U.S. patent application number 14/395780 was filed with the patent office on 2015-07-02 for oligomeric compounds comprising bicyclic nucleotides and uses thereof.
This patent application is currently assigned to Isis Pharmaceuticals, Inc.. The applicant listed for this patent is Isis Pharmaceuticals, Inc.. Invention is credited to Susan M. Freier, Eric E. Swayze.
Application Number | 20150184153 14/395780 |
Document ID | / |
Family ID | 49384239 |
Filed Date | 2015-07-02 |
United States Patent
Application |
20150184153 |
Kind Code |
A1 |
Freier; Susan M. ; et
al. |
July 2, 2015 |
OLIGOMERIC COMPOUNDS COMPRISING BICYCLIC NUCLEOTIDES AND USES
THEREOF
Abstract
The present invention provides oligomeric compounds. Certain
such oligomeric compounds are useful for hybridizing to a
complementary nucleic acid, including but not limited, to nucleic
acids in a cell. In certain embodiments, hybridization results in
modulation of the amount activity or expression of the target
nucleic acid in a cell.
Inventors: |
Freier; Susan M.; (San
Diego, CA) ; Swayze; Eric E.; (Encinitas,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Isis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Isis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
49384239 |
Appl. No.: |
14/395780 |
Filed: |
April 22, 2013 |
PCT Filed: |
April 22, 2013 |
PCT NO: |
PCT/US13/37638 |
371 Date: |
October 20, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61636513 |
Apr 20, 2012 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
C12N 2310/3231 20130101;
C12Y 301/03067 20130101; C12N 2310/341 20130101; C12N 15/111
20130101; C12Y 301/03048 20130101; C12N 15/1137 20130101; C12N
2310/3525 20130101; C12N 2310/11 20130101; C12Y 301/03016 20130101;
C12N 2320/51 20130101; C12N 15/113 20130101; C12N 2310/343
20130101; C12N 2310/321 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1.-20. (canceled)
21. A compound comprising: a modified oligonucleotide consisting of
10 to 20 linked nucleosides, wherein the modified oligonucleotide
comprises: a 5'-wing consisting of 4 to 6 linked nucleosides; a
3'-wing consisting of 4 to 5 linked nucleosides; and a gap between
the 5'-wing and the 3'-wing consisting of 7 to 10 linked
2'-deoxynucleosides; and wherein the wings comprise a total of at
least two bicyclic nucleosides; and wherein either the 5'-wing
comprises at least one 2'-deoxynucleoside and the 3'-wing comprises
at least four 2'-substituted nucleosides; or the 5'-wing does not
comprise a 2'-deoxynucleoside and the 3'-wing consists of four
linked nucleosides; and wherein when the 5'-wing consists of 6
linked nucleosides, the gap consists of 7 linked nucleosides; and
wherein the nucleobase sequence of the modified oligonucleotide is
complementary to the nucleobase sequence of a target nucleic
acid.
22. The compound of claim 21, wherein the 5'-wing comprises at
least one bicyclic nucleoside.
23. The compound of claim 22, wherein the 3'-wing comprises at
least three 2'-substituted nucleosides.
24. The compound of claim 23, wherein each 2'-substituent is
selected from among: 2'-OMe, 2'-O-methoxyethyl, or 2'-F group.
25. The compound of claim 24, wherein each 2'-substituent is a
2'-O-methoxyethyl group.
26. The compound of claim 21, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
e-e-e-k-(D).sub.9-k-e-e-e, wherein each "k" comprises a constrained
ethyl nucleoside, each "e" comprises a 2'-MOE substituted
nucleoside, and each "D" comprises a 2'-deoxynucleoside.
27. The compound of claim 25, wherein the 5'-wing comprises at
least two bicyclic nucleosides.
28. The compound of claim 27, wherein the gap consists of 8 to 9
linked nucleosides.
29. The compound of claim 28, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.8-e-e-e-e, wherein each "k" comprises a
constrained ethyl nucleoside, each "e" comprises a 2'-MOE
substituted nucleoside, and each "D" comprises a
2'-deoxynucleoside.
30. The compound of claim 28, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
e-k-e-k-(D).sub.9-e-e-e-e, wherein each "k" comprises a constrained
ethyl nucleoside, each "e" comprises a 2'-MOE substituted
nucleoside, and each "D" comprises a 2'-deoxynucleoside.
31. The compound of claim 27, wherein the 5'-wing comprises at
least one 2'-deoxynucleoside.
32. The compound of claim 31, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
e-k-e-k-d-k-(D).sub.7-e-e-e-e, wherein each "k" comprises a
constrained ethyl nucleoside, each "e" comprises a 2'-MOE
substituted nucleoside, each "d" comprises a 2'-deoxynucleoside,
and each "D" comprises a 2'-deoxynucleoside.
33. The compound of claim 31, wherein the 5'-wing comprises at
least two 2'-deoxynucleosides.
34. The compound of claim 33, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.10-e-e-e-e-e, wherein each "k" comprises a
constrained ethyl nucleoside, each "e" comprises a 2'-MOE
substituted nucleoside, each "d" comprises a 2'-deoxynucleoside,
and each "D" comprises a 2'-deoxynucleoside.
35. The compound of claim 33, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.8-e-e-e-e-e, wherein each "k" comprises a
constrained ethyl nucleoside, each "e" comprises a 2'-MOE
substituted nucleoside, each "d" comprises a 2'-deoxynucleoside,
and each "D" comprises a 2'-deoxynucleoside.
36. The compound of claim 33, wherein the compound comprises a
modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.8-e-e-e-e, wherein each "k" comprises a
constrained ethyl nucleoside, each "e" comprises a 2'-MOE
substituted nucleoside, each "d" comprises a 2'-deoxynucleoside,
and each "D" comprises a 2'-deoxynucleoside.
37. A pharmaceutical composition comprising the compound according
to claim 25 and a pharmaceutically acceptable diluent.
38. A method of modulating expression of a target nucleic acid in a
cell comprising contacting the cell with the compound of claim
25.
39. The method of claim 38, wherein the cell is in an animal.
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0104USLSEQ.txt, created Apr. 20, 2012, which is 4
Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Antisense compounds have been used to modulate target
nucleic acids. Antisense compounds comprising a variety of chemical
modifications and motifs have been reported. In certain instances,
such compounds are useful as research tools, diagnostic reagents,
and as therapeutic agents. In certain instances antisense compounds
have been shown to modulate protein expression by binding to a
target messenger RNA (mRNA) encoding the protein. In certain
instances, such binding of an antisense compound to its target mRNA
results in cleavage of the mRNA. Antisense compounds that modulate
processing of a pre-mRNA have also been reported. Such antisense
compounds alter splicing, interfere with polyadenlyation or prevent
formation of the 5'-cap of a pre-mRNA.
[0003] Certain antisense compounds have been described previously.
See for example U.S. Pat. No. 7,399,845 and published International
Patent Application No. WO 2008/049085, which are hereby
incorporated by reference herein in their entirety.
SUMMARY OF THE INVENTION
[0004] In certain embodiments, the present invention provides
compounds comprising oligonucleotides. In certain embodiments, such
oligonucleotides comprise a gapmer region. In certain embodiments,
such oligonucleotides consist of a gapmer region.
[0005] The present disclosure provides the following non-limiting
numbered embodiments:
Embodiment 1
[0006] A compound comprising: [0007] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide comprises: [0008] a 5'-wing consisting of 2 to 5
linked nucleosides; [0009] a 3'-wing consisting of 2 to 5 linked
nucleosides; and [0010] a gap between the 5'-wing and the 3'-wing
consisting of 6 to 14 linked 2'-deoxynucleosides; and [0011]
wherein at least one of the 5'-wing and the 3'-wing comprises at
least one bicyclic nucleoside; at least one of the 5'-wing and the
3'-wing comprises at least one 2'-substituted nucleoside; and
[0012] wherein the nucleobase sequence of the modified
oligonucleotide is complementary to the nucleobase sequence of a
target nucleic acid.
Embodiment 2
[0013] The compound of embodiment 1, wherein one of the 5'-wing or
the 3'-wing comprises at least one 2'-deoxynucleoside.
Embodiment 3
[0014] The compound of embodiments 1-2, wherein each of the 5'-wing
and the 3'-wing comprises at least one 2'-deoxynucleoside.
Embodiment 4
[0015] The compound of embodiments 1-3, wherein the 3'-wing
comprises at least one 2'-deoxynucleoside.
Embodiment 5
[0016] The compound of embodiments 1-4, wherein the 5'-wing
comprises at least one 2'-deoxynucleoside.
Embodiment 6
[0017] The compound of any of embodiments 1-5, wherein the 5'-wing
comprises at least one bicyclic nucleoside.
Embodiment 7
[0018] The compound of any of embodiments 1-6, wherein the 3'-wing
comprises at least one bicyclic nucleoside.
Embodiment 8
[0019] The compound of any of embodiments 1-7, wherein the 5'-wing
comprises at least one 2'-substituted nucleoside.
Embodiment 9
[0020] The compound of any of embodiments 1-8, wherein the 3'-wing
comprises at least one 2'-substituted nucleoside.
Embodiment 10
[0021] A compound comprising: [0022] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide comprises: [0023] a 5'-wing consisting of 2 to 5
linked nucleosides; [0024] a 3'-wing of 2 to 5 linked nucleosides;
and [0025] a gap between the 5' wing and the 3' wing consisting of
6 to 14 linked 2'-deoxynucleosides; and [0026] wherein at least one
of the 5'-wing and the 3'-wing comprises at least one constrained
ethyl nucleoside; and at least one of the 5'-wing and the 3'-wing
comprises at least one 2'-substituted nucleoside; and wherein the
nucleobase sequence of the modified oligonucleotide is
complementary to the nucleobase sequence of a target nucleic
acid.
Embodiment 11
[0027] The compound of embodiments 1-10, wherein and at least one
of the 5'-wing and the 3'-wing comprises at least one
2'-deoxynucleoside.
Embodiment 12
[0028] The compound of embodiments 1-11, wherein at least one of
the 5'-wing and the 3'-wing comprises both at least one constrained
ethyl nucleoside and at least one 2'-substituted nucleoside.
Embodiment 13
[0029] The compound of embodiments 1-12, wherein the 5'-wing
comprises at least one constrained ethyl nucleoside.
Embodiment 14
[0030] The compound of any of embodiments 10-13, wherein the
3'-wing comprises at least one constrained ethyl nucleoside.
Embodiment 15
[0031] The compound of any of embodiments 10-14, wherein the
5'-wing comprises at least one 2'-substituted nucleoside.
Embodiment 16
[0032] The compound of any of embodiments 10-15, wherein the
3'-wing comprises at least one 2'-substituted nucleoside.
Embodiment 17
[0033] The compound of any of embodiments 1-17, wherein the
modified oligonucleotide has a sugar motif described by Formula I
as follows:
(A).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(J).sub.t(D).sub.g-(J).sub.v-(B)-
.sub.w-(J).sub.x-(B).sub.y-(A).sub.z
wherein: [0034] each A is independently a 2'-substituted
nucleoside; [0035] each B is independently a bicyclic nucleoside;
[0036] each J is independently either a 2'-substituted nucleoside
or a 2'-deoxynucleoside; [0037] each D is a 2'-deoxynucleoside;
[0038] m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2;
w is 0-4; x is 0-2; y is 0-2; z is 0-4; and g is 6-14; provided
that: [0039] at least one of m, n, and r is other than 0; [0040] at
least one of w and y is other than 0; [0041] the sum of m, n, p, r,
and t is from 2 to 5; and [0042] the sum of v, w, x, y, and z is
from 2 to 5.
Embodiment 18
[0043] A compound comprising: [0044] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide has a sugar motif described by Formula I as
follows:
[0044]
(A).sub.m-(B).sub.n(J).sub.p-(B).sub.r-(J).sub.t-(D).sub.g-(J).su-
b.v-(B).sub.w-(J).sub.x-(B).sub.y-(A).sub.z
wherein: [0045] each A is independently a 2'-substituted
nucleoside; [0046] each B is independently a bicyclic nucleoside;
[0047] each J is independently either a 2'-substituted nucleoside
or a 2'-deoxynucleoside; [0048] each D is a 2'-deoxynucleoside;
[0049] m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2;
w is 0-4; x is 0-2; y is 0-2; z is 0-4; and g is 6-14; provided
that: [0050] at least one of m, n, and r is other than 0; [0051] at
least one of w and y is other than 0; [0052] the sum of m, n, p, r,
and t is from 2 to 5; and [0053] the sum of v, w, x, y, and z is
from 2 to 5.
Embodiment 19
[0054] The compound of embodiment 17 or 18, wherein at least one
bicyclic nucleoside is a constrained ethyl nucleoside.
Embodiment 20
[0055] The compound of embodiment 17 or 18, wherein each bicyclic
nucleoside is a constrained ethyl nucleoside.
Embodiment 21
[0056] The compound of any of embodiments 17-19, wherein at least
one bicyclic nucleoside is an LNA nucleoside.
Embodiment 22
[0057] The compound of embodiment 17 or 18, wherein each bicyclic
nucleoside is an LNA nucleoside.
Embodiment 23
[0058] The compound of any of embodiments 1-22, wherein the
2'-substituent of the at least one 2'-substituted nucleoside is
selected from among: OCH.sub.3, F, OCH.sub.2F, OCHF.sub.2,
OCF.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F,
OCH.sub.2CHF.sub.2, OCH.sub.2CF.sub.3, OCH.sub.2--CH--CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--ON(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.6)--(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5)
and
O(CH.sub.2).sub.2--N(R.sub.6)--C(.dbd.NR.sub.7)[N(R.sub.4)(R.sub.5)]
wherein R.sub.4, R.sub.5, R.sub.6 and R.sub.7 are each,
independently, H or C.sub.1-C.sub.6 alkyl.
Embodiment 24
[0059] The compound of embodiment 23, wherein the 2'-substituent of
the at least one 2'-substituted nucleoside of is selected from
among: OCH.sub.3, F, and O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 25
[0060] The compound of embodiment 24, wherein the 2'-substituent of
the at least one 2'-substituted nucleoside is
O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 26
[0061] The compound of any of embodiments 1-22, wherein the
2'-substituent of each 2'-substituted nucleoside is selected from
among: OCH.sub.3, F, OCH.sub.2F, OCHF.sub.2, OCF.sub.3,
OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F, OCH.sub.2CHF.sub.2,
OCH.sub.2CF.sub.3, OCH.sub.2--CH--CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--ON(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.6)--(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5)
and
O(CH.sub.2).sub.2--N(R.sub.6)--C(.dbd.NR.sub.7)[N(R.sub.4)(R.sub.5)]
wherein R.sub.4, R.sub.5, R.sub.6 and R.sub.7 are each,
independently, H or C.sub.1-C.sub.6 alkyl.
Embodiment 27
[0062] The compound of embodiment 26, wherein the 2'-substituent of
each 2'-substituted nucleoside of is selected from among:
OCH.sub.3, F, and O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 28
[0063] The compound of embodiment 27, wherein the 2'-substituent of
each 2'-substituted nucleoside is O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 29
[0064] The compound of any of embodiments 1-28, wherein the 5'-wing
does not comprise a bicyclic nucleotide.
Embodiment 30
[0065] The compound of any of embodiments 1-29, wherein the 3'-wing
does not comprise a bicyclic nucleotide.
Embodiment 31
[0066] The compound of any of embodiments 1-30, wherein the target
nucleic acid is not a Huntingtin gene transcript.
Embodiment 32
[0067] The compound of any of embodiments 1-31, wherein the
modified oligonucleotide has a base sequence other than:
TABLE-US-00001 (SEQ ID NO: 1) GTGCTACCCAACCTTTCTG; (SEQ ID NO: 2)
CACAGTGCTACCCAACCTT; (SEQ ID NO: 3) CAGTGCTACCCAACC; (SEQ ID NO: 4)
ATATCACAGTGCTACCCAA; (SEQ ID NO: 5) GATGCTGACTTGGGCCATT; (SEQ ID
NO: 6) GGGATGCTGACTTGG; (SEQ ID NO: 7) TGCCAAGGGATGCTGACTT; (SEQ ID
NO: 8) AATTGTCATCACCAGAAAA; (SEQ ID NO: 9) TAAATTGTCATCACC; (SEQ ID
NO: 10) ACAGTAGATGAGGGAGCAG; (SEQ ID NO: 11) ACACAGTAGATGAGG; (SEQ
ID NO: 12) AAGTGCACACAGTAGATGA; (SEQ ID NO: 13)
AGCTGCAACCTGGCAACAA; (SEQ ID NO: 14) GCAGCTGCAACCTGG; or (SEQ ID
NO: 15) GCAAGAGCAGCTGCAACCT.
Embodiment 33
[0068] The compound of any of embodiments 1-31, wherein the
oligonucleotide has a sugar motif other than: [0069]
E-K-K-(D).sub.9-K-K-E; [0070] E-E-E-E-K-(D).sub.9-E-E-E-E-E; [0071]
E-K-K-K-(D).sub.9-K-K-K-E; [0072] K-E-E-K-(D).sub.9-K-E-E-K; [0073]
K-D-D-K-(D).sub.9-K-D-D-K; [0074] K-E-K-E-K-(D).sub.9-K-E-K-E-K;
[0075] K-D-K-D-K-(D).sub.9-K-D-K-D-K; [0076]
E-K-E-K-(D).sub.9-K-E-K-E; [0077] E-E-E-E-E-K-(D).sub.8-E-E-E-E-E;
or [0078] E-K-E-K-E-(D).sub.9-E-K-E-K-E; wherein
[0079] K is a constrained ethyl nucleoside, E is a 2'-MOE
substituted nucleoside, and D is a 2'-deoxynucleoside.
Embodiment 34
[0080] The compound of any of embodiments 1-30, wherein the 5'-wing
consists of 2 linked nucleosides.
Embodiment 35
[0081] The compound of any of embodiments 1-30, wherein the 5'-wing
consists of 3 linked nucleosides.
Embodiment 36
[0082] The compound of any of embodiments 1-30, wherein the 5'-wing
consists of 4 linked nucleosides.
Embodiment 37
[0083] The compound of any of embodiments 1-30, wherein the 5'-wing
consists of 5 linked nucleosides.
Embodiment 38
[0084] The compound of any of embodiments 1-34, wherein the 3'-wing
consists of 2 linked nucleosides.
Embodiment 39
[0085] The compound of any of embodiments 1-34, wherein the 3'-wing
consists of 3 linked nucleosides.
Embodiment 40
[0086] The compound of any of embodiments 1-34, wherein the 3'-wing
consists of 4 linked nucleosides.
Embodiment 41
[0087] The compound of any of embodiments 1-34, wherein the 3'-wing
consists of 5 linked nucleosides.
Embodiment 42
[0088] The compound of any of embodiments 1-38, wherein the gap
consists of 6 linked 2'-deoxynucleosides.
Embodiment 43
[0089] The compound of any of embodiments 1-38, wherein the gap
consists of 7 linked 2'-deoxynucleosides.
Embodiment 44
[0090] The compound of any of embodiments 1-38, wherein the gap
consists of 8 linked 2'-deoxynucleosides.
Embodiment 45
[0091] The compound of any of embodiments 1-38, wherein the gap
consists of 9 linked 2'-deoxynucleosides.
Embodiment 46
[0092] The compound of any of embodiments 1-38, wherein the gap
consists of 10 linked 2'-deoxynucleosides.
Embodiment 47
[0093] The compound of any of embodiments 1-38, wherein the gap
consists of 11 linked 2'-deoxynucleosides.
Embodiment 48
[0094] The compound of any of embodiments 1-38, wherein the gap
consists of 12 linked 2'-deoxynucleosides.
Embodiment 49
[0095] The compound of any of embodiments 1-38, wherein the gap
consists of 13 linked 2'-deoxynucleosides.
Embodiment 50
[0096] The compound of any of embodiments 1-38, wherein the gap
consists of 14 linked 2'-deoxynucleosides.
Embodiment 51
[0097] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 10 linked nucleosides.
Embodiment 52
[0098] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 11 linked nucleosides.
Embodiment 53
[0099] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 12 linked nucleosides.
Embodiment 54
[0100] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 13 linked nucleosides.
Embodiment 55
[0101] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 14 linked nucleosides.
Embodiment 56
[0102] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 15 linked nucleosides.
Embodiment 57
[0103] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 16 linked nucleosides.
Embodiment 58
[0104] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 17 linked nucleosides.
Embodiment 59
[0105] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 18 linked nucleosides.
Embodiment 60
[0106] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 19 linked nucleosides.
Embodiment 61
[0107] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 20 linked nucleosides.
Embodiment 62
[0108] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 21 linked nucleosides.
Embodiment 63
[0109] The compound of any of embodiments 1-50, wherein the
oligonucleotide consists of 22 linked nucleosides.
Embodiment 64
[0110] The compound of any of embodiments 1-30, wherein the gapmer
motif is selected from among: 2-10-2, 2-10-3, 2-10-4, 2-10-5,
3-10-2, 3-10-3, 3-10-4, 3-10-5, 4-10-2, 4-10-3, 4-10-4, 4-10-5,
5-10-2, 5-10-3, 5-10-4, 5-10-5, 2-9-2, 2-9-3, 2-9-4, 2-9-5, 3-9-2,
3-9-3, 3-9-4, 3-9-5, 4-9-2, 4-9-3, 4-9-4, 4-9-5, 5-9-2, 5-9-3,
5-9-4, 5-9-5, 2-8-2, 2-8-3, 2-8-4, 2-8-5, 3-8-2, 3-8-3, 3-8-4,
3-8-5, 4-8-2, 4-8-3, 4-8-4, 4-8-5, 5-8-2, 5-8-3, 5-8-4, and
5-8-5.
Embodiment 65
[0111] A compound comprising a modified oligonucleotide having a
sugar motif selected from among sugar motifs 1-278 as shown in
Table 4.
Embodiment 66
[0112] The compound of any of embodiments 1-65, wherein the 5'-wing
has a motif selected from among the 5'-wing motifs as shown in
Tables 1-3.
Embodiment 67
[0113] The compound of any of embodiments 1-66, wherein the 3'-wing
has a motif selected from among the 3'-wing motifs as shown in
Tables 4-6.
Embodiment 68
[0114] The compound of any of embodiments 66-67, wherein each A,
each B, and each C are independently selected from among: HNA and
F-HNA.
Embodiment 69
[0115] The compound of any of embodiments 1-68, wherein the 5'-wing
comprises at least one F-HNA.
Embodiment 70
[0116] The compound of any of embodiments 1-69, wherein the 3'-wing
comprises at least one F-HNA.
Embodiment 71
[0117] The compound of any of embodiments 1-68, wherein the 5'-wing
comprises at least one modified nucleobase.
Embodiment 72
[0118] The compound of any of embodiments 1-69, wherein the 3'-wing
comprises at least one modified nucleobase.
Embodiment 73
[0119] The compound of embodiment 72, wherein the modified
nucleobase is 2-thio-thymidine.
Embodiment 74
[0120] The compound of any of embodiments 1-73, wherein the 5'-wing
has a motif selected from among the 5'-wing motifs as shown in
Tables 1-3 and the 3'-wing has a motif selected from among the
3'-wing motifs as shown in Tables 4-6.
Embodiment 75
[0121] The compound of any of embodiments 1-74, wherein the 5'-wing
has an ABABA motif, wherein each A is a modified nucleoside and
each B comprises a 2'-deoxynucleoside.
Embodiment 76
[0122] The compound of embodiment 75, wherein the modified
nucleoside is a bicyclic nucleoside.
Embodiment 77
[0123] The compound of embodiment 76, wherein the bicyclic
nucleoside is cEt.
Embodiment 78
[0124] The compound of embodiment 76, wherein the bicyclic
nucleoside is LNA.
Embodiment 79
[0125] The compound of any of embodiments 75-78 wherein the 3'-wing
has a motif selected from among: AA, AB, AC, BA, BB, BC, CA, CB,
and CC.
Embodiment 80
[0126] The compound of embodiment 79, wherein the 3'-wing has an AA
motif.
Embodiment 81
[0127] The compound of embodiment 80, wherein A is a 2'-substituted
nucleoside.
Embodiment 82
[0128] The compound of embodiment 80, wherein the 2'-substituted
nucleoside is selected from among: OCH.sub.3, F, OCH.sub.2F,
OCHF.sub.2, OCF.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F,
OCH.sub.2CHF.sub.2, OCH.sub.2CF.sub.3, OCH.sub.2--CH.dbd.CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--ON(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.6)--(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5)
and
O(CH.sub.2).sub.2--N(R.sub.6)--C(.dbd.NR.sub.7)[N(R.sub.4)(R.sub.5)]
wherein R.sub.4, R.sub.5, R.sub.6 and R.sub.7 are each,
independently, H or C.sub.1-C.sub.6 alkyl.
Embodiment 83
[0129] The compound of embodiment 82, wherein the 2'-substituent of
each 2'-substituted nucleoside of is selected from among:
OCH.sub.3, F, and O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 84
[0130] The compound of embodiment 83, wherein the 2'-substituent of
each 2'-substituted nucleoside is O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 85
[0131] The compound of any of embodiments 76-84 wherein the gap
between the 5'-wing and the 3'-wing consists of 6 to 11 linked
2'-deoxynucleosides.
Embodiment 86
[0132] The compound of any of embodiments 76-84 wherein the gap
between the 5'-wing and the 3'-wing consists of 7 to 10 linked
2'-deoxynucleosides.
Embodiment 87
[0133] The compound of any of embodiments 76-84 wherein the gap
between the 5'-wing and the 3'-wing consists of 10 linked
2'-deoxynucleosides.
Embodiment 88
[0134] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.6-E-E.
Embodiment 89
[0135] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.7-E-E.
Embodiment 90
[0136] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.8-E-E.
Embodiment 91
[0137] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.9-E-E.
Embodiment 92
[0138] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.10-E-E.
Embodiment 93
[0139] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.11-E-E.
Embodiment 94
[0140] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.12-E-E.
Embodiment 95
[0141] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.13-E-E.
Embodiment 96
[0142] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.14-E-E.
Embodiment 97
[0143] The compound of any of embodiments 75-87 having the sugar
motif: K-D-K-D-K-(D).sub.15-E-E.
Embodiment 98
[0144] The compound of any of embodiments 1-97, wherein the 5'-wing
has a BDBDB motif, wherein each B is a bicyclic nucleoside and each
D comprises a 2'-deoxynucleoside.
Embodiment 99
[0145] The compound of any of embodiments 1-97, wherein the 5'-wing
has a BDBDB-(D).sub.6-15-AA motif, wherein each B is a bicyclic
nucleoside and each D comprises a 2'-deoxynucleoside.
Embodiment 100
[0146] The compound of any of embodiments 98-99, wherein B is
selected from among: BNA, LNA, .alpha.-L-LNA, ENA and 2'-thio
LNA.
Embodiment 101
[0147] The compound of embodiment 100, wherein B comprises BNA.
Embodiment 102
[0148] The compound of embodiment 100, wherein B comprises LNA.
Embodiment 103
[0149] The compound of embodiment 100, wherein B comprises
.alpha.-L-LNA.
Embodiment 104
[0150] The compound of embodiment 100, wherein B comprises ENA.
Embodiment 105
[0151] The compound of embodiment 100, wherein B comprises 2'-thio
LNA.
Embodiment 106
[0152] The compound of any of embodiments 100 to 105, wherein A
comprises a 2'substituted nucleoside.
Embodiment 107
[0153] The compound of claim 106, wherein the 2' substituted
nucleoside comprises MOE.
Embodiment 108
[0154] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-B-B-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 109
[0155] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-B-B-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 110
[0156] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-B-B-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 111
[0157] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 112
[0158] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 113
[0159] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 114
[0160] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 115
[0161] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 116
[0162] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 117
[0163] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 118
[0164] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 119
[0165] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 120
[0166] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 121
[0167] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 122
[0168] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 123
[0169] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 124
[0170] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 125
[0171] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 126
[0172] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.8-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 127
[0173] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.9-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 128
[0174] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.10-B-B-A, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 129
[0175] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.8-B-B-B, wherein each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 130
[0176] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.9-B-B-B, wherein each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 131
[0177] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-(D).sub.10-B-B-B, wherein each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 132
[0178] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.8-B-B-B, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 133
[0179] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.9-B-B-B, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 134
[0180] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-(D).sub.10-B-B-B, wherein each A is an independently selected
2'-substituted nucleoside, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 135
[0181] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-D-B-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 136
[0182] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-D-B-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 137
[0183] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-D-B-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 138
[0184] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 139
[0185] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 140
[0186] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 141
[0187] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-B-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 142
[0188] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-B-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 143
[0189] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-B-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 144
[0190] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 145
[0191] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 146
[0192] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 147
[0193] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 148
[0194] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 149
[0195] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 150
[0196] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.8-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 151
[0197] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.9-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 152
[0198] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-(D).sub.10-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 153
[0199] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-B-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 154
[0200] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-B-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 155
[0201] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-D-B-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 156
[0202] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.8-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 157
[0203] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.9-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 158
[0204] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-(D).sub.10-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 159
[0205] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-B-(D).sub.8-B-B-B, wherein each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 160
[0206] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-B-(D).sub.9-B-B-B, each B is an independently selected
bicyclic nucleoside, and each D is a 2'-deoxynucleoside
Embodiment 161
[0207] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-B-B-B-(D).sub.10-B-B-B, wherein each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 162
[0208] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 163
[0209] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 164
[0210] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 165
[0211] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.8-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 166
[0212] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.9-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 167
[0213] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-A-(D).sub.10-B-B-B, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 168
[0214] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-A-D-B-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 169
[0215] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-A-D-B-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 170
[0216] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-A-D-B-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 171
[0217] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-D-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 172
[0218] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-D-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 173
[0219] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-D-B-D-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 174
[0220] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-D-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 175
[0221] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-D-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 176
[0222] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-D-A-D-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 177
[0223] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-B-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 178
[0224] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-B-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 179
[0225] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-A-A-B-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 180
[0226] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-A-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 181
[0227] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-A-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 182
[0228] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
A-A-B-A-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 183
[0229] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-A-(D).sub.8-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 184
[0230] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-A-(D).sub.9-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 185
[0231] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
B-A-A-A-A-(D).sub.10-B-B-A, wherein each A is an independently
selected 2'-substituted nucleoside, each B is an independently
selected bicyclic nucleoside, and each D is a
2'-deoxynucleoside
Embodiment 186
[0232] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-k-k-(D).sub.9-e-k-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 187
[0233] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.10-e-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 188
[0234] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
k-e-k-(D).sub.10-k-e-k, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 189
[0235] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.8-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 190
[0236] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
k-d-k-d-k-(D).sub.8-e-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 191
[0237] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
k-e-k-(D).sub.8-e-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 192
[0238] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-k-(D).sub.10-k-e-k-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 193
[0239] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-(D).sub.10-k-k-k, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 194
[0240] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.8-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 195
[0241] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.7-k-k-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 196
[0242] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-(D).sub.9-k-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 197
[0243] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.7-k-k-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 198
[0244] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.7-k-k-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 199
[0245] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-e-k-k-(D).sub.7-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 200
[0246] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-k-e-k-(D).sub.9-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 201
[0247] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-k-e-k-d-k-(D).sub.7-e-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 202
[0248] The compound of any of embodiments 1-2, wherein the compound
comprises a modified oligonucleotide having the sugar motif:
e-e-e-k-k-(D).sub.7-k-k-e-e-e, wherein each k comprises a bicyclic
nucleoside, each e comprises a 2'-modified nucleoside, and each D
comprises a 2'-deoxynucleoside.
Embodiment 203
[0249] The compound of any of embodiments 186 to 202, wherein each
k comprises a cEt nucleoside.
Embodiment 204
[0250] The compound of any of embodiments 186 to 202, wherein each
k comprises an LNA nucleoside.
Embodiment 205
[0251] The compound of any of embodiments 186 to 203, wherein each
e comprises a 2'-MOE modified nucleoside.
Embodiment 206
[0252] The compound of any of embodiments 186 to 203, wherein each
e comprises a 2'-OMe modified nucleoside.
Embodiment 207
[0253] The compound of any of embodiments 186 to 202, wherein each
k comprises a cEt nucleoside and each e comprises a 2'-MOE modified
nucleoside.
Embodiment 208
[0254] The compound of any of embodiments 89-202, wherein at least
one bicyclic nucleoside is a constrained ethyl nucleoside.
Embodiment 209
[0255] The compound of any of embodiments 89-202, wherein each
bicyclic nucleoside is a constrained ethyl nucleoside.
Embodiment 210
[0256] The compound of any of embodiments, 89-202, wherein at least
one bicyclic nucleoside is selected from among: BNA, LNA,
.alpha.-L-LNA, ENA and 2'-thio LNA.
Embodiment 211
[0257] The compound of any of embodiments, 89-202, wherein at least
one bicyclic nucleoside is an LNA nucleoside.
Embodiment 212
[0258] The compound of any of embodiments 89-202, wherein each
bicyclic nucleoside is an LNA nucleoside.
Embodiment 213
[0259] The compound of any of embodiments 89-202, wherein the
2'-substituent of the at least one 2'-substituted nucleoside is
selected from among: OCH.sub.3, F, OCH.sub.2F, OCHF.sub.2,
OCF.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F,
OCH.sub.2CHF.sub.2, OCH.sub.2CF.sub.3, OCH.sub.2--CH--CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--ON(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.6)--(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5)
and
O(CH.sub.2).sub.2--N(R.sub.6)--C(.dbd.NR.sub.7)[N(R.sub.4)(R.sub.5)]
wherein R.sub.4, R.sub.5, R.sub.6 and R.sub.7 are each,
independently, H or C.sub.1-C.sub.6 alkyl.
Embodiment 214
[0260] The compound of embodiment 213, wherein the 2'-substituent
of the at least one 2'-substituted nucleoside of is selected from
among: OCH.sub.3, F, and O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 215
[0261] The compound of embodiment 214, wherein the 2'-substituent
of the at least one 2'-substituted nucleoside is
O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 216
[0262] The compound of any of embodiments 89-202, wherein the
2'-substituent of each 2'-substituted nucleoside is selected from
among: OCH.sub.3, F, OCH.sub.2F, OCHF.sub.2, OCF.sub.3,
OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2F, OCH.sub.2CHF.sub.2,
OCH.sub.2CF.sub.3, OCH.sub.2--CH--CH.sub.2,
O(CH.sub.2).sub.2--OCH.sub.3, O(CH.sub.2).sub.2--SCH.sub.3,
O(CH.sub.2).sub.2--OCF.sub.3,
O(CH.sub.2).sub.3--N(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--ON(R.sub.4)(R.sub.5),
O(CH.sub.2).sub.2--O(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.4)(R.sub.5),
OCH.sub.2C(.dbd.O)--N(R.sub.6)--(CH.sub.2).sub.2--N(R.sub.4)(R.sub.5)
and
O(CH.sub.2).sub.2--N(R.sub.6)--C(.dbd.NR.sub.7)[N(R.sub.4)(R.sub.5)]
wherein R.sub.4, R.sub.5, R.sub.6 and R.sub.7 are each,
independently, H or C.sub.1-C.sub.6 alkyl.
Embodiment 217
[0263] The compound of embodiment 216, wherein the 2'-substituent
of each 2'-substituted nucleoside of is selected from among:
OCH.sub.3, F, and O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 218
[0264] The compound of embodiment 217, wherein the 2'-substituent
of each 2'-substituted nucleoside is
O(CH.sub.2).sub.2--OCH.sub.3.
Embodiment 219
[0265] The compound of any of embodiments 1-218, wherein the
oligonucleotide comprises at least one modified internucleoside
linkage.
Embodiment 220
[0266] The compound of embodiment 219, wherein each internucleoside
linkage is a modified internucleoside linkage.
Embodiment 221
[0267] The compound of embodiment 219 or 220, wherein the modified
internucleoside linkage is a phosphorothioate linkage.
Embodiment 222
[0268] The compound of embodiment 219 or 220, wherein the modified
internucleoside linkage is a methylphosphonate.
Embodiment 223
[0269] The compound of any of embodiments 1-222 comprising a
conjugate.
Embodiment 224
[0270] The compound of any of embodiments 1-223 comprising at least
one 5-methyl cytosine nucleobase.
Embodiment 225
[0271] The compound of any of embodiments 1-224 comprising at least
one modified nucleobase.
Embodiment 226
[0272] The compound of any of embodiments 1-225, wherein the
compound is an antisense compound.
Embodiment 227
[0273] The compound of embodiment 226, wherein the compound is
capable of inhibiting expression of the target nucleic acid in a
cell.
Embodiment 228
[0274] The compound of embodiment 227, wherein the compound is
capable of inhibiting expression of the target nucleic acid in a
cell by at least 50%.
Embodiment 229
[0275] The compound of embodiment 227, wherein the compound is
capable of inhibiting expression of the target nucleic acid in a
cell by at least 80%.
Embodiment 230
[0276] The compound of any of embodiments 227-229, wherein the cell
is in an animal.
Embodiment 231
[0277] The compound of embodiment 230, wherein the animal is a
human.
Embodiment 232
[0278] The compound of any of embodiments 1 to 231, wherein
bicyclic nucleoside is selected from among: BNA, LNA,
.alpha.-L-LNA, ENA and 2'-thio LNA.
Embodiment 233
[0279] A compound of any of embodiments 1-232, comprising not more
than 6 bicyclic nucleosides.
Embodiment 234
[0280] A compound of any of embodiments 1-232, comprising not more
than 5 bicyclic nucleosides.
Embodiment 235
[0281] A compound of any of embodiments 1-232, comprising not more
than 4 bicyclic nucleosides.
Embodiment 236
[0282] A compound of any of embodiments 1-232, comprising not more
than 3 bicyclic nucleosides.
Embodiment 237
[0283] A compound of any of embodiments 1-232, comprising not more
than 2 bicyclic nucleosides.
Embodiment 238
[0284] A compound of any of embodiments 1-232, comprising not more
than 1 bicyclic nucleoside.
Embodiment 239
[0285] The compound of any of embodiments 233-238, wherein the
bicyclic nucleoside comprises cEt.
Embodiment 240
[0286] The compound of any of embodiments 233-238, wherein the
bicyclic nucleoside comprises LNA.
Embodiment 241
[0287] A pharmaceutical composition comprising the compound
according to any of embodiments 1-240 and a pharmaceutically
acceptable diluent.
Embodiment 242
[0288] A method of modulating expression of a target nucleic acid
in a cell comprising contacting the cell with a compound according
to any of embodiments 1-240.
Embodiment 243
[0289] A method of modulating expression of a target nucleic acid
in an animal comprising administering to the animal the
pharmaceutical composition according to embodiment 242.
Embodiment 244
[0290] A method of manufacturing a compound according to any of
embodiments 1-241 comprising forming chemical bonds.
Embodiment 245
[0291] The method of embodiment 244, wherein said chemical bonds
are internucleoside linkages.
Embodiment 246
[0292] The method embodiment 244 or 245, wherein the method is
performed under conditions suitable for the preparation of products
for administration to humans.
Embodiment 247
[0293] A method of manufacturing the pharmaceutical composition
according to embodiment 246 comprising combining the compound
according to any of embodiments 1-241 and the pharmaceutically
acceptable diluent.
Embodiment 248
[0294] The method embodiment 247, wherein the method is performed
under conditions suitable for the preparation of products for
administration to humans.
Embodiment 249
[0295] A compound comprising a modified oligonucleotide having a
sugar motif selected from among sugar motifs 279-615 as shown in
Table 4.
Embodiment 250
[0296] A compound comprising: [0297] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide comprises: [0298] a 5'-wing consisting of 2 to 5
linked nucleosides; [0299] a 3'-wing consisting of 2 to 5 linked
nucleosides; and [0300] a gap between the 5'-wing and the 3'-wing
consisting of 6 to 14 linked 2'-deoxynucleosides; and [0301]
wherein the 5'-wing has a sugar modification motif selected from
among the motifs in Table 1.
Embodiment 251
[0302] A compound comprising: [0303] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide comprises: [0304] a 5'-wing consisting of 2 to 5
linked nucleosides; [0305] a 3'-wing consisting of 2 to 5 linked
nucleosides; and [0306] a gap between the 5'-wing and the 3'-wing
consisting of 6 to 14 linked 2'-deoxynucleosides; and [0307]
wherein the 3'-wing has a sugar modification motif selected from
among the motifs in Table 2.
Embodiment 252
[0308] A compound comprising: [0309] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide comprises: [0310] a 5'-wing consisting of 2 to 5
linked nucleosides; [0311] a 3'-wing consisting of 2 to 5 linked
nucleosides; and [0312] a gap between the 5'-wing and the 3'-wing
consisting of 6 to 14 linked 2'-deoxynucleosides; and [0313]
wherein the 5'-wing has a sugar modification motif selected from
among the motifs in Table 1 and the 3'-wing has a sugar
modification motif selected from among the motifs in Table 2.
Embodiment 253
[0314] A compound of any of embodiments 1-16, wherein the modified
oligonucleotide has a sugar motif described by Formula II as
follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).sub.v-(B-
).sub.w-(J).sub.x-(B).sub.y-(J).sub.z [0315] wherein: [0316] each A
is independently a 2'-substituted nucleoside; [0317] each B is
independently a bicyclic nucleoside; [0318] each J is independently
either a 2'-substituted nucleoside or a 2'-deoxynucleoside; [0319]
each D is a 2'-deoxynucleoside; [0320] m is 0-4; n is 0-2; p is
0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z
is 0-4; g is 6-14; provided that: [0321] at least one of m, n, and
r is other than 0; [0322] at least one of w and y is other than 0;
[0323] the sum of m, n, p, r, and t is from 1 to 5; and [0324] the
sum of v, w, x, y, and z is from 1 to 5.
Embodiment 254
[0325] A compound comprising: [0326] a modified oligonucleotide
consisting of 10 to 20 linked nucleosides, wherein the modified
oligonucleotide has a sugar motif described by Formula II as
follows:
[0326]
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.t-(D).sub.g-(A).s-
ub.v-(B).sub.w-(J).sub.x-(B).sub.y-(J).sub.z [0327] wherein: [0328]
each A is independently a 2'-substituted nucleoside; [0329] each B
is independently a bicyclic nucleoside; [0330] each J is
independently either a 2'-substituted nucleoside or a
2'-deoxynucleoside; [0331] each D is a 2'-deoxynucleoside; [0332] m
is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4;
x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that: [0333] at
least one of m, n, and r is other than 0; [0334] at least one of w
and y is other than 0; [0335] the sum of m, n, p, r, and t is from
1 to 5; and the sum of v, w, x, y, and z is from 1 to 5.
Embodiment 255
[0336] The compound of embodiment 253 or 254, wherein at least one
bicyclic nucleoside is a constrained ethyl nucleoside.
Embodiment 256
[0337] The compound of embodiment 255, wherein each bicyclic
nucleoside is a constrained ethyl nucleoside.
Embodiment 257
[0338] The compound of any of embodiments 253-254, wherein at least
one bicyclic nucleoside is an LNA nucleoside.
Embodiment 258
[0339] The compound of embodiments 250-254, wherein each bicyclic
nucleoside is an LNA nucleoside.
Embodiment 259
[0340] A method of treating a disease or condition.
Embodiment 260
[0341] Use of a compound of any of embodiments 1 to 259 for the
preparation of a medicament for the treatment of a disease or
condition.
Embodiment 261
[0342] The use of embodiment 260, wherein the disease or condition
is associated with a virus.
[0343] In certain embodiments, including but not limited to any of
the above numbered embodiments, compounds including
oligonucleotides described herein are capable of modulating
expression of a target mRNA. In certain embodiments, the target
mRNA is associated with a disease or disorder, or encodes a protein
that is associated with a disease or disorder. In certain
embodiments, the compounds or oligonucleotides provided herein
modulate the expression of function of such mRNA to alleviate one
or more symptom of the disease or disorder.
[0344] In certain embodiments, compounds including oligonucleotides
describe herein are useful in vitro. In certain embodiments such
compounds are used in diagnostics and/or for target validation
experiments.
DETAILED DESCRIPTION OF THE INVENTION
[0345] Unless specific definitions are provided, the nomenclature
used in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa.,
21.sup.st edition, 2005; and "Antisense Drug Technology,
Principles, Strategies, and Applications" Edited by Stanley T.
Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al.,
"Molecular Cloning, A laboratory Manual," 2.sup.nd Edition, Cold
Spring Harbor Laboratory Press, 1989, which are hereby incorporated
by reference for any purpose. Where permitted, all patents,
applications, published applications and other publications and
other data referred to throughout in the disclosure are
incorporated by reference herein in their entirety.
[0346] Unless otherwise indicated, the following terms have the
following meanings:
[0347] As used herein, "nucleoside" means a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA) and modified nucleosides. Nucleosides may be linked to a
phosphate moiety.
[0348] As used herein, "chemical modification" means a chemical
difference in a compound when compared to a naturally occurring
counterpart. In reference to an oligonucleotide, chemical
modification does not include differences only in nucleobase
sequence. Chemical modifications of oligonucleotides include
nucleoside modifications (including sugar moiety modifications and
nucleobase modifications) and internucleoside linkage
modifications.
[0349] As used herein, "furanosyl" means a structure comprising a
5-membered ring comprising four carbon atoms and one oxygen
atom.
[0350] As used herein, "naturally occurring sugar moiety" means a
ribofuranosyl as found in naturally occurring RNA or a
deoxyribofuranosyl as found in naturally occurring DNA.
[0351] As used herein, "sugar moiety" means a naturally occurring
sugar moiety or a modified sugar moiety of a nucleoside.
[0352] As used herein, "modified sugar moiety" means a substituted
sugar moiety or a sugar surrogate.
[0353] As used herein, "substituted sugar moiety" means a furanosyl
that is not a naturally occurring sugar moiety. Substituted sugar
moieties include, but are not limited to furanosyls comprising
substituents at the 2'-position, the 3'-position, the 5'-position
and/or the 4'-position. Certain substituted sugar moieties are
bicyclic sugar moieties.
[0354] As used herein, "2'-substituted sugar moiety" means a
furanosyl comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is
not a bicyclic sugar moiety (i.e., the 2'-substituent of a
2'-substituted sugar moiety does not form a bridge to another atom
of the furanosyl ring.
[0355] As used herein, "MOE" means
--OCH.sub.2CH.sub.2OCH.sub.3.
[0356] As used herein the term "sugar surrogate" means a structure
that does not comprise a furanosyl and that is capable of replacing
the naturally occurring sugar moiety of a nucleoside, such that the
resulting nucleoside is capable of (1) incorporation into an
oligonucleotide and (2) hybridization to a complementary
nucleoside. Such structures include rings comprising a different
number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings);
replacement of the oxygen of a furanosyl with a non-oxygen atom
(e.g., carbon, sulfur, or nitrogen); or both a change in the number
of atoms and a replacement of the oxygen. Such structures may also
comprise substitutions corresponding to those described for
substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic
sugar surrogates optionally comprising additional substituents).
Sugar surrogates also include more complex sugar replacements
(e.g., the non-ring systems of peptide nucleic acid). Sugar
surrogates include without limitation morpholinos, cyclohexenyls
and cyclohexitols.
[0357] As used herein, "bicyclic sugar moiety" means a modified
sugar moiety comprising a 4 to 7 membered ring (including but not
limited to a furanosyl) comprising a bridge connecting two atoms of
the 4 to 7 membered ring to form a second ring, resulting in a
bicyclic structure. In certain embodiments, the 4 to 7 membered
ring is a sugar ring. In certain embodiments the 4 to 7 membered
ring is a furanosyl. In certain such embodiments, the bridge
connects the 2'-carbon and the 4'-carbon of the furanosyl.
[0358] As used herein, "nucleotide" means a nucleoside further
comprising a phosphate linking group. As used herein, "linked
nucleosides" may or may not be linked by phosphate linkages and
thus includes, but is not limited to "linked nucleotides." As used
herein, "linked nucleosides" are nucleosides that are connected in
a continuous sequence (i.e. no additional nucleosides are present
between those that are linked).
[0359] As used herein, "nucleobase" means a group of atoms that can
be linked to a sugar moiety to create a nucleoside that is capable
of incorporation into an oligonucleotide, and wherein the group of
atoms is capable of bonding with a complementary naturally
occurring nucleobase of another oligonucleotide or nucleic acid.
Nucleobases may be naturally occurring or may be modified.
[0360] As used herein, "heterocyclic base" or "heterocyclic
nucleobase" means a nucleobase comprising a heterocyclic
structure.
[0361] As used herein the terms, "unmodified nucleobase" or
"naturally occurring nucleobase" means the naturally occurring
heterocyclic nucleobases of RNA or DNA: the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) (including 5-methyl C), and uracil (U).
[0362] As used herein, "modified nucleobase" means any nucleobase
that is not a naturally occurring nucleobase.
[0363] As used herein, "modified nucleoside" means a nucleoside
comprising at least one chemical modification compared to naturally
occurring RNA or DNA nucleosides. Modified nucleosides comprise a
modified sugar moiety and/or a modified nucleobase.
[0364] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety.
[0365] As used herein, "constrained ethyl nucleoside" or "cEt"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH(CH.sub.3)--O-2'-bridge.
[0366] As used herein, "locked nucleic acid nucleoside" or "LNA"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'-CH.sub.2--O-2'-bridge.
[0367] As used herein, "2'-substituted nucleoside" means a
nucleoside comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted nucleoside is
not a bicyclic nucleoside.
[0368] As used herein, "2'-deoxynucleoside" means a nucleoside
comprising 2'-H furanosyl sugar moiety, as found in naturally
occurring deoxyribonucleosides (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (e.g., uracil).
[0369] As used herein, "oligonucleotide" means a compound
comprising a plurality of linked nucleosides. In certain
embodiments, an oligonucleotide comprises one or more unmodified
ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA)
and/or one or more modified nucleosides.
[0370] As used herein "oligonucleoside" means an oligonucleotide in
which none of the internucleoside linkages contains a phosphorus
atom. As used herein, oligonucleotides include
oligonucleosides.
[0371] As used herein, "modified oligonucleotide" means an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0372] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides in an oligonucleotide.
[0373] As used herein "naturally occurring internucleoside linkage"
means a 3' to 5' phosphodiester linkage.
[0374] As used herein, "modified internucleoside linkage" means any
internucleoside linkage other than a naturally occurring
internucleoside linkage.
[0375] As used herein, "oligomeric compound" means a polymeric
structure comprising two or more sub-structures. In certain
embodiments, an oligomeric compound comprises an oligonucleotide.
In certain embodiments, an oligomeric compound comprises one or
more conjugate groups and/or terminal groups. In certain
embodiments, an oligomeric compound consists of an
oligonucleotide.
[0376] As used herein, "terminal group" means one or more atom
attached to either, or both, the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more terminal group nucleosides.
[0377] As used herein, "conjugate" means an atom or group of atoms
bound to an oligonucleotide or oligomeric compound. In general,
conjugate groups modify one or more properties of the compound to
which they are attached, including, but not limited to
pharmacodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and/or clearance
properties.
[0378] As used herein, "conjugate linking group" means any atom or
group of atoms used to attach a conjugate to an oligonucleotide or
oligomeric compound.
[0379] As used herein, "antisense compound" means a compound
comprising or consisting of an oligonucleotide at least a portion
of which is complementary to a target nucleic acid to which it is
capable of hybridizing, resulting in at least one antisense
activity.
[0380] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid.
[0381] As used herein, "detecting" or "measuring" means that a test
or assay for detecting or measuring is performed. Such detection
and/or measuring may result in a value of zero. Thus, if a test for
detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed.
[0382] As used herein, "detectable and/or measureable activity"
means a measurable activity that is not zero.
[0383] As used herein, "essentially unchanged" means little or no
change in a particular parameter, particularly relative to another
parameter which changes much more. In certain embodiments, a
parameter is essentially unchanged when it changes less than 5%. In
certain embodiments, a parameter is essentially unchanged if it
changes less than two-fold while another parameter changes at least
ten-fold. For example, in certain embodiments, an antisense
activity is a change in the amount of a target nucleic acid. In
certain such embodiments, the amount of a non-target nucleic acid
is essentially unchanged if it changes much less than the target
nucleic acid does, but the change need not be zero.
[0384] As used herein, "expression" means the process by which a
gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, post-transcriptional modification
(e.g., splicing, polyadenlyation, addition of 5'-cap), and
translation.
[0385] As used herein, "target nucleic acid" means a nucleic acid
molecule to which an antisense compound hybridizes.
[0386] As used herein, "single nucleotide polymorphism" or "SNP"
means a single nucleotide variation between the genomes of
individuals of the same species. In some cases, a SNP may be a
single nucleotide deletion or insertion.
[0387] As used herein, "mRNA" means an RNA molecule that encodes a
protein.
[0388] As used herein, "pre-mRNA" means an RNA transcript that has
not been fully processed into mRNA. Pre-RNA includes one or more
intron.
[0389] As used herein, "object RNA" means an RNA molecule other
than a target RNA, the amount, activity, splicing, and/or function
of which is modulated, either directly or indirectly, by a target
nucleic acid. In certain embodiments, a target nucleic acid
modulates splicing of an object RNA. In certain such embodiments,
an antisense compound modulates the amount or activity of the
target nucleic acid, resulting in a change in the splicing of an
object RNA and ultimately resulting in a change in the activity or
function of the object RNA.
[0390] As used herein, "microRNA" means a naturally occurring,
small, non-coding RNA that represses gene expression of at least
one mRNA. In certain embodiments, a microRNA represses gene
expression by binding to a target site within a 3' untranslated
region of an mRNA. In certain embodiments, a microRNA has a
nucleobase sequence as set forth in miRBase, a database of
published microRNA sequences found at
http://microrna.sanger.ac.uk/sequences/. In certain embodiments, a
microRNA has a nucleobase sequence as set forth in miRBase version
12.0 released September 2008, which is herein incorporated by
reference in its entirety.
[0391] As used herein, "microRNA mimic" means an oligomeric
compound having a sequence that is at least partially identical to
that of a microRNA. In certain embodiments, a microRNA mimic
comprises the microRNA seed region of a microRNA. In certain
embodiments, a microRNA mimic modulates translation of more than
one target nucleic acids. In certain embodiments, a microRNA mimic
is double-stranded.
[0392] As used herein, "targeting" or "targeted to" means the
association of an antisense compound to a particular target nucleic
acid molecule or a particular region of a target nucleic acid
molecule. An antisense compound targets a target nucleic acid if it
is sufficiently complementary to the target nucleic acid to allow
hybridization under physiological conditions.
[0393] As used herein, "nucleobase complementarity" or
"complementarity" when in reference to nucleobases means a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase means a nucleobase of
an antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair. Nucleobases comprising
certain modifications may maintain the ability to pair with a
counterpart nucleobase and thus, are still capable of nucleobase
complementarity.
[0394] As used herein, "non-complementary" in reference to
nucleobases means a pair of nucleobases that do not form hydrogen
bonds with one another.
[0395] As used herein, "complementary" in reference to oligomeric
compounds (e.g., linked nucleosides, oligonucleotides, or nucleic
acids) means the capacity of such oligomeric compounds or regions
thereof to hybridize to another oligomeric compound or region
thereof through nucleobase complementarity under stringent
conditions. Complementary oligomeric compounds need not have
nucleobase complementarity at each nucleoside. Rather, some
mismatches are tolerated. In certain embodiments, complementary
oligomeric compounds or regions are complementary at 70% of the
nucleobases (70% complementary). In certain embodiments,
complementary oligomeric compounds or regions are 80%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 90% complementary. In certain embodiments,
complementary oligomeric compounds or regions are 95%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 100% complementary.
[0396] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleobases.
[0397] As used herein, "specifically hybridizes" means the ability
of an oligomeric compound to hybridize to one nucleic acid site
with greater affinity than it hybridizes to another nucleic acid
site. In certain embodiments, an antisense oligonucleotide
specifically hybridizes to more than one target site.
[0398] As used herein, "fully complementary" in reference to an
oligonucleotide or portion thereof means that each nucleobase of
the oligonucleotide or portion thereof is capable of pairing with a
nucleobase of a complementary nucleic acid or contiguous portion
thereof. Thus, a fully complementary region comprises no mismatches
or unhybridized nucleobases in either strand.
[0399] As used herein, "percent complementarity" means the
percentage of nucleobases of an oligomeric compound that are
complementary to an equal-length portion of a target nucleic acid.
Percent complementarity is calculated by dividing the number of
nucleobases of the oligomeric compound that are complementary to
nucleobases at corresponding positions in the target nucleic acid
by the total length of the oligomeric compound.
[0400] As used herein, "percent identity" means the number of
nucleobases in a first nucleic acid that are the same type
(independent of chemical modification) as nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid.
[0401] As used herein, "modulation" means a change of amount or
quality of a molecule, function, or activity when compared to the
amount or quality of a molecule, function, or activity prior to
modulation. For example, modulation includes the change, either an
increase (stimulation or induction) or a decrease (inhibition or
reduction) in gene expression. As a further example, modulation of
expression can include a change in splice site selection of
pre-mRNA processing, resulting in a change in the absolute or
relative amount of a particular splice-variant compared to the
amount in the absence of modulation.
[0402] As used herein, "motif" means a pattern of chemical
modifications in an oligomeric compound or a region thereof. Motifs
may be defined by modifications at certain nucleosides and/or at
certain linking groups of an oligomeric compound.
[0403] As used herein, "nucleoside motif" means a pattern of
nucleoside modifications in an oligomeric compound or a region
thereof. The linkages of such an oligomeric compound may be
modified or unmodified. Unless otherwise indicated, motifs herein
describing only nucleosides are intended to be nucleoside motifs.
Thus, in such instances, the linkages are not limited.
[0404] As used herein, "sugar motif" means a pattern of sugar
modifications in an oligomeric compound or a region thereof
[0405] As used herein, "linkage motif" means a pattern of linkage
modifications in an oligomeric compound or region thereof. The
nucleosides of such an oligomeric compound may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only linkages are intended to be linkage motifs. Thus, in such
instances, the nucleosides are not limited.
[0406] As used herein, "nucleobase modification motif" means a
pattern of modifications to nucleobases along an oligonucleotide.
Unless otherwise indicated, a nucleobase modification motif is
independent of the nucleobase sequence.
[0407] As used herein, "sequence motif" means a pattern of
nucleobases arranged along an oligonucleotide or portion thereof.
Unless otherwise indicated, a sequence motif is independent of
chemical modifications and thus may have any combination of
chemical modifications, including no chemical modifications.
[0408] As used herein, "type of modification" in reference to a
nucleoside or a nucleoside of a "type" means the chemical
modification of a nucleoside and includes modified and unmodified
nucleosides. Accordingly, unless otherwise indicated, a "nucleoside
having a modification of a first type" may be an unmodified
nucleoside.
[0409] As used herein, "differently modified" mean chemical
modifications or chemical substituents that are different from one
another, including absence of modifications. Thus, for example, a
MOE nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified. For example, a nucleoside comprising a 2'-OMe
modified sugar and an unmodified adenine nucleobase and a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
thymine nucleobase are not differently modified.
[0410] As used herein, "the same type of modifications" refers to
modifications that are the same as one another, including absence
of modifications. Thus, for example, two unmodified DNA nucleoside
have "the same type of modification," even though the DNA
nucleoside is unmodified. Such nucleosides having the same type
modification may comprise different nucleobases.
[0411] As used herein, "separate regions" means portions of an
oligonucleotide wherein the chemical modifications or the motif of
chemical modifications of any neighboring portions include at least
one difference to allow the separate regions to be distinguished
from one another.
[0412] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline.
[0413] As used herein, "substituent" and "substituent group," means
an atom or group that replaces the atom or group of a named parent
compound. For example a substituent of a modified nucleoside is any
atom or group that differs from the atom or group found in a
naturally occurring nucleoside (e.g., a modified 2'-substuent is
any atom or group at the 2'-position of a nucleoside other than H
or OH). Substituent groups can be protected or unprotected. In
certain embodiments, compounds of the present invention have
substituents at one or at more than one position of the parent
compound. Substituents may also be further substituted with other
substituent groups and may be attached directly or via a linking
group such as an alkyl or hydrocarbyl group to a parent
compound.
[0414] Likewise, as used herein, "substituent" in reference to a
chemical functional group means an atom or group of atoms differs
from the atom or a group of atoms normally present in the named
functional group. In certain embodiments, a substituent replaces a
hydrogen atom of the functional group (e.g., in certain
embodiments, the substituent of a substituted methyl group is an
atom or group other than hydrogen which replaces one of the
hydrogen atoms of an unsubstituted methyl group). Unless otherwise
indicated, groups amenable for use as substituents include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido
(--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa),
ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)--(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S--(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb
and R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0415] As used herein, "alkyl," as used herein, means a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred.
[0416] As used herein, "alkenyl," means a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include without limitation, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0417] As used herein, "alkynyl," means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl,
and the like. Alkynyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkynyl groups
as used herein may optionally include one or more further
substituent groups.
[0418] As used herein, "acyl," means a radical formed by removal of
a hydroxyl group from an organic acid and has the general Formula
--C(O)--X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic
sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used
herein may optionally include further substituent groups.
[0419] As used herein, "alicyclic" means a cyclic ring system
wherein the ring is aliphatic. The ring system can comprise one or
more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substituent groups.
[0420] As used herein, "aliphatic" means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms
wherein the saturation between any two carbon atoms is a single,
double or triple bond. An aliphatic group preferably contains from
1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms with from 1 to about 6 carbon atoms being more
preferred. The straight or branched chain of an aliphatic group may
be interrupted with one or more heteroatoms that include nitrogen,
oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by
heteroatoms include without limitation, polyalkoxys, such as
polyalkylene glycols, polyamines, and polyimines Aliphatic groups
as used herein may optionally include further substituent
groups.
[0421] As used herein, "alkoxy" means a radical formed between an
alkyl group and an oxygen atom wherein the oxygen atom is used to
attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include without limitation, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0422] As used herein, "aminoalkyl" means an amino substituted
C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical
forms a covalent bond with a parent molecule. The amino group can
be located at any position and the aminoalkyl group can be
substituted with a further substituent group at the alkyl and/or
amino portions.
[0423] As used herein, "aralkyl" and "arylalkyl" mean an aromatic
group that is covalently linked to a C.sub.1-C.sub.12 alkyl
radical. The alkyl radical portion of the resulting aralkyl (or
arylalkyl) group forms a covalent bond with a parent molecule.
Examples include without limitation, benzyl, phenethyl and the
like. Aralkyl groups as used herein may optionally include further
substituent groups attached to the alkyl, the aryl or both groups
that form the radical group.
[0424] As used herein, "aryl" and "aromatic" mean a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include without limitation,
phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon
atoms in one or more rings. Aryl groups as used herein may
optionally include further substituent groups.
[0425] As used herein, "halo" and "halogen," mean an atom selected
from fluorine, chlorine, bromine and iodine.
[0426] As used herein, "heteroaryl," and "heteroaromatic," mean a
radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatoms. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include without limitation,
pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl,
thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl,
thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl,
benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can
be attached to a parent molecule directly or through a linking
moiety such as an aliphatic group or hetero atom. Heteroaryl groups
as used herein may optionally include further substituent
groups.
Oligomeric Compounds
[0427] In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, such oligomeric
compounds comprise oligonucleotides optionally comprising one or
more conjugate and/or terminal groups. In certain embodiments, an
oligomeric compound consists of an oligonucleotide. In certain
embodiments, oligonucleotides comprise one or more chemical
modifications. Such chemical modifications include modifications
one or more nucleoside (including modifications to the sugar moiety
and/or the nucleobase) and/or modifications to one or more
internucleoside linkage.
[0428] Certain Sugar Moieties
[0429] In certain embodiments, oligomeric compounds of the
invention comprise one or more modified nucleosides comprising a
modified sugar moiety. Such oligomeric compounds comprising one or
more sugar-modified nucleosides may have desirable properties, such
as enhanced nuclease stability or increased binding affinity with a
target nucleic acid relative to oligomeric compounds comprising
only nucleosides comprising naturally occurring sugar moieties. In
certain embodiments, modified sugar moieties are substituted sugar
moieties. In certain embodiments, modified sugar moieties are sugar
surrogates. Such sugar surrogates may comprise one or more
substitutions corresponding to those of substituted sugar
moieties.
[0430] In certain embodiments, modified sugar moieties are
substituted sugar moieties comprising one or more non-bridging
sugar substituent, including but not limited to substituents at the
2' and/or 5' positions. Examples of sugar substituents suitable for
the 2'-position, include, but are not limited to: 2'-F,
2'-OCH.sub.3 ("OMe" or "O-methyl"), and
2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
sugar substituents at the 2' position is selected from allyl,
amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
O--C.sub.1-C.sub.10 substituted alkyl; OCF.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O--N(Rm)(Rn), and
O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C.sub.1-C.sub.10
alkyl. Examples of sugar substituents at the 5'-position, include,
but are not limited to: 5'-methyl (R or S); 5'-vinyl, and
5'-methoxy. In certain embodiments, substituted sugars comprise
more than one non-bridging sugar substituent, for example,
2'-F-5'-methyl sugar moieties (see, e.g., PCT International
Application WO 2008/101157, for additional 5',2'-bis substituted
sugar moieties and nucleosides).
[0431] Nucleosides comprising 2'-substituted sugar moieties are
referred to as 2'-substituted nucleosides. In certain embodiments,
a 2'-substituted nucleoside comprises a 2'-substituent group
selected from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3,
OCF.sub.3, O, S, or N(R.sub.m)-alkyl; O, S, or N(R.sub.m)-alkenyl;
O, S or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl,
aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0432] In certain embodiments, a 2'-substituted nucleoside
comprises a 2'-substituent group selected from F, NH.sub.2,
N.sub.3, OCF.sub.3, O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH.sub.2--CH--CH.sub.2, O--CH.sub.2--CH--CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0433] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, OCF.sub.3, O--CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0434] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, O--CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0435] Certain modified sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' sugar substituents, include, but are not
limited to: --[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'-CH.sub.2-2',
4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-(CH.sub.2)--O-2'
(LNA); 4'-(CH.sub.2)--S-2; 4'-(CH.sub.2).sub.2--O-2' (ENA);
4'-CH(CH.sub.3)--O-2' (cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2',and
analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul.
15, 2008); 4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof,
(see, e.g., WO2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0436] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--;
[0437] wherein:
[0438] x is 0, 1, or 2;
[0439] n is 1, 2, 3, or 4;
[0440] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0441] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0442] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include,
but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA (also referred to as locked nucleic acid or
LNA), (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H)
methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic
(4'-CH.sub.2--CH(CH.sub.3)-2') BNA, and (J) propylene carbocyclic
(4'-(CH.sub.2).sub.3-2') BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0443] Additional bicyclic sugar moieties are known in the art, for
example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et
al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499,
7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO
1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Applications Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0444] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2'-methylene-oxy bridge, may be in the .alpha.-L
configuration or in the .beta.-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') bicyclic nucleosides
have been incorporated into antisense oligonucleotides that showed
antisense activity (Frieden et al., Nucleic Acids Research, 2003,
21, 6365-6372).
[0445] In certain embodiments, substituted sugar moieties comprise
one or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).
(see, PCT International Application WO 2007/134181, published on
Nov. 22, 2007, wherein LNA is substituted with, for example, a
5'-methyl or a 5'-vinyl group).
[0446] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
naturally occurring sugar is substituted, e.g., with a sulfer,
carbon or nitrogen atom. In certain such embodiments, such modified
sugar moiety also comprises bridging and/or non-bridging
substituents as described above. For example, certain sugar
surrogates comprise a 4'-sulfer atom and a substitution at the
2'-position (see, e.g., published U.S. Patent Application
US2005/0130923, published on Jun. 16, 2005) and/or the 5' position.
By way of additional example, carbocyclic bicyclic nucleosides
having a 4'-2' bridge have been described (see, e.g., Freier et
al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et
al., J. Org. Chem., 2006, 71, 7731-7740).
[0447] In certain embodiments, sugar surrogates comprise rings
having other than 5-atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran. Such
tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include, but
are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid
(ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. &
Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those
compounds having Formula VII:
##STR00003##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula VII:
[0448] Bx is a nucleobase moiety;
[0449] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5' or 3'-terminal group; [0450]
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7
are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl; and
[0451] one of R.sub.1 and R.sub.2 is hydrogen and the other is
selected from halogen, substituted or unsubstituted alkoxy,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and
CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0452] In certain embodiments, the modified THP nucleosides of
Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3,
q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP
nucleosides of Formula VII are provided wherein one of R.sub.1 and
R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2
is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is
methoxyethoxy and R.sub.2 is H.
[0453] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see, e.g., review
article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002,
10, 841-854).
[0454] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 Published on Aug. 21, 2008
for other disclosed 5',2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0455] Certain Nucleobases
[0456] In certain embodiments, nucleosides of the present invention
comprise one or more unmodified nucleobases. In certain
embodiments, nucleosides of the present invention comprise one or
more modified nucleobases.
[0457] In certain embodiments, modified nucleobases are selected
from: universal bases, hydrophobic bases, promiscuous bases,
size-expanded bases, and fluorinated bases as defined herein.
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and
3-deazaadenine, universal bases, hydrophobic bases, promiscuous
bases, size-expanded bases, and fluorinated bases as defined
herein. Further modified nucleobases include tricyclic pyrimidines
such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0458] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include without limitation, U.S.
Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617;
5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and
6,005,096, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0459] Certain Internucleoside Linkages
[0460] In certain embodiments, the present invention provides
oligomeric compounds comprising linked nucleosides. In such
embodiments, nucleosides may be linked together using any
internucleoside linkage. The two main classes of internucleoside
linking groups are defined by the presence or absence of a
phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the oligomeric compound.
In certain embodiments, internucleoside linkages having a chiral
atom can be prepared as a racemic mixture, or as separate
enantiomers. Representative chiral linkages include, but are not
limited to, alkylphosphonates and phosphorothioates. Methods of
preparation of phosphorous-containing and
non-phosphorous-containing internucleoside linkages are well known
to those skilled in the art.
[0461] The oligonucleotides described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.alpha. or .beta. such as for sugar anomers, or as (D) or (L) such
as for amino acids etc. Included in the antisense compounds
provided herein are all such possible isomers, as well as their
racemic and optically pure forms.
[0462] Neutral internucleoside linkages include without limitation,
phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5').
Further neutral internucleoside linkages include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4,
40-65). Further neutral internucleoside linkages include nonionic
linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0463] Certain Motifs
[0464] In certain embodiments, the present invention provides
oligomeric compounds comprising oligonucleotides. In certain
embodiments, such oligonucleotides comprise one or more chemical
modification. In certain embodiments, chemically modified
oligonucleotides comprise one or more modified sugars. In certain
embodiments, chemically modified oligonucleotides comprise one or
more modified nucleobases. In certain embodiments, chemically
modified oligonucleotides comprise one or more modified
internucleoside linkages. In certain embodiments, the chemically
modifications (sugar modifications, nucleobase modifications,
and/or linkage modifications) define a pattern or motif. In certain
embodiments, the patterns of chemical modifications of sugar
moieties, internucleoside linkages, and nucleobases are each
independent of one another. Thus, an oligonucleotide may be
described by its sugar modification motif, internucleoside linkage
motif and/or nucleobase modification motif (as used herein,
nucleobase modification motif describes the chemical modifications
to the nucleobases independent of the sequence of nucleobases).
[0465] Certain Sugar Motifs
[0466] In certain embodiments, oligonucleotides comprise one or
more type of modified sugar moieties and/or naturally occurring
sugar moieties arranged along an oligonucleotide or region thereof
in a defined pattern or sugar modification motif. Such motifs may
include any of the sugar modifications discussed herein and/or
other known sugar modifications.
[0467] In certain embodiments, the oligonucleotides comprise or
consist of a region having a gapmer sugar modification motif, which
comprises two external regions or "wings" and an internal region or
"gap." The three regions of a gapmer motif (the 5'-wing, the gap,
and the 3'-wing) form a contiguous sequence of nucleosides wherein
at least some of the sugar moieties of the nucleosides of each of
the wings differ from at least some of the sugar moieties of the
nucleosides of the gap. Specifically, at least the sugar moieties
of the nucleosides of each wing that are closest to the gap (the
3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the
3'-wing) differ from the sugar moiety of the neighboring gap
nucleosides, thus defining the boundary between the wings and the
gap. In certain embodiments, the sugar moieties within the gap are
the same as one another. In certain embodiments, the gap includes
one or more nucleoside having a sugar moiety that differs from the
sugar moiety of one or more other nucleosides of the gap. In
certain embodiments, the sugar modification motifs of the two wings
are the same as one another (symmetric gapmer). In certain
embodiments, the sugar modification motifs of the 5'-wing differs
from the sugar modification motif of the 3'-wing (asymmetric
gapmer).
[0468] Certain 5'-Wings
[0469] In certain embodiments, the 5'-wing of a gapmer consists of
1 to 5 linked nucleosides. In certain embodiments, the 5'-wing of a
gapmer consists of 2 to 5 linked nucleosides. In certain
embodiments, the 5'-wing of a gapmer consists of 3 to 5 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 4 or 5 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 1 to 4 linked nucleosides. In
certain embodiments, the 5'-wing of a gapmer consists of 1 to 3
linked nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 1 or 2 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 2 to 4 linked nucleosides. In
certain embodiments, the 5'-wing of a gapmer consists of 2 or 3
linked nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 3 or 4 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 1 nucleoside. In certain
embodiments, the 5'-wing of a gapmer consists of 2 linked
nucleosides. In certain embodiments, the 5'-wing of a gapmer
consists of 3 linked nucleosides. In certain embodiments, the
5'-wing of a gapmer consists of 4 linked nucleosides. In certain
embodiments, the 5'-wing of a gapmer consists of 5 linked
nucleosides.
[0470] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside. In certain embodiments, the 5'-wing
of a gapmer comprises at least two bicyclic nucleosides. In certain
embodiments, the 5'-wing of a gapmer comprises at least three
bicyclic nucleosides. In certain embodiments, the 5'-wing of a
gapmer comprises at least four bicyclic nucleosides. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside. In certain embodiments, the 5'-wing
of a gapmer comprises at least one LNA nucleoside. In certain
embodiments, each nucleoside of the 5'-wing of a gapmer is a
bicyclic nucleoside. In certain embodiments, each nucleoside of the
5'-wing of a gapmer is a constrained ethyl nucleoside. In certain
embodiments, each nucleoside of the 5'-wing of a gapmer is a LNA
nucleoside.
[0471] In certain embodiments, the 5'-wing of a gapmer comprises at
least one non-bicyclic modified nucleoside. In certain embodiments,
the 5'-wing of a gapmer comprises at least one 2'-substituted
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one 2'-MOE nucleoside. In certain embodiments,
the 5'-wing of a gapmer comprises at least one 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the 5'-wing of a gapmer
is a non-bicyclic modified nucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-substituted
nucleoside. In certain embodiments, each nucleoside of the 5'-wing
of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-OMe nucleoside.
[0472] In certain embodiments, the 5'-wing of a gapmer comprises at
least one 2'-deoxynucleoside. In certain embodiments, each
nucleoside of the 5'-wing of a gapmer is a 2'-deoxynucleoside. In a
certain embodiments, the 5'-wing of a gapmer comprises at least one
ribonucleoside. In certain embodiments, each nucleoside of the
5'-wing of a gapmer is a ribonucleoside.
[0473] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside and at least one non-bicyclic
modified nucleoside. In certain embodiments, the 5'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 5'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one
2'-deoxynucleoside.
[0474] In certain embodiments, the 5'-wing of a gapmer comprises at
least one constrained ethyl nucleoside and at least one
non-bicyclic modified nucleoside. In certain embodiments, the
5'-wing of a gapmer comprises at least one constrained ethyl
nucleoside and at least one 2'-substituted nucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In
certain embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In
certain embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one
2'-deoxynucleoside.
[0475] In certain embodiments, the 5'-wing of a gapmer comprises at
least one LNA nucleoside and at least one non-bicyclic modified
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 5'-wing of a
gapmer comprises at least one LNA nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one LNA nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-deoxynucleoside.
[0476] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one LNA
nucleoside, at least one non-bicyclic modified nucleoside, and at
least one 2'-deoxynucleoside.
[0477] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 5'-wing of a gapmer comprises at least one LNA
nucleoside, at least one 2'-substituted nucleoside, and at least
one 2'-deoxynucleoside.
[0478] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-MOE nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
5'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-MOE nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-MOE
nucleoside, and at least one 2'-deoxynucleoside.
[0479] In certain embodiments, the 5'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-OMe nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
5'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-OMe nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 5'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-OMe
nucleoside, and at least one 2'-deoxynucleoside.
[0480] In certain embodiments, the 5'-wing of a gapmer has a sugar
motif selected from among those listed in the following
non-limiting table:
TABLE-US-00002 TABLE 1 Certain 5'-Wing Sugar Motifs 5'-wing 5'-wing
5'-wing sugar sugar sugar motif # motif motif # motif motif # motif
1a A-B-B 1d A-L-L 1g A-K-K 2a A-A-B 2d A-A-L 2g A-A-K 3a A-D-B 3d
A-D-L 3g A-D-K 4a B-D-A 4d L-D-A 4g K-D-A 5a B-A-A 5d L-A-A 5g
K-A-A 6a B-B-B 6d L-L-L 6g K-K-K 7a A-A-A 7d A-A-A 7g A-A-A 8a
A-D-D-B 8d A-D-D-L 8g A-D-D-K 9a B-D-D-A 9d L-D-D-A 9g K-D-D-A 10a
A-A-A-B 10d A-A-A-L 10g A-A-A-K 11a B-A-A-A 11d L-A-A-A 11g K-A-A-A
12a A-A-A-A 12d A-A-A-A 12g A-A-A-A 13a B-D-D-B 13d L-D-D-L 13g
K-D-D-K 14a A-A-A-A 14d A-A-A-A 14g A-A-A-A 15a B-B-B-B 15d L-L-L-L
15g K-K-K-K 16a A-A-A-A-A 16d A-A-A-A-A 16g A-A-A-A-A 17a A-D-A-D-B
17d A-D-A-D-L 17g A-D-A-D-K 18a A-D-B-D-A 18d A-D-L-D-A 18g
A-D-K-D-A 19a B-D-A-D-A 19d L-D-A-D-A 19g K-D-A-D-A 20a A-A-A-A-B
20d A-A-A-A-L 20g A-A-A-A-K 21a A-A-B-A-A 21d A-A-L-A-A 21g
A-A-K-A-A 22a B-A-A-A-A 22d L-A-A-A-A 22g K-A-A-A-A 1b E-B-B 1e
E-L-L 1h E-K-K 2b E-E-B 2e E-E-L 2h E-E-K 3b E-D-B 3e E-D-L 3h
E-D-K 4b B-D-E 4e L-D-E 4h K-D-E 5b B-E-E 5e L-E-E 5h K-E-E 6b
B-B-B 6e L-L-L 6h K-K-K 7b E-E-E 7e E-E-E 7h E-E-E 8b E-D-D-B 8e
E-D-D-L 8h E-D-D-K 9b B-D-D-E 9e L-D-D-E 9h K-D-D-E 10b E-E-E-B 10e
E-E-E-L 10h E-E-E-K 11b B-E-E-E 11e L-E-E-E 11h K-E-E-E 12b E-E-E-E
12e E-E-E-E 12h E-E-E-E 13b B-D-D-B 13e L-D-D-L 13h K-D-D-K 14b
E-E-E-E 14e E-E-E-E 14h E-E-E-E 15b B-B-B-B 15e L-L-L-L 15h K-K-K-K
16b E-E-E-E-E 16e E-E-E-E-E 16h E-E-E-E-E 17b E-D-E-D-B 17e
E-D-E-D-L 17h E-D-E-D-K 18b E-D-B-D-E 18e E-D-L-D-E 18h E-D-K-D-E
19b B-D-E-D-E 19e L-D-E-D-E 19h K-D-E-D-E 20b E-E-E-E-B 20e
E-E-E-E-L 20h E-E-E-E-K 21b E-E-B-E-E 21e E-E-L-E-E 21h E-E-K-E-E
22b B-E-E-E-E 22e L-E-E-E-E 22h K-E-E-E-E 1c M-B-B 1f M-L-L 1i
M-K-K 2c M-M-B 2f M-M-L 2i M-M-K 3c M-D-B 3f M-D-L 3i M-D-K 4c
B-D-M 4f L-D-M 4i K-D-M 5c B-M-M 5f L-M-M 5i K-M-M 6c B-B-B 6f
L-L-L 6i K-K-K 7c M-M-M 7f M-M-M 7i M-M-M 8c M-D-D-B 8f M-D-D-L 8i
M-D-D-K 9c B-D-D-M 9f L-D-D-M 9i K-D-D-M 10c M-M-M-B 10f M-M-M-L
10i M-M-M-K 11c B-M-M-M 11f L-M-M-M 11i K-M-M-M 12c M-M-M-M 12f
M-M-M-M 12i M-M-M-M 13c B-D-D-B 13f L-D-D-L 13i K-D-D-K 14c M-M-M-M
14f M-M-M-M 14i M-M-M-M 15c B-B-B-B 15f L-L-L-L 15i K-K-K-K 16c
M-M-M- 16f M-M-M-M-M 16i M-M-M- M-M M-M 17c M-D-M-D-B 17f M-D-M-D-L
17i M-D-M-D-K 18c M-D-B-D-M 18f M-D-L-D-M 18i M-D-K-D-M 19c
B-D-M-D-M 19f L-D-M-D-M 19i K-D-M-D-M 20c M-M-M- 20f M-M-M-M-L 20i
M-M-M- M-B M-K 21c M-M-B- 21f M-M-L-M-M 21i M-M-K- M-M M-M 22c
B-M-M- 22f L-M-M-M-M 22i K-M-M- M-M M-M 1j A-L-K 1k A-K-L 1l E-L-K
2j M-E-K 2k M-E-L 2l E-M-K 3j L-D-K 3k K-D-L 3l B-D-K 4j K-D-A 4k
L-D-K 4l K-B-L 5j B-M-E 5k L-M-E 5l K-M-E 6j K-L-L 6k L-K-L 6l
L-K-K 7j E-M-E 7k M-E-M 7l M-E-E 8j E-D-D-M 8k K-D-D-L 8l L-D-D-K
9j M-D-D-E 9k L-D-K-E 9l K-D-L-E 10j E-M-E-B 10k E-M-E-L 10l
E-M-E-K 11j B-E-E-M 11k L-E-E-M 11l K-E-E-M 12j E-E-E-M 12k M-E-E-E
12l E-M-E-E 13j K-L-D-K 13k L-K-D-L 13l K-D-L-K 14j E-M-E-M 14k
M-EM-E 14l E-E-M-E 15j K-L-L-K 15k L-K-L-K 15l K-L-K-K 16j
E-E-M-E-E 16k M-E-E-E-M 16l E-E-M-M-E 17j E-D-M-D-K 17k E-D-M-D-L
17l M-D-E-D-K 18j E-D-K-D-M 18k E-D-L-D-M 18l M-D-K-D-E 19j
B-D-A-D-A 19k L-D-A-D-A 19l K-D-A-D-A 20j E-M-E-E-L 20k E-M-M-E-L
20l M-E-E-E-K 21j E-E-K-M-M 21k E-E-L-M-M 21l E-M-K-E-E 22j
B-E-M-E-A 22k L-E-A-M-A 22l K-E-A-A-A 23j K-D-K-D-K 23k
E-K-E-K-D-K
[0481] In the above table, "A" represents a nucleoside comprising a
2'-substituted sugar moiety; "B" represents a bicyclic nucleoside;
"D" represents a 2'-deoxynucleoside; "K" represents a constrained
ethyl nucleoside; "L" represents an LNA nucleoside; "E" represents
a 2'-MOE nucleoside; and "M" represents a 2'-OMe nucleoside.
[0482] In certain embodiments, an oligonucleotide comprises any
5'-wing motif provided herein. In certain such embodiments, the
oligonucleotide is a 5'-hemimer (does not comprise a 3'-wing). In
certain embodiments, such an oligonucleotide is a gapmer. In
certain such embodiments, the 3'-wing of the gapmer may comprise
any sugar modification motif.
[0483] In certain embodiments, the 5'-wing of a gapmer has a sugar
motif selected from among those listed in the following
non-limiting tables:
TABLE-US-00003 TABLE 2 Certain 5'-Wing Sugar Motifs Certain 5'-Wing
Sugar Motifs AAAAA ABCBB BABCC BCBBA CBACC AAAAB ABCBC BACAA BCBBB
CBBAA AAAAC ABCCA BACAB BCBBC CBBAB AAABA ABCCB BACAC BCBCA CBBAC
AAABB ABCCC BACBA BCBCB CBBBA AAABC ACAAA BACBB BCBCC CBBBB AAACA
ACAAB BACBC BCCAA CBBBC AAACB ACAAC BACCA BCCAB CBBCA AAACC ACABA
BACCB BCCAC CBBCB AABAA ACABB BACCC BCCBA CBBCC AABAB ACABC BBAAA
BCCBB CBCAA AABAC ACACA BBAAB BCCBC CBCAB AABBA ACACB BBAAC BCCCA
CBCAC AABBB ACACC BBABA BCCCB CBCBA AABBC ACBAA BBABB BCCCC CBCBB
AABCA ACBAB BBABC CAAAA CBCBC AABCB ACBAC BBACA CAAAB CBCCA AABCC
ACBBA BBACB CAAAC CBCCB AACAA ACBBB BBACC CAABA CBCCC AACAB ACBBC
BBBAA CAABB CCAAA AACAC ACBCA BBBAB CAABC CCAAB AACBA ACBCB BBBAC
CAACA CCAAC AACBB ACBCC BBBBA CAACB CCABA AACBC ACCAA BBBBB CAACC
CCABB AACCA ACCAB BBBBC CABAA CCABC AACCB ACCAC BBBCA CABAB CCACA
AACCC ACCBA BBBCB CABAC CCACB ABAAA ACCBB BBBCC CABBA CCACC ABAAB
ACCBC BBCAA CABBB CCBAA ABAAC ACCCA BBCAB CABBC CCBAB ABABA ACCCB
BBCAC CABCA CCBAC ABABB ACCCC BBCBA CABCB CCBBA ABABC BAAAA BBCBB
CABCC CCBBB ABACA BAAAB BBCBC CACAA CCBBC ABACB BAAAC BBCCA CACAB
CCBCA ABACC BAABA BBCCB CACAC CCBCB ABBAA BAABB BBCCC CACBA CCBCC
ABBAB BAABC BCAAA CACBB CCCAA ABBAC BAACA BCAAB CACBC CCCAB ABBBA
BAACB BCAAC CACCA CCCAC ABBBB BAACC BCABA CACCB CCCBA ABBBC BABAA
BCABB CACCC CCCBB ABBCA BABAB BCABC CBAAA CCCBC ABBCB BABAC BCACA
CBAAB CCCCA ABBCC BABBA BCACB CBAAC CCCCB ABCAA BABBB BCACC CBABA
CCCCC ABCAB BABBC BCBAA CBABB ABCAC BABCA BCBAB CBABC ABCBA BABCB
BCBAC CBACA
TABLE-US-00004 TABLE 3 Certain 5'-Wing Sugar Motifs Certain 5'-Wing
Sugar Motifs AAAAA BABC CBAB ABBB BAA AAAAB BACA CBAC BAAA BAB
AAABA BACB CBBA BAAB BBA AAABB BACC CBBB BABA BBB AABAA BBAA CBBC
BABB AA AABAB BBAB CBCA BBAA AB AABBA BBAC CBCB BBAB AC AABBB BBBA
CBCC BBBA BA ABAAA BBBB CCAA BBBB BB ABAAB BBBC CCAB AAA BC ABABA
BBCA CCAC AAB CA ABABB BBCB CCBA AAC CB ABBAA BBCC CCBB ABA CC
ABBAB BCAA CCBC ABB AA ABBBA BCAB CCCA ABC AB ABBBB BCAC CCCB ACA
BA BAAAA ABCB BCBA ACB BAAAB ABCC BCBB ACC BAABA ACAA BCBC BAA
BAABB ACAB BCCA BAB BABAA ACAC BCCB BAC BABAB AC BA BCCC BBA BABBA
ACBB CAAA BBB BABBB ACBC CAAB BBC BBAAA ACCA CAAC BCA BBAAB ACCB
CABA BCB BBABA ACCC CABB BCC BBABB BAAA CABC CAA BBBAA BAAB CACA
CAB BBBAB BAAC CACB CAC BBBBA BABA CACC CBA BBBBB BABB CBAA CBB
AAAA AACC CCCC CBC AAAB ABAA AAAA CCA AAAC ABAB AAAB CCB AABA ABAC
AABA CCC AABB ABBA AABB AAA AABC ABBB ABAA AAB AACA ABBC ABAB ABA
AACB ABCA ABBA ABB
[0484] In certain embodiments, each A, each B, and each C located
at the 3'-most 5'-wing nucleoside is a modified nucleoside. For
example, in certain embodiments the 5'-wing motif is selected from
among ABB, BBB, and CBB, wherein the underlined nucleoside
represents the 3'-most 5'-wing nucleoside and wherein the
underlined nucleoside is a modified nucleoside.
[0485] In certain embodiments, each A comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each A
comprises a modified sugar moiety. In certain embodiments, each A
comprises a 2'-substituted sugar moiety. In certain embodiments,
each A comprises a 2'-substituted sugar moiety selected from among
F, ara-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each A comprises a bicyclic sugar moiety. In certain
embodiments, each A comprises a bicyclic sugar moiety selected from
among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In
certain embodiments, each A comprises a modified nucleobase. In
certain embodiments, each A comprises a modified nucleobase
selected from among 2-thio-thymidine nucleoside and 5-propyne
uridine nucleoside. In certain embodiments, each A comprises an
HNA. In certain embodiments, each A comprises an F-HNA.
[0486] In certain embodiments, each B comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each B
comprises a modified sugar moiety. In certain embodiments, each B
comprises a 2'-substituted sugar moiety. In certain embodiments,
each B comprises a 2'-substituted sugar moiety selected from among
F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each B comprises a bicyclic sugar moiety. In certain
embodiments, each B comprises a bicyclic sugar moiety selected from
among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In
certain embodiments, each B comprises a modified nucleobase. In
certain embodiments, each B comprises a modified nucleobase
selected from among 2-thio-thymidine nucleoside and 5-propyne
urindine nucleoside. In certain embodiments, each B comprises an
HNA. In certain embodiments, each B comprises an F-HNA.
[0487] In certain embodiments, each C comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each C
comprises a modified sugar moiety. In certain embodiments, each C
comprises a 2'-substituted sugar moiety. In certain embodiments,
each C comprises a 2'-substituted sugar moiety selected from among
F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each C comprises a 5'-substituted sugar moiety. In
certain embodiments, each C comprises a 5'-substituted sugar moiety
selected from among 5'-Me, and 5'-(R)-Me. In certain embodiments,
each C comprises a bicyclic sugar moiety. In certain embodiments,
each C comprises a bicyclic sugar moiety selected from among cEt,
cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain
embodiments, each C comprises a modified nucleobase. In certain
embodiments, each C comprises a modified nucleobase selected from
among 2-thio-thymidine and 5-propyne uridine. In certain
embodiments, each C comprises a 2-thio-thymidine nucleoside. In
certain embodiments, each C comprises an HNA. In certain
embodiments, each C comprises an F-HNA.
[0488] In certain embodiments, at least one of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety, and the other comprises a
2'-substituted sugar moiety. In certain embodiments, at least one
of A or B comprises an unmodified 2'-deoxyfuranose sugar moiety,
and the other comprises a bicyclic sugar moiety.
[0489] In certain embodiments, at least one of A or B comprises a
bicyclic sugar moiety, and the other comprises a 2'-substituted
sugar moiety. In certain embodiments, one of A or B is an LNA
nucleoside and the other of A or B comprises a 2'-substituted sugar
moiety. In certain embodiments, one of A or B is a cEt nucleoside
and the other of A or B comprises a 2'-substituted sugar moiety. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside
and the other of A or B comprises a 2'-substituted sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises a 2'-MOE sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises a 2'-MOE sugar moiety. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside and the other of A or B
comprises a 2'-MOE sugar moiety. In certain embodiments, one of A
or B is an LNA nucleoside and the other of A or B comprises a 2'-F
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside and the other of A or B comprises a 2'-F sugar moiety.
In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside and the other of A or B comprises a 2'-F sugar moiety.
In certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises a 2'-(ara)-F sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside and the other of A or
B comprises a 2'-(ara)-F sugar moiety.
[0490] In certain embodiments, at least one of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety, and the other comprises a
2'-substituted sugar moiety. In certain embodiments, one of A or B
is an unmodified 2'-deoxyfuranose sugar moiety and the other of A
or B comprises a 2'-substituted sugar moiety. In certain
embodiments, one of A or B is an unmodified 2'-deoxyfuranose sugar
moiety and the other of A or B comprises a 2'-MOE sugar moiety. In
certain embodiments, one of A or B is an unmodified
2'-deoxyfuranose sugar moiety and the other of A or B comprises a
2'-F sugar moiety. In certain embodiments, one of A or B is an
unmodified 2'-deoxyfuranose sugar moiety and the other of A or B
comprises a 2'-(ara)-F sugar moiety. In certain embodiments, at
least one of A or B comprises a bicyclic sugar moiety, and the
other comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises an unmodified 2'-deoxyfuranose sugar
moiety. In certain embodiments, one of A or B is a cEt nucleoside
and the other of A or B comprises an unmodified 2'-deoxyfuranose
sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside and the other of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside and the other of A or B
comprises an unmodified 2'-deoxyfuranose sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside
and the other of A or B comprises an unmodified 2'-deoxyfuranose
sugar moiety.
[0491] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-substituted sugar moiety. In certain
embodiments, A is an LNA nucleoside and B comprises a
2'-substituted sugar moiety. In certain embodiments, A is a cEt
nucleoside and B comprises a 2'-substituted sugar moiety. In
certain embodiments, A is an .alpha.-L-LNA nucleoside and B
comprises a 2'-substituted sugar moiety.
[0492] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is
an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain
embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar
moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside
and B comprises a 2'-MOE sugar moiety.
[0493] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-F sugar moiety. In certain embodiments, A is
an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain
embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar
moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside
and B comprises a 2'-F sugar moiety.
[0494] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
A is an LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety.
In certain embodiments, A is a cEt nucleoside and B comprises a
2'-(ara)-F sugar moiety. In certain embodiments, A is an
.alpha.-L-LNA nucleoside and B comprises a 2'-(ara)-F sugar
moiety.
[0495] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is
an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain
embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar
moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside
and A comprises a 2'-MOE sugar moiety.
[0496] In certain embodiments, B comprises a bicyclic sugar moiety,
A comprises a 2'-MOE sugar moiety, and C comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, B is an LNA
nucleoside, A comprises a 2'-MOE sugar moiety, and C comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments, B
is a cEt nucleoside, A comprises a 2'-MOE sugar moiety, and C
comprises an unmodified 2'-deoxyfuranose sugar moiety. In certain
embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a
2'-MOE sugar moiety.
[0497] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-F sugar moiety. In certain embodiments, B is
an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain
embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar
moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside
and A comprises a 2'-F sugar moiety.
[0498] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
B is an LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety.
In certain embodiments, B is a cEt nucleoside and A comprises a
2'-(ara)-F sugar moiety. In certain embodiments, B is an
.alpha.-L-LNA nucleoside and A comprises a 2'-(ara)-F sugar
moiety.
[0499] In certain embodiments, at least one of A or B comprises a
bicyclic sugar moiety, another of A or B comprises a 2'-substituted
sugar moiety and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-substituted sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-substituted sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-substituted sugar moiety, and comprises a
modified nucleobase.
[0500] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a modified nucleobase. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a modified nucleobase. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a modified nucleobase.
[0501] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a modified nucleobase. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a modified nucleobase.
[0502] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a modified nucleobase. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a modified
nucleobase.
[0503] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-substituted sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-substituted sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is a cEt nucleoside, another of A or B comprises a 2'-substituted
sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside,
another of A or B comprises a 2'-substituted sugar moiety, and C
comprises a 2-thio-thymidine nucleobase.
[0504] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 2-thio-thymidine
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 2-thio-thymidine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 2-thio-thymidine
nucleobase.
[0505] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 2-thio-thymidine nucleobase. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
In certain embodiments, one of A or B is a cEt nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
[0506] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises
2-thio-thymidine nucleobase.
[0507] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase.
[0508] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase.
[0509] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
In certain embodiments, one of A or B is a cEt nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a
5-propyne uridine nucleobase. In certain embodiments, one of A or B
is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 5-propyne uridine nucleobase.
[0510] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a
5-propyne uridine nucleobase.
[0511] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a sugar surrogate. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a sugar surrogate.
In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a sugar surrogate.
[0512] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a sugar surrogate. In certain embodiments, one of A or
B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a sugar surrogate. In certain embodiments,
one of A or B is a cEt nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a sugar surrogate. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a sugar
surrogate.
[0513] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a sugar surrogate. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-(ara)-F sugar moiety, and C comprises a sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F
sugar moiety, and C comprises sugar surrogate.
[0514] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a HNA sugar surrogate. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a HNA sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a HNA sugar surrogate.
[0515] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a HNA sugar surrogate. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a HNA sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a sugar HNA surrogate.
[0516] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a HNA sugar surrogate. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a HNA sugar surrogate. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a HNA sugar
surrogate.
[0517] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a F-HNA sugar surrogate. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a F-HNA
sugar surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a F-HNA sugar surrogate.
[0518] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a F-HNA sugar surrogate. In certain embodiments, one of
A or B is an LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a F-HNA sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a F-HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a F-HNA sugar surrogate.
[0519] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a F-HNA sugar surrogate. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a F-HNA sugar
surrogate. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a F-HNA sugar surrogate. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a F-HNA sugar
surrogate.
[0520] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5'-Me DNA sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a 5'-Me DNA sugar moiety. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a 5'-Me DNA
sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a 5'-Me DNA sugar moiety.
[0521] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5'-Me DNA sugar moiety. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 5'-Me DNA sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a 5'-Me DNA sugar
moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside, another of A or B comprises a 2'-F sugar moiety, and C
comprises a 5'-Me DNA sugar moiety.
[0522] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5'-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-Me DNA
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5'-Me DNA sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-Me DNA
sugar moiety.
[0523] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5'-(R)-Me DNA
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5'-(R)-Me DNA
sugar moiety.
[0524] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 5'-(R)-Me DNA sugar moiety. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-F sugar moiety, and C comprises a 5'-(R)-Me
DNA sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a 5'-(R)-Me DNA sugar moiety.
[0525] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-(R)-Me
DNA sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a
5'-(R)-Me DNA sugar moiety.
[0526] In certain embodiments, at least two of A, B or C comprises
a 2'-substituted sugar moiety, and the other comprises a bicyclic
sugar moiety. In certain embodiments, at least two of A, B or C
comprises a bicyclic sugar moiety, and the other comprises a
2'-substituted sugar moiety.
[0527] In certain embodiments, at least two of A, B or C comprises
a 2'-substituted sugar moiety, and the other comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments,
at least two of A, B or C comprises a bicyclic sugar moiety, and
the other comprises an unmodified 2'-deoxyfuranose sugar
moiety.
[0528] Certain 3'-Wings
[0529] In certain embodiments, the 3'-wing of a gapmer consists of
1 to 5 linked nucleosides. In certain embodiments, the 3'-wing of a
gapmer consists of 2 to 5 linked nucleosides. In certain
embodiments, the 3'-wing of a gapmer consists of 3 to 5 linked
nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 4 or 5 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 1 to 4 linked nucleosides. In
certain embodiments, the 3'-wing of a gapmer consists of 1 to 3
linked nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 1 or 2 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 2 to 4 linked nucleosides. In
certain embodiments, the 3'-wing of a gapmer consists of 2 or 3
linked nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 3 or 4 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 1 nucleoside. In certain
embodiments, the 3'-wing of a gapmer consists of 2 linked
nucleosides. In certain embodiments, the 3'-wing of a gapmer
consists of 3 linked nucleosides. In certain embodiments, the
3'-wing of a gapmer consists of 4 linked nucleosides. In certain
embodiments, the 3'-wing of a gapmer consists of 5 linked
nucleosides.
[0530] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside. In certain embodiments, the 3'-wing
of a gapmer comprises at least one constrained ethyl nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
LNA nucleoside. In certain embodiments, each nucleoside of the
3'-wing of a gapmer is a bicyclic nucleoside. In certain
embodiments, each nucleoside of the 3'-wing of a gapmer is a
constrained ethyl nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a LNA nucleoside.
[0531] In certain embodiments, the 3'-wing of a gapmer comprises at
least one non-bicyclic modified nucleoside. In certain embodiments,
the 3'-wing of a gapmer comprises at least two non-bicyclic
modified nucleosides. In certain embodiments, the 3'-wing of a
gapmer comprises at least three non-bicyclic modified nucleosides.
In certain embodiments, the 3'-wing of a gapmer comprises at least
four non-bicyclic modified nucleosides. In certain embodiments, the
3'-wing of a gapmer comprises at least one 2'-substituted
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one 2'-MOE nucleoside. In certain embodiments,
the 3'-wing of a gapmer comprises at least one 2'-OMe nucleoside.
In certain embodiments, each nucleoside of the 3'-wing of a gapmer
is a non-bicyclic modified nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-substituted
nucleoside. In certain embodiments, each nucleoside of the 3'-wing
of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-OMe nucleoside.
[0532] In certain embodiments, the 3'-wing of a gapmer comprises at
least one 2'-deoxynucleoside. In certain embodiments, each
nucleoside of the 3'-wing of a gapmer is a 2'-deoxynucleoside. In a
certain embodiments, the 3'-wing of a gapmer comprises at least one
ribonucleoside. In certain embodiments, each nucleoside of the
3'-wing of a gapmer is a ribonucleoside.
[0533] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside and at least one non-bicyclic
modified nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one bicyclic nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one bicyclic nucleoside and at least one
2'-deoxynucleoside.
[0534] In certain embodiments, the 3'-wing of a gapmer comprises at
least one constrained ethyl nucleoside and at least one
non-bicyclic modified nucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside and at least one 2'-substituted nucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In
certain embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside and at least one
2'-deoxynucleoside.
[0535] In certain embodiments, the 3'-wing of a gapmer comprises at
least one LNA nucleoside and at least one non-bicyclic modified
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-substituted nucleoside. In certain embodiments, the 3'-wing of a
gapmer comprises at least one LNA nucleoside and at least one
2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one 2'-OMe
nucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside and at least one
2'-deoxynucleoside.
[0536] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one non-bicyclic modified
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one LNA
nucleoside, at least one non-bicyclic modified nucleoside, and at
least one 2'-deoxynucleoside.
[0537] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one
constrained ethyl nucleoside, at least one 2'-substituted
nucleoside, and at least one 2'-deoxynucleoside. In certain
embodiments, the 3'-wing of a gapmer comprises at least one LNA
nucleoside, at least one 2'-substituted nucleoside, and at least
one 2'-deoxynucleoside.
[0538] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-MOE nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-MOE nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-MOE
nucleoside, and at least one 2'-deoxynucleoside.
[0539] In certain embodiments, the 3'-wing of a gapmer comprises at
least one bicyclic nucleoside, at least one 2'-OMe nucleoside, and
at least one 2'-deoxynucleoside. In certain embodiments, the
3'-wing of a gapmer comprises at least one constrained ethyl
nucleoside, at least one 2'-OMe nucleoside, and at least one
2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer
comprises at least one LNA nucleoside, at least one 2'-OMe
nucleoside, and at least one 2'-deoxynucleoside.
[0540] In certain embodiments, the 3'-wing of a gapmer has a sugar
motif selected from among those listed in the following
non-limiting table:
TABLE-US-00005 TABLE 4 Certain 3'-Wing Sugar Motifs 3'-wing 3'-wing
3'-wing sugar sugar sugar motif # motif motif # motif motif # motif
1a B-B-A 1d L-L-A 1g K-K-A 2a B-B-B 2d L-L-L 2g K-K-K 3a A-A-B 3d
A-A-L 3g A-A-K 4a B-A-B 4d L-A-L 4g K-A-K 5a B-A-B-A 5d L-A-L-A 5g
K-A-K-A 6a B-B-B-A 6d L-L-L-A 6g K-K-K-A 7a B-D-B-A 7d L-D-L-A 7g
K-D-K-A 8a B-B-B-B 8d L-L-L-L 8g K-K-K-K 9a B-D-D-B 9d L-D-D-L 9g
K-D-D-K 10a A-B-B-A 10d A-L-L-A 10g A-K-K-A 1b B-B-E 1e L-L-E 1h
K-K-E 2b B-B-B 2e L-L-L 2h K-K-K 3b E-E-B 3e E-E-L 3h E-E-K 4b
B-E-B 4e L-E-L 4h K-E-K 5b B-E-B-E 5e L-E-L-E 5h K-E-K-E 6b B-B-B-E
6e L-L-L-E 6h K-K-K-E 7b B-D-B-E 7e L-D-L-E 7h K-D-K-E 8b B-B-B-B
8e L-L-L-L 8h K-K-K-K 9b B-D-D-B 9e L-D-D-L 9h K-D-D-K 10b E-B-B-E
10e E-L-L-E 10h E-K-K-E 1c B-B-M 1f L-L-M 1i K-K-M 2c B-B-B 2f
L-L-L 2i K-K-K 3c M-M-B 3f M-M-L 3i M-M-K 4c B-M-B 4f L-M-L 4i
K-M-K 5c B-M-B-M 5f L-M-L-M 5i K-M-K-M 6c B-B-B-M 6f L-L-L-M 6i
K-K-K-M 7c B-D-B-M 7f L-D-L-M 7i K-D-K-M 8c B-B-B-B 8f L-L-L-L 8i
K-K-K-K 9c B-D-D-B 9f L-D-D-L 9i K-D-D-K 10c M-B-B-M 10f M-L-L-M
10i M-K-K-M 1j K-K-A 1k L-K-A 1l K-L-E 2j K-L-L 2k K-K-L 2l K-L-K
3j E-M-B 3k E-M-L 3l E-K-K 4j K-A-L 4k L-A-K 4l L-E-K 5j K-A-L-A 5k
L-A-K-A 5l K-E-L-E 6j K-L-K-A 6k K-K-L-A 6l K-L-K-A 7j L-D-K-A 7k
K-D-L-A 7l K-D-L-E 8j B-K-L-B 8k K-L-L-L 8l K-K-L-K 9j K-D-D-B 9k
K-D-D-L 9l L-D-D-K 10j A-K-B-A 10k A-K-L-A 10l A-B-K-A 1m E-E
[0541] In the above table, "A" represents a nucleoside comprising a
2'-substituted sugar moiety; "B" represents a bicyclic nucleoside;
"D" represents a 2'-deoxynucleoside; "K" represents a constrained
ethyl nucleoside; "L" represents an LNA nucleoside; "E" represents
a 2'-MOE nucleoside; and "M" represents a 2'-OMe nucleoside.
[0542] In certain embodiments, an oligonucleotide comprises any
3'-wing motif provided herein. In certain such embodiments, the
oligonucleotide is a 3'-hemimer (does not comprise a 5'-wing). In
certain embodiments, such an oligonucleotide is a gapmer. In
certain such embodiments, the 5'-wing of the gapmer may comprise
any sugar modification motif.
[0543] In certain embodiments, the 5'-wing of a gapmer has a sugar
motif selected from among those listed in the following
non-limiting tables:
TABLE-US-00006 TABLE 5 Certain 3'-Wing Sugar Motifs Certain 3'-Wing
Sugar Motifs AAAAA ABCBB BABCC BCBBA CBACC AAAAB ABCBC BACAA BCBBB
CBBAA AAAAC ABCCA BACAB BCBBC CBBAB AAABA ABCCB BACAC BCBCA CBBAC
AAABB ABCCC BACBA BCBCB CBBBA AAABC ACAAA BACBB BCBCC CBBBB AAACA
ACAAB BACBC BCCAA CBBBC AAACB ACAAC BACCA BCCAB CBBCA AAACC ACABA
BACCB BCCAC CBBCB AABAA ACABB BACCC BCCBA CBBCC AABAB ACABC BBAAA
BCCBB CBCAA AABAC ACACA BBAAB BCCBC CBCAB AABBA ACACB BBAAC BCCCA
CBCAC AABBB ACACC BBABA BCCCB CBCBA AABBC ACBAA BBABB BCCCC CBCBB
AABCA ACBAB BBABC CAAAA CBCBC AABCB ACBAC BBACA CAAAB CBCCA AABCC
ACBBA BBACB CAAAC CBCCB AACAA ACBBB BBACC CAABA CBCCC AACAB ACBBC
BBBAA CAABB CCAAA AACAC ACBCA BBBAB CAABC CCAAB AACBA ACBCB BBBAC
CAACA CCAAC AACBB ACBCC BBBBA CAACB CCABA AACBC ACCAA BBBBB CAACC
CCABB AACCA ACCAB BBBBC CABAA CCABC AACCB ACCAC BBBCA CABAB CCACA
AACCC ACCBA BBBCB CABAC CCACB ABAAA ACCBB BBBCC CABBA CCACC ABAAB
ACCBC BBCAA CABBB CCBAA ABAAC ACCCA BBCAB CABBC CCBAB ABABA ACCCB
BBCAC CABCA CCBAC ABABB ACCCC BBCBA CABCB CCBBA ABABC BAAAA BBCBB
CABCC CCBBB ABACA BAAAB BBCBC CACAA CCBBC ABACB BAAAC BBCCA CACAB
CCBCA ABACC BAABA BBCCB CACAC CCBCB ABBAA BAABB BBCCC CACBA CCBCC
ABBAB BAABC BCAAA CACBB CCCAA ABBAC BAACA BCAAB CACBC CCCAB ABBBA
BAACB BCAAC CACCA CCCAC ABBBB BAACC BCABA CACCB CCCBA ABBBC BABAA
BCABB CACCC CCCBB ABBCA BABAB BCABC CBAAA CCCBC ABBCB BABAC BCACA
CBAAB CCCCA ABBCC BABBA BCACB CBAAC CCCCB ABCAA BABBB BCACC CBABA
CCCCC ABCAB BABBC BCBAA CBABB ABCAC BABCA BCBAB CBABC ABCBA BABCB
BCBAC CBACA
TABLE-US-00007 TABLE 6 Certain 3'-Wing Sugar Motifs Certain 3'-Wing
Sugar Motifs AAAAA BABC CBAB ABBB BAA AAAAB BACA CBAC BAAA BAB
AAABA BACB CBBA BAAB BBA AAABB BACC CBBB BABA BBB AABAA BBAA CBBC
BABB AA AABAB BBAB CBCA BBAA AB AABBA BBAC CBCB BBAB AC AABBB BBBA
CBCC BBBA BA ABAAA BBBB CCAA BBBB BB ABAAB BBBC CCAB AAA BC ABABA
BBCA CCAC AAB CA ABABB BBCB CCBA AAC CB ABBAA BBCC CCBB ABA CC
ABBAB BCAA CCBC ABB AA ABBBA BCAB CCCA ABC AB ABBBB BCAC CCCB ACA
BA BAAAA ABCB BCBA ACB BAAAB ABCC BCBB ACC BAABA ACAA BCBC BAA
BAABB ACAB BCCA BAB BABAA ACAC BCCB BAC BABAB ACBA BCCC BBA BABBA
ACBB CAAA BBB BABBB ACBC CAAB BBC BBAAA ACCA CAAC BCA BBAAB ACCB
CABA BCB BBABA ACCC CABB BCC BBABB BAAA CABC CAA BBBAA BAAB CACA
CAB BBBAB BAAC CACB CAC BBBBA BABA CACC CBA BBBBB BABB CBAA CBB
AAAA AACC CCCC CBC AAAB ABAA AAAA CCA AAAC ABAB AAAB CCB AABA ABAC
AABA CCC AABB ABBA AABB AAA AABC ABBB ABAA AAB AACA ABBC ABAB ABA
AACB ABCA ABBA ABB
[0544] In certain embodiments, each A, each B, and each C located
at the 5'-most 3'-wing region nucleoside is a modified nucleoside.
For example, in certain embodiments the 3'-wing motif is selected
from among ABB, BBB, and CBB, wherein the underlined nucleoside
represents the the 5'-most 3'-wing region nucleoside and wherein
the underlined nucleoside is a modified nucleoside.
[0545] In certain embodiments, each A comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each A
comprises a modified sugar moiety. In certain embodiments, each A
comprises a 2'-substituted sugar moiety. In certain embodiments,
each A comprises a 2'-substituted sugar moiety selected from among
F, ara-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each A comprises a bicyclic sugar moiety. In certain
embodiments, each A comprises a bicyclic sugar moiety selected from
among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In
certain embodiments, each A comprises a modified nucleobase. In
certain embodiments, each A comprises a modified nucleobase
selected from among 2-thio-thymidine nucleoside and 5-propyne
uridine nucleoside.
[0546] In certain embodiments, each B comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each B
comprises a modified sugar moiety. In certain embodiments, each B
comprises a 2'-substituted sugar moiety. In certain embodiments,
each B comprises a 2'-substituted sugar moiety selected from among
F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each B comprises a bicyclic sugar moiety. In certain
embodiments, each B comprises a bicyclic sugar moiety selected from
among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In
certain embodiments, each B comprises a modified nucleobase. In
certain embodiments, each B comprises a modified nucleobase
selected from among 2-thio-thymidine nucleoside and 5-propyne
urindine nucleoside.
[0547] In certain embodiments, each C comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, each C
comprises a modified sugar moiety. In certain embodiments, each C
comprises a 2'-substituted sugar moiety. In certain embodiments,
each C comprises a 2'-substituted sugar moiety selected from among
F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain
embodiments, each C comprises a 5'-substituted sugar moiety. In
certain embodiments, each C comprises a 5'-substituted sugar moiety
selected from among 5'-Me, and 5'-(R)-Me. In certain embodiments,
each C comprises a bicyclic sugar moiety. In certain embodiments,
each C comprises a bicyclic sugar moiety selected from among cEt,
cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain
embodiments, each C comprises a modified nucleobase. In certain
embodiments, each C comprises a modified nucleobase selected from
among 2-thio-thymidine and 5-propyne uridine. In certain
embodiments, each C comprises a 2-thio-thymidine nucleoside.
[0548] In certain embodiments, at least one of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety, and the other comprises a
2'-substituted sugar moiety. In certain embodiments, at least one
of A or B comprises an unmodified 2'-deoxyfuranose sugar moiety,
and the other comprises a bicyclic sugar moiety.
[0549] In certain embodiments, at least one of A or B comprises a
bicyclic sugar moiety, and the other comprises a 2'-substituted
sugar moiety. In certain embodiments, one of A or B is an LNA
nucleoside and the other of A or B comprises a 2'-substituted sugar
moiety. In certain embodiments, one of A or B is a cEt nucleoside
and the other of A or B comprises a 2'-substituted sugar moiety. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside
and the other of A or B comprises a 2'-substituted sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises a 2'-MOE sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises a 2'-MOE sugar moiety. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside and the other of A or B
comprises a 2'-MOE sugar moiety. In certain embodiments, one of A
or B is an LNA nucleoside and the other of A or B comprises a 2'-F
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside and the other of A or B comprises a 2'-F sugar moiety.
In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside and the other of A or B comprises a 2'-F sugar moiety.
In certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises a 2'-(ara)-F sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside and the other of A or
B comprises a 2'-(ara)-F sugar moiety.
[0550] In certain embodiments, at least one of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety, and the other comprises a
2'-substituted sugar moiety. In certain embodiments, one of A or B
is an unmodified 2'-deoxyfuranose sugar moiety and the other of A
or B comprises a 2'-substituted sugar moiety. In certain
embodiments, one of A or B is an unmodified 2'-deoxyfuranose sugar
moiety and the other of A or B comprises a 2'-MOE sugar moiety. In
certain embodiments, one of A or B is an unmodified
2'-deoxyfuranose sugar moiety and the other of A or B comprises a
2'-F sugar moiety. In certain embodiments, one of A or B is an
unmodified 2'-deoxyfuranose sugar moiety and the other of A or B
comprises a 2'-(ara)-F sugar moiety. In certain embodiments, at
least one of A or B comprises a bicyclic sugar moiety, and the
other comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside and the
other of A or B comprises an unmodified 2'-deoxyfuranose sugar
moiety. In certain embodiments, one of A or B is a cEt nucleoside
and the other of A or B comprises an unmodified 2'-deoxyfuranose
sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside and the other of A or B comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside and the other of A or B
comprises an unmodified 2'-deoxyfuranose sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside and the other of A
or B comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside
and the other of A or B comprises an unmodified 2'-deoxyfuranose
sugar moiety.
[0551] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-substituted sugar moiety. In certain
embodiments, A is an LNA nucleoside and B comprises a
2'-substituted sugar moiety. In certain embodiments, A is a cEt
nucleoside and B comprises a 2'-substituted sugar moiety. In
certain embodiments, A is an .alpha.-L-LNA nucleoside and B
comprises a 2'-substituted sugar moiety.
[0552] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is
an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain
embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar
moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside
and B comprises a 2'-MOE sugar moiety.
[0553] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-F sugar moiety. In certain embodiments, A is
an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain
embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar
moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside
and B comprises a 2'-F sugar moiety.
[0554] In certain embodiments, A comprises a bicyclic sugar moiety,
and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
A is an LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety.
In certain embodiments, A is a cEt nucleoside and B comprises a
2'-(ara)-F sugar moiety. In certain embodiments, A is an
.alpha.-L-LNA nucleoside and B comprises a 2'-(ara)-F sugar
moiety.
[0555] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is
an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain
embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar
moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside
and A comprises a 2'-MOE sugar moiety.
[0556] In certain embodiments, B comprises a bicyclic sugar moiety,
A comprises a 2'-MOE sugar moiety, and C comprises an unmodified
2'-deoxyfuranose sugar moiety. In certain embodiments, B is an LNA
nucleoside, A comprises a 2'-MOE sugar moiety, and C comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments, B
is a cEt nucleoside, A comprises a 2'-MOE sugar moiety, and C
comprises an unmodified 2'-deoxyfuranose sugar moiety. In certain
embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a
2'-MOE sugar moiety.
[0557] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-F sugar moiety. In certain embodiments, B is
an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain
embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar
moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside
and A comprises a 2'-F sugar moiety.
[0558] In certain embodiments, B comprises a bicyclic sugar moiety,
and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments,
B is an LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety.
In certain embodiments, B is a cEt nucleoside and A comprises a
2'-(ara)-F sugar moiety. In certain embodiments, B is an
.alpha.-L-LNA nucleoside and A comprises a 2'-(ara)-F sugar
moiety.
[0559] In certain embodiments, at least one of A or B comprises a
bicyclic sugar moiety, another of A or B comprises a 2'-substituted
sugar moiety and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-substituted sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-substituted sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-substituted sugar moiety, and comprises a
modified nucleobase.
[0560] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a modified nucleobase. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a modified nucleobase. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a modified nucleobase.
[0561] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a modified nucleobase. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a modified nucleobase.
[0562] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a modified nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a modified
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a modified nucleobase. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a modified
nucleobase.
[0563] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-substituted sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-substituted sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is a cEt nucleoside, another of A or B comprises a 2'-substituted
sugar moiety, and C comprises a 2-thio-thymidine nucleobase. In
certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside,
another of A or B comprises a 2'-substituted sugar moiety, and C
comprises a 2-thio-thymidine nucleobase.
[0564] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 2-thio-thymidine
nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 2-thio-thymidine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 2-thio-thymidine
nucleobase.
[0565] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 2-thio-thymidine nucleobase. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
In certain embodiments, one of A or B is a cEt nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 2-thio-thymidine nucleobase.
[0566] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a
2-thio-thymidine nucleobase. In certain embodiments, one of A or B
is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 2-thio-thymidine nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises
2-thio-thymidine nucleobase.
[0567] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase.
[0568] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises an unmodified 2'-deoxyfuranose sugar moiety. In
certain embodiments, one of A or B is an LNA nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne
uridine nucleobase.
[0569] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5-propyne uridine nucleobase. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 5-propyne uridine nucleobase.
In certain embodiments, one of A or B is a cEt nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a
5-propyne uridine nucleobase. In certain embodiments, one of A or B
is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 5-propyne uridine nucleobase.
[0570] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5-propyne
uridine nucleobase. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5-propyne uridine nucleobase. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a
5-propyne uridine nucleobase.
[0571] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a sugar surrogate. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a sugar surrogate.
In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a sugar surrogate.
[0572] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a sugar surrogate. In certain embodiments, one of A or
B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a sugar surrogate. In certain embodiments,
one of A or B is a cEt nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a sugar surrogate. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-F sugar moiety, and C comprises a sugar
surrogate.
[0573] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a sugar surrogate. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-(ara)-F sugar moiety, and C comprises a sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F
sugar moiety, and C comprises sugar surrogate.
[0574] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a HNA sugar surrogate. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a HNA sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a HNA sugar surrogate.
[0575] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a HNA sugar surrogate. In certain embodiments, one of A
or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a HNA sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a sugar HNA surrogate.
[0576] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a HNA sugar surrogate. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a HNA sugar
surrogate. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a HNA sugar surrogate. In certain embodiments, one
of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a HNA sugar
surrogate.
[0577] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a F-HNA sugar surrogate. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a F-HNA sugar surrogate. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a F-HNA
sugar surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a F-HNA sugar surrogate.
[0578] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a F-HNA sugar surrogate. In certain embodiments, one of
A or B is an LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a F-HNA sugar surrogate. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a F-HNA sugar
surrogate. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a F-HNA sugar surrogate.
[0579] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a F-HNA sugar surrogate. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a F-HNA sugar
surrogate. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a F-HNA sugar surrogate. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a F-HNA sugar
surrogate.
[0580] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5'-Me DNA sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-MOE sugar moiety, and C comprises a 5'-Me DNA sugar moiety. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-MOE sugar moiety, and C comprises a 5'-Me DNA
sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE
sugar moiety, and C comprises a 5'-Me DNA sugar moiety.
[0581] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5'-Me DNA sugar moiety. In certain embodiments, one
of A or B is an LNA nucleoside, another of A or B comprises a 2'-F
sugar moiety, and C comprises a 5'-Me DNA sugar moiety. In certain
embodiments, one of A or B is a cEt nucleoside, another of A or B
comprises a 2'-F sugar moiety, and C comprises a 5'-Me DNA sugar
moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA
nucleoside, another of A or B comprises a 2'-F sugar moiety, and C
comprises a 5'-Me DNA sugar moiety.
[0582] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5'-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-Me DNA
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5'-Me DNA sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-Me DNA
sugar moiety.
[0583] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-MOE sugar moiety,
and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5'-(R)-Me DNA
sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and
C comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments,
one of A or B is an .alpha.-L-LNA nucleoside, another of A or B
comprises a 2'-MOE sugar moiety, and C comprises a 5'-(R)-Me DNA
sugar moiety.
[0584] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-F sugar moiety, and
C comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments,
one of A or B is an LNA nucleoside, another of A or B comprises a
2'-F sugar moiety, and C comprises a 5'-(R)-Me DNA sugar moiety. In
certain embodiments, one of A or B is a cEt nucleoside, another of
A or B comprises a 2'-F sugar moiety, and C comprises a 5'-(R)-Me
DNA sugar moiety. In certain embodiments, one of A or B is an
.alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar
moiety, and C comprises a 5'-(R)-Me DNA sugar moiety.
[0585] In certain embodiments, one of A or B comprises a bicyclic
sugar moiety, another of A or B comprises a 2'-(ara)-F sugar
moiety, and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an LNA nucleoside, another of A or B
comprises a 2'-(ara)-F sugar moiety, and C comprises a 5'-(R)-Me
DNA sugar moiety. In certain embodiments, one of A or B is a cEt
nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety,
and C comprises a 5'-(R)-Me DNA sugar moiety. In certain
embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another
of A or B comprises a 2'-(ara)-F sugar moiety, and C comprises a
5'-(R)-Me DNA sugar moiety.
[0586] In certain embodiments, at least two of A, B or C comprises
a 2'-substituted sugar moiety, and the other comprises a bicyclic
sugar moiety. In certain embodiments, at least two of A, B or C
comprises a bicyclic sugar moiety, and the other comprises a
2'-substituted sugar moiety.
[0587] In certain embodiments, at least two of A, B or C comprises
a 2'-substituted sugar moiety, and the other comprises an
unmodified 2'-deoxyfuranose sugar moiety. In certain embodiments,
at least two of A, B or C comprises a bicyclic sugar moiety, and
the other comprises an unmodified 2'-deoxyfuranose sugar
moiety.
[0588] Certain Gaps
[0589] In certain embodiments, the gap of a gapmer consists of 6 to
20 linked nucleosides. In certain embodiments, the gap of a gapmer
consists of 6 to 15 linked nucleosides. In certain embodiments, the
gap of a gapmer consists of 6 to 12 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 to 10 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 6 to 9 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 6 to 8 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 or 7 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 7 to 10 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 7 to 9 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 7 or 8 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 8 to 10 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 8 or 9 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 6 linked nucleosides.
In certain embodiments, the gap of a gapmer consists of 7 linked
nucleosides. In certain embodiments, the gap of a gapmer consists
of 8 linked nucleosides. In certain embodiments, the gap of a
gapmer consists of 9 linked nucleosides. In certain embodiments,
the gap of a gapmer consists of 10 linked nucleosides. In certain
embodiments, the gap of a gapmer consists of 11 linked nucleosides.
In certain embodiments, the gap of a gapmer consists of 12 linked
nucleosides.
[0590] In certain embodiments, each nucleotide of the gap of a
gapmer is a 2'-deoxynucleoside. In certain embodiments, the gap
comprises one or more modified nucleosides. In certain embodiments,
each nucleotide of the gap of a gapmer is a 2'-deoxynucleoside or
is a modified nucleoside that is "DNA-like." In such embodiments,
"DNA-like" means that the nucleoside has similar characteristics to
DNA, such that a duplex comprising the gapmer and an RNA molecule
is capable of activating RNase H. For example, under certain
conditions, 2'-fluoro (arabino) nucleosides (also referred to as
FANA) have been shown to support RNase H activation, and thus is
DNA-like. In certain embodiments, one or more nucleosides of the
gap of a gapmer is not a 2'-deoxynucleoside and is not DNA-like. In
certain such embodiments, the gapmer nonetheless supports RNase H
activation (e.g., by virtue of the number or placement of the
non-DNA nucleosides).
[0591] Certain Gapmer Motifs
[0592] In certain embodiments, a gapmer comprises a 5'-wing, a gap,
and a 3' wing, wherein the 5'-wing, gap, and 3' wing are
independently selected from among those discussed above. For
example, in certain embodiments, a gapmer has a 5'-wing selected
from any of the 5'-wing motifs in Tables 1, 2, and 3 above and a
3'-wing selected from any of the 3'-wing motifs in Tables, 4, 5,
and 6. For example, in certain embodiments, a gapmer has a 5'-wing,
a gap, and a 3'-wing having features selected from among those
listed in the following non-limiting table:
TABLE-US-00008 TABLE 7 Certain Gapmer Sugar Motifs Gapmer motif #
5-wing Gap 3'-wing 1 At least one non-bicyclic All
2'-deoxynucleosides At least one bicyclic modified nucleoside
nucleoside 2 At least one non-bicyclic All 2'-deoxynucleosides At
least one LNA nucleoside modified nucleoside 3 At least one
non-bicyclic All 2'-deoxynucleosides At least one cEt nucleoside
modified nucleoside 4 At least one 2'-substituted All
2'-deoxynucleosides At least one bicyclic nucleoside nucleoside 5
At least one 2'-substituted All 2'-deoxynucleosides At least one
LNA nucleoside nucleoside 6 At least one 2'-substituted All
2'-deoxynucleosides At least one cEt nucleoside nucleoside 7 At
least one 2'-MOE nucleoside All 2'-deoxynucleosides At least one
bicyclic nucleoside 8 At least one 2'-MOE nucleoside All
2'-deoxynucleosides At least one LNA nucleoside 9 At least one
2'-MOE nucleoside All 2'-deoxynucleosides At least one cEt
nucleoside 10 At least one 2'-OMe nucleoside All
2'-deoxynucleosides At least one bicyclic nucleoside 11 At least
one 2'-OMe nucleoside All 2'-deoxynucleosides At least one LNA
nucleoside 12 At least one 2'-OMe nucleoside All
2'-deoxynucleosides At least one cEt nucleoside 13 At least one
2'-deoxynucleoside All 2'-deoxynucleosides At least one bicyclic
nucleoside 14 At least one 2'-deoxynucleoside All
2'-deoxynucleosides At least one LNA nucleoside 15 At least one
2'-deoxynucleoside All 2'-deoxynucleosides At least one cEt
nucleoside 16 At least one bicyclic nucleoside All
2'-deoxynucleosides At least one non-bicyclic modified nucleoside
17 At least one LNA nucleoside All 2'-deoxynucleosides At least one
non-bicyclic modified nucleoside 18 At least one cEt nucleoside All
2'-deoxynucleosides At least one non-bicyclic modified nucleoside
19 At least one bicyclic nucleoside All 2'-deoxynucleosides At
least one 2'-substituted nucleoside 20 At least one LNA nucleoside
All 2'-deoxynucleosides At least one 2'-substituted nucleoside 21
At least one cEt nucleoside All 2'-deoxynucleosides At least one
2'-substituted nucleoside 22 At least one bicyclic nucleoside All
2'-deoxynucleosides At least one 2'-MOE nucleoside 23 At least one
LNA nucleoside All 2'-deoxynucleosides At least one 2'-MOE
nucleoside 24 At least one cEt nucleoside All 2'-deoxynucleosides
At least one 2'-MOE nucleoside 25 At least one bicyclic nucleoside
All 2'-deoxynucleosides At least one 2'-OMe nucleoside 26 At least
one LNA nucleoside All 2'-deoxynucleosides At least one 2'-OMe
nucleoside 27 At least one cEt nucleoside All 2'-deoxynucleosides
At least one 2'-OMe nucleoside 28 At least one bicyclic nucleoside
All 2'-deoxynucleosides At least one 2'- deoxynucleoside 29 At
least one LNA nucleoside All 2'-deoxynucleosides At least one 2'-
deoxynucleoside 30 At least one cEt nucleoside All
2'-deoxynucleosides At least one 2'- deoxynucleoside 31 At least
one bicyclic nucleoside All 2'-deoxynucleosides At least one
bicyclic and at least one 2'-substituted nucleoside and at least
one 2'- nucleoside substituted nucleoside 32 At least one bicyclic
nucleoside All 2'-deoxynucleosides At least two bicyclic and at
least one 2'-substituted nucleosides nucleoside 33 At least one cEt
nucleoside and All 2'-deoxynucleosides At least one bicyclic at
least one 2'-substituted nucleoside and at least one 2'- nucleoside
substituted nucleoside 34 At least one cEt nucleoside and All
2'-deoxynucleosides At least two bicyclic at least one
2'-substituted nucleosides nucleoside 35 At least one LNA
nucleoside and All 2'-deoxynucleosides At least one bicyclic at
least one 2'-substituted nucleoside and at least one 2'- nucleoside
substituted nucleoside 36 At least one LNA nucleoside and All
2'-deoxynucleosides At least two bicyclic at least one
2'-substituted nucleosides nucleoside 37 At least one bicyclic
nucleoside All 2'-deoxynucleosides At least one LNA nucleoside and
at least one 2'-substituted and at least one 2'-substituted
nucleoside nucleoside 38 At least one bicyclic nucleoside All
2'-deoxynucleosides At least two LNA nucleosides and at least one
2'-substituted nucleoside 39 At least one cEt nucleoside and All
2'-deoxynucleosides At least one LNA nucleoside at least one
2'-substituted and at least one 2'-substituted nucleoside
nucleoside 40 At least one cEt nucleoside and All
2'-deoxynucleosides At least two LNA nucleosides at least one
2'-substituted nucleoside 41 At least one LNA nucleoside and All
2'-deoxynucleosides At least one LNA nucleoside at least one
2'-substituted and at least one 2'-substituted nucleoside
nucleoside 42 At least one LNA nucleoside and All
2'-deoxynucleosides At least two LNA nucleosides at least one
2'-substituted nucleoside 43 At least one bicyclic nucleoside All
2'-deoxynucleosides At least one bicyclic and at least one 2'-
nucleoside and at least one 2'- deoxynucleoside substituted
nucleoside 44 At least one bicyclic nucleoside All
2'-deoxynucleosides At least two bicyclic and at least one 2'-
nucleosides deoxynucleoside 45 At least one cEt nucleoside and All
2'-deoxynucleosides At least one bicyclic at least one
2'-deoxynucleoside nucleoside and at least one 2'- substituted
nucleoside 46 At least one cEt nucleoside and All
2'-deoxynucleosides At least two bicyclic at least one
2'-deoxynucleoside nucleosides 47 At least one LNA nucleoside and
All 2'-deoxynucleosides At least one bicyclic at least one
2'-deoxynucleoside nucleoside and at least one 2'- substituted
nucleoside 48 At least one LNA nucleoside and All
2'-deoxynucleosides At least two bicyclic at least one
2'-deoxynucleoside nucleosides 49 At least one bicyclic nucleoside
All 2'-deoxynucleosides At least one LNA nucleoside and at least
one 2'- and at least one 2'-substituted deoxynucleoside nucleoside
50 At least one bicyclic nucleoside All 2'-deoxynucleosides At
least two LNA nucleosides and at least one 2'- deoxynucleoside 51
At least one cEt nucleoside and All 2'-deoxynucleosides At least
one LNA nucleoside at least one 2'-deoxynucleoside and at least one
2'-substituted nucleoside 52 At least one cEt nucleoside and All
2'-deoxynucleosides At least two LNA nucleosides at least one
2'-deoxynucleoside 53 At least one LNA nucleoside and All
2'-deoxynucleosides At least one LNA nucleoside at least one
2'-deoxynucleoside and at least one 2'-substituted nucleoside 54 At
least one LNA nucleoside and All 2'-deoxynucleosides At least two
LNA nucleosides at least one 2'-deoxynucleoside 55 At least two
2'-substituted All 2'-deoxynucleosides At least one bicyclic
nucleosides nucleoside and at least one 2'- substituted nucleoside
56 At least two 2'-substituted All 2'-deoxynucleosides At least two
bicyclic nucleosides nucleosides 57 At least two 2'-substituted All
2'-deoxynucleosides At least one LNA nucleoside nucleosides and at
least one 2'-substituted nucleoside 58 At least two 2'-substituted
All 2'-deoxynucleosides At least two LNA nucleosides
nucleosides
[0593] In certain embodiments, a gapmer comprises a 5'-wing, a gap,
and a 3' wing, wherein the 5'-wing, gap, and 3' wing are
independently selected from among those discussed above. For
example, in certain embodiments, a gapmer has a 5'-wing, a gap, and
a 3'-wing wherein the 5'-wing and the 3'-wing have features
selected from among those listed in the tables above. In certain
embodiments, any 5'-wing may be paired with any 3'-wing. In certain
embodiments the 5'-wing may comprise ABBBB and the 3'-wing may
comprise BBA. In certain embodiments the 5'-wing may comprise ACACA
and the 3'-wing may comprise BB. For example, in certain
embodiments, a gapmer has a 5'-wing, a gap, and a 3'-wing having
features selected from among those listed in the following
non-limiting table, wherein each motif is represented as
(5'-wing)-(gap)-(3'-wing), wherein each number represents the
number of linked nucleosides in each portion of the motif, for
example, a 5-10-5 motif would have a 5'-wing comprising 5
nucleosides, a gap comprising 10 nucleosides, and a 3'-wing
comprising 5 nucleosides:
TABLE-US-00009 TABLE 8 Certain Gapmer Sugar Motifs Certain Gapmer
Sugar Motifs 2-10-2 3-10-2 4-10-2 5-10-2 2-10-3 3-10-3 4-10-3
5-10-3 2-10-4 3-10-4 4-10-4 5-10-4 2-10-5 3-10-5 4-10-5 5-10-5
2-9-2 3-9-2 4-9-2 5-9-2 2-9-3 3-9-3 4-9-3 5-9-3 2-9-4 3-9-4 4-9-4
5-9-4 2-9-5 3-9-5 4-9-5 5-9-5 2-11-2 3-11-2 4-11-2 5-11-2 2-11-3
3-11-3 4-11-3 5-11-3 2-11-4 3-11-4 4-11-4 5-11-4 2-11-5 3-11-5
4-11-5 5-11-5 2-8-2 3-8-2 4-8-2 5-8-2 2-8-3 3-8-3 4-8-3 5-8-3 2-8-4
3-8-4 4-8-4 5-8-4 2-8-5 3-8-5 4-8-5 5-8-5
In certain embodiments, gapmers have a motif described by Formula I
as follows:
(A).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(J).sub.t-(D).sub.g-h-(J).sub.v--
(B).sub.w-(J).sub.x-(B).sub.y-(A).sub.z [0594] wherein: [0595] each
A is independently a 2'-substituted nucleoside; [0596] each B is
independently a bicyclic nucleoside; [0597] each J is independently
either a 2'-substituted nucleoside or a 2'-deoxynucleoside; [0598]
each D is a 2'-deoxynucleoside; [0599] m is 0-4; n is 0-2; p is
0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z
is 0-4; g is 6; and h is 14; provided that: [0600] at least one of
m, n, and r is other than 0; [0601] at least one of w and y is
other than 0; [0602] the sum of m, n, p, r, and t is from 2 to 5;
and [0603] the sum of v, w, x, y, and z is from 2 to 5.
[0604] In certain embodiments, one or more 2'-substituted
nucleoside is a 2'-MOE nucleoside. In certain embodiments, one or
more 2'-substituted nucleoside is a 2'-OMe nucleoside. In certain
In certain embodiments, one or more bicyclic nucleoside is a cEt
nucleoside. In certain embodiments, one or more bicyclic nucleoside
is an LNA nucleoside.
[0605] In certain embodiments, a gapmer of Formula I has a motif
selected from among gapmer motifs 1-58.
[0606] In certain embodiments, gapmers have a motif described by
Formula II as follows:
(J).sub.m-(B).sub.n-(J).sub.p-(B).sub.r-(A).sub.r-(D).sub.g-(A).sub.v-(B-
).sub.w-(J).sub.x-(B).sub.y-(J).sub.z
[0607] wherein:
[0608] each A is independently a 2'-substituted nucleoside;
[0609] each B is independently a bicyclic nucleoside;
[0610] each J is independently either a 2'-substituted nucleoside
or a 2'-deoxynucleoside;
[0611] each D is a 2'-deoxynucleoside;
[0612] m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2;
w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14;
provided that:
[0613] at least one of m, n, and r is other than 0;
[0614] at least one of w and y is other than 0;
[0615] the sum of m, n, p, r, and t is from 1 to 5; and
[0616] the sum of v, w, x, y, and z is from 1 to 5.
[0617] In certain embodiments, one or more 2'-substituted
nucleoside is a 2'-MOE nucleoside. In certain embodiments, one or
more 2'-substituted nucleoside is a 2'-OMe nucleoside. In certain
embodiments, one or more bicyclic nucleoside is a cEt nucleoside.
In certain embodiments, one or more bicyclic nucleoside is an LNA
nucleoside.
[0618] In certain embodiments, each 2'-substituted nucleoside is a
2'-MOE nucleoside. In certain embodiments, each 2'-substituted
nucleoside is a 2'-OMe nucleoside. In certain embodiments, each
bicyclic nucleoside is a cEt nucleoside. In certain embodiments,
each bicyclic nucleoside is an LNA nucleoside.
[0619] In certain embodiments, each A is the same 2'-substituted
nucleoside. In certain embodiments, each B is the same bicyclic
nucleoside. In certain embodiments each A is the same 2'-modified
nucleoside and each B is the same bicyclic nucleoside. In certain
embodiments, each J is a 2'-modified nucleoside. In certain
embodiments each J is the same 2'-modified nucleoside. In certain
embodiments, each J and each A is the same 2'-modified
nucleoside.
[0620] In certain embodiments, a gapmer of Formula II has a motif
selected from among gapmer motifs 1-58.
[0621] In certain embodiments, a gapmer comprises a 5'-wing, a gap,
and a 3' wing, independently selected from among those proved in
the above tables, for example as provided in the following
table:
TABLE-US-00010 TABLE 9 Certain Gapmer Sugar Motifs 5-wing 3'-wing
Gapmer sugar motif sugar motif motif # (from table 1) Gap (from
table 2) 59 1(a-i) All 2'-deoxynucleosides 1(a-i) 60 2(a-i) All
2'-deoxynucleosides 1(a-i) 61 3(a-i) All 2'-deoxynucleosides 1(a-i)
62 4(a-i) All 2'-deoxynucleosides 1(a-i) 63 5(a-i) All
2'-deoxynucleosides 1(a-i) 64 6(a-i) All 2'-deoxynucleosides 1(a-i)
65 7(a-i) All 2'-deoxynucleosides 1(a-i) 66 8(a-i) All
2'-deoxynucleosides 1(a-i) 67 9(a-i) All 2'-deoxynucleosides 1(a-i)
68 10(a-i) All 2'-deoxynucleosides 1(a-i) 69 11(a-i) All
2'-deoxynucleosides 1(a-i) 70 12(a-i) All 2'-deoxynucleosides
1(a-i) 71 13(a-i) All 2'-deoxynucleosides 1(a-i) 72 14(a-i) All
2'-deoxynucleosides 1(a-i) 73 15(a-i) All 2'-deoxynucleosides
1(a-i) 74 16(a-i) All 2'-deoxynucleosides 1(a-i) 75 17(a-i) All
2'-deoxynucleosides 1(a-i) 76 18(a-i) All 2'-deoxynucleosides
1(a-i) 77 19(a-i) All 2'-deoxynucleosides 1(a-i) 78 20(a-i) All
2'-deoxynucleosides 1(a-i) 79 21(a-i) All 2'-deoxynucleosides
1(a-i) 80 22(a-i) All 2'-deoxynucleosides 1(a-i) 81 1(a-i) All
2'-deoxynucleosides 2(a-i) 82 2(a-i) All 2'-deoxynucleosides 2(a-i)
83 3(a-i) All 2'-deoxynucleosides 2(a-i) 84 4(a-i) All
2'-deoxynucleosides 2(a-i) 85 5(a-i) All 2'-deoxynucleosides 2(a-i)
86 6(a-i) All 2'-deoxynucleosides 2(a-i) 87 7(a-i) All
2'-deoxynucleosides 2(a-i) 88 8(a-i) All 2'-deoxynucleosides 2(a-i)
89 9(a-i) All 2'-deoxynucleosides 2(a-i) 90 10(a-i) All
2'-deoxynucleosides 2(a-i) 91 11(a-i) All 2'-deoxynucleosides
2(a-i) 92 12(a-i) All 2'-deoxynucleosides 2(a-i) 93 13(a-i) All
2'-deoxynucleosides 2(a-i) 94 14(a-i) All 2'-deoxynucleosides
2(a-i) 94 15(a-i) All 2'-deoxynucleosides 2(a-i) 96 16(a-i) All
2'-deoxynucleosides 2(a-i) 97 17(a-i) All 2'-deoxynucleosides
2(a-i) 98 18(a-i) All 2'-deoxynucleosides 2(a-i) 99 19(a-i) All
2'-deoxynucleosides 2(a-i) 100 20(a-i) All 2'-deoxynucleosides
2(a-i) 101 21(a-i) All 2'-deoxynucleosides 2(a-i) 102 22(a-i) All
2'-deoxynucleosides 2(a-i) 103 1(a-i) All 2'-deoxynucleosides
3(a-i) 104 2(a-i) All 2'-deoxynucleosides 3(a-i) 105 3(a-i) All
2'-deoxynucleosides 3(a-i) 106 4(a-i) All 2'-deoxynucleosides
3(a-i) 107 5(a-i) All 2'-deoxynucleosides 3(a-i) 108 6(a-i) All
2'-deoxynucleosides 3(a-i) 109 7(a-i) All 2'-deoxynucleosides
3(a-i) 110 8(a-i) All 2'-deoxynucleosides 3(a-i) 111 9(a-i) All
2'-deoxynucleosides 3(a-i) 112 10(a-i) All 2'-deoxynucleosides
3(a-i) 113 11(a-i) All 2'-deoxynucleosides 3(a-i) 114 12(a-i) All
2'-deoxynucleosides 3(a-i) 115 13(a-i) All 2'-deoxynucleosides
3(a-i) 116 14(a-i) All 2'-deoxynucleosides 3(a-i) 117 15(a-i) All
2'-deoxynucleosides 3(a-i) 118 16(a-i) All 2'-deoxynucleosides
3(a-i) 119 17(a-i) All 2'-deoxynucleosides 3(a-i) 120 18(a-i) All
2'-deoxynucleosides 3(a-i) 121 19(a-i) All 2'-deoxynucleosides
3(a-i) 122 20(a-i) All 2'-deoxynucleosides 3(a-i) 123 21(a-i) All
2'-deoxynucleosides 3(a-i) 124 22(a-i) All 2'-deoxynucleosides
3(a-i) 125 1(a-i) All 2'-deoxynucleosides 4(a-i) 126 2(a-i) All
2'-deoxynucleosides 4(a-i) 127 3(a-i) All 2'-deoxynucleosides
4(a-i) 128 4(a-i) All 2'-deoxynucleosides 4(a-i) 129 5(a-i) All
2'-deoxynucleosides 4(a-i) 130 6(a-i) All 2'-deoxynucleosides
4(a-i) 131 7(a-i) All 2'-deoxynucleosides 4(a-i) 132 8(a-i) All
2'-deoxynucleosides 4(a-i) 133 9(a-i) All 2'-deoxynucleosides
4(a-i) 134 10(a-i) All 2'-deoxynucleosides 4(a-i) 135 11(a-i) All
2'-deoxynucleosides 4(a-i) 136 12(a-i) All 2'-deoxynucleosides
4(a-i) 137 13(a-i) All 2'-deoxynucleosides 4(a-i) 138 14(a-i) All
2'-deoxynucleosides 4(a-i) 139 15(a-i) All 2'-deoxynucleosides
4(a-i) 140 16(a-i) All 2'-deoxynucleosides 4(a-i) 141 17(a-i) All
2'-deoxynucleosides 4(a-i) 142 18(a-i) All 2'-deoxynucleosides
4(a-i) 143 19(a-i) All 2'-deoxynucleosides 4(a-i) 144 20(a-i) All
2'-deoxynucleosides 4(a-i) 145 21(a-i) All 2'-deoxynucleosides
4(a-i) 146 22(a-i) All 2'-deoxynucleosides 4(a-i) 147 1(a-i) All
2'-deoxynucleosides 5(a-i) 148 2(a-i) All 2'-deoxynucleosides
5(a-i) 149 3(a-i) All 2'-deoxynucleosides 5(a-i) 150 4(a-i) All
2'-deoxynucleosides 5(a-i) 151 5(a-i) All 2'-deoxynucleosides
5(a-i) 152 6(a-i) All 2'-deoxynucleosides 5(a-i) 153 7(a-i) All
2'-deoxynucleosides 5(a-i) 154 8(a-i) All 2'-deoxynucleosides
5(a-i) 155 9(a-i) All 2'-deoxynucleosides 5(a-i) 156 10(a-i) All
2'-deoxynucleosides 5(a-i) 157 11(a-i) All 2'-deoxynucleosides
5(a-i) 158 12(a-i) All 2'-deoxynucleosides 5(a-i) 159 13(a-i) All
2'-deoxynucleosides 5(a-i) 160 14(a-i) All 2'-deoxynucleosides
5(a-i) 161 15(a-i) All 2'-deoxynucleosides 5(a-i) 162 16(a-i) All
2'-deoxynucleosides 5(a-i) 163 17(a-i) All 2'-deoxynucleosides
5(a-i) 164 18(a-i) All 2'-deoxynucleosides 5(a-i) 165 19(a-i) All
2'-deoxynucleosides 5(a-i) 166 20(a-i) All 2'-deoxynucleosides
5(a-i) 167 21(a-i) All 2'-deoxynucleosides 5(a-i) 168 22(a-i) All
2'-deoxynucleosides 5(a-i) 169 1(a-i) All 2'-deoxynucleosides
6(a-i) 170 2(a-i) All 2'-deoxynucleosides 6(a-i) 171 3(a-i) All
2'-deoxynucleosides 6(a-i) 172 4(a-i) All 2'-deoxynucleosides
6(a-i) 173 5(a-i) All 2'-deoxynucleosides 6(a-i) 174 6(a-i) All
2'-deoxynucleosides 6(a-i) 175 7(a-i) All 2'-deoxynucleosides
6(a-i) 176 8(a-i) All 2'-deoxynucleosides 6(a-i) 177 9(a-i) All
2'-deoxynucleosides 6(a-i) 178 10(a-i) All 2'-deoxynucleosides
6(a-i) 179 11(a-i) All 2'-deoxynucleosides 6(a-i) 180 12(a-i) All
2'-deoxynucleosides 6(a-i) 181 13(a-i) All 2'-deoxynucleosides
6(a-i) 182 14(a-i) All 2'-deoxynucleosides 6(a-i) 183 15(a-i) All
2'-deoxynucleosides 6(a-i) 184 16(a-i) All 2'-deoxynucleosides
6(a-i) 184 17(a-i) All 2'-deoxynucleosides 6(a-i) 186 18(a-i) All
2'-deoxynucleosides 6(a-i) 187 19(a-i) All 2'-deoxynucleosides
6(a-i) 188 20(a-i) All 2'-deoxynucleosides 6(a-i) 189 21(a-i) All
2'-deoxynucleosides 6(a-i) 190 22(a-i) All 2'-deoxynucleosides
6(a-i) 191 1(a-i) All 2'-deoxynucleosides 7(a-i) 192 2(a-i) All
2'-deoxynucleosides 7(a-i) 193 3(a-i) All 2'-deoxynucleosides
7(a-i) 194 4(a-i) All 2'-deoxynucleosides 7(a-i) 195 5(a-i) All
2'-deoxynucleosides 7(a-i) 196 6(a-i) All 2'-deoxynucleosides
7(a-i) 197 7(a-i) All 2'-deoxynucleosides 7(a-i) 198 8(a-i) All
2'-deoxynucleosides 7(a-i) 199 9(a-i) All 2'-deoxynucleosides
7(a-i) 200 10(a-i) All 2'-deoxynucleosides 7(a-i) 201 11(a-i) All
2'-deoxynucleosides 7(a-i) 202 12(a-i) All 2'-deoxynucleosides
7(a-i) 203 13(a-i) All 2'-deoxynucleosides 7(a-i) 204 14(a-i) All
2'-deoxynucleosides 7(a-i) 205 15(a-i) All 2'-deoxynucleosides
7(a-i) 206 16(a-i) All 2'-deoxynucleosides 7(a-i) 207 17(a-i) All
2'-deoxynucleosides 7(a-i) 208 18(a-i) All 2'-deoxynucleosides
7(a-i) 209 19(a-i) All 2'-deoxynucleosides 7(a-i) 210 20(a-i) All
2'-deoxynucleosides 7(a-i) 211 21(a-i) All 2'-deoxynucleosides
7(a-i) 212 22(a-i) All 2'-deoxynucleosides 7(a-i) 213 1(a-i) All
2'-deoxynucleosides 8(a-i) 214 2(a-i) All 2'-deoxynucleosides
8(a-i) 215 3(a-i) All 2'-deoxynucleosides 8(a-i) 216 4(a-i) All
2'-deoxynucleosides 8(a-i) 217 5(a-i) All 2'-deoxynucleosides
8(a-i) 218 6(a-i) All 2'-deoxynucleosides 8(a-i) 219 7(a-i) All
2'-deoxynucleosides 8(a-i) 220 8(a-i) All 2'-deoxynucleosides
8(a-i) 221 9(a-i) All 2'-deoxynucleosides 8(a-i) 222 10(a-i) All
2'-deoxynucleosides 8(a-i) 223 11(a-i) All 2'-deoxynucleosides
8(a-i) 224 12(a-i) All 2'-deoxynucleosides 8(a-i) 225 13(a-i) All
2'-deoxynucleosides 8(a-i) 226 14(a-i) All 2'-deoxynucleosides
8(a-i) 227 15(a-i) All 2'-deoxynucleosides 8(a-i) 228 16(a-i) All
2'-deoxynucleosides 8(a-i) 229 17(a-i) All 2'-deoxynucleosides
8(a-i) 230 18(a-i) All 2'-deoxynucleosides 8(a-i) 231 19(a-i) All
2'-deoxynucleosides 8(a-i) 232 20(a-i) All 2'-deoxynucleosides
8(a-i) 233 21(a-i) All 2'-deoxynucleosides 8(a-i) 234 22(a-i) All
2'-deoxynucleosides 8(a-i) 235 1(a-i) All 2'-deoxynucleosides
9(a-i) 236 2(a-i) All 2'-deoxynucleosides 9(a-i) 237 3(a-i) All
2'-deoxynucleosides 9(a-i) 238 4(a-i) All 2'-deoxynucleosides
9(a-i) 239 5(a-i) All 2'-deoxynucleosides 9(a-i) 240 6(a-i) All
2'-deoxynucleosides 9(a-i) 241 7(a-i) All 2'-deoxynucleosides
9(a-i) 242 8(a-i) All 2'-deoxynucleosides 9(a-i) 243 9(a-i) All
2'-deoxynucleosides 9(a-i) 244 10(a-i) All 2'-deoxynucleosides
9(a-i) 245 11(a-i) All 2'-deoxynucleosides 9(a-i) 246 12(a-i) All
2'-deoxynucleosides 9(a-i) 247 13(a-i) All 2'-deoxynucleosides
9(a-i) 248 14(a-i) All 2'-deoxynucleosides 9(a-i) 249 15(a-i) All
2'-deoxynucleosides 9(a-i) 250 16(a-i) All 2'-deoxynucleosides
9(a-i) 251 17(a-i) All 2'-deoxynucleosides 9(a-i) 252 18(a-i) All
2'-deoxynucleosides 9(a-i) 253 19(a-i) All 2'-deoxynucleosides
9(a-i) 254 20(a-i) All 2'-deoxynucleosides 9(a-i) 255 21(a-i) All
2'-deoxynucleosides 9(a-i) 256 22(a-i) All 2'-deoxynucleosides
9(a-i) 257 1(a-i) All 2'-deoxynucleosides 10(a-i) 258 2(a-i) All
2'-deoxynucleosides 10(a-i) 259 3(a-i) All 2'-deoxynucleosides
10(a-i) 260 4(a-i) All 2'-deoxynucleosides 10(a-i) 261 5(a-i) All
2'-deoxynucleosides 10(a-i) 262 6(a-i) All 2'-deoxynucleosides
10(a-i) 263 7(a-i) All 2'-deoxynucleosides 10(a-i) 264 8(a-i) All
2'-deoxynucleosides 10(a-i) 265 9(a-i) All 2'-deoxynucleosides
10(a-i) 266 10(a-i) All 2'-deoxynucleosides 10(a-i) 267 11(a-i) All
2'-deoxynucleosides 10(a-i) 268 12(a-i) All 2'-deoxynucleosides
10(a-i) 269 13(a-i) All 2'-deoxynucleosides 10(a-i) 270 14(a-i) All
2'-deoxynucleosides 10(a-i) 271 15(a-i) All 2'-deoxynucleosides
10(a-i) 272 16(a-i) All 2'-deoxynucleosides 10(a-i) 273 17(a-i) All
2'-deoxynucleosides 10(a-i) 274 18(a-i) All 2'-deoxynucleosides
10(a-i) 275 19(a-i) All 2'-deoxynucleosides 10(a-i) 276 20(a-i) All
2'-deoxynucleosides 10(a-i) 277 21(a-i) All 2'-deoxynucleosides
10(a-i) 278 22(a-i) All 2'-deoxynucleosides 10(a-i) 279 1(a)-22(a)
All 2'-deoxynucleosides 1(a)-10(a) 280 1(b)-22(b) All
2'-deoxynucleosides 1(a)-10(a) 281 1(c)-22(c) All
2'-deoxynucleosides 1(a)-10(a) 282 1(d)-22(d) All
2'-deoxynucleosides 1(a)-10(a) 283 1(e)-22(e) All
2'-deoxynucleosides 1(a)-10(a) 284 1(f)-22(f) All
2'-deoxynucleosides 1(a)-10(a) 285 1(g)-22(g) All
2'-deoxynucleosides 1(a)-10(a) 286 1(h)-22(h) All
2'-deoxynucleosides 1(a)-10(a) 287 1(i)-22(i) All
2'-deoxynucleosides 1(a)-10(a) 288 1(a)-22(a) All
2'-deoxynucleosides 1(b)-10(b) 289 1(b)-22(b) All
2'-deoxynucleosides 1(b)-10(b) 290 1(c)-22(c) All
2'-deoxynucleosides 1(b)-10(b) 291 1(d)-22(d) All
2'-deoxynucleosides 1(b)-10(b) 292 1(e)-22(e) All
2'-deoxynucleosides 1(b)-10(b) 293 1(f)-22(f) All
2'-deoxynucleosides 1(b)-10(b) 294 1(g)-22(g) All
2'-deoxynucleosides 1(b)-10(b) 295 1(h)-22(h) All
2'-deoxynucleosides 1(b)-10(b) 296 1(i)-22(i) All
2'-deoxynucleosides 1(b)-10(b) 297 1(a)-22(a) All
2'-deoxynucleosides 1(c)-10(c) 298 1(b)-22(b) All
2'-deoxynucleosides 1(c)-10(c) 299 1(c)-22(c) All
2'-deoxynucleosides 1(c)-10(c) 300 1(d)-22(d) All
2'-deoxynucleosides 1(c)-10(c) 301 1(e)-22(e) All
2'-deoxynucleosides 1(c)-10(c)
302 1(f)-22(f) All 2'-deoxynucleosides 1(c)-10(c) 303 1(g)-22(g)
All 2'-deoxynucleosides 1(c)-10(c) 304 1(h)-22(h) All
2'-deoxynucleosides 1(c)-10(c) 305 1(i)-22(i) All
2'-deoxynucleosides 1(c)-10(c) 306 1(a)-22(a) All
2'-deoxynucleosides 1(d)-10(d) 307 1(b)-22(b) All
2'-deoxynucleosides 1(d)-10(d) 308 1(c)-22(c) All
2'-deoxynucleosides 1(d)-10(d) 309 1(d)-22(d) All
2'-deoxynucleosides 1(d)-10(d) 310 1(e)-22(e) All
2'-deoxynucleosides 1(d)-10(d) 311 1(f)-22(f) All
2'-deoxynucleosides 1(d)-10(d) 312 1(g)-22(g) All
2'-deoxynucleosides 1(d)-10(d) 313 1(h)-22(h) All
2'-deoxynucleosides 1(d)-10(d) 314 1(i)-22(i) All
2'-deoxynucleosides 1(d)-10(d) 315 1(a)-22(a) All
2'-deoxynucleosides 1(e)-10(e) 316 1(b)-22(b) All
2'-deoxynucleosides 1(e)-10(e) 317 1(c)-22(c) All
2'-deoxynucleosides 1(e)-10(e) 318 1(d)-22(d) All
2'-deoxynucleosides 1(e)-10(e) 319 1(e)-22(e) All
2'-deoxynucleosides 1(e)-10(e) 320 1(f)-22(f) All
2'-deoxynucleosides 1(e)-10(e) 321 1(g)-22(g) All
2'-deoxynucleosides 1(e)-10(e) 322 1(h)-22(h) All
2'-deoxynucleosides 1(e)-10(e) 323 1(i)-22(i) All
2'-deoxynucleosides 1(e)-10(e) 324 1(a)-22(a) All
2'-deoxynucleosides 1(f)-10(f) 325 1(b)-22(b) All
2'-deoxynucleosides 1(f)-10(f) 326 1(c)-22(c) All
2'-deoxynucleosides 1(f)-10(f) 327 1(d)-22(d) All
2'-deoxynucleosides 1(f)-10(f) 328 1(e)-22(e) All
2'-deoxynucleosides 1(f)-10(f) 329 1(f)-22(f) All
2'-deoxynucleosides 1(f)-10(f) 330 1(g)-22(g) All
2'-deoxynucleosides 1(f)-10(f) 331 1(h)-22(h) All
2'-deoxynucleosides 1(f)-10(f) 332 1(i)-22(i) All
2'-deoxynucleosides 1(f)-10(f) 333 1(a)-22(a) All
2'-deoxynucleosides 1(g)-10(g) 334 1(b)-22(b) All
2'-deoxynucleosides 1(g)-10(g) 335 1(c)-22(c) All
2'-deoxynucleosides 1(g)-10(g) 336 1(d)-22(d) All
2'-deoxynucleosides 1(g)-10(g) 337 1(e)-22(e) All
2'-deoxynucleosides 1(g)-10(g) 338 1(f)-22(f) All
2'-deoxynucleosides 1(g)-10(g) 339 1(g)-22(g) All
2'-deoxynucleosides 1(g)-10(g) 340 1(h)-22(h) All
2'-deoxynucleosides 1(g)-10(g) 341 1(i)-22(i) All
2'-deoxynucleosides 1(g)-10(g) 342 1(a)-22(a) All
2'-deoxynucleosides 1(h)-10(h) 343 1(b)-22(b) All
2'-deoxynucleosides 1(h)-10(h) 344 1(c)-22(c) All
2'-deoxynucleosides 1(h)-10(h) 345 1(d)-22(d) All
2'-deoxynucleosides 1(h)-10(h) 346 1(e)-22(e) All
2'-deoxynucleosides 1(h)-10(h) 347 1(f)-22(f) All
2'-deoxynucleosides 1(h)-10(h) 348 1(g)-22(g) All
2'-deoxynucleosides 1(h)-10(h) 349 1(h)-22(h) All
2'-deoxynucleosides 1(h)-10(h) 350 1(i)-22(i) All
2'-deoxynucleosides 1(h)-10(h) 351 1(a)-22(a) All
2'-deoxynucleosides 1(i)-10(i) 352 1(b)-22(b) All
2'-deoxynucleosides 1(i)-10(i) 353 1(c)-22(c) All
2'-deoxynucleosides 1(i)-10(i) 354 1(d)-22(d) All
2'-deoxynucleosides 1(i)-10(i) 355 1(e)-22(e) All
2'-deoxynucleosides 1(i)-10(i) 356 1(f)-22(f) All
2'-deoxynucleosides 1(i)-10(i) 357 1(g)-22(g) All
2'-deoxynucleosides 1(i)-10(i) 358 1(h)-22(h) All
2'-deoxynucleosides 1(i)-10(i) 359 1(i)-22(i) All
2'-deoxynucleosides 1(i)-10(i) 360 1(a-l) All 2'-deoxynucleosides
1(a-l) 361 2(a-l) All 2'-deoxynucleosides 1(a-l) 362 3(a-l) All
2'-deoxynucleosides 1(a-l) 363 4(a-l) All 2'-deoxynucleosides
1(a-l) 364 5(a-l) All 2'-deoxynucleosides 1(a-l) 365 6(a-l) All
2'-deoxynucleosides 1(a-l) 366 7(a-l) All 2'-deoxynucleosides
1(a-l) 367 8(a-l) All 2'-deoxynucleosides 1(a-l) 368 9(a-l) All
2'-deoxynucleosides 1(a-l) 369 10(a-l) All 2'-deoxynucleosides
1(a-l) 370 11(a-l) All 2'-deoxynucleosides 1(a-l) 371 12(a-l) All
2'-deoxynucleosides 1(a-l) 372 13(a-l) All 2'-deoxynucleosides
1(a-l) 373 14(a-l) All 2'-deoxynucleosides 1(a-l) 374 15(a-l) All
2'-deoxynucleosides 1(a-l) 375 16(a-l) All 2'-deoxynucleosides
1(a-l) 376 17(a-l) All 2'-deoxynucleosides 1(a-l) 377 18(a-l) All
2'-deoxynucleosides 1(a-l) 378 19(a-l) All 2'-deoxynucleosides
1(a-l) 379 20(a-l) All 2'-deoxynucleosides 1(a-l) 380 21(a-l) All
2'-deoxynucleosides 1(a-l) 381 22(a-l) All 2'-deoxynucleosides
1(a-l) 382 1(a-l) All 2'-deoxynucleosides 2(a-l) 383 2(a-l) All
2'-deoxynucleosides 2(a-l) 384 3(a-l) All 2'-deoxynucleosides
2(a-l) 385 4(a-l) All 2'-deoxynucleosides 2(a-l) 386 5(a-l) All
2'-deoxynucleosides 2(a-l) 387 6(a-l) All 2'-deoxynucleosides
2(a-l) 388 7(a-l) All 2'-deoxynucleosides 2(a-l) 389 8(a-l) All
2'-deoxynucleosides 2(a-l) 390 9(a-l) All 2'-deoxynucleosides
2(a-l) 391 10(a-l) All 2'-deoxynucleosides 2(a-l) 392 11(a-l) All
2'-deoxynucleosides 2(a-l) 393 12(a-l) All 2'-deoxynucleosides
2(a-l) 394 13(a-l) All 2'-deoxynucleosides 2(a-l) 395 14(a-l) All
2'-deoxynucleosides 2(a-l) 396 15(a-l) All 2'-deoxynucleosides
2(a-l) 397 16(a-l) All 2'-deoxynucleosides 2(a-l) 398 17(a-l) All
2'-deoxynucleosides 2(a-l) 399 18(a-l) All 2'-deoxynucleosides
2(a-l) 400 19(a-l) All 2'-deoxynucleosides 2(a-l) 401 20(a-l) All
2'-deoxynucleosides 2(a-l) 402 21(a-l) All 2'-deoxynucleosides
2(a-l) 403 22(a-l) All 2'-deoxynucleosides 2(a-l) 404 1(a-l) All
2'-deoxynucleosides 3(a-l) 405 2(a-l) All 2'-deoxynucleosides
3(a-l) 406 3(a-l) All 2'-deoxynucleosides 3(a-l) 407 4(a-l) All
2'-deoxynucleosides 3(a-l) 408 5(a-l) All 2'-deoxynucleosides
3(a-l) 409 6(a-l) All 2'-deoxynucleosides 3(a-l) 410 7(a-l) All
2'-deoxynucleosides 3(a-l) 411 8(a-l) All 2'-deoxynucleosides
3(a-l) 412 9(a-l) All 2'-deoxynucleosides 3(a-l) 413 10(a-l) All
2'-deoxynucleosides 3(a-l) 414 11(a-l) All 2'-deoxynucleosides
3(a-l) 415 12(a-l) All 2'-deoxynucleosides 3(a-l) 416 13(a-l) All
2'-deoxynucleosides 3(a-l) 417 14(a-l) All 2'-deoxynucleosides
3(a-l) 418 15(a-l) All 2'-deoxynucleosides 3(a-l) 419 16(a-l) All
2'-deoxynucleosides 3(a-l) 420 17(a-l) All 2'-deoxynucleosides
3(a-l) 421 18(a-l) All 2'-deoxynucleosides 3(a-l) 422 19(a-l) All
2'-deoxynucleosides 3(a-l) 423 20(a-l) All 2'-deoxynucleosides
3(a-l) 424 21(a-l) All 2'-deoxynucleosides 3(a-l) 425 22(a-l) All
2'-deoxynucleosides 3(a-l) 426 1(a-l) All 2'-deoxynucleosides
4(a-l) 427 2(a-l) All 2'-deoxynucleosides 4(a-l) 428 3(a-l) All
2'-deoxynucleosides 4(a-l) 429 4(a-l) All 2'-deoxynucleosides
4(a-l) 430 5(a-l) All 2'-deoxynucleosides 4(a-l) 431 6(a-l) All
2'-deoxynucleosides 4(a-l) 432 7(a-l) All 2'-deoxynucleosides
4(a-l) 433 8(a-l) All 2'-deoxynucleosides 4(a-l) 434 9(a-l) All
2'-deoxynucleosides 4(a-l) 435 10(a-l) All 2'-deoxynucleosides
4(a-l) 436 11(a-l) All 2'-deoxynucleosides 4(a-l) 437 12(a-l) All
2'-deoxynucleosides 4(a-l) 438 13(a-l) All 2'-deoxynucleosides
4(a-l) 439 14(a-l) All 2'-deoxynucleosides 4(a-l) 440 15(a-l) All
2'-deoxynucleosides 4(a-l) 441 16(a-l) All 2'-deoxynucleosides
4(a-l) 442 17(a-l) All 2'-deoxynucleosides 4(a-l) 443 18(a-l) All
2'-deoxynucleosides 4(a-l) 444 19(a-l) All 2'-deoxynucleosides
4(a-l) 445 20(a-l) All 2'-deoxynucleosides 4(a-l) 446 21(a-l) All
2'-deoxynucleosides 4(a-l) 447 22(a-l) All 2'-deoxynucleosides
4(a-l) 448 1(a-l) All 2'-deoxynucleosides 5(a-l) 449 2(a-l) All
2'-deoxynucleosides 5(a-l) 450 3(a-l) All 2'-deoxynucleosides
5(a-l) 451 4(a-l) All 2'-deoxynucleosides 5(a-l) 452 5(a-l) All
2'-deoxynucleosides 5(a-l) 453 6(a-l) All 2'-deoxynucleosides
5(a-l) 454 7(a-l) All 2'-deoxynucleosides 5(a-l) 455 8(a-l) All
2'-deoxynucleosides 5(a-l) 456 9(a-l) All 2'-deoxynucleosides
5(a-l) 457 10(a-l) All 2'-deoxynucleosides 5(a-l) 458 11(a-l) All
2'-deoxynucleosides 5(a-l) 459 12(a-l) All 2'-deoxynucleosides
5(a-l) 460 13(a-l) All 2'-deoxynucleosides 5(a-l) 461 14(a-l) All
2'-deoxynucleosides 5(a-l) 462 15(a-l) All 2'-deoxynucleosides
5(a-l) 463 16(a-l) All 2'-deoxynucleosides 5(a-l) 464 17(a-l) All
2'-deoxynucleosides 5(a-l) 465 18(a-l) All 2'-deoxynucleosides
5(a-l) 466 19(a-l) All 2'-deoxynucleosides 5(a-l) 467 20(a-l) All
2'-deoxynucleosides 5(a-l) 468 21(a-l) All 2'-deoxynucleosides
5(a-l) 469 22(a-l) All 2'-deoxynucleosides 5(a-l) 470 1(a-l) All
2'-deoxynucleosides 6(a-l) 471 2(a-l) All 2'-deoxynucleosides
6(a-l) 472 3(a-l) All 2'-deoxynucleosides 6(a-l) 473 4(a-l) All
2'-deoxynucleosides 6(a-l) 474 5(a-l) All 2'-deoxynucleosides
6(a-l) 475 6(a-l) All 2'-deoxynucleosides 6(a-l) 476 7(a-l) All
2'-deoxynucleosides 6(a-l) 477 8(a-l) All 2'-deoxynucleosides
6(a-l) 478 9(a-l) All 2'-deoxynucleosides 6(a-l) 479 10(a-l) All
2'-deoxynucleosides 6(a-l) 480 11(a-l) All 2'-deoxynucleosides
6(a-l) 481 12(a-l) All 2'-deoxynucleosides 6(a-l) 482 13(a-l) All
2'-deoxynucleosides 6(a-l) 483 14(a-l) All 2'-deoxynucleosides
6(a-l) 484 15(a-l) All 2'-deoxynucleosides 6(a-l) 485 16(a-l) All
2'-deoxynucleosides 6(a-l) 486 17(a-l) All 2'-deoxynucleosides
6(a-l) 487 18(a-l) All 2'-deoxynucleosides 6(a-l) 488 19(a-l) All
2'-deoxynucleosides 6(a-l) 489 20(a-l) All 2'-deoxynucleosides
6(a-l) 490 21(a-l) All 2'-deoxynucleosides 6(a-l) 491 22(a-l) All
2'-deoxynucleosides 6(a-l) 492 1(a-l) All 2'-deoxynucleosides
7(a-l) 493 2(a-l) All 2'-deoxynucleosides 7(a-l) 494 3(a-l) All
2'-deoxynucleosides 7(a-l) 495 4(a-l) All 2'-deoxynucleosides
7(a-l) 496 5(a-l) All 2'-deoxynucleosides 7(a-l) 497 6(a-l) All
2'-deoxynucleosides 7(a-l) 498 7(a-l) All 2'-deoxynucleosides
7(a-l) 499 8(a-l) All 2'-deoxynucleosides 7(a-l) 500 9(a-l) All
2'-deoxynucleosides 7(a-l) 501 10(a-l) All 2'-deoxynucleosides
7(a-l) 502 11(a-l) All 2'-deoxynucleosides 7(a-l) 503 12(a-l) All
2'-deoxynucleosides 7(a-l) 504 13(a-l) All 2'-deoxynucleosides
7(a-l) 505 14(a-l) All 2'-deoxynucleosides 7(a-l) 506 15(a-l) All
2'-deoxynucleosides 7(a-l) 507 16(a-l) All 2'-deoxynucleosides
7(a-l) 508 17(a-l) All 2'-deoxynucleosides 7(a-l) 509 18(a-l) All
2'-deoxynucleosides 7(a-l) 510 19(a-l) All 2'-deoxynucleosides
7(a-l) 511 20(a-l) All 2'-deoxynucleosides 7(a-l) 512 21(a-l) All
2'-deoxynucleosides 7(a-l) 513 22(a-l) All 2'-deoxynucleosides
7(a-l) 514 1(a-l) All 2'-deoxynucleosides 8(a-l) 515 2(a-l) All
2'-deoxynucleosides 8(a-l) 516 3(a-l) All 2'-deoxynucleosides
8(a-l) 517 4(a-l) All 2'-deoxynucleosides 8(a-l) 518 5(a-l) All
2'-deoxynucleosides 8(a-l) 519 6(a-l) All 2'-deoxynucleosides
8(a-l) 520 7(a-l) All 2'-deoxynucleosides 8(a-l) 521 8(a-l) All
2'-deoxynucleosides 8(a-l) 522 9(a-l) All 2'-deoxynucleosides
8(a-l) 523 10(a-l) All 2'-deoxynucleosides 8(a-l) 524 11(a-l) All
2'-deoxynucleosides 8(a-l) 525 12(a-l) All 2'-deoxynucleosides
8(a-l) 526 13(a-l) All 2'-deoxynucleosides 8(a-l) 527 14(a-l) All
2'-deoxynucleosides 8(a-l) 528 15(a-l) All 2'-deoxynucleosides
8(a-l) 529 16(a-l) All 2'-deoxynucleosides 8(a-l) 530 17(a-l) All
2'-deoxynucleosides 8(a-l) 531 18(a-l) All 2'-deoxynucleosides
8(a-l) 532 19(a-l) All 2'-deoxynucleosides 8(a-l) 533 20(a-l) All
2'-deoxynucleosides 8(a-l) 534 21(a-l) All 2'-deoxynucleosides
8(a-l) 535 22(a-l) All 2'-deoxynucleosides 8(a-l) 536 1(a-l) All
2'-deoxynucleosides 9(a-l) 537 2(a-l) All 2'-deoxynucleosides
9(a-l) 538 3(a-l) All 2'-deoxynucleosides 9(a-l) 539 4(a-l) All
2'-deoxynucleosides 9(a-l) 540 5(a-l) All 2'-deoxynucleosides
9(a-l) 541 6(a-l) All 2'-deoxynucleosides 9(a-l) 542 7(a-l) All
2'-deoxynucleosides 9(a-l) 543 8(a-l) All 2'-deoxynucleosides
9(a-l) 544 9(a-l) All 2'-deoxynucleosides 9(a-l) 545 10(a-l) All
2'-deoxynucleosides 9(a-l) 546 11(a-l) All 2'-deoxynucleosides
9(a-l) 547 12(a-l) All 2'-deoxynucleosides 9(a-l) 548 13(a-l) All
2'-deoxynucleosides 9(a-l) 549 14(a-l) All 2'-deoxynucleosides
9(a-l) 550 15(a-l) All 2'-deoxynucleosides 9(a-l) 551 16(a-l) All
2'-deoxynucleosides 9(a-l) 552 17(a-l) All 2'-deoxynucleosides
9(a-l)
553 18(a-l) All 2'-deoxynucleosides 9(a-l) 554 19(a-l) All
2'-deoxynucleosides 9(a-l) 555 20(a-l) All 2'-deoxynucleosides
9(a-l) 556 21(a-l) All 2'-deoxynucleosides 9(a-l) 557 22(a-l) All
2'-deoxynucleosides 9(a-l) 558 1(a-l) All 2'-deoxynucleosides
10(a-l) 559 2(a-l) All 2'-deoxynucleosides 10(a-l) 560 3(a-l) All
2'-deoxynucleosides 10(a-l) 561 4(a-l) All 2'-deoxynucleosides
10(a-l) 562 5(a-l) All 2'-deoxynucleosides 10(a-l) 563 6(a-l) All
2'-deoxynucleosides 10(a-l) 564 7(a-l) All 2'-deoxynucleosides
10(a-l) 565 8(a-l) All 2'-deoxynucleosides 10(a-l) 566 9(a-l) All
2'-deoxynucleosides 10(a-l) 567 10(a-l) All 2'-deoxynucleosides
10(a-l) 568 11(a-l) All 2'-deoxynucleosides 10(a-l) 569 12(a-l) All
2'-deoxynucleosides 10(a-l) 570 13(a-l) All 2'-deoxynucleosides
10(a-l) 571 14(a-l) All 2'-deoxynucleosides 10(a-l) 572 15(a-l) All
2'-deoxynucleosides 10(a-l) 573 16(a-l) All 2'-deoxynucleosides
10(a-l) 574 17(a-l) All 2'-deoxynucleosides 10(a-l) 575 18(a-l) All
2'-deoxynucleosides 10(a-l) 576 19(a-l) All 2'-deoxynucleosides
10(a-l) 577 20(a-l) All 2'-deoxynucleosides 10(a-l) 578 21(a-l) All
2'-deoxynucleosides 10(a-l) 579 22(a-l) All 2'-deoxynucleosides
10(a-l) 580 1(j)-22(j) All 2'-deoxynucleosides 1(a)-10(a) 581
1(k)-22(k) All 2'-deoxynucleosides 1(a)-10(a) 582 1(l)-22(l) All
2'-deoxynucleosides 1(a)-10(a) 583 1(j)-22(j) All
2'-deoxynucleosides 1(b)-10(b) 584 1(k)-22(k) All
2'-deoxynucleosides 1(b)-10(b) 585 1(l)-22(l) All
2'-deoxynucleosides 1(b)-10(b) 586 1(j)-22(j) All
2'-deoxynucleosides 1(c)-10(c) 587 1(k)-22(k) All
2'-deoxynucleosides 1(c)-10(c) 588 1(l)-22(l) All
2'-deoxynucleosides 1(c)-10(c) 589 1(j)-22(j) All
2'-deoxynucleosides 1(d)-10(d) 590 1(k)-22(k) All
2'-deoxynucleosides 1(d)-10(d) 591 1(l)-22(l) All
2'-deoxynucleosides 1(d)-10(d) 592 1(j)-22(j) All
2'-deoxynucleosides 1(e)-10(e) 593 1(k)-22(k) All
2'-deoxynucleosides 1(e)-10(e) 594 1(l)-22(l) All
2'-deoxynucleosides 1(e)-10(e) 595 1(j)-22(j) All
2'-deoxynucleosides 1(f)-10(f) 596 1(k)-22(k) All
2'-deoxynucleosides 1(f)-10(f) 597 1(l)-22(l) All
2'-deoxynucleosides 1(f)-10(f) 598 1(j)-22(j) All
2'-deoxynucleosides 1(g)-10(g) 599 1(k)-22(k) All
2'-deoxynucleosides 1(g)-10(g) 600 1(l)-22(l) All
2'-deoxynucleosides 1(g)-10(g) 601 1(j)-22(j) All
2'-deoxynucleosides 1(h)-10(h) 602 1(k)-22(k) All
2'-deoxynucleosides 1(h)-10(h) 603 1(l)-22(l) All
2'-deoxynucleosides 1(h)-10(h) 604 1(j)-22(j) All
2'-deoxynucleosides 1(i)-10(i) 605 1(k)-22(k) All
2'-deoxynucleosides 1(i)-10(i) 606 1(l)-22(l) All
2'-deoxynucleosides 1(i)-10(i) 607 1(j)-22(j) All
2'-deoxynucleosides 1(j)-10(j) 608 1(k)-22(k) All
2'-deoxynucleosides 1(j)-10(j) 609 1(l)-22(l) All
2'-deoxynucleosides 1(j)-10(j) 610 1(j)-22(j) All
2'-deoxynucleosides 1(k)-10(k) 611 1(k)-22(k) All
2'-deoxynucleosides 1(k)-10(k) 612 1(l)-22(l) All
2'-deoxynucleosides 1(k)-10(k) 612 1(j)-22(j) All
2'-deoxynucleosides 1(l)-10(l) 614 1(k)-22(k) All
2'-deoxynucleosides 1(l)-10(l) 615 1(l)-22(l) All
2'-deoxynucleosides 1(l)-10(l) 616 1k All 2'-deoxynucleosides
1m
[0622] In certain embodiments, a gapmer comprises a 5'-wing
selected from among the 5'-wings provided herein and any 3'-wing.
In certain embodiments, a gapmer comprises a 5'-wing selected from
among 1(a-l) to 22(a-l). In certain embodiments, a gapmer comprises
a 5'-wing selected from among 1(a-l) to 22(a-l). In certain
embodiments, a gapmer comprises a 3'-wing selected from among the
3'-wings provided herein and any 5'-wing. In certain embodiments, a
gapmer comprises a 3'-wing selected from among 1(a-i) to 10(a-i).
In certain embodiments, a gapmer comprises a 3'-wing selected from
among 1(a-l) to 10(a-l).
[0623] In certain embodiments, a gapmer has a sugar motif other
than: E-K-K-(D).sub.9-K-K-E; E-E-E-E-K-(D).sub.9-E-E-E-E-E;
E-K--K-K-(D).sub.9-K--K-K-E; K-E-E-K-(D).sub.9-K-E-E-K;
K-D-D-K-(D).sub.9-K-D-D-K; K-E-K-E-K-(D).sub.9-K-E-K-E-K;
K-D-K-D-K-(D).sub.9-K-D-K-D-K; E-K-E-K-(D).sub.9-K-E-K-E;
E-E-E-E-E-K-(D).sub.g-E-E-E-E-E; or E-K-E-K-E-(D).sub.9-E-K-E-K-E.
In certain embodiments, a gapmer not having one of the above motifs
has a sugar motif of Formula I. In certain embodiments, a gapmer
not having one of the above motifs has a sugar motif selected from
motifs 1-58. In certain embodiments, a gapmer not having one of the
above motifs has a sugar motif of Formula I and selected from sugar
motifs 1-58. In certain embodiments, a gapmer not having one of the
above motifs has a sugar motif of Formula II. In certain
embodiments, a gapmer not having one of the above motifs has a
sugar motif selected from motifs 1-615. In certain embodiments, a
gapmer not having one of the above motifs has a sugar motif of
Formula II and selected from sugar motifs 1-615.
[0624] In certain embodiments a gapmer comprises a
A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-AA motif. In certain
embodiments a gapmer comprises a
B-(D).sub.4-A-(D).sub.4-A-(D).sub.4-AA motif. In certain
embodiments a gapmer comprises a
A-(D).sub.4-B-(D).sub.4-A-(D).sub.4-AA motif. In certain
embodiments a gapmer comprises a
A-(D).sub.4-A-(D).sub.4-B-(D).sub.4-AA motif. In certain
embodiments a gapmer comprises a
A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-BA motif. In certain
embodiments a gapmer comprises a
A-(D).sub.4-A-(D).sub.4-A-(D).sub.4-BB motif. In certain
embodiments a gapmer comprises a
K-(D).sub.4-K-(D).sub.4-K-(D).sub.4-K-E motif.
[0625] Certain Internucleoside Linkage Motifs
[0626] In certain embodiments, oligonucleotides comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, internucleoside linkages are
arranged in a gapped motif, as described above for sugar
modification motif. In such embodiments, the internucleoside
linkages in each of two wing regions are different from the
internucleoside linkages in the gap region. In certain embodiments
the internucleoside linkages in the wings are phosphodiester and
the internucleoside linkages in the gap are phosphorothioate. The
sugar modification motif is independently selected, so such
oligonucleotides having a gapped internucleoside linkage motif may
or may not have a gapped sugar modification motif and if it does
have a gapped sugar motif, the wing and gap lengths may or may not
be the same.
[0627] In certain embodiments, oligonucleotides comprise a region
having an alternating internucleoside linkage motif. In certain
embodiments, oligonucleotides of the present invention comprise a
region of uniformly modified internucleoside linkages. In certain
such embodiments, the oligonucleotide comprises a region that is
uniformly linked by phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide is uniformly linked by
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate and at least one internucleoside linkage is
phosphorothioate.
[0628] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
[0629] Certain Nucleobase Modification Motifs
[0630] In certain embodiments, oligonucleotides comprise chemical
modifications to nucleobases arranged along the oligonucleotide or
region thereof in a defined pattern or nucleobases modification
motif. In certain such embodiments, nucleobase modifications are
arranged in a gapped motif. In certain embodiments, nucleobase
modifications are arranged in an alternating motif. In certain
embodiments, each nucleobase is modified. In certain embodiments,
none of the nucleobases is chemically modified.
[0631] In certain embodiments, oligonucleotides comprise a block of
modified nucleobases. In certain such embodiments, the block is at
the 3'-end of the oligonucleotide. In certain embodiments the block
is within 3 nucleotides of the 3'-end of the oligonucleotide. In
certain such embodiments, the block is at the 5'-end of the
oligonucleotide. In certain embodiments the block is within 3
nucleotides of the 5'-end of the oligonucleotide.
[0632] In certain embodiments, nucleobase modifications are a
function of the natural base at a particular position of an
oligonucleotide. For example, in certain embodiments each purine or
each pyrimidine in an oligonucleotide is modified. In certain
embodiments, each adenine is modified. In certain embodiments, each
guanine is modified. In certain embodiments, each thymine is
modified. In certain embodiments, each cytosine is modified. In
certain embodiments, each uracil is modified.
[0633] In certain embodiments, some, all, or none of the cytosine
moieties in an oligonucleotide are 5-methyl cytosine moieties.
Herein, 5-methyl cytosine is not a "modified nucleobase."
Accordingly, unless otherwise indicated, unmodified nucleobases
include both cytosine residues having a 5-methyl and those lacking
a 5 methyl. In certain embodiments, the methylation state of all or
some cytosine nucleobases is specified.
[0634] Certain Overall Lengths
[0635] In certain embodiments, the present invention provides
oligomeric compounds including oligonucleotides of any of a variety
of ranges of lengths. In certain embodiments, the invention
provides oligomeric compounds or oligonucleotides consisting of X
to Y linked nucleosides, where X represents the fewest number of
nucleosides in the range and Y represents the largest number of
nucleosides in the range. In certain such embodiments, X and Y are
each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and
50; provided that X.ltoreq.Y. For example, in certain embodiments,
the invention provides oligomeric compounds which comprise
oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8
to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to
20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27,
8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to
14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21,
9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to
29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10
to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22,
10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to
29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11
to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23,
11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to
30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12
to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25,
12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to
15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13
to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28,
13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to
19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14
to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17,
15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to
24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16
to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23,
16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to
30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17
to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30,
18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to
25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19
to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29,
19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to
24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21
to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28,
21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to
27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23
to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27,
24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to
29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27
to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked
nucleosides. In embodiments where the number of nucleosides of an
oligomeric compound or oligonucleotide is limited, whether to a
range or to a specific number, the oligomeric compound or
oligonucleotide may, nonetheless further comprise additional other
substituents. For example, an oligonucleotide comprising 8-30
nucleosides excludes oligonucleotides having 31 nucleosides, but,
unless otherwise indicated, such an oligonucleotide may further
comprise, for example one or more conjugates, terminal groups, or
other substituents. In certain embodiments, a gapmer
oligonucleotide has any of the above lengths.
[0636] In certain embodiments, any of the gapmer motifs provided
above, including but not limited to gapmer motifs 1-278 provided in
Tables 3 and 4, may have any of the above lengths. One of skill in
the art will appreciate that certain lengths may not be possible
for certain motifs. For example: a gapmer having a 5'-wing region
consisting of four nucleotides, a gap consisting of at least six
nucleotides, and a 3'-wing region consisting of three nucleotides
cannot have an overall length less than 13 nucleotides. Thus, one
would understand that the lower length limit is 13 and that the
limit of 10 in "10-20" has no effect in that embodiment.
[0637] Further, where an oligonucleotide is described by an overall
length range and by regions having specified lengths, and where the
sum of specified lengths of the regions is less than the upper
limit of the overall length range, the oligonucleotide may have
additional nucleosides, beyond those of the specified regions,
provided that the total number of nucleosides does not exceed the
upper limit of the overall length range. For example, an
oligonucleotide consisting of 20-25 linked nucleosides comprising a
5'-wing consisting of 5 linked nucleosides; a 3'-wing consisting of
5 linked nucleosides and a central gap consisting of 10 linked
nucleosides (5+5+10=20) may have up to 5 nucleosides that are not
part of the 5'-wing, the 3'-wing, or the gap (before reaching the
overall length limitation of 25). Such additional nucleosides may
be 5' of the 5'-wing and/or 3' of the 3' wing.
[0638] Certain Oligonucleotides
[0639] In certain embodiments, oligonucleotides of the present
invention are characterized by their sugar motif, internucleoside
linkage motif, nucleobase modification motif and overall length. In
certain embodiments, such parameters are each independent of one
another. Thus, each internucleoside linkage of an oligonucleotide
having a gapmer sugar motif may be modified or unmodified and may
or may not follow the gapmer modification pattern of the sugar
modifications. Thus, the internucleoside linkages within the wing
regions of a sugar-gapmer may be the same or different from one
another and may be the same or different from the internucleoside
linkages of the gap region. Likewise, such sugar-gapmer
oligonucleotides may comprise one or more modified nucleobase
independent of the gapmer pattern of the sugar modifications. One
of skill in the art will appreciate that such motifs may be
combined to create a variety of oligonucleotides, such as those
provided in the non-limiting Table 5 below.
TABLE-US-00011 TABLE 10 Certain Oligonucleotides Overall
Internucleoside Nucleobase Mod. Length Sugar motif Linkage Motif
Motif 12 Gapmer motif selected from 1-278 uniform PS uniform
unmodified 14 Gapmer motif selected from 1-278 2-14-2 gapmer: PO in
uniform unmodified wings and PS in gap 14 Gapmer motif selected
from 1-278 uniform PS uniform unmodified; all C's are 5-meC 16
Gapmer of Formula I uniform PS uniform unmodified; no Cs are 5-meC)
16 Gapmer of Formula I uniform PS uniform unmodified; at least one
nucleobase is a 5-meC 16 Gapmer of Formula I and having uniform PS
uniform unmodified motif selected from 1-58 17 Gapmer of Formula I
and having uniform PO uniform unmodified motif selected from 1-58
17 Gapmer motif selected from 1-278 uniform PS uniform unmodified
17 Gapmer of Formula I uniform PS uniform unmodified 18 Gapmer of
Formula I and having uniform PS uniform unmodified motif selected
from 1-58 18 Gapmer motif selected from 1-278 uniform PS uniform
unmodified 20 Gapmer of Formula I uniform PS uniform unmodified 12
Gapmer motif selected from 1-359 uniform PS uniform unmodified 14
Gapmer motif selected from 1-359 2-14-2 gapmer: PO in uniform
unmodified wings and PS in gap 14 Gapmer motif selected from 1-359
uniform PS uniform unmodified; all C's are 5-meC 16 Gapmer of
Formula II uniform PS uniform unmodified; no Cs are 5-meC) 16
Gapmer of Formula II uniform PS uniform unmodified; at least one
nucleobase is a 5-meC 16 Gapmer of Formula II and having uniform PS
uniform unmodified motif selected from 1-359 17 Gapmer of Formula
II and having uniform PO uniform unmodified motif selected from
1-359 17 Gapmer motif selected from 1-359 uniform PS uniform
unmodified 17 Gapmer of Formula II uniform PS uniform unmodified 18
Gapmer of Formula I and having uniform PS uniform unmodified motif
selected from 1-359 18 Gapmer motif selected from 1-359 uniform PS
uniform unmodified 20 Gapmer of Formula II uniform PS uniform
unmodified 12 Gapmer motif selected from 1-615 uniform PS uniform
unmodified 14 Gapmer motif selected from 1-615 2-14-2 gapmer: PO in
uniform unmodified wings and PS in gap 14 Gapmer motif selected
from 1-615 uniform PS uniform unmodified; all C's are 5-meC 16
Gapmer of Formula I and having uniform PS uniform unmodified motif
selected from 1-615 17 Gapmer of Formula I and having uniform PO
uniform unmodified motif selected from 1-615 17 Gapmer motif
selected from 1-615 uniform PS uniform unmodified 18 Gapmer of
Formula I and having uniform PS uniform unmodified motif selected
from 1-615 18 Gapmer motif selected from 1-615 uniform PS uniform
unmodified
The above table is intended only to illustrate and not to limit the
various combinations of the parameters of oligonucleotides of the
present invention. Herein if a description of an oligonucleotide or
oligomeric compound is silent with respect to one or more
parameter, such parameter is not limited. Thus, an oligomeric
compound described only as having a gapmer sugar motif without
further description may have any length, internucleoside linkage
motif, and nucleobase modification motif. Unless otherwise
indicated, all chemical modifications are independent of nucleobase
sequence.
[0640] Certain Conjugate Groups
[0641] In certain embodiments, oligomeric compounds are modified by
attachment of one or more conjugate groups. In general, conjugate
groups modify one or more properties of the attached oligomeric
compound including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional conjugate linking moiety or conjugate
linking group to a parent compound such as an oligomeric compound,
such as an oligonucleotide. Conjugate groups includes without
limitation, intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, thioethers, polyethers,
cholesterols, thiocholesterols, cholic acid moieties, folate,
lipids, phospholipids, biotin, phenazine, phenanthridine,
anthraquinone, adamantane, acridine, fluoresceins, rhodamines,
coumarins and dyes. Certain conjugate groups have been described
previously, for example: cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0642] In certain embodiments, a conjugate group comprises an
active drug substance, for example, aspirin, warfarin,
phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic.
[0643] In certain embodiments, conjugate groups are directly
attached to oligonucleotides in oligomeric compounds. In certain
embodiments, conjugate groups are attached to oligonucleotides by a
conjugate linking group. In certain such embodiments, conjugate
linking groups, including, but not limited to, bifunctional linking
moieties such as those known in the art are amenable to the
compounds provided herein. Conjugate linking groups are useful for
attachment of conjugate groups, such as chemical stabilizing
groups, functional groups, reporter groups and other groups to
selective sites in a parent compound such as for example an
oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the conjugate linker comprises a chain
structure or an oligomer of repeating units such as ethylene glycol
or amino acid units. Examples of functional groups that are
routinely used in a bifunctional linking moiety include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like.
[0644] Some nonlimiting examples of conjugate linking moieties
include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a
nonlimiting list of preferred substituent groups includes hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0645] Conjugate groups may be attached to either or both ends of
an oligonucleotide (terminal conjugate groups) and/or at any
internal position.
[0646] In certain embodiments, conjugate groups are at the 3'-end
of an oligonucleotide of an oligomeric compound. In certain
embodiments, conjugate groups are near the 3'-end. In certain
embodiments, conjugates are attached at the 3' end of an oligomeric
compound, but before one or more terminal group nucleosides. In
certain embodiments, conjugate groups are placed within a terminal
group. In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, oligomeric compounds
comprise an oligonucleotide. In certain embodiments, an oligomeric
compound comprises an oligonucleotide and one or more conjugate
and/or terminal groups. Such conjugate and/or terminal groups may
be added to oligonucleotides having any of the chemical motifs
discussed above. Thus, for example, an oligomeric compound
comprising an oligonucleotide having region of alternating
nucleosides may comprise a terminal group.
[0647] Antisense Compounds
[0648] In certain embodiments, oligomeric compounds of the present
invention are antisense compounds. Such antisense compounds are
capable of hybridizing to a target nucleic acid, resulting in at
least one antisense activity. In certain embodiments, antisense
compounds specifically hybridize to one or more target nucleic
acid. In certain embodiments, a specifically hybridizing antisense
compound has a nucleobase sequence comprising a region having
sufficient complementarity to a target nucleic acid to allow
hybridization and result in antisense activity and insufficient
complementarity to any non-target so as to avoid non-specific
hybridization to any non-target nucleic acid sequences under
conditions in which specific hybridization is desired (e.g., under
physiological conditions for in vivo or therapeutic uses, and under
conditions in which assays are performed in the case of in vitro
assays).
[0649] In certain embodiments, the present invention provides
antisense compounds comprising oligonucleotides that are fully
complementary to the target nucleic acid over the entire length of
the oligonucleotide. In certain embodiments, oligonucleotides are
99% complementary to the target nucleic acid. In certain
embodiments, oligonucleotides are 95% complementary to the target
nucleic acid. In certain embodiments, such oligonucleotides are 90%
complementary to the target nucleic acid.
[0650] In certain embodiments, such oligonucleotides are 85%
complementary to the target nucleic acid. In certain embodiments,
such oligonucleotides are 80% complementary to the target nucleic
acid. In certain embodiments, an antisense compound comprises a
region that is fully complementary to a target nucleic acid and is
at least 80% complementary to the target nucleic acid over the
entire length of the oligonucleotide. In certain such embodiments,
the region of full complementarity is from 6 to 14 nucleobases in
length.
[0651] Certain Antisense Activities and Mechanisms
[0652] In certain antisense activities, hybridization of an
antisense compound results in recruitment of a protein that cleaves
of the target nucleic acid. For example, certain antisense
compounds result in RNase H mediated cleavage of target nucleic
acid. RNase H is a cellular endonuclease that cleaves the RNA
strand of an RNA:DNA duplex. The "DNA" in such an RNA:DNA duplex,
need not be unmodified DNA. In certain embodiments, the invention
provides antisense compounds that are sufficiently "DNA-like" to
elicit RNase H activity. Such DNA-like antisense compounds include,
but are not limited to gapmers having unmodified deoxyfuronose
sugar moieties in the nucleosides of the gap and modified sugar
moieties in the nucleosides of the wings.
[0653] Antisense activities may be observed directly or indirectly.
In certain embodiments, observation or detection of an antisense
activity involves observation or detection of a change in an amount
of a target nucleic acid or protein encoded by such target nucleic
acid; a change in the ratio of splice variants of a nucleic acid or
protein; and/or a phenotypic change in a cell or animal
[0654] In certain embodiments, compounds comprising
oligonucleotides having a gapmer motif described herein have
desirable properties compared to non-gapmer oligonucleotides or to
gapmers having other motifs. In certain circumstances, it is
desirable to identify motifs resulting in a favorable combination
of potent antisense activity and relatively low toxicity. In
certain embodiments, compounds of the present invention have a
favorable therapeutic index (measure of potency divided by measure
of toxicity).
[0655] Certain Target Nucleic Acids
[0656] In certain embodiments, antisense compounds comprise or
consist of an oligonucleotide comprising a region that is
complementary to a target nucleic acid. In certain embodiments, the
target nucleic acid is an endogenous RNA molecule. In certain
embodiments, the target nucleic acid is a non-coding RNA. In
certain such embodiments, the target non-coding RNA is selected
from: a long-non-coding RNA, a short non-coding RNA, an intronic
RNA molecule, a snoRNA, a scaRNA, a microRNA (including
pre-microRNA and mature microRNA), a ribosomal RNA, and promoter
directed RNA. In certain embodiments, the target nucleic acid
encodes a protein. In certain such embodiments, the target nucleic
acid is selected from: an mRNA and a pre-mRNA, including intronic,
exonic and untranslated regions. In certain embodiments, oligomeric
compounds are at least partially complementary to more than one
target nucleic acid. For example, antisense compounds of the
present invention may mimic microRNAs, which typically bind to
multiple targets.
[0657] In certain embodiments, the target nucleic acid is a nucleic
acid other than a mature mRNA. In certain embodiments, the target
nucleic acid is a nucleic acid other than a mature mRNA or a
microRNA. In certain embodiments, the target nucleic acid is a
non-coding RNA other than a microRNA. In certain embodiments, the
target nucleic acid is a non-coding RNA other than a microRNA or an
intronic region of a pre-mRNA. In certain embodiments, the target
nucleic acid is a long non-coding RNA. In certain embodiments, the
target RNA is an mRNA. In certain embodiments, the target nucleic
acid is a pre-mRNA. In certain such embodiments, the target region
is entirely within an intron. In certain embodiments, the target
region spans an intron/exon junction. In certain embodiments, the
target region is at least 50% within an intron. In certain
embodiments, the target nucleic acid is selected from among
non-coding RNA, including exonic regions of pre-mRNA. In certain
embodiments, the target nucleic acid is a ribosomal RNA (rRNA). In
certain embodiments, the target nucleic acid is a non-coding RNA
associated with splicing of other pre-mRNAs. In certain
embodiments, the target nucleic acid is a nuclear-retained
non-coding RNA.
[0658] In certain embodiments, antisense compounds described herein
are complementary to a target nucleic acid comprising a
single-nucleotide polymorphism. In certain such embodiments, the
antisense compound is capable of modulating expression of one
allele of the single-nucleotide polymorphism-containing-target
nucleic acid to a greater or lesser extent than it modulates
another allele. In certain embodiments an antisense compound
hybridizes to a single-nucleotide polymorphism-containing-target
nucleic acid at the single-nucleotide polymorphism site. In certain
embodiments an antisense compound hybridizes to a single-nucleotide
polymorphism-containing-target nucleic acid near the
single-nucleotide polymorphism site. In certain embodiments, the
target nucleic acid is a Huntingtin gene transcript. In certain
embodiments, the target nucleic acid is a single-nucleotide
polymorphism-containing-target nucleic acid other than a Huntingtin
gene transcript. In certain embodiments, the target nucleic acid is
any nucleic acid other than a Huntingtin gene transcript.
Certain Pharmaceutical Compositions
[0659] In certain embodiments, the present invention provides
pharmaceutical compositions comprising one or more antisense
compound. In certain embodiments, such pharmaceutical composition
comprises a suitable pharmaceutically acceptable diluent or
carrier. In certain embodiments, a pharmaceutical composition
comprises a sterile saline solution and one or more antisense
compound. In certain embodiments, such pharmaceutical composition
consists of a sterile saline solution and one or more antisense
compound. In certain embodiments, the sterile saline is
pharmaceutical grade saline. In certain embodiments, a
pharmaceutical composition comprises one or more antisense compound
and sterile water. In certain embodiments, a pharmaceutical
composition consists of one or more antisense compound and sterile
water. In certain embodiments, the sterile saline is pharmaceutical
grade water. In certain embodiments, a pharmaceutical composition
comprises one or more antisense compound and phosphate-buffered
saline (PBS). In certain embodiments, a pharmaceutical composition
consists of one or more antisense compound and sterile
phosphate-buffered saline (PBS). In certain embodiments, the
sterile saline is pharmaceutical grade PBS.
[0660] In certain embodiments, antisense compounds may be admixed
with pharmaceutically acceptable active and/or inert substances for
the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions depend on a number of criteria, including, but not
limited to, route of administration, extent of disease, or dose to
be administered.
[0661] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising antisense compounds comprise one or more oligonucleotide
which, upon administration to an animal, including a human, is
capable of providing (directly or indirectly) the biologically
active metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0662] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
antisense oligomeric compound.
[0663] Lipid moieties have been used in nucleic acid therapies in a
variety of methods. In certain such methods, the nucleic acid is
introduced into preformed liposomes or lipoplexes made of mixtures
of cationic lipids and neutral lipids. In certain methods, DNA
complexes with mono- or poly-cationic lipids are formed without the
presence of a neutral lipid. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to a
particular cell or tissue. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to
fat tissue. In certain embodiments, a lipid moiety is selected to
increase distribution of a pharmaceutical agent to muscle
tissue.
[0664] In certain embodiments, pharmaceutical compositions provided
herein comprise one or more modified oligonucleotides and one or
more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0665] In certain embodiments, a pharmaceutical composition
provided herein comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0666] In certain embodiments, a pharmaceutical composition
provided herein comprises one or more tissue-specific delivery
molecules designed to deliver the one or more pharmaceutical agents
of the present invention to specific tissues or cell types. For
example, in certain embodiments, pharmaceutical compositions
include liposomes coated with a tissue-specific antibody.
[0667] In certain embodiments, a pharmaceutical composition
provided herein comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0668] In certain embodiments, a pharmaceutical composition
provided herein is prepared for oral administration. In certain
embodiments, pharmaceutical compositions are prepared for buccal
administration.
[0669] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0670] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0671] In certain embodiments, a pharmaceutical composition
provided herein comprises an oligonucleotide in a therapeutically
effective amount. In certain embodiments, the therapeutically
effective amount is sufficient to prevent, alleviate or ameliorate
symptoms of a disease or to prolong the survival of the subject
being treated. Determination of a therapeutically effective amount
is well within the capability of those skilled in the art.
[0672] In certain embodiments, one or more modified oligonucleotide
provided herein is formulated as a prodrug. In certain embodiments,
upon in vivo administration, a prodrug is chemically converted to
the biologically, pharmaceutically or therapeutically more active
form of an oligonucleotide. In certain embodiments, prodrugs are
useful because they are easier to administer than the corresponding
active form. For example, in certain instances, a prodrug may be
more bioavailable (e.g., through oral administration) than is the
corresponding active form. In certain instances, a prodrug may have
improved solubility compared to the corresponding active form. In
certain embodiments, prodrugs are less water soluble than the
corresponding active form. In certain instances, such prodrugs
possess superior transmittal across cell membranes, where water
solubility is detrimental to mobility. In certain embodiments, a
prodrug is an ester. In certain such embodiments, the ester is
metabolically hydrolyzed to carboxylic acid upon administration. In
certain instances the carboxylic acid containing compound is the
corresponding active form. In certain embodiments, a prodrug
comprises a short peptide (polyaminoacid) bound to an acid group.
In certain of such embodiments, the peptide is cleaved upon
administration to form the corresponding active form.
[0673] In certain embodiments, the present invention provides
compositions and methods for reducing the amount or activity of a
target nucleic acid in a cell. In certain embodiments, the cell is
in an animal. In certain embodiments, the animal is a mammal. In
certain embodiments, the animal is a rodent. In certain
embodiments, the animal is a primate. In certain embodiments, the
animal is a non-human primate. In certain embodiments, the animal
is a human.
[0674] In certain embodiments, the present invention provides
methods of administering a pharmaceutical composition comprising an
oligomeric compound of the present invention to an animal. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intracerebroventricular,
intraperitoneal, intranasal, intraocular, intratumoral, and
parenteral (e.g., intravenous, intramuscular, intramedullary, and
subcutaneous). In certain embodiments, pharmaceutical intrathecals
are administered to achieve local rather than systemic
exposures.
NONLIMITING DISCLOSURE AND INCORPORATION BY REFERENCE
[0675] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
[0676] Although the sequence listing accompanying this filing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications. One of skill in the art will readily
appreciate that such designation as "RNA" or "DNA" to describe
modified oligonucleotides is, in certain instances, arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine base could be described as a DNA
having a modified sugar (2'-OH for the natural 2'-H of DNA) or as
an RNA having a modified base (thymine (methylated uracil) for
natural uracil of RNA).
[0677] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligomeric compound having the
nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and oligomeric
compounds having other modified or naturally occurring bases, such
as "AT.sup.meCGAUCG," wherein .sup.meC indicates a cytosine base
comprising a methyl group at the 5-position.
EXAMPLES
[0678] The following examples illustrate certain embodiments of the
present invention and are not limiting. Moreover, where specific
embodiments are provided, the inventors have contemplated generic
application of those specific embodiments. For example, disclosure
of an oligonucleotide having a particular motif provides reasonable
support for additional oligonucleotides having the same or similar
motif. And, for example, where a particular high-affinity
modification appears at a particular position, other high-affinity
modifications at the same position are considered suitable, unless
otherwise indicated.
[0679] Where nucleobase sequences are not provided, to allow
assessment of the relative effects of nucleobase sequence and
chemical modification, throughout the examples, oligomeric
compounds are assigned a "Sequence Code." Oligomeric compounds
having the same Sequence Code have the same nucleobase sequence.
Oligomeric compounds having different Sequence Codes have different
nucleobase sequences.
Example 1
Dose-Dependent Inhibition of Chimeric Antisense Oligonucleotides
Targeting PTEN
[0680] A series of modified oligonucleotides were designed based on
the parent gapmer, ISIS 482050, wherein the central gap region
contains ten 2'-deoxynucleosides. These modified oligonucleotides
were designed by having the central gap region shortened to nine,
eight or seven 2'-deoxynucleosides and by introducing
2'-O-methoxyethyl (MOE) modifications at one or both wing regions.
The newly designed oligonucleotides were evaluated for their
effects in reducing PTEN mRNA levels in vitro.
[0681] The gapmers and their motifs are described in Table 60. The
internucleoside linkages throughout each gapmer are
phosphorothioate linkages (P.dbd.S). Nucleosides followed by a
subscript "d" indicate 2'-deoxynucleosides. Nucleosides followed by
a subscript "e" indicate 2'-O-methoxyethyl (MOE) nucleosides.
Nucleosides followed by a subscript "k" indicate constrained ethyl
(cEt) nucleosides. "N" indicates modified or naturally occurring
nucleobases (A, T, C, G, U, or 5-methyl C).
[0682] The newly designed gapmers were tested in vitro. Mouse
primary hepatocytes were plated at a density of 20,000 cells per
well and transfected using electroporation with 0.6 .mu.M, 3.0
.mu.M and 15 .mu.M concentrations of antisense oligonucleotides.
After a treatment period of approximately 24 hours, RNA was
isolated from the cells and PTEN mRNA levels were measured by
quantitative real-time PCR. Mouse PTEN primer probe set RTS 186 was
used to measure mRNA levels. PTEN mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM.. The
results in Table 12 are presented as PTEN mRNA expression relative
to untreated control cells (% UTC).
[0683] The parent gapmer, ISIS 482050 was included in the study as
a bench mark oligonucleotide against which the activity of the
newly designed gapmers targeting PTEN could be compared.
TABLE-US-00012 TABLE 11 Chimeric antisense oligonucleotides
targeting PTEN Gap Wing chemistry ISIS NO. Sequence (5' to 3')
Motif chemistry 5' 3' SEQ ID NO 482050
A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-10-3 Full deoxy kkk kkk 23
.sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.k 508033
A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-10-3 Full deoxy kkk eee 23
.sub.dA.sub.dG.sub.d.sup.mC.sub.eT.sub.eT.sub.e 573351
A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-10-3 Full deoxy ekk kke 23
.sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573352
A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 4-9-3 Full deoxy eekk kke 23
.sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573353
A.sub.eT.sub.e.sup.mC.sub.eA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 5-8-3 Full deoxy eeekk kke 23
.sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.e 573355
A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-9-4 Full deoxy ekk kkee 23
.sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573356
A.sub.eT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-8-5 Full deoxy ekk kkeee 23
.sub.dA.sub.kG.sub.k.sup.mC.sub.eT.sub.eT.sub.e 573357
A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-7-6 Full deoxy ekk kkeeee 23
.sub.kA.sub.kG.sub.e.sup.mC.sub.eT.sub.eT.sub.e 573358
A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 4-8-4 Full deoxy eekk kkee 23
.sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573359
A.sub.eT.sub.e.sup.mC.sub.eA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 5-7-4 Full deoxy eeekk kkee 23
.sub.dA.sub.dG.sub.k.sup.mC.sub.kT.sub.eT.sub.e 573360
A.sub.eT.sub.e.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 4-7-5 Full deoxy eekk kkeee 23
.sub.dA.sub.kG.sub.k.sup.mC.sub.eT.sub.eT.sub.e e = 2'-MOE, k =
cEt, d = 2'-deoxynucleoside
TABLE-US-00013 TABLE 12 Dose-response effect of chimeric antisense
oligonucleotides targeting PTEN % UTC Wing 0.6 3.0 Gap chemistry
ISIS NO. .mu.M .mu.M 15 .mu.M Motif chemistry 5' 3' 482050 45.4
23.8 8.4 3-10-3 Full deoxy kkk kkk 508033 52.2 28.8 7.6 3-10-3 Full
deoxy kkk eee 573351 66.0 24.0 12.4 3-10-3 Full deoxy ekk kke
573352 69.0 38.1 12.5 4-9-3 Full deoxy eekk kke 573353 59.8 36.5
13.8 5-8-3 Full deoxy eeekk kke 573355 52.1 37.4 11.4 3-9-4 Full
deoxy ekk kkee 573356 52.9 46.4 15.4 3-8-5 Full deoxy ekk kkeee
573357 82.4 81.8 52.5 3-7-6 Full deoxy ekk kkeeee 573358 67.4 46.7
14.5 4-8-4 Full deoxy eekk kkee 573359 70.5 49.8 31.6 5-7-4 Full
deoxy eeekk kkee 573360 62.2 50.8 17.6 4-7-5 Full deoxy eekk kkeee
Saline = 100 e = 2'-MOE, k = cEt, d = 2'-deoxynucleoside
Example 2
Dose-Dependent Inhibition of Chimeric Antisense Oligonucleotides
Targeting PTEN
[0684] Additional chimeric oligonucleotides were designed based on
the parent gapmer, ISIS 482050, wherein the central gap region
contains ten 2'-deoxynucleosides. These modified oligonucleotides
were designed by having the central gap region shortened to eight
2'-deoxynucleosides and by introducing one or more
2'-O-methoxyethyl (MOE) modification(s) at the 3' wing region. The
modified oligonucleotides designed by microwalk were evaluated for
their effects in reducing PTEN mRNA levels in vitro.
[0685] The gapmers and their motifs are described in Table 13. The
internucleoside linkages throughout each gapmer are
phosphorothioate linkages (P.dbd.S). Nucleosides followed by a
subscript "d" indicate 2'-deoxynucleoside. Nucleosides followed by
a subscript "e" indicate 2'-O-methoxyethyl (MOE) nucleosides.
Nucleosides followed by a subscript "k" indicate constrained ethyl
(cEt) nucleosides. mC indicates a 5-methyl nucleoside.
[0686] The newly designed gapmers were tested in vitro. Mouse
primary hepatocytes were plated at a density of 20,000 cells per
well and transfected using electroporation with 0.6 .mu.M, 3.0
.mu.M and 15 .mu.M concentrations of antisense oligonucleotides.
After a treatment period of approximately 24 hours, RNA was
isolated from the cells and PTEN mRNA levels were measured by
quantitative real-time PCR. Mouse PTEN primer probe set RTS 186 was
used to measure mRNA levels. PTEN mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM.. The
results in Table 14 are presented as PTEN mRNA expression relative
to untreated control cells (% UTC).
[0687] The parent gapmer, ISIS 482050 was included in the study as
a bench mark oligonucleotide against which the activity of the
newly designed gapmers targeting PTEN could be compared.
TABLE-US-00014 TABLE 13 Chimeric antisense oligonucleotides
designed by microwalk targeting PTEN Gap Wing chemistry ISIS NO.
Sequence (5' to 3') Motif chemistry 5' 3' SEQ ID NO. 482050
A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-10-3 Full deoxy kkk kkk 24
.sub.dA.sub.dG.sub.d.sup.mC.sub.kT.sub.kT.sub.k 573797
T.sub.kG.sub.kG.sub.k.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.dA.sub.-
dG.sub.d.sup.mC.sub.dT 3-8-5 Full deoxy kkk keeee 25
.sub.dT.sub.k.sup.mC.sub.e.sup.mC.sub.eG.sub.eA.sub.e 573798
A.sub.kT.sub.kG.sub.kG.sub.d.sup.mC.sub.dT.sub.dG.sub.d.sup.mC.sub.-
dA.sub.dG.sub.d.sup.mC 3-8-5 Full deoxy kkk keeee 26
.sub.dT.sub.kT.sub.e.sup.mC.sub.e.sup.mC.sub.eG.sub.e 573799
.sup.mC.sub.kA.sub.kT.sub.kG.sub.dG.sub.d.sup.mC.sub.dT.sub.dG.sub.-
d.sup.mC.sub.dA.sub.dG 3-8-5 Full deoxy kkk keeee 27
.sub.d.sup.mC.sub.kT.sub.eT.sub.e.sup.mC.sub.e.sup.mC.sub.e 573800
T.sub.k.sup.mC.sub.kA.sub.kT.sub.dG.sub.dG.sub.d.sup.mC.sub.dT.sub.-
dG.sub.d.sup.mC.sub.dA 3-8-5 Full deoxy kkk keeee 28
.sub.dG.sub.k.sup.mC.sub.eT.sub.eT.sub.e.sup.mC.sub.e 573801
A.sub.kT.sub.k.sup.mC.sub.kA.sub.dT.sub.dG.sub.dG.sub.d.sup.mC.sub.-
dT.sub.dG.sub.d.sup.mC 3-8-5 Full deoxy kkk keeee 24
.sub.dA.sub.kG.sub.e.sup.mC.sub.eT.sub.eT.sub.e 573802
.sup.mC.sub.kA.sub.kT.sub.k.sup.mC.sub.dA.sub.dT.sub.dG.sub.dG.sub.-
d.sup.mC.sub.dT.sub.dG 3-8-5 Full deoxy kkk keeee 29
.sub.d.sup.mC.sub.kA.sub.eG.sub.e.sup.mC.sub.eT.sub.e 573803
.sup.mC.sub.k.sup.mC.sub.kA.sub.kT.sub.d.sup.mC.sub.dA.sub.dT.sub.a-
G.sub.dG.sub.d.sup.mC.sub.d 3-8-5 Full deoxy kkk keeee 30
T.sub.dG.sub.k.sup.mC.sub.eA.sub.eG.sub.e.sup.mC.sub.e 573804
T.sub.k.sup.mC.sub.k.sup.mC.sub.kA.sub.dT.sub.d.sup.mC.sub.dA.sub.d-
T.sub.dG.sub.dG.sub.d.sup.m 3-8-5 Full deoxy kkk keeee 31
C.sub.dT.sub.kG.sub.e.sup.mC.sub.eA.sub.eG.sub.e 573805
T.sub.kT.sub.k.sup.mC.sub.k.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.d-
A.sub.dT.sub.dG.sub.dG 3-8-5 Full deoxy kkk keeee 32
.sub.d.sup.mC.sub.kT.sub.eG.sub.e.sup.mC.sub.eA.sub.e e = 2'-MOE, k
= cEt, d = 2'-deoxynucleoside
TABLE-US-00015 TABLE 14 Dose-dependent inhibition of chimeric
antisense oligonucleotides designed by microwalk targeting PTEN
Wing ISIS % UTC Gap chemistry NO. 0.6 .mu.M 3.0 .mu.M 15 .mu.M
Motif chemistry 5' 3' 482050 45.4 23.8 8.4 3-10-3 Full deoxy kkk
kkk 573797 56.8 55.4 13.1 3-8-5 Full deoxy kkk keeee 573798 50.9
33.5 9.6 3-8-5 Full deoxy kkk keeee 573799 62.6 27.7 10.3 3-8-5
Full deoxy kkk keeee 573800 68.6 38.9 12.0 3-8-5 Full deoxy kkk
keeee 573801 54.6 46.3 11.8 3-8-5 Full deoxy kkk keeee 573802 60.7
40.4 13.0 3-8-5 Full deoxy kkk keeee 573803 47.0 29.8 8.5 3-8-5
Full deoxy kkk keeee 573804 62.5 34.1 11.3 3-8-5 Full deoxy kkk
keeee 573805 70.3 31.6 15.2 3-8-5 Full deoxy kkk keeee Saline = 100
e = 2'-MOE, k = cEt, d = 2'-deoxynucleoside
Example 3
Antisense Inhibition of Target-Z mRNA in HepG2 Cells
[0688] Antisense oligonucleotides were designed targeting a
Target-Z nucleic acid and were tested for their effects on Target-Z
mRNA in vitro. The antisense oligonucleotides were tested in a
series of experiments that had similar culture conditions. The
results for each experiment are presented in separate tables shown
below. ISIS 146786, 509934, ISIS 509959, and ISIS 510100, were also
included in these studies for comparison. Cultured HepG2 cells at a
density of 28,000 cells per well were transfected using
LipofectAMINE2000.RTM. with 70 nM antisense oligonucleotide. After
a treatment period of approximately 24 hours, RNA was isolated from
the cells and Target-Z mRNA levels were measured by quantitative
real-time PCR. Viral primer probe set RTS3370 (forward sequence
CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 33; reverse
sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 34;
probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID
NO: 35) was used to measure mRNA levels. Levels were also measured
using primer probe set RTS3371 (forward sequence
CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 36; reverse
sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 37;
probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ
ID NO: 38). Target-Z mRNA levels were adjusted according to total
RNA content, as measured by RIBOGREEN.RTM.. Results are presented
as percent inhibition of Target-Z, relative to untreated control
cells.
[0689] The newly designed chimeric antisense oligonucleotides and
their motifs are described in Tables 15-20. The gapmers are 16
nucleotides in length, wherein the central gap region comprises ten
2'-deoxynucleosides. Nucleosides followed by `k` indicate
constrained ethyl (cEt) nucleosides. Nucleosides followed by "e"
indicate 2'-O-methoxyethyl (2'-MOE) nucleosides. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each oligonucleotide are 5-methylcytosines.
[0690] Each gapmer listed in Tables 15-20 is targeted to the viral
genomic sequence, designated herein as Target-Z. The activity of
the newly designed oligonucleotides was compared with ISIS 146786,
ISIS 509934, ISIS 509959, and ISIS 510100.
TABLE-US-00016 TABLE 15 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 % ISIS No
Motif inhibition 509934 eeeee-d(10)- 30 eeeee 552787 ekk-d(10)-kke
57 552788 ekk-d(10)-kke 60 552789 ekk-d(10)-kke 67 552790
ekk-d(10)-kke 67 552791 ekk-d(10)-kke 65 552792 ekk-d(10)-kke 44
552793 ekkd(10)kke 0 552794 ekk-d(10)-kke 54 552795 ekk-d(10)-kke
55 552796 ekk-d(10)-kke 62 552797 ekk-d(10)-kke 59 552798
ekk-d(10)-kke 59 552799 ekk-d(10)-kke 58 552800 ekk-d(10)-kke 62
552801 ekk-d(10)-kke 65 552802 ekk-d(10)-kke 53 552803
ekk-d(10)-kke 67 552804 ekk-d(10)-kke 75 552805 ekk-d(10)-kke 72
552806 ekk-d(10)-kke 64 552807 ekk-d(10)-kke 68 552808
ekk-d(10)-kke 65 552809 ekk-d(10)-kke 60 552810 ekk-d(10)-kke 59
552811 ekk-d(10)-kke 64 552812 ekk-d(10)-kke 69 552813
ekk-d(10)-kke 64 552814 ekk-d(10)-kke 62 552815 ekk-d(10)-kke 61
552816 ekk-d(10)-kke 63 552817 ekk-d(10)-kke 42 552818
ekk-d(10)-kke 44 552819 ekk-d(10)-kke 56 552820 ekk-d(10)-kke 59
552821 ekk-d(10)-kke 76 552822 ekk-d(10)-kke 77 552823
ekk-d(10)-kke 73 552824 ekk-d(10)-kke 73 552825 ekk-d(10)-kke 51
552826 ekk-d(10)-kke 55 552827 ekk-d(10)-kke 67 552828
ekk-d(10)-kke 78 552829 ekk-d(10)-kke 72 552830 ekk-d(10)-kke 71
552831 ekk-d(10)-kke 69 552832 ekk-d(10)-kke 67 552833
ekk-d(10)-kke 65 552834 ekk-d(10)-kke 78 552835 ekk-d(10)-kke 70
552836 ekk-d(10)-kke 64 552837 ekk-d(10)-kke 65 552838
ekk-d(10)-kke 64 552839 ekk-d(10)-kke 60 552840 ekk-d(10)-kke 35
552841 ekk-d(10)-kke 62 552842 ekk-d(10)-kke 67 552843
ekk-d(10)-kke 77 552844 ekk-d(10)-kke 81 552845 ekk-d(10)-kke 63
552846 ekk-d(10)-kke 79 552847 ekk-d(10)-kke 47 552848
ekk-d(10)-kke 69 552849 ekk-d(10)-kke 59 552850 ekk-d(10)-kke 83
552851 ekk-d(10)-kke 90 552852 ekk-d(10)-kke 89 552853
ekk-d(10)-kke 83 552854 ekk-d(10)-kke 80 552855 ekk-d(10)-kke 75
552856 ekk-d(10)-kke 69 552857 ekk-d(10)-kke 68 552858
ekk-d(10)-kke 79 552859 ekk-d(10)-kke 79 552860 ekk-d(10)-kke 71
552861 ekk-d(10)-kke 68 552862 ekk-d(10)-kke 65 552863
ekk-d(10)-kke 70 552864 ekk-d(10)-kke 71 e = 2'-MOE, k = cEt, d =
2'-deoxynucleosic
TABLE-US-00017 TABLE 16 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 % ISIS No
Motif inhibition 552787 ekk-d(10)-kke 53 552788 ekk-d(10)-kke 45
552789 ekk-d(10)-kke 75 552790 ekk-d(10)-kke 68 552791
ekk-d(10)-kke 51 552792 ekk-d(10)-kke 38 552793 ekk-d(10)-kke 0
552794 ekk-d(10)-kke 44 552795 ekk-d(10)-kke 56 552796
ekk-d(10)-kke 45 552797 ekk-d(10)-kke 46 552798 ekk-d(10)-kke 53
552799 ekk-d(10)-kke 48 552800 ekk-d(10)-kke 54 552801
ekk-d(10)-kke 63 552802 ekk-d(10)-kke 49 552803 ekk-d(10)-kke 71
552804 ekk-d(10)-kke 64 552805 ekk-d(10)-kke 70 552806
ekk-d(10)-kke 67 552807 ekk-d(10)-kke 61 552808 ekk-d(10)-kke 83
552809 ekk-d(10)-kke 59 552810 ekk-d(10)-kke 56 552811
ekk-d(10)-kke 62 552812 ekk-d(10)-kke 66 552813 ekk-d(10)-kke 63
552814 ekk-d(10)-kke 65 552815 ekk-d(10)-kke 63 552816
ekk-d(10)-kke 88 552817 ekk-d(10)-kke 94 552818 ekk-d(10)-kke 82
552819 ekk-d(10)-kke 80 552820 ekk-d(10)-kke 84 552821
ekk-d(10)-kke 71 552822 ekk-d(10)-kke 85 552823 ekk-d(10)-kke 71
552824 ekk-d(10)-kke 81 552825 ekk-d(10)-kke 51 552826
ekk-d(10)-kke 64 552827 ekk-d(10)-kke 61 552828 ekk-d(10)-kke 76
552829 ekk-d(10)-kke 61 552830 ekk-d(10)-kke 59 552831
ekk-d(10)-kke 58 552832 ekk-d(10)-kke 64 552833 ekk-d(10)-kke 75
552834 ekk-d(10)-kke 84 552835 ekk-d(10)-kke 57 552836
ekk-d(10)-kke 51 552837 ekk-d(10)-kke 53 552838 ekk-d(10)-kke 48
552839 ekk-d(10)-kke 50 552840 ekk-d(10)-kke 54 552841
ekk-d(10)-kke 61 552842 ekk-d(10)-kke 71 552843 ekk-d(10)-kke 75
552844 ekk-d(10)-kke 78 552845 ekk-d(10)-kke 52 552846
ekk-d(10)-kke 76 552847 ekk-d(10)-kke 61 552848 ekk-d(10)-kke 72
552849 ekk-d(10)-kke 87 552850 ekk-d(10)-kke 76 552851
ekk-d(10)-kke 76 552852 ekk-d(10)-kke 79 552853 ekk-d(10)-kke 82
552854 ekk-d(10)-kke 85 552855 ekk-d(10)-kke 78 552856
ekk-d(10)-kke 77 552857 ekk-d(10)-kke 75 552858 ekk-d(10)-kke 75
552859 ekk-d(10)-kke 79 552860 ekk-d(10)-kke 71 552861
ekk-d(10)-kke 74 552862 ekk-d(10)-kke 66 552863 ekk-d(10)-kke 70
552864 ekk-d(10)-kke 73 e = 2'-MOE, k = cEt, d =
2'-deoxynucleoside
TABLE-US-00018 TABLE 17 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3371 % ISIS No
Motif inhibition 146786 eeeee-d(10)-eeeee 60 552889 ek-d(10)-keke
59 552890 ek-d(10)-keke 56 552891 ek-d(10)-keke 67 552892
ek-d(10)-keke 65 552893 ek-d(10)-keke 68 552894 ek-d(10)-keke 71
552895 ek-d(10)-keke 51 552896 ek-d(10)-keke 51 552897
ek-d(10)-keke 43 552898 ek-d(10)-keke 43 552899 ek-d(10)-keke 55
552900 ek-d(10)-keke 34 552901 ek-d(10)-keke 42 552902
ek-d(10)-keke 60 552903 ek-d(10)-keke 76 552904 ek-d(10)-keke 74
552905 ek-d(10)-keke 66 552907 ek-d(10)-keke 69 552908
ek-d(10)-keke 63 552909 ek-d(10)-keke 70 552910 ek-d(10)-keke 72
552911 ek-d(10)-keke 72 552912 ek-d(10)-keke 67 552913
ek-d(10)-keke 74 552914 ek-d(10)-keke 75 552915 ek-d(10)-keke 58
552916 ek-d(10)-keke 74 552917 ek-d(10)-keke 76 552918
ek-d(10)-keke 75 552919 ek-d(10)-keke 55 552920 ek-d(10)-keke 49
552921 ek-d(10)-keke 45 552922 ek-d(10)-keke 83 552923
ek-d(10)-keke 83 552924 ek-d(10)-keke 0 552925 ek-d(10)-keke 85
552926 ek-d(10)-keke 50 552927 ek-d(10)-keke 76 552928
ek-d(10)-keke 78 552929 ek-d(10)-keke 75 552930 ek-d(10)-keke 78
552931 ek-d(10)-keke 74 552932 ek-d(10)-keke 86 552933
ek-d(10)-keke 82 552934 ek-d(10)-keke 74 552935 ek-d(10)-keke 76
552936 ek-d(10)-keke 81 552937 ek-d(10)-keke 80 552938
ek-d(10)-keke 78 552939 ek-d(10)-keke 75 552940 ek-d(10)-keke 63
552941 ekk-d(10)-kke 78 552942 ek-d(10)-keke 80 552865
ekk-d(10)-kke 67 552866 ekk-d(10)-kke 68 552868 ekk-d(10)-kke 55
552869 ekk-d(10)-kke 48 552870 ekk-d(10)-kke 55 552871
ekk-d(10)-kke 57 552872 ekk-d(10)-kke 70 552873 ekk-d(10)-kke 49
552874 ekk-d(10)-kke 42 552875 ekk-d(10)-kke 41 552876
ekk-d(10)-kke 50 552877 ek-d(10)-keke 39 552878 ekk-d(10)-kke 31
552879 ekk-d(10)-kke 5 552880 ekk-d(10)-kke 5 552881 ekk-d(10)-kke
10 552882 ekk-d(10)-kke 11 552883 ekk-d(10)-kke 27 552884
ekk-d(10)-kke 36 552885 ekk-d(10)-kke 12 552886 ekk-d(10)-kke 32
552888 ekk-d(10)-kke 1 e = 2'-MOE, k = cEt, d =
2'-deoxynucleoside
TABLE-US-00019 TABLE 18 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 % ISIS No
Motif inhibition 146786 eeeee-d(10)-eeeee 59 552955 eee-d(10)-kkk
60 552956 eee-d(10)-kkk 60 552957 eee-d(10)-kkk 64 552958
eee-d(10)-kkk 56 552959 eee-d(10)-kkk 59 552960 eee-d(10)-kkk 42
552961 eee-d(10)-kkk 41 552962 eee-d(10)-kkk 35 552963
eee-d(10)-kkk 19 552964 eee-d(10)-kkk 34 552965 eee-d(10)-kkk 42
552966 eee-d(10)-kkk 60 552967 eee-d(10)-kkk 38 552968
eee-d(10)-kkk 35 552969 eee-d(10)-kkk 67 552970 eee-d(10)-kkk 56
552971 eee-d(10)-kkk 69 552972 eee-d(10)-kkk 75 552973
eee-d(10)-kkk 59 552974 eee-d(10)-kkk 71 552975 eee-d(10)-kkk 56
552976 eee-d(10)-kkk 50 552977 eee-d(10)-kkk 56 552978
eee-d(10)-kkk 43 552979 eee-d(10)-kkk 71 552980 eee-d(10)-kkk 80
552981 eee-d(10)-kkk 64 552982 ek-d(10)-keke 61 552983
eee-d(10)-kkk 77 552984 eee-d(10)-kkk 65 552985 eee-d(10)-kkk 41
552986 eee-d(10)-kkk 30 552987 eee-d(10)-kkk 41 552988
eee-d(10)-kkk 74 552989 eee-d(10)-kkk 85 552990 eee-d(10)-kkk 72
552991 eee-d(10)-kkk 73 552992 eee-d(10)-kkk 60 552993
eee-d(10)-kkk 52 552994 eee-d(10)-kkk 58 552995 eee-d(10)-kkk 70
552996 eee-d(10)-kkk 74 552997 eee-d(10)-kkk 59 552998
eee-d(10)-kkk 82 552999 eee-d(10)-kkk 70 553000 eee-d(10)-kkk 67
553001 eee-d(10)-kkk 67 553002 eee-d(10)-kkk 74 553003
eee-d(10)-kkk 72 553004 eee-d(10)-kkk 73 553005 eee-d(10)-kkk 67
553006 eee-d(10)-kkk 69 553007 eee-d(10)-kkk 60 553008
eee-d(10)-kkk 71 552943 ek-d(10)-keke 77 553009 eee-d(10)-kkk 78
552944 ek-d(10)-keke 74 553010 eee-d(10)-kkk 78 552945
ek-d(10)-keke 76 553011 eee-d(10)-kkk 72 552946 ek-d(10)-keke 71
553012 eee-d(10)-kkk 74 552947 ek-d(10)-keke 54 553013
eee-d(10)-kkk 39 552948 ek-d(10)-keke 50 553014 eee-d(10)-kkk 37
552949 ek-d(10)-keke 8 553015 eee-d(10)-kkk 45 552950 ek-d(10)-keke
44 553016 eee-d(10)-kkk 47 552951 ek-d(10)-keke 60 553017
eee-d(10)-kkk 47 552952 ek-d(10)-keke 35 553018 eee-d(10)-kkk 30
552953 ek-d(10)-keke 37 553019 eee-d(10)-kkk 37 552954
ek-d(10)-keke 40 553020 eee-d(10)-kkk 24 e = 2'-MOE, k = cEt, d =
2'-deoxynucleoside
TABLE-US-00020 TABLE 19 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 % ISIS No
Motif inhibition 552889 ek-d(10)-keke 42 552890 ek-d(10)-keke 56
552891 ek-d(10)-keke 55 552892 ek-d(10)-keke 53 552893
ek-d(10)-keke 56 552894 ek-d(10)-keke 53 552895 ek-d(10)-keke 38
552896 ek-d(10)-keke 43 552897 ek-d(10)-keke 40 552898
ek-d(10)-keke 50 552899 ek-d(10)-keke 37 552900 ek-d(10)-keke 43
552901 ek-d(10)-keke 56 552902 ek-d(10)-keke 43 552903
ek-d(10)-keke 78 552904 ek-d(10)-keke 75 552905 ek-d(10)-keke 52
552907 ek-d(10)-keke 75 552908 ek-d(10)-keke 57 552909
ek-d(10)-keke 66 552910 ek-d(10)-keke 60 552911 ek-d(10)-keke 65
552912 ek-d(10)-keke 37 552913 ek-d(10)-keke 76 552914
ek-d(10)-keke 79 552915 ek-d(10)-keke 71 552916 ek-d(10)-keke 82
552917 ek-d(10)-keke 78 552918 ek-d(10)-keke 64 552919
ek-d(10)-keke 38 552920 ek-d(10)-keke 43 552921 ek-d(10)-keke 49
552922 ek-d(10)-keke 90 552923 ek-d(10)-keke 92 552924
ek-d(10)-keke 30 552925 ek-d(10)-keke 81 552926 ek-d(10)-keke 39
552927 ek-d(10)-keke 53 552928 ek-d(10)-keke 48 552929
ek-d(10)-keke 68 552930 ek-d(10)-keke 87 552931 ek-d(10)-keke 87
552932 ek-d(10)-keke 88 552933 ek-d(10)-keke 75 552934
ek-d(10)-keke 76 552935 ek-d(10)-keke 71 552936 ek-d(10)-keke 80
552937 ek-d(10)-keke 81 552938 ek-d(10)-keke 85 552939
ek-d(10)-keke 82 552940 ek-d(10)-keke 76 552941 ekk-d(10)-kke 72
552942 ek-d(10)-keke 85 552865 ekk-d(10)-kke 70 552866
ekk-d(10)-kke 65 552868 ekk-d(10)-kke 36 552869 ekk-d(10)-kke 23
552870 ekk-d(10)-kke 49 552871 ekk-d(10)-kke 46 552872
ekk-d(10)-kke 73 552873 ekk-d(10)-kke 41 552874 ekk-d(10)-kke 18
552875 ekk-d(10)-kke 0 552876 ekk-d(10)-kke 49 552877 ek-d(10)-keke
37 552878 ekk-d(10)-kke 28 552879 ekk-d(10)-kke 0 552880
ekk-d(10)-kke 12 552881 ekk-d(10)-kke 0 552882 ekk-d(10)-kke 0
552883 ekk-d(10)-kke 12 552884 ekk-d(10)-kke 39 552885
ekk-d(10)-kke 37 552886 ekk-d(10)-kke 15 552888 ekk-d(10)-kke 0 e =
2'-MOE, k = cEt, d = 2'-deoxynucleoside
TABLE-US-00021 TABLE 20 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3370 % ISIS No
Motif inhibition 552955 eee-d(10)-kkk 67 552956 eee-d(10)-kkk 60
552957 eee-d(10)-kkk 73 552958 eee-d(10)-kkk 63 552959
eee-d(10)-kkk 58 552960 eee-d(10)-kkk 67 552961 eee-d(10)-kkk 78
552962 eee-d(10)-kkk 29 552963 eee-d(10)-kkk 25 552964
eee-d(10)-kkk 33 552965 eee-d(10)-kkk 55 552966 eee-d(10)-kkk 71
552967 eee-d(10)-kkk 23 552968 eee-d(10)-kkk 41 552969
eee-d(10)-kkk 76 552970 eee-d(10)-kkk 44 552971 eee-d(10)-kkk 77
552972 eee-d(10)-kkk 74 552973 eee-d(10)-kkk 61 552974
eee-d(10)-kkk 73 552975 eee-d(10)-kkk 66 552976 eee-d(10)-kkk 70
552977 eee-d(10)-kkk 65 552978 eee-d(10)-kkk 40 552979
eee-d(10)-kkk 79 552980 eee-d(10)-kkk 81 552981 eee-d(10)-kkk 74
552982 ek-d(10)-keke 52 552983 eee-d(10)-kkk 78 552984
eee-d(10)-kkk 71 552985 eee-d(10)-kkk 38 552986 eee-d(10)-kkk 48
552987 eee-d(10)-kkk 54 552988 eee-d(10)-kkk 85 552989
eee-d(10)-kkk 84 552990 eee-d(10)-kkk 79 552991 eee-d(10)-kkk 53
552992 eee-d(10)-kkk 68 552993 eee-d(10)-kkk 67 552994
eee-d(10)-kkk 69 552995 eee-d(10)-kkk 62 552996 eee-d(10)-kkk 82
552997 eee-d(10)-kkk 58 552998 eee-d(10)-kkk 86 552999
eee-d(10)-kkk 63 553000 eee-d(10)-kkk 67 553001 eee-d(10)-kkk 70
553002 eee-d(10)-kkk 84 553003 eee-d(10)-kkk 83 553004
eee-d(10)-kkk 68 553005 eee-d(10)-kkk 57 553006 eee-d(10)-kkk 74
553007 eee-d(10)-kkk 62 553008 eee-d(10)-kkk 50 552943
ek-d(10)-keke 86 553009 eee-d(10)-kkk 79 552944 ek-d(10)-keke 83
553010 eee-d(10)-kkk 74 552945 ek-d(10)-keke 79 553011
eee-d(10)-kkk 60 552946 ek-d(10)-keke 68 553012 eee-d(10)-kkk 78
552947 ek-d(10)-keke 51 553013 eee-d(10)-kkk 45 552948
ek-d(10)-keke 56 553014 eee-d(10)-kkk 53 552949 ek-d(10)-keke 1
553015 eee-d(10)-kkk 55 552950 ek-d(10)-keke 52 553016
eee-d(10)-kkk 65 552951 ek-d(10)-keke 59 553017 eee-d(10)-kkk 36
552952 ek-d(10)-keke 34 553018 eee-d(10)-kkk 20 552953
ek-d(10)-keke 55 553019 eee-d(10)-kkk 34 552954 ek-d(10)-keke 51
553020 eee-d(10)-kkk 28 e = 2'-MOE, k = cEt, d =
2'-deoxynucleoside
Example 4
Dose-Dependent Antisense Inhibition of Target-Z mRNA in HepG2
Cells
[0691] Antisense oligonucleotides from the study described in
Example 46 exhibiting in vitro inhibition of Target-Z mRNA were
selected and tested at various doses in HepG2 cells. Cells were
plated at a density of 28,000 cells per well and transfected using
LipofectAMINE2000.RTM. with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00
nM concentrations of antisense oligonucleotide, as specified in
Table 21. After a treatment period of approximately 16 hours, RNA
was isolated from the cells and Target-Z mRNA levels were measured
by quantitative real-time PCR. Target-Z primer probe set RTS3371
was used to measure mRNA levels. Target-Z mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of Target-Z, relative
to untreated control cells.
[0692] As illustrated in Table 21, Target-Z mRNA levels were
reduced in a dose-dependent manner in antisense oligonucleotide
treated cells.
TABLE-US-00022 TABLE 21 Dose-dependent antisense inhibition of
human Target-Z in HepG2 cells 9.2593 27.7778 83.3333 250.0 ISIS No
Motif nM nM nM nM 146786 eeeee-d(10)-eeeee 10 43 74 89 552808
ekk-d(10)-kke 13 14 55 70 552816 ekk-d(10)-kke 38 73 87 92 552818
ekk-d(10)-kke 29 63 87 85 552820 ekk-d(10)-kke 58 83 90 90 552821
ekk-d(10)-kke 33 49 71 88 552822 ekk-d(10)-kke 24 55 74 88 552824
ekk-d(10)-kke 8 24 65 87 552834 ekk-d(10)-kke 11 28 68 89 552849
ekk-d(10)-kke 12 25 73 84 552851 ekk-d(10)-kke 13 42 74 89 552852
ekk-d(10)-kke 4 35 70 87 552853 ekk-d(10)-kke 19 52 86 93 552854
ekk-d(10)-kke 28 57 80 89 552916 ek-d(10)-keke 5 26 64 82 552922
ek-d(10)-keke 25 44 77 89 552923 ek-d(10)-keke 22 49 82 91 552925
ek-d(10)-keke 33 56 80 92 552930 ek-d(10)-keke 12 49 79 89 552931
ek-d(10)-keke 12 40 62 82 552932 ek-d(10)-keke 24 62 84 91 552933
ek-d(10)-keke 20 40 75 89 552936 ek-d(10)-keke 18 36 75 88 552937
ek-d(10)-keke 22 51 82 88 552938 ek-d(10)-keke 12 36 67 80 552939
ek-d(10)-keke 17 40 65 79 552942 ek-d(10)-keke 21 48 74 88 552943
ek-d(10)-keke 5 39 70 85 552944 ek-d(10)-keke 14 33 70 77 552980
eee-d(10)-kkk 15 40 69 86 552988 eee-d(10)-kkk 4 36 58 84 552989
eee-d(10)-kkk 0 50 74 81 552996 eee-d(10)-kkk 0 25 53 72 552998
eee-d(10)-kkk 17 49 79 90 553002 eee-d(10)-kkk 0 32 68 86 553003
eee-d(10)-kkk 15 42 67 88 e = 2'-MOE, k = cEt, d =
2'-deoxynucleoside
Example 5
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0693] Mice harboring a Target-Z gene fragment (Guidotti, L. G. et
al., J. Virol. 1995, 69, 6158-6169) were used. The mice were
treated with ISIS antisense oligonucleotides selected from studies
described above as illustrated in Table 22 and evaluated for their
efficacy in this model.
Treatment
[0694] Groups of 10 mice each were injected subcutaneously twice a
week for the first with 50 mg/kg and, subsequently, twice a week
for the next 3 weeks with 25 mg/kg of ISIS 146786 or ISIS 510100.
Control groups of 10 mice each were treated in a similar manner
with ISIS 141923 (5-10-5 MOE gapmer with no known murine target) or
ISIS 459024 (3-10-4 MOE gapmer with no known murine target). Mice
were euthanized 48 hours after the last dose, and organs and serum
were harvested for further analysis.
TABLE-US-00023 TABLE 22 Antisense oligonucleotides targeting
Target-Z in transgenic mice ISIS NO. Sequence (5' to 3') Motif SEQ
ID NO. 146786
G.sub.esT.sub.esG.sub.esA.sub.esA.sub.esG.sub.dsC.sub.dsG.sub.dsA.s-
ub.dsA.sub.ds e5-d(10)-e5 39
G.sub.dsT.sub.dsG.sub.dsC.sub.dsA.sub.dsC.sub.esA.sub.esC.sub.esG.sub.esG-
.sub.es 510100
G.sub.esG.sub.es.sup.mC.sub.esA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.-
mC.sub.dsA.sub.ds eee-d(10)-eeee 40
G.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.esA.sub.esT.sub.esG.sub.e
141923
.sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.es.sup.mC.s-
ub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds e5-d(10)-e5 41
A.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.es.sup.mC.sub.esT.sub-
.es.sup.mC.sub.es.sup.mC.sub.e 459024
.sup.mC.sub.esG.sub.esG.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT-
.sub.dsT.sub.dsG.sub.dsG.sub.ds eee-d(10)-eeee 42
A.sub.dsG.sub.dsG.sub.dsA.sub.esT.sub.esG.sub.es.sup.mC.sub.e e =
2'-MOE (e.g. e5 = eeeee), d = 2'-deoxynucleoside
DNA and RNA Analysis
[0695] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe sets RTS3370, RTS3371,
or RTS3372 (forward sequence ATCCTATCAACACTTCCGGAAACT, designated
SEQ ID NO: 43; reverse sequence CGACGCGGCGATTGAG, designated SEQ ID
NO: 44; probe sequence AAGAACTCCCTCGCCTCGCAGACG, designated SEQ ID
NO: 45). The DNA levels were normalized to picogreen. Target-Z RNA
samples were also assayed with primer probe sets RTS3370 and
RTS3371 after RT-PCR analysis. The mRNA levels were normalized to
RIBOGREEN.RTM.. The data is presented in Table 23. Serum DNA
samples were analyzed after the study period. The data is presented
in Table 24, expressed relative to the levels measured in the
control group. As shown in Tables 23 and 24, the antisense
oligonucleotides achieved reduction of Target-Z DNA and RNA over
the PBS control. Treatment with either control oligonucleotide did
not cause any changes in RNA or DNA levels, as expected.
TABLE-US-00024 TABLE 23 Percent inhibition of Target-Z RNA and DNA
in the liver of transgenic mice % % % % % % inhibition inhibition
inhibition inhibition inhibition inhibition DNA DNA DNA RNA RNA RNA
ISIS No Motif (RTS3370) (RTS3371) (RTS3372) (RTS3370) (RTS3371)
(RTS3372) 146786 e5-d(10)-e5 97 97 95 86 85 89 510100
eee-d(10)-eeee 95 94 94 56 64 77 141923 e5-d(10)-e5 2 0 13 0 7 31
459024 eee-d(10)-eeee 19 0 8 0 0 0 e = 2'-MOE (e.g. e5 = eeeee), d
= 2'-deoxynucleoside
TABLE-US-00025 TABLE 24 Percent inhibition of Target-Z DNA in the
serum of transgenic mice % inhibition % inhibition ISIS No Motif
(RTS3370) (RTS3371) 146786 e5-d(10)-e5 98 98 510100 eee-d(10)-eeee
99 98 141923 e5-d(10)-e5 0 0 459024 eee-d(10)-eeee 0 0 e = 2'-MOE
(e.g. e5 = eeeee), d = 2'-deoxynucleoside
Example 6
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0696] Transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0697] A group of 6 mice was injected subcutaneously twice a week
for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each
were injected subcutaneously twice a week for 4 weeks with 10 mg/kg
of ISIS 552803, ISIS 552903, ISIS 552817, ISIS 552822, and ISIS
552907. One group of 10 mice was injected subcutaneously twice a
week for 4 weeks with PBS. Mice were euthanized 48 hours after the
last dose, and organs and plasma were harvested for further
analysis.
DNA and RNA Analysis
[0698] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe set RTS3371. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe set RTS3371 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. The data is
presented in Table 25. Serum DNA samples were analyzed after the
study period. The data is presented in Table 26, expressed relative
to the levels measured in the control group. As shown in Tables 25
and 26, the antisense oligonucleotides achieved reduction of
Target-Z DNA and RNA over the PBS control.
TABLE-US-00026 TABLE 25 Percent inhibition of Target-Z RNA and DNA
in transgenic mice % Dose % inhibition inhibition ISIS No Motif
(mg/kg/wk) of RNA of DNA 146786 e5-d(10)-e5 50 81 91 552803
ekk-d(10)-kke 20 71 95 552817 ekk-d(10)-kke 20 86 51 552822
ekk-d(10)-kke 20 90 89 552903 ek-d(10)-keke 20 56 82 552907
ek-d(10)-keke 20 41 45 e = 2'-MOE (e.g. e5 = eeeee), d =
2'-deoxynucleoside
TABLE-US-00027 TABLE 26 Serum levels of Target-Z DNA in transgenic
mice, relative to control levels Dose Post-dose ISIS No Motif
(mg/kg/wk) DNA levels 146786 e5-d(10)-e5 50 0.1 552803
ekk-d(10)-kke 20 0.2 552817 ekk-d(10)-kke 20 1.3 552822
ekk-d(10)-kke 20 0.0 552903 ek-d(10)-keke 20 2.9 552907
ek-d(10)-keke 20 1.0 e = 2'-MOE (e.g. e5 = eeeee), d =
2'-deoxynucleoside
Liver Function
[0699] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma concentrations of ALT were measured using an
automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.) (Nyblom, H. et al., Alcohol & Alcoholism 39:
336-339, 2004; Tietz N W (Ed): Clinical Guide to Laboratory Tests,
3rd ed. W. B. Saunders, Philadelphia, Pa., 1995). The results are
presented in Table 27 expressed in IU/L. All the ISIS
oligonucleotides were considered tolerable in the mice, as
demonstrated by their liver transaminase profile.
TABLE-US-00028 TABLE 27 ALT levels (IU/L) of transgenic mice Dose
Motif (mg/kg/wk) ALT PBS -- -- 77 ISIS 146786 e5-d(10)-e5 50 21
ISIS 552803 ekk-d(10)-kke 20 74 ISIS 552817 ekk-d(10)-kke 20 38
ISIS 552822 ekk-d(10)-kke 20 47 ISIS 552903 ek-d(10)-keke 20 57
ISIS 552907 ek-d(10)-keke 20 28 e = 2'-MOE (e.g. e5 = eeeee), d =
2'-deoxynucleoside
Example 7
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0700] Transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0701] A group of 6 mice was injected subcutaneously twice a week
for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each
were injected subcutaneously twice a week for 4 weeks with 10 mg/kg
of ISIS 552853, ISIS 552854, ISIS 552932, and ISIS 552938. One
group of 10 mice was injected subcutaneously twice a week for 4
weeks with PBS. Mice were euthanized 48 hours after the last dose,
and organs and plasma were harvested for further analysis.
DNA and RNA Analysis
[0702] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe set RTS3371. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe set RTS3371 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. As shown in Table
28, the antisense oligonucleotides achieved reduction of Target-Z
DNA and RNA over the PBS control. Results are presented as percent
inhibition of Target-Z mRNA or DNA, relative to control.
TABLE-US-00029 TABLE 28 Percent inhibition of Target-Z DNA and RNA
in transgenic mice Dose % inhibition % inhibition Motif (mg/kg/wk)
(DNA) (RNA) PBS -- -- ISIS 146786 e5-d(10)-e5 50 90 60 ISIS 552853
ekk-d(10)-kke 20 94 60 ISIS 552854 ekk-d(10)-kke 20 61 23 ISIS
552932 ekk-d(10)-kke 20 75 70 ISIS 552938 ek-d(10)-keke 20 67 56
=2'-MOE (e.g. e5 = eeeee), d = 2'-deoxynucloside
Example 8
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0703] Transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0704] A group of 6 mice was injected subcutaneously twice a week
for 4 weeks with 25 mg/kg of ISIS 146786. Groups of 6 mice each
were injected subcutaneously twice a week for 4 weeks with 10 mg/kg
of ISIS 552922, ISIS 552923, ISIS 552942, ISIS 552872, ISIS 552925,
ISIS 552937, and ISIS 552939. One group of 10 mice was injected
subcutaneously twice a week for 4 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
DNA and RNA Analysis
[0705] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe set RTS3371. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe set RTS3371 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. As shown in Table
29, the antisense oligonucleotides achieved reduction of Target-Z
DNA and RNA over the PBS control. Results are presented as percent
inhibition of Target-Z mRNA or DNA, relative to control.
TABLE-US-00030 TABLE 29 Percent inhibition of Target-Z DNA and RNA
in transgenic mice % % Dose inhibition inhibition ISIS No Motif
(mg/kg/wk) (DNA) (RNA) 146786 e5-d(10)-e5 50 52 57 552922
ek-d(10)-keke 20 61 50 552923 ek-d(10)-keke 20 89 76 552942
ek-d(10)-keke 20 58 52 552872 ekk-d(10)-kke 20 77 46 552925
ek-d(10)-keke 20 89 65 552937 ek-d(10)-keke 20 59 35 552939
ek-d(10)-keke 20 57 19 = 2'-MOE (e.g. e5 = eeeee), d =
2'-deoxynucleoside
Example 9
Antisense Inhibition of Target-Z mRNA in HepG2 Cells
[0706] Antisense oligonucleotides were designed targeting a
Target-Z nucleic acid and were tested for their effects on Target-Z
mRNA in vitro. The antisense oligonucleotides were tested in a
series of experiments that had similar culture conditions. The
results for each experiment are presented in separate tables. ISIS
146786, 509934, ISIS 509959, and ISIS 510100, from the studies
described above, were also included. Cultured HepG2 cells at a
density of 28,000 cells per well were transfected using
LipofectAMINE2000.RTM. with 70 nM antisense oligonucleotide. After
a treatment period of approximately 24 hours, RNA was isolated from
the cells and Target-Z mRNA levels were measured by quantitative
real-time PCR. Primer probe set RTS3370 (forward sequence
CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 33; reverse
sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 34;
probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID
NO: 35) was used to measure mRNA levels. Levels were also measured
using primer probe set RTS3371 (forward sequence
CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 36; reverse
sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 37;
probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ
ID NO: 38). Target-Z mRNA levels were adjusted according to total
RNA content, as measured by RIBOGREEN.RTM.. Results are presented
as percent inhibition of Target-Z, relative to untreated control
cells.
[0707] The newly designed chimeric antisense oligonucleotides and
their motifs are described in Tables 30-47. The modified
oligonucleotides are 16, 17 or 20 nucleotides in length, wherein
the central gap segment comprises of nine or ten
2'-deoxynucleosides and is flanked by wing segments on the 5'
direction and the 3' direction comprising 2'-O-methoxyethyl
(2'-MOE) modifications. The internucleoside linkages throughout
each gapmer are phosphorothioate (P.dbd.S) linkages. All cytosine
residues throughout each oligonucleotide are 5-methylcytosines.
[0708] Each gapmer listed in the Tables is targeted to the viral
genomic sequence, designated herein as Target-Z. The activity of
the newly designed oligonucleotides was compared with ISIS 146786,
509934, ISIS 509959, and ISIS 510100, the information of which have
been placed at the top of each table.
TABLE-US-00031 TABLE 30 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 50 510100
3-10-4 2'-MOE 62 552276 5-9-3 2'-MOE 42 552277 5-9-3 2'-MOE 46
552278 5-9-3 2'-MOE 31 552279 5-9-3 2'-MOE 41 552280 5-9-3 2'-MOE 5
552281 5-9-3 2'-MOE 11 552282 5-9-3 2'-MOE 20 552283 5-9-3 2'-MOE
28 552230 4-9-4 2'-MOE 57 552284 5-9-3 2'-MOE 0 552231 4-9-4 2'-MOE
29 552285 5-9-3 2'-MOE 61 552232 4-9-4 2'-MOE 35 552286 5-9-3
2'-MOE 47 552233 4-9-4 2'-MOE 38 552287 5-9-3 2'-MOE 45 552234
4-9-4 2'-MOE 0 552288 5-9-3 2'-MOE 50 552235 4-9-4 2'-MOE 0 552289
5-9-3 2'-MOE 46 552236 4-9-4 2'-MOE 45 552290 5-9-3 2'-MOE 41
552237 4-9-4 2'-MOE 44 552291 5-9-3 2'-MOE 26 552239 4-9-4 2'-MOE
62 552293 5-9-3 2'-MOE 67 552240 4-9-4 2'-MOE 61 552294 5-9-3
2'-MOE 71 552241 4-9-4 2'-MOE 55 552295 5-9-3 2'-MOE 58 552242
4-9-4 2'-MOE 60 552296 5-9-3 2'-MOE 59 552243 4-9-4 2'-MOE 57
552297 5-9-3 2'-MOE 55 552244 4-9-4 2'-MOE 33 552298 5-9-3 2'-MOE
48 552245 4-9-4 2'-MOE 48 552299 5-9-3 2'-MOE 34 552246 4-9-4
2'-MOE 81 552300 5-9-3 2'-MOE 56 552247 4-9-4 2'-MOE 87 552301
5-9-3 2'-MOE 86 552248 4-9-4 2'-MOE 72 552302 5-9-3 2'-MOE 77
552249 4-9-4 2'-MOE 56 552303 5-9-3 2'-MOE 65 552250 4-9-4 2'-MOE
52 552304 5-9-3 2'-MOE 57 552251 4-9-4 2'-MOE 43 552305 5-9-3
2'-MOE 56 552252 4-9-4 2'-MOE 62 552306 5-9-3 2'-MOE 75 552253
4-9-4 2'-MOE 82 552307 5-9-3 2'-MOE 90 552254 4-9-4 2'-MOE 74
552255 4-9-4 2'-MOE 78 552256 4-9-4 2'-MOE 65 552257 4-9-4 2'-MOE
62 552258 4-9-4 2'-MOE 72 552259 4-9-4 2'-MOE 63 552260 4-9-4
2'-MOE 58 552261 4-9-4 2'-MOE 63 552262 4-9-4 2'-MOE 50 552263
4-9-4 2'-MOE 60 552264 4-9-4 2'-MOE 52 552265 4-9-4 2'-MOE 68
552266 4-9-4 2'-MOE 62 552267 4-9-4 2'-MOE 58 552268 4-9-4 2'-MOE
62 552269 4-9-4 2'-MOE 52 552270 4-9-4 2'-MOE 54 552271 4-9-4
2'-MOE 58 552272 4-9-4 2'-MOE 40 552273 4-9-4 2'-MOE 34 552274
4-9-4 2'-MOE 34 552275 4-9-4 2'-MOE 39
TABLE-US-00032 TABLE 31 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 49 509959
3-10-3 2'-MOE 43 510100 3-10-4 2'-MOE 54 552384 2-9-5 2'-MOE 29
552440 3-9-4 2'-MOE 58 552385 2-9-5 2'-MOE 57 552441 3-9-4 2'-MOE
42 552386 2-9-5 2'-MOE 53 552442 3-9-4 2'-MOE 53 552387 2-9-5
2'-MOE 48 552443 3-9-4 2'-MOE 59 552388 2-9-5 2'-MOE 40 552444
3-9-4 2'-MOE 51 552389 2-9-5 2'-MOE 39 552445 3-9-4 2'-MOE 60
552390 2-9-5 2'-MOE 52 552446 3-9-4 2'-MOE 54 552391 2-9-5 2'-MOE
57 552447 3-9-4 2'-MOE 54 552392 2-9-5 2'-MOE 0 552448 3-9-4 2'-MOE
58 552393 2-9-5 2'-MOE 59 552449 3-9-4 2'-MOE 60 552394 2-9-5
2'-MOE 53 552450 3-9-4 2'-MOE 53 552395 2-9-5 2'-MOE 57 552451
3-9-4 2'-MOE 39 552396 2-9-5 2'-MOE 62 552452 3-9-4 2'-MOE 57
552238 4-9-4 2'-MOE 38 552292 5-9-3 2'-MOE 48 552346 6-9-2 2'-MOE 0
552397 2-9-5 2'-MOE 63 552453 3-9-4 2'-MOE 56 552398 2-9-5 2'-MOE
61 552454 3-9-4 2'-MOE 48 552399 2-9-5 2'-MOE 52 552400 2-9-5
2'-MOE 57 552401 2-9-5 2'-MOE 52 552402 2-9-5 2'-MOE 54 552403
2-9-5 2'-MOE 74 552404 2-9-5 2'-MOE 43 552405 2-9-5 2'-MOE 15
552406 2-9-5 2'-MOE 37 552407 2-9-5 2'-MOE 37 552408 2-9-5 2'-MOE
76 552409 2-9-5 2'-MOE 76 552410 2-9-5 2'-MOE 63 552411 2-9-5
2'-MOE 70 552412 2-9-5 2'-MOE 62 552413 2-9-5 2'-MOE 56 552414
2-9-5 2'-MOE 63 552415 2-9-5 2'-MOE 52 552416 2-9-5 2'-MOE 67
552417 2-9-5 2'-MOE 50 552418 2-9-5 2'-MOE 79 552419 2-9-5 2'-MOE
70 552420 2-9-5 2'-MOE 71 552421 2-9-5 2'-MOE 69 552422 2-9-5
2'-MOE 68 552423 2-9-5 2'-MOE 65 552424 2-9-5 2'-MOE 70 552425
2-9-5 2'-MOE 51 552426 2-9-5 2'-MOE 40 552427 2-9-5 2'-MOE 35
552428 2-9-5 2'-MOE 58 552429 2-9-5 2'-MOE 46 552430 2-9-5 2'-MOE
53 552431 2-9-5 2'-MOE 51 552432 2-9-5 2'-MOE 57 552433 2-9-5
2'-MOE 54 552434 2-9-5 2'-MOE 44 552435 2-9-5 2'-MOE 46 552436
2-9-5 2'-MOE 36 552437 2-9-5 2'-MOE 27 552438 2-9-5 2'-MOE 27
552439 2-9-5 2'-MOE 13
TABLE-US-00033 TABLE 32 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 35 509959
3-10-3 2'-MOE 52 552496 4-9-3 2'-MOE 47 552497 4-9-3 2'-MOE 57
552498 4-9-3 2'-MOE 45 552499 4-9-3 2'-MOE 52 552500 4-9-3 2'-MOE
46 552501 4-9-3 2'-MOE 44 552502 4-9-3 2'-MOE 57 552503 4-9-3
2'-MOE 52 552504 4-9-3 2'-MOE 45 552505 4-9-3 2'-MOE 56 552506
4-9-3 2'-MOE 54 552507 4-9-3 2'-MOE 34 552508 4-9-3 2'-MOE 34
552509 4-9-3 2'-MOE 48 552510 4-9-3 2'-MOE 50 552455 3-9-4 2'-MOE
66 552511 4-9-3 2'-MOE 66 552456 3-9-4 2'-MOE 64 552512 4-9-3
2'-MOE 62 552457 3-9-4 2'-MOE 14 552513 4-9-3 2'-MOE 56 552458
3-9-4 2'-MOE 59 552514 4-9-3 2'-MOE 52 552459 3-9-4 2'-MOE 69
552515 4-9-3 2'-MOE 57 552460 3-9-4 2'-MOE 0 552516 4-9-3 2'-MOE 54
552461 3-9-4 2'-MOE 20 552517 4-9-3 2'-MOE 52 552462 3-9-4 2'-MOE
46 552518 4-9-3 2'-MOE 34 552463 3-9-4 2'-MOE 48 552519 4-9-3
2'-MOE 44 552464 3-9-4 2'-MOE 81 552520 4-9-3 2'-MOE 69 552465
3-9-4 2'-MOE 84 552521 4-9-3 2'-MOE 80 552466 3-9-4 2'-MOE 75
552522 4-9-3 2'-MOE 76 552467 3-9-4 2'-MOE 65 552523 4-9-3 2'-MOE
71 552468 3-9-4 2'-MOE 53 552524 4-9-3 2'-MOE 43 552469 3-9-4
2'-MOE 51 552525 4-9-3 2'-MOE 57 552470 3-9-4 2'-MOE 46 552526
4-9-3 2'-MOE 60 552471 3-9-4 2'-MOE 54 552527 4-9-3 2'-MOE 72
552472 3-9-4 2'-MOE 78 552528 4-9-3 2'-MOE 78 552473 3-9-4 2'-MOE
67 552529 4-9-3 2'-MOE 77 552474 3-9-4 2'-MOE 79 552530 4-9-3
2'-MOE 78 552475 3-9-4 2'-MOE 74 552531 4-9-3 2'-MOE 68 552476
3-9-4 2'-MOE 52 552477 3-9-4 2'-MOE 76 552478 3-9-4 2'-MOE 70
552479 3-9-4 2'-MOE 67 552480 3-9-4 2'-MOE 68 552481 3-9-4 2'-MOE
57 552482 3-9-4 2'-MOE 51 552483 3-9-4 2'-MOE 48 552484 3-9-4
2'-MOE 58 552485 3-9-4 2'-MOE 51 552486 3-9-4 2'-MOE 55 552487
3-9-4 2'-MOE 62 552488 3-9-4 2'-MOE 51 552489 3-9-4 2'-MOE 49
552490 3-9-4 2'-MOE 51 552491 3-9-4 2'-MOE 51 552492 3-9-4 2'-MOE
38 552493 3-9-4 2'-MOE 52 552494 3-9-4 2'-MOE 17 552495 3-9-4
2'-MOE 49
TABLE-US-00034 TABLE 33 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 47 509959
3-10-3 2'-MOE 38 552552 5-9-2 2'-MOE 33 552553 5-9-2 2'-MOE 46
552554 5-9-2 2'-MOE 54 552555 5-9-2 2'-MOE 50 552556 5-9-2 2'-MOE
46 552557 5-9-2 2'-MOE 57 552558 5-9-2 2'-MOE 55 552559 5-9-2
2'-MOE 66 552560 5-9-2 2'-MOE 44 552561 5-9-2 2'-MOE 48 552562
5-9-2 2'-MOE 52 552563 5-9-2 2'-MOE 45 552564 5-9-2 2'-MOE 41
552565 5-9-2 2'-MOE 54 552566 5-9-2 2'-MOE 56 552567 5-9-2 2'-MOE
71 552568 5-9-2 2'-MOE 64 552569 5-9-2 2'-MOE 59 552570 5-9-2
2'-MOE 60 552571 5-9-2 2'-MOE 55 552572 5-9-2 2'-MOE 60 552573
5-9-2 2'-MOE 24 552574 5-9-2 2'-MOE 34 552575 5-9-2 2'-MOE 36
552576 5-9-2 2'-MOE 67 552577 5-9-2 2'-MOE 64 552578 5-9-2 2'-MOE
75 552579 5-9-2 2'-MOE 75 552580 5-9-2 2'-MOE 59 552581 5-9-2
2'-MOE 54 552582 5-9-2 2'-MOE 61 552583 5-9-2 2'-MOE 69 552584
5-9-2 2'-MOE 74 552585 5-9-2 2'-MOE 62 552586 5-9-2 2'-MOE 79
552587 5-9-2 2'-MOE 71 552532 4-9-3 2'-MOE 48 552588 5-9-2 2'-MOE
70 552533 4-9-3 2'-MOE 43 552589 5-9-2 2'-MOE 59 552534 4-9-3
2'-MOE 62 552590 5-9-2 2'-MOE 70 552535 4-9-3 2'-MOE 55 552591
5-9-2 2'-MOE 51 552536 4-9-3 2'-MOE 3 552592 5-9-2 2'-MOE 50 552537
4-9-3 2'-MOE 14 552593 5-9-2 2'-MOE 46 552538 4-9-3 2'-MOE 52
552594 5-9-2 2'-MOE 55 552539 4-9-3 2'-MOE 47 552595 5-9-2 2'-MOE
60 552540 4-9-3 2'-MOE 60 552596 5-9-2 2'-MOE 63 552541 4-9-3
2'-MOE 60 552597 5-9-2 2'-MOE 61 552542 4-9-3 2'-MOE 64 552598
5-9-2 2'-MOE 57 552543 4-9-3 2'-MOE 46 552600 5-9-2 2'-MOE 59
552544 4-9-3 2'-MOE 53 552602 5-9-2 2'-MOE 6 552545 4-9-3 2'-MOE 33
552604 5-9-2 2'-MOE 47 552546 4-9-3 2'-MOE 42 552606 5-9-2 2'-MOE
53 552547 4-9-3 2'-MOE 51 552608 5-9-2 2'-MOE 53 552548 4-9-3
2'-MOE 52 552610 5-9-2 2'-MOE 47 552549 4-9-3 2'-MOE 38 552612
5-9-2 2'-MOE 39 552550 4-9-3 2'-MOE 19 552614 5-9-2 2'-MOE 24
552551 4-9-3 2'-MOE 24 552616 5-9-2 2'-MOE 15
TABLE-US-00035 TABLE 34 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 ISIS No
Motif Wing chemistry % inhibition 146786 5-10-5 2'-MOE 51 509934
5-10-5 2'-MOE 76 552007 6-10-4 2'-MOE 61 552039 7-10-3 2'-MOE 84
552008 6-10-4 2'-MOE 48 552040 7-10-3 2'-MOE 48 552009 6-10-4
2'-MOE 77 552041 7-10-3 2'-MOE 73 552010 6-10-4 2'-MOE 63 552042
7-10-3 2'-MOE 66 552011 6-10-4 2'-MOE 52 552043 7-10-3 2'-MOE 54
552012 6-10-4 2'-MOE 73 552044 7-10-3 2'-MOE 86 552013 6-10-4
2'-MOE 73 552045 7-10-3 2'-MOE 65 552014 6-10-4 2'-MOE 76 552046
7-10-3 2'-MOE 93 552015 6-10-4 2'-MOE 70 552047 7-10-3 2'-MOE 77
552016 6-10-4 2'-MOE 61 552048 7-10-3 2'-MOE 66 552017 6-10-4
2'-MOE 73 552049 7-10-3 2'-MOE 73 552018 6-10-4 2'-MOE 98 552050
7-10-3 2'-MOE 98 552019 6-10-4 2'-MOE 98 552051 7-10-3 2'-MOE 99
551986 4-10-6 2'-MOE 92 552020 6-10-4 2'-MOE 97 552052 7-10-3
2'-MOE 98 551987 4-10-6 2'-MOE 95 552021 6-10-4 2'-MOE 97 552053
7-10-3 2'-MOE 98 551988 4-10-6 2'-MOE 50 552005 5-10-5 2'-MOE 99
552022 6-10-4 2'-MOE 99 552054 7-10-3 2'-MOE 99 551989 4-10-6
2'-MOE 96 552023 6-10-4 2'-MOE 99 552055 7-10-3 2'-MOE 98 551990
4-10-6 2'-MOE 86 552024 6-10-4 2'-MOE 89 552056 7-10-3 2'-MOE 88
551991 4-10-6 2'-MOE 0 552025 6-10-4 2'-MOE 90 552057 7-10-3 2'-MOE
92 551992 4-10-6 2'-MOE 72 552026 6-10-4 2'-MOE 88 552058 7-10-3
2'-MOE 86 551993 4-10-6 2'-MOE 82 552027 6-10-4 2'-MOE 87 552059
7-10-3 2'-MOE 88 551994 4-10-6 2'-MOE 85 552028 6-10-4 2'-MOE 83
552060 7-10-3 2'-MOE 82 551995 4-10-6 2'-MOE 84 552029 6-10-4
2'-MOE 88 552061 7-10-3 2'-MOE 85 551996 4-10-6 2'-MOE 87 552030
6-10-4 2'-MOE 88 552062 7-10-3 2'-MOE 85 551997 4-10-6 2'-MOE 83
552031 6-10-4 2'-MOE 82 551998 4-10-6 2'-MOE 85 552032 6-10-4
2'-MOE 87 551999 4-10-6 2'-MOE 82 552033 6-10-4 2'-MOE 87 552000
4-10-6 2'-MOE 83 552006 5-10-5 2'-MOE 88 552034 6-10-4 2'-MOE 89
552001 4-10-6 2'-MOE 65 552035 6-10-4 2'-MOE 60 552002 4-10-6
2'-MOE 63 552036 6-10-4 2'-MOE 65 552003 4-10-6 2'-MOE 65 552037
6-10-4 2'-MOE 58 552004 4-10-6 2'-MOE 58 552038 6-10-4 2'-MOE
70
TABLE-US-00036 TABLE 35 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 64 510100
3-10-4 2'-MOE 62 552168 3-9-5 2'-MOE 79 552222 4-9-4 2'-MOE 79
552169 3-9-5 2'-MOE 67 552223 4-9-4 2'-MOE 40 552170 3-9-5 2'-MOE
69 552224 4-9-4 2'-MOE 64 552171 3-9-5 2'-MOE 65 552225 4-9-4
2'-MOE 69 552172 3-9-5 2'-MOE 33 552226 4-9-4 2'-MOE 48 552173
3-9-5 2'-MOE 41 552227 4-9-4 2'-MOE 32 552174 3-9-5 2'-MOE 31
552228 4-9-4 2'-MOE 42 552175 3-9-5 2'-MOE 59 552176 3-9-5 2'-MOE
68 552177 3-9-5 2'-MOE 55 552178 3-9-5 2'-MOE 66 552179 3-9-5
2'-MOE 70 552180 3-9-5 2'-MOE 66 552181 3-9-5 2'-MOE 51 552182
3-9-5 2'-MOE 69 552183 3-9-5 2'-MOE 69 552184 3-9-5 2'-MOE 43
552185 3-9-5 2'-MOE 66 552186 3-9-5 2'-MOE 54 552187 3-9-5 2'-MOE
74 552188 3-9-5 2'-MOE 78 552189 3-9-5 2'-MOE 57 552190 3-9-5
2'-MOE 39 552191 3-9-5 2'-MOE 60 552192 3-9-5 2'-MOE 85 552193
3-9-5 2'-MOE 86 552194 3-9-5 2'-MOE 68 552195 3-9-5 2'-MOE 73
552196 3-9-5 2'-MOE 60 552197 3-9-5 2'-MOE 60 552198 3-9-5 2'-MOE
61 552199 3-9-5 2'-MOE 89 552200 3-9-5 2'-MOE 85 552201 3-9-5
2'-MOE 81 552202 3-9-5 2'-MOE 76 552203 3-9-5 2'-MOE 74 552204
3-9-5 2'-MOE 71 552151 2-9-6 2'-MOE 77 552205 3-9-5 2'-MOE 78
552152 2-9-6 2'-MOE 72 552206 3-9-5 2'-MOE 77 552153 2-9-6 2'-MOE
67 552207 3-9-5 2'-MOE 81 552154 2-9-6 2'-MOE 56 552208 3-9-5
2'-MOE 70 552155 2-9-6 2'-MOE 61 552209 3-9-5 2'-MOE 63 552156
2-9-6 2'-MOE 20 552210 3-9-5 2'-MOE 75 552157 2-9-6 2'-MOE 39
552211 3-9-5 2'-MOE 75 552158 2-9-6 2'-MOE 70 552212 3-9-5 2'-MOE
67 552159 2-9-6 2'-MOE 74 552213 3-9-5 2'-MOE 70 552160 2-9-6
2'-MOE 78 552214 3-9-5 2'-MOE 79 552161 2-9-6 2'-MOE 56 552215
3-9-5 2'-MOE 61 552162 2-9-6 2'-MOE 64 552216 3-9-5 2'-MOE 62
552163 2-9-6 2'-MOE 71 552217 3-9-5 2'-MOE 58 552164 2-9-6 2'-MOE
52 552218 3-9-5 2'-MOE 56 552165 2-9-6 2'-MOE 53 552219 3-9-5
2'-MOE 33 552166 2-9-6 2'-MOE 41 552220 3-9-5 2'-MOE 53 552167
2-9-6 2'-MOE 54 552221 3-9-5 2'-MOE 31
TABLE-US-00037 TABLE 36 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 73 509934
5-10-5 2'-MOE 76 510100 3-10-4 2'-MOE 73 552071 8-10-2 2'-MOE 79
552114 2-9-6 2'-MOE 66 552115 2-9-6 2'-MOE 70 552116 2-9-6 2'-MOE
68 552117 2-9-6 2'-MOE 70 552072 8-10-2 2'-MOE 50 552118 2-9-6
2'-MOE 66 552119 2-9-6 2'-MOE 62 552120 2-9-6 2'-MOE 35 552121
2-9-6 2'-MOE 39 552073 8-10-2 2'-MOE 80 552122 2-9-6 2'-MOE 55
552074 8-10-2 2'-MOE 73 552123 2-9-6 2'-MOE 75 552075 8-10-2 2'-MOE
78 552124 2-9-6 2'-MOE 64 552076 8-10-2 2'-MOE 70 552125 2-9-6
2'-MOE 73 552077 8-10-2 2'-MOE 83 552126 2-9-6 2'-MOE 64 552078
8-10-2 2'-MOE 80 552127 2-9-6 2'-MOE 72 552079 8-10-2 2'-MOE 86
552128 2-9-6 2'-MOE 76 552080 8-10-2 2'-MOE 83 552129 2-9-6 2'-MOE
72 552131 2-9-6 2'-MOE 61 552132 2-9-6 2'-MOE 73 552133 2-9-6
2'-MOE 75 552081 8-10-2 2'-MOE 76 552134 2-9-6 2'-MOE 58 552135
2-9-6 2'-MOE 67 552136 2-9-6 2'-MOE 65 552137 2-9-6 2'-MOE 55
552082 8-10-2 2'-MOE 98 552138 2-9-6 2'-MOE 82 552083 8-10-2 2'-MOE
99 552139 2-9-6 2'-MOE 86 552084 8-10-2 2'-MOE 99 552140 2-9-6
2'-MOE 74 552085 8-10-2 2'-MOE 100 552141 2-9-6 2'-MOE 67 552086
8-10-2 2'-MOE 100 552142 2-9-6 2'-MOE 45 552087 8-10-2 2'-MOE 100
552143 2-9-6 2'-MOE 68 552144 2-9-6 2'-MOE 78 552145 2-9-6 2'-MOE
88 552146 2-9-6 2'-MOE 81 552088 8-10-2 2'-MOE 95 552147 2-9-6
2'-MOE 88 552089 8-10-2 2'-MOE 93 552148 2-9-6 2'-MOE 79 552090
8-10-2 2'-MOE 87 552149 2-9-6 2'-MOE 81 552091 8-10-2 2'-MOE 88
552092 8-10-2 2'-MOE 90 552093 8-10-2 2'-MOE 91 552094 8-10-2
2'-MOE 88 552063 7-10-3 2'-MOE 81 552095 8-10-2 2'-MOE 89 552064
7-10-3 2'-MOE 85 552096 8-10-2 2'-MOE 92 552065 7-10-3 2'-MOE 86
552097 8-10-2 2'-MOE 93 552066 7-10-3 2'-MOE 33 552098 8-10-2
2'-MOE 88 552067 7-10-3 2'-MOE 50 552099 8-10-2 2'-MOE 70 552068
7-10-3 2'-MOE 73 552100 8-10-2 2'-MOE 70 552069 7-10-3 2'-MOE 73
552101 8-10-2 2'-MOE 76 552070 7-10-3 2'-MOE 71 552102 8-10-2
2'-MOE 64
TABLE-US-00038 TABLE 37 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 84 510100
3-1-4 2'-MOE 76 552330 6-9-2 2'-MOE 54 552331 6-9-2 2'-MOE 66
552332 6-9-2 2'-MOE 70 552333 6-9-2 2'-MOE 55 552334 6-9-2 2'-MOE
42 552335 6-9-2 2'-MOE 39 552336 6-9-2 2'-MOE 27 552337 6-9-2
2'-MOE 74 552338 6-9-2 2'-MOE 68 552339 6-9-2 2'-MOE 71 552340
6-9-2 2'-MOE 61 552341 6-9-2 2'-MOE 58 552342 6-9-2 2'-MOE 55
552343 6-9-2 2'-MOE 63 552344 6-9-2 2'-MOE 51 552345 6-9-2 2'-MOE
65 552346 6-9-2 2'-MOE 0 552347 6-9-2 2'-MOE 84 552348 6-9-2 2'-MOE
87 552349 6-9-2 2'-MOE 74 552350 6-9-2 2'-MOE 59 552351 6-9-2
2'-MOE 60 552352 6-9-2 2'-MOE 53 552353 6-9-2 2'-MOE 0 552354 6-9-2
2'-MOE 83 552355 6-9-2 2'-MOE 90 552356 6-9-2 2'-MOE 0 552357 6-9-2
2'-MOE 45 552358 6-9-2 2'-MOE 74 552359 6-9-2 2'-MOE 72 552360
6-9-2 2'-MOE 87 552361 6-9-2 2'-MOE 96 552308 5-9-3 2'-MOE 81
552362 6-9-2 2'-MOE 92 552309 5-9-3 2'-MOE 77 552363 6-9-2 2'-MOE
92 552310 5-9-3 2'-MOE 80 552364 6-9-2 2'-MOE 87 552311 5-9-3
2'-MOE 13 552365 6-9-2 2'-MOE 84 552150 2-9-6 2'-MOE 73 552312
5-9-3 2'-MOE 77 552366 6-9-2 2'-MOE 87 552313 5-9-3 2'-MOE 64
552367 6-9-2 2'-MOE 85 552314 5-9-3 2'-MOE 73 552368 6-9-2 2'-MOE
77 552315 5-9-3 2'-MOE 75 552369 6-9-2 2'-MOE 75 552316 5-9-3
2'-MOE 64 552370 6-9-2 2'-MOE 63 552317 5-9-3 2'-MOE 99 552371
6-9-2 2'-MOE 81 552318 5-9-3 2'-MOE 76 552372 6-9-2 2'-MOE 65
552319 5-9-3 2'-MOE 55 552373 6-9-2 2'-MOE 74 552320 5-9-3 2'-MOE
68 552374 6-9-2 2'-MOE 78 552321 5-9-3 2'-MOE 74 552375 6-9-2
2'-MOE 81 552322 5-9-3 2'-MOE 73 552376 6-9-2 2'-MOE 78 552323
5-9-3 2'-MOE 75 552377 6-9-2 2'-MOE 70 552324 5-9-3 2'-MOE 0 552378
6-9-2 2'-MOE 72 552325 5-9-3 2'-MOE 70 552379 6-9-2 2'-MOE 74
552326 5-9-3 2'-MOE 63 552380 6-9-2 2'-MOE 53 552327 5-9-3 2'-MOE
30 552381 6-9-2 2'-MOE 26 552328 5-9-3 2'-MOE 25 552382 6-9-2
2'-MOE 13 552329 5-9-3 2'-MOE 33 552383 6-9-2 2'-MOE 5
TABLE-US-00039 TABLE 38 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3370 Wing %
ISIS No Motif chemistry inhibition 509934 5-10-5 2'-MOE 30 551909
2-10-8 2'-MOE 62 551941 3-10-7 2'-MOE 74 551973 4-10-6 2'-MOE 64
551910 2-10-8 2'-MOE 52 551942 3-10-7 2'-MOE 54 551974 4-10-6
2'-MOE 51 551911 2-10-8 2'-MOE 58 551943 3-10-7 2'-MOE 64 551975
4-10-6 2'-MOE 57 551912 2-10-8 2'-MOE 59 551944 3-10-7 2'-MOE 66
551976 4-10-6 2'-MOE 57 551913 2-10-8 2'-MOE 58 551945 3-10-7
2'-MOE 56 551977 4-10-6 2'-MOE 56 551914 2-10-8 2'-MOE 0 551946
3-10-7 2'-MOE 48 551978 4-10-6 2'-MOE 53 551915 2-10-8 2'-MOE 44
551947 3-10-7 2'-MOE 53 551979 4-10-6 2'-MOE 64 551916 2-10-8
2'-MOE 57 551948 3-10-7 2'-MOE 68 551980 4-10-6 2'-MOE 56 551917
2-10-8 2'-MOE 58 551949 3-10-7 2'-MOE 64 551981 4-10-6 2'-MOE 63
551918 2-10-8 2'-MOE 59 551950 3-10-7 2'-MOE 71 551982 4-10-6
2'-MOE 63 551919 2-10-8 2'-MOE 76 551951 3-10-7 2'-MOE 71 551983
4-10-6 2'-MOE 73 551920 2-10-8 2'-MOE 68 551952 3-10-7 2'-MOE 76
551984 4-10-6 2'-MOE 81 551921 2-10-8 2'-MOE 83 551953 3-10-7
2'-MOE 82 551985 4-10-6 2'-MOE 76 551922 2-10-8 2'-MOE 73 551954
3-10-7 2'-MOE 68 551923 2-10-8 2'-MOE 59 551955 3-10-7 2'-MOE 71
551924 2-10-8 2'-MOE 80 551956 3-10-7 2'-MOE 80 551925 2-10-8
2'-MOE 82 551957 3-10-7 2'-MOE 88 551926 2-10-8 2'-MOE 71 551958
3-10-7 2'-MOE 74 551927 2-10-8 2'-MOE 68 551959 3-10-7 2'-MOE 69
551928 2-10-8 2'-MOE 69 551960 3-10-7 2'-MOE 62 551929 2-10-8
2'-MOE 54 551961 3-10-7 2'-MOE 20 551930 2-10-8 2'-MOE 53 551962
3-10-7 2'-MOE 60 551931 2-10-8 2'-MOE 47 551963 3-10-7 2'-MOE 63
551932 2-10-8 2'-MOE 68 551964 3-10-7 2'-MOE 56 551933 2-10-8
2'-MOE 72 551965 3-10-7 2'-MOE 67 551934 2-10-8 2'-MOE 64 551966
3-10-7 2'-MOE 73 551935 2-10-8 2'-MOE 68 551967 3-10-7 2'-MOE 60
551936 2-10-8 2'-MOE 67 551968 3-10-7 2'-MOE 63 551937 2-10-8
2'-MOE 47 551969 3-10-7 2'-MOE 36 551938 2-10-8 2'-MOE 41 551970
3-10-7 2'-MOE 43 551939 2-10-8 2'-MOE 53 551971 3-10-7 2'-MOE 55
551940 2-10-8 2'-MOE 50 551972 3-10-7 2'-MOE 58
TABLE-US-00040 TABLE 39 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 509934 5-10-5 2'-MOE 21 551909
2-10-8 2'-MOE 52 551941 3-10-7 2'-MOE 62 551973 4-10-6 2'-MOE 58
551910 2-10-8 2'-MOE 48 551942 3-10-7 2'-MOE 36 551974 4-10-6
2'-MOE 45 551911 2-10-8 2'-MOE 61 551943 3-10-7 2'-MOE 56 551975
4-10-6 2'-MOE 60 551912 2-10-8 2'-MOE 53 551944 3-10-7 2'-MOE 48
551976 4-10-6 2'-MOE 48 551913 2-10-8 2'-MOE 53 551945 3-10-7
2'-MOE 54 551977 4-10-6 2'-MOE 48 551914 2-10-8 2'-MOE 0 551946
3-10-7 2'-MOE 56 551978 4-10-6 2'-MOE 36 551915 2-10-8 2'-MOE 47
551947 3-10-7 2'-MOE 45 551979 4-10-6 2'-MOE 54 551916 2-10-8
2'-MOE 44 551948 3-10-7 2'-MOE 59 551980 4-10-6 2'-MOE 49 551917
2-10-8 2'-MOE 48 551949 3-10-7 2'-MOE 60 551981 4-10-6 2'-MOE 57
551918 2-10-8 2'-MOE 53 551950 3-10-7 2'-MOE 57 551982 4-10-6
2'-MOE 57 551919 2-10-8 2'-MOE 65 551951 3-10-7 2'-MOE 57 551983
4-10-6 2'-MOE 53 551920 2-10-8 2'-MOE 57 551952 3-10-7 2'-MOE 67
551984 4-10-6 2'-MOE 62 551921 2-10-8 2'-MOE 60 551953 3-10-7
2'-MOE 57 551985 4-10-6 2'-MOE 58 551922 2-10-8 2'-MOE 63 551954
3-10-7 2'-MOE 61 551923 2-10-8 2'-MOE 50 551955 3-10-7 2'-MOE 44
551924 2-10-8 2'-MOE 52 551956 3-10-7 2'-MOE 46 551925 2-10-8
2'-MOE 54 551957 3-10-7 2'-MOE 51 551926 2-10-8 2'-MOE 70 551958
3-10-7 2'-MOE 72 551927 2-10-8 2'-MOE 60 551959 3-10-7 2'-MOE 61
551928 2-10-8 2'-MOE 57 551960 3-10-7 2'-MOE 58 551929 2-10-8
2'-MOE 49 551961 3-10-7 2'-MOE 26 551930 2-10-8 2'-MOE 54 551962
3-10-7 2'-MOE 57 551931 2-10-8 2'-MOE 46 551963 3-10-7 2'-MOE 56
551932 2-10-8 2'-MOE 57 551964 3-10-7 2'-MOE 53 551933 2-10-8
2'-MOE 65 551965 3-10-7 2'-MOE 54 551934 2-10-8 2'-MOE 58 551966
3-10-7 2'-MOE 69 551935 2-10-8 2'-MOE 63 551967 3-10-7 2'-MOE 53
551936 2-10-8 2'-MOE 67 551968 3-10-7 2'-MOE 60 551937 2-10-8
2'-MOE 51 551969 3-10-7 2'-MOE 42 551938 2-10-8 2'-MOE 40 551970
3-10-7 2'-MOE 38 551939 2-10-8 2'-MOE 32 551971 3-10-7 2'-MOE 46
551940 2-10-8 2'-MOE 39 551972 3-10-7 2'-MOE 51
TABLE-US-00041 TABLE 40 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 40 510100
3-10-4 2'-MOE 60 552276 5-9-3 2'-MOE 44 552277 5-9-3 2'-MOE 39
552278 5-9-3 2'-MOE 37 552279 5-9-3 2'-MOE 50 552280 5-9-3 2'-MOE 2
552281 5-9-3 2'-MOE 0 552282 5-9-3 2'-MOE 13 552229 4-9-4 2'-MOE 17
552283 5-9-3 2'-MOE 27 552230 4-9-4 2'-MOE 53 552284 5-9-3 2'-MOE 0
552231 4-9-4 2'-MOE 31 552285 5-9-3 2'-MOE 56 552232 4-9-4 2'-MOE
35 552286 5-9-3 2'-MOE 43 552233 4-9-4 2'-MOE 40 552287 5-9-3
2'-MOE 44 552234 4-9-4 2'-MOE 0 552288 5-9-3 2'-MOE 44 552235 4-9-4
2'-MOE 13 552289 5-9-3 2'-MOE 21 552236 4-9-4 2'-MOE 40 552290
5-9-3 2'-MOE 34 552237 4-9-4 2'-MOE 37 552291 5-9-3 2'-MOE 34
552239 4-9-4 2'-MOE 58 552293 5-9-3 2'-MOE 61 552240 4-9-4 2'-MOE
54 552294 5-9-3 2'-MOE 62 552241 4-9-4 2'-MOE 47 552295 5-9-3
2'-MOE 63 552242 4-9-4 2'-MOE 61 552296 5-9-3 2'-MOE 61 552243
4-9-4 2'-MOE 55 552297 5-9-3 2'-MOE 52 552244 4-9-4 2'-MOE 45
552298 5-9-3 2'-MOE 27 552245 4-9-4 2'-MOE 41 552299 5-9-3 2'-MOE
32 552246 4-9-4 2'-MOE 67 552300 5-9-3 2'-MOE 57 552247 4-9-4
2'-MOE 74 552301 5-9-3 2'-MOE 76 552248 4-9-4 2'-MOE 65 552302
5-9-3 2'-MOE 68 552249 4-9-4 2'-MOE 38 552303 5-9-3 2'-MOE 59
552250 4-9-4 2'-MOE 43 552304 5-9-3 2'-MOE 30 552251 4-9-4 2'-MOE
52 552305 5-9-3 2'-MOE 49 552252 4-9-4 2'-MOE 51 552306 5-9-3
2'-MOE 56 552253 4-9-4 2'-MOE 47 552307 5-9-3 2'-MOE 49 552254
4-9-4 2'-MOE 50 552255 4-9-4 2'-MOE 64 552256 4-9-4 2'-MOE 57
552257 4-9-4 2'-MOE 51 552258 4-9-4 2'-MOE 62 552259 4-9-4 2'-MOE
59 552260 4-9-4 2'-MOE 56 552261 4-9-4 2'-MOE 54 552262 4-9-4
2'-MOE 47 552263 4-9-4 2'-MOE 45 552264 4-9-4 2'-MOE 52 552265
4-9-4 2'-MOE 58 552266 4-9-4 2'-MOE 54 552267 4-9-4 2'-MOE 43
552268 4-9-4 2'-MOE 57 552269 4-9-4 2'-MOE 34 552270 4-9-4 2'-MOE
37 552271 4-9-4 2'-M0E 42 552272 4-9-4 2'-M0E 36 552273 4-9-4
2'-M0E 25 552274 4-9-4 2'-M0E 11 552275 4-9-4 2'-M0E 38
TABLE-US-00042 TABLE 41 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 38 509959
3-10-3 2'-MOE 49 510100 3-10-4 2'-MOE 55 552384 2-9-5 2'-MOE 41
552440 3-9-4 2'-MOE 57 552385 2-9-5 2'-MOE 53 552441 3-9-4 2'-MOE
38 552386 2-9-5 2'-MOE 42 552442 3-9-4 2'-MOE 72 552387 2-9-5
2'-MOE 43 552443 3-9-4 2'-MOE 56 552388 2-9-5 2'-MOE 18 552444
3-9-4 2'-MOE 39 552389 2-9-5 2'-MOE 24 552445 3-9-4 2'-MOE 53
552390 2-9-5 2'-MOE 40 552446 3-9-4 2'-MOE 57 552391 2-9-5 2'-MOE
51 552447 3-9-4 2'-MOE 53 552392 2-9-5 2'-MOE 0 552448 3-9-4 2'-MOE
57 552393 2-9-5 2'-MOE 52 552449 3-9-4 2'-MOE 49 552394 2-9-5
2'-MOE 32 552450 3-9-4 2'-MOE 44 552395 2-9-5 2'-MOE 33 552451
3-9-4 2'-MOE 38 552396 2-9-5 2'-MOE 46 552452 3-9-4 2'-MOE 30
552130 2-9-6 2'-MOE 46 552184 3-9-5 2'-MOE 34 552238 4-9-4 2'-MOE
41 552292 5-9-3 2'-MOE 45 552346 6-9-2 2'-MOE 0 552397 2-9-5 2'-MOE
37 552453 3-9-4 2'-MOE 45 552398 2-9-5 2'-MOE 42 552454 3-9-4
2'-MOE 39 552399 2-9-5 2'-MOE 34 552400 2-9-5 2'-MOE 47 552401
2-9-5 2'-MOE 53 552402 2-9-5 2'-MOE 47 552403 2-9-5 2'-MOE 70
552404 2-9-5 2'-MOE 44 552405 2-9-5 2'-MOE 0 552406 2-9-5 2'-MOE 25
552407 2-9-5 2'-MOE 23 552408 2-9-5 2'-MOE 73 552409 2-9-5 2'-MOE
71 552410 2-9-5 2'-MOE 52 552411 2-9-5 2'-MOE 62 552412 2-9-5
2'-MOE 50 552413 2-9-5 2'-MOE 55 552414 2-9-5 2'-MOE 64 552415
2-9-5 2'-MOE 45 552416 2-9-5 2'-MOE 45 552417 2-9-5 2'-MOE 37
552418 2-9-5 2'-MOE 73 552419 2-9-5 2'-MOE 68 552420 2-9-5 2'-MOE
64 552421 2-9-5 2'-MOE 54 552422 2-9-5 2'-MOE 60 552423 2-9-5
2'-MOE 62 552424 2-9-5 2'-MOE 60 552425 2-9-5 2'-MOE 46 552426
2-9-5 2'-MOE 48 552427 2-9-5 2'-MOE 36 552428 2-9-5 2'-MOE 57
552429 2-9-5 2'-MOE 36 552430 2-9-5 2'-MOE 42 552431 2-9-5 2'-MOE
60 552432 2-9-5 2'-MOE 44 552433 2-9-5 2'-MOE 55 552434 2-9-5
2'-MOE 46 552435 2-9-5 2'-MOE 47 552436 2-9-5 2'-MOE 25 552437
2-9-5 2'-MOE 19 552438 2-9-5 2'-MOE 25 552439 2-9-5 2'-MOE 22
TABLE-US-00043 TABLE 42 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 509959 3-10-3 2'-MOE 49 552496
4-9-3 2'-MOE 35 552497 4-9-3 2'-MOE 60 552498 4-9-3 2'-MOE 20
552499 4-9-3 2'-MOE 45 552500 4-9-3 2'-MOE 53 552501 4-9-3 2'-MOE
56 552502 4-9-3 2'-MOE 50 552503 4-9-3 2'-MOE 36 552504 4-9-3
2'-MOE 50 552505 4-9-3 2'-MOE 53 552506 4-9-3 2'-MOE 49 552507
4-9-3 2'-MOE 35 552508 4-9-3 2'-MOE 62 552509 4-9-3 2'-MOE 65
552510 4-9-3 2'-MOE 54 552455 3-9-4 2'-MOE 60 552511 4-9-3 2'-MOE
65 552456 3-9-4 2'-MOE 69 552512 4-9-3 2'-MOE 63 552457 3-9-4
2'-MOE 4 552513 4-9-3 2'-MOE 50 552458 3-9-4 2'-MOE 59 552514 4-9-3
2'-MOE 53 552459 3-9-4 2'-MOE 69 552515 4-9-3 2'-MOE 68 552460
3-9-4 2'-MOE 3 552516 4-9-3 2'-MOE 65 552461 3-9-4 2'-MOE 37 552517
4-9-3 2'-MOE 54 552462 3-9-4 2'-MOE 42 552518 4-9-3 2'-MOE 23
552463 3-9-4 2'-MOE 28 552519 4-9-3 2'-MOE 32 552464 3-9-4 2'-MOE
72 552520 4-9-3 2'-MOE 61 552465 3-9-4 2'-MOE 68 552521 4-9-3
2'-MOE 68 552466 3-9-4 2'-MOE 76 552522 4-9-3 2'-MOE 71 552467
3-9-4 2'-MOE 72 552523 4-9-3 2'-MOE 73 552468 3-9-4 2'-MOE 50
552524 4-9-3 2'-MOE 49 552469 3-9-4 2'-MOE 65 552525 4-9-3 2'-MOE
45 552470 3-9-4 2'-MOE 58 552526 4-9-3 2'-MOE 39 552471 3-9-4
2'-MOE 30 552527 4-9-3 2'-MOE 39 552472 3-9-4 2'-MOE 43 552528
4-9-3 2'-MOE 43 552473 3-9-4 2'-MOE 25 552529 4-9-3 2'-MOE 50
552474 3-9-4 2'-MOE 70 552530 4-9-3 2'-MOE 73 552475 3-9-4 2'-MOE
64 552531 4-9-3 2'-MOE 62 552476 3-9-4 2'-MOE 50 552477 3-9-4
2'-MOE 66 552478 3-9-4 2'-MOE 68 552479 3-9-4 2'-MOE 60 552480
3-9-4 2'-MOE 58 552481 3-9-4 2'-MOE 54 552482 3-9-4 2'-MOE 44
552483 3-9-4 2'-MOE 17 552484 3-9-4 2'-MOE 64 552485 3-9-4 2'-MOE
56 552486 3-9-4 2'-MOE 26 552487 3-9-4 2'-MOE 42 552488 3-9-4
2'-MOE 35 552489 3-9-4 2'-MOE 46 552490 3-9-4 2'-MOE 41 552491
3-9-4 2'-MOE 38 552492 3-9-4 2'-MOE 47 552493 3-9-4 2'-MOE 49
552494 3-9-4 2'-MOE 22 552495 3-9-4 2'-MOE 0
TABLE-US-00044 TABLE 43 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 56 509959
3-10-3 2'-MOE 54 552552 5-9-2 2'-MOE 32 552553 5-9-2 2'-MOE 53
552554 5-9-2 2'-MOE 48 552555 5-9-2 2'-MOE 39 552556 5-9-2 2'-MOE
39 552557 5-9-2 2'-MOE 54 552558 5-9-2 2'-MOE 41 552559 5-9-2
2'-MOE 56 552560 5-9-2 2'-MOE 39 552561 5-9-2 2'-MOE 51 552562
5-9-2 2'-MOE 56 552563 5-9-2 2'-MOE 31 552564 5-9-2 2'-MOE 31
552565 5-9-2 2'-MOE 53 552566 5-9-2 2'-MOE 46 552567 5-9-2 2'-MOE
63 552568 5-9-2 2'-MOE 66 552569 5-9-2 2'-MOE 60 552570 5-9-2
2'-MOE 60 552571 5-9-2 2'-MOE 44 552572 5-9-2 2'-MOE 52 552573
5-9-2 2'-MOE 20 552574 5-9-2 2'-MOE 36 552575 5-9-2 2'-MOE 19
552576 5-9-2 2'-MOE 61 552577 5-9-2 2'-MOE 57 552578 5-9-2 2'-MOE
71 552579 5-9-2 2'-MOE 59 552580 5-9-2 2'-MOE 58 552581 5-9-2
2'-MOE 51 552582 5-9-2 2'-MOE 40 552583 5-9-2 2'-MOE 35 552584
5-9-2 2'-MOE 50 552585 5-9-2 2'-MOE 48 552586 5-9-2 2'-MOE 74
552587 5-9-2 2'-MOE 68 552532 4-9-3 2'-MOE 59 552588 5-9-2 2'-MOE
67 552533 4-9-3 2'-MOE 52 552589 5-9-2 2'-MOE 47 552534 4-9-3
2'-MOE 71 552590 5-9-2 2'-MOE 58 552535 4-9-3 2'-MOE 59 552591
5-9-2 2'-MOE 46 552536 4-9-3 2'-MOE 19 552592 5-9-2 2'-MOE 44
552537 4-9-3 2'-MOE 26 552593 5-9-2 2'-MOE 39 552538 4-9-3 2'-MOE
54 552594 5-9-2 2'-MOE 52 552539 4-9-3 2'-MOE 50 552595 5-9-2
2'-MOE 57 552540 4-9-3 2'-MOE 60 552596 5-9-2 2'-MOE 58 552541
4-9-3 2'-MOE 68 552597 5-9-2 2'-MOE 52 552542 4-9-3 2'-MOE 63
552598 5-9-2 2'-MOE 51 552543 4-9-3 2'-MOE 44 552600 5-9-2 2'-MOE
51 552544 4-9-3 2'-MOE 45 552602 5-9-2 2'-MOE 13 552545 4-9-3
2'-MOE 42 552604 5-9-2 2'-MOE 42 552546 4-9-3 2'-MOE 46 552606
5-9-2 2'-MOE 42 552547 4-9-3 2'-MOE 38 552608 5-9-2 2'-MOE 37
552548 4-9-3 2'-MOE 49 552610 5-9-2 2'-MOE 41 552549 4-9-3 2'-MOE
34 552612 5-9-2 2'-MOE 23 552550 4-9-3 2'-MOE 13 552614 5-9-2
2'-MOE 11 552551 4-9-3 2'-MOE 8 552616 5-9-2 2'-MOE 6
TABLE-US-00045 TABLE 44 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 47 509934
5-10-5 2'-MOE 67 552007 6-10-4 2'-MOE 53 552039 7-10-3 2'-MOE 74
552008 6-10-4 2'-MOE 47 552040 7-10-3 2'-MOE 57 552009 6-10-4
2'-MOE 70 552041 7-10-3 2'-MOE 65 552010 6-10-4 2'-MOE 51 552042
7-10-3 2'-MOE 59 552011 6-10-4 2'-MOE 47 552043 7-10-3 2'-MOE 36
552012 6-10-4 2'-MOE 62 552044 7-10-3 2'-MOE 82 552013 6-10-4
2'-MOE 72 552045 7-10-3 2'-MOE 62 552014 6-10-4 2'-MOE 73 552046
7-10-3 2'-MOE 74 552015 6-10-4 2'-MOE 66 552047 7-10-3 2'-MOE 60
552016 6-10-4 2'-MOE 67 552048 7-10-3 2'-MOE 60 552017 6-10-4
2'-MOE 72 552049 7-10-3 2'-MOE 68 552018 6-10-4 2'-MOE 89 552050
7-10-3 2'-MOE 86 552019 6-10-4 2'-MOE 87 552051 7-10-3 2'-MOE 86
551986 4-10-6 2'-MOE 64 552020 6-10-4 2'-MOE 86 552052 7-10-3
2'-MOE 87 551987 4-10-6 2'-MOE 76 552021 6-10-4 2'-MOE 84 552053
7-10-3 2'-MOE 75 551988 4-10-6 2'-MOE 5 552005 5-10-5 2'-MOE 72
552022 6-10-4 2'-MOE 80 552054 7-10-3 2'-MOE 83 551989 4-10-6
2'-MOE 64 552023 6-10-4 2'-MOE 78 552055 7-10-3 2'-MOE 57 551990
4-10-6 2'-MOE 83 552024 6-10-4 2'-MOE 89 552056 7-10-3 2'-MOE 82
551991 4-10-6 2'-MOE 0 552025 6-10-4 2'-MOE 89 552057 7-10-3 2'-MOE
89 551992 4-10-6 2'-MOE 67 552026 6-10-4 2'-MOE 84 552058 7-10-3
2'-MOE 82 551993 4-10-6 2'-MOE 78 552027 6-10-4 2'-MOE 85 552059
7-10-3 2'-MOE 85 551994 4-10-6 2'-MOE 82 552028 6-10-4 2'-MOE 82
552060 7-10-3 2'-MOE 74 551995 4-10-6 2'-MOE 81 552029 6-10-4
2'-MOE 81 552061 7-10-3 2'-MOE 81 551996 4-10-6 2'-MOE 79 552030
6-10-4 2'-MOE 86 552062 7-10-3 2'-MOE 85 551997 4-10-6 2'-MOE 80
552031 6-10-4 2'-MOE 86 551998 4-10-6 2'-MOE 74 552032 6-10-4
2'-MOE 78 551999 4-10-6 2'-MOE 79 552033 6-10-4 2'-MOE 80 552000
4-10-6 2'-MOE 84 552006 5-10-5 2'-MOE 86 552034 6-10-4 2'-MOE 81
552001 4-10-6 2'-MOE 66 552035 6-10-4 2'-MOE 55 552002 4-10-6
2'-MOE 54 552036 6-10-4 2'-MOE 58 552003 4-10-6 2'-MOE 50 552037
6-10-4 2'-MOE 43 552004 4-10-6 2'-MOE 56 552038 6-10-4 2'-MOE
66
TABLE-US-00046 TABLE 45 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 61 510100
3-10-4 2'-MOE 66 552168 3-9-5 2'-MOE 64 552222 4-9-4 2'-MOE 76
552169 3-9-5 2'-MOE 65 552223 4-9-4 2'-MOE 41 552170 3-9-5 2'-MOE
58 552224 4-9-4 2'-MOE 58 552171 3-9-5 2'-MOE 51 552225 4-9-4
2'-MOE 49 552172 3-9-5 2'-MOE 23 552226 4-9-4 2'-MOE 36 552173
3-9-5 2'-MOE 44 552227 4-9-4 2'-MOE 20 552174 3-9-5 2'-MOE 28
552228 4-9-4 2'-MOE 29 552175 3-9-5 2'-MOE 56 552176 3-9-5 2'-MOE
66 552177 3-9-5 2'-MOE 53 552178 3-9-5 2'-MOE 57 552179 3-9-5
2'-MOE 56 552180 3-9-5 2'-MOE 51 552181 3-9-5 2'-MOE 51 552182
3-9-5 2'-MOE 63 552183 3-9-5 2'-MOE 60 552185 3-9-5 2'-MOE 67
552186 3-9-5 2'-MOE 37 552187 3-9-5 2'-MOE 68 552188 3-9-5 2'-MOE
71 552189 3-9-5 2'-MOE 51 552190 3-9-5 2'-MOE 47 552191 3-9-5
2'-MOE 50 552192 3-9-5 2'-MOE 80 552193 3-9-5 2'-MOE 73 552194
3-9-5 2'-MOE 58 552195 3-9-5 2'-MOE 60 552196 3-9-5 2'-MOE 54
552197 3-9-5 2'-MOE 64 552198 3-9-5 2'-MOE 62 552199 3-9-5 2'-MOE
57 552200 3-9-5 2'-MOE 52 552201 3-9-5 2'-MOE 73 552202 3-9-5
2'-MOE 60 552203 3-9-5 2'-MOE 60 552204 3-9-5 2'-MOE 63 552151
2-9-6 2'-MOE 71 552205 3-9-5 2'-MOE 64 552152 2-9-6 2'-MOE 69
552206 3-9-5 2'-MOE 71 552153 2-9-6 2'-MOE 63 552207 3-9-5 2'-MOE
71 552154 2-9-6 2'-MOE 56 552208 3-9-5 2'-MOE 52 552155 2-9-6
2'-MOE 61 552209 3-9-5 2'-MOE 50 552156 2-9-6 2'-MOE 40 552210
3-9-5 2'-MOE 66 552157 2-9-6 2'-MOE 45 552211 3-9-5 2'-MOE 63
552158 2-9-6 2'-MOE 66 552212 3-9-5 2'-MOE 62 552159 2-9-6 2'-MOE
68 552213 3-9-5 2'-MOE 64 552160 2-9-6 2'-MOE 78 552214 3-9-5
2'-MOE 72 552161 2-9-6 2'-MOE 57 552215 3-9-5 2'-MOE 54 552162
2-9-6 2'-MOE 54 552216 3-9-5 2'-MOE 49 552163 2-9-6 2'-MOE 65
552217 3-9-5 2'-MOE 50 552164 2-9-6 2'-MOE 48 552218 3-9-5 2'-MOE
39 552165 2-9-6 2'-MOE 46 552219 3-9-5 2'-MOE 41 552166 2-9-6
2'-MOE 42 552220 3-9-5 2'-MOE 32 552167 2-9-6 2'-MOE 47 552221
3-9-5 2'-MOE 33
TABLE-US-00047 TABLE 46 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 509934
5-10-5 2'-MOE 56 510100 3-10-4 2'-MOE 69 552071 8-10-2 2'-MOE 73
552114 2-9-6 2'-MOE 64 552115 2-9-6 2'-MOE 61 552116 2-9-6 2'-MOE
53 552117 2-9-6 2'-MOE 69 552072 8-10-2 2'-MOE 39 552118 2-9-6
2'-MOE 49 552119 2-9-6 2'-MOE 49 552120 2-9-6 2'-MOE 21 552121
2-9-6 2'-MOE 27 552073 8-10-2 2'-MOE 73 552122 2-9-6 2'-MOE 48
552074 8-10-2 2'-MOE 69 552123 2-9-6 2'-MOE 68 552075 8-10-2 2'-MOE
78 552124 2-9-6 2'-MOE 47 552076 8-10-2 2'-MOE 63 552125 2-9-6
2'-MOE 72 552077 8-10-2 2'-MOE 62 552126 2-9-6 2'-MOE 64 552078
8-10-2 2'-MOE 59 552127 2-9-6 2'-MOE 65 552079 8-10-2 2'-MOE 80
552128 2-9-6 2'-MOE 78 552080 8-10-2 2'-MOE 74 552129 2-9-6 2'-MOE
68 552130 2-9-6 2'-MOE 46 552131 2-9-6 2'-MOE 61 552132 2-9-6
2'-MOE 66 552133 2-9-6 2'-MOE 78 552081 8-10-2 2'-MOE 69 552134
2-9-6 2'-MOE 68 552135 2-9-6 2'-MOE 59 552136 2-9-6 2'-MOE 39
552137 2-9-6 2'-MOE 36 552082 8-10-2 2'-MOE 86 552138 2-9-6 2'-MOE
80 552083 8-10-2 2'-MOE 85 552139 2-9-6 2'-MOE 80 552084 8-10-2
2'-MOE 86 552140 2-9-6 2'-MOE 70 552085 8-10-2 2'-MOE 83 552141
2-9-6 2'-MOE 72 552086 8-10-2 2'-MOE 83 552142 2-9-6 2'-MOE 58
552087 8-10-2 2'-MOE 77 552143 2-9-6 2'-MOE 70 552144 2-9-6 2'-MOE
66 552145 2-9-6 2'-MOE 78 552146 2-9-6 2'-MOE 63 552088 8-10-2
2'-MOE 90 552147 2-9-6 2'-MOE 80 552089 8-10-2 2'-MOE 87 552148
2-9-6 2'-MOE 74 552090 8-10-2 2'-MOE 85 552149 2-9-6 2'-MOE 79
552091 8-10-2 2'-MOE 84 552092 8-10-2 2'-MOE 86 552093 8-10-2
2'-MOE 82 552094 8-10-2 2'-MOE 84 552063 7-10-3 2'-MOE 79 552095
8-10-2 2'-MOE 85 552064 7-10-3 2'-MOE 83 552096 8-10-2 2'-MOE 88
552065 7-10-3 2'-MOE 86 552097 8-10-2 2'-MOE 90 552066 7-10-3
2'-MOE 35 552098 8-10-2 2'-MOE 86 552067 7-10-3 2'-MOE 53 552099
8-10-2 2'-MOE 66 552068 7-10-3 2'-MOE 70 552100 8-10-2 2'-MOE 67
552069 7-10-3 2'-MOE 68 552101 8-10-2 2'-MOE 65 552070 7-10-3
2'-MOE 64 552102 8-10-2 2'-MOE 54
TABLE-US-00048 TABLE 47 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotidesmeasured with RTS3371 Wing %
ISIS No Motif chemistry inhibition 146786 5-10-5 2'-MOE 63 510100
3-10-4 2'-MOE 59 552330 6-9-2 2'-MOE 50 552331 6-9-2 2'-MOE 46
552332 6-9-2 2'-MOE 50 552333 6-9-2 2'-MOE 48 552334 6-9-2 2'-MOE
42 552335 6-9-2 2'-MOE 30 552336 6-9-2 2'-MOE 23 552337 6-9-2
2'-MOE 42 552338 6-9-2 2'-MOE 40 552339 6-9-2 2'-MOE 50 552340
6-9-2 2'-MOE 45 552341 6-9-2 2'-MOE 44 552342 6-9-2 2'-MOE 51
552343 6-9-2 2'-MOE 44 552344 6-9-2 2'-MOE 24 552345 6-9-2 2'-MOE
41 552346 6-9-2 2'-MOE 0 552347 6-9-2 2'-MOE 75 552348 6-9-2 2'-MOE
72 552349 6-9-2 2'-MOE 65 552350 6-9-2 2'-MOE 42 552351 6-9-2
2'-MOE 45 552352 6-9-2 2'-MOE 43 552353 6-9-2 2'-MOE 20 552354
6-9-2 2'-MOE 70 552355 6-9-2 2'-MOE 66 552356 6-9-2 2'-MOE 62
552357 6-9-2 2'-MOE 53 552358 6-9-2 2'-MOE 57 552359 6-9-2 2'-MOE
46 552360 6-9-2 2'-MOE 45 552361 6-9-2 2'-MOE 44 552308 5-9-3
2'-MOE 38 552362 6-9-2 2'-MOE 51 552309 5-9-3 2'-MOE 76 552363
6-9-2 2'-MOE 73 552310 5-9-3 2'-MOE 58 552364 6-9-2 2'-MOE 66
552311 5-9-3 2'-MOE 38 552365 6-9-2 2'-MOE 64 552150 2-9-6 2'-MOE
68 552312 5-9-3 2'-MOE 75 552366 6-9-2 2'-MOE 55 552313 5-9-3
2'-MOE 66 552367 6-9-2 2'-MOE 67 552314 5-9-3 2'-MOE 56 552368
6-9-2 2'-MOE 41 552315 5-9-3 2'-MOE 46 552369 6-9-2 2'-MOE 52
552316 5-9-3 2'-MOE 55 552370 6-9-2 2'-MOE 35 552317 5-9-3 2'-MOE
53 552371 6-9-2 2'-MOE 58 552318 5-9-3 2'-MOE 59 552372 6-9-2
2'-MOE 68 552319 5-9-3 2'-MOE 56 552373 6-9-2 2'-MOE 63 552320
5-9-3 2'-MOE 62 552374 6-9-2 2'-MOE 70 552321 5-9-3 2'-MOE 63
552375 6-9-2 2'-MOE 64 552322 5-9-3 2'-MOE 52 552376 6-9-2 2'-MOE
58 552323 5-9-3 2'-MOE 45 552377 6-9-2 2'-MOE 42 552324 5-9-3
2'-MOE 49 552378 6-9-2 2'-MOE 37 552325 5-9-3 2'-MOE 48 552379
6-9-2 2'-MOE 57 552326 5-9-3 2'-MOE 50 552380 6-9-2 2'-MOE 48
552327 5-9-3 2'-MOE 13 552381 6-9-2 2'-MOE 22 552328 5-9-3 2'-MOE 9
552382 6-9-2 2'-MOE 20 552329 5-9-3 2'-MOE 18 552383 6-9-2 2'-MOE
18
Example 10
Dose-Dependent Antisense Inhibition of Target-Z mRNA in HepG2
Cells
[0709] Antisense oligonucleotides from the study described in
Example 52 exhibiting in vitro inhibition of Target-Z mRNA were
selected and tested at various doses in HepG2 cells. Cells were
plated at a density of 28,000 cells per well and transfected using
LipofectAMINE2000.RTM. with 9.26 nM, 27.78 nM, 83.33 nM, and 250.00
nM concentrations of antisense oligonucleotide, as specified in
Table 48. After a treatment period of approximately 16 hours, RNA
was isolated from the cells and Target-Z mRNA levels were measured
by quantitative real-time PCR. Target-Z primer probe set RTS3371
was used to measure mRNA levels. Target-Z mRNA levels were adjusted
according to total RNA content, as measured by RIBOGREEN.RTM..
Results are presented as percent inhibition of Target-Z, relative
to untreated control cells.
[0710] As illustrated in Table 48, Target-Z mRNA levels were
reduced in a dose-dependent manner in antisense oligonucleotide
treated cells. `n/a` indicates that the data for that dosage is not
available.
TABLE-US-00049 TABLE 48 Dose-dependent antisense inhibition of
human Target-Z in HepG2 cells 9.2593 27.7778 83.3333 250.0 ISIS No
nM nM nM nM 146786 10 43 74 89 509934 12 31 52 79 509959 4 24 49 67
510100 11 28 60 77 510124 3 11 13 41 551926 1 26 51 76 551958 15 17
56 82 551987 4 40 65 81 551990 7 55 78 91 551993 15 30 70 80 551994
0 30 39 58 551995 6 41 73 85 551996 13 47 71 85 551997 16 38 68 89
551998 4 36 69 85 551999 10 31 67 86 552000 0 17 61 78 552006 6 37
74 89 552009 1 5 39 60 552013 0 28 3 72 552014 0 26 32 77 552018 6
27 63 81 552019 15 34 65 90 552020 2 35 65 91 552021 4 11 53 82
552022 6 35 57 79 552023 11 33 59 81 552024 15 43 69 91 552025 17
35 69 87 552026 14 26 66 86 552027 3 46 62 88 552028 9 43 58 78
552029 8 40 72 89 552030 18 48 77 92 552031 0 38 66 89 552032 42 48
80 88 552033 2 40 64 84 552034 6 40 70 81 552039 2 33 56 83 552044
19 30 63 84 552046 4 21 47 77 552050 15 44 70 92 552051 8 33 69 90
552052 17 38 71 91 552053 0 40 59 86 552054 7 15 58 75 552056 19 62
86 92 552057 11 33 69 86 552058 30 55 79 90 552059 11 25 69 90
552060 9 32 61 86 552061 6 40 69 88 552062 22 48 75 89 552064 23 49
69 90 552065 10 8 69 86 552069 11 4 28 60 552073 9 31 62 78 552075
21 18 33 65 552077 0 17 40 72 552079 1 12 44 70 552080 3 12 34 69
552082 13 29 66 87 552083 24 54 69 88 552084 10 25 48 82 552085 28
35 64 85 552086 0 24 65 84 552088 33 53 77 93 552089 0 41 69 92
552090 17 35 70 87 552091 13 31 69 89 552092 6 23 66 89 552093 0 17
61 89 552094 12 38 65 88 552095 20 42 73 88 552096 n/a 39 66 91
552097 24 43 67 88 552098 0 24 56 85 552101 3 13 28 61 552147 11 27
58 80 552160 20 25 69 89 552163 0 21 22 53 552176 16 11 40 66
552192 7 38 78 89 552222 0 24 65 79 552247 0 38 69 86 552255 5 27
69 81 552301 5 38 65 86 552309 8 26 62 85 552312 0 4 32 62 552347 2
15 38 75 552348 12 40 42 65 552354 10 35 44 76 552361 2 25 55 74
552363 20 36 54 76 552374 7 4 38 76 552379 0 12 24 46 552403 8 27
54 76 552408 2 25 44 77 552409 6 31 56 80 552418 0 30 72 84 552420
9 34 53 81 552442 4 23 46 56 552466 0 23 56 79 552474 11 34 66 87
552477 11 22 44 64 552530 25 37 73 87 552559 9 13 29 51
Example 11
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0711] Target-Z transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0712] Groups of 12 mice each were injected subcutaneously twice a
week for 4 weeks with 50 mg/kg of ISIS 510106, ISIS 510116, ISIS
505347, or ISIS 509934. A control group of 12 mice was injected
subcutaneously twice a week for 4 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and livers were harvested
for further analysis.
DNA and RNA Analysis
[0713] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe sets RTS3370, RTS3371,
and RTS3372. The DNA levels were normalized to picogreen. Target-Z
RNA samples were also assayed with primer probe sets RTS3370 and
RTS3371 after RT-PCR analysis. The mRNA levels were normalized to
RIBOGREEN.RTM.. The data is presented in Table 49, expressed as
percent inhibition compared to the control group. As shown in Table
49, most of the antisense oligonucleotides achieved reduction of
Target-Z DNA and RNA over the PBS control. Results are presented as
percent inhibition of Target-Z mRNA or DNA, relative to
control.
TABLE-US-00050 TABLE 49 Percent inhibition of Target-Z RNA and DNA
in the liver of transgenic mice % % % % % % inhibition inhibition
inhibition inhibition inhibition inhibition DNA DNA DNA RNA RNA RNA
ISIS No (RTS3370) (RTS3371) (RTS3372) (RTS3370) (RTS3371) (RTS3372)
510106 0 0 51 0 0 12 510116 68 79 68 49 54 66 505347 72 79 75 54 28
30 509934 93 95 94 72 75 92
Example 12
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0714] Target-Z transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0715] Groups of 6 mice each were injected subcutaneously twice a
week for 4 weeks with 50 mg/kg of ISIS 146779, ISIS 505358, ISIS
146786, ISIS 509974, ISIS 509958, or ISIS 509959. A control group
of 10 mice was injected subcutaneously twice a week for 4 weeks
with PBS. Mice were euthanized 48 hours after the last dose, and
livers were harvested for further analysis.
DNA and RNA Analysis
[0716] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe sets RTS3370. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe sets RTS3370 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. The data is
presented in Table 50, expressed as percent inhibition compared to
the control group. As shown in Table 50, most of the antisense
oligonucleotides achieved reduction of Target-Z DNA and RNA over
the PBS control. Results are presented as percent inhibition of
Target-Z mRNA or DNA, relative to control.
TABLE-US-00051 TABLE 50 Percent inhibition of Target-Z RNA and DNA
in the liver of transgenic mice % % inhibition inhibition ISIS No
DNA RNA 146779 39 5 505358 84 77 146786 83 73 509974 56 28 509958
82 29 509959 54 30
Example 13
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0717] Transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0718] Groups of 6 mice each were injected subcutaneously twice a
week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 552176, and
ISIS 552073. One group of 10 mice was injected subcutaneously twice
a week for 4 weeks with PBS. Mice were euthanized 48 hours after
the last dose, and organs and plasma were harvested for further
analysis.
DNA and RNA Analysis
[0719] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe set RTS3371. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe set RTS3371 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. The data is
presented in Table 51. Serum DNA samples were analyzed after the
study period. The data is presented in Table 52, expressed relative
to the levels measured in the control group. As shown in Tables 51
and 52, the antisense oligonucleotides achieved reduction of
Target-Z DNA and RNA over the PBS control. Results are presented as
percent inhibition of Target-Z mRNA or DNA, relative to
control.
TABLE-US-00052 TABLE 51 Percent inhibition of Target-Z RNA and DNA
in transgenic mice Dose % inhibition of % inhibition of ISIS No
(mg/kg/wk) RNA DNA 146786 50 81 91 552073 50 39 22 552176 50 55
56
TABLE-US-00053 TABLE 52 Serum levels of Target-Z DNA in transgenic
mice, relative to control levels Dose Post-dose ISIS No (mg/kg/wk)
DNA levels 146786 50 0.1 552073 50 2.9 552176 50 2.1
Liver Function
[0720] To evaluate the effect of ISIS oligonucleotides on hepatic
function, plasma concentrations of ALT were measured using an
automated clinical chemistry analyzer (Hitachi Olympus AU400e,
Melville, N.Y.) (Nyblom, H. et al., Alcohol & Alcoholism 39:
336-339, 2004; Tietz N W (Ed): Clinical Guide to Laboratory Tests,
3rd ed. W. B. Saunders, Philadelphia, Pa., 1995). The results are
presented in Table 53 expressed in IU/L. Both the ISIS
oligonucleotides were considered tolerable in the mice, as
demonstrated by their liver transaminase profile.
TABLE-US-00054 TABLE 53 ALT levels (IU/L) of transgenic mice Dose
(mg/kg/wk) ALT PBS -- 77 ISIS 146786 50 21 ISIS 552073 50 19 ISIS
552176 50 27
Example 14
Efficacy of Antisense Oligonucleotides Targeting Target-Z in
Transgenic Mice
[0721] Transgenic mice were treated with ISIS antisense
oligonucleotides selected from studies described above and
evaluated for their efficacy in this model.
Treatment
[0722] Groups of 6 mice each were injected subcutaneously twice a
week for 4 weeks with 25 mg/kg of ISIS 146786, ISIS 552056, ISIS
552088, and ISIS 552309. One group of 10 mice was injected
subcutaneously twice a week for 4 weeks with PBS. Mice were
euthanized 48 hours after the last dose, and organs and plasma were
harvested for further analysis.
DNA and RNA Analysis
[0723] RNA was extracted from liver tissue for real-time PCR
analysis of Target-Z DNA, using primer probe set RTS3371. The DNA
levels were normalized to picogreen. Target-Z RNA samples were also
assayed with primer probe set RTS3371 after RT-PCR analysis. The
mRNA levels were normalized to RIBOGREEN.RTM.. As shown in Table
54, the antisense oligonucleotides achieved reduction of Target-Z
DNA and RNA over the PBS control. Results are presented as percent
inhibition of Target-Z mRNA or DNA, relative to control.
TABLE-US-00055 TABLE 54 Percent inhibition of Target-Z DNA and RNA
in transgenic mice % % Dose inhibition inhibition (mg/kg/wk) (RNA)
(DNA) ISIS 146786 50 60 90 ISIS 552056 50 25 58 ISIS 552088 50 8 0
ISIS 552309 50 35 84
Example 15
Antisense Inhibition of Target-Z Viral mRNA in HepG2 Cells by
Deoxy, MOE and (S)-cEt Gapmers
[0724] Additional antisense oligonucleotides were designed
targeting a Target-Z viral nucleic acid and were tested for their
effects on Target-Z mRNA in vitro. Cultured HepG2 cells at a
density of 28,000 cells per well were transfected using
LipofectAMINE2000.RTM. with 100 nM antisense oligonucleotide. After
a treatment period of approximately 24 hours, RNA was isolated from
the cells and Target-Z mRNA levels were measured by quantitative
real-time PCR. Viral primer probe sets RTS3370 and RTS3371 and were
used to separately measure mRNA levels. Target-Z mRNA levels were
adjusted according to total RNA content, as measured by
RIBOGREEN.RTM.. Results are presented as percent inhibition of
Target-Z, relative to untreated control cells.
[0725] The newly designed chimeric antisense oligonucleotides in
Table below were designed as MOE gapmers or deoxy, MOE and (S)-cEt
gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length,
wherein the central gap segment comprises of ten
2'-deoxynucleosides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising five nucleosides each. The deoxy,
MOE and (S)-cEt gapmers are 16 nucleosides in length wherein the
nucleoside have either a MOE sugar modification, an (S)-cEt sugar
modification, or a deoxy modification. The `Chemistry` column
describes the sugar modifications of each oligonucleotide. `k`
indicates an (S)-cEt sugar modification; the number indicates the
number of deoxynucleosides; otherwise, `d` indicates a
deoxynucleoside; and `e` indicates a MOE modification. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout each oligonucleotide are 5-methylcytosines.
[0726] Each gapmer listed in Table 55 is targeted to the viral
Target-Z genomic sequence.
TABLE-US-00056 TABLE 55 Inhibition of viral Target-Z mRNA levels by
chimeric antisense oligonucleotides measured with RTS3370 or
RTS3371 % % inhibition inhibition ISIS No Motif (RTS3370) (RTS3371)
5808 Uniform deoxy 57 64 524518 eeeee-10-eeeee 62 72 146781
eeeee-10-eeeee 72 93 582665 eeeee-10-eeeee 57 59 582666
eeeee-10-eeeee 49 92 566831 kdkdk-9-ee 96 73 577123 eekk-9-ekee 84
96 577124 kdkdk-8-eeee 92 96 577126 kkk-8-eeeee 87 90 566830
kdkdk-9-ee 93 95 577130 eek-10-kke 87 94 577131 kdkdk-9-ee 83 93
566828 kdkdk-9-ee 97 90 146786 eeeee-10-eeeee 93 71 566829
kdkdk-9-ee 98 84 577120 kdkdk-10-eeeee 94 93 577127 kkk-8-eeeee 95
70 577134 kek-8-eeeee 94 89 577135 kek-10-kek 96 94 552859
ekk-10-kke 92 91 577121 kdkdk-10-eeeee 91 74 577128 kkk-8-eeeee 92
85 577132 kdkdk-9-ee 97 81 577136 kek-10-kek 95 95 566832
kdkdk-9-ee 95 78 552870 ekk-10-kke 71 93 577122 kdkdk-10-eeeee 70
96 577125 kdkdk-8-eeee 70 94 577129 kkk-8-eeeee 76 51 577133
kdkdk-9-ee 80 52 9591 Uniform deoxy 30 14
Example 16
Antisense Inhibition of Target-Z Viral mRNA in HepG2 Cells by
Deoxy, MOE and (S)-cEt Gapmers
[0727] Additional antisense oligonucleotides were designed
targeting a Target-Z viral nucleic acid and were tested for their
effects on Target-Z mRNA in vitro. ISIS 577121, ISIS 577122, ISIS
577123, ISIS 577132, ISIS 577133, and ISIS 577134, disclosed in the
study described above, were also included in the assay. Cultured
HepG2 cells at a density of 28,000 cells per well were transfected
using Cytofectin with 9.375 nM, 18.75 nM, 37.50 nM, 75.00 nM,
150.00 nM, or 300.00 nM antisense oligonucleotide. After a
treatment period of approximately 24 hours, RNA was isolated from
the cells and Target-Z mRNA levels were measured by quantitative
real-time PCR. Viral primer probe set RTS3371 was used to measure
mRNA levels. Target-Z mRNA levels were adjusted according to total
RNA content, as measured by RIBOGREEN.RTM.. Results are presented
as percent inhibition of Target-Z, relative to untreated control
cells.
[0728] The newly designed chimeric antisense oligonucleotides in
Tables below were designed as deoxy, MOE and (S)-cEt gapmers. The
deoxy, MOE and (S)-cEt gapmers are 16, 17, or 18 nucleosides in
length wherein the nucleosides have either a MOE sugar
modification, an (S)-cEt sugar modification, or a deoxy
modification. The `Chemistry` column describes the sugar
modifications of each oligonucleotide. `k` indicates an (S)-cEt
sugar modification; the number indicates the number of
deoxynucleosides; otherwise, `d` indicates a deoxynucleoside; and
`e` indicates a MOE modification. The internucleoside linkages
throughout each gapmer are phosphorothioate (P.dbd.S) linkages. All
cytosine residues throughout each oligonucleotide are
5-methylcytosines.
[0729] Each gapmer listed in Table 56 is targeted to the viral
genomic sequence.
TABLE-US-00057 TABLE 56 Chimeric antisense oligonucleotides
targeting viral Target-Z genomic sequence ISIS No Motif 585163
eeekk-8-eeee 585164 eeekk-7-kkeee 585165 eeek-9-keee 585170
eeekk-7-kkeee 585171 eeek-9-keee 585172 eeeekk-7-eeee 585173
ekek-9-eeee 585174 ekekdk-7-eeee 585166 eeekk-7-kkeee 585167
eeek-9-keee 577119 kdkdk-8-eeeee 585168 eeekk-7-kkeee 585169
eeek-9-keee
TABLE-US-00058 TABLE 57 Dose dependent inhibition of Target-Z mRNA
levels by chimeric antisense oligonucleotides 9.375 18.75 37.5 75.0
150.0 300.0 ISIS No nM nM nM nM nM nM 146786 37 37 58 70 81 93
505358 30 26 28 57 74 85 510100 42 30 43 61 77 91 552859 21 30 39
61 79 91 577119 42 43 46 66 74 75 577121 10 15 42 64 82 89 577122
21 30 53 66 78 84 577123 27 29 45 56 78 84 577132 14 21 42 61 80 92
577133 12 14 32 47 62 77 577134 37 39 59 72 86 90 585174 31 28 48
61 80 90
TABLE-US-00059 TABLE 58 Dose dependent inhibition of Target-Z mRNA
levels by chimeric antisense oligonucleotides 9.375 18.75 37.5 75.0
150.0 300.0 ISIS No nM nM nM nM nM nM 146786 25 34 57 71 85 92
509932 9 28 59 62 70 74 585163 17 32 52 68 77 81 585164 23 4 29 31
36 56 585165 6 31 42 58 66 82 585166 19 27 35 48 50 63 585167 22 25
50 69 76 88 585168 4 30 44 52 67 76 585169 32 32 42 62 76 80 585170
23 19 39 49 66 75 585171 28 27 42 59 81 88 585172 26 29 30 64 80 91
585173 29 30 41 71 86 88
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 45 <210> SEQ ID NO 1 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 1 gtgctaccca acctttctg 19 <210> SEQ ID
NO 2 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
2 cacagtgcta cccaacctt 19 <210> SEQ ID NO 3 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 3 cagtgctacc caacc
15 <210> SEQ ID NO 4 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 4 atatcacagt gctacccaa 19 <210> SEQ ID
NO 5 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
5 gatgctgact tgggccatt 19 <210> SEQ ID NO 6 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 6 gggatgctga cttgg
15 <210> SEQ ID NO 7 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 7 tgccaaggga tgctgactt 19 <210> SEQ ID
NO 8 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
8 aattgtcatc accagaaaa 19 <210> SEQ ID NO 9 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 9 taaattgtca tcacc
15 <210> SEQ ID NO 10 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 10 acagtagatg agggagcag 19 <210> SEQ ID
NO 11 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
11 acacagtaga tgagg 15 <210> SEQ ID NO 12 <211> LENGTH:
19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 12 aagtgcacac agtagatga 19
<210> SEQ ID NO 13 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 13 agctgcaacc tggcaacaa 19 <210> SEQ ID
NO 14 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
14 gcagctgcaa cctgg 15 <210> SEQ ID NO 15 <211> LENGTH:
19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 15 gcaagagcag ctgcaacct 19
<210> SEQ ID NO 16 <400> SEQUENCE: 16 000 <210>
SEQ ID NO 17 <400> SEQUENCE: 17 000 <210> SEQ ID NO 18
<400> SEQUENCE: 18 000 <210> SEQ ID NO 19 <400>
SEQUENCE: 19 000 <210> SEQ ID NO 20 <400> SEQUENCE: 20
000 <210> SEQ ID NO 21 <400> SEQUENCE: 21 000
<210> SEQ ID NO 22 <400> SEQUENCE: 22 000 <210>
SEQ ID NO 23 <211> LENGTH: 16 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 23 atcatggctg cagctt 16 <210> SEQ ID NO
24 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
24 atcatggctg cagctt 16 <210> SEQ ID NO 25 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 25 tggctgcagc
ttccga 16 <210> SEQ ID NO 26 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 26 atggctgcag cttccg 16
<210> SEQ ID NO 27 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 27 catggctgca gcttcc 16 <210> SEQ ID NO
28 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
28 tcatggctgc agcttc 16 <210> SEQ ID NO 29 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 29 catcatggct
gcagct 16 <210> SEQ ID NO 30 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 30 ccatcatggc tgcagc 16
<210> SEQ ID NO 31 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 31 tccatcatgg ctgcag 16 <210> SEQ ID NO
32 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
32 ttccatcatg gctgca 16 <210> SEQ ID NO 33 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 33 cttggtcatg ggccatcag 19 <210> SEQ ID
NO 34 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 34 cggctaggag
ttccgcagta 20 <210> SEQ ID NO 35 <211> LENGTH: 22
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 35 tgcgtggaac cttttcggct cc 22 <210>
SEQ ID NO 36 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 36
ccaaaccttc ggacggaaa 19 <210> SEQ ID NO 37 <211>
LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 37 tgaggcccac tcccatagg 19 <210> SEQ ID
NO 38 <211> LENGTH: 26 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Probe <400> SEQUENCE: 38 cccatcatcc
tgggctttcg gaaaat 26 <210> SEQ ID NO 39 <211> LENGTH:
20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 39 gtgaagcgaa gtgcacacgg 20
<210> SEQ ID NO 40 <211> LENGTH: 17 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 40 ggcatagcag caggatg 17 <210> SEQ ID
NO 41 <211> LENGTH: 20 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
41 ccttccctga aggttcctcc 20 <210> SEQ ID NO 42 <211>
LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 42 cggtccttgg
aggatgc 17 <210> SEQ ID NO 43 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 43 atcctatcaa cacttccgga aact 24 <210>
SEQ ID NO 44 <211> LENGTH: 16 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 44
cgacgcggcg attgag 16 <210> SEQ ID NO 45 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 45 aagaactccc tcgcctcgca gacg 24
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 45 <210>
SEQ ID NO 1 <211> LENGTH: 19 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 1 gtgctaccca acctttctg 19 <210> SEQ ID
NO 2 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
2 cacagtgcta cccaacctt 19 <210> SEQ ID NO 3 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 3 cagtgctacc caacc
15 <210> SEQ ID NO 4 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 4 atatcacagt gctacccaa 19 <210> SEQ ID
NO 5 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
5 gatgctgact tgggccatt 19 <210> SEQ ID NO 6 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 6 gggatgctga cttgg
15 <210> SEQ ID NO 7 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 7 tgccaaggga tgctgactt 19 <210> SEQ ID
NO 8 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
8 aattgtcatc accagaaaa 19 <210> SEQ ID NO 9 <211>
LENGTH: 15 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 9 taaattgtca tcacc
15 <210> SEQ ID NO 10 <211> LENGTH: 19 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 10 acagtagatg agggagcag 19 <210> SEQ ID
NO 11 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
11 acacagtaga tgagg 15 <210> SEQ ID NO 12 <211> LENGTH:
19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 12 aagtgcacac agtagatga 19
<210> SEQ ID NO 13 <211> LENGTH: 19 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 13 agctgcaacc tggcaacaa 19 <210> SEQ ID
NO 14 <211> LENGTH: 15 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
14 gcagctgcaa cctgg 15 <210> SEQ ID NO 15 <211> LENGTH:
19 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 15 gcaagagcag ctgcaacct 19
<210> SEQ ID NO 16 <400> SEQUENCE: 16 000 <210>
SEQ ID NO 17 <400> SEQUENCE: 17 000 <210> SEQ ID NO 18
<400> SEQUENCE: 18 000 <210> SEQ ID NO 19 <400>
SEQUENCE: 19 000 <210> SEQ ID NO 20 <400> SEQUENCE: 20
000 <210> SEQ ID NO 21 <400> SEQUENCE: 21 000
<210> SEQ ID NO 22 <400> SEQUENCE: 22 000 <210>
SEQ ID NO 23 <211> LENGTH: 16 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 23 atcatggctg cagctt 16 <210> SEQ ID NO
24 <211> LENGTH: 16 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 24 atcatggctg cagctt 16 <210> SEQ ID NO
25 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
25 tggctgcagc ttccga 16 <210> SEQ ID NO 26 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 26 atggctgcag
cttccg 16 <210> SEQ ID NO 27 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 27 catggctgca gcttcc 16
<210> SEQ ID NO 28 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 28 tcatggctgc agcttc 16 <210> SEQ ID NO
29 <211> LENGTH: 16 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
29 catcatggct gcagct 16 <210> SEQ ID NO 30 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 30 ccatcatggc
tgcagc 16 <210> SEQ ID NO 31 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 31 tccatcatgg ctgcag 16
<210> SEQ ID NO 32 <211> LENGTH: 16 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 32 ttccatcatg gctgca 16 <210> SEQ ID NO
33 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 33 cttggtcatg
ggccatcag 19 <210> SEQ ID NO 34 <211> LENGTH: 20
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 34 cggctaggag ttccgcagta 20 <210> SEQ
ID NO 35 <211> LENGTH: 22 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Probe <400> SEQUENCE: 35 tgcgtggaac
cttttcggct cc 22 <210> SEQ ID NO 36 <211> LENGTH: 19
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 36 ccaaaccttc ggacggaaa 19 <210> SEQ ID
NO 37 <211> LENGTH: 19 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer <400> SEQUENCE: 37 tgaggcccac
tcccatagg 19 <210> SEQ ID NO 38 <211> LENGTH: 26
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 38 cccatcatcc tgggctttcg gaaaat 26
<210> SEQ ID NO 39 <211> LENGTH: 20 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic oligonucleotide
<400> SEQUENCE: 39 gtgaagcgaa gtgcacacgg 20 <210> SEQ
ID NO 40 <211> LENGTH: 17 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic oligonucleotide <400> SEQUENCE:
40 ggcatagcag caggatg 17 <210> SEQ ID NO 41 <211>
LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic oligonucleotide <400> SEQUENCE: 41 ccttccctga
aggttcctcc 20 <210> SEQ ID NO 42 <211> LENGTH: 17
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
oligonucleotide <400> SEQUENCE: 42 cggtccttgg aggatgc 17
<210> SEQ ID NO 43 <211> LENGTH: 24 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Primer <400> SEQUENCE: 43
atcctatcaa cacttccgga aact 24 <210> SEQ ID NO 44 <211>
LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION: Primer
<400> SEQUENCE: 44 cgacgcggcg attgag 16 <210> SEQ ID NO
45 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Probe
<400> SEQUENCE: 45 aagaactccc tcgcctcgca gacg 24
* * * * *
References