U.S. patent application number 14/341402 was filed with the patent office on 2015-05-21 for oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC.. The applicant listed for this patent is Isis Pharmaceuticals, Inc.. Invention is credited to Andrew M. Siwkowski, Eric E. Swayze.
Application Number | 20150141636 14/341402 |
Document ID | / |
Family ID | 40886736 |
Filed Date | 2015-05-21 |
United States Patent
Application |
20150141636 |
Kind Code |
A1 |
Swayze; Eric E. ; et
al. |
May 21, 2015 |
OLIGOMERIC COMPOUNDS COMPRISING BICYCLIC NUCLEOSIDES AND HAVING
REDUCED TOXICITY
Abstract
In certain embodiments, the present invention provides
oligomeric compounds having favorable toxicity profiles and
therapeutic indexes. Compounds of the present invention comprise
bicyclic nucleosides. Certain such bicyclic nucleosides are
pyrimidines that do not include a methyl group at the 5-carbon.
Oligomeric compounds comprising such nucleosides are less toxic
than compounds comprising bicyclic nucleosides that do include a
methyl group at the 5-carbon. In certain embodiments, the present
invention provides methods of preparing and using such
compounds.
Inventors: |
Swayze; Eric E.; (Encinitas,
CA) ; Siwkowski; Andrew M.; (Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Isis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
ISIS PHARMACEUTICALS, INC.
Carlsbad
CA
|
Family ID: |
40886736 |
Appl. No.: |
14/341402 |
Filed: |
July 25, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12936156 |
Jan 14, 2011 |
8846639 |
|
|
PCT/US2009/039557 |
Apr 3, 2009 |
|
|
|
14341402 |
|
|
|
|
61042619 |
Apr 4, 2008 |
|
|
|
Current U.S.
Class: |
536/24.5 |
Current CPC
Class: |
C12N 15/111 20130101;
C12N 2310/315 20130101; C12N 2310/341 20130101; C12N 15/113
20130101; C12N 2310/346 20130101; C12N 2320/53 20130101; C12N
2310/11 20130101; C12N 2310/3231 20130101; C12N 2310/14
20130101 |
Class at
Publication: |
536/24.5 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1.-257. (canceled)
257. An oligonucleotide consisting of 8-26 linked nucleosides
wherein at least one nucleoside is a bicyclic nucleoside comprising
a bicyclic sugar moiety and a nucleobase, wherein the nucleobase is
selected from among Formula I and Formula II: ##STR00029##
258. The oligonucleotide of claim 257, wherein the at least one
bicyclic nucleoside is a 4'-2' bridged bicyclic nucleoside.
259. The oligonucleotide of claim 258, wherein the at least one
bicyclic nucleoside has a bicyclic sugar moiety having Formula III:
##STR00030## wherein independently for each of the at least one
bicyclic nucleoside of formula III: X is selected from among:
4'-(CR.sub.1R.sub.2).sub.n--Y-2'; wherein each R.sub.1 and each
R.sub.2 is independently selected from among: hydrogen, a halogen,
an optionally substituted C.sub.1-C.sub.6 alkyl, an optionally
substituted C.sub.2-C.sub.6 alkenyl, an optionally substituted
C.sub.2-C.sub.6 alkynyl, an optionally substituted heteroalkyl, an
optionally substituted heteroalkenyl, and an optionally substituted
heteroalkynyl; Y is selected from among CR.sub.1R.sub.2, O, N(J),
and S; T.sub.1 and T.sub.2 are each, independently, an
internucleoside linking group linking the bicyclic nucleoside to
the oligonucleotide or one of T.sub.1 and T.sub.2 is an
internucleoside linking group linking the bicyclic nucleoside to
the oligonucleotide and the other of T.sub.1 and T.sub.2 is
hydroxyl, a protected hydroxyl, a linked conjugate group or a 5' or
3'-terminal group; n is from 1 to 3; J is hydrogen, a halogen, an
optionally substituted C.sub.1-C.sub.5 alkyl, an optionally
substituted C.sub.1-C.sub.5 alkenyl, an optionally substituted
C.sub.1-C.sub.5 alkynyl, an optionally substituted heteroalkyl, an
optionally substituted heteroalkenyl, or an optionally substituted
heteroalkynyl; and Bx is the heterocyclic base moiety of Formula I
or Formula II.
260. The oligonucleotide of claim 259, wherein X is selected from
among: 4'-CH.sub.2O-2', 4'-CH(CH.sub.3)O-2', and
4'-CH.sub.2CH.sub.2O-2'.
261. The oligonucleotide of claim 260, wherein X is 4'-CH.sub.2O-2'
or 4'-CH.sub.2CH.sub.2O-2'.
262. The oligonucleotide of claim 261, wherein X is
4'-CH.sub.2O-2'.
263. The oligonucleotide of claim 259, wherein the bicyclic
nucleoside has the configuration: ##STR00031##
264. The oligonucleotide of claim 259, wherein the bicyclic
nucleoside has the configuration: ##STR00032##
265. The oligonucleotide of claim 257, wherein the oligonucleotide
does not comprise any 5-methyl pyrimidine bicyclic nucleosides.
266. The oligonucleotide of claim 257, wherein each nucleoside is a
bicyclic nucleoside.
267. The oligonucleotide of claim 266, wherein each nucleoside
comprises the same bicyclic sugar moiety.
268. The oligonucleotide of claim 266, wherein at least two
nucleosides comprise bicyclic sugar moieties that are different
from one another.
269. The oligonucleotide of claim 257, comprising at least one
non-bicyclic nucleoside.
270. The oligonucleotide of claim 269, comprising at least one
modified non-bicyclic nucleoside.
271. The oligonucleotide of claim 270, comprising at least one
modified non-bicyclic nucleoside selected from among:
2'-O--(CH.sub.2).sub.2--OCH.sub.3, 2'-OCH.sub.3, and 2'-F.
272. The oligonucleotide of any of claim 257, comprising at least
one unmodified nucleoside.
273. The oligonucleotide of claim 257, comprising at least one
unmodified ribonucleoside.
274. The oligonucleotide of claim 257, comprising at least one
unmodified deoxyribonucleoside.
275. The oligonucleotide of claim 257, consisting of 16-18 linked
nucleosides.
276. The oligonucleotide of claim 257, consisting of 18-20 linked
nucleosides.
Description
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 12/936,156, filed Jan. 14, 2011, which is the US National Phase
filing under 35 U.S.C. .sctn.371 claiming priority to International
Serial No. PCT/US2009/039557, filed Apr. 3, 2009, which claims
priority to U.S. Provisional Patent Application No. 61/042,619,
filed Apr. 4, 2008, each of which is incorporated herein by
reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention provides compounds and methods for
modulating nucleic acids and proteins.
SEQUENCE LISTING
[0003] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0080USC1SEQ ST25.txt, created on Jul. 10, 2014
which is 12 Kb in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0004] Antisense compounds have been used to modulate target
nucleic acids. Antisense compounds comprising a variety of
modifications and motifs have been reported. Certain
oligonucleotides comprising nucleosides having bicyclic sugar
moieties have been reported. In certain instances, such compounds
are useful as research tools and as therapeutic agents. In certain
instances antisense compounds have been shown to modulate protein
expression by altering splicing of a pre-mRNA, by arresting
translation and/or by interrupting poly-adenylation of a
pre-mRNA.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, the present invention provides an
oligonucleotide consisting of 8-26 linked nucleosides wherein at
least one nucleoside is a bicyclic nucleoside comprising a bicyclic
sugar moiety and a nucleobase wherein the nucleobase is selected
from among Formula I and Formula II:
##STR00001##
[0006] In certain such embodiments, the oligonucleotide has at
least one bicyclic nucleoside that is a 4'-2' bridged bicyclic
nucleoside. In certain such embodiments, such oligonucleotides have
at least one bicyclic nucleoside has a bicyclic sugar moiety having
Formula III:
##STR00002##
wherein independently for each of the at least one bicyclic
nucleoside of formula III: [0007] X is selected from among:
4'-(CR.sub.1R.sub.2).sub.n--Y-2'; [0008] wherein each R.sub.1 and
each R.sub.2 is independently selected from among: hydrogen, a
halogen, an optionally substituted C.sub.1-C.sub.6 alkyl, an
optionally substituted C.sub.2-C.sub.6 alkenyl, an optionally
substituted C.sub.2-C.sub.6 alkynyl, an optionally substituted
heteroalkyl, an optionally substituted heteroalkenyl, and an
optionally substituted heteroalkynyl; [0009] Y is selected from
among CR.sub.1R.sub.2, O, N(J), and S; [0010] T.sub.1 and T.sub.2
are each, independently, an internucleoside linking group linking
the bicyclic nucleoside to the oligonucleotide or one of T.sub.1
and T.sub.2 is an internucleoside linking group linking the
bicyclic nucleoside to the oligonucleotide and the other of T.sub.1
and T.sub.2 is hydroxyl, a protected hydroxyl, a linked conjugate
group or a 5' or 3'-terminal group; [0011] n is from 1 to 3; [0012]
J is hydrogen, a halogen, an optionally substituted C.sub.1-C.sub.5
alkyl, an optionally substituted C.sub.1-C.sub.5 alkenyl, an
optionally substituted C.sub.1-C.sub.5 alkynyl, an optionally
substituted heteroalkyl, an optionally substituted heteroalkenyl,
or an optionally substituted heteroalkynyl; and [0013] Bx is the
heterocyclic base moiety of Formula I or Formula II.
[0014] In certain such embodiments X is selected from among:
4'-CH.sub.2O-2', 4'-CH(CH.sub.3)O-2', and 4'-CH.sub.2CH.sub.2O-2'.
In certain embodiments, X is 4'-CH.sub.2O-2' or
4'-CH.sub.2CH.sub.2O-2'. In certain embodiments, X is
4'-CH.sub.2CH.sub.2O-2'. In certain embodiments, X is
4'-CH.sub.2O-2'.
[0015] In any of such embodiments, the bicyclic nucleoside may be
in the .alpha.-L configuration or in the .beta.-D configuration. In
certain embodiments, the bicyclic nucleoside has the
configuration:
##STR00003##
[0016] In certain embodiments, such oligonucleotides do not
comprise any 5-methyl pyrimidine bicyclic nucleosides.
[0017] In certain embodiments, each nucleoside of an
oligonucleotide of the present invention is a bicyclic nucleoside.
In certain such embodiments, each nucleoside comprises the same
bicyclic sugar moiety. In certain embodiments at least two
nucleosides comprise bicyclic sugar moieties that are different
from one another.
[0018] In certain embodiments, oligonucleotides of the present
invention comprise at least one non-bicyclic nucleoside. Certain
such oligonucleotides comprise at least one modified non-bicyclic
nucleoside. In certain such embodiments, at least one modified
nucleoside comprises at least one modified non-bicyclic nucleoside
selected from among: 2'-O--(CH.sub.2).sub.2--OCH.sub.3,
2'-OCH.sub.3, and 2'-F. In certain embodiments, oligonucleotides of
the present invention comprise at least one unmodified nucleoside,
such as a ribonucleoside and/or a deoxyribonucleoside.
[0019] In certain embodiments, oligonucleotides of the present
invention comprise two or more bicyclic nucleosides having a base
moiety of Formula I or I and a sugar moiety of Formula III. In
certain such embodiments, the two or more bicyclic nucleosides all
comprise the same bicyclic sugar moiety. In certain embodiments, at
least two of the two or more bicyclic nucleosides comprise bicyclic
sugar moieties that are different from one another.
[0020] In certain embodiments, oligonucleotides of the present
invention consist of 8-10 linked nucleosides. In certain
embodiments, oligonucleotides of the present invention consist of
8-10 linked nucleosides. In certain embodiments, oligonucleotides
of the present invention consist of 10-12 linked nucleosides. In
certain embodiments, oligonucleotides of the present invention
consist of 12-14 linked nucleosides. In certain embodiments,
oligonucleotides of the present invention consist of 14-16 linked
nucleosides. In certain embodiments, oligonucleotides of the
present invention consist of 16-18 linked nucleosides. In certain
embodiments, oligonucleotides of the present invention consist of
18-20 linked nucleosides. In certain embodiments, oligonucleotides
of the present invention consist of 20-22 linked nucleosides. In
certain embodiments, oligonucleotides of the present invention
consist of 22-24 linked nucleosides. In certain embodiments,
oligonucleotides of the present invention consist of 24-26 linked
nucleosides. In certain embodiments, oligonucleotides of the
present invention consist of 11-18 linked nucleosides.
[0021] In certain embodiments, oligonucleotides of the present
invention are gapmers. In certain such embodiments, such gapmers
comprise at least one bicyclic nucleoside of Formula III in at
least one wing of the gapmer. In certain embodiments, such gapmers
comprise at least one bicyclic nucleoside of Formula III in each
wing of the gapmer. In certain embodiments, each nucleoside of each
wing is a bicyclic nucleoside comprising a sugar moiety of Formula
III. In certain embodiments, such gapmers consist of 1-6
nucleosides. In certain embodiments, such gapmers consist of 1-6
nucleosides. In certain embodiments, such gapmers consist of 1-5
nucleosides. In certain embodiments, such gapmers consist of 1-4
nucleosides. In certain embodiments, such gapmers consist of 1-3
nucleosides. In certain embodiments, such gapmers consist of 1-2
nucleosides.
[0022] In certain embodiments, such gapmers consist of 1
nucleoside.
[0023] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 8-10
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 10-12
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 12-14
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 14-16
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 16-18
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 18-20
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 20-22
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 8-9 nucleosides.
In certain embodiments where an oligonucleotide of the present
invention is a gapmer, the gap consists of 9-11 nucleosides.
[0024] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the sugar modification of each
nucleoside of one wing of the gapmer and the sugar modification of
each nucleoside of the other wing of the gapmer are the same as one
another. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the sugar modification of each
nucleoside of one wing of the gapmer and the sugar modification of
each nucleoside of the other wing of the gapmer are different from
one another.
[0025] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the nucleosides of the gap are all
unmodified nucleosides. In certain such embodiments, the
nucleosides of the gap are all deoxyribonucleosides. In certain
embodiments, the nucleosides of the gap are modified
nucleosides.
[0026] In certain embodiments, oligonucleotide of the present
invention have an alternating motif wherein regions of nucleosides
having a sugar moiety of Formula III alternate with differently
modified nucleosides. In certain such embodiments, oligonucleotides
have at least four, at least five, at least six, at least seven, at
least eight, an least nine, at least ten, at least eleven, or at
least twelve separate regions. In certain embodiments the separate
regions alternate between nucleosides of one type of modification
and nucleoside of a different type of modification. In certain
embodiments, the regions alternate among three types of
modifications. In certain embodiments, each region comprises
modifications that are different from the modifications of any
other region.
[0027] In certain embodiments, an oligonucleotide of the present
invention comprises at least one modified internucleoside linkage.
In certain such embodiments, at least one modified internucleoside
linkage is a phosphorothioate internucleoside linkages.
[0028] In certain embodiments, an oligonucleotide of the present
invention is an antisense compound. In certain such embodiments,
the oligonucleotide is complementary to a target nucleic acid
selected from among: target mRNA, target pre-mRNA, target microRNA,
and a target non-coding RNA. In certain embodiments, the target
nucleic acid is a mammalian target nucleic acid, including, but not
limited to a human nucleic acid, including, but not limited to a
human mRNA. In certain embodiments where an oligonucleotide of the
present invention is an antisense compound, the oligonucleotide is
at least 85%, 90%, 95%, 98%, or 100% complementary to a target
nucleic acid.
[0029] In certain embodiments, an oligonucleotide of the present
invention consisting of 8-26 linked nucleosides wherein at least
four nucleosides are bicyclic nucleoside comprising a bicyclic
sugar moiety and a nucleobase wherein none of the nucleobases of
the at least four bicyclic nucleosides has the structure of Formula
IV or Formula V:
##STR00004##
In certain embodiments, such oligonucleotides comprise at least
five bicyclic nucleosides and none of the at least five bicyclic
nucleosides has a nucleobase of structure IV or V. In certain
embodiments, such oligonucleotides comprise at least six bicyclic
nucleosides and none of the at least five bicyclic nucleosides has
a nucleobase of structure IV or V. In certain embodiments, such
oligonucleotides comprise at least seven bicyclic nucleosides and
none of the at least five bicyclic nucleosides has a nucleobase of
structure IV or V. In certain embodiments, such oligonucleotides
comprise at least eight bicyclic nucleosides and none of the at
least five bicyclic nucleosides has a nucleobase of structure IV or
V. In certain embodiments, such oligonucleotides comprise at least
nine bicyclic nucleosides and none of the at least five bicyclic
nucleosides has a nucleobase of structure IV or V. In certain
embodiments, such oligonucleotides comprise at least ten bicyclic
nucleosides and none of the at least five bicyclic nucleosides has
a nucleobase of structure IV or V. In certain such embodiments, at
least one bicyclic nucleoside comprises a nucleobase selected from
Formula I and Formula II. In certain embodiments, the sugar moiety
of such nucleosides is a 4'-2' bridged bicyclic nucleoside. In
certain embodiments, such nucleoside has formula III.
##STR00005## [0030] wherein independently for each of the at least
one bicyclic nucleoside of formula III: [0031] X is selected from
among: 4'-(CR.sub.1R.sub.2).sub.n--Y-2'; [0032] wherein each
R.sub.1 and each R.sub.2 is independently selected from among:
hydrogen, a halogen, an optionally substituted C.sub.1-C.sub.6
alkyl, an optionally substituted C.sub.2-C.sub.6 alkenyl, an
optionally substituted C.sub.2-C.sub.6 alkynyl, an optionally
substituted heteroalkyl, an optionally substituted heteroalkenyl,
and an optionally substituted heteroalkynyl; [0033] Y is selected
from among CR.sub.1R.sub.2, O, N(J), and S; [0034] T.sub.1 and
T.sub.2 are each, independently, an internucleoside linking group
linking the bicyclic nucleoside to the oligonucleotide or one of
T.sub.1 and T.sub.2 is an internucleoside linking group linking the
bicyclic nucleoside to the oligonucleotide and the other of T.sub.1
and T.sub.2 is hydroxyl, a protected hydroxyl, a linked conjugate
group or a 5' or 3'-terminal group; [0035] n is from 1 to 3; [0036]
J is hydrogen, a halogen, an optionally substituted C.sub.1-C.sub.5
alkyl, an optionally substituted C.sub.1-C.sub.5 alkenyl, an
optionally substituted C.sub.1-C.sub.5 alkynyl, an optionally
substituted heteroalkyl, an optionally substituted heteroalkenyl,
or an optionally substituted heteroalkynyl; and [0037] Bx is the
heterocyclic base moiety of Formula I or Formula II.
[0038] In certain embodiments, X is selected from among:
4'-CH.sub.2O-2', 4'-CH(CH.sub.3)O-2', and 4'-CH.sub.2CH.sub.2O-2'.
In certain embodiments, X is selected from among 4'-CH.sub.2O-2'
and 4'-CH.sub.2CH.sub.2O-2'. In certain embodiments, X is
4'-CH.sub.2O-2'. In certain embodiments, X is
4'-CH.sub.2CH.sub.2O-2'.
[0039] In any of such embodiments, the bicyclic nucleoside may be
in the .alpha.-L configuration or in the .beta.-D configuration. In
certain embodiments, the bicyclic nucleoside has the
configuration:
##STR00006##
[0040] In certain embodiments, each nucleoside of an
oligonucleotide of the present invention is a bicyclic nucleoside.
In certain such embodiments, each nucleoside comprises the same
bicyclic sugar moiety. In certain embodiments at least two
nucleosides comprise bicyclic sugar moieties that are different
from one another.
[0041] In certain embodiments, oligonucleotides of the present
invention comprise at least one non-bicyclic nucleoside. Certain
such oligonucleotides comprise at least one modified non-bicyclic
nucleoside. In certain such embodiments, at least one modified
nucleoside comprises at least one modified non-bicyclic nucleoside
selected from among: 2'-O--(CH.sub.2).sub.2--OCH.sub.3,
2'-OCH.sub.3, and 2'-F. In certain embodiments, oligonucleotides of
the present invention comprise at least one unmodified nucleoside,
such as a ribonucleoside and/or a deoxyribonucleoside.
[0042] In certain embodiments, oligonucleotides of the present
invention comprise two or more bicyclic nucleosides having a base
moiety of Formula I or I and a sugar moiety of Formula III. In
certain such embodiments, the two or more bicyclic nucleosides all
comprise the same bicyclic sugar moiety. In certain embodiments, at
least two of the two or more bicyclic nucleosides comprise bicyclic
sugar moieties that are different from one another.
[0043] In certain embodiments, oligonucleotides of the present
invention consist of 8-10 linked nucleosides. In certain
embodiments, oligonucleotides of the present invention consist of
8-10 linked nucleosides. In certain embodiments, oligonucleotides
of the present invention consist of 10-12 linked nucleosides. In
certain embodiments, oligonucleotides of the present invention
consist of 12-14 linked nucleosides. In certain embodiments,
oligonucleotides of the present invention consist of 14-16 linked
nucleosides. In certain embodiments, oligonucleotides of the
present invention consist of 16-18 linked nucleosides. In certain
embodiments, oligonucleotides of the present invention consist of
18-20 linked nucleosides. In certain embodiments, oligonucleotides
of the present invention consist of 20-22 linked nucleosides. In
certain embodiments, oligonucleotides of the present invention
consist of 22-24 linked nucleosides. In certain embodiments,
oligonucleotides of the present invention consist of 24-26 linked
nucleosides. In certain embodiments, oligonucleotides of the
present invention consist of 11-18 linked nucleosides.
[0044] In certain embodiments, oligonucleotides of the present
invention are gapmers. In certain such embodiments, such gapmers
comprise at least one bicyclic nucleoside of Formula III in at
least one wing of the gapmer. In certain embodiments, such gapmers
comprise at least one bicyclic nucleoside of Formula III in each
wing of the gapmer. In certain embodiments, each nucleoside of each
wing is a bicyclic nucleoside comprising a sugar moiety of Formula
III. In certain embodiments, such gapmers consist of 1-6
nucleosides. In certain embodiments, such gapmers consist of 1-6
nucleosides. In certain embodiments, such gapmers consist of 1-5
nucleosides. In certain embodiments, such gapmers consist of 1-4
nucleosides. In certain embodiments, such gapmers consist of 1-3
nucleosides. In certain embodiments, such gapmers consist of 1-2
nucleosides.
[0045] In certain embodiments, such gapmers consist of 1
nucleoside.
[0046] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 8-10
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 10-12
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 12-14
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 14-16
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 16-18
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 18-20
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 20-22
nucleosides. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the gap consists of 8-9 nucleosides.
In certain embodiments where an oligonucleotide of the present
invention is a gapmer, the gap consists of 9-11 nucleosides.
[0047] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the sugar modification of each
nucleoside of one wing of the gapmer and the sugar modification of
each nucleoside of the other wing of the gapmer are the same as one
another. In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the sugar modification of each
nucleoside of one wing of the gapmer and the sugar modification of
each nucleoside of the other wing of the gapmer are different from
one another.
[0048] In certain embodiments where an oligonucleotide of the
present invention is a gapmer, the nucleosides of the gap are all
unmodified nucleosides. In certain such embodiments, the
nucleosides of the gap are all deoxyribonucleosides. In certain
embodiments, the nucleosides of the gap are modified
nucleosides.
[0049] In certain embodiments, oligonucleotide of the present
invention have an alternating motif wherein regions of nucleosides
having a sugar moiety of Formula III alternate with differently
modified nucleosides. In certain such embodiments, oligonucleotides
have at least four, at least five, at least six, at least seven, at
least eight, an least nine, at least ten, at least eleven, or at
least twelve separate regions. In certain embodiments the separate
regions alternate between nucleosides of one type of modification
and nucleoside of a different type of modification. In certain
embodiments, the regions alternate among three types of
modifications. In certain embodiments, each region comprises
modifications that are different from the modifications of any
other region.
[0050] In certain embodiments, an oligonucleotide of the present
invention comprises at least one modified internucleoside linkage.
In certain such embodiments, at least one modified internucleoside
linkage is a phosphorothioate internucleoside linkages.
[0051] In certain embodiments, an oligonucleotide of the present
invention is an antisense compound. In certain such embodiments,
the oligonucleotide is complementary to a target nucleic acid
selected from among: target mRNA, target pre-mRNA, target microRNA,
and a target non-coding RNA. In certain embodiments, the target
nucleic acid is a mammalian target nucleic acid, including, but not
limited to a human nucleic acid, including, but not limited to a
human mRNA. In certain embodiments where an oligonucleotide of the
present invention is an antisense compound, the oligonucleotide is
at least 85%, 90%, 95%, 98%, or 100% complementary to a target
nucleic acid.
[0052] In certain embodiments, the invention provides oligomeric
compounds comprising an oligonucleotide of the present invention.
In certain embodiments, such oligomeric compounds comprise at least
one terminal group. In certain embodiments, such terminal group is
selected from: a conjugate group, either directly attached or
attached through a linker; a capping group, an additional modified
or unmodified nucleoside; an inverted nucleoside; and an abasic
nucleoside. In certain embodiments, such terminal group is attached
to the 3' terminal end and/or the 5' terminal end. In certain
embodiments, oligomeric compounds comprise one or more internally
attached conjugate groups.
[0053] In certain embodiments, oligomeric compounds of the present
invention are not toxic when administered to an animal, including a
mouse or human. In certain embodiments, oligomeric compounds of the
present invention are less toxic when administered to an animal
when compared to the same compound comprising one or more bicyclic
nucleosides comprising a nucleobase of Formula IV or Formula V. In
certain embodiments, oligomeric compounds of the present invention
have a MNTD of less than 66 mg/kg when administered to an animal.
In certain embodiments, oligomeric compounds of the present
invention have a MNTD of less than 33 mg/kg when administered to an
animal. In certain embodiments, oligomeric compounds of the present
invention have a MNTD of less than 1 mg/kg when administered to an
animal.
[0054] In certain embodiments, although the oligomeric compounds of
the present invention are not toxic, or less toxic compared to
counterpart oligomeric compounds comprising bicyclic nucleosides
having a nucleobase of Formula IV or V, such oligomeric compounds
of the present invention have the same or only slightly reduced
antisense activity. Accordingly, in certain embodiments, the
oligomeric compounds of the present invention have improved
therapeutic index compared to counterpart oligomeric compounds
comprising one or more bicyclic nucleoside having a nucleobase of
Formula IV or V. In certain embodiments, oligomeric compounds of
the present invention have a therapeutic index of greater than 5
when tested in an animal, including, but not limited to, a mouse or
human.
[0055] In certain embodiments, the present invention provides
methods comprising contacting a cell with an oligomeric compound
according to the present invention. In certain embodiments, such
methods include detecting antisense activity. In certain such
embodiments such detecting antisense activity comprises detecting a
phenotypic change in the cell, detecting a change in the amount of
target nucleic acid in the cell, and/or detecting a change in the
amount of a target protein. In certain embodiments, such cell is in
vitro or in an animal, such as a mouse or human.
[0056] In certain embodiments, the present invention provides
methods of modulating mRNA in a cell comprising contacting a cell
with an oligomeric compound according to the present invention. In
certain embodiments, such methods include detecting antisense
activity. In certain such embodiments such detecting antisense
activity comprises detecting a phenotypic change in the cell,
detecting a change in the amount of target nucleic acid in the
cell, and/or detecting a change in the amount of a target protein.
In certain embodiments, such cell is in vitro or in an animal, such
as a mouse or human.
[0057] In certain embodiments, the present invention provides
methods comprising administering an oligomeric compound according
to the present invention to an animal. In certain embodiments, such
methods include detecting antisense activity in the animal. In
certain such embodiments such detecting antisense activity
comprises detecting a phenotypic change in the animal. In certain
such embodiments, the phenotypic change is a change in the amount
or quality of a biological marker of activity; a change in the
amount of target nucleic acid in the animal; and/or a change in the
amount of a target protein. In certain embodiments, the animal is a
mouse or human. In certain embodiments, such methods comprising
assessing toxicity in the animal. In certain such embodiments,
assessing toxicity in the animal comprises measuring a marker for
toxicity including, but not limited to, the serum concentration of
one or more liver transaminase such as alanine aminotranferease or
aspartate aminotransferase.
[0058] In certain embodiments, the invention provides duplexes
comprising two oligomeric compounds, wherein one or both oligomeric
compounds comprises an oligonucleotide of the present
invention.
[0059] In certain embodiments, the invention provides an
oligonucleotide of Formula:
TABLE-US-00001 5'-LDLDDLLDDLDLDLL-3'
[0060] wherein, each L is a bicylcic nucleoside comprising a
bicyclic sugar moiety and a nucleobase, wherein none of the
nucleobases of the L nucleosides has the structure of Formula IV or
Formula V:
##STR00007##
[0060] and [0061] wherein each D is an unmodified
deoxynucleoside.
[0062] In certain such embodiments the sugar moiety of each L
nucleoside comprises a 4'-2' bridge having the formula:
4'-CH.sub.2O-2'.
[0063] In certain embodiments, the invention provides
oligonucleotides having the Formula:
TABLE-US-00002 5'-LLLLDDDDDDDDLLLL-3'
[0064] wherein, each L is a bicylcic nucleoside comprising a
bicyclic sugar moiety and a nucleobase, wherein none of the
nucleobases of the L nucleosides has the structure of Formula IV or
Formula V:
##STR00008##
[0064] and [0065] wherein each D is an unmodified
deoxynucleoside.
[0066] In certain such embodiments the sugar moiety of each L
nucleoside comprises a 4'-2' bridge having the formula:
4'-CH.sub.2O-2'.
[0067] In certain embodiments, the invention provides
oligonucleotides having the Formula:
5'-(L).sub.2-4(D).sub.6-14(L).sub.2-4-3' [0068] wherein, each L is
a bicylcic nucleoside comprising a bicyclic sugar moiety and a
nucleobase, wherein none of the nucleobases of the L nucleosides
has the structure of Formula IV or Formula V:
##STR00009##
[0068] and [0069] wherein each D is an unmodified
deoxynucleoside.
[0070] In certain such embodiments the sugar moiety of each L
nucleoside comprises a 4'-2' bridge having the formula:
4'-CH.sub.2O-2'.
[0071] In certain embodiments, the invention provides methods of
producing a compound having reduced toxicity when compared to a
parent compound wherein the parent compound comprises at least one
bicyclic nucleoside comprising a 5-methyl pyrimidine, comprising:
[0072] preparing a compound wherein at least one bicyclic
nucleoside comprising a 5-methyl pyrimidine in the parent is
instead a bicyclic nucleoside comprising an unmodified pyrimidine;
and [0073] thereby producing a compound having reduced toxicity
compared to the parent compound.
[0074] In certain embodiments, the invention provides methods of
treating a disease or condition in an animal comprising: [0075]
administering an oligomeric compound of the present invention to an
animal; [0076] monitoring the effect of the compound on the disease
or condition; and [0077] monitoring the animal for toxicity.
[0078] In certain embodiments, the invention provides methods of
treating a disease or condition in an animal comprising: [0079]
administering an oligomeric compound of any of claims 152-168 to an
animal; [0080] monitoring the effect of the compound on the disease
or condition; [0081] monitoring the animal for toxicity; and [0082]
calculating the therapeutic index for the oligomeric compound.
[0083] In certain embodiments, the present invention provides
pharmaceutical compositions comprising an oligomeric compound of
any of claims 152-168 and a pharmaceutically acceptable carrier or
diluent.
DETAILED DESCRIPTION OF THE INVENTION
[0084] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0085] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
DEFINITIONS
[0086] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990; and "Antisense Drug Technology, Principles,
Strategies, and Applications" Edited by Stanley T. Crooke, CRC
Press, Boca Raton, Fla.; and Sambrook et al., "Molecular Cloning, A
laboratory Manual," 2.sup.nd Edition, Cold Spring Harbor Laboratory
Press, 1989, which are hereby incorporated by reference for any
purpose. Where permitted, all patents, applications, published
applications and other publications and other data referred to
throughout in the disclosure herein are incorporated by reference
in their entirety.
[0087] Unless otherwise indicated, the following terms have the
following meanings:
[0088] As used herein, "nucleoside" refers to a glycosylamine
comprising a heterocyclic base moiety and a sugar moiety.
Nucleosides include, but are not limited to, naturally occurring
nucleosides, abasic nucleosides, modified nucleosides, and
nucleosides having mimetic bases and/or sugar groups. Nucleosides
may be modified with any of a variety of substituents.
[0089] As used herein, "nucleotide" refers to a nucleoside
comprising a phosphate linking group. As used herein, nucleosides
include nucleotides.
[0090] As used herein, "nucleobase" refers to the heterocyclic base
portion of a nucleoside. Nucleobases may be naturally occurring or
may be modified. In certain embodiments, a nucleobase may comprise
any atom or group of atoms capable of hydrogen bonding to a base of
another nucleic acid.
[0091] As used herein, "modified nucleoside" refers to a nucleoside
comprising at least one modification compared to naturally
occurring RNA or DNA nucleosides. Such modification may be at the
sugar moiety and/or at the nucleobases.
[0092] As used herein, "unmodified nucleoside" refers to an RNA or
DNA nucleoside. In certain embodiments, unmodified nucleosides may
be linked by modified internucleoside linkages.
[0093] As used herein, "bicyclic nucleoside" or "BNA" refers to a
nucleoside wherein the sugar moiety of the nucleoside comprises a
bridge connecting two carbon atoms of the sugar ring, thereby
forming a bicyclic sugar moiety.
[0094] As used herein, "4'-2' bicyclic nucleoside" refers to a
bicyclic nucleoside wherein the bridge connecting two carbon atoms
of the sugar ring connects the 2' carbon atom and the 4' carbon
atom of the sugar ring.
[0095] As used herein, "2'-modified" or "2'-substituted" refers to
a nucleoside comprising a sugar comprising a substituent at the 2'
position other than H or OH. 2'-modified nucleosides, include, but
are not limited to, bicyclic nucleosides wherein the bridge
connecting two carbon atoms of the sugar ring connects the 2'
carbon and another carbon of the sugar ring; and nucleosides with
non-bridging 2' substituents, such as allyl, amino, azido, thio,
O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3,
O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. 2'-modified nucleosides may further
comprise other modifications, for example at other positions of the
sugar and/or at the nucleobase.
[0096] As used herein, "2'-F" refers to a nucleoside comprising a
sugar comprising a fluoro group at the 2' position.
[0097] As used herein, "2'-OMe" refers to a nucleoside comprising a
sugar comprising an O-Methyl group at the 2' position.
[0098] As used herein, "MOE" refers to a nucleoside comprising a
sugar comprising a 2'-O-methoxyethyl substituent.
[0099] As used herein, "5-methyl pyrimidine bicyclic nucleoside"
refers to a nucleoside having a bicyclic sugar moiety and a
pyrimidine nucleobase comprising a methyl group at the 5
position.
[0100] As used herein, "non-methylated pyrimidine bicyclic
nucleoside" refers to a nucleoside having a bicyclic sugar moiety
and a pyrimidine nucleobase that does not comprise a methyl group
at the 5 position.
[0101] As used herein, "oligonucleotide" refers to a compound
comprising a plurality of linked nucleosides. In certain
embodiments, one or more nucleosides of an oligonucleotide is
modified. In certain embodiments, an oligonucleotide comprises one
or more ribonucleosides (RNA) and/or deoxyribonucleosides
(DNA).
[0102] As used herein "oligonucleoside" refers to an
oligonucleotide in which none of the internucleoside linkages
contains a phosphorus atom. As used herein, oligonucleotides
include oligonucleosides.
[0103] As used herein, "modified oligonucleotide" refers to an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0104] As used herein "internucleoside linkage" refers to a
covalent linkage between adjacent nucleosides.
[0105] As used herein "naturally occurring internucleoside linkage"
refers to a 3' to 5' phosphodiester linkage.
[0106] As used herein, "modified internucleoside linkage" refers to
any internucleoside linkage other than a naturally occurring
internucleoside linkage.
[0107] As used herein, "oligomeric compound" refers to a polymeric
structure comprising two or more sub-structures. In certain
embodiments, oligomeric compounds comprise an oligonucleotide. In
certain embodiments, an oligomeric compound comprises a
single-stranded oligonucleotide. In certain embodiments, oligomeric
compounds comprise one or more conjugate groups and/or terminal
groups.
[0108] As used herein, "duplex" refers to two separate oligomeric
compounds that are hybridized together.
[0109] As used herein, "terminal group" refers to one or more atom
attached to either or both the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more additional nucleosides.
[0110] As used herein, "conjugate" refers to an atom or group of
atoms bound to an oligonucleotide or oligomeric compound. In
general, conjugate groups modify one or more properties of the
compound to which they are attached, including, but not limited to
pharmakodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional linking moiety or linking group to the
parent compound such as an oligomeric compound. In certain
embodiments, conjugate groups includes without limitation,
intercalators, reporter molecules, polyamines, polyamides,
polyethylene glycols, thioethers, polyethers, cholesterols,
thiocholesterols, cholic acid moieties, folate, lipids,
phospholipids, biotin, phenazine, phenanthridine, anthraquinone,
adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
In certain embodiments, conjugates are terminal groups. In certain
embodiments, conjugates are attached to internal nucleosides of an
oligonucleotide.
[0111] As used herein, "conjugate linking group" refers to any atom
or group of atoms used to attach a conjugate to an oligonucleotide
or oligomeric compound. Linking groups or bifunctional linking
moieties such as those known in the art are amenable to the present
invention.
[0112] As used herein, "protecting group," as used herein, refers
to a labile chemical moiety which is known in the art to protect
reactive groups including without limitation, hydroxyl, amino and
thiol groups, against undesired reactions during synthetic
procedures. Protecting groups are typically used selectively and/or
orthogonally to protect sites during reactions at other reactive
sites and can then be removed to leave the unprotected group as is
or available for further reactions. Protecting groups as known in
the art are described generally in Greene and Wuts, Protective
Groups in Organic Synthesis, 3rd edition, John Wiley & Sons,
New York (1999).
[0113] As used herein, the term "orthogonally protected" refers to
functional groups which are protected with different classes of
protecting groups, wherein each class of protecting group can be
removed in any order and in the presence of all other classes (see,
Barany, G. and Merrifield, R. B., J. Am. Chem. Soc., 1977, 99,
7363; idem, 1980, 102, 3084.) Orthogonal protection is widely used
in for example automated oligonucleotide synthesis. A functional
group is deblocked in the presence of one or more other protected
functional groups which is not affected by the deblocking
procedure. This deblocked functional group is reacted in some
manner and at some point a further orthogonal protecting group is
removed under a different set of reaction conditions. This allows
for selective chemistry to arrive at a desired compound or
oligomeric compound.
[0114] As used herein, "toxic oligomeric compound" refers to an
oligomeric compound that, when administered to an animal results in
a toxic response in the animal. In certain embodiments,
administration of a toxic oligomeric compound to an animal results
in a change in one or more markers of toxicity. In certain
embodiments, a toxic oligomeric compound is a compound that results
in a toxic response in an animal when it is administered at a dose
of about 10 mg/kg, 20 mg/kg, 30 mg/kg, 33 mg/kg, 50 mg/kg, 60
mg/kg, 66 mg/kg, 100 mg/kg, 150 mg/kg, 200 mg/kg, or 500 mg/kg.
[0115] As used herein, "maximum non-toxic dose" or "MNTD" refers to
the highest dose that may be administered to an animal that does
not result in a toxic response.
[0116] As used herein, "toxic response" or "toxicity" refers to an
undesired physiological responses attributable to a administration
of a pharmaceutical agent. In certain embodiments, toxic response
includes, without limitation, injection site reactions, liver
function test abnormalities, renal function abnormalities, liver
toxicity, renal toxicity, central nervous system abnormalities, and
myopathies. For example, increased aminotransferase levels in serum
may indicate liver toxicity or liver function abnormality. For
example, increased bilirubin may indicate liver toxicity or liver
function abnormality. In certain embodiments a toxic response is
assessed by monitoring one or more markers of toxicity. In certain
embodiments, a toxic response requires a substantial change in one
or more marker of toxicity. In certain embodiments, a toxic
response is characterized by a change in a marker of toxicity of
more than 20%, more than 50%, more than 100% or more than 200%. In
certain embodiments, a marker of toxicity is elevation of the serum
concentration of one or more liver transaminase, such as alanine
aminotranferease (ALT) and aspartate aminotransferase (AST).
[0117] As used herein, "antisense compound" refers to an oligomeric
compound, at least a portion of which is at least partially
complementary to a target nucleic acid to which it hybridizes. In
certain embodiments, an antisense compound modulates (increases or
decreases) expression or amount of a target nucleic acid. In
certain embodiments, an antisense compound alters splicing of a
target pre-mRNA resulting in a different splice variant. In certain
embodiments, an antisense compound modulates expression of one or
more different target proteins.
[0118] As used herein, "antisense oligonucleotide" refers to an
antisense compound that is an oligonucleotide.
[0119] As used herein, "antisense activity" refers to any
detectable and/or measurable activity attributable to the
hybridization of an antisense compound to its target nucleic acid.
In certain embodiments, such activity may be an increase or
decrease in an amount of a nucleic acid or protein. In certain
embodiments, such activity may be a change in the ratio of splice
variants of a nucleic acid or protein. Detection and/or measuring
of antisense activity may be direct or indirect. For example, in
certain embodiments, antisense activity is assessed by detecting
and/or measuring the amount of target protein or the relative
amounts of splice variants of a target protein. In certain
embodiments, antisense activity is assessed by detecting and/or
measuring the amount of target nucleic acids and/or cleaved target
nucleic acids and/or alternatively spliced target nucleic acids. In
certain embodiments, antisense activity is assessed by observing a
phenotypic change in a cell or animal.
[0120] As used herein "detecting" or "measuring" in connection with
an activity, response, or effect indicate that a test for detecting
or measuring such activity, response, or effect is performed. Such
detection and/or measuring may include values of zero. Thus, if a
test for detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed. For example, in certain
embodiments, the present invention provides methods that comprise
steps of detecting antisense activity, detecting toxicity, and/or
measuring a marker of toxicity. Any such step may include values of
zero.
[0121] As used herein, "target nucleic acid" refers to any nucleic
acid molecule the expression, amount, or activity of which is
capable of being modulated by an antisense compound. Target nucleic
acids include, but are not limited to, RNA (including, but not
limited to pre-mRNA and mRNA or portions thereof) transcribed from
DNA encoding a target protein, and also cDNA derived from such RNA,
and miRNA. For example, the target nucleic acid can be a cellular
gene (or mRNA transcribed from the gene) whose expression is
associated with a particular disorder or disease state, or a
nucleic acid molecule from an infectious agent. In certain
embodiments, target nucleic acid is a viral or bacterial nucleic
acid.
[0122] As used herein, "target mRNA" refers to a pre-selected RNA
molecule that encodes a protein.
[0123] As used herein, "target pre-mRNA" refers to a pre-selected
RNA transcript that has not been fully processed into mRNA.
Notably, pre-RNA includes one or more intron.
[0124] As used herein, "target microRNA" refers to a pre-selected
non-coding RNA molecule about 18-30 nucleobases in length that
modulates expression of one or more proteins.
[0125] As used herein, "target pdRNA" refers to refers to a
pre-selected RNA molecule that interacts with one or more promoter
to modulate transcription.
[0126] As used herein, "target non-coding RNA" refers to a
pre-selected RNA molecule that is not translated to generate a
protein. Certain non-coding RNA are involved in regulation of
expression.
[0127] As used herein, "target viral nucleic acid" refers to a
pre-selected nucleic acid (RNA or DNA) associated with a virus.
Such viral nucleic acid includes nucleic acids that constitute the
viral genome, as well as transcripts (including reverse-transcripts
and RNA transcribed from RNA) of those nucleic acids, whether or
not produced by the host cellular machinery. In certain instances,
viral nucleic acids also include host nucleic acids that are
recruited by a virus upon viral infection.
[0128] As used herein, "targeting" or "targeted to" refers to the
association of an antisense compound to a particular target nucleic
acid molecule or a particular region of nucleotides within a target
nucleic acid molecule.
[0129] As used herein, "nucleobase complementarity" refers to a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase refers to a
nucleobase of an antisense compound that is capable of base pairing
with a nucleobase of its target nucleic acid. For example, if a
nucleobase at a certain position of an antisense compound is
capable of hydrogen bonding with a nucleobase at a certain position
of a target nucleic acid, then the position of hydrogen bonding
between the oligonucleotide and the target nucleic acid is
considered to be complementary at that nucleobase pair. Nucleobases
comprising certain modifications may maintain the ability to pair
with a counterpart nucleobase and thus, are still capable of
nucleobase complementartity.
[0130] As used herein, "non-complementary nucleobase" refers to a
pair of nucleobases that do not form hydrogen bonds with one
another or otherwise support hybridization.
[0131] As used herein, "complementary" refers to the capacity of an
oligomeric compound to hybridize to another oligomeric compound or
nucleic acid through nucleobase complementarity. In certain
embodiments, an antisense compound and its target are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleobases that can bond with
each other to allow stable association between the antisense
compound and the target. One skilled in the art recognizes that the
inclusion of mismatches is possible without eliminating the ability
of the oligomeric compounds to remain in association. Therefore,
described herein are antisense compounds that may comprise up to
about 20% nucleotides that are mismatched (i.e., are not nucleobase
complementary to the corresponding nucleotides of the target).
Preferably the antisense compounds contain no more than about 15%,
more preferably not more than about 10%, most preferably not more
than 5% or no mismatches. The remaining nucleotides are nucleobase
complementary or otherwise do not disrupt hybridization (e.g.,
universal bases). One of ordinary skill in the art would recognize
the compounds provided herein are at least 80%, at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99% or 100% complementary to a target nucleic acid.
[0132] As used herein, "hybridization" refers to the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid or an antidote to its antisense compound).
While not limited to a particular mechanism, the most common
mechanism of pairing involves hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding,
between complementary nucleoside or nucleotide bases (nucleobases).
For example, the natural base adenine is nucleobase complementary
to the natural nucleobases thymidine and uracil which pair through
the formation of hydrogen bonds. The natural base guanine is
nucleobase complementary to the natural bases cytosine and 5-methyl
cytosine. Hybridization can occur under varying circumstances.
[0133] As used herein, "specifically hybridizes" refers to the
ability of an oligomeric compound to hybridize to one nucleic acid
site with greater affinity than it hybridizes to another nucleic
acid site. In certain embodiments, an antisense oligonucleotide
specifically hybridizes to more than one target site.
[0134] As used herein, "modulation" refers to a perturbation of
amount or quality of a function or activity when compared to the
function or activity prior to modulation. For example, modulation
includes the change, either an increase (stimulation or induction)
or a decrease (inhibition or reduction) in gene expression. As
further example, modulation of expression can include perturbing
splice site selection of pre-mRNA processing, resulting in a change
in the amount of a particular splice-variant present compared to
conditions that were not perturbed.
[0135] As used herein, "chemical motif" refers to the pattern of
unmodified and/or modified and/or differently modified nucleotides
in an oligonucleotide or oligomeric compound.
[0136] As used herein, "blockmer" refers to an oligomeric compound
comprising a sequence of nucleosides having uniform modifications
that is internally interrupted by a block of two or more
differently modified nucleosides.
[0137] As used herein, "hemimer" refers to an oligomeric compound
comprising a sequence of nucleosides having uniform modifications
that is flanked at one end by a block of two or more differently
modified nucleosides.
[0138] As used herein, "gapmer" refers to an oligomeric compound
having a chemical motif comprising a central region (a "gap") and a
region on either side of the central region (the "wings"), wherein
the gap comprises at least one modification that is different from
that of each wing. Such modifications include nucleobase, monomeric
linkage, and sugar modifications as well as the absence of
modification (unmodified). Thus, in certain embodiments, the
nucleotide linkages in each of the wings are different than the
nucleotide linkages in the gap. In certain embodiments, each wing
comprises nucleotides with high affinity modifications and the gap
comprises nucleotides that do not comprise that modification. In
certain embodiments the nucleotides in the gap and the nucleotides
in the wings all comprise high affinity modifications, but the high
affinity modifications in the gap are different than the high
affinity modifications in the wings. In certain embodiments, the
modifications in the wings are the same as one another. In certain
embodiments, the modifications in the wings are different from each
other. In certain embodiments, nucleotides in the gap are
unmodified and nucleotides in the wings are modified. In certain
embodiments, the modification(s) in each wing are the same. In
certain embodiments, the modification(s) in one wing are different
from the modification(s) in the other wing. In certain embodiments,
oligomeric compounds are gapmers having 2'-deoxynucleotides in the
gap and nucleotides with high-affinity modifications in the
wing.
[0139] As used herein, "different modifications" or "differently
modified" refer to nucleosides or internucleoside linkages that
have different nucleoside modifications or internucleoside linkages
than one another, including absence of modifications. Thus, for
example, a MOE nucleoside and an unmodified DNA nucleoside are
"differently modified," even though the DNA nucleoside is
unmodified. Likewise, DNA and RNA are "differently modified," even
though both are naturally-occurring unmodified nucleosides.
[0140] As used herein, "the same modifications" refer to
nucleosides and internucleoside linkages (including unmodified
nucleosides and internucleoside linkages) that are the same as one
another. Thus, for example, two unmodified DNA nucleoside have "the
same modification," even though the DNA nucleoside is
unmodified.
[0141] As used herein, "separate regions" refers to a portion of an
oligomeric compound wherein the nucleosides and internucleoside
linkages within the region all comprise the same modifications; and
the nucleosides and/or the internucleoside linkages of any
neighboring portions include at least one different
modification.
[0142] As used herein, "alternating motif" refers to an oligomeric
compound or a portion thereof, having at lease four separate
regions of modified nucleosides in a pattern (AB).sub.nA.sub.m
where A represents a first type of modification; B represent a
different type of modification; n is 2-15; and m is 0 or 1. Thus,
in certain embodiments, alternating motifs include 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more
alternating regions. In certain embodiments, each region
independently comprises 1-4 nucleosides.
[0143] As used herein, "fully modified" refers to an oligomeric
compound or portion thereon wherein each nucleoside is a modified
nucleoside. The modifications of the nucleosides of a fully
modified oligomeric compound may all be the same or one or more may
be different from one another.
[0144] As used herein, "pharmaceutically acceptable salts" refers
to salts of active compounds that retain the desired biological
activity of the active compound and do not impart undesired
toxicological effects thereto.
[0145] As used herein, "cap structure" or "terminal cap moiety"
refers to chemical modifications incorporated at either terminus of
an antisense compound.
[0146] As used herein, "mitigation" refers to a lessening of at
least one activity or one indicator of the severity of a condition
or disease. The severity of indicators may be determined by
subjective or objective measures which are known to those skilled
in the art. In certain embodiments, the condition may be a toxic
effect of a therapeutic agent.
[0147] As used herein, "pharmaceutical agent" refers to a substance
that provides a therapeutic effect when administered to a subject.
In certain embodiments, a pharmaceutical agent provides a
therapeutic benefit. In certain embodiments, a pharmaceutical agent
provides a toxic effect.
[0148] As used herein, "therapeutic index" refers to a measure of
the therapeutic benefit of a pharmaceutical agent divided by a
measure of a toxic effect of the pharmaceutical agent.
[0149] As used herein, "therapeutically effective amount" refers to
an amount of a pharmaceutical agent that provides a therapeutic
benefit to an animal.
[0150] As used herein, "activity to toxicity ratio" refers to any
measure of antisense activity relative to any measure of
toxicity.
[0151] As used herein, "administering" refers to providing a
pharmaceutical agent to an animal, and includes, but is not limited
to administering by a medical professional and
self-administering.
[0152] As used herein, "co-administer" refers to administering more
than one pharmaceutical agent to an animal. The more than one agent
may be administered together or separately; at the same time or
different times; through the same route of administration or
through different routes of administration.
[0153] As used herein, "route of administration" refers to the
means by which a pharmaceutical agent is administered to an
animal.
[0154] As used herein, "pharmaceutical composition" refers to a
mixture of substances suitable for administering to an animal. For
example, a pharmaceutical composition may comprise an antisense
oligonucleotide and a sterile aqueous solution.
[0155] As used herein, "pharmaceutically acceptable carrier or
diluent" refers to any substance suitable for use in administering
to an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline.
[0156] As used herein, "animal" refers to a human or a non-human
animal, including, but not limited to, mice, rats, rabbits, dogs,
cats, pigs, and non-human primates, including, but not limited to,
monkeys and chimpanzees.
[0157] As used herein, "parenteral administration," refers to
administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0158] As used herein, "subcutaneous administration" refers to
administration just below the skin. "Intravenous administration"
refers to administration into a vein.
[0159] As used herein, "active pharmaceutical ingredient" refers to
the substance in a pharmaceutical composition that provides a
desired effect.
[0160] As used herein, "prodrug" refers to a therapeutic agent that
is prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions.
[0161] As used herein, "alkyl," refers to a saturated straight or
branched hydrocarbon radical containing up to twenty four carbon
atoms. Examples of alkyl groups include, but are not limited to,
methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl,
dodecyl and the like. Alkyl groups typically include from 1 to
about 24 carbon atoms, more typically from 1 to about 12 carbon
atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms
being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0162] As used herein, "alkenyl," refers to a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include, but are not limited to, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0163] As used herein, "alkynyl," refers to a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, but are not limited to, ethynyl, 1-propynyl,
1-butyryl, and the like. Alkynyl groups typically include from 2 to
about 24 carbon atoms, more typically from 2 to about 12 carbon
atoms with from 2 to about 6 carbon atoms being more preferred.
Alkynyl groups as used herein may optionally include one or more
further substituent groups.
[0164] As used herein, "aminoalkyl" refers to an amino substituted
alkyl radical. This term is meant to include C.sub.1-C.sub.12 alkyl
groups having an amino substituent at any position and wherein the
alkyl group attaches the aminoalkyl group to the parent molecule.
The alkyl and/or amino portions of the aminoalkyl group can be
further substituted with substituent groups.
[0165] As used herein, "aliphatic," refers to a straight or
branched hydrocarbon radical containing up to twenty four carbon
atoms wherein the saturation between any two carbon atoms is a
single, double or triple bond. An aliphatic group preferably
contains from 1 to about 24 carbon atoms, more typically from 1 to
about 12 carbon atoms with from 1 to about 6 carbon atoms being
more preferred. The straight or branched chain of an aliphatic
group may be interrupted with one or more heteroatoms that include
nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups
interrupted by heteroatoms include without limitation polyalkoxys,
such as polyalkylene glycols, polyamines, and polyimines. Aliphatic
groups as used herein may optionally include further substituent
groups.
[0166] As used herein, "alicyclic" or "alicyclyl" refers to a
cyclic ring system wherein the ring is aliphatic. The ring system
can comprise one or more rings wherein at least one ring is
aliphatic. Preferred alicyclics include rings having from about 5
to about 9 carbon atoms in the ring. Alicyclic as used herein may
optionally include further substituent groups.
[0167] As used herein, "alkoxy," refers to a radical formed between
an alkyl group and an oxygen atom wherein the oxygen atom is used
to attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include, but are not limited to, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0168] As used herein, "halo" and "halogen," refer to an atom
selected from fluorine, chlorine, bromine and iodine.
[0169] As used herein, "aryl" and "aromatic," refer to a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include, but are not
limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl
and the like. Preferred aryl ring systems have from about 5 to
about 20 carbon atoms in one or more rings. Aryl groups as used
herein may optionally include further substituent groups.
[0170] As used herein, "aralkyl" and "arylalkyl," refer to a
radical formed between an alkyl group and an aryl group wherein the
alkyl group is used to attach the aralkyl group to a parent
molecule. Examples include, but are not limited to, benzyl,
phenethyl and the like. Aralkyl groups as used herein may
optionally include further substituent groups attached to the
alkyl, the aryl or both groups that form the radical group.
[0171] As used herein, "heterocyclic radical" refers to a radical
mono-, or poly-cyclic ring system that includes at least one
heteroatom and is unsaturated, partially saturated or fully
saturated, thereby including heteroaryl groups. Heterocyclic is
also meant to include fused ring systems wherein one or more of the
fused rings contain at least one heteroatom and the other rings can
contain one or more heteroatoms or optionally contain no
heteroatoms. A heterocyclic group typically includes at least one
atom selected from sulfur, nitrogen or oxygen. Examples of
heterocyclic groups include, [1,3]dioxolane, pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl,
morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl,
pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as
used herein may optionally include further substitutent groups.
[0172] As used herein, "heteroaryl," and "heteroaromatic," refer to
a radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatom. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include, but are not limited
to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl,
imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl,
oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl,
benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like.
Heteroaryl radicals can be attached to a parent molecule directly
or through a linking moiety such as an aliphatic group or hetero
atom. Heteroaryl groups as used herein may optionally include
further substitutent groups.
[0173] As used herein, "heteroarylalkyl," refers to a heteroaryl
group as previously defined having an alky radical that can attach
the heteroarylalkyl group to a parent molecule. Examples include,
but are not limited to, pyridinylmethyl, pyrimidinylethyl,
napthyridinylpropyl and the like. Heteroarylalkyl groups as used
herein may optionally include further substitutent groups on one or
both of the heteroaryl or alkyl portions.
[0174] As used herein, "mono or poly cyclic structure" refers to
any ring systems that are single or polycyclic having rings that
are fused or linked and is meant to be inclusive of single and
mixed ring systems individually selected from aliphatic, alicyclic,
aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl,
heteroaromatic, heteroarylalkyl. Such mono and poly cyclic
structures can contain rings that are uniform or have varying
degrees of saturation including fully saturated, partially
saturated or fully unsaturated. Each ring can comprise ring atoms
selected from C, N, O and S to give rise to heterocyclic rings as
well as rings comprising only C ring atoms which can be present in
a mixed motif such as for example benzimidazole wherein one ring
has only carbon ring atoms and the fused ring has two nitrogen
atoms. The mono or poly cyclic structures can be further
substituted with substituent groups such as for example phthalimide
which has two .dbd.O groups attached to one of the rings. In
another aspect, mono or poly cyclic structures can be attached to a
parent molecule directly through a ring atom, through a substituent
group or a bifunctional linking moiety.
[0175] As used herein, "acyl," refers to a radical formed by
removal of a hydroxyl group from an organic acid an d has the
general formula --C(O)--X where X is typically aliphatic, alicyclic
or aromatic. Examples include aliphatic carbonyls, aromatic
carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic
sulfinyls, aromatic phosphates, aliphatic phosphates and the like.
Acyl groups as used herein may optionally include further
substitutent groups.
[0176] As used herein, "hydrocarbyl" refers to any group comprising
C, O and H. Included are straight, branched and cyclic groups
having any degree of saturation. Such hydrocarbyl groups can
include one or more heteroatoms selected from N, O and S and can be
further mono or poly substituted with one or more substituent
groups.
[0177] As used herein, "substituent" and "substituent group,"
include groups that are typically added to other groups or parent
compounds to enhance desired properties or give desired effects.
Substituent groups can be protected or unprotected and can be added
to one available site or to many available sites in a parent
compound. Substituent groups may also be further substituted with
other substituent groups and may be attached directly or via a
linking group such as an alkyl or hydrocarbyl group to a parent
compound. Unless otherwise indicated, the term substituted or
"optionally substituted" refers to the following substituents:
halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C--(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxo (--O--R.sub.aa), aryl,
aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino
(--NR.sub.bbR.sub.cc), imino (.dbd.NR.sub.bb), amido
(--C(O)NR.sub.bbR.sub.cc or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)NR.sub.bbR.sub.cc or --N(R.sub.bb)C(O)OR.sub.aa), ureido
(--N(R.sub.bb)C(O)NR.sub.bbR.sub.cc), thioureido
(--N(R.sub.bb)C--(S)NR.sub.bbR.sub.cc), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc), amidinyl
(--C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc or
--N(R.sub.bb)C(NR.sub.bb)R.sub.aa), thiol (--SR.sub.bb), sulfinyl
(--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb), sulfonamidyl
(--S(O).sub.2NR.sub.bbR.sub.cc or --N(R.sub.bb)S(O).sub.2R.sub.bb)
and conjugate groups. Wherein each R.sub.aa, R.sub.bb and R.sub.cc
is, independently, H, an optionally linked chemical functional
group or a further substituent group with a preferred list
including without limitation H, alkyl, alkenyl, alkynyl, aliphatic,
alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic
and heteroarylalkyl.
Certain Nucleosides
[0178] In certain embodiments, the present invention provides
modified nucleosides. In certain embodiments modified nucleosides
comprise a modified sugar moiety. In certain embodiments modified
nucleosides comprise a modified nucleobase. In certain embodiments
modified nucleosides comprise a modified sugar moiety and a
modified nucleobase. In certain embodiments, modified nucleosides
comprise a modified sugar moiety and a non-modified nucleobase.
Certain Modified Sugar Moieties
[0179] In certain embodiments, the present invention provides
modified nucleosides comprising a modified sugar moiety. In certain
embodiments, a modified sugar moiety is a bicyclic sugar moiety. In
certain embodiments a modified sugar moiety is a non-bicyclic
modified sugar moiety.
[0180] Certain modified sugar moiety moieties are known and can be
used to alter, typically increase, the affinity of the antisense
compound for its target and/or increase nuclease resistance. A
representative list of preferred modified sugar moieties includes
but is not limited to bicyclic modified sugar moieties (BNA's),
including methyleneoxy (4'-CH.sub.2--O-2') BNA and ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2' bridge) BNA; substituted sugar moieties,
especially 2'-substituted sugar moieties having a 2'-F,
2'-OCH.sub.3 or a 2'-O(CH.sub.2).sub.2--OCH.sub.3 substituent
group; and 4'-thio modified sugar moieties. Sugar moieties can also
be replaced with sugar moiety mimetic groups among others. Methods
for the preparations of modified sugar moieties are well known to
those skilled in the art. Some representative patents and
publications that teach the preparation of such modified sugar
moieties include, but are not limited to, U.S. Pat. Nos. 4,981,957;
5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786;
5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909;
5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633;
5,792,747; 5,700,920; 6,531,584; 6,172,209; 6,271,358; and
6,600,032; and WO 2005/121371.
Bicyclic Sugar Moieties
[0181] In certain embodiments, the present invention provides
modified nucleosides comprising a bicyclic sugar moiety. Certain
such sugar moieties have been described. See, for example: Singh et
al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron,
1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci.
U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem.
Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63,
10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-79
(Jul. 4, 2007); U.S. Pat. Nos. 7,053,207; 6,268,490; 6,770,748;
6,794,499; 7,034,133; and 6,525,191; Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
and U.S. Pat. No. 6,670,461; International applications WO
2004/106356; WO 94/14226; WO 2005/021570; each of which is
incorporated by reference in its entirety.
[0182] In certain embodiments, nucleosides comprising a bicyclic
sugar moiety have increased affinity for a complementary nucleic
acid. In certain embodiments, nucleosides comprising a bicyclic
sugar moiety provide resistance to nuclease degradation of an
oligonucleotide in which they are incorporated. For example,
methyleneoxy (4'-CH.sub.2--O-2') BNA and other bicyclic sugar
moiety analogs display duplex thermal stabilities with
complementary DNA and RNA (Tm=+3 to +10.degree. C.), stability
towards 3'-exonucleolytic degradation and good solubility
properties. Antisense oligonucleotides comprising BNAs have been
described (Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638).
[0183] Certain bicyclic-sugar moiety containing nucleosides (or BNA
nucleosides) comprise a bridge linking the 4' carbon and the 2'
carbon of the sugar moiety. In certain embodiments, the bridging
group is a methyleneoxy (4'-CH.sub.2--O-2'). In certain
embodiments, the bridging group is an ethyleneoxy
(4'-CH.sub.2CH.sub.2--O-2') (Singh et al., Chem. Commun., 1998, 4,
455-456: Morita et al., Bioorganic Medicinal Chemistry, 2003, 11,
2211-2226).
[0184] In certain embodiments, bicyclic sugar moieties of BNA
nucleosides include, but are not limited to, compounds having at
least one bridge between the 4' and the 2' position of the sugar
moiety wherein such bridges independently comprises 1 or from 2 to
4 linked groups independently selected from
--[C(R.sub.1)(R.sub.2)].sub.n--, --C(R.sub.1).dbd.C(R.sub.2)--,
--C(R.sub.1).dbd.N--, --C(.dbd.NR.sub.1)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.1).sub.2--, --S(.dbd.O).sub.x--
and --N(R.sub.1)--;
[0185] wherein:
[0186] x is 0, 1, or 2;
[0187] n is 1, 2, 3, or 4;
[0188] each R.sub.1 and R.sub.2 is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0189] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.
[0190] In certain embodiments, the bridge of a bicyclic sugar
moiety is, --[C(R.sub.1)(R.sub.2)].sub.n--,
--[C(R.sub.1)(R.sub.2)].sub.n--O--,
--C(R.sub.1R.sub.2)--N(R.sub.1)--O-- or
--C(R.sub.1R.sub.2)--O--N(R.sub.1)--. In certain embodiments, the
bridge is 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2',
4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2',
4'-(CH.sub.2).sub.2--O-2', 4'-CH.sub.2--O--N(R.sub.1)-2' and
4'-CH.sub.2--N(R.sub.1)--O-2'- wherein each R.sub.1 is,
independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.
[0191] In certain embodiments, bicyclic nucleosides are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylenoxy bridge, may be in the .alpha.-L
configuration or in the .beta.-D configuration. Previously,
alpha-L-methyleneoxy (4'-CH.sub.2--O-2') BNA's have been
incorporated into antisense oligonucleotides that showed antisense
activity (Frieden et al., Nucleic Acids Research, 2003, 21,
6365-6372).
[0192] In certain embodiments, bicyclic nucleosides include, but
are not limited to, (A) .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2')
BNA, (B) .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA, (C)
Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA and (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, as depicted below.
##STR00010##
wherein Bx is the base moiety. In certain embodiments, bicyclic
nucleosides include, but are not limited to, the structures
below:
##STR00011##
wherein Bx is the base moiety.
[0193] In certain embodiments, bicyclic nucleosides have the
formula:
##STR00012##
wherein:
[0194] Bx is a heterocyclic base moiety;
[0195] T.sub.1 is H or a hydroxyl protecting group;
[0196] T.sub.2 is H, a hydroxyl protecting group or a reactive
phosphorus group;
[0197] Z is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, or substituted amide.
[0198] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with optionally protected
substituent groups independently selected from halogen, oxo,
hydroxyl, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1.
[0199] In certain such embodiments, each of the substituted groups,
is, independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, and
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, wherein each J.sub.1, J.sub.2 and
J.sub.3 is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted
C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.1.
[0200] In certain embodiments, the Z group is C.sub.1-C.sub.6 alkyl
substituted with one or more X.sup.x, wherein each X.sup.x is
independently OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, the Z group is
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is independently halo (e.g., fluoro), hydroxyl, alkoxy
(e.g., CH.sub.3O--), substituted alkoxy or azido.
[0201] In certain embodiments, the Z group is --CH.sub.2X.sup.x,
wherein X.sup.x is OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, the Z group is
--CH.sub.2X.sup.x, wherein X.sup.x is halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0202] In certain such embodiments, the Z group is in the
(R)-configuration:
##STR00013##
[0203] In certain such embodiments, the Z group is in the
(S)-configuration:
##STR00014##
[0204] In certain embodiments, each T.sub.1 and T.sub.2 is a
hydroxyl protecting group. A preferred list of hydroxyl protecting
groups includes benzyl, benzoyl, 2,6-dichlorobenzyl,
t-butyldimethylsilyl, t-butyldiphenylsilyl, mesylate, tosylate,
dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and
9-(p-methoxyphenyl)xanthine-9-yl (MOX). In certain embodiments,
T.sub.1 is a hydroxyl protecting group selected from acetyl,
benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and
dimethoxytrityl wherein a more preferred hydroxyl protecting group
is T.sub.1 is 4,4'-dimethoxytrityl.
[0205] In certain embodiments, T.sub.2 is a reactive phosphorus
group wherein preferred reactive phosphorus groups include
diisopropylcyanoethoxy phosphoramidite and H-phosphonate. In
certain embodiments T.sub.1 is 4,4'-dimethoxytrityl and T.sub.2 is
diisopropylcyanoethoxy phosphoramidite.
[0206] In certain embodiments, oligomeric compounds have at least
one monomer of the formula:
##STR00015##
or of the formula:
##STR00016##
or of the formula:
##STR00017##
wherein
[0207] Bx is a heterocyclic base moiety;
[0208] T.sub.3 is H, a hydroxyl protecting group, a linked
conjugate group or an internucleoside linking group attached to a
nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a
monomeric subunit or an oligomeric compound;
[0209] T.sub.4 is H, a hydroxyl protecting group, a linked
conjugate group or an internucleoside linking group attached to a
nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a
monomeric subunit or an oligomeric compound;
[0210] wherein at least one of T.sub.3 and T.sub.4 is an
internucleoside linking group attached to a nucleoside, a
nucleotide, an oligonucleoside, an oligonucleotide, a monomeric
subunit or an oligomeric compound; and
[0211] Z is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, or substituted amide.
[0212] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with optionally protected
substituent groups independently selected from halogen, oxo,
hydroxyl, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3,
OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 and CN, wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1.
[0213] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, and
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, wherein each J.sub.1, J.sub.2 and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl, and X is O
or NJ.sub.1.
[0214] In certain such embodiments, at least one Z is
C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl. In
certain embodiments, each Z is, independently, C.sub.1-C.sub.6
alkyl or substituted C.sub.1-C.sub.6 alkyl. In certain embodiments,
at least one Z is C.sub.1-C.sub.6 alkyl. In certain embodiments,
each Z is, independently, C.sub.1-C.sub.6 alkyl. In certain
embodiments, at least one Z is methyl. In certain embodiments, each
Z is methyl. In certain embodiments, at least one Z is ethyl. In
certain embodiments, each Z is ethyl. In certain embodiments, at
least one Z is substituted C.sub.1-C.sub.6 alkyl. In certain
embodiments, each Z is, independently, substituted C.sub.1-C.sub.6
alkyl. In certain embodiments, at least one Z is substituted
methyl. In certain embodiments, each Z is substituted methyl. In
certain embodiments, at least one Z is substituted ethyl. In
certain embodiments, each Z is substituted ethyl.
[0215] In certain embodiments, at least one substituent group is
C.sub.1-C.sub.6 alkoxy (e.g., at least one Z is C.sub.1-C.sub.6
alkyl substituted with one or more C.sub.1-C.sub.6 alkoxy). In
another embodiment, each substituent group is, independently,
C.sub.1-C.sub.6 alkoxy (e.g., each Z is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more C.sub.1-C.sub.6
alkoxy).
[0216] In certain embodiments, at least one C.sub.1-C.sub.6 alkoxy
substituent group is CH.sub.3O-- (e.g., at least one Z is
CH.sub.3OCH.sub.2--). In another embodiment, each C.sub.1-C.sub.6
alkoxy substituent group is CH.sub.3O-- (e.g., each Z is
CH.sub.3OCH.sub.2--).
[0217] In certain embodiments, at least one substituent group is
halogen (e.g., at least one Z is C.sub.1-C.sub.6 alkyl substituted
with one or more halogen). In certain embodiments, each substituent
group is, independently, halogen (e.g., each Z is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more halogen). In
certain embodiments, at least one halogen substituent group is
fluoro (e.g., at least one Z is CH.sub.2FCH.sub.2--,
CHF.sub.2CH.sub.2-- or CF.sub.3CH.sub.2--). In certain embodiments,
each halo substituent group is fluoro (e.g., each Z is,
independently, CH.sub.2FCH.sub.2--, CHF.sub.2CH.sub.2-- or
CF.sub.3CH.sub.2--).
[0218] In certain embodiments, at least one substituent group is
hydroxyl (e.g., at least one Z is C.sub.1-C.sub.6 alkyl substituted
with one or more hydroxyl). In certain embodiments, each
substituent group is, independently, hydroxyl (e.g., each Z is,
independently, C.sub.1-C.sub.6 alkyl substituted with one or more
hydroxyl). In certain embodiments, at least one Z is HOCH.sub.2--.
In another embodiment, each Z is HOCH.sub.2--.
[0219] In certain embodiments, at least one Z is CH.sub.3--,
CH.sub.3CH.sub.2--, CH.sub.2OCH.sub.3--, CH.sub.2F-- or
HOCH.sub.2--. In certain embodiments, each Z is, independently,
CH.sub.3--, CH.sub.3CH.sub.2--, CH.sub.2OCH.sub.3--, CH.sub.2F-- or
HOCH.sub.2--.
[0220] In certain embodiments, at least one Z group is
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is, independently, OJ.sub.1, NJ.sub.1J.sub.2,
SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, at least one Z
group is C.sub.1-C.sub.6 alkyl substituted with one or more
X.sup.x, wherein each X.sup.x is, independently, halo (e.g.,
fluoro), hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0221] In certain embodiments, each Z group is, independently,
C.sub.1-C.sub.6 alkyl substituted with one or more X.sup.x, wherein
each X.sup.x is independently OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1,
N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In another embodiment, each Z group is,
independently, C.sub.1-C.sub.6 alkyl substituted with one or more
X.sup.x, wherein each X.sup.x is independently halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0222] In certain embodiments, at least one Z group is
--CH.sub.2X.sup.x, wherein X.sup.x is OJ.sub.1, NJ.sub.1J.sub.2,
SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN; wherein each J.sub.1,
J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl,
and X is O, S or NJ.sub.1. In certain embodiments, at least one Z
group is --CH.sub.2X.sup.x, wherein X.sup.x is halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0223] In certain embodiments, each Z group is, independently,
--CH.sub.2X.sup.x, wherein each X.sup.x is, independently,
OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2 or CN;
wherein each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or
C.sub.1-C.sub.6 alkyl, and X is O, S or NJ.sub.1. In another
embodiment, each Z group is, independently, --CH.sub.2X.sup.x,
wherein each X.sup.x is, independently, halo (e.g., fluoro),
hydroxyl, alkoxy (e.g., CH.sub.3O--) or azido.
[0224] In certain embodiments, at least one Z is CH.sub.3--. In
another embodiment, each Z is, CH.sub.3--.
[0225] In certain embodiments, the Z group of at least one monomer
is in the (R)-configuration represented by the formula:
##STR00018##
or the formula:
##STR00019##
or the formula:
##STR00020##
[0226] In certain embodiments, the Z group of each monomer of the
formula is in the (R)-configuration.
[0227] In certain embodiments, the Z group of at least one monomer
is in the (S)-configuration represented by the formula:
##STR00021##
or the formula:
##STR00022##
or the formula:
##STR00023##
[0228] In certain embodiments, the Z group of each monomer of the
formula is in the (S)-configuration.
[0229] In certain embodiments, T.sub.3 is H or a hydroxyl
protecting group. In certain embodiments, T.sub.4 is H or a
hydroxyl protecting group. In a further embodiment T.sub.3 is an
internucleoside linking group attached to a nucleoside, a
nucleotide or a monomeric subunit. In certain embodiments, T.sub.4
is an internucleoside linking group attached to a nucleoside, a
nucleotide or a monomeric subunit. In certain embodiments, T.sub.3
is an internucleoside linking group attached to an oligonucleoside
or an oligonucleotide. In certain embodiments, T.sub.4 is an
internucleoside linking group attached to an oligonucleoside or an
oligonucleotide. In certain embodiments, T.sub.3 is an
internucleoside linking group attached to an oligomeric compound.
In certain embodiments, T.sub.4 is an internucleoside linking group
attached to an oligomeric compound. In certain embodiments, at
least one of T.sub.3 and T.sub.4 comprises an internucleoside
linking group selected from phosphodiester or phosphorothioate.
[0230] In certain embodiments, oligomeric compounds have at least
one region of at least two contiguous monomers of the formula:
##STR00024##
or of the formula:
##STR00025##
or of the formula:
##STR00026##
[0231] The synthesis and preparation of the methyleneoxy
(4'-CH.sub.2--O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs
and preparation thereof are also described in WO 98/39352 and WO
99/14226.
[0232] Analogs of methyleneoxy (4'-CH.sub.2--O-2') BNA,
phosphorothioate-methyleneoxy (4'-CH.sub.2-0-2') BNA and
2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs comprising oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
comformationally restricted high-affinity oligonucleotide analog
has been described in the art (Singh et al., J. Org. Chem., 1998,
63, 10035-10039). In addition, 2'-Amino- and 2'-methylamino-BNA's
have been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0233] Certain Non-Bicyclic Modified Sugar Moieties
[0234] In certain embodiments, the present invention provides
modified nucleosides comprising modified sugar moieties that are
not bicyclic sugar moieties. Certain such modified nucleosides are
known. In certain embodiments, the sugar ring of a nucleoside may
be modified at any position. Examples of sugar modifications useful
in this invention include, but are not limited to compounds
comprising a sugar substituent group selected from: OH; F; O-, S-,
or N-alkyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and
alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10
alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. In certain such
embodiments, such substituents are at the 2' position of the
sugar.
[0235] In certain embodiments, modified nucleosides comprise a
substituent at the 2' position of the sugar. In certain
embodiments, such substituents are selected from among: a halide,
including, but not limited to F; allyl, amino, azido, thio,
O-allyl, O--C1-C10 alkyl, --OCF3, O--(CH2)2-O--CH3, 2'-O(CH2)2SCH3,
O--(CH2)2-O--N(Rm)(Rn), or O--CH2-C(.dbd.O)--N(Rm)(Rn), where each
Rm and Rn is, independently, H or substituted or unsubstituted
C1-C10 alkyl.
[0236] In certain embodiments, modified nucleosides suitable for
use in the present invention are: 2-methoxyethoxy (also known as
2'-O-methoxyethyl, 2'-MOE, or 2'-OCH.sub.2CH.sub.2OCH.sub.3),
2'-O-methyl (2'-O--CH.sub.3), 2'-fluoro (2'-F).
[0237] In one embodiment, modified nucleosides having a substituent
group at the 2'-position selected from:
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2,
OCH.sub.2C(.dbd.O)N(H)CH.sub.3 and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m
are from 1 to about 10. Other 2'-sugar substituent groups include:
C.sub.1 to C.sub.10 alkyl, substituted alkyl, alkenyl, alkynyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving pharmacokinetic properties, or a group for
improving the pharmacodynamic properties of an oligomeric compound,
and other substituents having similar properties.
[0238] In certain embodiments, modified nucleosides comprise a
2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272,
11944-12000). Such 2'-MOE substitution have been described as
having improved binding affinity compared to unmodified nucleosides
and to other modified nucleosides, such as 2'-O-methyl, O-propyl,
and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent
also have been shown to be antisense inhibitors of gene expression
with promising features for in vivo use (Martin, P., Helv. Chim.
Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176;
Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and
Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
[0239] In certain embodiments, 2'-Sugar substituent groups are in
either the arabino (up) position or ribo (down) position. In
certain such embodiments, a 2'-arabino modification is 2'-F arabino
(FANA). Similar modifications can also be made at other positions
on the sugar, particularly the 3' position of the sugar on a 3'
terminal nucleoside or in 2'-5' linked oligonucleotides and the 5'
position of 5' terminal nucleotide.
[0240] In certain embodiments, nucleosides suitable for use in the
present invention have sugar mimetics such as cyclobutyl moieties
in place of the pentofuranosyl sugar. Representative U.S. patents
that teach the preparation of such modified sugar structures
include, but are not limited to, U.S. Pat. Nos. 4,981,957;
5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786;
5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909;
5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633;
5,792,747; and 5,700,920, each of which is herein incorporated by
reference in its entirety.
Certain Nucleobases
[0241] In certain embodiments, nucleosides of the present invention
comprise unmodified nucleobases. In certain embodiments,
nucleosides of the present invention comprise modified
nucleobases.
[0242] In certain embodiments, nucleobase modifications can impart
nuclease stability, binding affinity or some other beneficial
biological property to the oligomeric compounds. As used herein,
"unmodified" or "natural" nucleobases include the purine bases
adenine (A) and guanine (G), and the pyrimidine bases thymine (T),
cytosine (C) and uracil (U). Modified nucleobases also referred to
herein as heterocyclic base moieties include other synthetic and
natural nucleobases, many examples of which such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, 7-deazaguanine
and 7-deazaadenine among others.
[0243] Heterocyclic base moieties can also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Certain modified nucleobases are disclosed in, for
example, Swayze, E. E. and Bhat, B., The medicinal Chemistry of
Oligonucleotides in ANTISENSE DRUG TECHNOLOGY, Chapter 6, pages
143-182 (Crooke, S. T., ed., 2008); U.S. Pat. No. 3,687,808, those
disclosed in The Concise Encyclopedia Of Polymer Science And
Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley &
Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613, and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993.
Certain of these nucleobases are particularly useful for increasing
the binding affinity of the oligomeric compounds of the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and O-6 substituted purines, including 2 aminopropyladenine,
5-propynyluracil and 5-propynylcytosine.
[0244] In certain embodiments, nucleobases comprise polycyclic
heterocyclic compounds in place of one or more heterocyclic base
moieties of a nucleobase. A number of tricyclic heterocyclic
compounds have been previously reported. These compounds are
routinely used in antisense applications to increase the binding
properties of the modified strand to a target strand. The most
studied modifications are targeted to guanosines hence they have
been termed G-clamps or cytidine analogs.
[0245] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10=O, R.sub.11-R.sub.14=H)
(Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16,
1837-1846), 1,3-diazaphenothiazine-2-one (R.sub.10=S,
R.sub.11-R.sub.14=H), (Lin, K.-Y.; Jones, R. J.; Matteucci, M. J.
Am. Chem. Soc. 1995, 117, 3873-3874) and
6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R.sub.10=O,
R.sub.11-R.sub.14=F) (Wang, J.; Lin, K.-Y., Matteucci, M.
Tetrahedron Lett. 1998, 39, 8385-8388). When incorporated into
oligonucleotides, these base modifications have been shown to
hybridize with complementary guanine and the latter was also shown
to hybridize with adenine and to enhance helical thermal stability
by extended stacking interactions (also see U.S. Patent Application
Publication 20030207804 and U.S. Patent Application Publication
20030175906, both of which are incorporated herein by reference in
their entirety).
[0246] Helix-stabilizing properties have been observed when a
cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10=O,
R.sub.11=--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14=H) (Lin,
K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532).
Binding studies demonstrated that a single incorporation could
enhance the binding affinity of a model oligonucleotide to its
complementary target DNA or RNA with a .DELTA.T.sub.m of up to
18.degree. relative to 5-methyl cytosine (dC5.sup.me), which is the
highest known affinity enhancement for a single modification. On
the other hand, the gain in helical stability does not compromise
the specificity of the oligonucleotides. The T.sub.m data indicate
an even greater discrimination between the perfect match and
mismatched sequences compared to dC5.sup.me. It was suggested that
the tethered amino group serves as an additional hydrogen bond
donor to interact with the Hoogsteen face, namely the O6, of a
complementary guanine thereby forming 4 hydrogen bonds. This means
that the increased affinity of G-clamp is mediated by the
combination of extended base stacking and additional specific
hydrogen bonding.
[0247] Tricyclic heterocyclic compounds and methods of using them
that are amenable to the present invention are disclosed in U.S.
Pat. No. 6,028,183, and U.S. Pat. No. 6,007,992, the contents of
both are incorporated herein in their entirety.
[0248] The enhanced binding affinity of the phenoxazine derivatives
together with their sequence specificity makes them valuable
nucleobase analogs for the development of more potent
antisense-based drugs. The activity enhancement was even more
pronounced in case of G-clamp, as a single substitution was shown
to significantly improve the in vitro potency of a 20mer
2'-deoxyphosphorothioate oligonucleotides (Flanagan, W. M.; Wolf,
J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci,
M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518).
[0249] Modified polycyclic heterocyclic compounds useful as
heterocyclic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S.: 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
Patent Application Publication 20030158403, each of which is
incorporated herein by reference in its entirety.
[0250] Certain nucleobase substitutions, including
5-methylcytosinse substitutions, have been shown to increase the
binding affinity of oligonucleotides comprising them. For example,
5-methylcytosine substitutions have been shown to increase nucleic
acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S.,
Crooke, S. T. and Lebleu, B., eds., Antisense Research and
Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
[0251] In certain embodiments, nucleosides of the present invention
comprise unmodified pyrimidine nucleobases. In certain embodiments,
nucleosides of the present invention are selected from Formula I
and Formula II below:
##STR00027##
Formula I represents an unmodified uracil. Formula II represents an
unmodified cytosine. In certain embodiments, nucleosides comprise
modified sugar moieties and unmodified uracil or cytosine
nucleobases.
Certain Nucleosides
[0252] In certain embodiments, the present invention provides
oligonucleotides comprising nucleosides comprising any of the above
described sugar moieties with any of the above described
nucleobases. In certain embodiments, the invention provides
nucleosides comprising a bicyclic sugar moiety and an unmodified
pyrimidine nucleobase. In certain such embodiments, the bicyclic
sugar moiety is a 4'-2' bicyclic sugar moiety. In certain
embodiments, the sugar moiety is sugar moiety having the following
Formula:
##STR00028##
wherein independently for each of the at least one bicyclic
nucleoside of formula III:
[0253] X is selected from among:
4'-(CR.sub.1R.sub.2).sub.n--Y-2';
[0254] wherein each R.sup.1 and each R.sup.2 is independently
selected from among: hydrogen, a halogen, an optionally substituted
C.sub.1-C.sub.5 alkyl, an optionally substituted C.sub.1-C.sub.5
alkenyl, an optionally substituted C.sub.1-C.sub.5 alkynyl, an
optionally substituted heteroalkyl, an optionally substituted
heteroalkenyl, and an optionally substituted heteroalkynyl;
[0255] Y is selected from among CR.sub.1R.sub.2, O, N(J), and
S;
[0256] T.sub.1 and T.sub.2 are each, independently, an
internucleoside linking group linking the bicyclic nucleoside to
the oligonucleotide or one of T.sub.1 and T.sub.2 is an
internucleoside linking group linking the bicyclic nucleoside to
the oligonucleotide and the other of T.sub.1 and T.sub.2 is
hydroxyl, a protected hydroxyl, a linked conjugate group or a 5' or
3'-terminal group;
[0257] n is from 1 to 3;
[0258] J is H, hydrogen, a halogen, an optionally substituted
C.sub.1-C.sub.5 alkyl, an optionally substituted C.sub.1-C.sub.5
alkenyl, an optionally substituted C.sub.1-C.sub.5 alkynyl, an
optionally substituted heteroalkyl, an optionally substituted
heteroalkenyl, and an optionally substituted heteroalkynyl; and
[0259] Bx is an unmodified pyrimidine.
Certain Internucleoside Linkages
[0260] In such embodiments, nucleosides may be linked together
using any internucleoside linkage. The two main classes of
internucleoside linking groups are defined by the presence or
absence of a phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H)2-O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Oligonucleotides having
non-phosphorus internucleoside linking groups may be referred to as
oligonucleosides. Modified linkages, compared to natural
phosphodiester linkages, can be used to alter, typically increase,
nuclease resistance of the oligomeric compound. In certain
embodiments, internucleoside linkages having a chiral atom can be
prepared a racemic mixtures, as separate enantomers. Representative
chiral linkages include, but are not limited to, alkylphosphonates
and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing
internucleoside linkages are well known to those skilled in the
art.
[0261] The oligomeric compounds described herein contain one or
more asymmetric centers and thus give rise to enantomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.alpha. or .beta. such as for sugar anomers, or as (D) or (L) such
as for amino acids et al. Included in the antisense compounds
provided herein are all such possible isomers, as well as their
racemic and optically pure forms.
Certain Oligonucleotides
[0262] In certain embodiments, the present invention provides
oligonucleotides comprising linked nucleosides. In certain
embodiments, any of the nucleosides described above can be linked
using any of the linkages described above to generate
oligonucleotides.
[0263] In certain embodiments, oligonucleotides of the present
invention comprise at least one nucleoside comprising a modified
sugar and an unmodified pyrimidine nucleobase. In certain
embodiments, oligonucleotides of the present invention comprise at
least one nucleoside comprising a bicyclic sugar and an unmodified
cytosine or uracil nucleobase.
[0264] In certain embodiments, the present invention provides
chimeric oligomeric compounds. In certain such embodiments,
chimeric oligomeric compounds are chimeric oligonucleotides. In
certain such embodiments, the chimeric oligonucleotides comprise
differently modified nucleotides. In certain embodiments, chimeric
oligonucleotides are mixed-backbone antisense oligonucleotides.
[0265] In general a chimeric oligomeric compound have modified
nucleosides that can be in isolated positions or grouped together
in regions that will define a particular motif. Any combination of
modifications and/or mimetic groups can comprise a chimeric
oligomeric compound as described herein.
[0266] In certain embodiments, chimeric oligomeric compounds
typically comprise at least one region modified so as to confer
increased resistance to nuclease degradation, increased cellular
uptake, and/or increased binding affinity for the target nucleic
acid. In certain embodiments, an additional region of the
oligomeric compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids.
[0267] In certain embodiments, the present invention provides
oligonucleotides of any of a variety of ranges of lengths. In
certain embodiments, the invention provides oligonucleotides and/or
oligomeric compounds consisting of X-Y linked oligonucleosides,
where X and Y are each independently selected from 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, and 50; provided that X.ltoreq.Y. For example, in
certain embodiments, the invention provides oligonucleotides and/or
oligomeric compounds consisting of: 8-9, 8-10, 8-11, 8-12, 8-13,
8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23, 8-24,
8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11, 9-12, 9-13, 9-14,
9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24, 9-25,
9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12, 10-13, 10-14, 10-15,
10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23, 10-24,
10-25, 10-26, 10-27, 10-28, 10-29, 10-30, 11-12, 11-13, 11-14,
11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22, 11-23,
11-24, 11-25, 11-26, 11-27, 11-28, 11-29, 11-30, 12-13, 12-14,
12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23,
12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15,
13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24,
13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17,
14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26,
14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20,
15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29,
15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24,
16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20,
17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29,
17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26,
18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24,
19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23,
20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23,
21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24,
22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26,
23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29,
24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29,
26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked
nucleosides.
Certain Chemical Motifs
[0268] In certain embodiments oligonucleotides of the present
invention may be described by their chemical motif. Certain
chemical motifs are known in the art.
[0269] In certain embodiments, oligonucleotides of the present
invention are fully modified motif. In certain embodiments, such
fully modified oligonucleotides are uniformly modified, wherein
each nucleoside is comprises the same modified bicyclic sugar
moiety.
[0270] In certain embodiments, oligonucleotides of the present
invention have blockmer motif. In certain such embodiments,
oligonucleotides of the present invention comprise a sequence of
.beta.-D-ribonucleosides or .beta.-D-deoxyribonucleosides having
one internal block of from 2 to 6, or from 2 to 4 sugar modified
nucleosides. The internal block region can be at any position
within the oligomeric compound as long as it is not at one of the
termini which would then make it a hemimer. The base sequence and
internucleoside linkages can vary at any position within a blockmer
motif.
[0271] In certain embodiments, the present invention provides
gapmers. In certain such embodiments, the wings of such gapmers
comprise the same modification as one another (a symmetric gapmer).
In certain embodiments, the wings of the gapmer comprise
modifications that are different from one another (asymmetric
gapmer).
[0272] In certain embodiments, the invention provides gapmers
comprising at least one nucleoside comprising a bicyclic sugar
moiety and an unmodified cytosine or uracil nucleobase. In certain
embodiments, such nucleoside is in one or both wings of the gapmer.
In certain such embodiments, the gap of the gapmer comprises
unmodified deoxyribonucleosides and/or ribonucleosides. In certain
such embodiments, one or more of the linkages is modified. In
certain such embodiments, all of the linkages are modified.
[0273] In certain embodiments, a wing of a gapmer consists of 1-5
nucleosides. In certain embodiments, a wing of a gapmer consists of
1-4 nucleosides. In certain embodiments, a wing of a gapmer
consists of 1-3 nucleosides. In certain embodiments, a wing of a
gapmer consists of 1-2 nucleosides. In certain embodiments, a wing
of a gapmer consists of one nucleoside. In certain embodiments,
each wing of a gapmer comprises the same number of nucleosides. In
certain embodiments, one wing of a gapmer comprises a different
number of nucleosides than the other wing of the gapmer. In certain
embodiments, the gap region of a gapmer consists of 5 to 23
nucleosides. In certain embodiments, the gap region of a gapmer
consists of X to Y nucleosides, where X and Y are each
independently selected from 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23; provided that X.ltoreq.Y.
[0274] In certain embodiments, oligonucleotides of the present
invention are hemimers wherein chemical modifications to sugar
moieties and/or internucleotide linkage distinguish a region of
subunits at the 5' terminus from a region of subunits at the 3'
terminus of the oligomeric compound. In certain such embodiments
one of the 5'-end or the 3'-end has a sequence of from 2 to 12
nucleosides that are sugar modified nucleosides that are different
from the other nucleosides in the hemimer modified oligomeric
compound. An example of a typical hemimer is an oligomeric compound
comprising .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides that have a sequence of sugar
modified nucleosides at one of the termini. One hemimer motif
includes a sequence of .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides having from 2-12 sugar modified
nucleosides located at one of the termini. Another hemimer motif
includes a sequence of .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides having from 2-6 sugar modified
nucleosides located at one of the termini with from 2-4 being
suitable. In certain embodiments, .beta.-D-deoxyribonucleosides
comprise less than 13 contiguous nucleotides within the oligomeric
compound. Such hemimer oligomeric compounds may comprise
phosphodiester internucleotide linkages, phosphorothioate
internucleotide linkages, or a combination of phosphodiester and
phosphorothioate internucleotide linkages.
[0275] In certain embodiments, oligonucleotides of the present
invention are positionally modified. Such positionally modified
oligonucleotides comprise one or more region of uniformly modified
nucleosides wherein the sequence is interrupted by two or more
regions of 1 to about 8 differently modified modified nucleosides.
The positionally modified motif includes internal regions of sugar
modified nucleoside and can also include one or both termini. Each
particular modification within a region of modified nucleosides
essentially uniform. In certain embodiments, the nucleosides of
regions are distinguished by differing sugar modifications.
Positionally modified motifs are not determined by the nucleobase
sequence or the location or types of internucleoside linkages. The
term positionally modified oligomeric compound includes many
different specific substitution patterns. In certain embodiments,
positionally modified oligonucleotides have clusters of a first
modification interspersed with a second modification, as follows
5'-MMmmMmMMMmmmmMMMMmmmmm-3'; and 5'-MMmMMmMMmMMmMMmMMmMMmMM-3';
wherein "M" represent the first modification, and "m" represents
the second modification. For example, in certain embodiments, "M"
could be 2'-MOE and "m" could be a bicyclic nucleoside having a
4'-(CH.sub.2).sub.n--O-2' where n is 1 or 2.
[0276] In certain embodiments, oligonucleotides of the present
invention may have an alternating motif, which comprise two
different types of nucleosides modification in alternating regions
for essentially the entire sequence of the oligonucleotide. For
example, in certain embodiments, the pattern of alternation can be
described by the formula: 5'-A(-L-B-L-A)n(-L-B)nn-3' where A and B
are nucleosides differentiated by having at least different sugar
groups, each L is an internucleoside linking group, nn is 0 or 1
and n is from about 7 to about 11. This permits alternating
oligomeric compounds from about 17 to about 24 nucleosides in
length. This length range is not meant to be limiting as longer and
shorter oligomeric compounds are also amenable to the present
invention. This formula also allows for even and odd lengths for
alternating oligomeric compounds wherein the 3' and 5'-terminal
nucleosides are the same (odd) or different (even). These
alternating oligomeric compounds may comprise phosphodiester
internucleotide linkages, phosphorothioate internucleotide
linkages, or a combination of phosphodiester and phosphorothioate
internucleotide linkages.
[0277] The "A" and "B" nucleosides comprising alternating
oligomeric compounds of the present invention are differentiated
from each other by having at least different sugar moieties. Each
of the A and B nucleosides has a modified sugar moiety selected
from .beta.-D-ribonucleosides, .beta.-D-deoxyribonucleosides,
2'-modified nucleosides (such 2'-modified nucleosides may include
2'-MOE, 2'-fluoro, and 2'-O--CH3, among others), and bicyclic sugar
modified nucleosides. The alternating motif is independent from the
nucleobase sequence and the internucleoside linkages. The
internucleoside linkage can vary at each position or at particular
selected positions or can be uniform or alternating throughout the
oligomeric compound.
Oligomeric Compounds
[0278] In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, oligomeric compounds
comprise an oligonucleotide. In certain embodiments, an oligomeric
compound comprises one or more conjugate and/or terminal group.
[0279] Such conjugate and/or terminal groups may be added to
oligomeric compounds having any of the chemical motifs discussed
above. Thus, for example, an oligomeric compound comprising a
hemimer oligonucleotide may comprise a terminal group on the same
terminal end as the block defining the hemimer and or at the other
terminal end of the hemimer oligonucleotide.
Certain Conjugate Groups
[0280] In certain embodiments, oligomeric compounds are modified by
attachment of one or more conjugate groups. In general, conjugate
groups modify one or more properties of the attached oligomeric
compound including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional conjugate linking moiety or conjugate
linking group to a parent compound such as an oligomeric compound,
such as an oligonucleotide. Conjugate groups includes without
limitation, intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, thioethers, polyethers,
cholesterols, thiocholesterols, cholic acid moieties, folate,
lipids, phospholipids, biotin, phenazine, phenanthridine,
anthraquinone, adamantane, acridine, fluoresceins, rhodamines,
coumarins and dyes. Certain conjugate groups have been described
previously, for example: cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0281] In certain embodiments, a conjugate group comprises an
active drug substance, for example, aspirin, warfarin,
phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in U.S. patent application Ser. No.
09/334,130.
[0282] Representative U.S. patents that teach the preparation of
oligonucleotide conjugates include, but are not limited to, U.S.:
4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730;
5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124;
5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;
5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;
4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;
5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667;
5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371;
5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
[0283] In certain embodiments, conjugate groups are directly
attached to oligonucleotides in oligomeric compounds. In certain
embodiments, conjugate groups are attached to oligonucleotides by a
conjugate linking group. In certain such embodiments, conjugate
linking groups, including, but not limited to, bifunctional linking
moieties such as those known in the art are amenable to the
compounds provided herein. Conjugate linking groups are useful for
attachment of conjugate groups, such as chemical stabilizing
groups, functional groups, reporter groups and other groups to
selective sites in a parent compound such as for example an
oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the conjugate linker comprises a chain
structure or an oligomer of repeating units such as ethylene glycol
or amino acid units. Examples of functional groups that are
routinely used in a bifunctional linking moiety include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like.
[0284] Some nonlimiting examples of conjugate linking moieties
include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C1-C10 alkyl,
substituted or unsubstituted C2-C10 alkenyl or substituted or
unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of
preferred substituent groups includes hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl and alkynyl.
[0285] Conjugate groups may be attached to either or both ends of
an oligonucleotide (terminal conjugate groups) and/or at any
internal position.
Terminal Groups
[0286] In certain embodiments, oligomeric compounds comprise
terminal groups at one or both ends. In certain embodiments, a
terminal group may comprise any of the conjugate groups discussed
above. In certain embodiments, terminal groups may comprise
additional nucleosides and/or inverted abasic nucleosides. In
certain embodiments, a terminal group is a stabilizing group.
[0287] In certain embodiments, oligomeric compounds comprise one or
more terminal stabilizing group that enhances properties such as
for example nuclease stability. Included in stabilizing groups are
cap structures. The terms "cap structure" or "terminal cap moiety,"
as used herein, refer to chemical modifications, which can be
attached to one or both of the termini of an oligomeric compound.
These terminal modifications protect the oligomeric compounds
having terminal nucleic acid moieties from exonuclease degradation,
and can help in delivery and/or localization within a cell. The cap
can be present at the 5'-terminus (5'-cap) or at the 3'-terminus
(3'-cap) or can be present on both termini. In non-limiting
examples, the 5'-cap includes inverted abasic residue (moiety),
4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide,
4'-thio nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol
nucleotide; L-nucleotides; alpha-nucleotides; modified base
nucleotide; phosphorodithioate linkage; threo-pentofuranosyl
nucleotide; acyclic 3',4'-seco nucleotide; acyclic
3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl
nucleotide, 3'-3'-inverted nucleotide moiety; 3'-3'-inverted abasic
moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic
moiety; 1,4-butanediol phosphate; 3'-phosphoramidate;
hexylphosphate; aminohexyl phosphate; 3'-phosphate;
3'-phosphorothioate; phosphorodithioate; or bridging or
non-bridging methylphosphonate moiety (for more details see Wincott
et al., International PCT publication No. WO 97/26270).
[0288] Particularly suitable 3'-cap structures of the present
invention include, for example 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide,
carbocyclic nucleotide; 5'-amino-alkyl phosphate;
1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxy-pentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925 and
Published U.S. Patent Application Publication No. US 2005/0020525
published on Jan. 27, 2005). Further 3' and 5'-stabilizing groups
that can be used to cap one or both ends of an oligomeric compound
to impart nuclease stability include those disclosed in WO
03/004602.
Additional Nucleosides
[0289] In certain embodiments, one or more additional nucleosides
is added to one or both terminal ends of an oligonucleotide or an
oligomeric compound. In a double-stranded compound, such additional
nucleosides are terminal (3' and/or 5') overhangs. In the setting
of double-stranded antisense compounds, such additional nucleosides
may or may not be complementary to a target nucleic acid. In a
single-stranded antisense oligomeric compound, additional
nucleosides are non-hybridizing terminal nucleosides.
Synthesis, Purification and Analysis
[0290] Oligomerization of modified and unmodified nucleosides and
nucleotides can be routinely performed according to literature
procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed.
Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001),
23, 206-217. Gait et al., Applications of Chemically synthesized
RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et
al., Tetrahedron (2001), 57, 5707-5713).
[0291] Oligomeric compounds provided herein can be conveniently and
routinely made through the well-known technique of solid phase
synthesis. Equipment for such synthesis is sold by several vendors
including, for example, Applied Biosystems (Foster City, Calif.).
Any other means for such synthesis known in the art may
additionally or alternatively be employed. It is well known to use
similar techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives. The invention is not
limited by the method of antisense compound synthesis.
[0292] Methods of purification and analysis of oligomeric compounds
are known to those skilled in the art. Analysis methods include
capillary electrophoresis (CE) and electrospray-mass spectroscopy.
Such synthesis and analysis methods can be performed in multi-well
plates. The method of the invention is not limited by the method of
oligomer purification.
Antisense
[0293] In certain embodiments, oligomeric compounds of the present
invention are antisense compounds. In such embodiments, the
oligomeric compound is complementary to a target nucleic acid. In
certain embodiments, a target nucleic acid is selected from a mRNA,
a pre-mRNA, a microRNA, a non-coding RNA, including small
non-coding RNA, and a promoter-directed RNA, each of which has been
described.
[0294] Antisense mechanisms include any mechanism involving the
hybridization of an oligomeric compound with target nucleic acid,
wherein the hybridization results in a biological effect. In
certain embodiments, such hybridization results in either target
nucleic acid degradation or occupancy with concomitant stalling of
the cellular machinery involving, for example, translation,
transcription or splicing.
[0295] One type of antisense mechanism involving degradation of
target RNA is RNase H mediated antisense. RNase H is a cellular
endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It
is known in the art that single-stranded antisense compounds which
are "DNA-like" elicit RNase H activity in mammalian cells.
Activation of RNase H, therefore, results in cleavage of the RNA
target, thereby greatly enhancing the efficiency of DNA-like
oligonucleotide-mediated inhibition of gene expression.
[0296] Antisense mechanism also include, without limitation siRNA
and RNAi mechanism. In certain instances, such mechanisms utilize
the RISC pathway.
[0297] Antisense mechanism also include, without limitation
microRNA mechanism. Such mechanism include creation of a microRNA
mimic and/or an anti-microRNA.
[0298] Antisense mechanisms also include, without limitation,
mechanisms that hybridize or mimic non-coding RNA other than
microRNA or mRNA. Such non-coding RNA includes, but is not limited
to promoter-directed RNA and short and long RNA that effects
transcription or translation of one or more nucleic acids.
[0299] In certain embodiments, antisense compounds specifically
hybridize when there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment, and under conditions in which
assays are performed in the case of in vitro assays.
[0300] As used herein, "stringent hybridization conditions" or
"stringent conditions" refers to conditions under which an
antisense compound will hybridize to its target sequence, but to a
minimal number of other sequences. Stringent conditions are
sequence-dependent and will be different in different
circumstances, and "stringent conditions" under which antisense
compounds hybridize to a target sequence are determined by the
nature and composition of the antisense compounds and the assays in
which they are being investigated.
[0301] It is understood in the art that incorporation of nucleotide
affinity modifications may allow for a greater number of mismatches
compared to an unmodified compound. Similarly, certain
oligonucleotide sequences may be more tolerant to mismatches than
other oligonucleotide sequences. One of ordinary skill in the art
is capable of determining an appropriate number of mismatches
between oligonucleotides, or between an oligonucleotide and a
target nucleic acid, such as by determining melting temperature
(T.sub.m). T.sub.m or .DELTA.T.sub.m can be calculated by
techniques that are familiar to one of ordinary skill in the art.
For example, techniques described in Freier et al. (Nucleic Acids
Research, 1997, 25, 22: 4429-4443) allow one of ordinary skill in
the art to evaluate nucleotide modifications for their ability to
increase the melting temperature of an RNA:DNA duplex.
Certain Bicyclic Nucleoside Containing Compounds
[0302] Oligomeric compounds for use as antisense compounds often
comprise pyrimidine nucleobases that are modified to include a
methyl at the C5 position (5-methyl pyrimidines). It has been
reported that such methyl modification at this position improves
affinity. See e.g., Antisense Drug Technology, Second Edition,
Crooke, Ed., page 165. It has also been reported that in certain
circumstances, such modification decreases toxicity. See, for
example, Henry et al., Chemically modified Oligonucleotides Exhibit
Decreases Immune Stimulation in Mice, J. of Phamacology and
Experimental Therapeutics, 292(2) 468-479 (2000). Since this
modification is reported to both improve affinity and reduce
toxicity, most reported antisense oligomeric compounds comprise C5
methylated pyrimidines: 5-methyl cytosine and 5-methyl uracil
(thymine).
[0303] In certain embodiments, the present invention provides
oligomeric compounds comprising at least one nucleoside comprising
a bicyclic sugar moiety and an unmodified cytosine or uracil. In
certain embodiments, such oligomeric compounds do not comprise any
nucleosides comprising a bicyclic sugar moiety and a 5-methyl
cytosine or 5-methyl uracil (thymine).
[0304] Certain oligomeric compounds comprising one or more bicyclic
nucleoside have been shown to have improved affinity for a target
nucleic acid, relative to oligomeric compounds having different
modifications or no modifications. It has also been shown that
certain such oligomeric compounds have improved in vitro and in
vivo potency compared to oligomeric compounds having different
modifications or no modifications. However, it has also been shown
that such compounds have increased toxicity when administered to
animals, compared to those differently modified oligomeric
compounds. See, e.g., Swayze, E. E., et al., Antisense
oligonucleotides containing locked nucleic acid improve potency but
cause significant hepatotoxicity in animals, Nucleic Acid Research,
Vol. 35, No. 2, 687-700 (2007).
[0305] The present invention provides certain oligomeric compounds
comprising nucleosides having bicyclic sugar moieties with reduced
toxicity. In certain embodiments, compounds of the present
invention comprising nucleosides having bicyclic sugar moieties and
pyrimidine nucleobases without methyl groups at the 5-carbon have
reduced toxicity compared to a counterpart oligomeric compound
having the same modifications except that the pyrimidines are
methylated at the 5-carbon. Thus, in certain embodiments, replacing
5-methyl cytosine and thymine of bicyclic nucleosides with
unmodified cytosine and uracil results in oligomeric compounds
having decreased toxicity. In certain embodiments, such compounds
have reduced potency compared to their methylated counterparts,
however, in such embodiments, the loss in potency is typically less
than the loss in toxicity. Accordingly, in certain embodiments,
such compounds have an improved (increased) therapeutic index. In
certain embodiments, compounds have an improved activity to
toxicity ratio.
[0306] In certain embodiments, compounds comprising bicyclic
nucleosides comprising non-methylated pyrimidines are less toxic
compared to their methylated counterparts. In certain embodiments,
such compounds are less pro-inflammatory. In certain embodiments,
such compounds are less immunostimulatory. In certain embodiments,
administration of such compounds to an animal results in reduced
undesired side-effects. For example, such compounds, in certain
embodiments results in reduced or absent enlargement of spleen,
injection site reaction, weight loss, inflammation, etc.
[0307] In certain embodiments, the present invention envisions
using bicyclic nucleosides comprising non-methylated pyrimidine
nucleobases in any application for which 5-methylated counterparts
have been used. For example, certain oligomeric compounds
comprising bicyclic nucleotides with 5-methyl pyrimidines have been
advanced as potential therapeutics. In certain embodiments, the
present invention provides less toxic counterparts to such
oligomeric compounds, wherein such less toxic counterparts are
identical to the parent oligomeric compound, except that they lack
methyl groups at the 5-positions of the pyrimidines of the bicyclic
nucleosides. In certain embodiments, such oligomeric compounds are
less toxic than their 5-methyl-pyrimidine counterparts. Thus, the
present invention provides compounds with improved toxicity
properties.
[0308] In certain embodiments, the present invention provides
methods for improving the toxic properties of a parent oligomeric
compound wherein the parent oligomeric compound comprises at least
one bicyclic nucleoside comprising a bicyclic sugar moiety and a
5-methyl pyrimidine. In certain such embodiments the invention
provides producing a less toxic counterpart compound that is the
same as the parent compound, except that one or more bicyclic
nucleobases that comprised a 5-methy pyrimidine in the parent
oligomeric compound is replaced with the same pyrimidine lacking
the 5-methyl in the less toxic counterpart oligomeric compound.
[0309] In certain embodiments, bicyclic nucleosides without
5-methyl modifications on the pyrimidines may be incorporated into
oligonucleotides having any chemical motif. Thus, for example, in
certain embodiments, the present invention provides oligomeric
compounds comprising gapmers, wherein the nucleosides of the wings
of the gapmer comprise bicyclic sugar moieties, wherein the
nucleobases of those nucleosides are not 5-methyl cytosine or
thymine. In such embodiments, the nucleosides of the gap may be
modified or unmodified and may include 5-methyl cytosine and/or
thymine nucleobases. In certain embodiments, oligomeric compounds
of the present invention are fully modified. In certain such
embodiments, each nucleoside is a bicyclic nucleoside and none of
the nucleobases is a 5-methyl pyrimidine.
[0310] In certain embodiments, oligomeric compounds comprise one or
more bicyclic nucleoside wherein the sugar bridge is
4'-CH.sub.2O-2' and none of the nucleobases of any of those one or
more nucleosides is a 5-methyl cytosine or a thymine. In certain
embodiments, oligomeric compounds comprise one or more bicyclic
nucleoside wherein the sugar bridge is 4'-CH.sub.2CH.sub.2O-2' and
none of the nucleobases of any of those one or more nucleosides is
a 5-methyl cytosine or a thymine.
[0311] Use of pyrimidine nucleosides modified to include a methyl
group at the 5C position improves affinity of antisense compounds
to their target. Such modified pyrimidines have not been reported
to cause toxicity and have been reported to reduce immune
stimulation in mice. Consequently, such nucleosides are routinely
used in the antisense art. Incorporation of certain bicyclic
nucleosides results in antisense compounds having good affinity and
potency. However the therapeutic potential of such compounds is
diminished by their toxicity. In certain embodiments of the present
invention, it is shown that oligomeric compounds comprising
bicyclic nucleosides lacking the standard methyl group at the 5C
position of pyrimidines have reduced toxicity. Further, such
compounds have no loss or only slight loss in activity and potency.
Thus, the therapeutic index of such compounds is improved compared
to their counterparts comprising 5-methyl pyrimidine bicyclic
nucleosides. In certain embodiments, any parent oligomeric compound
comprising one or more bicyclic pyrimidine nucleoside comprising a
methyl group at the 5C position can be made less toxic by removal
of the 5-methyl. Thus, in certain embodiments, the present
invention provides methods of preparing an oligomeric compound
having reduced toxicity compared to a parent compound wherein the
parent compound comprises at least one 5-methyl pyrimidine bicyclic
nucleoside, comprising preparing the same oligomeric compound
except that the at least one 5-methyl pyrimidine bicyclic
nucleoside is replaced with the same pyrimidine bicyclic nucleoside
lacking a 5-methyl.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0312] Oligomeric compounds may be admixed with pharmaceutically
acceptable active and/or inert substances for the preparation of
pharmaceutical compositions or formulations. Compositions and
methods for the formulation of pharmaceutical compositions are
dependent upon a number of criteria, including, but not limited to,
route of administration, extent of disease, or dose to be
administered.
[0313] Oligomeric compounds, including antisense compounds and/or
antidote compounds, can be utilized in pharmaceutical compositions
by combining such oligomeric compounds with a suitable
pharmaceutically acceptable diluent or carrier. A pharmaceutically
acceptable diluent includes phosphate-buffered saline (PBS). PBS is
a diluent suitable for use in compositions to be delivered
parenterally. Accordingly, in one embodiment, employed in the
methods described herein is a pharmaceutical composition comprising
an antisense compound and/or antidote compound and a
pharmaceutically acceptable diluent. In certain embodiments, the
pharmaceutically acceptable diluent is PBS.
[0314] Pharmaceutical compositions comprising oligomeric compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising oligomeric compounds comprise one or more
oligonucleotide which, upon administration to an animal, including
a human, is capable of providing (directly or indirectly) the
biologically active metabolite or residue thereof. Accordingly, for
example, the disclosure is also drawn to pharmaceutically
acceptable salts of antisense compounds, prodrugs, pharmaceutically
acceptable salts of such prodrugs, and other bioequivalents.
Suitable pharmaceutically acceptable salts include, but are not
limited to, sodium and potassium salts.
[0315] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
oligomeric compound.
Nonlimiting Disclosure and Incorporation by Reference
[0316] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
[0317] The nucleoside sequences set forth in the sequence listing
and Examples, are independent of any modification to a sugar
moiety, a monomeric linkage, or a nucleobase. As such, oligomeric
compounds defined by a SEQ ID NO may comprise, independently, one
or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase. Oligomeric compounds described by Isis
Number (Isis NO.) indicate a combination of nucleobase sequence and
one or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase, as indicated.
[0318] The sequence listing accompanying this filing provides
certain nucleic acid sequences independent of chemical
modification. Though that listing identifies each sequence as
either "RNA" or "DNA" as required, in reality, those sequences may
be modified with any combination of chemical modifications and/or
motifs. One of skill in the art will readily appreciate that such
designation as "RNA" or "DNA" to describe modified oligonucleotides
is, in certain instances, arbitrary. For example, an
oligonucleotide comprising a nucleoside comprising a 2'-OH sugar
moiety and a thymine base could be described as a DNA having a
modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA
having a modified base (thymine (methylated uracil) for natural
uracil of RNA).
[0319] All publications, patents, and patent applications
referenced herein are incorporated by reference. While in the
foregoing specification this invention has been described in
relation to certain preferred embodiments thereof, and many details
have been set forth for purposes of illustration, it will be
apparent to those skilled in the art that the invention is
susceptible to additional embodiments and that certain of the
details described herein may be varied considerably without
departing from the basic principles of the invention.
EXAMPLES
Examples
General
[0320] .sup.1H and .sup.13C NMR spectra were recorded on a 300 MHz
and 75 MHz Bruker spectrometer, respectively.
Example 1
Synthesis of Nucleoside Phosphoramidites
[0321] The preparation of nucleoside phosphoramidites is performed
following procedures that are illustrated herein and in the art
such as but not limited to U.S. Pat. No. 6,426,220 and published
PCT WO 02/36743.
Example 2
Oligonucleoside Synthesis
[0322] The oligomeric compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0323] Oligonucleotides: Unsubstituted and substituted
phosphodiester (P.dbd.O) oligonucleotides can be synthesized on an
automated DNA synthesizer (Applied Biosystems model 394) using
standard phosphoramidite chemistry with oxidation by iodine.
[0324] Phosphorothioates (P.dbd.S) are synthesized similar to
phosphodiester oligonucleotides with the following exceptions:
thiation is effected by utilizing a 10% w/v solution of
3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the
oxidation of the phosphite linkages. The thiation reaction step
time is increased to 180 sec and preceded by the normal capping
step. After cleavage from the CPG column and deblocking in
concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the
oligonucleotides are recovered by precipitating with greater than 3
volumes of ethanol from a 1 M NH.sub.4OAc solution. Phosphinate
oligonucleotides can be prepared as described in U.S. Pat. No.
5,508,270.
[0325] Alkyl phosphonate oligonucleotides can be prepared as
described in U.S. Pat. No. 4,469,863.
[0326] 3'-Deoxy-3'-methylene phosphonate oligonucleotides can be
prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050.
[0327] Phosphoramidite oligonucleotides can be prepared as
described in U.S. Pat. No. 5,256,775 or U.S. Pat. No.
5,366,878.
[0328] Alkylphosphonothioate oligonucleotides can be prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively).
[0329] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides can be
prepared as described in U.S. Pat. No. 5,476,925.
[0330] Phosphotriester oligonucleotides can be prepared as
described in U.S. Pat. No. 5,023,243.
[0331] Borano phosphate oligonucleotides can be prepared as
described in U.S. Pat. Nos. 5,130,302 and 5,177,198.
[0332] Oligonucleosides: Methylenemethylimino linked
oligonucleosides, also identified as MMI linked oligonucleosides,
methylenedimethylhydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone oligomeric compounds
having, for instance, alternating MMI and P.dbd.O or P.dbd.S
linkages can be prepared as described in U.S. Pat. Nos. 5,378,825,
5,386,023, 5,489,677, 5,602,240 and 5,610,289.
[0333] Formacetal and thioformacetal linked oligonucleosides can be
prepared as described in U.S. Pat. Nos. 5,264,562 and
5,264,564.
[0334] Ethylene oxide linked oligonucleosides can be prepared as
described in U.S. Pat. No. 5,223,618.
Example 3
Oligonucleotide Isolation
[0335] After cleavage from the controlled pore glass solid support
and deblocking in concentrated ammonium hydroxide at 55.degree. C.
for 12-16 hours, the oligonucleotides or oligonucleosides are
recovered by precipitation out of 1 M NH.sub.4OAc with >3
volumes of ethanol. Synthesized oligonucleotides are analyzed by
electrospray mass spectroscopy (molecular weight determination) and
by capillary gel electrophoresis. The relative amounts of
phosphorothioate and phosphodiester linkages obtained in the
synthesis is determined by the ratio of correct molecular weight
relative to the -16 amu product (+/-32+/-48). For some studies
oligonucleotides are purified by HPLC, as described by Chiang et
al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with
HPLC-purified material are generally similar to those obtained with
non-HPLC purified material.
Example 4
Oligonucleotide Synthesis
96 Well Plate Format
[0336] Oligonucleotides can be synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a 96-well format.
Phosphodiester internucleotide linkages are afforded by oxidation
with aqueous iodine. Phosphorothioate internucleotide linkages are
generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites are
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per standard or patented methods.
They are utilized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0337] Oligonucleotides are cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product is then re-suspended in sterile water to afford a
master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 5
Oligonucleotide Analysis Using 96-Well Plate Format
[0338] The concentration of oligonucleotide in each well is
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products is evaluated by
capillary electrophoresis (CE) in either the 96-well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition is confirmed by mass analysis of the
oligomeric compounds utilizing electrospray-mass spectroscopy. All
assay test plates are diluted from the master plate using single
and multi-channel robotic pipettors. Plates are judged to be
acceptable if at least 85% of the oligomeric compounds on the plate
are at least 85% full length.
Example 6
Cell Culture and Oligonucleotide Treatment
[0339] The effect of oligomeric compounds on target nucleic acid
expression is tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. Cell lines derived from multiple tissues and species
can be obtained from American Type Culture Collection (ATCC,
Manassas, Va.).
[0340] The following cell type is provided for illustrative
purposes, but other cell types can be routinely used, provided that
the target is expressed in the cell type chosen. This can be
readily determined by methods routine in the art, for example
Northern blot analysis, ribonuclease protection assays or
RT-PCR.
[0341] b.END cells: The mouse brain endothelial cell line b.END was
obtained from Dr. Werner Risau at the Max Plank Institute (Bad
Nauheim, Germany). b.END cells were routinely cultured in DMEM,
high glucose (Invitrogen Life Technologies, Carlsbad, Calif.)
supplemented with 10% fetal bovine serum (Invitrogen Life
Technologies, Carlsbad, Calif.). Cells were routinely passaged by
trypsinization and dilution when they reached approximately 90%
confluence. Cells were seeded into 96-well plates (Falcon-Primaria
#353872, BD Biosciences, Bedford, Mass.) at a density of
approximately 3000 cells/well for uses including but not limited to
oligomeric compound transfection experiments.
[0342] Experiments involving treatment of cells with oligomeric
compounds:
[0343] When cells reach appropriate confluency, they are treated
with oligomeric compounds using a transfection method as
described.
[0344] LIPOFECTIN.TM.
[0345] When cells reached 65-75% confluency, they are treated with
oligonucleotide. Oligonucleotide is mixed with LIPOFECTIN.TM.
Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM.TM.-1
reduced serum medium (Invitrogen Life Technologies, Carlsbad,
Calif.) to achieve the desired concentration of oligonucleotide and
a LIPOFECTIN.TM. concentration of 2.5 or 3 .mu.g/mL per 100 nM
oligonucleotide. This transfection mixture is incubated at room
temperature for approximately 0.5 hours. For cells grown in 96-well
plates, wells are washed once with 100 .mu.L OPTI-MEM.TM.-1 and
then treated with 130 .mu.L of the transfection mixture. Cells
grown in 24-well plates or other standard tissue culture plates are
treated similarly, using appropriate volumes of medium and
oligonucleotide. Cells are treated and data are obtained in
duplicate or triplicate. After approximately 4-7 hours of treatment
at 37.degree. C., the medium containing the transfection mixture is
replaced with fresh culture medium. Cells are harvested 16-24 hours
after oligonucleotide treatment.
[0346] Other suitable transfection reagents known in the art
include, but are not limited to, CYTOFECTIN.TM., LIPOFECTAMINE.TM.,
OLIGOFECTAMINE.TM., and FUGENE.TM.. Other suitable transfection
methods known in the art include, but are not limited to,
electroporation.
Example 7
Real-Time Quantitative PCR Analysis of Target mRNA Levels
[0347] Quantitation of a target mRNA levels was accomplished by
real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied
Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda,
Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is
attached to the 5' end of the probe and a quencher dye (e.g.,
TAMRA, obtained from either PE-Applied Biosystems, Foster City,
Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA
Technologies Inc., Coralville, Iowa) is attached to the 3' end of
the probe. When the probe and dyes are intact, reporter dye
emission is quenched by the proximity of the 3' quencher dye.
During amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. Sequence Detection System. In
each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0348] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0349] RT and PCR reagents were obtained from Invitrogen Life
Technologies (Carlsbad, Calif.). RT, real-time PCR was carried out
by adding 20 .mu.L PCR cocktail (2.5.times.PCR buffer minus
MgCl.sub.2, 6.6 mM MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP
and dGTP, 375 nM each of forward primer and reverse primer, 125 nM
of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5
Units MuLV reverse transcriptase, and 2.5.times.ROX dye) to 96-well
plates containing 30 .mu.L total RNA solution (20-200 ng). The RT
reaction was carried out by incubation for 30 minutes at 48.degree.
C. Following a 10 minute incubation at 95.degree. C. to activate
the PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol were
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/extension).
[0350] Gene target quantities obtained by RT, real-time PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RIBOGREEN.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA
quantification by RIBOGREEN.TM. are taught in Jones, L. J., et al,
(Analytical Biochemistry, 1998, 265, 368-374).
[0351] In this assay, 170 .mu.L of RIBOGREEN.TM. working reagent
(RIBOGREEN.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 485 nm and emission at 530
nm.
Example 8
Analysis of Oligonucleotide Inhibition of a Target Expression
[0352] Antisense modulation of a target expression can be assayed
in a variety of ways known in the art. For example, a target mRNA
levels can be quantitated by, e.g., Northern blot analysis,
competitive polymerase chain reaction (PCR), or real-time PCR.
Real-time quantitative PCR is presently desired. RNA analysis can
be performed on total cellular RNA or poly(A)+mRNA. One method of
RNA analysis of the present invention is the use of total cellular
RNA as described in other examples herein. Methods of RNA isolation
are well known in the art. Northern blot analysis is also routine
in the art. Real-time quantitative (PCR) can be conveniently
accomplished using the commercially available ABI PRISM.TM. 7600,
7700, or 7900 Sequence Detection System, available from PE-Applied
Biosystems, Foster City, Calif. and used according to
manufacturer's instructions.
[0353] Protein levels of a target can be quantitated in a variety
of ways well known in the art, such as immunoprecipitation, Western
blot analysis (immunoblotting), enzyme-linked immunosorbent assay
(ELISA) or fluorescence-activated cell sorting (FACS). Antibodies
directed to a target can be identified and obtained from a variety
of sources, such as the MSRS catalog of antibodies (Aerie
Corporation, Birmingham, Mich.), or can be prepared via
conventional monoclonal or polyclonal antibody generation methods
well known in the art. Methods for preparation of polyclonal
antisera are taught in, for example, Ausubel, F. M. et al., Current
Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John
Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies
is taught in, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley
& Sons, Inc., 1997.
[0354] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 9
Design of Phenotypic Assays and In Vivo Studies for the Use of
Target Inhibitors
Phenotypic Assays
[0355] Once target inhibitors have been identified by the methods
disclosed herein, the oligomeric compounds are further investigated
in one or more phenotypic assays, each having measurable endpoints
predictive of efficacy in the treatment of a particular disease
state or condition.
[0356] Phenotypic assays, kits and reagents for their use are well
known to those skilled in the art and are herein used to
investigate the role and/or association of a target in health and
disease. Representative phenotypic assays, which can be purchased
from any one of several commercial vendors, include those for
determining cell viability, cytotoxicity, proliferation or cell
survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston,
Mass.), protein-based assays including enzymatic assays (Panvera,
LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene
Research Products, San Diego, Calif.), cell regulation, signal
transduction, inflammation, oxidative processes and apoptosis
(Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation
(Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube
formation assays, cytokine and hormone assays and metabolic assays
(Chemicon International Inc., Temecula, Calif.; Amersham
Biosciences, Piscataway, N.J.).
[0357] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with a target inhibitors identified from the in vitro
studies as well as control compounds at optimal concentrations
which are determined by the methods described above. At the end of
the treatment period, treated and untreated cells are analyzed by
one or more methods specific for the assay to determine phenotypic
outcomes and endpoints.
[0358] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0359] Measurement of the expression of one or more of the genes of
the cell after treatment is also used as an indicator of the
efficacy or potency of the a target inhibitors. Hallmark genes, or
those genes suspected to be associated with a specific disease
state, condition, or phenotype, are measured in both treated and
untreated cells.
In Vivo Studies
[0360] The individual subjects of the in vivo studies described
herein are warm-blooded vertebrate animals, which includes
humans.
Example 10
RNA Isolation
[0361] Poly(A)+mRNA Isolation
[0362] Poly(A)+mRNA is isolated according to Miura et al., (Clin.
Chem., 1996, 42, 1758-1764). Other methods for poly(A)+mRNA
isolation are routine in the art. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) is added to each well, the plate is
gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate is transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for
60 minutes at room temperature, washed 3 times with 200 .mu.L of
wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After
the final wash, the plate is blotted on paper towels to remove
excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of
elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C.,
is added to each well, the plate is incubated on a 90.degree. C.
hot plate for 5 minutes, and the eluate is then transferred to a
fresh 96-well plate.
[0363] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Total RNA Isolation
[0364] Total RNA is isolated using an RNEASY 96.TM. kit and buffers
purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT is
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol is then added to each well and
the contents mixed by pipetting three times up and down. The
samples are then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum is applied for 1
minute. 500 .mu.L of Buffer RW1 is added to each well of the RNEASY
96.TM. plate and incubated for 15 minutes and the vacuum is again
applied for 1 minute. An additional 500 .mu.L of Buffer RW1 is
added to each well of the RNEASY 96.TM. plate and the vacuum is
applied for 2 minutes. 1 mL of Buffer RPE is then added to each
well of the RNEASY 96.TM. plate and the vacuum applied for a period
of 90 seconds. The Buffer RPE wash is then repeated and the vacuum
is applied for an additional 3 minutes. The plate is then removed
from the QIAVAC.TM. manifold and blotted dry on paper towels. The
plate is then re-attached to the QIAVAC.TM. manifold fitted with a
collection tube rack containing 1.2 mL collection tubes. RNA is
then eluted by pipetting 140 .mu.L of RNAse free water into each
well, incubating 1 minute, and then applying the vacuum for 3
minutes.
[0365] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 11
Target-Specific Primers and Probes
[0366] Probes and primers may be designed to hybridize to a target
sequence, using published sequence information.
[0367] For example, for human PTEN, the following primer-probe set
was designed using published sequence information (GENBANK.TM.
accession number U92436.1, SEQ ID NO: 1).
TABLE-US-00003 Forward primer: (SEQ ID NO: 2)
AATGGCTAAGTGAAGATGACAATCAT Reverse primer: (SEQ ID NO: 3)
TGCACATATCATTACACCAGTTCGT
And the PCR probe:
[0368] FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO: 4),
where FAM is the fluorescent dye and TAMRA is the quencher dye.
Example 12
Western Blot Analysis of Target Protein Levels
[0369] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on
a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to a target is used, with a radiolabeled or
fluorescently labeled secondary antibody directed against the
primary antibody species. Bands are visualized using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Example 13
4'-CH.sub.2--O-2' BNA Gapped Oligomeric Compounds Targeted to
PTEN
In Vivo Study
[0370] In accordance with the present invention, oligomeric
compounds were synthesized and tested for their ability to reduce
PTEN expression in vivo at doses of 20 and 60 mg/kg. Six week old
male Balb/c mice (Jackson Laboratory, Bar Harbor, Me.) were
administered a single intraperitoneal (i.p) injection at either 20
or 60 mg/kg of 4'-CH.sub.2--O-2' BNA 2-10-2 gapped oligomers
(392063 and 392745). The 4'-CH.sub.2--O-2' BNA gapped oligomer,
392745, contains non-methylated pyrimidine in the wings. The
4'-CH.sub.2--O-2' BNA gapped oligomer, 392063, contains methylated
pyrimidine in the wings (i.e. each cytosine residues in the
4'-CH.sub.2--O-2' BNA wings of 392745 are replaced with
5-methylcytosines, while the thymidine residues in the
4'-CH.sub.2--O-2' BNA wings of 392745 are replaced with 5-methyl
thymidines). All internucleoside linkages are phosphorothioates,
nucleosides not followed by a subscript are
.beta.-D-2'-deoxyribonucleosides, nucleosides followed by a
subscript 1 are 4'-CH.sub.2--O-2' modified bicyclic nucleosides and
.sup.MeC indicates a 5'-methyl cytosine nucleoside.
TABLE-US-00004 SEQ ID NO./ Composition Wing ISIS NO. (5' to 3')
Chemistry 5/392745 C.sub.1U.sub.1TAGCACTGGCC.sub.1U.sub.1
4'-CH.sub.2-O-2' BNA (U/C) 6/392063
.sup.MeC.sub.1T.sub.1TAGCACTGGC.sup.MeC.sub.1T.sub.1
4'-CH.sub.2-O-2' BNA (T/.sup.MeC)
[0371] Each dose group consisted of four animals. The mice were
sacrificed 72 hours following the final administration to determine
the PTEN mRNA levels in liver using real-time PCR and
RIBOGREEN.RTM. RNA quantification reagent (Molecular Probes, Inc.
Eugene, Oreg.) according to standard protocols. PTEN mRNA levels
were determined relative to total RNA (using Ribogreen), prior to
normalization to saline-treated control. Results are listed below
as the average % inhibition of mRNA expression for each treatment
group, normalized to saline-injected control. Resulting
dose-response curves were used to determine the IC.sub.50. Tm's
were assessed in 100 mM phosphate buffer, 0.1 mM EDTA, pH 7, at 260
nm using 404 modified oligomers and 404 complementary RNA. The
activities are listed below.
TABLE-US-00005 SEQ ID NO./ Dose IC50 ISIS NO. (mg/kg) % inhibition
(nM) Tm (.degree. C.) 6/392063 20 86 5.8 60.5 60 92 5/392745 20 89
6.8; 6.2 58.6 60 92
[0372] Liver transaminase levels, alanine aminotranferease (ALT)
and aspartate aminotransferase (AST), in serum were also measured
relative to saline injected mice. Increases in the transaminase
levels can indicate hepatotoxicity. The transaminase levels
measured for mice treated with the 2-10-2 gapped oligomers
comprising LNA nucleosides (both 392063 and 392745) at lower doses
(20 mg/kg) were not elevated to a level indicative of
hepatotoxicity with respect to saline treated control. Treatment
with 60 mg/kg does of 392063 substantially increased ALT and AST
levels. The ALT and AST levels measured for mice treated with 60
mg/kg does of 392745 were decreased about 4.5-fold and 3 fold as
compared to 392063 treatment. The approximate liver transaminase
levels are listed below.
TABLE-US-00006 SEQ ID NO./ Dose ISIS NO. (mg/kg) AST (IU/L) ALT
(IU/L) saline n/a 68 24 6/392063 20 56 28 60 598 489 5/392745 20 81
29 60 202 108
[0373] The effects on liver, kidney, spleen weights and body weight
gain were also determined. Approximate average tissue weights and
body weight gain for each treatment group are presented in the
table below. As show, treatment with the 2-10-2 gapped oligomers
comprising LNA nucleosides (both 392063 and 392745) did not
substantially alter liver, kidney, spleen weights or body weight
gain in normal mice as compared to the organ weights of mice
treated with saline alone.
TABLE-US-00007 SEQ ID NO./ Dose Body weight ISIS NO. (mg/kg) Liver
Kidney Spleen gain Saline 1.00 1.00 1.00 1.05 6/392063 20 1.22 1.02
0.99 1.05 60 1.29 1.00 1.11 0.99 5/392745 20 1.22 1.02 1.14 1.06 60
1.25 1.02 1.12 1.01
Example 14
4'-CH.sub.2--O-2', 4'-CH.sub.2CH.sub.2--O-2' BNA 2-10-2 Gapped
Oligomeric Compounds Targeted to PTEN: In Vivo Study
[0374] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal (i.p)
injection with 4'-CH.sub.2--O-2' BNA containing oligomers (392745
and 392063) and 6(S)-4'-CH(CH.sub.3)--O-2' BNA containing oligomers
(392749 and 411847) at a does of 3.2, 10, 32, 66 and 100 mg/kg.
Oligomers 392063 and 411847 contain LNA nucleosides with methylated
pyrimidines, and oligomers 392745 and 392749 contain LNA
nucleosides with non-methylated pyrimidines in the wings. All
internucleoside linkages are phosphorothioates, nucleosides not
followed by a subscript are .beta.-D-2'-deoxyribonucleosides,
nucleosides followed by a subscript 1 are 4'-CH.sub.2--O-2'
modified bicyclic nucleosides, nucleosides followed by a subscript
S are 6(S)-4'-CH(CH.sub.3)--O-2' modified bicyclic nucleosides
wherein S indicates the configuration at the 6 carbon atom and
.sup.MeC indicates a 5'-methyl cytosine nucleoside.
TABLE-US-00008 SEQ ID NO./ Composition Wing ISIS NO. (5' to 3')
Chemistry 5/392745 C.sub.1U.sub.1TAGCACTGGCC.sub.1U.sub.1
4'-CH.sub.2-O-2' BNA (U/C) 6/392063
.sup.MeC.sub.1T.sub.1TAGCACTGGC.sup.MeC.sub.1T.sub.1
4'-CH.sub.2-O-2' BNA (T/.sup.MeC) 5/392749
C.sub.SU.sub.STAGCACTGGCC.sub.SU.sub.S 6(S)-CH.sub.2-O-CH.sub.3 BNA
(U/C) 6/411847 .sup.MeC.sub.ST.sub.STAGCACTGGC.sup.MeC.sub.ST.sub.S
6(S)-CH.sub.2-O-CH.sub.3 BNA (T/.sup.MeC)
[0375] Each dose group consisted of four animals. The mice were
sacrificed 72 hours following the final administration to determine
the PTEN mRNA levels in liver using real-time PCR and
RIBOGREEN.RTM. RNA quantification reagent (Molecular Probes, Inc.
Eugene, Oreg.) according to standard protocols. PTEN mRNA levels
were determined relative to total RNA (using Ribogreen), prior to
normalization to saline-treated control. Results are listed below
as the average % inhibition of mRNA expression for each treatment
group, normalized to saline-injected control.
TABLE-US-00009 SEQ ID NO./ PTEN mRNA levels (% inhibition) ISIS NO.
3.2 mg/kg 10 mg/kg 32 mg/kg 66 mg/kg 100 mg/kg 5/392745 0 58 90 90
93 6/392063 0 68 88 90 91 7/392749 14 20 81 92 93 8/411847 0 32 87
84 92
[0376] Estimated ED.sub.50 concentrations for each oligomers were
calculated using Graphpad Prism. ED.sub.50 is the dose at which 50%
mRNA reduction is observed.
TABLE-US-00010 SEQ ID NO./ ISIS NO. ED.sub.50 5/392745 9 6/392063 8
5/392749 15 6/411847 12
[0377] Liver transaminase levels, alanine aminotranferease (ALT)
and aspartate aminotransferase (AST), in serum were also measured
relative to saline injected mice. Increases in the transaminase
levels can indicate hepatotoxicity. The approximate liver
transaminase levels are listed below.
TABLE-US-00011 SEQ ID NO./ ALT levels (IU/L) ISIS NO. 3.2 mg/kg 10
mg/kg 32 mg/kg 66 mg/kg 100 mg/kg 5/392745 30 20 13 59 3842
6/392063 20 17 20 4292 13811 5/392749 18 24 14 18 33 6/411847 26 27
16 279 2816 Saline ALT = 24 IU/L
[0378] Similar to the results indicated in the previous example,
treatment with higher doses (66 mg/kg and 100 mg/kg) of
4'-CH.sub.2--O-2' BNA 2-10-2 gapped oligomer 392063 substantially
increased ALT levels. Treatment with lower doses (3.2, 10, 32 and
66 mg/kg) of 392745 were not elevated to a level indicative of
hepatotoxicity with respect to saline treated control. Treatment
with the higher doses (100 mg/kg) of 392745 decreased the ALT
levels about 3.5-fold as compared to 392063 treatment. Treatment
with 6(S)-4'-CH(CH.sub.3)--O-2' BNA 2-10-2 gapped oligomer 411847
decreased the ALT levels about 5-fold as compared to 392063
treatment. The measured ALT levels at all doses amounts for mice
treated with 6(S)-4'-CH(CH.sub.3)--O-2' BNA 2-10-2 gapped oligomer
392749 were not elevated to a level indicative of
hepatotoxicity.
[0379] This example compared parent gapmer compounds comprising
bicyclic nucleosides with 5-methyl pyrimidines in the wings with
counterpart compounds that were identical, except that they lacked
the 5-methyl on the pyrimidines of the bicyclic nucleosides. The
counterpart compounds lacking 5-methyl modifications on the
pyrimidines were dramatically less toxic than the parent compounds
with 5-methyl pyrimidines as measured by ALT levels. Potency of the
parent compounds and the less toxic counterparts were similar.
Example 15
BNA 2-10-2 Gapped Oligomeric Compounds Targeted to PTEN
In Vivo Study
[0380] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal (i.p)
injection of oligomers as set forth in the table below.
TABLE-US-00012 SEQ ID NO./ Composition Wing ISIS NO. (5' to 3')
Chemistry 5/396006 C.sub.as U.sub.as T.sub.ds A.sub.ds G.sub.ds
C.sub.ds A.sub.ds .alpha.-L-LNA C.sub.ds T.sub.ds G.sub.ds G.sub.ds
C.sub.ds C.sub.as U.sub.a (C/U) 6/435854 .sup.mC.sub.as T.sub.as
T.sub.ds A.sub.ds G.sub.ds C.sub.ds A.sub.ds .alpha.-L-LNA C.sub.ds
T.sub.ds G.sub.ds G.sub.ds C.sub.ds .sup.mC.sub.as T.sub.a
(.sup.meC/T) Subscript key: a = .alpha.-L-LNA; d = 2'-deoxy; s =
phosphorothioate linkage
[0381] Mice were divided into 9 groups, with 4 mice in each group.
The mice of 8 groups received a single dose, administered i.p., of
one of the above oligomeric compounds at a dose of 100, 32, 10, or
3.2 mg/kg. The final group was dosed with phosphate buffered saline
(PBS) as a control. The mice were sacrificed 72 hours after
administration. Antisense activity was determined by measuring PTEN
RNA in liver. The average of each of oligomer-treated group,
expressed as % reduction compared to the PBS control group, is
provided in the table below.
TABLE-US-00013 % Reduction ISIS NO Wing bases Dose (mg/kg) PTEN RNA
396006 C/U 100 97 32 95 10 77 3.2 47 435854 .sup.meC/T 100 95 32 94
10 73 3.2 48
These oligomers showed very similar PTEN RNA antisense activity in
liver.
[0382] Serum ALT was measured for each animal and is provided in
the table below.
TABLE-US-00014 Dose ALT levels (IU/L) - ISIS NO Wing bases (mg/kg)
Individual animals PBS NA 0 16 23 20 18 396006 C/U 100 28 23 23 28
32 24 19 15 23 10 18 22 19 20 3.2 27 19 17 24 435854 .sup.meC/T 100
1575 854 1665 3948 32 24 29 16 46 10 23 21 33 28 3.2 15 22 20
11
[0383] Serum ALT was elevated at the highest dose of ISIS 43584,
which includes methylated pyrimidines on bicylcic nucleosides.
[0384] Body weight was measured before treatment and again at
sacrifice 72 hours after treatment. Average body weight for each
group at sacrifice relative to pre-dose body weight is reported in
the table below.
TABLE-US-00015 % of pre-dose ISIS NO Wing bases Dose (mg/kg) weight
PBS NA 0 99 396006 C/U 100 100 32 101 10 101 3.2 100 435854
.sup.meC/T 100 94 32 102 10 102 3.2 99
[0385] The highest dose of ISIS 435854 shows some weight loss.
[0386] Spleens were weighed as a measure of inflammatory response.
Average spleen weight for each treatment group relative to PBS
control is provided in the table below.
TABLE-US-00016 ISIS NO Wing bases Dose (mg/kg) % control PBS NA 0
100 396006 C/U 100 120 32 97 10 100 3.2 95 435854 .sup.meC/T 100
160 32 115 10 87 3.2 112
[0387] Treatment with ISIS 43584, which comprises bicyclic
nucleosides having methylated pyrimidines had a marked increase in
spleen weight compared to control and compared to the same compound
with non-methylated pyrimidine bicyclic nucleosides. This suggests
that the removal of the 5-methyl of the pyrimidine results in a
less pro-inflammatory oligomer.
Example 16
BNA 2-10-2 Gapped Oligomeric Compounds Targeted to PTEN
In Vivo Study
[0388] Six week old male Balb/c mice (Jackson Laboratory, Bar
Harbor, Me.) were administered a single intraperitoneal (i.p)
injection of oligomers as set forth in the table below.
TABLE-US-00017 SEQ ID NO./ Composition Wing ISIS NO. (5' to 3')
Chemistry 5/443393 C.sub.js U.sub.os T.sub.ds A.sub.ds G.sub.ds
C.sub.ds A.sub.ds U/C ENA C.sub.ds T.sub.ds G.sub.ds G.sub.ds
C.sub.ds C.sub.js U.sub.j 6/443394 .sup.mC.sub.js T.sub.js T.sub.ds
A.sub.ds G.sub.ds C.sub.ds A.sub.ds T/.sup.mC ENA C.sub.ds T.sub.ds
G.sub.ds G.sub.ds C.sub.ds .sup.mC.sub.js T.sub.j 5/445544 C.sub.xs
U.sub.xs T.sub.ds A.sub.ds G.sub.ds C.sub.ds A.sub.ds U/C C.sub.ds
T.sub.ds G.sub.ds G.sub.ds C.sub.ds C.sub.xs U.sub.x 2'-S-LNA
6/445545 .sup.mC.sub.xs T.sub.xs T.sub.ds A.sub.ds G.sub.ds
C.sub.ds A.sub.ds T/.sup.mC C.sub.ds T.sub.ds G.sub.ds G.sub.ds
C.sub.ds .sup.mC.sub.xs T.sub.x 2'-S-LNA Subscript key: x = S-LNA;
j = ENA; k = constrained ethyl BNA; d = 2'-deoxy; s =
phosphorothioate linkage
[0389] Mice were divided into 17 groups, with 4 mice in each group.
The mice of 16 groups received a single dose, administered i.p., of
one of the above oligomeric compounds at a dose of 100, 32, 10, or
3.2 mg/kg. The final group was dosed with phosphate buffered saline
(PBS) as a control. The mice were sacrificed 72 hours after
administration. Antisense activity was determined by measuring PTEN
RNA in liver and is expressed as % reduction compared to PBS
control mice. The results are summarized in the table below.
TABLE-US-00018 ISIS % Reduction NO Wings Chem Dose (mg/kg) PTEN RNA
ED.sub.50 (mg/kg) 443393 U/C ENA 100 91 16.2 32 64 10 35 3.2 10
443394 T/.sup.mC ENA 100 89 13.5 32 68 10 39 3.2 16 445544 U/C
2'-S-LNA 100 95 4.9 32 93 10 72 3.2 31 445545 T/.sup.mC 2'-S-LNA
100 92 7.7 32 87 10 55 3.2 21
Each of the oligomers reduced PTEN RNA in liver.
[0390] Toxicity was assessed by measuring alanine aminotranferease
(ALT) in serum. Results for each animal are provided below.
TABLE-US-00019 Dose ALT levels (IU/L) - ISIS NO Wings Chem (mg/kg)
Individual animals PBS NA 0 34 25 33 32 443393 U/C ENA 100 16 22 42
23 32 21 24 53 53 10 26 33 30 29 3.2 19 36 83 20 443394 T/.sup.mC
ENA 100 23 44 18 23 32 55 25 28 25 10 55 28 32 32 3.2 28 26 30 69
445544 U/C 2'-S- 100 977 1061 88 133 LNA 32 23 38 19 22 10 23 33 20
36 3.2 21 28 30 36 445545 T/.sup.mC 2'-S- 100 102 135 277 85 LNA 32
22 45 24 47 10 79 19 28 18 3.2 20 34 31 34
[0391] In this example, ALT was not elevated in either of the ENA
groups, whether or not the ENA-pyrimidines included a 5-methyl. Two
animals treated with 2'-S-LNA having non-methylated pyrimidines had
considerably elevated ALT, while the other two animals had only
mild elevation. The methylated counterpart showed mild ALT
elevation.
[0392] Body weight was measured before treatment and again at
sacrifice 72 hours after treatment. Average body weight for each
group at sacrifice relative to pre-dose body weight is reported in
the table below.
TABLE-US-00020 ISIS NO Wings Chem Dose (mg/kg) % pre-dose wt PBS NA
0 102 443393 U/C ENA 100 98 32 99 10 104 3.2 101 443394 T/.sup.mC
ENA 100 101 32 101 10 102 3.2 102 445544 U/C 2'-S-LNA 100 98 32 102
10 101 3.2 103 445545 T/.sup.mC 2'-S-LNA 100 102 32 101 10 102 3.2
100
[0393] Spleens were weighed as a measure of inflammatory response.
Average spleen weight for each treatment group relative to PBS
control is provided in the table below.
TABLE-US-00021 ISIS NO Wings Chem Dose (mg/kg) % Control PBS NA 0
100 443393 U/C ENA 100 96 32 110 10 96 3.2 89 443394 T/.sup.mC ENA
100 98 32 97 10 96 3.2 106 445544 U/C 2'-S-LNA 100 109 32 101 10 92
3.2 98 445545 T/.sup.mC 2'-S-LNA 100 139 32 134 10 99 3.2 100
[0394] Treatment with ISIS445545, which comprises bicyclic
nucleosides having methylated pyrimidines had an increase in spleen
weight compared to control and compared to the same compound with
non-methylated pyrimidine bicyclic nucleosides. This suggests that
the removal of the 5-methyl of the pyrimidine results in a less
pro-inflammatory oligomer.
Sequence CWU 1
1
613160DNAHomo sapiensCDS(1035)..(2246) 1cctcccctcg cccggcgcgg
tcccgtccgc ctctcgctcg cctcccgcct cccctcggtc 60ttccgaggcg cccgggctcc
cggcgcggcg gcggaggggg cgggcaggcc ggcgggcggt 120gatgtggcag
gactctttat gcgctgcggc aggatacgcg ctcggcgctg ggacgcgact
180gcgctcagtt ctctcctctc ggaagctgca gccatgatgg aagtttgaga
gttgagccgc 240tgtgaggcga ggccgggctc aggcgaggga gatgagagac
ggcggcggcc gcggcccgga 300gcccctctca gcgcctgtga gcagccgcgg
gggcagcgcc ctcggggagc cggccggcct 360gcggcggcgg cagcggcggc
gtttctcgcc tcctcttcgt cttttctaac cgtgcagcct 420cttcctcggc
ttctcctgaa agggaaggtg gaagccgtgg gctcgggcgg gagccggctg
480aggcgcggcg gcggcggcgg cggcacctcc cgctcctgga gcggggggga
gaagcggcgg 540cggcggcggc cgcggcggct gcagctccag ggagggggtc
tgagtcgcct gtcaccattt 600ccagggctgg gaacgccgga gagttggtct
ctccccttct actgcctcca acacggcggc 660ggcggcggcg gcacatccag
ggacccgggc cggttttaaa cctcccgtcc gccgccgccg 720caccccccgt
ggcccgggct ccggaggccg ccggcggagg cagccgttcg gaggattatt
780cgtcttctcc ccattccgct gccgccgctg ccaggcctct ggctgctgag
gagaagcagg 840cccagtcgct gcaaccatcc agcagccgcc gcagcagcca
ttacccggct gcggtccaga 900gccaagcggc ggcagagcga ggggcatcag
ctaccgccaa gtccagagcc atttccatcc 960tgcagaagaa gccccgccac
cagcagcttc tgccatctct ctcctccttt ttcttcagcc 1020acaggctccc agac atg
aca gcc atc atc aaa gag atc gtt agc aga aac 1070 Met Thr Ala Ile
Ile Lys Glu Ile Val Ser Arg Asn 1 5 10 aaa agg aga tat caa gag gat
gga ttc gac tta gac ttg acc tat att 1118Lys Arg Arg Tyr Gln Glu Asp
Gly Phe Asp Leu Asp Leu Thr Tyr Ile 15 20 25 tat cca aac att att
gct atg gga ttt cct gca gaa aga ctt gaa ggc 1166Tyr Pro Asn Ile Ile
Ala Met Gly Phe Pro Ala Glu Arg Leu Glu Gly 30 35 40 gta tac agg
aac aat att gat gat gta gta agg ttt ttg gat tca aag 1214Val Tyr Arg
Asn Asn Ile Asp Asp Val Val Arg Phe Leu Asp Ser Lys 45 50 55 60 cat
aaa aac cat tac aag ata tac aat ctt tgt gct gaa aga cat tat 1262His
Lys Asn His Tyr Lys Ile Tyr Asn Leu Cys Ala Glu Arg His Tyr 65 70
75 gac acc gcc aaa ttt aat tgc aga gtt gca caa tat cct ttt gaa gac
1310Asp Thr Ala Lys Phe Asn Cys Arg Val Ala Gln Tyr Pro Phe Glu Asp
80 85 90 cat aac cca cca cag cta gaa ctt atc aaa ccc ttt tgt gaa
gat ctt 1358His Asn Pro Pro Gln Leu Glu Leu Ile Lys Pro Phe Cys Glu
Asp Leu 95 100 105 gac caa tgg cta agt gaa gat gac aat cat gtt gca
gca att cac tgt 1406Asp Gln Trp Leu Ser Glu Asp Asp Asn His Val Ala
Ala Ile His Cys 110 115 120 aaa gct gga aag gga cga act ggt gta atg
ata tgt gca tat tta tta 1454Lys Ala Gly Lys Gly Arg Thr Gly Val Met
Ile Cys Ala Tyr Leu Leu 125 130 135 140 cat cgg ggc aaa ttt tta aag
gca caa gag gcc cta gat ttc tat ggg 1502His Arg Gly Lys Phe Leu Lys
Ala Gln Glu Ala Leu Asp Phe Tyr Gly 145 150 155 gaa gta agg acc aga
gac aaa aag gga gta act att ccc agt cag agg 1550Glu Val Arg Thr Arg
Asp Lys Lys Gly Val Thr Ile Pro Ser Gln Arg 160 165 170 cgc tat gtg
tat tat tat agc tac ctg tta aag aat cat ctg gat tat 1598Arg Tyr Val
Tyr Tyr Tyr Ser Tyr Leu Leu Lys Asn His Leu Asp Tyr 175 180 185 aga
cca gtg gca ctg ttg ttt cac aag atg atg ttt gaa act att cca 1646Arg
Pro Val Ala Leu Leu Phe His Lys Met Met Phe Glu Thr Ile Pro 190 195
200 atg ttc agt ggc gga act tgc aat cct cag ttt gtg gtc tgc cag cta
1694Met Phe Ser Gly Gly Thr Cys Asn Pro Gln Phe Val Val Cys Gln Leu
205 210 215 220 aag gtg aag ata tat tcc tcc aat tca gga ccc aca cga
cgg gaa gac 1742Lys Val Lys Ile Tyr Ser Ser Asn Ser Gly Pro Thr Arg
Arg Glu Asp 225 230 235 aag ttc atg tac ttt gag ttc cct cag ccg tta
cct gtg tgt ggt gat 1790Lys Phe Met Tyr Phe Glu Phe Pro Gln Pro Leu
Pro Val Cys Gly Asp 240 245 250 atc aaa gta gag ttc ttc cac aaa cag
aac aag atg cta aaa aag gac 1838Ile Lys Val Glu Phe Phe His Lys Gln
Asn Lys Met Leu Lys Lys Asp 255 260 265 aaa atg ttt cac ttt tgg gta
aat aca ttc ttc ata cca gga cca gag 1886Lys Met Phe His Phe Trp Val
Asn Thr Phe Phe Ile Pro Gly Pro Glu 270 275 280 gaa acc tca gaa aaa
gta gaa aat gga agt cta tgt gat caa gaa atc 1934Glu Thr Ser Glu Lys
Val Glu Asn Gly Ser Leu Cys Asp Gln Glu Ile 285 290 295 300 gat agc
att tgc agt ata gag cgt gca gat aat gac aag gaa tat cta 1982Asp Ser
Ile Cys Ser Ile Glu Arg Ala Asp Asn Asp Lys Glu Tyr Leu 305 310 315
gta ctt act tta aca aaa aat gat ctt gac aaa gca aat aaa gac aaa
2030Val Leu Thr Leu Thr Lys Asn Asp Leu Asp Lys Ala Asn Lys Asp Lys
320 325 330 gcc aac cga tac ttt tct cca aat ttt aag gtg aag ctg tac
ttc aca 2078Ala Asn Arg Tyr Phe Ser Pro Asn Phe Lys Val Lys Leu Tyr
Phe Thr 335 340 345 aaa aca gta gag gag ccg tca aat cca gag gct agc
agt tca act tct 2126Lys Thr Val Glu Glu Pro Ser Asn Pro Glu Ala Ser
Ser Ser Thr Ser 350 355 360 gta aca cca gat gtt agt gac aat gaa cct
gat cat tat aga tat tct 2174Val Thr Pro Asp Val Ser Asp Asn Glu Pro
Asp His Tyr Arg Tyr Ser 365 370 375 380 gac acc act gac tct gat cca
gag aat gaa cct ttt gat gaa gat cag 2222Asp Thr Thr Asp Ser Asp Pro
Glu Asn Glu Pro Phe Asp Glu Asp Gln 385 390 395 cat aca caa att aca
aaa gtc tga attttttttt atcaagaggg ataaaacacc 2276His Thr Gln Ile
Thr Lys Val 400 atgaaaataa acttgaataa actgaaaatg gacctttttt
tttttaatgg caataggaca 2336ttgtgtcaga ttaccagtta taggaacaat
tctcttttcc tgaccaatct tgttttaccc 2396tatacatcca cagggttttg
acacttgttg tccagttgaa aaaaggttgt gtagctgtgt 2456catgtatata
cctttttgtg tcaaaaggac atttaaaatt caattaggat taataaagat
2516ggcactttcc cgttttattc cagttttata aaaagtggag acagactgat
gtgtatacgt 2576aggaattttt tccttttgtg ttctgtcacc aactgaagtg
gctaaagagc tttgtgatat 2636actggttcac atcctacccc tttgcacttg
tggcaacaga taagtttgca gttggctaag 2696agaggtttcc gaaaggtttt
gctaccattc taatgcatgt attcgggtta gggcaatgga 2756ggggaatgct
cagaaaggaa ataattttat gctggactct ggaccatata ccatctccag
2816ctatttacac acacctttct ttagcatgct acagttatta atctggacat
tcgaggaatt 2876ggccgctgtc actgcttgtt gtttgcgcat ttttttttaa
agcatattgg tgctagaaaa 2936ggcagctaaa ggaagtgaat ctgtattggg
gtacaggaat gaaccttctg caacatctta 2996agatccacaa atgaagggat
ataaaaataa tgtcataggt aagaaacaca gcaacaatga 3056cttaaccata
taaatgtgga ggctatcaac aaagaatggg cttgaaacat tataaaaatt
3116gacaatgatt tattaaatat gttttctcaa ttgtaaaaaa aaaa
3160226DNAArtificial sequencePrimer 2aatggctaag tgaagatgac aatcat
26325DNAArtificial sequencePrimer 3tgcacatatc attacaccag ttcgt
25430DNAArtificial sequenceProbe 4ttgcagcaat tcactgtaaa gctggaaagg
30514DNAArtificial sequenceSynthetic oligonucleotide 5cutagcactg
gccu 14614DNAArtificial sequenceSynthetic oligonucleotide
6cttagcactg gcct 14
* * * * *