U.S. patent application number 13/617059 was filed with the patent office on 2013-03-28 for structural variants of antibodies for improved therapeutic characteristics.
This patent application is currently assigned to IMMUNOMEDICS, INC.. The applicant listed for this patent is Chien-Hsing Chang, David M. Goldenberg, Hans J. Hansen. Invention is credited to Chien-Hsing Chang, David M. Goldenberg, Hans J. Hansen.
Application Number | 20130078182 13/617059 |
Document ID | / |
Family ID | 41681390 |
Filed Date | 2013-03-28 |
United States Patent
Application |
20130078182 |
Kind Code |
A1 |
Goldenberg; David M. ; et
al. |
March 28, 2013 |
Structural Variants of Antibodies for Improved Therapeutic
Characteristics
Abstract
Substituted humanized, chimeric or human anti-CD20 antibodies or
antigen binding fragments and bispecific antibodies or fusion
proteins comprising the substituted antibodies or antigen binding
fragments are disclosed. They are useful for treatment of B-cell
disorders, such as B-cell malignancies and autoimmune diseases, as
well as GVHD, organ transplant rejection, and hemolytic anemia and
cryoglobulinemia. Substitution of an aspartate residue at Kabat
position 101 of CDR3 V.sub.H (CDRH3), produces improved therapeutic
properties, including decreased dissociation rates and improved CDC
activity, apoptosis, B-cell depletion and therapeutic efficacy at
very low dosages. Veltuzumab, a humanized antibody that
incorporates such sequence variation, exhibits improved therapeutic
efficacy compared to similar antibodies of different CDRH3
sequence, allowing therapeutic effect at dosages as low as 200 mg
or less, preferably 100 mg or less, preferably 80 mg or less,
preferably 50 mg or less, most preferably 30 mg or less of naked
antibody administered i.v. or s.c.
Inventors: |
Goldenberg; David M.;
(Mendham, NJ) ; Chang; Chien-Hsing; (Downingtown,
PA) ; Hansen; Hans J.; (Picayune, MS) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Goldenberg; David M.
Chang; Chien-Hsing
Hansen; Hans J. |
Mendham
Downingtown
Picayune |
NJ
PA
MS |
US
US
US |
|
|
Assignee: |
IMMUNOMEDICS, INC.
Morris Plains
NJ
|
Family ID: |
41681390 |
Appl. No.: |
13/617059 |
Filed: |
September 14, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12506996 |
Jul 21, 2009 |
8287864 |
|
|
13617059 |
|
|
|
|
12212359 |
Sep 17, 2008 |
8057793 |
|
|
12506996 |
|
|
|
|
11534103 |
Sep 21, 2006 |
7435803 |
|
|
12212359 |
|
|
|
|
10366709 |
Feb 14, 2003 |
7151164 |
|
|
11534103 |
|
|
|
|
61082399 |
Jul 21, 2008 |
|
|
|
60416232 |
Oct 7, 2002 |
|
|
|
60356132 |
Feb 14, 2002 |
|
|
|
Current U.S.
Class: |
424/1.49 ;
424/133.1; 424/136.1; 424/178.1; 424/85.2; 424/85.5; 424/85.6;
424/85.7 |
Current CPC
Class: |
C07K 16/2887 20130101;
C07K 2317/56 20130101; C07K 2317/565 20130101; A61K 39/3955
20130101; A61K 39/39558 20130101; C07K 2317/734 20130101; C07K
2317/92 20130101; C07K 2317/24 20130101; A61K 2039/505 20130101;
C07K 2317/732 20130101; A61K 51/1093 20130101; A61P 31/12
20180101 |
Class at
Publication: |
424/1.49 ;
424/136.1; 424/133.1; 424/178.1; 424/85.2; 424/85.7; 424/85.6;
424/85.5 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 51/10 20060101 A61K051/10 |
Claims
1. A method of treating a disease in a subject comprising: a)
obtaining a bispecific antibody or antibody fusion protein
comprising (i) a first antibody or fragment thereof which is a
substituted chimeric, humanized or human anti-CD20 antibody or
antigen binding fragment thereof made by a method comprising making
one amino acid substitution in the third complementarity
determining region (CDR) sequence of the heavy chain of a chimeric,
humanized or human anti-CD20 antibody or antigen binding fragment
thereof to make a substituted antibody or antigen binding fragment
thereof, wherein the antibody is substituted at Kabat position 101
of CDR3 and the substituted antibody or antigen binding fragment
thereof has at least one improved characteristic selected from the
group consisting of a slower off-rate, slower antigen dissociation
rate, higher CDC activity, higher ADCC activity, higher apoptotic
activity, greater ability to induce cell death in vitro in the
absence of cross-linking and greater ability to kill or inhibit the
growth of CD20-positive cells in vivo when administered to a
subject with CD20-positive cells and (ii) a second antibody or
fragment thereof: b) administering the bispecific antibody or
antibody fusion protein to a subject; and c) treating the disease
in the subject, wherein the disease is selected from the group
consisting of B-cell mediated immune disease, autoimmune disease,
B-cell lymphoma and leukemia, graft-versus-host disease, organ
transplant rejection, immune hemolytic anemia, allosensitization,
and cryoglobulinemia.
2. The method of claim 1, wherein the disease is immune
thrombocytopenic purpura, systemic lupus erythematosus, Sjogren's
syndrome, Evans syndrome, arthritis, arteritis, pemphigus vulgaris,
renal graft rejection, cardiac graft rejection, rheumatoid
arthritis, Burkitt lymphoma, non-Hodgkin's lymphoma, follicular
lymphoma, small lymphocytic lymphoma, diffuse B-cell lymphoma,
marginal zone lymphoma, chronic lymphocytic leukemia, acute
lymphocytic leukemia, Type I diabetes mellitus, GVHD, multiple
sclerosis and multiple myeloma.
3. The method of claim 1, further comprising administering at least
one therapeutic agent to the subject before, concurrently with or
after the administration of the bispecific antibody or antibody
fusion protein.
4. The method of claim 1, wherein the bispecific antibody or
antibody fusion protein is conjugated to at least one therapeutic
agent.
5. The method of claim 1, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 200 mg or less, wherein the administration is
effective to treat the B-cell mediated immune disease, autoimmune
disease, other B-cell related immune diseases, B-cell lymphomas or
leukemias.
6. The method of claim 5, wherein the bispecific antibody or
antibody fusion protein is administered to the subject two or more
times at an interval of one to three weeks.
7. The method of claim 5, wherein the administration is intravenous
or subcutaneous.
8. The method of claim 5, wherein the administration is
subcutaneous and wherein subcutaneous administration is more
effective than intravenous administration at killing or inhibiting
the growth of CD20-positive cells in vivo when administered to a
subject with CD20-positive cells.
9. The method of claim 5, wherein administration of the bispecific
antibody or antibody fusion protein is effective to deplete
peripheral B-cell levels in the subject.
10. The method of claim 9, wherein the administration is effective
to deplete peripheral B-cells in the subject with a single dose of
80 mg/m.sup.2i.v. or 80 mg s.c.
11. The method of claim 9, wherein the administration is effective
to deplete peripheral B-cells in the subject at a dosage less than
80 mg/m.sup.2 i.v. or less than 80 mg s.c. when administered at
least once, preferably when administered two to four times to the
subject.
12. The method of claim 1, further comprising repeating the
administration as needed to prevent or treat relapse of the
subject.
13. The method of claim 1, wherein the first antibody is veltuzumab
and administration is to a subject who is refractory to
rituximab.
14. The method of claim 4, wherein the therapeutic agent is
selected from the group consisting of a radionuclide, boron, an
immunomodulator, a cytokine, a hormone, a hormone antagonist, an
enzyme, an enzyme inhibitor, a photoactive therapeutic agent, a
cytotoxic drug, a toxin, an angiogenesis inhibitor, an
oligonucleotide, an interference RNA, a second antibody or fragment
thereof and a combination thereof.
15. The method of claim 3, wherein the therapeutic agent is
selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15,
IL-16, IL-17, IL-18, IL-21, IL-25, interferon-alpha,
interferon-beta interferon-gamma, TNF-alpha and the stem cell
growth factor designated "S1 factor".
16. The method of claim 1, wherein the second antibody or fragment
thereof binds to an antigen selected from the group consisting of
carbonic anhydrase IX, B7, CCCL19, CCCL21, CD1, CD1a, CD2, CD3,
CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19, CD20, CD21,
CD22, CD23, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L,
CD45, CD46, CD52, CD54, CD55, CD59, CD64, CD66a-d, CD67, CD70,
CD74, CD79a, CD80, CD83, CD95, CD126, CD133, CD138, CD147, CD154,
CEACAM6, B7, ED-B fibronectin, Factor H, FHL-1, Flt-3, folate
receptor, GROB, HMGB-1, hypoxia inducible factor (HIF), HM1.24, Ia,
insulin-like growth factor-1 (ILGF-1), IFN-.gamma., IFN-.alpha.,
IFN-.beta., IL-2, IL-4R, IL-6R, IL-13R, IL-15R, IL-17R, IL-18R,
IL-6, IL-8, IL-12, IL-15, IL-17, IL-25, IP-10, MAGE, mCRP, MCP-1,
MIP-1A, MIP-1B, MIF, MUC1, MUC2, MUC3, MUC4, NCA-66, NCA-95,
NCA-90, Ia, HLA-DR, tenascin, Le(y), RANTES, T101, TAC, Tn antigen,
Thomson-Friedenreich antigens, tumor necrosis antigens,
TNF-.alpha., TRAIL receptors (R1 and R2), VEGFR, EGFR, P1GF,
complement factors C3, C3a, C3b, C5a, C5, and oncogene products,
including bcl-2, Kras and cMET.
17. The method of claim 1, wherein the second antibody or fragment
thereof is selected from the group consisting of LL1, LL2, RFB4,
hA20, 1F5, L243, MN-3, MN-15, L19, G250, and L243 or a fragment of
one of these.
18. The method of claim 1, wherein the bispecific antibody or
antibody fusion protein is administered to the subject at least
twice a week.
19. The method of claim 1, wherein the first antibody is veltuzumab
and the second antibody or fragment thereof binds to CD20.
20. The method of claim 1, wherein the first antibody or fragment
thereof is veltuzumab or a fragment thereof and the second antibody
or fragment thereof is epratuzumab or a fragment thereof.
21. The method of claim 1, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 1 to 10 mg/kg.
22. The method of claim 5, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 100 mg or less.
23. The method of claim 5, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 80 mg or less.
24. The method of claim 5, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 50 mg or less.
25. The method of claim 5, wherein the bispecific antibody or
antibody fusion protein is administered parenterally to the subject
at a dosage of 30 mg or less.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 12/506,996, filed Jul. 21, 2009, which claims the benefit
under 35 U.S.C. 119(e) of U.S. Provisional Patent Application Ser.
No. 61/082,399, filed Jul. 21, 2008. U.S. patent application Ser.
No. 12/506,996 also claims the benefit under 35 U.S.C. 120 of U.S.
application Ser. No. 12/212,359 (filed Sep. 17, 2008, now patented
as U.S. Pat. No. 8,057,793), which is a continuation of U.S.
application Ser. No. 11/534,103 (filed Sep. 21, 2006, now patented
as U.S. Pat. No. 7,435,803), which is a continuation of U.S.
application Ser. No. 10/366,709 (filed Feb. 14, 2003, now patented
as U.S. 7,151,164) which claimed the benefit under 35 U.S.C. 119(e)
of U.S. Provisional Patent Application Ser. Nos. 60/416,232 (filed
Oct. 7, 2002, expired) and 60/356,132 (filed Feb. 14, 2002,
expired).
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to structural variants of
anti-CD20 antibodies and/or antigen binding fragments thereof,
preferably involving the amino acid sequences of
complementarity-determining regions (CDRs), with improved
therapeutic characteristics. In particular embodiments, the
structural variation may comprise changes to the third CDR sequence
of the antibody heavy chain (CDRH3), for example substitution of an
aspartate residue for an asparagine residue at Kabat position 101.
In other particular embodiments, the structural variation may
comprise an arginine residue at Kabat position 94, which may form a
salt bridge with an aspartate at Kabat position 101. In still other
particular embodiments, the structural variation may comprise a
valine residue at Kabat position 102. Such structural variants may
provide improved efficacy for diseases related to proliferation of
B-cells, such as B-cell leukemias, lymphomas or autoimmune
diseases, as well as other immune diseases implicating B-cells. In
preferred embodiments, the improved efficacy may allow
administration of low dosages of anti-CD20 antibody or antigen
binding fragment thereof, such as 80 mg or less, more preferably 50
mg or less, most preferably 30 mg or less, which may be
administered two or more times about one to three weeks apart, or
even two or more times weekly.
[0004] The anti-CD20 antibody may be a humanized, chimeric or human
anti-CD20 antibody, particularly a monoclonal antibody (MAb). Other
embodiments may concern therapeutic and/or diagnostic conjugates of
humanized, chimeric or human anti-CD20 antibodies and methods of
treating B-cell lymphomas and leukemias and various autoimmune
diseases, for example using humanized, chimeric or human anti-CD20
antibodies. Still other embodiments may relate to antibody fusion
proteins or antigen binding fragments thereof comprising at least
one anti-CD20 MAb or antigen binding fragment thereof, in some
cases in combination with a second, different antibody, especially
anti-CD20 antibody, preferably anti-CD20 MAb, or antigen binding
fragment thereof. The humanized, chimeric or human MAbs, antigen
binding fragments thereof or antibody fusion proteins may be
administered alone, as a therapeutic immunoconjugate or in
combination with one or more therapeutic agents, with other naked
antibodies or other immunoconjugates. Still other embodiments
relate to DNA sequences encoding humanized, chimeric or human
anti-CD20 antibodies and antibody fusion proteins, vectors and host
cells containing the DNA sequences, and methods of making the
humanized, chimeric or human anti-CD20 antibodies.
[0005] 2. Background
[0006] The immune system of vertebrates consists of a number of
organs and cell types which have evolved to accurately recognize
foreign antigens, specifically bind to, and eliminate/destroy such
foreign antigens. Lymphocytes, amongst others, are critical to the
immune system. Lymphocytes are divided into two major
sub-populations, T cells and B cells. Although inter-dependent, T
cells are largely responsible for cell-mediated immunity and
B-cells are largely responsible for antibody production (humoral
immunity).
[0007] In humans, each B-cell can produce an enormous number of
antibody molecules. Such antibody production typically ceases (or
substantially decreases) when a foreign antigen has been
neutralized. Occasionally, however, proliferation of a particular
B-cell will continue unabated and may result in cancers known as
B-cell lymphomas or leukemias. B-cell lymphomas, such as the B-cell
subtype of non-Hodgkin's lymphoma, are significant contributors to
cancer mortality. The response of B-cell malignancies to various
forms of treatment is mixed. For example, in cases in which
adequate clinical staging of non-Hodgkin's lymphoma is possible,
field radiation therapy can provide satisfactory treatment. Still,
about one-half of the patients die from the disease. Devesa et al.,
J. Nat. Cancer Inst. 79:701 (1987).
[0008] The majority of chronic lymphocytic leukemias are of B-cell
lineage. Freedman, Hematol. Oncol. Clin. North Am. 4:405 (1990).
This type of B-cell malignancy is the most common leukemia in the
Western world. Goodman et al., Leukemia and Lymphoma 22:1 (1996).
The natural history of chronic lymphocytic leukemia falls into
several phases. In the early phase, chronic lymphocytic leukemia is
an indolent disease, characterized by the accumulation of small
mature functionally-incompetent malignant B-cells having a
lengthened life span. Eventually, the doubling time of the
malignant B-cells decreases and patients become increasingly
symptomatic. While treatment can provide symptomatic relief, the
overall survival of the patients is only minimally affected. The
late stages of chronic lymphocytic leukemia are characterized by
significant anemia and/or thrombocytopenia. At this point, the
median survival is less than two years. Foon et al., Annals Int.
Medicine 113:525 (1990). Due to the very low rate of cellular
proliferation, chronic lymphocytic leukemia is resistant to
cytotoxic drug treatment. Both chronic and acute lymphocytic
leukemias of B-cell origin are suitable targets for the therapies
described herein.
[0009] Traditional methods of treating B-cell malignancies,
including chemotherapy and radiotherapy, have limited utility due
to toxic side effects. The use of monoclonal antibodies to direct
radionuclides, toxins, or other therapeutic agents offers the
possibility that such agents can be delivered selectively to tumor
sites, thus limiting toxicity to normal tissues. Also, the presence
of B-cell antigens on these B-cell malignancies makes them optimal
targets for therapy with unconjugated B-cell antibodies, such as
against CD19, CD20, CD21, CD23, and CD22 markers on B-cells.
HLA-DR, CD30, CD37, CD40, CD45, CD70, CD79a, and other antigens may
serve as targets for normal and malignant B-cells, although they
are also expressed on other cell types. Further, certain MUC1,
MUC2, MUC3, and MUC4 antigens, preferably MUC1, as well as also
insulin-like growth factors (ILGF), insulin-like growth factor
receptor, macrophage migration-inhibitory factor (MIF), are also
expressed in different hematopoietic malignancies, including B-cell
tumors expressing CD20 and other B-cell markers. Still other
antigen targets, such as those associated with the vascular
endothelium of tumors, including tenascin, vascular endothelium
growth factor receptor (VEGFR), and placental growth factor (P1GF),
as well as other categories of antigens associated with B-cell
malignancies, such as oncogene products (cMET, Kras, bcl-2, bcl-6),
are also suitable targets for therapeutic antibodies.
[0010] B-cells comprise cell surface proteins which can be utilized
as markers for differentiation and identification. One such human
B-cell marker is the human B lymphocyte-restricted differentiation
antigen, Bp35, referred to as CD20. CD20 is expressed during early
pre-B-cell development and remains until plasma cell
differentiation. CD20 is expressed on both normal B cells and
malignant B cells whose abnormal growth can lead to B-cell
lymphomas and leukemias. Antibodies against the CD20 antigen have
been investigated for the therapy of B-cell lymphomas and
leukemias. For example, a chimeric anti-CD20 antibody, designated
as "IDEC-c2B8" (rituximab), has activity against B-cell lymphomas
when provided as unconjugated antibodies at repeated injections of
doses exceeding 500 mg per injection. Maloney et al., Blood 84:2457
(1994); Longo, Curr. Opin. Oncol. 8:353 (1996). About 50 percent of
non-Hodgkin's patients, having the low-grade indolent form, treated
with this regimen showed responses. Therapeutic responses have also
been obtained using .sup.131I-labeled B1 (tositumomab) anti-CD20
murine monoclonal antibody when provided as repeated doses with
pretreatment of unlabeled antibodies exceeding 600 mg per
injection. Kaminski et al., N. Engl. J. Med. 329:459 (1993); Press
et al., N. Engl. J. Med. 329:1219 (1993); Press et al., Lancet
346:336 (1995). However, these antibodies, whether provided as
unconjugated forms or radiolabeled forms, have not shown high rates
of objective and durable responses in patients with the more
prevalent and lethal form of B-cell lymphoma, the intermediate or
aggressive types. Therefore, a need exists to develop an
immunotherapy for B-cell malignancies that achieves a therapeutic
response of significant duration.
[0011] Additional studies targeting CD20 surface antigen have been
performed using an anti-CD20 murine monoclonal antibody, IFS, which
was administered by continuous intravenous infusion to B-cell
lymphoma patients. Extremely high levels (>2 grams) of 1F5 were
reportedly required to deplete circulating tumor cells, and the
results were described as being "transient." Press et al.,
"Monoclonal Antibody 1F5 (Anti-CD20) Serotherapy of Human B-Cell
Lymphomas." Blood 69/2:584-591 (1987). However, a potential problem
with this approach is that non-human monoclonal antibodies (e.g.,
murine monoclonal antibodies) typically lack human effector
functionality, i.e., they are unable to mediate
complement-dependent lysis or lyse human target cells through
antibody-dependent cellular toxicity or Fc-receptor mediated
phagocytosis. Furthermore, non-human monoclonal antibodies can be
recognized by the human host as a foreign protein and, therefore,
repeated injections of such foreign antibodies can lead to the
induction of immune responses leading to harmful hypersensitivity
reactions. For murine-based monoclonal antibodies, this is often
referred to as a Human Anti-Mouse Antibody (HAMA) response.
[0012] The use of chimeric antibodies is preferred because they do
not elicit as strong a HAMA response as murine antibodies. Chimeric
antibodies are antibodies which comprise portions from two or more
different species. For example, Liu, A. Y. et al, "Production of a
Mouse-Human Chimeric Monoclonal Antibody to CD20 with Potent
Fc-Dependent Biologic Activity" J. Immunol. 139/10:3521-3526
(1987), describe a mouse/human chimeric antibody directed against
the CD20 antigen. See also, PCT Publication No. WO 88/04936. An
exemplary chimeric antibody would comprise mouse variable region
sequences attached to human antibody constant region sequences.
[0013] The use of humanized antibodies is even more preferred, in
order to further reduce the possibility of inducing a HAMA
reaction. As discussed below, techniques for humanization of murine
antibodies by replacing murine framework and constant region
sequences with corresponding human antibody framework and constant
region sequences are well known in the art and have been applied to
numerous murine anti-cancer antibodies. Antibody humanization may
also involve the substitution of one or more human framework amino
acid residues with the corresponding residues from the parent
murine framework region sequences.
[0014] Another approach that has improved the ability of antibodies
to be effective in the treatment of B-cell disorders has been to
conjugate a therapeutic agent, such as a radioactive or
chemotherapeutic agent to the antibody, such that the agent is
localized at the tumor site. For example, the above-referenced 1F5
antibody and other B-cell antibodies have been labeled with
.sup.131I and were evaluated for biodistribution in two patients.
See Eary, J. F. et al., "Imaging and Treatment of B-Cell Lymphoma"
J. Nuc. Med. 31/8:1257-1268 (1990); see also, Press, O. W. et al.,
"Treatment of Refractory Non-Hodgkin's Lymphoma with Radiolabeled
MB-1 (Anti-CD37) Antibody" J. Clin. Oncol. 7/8:1027-1038 (1989)
(indication that one patient treated with .sup.131H-labeled IF-5
achieved a partial response); Goldenberg, D. M. et al., "Targeting,
Dosimetry and Radioimmunotherapy of B-Cell Lymphomas with
.sup.131I-Labeled LL2 Monoclonal Antibody" J. Clin. Oncol.
9/4:548-564 (1991) (three of eight patients receiving multiple
injections reported to have developed a HAMA response to this CD22
murine antibody); Appelbaum, F. R. "Radiolabeled Monoclonal
Antibodies in the Treatment of Non-Hodgkin's Lymphoma" Hem./Oncol.
Clinics of N. Am. 5/5:1013-1025 (1991) (review article); Press, O.
W. et al. "Radiolabeled-Antibody Therapy of B-Cell Lymphoma with
Autologous Bone Marrow Support." New England Journal of Medicine
329/17: 1219-12223 (1993) (.sup.131I-labeled anti-CD20 antibody IFS
and B1-tositumomab); and Kaminski, M. G. et al "Radioimmunotherapy
of B-Cell Lymphoma with [.sup.131I] Anti-B1 (Anti-CD20) Antibody".
NEJM 329/7:459 (1993) (.sup.131I-labeled anti-CD20 antibody B1);
PCT published application WO 92/07466 (antibodies conjugated to
chemotherapeutic agents such as doxorubicin or mitomycin). However,
these approaches have not eliminated the obstacles associated with
using murine antibodies, despite the fact that many patients with
lymphoma who have received prior aggressive cytotoxic chemotherapy
are immune suppressed, thus having lower HAMA rates than lymphoma
patients who have not been heavily pretreated.
[0015] Autoimmune diseases are a class of diseases associated with
B-cell disorders. Examples comprise acute idiopathic
thrombocytopenic purpura, chronic idiopathic thrombocytopenic
purpura, dermatomyositis, Sydenham's chorea, myasthenia gravis,
systemic lupus erythematosus, lupus nephritis, rheumatic fever,
polyglandular syndromes, bullous pemphigoid, Type-I diabetes
mellitus, Henoch-Schonlein purpura, post-streptococcal nephritis,
erythema nodosum, Takayasu's arteritis, Addison's disease,
rheumatoid arthritis, multiple sclerosis, sarcoidosis, ulcerative
colitis, erythema multiforme, IgA nephropathy, polyarteritis
nodosa, ankylosing spondylitis, Goodpasture's syndrome,
thromboangitis obliterans, Sjogren's syndrome, primary biliary
cirrhosis, Hashimoto's thyroiditis, thyrotoxicosis, scleroderma,
chronic active hepatitis, polymyositis/dermatomyositis,
polychondritis, pemphigus vulgaris, Wegener's granulomatosis,
membranous nephropathy, amyotrophic lateral sclerosis, tabes
dorsalis, giant cell arteritis/polymyalgia, pernicious anemia,
rapidly progressive glomerulonephritis and fibrosing alveolitis.
The most common treatments are corticosteroids and cytotoxic drugs,
which can be very toxic. These drugs also suppress the entire
immune system, can result in serious infection, and have adverse
affects on the bone marrow, liver and kidneys. There is a need for
more effective methods of treating autoimmune diseases,
particularly Class-III autoimmune diseases. A further need exists
for the development of more effective antibodies for the treatment
of cancer and/or autoimmune disease.
[0016] Still other diseases with immunological dysregulation are
suitably treated by the novel compositions and methods described
herein, such as hemolytic anemias, cryoglobulinemias, hepatitis
(particularly hepatitis C), graft-versus-host disease (GVHD)
(particularly after allogeneic stem cell transplantation),
allosensitization (particularly with organ transplantation). There
is now mounting evidence that B-cells are involved in these
pathological states, so depleting B-cells by anti-B-cell therapies
is gaining in interest (Roccatello et al., Clin Rev Allergy Immunol
2008, 34:111-117; Cutler et al., Blood 2006, 108:756-752; Vo et
al., N Engl J Med 2008, 359:242-251; Vieira et al., Transplantation
2004; 77:542-548; Abdallah & Prak, Clin. Transpl. 2006:427-37;
Zaja et al., Bone Marrow Transplant., 2007, 40:273-77; Saadoun et
al., Curr. Opin. Rheumatol. 2008, 20:23-8; Antonelli et al., Clin.
Exp. Rheumatol. 2008, 26:S39-47).
SUMMARY OF THE INVENTION
[0017] The present invention provides structural variants of
anti-CD20 antibodies and/or antigen binding fragments thereof with
improved therapeutic characteristics. In particular embodiments,
the structural variation may comprise an aspartate residue at Kabat
position 101, for example as a substitution for an asparagine
residue, in V.sub.H of CDR3 (CDRH3). In other particular
embodiments, the structural variation may comprise an arginine
residue at Kabat position 94, which may form a salt bridge with an
aspartate at Kabat position 101. In still other particular
embodiments, the structural variation may comprise a valine residue
at Kabat position 102. The skilled artisan will realize that the
possible amino acid substitutions that may be performed are not
limited to the particular examples recited above and may comprise
substitutions at additional and/or different Kabat positions.
[0018] The improved therapeutic characteristics may take a variety
of forms, such as a slower dissociation rate from the target
antigen, an increase in complement-dependent cytotoxicity (CDC)
and/or a reduction in EC.sub.50 in complement-dependent
cytotoxicity (CDC). In preferred embodiments, the characteristics
may include efficacy at a lower dosage, preferably a dosage of 80
mg or less for a human subject, more preferably a dosage of 50 mg
or less, most preferably a dosage of 30 mg or less. The dosage may
be administered two or more times. Preferably, where multiple
administrations are provided, they are administered about 1 to 3
weeks apart. But in certain disease setting, a more frequent,
fractionated dosing is preferred, such as, for example, twice
weekly for 4 or more weeks in chronic lymphocytic leukemia.
[0019] In certain embodiments, the anti-CD20 antibodies or antigen
binding fragments thereof may be humanized, chimeric or human
antibodies that bind to a human B-cell marker, such as anti-CD20
antibodies, of use for the treatment and diagnosis of B-cell
disorders, such as B-cell malignancies and autoimmune diseases, as
well as other diseases involving B-cells, such as GVHD, hemolytic
anemia, cryoglobulinemia, allosensitization, and in organ
transplant rejection, as well as certain viral diseases, such as
hepatitis C. The humanized, chimeric or human anti-CD20 antibodies
may be used for methods of treatment of mammalian subjects, such as
humans or domestic animals, as naked antibodies either alone or in
combination with one or more therapeutic agents, as
immunoconjugates labeled with one or more therapeutic and/or
diagnostic agents, as an antibody fusion protein, in pre-targeting
methods with targetable constructs that are conjugated to one or
more therapeutic or diagnostic agents, or as a multimodal therapy
with other antibodies, other therapeutic agents or
immunomodulators. The humanized, chimeric or human anti-CD20
antibodies can also be used as a diagnostic imaging agent alone, in
combination with other diagnostic imaging agents, and/or in
conjunction with therapeutic applications.
[0020] The skilled artisan will realize that the disclosed methods
and compositions for sequence variations with improved therapeutic
characteristics are not limited to anti-CD20 antibodies and may be
applied to antibodies against other tumor-associated antigens or
autoimmune and other immune disease-associated antigens, including
but not limited to carbonic anhydrase IX, CCCL19, CCCL21, CD1,
CD1a, CD2, CD3, CD4, CD5, CD8, CD11A, CD14, CD15, CD16, CD18, CD19,
CD20, CD21, CD22, CD23, CD25, CD29, CD30, CD32b, CD33, CD37, CD38,
CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59, CD64, CD66a-d,
CD67, CD70, CD74, CD79a, CD80, CD83, CD95, CD126, CD133, CD138,
CD147, CD154, CEACAM6, B7, ED-B fibronectin, Factor H, FHL-1,
Flt-1, Flt-3, folate receptor, GROB, HMGB-1, hypoxia inducible
factor (HIF), HM1.24, insulin-like growth factor-1 (ILGF-1),
ILGF-1R, IFN-.gamma., IFN-.alpha., IFN-.beta., IL-2, IL-4R, IL-6R,
IL-13R, IL-15R, IL-17R, IL-18R, IL-6, IL-8, IL-12, IL-15, IL-17,
IL-25, IP-10, MAGE, mCRP, MCP-1, MIP-1A, MIP-1B, MIF, MUC1, MUC2,
MUC3, MUC4, NCA-66, NCA-95, NCA-90, Ia, HLA-DR, tenascin, Le(y),
RANTES, T101, TAC, Tn antigen, Thomson-Friedenreich antigens, tumor
necrosis antigens, TNF-.alpha., TRAIL receptors (R1 and R2), VEGFR,
EGFR, P1GF, complement factors C3, C3a, C3b, C5a, C5, and oncogene
products, including bcl-2, bcl-6, Kras and cMET.
[0021] Other embodiments may be directed to anti-CD20 MAbs or
antigen binding fragments thereof that contain specific murine CDRs
or a combination of murine CDRs from more than one murine or
chimeric anti-CD20 MAb. These MAbs can be humanized, chimeric or
human anti-CD20 MAbs. The CDR sequences may include, but are not
limited to, light chain CDR sequences CDRL1 (RASSSVSYIH, SEQ ID
NO:1), CDRL2 (ATSNLAS, SEQ ID NO:2) and CDRL3 (QQWTSNPPT, SEQ ID
NO:3) and heavy chain CDR sequences CDRH1 (SYNMH, SEQ ID NO:4),
CDRH2 (AIYPGNGDTSYNQKFKG, SEQ ID NO:5) and CDRH3 (STYYGGDWYFDV, SEQ
ID NO:6).
[0022] Various embodiments may concern bispecific antibodies or
antibody fusion proteins comprising at least two anti-CD20 MAbs or
antigen binding fragments thereof or a first MAb comprising an
anti-CD20 MAb or antigen binding fragment thereof and a second MAb.
The second MAb may bind to a tumor-associated antigen, such as
those listed above, or a hapten, for example on a targetable
conjugate.
[0023] Other embodiments may concern therapeutic or diagnostic
conjugates of anti-CD20 MAbs or antigen binding fragments thereof
or antibody fusion proteins, bound to at least one therapeutic
agent or at least one diagnostic agent. Antibodies and fusion
proteins with multiple therapeutic agents of the same or different
type are also encompassed. In alternative embodiments, the
anti-CD20 antibodies, antigen binding fragments or fusion proteins
may be used in therapeutic or diagnostic pre-targeting methods, for
example using bispecific antibodies with one arm that binds
specifically to a cell, disease, tissue or pathogen (e.g.,
hepatitis-C-associated target antigen) and a second arm that binds
to a targetable conjugate attached to one or more diagnostic or
therapeutic agents. Methods of pre-targeting with bispecific
antibodies are well known in the art (see, e.g., U.S. Pat. Nos.
7,300,644; 7,138,103; 7,074,405; 7,052,872; 6,962,702; 6,458,933,
the Examples section of each of which is incorporated herein by
reference).
[0024] Alternative embodiments may concern methods of using the
anti-CD20 MAbs or antigen binding fragments thereof or antibody
fusion proteins for therapy, either alone, in combination with one
or more other therapeutic agents, for example as the antibody
component of a therapeutic immunoconjugate with one or more
therapeutic agents or as a naked antibody, antigen binding fragment
or fusion protein administered alone or in combination with one or
more therapeutic agents. Use for diagnostic methods in combination
with one or more diagnostic agents is also contemplated. In
preferred embodiments, the disease to be diagnosed or treated is a
B-cell mediated immune disease, autoimmune disease, B-cell lymphoma
or leukemia. B-cell mediated immune disease refers to a sub-class
of autoimmune disease, as well as the other immune diseases
discussed above (e.g., GVHD, cryoglobulinemia, hemolytic anemia,
allosensitization, transplant organ rejection) in which the disease
state is primarily mediated by production of autoantibodies, rather
than by autoreactive T lymphocytes, or by a combination of B- and
T-cell immunity.
BRIEF DESCRIPTION OF THE FIGURES
[0025] FIG. 1. Variable light chain (cA20Vk) and variable heavy
chain (cA20VH) sequences of cA20, a chimeric anti-CD20 antibody.
The CDR region sequences are shown in bold and underlined. The
amino acid residues and the nucleotides are numbered sequentially
and same numbering system is used for humanized V sequences shown
in FIG. 2. The light chain variable region is shown in FIG. 1A (SEQ
ID NOS 7 & 8) and the heavy chain variable region is shown in
FIG. 1B (SEQ ID NOS 9 & 10). The Kabat numbering scheme was
used for amino acid residues. Amino acid residues numbered by a
letter represent the insertion residue according to Kabat, and have
the same number as that of the previous residue.
[0026] FIG. 2. Nucleotide and amino acid sequences of the hA20
light chain hA20Vk (FIG. 2A) (SEQ ID NOS 11 & 12), and heavy
chain hA20VH1 (FIG. 2B) (SEQ ID NOS 13 & 14), as well as the
adjacent flanking sequences of the VKpBR2 (FIG. 2A) and VHpBS2
(FIG. 2B) staging vectors, respectively. The non-translated
nucleotide sequences are shown in lowercase. The restriction sites
used for subcloning are underlined and indicated. The secretion
signal peptide sequence is indicated by a double underline.
[0027] FIG. 3. Comparison of the variable region sequences of cA20
(SEQ ID NOS 10 & 8), rituximab (from murine C2B8, SEQ ID NOS 15
& 16) and hA20 (SEQ ID NOS 14 & 12). Dots indicate homology
to cA20. CDR sequences are in boxes. The heavy chain (FIG. 3A) and
light chain (FIG. 3B) variable region sequences are shown.
[0028] FIG. 4. Scatchard analysis--the binding characteristics of
veltuzumab and rituximab were determined by binding the
.sup.125I-labeled MAbs to Raji cells. Direct cell surface
saturation binding and Scatchard plot analysis (inset)--closed
triangles veltuzumab; circles rituximab. B.sub.max and K.sub.d were
determined by non-linear regression analysis using a one-site
binding model with Prism software. These results are representative
of one of three repeated experiments.
[0029] FIG. 5. Comparison of dissociation rates of veltuzumab and
rituximab from live cells. Daudi (A), Ramos (B), and Raji (C-E)
cells were stained with PE-labeled rituximab (closed triangle),
veltuzumab (closed square), cA20 (upside down closed triangle),
D101N (closed circle), 1F5 (open circle) or B1 (tositumomab) (open
square). The labeled MAbs were incubated at 37.degree. C. with
(A-D) or without (E) excess veltuzumab Fab'-NEM and the cells
analyzed by flow cytometry over time. The off-rate was determined
by non-linear regression (one phase exponential decay) and P-values
were generated by F-test using GraphPad Prism software.
[0030] FIG. 6. Effects of veltuzumab and rituximab on proliferation
of non-Hodgkin's lymphoma cell lines. Anti-proliferative effects
were assessed by MTT cytotoxicity assays. Cells were cultured with
the MAbs with or without a second antibody for crosslinking. White
bars, no second antibody; gray bars with GAH second antibody; error
bars, SD.
[0031] FIG. 7. In vitro depletion of B-cells from healthy blood
donors. The effect of veltuzumab on peripheral blood lymphocytes
from healthy volunteers was evaluated in vitro using flow
cytometry. Decrease in the percent of CD19+cells present in the
lymphocyte gate after a two-day incubation of heparinized whole
blood of healthy volunteers with veltuzumab is shown. Each line
represents a different blood donor. Error bars, SD.
[0032] FIG. 8. Survival curves for veltuzumab in a disseminated
Burkitt's lymphoma xenograft model comparing intraperitoneal versus
subcutaneous administration. C.B. 17 SCID mice were administered
1.5.times.10.sup.7 Daudi cells i.v. on day 0. Therapy with
veltuzumab began on day 1 with mice receiving either a single i.p.
or single s.c. injection of veltuzumab. Doses administered were 60,
20, or 5 .mu.g veltuzumab. Control mice received an i.p. injection
of either saline or 60 .mu.g hMN-14 IgG (labetuzumab, anti-CEACAM5
isotype matched antibody).
[0033] FIG. 9. The minimal effective dose of veltuzumab was
determined in a disseminated Burkitt lymphoma xenograft model. C.B.
17 SCID mice were administered 1.5.times.10.sup.7 Daudi cells i.v.
on day 0. Therapy with veltuzumab began on day 1 with mice
receiving a single i.p. injection of veltuzumab. Doses administered
were 0.5, 0.25, 0.1, or 0.05 .mu.g veltuzumab. Control mice
received a 200 .mu.L i.p. of saline.
[0034] FIG. 10. Representative survival curves of mice bearing
disseminated follicular cell lymphoma and treated with decreasing
doses of veltuzumab. C.B. 17 SCID mice were administered
2.5.times.10.sup.6 WSU-FSCCL cells i.v. on day 0. On day 5 mice
received a single i.p. injection of veltuzumab at a dose of 35,
3.5, 0.35, or 0.035 .mu.g. Control mice received only saline.
[0035] FIG. 11. The effect of depleting NK cells and neutrophils on
anti-lymphoma activity was assessed in SCID mice. C.B. 17 SCID mice
were depleted of NK and neutrophils as described in the Methods
section and injected with 1.times.10.sup.6 Raji cells i.v. Therapy
with veltuzumab began on day 3 with mice receiving 200 .mu.g
veltuzumab i.v. on days 3, 5, 7, and 11. Control mice received 100
.mu.L saline.
[0036] FIG. 12. Serum pharmacokinetics--veltuzumab (150 .mu.g) was
administered to naive Swiss-Webster mice either via the i.p. or
s.c. route. Animals were bled over a 14-day period and serum was
assayed for veltuzumab concentrations as described in Example 11
(N=6).
[0037] FIG. 13. Veltuzumab is more effective than rituximab in
controlling the growth of lymphoma in vivo in SCID mice. SCID mice
were inoculated with Raji cells by tail vein injection. On days +5,
+10, +15 and +20, the mice received either rituximab or veltuzumab
(hA20) at 10 mg/kg/dose. Treatment with veltuzumab resulted in a
significantly longer cumulative survival time compared to treatment
with an identical dosage of rituximab (P=0.005).
[0038] FIG. 14. Kaplan-Meier estimates of duration of response (DR)
and time to progression (TTP) for 24 follicular lymphoma responders
in human studies of veltuzamab effects in non-Hodgkin's
lymphoma.
[0039] FIG. 15. B-cell levels for NHL patients treated with
veltuzumab in different dose groups measured at baseline, prior to
infusions 2, 3 and 4, at 4 and 12 weeks later, then at 3-month
intervals for up to 12 months after last infusion.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0040] As used herein, an antibody refers to a full-length (i.e.,
naturally occurring or formed by normal immunoglobulin gene
fragment recombinatorial processes) immunoglobulin molecule (e.g.,
an IgG antibody) or an immunologically active, antigen-binding
portion of an immunoglobulin molecule, like an antibody
fragment.
[0041] An antibody fragment is a portion of an antibody such as
F(ab').sub.2, F(ab).sub.2, Fab', Fab, Fv, scFv and the like.
Regardless of structure, an antibody fragment binds with the same
antigen that is recognized by the intact antibody. For example, an
anti-CD20 monoclonal antibody fragment binds to CD20. The term
"antibody fragment" also includes isolated fragments consisting of
the variable regions, such as the "Fv" fragments consisting of the
variable regions of the heavy and light chains, recombinant single
chain polypeptide molecules in which light and heavy variable
regions are connected by a peptide linker ("scFv proteins"), and
minimal recognition units consisting of the amino acid residues
that mimic the hypervariable region. As used herein, the term
"antibody fragment" does not include portions of antibodies without
antigen binding activity, such as Fc fragments.
[0042] A naked antibody refers to an antibody or antigen binding
fragment thereof which is not conjugated to a therapeutic agent.
The Fc portion of the antibody molecule may provide effector
functions, such as complement fixation and ADCC (antibody dependent
cell cytotoxicity), which set mechanisms into action that may
result in cell lysis. However, it is possible that the Fc portion
is not required for therapeutic function, with other mechanisms,
such as apoptosis, coming into play. Naked antibodies may include
polyclonal and monoclonal antibodies, as well as recombinant
antibodies, such as chimeric, humanized or human antibodies.
[0043] A therapeutic agent is a molecule or atom which is
administered separately, concurrently or sequentially with an
antibody moiety or conjugated to an antibody moiety, i.e., antibody
or antibody fragment, or a subfragment, and is useful in the
treatment of a disease. Non-limiting examples of therapeutic agents
include antibodies, antibody fragments, drugs, toxins, nucleases,
hormones, immunomodulators, chelators, boron compounds, photoactive
agents, oligonucleotides (e.g. anti-sense oligonucleotides or RNAi)
and radioisotopes.
[0044] A diagnostic agent is a detectable molecule or atom that may
be conjugated to an antibody, antibody fragment, targetable
construct or other moiety for delivery to a cell, tissue, pathogen
or other target associated with a disease or medical condition.
Useful diagnostic agents include, but are not limited to,
radioisotopes, ultrasound, dyes (such as with the
biotin-streptavidin complex), contrast agents, fluorescent
compounds or molecules and enhancing agents (e.g. paramagnetic ions
for magnetic resonance imaging).
[0045] An immunoconjugate is a conjugate of an antibody component
with at least one therapeutic or diagnostic agent. An antibody
component may be conjugated with multiple therapeutic and/or
diagnostic agents to form an immunoconjugate.
[0046] The term antibody fusion protein may refer to a
recombinantly produced antigen-binding molecule in which one or
more of the same or different single-chain antibody or antibody
fragment segments with the same or different specificities are
linked. Valency of the fusion protein indicates how many binding
arms or sites the fusion protein has to a single antigen or
epitope; i.e., monovalent, bivalent, trivalent or multivalent. The
multivalency of the antibody fusion protein means that it can take
advantage of multiple interactions in binding to an antigen, thus
increasing the avidity of binding to the antigen. Specificity
indicates how many antigens or different epitopes an antibody
fusion protein is able to bind; i.e., monospecific, bispecific,
trispecific, multispecific. Using these definitions, a natural
antibody, e.g., an IgG, is bivalent because it has two binding arms
but is monospecific because it binds to one epitope type.
Monospecific, multivalent fusion proteins have more than one
binding site for an epitope but only bind with one epitope. The
fusion protein may comprise a single antibody component, a
multivalent or multispecific combination of different antibody
components or multiple copies of the same antibody component. The
fusion protein may additionally comprise an antibody or an antibody
fragment and a therapeutic agent. Examples of therapeutic agents
suitable for such fusion proteins include immunomodulators
("antibody-immunomodulator fusion protein") and toxins
("antibody-toxin fusion protein"). One preferred toxin comprises a
ribonuclease (RNase), preferably a recombinant RNase. Another
preferred immunomodulator fusion protein is an immunocytokine, such
as fusing an interferon to a specific antibody or multivalent
antibody or multispecific antibody as described herein.
[0047] A multispecific antibody is an antibody that can bind
simultaneously to at least two targets that are of different
structure, e.g., two different antigens, two different epitopes on
the same antigen, or a hapten and/or an antigen or epitope. One
specificity may be for a B-cell, T-cell, myeloid-, plasma- or
mast-cell antigen or epitope. Another specificity may be to a
different antigen on the same cell type, such as CD20, CD19, CD21,
CD23, CD37, CD45, CD70, CD79a, CD80, HLA-DR, CD74, MUC1 or CD22 on
B-cells. Multispecific, multivalent antibodies are constructs that
have more than one binding site, and the binding sites are of
different specificity.
[0048] A bispecific antibody is an antibody that can bind
simultaneously to two targets which are of different structure. In
preferred embodiments, bispecific antibodies (bsAb) and bispecific
antibody fragments (bsFab) have at least one arm that specifically
binds to, for example, a B-cell, T-cell, myeloid-, plasma- or
mast-cell antigen or epitope and at least one other arm that
specifically binds to a targetable conjugate that bears a
therapeutic or diagnostic agent.
Improved Anti-CD20 Antibodies
[0049] Advances in medical therapy during the last ten years have
witnessed the introduction of 9 antibodies for the treatment of
diverse cancers (Sharkey and Goldenberg, C A Cancer J Clin. 2006,
56:226-243). Most of these new biological therapeutics are used in
combination with conventional cytotoxic drugs, indicating that the
antibodies require additional measures to improve their efficacy
(Id.). This is best exemplified with rituximab, the
first-generation chimeric anti-CD20 monoclonal antibody (MAb) that
was approved initially as a monotherapy for the treatment of
non-Hodgkin lymphoma (NHL) (Castillo et al., Exp Hematol. 2008,
36:755-768). Rituximab is well known in the art and is commercially
available from Biogen/IDEC and Genentech (see, e.g., U.S. Pat. Nos.
5,736,137; 5,776,456; 6,399,061; 6,455,043; 6,846,476). Based on
this success, efforts are underway to introduce improved anti-CD20
antibodies (Stein et al., Clin Cancer Res. 2004, 10:2868-78;
Teeling et al., Blood. 2004, 104:1793-1800; Vugmeyster et al., J
Immunother. 2005, 28:212-219, Umana et al., Ann Oncol. 2008,
19(Suppl 7), abstract 98; Forero et al., Proc 99.sup.th Ann Meeting
of the Am Assoc Cancer Res, 2008, abstract LB-70; Glennie et al.,
Mol Immunol. 2007, 44:3823-37).
[0050] Most of these new anti-CD20 MAbs are intended to reduce the
murine components while enhancing Fc.gamma.R or complement-mediated
functions (Glennie et al., Mol Immunol. 2007, 44:3823-37; Maloney,
Hematology Am Soc Hematol Educ Program.2007:226-232; Martin et al.,
Semin Hematol. 2008, 45:126-132). One of the first
second-generation MAbs developed to mitigate the infusion-related
reactions experienced with rituximab is the hA20 MAb now termed
veltuzumab (e.g., Qu et al., Blood 2008, 111:2211-19; Stein et al.,
Clin Cancer Res. 2004, 10:2868-78; U.S. Pat. No. 7,151,164, the
Examples section of which is incorporated herein by reference).
Veltuzumab has a shorter infusion time than rituximab while
indicating a higher complete response (CR) rate than has been
reported for rituximab (Morschhauser et al., Proc Am Soc Clin
Oncol, J Clin Oncol. 2007, 25(18S):449s; Goldenberg et al., Proc
Amer Soc Clin Oncol, J. Clin. Oncol. 2008, 26(15S):142s). As
described in the Examples below, veltuzumab was recombinantly
engineered using the backbone framework regions of the humanized
anti-CD22 MAb, epratuzumab or hLL2 (see, e.g., Leung et al., Mol
Immunol. 1995, 32:1413-1427; U.S. Pat. Nos. 6,306,393; 6,183,774
and 7,074,403, the Examples section of each incorporated herein by
reference), while having identical light chain CDRs, identical
heavy chain CDR1 and CDR2, but a different CDR3-V.sub.H (CDRH3)
construct, compared to rituximab, as shown in Table 1 below.
[0051] As discussed in the Examples below, as a result of the
differences in sequence, veltuzumab has unique characteristics in
terms of significantly improved complement-dependent cytotoxicity
(CDC) in the Daudi cell line, slower off-rates in all three
lymphoma cell lines tested, compared to rituximab, and potent
anti-B-cell activity in cynomolgus monkeys and therapeutic effects
in human lymphoma-murine models, as well as significantly better
control of Raji lymphoma xenografts in mice as compared to
rituximab, thus corroborating the activity observed in patients at
very low doses. See, Goldenberg et al., 2009, "Properties and
structure-function relationships of veltuzumab (hA20), a humanized
anti-CD20 monoclonal antibody," Blood 113:1062-70. Surprisingly, as
described in the Examples below, these functional differences
between veltuzumab and rituximab are related to a non-conservative
single amino acid change in the heavy chain third
complementarity-determining region (CDRH3) (Kabat residue 101) of
rituximab. Such a non-conservative change would not be considered
by one skilled in the art due to the lack of a reasonable chance or
the reduced chance of success to improve the antibody in the
designated characteristics.
[0052] In various embodiments, the present invention provides
humanized, chimeric or human anti-CD20 antibodies, and antibody
fusion proteins thereof, useful for treatment of mammalian
subjects, humans and domestic animals, alone, as a conjugate or
administered in combination with other therapeutic agents,
including other naked antibodies and antibody therapeutic
conjugates.
[0053] In preferred embodiments, the instant anti-CD20 MAbs or
antigen binding fragments thereof comprise an aspartate residue at
Kabat position 101, an arginine residue at Kabat position 94, and a
valine residue at Kabat position 102 of CDR3's V.sub.H. More
preferably, the anti-CD20 antibodies and antigen binding fragments
thereof comprise the CDR sequences of veltuzumab, comprising light
chain CDR sequences CDRL1 (RASSSVSYIH, SEQ ID NO:1), CDRL2
(ATSNLAS, SEQ ID NO:2) and CDRL3 (QQWTSNPPT, SEQ ID NO:3) and heavy
chain CDR sequences CDRH1 (SYNMH, SEQ ID NO:4), CDRH2
(AIYPGNGDTSYNQKFKG, SEQ ID NO:5) and CDRH3 (STYYGGDWYFDV, SEQ ID
NO:6). In most preferred embodiments, the anti-CD20 antibody is
veltuzumab.
[0054] The humanized anti-CD20 MAb or antigen binding fragment
thereof may comprise the CDRs of a murine anti-CD20 MAb (or
sequences derived from the CDRs of a murine anti-CD20 antibody) and
the framework (FR) and constant regions of the light and heavy
chain variable regions of one or more human antibodies, while
retaining the B-cell, B-cell lymphoma and B-cell leukemia targeting
characteristics of the parent murine anti-CD20 MAb. The humanized
anti-CD20 MAb or antigen binding fragment thereof may further
comprise at least one amino acid from the corresponding FRs of the
parent murine MAb. Specifically, the humanized anti-CD20 MAb or
antigen binding fragment thereof may contain at least one amino
acid residue corresponding to amino acids 1, 5, 27, 30, 38, 48, 67,
68, 70, 95, 115 or 116 of the heavy chain variable region shown in
FIG. 2B (hA20VH1, SEQ ID NO:14) and/or at least one amino acid
residue corresponding to amino acid residues 4, 21, 35, 38, 45, 46,
59, 99, 104 or 106 of the light chain variable region shown in FIG.
2A (hA20Vk, SEQ ID NO:12). The murine framework amino acid residues
can be substituted in the human FR regions of the light and heavy
variable chains if necessary to maintain proper binding or to
enhance binding to the CD20 antigen. More preferably the humanized
anti-CD20 MAb or antigen binding fragment thereof comprises the
amino acid sequences of hA20Vk (SEQ ID NO:12) and hA2VH1 (SEQ ID
NO:14).
[0055] Chimeric anti-CD20 MAbs or antigen binding fragments thereof
may comprise the variable region sequences of a murine anti-CD20
antibody (or derived from a murine anti-CD20 antibody), attached to
human antibody constant region sequences. In preferred embodiments,
the light and heavy chain variable regions of a chimeric anti-CD20
MAb comprise the CDR sequences of cA20Vk (SEQ ID NO:8) and cA20VH
(SEQ ID NO:10), shown in FIGS. 1A and 1B. Most preferably, the
chimeric anti-CD20 MAb or antigen binding fragment thereof
comprises the light and heavy chain variable region sequences of
cA20Vk (SEQ ID NO:8) and cA20VH (SEQ ID NO:10).
[0056] Certain embodiments may concern a human anti-CD20 MAb or
antigen binding fragment thereof, having substantially the B-cell,
and B-cell lymphoma and leukemia cell targeting and cell binding
characteristics of a murine anti-CD20 MAb, wherein the CDRs are as
set forth above for the chimeric and humanized anti-CD20 MAbs as
shown in FIGS. 1 and 2.
[0057] Other embodiments may encompass antibody fusion proteins or
antigen binding fragments thereof comprising at least one anti-CD20
MAb or antigen binding fragments thereof, as described above. The
antibody fusion protein or antigen binding fragment thereof is also
intended to encompass an antibody fusion protein or antigen binding
fragment thereof comprising at least one first anti-CD20 MAb or
antigen binding fragment thereof as described above and at least
one second MAb or antigen binding fragment thereof, other than the
anti-CD20 MAb or antigen binding fragment thereof described above.
More preferably this second MAb is a MAb reactive with B7, CD4,
CD5, CD8 CD14, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25,
CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54,
CD55, CD59, CD70, CD74, CD80, CD95, CD126, CD133, CD138, CD154,
CEACAM6, ED-B fibronectin, Factor H, FHL-1, Flt-1, Flt-3, folate
receptor, GROB, HMGB-1, hypoxia inducible factor (HIF), HM1.24,
insulin-like growth factor-1 (ILGF-1), insulin-like growth factor-1
receptor (ILGF-1R), IFN-.gamma., IFN-.alpha., IFN-.beta., IL-2,
IL-4R, IL-6R, IL-13R, IL-15R, IL-17R, IL-18R, IL-6, IL-8, IL-12,
IL-15, IL-17, IL-25, IP-10, MAGE, mCRP, MCP-1, MIP-1A, MIP-1B, MIF,
MUC1, MUC2, MUC3, MUC4, NCA-66, 1a, HM1.24, HLA-DR, tenascin, T101,
TAC, TRAIL-R1, TRAIL-R2, VEGFR, EGFR, P1GF, complement factor C5,
and an oncogene product (e.g., Kras, cMET, bcl-2, bcl-6) or a
combination thereof, and even an anti-CD20 MAb that is different
than the anti-CD20 MAb described herein.
[0058] The humanized, chimeric or human anti-CD20 antibody may
possess enhanced affinity binding with the epitope, as well as
antitumor and anti-B-cell activity, as a result of CDR mutation and
manipulation of the CDR and other sequences in the variable region
to obtain a superior therapeutic agent for the treatment of B-cell
disorders, including B-cell lymphomas and leukemias and autoimmune
diseases and also other immune diseases involving B-cells (GVHD,
hemolytic anemia, organ transplant rejection).
Amino Acid Substitutions
[0059] It may also be desirable to modify the amino acid sequences
to improve effector function, e.g., to enhance antibody-dependent
cell-dependent cytotoxicity (ADCC) and/or complement-dependent
cytotoxicity (CDC). One or more amino acid substitutions or the
introduction of cysteine in the Fc region may be made, thereby
improving internalization capability and/or increased
complement-dependent cell killing and ADCC. See Caron et al., J.
Exp. Med. 176:1191-1195 (1991) and Shopes, Br. J. Immunol.
148:2918-2022 (1992), incorporated herein by reference. An antibody
fusion protein may be prepared that has dual Fc regions with both
enhanced complement lysis and ADCC capabilities.
[0060] Changes to the Fc region to enhance effector function or
other antibody functional characteristics have been reported (see,
e.g., Lazar et al., Proc. Natl. Acad. Sci. USA 2006, 103:4005-10;
Stavenhagen et al., Cancer Res. 2007, 67:8882-90; Hinton et al., J.
Immunol. 2006, 176:346-56; Idusogie et al., J. Immunol. 2001,
166:2571-75) and any such known Fc region amino acid substitutions
may be utilized in the claimed methods and compositions. For
example, replacement of a serine residue with an aspartate residue
at Kabat position 239 was reported to enhance ADCC activity (Lazar
et al., ibid., 2006). Substitution of phenylalanine 243 with
leucine, arginine 292 with proline, tyrosine 300 with leucine,
valine 305 with isoleucine and proline 396 with leucine also
appeared to optimize ADCC activity (Stagenhagenet al., 20007).
Replacement of threonine 250 with glutamine and methionine 428 with
leucine resulted in an apparent increase in serum half-life (Hinton
et al., ibid., 2006). Substitution of lysine 326 with tryptophan
and glutamate 333 with serine appeared to increase CDC activity
(Idusogie et al., ibid., 2001). These and other known modifications
to enhance antibody physiological function may be combined with
changes to variable region sequence, described herein, to produce
anti-CD20 antibodies of improved therapeutic characteristics.
[0061] In certain embodiments, the disclosed methods and
compositions may involve production and use of antibodies or
antigen-binding fragments thereof with one or more substituted
amino acid residues. As discussed below, methods for making
monoclonal antibodies against virtually any target antigen are well
known in the art. Typically, these result in production of murine
antibodies against a target antigen. As is well known in the art,
the antigen-binding specificity of murine monoclonal antibodies is
determined largely by the hypervariable complementarity determining
region (CDR) sequences. Murine antibodies generally comprise 6 CDR
sequences, 3 on the antibody light chain and 3 on the heavy chain.
As described in detail below, chimeric, humanized or human versions
of murine antibodies may be constructed by techniques such as CDR
grafting, where the murine CDR sequences are inserted into, for
example, human antibody framework and constant region sequences, or
by attaching the entire murine variable region sequences to human
antibody constant region sequences. In alternative embodiments, the
variable region sequences of an antibody may be constructed, for
example, by chemical synthesis and assembly of oligonucleotides
encoding the entire light and heavy chain variable regions of an
antibody.
[0062] In various embodiments, the structural, physical and/or
therapeutic characteristics of chimeric, humanized or human
antibodies may be optimized by replacing one or more amino acid
residues.
[0063] The skilled artisan will be aware that, in general, amino
acid substitutions typically involve the replacement of an amino
acid with another amino acid of relatively similar properties
(i.e., conservative amino acid substitutions). The properties of
the various amino acids and effect of amino acid substitution on
protein structure and function have been the subject of extensive
study and knowledge in the art.
[0064] For example, the hydropathic index of amino acids may be
considered (Kyte & Doolittle, 1982, J. Mol. Biol.,
157:105-132). The relative hydropathic character of the amino acid
contributes to the secondary structure of the resultant protein,
which in turn defines the interaction of the protein with other
molecules. Each amino acid has been assigned a hydropathic index on
the basis of its hydrophobicity and charge characteristics (Kyte
& Doolittle, 1982), these are: isoleucine (+4.5); valine
(+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine
(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4);
threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine
(-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5);
glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine
(-3.9); and arginine (-4.5). In making conservative substitutions,
the use of amino acids whose hydropathic indices are within .+-.2
is preferred, within .+-.1 are more preferred, and within .+-.0.5
are even more preferred.
[0065] Amino acid substitution may also take into account the
hydrophilicity of the amino acid residue (e.g., U.S. Pat. No.
4,554,101). Hydrophilicity values have been assigned to amino acid
residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0);
glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine
(+0.2); glycine (0); threonine (-0.4); proline (-0.5.+-0.1);
alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine
(-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine
(-2.3); phenylalanine (-2.5); tryptophan (-3.4). Replacement of
amino acids with others of similar hydrophilicity is preferred, but
not required.
[0066] Other considerations include the size of the amino acid side
chain. For example, it would generally not be preferred to replace
an amino acid with a compact side chain, such as glycine or serine,
with an amino acid with a bulky side chain, e.g., tryptophan,
tyrosine. The effect of various amino acid residues on protein
secondary structure is also a consideration. Through empirical
study, the effect of different amino acid residues on the tendency
of protein domains to adopt an alpha-helical, beta-sheet or reverse
turn secondary structure has been determined and is known in the
art (see, e.g., Chou & Fasman, 1974, Biochemistry, 13:222-245;
1978, Ann. Rev. Biochem., 47: 251-276; 1979, Biophys. J.,
26:367-384).
[0067] Based on such considerations and extensive empirical study,
tables of conservative amino acid substitutions have been
constructed and are known in the art. For example: arginine and
lysine; glutamate and aspartate; serine and threonine; glutamine
and asparagine; and valine, leucine and isoleucine. Alternatively:
Ala (A) leu, ile, val; Arg (R) gln, asn, lys; Asn (N) his, asp,
lys, arg, gln; Asp (D) asn, glu; Cys (C) ala, ser; Gln (Q) glu,
asn; Glu (E) gln, asp; Gly (G) ala; His (H) asn, gln, lys, arg; Ile
(I) val, met, ala, phe, leu; Leu (L) val, met, ala, phe, ile; Lys
(K) gln, asn, arg; Met (M) phe, ile, leu; Phe (F) leu, val, ile,
ala, tyr; Pro (P) ala; Ser (S), thr; Thr (T) ser; Trp (W) phe, tyr;
Tyr (Y) trp, phe, thr, ser; Val (V) ile, leu, met, phe, ala.
[0068] Other considerations for amino acid substitutions include
whether or not the residue is located in the interior of a protein
or is solvent exposed. For CDR residues, the residue in the free
antibody would normally be assumed to be solvent exposed. For
interior residues, conservative substitutions would include: Asp
and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and Gly; Ile
and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr
and Trp. (See, e.g., PROWL website at rockefeller.edu) For solvent
exposed residues, conservative substitutions would include: Asp and
Asn; Asp and Glu; Glu and Gln; Glu and Ala; Gly and Asn; Ala and
Pro; Ala and Gly; Ala and Ser; Ala and Lys; Ser and Thr; Lys and
Arg; Val and Leu; Leu and Ile; Ile and Val; Phe and Tyr. (Id.)
Various matrices have been constructed to assist in selection of
amino acid substitutions, such as the PAM250 scoring matrix,
Dayhoff matrix, Grantham matrix, McLachlan matrix, Doolittle
matrix, Henikoff matrix, Miyata matrix, Fitch matrix, Jones matrix,
Rao matrix, Levin matrix and Risler matrix (Idem.)
[0069] In determining amino acid substitutions, one may also
consider the existence of intermolecular or intramolecular bonds,
such as formation of ionic bonds (salt bridges) between positively
charged residues (e.g., His, Arg, Lys) and negatively charged
residues (e.g., Asp, Glu) or disulfide bonds between nearby
cysteine residues.
Preparation of Monoclonal Antibodies including Chimeric, Humanized
or Human Antibodies
[0070] Techniques for preparing monoclonal antibodies against
virtually any target antigen are well known in the art. See, for
example, Kohler and Milstein, Nature 256: 495 (1975), and Coligan
et al. (eds.), CURRENT PROTOCOLS IN IMMUNOLOGY, VOL. 1, pages
2.5.1-2.6.7 (John Wiley & Sons 1991). Briefly, monoclonal
antibodies can be obtained by injecting mice with a composition
comprising an antigen, removing the spleen to obtain B-lymphocytes,
fusing the B-lymphocytes with myeloma cells to produce hybridomas,
cloning the hybridomas, selecting positive clones which produce
antibodies to the antigen, culturing the clones that produce
antibodies to the antigen, and isolating the antibodies from the
hybridoma cultures.
[0071] MAbs can be isolated and purified from hybridoma cultures by
a variety of well-established techniques. Such isolation techniques
include affinity chromatography with Protein-A Sepharose,
size-exclusion chromatography, and ion-exchange chromatography.
See, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3. Also, see Baines et al., "Purification of
Immunoglobulin G (IgG)," in METHODS IN MOLECULAR BIOLOGY, VOL. 10,
pages 79-104 (The Humana Press, Inc. 1992).
[0072] After the initial raising of antibodies to the immunogen,
the antibodies can be sequenced and subsequently prepared by
recombinant techniques. Humanization or chimerization of murine
antibodies and antibody fragments are well known to those skilled
in the art. For example, humanized monoclonal antibodies are
produced by transferring mouse complementary determining regions
from heavy and light variable chains of the mouse immunoglobulin
into a human variable domain, and then, substituting human residues
in the framework regions of the murine counterparts. The use of
antibody components derived from humanized monoclonal antibodies
obviates potential problems associated with the immunogenicity of
murine constant regions.
[0073] Chimeric Antibodies
[0074] A chimeric antibody is a recombinant protein in which the
variable regions of a human antibody have been replaced by the
variable regions of, for example, a mouse antibody, including the
complementarity-determining regions (CDRs) of the mouse antibody.
Chimeric antibodies exhibit decreased immunogenicity and increased
stability when administered to a subject. General techniques for
cloning murine immunoglobulin variable domains are disclosed, for
example, in Orlandi et al., Proc. Nat. Acad. Sci. USA 86: 3833
(1989). Techniques for constructing chimeric antibodies are well
known to those of skill in the art. As an example, Leung et al.,
Hybridoma 13:469 (1994), produced an LL2 chimera by combining DNA
sequences encoding the V.sub..kappa. and V.sub.H domains of murine
LL2, an anti-CD22 monoclonal antibody, with respective human
.kappa. and IgG.sub.1 constant region domains.
[0075] Humanized Antibodies
[0076] Techniques for producing humanized MAbs are well known in
the art (see, e.g., Jones et al., Nature 321: 522 (1986), Riechmann
et al., Nature 332: 323 (1988), Verhoeyen et al., Science 239: 1534
(1988), Carter et al., Proc. Nat. Acad. Sci. USA 89: 4285 (1992),
Sandhu, Crit. Rev. Biotech. 12: 437 (1992), and Singer et al., J.
Immun. 150: 2844 (1993)). A chimeric or murine monoclonal antibody
may be humanized by transferring the mouse CDRs from the heavy and
light variable chains of the mouse immunoglobulin into the
corresponding variable domains of a human antibody. The mouse
framework regions (FR) in the chimeric monoclonal antibody are also
replaced with human FR sequences. As simply transferring mouse CDRs
into human FRs often results in a reduction or even loss of
antibody affinity, additional modification might be required in
order to restore the original affinity of the murine antibody. This
can be accomplished by the replacement of one or more some human
residues in the FR regions with their murine counterparts to obtain
an antibody that possesses good binding affinity to its epitope.
See, for example, Tempest et al., Biotechnology 9:266 (1991) and
Verhoeyen et al., Science 239: 1534 (1988). The affinity of
humanized antibodies for a target may also be increased by selected
modification of the CDR sequences (WO0029584A1).
[0077] Human Antibodies
[0078] Methods for producing fully human antibodies using either
combinatorial approaches or transgenic animals transformed with
human immunoglobulin loci are known in the art (e.g., Mancini et
al., 2004, New Microbiol. 27:315-28; Conrad and Scheller, 2005,
Comb. Chem. High Throughput Screen. 8:117-26; Brekke and Loset,
2003, Curr. Opin. Phamacol. 3:544-50). A fully human antibody also
can be constructed by genetic or chromosomal transfection methods,
as well as phage display technology, all of which are known in the
art. See for example, McCafferty et al., Nature 348:552-553 (1990).
Such fully human antibodies are expected to exhibit even fewer side
effects than chimeric, humanized or human antibodies and to
function in vivo as essentially endogenous human antibodies. In
certain embodiments, the claimed methods and procedures may utilize
human antibodies produced by such techniques.
[0079] In one alternative, the phage display technique may be used
to generate human antibodies (e.g., Dantas-Barbosa et al., 2005,
Genet. Mol. Res. 4:126-40). Human antibodies may be generated from
normal humans or from humans that exhibit a particular disease
state, such as cancer (Dantas-Barbosa et al., 2005). The advantage
to constructing human antibodies from a diseased individual is that
the circulating antibody repertoire may be biased towards
antibodies against disease-associated antigens.
[0080] In one non-limiting example of this methodology,
Dantas-Barbosa et al. (2005) constructed a phage display library of
human Fab antibody fragments from osteosarcoma patients. Generally,
total RNA was obtained from circulating blood lymphocytes (Id.).
Recombinant Fab were cloned from the .mu., .gamma. and .kappa.
chain antibody repertoires and inserted into a phage display
library (ld.). RNAs were converted to cDNAs and used to make Fab
cDNA libraries using specific primers against the heavy and light
chain immunoglobulin sequences (Marks et al., 1991, J. Mol. Biol.
222:581-97). Library construction was performed according to
Andris-Widhopf et al. (2000, In: Phage Display Laboratory Manual,
Barbas et al. (eds), 1.sup.st edition, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. pp. 9.1 to 9.22). The
final Fab fragments were digested with restriction endonucleases
and inserted into the bacteriophage genome to make the phage
display library. Such libraries may be screened by standard phage
display methods, as known in the art. Phage display can be
performed in a variety of formats, for their review, see e.g.,
Johnson and Chiswell, Current Opinion in Structural Biology
3:5564-571 (1993). Human antibodies may also be generated by in
vitro activated B-cells. See U.S. Pat. Nos. 5,567,610 and
5,229,275, the Examples section of each of which is incorporated
herein by reference. The skilled artisan will realize that these
techniques are exemplary and any known method for making and
screening human antibodies or antibody fragments may be
utilized.
[0081] In another alternative, transgenic animals that have been
genetically engineered to produce human antibodies may be used to
generate antibodies against essentially any immunogenic target,
using standard immunization protocols. Methods for obtaining human
antibodies from transgenic mice are disclosed by Green et al.,
Nature Genet. 7:13 (1994), Lonberg et al., Nature 368:856 (1994),
and Taylor et al., Int. Immun. 6:579 (1994). A non-limiting example
of such a system is the XenoMouse.RTM. (e.g., Green et al., 1999,
J. Immunol. Methods 231:11-23, incorporated herein by reference)
from Abgenix (Fremont, Calif.). In the XenoMouse.RTM. and similar
animals, the mouse antibody genes have been inactivated and
replaced by functional human antibody genes, while the remainder of
the mouse immune system remains intact.
[0082] The XenoMouse.RTM. was transformed with germline-configured
YACs (yeast artificial chromosomes) that contained portions of the
human IgH and Igkappa loci, including the majority of the variable
region sequences, along with accessory genes and regulatory
sequences. The human variable region repertoire may be used to
generate antibody producing B-cells, which may be processed into
hybridomas by known techniques. A XenoMouse.RTM. immunized with a
target antigen will produce human antibodies by the normal immune
response, which may be harvested and/or produced by standard
techniques discussed above. A variety of strains of XenoMouse.RTM.
are available, each of which is capable of producing a different
class of antibody. Transgenically produced human antibodies have
been shown to have therapeutic potential, while retaining the
pharmacokinetic properties of normal human antibodies (Green et
al., 1999). The skilled artisan will realize that the claimed
compositions and methods are not limited to use of the
XenoMouse.RTM. system but may utilize any transgenic animal that
has been genetically engineered to produce human antibodies.
Production of Antibody Fragments
[0083] Antibody fragments which recognize specific epitopes can be
generated by known techniques. The antibody fragments are antigen
binding portions of an antibody, such as F(ab').sub.2, Fab',
F(ab).sub.2, Fab, Fv, scFv and the like. F(ab').sub.2 fragments can
be produced by pepsin digestion of the antibody molecule and Fab'
fragments can be generated by reducing disulfide bridges of the
F(ab').sub.2fragments. Alternatively, Fab' expression libraries can
be constructed (Huse et al., 1989, Science, 246:1274-1281) to allow
rapid and easy identification of monoclonal Fab' fragments with the
desired specificity.
[0084] A single chain Fv molecule (scFv) comprises a VL domain and
a VH domain. The VL and VH domains associate to form a target
binding site. These two domains are further covalently linked by a
peptide linker (L). Methods for making scFv molecules and designing
suitable peptide linkers are described in U.S. Pat. No. 4,704,692,
U.S. Pat. No. 4,946,778, R. Raag and M. Whitlow, "Single Chain
Fvs." FASEB Vol 9:73-80 (1995) and R. E. Bird and B. W. Walker,
"Single Chain Antibody Variable Regions," TIBTECH, Vol 9: 132-137
(1991), incorporated herein by reference.
[0085] An antibody fragment can be prepared by proteolytic
hydrolysis of the full length antibody or by expression in E. coli
or another host of the DNA coding for the fragment. An antibody
fragment can be obtained by pepsin or papain digestion of full
length antibodies by conventional methods. For example, an
enzymatic cleavage using papain produces two monovalent Fab
fragments and an Fc fragment. These methods are described, for
example, by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647 and
references contained therein, which patents are incorporated herein
by reference. Also, see Nisonoff et al., Arch Biochem. Biophys. 89:
230 (1960); Porter, Biochem. J. 73: 119 (1959), Edelman et al., in
METHODS IN ENZYMOLOGY VOL. 1, page 422 (Academic Press 1967), and
Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
Bispecific and Multispecific Antibodies
[0086] Bispecific antibodies are useful in a number of biomedical
applications. For instance, a bispecific antibody with binding
sites for a tumor cell surface antigen and for a T-cell surface
receptor can direct the lysis of specific tumor cells by T cells.
Bispecific antibodies recognizing gliomas and the CD3 epitope on T
cells have been successfully used in treating brain tumors in human
patients (Nitta, et al., Lancet 1990; 355:368-371). Pre-targeting
methods with bispecific antibodies comprising at least one binding
site for a tumor-associated antigen (TAA) or other disease target,
as well as at one binding site for a targetable construct
conjugated to therapeutic or diagnostic agents, are also well known
in the art (see, e.g., U.S. Pat. Nos. 7,300,644; 7,138,103;
7,074,405; 7,052,872; 6,962,702; 6,458,933, the Examples section of
each of which is incorporated herein by reference).
[0087] Bispecific antibodies comprising the antigen-binding
variable region sequences of any known anti-TAA antibody may be
utilized, including but not limited to hPAM4 (U.S. Pat. No.
7,282,567), hA20 (U.S. Pat. No. 7,251,164), hA19 (U.S. Pat. No.
7,109,304), hIMMU31 (U.S. Pat. No. 7,300,655), hLL1 (U.S. Pat. No.
7,312,318,), hLL2 (U.S. Pat. No. 7,074,403), hMu-9 (U.S. Pat. No.
7,387,773), hL243 (U.S. patent application Ser. No. 11/368,296),
hMN-14 (U.S. Pat. No. 6,676,924), hRS7 (U.S. Pat. No. 7,238,785),
hMN-3 (U.S. patent application Ser. No. 10/672,278) and hR1 (U.S.
Provisional Patent Application Ser. No. 61/145,896, filed Jan. 20,
2009), the Examples section of each cited patent or application
incorporated herein by reference.
[0088] Other antibodies of use may be commercially obtained from a
wide variety of known sources. For example, a variety of antibody
secreting hybridoma lines are available from the American Type
Culture Collection (ATCC, Manassas, Va.). A large number of
antibodies against various disease targets, including but not
limited to tumor-associated antigens, have been deposited at the
ATCC and/or have published variable region sequences and are
available for use in the claimed methods and compositions. See,
e.g., U.S. Pat. Nos. 7,312,318; 7,282,567; 7,151,164; 7,074,403;
7,060,802; 7,056,509; 7,049,060; 7,045,132; 7,041,803; 7,041,802;
7,041,293; 7,038,018; 7,037,498; 7,012,133; 7,001,598; 6,998,468;
6,994,976; 6,994,852; 6,989,241; 6,974,863; 6,965,018; 6,964,854;
6,962,981; 6,962,813; 6,956,107; 6,951,924; 6,949,244; 6,946,129;
6,943,020; 6,939,547; 6,921,645; 6,921,645; 6,921,533; 6,919,433;
6,919,078; 6,916,475; 6,905,681; 6,899,879; 6,893,625; 6,887,468;
6,887,466; 6,884,594; 6,881,405; 6,878,812; 6,875,580; 6,872,568;
6,867,006; 6,864,062; 6,861,511; 6,861,227; 6,861,226; 6,838,282;
6,835,549; 6,835,370; 6,824,780; 6,824,778; 6,812,206; 6,793,924;
6,783,758; 6,770,450; 6,767,711; 6,764,688; 6,764,681; 6,764,679;
6,743,898; 6,733,981; 6,730,307; 6,720,15; 6,716,966; 6,709,653;
6,693,176; 6,692,908; 6,689,607; 6,689,362; 6,689,355; 6,682,737;
6,682,736; 6,682,734; 6,673,344; 6,653,104; 6,652,852; 6,635,482;
6,630,144; 6,610,833; 6,610,294; 6,605,441; 6,605,279; 6,596,852;
6,592,868; 6,576,745; 6,572;856; 6,566,076; 6,562,618; 6,545,130;
6,544,749; 6,534,058; 6,528,625; 6,528,269; 6,521,227; 6,518,404;
6,511,665; 6,491,915; 6,488,930; 6,482,598; 6,482,408; 6,479,247;
6,468,531; 6,468,529; 6,465,173; 6,461,823; 6,458,356; 6,455,044;
6,455,040, 6,451,310; 6,444,206; 6,441,143; 6,432,404; 6,432,402;
6,419,928; 6,413,726; 6,406,694; 6,403,770; 6,403,091; 6,395,276;
6,395,274; 6,387,350; 6,383,759; 6,383,484; 6,376,654; 6,372,215;
6,359,126; 6,355,481; 6,355,444; 6,355,245; 6,355,244; 6,346,246;
6,344,198; 6,340,571; 6,340,459; 6,331,175; 6,306,393; 6,254,868;
6,187,287; 6,183,744; 6,129,914; 6,120,767; 6,096,289; 6,077,499;
5,922,302; 5,874,540; 5,814,440; 5,798,229; 5,789,554; 5,776,456;
5,736,119; 5,716,595; 5,677,136; 5,587,459; 5,443,953, 5,525,338,
the Examples section of each of which is incorporated herein by
reference. These are exemplary only and a wide variety of other
antibodies and their hybridomas are known in the art. The skilled
artisan will realize that antibody sequences or antibody-secreting
hybridomas against almost any disease-associated antigen may be
obtained by a simple search of the ATCC, NCBI and/or USPTO
databases for antibodies against a selected disease-associated
target of interest. The antigen binding domains of the cloned
antibodies may be amplified, excised, ligated into an expression
vector, transfected into an adapted host cell and used for protein
production, using standard techniques well known in the art.
[0089] Numerous methods to produce bispecific or multispecific
antibodies are known, as disclosed, for example, in U.S. Patent
Application Publication No. 20050002945, filed Feb. 11, 2004, the
Examples section of which is incorporated herein by reference.
Bispecific antibodies can be produced by the quadroma method, which
involves the fusion of two different hybridomas, each producing a
monoclonal antibody recognizing a different antigenic site
(Milstein and Cuello, Nature, 1983; 305:537-540).
[0090] Another method for producing bispecific antibodies uses
heterobifunctional cross-linkers to chemically tether two different
monoclonal antibodies (Staerz, et al., Nature 1985; 314:628-631;
Perez, et al., Nature 1985; 316:354-356). Bispecific antibodies can
also be produced by reduction of each of two parental monoclonal
antibodies to the respective half molecules, which are then mixed
and allowed to reoxidize to obtain the hybrid structure (Staerz and
Bevan, Proc Natl Acad Sci USA 1986; 83:1453-1457). Another
alternative involves chemically cross-linking two or three
separately purified Fab' fragments using appropriate linkers. (See,
e.g., European Patent Application 0453082).
[0091] Other methods include improving the efficiency of generating
hybrid hybridomas by gene transfer of distinct selectable markers
via retrovirus-derived shuttle vectors into respective parental
hybridomas, which are fused subsequently (DeMonte, et al., Proc
Natl Acad Sci USA 1990, 87:2941-2945); or transfection of a
hybridoma cell line with expression plasmids containing the heavy
and light chain genes of a different antibody.
[0092] Cognate V.sub.H and V.sub.L domains can be joined with a
peptide linker of appropriate composition and length (usually
consisting of more than 12 amino acid residues) to form a
single-chain Fv (scFv) with binding activity. Methods of
manufacturing scFvs are disclosed in U.S. Pat. No. 4,946,778 and
U.S. Pat. No. 5,132,405, the Examples section of each of which is
incorporated herein by reference. Reduction of the peptide linker
length to less than 12 amino acid residues prevents pairing of
V.sub.H and V.sub.L domains on the same chain and forces pairing of
V.sub.H and V.sub.L domains with complementary domains on other
chains, resulting in the formation of functional multimers.
Polypeptide chains of V.sub.H and V.sub.L domains that are joined
with linkers between 3 and 12 amino acid residues form
predominantly dimers (termed diabodies). With linkers between 0 and
2 amino acid residues, trimers (termed triabody) and tetramers
(termed tetrabody) are favored, but the exact patterns of
oligomerization appear to depend on the composition as well as the
orientation of V-domains (V.sub.H-linker-V.sub.L or
V.sub.L-linker-V.sub.H), in addition to the linker length.
[0093] These techniques for producing multispecific or bispecific
antibodies exhibit various difficulties in terms of low yield,
necessity for purification, low stability or the
labor-intensiveness of the technique. More recently, a technique
known as "dock and lock" (DNL) has been utilized to produce
combinations of virtually any desired antibodies, antibody
fragments and other effector molecules (see, e.g., U.S. Patent
Application Publ. Nos. 20060228357 (now issued U.S. Pat. No.
7,550,143); 20060228300 (now issued U.S. Pat. No. 7,521,056);
20070086942 (now issued U.S. Pat. No. 7,534,866); 20070140966 (now
issued U.S. Pat. No. 7,527,787); 20070264265 and 20090060862 and
U.S. Ser. No. 12/418,877, filed Apr. 8, 2009, the Examples section
of each of which is incorporated herein by reference). The
technique utilizes complementary protein binding domains, referred
to as anchoring domains and dimerization and docking domains, which
bind to each other and allow the assembly of complex structures,
ranging from dimers, trimers, tetramers, quintamers and hexamers.
These form stable complexes in high yield without requirement for
extensive purification. The DNL technique allows the assembly of
monospecific, bispecific or multispecific antibodies, either as
naked antibody moieties or in combination with a wide range of
other effector molecules such as immunomodulators, enzymes,
chemotherapeutic agents, chemokines, cytokines, diagnostic agents,
therapeutic agents, radionuclides, imaging agents, anti-angiogenic
agents, growth factors, oligonucleotides, hormones, peptides,
toxins, pro-apoptotic agents, or a combination thereof. Any of the
techniques known in the art for making bispecific or multispecific
antibodies may be utilized in the practice of the presently claimed
methods.
Pre-Targeting
[0094] Bispecific or multispecific antibodies may be utilized in
pre-targeting techniques. Pre-targeting is a multistep process
originally developed to resolve the slow blood clearance of
directly targeting antibodies, which contributes to undesirable
toxicity to normal tissues such as bone marrow. With pre-targeting,
a radionuclide or other therapeutic agent is attached to a small
delivery molecule (targetable construct or targetable conjugate)
that is cleared within minutes from the blood. A pre-targeting
bispecific or multispecific antibody, which has binding sites for
the targetable construct as well as a target antigen, is
administered first, free antibody is allowed to clear from
circulation and then the targetable construct is administered.
[0095] Pre-targeting methods are well known in the art, for
example, as disclosed in Goodwin et al., U.S. Pat. No. 4,863,713;
Goodwin et al., J. Nucl. Med. 29:226, 1988; Hnatowich et al., J.
Nucl. Med. 28:1294, 1987; Oehr et al., J. Nucl. Med. 29:728, 1988;
Klibanov et al., J. Nucl. Med. 29:1951, 1988; Sinitsyn et al., J.
Nucl. Med. 30:66, 1989; Kalofonos et al., J. Nucl. Med. 31:1791,
1990; Schechter et al., Int. J. Cancer 48:167, 1991; Paganelli et
al., Cancer Res. 51:5960, 1991; Paganelli et al., Nucl. Med.
Commun. 12:211, 1991; U.S. Pat. No. 5,256,395; Stickney et al.,
Cancer Res. 51:6650, 1991; Yuan et al., Cancer Res. 51:3119, 1991;
U.S. Pat. No. 6,077,499; U.S. Ser. No. 09/597,580; U.S. Ser. No.
10/361,026; U.S. Ser. No. 09/337,756; U.S. Ser. No. 09/823,746;
U.S. Ser. No. 10/116,116; U.S. Ser. No. 09/382,186; U.S. Ser. No.
10/150,654; U.S. Pat. No. 6,090,381; U.S. Pat. No. 6,472,511; U.S.
Ser. No. 10/114,315; U.S. Provisional Application No. 60/386,411;
U.S. Provisional Application No. 60/345,641; U.S. Provisional
Application No. 60/3328,835; U.S. Provisional Application No.
60/426,379; U.S. Ser. No. 09/823,746; U.S. Ser. No. 09/337,756;
U.S. Provisional Application No. 60/342,103; and U.S. Pat. No.
6,962,702.
[0096] A pre-targeting method of treating or diagnosing a disease
or disorder in a subject may be provided by: (1) administering to
the subject a bispecific antibody or antigen binding antibody
fragment; (2) optionally administering to the subject a clearing
composition, and allowing the composition to clear the antibody
from circulation; and (3) administering to the subject the
targetable construct, containing one or more chelated or chemically
bound therapeutic or diagnostic agents. The technique may also be
utilized for antibody dependent enzyme prodrug therapy (ADEPT) by
administering an enzyme conjugated to a targetable construct,
followed by a prodrug that is converted into active form by the
enzyme.
Therapeutic and Diagnostic Agents
[0097] In certain embodiments, the antibodies, antigen binding
antibody fragments or fusion proteins described herein may be
administered alone, as a "naked" antibody, antigen binding fragment
thereof or fusion protein. In alternative embodiments, the
antibody, antigen binding fragment thereof or fusion protein may be
administered before, concurrently with, or after at least one other
therapeutic agent. In other alternatives, an antibody, antigen
binding fragment thereof or fusion protein may be covalently or
non-covalently attached to at least one therapeutic and/or
diagnostic agent to form an immunoconjugate.
[0098] Diagnostic agents are preferably selected from the group
consisting of a radionuclide, a radiological contrast agent, a
paramagnetic ion, a metal, a fluorescent label, a chemiluminescent
label, an ultrasound contrast agent and a photoactive agent. Such
diagnostic agents are well known and any such known diagnostic
agent may be used. Non-limiting examples of diagnostic agents may
include a radionuclide such as .sup.110I, .sup.111In, .sup.177,
.sup.18F, .sup.52Fe, .sup.62Cu, .sup.64Cu, .sup.67Cu, .sup.67Ga,
.sup.68Ga, .sup.86Y, .sup.90Y, .sup.89Zr, .sup.94mTc, .sup.94Tc,
.sup.99mTc, .sup.120I, .sup.123I, .sup.124I, .sup.125I, .sup.131I,
.sup.154-158Gd, .sup.32P, .sup.11C, .sup.13N, .sup.15O, .sup.186Re,
.sup.188Re, .sup.51Mn, .sup.52mMn, .sup.55Co, .sup.72As, .sup.75Br,
.sup.76Br, .sup.82mRb, .sup.83Sr, or other gamma-, beta-, or
positron-emitters. Paramagnetic ions of use may include chromium
(III), manganese (II), iron (III), iron (II), cobalt (II), nickel
(II), copper (II), neodymium (III), samarium (III), ytterbium
(III), gadolinium (III), vanadium (II), terbium (III), dysprosium
(III), holmium (III) or erbium (III). Metal contrast agents may
include lanthanum (III), gold (III), lead (II) or bismuth (III).
Ultrasound contrast agents may comprise liposomes, such as gas
filled liposomes. Radiopaque diagnostic agents may be selected from
barium compounds, gallium compounds and thallium compounds. A wide
variety of fluorescent labels are known in the art, including but
not limited to fluorescein isothiocyanate, rhodamine,
phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and
fluorescamine. Chemiluminescent labels of use may include luminol,
isoluminol, an aromatic acridinium ester, an imidazole, an
acridinium salt or an oxalate ester.
[0099] Therapeutic agents are preferably selected from the group
consisting of a radionuclide, an immunomodulator, an
anti-angiogenic agent, a cytokine, a chemokine, a growth factor, a
hormone, a drug, a prodrug, an enzyme, an oligonucleotide, an
interference RNA, a pro-apoptotic agent, a photoactive therapeutic
agent, a cytotoxic agent, which may be a chemotherapeutic agent or
a toxin, a second antibody or fragment thereof and a combination
thereof. The drugs of use may possess a pharmaceutical property
selected from the group consisting of antimitotic, antikinase,
alkylating, antimetabolite, antibiotic, alkaloid, anti-angiogenic,
pro-apoptotic agents and combinations thereof.
[0100] Exemplary drugs of use include, but are not limited to,
5-fluorouracil, aplidin, azaribine, anastrozole, anthracyclines,
bendamustine, bleomycin, bortezomib, bryostatin-1, busulfan,
calicheamycin, camptothecin, carboplatin, 10-hydroxycamptothecin,
carmustine, celebrex, chlorambucil, cisplatin (CDDP), Cox-2
inhibitors, irinotecan (CPT-11), SN-38, carboplatin, cladribine,
camptothecans, cyclophosphamide, cytarabine, dacarbazine,
docetaxel, dactinomycin, daunorubicin, doxorubicin,
2-pyrrolinodoxorubicine (2P-DOX), cyano-morpholino doxorubicin,
doxorubicin glucuronide, epirubicin glucuronide, estramustine,
epidophyllotoxin, estrogen receptor binding agents, etoposide
(VP16), etoposide glucuronide, etoposide phosphate, floxuridine
(FUdR), 3',5'-O-dioleoyl-FudR (FUdR-dO), fludarabine, flutamide,
farnesyl-protein transferase inhibitors, gemcitabine, hydroxyurea,
idarubicin, ifosfamide, L-asparaginase, lenolidamide, leucovorin,
lomustine, mechlorethamine, melphalan, mercaptopurine,
6-mercaptopurine, methotrexate, mitoxantrone, mithramycin,
mitomycin, mitotane, navelbine, nitrosurea, plicomycin,
procarbazine, paclitaxel, pentostatin, PSI-341, raloxifene,
semustine, streptozocin, tamoxifen, taxol, temazolomide (an aqueous
form of DTIC), transplatinum, thalidomide, thioguanine, thiotepa,
teniposide, topotecan, uracil mustard, vinorelbine, vinblastine,
vincristine and vinca alkaloids.
[0101] Toxins of use may include ricin, abrin, alpha toxin,
saporin, ribonuclease (RNase), e.g., onconase, DNase I,
Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin,
diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas
endotoxin.
[0102] Immunomodulators of use may be selected from a cytokine, a
stem cell growth factor, a lymphotoxin, a hematopoietic factor, a
colony stimulating factor (CSF), an interferon (IFN),
erythropoietin, thrombopoietin and a combination thereof.
Specifically useful are lymphotoxins such as tumor necrosis factor
(TNF), hematopoietic factors, such as interleukin (IL), colony
stimulating factor, such as granulocyte-colony stimulating factor
(G-CSF) or granulocyte macrophage-colony stimulating factor
(GM-CSF), interferon, such as interferons-.alpha., -.beta. or
-.gamma., and stem cell growth factor, such as that designated "S1
factor". Included among the cytokines are growth hormones such as
human growth hormone, N-methionyl human growth hormone, and bovine
growth hormone; parathyroid hormone; thyroxine; insulin;
proinsulin; relaxin; prorelaxin; glycoprotein hormones such as
follicle stimulating hormone (FSH), thyroid stimulating hormone
(TSH), and luteinizing hormone (LH); hepatic growth factor;
prostaglandin, fibroblast growth factor; prolactin; placental
lactogen, OB protein; tumor necrosis factor-.alpha. and -.beta.;
mullerian-inhibiting substance; mouse gonadotropin-associated
peptide; inhibin; activin; vascular endothelial growth factor;
integrin; thrombopoietin (TPO); nerve growth factors such as
NGF-.beta.; platelet-growth factor; transforming growth factors
(TGFs) such as TGF-.alpha. and TGF-.beta.; insulin-like growth
factor-I and -II; erythropoietin (EPO); osteoinductive factors;
interferons such as interferon-.alpha., -.beta., and -.gamma.;
colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF);
interleukins (ILs) such as IL-1, IL-1.alpha., IL-2, IL-3, IL-4,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12; IL-13, IL-14,
IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, kit-ligand or FLT-3,
Flt-1, angiostatin, thrombospondin, endostatin, tumor necrosis
factor (TNF, such as TNF-.alpha.) and LT. As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines.
[0103] Chemokines of use include RANTES, MCAF, MIP1-alpha,
MIP1-Beta and IP-10.
[0104] Radioactive isotopes useful for treating diseased tissue
include, but are not limited to--.sup.111In, .sup.177Lu,
.sup.212Bi, .sup.213Bi, .sup.211At, .sup.67Cu, .sup.90Y, .sup.125I,
.sup.131I, .sup.32P, .sup.33P, .sup.47Sc, .sup.111Ag, .sup.67Ga,
.sup.142Pr, .sup.153Sm, .sup.161Tb, .sup.166Dy, .sup.166Ho,
.sup.186Re, .sub.188Re, .sup.189Re, .sup.212Pb, .sup.223Ra,
.sup.225Ac, .sup.59Fe, .sup.75Se, .sup.77As, .sup.89Sr, .sup.99Mo,
.sup.105Rh, .sup.109Pd, .sup.143Pr, .sup.149Pm, .sup.169Er,
.sup.194Ir, .sup.198Au, .sup.199Au, and .sup.211Pb. The therapeutic
radionuclide preferably has a decay energy in the range of 20 to
6,000 keV, preferably in the ranges 60 to 200 keV for an Auger
emitter, 100-2,500 keV for a beta emitter, and 4,000-6,000 keV for
an alpha emitter. Maximum decay energies of useful
beta-particle-emitting nuclides are preferably 20-5,000 keV, more
preferably 100-4,000 keV, and most preferably 500-2,500 keV. Also
preferred are radionuclides that substantially decay with
Auger-emitting particles. For example, Co-58, Ga-67, Br-80m,
Tc-99m, Rh-103m, Pt-109, In-111, Sb-119, I-125, Ho-161, Os-189m and
Ir-192. Decay energies of useful beta-particle-emitting nuclides
are preferably <1,000 keV, more preferably <100 keV, and most
preferably <70 keV. Also preferred are radionuclides that
substantially decay with generation of alpha-particles. Such
radionuclides include, but are not limited to: Dy-152, At-211,
Bi-212, Ra-223, Rn-219, Po-215, Bi-211, Ac-225, Fr-221, At-217,
Bi-213 and Fm-255. Decay energies of useful alpha-particle-emitting
radionuclides are preferably 2,000-10,000 keV, more preferably
3,000-8,000 keV, and most preferably 4,000-7,000 keV. Additional
potential radioisotopes of use include .sup.11C, .sup.13N,
.sup.15O, .sup.75Br, .sup.198Au, .sup.224Ac, .sup.126I, .sup.133I,
.sup.77Br, .sup.113mIn, .sup.95Ru, .sup.97Ru, .sup.103Ru,
.sup.105Ru, .sup.107Hg, .sup.203Hg, .sup.121mTe, .sup.122mTe,
.sup.125mTe, .sup.165Tm, .sup.167Tm, .sup.168Tm, .sup.197Pt,
.sup.109Pd, .sup.105Rh, .sup.142Pr, .sup.143Pr, .sup.161Tb,
.sup.166Ho, .sup.199Au, .sup.57Co, .sup.58Co, .sup.51Cr, .sup.59Fe,
.sup.75Se, .sup.201Tl, .sup.225Ac, .sup.76Br, .sup.169Yb, and the
like. Some useful diagnostic nuclides may include .sup.124I,
.sup.123I, .sup.131I, .sup.18F, .sup.52Fe, .sup.62Cu, .sup.64Cu,
.sup.67Cu, .sup.67Ga, .sup.67Ga, .sup.86Y, .sup.89Zr, .sup.94Tc,
.sup.94mTc, .sup.99mTc, or .sup.111In.
[0105] Therapeutic agents may include a photoactive agent or dye.
Fluorescent compositions, such as fluorochrome, and other
chromogens, or dyes, such as porphyrins sensitive to visible light,
have been used to detect and to treat lesions by directing the
suitable light to the lesion. In therapy, this has been termed
photoradiation, phototherapy, or photodynamic therapy. See Jori et
al. (eds.), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES
(Libreria Progetto 1985); van den Bergh, Chem. Britain (1986),
22:430. Moreover, monoclonal antibodies have been coupled with
photoactivated dyes for achieving phototherapy. See Mew et al., J.
Immunol. (1983),130:1473; idem., Cancer Res. (1985), 45:4380;
Oseroff et al., Proc. Natl. Acad. Sci. USA (1986), 83:8744; idem.,
Photochem. Photobiol. (1987), 46:83; Hasan et al., Prog. Clin.
Biol. Res. (1989), 288:471; Tatsuta et al., Lasers Surg. Med.
(1989), 9:422; Pelegrin et al., Cancer (1991), 67:2529.
[0106] Corticosteroid hormones can increase the effectiveness of
other chemotherapy agents, and consequently, they are frequently
used in combination treatments. Prednisone and dexamethasone are
examples of corticosteroid hormones.
[0107] In certain embodiments, anti-angiogenic agents, such as
angiostatin, baculostatin, canstatin, maspin, anti-VEGF antibodies,
anti-P1GF peptides and antibodies, anti-vascular growth factor
antibodies, anti-Flk-1 antibodies, anti-Flt-1 antibodies and
peptides, anti-Kras antibodies, anti-cMET antibodies, anti-MIF
(macrophage migration-inhibitory factor) antibodies, laminin
peptides, fibronectin peptides, plasminogen activator inhibitors,
tissue metalloproteinase inhibitors, interferons, interleukin-12,
IP-10, Gro-.beta., thrombospondin, 2-methoxyoestradiol,
proliferin-related protein, carboxiamidotriazole, CM101,
Marimastat, pentosan polysulphate, angiopoietin-2,
interferon-alpha, herbimycin A, PNU145156E, 16K prolactin fragment,
Linomide, thalidomide, pentoxifylline, genistein, TNP-470,
endostatin, paclitaxel, accutin, angiostatin, cidofovir,
vincristine, bleomycin, AGM-1470, platelet factor 4 or minocycline
may be of use.
[0108] Other useful therapeutic agents comprise oligonucleotides,
especially antisense oligonucleotides that preferably are directed
against oncogenes and oncogene products of B-cell malignancies,
such as bcl-2. Preferred antisense oligonucleotides include those
known as siRNA or RNAi.
Immunoconjugates
[0109] Any of the antibodies, antigen binding antibody fragments or
antibody fusion proteins described herein may be conjugated to one
or more therapeutic or diagnostic agents. The therapeutic agents do
not need to be the same but can be different, e.g., a drug and a
radioisotope. For example, .sup.131I can be incorporated into a
tyrosine of an antibody or fusion protein and a drug attached to an
epsilon amino group of a lysine residue. Therapeutic and diagnostic
agents also can be attached, for example to reduced SH groups
and/or to carbohydrate side chains. Many methods for making
covalent or non-covalent conjugates of therapeutic or diagnostic
agents with antibodies or fusion proteins are known in the art and
any such known method may be utilized.
[0110] A therapeutic or diagnostic agent can be attached at the
hinge region of a reduced antibody component via disulfide bond
formation. Alternatively, such agents can be attached using a
heterobifunctional cross-linker, such as N-succinyl
3-(2-pyridyldithio)propionate (SPDP). Yu et al., Int. J. Cancer 56:
244 (1994). General techniques for such conjugation are well-known
in the art. See, for example, Wong, CHEMISTRY OF PROTEIN
CONJUGATION AND CROSS-LINKING (CRC Press 1991); Upeslacis et al.,
"Modification of Antibodies by Chemical Methods," in MONOCLONAL
ANTIBODIES: PRINCIPLES AND APPLICATIONS, Birch et al. (eds.), pages
187-230 (Wiley-Liss, Inc. 1995); Price, "Production and
Characterization of Synthetic Peptide-Derived Antibodies," in
MONOCLONAL ANTIBODIES: PRODUCTION, ENGINEERING AND CLINICAL
APPLICATION, Ritter et al. (eds.), pages 60-84 (Cambridge
University Press 1995). Alternatively, the therapeutic or
diagnostic agent can be conjugated via a carbohydrate moiety in the
Fc region of the antibody. The carbohydrate group can be used to
increase the loading of the same agent that is bound to a thiol
group, or the carbohydrate moiety can be used to bind a different
therapeutic or diagnostic agent.
[0111] Methods for conjugating peptides to antibody components via
an antibody carbohydrate moiety are well-known to those of skill in
the art. See, for example, Shih et al., Int. J. Cancer 41: 832
(1988); Shih et al., Int. J. Cancer 46: 1101 (1990); and Shih et
al., U.S. Pat. No. 5,057,313, incorporated herein by reference. The
general method involves reacting an antibody component having an
oxidized carbohydrate portion with a carrier polymer that has at
least one free amine function. This reaction results in an initial
Schiff base (imine) linkage, which can be stabilized by reduction
to a secondary amine to form the final conjugate.
[0112] The Fc region may be absent if the antibody used as the
antibody component of the immunoconjugate is an antigen binding
antibody fragment. However, it is possible to introduce a
carbohydrate moiety into the light chain variable region of a full
length antibody or antigen binding antibody fragment. See, for
example, Leung et al., J. Immunol. 154: 5919 (1995); Hansen et al.,
U.S. Pat. No. 5,443,953 (1995), Leung et al., U.S. Pat. No.
6,254,868, each incorporated herein by reference. The engineered
carbohydrate moiety is used to attach the therapeutic or diagnostic
agent.
[0113] In some embodiments, a chelating agent may be attached to an
antibody, antigen binding antibody fragment or fusion protein or to
a targetable construct and used to chelate a therapeutic or
diagnostic agent, such as a radionuclide. Exemplary chelators
include but are not limited to DTPA (such as Mx-DTPA), DOTA, TETA,
NETA or NOTA. Methods of conjugation and use of chelating agents to
attach metals or other ligands to proteins are well known in the
art (see, e.g., U.S. patent application Ser. No. 12/112,289, the
Examples section of which is incorporated herein by reference).
[0114] In certain embodiments, radioactive metals or paramagnetic
ions may be attached to proteins or peptides by reaction with a
reagent having a long tail, to which may be attached a multiplicity
of chelating groups for binding ions. Such a tail can be a polymer
such as a polylysine, polysaccharide, or other derivatized or
derivatizable chains having pendant groups to which can be bound
chelating groups such as, e.g., ethylenediaminetetraacetic acid
(EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrins,
polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and
like groups known to be useful for this purpose.
[0115] Chelates may be directly linked to antibodies or peptides,
for example as disclosed in U.S. Pat. No. 4,824,659, incorporated
herein by reference. Particularly useful metal-chelate combinations
include 2-benzyl-DTPA and its monomethyl and cyclohexyl analogs,
used with diagnostic isotopes in the general energy range of 60 to
4,000 keV, such as .sup.125I, .sup.131I, .sup.123I, .sup.124I,
.sup.62Cu, .sup.64Cu, .sup.18F, .sup.111In, .sup.67Ga, .sup.68Ga,
.sup.99mTc, .sup.94mTc, .sup.11C, .sup.13N, .sup.15O, .sup.76Br,
for radio-imaging. The same chelates, when complexed with
non-radioactive metals, such as manganese, iron and gadolinium are
useful for MRI. Macrocyclic chelates such as NOTA, DOTA, and TETA
are of use with a variety of metals and radiometals, most
particularly with radionuclides of gallium, yttrium and copper,
respectively. Such metal-chelate complexes can be made very stable
by tailoring the ring size to the metal of interest. Other
ring-type chelates such as macrocyclic polyethers, which are of
interest for stably binding nuclides, such as .sup.223Ra for RAIT
are encompassed.
[0116] More recently, methods of .sup.18F-labeling of use in PET
scanning techniques have been disclosed, for example by reaction of
F-18 with a metal or other atom, such as aluminum. The .sup.18F-Al
conjugate may be complexed with chelating groups, such as DOTA,
NOTA or NETA that are attached directly to antibodies or used to
label targetable constructs in pre-targeting methods. Such F-18
labeling techniques are disclosed in U.S. patent application Ser.
No. 12/112,289, the Examples section of which is incorporated
herein by reference.
Methods of Therapeutic Treatment
[0117] Various embodiments concern methods of treating a B-cell
lymphoma or leukemia cell disease or an autoimmune disease in a
subject, such as a mammal, including humans, domestic or companion
pets, such as dogs and cats, comprising administering to the
subject a therapeutically effective amount of an antibody, antigen
binding fragment thereof or fusion protein. In preferred
embodiments, the antibody or antigen binding fragment thereof is an
anti-CD20 MAb. In certain embodiments, the therapy may utilize a
"naked antibody" that does not have a therapeutic agent bound to
it.
[0118] The administration of a "naked" anti-CD20 antibody can be
supplemented by administering concurrently or sequentially a
therapeutically effective amount of another "naked antibody" that
binds to or is reactive with another antigen on the surface of the
target cell. Preferred additional MAbs comprise at least one
humanized, chimeric or human MAb selected from the group consisting
of a MAb reactive with CD4, CD5, CD8, CD14, CD15, CD16, CD19, CD20,
CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L,
CD45, CD46, CD52, CD54, CD70, CD74, CD79a, CD80, CD95, CD126,
CD133, CD138, CD154, CEACAM6, B7, MUC1, MUC2, MUC3, MUC4, 1a,
HM1.24, HLA-DR, tenascin, Flt-1, Flt-3, VEGFR, P1GF, ILGF, ILGF-1R,
IL-6, IL-25, tenascin, MIF, complement factor C5, an oncogene,
oncogene product, bcl-2, bcl-6, Kras, cMET, or a combination
thereof.
[0119] Both the naked anti-CD20 therapy alone or in combination
with other naked MAbs can be further supplemented with the
administration, either concurrently or sequentially, of at least
one therapeutic agent, as discussed above. Multimodal therapies may
include therapy with naked anti-CD20 antibodies supplemented with
administration of anti-CD22, anti-CD19, anti-CD21, anti-CD74,
anti-CD80, anti-CD23, anti-CD45, or HLA-DR (including the invariant
chain) antibodies in the form of naked antibodies, fusion proteins,
or as immunoconjugates. Immunoconjugates may comprise an antibody
or antigen binding fragment thereof conjugated to one or more of
any therapeutic and/or diagnostic agent as discussed above. The
naked anti-CD20 antibodies or antigen binding fragments thereof may
also be supplemented with naked antibodies against a MUC1 antigen
that is expressed on certain B-cells. Various antibodies of use,
such as anti-CD19 and anti-CD22 antibodies, are known to those of
skill in the art. See, for example, Ghetie et al., Cancer Res.
48:2610 (1988); Hekman et al., Cancer Immunol. Immunother. 32:364
(1991); Longo, Curr. Opin. Oncol. 8:353 (1996), U.S. Pat. Nos.
5,798,554; 6,187,287; 6,306,393; 6,676,924; 7,109,304; 7,151,164;
7,230,084; 7,230,085; 7,238,785; 7,238,786; 7,282,567; 7,300,655;
7,312,318; and U.S. Patent Application Publ. Nos. 20080131363;
20080089838; 20070172920; 20060193865; 20060210475; 20080138333;
and 20080146784, the Examples section of each listed patent or
patent application incorporated herein by reference.
[0120] In another form of multimodal therapy, subjects receive
naked anti-CD20 antibodies, and/or immunoconjugates, in conjunction
with standard cancer chemotherapy. For example, "CVB" (1.5
g/m.sup.2 cyclophosphamide, 200-400 mg/m.sup.2 etoposide, and
150-200 mg/m.sup.2 carmustine) is a regimen used to treat
non-Hodgkin's lymphoma. Patti et al., Eur. J. Haematol. 51: 18
(1993). Other suitable combination chemotherapeutic regimens are
well-known to those of skill in the art. See, for example, Freedman
et al., "Non-Hodgkin's Lymphomas," in CANCER MEDICINE, VOLUME 2,
3rd Edition, Holland et al. (eds.), pages 2028-2068 (Lea &
Febiger 1993). As an illustration, first generation
chemotherapeutic regimens for treatment of intermediate-grade
non-Hodgkin's lymphoma (NHL) include C-MOPP (cyclophosphamide,
vincristine, procarbazine and prednisone) and CHOP
(cyclophosphamide, doxorubicin, vincristine, and prednisone). A
useful second generation chemotherapeutic regimen is m-BACOD
(methotrexate, bleomycin, doxorubicin, cyclophosphamide,
vincristine, dexamethasone and leucovorin), while a suitable third
generation regimen is MACOP-B (methotrexate, doxorubicin,
cyclophosphamide, vincristine, prednisone, bleomycin and
leucovorin). Additional useful drugs include phenyl butyrate,
bendamustine, and bryostatin-1. In a preferred multimodal therapy,
both chemotherapeutic drugs and cytokines are co-administered with
an antibody, immunoconjugate or fusion protein, preferably
comprising an anti-CD20 antibody or antigen binding fragment
thereof. Generally, co-administration would refer to the
simultaneous administration of two or more agents, such as an
antibody and a therapeutic agent. The cytokines, chemotherapeutic
drugs and antibody or immunoconjugate can be administered in any
order, or together.
[0121] Immunoconjugates or naked antibodies can be formulated
according to known methods to prepare pharmaceutically useful
compositions, whereby the immunoconjugate or naked antibody is
combined in a mixture with a pharmaceutically suitable excipient.
Sterile phosphate-buffered saline is one example of a
pharmaceutically suitable excipient. Other suitable excipients are
well-known to those in the art. See, for example, Ansel et al.,
PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition
(Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S
PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company
1990), and revised editions thereof.
[0122] The immunoconjugate or naked antibody can be formulated for
intravenous administration via, for example, bolus injection or
continuous infusion. Preferably, the antibody is infused over a
period of less than about 4 hours, and more preferably, over a
period of less than about 3 hours. For example, the first 25-50 mg
could be infused within 30 minutes, preferably even 15 min, and the
remainder infused over the next 2-3 hrs. Formulations for injection
can be presented in unit dosage form, e.g., in ampoules or in
multi-dose containers, with an added preservative. The compositions
can take such forms as suspensions, solutions or emulsions in oily
or aqueous vehicles, and can contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Alternatively,
the active ingredient can be in powder form for constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0123] Additional pharmaceutical methods may be employed to control
the duration of action of the therapeutic or diagnostic conjugate
or naked antibody. Control release preparations can be prepared
through the use of polymers to complex or adsorb the
immunoconjugate or naked antibody. For example, biocompatible
polymers include matrices of poly(ethylene-co-vinyl acetate) and
matrices of a polyanhydride copolymer of a stearic acid dimer and
sebacic acid. Sherwood et al., Bio/Technology 10: 1446 (1992). The
rate of release of an immunoconjugate or antibody from such a
matrix depends upon the molecular weight of the immunoconjugate or
antibody, the amount of immunoconjugate, antibody within the
matrix, and the size of dispersed particles. Saltzman et al.,
Biophys. J. 55: 163 (1989); Sherwood et al., supra. Other solid
dosage forms are described in Ansel et al., PHARMACEUTICAL DOSAGE
FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger
1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th
Edition (Mack Publishing Company 1990), and revised editions
thereof.
[0124] The immunoconjugate, antibody fusion proteins, or naked
antibody may also be administered to a mammal subcutaneously or
even by other parenteral routes. Moreover, the administration may
be by continuous infusion or by single or multiple boluses.
Preferably, the antibody is infused over a period of less than
about 4 hours, and more preferably, over a period of less than
about 3 hours. This is preferably performed by infusing slowly at
first. For example, a dose of 25 to 50 mg is infused within 15-30
minutes and the remainder of the dose is infused over a period of
up to 2-3 hrs.
[0125] Generally, the dosage of an administered immunoconjugate,
fusion protein or naked antibody for humans will vary depending
upon such factors as the patient's age, weight, height, sex,
general medical condition and previous medical history. With
therapeutic antibodies of lower efficacy than veltuzumab, it may be
desirable to provide the recipient with a dosage of
immunoconjugate, antibody fusion protein or naked antibody that is
in the range of from about 1 mg/kg to 20 mg/kg as a single
intravenous infusion, although a lower or higher dosage also may be
administered as circumstances dictate. Dosages may range from 1 to
20, 5 to 10, 2 to 10, 10 to 20, 5 to 15, 1 to 10, 1 to 5, 2 to 5
mg/kg or any range in between 1 and 20 mg/kg. The dosage may be
repeated as needed, for example, once per week for 4-10 weeks, once
per week for 8 weeks, once per week for 4 weeks, or twice or
3-times per week for 2-8 weeks. It may also be given less
frequently, such as every other week for several months, or monthly
or quarterly for many months, as needed in a maintenance
therapy.
[0126] Alternatively, an antibody such as a naked anti-CD20 MAb,
may be administered as one dosage every 2 or 3 weeks, repeated for
a total of at least 3 dosages. Or, the antibodies may be
administered once per week for 4-8 weeks. If the dosage is lowered
to approximately 200-300 mg/m.sup.2 (340 mg per dosage for a
1.7-m.sup.2 patient, or 4.9 mg/kg for a 70 kg patient) or less, it
may be administered once weekly for 4 to 8 weeks. Alternatively,
the dosage schedule may be decreased, namely every 2 or 3 weeks for
2-3 months. The dosing schedule can optionally be repeated at other
intervals and dosage may be given through various parenteral
routes, with appropriate adjustment of the dose and schedule.
[0127] In an exemplary embodiment, NHL or an autoimmune disease may
be treated with 4 weekly infusions of a humanized anti-CD20
antibody at a dose of 100-400 mg/m.sup.2 weekly for 4 consecutive
weeks (i.v. (intravenously) over 2-6 hours), repeated as needed
over the next months/yrs. Alternatively, the humanized anti-CD20
antibody may be administered at a dose of 100-300 mg/m.sup.2 once
every other week or every third week, for 4 to 8 injections. In
another alternative, NHL may be treated with 4 weekly infusions as
above, or injections less frequently as above, but combined with
epratuzumab (anti-CD22 humanized antibody) on the same days, at a
dose of 360 mg/m.sup.2, given as i.v. (intravenously) infusion over
1 hour, either before, during or after the anti-CD20 monoclonal
antibody infusion. Or, the antibodies used in combination therapy
may also be infused in alternative sequences, such that they are
alternated on different weeks, resulting in each being given every
other week for a total injection sequence for each of 4 to 8 or
more doses. These dosage schedules may then be repeated at
different intervals, such as every 3-6 months, depending on the
patient's clinical status and response to each therapy regimen. In
a further alternative, NHL may be treated with 4 weekly infusions,
or less frequent infusions, of an anti-CD20 antibody, combined with
one or more injections of CD22 MAb radiolabeled with a therapeutic
isotope such as yttrium-90 (at a total dose of Y-90 between 5 and
35 mCi/meter-square as one or more injections over a period of
weeks or months). U.S. Ser. No. 09/590,284, incorporated herein by
reference, discloses immunotherapy of autoimmune disorders using an
anti-CD22 antibody.
[0128] In preferred embodiments, a naked or conjugated anti-CD20
antibody that has been engineered to be particularly efficacious,
such as veltuzumab, may be administered at very low dosages for
treatment of diseases such as B-cell diseases, such as B-cell
lymphomas or leukemias, systemic lupus erythematosus, follicular
lymphoma, non-Hodgkin's lymphoma or immune thrombocytopenic
purpura, or pemphigus vulgaris, as well as such immune diseases as
GVHD, hemolytic anemia, cryoglobulinemia, allosensitization, and
organ transplant rejection. As described in the following Examples,
doses as low as 80 mg or less of veltuzumab, more preferably 50 mg
or less, most preferably 30 mg or less, may be efficacious when
administered to a human subject. Such dosages may preferably be
administered two or more times to the subject at an interval of
about one to three weeks, and may even be given more than once
weekly, e.g., twice or thrice weekly, such as in a fractionated
dosing which may continue over several weeks (which may be
preferred in certain diseases, such as, for example, chronic
lymphocytic leukemia). Surprisingly, such low doses of highly
efficacious anti-CD20 antibodies such as veltuzumab have been found
to be effective to deplete circulating B-cells and/or to inhibit
the growth of B-cell related tumors. Administration of low dosage
anti-CD20 antibodies is preferably by intravenous or subcutaneous
delivery.
[0129] As described in the Examples below, preferred protocols for
low-dosage administration of veltuzumab have been found to work
well in the practice of the claimed methods and may be utilized.
For example, in a mouse model system of Burkitt lymphoma, a single
i.p. (intraperitoneal) or s.c. (subcutaneously) injection of as low
as 5 .mu.g veltuzumab per 20 .mu.m mouse produced a significant
decrease in mortality compared to controls (Example 13).
Extrapolating to a 70 kg human the 5 .mu.g dosage would be
equivalent to a single 17.5 mg injection of veltuzumab. A higher
mouse dosage of 20 .mu.g veltuzumab (equivalent to 70 mg for a 70
kg individual), administered as a single i.p. or s.c. injection,
resulted in a four-fold increase in mean survival time (Example
13). Dosages in mice as low as 0.05 .mu.g single dose (equivalent
to 0.175 mg for a 70 kg individual) still resulted in a significant
improvement in survival relative to controls, with a two-fold
increase in mean survival time. While such low dosages may produce
significant improvement relative to controls, the effective
treatment of B-cell related diseases may utilize somewhat higher
dosages for better therapeutic effects. Non-limiting examples
include administration of 80 mg i.v. veltuzumab in 2 doses at an
interval of two weeks (Example 15), 4 once-weekly doses of 138 mg
(80 mg/m.sup.2) i.v. veltuzumab (Example 15), 4 doses of 80 mg
veltuzumab administered s.c. at two week intervals (Example 15), 4
weekly doses of 80 mg/m.sup.2 i.v. veltuzumab (Example 15), 2 doses
of 10 mg veltuzumab s.c. at two week interval (Example 17), doses
of 40 mg veltuzumab s.c. twice weekly for 6 weeks (Example 18), 2
doses of 40 mg veltuzumab s.c. 2 weeks apart (Example 19), 3 doses
of 120 mg veltuzumab s.c. weekly(Example 20), an initial i.v.
injection of 15 mg veltuzumab followed by 40 mg s.c. weekly for 3
weeks (Example 21), 4 s.c. injections of 40 mg veltuzumab at zero,
8, 12 and 21 days (Example 22) and 4 s.c. injections of 80 mg
veltuzumab two weeks apart (Example 16). It is noteworthy that in
the latter case (Example 16), a single s.c. injection of 80 mg
veltuzumab produced a significant regression of a tumor neck mass
and rapid depletion of circulating B-cells. Example 24 shows that 4
once-weekly doses of veltuzumab as low as 80 mg/m.sup.2 resulted in
complete responses in at least some human patients with NHL.
[0130] The skilled artisan will realize that the disclosed dosages
of veltuzumab are exemplary only and that other non-limiting
dosages may be utilized in the practice of the claimed methods,
such as 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95 or 100 mg veltuzumab (total dose) or 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100
mg/m.sup.2 veltuzumab, administered i.v. or more preferably s.c.
Potential useful ranges of In certain embodiments, veltuzumab may
be provided in the form of prefilled syringes or autoinjection
pens, formulated for s.c., i.v. or other parenteral injection, at a
dosage of 10 to 180, 10 to 100 mg, 20 to 80 mg, 30 to 60 mg, 40 to
50 mg or any other range of dosages.
[0131] Exemplary ranges of low-dosage veltuzumab for s.c., i.v. or
i.p. administration may be less than 1 mg, 1 to 2 mg, 1 to 5 mg, 1
to 10 mg, 1 to 20 mg, 1 to 50 mg, 1 to 75 mg, 1 to 100 mg, 2 to 5
mg, 2 to 10 mg, 2 to 20 mg, 2 to 50 mg, 2 to 75 mg, 2 to 100 mg, 5
to 10 mg, 5 to 20 mg, 5 to 30 mg, 5 to 40 mg, 5 to 50 mg, 5 to 60
mg, 5 to 75 mg, 5 to 100 mg, 10 to 20 mg, 10 to 30 mg, 10 to 40 mg,
10 to 50 mg, 10 to 60 mg, 10 to 75 mg, 10 to 100 mg, 20 to 30 mg,
20 to 40 mg, 20 to 50 mg, 20 to 60 mg, 20 to 75 mg, 20 to 100 mg,
25 to 40 mg, 25 to 50 mg, 25 to 60 mg, 25 to 75 mg, 25 to 100 mg,
30 to 40 mg, 30 to 50 mg, 30 to 60 mg, 30 to 75 mg, 30 to 100 mg,
40 to 50 mg, 40 to 60 mg, 40 to 75 mg, 40 to 100 mg, 50 to 60 mg,
50 to 75 mg, 50 to 100 mg, 60 to 70 mg, 60 to 80 mg, 60 to 90 mg,
60 to 100 mg or 75 to 100 mg. Alternatively, the same ranges in
mg/m.sup.2 may be administered to a human subject. As discussed in
the Examples below, such low dosages of veltuzumab have been shown
to be effective at least in animal model systems and some exemplary
human subjects with B-cell related leukemias or lymphomas or
autoimmune diseases, or other immune diseases.
[0132] The compositions described herein are particularly useful
for treatment of various autoimmune diseases as well as indolent
forms of B-cell lymphomas, aggressive forms of B-cell lymphomas,
chronic lymphatic leukemias, acute lymphatic leukemias, and
Waldenstro's macroglobulinemia, as well as GVHD, cryoglobulinemia,
hemolytic anemia, allosensitization, and organ transplant
rejection. For example, the humanized anti-CD20 antibody components
and immunoconjugates can be used to treat both indolent and
aggressive forms of non-Hodgkin's lymphoma, various autoimmune
diseases (e.g., rheumatoid arthritis, SLE, Sjogren's syndrome,
pemphigus vulgaris, immune thrombocytopenic purpura), and various
other immune diseases (organ transplant rejection, such as kidney
and heart rejection, GVHD after allogeneic stem cell transplantion,
and immune hemolytic anemia).
[0133] As discussed supra, the antibodies can be used for treating
B-cell lymphoma and leukemia, and other B-cell diseases or
disorders. Exemplary types of cancers that may be targeted include
acute lymphoblastic leukemia, chronic lymphocytic leukemia,
Hodgkin's lymphoma, non-Hodgkin's lymphoma and multiple
myeloma.
[0134] Anti-CD20 antibodies can be used to treat B-cell related
autoimmune diseases, including Class III autoimmune diseases such
as immune-mediated thrombocytopenias (acute idiopathic
thrombocytopenic purpura and chronic idiopathic thrombocytopenic
purpura0, dermatomyositis, Sjogren's syndrome, multiple sclerosis,
Sydenham's chorea, myasthenia gravis, systemic lupus erythematosus,
lupus nephritis, rheumatic fever, rheumatoid arthritis,
polyglandular syndromes, bullous pemphigoid, diabetes mellitus,
Henoch-Schonlein purpura, post-streptococcal nephritis, erythema
nodosum, Takayasu's arteritis, Addison's disease, sarcoidosis,
ulcerative colitis, erythema multiforme, IgA nephropathy,
polyarteritis nodosa, ankylosing spondylitis, Goodpasture's
syndrome, thromboangitis obliterans, primary biliary cirrhosis,
Hashimoto's thyroiditis, thyrotoxicosis, scleroderma, chronic
active hepatitis, polymyositis/dermatomyositis, polychondritis,
pemphigus vulgaris, Wegener's granulomatosis, membranous
nephropathy, amyotrophic lateral sclerosis, tabes dorsalis, giant
cell arteritis/polymyalgia, pernicious anemia, rapidly progressive
glomerulonephritis and fibrosing alveolitis.
[0135] Anti-CD20 antibodies may also induce apoptosis in cells
expressing the CD20 antigen. For example, it was demonstrated that
apoptosis could be induced using lymphoid cells that have
Fc-receptors reactive with the IgG1-Fc of CD20 MAbs that are
crosslinked. See Shan et al., Cancer Immunol. Immunother.
48(12):673-683 (2000). Further, it was reported that aggregates of
a chimeric CD20 MAb, i.e., homopolymers, induced apoptosis. See
Ghetie et al., Blood 97(5): 1392-1398 (2000) and Ghetie et al.,
Proc. Natl. Acad. Sci USA 94(14): 7509-7514 (1997).
Kits
[0136] Various embodiments may concern kits containing components
suitable for treating or diagnosing diseased tissue in a patient.
Exemplary kits may contain at least one antibody, antigen binding
fragment or fusion protein as described herein. If the composition
containing components for administration is not formulated for
delivery via the alimentary canal, such as by oral delivery, a
device capable of delivering the kit components through some other
route may be included. One type of device, for applications such as
parenteral delivery, is a syringe that is used to inject the
composition into the body of a subject. Inhalation devices may also
be used. In certain embodiments, an anti-CD20 antibody or antigen
binding fragment thereof, such as veltuzumab, may be provided in
the form of a prefilled syringe or autoinjection pen containing a
sterile, liquid formulation or lyophilized preparation of antibody
(e.g., Kivitz et al., Clin. Ther. 2006, 28:1619-29).
[0137] The kit components may be packaged together or separated
into two or more containers. In some embodiments, the containers
may be vials that contain sterile, lyophilized formulations of a
composition that are suitable for reconstitution. A kit may also
contain one or more buffers suitable for reconstitution and/or
dilution of other reagents. Other containers that may be used
include, but are not limited to, a pouch, tray, box, tube, or the
like. Kit components may be packaged and maintained sterilely
within the containers. Another component that can be included is
instructions to a person using a kit for its use.
Expression Vectors
[0138] Still other embodiments may concern DNA sequences comprising
a nucleic acid encoding an antibody, antigen binding fragment
thereof, fusion protein or bispecific antibody. Exemplary sequences
that may be encoded and expressed include an anti-CD20 MAb or
antigen binding fragment thereof, a fusion protein comprising at
least one anti-CD20 antibody or antigen binding fragments thereof,
a fusion protein comprising at least one first antibody or antigen
binding fragment thereof and at least one second antibody or
antigen binding fragment thereof. The first and second antibodies
may comprise an anti-CD20 antibody, an antibody against a tumor or
B-cell associated antigen such as B7, CD4, CD5, CD8 CD14, CD15,
CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37,
CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59, CD70, CD74,
CD79a, CD80, CD95, CD126, CD133, CD138, CD154, CEACAM6, ED-B
fibronectin, IL-2, IL-6, IL-25, MUC1, MUC2, MUC3, MUC4, MIF,
NCA-66, Ia, HM1.24, HLA-DR, tenascin, T101, TAC, TRAIL-R1,
TRAIL-R2, VEGFR, EGFR, PlGF, ILGF, ILGF-1R, Flt-1, Flt-3, tenascin,
complement factor C5, an oncogene product, Kras, cMET, bcl-2,
bcl-6, and/or a hapten on a targetable construct.
[0139] Various embodiments relate to expression vectors comprising
the coding DNA sequences. The vectors may contain sequences
encoding the light and heavy chain constant regions and the hinge
region of a human immunoglobulin to which may be attached chimeric,
humanized or human variable region sequences. The vectors may
additionally contain promoters that express MAbs in a selected host
cell, immunoglobulin enhancers and signal or leader sequences.
Vectors that are particularly useful are pdHL2 or GS. More
preferably, the light and heavy chain constant regions and hinge
region may be from a human EU myeloma immunoglobulin, where
optionally at least one of the amino acid in the allotype positions
is changed to that found in a different IgG1 allotype, and wherein
optionally amino acid 253 of the heavy chain of EU based on the EU
number system may be replaced with alanine. See Edelman et al.,
Proc. Natl. Acad. Sci USA 63: 78-85 (1969).
[0140] Also encompassed is a method of expressing antibodies or
antigen binding fragments thereof or fusion proteins. The skilled
artisan will realize that methods of genetically engineering
expression constructs and insertion into host cells to express
engineered proteins are well known in the art and a matter of
routine experimentation. Host cells and methods of expression of
cloned antibodies or antigen binding fragments have been described,
for example, in U.S. patent application Ser. No. 11/187,863, filed
Jul. 25, 2005; Ser. No. 11/253,666, filed Oct. 20, 2005 and Ser.
No. 11/487,215, filed Jul. 14, 2006, the Examples section of each
of which is incorporated herein by reference.
General Techniques for Construction of Anti-CD20 Antibodies
[0141] The V.kappa. (variable light chain) and V.sub.H (variable
heavy chain) sequences for anti-CD20 antibodies may be obtained by
a variety of molecular cloning procedures, such as RT-PCR, 5'-RACE,
and cDNA library screening. Specifically, the V genes of an
anti-CD20 MAb from a cell that expresses a murine anti-CD20 MAb can
be cloned by PCR amplification and sequenced. To confirm their
authenticity, the cloned V.sub.L and V.sub.H genes can be expressed
in cell culture as a chimeric Ab as described by Orlandi et al.,
(Proc. Natl. Acad. Sci., USA, 86: 3833 (1989)). Based on the V gene
sequences, a humanized anti-CD20 MAb can then be designed and
constructed as described by Leung et al. (Mol. Immunol., 32: 1413
(1995)).
[0142] cDNA can be prepared from any known hybridoma line or
transfected cell line producing a murine anti-CD20 MAb by general
molecular cloning techniques (Sambrook et al., Molecular Cloning, A
laboratory manual, 2.sup.nd Ed (1989)). The V.kappa. sequence for
the MAb may be amplified using the primers VK1BACK and VK1FOR
(Orlandi et al., 1989) or the extended primer set described by
Leung et al. (BioTechniques, 15: 286 (1993)). The V.sub.H sequences
can be amplified using the primer pair VH1BACK/VH1FOR (Orlandi et
al., 1989) or the primers annealing to the constant region of
murine IgG described by Leung et al. (Hybridoma, 13:469
(1994)).
[0143] PCR reaction mixtures containing 10 .mu.l of the first
strand cDNA product, 10 .mu.l of 10.times. PCR buffer [500 mM KCl,
100 mM Tris-HCl (pH 8.3), 15 mM MgCl.sub.2, and 0.01% (w/v)
gelatin] (Perkin Elmer Cetus, Norwalk, Conn.), 250 .mu.M of each
dNTP, 200 nM of the primers, and 5 units of Taq DNA polymerase
(Perkin Elmer Cetus) can be subjected to 30 cycles of PCR. Each PCR
cycle preferably consists of denaturation at 94.degree. C. for 1
min, annealing at 50.degree. C. for 1.5 min, and polymerization at
72.degree. C. for 1.5 min. Amplified V.kappa. and VH fragments can
be purified on 2% agarose (BioRad, Richmond, Calif.). The humanized
V genes can be constructed by a combination of long oligonucleotide
template syntheses and PCR amplification as described by Leung et
al. (Mol. Immunol., 32: 1413 (1995)).
[0144] PCR products for V.kappa. can be subcloned into a staging
vector, such as a pBR327-based staging vector, VKpBR, that contains
an Ig promoter, a signal peptide sequence and convenient
restriction sites to facilitate in-frame ligation of the V.kappa.
PCR products. PCR products for V.sub.H can be subcloned into a
similar staging vector, such as the pBluescript-based VHpBS.
Individual clones containing the respective PCR products may be
sequenced by, for example, the method of Sanger et al. (Proc. Natl.
Acad. Sci., USA, 74: 5463 (1977)).
[0145] Expression cassettes containing the Vic and V.sub.H
sequences, together with the promoter and signal peptide sequences,
can be excised from VKpBR and VHpBS, respectively, by double
restriction digestion as HindIII-BamHI fragments. The V.kappa. and
V.sub.H expression cassettes can be ligated into appropriate
expression vectors, such as pKh and pG1g, respectively (Leung et
al., Hybridoma, 13:469 (1994)). The expression vectors can be
co-transfected into an appropriate cell, e.g., myeloma Sp2/0-Ag14
(ATCC, VA), colonies selected for hygromycin resistance, and
supernatant fluids monitored for production of a chimeric,
humanized or human anti-CD20 MAb by, for example, an ELISA assay.
Alternatively, the V.kappa. and VH expression cassettes can be
assembled in the modified staging vectors, VKpBR2 and VHpBS2,
excised as XbaI/BamHI and XhoI/BamHI fragments, respectively, and
subcloned into a single expression vector, such as pdHL2, as
described by Gilles et al. (J. Immunol. Methods 125:191 (1989) and
also shown in Losman et al., Cancer, 80:2660 (1997)). Another
vector that is useful is the GS vector, as described in Barnes et
al., Cytotechnology 32:109-123 (2000). Other appropriate mammalian
expression systems are described in Werner et al.,
Arzneim.-Forsch./Drug Res. 48(II), Nr. 8, 870-880 (1998).
[0146] Co-transfection and assay for antibody secreting clones by
ELISA, can be carried out as follows. About 10 .mu.g of VKpKh
(light chain expression vector) and 20 .mu.g of VHpG1g (heavy chain
expression vector) can be used for the transfection of
5.times.10.sup.6 SP2/0 myeloma cells by electroporation (BioRad,
Richmond, Calif.) according to Co et al., J. Immunol., 148: 1149
(1992). Following transfection, cells may be grown in 96-well
microtiter plates in complete HSFM medium (Life Technologies, Inc.,
Grand Island, N.Y.) at 37.degree. C., 5% CO.sub.2. The selection
process can be initiated after two days by the addition of
hygromycin selection medium (Calbiochem, San Diego, Calif.) at a
final concentration of 500 units/ml of hygromycin. Colonies
typically emerge 2-3 weeks post-electroporation. The cultures can
then be expanded for further analysis. Transfectoma clones that are
positive for the secretion of chimeric, humanized or human heavy
chain can be identified by ELISA assay.
[0147] Antibodies can be isolated from cell culture media as
follows. Transfectoma cultures are adapted to serum-free medium.
For production of chimeric antibody, cells are grown as a 500 ml
culture in roller bottles using HSFM. Cultures are centrifuged and
the supernatant filtered through a 0.2.mu. membrane. The filtered
medium is passed through a protein A column (1.times.3 cm) at a
flow rate of 1 .mu.ml/min. The resin is then washed with about 10
column volumes of PBS and protein A-bound antibody is eluted from
the column with 0.1 M glycine buffer (pH 3.5) containing 10 mM
EDTA. Fractions of 1.0 ml are collected in tubes containing 10
.mu.l of 3 M Tris (pH 8.6), and protein concentrations determined
from the absorbance at 280/260 nm. Peak fractions are pooled,
dialyzed against PBS, and the antibody concentrated, for example,
with the Centricon 30 (Amicon, Beverly, Mass). The antibody
concentration is determined by ELISA and its concentration adjusted
to about 1 mg/ml using PBS. Sodium azide, 0.01% (w/v), is
conveniently added to the sample as preservative.
EXAMPLES
Example 1
Construction of Chimeric and Humanized Anti-CD20 Antibodies
[0148] The construction of chimeric (cA20) and humanized (hA20,
veltuzumab) anti-CD20 antibodies was performed as described in U.S.
Pat. No. 7,151,164, the Examples section of which is incorporated
herein by reference. (See also, Stein et al., Clin Cancer Res 2004;
10: 2868-2878.) The variable region DNA and amino acid sequences of
cA20 and hA20 are disclosed, respectively, in FIG. 1 and FIG.
2.
[0149] The CDR sequences of cA20 and hA20 are identical to those of
rituximab (parental murine MAb C2B8), with the exception of the
third CDR of the heavy chain (CDRH3). For convenience, the heavy
chain CDR sequences are referred to as CDRH1-H3 and the light chain
CDRs as CDRL1-L3. Of the reported CDRH3 sequences for anti-CD20
antibodies, only C2B8 and the corresponding rituximab have an
asparagine residue at Kabat position 101.
[0150] The framework region sequences of veltuzumab (hA20) were
constructed using the same human IgG donor framework regions (FRs)
as the humanized anti-CD22 antibody epratuzumab (Leung et al., Mol
Immunol 1995; 32: 1413-1427). Specifically, FR1, FR2, and FR3 of
the human EU antibody and FR4 of the human NEWM antibody were
selected for the heavy chain and the FRs of the human REI antibody
were selected for the light chain of the humanized hA20 antibody.
As disclosed in U.S. Pat. No. 7,151,164, key murine residues were
retained in the FRs to maintain the binding specificity and
affinity of veltuzumab for CD20 similar to those of the parental
murine antibody. The heavy chain of hA20 (hA20VH1) contains nine
changes from the human EU frameworks, while the light chain of hA20
(hA20V.kappa.) contains seven amino acid changes from the REI
framework (U.S. Pat. No. 7,151,164).
[0151] A comparison of the variable region sequences of cA20, hA20
and rituximab (from c2B8) is shown in FIG. 3. As indicated in FIGS.
3A and 3B, cA20 differs from veltuzumab (hA20) in the variable
framework regions but has identical CDRs as veltuzumab. The
framework region sequences of cA20 are identical to those of
rituximab (c2B8), with the exception of three amino acid residues
at the N-terminal end of the light chain, while the framework
region sequences of ritixumab and veltuzumab differ at 18 residues
in the light chain and 14 residues in the heavy chain. The CDR
sequences of rituximab differ from those of veltuzumab (hA20) and
cA20 only at Kabat position 101 of the V.sub.H of CDR3.
[0152] As described in the following Examples, veltuzumab and
rituximab differ significantly with respect to the rate of
dissociation from CD20 positive lymphoma cells and in certain
therapeutic characteristics in vivo and in vitro. To determine
whether or not these changes in characteristics were attributable
to the differences in framework sequence or the substitution of Asp
for Asn at Kabat position 101 of CDR3's V.sub.H, a mutant of
veltuzumab, designated D101N, was engineered with a
non-conservative single amino acid change of aspartic acid to
asparagine at position 101 in CDRH3. Thus, D101N has the same CDRs
as rituximab but identical FRs to veltuzumab. Further details of
the construction of D101N are provided below. Table 1 compares the
CDRH3 sequences of veltuzumab, cA20, D101N, rituximab, and 1F5, all
of which have identical CDRH1 and CDRH2 sequences.
TABLE-US-00001 TABLE 1 Comparison of CDRH3.sup.1 SEQ ID Kabat
numbering NO: 95 100 101 102 Veltuzumab 6 S T Y Y G G -- D W Y F D
V D101N 32 .cndot. .cndot. .cndot. .cndot. .cndot. .cndot. --
.cndot. .cndot. .cndot. .cndot. N .cndot. cA20 6 .cndot. .cndot.
.cndot. .cndot. .cndot. .cndot. -- .cndot. .cndot. .cndot. .cndot.
.cndot. .cndot. Rituximab 32 .cndot. .cndot. .cndot. .cndot.
.cndot. .cndot. -- .cndot. .cndot. .cndot. .cndot. N .cndot. 1F5 33
.cndot. H .cndot. G S N Y V D .cndot. .cndot. .cndot. Y
.sup.1Residues marked as .cndot. are identical to those of
veltuzumab in the same position.
Example 2
Construction of D101N Sequence Variant of Veltuzumab
[0153] All restriction endonucleases and other enzymes were
purchased from New England Biolabs (Beverly, Mass.).
Oligonucleotides were synthesized by Sigma Genosys (Haverhill, UK).
PCR reactions were performed using Amplitaq polymerase (Applied
Biosystems, Foster City, Calif.) and a Perkin Elmer (Wellesley,
Mass.) GeneAmp PCR system 9600. Two PCR reactions using hA20-pdHL2
(see U.S. Pat. No. 7,151,164) vector as a template and the
oligonucleotide primer pairs of 5' D101N
(cggtgactggtacttcaatgtctggggccaaggcaccacg SEQ ID NO:17) and 3'
Hind3 (aaagcttgcggccgcgatcc SEQ ID NO:18) or 3' D101N
(cgtggtgccttggccccagacattgaag taccagtcaccg SEQ ID NO:19) and 5'
XhoI (cctcgagcacacaggacctc SEQ ID NO:20) produced 210 by or 510 by
amplimers, respectively. A third PCR reaction using a mixture of
the 210 by and 510 by products as template and the 5' XhoI and 3'
Hind3 primers produced a 680 by amplimer, which was gel isolated
and cloned into the pGemT PCR cloning vector (Promega, Madison,
Wis.). The sequence of the amplimer was confirmed by automated DNA
sequencing. The 680 by fragment was excised from the pGemT vector
with XhoI and Hind III restriction enzymes and ligated into the
hA20-pdHL2 vector, which was prepared by digestion with the same
enzymes. The sequence of the final vector, D101N-hA20-pdHL2, was
confirmed by automated DNA sequencing.
Example 3
Scatchard Analysis of Binding of Anti-CD20 Antibodies
[0154] Cell Lines
[0155] In the following Examples, the murine hybridoma 1F5 and the
human Burkitt lymphoma lines, Daudi, Raji and Ramos, were purchased
from the American Type Culture Collection (Manassas, Va.). The
non-Burkitt lymphoma cell lines used were: SU-DHL-6 from Dr. Alan
Epstein (University of Southern California, Los Angeles, Calif.),
and WSU-FSCCL from Dr. Mitchell Smith (Fox Chase Cancer Center,
Philadelphia, Pa.). The cells were grown as suspension cultures in
DMEM (Life Technologies, Inc. Gaithersburg, Md.), supplemented with
10% fetal bovine serum, penicillin (100 units/ml), streptomycin
(100 .mu.g/ml), and L-glutamine (2 mM).
[0156] Scatchard Analysis
[0157] The maximum number of binding sites per Raji cell and the
apparent dissociation constants of veltuzumab and rituximab were
determined by nonlinear regression analysis of the saturation
binding data obtained with the radioiodinated samples and Raji
cells, using Prism software (GraphPad Software Inc., San Diego,
Calif.). Raji cells (5.times.10.sup.5) were incubated with
radioiodinated MAbs in an assay volume of 225 .mu.l, using tissue
culture media as diluent, for 1 h at 37.degree. C. or room
temperature. Cells then were washed twice with PBS containing 1%
horse serum, and cell pellets were counted in a gamma counter. The
MAbs were titrated at a 2:3 serial dilution starting with
approximately 2.times.10.sup.6 cpm/2 .mu.g MAb/tube, run in
triplicate. Non-specific binding was measured by including
replicate unlabeled MAb. Immunoreactivity of the radiolabeled MAbs,
measured by binding to anti-idiotype antibodies, was 90% or
greater.
[0158] The results shown in FIG. 4 demonstrate that both the number
of binding sites per cell and the equilibrium dissociation
constants (functional K.sub.d) were similar for veltuzumab and
rituximab. The number of binding sites per Raji cell was calculated
to range from 2.0.times.10.sup.5-4.2.times.10.sup.5 for veltuzumab
versus 1.8.times.10.sup.5-3.6.times.10.sup.5 for rituximab. In
replicate assays, the apparent dissociation constant values ranged
from 6.23-12.02 nM for veltuzumab versus 6.70-8.63 nM for
rituximab. These values are similar to those reported previously by
ourselves and others, as well as in the prescribing information for
rituximab (Melhus et al., Cancer Biother. Radiopharm., 22: 469-479,
2007; Stein et al., Clin. Cancer Res., 10: 2868-2878, 2004).
Example 4
Competitive Cell Surface Binding Assay
[0159] Ag (Antigen)-binding specificity and affinity studies of the
anti-CD20 Abs cA20, hA20, and c1F5, purified by affinity
chromatography on a Protein A column were evaluated by a cell
surface competitive binding assay with murine 2B8 and rituximab
(IDEC Pharmaceuticals Corp., San Diego, Calif.). A constant amount
(100,000 cpm, .about.10 .mu.Ci/.mu.g) of .sup.125I-labeled m2B8 or
rituximab was incubated with Raji cells in the presence of varying
concentrations (0.2-700 nM) of competing Abs (cA20, hA20, m2B8,
c1F5, or rituximab) at 4.degree. C. for 1-2 h. Unbound Abs were
removed by washing the cells with PBS. Radioactivity associated
with the cells was determined after washing. The results (not
shown) demonstrated that cA20, hA20 and cIF5 all competed for
binding to CD20 with rituximab (c2B8) and murine 2B8.
Example 5
Comparison of Dissociation or Off-Rates
[0160] The dissociation rates of veltuzumab, rituximab, cA20,
D101N, 15F and to situmomab (anti-CD20, BEXXAR.RTM.,
GlaxoSmithKline) were compared by flow cytometry using Daudi, Raji
and Ramos cells (FIG. 5). Each MAb was labeled with phycoerythrin
(PE) using a Zenon R-Phycoerythrin Human IgG labeling kit following
the manufacturer's suggested protocol (Invitrogen, Molecular
Probes, Z-25455). Cells (Daudi, Raji, or Ramos) in 0.5 mL of CM
(phenol red-free RPMI 1640 media supplemented with 10% FBS) at
1.times.10.sup.6 cells/mL were incubated with 5 .mu.g of each
PE-labeled MAb at room temperature for 30 min, pelleted at
400.times.g, washed twice with CM, resuspended in 1.5 mL of CM, and
split into two 0.75-mL aliquots. To prevent rebinding,
N-ethyl-maleimide (NEM)-blocked veltuzumab-Fab' was added to each
replicate (1 mg/mL final concentration) and the mean fluorescence
intensity (MFI) was immediately measured to determine the maximal
binding (T=0) using a Guava PCA and Guava Express software (Guava
Technologies, Inc., Hayward, Calif.). Subsequent measurements were
taken at 30-min intervals. The percent maximal binding, which is
the quotient of the MFI at T=X divided by that at T=0, was plotted
against time, and the results analyzed by Prism software (GraphPad
Software Inc., San Diego, Calif.) to yield the half-life or
off-rates.
[0161] The dissociation rates of veltuzumab, rituximab and cA20
from Daudi (FIG. 5A), Ramos (FIG. 5B) and Raji (FIG. 5C) cells were
compared in the presence of excess veltuzumab-Fab'-NEM at
37.degree. C. Additional measurements were performed to compare the
dissociation of veltuzumab, rituximab, and D101N from Raji cells
(FIG. 5D) under similar conditions. For each cell line tested, the
half-life of veltuzumab on average was 2.7-fold (.+-.0.3) longer
than that of rituximab (P<0.0001), but indistinguishable from
that of cA20 (P>0.2). In contrast, the D101N mutant dissociates
from Raji cells with an off-rate two- and six-fold faster than
rituximab and veltuzumab, respectively. These results indicate that
the change of Asn.sub.101 to Asp.sub.101 is responsible for the
slower dissociation of veltuzumab. We also compared the
dissociation of veltuzumab, rituximab, D101N, 1F5, and tositumomab
from Raji cells (FIG. 5E) in the absence of the competing
veltuzumab-Fab'-NEM, and found that veltuzumab has the longest
half-life (281 min), followed by 1F5 (195 min), rituximab (94 min),
tositumomab (50 min), and D101N (42 min).
Example 6
In-Vitro Cell Proliferation Inhibition by MTT Assay
[0162] The in-vitro cytotoxicity assay was based on the method of
Mosmann (J Immunol Methods, 65: 55-63, 1983). Briefly, cell lines
were plated at 1-2.times.10.sup.4 cells/well (100 .mu.l) in 96-well
plates, to which antibodies were added (100 .mu.l). After
incubation for 4 days at 37.degree. C. in a humidified CO.sub.2
(5%) incubator, 25 .mu.l of 5.0 mg/ml MTT
[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] was
added, and the cells were incubated for an additional 4 h at
37.degree. C. Plates were then centrifuged and supernatants
removed. Pellets were dissolved using 100 .mu.l DMSO/well and
optical density was measured at 570 nm on a microplate reader
(Molecular Devices, Sunnyvale, Calif.). Because unlabeled rituximab
and veltuzumab were reported previously to require crosslinking for
cytotoxic activity (Stein et al., Blood, 104: 3705-3711, 2004),
goat-anti-human IgG (GAH) was added to some of the wells.
Veltuzumab and rituximab were used at a final concentration of 5
.mu.g/ml and GAH was used at 20 .mu.g/ml. All tests were performed
in 4 replicates.
[0163] The ability of veltuzumab and rituximab to inhibit
proliferation was examined using MTT cytotoxicity assays on four
lymphoma cell lines, SU-DHL-6, Daudi, Raji, and WSU-FSCCL, which
differ in their expression levels of CD20 (Stein et al., Clin
Cancer Res, 10: 2868-2878, 2004). While the sensitivity to both
MAbs correlated with CD20 expression
(SU-DHL-6>Raji>Daudi>WSU-FSCCL), no significant
differences in potency were observed between veltuzumab and
rituximab within a cell line (FIG. 6). Crosslinking with second
antibody (GAH, goat anti-human IgG) increased the efficacy of
veltuzumab and rituximab on Raji and Daudi cells, two cell lines
with intermediate levels of CD20 expression and sensitivity to
killing by anti-CD20 MAbs (FIG. 6). Inhibition of proliferation of
cell lines on either extreme of anti-CD20 sensitivity (e.g.,
SU-DHL-6, which is very sensitive, and WSU-FSCCL, which is very
insensitive) did not benefit by the addition of second antibody
(FIG. 6).
Example 7
B- and T-Cell Depletion In Vitro
[0164] The effects of veltuzumab on human peripheral blood
lymphocytes of healthy volunteers were assessed in vitro using flow
cytometry. Aliquots of whole blood were incubated with veltuzumab
for two days followed by analysis of B-cells (CD19+) and T-cells
(CD3+) by FACS. Controls included no antibody and a negative
control humanized MAb (anti-CEACAM5 monoclonal antibody, hMN-14).
Incubation of whole blood with veltuzumab led to significant
decreases in the number of B-cells, but not T-cells (FIG. 7).
Decreases of B-cells ranged from 26-80% using 5 .mu.g/ml, and
11-61% using 1 .mu.g/ml (P values vs. untreated cells <0.05 with
1 .mu.g/ml [6.7 nM] for 3/3 blood donors and 5 .mu.g/ml [33.3 nM]
for 5/5 blood donors). Because whole blood was used in the
incubation mixtures, the decreases observed in the cell counts
could be due to CDC or ADCC, as well as direct signaling.
Example 8
Complement-Dependent Cytotoxicity (CDC) Assays
[0165] A fluorometric method was used to evaluate and compare CDC
activity of veltuzumab vs. rituximab. Daudi, Raji or Ramos cells
(1.times.10.sup.6/mL) were seeded (50 .mu.L per well) in black
96-well plates (Nunc) and incubated for 3 h at 37.degree. C. and 5%
CO.sub.2 with each test MAb (0.001 to 10 .mu.g/mL) in the presence
of human complement (Quidel Corp., San Diego, Calif.) at 1/20 final
dilution. The indicator dye, AlamarBlue (BioSource, Camarillo,
Calif.), was added and the incubation continued overnight. Viable
cells were then quantified by measuring the fluorescence intensity
with excitation at 530 nM and emission at 590 nM using a BioTek
Synergy.TM. HT Multi-Detection Microplate Reader and KC4 Signature
Software (BioTek Instruments, Inc., Winooski, Vt.).
[0166] The dose-response curves generated from the mean of 6
replicate determinations were analyzed using Prism software to
obtain EC.sub.50 values. In the case of Daudi cells, to account for
day-to-day variations in the assay, as well as to increase the
precision of the EC.sub.50 estimates, the experiments used a
multi-factorial design, where the assay for each antibody was
performed in triplicate each day, and repeated on three different
days for a total of 9 assays per antibody. The samples included 3
different lots of veltuzumab and one of rituximab. Statistical
analysis of the EC.sub.50 data was based on a 2-way analysis of
variance (ANOVA) model with day and antibody type as factors.
Dunnett's multiple comparison procedure was utilized to perform the
3 comparisons of all 4 constructs at an overall experimental error
rate of 0.05.
[0167] With Daudi as the target cells for CDC, we observed
consistently a lower value of EC.sub.so for veltuzumab (Table 2)
when compared to rituximab. Further measurements addressing any
effect of day-to-day variation as well as any differences in
EC.sub.50 patterns amongst the antibodies across different days
indicated that the mean difference in EC.sub.50 observed between
rituximab and each of the three lots of veltuzumab was consistently
statistically significant (P<0.0001). However, no differences
between veltuzumab and rituximab were observed with CDC results in
the other two cell lines, Raji and Ramos.
TABLE-US-00002 TABLE 2 Comparison of Veltuzumab versus Rituximab:
Summary of CDC Results (EC.sub.50) in the Daudi cell line. No. of
Mean Experi- EC.sub.50 (g/mL) Difference 95% ments Mean .+-. Std.
(Vmab - Confidence Antibody (N) Dev. Rmab) Interval.sup.[1]
Rituximab 9 0.1485 .+-. 0.0200 Veltuzumab 9 0.0990 .+-. 0.0232
-0.0495 (-0.0611, (Lot 1) -0.0378) Veltuzumab 9 0.0843 .+-. 0.0215
-0.0642 (-0.0758, (Lot 2) -0.0525) Veltuzumab 9 0.0904 .+-. 0.0239
-0.0581 (-0.0697, (Lot 3) -0.0464) .sup.[1]Based on 2-way ANOVA
model adjusted for multiple comparisons using Dunnett's method.
Example 9
Antibody-Dependent Cellular Cytotoxicity (ADCC) Assays
[0168] Induction of ADCC was measured using peripheral blood
mononuclear cells (PBMCs) and Daudi as effector and target cells,
respectively. Daudi cells were incubated with each test antibody in
triplicate at 5 .mu.g/mL for 30 min at 37.degree. C. and 5%
CO.sub.2. Freshly isolated peripheral blood mononuclear cells
(PBMCs) obtained from healthy volunteers were then added at a
predetermined optimal effector-to-target ratio of 50:1. Following a
four hour incubation, cell lysis was assessed by CytoTox-One
(Promega, Madison, Wis.). ADCC was determined for MAb+effector
cells, MAb+target cells, and MAb+target cells+effector cells.
Control wells containing MAb alone and target cells alone also were
processed.
[0169] To evaluate the results, the mean background value obtained
from wells with media alone was subtracted from all other wells,
and the % lysis was calculated using the following equation in
which MET represents wells containing MAb, effector and target
cells; ET is wells containing effector and target cells; T, wells
containing target cells only; and Max is wells containing target
cells and lysis buffer:
% Lysis = MET - ET Max - T . .times. 100. ##EQU00001##
[0170] The level of ADCC activity of five lots of veltuzumab was
compared to those of rituximab and a negative control MAb (hMN-14)
by measuring cytolysis of the CD20-expressing Daudi cell line.
Effector cell function was provided by PBMCs freshly isolated from
two volunteer blood donors. The results indicated that rituximab
and each of the 5 lots of veltuzumab produced statistically similar
(P=0.12) levels of ADCC (40-45% lysis) (data not shown). Rituximab
and veltuzumab both showed significantly higher levels of ADCC
(P<0.0001) compared to the control MAb (9.9% lysis, humanized
anti-CEA labetuzumab).
Example 10
Effects of Natural Killer (NK) Cell and Neutrophil Depletion on
Therapy
[0171] Depletion of NK cells and neutrophils was performed as
described previously (Hernandez-Ilizaliturri et. al., Clin Cancer
Res 9:5810-12, 2003). Briefly, each mouse received 100 .mu.L of
anti-mouse Gr-1 ascites i.p. (provided by Dr. F. J.
Hernandez-Ilizaliturri, Roswell Park Cancer Institute, Buffalo,
N.Y.) and 100 .mu.g anti-mouse IL-2 receptor antibody (TMI.beta.-1,
BD PharMingen, Inc., San Jose, Calif.) one day before inoculating
1.times.10.sup.6 Raji cells, followed by two more i.p. injections
of anti-mouse Gr-1 ascites on Days 6 and 13. Depletion was
confirmed by FACS analysis of blood samples taken from 1 depleted
and 1 non-depleted mouse on Days 3 and 13. Veltuzumab (200 .mu.g)
or saline was administered i.v. on Days 3, 5, 7, and 11.
[0172] The role of effector cells on veltuzumab's inhibition of
Raji tumor growth in vivo was examined (FIG. 11). In those animals
depleted of NK and neutrophils, there was no difference between
saline control and treated mice, both having the same MST
(16.4.+-.1.3 days). In contrast, in the non-depleted mice,
veltuzumab-treated mice had a significantly improved MST over the
saline controls (38.6.+-.7.3 vs. 18.4.+-.0.9 days;
P<0.0035).
Example 11
Analysis of Serum Pharmacokinetics in Mice After i.p. or s.c.
Administration
[0173] Twelve 9-week-old naive female Swiss-Webster mice (Taconic
Farms; Germantown, N.Y.) were weighed prior to injection and
grouped six to a cage such that the mean and standard deviations
between the two sets of mice were not significantly different.
Veltuzumab, 1 nmole (150 .mu.g), was administered either as a 200
.mu.L i.p. or s.c. injection. Serum samples were taken by
retro-orbital bleeding at 0.5, 1, 4, 6, 24, 48, 120, 168 and 336 h
and stored frozen until analysis for veltuzumab.
[0174] A capture ELISA was used to quantify the amount of
veltuzumab in the serum samples. A 96-well assay plate (Nunc
Maxisorp Certified Flat-Bottom Immuno Modular w/frame; NalgeNunc
International Corp., Rochester, N.Y.) was coated with a rat
anti-veltuzumab idiotype monoclonal antibody, WR2 (Immunomedics,
Inc., Morris Plains, N.J.). A standard curve was constructed by
making 8 serial dilutions of veltuzumab (100 to 1.56 ng/mL). The
murine serum samples were appropriately diluted and, together with
the standards, pipetted into triplicate wells. Bound veltuzumab was
detected with a peroxidase-conjugated goat anti-human polyclonal
antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove,
Pa.), and the plates developed using an OPD solution
(o-phenylenediamine dihydrochloride, Sigma-Aldrich, St. Louis,
Mo.). The plates were incubated in the dark until the color
developed in the standard curve wells (-20 min). At this time, 4N
sulfuric acid was added to the wells to stop the reaction, and the
plates read on a plate reader at OD.sub.490 nm.
[0175] Using Prism software (GraphPad Software, Inc.), the
concentration of veltuzumab was calculated in the mouse serum
samples based on the standard curve. To ensure accuracy, each
sample was run multiple times and the mean value from all these
runs was used in the PK-analysis. Plasma concentrations that were
determined from the above assay were converted to nmol/mL and
analyzed using the WinNonLin PK software package (v5.1, Pharsight
Corp., Mountain View, Calif.). Non-compartmental analysis was
performed on both the i.p. and s.c. data (representing the best-fit
model).
[0176] While serum concentrations and clearance of veltuzumab were
very similar between those animals injected i.p. versus s.c. (FIG.
12), several of their respective PK-parameters were significantly
different (Tables 3 and 4). In terms of maximum serum
concentrations (C.sub.max) and the time to C.sub.max (T.sub.max),
there were no significant differences between the injection routes.
This was also true for comparisons between clearance (Cl) and area
under the curve (AUC) values. However, notable differences were
observed in the terminal half-life (T.sub.1/2) and mean residence
time (MRT), with the i.p. route yielding significantly higher
values for each (P=0.0316 and P=0.0357, respectively).
TABLE-US-00003 TABLE 3 Pharmacokinetics of hA20 with
Intraperitoneal Injection Individual Mouse Serum PK of hA20 IgG
Administered as a Single Intraperitoneal Injection. Injected Animal
Dose C.sub.max T.sub.max T.sub.1/2 AUC.sub.0.fwdarw..infin. Cl
MRT.sub.0.fwdarw..infin. No. (pmoles) (pmole/mL) (h) (h)
(h*pmole/mL) (mL/h) (h) 1 1000 143.7 24 308.5 86,170 0.0116 540.8 2
1000 173.9 24 225.9 54,204 0.0184 379.2 3 1000 229.8 24 846.1
214,007 0.0047 1219.5 4 1000 246.5 24 562.8 149,725 0.0067 840.1 5
1000 76.5 24 292.8 28,628 0.0349 439.6 6 1000 296.7 24 333.0
107,101 0.0093 500.8 Mean 195 428 106,639 0.0143 653 (Stdv) (79)
(235) (67,288) (0.0112) (320)
[0177] The tumor-free Swiss-Webster mice used in our PK study
weighed an average of 30 g. Whole blood volume in mice is estimated
based on their weight and uses a range of 5.5 to 7% of body weight
as mL of whole blood. If we use an average of 6.25%, our mice had
approximately 1.9 mL whole blood of which approximately 50% is
serum or 0.95 mL. We injected 150 .mu.g into these mice i.p., so if
all of it ended up in the blood we would have a serum concentration
of approximately 158 .mu.g/mL. We found that after injecting 150
.mu.g of veltuzumab into these 30 g mice, we achieved a C.sub.max
of 30 .mu.g/mL serum, or 5.3-fold less than what could be maximally
expected.
TABLE-US-00004 TABLE 4 Pharmacokinetics of hA20 with Subcutaneous
Injection Individual Mouse Serum PK of hA20 IgG Administered as a
Single Subcutaneous Injection. Injected Animal Dose C.sub.max
T.sub.max T.sub.1/2 AUC.sub.0.fwdarw..infin. Cl
MRT.sub.0.fwdarw..infin. No. (pmoles) (pmole/mL) (h) (h)
(h*pmole/mL) (mL/h) (h) 1 1000 227.2 24 166.1 45,734 0.0219 261.3 2
1000 256.1 24 173.4 55,139 0.0181 265.4 3 1000 172.7 24 244.9
66,351 0.0151 355.9 4 1000 204.1 24 189.7 58,214 0.0172 278.4 5
1000 195.5 24 162.5 41,018 0.0244 247.9 6 1000 162.6 24 185.0
43,580 0.0229 280.3 Mean 203 187 51,673 0.0199 282 (Stdv) (35) (30)
(9,844) (0.0037) (38)
[0178] Using the above observations, we injected 50 ng (0.05 .mu.g)
into .about.20-g SCID mice for our lowest therapy dose. Based on
their weight, they should have approximately 1.14 mL whole blood
volume, of which 0.57 mL is serum. If all 50 ng resided in the
blood, there would be a serum concentration of 87.7 ng/mL. Given
the same kinetics as observed in the normal mouse PK studies, we
estimate a C.sub.max concentration of approximately 16.5 ng/mL
veltuzumab in the serum (87.7 ng/mL divided by 5.3). This does not
take into account the presence of Daudi cells that can be an
antigen sink in these mice, and thus lower the serum
concentration.
Example 12
Tolerability and Toxicokinetics in Cynomologus Monkeys
[0179] An exploratory single- and repeated-dose study of
intravenous and s.c.injections of veltuzumab was conducted in
cynomolgus monkeys (Macaca fascicularis) at SNBL USA, Ltd.
(Everett, Wash.). Sixteen male and 16 female monkeys weighing 2.5
to 6.6 kg (3-7 years old) were given i.v. or s.c. doses of 0, 6.7,
33.5, and 67 mg/kg (which correspond to 80, 375, and 800 mg/m.sup.2
doses, respectively, in humans), either once or three times (2
weeks apart). The monkeys were examined regularly, with blood
sampling taken for MAb titers and PK, blood chemistry, coagulation,
and hematology testing, as well as urinalysis, and then postmortem
evaluation of lymphoid tissue status in spleen, mandibular, and
mesenteric lymph nodes.
[0180] Veltuzumab administered i.v. or s.c. as single or multiple
doses was well tolerated, with no clinical or persistent laboratory
test abnormalities noted other than B-cell depletion in the
circulation and lymphatic organs. Post-mortem changes in the
animals receiving all doses included follicular lymphoid depletion
of the spleen, mandibular, and mesenteric lymph nodes at all doses
(data not shown). Transient decreases in white blood cells,
neutrophils, lymphocytes, and basophils were noted, but only a
rapid and persistent reduction in the number of peripheral blood
B-cells was observed (not shown). These effects occurred within 2
days of dosing by either route and were present at doses of 6.7
mg/kg or higher. The animals recovered at either 28 days when
treated once, or at 56 days when given 3 doses. Pharmacokinetic
analyses (data not shown) indicated that the half-life was
estimated at 5 to 8 days after i.v. injection or 6-13 days
following s.c. administration, and the T.sub.max for both routes
ranged from 2 to 5 days. C.sub.max following i.v. injection was
linear and showed no accumulation, and the AUC.sub.0-27 days was
greater for i.v. administration than for the s.c. route (not
shown). This is likely related to the longer period required for
the MAb to enter the blood stream via the s.c. route with a similar
rate of clearance. The dose-normalized AUC values showed
accumulation of veltuzumab after i.v.--infusion or s.c.
administration at all dose levels, but the mean volume of
distribution was greater after s.c. administration than after i.v.
infusion at all dose levels (not shown). These results indicate
that at the lowest single dose of 6.7 mg/kg (equivalent to 80
mg/m.sup.2 in humans), rapid depletion of peripheral and splenic
B-cell depletion occurs for veltuzumab given either by i.v. and
s.c. routes at this low dose.
Example 13
In-Vivo Efficacy of Veltuzumab in Mouse Models
[0181] These studies were performed in C.B.17 homozygous severe
combined immune deficient (SCID) mice of approximately 20 grams
(7-week-old when received from Taconic, Germantown, N.Y.). For the
Daudi (Burkitt's lymphoma) model, mice were inoculated i.v. on Day
0 with 1.5.times.10.sup.7 cells, weighed, and randomly assigned to
six treatment and two control groups (8 per group). On Day 1, mice
in a treatment group received a single dose of veltuzumab (5, 20,
or 60 .mu.g) s.c. or i.p., and those in the control groups received
either saline (200 .mu.L) or 60 .mu.g of a non-Daudi targeting
isotype-matched anti-CEACAM5 monoclonal antibody, hMN-14 IgG
(labetuzumab, Immunomedics, Inc., Morris Plains, N.J.).
[0182] In addition to this study, a minimal effective dose
experiment was performed in the same Daudi model. Groups of 14 mice
received a single dose of veltuzumab (0.5, 0.25, 0.1, or 0.05 jig)
i.p with saline given to controls. In the WSU-FSCCL follicular cell
lymphoma model, each mouse in groups of 15 was inoculated with
2.5.times.10.sup.6 cells i.v. and 5 days later received a single
dose of veltuzumab (0.035, 0.35, 3.5, or 35 .mu.g) i.p. Animals
were monitored daily and sacrificed humanely when hind-limb
paralysis developed, when they became moribund, or if they lost
more than 20% of initial body weight. Survival curves were analyzed
using Kaplan-Meier plots (log-rank analysis), using the Prism
(v4.03) software package (GraphPad Software, Inc.).
[0183] Intraperitoneal Versus Subcutaneous Therapy of Burkitt
Lymphoma Xenografts.
[0184] Mice bearing disseminated disease were treated with single
i.p. or s.c. injections of veltuzumab. All three doses of
veltuzumab, regardless of whether administered i.p. or s.c.,
significantly increased survival of mice in comparison to the
saline and labetuzumab control groups (FIG. 8, P=0.0001).
Comparisons between equal doses administered i.p. and s.c. did not
yield any significant differences (FIG. 8). While the control mice
succumbed to disease (hind-limb paralysis) on day 28, the mean
survival times (MSTs) of the two 60-.mu.g groups were 101.9.+-.26.8
and 114.6.+-.21.8 days for i.p. and s.c., respectively, with 4/8
and 6/8 mice still alive when the study ended on Day-126. Similar
results were obtained for the animals given 20 .mu.g, with the MSTs
of 116.4.+-.14.0 (i.p.) and 108.4.+-.26.2 (s.c.) days, and 5/8 mice
alive at the end of the study in both groups. Only at the lowest
dose (5 .mu.g) was a >50% mortality rate observed (3/8 and 1/8
mice were still alive at the end of the study in each
i.p./s.c.group), but these mice still had a >3.2-fold increase
in the MSTs (91.1.+-.30.9 and 91.6.+-.22.5 days for i.p. and s.c.,
respectively) compared to controls.
[0185] Minimum Effective Dose of Veltuzumab in Daudi Burkitt
Lymphoma Xenografts.
[0186] Since a single 5 .mu.g dose of veltuzumab proved to be
potent in the Daudi disseminated Burkitt lymphoma model, even lower
doses (0.5, 0.25, 0.1, and 0.05 .mu.g) were then examined in this
same disease model. Remarkably, all four doses improved survival
significantly (P<0.0001) when compared to saline control mice
(FIG. 9). For example, mice receiving a single dose of 0.5 .mu.g
had a 3-fold improvement in the MST compared to controls
(69.5.+-.23.9 vs. 21.4.+-.1.1 days). Even the lowest tested dose of
0.05 .mu.g (50 ng) increased the MST (50.+-.8 days) by more than
2-fold over the controls.
[0187] Minimum Effective Dose of Veltuzumab in Follicular Cell
Lymphoma Xenografts.
[0188] In a disseminated follicular cell lymphoma model, WSU-FSCCL
xenografts, groups of mice were administered single i.p. injections
of veltuzumab (FIG. 10). Each group received a 10-fold dilution
ranging from a high of 35 .mu.g to a low of 0.035 .mu.g (35, 3.5,
0.35, and 0.035 .mu.g). Therapy did not start until 5 days after
the administration of the WSU-FSCCL cells. All four doses
significantly increased survival of the mice when compared to the
saline control (FIG. 10, control MST=28 days; P<0.0001). The MST
of mice administered the 35-.mu.g dose (44.3.+-.4.9 days) was not
significantly different from that of the 3.5-.mu.g group
(39.5.+-.4.6 days), but was significantly (P<0.021) longer than
that of the 0.35- and 0.035-.mu.g (35 ng) groups (40.5.+-.1.6 days
and 33.3.+-.2.1 days, respectively). However, all mice, except for
one in the 3.5-.mu.g group, succumbed to disease progression by
Day-61.
Example 14
Veltuzumab Shows Improved In Vivo Efficacy Compared to Rituximab in
a Mouse Model System
[0189] SCID mice were inoculated with human Burkitt lymphoma (Raji)
cells by tail vein injection. At 5, 10, 15 and 20 days after
inoculation, the mice received either rituximab or veltuzumab
(hA20) at 10 mg/kg/dose. The results of cumulative survival are
shown in FIG. 13.
[0190] As seen in FIG. 13, SCID mice injected with Raji lymphoma
cells and treated with veltuzumab (hA20) showed a significant
improvement (P=0.005) in cumulative survival compared to mice
treated with an identical dose of rituximab. In this study, time to
limb paralysis was used as a surrogate end-point for survival. FIG.
13 shows that at over 90 days after inoculation, SCID mice with
Raji lymphoma that had been treated with veltuzumab exhibited about
an 80% survival rate, while equivalent mice treated with rituximab
exhibited a survival rate close to zero. The lower part of FIG. 13
shows that the estimated median cumulative survival was 22.1 days
for control mice, 47.9 days for mice treated with rituximab and not
yet reached for mice treated with veltuzumab.
[0191] These results demonstrate that the replacement of Kabat 101
asparagine with aspartate in the CDRH3 sequence produces a
significant improvement in in vivo efficacy in a mouse model system
using human Burkitt lymphoma cells.
Example 15
Treatment with Low-Dose Veltuzumab
[0192] Idiopathic Thrombocytopenic Purpura
[0193] A 39-year-old female with a 6-month history of ITP had
received steroids as standard of care without satisfactory
improvement of platelet levels. She received 2 doses of 80
mg/m.sup.2 veltuzumab administered intravenously 2 weeks apart. In
spite of the low dose, her B-cell levels were depleted following
the first dose, and her serum antibody levels increased to 10
.mu.g/mL after the first dose, reaching 19 .mu.g/mL after the
second dose, and then clearing slowly but still measurable (1
.mu.g/mL) 8 weeks later. Most importantly, her platelet levels
rapidly increased from 24,000/mm.sup.3 at study entry to normal
limits (>150,000/mm.sup.3) within 4 days after the first dose.
This complete response is currently continuing and her platelets
are still >150,000/mm.sup.3 at the last evaluation 18 weeks
after treatment. Interestingly, the patient also suffered from
ulcerative colitis, and went off therapy for this condition during
the trial with veltuzumab. During veltuzumab therapy, all signs and
symptoms of ulcerative colitis abated over the current 18-week
followup, which appears to be a collateral effect of this B-cell
therapy.
[0194] Marginal Zone Lymphoma
[0195] A 79-year-old female with marginal zone lymphoma was
initially diagnosed 12 years earlier and previously treated with
CHOP and then CVP, but no rituximab. She presented with stage-IV
disease including 2 enlarged iliac lymph nodes and bone marrow
involvement. She received 4 once-weekly doses of 138 mg (80
mg/m.sup.2) veltuzumab administered intravenously. B-cell levels
were depleted following the first dose, and serum antibody levels
increased with successive doses, reaching 120 .mu.g/ml after the
last dose and then clearing slowly with values still measurable (5
.mu.g/ml) at last evaluation, 12 weeks later. Most importantly, the
patient had an excellent response to treatment, with regression of
the iliac lymph nodes to normal size on a CT scan and a negative
bone marrow biopsy. The complete response is currently continuing
at the last evaluation, 15 months after treatment.
[0196] Follicular Lymphoma
[0197] A 42-year-old female with a 15-year history of follicular
lymphoma had received multiple prior treatment regimens, including
intravenous veltuzumab to which she had achieved a 9-month
response. She received 80 mg veltuzumab injected subcutaneously
every two weeks for a total of 4 doses. In spite of the low dose
administered by this route, B-cell levels were depleted following
the first dose. Serum antibody levels measured over several days
following the initial dose showed levels increasing slowly to 10
.mu.g/ml, which is comparable to levels obtained with intravenous
administration. At the 4-week followup after the last treatment,
examination of the patient revealed evidence of most enlarged lymph
nodes with disease regressing, and at 4 weeks later, the repeat
examination, including computed tomography scans, showed that the
sum of all dimensions of involved lymph nodes were reduced by more
than 50% compared to the cumulative dimensions of these nodes at
baseline, indicating that the patient had at this point a partial
response. Further evaluations are pending for this recent patient,
but the demonstration of good bioavailability and the evidence of
activity with B-cell depletion as well as >50% reduction of
disease proves that the s.c. route was effective.
[0198] Follicular Lymphoma
[0199] A 41-year-old male with stage-IV, grade-3, follicular
lymphoma was initially diagnosed 8 years earlier and had previously
been treated with CHOP chemotherapy but no rituximab. He received 4
once-weekly doses of 80 mg/m.sup.2 veltuzumab administered
intravenously. B-cell levels were depleted following the first
dose, and serum antibody levels increased with successive doses,
reaching 86 .mu.g/mL after the last dose and then clearing slowly
with values still measurable (4 .mu.g/mg) at last evaluation, 12
weeks later. Most importantly, there was complete disappearance of
all disease including a 3.6 cm scalp lesion that had been present
at study entry. The complete response continued until 9 months
after treatment, at which time a new lesion was seen by FDG-PET
imaging. This patient also shows that the low dose of veltuzumab
was potent, inducing a complete response in this patient, including
ablation of circulating B-cells after only a single administration
of 80 mg/m.sup.2 of veltuzumab.
Example 16
Therapy of Follicular Large Cell Lymphoma
[0200] AF is a 63-year-old white male with Grade-3 follicular
large-cell non-Hodgkiin's lymphoma, proven to be CD20+by lymph node
biopsy in January of 2004. His stage at diagnosis was stage 3, but
presents now in stage 2. His prior therapy in 1992 included
doxorubicin, vincristine, high-dose cyclophosphamide, which
resulted in a remission of 24 months. In 1996, he received a
regimen of ICE (ifosfamide, carboplatin and etoposide), and also
stem-cell therapy, followed by consolidation radiation to a
retroperitoneal mass. He responded for 88 months. He recently
presented with no B-symptoms, no significant CBC, serum chemistry
or serum immunoglobulin abnormalities, 687 CD3-T cells/.mu.L, 32
CD19-B-cells/.mu.L and enlarged supraclavicular node of 10.times.8
cm, left and right axillary masses of 2.0 and 2.8 cm diameters, and
a lateral neck mass of 2-3 cm. The patient was given four s.c.
injections of 80 mg veltuzumab, two weeks apart. There were no
significant adverse reactions or safety issues, only minor
transient erythematous reactions and tenderness at the injection
sites. At four days after the first injection, CD19+ B-cells in the
blood were measured as 0, so were completely ablated. The patient's
large neck mass shrank, as measured by palpation, by 50% 4 days
after the first injection, and he indicated that he was feeling
better. CT scans are pending in another 4 weeks. The patient
apparently had a rapid depletion of circulating B-cells and a
significant regression of his neck mass after a single s.c.
injection of 80 mg veltuzumab.
[0201] This surprising result shows that a single 80 mg s.c.
injection of the CDRH3 (Kabat 101) substituted anti-CD20 humanized
antibody veltuzumab is capable of ablating peripheral B-cells and
significantly shrinking an apparent B-cell tumor mass. This is the
first report of such a low dose s.c. injection of veltuzumab
producing such a profound effect on circulating and sessile
B-cells, as well as a NHL masses.
Example 17
Evans Syndrome
[0202] MT is a 3-year old Asian female followed since age 11 months
for multiple hematological autoantibodies and pancytopenia. At age
11 months she presented with diarrhea, red spots on her legs, blood
in stools, diffuse petechiae and purpura on head, neck, trunk, and
extremities, cervical adeonopathy, including several 1-cm axillary
nodes, slightly enlarged spleen, increased fatigue, decreased
appetite, bruising, and blasts on peripheral blood smear, increased
sed rate (116 mm/h), D-dimer elevated, and bone marrow aspirate
showing a hypercellular marrow (>90% cellularity), erythroid,
myeloid and megakaryocyte precursors being abundant (maturation
arrest myelocyte/metamyelocyte level but mature neutrophils seen).
Red cell precursors also showed some maturation arrest, but no
cytogenetic abnormalities. Lab studies also indicated elevations in
immunoglobulins IgA, IgG, and IgM, and an increase in circulating
CD19+ B-cells (48%). There was also evidence of a strong positive
neutrophil antibody and a strong positive platelet antibody, with
IIb/IIIa specificity. The patient was first given steroids, but had
a poor or no initial response. Therefore, she was given two courses
of rituximab. In the first course, she received 4 weekly doses and
the platelet count stabilized, but she continued to be anemic and
neutropenic. Her CD20 and CD19 lymphocytes decreased, but after
only 5-6 weeks, these increased dramatically. A second course of
rituximab involved 3 weekly doses, and over several weeks, her
platelet count, hemoblobin and absolute neutrophil normalized, and
after 2-3 months, red cell and platelet antibodies resolved. This
remission to rituximab lasted for 9 months, but then
thrombocytopenia was noted on a routine CBC, and again red cell,
neutrophil and platelet antibody was detected. The patient was then
given prednisone and intravenous immunoglobulin, and showed a
partial response.
[0203] Then a third course of rituximab, 2 weekly doses, was given,
and two episodes of anaphylaxis resulted, requiring aggressive
medical management. The patient showed a transient response, 2-3
months, but pancytopenia and hematological antibodies recurred. The
patient has since had transfusions for her anemia, with red cell
antibodies and anemia being her most significant problem, with
intermittent episodes of thrombocytopenia; she was not responsive
to steroids or intravenous immunoglobulin.
[0204] Since the next option is splenectomy or a course of
cytotoxic chemotherapy, she is given an experimental regimen of
veltuzumab, consisting of 10 mg subcutaneously, repeated at a dose
of 10 mg veltuzumab given subcutaneously 2 weeks later. Prior to
the second dose, depletion of circulating CD19-positive B-cells is
found, and improvement in her red blood cell and platelet counts is
observed. Two weeks after the second s.c. injection of veltuzumab,
the patient's general condition shows improvement, her red blood
cell, neutrophil, and platelet antibodies are barely measureable,
and all hematological abnormalities show significant improvement,
with platelet, neutrophil, and RBC counts being at the lower end of
the normal ranges. At 2 months post therapy, the patient continues
to be in remission. No evidence of any anaphylaxis is noted at
anytime during the veltuzumab therapy, indicating that there is no
immune crossreactivity ro rituximab, and that very low subcutaneous
doses of veltuzumab are therapeutic in this patient with Evans
syndrome.
Example 18
Chronic Lymphocytic Leukemia
[0205] RT is a 47-year-old female with a 3-year history of chronic
lymphocytic leukemia, now relapsed after a course of alemtuzumab
(CAMPATH.RTM.), but prior history shows that she had responses of
various durations to chlorambucil and other cytotoxic drugs. She
presents now with evidence of CLL in her bone marrow and also an
elevated peripheral lymphocyte count with prominent blasts of
58,000/cmm. She is given subcutaneous injections of 40 mg
veltuzumab twice weekly for 6 weeks, and after the second
injection, the peripheral lymphocyte count drops by 55%. Two weeks
after the fourth s.c. injection, her peripheral blood counts are
slightly above the normal range, but more importantly, bone marrow
aspiration shows a definite good partial response, and the clinical
picture of fatigue, petechiae, and diffuse enlarged cervical and
other lymph nodes improve dramatically.
Example 19
Immune Thrombocytopenic Purpura (ITP)
[0206] RH is a 66-year-old male with a history of ITP for 1.5
years, 4 prior therapies, no splenectomy, and presenting with
26,000 platelets/cmm at baseline. He is given 2 doses of 40 mg
veltuzumab subcutaneously, 2 weeks apart. Prior to the second
injection, measurement of his blood CD19+ lymphocytes shows >90%
reduction. Two weeks after the second injection of veltuzumab, his
platelet count shows a doubling, which increases to 70,000 by the
5.sup.th week post therapy, which is maintained until week 11, when
the platelet count again falls to counts of <5,000/cmm. The
patient is then retreated twice with 30 mg veltuzumab s.c., again 2
weeks apart. Four days after the second injection the platelet
count rises to 28,000/cmm, and then to 42,000/cmm by week 3 post
therapy. At 6 weeks post therapy, the platelet count is
significantly improved to 67,000/cmm, and the patient is considered
to have a good partial response, with no evidence of bleeding or
petechiae during veltuzumab therapy, and returns to full-time
activity and work.
Example 20
Rheumatoid Arthritis
[0207] FH is a 37-year-old female who gradually develops painful
joints, particularly her wrists, over 3 months, with pain and early
morning stiffness of about 40 min. On examination, both her wrists
and the metacarpophalangeal joints of both her hands are swollen
and tender, but are not deformed; there are no nodules or vasulitic
lesions. She has an elevated C-reactive protein (CRP) level of 30
mg/l but otherwise normal laboratory findings, but with a positive
rheumatoid factor and antinuclear antibodies. She clearly is at the
beginning of RA and is first treated with ibuprofen. However,
despite some initial symptomatic improvement, the pain, stiffness
and swelling of the hands persist, and 2 months later, her knees
are similarly affected. Six months after the initial presentation,
she develops 3 subcutaneous nodules on the left elbow, small,
painless and immobile, but not tender. X-rays of the hands show
bony erosions in the metacarpal heads, again an elevated CRP (53
mg/l). She is now given 120 mg veltuzumab subcutaneously for 3
weekly injections. Her first evidence of improvement occurs after
the second injection, when she notices that her morning joint pain
and stiffness is reduced to about 15 minutes, and within 2 weeks
after the third injection, she experiences improved mobility, her
joints appear to have reduced swelling, and her CRP levels falls to
15 mg/l, slightly above the normal range. Her symptoms and signs of
RA are markedly improved for the next 8 weeks of followup. No
methotrexate or steroid therapy is required during the veltuzumab
treatment or for the 2 months thereafter.
Example 21
Sjogren's Syndrome with Arthritis
[0208] K.S. is a 41-year-old woman who is referred to an oral
surgeon for evaluation of a dry mouth. Except for an elevated
sedimentation rate (ESR, 60 mm/h), she has no remarkable laboratory
abnormalities. She develops a mild conjunctivitis and sore eyes 2
months later. Her rheumatoid factor becomes positive, her total
serum proteins are raised (100 g/l), as also is her IgG level (30
g/l). The Schirmer test is markedly abnormal (only 3 mm of the
filter strip in the right eye and 1 mm of that in the left eye
became wet). She is treated with methylcellulose eye drops to
prevent corneal ulceration, and over the next year shows a steady
elevation of rheumatoid factor titer and anti-nuclear antibodies,
and also develops evidence of polyarthritic changes in her hands
and wrists. She is considered to have a mild Sjogren's syndrome and
receives non-steroidal anti-inflammatory drugs (NSAIDs) for the
arthritis, but these have no effect on the sicca complex. She is
then given a course of veltuzumab, starting with an intravenous
infusion of 15 mg, followed after a week by three more subcutaneous
injections of 40 mg veltuzumab weekly. Two weeks after the
completion of this therapy course, her polyarthritic symptoms and
signs show considerable improvement, but the most dramatic effect
is the improvement of her salivation, confirmed by an improved
Schirmer test. The patient now has only minimal dry mouth and no
conjunctivitis or sore eyes, and this remission is maintained for 4
months.
Example 22
Desensitization During Renal Transplantation
[0209] SW is a 56-year-old, 55 kg, woman with 5 previous living
births and with end-stage renal disease and is waiting for a
transplant to replace her left kidney. .She is highly HLA
sensitized, showing high titers of anti-HLA antibodies. She is
undergoing regular hemodialysis. In order to undergo renal
transplantation, she requires desensitization to the anti-HLA
antibodies, and therefore is administered one intravenous dose of
120 g of human polyclonal immune globulin (10% formulation),
followed 4 days later by an s.c. injection of 40 mg veltuzumab. The
veltuzumab s.c. injection is repeated on day 8, day 12, and again
on day 21. After the first injection, the blood CD19+ B-cells
totally disappear, and 8 weeks after the 4.sup.th s.c. injection of
veltuzumab, they remain depleted.
[0210] Prior to receiving the intravenous immune globulin, she is
given 40 mg intravenous methylprednisolone, 650 mg oral
acetaminophen, and 50 mg diphenhydramine. No premedication is given
prior to the subsequent veltuzumab injections. Following this
course of pre-transplant therapy, the panel-reactive antibody level
is reduced significantly, and T-cell flow-cytometric cross-matching
shows a 50% drop prior to transplantation. Three months later, the
patient receives a kidney transplant from a deceased donor, and a
typical induction therapy immediately thereafter (30 mg alemtuzumab
s.c.) and then immunosuppressive therapy consisting of prednisone,
mycophenolate mofetil, and tacrolimus, tapered over the next year,
as well as prophylactic antibiotics, are given. She has no
rejection episode as monitored for the year post transplantation,
and her renal functions normalize. This appears to be a successful
case of desensitizing a patient in need of a renal transplant quite
effectively, resulting in a successful transplant.
Example 23
Structure-Function Relationships and Therapeutic Characteristics in
Anti-CD20 Antibodies
[0211] Approaches to improve on rituximab, the first chimeric
anti-CD20 MAb introduced into lymphoma and autoimmune disease
therapy, include reducing the murine component by CDR-grafting
(humanization) and making fully human MAbs from transgenic mice,
targeting a different CD20 epitope, and enhancing CDC or ADCC
activity by altering Fc structures (Forero et al., Proc 99.sup.th
Ann Meeting of the Am Assoc Cancer Res, 2008, abstract LB-70;
Glennie et al., Mol Immunol. 2007, 44:3823-37). However, it is not
yet known which of these modifications will result in a more potent
anti-CD20 MAb, as measured either by B-cell depletion, control of
autoimmunity, or lymphoma responses in patients, especially when
they are refractive or resistant to rituximab.
[0212] At present, rituximab induces objective responses, mostly
partial responses, in about half of patients with follicular
lymphoma (Castillo et al., Exp Hematol. 2008, 36:755-768), yet both
the optimal therapeutic dose and schedule still remain undefined.
Despite the use of rituximab in virtually all NHL patients for the
past decade, its mechanisms of action, as well as those of other
anti-CD20 MAbs, either in model systems or patients, remain debated
among numerous studies demonstrating cell killing mediated by CDC,
ADCC, and direct signaling with apoptotic effects. (Glennie et al.,
Mol Immunol. 2007, 44:3823-37; Maloney, Hematology Am Soc Hematol
Educ Program. 2007:226-232; Martin et al., Semin Hematol.
2008;45:126-132.)
[0213] Because of our observations that rituximab combined with
epratuzumab showed evidence of improved responses in NHL patients,
with no increased side-effects over those resulting from
monotherapy with rituximab (Goldenberg, Expert Rev Anticancer Ther.
2006, 6:1341-1353; Leonard et al., J Clin Oncol. 2005,
23:5044-5051; Strauss et al., J Clin Oncol. 2006, 24:3880-3886) our
original purpose was to construct a humanized anti-CD20 MAb that
could be combined with epratuzumab, but would be more tolerable for
rapid infusions due to having the FRs of epratuzumab. The first
characterization study of veltuzumab reported similarities to
rituximab in terms of epitope binding, affinity, ADCC, CDC, and
cell growth inhibition in vitro (Stein et al., Clin Cancer Res.
2004, 10:2868-78). After treating patients with indolent NHL, the
anticipated improved tolerability and infusion profile was
confirmed, but also a high rate of complete responses (CR/CRu) was
found. The Phase I/II trial in 82 indolent NHL patients
demonstrated complete response rates for all doses tested (27% for
all follicular lymphoma patients for doses between 80 and 750
mg/m.sup.2 once-weekly.times.4 weeks) (Morschhauser et al., Proc Am
Soc Clin Oncol, J Clin Oncol. 2007, 25(18S):449s, Abstract 8032;
Goldenberg et al., Proc Amer Soc Clin Oncol, J. Clin. Oncol. 2008,
26(15S):142s, Abstract. 3043; Morschhauser et al., J Clin Oncol,
2009 Jul 10;27(20):3346-53. Epub 2009 May 18) exceed those reported
for repeated use of rituximab at its conventional dose in
comparable patients (Davis et al., J Clin Oncol. 2000,
18:3135-3143). These findings prompted us to re-evaluate the
functional properties of veltuzumab in comparison to rituximab.
[0214] Studies in cynomolgus monkeys (Example 12) have confirmed
the effects of various i.v. and s.c. doses, and we found that a
single dose as low as the equivalent of 80 mg/m.sup.2 in humans,
given by either route, is sufficiently potent to induce peripheral
blood and lymphatic organ B-cell depletion. In addition, enhanced
survival and even cures were demonstrated in mice bearing CD20+
lymphoma xenografts after a single, i.p. or s.c. dose as low as
0.05 .mu.g. In these mouse studies, a dose-response was observed,
but no significant difference between the i.v. or s.c. routes was
noted.
[0215] Although different anti-CD20 MAbs have shown some variations
in functional properties and epitope specificities, mediating
different CDC and cell-killing effects (Nishida et al., Int J
Oncol. 2007, 31:29-40), virtually all recognize the large,
extracellular loop and partially or completely crossblock each
other (Polyak et al., J Immunol.1998, 161:3242-3248; Polyak and
Deans, 2002, 99:3256-3262; Perosa et al., Blood 2006,
107:1070-1077) except ofatumumab, which is reported to bind to a
novel epitope of CD20 (Teeling et al., J Immunol. 2006,
177:362-371). Veltuzumab crossblocks binding by rituximab (Stein et
al., Clin Cancer Res. 2004, 10:2868-78), suggesting either the same
epitope is recognized by both MAbs or binding to an adjacent
epitope could result in steric hindrance.
[0216] In the Examples above, the binding and dissociation
parameters of veltuzumab and rituximab were compared both by
Scatchard analyses (Example 3) and off-rate measurements (Example
5). The Scatchard analyses confirmed that veltuzumab and rituximab
have similar affinity for cell-surface CD20 and number of binding
sites per cell (Example 3). Surprisingly, statistically significant
differences between veltuzumab or cA20 vs. rituximab or D101N were
found in a slower off-rate (i.e., longer cell-surface retention) in
all 3 human lymphoma cell lines tested (Example 5), and a higher
CDC-mediated cell killing in Daudi lymphoma cells by veltuzumab
(Example 8), compared to rituximab or D101N. Whether measured in
the presence or absence of a competitive binder, veltuzumab and
cA20, both containing Asp.sub.101 instead of Asn.sub.101 in
CDR3-V.sub.H, yielded significantly (P<0.0001) slower off rates
(.about.2.5-fold) than rituximab or D101N (Example 5).
[0217] The demonstration of CDC activity for veltuzumab in Daudi
being significantly more than rituximab or D101N is also
intriguing, since the Fc portion of veltuzumab is derived from that
of epratuzumab, which fails to show CDC functions (Carnahan et al.,
Mol Immunol. 2007, 44:1331-41). This suggests that rapid
internalization of epratuzumab may prevent it from residing on the
cell surface long enough to form the membrane attack complexes. The
results above also suggest that the off-rate difference between
veltuzumab and rituximab is not related to the enhanced CDC
observed in Daudi cells, as first postulated for ofatumumab
(Teeling et al., Blood 2004, 104:1793-1800), since this difference
was not observed for CDC in two other cell lines that also showed a
significantly slower off-rate with veltuzumab compared to rituximab
(Examples 5 and 8). Since these results with veltuzumab involve
evidently a different targeted epitope of CD20 than ofatumumab, it
does not appear that such off-rate changes are due to the position
of the epitope, as postulated by Teeling et al. (2004).
Nevertheless, it appears that such off-rate changes, as suggested
by Teeling et al. (2004) for ofatumumab and reported herein for
veltuzumab, may explain why a given anti-CD20 antibody functions at
lower concentrations than other MAbs (e.g., rituximab), such as we
have found with veltuzumab (Examples 12 and 13). Whether CDC plays
a role remains unknown.
[0218] It is unlikely that these differences are related to
veltuzumab having the FRs of epratuzumab. The V.sub.H and V.sub.K
chains of cA20 differ from those of rituximab in six positions, but
except for the 101-residue in CDRH3, the remaining five residues
(two in FR4-V.sub.H and three in FR1-V.sub.K) are unlikely to be
responsible for the differential off-rates. Du et al. (Mol Immunol.
2008, 45:2861-2868) reported a weaker interaction of the CDRs of
another anti-CD20 MAb, c2H7, compared to rituximab, suggesting that
the amino acid residues of 2H7 at the equivalent positions in CDRH3
have more bulky side chains, resulting in a wider pocket to
accomodate CD20 peptide. The fact that cA20 and veltuzumab have
virtually the same affinity and off-rate, whereas cA20 has more
similar FRs to rituximab than to veltuzumab, emphasizes the more
critical role of CDRs than the FRs in interacting with CD20. Thus,
the significant difference observed in the off-rate between
veltuzumab/cA20 and rituximab/D101N is apparently due to the single
amino acid difference in CDRH3, and not to the more extensive
differences in the FRs between veltuzumab and rituximab.
Accordingly, we believe this is the first single amino-acid change
in a CDR that is shown to cause a functional effect, resulting in a
more potent antibody.
[0219] The in-vitro off-rate and CDC differences described herein
are comparable to the findings with another anti-CD20 MAb,
ofatumumab, which was reported to bind to a different epitope than
rituximab (Teeling et al., J Immunol. 2006, 177:362-371) and
claimed to be therapeutically more active than rituximab in vitro
(Teeling et al., Blood 2004, 104:1793-1800). However, this is not
consistent with the relatively high doses of ofatumumab chosen for
clinical studies, also requiring long infusion times like rituximab
(Coiffier et al., Blood 2008, 111:1094-1100; Hagenbeek et al.,
Blood 2008, 111:548609), or the lowest dose of 0.5 mg/kg (10
.mu.g/mouse) shown to elicit growth inhibition in lymphoma
xenografts (Bleeker et al., Brit. J. Haematol. 2007,
140:303-312).
[0220] Still another recently developed human anti-CD20 MAb, G101,
which has properties of a Type-II anti-CD20 MAb (Umana et al., Ann
Oncol. 2008, 19 (Suppl 7), abstract 98), has been shown to be more
potent in vitro and in animal models than rituximab, when mice were
given repeated doses of 10-30 mg/kg (Id.) This translates to each
dose of repeated applications being between 200 and 600 .mu.g in a
20-g mouse, which are at least 4,000- to 12,000-fold higher than
the single doses of 0.05 to 0.35 .mu.g of veltuzumab showing high
anti-growth activity in the lymphoma xenografts tested (Examples 11
and 13). Depletion of murine NK cells and neutrophils prevented
these effects of veltuzumab (Example 10), emphasizing the role of
ADCC in vivo, as shown previously for rituximab
(Hernandez-Ilizaliturri et al., Clin Cancer Res. 2003;
9:5866-73).
[0221] These in-vitro, mouse, monkey, and other human studies
indicate (i) that veltuzumab is active at a fraction of the
conventional clinical dose of rituximab or of the minimal
therapeutic doses of two other second-generation anti-CD20 MAbs in
preclinical models, (ii) that the two distinguishing differences in
activity vs. rituximab involve CDC and off-rate functions, and
(iii) that the lower off-rate appears to be related to a single
amino acid mutation at the Kabat-101 residue in the CDRH3.
Example 24
Low-Dose Veltuzumab in Recurrent Non-Hodgkin's Lymphoma (NHL)
Summary
[0222] A total of 82 patients (34 male, 48 female; age 33-85)
received 4 once-weekly doses of 80-750 mg/m.sup.2 veltuzumab, with
study evaluations continued for 12 weeks and then until disease
progression. They had follicular (FL, N=55) or other (N=27) B-cell
NHL, were predominantly stage III/IV (79%) at study entry, and had
received 1-7 prior treatment regimens (median, 1.5), most (89%)
including at least one rituximab-containing regimen.
[0223] Veltuzumab was generally well-tolerated, with drug-related
adverse events being transient (Grade 1-2), and with shorter
infusion times (typically 2 h initially and 1 h subsequently) at
lower doses. In follicular lymphoma, 24/55 patients had objective
responses (OR, 44%), with 15 (27%) complete responses (CR/CRu)
occurring even after 2-5 prior rituximab-regimens, with less
favorable prognosis (elevated LDH, tumors >5 cm, FLIPI
.gtoreq.2), and at all dose levels. In other B-cell NHL, patients
with marginal zone lymphoma had ORs (83%), including 2 CR/CRu's
(33%), one at 80 mg/m.sup.2, while 3/7 patients with diffuse large
B-cell lymphoma had partial responses (43%), including one at 80 m
g/m.sup.2. Even at 80 mg/m.sup.2, B-cells were depleted after 1st
infusion, and mean antibody serum levels exceeded values (25
.mu.g/mL) considered important for anti-CD20 therapy (with apparent
higher levels in responders at this dose), with post-treatment
serum clearance similar to or slower than rituximab.
[0224] Background
[0225] The chimeric anti-CD20 monoclonal antibody (MAb), rituximab
(Rituxan.RTM.; Genentech, South San Francisco, Calif.; Biogen Idec
Pharmaceuticals, San Diego, Calif.), was approved more than a
decade ago for the treatment of relapsed or refractory low-grade or
follicular CD20 positive, B-cell lymphoma. In the pivotal trial in
this population, a 375-mg/m.sup.2 dose administered once weekly for
4 consecutive weeks resulted in a 48% overall response rate (6%
complete responses). (McLaughlin et al., J Clin Oncol 16:2825-2833,
1998.) Expanding on this initial success, rituximab has been
broadly adopted for use in B-cell malignancies (Traulle &
Coiffier, Future Oncol 1:297-306, 2005; Marcus & Hagenbeek, Eur
J Haematol Suppl 67:5-14, 2007; Cheung et al., Cancer Treat Rev
33:161-176, 2007), primarily in combination with chemotherapy
(e.g., Czuczman et al., J Clin Oncol 22:4711-4716, 2004; Coiffier
et al., N Engl J Med 346:235-242, 2002), as well as in autoimmune
disorders (Chambers & Isenberg, Lupus 14:210-214, 2005;
Silverman, Front Biosci 12:2194-2206, 2007; Cohen et al., Arthritis
Rheum 54:2793-2806, 2006; Hauser et al., N Engl J Med 358:676-688,
2008). Second-generation anti-CD20 antibodies have been constructed
in order to increase efficacy, decrease toxicity (primarily
infusion reactions) or immunogenicity, and allow more rapid
administrations (Dorner & Burmester, Curr Opin Rheumatol
20:263-268, 2008; Martin et al., Semin Hematol 45:126-132, 2008;
Genovese et al., Arthritis & Rheumatism 54:S66, 2006;
Morschhauser et al., Blood 110:199a, 2007; Hagenbeek et al., Blood
111:5486-5495, 2008; Coiffier et al., Blood 111:1094-1100,
2008).
[0226] Veltuzumab (hA20) is a CDR (complementarity-determining
region)-grafted, humanized, anti-CD20 IgG-kappa MAb that was
constructed with light chain CDRs and heavy chain CDR1 and CDR2
identical to rituximab, but a different
CDR3-variable-region-heavy-chain construct, and with the remaining
framework regions taken from epratuzumab, a humanized anti-CD22 MAb
(Goldenberg et al., Proc Am Soc Clin Oncol 22:595, 2003; Goldenberg
et al., Proc Am Soc Clin Oncol 26:142s, 2008; Example 1). These
changes resulted in important differences compared to rituximab,
such as significantly slower off-rates in all 3 human lymphoma cell
lines tested (Example 5) and a significantly increased
complement-dependent cytotoxicity in one of these cell lines
(Example 8), while no significant differences in direct
proliferation inhibition, apoptosis, or antibody-mediated
cytotoxicity were observed in vitro (Examples 6 and 9; Goldenberg
et al., Proc Am Soc Clin Oncol 22:595, 2003; Stein et al., Clin
Cancer Res 10:2868-2878, 2004; Goldenberg et al., Proc Am Soc Clin
Oncol 26:142s, 2008). In addition, studies in normal cynomolgus
monkeys (Example 12) and in mice bearing human lymphoma xenografts
(Example 13) found that very low doses of veltuzumab not only given
intravenously, but also subcutaneously, were very effective in
depleting B-cells and controlling tumor growth, respectively, even
curing a significant number of mice (Examples 13 and 14; Goldenberg
et al., Proc Am Soc Clin Oncol 26:142s, 2008).
[0227] The first clinical test of veltuzumab was in a young patient
with systemic lupus erythematosus (SLE) with life threatening
cytopenias who had become refractory to standard salvage
medications and no longer responded to rituximab (Tahir et al.,
Rheumatology 44:561-562, 2005). Veltuzumab was able to deplete
peripheral B-cell levels even in the face of extremely high serum
levels of anti-rituximab antibodies (HACA 43,000 ng/mL; normal
<5 ng/mL), and the patient responded rapidly.
[0228] Since most experience with rituximab is in non-Hodgkin's
lymphoma (NHL), the present Example was performed to characterize
the basic safety, tolerability, pharmacokinetics, pharmacodynamics,
immunogenicity and preliminary efficacy of veltuzumab in this
population, particularly follicular or low-grade lymphoma
(Morschhauser et al., Blood 106:683a, 2005; Morschhauser et al.,
Blood 108:769a, 2006; Morschhauser et al., Proc Am Soc Clin Oncol
25, 449, 2007). Complete trial results, including follow-up with
the last patients entered now at least 6 months beyond treatment,
and with several of the earliest patients continuing in remission
now for more than 3 years, are provided below.
[0229] Methods
[0230] An open-label, single-arm, multicenter phase I/II study of
veltuzumab administered by intravenous infusion to patients with
refractory or recurrent NHL was conducted to evaluate the safety
and effectiveness of veltuzumab in patients with refractory or
recurrent NHL. The study end-points were safety, efficacy
(objective and complete response rates, duration of response, time
to progression), pharmacokinetics, pharmacodynamics, and
immunogenicity.
[0231] All patients received once-weekly doses for 4 consecutive
weeks. The initial portion of the study enrolled cohorts treated at
increasing dose levels from 120 mg/m.sup.2 up to 750 mg/m.sup.2,
i.e., up to twice the dose usually given with rituximab. In the
second portion of the study, additional patients received
veltuzumab at 375 mg/m.sup.2 and below (Morschhauser et al., Blood
106:683a, 2005). It became apparent that objective responses
(increasing complete responses) occurred at all dose levels without
obvious dose response (Morschhauser et al., Blood 108:769a, 2006),
consistent with observations in animal studies that low doses of
this antibody may be effective (Example 13). Since even lower doses
of veltuzumab (including 60 mg/m.sup.2) had shown promise in
several other patients with moderate SLE activity (Example 15), the
protocol was amended and the final patients enrolled in the study
were treated at the lower dose level of 80 mg/m.sup.2 (Morschhauser
et al., Proc Am Soc Clin Oncol 25, 449, 2007).
[0232] Patient population--To be eligible, adults with documented
CD20+B-cell NHL by WHO criteria must have failed at least one prior
standard chemotherapy regimen or rituximab treatment for NHL and
have measurable disease with at least one lesion .gtoreq.1.5 cm by
CT, but no mass >10 cm. Patients must be at least 12 months
beyond any rituximab, without progression during or within 6 months
of rituximab treatment, NCI CTC Grade 3 or 4 toxicity to rituximab,
or known HACA positivity. Eligibility also required hemoglobin
.gtoreq.10 g/dL, ANC.gtoreq.1.5.times.10.sup.9/L,
platelets.gtoreq.100.times.10.sup.9/L (all without transfusional
support), creatinine and bilirubin .ltoreq.1.5.times.institutional
upper limit of normal (IULN), AST and ALT .ltoreq.2.5.times.IULN,
0-1 ECOG or KPS .gtoreq.70 performance status, life expectancy
.gtoreq.6 months, 12 weeks beyond any autologous stem cell
transplant, and 4 weeks any beyond chemotherapy, other experimental
treatments, or any radiation therapy to the index lesion(s).
Patients with primary CNS lymphoma, HIV lymphoma, transformed
lymphoma, symptomatic CNS metastases or carcinomatous meningitis,
pleural effusion with positive cytology for lymphoma, prior
radioimmunotherapy, or prior therapy with other human or humanized
monoclonal antibodies (unless HAHA tested negative) were
ineligible. Other exclusion criteria were known HIV, hepatitis B or
C positivity, known autoimmune disease or presence of autoimmune
phenomena, infection or antibiotic use within 5 days,
corticosteroids within 2 weeks, other cancer within 5 years (except
non-melanoma skin cancer or cervical carcinoma in situ), and other
conditions likely to interfere with study interpretation or
procedures. Women of childbearing potential must have a negative
pregnancy test, and patients of childbearing potential must
practice birth control for at least 12 weeks after treatment.
[0233] Treatment--Veltuzumab was given on a weekly basis for 4
consecutive weeks. All patients were premedicated each week with an
anti-histamine and an anti-pyretic, but no steroids were given
routinely. During dose escalation, cohorts of 3-6 patients received
veltuzumab at increasing dose levels of 120, 200, 375, and 750
mg/m.sup.2, while subsequent patients received veltuzumab at 80,
120, 200 or 375 mg/m.sup.2. For patients remaining stable in the
absence of infusion reactions, guidelines for veltuzumab infusions
allowed the infusion rate to be advanced every 15-30 minutes in
increments of 50 mg/h for the 1.sup.st infusion and 100-200 mg/h
for subsequent infusions. Otherwise, recommended actions included
slowing the infusion rate for mild toxicity; interrupting the
infusion for moderate toxicity for at least 15 minutes or until
symptoms resolve and then resuming at the slowed infusion rate, if
the patient was stable; and permanently discontinuing the infusion
for more serious toxicity.
[0234] Data collection--CT scans (neck, chest, abdomen, pelvis,
other sites of known disease) and physical examinations were
obtained at baseline and 4 weeks after last infusion. Patients
without disease progression continued CT scans and physical
examination at 12 weeks and then every 3 months until the
occurrence of disease progression. Bone marrow biopsy was required
at baseline and in those patients with bone marrow infiltration
only if needed to confirm a complete response. During infusions,
patients were monitored for adverse reactions, with vital signs
obtained every 15 min until completion, and then 30 and 60 min
later. They continued to be monitored for adverse events at
evaluations 4 and 12 weeks after the last infusion and then every 3
months until resolution of any treatment-related abnormalities or
other changes warranting additional follow-up. Blood samples for
routine safety laboratories (serum chemistry, hematology) and
physical examinations were obtained prior to each infusion, 4 and
12 weeks after last infusion, and then every 3 months at follow-up
evaluations until progression of disease.
[0235] Blood samples for B-cell counts (CD19+) were obtained prior
to each infusion, at 1, 4, 8 and 12 weeks after last infusion, and
during follow-up every 3 months until decreased levels returned
towards baseline. Urinalysis, blood samples for T-cell levels
(CD3+) and serum immunoglobulins were determined at baseline, prior
to last infusion, 4 and 12 weeks after last infusion, and then
during follow-up every 3 months until resolution of any
treatment-related abnormalities. Blood samples for veltuzumab serum
levels were obtained prior to and 30 minutes after each infusion,
at 24, 48, 72 and 96 hours after the first and last infusions, and
then at 1, 2, 3, 4, 8 and 12 weeks after last infusion. Blood
samples for immunogenicity (HAHA; human anti-veltuzumab antibodies)
were obtained at baseline, 4 and 12 weeks after last infusion, and
then during follow-up if positive at 12 weeks.
[0236] Study Evaluations--Treatment responses were determined using
international workshop criteria (Cheson et al., J Clin Oncol. 1999,
17:1244-1253), with each patient's best response classified as
either complete response (CR), complete response unconfirmed (CRu),
partial response (PR), stable disease, or progressive disease.
Adverse events (AEs) were classified according to MedDRA system
organ class and preferred term. Toxicity grading of AEs and
laboratories utilized National Cancer Institute (NCI) Common
Toxicity Criteria (CTC), version 3.0. Dose-limiting toxicity (DLT)
was defined as any treatment-related Grade 3 or 4 toxicity or the
following Grade 2 events: autoimmune reaction, asymptomatic
bronchospasm, or generalized urticaria. All laboratory values were
determined locally, except for veltuzumab serum levels and HAHA
determinations, which were performed by the sponsor using an ELISA
test. Pharmacokinetics following last infusion was evaluated with a
single compartment model using WinNonLin 2.1 (Pharsight
Corporation, Mountain View, Calif.).
[0237] Statistical Analysis--Descriptive statistics were used to
summarize demographics, safety and laboratory data, and treatment
response rates, including exact 95% confidence intervals where
indicated. Progression-free survival (PFS), defined as the duration
from the first day of study drug administration to the day of
disease progression (based on physical or radiological (CT)
evidence), death, or last contact, whichever occurred earliest, was
summarized using descriptive statistics as well as statistics based
on the Kaplan-Meier product-limit method. Patients were considered
as censored if they never experienced disease progression or death.
Duration of response, defined as the duration from the first day of
onset of an objective response (OR), ie, CR, CRu, or PR, to the day
of disease progression, death, or last contact, whichever occurred
earliest, was summarized using similar methods.
[0238] Results
[0239] Patient Characteristics--A total of 82 patients (34 men, 48
women, median age 64 years) were enrolled. They were a median of 5
years from initial diagnosis and 1.8 years from last treatment.
Most patients were in good performance status (83% ECOG 0) at study
entry, but with widespread disease (79% Stage III/IV), and with 17
patients (21%) having elevated LDH, and 30 (40%) having at least
one tumor mass >5 cm. All patients received at least one prior
treatment regimen (range, 1-7), and most patients (89%) had
received at least one prior rituximab-containing regimen. Based on
WHO classification (Harris & Ferry, 2001), 55 patients had
follicular lymphoma (FCL), while 27 patients had non-follicular
lymphomas: diffuse large B-cell lymphoma (DLBCL, N=7), mantle cell
lymphoma (MCL, N=7), small lymphocytic lymphoma (SLL, N=5),
marginal zone lymphoma (MZL, N=6) [including nodal MZL (N=2) and
extranodal MZL of mucosa-associated lymphoid tissue (MALT, N=4)],
and lymphoplasmacytoid lymphoma (N=2). Published criteria were used
to assign FLIPI and IPI scores for risk of poor outcome for
patients with follicular and non-follicular lymphomas, respectively
(Solal-Celigny et al., Blood 104:1258-1265, 2004). Demographics and
patient characteristics are summarized in Table 5.
TABLE-US-00005 TABLE 5 Demographics and Baseline Information. All
Patients FCL.sup.1 Other.sup.2 (N = 82) (N = 55) (N = 27) Sex (M/F)
34/48 21/34 13/14 Age, median yrs (range) 64 (33-85) 61 (33-80) 66
(43-85) ECOG: 0, 1, 2 68, 18, 2 45, 10, 0 17, 8, 2 Disease stage at
study entry I 9 5 4 II 7 6 2 III 26 20 6 IV 39 24 15 Yrs from
diagnosis 5.1 5.1 5.1 median (range) (1.2-31.5) (1.6-31.5)
(1.2-15.3) Prior treatment regimens Number, median (range) 1.5
(1-7) 2 (1-7) 1 (1-5) Rituximab containing: 0, 1, .gtoreq.2 9, 49,
24 7, 31, 17 2, 18, 7 Last treatment Yrs from, median (range) 1.8
(0.1-11) 1.9 (0.1-8) 1.6 (0.1-11) Response (yes/no) 76/6 53/2 23/4
Duration of (mo), median 18.0 (2-143) 18.0 (2-79) 19.0 (2-143)
(range) Elevated LDH 17 13 4 Bulky Disease > 5 cm 30 24 6 FLIPI
Low (0-1) 20 Intermediate (2-3) 31 High (4-5) 4 IPI Low (0-1) 9
Low/intermediate (2) 12 High/intermediate (3) 5 High (4-5) 1
Veltuzumab Dose Level 80 mg/m.sup.2 14 9 5 120 mg/m.sup.2 21 17 4
200 mg/m.sup.2 18 13 5 375 mg/m.sup.2 26 14 12 750 mg/m.sup.2 3 2 1
.sup.1Includes follicular grades 1 (N = 31), 2 (N = 18), and 3 (N =
4). Grades were not assigned for 2 patients. .sup.2Includes diffuse
large B-cell lymphoma (N = 7), mantle cell lymphoma (N = 7),
marginal zone lymphoma (N = 6), small lymphocytic lymphoma (N = 5),
and lymphoplasmacytoid lymphoma (N = 2).
[0240] Drug Administration--Of the 82 patients, 78 received 4
infusions, while 3 patients with early progression of disease
withdrew after completing 2-3 veltuzumab infusions, and one SLL
patient with hives and chills at prior rituximab withdrew after
similar Grade 1-2 reactions at the first veltuzumab infusion. Doses
were otherwise administered as prescribed, based on the patient's
body surface area and dose level, except for 3 patients given 1 or
2 of the 4 infusions at reduced doses due to allergic reactions,
and one patient who was inadvertently administered one infusion at
the next higher dose level. Infusion times are summarized in Table
6 for all doses given.
TABLE-US-00006 TABLE 6 Median Infusion Times (hours).* Dose (mg/m2)
N Infusion 1 Infusion 2 Infusion 3 Infusion 4 80 14 1.8 (1.1-3.6)
1.4 (0.6-2.3) 1.2 (0.8-1.6) 1.2 (0.8-1.7) 120 21 2.1 (1.1-4.6) 1.4
(0.7-3.5) 1.4 (0.7-3.5) 1.3 (0.6-3.7) 200 18 2.4 (1.3-8.1) 1.3
(0.8-7.9) 1.5 (0.8-8.8) 1.3 (0.8-8.3) 375 26 3.1 (2.1-7.6) 2.1
(1.6-4.8) 2.1 (1.7-3.8) 2.1 (1.3-6.9) 750 3 4.7 (3.8-6.2) 2.6
(2.2-3.2) 2.4 (2.0-2.8) 2.5 (2.5-2.7) *Median (range) times in
hours from start of infusion to termination of infusion.
[0241] Treatment Response--The single patient who withdrew at first
infusion was unable to be assessed for efficacy. Of the 81 patients
evaluated, 23 had disease progression at or prior to the first
scheduled evaluation 4 weeks after treatment and underwent no
further response evaluations. Otherwise, the best response in each
patient prior to disease progression included 10 with CR, 7 with
CRu, 16 with PR, and 25 with stable disease.
[0242] Calculating objective responses (OR=CR+CRu+PR), the overall
OR and CR/CRu rates were 40.7% (33/81) and 21.0% ( 17/81),
respectively. In follicular lymphoma, the OR and CR/CRu rates were
44% ( 24/55) and 27% ( 15/55), respectively, with both ORs and
CR/CRu's occurring even after 2-5 prior rituximab-regimens, among
follicular patients with less favorable prognosis (FLIPI >2,
elevated LDH, bulky disease >5 cm), and at all dose levels
including 80 mg/m.sup.2. Among the other non-follicular lymphomas,
the overall OR and CR/CRu rates were 35% ( 9/26) and 27% ( 7/26),
respectively. This included MZL patients with ORs (83%), including
2 CR/CRu's (33%), one at 80 mg/m.sup.2, and partial responses in
3/7 DLBCL patients (43%), and 1/7 MCL patients (14%). Table 7
summarizes these results.
TABLE-US-00007 TABLE 7 Objective Treatment Responses.* OR CR/CRu
All Evaluable Patients (N = 81) 40.7% (33/81) 21.0% (17/81)
Follicular Lymphoma (N = 55) 43.6% (24/55) 27.3% (15/55) Dose
(mg/m.sup.2): 80 22.2% (2/9) 11.1% (1/9) 120 41.2% (7/17) 29.4%
(5/17) 200 46.2% (6/13) 30.8% (4/13) 375 50.0% (7/14) 21.4% (3/14)
750 100% (2/2) 100% (2/2) FLIPI: 0-1 55.0% (11/20) 40.0% (8/20)
.gtoreq.2 37.1% (13/35) 20.0% (7/35) Prior Rituximab: 0 57.1% (4/7)
42.9% (3/7) 1 45.2% (14/31) 22.6% (7/31) 2-5 35.3% (6/17) 29.4%
(5/17) Elevated LDH: Yes 23.1% (3/13) 15.4% (2/13) No 50.0% (21/42)
31.0% (13/42) Bulky Disease (>5 cm): Yes 25.0% (6/24) 8.3%
(2/24) No 58.1% (18/31) 41.9% (13/31) Non-Follicular (N = 26) 34.6%
(9/26) 26.9% (7/26) Marginal zone lymphoma.sup.1 83.3% (5/6) 33.3%
(2/6) Diffuse large B-cell lymphoma.sup.2 42.9% (3/7) 0.0% (0/7)
Mantle cell lymphoma.sup.3 14.3% (1/7) 0.0% (0/7) Small lymphocytic
lymphoma.sup.4 0.0% (0/4) 0.0% (0/4) Lymphoplasmacytoid
lymphoma.sup.5 0.0% (0/2) 0.0% (0/2) *Best response prior to
disease progression based on Cheson criteria (OR = CR + CRu + PR,
CR = complete response, CRu = unconfirmed CR, PR = partial
response, SD = stable disease, POD = progression of disease)
.sup.1MZL: 1 CR (80 mg/m.sup.2), 1 CRu (375 mg/m.sup.2), 3 PR (80
mg/m.sup.2, 2 .times. 200 mg/m.sup.2), 1 SD (120 mg/m.sup.2)
.sup.2DLBCL: 3 PR (80 mg/m.sup.2, 2 .times. 375 mg/m.sup.2), 4 POD
(80 mg/m.sup.2, 2 .times. 120 mg/m.sup.2, 200 mg/m.sup.2)
.sup.3MCL: 1 PR (375 mg/m.sup.2), 3 SD (200 mg/m.sup.2, 375
mg/m.sup.2, 750 mg/m.sup.2), 3 POD (120 mg/m.sup.2, 2 .times. 375
mg/m.sup.2) .sup.4SLL: 2 SD (375 mg/m.sup.2), 2 POD (80 mg/m.sup.2,
375 mg/m.sup.2); .sup.5LPL: 2 SD (200 mg/m.sup.2, 375
mg/m.sup.2)
[0243] For all 55 follicular patients, based on Kaplan-Meier
estimates, the median TTP was 6.7 months (95% CI: 3.7-9.3 mo) and
the median time from first infusion to the onset of an OR (TTR) was
3.3 months (95% CI: 1.7-3.7 mo). The 24 patients with an OR had a
median DR of 10.2 months (95% CI: 6.0-22.6 mo) and median TTP of
15.2 mo (95% CI: 9.5-28.2 mo). Kaplan-Meier DR and TTP curves for
the 24 responders are presented in FIG. 15. For the 15 follicular
patients who achieved CR/CRu, the Kaplan-Meier estimated median DR
and TTP were 19.7 months (95% CI: 8.7-32.5 mos.) and 24.2 months
(95% CI: 13.8-34.4 mos.), respectively, including 5 patients still
continuing long-lived responses 15.9 to 37.6 months from the date
of 1.sup.st infusion. Although the sample sizes are small, there
was no decrease in the durability of complete responses at lower
doses, and the single follicular patient with a complete response
at 80 m g/m.sup.2 is still in remission 15.9 months after the
1.sup.st infusion. Among the non-follicular histologies, the 2
complete responses that occurred (one at 80 mg/m.sup.2), as well as
one long-lived stable response (all in marginal zone lymphoma),
were still continuing 15-24 months after treatment.
[0244] Adverse Events--Seventy-eight patients had one or more
adverse events during the study. Of 48 patients with events
considered at least possibly treatment-related, only one patient
had a Grade 3 event, hypogobulinemia which developed during
long-term remission >1 year after treatment. Otherwise, all
events considered at least possibly treatment-related were
mild-moderate (Grades 1-2), most of which were infusion reactions
that occurred predominantly at first infusion, with .ltoreq.11
patients having such events at each of the subsequent infusions.
Table 8 summaries the most frequent events.
[0245] Ten patients had serious adverse events, none of which were
considered even possibly treatment-related, including pre-existing
atrial fibrillation and events occurring during the treatment
period (trauma, cellulitis, sepsis), within the 12-week
post-treatment evaluation period (decreased performance status,
back pain, incidental finding of A-V malformation) or during
long-term follow-up (bladder tumor, pulmonary embolism, urinary
fungal infection).
TABLE-US-00008 TABLE 8 Adverse Events Occurring in .gtoreq.5% of
Patients. Patients with Patients with Events Events Considered at
Least Possibly (Grade .gtoreq.3) Treatment Related (Grade
.gtoreq.3) Fatigue 23% (0%) 13% (0%) Pruritis 13% (0%) 7% (0%)
Fever 13% (0%) 9% (0%) Headache 11% (0%) 4% (0%) Asthenia 11% (0%)
9% (0%) Dyspnea 10% (0%) 4% (0%) Cough 10% (0%) 0% (0%) Abdominal
pain 9% (0%) 4% (0%) Chills 9% (0%) 7% (0%) Arhralgia 9% (0%) 2%
(0%) Diarrhea 7% (0%) 5% (0%) Nausea 7% (0%) 5% (0%) Nasal 7% (0%)
4% (0%) Congestion Peripheral 6% (0%) 2% (0%) Edema Back Pain 6%
(1%) 1% (0%) Myalgia 6% (0%) 2% (0%) Dizziness 6% (0%) 4% (0%)
Pharyngeal pain 6% (0%) 4% (0%) Hypertension 5% (0%) 2% (0%)
Urticaria 5% (0%) 1% (0%) Constipation 5% (0%) 1% (0%) Anemia 5%
(2%) 0% (0%)
[0246] Eighteen patients (22%) had one or more infections. None of
the 4 Grade 3-4 infections were considered treatment-related,
including 3 infections (sepsis, cellulitis, fungal urine infection)
requiring IV antibiotics and one infection (not otherwise
specified) treated with multiple oral antibiotics. Otherwise, all
infections were Grade 1-2 events treated with oral medications,
predominantly involving the respiratory tract, urinary tract or
sinuses.
[0247] Safety Laboratories--Blood samples for hematology and serum
chemistries were obtained prior to each infusion, 4 and 12 weeks
after the last infusion, and then every 3 months as needed at
follow-up evaluations. No abnormal pattern of changes in standard
safety laboratories occurred and few patients had increases in
toxicity grades after treatment (Table 9).
TABLE-US-00009 TABLE 9 Changes of Safety Laboratories: Patients
with Increases in CTC v 3.0 Toxicity Grades From Baseline (N = 82).
Maximum Post-Treatment Grade 1 2 3 4 Hematology Hemoglobin 10 5 1 0
WBC 11 5 1 0 ANC 2 4 2 0 Platelets 4 2 0 0 Serum Chemistry
Creatinine 1 1 1 0 Total bilirubin 5 0 0 0 Alkaline phosphatase 6 0
0 0 SGPT (ALT) 4 0 0 0 SGOT (AST) 4 1 0 0 *Grade 3 events: 3
patients had abnormal laboratories (grade 2 creatinine, grade 2
ANC, grade 1 hemoglobin) at study entry which became Grade 3 at
week 12, while the other patient maintained normal WBC and ANC
levels until week 12.
[0248] Pharmacokinetics--A total of 72 patients who completed all 4
infusions received all veltuzumab doses at the intended dose, had
serum samples collected after both first and last infusions, and
had negative ELISA assay results prior to receiving veltuzumab (one
patient was excluded due to an apparent interfering serum factor of
unknown cause) were included in the analysis of pharmacokinetics.
Table 10 summarizes the mean serum levels prior to and 30 min
following each infusion. At all doses, the mean peak levels at the
first infusion exceeded the 25-.mu.g/mL value considered important
for maintaining efficacy with rituximab (Berinstein et al., Ann
Oncol 9: 995-1001, 1998; Gordon et al., J Clin Oncol 23:1096-1102,
2005; Cartron et al., Crit Rev in Oncol Hematol 62:43-52, 2007).
The antibody accumulated with infusion number at all doses, and
even at 80 mg/m.sup.2, the mean trough serum levels exceeded the
25-.mu.g/mL value by the last infusion. Post-treatment serum
samples were scheduled to be collected 30 min after last infusion,
1, 2, 3 and 4 days later, and at 1, 2, 3, 4, 8 and 12 weeks.
TABLE-US-00010 TABLE 10 Veltuzumab Serum Levels (Mean .+-. SD):
Pre- and Post-Infusion Results (.mu.g/mL). 80 mg/m.sup.2 120
mg/m.sup.2 200 mg/m.sup.2 375 mg/m.sup.2 750 mg/m.sup.2 (N = 12) (N
= 19) (N = 14) (N = 24) (N = 3) Infusion 1 Pre 1.3 .+-. 1.5 0.3
.+-. 0.5 0.3 .+-. 0.6 0.1 .+-. 0.3 0.7 .+-. 0.5 Post 39 .+-. 9 59
.+-. 13 94 .+-. 22 194 .+-. 35 474 .+-. 33 Infusion 2 Pre 11 .+-. 5
18 .+-. 11 28 .+-. 18 75 .+-. 45 222 .+-. 158 Post 48 .+-. 15 86
.+-. 31 125 .+-. 44 276 .+-. 90 632. .+-. 99 Infusion 3 Pre 20 .+-.
7 30 .+-. 19 57 .+-. 29 118 .+-. 51 385 .+-. 77 Post 55 .+-. 15 92
.+-. 44.4 140 .+-. 49 335 .+-. 91 801 .+-. 29 Infusion 4 Pre 27
.+-. 11 43 .+-. 26 72 .+-. 41 173 .+-. 69 495 .+-. 64 Post 68 .+-.
25 100 .+-. 37 170 .+-. 67 404 .+-. 105 996 .+-. 66
[0249] A single-compartment (mono-exponential) model was fit to all
available post-treatment serum-level data in each of the 72
patients. Table 11 summarizes the resulting fit-determined
pharmacokinetic parameters showing that the mean Cmax and AUC
increased with dose level, while the clearance (CL) values showed
no consistent pattern of dose dependence. Most importantly, the
mean T.sub.1/2 values appeared comparable at all doses, and even at
80 mg/m.sup.2, the antibody remained in circulation with a mean
half-life of 20 days. Although a formal comparison was not
performed, there were no major differences in mean peak and trough
or post-treatment pharmacokinetics for the 50 follicular patients
compared to the 22 other non-follicular patients (data not
shown).
TABLE-US-00011 TABLE 11 Veltuzumab Serum Levels (Mean .+-. SD):
Pharmacokinetics After 4th Infusion. 80 mg/m.sup.2 120 mg/m.sup.2
200 mg/m.sup.2 375 mg/m.sup.2 750 mg/m.sup.2 (N = 12) (N = 19) (N =
14) (N = 24) (N = 3) Cmax (.mu.g/mL) 56 .+-. 19 91 .+-. 34 155 .+-.
60 358 .+-. 90 884 .+-. 90 T.sub.1/2 (d) 19.7 .+-. 9.4 14.7 .+-.
7.7 18.4 .+-. 9.8 13.3 .+-. 4.1 16.1 .+-. 1.4
AUC.sub.0.fwdarw..infin. (d .times. .mu.g/mL) 1487 .+-. 646 1952
.+-. 1204 4188 .+-. 2286 7191 .+-. 3262 20647 + 3313 CL
(mL/d/m.sup.2) 67 .+-. 33 108 .+-. 103 230 .+-. 604 72 .+-. 52 37
.+-. 7
[0250] Similar to what has been reported with rituximab (Berinstein
et al., Ann Oncol 9: 995-1001, 1998; Gordon et al., J Clin Oncol
23:1096-1102, 2005; Cartron et al., Crit Rev in Oncol Hematol
62:43-52, 2007), both mean and median peak and trough serum levels
at each infusion were generally higher among patients with
objective responses than in nonresponders, and in spite of small
number of patients, even for those patients treated at the lowest
dose of 80 mg/m.sup.2. Median pre- and post-infusion results are
summarized in Table 12 for all follicular patients with available
data.
TABLE-US-00012 TABLE 12 Veltuzumab Serum Levels During Treatment
for Follicular Lymphoma Responders and Nonresponders. Preinfusion
Postinfusion Infusion Responder N Median (.mu.g/mL) N Median
(.mu.g/mL) 1 Yes 20 0.0 16 90.7 No 21 0.0 15 59.0 2 Yes 20 36.5 16
152.9 No 20 16.1 14 83.5 3 Yes 20 69.2 16 201.0 No 21 33.0 16 75.2
4 Yes 20 93.0 16 201.0 No 21 43.0 16 85.4
[0251] B-cell and Other Immunological Changes--Peripheral blood
B-cell levels (CD19+) were to be determined at baseline, prior to
each infusion, at 4 weeks following the last infusion, and then at
3-month intervals until recovery to baseline. At study entry, 68
patients had low or low-normal peripheral blood B-cell levels
(1-256 cells/.mu.l, median 60), 9 patients (including all 5 SLL
patients) had elevated levels (572-14,712 cells/.mu.l, median
1,782), and 5 patients did not have baseline levels determined.
[0252] FIG. 15 graphs the course of B-cell levels for all patients
who had non-elevated B-cell levels at baseline and at least one
sample obtained during treatment. At laboratories where B-cell
levels were reported as percentage of total lymphocytes, decreases
below the lower limit of quantitation (typically 1%) could not be
determined and for analysis were conservatively set at the limit
prior to converting results to absolute cell counts. As such, the
actual extent of B-cell depletion is likely more complete, but
nonetheless, the results appear comparable for all the dose levels,
including the lowest dose level of 80 mg/m.sup.2.
[0253] The B-cells generally remained depleted until onset of
recovery 6 months after last infusion, with decreased values then
returning towards baseline by 9-12 months, and there is no evidence
that B-cell depletion is less durable at lower dose levels,
although long-term data are still limited for patients treated at
the most recent dose level of 80 mg/m.sup.2.
[0254] The few patients with elevated B-cell levels at study entry
were not included in FIG. 14 for clarity. In spite of greatly
increased baseline values, particularly for the SLL patients, their
B-cell levels were also substantially decreased with treatment
(median 96% decrease), including a 94% decrease in one patient
treated at 80 mg/m.sup.2. However, these were primarily short-lived
responses, most beginning to return towards elevated baseline
values by 12 weeks after the last infusion.
[0255] Quantitative serum immunoglobulin and T-cell levels were to
be obtained from blood samples evaluated at baseline, prior to last
infusion, 4 and 12 weeks later, and then every 3 months for
patients remaining in follow-up. There was no consistent pattern of
clinically significant decreases during the 12-week study period or
in smaller subsets of patients followed up to one year after last
infusion, with median changes from baseline being small at most
time points (typically <5% for IgA and IgG, <15% for T cells,
<20% for IgM).
[0256] Immunogenicity (HAHA)--Seventy patients had at least one
post-treatment serum sample at 4 weeks (N=58), 12 weeks (N=53), 6
months (N=8), or one year (N=2) after last infusion analyzed for
HAHA by ELISA assay. One SLL patient with prior rituximab exposure
was negative at study entry, but developed elevated titers (3,380
ng/mL) 4 weeks after treatment without any apparent clinical
consequence. All other samples were negative (<50 ng/mL).
[0257] Discussion
[0258] Despite evidence of cell killing mediated by antibody
dependent cellular cytotoxicity (ADCC), complement dependent
cytotoxicity (CDC), and direct signaling with apoptosis effects,
the clinically relevant mechanisms of action of anti-CD20
immunotherapy in B-cell malignancies or various autoimmune
disorders remains uncertain (Glennie et al., Mol Immunol
44:3823-3837, 2007). As such, clinical trials of second generation
anti-CD20 antibodies remain necessary and most of these have
focused on antibody doses close to or higher than that typically
given with rituximab (Morschhauser et al., Blood 110:199a, 2007;
Hagenbeek et al., Blood 111:5486-5495, 2008; Coiffier et al., Blood
111:1094-1100, 2008). However, several lines of inquiry, including
animal studies (Example 15), as well as independent studies of
shaving effects in CLL (Kennedy et al., J Immunol 172:3280-3288,
2004; Williams et al., J Immunol 177:7435-7443, 2006), have
suggested that lower doses than the typical 375 mg/m.sup.2 dose
used with rituximab should be explored. The present results
demonstrate that at least with veltuzumab, much lower doses than
375 mg/m.sup.2 are efficacious, both with regard to clinical
responses and ability to deplete peripheral blood B-cells.
[0259] Most patients in this study had follicular lymphoma for
which veltuzumab had an overall 44% objective response, between the
48% rate reported with rituximab in the initial pivotal trial of
rituximab-naive patients (McLaughlin et al, J Clin Oncol
16:2825-2833, 1998) or 40% in patients who previously responded to
rituximab (since many patients here had prior exposure to one or
more rituximab-containing regimens) (Davis et al., J Clin Oncol
18:3135-3143, 2000). Similarly, the rate of complete responses,
either 27% CR/CRu or 16% for CRs alone, exceeded the complete
response rates of 6% and 11% reported in those groups, although
different criteria were used in the earlier studies.
[0260] It is important that veltuzumab responses, including
complete responses, occurred in patients who had received multiple
prior rituximab-regimens as well in patients generally considered
at risk for less-favorable outcome (higher FLIPI scores, elevated
LDH, tumor masses >5 cm). The highest response rates occurred in
the small number of rituximab-naive patients, achieving 57% ORs and
43% CR/CRu's.
[0261] The 10.2 months median DR found for all FL responders in
this study is comparable with the 11.2 months DR reported in
relapsed/refractory, indolent NHL patients after a first
application of rituximab (McLaughlin et al, J Clin Oncol
16:2825-2833, 1998). Although a longer 15.0 months median DR was
reported in patients retreated with rituximab, they all had
achieved an objective response to prior rituximab lasting at least
6 months (Davis et al., J Clin Oncol 18:3135-3143, 2000). In
contrast, patients in this study could not have progressed within 6
months of rituxmab, but an objective response was not required. As
such, they may likely be more refractory and require more time for
veltuzumab to be effective, consistent with the median time to
onset of response of 3.3 months in this study compared to 1.6
months in both of the other rituximab studies (McLaughlin et al.,
1998; Davis et al., 2000), and also consistent with the relatively
long median TTP for responders of 15.2 months seen in this
study.
[0262] As discussed above, there also appeared to be a greater
number of complete responses with veltuzumab compared to these
other studies. This is particularly important because patients with
CR/CRu's in this study generally had durable responses, with the
median DR and PFS currently being 19.7 and 24.2 months,
respectively, both of which may increase further since 5 patients
are still continuing with long-lived responses (15.9-37.6 months).
Thus, despite the lower dose levels studied here, efficacy results
with veltuzumab appeared favorable compared to rituximab when given
once-weekly for 4 weeks.
[0263] Among the non-follicular histologies, veltuzumab achieved an
overall objective response rate of 35% with 27% CR/CRu's.
Veltuzumab did particularly well in marginal zone lymphoma, with
ORs in patients (83%) having either extranodal MALT or nodal type
disease, including 3 long-term responses (15-24 months), one at a
dose level of only 80 mg/m.sup.2. Thus, consistent with favorable
responses previously reported with rituximab (Tsimberidou et al.,
Cancer 107:125-135, 2006; Conconi et al., Blood 102:2741-2745,
2003), veltuzumab shows promising activity for use in marginal zone
lymphoma.
[0264] In DLBCL, no complete responses occurred, but 3/7 patients
achieved a partial response, including one patient treated with 80
mg/m.sup.2. The resulting OR rate of 43% obtained here with 4
weekly doses of veltuzumab is comparable to the 37% rate reported
in DLBCL with 8 weekly doses of rituximab (Coiffier et al., Blood
92:1927-1932, 1998). These findings of promising activity suggest
that veltuzumab may be useful in combination with chemotherapy in
this population, similar to what has been found with rituximab
(Czuczman et al., J Clin Oncol 22:4711-4716, 2004; Coiffier et al.,
N Engl J Med 346:235-242, 2002; Habermann et al., J Clin Oncol
24:3121-3127, 2006), which is approved for use in DLBCL in
combination with CHOP.
[0265] Only one of seven patients with mantle cell lymphoma had an
objective response, a short-lived partial response in a patient
treated with veltuzumab at 120 mg/m.sup.2. This is consistent with
modest response rates, and predominantly partial responses,
reported with single-agent rituximab in this disease (Igarashi et
al., Ann Oncol 13:928-943, 2002; Foran et al., J Clin Oncol
18:317-324, 2000). Patients with relapsed small lymphocytic
lymphoma are known to be relatively refractive to single-agent
rituximab (McLaughlin et al., 1998; Foran et al., J Clin Oncol
18:317-324, 2000), and none of the few patients in this study had
an objective response.
[0266] However, veltuzumab did have other evidence of activity in
SLL, since all the patients had elevated B-cell levels at study
entry (3 above 10,000/mm.sup.3) which decreased after the first
veltuzumab infusion and remained decreased for at least 4 weeks
after the last infusion, and this included one patient treated at
80 mg/m.sup.2 with initial levels >10,000/mm.sup.3 subsequently
decreased by 94%. Two studies of rituximab in patients with
Waldenstrom's macroglobulenemia and immunocytoma reported only
modest response rates with no complete responses (Foran et al., J
Clin Oncol 18:317-324, 2000; Gertz et al., Leuk Lymphoma
45:2047-2055, 2004), and thus it is not surprising that neither of
the 2 patients in this study with lymphoplasmacytic lymphoma had an
objective response.
[0267] Concerning veltuzumab pharmacokinetics, at 375 mg/m.sup.2
the mean peak and trough serum antibody levels achieved with
veltuzumab were comparable to values reported for rituximab
(Berinstein et al., Ann Oncol 9: 995-1001, 1998). Even at 80
mg/m.sup.2, B-cell depletion occurred after the first infusion,
antibody serum levels after the first infusion exceeded the
25-.mu.g/mL value associated with maintained efficacy (Berinstein
et al., 1998; Gordon et al., 2005; Cartron et al. 2007), and
continued to increase with each successive infusion, and veltuzumab
remained in circulation after last infusion with a half-life
comparable to or at least as long as reported in rituximab studies
(Berinstein et al., 1998; Cartron et al. 2007).
[0268] We found the same relationship of higher serum levels in
responders reported with rituximab (Berinstein et al., 1998; Gordon
et al., 2005; Cartron et al., 2007), and although the numbers were
small, this trend was still seen even for patients only treated at
the lowest dose of 80 mg/m.sup.2. These pharmacokinetic and
pharmacodynamic findings suggest the lower veltuzumab doses were
adequate to overcome the antigenic sink, thus supporting the
demonstration of clinical activity that occurred at all dose levels
in this study, including 80 mg/m.sup.2.
[0269] An added benefit of using lower doses is the decreased
infusion time. With veltuzumab, the median first infusion times
were 4.7 hours at 750 mg/m.sup.2, 3.1 hours at 375 mg/m.sup.2, and
1.8-2.4 hours at lower doses, while median times for subsequent
infusions were 2.1-2.6 hours at 375 or 750 mg/m.sup.2, and 1.2-1.5
hours at lower doses. At these shorter infusion times, there were
no serious infusion reactions or increases in the frequency of more
common infusion reactions. This is important, because the protocol
limited the rate of infusions in this first study, so that even
more rapid administrations are likely possible with this agent.
Veltuzumab also had no significant clinical impact on standard
safety laboratories, T-cell levels, or serum immunoglobulins. Only
one case of HAHA response occurred, of uncertain clinical
significance; otherwise, there was no evidence of veltuzumab
immunogenicity.
[0270] The first clinical study of rituximab evaluated single doses
of 10-500 mg/m.sup.2, with several partial responses achieved at
doses of 100 mg/m.sup.2 and above (Maloney et al., Blood 84:
2457-2466, 1994). In the next rituximab study, only doses of 125
mg/m.sup.2 and higher were given once weekly for 4 weeks, and the
now standard 375-mg/m.sup.2 dose was selected at that point for
further development, apparently on the basis of logistical rather
than scientific considerations, since the actual response rates
(all partial responses) were identical at each dose level tested
(Maloney et al., J Clin Oncol 15:3266-3274, 1997). A better
understanding of pharmacokinetics and factors influencing patient
response is clearly needed to optimize dosing (Cartron et al., Crit
Rev in Oncol Hematol 62:43-52, 2007), but after the initial
approval of rituximab, 375-mg/m.sup.2 and even higher doses were
accepted for clinical use with anti-CD20 antibodies without
critical evaluation, or consideration of lower levels. However, the
recent evidence of "shaving" in chronic lymphocytic leukemia has
led others to suggest that low doses may be effective in that
disease (Kennedy et al., J Immunol 172:3280-3288, 2004; Williams et
al., J Immunol 177:7435-7443, 2006). Low doses also would be
expected to be effective against lower CD20 tumor burdens, such as
lymphoma patients with small volume disease or undergoing
maintenance therapy, or in B-cell mediated autoimmune diseases,
where there may be much less of a CD20 sink than in malignant
diseases, and where overly aggressive B-cell suppression may not be
needed nor desirable.
[0271] In summary, this Example demonstrated that veltuzumab is not
only well-tolerated, but also that low doses are active, with
B-cell depletion and complete responses occurring at all doses
evaluated, including 80 mg/m.sup.2. Lower doses are also important
because of the opportunity to deliver veltuzumab by subcutaneous
injection using a more concentrated antibody formulation, as has
been shown in animal models (Example 15).
Example 25
hA20 Variants
TABLE-US-00013 [0272] Alternate H-CDR3 Fc Nomenclature Name 101 102
239 332 Note v-mab Veltuzumab; D V S I Slower off-rate hA20 V102Y
.cndot. Y .cndot. .cndot. CDR variant of v-mab Ex. 25A with similar
or equivalent in vitro and in vivo properties YDE .cndot. Y D E Fc
variant of V102Y Ex. 25B with enhanced ADCC v-mab-DE .cndot.
.cndot. D E Fc variant of v-mab Ex. 25C with enhanced ADCC D101N
.cndot. .cndot. .cndot. CDR variant of v-mab with faster off-rate
The amino acid residue identical to that of v-mab at the
corresponding position is indicated with .cndot.
Materials and methods
[0273] PCR were performed according to the standard PCR protocol.
DNA sequencing was performed by SeqWright (Houston, Tex.). The
restriction enzymes were purchased from New England Biolabs. The
primers were made through Fisher Scientific.
A. Variant V102Y
[0274] V102Y is the variant of hA20 with one amino acid change of
Val to Tyr at the 102 position (Kabat's numbering) in the CDR3 of
VH. SEQ ID NOS 6 & 21, respectively.
TABLE-US-00014 .sub.102 .sub.102 V.sub.102Y mutant: STYYGGDWYFDV
-> STYYGGDWYFDY (Val -> Tyr) VH-CDR3 VH-CDR3
[0275] Thus, CDRH3 in V102Y is STYYGGDWYFDY (SEQ ID NO:21).
[0276] Vector Construction and Cloning Scheme
[0277] Four primers were used:
TABLE-US-00015 5' V102Y primer (40 mers) (SEQ ID NO: 22)
CGGTGACTGGTACTTCGATTACTGGGGCCAAGGCACCACG 3' V102Y primer (40 mers)
(SEQ ID NO: 23 CGTGGTGCCTTGGCCCCAGTAATCGAAGTACCAGTCACCG 5' Xho I
primer (20 mers) (SEQ ID NO: 24) CCTCGAGCACACAGGACCTC 3' Hind III
primer (20 mers) (SEQ ID NO: 25) AAAGCTTGCGGCCGCGATCC
[0278] The cloning scheme was as follows: [0279] DNA template:
hA20-IgG-pdHL2 [0280] 5' Xho I primer & 3' V102Y primer [0281]
PCR product #1: 510 by [0282] DNA template: hA20-IgG-pdHL2 [0283]
5' V102Y primer & 3' Hind III primer [0284] PCR product #2: 210
by
[0285] PCR product #1& #2 were purified from gel, mixed in
equal molar amounts as template and PCR with 5' Xho I & 3' Hind
III as primers to generate PCR product #3 (680 bp), which was
cloned into pGEMT and confirmed with XhoI and HindIll digestion,
followed by sequencing. Ligating PCR product #3 with the Xho I/Hind
III restricted fragment of hA20-IgG-pdHL2 completed the expression
vector for V102Y, designated as V102Y-hA20-IgG-pdHL2).
[0286] Transfection and Protein Purification
[0287] V102Y-hA20-pdHL2 (30 .mu.g) was linearized by digestion with
Sal I, followed by phenol, chloroform extraction, and precipitate
with 100% ethanol and ammonium acetate. The DNA pellet was
resuspended into electroporation buffer (20 mM HEPES, pH 7.0; 137
mM NaCl, 5 mM KCl, 0.7 mM Na.sub.2HPO.sub.4, and 6 mM Dextrose),
then mixed with 2.8.times.10.sup.6 SpESF cells and electroporated
with electroporator GenePulser Xcell BioRad @ capacitance 25 .mu.F,
450 V, resistance infinite ohms, 4 mm cuvette. The medium was added
and plated on 96-wells plates.
[0288] After 48 hours, equal volume of the selection medium
containing 0.2 .mu.M MTX was added. About 10 days, the clones were
screen by ELISA using mouse anti-hA20 antibody coated on the plates
and anti-human Fc-HRP conjugate. The color was developed with OPD
and H.sub.2O.sub.2.
[0289] The clone with the highest productivity (42 mg/L) was
selected and designated as 3D10. V102Y was made in roller bottles,
purified with protein A, and its purity shown by SDS-PAGE and
size-exclusion HPLC. Other characterizations included off-rate
determination and ADCC assay.
B. Variant YDE
[0290] YDE is a mutant of V102Y with two 2 amino acid mutations on
the CH2 domain of Fc: S 239 D (TCA.fwdarw.GAT) & I 332 E
(ATC.fwdarw.GAA)
[0291] Like V102Y, CDRH3 in YDE is STYYGGDWYFDY (SEQ ID NO:21).
[0292] Vector Construction and Cloning Scheme
[0293] Six primers were designed for the two amino acid
mutations:
TABLE-US-00016 5' PstI-Fc (20 mers) 5' CTCTGCAGAGCCCAAATCTT (SEQ ID
NO: 26) 3' S239D (23 mers) 5' AGAGGAAGACATCCGGTCCCCCC (SEQ ID NO:
27) 5' S239D (23 mers) 5' GGGGGGACCGGATGTCTTCCTCT (SEQ ID NO: 28)
3' I332E (23 mers) 5' ATGGTTTTCTCTTCGGGGGCTGG (SEQ ID NO: 29) 5'
I332E (23 mers) 5' CCAGCCCCCGAAGAGAAAACCAT (SEQ ID NO: 30) 3'
PstI-Fc (20 mers) 5' ACCTGCAGGCGGCCGTCGCA (SEQ ID NO: 31)
[0294] The cloning scheme was as follows: [0295] DNA template:
1826-SV3 (an in-house staging vector) [0296] PCR#1: 5' PstI-Fc
& 3' S239D primers->207 by [0297] PCR#2: 5' S239D & 3'
I332E primers->303 by [0298] PCR#3: 5' I332E & 3' PstI-Fc
primers->477 by
[0299] Each PCR product was gel-purified, mixed in equal molar
concentration to obtain PCR#4 (941 bp) using 5' PstI-Fc and 3'
PstI-Fc as primers. PCR#4 was cloned into pGEMT and confirmed by
sequencing. The fragment was then digested from pGEMT with PstI and
cloned into an intermediate vector, 1826-SV3, which was also
digested with PstI. Ligating PCR#4 cut from the staging vector with
EagI with the EagI-restricted V102Y-hA20-IgG-pdHL2 completed the
construction of the final YDE-hA20-pdHL2.
[0300] Transfection and Protein Purification
[0301] The same procedures as described above for V102Y were used
to obtain the production clone for YDE, which was purified from
cell culture by protein A, and its purity shown by SDS-PAGE and
SE-HPLC. YDE was shown to have enhanced ADCC compared to either
v-mab or V102Y.
C. Variant v-mab-DE
[0302] v-mab-DE is a Fc variant of v-mab, with the same amino acid
mutations on the CH2 domain of Fc as YDE. The same primers and
cloning scheme as described for YDE in Example 2 were used in the
construction of the expression vector v-mab-DE-hA20-pdHL2, which
has not been transfected.
[0303] ADCC Assays of hA20 Variants
[0304] ADCC assay was performed as follows. Briefly, Daudi cells
were plated at 10.sup.4 cells/well in 50 .mu.L of assay media (RPMI
1640 no phenol red, 1% Glutamax, 1% PenStrep). One set of wells
received only the media for background control and another set of
wells received cells only and served as the control for maximum
cell lysis.
[0305] For each assay, the PBMC collected from one donor was used.
Blood was drawn into heparinized tubes (approximately 50mL of
blood/donor) at which time UNI-SEP maxi tubes (NOVAmed, LTD.) were
used for density gradient separation of the lymphocytes.
Approximately 3 mL of PBMC at 1.6.times.10.sup.7 cells /mL was
obtained with each donor.
[0306] Each assay used an effector to target ratio of 40 to 1, 5
.mu.g/mL of antibody. After 4-h incubation in a humidified
incubator at 37.degree. C., 5% CO2, the plates were removed from
the incubator, allowed to reach room temperature, and analyzed with
CytoTox-One Homogenous Membrane Integrity Assay Kit according to
manufacturer's protocol. The percent of lysis for each sample in 6
replicates was determined using the following formula:
% Lysis = [ Experimental - ( Effector + Target Control ) ] (
Maximum Lysis - Target Control ) .times. 100 ##EQU00002##
[0307] The table below summarizes the ADCC results (% lysis)
obtained with Daudi as the target cell from three donors. For each
donor, the difference between YDE and either v-mab or V102Y was
statistically significant (p<0.0001 for donor 009; p<0.0002
for donor 006; p<0.02 for donor 001). The difference between
v-mab and V102Y was not statistically significant. The isotype
control (h734 IgG) showed minimal ADCC.
TABLE-US-00017 Donor 009 Donor 006 Donor 001 v-mab 36.7 .+-. 3.7
21.1 .+-. 4.2 52.5 .+-. 4.3 V102Y 33.4 .+-. 7.7 24.2 .+-. 2.7 47.5
.+-. 0.5 YDE 54.5 .+-. 2.7 31.5 .+-. 3.6 58.3 .+-. 3.3 h734 IgG 4.2
.+-. 2.6 0.06 .+-. 3.5 4.2 .+-. 2.8
[0308] All of the COMPOSITIONS and METHODS disclosed and claimed
herein can be made and used without undue experimentation in light
of the present disclosure. While the compositions and methods have
been described in terms of preferred embodiments, it is apparent to
those of skill in the art that variations maybe applied to the
COMPOSITIONS and METHODS and in the steps or in the sequence of
steps of the METHODS described herein without departing from the
concept, spirit and scope of the invention. More specifically,
certain agents that are both chemically and physiologically related
may be substituted for the agents described herein while the same
or similar results would be achieved. All such similar substitutes
and modifications apparent to those skilled in the art are deemed
to be within the spirit, scope and concept of the invention as
defined by the appended claims.
[0309] This application is based on and claims priority to U.S.
Provisional Patent application Ser. No. 61/082,399, filed Jul. 21,
2008. The disclosure of the priority application in its entirety,
including the drawings, claims, and the specification thereof, is
incorporated herein by reference. In addition, the content of all
articles, patents and patent applications referenced herein are
incorporated in their entirety.
Sequence CWU 1
1
33110PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Arg Ala Ser Ser Ser Val Ser Tyr Ile His 1 5 10
27PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 2Ala Thr Ser Asn Leu Ala Ser 1 5 39PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 3Gln
Gln Trp Thr Ser Asn Pro Pro Thr 1 5 45PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 4Ser
Tyr Asn Met His 1 5 517PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 5Ala Ile Tyr Pro Gly Asn Gly
Asp Thr Ser Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly 612PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 6Ser
Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asp Val 1 5 10
7318DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7gac atc cag ctg acc cag tct cca gca atc
ctg tct gca tct cca ggg 48Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile
Leu Ser Ala Ser Pro Gly 1 5 10 15 gag aag gtc aca atg act tgc agg
gcc agc tca agt gta agt tac atc 96Glu Lys Val Thr Met Thr Cys Arg
Ala Ser Ser Ser Val Ser Tyr Ile 20 25 30 cac tgg ttc cag cag aag
cca gga tcc tcc ccc aaa ccc tgg att tat 144His Trp Phe Gln Gln Lys
Pro Gly Ser Ser Pro Lys Pro Trp Ile Tyr 35 40 45 gcc aca tcc aac
ctg gct tct gga gtc cct gtt cgc ttc agt ggc agt 192Ala Thr Ser Asn
Leu Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser 50 55 60 ggg tct
ggg act tct tac tct ctc aca atc agc aga gtg gag gct gaa 240Gly Ser
Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu 65 70 75 80
gat gct gcc act tat tac tgc cag cag tgg act agt aac cca ccc acg
288Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr
85 90 95 ttc gga ggg ggg acc aag ctg gag atc aaa 318Phe Gly Gly Gly
Thr Lys Leu Glu Ile Lys 100 105 8106PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
8Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Leu Ser Ala Ser Pro Gly 1
5 10 15 Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr
Ile 20 25 30 His Trp Phe Gln Gln Lys Pro Gly Ser Ser Pro Lys Pro
Trp Ile Tyr 35 40 45 Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Val
Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr
Ile Ser Arg Val Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys
Gln Gln Trp Thr Ser Asn Pro Pro Thr 85 90 95 Phe Gly Gly Gly Thr
Lys Leu Glu Ile Lys 100 105 9363DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 9cag gtc caa ctg
cag cag cct ggg gct gag ctg gtg aag cct ggg gcc 48Gln Val Gln Leu
Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 tca gtg
aag atg tcc tgc aag gct tct ggc tac aca ttt acc agt tac 96Ser Val
Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30
aat atg cac tgg gta aaa cag aca cct ggt cgg ggc ctg gaa tgg att
144Asn Met His Trp Val Lys Gln Thr Pro Gly Arg Gly Leu Glu Trp Ile
35 40 45 gga gct att tat ccc gga aat ggt gat act tcc tac aat cag
aag ttc 192Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln
Lys Phe 50 55 60 aaa ggc aag gcc aca ttg act gca gac aaa tcc tcc
agc aca gcc tac 240Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser
Ser Thr Ala Tyr 65 70 75 80 atg cag ctc agc agc ctg aca tct gag gac
tct gcg gtc tat tac tgt 288Met Gln Leu Ser Ser Leu Thr Ser Glu Asp
Ser Ala Val Tyr Tyr Cys 85 90 95 gca aga tcg act tac tac ggc ggt
gac tgg tac ttc gat gtc tgg ggc 336Ala Arg Ser Thr Tyr Tyr Gly Gly
Asp Trp Tyr Phe Asp Val Trp Gly 100 105 110 caa ggg acc acg gtc acc
gtc tcc tca 363Gln Gly Thr Thr Val Thr Val Ser Ser 115 120
10121PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 10Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu
Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser
Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Asn Met His Trp Val Lys Gln
Thr Pro Gly Arg Gly Leu Glu Trp Ile 35 40 45 Gly Ala Ile Tyr Pro
Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys
Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met
Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90
95 Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asp Val Trp Gly
100 105 110 Gln Gly Thr Thr Val Thr Val Ser Ser 115 120
11516DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 11tctagacaca ggacctcacc atg gga tgg agc
tgt atc atc ctc ttc ttg gta 53 Met Gly Trp Ser Cys Ile Ile Leu Phe
Leu Val -15 -10 gca aca gct ac aggtaagggg ctcacagtag caggcttgag
gtctggacat 104Ala Thr Ala Thr -5 atatatgggt gacaatgaca tccactttgc
ctttctctcc ac a ggt gtc cac tcc 159 Gly Val His Ser -1 gac atc cag
ctg acc cag tct cca tca tct ctg agc gca tct gtt gga 207Asp Ile Gln
Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 gat
agg gtc act atg act tgt agg gcc agc tca agt gta agt tac atc 255Asp
Arg Val Thr Met Thr Cys Arg Ala Ser Ser Ser Val Ser Tyr Ile 20 25
30 cac tgg ttc cag cag aaa cca ggg aaa gca cct aaa ccc tgg att tat
303His Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro Trp Ile Tyr
35 40 45 gcc act tcg aac ctg gct tct ggt gtc cct gtc cga ttc tct
ggc agc 351Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Val Arg Phe Ser
Gly Ser 50 55 60 gga tct ggg aca gat tac act ttc acc atc agc tct
ctt caa cca gaa 399Gly Ser Gly Thr Asp Tyr Thr Phe Thr Ile Ser Ser
Leu Gln Pro Glu 65 70 75 80 gac att gca aca tat tat tgt cag cag tgg
act agt aac cca ccc acg 447Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Trp
Thr Ser Asn Pro Pro Thr 85 90 95 ttc ggt gga ggg acc aag ctg gag
atc aaa cgtgagtaga atttaaactt 497Phe Gly Gly Gly Thr Lys Leu Glu
Ile Lys 100 105 tgcttcctca gttggatcc 51612125PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
12Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly
-15 -10 -5 Val His Ser Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu
Ser Ala -1 1 5 10 Ser Val Gly Asp Arg Val Thr Met Thr Cys Arg Ala
Ser Ser Ser Val 15 20 25 Ser Tyr Ile His Trp Phe Gln Gln Lys Pro
Gly Lys Ala Pro Lys Pro 30 35 40 45 Trp Ile Tyr Ala Thr Ser Asn Leu
Ala Ser Gly Val Pro Val Arg Phe 50 55 60 Ser Gly Ser Gly Ser Gly
Thr Asp Tyr Thr Phe Thr Ile Ser Ser Leu 65 70 75 Gln Pro Glu Asp
Ile Ala Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn 80 85 90 Pro Pro
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 95 100 105
13726DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 13ctcgagcaca caggacctca cc atg gga tgg agc
tgt atc atc ctc ttc ttg 52 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu
-15 -10 gta gca aca gct ac aggtaagggg ctcacagtag caggcttgag
gtctggacat 106Val Ala Thr Ala Thr -5 atatatgggt gacaatgaca
tccactttgc ctttctctcc ac a ggt gtc cac tcc 161 Gly Val His Ser -1
cag gtc caa ctg cag caa tca ggg gct gaa gtc aag aaa cct ggg tca
209Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15 tcg gtg aag gtc tcc tgc aag gct tct ggc tac acc ttt act
agt tac 257Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr
Ser Tyr 20 25 30 aat atg cac tgg gtc aag cag gca cct gga cag ggt
ctg gaa tgg att 305Asn Met His Trp Val Lys Gln Ala Pro Gly Gln Gly
Leu Glu Trp Ile 35 40 45 gga gct att tat ccc gga aat ggt gat act
tcc tac aat cag aag ttc 353Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr
Ser Tyr Asn Gln Lys Phe 50 55 60 aag ggt aaa gcc aca ctg act gcc
gac gaa tcc acc aat aca gcc tac 401Lys Gly Lys Ala Thr Leu Thr Ala
Asp Glu Ser Thr Asn Thr Ala Tyr 65 70 75 80 atg gag ctg agc agc ctg
agg tct gag gac acg gca ttt tat tac tgt 449Met Glu Leu Ser Ser Leu
Arg Ser Glu Asp Thr Ala Phe Tyr Tyr Cys 85 90 95 gca aga tcg act
tac tac ggc ggt gac tgg tac ttc gat gtc tgg ggc 497Ala Arg Ser Thr
Tyr Tyr Gly Gly Asp Trp Tyr Phe Asp Val Trp Gly 100 105 110 caa ggc
acc acg gtc acc gtc tcc tca ggtgagtcct tacaacctct 544Gln Gly Thr
Thr Val Thr Val Ser Ser 115 120 ctcttctatt cagcttaaat agattttact
gcatttgttg ggggggaaat gtgtgtatct 604gaatttcagg tcatgaagga
ctagggacac cttgggagtc agaaagggtc attgggagcc 664cgggctgatg
cagacagaca tcctcagctc ccagacttca tggccagaga tttataggat 724cc
72614140PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 14Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val
Ala Thr Ala Thr Gly -15 -10 -5 Val His Ser Gln Val Gln Leu Gln Gln
Ser Gly Ala Glu Val Lys Lys -1 1 5 10 Pro Gly Ser Ser Val Lys Val
Ser Cys Lys Ala Ser Gly Tyr Thr Phe 15 20 25 Thr Ser Tyr Asn Met
His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu 30 35 40 45 Glu Trp Ile
Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn 50 55 60 Gln
Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Glu Ser Thr Asn 65 70
75 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Phe
80 85 90 Tyr Tyr Cys Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr
Phe Asp 95 100 105 Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
110 115 120 15121PRTMus sp. 15Gln Val Gln Leu Gln Gln Pro Gly Ala
Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Asn Met His Trp Val
Lys Gln Thr Pro Gly Arg Gly Leu Glu Trp Ile 35 40 45 Gly Ala Ile
Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe 50 55 60 Lys
Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr 65 70
75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr
Cys 85 90 95 Ala Arg Ser Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asn
Val Trp Gly 100 105 110 Gln Gly Thr Thr Val Thr Val Ser Ser 115 120
16102PRTMus sp. 16Gln Ile Val Leu Ser Gln Ser Pro Ala Ile Leu Ser
Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Arg Ala Ser
Ser Ser Val Ser Tyr Ile 20 25 30 His Trp Phe Gln Gln Lys Pro Gly
Ser Ser Pro Lys Pro Trp Ile Tyr 35 40 45 Ala Thr Ser Asn Leu Ala
Ser Gly Val Pro Val Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr
Ser Tyr Ser Leu Thr Ile Ser Arg Val Glu Ala Glu 65 70 75 80 Asp Ala
Ala Thr Tyr Tyr Cys Gln Gln Trp Thr Ser Asn Pro Pro Thr 85 90 95
Phe Gly Gly Gly Thr Lys 100 1740DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 17cggtgactgg tacttcaatg
tctggggcca aggcaccacg 401820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 18aaagcttgcg gccgcgatcc
201940DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 19cgtggtgcct tggccccaga cattgaagta ccagtcaccg
402020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20cctcgagcac acaggacctc 202112PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 21Ser
Thr Tyr Tyr Gly Gly Asp Trp Tyr Phe Asp Tyr 1 5 10
2240DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22cggtgactgg tacttcgatt actggggcca aggcaccacg
402340DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23cgtggtgcct tggccccagt aatcgaagta ccagtcaccg
402420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24cctcgagcac acaggacctc 202520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25aaagcttgcg gccgcgatcc 202620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 26ctctgcagag cccaaatctt
202723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 27agaggaagac atccggtccc ccc 232823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28ggggggaccg gatgtcttcc tct 232923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 29atggttttct cttcgggggc tgg
233023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 30ccagcccccg aagagaaaac cat 233120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31acctgcaggc ggccgtcgca 203212PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 32Ser Thr Tyr Tyr Gly Gly Asp
Trp Tyr Phe Asn Val 1 5 10 3313PRTArtificial SequenceDescription of
Artificial
Sequence Synthetic peptide 33Ser His Tyr Gly Ser Asn Tyr Val Asp
Tyr Phe Asp Tyr 1 5 10
* * * * *