I120 interleukin 20 I121 NM_021782.2
I121 interleukin 21 I122 NM_054079.2|NM_016971.2 I122 interleukin
22 I123a NM_031252.2 I123a interleukin 23, alpha subunit p19 I127
NM_145636.1 I127 interleukin 27 Il2ra NM_008367.3 Il2ra interleukin
2 receptor, alpha chain I13 NM_010556.4 I13 interleukin 3 I133
NM_001164724.1| I133 interleukin 33 NM_133775.2 I14 NM_021283.2 I14
interleukin 4 I15 NM_010558.1 I15 interleukin 5 I16 NM_031168.1 I16
interleukin 6 I19 NM_008373.1 I19 interleukin 9 Irf4 NM_013674.1
Irf4 interferon regulatory factor 4 Irf8 NM_008320.3 Irf8
interferon regulatory factor 8 Isg15 NM_015783.3 Isg15 ISG15
ubiquitin-like modifier Ldha16b NM_175349.2 Ldha16b lactate
dehydrogenase A-like 6B Lef1 NM_010703.3 Lef1 lymphoid enhancer
binding factor 1 Mafb NM_010658.3 Mafb v-maf musculoaponeurotic
fibrosarcoma oncogene family, protein B (avian) Mcl1 NM_008562.3
Mcl1 myeloid cell leukemia sequence 1 Myc NM_001177354.1| Myc
myelocytomatosis oncogene NM_001177353.1| NM_001177352.1|
NM_010849.4 Ncf1 NM_010876.3 Ncfl neutrophil cytosolic factor 1
Nfil3 NM_017373.3 Nfil3 nuclear factor, interleukin 3, regulated
Nos2 NM_010927.3 Nos2 nitric oxide synthase 2, inducible Notch1
NM_008714.3 Notch1 notch 1 Nqo1 NM_008706.5 Nqo1 NAD(P)H
dehydrogenase, quinone 1 Pdia4 NM_009787.2 Pdia4 protein disulfide
isomerase associated 4 Ptgs2 NM_011198.3 Ptgs2
prostaglandin-endoperoxide synthase 2 Rorc NM_011281.2 Rorc
RAR-related orphan receptor gamma Runx3 NM_019732.2 Runx3 runt
related transcription factor 3 Sfpi1 NM_011355.1 Sfpi1 SftV
proviral integration 1 Slc2a1 NM_011400.3 Slc2a1 solute carrier
family 2 (facilitated glucose transporter), member 1 Socs1
NM_009896.2 Socs1 suppressor of cytokine signaling 1 Socs3
NM_007707.3 Socs3 suppressor of cytokine signaling 3 Sod2
NM_013671.3 Sod2 superoxide dismutase 2, mitochondrial Spib
NM_019866.1 Spib Spi-B transcription factor (Spi-l/PU.1 related)
Sqstm1 NM_011018.2 Sqstm1 sequestosome 1 Tbx21 NM_019507.2 Tbx21
T-box 21 Tcf7 NM_009331.3 Tcf7 transcription factor 7, T-cell
specific Tcf712 NM_001142924.1| Tcf712 transcription factor 7-like
2, T-cell NM_001142923.1| specific, HMG-box NM_001142922.1|
NM_001142921.1| NM_001142920.1| NM_001142919.1| NM_001142918.1|
NM_009333.3 Xbp1 NM_013842.2 Xbp1 X-box binding protein 1 Zbtb10
NM_177660.3 Zbtb10 zinc finger and BTB domain containing 10 Zbtb46
NM_028125.3|NM_027656.2 Zbtb46 zinc finger and BTB domain
containing 46 Zbtb7b NM_009565.4 Zbtb7b zinc finger and BTB domain
containing 7B Zfpm1 NM_009569.3 Zfpm1 zinc finger protein,
multitype 1
Example 12. Methods for Detecting and NO Production
[0525] After stimulation of cells with microbial ligands, the
culture medium was removed, clarified by centrifugation for 10 min
at 14,000.times.g, and the concentration of TNF-.alpha., IL-6,
IL-10, IL-12p40, IL-1.beta. and RANTES were measured using FlexSet
Cytokine Bead Array (BD Biosciences) according to the
manufacturer's instructions. Where indicated, ELISAs were used to
detect IL-10 and IL-12p70 (BD Biosciences) according to the
manufacturer's instructions. NO production was estimated based on
nitrate content in culture medium using the Greiss reagent as
described previously (Miletic A V, et al. (2007) Vav proteins
control MyD88-dependent oxidative burst. Blood
109(8):3360-3368).
Example 13. Methods for T Cell Differentiation and FoxP3
Staining
[0526] Balb/c mice were euthanized and splenic CD4+CD62L+ T cells
were magnetically enriched (Miltenyi Biotec) to >95% purity and
cultured in DMEM media on plates pre-coated with anti-CD3 and
anti-CD28 antibodies (clones 145-2C11 and 37.51; BioXCell). Culture
media was supplemented with 10 .mu.g/mL anti-IL-4 (clone 11B11;
BioXCell), anti-IL-12 (clone C17.8; BioXCell), and anti-IFN.gamma.
(clone XMG1.2; BioXCell) as well as TGF.beta. (2 ng/mL; PeproTech).
HG-9-91-01 (100 nM) or DMSO were added at day 0. Cultures were fed
with DMEM+IL-2 (10 ng/mL, Peprotech) containing small molecules at
day 2 and analyzed at day 4. Cells were stained with blue
LIVE/DEADAqua stain (Invitrogen) to discriminate live cells, fixed
with Foxp3 Permeabilization Buffer (eBioscience), stained with FITC
anti-CD4 (clone RM4-5, Biolegend) and PE anti-Foxp3 (clone FJK-16S,
eBioscience) and acquired on a FACSVerse (BD Biosciences). For Th0
and Tr1 differentiations, C57BL/6 mice were euthanized and splenic
CD4+CD62L+ T cells were magnetically enriched (Miltenyi Biotec) to
>95% purity and cultured in DMEM media on plates pre-coated with
anti-CD3 and anti-CD28 antibodies (clones 145-2C11 and 37.51;
BioXCell) in the absence of neutralizing antibodies. For Tr1
differentiations, the culture media was supplement with TGF.beta.
(2 ng/mL; PeproTech) and rIL-27 (25 ng/mL; R&D Systems) as
described previously (Gagliani N, et al. (2013) Coexpression of
CD49b and LAG-3 identifies human and mouse T regulatory type 1
cells. Nature medicine 19(6):739-746). After 4 days, cells were
harvested, washed in PBS and stained with LIVE/DEADGreen to
discriminate viable cells and eFluor450 anti-CD4 (BioLegend) and
acquired on a FACSVerse (BD Biosciences). Absolute cell numbers
were enumerated by adding 5000 10 mm beads (Spherotech) to each
well. Analysis was performed using Flowjo (Treestar) excluding
samples were significant toxicity was observed. For all
differentiation conditions, IL-10 levels were quantified in the
culture media at day 4 by ELISA (BD Biosciences).
Example 14. Immunoblotting Methods
[0527] Cell lysis and immunoblotting were conducted as described
previously (Clark K, et al. (2012) Phosphorylation of CRTC3 by the
salt-inducible kinases controls the interconversion of classically
activated and regulatory macrophages. Proceedings of the National
Academy of Sciences of the United States of America
109(42):16986-16991). Briefly, cells were rinsed in ice-cold PBS
and extracted in lysis buffer (50 mM Tris.cndot.HCl at pH 7.4, 1 mM
EDTA, 1 mM EGTA, 50 mM NaF, 10 mM sodium .beta.-glycerol
1-phosphate, 1 mM DTT, 1 mM sodium orthovanadate, 1% (vol/vol)
Triton X-- 100 and 1.times. Complete EDTA-free Protease Inhibitor
Cocktail (Roche). Cell extracts were clarified by centrifugation at
14,000.times.g for 10 min at 4.degree. C., and protein
concentrations were determined by using the Bradford assay. To
detect proteins in cell lysates, 25 .mu.g of protein extract was
separated by SDS/PAGE. After transfer to PVDF membranes, proteins
were detected by immunoblotting and visualized by treating the
blots with SuperSignal West Pico Chemiluminescent Substrate
(ThermoScientific) followed by autoradiography. The following
antibodies were used for immunoblotting: .beta.-actin (clone 13E5)
was from Cell Signaling; CRTC3 (clone EPR3440) was from Abcam;
pSer370 (S253D bleed 2) of CRTC3 was a generous gift of P. Cohen
(University of Dundee).
Example 15. Methods for Isolation of Lamina Propria Myeloid
Cells
[0528] CX3CR1GFP/+ mice were euthanized and intestines cut into 3-4
pieces before inversion onto polyethylene tubes (Becton Dickinson).
Intestinal fragments were washed with calcium- and magnesium-free
PBS (Lonza), and mucus was removed with 1 mM DTT. The intestinal
epithelium was eluted with 30 mM EDTA at room temperature, followed
by digestion of the tissue with 36 U/ml type IV collagenase
(Sigma-Aldrich) in DMEM containing 5% (vol/vol) FBS for 90 min at
37.degree. C. in a 5% C02 humidified incubator. The digested tissue
was gently shaken for 10 min at room temperature and then passed
through a 70 .mu.m nylon cell strainer and washed with DMEM. A
final OptiPrep density centrifugation at .rho.=1.055 g/ml (Axis
Shield) yielded lamina propria myeloid cells. To purify
CX3CR1-expressing macrophages, cells were stained with
PE-conjugated anti-CD11c (HL3; BD Biosciences) and PE/Cy7
conjugated anti-CD45 (30-F11; BioLegend) and enriched with a BD
FACSVantage SE-DiVa cell sorter.
Example 16. Methods of Statistical Analysis
[0529] Unless otherwise indicated, error bars represent mean.+-.SD
for 3 replicates from an independent experiment that is
representative of 2 independent experiments. Fisher-Exact tests
correlating kinase inhibition with IL-10 up-regulation were
conducted using Prism6 (GraphPad). EC50's for IL-10 up-regulation
were estimated using the SmartFit Non-linear regression in Genedata
Screener software suite (Genedata). Statistical significance of
differences between experimental groups was assessed by using
unpaired, two-tailed Student t test and differences in means were
considered significant if p<0.05. Unless otherwise indicated,
*p<0.05; **p<0.01.
Example 17. Focused High-Throughput Screen Identifies Kinase
Inhibitors that Enhance IL-10 Production by Activated Dendritic
Cells
[0530] To enable measurement of IL-10 production by myeloid cells
in high throughput, we established an AlphaLISA-based assay to
detect IL-10 released by BMDCs in 384-well plate format (FIG. 1A).
Consistent with established role of EP2/EP4 prostanoid receptor
signaling in promoting IL-10 expression in myeloid cells (19),
differentiation of BMDCs in the presence PGE.sub.2 increased levels
of IL-10 detectable in the culture media by ELISA following
stimulation with a variety of microbial-derived ligands (FIG. 5A).
The robust IL-10-potentiating effect of differentiating BMDCs in
the presence of PGE.sub.2 was recapitulated in fully differentiated
BMDCs treated with PGE.sub.2 for 2 days prior to stimulation with
the yeast cell wall preparation zymosan (FIG. 5B). Moreover, the
stimulatory effects of treatment with PGE.sub.2 for 2 days on
zymosan-induced IL-10 production were observed with BMDCs cultured
in 384-well plates using AlphaLISA-based IL-10 detection (FIG. 5C).
Together, these results establish zymosan-stimulated BMDCs as a
robust, reproducible assay system to identify small-molecules that
enhance IL-10 production by activated myeloid cells.
[0531] To discover novel small-molecule enhancers of IL-10
production by inflammatory DCs, we screened a collection of >150
kinase inhibitors comprising FDA-approved drugs and well-annotated
probe compounds for their effects on zymosan-induced IL-10
production in BMDCs (FIG. 5D). Ten kinase inhibitors were
classified as hits based on their ability to dose-dependently
potentiate IL-10 production with a maximum effect>30% of the
PGE.sub.2 response (FIG. 1B and FIG. 6). These hits include the
GSK-3.beta. inhibitor CHIR-99021, which further validates the
screening strategy because pharmacological or genetic disruption of
GSK-3P3 has been previously reported to enhance IL-10 production by
LPS-stimulated M.PHI.s (17). Several of the IL-10-enhancing
compounds reduced IL-10 at concentrations greater than 1 .mu.M, an
effect that correlates with reduced viability in the case of
bosutinib, saracatinib, TAE-684 and CHIR-99021 (FIG. 6).
Alternatively, inhibition of kinases (e.g., Src and Syk) that
convey proximal signals downstream of the zymosan receptor Dectin-1
may account for the inhibitory effect on IL-10 production at high
concentrations of compound. In these cases, EC.sub.50 values were
calculated solely using IL-10-potentiating concentrations for each
inhibitor.
Example 18. Analysis of Shared Targets of Hit SIK Inhibitors
Suggests Role for Inhibition Salt-Inducible Kinases in IL-10
Potentiation
[0532] Dasatinib, bosutinib and saracatinib, which are used
clinically to inhibit BCR-Abl, c-Kit and several other kinases for
treatment of chronic myeloid leukemia (CML) (22), were among the
most potent and active (i.e., large maximum effect) IL-10 enhancers
identified in this screen. However, the BCR-Abl-targeting CML drug
imatinib was non-toxic in BMDCs, but did not up-regulate IL-10
production (FIG. 6). This contrast suggests that the observed
IL-10-potentiating effects of the hit SIK inhibitors might arise
from shared `off-target` inhibition of kinases other than Abl1.
This possibility is supported by kinase-profiling data indicating
that dasatinib and bosutinib modulate the activity of a large
number of kinases (23). To investigate this possibility, we
correlated the IL-10-potentiating activity of 38 of the screened
kinase inhibitors, including six of the hit SIK inhibitors, with
publically available binding affinities (K.sub.d's) for a panel of
>400 recombinant kinases (23). Fisher-Exact testing was used to
determine whether high affinity ligands of a particular kinase,
defined as SIK inhibitors with K.sub.d<500 nM, were enriched
among the hit SIK inhibitors. This analysis identified
statistically significant associations (p<0.05) between IL-10
up-regulation and binding to several kinases (FIG. 1C). However,
due to the small number of SIK inhibitors with available kinase
profiling data and large number of tests, none of the associations
remained significant after correction for multiple hypothesis
testing.
[0533] SIK1 and SIK2 were enriched among the high-affinity targets
of the IL-10-potentiating kinase inhibitors (FIG. 1C), which is
consistent with the IL-10-potentiating effects of SIK inhibition in
activated M.PHI.s (20, 21). In agreement with these reports,
pre-treating BMDCs with HG-9-91-01, a recently described inhibitor
of SIK1-3, along with several other kinases (21), results in
concentration-dependent potentiation of zymosan-induced IL-10
production with an EC.sub.50.apprxeq.200 nM and a maximum effect
similar to that observed with PGE.sub.2 (FIG. 1D). Similar to our
observations with dasatinib and bosutinib, concentrations of
HG-9-91-01 greater than 1 .mu.M suppressed zymosan-induced IL-10
production. This decrease in IL-10 secretion does not correlate
with reduced viability (FIG. 2A), suggesting that it may instead
result from inhibition of additional kinase targets mediating the
effects of zymosan stimulation. For example, HG-9-91-01 potently
inhibits Src with less than 4% activity remaining at 1 .mu.M (21).
As with PGE.sub.2, extended pre-incubation of BMDCs with HG-9-91-01
was required for robust up-regulation of IL-10 in response to
stimulation with zymosan, LPS or the viral RNA mimetic R848 (FIGS.
7A to 7C). To determine if SIK inhibition increases the fraction of
cells producing IL-10, BMDCs derived from transgenic mice in which
the Il10 promoter drives expression of Thy1.1 (`10BiT` reporter
(24)) were treated with HG-9-91-01 for 2 days prior to stimulation
with zymosan for 18 hr and immunostaining for cell surface Thy 1.1
(FIG. 1E). In this assay system, SIK inhibition enhanced the
fraction of BMDCs expressing Il10 following zymosan stimulation
more than 5-fold (FIG. 1F). Collectively, these results suggest
that SIK inhibition underlies the IL-10-potentiating activity of
several of the hit SIK inhibitors identified in this screen by
enhancing the fraction of activated dendritic cells that produce
IL-10 in response to microbial stimulation.
Example 19. FDA-Approved CML Drugs Up-Regulate IL-10 Production by
a Mechanism Involving Enhanced CRTC3/CREB Signaling
[0534] Potent binding to SIK1 and SIK2 by dasatinib, bosutinib and
the annotated Alk inhibitor TAE-684 (K.sub.d<30 nM in all cases
(23)) contributes to the positive correlation between SIK
inhibition and IL-10 potentiation. Based on the kinase profiling
data, we then studied whether dasatinib and bosutinib, as
representative hits, induced cellular effects consistent with
up-regulation of IL-10 production via the SIK2/CRTC3/CREB pathway.
In support of this hypothesis, pre-incubation of BMDCs with
dasatinib or bosutinib resulted in a four-fold induction of a
CREB-dependent luciferase reporter construct following zymosan
stimulation (FIG. 8A). In addition, as reported for HG-9-91-01
(21), bosutinib treatment is associated with a decrease in
SIK-specific phosphorylation of CRTC3 at S370 with an EC.sub.50
similar to that observed for up-regulation of CREB transcriptional
activity and IL-10 production (FIG. 8B). Finally, abundance of
CRTC3 protein was reduced to nearly undetectable levels in BMDCs
stably transduced with shRNAs targeting its transcript to test
whether the IL-10-potentiating effects of dasatinib and bosutinib
require functional CREB/CRTC3 complexes (FIG. 8C). In support of
this hypothesis, CRTC3 knockdown significantly reduced the maximum
IL-10 enhancement induced by both dasatinib and bosutinib relative
to control shRNAs targeting RFP or LacZ (FIGS. 8D and 8E).
Together, these biochemical and cellular data support a model where
enhancement of CREB/CRTC3 signaling following SIK inhibition
mediates the IL-10-potentiating activity of dasatinib, bosutinib
and potentially other FDA-approved multi-kinase inhibitors.
Example 20. Activity of HG-9-91-01 Analogs Suggests Specific Role
of SIK2 Inhibition in IL-10 Potentiation
[0535] HG-9-91-01 potently inhibits SIK1-3 (IC.sub.50<20 nM
(21)) making it challenging to determine how inhibiting particular
SIK isoforms contributes to IL-10 up-regulation in activated DCs.
This question was addressed by determining how modifying the
structure of HG-9-91-01 affects IL-10 potentiation relative to
inhibition of SIK1-3. To do so, we first developed a succinct,
modular synthesis of HG-9-91-01 and related analogs bearing
substitutions of the central heteroaromatic core (FIG. 9A). This
series of SIK inhibitors was then tested for their effects on
SIK1-3 activity as well as IL-10 production by and viability of
zymosan-stimulated DCs (FIG. 2A and FIG. 9B). Despite displaying a
range of EC.sub.50's for IL-10 up-regulation, these SIK inhibitors
were all potent inhibitors of SIK1 such that the two activities
appear to be uncorrelated (FIG. 2B). In contrast, SIK inhibitors
lacking the 2,4-dimethoxy aniline moieties and/or bearing
alterations to the central heteroaromatic core of HG-9-91-01 had
differentially reduced potencies of SIK2 and SIK3 inhibition (FIG.
2B). Comparing the EC.sub.50 values for IL-10 induction versus the
IC.sub.50's for SIK2 or SIK3 inhibition for the five SIK inhibitors
retaining the phenyl piperazine moiety revealed a significant
(R.sup.2=0.92) positive correlation between the potency of SIK2
inhibition and IL-10 induction, whereas this trend was less
pronounced for SIK3 (FIG. 2B). Several SIK inhibitors in this
series displayed toxicity at concentrations greater than 1 .mu.M
(FIGS. 2A and 9B). However, consistent with data indicating that
reduction of Sik2 expression by RNAi is well tolerated in
macrophages (21), the toxicity of HG-9-91-01 analogs did not
correlate with the IC.sub.50's for SIK1-3 inhibition. The close
correlation between the potencies of SIK2 inhibition and IL-10
up-regulation suggest that inhibition of this SIK isoform is
primarily responsible for the IL-10-potentiating activity of
HG-9-91-01 and structurally related SIK inhibitors in activated
dendritic cells.
Example 21. SIK Inhibition Converts Activated Myeloid Cells to an
Anti-Inflammatory State
[0536] To test whether SIK inhibition promotes anti-inflammatory
phenotypes beyond enhanced IL-10 production, we pre-treated BMDCs
with concentrations of HG-9-91-01 or PGE.sub.2 that equivalently
up-regulate IL-10, and measured the abundance of 100 transcripts
encoding key myeloid cytokines and transcriptional regulators after
4 hr stimulation with LPS, R848 or zymosan (FIG. 3A).
Transcriptional responses to PGE.sub.2 or HG-9-91-01 were
normalized to vehicle-treated samples for each activating stimuli,
and significantly induced or repressed genes (p<0.05) were
clustered using One-minus Pearson's correlations (FIG. 3A). While
IL-10 mRNA levels were robustly enhanced by both PGE.sub.2 and
HG-9-91-01 (FIG. 10A), notable differences are observed in the
transcriptional response to these two CREB activating stimuli.
Expression of the pro-inflammatory cytokines Il12b and Il1b were
significantly elevated in PGE.sub.2- versus HG-9-91-01-treated
BMDCs (FIGS. 10B and 10C) and similar trends were observed with
Il23a and Il33 (FIGS. 10D and 10E). Similarly, abundance of Arg and
Nos2 transcripts, which encode genes essential arginine catabolism
and nitric oxide (NO) production, respectively, were highly induced
by PGE.sub.2, while these changes were significantly blunted in
BMDCs pre-treated with HG-9-91-01 (FIGS. 10F and 10G).
[0537] Next, we asked how the differential transcriptional
responses activated by PGE.sub.2 versus SIK inhibition translate
into production NO and inflammatory cytokines. While IL-10
secretion was similarly induced in BMDCs pre-treated with PGE.sub.2
or HG-9-91-01 before stimulation with LPS, R848 or zymosan,
production of several pro-inflammatory mediators was significantly
different (FIG. 3B). For instance, production of IL-12p40 and
TNF-.alpha. was suppressed to a significantly greater extent by
treatment with HG-9-91-01 rather than PGE.sub.2 regardless of
activating stimuli. More strikingly, IL-1.beta. production was
enhanced by PGE.sub.2 following stimulation with R848 or zymosan,
while production of this pro-inflammatory cytokine was suppressed
in the presence of the SIK inhibitor. Lastly, elevated expression
of Nos2 in PGE.sub.2-treated BMDCs relative to HG-9-91-01-treated
BMDCs correlated with increased NO production following zymosan
stimulation. Consistent with the effects of SIK inhibition in
BMDCs, pre-incubating human M.PHI.s or DCs with HG-9-91-01 enhanced
IL-10 production while dramatically reducing IL-12p70 secretion in
response to zymosan stimulation (FIGS. 11A and 11B). Hence, SIK
inhibition converts human and murine myeloid cells to an
anti-inflammatory phenotype in which up-regulation of IL-10 is
accompanied by reduced secretion of inflammatory cytokines.
Moreover, the stimulatory effect of SIK inhibition on several
inflammatory mediators is substantially blunted relative to the
responses induced by PGE.sub.2.
Example 22. SIK Inhibition does not Enhance IL-10 Production by
Regulatory T Cells Subsets
[0538] Regulatory CD4.sup.+ T cells expressing the master
transcription factor FoxP3 (i.e., T.sub.reg's) play an essential
role in maintaining tolerance to self and commensal antigens (25).
In addition, a subset of FoxP3.sup.- CD4.sup.+ T cells that produce
high levels of IL-10, termed type 1 regulatory (Tr1) cells, have
been implicated in gut immune homeostasis (26). To determine if SIK
inhibition affects differentiation and/or IL-10 production by
either regulatory T cell subset, we treated naive splenic CD4.sup.+
T cells with HG-9-91-01 in the presence of culture conditions that
promote T.sub.reg or Tr1 differentiation for 4 days. In contrast to
myeloid cells, concentrations of HG-9-91-01 greater than 0.5 .mu.M
were toxic in both T.sub.reg's and Tr1 cells (FIGS. 12A and 13A).
Differentiation of T.sub.reg's in the presence of concentrations of
HG-9-91-01 sufficient to potently inhibit SIKs and increase IL-10
in BMDCs did not increase the fraction of Foxp3.sup.+ cells or
promote IL-10 secretion (FIGS. 12B and 12C). Similarly, although
Tr1 cells abundantly secreted IL-10, this activity was not further
enhanced by non-toxic concentrations of HG-9-91-01 (FIG. 13B).
Together, these data suggest that SIK/CRTC/CREB signaling may play
a greater role in regulating Il10 expression in myeloid cells than
T lymphocytes.
Example 23. SIK Inhibition Enhances IL-10 Production by
Immunoregulatory Gut Myeloid Cells
[0539] To determine if SIK inhibition enhances IL-10 production by
primary myeloid cells from gut tissues, we isolated
immunoregulatory CD11c.sup.+CX.sub.3CR1.sup.hi cells and a control
population of CD11c.sup.+CX.sub.3CR1.sup.- DCs from the small
intestine of Cx3cr1.sup.eGFP/+ mice (FIG. 4A). Because ex vivo
survival of primary gut cells is limited, both subsets were
pre-treated with HG-9-91-01 for 30 min prior to 18 hr stimulation
with LPS or zymosan. Despite the limited pre-treatment, HG-9-91-01
enhanced IL-10 production by CD11c.sup.+CX.sub.3CR1.sup.hi cells
activated with LPS or zymosan (FIG. 4B). Consistent with our
results in BMDCs and human DCs/M.PHI.s, up-regulation of IL-10 was
accompanied by reduced secretion of TNF-.alpha. in both gut myeloid
cell subsets. SIK inhibition does not appear to non-specifically
disrupt function of gut DCs/M.PHI.s because production of IL-6 or
the IFN.gamma.-responsive chemokine RANTES were not affected by
HG-9-91-01 pre-treatment in either subset (FIG. 4B). Thus, the
IL-10-potentiating activity of HG-9-91-01 in
CD11c.sup.+CX.sub.3CR1.sup.hi myeloid cells isolated from the small
intestine provides experimental evidence supporting SIKs as novel
target to enhance gut IL-10 levels.
Example 24. Discussion of Examples
[0540] Described herein, is a small-molecule screen that identified
SIK inhibition as a common mechanism by which several multi-kinase
inhibitors, including FDA-approved drugs for CML, enhance IL-10
production by activated BMDCs. Evaluation of a series of structural
analogs of the selective SIK targeting inhibitor HG-9-91-01
demonstrates a strong correlation between the potency of SIK2
inhibition and enhanced IL-10 production. These results, together
with data indicating that expression of a HG-9-91-01-resistant SIK2
allele suppresses the IL-10-potentiating effects of this SIK
inhibitor in the RAW264.7 murine macrophages (21), suggests that
SIK2 plays a primary role in restraining IL-10 production in
activated myeloid cells. Along with enhanced IL-10 secretion, SIK
inhibition converted activated BMDCs to an anti-inflammatory
phenotype marked by reduced secretion of the inflammatory cytokines
IL-1.beta., IL-6, IL-12 and TNF-.alpha., and these coordinated
effects of SIK inhibition were conserved in human DCs/M.PHI.s. In
addition, we evaluated whether SIK inhibition enhanced IL-10
production in other immune cell types known to produce IL-10 such
as FoxP3.sup.+ T.sub.reg's or Tr1 cells. In contrast to our
observations in myeloid cells, treatment with HG-9-91-01 did not
increase IL-10 production during ex vivo differentiation of either
regulatory T cell subset, which is consistent with studies
indicating that c-MAF and mitogen-activated protein (MAP) kinase
signaling play a central role in IL-10 regulation in T lymphocytes
(16).
[0541] The results indicate that dasatinib and bosutinib induce
effects consistent with SIK inhibition in dendritic cells including
activation of a CREB-dependent luciferase reporter construct and
reduction of SIK-specific phosphorylation of CRTC3 at S370.
Significantly, the IL-10-enhancing activity of both dasatinib and
bosutinib in activated BMDCs was blunted by knockdown of CRTC3.
Together, these results support a model where SIK inhibition
underlies the immunomodulatory effects of these FDA-approved CML
drugs in myeloid cells and provide new mechanistic insight into the
recent report that dasatinib treatment increased serum IL-10
levels, while decreasing TNF-.alpha., following systemic LPS
challenge (27). These findings have several potential implications
for therapeutic use of dasatinib and related SIK inhibitors.
Dasatinib doses administered to CML patients achieve serum
concentrations sufficient to potently inhibit SIKs and to
up-regulate IL-10 by activated dendritic cells (28), which suggests
that SIK inhibition is unlikely to be toxic and that the
IL-10-potentiating activity of FDA-approved drugs targeting these
kinases might be explored as candidate treatments for IBD. In the
context of cancer, it is possible that elevated serum IL-10 levels
mediated by `off-target` SIK inhibition could modulate the
chemotherapeutic activity of dasatinib given that T cell-mediated
immune responses targeting tumor antigens are a critical component
of dasatinib's mode-of-action (29). Therefore, combining dasatinib
or related kinase inhibitors with an IL-10 neutralizing strategy
might be a rational approach to enhance the chemotherapeutic
activity of these SIK inhibitors.
[0542] The results described herein, provide additional mechanistic
insight into the ability of SIK inhibitors to selectively enhance
IL-10 production by activated myeloid cells. For instance, key
differences in the expression of genes encoding inflammatory
cytokines (e.g., Il1b, Il12b and Il23a) or NO production (Nos2)
were observed in the transcriptional profiles of BMDCs treated with
concentrations of PGE.sub.2 or HG-9-91-01 that up-regulate IL-10 to
a similar extent. Significantly, these differential transcriptional
responses were mirrored by greater suppression of IL-12p40 (i.e.,
the cytokine encoded by Il12b) secretion and a lack of increased NO
production in HG-9-91-01- versus PGE.sub.2-treated BMDCs. Reduced
induction of Il12b and Il23a expression with HG-9-91-01 is
significant because these genes encode the two subunits of IL-23, a
heterodimeric cytokine that promotes expansion of the inflammatory
T.sub.H17 T cell lineage (30). Similarly, while NO plays an
essential role in the anti-microbial activity of myeloid cells,
aberrantly high production of this inflammatory mediator is thought
to contribute to IBD pathogenesis (31). Both SIK inhibition and
PGE.sub.2 enhance IL-10 transcription by via SIK/CRTC/CREB
signaling. However, in the case of EP2/EP4 prostanoid receptors
agonists like PGE.sub.2, these effects are mediated by activation
of PKA following an intracellular cAMP flux. In addition to the
PKA/CREB cascade, cAMP activates exchange proteins activated by
cAMP (Epac's), which are scaffolding proteins that nucleate MAP
kinase and cytoskeletal signaling components (32). Of note, the
stimulatory effects of PGE.sub.2 on IL-23 and NO production have
both been linked to the cAMP/ePac pathways in myeloid cells (19).
Hence, our findings extend previous studies of SIK inhibitors by
suggesting a model in which SIK inhibition promotes selective
enhancement of CREB-dependent Il10 expression in the absence of
pleiotropic effects of elevated intracellular cAMP (FIG. 14).
[0543] In addition to IL-10 and its receptor, SNPs near the genetic
loci for PTGER4, which encodes the EP4 prostanoid receptor, and
CRTC3 confer increased risk for Crohn's disease and ulcerative
colitis (2). In addition, an intronic SNP in the SIK2 confers
susceptibility to primary sclerosing cholangitis, a degenerative
liver disease that shares significant co-morbidity with IBD (33).
These human genetic data potentially implicate EP4/SIK2/CRTC3/CREB
signaling as a contributor to IBD (patho)physiology via regulation
of gut IL-10 levels, and make it an intriguing target for
therapeutic manipulation. This is supported by the efficacy of
phosphodiesterase (PDE) inhibitors, which suppress cAMP hydrolysis,
and gut restricted delivery of EP4-selective agonists in murine
models of colitis (34, 35). Unfortunately, potent emetic effects
have hampered therapeutic development of PDE inhibitors (36), while
gut-specific activation of prostanoid receptors remains an unproven
therapeutic strategy. Specific experimental support for SIK
inhibition as a novel IBD treatment comes from our observation that
the IL-10-potentiating activity of HG-9-91-01 is maintained in
murine CD11c.sup.+CX.sub.3CR1.sup.hi cells, a highly abundant
subset of myeloid cells that play a key role in maintaining gut
immune homeostasis, isolated from the small intestine (13, 14). The
anti-inflammatory activity of CD11c.sup.+CX.sub.3CR1.sup.hi myeloid
cells in the CD45RB.sup.hi T cell transfer colitis model requires
intact IL-10/STAT3 signaling (15), which suggests that SIK
inhibition will enhance the T cell suppressive activity of these
cells and, in turn, suppress pathogenic auto-inflammation
characteristic of IBD.
[0544] The disclosure reveals that SIK inhibition by small
molecules converts activated DCs/M.PHI.s to an anti-inflammatory
phenotype characterized by enhanced IL-10 production coupled with
reduced secretion of inflammatory cytokines. Integrating genetic
analysis of IBD susceptibility with the IL-10-potentiating activity
of HG-9-91-01 in primary gut myeloid cells supports SIKs as a
potential new target for treatment of these disorders. However,
because aberrant recruitment/activation of inflammatory myeloid
cells also contributes to the pathogenesis of type-1 diabetes,
rheumatoid arthritis and systemic lupus erythematosus (10), SIK
inhibition may be a more broadly applicable therapeutic strategy
for treatment of autoimmune/auto-inflammatory disorders.
REFERENCES
[0545] 1. Khor B, Gardet A, & Xavier R J (2011) Genetics and
pathogenesis of inflammatory bowel disease. Nature
474(7351):307-317. [0546] 2. Jostins L, et al. (2012) Host-microbe
interactions have shaped the genetic architecture of inflammatory
bowel disease. Nature 491(7422): 119-124. [0547] 3. Shouval D S, et
al. (2014) Interleukin 10 receptor signaling: master regulator of
intestinal mucosal homeostasis in mice and humans. Advances in
immunology 122:177-210. [0548] 4. Kuhn R, Lohler J, Rennick D,
Rajewsky K, & Muller W (1993) Interleukin-10-deficient mice
develop chronic enterocolitis. Cell 75(2):263-274. [0549] 5.
Spencer S D, et al. (1998) The orphan receptor CRF2-4 is an
essential subunit of the interleukin 10 receptor. The Journal of
experimental medicine 187(4):571-578. [0550] 6. Tomoyose M,
Mitsuyama K, Ishida H, Toyonaga A, & Tanikawa K (1998) Role of
interleukin-10 in a murine model of dextran sulfate sodium-induced
colitis. Scandinavian journal of gastroenterology 33(4):435-440.
[0551] 7. Schreiber S, et al. (2000) Safety and efficacy of
recombinant human interleukin 10 in chronic active Crohn's disease.
Crohn's Disease IL-10 Cooperative Study Group. Gastroenterology
119(6):1461-1472. [0552] 8. Marlow G J, van Gent D, & Ferguson
L R (2013) Why interleukin-10 supplementation does not work in
Crohn's disease patients. World journal of gastroenterology: WJG
19(25):3931-3941. [0553] 9. Braat H, et al. (2006) A phase I trial
with transgenic bacteria expressing interleukin-10 in Crohn's
disease. Clinical gastroenterology and hepatology: the official
clinical practice journal of the American Gastroenterological
Association 4(6):754-759. [0554] 10. Wynn T A, Chawla A, &
Pollard J W (2013) Macrophage biology in development, homeostasis
and disease. Nature 496(7446):445-455. [0555] 11. Grimm M C, et al.
(1995) Direct evidence of monocyte recruitment to inflammatory
bowel disease mucosa. Journal of gastroenterology and hepatology
10(4):387-395. [0556] 12. Zigmond E, et al. (2012) Ly6C hi
monocytes in the inflamed colon give rise to proinflammatory
effector cells and migratory antigen-presenting cells. Immunity
37(6):1076-1090. [0557] 13. Zigmond E & Jung S (2013)
Intestinal macrophages: well educated exceptions from the rule.
Trends in immunology 34(4):162-168. [0558] 14. Niess J H, et al.
(2005) CX3CR1-mediated dendritic cell access to the intestinal
lumen and bacterial clearance. Science 307(5707):254-258. [0559]
15. Kayama H, et al. (2012) Intestinal CX3C chemokine receptor
1(high) (CX3CR1(high)) myeloid cells prevent T-cell-dependent
colitis. Proceedings of the National Academy of Sciences of the
United States of America 109(13):5010-5015. [0560] 16. Saraiva M
& O'Garra A (2010) The regulation of IL-10 production by immune
cells. Nature reviews. Immunology 10(3):170-181. [0561] 17. Martin
M, Rehani K, Jope R S, & Michalek S M (2005) Toll-like
receptor-mediated cytokine production is differentially regulated
by glycogen synthase kinase 3. Nature immunology 6(8):777-784.
[0562] 18. Matsumoto T, et al. (2013) Protein kinase C inhibitor
generates stable human tolerogenic dendritic cells. Journal of
immunology 191(5):2247-2257. [0563] 19. Rodriguez M, et al. (2014)
Polarization of the innate immune response by prostaglandin E2: a
puzzle of receptors and signals. Molecular pharmacology 85(1):
187-197. [0564] 20. MacKenzie K F, et al. (2013) PGE(2) induces
macrophage IL-10 production and a regulatory-like phenotype via a
protein kinase A-SIK-CRTC3 pathway. Journal of immunology
190(2):565-577. [0565] 21. Clark K, et al. (2012) Phosphorylation
of CRTC3 by the salt-inducible kinases controls the interconversion
of classically activated and regulatory macrophages. Proceedings of
the National Academy of Sciences of the United States of America
109(42):16986-16991. [0566] 22. Weisberg E, Manley P W, Cowan-Jacob
S W, Hochhaus A, & Griffin J D (2007) Second generation
inhibitors of BCR-ABL for the treatment of imatinib-resistant
chronic myeloid leukaemia. Nature reviews. Cancer 7(5):345-356.
[0567] 23. Davis M I, et al. (2011) Comprehensive analysis of
kinase inhibitor selectivity. Nature biotechnology 29(11):
1046-1051. [0568] 24. Maynard C L, et al. (2007) Regulatory T cells
expressing interleukin 10 develop from Foxp3+ and Foxp3- precursor
cells in the absence of interleukin 10. Nature immunology
8(9):931-941. [0569] 25. Hori S, Nomura T, & Sakaguchi S (2003)
Control of regulatory T cell development by the transcription
factor Foxp3. Science 299(5609):1057-1061. [0570] 26. Pot C, Apetoh
L, & Kuchroo V K (2011) Type 1 regulatory T cells (Tr1) in
autoimmunity. Seminars in immunology 23(3):202-208. [0571] 27.
Fraser C K, et al. (2009) Dasatinib inhibits the secretion of
TNF-alpha following TLR stimulation in vitro and in vivo.
Experimental hematology 37(12):1435-1444. [0572] 28. Kantarjian H,
et al. (2010) Dasatinib versus imatinib in newly diagnosed
chronic-phase chronic myeloid leukemia. The New England journal of
medicine 362(24):2260-2270. [0573] 29. Yang Y, et al. (2012)
Antitumor T-cell responses contribute to the effects of dasatinib
on c-KIT mutant murine mastocytoma and are potentiated by
anti-OX40. Blood 120(23):4533-4543. [0574] 30. Ghoreschi K, et al.
(2010) Generation of pathogenic T(H)17 cells in the absence of
TGF-beta signalling. Nature 467(7318):967-971. [0575] 31. Cross R K
& Wilson K T (2003) Nitric oxide in inflammatory bowel disease.
Inflammatory bowel diseases 9(3):179-189. [0576] 32. Bos J L (2006)
Epac proteins: multi-purpose cAMP targets. Trends in biochemical
sciences 31(12):680-686. [0577] 33. Liu J Z, et al. (2013) Dense
genotyping of immune-related disease regions identifies nine new
risk loci for primary sclerosing cholangitis. Nature genetics
45(6):670-675. [0578] 34. Hartmann G, et al. (2000) Specific type
IV phosphodiesterase inhibitor rolipram mitigates experimental
colitis in mice. The Journal of pharmacology and experimental
therapeutics 292(1):22-30. [0579] 35. Okamoto T, Uemoto S, &
Tabata Y (2012) Prevention of trinitrobenzene sulfonic acid-induced
experimental colitis by oral administration of a
poly(lactic-coglycolic acid) microsphere containing prostaglandin
E(2) receptor subtype 4 agonist. The Journal of pharmacology and
experimental therapeutics 341(2):340-349. [0580] 36. Houslay M D,
Schafer P, & Zhang K Y (2005) Keynote review:
phosphodiesterase-4 as a therapeutic target. Drug discovery today
10(22):1503-1519.
EQUIVALENTS AND SCOPE
[0581] In the claims articles such as "a," "an," and "the" may mean
one or more than one unless indicated to the contrary or otherwise
evident from the context. Claims or descriptions that include "or"
between one or more members of a group are considered satisfied if
one, more than one, or all of the group members are present in,
employed in, or otherwise relevant to a given product or process
unless indicated to the contrary or otherwise evident from the
context. The invention includes embodiments in which exactly one
member of the group is present in, employed in, or otherwise
relevant to a given product or process. The invention includes
embodiments in which more than one, or all of the group members are
present in, employed in, or otherwise relevant to a given product
or process.
[0582] Furthermore, the invention encompasses all variations,
combinations, and permutations in which one or more limitations,
elements, clauses, and descriptive terms from one or more of the
listed claims is introduced into another claim. For example, any
claim that is dependent on another claim can be modified to include
one or more limitations found in any other claim that is dependent
on the same base claim. Where elements are presented as lists,
e.g., in Markush group format, each subgroup of the elements is
also disclosed, and any element(s) can be removed from the group.
It should it be understood that, in general, where the invention,
or aspects of the invention, is/are referred to as comprising
particular elements and/or features, certain embodiments of the
invention or aspects of the invention consist, or consist
essentially of, such elements and/or features. For purposes of
simplicity, those embodiments have not been specifically set forth
in haec verba herein. It is also noted that the terms "comprising"
and "containing" are intended to be open and permits the inclusion
of additional elements or steps. Where ranges are given, endpoints
are included. Furthermore, unless otherwise indicated or otherwise
evident from the context and understanding of one of ordinary skill
in the art, values that are expressed as ranges can assume any
specific value or sub-range within the stated ranges in different
embodiments of the invention, to the tenth of the unit of the lower
limit of the range, unless the context clearly dictates
otherwise.
[0583] This application refers to various issued patents, published
patent applications, journal articles, and other publications, all
of which are incorporated herein by reference. If there is a
conflict between any of the incorporated references and the instant
specification, the specification shall control. In addition, any
particular embodiment of the present invention that falls within
the prior art may be explicitly excluded from any one or more of
the claims. Because such embodiments are deemed to be known to one
of ordinary skill in the art, they may be excluded even if the
exclusion is not set forth explicitly herein. Any particular
embodiment of the invention can be excluded from any claim, for any
reason, whether or not related to the existence of prior art.
[0584] Those skilled in the art will recognize or be able to
ascertain using no more than routine experimentation many
equivalents to the specific embodiments described herein. The scope
of the present embodiments described herein is not intended to be
limited to the above Description, but rather is as set forth in the
appended claims. Those of ordinary skill in the art will appreciate
that various changes and modifications to this description may be
made without departing from the spirit or scope of the present
invention, as defined in the following claims.
* * * * *