U.S. patent application number 15/480533 was filed with the patent office on 2017-07-27 for rapid method for cloning and expression of cognate antibody variable region gene segments.
This patent application is currently assigned to Hoffmann-La Roche Inc.. The applicant listed for this patent is Hoffmann-La Roche Inc.. Invention is credited to Simone Hoege, Erhard Kopetzki, Dominique Ostler, Stefan Seeber, Georg Tiefenthaler.
Application Number | 20170210785 15/480533 |
Document ID | / |
Family ID | 47522537 |
Filed Date | 2017-07-27 |
United States Patent
Application |
20170210785 |
Kind Code |
A1 |
Hoege; Simone ; et
al. |
July 27, 2017 |
RAPID METHOD FOR CLONING AND EXPRESSION OF COGNATE ANTIBODY
VARIABLE REGION GENE SEGMENTS
Abstract
In the method as reported herein the isolation of nucleic acid
segments encoding antibody variable domains and the insertion of
the isolated nucleic acid segments in eukaryotic expression
plasmids is performed without the intermediate isolation and
analysis of clonal intermediate plasmids. Thus, in the method as
reported herein the intermediate cloning, isolation and analysis of
intermediate plasmids is not required, e.g. by analysis of isolated
transformed E. coli cells.
Inventors: |
Hoege; Simone; (Bichl,
DE) ; Kopetzki; Erhard; (Penzberg, DE) ;
Ostler; Dominique; (Aidling, DE) ; Seeber;
Stefan; (Sindelsdorf, DE) ; Tiefenthaler; Georg;
(Sindelsdorf, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Hoffmann-La Roche Inc. |
Little Falls |
NJ |
US |
|
|
Assignee: |
Hoffmann-La Roche Inc.
Little Falls
NJ
|
Family ID: |
47522537 |
Appl. No.: |
15/480533 |
Filed: |
April 6, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14310966 |
Jun 20, 2014 |
|
|
|
15480533 |
|
|
|
|
PCT/EP2012/076155 |
Dec 19, 2012 |
|
|
|
14310966 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 5/0635 20130101;
C07K 2317/14 20130101; C07K 2317/56 20130101; C07K 16/00 20130101;
C12N 15/85 20130101; C12N 15/1086 20130101; C12P 21/02 20130101;
C12N 2510/02 20130101; C12N 15/1086 20130101; C12Q 2521/507
20130101; C12Q 2537/143 20130101 |
International
Class: |
C07K 16/00 20060101
C07K016/00; C12N 15/85 20060101 C12N015/85; C12N 5/0781 20060101
C12N005/0781 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 21, 2011 |
EP |
11194861.8 |
Claims
1-15. (canceled)
16. A method for producing an antibody, the method comprising: (i)
obtaining an antibody-secreting B-cell from an animal, wherein the
B-cell comprises nucleic acid encoding the antibody; (ii) culturing
the B-cell as a single-deposited B-cell, wherein the B-cell and its
progeny produce greater than 20 ng/ml of the antibody in 7 days of
co-cultivation of the B-cell with feeder cells; (iii) amplifying
the nucleic acid encoding the antibody light chain variable domain
or the antibody heavy chain variable domain by PCR using
single-stranded cDNA obtained from the RNA of the
antibody-secreting B-cell as template, thereby obtaining a pool of
nucleic acids encoding the antibody light chain variable domain or
the antibody heavy chain variable domain; (iv) generating single
strand extensions of the pool of nucleic acids in the absence of
nucleotides using T4 DNA polymerase; and (v) inserting the
amplified nucleic acids encoding the antibody light chain variable
domain or the antibody heavy chain variable domain into a
eukaryotic expression plasmid by sequence- and ligation-independent
cloning, wherein the pool of nucleic acids encoding the antibody
light chain variable domain and the antibody heavy chain variable
domain, respectively, is inserted into the expression plasmid.
17. The method of claim 16, wherein the B-cell is a rabbit
B-cell.
18. The method of claim 16 or claim 17, wherein the feeder cells
are EL4-B5 cells.
19. The method of claim 16 or claim 17, wherein PCR primers
comprising the nucleic acid sequences of SEQ ID NOs:5 and 6 or the
nucleic acid sequences of SEQ ID NOs:7 or 8 are used for the
amplification of nucleic acid encoding the antibody light chain
variable domain or the antibody heavy chain variable domain,
respectively.
20. The method of claim 16 or claim 17, wherein method further
comprises removing PCR primers after the PCR amplification
step.
21. The method of claim 16 or claim 17, wherein about 300 ng
nucleic acid is used in the insertion reaction.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/310,966, filed Jun. 20, 2014, which is a
continuation of International Patent Application No.
PCT/EP2012/076155, having an international filing date of Dec. 19,
2012, the entire contents of which are incorporated herein by
reference in its entirety, which claims benefit under 35 U.S.C.
.sctn.119 to European Patent Application No. 11194861.8, filed Dec.
21, 2011.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing
submitted via EFS-Web and hereby incorporated by reference in its
entirety. Said ASCII copy, created on Apr. 3, 2017, is named
P30785_US_1_US_Seq_Listing.txt, and is 10,279 bytes in size.
FIELD OF THE INVENTION
[0003] Herein is reported a method for the isolation (cloning,
expression, and selection) of an antibody starting from a single
antibody-producing B-cell, wherein the individual steps of the
method are all performed in solution allowing for the
identification of antibodies with the desired specificity.
BACKGROUND OF THE INVENTION
[0004] For obtaining cells secreting monoclonal antibodies the
hybridoma technology developed by Koehler and Milstein is widely
used. But in the hybridoma technology only a fraction of the
B-cells obtained from an immunized experimental animal can be fused
and propagated. The source of the B-cells is generally an organ of
an immunized experimental animal such as the spleen.
[0005] Zubler et al. started in 1984 to develop a different
approach for obtaining cells secreting monoclonal antibodies (see
e.g. Eur. J. Immunol. 14 (1984) 357-363, J. Exp. Med. 160 (1984)
1170-1183). Therein the B-cells are obtained from the blood of the
immunized experimental animal and co-cultivated with murine EL-4 B5
feeder cells in the presence of a cytokine comprising feeder mix.
With this methodology up to 50 ng/ml antibody can be obtained after
10-12 days of co-cultivation.
[0006] Weitkamp, J.-H., et al., (J. Immunol. Meth. 275 (2003)
223-237) report the generation of recombinant human monoclonal
antibodies to rotavirus from single antigen-specific B-cells
selected with fluorescent virus-like particles. A method of
producing a plurality of isolated antibodies to a plurality of
cognate antigens is reported in US 2006/0051348. In WO 2008/144763
and WO 2008/045140 antibodies to IL-6 and uses thereof and a
culture method for obtaining a clonal population of
antigen-specific B cells are reported, respectively. A culture
method for obtaining a clonal population of antigen-specific
B-cells is reported in US 2007/0269868. Masri et al. (in Mol.
Immunol. 44 (2007) 2101-2106) report the cloning and expression in
E. coli of a functional Fab fragment obtained from single human
lymphocyte against anthrax toxin. A method for preparing
immunoglobulin libraries is reported in WO 2007/031550.
[0007] In WO 2010/056898 rapid expression and cloning of human
monoclonal antibodies from memory B-cells is reported. A rapid and
efficient single-cell manipulation method for screening
antigen-specific antibody-producing cells from human peripheral
blood is reported by Jin et al. (Jin, A., et al., Nature Medicine
15 (2009) 1088-1093). Lightwood et al. (Lightwood, D. J., et al.,
J. Immunol. Meth. 316 (2006) 133-143) report antibody generation
through B-cell panning on antigen followed by in situ culture and
direct RT-PCR on cells harvested en masse from antigen-positive
wells.
SUMMARY OF THE INVENTION
[0008] In the method as reported herein the isolation of nucleic
acid fragments or segments encoding antibody variable domains
(light and heavy chain) and the insertion of the isolated nucleic
acid fragments or segments in eukaryotic expression cassettes (one
cassette each for the light and heavy chain, respectively) is
performed without the intermediate isolation and analysis of clonal
intermediate plasmids/cassettes. Thus, in the method as reported
herein the intermediate cloning, isolation and analysis of
intermediate plasmids/cassettes is not required, e.g. by analysis
of isolated transformed E. coli cells, thus, resulting in a faster
method.
[0009] One aspect as reported herein is a method for the isolation
of nucleic acids encoding cognate variable domains of an antibody
comprising the following steps: [0010] synthesizing single stranded
cDNA using the RNA obtained from an antibody secreting B-cell as
template in an RT-PCR, [0011] amplifying the variable domain
encoding nucleic acids in a PCR and thereby isolating the nucleic
acid fragments encoding the cognate variable domains of an
antibody, whereby the PCR primer are removed after the PCR.
[0012] In one embodiment the method is performed without the
isolation and analysis of intermediate nucleic acids.
[0013] One aspect as reported herein is a method for producing an
antibody comprising the following step: [0014] cultivating a
eukaryotic cell comprising a nucleic acid encoding an antibody, and
[0015] recovering the antibody from the cell or the cultivation
medium, whereby the nucleic acid encoding the antibody is obtained
by [0016] synthesizing single stranded cDNA using the RNA obtained
from an antibody secreting B-cell as template in an RT-PCR, [0017]
amplifying the variable domain encoding nucleic acid(s) in a PCR,
and [0018] inserting the variable domain encoding nucleic acid(s)
in one or more eukaryotic expression plasmids.
[0019] In one embodiment the PCR primer are removed after the
PCR.
[0020] In one embodiment the method is performed without the
isolation and analysis of intermediate nucleic acids.
[0021] One aspect as reported herein is a method for producing an
antibody comprising the following step: [0022] cultivating a
eukaryotic cell transfected with one or more expression plasmids
encoding the antibody heavy and light chains whereby the one or
more expression plasmids have been prepared from a pool of plasmid
transformed E. coli cells, [0023] recovering the antibody from the
cell or the cultivation medium.
[0024] One aspect as reported herein is a method for producing an
antibody comprising the following step: [0025] recovering the
antibody from the cultivation medium of a eukaryotic cell
comprising a nucleic acid encoding the antibody, [0026] whereby the
nucleic acid encoding the antibody is obtained by [0027] amplifying
cognate variable domain encoding nucleic acids from single stranded
cDNA obtained from the RNA of an antibody secreting B-cell as
template in a PCR, and [0028] inserting the variable domain
encoding nucleic acids in a eukaryotic expression plasmid by
ligation independent cloning, [0029] wherein a pool of nucleic
acids encoding the antibody light and heavy chain variable domain,
respectively, is used for the insertion.
[0030] In one embodiment the method comprises as first step: [0031]
synthesizing single stranded cDNA using the RNA obtained from an
antibody secreting B-cell as template.
[0032] In one embodiment the PCR primer are removed after the
PCR.
[0033] In one embodiment the method is performed without the
isolation and analysis of intermediate nucleic acids.
[0034] One aspect as reported herein is a method for producing an
antibody comprising the following step: [0035] cultivating a
eukaryotic cell transfected with an expression plasmid encoding the
antibody, whereby the eukaryotic cell has been transfected with a
pool of expression plasmids that has been prepared from a pool of
plasmid transformed E. coli cells, [0036] recovering the antibody
from the cell or the cultivation medium.
[0037] In one embodiment the nucleic acid encoding the antibody is
obtained by [0038] amplifying cognate variable domain encoding
nucleic acids from single stranded cDNA obtained from the RNA of an
antibody secreting B-cell as template in a PCR, and [0039]
inserting the variable domain encoding nucleic acids in a
eukaryotic expression plasmid by ligation independent cloning.
[0040] In one embodiment the method comprises as first step: [0041]
synthesizing single stranded cDNA using the RNA obtained from an
antibody secreting B-cell as template.
[0042] In one embodiment the PCR primer are removed after the
PCR.
[0043] In one embodiment the method is performed without the
isolation and analysis of intermediate nucleic acids.
[0044] In one embodiment of all aspects the B-cell is a rabbit
B-cell.
[0045] In one embodiment of all aspects the B-cell is a single
deposited B-cell.
[0046] In one embodiment of all aspects the B-cell is cultivated
for about 7 days.
[0047] In one embodiment of all aspects the B-cell and its progeny
produces more than 20 ng/ml antibody in 7 days of co-cultivation
with feeder cells starting from a single cell.
[0048] In one embodiment of all aspects the PCR primer have the
nucleic acid sequences of SEQ ID NO: 5 and 6 or SEQ ID NO: 7 or
8.
[0049] In one embodiment of all aspects the nucleic acid fragments
are inserted into the expression plasmid by sequence and ligation
independent cloning.
[0050] In one embodiment of all aspects about 300 ng nucleic acid
is used in the insertion reaction.
[0051] In one embodiment of all aspects a pool of nucleic acids is
used for the insertion.
[0052] In one embodiment of all aspects the expression plasmid is
obtained by sequence and ligation independent cloning of the
variable domain encoding nucleic acid into a variable domain free
amplified expression plasmid.
[0053] In one embodiment of all aspects the plasmid is linearized
prior to the amplification.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0054] "Affinity" refers to the strength of the total sum of
non-covalent interactions between a single binding site of a
molecule (e.g., an antibody) and its binding partner (e.g., an
antigen). Unless indicated otherwise, as used herein, "binding
affinity" refers to intrinsic binding affinity which reflects a 1:1
interaction between members of a binding pair (e.g., antibody and
antigen). The affinity of a molecule X for its partner Y can
generally be represented by the dissociation constant (Kd).
Affinity can be measured by common methods known in the art,
including those described herein. Specific illustrative and
exemplary embodiments for measuring binding affinity are described
in the following.
[0055] The term "amino acid" as used within this application
denotes the group of carboxy .alpha.-amino acids, which directly or
in form of a precursor can be encoded by a nucleic acid. The
individual amino acids are encoded by nucleic acids consisting of
three nucleotides, so called codons or base-triplets. Each amino
acid is encoded by at least one codon. This is known as
"degeneration of the genetic code". The term "amino acid" as used
within this application denotes the naturally occurring carboxy
.alpha.-amino acids comprising alanine (three letter code: ala, one
letter code: A), arginine (arg, R), asparagine (asn, N), aspartic
acid (asp, D), cysteine (cys, C), glutamine (gln, Q), glutamic acid
(glu, E), glycine (gly, G), histidine (his, H), isoleucine (ile,
I), leucine (leu, L), lysine (lys, K), methionine (met, M),
phenylalanine (phe, F), proline (pro, P), serine (ser, S),
threonine (thr, T), tryptophan (trp, W), tyrosine (tyr, Y), and
valine (val, V).
[0056] The term "antibody" herein is used in the broadest sense and
encompasses various antibody structures, including but not limited
to monoclonal antibodies, polyclonal antibodies, multispecific
antibodies (e.g., bispecific antibodies), and antibody fragments so
long as they exhibit the desired antigen-binding activity.
[0057] An "antibody fragment" refers to a molecule other than an
intact antibody that comprises a portion of an intact antibody that
binds the antigen to which the intact antibody binds. Examples of
antibody fragments include but are not limited to Fv, Fab, Fab',
Fab'-SH, F(ab').sub.2; diabodies; linear antibodies; single-chain
antibody molecules (e.g. scFv); single domain antibodies; and
multispecific antibodies formed from antibody fragments.
[0058] The "class" of an antibody refers to the type of constant
domain or constant region possessed by its heavy chain. E.g. there
are five major classes of antibodies in the human: IgA, IgD, IgE,
IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and
IgA2. The heavy chain constant domains that correspond to the
different classes of immunoglobulins are called .alpha., .delta.,
.epsilon., .gamma., and .mu., respectively.
[0059] The term "cognate pair of antibody variable domains" denotes
a pair of antibody variable domains that is obtained from a single
antibody secreting B-cell, i.e. which has been generated as pair
during the immune response of a mammal due to the contact with an
immunogenic molecule or which have been assembled randomly during a
display approach.
[0060] An "effective amount" of an agent, e.g., a pharmaceutical
formulation, refers to an amount effective, at dosages and for
periods of time necessary, to achieve the desired therapeutic or
prophylactic result.
[0061] The term "expression" as used herein refers to transcription
and/or translation and secretion processes occurring within a cell.
The level of transcription of a nucleic acid sequence of interest
in a cell can be determined on the basis of the amount of
corresponding mRNA that is present in the cell. For example, mRNA
transcribed from a sequence of interest can be quantified by qPCR
or RT-PCR or by Northern hybridization (see Sambrook, et al.,
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)).
Polypeptides encoded by a nucleic acid can be quantified by various
methods, e.g. by ELISA, by assaying the biological activity of the
polypeptide, or by employing assays that are independent of such
activity, such as Western blotting or radioimmunoassay, using
immunoglobulins that recognize and bind to the polypeptide (see
Sambrook, et al., (1989), supra).
[0062] An "expression cassette" denotes a construct that contains
the necessary regulatory elements, such as promoter and
polyadenylation site, for expression of at least the contained
nucleic acid in a cell.
[0063] The term "expression machinery" denotes the sum of the
enzymes, cofactors, etc. of a cell that is involved in the steps of
gene expression beginning with the transcription step of a nucleic
acid or gene (i.e. also called "gene expression machinery") to the
post-translational modification of the polypeptide encoded by the
nucleic acid. The expression machinery e.g. comprises the steps of
transcription of DNA into pre-mRNA, pre-mRNA splicing to mature
mRNA, translation into a polypeptide of the mRNA, and post
translational modification of the polypeptide.
[0064] An "expression plasmid" is a nucleic acid providing all
required elements for the expression of the comprised structural
gene(s) in a host cell. Typically, an expression plasmid comprises
a prokaryotic plasmid propagation unit, e.g. for E. coli,
comprising an origin of replication, and a selectable marker, a
eukaryotic selection marker, and one or more expression cassettes
for the expression of the structural gene(s) of interest each
comprising a promoter, a structural gene, and a transcription
terminator including a polyadenylation signal. Gene expression is
usually placed under the control of a promoter, and such a
structural gene is said to be "operably linked to" the promoter.
Similarly, a regulatory element and a core promoter are operably
linked if the regulatory element modulates the activity of the core
promoter.
[0065] The terms "host cell", "host cell line", and "host cell
culture" are used interchangeably and refer to cells into which
exogenous nucleic acid has been introduced, including the progeny
of such cells. Host cells include "transformants" or
"transfectants" and "transformed cells" and "transfected cells"
which include the primary transformed cell and progeny derived
therefrom without regard to the number of passages. Progeny may not
be completely identical in nucleic acid content to a parent cell,
but may contain mutations. Mutant progeny that have the same
function or biological activity as screened or selected for in the
originally transformed cell are included herein.
[0066] The term "cell" includes both prokaryotic cells, which are
used for propagation of plasmids, and eukaryotic cells, which are
used for the expression of a nucleic acid. In one embodiment the
eukaryotic cell is a mammalian cell. In one embodiment the
mammalian cell is selected from the group of mammalian cells
comprising CHO cells (e.g. CHO K1, CHO DG44), BHK cells, NS0 cells,
Sp2/0 cells, HEK 293 cells, HEK 293 EBNA cells, PER.C6.RTM. cells,
and COS cells.
[0067] A "human antibody" is one which possesses an amino acid
sequence which corresponds to that of an antibody produced by a
human or a human cell or derived from a non-human source that
utilizes human antibody repertoires or other human
antibody-encoding sequences. This definition of a human antibody
specifically excludes a humanized antibody comprising non-human
antigen-binding residues.
[0068] An "individual" or "subject" is a vertebrate. In one
embodiment the vertebrate is a mammal. Mammals include, but are not
limited to, domesticated animals (e.g., cows, sheep, cats, dogs,
and horses), primates (e.g., humans and non-human primates such as
monkeys), rabbits, and rodents (e.g., mice and rats). In certain
embodiments, the individual or subject is a human. In other
embodiments the individual or subject is a rabbit.
[0069] "Operably linked" refers to a juxtaposition of two or more
components, wherein the components so described are in a
relationship permitting them to function in their intended manner.
For example, a promoter and/or enhancer are operably linked to a
coding sequence, if it acts in cis to control or modulate the
transcription of the linked sequence. Generally, but not
necessarily, the DNA sequences that are "operably linked" are
contiguous and, where necessary to join two protein encoding
regions such as a secretory leader and a polypeptide, contiguous
and in (reading) frame. However, although an operably linked
promoter is generally located upstream of the coding sequence, it
is not necessarily contiguous with it. Enhancers do not have to be
contiguous. An enhancer is operably linked to a coding sequence if
the enhancer increases transcription of the coding sequence.
Operably linked enhancers can be located upstream, within or
downstream of coding sequences and at considerable distance from
the promoter. A polyadenylation site is operably linked to a coding
sequence if it is located at the downstream end of the coding
sequence such that transcription proceeds through the coding
sequence into the polyadenylation sequence. A translation stop
codon is operably linked to an exonic nucleic acid sequence if it
is located at the downstream end (3' end) of the coding sequence
such that translation proceeds through the coding sequence to the
stop codon and is terminated there. Linking is accomplished by
recombinant methods known in the art, e.g., using PCR methodology
and/or by ligation at convenient restriction sites. If convenient
restriction sites do not exist, then synthetic oligonucleotide
adaptors or linkers are used in accord with conventional
practice.
[0070] The term "peptide linker" denotes amino acid sequences of
natural and/or synthetic origin.
[0071] They consist of a linear amino acid chain wherein the 20
naturally occurring amino acids are the monomeric building blocks.
The peptide linker has a length of from 1 to 50 amino acids, in one
embodiment between 1 and 28 amino acids, in a further embodiment
between 2 and 25 amino acids. The peptide linker may contain
repetitive amino acid sequences or sequences of naturally occurring
polypeptides. The linker has the function to ensure that
polypeptides conjugated to each other can perform their biological
activity by allowing the polypeptides to fold correctly and to be
presented properly. In one embodiment the peptide linker is rich in
glycine, glutamine, and/or serine residues. These residues are
arranged e.g. in small repetitive units of up to five amino acids,
such as GS (SEQ ID NO: 1), GGS (SEQ ID NO: 2), GGGS (SEQ ID NO: 3),
and GGGGS (SEQ ID NO: 4). The small repetitive unit may be repeated
for one to five times. At the amino- and/or carboxy-terminal ends
of the multimeric unit up to six additional arbitrary, naturally
occurring amino acids may be added. Other synthetic peptidic
linkers are composed of a single amino acid, which is repeated
between 10 to 20 times and may comprise at the amino- and/or
carboxy-terminal end up to six additional arbitrary, naturally
occurring amino acids. All peptidic linkers can be encoded by a
nucleic acid molecule and therefore can be recombinantly expressed.
As the linkers are themselves peptides, the polypeptide connected
by the linker are connected to the linker via a peptide bond that
is formed between two amino acids.
[0072] "Percent (%) amino acid sequence identity" with respect to a
reference polypeptide sequence is defined as the percentage of
amino acid residues in a candidate sequence that are identical with
the amino acid residues in the reference polypeptide sequence,
after aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity, and not considering
any conservative substitutions as part of the sequence identity.
Alignment for purposes of determining percent amino acid sequence
identity can be achieved in various ways that are within the skill
in the art, for instance, using publicly available computer
software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR)
software. Those skilled in the art can determine appropriate
parameters for aligning sequences, including any algorithms needed
to achieve maximal alignment over the full length of the sequences
being compared. For purposes herein, however, % amino acid sequence
identity values are generated using the sequence comparison
computer program ALIGN-2. The ALIGN-2 sequence comparison computer
program was authored by Genentech, Inc., and the source code has
been filed with user documentation in the U.S. Copyright Office,
Washington D.C., 20559, where it is registered under U.S. Copyright
Registration No. TXU510087. The ALIGN-2 program is publicly
available from Genentech, Inc., South San Francisco, Calif., or may
be compiled from the source code. The ALIGN-2 program should be
compiled for use on a UNIX operating system, including digital UNIX
V4.0D. All sequence comparison parameters are set by the ALIGN-2
program and do not vary.
[0073] In situations where ALIGN-2 is employed for amino acid
sequence comparisons, the % amino acid sequence identity of a given
amino acid sequence A to, with, or against a given amino acid
sequence B (which can alternatively be phrased as a given amino
acid sequence A that has or comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence
B) is calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical
matches by the sequence alignment program ALIGN-2 in that program's
alignment of A and B, and where Y is the total number of amino acid
residues in B. It will be appreciated that where the length of
amino acid sequence A is not equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not
equal the % amino acid sequence identity of B to A. Unless
specifically stated otherwise, all % amino acid sequence identity
values used herein are obtained as described in the immediately
preceding paragraph using the ALIGN-2 computer program.
[0074] A "polypeptide" is a polymer consisting of amino acids
joined by peptide bonds, whether produced naturally or
synthetically. Polypeptides of less than about 25 amino acid
residues may be referred to as "peptides", whereas molecules
consisting of two or more polypeptides or comprising one
polypeptide of more than 100 amino acid residues may be referred to
as "proteins". A polypeptide may also comprise non-amino acid
components, such as carbohydrate groups, metal ions, or carboxylic
acid esters. The non-amino acid components may be added by the
cell, in which the polypeptide is expressed, and may vary with the
type of cell. Polypeptides are defined herein in terms of their
amino acid backbone structure or the nucleic acid encoding the
same. Additions such as carbohydrate groups are generally not
specified, but may be present nonetheless.
[0075] A "structural gene" denotes the region of a gene without a
signal sequence, i.e. the coding region.
[0076] The term "variable region" or "variable domain" refers to
the domain of an antibody heavy or light chain that is involved in
binding the antibody to antigen. The variable domains of the heavy
chain and light chain (VH and VL, respectively) of a native
antibody generally have similar structures, with each domain
comprising four conserved framework regions (FRs) and three
hypervariable regions (HVRs). (See, e.g., Kindt, T. J., et al.,
Kuby Immunology, 6th ed., W.H. Freeman and Co., N.Y. (2007), page
91) A single VH or VL domain may be sufficient to confer
antigen-binding specificity. Furthermore, antibodies that bind a
particular antigen may be isolated using a VH or VL domain from an
antibody that binds the antigen to screen a library of
complementary VL or VH domains, respectively (see, e.g., Portolano,
S., et al., J. Immunol. 150 (1993) 880-887; Clackson, T., et al.,
Nature 352 (1991) 624-628).
[0077] The term "variant" denotes variants of a parent amino acid
sequence that comprises one or more amino acid substitution,
addition, or deletion.
[0078] The term "vector" denotes a nucleic acid molecule capable of
propagating another nucleic acid to which it is linked. The term
includes the vector as a self-replicating nucleic acid structure as
well as the vector incorporated into the genome of a host cell into
which it has been introduced. Certain vectors are capable of
directing the expression of nucleic acids to which they are
operatively linked. Such vectors are referred to herein as
"expression vectors".
General Steps of the Method as Reported Herein
Immunization
[0079] Often non-human animals, such as mice, rabbits, hamster and
rats, are used as animal model for evaluating antibody based
therapies. Also possible is to use the B-cells of a human that
survived a specific disease, that suffers from a chronic disease,
or that was recently vaccinated against a specific disease.
[0080] In the method as reported herein B-cells obtained from e.g.
mouse, rat, hamster, rabbit, sheep, llama, or human can be used. In
one embodiment the mouse is an NMRI-mouse or a balb/c-mouse. In
another embodiment the hamster is selected from Armenian hamster
(Cricetulus migratorius), Chinese hamster (Cricetulus griseus), and
Syrian hamster (Mesocricetulus auratus). In a specific embodiment
the hamster is the Armenia hamster. In one embodiment the rabbit is
selected from New Zealand White (NZW) rabbits, Zimmermann-rabbits
(ZIKA), Alicia-mutant strain rabbits, basilea mutant strain
rabbits, transgenic rabbits with a human immunoglobulin locus,
rabbit IgM knock-out rabbits, and cross-breeding thereof.
[0081] In one embodiment the experimental animals, e.g. mice,
hamsters, rats and rabbits, chosen for immunization are not older
than 12 weeks.
Source and Isolation of B-Cells
[0082] The blood of an experimental animal or a human provides a
high diversity of antibody producing B-cells. The therefrom
obtained B-cells secrete antibodies that have almost no identical
or overlapping amino acid sequences within the CDRs, thus, show a
high diversity.
[0083] In one embodiment the B-cells of an experimental animal or a
human, e.g. from the blood, are obtained from 4 days after
immunization until at least 9 days after immunization or the most
recent boost immunization. This time span allows for a high
flexibility in the method as reported herein. In this time span it
is likely that the B-cells providing for the most affine antibodies
migrate from spleen to blood (see e.g. Paus, D., et al., JEM 203
(2006) 1081-1091; Smith, K. G. S., et al., The EMBO J. 16 (1997)
2996-3006; Wrammert, J., et al., Nature 453 (2008) 667-672).
[0084] B-cells from the blood of an experimental animal or human
may be obtained with any method known to a person skilled in the
art. For example, density gradient centrifugation (DGC) or red
blood cell lysis (lysis) can be used. Density gradient
centrifugation compared to lysis provides for a higher overall
yield, i.e. number of B-cell clones. Additionally from the cells
obtained by density gradient centrifugation a larger number of
cells divides and grows in the co-cultivation step. Also the
concentration of secreted antibody is higher compared to cells
obtained with a different method. Therefore, in one embodiment the
provision of a population of B-cells is by density gradient
centrifugation.
Isolation of mRNA, Cloning, and Sequencing
[0085] From the B-cells the total mRNA can be isolated and
transcribed to cDNA. With specific primers, the cognate VH- and
VL-region encoding nucleic acids can be amplified. With the method
as reported herein almost no identical sequences will be obtained.
Thus, the method provides for highly diverse antibodies binding to
the same antigen.
[0086] In one embodiment the methods as reported herein are for
producing an antibody comprising cognate antibody variable domains.
In one embodiment the cognate antibody variable domains are from a
single B-cell.
[0087] Primer can be provided for the amplification of the
VH-encoding nucleic acid obtained from B-cells of the NMRI-mouse,
the Armenian Hamster, the Balb/c-mouse, the Syrian hamster, the
rabbit, the rat, the sheep, the llama, and the human.
[0088] One aspect as reported herein is a method for producing an
antibody comprising the following steps: [0089] a) depositing
single (mature) B-cells (obtained from the blood or a lymphoid
organ of an experimental animal or a human) from a stained
population of B-cells (in one embodiment the B-cells are stained
with one to three, or two to three fluorescence dyes) in individual
containers (in one embodiment is the container a well of a multi
well plate), [0090] b) cultivating the deposited individual B-cells
in the presence of feeder cells and a feeder mix (in one embodiment
the feeder cells are EL-4 B5 cells, in one embodiment the feeder
mix is natural TSN (supernatant of a cultivation of thymocytes of
an experimental animal of the same species from which the B-cells
are derived), in one embodiment the feeder mix is a synthetic
feeder mix), [0091] c) determining the amino acid sequence of the
variable light and heavy chain domains of specifically binding
antibodies by a reverse transcription PCR (RT-PCR) and nucleotide
sequencing, and thereby obtaining a monoclonal antibody variable
light and heavy chain domain encoding nucleic acid, [0092] d)
cultivating a cell comprising a nucleic acid encoding the variable
light and heavy chain in individual HC and LC expression cassettes
and recovering the antibody from the cell or the cell culture
supernatant and thereby producing an antibody.
[0093] In one embodiment the method comprises the following steps:
[0094] a) providing a population of (mature) B-cells (obtained from
the blood or a lymphoid organ of an experimental animal or a
human), [0095] b) staining the cells of the population of B-cells
with at least one fluorescence dye (in one embodiment with one to
three, or two to three fluorescence dyes), [0096] c) depositing
single cells of the stained population of B-cells in individual
containers (in one embodiment is the container a well of a multi
well plate), [0097] d) cultivating the deposited individual B-cells
in the presence of feeder cells and a feeder mix (in one embodiment
the feeder cells are EL-4 B5 cells, in one embodiment the feeder
mix is natural TSN (supernatant of a cultivation of thymocytes of
an experimental animal of the same species from which the B-cells
are derived), in one embodiment the feeder mix is a synthetic
feeder mix), [0098] e) determining the binding specificity of the
antibodies secreted in the cultivation of the individual B-cells,
[0099] f) isolating the total RNA of a B-cell secreting an antibody
with the desired binding specificity, [0100] g) performing with the
polyA.sup.+ extracted mRNA an RT-PCR with primer specific for the
light and heavy chain variable domains, [0101] h) determining the
amino acid sequence of the variable light and heavy chain domains
of specifically binding antibodies, [0102] i) introducing the
monoclonal antibody light and heavy chain variable domain encoding
nucleic acids in respective expression cassettes for the expression
of an antibody, [0103] j) introducing the nucleic acid into a cell,
[0104] k) cultivating the cell and recovering the antibody from the
cell or the cell culture supernatant and thereby producing an
antibody.
Specific Embodiments
[0105] In the method as reported herein the isolation of nucleic
acid segments encoding antibody variable domains (light and heavy
chain) and the insertion of the isolated nucleic acid segments in
eukaryotic expression plasmids (one expression cassette each for
the light and heavy chain, respectively) is performed without the
intermediate isolation and analysis of clonal intermediate
plasmids. Thus, in the method as reported herein the intermediate
cloning, isolation and analysis of intermediate cassettes/plasmids
is not required, e.g. by analysis of isolated transformed E. coli
cells. In one embodiment the methods as reported herein are
performed without the intermediate isolation and analysis of clonal
intermediate plasmids.
[0106] It has been found that in the methods as reported herein the
respective nucleic acid fragments encoding the heavy and light
chain variable domain of an antibody as obtained after a specific
polymerase chain reaction can be inserted into eukaryotic
expression constructs, one for each chain, respectively, and
expanded without the requirement of intermediate plating in order
to pick and analyze plasmid DNA obtained from single colonies of
transformed bacteria.
[0107] Typically, a restriction endonuclease cleavage site is
engineered into both sense and antisense primer, respectively,
allowing the insertion of the PCR fragments into an appropriately
designed expression vector. However, the relatively high
promiscuity of the ligation process results in a comparatively high
number of individual plasmid clones containing no inserted nucleic
acid fragment ("empty vector"), containing a nucleic acid fragment
inserted in the wrong direction, or containing only an incomplete
fragment of the nucleic acid to be cloned. This problem usually is
solved by plating the ligation reaction on solid media in such a
way that individual bacterial colonies can be isolated. Several of
these bacterial colonies (clones) are then picked and grown in
liquid culture, and the respective plasmids contained in these
clones are analyzed for orientation and completeness of the
inserted nucleic acid fragments. One of the correctly assembled
plasmids is then selected and further amplified for e.g. the
recombinant expression of the encoded polypeptides. While being a
multi time-tested method for the cloning of a small, limited number
of DNA fragments, this method is cumbersome, laborious and
time-consuming when the cloning of a large number of nucleic acid
fragments is required because of the necessity to pick, amplify and
analyze the plasmid DNA derived from single colonies as specified
above.
[0108] Thus, it has been found that the entire workflow from the
initial generation and cloning of the DNA fragments into expression
vectors until the recombinant expression of the polypeptides
encoded by the respective plasmid vectors can be performed in one
coherent workflow without the need for intermediate isolation and
analysis of single colonies. It has been found that it is
advantageous to employ ligation-independent cloning as a means to
improve the above-outlined workflow. Thus, in one embodiment the
inserting in the eukaryotic expression plasmid is by
ligation-independent cloning.
[0109] Ligation-independent cloning as such is not necessarily more
efficient than conventional cloning via restriction and ligation in
the sense that the number of individual colonies obtained is
significantly higher. But since this method is based on
sequence-specific annealing of complementary single-stranded DNA
overhangs rather than enzymatic ligation for the assembly of
complex molecules, this method comprises significantly longer
complementary single-stranded ends of the individual nucleic acid
fragments to be cloned. Thus, typically single-stranded nucleotide
overhangs encompassing 15-30 nucleotides are used in
ligation-independent cloning versus 2-4 nucleotides generated by
restriction endonucleases. In addition, since no ligase enzyme is
present in ligation-independent cloning, the re-ligation of empty
vector cannot occur. Consequently, the proportion of correctly
inserted nucleic acid fragments into a vector with regard to size,
orientation and integrity is increased while simultaneously the
proportion of "empty", re-ligated vector containing no inserted
nucleic acid fragment at all and the frequency of plasmids
containing defective DNA fragments are decreased in
ligation-independent cloning. Indeed, the analysis of cloning
products obtained by ligation-independent cloning showed that over
90% of all plasmid molecules contained a full length inserted
nucleic acid in the correct orientation.
[0110] It has been found, since the vast majority of all plasmid
molecules thus generated contains correctly inserted nucleic acid
fragments, the entire pool of transformed bacteria can be grown and
expanded in liquid culture without the need for the intermediate
steps of plating the transformed bacteria on solid media, isolation
of single colonies, and analysis and isolation of individual
plasmid DNA clones. With the method as reported herein a reduction
in time and labor required can be achieved. With this improved
method an automatization of the process can be performed.
[0111] The difference between the classical approach and the method
as reported herein is outlined in the following Table 1. It can be
seen that the number of steps required can be reduced by more than
40%.
TABLE-US-00001 TABLE 1 classical approach ligation-independent
approach generate and purify PCR generate and purify PCR fragment
fragment prepare vector for ligation prepare vector for annealing
restriction enzyme treatment T4-DNA polymerase treatment purify DNA
insert -- ligation of fragment with annealing of fragment with
prepared vector prepared vector transformation into competent
transformation into competent bacteria bacteria plate and grow on
solid media grow in bulk in liquid culture pick individual colonies
(clones) -- grow clones in liquid culture -- isolate plasmid DNA
from colonies -- analyze plasmid DNA from colonies -- grow correct
clone in liquid culture -- isolate plasmid DNA isolate plasmid DNA
transfect eukaryotic cells with expression transfect eukaryotic
cells with plasmid expression plasmid -- denotes: not needed to be
performed.
[0112] The method as reported herein can be performed with B-cells
obtained at any point in time after the immunization of an
experimental animal.
[0113] The method as reported herein can be performed early after
immunization so that first antibody-encoding nucleic acids can be
isolated as early as three weeks after the first immunization of an
experimental animal.
[0114] The method as reported herein is especially suited for the
isolation of variable domain-encoding nucleic acid fragments from
rabbit B-cells since hybridomas derived from rabbit B-cells result
in poorly producing clones. In addition the isolation of variable
domain-encoding nucleic acid fragments from rabbit-derived
hybridomas is interfered by the endogenous light chain transcript
of the commonly used myeloma fusion partner.
[0115] The method as reported herein is faster compared to the
classical approach.
[0116] In one embodiment the B-cell is a human B-cell, or a mouse
B-cell, or a rat B-cell, or a rabbit B-cell, or a hamster B-cell,
or a B-cell derived from a transgenic animal. In one embodiment the
B-cell is a rabbit B-cell, or a human B-cell, or a B-cell derived
from a transgenic animal.
[0117] A transgenic animal is an animal in which the endogenous Ig
locus has been inactivated or removed and which comprises an active
or functional human Ig locus.
[0118] In one embodiment the B-cell is a B-cell of an immunized
experimental animal.
[0119] In one embodiment the B-cell is a B-cell of an immunized
human individual, or a human individual that has survived a
disease, or a human that is suffering from a chronic disease.
[0120] In one embodiment the B-cell is a single deposited antibody
secreting B-cell.
[0121] In one embodiment the B-cell is cultivated for 6 to 8
generations.
[0122] In one embodiment the B-cell is cultivated until about 10 to
about 100 cells are obtained.
[0123] In one embodiment the B-cell produces about 10 ng/ml
antibody after 7 days of cultivation. In one embodiment the B-cell
produces about 20 ng/ml antibody after 7 days of cultivation.
[0124] It has been found, that if a B-cell producing less than 10
ng/ml antibody is used the method as reported herein can also be
performed but with lesser amplification efficiency.
[0125] In one embodiment the nucleic acid fragments encoding the
variable domains are isolated and/or amplified by RT-PCR.
[0126] In one embodiment the nucleic acid fragment encoding the
variable light chain domain and the nucleic acid fragment encoding
the variable heavy chain domain are cognate nucleic acids. In one
embodiment the nucleic acid fragments encoding the heavy and light
chain variable domains are isolated from the same cell and/or their
progeny.
[0127] In one embodiment the B-cell is a rabbit B-cell and the
nucleic acid encoding the variable heavy chain domain is isolated
with the primer of SEQ ID NO: 5
(AAGCTTGCCACCATGGAGACTGGGCTGCGCTGGCTTC) and SEQ ID NO: 6
(CCATTGGTGAGGGTGCCCGAG).
[0128] In one embodiment the B-cell is a rabbit B-cell and the
nucleic acid encoding the variable light chain domain is isolated
with the primer of SEQ ID NO: 7
(AAGCTTGCCACCATGGACAYGAGGGCCCCCACTC) and SEQ ID NO: 8
(CAGAGTRCTGCTGAGGTTGTAGGTAC).
[0129] In analogy, primer for amplification of e.g. rat, mouse or
human immunoglobulin V-domain gene segments can be designed. In one
embodiment the primer are directed to sequences in the first
framework region. See e.g. van Dongen, J. J. M., et al. Leukemia 17
(2003) 2257; Widhopf, G. F., et al. Blood 111 (2008) 3137; Fais,
F., et al. J. Clin. Invest. 102 (1998) 1515 for human B-cells; see
e.g. Wang, Z., et al. J. Immunol. Methods. 233 (2000) 167; Jones,
T. and Bendig, M., Bio/Technology 90 (1991) 88 for murine
B-cells.
[0130] In one embodiment the amplified nucleic acid is used without
purification after removal of the PCR primer.
[0131] In one embodiment the amplified nucleic acid is used without
purification after removal of all PCR primer.
[0132] In one embodiment the nucleic acid fragments encoding the
variable domains are inserted by sequence and ligation independent
cloning (SLIC) into the eukaryotic expression plasmid.
[0133] In one embodiment the insertion does not require restriction
enzyme cleavage sites.
[0134] In one embodiment the insertion does not require a
phosphatase treatment of the nucleic acid fragment.
[0135] In one embodiment the integration does not require an
enzymatic ligation.
[0136] In one embodiment the T4 DNA polymerase is employed in the
absence of nucleotides for generating single strand extensions.
[0137] In one embodiment about 200 ng nucleic acid (=PCR product)
is used in the insertion step. In one embodiment about 100 ng
nucleic acid is used. In one embodiment about 50 ng nucleic acid is
used.
[0138] In one embodiment the ratio of plasmid to nucleic acid is
about 1:2 (w/w). In one embodiment about 100 ng plasmid and about
200 ng nucleic acid are used in the insertion step.
[0139] In one embodiment the method is a high throughput
method.
[0140] In one embodiment the method is performed in parallel for at
least ten B-cell clones.
[0141] In one embodiment the efficiency of the method starting from
the amplification product to the recombinantly expressed antibody
is more than 50%.
[0142] It has been found that it is especially suited to employ in
the method as reported herein a pool of nucleic acids obtained from
a pool of E. coli cells containing the assembled and/or amplified
antibody expression plasmids for the antibody light and heavy
chain, respectively. Therewith potential errors during the nucleic
acid amplification of single clones can be leveled, or masked, or
reduced to background level.
[0143] In one embodiment the nucleic acid is a pool of nucleic
acids obtained from a pool of E. coli cells containing the
assembled and/or amplified antibody expression plasmids for the
antibody light and heavy chain, respectively.
[0144] It has been found that the PCR primers have to be removed or
likewise the PCR product has to be purified prior to the sequencing
step. This separation/purification increases the sequencing
efficiency.
[0145] It has been found that it is advantageous to amplify the
backbone of the plasmid excluding the nucleic acids encoding the
variable domains.
[0146] In one embodiment the plasmid from which the vector (or
plasmid) backbone is amplified is linearized prior to the
amplification. In one embodiment the plasmid is linearized by the
use of two or more different restriction enzymes prior to the
amplification.
[0147] In one embodiment the amplification product is digested with
a methylation dependent restriction enzyme, e.g. DpnI.
[0148] This allows for more flexibility and efficiency in the
subsequent method steps.
[0149] In one embodiment the method comprises the following steps:
[0150] total RNA extraction from antibody-producing B-cells of an
immunized experimental animal, [0151] single stranded cDNA
synthesis/reverse transcription of the extracted polyA.sup.+ mRNA,
[0152] PCR with species specific primer, [0153] removal of the PCR
primer/purification of the PCR product, [0154] optionally
sequencing of the PCR product, [0155] T4 polymerase incubation of
the PCR product, [0156] linearization and amplification of
plasmid-DNA, [0157] T4 polymerase incubation of the amplified
plasmid-DNA, [0158] sequence and ligation independent cloning of
the variable domain encoding nucleic acid into the amplified
plasmid, [0159] preparation of plasmid from pool of plasmid
transformed E. coli cells, [0160] transfection of eukaryotic cells
with plasmid prepared in the previous step, [0161] expression of
antibody.
[0162] In one embodiment the light chain encoding plasmid backbone
DNA is amplified with the primer of
TABLE-US-00002 SEQ ID NO: 9 (GTACCTACAACCTCAGCAGCACTCTG) and SEQ ID
NO: 10 (CCCTCRTGTCCATGGTGGCAAGCTTCCTCTGTGTTCAGTGCT G).
[0163] In one embodiment the heavy chain encoding plasmid backbone
DNA is amplified with the primer of SEQ ID NO: 11
(TGGGAACTCGGGCACCCTCACCAATGG) and SEQ ID NO: 12
(GCCCAGTCTCCATGGTGGCAAGCTTCCTCTGTGTTCAGT GCTG).
[0164] The following examples and sequence listing are provided to
aid the understanding of the present invention, the true scope of
which is set forth in the appended claims. It is understood that
modifications can be made in the procedures set forth without
departing from the spirit of the invention.
Sequences:
[0165] SEQ ID NO: 1 linker peptide 1 SEQ ID NO: 2 linker peptide 2
SEQ ID NO: 3 linker peptide 3 SEQ ID NO: 4 linker peptide 4 SEQ ID
NO: 5 heavy chain variable domain isolation primer 1
(rb-VH3-23-Slic-s001 primer) SEQ ID NO: 6 heavy chain variable
domain isolation primer 2 (rb-CH1rev-2 primer) SEQ ID NO: 7 light
chain variable domain isolation primer 1 (rb-V-kappa-Slic-s001
primer) SEQ ID NO: 8 light chain variable domain isolation primer 2
(rbCk1-rev2 primer) SEQ ID NO: 9 light chain plasmid amplification
primer 1 (8011-Slic-s001 primer) SEQ ID NO: 10 light chain plasmid
amplification primer 2 (8000-Slic-as002 primer) SEQ ID NO: 11 heavy
chain plasmid amplification primer 1 (8001-Slic-s001 primer) SEQ ID
NO: 12 heavy chain plasmid amplification primer 2 (8001-Slic-as002
primer) SEQ ID NO: 13 rb-V-kappa-HindIIIs primer SEQ ID NO: 14
rb-C-kappa-NheIas primer SEQ ID NO: 15 rb-CH1rev-1 primer SEQ ID
NO: 16 rbVH3-23for3 primer SEQ ID NO: 17 bcPCR-huCgamma-rev primer
SEQ ID NO: 18 bcPCR-FHLC-leader-fw primer SEQ ID NO: 19
bcPCR-huCkappa-rev primer SEQ ID NO: 20 bcPCR-hu-HC-10600-SLIC-as
primer SEQ ID NO: 21 bcPCR-hu-HC-10600-SLIC-s primer SEQ ID NO: 22
bcPCR-hu-LC-10603-SLIC-s primer SEQ ID NO: 23
bcPCR-hu-LC-10603-SLIC-as primer SEQ ID NO: 24
SLIC-hu-VHuniversal-for primer SEQ ID NO: 25 SLIC-hu-VH6-for primer
SEQ ID NO: 26 hu-CH1gamma-rev primer SEQ ID NO: 27 SLIC-huVk2-for
primer SEQ ID NO: 28 SLIC-huVk3-for primer SEQ ID NO: 29
SLIC-huVk5-for primer SEQ ID NO: 30 SLIC-huVk7-for primer SEQ ID
NO: 31 SLIC-huVk8-for primer SEQ ID NO: 32 SLIC-huVk1long-for
primer SEQ ID NO: 33 SLIC-huVk2longw-for primer SEQ ID NO: 34
huCk-rev primer SEQ ID NO: 35 SLIC-huVl1-for primer SEQ ID NO: 36
SLIC-huVl2-for primer SEQ ID NO: 37 SLIC-huVl3-for primer SEQ ID
NO: 38 SLIC-huVl4-for primer SEQ ID NO: 39 SLIC-huVl5-for primer
SEQ ID NO: 40 SLIC-huVl6-for primer SEQ ID NO: 41 SLIC-huVl7-for
primer SEQ ID NO: 42 SLIC-huVl8-for primer SEQ ID NO: 43
SLIC-huVl9-for primer SEQ ID NO: 44 SLIC-huVlambda10-for primer SEQ
ID NO: 45 huC1-1-rev primer SEQ ID NO: 46 huIg-PCR-vectorprimer-as
SEQ ID NO: 47 huIg-PCR-vectorprimer-VH-s SEQ ID NO: 48
huIg-PCR-vectorprimer-as kappa SEQ ID NO: 49
huIg-PCR-vectorprimer-VK-s SEQ ID NO: 50 huIg-PCR-vectorprimer-as
lambda SEQ ID NO: 51 huIg-PCR-vectorprimer-VL-s
EXAMPLES
Example 1: Cloning and Expression of Cognate Antibody Variable
Region Gene Segments
a) RNA Extraction
[0166] Cells were lysed by adding of 100 .mu.l RLT buffer
containing 10 .mu.l/ml 2-mercaptoethanol and mixing by repeated
pipetting. The lysate was either used directly for RNA isolation or
stored frozen at -20.degree. C. until RNA preparation. RNA was
prepared using the Total RNA Isolation Kit NucleoSpin (Machery
& Nagel) according to the manufacturer's instructions
b) First Strand cDNA Synthesis
[0167] cDNA was generated by reverse transcription of mRNA using
the Super Script III first-strand synthesis SuperMix (Invitrogen)
according to the manufacturer's instructions. In a first step 6
.mu.l of the isolated mRNA was mixed with 1 .mu.l annealing buffer
and 1 .mu.l (50 .mu.M) oligo dT, incubated for 5 minutes at
65.degree. C. and thereafter immediately placed on ice for about 1
minute. Subsequently while still on ice 10 .mu.l 2.times.
First-Strand Reaction Mix and SuperScript.TM. III/RNaseOUT.TM.
Enzyme Mix were added. After mixing the reaction was incubated for
50 minutes at 50.degree. C. The reaction was terminated by
incubation at 85.degree. C. for 5 minutes. After termination the
reaction mix was placed on ice.
c) Polymerase Chain Reaction (PCR)
[0168] The polymerase chain reaction was carried out using
AccuPrime Pfx SuperMix (Invitrogen) according to the manufacturer's
instructions. Light chain and heavy chain variable regions were
amplified in separate reactions. PCR-primer (0.2 .mu.M/reaction)
with 25 bp overlaps to target antibody expression vectors were
used. After the PCR 8 .mu.l of the PCR reaction mixture were used
for analysis on 48-well eGels (Invitrogen).
d) Purification of PCR Products
[0169] Residual PCR primer were removed using the NucleoSpin.RTM.
96 Extract II kit (Machery & Nagel) according to the
manufacturer's instructions.
e) Sequence Determination
[0170] The DNA sequences encoding the variable domains of the
antibody heavy and light chains were obtained by sequencing the PCR
products.
f) Preparation of Plasmid-DNA
[0171] The plasmid DNA to be used as recipient for the cloning of
the PCR products encoding the antibody heavy and light chain
variable domains was first linearized by restriction enzyme
digestion. Subsequently, the linearized plasmid DNA was purified by
preparative agarose electrophoresis and extracted from the gel
(QIAquick Gel Extraction Kit/Qiagen). This purified plasmid DNA was
added to a PCR-protocol as template using primer overlapping (by
20-25 bp) with the PCR-products to be cloned. The PCR was carried
out using AccuPrime Pfx SuperMix (Invitrogen).
g) Cloning
[0172] The PCR-products were cloned into expression vectors using a
"site and ligation independent cloning" method (SLIC) which was
described by Haun, R. S., et al. (BioTechniques 13 (1992) 515-518)
and Li, M. Z., et al. (Nature Methods 4 (2007) 251-256). Both
purified vector and insert were treated with 0.5 U T4 DNA
polymerase (Roche Applied Sciences, Mannheim, Germany) per 1 .mu.g
DNA for 45 minutes at 25.degree. C. in the absence of dNTPs to
generate matching overhangs. The reaction was stopped by adding
1/10.sup.th of the reaction volume of a 10 mM dCTP Solution
(Invitrogen). The T4 treated vector and insert DNA fragments were
combined with a plasmid:insert ratio of 1:2 (w/w) (e.g. 100 ng:200
ng) and recombined by adding RecAProtein (New England Biolabs) and
10.times.RecA Buffer for 30 minutes at 37.degree. C. Subsequently,
5 .mu.l of each of the generated heavy chain and light chain
expression plasmid was used to transform MultiShot Strip Well TOP
10 Chemically Competent E. coli cells (Invitrogen) using a standard
chemical transformation protocol. After regeneration (shaking for
45 minutes at 37.degree. C. of the transformed E. coli cells) the
entire transformation mixture was transferred into DWP 96 (deep
well plates) containing 2 ml of LB medium supplemented with
ampicillin per well. The cells were incubated in a shaker for 20
hours at 37.degree. C. In the following step the plasmid DNA
encoding the immunoglobulin heavy- and light chains was purified
using the NucleoSpin 96 Plasmid Mini Kit (Macherey&Nagel),
digested with selected restriction enzymes, and analyzed on 48-well
eGels (Invitrogen). In parallel, glycerol stocks were prepared for
storage.
h) Transfection and Expression of Recombinant Antibodies in
Eukaryotic Cells
[0173] HEK293 cells were grown with shaking at 120 rpm in
F17-medium (Gibco) at 37.degree. C. in an atmosphere containing 8%
CO.sub.2. Cells were split the day before transfection and seeded
at a density of 0.7-0.8.times.10.sup.6 cells/ml. On the day of
transfection, 1-1.5.times.10.sup.6 HEK293 cells in a volume of 2 ml
were transfected with 0.5 .mu.g HC plasmid plus 0.5 .mu.g LC
plasmid, suspended in 1 .mu.l 293-free medium (Novagen) and 80
.mu.l OptiMEM.RTM. medium (Gibco) in 48 well deep well plates.
Cultures were incubated for 7 days at 180 rpm at 37.degree. C. and
8% CO.sub.2. After 7 days the culture supernatants were harvested,
filtered and analyzed for antibody content and specificity.
Example 2: B-Cell Productivity Vs. Amplification Efficiency
[0174] It has been found that B-cells to be used in the method as
reported herein have to be selected based on the expression yield
(antibody titer) obtained by the cultivation of the single
deposited B-cell in the presence of feeder cells, e.g. EL4-B5 cells
and Zubler mix. The obtained expression yield has to be above a
specific threshold value as can be seen from the following Table
2.
TABLE-US-00003 TABLE 2 rabbit IgG % HC % LC [ng/ml] sequences
sequences Experiment 1 <20 ng/ml 0% (0/14) 0% (0/14) Experiment
2 >20 ng/ml 85% (52/61) 85% (52/61)
[0175] Successful sequence generation depending on rabbit IgG
concentration in single cell cultivation supernatant.
Example 3: Primer
Primer for B-Cell PCR of B-Cells Expressing Rabbit Antibodies
[0176] Primer Set 1:
[0177] LC-Primer
TABLE-US-00004 -rb-V-kappa-HindIIIs (SEQ ID NO: 13):
GATTAAGCTTATGGACAYGAGGGCCCCCACTC -rb-C-kappa-NheIas (SEQ ID NO:
14): GATCGCTAGCCCTGGCAGGCGTCTCRCTCTAACAG
[0178] HC-Primer
TABLE-US-00005 -rb-CH1rev-1 (SEQ ID NO: 15):
GCAGGGGGCCAGTGGGAAGACTG -rbVH3-23for3 (SEQ ID NO: 16):
CACCATGGAGACTGGGCTGCGCTGGCTTC
[0179] Primer Set 2:
[0180] LC-Primer
TABLE-US-00006 -rb-V-kappa-Slic-s001 (SEQ ID NO: 18):
AAGCTTGCCACCATGGACAYGAGGGCCCCCACTC -rbCk1-rev2 (SEQ ID NO: 19):
CAGAGTRCTGCTGAGGTTGTAGGTAC
[0181] HC-Primer
TABLE-US-00007 -rb-VH3-23-Slic-s001 (SEQ ID NO: 20):
AAGCTTGCCACCATGGAGACTGGGCTGCGCTGGCTTC -rb-CH1rev-2 (SEQ ID NO: 21):
CCATTGGTGAGGGTGCCCGAG
[0182] Primer for Amplification of Heavy Chain Expression Plasmid
Backbone:
TABLE-US-00008 -8001-Slic-s001 (SEQ ID NO: 22):
TGGGAACTCGGGCACCCTCACCAATGG -8001-Slic-as002 (SEQ ID NO: 23):
GCCCAGTCTCCATGGTGGCAAGCTTCCTCTGTGTTCAGTGCTG
[0183] Primer for Amplification of Kappa Light Chain Expression
Plasmid Backbone:
TABLE-US-00009 -8011-Slic-s001(SEQ ID NO: 24):
GTACCTACAACCTCAGCAGCACTCTG -8000-Slic-as002(SEQ ID NO: 25):
CCCTCRTGTCCATGGTGGCAAGCTTCCTCTGTGTTCAGTGCTG
Primer for B-Cell PCR of Rabbit B-Cells Expressing Human Antibodies
(Derived from Transgenic Rabbit)
[0184] Primer for Amplification of Heavy Chain Variable Domains
[0185] HC-Up
TABLE-US-00010 -rb-VH3-23-Slic-s001(SEQ ID NO: 20):
AAGCTTGCCACCATGGAGACTGGGCTGCGCTGGCTTC -bcPCR-huCgamma-rev (SEQ ID
NO: 17): CCCCCAGAGGTGCTCTTGGA
[0186] Primer for Amplification of Light Chain Variable Domains
TABLE-US-00011 -bcPCR-FHLC-leader-fw (SEQ ID NO: 18):
ATGGACATGAGGGTCCCCGC -bcPCR-huCkappa-rev (SEQ ID NO: 19):
GATTTCAACTGCTCATCAGATGGC
Primer for the Amplification of Heavy Chain Plasmid Backbone:
TABLE-US-00012 [0187] -bcPCR-hu-HC-10600-SLIC-as (SEQ ID NO: 20):
CAGCCCAGTCTCCATGGTGGCAAGCTTCCTCTGTGTTCAGTGCTG
-bcPCR-hu-HC-10600-SLIC-s (SEQ ID NO: 21):
CTCCAAGAGCACCTCTGGGGGCACAG
Primer for the Amplification of Kappa Light Chain Plasmid
Backbone:
TABLE-US-00013 [0188] -bcPCR-hu-LC-10603-SLIC-s (SEQ ID NO: 22):
GCCATCTGATGAGCAGTTGAAATC -bcPCR-hu-LC-10603-SLIC-as (SEQ ID NO:
23): GCGGGGACCCTCATGTCCATGGTGGCAAGCTTCCTCTG
Primer for B-Cell PCR of B-Cells from Human Donors
[0189] Primer for Amplification of Heavy Chain Variable Domains
TABLE-US-00014 -SLIC-hu-VHuniversal-for (SEQ ID NO: 24):
AGCAACAGCTACAGGTGTGCATTCCGAGGTGCAGCTGKTGSAGTCTGS -SLIC-hu-VH6-for
(SEQ ID NO: 25): AGCAACAGCTACAGGTGTGCATTCCCAGGTRCAGCTGCAGSAGTC
-hu-CH1gamma-rev (SEQ ID NO: 26): GTCCACCTTGGTGTTGCTGGGCTT
[0190] Primer for Amplification of Kappa Light Chain Variable
Domains
TABLE-US-00015 -SLIC-huVk2-for (SEQ ID NO: 27):
TAGCAACAGCTACAGGTGTGCATTCCGATGTTGTGATGACTCAGTCT -SLIC-huVk3-for
(SEQ ID NO: 28): TAGCAACAGCTACAGGTGTGCATTCCGAAATTGTGWTGACRCAGTCT
-SLIC-huVk5-for (SEQ ID NO: 29):
TAGCAACAGCTACAGGTGTGCATTCCGACATCGTGATGACCCAG -SLIC-huVk7-for (SEQ
ID NO: 30): TAGCAACAGCTACAGGTGTGCATTCCGAAATTGTGCTGACTCAGTCT
-SLIC-huVk8-for (SEQ ID NO: 31):
TAGCAACAGCTACAGGTGTGCATTCCGAWRTTGTGMTGACKCAGTCTCC
-SLIC-huVk1long-for (SEQ ID NO: 32):
TAGCAACAGCTACAGGTGTGCATTCCGACATCCRGWTGACCCAGTCT
-SLIC-huVk2longw-for (SEQ ID NO: 33):
TAGCAACAGCTACAGGTGTGCATTCCGATRTTGTGATGACYCAGWCT -huCk-rev (SEQ ID
NO: 34): ACACTCTCCCCTGTTGAAGCTC
[0191] Primer for Amplification of Lambda Light Chain Variable
Domains
TABLE-US-00016 -SLIC-huV11-for (SEQ ID NO: 35):
TAGCAACAGCTACAGGTGTGCATTCCCAGTCTGTGYTGACKCAG -SLIC-huV12-for (SEQ
ID NO: 36): TAGCAACAGCTACAGGTGTGCATTCCCAGTCTGCCCTGACTCAG
-SLIC-huV13-for (SEQ ID NO: 37):
TAGCAACAGCTACAGGTGTGCATTCCTCCTATGAGCTGAYWCAG -SLIC-huV14-for (SEQ
ID NO: 38): TAGCAACAGCTACAGGTGTGCATTCCCAGCYTGTGCTGACTCAA
-SLIC-huV15-for (SEQ ID NO: 39):
TAGCAACAGCTACAGGTGTGCATTCCCAGSCTGTGCTGACTCAG -SLIC-huV16-for (SEQ
ID NO: 40): TAGCAACAGCTACAGGTGTGCATTCCAATTTTATGCTGACTCAG
-SLIC-huV17-for (SEQ ID NO: 41):
TAGCAACAGCTACAGGTGTGCATTCCCAGRCTGTGGTGACTCAG -SLIC-huV18-for (SEQ
ID NO: 42): TAGCAACAGCTACAGGTGTGCATTCCCAGACTGTGGTGACCCAG
-SLIC-huV19-for (SEQ ID NO: 43):
TAGCAACAGCTACAGGTGTGCATTCCCWGCCTGTGCTGACTCAG -SLIC-huVlambda10-for
(SEQ ID NO: 44): TAGCAACAGCTACAGGTGTGCATTCCCAGGCAGGGCTGACTCAG
-huC1-1-rev (SEQ ID NO: 45): TCTCCACGGTGCTCCCTTC
Primer for Amplification of Human Immunoglobulin Expression
Plasmid
[0192] Amplification of Heavy Chain Expression Plasmid
Backbone:
TABLE-US-00017 -huIg-PCR-vectorprimer-as (SEQ ID NO: 46):
GGAATGCACACCTGTAGCTGTTGCTA -huIg-PCR-vectorprimer-VH-s (SEQ ID NO:
47): AAGCCCAGCAACACCAAGGTGGAC
[0193] Amplification of Kappa Light Chain Expression Plasmid
Backbone:
TABLE-US-00018 -huIg-PCR-vectorprimer-as kappa (SEQ ID NO: 48):
GGAATGCACACCTGTAGCTGTTGCTA -huIg-PCR-vectorprimer-VK-s (SEQ ID NO:
49): GAGCTTCAACAGGGGAGAGTGT
[0194] Amplification of Lambda Light Chain Expression Plasmid
Backbone:
TABLE-US-00019 -huIg-PCR-vectorprimer-as lambda (SEQ ID NO: 50):
GGAATGCACACCTGTAGCTGTTGCTA -huIg-PCR-vectorprimer-VL-s (SEQ ID NO:
51): GAAGGGAGCACCGTGGAGA
Example 4: Pool Compared to Single Clones
[0195] Antibody variable region gene segments were amplified and
cloned into the respective expression vectors as described in
Example 1. To determine the fidelity of sequences derived from
pool-cloning versus conventional clone-picking from single
colonies, the transformation mix was split in two halves; one half
was plated conventionally to generate single colonies while the
other half was grown directly as pool-culture. Subsequently,
plasmid was prepared both the pool-transformed E. coli cells as
well as from single colonies picked from the conventional plates
and the sequences of the cloned variable region gene segments was
determined. As shown in the following Table 3, between 80% and 100%
of colony-derived plasmids contained a correct variable region gene
segment which was identical to the sequence obtained from the
pool-transformation.
TABLE-US-00020 TABLE 3 Number of most abundant Number of most
abundant B-cell LC sequence/total HC sequence/total Clone No.
number of sequences number of sequences 5 10/11 8/12 6 11/12 12/12
10 2/2 8/12 35 6/6 7/12 38 11/12 12/12 39 9/11 10/12 42 3/5 11/12
50 6/6 6/7
[0196] The VH and VL encoding nucleic acid sequence obtained from
the sequencing of the pool cultivated cells were identical to the
most abundant sequence obtained from the sequencing of individual
clones.
Sequence CWU 1
1
5112PRTArtificial Sequencelinker peptide 1 1Gly Ser 1
23PRTArtificial Sequencelinker peptide 2 2Gly Gly Ser 1
34PRTArtificial Sequencelinker peptide 3 3Gly Gly Gly Ser 1
45PRTArtificial Sequencelinker pepetide 4 4Gly Gly Gly Gly Ser 1 5
537DNAArtificial SequenceHC isolation primer 5aagcttgcca ccatggagac
tgggctgcgc tggcttc 37621DNAArtificial SequenceHC isolation primer 2
6ccattggtga gggtgcccga g 21734DNAArtificial SequenceLC isolation
primer 1 7aagcttgcca ccatggacay gagggccccc actc 34826DNAArtificial
SequenceLC isolation primer 2 8cagagtrctg ctgaggttgt aggtac
26926DNAArtificial SequenceLC plasmid amplification primer 1
9gtacctacaa cctcagcagc actctg 261043DNAArtificial SequenceLC
plasmid amplification primer 2 10ccctcrtgtc catggtggca agcttcctct
gtgttcagtg ctg 431127DNAArtificial SequenceHC plasmid amplification
primer 1 11tgggaactcg ggcaccctca ccaatgg 271243DNAArtificial
SequenceHC plasmid amplification primer 2 12gcccagtctc catggtggca
agcttcctct gtgttcagtg ctg 431332DNAArtificial
Sequencerb-V-kappa-HindIIIs primer 13gattaagctt atggacayga
gggcccccac tc 321435DNAArtificial Sequencerb-C-kappa-NheIas primer
14gatcgctagc cctggcaggc gtctcrctct aacag 351523DNAArtificial
Sequencerb-CH1rev-1 primer 15gcagggggcc agtgggaaga ctg
231629DNAArtificial SequencerbVH3-23for3 primer 16caccatggag
actgggctgc gctggcttc 291720DNAArtificial SequencebcPCR-huCgamma-rev
primer 17cccccagagg tgctcttgga 201820DNAArtificial
SequencebcPCR-FHLC-leader-fw primer 18atggacatga gggtccccgc
201924DNAArtificial SequencebcPCR-huCkappa-rev primer 19gatttcaact
gctcatcaga tggc 242045DNAArtificial
SequencebcPCR-hu-HC-10600-SLIC-as primer 20cagcccagtc tccatggtgg
caagcttcct ctgtgttcag tgctg 452126DNAArtificial
SequencebcPCR-hu-HC-10600-SLIC-s primer 21ctccaagagc acctctgggg
gcacag 262224DNAArtificial SequencebcPCR-hu-LC-10603-SLIC-s primer
22gccatctgat gagcagttga aatc 242338DNAArtificial
SequencebcPCR-hu-LC-10603-SLIC-as primer 23gcggggaccc tcatgtccat
ggtggcaagc ttcctctg 382448DNAArtificial
SequenceSLIC-hu-VHuniversal-for primer 24agcaacagct acaggtgtgc
attccgaggt gcagctgktg sagtctgs 482545DNAArtificial
SequenceSLIC-hu-VH6-for primer 25agcaacagct acaggtgtgc attcccaggt
rcagctgcag sagtc 452624DNAArtificial Sequencehu-CH1gamma-rev primer
26gtccaccttg gtgttgctgg gctt 242747DNAArtificial
SequenceSLIC-huVk2-for primer 27tagcaacagc tacaggtgtg cattccgatg
ttgtgatgac tcagtct 472847DNAArtificial SequenceSLIC-huVk3-for
primer 28tagcaacagc tacaggtgtg cattccgaaa ttgtgwtgac rcagtct
472944DNAArtificial SequenceSLIC-huVk5-for primer 29tagcaacagc
tacaggtgtg cattccgaca tcgtgatgac ccag 443047DNAArtificial
SequenceSLIC-huVk7-for primer 30tagcaacagc tacaggtgtg cattccgaaa
ttgtgctgac tcagtct 473149DNAArtificial SequenceSLIC-huVk8-for
primer 31tagcaacagc tacaggtgtg cattccgawr ttgtgmtgac kcagtctcc
493247DNAArtificial SequenceSLIC-huVk1long-for primer 32tagcaacagc
tacaggtgtg cattccgaca tccrgwtgac ccagtct 473347DNAArtificial
SequenceSLIC-huVk2longw-for primer 33tagcaacagc tacaggtgtg
cattccgatr ttgtgatgac ycagwct 473422DNAArtificial SequencehuCk-rev
primer 34acactctccc ctgttgaagc tc 223544DNAArtificial
SequenceSLIC-huVl1-for primer 35tagcaacagc tacaggtgtg cattcccagt
ctgtgytgac kcag 443644DNAArtificial SequenceSLIC-huVl2-for primer
36tagcaacagc tacaggtgtg cattcccagt ctgccctgac tcag
443744DNAArtificial SequenceSLIC-huVl3-for primer 37tagcaacagc
tacaggtgtg cattcctcct atgagctgay wcag 443844DNAArtificial
SequenceSLIC-huVl4-for primer 38tagcaacagc tacaggtgtg cattcccagc
ytgtgctgac tcaa 443944DNAArtificial SequenceSLIC-huVl5-for primer
39tagcaacagc tacaggtgtg cattcccags ctgtgctgac tcag
444044DNAArtificial SequenceSLIC-huVl6-for primer 40tagcaacagc
tacaggtgtg cattccaatt ttatgctgac tcag 444144DNAArtificial
SequenceSLIC-huVl7-for primer 41tagcaacagc tacaggtgtg cattcccagr
ctgtggtgac tcag 444244DNAArtificial SequenceSLIC-huVl8-for primer
42tagcaacagc tacaggtgtg cattcccaga ctgtggtgac ccag
444344DNAArtificial SequenceSLIC-huVl9-for primer 43tagcaacagc
tacaggtgtg cattcccwgc ctgtgctgac tcag 444444DNAArtificial
SequenceSLIC-huVlambda10-for primer 44tagcaacagc tacaggtgtg
cattcccagg cagggctgac tcag 444519DNAArtificial SequencehuCl-1-rev
primer 45tctccacggt gctcccttc 194626DNAArtificial
SequencehuIg-PCR-vectorprimer-as 46ggaatgcaca cctgtagctg ttgcta
264724DNAArtificial SequencehuIg-PCR-vectorprimer-VH-s 47aagcccagca
acaccaaggt ggac 244826DNAArtificial
SequencehuIg-PCR-vectorprimer-as kappa 48ggaatgcaca cctgtagctg
ttgcta 264922DNAArtificial SequencehuIg-PCR-vectorprimer-VK-s
49gagcttcaac aggggagagt gt 225026DNAArtificial
SequencehuIg-PCR-vectorprimer-as lambda 50ggaatgcaca cctgtagctg
ttgcta 265119DNAArtificial SequencehuIg-PCR-vectorprimer-VL-s
51gaagggagca ccgtggaga 19
* * * * *