U.S. patent application number 14/662061 was filed with the patent office on 2015-07-09 for bicyclic cyclohexose nucleic acid analogs.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC.. The applicant listed for this patent is ISIS PHARMACEUTICALS, INC.. Invention is credited to Mingming Han, Michael T. Migawa, Bruce S. Ross, Punit P. Seth, Quanlai Song, Eric E. Swayze.
Application Number | 20150191727 14/662061 |
Document ID | / |
Family ID | 43544942 |
Filed Date | 2015-07-09 |
United States Patent
Application |
20150191727 |
Kind Code |
A1 |
Migawa; Michael T. ; et
al. |
July 9, 2015 |
BICYCLIC CYCLOHEXOSE NUCLEIC ACID ANALOGS
Abstract
The present invention provides bicyclic cyclohexose nucleoside
analogs and oligomeric compounds comprising these nucleoside
analogs. These bicyclic nucleoside analogs are useful for enhancing
properties of oligomeric compounds including nuclease
resistance.
Inventors: |
Migawa; Michael T.;
(Carlsbad, CA) ; Seth; Punit P.; (Carlsbad,
CA) ; Swayze; Eric E.; (Encinitas, CA) ; Ross;
Bruce S.; (Princeton, NJ) ; Song; Quanlai;
(Carlsbad, CA) ; Han; Mingming; (Nazareth,
PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ISIS PHARMACEUTICALS, INC. |
Carlsbad |
CA |
US |
|
|
Assignee: |
ISIS PHARMACEUTICALS, INC.
Carlsbad
CA
|
Family ID: |
43544942 |
Appl. No.: |
14/662061 |
Filed: |
March 18, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13388115 |
Mar 21, 2012 |
9012421 |
|
|
PCT/US2010/044549 |
Aug 5, 2010 |
|
|
|
14662061 |
|
|
|
|
61231885 |
Aug 6, 2009 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 536/23.1; 536/26.8 |
Current CPC
Class: |
C07H 19/06 20130101;
C07H 19/16 20130101; C07H 21/00 20130101; C12N 15/113 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C07H 19/06 20060101 C07H019/06 |
Claims
1. A bicyclic nucleoside analog of Formula I.sub.e: ##STR00036##
wherein: Bx is a heterocyclic base moiety; Q is a bridge group
comprising one C(R.sub.3).dbd.C(R.sub.4), N(R.sub.5)--O or
N(R.sub.5)--S biradical group and one C(R.sub.3)(R.sub.4) biradical
group or one O, S or N(R.sub.5) biradical group and two
C(R.sub.3)(R.sub.4) biradical groups; each R.sub.3 and R.sub.4 is,
independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy or halogen; R.sub.5 is H, C.sub.1-C.sub.6
alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or
substituted C.sub.1-C.sub.6 alkoxy; L.sub.1 and L.sub.2 are each H
or one of L.sub.1 and L.sub.2 is H and the other of L.sub.1 and
L.sub.2 is CH.sub.3 or OCH.sub.3; one of E.sub.1, E.sub.2, E.sub.3
and E.sub.4 is O-T.sub.2, two of E.sub.1, E.sub.2, E.sub.3 and
E.sub.4 are H and the remaining one of E.sub.1, E.sub.2, E.sub.3
and E.sub.4 is H, halogen, C.sub.1-C.sub.6 alkyl or substituted
C.sub.1-C.sub.6 alkyl; one of T.sub.1 and T.sub.2 is H, a hydroxyl
protecting group or a phosphorus moiety and the other of T.sub.1
and T.sub.2 is H, a hydroxyl protecting group or a reactive
phosphorus group. each substituted group comprises one or more
optionally protected substituent groups independently selected from
halogen, OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5,
N.sub.3, CN, OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6); L is O, S or NJ.sub.7; and each J.sub.5,
J.sub.6 and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12 aminoalkyl.
2. The bicyclic nucleoside analog of claim 1 wherein Bx is an
optionally protected uracil, thymine, cytosine, 5-methylcytosine,
adenine or guanine.
3. The bicyclic nucleoside analog of claim 1 wherein three of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are H.
4. The bicyclic nucleoside analog of claim 1 wherein L.sub.1 and
L.sub.2 are each H.
5. The bicyclic nucleoside analog of claim 1 wherein one of L.sub.1
and L.sub.2 is H and the other of L.sub.1 and L.sub.2 is
CH.sub.3.
6. The bicyclic nucleoside analog of claim 1 wherein T.sub.1 is
4,4'-dimethoxytrityl and T.sub.2 is diisopropylcyanoethoxy
phosphoramidite.
7. The bicyclic nucleoside analog of claim 1 wherein Q comprises
two C(R.sub.3)(R.sub.4) biradical groups.
8. The bicyclic nucleoside analog of claim 7 wherein each R.sub.3
and R.sub.4 is H.
9. The bicyclic nucleoside analog of claim 1 wherein Q comprises
one O biradical group;
10. The bicyclic nucleoside analog of claim 1 wherein said
phosphorus moiety has the formula: ##STR00037## wherein: R.sub.a
and R.sub.c are each, independently, OH, SH, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
substituted C.sub.1-C.sub.6 alkoxy, amino or substituted amino; and
R.sub.b is O or S.
11. The bicyclic nucleoside analog of claim 1 having the
configuration of one of formulas I.sub.f, I.sub.g, I.sub.h and
I.sub.i: ##STR00038##
12. An oligomeric compound consisting of from 8 to 40 monomers
comprising at least one bicyclic nucleoside analog of Formula
II.sub.e: ##STR00039## wherein independently for each bicyclic
nucleoside analog having Formula II.sub.e: Bx is a heterocyclic
base moiety; Q is a bridge group comprising one
C(R.sub.3).dbd.C(R.sub.4), N(R.sub.5)--O or N(R.sub.5)--S biradical
group and one C(R.sub.3)(R.sub.4) biradical group or one O, S or
N(R.sub.5) biradical group and two C(R.sub.3)(R.sub.4) biradical
groups; each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen; R.sub.5 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted
C.sub.1-C.sub.6 alkoxy; L.sub.1 and L.sub.2 are each H or one of
L.sub.1 and L.sub.2 is H and the other of L.sub.1 and L.sub.2 is
CH.sub.3 or OCH.sub.3; one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8
is O-T.sub.4, two of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are H
and the remaining one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 is
H, halogen, C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6
alkyl; one of T.sub.3 and T.sub.4 is an internucleoside linking
group linking the bicyclic nucleoside analog to the remainder of
the oligomeric compound and the other of T.sub.3 and T.sub.4 is H,
a protecting group, a phosphorus moiety, a 5' or 3'-terminal group
or an internucleoside linking group linking the bicyclic nucleoside
analog to the remainder of the oligomeric compound; each
substituted group comprises one or more optionally protected
substituent groups independently selected from halogen, OJ.sub.5,
N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6); L is O, S or NJ.sub.7; and each J.sub.5,
J.sub.6 and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12 aminoalkyl.
13. The oligomeric compound of claim 12 wherein independently for
each bicyclic nucleoside analog of Formula II.sub.e, Bx is uracil,
thymine, cytosine, 5-methylcytosine, adenine or guanine.
14. The oligomeric compound of claim 12 wherein independently for
each bicyclic nucleoside analog of Formula II.sub.e, three of
E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are H.
15. The oligomeric compound of claim 12 wherein independently for
each bicyclic nucleoside analog of Formula II.sub.e, L.sub.1 and
L.sub.2 are each H.
16. The oligomeric compound of claim 12 wherein independently for
each bicyclic nucleoside analog of Formula II.sub.e, one of L.sub.1
and L.sub.2 is H and the other of L.sub.1 and L.sub.2 is
CH.sub.3.
17. The oligomeric compound of claim 12 wherein each Q comprises
two C(R.sub.3)(R.sub.4) biradical groups.
18. The oligomeric compound of claim 17 wherein each R.sub.3 and
R.sub.4 is H.
19. The oligomeric compound of claim 12 wherein each Q comprises
one O biradical group;
20. The oligomeric compound of claim 12 wherein said phosphorus
moiety has the formula: ##STR00040## wherein: R.sub.a and R.sub.c
are each, independently, OH, SH, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted
C.sub.1-C.sub.6 alkoxy, amino or substituted amino; and R.sub.b is
O or S.
21. The oligomeric compound of claim 12 wherein each bicyclic
nucleoside of Formula II.sub.e has the configuration of one of
formulas II.sub.f, II.sub.g, II.sub.h and II.sub.i:
##STR00041##
22. The oligomeric compound of claim 21 comprising a gapped
oligomeric compound having two external regions independently
comprising from 2 to 5 contiguous bicyclic nucleoside analogs
wherein each bicyclic nucleoside analog has Formula II.sub.f,
II.sub.g, II.sub.h or II.sub.i, wherein the two external regions
are separated by an internal region comprising from about 8 to
about 14 monomer subunits independently selected from nucleosides
and modified nucleosides that are different from the bicyclic
nucleoside analogs.
23. The oligomeric compound of claim 22 wherein said internal
region comprises from about 8 to about 14 contiguous
.beta.-D-2'-deoxyribofuranosyl nucleosides.
24. The oligomeric compound of claim 12 wherein each
internucleoside linking group is, independently, a phosphodiester
or a phosphorothioate internucleoside linking group.
25. The oligomeric compound of claim 12 wherein essentially each
internucleoside linking group is a phosphorothioate internucleoside
linking group.
26. A method of inhibiting gene expression comprising contacting
one or more cells, a tissue or an animal with an oligomeric
compound of claim 21.
Description
FIELD OF THE INVENTION
[0001] Provided herein are novel bicyclic nucleoside analogs and
oligomeric compounds and compositions prepared therefrom. More
particularly, bicyclic nucleoside analogs are provided wherein the
naturally occurring pentofuranose ring is replaced with a
cyclohexyl ring that comprises one ring heteroatom and a bridge
making the ring system bicyclic. In certain embodiments, the
oligomeric compounds and compositions of the present invention are
expected to hybridize to a portion of a target RNA resulting in
loss of normal function of the target RNA. The oligomeric compounds
provided herein are also expected to be useful as primers and
probes in diagnostic applications.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CHEM0030USC1SEQ_ST25.txt, created on Mar. 18, 2015
which is 8 Kb in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0003] Antisense technology is an effective means for reducing the
expression of one or more specific gene products and can therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications. Chemically modified nucleosides are
routinely used for incorporation into antisense sequences to
enhance one or more properties such as for example nuclease
resistance. One such group of chemical modifications includes
bicyclic nucleosides wherein the furanose portion of the nucleoside
includes a bridge connecting two atoms on the furanose ring thereby
forming a bicyclic ring system. Such bicyclic nucleosides have
various names including BNA's and LNA's for bicyclic nucleic acids
or locked nucleic acids respectively.
[0004] Various BNA's have been prepared and reported in the patent
literature as well as in scientific literature, see for example:
Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al.,
Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl.
Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222; Wengel et al., PCT International
Application WO 98-DK393 19980914; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039, the text of each is incorporated by
reference herein, in their entirety. Examples of issued US patents
and published applications include for example: U.S. Pat. Nos.
7,053,207, 6,770,748, 6,268,490 and 6,794,499 and published U.S.
applications 20040219565, 20040014959, 20030207841, 20040192918,
20030224377, 20040143114 and 20030082807; the text of each is
incorporated by reference herein, in their entirety.
[0005] Many BNA's are toxic. See, e.g., Swayze, E. E.; Siwkowski,
A. M.; Wancewicz, E. V.; Migawa, M. T.; Wyrzykiewicz, T. K.; Hung,
G.; Monia, B. P.; Bennett, C. F., Antisense oligonucleotides
containing locked nucleic acid improve potency but cause
significant hepatotoxicity in animals. Nucl. Acids Res., doi:
10.1093/nar/gkl1071 (December 2006, advanced online
publication).
[0006] Many alternative chemically modified nucleosides have been
prepared, for instance nucleosides comprising 2' modifications,
nucleosides comprising 5' modifications, and nucleosides utilizing
non-natural bases. Anhydrohexitol nucleic acids have been prepared
(but not as the bicyclic analog, see Wouters and Herdewijn, Bioorg.
Med. Chem. Lett., 1999, 9, 1563-1566).
[0007] There remains a long-felt need for new agents that
specifically regulate gene expression via antisense mechanisms.
Disclosed herein are bicyclic cyclohexose nucleic acids and
antisense compounds prepared therefrom useful for modulating gene
expression pathways, including those relying on mechanisms of
action such as RNaseH, RNAi and dsRNA enzymes, as well as other
antisense mechanisms based on target degradation or target
occupancy. One having skill in the art, once armed with this
disclosure will be able, without undue experimentation, to
identify, prepare and exploit antisense compounds for these
uses.
BRIEF SUMMARY OF THE INVENTION
[0008] Provided herein are novel bicyclic nucleoside analogs and
oligomeric compounds prepared therefrom. More particularly, the
bicyclic nucleoside analogs provided herein have a core structure
comprising a cyclohexyl ring wherein one of the ring carbons is
replaced with a heteroatom. The cyclohexyl core also includes a
bridge connecting two of the ring carbon atoms wherein the two
bridging ring carbon atoms have at least one ring carbon atom
separating them. In certain embodiments, the oligomeric compounds
are expected to hybridize to a portion of a target RNA resulting in
loss of normal function of the target RNA. The oligomeric compounds
are also expected to be useful as primers and probes in diagnostic
applications.
[0009] The variables are defined individually in further detail
herein. It is to be understood that the bicyclic nucleoside analogs
and oligomeric compounds provided herein include all combinations
of the embodiments disclosed and variables defined herein.
[0010] In certain embodiments, bicyclic nucleoside analogs are
provided herein having formula I:
##STR00001##
wherein:
[0011] Bx is a heterocyclic base moiety;
[0012] Z is O or S;
Q is a bridge group comprising 1 or from 2 to 8 linked biradical
groups independently selected from O, S, N(R.sub.1),
C(R.sub.1)(R.sub.2), C(R.sub.1).dbd.C(R.sub.2), C(R.sub.1).dbd.N,
C(.dbd.NR.sub.1), Si(R.sub.1).sub.2, S(O).sub.2, S(O), C(.dbd.O)
and C(.dbd.S);
[0013] each R.sub.1 and R.sub.2 is, independently, H, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1
NJ.sub.1J.sub.2, SJ.sub.1N.sub.3, COOJ.sub.1, acyl (C(.dbd.O)--H),
substituted acyl, CN, S(.dbd.O).sub.2-J.sub.1 or
S(.dbd.O)-J.sub.1;
[0014] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group;
[0015] one of E.sub.1 and E.sub.2 is H and the other of E.sub.1 and
E.sub.2 is O-T.sub.2 or one of E.sub.3 and E.sub.4 is H and the
other of E.sub.3 and E.sub.4 is O-T.sub.2 and the remaining two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are each, independently, H,
halogen, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted
heterocycle radical, heteroaryl, substituted heteroaryl,
C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7
alicyclic radical, OJ.sub.3, NJ.sub.3J.sub.4, SJ.sub.3, N.sub.3,
COOJ.sub.3, acyl (C(.dbd.O)--H), substituted acyl, CN,
S(.dbd.O).sub.2-J.sub.3 or S(.dbd.O)-J.sub.3;
[0016] one of T.sub.1 and T.sub.2 is H, a hydroxyl protecting group
or a phosphorus moiety and the other of T.sub.1 and T.sub.2 is H, a
hydroxyl protecting group or a reactive phosphorus group;
[0017] each substituted group comprises one or more optionally
protected substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6); [0018] L is O, S or NJ.sub.7; and
[0019] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12
aminoalkyl.
[0020] In certain embodiments, each J.sub.1, J.sub.2, J.sub.3,
J.sub.4, J.sub.5, J.sub.6 and J.sub.7 is, independently, H,
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12 aminoalkyl.
[0021] In certain embodiments, each substituted group comprises one
or more substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6);
[0022] L is O, S or NJ.sub.7; and
[0023] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or
C.sub.1-C.sub.6 aminoalkyl.
[0024] In certain embodiments, Bx is uracil, thymine, cytosine,
5-methylcytosine, adenine or guanine
[0025] In certain embodiments, Z is O.
[0026] In certain embodiments, one of E.sub.1, E.sub.2, E.sub.3 and
E.sub.4 is OT.sub.2 and the remaining three of E.sub.1, E.sub.2,
E.sub.3 and E.sub.4 are H. In certain embodiments, one of E.sub.1,
E.sub.2, E.sub.3 and E.sub.4 is OT.sub.2, one of E.sub.1, E.sub.2,
E.sub.3 and E.sub.4 is H and the remaining two of E.sub.1, E.sub.2,
E.sub.3 and E.sub.4 are, independently, halogen, C.sub.1-C.sub.6
alkyl or substituted C.sub.1-C.sub.6 alkyl. In certain embodiments,
one of E.sub.1, E.sub.2, E.sub.3 and E.sub.4 is OT.sub.2, two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are H and the remaining one
of E.sub.1, E.sub.2, E.sub.3 and E.sub.4 is halogen,
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl. In
certain embodiments, the remaining of E.sub.1, E.sub.2, E.sub.3 and
E.sub.4 is, independently, fluoro, methyl or substituted
methyl.
[0027] In certain embodiments, L.sub.1 and L.sub.2 are each H. In
certain embodiments, one of L.sub.1 and L.sub.2 is H and the other
of L.sub.1 and L.sub.2 is other than H. In certain embodiments,
L.sub.1 and L.sub.2 are each other than H. In certain embodiments,
one of L.sub.1 and L.sub.2 is substituted C.sub.1-C.sub.6 alkyl. In
certain embodiments, the substituted C.sub.1-C.sub.6 alkyl
comprises at least one substituent group selected from halogen,
C.sub.2-C.sub.6 alkenyl, OJ.sub.5, NJ.sub.5J.sub.6 and CN, wherein
each J.sub.5 and J.sub.6 is, independently, H or C.sub.1-C.sub.6
alkyl. In certain embodiments, the substituted C.sub.1-C.sub.6
alkyl comprises at least one substituent group selected from fluoro
and OCH.sub.3. In certain embodiments, at least one of L.sub.1 and
L.sub.2 is C.sub.1-C.sub.6 alkyl. In certain embodiments, one of
L.sub.1 and L.sub.2 is methyl.
[0028] In certain embodiments, T.sub.1 is selected from acetyl,
benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and
dimethoxytrityl. In certain embodiments, T.sub.1 is
4,4'-dimethoxytrityl. In certain embodiments, T.sub.1 is a
phosphorus moiety. In certain embodiments, T.sub.2 is a reactive
phosphorus group. In certain embodiments, T.sub.2 is a reactive
phosphorus group selected from diisopropylcyanoethoxy
phosphoramidite and H-phosphonate. In certain embodiments, T.sub.1
is 4,4'-dimethoxytrityl and T.sub.2 is diisopropylcyanoethoxy
phosphoramidite.
[0029] In certain embodiments, Q comprises from 2 to 4 of the
linked biradical groups. In certain embodiments, Q comprises 2 or 3
of the linked biradical groups. In certain embodiments, Q comprises
1 of the biradical groups. In certain embodiments, Q is
C(R.sub.1)(R.sub.2), C(R.sub.1)(R.sub.2)--C(R.sub.1)(R.sub.2) or
O--C(R.sub.1)(R.sub.2). In certain embodiments, Q is CH.sub.2,
(CH.sub.2).sub.2 or O--CH.sub.2. In certain embodiments, Q is
2'-O--CH.sub.2-5'.
[0030] In certain embodiments, further bicyclic nucleoside analogs
are provided having formula I wherein:
[0031] Q is 5'-CR.sub.3R.sub.4--O-2', 5'-CR.sub.3R.sub.4--S-2',
5'-CR.sub.3R.sub.4--N(R.sub.5)-2', 5'-(CR.sub.3R.sub.4).sub.2-2',
5'-(CR.sub.3R.sub.4).sub.3-2', 5'-CR.sub.3.dbd.CR.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--CR.sub.3.dbd.CR.sub.4-2',
5'-CR.sub.3.dbd.CR.sub.4--CR.sub.3R.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--(CR.sub.3R.sub.4).sub.2-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-(CR.sub.3R.sub.4).sub.2--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2' or
5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2';
[0032] each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0033] R.sub.5 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted
C.sub.1-C.sub.6 alkoxy;
[0034] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl or substituted C.sub.2-C.sub.6 alkenyl;
[0035] one of E.sub.1 and E.sub.2 is H and the other of E.sub.1 and
E.sub.2 is O-T.sub.2 or one of E.sub.3 and E.sub.4 is H and the
other of E.sub.3 and E.sub.4 is O-T.sub.2 and the remaining two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0036] one of T.sub.1 and T.sub.2 is H, a hydroxyl protecting group
or a reactive phosphorus group selected from a phosphoramidite,
H-phosphonate, phosphate triester and a phosphorus containing
chiral auxiliary and the other of T.sub.1 and T.sub.2 is H, a
hydroxyl protecting group or a phosphorus moiety having the
formula:
##STR00002##
wherein:
[0037] R.sub.a and R.sub.c are each, independently, OH, SH,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy, amino
or substituted amino; and
[0038] R.sub.b is O or S; and
[0039] wherein each substituted group comprises one or more
optionally protected substituent groups independently selected from
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, hydroxyl,
thiol, amino and C.sub.1-C.sub.6 aminoalkyl.
[0040] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein Bx is uracil,
thymine, cytosine, 5-methylcytosine, adenine or guanine
[0041] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein Z is O.
[0042] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein the remaining two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are each H. In certain
embodiments, one of the remaining two of E.sub.1, E.sub.2, E.sub.3
and E.sub.4 is H and the other one of the remaining two of E.sub.1,
E.sub.2, E.sub.3 and E.sub.4 is CH.sub.3, CH.sub.2CH.sub.3,
OCH.sub.3 or F.
[0043] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein L.sub.1 and L.sub.2
are each H. In certain embodiments, one of L.sub.1 and L.sub.2 is H
and the other of L.sub.1 and L.sub.2 is CH.sub.3 or OCH.sub.3.
[0044] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein T.sub.1 is a
phosphorus moiety. In certain embodiments, T.sub.1 is
4,4'-dimethoxytrityl. In certain embodiments, T.sub.2 is
diisopropylcyanoethoxy phosphoramidite. In certain embodiments,
T.sub.1 is 4,4'-dimethoxytrityl and T.sub.2 is
diisopropylcyanoethoxy phosphoramidite.
[0045] In certain embodiments, the further bicyclic nucleoside
analogs having formula I are provided wherein Q is
5'-CR.sub.3R.sub.4--O-2', 5'-(CR.sub.3R.sub.4).sub.2-2',
5'-CR.sub.3.dbd.CR.sub.4-2', 5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2'
or 5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2'. In certain embodiments, Q
is 5'-CH.sub.2--O-2'.
[0046] In certain embodiments, bicyclic nucleoside analogs having
formula I are provided having the configuration:
##STR00003##
[0047] In certain embodiments, bicyclic nucleoside analogs having
formula I are provided having the configuration:
##STR00004##
[0048] In certain embodiments, bicyclic nucleoside analogs are
provided wherein one of E.sub.1 and E.sub.2 is H and the other of
E.sub.1 and E.sub.2 is O-T.sub.2 and the resultant bicyclic
nucleoside analog has the configuration:
##STR00005##
[0049] In certain embodiments, bicyclic nucleoside analogs are
provided wherein one of E.sub.1 and E.sub.2 is H and the other of
E.sub.1 and E.sub.2 is O-T.sub.2 and the resultant bicyclic
nucleoside analog has the configuration:
##STR00006##
[0050] In certain embodiments, bicyclic nucleoside analogs are
provided wherein one of E.sub.3 and E.sub.4 is H and the other of
E.sub.3 and E.sub.4 is O-T.sub.2 and the resultant bicyclic
nucleoside analog has the configuration:
##STR00007##
[0051] In certain embodiments, bicyclic nucleoside analogs are
provided wherein one of E.sub.3 and E.sub.4 is H and the other of
E.sub.3 and E.sub.4 is O-T.sub.2 and the resultant bicyclic
nucleoside analog has the configuration:
##STR00008##
[0052] Further provided herein are oligomeric compounds that each
comprise at least one bicyclic nucleoside analog of formula II:
##STR00009##
wherein independently for each bicyclic nucleoside analog of
formula II:
[0053] Bx is a heterocyclic base moiety;
[0054] Z is O or S;
[0055] Q is a bridge group comprising 1 or from 2 to 8 linked
biradical groups independently selected from O, S, N(R.sub.1),
C(R.sub.1)(R.sub.2), C(R.sub.1).dbd.C(R.sub.2), C(R.sub.1).dbd.N,
C(.dbd.NR.sub.1), Si(R.sub.1).sub.2, S(O).sub.2, S(O), C(.dbd.O)
and C(.dbd.S);
[0056] each R.sub.1 and R.sub.2 is, independently, H, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen,
OJ.sub.1NJ.sub.1H.sub.2, SJ.sub.1N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, S(.dbd.O).sub.2-J.sub.1 or
S(.dbd.O)-J.sub.1;
[0057] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group;
[0058] one of E.sub.5 and E.sub.6 is H and the other of E.sub.5 and
E.sub.6 is O-T.sub.4 or one of E.sub.7 and E.sub.8 is H and the
other of E.sub.7 and E.sub.8 is O-T.sub.4 and the remaining two of
E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are each, independently, H,
halogen, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted
heterocycle radical, heteroaryl, substituted heteroaryl,
C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7
alicyclic radical, OJ.sub.3, NJ.sub.3J.sub.4, SJ.sub.3, N.sub.3,
COOJ.sub.3, acyl (C(.dbd.O)--H), substituted acyl, CN,
S(.dbd.O).sub.2-J.sub.3 or S(.dbd.O)-J.sub.3;
[0059] one of T.sub.3 and T.sub.4 is an internucleoside linking
group linking the bicyclic nucleoside analog to the oligomeric
compound and the other of T.sub.3 and T.sub.4 is H, a protecting
group, a phosphorus moiety, a 5' or 3'-terminal group or an
internucleoside linking group linking the bicyclic nucleoside
analog to the oligomeric compound;
[0060] each substituted group comprises one or more optionally
protected substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6);
[0061] L is O, S or NJ.sub.7; and
[0062] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12
aminoalkyl.
[0063] In certain embodiments, each J.sub.1, J.sub.2, J.sub.3,
J.sub.4, J.sub.5, J.sub.6 and J.sub.7 is, independently, H,
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12 aminoalkyl.
[0064] In certain embodiments, each substituted group comprises one
or more substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6);
[0065] L is O, S or NJ.sub.7; and
[0066] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or
C.sub.1-C.sub.6 aminoalkyl.
[0067] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II, Bx is uracil, thymine, cytosine, 5-methylcytosine,
adenine or guanine
[0068] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II Z is O.
[0069] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 is OT.sub.4
and the remaining three of E.sub.5, E.sub.6, E.sub.7 and E.sub.8
are H. In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 is
OT.sub.4, one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 is H and the
remaining two of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are,
independently, halogen, C.sub.1-C.sub.6 alkyl or substituted
C.sub.1-C.sub.6 alkyl. In certain embodiments, oligomeric compounds
are provided wherein independently for each bicyclic nucleoside
analog of formula II one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8
is OT.sub.4, two of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are H and
the remaining one of E.sub.5, E.sub.6, E.sub.7 and E.sub.8 is
halogen, C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6
alkyl. In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II the remaining of E.sub.5, E.sub.6, E.sub.7 and E.sub.8
is, independently, fluoro, methyl or substituted methyl.
[0070] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II L.sub.1 and L.sub.2 are each H. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II one of L.sub.1 and L.sub.2
is H and the other of L.sub.1 and L.sub.2 is other than H. In
certain embodiments, oligomeric compounds are provided wherein
independently for each bicyclic nucleoside analog of formula II
L.sub.1 and L.sub.2 are each other than H. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II one of L.sub.1 and L.sub.2
is substituted C.sub.1-C.sub.6 alkyl. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II the substituted
C.sub.1-C.sub.6 alkyl comprises at least one substituent group
selected from halogen, C.sub.2-C.sub.6 alkenyl, OJ.sub.5,
NJ.sub.5J.sub.6 and CN, wherein each J.sub.5 and J.sub.6 is,
independently, H or C.sub.1-C.sub.6 alkyl. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II the substituted
C.sub.1-C.sub.6 alkyl comprises at least one substituent group
selected from fluoro and OCH.sub.3. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II at least one of L.sub.1
and L.sub.2 is C.sub.1-C.sub.6 alkyl. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II one of L.sub.1 and L.sub.2
is methyl.
[0071] In certain embodiments, oligomeric compounds are provided
wherein at least one of T.sub.3 and T.sub.4 is a 5' or 3'-terminal
group. In certain embodiments, oligomeric compounds are provided
wherein one T.sub.3 is a phosphorus moiety. In certain embodiments,
the phosphorus moiety has the formula:
##STR00010##
[0072] wherein R.sub.8 is O or S.
[0073] In certain embodiments, oligomeric compounds are provided
wherein one T.sub.3 is H and one T.sub.4 is H.
[0074] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II Q comprises from 2 to 4 of said linked biradical groups.
In certain embodiments, oligomeric compounds are provided wherein
independently for each bicyclic nucleoside analog of formula II Q
comprises 2 or 3 of said linked biradical groups. In certain
embodiments, oligomeric compounds are provided wherein
independently for each bicyclic nucleoside analog of formula II Q
comprises 1 of said biradical groups. In certain embodiments,
oligomeric compounds are provided wherein independently for each
bicyclic nucleoside analog of formula II Q is C(R.sub.1)(R.sub.2),
C(R.sub.1)(R.sub.2)--C(R.sub.1)(R.sub.2) or O--C(R.sub.1)(R.sub.2).
In certain embodiments, oligomeric compounds are provided wherein
independently for each bicyclic nucleoside analog of formula II Q
is CH.sub.2, (CH.sub.2).sub.2 or O--CH.sub.2. In certain
embodiments, oligomeric compounds are provided wherein
independently for each bicyclic nucleoside analog of formula II Q
is 2'-O--CH.sub.2-5'.
[0075] In certain embodiments, further oligomeric compounds
comprising at least one bicyclic nucleoside analog of formula II
are provided wherein independently for each bicyclic nucleoside
analog of formula II:
[0076] Q is 5'-CR.sub.3R.sub.4--O-2', 5'-CR.sub.3R.sub.4--S-2',
5'-CR.sub.3R.sub.4--N(R.sub.5)-2', 5'-(CR.sub.3R.sub.4).sub.2-2',
5'-(CR.sub.3R.sub.4).sub.3-2', 5'-CR.sub.3.dbd.CR.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--CR.sub.3.dbd.CR.sub.4-2',
5'-CR.sub.3.dbd.CR.sub.4--CR.sub.3R.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--(CR.sub.3R.sub.4).sub.2-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-(CR.sub.3R.sub.4).sub.2--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2' or
5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2;
[0077] each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0078] R.sub.5 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted
C.sub.1-C.sub.6 alkoxy;
[0079] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl or substituted C.sub.2-C.sub.6 alkenyl;
[0080] one of E.sub.5 and E.sub.6 is H and the other of E.sub.5 and
E.sub.6 is O-T.sub.4 or one of E.sub.7 and E.sub.8 is H and the
other of E.sub.7 and E.sub.8 is O-T.sub.4 and the remaining two of
E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen; and
[0081] wherein each substituted group comprises one or more
optionally protected substituent groups independently selected from
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, hydroxyl,
thiol, amino and C.sub.1-C.sub.6 aminoalkyl.
[0082] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II Bx uracil, thymine, cytosine, 5-methylcytosine,
adenine or guanine
[0083] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II Z is O.
[0084] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II the remaining two of E.sub.5, E.sub.6, E.sub.7 and
E.sub.8 are each H for each bicyclic nucleoside of formula II. In
certain embodiments, the further oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of the remaining two of E.sub.1, E.sub.2, E.sub.3
and E.sub.4 is H and the other one of the remaining two of E.sub.1,
E.sub.2, E.sub.3 and E.sub.4 is CH.sub.3, CH.sub.2CH.sub.3,
OCH.sub.3 or F.
[0085] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II L.sub.1 and L.sub.2 are each H.
[0086] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II one of L.sub.1 and L.sub.2 is H and the other of
L.sub.1 and L.sub.2 is CH.sub.3 or OCH.sub.3.
[0087] In certain embodiments, the further oligomeric compounds are
provided wherein one T.sub.3 is a phosphorus moiety.
[0088] In certain embodiments, the further oligomeric compounds are
provided wherein independently for each bicyclic nucleoside analog
of formula II Q is 5'-CR.sub.3R.sub.4--O-2',
5'-(CR.sub.3R.sub.4).sub.2-2', 5'-CR.sub.3.dbd.CR.sub.4-2',
5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2' or
5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2'. In certain embodiments, the
further oligomeric compounds are provided wherein for each bicyclic
nucleoside analog of formula II Q is 5'-CH.sub.2--O-2'.
[0089] In certain embodiments, each of the further oligomeric
compounds are provided comprising one phosphorus moiety having the
formula:
##STR00011##
[0090] wherein R.sub.8 is O or S.
[0091] In certain embodiments, oligomeric compounds comprising at
least one bicyclic nucleoside analog of formula II are provided
wherein each bicyclic nucleoside analog of formula II has the
configuration:
##STR00012##
[0092] In certain embodiments, oligomeric compounds comprising at
least one bicyclic nucleoside analog of formula II are provided
wherein each bicyclic nucleoside analog of formula II has the
configuration:
##STR00013##
[0093] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.5 and E.sub.6 is H and the other of E.sub.5
and E.sub.6 is O-T.sub.4 having the configuration:
##STR00014##
[0094] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.5 and E.sub.6 is H and the other of E.sub.5
and E.sub.6 is O-T.sub.4 having the configuration:
##STR00015##
[0095] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.7 and E.sub.8 is H and the other of E.sub.7
and E.sub.8 is O-T.sub.4 having the configuration:
##STR00016##
[0096] In certain embodiments, oligomeric compounds are provided
wherein independently for each bicyclic nucleoside analog of
formula II one of E.sub.7 and E.sub.8 is H and the other of E.sub.7
and E.sub.8 is O-T.sub.4 having the configuration:
##STR00017##
[0097] In certain embodiments, oligomeric compounds are provided
wherein at least one bicyclic nucleoside analog of formula II is
located at the 5' end.
[0098] In certain embodiments, oligomeric compounds are provided
comprising at least one region having at least 2 contiguous
bicyclic nucleoside analogs of formula II. In certain embodiments,
the at least one region comprises from 2 to 5 contiguous bicyclic
nucleoside analogs of formula II.
[0099] In certain embodiments, oligomeric compounds are provided
comprising at least two regions wherein each region independently
comprises from 1 to about 5 contiguous bicyclic nucleoside analogs
of formula II and wherein each region is separated by at least one
monomer subunit that is different from the bicyclic nucleoside
analogs of formula II and is independently selected from
nucleosides and modified nucleosides. In certain embodiments,
oligomeric compounds are provided comprising a gapped oligomeric
compound wherein one region of contiguous bicyclic nucleoside
analogs of formula II is located at the 5'-end and a second region
of contiguous bicyclic nucleoside analogs of Formula II is located
at the 3'-end, wherein the two regions are separated by an internal
region comprising from about 6 to about 18 monomer subunits
independently selected from nucleosides and modified nucleosides
that are different from the bicyclic nucleoside analogs of formula
II. In certain embodiments, the internal region comprises from
about 8 to about 14 contiguous .beta.-D-2'-deoxyribofuranosyl
nucleosides. In certain embodiments, the internal region comprises
from about 9 to about 12 contiguous .beta.-D-2'-deoxyribofuranosyl
nucleosides.
[0100] In certain embodiments, oligomeric compounds are provided
comprising one region of from 2 to 3 contiguous bicyclic nucleoside
analogs of formula II, an optional second region of from 1 to 3
contiguous bicyclic nucleoside analogs of formula II and a third
region of from 8 to 14 .beta.-D-2'-deoxyribofuranosyl nucleosides
wherein said third region is located between said first and said
second regions.
[0101] In certain embodiments, oligomeric compounds are provided
wherein each internucleoside linking group is, independently, a
phosphodiester internucleoside linking group or a phosphorothioate
internucleoside linking group. In certain embodiments, oligomeric
compounds are provided wherein essentially each internucleoside
linking group is a phosphorothioate internucleoside linking
group.
[0102] In certain embodiments, oligomeric compounds are provided
comprising from about 8 to about 40 monomer subunits in length. In
certain embodiments, oligomeric compounds are provided comprising
from about 8 to about 20 monomer subunits in length. In certain
embodiments, oligomeric compounds are provided comprising from
about 10 to about 16 monomer subunits in length. In certain
embodiments, oligomeric compounds are provided comprising from
about 0 to about 14 monomer subunits in length.
[0103] Also provided herein are bicyclic nucleoside analogs wherein
each bicyclic nucleoside analog comprises a 6 membered ring having
5 carbon atoms and one heteroatom selected from oxygen, sulfur or
substituted amino, wherein a first ring carbon flanking the ring
heteroatom is substituted with a nucleobase and the opposite
flanking ring carbon is substituted with a first group that can
form an internucleoside linkage; one additional ring carbon is
substituted with a second group that can form an internucleoside
linkage; and wherein said 6 membered ring comprises a bridge
connecting two ring carbon atoms of said six membered ring wherein
the two ring atoms are separated by at least one additional ring
atom. In certain embodiments, each of the groups that can form an
internucleoside linkage is, independently, hydroxyl, protected
hydroxyl, hydroxymethylene, protected hydroxymethylene or a
reactive phosphorus group. In certain embodiments, the bridge
comprises a single atom between said two ring carbons thereby
having a 2.2.1. bicyclic ring structure. In certain embodiments,
the bridge comprises two atoms between said two ring carbons
thereby having a 2.2.2. bicyclic ring structure. In certain
embodiments, oligomeric compounds are provided comprising at least
one of these bicyclic nucleoside analogs.
[0104] Also provided herein are methods of inhibiting gene
expression comprising contacting one or more cells, a tissue or an
animal with an oligomeric compound as provided herein.
[0105] In certain embodiments, oligomeric compounds are provided
herein for use in an in vivo method of inhibiting gene expression
said method comprising contacting one or more cells, a tissue or an
animal with an oligomeric compound as provided herein.
[0106] In certain embodiments, oligomeric compounds as provided
herein are used in medical therapy.
DETAILED DESCRIPTION OF THE INVENTION
[0107] Provided herein are novel bicyclic nucleosides and
oligomeric compounds prepared therefrom. More particularly, the
bicyclic nucleosides each have a core structure comprising a
cyclohexyl ring wherein one of the ring carbons is replaced with a
heteroatom. Attached to one of the two carbon atoms flanking the
heteroatom is a heterocyclic base moiety and attached to the other
flanking carbon atom is a first group capable of forming an
internucleoside linkage. A second group capable of forming an
internucleoside linkage is adjacent to or one atom removed from the
first group capable of forming an internucleoside linkage. The core
six membered ring system further comprises a bridge connecting two
of the ring carbon atoms wherein the two bridging ring carbon atoms
have at least one ring carbon atom separating them.
[0108] The bridge forming the second ring is variable comprising a
single biradical group such as for example a methylene or
substituted methylene group or up to about 8 biradical groups
linked together. Biradical groups that can be used individually or
linked together to form larger bridging groups include, but are not
limited to: O, S, N(R.sub.1), C(R.sub.1)(R.sub.2),
C(R.sub.1).dbd.C(R.sub.2), C(R.sub.1).dbd.N, C(.dbd.NR.sub.1),
Si(R.sub.1).sub.2, SO.sub.2, SO, C(.dbd.O) and C(.dbd.S) where
R.sub.1 and R.sub.2 are as listed above. The conformation (.alpha.
or .beta.) of the bicyclic nucleosides can also be varied by
choosing the route of synthesis to place the bridge above the plane
of the 6 membered ring system or below it.
[0109] The groups capable of forming internucleoside linkages can
be variable. Preferred groups capable of forming internucleoside
linkages include optionally protected primary and secondary
alcohols and reactive phosphorus groups such as phosphoramidites
and H-phosphonates. In one preferred embodiment one of the groups
capable of forming an internucleoside linkage is an optionally
protected hydroxymethylene and the other group is an optionally
protected hydroxyl or reactive phosphorus group.
[0110] In certain embodiments, the bicyclic nucleosides are
expected to be useful for enhancing desired properties of
oligomeric compounds in which they are incorporated such as for
example nuclease resistance. In certain embodiments, the oligomeric
compounds provided herein are expected to hybridize to a portion of
a target RNA resulting in loss of normal function of the target
RNA. The oligomeric compounds provided herein are also expected to
be useful as primers and probes in diagnostic applications. In
certain embodiments, bicyclic nucleosides of the present invention
have formula I shown below:
##STR00018##
wherein:
[0111] Bx is a heterocyclic base moiety;
[0112] Z is O or S;
[0113] Q is a bridge group comprising 1 or from 2 to 8 linked
biradical groups independently selected from O, S, N(R.sub.1),
C(R.sub.1)(R.sub.2), C(R.sub.1).dbd.C(R.sub.2), C(R.sub.1).dbd.N,
C(.dbd.NR.sub.1), Si(R.sub.1).sub.2, S(O).sub.2, S(O), C(.dbd.O)
and C(.dbd.S);
[0114] each R.sub.1 and R.sub.2 is, independently, H, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen,
OJ.sub.1NJ.sub.1J.sub.2, SJ.sub.1N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, S(.dbd.O).sub.2J.sub.1 or
S(.dbd.O)-J.sub.1;
[0115] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group;
[0116] one of E.sub.1 and E.sub.2 is H and the other of E.sub.1 and
E.sub.2 is O-T.sub.2 or one of E.sub.3 and E.sub.4 is H and the
other of E.sub.3 and E.sub.4 is O-T.sub.2 and the remaining two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are each, independently, H,
halogen, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted
heterocycle radical, heteroaryl, substituted heteroaryl,
C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7
alicyclic radical, OJ.sub.3, NJ.sub.3J.sub.4, SJ.sub.3, N.sub.3,
COOJ.sub.3, acyl (C(.dbd.O)--H), substituted acyl, CN,
S(.dbd.O).sub.2-J.sub.3 or S(.dbd.O)-J.sub.3;
[0117] one of T.sub.1 and T.sub.2 is H, a hydroxyl protecting group
or a phosphorus moiety and the other of T.sub.1 and T.sub.2 is H, a
hydroxyl protecting group or a reactive phosphorus group;
[0118] each substituted group comprises one or more optionally
protected substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6);
[0119] L is O, S or NJ.sub.7; and
[0120] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12
aminoalkyl.
[0121] In certain embodiments, further bicyclic nucleoside analogs
are provided having formula I wherein:
[0122] Q is 5'-CR.sub.3R.sub.4--O-2', 5'-CR.sub.3R.sub.4--S-2',
5'-CR.sub.3R.sub.4--N(R.sub.5)-2', 5'-(CR.sub.3R.sub.4).sub.2-2',
5'-(CR.sub.3R.sub.4).sub.3-2', 5'-CR.sub.3.dbd.CR.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--CR.sub.3.dbd.CR.sub.4-2',
5'-CR.sub.3.dbd.CR.sub.4--CR.sub.3R.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--(CR.sub.3R.sub.4).sub.2-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-(CR.sub.3R.sub.4).sub.2--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2' or
5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2';
[0123] each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0124] R.sub.5 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted
C.sub.1-C.sub.6 alkoxy;
[0125] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl or substituted C.sub.2-C.sub.6 alkenyl;
[0126] one of E.sub.1 and E.sub.2 is H and the other of E.sub.1 and
E.sub.2 is O-T.sub.2 or one of E.sub.3 and E.sub.4 is H and the
other of E.sub.3 and E.sub.4 is O-T.sub.2 and the remaining two of
E.sub.1, E.sub.2, E.sub.3 and E.sub.4 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0127] one of T.sub.1 and T.sub.2 is H, a hydroxyl protecting group
or a reactive phosphorus group selected from a phosphoramidite,
H-phosphonate, phosphate triester and a phosphorus containing
chiral auxiliary and the other of T.sub.1 and T.sub.2 is H, a
hydroxyl protecting group or a phosphorus moiety having the
formula:
##STR00019##
wherein:
[0128] R.sub.a and R.sub.c are each, independently, OH, SH,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy, amino
or substituted amino; and
[0129] R.sub.b is O or S; and
[0130] wherein each substituted group comprises one or more
optionally protected substituent groups independently selected from
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, hydroxyl,
thiol, amino and C.sub.1-C.sub.6 aminoalkyl.
[0131] In certain embodiments, oligomeric compounds are provided
comprising at least one bicyclic nucleoside analog of formula
II:
##STR00020##
wherein independently for each bicyclic nucleoside analog of
formula II:
[0132] Bx is a heterocyclic base moiety;
[0133] Z is O or S;
[0134] Q is a bridge group comprising 1 or from 2 to 8 linked
biradical groups independently selected from O, S, N(R.sub.1),
C(R.sub.1)(R.sub.2), C(R.sub.1).dbd.C(R.sub.2), C(R.sub.1).dbd.N,
C(.dbd.NR.sub.1), Si(R.sub.1).sub.2, S(O).sub.2, S(O), C(.dbd.O)
and C(.dbd.S);
[0135] each R.sub.1 and R.sub.2 is, independently, H, hydroxyl,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, a
heterocycle radical, a substituted heterocycle radical, heteroaryl,
substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical,
substituted C.sub.5-C.sub.7 alicyclic radical, halogen,
OJ.sub.1NJ.sub.1J.sub.2, SJ.sub.1N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, S(.dbd.O).sub.2-J.sub.1 or
S(.dbd.O)-J.sub.1;
[0136] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group;
[0137] one of E.sub.5 and E.sub.6 is H and the other of E.sub.5 and
E.sub.6 is O-T.sub.4 or one of E.sub.7 and E.sub.8 is H and the
other of E.sub.7 and E.sub.8 is O-T.sub.4 and the remaining two of
E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are each, independently, H,
halogen, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, a heterocycle radical, a substituted
heterocycle radical, heteroaryl, substituted heteroaryl,
C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7
alicyclic radical, OJ.sub.3, NJ.sub.3J.sub.4, SJ.sub.3, N.sub.3,
COOJ.sub.3, acyl (C(.dbd.O)--H), substituted acyl, CN,
S(.dbd.O).sub.2-J.sub.3 or S(.dbd.O)-J.sub.3;
[0138] one of T.sub.3 and T.sub.4 is an internucleoside linking
group linking the bicyclic nucleoside analog to the oligomeric
compound and the other of T.sub.3 and T.sub.4 is H, a protecting
group, a phosphorus moiety, a 5' or 3'-terminal group or an
internucleoside linking group linking the bicyclic nucleoside
analog to the oligomeric compound;
[0139] each substituted group comprises one or more optionally
protected substituent groups independently selected from halogen,
OJ.sub.5, N(J.sub.5)(J.sub.6), =NJ.sub.5, SJ.sub.5, N.sub.3, CN,
OC(=L)J.sub.5, OC(=L)N(J.sub.5)(J.sub.6) and
C(=L)N(J.sub.5)(J.sub.6);
[0140] L is O, S or NJ.sub.7; and
[0141] each J.sub.1, J.sub.2, J.sub.3, J.sub.4, J.sub.5, J.sub.6
and J.sub.7 is, independently, H, C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl or C.sub.1-C.sub.12
aminoalkyl. In certain embodiments, further oligomeric compounds
comprising at least one bicyclic nucleoside analog of formula II
are provided wherein independently for each bicyclic nucleoside
analog of formula II:
[0142] Q is 5'-CR.sub.3R.sub.4--O-2', 5'-CR.sub.3R.sub.4--S-2',
5'-CR.sub.3R.sub.4--N(R.sub.5)-2', 5'-(CR.sub.3R.sub.4).sub.2-2',
5'-(CR.sub.3R.sub.4).sub.3-2', 5'-CR.sub.3.dbd.CR.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--CR.sub.3.dbd.CR.sub.4-2',
5'-CR.sub.3.dbd.CR.sub.4--CR.sub.3R.sub.4-2',
5'-C(.dbd.CR.sub.3R.sub.4)--(CR.sub.3R.sub.4).sub.2-2',
5'-CR.sub.3R.sub.4--C(.dbd.CR.sub.3R.sub.4)--CR.sub.3R.sub.4-2',
5'-(CR.sub.3R.sub.4).sub.2--C(.dbd.CR.sub.3R.sub.4)-2',
5'-CR.sub.3R.sub.4--O--N(R.sub.5)-2' or
5'-CR.sub.3R.sub.4--N(R.sub.5)--O-2';
[0143] each R.sub.3 and R.sub.4 is, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen;
[0144] R.sub.5 is H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted
C.sub.1-C.sub.6 alkoxy;
[0145] L.sub.1 and L.sub.2 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl or substituted C.sub.2-C.sub.6 alkenyl;
[0146] one of E.sub.5 and E.sub.6 is H and the other of E.sub.5 and
E.sub.6 is O-T.sub.4 or one of E.sub.7 and E.sub.8 is H and the
other of E.sub.7 and E.sub.8 is O-T.sub.4 and the remaining two of
E.sub.5, E.sub.6, E.sub.7 and E.sub.8 are each, independently, H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy or
halogen; and
[0147] wherein each substituted group comprises one or more
optionally protected substituent groups independently selected from
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, hydroxyl,
thiol, amino and C.sub.1-C.sub.6 aminoalkyl.
[0148] In certain embodiments, oligomeric compounds comprising at
least one bicyclic nucleoside analog of formula II are provided
wherein each bicyclic nucleoside analog of formula II has the
configuration:
##STR00021##
[0149] In certain embodiments, oligomeric compounds comprising at
least one bicyclic nucleoside analog of formula II are provided
wherein each bicyclic nucleoside analog of formula II has the
configuration:
##STR00022##
[0150] Incorporation of one or more of the bicyclic nucleosides, as
provided herein, into an oligomeric compound is expected to enhance
one or more desired properties of the resulting oligomeric
compound. Such properties include without limitation stability,
nuclease resistance, binding affinity, specificity, absorption,
cellular distribution, cellular uptake, charge, clearance and
pharmacodynamics and pharmacokinetics in general.
[0151] In certain embodiments, the bicyclic nucleosides provided
herein are incorporated into oligomeric compounds such that a motif
results. The placement of bicyclic nucleosides into oligomeric
compounds to provide particular motifs can enhance the desired
properties of the resulting oligomeric compounds for activity using
a particular mechanism such as RNaseH or RNAi. Such motifs include
without limitation, gapped motifs, hemimer motifs, blockmer motifs,
uniformly fully modified motifs, positionally modified motifs and
alternating motifs. In conjunction with these motifs a wide variety
of internucleoside linkages can also be used including but not
limited to phosphodiester and phosphorothioate internucleoside
linkages which can be incorporated uniformly or in various
combinations. The oligomeric compounds can further include at least
one 5' or 3' terminal group such as for example a conjugate or
reporter group. The positioning of the bicyclic nucleosides
provided herein, the use of linkage strategies and 5' or 3'
terminal groups can be easily optimized to enhance a desired
activity for a selected target.
[0152] As used herein the term "motif" refers to the pattern
created by the relative positioning of monomer subunits within an
oligomeric compound wherein the pattern is determined by comparing
the sugar groups. The only determinant for the motif of an
oligomeric compound is the differences or lack of differences
between the sugar groups. The internucleoside linkage, heterocyclic
base and further groups such as terminal groups are not considered
when determining the motif of an oligomeric compound. As used
herein the term "sugar group" as it applies to motifs includes
naturally occurring sugars having a furanose ring, sugars having a
modified furanose ring and sugar surrogates wherein the furanose
ring has been replaced with another ring system such as for example
a morpholino or hexitol ring system. When each sugar group is the
same (either modified furanose or surrogate ring system) the motif
is termed uniformly fully modified. When two or more types of sugar
groups are present the motif is defined by the pattern created from
the positioning of monomer subunits having one type of sugar group
relative to the positioning of monomer subunits having different
types of sugar groups within an oligomeric compound.
[0153] Illustrative examples of some different types of sugar
groups useful in the preparation of oligomeric compounds having
motifs include without limitation, .beta.-D-ribose,
.beta.-D-2'-deoxyribose, substituted sugars (such as 2', 5' and bis
substituted sugars), 4'-S-sugars (such as 4'-S-ribose,
4'-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic
modified sugars (such as the 2'-O--CH.sub.2-4' or
2'-O--(CH.sub.2).sub.2-4' bridged ribose derived bicyclic sugars)
and sugar surrogates (such as when the ribose ring has been
replaced with a morpholino or a hexitol ring system). The type of
heterocyclic base and internucleoside linkage used at each position
is variable and is not a factor in determining the motif. The
presence of one or more other groups including but not limited to
capping groups, conjugate groups and other 5' or 3'-terminal groups
is also not a factor in determining the motif
[0154] Representative U.S. patents that teach the preparation of
motifs include without limitation, U.S. Pat. Nos. 5,013,830;
5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133;
5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain
of which are commonly owned with the instant application, and each
of which is herein incorporated by reference in its entirety.
Motifs are also disclosed in International Applications
PCT/US2005/019219, filed Jun. 2, 2005 and published as WO
2005/121371 on Dec. 22, 2005 and PCT/US2005/019220, filed Jun. 2,
2005 and published as WO 2005/121372 on Dec. 22, 2005; each of
which is incorporated by reference herein in its entirety.
[0155] As used herein the term "alternating motif" refers to a an
oligomeric compound comprising a contiguous sequence of linked
monomer subunits wherein the monomer subunits have two different
types of sugar groups that alternate for essentially the entire
sequence of the oligomeric compound. Oligomeric compounds having an
alternating motif can be described by the formula:
5'-A(-L-B-L-A).sub.n(-L-B).sub.nn-3' where A and B are monomer
subunits that have different sugar groups, each L is,
independently, an internucleoside linking group, n is from about 4
to about 12 and nn is 0 or 1. The heterocyclic base and
internucleoside linkage is independently variable at each position.
The motif further optionally includes the use of one or more other
groups including but not limited to capping groups, conjugate
groups and other 5' or 3'-terminal groups. This permits alternating
oligomeric compounds from about 9 to about 26 monomer subunits in
length. This length range is not meant to be limiting as longer and
shorter oligomeric compounds are also amenable to oligomeric
compounds provided herein. In certain embodiments, each A or each B
comprise bicyclic nucleosides as provided herein.
[0156] As used herein the term "uniformly fully modified motif"
refers to an oligomeric compound comprising a contiguous sequence
of linked monomer subunits that each have the same type of sugar
group. The heterocyclic base and internucleoside linkage is
independently variable at each position. The motif further
optionally includes the use of one or more other groups including
but not limited to capping groups, conjugate groups and other 5' or
3'-terminal groups. In certain embodiments, the uniformly fully
modified motif includes a contiguous sequence of bicyclic
nucleosides. In certain embodiments, one or both of the 5' and
3'-ends of the contiguous sequence of bicyclic nucleosides,
comprise 5' or 3'-terminal groups such as one or more unmodified
nucleosides.
[0157] As used herein the term "hemimer motif" refers to an
oligomeric compound comprising a contiguous sequence of monomer
subunits that each have the same type of sugar group with a further
short contiguous sequence of monomer subunits located at the 5' or
the 3' end that have a different type of sugar group. The
heterocyclic base and internucleoside linkage is independently
variable at each position. The motif further optionally includes
the use of one or more other groups including but not limited to
capping groups, conjugate groups and other 5' or 3'-terminal
groups. In general, a hemimer is an oligomeric compound of uniform
sugar groups further comprising a short region (1, 2, 3, 4 or about
5 monomer subunits) having uniform but different sugar groups
located on either the 3' or the 5' end of the oligomeric
compound.
[0158] In certain embodiments, the hemimer motif comprises a
contiguous sequence of from about 10 to about 28 monomer subunits
having one type of sugar group with from 1 to 5 or from 2 to about
5 monomer subunits having a second type of sugar group located at
one of the termini. In certain embodiments, the hemimer is a
contiguous sequence of from about 8 to about 20
.beta.-D-2'-deoxyribonucleosides having from 1-12 contiguous
bicyclic nucleosides located at one of the termini. In certain
embodiments, the hemimer is a contiguous sequence of from about 8
to about 20 .beta.-D-2'-deoxyribonucleosides having from 1-5
contiguous bicyclic nucleosides located at one of the termini. In
certain embodiments, the hemimer is a contiguous sequence of from
about 12 to about 18 .beta.-D-2'-deoxyribonucleosides having from
1-3 contiguous bicyclic nucleosides located at one of the termini.
In certain embodiments, the hemimer is a contiguous sequence of
from about 10 to about 14 .beta.-D-2'-deoxyribonucleosides having
from 1-3 contiguous bicyclic nucleosides located at one of the
termini.
[0159] As used herein the terms "blockmer motif" and "blockmer"
refer to an oligomeric compound comprising an otherwise contiguous
sequence of monomer subunits wherein the sugar groups of each
monomer subunit is the same except for an interrupting internal
block of contiguous monomer subunits having a different type of
sugar group. The heterocyclic base and internucleoside linkage is
independently variable at each position of a blockmer. The motif
further optionally includes the use of one or more other groups
including but not limited to capping groups, conjugate groups and
other 5' or 3'-terminal groups. A blockmer overlaps somewhat with a
gapmer in the definition but typically only the monomer subunits in
the block have non-naturally occurring sugar groups in a blockmer
and only the monomer subunits in the external regions have
non-naturally occurring sugar groups in a gapmer with the remainder
of monomer subunits in the blockmer or gapmer being
.beta.-D-2'-deoxyribonucleosides or .beta.-D-ribonucleosides. In
certain embodiments, blockmers are provided herein wherein all of
the monomer subunits comprise non-naturally occurring sugar
groups.
[0160] As used herein the term "positionally modified motif" is
meant to include an otherwise contiguous sequence of monomer
subunits having one type of sugar group that is interrupted with
two or more regions of from 1 to about 5 contiguous monomer
subunits having another type of sugar group. Each of the two or
more regions of from 1 to about 5 contiguous monomer subunits are
independently uniformly modified with respect to the type of sugar
group. In certain embodiments, each of the two or more regions have
the same type of sugar group. In certain embodiments, each of the
two or more regions have a different type of sugar group. In
certain embodiments, each of the two or more regions,
independently, have the same or a different type of sugar group.
The heterocyclic base and internucleoside linkage is independently
variable at each position of a positionally modified oligomeric
compound. The motif further optionally includes the use of one or
more other groups including but not limited to capping groups,
conjugate groups and other 5' or 3'-terminal groups. In certain
embodiments, positionally modified oligomeric compounds are
provided comprising a sequence of from 8 to 20
.beta.-D-2'-deoxyribonucleosides that further includes two or three
regions of from 2 to about 5 contiguous bicyclic nucleosides each.
Positionally modified oligomeric compounds are distinguished from
gapped motifs, hemimer motifs, blockmer motifs and alternating
motifs because the pattern of regional substitution defined by any
positional motif does not fit into the definition provided herein
for one of these other motifs. The term positionally modified
oligomeric compound includes many different specific substitution
patterns.
[0161] As used herein the term "gapmer" or "gapped oligomeric
compound" refers to an oligomeric compound having two external
regions or wings and an internal region or gap. The three regions
form a contiguous sequence of monomer subunits with the sugar
groups of the external regions being different than the sugar
groups of the internal region and wherein the sugar group of each
monomer subunit within a particular region is essentially the same.
In certain embodiments, each monomer subunit within a particular
region has the same sugar group. When the sugar groups of the
external regions are the same the gapmer is a symmetric gapmer and
when the sugar group used in the 5'-external region is different
from the sugar group used in the 3'-external region, the gapmer is
an asymmetric gapmer. In certain embodiments, the external regions
are small (each independently 1, 2, 3, 4 or about 5 monomer
subunits) and the monomer subunits comprise non-naturally occurring
sugar groups with the internal region comprising
.beta.-D-2'-deoxyribonucleosides. In certain embodiments, the
external regions each, independently, comprise from 1 to about 5
monomer subunits having non-naturally occurring sugar groups and
the internal region comprises from 6 to 18 unmodified nucleosides.
The internal region or the gap generally comprises
.beta.-D-2'-deoxyribonucleosides but can comprise non-naturally
occurring sugar groups. The heterocyclic base and internucleoside
linkage is independently variable at each position of a gapped
oligomeric compound. The motif further optionally includes the use
of one or more other groups including but not limited to capping
groups, conjugate groups and other 5' or 3'-terminal groups.
[0162] In certain embodiments, the gapped oligomeric compounds
comprise an internal region of .beta.-D-2'-deoxyribonucleosides
with one of the external regions comprising bicyclic nucleosides as
disclosed herein. In certain embodiments, the gapped oligomeric
compounds comprise an internal region of
.beta.-D-2'-deoxyribonucleosides with both of the external regions
comprising bicyclic nucleosides as provided herein. In certain
embodiments, gapped oligomeric compounds are provided herein
wherein all of the monomer subunits comprise non-naturally
occurring sugar groups.
[0163] In certain embodiments, gapped oligomeric compounds are
provided comprising one or two bicyclic nucleosides at the 5'-end,
two or three bicyclic nucleosides at the 3'-end and an internal
region of from 10 to 16 .beta.-D-2'-deoxyribonucleosides. In
certain embodiments, gapped oligomeric compounds are provided
comprising one bicyclic nucleoside at the 5'-end, two bicyclic
nucleosides at the 3'-end and an internal region of from 10 to 16
.beta.-D-2'-deoxyribonucleosides. In certain embodiments, gapped
oligomeric compounds are provided comprising one bicyclic
nucleosides at the 5'-end, two bicyclic nucleosides at the 3'-end
and an internal region of from 10 to 14
.beta.-D-2'-deoxyribonucleosides.
[0164] In certain embodiments, gapped oligomeric compounds are
provided that are from about 10 to about 21 monomer subunits in
length. In certain embodiments, gapped oligomeric compounds are
provided that are from about 12 to about 16 monomer subunits in
length. In certain embodiments, gapped oligomeric compounds are
provided that are from about 12 to about 14 monomer subunits in
length.
[0165] The terms "substituent" and "substituent group," as used
herein, are meant to include groups that are typically added to
other groups or parent compounds to enhance desired properties or
provide other desired effects. Substituent groups can be protected
or unprotected and can be added to one available site or to many
available sites in a parent compound. Substituent groups may also
be further substituted with other substituent groups and may be
attached directly or via a linking group such as an alkyl or
hydrocarbyl group to a parent compound.
[0166] Substituent groups amenable herein include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido
(--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa),
ureido (--N(R.sub.bb)C(O)--N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb
and R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, H, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0167] In this context, "recursive substituent" means that a
substituent may recite another instance of itself. Because of the
recursive nature of such substituents, theoretically, a large
number may be present in any given claim. One of ordinary skill in
the art of medicinal chemistry and organic chemistry understands
that the total number of such substituents is reasonably limited by
the desired properties of the compound intended. Such properties
include, by way of example and not limitation, physical properties
such as molecular weight, solubility or log P, application
properties such as activity against the intended target and
practical properties such as ease of synthesis.
[0168] Recursive substituents are an intended aspect of the
invention. One of ordinary skill in the art of medicinal and
organic chemistry understands the versatility of such substituents.
To the degree that recursive substituents are present in a claim of
the invention, the total number will be determined as set forth
above.
[0169] The terms "stable compound" and "stable structure" as used
herein are meant to indicate a compound that is sufficiently robust
to survive isolation to a useful degree of purity from a reaction
mixture, and formulation into an efficacious therapeutic agent.
Only stable compounds are contemplated herein.
[0170] The term "alkyl," as used herein, refers to a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0171] The term "alkenyl," as used herein, refers to a straight or
branched hydrocarbon chain radical containing up to twenty four
carbon atoms and having at least one carbon-carbon double bond.
Examples of alkenyl groups include without limitation, ethenyl,
propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as
1,3-butadiene and the like. Alkenyl groups typically include from 2
to about 24 carbon atoms, more typically from 2 to about 12 carbon
atoms with from 2 to about 6 carbon atoms being more preferred.
Alkenyl groups as used herein may optionally include one or more
further substituent groups.
[0172] The term "alkynyl," as used herein, refers to a straight or
branched hydrocarbon radical containing up to twenty four carbon
atoms and having at least one carbon-carbon triple bond. Examples
of alkynyl groups include, without limitation, ethynyl, 1-propynyl,
1-butynyl, and the like. Alkynyl groups typically include from 2 to
about 24 carbon atoms, more typically from 2 to about 12 carbon
atoms with from 2 to about 6 carbon atoms being more preferred.
Alkynyl groups as used herein may optionally include one or more
further substituent groups.
[0173] The term "acyl," as used herein, refers to a radical formed
by removal of a hydroxyl group from an organic acid and has the
general formula --C(O)--X where X is typically aliphatic, alicyclic
or aromatic. Examples include aliphatic carbonyls, aromatic
carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic
sulfinyls, aromatic phosphates, aliphatic phosphates and the like.
Acyl groups as used herein may optionally include further
substituent groups.
[0174] The term "alicyclic" refers to a cyclic ring system wherein
the ring is aliphatic. The ring system can comprise one or more
rings wherein at least one ring is aliphatic. Preferred alicyclics
include rings having from about 5 to about 9 carbon atoms in the
ring. Alicyclic as used herein may optionally include further
substituent groups.
[0175] The term "aliphatic," as used herein, refers to a straight
or branched hydrocarbon radical containing up to twenty four carbon
atoms wherein the saturation between any two carbon atoms is a
single, double or triple bond. An aliphatic group preferably
contains from 1 to about 24 carbon atoms, more typically from 1 to
about 12 carbon atoms with from 1 to about 6 carbon atoms being
more preferred. The straight or branched chain of an aliphatic
group may be interrupted with one or more heteroatoms that include
nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups
interrupted by heteroatoms include without limitation, polyalkoxys,
such as polyalkylene glycols, polyamines, and polyimines. Aliphatic
groups as used herein may optionally include further substituent
groups.
[0176] The term "alkoxy," as used herein, refers to a radical
formed between an alkyl group and an oxygen atom wherein the oxygen
atom is used to attach the alkoxy group to a parent molecule.
Examples of alkoxy groups include without limitation, methoxy,
ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy,
n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used
herein may optionally include further substituent groups.
[0177] The term "aminoalkyl" as used herein, refers to an amino
substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of
the radical forms a covalent bond with a parent molecule. The amino
group can be located at any position and the aminoalkyl group can
be substituted with a further substituent group at the alkyl and/or
amino portions.
[0178] The terms "aralkyl" and "arylalkyl," as used herein, refer
to an aromatic group that is covalently linked to a
C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the
resulting aralkyl (or arylalkyl) group forms a covalent bond with a
parent molecule. Examples include without limitation, benzyl,
phenethyl and the like. Aralkyl groups as used herein may
optionally include further substituent groups attached to the
alkyl, the aryl or both groups that form the radical group.
[0179] The terms "aryl" and "aromatic," as used herein, refer to a
mono- or polycyclic carbocyclic ring system radicals having one or
more aromatic rings. Examples of aryl groups include without
limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl
and the like. Preferred aryl ring systems have from about 5 to
about 20 carbon atoms in one or more rings. Aryl groups as used
herein may optionally include further substituent groups.
[0180] The terms "halo" and "halogen," as used herein, refer to an
atom selected from fluorine, chlorine, bromine and iodine.
[0181] The terms "heteroaryl," and "heteroaromatic," as used
herein, refer to a radical comprising a mono- or poly-cyclic
aromatic ring, ring system or fused ring system wherein at least
one of the rings is aromatic and includes one or more heteroatoms.
Heteroaryl is also meant to include fused ring systems including
systems where one or more of the fused rings contain no
heteroatoms. Heteroaryl groups typically include one ring atom
selected from sulfur, nitrogen or oxygen. Examples of heteroaryl
groups include without limitation, pyridinyl, pyrazinyl,
pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl,
isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl,
quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl,
quinoxalinyl and the like. Heteroaryl radicals can be attached to a
parent molecule directly or through a linking moiety such as an
aliphatic group or hetero atom. Heteroaryl groups as used herein
may optionally include further substituent groups.
[0182] The term "heteroarylalkyl," as used herein, refers to a
heteroaryl group as previously defined that further includes a
covalently attached C.sub.1-C.sub.12 alkyl radical. The alkyl
radical portion of the resulting heteroarylalkyl group is capable
of forming a covalent bond with a parent molecule. Examples include
without limitation, pyridinylmethyl, pyrimidinylethyl,
napthyridinylpropyl and the like. Heteroarylalkyl groups as used
herein may optionally include further substituent groups on one or
both of the heteroaryl or alkyl portions.
[0183] The term "heterocyclic radical" as used herein, refers to a
radical mono-, or poly-cyclic ring system that includes at least
one heteroatom and is unsaturated, partially saturated or fully
saturated, thereby including heteroaryl groups. Heterocyclic is
also meant to include fused ring systems wherein one or more of the
fused rings contain at least one heteroatom and the other rings can
contain one or more heteroatoms or optionally contain no
heteroatoms. A heterocyclic radical typically includes at least one
atom selected from sulfur, nitrogen or oxygen. Examples of
heterocyclic radicals include, [1,3]dioxolanyl, pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl,
morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl,
pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as
used herein may optionally include further substituent groups.
[0184] The term "hydrocarbyl" includes radical groups that comprise
C, O and H. Included are straight, branched and cyclic groups
having any degree of saturation. Such hydrocarbyl groups can
include one or more heteroatoms selected from N, O and S and can be
further mono or poly substituted with one or more substituent
groups.
[0185] The term "mono or poly cyclic structure" as used herein
includes all ring systems selected from single or polycyclic
radical ring systems wherein the rings are fused or linked and is
meant to be inclusive of single and mixed ring systems individually
selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl,
arylalkyl, heterocyclic, heteroaryl, heteroaromatic and
heteroarylalkyl. Such mono and poly cyclic structures can contain
rings that each have the same level of saturation or each,
independently, have varying degrees of saturation including fully
saturated, partially saturated or fully unsaturated. Each ring can
comprise ring atoms selected from C, N, O and S to give rise to
heterocyclic rings as well as rings comprising only C ring atoms
which can be present in a mixed motif such as for example
benzimidazole wherein one ring has only carbon ring atoms and the
fused ring has two nitrogen atoms. The mono or poly cyclic
structures can be further substituted with substituent groups such
as for example phthalimide which has two .dbd.O groups attached to
one of the rings. Mono or poly cyclic structures can be attached to
parent molecules using various strategies such as directly through
a ring atom, through a substituent group or through a bifunctional
linking moiety.
[0186] The term "oxo" refers to the group (.dbd.O).
[0187] Linking groups or bifunctional linking moieties such as
those known in the art are useful for attachment of chemical
functional groups, conjugate groups, reporter groups and other
groups to selective sites in a parent compound such as for example
an oligomeric compound. In general, a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind to
essentially any selected group such as a chemical functional group
or a conjugate group. In some embodiments, the linker comprises a
chain structure or a polymer of repeating units such as ethylene
glycols or amino acid units. Examples of functional groups that are
routinely used in bifunctional linking moieties include without
limitation, electrophiles for reacting with nucleophilic groups and
nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like. Some nonlimiting examples of bifunctional
linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include without limitation, substituted C.sub.1-C.sub.10 alkyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a
nonlimiting list of preferred substituent groups includes hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0188] In certain embodiments, the oligomeric compounds as provided
herein can be modified by covalent attachment of one or more
conjugate groups. In general, conjugate groups modify one or more
properties of the oligomeric compounds they are attached to. Such
oligonucleotide properties include without limitation,
pharmacodynamics, pharmacokinetics, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional linking moiety or linking group to a
parent compound such as an oligomeric compound. A preferred list of
conjugate groups includes without limitation, intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
thioethers, polyethers, cholesterols, thiocholesterols, cholic acid
moieties, folate, lipids, phospholipids, biotin, phenazine,
phenanthridine, anthraquinone, adamantane, acridine, fluoresceins,
rhodamines, coumarins and dyes.
[0189] In certain embodiments, the oligomeric compounds as provided
herein can be modified by covalent attachment of one or more 5' or
3'-terminal groups. The terms "5' or 3'-terminal groups",
"5-terminal group" and "3'-terminal group" as used herein are meant
to include useful groups known to the art skilled that can be
placed on one or both of the 5' and 3'-ends of an oligomeric
compound respectively, for various purposes such as enabling the
tracking of the oligomeric compound (a fluorescent label or other
reporter group), improving the pharmacokinetics or pharmacodynamics
of the oligomeric compound (such as for example: uptake and/or
delivery) or enhancing one or more other desirable properties of
the oligomeric compound (a group for improving nuclease stability
or binding affinity). In certain embodiments, 5' and 3'-terminal
groups include without limitation, modified or unmodified
nucleosides; two or more linked nucleosides that are independently,
modified or unmodified; conjugate groups; capping groups; phosphate
moieties; and protecting groups.
[0190] The term "phosphate moiety" as used herein, refers to a
terminal phosphate group that includes phosphates as well as
modified phosphates. The phosphate moiety can be located at either
terminus but is preferred at the 5'-terminal nucleoside. In one
aspect, the terminal phosphate is unmodified having the formula
--O--P(.dbd.O)(OH)OH. In another aspect, the terminal phosphate is
modified such that one or more of the O and OH groups are replaced
with H, O, S, N(R) or alkyl where R is H, an amino protecting group
or unsubstituted or substituted alkyl. In certain embodiments, the
5' and or 3' terminal group can comprise from 1 to 3 phosphate
moieties that are each, independently, unmodified (di or
tri-phosphates) or modified.
[0191] As used herein, the term "phosphorus moiety" refers to a
group having the formula:
##STR00023##
wherein:
[0192] R.sub.a and R.sub.c are each, independently, OH, SH,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy, amino
or substituted amino; and
[0193] R.sub.b is O or S.
[0194] Phosphorus moieties included herein can be attached to a
monomer, which can be used in the preparation of oligomeric
compounds, wherein the monomer may be attached using O, S, NR.sub.d
or CR.sub.eR.sub.f, wherein R.sub.d includes without limitation H,
C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy,
C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or
substituted acyl, and R.sub.e and R.sub.f each, independently,
include without limitation H, halogen, C.sub.1-C.sub.6 alkyl,
substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or
substituted C.sub.1-C.sub.6 alkoxy. Such linked phosphorus moieties
include without limitation, phosphates, modified phosphates,
thiophosphates, modified thiophosphates, phosphonates, modified
phosphonates, phosphoramidates and modified phosphoramidates.
[0195] The term "protecting group," as used herein, refers to a
labile chemical moiety which is known in the art to protect
reactive groups including without limitation, hydroxyl, amino and
thiol groups, against undesired reactions during synthetic
procedures. Protecting groups are typically used selectively and/or
orthogonally to protect sites during reactions at other reactive
sites and can then be removed to leave the unprotected group as is
or available for further reactions. Protecting groups as known in
the art are described generally in Greene's Protective Groups in
Organic Synthesis, 4th edition, John Wiley & Sons, New York,
2007.
[0196] Groups can be selectively incorporated into oligomeric
compounds as provided herein as precursors. For example an amino
group can be placed into a compound as provided herein as an azido
group that can be chemically converted to the amino group at a
desired point in the synthesis. Generally, groups are protected or
present as precursors that will be inert to reactions that modify
other areas of the parent molecule for conversion into their final
groups at an appropriate time. Further representative protecting or
precursor groups are discussed in Agrawal et al., Protocols for
Oligonucleotide Conjugates, Humana Press; New Jersey, 1994, 26,
1-72.
[0197] The term "orthogonally protected" refers to functional
groups which are protected with different classes of protecting
groups, wherein each class of protecting group can be removed in
any order and in the presence of all other classes (see, Barany et
al., J. Am. Chem. Soc., 1977, 99, 7363-7365; Barany et al., J. Am.
Chem. Soc., 1980, 102, 3084-3095). Orthogonal protection is widely
used in for example automated oligonucleotide synthesis. A
functional group is deblocked in the presence of one or more other
protected functional groups which is not affected by the deblocking
procedure. This deblocked functional group is reacted in some
manner and at some point a further orthogonal protecting group is
removed under a different set of reaction conditions. This allows
for selective chemistry to arrive at a desired compound or
oligomeric compound.
[0198] Examples of hydroxyl protecting groups include without
limitation, acetyl, t-butyl, t-butoxymethyl, methoxymethyl,
tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxyl)ethyl,
p-chlorophenyl, 2,4-dinitrophenyl, benzyl, 2,6-dichlorobenzyl,
diphenylmethyl, p-nitrobenzyl, bis(2-acetoxyethoxy)methyl (ACE),
2-trimethylsilylethyl, trimethylsilyl, triethylsilyl,
t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl,
[(triisopropylsilyl)oxy]methyl (TOM), benzoylformate, chloroacetyl,
trichloroacetyl, trifluoroacetyl, pivaloyl, benzoyl,
p-phenylbenzoyl, 9-fluorenylmethyl carbonate, mesylate, tosylate,
triphenylmethyl (trityl), monomethoxytrityl, dimethoxytrityl (DMT),
trimethoxytrityl, 1(2-fluorophenyl)-4-methoxypiperidin-4-yl (FPMP),
9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl
(MOX). Wherein more commonly used hydroxyl protecting groups
include without limitation, benzyl, 2,6-dichlorobenzyl,
t-butyldimethylsilyl, t-butyldiphenylsilyl, benzoyl, mesylate,
tosylate, dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and
9-(p-methoxyphenyl)xanthine-9-yl (MOX).
[0199] Examples of amino protecting groups include without
limitation, carbamate-protecting groups, such as
2-trimethylsilylethoxycarbonyl (Teoc),
1-methyl-1-(4-biphenylyl)ethoxycarbonyl (Bpoc), t-butoxycarbonyl
(BOC), allyloxycarbonyl (Alloc), 9-fluorenylmethyloxycarbonyl
(Fmoc), and benzyloxycarbonyl (Cbz); amide-protecting groups, such
as formyl, acetyl, trihaloacetyl, benzoyl, and nitrophenylacetyl;
sulfonamide-protecting groups, such as 2-nitrobenzenesulfonyl; and
imine- and cyclic imide-protecting groups, such as phthalimido and
dithiasuccinoyl.
[0200] Examples of thiol protecting groups include without
limitation, triphenylmethyl (trityl), benzyl (Bn), and the
like.
[0201] In certain embodiments, oligomeric compounds as provided
herein can be prepared having one or more optionally protected
phosphorus containing internucleoside linkages. Representative
protecting groups for phosphorus containing internucleoside
linkages such as phosphodiester and phosphorothioate linkages
include .beta.-cyanoethyl, diphenylsilylethyl,
.delta.-cyanobutenyl, cyano p-xylyl (CPX),
N-methyl-N-trifluoroacetyl ethyl (META), acetoxy phenoxy ethyl
(APE) and butene-4-yl groups. See for example U.S. Pat. Nos.
4,725,677 and Re. 34,069 (.beta.-cyanoethyl); Beaucage et al.,
Tetrahedron, 1993, 49(10), 1925-1963; Beaucage et al., Tetrahedron,
1993, 49(46), 10441-10488; Beaucage et al., Tetrahedron, 1992,
48(12), 2223-2311.
[0202] In certain embodiments, compounds having reactive phosphorus
groups are provided that are useful for forming internucleoside
linkages including for example phosphodiester and phosphorothioate
internucleoside linkages. Such reactive phosphorus groups are known
in the art and contain phosphorus atoms in P.sup.III or P.sup.V
valence state including, but not limited to, phosphoramidite,
H-phosphonate, phosphate triesters and phosphorus containing chiral
auxiliaries. In certain embodiments, reactive phosphorus groups are
selected from diisopropylcyanoethoxy phosphoramidite
(--O*--P[N[(CH(CH.sub.3).sub.2].sub.2]O(CH.sub.2).sub.2CN) and
H-phosphonate (--O*--P(.dbd.O)(H)OH), wherein the O* is provided
from the Markush group for the monomer. A preferred synthetic solid
phase synthesis utilizes phosphoramidites (P.sup.III chemistry) as
reactive phosphites. The intermediate phosphite compounds are
subsequently oxidized to the phosphate or thiophosphate (P.sup.V
chemistry) using known methods to yield, phosphodiester or
phosphorothioate internucleoside linkages. Additional reactive
phosphates and phosphites are disclosed in Tetrahedron Report
Number 309 (Beaucage and Iyer, Tetrahedron, 1992, 48,
2223-2311).
[0203] As used herein the term "internucleoside linkage" or
"internucleoside linking group" is meant to include all manner of
internucleoside linking groups known in the art including but not
limited to, phosphorus containing internucleoside linking groups
such as phosphodiester and phosphorothioate, and non-phosphorus
containing internucleoside linking groups such as formacetyl and
methyleneimino. Internucleoside linkages also includes neutral
non-ionic internucleoside linkages such as amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5') and methylphosphonate wherein a
phosphorus atom is not always present.
[0204] In certain embodiments, oligomeric compounds as provided
herein can be prepared having one or more internucleoside linkages
containing modified e.g. non-naturally occurring internucleoside
linkages. The two main classes of internucleoside linkages are
defined by the presence or absence of a phosphorus atom. Modified
internucleoside linkages having a phosphorus atom include without
limitation, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Oligonucleotides having inverted polarity
can comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0205] Representative U.S. patents that teach the preparation of
the above phosphorus containing linkages include without
limitation, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,194,599; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,527,899; 5,536,821;
5,541,306; 5,550,111; 5,563,253; 5,565,555; 5,571,799; 5,587,361;
5,625,050; 5,672,697 and 5,721,218, certain of which are commonly
owned with this application, and each of which is herein
incorporated by reference.
[0206] In certain embodiments, oligomeric compounds as provided
herein can be prepared having one or more non-phosphorus containing
internucleoside linkages. Such oligomeric compounds include without
limitation, those that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having siloxane backbones; sulfide, sulfoxide and
sulfone backbones; formacetyl and thioformacetyl backbones;
methylene formacetyl and thioformacetyl backbones; riboacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH.sub.2 component parts.
[0207] Representative U.S. patents that teach the preparation of
the above oligonucleosides include without limitation, U.S. Pat.
Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; 5,677,439; 5,646,269 and 5,792,608, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0208] As used herein the phrase "neutral internucleoside linkage"
is intended to include internucleoside linkages that are non-ionic.
Neutral internucleoside linkages include without limitation,
phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5').
Further neutral internucleoside linkages include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4,
40-65). Further neutral internucleoside linkages include nonionic
linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0209] The bicyclic nucleosides provided herein can be prepared by
any of the applicable techniques of organic synthesis, as, for
example, illustrated in the examples below. Many such techniques
are well known in the art. However, many of the known techniques
are elaborated in Compendium of Organic Synthetic Methods, John
Wiley & Sons, New York: Vol. 1, Ian T. Harrison and Shuyen
Harrison, 1971; Vol. 2, Ian T. Harrison and Shuyen Harrison, 1974;
Vol. 3, Louis S. Hegedus and Leroy Wade, 1977; Vol. 4, Leroy G.
Wade Jr., 1980; Vol. 5, Leroy G. Wade Jr., 1984; and Vol. 6,
Michael B. Smith; as well as March, J., Advanced Organic Chemistry,
3rd Edition, John Wiley & Sons, New York, 1985; Comprehensive
Organic Synthesis. Selectivity, Strategy & Efficiency in Modern
Organic Chemistry, in 9 Volumes, Barry M. Trost, Editor-in-Chief,
Pergamon Press, New York, 1993; Advanced Organic Chemistry, Part B:
Reactions and Synthesis, 4th Edition; Carey and Sundberg, Kluwer
Academic/Plenum Publishers, New York, 2001; Advanced Organic
Chemistry, Reactions, Mechanisms, and Structure, 2nd Edition,
March, McGraw Hill, 1977; Greene, T. W., and Wutz, P. G. M.,
Protecting Groups in Organic Synthesis, 4th Edition, John Wiley
& Sons, New York, 1991; and Larock, R. C., Comprehensive
Organic Transformations, 2nd Edition, John Wiley & Sons, New
York, 1999.
[0210] The compounds described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric forms that may be defined,
in terms of absolute stereochemistry, as (R)- or (S)-, a or B, or
as (D)- or (L)- such as for amino acids. Included herein are all
such possible isomers, as well as their racemic and optically pure
forms. Optical isomers may be prepared from their respective
optically active precursors by the procedures described above, or
by resolving the racemic mixtures. The resolution can be carried
out in the presence of a resolving agent, by chromatography or by
repeated crystallization or by some combination of these techniques
which are known to those skilled in the art. Further details
regarding resolutions can be found in Jacques, et al., Enantiomers,
Racemates, and Resolutions, John Wiley & Sons, 1981. When the
compounds described herein contain olefinic double bonds, other
unsaturation, or other centers of geometric asymmetry, and unless
specified otherwise, it is intended that the compounds include both
E and Z geometric isomers or cis- and trans-isomers. Likewise, all
tautomeric forms are also intended to be included. The
configuration of any carbon-carbon double bond appearing herein is
selected for convenience only and is not intended to limit a
particular configuration unless the text so states.
[0211] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base moiety. The two most common classes of such
heterocyclic bases are purines and pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. The respective ends of this linear
polymeric structure can be joined to form a circular structure by
hybridization or by formation of a covalent bond. However, open
linear structures are generally desired. Within the oligonucleotide
structure, the phosphate groups are commonly referred to as forming
the internucleoside linkages of the oligonucleotide. The normal
internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester
linkage.
[0212] The term "nucleotide mimetic" as used herein is meant to
include monomers that incorporate into oligomeric compounds with
sugar and linkage surrogate groups, such as for example peptide
nucleic acids (PNA) or morpholinos (linked by
--N(H)--C(.dbd.O)--O--). In general, the heterocyclic base at each
position is maintained for hybridization to a nucleic acid target
but the sugar and linkage is replaced with surrogate groups that
are expected to function similar to native groups but have one or
more enhanced properties.
[0213] As used herein the term "nucleoside mimetic" is intended to
include those structures used to replace the sugar and the base at
one or more positions of an oligomeric compound. Examples of
nucleoside mimetics include without limitation replacement of the
heterocyclic base moiety with a mimetic thereof such as a
phenoxazine moiety (for example the
9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one group, also referred
to as a G-clamp which forms four hydrogen bonds when hybridized
with a guanosine base) and further replacement of the sugar group
with a group such as for example a morpholino, a cyclohexenyl or a
bicyclo[3.1.0]hexyl.
[0214] As used herein the term "modified nucleoside" is meant to
include all manner of modified nucleosides that can be incorporated
into an oligomeric compound using oligomer synthesis. The term is
intended to include modifications made to a nucleoside such as
modified stereochemical configurations, one or more substitutions,
and deletion of groups as opposed to the use of surrogate groups
which are described elsewhere herein. The term includes nucleosides
having a furanose sugar (or 4'-S analog) portion and can include a
heterocyclic base or can include an abasic site. One group of
representative modified nucleosides includes without limitation,
substituted nucleosides (such as 2', 5', and/or 4' substituted
nucleosides) 4'-S-modified nucleosides, (such as
4'-S-ribonucleosides, 4'-S-2'-deoxyribonucleosides and
4'-S-2'-substituted ribonucleosides), bicyclic modified nucleosides
(such as for example, bicyclic nucleosides wherein the sugar group
has a 2'-O--CHR.sub.a-4' bridging group, wherein R.sub.a is H,
alkyl or substituted alkyl) and base modified nucleosides. The
sugar can be modified with more than one of these modifications
listed such as for example a bicyclic modified nucleoside further
including a 5'-substitution or a 5' or 4' substituted nucleoside
further including a 2' substituent. The term modified nucleoside
also includes combinations of these modifications such as a base
and sugar modified nucleosides. These modifications are meant to be
illustrative and not exhaustive as other modifications are known in
the art and are also envisioned as possible modifications for the
modified nucleosides described herein.
[0215] As used herein the term "monomer subunit" is meant to
include all manner of monomer units that are amenable to oligomer
synthesis with one preferred list including monomer subunits such
as .beta.-D-ribonucleosides, .beta.-D-2'-deoxyribnucleosides,
modified nucleosides, including substituted nucleosides (such as
2', 5' and bis substituted nucleosides), 4'-S-modified nucleosides,
(such as 4'-S-ribonucleosides, 4'-S-2'-deoxyribonucleosides and
4'-S-2'-substituted ribonucleosides), bicyclic modified nucleosides
(such as bicyclic nucleosides wherein the sugar group has a
2'-O--CHR.sub.a-4' bridging group, wherein R.sub.a is H, alkyl or
substituted alkyl), other modified nucleosides, nucleoside
mimetics, nucleosides having sugar surrogates and the bicyclic
nucleosides as provided herein.
[0216] The term "oligonucleotide" refers to an oligomer or polymer
of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term
includes oligonucleotides composed of naturally-occurring
nucleobases, sugars and covalent internucleoside linkages. The term
"oligonucleotide analog" refers to oligonucleotides that have one
or more non-naturally occurring portions. Such non-naturally
occurring oligonucleotides are often desired over naturally
occurring forms because of desirable properties such as, for
example, enhanced cellular uptake, enhanced affinity for nucleic
acid target and/or increased stability in the presence of
nucleases.
[0217] The term "oligonucleoside" refers to a sequence of
nucleosides that are joined by internucleoside linkages that do not
have phosphorus atoms. Internucleoside linkages of this type
include short chain alkyl, cycloalkyl, mixed heteroatom alkyl,
mixed heteroatom cycloalkyl, one or more short chain heteroatomic
and one or more short chain heterocyclic. These internucleoside
linkages include without limitation, siloxane, sulfide, sulfoxide,
sulfone, acetyl, formacetyl, thioformacetyl, methylene formacetyl,
thioformacetyl, alkeneyl, sulfamate, methyleneimino,
methylenehydrazino, sulfonate, sulfonamide, amide and others having
mixed N, O, S and CH.sub.2 component parts.
[0218] The terms "heterocyclic base moiety" and "nucleobase" as
used herein, include unmodified or naturally occurring nucleobases,
modified or non-naturally occurring nucleobases as well as
synthetic mimetics thereof (such as for example phenoxazines). In
general, a heterocyclic base moiety is heterocyclic system that
contains one or more atoms or groups of atoms capable of hydrogen
bonding to a base of a nucleic acid.
[0219] As used herein the terms, "unmodified nucleobase" and
"naturally occurring nucleobase" include the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) and uracil (U). Modified nucleobases include other synthetic
and natural nucleobases such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine
and other alkynyl derivatives of pyrimidine bases, 6-azo uracil,
cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil,
8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other
8-substituted adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine,
3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic
bases, promiscuous bases, size-expanded bases, and fluorinated
bases as defined herein. Further modified nucleobases include
tricyclic pyrimidines such as phenoxazine
cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0220] The heterocyclic base moiety of each of the bicyclic
nucleosides can be modified with one or more substituent groups to
enhance one or more properties such as affinity for a target strand
or affect some other property in an advantageous manner. Modified
nucleobases include without limitation, universal bases,
hydrophobic bases, promiscuous bases, size-expanded bases, and
fluorinated bases as defined herein. Certain of these nucleobases
are particularly useful for increasing the binding affinity of the
oligomeric compounds as provided herein. These include
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Antisense Research and
Applications, Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds.,
CRC Press, Boca Raton, 1993, 276-278).
[0221] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include without limitation, U.S.
Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617;
5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and
6,005,096, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0222] In general, the term "oligomeric compound" refers to a
contiguous sequence of linked monomer subunits. In general, each
linked monomer subunit is directly or indirectly attached to a
heterocyclic base moiety but abasic sites are also possible. At
least some and generally most if not essentially all of the
heterocyclic bases in an oligomeric compound are capable of
hybridizing to a nucleic acid molecule, normally a preselected RNA
target. The term "oligomeric compound" therefore includes
oligonucleotides, oligonucleotide analogs and oligonucleosides. It
also includes polymers having a plurality of non-naturally
occurring nucleoside mimetics and or nucleosides having sugar
surrogate groups. In certain embodiments, oligomeric compounds
comprise a plurality of monomer subunits independently selected
from naturally occurring nucleosides, non-naturally occurring
nucleosides, modified nucleosides, nucleoside mimetics, and
nucleosides having sugar surrogate groups.
[0223] When preparing oligomeric compounds having specific motifs
as disclosed herein it can be advantageous to mix non-naturally
occurring monomer subunits such as the bicyclic nucleosides as
provided herein with other non-naturally occurring monomer
subunits, naturally occurring monomer subunits (nucleosides) or
mixtures thereof. In certain embodiments, oligomeric compounds are
provided herein comprising a contiguous sequence of linked monomer
subunits wherein at least one monomer subunit is a bicyclic
nucleoside as provided herein. In certain embodiments, oligomeric
compounds are provided comprising a plurality of bicyclic
nucleosides as provided herein.
[0224] Oligomeric compounds are routinely prepared linearly but can
also be joined or otherwise prepared to be circular and/or can be
prepared to include branching. Oligomeric compounds can form double
stranded constructs such as for example two strands hybridized to
form a double stranded composition. Double stranded compositions
can be linked or separate and can include various other groups such
as conjugates and/or overhangs on the ends.
[0225] Oligomeric compounds provided herein can optionally contain
one or more nucleosides wherein the sugar group has been modified.
Such sugar modified nucleosides may impart enhanced nuclease
stability, increased binding affinity or some other beneficial
biological property to the oligomeric compounds. As used herein the
term "modified sugar" refers to modifications that can be made to
the furanose sugar portion of otherwise unmodified or modified
nucleosides useful herein. Such modified sugars include without
limitation substitution with one or more substituent groups,
bridging of two non-geminal ring carbon atoms to form a bicyclic
nucleoside or substitution of the 4'-O atom with a disubstituted
methylene group [C(R).sub.2] or a heteroatom or substituted
heteroatom (NR). Modified sugar moieties can also comprise mixtures
of these modifications such as for example putting a 5'-substituent
group on a bicyclic nucleoside.
[0226] Examples of substituent groups useful for modifying sugar
moieties of nucleosides include without limitation 2'-F, 2'-allyl,
2'-amino, 2'-azido, 2'-thio, 2'-O-allyl, 2'-OCF.sub.3,
2'-O--C.sub.1-C.sub.10 alkyl, 2'-O--CH.sub.3, OCF.sub.3,
2'-O--CH.sub.2CH.sub.3, 2'-O--(CH.sub.2).sub.2CH.sub.3,
2'-O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
2'-O--CH.sub.2--CH.dbd.CH.sub.2 (MOE),
2'-O--(CH.sub.2).sub.3--N(R.sub.m)(R.sub.n),
2'-O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
2'-O--(CH.sub.2).sub.2--O--(CH.sub.2).sub.2--N(R.sub.m)(R.sub.n),
2'-O--CH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n),
2'-O--CH.sub.2C(.dbd.O)--N(H)--(CH.sub.2).sub.2--N(R.sub.m)(R.sub.n)
and 2'-O--CH.sub.2--N(H)--C(.dbd.NR.sub.m)[N(R.sub.m)(R.sub.n)],
5'-vinyl, 5'-methyl (R or S) and 4'-S wherein each R.sub.m and
R.sub.n is, independently, H, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl or a protecting group. Further examples of
modified sugar moieties include without limitation bicyclic sugars
(e.g. bicyclic nucleic acids or bicyclic nucleosides discussed
below).
[0227] Combinations of these modifications are also provided for
herein without limitation, such as 2'-F-5'-methyl substituted
nucleosides (see PCT International Application WO 2008/101157
Published on Aug. 21, 2008 for other disclosed 5',2'-bis
substituted nucleosides) and replacement of the ribosyl ring oxygen
atom with S and further substitution at the 2'-position (see
published U.S. Patent Application US2005-0130923, published on Jun.
16, 2005) or alternatively 5'-substitution of a bicyclic nucleic
acid (see PCT International Application WO 2007/134181, published
on Nov. 22, 2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is
further substituted at the 5' position with a 5'-methyl or a
5'-vinyl group).
[0228] As used herein the terms "bicyclic nucleic acid" and
"bicyclic nucleoside" refer to nucleosides wherein the sugar
portion of the nucleoside is bicyclic (e.g. bicyclic sugar). In
certain embodiments, a bicyclic nucleic acid comprises a nucleoside
wherein the furanose ring comprises a bridge between two
non-geminal ring carbon atoms. Examples of bicyclic nucleosides
include without limitation nucleosides comprising a bridge between
the 4' and the 2' ribosyl ring atoms. In certain embodiments,
oligomeric compounds provided herein include one or more bicyclic
nucleosides wherein the bridge comprises one of the formulae:
4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2;
4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' and
4'-CH(CH.sub.2OCH.sub.3)--O-2' (and analogs thereof see U.S. Pat.
No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' (and analogs thereof see published
International Application WO/2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' (and analogs thereof see published
International Application WO/2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see published U.S. Patent
Application US2004-0171570, published Sep. 2, 2004);
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23,
2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see Chattopadhyaya, et al.,
J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' (and analogs thereof see published
International Application WO 2008/154401, published on Dec. 8,
2008). Each of the foregoing bicyclic nucleosides can be prepared
having one or more stereochemical sugar configurations including
for example .alpha.-L-ribofuranose and .beta.-D-ribofuranose (see
PCT international application PCT/DK98/00393, published on Mar. 25,
1999 as WO 99/14226).
[0229] As used herein the term "sugar surrogate" refers to
replacement of the nucleoside furanose ring with a non-furanose (or
4'-substituted furanose) group with another structure such as
another ring system or open system. Such structures can be as
simple as a six membered ring as opposed to the five membered
furanose ring or can be more complicated as is the case with the
non-ring system used in peptide nucleic acid. The term is meant to
include replacement of the sugar group with all manner of sugar
surrogates know in the art and includes without limitation sugar
surrogate groups such as morpholinos, cyclohexenyls and
cyclohexitols. In most monomer subunits having a sugar surrogate
group the heterocyclic base moiety is generally maintained to
permit hybridization.
[0230] In certain embodiments, nucleosides having sugar surrogate
groups include without limitation, replacement of the ribosyl ring
with a surrogate ring system such as a tetrahydropyranyl ring
system (also referred to as hexitol) as illustrated below:
##STR00024##
[0231] Many other monocyclic, bicyclic and tricyclic ring systems
are known in the art and are suitable as sugar surrogates that can
be used to modify nucleosides for incorporation into oligomeric
compounds as provided herein (see for example review article:
Leumann, Christian J.). Such ring systems can undergo various
additional substitutions to further enhance their activity.
[0232] Some representative U.S. patents that teach the preparation
of such modified sugars include without limitation, U.S. Pat. Nos.
4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137;
5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722;
5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633;
5,700,920; 5,792,847 and 6,600,032 and International Application
PCT/US2005/019219, filed Jun. 2, 2005 and published as WO
2005/121371 on Dec. 22, 2005 certain of which are commonly owned
with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0233] Those skilled in the art, having possession of the present
disclosure will be able to prepare oligomeric compounds, comprising
a contiguous sequence of linked monomer subunits, of essentially
any viable length to practice the methods disclosed herein. Such
oligomeric compounds will include at least one and preferably a
plurality of the bicyclic nucleosides provided herein and may also
include other monomer subunits including but not limited to
nucleosides, modified nucleosides, nucleosides comprising sugar
surrogate groups and nucleoside mimetics.
[0234] In certain embodiments, oligomeric compounds provided herein
comprise from about 8 to about 80 monomer subunits in length. One
having ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52,
53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,
70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 monomer subunits in
length, or any range therewithin.
[0235] In certain embodiments, oligomeric compounds provided herein
comprise from about 8 to 40 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39 or 40 monomer subunits in length, or any range
therewithin.
[0236] In certain embodiments, oligomeric compounds provided herein
comprise from about 8 to 20 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19 or 20 monomer subunits in length, or any range therewithin.
[0237] In certain embodiments, oligomeric compounds provided herein
comprise from about 8 to 16 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomer
subunits in length, or any range therewithin.
[0238] In certain embodiments, oligomeric compounds provided herein
comprise from about 10 to 14 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 10, 11, 12, 13 or 14 monomer subunits in
length, or any range therewithin.
[0239] In certain embodiments, oligomeric compounds provided herein
comprise from about 10 to 18 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 10, 11, 12, 13, 14, 15, 16, 17 or 18
monomer subunits in length, or any range therewithin.
[0240] In certain embodiments, oligomeric compounds provided herein
comprise from about 10 to 21 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
or 21 monomer subunits in length, or any range therewithin.
[0241] In certain embodiments, oligomeric compounds provided herein
comprise from about 12 to 14 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 12, 13 or 14 monomer subunits in length, or
any range therewithin.
[0242] In certain embodiments, oligomeric compounds provided herein
comprise from about 12 to 18 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 12, 13, 14, 15, 16, 17 or 18 monomer
subunits in length, or any range therewithin.
[0243] In certain embodiments, oligomeric compounds provided herein
comprise from about 12 to 21 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21
monomer subunits in length, or any range therewithin.
[0244] In certain embodiments, oligomeric compounds provided herein
comprise from about 14 to 18 monomer subunits in length. One having
ordinary skill in the art will appreciate that this embodies
oligomeric compounds of 14, 15, 16, 17 or 18 monomer subunits in
length, or any range therewithin.
[0245] In certain embodiments, oligomeric compounds of any of a
variety of ranges of lengths of linked monomer subunits are
provided. In certain embodiments, oligomeric compounds are provided
consisting of X--Y linked monomer subunits, where X and Y are each
independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50;
provided that X<Y. For example, in certain embodiments, this
provides oligomeric compounds comprising: 8-9, 8-10, 8-11, 8-12,
8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23,
8-24, 8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11, 9-12, 9-13,
9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24,
9-25, 9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12, 10-13, 10-14,
10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23,
10-24, 10-25, 10-26, 10-27, 10-28, 10-29, 10-30, 11-12, 11-13,
11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22,
11-23, 11-24, 11-25, 11-26, 11-27, 11-28, 11-29, 11-30, 12-13,
12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22,
12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14,
13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23,
13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16,
14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25,
14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19,
15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28,
15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23,
16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19,
17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28,
17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25,
18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23,
19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 20-21, 20-22,
20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22,
21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23,
22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25,
23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28,
24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28,
26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked
monomer subunits.
[0246] In certain embodiments, the ranges for the oligomeric
compounds listed herein are meant to limit the number of monomer
subunits in the oligomeric compounds, however such oligomeric
compounds may further include 5' and/or 3'-terminal groups
including but not limited to protecting groups such as hydroxyl
protecting groups, optionally linked conjugate groups and/or other
substituent groups.
[0247] In certain embodiments, the preparation of oligomeric
compounds as disclosed herein is performed according to literature
procedures for DNA: Protocols for Oligonucleotides and Analogs,
Agrawal, Ed., Humana Press, 1993, and/or RNA: Scaringe, Methods,
2001, 23, 206-217; Gait et al., Applications of Chemically
synthesized RNA in RNA:Protein Interactions, Smith, Ed., 1998,
1-36; Gallo et al., Tetrahedron, 2001, 57, 5707-5713. Additional
methods for solid-phase synthesis may be found in Caruthers U.S.
Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679;
and 5,132,418; and Koster U.S. Pat. Nos. 4,725,677 and Re.
34,069.
[0248] Oligomeric compounds are routinely prepared using solid
support methods as opposed to solution phase methods. Commercially
available equipment commonly used for the preparation of oligomeric
compounds that utilize the solid support method is sold by several
vendors including, for example, Applied Biosystems (Foster City,
Calif.). Any other means for such synthesis known in the art may
additionally or alternatively be employed. Suitable solid phase
techniques, including automated synthesis techniques, are described
in Oligonucleotides and Analogues, a Practical Approach, F.
Eckstein, Ed., Oxford University Press, New York, 1991.
[0249] The synthesis of RNA and related analogs relative to the
synthesis of DNA and related analogs has been increasing as efforts
in RNA interference and micro RNA increase. The primary RNA
synthesis strategies that are presently being used commercially
include 5'-O-DMT-2'-O-t-butyldimethylsilyl (TBDMS),
5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-methoxypiperidin-4-yl] (FPMP),
2'-O-[(triisopropylsilyl)oxy]methyl
(2'-O--CH.sub.2--O-Si(iPr).sub.3 (TOM) and the 5'-O-silyl
ether-2'-ACE (5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether
(DOD)-2'-O-bis(2-acetoxyethoxy)methyl (ACE). A current list of some
of the major companies currently offering RNA products include
Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri
Biotechnologies Inc., and Integrated DNA Technologies, Inc. One
company, Princeton Separations, is marketing an RNA synthesis
activator advertised to reduce coupling times especially with TOM
and TBDMS chemistries. The primary groups being used for commercial
RNA synthesis are: TBDMS: 5'-O-DMT-2'-O-t-butyldimethylsilyl; TOM:
2'-O-[(triisopropylsilyl)oxy]methyl; DOD/ACE:
(5'-O-bis(trimethylsiloxy)cyclododecyloxysilyl
ether-2'-O-bis(2-acetoxyethoxy)methyl; and FPMP:
5'-O-DMT-2'-O-[1(2-fluorophenyl)-4-ethoxypiperidin-4-yl]. In
certain embodiments, each of the aforementioned RNA synthesis
strategies can be used herein. In certain embodiments, the
aforementioned RNA synthesis strategies can be performed together
in a hybrid fashion e.g. using a 5'-protecting group from one
strategy with a 2'-O-protecting from another strategy.
[0250] As used herein the term "hybridization" includes the pairing
of complementary strands of oligomeric compounds such as including
the binding of an oligomeric compound as provided herein to a
target nucleic acid. In certain embodiments, the mechanism of
pairing involves hydrogen bonding, which may be Watson-Crick,
Hoogsteen or reversed Hoogsteen hydrogen bonding, between
complementary heterocyclic base moieties of nucleosides (or monomer
subunits) that are in close enough proximity to hydrogen bond. For
example, adenine and thymine are complementary nucleobases which
pair through the formation of hydrogen bonds. Hybridization can
occur under varying circumstances.
[0251] An oligomeric compound is specifically hybridizable when
binding of the compound to the target nucleic acid interferes with
the normal function of the target nucleic acid resulting in a loss
of activity. To be specifically hybridizable also requires a
sufficient degree of complementarity to avoid non-specific binding
of the oligomeric compound to non-target nucleic acid sequences
under the conditions in which specific binding is desired, i.e.,
under physiological conditions (for in vivo assays or therapeutic
treatment) or other diagnostic conditions (for performing in vitro
assays).
[0252] As used herein the term "complementary," refers to the
capacity for precise pairing of two nucleobases regardless of where
the two nucleobases are located. For example, if a nucleobase at a
certain position of an oligomeric compound is capable of hydrogen
bonding with a nucleobase at a certain position of a target nucleic
acid, the target nucleic acid being a DNA, RNA, or oligonucleotide
molecule, then the position of hydrogen bonding between the
oligonucleotide and the target nucleic acid is considered to be a
complementary position. The oligomeric compound and the further
DNA, RNA, or oligonucleotide molecule are complementary to each
other when a sufficient number of complementary positions in each
molecule are occupied by nucleobases which can hydrogen bond with
each other. Thus, "specifically hybridizable" and "complementary"
are terms which are used to indicate a sufficient degree of precise
pairing or complementarity over a sufficient number of nucleobases
such that stable and specific binding occurs between an oligomeric
compound and its target nucleic acid.
[0253] It is understood in the art that the sequence of an
oligomeric compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. Moreover, an
oligomeric compound may hybridize over one or more segments such
that intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure or hairpin structure).
In certain embodiments, oligomeric compounds can comprise at least
about 70%, at least about 80%, at least about 90%, at least about
95%, or at least about 99% sequence complementarity to a target
region within the target nucleic acid sequence to which they are
targeted. For example, an oligomeric compound in which 18 of 20
nucleobases of the oligomeric compound are complementary to a
target region, and would therefore specifically hybridize, would
represent 90 percent complementarity. In this example, the
remaining noncomplementary nucleobases may be clustered or
interspersed with complementary nucleobases and need not be
contiguous to each other or to complementary nucleobases. As such,
an oligomeric compound which is 18 nucleobases in length having 4
(four) noncomplementary nucleobases which are flanked by two
regions of complete complementarity with the target nucleic acid
would have 77.8% overall complementarity with the target nucleic
acid and would thus fall within this scope. Percent complementarity
of an oligomeric compound with a region of a target nucleic acid
can be determined routinely using BLAST programs (basic local
alignment search tools) and PowerBLAST programs known in the art
(Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and
Madden, Genome Res., 1997, 7, 649-656).
[0254] Further included herein are oligomeric compounds such as
antisense oligomeric compounds, antisense oligonucleotides,
ribozymes, external guide sequence (EGS) oligonucleotides,
alternate splicers, primers, probes, and other oligomeric compounds
which hybridize to at least a portion of the target nucleic acid.
As such, these oligomeric compounds may be introduced in the form
of single-stranded, double-stranded, circular or hairpin oligomeric
compounds and may contain structural elements such as internal or
terminal bulges or loops. Once introduced to a system, the
oligomeric compounds provided herein may elicit the action of one
or more enzymes or structural proteins to effect modification of
the target nucleic acid. Alternatively, the oligomeric compound may
inhibit the activity the target nucleic acid through an
occupancy-based method, thus interfering with the activity of the
target nucleic acid.
[0255] One non-limiting example of such an enzyme is RNAse H, a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded oligomeric
compounds which are "DNA-like" elicit RNAse H. Activation of RNase
H, therefore, results in cleavage of the RNA target, thereby
greatly enhancing the efficiency of oligonucleotide-mediated
inhibition of gene expression. Similar roles have been postulated
for other ribonucleases such as those in the RNase III and
ribonuclease L family of enzymes.
[0256] While one form of oligomeric compound is a single-stranded
antisense oligonucleotide, in many species the introduction of
double-stranded structures, such as double-stranded RNA (dsRNA)
molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. This phenomenon occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing.
[0257] In some embodiments, "suitable target segments" may be
employed in a screen for additional oligomeric compounds that
modulate the expression of a selected protein. "Modulators" are
those oligomeric compounds that decrease or increase the expression
of a nucleic acid molecule encoding a protein and which comprise at
least an 8-nucleobase portion which is complementary to a suitable
target segment. The screening method comprises the steps of
contacting a suitable target segment of a nucleic acid molecule
encoding a protein with one or more candidate modulators, and
selecting for one or more candidate modulators which decrease or
increase the expression of a nucleic acid molecule encoding a
protein. Once it is shown that the candidate modulator or
modulators are capable of modulating (e.g. either decreasing or
increasing) the expression of a nucleic acid molecule encoding a
peptide, the modulator may then be employed herein in further
investigative studies of the function of the peptide, or for use as
a research, diagnostic, or therapeutic agent. In the case of
oligomeric compounds targeted to microRNA, candidate modulators may
be evaluated by the extent to which they increase the expression of
a microRNA target RNA or protein (as interference with the activity
of a microRNA will result in the increased expression of one or
more targets of the microRNA).
[0258] Suitable target segments may also be combined with their
respective complementary oligomeric compounds provided herein to
form stabilized double-stranded (duplexed) oligonucleotides. Such
double stranded oligonucleotide moieties have been shown in the art
to modulate target expression and regulate translation as well as
RNA processing via an antisense mechanism. Moreover, the
double-stranded moieties may be subject to chemical modifications
(Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature,
1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et
al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl.
Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev.,
1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498;
Elbashir et al., Genes Dev., 2001, 15, 188-200). For example, such
double-stranded moieties have been shown to inhibit the target by
the classical hybridization of antisense strand of the duplex to
the target, thereby triggering enzymatic degradation of the target
(Tijsterman et al., Science, 2002, 295, 694-697).
[0259] The oligomeric compounds provided herein can also be applied
in the areas of drug discovery and target validation. In certain
embodiments, provided herein is the use of the oligomeric compounds
and targets identified herein in drug discovery efforts to
elucidate relationships that exist between proteins and a disease
state, phenotype, or condition. These methods include detecting or
modulating a target peptide comprising contacting a sample, tissue,
cell, or organism with one or more oligomeric compounds provided
herein, measuring the nucleic acid or protein level of the target
and/or a related phenotypic or chemical endpoint at some time after
treatment, and optionally comparing the measured value to a
non-treated sample or sample treated with a further oligomeric
compound as provided herein. These methods can also be performed in
parallel or in combination with other experiments to determine the
function of unknown genes for the process of target validation or
to determine the validity of a particular gene product as a target
for treatment or prevention of a particular disease, condition, or
phenotype. In certain embodiments, oligomeric compounds are
provided for use in therapy. In certain embodiments, the therapy is
reducing target messenger RNA.
[0260] As used herein, the term "dose" refers to a specified
quantity of a pharmaceutical agent provided in a single
administration. In certain embodiments, a dose may be administered
in two or more boluses, tablets, or injections. For example, in
certain embodiments, where subcutaneous administration is desired,
the desired dose requires a volume not easily accommodated by a
single injection. In such embodiments, two or more injections may
be used to achieve the desired dose. In certain embodiments, a dose
may be administered in two or more injections to minimize injection
site reaction in an individual.
[0261] In certain embodiments, chemically-modified oligomeric
compounds are provided herein that may have a higher affinity for
target RNAs than does non-modified DNA. In certain such
embodiments, higher affinity in turn provides increased potency
allowing for the administration of lower doses of such compounds,
reduced potential for toxicity, improvement in therapeutic index
and decreased overall cost of therapy.
[0262] Effect of nucleoside modifications on RNAi activity is
evaluated according to existing literature (Elbashir et al.,
Nature, 2001, 411, 494-498; Nishikura et al., Cell, 2001, 107,
415-416; and Bass et al., Cell, 2000, 101, 235-238.)
[0263] In certain embodiments, oligomeric compounds provided herein
can be utilized for diagnostics, therapeutics, prophylaxis and as
research reagents and kits. Furthermore, antisense
oligonucleotides, which are able to inhibit gene expression with
exquisite specificity, are often used by those of ordinary skill to
elucidate the function of particular genes or to distinguish
between functions of various members of a biological pathway. In
certain embodiments, oligomeric compounds provided herein can be
utilized either alone or in combination with other oligomeric
compounds or other therapeutics as tools in differential and/or
combinatorial analyses to elucidate expression patterns of a
portion or the entire complement of genes expressed within cells
and tissues. Oligomeric compounds can also be effectively used as
primers and probes under conditions favoring gene amplification or
detection, respectively. These primers and probes are useful in
methods requiring the specific detection of nucleic acid molecules
encoding proteins and in the amplification of the nucleic acid
molecules for detection or for use in further studies.
Hybridization of oligomeric compounds as provided herein,
particularly the primers and probes, with a nucleic acid can be
detected by means known in the art. Such means may include
conjugation of an enzyme to the oligonucleotide, radiolabelling of
the oligonucleotide or any other suitable detection means. Kits
using such detection means for detecting the level of selected
proteins in a sample may also be prepared.
[0264] As one nonlimiting example, expression patterns within cells
or tissues treated with one or more of the oligomeric compounds
provided herein are compared to control cells or tissues not
treated with oligomeric compounds and the patterns produced are
analyzed for differential levels of gene expression as they
pertain, for example, to disease association, signaling pathway,
cellular localization, expression level, size, structure or
function of the genes examined. These analyses can be performed on
stimulated or unstimulated cells and in the presence or absence of
other compounds and or oligomeric compounds which affect expression
patterns.
[0265] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression)(Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. USA, 2000, 97, 1976-81), protein arrays
and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (To, Comb. Chem. High
Throughput Screen, 2000, 3, 235-41).
[0266] While in certain embodiments, oligomeric compounds provided
herein can be utilized as described, the following examples serve
only to illustrate and are not intended to be limiting.
EXAMPLES
General
[0267] .sup.1H and .sup.13C NMR spectra were recorded on a 300 MHz
and 75 MHz Bruker spectrometer, respectively. Silica gel 60 from EM
Science was used for purification.
Example 1
Preparation of
(1R,3R,4R,7S)-7-(2-cyanoethoxy(diisopropylamino)phosphin
oxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(N-Bz-(Cytidin-1-yl)-2,5-dioxa-b-
icyclo[2.2.2]octane (14 U, 16 C)
##STR00025## ##STR00026##
[0269] Note: Compound 4 was prepared from compound 1 by a slightly
modified version of the procedures found in Tetrahedron Lett.,
1993, 1653 and Tetrahedron, 2004, 6813.
##STR00027##
Compound 1
[0270] The starting material, Compound 1, is prepared according to
the procedure of Moffatt et al, J. Org. Chem., 1979, 44, 1301.
Compound 1 is also commercially available from a number of
vendors.
Compound 2
Alkylation of Diacetone Glucose
[0271] NaH (60% in Mineral oil, 49.2 g, 1.6 equivalents) was added
to a 2 L round bottom flask flushed with nitrogen, and the NaH was
washed with hexanes (2.times.1.0 L) to remove the mineral oil.
After decanting the hexanes, DMF (700 mL) was added and the mixture
was cooled in an ice bath. Diacetone glucose (1, 200 g, 0.77 moles)
was then added over a period of 30 minutes. The ice-bath was
removed and the mixture was stirred for 1 hour at room temperature.
The reaction was then cooled in an ice-bath for second time, and
1-bromomethylnapthylene (187 g, 1.1 equiv) in DMF (100 mL) was
added drop-wise over a 30-minute period. Upon complete addition,
the ice-bath was stirred over night while the ice was allowed to
melt, thereby allowing the reaction to proceed to room temperature.
After 16 hours, the reaction was complete, as determined by tlc
(Rf=0.45, 20% EtOAc/hexanes and visualized by charring after
treatment with anisaldehyde spray reagent). The mixture was then
poured onto cold water (1.5 L) that was placed in an ice bath. The
aqueous layer was extracted with EtOAc (250 mL.times.2) and then
washed successively with saturated NaHCO.sub.3 (1 L), brine (1 L)
and the organic layer was evaporated under reduced pressure to give
a dark brown oil. This oil was dissolved in minimal DCM and passed
through a plug of silica gel eluting with 100% Hexanes (3.0 L) to
remove minor upper impurities, then 20% EtOAc/Hexanes to collect
the major spot. Concentration of the solvent provided the alkylated
product (269 g, 87%) as a brown oil which was used without further
purification.
Selective Cleavage of the Isopropylidine
[0272] The crude oil (269 g, 0.67 moles), was dissolved in acetic
acid (2.2 L) and water (900 mL). The reaction was allowed to
proceed for 16 hours at room temperature. The reaction was follow
by tlc (20% EtOAc/Hexanes). After completion of the reaction, most
of the acetic acid was evaporated under reduced pressure and then
the remaining solution was poured into a stirred mixture of EtOAc
(1 L)/NaHCO.sub.3 (1 L, aq. sat.) in small portions followed by
NaHCO.sub.3 (s) until gas evolution ceased. The organic layer was
washed with water (1 L.times.2), brine (1 L), dried
Na.sub.2SO.sub.4, filtered and removed under reduced pressure to
give a crude yellow oil. The oil was then dissolved in minimal DCM
and passed through a plug of silica gel eluting with 20%
EtOAc/Hexanes (3.0 L) to remove the upper spot impurities, and then
eluted with 80% EtOAc/Hexanes to give the major compound.
Evaporation of the solvent gave the crude product (201 g, 82%) as a
light yellow oil. (Rf=0.22, 20% EtOAc/hexanes).
Selective Silylation of the Primary Hydroxy group
[0273] The crude compound (105 g, 0.293 moles), was dissolved in
anhydrous DMF (1 L) followed by the addition of imidazole (39.9 g,
0.58 moles). The resulting yellow solution was cooled to 0.degree.
C. in ice-bath while stirring under nitrogen.
tert-Butyldimethylsilyl chloride (TBDMSCl, 48.5 ml, 0.322 moles)
dissolved in a minimal amount of DMF was added drop-wise over a
40-minute period. The ice-bath, initially at 0.degree. C. upon
complete addition, was allowed to come to room temperature and
stirring continued for an additional 16 hours. The reaction was
complete at this time, as determined by tlc (Rf=0.56, 20%
EtOAc/hexanes). The reaction was then quenched by addition of MeOH
(50 mL). Water (1 L) and EtOAc (500 mL) were then added and the
organic was washed with, saturated NaHCO.sub.3 (1 L) and brine (1
L) and then dried (Na.sub.2SO.sub.4), filtered and the solvent
removed under reduced pressure to give compound 2 (139.0 g), as a
yellow oil. .sup.1H NMR (300 MHz, CDCl.sub.3+2% D.sub.2O): .delta.
7.7 and 7.4 (m, 7H, Nap), 5.86 (d, 1H, J=3.6 Hz), 4.7 (m, 2H), 4.54
(d, 1H, J=5.7 Hz), 4.08 (s, 2H), 3.9-4.0 (m, 1H), 3.7-3.8 (m, 2H),
1.39 (s, 1H, CH.sub.3), 1.24 (s, 1H, CH.sub.3), 0.82 (s, 9H, tBu),
0.02 (s, 6H, SiMe.sub.2). .sup.13C NMR (75 MHz, CDCl.sub.3+2%
D.sub.2O): .delta. 135.1, 133.3, 133.1, 128.3, 128.0, 127.7, 126.6,
126.2, 126.0, 125.7, 111.7, 105.2, 82.6, 81.9, 79.6, 72.6, 68.6,
64.5, 26.7, 26.3, 25.9, 18.3, -5.4. LCMS (Method CN.sub.1),
retention time=1.8 min, m/z=497.1 (M+Na), >98% purity.
Compound 3
[0274] Oxalyl chloride (12.2 mL, 145 mmoles) and CH.sub.2Cl.sub.2
(280 mL) were added to a 2 L round bottom flask fitted with two
addition funnels. One addition funnel contained DMSO (20.5 mL, 289
mmoles) in CH.sub.2Cl.sub.2 (30 mL), while the other funnel
contained compound 2 (45.75 g, 96.4 mmoles) dissolved in
CH.sub.2Cl.sub.2 (380 mL). The round bottom was then cooled to
-78.degree. C. under nitrogen, and the DMSO solution was added
dropwise over 15 minutes. After stirring an additional 50 minutes,
the solution of compound 2 was added dropwise over 15 min. After
stirring an additional 30 minutes, Et.sub.3N (60 mL, 434 mmoles)
was added over 10 minutes and the reaction was allowed to proceed
at room temperature for 30 minutes. The reaction was then quenched
with NH.sub.4Cl (sat, 150 mL), and the organic layer was washed
successively with 10% citric acid (1 L), sodium bicarbonate (sat, 1
L), and brine (1 L). The organic layer was then dried over
Na.sub.2SO.sub.4, concentrated and filtered thru silica gel (20%
EtOAc/hexanes) to give 42.4 g (93%) of the crude ketone, which was
used directly in the next step without further purification. tlc,
(Rf=0.55, 20% EtOAc/hexanes); LCMS (Method CN.sub.1), retention
time=2.1 min, m/z=473.1 (M+H), 495.1 (M+Na), 967.3 (2M+Na). The
crude ketone (39 g, 82.5 mmoles) in THF (240 mL) was added to a 1 L
round bottom flask equipped with an addition funnel containing 1.0
M vinyl magnesiumbromide in THF (125 mL). The flask was cooled in
an ice bath and the Grignard reagent was then added dropwise over
10 minutes. The reaction was then allowed to proceed at room
temperature for 1.5 h, and quenched with NH.sub.4Cl (sat, 150 mL).
Et.sub.2O (400 mL) was added and the organic layer was washed with
brine (1 L). The organic layer was then passed through a plug of
silica gel (eluting with Et.sub.2O as necessary) and then
concentrated to give a quantitative yield of compound 3, which was
about 90% pure, and used directly in the next step. Rf=0.55, 20%
EtOAc/hexanes; .sup.1H NMR (300 MHz, CDCl.sub.3): .delta. 7.79-7.90
and 7.47-7.56 (m, 7H, Nap), 6.11 (dd, 1H, J=16.2, 9.6 Hz,
.dbd.CH--), 6.08 (d, 1H, J=3.9 Hz, H-1), 5.49 (dd, 1H, J=17.4, 1.5
Hz, .dbd.CH.sub.2); 5.22 (dd, 1H, J=12.3, 1.5 Hz, .dbd.CH.sub.2),
4.91 and 4.72 (ABq, 2H, CH.sub.2), 4.71 (d, 1H, J=4.2 Hz, H-2),
4.38 (d, 1H, J=3.0 Hz, H-4), 4.24 (d, 1H, J=2.7 Hz, H-3), 3.92 (s,
1H, OH), 3.63 (d, 1H, J=9.6 Hz, 6a), 3.47 (d, 1H, J=9.6 Hz, 6b),
1.53 (s, 3H, CH.sub.3), 1.38 (s, 3H, CH.sub.3), 0.86 (s, 9H,
C(CH.sub.3).sub.3), -0.0 (s, 3H, SiMe), -0.08 (s, 3H, SiMe).
.sup.1H NMR matched closely with the OBn derivative from
Tetrahedron Lett., 1993, 1653. LCMS (Method DR1), m/z=501.1 (M+H),
523.2 (M+Na).
Compound 4
Hydrolysis of TBS and Isopropylidine
[0275] To the mostly pure compound 3 (41.3 g, 82.5 mmoles) and
Amberlite (IR-120 H.sup.+ Strongly Acidic ion-exchange resin, 80
g), was added 1,4-dioxane (275 mL) and H.sub.2O (230 mL). This was
heated at 90.degree. C. for 36 hours, and then filtered hot through
celite and evaporated to dryness. The resultant crude solid was
then dried for 12 hours at 50.degree. C. over P.sub.2O.sub.5.
Acetylation of the Hydrolyzed Material
[0276] The crude white solid was treated with pyridine (290 mL) and
Ac.sub.2O (78 mL, 10 equiv) was then added dropwise followed by
DMAP (120 mg). The reaction proceeded at room temperature for 16
hours and then the solvent was evaporated and coevaporated with
toluene (3.times.100 mL). The major product was purified by silica
gel chromatography (25% EtOAc/hexanes to 35% EtOAc/hexanes) to give
the crude tetraacetate, compound 4 (31.4 g, 74%) as a clear white
foam. TLC (Rf=0.27, 40% EtOAc/hexanes). .sup.1H NMR (300 MHz,
CDCl.sub.3): .delta. 7.83-7.79, 7.68, 7.5-7.4, 7.35 and 7.32 (m,
7H, Nap), 5.95-5.87 (m, 3H, CH.dbd.CH and H1), 5.63 (dd, 1H, J=8.7,
3.3 Hz, .dbd.CH), 5.46 (d, 1H, J=9.9 Hz, H4), 5.25 (dd, 1H, J=9.3,
8.4 Hz, H2), 4.76 (s, 2H, CH.sub.2Nap), 4.14 and 3.71 (d, J=12.4
Hz, H6), 3.79 (dd, 1H, J=9.8, 9.8 Hz, H3), 2.10 (s, 6H,
Ac.times.2), 1.95 (s, 3H, Ac), 1.90 (s, 3H, Ac). .sup.13C NMR (75
MHz, CDCl.sub.3+2% D.sub.2O): .delta. 170.7, 169.5, 169.1, 169.0,
135.2, 133.2, 133.0, 129.8, 128.3, 127.9, 127.7, 126.3 (2C), 126.1,
125.5, 122.03, 88.9, 78.5, 78.1, 74.6, 72.6, 69.5, 65.2, 20.9 (3C),
20.8. LCMS (Method CN1), retention time=1.47 min, m/z=537.1 (M+Na),
purity=99%.
Compound 5
Vorbruggen Coupling and Deacetylation
[0277] N,O-Bis(trimethylsilyl)acetamide (BSA, 54.7 mL, 224 mmol)
was added to a stirred suspension of uracil (10.2 g, 90.7 mmol) and
compound 4 (31.1 g, 60.4 mmoles) in dry acetonitrile (300 mL).
After stirring at rt for 30 min a clear solution was observed, and
the reaction was cooled to 0.degree. C. under nitrogen.
Trimethylsilyfluoromethanesulfonate (TMSOTf, 21.9 mL, 121 mmol) was
added and after the reaction was stirred at rt for 15 min, it was
transferred to a preheated oil bath at 80.degree. C. After stirring
for 4 h at 80.degree. C., the reaction was cooled to rt and MeOH
(20 mL), EtOAc (250 mL) and H.sub.2O (400 mL) were added. The
organic phase was then sequentially washed with sat. NaHCO.sub.3,
brine, dried (Na.sub.2SO.sub.4) and concentrated to provide the
crude triacetate. TLC (Rf=0.60, 80% EtOAc/hexanes). LCMS (Method
DRHI), m/z=567.1 (M+H). The crude nucleoside was treated with 7N
MeOH/NH.sub.3 (300 mL) at 50.degree. C. overnight and then
evaporated to dryness. The major product was purified by silica gel
chromatography (2% MeOH/CH.sub.2Cl.sub.2 to 6%
MeOH/CH.sub.2Cl.sub.2) to give the triol compound 5 (17.75 g, 67%)
as a white solid. TLC (Rf=0.25, 8% MeOH/CH.sub.2Cl.sub.2). .sup.1H
NMR (300 MHz, DMSO-d.sub.6/2% D.sub.2O): .delta. 7.9-7.8 (m, 5H,
Nap and H6), 7.62, 7.59, and 7.53-7.46 (m, 3H, Nap), 6.07 (dd, 1H,
J=11.9, 17.3 Hz, C.dbd.CH), 5.68 (d, 1H, J=3.0 Hz, H5), 5.66 (s,
1H, H1'), 5.45-5.39 (m, 2H, C.dbd.CH.sub.2), 4.99 (s, 2H,
CH.sub.2ONap), 3.93 (d, 1H, J=9.6 Hz, H4'), 3.67 (dd, 1H, J=8.9,
8.9 Hz, H2'), 3.43 (dd, 1H, J=9.6, 12.0 Hz, H3'), 3.16 and 3.42 (d,
2H, J=8.9 Hz, 6'-CH.sub.2). .sup.13C NMR (75 MHz, DMSO-d.sub.6/2%
D.sub.2O): .delta. 162.8 (C4), 150.6 (C2), 141.4 (C6), 136.8
(quat), 132.6 (quat), 132.5 (.dbd.CH--), 132.0 (quat), 127.3,
127.2, 127.1, 125.8, 125.7, 125.3,* 117.9 (.dbd.CH.sub.2), 101.6
(C5), 82.3 (C3'), 81.3 (C5'), 77.8 (C1'), 73.5 (CH.sub.2ONap), 71.1
(C2'), 68.4 (C4'), 64.8 (6'-CH.sub.2). *Between 127.3 and 125.3
lies one additional carbon that overlaps one of the others. LCMS
(Method G1), retention time=2.09 min, m/z=463.1 (M+Na), purity
>99%.
Compound 6
Benzylidine Formation
[0278] To a stirred mixture of triol compound 5 (16.1 g, 36.5
mmoles) in dry DMF (180 mL) was added camphorsulphonic acid (CSA,
850 mg) followed by benzaldehyde dimethylacetal (BDMA, 22 mL, 146
mmoles). This was stirred at 50.degree. C., and after two hours
additional CSA (600 mg) and BDMA (6 mL) were added. After an
additional 2 h, the reaction mixture was cooled to rt and
partitioned between EtOAc (300 mL) and a NaHCO.sub.3 (sat)/H.sub.2O
(500 mL, 3:2). The organic layer was then washed with brine twice,
and the aqueous layers were back-extracted with additional portions
of EtOAc. The combined organic layers were dried over
Na.sub.2SO.sub.4, and evaporated to give the crude benzylidine. The
crude product was purified by silica gel chromatography (2%
MeOH/CH.sub.2Cl.sub.2 to 5% MeOH/CH.sub.2Cl.sub.2) to give the
benzylidine compound 6 (18.6 g, 96%) as a white solid. The final
compound contained some DMF as determined by .sup.1H NMR and did
not interfere the subsequent step. TLC (Rf=0.45, 8%
MeOH/CH.sub.2Cl.sub.2). .sup.1H NMR (300 MHz, DMSO-d.sub.6/2%
D.sub.2O): .delta. 7.9-7.8 (m, 5H, Nap and H6), 7.71-7.78 and
7.51-7.41 (m, 8H, Nap, Ph), 6.32 (dd, 3H, J=11.1, 18.2 Hz,
C.dbd.CH), 5.84 (d, 1H, J=9.3 Hz, H1'), 5.77 (s, 1H, benzylidine
CH), 5.72 (d, 1H, J=7.8 Hz, H5), 5.61-5.56 (m, 2H, C.dbd.CH.sub.2),
4.96 (s, 2H, CH.sub.2ONap), 4.06 (d, 1H, J=10.5 Hz, H4'), 4.0-3.7
(m, 4H, H2', H3', and 6'-CH.sub.2). .sup.13C NMR (75 MHz,
DMSO-d.sub.6/2% D.sub.2O): .delta. 162.8 (C4), 150.4 (C2), 140.8
(C6), 136.9 (quat), 136.0 (quat), 134.5 (.dbd.CH--), 132.2 (quat),
131.9 (quat), 128.5, 127.7, 127.1, 127.0, 125.7, 125.5, 125.3,
125.2, 125.1*, 118.0 (.dbd.CH.sub.2), 101.8 (benzylidine CH), 101.2
(C5), 80.8 (CH), 78.6 (C1'), 77.9 (CH), 75.5 (6'-CH.sub.2), 72.9
(CH.sub.2ONap), 71.5 (CH), 70.6 (quat). *Between 128.5 and 125.1
lies one additional carbon that overlaps one of the others. LCMS
(Method G1), retention time=3.70 min, m/z=529.1 (M+H), 551.1
(M+Na), purity >99%.
Compound 7
Dihydroxylation, Periodate Cleavage and Reduction to the
Alcohol
[0279] To as stirred solution of compound 6 (45 g, 85 mmoles) in
95% acetone (aq, 350 mL) was added N-methylmorpholine oxide (48 g,
409 mmoles) and 2.5% OsO.sub.4 in isopropanol (70 mg OsO.sub.4),
and the reaction was allowed to stir at room temperature for 4
days. At that time, the reaction was filtered thru celite and
silica gel, and eluted thouroughly with acetone. The resultant
crude product was purified by column chromatography (2.5% to 5%
methanol/DCM) to give 19.74 g of the diol, which was immediately
treated with THF (175 mL), H.sub.2O (175 mL) and NaIO.sub.4 (15 g,
70 mmoles). After 1 hour, water and EtOAc were added and the
organic was washed with, saturated NaHCO.sub.3 and brine and then
dried (Na.sub.2SO.sub.4), filtered and the solvent removed under
reduced pressure to give the crude aldehyde. This compound was
immediately treated with 4 equivalents of NaBH.sub.4 in methanol at
0.degree. C. for 1 hour, and then water and EtOAc were added and
the organic was washed with, 10% citric acid (aq) and brine and
then dried (Na.sub.2SO.sub.4), filtered and the solvent removed
under reduced pressure to give the crude alcohol. The reaction was
purified by silica gel chromatography, eluting with methanol/DCM to
give compound 7 (40% overall yield). .sup.1H NMR and LCMS was
consistent with structure.
Compound 8
Anhydro Formation
[0280] To a stirred 0.degree. C. mixture of compound 7 (1.28 g, 2.4
mmoles) and triphenyl phosphine (2.2 g, 8.4 mmoles) in dry THF (20
mL) was added DIAD (1.6 mL, 8.4 mmoles) dropwise. After stirring at
room temp for 18 hours, water and DCM were added and the organic
was washed with brine and then dried (Na.sub.2SO.sub.4), filtered
and the solvent removed under reduced pressure to give the crude
bicyclic product. This was purified by silica gel chromatography
(2% methanol/DCM to 10% methanol/DCM) to give the pure compound 8
(1.11 g, 90%). .sup.1H NMR and LCMS was consistent with
structure.
Compound 9 and 10
Ring Closure to the Bicyclo[2.2.2]Octane Ring System
[0281] Compound 8 (1.1 g, 2.15 mmoles) was dissolved in DMF (15 mL)
and treated with NaH (60% in mineral oil, 6.4 mmoles) for 15
minutes. At that time, NH.sub.4Cl and EtOAc were added and the
organic was washed with, water and brine and then dried
(Na.sub.2SO.sub.4), filtered and the solvent removed under reduced
pressure to give the crude compound. This was purified by silica
gel chromatography (3% methanol/DCM) to give the pure compound 9
(866 mg, 79%) and 10 (68 mg), individually. .sup.1H NMR and LCMS
was consistent with structure.
Compound 11
Removal of Nap
[0282] Compound 9 (800 mg, 1.6 mmoles) was dissolved in DCM (15 mL)
and treated with water (1.5 mL) and DDQ (529 mg, 2.3 mmoles). After
stirring for 16 hours, water and DCM were added and the organic was
washed with, saturated NaHCO.sub.3 and brine and then dried
(Na.sub.2SO.sub.4), filtered and the solvent removed under reduced
pressure to give the crude alcohol. The organics were
back-extracted several times with DCM. The crude compound was
co-evaporated with methanol/DCM (10 mL) and silica gel (1 g). After
drying, this was applied directly to a silica gel column, and
purified by silica gel chromatography (2% to 6% methanol/DCM) to
give compound 11 (409 mg, 70%). .sup.1H NMR and LCMS was consistent
with structure.
Compound 12
The Barton-Macombie Deoxygenation
[0283] A stirred mixture of compound 11 (388 mg, 1.04 mmoles) and
DMAP (343 mg, 2.8 mmoles) in CH.sub.3CN (14 mL) at 0.degree. C. was
added phenylchlorothioformate (196 .mu.L, 1.45 mmoles). After
stirring for 4 hours, the reaction mixture was evaporated to
dryness. Toluene (13 mL), Bu.sub.4SnH (1.65 mL, 6.24 mmoles) and
AIBN (15 mg) were heated at 90.degree. C. for 4 hours. The reaction
was then evaporated to dryness, and purified by silica gel
chromatography (1.5% to 3% methanol/DCM) to give compound 12 (254
mg, 68%). .sup.1H NMR and LCMS was consistent with structure.
Compound 13
Removal of the Benzylidine and DMT Protection
[0284] A stirred mixture of compound 12 (230 mg, 0.64 mmoles) was
hydrogenated over 10% Pd/C (20 mg) at 40 psi for 10 hours. The
reaction was filtered and evaporated and co-evaporated with
toluene. After drying under reduced pressure for 16 hours, pyridine
(3 mL) and DMTCl (187 mg, 0.55 mmoles) was added. The reaction was
allowed to stir at room temperature for 4 hours, and water and
EtOAc were added and the organic was washed with, saturated
NaHCO.sub.3 and brine and then dried (Na.sub.2SO.sub.4), filtered
and the solvent removed under reduced pressure. The resultant foam
was purified by silica gel chromatography (10% to 40%
acetone/CH.sub.2Cl.sub.2) to give compound 13 (171 mg, 47%).
.sup.1H NMR and LCMS was consistent with structure.
Compound 14
Preparation of U-Amidite
[0285] 2-Cyanoethyl N,N'-tetraisopropylphosphoramidite (0.75 .mu.L,
0.24 mmol) was added to a solution of compound 13 (90 mg, 0.157
mmol), tetrazole (8 mg), N-methylimidazole (3 .mu.L) in DMF (1 mL).
After stirring for 8 hours at room temperature, the reaction was
poured into EtOAc and the organic phase was washed with 90% brine,
brine, dried (Na.sub.2SO.sub.4) and concentrated under vacuum.
Purification by column chromatography (SiO.sub.2, eluting with 60%
to 90% EtOAc/hexanes) gave Compound 14 (99 mg, 92%) as a white
solid. .sup.1H NMR and LCMS was consistent with structure.
Compound 15
Conversion of U to CBz
[0286] A solution of compound 13 (114 mg, 0.20 mmoles), in
CH.sub.3CN (2 mL) was treated with Et.sub.3N (1.1 mL, 7.96 mmoles)
and cooled to 0.degree. C. TMSCl (76 .mu.L, 0.6 mmoles) was added
and after 1 hour, 1,2,4-triazole (330 mg, 4.8 mmoles) was added
followed by POCl.sub.3 (146 .mu.L, 1.6 mmoles). The reaction was
then allowed to proceed for 4 hours at room temperature. Water and
EtOAc were added and the organic was washed with, saturated
NaHCO.sub.3 and brine and then dried (Na.sub.2SO.sub.4), filtered
and the solvent removed under reduced pressure to give the crude
triazole. A prestirred mixture of NaH (48 mg, 1.2 .mu.moles) and
benzamide (145 mg, 1.2 .mu.moles) was then added. After 1 hour,
water and EtOAc were added and the organic was washed with,
saturated NaHCO.sub.3 and brine and then dried (Na.sub.2SO.sub.4),
filtered and the solvent removed under reduced pressure.
Triethylamine trihydroflouride (166 .mu.L, 1.0 mmol) was added to a
solution of the crude compound and triethylamine (0.06 mL, 0.4
mmol) in THF (1 mL). After stirring at room temperature for 12
hours, the reaction was poured into EtOAc and the organic layer was
washed with H.sub.2O, saturated NaHCO.sub.3, brine, dried
(Na.sub.2SO.sub.4) and concentrated. Purification by column
chromatography (SiO.sub.2, eluting with 20% to 40% acetone in
chloroform) gave Compound 15 (73 mg, 54% overall).
Compound 16
Preparation of CBz Amidite
[0287] 2-Cyanoethyl N,N'-tetraisopropylphosphoramidite (0.50 mL,
0.156 mmol) was added to a solution of compound 15 (70 mg, 1.0
.mu.mol), tetrazole (7 mg), N-methylimidazole (3 .mu.L) in DMF (1
mL). After stirring for 8 hours at room temperature, the reaction
was poured into EtOAc and the organic phase was washed with 90%
brine, brine, dried (Na.sub.2SO.sub.4) and concentrated under
vacuum. Purification by column chromatography (SiO.sub.2, eluting
with 60% to 90% EtOAc/hexanes) gave Compound 16 (62 mg, 68%) as a
white solid. .sup.1H NMR and LCMS was consistent with
structure.
Example 2
Preparation of
(1S,3R,4S,7R)-7-(2-cyanoethoxy(diisopropylamino)phosphin
oxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(heterocyclic base
radical)-2,5-dioxa-bicyclo[2.2.2]octane (27)
Route 1:
##STR00028## ##STR00029##
[0288] Route 2: Alternative Procedures to Prepare Compound 20
##STR00030##
[0290] Compound 6 is prepared as per the procedures illustrated in
Example 1.
Example 3
Preparation of
(1R,3R,4R,8R)-8-(2-cyanoethoxy(diisopropylamino)phosphin
oxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(heterocyclic base
radical)-2,5-dioxa-bicyclo[2.2.2]octane (39)
##STR00031## ##STR00032##
[0292] Compound 6 is prepared as per the procedures illustrated in
Example 1.
Example 4
Preparation of
(1S,3R,4S,8S)-8-(2-cyanoethoxy(diisopropylamino)phosphin
oxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(heterocyclic base
radical)-2,5-dioxa-bicyclo[2.2.2]octane (47 U, 49 C)
##STR00033## ##STR00034##
[0294] Compound 8 was prepared as per the procedures illustrated in
Example 1.
Compound 40
Protection of the Primary Hydroxyl and Hydrolysis of the Anyhdro
Nucleoside
[0295] To a stirred solution of compound 8 (5.56 g, 10.8 mmoles) in
CH.sub.2Cl.sub.2 (80 mL) was added DMAP (800 mg), Hunig's Base (3.8
mL, 21.6 mmoles), and pivaloyl chloride (PivCl, 2.0 mL, 16.2
mmoles) at 0.degree. C. The reaction was then stirred at room
temperature for 3 hours, at which time NaHCO.sub.3 (sat) and EtOAc
were added and the organic was washed with, saturated NaHCO.sub.3
and brine and then dried (Na.sub.2SO.sub.4), filtered and the
solvent removed under reduced pressure to give the crude compound.
Purification by column chromatography (SiO.sub.2, eluting with 3%
MeOH/CH.sub.2Cl.sub.2) gave (3.34 g, 52%) as a white solid. .sup.1H
NMR and LCMS was consistent with structure. To a stirred solution
of the crude ester (3.28 g) in CH.sub.3CN/H.sub.2O (90 mL, 7:2) was
added camphorsuphonic acid (CSA, 500 mg). This was heated at
70.degree. C. for 5 hours, at which time the solvent was removed
under reduced pressure to give the crude compound. Purification by
column chromatography (SiO.sub.2, eluting with 4 to 6%
MeOH/CH.sub.2Cl.sub.2) gave Compound 40 (2.43 g, 84%) as a white
solid. .sup.1H NMR and LCMS were consistent with structure.
Compound 41
Tosylation of the Primary Hydroxy Group
[0296] To a stirred solution of compound 40 (2.36 g, 4.46 mmoles)
in pyridine (50 mL) was added tosyl chloride (1.3 g, 6.7 mmoles).
The reaction was then stirred at room temperature for 24 hours, at
which time NaHCO.sub.3 (sat) and H.sub.2O were added and the
organic was washed with, saturated NaHCO.sub.3 and brine and then
dried (Na.sub.2SO.sub.4), filtered and the solvent removed under
reduced pressure to give the crude compound. Purification by column
chromatography (SiO.sub.2, eluting with 3 to 10%
MeOH/CH.sub.2Cl.sub.2) gave compound 41 (1.92 g, 63%) as a white
solid. .sup.1H NMR and LCMS were consistent with structure.
Compound 42
Ring Closure to the Bicyclo[2.2.2]Octane Ring System
[0297] Compound 41 (1.7 g, 2.5 mmoles) was dissolved in DMF (14 mL)
and treated with NaH (60% in mineral oil, 200 mg, 5.0 mmoles) for
15 minutes. At that time, NH.sub.4Cl and EtOAc were added and the
organic was washed with, water and brine and then dried
(Na.sub.2SO.sub.4), filtered and the solvent removed under reduced
pressure to give the crude compound. This was purified by
precipitating from CH.sub.2Cl.sub.2/hexanes to give pure compound
42 (464 mg). .sup.1H NMR and LCMS were consistent with
structure.
Compound 43
TBS Protection
[0298] Compound 42 (416 mg, 0.98 mmoles) was dissolved in anhydrous
DMF (5 mL) followed by the addition of imidazole (133 g, 2.0
mmoles). The resulting yellow solution was cooled to 0.degree. C.
in ice-bath while stirring under nitrogen. tert-butyldimethylsilyl
chloride (TBSCl, 191 mg, 1.3 mmoles) was added and stirring
continued for an additional 16 hours at room temperature. The
reaction was then quenched by addition of MeOH. Water and EtOAc
were then added and the organic was washed with, saturated
NaHCO.sub.3 and brine and then dried (Na.sub.2SO.sub.4), filtered
and the solvent removed under reduced pressure to give crude
compound 43. Purification by column chromatography (SiO.sub.2,
eluting with 4 to 6% MeOH/CH.sub.2Cl.sub.2) gave compound 43 (600
mg, 94%) as a white solid. .sup.1H NMR and LCMS were consistent
with structure.
Compound 44
The Barton-Macombie Deoxygenation.
[0299] Compound 42 (1.25 g, 2.3 mmoles) was deoxygenated as in the
procedure for compound 12 to give compound 44 (792 mg). .sup.1H NMR
and LCMS were consistent with structure.
Compound 45
Removal of Nap and TBS Groups.
[0300] Compound 44 (743 mg, 1.42 mmoles) was dissolved in DCM (13
mL) and treated with water (1 mL) and DDQ (341 mg, 2.1 mmoles).
After stirring for 6 hours, water and DCM were added and the
organic was washed with, saturated NaHCO.sub.3 and brine and then
dried (Na.sub.2SO.sub.4), filtered and the solvent removed under
reduced pressure to give the crude alcohol. The organics were
back-extracted several times with DCM. The combined organics were
evaporated and used in the next step. The crude alcohol was
deprotected according to (Kaburagi, Y.; Kishi, Y. Operationally
Simple and Efficient Workup Procedure for TBAF-Mediated
Desilylation: Application to Halichondrin Synthesis. Org. Lett.
2007, 9, 723-726) to give compound 45 (328 mg).
Compound 46
DMT Protection
[0301] To a stirred mixture of compound 45 (190 mg, 0.70 mmoles) in
pyridine (5 mL) was added DMTCl (286 mg, 0.84 mmoles). The reaction
was allowed to stir at room temperature for 4 hours, and water and
EtOAc were added and the organic was washed with, saturated
NaHCO.sub.3 and brine and then dried (Na.sub.2SO.sub.4), filtered
and the solvent removed under reduced pressure. Purification by
column chromatography (SiO.sub.2, eluting with 4 to 10%
MeOH/CH.sub.2Cl.sub.2) gave compound 46 (298 mg, 74%) as a white
solid. .sup.1H NMR and LCMS were consistent with structure.
Compound 47
Preparation of U-Amidite
[0302] 2-Cyanoethyl N,N'-tetraisopropylphosphoramidite (104 .mu.L,
0.33 mmol) was added to a solution of compound 46 (125 mg, 0.218
mmol), tetrazole (12 mg), N-methylimidazole (4 .mu.L) in DMF (1
mL). After stirring for 4 hours at room temperature, the reaction
was poured into EtOAc and the organic phase was washed with 90%
brine, brine, dried (Na.sub.2SO.sub.4) and concentrated under
vacuum. Purification by column chromatography (SiO.sub.2, eluting
with 60% EtOAc/hexanes) gave Compound 47 (140 mg) as a white solid.
.sup.31P NMR was consistent with structure.
Compound 48
Conversion of U to CBz
[0303] Compound 46 (124 mg, 180 .mu.moles) was converted into
compound 48 (104 mg, 73%) using the procedure for compound 15,
except TBSCl was used instead of TMSCl.
Compound 49
Preparation of CBz Amidite
[0304] 2-Cyanoethyl N,N'-tetraisopropylphosphoramidite (0.53 mL,
0.15 mmol) was added to a solution of compound 48 (75 mg, 0.11
mmol), tetrazole (6 mg), N-methylimidazole (1 drop) in DMF (1 mL).
After stirring for 4 hours at room temperature, the reaction was
poured into EtOAc and the organic phase was washed with 90% brine,
brine, dried (Na.sub.2SO.sub.4) and concentrated under vacuum.
Purification by column chromatography (SiO.sub.2, eluting with 60%
EtOAc/hexanes) gave Compound 49 (80 mg) as a white solid. .sup.31P
NMR was consistent with structure.
Example 5
Synthesis of Nucleoside Phosphoramidites
[0305] The preparation of nucleoside phosphoramidites is performed
following procedures that are illustrated herein and in the art
such as but not limited to U.S. Pat. No. 6,426,220 and published
PCT WO 02/36743.
Example 6
Synthesis of Oligomeric Compounds
[0306] The oligomeric compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as alkylated derivatives and those having
phosphorothioate linkages.
[0307] Oligomeric compounds: Unsubstituted and substituted
phosphodiester (P.dbd.O) oligomeric compounds, including without
limitation, oligonucleotides can be synthesized on an automated DNA
synthesizer (Applied Biosystems model 394) using standard
phosphoramidite chemistry with oxidation by iodine.
[0308] In certain embodiments, phosphorothioate internucleoside
linkages (P.dbd.S) are synthesized similar to phosphodiester
internucleoside linkages with the following exceptions: thiation is
effected by utilizing a 10% w/v solution of
3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the
oxidation of the phosphite linkages. The thiation reaction step
time is increased to 180 sec and preceded by the normal capping
step. After cleavage from the CPG column and deblocking in
concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the
oligomeric compounds are recovered by precipitating with greater
than 3 volumes of ethanol from a 1 M NH.sub.4OAc solution.
Phosphinate internucleoside linkages can be prepared as described
in U.S. Pat. No. 5,508,270.
[0309] Alkyl phosphonate internucleoside linkages can be prepared
as described in U.S. Pat. No. 4,469,863.
[0310] 3'-Deoxy-3'-methylene phosphonate internucleoside linkages
can be prepared as described in U.S. Pat. No. 5,610,289 or
5,625,050.
[0311] Phosphoramidite internucleoside linkages can be prepared as
described in U.S. Pat. No. 5,256,775 or U.S. Pat. No.
5,366,878.
[0312] Alkylphosphonothioate internucleoside linkages can be
prepared as described in published PCT applications PCT/US94/00902
and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively).
[0313] 3'-Deoxy-3'-amino phosphoramidate internucleoside linkages
can be prepared as described in U.S. Pat. No. 5,476,925.
[0314] Phosphotriester internucleoside linkages can be prepared as
described in U.S. Pat. No. 5,023,243.
[0315] Borano phosphate internucleoside linkages can be prepared as
described in U.S. Pat. Nos. 5,130,302 and 5,177,198.
[0316] Oligomeric compounds having one or more non-phosphorus
containing internucleoside linkages including without limitation
methylenemethylimino linked oligonucleosides, also identified as
MMI linked oligonucleosides, methylenedimethylhydrazo linked
oligonucleosides, also identified as MDH linked oligonucleosides,
methylenecarbonylamino linked oligonucleosides, also identified as
amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone oligomeric compounds
having, for instance, alternating MMI and P.dbd.O or P.dbd.S
linkages can be prepared as described in U.S. Pat. Nos. 5,378,825,
5,386,023, 5,489,677, 5,602,240 and 5,610,289.
[0317] Formacetal and thioformacetal internucleoside linkages can
be prepared as described in U.S. Pat. Nos. 5,264,562 and
5,264,564.
[0318] Ethylene oxide internucleoside linkages can be prepared as
described in U.S. Pat. No. 5,223,618.
Example 7
Isolation and Purification of Oligomeric Compounds
[0319] After cleavage from the controlled pore glass solid support
or other support medium and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 12-16 hours, the oligomeric
compounds, including without limitation oligonucleotides and
oligonucleosides, are recovered by precipitation out of 1 M
NH.sub.4OAc with >3 volumes of ethanol. Synthesized oligomeric
compounds are analyzed by electrospray mass spectroscopy (molecular
weight determination) and by capillary gel electrophoresis. The
relative amounts of phosphorothioate and phosphodiester linkages
obtained in the synthesis is determined by the ratio of correct
molecular weight relative to the -16 amu product (+/-32+/-48). For
some studies oligomeric compounds are purified by HPLC, as
described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171.
Results obtained with HPLC-purified material are generally similar
to those obtained with non-HPLC purified material.
Example 8
Synthesis of Oligomeric Compounds Using the 96 Well Plate
Format
[0320] Oligomeric compounds, including without limitation
oligonucleotides, can be synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a 96-well format.
Phosphodiester internucleoside linkages are afforded by oxidation
with aqueous iodine. Phosphorothioate internucleoside linkages are
generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites can be
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per standard or patented methods and
can be functionalized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0321] Oligomeric compounds can be cleaved from support and
deprotected with concentrated NH.sub.4OH at elevated temperature
(55-60.degree. C.) for 12-16 hours and the released product then
dried in vacuo. The dried product is then re-suspended in sterile
water to afford a master plate from which all analytical and test
plate samples are then diluted utilizing robotic pipettors.
Example 9
Analysis of Oligomeric Compounds Using the 96-Well Plate Format
[0322] The concentration of oligomeric compounds in each well can
be assessed by dilution of samples and UV absorption spectroscopy.
The full-length integrity of the individual products can be
evaluated by capillary electrophoresis (CE) in either the 96-well
format (Beckman P/ACE.TM. MDQ) or, for individually prepared
samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM.
5000, ABI 270). Base and backbone composition is confirmed by mass
analysis of the oligomeric compounds utilizing electrospray-mass
spectroscopy. All assay test plates are diluted from the master
plate using single and multi-channel robotic pipettors. Plates are
judged to be acceptable if at least 85% of the oligomeric compounds
on the plate are at least 85% full length.
Example 10
In Vitro Treatment of Cells with Oligomeric Compounds
[0323] The effect of oligomeric compounds on target nucleic acid
expression is tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. Cell lines derived from multiple tissues and species
can be obtained from American Type Culture Collection (ATCC,
Manassas, Va.).
[0324] The following cell type is provided for illustrative
purposes, but other cell types can be routinely used, provided that
the target is expressed in the cell type chosen. This can be
readily determined by methods routine in the art, for example
Northern blot analysis, ribonuclease protection assays or
RT-PCR.
[0325] b.END cells: The mouse brain endothelial cell line b.END was
obtained from Dr. Werner Risau at the Max Plank Institute (Bad
Nauheim, Germany). b.END cells are routinely cultured in DMEM, high
glucose (Invitrogen Life Technologies, Carlsbad, Calif.)
supplemented with 10% fetal bovine serum (Invitrogen Life
Technologies, Carlsbad, Calif.). Cells are routinely passaged by
trypsinization and dilution when they reached approximately 90%
confluence. Cells are seeded into 96-well plates (Falcon-Primaria
#353872, BD Biosciences, Bedford, Mass.) at a density of
approximately 3000 cells/well for uses including but not limited to
oligomeric compound transfection experiments.
[0326] Experiments involving treatment of cells with oligomeric
compounds:
[0327] When cells reach appropriate confluency, they are treated
with oligomeric compounds using a transfection method as
described.
[0328] LIPOFECTIN.TM.
[0329] When cells reached 65-75% confluency, they are treated with
one or more oligomeric compounds. The oligomeric compound is mixed
with LIPOFECTIN.TM. Invitrogen Life Technologies, Carlsbad, Calif.)
in Opti-MEM.TM.-1 reduced serum medium (Invitrogen Life
Technologies, Carlsbad, Calif.) to achieve the desired
concentration of the oligomeric compound(s) and a LIPOFECTIN.TM.
concentration of 2.5 or 3 .mu.g/mL per 100 nM oligomeric
compound(s). This transfection mixture is incubated at room
temperature for approximately 0.5 hours. For cells grown in 96-well
plates, wells are washed once with 100 .mu.L OPTI-MEM.TM.-1 and
then treated with 130 .mu.L of the transfection mixture. Cells
grown in 24-well plates or other standard tissue culture plates are
treated similarly, using appropriate volumes of medium and
oligomeric compound(s). Cells are treated and data are obtained in
duplicate or triplicate. After approximately 4-7 hours of treatment
at 37.degree. C., the medium containing the transfection mixture is
replaced with fresh culture medium. Cells are harvested 16-24 hours
after treatment with oligomeric compound(s).
[0330] Other suitable transfection reagents known in the art
include, but are not limited to, CYTOFECTIN.TM., LIPOFECTAMINE.TM.,
OLIGOFECTAMINE.TM., and FUGENE.TM.. Other suitable transfection
methods known in the art include, but are not limited to,
electroporation.
Example 11
Real-Time Quantitative PCR Analysis of Target mRNA Levels
[0331] Quantitation of target mRNA levels is accomplished by
real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied
Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda,
Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is
attached to the 5' end of the probe and a quencher dye (e.g.,
TAMRA, obtained from either PE-Applied Biosystems, Foster City,
Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA
Technologies Inc., Coralville, Iowa) is attached to the 3' end of
the probe. When the probe and dyes are intact, reporter dye
emission is quenched by the proximity of the 3' quencher dye.
During amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. Sequence Detection System. In
each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0332] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0333] RT and PCR reagents are obtained from Invitrogen Life
Technologies (Carlsbad, Calif.). RT, real-time PCR is carried out
by adding 20 .mu.L PCR cocktail (2.5.times.PCR buffer minus
MgCl.sub.2, 6.6 mM MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP
and dGTP, 375 nM each of forward primer and reverse primer, 125 nM
of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5
Units MuLV reverse transcriptase, and 2.5.times.ROX dye) to 96-well
plates containing 30 .mu.L total RNA solution (20-200 ng). The RT
reaction is carried out by incubation for 30 minutes at 48.degree.
C. Following a 10 minute incubation at 95.degree. C. to activate
the PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol are
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/-extension).
[0334] Gene target quantities obtained by RT, real-time PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RIBOGREEN.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA
quantification by RIBOGREEN.TM. are taught in Jones, L. J., et al,
(Analytical Biochemistry, 1998, 265, 368-374).
[0335] In this assay, 170 .mu.L of RIBOGREEN.TM. working reagent
(RIBOGREEN.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 485 nm and emission at 530
nm.
Example 12
Analysis of Inhibition of Target Expression
[0336] Antisense modulation of a target expression can be assayed
in a variety of ways known in the art. For example, a target mRNA
levels can be quantitated by, e.g., Northern blot analysis,
competitive polymerase chain reaction (PCR), or real-time PCR.
Real-time quantitative PCR is presently desired. RNA analysis can
be performed on total cellular RNA or poly(A)+mRNA. One method of
RNA analysis of the present disclosure is the use of total cellular
RNA as described in other examples herein. Methods of RNA isolation
are well known in the art. Northern blot analysis is also routine
in the art. Real-time quantitative (PCR) can be conveniently
accomplished using the commercially available ABI PRISM.TM. 7600,
7700, or 7900 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions.
[0337] Protein levels of a target can be quantitated in a variety
of ways well known in the art, such as immunoprecipitation, Western
blot analysis (immunoblotting), enzyme-linked immunosorbent assay
(ELISA) or fluorescence-activated cell sorting (FACS). Antibodies
directed to a target can be identified and obtained from a variety
of sources, such as the MSRS catalog of antibodies (Aerie
Corporation, Birmingham, Mich.), or can be prepared via
conventional monoclonal or polyclonal antibody generation methods
well known in the art. Methods for preparation of polyclonal
antisera are taught in, for example, Ausubel, F. M. et al., Current
Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John
Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies
is taught in, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley
& Sons, Inc., 1997.
[0338] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 13
Design of Phenotypic Assays and In Vivo Studies for the Use of
Target Inhibitors
Phenotypic Assays
[0339] Once target inhibitors have been identified by the methods
disclosed herein, the oligomeric compounds are further investigated
in one or more phenotypic assays, each having measurable endpoints
predictive of efficacy in the treatment of a particular disease
state or condition.
[0340] Phenotypic assays, kits and reagents for their use are well
known to those skilled in the art and are herein used to
investigate the role and/or association of a target in health and
disease. Representative phenotypic assays, which can be purchased
from any one of several commercial vendors, include those for
determining cell viability, cytotoxicity, proliferation or cell
survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston,
Mass.), protein-based assays including enzymatic assays (Panvera,
LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene
Research Products, San Diego, Calif.), cell regulation, signal
transduction, inflammation, oxidative processes and apoptosis
(Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation
(Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube
formation assays, cytokine and hormone assays and metabolic assays
(Chemicon International Inc., Temecula, Calif.; Amersham
Biosciences, Piscataway, N.J.).
[0341] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with a target inhibitors identified from the in vitro
studies as well as control compounds at optimal concentrations
which are determined by the methods described above. At the end of
the treatment period, treated and untreated cells are analyzed by
one or more methods specific for the assay to determine phenotypic
outcomes and endpoints.
[0342] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0343] Measurement of the expression of one or more of the genes of
the cell after treatment is also used as an indicator of the
efficacy or potency of the target inhibitors. Hallmark genes, or
those genes suspected to be associated with a specific disease
state, condition, or phenotype, are measured in both treated and
untreated cells.
In Vivo Studies
[0344] The individual subjects of the in vivo studies described
herein are warm-blooded vertebrate animals, which includes
humans.
Example 14
RNA Isolation
[0345] Poly(A)+mRNA Isolation
[0346] Poly(A)+mRNA is isolated according to Miura et al., (Clin.
Chem., 1996, 42, 1758-1764). Other methods for poly(A)+mRNA
isolation are routine in the art. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) is added to each well, the plate is
gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate is transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for
60 minutes at room temperature, washed 3 times with 200 .mu.L of
wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After
the final wash, the plate is blotted on paper towels to remove
excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of
elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C.,
is added to each well, the plate is incubated on a 90.degree. C.
hot plate for 5 minutes, and the eluate is then transferred to a
fresh 96-well plate.
[0347] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Total RNA Isolation
[0348] Total RNA is isolated using an RNEASY 96.TM. kit and buffers
purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT is
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol is then added to each well and
the contents mixed by pipetting three times up and down. The
samples are then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum is applied for 1
minute. 500 .mu.L of Buffer RW1 is added to each well of the RNEASY
96.TM. plate and incubated for 15 minutes and the vacuum is again
applied for 1 minute. An additional 500 .mu.L of Buffer RW1 is
added to each well of the RNEASY 96.TM. plate and the vacuum is
applied for 2 minutes. 1 mL of Buffer RPE is then added to each
well of the RNEASY 96.TM. plate and the vacuum applied for a period
of 90 seconds. The Buffer RPE wash is then repeated and the vacuum
is applied for an additional 3 minutes. The plate is then removed
from the QIAVAC.TM. manifold and blotted dry on paper towels. The
plate is then re-attached to the QIAVAC.TM. manifold fitted with a
collection tube rack containing 1.2 mL collection tubes. RNA is
then eluted by pipetting 140 .mu.L of RNAse free water into each
well, incubating 1 minute, and then applying the vacuum for 3
minutes.
[0349] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 15
Target-Specific Primers and Probes
[0350] Probes and primers may be designed to hybridize to a target
sequence, using published sequence information.
[0351] For example, for human PTEN, the following primer-probe set
was designed using published sequence information (GENBANK.TM.
accession number U92436.1, SEQ ID NO: 1).
[0352] Forward primer: AATGGCTAAGTGAAGATGACAATCAT (SEQ ID NO:
2)
[0353] Reverse primer: TGCACATATCATTACACCAGTTCGT (SEQ ID NO: 3)
And the PCR probe:
[0354] FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO: 4),
where FAM is the fluorescent dye and TAMRA is the quencher dye.
Example 16
Western Blot Analysis of Target Protein Levels
[0355] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on
a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to a target is used, with a radiolabeled or
fluorescently labeled secondary antibody directed against the
primary antibody species. Bands are visualized using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Example 17
In Vitro PTEN Study Using 2-10-2 Gapped Oligomers with Bicyclic
Nucleoside Analogs in the Wings
[0356] A 2-10-2 Gapped oligomeric compound was synthesized and
tested for its ability to reduce PTEN expression in B.END cells.
B.END cells were treated with the oligomeric compound indicated at
a concentration of 20 and 40 nM using methods described herein.
PTEN mRNA levels were measured using quantitative real-time PCR
following routine methods described herein. The data represents
averages from two experiments.
[0357] Tm's were assessed in 100 mM phosphate buffer, 0.1 mM EDTA,
pH 7, at 260 nm using bicyclic cyclohexose nucleic acid modified
oligomers and 4 .mu.M complementary RNA.
TABLE-US-00001 SEQ % Tm ID NO./ Composition Conc. Inhi- (.degree.
ISIS NO: (5' to 3') (nM) bition C.) 05/402380
C.sub.xU.sub.xTAGCACTGGCC.sub.xU.sub.x 20 18 41.5 05/402380
C.sub.xU.sub.xTAGCACTGGCC.sub.xU.sub.x 40 22 05/405837
C.sub.yU.sub.yTAGCACTGGCC.sub.yU.sub.y 20 45 50.6 05/405837
C.sub.yU.sub.yTAGCACTGGCC.sub.yU.sub.y 40 39
All internucleoside linkages are phosphorothioate. Nucleosides not
followed by a subscript are .beta.-D-2'-deoxyribonucleosides.
Nucleosides followed by a subscript are bicyclic nucleoside analogs
having the formula and configuration:
##STR00035##
[0358] wherein Bx is the heterocyclic base.
Sequence CWU 1
1
513160DNAHomo sapiens 1cctcccctcg cccggcgcgg tcccgtccgc ctctcgctcg
cctcccgcct cccctcggtc 60ttccgaggcg cccgggctcc cggcgcggcg gcggaggggg
cgggcaggcc ggcgggcggt 120gatgtggcag gactctttat gcgctgcggc
aggatacgcg ctcggcgctg ggacgcgact 180gcgctcagtt ctctcctctc
ggaagctgca gccatgatgg aagtttgaga gttgagccgc 240tgtgaggcga
ggccgggctc aggcgaggga gatgagagac ggcggcggcc gcggcccgga
300gcccctctca gcgcctgtga gcagccgcgg gggcagcgcc ctcggggagc
cggccggcct 360gcggcggcgg cagcggcggc gtttctcgcc tcctcttcgt
cttttctaac cgtgcagcct 420cttcctcggc ttctcctgaa agggaaggtg
gaagccgtgg gctcgggcgg gagccggctg 480aggcgcggcg gcggcggcgg
cggcacctcc cgctcctgga gcggggggga gaagcggcgg 540cggcggcggc
cgcggcggct gcagctccag ggagggggtc tgagtcgcct gtcaccattt
600ccagggctgg gaacgccgga gagttggtct ctccccttct actgcctcca
acacggcggc 660ggcggcggcg gcacatccag ggacccgggc cggttttaaa
cctcccgtcc gccgccgccg 720caccccccgt ggcccgggct ccggaggccg
ccggcggagg cagccgttcg gaggattatt 780cgtcttctcc ccattccgct
gccgccgctg ccaggcctct ggctgctgag gagaagcagg 840cccagtcgct
gcaaccatcc agcagccgcc gcagcagcca ttacccggct gcggtccaga
900gccaagcggc ggcagagcga ggggcatcag ctaccgccaa gtccagagcc
atttccatcc 960tgcagaagaa gccccgccac cagcagcttc tgccatctct
ctcctccttt ttcttcagcc 1020acaggctccc agacatgaca gccatcatca
aagagatcgt tagcagaaac aaaaggagat 1080atcaagagga tggattcgac
ttagacttga cctatattta tccaaacatt attgctatgg 1140gatttcctgc
agaaagactt gaaggcgtat acaggaacaa tattgatgat gtagtaaggt
1200ttttggattc aaagcataaa aaccattaca agatatacaa tctttgtgct
gaaagacatt 1260atgacaccgc caaatttaat tgcagagttg cacaatatcc
ttttgaagac cataacccac 1320cacagctaga acttatcaaa cccttttgtg
aagatcttga ccaatggcta agtgaagatg 1380acaatcatgt tgcagcaatt
cactgtaaag ctggaaaggg acgaactggt gtaatgatat 1440gtgcatattt
attacatcgg ggcaaatttt taaaggcaca agaggcccta gatttctatg
1500gggaagtaag gaccagagac aaaaagggag taactattcc cagtcagagg
cgctatgtgt 1560attattatag ctacctgtta aagaatcatc tggattatag
accagtggca ctgttgtttc 1620acaagatgat gtttgaaact attccaatgt
tcagtggcgg aacttgcaat cctcagtttg 1680tggtctgcca gctaaaggtg
aagatatatt cctccaattc aggacccaca cgacgggaag 1740acaagttcat
gtactttgag ttccctcagc cgttacctgt gtgtggtgat atcaaagtag
1800agttcttcca caaacagaac aagatgctaa aaaaggacaa aatgtttcac
ttttgggtaa 1860atacattctt cataccagga ccagaggaaa cctcagaaaa
agtagaaaat ggaagtctat 1920gtgatcaaga aatcgatagc atttgcagta
tagagcgtgc agataatgac aaggaatatc 1980tagtacttac tttaacaaaa
aatgatcttg acaaagcaaa taaagacaaa gccaaccgat 2040acttttctcc
aaattttaag gtgaagctgt acttcacaaa aacagtagag gagccgtcaa
2100atccagaggc tagcagttca acttctgtaa caccagatgt tagtgacaat
gaacctgatc 2160attatagata ttctgacacc actgactctg atccagagaa
tgaacctttt gatgaagatc 2220agcatacaca aattacaaaa gtctgaattt
ttttttatca agagggataa aacaccatga 2280aaataaactt gaataaactg
aaaatggacc tttttttttt taatggcaat aggacattgt 2340gtcagattac
cagttatagg aacaattctc ttttcctgac caatcttgtt ttaccctata
2400catccacagg gttttgacac ttgttgtcca gttgaaaaaa ggttgtgtag
ctgtgtcatg 2460tatatacctt tttgtgtcaa aaggacattt aaaattcaat
taggattaat aaagatggca 2520ctttcccgtt ttattccagt tttataaaaa
gtggagacag actgatgtgt atacgtagga 2580attttttcct tttgtgttct
gtcaccaact gaagtggcta aagagctttg tgatatactg 2640gttcacatcc
tacccctttg cacttgtggc aacagataag tttgcagttg gctaagagag
2700gtttccgaaa ggttttgcta ccattctaat gcatgtattc gggttagggc
aatggagggg 2760aatgctcaga aaggaaataa ttttatgctg gactctggac
catataccat ctccagctat 2820ttacacacac ctttctttag catgctacag
ttattaatct ggacattcga ggaattggcc 2880gctgtcactg cttgttgttt
gcgcattttt ttttaaagca tattggtgct agaaaaggca 2940gctaaaggaa
gtgaatctgt attggggtac aggaatgaac cttctgcaac atcttaagat
3000ccacaaatga agggatataa aaataatgtc ataggtaaga aacacagcaa
caatgactta 3060accatataaa tgtggaggct atcaacaaag aatgggcttg
aaacattata aaaattgaca 3120atgatttatt aaatatgttt tctcaattgt
aaaaaaaaaa 3160226DNAArtificial SequencePrimer 2aatggctaag
tgaagatgac aatcat 26325DNAArtificial SequencePrimer 3tgcacatatc
attacaccag ttcgt 25430DNAArtificial SequenceProbe 4ttgcagcaat
tcactgtaaa gctggaaagg 30514DNAArtificial SequenceSynthetic
oligonucleotide 5cutagcactg gccu 14
* * * * *