U.S. patent application number 14/314866 was filed with the patent office on 2014-10-16 for targeted modification of rat genome.
The applicant listed for this patent is Regeneron Pharmaceuticals, Inc.. Invention is credited to Wojtek Auerbach, Ka-Man Venus Lai, Jeffrey D. Lee, Alexander O. Mujica, David M. Valenzuela, George D. Yancopoulos.
Application Number | 20140309487 14/314866 |
Document ID | / |
Family ID | 51687240 |
Filed Date | 2014-10-16 |
United States Patent
Application |
20140309487 |
Kind Code |
A1 |
Lee; Jeffrey D. ; et
al. |
October 16, 2014 |
TARGETED MODIFICATION OF RAT GENOME
Abstract
Compositions and methods are provided for modifying a rat
genomic locus of interest using a large targeting vector (LTVEC)
comprising various endogenous or exogenous nucleic acid sequences
as described herein. Compositions and methods for generating a
genetically modified rat comprising one or more targeted genetic
modifications in their germline are also provided. Compositions and
methods are provided which comprise a genetically modified rat or
rat cell comprising a targeted genetic modification in the rat
interleukin-2 receptor gamma locus, the rat ApoE locus, the rat
Rag2 locus, the rat Rag1 locus and/or the rat Rag2/Rag1 locus. The
various methods and compositions provided herein allows for these
modified loci to be transmitted through the germline.
Inventors: |
Lee; Jeffrey D.; (New York,
NY) ; Mujica; Alexander O.; (Elmsford, NY) ;
Auerbach; Wojtek; (Ridgewood, NJ) ; Lai; Ka-Man
Venus; (Tarrytown, NY) ; Valenzuela; David M.;
(Yorktown Heights, NY) ; Yancopoulos; George D.;
(Yorktown Heights, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regeneron Pharmaceuticals, Inc. |
Tarrytown |
NY |
US |
|
|
Family ID: |
51687240 |
Appl. No.: |
14/314866 |
Filed: |
June 25, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14254715 |
Apr 16, 2014 |
|
|
|
14314866 |
|
|
|
|
61812319 |
Apr 16, 2013 |
|
|
|
61914768 |
Dec 11, 2013 |
|
|
|
Current U.S.
Class: |
600/34 ;
435/462 |
Current CPC
Class: |
C12N 2015/8527 20130101;
A01K 2227/105 20130101; A01K 2217/07 20130101; C12N 2800/30
20130101; A01K 67/0278 20130101; A01K 67/0276 20130101; A01K
2267/0381 20130101; C12N 15/907 20130101; C07K 14/775 20130101;
C07K 14/7155 20130101; C12N 15/8509 20130101; C12N 2810/00
20130101; A01K 2267/0362 20130101; A61D 19/04 20130101 |
Class at
Publication: |
600/34 ;
435/462 |
International
Class: |
C12N 15/85 20060101
C12N015/85; A61D 19/04 20060101 A61D019/04 |
Claims
1. A method for modifying a genomic locus of interest in a
non-human pluripotent cell, comprising (a) introducing into the
non-human pluripotent cell: (i) a large targeting vector (LTVEC)
comprising a first nucleic acid flanked with a 5' homology arm and
a 3' homology arm, wherein the sum total of the 5' and 3' homology
arms of the LTVEC is at least 10 kb; (ii) a first expression
construct comprising a first promoter operably linked to a second
nucleic acid encoding a Cas protein, (iii) a second expression
construct comprising a second promoter operably linked to a third
nucleic acid encoding a guide RNA (gRNA) comprising a nucleotide
sequence that hybridizes to a target sequence and a
trans-activating CRISPR RNA (tracrRNA), wherein the first and the
second promoters are active in the non-human pluripotent cell; and
(b) identifying a modified non-human pluripotent cell comprising a
targeted genetic modification at the genomic locus of interest.
2. The method of claim 1, wherein the LTVEC is from about 20 kb to
about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to
about 50 kb, from about 50 kb to about 75 kb, or from about 75 kb
to about 100 kb.
3. The method of claim 1, wherein the LTVEC is from about 100 kb to
about 125 kb, from about 125 kb to about 150 kb, from about 150 kb
to about 175 kb, or from about 175 kb to about 200 kb.
4. The method of claim 1, wherein the targeted genetic modification
is a biallelic genetic modification.
5. The method of claim 1, wherein the non-human pluripotent cell is
a rodent pluripotent cell.
6. The method of claim 5, wherein the rodent pluripotent cell is
derived from a mouse, a rat, or a hamster.
7. The method of claim 5, wherein the rodent pluripotent cell is a
mouse or a rat embryonic stem (ES) cell.
8. The method of claim 5, wherein the rodent pluripotent cell is a
rat ES cell derived from a DA strain or an ACI strain.
9. The method of claim 1, wherein the Cas protein is Cas9.
10. The method of claim 1, wherein the target sequence is
immediately flanked on the 3' end by a Protospacer Adjacent Motif
(PAM) sequence.
11. The method of claim 1, wherein the sum total of the 5' and the
3' homology arms is from about 10 kb to about 150 kb.
12. The method of claim 1, wherein the sum total of the 5' and the
3' homology arms of the LTVEC is from about 10 kb to about 20 kb,
from about 20 kb to about 40 kb, from about 40 kb to about 60 kb,
from about 60 kb to about 80 kb, from about 80 kb to about 100 kb,
from about 100 kb to about 120 kb, or from about 120 kb to 150
kb.
13. The method of claim 1, wherein the targeted genetic
modification comprises: (a) a replacement of an endogenous nucleic
acid sequence with a homologous or an orthologous nucleic acid
sequence; (b) a deletion of an endogenous nucleic acid sequence;
(c) a deletion of an endogenous nucleic acid sequence, wherein the
deletion ranges from about 5 kb to about 10 kb, from about 10 kb to
about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to
about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to
about 100 kb, from about 100 kb to about 150 kb, or from about 150
kb to about 200 kb, from about 200 kb to about 300 kb, from about
300 kb to about 400 kb, from about 400 kb to about 500 kb, from
about 500 kb to about 1 Mb, from about 1 Mb to about 1.5 Mb, from
about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or
from about 2.5 Mb to about 3 Mb; (d) insertion of an exogenous
nucleic acid sequence; (e) insertion of an exogenous nucleic acid
sequence ranging from about 5 kb to about 10 kb, from about 10 kb
to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb
to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb
to about 100 kb, from about 100 kb to about 150 kb, from about 150
kb to about 200 kb, from about 200 kb to about 250 kb, from about
250 kb to about 300 kb, from about 300 kb to about 350 kb, or from
about 350 kb to about 400 kb; (f) insertion of an exogenous nucleic
acid sequence comprising a homologous or an orthologous nucleic
acid sequence; (g) insertion of a chimeric nucleic acid sequence
comprising a human and a non-human nucleic acid sequence; (h)
insertion of a conditional allele flanked with site-specific
recombinase target sequences; (i) insertion of a selectable marker
or a reporter gene operably linked to a third promoter active in
the pluripotent cell; or (j) a combination thereof.
14. The method of claim 1, wherein the genomic locus of interest
comprises (i) a 5' target sequence that is homologous to the 5'
homology arm; and (ii) a 3' target sequence that is homologous to
the 3' homology arm.
15. The method of claim 14, wherein the 5' target sequence and the
3' target sequence is separated by at least 5 kb but less than 3
Mb.
16. The method of claim 14, wherein the 5' target sequence and the
3' target sequence is separated by at least 5 kb but less than 10
kb, at least 10 kb but less than 20 kb, at least 20 kb but less
than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb but
less than 80 kb, at least about 80 kb but less than 100 kb, at
least 100 kb but less than 150 kb, or at least 150 kb but less than
200 kb, at least about 200 kb but less than about 300 kb, at least
about 300 kb but less than about 400 kb, at least about 400 kb but
less than about 500 kb, at least about 500 kb but less than about 1
Mb, at least about 1 Mb but less than about 1.5 Mb, at least about
1.5 Mb but less than about 2 Mb, at least about 2 Mb but less than
about 2.5 Mb, or at least about 2.5 Mb but less than about 3
Mb.
17. The method of claim 1, wherein the genomic locus of interest
comprises the Interleukin-2 receptor gamma locus, the ApoE locus,
the Rag1 locus, the Rag2 locus, or both of the Rag1 and the Rag2
loci.
18. The method of claim 1, wherein the first and the second
expression constructs are on a single nucleic acid molecule.
19. A method for targeted genetic modification of a non-human
animal, comprising: (a) modifying a genomic locus of interest in a
non-human pluripotent cell according to the method of claim 1,
thereby producing a genetically modified non-human pluripotent cell
comprising a targeted genetic modification; (b) introducing the
modified non-human pluripotent cell of (a) into a non-human host
embryo; and (c) gestating the non-human host embryo comprising the
modified pluripotent cell in a surrogate mother, wherein the
surrogate mother produces F0 progeny comprising the targeted
genetic modification, wherein the targeted genetic modification is
capable of being transmitted through the germline.
20. The method of claim 19, wherein the genomic locus of interest
comprises the Interleukin-2 receptor gamma locus, the ApoE locus,
the Rag1 locus, the Rag2 locus, or both of the Rag1 and the Rag2
loci.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
application Ser. No. 14/254,715, filed Apr. 16, 2014 and claims the
benefit of U.S. Provisional Application No. 61/812,319, filed Apr.
16, 2013, and U.S. Provisional Application No. 61/914,768, filed
Dec. 11, 2013, all of which are hereby incorporated herein in their
entirety by reference.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS
WEB
[0002] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named 447859SEQLIST.TXT, created on Jun. 25, 2014, and
having a size of 15 kilobytes, and is filed concurrently with the
specification. The sequence listing contained in this ASCII
formatted document is part of the specification and is herein
incorporated by reference in its entirety.
FIELD OF INVENTION
[0003] Isolated non-human totipotent or pluripotent stem cells, in
particular rat embryonic stem cells, that are capable of sustaining
pluripotency following one or more serial genetic modifications in
vitro, and that are capable of transmitting the targeted genetic
modifications to subsequent generations through germline.
Compositions and methods for modifying a rat genomic locus of
interest via bacterial homologous recombination (BHR) in a
prokaryotic cell. Compositions and methods for genetically
modifying a rat genomic locus of interest using a large targeting
vector (LTVEC) in combination with endonucleases. Compositions and
methods for producing a genetically modified rat comprising one or
more targeted genetic modifications.
BACKGROUND OF THE INVENTION
[0004] While rats have been regarded as an important animal model
system that can recapitulate the pathology of various human
diseases, including, but not limited to, cardiovascular (e.g.,
hypertension), metabolic (e.g., obesity, diabetes), neurological
(e.g., pain pathologies), and a variety of cancers, the use of rats
in modeling human diseases has been limited as compared to mice,
due in part to unavailability of germline-transmittable pluripotent
rat cells, which can sustain their pluripotency following a series
of genetic modifications in vitro, e.g., one or more serial
electroporations, and due in part to lack of efficient targeting
technologies that allow introduction or deletion of large genomic
DNA sequences, or replacement of large endogenous genomic DNA
sequences with exogenous nucleic acid sequences in pluripotent rat
cells.
[0005] There is a need in the art for compositions and methods that
allow precise targeted changes in the genome of a rat, which can
open or expand current areas of target discovery and validate
therapeutic agents more quickly and easily.
SUMMARY
[0006] Methods are provided for modifying a genomic locus of
interest in a pluripotent cell via targeted genetic modification.
Such a method comprises (a) introducing into the pluripotent cell a
large targeting vector (LTVEC) comprising an insert nucleic acid
flanked with a 5' homology arm and a 3' homology arm; and (b)
identifying a genetically modified pluripotent cell comprising the
targeted genetic modification at the genomic locus of interest,
wherein the targeted genetic modification is capable of being
transmitted through the germline.
[0007] In one embodiment, the pluripotent cell is derived from a
non-human animal, including, but not limited to, a rodent, a human,
a rat, a mouse, a hamster, a rabbit, a pig, a bovine, a deer, a
sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g.,
marmoset, rhesus monkey), a domesticated mammal or an agricultural
mammal, or any other organism of interest.
[0008] In one embodiment, the pluripotent cell is a non-human
pluripotent cell. In one embodiment, the non-human pluripotent cell
is a mammalian pluripotent cell. In one embodiment, the mammalian
pluripotent cell is a rodent pluripotent cell. In one embodiment,
the rodent pluripotent cell is a rat or mouse pluripotent cell. In
one embodiment, the pluripotent cell is a human induced pluripotent
stem (iPS) cell.
[0009] In one embodiment, the pluripotent cell is a non-human
fertilized egg at the single cell stage. In one embodiment, the
non-human fertilized egg is a mammalian fertilized egg. In one
embodiment, the mammalian fertilized egg is a rodent fertilized egg
at the single cell stage. In one embodiment, the mammalian
fertilized egg is a rat or mouse fertilized egg at the single cell
stage.
[0010] In some embodiments, the sum total of the 5' and the 3'
homology arms of the LTVEC is at least 10 kb. In some embodiments,
the sum total of the 5' and the 3' homology arms of the LTVEC is at
least 10 kb but less than 100 kb or the sum total of the 5' and the
3' homology arms of the LTVEC is at least 10 kb but less than 150
kb. In other embodiments, the size of the sum total of the total of
the 5' and 3' homology arms of the LTVEC is about 10 kb to about
150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb,
about 20 kb to about 150 kb, about 20 kb to about 100 kb, about 20
kb to about 75 kb, about 30 kb to about 150 kb, about 30 kb to
about 100 kb, about 30 kb to about 75 kb, about 40 kb to about 150
kb, about 40 kb to about 100 kb, about 40 kb to about 75 kb, about
50 kb to about 150 kb, about 50 kb to about 100 kb, or about 50 kb
to about 75 kb, about 10 kb to about 30 kb, about 20 kb to about 40
kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about
80 kb to about 100 kb, about 100 kb to about 120 kb, or from about
120 kb to about 150 kb. In one embodiment, the size of the deletion
is the same or similar to the size of the sum total of the 5' and
3' homology arms of the LTVEC.
[0011] In some such embodiments, the targeted genetic modification
is biallelic.
[0012] In some embodiments, the pluripotent cell is a pluripotent
rat cell. In one embodiment, the pluripotent rat cell is a rat
embryonic stem cell. In one embodiment, the pluripotent rat cell is
derived from a DA strain or an ACI strain. In some embodiments, the
pluripotent rat cell is characterized by expression of at least one
pluripotency marker comprising Dnmt3L, Eras, Err-beta, Fbxo15,
Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15,
Sox2, Utf1, or a combination thereof. In some such methods, the
pluripotent rat cell is characterized by one of more of the
following characteristics: (a) lack of expression of one or more
pluripotency markers comprising c-Myc, Ecat1, and/or Rexo1; (b)
lack of expression of mesodermal markers comprising Brachyury
and/or Bmpr2; (c) lack of expression of one or more endodermal
markers comprising Gata6, Sox17 and/or Sox7; or (d) lack of
expression of one or more neural markers comprising Nestin and/or
Pax6. Such methods provide that the sum total of the 5' and the 3'
homology arms of the LTVEC is from about 10 kb to about 30 kb, from
about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from
about 60 kb to about 80 kb, or from about 80 kb to about 100 kb,
from about 100 kb to about 120 kb, from about 120 kb to about 150
kb, or from about 10 kb but less than about 150 kb. In some
embodiments, the sum total of the 5' and the 3' homology arms of
the LTVEC is from about 16 Kb to about 100 Kb. In other
embodiments, the size of the sum total of the total of the 5' and
3' homology arms of the LTVEC is about 10 kb to about 150 kb, about
10 kb to about 100 kb, about 10 kb to about 75 kb, about 20 kb to
about 150 kb, about 20 kb to about 100 kb, about 20 kb to about 75
kb, about 30 kb to about 150 kb, about 30 kb to about 100 kb, about
30 kb to about 75 kb, about 40 kb to about 150 kb, about 40 kb to
about 100 kb, about 40 kb to about 75 kb, about 50 kb to about 150
kb, about 50 kb to about 100 kb, about 50 kb to about 75 kb, about
10 kb to about 30 kb, about 20 kb to about 40 kb, about 40 kb to
about 60 kb, about 60 kb to about 80 kb, about 80 kb to about 100
kb, about 100 kb to about 120 kb, or from about 120 kb to about 150
kb. In one embodiment, the size of the deletion is the same or
similar to the size of the sum total of the 5' and 3' homology arms
of the LTVEC.
[0013] The methods further provide that targeted genetic
modification (a) comprises a replacement of an endogenous rat
nucleic acid sequence with a homologous or an orthologous mammalian
nucleic acid sequence; (b) comprises a deletion of an endogenous
rat nucleic acid sequence; (c) comprises a deletion of an
endogenous rat nucleic acid sequence, wherein the deletion ranges
from about 5 kb to about 10 kb, from about 10 kb to about 20 kb,
from about 20 kb to about 40 kb, from about 40 kb to about 60 kb,
from about 60 kb to about 80 kb, from about 80 kb to about 100 kb,
from about 100 kb to about 150 kb, or from about 150 kb to about
200 kb, from about 200 kb to about 300 kb, from about 300 kb to
about 400 kb, from about 400 kb to about 500 kb, from about 500 kb
to about 1 Mb, from about 1 Mb to about 1.5 Mb, from about 1.5 Mb
to about 2 Mb, from about 2 Mb to about 2.5 Mb, or from about 2.5
Mb to about 3 Mb; (d) comprises an exogenous nucleic acid sequence
ranging from about 5 kb to about 10 kb, from about 10 kb to about
20 kb, from about 20 kb to about 40 kb, from about 40 kb to about
60 kb, from about 60 kb to about 80 kb, from about 80 kb to about
100 kb, from about 100 kb to about 150 kb, from about 150 kb to
about 200 kb, from about 200 kb to about 250 kb, from about 250 kb
to about 300 kb, from about 300 kb to about 350 kb, or from about
350 kb to about 400 kb; (e) comprises an exogenous nucleic acid
sequence comprising a homologous or an orthologous nucleic acid
sequence; (f) comprises a chimeric nucleic acid sequence comprising
a human and a rat nucleic acid sequence; (g) ranges from about 5 kb
to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb
to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb
to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb
to about 150 kb, from about 150 kb to about 200 kb, from about 200
kb to about 250 kb, from about 250 kb to about 300 kb, from about
300 kb to about 350 kb, or from about 350 kb to about 400 kb. (h)
comprises a conditional allele flanked with site-specific
recombinase target sequences; or, (i) comprises a reporter gene
operably linked to a promoter active in a rat cell.
[0014] Further provided is a method for modifying a genomic locus
of interest in a pluripotent rat cell via targeted genetic
modification, wherein the genomic locus of interest comprises (i) a
first nucleic acid sequence that is complementary to the 5' rat
homology arm; and (ii) a second nucleic acid sequence that is
complementary to the 3' rat homology arm. In some such embodiments,
the first and the second nucleic acid sequence is separated by at
least 5 kb. In some embodiments, the first and the second nucleic
acid sequence is separated by at least 5 kb but less than 3 Mb. In
some such methods, the first and the second nucleic acid sequence
is separated by at least 5 kb but less than 10 kb, at least 10 kb
but less than 20 kb, at least 20 kb but less than 40 kb, at least
40 kb but less than 60 kb, at least 60 kb but less than 80 kb, at
least about 80 kb but less than 100 kb, at least 100 kb but less
than 150 kb, or at least 150 kb but less than 200 kb, at least
about 200 kb but less than about 300 kb, at least about 300 kb but
less than about 400 kb, at least about 400 kb but less than about
500 kb, at least about 500 kb but less than about 1 Mb, at least
about 1 Mb but less than about 1.5 Mb, at least about 1.5 Mb but
less than about 2 Mb, at least about 2 Mb but less than about 2.5
Mb, at least about 2.5 Mb but less than about 3 Mb, at least about
1 Mb but less than about 2 Mb, at least about 2 Mb but less than
about 3 Mb.
[0015] In some embodiments, the introducing step further comprises
introducing a second nucleic acid encoding a nuclease agent that
promotes a homologous recombination between the targeting construct
and the genomic locus of interest in the pluripotent rat cell. In
some such embodiments, the nuclease agent comprises (a) a chimeric
protein comprising a zinc finger-based DNA binding domain fused to
a FokI endonuclease; or, (b) a chimeric protein comprising a
Transcription Activator-Like Effector Nuclease (TALEN) fused to a
FokI endonuclease.
[0016] In some methods, the introducing step further comprises
introducing into the pluripotent rat cell: (i) a first expression
construct comprising a first promoter operably linked to a first
nucleic acid sequence encoding a Clustered Regularly Interspaced
Short Palindromic Repeats (CRISPR)-associated (Cas) protein, (ii) a
second expression construct comprising a second promoter operably
linked to a second nucleic acid sequence encoding a genomic target
sequence operably linked to a guide RNA (gRNA), wherein the genomic
target sequence is immediately flanked on the 3' end by a
Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the
genomic locus of interest comprises the nucleotide sequence of SEQ
ID NO: 1. In one embodiment, the gRNA comprises a third nucleic
acid sequence encoding a Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR) RNA (crRNA) and a trans-activating
CRISPR RNA (tracrRNA). In another embodiment, the genome of the
pluripotent rat cell comprises a target DNA region complementary to
the genomic target sequence. In some such methods, the Cas protein
is Cas9. In some such methods the gRNA comprises (a) the chimeric
RNA of the nucleic acid sequence of SEQ ID NO: 2; or, (b) the
chimeric RNA of the nucleic acid sequence of SEQ ID NO: 3. In some
such methods, the crRNA comprises the sequence set forth in SEQ ID
NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6. In some such methods, the
tracrRNA comprises the sequence set forth in SEQ ID NO: 7 or SEQ ID
NO: 8.
[0017] Further provided is a rat genomic locus comprising (i) an
insertion of a homologous or orthologous human nucleic acid
sequence; (ii) a replacement of an endogenous rat nucleic acid
sequence with the homologous or orthologous human nucleic acid
sequence; or (iii) a combination thereof, wherein the rat genomic
locus is capable of being transmitted through the germline. In some
such rat genomic locus, the size of the insertion or replacement is
from about 5 kb to about 400 kb. In some such rat genomic locus,
the size of the insertion or replacement is from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to
about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to
about 150 kb, from about 150 kb to about 200 kb, from about 200 kb
to about 250 kb, from about 250 kb to about 300 kb, from about 300
kb to about 350 kb, from about 350 kb to about 400 kb, from about
400 kb to about 800 kb, from about 800 kb to 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb,
to about 2.5 Mb, from about 2.5 Mb to about 2.8 Mb, from about 2.8
Mb to about 3 Mb, at least about 200 kb but less than about 300 kb,
at least about 300 kb but less than about 400 kb, at least about
400 kb but less than about 500 kb, at least about 500 kb but less
than about 1 Mb, at least about 1 1 Mb but less than about 2 Mb, at
least about 2 Mb but less than about 3 Mb.
[0018] Further provided is a method for making a humanized rat,
comprising: (a) targeting a genomic locus of interest in a
pluripotent rat cell with a targeting construct comprising a human
insert nucleic acid to form a genetically modified pluripotent rat
cell; (b) introducing the genetically modified pluripotent rat cell
into a host rat embryo; and (c) gestating the host rat embryo in a
surrogate mother; wherein the surrogate mother produces rat progeny
comprising, a modified genomic locus that comprises: (i) an
insertion of a human nucleic acid sequence; (ii) a replacement of
the rat nucleic acid sequence at the genomic locus of interest with
a homologous or orthologous human nucleic acid sequence; (iii) a
chimeric nucleic acid sequence comprising a human and a rat nucleic
acid sequence; or (iv) a combination thereof, wherein the modified
genomic locus is capable of being transmitted through the
germline.
[0019] In some such methods, the targeting construct is a large
targeting vector (LTVEC), and the sum total of the 5' and the 3'
homology arms of the LTVEC is at least 10 kb but less than 100 kb
or the sum total of the 5' and the 3' homology arms of the LTVEC is
at least 10 kb but less than 150 kb. In some such methods, the sum
total of the 5' and the 3' homology arms of the targeting construct
is from about 10 kb to about 30 kb, from about 20 kb to 40 kb, from
about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from
about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or
from about 120 kb to about 150 kb. In some such methods, the human
nucleic acid sequence is at least 5 kb but less than 400 kb. In
some such methods, the human nucleic acid sequence is at least 5 kb
but less than 10 kb, at least 10 kb but less than 20 kb, at least
20 kb but less than 40 kb, at least 40 kb but less than 60 kb, at
least 60 kb but less than 80 kb, at least about 80 kb but less than
100 kb, at least 100 kb but less than 150 kb, at least 150 kb but
less than 200 kb, at least 200 kb but less than 250 kb, at least
250 kb but less than 300 kb, at least 300 kb but less than 350 kb,
or at least 350 kb but less than 400 kb. In other embodiments, the
size of the sum total of the total of the 5' and 3' homology arms
of the LTVEC is about 10 kb to about 150 kb, about 10 kb to about
100 kb, about 10 kb to about 75 kb, about 20 kb to about 150 kb,
about 20 kb to about 100 kb, about 20 kb to about 75 kb, about 30
kb to about 150 kb, about 30 kb to about 100 kb, about 30 kb to
about 75 kb, about 40 kb to about 150 kb, about 40 kb to about 100
kb, about 40 kb to about 75 kb, about 50 kb to about 150 kb, about
50 kb to about 100 kb, about 50 kb to about 75 kb, about 10 kb to
about 30 kb, about 20 kb to about 40 kb, about 40 kb to about 60
kb, about 60 kb to about 80 kb, about 80 kb to about 100 kb, about
100 kb to about 120 kb, or from about 120 kb to about 150 kb. In
one embodiment, the size of the deletion is the same or similar to
the size of the sum total of the 5' and 3' homology arms of the
LTVEC.
[0020] In some methods for making a humanized rat, the pluripotent
rat cell is a rat embryonic stem (ES) cell. In some such methods,
the pluripotent rat cell is derived from a DA strain or an ACI
strain. In some such methods, the pluripotent rat cell is
characterized by expression of at least one pluripotency marker
comprises Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4, Lef1,
LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1, and/or a
combination thereof. In some such methods, the pluripotent rat cell
is characterized by one or more of the following features: (a) lack
of expression of one or more pluripotency markers comprising c-Myc,
Ecat1, and/or Rexo1; (b) lack of expression of one or more
mesodermal markers comprising Brachyury and/or Bmpr2; (c) lack of
expression of one or more endodermal markers comprising Gata6,
Sox17, and/or Sox7; or (d) lack of expression of one or more neural
markers comprising Nestin and/or Pax6.
[0021] Further provided is a genetically modified rat comprising a
humanized genomic locus, wherein the genetically modified rat
comprises: (i) an insertion of a homologous or orthologous human
nucleic acid sequence; (ii) a replacement of a rat nucleic acid
sequence with a homologous or orthologous human nucleic acid
sequence at an endogenous genomic locus with a homologous or
orthologous human nucleic acid sequence; (iii) a chimeric nucleic
acid sequence comprising a human and a rat nucleic acid sequence;
or, (iv) a combination thereof, wherein the humanized genomic locus
is capable of being transmitted through the germline. In some such
genetically modified rats, the humanized genomic locus comprises a
chimeric nucleic acid sequence comprising a human and a rat nucleic
acid sequence.
[0022] Methods for modifying a target genomic locus of a rat via
bacterial homologous recombination (BHR) are also provided and
comprise: introducing into a prokaryotic cell a large targeting
vector (LTVEC) comprising an insert nucleic acid flanked with a 5'
rat homology arm and a 3' rat homology arm, wherein the prokaryotic
cell comprises a rat nucleic acid and is capable of expressing a
recombinase that mediates the BHR at the target locus, and wherein
the sum total of the 5' and 3' homology arms of the LTVEC is at
least 10 kb but less than 100 kb or the sum total of the 5' and the
3' homology arms of the LTVEC is at least 10 kb but less than 150
kb. In other embodiments, the size of the sum total of the total of
the 5' and 3' homology arms of the LTVEC is about 10 kb to about
150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb,
about 20 kb to about 150 kb, about 20 kb to about 100 kb, about 20
kb to about 75 kb, about 30 kb to about 150 kb, about 30 kb to
about 100 kb, about 30 kb to about 75 kb, about 40 kb to about 150
kb, about 40 kb to about 100 kb, about 40 kb to about 75 kb, about
50 kb to about 150 kb, about 50 kb to about 100 kb, or about 50 kb
to about 75 kb, about 10 kb to about 30 kb, about 20 kb to about 40
kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about
80 kb to about 100 kb, about 100 kb to about 120 kb, or from about
120 kb to about 150 kb. In one embodiment, the size of the deletion
is the same or similar to the size of the sum total of the 5' and
3' homology arms of the LTVEC.
[0023] In some such methods, the target locus of the rat nucleic
acid comprises a first nucleic acid sequence that is complementary
to the 5' homology arm and a second nucleic acid sequence that is
complementary to the 3' homology arm. In some such methods, the
first and the second nucleic acid sequence is separated by at least
5 kb but less than 10 kb, at least 10 kb but less than 20 kb, at
least 20 kb but less than 40 kb, at least 40 kb but less than 60
kb, at least 60 kb but less than 80 kb, at least about 80 kb but
less than 100 kb, at least 100 kb but less than 150 kb, or at least
150 kb but less than 200 kb, at least about 200 kb but less than
about 300 kb, at least about 300 kb but less than about 400 kb, at
least about 400 kb but less than about 500 kb, at least about 500
kb but less than about 1 Mb, at least about 1 1 Mb but less than
about 2 Mb, at least about 2 Mb but less than about 3 Mb.
[0024] In some such methods, introducing the targeting vector into
the prokaryotic cell leads to: (i) a deletion of an endogenous rat
nucleic acid sequence from the target genomic locus; (ii) an
addition of an exogenous nucleic acid sequence at the target
genomic locus; (iii) a replacement of the endogenous rat nucleic
acid sequence with the exogenous nucleic acid sequence at the
target locus; or (iv) a combination thereof. In some such methods,
the insert nucleic acid comprises (a) a polynucleotide that is
homologous or orthologous to the rat nucleic acid sequence at the
target genomic locus; or (b) a conditional allele flanked with
site-specific recombination recognition sequences.
[0025] Further provided is a host prokaryotic cell comprising a
targeting vector comprising an insert nucleic acid flanked with a
5' rat homology arm and a 3' rat homology arm, wherein the insert
nucleic acid ranges from about 5 k to about 400 kb. In some host
prokaryotic cells the size of the insert nucleic acid is from about
5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20
kb to about 40 kb, from about 40 kb to about 60 kb, from about 60
kb to about 80 kb, from about 80 kb to about 100 kb, from about 100
kb to about 150 kb, from about 150 kb to about 200 kb, from about
200 kb to about 250 kb, from about 250 kb to about 300 kb, from
about 300 kb to about 350 kb, or from 350 kb to about 400 kb. In
some host prokaryotic cells, the prokaryotic cell comprises a
recombinase gene operably linked to a constitutively active
promoter or an inducible promoter.
[0026] Methods are also provided for modifying a genomic locus of
interest in a cell via targeted genetic modification comprising
introducing into the cell
[0027] (a) a large targeting vector (LTVEC) comprising an insert
nucleic acid flanked with a 5' homology arm and a 3' homology arm,
wherein the sum total of the 5' and 3' homology arms of the LTVEC
is at least 10 kb; and
[0028] (b) (i) a first expression construct comprising a first
promoter operably linked to a first nucleic acid sequence encoding
a Clustered Regularly Interspaced Short Palindromic Repeats
(CRISPR)-associated (Cas) protein, (ii) a second expression
construct comprising a second promoter operably linked to a second
nucleic acid sequence encoding a genomic target sequence operably
linked to a guide RNA (gRNA); and identifying a genetically
modified pluripotent cell comprising the targeted genetic
modification at the genomic locus of interest.
[0029] In one embodiment, the genomic locus of interest comprises
the nucleotide sequence set forth in SEQ ID NO: 1, wherein the gRNA
comprises a third nucleic acid sequence encoding a Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA
(crRNA) and a trans-activating CRISPR RNA (tracrRNA), and wherein
the genome of the cell comprises a target DNA region complementary
to the genomic target sequence. In some such methods, the Cas
protein is Cas9. In such methods, the cell can be a pluripotent
cell (such as an embryonic stem cell) or a prokaryotic cell. In one
embodiment, the pluripotent cell is from non-human animal, a
non-human mammal, a rodent, a human, a rat, a mouse, a hamster a
rabbit, a pig, a bovine, a deer, a sheep, a goat, a chicken, a cat,
a dog, a ferret, a primate (e.g., marmoset, rhesus monkey),
domesticated mammal or an agricultural mammal or any other organism
of interest. In another embodiment, the prokaryotic cell is from
bacteria, such as, E. coli.
[0030] In other embodiments, the size of the sum total of the total
of the 5' and 3' homology arms of the LTVEC is about 10 kb to about
150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb,
about 20 kb to about 150 kb, about 20 kb to about 100 kb, about 20
kb to about 75 kb, about 30 kb to about 150 kb, about 30 kb to
about 100 kb, about 30 kb to about 75 kb, about 40 kb to about 150
kb, about 40 kb to about 100 kb, about 40 kb to about 75 kb, about
50 kb to about 150 kb, about 50 kb to about 100 kb, or about 50 kb
to about 75 kb, about 10 kb to about 30 kb, about 20 kb to about 40
kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about
80 kb to about 100 kb, about 100 kb to about 120 kb, or from about
120 kb to about 150 kb. In one embodiment, the size of the deletion
is the same or similar to the size of the sum total of the 5' and
3' homology arms of the LTVEC.
[0031] In one embodiment, the pluripotent cell is a non-human
pluripotent cell. In one embodiment, the non-human pluripotent cell
is a mammalian pluripotent cell. In one embodiment, the mammalian
pluripotent cell is a rodent pluripotent cell. In one embodiment,
the rodent pluripotent cell is a rat or mouse pluripotent cell. In
one embodiment, the pluripotent cell is a human induced pluripotent
stem (iPS) cell.
[0032] In one embodiment, the pluripotent cell is a non-human
fertilized egg at the single cell stage. In one embodiment, the
non-human fertilized egg is a mammalian fertilized egg. In one
embodiment, the mammalian fertilized egg is a rodent fertilized egg
at the single cell stage. In one embodiment, the mammalian
fertilized egg is a rat or mouse fertilized egg at the single cell
stage.
[0033] Further provided is a rat or rat cell comprising a targeted
genetic modification in its genomic locus, wherein the genomic
locus is an Interleukin-2 receptor gamma locus, an ApoE locus, a
Rag1 locus, a Rag2 locus, or a Rag2/Rag1 locus, wherein the
targeted genetic modification comprises: (a) a deletion of an
endogenous rat nucleic acid sequence at the genomic locus; (b) an
insertion of a homologous nucleic acid, an orthologous nucleic
acid, or a chimeric nucleic acid comprising a human and a rat
nucleic acid sequence; or (c) a combination thereof. In such a rat
or rat cell, the targeted genetic modification is transmissible
through the germline of the rat or a rat propagated from the rat
cell.
[0034] In some such rats or rat cells the deletion of the
endogenous rat nucleic acid at the genomic locus is at least about
10 kb, or the insertion of the exogenous nucleic acid sequence at
the genomic locus is at least about 5 kb.
[0035] Further provided is a rat or rat cell, wherein (a) the
targeted genetic modification at the Interleukin-2 receptor gamma
locus results in a decrease in or absence of Interleukin-2 receptor
gamma protein activity; (b) the targeted genetic modification at
the ApoE locus results in a decrease in or absence of ApoE protein
activity; (c) the targeted genetic modification at the Rag1 locus
results in a decrease in or absence of Rag1 protein activity; (d)
the targeted genetic modification at the Rag2 locus results in a
decrease in or absence of Rag2 protein activity; or, (e) the
targeted genetic modification at the Rag2/Rag1 locus results in a
decrease in or absence of Rag2 protein activity and Rag1
activity.
[0036] In some embodiments, the targeted genetic modification of
the Interleukin-2 receptor gamma locus comprises: (a) a deletion of
the entire rat Interleukin-2 receptor gamma coding region or a
portion thereof; (b) a replacement of the entire rat Interleukin-2
receptor gamma coding region or a portion thereof with a human
Interleukin-2 receptor gamma coding region or a portion thereof;
(c) a replacement of an ecto-domain of the rat Interleukin-2
receptor gamma coding region with the ecto-domain of a human
Interleukin-2 receptor gamma; or, (d) at least a 3 kb deletion of
the Interleukin-2 receptor gamma locus. In other such rats or rat
cells the targeted genetic modification of the ApoE locus
comprises: (a) a deletion of the entire ApoE coding region or a
portion thereof; or, (b) at least a 1.8 kb deletion of the ApoE
locus comprising the ApoE coding region.
[0037] Further provided is a rat or rat cell, wherein the targeted
genetic modification of the Rag2 locus comprises: (a) a deletion of
the entire Rag2 coding region or a portion thereof; or (b) at least
a 5.7 kb deletion of the Rag2 locus comprising the Rag2 coding
region. In some embodiments, the targeted genetic modification of
the Rag2/Rag1 locus comprises: (a) a deletion of the entire Rag2
coding region or a portion thereof and a deletion of the entire
Rag1 coding region or portion thereof; or, (b) a deletion of at
least 16 kb of the Rag2/Rag1 locus comprising the Rag2 coding
region.
[0038] Further provided is a rat or rat cell, wherein the targeted
genetic modification comprises an insertion of an expression
cassette comprising a selective marker at the Interleukin-2
receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2
locus, or the Rag2/Rag1 locus. In some such rats or rat cells the
expression cassette comprises a lacZ gene operably linked to the
endogenous promoter at the genomic locus and a human ubiquitin
promoter operably linked to a selective marker.
[0039] Further provided is a rat or rat cell, wherein the targeted
genetic modification in the Interleukin-2 receptor gamma locus, the
ApoE locus, the Rag1 locus, the Rag2 locus or the Rag2/Rag1 locus
comprises the insertion of a self-deleting selection cassette. In
some such rats or rat cells, the self-deleting selection cassette
comprises a selective marker gene operably linked to a promoter
active in the rat cell and a recombinase gene operably linked to a
male germ cell-specific promoter, wherein the self-deleting
cassette is flanked by recombination recognition sites recognized
by the recombinase. In some such rats or rat cells, the male germ
cell-specific promoter is a Protamine-1 promoter; the recombinase
gene encodes Cre, and the recombination recognition sites are loxP
sites. In one embodiment, the Protamine-1 promoter is a mouse or a
rat Protamine-1 promoter.
[0040] Further provided is a rat or rat cell, wherein the insertion
of the exogenous nucleic acid sequence at the genomic locus
comprises a reporter nucleic acid operably linked to an endogenous
Interleukin-2 receptor gamma promoter, an endogenous ApoE promoter,
an endogenous Rag1 promoter, or an endogenous Rag2 promoter. In
some such rats or rat cells, the reporter nucleic acid encodes a
reporter comprising .beta.-galactosidase, mPlum, mCherry, tdTomato,
mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet,
enhanced yellow fluorescent protein (EYFP), Emerald, enhanced green
fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP),
Cerulean, T-Sapphire, luciferase, alkaline phosphatase, or a
combination thereof.
[0041] Further provided is a rat cell, wherein the rat cell is a
pluripotent rat cell or a rat embryonic stem (ES) cell. In some
such rat cells, the pluripotent rat cell or the rat embryonic stem
(ES) cell (a) is derived from a DA strain or an ACI strain; (b) is
characterized by expression of at least one pluripotency marker
comprising Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4, Lef1,
LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1, or a
combination thereof; or (c) is characterized by one or more of the
following characteristics: (i) lack of expression of one or more
pluripotency markers comprising c-Myc, Ecat1, and Rexo1; (ii) lack
of expression of mesodermal markers comprising Brachyury and Bmpr2;
(iii) lack of expression of one or more endodermal markers
comprising Gata6, Sox17 and Sox7; or (iv) lack of expression of one
or more neural markers comprising Nestin and Pax6.
[0042] Further provided is a method for modifying a target genomic
locus in an Interleukin-2 receptor gamma locus, an ApoE locus, a
Rag1 locus, a Rag2 locus or a Rag2/Rag1 locus in a pluripotent rat
cell, the method comprising: (a) introducing into the pluripotent
rat cell a targeting vector comprising an insert nucleic acid
flanked with 5' and 3' rat homology arms homologous to the target
genomic locus; and (b) identifying a genetically modified
pluripotent rat cell comprising a targeted genetic modification at
the target genomic locus, wherein the targeted genetic modification
is capable of being transmitted through the germline of a rat
propagated from the pluripotent rat cell. In some such methods, the
targeting vector is a large targeting vector (LTVEC), wherein the
sum total of the 5' and the 3' rat homology arms is at least about
10 kb. In some embodiments, the sum total of the 5' and the 3' rat
homology arms is at least 10 kb but less than 150 kb. In some
embodiments, the sum total of the 5' and the 3' rat homology arms
is at least about 10 kb but less than about 100 kb. In some
embodiments, introducing the targeting vector into the pluripotent
rat cell leads to: (i) a deletion of an endogenous rat nucleic acid
sequence at the target genomic locus; (ii) an insertion of an
exogenous nucleic acid sequence at the target genomic locus; or
(iii) a combination thereof.
[0043] In some embodiments, the deletion of the endogenous rat
nucleic acid at the genomic locus is at least about 10 kb; the
deletion of an endogenous rat nucleic acid sequence at the genomic
locus ranges from about 5 kb to about 10 kb, from about 10 kb to
about 20 kb, from about 20 kb to about 40 kb, from about 40 kb to
about 60 kb, from about 60 kb to about 80 kb, from about 80 kb to
about 100 kb, from about 100 kb to about 150 kb, or from about 150
kb to about 200 kb, from about 200 kb to about 300 kb, from about
300 kb to about 400 kb, from about 400 kb to about 500 kb, from
about 500 kb to about 1 Mb, from about 1 Mb to about 1.5 Mb, from
about 1.5 Mb to about 2 Mb, from about 2 Mb to about 2.5 Mb, or
from about 2.5 Mb to about 3 Mb; the insertion of an exogenous
nucleic acid sequence at the genomic locus is at least about 5 kb;
or the insertion of an exogenous nucleic acid sequence ranges from
about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from
about 20 kb to about 40 kb, from about 40 kb to about 60 kb, from
about 60 kb to about 80 kb, from about 80 kb to about 100 kb, from
about 100 kb to about 150 kb, from about 150 kb to about 200 kb,
from about 200 kb to about 250 kb, from about 250 kb to about 300
kb, from about 300 kb to about 350 kb, or from about 350 kb to
about 400 kb.
[0044] In some embodiments, (a) the targeted genetic modification
at the Interleukin-2 receptor gamma locus results in a decrease in
or absence of Interleukin-2 receptor gamma protein activity; (b)
the targeted genetic modification at the ApoE locus results in a
decrease in or absence of ApoE protein activity; (c) the targeted
genetic modification at the Rag1 locus results in a decrease in or
absence of Rag1 protein activity; (d) the targeted genetic
modification at the Rag2 locus results in a decrease in or absence
of Rag2 protein activity; or, (e) the targeted genetic modification
at the Rag2/Rag1 locus results in a decrease in or absence of Rag2
protein activity and Rag1 protein activity.
[0045] In some embodiments, the targeted genetic modification at
the Interleukin-2 receptor gamma locus comprises (a) a deletion of
the entire rat Interleukin-2 receptor gamma coding region or a
portion thereof; (b) a replacement of the entire rat Interleukin-2
receptor gamma coding region or a portion thereof with a human
Interleukin-2 receptor gamma coding region or a portion thereof;
(c) a replacement of an ecto-domain of the rat Interleukin-2
receptor gamma coding region with the ecto-domain of a human
Interleukin-2 receptor gamma; or, (d) at least a 3 kb deletion of
the Interleukin-2 receptor gamma locus comprising the Interleukin-2
receptor gamma coding region.
[0046] In some embodiments, the targeted genetic modification at
the ApoE locus comprises: (a) a deletion of the entire ApoE coding
region or a portion thereof; or, (b) at least a 1.8 kb deletion of
the ApoE locus comprising the ApoE coding region.
[0047] In some embodiments, the targeted genetic modification at
the Rag2 locus comprises: (a) a deletion of the entire Rag2 coding
region or a portion thereof; or, (b) at least a 5.7 kb deletion of
the Rag2 locus comprising the Rag2 coding region. In other methods,
the targeted genetic modification of the Rag1/Rag2 locus comprises:
(a) a deletion of the entire Rag2 coding region or a portion
thereof and a deletion of the entire Rag1 coding region or portion
thereof; or, (b) a deletion of at least 16 kb of the Rag2/Rag1
locus comprising the Rag2 and Rag1 coding regions.
[0048] In some such embodiments for modifying a target genomic
locus, the insert nucleic acid comprises an expression cassette
comprising a polynucleotide encoding a selective marker. In some
such embodiments, the expression cassette comprises a lacZ gene
operably linked to an endogenous promoter at the genomic locus and
a human ubiquitin promoter operably linked to a selective marker
gene.
[0049] In some embodiments, the insert nucleic acid comprises a
self-deleting selection cassette. In some such embodiments, the
self-deleting selection cassette comprises a selective marker
operably linked to a promoter active in the rat pluripotent cell
and a polynucleotide encoding a recombinase operably linked to a
male germ cell-specific promoter, wherein the self-deleting
cassette is flanked by recombination recognition sites recognized
by the recombinase. In some such embodiments, the male germ
cell-specific promoter is a Protamine-1 promoter; or, the
recombinase gene encodes Cre and the recombination recognition
sites are loxP sites. In some embodiments, the Protamine-1 promoter
is a mouse or a rat Protamine-1 promoter.
[0050] In other methods, the insertion of the exogenous nucleic
acid sequence at the genomic locus comprises a reporter nucleic
acid sequence operably linked to the endogenous Interleukin-2
receptor gamma promoter, the endogenous ApoE promoter, the
endogenous Rag1 promoter, or the endogenous Rag2 promoter. In some
such embodiments, the reporter nucleic acid sequence encodes a
reporter comprising .beta.-galactosidase, mPlum, mCherry, tdTomato,
mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet,
enhanced yellow fluorescent protein (EYFP), Emerald, enhanced green
fluorescent protein (EGFP), CyPet, cyan fluorescent protein (CFP),
Cerulean, T-Sapphire, luciferase, alkaline phosphatase, or a
combination thereof.
[0051] In some embodiments for modifying a target genomic locus,
the pluripotent rat cell is a rat embryonic stem (ES) cell. In some
such embodiments, the pluripotent rat cell (a) is derived from a DA
strain or an ACI strain; (b) is characterized by expression of a
pluripotency marker comprising Oct-4, Sox-2, alkaline phosphatase,
or a combination thereof; or, (c) is characterized by one or more
of the following characteristics: (i) lack of expression of one or
more pluripotency markers comprising c-Myc, Ecat1, and Rexo1; (ii)
lack of expression of mesodermal markers comprising Brachyury and
Bmpr2; (iii) lack of expression of one or more endodermal markers
comprising Gata6, Sox17 and Sox7; or (iv) lack of expression of one
or more neural markers comprising Nestin and Pax6.
[0052] In some embodiments, the method further comprises
identifying the targeted genetic modification at the target genomic
locus, wherein the identification step employs a quantitative assay
for assessing a modification of allele (MOA) at the target genomic
locus.
[0053] In some embodiments, the introducing step further comprises
introducing a second nucleic acid encoding a nuclease agent that
promotes a homologous recombination between the targeting vector
and the target genomic locus in the pluripotent rat cell. In some
such embodiments, the nuclease agent comprises a chimeric protein
comprising a zinc finger-based DNA binding domain fused to a FokI
endonuclease. Some such methods result in bi-allelic modification
of the target genomic locus.
[0054] In some embodiments, the introducing step of the method
further comprises introducing into the pluripotent rat cell: a
first expression construct comprising a first promoter operably
linked to a first nucleic acid sequence encoding a Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated
(Cas) protein, and a second expression construct comprising a
second promoter operably linked to a second nucleic acid sequence
encoding a genomic target sequence operably linked to a guide RNA
(gRNA), wherein the genomic target sequence is immediately flanked
on the 3' end by a Protospacer Adjacent Motif (PAM) sequence. In
one embodiment, the genomic target sequence comprises the
nucleotide sequence set forth in SEQ ID NO: 1. In one embodiment
the gRNA comprises a third nucleic acid sequence encoding a
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
RNA (crRNA) and a trans-activating CRISPR RNA (tacrRNA). In some
such embodiments, the Cas protein is Cas9. In some such
embodiments, (a) the gRNA is the chimeric RNA of the nucleic acid
sequence set forth in SEQ ID NO: 2; (b) the gRNA is the chimeric
RNA of the nucleic acid sequence set forth in SEQ ID NO: 3; (c) the
crRNA comprises a sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6; or, (d) the tracrRNA comprises the sequence set forth
in SEQ ID NO: 7 and/or SEQ ID NO: 8.
BRIEF DESCRIPTION OF THE DRAWINGS
[0055] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the Office
upon request and payment of the necessary fee.
[0056] FIG. 1 depicts rat ESCs, which grow as compact spherical
colonies that routinely detach and float in the dish.
[0057] FIG. 2A through D depict various pluripotency markers
expressed by rat ESCs: A depicts Oct-4 (green); B depicts Sox-2
(red); C depicts DAPI (blue); D depicts an overlay of pluripotency
markers expressed by rESCs.
[0058] FIG. 3 depicts that the rat ESCs express light levels of
alkaline phosphatase (a pluripotency marker)(left), and the
karyotype for line DA.2B is 42X,Y (right). Karyotyping was done
because rat ESCs often become tetraploid; lines were thus
pre-screened by counting metaphase chromosome spreads, and lines
with mostly normal counts were then formally karyotyped.
[0059] FIG. 4A-B provides a photograph showing the analysis of the
chromosome number of the ACI.G1 rat ES cell line.
[0060] FIG. 5A-B provides a photograph showing the analysis of the
chromosome number of the DA.2B rat ES cell line.
[0061] FIG. 6A-B provides a photograph showing the analysis of the
chromosome number of the DA.C2 rat ES cell line.
[0062] FIG. 7 depicts a closer view of a rat ESC of FIG. 1.
[0063] FIG. 8 depicts production of chimeras by blastocyst
injection and transmission of the rat ESC genome through the
germline; chimeras produced by blastocyst injection using parental
ACI.G1 rat ESCs; high percentage chimeras usually have albino
snouts.
[0064] FIG. 9 depicts F1 agouti pups with albino littermates, sired
by ACI/SD chimera labeled with an asterisk (*) in FIG. 8.
[0065] FIG. 10 provides a schematic of the rat ApoE locus and
denotes with grey bars the cutting site for zinc finger nucleases
(ZFN1 and ZFN2). The genomic regions corresponding to the 5' and 3'
homology arms (5 kb and 5.4 kb, respectively) are denoted by the
dark grey boxes. Exon 1 of the ApoE gene is non-coding and is shown
as an open box closest to the 5' homology arm. The three introns of
the ApoE gene are denoted as lines. Exons 2 and 3 comprise coding
regions and are shown as stippled grey boxes. Exon 4 contains both
coding and non-coding sequences as denoted by the stippled grey
shading and the open box.
[0066] FIG. 11 provides a summary of the ApoE targeting efficiency
when performed in the presence of zinc finger nucleases (ZFN1 or
ZFN2)
[0067] FIG. 12 depicts targeting of the rat Rosa 26 locus, which
lies between the Setd5 and Thumpd3 genes as in mouse, with the same
spacing. Panel A shows the structure of the mouse Rosa 26 locus.
Mouse Rosa26 transcripts consist of 2 or 3 exons. Panel B depicts
the structure of the rat Rosa26 locus; the rat locus contains a
second exon 1 (Ex1b) in addition to the homologous exon to mouse
exon1 (Ex1a); no third exon has been identified in rat. Panel C
depicts a targeted rat Rosa26 allele; homology arms of 5 kb each
were cloned by PCR using genomic DNA from DA rESC; the targeted
allele contains a Splicing Acceptor (SA)-lacZ-hUB-neo cassette
replacing a 117 bp deletion in the rat Rosa26 intron.
[0068] FIG. 13A depicts a control brain of a 14-week-old wild type
rat, which was stained with X-gal. The control brain showed a low
level of background staining for LacZ (dorsal view).
[0069] FIG. 13B depicts LacZ expression in the brain of an rRosa26
heterozygous rat (14-week old). The lacZ reporter was expressed
ubiquitously throughout the brain of the rRosa26 heterozygote.
[0070] FIG. 13C depicts a control heart and thymus (inset) of a
14-week-old wild type rat, which were treated with X-gal. The
control heart and thymus showed a low level of background staining
for LacZ.
[0071] FIG. 13D depicts LacZ expression in the heart and thymus
(inset) of a 14-week-old rRosa26 heterozygous rat. The lacZ
reporter was expressed ubiquitously throughout the heart and thymus
of the rROSA26 heterozygote.
[0072] FIG. 13E depicts a control lung of a 14-week-old wild type
rat, which was treated with X-gal. The control lung showed a low
level of background staining for LacZ.
[0073] FIG. 13F depicts LacZ expression in the lung of a
14-week-old rRosa26 heterozygote rat. The lacZ reporter was
expressed ubiquitously throughout the lung of the rRosa26
heterozygote.
[0074] FIGS. 13G and H depict LacZ expression in E12.5 rat embryos.
In contrast to the wild-type control embryo (H), which shows a low
level of background LacZ staining, the rRosa26 heterozygous embryo
exhibited ubiquitous expression of the LacZ reporter throughout the
embryo.
[0075] FIGS. 13I and J depict LacZ expression in E14.5 rat embryos.
In contrast to the wild-type control embryo (J), which shows a low
level of background LacZ staining, the rRosa26 heterozygous rat
embryo exhibited ubiquitous expression of the LacZ reporter
throughout the embryo.
[0076] FIG. 14 illustrates a homologous or non-homologous
recombination event that occurs inside a rat ES cell following an
electroporation of a targeting vector comprising a selection
cassette (lacZ-neo cassette).
[0077] FIG. 15 illustrates the mechanism by which genome-editing
endonucleases (e.g., ZFNs and TALENs) introduce a double strand
break (DSB) in a target genomic sequence and activate
non-homologous end joining (NHEJ) in an ES cell.
[0078] FIG. 16 illustrates a gene targeting technique that utilizes
ZFN/TALENs to improve the efficiency of homologous recombination of
a targeting vector. DSB represents double strand break.
[0079] FIG. 17 provides a summary of the chimera production and
germline transmission of the modified rat ApoE locus. The targeted
modification was assisted by zinc finger nucleases.
[0080] FIG. 18 provides a schematic of the IL2r-.gamma. targeting
event in combination with zinc finger nucleases that target ZFN U
and ZFN D. ZFN cut sites are noted in the figure.
[0081] FIG. 19 provides the targeting efficiency when targeting
IL2r-.gamma. in combination with the CRISPR/Cas9 system.
[0082] FIG. 20 provides a schematic of the rat ApoE locus and a
targeting plasmid. The upper schematic shows the genomic structure
of the rat ApoE locus and the genomic regions corresponding to the
5' and 3' homology arms (5 kb and 5.4 kb respectively; dark grey
boxes). Exon 1 of the ApoE gene is non-coding and is shown as an
open box closest to the 5' homology arm. The three introns of the
ApoE gene are denoted as lines. Exons 2 and 3 comprise coding
regions and are shown as stippled grey boxes. Exon 4 contains both
coding and non-coding sequences as denoted by the stippled grey
shading and the open box. The lower panel shows the targeting
plasmid. The 5' and 3' homology arms (5 kb and 5.4 kb,
respectively) are denoted by the dark grey boxes. The targeting
vector comprises a reporter gene (lacZ) and a self-deleting
cassette flanked by loxP sites (open arrows). The self-deleting
cassette comprises a mouse Prm1 promoter operably linked to the
Crei gene and a drug selection cassette comprising a human
ubiquitin promoter operably linked to a neomycin resistance
gene.
[0083] FIG. 21 provides a schematic for targeting the ApoE locus in
rat ES cells using zinc-finger nucleases and a targeting vector
comprising a reporter gene (LacZ) and a self-deleting cassette
comprising a mouse Prm1 promoter operably linked to the Crei gene
and a drug selection cassette comprising a human ubiquitin promoter
operably linked to a neomycin resistance gene.
[0084] FIG. 22 provides a schematic of the rat ApoE locus and a
large targeting vector (LTVEC). The upper panel shows the genomic
organization of the rat ApoE locus and the genomic regions
corresponding to the 5' and 3' homology arms (45 kb and 23 kb,
respectively; the dark grey boxes). Exon 1 of ApoE is non-coding
and is shown as an open box closet to the 5' homology arm. The
three introns of the ApoE gene are denoted as lines and exons 2 and
3 comprise coding regions and are shown as stippled grey boxes.
Exon 4 contains both coding and non-coding sequences as denoted by
the stippled grey shading and the open box. The lower panel shows
the LTVEC for modifying the rat ApoE locus. The 5' and 3' homology
arms (45 kb and 23 kb, respectively) are denoted by the dark grey
boxes. The LTVEC comprises a reporter gene (lacZ) and a
self-deleting cassette flanked by loxP sites (open arrows), which
comprises a mouse Prm1 promoter operably linked to the Crei gene
and a drug selection cassette comprising a human ubiquitin promoter
operably linked to a neomycin resistance gene.
[0085] FIG. 23 provides a schematic of the rat ApoE locus and
denotes with grey bars the cutting sites for zinc finger nucleases
(ZFN1 and ZFN2) used together with the large targeting vector
(LTVEC) to enhance homologous recombination between the targeting
vector and the target cognate chromosomal region.
[0086] FIG. 24 depicts the rat IL2r-.gamma. locus that has been
disrupted by a 3.2 kb deletion and the insertion of a reporter gene
(eGFP) and a self-deleting cassette comprising a drug selection
cassette (hUb-neo) and the Crei gene operably linked to a mouse
Prm1 promoter.
[0087] FIG. 25 provides a summary of the germ-line transmitting,
targetable rat embryonic stem cell lines.
[0088] FIG. 26 provides another depiction of the rat IL2r-.gamma.
locus that has been disrupted by a 3.2 kb deletion and the
insertion of a reporter gene (eGFP) and a self-deleting cassette
comprising the Crei gene operably linked to a mouse Prm1 promoter
and a drug selection cassette (hUb-Neo).
[0089] FIG. 27 provides a schematic of the rat Rag2 locus and a
large targeting vector (LTVEC) for modifying the rat Rag2 locus.
The upper panel shows the genomic organization of the rat Rag2
locus and the cognate genomic regions corresponding to the 5' and
3' homology arms (48 kb and 15 kb, respectively; dark grey boxes).
Rag2 comprises single exon denoted by the stippled grey shading.
The lower panel is the LTVEC. The 5' and 3' homology arms (48 kb
and 15 kb, respectively) are denoted by the dark grey boxes. The
LTVEC comprises a reporter gene (lacZ) and a self-deleting cassette
flanked by loxP sites (open arrows) that contains a rat Prm1
promoter operably linked to the Crei gene and a drug selection
cassette containing a human ubiquitin promoter operably linked to a
neomycin resistance gene.
[0090] FIG. 28 provides the genomic structure of the rat Rag1/Rag2
locus and the genomic regions deleted by either Rag2 targeting
(Rag2 deletion) or Rag2/Rag1 double targeting (Rag2/Rag1
deletion).
[0091] FIG. 29 provides a schematic of the rat Rag2 and Rag1 loci
and a large targeting vector (LTVEC) used for modifying the loci.
The upper panel shows the genomic organization of the Rag1 and Rag2
loci and the cognate genomic regions corresponding to the 5' and 3'
homology arms (48 kb and 84 kb, respectively; dark grey boxes).
Rag2 and Rag1 each comprise a single exon denoted by the stippled
grey shading. The lower panel is the LTVEC. The 5' and 3' homology
arms (48 kb and 84 kb, respectively) are denoted by the dark grey
boxes. The LTVEC comprises a reporter gene (lacZ) and a
self-deleting cassette flanked by loxP sites (open arrows), which
comprises a rat Prm1 promoter operably linked to the Crei gene and
a drug selection cassette comprising a human ubiquitin promoter
operably linked to a neomycin resistance gene.
[0092] FIG. 30 shows that II2rg-/y PBMC do not express mature
lymphocyte markers. GFP-positive lymphocytes were detected in
peripheral blood in 2 of the 3 chimeras.
[0093] FIG. 31 provides a schematic of the rat IL-2rg locus and a
targeting plasmid for the full humanization of the rat IL-2rg
locus. The upper panel shows the genomic organization of the rat
IL-2rg locus and the cognate genomic regions corresponding to the
5' and 3' homology arms (4.4 kb and 5.0 kb, respectively; dark grey
boxes). The lower panel is the targeting plasmid. The 5' and 3'
homology arms (4.4 kb and 5.0 kb, respectively) are denoted by the
dark grey boxes. The targeting plasmid comprises the human IL-2rg
genomic region, a reporter gene (GFP) and a self-deleting cassette
flanked by loxP sites (open arrows) that contains a mouse Prm1
promoter operably linked to the Crei gene and a drug selection
cassette containing a human ubiquitin promoter operably linked to a
neomycin resistance gene.
[0094] FIG. 32 provides a schematic of the rat IL-2rg locus and a
targeting plasmid for the ecto-domain humanization of the rat
IL-2rg locus. The upper panel shows the genomic organization of the
rat IL-2rg locus and the cognate genomic regions corresponding to
the 5' and 3' homology arms (4.4 kb and 5.0 kb, respectively; dark
grey boxes). The lower panel is the targeting plasmid. The 5' and
3' homology arms (4.4 kb and 5.0 kb, respectively) are denoted by
the dark grey boxes. The targeting plasmid comprises the human
ecto-domain of the IL-2Rg genomic region, a reporter gene (GFP) and
a self-deleting cassette flanked by loxP sites (open arrows) that
contains a mouse Prm1 promoter operably linked to the Crei gene and
a drug selection cassette a human ubiquitin promoter operably
linked to a neomycin resistance gene.
[0095] FIG. 33 provides a sequence alignment of the human IL-2rg
protein (SEQ ID NO: 20; NP.sub.--000197.1); the rat IL-2rg protein
(SEQ ID NO: 21; NP.sub.--543165.1); and the chimeric IL-2rg protein
(SEQ ID NO: 22) comprising the human ecto-domain of IL-2rg fused to
the remainder of the rat IL-2rg protein. The junction between the
human and rat IL-2rg is noted by the vertical line.
DETAILED DESCRIPTION OF THE INVENTION
Glossary
[0096] The term "embryonic stem cell" or "ES cell" as used herein
includes an embryo-derived totipotent or pluripotent cell that is
capable of contributing to any tissue of the developing embryo upon
introduction into an embryo. The term "pluripotent cell" as used
herein includes an undifferentiated cell that possesses the ability
to develop into more than one differentiated cell types.
[0097] The term "homologous nucleic acid" as used herein includes a
nucleic acid sequence that is either identical or substantially
similar to a known reference sequence. In one embodiment, the term
"homologous nucleic acid" is used to characterize a sequence having
amino acid sequence that is at least 70%, at least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99%, or even 100% identical to a
known reference sequence.
[0098] The term "orthologous nucleic acid" as used herein includes
a nucleic acid sequence from one species that is functionally
equivalent to a known reference sequence in another species.
[0099] The term "large targeting vector" or "LTVEC" as used herein
includes large targeting vectors for eukaryotic cells that are
derived from fragments of cloned genomic DNA larger than those
typically used by other approaches intended to perform homologous
gene targeting in eukaryotic cells. Examples of LTVEC, include, but
are not limited to, bacterial homologous chromosome (BAC) and yeast
artificial chromosome (YAC).
[0100] The term "modification of allele" (MOA) as used herein
includes the modification of the exact DNA sequence of one allele
of a gene(s) or chromosomal locus (loci) in a genome. Examples of
"modification of allele (MOA)" as described herein includes, but is
not limited to, deletions, substitutions, or insertions of as
little as a single nucleotide or deletions of many kilobases
spanning a gene(s) or chromosomal locus (loci) of interest, as well
as any and all possible modifications between these two
extremes.
[0101] The term "recombination site" as used herein includes a
nucleotide sequence that is recognized by a site-specific
recombinase and that can serve as a substrate for a recombination
event.
[0102] "Serial" genetic modifications include two or more
modifications to, e.g., a rat ES cell, conducted independently. For
example, a first modification is made to a rat ES cell genome
employing a suitable first nucleic acid construct. The first
modification may be achieved by electroporation, or any other
method known in the art. Then a second modification is made to the
same rat ES cell genome employing a suitable second nucleic acid
construct. The second modification may be achieved by a second
electroporation, or any other method known in the art. In various
embodiments, following the first and the second genetic
modifications of the same rat ES cell, a third, a fourth, a fifth,
a sixth, and so on, serial genetic modifications (one following
another) may be achieved using, e.g., serial electroporation or any
other suitable method (serially) known in the art.
[0103] The term "site-specific recombinase" as used herein includes
a group of enzymes that can facilitate recombination between
"recombination sites" where the two recombination sites are
physically separated within a single nucleic acid molecule or on
separate nucleic acid molecules. Examples of "site-specific
recombinase" include, but are not limited to, Cre, Flp, and Dre
recombinases.
[0104] The term "germline" in reference to a nucleic acid sequence
includes a nucleic acid sequence that can be passed to progeny.
[0105] The phrase "heavy chain," or "immunoglobulin heavy chain"
includes an immunoglobulin heavy chain sequence, including
immunoglobulin heavy chain constant region sequence, from any
organism. Heavy chain variable domains include three heavy chain
CDRs and four FR regions, unless otherwise specified. Fragments of
heavy chains include CDRs, CDRs and FRs, and combinations thereof.
A typical heavy chain has, following the variable domain (from
N-terminal to C-terminal), a C.sub.H1 domain, a hinge, a C.sub.H2
domain, and a C.sub.H3 domain. A functional fragment of a heavy
chain includes a fragment that is capable of specifically
recognizing an epitope (e.g., recognizing the epitope with a
K.sub.D in the micromolar, nanomolar, or picomolar range), that is
capable of expressing and secreting from a cell, and that comprises
at least one CDR. Heavy chain variable domains are encoded by
variable region nucleotide sequence, which generally comprises
V.sub.H, D.sub.H, and J.sub.H segments derived from a repertoire of
V.sub.H, D.sub.H, and J.sub.H segments present in the germline.
Sequences, locations and nomenclature for V, D, and J heavy chain
segments for various organisms can be found in IMGT database, which
is accessible via the internet on the world wide web (www) at the
URL "imgt.org."
[0106] The phrase "light chain" includes an immunoglobulin light
chain sequence from any organism, and unless otherwise specified
includes human kappa (.kappa.) and lambda (.lamda.) light chains
and a VpreB, as well as surrogate light chains. Light chain
variable domains typically include three light chain CDRs and four
framework (FR) regions, unless otherwise specified. Generally, a
full-length light chain includes, from amino terminus to carboxyl
terminus, a variable domain that includes
FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant region
amino acid sequence. Light chain variable domains are encoded by
the light chain variable region nucleotide sequence, which
generally comprises light chain V.sub.L and light chain J.sub.L
gene segments, derived from a repertoire of light chain V and J
gene segments present in the germline. Sequences, locations and
nomenclature for light chain V and J gene segments for various
organisms can be found in IMGT database, which is accessible via
the internet on the world wide web (www) at the URL "imgt.org."
Light chains include those, e.g., that do not selectively bind
either a first or a second epitope selectively bound by the
epitope-binding protein in which they appear. Light chains also
include those that bind and recognize, or assist the heavy chain
with binding and recognizing, one or more epitopes selectively
bound by the epitope-binding protein in which they appear.
[0107] The phrase "operably linked" comprises a relationship
wherein the components operably linked function in their intended
manner. In one instance, a nucleic acid sequence encoding a protein
may be operably linked to regulatory sequences (e.g., promoter,
enhancer, silencer sequence, etc.) so as to retain proper
transcriptional regulation. In one instance, a nucleic acid
sequence of an immunoglobulin variable region (or V(D)J segments)
may be operably linked to a nucleic acid sequence of an
immunoglobulin constant region so as to allow proper recombination
between the sequences into an immunoglobulin heavy or light chain
sequence.
[0108] 1. Target Locus Comprising a Rat Nucleic Acid
[0109] Various methods and compositions are provided, which allow
for the integration of at least one insert nucleic acid at a target
locus. As used herein, a "genomic locus of interest" comprises any
segment or region of DNA within the genome that one desires to
integrate an insert nucleic acid. The terms "genomic locus of
interest" and "target genomic locus of interest" can be used
interchangeable. The genomic locus of interest can be native to the
cell, or alternatively can comprise a heterologous or exogenous
segment of DNA that was integrated into the genome of the cell.
Such heterologous or exogenous segments of DNA can include
transgenes, expression cassettes, polynucleotide encoding selection
makers, or heterologous or exogenous regions of genomic DNA. The
term "locus" is a defined herein as a segment of DNA within the
genomic DNA. Genetic modifications as described herein can include
one or more deletions from a locus of interest, additions to a
locus of interest, replacement of a locus of interest, and/or any
combination thereof. The locus of interest can comprise coding
regions or non-coding regulatory regions.
[0110] The genomic locus of interest can further comprise any
component of a targeted integration system including, for example,
a recognition site, a selection marker, a previously integrated
insert nucleic acid, polynucleotides encoding nuclease agents,
promoters, etc. Alternatively, the genomic locus of interest can be
located within a yeast artificial chromosome (YAC), bacterial
artificial chromosome (BAC), a human artificial chromosome, or any
other engineered genomic region contained in an appropriate host
cell. In various embodiments, the targeted locus can comprise
native, heterologous, or exogenous nucleic acid sequence from a
prokaryote, a eukaryote, yeast, bacteria, a non-human mammal, a
non-human cell, a rodent, a human, a rat, a mouse, a hamster, a
rabbit, a pig, a bovine, a deer, a sheep, a goat, a chicken, a cat,
a dog, a ferret, a primate (e.g., marmoset, rhesus monkey),
domesticated mammal or an agricultural mammal or any other organism
of interest or a combination thereof.
[0111] In specific embodiments, the genomic locus of interest
comprises a target locus of a "rat nucleic acid". Such a region
comprises a nucleic acid from a rat that is integrated within the
genome of a cell.
[0112] Non-limiting examples of the target locus include a genomic
locus that encodes a protein expressed in a B cell, a genomic locus
that expresses a polypeptide in an immature B cell, a genomic locus
that expresses a polypeptide in a mature B cell, an immunoglobulin
(Ig) loci, or a T cell receptor loci, including, for example, a T
cell receptor alpha locus. Additional examples of target genomic
locus include an FcER1a locus, a TLR4 locus, a PRLR locus, a Notch4
locus, an Accn2 locus, an Adamts5 locus, a TRPA1 locus, FolH1
locus, an LRP5 locus, an IL2 receptor locus, including, for
example, an IL2 Receptor gamma (IL2Rg) locus, an ApoE locus, a Rag1
locus, a Rag2 locus, a Rag1/Rag2 locus, and an ERBB4 locus. Any
such target locus can be from a rat.
[0113] In one embodiment, the target locus encodes a mammalian
immunoglobulin heavy chain variable region amino acid sequence. In
one embodiment, the target locus encodes a rat immunoglobulin heavy
chain variable region amino acid sequence. In one embodiment, the
target locus comprises a genomic DNA sequence comprising an
unrearranged rat, mouse, or human immunoglobulin heavy chain
variable region nucleic acid sequence operably linked to an
immunoglobulin heavy chain constant region nucleic acid sequence.
In one embodiment, the immunoglobulin heavy chain constant region
nucleic acid sequence is a rat, mouse, or human immunoglobulin
heavy chain constant region nucleic acid sequence selected from a
CH1, a hinge, a CH2, a CH3, and a combination thereof. In one
embodiment, the heavy chain constant region nucleic acid sequence
comprises a CH1-hinge-CH2-CH3. In one embodiment, the target locus
comprises a rearranged rat, mouse, or human immunoglobulin heavy
chain variable region nucleic acid sequence operably linked to an
immunoglobulin heavy chain constant region nucleic acid sequence.
In one embodiment, the immunoglobulin heavy chain constant region
nucleic acid sequence is a rat, mouse, or human immunoglobulin
heavy chain constant region nucleic acid sequence selected from a
CH1, a hinge, a CH2, a CH3, and a combination thereof. In one
embodiment, the heavy chain constant region nucleic acid sequence
comprises a CH1-hinge-CH2-CH3.
[0114] In one embodiment, the target locus comprises a genomic DNA
sequence that encodes a mammalian immunoglobulin light chain
variable region amino acid sequence. In one embodiment, the genomic
DNA sequence comprises an unrearranged mammalian .lamda. and/or
.kappa. light chain variable region nucleic acid sequence.
[0115] In one embodiment, the genomic DNA sequence comprises a
rearranged mammalian .lamda. and/or .kappa. light chain variable
region nucleic acid sequence. In one embodiment, the unrearranged
.lamda. or .kappa. light chain variable region nucleic acid
sequence is operably linked to a mammalian immunoglobulin light
chain constant region nucleic acid sequence selected from a .lamda.
light chain constant region nucleic acid sequence and a .kappa.
light chain constant region nucleic acid sequence. In one
embodiment, the mammalian immunoglobulin light chain constant
region nucleic acid sequence is a rat immunoglobulin light chain
constant region nucleic acid sequence. In one embodiment, the
mammalian immunoglobulin light chain constant region nucleic acid
sequence is a mouse immunoglobulin light chain constant region
nucleic acid sequence. In one embodiment, the mammalian
immunoglobulin light chain constant region nucleic acid sequence is
a human immunoglobulin light chain constant region nucleic acid
sequence.
[0116] As used herein, a rat ApoE locus, a rat interleukin-2
receptor gamma (I1-2rg) locus, a rat Rag2 locus, a rat Rag1 locus
and/or a rat Rag2/Rag1 locus comprise the respective regions of the
rat genome in which each of these genes or gene combinations are
located. Modifying any one of the rat ApoE locus, the rat
interleukin-2 receptor gamma locus, the rat Rag2 locus, the rat
Rag1 locus and/or the combined rat Rag2/Rag1 locus can comprise any
desired alteration to the given locus. Non-limiting examples of
modification to the given rat locus are discussed in further detail
herein.
[0117] For example, in specific embodiments, one or more of the rat
ApoE locus, the rat interleukin-2 receptor gamma locus, the Rag2
locus, and/or the Rag2/Rag1 locus is modified such that the
activity and/or level of the encoded ApoE protein or the
interleukin-2 receptor gamma protein or the Rag1 protein or the
Rag2 protein or a combination of the Rag1 and Rag2 proteins are
decreased. In other embodiments, the activity of the ApoE protein,
the interleukin-2 receptor gamma protein, the Rag1 protein, or the
Rag2 protein, or a combination of the Rag1 and Rag2 proteins is
absent.
[0118] By "decreased" is intended any decrease in the level or
activity of the gene/protein encoded at the locus of interest. For
example, a decrease in activity can comprise either (1) a
statistically significant decrease in the overall level or activity
of a given protein (i.e., ApoE, interleukin-2 receptor gamma, Rag2,
Rag2 or a combination of Rag1 and Rag2) including, for example, a
decreased level or activity of 0.5%, 1%, 5%, 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, 100%, 120% or greater when compared to an
appropriate control. Methods to assay for a decrease in the
concentration and/or the activity of anyone of ApoE, interleukin-2
receptor gamma, Rag1 and Rag2 are known in the art.
[0119] In other embodiments, one or more of the rat ApoE locus, the
rat interleukin-2 receptor gamma locus, the rat Rag2 locus, the rat
Rag1 locus and/or rat Rag2/Rag1 locus comprise a modification such
that the activity and/or level of the encoded ApoE polypeptide, the
interleukin-2 receptor gamma polypeptide, the Rag2 polypeptide, the
Rag1 polypeptide, or both the Rag1 and Rag2 polypeptide is
increased. By "increased" is intended any increase in the level or
activity of the gene/polypeptide encoded at the locus of interest.
For example, an increase in activity can comprise either (1) a
statistically significant increase in the overall level or activity
of a given protein (i.e., ApoE, interleukin-2 receptor gamma, Rag1,
Rag2 or Rag1 and Rag2) including, for example, an increased level
or activity of 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 100%, 120% or greater when compared to an appropriate
control. Methods to assay for an increase in the concentration
and/or the activity of anyone of the ApoE, Rag1, Rag2 and
interleukin-2 receptor gamma proteins are known in the art.
[0120] The genetic modification to the rat ApoE locus, the rat
interleukin-2 receptor gamma locus, the rat Rag2 locus, the rat
Rag1 locus and/or rat Rag2/Rag1 locus can comprise a deletion of an
endogenous rat nucleic acid sequence at the genomic locus, an
insertion of an exogenous nucleic acid at the genomic locus, or a
combination thereof. The deletion and/or insertion can occur
anywhere within the given locus as discussed elsewhere herein.
[0121] Further embodiments provided herein comprise the
modification of one or more of the rat ApoE locus, the rat
interleukin-2 receptor gamma locus, the rat Rag2 locus, the rat
Rag1 locus and/or the rat Rag2/Rag1 locus through the replacement
of a portion of the rat ApoE locus, the interleukin-2 receptor
gamma locus, Rag2 locus, Rag1 locus and/or Rag2/Rag1 locus with the
corresponding homologous or orthologous portion of an ApoE locus,
an interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1 locus
and/or a Rag2/Rag1 locus from another organism.
[0122] Still other embodiments, the modification of one or more of
the rat ApoE locus, the rat interleukin-2 receptor gamma locus,
Rag2 locus, Rag1 locus, and/or Rag2/Rag1 locus is carried out
through the replacement of a portion of the rat ApoE locus, the rat
interleukin-2 receptor gamma locus and/or the rat Rag2 locus,
and/or the Rag1 locus and/or Rag2/Rag1 locus with an insert
polynucleotide sharing across its full length least 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a portion of an ApoE
locus, an interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1
locus and/or a Rag2/Rag1 locus it is replacing.
[0123] The given insert polynucleotide and/or the corresponding
region of the rat locus being deleted can be a coding region, an
intron, an exon, an untranslated region, a regulatory region, a
promoter, or an enhancer or any combination thereof or any portion
thereof. Moreover, the given insert polynucleotide and/or the
region of the rat locus being deleted can be of any desired length,
including for example, between 10-100 nucleotides in length,
100-500 nucleotides in length, 500-1 kb nucleotide in length, 1 Kb
to 1.5 kb nucleotide in length, 1.5 kb to 2 kb nucleotides in
length, 2 kb to 2.5 kb nucleotides in length, 2.5 kb to 3 kb
nucleotides in length, 3 kb to 5 kb nucleotides in length, 5 kb to
8 kb nucleotides in length, 8 kb to 10 kb nucleotides in length or
more. In other instances, the size of the insertion or replacement
is from about 5 kb to about 10 kb, from about 10 kb to about 20 kb,
from about 20 kb to about 40 kb, from about 40 kb to about 60 kb,
from about 60 kb to about 80 kb, from about 80 kb to about 100 kb,
from about 100 kb to about 150 kb, from about 150 kb to about 200
kb, from about 200 kb to about 250 kb, from about 250 kb to about
300 kb, from about 300 kb to about 350 kb, from about 350 kb to
about 400 kb, from about 400 kb to about 800 kb, from about 800 kb
to 1 Mb, from about 300 kb to about 400 kb, from about 400 kb to
about 500 kb, from about 500 kb to 1 Mb, from about 1 Mb to about
1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about
2.5 Mb, from about 2.5 Mb to about 2.8 Mb, from about 2.8 Mb to
about 3 Mb. In other embodiments, the given insert polynucleotide
and/or the region of the rat locus being deleted is at least 100,
200, 300, 400, 500, 600, 700, 800, or 900 nucleotides or at least 1
kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb,
12 kb, 13 kb, 14 kb, 15 kb, 16 kb or greater.
[0124] The given insert polynucleotide can be from any organism,
including, for example, a rodent, a rat, a mouse, a hamster, a
mammal, a non-human mammal, a human, an agricultural animal or a
domestic animal.
[0125] As discussed in further detail herein, various methods are
provided to generate targeted modifications of any rat locus of
interest, including for example, targeted modifications in the rat
ApoE locus, the rat interleukin-2 receptor gamma locus, the rat
Rag2 locus, the rat Rag1 locus, and/or the rat Rag2/Rag1 locus.
Further provided are genetically modified rats or genetically
modified pluripotent rat cells (e.g., an rat ES cells), which
comprise a deletion, an insertion, a replacement and/or any
combination thereof at the interleukin-2 receptor gamma locus, at
the ApoE locus, at the rat Rag2 locus, at the rat Rag1 locus,
and/or at the rat Rag2/Rag1 locus. Such genetic modifications
(including those that result in an absence, a decrease, an increase
or a modulation in activity of the target locus) and are also
capable of being transmitted through the germline. In specific
embodiments, the genetic modifications result in a knockout of the
desired target locus. Such rats find use in a variety of
experimental systems as discussed elsewhere herein.
[0126] For example, ApoE (Apolipoprotein E) knockouts in rats offer
an animal model to study endothelial function, including, but not
limited to, plaque formation, transcriptional changes (Whole
Transcriptome Shotgun Sequencing (RNA-Seq), and ex vivo function.
Moreover, the larger size of rats facilitate all these assays and
potentially improve the quality of the RNA-Seq data. ApoE is an
important transport molecule and can transport lipids, such as
cholesterol, through the bloodstream. ApoE can also function in the
nervous system, for example, to clear .beta.-amyloid from the
brain. Modifications in ApoE have been implicated in various
conditions, including, for example, atherosclerosis,
hyperlipidemia, and Alzheimer's disease. ApoE knockout animals
display impaired clearing of lipoproteins from the blood and
develop atherosclerosis. Thus, ApoE knockout animals provide a
model to study conditions and/or processes such as, for example,
endothelia function, plaque formation, transcriptional changes
(RNA-Seq), hyperlipidemia, atherosclerosis and Alzheimer's disease.
Assays to measure ApoE activity are known in the art. For example,
a decrease in ApoE activity can be measured by assaying for a
decrease in the ApoE levels in a blood sample obtained from a
subject by immunoassays, such as by ELISA or by Immunoblotting
techniques. Moreover, the large size of rats facilitates all these
assays and improves the quality of the data.
[0127] RAG1 (Recombination-Activating Gene 1) and RAG2
(Recombination-Activating Gene 2) are enzymes that are part of a
multi-subunit complex having VDJ recombination activity and play an
important role in the rearrangement and recombination of
immunoglobulin and T-cell receptor genes in lymphocytes. RAG1 and
RAG2 induce a double stranded DNA cleavage to facilitate
recombination and join of segments of the T cell receptor and B
cell receptor (i.e. immunoglobulin) genes. Knockout of RAG1 and/or
RAG2 causes a loss of B cells and T cells in the animal resulting
in severe immunodeficiency. RAG1 and/or RAG2 knockout animals find
use, for example, in studies of xenografts (i.e. human cell
xenografts in rats), cancer, vaccine development, autoimmune
disease, infectious disease and graft versus host disease (GVHD).
Various assays to measure RAG1 and/or RAG2 activity are known in
the art and include, for example, measuring recombination
efficiency or assaying for the presence or absence of B cells
and/or T cells in a subject. Moreover, the large size of rats
facilitates all these assays and potentially improves the quality
of the data.
[0128] The IL-2 receptor (IL-2R) is expressed on the surface of
certain immune cells and binds to the cytokine interleukin-2
(IL-2). The IL-2R is an integral membrane protein comprising at
least three separate subunit chains, including, an alpha chain
(IL-2Ra, CD25), a beta chain (IL-2Rb, CD122) and a gamma chain
(IL2-Rg, CD132). The IL-2 receptor gamma (also referred to as
IL2r-.gamma. or IL2Rg) chain is a common gamma chain that is shared
by various cytokine receptors, including, for example, the
receptors for IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21. IL-2Rg
comprises an ectodomain on the extracellular surface of the cell,
which contributes to the binding of the ligand, a transmembrane
domain, and an intracellular domain which can interact with various
molecules to induce intracellular signal transduction pathways. The
Il2rg gene is found on the X-chromosome in mammals and certain
mutations in the gamma chain gene in humans can cause human
X-linked severe combined immunodeficiency (XSCID) characterized by
a profound T-cell defect. In addition, the gamma chain ecto-domain
can be shed off of the transmembrane receptor and released as a
soluble gamma chain receptor. The soluble gamma chain receptor can
be detected in the blood of a subject and can function to regulate
cytokine signaling.
[0129] In some embodiments, the rat IL-2Rg chain is replaced with
the human IL2-Rg chain such that the rat expresses a fully human
IL-2Rg chain. In other instances, it may be useful to replace only
the ectodomain of the rat IL-2Rg chain with the ectodomain of the
human IL-2Rg chain. In such cases, the resulting humanized IL-2Rg
chain expressed in a rat comprises a human ectodomain, with the
remainder of the molecule being from the rat.
[0130] The full-length humanization of IL-2Rg is useful because
rats having this modified locus will produce human IL-2Rg. This
will allow for the detection of human IL-2Rg in rats with
antibodies specific to human IL-2Rg. The ecto-humanization (i.e.,
replacing the rat ecto-domain of IL-2Rg with the human ecto-domain
of IL-2Rg) will result in an IL-2Rg polypeptide that will bind the
human ligands for IL2-Rg, but because the cytoplasmic domain is
still rat, it ecto-humanized form of IL-2Rg will also interact with
the rat signaling machinery.
[0131] 2. Modifying a Rat Target Locus
[0132] A. Targeting Vectors and Insert Nucleic Acids
[0133] i. Insert Nucleic Acid
[0134] As used herein, the "insert nucleic acid" comprises a
segment of DNA that one desires to integrate at the target locus.
In one embodiment, the insert nucleic acid comprises one or more
polynucleotides of interest. In other embodiments, the insert
nucleic acid can comprise one or more expression cassettes. A given
expression cassette can comprise a polynucleotide of interest, a
polynucleotide encoding a selection marker and/or a reporter gene
along with the various regulatory components that influence
expression. Non-limiting examples of polynucleotides of interest,
selection markers, and reporter genes that can be included within
the insert nucleic acid are discussed in detail elsewhere
herein.
[0135] In specific embodiments, the insert nucleic acid can
comprise a nucleic acid from rat, which can include a segment of
genomic DNA, a cDNA, a regulatory region, or any portion or
combination thereof. In other embodiments, the insert nucleic acid
can comprise a nucleic acid from a non-human mammal, a rodent, a
human, a rat, a mouse, a hamster a rabbit, a pig, a bovine, a deer,
a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate
(e.g., marmoset, rhesus monkey), domesticated mammal or an
agricultural mammal or any other organism of interest. As outlined
in further detail herein, the insert nucleic acid employed in the
various methods and compositions can result in the "humanization"
of the a target locus comprising a rat nucleic acid.
[0136] In one embodiment, the insert nucleic acid comprises a
knock-in allele of at least one exon of an endogenous gene. In one
embodiment, the insert nucleic acid comprises a knock-in allele of
the entire endogenous gene (i.e., "gene-swap knock-in").
[0137] In one embodiment, the insert nucleic acid comprises a
regulatory element, including for example, a promoter, an enhancer,
or a transcriptional repressor-binding element.
[0138] In further embodiments, the insert nucleic acid comprises a
conditional allele. In one embodiment, the conditional allele is a
multifunctional allele, as described in US 2011/0104799, which is
incorporated by reference in its entirety. In specific embodiments,
the conditional allele comprises: (a) an actuating sequence in
sense orientation with respect to transcription of a target gene,
and a drug selection cassette in sense or antisense orientation;
(b) in antisense orientation a nucleotide sequence of interest
(NSI) and a conditional by inversion module (COIN, which utilizes
an exon-splitting intron and an invertible genetrap-like module;
see, for example, US 2011/0104799, which is incorporated by
reference in its entirety); and (c) recombinable units that
recombine upon exposure to a first recombinase to form a
conditional allele that (i) lacks the actuating sequence and the
DSC, and (ii) contains the NSI in sense orientation and the COIN in
antisense orientation.
[0139] The insert nucleic acid ranges from about 5 kb to about 10
kb, from about 10 kb to about 20 kb, from about 20 kb to about 40
kb, from about 40 kb to about 60 kb, from about 60 kb to about 80
kb, from about 80 kb to about 100 kb, from about 100 kb to about
150 kb, from about 150 kb to about 200 kb, from about 200 kb to
about 250 kb, from about 250 kb to about 300 kb, from about 300 kb
to about 350 kb, or from about 350 kb to about 400 kb.
[0140] In one embodiment, the insert nucleic acid comprises a
deletion of a rat genomic DNA sequence ranging from about 1 kb to
about 200 kb, from about 2 kb to about 20 kb, or from about 0.5 kb
to about 3 Mb. In one embodiment, the extent of the deletion of the
genomic DNA sequence is greater than a total length of the 5'
homology arm and the 3' homology arm. In one embodiment, the extent
of the deletion of the genomic DNA sequence ranges from about 5 kb
to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb
to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb
to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb
to about 150 kb, from about 150 kb to about 200 kb, from about 20
kb to about 30 kb, from about 30 kb to about 40 kb, from about 40
kb to about 50 kb, from about 50 kb to about 60 kb, from about 60
kb to about 70 kb, from about 70 kb to about 80 kb, from about 80
kb to about 90 kb, from about 90 kb to about 100 kb, from about 100
kb to about 110 kb, from about 110 kb to about 120 kb, from about
120 kb to about 130 kb, from about 130 kb to about 140 kb, from
about 140 kb to about 150 kb, from about 150 kb to about 160 kb,
from about 160 kb to about 170 kb, from about 170 kb to about 180
kb, from about 180 kb to about 190 kb, from about 190 kb to about
200 kb, from about 200 kb to about 250 kb, from about 250 kb to
about 300 kb, from about 300 kb to about 350 kb, from about 350 kb
to about 400 kb, from about 400 kb to about 800 kb, from about 800
kb to 1 Mb, from about 1 Mb to about 1.5 Mb, from about 1.5 Mb to
about 2 Mb, from about 2 Mb, to about 2.5 Mb, from about 2.5 Mb to
about 2.8 Mb, from about 2.8 Mb to about 3 Mb, from about 200 kb to
about 300 kb, from about 300 kb to about 400 kb, from about 400 kb
to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb
to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb.
[0141] In one embodiment, the insert nucleic acid comprises an
insertion or a replacement of a rat nucleic acid sequence with a
homologous or orthologous human nucleic acid sequence. In one
embodiment, the insert nucleic acid comprises an insertion or
replacement of a rat DNA sequence with a homologous or orthologous
human nucleic acid sequence at an endogenous rat locus that
comprises the corresponding rat DNA sequence.
[0142] In one embodiment, the genetic modification is an addition
of a nucleic acid sequence. In one embodiment, the added nucleotide
sequence ranges from 5 kb to 200 kb.
[0143] In one embodiment, the insert nucleic acid comprises a
genetic modification in a coding sequence. In one embodiment, the
genetic modification comprises a deletion mutation of a coding
sequence. In one embodiment, the genetic modification comprises a
fusion of two endogenous coding sequences.
[0144] In one embodiment, the insert nucleic acid comprises an
insertion or a replacement of a rat nucleic acid sequence with a
homologous or orthologous human nucleic acid sequence. In one
embodiment, the insert nucleic acid comprises an insertion or
replacement of a rat DNA sequence with a homologous or orthologous
human nucleic acid sequence at an endogenous rat locus that
comprises the corresponding rat DNA sequence.
[0145] In one embodiment, the genetic modification comprises a
deletion of a non-protein-coding sequence, but does not comprise a
deletion of a protein-coding sequence. In one embodiment, the
deletion of the non-protein-coding sequence comprises a deletion of
a regulatory element. In one embodiment, the genetic modification
comprises a deletion of a promoter. In one embodiment, the genetic
modification comprises an addition of a promoter or a regulatory
element. In one embodiment, the genetic modification comprises a
replacement of a promoter or a regulatory element.
[0146] In one embodiment, the nucleic acid sequence of the
targeting vector can comprise a polynucleotide that when integrated
into the genome will produce a genetic modification of a region of
the rat ApoE locus, wherein the genetic modification at the ApoE
locus results in a decrease in ApoE activity, increase in ApoE
activity, or a modulation of ApoE activity. In one embodiment, an
ApoE knockout ("null allele) is generated.
[0147] In one embodiment, the nucleic acid sequence of the
targeting vector can comprise a polynucleotide that when integrated
into the genome will produce a genetic modification of a region of
the rat interleukin-2 receptor locus, wherein the genetic
modification at the interleukin-2 receptor locus results in a
decrease in interleukin-2 receptor activity. In one embodiment, an
interleukin-2 receptor knockout ("null allele") is generated.
[0148] In further embodiments, the insert nucleic acid results in
the replacement of a portion of the rat ApoE locus, the
interleukin-2 receptor gamma locus and/or Rag2 locus, and/or Rag1
locus and/or Rag2/Rag1 locus with the corresponding homologous or
orthologous portion of an ApoE locus, an interleukin-2 receptor
gamma locus, a Rag2 locus, a Rag1 locus and/or a Rag2/Rag1 locus
from another organism.
[0149] Still other embodiments, the insert nucleic acid comprises a
polynucleotide sharing across its full length least 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a portion of an ApoE
locus, an interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1
locus and/or a Rag2/Rag1 locus it is replacing.
[0150] The given insert polynucleotide and the corresponding region
of the rat locus being replaced can be a coding region, an intron,
an exon, an untranslated region, a regulatory region, a promoter,
or an enhancer or any combination thereof. Moreover, the given
insert polynucleotide and/or the region of the rat locus being
deleted can be of any desired length, including for example,
between 10-100 nucleotides in length, 100-500 nucleotides in
length, 500-1 kb nucleotide in length, 1 Kb to 1.5 kb nucleotide in
length, 1.5 kb to 2 kb nucleotides in length, 2 kb to 2.5 kb
nucleotides in length, 2.5 kb to 3 kb nucleotides in length, 3 kb
to 5 kb nucleotides in length, 5 kb to 8 kb nucleotides in length,
8 kb to 10 kb nucleotides in length or more. In other instances,
the size of the insertion or replacement is from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to
about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to
about 150 kb, from about 150 kb to about 200 kb, from about 200 kb
to about 250 kb, from about 250 kb to about 300 kb, from about 300
kb to about 350 kb, from about 350 kb to about 400 kb, from about
400 kb to about 800 kb, from about 800 kb to 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb,
to about 2.5 Mb, from about 2.5 Mb to about 2.8 Mb, from about 2.8
Mb to about 3 Mb. In other embodiments, the given insert
polynucleotide and/or the region of the rat locus being deleted is
at least 100, 200, 300, 400, 500, 600, 700, 800, or 900 nucleotides
or at least 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb,
10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 16 kb or greater.
[0151] In one embodiment, the promoter is constitutively active
promoter.
[0152] In one embodiment, the promoter is an inducible promoter. In
one embodiment, the inducible promoter is a chemically-regulated
promoter. In one embodiment, the chemically-regulated promoter is
an alcohol-regulated promoter. In one embodiment, the
alcohol-regulated promoter is an alcohol dehydrogenase (alcA) gene
promoter. In one embodiment, the chemically-regulated promoter is a
tetracycline-regulated promoter. In one embodiment, the
tetracycline-regulated promoter is a tetracycline-responsive
promoter. In one embodiment, the tetracycline-regulated promoter is
a tetracycline operator sequence (tetO). In one embodiment, the
tetracycline-regulated promoter is a tet-On promoter. In one
embodiment, the tetracycline-regulated promoter a tet-Off promoter.
In one embodiment, the chemically-regulated promoter is a steroid
regulated promoter. In one embodiment, the steroid regulated
promoter is a promoter of a rat glucocorticoid receptor. In one
embodiment, the steroid regulated promoter is a promoter of an
estrogen receptor. In one embodiment, the steroid-regulated
promoter is a promoter of an ecdysone receptor. In one embodiment,
the chemically-regulated promoter is a metal-regulated promoter. In
one embodiment, the metal-regulated promoter is a metalloprotein
promoter. In one embodiment, the inducible promoter is a
physically-regulated promoter. In one embodiment, the
physically-regulated promoter is a temperature-regulated promoter.
In one embodiment, the temperature-regulated promoter is a heat
shock promoter. In one embodiment, the physically-regulated
promoter is a light-regulated promoter. In one embodiment, the
light-regulated promoter is a light-inducible promoter. In one
embodiment, the light-regulated promoter is a light-repressible
promoter.
[0153] In one embodiment, the promoter is a tissue-specific
promoter. In one embodiment, the promoter is a neuron-specific
promoter. In one embodiment, the promoter is a glia-specific
promoter. In one embodiment, the promoter is a muscle cell-specific
promoter. In one embodiment, the promoter is a heart cell-specific
promoter. In one embodiment, the promoter is a kidney cell-specific
promoter. In one embodiment, the promoter is a bone cell-specific
promoter. In one embodiment, the promoter is an endothelial
cell-specific promoter. In one embodiment, the promoter is an
immune cell-specific promoter. In one embodiment, the immune cell
promoter is a B cell promoter. In one embodiment, the immune cell
promoter is a T cell promoter.
[0154] In one embodiment, the promoter is a
developmentally-regulated promoter. In one embodiment, the
developmentally-regulated promoter is active only during an
embryonic stage of development. In one embodiment, the
developmentally-regulated promoter is active only in an adult
cell.
[0155] In some embodiments, the insert nucleic acid comprises a
nucleic acid flanked with site-specific recombination target
sequences. It is recognized the while the entire insert nucleic
acid can be flanked by such site-specific recombination target
sequences, any region or individual polynucleotide of interest
within the insert nucleic acid can also be flanked by such sites.
The site-specific recombinase can be introduced into the cell by
any means, including by introducing the recombinase polypeptide
into the cell or by introducing a polynucleotide encoding the
site-specific recombinase into the host cell. The polynucleotide
encoding the site-specific recombinase can be located within the
insert nucleic acid or within a separate polynucleotide. The
site-specific recombinase can be operably linked to a promoter
active in the cell including, for example, an inducible promoter, a
promoter that is endogenous to the cell, a promoter that is
heterologous to the cell, a cell-specific promoter, a
tissue-specific promoter, or a developmental stage-specific
promoter. Site-specific recombination target sequences, which can
flank the insert nucleic acid or any polynucleotide of interest in
the insert nucleic acid can include, but are not limited to, loxP,
lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71,
attp, att, FRT, rox, and a combination thereof.
[0156] In some embodiments, the site-specific recombination sites
flank a polynucleotide encoding a selection marker and/or a
reporter gene contained within the insert nucleic acid. In such
instances following integration of the insert nucleic acid at the
targeted locus the sequences between the site-specific
recombination sites can be removed.
[0157] In one embodiment, the insert nucleic acid comprises a
polynucleotide encoding a selection marker. The selection marker
can be contained in a selection cassette. Such selection markers
include, but are not limited, to neomycin phosphotransferase
(neo.sup.r), hygromycin B phosphotransferase (hyg.sup.r),
puromycin-N-acetyltransferase (puro.sup.r), blasticidin S deaminase
(bsr.sup.r), xanthine/guanine phosphoribosyl transferase (gpt), or
herpes simplex virus thymidine kinase (HSV-k), or a combination
thereof. In one embodiment, the polynucleotide encoding the
selection marker is operably linked to a promoter active in the
cell, rat cell, pluripotent rat cell or the ES rat cell. When
serially stacking polynucleotides of interest into a targeted
locus, the selection marker can comprise a recognition site for a
nuclease agent, as outlined above. In one embodiment, the
polynucleotide encoding the selection marker is flanked with a
site-specific recombination target sequences.
[0158] The insert nucleic acid can further comprise a reporter gene
operably linked to a promoter, wherein the reporter gene encodes a
reporter protein selected from the group consisting of or
comprising LacZ, mPlum, mCherry, tdTomato, mStrawberry, J-Red,
DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow
fluorescent protein (EYFP), Emerald, enhanced green fluorescent
protein (EGFP), CyPet, cyan fluorescent protein (CFP), Cerulean,
T-Sapphire, luciferase, alkaline phosphatase, and/or a combination
thereof. Such reporter genes can be operably linked to a promoter
active in the cell. Such promoters can be an inducible promoter, a
promoter that is endogenous to the reporter gene or the cell, a
promoter that is heterologous to the reporter gene or to the cell,
a cell-specific promoter, a tissue-specific promoter, or a
developmental stage-specific promoter.
[0159] In one embodiment, nucleic acid insert can comprise a
mammalian nucleic acid comprises a genomic locus that encodes a
protein expressed in the nervous system, the skeletal system, the
digestive system, the circulatory system, the muscular system, the
respiratory system, the cardiovascular system, the lymphatic
system, the endocrine system, the urinary system, the reproductive
system, or a combination thereof. In one embodiment, the mammalian
nucleic acid comprises a genomic locus that encodes a protein
expressed in a bone marrow or a bone marrow-derived cell. In one
embodiment, the nucleic acid comprises a genomic locus that encodes
a protein expressed in a spleen cell.
[0160] In one embodiment, the mammalian nucleic acid comprises a
genomic locus that encodes a protein expressed in the nervous
system, the skeletal system, the digestive system, the circulatory
system, the muscular system, the respiratory system, the
cardiovascular system, the lymphatic system, the endocrine system,
the urinary system, the reproductive system, or a combination
thereof. In one embodiment, the mammalian nucleic acid comprises a
genomic locus that encodes a protein expressed in a bone marrow or
a bone marrow-derived cell. In one embodiment, the nucleic acid
comprises a genomic locus that encodes a protein expressed in a
spleen cell. In one embodiment, the genomic locus comprises a mouse
genomic DNA sequence, a rat genomic DNA sequence a human genomic
DNA sequence, or a combination thereof. In one embodiment, the
genomic locus comprises, in any order, rat and human genomic DNA
sequences. In one embodiment, the genomic locus comprises, in any
order, mouse and human genomic DNA sequences. In one embodiment,
the genomic locus comprises, in any order, mouse and rat genomic
DNA sequences. In one embodiment, the genomic locus comprises, in
any order, rat, mouse, and human genomic DNA sequences.
[0161] In one embodiment, the genomic locus comprises a mouse
genomic DNA sequence, a rat genomic DNA sequence a human genomic
DNA sequence, or a combination thereof. In one embodiment, the
genomic locus comprises, in any order, rat and human genomic DNA
sequences. In one embodiment, the genomic locus comprises, in any
order, mouse and human genomic DNA sequences. In one embodiment,
the genomic locus comprises, in any order, mouse and rat genomic
DNA sequences. In one embodiment, the genomic locus comprises, in
any order, rat, mouse, and human genomic DNA sequences.
[0162] In one embodiment, the genetic modification comprises at
least one human disease allele of a human gene. In one embodiment,
the human disease is a neurological disease. In one embodiment, the
human disease is a cardiovascular disease. In one embodiment, the
human disease is a kidney disease. In one embodiment, the human
disease is a muscle disease. In one embodiment, the human disease
is a blood disease. In one embodiment, the human disease is a
cancer. In one embodiment, the human disease is an immune system
disease.
[0163] In one embodiment, the human disease allele is a dominant
allele. In one embodiment, the human disease allele is a recessive
allele. In one embodiment, the human disease allele comprises a
single nucleotide polymorphism (SNP) allele.
[0164] In one embodiment, the genetic modification produces a
mutant form of a protein with an altered binding characteristic,
altered localization, altered expression, and/or altered expression
pattern.
[0165] In one embodiment, the insert nucleic acid comprises a
selection cassette. In one embodiment, the selection cassette
comprises a nucleic acid sequence encoding a selective marker,
wherein the nucleic acid sequence is operably linked to a promoter
active in rat ES cells. In one embodiment, the selective marker is
selected from or comprises a hygromycin resistance gene or a
neomycin resistance gene.
[0166] In one embodiment, the nucleic acid comprises a genomic
locus that encodes a protein expressed in a B cell. In one
embodiment, the nucleic acid comprises a genomic locus that encodes
a protein expressed in an immature B cell. In one embodiment, the
nucleic acid comprises a genomic locus that encodes a protein
expressed in a mature B cell.
[0167] In one embodiment, the insert nucleic acid comprises a
regulatory element. In one embodiment, the regulatory element is a
promoter. In one embodiment, the regulatory element is an enhancer.
In one embodiment, the regulatory element is a transcriptional
repressor-binding element.
[0168] In one embodiment, the genetic modification comprises a
deletion of a non-protein-coding sequence, but does not comprise a
deletion of a protein-coding sequence. In one embodiment, the
deletion of the non-protein-coding sequence comprises a deletion of
a regulatory element. In one embodiment, the genetic modification
comprises a deletion of a regulatory element. In one embodiment,
the genetic modification comprises an addition of a promoter or a
regulatory element. In one embodiment, the genetic modification
comprises a replacement of a promoter or a regulatory element.
[0169] ii. Expression Cassettes
[0170] Provided herein are polynucleotides or nucleic acid
molecules comprising the various components employed in a targeted
genomic integration system provided herein (i.e. any one of or any
combination of nuclease agents, recognition sites, insert nucleic
acids, polynucleotides of interest, targeting vectors, selection
markers, and other components).
[0171] The terms "polynucleotide," "polynucleotide sequence,"
"nucleic acid sequence," and "nucleic acid fragment" are used
interchangeably herein. These terms encompass nucleotide sequences
and the like. A polynucleotide may be a polymer of RNA or DNA that
is single- or double-stranded, that optionally contains synthetic,
non-natural or altered nucleotide bases. A polynucleotide in the
form of a polymer of DNA may be comprised of one or more segments
of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
Polynucleotides can comprise deoxyribonucleotides and
ribonucleotides include both naturally occurring molecules and
synthetic analogues, and any combination these. The polynucleotides
provided herein also encompass all forms of sequences including,
but not limited to, single-stranded forms, double-stranded forms,
hairpins, stem-and-loop structures, and the like.
[0172] Further provided are recombinant polynucleotides comprising
the various components of the targeted genomic integration system.
The terms "recombinant polynucleotide" and "recombinant DNA
construct" are used interchangeably herein. A recombinant construct
comprises an artificial or heterologous combination of nucleic acid
sequences, e.g., regulatory and coding sequences that are not found
together in nature. In other embodiments, a recombinant construct
may comprise regulatory sequences and coding sequences that are
derived from different sources, or regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different than that found in nature. Such a construct may be used
by itself or may be used in conjunction with a vector. If a vector
is used, then the choice of vector is dependent upon the method
that is used to transform the host cells as is well known to those
skilled in the art. For example, a plasmid vector can be used.
Genetic elements required to successfully transform, select, and
propagate host cells comprising any of the isolated nucleic acid
fragments provided herein are also provided. Screening may be
accomplished by Southern analysis of DNA, Northern analysis of mRNA
expression, immunoblotting analysis of protein expression, or
phenotypic analysis, among others.
[0173] In specific embodiments, one or more of the components of
the targeted genomic integration system described herein can be
provided in an expression cassette for expression in a prokaryotic
cell, a eukaryotic cell, a bacterial, a yeast cell, or a mammalian
cell or other organism or cell type of interest. The cassette can
include 5' and 3' regulatory sequences operably linked to a
polynucleotide provided herein. "Operably linked" comprises a
relationship wherein the components operably linked function in
their intended manner. For example, an operable linkage between a
polynucleotide of interest and a regulatory sequence (i.e., a
promoter) is a functional link that allows for expression of the
polynucleotide of interest. Operably linked elements may be
contiguous or non-contiguous. When used to refer to the joining of
two protein coding regions, operably linked means that the coding
regions are in the same reading frame. In another instance, a
nucleic acid sequence encoding a protein may be operably linked to
regulatory sequences (e.g., promoter, enhancer, silencer sequence,
etc.) so as to retain proper transcriptional regulation. In one
instance, a nucleic acid sequence of an immunoglobulin variable
region (or V(D)J segments) may be operably linked to a nucleic acid
sequence of an immunoglobulin constant region so as to allow proper
recombination between the sequences into an immunoglobulin heavy or
light chain sequence.
[0174] The cassette may additionally contain at least one
additional polynucleotide of interest to be co-introduced into the
organism. Alternatively, the additional polynucleotide of interest
can be provided on multiple expression cassettes. Such an
expression cassette is provided with a plurality of restriction
sites and/or recombination sites for insertion of a recombinant
polynucleotide to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selection marker genes.
[0175] The expression cassette can include in the 5'-3' direction
of transcription, a transcriptional and translational initiation
region (i.e., a promoter), a recombinant polynucleotide provided
herein, and a transcriptional and translational termination region
(i.e., termination region) functional in mammalian cell or a host
cell of interest. The regulatory regions (i.e., promoters,
transcriptional regulatory regions, and translational termination
regions) and/or a polynucleotide provided herein may be
native/analogous to the host cell or to each other. Alternatively,
the regulatory regions and/or a polynucleotide provided herein may
be heterologous to the host cell or to each other. For example, a
promoter operably linked to a heterologous polynucleotide is from a
species different from the species from which the polynucleotide
was derived, or, if from the same/analogous species, one or both
are substantially modified from their original form and/or genomic
locus, or the promoter is not the native promoter for the operably
linked polynucleotide. Alternatively, the regulatory regions and/or
a recombinant polynucleotide provided herein may be entirely
synthetic.
[0176] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked recombinant polynucleotide, may be native with the host
cell, or may be derived from another source (i.e., foreign or
heterologous) to the promoter, the recombinant polynucleotide, the
host cell, or any combination thereof.
[0177] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation. Toward this end, adapters or
linkers may be employed to join the DNA fragments or other
manipulations may be involved to provide for convenient restriction
sites, removal of superfluous DNA, removal of restriction sites, or
the like. For this purpose, in vitro mutagenesis, primer repair,
restriction, annealing, resubstitutions, e.g., transitions and
transversions, may be involved.
[0178] A number of promoters can be used in the expression
cassettes provided herein. The promoters can be selected based on
the desired outcome. It is recognized that different applications
can be enhanced by the use of different promoters in the expression
cassettes to modulate the timing, location and/or level of
expression of the polynucleotide of interest. Such expression
constructs may also contain, if desired, a promoter regulatory
region (e.g., one conferring inducible, constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific/selective expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
[0179] The expression cassette containing the polynucleotides
provided herein can also comprise a selection marker gene for the
selection of transformed cells. Selectable marker genes are
utilized for the selection of transformed cells or tissues.
[0180] Where appropriate, the sequences employed in the methods and
compositions (i.e., the polynucleotide of interest, the nuclease
agent, etc.) may be optimized for increased expression in the cell.
That is, the genes can be synthesized using codons preferred in a
given cell of interest including, for example, mammalian-preferred
codons, human-preferred codons, rodent-preferred codon,
mouse-preferred codons, rat-preferred codons, etc. for improved
expression.
[0181] The various methods and compositions provided herein can
employ selection markers. Various selection markers can be used in
the methods and compositions disclosed herein. Such selection
markers can, for example, impart resistance to an antibiotic such
as G418, hygromycin, blastocidin, neomycin, or puromycin. Such
selection markers include neomycin phosphotransferase (neo.sup.r),
hygromycin B phosphotransferase (hyg.sup.r),
puromycin-N-acetyltransferase (puro.sup.r), and blasticidin s
deaminase (bsr.sup.r). In still other embodiments, the selection
marker is operably linked to an inducible promoter and the
expression of the selection marker is toxic to the cell.
Non-limiting examples of such selection markers include
xanthine/guanine phosphoribosyl transferase (gpt),
hahypoxanthine-guanine phosphoribosyltransferase (HGPRT) or herpes
simplex virus thymidine kinase (HSV-TK). The polynucleotide
encoding the selection markers are operably linked to a promoter
active in the cell.
[0182] iii. Targeting Vectors
[0183] Targeting vectors are employed to introduce the insert
nucleic acid into the target locus of the rat nucleic acid. The
targeting vector comprises the insert nucleic acid and further
comprises a 5' and a 3' homology arm, which flank the insert
nucleic acid. The homology arms, which flank the insert nucleic
acid, correspond to regions within the target locus of the rat
nucleic acid. For ease of reference, the corresponding cognate
genomic regions within the targeted genomic locus are referred to
herein as "target sites". For example, a targeting vector can
comprise a first insert nucleic acid flanked by a first and a
second homology arm complementary to a first and a second target
site As such, the targeting vector thereby aids in the integration
of the insert nucleic acid into the target locus of the rat nucleic
acid through a homologous recombination event that occurs between
the homology arms and the complementary target sites within the
genome of the cell.
[0184] In one embodiment, the target locus of the rat nucleic acid
comprises a first nucleic acid sequence that is complementary to
the 5' homology arm and a second nucleic acid sequence that is
complementary to the 3' homology arm. In one embodiment, the first
and the second nucleic acid sequences are separated by at least 5
kb. In another embodiment, the first and the second nucleic acid
sequences are separated by at least 5 kb but less than 200 kb. In
one embodiment, the first and the second nucleic acid sequences are
separated by at least 10 kb. In one embodiment, the first and the
second nucleic acid sequences are separated by at least 20 kb, at
least 30 kb, at least 40 kb, at least 50 kb, at least 60 kb, at
least 70 kb, at least 80 kb, at least 90 kb, at least 100 kb, at
least 110 kb, at least 120 kb, at least 130 kb, at least 140 kb, at
least 150 kb, at least 160 kb, at least 170 kb, at least 180 kb, at
least 190 kb, or at least 200 kb. In still further embodiments, the
first and the second nucleic acid sequence is separated by at least
5 kb but less than 10 kb, at least 5 kb but less than 3 Mb, at
least 10 kb but less than 20 kb, at least 20 kb but less than 40
kb, at least 40 kb but less than 60 kb, at least 60 kb but less
than 80 kb, at least about 80 kb but less than 100 kb, at least 100
kb but less than 150 kb, or at least 150 kb but less than 200 kb,
at least about 200 kb but less than about 300 kb, at least about
300 kb but less than about 400 kb, at least about 400 kb but less
than about 500 kb, at least about 500 kb but less than about 1 Mb,
at least about 1.5 Mb but less than about 2 Mb, at least about 1 Mb
but less than about 1.5 Mb, at least about 2 Mb but less than 2.5
Mb, at least about 2.5 Mb but less than 3 Mb, or at least about 2
Mb but less than about 3 Mb.
[0185] A homology arm of the targeting vector can be of any length
that is sufficient to promote a homologous recombination event with
a corresponding target site, including for example, at least 5-10
kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb, 50-60 kb,
60-70 kb, 70-80 kb, 80-90 kb, 90-100 kb, 100-110 kb, 110-120 kb,
120-130 kb, 130-140 kb, 140-150 kb, 150-160 kb, 160-170 kb, 170-180
kb, 180-190 kb, 190-200 kb in length or greater. As outlined in
further detail below, large targeting vectors can employ targeting
arms of greater length. In a specific embodiment, the sum total of
the 5' homology arm and the 3' homology arm is at least 10 kb or
the sum total of the 5' homology arm and the 3' homology arm is at
least about 16 kb to about 100 kb or about 30 kb to about 100 kb.
In other embodiments, the size of the sum total of the total of the
5' and 3' homology arms of the LTVEC is about 10 kb to about 150
kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about
20 kb to about 150 kb, about 20 kb to about 100 kb, about 20 kb to
about 75 kb, about 30 kb to about 150 kb, about 30 kb to about 100
kb, about 30 kb to about 75 kb, about 40 kb to about 150 kb, about
40 kb to about 100 kb, about 40 kb to about 75 kb, about 50 kb to
about 150 kb, about 50 kb to about 100 kb, or about 50 kb to about
75 kb, about 10 kb to about 30 kb, about 20 kb to about 40 kb,
about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb
to about 100 kb, about 100 kb to about 120 kb, or from about 120 kb
to about 150 kb. In one embodiment, the size of the deletion is the
same or similar to the size of the sum total of the 5' and 3'
homology arms of the LTVEC.
[0186] When nuclease agents are employed, the cognate genomic
regions corresponding to the 5' and 3' homology arms of a targeting
vector are "located in sufficient proximity" to nuclease target
sites so as to promote the occurrence of a homologous recombination
event between the cognate genomic regions and the homology arms
upon a nick or double-strand break at the recognition site. For
example, the nuclease target sites can be located anywhere between
the cognate genomic regions corresponding to the 5' and 3' homology
arms. In specific embodiments, the recognition site is immediately
adjacent to at least one or both of the cognate genomic
regions.
[0187] As used herein, a homology arm and a target site (i.e.,
cognate genomic region) "complement" or are "complementary" to one
another when the two regions share a sufficient level of sequence
identity to one another to act as substrates for a homologous
recombination reaction. By "homology" is meant DNA sequences that
are either identical or share sequence identity to a corresponding
or "complementary" sequence. The sequence identity between a given
target site and the corresponding homology arm found on the
targeting vector can be any degree of sequence identity that allows
for homologous recombination to occur. For example, the amount of
sequence identity shared by the homology arm of the targeting
vector (or a fragment thereof) and the target site (or a fragment
thereof) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the
sequences undergo homologous recombination. Moreover, a
complementary region of homology between the homology arm and the
complementary target site can be of any length that is sufficient
to promote homologous recombination at the cleaved recognition
site. For example, a given homology arm and/or complementary target
site can comprise complementary regions of homology that are at
least 5-10 kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb,
50-60 kb, 60-70 kb, 70-80 kb, 80-90 kb, 90-100 kb, 100-110 kb,
110-120 kb, 120-130 kb, 130-140 kb, 140-150 kb, 150-160 kb, 160-170
kb, 170-180 kb, 180-190 kb, 190-200 kb in length or greater (such
as described in the LTVEC vectors described elsewhere herein) such
that the homology arm has sufficient homology to undergo homologous
recombination with the corresponding target sites within the genome
of the cell. For ease of reference the homology arms are referred
to herein as a 5' and a 3' homology arm. This terminology relates
to the relative position of the homology arms to the insert nucleic
acid within the targeting vector.
[0188] The homology arms of the targeting vector are therefore
designed to be complementary to a target site with the targeted
locus. Thus, the homology arms can be complementary to a locus that
is native to the cell, or alternatively they can be complementary
to a region of a heterologous or exogenous segment of DNA that was
integrated into the genome of the cell, including, but not limited
to, transgenes, expression cassettes, or heterologous or exogenous
regions of genomic DNA. Alternatively, the homology arms of the
targeting vector can be complementary to a region of a human
artificial chromosome or any other engineered genomic region
contained in an appropriate host cell. Still further, the homology
arms of the targeting vector can be complementary to or be derived
from a region of a BAC library, a cosmid library, or a P1 phage
library. Thus, in specific embodiments, the homology arms of the
targeting vector are complementary to a rat genomic locus that is
native, heterologous or exogenous to a given cell. In further
embodiments, the homology arms are complementary to a rat genomic
locus that is not targetable using a conventional method or can be
targeted only incorrectly or only with significantly low
efficiency, in the absence of a nick or double-strand break induced
by a nuclease agent. In one embodiment, the homology arms are
derived from a synthetic DNA.
[0189] In still other embodiments, the 5' and 3' homology arms are
complementary to the same genome as the targeted genome. In one
embodiment, the homology arms are from a related genome, e.g., the
targeted genome is a rat genome of a first strain, and the
targeting arms are from a rat genome of a second strain, wherein
the first strain and the second strain are different. In other
embodiments, the homology arms are from the genome of the same
animal or are from the genome of the same strain, e.g., the
targeted genome is a rat genome of a first strain, and the
targeting arms are from a rat genome from the same rat or from the
same strain.
[0190] The targeting vector (such as a large targeting vector) can
also comprise a selection cassette or a reporter gene as discussed
elsewhere herein. The selection cassette can comprise a nucleic
acid sequence encoding a selection marker, wherein the nucleic acid
sequence is operably linked to a promoter. The promoter can be
active in a prokaryotic cell of interest and/or active in a
eukaryotic cell of interest. Such promoters can be an inducible
promoter, a promoter that is endogenous to the reporter gene or the
cell, a promoter that is heterologous to the reporter gene or to
the cell, a cell-specific promoter, a tissue-specific promoter or a
developmental stage-specific promoter. In one embodiment, the
selection marker is selected from or comprises neomycin
phosphotransferase (neo.sup.r), hygromycin B phosphotransferase
(hyg.sup.r), puromycin-N-acetyltransferase (puro.sup.r),
blasticidin S deaminase (bsr.sup.r), xanthine/guanine
phosphoribosyl transferase (gpt), and herpes simplex virus
thymidine kinase (HSV-k), and/or a combination thereof. The
selection marker of the targeting vector can be flanked by the 5'
and 3' homology arms or found either 5' or 3' to the homology
arms.
[0191] In one embodiment, the targeting vector (such as a large
targeting vector) comprises a reporter gene operably linked to a
promoter, wherein the reporter gene encodes a reporter protein
selected from the group consisting of or comprises LacZ, mPlum,
mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO,
mCitrine, Venus, YPet, enhanced yellow fluorescent protein (EYFP),
Emerald, enhanced green fluorescent protein (EGFP), CyPet, cyan
fluorescent protein (CFP), Cerulean, T-Sapphire, luciferase,
alkaline phosphatase, and/or a combination thereof. Such reporter
genes can be operably linked to a promoter active in the cell. Such
promoters can be an inducible promoter, a promoter that is
endogenous to the report gene or the cell, a promoter that is
heterologous to the reporter gene or to the cell, a cell-specific
promoter, a tissue-specific promoter or a developmental
stage-specific promoter.
[0192] In one embodiment, combined use of the targeting vector
(including, for example, a large targeting vector) with the
nuclease agent results in an increased targeting efficiency
compared to use of the targeting vector alone. In one embodiment,
when the targeting vector is used in conjunction with the nuclease
agent, targeting efficiency of the targeting vector is increased at
least by two-fold, at least three-fold, or at least 4-fold when
compared to when the targeting vector is used alone.
[0193] When employing a targeting vector, the vector design can be
such as to allow for the insertion of a given sequence that is from
about 5 kb to about 200 kb as described herein. In one embodiment,
the insertion is from about 5 kb to about 10 kb, from about 10 kb
to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb
to about 40 kb, from about 40 kb to about 50 kb, from about 50 kb
to about 60 kb, from about 60 kb to about 70 kb, from about 80 kb
to about 90 kb, from about 90 kb to about 100 kb, from about 100 kb
to about 110 kb, from about 110 kb to about 120 kb, from about 120
kb to about 130 kb, from about 130 kb to about 140 kb, from about
140 kb to about 150 kb, from about 150 kb to about 160 kb, from
about 160 kb to about 170 kb, from about 170 kb to about 180 kb,
from about 180 kb to about 190 kb, or from about 190 kb to about
200 kb, from about 5 kb to about 10 kb, from about 10 kb to about
20 kb, from about 20 kb to about 40 kb, from about 40 kb to about
60 kb, from about 60 kb to about 80 kb, from about 80 kb to about
100 kb, from about 100 kb to about 150 kb, from about 150 kb to
about 200 kb, from about 200 kb to about 250 kb, from about 250 kb
to about 300 kb, from about 300 kb to about 350 kb, or from about
350 kb to about 400 kb.
[0194] When employing a targeting vector, the vector design can be
such as to allow for the replacement of a given sequence that is
from about 5 kb to about 200 kb or from about 5 kb to about 3.0 Mb
as described herein. In one embodiment, the replacement is from
about 5 kb to about 10 kb, from about 10 kb to about 20 kb, from
about 20 kb to about 30 kb, from about 30 kb to about 40 kb, from
about 40 kb to about 50 kb, from about 50 kb to about 60 kb, from
about 60 kb to about 70 kb, from about 80 kb to about 90 kb, from
about 90 kb to about 100 kb, from about 100 kb to about 110 kb,
from about 110 kb to about 120 kb, from about 120 kb to about 130
kb, from about 130 kb to about 140 kb, from about 140 kb to about
150 kb, from about 150 kb to about 160 kb, from about 160 kb to
about 170 kb, from about 170 kb to about 180 kb, from about 180 kb
to about 190 kb, from about 190 kb to about 200 kb, from about 5 kb
to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb
to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb
to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb
to about 150 kb, or from about 150 kb to about 200 kb, from about
200 kb to about 300 kb, from about 300 kb to about 400 kb, from
about 400 kb to about 500 kb, from about 500 kb to about 1 Mb, from
about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from
about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb.
[0195] In one embodiment, the targeting vector comprises a
site-specific recombinase gene. In one embodiment, the
site-specific recombinase gene encodes a Cre recombinase. In one
embodiment, the Cre recombinase gene is Crei, wherein two exons
encoding the Cre recombinase are separated by an intron to prevent
its expression in a prokaryotic cell.
[0196] In one embodiment, the Cre recombinase gene further
comprises a nuclear localization signal to facilitate localization
of Cre (or any recombinase or nuclease agent) to the nucleus (e.g.,
the gene is an NL-Cre gene). In a specific embodiment, the Cre
recombinase gene further comprises a nuclear localization signal
and an intron (e.g., NL-Crei).
[0197] In various embodiments, a suitable promoter for expression
of the nuclease agent (including the Cre or Crei recombinase
discussed above) is selected from or comprises a Prm1, Blimp 1,
Gata6, Gata4, Igf2, Lhx2, Lhx5, and/or Pax3. In a specific
embodiment, the promoter is the Gata6 or Gata4 promoter. The
various promoters can be from any organism, including for example,
a rodent such as a mouse or a rat. In another specific embodiment,
the promoter is a Prm1 promoter. In another specific embodiment,
the promoter is a rat Prm1 promoter. In another specific
embodiment, the promoter is a mouse Prm1 promoter. In another
specific embodiment, the promoter is a Blimp1 promoter or a
fragment thereof, e.g., a 1 kb or 2 kb fragment of a Blimp1
promoter. See, for example, U.S. Pat. No. 8,697,851 and U.S.
Application Publication 2013-0312129, both of which are herein
incorporated by reference in their entirety.
[0198] iv. Large Targeting Vectors
[0199] The term "large targeting vector" or "LTVEC" as used herein
comprises large targeting vectors that comprise homology arms that
correspond to and are derived from nucleic acid sequences larger
than those typically used by other approaches intended to perform
homologous targeting in cells and/or comprising insert nucleic
acids comprising nucleic acid sequences larger than those typically
used by other approaches intended to perform homologous
recombination targeting in cells. For example, the LTVEC make
possible the modification of large loci that cannot be accommodated
by traditional plasmid-based targeting vectors because of their
size limitations. In specific embodiments, the homology arms and/or
the insert nucleic acid of the LTVEC comprises genomic sequence of
a eukaryotic cell. The size of the LTVEC is too large to enable
screening of targeting events by conventional assays, e.g.,
southern blotting and long-range (e.g., 1 kb-5 kb) PCR. Examples of
the LTVEC, include, but are not limited to, vectors derived from a
bacterial artificial chromosome (BAC), a human artificial
chromosome or a yeast artificial chromosome (YAC). Non-limiting
examples of LTVECs and methods for making them are described, e.g.,
in U.S. Pat. Nos. 6,586,251, 6,596,541, 7,105,348, and WO
2002/036789 (PCT/US01/45375), and US 2013/0137101, each of which is
herein incorporated by reference.
[0200] The LTVEC can be of any length, including, but not limited
to, from about 20 kb to about 400 kb, from about 20 kb to about 30
kb, from about 30 kb to 40 kb, from about 40 kb to about 50 kb,
from about 50 kb to about 75 kb, from about 75 kb to about 100 kb,
from about 100 kb to 125 kb, from about 125 kb to about 150 kb,
from about 150 kb to about 175 kb, about 175 kb to about 200 kb,
from about 200 kb to about 225 kb, from about 225 kb to about 250
kb, from about 250 kb to about 275 kb or from about 275 kb to about
300 kb, from about 200 kb to about 300 kb, from about 300 kb to
about 350 kb, from about 350 kb to about 400 kb, from about 350 kb
to about 550 kb. In one embodiment, the LTVEC is about 100 kb.
[0201] In one embodiment, the LTVEC comprises an insert nucleic
acid ranging from about 5 kb to about 200 kb, from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 30 kb, from about 0.5 kb to about 30 kb, from about 0.5 kb to
about 40 kb, from about 30 kb to about 150 kb, from about 0.5 kb to
about 150 kb, from about 30 kb to about 40 kb, from about 40 kb to
about 50 kb, from about 60 kb to about 70 kb, from about 80 kb to
about 90 kb, from about 90 kb to about 100 kb, from about 100 kb to
about 110 kb, from about 120 kb to about 130 kb, from about 130 kb
to about 140 kb, from about 140 kb to about 150 kb, from about 150
kb to about 160 kb, from about 160 kb to about 170 kb, from about
170 kb to about 180 kb, from about 180 kb to about 190 kb, or from
about 190 kb to about 200 kb, from about 5 kb to about 10 kb, from
about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from
about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from
about 80 kb to about 100 kb, from about 100 kb to about 150 kb,
from about 150 kb to about 200 kb, from about 200 kb to about 250
kb, from about 250 kb to about 300 kb, from about 300 kb to about
350 kb, or from about 350 kb to about 400 kb;
[0202] When employing a LTVEC, the vector design can be such as to
allow for the replacement of a given sequence that is from about 5
kb to about 200 kb or from about 5 kb to about 3 Mb as described
herein. In one embodiment, the replacement is from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to
about 50 kb, from about 50 kb to about 60 kb, from about 60 kb to
about 70 kb, from about 80 kb to about 90 kb, from about 90 kb to
about 100 kb, from about 100 kb to about 110 kb, from about 110 kb
to about 120 kb, from about 120 kb to about 130 kb, from about 130
kb to about 140 kb, from about 140 kb to about 150 kb, from about
150 kb to about 160 kb, from about 160 kb to about 170 kb, from
about 170 kb to about 180 kb, from about 180 kb to about 190 kb,
from about 190 kb to about 200 kb, from about 5 kb to about 10 kb,
from about 10 kb to about 20 kb, from about 20 kb to about 40 kb,
from about 40 kb to about 60 kb, from about 60 kb to about 80 kb,
from about 80 kb to about 100 kb, from about 100 kb to about 150
kb, or from about 150 kb to about 200 kb, from about 200 kb to
about 300 kb, from about 300 kb to about 400 kb, from about 400 kb
to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb
to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb.
[0203] In one embodiment, the homology arms of the LTVEC are
derived from a BAC library, a cosmid library, or a P1 phage
library. In other embodiments, the homology arms are derived from
the targeted genomic locus of the cell and in some instances the
target genomic locus, which the LTVEC is designed to target is not
targetable using a conventional method. In still other embodiments,
the homology arms are derived from a synthetic DNA.
[0204] In one embodiment, a sum total of the 5' homology arm and
the 3' homology arm in the LTVEC is at least 10 kb. In other
embodiments, the sum total of the 5' and the 3' homology arms of
the LTVEC is from about 10 kb to about 30 kb, from about 20 kb to
about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to
about 80 kb, from about 80 kb to about 100 kb, from 100 kb to about
120 kb, from about 120 kb to about 140 kb, from about 140 kb to
about 160 kb, from about 160 kb to about 180 kb, from about 180 kb
to about 200 kb. In one embodiment the sum total of the 5' and the
3' homology arms of the LTVEC is from about 30 kb to about 100 kb.
In other embodiments, the size of the sum total of the total of the
5' and 3' homology arms of the LTVEC is about 10 kb to about 150
kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about
20 kb to about 150 kb, about 20 kb to about 100 kb, about 20 kb to
about 75 kb, about 30 kb to about 150 kb, about 30 kb to about 100
kb, about 30 kb to about 75 kb, about 40 kb to about 150 kb, about
40 kb to about 100 kb, about 40 kb to about 75 kb, about 50 kb to
about 150 kb, about 50 kb to about 100 kb, or about 50 kb to about
75 kb, about 10 kb to about 30 kb, about 20 kb to about 40 kb,
about 40 kb to about 60 kb, about 60 kb to about 80 kb, about 80 kb
to about 100 kb, about 100 kb to about 120 kb, or from about 120 kb
to about 150 kb. In one embodiment, the size of the deletion is the
same or similar to the size of the sum total of the 5' and 3'
homology arms of the LTVEC.
[0205] In other embodiments, the 5' homology arm ranges from about
5 kb to about 100 kb. In one embodiment, the 3' homology arm ranges
from about 5 kb to about 100 kb. In other embodiments, the sum
total of the 5' and 3' homology arms are from about 5 kb to about
10 kb, from about 10 kb to about 20 kb, from about 20 kb to about
30 kb, from about 30 kb to about 40 kb, from about 40 kb to about
50 kb, from about 50 kb to about 60 kb, from about 60 kb to about
70 kb, from about 70 kb to about 80 kb, from about 80 kb to about
90 kb, from about 90 kb to about 100 kb, from about 100 kb to about
110 kb, from about 110 kb to about 120 kb, from about 120 kb to
about 130 kb, from about 130 kb to about 140 kb, from about 140 kb
to about 150 kb, from about 150 kb to about 160 kb, from about 160
kb to about 170 kb, from about 170 kb to about 180 kb, from about
180 kb to about 190 kb, from about 190 kb to about 200 kb, or from
about 30 kb to about 100 kb, about 10 kb to about 30 kb, about 20
kb to about 40 kb, about 40 kb to about 60 kb, about 60 kb to about
80 kb, about 80 kb to about 100 kb, about 100 kb to about 120 kb,
or from about 120 kb to about 150 kb.
[0206] In one embodiment, the LTVEC comprises an insert nucleic
acid that is homologous or orthologous to a rat nucleic acid
sequence flanked by the LTVEC homology arms. In one embodiment, the
insert nucleic acid sequence is from a species other than a rat. In
one embodiment, the insert nucleic acid that is homologous or
orthologous to the rat nucleic acid sequence is a mammalian nucleic
acid. In one embodiment, the mammalian nucleic acid is a mouse
nucleic acid. In one embodiment, the mammalian nucleic acid is a
human nucleic acid. In one embodiment, the insert nucleic acid is a
genomic DNA. In one embodiment, the insert is from 5 kb to 200 kb
as described above.
[0207] In one embodiment, the LTVEC comprises a selection cassette
or a reporter gene. Various forms of the selection cassette and
reporter gene that can be employed are discussed elsewhere
herein.
[0208] As described elsewhere herein, the LTVEC can also be used in
the methods provided herein in combination with a nuclease agent
that promotes a homologous recombination between the targeting
vector and the target locus of a rat nucleic acid in a pluripotent
rat cell.
[0209] In one embodiment, the large targeting vector (LTVEC)
comprises a 1 specific recombinase gene. In one embodiment, the
site-specific recombinase gene encodes a Cre recombinase. In one
embodiment, the Cre recombinase gene is Crei, wherein two exons
encoding the Cre recombinase are separated by an intron to prevent
its expression in a prokaryotic cell. In one embodiment, the Cre
recombinase gene further comprises a nuclear localization signal to
facilitate localization of Cre (or any recombinase or nuclease
agent) to the nucleus (e.g., the gene is an NL-Cre gene). In a
specific embodiment, the Cre recombinase gene further comprises a
nuclear localization signal and an intron (e.g., NL-Crei)
[0210] In various embodiments, a suitable promoter for expression
of the nuclease agent (including the Cre or Crei recombinase
discussed above) is selected from or comprises a Prm1, Blimp1,
Gata6, Gata4, Igf2, Lhx2, Lhx5, and/or Pax3. In a specific
embodiment, the promoter is the Gata6 or Gata4 promoter. The
various promoters can be from any organism, including for example,
a rodent such as a mouse or a rat. In another specific embodiment,
the promoter is a Prm1 promoter. In another specific embodiment,
the promoter is a rat Prm1 promoter. In another specific
embodiment, the promoter is a mouse Prm1 promoter. In another
specific embodiment, the promoter is a Blimp1 promoter or a
fragment thereof, e.g., a 1 kb or 2 kb fragment of a Blimp1
promoter, See, for example, U.S. Pat. No. 8,697,851 and U.S.
Application Publication 2013-0312129, both of which are herein
incorporated by reference in their entirety.
[0211] In one embodiment, the LTVEC comprises an insert nucleic
acid that can produce a deletion, addition, replacement or a
combination thereof of a region of the rat ApoE locus, the IL-2Rg
locus, the Rag2 locus, the Rag1 locus and/or the Rag2/Rag1 locus as
discussed in detail elsewhere herein. In specific embodiments, the
genetic modification at the ApoE locus results in a decrease, an
increase or a modulation in ApoE activity, IL-2Rg activity, Rag2
activity, Rag1 activity and/or Rag2 and Rag1 activity. In one
embodiment, an ApoE knockout, and IL-2Rg knockout, a Rag2 knockout,
a Rag1 knockout, a Rag2/Rag1 knockout is generated. As discussed
below, nuclease agents can be employed with any of the LTVEC
targeting systems to target any genomic locus of interest.
[0212] v. Nuclease Agents and Recognition Sites for Nuclease
Agents
[0213] As outlined in detail above, nuclease agents may be utilized
in the methods and compositions disclosed herein to aid in the
modification of the target locus both in a prokaryotic cell or
within a pluripotent rat cell. Such a nuclease agent may promote
homologous recombination between the targeting vector and the
target locus. In one embodiment, the nuclease agent comprises an
endonuclease agent.
[0214] As used herein, the term "recognition site for a nuclease
agent" comprises a DNA sequence at which a nick or double-strand
break is induced by a nuclease agent. The recognition site for a
nuclease agent can be endogenous (or native) to the cell or the
recognition site can be exogenous to the cell. In specific
embodiments, the recognition site is exogenous to the cell and
thereby is not naturally occurring in the genome of the cell. In
still further embodiments, the recognition site is exogenous to the
cell and to the polynucleotides of interest that one desired to be
positioned at the target genomic locus. In further embodiments, the
exogenous or endogenous recognition site is present only once in
the genome of the host cell. In specific embodiments, an endogenous
or native site that occurs only once within the genome is
identified. Such a site can then be used to design nuclease agents
that will produce a nick or double-strand break at the endogenous
recognition site.
[0215] The length of the recognition site can vary, and includes,
for example, recognition sites that are at least 4, 6, 8, 10, 12,
14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70 or more nucleotides in length. In one embodiment,
each monomer of the nuclease agent recognizes a recognition site of
at least 9 nucleotides. In other embodiments, the recognition site
is from about 9 to about 12 nucleotides in length, from about 12 to
about 15 nucleotides in length, from about 15 to about 18
nucleotides in length, or from about 18 to about 21 nucleotides in
length, and any combination of such subranges (e.g., 9-18
nucleotides). The recognition site could be palindromic, that is,
the sequence on one strand reads the same in the opposite direction
on the complementary strand. It is recognized that a given nuclease
agent can bind the recognition site and cleave that binding site or
alternatively, the nuclease agent can bind to a sequence that is
the different from the recognition site. Moreover, the term
recognition site comprises both the nuclease agent binding site and
the nick/cleavage site irrespective whether the nick/cleavage site
is within or outside the nuclease agent binding site. In another
variation, the cleavage by the nuclease agent can occur at
nucleotide positions immediately opposite each other to produce a
blunt end cut or, in other cases, the incisions can be staggered to
produce single-stranded overhangs, also called "sticky ends", which
can be either 5' overhangs, or 3' overhangs.
[0216] Any nuclease agent that induces a nick or double-strand
break into a desired recognition site can be used in the methods
and compositions disclosed herein. A naturally-occurring or native
nuclease agent can be employed so long as the nuclease agent
induces a nick or double-strand break in a desired recognition
site. Alternatively, a modified or engineered nuclease agent can be
employed. An "engineered nuclease agent" comprises a nuclease that
is engineered (modified or derived) from its native form to
specifically recognize and induce a nick or double-strand break in
the desired recognition site. Thus, an engineered nuclease agent
can be derived from a native, naturally-occurring nuclease agent or
it can be artificially created or synthesized. The modification of
the nuclease agent can be as little as one amino acid in a protein
cleavage agent or one nucleotide in a nucleic acid cleavage agent.
In some embodiments, the engineered nuclease induces a nick or
double-strand break in a recognition site, wherein the recognition
site was not a sequence that would have been recognized by a native
(non-engineered or non-modified) nuclease agent. Producing a nick
or double-strand break in a recognition site or other DNA can be
referred to herein as "cutting" or "cleaving" the recognition site
or other DNA.
[0217] Active variants and fragments of the exemplified recognition
sites are also provided. Such active variants can comprise at least
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or more sequence identity to the given recognition site,
wherein the active variants retain biological activity and hence
are capable of being recognized and cleaved by a nuclease agent in
a sequence-specific manner. Assays to measure the double-strand
break of a recognition site by a nuclease agent are known in the
art and generally measure the ability of a nuclease to cut the
recognition site.
[0218] The recognition site of the nuclease agent can be positioned
anywhere in or near the target locus. The recognition site can be
located within a coding region of a gene, or within regulatory
regions, which influence expression of the gene. Thus, a
recognition site of the nuclease agent can be located in an intron,
an exon, a promoter, an enhancer, a regulatory region, or any
non-protein coding region.
[0219] In one embodiment, the nuclease agent is a Transcription
Activator-Like Effector Nuclease (TALEN). TAL effector nucleases
are a class of sequence-specific nucleases that can be used to make
double-strand breaks at specific target sequences in the genome of
a prokaryotic or eukaryotic organism. TAL effector nucleases are
created by fusing a native or engineered transcription
activator-like (TAL) effector, or functional part thereof, to the
catalytic domain of an endonuclease, such as, for example, FokI.
The unique, modular TAL effector DNA binding domain allows for the
design of proteins with potentially any given DNA recognition
specificity. Thus, the DNA binding domains of the TAL effector
nucleases can be engineered to recognize specific DNA target sites
and thus, used to make double-strand breaks at desired target
sequences. See, WO 2010/079430; Morbitzer et al. (2010) PNAS
10.1073/pnas.1013133107; Scholze & Boch (2010) Virulence
1:428-432; Christian et al. Genetics (2010) 186:757-761; Li et al.
(2010) Nuc. Acids Res. (2010) doi:10.1093/nar/gkq704; and Miller et
al. (2011) Nature Biotechnology 29:143-148; all of which are herein
incorporated by reference.
[0220] Examples of suitable TAL nucleases, and methods for
preparing suitable TAL nucleases, are disclosed, e.g., in US Patent
Application No. 2011/0239315 A1, 2011/0269234 A1, 2011/0145940 A1,
2003/0232410 A1, 2005/0208489 A1, 2005/0026157 A1, 2005/0064474 A1,
2006/0188987 A1, and 2006/0063231 A1 (each hereby incorporated by
reference). In various embodiments, TAL effector nucleases are
engineered that cut in or near a target nucleic acid sequence in,
e.g., a genomic locus of interest, wherein the target nucleic acid
sequence is at or near a sequence to be modified by a targeting
vector. The TAL nucleases suitable for use with the various methods
and compositions provided herein include those that are
specifically designed to bind at or near target nucleic acid
sequences to be modified by targeting vectors as described
herein.
[0221] In one embodiment, each monomer of the TALEN comprises 12-25
TAL repeats, wherein each TAL repeat binds a 1 bp subsite. In one
embodiment, the nuclease agent is a chimeric protein comprising a
TAL repeat-based DNA binding domain operably linked to an
independent nuclease. In one embodiment, the independent nuclease
is a FokI endonuclease. In one embodiment, the nuclease agent
comprises a first TAL-repeat-based DNA binding domain and a second
TAL-repeat-based DNA binding domain, wherein each of the first and
the second TAL-repeat-based DNA binding domain is operably linked
to a FokI nuclease, wherein the first and the second
TAL-repeat-based DNA binding domain recognize two contiguous target
DNA sequences in each strand of the target DNA sequence separated
by about 6 bp to about 40 bp cleavage site, and wherein the FokI
nucleases dimerize and make a double strand break at a target
sequence.
[0222] In one embodiment, the nuclease agent comprises a first
TAL-repeat-based DNA binding domain and a second TAL-repeat-based
DNA binding domain, wherein each of the first and the second
TAL-repeat-based DNA binding domain is operably linked to a FokI
nuclease, wherein the first and the second TAL-repeat-based DNA
binding domain recognize two contiguous target DNA sequences in
each strand of the target DNA sequence separated by a 5 bp or 6 bp
cleavage site, and wherein the FokI nucleases dimerize and make a
double strand break.
[0223] The nuclease agent employed in the various methods and
compositions disclosed herein can further comprise a zinc-finger
nuclease (ZFN). In one embodiment, each monomer of the ZFN
comprises 3 or more zinc finger-based DNA binding domains, wherein
each zinc finger-based DNA binding domain binds to a 3 bp subsite.
In other embodiments, the ZFN is a chimeric protein comprising a
zinc finger-based DNA binding domain operably linked to an
independent nuclease. In one embodiment, the independent
endonuclease is a FokI endonuclease. In one embodiment, the
nuclease agent comprises a first ZFN and a second ZFN, wherein each
of the first ZFN and the second ZFN is operably linked to a FokI
nuclease, wherein the first and the second ZFN recognize two
contiguous target DNA sequences in each strand of the target DNA
sequence separated by about 6 bp to about 40 bp cleavage site or
about a 5 bp to about 6 bp cleavage site, and wherein the FokI
nucleases dimerize and make a double strand break. See, for
example, US20060246567; US20080182332; US20020081614;
US20030021776; WO/2002/057308A2; US20130123484; US20100291048; and,
WO/2011/017293A2, each of which is herein incorporated by
reference.
[0224] In one embodiment of the methods provided herein, the
nuclease agent comprises (a) a chimeric protein comprising a zinc
finger-based DNA binding domain fused to a FokI endonuclease; or,
(b) a chimeric protein comprising a Transcription Activator-Like
Effector Nuclease (TALEN) fused to a FokI endonuclease.
[0225] In still another embodiment, the nuclease agent is a
meganuclease. Meganucleases have been classified into four families
based on conserved sequence motifs, the families are the LAGLIDADG
(SEQ ID NO: 16), GIY-YIG, H-N-H, and His-Cys box families. These
motifs participate in the coordination of metal ions and hydrolysis
of phosphodiester bonds. HEases are notable for their long
recognition sites, and for tolerating some sequence polymorphisms
in their DNA substrates. Meganuclease domains, structure and
function are known, see for example, Guhan and Muniyappa (2003)
Crit Rev Biochem Mol Biol 38:199-248; Lucas et al., (2001) Nucleic
Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci
55:1304-26; Stoddard, (2006) Q Rev Biophys 38:49-95; and Moure et
al., (2002) Nat Struct Biol 9:764. In some examples a naturally
occurring variant, and/or engineered derivative meganuclease is
used. Methods for modifying the kinetics, cofactor interactions,
expression, optimal conditions, and/or recognition site
specificity, and screening for activity are known, see for example,
Epinat et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier et
al., (2002) Mol Cell 10:895-905; Gimble et al., (2003) Mol Biol
334:993-1008; Seligman et al., (2002) Nucleic Acids Res 30:3870-9;
Sussman et al., (2004) J Mol Biol 342:31-41; Rosen et al., (2006)
Nucleic Acids Res 34:4791-800; Chames et al., (2005) Nucleic Acids
Res 33:e178; Smith et al., (2006) Nucleic Acids Res 34:e149; Gruen
et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005)
Nucleic Acids Res 33:e154; WO2005105989; WO2003078619;
WO2006097854; WO2006097853; WO2006097784; and WO2004031346.
[0226] Any meganuclease can be used herein, including, but not
limited to, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI,
I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP,
I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI,
F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI,
I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI,
I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI,
I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP,
I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP,
I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP,
I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P,
I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP,
I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP
PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP,
PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI,
PI-TliII, or any active variants or fragments thereof.
[0227] In one embodiment, the meganuclease recognizes
double-stranded DNA sequences of 12 to 40 base pairs. In one
embodiment, the meganuclease recognizes one perfectly matched
target sequence in the genome. In one embodiment, the meganuclease
is a homing nuclease. In one embodiment, the homing nuclease is a
LAGLIDADG (SEQ ID NO: 16) family of homing nuclease. In one
embodiment, the LAGLIDADG (SEQ ID NO: 16) family of homing nuclease
is selected from I-SceI, I-CreI, and I-DmoI.
[0228] Nuclease agents can further comprise restriction
endonucleases, which include Type I, Type II, Type III, and Type IV
endonucleases. Type I and Type III restriction endonucleases
recognize specific recognition sites, but typically cleave at a
variable position from the nuclease binding site, which can be
hundreds of base pairs away from the cleavage site (recognition
site). In Type II systems the restriction activity is independent
of any methylase activity, and cleavage typically occurs at
specific sites within or near to the binding site. Most Type II
enzymes cut palindromic sequences, however Type IIa enzymes
recognize non-palindromic recognition sites and cleave outside of
the recognition site, Type IIb enzymes cut sequences twice with
both sites outside of the recognition site, and Type IIs enzymes
recognize an asymmetric recognition site and cleave on one side and
at a defined distance of about 1-20 nucleotides from the
recognition site. Type IV restriction enzymes target methylated
DNA. Restriction enzymes are further described and classified, for
example in the REBASE database (webpage at rebase.neb.com; Roberts
et al., (2003) Nucleic Acids Res 31:418-20), Roberts et al., (2003)
Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile
DNA II, pp. 761-783, Eds. Craigie et al., (ASM Press, Washington,
D.C.).
[0229] The nuclease agent employed in the various methods and
compositions can also comprise a CRISPR/Cas system. Such systems
can employ, for example, a Cas9 nuclease, which in some instances,
is codon-optimized for the desired cell type in which it is to be
expressed. The system further employs a fused crRNA-tracrRNA
construct that functions with the codon-optimized Cas9. This single
RNA is often referred to as a guide RNA or gRNA. Within a gRNA, the
crRNA portion is identified as the `target sequence` for the given
recognition site and the tracrRNA is often referred to as the
`scaffold`. Briefly, a short DNA fragment containing the target
sequence is inserted into a guide RNA expression plasmid. The gRNA
expression plasmid comprises the target sequence (in some
embodiments around 20 nucleotides), a form of the tracrRNA sequence
(the scaffold) as well as a suitable promoter that is active in the
cell and necessary elements for proper processing in eukaryotic
cells. Many of the systems rely on custom, complementary oligos
that are annealed to form a double stranded DNA and then cloned
into the gRNA expression plasmid. The gRNA expression cassette and
the Cas9 expression cassette is then introduced into the cell. See,
for example, Mali P et al. (2013) Science 2013 Feb. 15;
339(6121):823-6; Jinek M et al. Science 2012 Aug. 17;
337(6096):816-21; Hwang W Y et al. Nat Biotechnol 2013 March;
31(3):227-9; Jiang W et al. Nat Biotechnol 2013 March; 31(3):233-9;
and, Cong L et al. Science 2013 Feb. 15; 339(6121):819-23, each of
which is herein incorporated by reference.
[0230] In one embodiment, the method for modifying a genomic locus
of interest in a pluripotent rat cell further comprises introducing
into the pluripotent rat cell: (a) a first expression construct
comprising a first promoter operably linked to a first nucleic acid
sequence encoding a Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR)-associated (Cas) protein; (b) a second
expression construct comprising a second promoter operably linked
to a genomic target sequence linked to a guide RNA (gRNA), wherein
the genomic target sequence is flanked on the 3' end by a
Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the
genomic target sequence comprises the nucleotide sequence of
GNNNNNNNNNNNNNNNNNNNNGG (GN.sub.1-20 GG; SEQ ID NO: 1). In one
embodiment, the genomic target sequence comprises SEQ ID NO:23,
wherein N is between 1 and 20 nucleotides in length. In another
embodiment, the genomic target sequence comprises between 14 and 20
nucleotides in length of SEQ ID NO:1.
[0231] In one embodiment, the gRNA comprises a third nucleic acid
sequence encoding a Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR) RNA (crRNA) and a trans-activating
CRISPR RNA (tracrRNA). In specific embodiments, the Cas protein is
Cas9.
[0232] In some embodiments, the gRNA comprises (a) the chimeric RNA
of the nucleic acid sequence 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU
AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO:
2); or, (b) the chimeric RNA of the nucleic acid sequence
5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG-3' (SEQ ID NO:
3).
[0233] In another embodiment, the crRNA comprises
5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3' (SEQ ID NO: 4);
5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG (SEQ ID NO: 5); or
5'-GAGUCCGAGCAGAAGAAGAAGUUUUA-3' (SEQ ID NO: 6).
[0234] In yet other embodiments, the tracrRNA comprises,
5'-AAGGCUAGUCCG-3' (SEQ ID NO: 7) or 5'-AAGGCUAGUCCGU
UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO:
[0235] In one embodiment, the Cas protein is a type I Cas protein.
In one embodiment, the Cas protein is a type II Cas protein. In one
embodiment, the type II Cas protein is Cas9. In one embodiment, the
first nucleic acid sequence encodes a human codon-optimized Cas
protein.
[0236] In one embodiment, the first nucleic acid comprises a
mutation that disrupts at least one amino acid residue of nuclease
active sites in the Cas protein, wherein the mutant Cas protein
generates a break in only one strand of the target DNA region, and
wherein the mutation diminishes nonhomologous recombination in the
target DNA region.
[0237] In one embodiment, the first nucleic acid that encodes the
Cas protein further comprises a nuclear localization signal (NLS).
In one embodiment, the nuclear localization signal is a SV40
nuclear localization signal.
[0238] In one embodiment, the second promoter that drives the
expression of the genomic target sequence and the guide RNA (gRNA)
is an RNA polymerase III promoter. In one embodiment, the RNA
polymerase III promoter is a human U6 promoter. In one embodiment,
the RNA polymerase III promoter is a rat U6 polymerase III
promoter. In one embodiment, the RNA polymerase III promoter is a
mouse U6 polymerase III promoter.
[0239] In one embodiment, the nucleic acid sequences encoding crRNA
and the tracrRNA are linked via a synthetic loop, wherein, upon
expression, the crRNA and the tracrRNA forms a crRNA:tracrRNA
duplex.
[0240] In one embodiment, the first expression construct and the
second expression construct are expressed from a same plasmid.
[0241] In one embodiment, the first and the second expression
constructs are introduced together with the LTVEC. In one
embodiment, the first and the second expression constructs are
introduced separately from the LTVEC over a period of time.
[0242] In one embodiment, the method comprises introducing a
plurality of the second construct and a plurality of the LTVEC for
multiplex editing of distinct target loci as described herein.
[0243] Active variants and fragments of nuclease agents (i.e. an
engineered nuclease agent) are also provided. Such active variants
can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the
native nuclease agent, wherein the active variants retain the
ability to cut at a desired recognition site and hence retain nick
or double-strand-break-inducing activity. For example, any of the
nuclease agents described herein can be modified from a native
endonuclease sequence and designed to recognize and induce a nick
or double-strand break at a recognition site that was not
recognized by the native nuclease agent. Thus in some embodiments,
the engineered nuclease has a specificity to induce a nick or
double-strand break at a recognition site that is different from
the corresponding native nuclease agent recognition site. Assays
for nick or double-strand-break-inducing activity are known and
generally measure the overall activity and specificity of the
endonuclease on DNA substrates containing the recognition site.
[0244] The nuclease agent may be introduced into the cell by any
means known in the art. The polypeptide encoding the nuclease agent
may be directly introduced into the cell. Alternatively, a
polynucleotide encoding the nuclease agent can be introduced into
the cell. When a polynucleotide encoding the nuclease agent is
introduced into the cell, the nuclease agent can be transiently,
conditionally or constitutively expressed within the cell. Thus,
the polynucleotide encoding the nuclease agent can be contained in
an expression cassette and be operably linked to a conditional
promoter, an inducible promoter, a constitutive promoter, or a
tissue-specific promoter. Such promoters of interest are discussed
in further detail elsewhere herein. Alternatively, the nuclease
agent is introduced into the cell as an mRNA encoding or comprising
a nuclease agent.
[0245] In one embodiment, the cRNA and the tracrRNA are expressed
as separate RNA transcripts.
[0246] In specific embodiments, the polynucleotide encoding the
nuclease agent is stably integrated in the genome of the cell and
operably linked to a promoter active in the cell. In other
embodiments, the polynucleotide encoding the nuclease agent is in
the same targeting vector comprising the insert nucleic acid, while
in other instances the polynucleotide encoding the nuclease agent
is in a vector or a plasmid that is separate from the targeting
vector comprising the insert nucleic acid.
[0247] When the nuclease agent is provided to the cell through the
introduction of polynucleotide encoding the nuclease agent, such a
polynucleotide encoding a nuclease agent can be modified to
substitute codons having a higher frequency of usage in the cell of
interest, as compared to the naturally occurring polynucleotide
sequence encoding the nuclease agent. For example the
polynucleotide encoding the nuclease agent can be modified to
substitute codons having a higher frequency of usage in a given
prokaryotic or eukaryotic cell of interest, including a bacterial
cell, a yeast cell, a human cell, a non-human cell, a mammalian
cell, a rodent cell, a mouse cell, a rat cell or any other host
cell of interest, as compared to the naturally occurring
polynucleotide sequence.
[0248] In one embodiment, the endonuclease agent is introduced
together with the LTVEC. In one embodiment, the endonuclease agent
is introduced separately from the LTVEC over a period of time. In
one embodiment, the endonuclease agent is introduced prior to the
introduction of the LTVEC. In one embodiment, the endonuclease
agent is introduced into the rat ES cell following introduction of
the LTVEC.
[0249] In one embodiment, the endonuclease agent is an expression
construct comprising a nucleic acid sequence encoding an
endonuclease, wherein the nucleic acid sequence is operably linked
to a promoter. In one embodiment, the promoter is a constitutively
active promoter. In one embodiment, the promoter is an inducible
promoter. In one embodiment, the promoter is active in the
pluripotent rat cell. In one embodiment, the endonuclease agent is
an mRNA encoding an endonuclease.
[0250] B. Methods for Integrating a Polynucleotide of Interest Into
a Target Locus
[0251] Methods for modifying a target locus of interest are
provided. In one embodiment, a target locus in a pluripotent rat
cell is targeted for genetic modification. Such a method comprises:
(a) introducing into the pluripotent rat cell a targeting vector
comprising an insert nucleic acid flanked with a 5' rat homology
arm and a 3' rat homology arm; and (b) identifying a genetically
modified pluripotent rat cell comprising the targeted genetic
modification at the target locus, wherein the targeted genetic
modification is capable of being transmitted through the germline.
In specific embodiments, the sum total of the 5' homology arm and
the 3' homology arm is at least 10 kb and/or a large targeting
vector is employed.
[0252] In other embodiments, the size of the sum total of the total
of the 5' and 3' homology arms of the LTVEC is about 10 kb to about
150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb,
about 20 kb to about 150 kb, about 20 kb to about 100 kb, about 20
kb to about 75 kb, about 30 kb to about 150 kb, about 30 kb to
about 100 kb, about 30 kb to about 75 kb, about 40 kb to about 150
kb, about 40 kb to about 100 kb, about 40 kb to about 75 kb, about
50 kb to about 150 kb, about 50 kb to about 100 kb, or about 50 kb
to about 75 kb, about 10 kb to about 30 kb, about 20 kb to about 40
kb, about 40 kb to about 60 kb, about 60 kb to about 80 kb, about
80 kb to about 100 kb, about 100 kb to about 120 kb, or from about
120 kb to about 150 kb. In one embodiment, the size of the deletion
is the same or similar to the size of the sum total of the 5' and
3' homology arms of the LTVEC.
[0253] The pluripotent rat cell can be a rat embryonic stem cell.
In a specific embodiment, (a) the rat ES cell is derived from a DA
strain or an ACI strain; or, (b) the rat ES cell is characterized
by expression of a pluripotency marker comprising Oct-4, Sox-2,
alkaline phosphatase, or a combination thereof. In other instances,
the rat embryonic stem cell employed comprises a rat ES cell as
described in U.S. patent application Ser. No. 14/185,103, filed on
Feb. 20, 2014, herein incorporated by reference in its
entirety.
[0254] As described elsewhere herein, the insert nucleic acid can
be any nucleic acid sequence. In non-limiting embodiments, (a) the
insert nucleic acid comprises a replacement of an endogenous rat
nucleic acid sequence with a homologous or a orthologous mammalian
nucleic acid sequence; (b) the insert nucleic acid comprises a
deletion of an endogenous rat nucleic acid sequence; (c) the insert
nucleic acid comprises a deletion of an endogenous rat nucleic acid
sequence, wherein the deletion ranges from 5 kb to 200 kb or from 5
kb to 3 Mb (as discussed in detail elsewhere herein); (d) the
insert nucleic acid comprises an addition of an exogenous nucleic
acid sequence (including for example an exogenous nucleic acid
sequence ranging from about 5 kb to about 10 kb, from about 10 kb
to about 20 kb, from about 20 kb to about 40 kb, from about 40 kb
to about 60 kb, from about 60 kb to about 80 kb, from about 80 kb
to about 100 kb, from about 100 kb to about 150 kb, from about 150
kb to about 200 kb, from about 200 kb to about 250 kb, from about
250 kb to about 300 kb, from about 300 kb to about 350 kb, or from
about 350 kb to about 400 kb); (e) the insert nucleic acid
comprises an exogenous nucleic acid sequence comprising a
homologous or an orthologous nucleic acid sequence; (f) the
homologous or the orthologous nucleic acid sequence of (a) wherein
the nucleic acid sequence is a human nucleic acid sequence; (g) the
insert nucleic acid comprises the homologous or the orthologous
nucleic acid sequence of wherein the nucleic acid sequence is a
chimeric nucleic acid sequence comprising a human and a rat nucleic
acid sequence; (h) the insert nucleic acid comprises the exogenous
nucleic acid sequence of (e), wherein the insert nucleic acid
ranges from about 5 kb to about 200 kb; (i) the insert nucleic acid
comprises a conditional allele flanked with site-specific
recombinase target sequences; (j) the insert nucleic acid comprises
a reporter gene operably linked to a promoter; (k) the insert
nucleic acid comprises one or more unrearranged human
immunoglobulin heavy chain V.sub.H gene segments, one or more
unrearranged human immunoglobulin heavy chain D gene segments, and
one or more unrearranged human immunoglobulin heavy chain J.sub.H
gene segments, which are operably linked to a rodent heavy chain
constant region nucleic acid sequence; (l) the insert nucleic acid
comprises a rearranged human immunoglobulin heavy chain variable
region nucleic acid sequence operably linked to a rodent heavy
chain constant region nucleic acid sequence; (m) the insert nucleic
acid comprises one or more unrearranged human immunogloulin
V.sub..kappa. or V.sub..lamda. gene segments and one or more
unrearranged human immunoglobulin J.sub..kappa. or J.sub..lamda.
gene segments, which are operably linked to a mammalian
immunoglobulin .lamda. or .kappa. light chain light chain constant
region nucleic acid sequence; (n) the insert nucleic acid comprises
a rearranged human immunoglobulin .lamda. or .kappa. light chain
variable region nucleic acid sequence operably linked to a
mammalian immunoglobulin .lamda. or .kappa. light chain light chain
constant region nucleic acid sequence; (o) the mammalian heavy
chain constant region nucleic acid sequence of (k) and/or (l)
comprises a rat constant region nucleic acid sequence, a human
constant region nucleic acid sequence, or a combination thereof;
or, (p) the mammalian immunoglobulin .lamda. or .kappa. light chain
constant region nucleic acid of (m) and/or (n) comprises a rat
constant region nucleic acid sequence, a human constant region
nucleic acid sequence, or a combination thereof.
[0255] In one embodiment, the insert nucleic acid comprises one or
more functional human V.sub.H gene segments comprising V.sub.H1-2,
V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45,
V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26,
V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13,
V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23,
V.sub.H3-30, V.sub.H3-30-3, V.sub.H3-30-5, V.sub.H3-33,
V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49,
V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73,
V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2,
V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59,
V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, or
a combination thereof.
[0256] In one embodiment, the insert nucleic acid comprises one or
more functional human D gene segments comprising D1-1, D1-7, D1-14,
D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16,
D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6,
D6-13, D6-19, D6-25, D7-27, or a combination thereof.
[0257] In one embodiment, the insert nucleic acid comprises one or
more functional J.sub.H gene segments comprising J.sub.H1,
J.sub.H2, JO, J.sub.H4, J.sub.H5, J.sub.H6, or a combination
thereof. In one embodiment, the insert nucleic acid comprises one
or more human V.kappa. gene segments comprising V.kappa.4-1,
V.kappa.5-2, V.kappa.7-3, V.kappa.2-4, V.kappa.1-5, V.kappa.1-6,
V.kappa.3-7, V.kappa.1-8, V.kappa.1-9, V.kappa.2-10, V.kappa.3-11,
V.kappa.1-12, V.kappa.1-13, V.kappa.2-14, V.kappa.3-15,
V.kappa.1-16, V.kappa.1-17, V.kappa.2-18, V.kappa.2-19,
V.kappa.3-20, V.kappa.6-21, V.kappa.1-22, V.kappa.1-23,
V.kappa.2-24, V.kappa.3-25, V.kappa.2-26, V.kappa.1-27,
V.kappa.2-28, V.kappa.2-29, V.kappa.2-30, V.kappa.3-31,
V.kappa.1-32, V.kappa.1-33, V.kappa.3-34, V.kappa.1-35,
V.kappa.2-36, V.kappa.1-37, V.kappa.2-38, V.kappa.1-39,
V.kappa.2-40, or a combination thereof.
[0258] In one embodiment, the insert nucleic acid comprises one or
more human V.lamda. gene segments comprising V.lamda.3-1,
V.lamda.2-8, V.lamda.3-9, V.lamda.3-10, V.lamda.2-11, V.lamda.3-12,
V.lamda.2-14, V.lamda.3-16, V.lamda.2-18, V.lamda.3-19,
V.lamda.3-21, V.lamda.2-23, V.lamda.3-25, V.lamda.3-27, or a
combination thereof.
[0259] In one embodiment, the insert nucleic acid comprises one or
more human J.kappa. gene segments comprising J.kappa.1, J.kappa.2,
J.kappa.3, J.kappa.4, J.kappa.5, or a combination thereof.
[0260] In specific embodiments, upon modification of the target
locus in a pluripotent rat cell, the genetic modification is
transmitted through the germline.
[0261] In one embodiment, the insert nucleic acid sequence
comprises a polynucleotide that when integrated into the genome
will produce a genetic modification of a region of the rat ApoE
locus, wherein the genetic modification at the ApoE locus results
in a decrease in ApoE activity, an increase in ApoE activity or a
modulation of ApoE activity. In one embodiment, an ApoE knockout is
generated.
[0262] In one embodiment, the insert nucleic acid sequence
comprises a polynucleotide that when integrated into the genome
will produce a genetic modification of a region of the rat
interleukin-2 receptor gamma locus, wherein the genetic
modification at the interleukin-2 receptor gamma locus results in a
decrease in interleukin-2 receptor activity, an increase in
interleukin-2 receptor gamma activity, or a modulation of
interleukin-2 receptor activity. In one embodiment, an
interleukin-2 receptor knockout is generated.
[0263] In still another embodiment, the insert nucleic acid
sequence comprises a polynucleotide that when integrated into the
genome will produce a genetic modification of a region of the rat
Rag1 locus, the rat Rag2 locus and/or the rat Rag2/Rag1 locus,
wherein the genetic modification at the rat Rag1, Rag2 and/or
Rag2/Rag1 locus results in a decrease in Rag1, Rag2 or Rag1 and
Rag2 protein activity, an increase in Rag1, Rag2 or Rag1 and Rag2
protein activity, or a modulation in Rag1, Rag2 or Rag1 and Rag2
protein activity. In one embodiment, a Rag1, Rag2 or Rag2/Rag1
knockout is generated.
[0264] In further embodiments, the insert nucleic acid results in
the replacement of a portion of the rat ApoE locus, the
interleukin-2 receptor gamma locus and/or Rag2 locus, and/or Rag1
locus and/or Rag2/Rag1 locus with the corresponding orthologous
portion of an ApoE locus, an interleukin-2 receptor gamma locus, a
Rag2 locus, a Rag1 locus and/or a Rag2/Rag1 locus from another
organism.
[0265] Still other embodiments, the insert nucleic acid comprises a
polynucleotide sharing across its full length least 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a portion of an ApoE
locus, an interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1
locus and/or a Rag2/Rag1 locus it is replacing.
[0266] The given insert polynucleotide and the corresponding region
of the rat locus being replaced can be a coding region, an intron,
an exon, an untranslated region, a regulatory region, a promoter,
or an enhancer or any combination thereof. Moreover, the given
insert polynucleotide and/or the region of the rat locus being
replaced can be of any desired length, including for example,
between 10-100 nucleotides in length, 100-500 nucleotides in
length, 500-1 kb nucleotide in length, 1 Kb to 1.5 kb nucleotide in
length, 1.5 kb to 2 kb nucleotides in length, 2 kb to 2.5 kb
nucleotides in length, 2.5 kb to 3 kb nucleotides in length, 3 kb
to 5 kb nucleotides in length, 5 kb to 8 kb nucleotides in length,
8 kb to 10 kb nucleotides in length or more. In other instances,
the size of the insertion or replacement is from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 40 kb, from about 40 kb to about 60 kb, from about 60 kb to
about 80 kb, from about 80 kb to about 100 kb, from about 100 kb to
about 150 kb, from about 150 kb to about 200 kb, from about 200 kb
to about 250 kb, from about 250 kb to about 300 kb, from about 300
kb to about 350 kb, from about 350 kb to about 400 kb, from about
400 kb to about 800 kb, from about 800 kb to 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb,
to about 2.5 Mb, from about 2.5 Mb to about 2.8 Mb, from about 2.8
Mb to about 3 Mb. In other embodiments, the given insert
polynucleotide and/or the region of the rat locus being replaced is
at least 100, 200, 300, 400, 500, 600, 700, 800, or 900 nucleotides
or at least 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb,
10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 16 kb or greater.
[0267] i. Methods for Modifying a Target Locus of a Rat Nucleic
Acid via Bacterial Homologous Recombination (BHR)
[0268] Methods and compositions are provided for modifying a target
locus of a rat nucleic acid via bacterial homologous recombination
(BHR) in a prokaryotic cell. Such methods find use in utilizing
bacterial homologous recombination in a prokaryotic cell to
genetically modify a target locus of a rat nucleic acid in order to
create a targeting vector. Such a targeting vector comprising the
genetically modified target locus can be introduced into a
eukaryotic cell, for example, a pluripotent rat cell. "Homologous
recombination" includes the exchange of DNA fragments between two
DNA molecules at cross-over sites within regions of homology. Thus,
"bacterial homologous recombination" or "BHR" includes homologous
recombination that occurs in bacteria.
[0269] Methods for modifying a target locus of a rat nucleic acid
via bacterial homologous recombination (BHR) are provided that
comprise introducing into a prokaryotic cell a targeting vector
comprising an insert nucleic acid flanked with a 5' rat homology
arm and a 3' rat homology arm, wherein the prokaryotic cell
comprises a rat nucleic acid and is capable of expressing a
recombinase that mediates the BHR at the target locus. Such
targeting vectors can include any of the large targeting vectors
described herein.
[0270] In one embodiment, the method comprises introducing into a
prokaryotic cell: (i) a first construct comprising a rat nucleic
acid having a DNA sequence of interest; (ii) a second targeting
construct comprising an insert nucleic acid flanked with a rat 5'
homology arm and a rat 3' homology arm, and (iii) a third construct
encoding a recombinase that mediates bacterial homologous
recombination. In one embodiment, the first, the second, and the
third construct are introduced into the prokaryotic cell separately
over a period of time. In one embodiment, the prokaryotic cell
comprises a nucleic acid that encodes the recombinase, and the
method does not require introduction of the third construct. In one
embodiment, the recombinase is expressed under the control of an
inducible promoter.
[0271] In one embodiment the first construct comprising the rat
nucleic acid is derived from a bacterial artificial chromosome
(BAC) or yeast artificial chromosome (YAC).
[0272] A prokaryotic cell comprising the insert nucleic acid at the
target genomic locus can be selected. This method can be serially
repeated as disclosed herein to allow the introduction of multiple
insert nucleic acids at the targeted rat locus in the prokaryotic
cell. Once the target rat nucleic acid locus is "built" within the
prokaryotic cell, a targeting vector comprising the modified rat
target locus can be isolated from the prokaryotic cell and
introduced into a target genomic locus within a mammalian cell
(i.e., a rat cell, a pluripotent rat cell, or a rat embryonic stem
cell).
[0273] Preferred rat cells for receiving targeting vectors are
described in U.S. application Ser. No. 14/185,703, filed Feb. 20,
2014, the contents of which are summarized herein. These rat cells
are pluripotent rat cells capable of sustaining their pluripotency
following one or more targeted genetic modifications in vitro, and
are capable of transmitting the targeted genetic modifications
through the germline.
[0274] Electroporated pluripotent rat cells are plated at a high
density for the selection of drug-resistant cells comprising the
targeting vector. The drug selection process removes the majority
of the plated cells (.about.99%), leaving behind individual
colonies, each of which is a clone derived from a single cell. Of
the remaining cells, most cells (.about.80-100%) contain the
targeting vector (comprising a drug selection cassette) integrated
at a random location in the genome. Therefore, the colonies are
picked individually and genotyped to identify rat ES cells
harboring the targeting vector at the correct genomic location
(e.g., using the modification of allele assay described below).
[0275] A high-throughput quantitative assay, namely, modification
of allele (MOA) assay, can be used for genotyping. Such an assay
allows a large-scale screening of a modified allele(s) in a
parental chromosome following a genetic modification. The MOA assay
can be carried out via various analytical techniques, including,
but not limited to, a quantitative PCR, e.g., a real-time PCR
(qPCR). For example, the real-time PCR comprises a first primer set
that recognizes the target locus and a second primer set that
recognizes a non-targeted reference locus. In addition, the primer
set comprises a fluorescent probe that recognizes the amplified
sequence. In one embodiment, the quantitative assay is carried out
via Invader Probes.RTM.. In one embodiment, the quantitative assay
is carried out via MMP Assays.RTM.. In one embodiment, the
quantitative assay is carried out via TaqMan.RTM. Molecular Beacon.
In one embodiment, the quantitative assay is carried out via
Eclipse.TM. probe technology. (See, for example, US2005/0144655,
which is incorporated by reference herein in its entirety).
[0276] The selected pluripotent rat cell or the rat ES cells
comprising the targeted genetic modification can then be introduced
into a host rat embryo, for example, a pre-morula stage or
blastocyst stage rat embryo, and implanted in the uterus of a
surrogate mother to generate a founder rat (F0 rat). Subsequently,
the founder rat can be bred to a wild-type rat to create F1 progeny
heterozygous for the genetic modification. Mating of the
heterozygous F1 rat can produce progeny homozygous for the genetic
modification. Mating of the heterozygous F1 rat can produce progeny
homozygous for the genetic modification. In some embodiments,
various genetic modifications of the target loci described herein
can be carried out using a large targeting vector (LTVEC) as
described in detail elsewhere herein. For example, an LTVEC can be
derived from Bacterial Artificial Chromosome (BAC) DNA using
VELOCIGENE.RTM. genetic engineering technology (see, e.g., U.S.
Pat. No. 6,586,251 and Valenzuela, D. M. et al. (2003),
High-throughput engineering of the mouse genome coupled with
high-resolution expression analysis, Nature Biotechnology 21(6):
652-659, which is incorporated herein by reference in their
entireties).
[0277] Use of bacterial homologous recombination (BHR) to generate
a large targeting vector (LTVEC) circumvents the limitations of
plasmids in accommodating a large genomic DNA fragment and
consequent low efficiency of introducing a targeted modification
into an endogenous locus pluripotent rat cells. One or more
targeted genetic modifications can be performed in generating a
LTVEC. An exemplary LTVEC produced in the prokaryotic cell can
comprises an insert nucleic acid that carries a rat genomic
sequence with one or more genetic modifications or an exogenous
nucleic acid (e.g., a homolog or ortholog of a rat nucleic acid),
which is flanked by rat homologous arms complementary to specific
genomic regions.
[0278] Host prokaryotic cells comprising the various targeting
vectors described herein are also provided. Such prokaryotic cells
include, but are not limited to, bacteria such as E. coli. In one
embodiment, a host prokaryotic cell comprises a targeting vector
comprising an insert nucleic acid flanked with a 5 rat homology arm
and a 3' rat homology arm, wherein the insert nucleic acid ranges
from about 5 kb to about 200 kb.
[0279] The host prokaryotic cell can further comprise a nucleic
acid that encodes a recombinase polypeptide or the nucleic acid
that encodes the recombinase polypeptide is operably linked to an
inducible promoter.
[0280] Further provided are various methods and compositions, which
employ the LTVEC as described herein in combination with a
prokaryotic cell in order to produce targeted genetic
modifications, Such compositions and methods are discussed
elsewhere herein.
[0281] Methods for modifying a target locus of a nucleic acid via
bacterial homologous recombination (BHR) are provided that comprise
introducing into a prokaryotic cell a targeting vector comprising
an insert nucleic acid flanked with a 5' homology arm and a 3'
homology arm, wherein the prokaryotic cell comprises nucleic acids
corresponding to the 5' and 3' homology arms and the prokaryotic
cell is capable of expressing a recombinase that mediates the BHR
at the target locus. Such targeting vectors can include any of the
large targeting vectors described herein. Such methods can employ a
LTVEC as discussed in detail herein and further employ the
CRISPR/Cas system as discussed elsewhere herein.
[0282] ii. Methods for Modifying a Target Locus of Interest in a
Pluripotent Rat Cell
[0283] Further provided is a method for modifying a target locus of
interest in a pluripotent rat cell via targeted genetic
modification, comprising (a) introducing into the pluripotent rat
cell a targeting vector comprising an insert nucleic acid flanked
with a 5' rat homology arm and a 3' rat homology arm, wherein the
sum total of the 5' homology arm and the 3' homology arm is at
least 10 kb; and (b) identifying a genetically modified pluripotent
rat cell comprising the targeted genetic modification at the target
locus of interest. In one embodiment, the sum total of the 5'
homology arm and the 3' homology arm is at least about 16 kb to
about 30 kb. In specific embodiments, the targeted genetic
modification is capable of being transmitted through the germline.
Such targeting vectors can include any of the large targeting
vectors described herein.
[0284] In one aspect, a method for modifying a genomic locus of
interest in a pluripotent rat cell via targeted genetic
modification is provided, comprising: (a) providing a pluripotent
rat cell that is able to sustain its pluripotency following at
least one targeted genetic modification of its genome and is able
to transmit the targeted modification to a germline of an F1
generation; (b) introducing a large targeting vector (LTVEC) into
the pluripotent rat cell, wherein the LTVEC comprises an insert
nucleic acid flanked with a 5' homology arm and a 3' homology arm,
wherein the 5' homology arm and the 3' homology arm comprise a rat
genomic DNA fragment; and (c) identifying a genetically modified
pluripotent rat cell comprising the targeted genetic
modification.
[0285] Various methods can be used to identify cells having the
insert nucleic acid integrated at the target locus of interest,
Insertion of the insert nucleic acid at the target locus of
interest results in a "modification of allele". The term
"modification of allele" and methods for the detection of the
modified allele are discussed in further detail elsewhere
herein.
[0286] In one aspect, a method for modifying a genomic locus of
interest in a pluripotent rat cell via endonuclease-mediated gene
targeting is provided, the method comprising: (a) providing an
isolated pluripotent rat cell that is able to transmit the
genetically modified genome to a germline of an F1 generation; (b)
introducing into the pluripotent rat cell an endonuclease agent;
wherein the endonuclease agent makes a nick or a double strand
break at a target DNA sequence located in the genomic locus of
interest, and wherein the nick or the double strand break at the
target DNA sequence in the rat ES cell induces: (i) non-homologous
end joining (NHEJ)-mediated DNA repair of the nick or the double
strand break, wherein the NHEJ-mediated DNA repair generates a
mutant allele comprising an insertion or a deletion of a nucleic
acid sequence at the target DNA sequence; or (ii) homologous
recombination-mediated DNA repair that results in restoration of a
wild-type nucleic acid sequence; and (c) identifying the modified
genomic locus of interest.
[0287] In one aspect, a method for modifying a genomic locus of
interest in an isolated rat embryonic stem cell (ES) via a nuclease
agent is provided, comprising: (a) providing an isolated rat ES
cell that is able to transmit the targeted genetic modification to
a germline of an F1 generation; (b) introducing into the rat ES
cell: (i) a large targeting vector (LTVEC) comprising an insert
nucleic acid flanked with a rat 5' homology arm and a rat 3'
homology arm, wherein the insert is a nucleic acid sequence that is
at least 5 kb; and (ii) an endonuclease agent, wherein the
endonuclease agent makes a nick or a double strand break at a
target DNA sequence located in the genomic locus of interest, and
wherein the target sequence is not present in the insert nucleic
acid; and (c) identifying the targeted genetic modification in the
rat embryonic stem (ES) cell.
[0288] In one aspect, a method for modifying a genomic locus of
interest in a pluripotent rat cell via RNA-guided genome
engineering is provided, the method comprising: (a) providing a
pluripotent rat cell that is able to transmit the genetically
modified genome to a germline of an F1 generation; (b) introducing
into the pluripotent rat cell: (i) a first expression construct
comprising a first promoter operably linked to a first nucleic acid
sequence encoding a Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR)-associated (Cas) protein, (ii) a
second expression construct comprising a second promoter operably
linked to a genomic target sequence linked to a guide RNA (gRNA),
wherein the genomic target sequence is flanked on the 3' end by a
Protospacer Adjacent Motif (PAM) sequence. In one embodiment, the
genomic target sequence comprises the nucleotide sequence of
GNNNNNNNNNNNNNNNNNNNNGG (GN.sub.1-20GG; SEQ ID NO: 1). In one
embodiment, the genomic target sequence comprises SEQ ID NO:1,
wherein N is between 14 and 20 nucleotides in length. In one
embodiment, the gRNA comprises a third nucleic acid sequence
encoding a Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR) RNA (crRNA) and a fourth nucleic acid sequence
encoding a trans-activating CRISPR RNA (tracrRNA). In one
embodiment, upon expression, the Cas protein forms a CRISPR-Cas
complex comprising the crRNA and the tracrRNA, and the CRISPR-Cas
complex makes a nick or a double strand break at a target DNA
sequence located in the genomic locus of interest, and wherein the
nick or the double strand break at the target DNA sequence in the
pluripotent rat cell induces: (i) non-homologous end joining
(NHEJ)-mediated DNA repair of the nick or the double strand break
created by the CRISPR-Cas complex, wherein the NHEJ generates a
mutant allele comprising an insertion or a deletion of a nucleic
acid sequence at the target DNA sequence; or (ii) homologous
recombination-mediated DNA repair that results in restoration of a
wild-type nucleic acid sequence; and (c) identifying the modified
the genomic locus of interest.
[0289] In one embodiment, the pluripotent rat cell is an induced
rat pluripotent stem cell (iPS). In one embodiment, the pluripotent
rat cell is a developmentally restricted progenitor cell.
[0290] The presence of a nick or a double-strand break in the
recognition site within the selection marker, in various
embodiments, increases the efficiency and/or frequency of
recombination between a targeting vector (such as a LTVEC) and the
targeted locus of interest. In one embodiment, the recombination is
homologous recombination. In another embodiment, the recombination
is an insertion by non-homologous end joining. In various
embodiments, in the presence of the nick or double strand break,
targeting efficiency of a targeting vector (such as a LTVEC) at the
target genomic locus is at least about 2-fold higher, at least
about 3-fold higher, at least about 4-fold higher than in the
absence of the nick or double-strand break (using, e.g., the same
targeting vector and the same homology arms and corresponding
target sites at the genomic locus of interest but in the absence of
an added nuclease agent that makes the nick or double strand
break).
[0291] In one embodiment, the targeted genetic modification at the
target locus is biallelic. By "biallelic" is meant that both
alleles of a gene comprise the targeted genetic modification. In
certain embodiments, the combined use of a targeting vector
(including, for example, an LTVEC) with a nuclease agent results in
biallelic targeted genetic modification of the genomic locus of
interest in a cell as compared to use of the targeting vector
alone. When the targeting vector is used in conjunction with a
nuclease agent, blanche targeting efficiency is increased at least
by two-fold, at least three-fold, at least 4-fold or more as
compared to when the targeting vector is used alone. In further
embodiments, the biallelic targeting efficiency is at least 0.2%,
0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4% or 5% or
higher.
[0292] Compositions are provided which comprise a genetically
modified rat having a targeted genetic modification in the
interleukin-2 receptor gamma locus or in the ApoE locus. The
various methods and compositions provided herein allows for these
modified loci to be transmitted through the germline.
[0293] In specific embodiments, a genetically modified rat or a
genetically modified pluripotent rat cell comprises a genomic locus
having a targeted genetic modification in the interleukin-2 gamma
receptor locus or having a targeted genetic modification in the
ApoE locus, wherein the interleukin-2 gamma receptor genomic locus
or the ApoE locus comprise: (i) a deletion of at least a portion of
the interleukin-2 gamma receptor locus or at least a portion of the
ApoE locus; (ii) an insertion of a heterologous nucleic acid
sequence into the ApoE locus or into the interleukin-2 gamma
receptor locus; or (iii) a combination thereof, wherein the
genetically modified genomic locus is capable of being transmitted
through the germline.
[0294] Methods are further provided that allow for such genetically
modified rats and for such genetically modified pluripotent rat
cells to be made. Such methods include a method for modifying an
ApoE genomic locus or a interleukin-2 gamma receptor locus in a
pluripotent rat cell via targeted genetic modification. The method
comprises (a) introducing into the pluripotent rat cell a targeting
vector comprising an insert nucleic acid flanked with a 5' rat
homology arm to the ApoE locus and a 3' rat homology arm to the
ApoE locus, (b) identifying a genetically modified pluripotent rat
cell comprising the targeted genetic modification at the ApoE
genomic locus of interest, wherein the targeted genetic
modification is capable of being transmitted through germline.
[0295] Additional methods include (a) introducing into the
pluripotent rat cell a targeting vector comprising an insert
nucleic acid flanked with a 5' rat homology arm to the
interleukin-2 receptor gamma locus and a 3' rat homology arm to the
interleukin-2 receptor gamma locus, (b) identifying a genetically
modified pluripotent rat cell comprising the targeted genetic
modification at the interleukin-2 receptor gamma locus, wherein the
targeted genetic modification is capable of being transmitted
through germline.
[0296] iii. Methods of Integrating Multiple Polynucleotides of
Interest at the Targeted Locus
[0297] The various methods and compositions provided herein allow
for the targeted integration of multiple polynucleotides of
interest with a given target locus. The various methods set forth
above can be sequentially repeated to allow for the targeted
integration of any number of insert nucleic acids into a given
targeted locus. Thus, the various methods provide for the insertion
of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20 or more insert nucleic acids into the target locus.
In particular embodiments, such sequential stacking methods allow
for the reconstruction of large genomic regions from a mammalian
cell (i.e., a human, a non-human, a rodent, a mouse, a monkey, a
rat, a hamster, a domesticated mammal or an agricultural animal)
into a targeted locus. In such instances, the transfer and
reconstruction of genomic regions that include both coding and
non-coding regions allow for the complexity of a given region to be
preserved by retaining, at least in part, the coding regions, the
non-coding regions and the copy number variations found within the
native genomic region. Thus, the various methods provide, for
example, methods to generate "heterologous" or "exogenous" genomic
regions within any mammalian cell or animal of interest,
particularly within a prokaryotic host cell or within a pluripotent
rat cell or a rat ES cell. In one non-limiting example, a
"humanized" genomic region within a non-human animal (i.e., within
a rat) is generated.
[0298] 3. A Humanized Genomic Locus
[0299] Provided herein are various methods and compositions
comprising a humanized rat locus. As used herein, by "humanized"
genomic locus is meant a region of a non-human genome comprising at
least one human nucleic acid sequence. A "humanized rat locus"
comprises a region of rat DNA that has a human DNA sequence
inserted therein. The human DNA sequence can be a naturally
occurring human DNA sequence or it can be modified from its native
form. In specific embodiments, the human DNA shares at least 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence
identity to a native human sequence. If a human sequence is not a
native human sequence it at least has greater sequence identity to
a native human sequence than it does to an orthologous rat
sequence. Moreover, the human DNA sequence can comprise a cDNA, a
region of human genomic DNA, a non-coding regulatory region, or any
portion of a coding, genomic, or regulatory region of the human
DNA. The human DNA sequence inserted into the rat locus can
comprise any of the insert polynucleotides as described elsewhere
herein. In specific embodiments, the human DNA sequence is
orthologous to the rat target locus, while in other instances, the
human DNA sequence is homologous to the rat target locus.
[0300] In one embodiment, the targeted genetic modification is an
insertion or a replacement of an endogenous rat nucleic acid
sequence with a homologous or orthologous human nucleic acid
sequence. In one embodiment, the targeted genetic modification
comprises an insertion or replacement of an endogenous rat nucleic
acid sequence with a homologous or orthologous human nucleic acid
sequence at an endogenous rat locus that comprises the
corresponding rat nucleic acid sequence.
[0301] Methods for making a humanized rat locus (or a rat or rat
cell comprising the humanized rat locus) comprise introducing into
the target locus comprising a rat nucleic acid a human nucleic acid
sequence. In one embodiment, a method of making a humanized rat is
provided. Such a method comprises (a) modifying a genome of a
pluripotent rat cell with a targeting vector comprising an insert
nucleic acid that comprises a human nucleic acid sequence to form a
donor cell; (b) introducing the donor cell into a host rat embryo;
and (c) gestating the host rat embryo in a surrogate mother;
wherein the surrogate mother produces a rat progeny that comprises
the human nucleic acid sequence. In specific embodiments, the
humanized rat locus is capable of being transmitted through the
germline. In a further embodiment, the targeting vector comprises a
large targeting vector (LTVEC) and the insert nucleic acid that
comprises a human nucleic acid sequence is at least 5 kb.
[0302] In other methods, the humanized rat locus is made by
modifying a target locus of a rat nucleic acid via bacterial
homologous recombination (BHR). The method comprises introducing
into a prokaryotic cell a targeting vector comprising an insert
nucleic acid flanked with a 5' rat homology arm and a 3' rat
homology arm, wherein the insert nucleic acid comprises a human
nucleic acid sequence, and wherein the prokaryotic cell comprises a
rat nucleic acid and is capable of expressing a recombinase that
mediates the BHR at the target locus.
[0303] The humanized rat genomic locus can comprise (a) an
insertion of a homologous or orthologous human nucleic acid
sequence; (b) a replacement of an endogenous rat nucleic acid
sequence with a homologous or orthologous human nucleic acid
sequence; or (c) a combination thereof. In specific embodiments,
the humanized rat genomic locus is capable of being transmitted
through the germline. In still other embodiments, the human
orthologous sequence replaces the corresponding sequence found in
the rat.
[0304] Any human nucleic acid sequence can be used in the methods
and compositions provided herein, Non-limiting examples of human
nucleic acid sequences that can be used in the methods and
compositions are discussed in detail elsewhere herein.
[0305] The human nucleic acid sequence for insertion into the rat
locus of interest can be any size. In one embodiment, the human
nucleic acid sequence can be from about 500 nucleotides to about
200 kb, from about 500 nucleotides to about 5 kb, from about 5 kb
to about 200 kb, from about 5 kb to about 10 kb, from about 10 kb
to about 20 kb, from about 20 kb to about 30 kb, from about 30 kb
to about 40 kb, from about 40 kb to about 50 kb, from about 60 kb
to about 70 kb, from about 80 kb to about 90 kb, from about 90 kb
to about 100 kb, from about 100 kb to about 11.0 kb, from about 120
kb to about 130 kb, from about 130 kb to about 140 kb, from about
140 kb to about 150 kb, from about 150 kb to about 160 kb, from
about 160 kb to about 170 kb, from about 170 kb to about 180 kb,
from about 180 kb to about 190 kb, or from about 190 kb to about
200 kb. In a specific embodiment, the human nucleic acid sequence
is at least 5 kb.
[0306] In one embodiment, a rat genomic locus is provided wherein
the homologous or orthologous human nucleic acid sequence comprises
(a) one or more unrearranged human immunoglobulin heavy chain
V.sub.H gene segments, one or more unrearranged human
immunoglobulin heavy chain D gene segments, and one or more
unrearranged human immunoglobulin heavy chain J.sub.H gene
segments, which are operably linked to a mammalian heavy chain
constant region nucleic acid sequence; (b) a rearranged human
immunoglobulin heavy chain variable region nucleic acid sequence
operably linked to a mammalian immunoglobulin heavy chain constant
region nucleic acid sequence; (c) one or more unrearranged human
immunoglobulin V.sub..kappa. or V.sub..lamda. gene segments and one
or more unrearranged human immunoglobulin J.sub..kappa. or
J.sub..lamda. gene segments, which are operably linked to a
mammalian, immunoglobulin .lamda. or .kappa. light chain light
chain constant region nucleic acid sequence; or, (d) a rearranged
human immunoglobulin .lamda. or .kappa. light chain variable region
nucleic acid sequence operably linked to a mammalian immunoglobulin
.lamda. or .kappa. light chain light chain constant region nucleic
acid sequence.
[0307] In another embodiment, a rat genomic locus is provided
wherein (a) the mammalian immunoglobulin heavy chain constant
region nucleic acid sequence is a rat constant region nucleic acid
sequence, a human constant region nucleic acid sequence, or a
combination thereof; or, (b) the mammalian immunoglobulin .lamda.
or .kappa. light chain light chain constant region nucleic acid
sequence is a rat constant region nucleic acid sequence, a human
constant region nucleic acid sequence, or a combination
thereof.
[0308] In a specific embodiment, a rat genomic locus is provided
wherein the immunoglobulin heavy chain constant region nucleic acid
sequence is selected from or comprises a CH1, a hinge, a CH2, a
CH3, and/or a combination thereof.
[0309] In one embodiment, the rat genomic locus comprises one or
more functional human V.sub.H gene segments comprising V.sub.H1-2,
V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45,
V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26,
V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13,
V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23,
V.sub.H3-30, V.sub.H3-30-3, V.sub.H3-30-5, V.sub.H3-33,
V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49,
V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73,
V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2,
V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59,
V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, or
a combination thereof.
[0310] In one embodiment, the rat genomic locus comprises one or
more functional human D gene segments comprising D1-1, D1-7, D1-14,
D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16,
D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6,
D6-13, D6-19, D6-25, D7-27, or a combination thereof.
[0311] In one embodiment, the rat genomic locus comprises one or
more functional J.sub.H gene segments comprising J.sub.H1,
J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5, J.sub.H6, and/or a
combination thereof. In one embodiment, the insert nucleic acid
comprises one or more human V.kappa. gene segments comprises
V.kappa.4-1, V.kappa.5-2, V.kappa.7-3, V.kappa.2-4, V.kappa.1-5,
V.kappa.1-6, V.kappa.3-7, V.kappa.1-8, V.kappa.1-9, V.kappa.2-10,
V.kappa.3-11, V.kappa.1-12, V.kappa.1-13, V.kappa.2-14,
V.kappa.3-15, V.kappa.1-16, V.kappa.1-17, V.kappa.2-18,
V.kappa.2-19, V.kappa.3-20, V.kappa.6-21, V.kappa.1-22,
V.kappa.1-23, V.kappa.2-24, V.kappa.3-25, V.kappa.2-26,
V.kappa.1-27, V.kappa.2-28, V.kappa.2-29, V.kappa.2-30,
V.kappa.3-31, V.kappa.1-32, V.kappa.1-33, V.kappa.3-34,
V.kappa.1-35, V.kappa.2-36, V.kappa.1-37, V.kappa.2-38,
V.kappa.1-39, V.kappa.2-40, or a combination thereof.
[0312] In one embodiment, the rat genomic locus comprises one or
more human V.lamda. gene segments comprising V.lamda.3-1,
V.lamda.3-9, V.lamda.3-10, V.lamda.22-11, V.lamda.3-12,
V.lamda.2-14, V.lamda.3-16, V.lamda.2-18, V.lamda.3-19,
V.lamda.3-21, V.lamda.3-22, V.lamda.2-23, V.lamda.3-25,
V.lamda.3-27, or a combination thereof.
[0313] In one embodiment, the rat genomic locus comprises one or
more human J.kappa. gene segments comprising J.kappa.1, J.kappa.2,
J.kappa.3, J.kappa.4, J.kappa.5, or a combination thereof.
[0314] In yet another embodiment, the rat genomic locus comprises a
humanized genomic locus comprising a human interleukin-2 receptor
(IL2R) nucleic acid sequence or a variant or a fragment thereof is
provided. In specific embodiments, the IL2R nucleic acid sequence
comprises an interleukin-2 receptor alpha, an interleukin-2
receptor beta, or an interleukin-2 receptor gamma nucleic acid
sequence or variants or fragments thereof.
[0315] In further embodiments, a rat genomic locus comprises a
humanized genomic locus comprising of a portion of the human ApoE
locus, the human interleukin-2 receptor gamma locus, the human Rag2
locus, the human Rag1 locus and/or the human Rag2/Rag1 locus
replacing the corresponding homologous or orthologous portion of
the rat ApoE locus, the rat interleukin-2 receptor gamma locus, the
rat Rag2 locus, the rat Rag1 locus and/or the rat Rag2/Rag1 locus.
In one embodiment, the rat ecto-domain of IL-2Rg is replaced with
the ecto-domain of human IL-2Rg, with the remainder of the molecule
being from the rat.
[0316] In another embodiment, a genetically modified rat comprising
a humanized genomic locus is provided, Such genetically modified
rats comprise (a) an insertion of a homologous or orthologous human
nucleic acid sequence; (b) a replacement of rat nucleic acid
sequence with a homologous or orthologous human nucleic acid
sequence at an endogenous genomic locus; or (c) a combination
thereof, wherein the humanized genomic locus is capable of being
transmitted through the germline.
[0317] Genetically modified rats comprising any of the various
humanized genomic loci provided herein and described above are also
provided.
[0318] 4. Polynucleotides of Interest
[0319] Any polynucleotide of interest may be contained in the
various insert nucleic acids and thereby integrated at the target
locus. The methods disclosed herein, provide for at least 1, 2, 3,
4, 5, 6 or more polynucleotides of interest to be integrated into
the targeted genomic locus.
[0320] The polynucleotide of interest within the insert nucleic
acid when integrated at the target genomic locus can introduce one
or more genetic modifications into the cell. The genetic
modification can comprise a deletion of an endogenous nucleic acid
sequence and/or the addition of an exogenous or heterologous or
orthologous polynucleotide into the target genomic locus. In one
embodiment, the genetic modification comprises a replacement of an
endogenous nucleic acid sequence with an exogenous polynucleotide
of interest at the target genomic locus. Thus, methods provided
herein allow for the generation of a genetic modification
comprising a knockout, a deletion, an insertion, a replacement
("knock-in"), a point mutation, a domain swap, an exon swap, an
intron swap, a regulatory sequence swap, a gene swap, or a
combination thereof. Such modifications may occur upon integration
of the first, second, third, fourth, fifth, six, seventh, or any
subsequent insert nucleic acids into the target genomic locus.
[0321] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can comprise a sequence
that is native to the cell it is introduced into; the
polynucleotide of interest can be heterologous to the cell it is
introduced to; the polynucleotide of interest can be exogenous to
the cell it is introduced into; the polynucleotide of interest can
be orthologous to the cell it is introduced into; or the
polynucleotide of interest can be from a different species than the
cell it is introduced into. As used herein "native" in reference to
a sequence inserted at the target locus is a sequence that is
native to the cell having the target locus or native to the cell
from which the target locus was derived (i.e., from a rat). As used
herein, "heterologous" in reference to a sequence includes a
sequence that originates from a foreign species, or, if from the
same species, is substantially different or modified from its
native form in composition and/or genomic locus by deliberate human
intervention. As used herein, "exogenous" in reference to a
sequence is a sequence that originates from a foreign species. The
polynucleotide of interest can be from any organism of interest
including, but not limited to, non-human, a rodent, a hamster, a
mouse, a rat, a human, a monkey, an agricultural mammal or a
non-agricultural mammal. The polynucleotide of interest can further
comprise a coding region, a non-coding region, a regulatory region,
or a genomic DNA. Thus, the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th,
and/or any of the subsequent insert nucleic acids can comprise such
sequences.
[0322] In one embodiment, the polynucleotide of interest within the
insert nucleic acid and/or integrated at the target locus is native
to a mouse nucleic acid sequence, a human nucleic acid, a non-human
nucleic acid, a rodent nucleic acid, a rat nucleic acid, a hamster
nucleic acid, a monkey nucleic acid, an agricultural mammal nucleic
acid, or a non-agricultural mammal nucleic acid. In still further
embodiments, the polynucleotide of interest integrated at the
target locus is a fragment of a genomic nucleic acid. In one
embodiment, the genomic nucleic acid is a mouse genomic nucleic
acid, a human genomic nucleic acid, a non-human nucleic acid, a
rodent nucleic acid, a rat nucleic acid, a hamster nucleic acid, a
monkey nucleic acid, an agricultural mammal nucleic acid or a
non-agricultural mammal nucleic acid or a combination thereof.
[0323] In one embodiment, the polynucleotide of interest can range
from about 500 nucleotides to about 200 kb as described above. The
polynucleotide of interest can be from about 500 nucleotides to
about 5 kb, from about 5 kb to about 200 kb, from about 5 kb to
about 10 kb, from about 10 kb to about 20 kb, from about 20 kb to
about 30 kb, from about 30 kb to about 40 kb, from about 40 kb to
about 50 kb, from about 60 kb to about 70 kb, from about 80 kb to
about 90 kb, from about 90 kb to about 1.00 kb, from about 100 kb
to about 110 kb, from about 120 kb to about 130 kb, from about 130
kb to about 140 kb, from about 140 kb to about 150 kb, from about
150 kb to about 160 kb, from about 160 kb to about 170 kb, from
about 170 kb to about 180 kb, from about 180 kb to about 190 kb, or
from about 190 kb to about 200 kb, from about 5 kb to about 10 kb,
from about 10 kb to about 20 kb, from about 20 kb to about 40 kb,
from about 40 kb to about 60 kb, from about 60 kb to about 80 kb,
from about 80 kb to about 100 kb, from about 100 kb to about 150
kb, from about 150 kb to about 200 kb, from about 200 kb to about
250 kb, from about 250 kb to about 300 kb, from about 300 kb to
about 350 kb, or from about 350 kb to about 400 kb.
[0324] The polynucleotide of interest within the insert nucleic
acid and/or inserted at the target genomic locus can encode a
polypeptide, can encode an miRNA, or it can comprise any regulatory
regions or non-coding regions of interest including, for example, a
regulatory sequence, a promoter sequence, an enhancer sequence, a
transcriptional repressor-binding sequence, or a deletion of a
non-protein-coding sequence, but does not comprise a deletion of a
protein-coding sequence. In addition, the polynucleotide of
interest within the insert nucleic acid and/or inserted at the
target genomic locus can encode a protein expressed in the nervous
system, the skeletal system, the digestive system, the circulatory
system, the muscular system, the respiratory system, the
cardiovascular system, the lymphatic system, the endocrine system,
the urinary system, the reproductive system, or a combination
thereof. In one embodiment, the polynucleotide of interest within
the insert nucleic acid and/or inserted at the target genomic locus
encodes a protein expressed in a bone marrow or a bone
marrow-derived cell. In one embodiment, the polynucleotide of
interest within the insert nucleic acid and/or integrated at the
target locus encodes a protein expressed in a spleen cell. In still
further embodiments, the polynucleotide of interest within the
insert nucleic acid and/or inserted at the target locus encodes a
protein expressed in a B cell, encodes a protein expressed in an
immature B cell or encodes a protein expressed in a mature B
cell.
[0325] The polynucleotide of interest within the insert
polynucleotide can comprise a portion of an ApoE locus, an IL-2-Rg
locus, a Rag1 locus, a Rag2 locus and/or a Rag2/Rag1 locus. Such
portions of these given loci are discussed elsewhere herein, as are
the various homologous and orthologous regions from any organism of
interest that can be employed.
[0326] In one embodiment, polynucleotide of interest within the
insert nucleic acid and/or inserted at the target locus comprises a
genomic nucleic acid sequence that encodes an immunoglobulin heavy
chain variable region amino acid sequence. The phrase "heavy
chain," or "immunoglobulin heavy chain" are described elsewhere
herein.
[0327] In one embodiment, the polynucleotide of interest within the
insert nucleic acid and/or integrated at the target locus comprises
a genomic nucleic acid sequence that encodes a human immunoglobulin
heavy chain variable region amino acid sequence.
[0328] In one embodiment, the genomic nucleic acid sequence
comprises one or more unrearranged human immunoglobulin heavy chain
V.sub.H gene segments, one or more unrearranged human
immunoglobulin heavy chain D gene segments, and one or more
unrearranged human immunoglobulin heavy chain J.sub.H gene
segments, which are operably linked to a mammalian heavy chain
constant region nucleic acid sequence. In one embodiment, the
genomic nucleic acid sequence comprises a rearranged human
immunoglobulin heavy chain variable region nucleic acid sequence
operably linked to a mammalian heavy chain constant region nucleic
acid sequence. In one embodiment, the genomic nucleic acid sequence
comprises one or more unrearranged human immunoglobulin
V.sub..kappa. or V.sub..lamda. gene segments and one or more
unrearranged human immunoglobulin J.sub..kappa. or J.sub..lamda.
gene segments, which are operably linked to a mammalian
immunoglobulin .lamda. or .kappa. light chain light chain constant
region nucleic acid sequence. In one embodiment, the genomic
nucleic acid sequence comprises a rearranged human immunoglobulin
.lamda. or .kappa. light chain variable region nucleic acid
sequence operably linked to a mammalian immunoglobulin .lamda. or
.kappa. light chain light chain constant region nucleic acid
sequence. In one embodiment, the heavy chain constant region
nucleic acid sequence comprises a rat constant region nucleic acid
sequence, a human constant region nucleic acid sequence, or a
combination thereof. In one embodiment, the immunoglobulin .lamda.
or .kappa. light chain constant region nucleic acid comprises a rat
constant region nucleic acid sequence, a human constant region
nucleic acid sequence, or a combination thereof.
[0329] In one embodiment, the immunoglobulin heavy chain constant
region nucleic acid sequence is selected from or comprises a CH1, a
hinge, a CH2, a CH3, and/or a combination thereof. In one
embodiment, the heavy chain constant region nucleic acid sequence
comprises a CH1-hinge-CH2-CH3.
[0330] In one embodiment, the polynucleotide of interest within the
insert nucleic acid and/or integrated at the target locus comprises
a genomic nucleic acid sequence that encodes an immunoglobulin
light chain variable region amino acid sequence. The phrase "light
chain" includes an immunoglobulin light chain sequence from any
organism, and is described elsewhere herein.
[0331] In one embodiment, the polynucleotide of interest within the
insert nucleic acid and/or integrated at the target genomic locus
comprises a genomic nucleic acid sequence that encodes a human
immunoglobulin light chain variable region amino acid sequence.
[0332] In one embodiment, the genomic nucleic acid sequence
comprises one or more unrearranged human immunoglobulin
V.sub..kappa. or V.sub..lamda. gene segments and one or more
unrearranged human immunoglobulin .lamda. or .kappa. gene segments,
which are operably linked to a rodent immunoglobulin .lamda. or
.kappa. light chain light chain constant region nucleic acid
sequence. In one embodiment, the genomic nucleic acid sequence
comprises a rearranged human immunoglobulin .lamda. or .kappa.
light chain variable region nucleic acid sequence operably linked
to a rodent immunoglobulin .lamda. or .kappa. light chain light
chain constant region nucleic acid sequence. In one embodiment, the
light chain constant region nucleic acid sequence comprises a rat
constant region nucleic acid sequence, a human constant region
nucleic acid sequence, or a combination thereof. In one embodiment,
the immunoglobulin .lamda. or .kappa. light chain constant region
nucleic acid comprises a rat constant region nucleic acid sequence,
a human constant region nucleic acid sequence, or a combination
thereof.
[0333] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can encode an
extracellular protein or a ligand for a receptor. In specific
embodiments, the encoded ligand is a cytokine. Cytokines of
interest includes chemokine selected from or comprising CCL, CXCL,
CX3CL, and/or XCL. The cytokine can also comprise a tumor necrosis
factor (TNF). In still other embodiments, the cytokine is an
interleukin (IL). In one embodiment, the interleukin is selected
from or comprises IL-1, IL-2, IL-3, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18,
IL-19, IL-20, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28,
IL-29, IL-33, IL-34, IL-35, and/or IL-36. In one embodiment, the
interleukin is IL-2. In specific embodiments, such polynucleotides
of interest within the insert nucleic acid and/or integrated at the
target genomic locus are from a human and, in more specific
embodiments, can comprise human genomic sequence.
[0334] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target genomic locus can encode
Apolipoprotein E (ApoE).
[0335] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can encode a cytoplasmic
protein or a membrane protein. In one embodiment, the membrane
protein is a receptor, such as, a cytokine receptor, an interleukin
receptor, an interleukin 2 receptor-alpha, an interleukin-2
receptor beta, an interleukin-2 receptor gamma or receptor tyrosine
kinase. In other instances, the polynucleotide of interest within
the insert nucleic acid and/or integrated at the target locus can
comprise an orthologous or homologous region of the target
locus.
[0336] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can comprise a
polynucleotide encoding at least a region of a T cell receptor,
including the T cell receptor alpha. In specific methods each of
the insert nucleic acids comprise a genomic region of the T cell
receptor locus (i.e. the T cell receptor alpha locus) such that
upon completion of the serial integration, a portion or the
entirety of the genomic T cell receptor locus has been integrated
at the target locus. Such insert nucleic acids can comprise at
least one or more of a variable segment or a joining segment of a T
cell receptor locus (i.e. of the T cell receptor alpha locus). In
still further embodiments, the polynucleotide of interest encoding
the region of the T cell receptor can be from, for example, a
mammal, a non-human mammal, rodent, mouse, rat, a human, a monkey,
an agricultural mammal or a domestic mammal polynucleotide encoding
a mutant protein.
[0337] In other embodiments, the polynucleotide of interest
integrated at the target locus encodes a nuclear protein. In one
embodiment, the nuclear protein is a nuclear receptor. In specific
embodiments, such polynucleotides of interest within the insert
nucleic acid and/or integrated at the target locus are from a human
and, in more specific embodiments, can comprise human genomic
sequence.
[0338] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target genomic locus can comprise a
genetic modification in a coding sequence. Such genetic
modifications include, but are not limited to, a deletion mutation
of a coding sequence or the fusion of two coding sequences.
[0339] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can comprise a
polynucleotide encoding a mutant protein, including, for example, a
human mutant protein. In one embodiment, the mutant protein is
characterized by an altered binding characteristic, altered
localization, altered expression, and/or altered expression
pattern. In one embodiment, the polynucleotide of interest within
the insert nucleic acid and/or integrated at the target locus
comprises at least one disease allele, including for example, an
allele of a neurological disease, an allele of a cardiovascular
disease, an allele of a kidney disease, an allele of a muscle
disease, an allele of a blood disease, an allele of a
cancer-causing gene, or an allele of an immune system disease. In
such instances, the disease allele can be a dominant allele or the
disease allele is a recessive allele. Moreover, the disease allele
can comprises a single nucleotide polymorphism (SNP) allele. The
polynucleotide of interest encoding the mutant protein can be from
any organism, including, but not limited to, a mammal, a non-human
mammal, rodent, mouse, rat, a human, a monkey, an agricultural
mammal or a domestic mammal polynucleotide encoding a mutant
protein.
[0340] In one embodiment, the genetic modification produces a
mutant form of a protein with an altered binding characteristic,
altered localization, altered expression, and/or altered expression
pattern.
[0341] In one embodiment, the genetic modification produces a
deletion, addition, replacement or a combination thereof of a
region of the rat ApoE locus, wherein the genetic modification at
the ApoE locus results in a decrease in ApoE activity. In one
embodiment, an ApoE knockout is generated.
[0342] In one embodiment, the genetic modification produces a
deletion, addition, replacement or a combination thereof of a
region of the rat Rag1 locus, wherein the genetic modification at
the Rag1 locus results in a decrease in Rag1 activity. In one
embodiment, a Rag1 knockout is generated. In one embodiment, the
genetic modification produces a deletion, addition, replacement or
a combination thereof of a region of the rat Rag2 locus, wherein
the genetic modification at the Rag2 locus results in a decrease in
Rag2 activity. In one embodiment, a Rag2 knockout is generated. In
one embodiment, the genetic modification produces a deletion,
addition, replacement or a combination thereof of a region of the
rat Rag1/Rag2 locus, wherein the genetic modification at the
Rag1/Rag2 locus results in a decrease in Rag1 activity and a
decrease in Rag2 activity. In one embodiment, a Rag1/Rag2 knockout
is generated.
[0343] In one embodiment, the genetic modification produces a
deletion, addition, replacement or a combination thereof of a
region of the rat interleukin-2 receptor gamma locus, wherein the
genetic modification at the interleukin-2 receptor gamma locus
results in a decrease in interleukin-2 receptor gamma. In one
embodiment, a interleukin-2 receptor gamma knockout is
generated.
[0344] As discussed elsewhere herein, further embodiments provided
herein comprises one or more of the rat ApoE locus, the rat
interleukin-2 receptor gamma locus, the Rag2 locus, the Rag1 locus
and/or the Rag2/Rag1 locus is modified through the replacement of a
portion of the rat ApoE locus, the interleukin-2 receptor gamma
locus, the Rag2 locus, the Rag1 locus and/or Rag2/Rag1 locus with
the corresponding orthologous portion of an ApoE locus, an
interleukin-2 receptor gamma locus, a Rag2 locus, a Rag1 locus
and/or a Rag2/Rag1 locus from another organism.
[0345] In one embodiment, multiple genetic modifications are
generated. In one embodiment, a genetic modification produces a
deletion, addition, replacement or a combination thereof of a
region of the rat interleukin-2 receptor gamma locus, wherein the
genetic modification at the interleukin-2 receptor gamma locus
results in a decrease in interleukin-2 receptor gamma and a second
genetic modification produces a deletion, addition, replacement or
a combination thereof of a region of the rat Rag2 locus, wherein
the genetic modification at the Rag2 locus results in a decrease in
Rag2 activity. In one embodiment, an interleukin-2 receptor
gamma/Rag2 knockout is generated. Such a rat has a SCID
phenotype.
[0346] In one embodiment, the mammalian nucleic acid comprises a
genomic locus that encodes a protein expressed in the nervous
system, the skeletal system, the digestive system, the circulatory
system, the muscular system, the respiratory system, the
cardiovascular system, the lymphatic system, the endocrine system,
the urinary system, the reproductive system, or a combination
thereof. In one embodiment, the mammalian nucleic acid comprises a
genomic locus that encodes a protein expressed in a bone marrow or
a bone marrow-derived cell. In one embodiment, the nucleic acid
comprises a genomic locus that encodes a protein expressed in a
spleen cell. In one embodiment, the genomic locus comprises a mouse
genomic DNA sequence, a rat genomic DNA sequence a human genomic
DNA sequence, or a combination thereof. In one embodiment, the
genomic locus comprises, in any order, rat and human genomic DNA
sequences. In one embodiment, the genomic locus comprises, in any
order, mouse and human genomic DNA sequences. In one embodiment,
the genomic locus comprises, in any order, mouse and rat genomic
DNA sequences. In one embodiment, the genomic locus comprises, in
any order, rat, mouse, and human genomic DNA sequences.
[0347] In one embodiment, the insert nucleic acid comprises a
genetic modification in a coding sequence of a gene. In one
embodiment, the genetic modification comprises a deletion mutation
in the coding sequence. In one embodiment, the genetic modification
comprises a fusion of two endogenous coding sequences.
[0348] In one embodiment, the genetic modification comprises a
deletion of a non-protein-coding sequence, but does not comprise a
deletion of a protein-coding sequence. In one embodiment, the
deletion of the non-protein-coding sequence comprises a deletion of
a regulatory element. In one embodiment, the genetic modification
comprises an addition of a promoter. In one embodiment, the genetic
modification comprises a replacement of a promoter or regulatory
element. In one embodiment, the regulatory element is an enhancer.
In one embodiment, the regulatory element is a transcriptional
repressor-binding element.
[0349] In one embodiment, the genetic modification comprises
placement of a human nucleic acid sequence encoding a mutant human
protein. In one embodiment, the genetic modification comprises at
least one human disease allele of a human gene. In one embodiment,
the human disease is a neurological disease. In one embodiment, the
human disease is a cardiovascular disease. In one embodiment, the
human disease is a kidney disease. In one embodiment, the human
disease is a muscle disease. In one embodiment, the human disease
is a blood disease. In one embodiment, the human disease is a
cancer. In one embodiment, the human disease is an immune system
disease. In one embodiment, the human disease allele is a dominant
allele. In one embodiment, the human disease allele is a recessive
allele. In one embodiment, the human disease allele comprises a
single nucleotide polymorphism (SNP) allele.
[0350] The polynucleotide of interest within the insert nucleic
acid and/or integrated at the target locus can also comprise a
regulatory sequence, including for example, a promoter sequence, an
enhancer sequence, or a transcriptional repressor-binding sequence.
In specific embodiments, the polynucleotide of interest within the
insert nucleic acid and/or integrated at the target genomic locus
comprises a polynucleotide having a deletion of a
non-protein-coding sequence, but does not comprise a deletion of a
protein-coding sequence. In one embodiment, the deletion of the
non-protein-coding sequence comprises a deletion of a regulatory
sequence. In another embodiment, the deletion of the regulatory
element comprises a deletion of a promoter sequence. In one
embodiment, the deletion of the regulatory element comprises a
deletion of an enhancer sequence. Such a polynucleotide of interest
can be from any organism, including, but not limited to, a mammal,
a non-human mammal, rodent, mouse, rat, a human, a monkey, an
agricultural mammal or a domestic mammal polynucleotide encoding a
mutant protein.
[0351] 5. Methods of Introducing Sequences and Generation of
Transgenic Animals
[0352] As outlined above, methods and compositions are provided
herein to allow for the targeted integration of one or more
polynucleotides of interest into a target locus. Such systems
employ a variety of components and for ease of reference, herein
the term "targeted integration system" generically comprises all
the components required for an integration event (i.e. in
non-limiting examples, the various nuclease agents, recognition
sites, insert DNA polynucleotides, targeting vectors, target
genomic locus, and/or polynucleotides of interest).
[0353] The methods provided herein comprise introducing into a cell
one or more polynucleotides or polypeptide constructs comprising
the various components of the targeted genomic integration system.
"Introducing" means presenting to the cell the sequence
(polypeptide or polynucleotide) in such a manner that the sequence
gains access to the interior of the cell. The methods provided
herein do not depend on a particular method for introducing any
component of the targeted genomic integration system into the cell,
only that the polynucleotide gains access to the interior of a
least one cell. Methods for introducing polynucleotides into
various cell types are known in the art and include, but are not
limited to, stable transfection methods, transient transfection
methods, and virus-mediated methods.
[0354] In some embodiments, the cells employed in the methods and
compositions have a DNA construct stably incorporated into their
genome. "Stably incorporated" or "stably introduced" means the
introduction of a polynucleotide into the cell such that the
nucleotide sequence integrates into the genome of the cell and is
capable of being inherited by progeny thereof. Any protocol may be
used for the stable incorporation of the DNA constructs or the
various components of the targeted genomic integration system.
[0355] Transfection protocols as well as protocols for introducing
polypeptides or polynucleotide sequences into cells may vary.
Non-limiting transfection methods include chemical-based
transfection methods include the use of liposomes; nanoparticles;
calcium phosphate (Graham et al. (1973). Virology 52 (2): 456-67,
Bacchetti et al. (1977) Proc Natl. Acad Sci USA 74(4): 1590-4 and,
Kriegler, M (1991). Transfer and Expression: A Laboratory Manual.
New York: W. H. Freeman and Company. pp. 96-97); dendrimers; or
cationic polymers such as DEAE-dextran or polyethylenimine. Non
chemical methods include electroporation; Sono-poration; and
optical transfection. Particle-based transfection include the use
of a gene gun, magnet assisted transfection (Bertram, J. (2006)
Current Pharmaceutical Biotechnology 7, 277-28). Viral methods can
also be used for transfection.
[0356] In one embodiment, the introducing one or more of the
polynucleotides into a cell is mediated by electroporation, by
intracytoplasmic injection, by a viral infection, by an adenovirus,
by lentivirus, by retrovirus, by transfection, by lipid-mediated
transfection or is mediated via Nucleofection.TM..
[0357] In one embodiment, introduction one or more of the
polynucleotides into a cell further comprises: introducing an
expression construct comprising a nucleic acid sequence of interest
operably linked to a promoter. In one embodiment, the promoter is a
constitutively-active promoter. In one embodiment, the promoter is
an inducible promoter. In one embodiment, the promoter is active in
the rat embryonic stem cell.
[0358] In one embodiment, the expression construct is introduced
together with the LTVEC. In one embodiment, the expression
construct is introduced separately from the LTVEC over a period of
time.
[0359] In one embodiment, the introduction of the one or more
polynucleotides into the cell can be performed multiple times over
a period of time. In one embodiment, the introduction of the one or
more polynucleotides into the cell are performed at least two times
over a period of time, at least three times over a period of time,
at least four times over a period of time, at least five times over
a period of time, at least six times over a period of time, at
least seven times over a period of time, at least eight times over
a period of time, at least nine times over a period of times, at
least ten times over a period of time, at least eleven times, at
least twelve times over a period of time, at least thirteen times
over a period of time, at least fourteen times over a period of
time, at least fifteen times over a period of time, at least
sixteen times over a period of time, at least seventeen times over
a period of time, at least eighteen times over a period of time, at
least nineteen times over a period of time, or at least twenty
times over a period of time.
[0360] In one embodiment, the nuclease agent is introduced into the
cell simultaneously with the targeting vector or the large
targeting vector (LTVEC). Alternatively, the nuclease agent is
introduced separately front the targeting vector or the LTVEC over
a period of time. In one embodiment, the nuclease agent is
introduced prior to the introduction of the targeting vector or the
LTVEC, while in other embodiments, the nuclease agent is introduced
following introduction of the targeting vector or the LTVEC.
[0361] In one embodiment, screening step comprises a quantitative
assay for assessing modification of allele (MOA) of a parental
chromosome. In one embodiment, the quantitative assay is carried
out via a quantitative PCR. In one embodiment, the quantitative PCR
is a real-time PCR (qPCR). In one embodiment, the real-time PCR
comprises a first primer set that recognizes the target locus and a
second primer set that recognizes a non-targeted reference locus.
In one embodiment, the primer set comprises a fluorescent probe
that recognizes the amplified sequence. In one embodiment, the
quantitative assay is carried out via fluorescence-mediated in situ
hybridization (FISH). In one embodiment, the quantitative assay is
carried out via comparative genomic hybridization. In one
embodiment, the quantitative assay is carried out via isothermic
DNA amplification. In one embodiment, the quantitative assay is
carried out via isothermic DNA amplification. In one embodiment,
the quantitative assay is carried out via quantitative
hybridization to an immobilized probe(s). In one embodiment, the
quantitative assay is carried out via Invader Probes.RTM.. In one
embodiment, the quantitative assay is carried out via MMP
Assays.RTM.. In one embodiment, the quantitative assay is carried
out via TaqMan.RTM. Molecular Beacon. In one embodiment, the
quantitative assay is carried out via Eclipse.TM. probe technology.
(See, for example, US2005/0144655, which is incorporated by
reference herein in its entirety).
[0362] Further provided is a method for making a humanized rat,
comprising: (a) modifying a genome of a pluripotent rat cell with a
targeting vector comprising an insert nucleic acid that comprises a
human nucleic acid sequence to form a donor cell; (b) introducing
the donor cell into a host rat embryo; and (c) gestating the host
rat embryo in a surrogate mother; wherein the surrogate mother
produces a rat progeny that comprises the human nucleic acid
sequence. In one embodiment, the donor cell is introduced into a
host rat embryo that is at the blastocyst stage or at a pre-morula
stage (i.e., a 4 cell stage or an 8 cell stage). Moreover, step (a)
can also be performed with a large targeting vector (LTVEC) and/or
a human nucleic acid sequence at least 5 Kb in length. In still
further embodiments, the genetic modification is capable of being
transmitted through the germline.
[0363] Genetically modified rats can be generated employing the
various methods disclosed herein. Such methods comprise (1)
integrating one or more polynucleotide of interest at the target
locus of a pluripotent rat cell to generate a genetically modified
pluripotent rat cell comprising the insert nucleic acid in the
targeted genomic locus employing the methods disclosed herein; (2)
selecting the genetically modified pluripotent rat cell having the
one or more polynucleotides of interest at the target genomic
locus; (3) introducing the genetically modified pluripotent rat
cell into a rat host embryo; and (4) implanting the host rat embryo
comprising the genetically modified pluripotent rat cell into a
surrogate mother. A progeny from the genetically modified
pluripotent rat cell is generated. In one embodiment, the donor
cell is introduced into a rat host embryo at the blastocyst stage
or at the pre-morula stage (i.e., the 4 cell stage or the 8 cell
stage). Progeny that are capable of transmitting the genetic
modification though the germline are generated. The pluripotent rat
cell can be a rat ES cell as discussed elsewhere herein.
[0364] Nuclear transfer techniques can also be used to generate the
genetically modified rats. Briefly, methods for nuclear transfer
include the steps of: (1) enucleating an oocyte; (2) isolating a
donor cell or nucleus to be combined with the enucleated oocyte;
(3) inserting the cell or nucleus into the enucleated oocyte to
form a reconstituted cell; (4) implanting the reconstituted cell
into the womb of an animal to form an embryo; and (5) allowing the
embryo to develop. In such methods oocytes are generally retrieved
from deceased animals, although they may be isolated also from
either oviducts and/or ovaries of live animals. Oocytes can be
matured in a variety of medium known to those of ordinary skill in
the art prior to enucleation. Enucleation of the oocyte can be
performed in a number of manners well known to those of ordinary
skill in the art. Insertion of the donor cell or nucleus into the
enucleated oocyte to form a reconstituted cell is usually by
microinjection of a donor cell under the zona pellucida prior to
fusion. Fusion may be induced by application of a DC electrical
pulse across the contact/fusion plane (electrofusion), by exposure
of the cells to fusion-promoting chemicals, such as polyethylene
glycol, or by way of an inactivated virus, such as the Sendai
virus. A reconstituted cell is typically activated by electrical
and/or non-electrical means before, during, and/or after fusion of
the nuclear donor and recipient oocyte. Activation methods include
electric pulses, chemically induced shock, penetration by sperm,
increasing levels of divalent cations in the oocyte, and reducing
phosphorylation of cellular proteins (as by way of kinase
inhibitors) in the oocyte. The activated reconstituted cells, or
embryos, are typically cultured in medium well known to those of
ordinary skill in the art and then transferred to the womb of an
animal. See, for example, US20080092249, WO/999/005266A2,
US20040177390, WO/2008/017234A1, and U.S. Pat. No. 7,612,250, each
of which is herein incorporated by reference.
[0365] In one aspect, a method for making a genetically modified
rat is provided, comprising modifying a genomic locus of interest
in a pluripotent rat cell employing endonuclease-mediated gene
targeting to introduce a modification at a rat genomic locus of
interest to form a modified pluripotent rat cell, maintaining the
modified pluripotent rat cell under conditions sufficient to
maintain pluripotency, employing the modified pluripotent rat cell
as a donor cell in a rat host embryo, and gestating the host embryo
comprising the modified pluripotent rat cell in a surrogate mother,
wherein the host embryo is gestated by the surrogate mother and a
genetically modified rat progeny is born.
[0366] In one embodiment, the target sequence is located in an
intron. In one embodiment, the target sequence is located in an
exon. In one embodiment, the target sequence is located in a
promoter. In one embodiment, the target sequence is located in a
promoter regulatory region. In one embodiment, the target sequence
is located in an enhancer region.
[0367] In one embodiment, introducing step is performed multiple
times over a period of time using a plurality of endonucleases that
recognize distinct target sequences. In one embodiment, step is
performed at least two times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least three times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least four times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least five times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least six times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least seven times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least eight times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least nine times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least ten times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least eleven times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least twelve times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least thirteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least fourteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least fifteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least sixteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least seventeen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least eighteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, at least nineteen times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences, or at least twenty times over a period of time using a
plurality of endonucleases that recognize distinct target
sequences.
[0368] In one embodiment, introducing step is mediated by
electroporation, by intracytoplasmic injection, by an adenovirus,
by lentivirus, by retrovirus, by transfection, by lipid-mediated
transfection or is mediated via Nucleofection.TM..
[0369] In one embodiment, the method further comprises introducing
an exogenous nucleic acid into the genetically modified pluripotent
rat cell. In one embodiment, the exogenous nucleic acid is a
transgene. In one embodiment, the exogenous nucleic acid is
introduced into an endogenous locus. In one embodiment, the
exogenous nucleic acid is introduced ectopically (e.g., at a locus
different from its endogenous locus).
[0370] In one aspect, a method for making a genetically modified
rat is provided, comprising modifying a genomic locus of interest
in a pluripotent rat cell employing RNA-guided genome engineering
to introduce a modification at a rat genomic locus of interest to
form a modified pluripotent rat cell, maintaining the modified
pluripotent rat cell under conditions sufficient to maintain
pluripotency, employing the modified pluripotent rat cell as a
donor cell in a rat host embryo, and gestating the host embryo
comprising the modified pluripotent rat cell in a surrogate mother,
wherein the host embryo is gestated by the surrogate mother and a
genetically modified rat progeny is born.
[0371] In one embodiment, the method has a targeting rate ranging
from about 2% to about 80%.
[0372] In one embodiment, the method comprises co-introducing a
plurality of the second expression construct comprising distinct
genomic target sequences for multiplex editing of distinct genomic
loci. In on embodiment, the method comprises introducing a
plurality of the second expression construct comprising distinct
genomic target sequences for multiplex editing of distinct genomic
loci over a period of time.
[0373] In one embodiment, introducing step is performed multiple
times over a period of time. In one embodiment, introducing step
(b) is performed at least two times over a period of time, at least
three times over a period of time, at least four times over a
period of time, at least five times over a period of time, at least
six times over a period of time, at least seven times over a period
of time, at least eight times over a period of time, at least nine
times over a period of time, at least ten times over a period of
time, at least eleven times over a period of time, at least twelve
times over a period of time, at least thirteen times over a period
of time, at least fourteen times over a period of time, at least
fifteen times over a period of time, at least sixteen times over a
period of time, at least seventeen times over a period of time, at
least eighteen times over a period of time, at least nineteen times
over a period of time, at least twenty times over a period of
time.
[0374] In one embodiment, the first expression construct and the
second expression construct are expressed from a same plasmid.
[0375] In one embodiment, introducing step is mediated by
electroporation, by intracytoplasmic injection, by an adenovirus,
by lentivirus, by retrovirus, by transfection, by lipid-mediated
transfection or is mediated via Nucleofection.TM..
[0376] In one embodiment, the method further comprises introducing
an exogenous nucleic acid into the pluripotent rat cell comprising
the mutant allele.
[0377] In one embodiment, the exogenous nucleic acid is a
transgene. In one embodiment, the exogenous nucleic acid is
introduced into an endogenous locus. In one embodiment, the
exogenous nucleic acid is placed ectopically (e.g., at a locus
different from its endogenous locus).
[0378] In one embodiment, the method further comprises introducing
an exogenous nucleic acid into the genetically modified pluripotent
rat cell. In one embodiment, the exogenous nucleic acid is a
transgene. In one embodiment, the exogenous nucleic acid is
introduced into an endogenous locus. In one embodiment, the
exogenous nucleic acid is introduced ectopically (e.g., at a locus
different from its endogenous locus).
[0379] In one aspect, a method for making a humanized rat is
provided, comprising modifying a genome of a pluripotent rat cell
with an LTVEC comprising an insert that comprises a human sequence
of at least 5 kb, and employing the pluripotent rat cell as a donor
cell, introducing the donor cell into a host embryo, and gestating
the host embryo in a surrogate mother, wherein the surrogate mother
births a rat progeny that comprises the humanization.
[0380] Other methods for making a genetically modified rat
comprising in its germline one or more genetic modifications as
described herein is provided, comprising: (a) modifying a targeted
rat locus contained in a prokaryotic cell employing the various
methods described herein; (b) selecting a modified prokaryotic cell
comprising the genetic modification at the targeted rat locus; (c)
isolating the genetically modified targeting vector from the genome
of the modified prokaryotic cell; (d) introducing the genetically
modified targeting vector into a pluripotent rat cell to generate a
genetically modified pluripotent cell comprising the insert nucleic
acid at the targeted genomic locus; (e) selecting the genetically
modified rat pluripotent cell; (t) introducing the genetically
modified pluripotent rat cell into a host rat embryo at a
pre-morula stage; and (g) implanting the host rat embryo comprising
the genetically modified pluripotent rat cell into a surrogate
mother to generate an F0 generation derived from the genetically
modified pluripotent rat cell. In such methods the targeting vector
can comprise a large targeting vector. The pluripotent rat cell can
be a rat ES cell. In further methods, the isolating step (c)
further comprises (c1) linearizing the genetically modified
targeting vector (i.e., the genetically modified LTVEC). In still
further embodiments, the introducing step (d) further comprises
(d1) introducing a nuclease agent as described herein into the
pluripotent rat cell. In one embodiment, selecting steps (b) and/or
(e) are carried out by applying a selectable agent as described
herein to the prokaryotic cell or the pluripotent rat cell. In one
embodiment, selecting steps (b) and/or (e) are carried out via a
modification of allele (MOA) assay as described herein.
[0381] Further methods for modifying a target genomic locus of a
mammalian cell via bacterial homologous recombination (BHR) in a
prokaryotic cell are provided and comprise: (a) providing a
prokaryotic cell comprising a target locus comprising a rat nucleic
acid, (b) introducing into the prokaryotic cell a targeting vector
comprising an insert nucleic acid flanked with a 5' rat homology
arm and a 3' rat homology arm, wherein the insert nucleic acid
comprises a mammalian region (including, for example, a DNA insert
from a human), and (c) selecting a targeted prokaryotic cell
comprising the insert nucleic acid at the target rat locus, wherein
the prokaryotic cell is capable of expressing a recombinase that
mediates the BHR. Step (a1) can comprise providing a prokaryotic
cell comprising a target locus comprising a rat nucleic acid
comprising a first polynucleotide comprising a first recognition
site thr a first nuclease agent, and step (b1) can further comprise
expressing in the prokaryotic cell a nuclease agent that makes a
nick or double-strand break at or near the first recognition site.
Steps (a)-(c) can be serially repeated as disclosed herein to allow
the introduction of multiple insert nucleic acids at the targeted
rat locus in the prokaryotic cell. Once the targeted genomic locus
is "built" with the prokaryotic cell, a targeting vector comprising
the modified target rat locus can be isolated from the prokaryotic
cell and introduced into a target genomic locus within a
pluripotent rat cell. Pluripotent rat cells (i.e., rat ES cells)
comprising the modified genomic locus can then be made into
genetically modified rats.
[0382] In some embodiments, various genetic modifications of the
target genomic loci described herein can be carried out by a series
of homologous recombination reactions (BHR) in bacterial cells
using an LTVEC derived from Bacterial Artificial Chromosome (BAC)
DNA using VELOCIGENE.RTM., genetic engineering technology (see,
e.g., U.S. Pat. No. 6,586,251 and Valenzuela, D. M. et al. (2003),
High-throughput engineering of the mouse genome coupled with
high-resolution expression analysis, Nature Biotechnology 21(6):
652-659, which is incorporated herein by reference in their
entireties).
[0383] In some embodiments, targeted rat ES cells comprising
various genetic modifications as described herein are used as
insert ES cells and introduced into a pre-morula stage embryo from
a corresponding organism, e.g., an 8-cell stage mouse embryo, via
the VELOCIMOUSE.RTM. method (see, e.g., U.S. Pat. No. 7,576,259,
U.S. Pat. No. 7,659,442, U.S. Pat. No. 7,294,754, and US
2008-0078000 A1, all of which are incorporated by reference herein
in their entireties). The rat embryo comprising the genetically
modified rat ES cells is incubated until the blastocyst stage and
then implanted into a surrogate mother to produce F0. Rats bearing
the genetically modified genomic locus can be identified
modification of allele (MOA) assay as described herein. The
resulting F0 generation rat derived from the genetically modified
ES rat cells is crossed to a wild-type rat to obtain F1 generation
offspring. Following genotyping with specific primers and/or
probes, F1 rats that are heterozygous for the genetically modified
genomic locus are crossed to each other to produce rats that are
homozygous for the genetically modified genomic locus.
Alternatively, an F0 female rat and an F0 male rat each having the
genetic modification can be crossed to obtain an F1 rat homozygous
for the genetic modification.
[0384] In one aspect, a genetically modified rat genome is
provided, comprising a targeted modification of an endogenous rat
nucleic acid sequence with a homologous or orthologous non-rat
nucleic acid sequence.
[0385] In one embodiment, the homologous or orthologous non-rat
nucleic acid sequence is of a length from about 5 kb to about 200
kb. In one embodiment, the homologous or orthologous non-rat
nucleic acid sequence ranges from about 5 kb to about 10 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 10 kb to about 20 kb. In one embodiment,
the homologous or orthologous non-rat nucleic acid sequence ranges
from about 20 kb to about 30 kb. In one embodiment, the homologous
or orthologous non-rat nucleic acid sequence ranges from about 30
kb to about 40 kb. In one embodiment, the homologous or orthologous
non-rat nucleic acid sequence ranges from about 40 kb to about 50
kb. In one embodiment, the homologous or orthologous non-rat
nucleic acid sequence ranges from about 50 kb to about 60 kb. In
one embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 60 kb to about 70 kb. In one embodiment,
the homologous or orthologous non-rat nucleic acid sequence ranges
from about 70 kb to about 80 kb. In one embodiment, the homologous
or orthologous non-rat nucleic acid sequence ranges from about 80
kb to about 90 kb. In one embodiment, the homologous or orthologous
non-rat nucleic acid sequence ranges from about 90 kb to about 100
kb. In one embodiment, the homologous or orthologous non-rat
nucleic acid sequence ranges from about 100 kb to about 110 kb. In
one embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 110 kb to about 120 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 120 kb to about 130 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 140 kb to about 150 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 150 kb to about 160 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 160 kb to about 170 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 170 kb to about 180 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 180 kb to about 190 kb. In one
embodiment, the homologous or orthologous non-rat nucleic acid
sequence ranges from about 190 kb to about 200 kb. Various
polynucleotides of interest that can be employed in the insert
nucleic acid are described elsewhere herein.
[0386] 6. Cells
[0387] The various methods and compositions described herein employ
a genomic locus targeting system in a cell. In one embodiment, the
cell is a pluripotent cell. In one embodiment, the pluripotent cell
is a non-human pluripotent cell. In one embodiment, the non-human
pluripotent cell is a mammalian pluripotent cell. In one
embodiment, the pluripotent cell is a human induced pluripotent
stem (iPS) cell.
[0388] In one embodiment, the pluripotent cell is a pluripotent rat
cell. In one embodiment, the pluripotent rat cell is a rat
embryonic stem (ES) cell. In one embodiment, the pluripotent rat
cell is an induced pluripotent stem (iPS) cell or is a
developmentally restricted progenitor cell. In other embodiments,
the pluripotent rat cell is able to sustain its pluripotency
following at least one targeted genetic modification of its genome
and is able to transmit the targeted modification to a germline of
an F1 generation.
[0389] In one embodiment, the pluripotent cell is a non-human
fertilized egg at the single cell stage. In one embodiment, the
non-human fertilized egg is a mammalian fertilized egg. In one
embodiment, the mammalian fertilized egg is a rodent fertilized egg
at the single cell stage. In one embodiment, the mammalian
fertilized egg is a rat or mouse fertilized egg at the single cell
stage.
[0390] The various cells employed in the method and compositions
disclosed herein can also comprise prokaryotic cells, such as a
bacterial cell, including E. coli. In specific embodiments, the
prokaryotic cell is a recombination-competent strain of E. coli. In
one embodiment, the prokaryotic cell comprises a nucleic acid that
encodes the recombinase, while in other instances, the prokaryotic
cell does not comprise the nucleic acid that encodes the
recombinase, and the nucleic acid encoding the recombinase is
introduced into the prokaryotic cell. In one embodiment, the
nucleic acid encoding the recombinase comprises a DNA or an mRNA.
In some embodiments, the nucleic acid encoding the recombinase is
pABG. In one embodiment, the recombinase is expressed under the
control of an inducible promoter. In one embodiment, expression of
the recombinase is controlled by arabinose.
[0391] A. Rat Embryonic Stem (ES) Cells
[0392] As outlined in detail above, the various compositions and
methods provided herein can employ embryonic stem (ES) cells from
rat. In one embodiment, the pluripotent rat cell is a rat ES cell.
In one embodiment, the rat ES cell is derived from a rat strain is
a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer
strain, F344, F6, and Dark Agouti or ACI. In one embodiment, the
rat strain is a mix of two or more of a strain selected from the
group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6,
and Dark Agouti. In one embodiment, the rat ES cell is derived from
an inbred strain. In one embodiment, the rat ES cell is derived
from a strain selected from a DA strain and an ACI strain. In a
specific embodiment, the rat ES cell is derived from an ACI strain.
In one embodiment, the rat ES cell is derived from a rat
blastocyst.
[0393] In other embodiments, the rat ES cell is characterized by
expression of at least one pluipotency marker. In specific
embodiments, the rat ES cell is characterized by expression of a
pluripotency marker comprising Oct-4, Sox-2, alkaline phosphatase,
or a combination thereof. In one embodiment, the rat ES cell is a
male (XY) rat ES cell or a female (XX) rat ES cell.
[0394] In one embodiment, following the one to 15 serial genetic
modifications, the genetically modified rat ES cells upon exposure
to differentiation medium are capable of differentiation into a
plurality of cell types.
[0395] In one embodiment, following the one to 15 serial genetic
modifications, the genetically modified rat ES cells are capable of
being maintained in an undifferentiated state in culture. In one
embodiment, the genetically modified and cultured rat ES cells in
the undifferentiated state, when employed as donor cells in a rat
host embryo, populate the embryo and form a blastocyst comprising
the one to fifteen genetic modifications. In one embodiment, the
blastocyst, when implanted into a surrogate mother under conditions
suitable for gestation, develops into an F0 rat progeny that
comprises the one to 15 genetic modifications.
[0396] In one aspect, an isolated rat ES cell is provided that is
capable of sustaining pluripotency following one or more genetic
modifications in vitro, and that is capable of transmitting a
genetically modified genome to a germline of an F1 generation.
[0397] In one embodiment, the rat ES cell maintains its
pluripotency to develop into a plurality of cell types following
the one or more serial genetic modifications in vitro (e.g., two,
three, four, five, or six or more serial genetic modifications). In
one embodiment, the genetic modification is mediated by an
electroporation, by intracytoplasmic injection, by a viral
infection, by an adenovirus, by lentivirus, by retrovirus, by
transfection, by lipid-mediated transfection, or by
Nucleofaction.TM..
[0398] In one embodiment, the rat ES cell maintains its
pluripotency to develop into a plurality of cell types following a
single round of electroporation with an exogenous nucleic acid. In
one embodiment, the rat ES cell maintains its pluripotency to
develop into a plurality of cell types following a 2.sup.nd,
3.sup.rd, 4.sup.th, 5.sup.th, 6.sup.th, 7.sup.th, 8.sup.th,
9.sup.th, 10.sup.th, 11.sup.th, 12.sup.th, 13.sup.th, 14.sup.th, or
15.sup.th round of electroporation with an exogenous nucleic
acid.
[0399] In other embodiments, the rat ES cells employed are those
described in U.S. application Ser. No. 14/185,703, filed Feb. 20,
2014 and herein incorporated by reference in its entirety.
[0400] The pluripotent rat cell employed in the various methods and
compositions disclosed herein can be characterized by expression of
at least one pluripotency marker comprising Dnmt3L, Eras, Err-beta,
Fbxo15, Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4,
Sox15, Sox2, Utf1, and/or a combination thereof. In other
instances, the pluripotent rat cell employed in the various methods
and compositions disclosed herein is characterized by one or more
of the following features: (a) lack of expression of one or more
pluripotency markers comprising c-Myc, Ecat1, and/or Rexo1; (b)
lack of expression of one or more mesodermal markers comprising
Brachyury and/or Bmpr2; (c) lack of expression of one or more
endodermal markers comprising Gata6, Sox17, and/or Sox7; or (d)
lack of expression of one or more neural markers comprising Nestin
and/or Pax6. As used herein, "lack of expression" as it relates to
expression of a pluripotency marker means that the expression of
the pluripotency marker is at or below the experimental background
as determined for each individual experiment.
[0401] In one non-limiting embodiment, the rat ES cells provided
herein have one or more of any of the following properties:
[0402] (a) have germ-line competency, meaning when the rat ES cell
is implanted into a rat host embryo, the genome of the rat ES cell
line is transmitted into an offspring;
[0403] (b) have germ-line competency following at least one
targeted genetic modification, meaning when the rat ES cell having
the targeted genetic modification is implanted into a rat host
embryo, the targeted genetic modification within the genome of the
rat ES cell line is transmitted into an offspring;
[0404] (c) have pluripotency in vitro;
[0405] (d) have totipotency in vitro;
[0406] (e) when cultured in vitro loosely adhere to a feeder cell
layer;
[0407] (f) when cultured in vitro form sphere-like colonies when
plated on a feeder cell layer in vitro;
[0408] (g) maintain pluripotency when cultured in vitro under
conditions comprising a feeder cell layer that is not genetically
modified to express leukemia inhibitor factor (LIF), wherein the
culture media comprises a sufficient concentration of LIF;
[0409] (h) maintain pluripotency when cultured in vitro under
conditions comprising a feeder cell layer, wherein the culture
media comprises mouse LIF or an active variant or fragment
thereof;
[0410] (i) comprise a molecular signature that is characterized by
[0411] i) the expression of one or more of rat ES cell-specific
genes comprising Adheres Junctions Associate Protein (Ajap1),
Claudin 5 (Cldn5), Cdc42 guanine nucleotide exchange factor 9
(Arhgef9), Calcium/calmodulin-dependent protein kinase IV (Camk4),
ephrin-A1 (Efna1), EPH receptor A4 (Epha4), gap junction protein
beta 5 (Gjb5), Insulin-like growth factor binding protein-like 1
(Igfbp11), Interleulin 36 beta(Il1f8), Interleukin 28 receptor,
alpha (Il28ra), left-right determination factor 1 (Lefty1),
Leukemia inhibitory factor receptor alpha (Lifr), Lysophosphatidic
acid receptor 2 (Lpar2), Neuronal pentraxin receptor (Ntm), Protein
tyrosine phosphatase non-receptor type 18 (Ptpn18), Caudal type
homeobox 2 (Cdx2), Fibronectin type III and ankyrin repeat domains
1 (Fank1), Forkhead box El (thyroid transcription factor 2)
(Foxe1), Hairy/enhancer-of-split related with YRPW motif 2 (Hey2),
Forkhead box El (thyroid transcription factor 2) (Foxe1),
Hairy/enhancer-of-split related with YRPW motif 2 (Hey2), Lymphoid
enhancer-binding factor 1 (Lef1), Sal-like 3 (Drosophila) (Sall3),
SATB homeobox 1 (Satb1), miR-632, or a combination thereof; [0412]
ii) the expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more of the
rat ES cell-specific genes comprising Adheres Junctions Associate
Protein (Ajap1), Claudin 5 (Cldn5), Cdc42 guanine nucleotide
exchange factor 9 (Arhgef9), Calcium/calmodulin-dependent protein
kinase IV (Camk4), ephrin-A1 (Efna1), EPH receptor A4 (Epha4), gap
junction protein beta 5 (Gjb5), Insulin-like growth factor binding
protein-like 1 (Igfbp11), Interleulin 36 beta(Il1f8), Interleukin
28 receptor, alpha (I128ra), left-right determination factor 1
(Lefty1), Leukemia inhibitory factor receptor alpha (Lifr),
Lysophosphatidic acid receptor 2 (Lpar2), Neuronal pentraxin
receptor (Ntm), Protein tyrosine phosphatase non-receptor type 18
(Ptpn18), Caudal type homeobox 2 (Cdx2), Fibronectin type III and
ankyrin repeat domains 1 (Fank1), Forkhead box El (thyroid
transcription factor 2) (Foxe1), Hairy/enhancer-of-split related
with YRPW motif 2 (Hey2), Forkhead box El (thyroid transcription
factor 2) (Foxe1), Hairy/enhancer-of-split related with YRPW motif
2 (Hey2), Lymphoid enhancer-binding factor 1 (Lef1), Sal-like 3
(Drosophila) (Sall3), SATB homeobox 1 (Satb1), miR-632, or a
combination thereof; [0413] iii) at least a 20-fold increase in the
expression of one or more of the rat ES cell-specific genes as set
forth in Table 9 when compared to a F1H4 mouse ES cell; [0414] iv)
at least a 20-fold increase in the expression of at least 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25 or more of the rat ES cell-specific genes as set forth
in Table 9 when compared to a F1H4 mouse ES cell; [0415] v) the
expression of one or more of rat ES cell-specific genes as set
forth in Table 10; [0416] vi) the expression of at least 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 30, 35, 40, 45, 50 or more of the rat ES cell-specific
genes as set forth in Table 10; [0417] vii) at least a 20-fold
increase in the expression of one or more of the rat ES
cell-specific genes as set forth in Table 10 when compared to a
F1H4 mouse ES cell; [0418] viii) at least a 20-fold increase in the
expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or
more of the rat ES cell-specific genes as set forth in Table 10
when compared to a F1H4 mouse ES cell; [0419] ix) at least a
20-fold decrease in the expression of one or more of the rat ES
cell-specific genes as set forth in Table 8 when compared to a F1H4
mouse ES cell; [0420] x) at least a 20-fold decrease in the
expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or
more of the rat ES cell-specific genes as set forth in Table 8 when
compared to a F1H4 mouse ES cell; [0421] xi) any combination of
expression of the rat ES cell-specific genes of parts (i)-(x);
[0422] xii) a relative expression level of pluripotency markers as
shown in Table 11 for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17 or 18 of the listed pluripotency markers. See,
pluripotency ranking column of Table 11 for relative expression
levels; [0423] xiii) a relative expression level of the mesodermal
markers as shown in Table 11 for at least 2, 3, or 4 of the listed
mesodermal markers. See, mesodermal ranking column in Table 11 for
relative expression levels; [0424] xiv) a relative expression level
of endodermal markers as shown in Table 11 for at least 2, 3, 4, 5,
or 6 of the listed endodermal markers. See, endodermal ranking
column in Table 11 for relative expression levels; [0425] xv) a
relative expression level of neural markers as shown in Table 11
for at least 2 and 3 of the listed neural markers. See, neural
ranking column in Table 11 for relative expression levels; [0426]
xvi) a relative expression level of trophectoderm markers as shown
in Table 11 for the listed trophectoderm markers. See,
trophectoderm ranking column in Table 11 for relative expression
levels; [0427] xvii) any relative expression level of one or more
(2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) of the pluripotency
markers, mesodermal markers, endodermal markers, neural markers
and/or trophectoderm markers set forth in Table 11; [0428] xviii)
the relative expression level of each of the markers set forth in
Table 11; [0429] xix) any combination of the signatures set forth
in xii-xiix; and/or [0430] xx) any combination of the signature set
forth in i-xiix;
[0431] (j) have the ability to produce a F0 rat;
[0432] (k) are capable of being subcultured and maintaining the
undifferentiated state;
[0433] (l) have the same number of chromosomes as a normal rat
cell;
[0434] (m) maintain pluripotency in vitro without requiring
paracrine LIF signaling;
[0435] (n) have self renewal, meaning they divide indefinitely
while maintaining pluripotency;
[0436] (o) the rat ES cells express at least one pluripotency
marker comprising Dnmt3L, Eras, Err-beta, Fbxo15, Fgf4, Gdf3, Klf4,
Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15, Sox2, Utf1, and/or a
combination thereof;
[0437] (p) the rat ES cells do not express one or more
differentiation markers comprising c-Myc, Ecat1, and/or Rexo1;
[0438] (q) the rat ES cells do not express one or more mesodermal
markers comprising Brachyury, Bmpr2, and/or a combination
thereof;
[0439] (r) the rat ES cells do not express one or more endodermal
markers comprising Gata6, Sox17, Sox7, and/or combination thereof;
and/or
[0440] (s) the rat ES cells do not express one or more neural
markers comprising Nestin, Pax6, and/or combination thereof.
[0441] One or more of the characteristics outlined in (a)-(s) can
be present in a rat ES cell, a rat ES cell population or a rat ES
cell line employed in the methods and compositions provided herein,
wherein the rat ES cells have not undergone a targeted genetic
modification. Moreover, following the one or more genetic
modification to the rat target locus as described in detail above,
the one or more of the characteristics outlined in (a)-(s) can be
retained in the rat ES cell following the genetic modification of
the target locus.
[0442] In one embodiment, the rat ES cell exhibits a homologous
recombination efficiency of at least 2%, at least 3%, at least 4%,
at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at
least 10%, at least 11%, at least 12%, at least 13%, at least 14%,
at least 15%, at least 20%, at least 25%, at least 30%, at least
35%, at least 40%, at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, or at least
80%.
[0443] In one embodiment, the homologous recombination efficiency
employing the rat ES cell is greater than 4%.
[0444] In one embodiment, the rat ES cell has a doubling time
ranging from 24 hours to 36 hours. In one embodiment, the rat ES
cell has a doubling time of 25 hours.
[0445] In one embodiment, the rat ES cell can be passaged up to at
least 15 times in 2i medium (Millipore Cat. SF016-200). In one
embodiment, the rat ES cell can be passaged at least 14 times in 2i
medium (Millipore Cat. No. SF016-200). In one embodiment, the rat
ES cell can be passaged at least 13, 12, 11, 10, 9, 8, 7, 6, or 5
times in 2i medium.
[0446] In one embodiment, when transplanted into a pre-morula stage
rat embryo, the rat ES cell can contribute to at least 90% of the
cells in an F0 generation. In one embodiment, when transplanted
into a pre-morula stage rat embryo, the rat ES cell can contribute
to at least 95%, 96%, 97%, 98%, or 99% of the cells in an F0
generation.
[0447] In specific embodiments, the various rat ES cells and cell
lines employed in the various methods and compositions provided
herein are used to generate a targeted modification at a target
locus. The rat ES cell having these targeted genetic modifications
can be germ-line competent, meaning when the rat ES cell having the
targeted genetic modification is implanted into a rat host embryo,
the targeted genetic modification of the rat ES cell is transmitted
to the offspring (i.e., the F1 population). Thus, in various
aspects, the rat ES cells in the various methods and compositions
are employed to obtain a high frequency, or high efficiency, of
germline transmission of a rat cell genome from rat ES cells that
have undergone a targeted genetic modification. In various
embodiments, the frequency of germline transmission is greater than
1:600, greater than 1:500, greater than 1:400, greater than 1:300,
greater than 1:200, and greater than 1:100. In various embodiments,
the frequency of germline transmission is greater than 1%, greater
than 2%, greater than 3%, greater than 4%, greater than 5%, greater
than 6%, greater than 7%, greater than 8%, greater than 9%, greater
than 10%, up to about 16%, greater than 25%, greater than 50%,
greater than 60%, greater than 65%, greater than 70%, greater than
75% or greater. In various embodiments, the frequency of germline
transmission ranges from 9% to 16%. In various aspects, percent of
donor rESC-derived progeny in the F1 generation is 1% or more, 2%
or more, 3% or more, 10% or more, 20% or more, 30% or more, 40% or
more, 50% or more, 60% or more, from 3% to about 10% or more; from
3% or more to about 63%, from about 10% to about 30%, from about
10% to about 50%, from about 30% to about 70%, from about 30% to
about 60%, from about 20% to about 40%, from about 20% to 65%, or
from about 40% to 70%. Thus, a rat ES cell that has a targeted
genetic modification have the ability to transmit their genome into
the F1 population.
[0448] A rat ES cell that has a targeted genetic modification can
be pluripotent and/or totipotent. Various methods can be used to
determine if a rat ES cell is pluripotent. For example, the ES cell
can be assayed for the expression of various pluripotent markers
including, but not limited to, Oct-4, Sox2, alkaline phosphatase,
or a combination thereof. See, for example, Okamoto, K. et al.,
Cell, 60: 461-472 (1990), Scholer, H. R. et al., EMBO J. 9:
2185-2195 (1990)) and Nanog (Mitsui, K. et al., Cell, 113: 631-642
(2003), Chambers, I. et al., Cell, 113: 643-655 (2003) for various
methods of assaying for the presence or the level of such markers.
See, also FIGS. 2 and 3 provided herein. Other pluripotency markers
include, for example, the presence of at least 1, 2, 3, 4, or 5
pluripotency marker comprising Nanog, Klf4, Dppa2, Fgf4, Rex1,
Eras, Err-beta and/or Sall3. Other pluripotency markers include,
for example, the absence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or
10 pluripotency marker comprising T/Brachyury, Flk1, Noda1, Bmp4,
Bmp2, Gata6, Sox17, Hhex1, Sox7, and/or Pax6.
[0449] In specific embodiments, the expression and/or the level of
expression of these markers can be determined using RT-PCR. Various
kits are available to determine the level and/or presence of
alkaline phosphatase, including, for example, an ALP tissue
staining kit (Sigma) and Vector Red Alkaline Phosphatase Substrate
Kit I (Funakoshi) and the like. Additional assays include in situ
hybridization, immunohistochemistry, immunofluorescence. In
specific embodiments, the rat ES cell is characterized by
expression of at least one pluripotency marker, including for
example expression of Oct-4, Sox2, alkaline phosphatase, or a
combination thereof, and preferably all three of these markers.
[0450] The various rat ES cells employed in the method and
compositions provided herein are capable of maintaining
pluripotency and/or totipotency while being maintained in in vitro
culturing conditions. Thus, the various rat ES cells provide herein
can, in some embodiments, be subcultured while still maintaining
the undifferentiated state. Various methods of culturing the rat ES
cells are discussed in further detail elsewhere herein and in U.S.
patent application Ser. No. 14/185,103, filed on Feb. 20, 2014,
herein incorporated by reference in its entirety.
[0451] In some embodiments, the rat embryonic stem cells employed
herein have been isolated from the rat embryo employing various
isolation, purification, and culture expansion techniques which are
discussed in detail in U.S. application in U.S. patent application
Ser. No. 14/185,103, filed on Feb. 20, 2014, herein incorporated by
reference in its entirety.
[0452] An "isolated" rat ES cell or rat embryo has been removed
from its natural environment. The term "isolated" can mean free
from 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the constituents
with which a component is found in its natural state. As used
herein, a rat ES "cell line" comprises a population of isolated rat
cells that were developed from a single rat ES cell and therefore
the population of cells within a given cell line have a uniform
genetic makeup other than for mutations or karyotypic changes
occurring during propagation or during targeted genetic
modifications. For example, rat ES cells can be characterized by a
high level of euploidy. Nevertheless, in some cell lines the level
of euploidy is less than 100% due to karyotypic changes in
propagation of the line from a single cell. Moreover, a given
population of rat ES cells can comprise at least 1.times.10.sup.3,
1.times.10.sup.4, 1.times.10.sup.5, 1.times.10.sup.6,
1.times.10.sup.7, 1.times.10.sup.8, 1.times.10.sup.9, or
1.times.10.sup.10 cells or greater. Some cell populations have
sufficient cells to permit selection of a desired modified cell but
not an excessively greater number so as to reduce the possibility
of mutations or karyotypic changes developing in the cell line. For
example, some cell populations have 1.times.10.sup.3 to
1.times.10.sup.6 cells.
[0453] As discussed elsewhere herein, various methods are provided
for the targeted genetic modification of a rat ES cell line. When
such methods are carried out, at least one cell within a rat ES
cell line contains the targeted genetic modification. Through
various culturing and/or selection techniques rat ES cell lines
having one or more desired targeted genetic modifications are
produced.
[0454] In specific embodiments, a rat ES cell, a population of rat
ES cell or a rat ES cell line (that have not undergone a targeted
genetic modification and/or have a targeted genetic modification)
are euploid, and thus have a chromosome number that is an exact
multiple of the haploid number. In further embodiment, a rat ES
cell, a population of rat ES cells or a rat ES cell line (that have
not undergone a targeted genetic modification and/or have a
targeted genetic modification) are diploid, and thus have two
haploid sets of homologous chromosomes. When referring to a rat ES
cell population or a population of cells from a given population of
rat ES cells or a rat ES cell line (that have not undergone a
targeted genetic modification and/or have a targeted genetic
modification), at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or 100% of the cells with the given population are euploid
and/or diploid. In other instances, when referring to a rat ES cell
population or a population of cells from a given rat ES cell line
(that have not undergone a targeted genetic modification and/or
have a targeted genetic modification), at least about 50% to 95%,
about 60% to 90%, about 60% to 95%, about 60% to 85%, about 60% to
80%, about 70% to 80%, about 70% to 85%, about 70% to about 90%,
about 70% to about 95%, about 70% to about 100%, about 80% to about
100%, about 80% to about 95%, about 80% to about 90%, about 90% to
about 100%, about 90% to about 99%, about 90% to about 98%, about
90% to about 97%, about 90% to about 95% of the cells within the
given population are euploid and/or diploid.
[0455] In still further embodiments, a rat ES cell, a population of
rat ES cells or a rat ES cell line (that have not undergone a
targeted genetic modification and/or have a targeted genetic
modification) have 42 chromosomes. When referring to a rat ES cell
population or a population of cells from a given rat ES cell line
(that have not undergone a targeted genetic modification and/or
have a targeted genetic modification) at least about 50%, 60%, 65%,
70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% of the cells with the given
population have 42 chromosomes. In other instances, when referring
to a rat ES cell population or a population of cells from a given
rat ES cell line (that have not undergone a targeted genetic
modification and/or have a targeted genetic modification) at least
about 50% to 95%, about 60% to 90%, about 60% to 95%, about 60% to
85%, about 60% to 80%, about 70% to 80%, about 70% to 85%, about
70% to about 90%, about 70% to about 95%, about 70% to about 100%,
about 80% to about 100%, about 80% to about 95%, about 80% to about
90%, about 90% to about 100%, about 90% to about 99%, about 90% to
about 98%, about 90% to about 97%, about 90% to about 95% of the
cells within the given population have 42 chromosomes.
[0456] In further embodiments, a rat ES cell, a population of rat
ES cells or a rat ES cell line (that have not undergone a targeted
genetic modification and/or have a targeted genetic modification)
provided herein form sphere-like colonies when plated on a feeder
cell layer in vitro. The "sphere-like" morphology refers to the
shape of rat ES cell colonies in culture, rather than the shape of
individual ES cells. The rat ES cell colonies are spherical-like.
Colonies, which are loosely attached to the feeder cells appear
circular (have a circular-like morphology). Free-floating colonies
are spherical-like. The rat ES cell colonies are spherical-like and
very compact, meaning: the boundaries between cells are very hard
to see. The edge of the colony appears bright and sharp. Individual
nuclei are difficult to distinguish because the cells are very
small (so that the nucleus takes up most of the volume of the
cell). Mouse ES Cells form elongated colonies and attach strongly
to feeder cells. mESC morphology can vary with strain; e.g. B6
colonies are rounder and more domed than F1H4 colonies but are
still more elongated than rESC. Human ES cell colonies are flatter
and more spread out than mESC colonies. The instant rat ES colonies
are not flat and do not resemble human ES cell colonies.
[0457] In still further embodiments, a rat ES cell, a population of
rat ES cells or a rat ES cell line (that have not undergone a
targeted genetic modification and/or have a targeted genetic
modification) have a circular morphology. A morphology scale for a
circle is provided below, where a score of a 10 represents a
perfect circle and a score of a 1 represents an ellipse.
[0458] Morphology scale of a circle:
[0459] 10=A circle with a structure having a longitudinal axis and
a vertical axis that run through the center of the structure and
are of equal length.
[0460] 9=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.9999 to 0.9357 the length of the other axis.
[0461] 8=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.9357 to 0.875 the length of the other axis.
[0462] 7=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.875 to about 0.8125 the length of the other
axis.
[0463] 6=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.8125 to 0.750 the length of the other axis.
[0464] 5=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.750 to 0.6875 the length of the other axis.
[0465] 4=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.6875 to 0.625 the length of the other axis.
[0466] 3=A structure having a longitudinal axis and vertical axis
that run through the center of the structure, wherein one of the
axis is between 0.625 to 0.5625 the length of the other axis.
[0467] 2=A structure having a longitudinal axis and vertical axis
that run through the center of the circle, wherein one of the axis
is between 0.5625 to 0.523 the length of the other axis.
[0468] 1=An ellipse is defined as having a longitudinal axis and
vertical axis that run through the center of the structure, wherein
one of the axis is between 0.523 to 0.500 the length of the other
axis.
[0469] In one non-limiting embodiment, the rat ES cell population
or a population of cells from a given rat ES cell line (that have
not undergone a targeted genetic modification and/or have a
targeted genetic modification) have at least about 50%, 60%, 65%,
70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% of the cells with the given
population have a circular morphology score of a 10, 9 or 8. In
other embodiments, the rat ES cell population or a population of
cells from a given rat ES cell line (that have not undergone a
targeted genetic modification and/or have a targeted genetic
modification) have at least about 50% to 95%, about 60% to 90%,
about 60% to 95%, about 60% to 85%, about 60% to 80%, about 70% to
80%, about 70% to 85%, about 70% to about 90%, about 70% to about
95%, about 70% to about 100%, about 80% to about 100%, about 80% to
about 95%, about 80% to about 90%, about 90% to about 100%, about
90% to about 99%, about 90% to about 98%, about 90% to about 97%,
about 90% to about 95% of the cells within the given population
have a circular morphology score of a 10, 9, or 8.
[0470] In another non-limiting embodiment, the rat ES cell
population or a population of cells from a given rat ES cell line
(that have not undergone a targeted genetic modification and/or
have a targeted genetic modification) have at least about 50%, 60%,
65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or 100% of the cells with the given
population have a circular morphology score of a 7, 6, 5, 4 or 3.
In other non-limiting embodiments, the rat ES cell population or a
population of cells from a given rat ES cell line (that have not
undergone a targeted genetic modification and/or have a targeted
genetic modification) have at least about 50% to 95%, about 60% to
90%, about 60% to 95%, about 60% to 85%, about 60% to 80%, about
70% to 80%, about 70% to 85%, about 70% to about 90%, about 70% to
about 95%, about 70% to about 100%, about 80% to about 100%, about
80% to about 95%, about 80% to about 90%, about 90% to about 100%,
about 90% to about 99%, about 90% to about 98%, about 90% to about
97%, about 90% to about 95% of the cells within the given
population have a circular morphology score of a 7, 6, 5, 4, or
3.
[0471] In still further embodiments, sphere-like colonies form when
the rat ES cells (that have not undergone a targeted genetic
modification and/or have a targeted genetic modification) are
plated on a feeder cell layer in vitro. A morphology scale for a
sphere is provided below, where a score of a 10 represents a
perfect sphere and a score of a 1 represents a three dimensional
elliptical structure.
[0472] Morphology scale of a sphere-like structure:
[0473] 10=A sphere is a structure having an X-axis and a Y-axis and
a Z-axis each of which runs through the center of the structure and
are of equal length.
[0474] 9=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.9999 to 0.9357 the length of at least one of the
other axes.
[0475] 8=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.9357 to 0.875 the length of at least one or both
of the other axes.
[0476] 7=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.875 to 0.8125 the length of at least one or both
of the other axes.
[0477] 6=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.8125 to 0.750 the length of at least one or both
of the other axes.
[0478] 5=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is 0.750 to 0.6875 the length of at least one or both of the
other axes.
[0479] 4=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is 0.6875 to 0.625 the length of at least one or both of the
other axes.
[0480] 3=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.625 to 0.5625 the length of at least one or both
of the other axes.
[0481] 2=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.5625 to 0.523 the length of at least one or both
of the other axes.
[0482] 1=A structure having an X axis and a Y-axis and a Z-axis
that run through the center of the structure, wherein one of the
axis is between 0.523 to 0.500 the length of at least one or both
of the other axes.
[0483] In one non-limiting embodiment, the rat ES cell population
or a population of cells from a given rat ES cell line (that have
not undergone a targeted genetic modification and/or have a
targeted genetic modification) have at least about 50%, 60%, 65%,
70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% of the colonies that form when the
cells are plated on a feeder cell layer in vitro have a sphere-like
morphology of a 10, 9 or 8. In other embodiments, the rat ES cell
population or a population of cells from a given rat ES cell line
(that have not undergone a targeted genetic modification and/or
have a targeted genetic modification) have at least about 50% to
95%, about 60% to 90%, about 60% to 95%, about 60% to 85%, about
60% to 80%, about 70% to 80%, about 70% to 85%, about 70% to about
90%, about 70% to about 95%, about 70% to about 100%, about 80% to
about 100%, about 80% to about 95%, about 80% to about 90%, about
90% to about 100%, about 90% to about 99%, about 90% to about 98%,
about 90% to about 97%, about 90% to about 95% of the colonies that
form when the cells are plated on a feeder cell layer in vitro have
a sphere-like morphology of a 10, 9 or 8.
[0484] In another non-limiting embodiment, the rat ES cell
population or a population of cells from a given rat ES cell line
(that have not undergone a targeted genetic modification and/or
have a targeted genetic modification) have at least about 50%, 60%,
65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or 100% of the colonies that form when
the cells are plated on a feeder cell layer in vitro have a
sphere-like morphology of a 7, 6, 5, 4, or 3. In other embodiments,
the rat ES cell population or a population of cells from a given
rat ES cell line (that have not undergone a targeted genetic
modification and/or have a targeted genetic modification) have at
least about 50% to 95%, about 60% to 90%, about 60% to 95%, about
60% to 85%, about 60% to 80%, about 70% to 80%, about 70% to 85%,
about 70% to about 90%, about 70% to about 95%, about 70% to about
100%, about 80% to about 100%, about 80% to about 95%, about 80% to
about 90%, about 90% to about 100%, about 90% to about 99%, about
90% to about 98%, about 90% to about 97%, about 90% to about 95% of
the colonies that form when the cells are plated on a feeder cell
layer in vitro have a sphere-like morphology of a 7, 6, 5, 4, or
3.
[0485] A given rat ES cell, employed in the various methods and
compositions provided herein can be a male (XY) rat ES cell, a male
(XY) population of rat ES cells, or a male (XY) rat ES cell line.
In other embodiments, a population of rat ES cells or a rat ES cell
line employed herein can be a female (XX) rat ES cell, a female
(XX) population of rat ES cells, or a female (XX) rat ES cell line.
Any such rat ES cell, population of rat ES cells or rat ES cell
line can comprise the euploidy and/or diploidy as described
above.
[0486] The various rat ES cells employed in the methods and
compositions can be from any rat strain, including but not limited
to, an ACI rat strain, a Dark Agouti (DA) rat strain, a Wistar rat
strain, a LEA rat strain, a Sprague Dawley (SD) rat strain, or a
Fischer rat strain such as Fisher F344 or Fisher F6. The various
rat ES cells can also be obtained from a strain derived from a mix
of two or more strains recited above. In one embodiment, the rat ES
cell is derived from a strain selected from a DA strain and an ACI
strain. In a specific embodiment, the rat ES cell is derived from
an ACI strain. The ACI rat strain is are characterized as having
black agouti, with white belly and feet and an RT1av1 haplotype.
Such strains are available from a variety of sources including
Harlan Laboratories. In other embodiments, the various rat ES cells
are from a Dark Agouti (DA) rat strain, which is characterized as
having an agouti coat and an RT1av1 haplotype. Such rats are
available from a variety of source including Charles River and
Harlan Laboratories. In a further embodiment, the various rat ES
cells employed herein are from an inbred rat strain.
[0487] In specific embodiments the rat ES cell line is from an ACI
rat and comprises the ACI.G1 rat ES cell as described in detail in
U.S. patent application Ser. No. 14/185,103, filed on Feb. 20,
2014, herein incorporated by reference in its entirety. In another
embodiment, the rat ES cell line is from a DA rat and comprises the
DA.2B rat ES cell line or the DA.2C rat ES cell line as described
in detail in U.S. patent application Ser. No. 14/185,103, filed on
Feb. 20, 2014, herein incorporated by reference in its
entirety.
[0488] A given rat ES cell provided herein can be obtained from a
rat embryo at various stages of rat embryo development. The rat
embryos employed to derive the rat ES cells can be a morula-stage
embryo, a blastocyst-stage embryo, or a rat embryo at a
developmental stage between a morula-stage embryo and a
blastocyst-stage embryo. Thus, in specific embodiments, the rat
embryo employed is at or between the Witschi stages of 5 and 7. In
other embodiments, the rat embryo employed is at the Witschi stage
5, 6, or 7.
[0489] In one embodiment, the rat ES cell is obtained from a rat
blastocyst. In other embodiments, the rat ES cell is obtained from
a blastocyst from a superovulated rat. In other embodiments, the
rat ES cells are obtained from an 8-cell stage embryo, which is
then cultured in vitro until it develops into a morula-stage,
blastocyst stage, an embryo between the Witschi stages 5 and 7, or
into an embryo at the Witschi stage 5, 6, or 7. At which time the
embryos are then plated. Morula-stage embryos comprise a compact
ball of cells with no internal cavity. Blastocyst-stage embryos
have a visible internal cavity (the blastocoel) and contain an
inner cell mass (ICM). The ICM cells form ES cells.
[0490] B. Derivation and Propagation of Rat Embryonic Stem (ES)
Cells
[0491] Methods of derivation and propagation of rat embryonic stem
cells are known in the art and are disclosed, for example, in U.S.
patent application Ser. No. 14/185,103, filed on Feb. 20, 2014,
herein incorporated by reference in its entirety. In specific
embodiments, such methods comprise (a) providing an in vitro
culture comprising a feeder cell layer and a population of isolated
rat embryonic stem (ES) cells; (b) culturing in vitro under
conditions which are sufficient to maintain pluipotency and/or
totipotency of the isolated rat ES cell. Such methods thereby allow
for the propagation of a rat ES cell population and/or a rat ES
cell line.
[0492] Methods for culturing a rat embryonic stem cell line is
provided. Such methods comprise culturing in vitro a feeder cell
layer and a rat ES cell line, wherein the culture conditions
maintain pluripotency of the rat ES cells and comprise a media
having mouse leukemia inhibitor factor (LIF) or an active variant
or fragment thereof. The methods can further comprise passaging and
culturing in vitro the cells of the rat ES cell line, wherein each
subsequent in vitro culturing comprises culturing the rat ES cells
on the feeder cell layer under conditions that maintain
pluripotency of the rat ES cells and comprises a media having mouse
LIF or an active variant or fragment thereof.
[0493] The culture media employed in the various methods and
compositions can maintain the rat ES cells. The terms "maintaining"
and "maintenance" refer to the stable preservation of at least one
or more of the characteristics or phenotypes of the rat ES cells
outline herein. Such phenotypes can include maintaining
pluripotency and/or totipotency, cell morphology, gene expression
profiles and the other functional characteristics of the rat stem
cells described herein. The term "maintain" can also encompass the
propagation of stem cells, or an increase in the number of stem
cells being cultured. The term further contemplates culture
conditions that permit the stem cells to remain pluripotent, while
the stem cells may or may not continue to divide and increase in
number.
[0494] The term "feeder cell" or "feeder cell layer" comprises a
culture of cells that grow in vitro and secrete at least one factor
into the culture medium that is used to support the growth of
another cell of interest in the culture. The feeder cells employed
herein aid in maintaining the pluripotency of the rat ES cells, and
in specific embodiments, one or more of the other characteristics
or phenotypes described herein. Various feeder cells can be used
including, for example, mouse embryonic fibroblasts, including
mouse embryonic fibroblasts obtained between the 12.sup.th and
16.sup.th day of pregnancy. In specific embodiments, feeder cell
layer comprises a monolayer of mitotically inactivated mouse
embryonic fibroblasts (MEFs).
[0495] The in vitro cultures of the rat ES cells further comprise
an effective amount of Leukemia Inhibitor Factor (LIF) or an active
variant or fragment thereof. Leukemia inhibitory factor (LIF)
belongs to the IL-6 receptor family. LIF binds to a heterodimeric
membrane receptor made up of a LIF-specific subunit, gp190 or LIFR,
and the subunit gp130, which is shared with the other members of
the IL-6 family. LIF inhibits the differentiation of embryonic stem
cells in mice and contribute to stem cell self-renewal. Human and
mouse LIF share 79% sequence homology and exhibit cross-species
activity. Rat LIF (rtLIF) is a 22.1 kDa protein containing 202
amino acid residues that exhibits 91% amino acid sequence identity
with murine LIF (Takahama et al. 1998). There are six possible
asparagine-linked glycosylation (N-glycosylation) sites which are
conserved among the LIF polypeptide from the various species and an
additional site of Asn150 which is specific for rat LIF. The
tertiary structure of the mouse LIF and its function is described
in further detail in Aikawa et al. (1998) Biosci. Biotechnol.
Biochem. 62 1318-1325 and Senturk et al. (2005) Immunology of
Pregnancy, editor Gil Mor., U.S. Pat. No. 5,750,654 and D P Gearing
(1987) EMBO Journal 1987-12-20, each of which is herein
incorporated by reference in their entirety. A partial mouse LIF
sequence is reported on the SwissProt website under the accession
number P09056.
[0496] Mouse LIF activity is assessed by its ability to induce
differentiation of M1 myeloid leukemia cells. The specific activity
is 1.times.10.sup.6 units/ml (Cat. No. 03-0011 from Stemgent) and
1.times.10.sup.7 units/ml (Cat. No. 03-0011-100 from Stemgent),
where 50 units is defined as the amount of mouse LIF required to
induce differentiation in 50% of the M1 colonies in 1 ml of medium.
See, also, Williams, R. L. et al. (1988) Nature 336: 684-687;
Metcalf, D. et al. (1988) Leukemia 2: 216-221; Niwa, H. et al.
(2009) Nature 460: 118-122; Xu, J. et al. (2010) Cell Biol Int. 34:
791-797; Fukunaga, N. et al. (2010) Cell Reprogram. 12: 369-376;
and, Metcalf D. (2003) Stem Cells 21: 5-14, each of which is herein
incorporated by reference in their entirety. An "effective amount
of LIF" comprises a concentration of LIF that allows the rat ES
cells of an in vitro culture to remain in an undifferentiated
pluripotent state. Various markers that can be used to assay for
the cells remaining in a pluripotent state are discussed elsewhere
herein.
[0497] The LIF polypeptide employed in the various methods and
compositions provided herein can be from any organism, including
from a mammal, a rodent, a human, a rat or a mouse. In one
embodiment, the LIF polypeptide is from a mouse. In still further
embodiments, the mouse LIF polypeptide comprises the amino acid
sequence set forth in SwissProt Accession number: P09056, which is
herein incorporated by reference in its entirety and is also set
forth in SEQ ID NO: 9.
[0498] In other embodiments, an active variant or fragment of the
mouse LIF polypeptide as set forth in SEQ ID NO: 9 or in SwissProt
Accession number: P09056 can be used. Such active variants and
fragments (including active variants having at least 75%, 80%, 85%
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence
identity to SEQ ID NO: 9 are discussed in further detail elsewhere
herein.
[0499] LIF polypeptide or the active variant or fragment thereof
can be provided to the in vitro culture in a variety of ways. In
one embodiment, the effective amount of the LIF polypeptide or the
active variant or fragment thereof is added to the culture media.
In other embodiments, the feeder cells have been genetically
modified to overexpress the LIF polypeptide or the active variant
or fragment thereof. Such feeder cells include feeder cells
prepared from gamma-irradiated or mitomycin-C treated DIA-M mouse
fibroblasts that express matrix-associated LIF. Method of
generating and using such genetically modified feeder cells can be
found, for example, in See, Buehr et al. (2003) Biol Reprod
68:222-229, Rathjen et al, (1990) Cell 62 1105-1115, and Buehr et
al. (2008) Cell 135:1287-1298, each of which is herein incorporated
by reference. The heterologous LIF expressed in the feeder cells
can be from the same organism as the feeder cells or from an
organism that is different from that of the feeder cell. In
addition, the heterologous LIF expressed in the feeder cells can be
from the same or from a different organism than the ES cells the
feeder layer is supporting.
[0500] In still other embodiments, the feeder cells employed in the
various methods disclosed herein are not genetically modified to
express a heterologous LIF polypeptide or an active variant or
fragment thereof. Thus, in particular embodiments, the monolayer of
mitotically inactivated mouse embryonic fibroblast employed in the
methods has not been genetically modified to express a heterologous
LIF polypeptide.
[0501] In other embodiments, the LIF polypeptide or the active
variant or fragment thereof is added to the culture media. When LIF
is added to the culture media, the LIF can be from any organism,
including from a mammal, a rodent, a human, a rat or a mouse. In
one embodiment, the LIF present in the culture media is from a
mouse. In still further embodiments, the mouse LIF polypeptide
comprises the amino acid sequence set forth in SEQ ID NO:9. In
other embodiments, an active variant or fragment of the mouse LIF
polypeptide as set forth in SEQ ID NO:9 can be used. Such active
variants and fragments (including active variants having at least
75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
sequence identity to SEQ ID NO: 9) are discussed in further detail
elsewhere herein.
[0502] In specific embodiments, the rat ES cells and rat ES cell
lines provided herein maintain pluripotency in vitro without
requiring paracrine LIF signaling.
[0503] In specific embodiments, LIF or an active variant or
fragment thereof is present in the culture media at any
concentration that maintains the rat ES cells. LIF polypeptide or
active variant or fragment thereof is present in the culture media
at about 25 U/ml to about 50 U/ml, at about 50 U/ml to about 100
U/ml, at about 100 U/ml to about 125 U/ml, at about 125 U/ml to
about 150 U/ml, at about 150 U/ml to about 175 U/ml, at about 175
U/ml to about 200 U/ml, at about 200 U/ml to about 225 U/ml, at
about 225 U/ml to about 250 U/ml, at about 250 U/ml to about 300
U/ml, to about 300 U/ml to about 325 U/ml, at about 325 U/ml to
about 350 U/ml, at about 350 U/ml to about 400 U/ml, at about 400
U/ml to about 425 U/ml, at about 425 U/ml to about 450 U/ml, at
about 450 U/ml to about 475 U/ml, at about 475 U/ml to about 500
U/ml, at about 75 U/ml to about 500 U/ml or greater. In other
embodiments, LIF polypeptide or active variant or fragment thereof
is present in the culture media at about 25 U/ml to about 50 U/ml,
at about 25 U/ml to about 100 U/ml, at about 75 U/ml to about 125
U/ml, at about 50 U/ml to about 150 U/ml, at about 90 U/ml to about
125 U/ml, at about 90 U/ml to about 110 U/ml, at about 80 U/ml to
about 150 U/ml, or at about 80 U/ml to about 125 U/ml. In a
specific embodiment, LIF polypeptide or active variant or fragment
thereof is present in the culture media at about 100 U/ml.
[0504] When mouse LIF is employed, the mouse LIF polypeptide or
active variant or fragment thereof is present in the culture media
at any concentration that maintains the rat ES cells. Mouse LIF
polypeptide or active variant or fragment thereof is present at
about 25 U/ml to about 50 U/ml, at about 50 U/ml to about 100 U/ml,
at about 100 U/ml to about 125 U/ml, at about 125 U/ml to about 150
U/ml, at about 150 U/ml to about 175 U/ml, at about 175 U/ml to
about 200 U/ml, at about 200 U/ml to about 225 U/ml, at about 225
U/ml to about 250 U/ml, at about 250 U/ml to about 300 U/ml, to
about 300 U/ml to about 325 U/ml, at about 325 U/ml to about 350
U/ml, at about 350 U/ml to about 400 U/ml, at about 400 U/ml to
about 425 U/ml, at about 425 U/ml to about 450 U/ml, at about 450
U/ml to about 475 U/ml, at about 475 U/ml to about 500 U/ml, at
about 75 U/ml to about 500 U/ml or greater. In other embodiments,
mouse LIF polypeptide or active variant or fragment thereof is
present at about 25 U/ml to about 50 U/ml, at about 25 U/ml to
about 100 U/ml, at about 75 U/ml to about 125 U/ml, at about 50
U/ml to about 150 U/ml, at about 90 U/ml to about 125 U/ml, at
about 90 U/ml to about 110 U/ml, at about 80 U/ml to about 150
U/ml, or at about 80 U/ml to about 125 U/ml. In a specific
embodiment, mouse LIF polypeptide or active variant or fragment
thereof is present in the culture media at about 100 U/ml.
[0505] The culture media employed maintains rat ES cells. As such,
in specific embodiments, the culture media employed in the various
method and compositions will maintain the pluripotency of all or
most of (i.e., over 50%) of the rat ES cells in a cell line for a
period of a at least 5, 10 or 15 passages. In one embodiment, the
culture media comprises one or more compounds that assist in
maintaining pluripotency. In one embodiment, the culture media
comprises a MEK pathway inhibitor and a glycogen synthase kinase-3
(GSK-3) inhibitor. The media can further comprise additional
components that aid in maintaining the ES cells, including for
example, FGF receptor inhibitors, ROCK inhibitors, and/or ALK (TGFb
receptor) inhibitors. A non-limiting example of an FGF receptor
inhibitors includes PD184352. A non-limiting example of a ROCK
inhibitor includes Y-27632, and non-limiting example of an ALK
(TGFb receptor) inhibitor includes A-83-01. In specific
embodiments, 2i media is used with 10 uM ROCKi when thawing
cryopreserved rESC or when re-plating rESC after dissociation with
trypsin.
[0506] In other embodiments, the media comprises a combination of
inhibitors consisting of a MEK pathway inhibitor and a glycogen
synthase kinase-3 (GSK-3) inhibitor.
[0507] In one non-limiting embodiment, the culture media comprises
a GSK-3 inhibitor comprising CHIR99021 and/or comprises a MEK
inhibitor comprising PD0325901. In other embodiments, the media
comprises a combination of inhibitors consisting of CHIR99021 and
PD0325901. Either of these compounds can be obtained, for example,
from Stemgent. In specific embodiments, CHIR99021 is present in the
culture media at a concentration of about 0.5.mu. to about 3 .mu.M,
about 0.5.mu. to about 3.5 .mu.M, about 0.5 .mu.M to about 4 .mu.M,
about 0.5 .mu.M to about 1 .mu.M, about 1 .mu.M to about 1.5 .mu.M,
about 1.5 .mu.M to about 2 .mu.M, about 2 .mu.M to about 2.5 .mu.M,
about 2.5 to about 3 .mu.M, 3 .mu.M to about 3.5 .mu.M. In further
embodiments, CHIR99021 is present in the culture media at a
concentration of about 3 .mu.M. In other embodiments, PD0325901 is
present in the culture media at a concentration of about 0.4 .mu.M
to about 1 uM, about 0.4 .mu.M to about 1.5 uM, about 0.4 .mu.M to
about 2 .mu.M, about 0.4 .mu.M to about 0.8 .mu.M, 0.8 .mu.M to
about 1.2 .mu.M, about 1.2 to about 1.5 .mu.M. In further
embodiments, PD0325901 is present in the culture media at a
concentration of about 1 .mu.M. In specific embodiments, CHIR99021
is present in the culture media at a concentration of about 3 .mu.M
and PD0325901 is present at a concentration of about 1 .mu.M.
[0508] In one non-limiting embodiment, the culture media employed
in the various methods and compositions disclosed herein is a 2i
media which comprises: DMEM/F12 basal media (at a concentration of
1.times. (50%)); Neurobasal media (at a concentration of 1.times.
(50%)); Penicillin/streptomycin (at a concentration of 1%);
L-Glutamine (at a concentration of 4 mM); 2-Mercaptoethanol (at a
concentration of 0.1 mM); N2 supplement (at a concentration of
1.times.); B27 supplement (at a concentration 1.times.); LIF (at a
concentration of 100 U/ml); PD0325901 (MEK inhibitor) (at a
concentration of 1 .mu.M) and CHIR99021 (GSK inhibitor) (at a
concentration of 3 .mu.M).
[0509] Additional media that can be employed include those
disclosed in Li et al. (2008) Cell 135:1299-1310, Yamamoto et al.
(2012) Transgenic Rats 21:743-755, Ueda et al. (2008) PLoS ONE
3(6):e2800, Meek et al. (2010) PLoS ONE 4 (12): e14225; Tong et al.
(2010) Nature 467:211-213; US Patent Publication 2012/0142092,
Buehr et al. (2008) Cell 135:1287-1298, Li et al. (135) Cell
1299-1310, each of which is herein incorporated by reference in
their entirety. When employing such media, the concentration and
the source of LIF can be modified as outlined herein. In specific
embodiments, the various culture medias are used in combination
with mouse LIF or an active variant or fragment thereof, and in
even further embodiments, the various culture medias comprise a
mouse LIF or an active variant or fragment thereof at a
concentration of about 50 U/ml to about 100 U/ml, about 50 U/ml to
about 150 U/ml, or about 100 U/ml.
[0510] The temperature of the cultures of rat ES cells, both for
the production of the ES cell line and for the culturing and
maintaining of the ES line it typically carried out at about
35.degree. C. to about 37.5.degree. C. In specific embodiment, the
temperature is 37.0.degree. C. The culture is typically carried out
at 7.5% CO.sub.2.
[0511] 7. Sequence Identity
[0512] The methods and compositions provided herein employ a
variety of different components of the targeted genomic integration
system (i.e. nuclease agents, recognition sites, insert nucleic
acids, polynucleotides of interest, targeting vectors, selection
markers and other components). It is recognized throughout the
description that some components of the targeted genomic
integration system can have active variants and fragments. Such
components include, for example, nuclease agents (i.e. engineered
nuclease agents), nuclease agent recognition sites, polynucleotides
of interest, target sites and corresponding homology arms of the
targeting vector. Biological activity for each of these components
is described elsewhere herein.
[0513] As used herein, "sequence identity" or "identity" in the
context of two polynucleotides or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0514] As used herein, "percentage of sequence identity" means the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0515] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
using the following parameters: % identity and % similarity for a
nucleotide sequence using GAP Weight of 50 and Length Weight of 3,
and the nwsgapdna.cmp scoring matrix; % identity and % similarity
for an amino acid sequence using GAP Weight of 8 and Length Weight
of 2, and the BLOSUM62 scoring matrix; or any equivalent program
thereof "Equivalent program" means any sequence comparison program
that, for any two sequences in question, generates an alignment
having identical nucleotide or amino acid residue matches and an
identical percent sequence identity when compared to the
corresponding alignment generated by GAP Version 10.
[0516] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein also can be used in the practice or testing of the described
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0517] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
references unless the context clearly dictates otherwise. All
technical and scientific terms used herein have the same
meaning.
[0518] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the described invention is not entitled to antedate such
publication by virtue of prior invention. Further, the dates of
publication provided may be different from the actual publication
dates, which may need to be independently confirmed.
[0519] The described invention may be embodied in other specific
forms without departing from the spirit or essential attributes
thereof and, accordingly, reference should be made to the appended
claims, rather than to the foregoing specification, as indicating
the scope of the invention.
[0520] Non-limiting embodiments include:
[0521] 1. A method for targeted modification of a genomic locus of
interest in a pluripotent rat cell, comprising (a) introducing into
the pluripotent rat cell a large targeting vector (LTVEC)
comprising an insert nucleic acid flanked with a 5' rat homology
arm and a 3' rat homology arm, wherein the sum total of the 5' and
the 3' homology arms is at least 10 kb but less than 150 kb; and
(b) identifying a genetically modified pluripotent rat cell
comprising the targeted genetic modification at the genomic locus
of interest, wherein the targeted genetic modification is capable
of being transmitted through the germline.
[0522] 2. The method of embodiment 1, wherein the targeted genetic
modification is biallelic.
[0523] 3. The method of embodiment 1 or 2, wherein the pluripotent
rat cell is a rat embryonic stem (ES) cell.
[0524] 4. The method of embodiment 1, 2 or 3, wherein the
pluripotent rat cell is derived from a DA strain or an ACI
strain.
[0525] 5. The method of any one of embodiments 1-4, wherein the
pluripotent rat cell is characterized by expression of at least one
pluripotency marker comprising Dnmt3L, Eras, Err-beta, Fbxo15,
Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15,
Sox2, Utf1, or a combination thereof.
[0526] 6. The method of any one of embodiments 1-4 wherein the
pluripotent rat cell is characterized by one of more of the
following characteristics:
[0527] (a) lack of expression of one or more pluripotency markers
comprising c-Myc, Ecat1, and/or Rexo1; (b) lack of expression of
mesodermal markers comprising Brachyury and/or Bmpr2; (c) lack of
expression of one or more endodermal markers comprising Gata6,
Sox17 and/or Sox7; or (d) lack of expression of one or more neural
markers comprising Nestin and/or Pax6.
[0528] 7. The method of any one of embodiments 1-6, wherein the sum
total of the 5' and the 3' homology arms of the LTVEC is from about
10 kb to about 30 kb, from about 20 kb to about 40 kb, from about
40 kb to about 60 kb, from about 60 kb to about 80 kb, from about
80 kb to about 100 kb, from about 100 kb to about 120 kb, or from
about 120 kb to 150 kb.
[0529] 8. The method of any one of embodiments 1-6, wherein the sum
total of the 5' and the 3' homology arms of the LTVEC is from about
16 Kb to about 150 Kb.
[0530] 9. The method of any one of embodiments 1-8, wherein the
targeted genetic modification comprises: (a) a replacement of an
endogenous rat nucleic acid sequence with a homologous or an
orthologous nucleic acid sequence; (b) a deletion of an endogenous
rat nucleic acid sequence; (c) a deletion of an endogenous rat
nucleic acid sequence, wherein the deletion ranges from about 5 kb
to about 10 kb, from about 10 kb to about 20 kb, from about 20 kb
to about 40 kb, from about 40 kb to about 60 kb, from about 60 kb
to about 80 kb, from about 80 kb to about 100 kb, from about 100 kb
to about 150 kb, or from about 150 kb to about 200 kb, from about
200 kb to about 300 kb, from about 300 kb to about 400 kb, from
about 400 kb to about 500 kb, from about 500 kb to about 1 Mb, from
about 1 Mb to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from
about 2 Mb to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; (d)
an exogenous nucleic acid sequence ranging from about 5 kb to about
10 kb, from about 10 kb to about 20 kb, from about 20 kb to about
40 kb, from about 40 kb to about 60 kb, from about 60 kb to about
80 kb, from about 80 kb to about 100 kb, from about 100 kb to about
150 kb, from about 150 kb to about 200 kb, from about 200 kb to
about 250 kb, from about 250 kb to about 300 kb, from about 300 kb
to about 350 kb, or from about 350 kb to about 400 kb; (e) an
exogenous nucleic acid sequence comprising a homologous or an
orthologous nucleic acid sequence; (f) a chimeric nucleic acid
sequence comprising a human and a rat nucleic acid sequence; (g) a
conditional allele flanked with site-specific recombinase target
sequences; or, (h) a reporter gene operably linked to a promoter
active in a rat cell.
[0531] 10. The method of any one of embodiments 1-9, wherein the
genomic locus of interest comprises (i) a first nucleic acid
sequence that is complementary to the 5' rat homology arm; and (ii)
a second nucleic acid sequence that is complementary to the 3' rat
homology arm.
[0532] 11. The method of embodiment 10, wherein the first and the
second nucleic acid sequence is separated by at least 5 kb but less
than 3 Mb.
[0533] 12. The method of embodiment 10, wherein the first and the
second nucleic acid sequence is separated by at least 5 kb but less
than 10 kb, at least 10 kb but less than 20 kb, at least 20 kb but
less than 40 kb, at least 40 kb but less than 60 kb, at least 60 kb
but less than 80 kb, at least about 80 kb but less than 100 kb, at
least 100 kb but less than 150 kb, or at least 150 kb but less than
200 kb, at least about 200 kb but less than about 300 kb, at least
about 300 kb but less than about 400 kb, at least about 400 kb but
less than about 500 kb, at least about 500 kb but less than about 1
Mb, at least about 1 Mb but less than about 1.5 Mb, at least about
1.5 Mb but less than about 2 Mb, at least about 2 Mb but less than
about 2.5 Mb, or at least about 2.5 Mb but less than about 3
Mb.
[0534] 13. The method of any one of embodiment 1-12, wherein
introducing step (a) further comprises introducing a second nucleic
acid encoding a nuclease agent that promotes a homologous
recombination between the targeting construct and the genomic locus
of interest in the pluripotent rat cell.
[0535] 14. The method of embodiment 13, wherein the nuclease agent
comprises (a) a chimeric protein comprising a zinc finger-based DNA
binding domain fused to a FokI endonuclease; or, (b) a chimeric
protein comprising a Transcription Activator-Like Effector Nuclease
(TALEN) fused to a FokI endonuclease.
[0536] 15. The method of any one of embodiments 1-12, wherein
introducing step (a) further comprises introducing into the
pluripotent rat cell: (i) a first expression construct comprising a
first promoter operably linked to a first nucleic acid sequence
encoding a Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR)-associated (Cas) protein, (ii) a second expression
construct comprising a second promoter operably linked to a genomic
target sequence linked to a guide RNA (gRNA), wherein the genomic
target sequence is immediately flanked on the 3' end by a
Protospacer Adjacent Motif (PAM) sequence.
[0537] 16. The method of embodiment 15, wherein the genomic locus
of interest comprises the nucleotide sequence of SEQ ID NO: 1.
[0538] 17. The method of embodiment 15 or 16, wherein the gRNA
comprises a third nucleic acid sequence encoding a Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA
(crRNA) and a trans-activating CRISPR RNA (tracrRNA).
[0539] 18. The method of embodiment 15, 16 or 17, wherein the Cas
protein is Cas9.
[0540] 19. The method of embodiment 15, 16, 17, or 18, wherein the
gRNA comprises: (a) the chimeric RNA of the nucleic acid sequence
of SEQ ID NO: 2; or, (b) the chimeric RNA of the nucleic acid
sequence of SEQ ID NO: 3.
[0541] 20. The method of embodiment 17, wherein the crRNA comprises
SEQ ID NO: 4; SEQ ID NO: 5; or SEQ ID NO: 6.
[0542] 21. The method of embodiment 17, wherein the tracrRNA
comprises SEQ ID NO: 7 or SEQ ID NO: 8.
[0543] 22. A modified rat genomic locus comprising: (i) an
insertion of a homologous or orthologous human nucleic acid
sequence; (ii) a replacement of an endogenous rat nucleic acid
sequence with the homologous or orthologous human nucleic acid
sequence; or (iii) a combination thereof, wherein the modified rat
genomic locus is capable of being transmitted through the
germline.
[0544] 23. The modified rat genomic locus of embodiment 22, wherein
the size of the insertion or replacement is from about 5 kb to
about 400 kb.
[0545] 24. The rat genomic locus of embodiment 22, wherein the size
of the insertion or replacement is from about 5 kb to about 10 kb,
from about 10 kb to about 20 kb, from about 20 kb to about 40 kb,
from about 40 kb to about 60 kb, from about 60 kb to about 80 kb,
from about 80 kb to about 100 kb, from about 100 kb to about 150
kb, from about 150 kb to about 200 kb, from about 200 kb to about
250 kb, from about 250 kb to about 300 kb, from about 300 kb to
about 350 kb, or from about 350 kb to about 400 kb.
[0546] 25. A method for making a humanized rat, comprising: (a)
targeting a genomic locus of interest in a pluripotent rat cell
with a targeting construct comprising a human nucleic acid to form
a genetically modified pluripotent rat cell; (b) introducing the
genetically modified pluripotent rat cell into a host rat embryo;
and (c) gestating the host rat embryo in a surrogate mother;
wherein the surrogate mother produces rat progeny comprising a
modified genomic locus that comprises: (i) an insertion of a human
nucleic acid sequence; (ii) a replacement of the rat nucleic acid
sequence at the genomic locus of interest with a homologous or
orthologous human nucleic acid sequence; (iii) a chimeric nucleic
acid sequence comprising a human and a rat nucleic acid sequence;
or (iv) a combination thereof, wherein the modified genomic locus
is capable of being transmitted through the germline.
[0547] 26. The method of embodiment 25, wherein the targeting
construct is a large targeting vector (LTVEC), and the sum total of
the 5' and the 3' homology arms of the LTVEC is at least 10 kb but
less than 150 kb.
[0548] 27. The method of embodiment 26, wherein the sum total of
the 5' and the 3' homology arms of the targeting construct is from
about 10 kb to about 30 kb, from about 20 kb to 40 kb, from about
40 kb to about 60 kb, from about 60 kb to about 80 kb, or from
about 80 kb to about 100 kb, from about 100 kb to about 120 kb, or
from about 120 kb to 150 kb.
[0549] 28. The method of embodiment 25, 26 or 27, wherein the human
nucleic acid sequence is at least 5 kb but less than 400 kb.
[0550] 29. The method of embodiment 25, 26, or 27, wherein the
human nucleic acid sequence is at least 5 kb but less than 10 kb,
at least 10 kb but less than 20 kb, at least 20 kb but less than 40
kb, at least 40 kb but less than 60 kb, at least 60 kb but less
than 80 kb, at least about 80 kb but less than 100 kb, at least 100
kb but less than 150 kb, at least 150 kb but less than 200 kb, at
least 200 kb but less than 250 kb, at least 250 kb but less than
300 kb, at least 300 kb but less than 350 kb, or at least 350 kb
but less than 400 kb.
[0551] 30. The method of any one of embodiments 25-29, wherein the
pluripotent rat cell is a rat embryonic stem (ES) cell.
[0552] 31. The method of any one of embodiments 25-30, wherein the
pluripotent rat cell is derived from a DA strain or an ACI
strain.
[0553] 32. The method of any one of embodiments 25-31, wherein the
pluripotent rat cell is characterized by expression of at least one
pluripotency marker comprising Dnmt3L, Eras, Err-beta, Fbxo15,
Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4, Sox15,
Sox2, Utf1, or a combination thereof.
[0554] 33. The method of any one of embodiment 25-31, wherein the
pluripotent rat cell is characterized by one or more of the
following features: (a) lack of expression of one or more
pluripotency markers comprising c-Myc, Ecat1, and/or Rexo1; (b)
lack of expression of one or more mesodermal markers comprising
Brachyury and/or Bmpr2; (c) lack of expression of one or more
endodermal markers comprising Gata6, Sox17, and/or Sox7; or (d)
lack of expression of one or more neural markers comprising Nestin
and/or Pax6.
[0555] 34. A modified rat comprising a humanized genomic locus,
wherein the humanized genomic locus comprises: (i) an insertion of
a homologous or orthologous human nucleic acid sequence; (ii) a
replacement of a rat nucleic acid sequence at an endogenous genomic
locus with a homologous or orthologous human nucleic acid sequence;
(iii) a chimeric nucleic acid sequence comprising a human and a rat
nucleic acid sequence or, (iv) a combination thereof, wherein the
humanized genomic locus is capable of being transmitted through the
germline.
[0556] 35. A rat or rat cell comprising a targeted genetic
modification in its genomic locus, wherein the genomic locus is an
Interleukin-2 receptor gamma locus, an ApoE locus, a Rag1 locus, a
Rag2 locus, or a Rag2/Rag1 locus, wherein the targeted genetic
modification comprises: (a) a deletion of an endogenous rat nucleic
acid sequence at the genomic locus; (b) an insertion of a
homologous nucleic acid, an orthologous nucleic acid, or a chimeric
nucleic acid comprising a human and a rat nucleic acid sequence, or
(c) a combination thereof, wherein the targeted genetic
modification is transmissible through the germline of the rat or a
rat propagated from the rat cell.
[0557] 36. The rat or rat cell of embodiment 35, wherein (a) the
deletion of the endogenous rat nucleic acid at the genomic locus is
at least about 10 kb; or, (b) the deletion of the endogenous rat
nucleic acid at the genomic locus is from about 5 kb to about 10
kb, from about 10 kb to about 20 kb, from about 20 kb to about 40
kb, from about 40 kb to about 60 kb, from about 60 kb to about 80
kb, from about 80 kb to about 100 kb, from about 100 kb to about
150 kb, or from about 150 kb to about 200 kb, from about 200 kb to
about 300 kb, from about 300 kb to about 400 kb, from about 400 kb
to about 500 kb, from about 500 kb to about 1 Mb, from about 1 Mb
to about 1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb
to about 2.5 Mb, or from about 2.5 Mb to about 3 Mb; (c) the
insertion of the exogenous nucleic acid sequence at the genomic
locus is at least about 5 kb; or, (d) the insertion of the
exogenous nucleic acid sequence at the genomic locus is from about
5 kb to about 10 kb, from about 10 kb to about 20 kb, from about 20
kb to about 40 kb, from about 40 kb to about 60 kb, from about 60
kb to about 80 kb, from about 80 kb to about 100 kb, from about 100
kb to about 150 kb, from about 150 kb to about 200 kb, from about
200 kb to about 250 kb, from about 250 kb to about 300 kb, from
about 300 kb to about 350 kb, or from about 350 kb to about 400
kb.
[0558] 37. The rat or rat cell of embodiment 35 or 36, wherein (a)
the targeted genetic modification at the Interleukin-2 receptor
gamma locus results in a decrease in or absence of Interleukin-2
receptor gamma protein activity; (b) the targeted genetic
modification at the ApoE locus results in a decrease in or absence
of ApoE protein activity; (c) the targeted genetic modification at
the Rag1 locus results in a decrease in or absence of Rag1 protein
activity; (d) the targeted genetic modification at the Rag2 locus
results in a decrease in or absence of Rag2 protein activity; or,
(e) the targeted genetic modification at the Rag2/Rag1 locus
results in a decrease in or absence of Rag2 protein activity and
Rag1 activity.
[0559] 38. The rat or rat cell of embodiment 35, 36, or 37, wherein
the targeted genetic modification of the Interleukin-2 receptor
gamma locus comprises: (a) a deletion of the entire rat
Interleukin-2 receptor gamma coding region or a portion thereof;
(b) a replacement of the entire rat Interleukin-2 receptor gamma
coding region or a portion thereof with a human Interleukin-2
receptor gamma coding region or a portion thereof; (c) a
replacement of an ecto-domain of the rat Interleukin-2 receptor
gamma coding region with the ecto-domain of a human Interleukin-2
receptor gamma; or, (d) at least a 3 kb deletion of the
Interleukin-2 receptor gamma locus.
[0560] 39. The rat or rat cell of any one of embodiments 35-37,
wherein the targeted genetic modification of the ApoE locus
comprises: (a) a deletion of the entire ApoE coding region or a
portion thereof; or, (b) at least a 1.8 kb deletion of the ApoE
locus comprising the ApoE coding region.
[0561] 40. The rat or rat cell of any one of embodiments 35-37,
wherein the targeted genetic modification of the Rag2 locus
comprises: (a) a deletion of the entire Rag2 coding region or a
portion thereof; (b) at least a 5.7 kb deletion of the Rag2 locus
comprising the Rag2 coding region.
[0562] 41. The rat or rat cell of any one of embodiments 35-37,
wherein the targeted genetic modification of the Rag2/Rag1 locus
comprises: (a) a deletion of the entire Rag2 coding region or a
portion thereof and a deletion of the entire Rag1 coding region or
portion thereof; or, (b) a deletion of at least 16 kb of the
Rag2/Rag1 locus comprising the Rag2 coding region.
[0563] 42. The rat or rat cell of any one of embodiment 35-41,
wherein the targeted genetic modification comprises an insertion of
an expression cassette comprising a selective marker at the
Interleukin-2 receptor gamma locus, the ApoE locus, the Rag1 locus,
the Rag2 locus, or the Rag2/Rag1 locus.
[0564] 43. The rat or rat cell of any one of embodiments 42,
wherein the expression cassette comprises a lacZ gene operably
linked to the endogenous promoter at the genomic locus and a human
ubiquitin promoter operably linked to a selective marker.
[0565] 44. The rat or rat cell of any one of embodiments 35-43,
wherein the targeted genetic modification in the Interleukin-2
receptor gamma locus, the ApoE locus, the Rag1 locus, the Rag2
locus or the Rag2/Rag1 locus comprises the insertion of a
self-deleting selection cassette.
[0566] 45. The rat or rat cell of embodiment 44, wherein the
self-deleting selection cassette comprises a selective marker gene
operably linked to a promoter active in the rat cell and a
recombinase gene operably linked to a male germ cell-specific
promoter, wherein the self-deleting cassette is flanked by
recombination recognition sites recognized by the recombinase.
[0567] 46. The rat or rat cell of embodiment 45, wherein (a) the
male germ cell-specific promoter is a Protamine-1 promoter; or, (b)
the recombinase gene encodes Cre, and the recombination recognition
sites are loxP sites.
[0568] 47. The rat or rat cell of any one of embodiments 35-46,
wherein the insertion of the exogenous nucleic acid sequence at the
genomic locus comprises a reporter nucleic acid operably linked to
an endogenous Interleukin-2 receptor gamma promoter, an endogenous
ApoE promoter, an endogenous Rag1 promoter, or an endogenous Rag2
promoter.
[0569] 48. The rat or rat cell of embodiment 47, wherein the
reporter nucleic acid encodes a reporter comprising
.beta.-galactosidase, mPlum, mCherry, tdTomato, mStrawberry, J-Red,
DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow
fluorescent protein (EYFP), Emerald, enhanced green fluorescent
protein (EGFP), CyPet, cyan fluorescent protein (CFP), Cerulean,
T-Sapphire, luciferase, alkaline phosphatase, or a combination
thereof.
[0570] 49. The rat cell of any one of embodiments 35-48, wherein
the rat cell is a pluripotent rat cell or a rat embryonic stem (ES)
cell.
[0571] 50. The rat cell of embodiment 49, wherein the pluripotent
rat cell or the rat embryonic stem (ES) cell (a) is derived from a
DA strain or an ACI strain; (b) is characterized by expression of
at least one pluripotency marker comprising Dnmt3L, Eras, Err-beta,
Fbxo15, Fgf4, Gdf3, Klf4, Lef1, LIF receptor, Lin28, Nanog, Oct4,
Sox15, Sox2, Utf1, or a combination thereof; or (c) is
characterized by one or more of the following characteristics: (i)
lack of expression of one or more pluripotency markers comprising
c-Myc, Ecat1, and/or Rexo1; (ii) lack of expression of mesodermal
markers comprising Brachyury and/or Bmpr2; (iii) lack of expression
of one or more endodermal markers comprising Gata6, Sox17 and/or
Sox7; or (iv) lack of expression of one or more neural markers
comprising Nestin and/or Pax6.
[0572] 51. A method for modifying a target genomic locus in an
Interleukin-2 receptor gamma locus, an ApoE locus, a Rag1 locus, a
Rag2 locus or a Rag2/Rag1 locus in a pluripotent rat cell, the
method comprising: (a) introducing into the pluripotent rat cell a
targeting vector comprising an insert nucleic acid flanked with 5'
and 3' rat homology arms homologous to the target genomic locus,
(b) identifying a genetically modified pluripotent rat cell
comprising a targeted genetic modification at the target genomic
locus, wherein the targeted genetic modification is capable of
being transmitted through the germline of a rat propagated from the
pluripotent rat cell.
[0573] 52. The method of embodiment 51, wherein the targeting
vector is a large targeting vector (LTVEC) wherein the sum total of
the 5' and the 3' rat homology arms is at least about 10 kb but
less than about 150 kb.
[0574] 53. The method of embodiment 51 or 52, wherein introducing
the targeting vector into the pluripotent rat cell leads to: (i) a
deletion of an endogenous rat nucleic acid sequence at the target
genomic locus; (ii) an insertion of an exogenous nucleic acid
sequence at the target genomic locus; or (iii) a combination
thereof.
[0575] 54. The method of embodiment 53, wherein (a) the deletion of
the endogenous rat nucleic acid at the genomic locus is at least
about 10 kb; or, (b) the deletion of the endogenous rat nucleic
acid at the genomic locus is from about 5 kb to about 10 kb, from
about 10 kb to about 20 kb, from about 20 kb to about 40 kb, from
about 40 kb to about 60 kb, from about 60 kb to about 80 kb, from
about 80 kb to about 100 kb, from about 100 kb to about 150 kb, or
from about 150 kb to about 200 kb, from about 200 kb to about 300
kb, from about 300 kb to about 400 kb, from about 400 kb to about
500 kb, from about 500 kb to about 1 Mb, from about 1 Mb to about
1.5 Mb, from about 1.5 Mb to about 2 Mb, from about 2 Mb to about
2.5 Mb, or from about 2.5 Mb to about 3 Mb; (c) the insertion of
the exogenous nucleic acid sequence at the genomic locus is at
least about 5 kb; or. (d) the insertion of the exogenous nucleic
acid sequence at the genomic locus is from about 5 kb to about 10
kb, from about 10 kb to about 20 kb, from about 20 kb to about 40
kb, from about 40 kb to about 60 kb, from about 60 kb to about 80
kb, from about 80 kb to about 100 kb, from about 100 kb to about
150 kb, from about 150 kb to about 200 kb, from about 200 kb to
about 250 kb, from about 250 kb to about 300 kb, from about 300 kb
to about 350 kb, or from about 350 kb to about 400 kb.
[0576] 55. The method of any one of embodiment 51-54, wherein (a)
the targeted genetic modification at the Interleukin-2 receptor
gamma locus results in a decrease in or absence of Interleukin-2
receptor gamma protein activity; (b) the targeted genetic
modification at the ApoE locus results in a decrease in or absence
of ApoE protein activity; (c) the targeted genetic modification at
the Rag1 locus results in a decrease in or absence of Rag1 protein
activity; (d) the targeted genetic modification at the Rag2 locus
results in a decrease in or absence of Rag2 protein activity; or,
(e) the targeted genetic modification at the Rag2/Rag1 locus
results in a decrease in or absence of Rag2 protein activity and i
Rag1 protein activity.
[0577] 56. The method of any one of embodiment 51-54, wherein the
targeted genetic modification of the Interleukin-2 receptor gamma
locus comprises (a) a deletion of the entire rat Interleukin-2
receptor gamma coding region or a portion thereof; (b) a
replacement of the entire rat Interleukin-2 receptor gamma coding
region or a portion thereof with a human Interleukin-2 receptor
gamma coding region or a portion thereof; (c) a replacement of an
ecto-domain of the rat Interleukin-2 receptor gamma coding region
with the ecto-domain of a human Interleukin-2 receptor gamma; or,
(d) at least a 3 kb deletion of the Interleukin-2 receptor gamma
locus comprising the Interleukin-2 receptor gamma coding
region.
[0578] 57. The method of any one of embodiment 51-55, wherein the
targeted genetic modification of the ApoE locus comprises: (a) a
deletion of the entire ApoE coding region or a portion thereof; or,
(b) at least a 1.8 kb deletion of the ApoE locus comprising the
ApoE coding region.
[0579] 58. The method of any one of embodiment 51-55, wherein the
targeted genetic modification of the Rag2 locus comprises: (a) a
deletion of the entire Rag2 coding region or a portion thereof; or,
(b) at least a 5.7 kb deletion of the Rag2 locus comprising the
Rag2 coding region.
[0580] 59. The method of any one of embodiment 51-55, wherein the
targeted genetic modification of the Rag1/Rag2 locus comprises: (a)
a deletion of the entire Rag2 coding region or a portion thereof
and a deletion of the entire Rag1 coding region or portion thereof;
or, (b) a deletion of at least 16 kb of the Rag2/Rag1 locus
comprising the Rag2 and Rag1 coding regions.
[0581] 60. The method of any one of embodiment 51-59, wherein the
insert nucleic acid comprises an expression cassette comprising a
polynucleotide encoding a selective marker.
[0582] 61. The method embodiment 60, wherein the expression
cassette comprises a lacZ gene operably linked to an endogenous
promoter at the genomic locus and a human ubiquitin promoter
operably linked to a selective marker gene.
[0583] 62. The method of any one of embodiments 51-60, wherein the
insert nucleic acid comprises a self-deleting selection
cassette.
[0584] 63. The method of embodiment 62, wherein the self-deleting
selection cassette comprises a selective marker operably linked to
a promoter active in the rat pluripotent cell and a polynucleotide
encoding a recombinase operably linked to a male germ cell-specific
promoter, wherein the self-deleting cassette is flanked by
recombination recognition sites recognized by the recombinase.
[0585] 64. The method of embodiment 63, wherein (a) the male germ
cell-specific promoter is a Protamine-1 promoter; or, (b) the
recombinase gene encodes Cre and the recombination recognition
sites are loxP sites.
[0586] 65. The method of embodiment 53, wherein the insertion of
the exogenous nucleic acid sequence at the genomic locus comprises
a reporter nucleic acid sequence operably linked to an endogenous
Interleukin-2 receptor gamma promoter, an endogenous ApoE promoter,
an endogenous Rag1 promoter, or an endogenous Rag2 promoter.
[0587] 66. The method of embodiment 65, wherein the reporter
nucleic acid sequence encodes a reporter comprising
.beta.-galactosidase, mPlum, mCherry, tdTomato, mStrawberry, J-Red,
DsRed, mOrange, mKO, mCitrine, Venus, YPet, enhanced yellow
fluorescent protein (EYFP), Emerald, enhanced green fluorescent
protein (EGFP), CyPet, cyan fluorescent protein (CFP), Cerulean,
T-Sapphire, luciferase, alkaline phosphatase, or a combination
thereof.
[0588] 67. The method of any one of embodiment 51-66, wherein the
pluripotent rat cell is a rat embryonic stem (ES) cell.
[0589] 68. The method of any one of embodiment 51-67, wherein the
pluripotent rat cell (a) is derived from a DA strain or an ACI
strain; or, (b) is characterized by expression of a pluripotency
marker comprising Oct-4, Sox-2, alkaline phosphatase, or a
combination thereof; or, (c) is characterized by one or more of the
following characteristics: (i) lack of expression of one or more
pluripotency markers comprising c-Myc, Ecat1, and/or Rexo1; (ii)
lack of expression of mesodermal markers comprising Brachyury
and/or Bmpr2; (iii) lack of expression of one or more endodermal
markers comprising Gata6, Sox17 and/or Sox7; or (iv) lack of
expression of one or more neural markers comprising Nestin and/or
Pax6.
[0590] 69. The method of any one of embodiment 51-68, further
comprising identifying the targeted genetic modification at the
target genomic locus, wherein the identification step employs a
quantitative assay for assessing a modification of allele (MOA) at
the target genomic locus.
[0591] 70. The method of any one of embodiment 51-69, wherein
introducing step (a) further comprises introducing a second nucleic
acid encoding a nuclease agent that promotes a homologous
recombination between the targeting vector and the target genomic
locus in the pluripotent rat cell.
[0592] 71. The method of embodiment 70, wherein the nuclease agent
comprises a chimeric protein comprising a zinc finger-based DNA
binding domain fused to a FokI endonuclease.
[0593] 72. The method of embodiment 71, wherein the method results
in bi-allelic modification of the target genomic locus.
[0594] 73. The method of any one of embodiment 51-70, wherein
introducing step (a) further comprises introducing into the
pluripotent rat cell: (i) a first expression construct comprising a
first promoter operably linked to a first nucleic acid sequence
encoding a Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR)-associated (Cas) protein, (ii) a second expression
construct comprising a second promoter operably linked to a genomic
target sequence linked to a guide RNA (gRNA), wherein the genomic
target sequence is immediately flanked on the 3' end by a
Protospacer Adjacent Motif (PAM) sequence.
[0595] 74. The method of embodiment 73, wherein the genomic locus
of interest comprises the nucleotide sequence of SEQ ID NO: 1.
[0596] 75. The method of embodiment 73 or 74, wherein the gRNA
comprises a third nucleic acid sequence encoding a Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA
(crRNA) and a trans-activating CRISPR RNA (tracrRNA).
[0597] 76. The method of embodiment 73, wherein the Cas protein is
Cas9.
[0598] 77. The method of embodiment 73, 74, or 75, wherein the gRNA
comprises: (a) the chimeric RNA of the nucleic acid sequence of SEQ
ID NO: 2; or, (b) the chimeric RNA of the nucleic acid sequence of
SEQ ID NO: 3.
[0599] 78. The method of embodiment 75, wherein the crRNA comprises
SEQ ID NO: 4; SEQ ID NO: 5; or SEQ ID NO: 6.
[0600] 79. The method of embodiment 75, wherein the tracrRNA
comprises SEQ ID NO: 7 or SEQ ID NO: 8.
EXAMPLES
[0601] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
Example 1
Rat ES Cell Derivation and Characterization
[0602] 1.1. Rat ES Cell Characterization
[0603] As shown in FIG. 1, rat ESCs grow as compact spherical
colonies, which routinely detach and float in the dish (close-up,
FIG. 7). Rat ESCs express pluripotency markers including Oct-4
(FIG. 2A) and Sox2 (FIG. 2B), and express high levels of alkaline
phosphatase (FIG. 3, left panel). Karyotype for line DA.2B is 42X,Y
(FIG. 3, right panel). Rat ESCs often become tetraploid; thus,
lines were pre-screened by counting metaphase chromosome spreads;
lines with mostly normal counts were then formally karyotyped.
[0604] ACI blastocysts were collected from super-ovulated females
obtained commercially. DA blastocysts were cultured from frozen
8-cell embryos obtained commercially. Zona pellucidae were removed
with Acid Tyrodes; and blastocysts were plated onto mitotically
inactivated MEFs. Outgrowths were picked and expanded using
standard methods. All blastocysts were plated, cultured and
expanded using 2i media (Li et al. (2008) Germline competent
embryonic stem cells derived from rat blastocysts, Cell
135:1299-1310; incorporated herein by reference in its
entirety).
TABLE-US-00001 TABLE 1 Rat ES Cell Derivation ACI DA Embryo source
Blastocysts Frozen 8-cell embryos (Superovulation) cultured to
blastocyst Blastocysts plated: 107 22 Outgrowths: 32 (30% of
blasts) 10 (45% of blasts) Lines: 16 (50% of outgrowths) 9 (90% of
outgrowths) Karyotyped: 3; all 42X, Y 6: 3 42X, X 3 42X, Y GLT
validated: 1 (ACI.G1) 1 42X, X (DA.2C) 1 42X, Y (DA.2B)
[0605] 1.2: Rat Production
[0606] Chimeric rats were produced by blastocyst injection and
transmission of the rat ESC genome. Chimeras produced by blastocyst
microinjection using parental ACI.G1 rat ESCs are shown in FIG. 8.
F1 agouti pups with albino littermates, sired by the ACI/SD chimera
labeled with an asterisk (*) in FIG. 8 are shown in FIG. 9.
[0607] Germline Transmission of Parental Rat ESC.
[0608] Three euploid rat ESC lines were evaluated for pluripotency
by microinjection into albino SD blastocysts. Chimeras were
identified by agouti coat color, which indicates rat ESC
contribution. For each line, a majority of chimeras transmitted the
rESC genome to F1 offspring (Table 2).
TABLE-US-00002 TABLE 2 Germline Transmission of Parental rESC Total
pups rESC- GLT Chimeras Germline from GLT derived efficiency Line
bred transmitters chimeras pups (%) ACI.G1 5 3 (60%) 103 11 11
DA.2B 5 4 (80%) 129 11 9 DA.2C 3 2 (66%) 45 7 16 (XX)
[0609] 1.3: Derivation of Rat Embryonic Stem Cells.
[0610] Superovulation Protocol, Rats
[0611] Day 0: injected with pregnant mare serum: IP, 20 U (0.4
ml).
[0612] Day 1: no action
[0613] Day 2: (46 hr. later): injected with hCG, IP, 50 U (1 ml).
[0614] set up single female matings.
[0615] Day 3: checked plugs. Females were plugged. This is day
0.5.
[0616] Day 6 (e3.5): Euthanized females and flushed embryos.
[0617] ES Cell Derivation Protocol (Superovulation)
[0618] Day 0: [0619] 1) Euthanized female rat with CO.sub.2. [0620]
2) Swabbed ventral abdomen with 70% ethanol; using scissors, opened
the ventral body wall to expose the viscera. [0621] 3) Dissected
out the oviducts and uterine horns and placed them into a tissue
culture dish containing warm N2B27 media. Washed out as much blood
as possible and transferred to a new dish with N2B27. [0622] 4)
Using a 1 ml syringe and a blunt 27 g needle, flushed media through
the uterine horns and oviducts to eject blastocysts into the media.
[0623] 5) Collected the blastocysts with a mouth pipet and transfer
to embryo culture dish containing KSOM+2i (1 .mu.MPD0325901, 3
.mu.M CHIR99021). KSOM is a culture medium produced by Millipore.
Catalog number is MR-106-D. [0624] 6) Cultured overnight at
37.degree.; 7.5% CO.sub.2.
[0625] ES Cell Derivation Protocol (Frozen Embryos)
[0626] Day 0: [0627] 1) Thawed frozen 8-cell embryos (commercially
obtained) into M2 medium. Cultured 10 minutes at room temperature.
[0628] 2) Transferred to KSOM+2i and culture overnight.
[0629] ES Cell Derivation Protocol (Same for Both)
[0630] Day 1: [0631] 1) Transferred cavitated embryos to 2i medium
& culture overnight. [0632] 2) Continued culturing un-cavitated
embryos in KSOM+2i
[0633] Day 2: [0634] 1) Transferred all remaining embryos to 2i
medium (whether or not they've cavitated). [0635] 2) Cultured
overnight; continued culturing earlier embryos in 2i medium.
[0636] Day 3: [0637] 1) Transferred embryos for 30-60 seconds with
Acid Tyrodes to remove the zona pellucida. [0638] 2) Washed embryos
3.times. in 2i medium to remove Acid Tyrodes. [0639] 3) Deposited
each embryo into a separate well of a 96-well feeder plate (the
well contains a monolayer of mitotically inactivated mouse
embryonic fibroblasts (MEFs). [0640] 4) Cultured overnight in 2i
medium.
[0641] Day 4-5: [0642] 1) Monitored plated embryos for the presence
of an outgrowth (an amorphous undifferentiated mass of cells).
Outgrowths are ready for transfer when they are approximately twice
the size of the plated embryo. [0643] 2) Each day: remove spent
media with a mircropipet and replace with fresh 2i media. [0644] 3)
Transferred outgrowths to new feeder wells: [0645] a. Removed spent
media and gently wash well with PBS. [0646] b. Removed PBS and add
30 .mu.l 0.05% trypsin; incubate for 10 minutes. [0647] c. Stopped
trypsin reaction by adding 30 .mu.l 2i+10% FBS. [0648] d. Gently
dissociated the cells with a micropipettor and transferred entire
contents of the well to a new well in a 24-well feeder plate. This
was Passage 1 (P1). [0649] e. Cultured overnight in 2i medium.
[0650] Day 5-8: (timing depends on how fast each line expands)
[0651] 1) Changed media each day (2i media) and monitored for the
presence of colonies with an ESC morphology. [0652] 2) When
colonies appear, continued culturing until colonies expand to
.about.50% confluency. [0653] 3) Tryspinzed and passaged colonies
as before; plated on feeders, 1 well per line, in a 6-well dish.
This was Passage 2 (P2).
[0654] Ongoing: [0655] 1) Continued feeding and monitoring each
line until approximately 50% confluent. [0656] 2) Trypsinized cells
as usual. [0657] 3) stopped trypsin with 2i+10% FBS; pelleted the
cells by centrifugation (5', 1200 rpm in Beckman-Coulter tabletop
centrifuge). [0658] 4) Aspirated the supernatant and gently
resuspend the cells in 400 .mu.l Freezing Medium (70% 2i, 20% FBS,
10% DMSO). [0659] 5) Distributed the cells into 2 vials and freeze
at -80.degree.. This was Passage 3 (P3). [0660] 6) For long-term
storage, transferred the vials to liquid N.sub.2 storage.
[0661] The 2i media was prepared as follows in Table 3.
TABLE-US-00003 Reagent Vendor Concentration DMEM/F12 basal media
Invitrogen/Life 1x Technologies Neurobasal media Invitrogen/Life 1x
Technologies Penicillin/streptomycin Invitrogen/Life % Technologies
L-Glutamine Invitrogen/Life 4 mM Technologies 2-Mercaptoethanol
Invitrogen/Life 0.1 mM Technologies N2 supplement Invitrogen/Life
1x Technologies B27 supplement Invitrogen/Life 1x Technologies LIF
Millipore 100 U/ml PD0325901 Stemgent 1 uM (MEK inhibitor).
CHIR99021 Stemgent 3 uM (GSK inhibitor).
[0662] Materials: [0663] Pregnant Mare's Serum Gonadotropin (PMSG)
[0664] Human Pregnancy Urine Chorionic Gonadotropin (HCG) [0665]
Female Rats (5-12 weeks old) [0666] Male rats (12 wks. to 8 mos.
old), one per cage [0667] Syringes/needles [0668] Animal room with
lights on 6:00-18:00
[0669] Procedure:
[0670] Day 1: 8:00-10:00 AM [0671] Inject females with 20 IU PMSG
(0.4 ml), IP [0672] Discard unused PMSG.
[0673] Day 3: 8:00-10:00 AM (48 hours after PMSG injection) [0674]
Inject females with 50 IU HCG (1 ml), IP [0675] Place one female
per male in mating cage. [0676] Discard unused HCG.
[0677] Day 4: 8:00-10:00 AM (24 hrs. after HCG injection) [0678]
Check females for plugs.
[0679] Hormone Suppliers
[0680] PMSG: Sigma #G-4877 (1000 IU). Resuspend in PBS to a final [
] of 50 IU/ml. Store at -20.degree. in 1 ml aliquots.
[0681] HCG: Sigma #CG-5 (5000 IU). Resuspend in PBS to a final [ ]
of 50 IU/ml. Store at -20.degree. in 1 ml aliquots.
[0682] 1.4: Karyotyping of Rat Embryonic Stem Cell Lines
[0683] The rat ES cell lines generated herein were karyotyped, and
the results are summarized in Tables 4-7.
TABLE-US-00004 TABLE 4 ACI.G1 Karyotyping Results Number of cells
Number of cells karyotyped 7 Number of cells analyzed 20 Number of
42, XY cells 18 Number of abnormal cells 2 40, XY, -5, -9 1 41, XY,
-14 1 42, XY 18 Other notes: Two analyzed cells were missing
different autosomes, which may be a sporadic occurrence due to
technical artifact. 90% of analyzed cells had a normal male 42, XY
karyotype. FIG. 4 provides a photograph showing the analysis of the
chromosome number of the ACI.G1 rat ES cell line.
TABLE-US-00005 TABLE 5 DA.2B Karyotyping Results Number of cells
Number of cells karyotyped 6 Number of cells analyzed 20 Number of
42, XY cells 20 Number of abnormal cells 0 42, XY 20 Other notes:
All analyzed cells had a normal diploid 42, XY karyotype. FIG. 5
provides a photograph showing the analysis of the chromosome number
of the DA.2B rat ES cell line.
TABLE-US-00006 TABLE 6 DA.C2 Karyotyping Results Number of cells
Number of cells karyotyped 5 Number of cells analyzed 20 Number of
42, XY cells 20 Number of abnormal cells 0 42, XX Other notes: 100%
of analyzed cells had normal female XX rat karyotype. FIG. 6
provides a photograph showing the analysis of the chromosome number
of the DA.C2 rat ES cell line.
TABLE-US-00007 TABLE 7 Blasto- Lines cysts Lines Karyo- strain
plated established typed Karyotypes BN x SD 41 8 (20%) 5 all lines
were high % F1 complex polyploid ACI 27 16 (60%) 3 G1: 90% 42 XY;
others were 70-85% euploid DA 20 9 (45%) 6 2B: 100% 42 XY; 2C: 100%
42 XX; others were 95-100% euploid F344 4 1 (25%) 0 Totals 92 34
(37%)
[0684] 1.5: Electroporation of Vector into Rat Embryonic Stem
Cell
[0685] 1. Passaged rat ES cells 24-48 hrs prior to
electroporation.
[0686] 2. Changed media to RVG2i+ROCKi (10 .mu.M Y-27632) 24 hr.
prior to electroporation
[0687] 3. Changed media 30' prior to trypsinization.
[0688] 4. Aliquoted DNA to be electroporated.
[0689] 5. Allowed DNA to warm at RT for >10 min.
[0690] 6. Heated DNA for 5' @ 62.degree. C. Place DNA on ice.
[0691] 7. Trypsinized cells: [0692] a. Collected floating colonies.
Washed plate to collect as many floaters as possible. [0693] b.
Pelleted colonies: 3' @ 750 rpm. [0694] c. Washed pellet 1.times.
with 5-10 ml PBS and re-spin/pellet [0695] d. Aspirated
supernatant; add 500.lamda. trypsin, 0.05%+1% chicken serum. [0696]
i. Did not pool more than 1 10 cm plate of colonies per tube. If
there are too many colonies packed into the bottom of the tube
during trypsinization they will clump and most of the cells will be
lost. [0697] e. 4' @ 37.degree.. Pipeted colonies several times to
minimize clumping. [0698] f. Repeated steps 1-2.times.: 4' @
37.degree.. [0699] g. Stopped trypsin with 500.lamda. RVG2i+10%
FBS.
[0700] 8. Pelleted cells: 5' @ 1200 rpm.
[0701] 9. Resuspend cells in 10 ml PBS. Count two 20.lamda.
aliquots to determine total cell number.
[0702] 10. Pelleted cells (5'/1200 rpm); calculate total cell
number and total resuspension volume to achieve correct cell
concentration (target #175 .mu.l EP buffer).
[0703] 11. Resuspend in a minimal volume of EP buffer; measure
total volume and adjust to target volume with EP buffer.
Electroporation buffer is sold by Millipore. The catalog # is
ES-003-D. See, Valenzuela et al. (2003) Nature Biotechnology
21:652-659, which is herein incorporated by reference.
[0704] 12. Add 75.lamda. cells to 50.lamda. DNA; transfer the
125.lamda. cells/DNA solution to one well of a BTX 48-well cuvette.
[0705] a. Filled the empty wells in the same column with 125.lamda.
EP buffer.
[0706] 13. Pulsed the cuvette once in the BTX electroporator:
[0707] a. Settings: 400V; .OMEGA.; 100 .mu.F (settings may
vary)
[0708] 14. Placed cuvette on ice for 15' to recover.
[0709] 15. Removed cells into 5 ml RVG2i+10 .mu.M ROCKi.
[0710] 16. Added to 15 cm plate with 20 ml RVG2i+10 .mu.M ROCKi.
Plate has 2.times. neoR MEFs (or other MEFs depending on project).
The neoR selectable marker is the neomycin phosphotransferase (neo)
gene of Beck et al. (1982) Gene, 19:327-36 or in U.S. Pat. No.
7,205,148 or 6,596,541, each of which are herein incorporated by
reference.
[0711] 17. Incubated @ 37.degree.. Begin selection 48 hrs
later.
[0712] ROCK inhibitor used was Y-27632.
[0713] 1.6: Selecting a Targeted Genetic Modification in a Rat
Embryonic Stem Cell.
[0714] 1. Passaged cells for 24-48 hrs prior to
electroporation.
[0715] 2. Changed media to RVG2i+ROCKi (10 .mu.M Y-27632) 24 hr.
prior to electroporation
[0716] 3. Changed media 30' prior to trypsinization.
[0717] 4. Aliquoted DNA to be electroporated.
[0718] 5. Allowed DNA warm at RT for >10 min.
[0719] 6. Heated DNA for 5' @ 62.degree. C. Place DNA on ice.
[0720] 7. Trypsinized cells: [0721] a. Collected floating colonies.
Washed plate to collect as many floaters as possible. [0722] b.
Pelleted colonies: 3' @ 750 rpm. [0723] c. Washed pellet 1.times.
with 5-10 ml PBS and re-spin/pellet [0724] d. Aspirated
supernatant; add 500.lamda. trypsin, 0.05%+1% chicken serum. [0725]
i. Did not pool more than 1 10 cm plate of colonies per tube. If
there are too many colonies packed into the bottom of the tube
during trypsinization they will clump and most of the cells will be
lost. [0726] e. 4' @ 37.degree.. Pipeted colonies several times to
minimize clumping [0727] f. Repeated 1-2.times.: 4' @ 37.degree..
[0728] g. Stopped trypsin with 500.lamda. RVG2i+10% FBS.
[0729] 8. Pelleted cells: 5' @ 1200 rpm.
[0730] 9. Resuspended cells in 10 ml PBS. Count two 20.lamda.
aliquots to determine total cell number.
[0731] 10. Pelleted cells (5'/1200 rpm); calculate total cell
number and total resuspension volume to achieve correct cell
concentration (target #/75 .mu.l EP buffer).
[0732] 11. Resuspend in a minimal volume of EP buffer; measured
total volume and adjusted to target volume with EP buffer.
[0733] 12. Added 75.lamda. cells to 50.lamda. DNA; transfer the
125.lamda. cells/DNA solution to one well of a BTX 48-well cuvette.
[0734] a. Filled the empty wells in the same column with 125.lamda.
EP buffer.
[0735] 13. Pulsed the cuvette once in the BTX electroporator:
[0736] a. Settings: 400V; 100 .mu.F (settings may vary)
[0737] 14. Placed cuvette on ice for 15' to recover.
[0738] 15. Removed cells into 5 ml RVG2i+10 .mu.M ROCKi.
[0739] 16. Added to 15 cm plate with 20 ml RVG2i+10 .mu.M ROCKi.
Plate had 2.times. neoR MEFs (or other MEFs depending on
project).
[0740] 17. Incubated @ 37.degree.. Began selection 48 hrs
later.
[0741] 18. G418 selection protocol was as follows: [0742] a. Day 2
(2.sup.nd day after EP): incubated cells in 2i media+G418, 75
.mu.g/ml. [0743] b. Day 3: incubated cells in 2i media without G418
[0744] c. Day 4: incubated cells in 2i media+G418, 75 .mu.g/ml.
[0745] d. Day 5: incubated cells in 2i media without G418 [0746] e.
Day 6: incubated cells in 2i media+G418, 75 .mu.g/ml. [0747] f. Day
7: incubated cells in 2i media without G418 [0748] g. Day 8:
incubated cells in 2i media+G418, 75 .mu.g/ml. [0749] h. Day 9:
incubated cells in 2i media without G418
[0750] i. Day 10: incubated cells in 2i media+G418, 75 .mu.g/ml.
[0751] j. Day 11: incubated cells in 2i media without G418 [0752]
k. Day 12: picked colonies to expand for screening. Each colony was
dissociated in 0.05% trypsin+1% chicken serum for 10 minutes and
then plated into 1 well of a 96-well feeder plate.
[0753] 19. Expanded colonies for 3 days in 2i media.
[0754] 20. Passaged clones 1:1 to new 96-well feeder plates.
[0755] 21. Expanded clones for 3 days in 2i media.
[0756] 22. For each clone, dissociated colonies in trypsin. Froze
2/3 of each clone and store at -80.degree.; plated the remaining
1/3 onto laminin plates (96-well plates coated with 10 .mu.g/ml
laminin).
[0757] 23. When the laminin plates were confluent, passed off to
the screening lab for genotyping of the clones.
[0758] 1.7. Molecular Signature of the Rat Embryonic Stem Cells
[0759] The genes listed in Table 8 were expressed at 20-fold lower
in rat ES cells than the corresponding genes in mouse ES cells. The
genes listed in Table 9 were expressed at levels 20-fold higher in
rat ES cells than the corresponding genes in mouse ES cells.
[0760] The microarray data in Tables 8 and 9 were generated as
follows. Rat ES cells (ACI.G2 and DA.2B) and mouse ES cells (F1H4)
were cultured in 2i media for 3 passages until confluent. F1H4
cells were cultured on gelatin-coated plates in the absence of
feeders. F1H4 mouse ES cells were derived from 12956/SvEvTac and
C57BL/6NTac heterozygous embryos (see, e.g., U.S. Pat. No.
7,294,754 and Poueymirou, W. T., Auerbach, W., Frendewey, D.,
Hickey, J. F., Escaravage, J. M., Esau, L., Dore, A. T., Stevens,
S., Adams, N. C., Dominguez, M. G., Gale, N. W., Yancopoulos, G.
D., DeChiara, T. M., Valenzuela, D. M. (2007), incorporated by
reference herein in its entirety).
[0761] The following protocol was used for sample prep: The 1.5 mL
Eppendorf tubes were labeled with the Sample ID. Cells grown on a
plate were rinsed in 37.degree. C. Phosphate-Buffered Saline (PBS).
PBS was removed and 300 ul of Trizol.RTM. was added. A scraper was
used to break the cells in Trizol.RTM. (Life Technology). The lysed
cells were collected in Trizol.RTM. in a 1.5 mL Epperdorf tube. For
cells grown on suspension, the cells were rinsed in 37.degree. C.
PBS and collected in a 1.5 mL tube. The cells were spun down; PBS
was removed; and 300 ul of Trizol.RTM. was added to the cells. The
cell membranes were broken by pipetting. Samples were sorted for
FACS with 10 to 10.sup.5 cells, the volume was concentrated to less
than 100 uL. 4 volumes of RNA Lysis buffer were added and mixed by
pipetting. For sample, 320 uL RNA Lysis buffer was added to 80 uL
sample. Samples were stored at -20.degree. C.
[0762] RNA-Seq was used to measure the expression level of mouse
and rat genes. Sequencing reads were mapped to mouse and rat
reference genome by Tophat, and RPKM (fragments per kilobase of
exon per million fragments mapped) were calculated for mouse and
rat genes. Homology genes based on gene symbol were selected, and
then used t-test to compare the expression level of each gene
between mouse and rat. miR-632 was in the top 10 highest expressed
in rat ESCs but was not expressed in mouse ES cells. Although no
comparative data exist from miR-632, based on the level of its
expression compared to other genes expressed in rat ESCs and their
known function in embryonic development, miR-632 was selected as a
marker for rat ES cells.
TABLE-US-00008 TABLE 8 The genes listed were expressed at levels
20-fold lower in rat ES cells than the corresponding genes in mouse
ES cells. ID Symbol Entrez Gene Name Location Type(s) Abcb1b Abcb1b
ATP-binding Plasma transporter cassette, sub- Membrane family B
(MDR/TAP), member 1B Acta2 ACTA2 actin, alpha 2, Cytoplasm other
smooth muscle, aorta Actg2 ACTG2 actin, gamma 2, Cytoplasm other
smooth muscle, enteric Aebp1 AEBP1 AE binding protein 1 Nucleus
peptidase Angptl2 ANGPTL2 angiopoietin-like 2 Extracellular other
Space Ankrd1 ANKRD1 ankyrin repeat Cytoplasm transcription domain 1
(cardiac regulator muscle) Anxa1 ANXA1 annexin A1 Plasma other
Membrane Anxa6 ANXA6 annexin A6 Plasma other Membrane Anxa8 ANXA8L2
annexin A8-like 2 Plasma other Membrane Arhgef25 ARHGEF25 Rho
guanine Cytoplasm other nucleotide exchange factor (GEF) 25 Axl AXL
AXL receptor Plasma kinase tyrosine kinase Membrane Basp1 BASP1
brain abundant, Nucleus transcription membrane attached regulator
signal protein 1 Bgn BGN biglycan Extracellular other Space Bst2
BST2 bone marrow Plasma other stromal cell antigen 2 Membrane Btf3
BTF3 basic transcription Nucleus transcription factor 3 regulator
Btg2 BTG2 BTG family, Nucleus transcription member 2 regulator
Capsl CAPSL calcyphosine-like Other other Cav1 CAV1 caveolin 1,
Plasma transmembrane caveolae protein, Membrane receptor 22 kDa
Ccdc80 CCDC80 coiled-coil domain Nucleus other containing 80 Ccnd2
CCND2 cyclin D2 Nucleus other Cd248 CD248 CD248 molecule, Plasma
other endosialin Membrane Cd44 CD44 CD44 molecule Plasma enzyme
(Indian blood Membrane group) Cd97 CD97 CD97 molecule Plasma
G-protein Membrane coupled receptor Cdc42ep5 CDC42EP5 CDC42
effector Cytoplasm other protein (Rho GTPase binding) 5 Cdh11 CDH11
cadherin 11, type 2, Plasma other OB-cadherin Membrane (osteoblast)
Cdkn2a CDKN2A cyclin-dependent Nucleus transcription kinase
inhibitor 2A regulator Cdo1 CDO1 cysteine Cytoplasm enzyme
dioxygenase type 1 Clip3 CLIP3 CAP-GLY domain Cytoplasm other
containing linker protein 3 Cln5 CLN5 ceroid- Cytoplasm other
lipofuscinosis, neuronal 5 Cnn1 CNN1 calponin 1, basic, Cytoplasm
other smooth muscle Col1a1 COL1A1 collagen, type I, Extracellular
other alpha 1 Space Col1a2 COL1A2 collagen, type I, Extracellular
other alpha 2 Space Col3a1 COL3A1 collagen, type III, Extracellular
other alpha 1 Space Col5a2 COL5A2 collagen, type V, Extracellular
other alpha 2 Space Col6a2 COL6A2 collagen, type VI, Extracellular
other alpha 2 Space Cryab CRYAB crystallin, alpha B Nucleus other
Csf1 CSF1 colony stimulating Extracellular cytokine factor 1 Space
(macrophage) Cth CTH cystathionase Cytoplasm enzyme (cystathionine
gamma-lyase) Cthrc1 CTHRC1 collagen triple Extracellular other
helix repeat Space containing 1 Ctsc CTSC cathepsin C Cytoplasm
peptidase Cyr61 CYR61 cysteine-rich, Extracellular other angiogenic
inducer, Space 61 Ddx58 DDX58 DEAD (Asp-Glu- Cytoplasm enzyme
Ala-Asp) box polypeptide 58 Dkk3 DKK3 dickkopf WNT Extracellular
cytokine signaling pathway Space inhibitor 3 Dmc1 DMC1 DNA meiotic
Nucleus enzyme recombinase 1 Dpysl3 DPYSL3 dihydropyrimidinase-
Cytoplasm enzyme like 3 Dse DSE dermatan sulfate Cytoplasm enzyme
epimerase Dusp1 DUSP1 dual specificity Nucleus phosphatase
phosphatase 1 Dusp27 DUSP27 dual specificity Other phosphatase
phosphatase 27 (putative) Dusp9 DUSP9 dual specificity Nucleus
phosphatase phosphatase 9 Ece2 ECE2 endothelin Plasma peptidase
converting enzyme 2 Membrane Ecm1 ECM1 extracellular matrix
Extracellular transporter protein 1 Space Egr1 EGR1 early growth
Nucleus transcription response 1 regulator Emp1 EMP1 epithelial
Plasma other membrane protein 1 Membrane Emp3 EMP3 epithelial
Plasma other membrane protein 3 Membrane Ephx2 EPHX2 epoxide
hydrolase Cytoplasm enzyme 2, cytoplasmic F3 F3 coagulation factor
Plasma transmembrane III (thromboplastin, Membrane receptor tissue
factor) Fau FAU Finkel-Biskis- Cytoplasm other Reilly murine
sarcoma virus (FBR-MuSV) ubiquitously expressed Fbn1 FBN1 fibrillin
1 Extracellular other Space Fbxo15 FBXO15 F-box protein 15 Other
transcription regulator Fhl2 FHL2 four and a half Nucleus
transcription LIM domains 2 regulator Flnc FLNC filamin C, gamma
Cytoplasm other Fos FOS FBJ murine Nucleus transcription
osteosarcoma viral regulator oncogene homolog Fundc2 FUNDC2 FUN14
domain Cytoplasm other containing 2 Gjb3 GJB3 gap junction Plasma
transporter protein, beta 3, Membrane 31 kDa Gpa33 GPA33
glycoprotein A33 Plasma other (transmembrane) Membrane Gpbp111
GPBP1L1 GC-rich promoter Other other binding protein 1- like 1 Gpc3
GPC3 glypican 3 Plasma other Membrane Grb10 GRB10 growth factor
Cytoplasm other receptor-bound protein 10 Gstm1 GSTM5 glutathione
S- Cytoplasm enzyme transferase mu 5 Hap1 HAP1 huntingtin-
Cytoplasm other associated protein 1 Hist1h2bc HIST2H2BE histone
cluster 2, Nucleus other (includes H2be others) Hmga2 HMGA2 high
mobility Nucleus enzyme group AT-hook 2 Hmgn3 Hmgn3 high mobility
Nucleus other group nucleosomal binding domain 3 Hormad1 HORMAD1
HORMA domain Nucleus other containing 1 Hsd17b14 HSD17B14
hydroxysteroid Cytoplasm enzyme (17-beta) dehydrogenase 14 Hspb1
HSPB1 heat shock 27 kDa Cytoplasm other protein 1 Hspb8 HSPB8 heat
shock 22 kDa Cytoplasm kinase protein 8 Htra1 HTRA1 HtrA serine
Extracellular peptidase peptidase 1 Space Ifi204 Ifi204 interferon
activated Nucleus transcription (includes gene 204 regulator
others) Ifi44 IFI44 interferon-induced Cytoplasm other protein 44
Ifit1 IFIT1B interferon-induced Cytoplasm other protein with
tetratricopeptide repeats 1B Ifitm3 IFITM2 interferon induced
Cytoplasm other transmembrane protein 2 Igf2 IGF2 insulin-like
growth Extracellular growth factor 2 Space factor (somatomedin A)
Igfbp7 IGFBP7 insulin-like growth Extracellular transporter factor
binding Space protein 7 Il1rl1 IL1RL1 interleukin 1 Plasma
transmembrane receptor-like 1 Membrane receptor Inhba INHBA
inhibin, beta A Extracellular growth Space factor Inhbb INHBB
inhibin, beta B Extracellular growth Space factor Irf7 IRF7
interferon Nucleus transcription regulatory factor 7 regulator
Isg15 ISG15 ISG15 ubiquitin- Extracellular other like modifier
Space Itga5 ITGA5 integrin, alpha 5 Plasma transmembrane
(fibronectin Membrane receptor receptor, alpha polypeptide) Jun JUN
jun proto-oncogene Nucleus transcription regulator Junb JUNB jun B
proto- Nucleus transcription oncogene regulator Lgals3bp LGALS3BP
lectin, galactoside- Plasma transmembrane binding, soluble, 3
Membrane receptor binding protein Lgals9 LGALS9 lectin,
galactoside- Extracellular other binding, soluble, 9 Space Lmna
LMNA lamin A/C Nucleus other Lox LOX lysyl oxidase Extracellular
enzyme Space Loxl2 LOXL2 lysyl oxidase-like 2 Extracellular enzyme
Space Loxl3 LOXL3 lysyl oxidase-like 3 Extracellular enzyme Space
Lrp1 LRP1 low density Plasma transmembrane lipoprotein Membrane
receptor receptor-related protein 1 Mageb16 MAGEB16 melanoma
antigen Other other family B, 16 Mcam MCAM melanoma cell Plasma
other adhesion molecule Membrane Mgp MGP matrix Gla protein
Extracellular other Space Mmp2 MMP2 matrix Extracellular
peptidase
metallopeptidase 2 Space (gelatinase A, 72 kDa gelatinase, 72 kDa
type IV collagenase) Mxra8 MXRA8 matrix-remodelling Other other
associated 8 Myl9 MYL9 myosin, light chain Cytoplasm other 9,
regulatory Mylpf MYLPF myosin light chain, Cytoplasm other
phosphorylatable, fast skeletal muscle Nab2 NAB2 NGFI-A binding
Nucleus transcription protein 2 (EGR1 regulator binding protein 2)
Ndufb4 NDUFB4 NADH Cytoplasm transporter dehydrogenase (ubiquinone)
1 beta subcomplex, 4, 15 kDa Npm1 NPM1 nucleophosmin Nucleus
transcription (nucleolar regulator phosphoprotein B23, numatrin)
Nr0b1 NR0B1 nuclear receptor Nucleus ligand- subfamily 0, group
dependent B, member 1 nuclear receptor Nr4a1 NR4A1 nuclear receptor
Nucleus ligand- subfamily 4, group dependent A, member 1 nuclear
receptor Nrp2 NRP2 neuropilin 2 Plasma kinase Membrane Oas1a OAS1
2'-5'-oligoadenylate Cytoplasm enzyme synthetase 1, 40/46 kDa Oasl2
Oasl2 2'-5' oligoadenylate Other enzyme synthetase-like 2 P4ha2
P4HA2 prolyl 4- Cytoplasm enzyme hydroxylase, alpha polypeptide II
Parp3 PARP3 poly (ADP-ribose) Nucleus enzyme polymerase family,
member 3 Pcolce PCOLCE procollagen C- Extracellular other
endopeptidase Space enhancer Pcyt1b PCYT1B phosphate Cytoplasm
enzyme cytidylyltransferase 1, choline, beta Pdgfc PDGFC platelet
derived Extracellular growth growth factor C Space factor Phlda1
PHLDA1 pleckstrin Cytoplasm other homology-like domain, family A,
member 1 Phlda2 PHLDA2 pleckstrin Cytoplasm other homology-like
domain, family A, member 2 Pla2g1b PLA2G1B phospholipase A2,
Extracellular enzyme group IB Space (pancreas) Pla2g4a PLA2G4A
phospholipase A2, Cytoplasm enzyme group IVA (cytosolic, calcium-
dependent) Porcn PORCN porcupine homolog Cytoplasm other
(Drosophila) Postn POSTN periostin, Extracellular other osteoblast
specific Space factor Prrx1 PRRX1 paired related Nucleus
transcription homeobox 1 regulator Prss23 PRSS23 protease, serine,
23 Extracellular peptidase Space Psmb8 PSMB8 proteasome Cytoplasm
peptidase (prosome, macropain) subunit, beta type, 8 Ptgs2 PTGS2
prostaglandin- Cytoplasm enzyme endoperoxide synthase 2
(prostaglandin G/H synthase and cyclooxygenase) Ptn PTN
pleiotrophin Extracellular growth Space factor Ptrf PTRF polymerase
I and Nucleus transcription transcript release regulator factor
Rarg RARG retinoic acid Nucleus ligand- receptor, gamma dependent
nuclear receptor Rgs16 RGS16 regulator of G- Cytoplasm other
protein signaling 16 Rn45s Rn45s 45S pre-ribosomal Other other RNA
Rpl10a RPL10A ribosomal protein Other other L10a Rpl31 RPL31
ribosomal protein Other other L31 Rpl37a RPL37A ribosomal protein
Cytoplasm other L37a Rps10 RPS10- RPS10-NUDT3 Cytoplasm other NUDT3
readthrough Rps14 RPS14 ribosomal protein Cytoplasm translation S14
regulator Rps20 Rps20 ribosomal protein Cytoplasm other S20 Rps26
RPS26 ribosomal protein Cytoplasm other S26 Rps9 RPS9 ribosomal
protein Cytoplasm translation S9 regulator S100a4 S100A4 S100
calcium Cytoplasm other binding protein A4 S100a6 S100A6 S100
calcium Cytoplasm transporter binding protein A6 Schip1 SCHIP1
schwannomin Cytoplasm other interacting protein 1 Sdc2 SDC2
syndecan 2 Plasma other Membrane Serpine1 SERPINE1 serpin peptidase
Extracellular other inhibitor, clade E Space (nexin, plasminogen
activator inhibitor type 1), member 1 Serpine2 SERPINE2 serpin
peptidase Extracellular other inhibitor, clade E Space (nexin,
plasminogen activator inhibitor type 1), member 2 Serpinf1 SERPINF1
serpin peptidase Extracellular other inhibitor, clade F Space
(alpha-2 antiplasmin, pigment epithelium derived factor), member 1
Sh3gl2 SH3GL2 SH3-domain Plasma enzyme GRB2-like 2 Membrane Slc19a2
SLC19A2 solute carrier Plasma transporter family 19 Membrane
(thiamine transporter), member 2 Slc25a5 SLC25A5 solute carrier
Cytoplasm transporter family 25 (mitochondrial carrier; adenine
nucleotide translocator), member 5 Slc29a1 SLC29A1 solute carrier
Plasma transporter family 29 Membrane (equilibrative nucleoside
transporter), member 1 Slc35f2 SLC35F2 solute carrier Other other
family 35, member F2 Snrpn SNRPN small nuclear Nucleus other
ribonucleoprotein polypeptide N Snx22 SNX22 sorting nexin 22 Other
transporter Sparc SPARC secreted protein, Extracellular other
acidic, cysteine- Space rich (osteonectin) Spp1 SPP1 secreted
Extracellular cytokine phosphoprotein 1 Space Sult4a1 SULT4A1
sulfotransferase Cytoplasm enzyme family 4A, member 1 Tagln TAGLN
transgelin Cytoplasm other Tcea3 TCEA3 transcription Nucleus
transcription elongation factor A regulator (SII), 3 Tgfb3 TGFB3
transforming Extracellular growth growth factor, beta 3 Space
factor Thbs1 THBS1 thrombospondin 1 Extracellular other Space Thbs2
THBS2 thrombospondin 2 Extracellular other Space Tm4sf1 TM4SF1
transmembrane 4 L Plasma other six family member 1 Membrane Tmbim1
TMBIM1 transmembrane Cytoplasm other BAX inhibitor motif containing
1 Tmem176b TMEM176B transmembrane Other other protein 176B Tnc TNC
tenascin C Extracellular other Space Tpd52l1 TPD52L1 tumor protein
D52- Cytoplasm other like 1 Tpm2 TPM2 tropomyosin 2 Cytoplasm other
(beta) Usp18 USP18 ubiquitin specific Cytoplasm peptidase peptidase
18 Vim VIM vimentin Cytoplasm other Wfdc2 WFDC2 WAP four-
Extracellular other disulfide core Space domain 2 Wisp2 WISP2 WNT1
inducible Extracellular growth signaling pathway Space factor
protein 2 Ybx1 YBX1 Y box binding Nucleus transcription protein 1
regulator
TABLE-US-00009 TABLE 9 The genes listed were expressed at levels
20-fold higher in rat ES cells than the corresponding genes in
mouse ES cells. ID Symbol Entrez Gene Name Location Type(s) Ajap1
Ajap1 adherens junction Other other associated protein 1 Amd1 AMD1
adenosylmethionine Cytoplasm enzyme decarboxylase 1 Ankrd2 ANKRD2
ankyrin repeat Nucleus transcription domain 2 (stretch regulator
responsive muscle) Arhgef9 ARHGEF9 Cdc42 guanine Cytoplasm other
nucleotide exchange factor (GEF) 9 Atp5h Atp5h ATP synthase, H+
Cytoplasm enzyme transporting, mitochondrial F0 complex, subunit d
Btg3 BTG3 BTG family, Nucleus other member 3 Car6 CA6 carbonic
anhydrase Extracellular enzyme VI Space Camk4 CAMK4
calcium/calmodulin- Nucleus kinase dependent protein kinase IV
Capn12 CAPN12 calpain 12 Other peptidase Cct6b CCT6B chaperonin
Cytoplasm transporter containing TCP1, subunit 6B (zeta 2) Cdx2
CDX2 caudal type Nucleus transcription homeobox 2 regulator Cldn5
CLDN5 claudin 5 Plasma other Membrane Clec3a CLEC3A C-type lectin
Other other domain family 3, member A Clic6 CLIC6 chloride
intracellular Plasma ion channel channel 6 Membrane Dhrsx DHRSX
dehydrogenase/reductase Other enzyme (SDR family) X-linked Dpysl2
DPYSL2 dihydropyrimidinase- Cytoplasm enzyme like 2 Dusp26 DUSP26
dual specificity Cytoplasm enzyme phosphatase 26 (putative) Eci3
Eci3 enoyl-Coenzyme A Other enzyme delta isomerase 3 Eef2k EEF2K
eukaryotic Cytoplasm kinase elongation factor-2 kinase Efna1 EFNA1
ephrin-A1 Plasma other Membrane Epha4 EPHA4 EPH receptor A4 Plasma
kinase Membrane Fank1 FANK1 fibronectin type III Nucleus
transcription and ankyrin repeat regulator domains 1 Fhit FHIT
fragile histidine Cytoplasm enzyme triad Filip1 FILIP1 filamin A
Cytoplasm other interacting protein 1 Fmod FMOD fibromodulin
Extracellular other Space Foxe1 FOXE1 forkhead box E1 Nucleus
transcription (thyroid regulator transcription factor 2) Fry FRY
furry homolog Extracellular other (Drosophila) Space Gjb5 GJB5 gap
junction protein, Plasma transporter beta 5, 31.1 kDa Membrane Gpx2
GPX2 glutathione Cytoplasm enzyme peroxidase 2 (gastrointestinal)
Grxcr2 GRXCR2 glutaredoxin, Other other cysteine rich 2 Hecw2 HECW2
HECT, C2 and WW Extracellular enzyme domain containing Space E3
ubiquitin protein ligase 2 Hey2 HEY2 hairy/enhancer-of- Nucleus
transcription split related with regulator YRPW motif 2 Icos Icos
inducible T-cell co- Plasma other stimulator Membrane Ifitm1 IFITM1
interferon induced Plasma transmembrane transmembrane Membrane
receptor protein 1 Il1f8 IL1F8 Interleukin 1 Extracellular cytokine
(IL36B) family member space (Interleukin 36 beta) Il28ra IL-28RA
Interleukin 28 receptor, Plasma Cytokine alpha membrane receptor
Igfbpl1 IGFBPL1 insulin-like growth Other other factor binding
protein-like 1 Ipcef1 IPCEF1 interaction protein Cytoplasm enzyme
for cytohesin exchange factors 1 Lctl Lctl lactase-like Cytoplasm
other Ldhd LDHD lactate Cytoplasm enzyme dehydrogenase D Lef1 LEF1
lymphoid enhancer- Nucleus transcription binding factor 1 regulator
Lefty1 LEFTY1 left-right Extracellular growth factor determination
factor 1 Space Lifr LIFR leukemia inhibitory Plasma transmembrane
factor receptor alpha Membrane receptor Lpar2 LPAR2
lysophosphatidic Plasma G-protein acid receptor 2 Membrane coupled
receptor Mog MOG myelin Extracellular other oligodendrocyte Space
glycoprotein Morn5 MORN5 MORN repeat Other other containing 5 Pigz
NCBP2 nuclear cap binding Nucleus other protein subunit 2, 20 kDa
Nptxr NPTXR neuronal pentraxin Plasma transmembrane receptor
Membrane receptor Ntm NTM neurotrimin Plasma other Membrane Nutf2
NUTF2 nuclear transport Nucleus transporter factor 2 Ocln OCLN
occludin Plasma enzyme Membrane Olr1 OLR1 oxidized low density
Plasma transmembrane lipoprotein (lectin- Membrane receptor like)
receptor 1 Pabpc4 PABPC4 poly(A) binding Cytoplasm translation
protein, cytoplasmic regulator 4 (inducible form) Pde11a PDE11A
phosphodiesterase Cytoplasm enzyme 11A Pdyn PDYN prodynorphin
Extracellular transporter Space Per3 PER3 period circadian Nucleus
other clock 3 Pllp PLLP plasmolipin Plasma transporter Membrane
Ppp1r14c PPP1R14C protein phosphatase Cytoplasm other 1, regulatory
(inhibitor) subunit 14C Pramel6 Pramel6 preferentially Other other
expressed antigen in melanoma like 6 Ptpn18 PTPN18 protein tyrosine
Nucleus phosphatase phosphatase, non- receptor type 18
(brain-derived) Pycr1 PYCR1 pyrroline-5- Cytoplasm enzyme
carboxylate reductase 1 Rab26 RAB26 RAB26, member Plasma enzyme RAS
oncogene Membrane family Ramp2 RAMP2 receptor (G protein- Plasma
transporter coupled) activity Membrane modifying protein 2 Rbm24
RBM24 RNA binding motif Other other protein 24 Rhag RHAG
Rh-associated Plasma peptidase glycoprotein Membrane Rpl3 RPL3
ribosomal protein Cytoplasm other L3 Sall3 SALL3 sal-like 3 Nucleus
other (Drosophila) Satb1 SATB1 SATB homeobox 1 Nucleus
transcription regulator Scg2 SCG2 secretogranin II Extracellular
cytokine Space Slc15a1 SLC15A1 solute carrier family Plasma
transporter 15 (oligopeptide Membrane transporter), member 1 Slc1a1
SLC1A1 solute carrier family 1 Plasma transporter
(neuronal/epithelial Membrane high affinity glutamate transporter,
system Xag), member 1 Slc24a5 Slc24a5 solute carrier family Other
other 24 (sodium/potassium/calcium exchanger), member 5 Slc37a2
SLC37A2 solute carrier family Other transporter 37 (glucose-6-
phosphate transporter), member 2 40424 SNTB1 syntrophin, beta 1
Plasma other (dystrophin- Membrane associated protein A1, 59 kDa,
basic component 1) St6galnac3 ST6GALNAC3 ST6 (alpha-N- Cytoplasm
enzyme acetyl-neuraminyl- 2,3-beta-galactosyl- 1,3)-N-
acetylgalactosaminide alpha-2,6- sialyltransferase 3 Tex12 TEX12
testis expressed 12 Nucleus other Tex15 TEX15 testis expressed 15
Extracellular other Space Tfap2a TFAP2A transcription factor
Nucleus transcription AP-2 alpha regulator (activating enhancer
binding protein 2 alpha) Tmc1 TMC1 transmembrane Plasma other
channel-like 1 Membrane Tmem130 TMEM130 transmembrane Other other
protein 130 Tmem30b TMEM30B transmembrane Other other protein 30B
Tomm20 TOMM20 translocase of outer Cytoplasm transporter
mitochondrial membrane 20 homolog (yeast) Tox3 TOX3 TOX high
mobility Other other group box family member 3 Ttc25 TTC25
tetratricopeptide Cytoplasm other repeat domain 25 Tymp TYMP
thymidine Extracellular growth factor phosphorylase Space Ubb Ubb
ubiquitin B Cytoplasm other Vamp7 VAMP7 vesicle-associated
Cytoplasm transporter membrane protein 7 Wfdc12 Wfdc12 WAP
four-disulfide Extracellular other core domain 12 Space Wfdc15a
Wfdc15a WAP four-disulfide Other other core domain 15A Wfdc6a
Wfdc6a WAP four-disulfide Other other core domain 6A
TABLE-US-00010 TABLE 10 A subset of genes from Table 9, which are
expressed at levels 20-fold higher in rat ES cells than the
corresponding genes in mouse ES cells. ID Entrez Gene Name Ajap1
Adheres Junctions Associate Protein Cldn5 Claudin 5 Arhgef9 Cdc42
guanine nucleotide exchange facter 9 Camk4
Calcium/calmodulin-dependent protein kinase IV Efna1 ephrin-A1
Epha4 EPH receptor A4 Gjb5 gap junction protein beta 5 Igfbpl1
Insulin-like growth factor binding protein-like 1 Il1f8 Interleukin
36 beta Il28ra Interleukin 28 receptor, alpha Lefty1 left-right
determination factor 1 Lifr Leukemia inhibitory factor receptor
alpha Lpar2 Lysophosphatidic acid receptor 2 Ntm Neuronal pentraxin
receptor Ptpn18 Protein tyrosine phosphatase non-receptor type 18
Cdx2 Caudal type homeobox 2 Fank1 Fibronectin type III and ankyrin
repeat domains 1 Foxe1 Forkhead box E1 (thyroid transcription
factor 2) Hey2 Hairy/enhancer-of-split related with YRPW motif 2
Lef1 Lymphoid enhancer-binding factor 1 Sall3 Sal-like 3
(Drosophila) Satb1 SATB homeobox 1
[0763] An additional molecular signature employing the pluripotency
markers/genes for the rat ES cells has also been developed. Table
11 provides a gene list and their expression ranks from the RNA
profiling data. mRNA was isolated from rat ES cells and the
expression level of various markers were compared relative to each
other. The term "rank" means the comparative expression levels of
individual genes: the higher the rank (1 is highest), the higher
the expression. For example, Oct4's rank of 13 means that, of all
the genes assayed, it was expressed higher than all but 12 genes.
Background in this experiment was any expression value below 30;
6107 genes had expression values of 30 or higher.
TABLE-US-00011 TABLE 11 Rat ES cell molecular signature employing
various pluripotency, mesodermal, endodermal, neural and
trophectoderm markers/genes. Pluripotency Mesodermal Endodermal
Neural Trophectoderm Pluripotency Rank Mesodermal Rank Endodermal
Rank Neural Rank Trophectoderm Rank c-Myc 8248 Brachyury 7542 Gata6
11195 Nestin 7761 Cdx2 739 Dnmt3L 127 Flk1 Not tested Sox17 11418
Pax6 13570 Dppa2 Not tested Nodal 3050 Hhex1 4571 Sox2 681 Dppa5
Not tested Bmp4 3072 Nodal 3050 Ecat1 9714 Bmpr2 6382 Ext1 6091
Eras 2541 Sox7 10284 Err-beta 1368 Fbxo15 1369 Fgf4 3440 Fthl17 Not
tested Gdf3 2771 Rank > 6107 = bkg expression Klf4 836 Lef1 1313
LIF receptor 724 Lin28 828 Nanog 774 Oct4 13 Rexo1 6119 Sox15 4524
Sox2 681 SSEA1 Not tested SSEA4 Not tested Stella Not tested Tcl1
Not tested Utf1 1501
Example 2
Inactivation of Genomic Loci in Rats
[0764] 2.1: Inactivation of Endogenous Genomic Loci Using an
Endonuclease Agent
[0765] In order to introduce a mutant allele at an endogenous rat
genomic locus, the rat ES cells described herein are electroporated
with expression vectors (or mRNA) that express ZFNs 1 and 2 (or
TALENs 1 and 2). These proteins bind their target sequences on
opposite strands, separated by about 6 bp to about 40 bp. A
double-stranded break is formed within the target locus, which the
cell attempts to repair by Non-Homologous End-Joining (NHEJ). In
many cases, NHEJ results in creation of a deletion, which often
disrupts the function of the gene (most often by producing a
frameshift mutation). In order to identify a positive clone
comprising a mutant allele, the electroporated cells are plated at
low density, because no drug selection is done. Colonies are picked
and assayed at the target site to see if a mutation was produced
(e.g., using a modification of allele (MOA) assay described above).
The selected ES cells comprising the mutant allele are then
introduced into a host rat embryo, for example, a pre-morula stage
or blastocyst stage rat embryo, and implanted in the uterus of a
surrogate mother to generate a founder rat (F0 rat). Subsequently,
the founder rat is bred to a wild-type rat to create F1 progeny
heterozygous for the mutant allele. Mating of the heterozygous F1
rat can produce progeny homozygous for the mutant allele.
[0766] 2.2: Rat ESC Targeting for the Inactivation of the Rat
Apolipoprotein E (ApoE) Gene Using Zinc Finger Nucleases
[0767] Zinc finger nucleases use sequence specific modular DNA
binding domains to direct endonuclease activity to unique target
sequence in the genome. ZFNs are engineered as a pair of monomers.
Each monomer contains nonspecific cleavage domain from FokI
endonuclease fused to 3 or more zinc finger DNA-binding domains.
Each zinc finger binds a 3 bp subsite and specificity is achieved
by the combined target sites of both monomers. ZFNs produce
double-stranded breaks (DSB'S) in DNA, and mutations (indertions or
deletions) frequently occur during non-homologous end joining
(NHEJ). DSBs also stimulate homology-directed repair (HDR) by
homologous recombination if a donor sequence is provided with
ZFN.
[0768] Such ZFNs were employed in combination with the various
methods and compositions described herein to improve targeting
efficiency. The rat Apolipoprotein E (ApoE) locus was targeted as
described in Example 3.2(a)(i), except expression vectors that
express ZFNs 1 and 2 were also introduced into the rat ES cells.
See FIG. 10 which provides a schematic of the ApoE targeting event
in combination with rTZFN1P and rTZFN2P. The targeting efficiency
was determined as discussed below in Example 6 and results are
shown in FIG. 11. Surprisingly, the targeting efficiency went up
8-10 fold.
[0769] A plasmid targeting vector was built with a self-deleting
drug selection cassette and a lacZ gene as a reporter gene. Good
targeting efficiency was achieved and a high % chimeras were
produced. Zinc finger nucleases (ZFNs) were also tested in
combination with targeting vectors to examine its effect on
improving targeting efficiency. The targeting vector was
co-expressed with the expression vectors for 2 ZFN pairs that cut
the ApoE locus. The rat ESC clones electroporated with both the
targeting vector and a set of the ZFNs showed a targeting
efficiency of 8-10 fold higher than that of rat ESC clones
electroporated with a targeting vector alone. Moreover, bi-allelic
homozygous targeting in about 2% of our clones was detected. High %
chimeras from two of these targeted clones were obtained.
[0770] The ApoE-targeted (with ZFN assistance) rat ESC clones were
microinjected into SD blastocysts, which were then transferred to
pseudopregnant SD recipient females, using standard techniques.
Chimeras were identified by coat color; male F0 chimeras were bred
to SD females. Germline F1 pups were genotyped for the presence of
the targeted ApoE allele (FIG. 17). There was a high % chimeras
from two of these targeted clones.
[0771] An ApoE knockout rat provides a means to study various types
of disorders and diseases. In humans, Apolipoprotein is found in
chylomicron, HDL, LDL and VLDL. ApoE is essential for the normal
catabolism of triglyceride-rich lipoprotein constituents. Defects
in APOE result in numerous disease states including, for example,
familial hypercholesterolemia, hyperlipemia, betalipoproteinemia,
familial dysbetalipoproteinemia, type III hyperlipoproteinemia (HLP
III), risk of coronary artery disease. One isoform (ApoE4) is
associated with late-onset familial and sporadic Alzheimer's
disease, possibly with MS as well.
[0772] In mice, ApoE is primarily found in HDL; transports
cholesterol, as in humans. ApoE-deficient mice (2 independent KOs)
have 5 times normal plasma cholesterol; developed foam cell-rich
depositions in their proximal aortas by age 3 months (comparable to
human syndrome).
[0773] ApoE knockouts in rats offer an animal model to study
endothelial function, including, but not limited to, plaque
formation, transcriptional changes (RNA-Seq), ex vivo function.
Moreover, larger size of rats would facilitate all these assays and
potentially improve the quality of the RNA-Seq data.
[0774] 2.3. Inactivation of The Rat Interleukin-2 Receptor Gamma
(IL2r-.gamma.) Locus Using Zinc Finger Nucleases
[0775] The rat Interleukin-2 receptor gamma (IL2r-.gamma.) locus
was targeted as described in Example 3.3(a), except that expression
vectors that express ZFN U (ZFN upstream) and ZFN D (ZFN
downstream) were also introduced into the rat ES cells. FIG. 18
provides a schematic of the IL2r-.gamma. targeting event in
combination with ZFN U and ZFN D. The sequence of the IL2r-.gamma.
locus which these zinc fingers bind is denoted in FIG. 18. The
targeting efficiency was determined as discussed below in Example
3.3(a) and the results are shown in FIG. 18. Briefly, homozygously
targeted clones were confirmed by PCR. For the ZFN1 pair: 173
mutant clones out of 192 screened (90%) and for the ZFN2 pair: 162
clones out of 192 (84%) screened.
[0776] The IL2r-.gamma.-targeted (with ZFN assistance) rat ESC
clones were microinjected into SD blastocysts, which were then
transferred to pseudopregnant SD recipient females, using standard
techniques. Chimeras were identified by coat color; male F0
chimeras were bred to SD females. Germline F1 pups were genotyped
for the presence of the targeted IL2r-.gamma. allele.
[0777] 2.4: Inactivation of the Rat Interleukin-2 Receptor Gamma
(IL2r-.gamma.) Using CRISPR/Cas9
[0778] The rat IL2r-.gamma. locus was targeted as described in
Example 3.3(a), except that the CRISPR/Cas9 system was also
introduced into the rat ES cells to aid in targeting efficiency.
SBI: System Biosciences Cas9 "SmartNuclease" all-in-one vectors
were employed and Cas9 expression was driven by CAG, EF1a, PGK, or
CMV promoter. Custom gRNA was ligated into a vector and expressed
by H1 promoter. 4 gRNAs against Il2rg were designed. The targeting
efficiency when employing the various guide RNAs is shown in FIG.
19.
Example 3
Targeted Modification of Rat Genomic Loci
3.1: Rat ESC Targeting
The Rat Rosa 26 Locus
[0779] The rat Rosa26 locus lies between the Setd5 and Thumpd3
genes as in mouse, with the same spacing. The rat Rosa 26 locus
(FIG. 12, Panel B) differs from the mouse Rosa 26 locus (FIG. 12,
Panel A). The mouse Rosa26 transcripts consist of 2 or 3 exons. The
rat locus contains a 2nd exon 1 (Ex1b) in addition to the
homologous exon to mouse exon1 (Ex1a). No 3rd exon has been
identified in rat. Targeting of a rat Rosa26 allele is depicted in
FIG. 12 (bottom), where homology arms of 5 kb each were cloned by
PCR using genomic DNA from DA rat ESC. The targeted allele contains
a SA (splicing acceptor)-lacZ-hUb-neo cassette replacing a 117 bp
deletion in the rat Rosa26 intron.
[0780] Targeting efficiency at the rat Rosa 26 locus was determined
(Table 12). Linearized vector was electroporated into DA or ACI rat
ESCs, and transfected colonies were cultured in 2i media+G418,
using standard techniques. Individual colonies were picked and
screened using a Loss of Allele (LOA) assay (Valenzuela, D. et al.
(2003) High-throughput engineering of the mouse genome coupled with
high-resolution expression analysis, Nature Biotech. 21:652-660,
incorporated herein by reference).
TABLE-US-00012 TABLE 12 rat Rosa26 Targeting Efficiency Colonies
Reconfirmed Targeting Cell line picked positives efficiency (%)
DA.2B 192 4 2.1 ACI.G1 96 4 4.2
[0781] Chimera Production and Germline Transmission Using
Rosa26-Targeted Rat ESC Clones.
[0782] Reconfirmed Rosa26-targeted rat ESC clones were
microinjected into SD blastocysts, which were then transferred to
pseudopregnant SD recipient females, using standard techniques.
Chimeras were identified by coat color; male F0 chimeras were bred
to SD females. Germline (agouti) F1 pups were genotyped for the
presence of the targeted Rosa26 allele; nine of 22 agouti pups
genotyped as heterozygous at the Rosa26 locus (Table 13).
TABLE-US-00013 TABLE 13 Germline Transmission Using Targeted Rosa26
rESC Clones Germline rESC- ESC- R26 clones producing Transmitting
Total derived derived Cell line injected Chimeras Clones Pups Pups
pups (%) DA.2B 4 3 2 AH7: 64 AH7: 41 AH7: 63 AE3: 112 AE3: 6 AE3: 3
ACI.G1 4 4 1 DE9: 39 DE9: 4 10
3.2.(a)(i)
Targeting of the Rat Apolipoprotein E (ApoE) Locus
[0783] The rat Apolipoprotein E (ApoE) locus was targeted to
disrupt ApoE function. Targeting of the ApoE locus was done using a
targeting vector comprising a lacZ-hUb-neo cassette flanked with a
5' and 3' homology arms homologus to the ApoE locus. FIG. 20
depicts a genetically modified rat ApoE locus that has been
disrupted by a 1.8 kb deletion and the insertion of a lacZ-hUb-neo
cassette, which further includes a self-deleting Cre cassette
comprising a Crei gene driven by a protamine promoter. The
electroporation conditions were as follows: 6 ug DNA;
2.05.times.10.sup.6 cells; 400V; 200 uF: 342 V, 593 usec; plate on
15 cm 2.times. dense neoR MEFs in 2i+10 uM ROCKi.
[0784] Targeting efficiency at the ApoE locus was determined and is
shown in Table 14. Linearized vector was electroporated into DA.2B
rat ESCs derived from the DA strain, and transfected colonies were
cultured using standard techniques. Individual colonies were picked
and screened using a Loss of Allele (LOA) assay.
TABLE-US-00014 TABLE 14 rat ApoE Targeting Efficiency Colonies
Targeting Cell line Vector picked Targeted efficiency (%) DA.2B
ApoE-mSDC 192 7 3.7 DA.2B ApoE-mSDC 192 15 7.8
[0785] Chimera production and germline transmission using
ApoE-targeted rat ESC clones was performed. ApoE-targeted rat ESC
clones were microinjected into SD blastocysts, which were then
transferred to pseudopregnant SD recipient females, using standard
techniques. Chimeras were identified by coat color; male F0
chimeras were bred to SD females. F1 pups were genotyped for the
presence of the targeted ApoE allele (Table 15).
TABLE-US-00015 TABLE 15 Microinjection Results Exp Clone pups
Chimeras 1 ApoE-AF5 4 3 (90, 90, 90) 2 ApoE-BC4 5 0
[0786] Additional targeting data for ApoE is also provided in FIG.
21.
3.2. (a)(ii)
Targeting ApoE in Rats with a Targeting Vector
[0787] FIG. 20 provides a schematic of the rat ApoE locus and a
targeting plasmid. The upper schematic of FIG. 20 shows the genomic
structure of the rat ApoE locus and the genomic regions
corresponding to 5' and 3' homology arms (5 kb and 5.4 kb,
respectively; dark grey boxes). Exon 1 of ApoE is non-coding and is
shown as an open box closest to the 5' homology arm. The 3 introns
of ApoE are denoted as lines and exons 2 and 3 comprise coding
regions and are shown as stippled grey boxes. Exon 4 contains both
coding and non-coding sequences as denoted by the stippled grey
shading and the open box.
[0788] The lower schematic in FIG. 20 is the targeting vector. The
5' and 3' homology arms (5 kb and 5.4 kb respectively) are denoted
by the dark grey boxes. The targeting vector comprises a reporter
gene (lacZ) and a self-deleting cassette flanked by loxP sites
(open arrows). The self-deleting cassette comprises the Crei gene
operably linked to a mouse Prm1 promoter and a selection cassette
comprising a neomycin resistance gene operably linked to a human
ubiquitin promoter.
[0789] The Crei gene comprises two exons encoding a Cre
recombinase, which are separated by an intron (Crei) to prevent its
expression in a prokaryotic cell. See, See, for example, U.S. Pat.
No. 8,697,851 and U.S. Application Publication 2013-0312129, which
describe the self-deleting cassette in detail and are hereby
incorporated by reference in their entirety. By employing the Prm1
promoter, the self-deleting cassette can be deleted specifically in
male germ cells of F0 rats. The targeting vector was electroporated
into the rat ES cells obtained in Example 1 and the cells were
plated on 15 cm 2.times. dense neomycin-resistant MEFs in 2i+10 uM
ROCKi. The transformed rat ES cells were cultured, selected, and
maintained as described in Example 1.
[0790] As shown in Table 23, 384 colonies were screened and 23
targeted clones were obtained. The targeting efficiency was 5.99%.
3 clones were injected into blastocysts as described herein in
Example 1. 3 clones producing chimeras were obtained and 2 of the
clones transmitted the targeted modification through the
germline.
3.2.(a)(iii)
Targeting ApoE in Rats with a Targeting Vector in Combination with
Zinc Finger Nucleases
[0791] The targeting vector employed in Example 3.2(a)(ii) was used
in combination with zinc finger nucleases to target the rat ApoE
locus. Table 16 provides a summary of the genomic organization of
the rat ApoE locus. The positions shown in the Table 16 were taken
from build 5.0 of the Reference Sequence of the rat genome
(ENSMBL). ApoE is on chromosome 1 on the (-) strand.
TABLE-US-00016 TABLE 16 Summary of the rat ApoE locus and the
positions of the zinc finger nuclease binding sites and cutting
sites. Feature Start End length Notes Exon 1 81881110 81881182 73
5' non-coding Exon2 81880269 81880332 64 contains ATG ATG 81880309
81880311 3 start codon Exon3 81879607 81879775 169 ZFN1a 81879707
81879693 15 CAGGCCCTGAACCGC binding site (SEQ ID NO: 10) ZFN1
81879692 81879687 6 TTCTGG cutting site (SEQ ID NO: 11) ZFN1b
81879686 81879671 16 GATTACCTGCGCTGGG binding site (SEQ ID NO: 12)
Intron 3-4 81879776 81879207 400 ZF21a 81879591 81879577 15
TTCACCCTCCGCACC binding site (SEQ ID NO: 13) ZFN2 81879576 81879570
7 TGCTGAG cutting site (SEQ ID NO: 14) ZF21b 81879569 81879552 18
TATCCAGATCCAGGGGTT binding site (SEQ ID NO: 15) Exon 4 81878371
81879208 838 contains TGA TGA 81878482 81878484 3 ApoE deletion
81878482 81880311 1830
[0792] FIG. 10 provides a schematic of the rat ApoE locus and
denotes with grey bars the cutting site for ZFN1 and ZFN2. The
cutting site for ZFN1 is in exon 3 and the cutting site for ZFN2 is
in intron 3. The exact position of the both ZFN sites is set forth
in Table 16. The genomic regions corresponding to the 5' and 3'
homology arms (5 kb and 5.4 kb, respectively) are denoted by the
dark grey boxes. Exon 1 of ApoE is non-coding and is shown as an
open box closest to the 5' homology arm. The three introns of the
ApoE gene are denoted as lines and exons 2 and 3 comprise coding
regions and are shown as stippled grey boxes. Exon 4 contains both
coding and non-coding sequences as denoted by the stippled grey
shading and the open box.
[0793] The employed targeting vector was the same as that in
Example 3.2(a)(ii) and shown in FIG. 20. The ZFNs were introduced
as two expression plasmids, one for each half of the ZFN pair. 20
ug of the plasmid for ZFN1 and 20 ug of the plasmid for ZFN2 was
used. ZFNs were purchased from Sigma. The expression of each ZFN
was driven by the CMV promoter.
[0794] The targeting vector were electroporated into the rat ES
cells obtained in Example 1 and the cells were plated on 15 cm
2.times. dense neoR MEFs in 2i+10 uM ROCKi. The transformed rat ES
cells were cultured, selected and maintained as described in
Example 1.
[0795] As shown in Table 23, 384 colonies were screened and 290
targeted clones were obtained. The targeting efficiency was 75.52%.
2 clones were injected into blastocysts as described herein in
Example 1. Two clones producing chimeras were obtained and one of
the clones transmitted the targeted modification through the
germline.
[0796] Moreover, employing ZFN1 and ZFN2 produced 8 biallelic
targeted clones with an efficiency of 2.08%.
3.2.(b)(i)
Targeted Modification of the Rat Apolipoprotein E (ApoE) Locus
Using a Large Targeting Vector (LTC)
[0797] Targeting of the ApoE locus is done using a large targeting
vector (LTVEC) comprising a lacZ-mouse Prm1-Crei cassette flanked
with a 5' homology arm to the ApoE locus of about 45 kb and a 3'
homology arm to the ApoE locus of about 23 Kb. FIG. 22 depicts the
rat ApoE locus in which the ApoE locus has been disrupted by a 1.83
kb deletion and the insertion of the lacZ gene and a self-deleting
cassette comprising mPrm1-Crei cassette and a hUb-neo selection
cassette. Methods employed in example 3.2(a)(i) can be used to
introduce this vector into rat ES cells.
Example 3.2.(b)(ii)
Targeting of the Rat ApoE locus with a Large Targeting Vector
(LTVEC)
[0798] FIG. 22 provides a schematic of the rat ApoE locus and a
large targeting vector (LTEVC). The upper schematic of FIG. 22
shows the genomic organization of the rat ApoE locus and the
genomic regions corresponding to the 5' and 3' homology arms (45 kb
and 23 kb, respectively; dark grey boxes). Exon 1 of ApoE is
non-coding and is shown as an open box closest to the 5' homology
arm. The 3 introns of ApoE are denoted as lines and exons 2 and 3
comprise coding regions and are shown as stippled grey boxes. Exon
4 contains both coding and non-coding sequences as denoted by the
stippled grey shading and the open box.
[0799] The lower schematic in FIG. 22 is the LTVEC. The 5' and 3'
homology arms (45 kb and 23 kb, respectively) are denoted by the
dark grey boxes. The targeting vector comprises a reporter gene
(lacZ) and a self-deleting cassette flanked by loxP sites (open
arrows), which comprises the Crei gene operably linked to a mouse
Prm1 promoter and a drug selection cassette comprising a neomycin
resistance gene operably linked to a human ubiquitin promoter. The
Crei comprises two exons encoding the Cre recombinase which are
separated by an intron (Crei) to prevent its expression in a
prokaryotic cell. See, for example, U.S. Pat. No. 8,697,851 and
U.S. Application Publication 2013-0312129, which describes the
self-deleting cassette in detail and is hereby incorporated by
reference in their entirety. By employing a mouse Prm1 promoter,
the self-deleting cassette can be deleted specifically in male germ
cells of F0 rat.
[0800] The LTVEC was electroporated into the rat ES cells obtained
in Example 1 and the cells were plated on 15 cm 2.times. dense neoR
MEFs in 2i+10 uM ROCKi. The transformed rat ES cells were cultured,
selected, and maintained as described in Example 1.
[0801] As shown in Table 23, 288 colonies were screened and 8
targeted clones were obtained. The targeting efficiency was 2.78%.
3 clones were injected into a host embryo at a blastocyst stage as
described herein in Example 2 to produce chimeric rats (F0).
Moreover, one biallelic targeted clone was produced providing a
biallelic efficiency of 0.35%.
3.2.(b)(iii)
Targeting ApoE in Rats with a Large Targeting Vector (LTVEC) In
Combination with Zinc Finger Nucleases
[0802] The LTVEC employed in Example 3.2.(b)(ii) was used in
combination with zinc finger nucleases to target the rat ApoE
locus. Table 16 provides a summary of the genomic organization of
the rat ApoE locus and the positions shown were taken from build
5.0 of the Reference Sequence of the rat genome (ENSMBL).
[0803] FIG. 23 provides a schematic of the rat ApoE locus and
denotes with grey bars the cutting site for ZFN1 and ZFN2. The
cutting site for ZFN1 is in t exon 3 and the cutting site for ZFN2
is in intron 3. The exact position of the both ZFN sites is set
forth in Table 16. The 5' and 3' homology arms (45 kb and 23 kb,
respectively) are denoted by the dark grey boxes. Exon 1 of the
ApoE gene is non-coding and is shown as an open box closest to the
5' homology arm. The three introns of the ApoE gene are denoted as
lines. Exons 2 and 3 comprise coding regions and are shown as
stippled grey boxes. Exon 4 contains both coding and non-coding
sequences as denoted by the stippled grey shading and the open
box.
[0804] The LTVEC employed was the same as that in Example
3.2(b)(ii) and shown in FIG. 22. The ZFNs were introduced as two
expression plasmids, one for each half of the ZFN pair. 20 ug of
the plasmid for ZFN 1 and 20 ug of the plasmid for ZFN2 was used.
ZFNs were purchased from Sigma. The expression of each ZFN was
driven by the CMV promoter.
[0805] The targeting vector was electroporated into the rat ES
cells obtained in Example 1 and the cells were plated on 15 cm
2.times. dense neoR MEFs in 2i+10 uM ROCKi. The transformed rat ES
cells were cultured, selected, and maintained as described in
Example 1.
[0806] As shown in Table 23, 288 colonies were screened and 16
targeted clones were obtained. The targeting efficiency was 5.56%.
One clone was injected into blastocysts as described herein in
Example 2.
[0807] Moreover, the employment of ZFN1 and ZFN2 produced one
biallelic targeted clone, with an efficiency of 0.35%.
3.3(a): Targeting of the Rat Interleukin-2 Receptor Gamma
(IL2r-.gamma.) Locus
[0808] The rat Interleukin-2 receptor gamma (IL2r-.gamma.) locus
was targeted to disrupt IL2r-.gamma. function. IL2r-.gamma. plays
an important role for signaling by IL-2, IL-4, IL-7, IL-9, IL-15,
IL-21 and mutations in IL2r-.gamma. are associated with severe
defects in T, B and NK cell development.
[0809] Targeting of the IL2r-.gamma. locus was done using a
targeting vector comprising an eGFP-hUb-neo cassette flanked with a
5' and 3' homology arms homologous to the IL2r-.gamma. locus. FIG.
26 depicts the genomic structure of the rat IL2r-.gamma. locus in
which the IL2r-.gamma. locus has been disrupted by a 3.2 kb
deletion. The targeted IL2r-.gamma. locus also comprised an eGFP
gene and a self-deleting cassette containing Crei operably linked
to a mouse Protamine1 promoter and a drug selection cassette
comprising a hUb promoter operably linked to a neomycin resistance
gene.
[0810] Targeting efficiency at the IL2r-.gamma. locus was
determined and shown in Table 17. Linearized vector was
electroporated into DA.2B rat ESCs, and transfected colonies were
cultured using standard techniques. Individual colonies were picked
and screened using a Loss of Allele (LOA) assay.
TABLE-US-00017 TABLE 17 rat IL2r-.gamma. Targeting Efficiency
Colonies Targeting Cell line Vector picked Targeted efficiency (%)
DA.2B II2rg-floxed neo 136 1 0.7 DA.2B II2rg-mSDC 96 4 4.2
[0811] Chimera production and germline transmission using
IL2r-.gamma.-targeted rat ESC clones was performed.
IL2r-.gamma.-targeted rat ESC clones were microinjected into SD
blastocysts, which were then transferred to pseudopregnant SD
recipient females, using standard techniques. Chimeras were
identified by coat color; male F0 chimeras were bred to SD females.
Germline F1 pups were genotyped for the presence of the targeted
IL2r-.gamma. allele (Table 18).
TABLE-US-00018 TABLE 18 Microinjection Results Exp Clone pups
Chimeras 1 Il2rg-AA1 5 2 (90, 70) 2 Il2rg-AA1 10 3 (90, 90, 80)
[0812] The phenotype of Il2rg.sup.-/Y chimera #3 was further
studied. The peripheral blood mononuclear cells (PBMCs) were
stained with antibodies that recognize antigens in several lymphoid
lineages. GFP-positive PBMCs were detected from 2 of the chimeras.
Moreover, the GFP+ cells were negative for the T-cell marker CD3,
and were mostly negative for the B-cell marker B220 and the NK cell
marker CD 161a. See, FIG. 30. The small double-positive populations
are consistent with the published Il2rg knockout phenotype in mice.
These data were obtained from a chimeric rat, which contains IL2
receptor gamma-positive cells, and this may complicate the analysis
of the phenotype.
3.3(b): Targeted Modification of the Rat Interleukin-2 Receptor
Gamma (IL2r-.gamma.) Locus
[0813] The rat Interleukin-2 receptor gamma (IL2r-.gamma.) locus
was targeted to disrupt the IL2r-.gamma. function in rats. FIG. 26
shows the genomic structure of the rat Il2rg locus and the
targeting vector introduced into the locus. eGFP was chosen as a
reporter so that the immunophenotype of the genetically modified
rats could be examined using FACS. The self-deleting cassette
(hUb-Neo; Prm1-Cre) was used to delete the drug section cassette
and the Cre gene specifically in male germ cells of the F0 rat.
Additionally, the targeting vector was designed to delete the
entire coding region (about 3.2 kb) of the rat Il2rg gene.
[0814] The size of the deletion in rat ESCs was confirmed by PCR
using primers specific to the rat Il2rg locus. Upon microinjection
of the targeted clones into host embryos at a blastocyst stage,
high percentage of chimeras were obtained. Those chimeras have been
set up for breeding. To determine if the targeting worked as
expected, the peripheral blood from the chimeras were collected
prior to breeding, and the phenotype of the immune cells in the
peripheral blood was analyzed via FACS. As shown in FIG. 30,
GFP-positive cells were detected in the peripheral blood in 2 of
the 3 chimeras examined (upper right panel), and the chimeric rats
contained less than 1% of T cells, less than 1% of B cells, and
less than 1% of NK-cells, which are positive for GFP (i.e., Il2rg
KO cells).
3.4(a). Targeting the Rag2 Locus in Rats with a Large Targeting
Vector (LTVEC)
[0815] Table 19 provides a summary of the genomic organization of
the rat Rag2 locus and the positions shown were taken from build
5.0 of the Reference Sequence of the rat genome (ENSMBL). Rag2 is
on chromosome 3 on the (+) strand.
TABLE-US-00019 TABLE 19 Genomic organization summary of the rat
Rag2 locus. Feature Start End length Notes Exon 1 97,851,317
97,851,448 132 Exon 2 97,854,635 97,854,693 59 Exon 3 97,858,260
97,859,615 1,356 contains entire coding sequence ATG 97,856,286
97,856,288 3 start codon TGA 97,857,867 97,857,869 3 stop codon
Rag2 97,856,289 97,859,784 3,496 deletion
[0816] FIG. 27 provides a schematic of the rat Rag2 locus and a
large targeting vector (LTVEC). The upper schematic of FIG. 27
shows the genomic organization of the rat ApoE locus and the
genomic regions corresponding to the 5' and 3' homology arms (48 Kb
and 15 Kb, respectively; dark grey boxes). Rag2 comprises a single
exon denoted by the stippled grey shading.
[0817] The lower schematic in FIG. 27 is the LTVEC. The 5' and 3'
homology arms (48 kb and 15 kb, respectively) are denoted by the
dark grey boxes. The LTVEC comprises a reporter gene (lacZ) and a
self-deleting cassette flanked by loxP sites (open arrows). The
self-deleting cassette comprises a mouse Prm1 promoter operably
linked to the Crei gene and a drug selection cassette comprising a
human ubiquitin promoter operably linked to a neomycin resistance
gene. The Crei comprises two exons encoding the Cre recombinase are
separated by an intron (Crei) to prevent its expression in a
prokaryotic cell. See, for example, U.S. Pat. No. 8,697,851 and
U.S. Application Publication 2013-0312129, which describe the
self-deleting cassette in detail and are hereby incorporated by
reference in their entirety. By employing a mouse Prm1 promoter,
the self-deleting cassette can be deleted specifically in male germ
cells of F0 rats.
[0818] The LTVEC was electroporated into the rat ES cells obtained
in Example 1 and the cells were plated on 15 cm 2.times. dense neoR
MEFs in 2i+10 uM ROCKi. The transformed rat ES cells were cultured
and maintained as described in Example 1. Colonies are screened as
described elsewhere herein and targeted clones are obtained. The
targeted clones are then injected into a host embryo as described
elsewhere herein to produce an F0 rat.
3.4.(b). Targeting the Rag1 and the Rag2 Locus in Rats
[0819] FIG. 28 provides the genomic structure of the rat Rag1/Rag2
locus. CDS denotes the coding sequence and grey boxes represent
exons. Rag2 is on the "plus" strand with transcription to the
right. Rag1 is on the "minus" strand with transcription to the
left. Mbp=million base pairs.
[0820] Table 20 provides a summary of the genomic organization of
the rat Rag2 and Rag1 locus and the positions shown were taken from
build 5.0 of the Reference Sequence of the rat genome (ENSMBL).
Rag1 is on chromosome 3 on the (-) strand.
TABLE-US-00020 TABLE 20 Genomic organization summary of the rat
Rag1 locus. Feature Start End length Notes Exon 1 97,877,145
97,877,066 80 Exon 2 97,872,503 97,866,047 6,457 contains entire
coding sequence ATG 97,872,489 97,872,487 3 start codon TAA
97,869,369 97,869,367 3 stop codon Rag1-2 97,856,289 97,872,486
16,198 deletion
[0821] FIG. 29 provides a schematic of the rat Rag2 and Rag1 locus
and a large targeting vector (LTVEC). The upper schematic of FIG.
29 shows the genomic organization of the Rag1 and Rag2 loci and the
genomic regions corresponding to the 5' and 3' homology arms (48 kb
and 84 kb, respectively; dark grey boxes). Rag2 and Rag1 each
comprises a single exon denoted by the stippled grey shading. The
lower schematic in FIG. 29 is the LTVEC. The 5' and 3' homology
arms (48 kb and 84 kb, respectively) are denoted by the dark grey
boxes. The LTVEC comprises a reporter gene (lacZ) and a
self-deleting cassette flanked by loxP sites (open arrows). The
self-deleting cassette comprises a rat Prm1 promoter operably
linked to the Crei gene and a drug selection cassette comprising a
human ubiquitin promoter operably linked to a neomycin resistance
gene. The Crei comprises two exons encoding the Cre recombinase are
separated by an intron (Crei) to prevent its expression in a
prokaryotic cell. See, for example, U.S. Pat. No. 8,697,851 and
U.S. Application Publication 2013-0312129, which describes the
self-deleting cassette in detail and is hereby incorporated by
reference in their entirety. By employing a rat Prm1 promoter that
drives expression of Crei specifically in male germ cells, the
self-deleting cassette can be deleted from the male germ cells of
F0 rats.
[0822] The LTVEC was electroporated into the rat ES cells obtained
in Example 1 and the cells were plated on 15 cm 2.times. dense neoR
MEFs in 2i+10 uM ROCKi. The transformed rat ES cells were cultured
and maintained as described in Example 1.
[0823] Colonies are screened as described elsewhere herein and
targeted clones are obtained. The targeted clones are then injected
into a host embryo as described elsewhere herein to produce an F0
rat.
Example 4
Humanization
4.1. Humanization of Rat Genomic Loci
[0824] Humanization of rat genomic loci is carried out employing
the rat ES cells described herein, which are capable of sustaining
their pluripotency following one or more electroporations in vitro,
and are capable of transmitting the targeted genetic modifications
to subsequent generations. In addition, in order to circumvent the
limitations of plasmids in accommodating a large genomic DNA
fragment, and to overcome the low efficiency of introducing a
targeted genetic modification into an endogenous locus in rat ES
cells, one or more targeted genetic modifications are carried out
in bacteria, e.g., E. coli, by utilizing bacterial homologous
recombination (BHR) and employing a large targeting vector (LTVEC).
The LTVEC described herein, for example, includes a large fragment
of an endogenous rat genomic sequence with one or more
modifications or comprises an exogenous nucleic acid (e.g., a
homologous or orthologous human nucleic acid) flanked with rat
homology arms complementary to specific genomic regions.
4.2. Humanization of Rat Immunoglobulin Loci
[0825] Humanization of an endogenous rat immunoglobulin heavy chain
locus is carried out by removing one or more endogenous rat
immunoglobulin heavy chain nucleic acid sequences (e.g., one or
more endogenous V.sub.H gene segments, one or more human D gene
segments, and one or more human J.sub.H gene segments); and
introducing into the modified immunoglobulin locus a targeting
vector, e.g., a large targeting vector (LTVEC) comprising: (i) one
or more unrearranged human variable region nucleic acid sequences
(e.g., one or more human V.sub.H gene segments, one or more human D
gene segments, and one or more human J.sub.H gene segments), or one
or more rearranged human variable region nucleic acid sequences
(e.g., one or more human rearranged V-D-J gene segments); (ii) a
selection cassette (e.g., neomycin resistance gene flanked with
loxP sites); and (iii) 5' and 3' rat homology arms.
[0826] Briefly, one or more endogenous rat immunoglobulin heavy
chain variable region gene segments (i.e., one or more V.sub.H gene
segments, one or more human D gene segments, and one or more human
J.sub.H gene segments) in a rat BAC clone are removed or
inactivated by targeting the endogenous rat immunoglobulin heavy
chain locus with a selection cassette flanked by rat homology arms.
More specifically, a targeting vector is constructed to contain a
selection cassette (e.g., a neomycin resistance gene flanked with
loxP sites) flanked with 5' and 3' rat homology arms that are
complementary to target rat genomic sequences (e.g., upstream and
downstream rat genomic DNA sequences encompassing one or more rat
V.sub.H gene segments, one or more human D gene segments, and one
or more human J.sub.H gene segments).
[0827] Next, bacterial cells containing a large rat genomic DNA
fragment encompassing a rat immunoglobulin heavy chain locus are
selected and introduced with a plasmid (e.g., pABG) encoding a
recombinase operably linked to a transiently inducible promoter.
The targeting vector constructed above is then introduced into the
recombination-competent bacterial cells. Following electroporation,
the bacterial cells are treated with an inducer (e.g., arabinoside)
to initiate homologous recombination between the targeting vector
and the target rat genomic sequence in the BAC clone. Transformed
cells are plated at a high density and subjected to drug selection
to find colonies that are drug-resistant. Drug-resistant colonies
are picked and screened for the targeted modification.
[0828] In order to facilitate identification of the targeted
genetic modification, a high-throughput quantitative assay, namely,
modification of allele (MOA) assay, is employed, which allows a
large-scale screening of a modified allele(s) in a parental
chromosome following a genetic modification. The MOA assay can be
carried out via various analytical techniques, including, but not
limited to, a quantitative PCR, e.g., a real-time PCR (qPCR). For
example, the real-time PCR comprises a first primer set that
recognizes the target locus and a second primer set that recognizes
a non-targeted reference locus. In addition, the primer set can
comprise a fluorescent probe that recognizes the amplified
sequence. Alternatively, the quantitative assay can be carried out
via a variety of analytical techniques, including, but not limited
to, fluorescence-mediated in situ hybridization (FISH), comparative
genomic hybridization, isothermic DNA amplification, quantitative
hybridization to an immobilized probe(s), Invader Probes.RTM., MMP
Assays.RTM., TaqMan.RTM. Molecular Beacon, and Eclipse.TM. probe
technology. (See, for example, US2005/0144655, incorporated by
reference herein in its entirety).
[0829] The bacterial cells comprising the modified rat BAC clone,
i.e., a BAC clone containing a rat genomic DNA sequence wherein one
or more endogenous heavy chain variable region gene segments
(V.sub.H, D, and/or J.sub.H gene segments) have been deleted or
inactivated, are then electroporated with a large targeting vector
(LTVEC) comprising: (i) one or more unrearranged human variable
region nucleic acid sequences (e.g., one or more unrearranged human
V.sub.H gene segments, one or more human D gene segments, and one
or more human J.sub.H gene segments), or one or more rearranged
human variable region nucleic acid sequences (e.g., one or more
rearranged human V-D-J gene segments).
[0830] Initiation of homologous recombination in the bacterial
cells and the selection of positive clones are performed as
described above. The unrearranged or rearranged human
immunoglobulin heavy chain variable region nucleic acid sequences,
when targeted into the endogenous immunoglobulin heavy chain locus,
become operably linked to an endogenous rat immunoglobulin heavy
chain constant region nucleic acid sequence. Alternatively,
endogenous rat heavy chain constant region locus can be
inactivated, for example, by deleting one or more rat heavy chain
constant region gene segments (CH) from the endogenous heavy chain
constant region locus, and can be replaced with a human heavy chain
constant region nucleic acid sequence.
[0831] Likewise, humanization of an endogenous rat immunoglobulin
.kappa. or .lamda. light chain locus is carried out by removing one
or more endogenous rat immunoglobulin .kappa. and/or .lamda. light
chain variable region nucleic acid sequences (e.g., one or more
endogenous rat V.sub..kappa. gene segments and one or more
endogenous rat J.sub..kappa. gene segments); and targeting the
modified immunoglobulin light chain locus with a targeting vector,
e.g., a large targeting vector (LTVEC), comprising: (i) one or more
unrearranged human immunoglobulin light chain variable region
nucleic acid sequences (e.g., one or more human V.sub..kappa. gene
segments and one or more human J.sub..kappa. gene segments), or one
or more rearranged human variable region nucleic acid sequences
(e.g., one or more human rearranged V.sub..kappa.-J.sub..kappa.
gene segments); (ii) a selection cassette (e.g., neomycin
resistance gene flanked with loxP sites); and (iii) 5' and 3' rat
homology arms.
[0832] The unrearranged or rearranged human immunoglobulin light
chain variable region nucleic acid sequences, when targeted into
the endogenous immunoglobulin light chain locus, become operably
linked to the endogenous rat immunoglobulin light chain constant
region nucleic acid sequence.
[0833] The LTVEC so produced in the bacterial cells comprises, for
example, an insert nucleic acid that contains a humanized rat
immunoglobulin heavy chain or light chain locus in which one or
more endogenous rat heavy or light chain variable region gene
segments have been replaced with one or more human heavy or light
chain variable region gene segments; and rat homologous arms (e.g.,
ranging from 5 kb to 150 kb) complementary to specific genomic
target sequences. The LTVEC comprising the genetic modification
described above is then linearized and electroporated into the rat
ES cells. Electroporated rat ES cells are plated at a high density
to select drug-resistant ES cells comprising the targeting vector.
The drug selection process removes the majority of the plated cells
(.about.99%), leaving behind individual colonies, each of which is
a clone derived from a single cell. Of the remaining cells, most
cells (.about.80-100%) contain the targeting vector integrated at a
random location in the genome. Therefore, the colonies are picked
and genotyped individually in order to identify rat ES cells
comprising the targeting vector at the correct genomic location
(e.g., using the modification of allele (MOA) assay described
above).
[0834] In order to increase the efficiency of the targeted genetic
modification, the rat ES cells are electroporated with expression
vectors (or mRNA) that express ZFNs 1 and 2 (or TALENs 1 and 2)
together with the LTVEC. The targeting vector's homology arms lie
outside the ZFN target site, therefore, the targeting vector is not
cleaved by the ZFNs. The double strand break produced by the ZFNs
stimulates homology-directed repair (HDR), which otherwise accounts
for a very small percentage of repairs occurred normally in
mammalian cells (compared to non-homologous end-joining; NHEJ).
[0835] Alternatively, expression vectors containing a type II
CRISPR-associated nuclease (e.g., Cas9), a guide RNA (including
CRISPR-RNA (cr-RNA) and trans-activating CRISPR RNA (tracrRNA)), as
described herein, can be introduced into the bacterial cells
together with the LTVEC to increase the efficiency of homologous
recombination at the target genomic locus. Electroporated cells are
plated at a high density and subjected to drug selection to find
colonies that are drug-resistant. Drug-resistant colonies are
picked and screened for the targeted modification using the
modification of allele (MOA) assay as described herein. Following
these procedures, improvement in the targeting efficiency can be
achieved. For example, the amount of improvement can be small
(e.g., improve from 10% to 15%) or large (e.g., improve from 10% to
80%).
[0836] The selected rat ES cells comprising the targeted genetic
modification are then introduced into a host rat embryo, for
example, a pre-morula stage or blastocyst stage rat embryo, and
implanted in the uterus of a surrogate mother to generate a founder
rat (F0 rat). Subsequently, the founder rat is bred to a wild-type
rat to create F1 progeny heterozygous for the genetic modification.
Mating of the heterozygous F1 rat can produce progeny homozygous
for the genetic modification.
4.3(a). Replacing Rat IL2rg with Human IL2 Receptor Gamma
[0837] Table 21 provides a summary of the genomic organization of
the rat Interleukin 2 receptor gamma locus and the positions shown
were taken from build 5.0 of the Reference Sequence of the rat
genome (ENSMBL). IL2rg is on chromosome X on the (-) strand.
TABLE-US-00021 TABLE 21 Summary of the genomic organization of the
rat Il2rg locus Feature Start End 1ength Notes Exon 1 72,021,388
72,021,516 129 contains ATG ATG 72,017,500 72,017,502 3 start codon
Exon2 72,021,007 72,021,160 154 ZFN1a 72,021,014 72,021,028 15
CAGGCCCTGAACCGC binding site (SEQ ID NO: 17) ZFN1 72,021,008
72,021,013 6 TTCTGG cutting site (SEQ ID NO: 18) ZFN1b 72,020,993
72,021,007 15 GATTACCTGCGCTGGG binding site (SEQ ID NO: 20) Exon3
72,020,606 72,020,790 185 Exon4 72,020,274 72,020,413 140 Exon5
72,019,662 72,019,824 163 Exon6 72,019,101 72,019,197 97 Exon7
72,018,844 72,018,910 67 Exon8 72,017,856 72,018,506 651 contains
TGA TGA 72,018,321 72,018,323 3 stop codon Il2rg deletion
72,018,323 72,021,502 3,180
[0838] The lower schematic in FIG. 26 is the targeting vector for
the IL2rg 3.2 kb deletion. The targeting vector comprises a
reporter gene (eGFP) operably linked to the endogenous promoter and
a self-deleting cassette flanked by loxP sites (open arrows). The
self-deleting cassette comprises the Crei gene operably linked to a
mouse Prm1 promoter and a selection cassette comprising a neomycin
resistance gene operably linked to a human ubiquitin promoter.
[0839] The Crei gene comprises two exons encoding a Cre
recombinase, which are separated by an intron (Crei) to prevent its
expression in a prokaryotic cell. See, See, for example, U.S. Pat.
No. 8,697,851 and U.S. Application Publication 2013-0312129, which
describe the self-deleting cassette in detail and are hereby
incorporated by reference in their entirety. By employing the mouse
Prm1 promoter the Cre expression cassette and the drug selection
cassette can be deleted specifically in male germ cells of F0 rats.
The targeting vector was electroporated into the rat ES cells
obtained in Example 1 and the cells were plated on 15 cm 2.times.
dense neomycin-resistant MEFs in 2i+10 uM ROCKi. The transformed
rat ES cells were cultured, selected, and maintained as described
in Example 1.
[0840] As shown in Table 23, 168 colonies were screened and 6
targeted clones were obtained. The targeting efficiency was
3.57%.
[0841] Clones are injected into blastocysts as described herein in
Example 1. Clones producing F0 rats are obtained and F0 rats that
transmit the targeted modification through the germline are
obtained.
Example 4.3(b)
Replacing Rat IL2rg Ecto-Domain with Human IL2rg Ecto-Domain
[0842] The full-length humanization of IL 2 receptor gamma is
useful because rats having this modified locus will produce human
Il2rg; and this would allow for the detection of human Il2rg in
rats with antibodies specific to human Il2rg.
[0843] The ecto-humanization (i.e., replacing the rat ecto-domain
of Il2rg with the human ecto-domain of Il2rg) will result in an
Il2rg polypeptide that will bind the human ligands for Il2rg, but
because the cytoplasmic domain is still rat, it ecto-humanized form
of Il2rg will also interact with the rat signaling machinery. FIG.
33 provides a sequence alignment of the human IL-2rg protein (SEQ
ID NO: 20; NP.sub.--000197.1); the rat IL-2rg protein (SEQ ID NO:
21; NP.sub.--543165.1); and the chimeric IL-2rg protein (SEQ ID NO:
22) comprising the human ecto-domain of IL-2rg fused to the
remainder of the rat IL-2rg protein. The junction between the human
and rat IL-2rg is noted by the vertical line.
[0844] Table 22 provides a summary of the genomic organization of
the rat Interleukin 2 receptor gamma locus and the positions shown
were taken from build 5.0 of the Reference Sequence of the rat
genome (ENSMBL). IL2rg is on chromosome X on the (-) strand.
Further noted is the position of the ecto-domain of IL2rg.
TABLE-US-00022 TABLE 22 Summary of the genomic organization of the
rat Il2rg locus Feature Start End length Notes Exon 1 71,111,444
71,111,543 100 contains ATG ATG 71,111,537 71,111,539 3 start codon
Exon2 71,110,897 71,111,050 154 Exon3 71,110,504 71,110,688 185
Exon4 71,110,156 71,110,295 140 Exon5 71,109,228 71,109,390 163
Exon6 71,108,599 71,108,645 47 contains transmembrane domain Exon7
71,108,277 71,108,346 70 Exon8 71,107,404 71,107,921 518 contains
TGA TGA 71,108,736 71,108,738 3 stop codon full-length 71,107,404
71,111,539 4,136 (ATG to TGA humaniza- plus 3' poly-A) tion: ecto-
71,108,679 71,111,539 2,861 (ATG to beginning humaniza- of
transmembrane tion domain)
[0845] A plasmid targeting vectors were constructed to replace the
rat ecto-domain of the interleukin 2 receptor gamma coding region
with the human ecto domain as shown in FIG. 31. The targeting
vector was electroporated into the rat ES cells obtained in Example
1 and the cells were plated on 15 cm 2.times. dense
neomycin-resistant MEFs in 2i+10 uM ROCKi. The transformed rat ES
cells were cultured, selected, and maintained as described in
Example 1.
[0846] As shown in Table 23, 192 colonies were screened and 13
targeted clones were obtained. The targeting efficiency was
6.77%.
[0847] Clones are injected into blastocysts as described herein in
Example 1. Clones producing F0 rats are obtained and F0 rats that
transmit the targeted modification through the germline are
obtained.
Example 5
Summary
[0848] Table 23. Summary of rat targeting with various vector types
and nuclease agents discussed in Examples 3 and 4.
TABLE-US-00023 TABLE 23 Targeting Summary Clones Clones
transmitting Example Colonies Targeted Targeting Biallelic
Biallelic Clones producing through # Locus Vector screened Clones
efficiency targeted efficiency Injected chimeras germline Notes
3.2(a)(ii) ApoE plasmid 384 23 5.99% 3 3 2 3.2(a)(iii) ApoE +
plasmid 384 290 75.52% 8 2.08% 2 2 1 These 2 clones are ZFN
biallelic targeted 3.3(a) Il2rg plasmid 232 5 2.16% 6 5 3.2(b)(ii)
ApoE LTVEC 288 8 2.78% 1 0.35% 3 1 LTVEC 3.2(b)(iii) ApoE LTVEC 288
16 5.56% 1 0.35% 1 N/A This clone is LTVEC + biallelic targeted ZFN
4.3(a) Il2rg plasmid 168 6 3.57% replaces entire rat Humaniza-
Il2rg with human tion 1 Il2rg 4.3(b) Il2rg plasmid 192 13 6.77% 2
N/A replaces rat Il2rg Humaniza- ecto-domain with tion 2 human
Il2rg ecto- domain 3.4(a) Rag2 LTVEC 270 N/A Predicted 5.7 KB
deletion 3.4(b) Rag1-2 LTVEC 256 N/A Predicted 16.2 kb deletion
[0849] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference. Unless otherwise apparent from the context of any
embodiment, aspect, step or feature of the invention can be used in
combination with any other. Reference to a range includes any
integers within the range, any subrange within the range. Reference
to multiple ranges includes composites of such ranges.
Sequence CWU 1
1
23123DNAArtificial Sequencea genomic target sequence that is linked
to a guide RNA (gRNA) 1gnnnnnnnnn nnnnnnnnnn ngg 23280DNAArtificial
Sequencea guide RNA (gRNA) 2guuuuagagc uagaaauagc aaguuaaaau
aaggcuaguc cguuaucaac uugaaaaagu 60ggcaccgagu cggugcuuuu
80342DNAArtificial Sequencea guide RNA (gRNA) 3guuuuagagc
uagaaauagc aaguuaaaau aaggcuaguc cg 42430DNAArtificial Sequencea
crRNA 4guuuuagagc uagaaauagc aaguuaaaau 30533DNAArtificial
Sequencea crRNA 5guuuuagagc uagaaauagc aaguuaaaau aag
33626DNAArtificial Sequencea crRNA 6gaguccgagc agaagaagaa guuuua
26712DNAArtificial Sequencea tracrRNA 7aaggcuaguc cg
12850DNAArtificial Sequencea tracrRNA 8aaggcuaguc cguuaucaac
uugaaaaagu ggcaccgagu cggugcuuuu 509203PRTMus Musculus 9Met Lys Val
Leu Ala Ala Gly Ile Val Pro Leu Leu Leu Leu Val Leu1 5 10 15 His
Trp Lys His Gly Ala Gly Ser Pro Leu Pro Ile Thr Pro Val Asn 20 25
30 Ala Thr Cys Ala Ile Arg His Pro Cys His Gly Asn Leu Met Asn Gln
35 40 45 Ile Lys Asn Gln Leu Ala Gln Leu Asn Gly Ser Ala Asn Ala
Leu Phe 50 55 60 Ile Ser Tyr Tyr Thr Ala Gln Gly Glu Pro Phe Pro
Asn Asn Val Glu65 70 75 80 Lys Leu Cys Ala Pro Asn Met Thr Asp Phe
Pro Ser Phe His Gly Asn 85 90 95 Gly Thr Glu Lys Thr Lys Leu Val
Glu Leu Tyr Arg Met Val Ala Tyr 100 105 110 Leu Ser Ala Ser Leu Thr
Asn Ile Thr Arg Asp Gln Lys Val Leu Asn 115 120 125 Pro Thr Ala Val
Ser Leu Gln Val Lys Leu Asn Ala Thr Ile Asp Val 130 135 140 Met Arg
Gly Leu Leu Ser Asn Val Leu Cys Arg Leu Cys Asn Lys Tyr145 150 155
160 Arg Val Gly His Val Asp Val Pro Pro Val Pro Asp His Ser Asp Lys
165 170 175 Glu Ala Phe Gln Arg Lys Lys Leu Gly Cys Gln Leu Leu Gly
Thr Tyr 180 185 190 Lys Gln Val Ile Ser Val Val Val Gln Ala Phe 195
200 1015DNAArtificial SequenceZFN1a binding site 10caggccctga accgc
15116DNAArtificial SequenceZFN1 cutting site 11ttctgg
61216DNAArtificial SequenceZFN1b binding site 12gattacctgc gctggg
161315DNAArtificial SequenceZF21a binding site 13ttcaccctcc gcacc
15147DNAArtificial SequenceZFN2 cutting site 14tgctgag
71518DNAArtificial SequenceZF21b binding site 15tatccagatc caggggtt
18169PRTArtificial Sequenceconserved domain of a family of homing
nucleases 16Leu Ala Gly Leu Ile Asp Ala Asp Gly1 5
1715DNAArtificial SequenceZFN1a binding site 17caggccctga accgc
15186DNAArtificial SequenceZFN1 cutting site 18ttctgg
61916DNAArtificial SequenceZFN1b binding site 19gattacctgc gctggg
1620369PRTHomo sapiens 20Met Leu Lys Pro Ser Leu Pro Phe Thr Ser
Leu Leu Phe Leu Gln Leu1 5 10 15 Pro Leu Leu Gly Val Gly Leu Asn
Thr Thr Ile Leu Thr Pro Asn Gly 20 25 30 Asn Glu Asp Thr Thr Ala
Asp Phe Phe Leu Thr Thr Met Pro Thr Asp 35 40 45 Ser Leu Ser Val
Ser Thr Leu Pro Leu Pro Glu Val Gln Cys Phe Val 50 55 60 Phe Asn
Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Pro65 70 75 80
Gln Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Asn Ser Asp Asn 85
90 95 Asp Lys Val Gln Lys Cys Ser His Tyr Leu Phe Ser Glu Glu Ile
Thr 100 105 110 Ser Gly Cys Gln Leu Gln Lys Lys Glu Ile His Leu Tyr
Gln Thr Phe 115 120 125 Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg
Arg Gln Ala Thr Gln 130 135 140 Met Leu Lys Leu Gln Asn Leu Val Ile
Pro Trp Ala Pro Glu Asn Leu145 150 155 160 Thr Leu His Lys Leu Ser
Glu Ser Gln Leu Glu Leu Asn Trp Asn Asn 165 170 175 Arg Phe Leu Asn
His Cys Leu Glu His Leu Val Gln Tyr Arg Thr Asp 180 185 190 Trp Asp
His Ser Trp Thr Glu Gln Ser Val Asp Tyr Arg His Lys Phe 195 200 205
Ser Leu Pro Ser Val Asp Gly Gln Lys Arg Tyr Thr Phe Arg Val Arg 210
215 220 Ser Arg Phe Asn Pro Leu Cys Gly Ser Ala Gln His Trp Ser Glu
Trp225 230 235 240 Ser His Pro Ile His Trp Gly Ser Asn Thr Ser Lys
Glu Asn Pro Phe 245 250 255 Leu Phe Ala Leu Glu Ala Val Val Ile Ser
Val Gly Ser Met Gly Leu 260 265 270 Ile Ile Ser Leu Leu Cys Val Tyr
Phe Trp Leu Glu Arg Thr Met Pro 275 280 285 Arg Ile Pro Thr Leu Lys
Asn Leu Glu Asp Leu Val Thr Glu Tyr His 290 295 300 Gly Asn Phe Ser
Ala Trp Ser Gly Val Ser Lys Gly Leu Ala Glu Ser305 310 315 320 Leu
Gln Pro Asp Tyr Ser Glu Arg Leu Cys Leu Val Ser Glu Ile Pro 325 330
335 Pro Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Ala Ser Pro Cys Asn
340 345 350 Gln His Ser Pro Tyr Trp Ala Pro Pro Cys Tyr Thr Leu Lys
Pro Glu 355 360 365 Thr21368PRTRattus norvegicus 21Met Leu Lys Pro
Leu Leu Pro Ser Arg Ser Phe Leu Leu Leu Gln Leu1 5 10 15 Leu Leu
Leu Arg Val Gly Trp Ser Ser Lys Val Leu Met Ser Ser Gly 20 25 30
Asn Glu Asp Thr Lys Ser Asp Leu Leu Leu Thr Ser Met Asp Leu Lys 35
40 45 His Leu Ser Val Pro Thr Leu Pro Leu Pro Glu Val Gln Cys Phe
Val 50 55 60 Phe Asn Val Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser
Ser Glu Pro65 70 75 80 Gln Pro Thr Asn Leu Thr Met His Tyr Arg Tyr
Lys Gly Ser Asp Asn 85 90 95 Asn Thr Phe Gln Glu Cys Ser His Tyr
Leu Phe Ser Lys Glu Ile Thr 100 105 110 Ser Gly Cys Gln Ile Gln Lys
Glu Asp Ile Gln Leu Tyr Gln Thr Phe 115 120 125 Val Val Gln Leu Gln
Asp Pro Gln Lys Pro Gln Arg Arg Ala Glu Gln 130 135 140 Lys Leu Asn
Leu Gln Asn Leu Val Ile Pro Trp Ala Pro Glu Asn Leu145 150 155 160
Thr Leu Tyr Asn Leu Ser Glu Ser Gln Val Glu Leu Arg Trp Lys Ser 165
170 175 Arg Tyr Ile Glu Arg Cys Leu Gln Tyr Leu Val Gln Tyr Arg Ser
Asn 180 185 190 Arg Asp Arg Ser Trp Thr Glu Gln Ile Val Asp His Glu
Pro Arg Phe 195 200 205 Ser Leu Pro Ser Val Asp Glu Gln Lys Leu Tyr
Thr Phe Arg Val Arg 210 215 220 Ser Arg Phe Asn Pro Ile Cys Gly Ser
Thr Gln Gln Trp Ser Lys Trp225 230 235 240 Ser Gln Pro Ile His Trp
Gly Ser His Thr Ala Glu Glu Asn Pro Ser 245 250 255 Leu Phe Ala Leu
Glu Ala Val Leu Ile Pro Val Gly Thr Met Gly Leu 260 265 270 Ile Ile
Thr Leu Ile Phe Val Tyr Cys Trp Leu Glu Arg Met Pro Arg 275 280 285
Ile Pro Ala Ile Lys Asn Leu Glu Asp Leu Val Thr Glu Tyr His Gly 290
295 300 Asn Phe Ser Ala Trp Ser Gly Val Ser Lys Gly Leu Thr Glu Ser
Leu305 310 315 320 Gln Pro Asp Tyr Ser Glu Arg Phe Cys His Val Ser
Glu Ile Pro Pro 325 330 335 Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly
Gly Ser Pro Cys Ser Leu 340 345 350 His Ser Pro Tyr Trp Pro Pro Pro
Cys Tyr Ser Leu Lys Pro Glu Ala 355 360 365 22368PRTArtificial
Sequencechimeric IL-2 receptor gamma comprising the rat IL-2
receptor gamma protein having the ecto domain of IL-2 gamma
receptor from human 22Met Leu Lys Pro Ser Leu Pro Phe Thr Ser Leu
Leu Phe Leu Gln Leu1 5 10 15 Pro Leu Leu Gly Val Gly Leu Asn Thr
Thr Ile Leu Thr Pro Asn Gly 20 25 30 Asn Glu Asp Thr Thr Ala Asp
Phe Phe Leu Thr Thr Met Pro Thr Asp 35 40 45 Ser Leu Ser Val Ser
Thr Leu Pro Leu Pro Glu Val Gln Cys Phe Val 50 55 60 Phe Asn Val
Glu Tyr Met Asn Cys Thr Trp Asn Ser Ser Ser Glu Pro65 70 75 80 Gln
Pro Thr Asn Leu Thr Leu His Tyr Trp Tyr Lys Asn Ser Asp Asn 85 90
95 Asp Lys Val Gln Lys Cys Ser His Tyr Leu Phe Ser Glu Glu Ile Thr
100 105 110 Ser Gly Cys Gln Leu Gln Lys Lys Glu Ile His Leu Tyr Gln
Thr Phe 115 120 125 Val Val Gln Leu Gln Asp Pro Arg Glu Pro Arg Arg
Gln Ala Thr Gln 130 135 140 Met Leu Lys Leu Gln Asn Leu Val Ile Pro
Trp Ala Pro Glu Asn Leu145 150 155 160 Thr Leu His Lys Leu Ser Glu
Ser Gln Leu Glu Leu Asn Trp Asn Asn 165 170 175 Arg Phe Leu Asn His
Cys Leu Glu His Leu Val Gln Tyr Arg Thr Asp 180 185 190 Trp Asp His
Ser Trp Thr Glu Gln Ser Val Asp Tyr Arg His Lys Phe 195 200 205 Ser
Leu Pro Ser Val Asp Gly Gln Lys Arg Tyr Thr Phe Arg Val Arg 210 215
220 Ser Arg Phe Asn Pro Leu Cys Gly Ser Ala Gln His Trp Ser Glu
Trp225 230 235 240 Ser His Pro Ile His Trp Gly Ser Asn Thr Ser Lys
Glu Asn Pro Phe 245 250 255 Leu Phe Ala Leu Glu Ala Val Leu Ile Pro
Val Gly Thr Met Gly Leu 260 265 270 Ile Ile Thr Leu Ile Phe Val Tyr
Cys Trp Leu Glu Arg Met Pro Arg 275 280 285 Ile Pro Ala Ile Lys Asn
Leu Glu Asp Leu Val Thr Glu Tyr His Gly 290 295 300 Asn Phe Ser Ala
Trp Ser Gly Val Ser Lys Gly Leu Thr Glu Ser Leu305 310 315 320 Gln
Pro Asp Tyr Ser Glu Arg Phe Cys His Val Ser Glu Ile Pro Pro 325 330
335 Lys Gly Gly Ala Leu Gly Glu Gly Pro Gly Gly Ser Pro Cys Ser Leu
340 345 350 His Ser Pro Tyr Trp Pro Pro Pro Cys Tyr Ser Leu Lys Pro
Glu Ala 355 360 365 2323DNAArtificial Sequencea genomic target
sequence that is linked to a guide RNA (gRNA) 23gnnnnnnnnn
nnnnnnnnnn ngg 23
* * * * *