U.S. patent application number 13/470729 was filed with the patent office on 2012-08-30 for combination motif immune stimulatory oligonucleotides with improved activity.
This patent application is currently assigned to COLEY PHARMACEUTICAL GMBH. Invention is credited to DOUGLAS C. HANSON, ARTHUR M. KRIEG, ULRIKE SAMULOWITZ, EUGEN UHLMANN, JORG VOLLMER.
Application Number | 20120219571 13/470729 |
Document ID | / |
Family ID | 40130811 |
Filed Date | 2012-08-30 |
United States Patent
Application |
20120219571 |
Kind Code |
A1 |
VOLLMER; JORG ; et
al. |
August 30, 2012 |
COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED
ACTIVITY
Abstract
Immunostimulatory oligonucleotides, which contain a CpG
immunostimulatory motif and a second motif that is capable of
forming secondary structure, including duplex and higher order
structures in vitro and in vivo, are disclosed. They include
nucleic acids, or pharmaceutically acceptable salts thereof, having
base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID
NO: 1), in which each C is unmethylated and 3' refers to the 3' end
of the nucleic acid. The oligonucleotides activate B cells and NK
cells and induce expression of type I interferon and
interferon-.gamma.. The oligonucleotides are useful for treating a
variety of disorders and conditions, including allergy, asthma,
infection, and cancer. In addition to their use as single agents
and as combination therapies, the disclosed oligonucleotides are
useful as adjuvants in vaccines.
Inventors: |
VOLLMER; JORG; (DUSSELDORF,
DE) ; UHLMANN; EUGEN; (GLASHUETTEN, DE) ;
KRIEG; ARTHUR M.; (WELLESLEY, MA) ; HANSON; DOUGLAS
C.; (NIANTIC, CT) ; SAMULOWITZ; ULRIKE;
(LANGENFELD, DE) |
Assignee: |
COLEY PHARMACEUTICAL GMBH
Dusseldorf
NY
PFIZER INC
New York
MA
COLEY PHARMACEUTICAL GROUP, INC.
Wellesley
|
Family ID: |
40130811 |
Appl. No.: |
13/470729 |
Filed: |
May 14, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12190402 |
Aug 12, 2008 |
8198251 |
|
|
13470729 |
|
|
|
|
60964477 |
Aug 13, 2007 |
|
|
|
Current U.S.
Class: |
424/184.1 ;
536/23.1 |
Current CPC
Class: |
A61P 37/00 20180101;
A61P 31/00 20180101; C12N 15/117 20130101; A61P 37/04 20180101;
A61P 35/00 20180101; A61P 35/02 20180101; A61P 31/04 20180101; A61P
31/12 20180101; A61P 31/10 20180101; C12N 2310/17 20130101; A61P
37/08 20180101; A61K 31/7088 20130101; A61K 39/39 20130101; C12N
2310/315 20130101; A61K 2039/55561 20130101; A61P 33/00 20180101;
C12N 2310/31 20130101 |
Class at
Publication: |
424/184.1 ;
536/23.1 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; A61P 37/04 20060101 A61P037/04; A61P 31/00 20060101
A61P031/00; A61P 37/08 20060101 A61P037/08; C07H 21/04 20060101
C07H021/04; A61P 35/00 20060101 A61P035/00 |
Claims
1.-20. (canceled)
21. An immunostimulatory oligonucleotide having a base sequence
comprising 5' T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ
ID NO: 2), wherein each * represents a stabilized internucleotide
linkage and _ represents a phosphodiester or phosphodiester-like
internucleotide linkage.
22. The immunostimulatory oligonucleotide according to claim 21,
wherein each * in SEQ ID NO: 2 represents a phosphorothioate
internucleotide linkage and _ represents a phosphodiester
internucleotide linkage.
23. An immunostimulatory oligonucleotide having a base sequence
comprising 5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ
ID NO: 3), wherein each * represents a stabilized internucleotide
linkage and the oligonucleotide is 23-26 nucleotides in length.
24. The immunostimulatory oligonucleotide according to claim 23,
wherein each * in SEQ ID NO: 3 represents a phosphorothioate
internucleotide linkage.
25. An immunostimulatory oligonucleotide having a base sequence
comprising 5' TCGTCGTTTTCGGCGCGCGCCGTX.sub.1X.sub.2X.sub.3X.sub.4
3' (SEQ ID NO: 6), wherein each C is unmethylated, X.sub.1,
X.sub.2, X.sub.3, and X.sub.4 are each independently a nucleotide
base, and X.sub.1X.sub.2X.sub.3X.sub.4 is not TTTT.
26. A pharmaceutical composition comprising an immunostimulatory
oligonucleotide according to claim 21, a pharmaceutically
acceptable carrier, and an optional antigen.
27. A method of treating a disorder or condition in a subject
comprising administering to the subject in need of treatment an
effective amount of an immunostimulatory oligonucleotide according
to claim 21, wherein the disease or condition is selected from an
infection, an allergic condition, and cancer.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/964,477, filed Aug. 13, 2007, which is herein
incorporated by reference.
BACKGROUND OF INVENTION
[0002] This invention relates to immunostimulatory nucleic acids,
to compositions which contain them, and to the use of the
immunostimulatory nucleic acids to treat various conditions and
disorders, including cancer.
[0003] Several classes of immunostimulatory nucleic acids are
known. Although many share an unmethylated cytosine-guanine (CpG)
base sequence motif, they also possess structural differences that
produce distinct immunostimulatory activities that characterize
each class. See, e.g., Krieg, A M (2006) Nature Reviews Drug
Discovery 5:471-84; Jurk, M et al. (2004) Immunobiology 209:141-54;
Vollmer, J et al. (2004) Eur. J. Immunol. 34:251-62; Krieg, A M
(2001) Trends in Microbiology 9:249-52. For example, A-class CpG
oligodeoxyribonucleotides (ODN) typically include
nuclease-resistant (stabilized) base sequences comprised of three
or more consecutive guanines (poly-G motifs) at one or both ends,
and a central region comprised of one or more CpG dinucleotides
contained in a self-complementary palindrome. Members of A-class
CpG ODN activate natural killer (NK) cells and induce
interferon-alpha (INF-.alpha.) secretion from plasmacytoid
dendritic cells (pDC). B-class CpG oligodeoxyribonucleotides
typically include a stabilized non-palindromic nucleotide sequence,
which comprises one or more CpG dinucleotides. In contrast to
A-class ODN, B-class CpG oligodeoxyribonucleotides strongly
activate B cells, but induce comparatively weaker INF-.alpha.
secretion.
[0004] Commonly assigned, published international patent
application WO 03/015711 (the '711 application) describes a third
class of immunostimulatory nucleic acids. C-class CpG
oligodeoxyribonucleotides typically include one or more CpG motifs,
which are located within the 5'-region, and a palindromic sequence,
which is located at or near the 3'-end. They exhibit
immunostimulatory activity that is characteristic of both A-class
and B-class CpG ODN, including induction of INF-.alpha. secretion
and activation of NK cells. At similar concentrations, C-class
oligodeoxyribonucleotides generally exhibit B cell activation that
is greater than what is observed with A-class CpG ODN, but is less
than what is typically seen with B-class CpG ODN.
[0005] Recent studies have shown that CpG oligodeoxyribonucleotides
induce immunostimulatory activity through interaction with
Toll-like receptor 9 (TLR9). See Rutz, M et al. (2004) Eur. J.
Immunol. 34:2541-50; Bauer, S et al. (2001) Proc. Nat'l Acad. Sci.
USA 98(16):9237-42; and Latz, E et al. (2004) Nature Immunol.
5(2):190-98. A number of TLR9 agonists have been evaluated, or are
currently undergoing evaluation, in human clinical trials related
to infectious diseases, cancer, and allergy-related disorders. See,
e.g., Krieg, A M (2006) Nature Reviews Drug Discovery 5:471-84.
SUMMARY OF INVENTION
[0006] This invention relates to immunostimulatory
oligonucleotides, including immunostimulatory CpG
oligodeoxyribonucleotides, which may be used to treat diseases,
conditions, and disorders associated with the immune system,
including infectious diseases, cancer, and allergy-related
disorders.
[0007] One aspect of the invention provides an immunostimulatory
oligonucleotide having a base sequence comprising:
TABLE-US-00001 5' TCGTCGTTTTCGGCGCGCGCCGT 3', (SEQ ID NO: 1)
in which each C in the base sequence is unmethylated and 3' in SEQ
ID NO: 1 refers to the 3' end of the oligonucleotide.
[0008] The immunostimulatory oligonucleotide (SEQ ID NO: 1) may
have a nuclease resistant backbone. For example, the
oligonucleotide may have at least one internucleotide linkage which
has a phosphate backbone modification, such as a phosphorothioate
or phosphorodithioate modification. In some embodiments, every
internucleotide linkage may have a phosphorothioate
modification.
[0009] In addition, any of the aforementioned immunostimulatory
oligonucleotides may have a base sequence in which 5' in SEQ ID NO:
1 refers to the 5' end of the immunostimulatory
oligonucleotide.
[0010] In other embodiments, the immunostimulatory oligonucleotide
(SEQ ID NO: 1) may have a length of 100 nucleotides or less.
[0011] Another aspect of the invention provides an
immunostimulatory oligonucleotide having a base sequence
comprising:
TABLE-US-00002 (SEQ ID NO: 2) 5'
T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3',
in which each asterisk "*" in SEQ ID NO: 2 represents a stabilized
internucleotide linkage and the underscore "_" in SEQ ID NO: 2
represents a phosphodiester or phosphodiester-like internucleotide
linkage.
[0012] In some embodiments, the immunostimulatory oligonucleotide
(SEQ ID NO: 2) may have a sequence in which 5' refers to the 5' end
of the oligonucleotide and 3' refers to the 3' end of the
oligonucleotide.
[0013] Another aspect of the invention provides an
immunostimulatory oligonucleotide having a base sequence
comprising:
TABLE-US-00003 (SEQ ID NO: 3) 5'
T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3',
in which each asterisk "*" in SEQ ID NO: 3 represents a stabilized
internucleotide linkage and the oligonucleotide is 23-26
nucleotides in length.
[0014] In some embodiments, the immunostimulatory oligonucleotide
(SEQ ID NO: 2 or SEQ ID NO: 3) may have a sequence in which each
asterisk "*" represents a phosphorothioate internucleotide linkage
and the underscore "_" represents a phosphodiester internucleotide
linkage. This includes immunostimulatory oligonucleotides in which
the 5' and 3' notations in SEQ ID NO: 2 or SEQ ID NO: 3 refer to
the 5' and 3' ends of the oligonucleotide, respectively.
[0015] Another aspect of the invention provides an
immunostimulatory oligonucleotide having a base sequence
comprising:
TABLE-US-00004 5' TCGTCGTTTTCGGCGCGCGCCGT 3', (SEQ ID NO: 1)
in which each C in SEQ ID NO: 1 is unmethylated and the
oligonucleotide is 23-26 nucleotides in length.
[0016] A further aspect of the invention provides an
immunostimulatory oligonucleotide having a sequence comprising:
TABLE-US-00005 (SEQ ID NO: 6) 5'
TCGTCGTTTTCGGCGCGCGCCGTX.sub.1X.sub.2X.sub.3X.sub.4 3',
in which each C is unmethylated, X.sub.1, X.sub.2, X.sub.3, and
X.sub.4 are each independently a nucleotide base, and
X.sub.1X.sub.2X.sub.3X.sub.4 is not TTTT.
[0017] This invention also provides a pharmaceutical composition,
which comprises any of the immunostimulatory oligonucleotides
defined above, as well as a pharmaceutically acceptable
carrier.
[0018] The pharmaceutical composition may include an antigen, such
as a bacterial antigen, a viral antigen, a fungal antigen or a
parasitic antigen. In some instances, the antigen is a vaccine and
the composition includes a vaccine adjuvant.
[0019] This invention also provides a method of treating a disorder
or condition in a subject. The method comprises administering to
the subject in need of treatment an effective amount of any of the
immunostimulatory oligonucleotides defined above, wherein the
disease or condition is an infection, an allergic condition, or
cancer.
[0020] The method may include treating a subject having or at risk
of developing an infection, which is selected from the group
consisting of a viral infection, a bacterial infection, a fungal
infection, and parasitic infection, or the method may include
treating a subject having an allergic condition, such as allergic
asthma.
[0021] The method may include treating a subject having or at risk
of developing one or more of the following types of cancer: basal
cell carcinoma; biliary tract cancer; bladder cancer; bone cancer;
brain and central nervous system (CNS) cancer; breast cancer;
cervical cancer; choriocarcinoma; colon and rectum cancer;
connective tissue cancer; cancer of the digestive system;
endometrial cancer; esophageal cancer; eye cancer; cancer of the
head and neck; gastric cancer; intra-epithelial neoplasm; kidney
cancer; larynx cancer; leukemia; liver cancer; lung cancer;
lymphoma including Hodgkin's and Non-Hodgkin's lymphoma; melanoma;
myeloma; neuroblastoma; oral cavity cancer; ovarian cancer;
pancreatic cancer; prostate cancer; retinoblastoma;
rhabdomyosarcoma; rectal cancer; renal cancer; cancer of the
respiratory system; sarcoma; skin cancer; stomach cancer;
testicular cancer; thyroid cancer; uterine cancer; cancer of the
urinary system, and other carcinomas and sarcomas.
[0022] The claimed immunostimulatory oligonucleotides may be
administered in conjunction with an anti-cancer therapy, such as
cancer medicaments, radiation, surgical procedures, or some
combination thereof.
[0023] This invention also provides for the use of any of the
immunostimulatory oligonucleotides defined above for the
preparation of a medicament for the treatment of a disease or
condition selected from an infection, an allergic condition, or
cancer.
[0024] This invention also provides a method for inducing type 1
interferon (IFN) expression or for activating a natural killer (NK)
cell. The method includes contacting an NK cell or a cell capable
of expressing type 1 IFN with any of the immunostimulatory
oligonucleotides defined above in an amount effective to activate
the NK cell or to induce expression of type 1 IFN,
respectively.
[0025] The immunostimulatory oligonucleotides may exist in various
forms, including free acid (e.g., zwitterionic) and salt forms
(e.g., acid or base addition salt, such as a sodium salt).
Therefore, any reference to an immunostimulatory oligonucleotide in
the written description and claims encompasses all forms of the
oligonucleotide, including its free acid and its salts. The salts
include all pharmaceutically acceptable salts.
[0026] The invention includes other embodiments and may be
practiced or carried out in various ways. The phrasing and
terminology used herein is for the purpose of description and
should not be regarded as limiting. The use of the words
"including," "comprising," "having," "containing," "involving," and
variations thereof, is meant to encompass the items listed
thereafter and equivalents thereof as well as additional items.
BRIEF DESCRIPTION OF DRAWINGS
[0027] FIG. 1 is a set of graphs depicting human and mouse TLR9
reporter assays. Human TLR9 hTLR9-NF.kappa.B-293 cells were
incubated with ODN in concentrations as indicated for 16 h, after
which cells were lysed and luciferase activity was determined (FIG.
1A). Mouse TLR9 mTLR9-NF.kappa.B-293 cells were incubated with ODN
in concentrations as indicated for 16 h, after which cells were
lysed and luciferase activity was determined (FIG. 1B).
[0028] FIG. 2 is a graph depicting induction of IFN-.alpha. in
isolated pDC. Magnetic isolation of pDC from peripheral blood
mononuclear cells (PBMC) of two donors by CD14 depletion was
followed by positive selection with BDCA-4 (Miltenyi). Data
(mean+/-SEM) is shown for 24 h incubation with ODN concentrations
as indicated followed by ELISA for IFN-.alpha..
[0029] FIG. 3 is a set of graphs depicting CD86 and CCR7 in
isolated pDC. Magnetic isolation of pDC from PBMC from two donors
by CD14 depletion was followed by positive selection with BDCA-4
(Miltenyi). Data (mean+/-SEM) is shown for 24 h incubation with ODN
concentrations as indicated followed by flow cytometric analysis of
CD86 expression (FIG. 3A) (CD86 FITC, CCR-7 PE, CD14 PerCP, BDCA-4
APC) or CCR7 (FIG. 3B).
[0030] FIG. 4 is a set of graphs depicting cytokine induction in
PBMC. PBMC from two donors were incubated with CpG ODN at 0.016-1
.mu.M. After 24 h supernatants were collected and tested by 25-plex
(Biosource). Shown is the mean+/-SEM of cytokines IFN-.alpha. (FIG.
4A), IFN-.gamma. (FIG. 4B), and IP-10 (FIG. 4C) secreted by the
PBMC of the two donors.
[0031] FIG. 5 is a set of graphs depicting cytokine induction in
PBMC. PBMC from two donors were incubated with CpG ODN at 0.016-1
.mu.M. After 24 h supernatants were collected and tested by 25-plex
(Biosource). Shown is the mean+/-SEM of cytokines IL-1.beta. (FIG.
5A), IL-2R (FIG. 5B), GM-CSF (FIG. 5C), and MCP-1 (FIG. 5D)
secreted by the PBMC of the two donors.
[0032] FIG. 6 is a set of graphs depicting cytokine induction in
PBMC. PBMC from two donors were incubated with CpG ODN at 0.016-1
.mu.M. After 24 h supernatants were collected and tested by 25-plex
(Biosource). Shown is the mean+/-SEM of cytokines IL-6 (FIG. 6A),
IL-10 (FIG. 6B), IL-12 (FIG. 6C), and IL-15 (FIG. 6D) secreted by
the PBMC of the two donors.
[0033] FIG. 7 is a set of graphs depicting cytokine induction in
PBMC. PBMC from two donors were incubated with CpG ODN at 0.016-1
.mu.M. After 24 h supernatants were collected and tested by 25-plex
(Biosource). Shown is the mean+/-SEM of cytokines MIP-1.alpha.
(FIG. 7A), MIP-1.beta. (FIG. 7B), and TNF-.alpha. (FIG. 7C)
secreted by the PBMC of the two donors.
[0034] FIG. 8 is a set of graphs depicting human NK cell
cytotoxicity. Human PBMC were incubated for 16 h with ODN at 0.25
.mu.M (FIG. 8A) or 1 .mu.M (FIG. 8B) as indicated, followed by
incubation with carboxyfluorescein succinimidyl ester (CFSE)
labeled target cells (K562, chronic myelogenous leukemia) at
different effector:target ratios for an additional 4 h. Cell
killing was determined by staining with 7-Amino-actinomycin D
(7-AAD) and flow cytometry. Shown is the mean+/-SEM of three
donors.
[0035] FIG. 9 is a graph depicting human B cell proliferation. CFSE
labeled PBMC from three donors were incubated for five days with
CpG ODN at 0.016-1 .mu.M, followed by cell surface staining with
CD19 to differentiate the B cells. The percentage of B cells with
reduced CFSE staining was determined. Shown is the mean+/-SEM of
the three donors.
[0036] FIG. 10 is a set of graphs depicting human TLR8 and
NF.kappa.B reporter gene assays. hTLR8-NF.kappa.B-293 (FIG. 10A)
and NF.kappa.B-293 (FIG. 10B) cells were incubated with ODN or
TNF-.alpha. in concentrations as indicated for 16 h, after which
cells were lysed and luciferase activity was determined.
[0037] FIG. 11 is a graph depicting mouse B cell proliferation.
Naive BALB/c mouse splenocytes (4.times.10.sup.6/mL) were incubated
with media (negative control used as parent population in data
analysis) or ODN. Splenocyte (B cell) proliferation measured via
CFSE staining following 5-day incubation. Proliferation index
measured using the Verity ModFit 5.1 software.
[0038] FIG. 12 is a set of graphs depicting in vitro cytokine
induction in mouse splenocytes. Naive BALB/c mouse splenocytes
(5.times.10.sup.6/mL) were incubated with ODN. Culture supernatants
from 48 h post incubation were tested for IL-6 (FIG. 12A), IL-12
(FIG. 12B), IFN-gamma (FIG. 12C), and TNF-.alpha. (FIG. 12D) using
Luminex technology (mouse cytokine 20-Plex; Catalogue #LMC 0006,
BioSource, Camarillo, Calif.).
[0039] FIG. 13 is a set of graphs depicting in vitro cytokine
induction in mouse. Female BALB/c mice (5 per group) were injected
subcutaneously (SC) with various doses (100 mg, 250 mg or 500 mg)
of CpG ODN or non-CpG control ODN (SEQ ID NO:5). Animals were bled
at 3 h post injection and the plasma tested for IP-10 (FIG. 13A)
and IL-6 (FIG. 13B) by ELISA.
[0040] FIG. 14 is a set of graphs depicting augmentation of NK
Activity. BALB/c mouse splenocytes (30.times.10.sup.6) were
incubated with 0 .mu.g/mL (media alone), 1 .mu.g/mL (FIG. 14A), 3
.mu.g/mL (FIG. 14B) or 10 .mu.g/mL (FIG. 14C) of ODN as indicated
for 24 h. NK activity was evaluated using standard 51Cr-release
assay with YAC-1 target cells at various effector:target
ratios.
[0041] FIG. 15 is a set of graphs depicting Lewis Lung
Carcinoma-Survival and Tumor volume. Female C57Bl/6 (.about.20 g @
start of study; 10 per group) were injected SC with
1.times.10.sup.5 LLC cells (ATCC; CRL 1642) in the lower back. ODN
(200 mg) was injected SC in the tumor perimeter on day 1 and 3 and
then twice weekly. Animals were monitored for tumor growth, as
measured by tumor volume (FIG. 15B), and for survival (FIG. 15A).
Tumor size (length and width) was measured using a digital vernier
caliper. Tumor volume was calculated using the formula: Tumor
volume=(0.4) (ab.sup.2), where a is the length (large diameter) and
b is the width (smaller diameter). Changes in average tumor volume
are indicated until 50% death in each animal group. Mice euthanized
on day of tumor measurement are not included on graphs.
[0042] FIG. 16 is a set of graphs depicting Neuroblastoma Therapy.
Female NJ mice were injected SC (.about.20 g @ start of study; 10
per group) with 1.times.10.sup.6 neuro-2a cells (ATCC; CCL 131) in
the upper left flank. 100 mg ODN was injected SC in the tumor
perimeter starting from day 10 post tumor injections. Mice were
treated either daily or every 3rd day for 15 days. Animals were
monitored for tumor growth, as measured by tumor volume (FIG. 16B),
and for survival (FIG. 16A).
DETAILED DESCRIPTION
[0043] As discussed above, this invention relates to
immunostimulatory nucleic acids and pharmaceutically acceptable
salts thereof, including immunostimulatory
oligodeoxyribonucleotides. These compounds include a base sequence
selected from the following:
TABLE-US-00006 (SEQ ID NO: 1) 5' TCGTCGTTTTCGGCGCGCGCCGT 3'; (SEQ
ID NO: 2) 5' T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3'; (SEQ
ID NO: 3) 5' T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3'; and
(SEQ ID NO: 6) 5' TCGTCGTTTTCGGCGCGCGCCGTX1X2X3X4 3';
wherein each of the asterisks "*" in SEQ ID NO: 2 and SEQ ID NO: 3
represents a stabilized internucleotide linkage, the underscore "_"
in SEQ ID NO: 2 represents a phosphodiester or phosphodiester-like
internucleotide linkage, X.sub.1X.sub.2X.sub.3 and X.sub.4 are each
independently a nucleotide base, and the sequence
X.sub.1X.sub.2X.sub.3X.sub.4 is not TTTT. For example,
X.sub.1X.sub.2X.sub.3X.sub.4 may be TTTA, TTTG, TTTC, TTAA, TTCG,
TTCC, TTGG, TTAT, TTCT, TTGT, TATT, TCTT, or TGTT. Unless stated
otherwise, any references in the description to an
immunostimulatory nucleic acid, oligonucleotide,
oligodeoxyribonucleotide, oligoribonucleotide, and so on, refers to
the free acid and to any pharmaceutically acceptable salts
thereof.
[0044] Generally, the 3' and 5' notations in the SEQ ID NOs refer
to the relative positions (directionality) of the bases and the
corresponding nucleotides in the base sequence, i.e., the notations
refer to the 3' and 5' carbon atoms of the five-carbon sugar
associated with the labeled base (T and T in SEQ ID NO: 1-3 or
X.sub.4 and T in SEQ ID NO: 6, respectively) to which another
nucleotide may be attached. In some instances, however, the
specification states that 3' refers to the 3' end of the nucleic
acid, and alternatively or additionally, 5' refers to the 5' end of
the nucleic acid. In those instances, the 3' and/or 5' notations
indicate that a nucleotide (or nucleoside) is not directly linked
to the 3' and/or 5' position, respectively, of the sugar moiety
that is associated with the labeled base (nucleotide or nucleoside)
in the nucleic acid. Although a nucleotide is not present, the 3'
and 5' ends may be attached to a non-nucleotide molecule, such as a
linker or an abasic molecule.
[0045] As used herein, "nucleic acid" and "oligonucleotide" are
used interchangeably and refer to multiple nucleotides, i.e.,
molecules comprising a sugar moiety (e.g., ribose or deoxyribose)
linked to a phosphate group, which may be modified as described
below, and to an exchangeable organic base, which is either a
substituted pyrimidine--e.g., cytosine (C), thymine (T) or uracil
(U)--or a substituted purine--e.g., adenine (A) or guanine (G). As
used herein, the terms refer to oligoribonucleotides as well as to
oligodeoxyribonucleotides (ODN). The terms may also include
polynucleosides, i.e., a polynucleotide minus the phosphate group.
Nucleic acid molecules can be obtained from existing nucleic acid
sources, e.g., genomic or cDNA, but are preferably synthetic, e.g.,
produced by nucleic acid synthesis.
[0046] As used herein, "immune stimulatory nucleic acid," "immune
stimulatory oligonucleotide," "immunostimulatory nucleic acid," and
"immunostimulatory oligonucleotide" are equivalent terms and refer
to a ribonucleic acid or deoxyribonucleic acid molecule, derivative
or analog thereof, characterized by its capacity to induce a
functional aspect of a cell of the immune system. Such functional
aspect of a cell of the immune system can include, for example,
elaboration of a cytokine or chemokine, expression of a cell
surface marker, secretion of an antibody, proliferation, or other
activity in response to or directed against an antigen or
antigen-bearing membrane-bound target.
[0047] The immunostimulatory nucleic acids can be synthesized de
novo using any number of well known procedures, including, for
example, the .beta.-cyanoethyl phosphoramidite method and the
nucleoside H-phosphonate method. For a discussion of the
.beta.-cyanoethyl phosphoramidite method see Beaucage, S L and
Caruthers, M H (1981) Tetrahedron Lett 22:1859-62 and Scheme I,
below; for a description of the nucleoside H-phosphonate method see
Garegg, I L et al. (1986) Tetrahedron Lett 27(34):4051-54,
Froehler, B C et al. (1986) Nucl Acid Res 14(13):5399-407, Garegg,
I L et al. (1986) Tetrahedron Lett 27(34):4055-58, and Gaffney et
al. (1988) Tetrahedron Lett 29(22):2619-22). These chemistries can
be performed using a variety of commercially available automated
nucleic acid synthesizers. These nucleic acids are referred to as
synthetic nucleic acids.
[0048] Alternatively, the immunostimulatory nucleic acids can be
produced on a large scale in plasmids and separated into smaller
pieces or administered whole. See e.g., Sambrook, T. et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York (1989). Nucleic acids can be prepared
from existing nucleic acid sequences (e.g., genomic or cDNA) using
known techniques, such as those employing restriction enzymes,
exonucleases or endonucleases. Nucleic acids prepared in this
manner are referred to as isolated nucleic acids. An isolated
nucleic acid generally refers to a nucleic acid which is separated
from components which it is normally associated with in nature. For
example, an isolated nucleic acid may be one which is separated
from a cell, from a nucleus, from mitochondria or from chromatin.
The immunostimulatory nucleic acids described in this specification
encompass synthetic and isolated nucleic acids.
[0049] For use in vivo, the immunostimulatory nucleic acids may be
optionally resistant to degradation (e.g., stabilized). A
"stabilized nucleic acid molecule" refers to a nucleic acid that is
more resistant to in vivo degradation (e.g., via an exonuclease or
endonuclease) than one having the same base sequence and standard
phosphate linkages. Nucleic acid stabilization can be accomplished
via modifications of the phosphate backbone. Preferred stabilized
nucleic acids have a modified phosphate backbone. Generally,
modification of the nucleic acid backbone has been shown to provide
enhanced immunostimulatory activity of the nucleic acids when
administered in vivo. In some instances, immunostimulatory nucleic
acids having phosphorothioate linkages possess improved activity
and protect the nucleic acid from degradation by intracellular
exonucleases and endonucleases. Other nucleic acid backbone
modifications include combinations of phosphodiester and
phosphorothioate linkages (i.e., chimeric backbones), as well as
backbones comprised of alkylphosphonate (e.g., methylphosphonate)
groups, alkylphosphorothioate (e.g., methylphosphorothioate)
groups, phosphorodithioate groups, ethyl phosphate groups, and the
like, including combinations thereof.
[0050] Nucleic acids having modified backbones may be prepared
using known methods. For example, modified backbones such as
phosphorothioates may be synthesized using automated techniques
employing either phosphoramidate or H-phosphonate chemistries;
aryl- and alkyl-phosphonates can be made as described in U.S. Pat.
No. 4,469,863; and alkylphosphotriesters (e.g., ethyl phosphates)
can be prepared as described in U.S. Pat. No. 5,023,243 by
automated solid phase synthesis using commercially available
reagents. Methods for making other nucleic acid backbone
modifications and substitutions have been described. See e.g.,
Uhlmann, E & Peyman, A (1990) Chem Rev 90(4):544-84; Goodchild,
J (1990) Bioconjugate Chem 1(3):165-86.
[0051] Nucleic acids which contain a diol, such as
tetraethyleneglycol or hexaethyleneglycol, at either or both ends
have also been shown to be substantially resistant to nuclease
degradation.
[0052] Some embodiments of the immunostimulatory nucleic acids may
have partially stabilized, chimeric backbones, which comprise soft
or semi-soft backbones. As noted earlier, a chimeric backbone
includes phosphodiester and modified backbone linkages. A soft
oligonucleotide is an immunostimulatory nucleic acid having a
partially stabilized backbone, in which phosphodiester or
phosphodiester-like internucleotide linkages occur only within and
immediately adjacent to at least one internal pyrimidine-guanine
(YG) dinucleotide base sequence. The internal YG dinucleotide thus
includes phosphodiester or phosphodiester-like internucleotide
linkages that (i) connect the pyrimidine nucleoside and the
guanosine or deoxyguanosine moieties (i.e., Y_G) and (ii) connect
an adjacent nucleotide or nucleotides 5', 3', or both 5' and 3' to
the internal YG dinucleotide. Preferably, the adjacent
phosphodiester or phosphodiester-like internucleotide linkage is an
internal internucleotide linkage.
[0053] A semi-soft oligonucleotide is an immunostimulatory nucleic
acid having a partially stabilized backbone, in which
phosphodiester or phosphodiester-like internucleotide linkages
occur only within at least one internal pyrimidine-guanine (YG)
dinucleotide base sequence. Semi-soft oligonucleotides can have a
number of advantages over immunostimulatory oligonucleotides with
fully stabilized backbones. For instance, semi-soft
oligonucleotides may possess increased immunostimulatory potency
relative to corresponding fully stabilized immunostimulatory
oligonucleotides.
[0054] A phosphodiester-like internucleotide linkage is a
phosphorus-containing bridging group that is chemically and/or
diastereomerically similar to a phosphodiester bond. Measures of
similarity to phosphodiester bonds include susceptibility to
nuclease digestion and the ability to activate RNAse H. Thus, for
example, phosphodiester oligonucleotides, but not phosphorothioate
oligonucleotides, are susceptible to nuclease digestion, while both
phosphodiester and phosphorothioate oligonucleotides activate RNAse
H. In a preferred embodiment the phosphodiester-like
internucleotide linkage is a boranophosphate (or equivalently,
boranophosphonate) linkage. See e.g., U.S. Pat. No. 5,177,198, U.S.
Pat. No. 5,859,231, U.S. Pat. No. 6,160,109, U.S. Pat. No.
6,207,819, and Sergueev, D S & Shaw, B S (1998) J Am Chem Soc
120:9417-27. In another preferred embodiment, the
phosphodiester-like internucleotide linkage is diasteromerically
pure Rp phosphorothioate. In some embodiments, the term
"phosphodiester-like internucleotide linkage" specifically excludes
phosphorodithioate and methylphosphonate internucleotide
linkages.
[0055] Scheme I shows one process for preparing
oligodeoxyribonucleotides using solid phase .beta.-cyanoethyl
phosphoramidite methodology. The process employs monomeric
.beta.-cyanoethyl-diisopropylphosphoramidite building blocks,
T-Amidite, G Amidite, and C Amidite, whose structures are shown,
below:
##STR00001##
The monomeric building blocks contain an acid labile
4,4'-dimethoxytrityl (DMT) group, which protects the 5'-hydroxy
function of each deoxyribose moiety. The building blocks also
contain a .beta.-cyanoethyl group, which protects the phosphite (or
phosphate) group during synthesis, and base-labile acyl groups
(e.g., isobutanoyl and benzoyl), which protect the primary amino
functions of the nucleobases (guanine and cytosine).
[0056] Scheme I illustrates the preparation of an ODN (formula XII)
which contains n bases (B.sub.1, B.sub.2, B.sub.3, . . . B.sub.n)
and nucleosides. The synthesis is performed using a
computer-controlled solid phase oligonucleotide synthesizer, which
includes a flow-through reactor module comprised of a stainless
steel column containing a packed bed of solid support media (e.g.,
controlled pore glass, polystyrene, etc.). The synthesizer delivers
reagents and wash-solutions and monitors the course of the process.
No intermediates are isolated during the chain-lengthening portion
of the process. The starting material is a first nucleoside
(formula I) which includes a DMT-protected 5'-hydroxy function and
a nucleobase B.sub.1. The first nucleoside is connected to the
solid support media at the 3'-position of the deoxyribose moiety
via a succinyl linker. As noted above, the nucleobases having
primary amine groups include base-labile acyl groups to prevent
undesirable side reactions during processing.
[0057] The process includes n-1 cycles, each comprised of four
primary steps--(a) deblocking or detritylation of the 5'-end of the
solid-supported ODN; (b) coupling of the requisite monomeric
building block (T-Amidite, G-Amitide or C-Amidite) to the
deprotected 5'-end of the ODN; (c) oxidation (e.g., thiolation) of
the phosphite bridge, which links the nucleoside installed in the
coupling step to the solid-supported ODN; and (d) capping of any
unreacted deprotected starting material or deprotected
intermediates. An acetonitrile (ACN) wash between each primary step
(a-d) removes excess reactants (e.g., monomeric building blocks).
During the process, the ODN is assembled in the 3' to 5' direction.
Following the n-1 cycles, the full-length ODN (having a DMT group
at the 5'-end) is cleaved from the solid support, the primary
amines of the nucleobases are deprotected, the ODN is purified by
column chromatography, and the DMT group is removed to furnish the
desired ODN (XII) or its salt.
[0058] As noted above, and as shown in Scheme I, the first step
(a.sub.1) in the ODN synthesis includes removal of the DMT
protective group from the 5'-hydroxy function of the starting
material (formula I) via brief contact with an acid, e.g.,
dichloroacetic acid (DCA) in toluene. Following deprotection, the
5'-hydroxy group (formula II) is available for reaction in the
coupling step (b.sub.1) with the requisite phosphoramidite building
block (formula III). The phosphoramidite monomer (formula III) is
first activated with a coupling agent, such as saccharin
N-methylimidazole salt (SMI), and is then reacted with the
deprotected starting material (formula II) to give a two-base
intermediate (formula IV). Next, the phosphite moiety, which links
the newly installed B.sub.2-nucleoside to the B.sub.1-nucleoside,
is oxidized (c.sub.1) to a more stable pentavalent phosphotriester
bridge. If a phosphorothioate linkage (X.dbd.S in formula V) is
desired, the intermediate (formula IV) is reacted with a
sulfur-transferring reagent, e.g., a thiolation reagent such as
5-amino-3H-1,2,4-dithiazole-3-thione (xanthane hydride) in
pyridine; if a phosphodiester linkage (X.dbd.O in formula V) is
desired, the intermediate (formula IV) is reacted with
iodine/water. In the final step (d.sub.1) of the first cycle, any
unreacted 5'-hydroxy groups (formula II) are capped by reaction
with an acylating agent, e.g., a mixture of isobutanoic acid
anhydride and N-methylimidazole in ACN and pyridine. This prevents
incomplete ODN strands from reacting later in the ODN assembly
process.
##STR00002## ##STR00003## ##STR00004##
[0059] Subsequent cycles begin with the removal of the DMT group
from the 5'-hydroxy function of the newly added nucleoside. Thus,
as shown in Scheme I, the protected dinucleotide (formula V) is
contacted (a.sub.2) with acid to reveal the 5'-hydroxy moiety
(formula VII) which is subsequently reacted (b.sub.2) with the
requisite phosphoramidite building block (formula VIII) following
monomer activation. Oxidation (c.sub.2) of the newly-formed
phosphite moiety (formula IX), linking the newly installed
B.sub.3-nucleoside to the B.sub.2-nucleoside, gives a trinucleotide
(formula X) having a DMT-protected 5'-hydroxy end. Capping
(d.sub.2) of any unreacted 5'-hydroxy groups (formula VII) via
reaction with an acylating agent completes the second cycle. Note
that substituent X in formula VII and in formula IX-XII is S or O,
depending on whether a phosphorothioate or a phosphodiester
internucleotide linkage is desired.
[0060] After the last (n-1) cycle is completed, the R-cyanoethyl
protective groups are removed by contacting the ODN (formula XI)
with a hindered primary aliphatic amine, e.g., tert-butylamine. The
resulting DMT-capped ODN (not shown) is subsequently contacted with
a base, e.g., concentrated ammonium hydroxide, which cleaves the
base-labile succinyl linker, liberating the DMT-protected ODN from
the solid support. Contact with the base also deprotects the
primary amines on the nucleobases.
[0061] The finished ODN (formula XII) is isolated and purified by
ion exchange column chromatography. The method exploits the higher
affinity of the DMT-capped full-length ODN in the stationary phase
relative to the incomplete ODN (e.g., formula VI) which lack a
terminal 5'-DMT group. To obtain a sodium salt of the ODN, the
crude aqueous ammonia hydroxide wash solution, which contains the
DMT-capped ODN, is adsorbed onto the ion exchange column and washed
with aqueous NaOH. The incomplete ODN are removed from the column
by washing with an aqueous NaCl/NaOH. This leaves the DMT-capped
ODN bound to the stationary phase. The DMT-group is subsequently
removed by washing with aqueous acetic acid, followed by water, and
by aqueous NaOH to reconvert the ODN (formula XII) back to the
sodium salt. The ODN is then purified on the column using a linear
gradient of NaCl in NaOH. Fractions are collected, and mock pools
are prepared and analyzed by HPLC and capillary gel electrophoresis
(CGE). Fractions of the corresponding mock pool which meet the ODN
specifications are pooled together, concentrated and desalted using
tangential flow filtration (TFF). The resulting retentate is
filtered (e.g., using a 0.22 .mu.m filter) and the solution is
lyophilized to give the finished ODN.
[0062] The immunostimulatory nucleic acids may be used to treat a
subject to induce an immune response or to treat an immune related
disease such as, for example, infectious disease, cancer, and
allergic disorders.
[0063] As used herein, "subject" refers to a human being and to
vertebrate animals, including, but not limited to a dog, cat,
horse, cow, pig, sheep, goat, chicken, monkey, rabbit, rat, mouse,
etc.
[0064] As used herein, the terms "treat," "treating," "treated,"
and variations thereof, refer to reversing, alleviating, inhibiting
the progress of, or preventing a disease, disorder or condition to
which such term applies, or to reversing, alleviating, inhibiting
the progress of, or preventing one or more symptoms of such
disease, disorder or condition. "Treatment" refers to the act of
"treating."
[0065] Thus, treating refers to prophylactic treatment--i.e.,
treatment that increases the resistance of a subject to developing
a disease, or decreases the likelihood that the subject will
develop a disease, or slows the development of the disease--and
refers to treatment after the subject has developed the
disease--i.e., treatment that seeks to reduce or eliminate the
disease or to prevent the disease from becoming worse. For example,
when used with respect to the treatment of an infectious disease,
treating refers to prophylactic treatment, which increases the
resistance of a subject to a microorganism, or decreases the
likelihood that the subject will develop an infectious disease to
the microorganism, as well as to a treatment after the subject has
been infected in order to fight the infectious disease, e.g.,
reduce or eliminate it altogether or prevent it from becoming
worse. When used with respect to a disease such as cancer the terms
refer to (i) preventing or (ii) delaying the development of a
cancer, (iii) reducing the symptoms of cancer, (iv) inhibiting or
(v) slowing the growth of an established cancer or a combination of
(i)-(v).
[0066] Thus, the nucleic acids are useful as prophylactics for
inducing immunity in a subject at risk of developing an infection
from an infectious organism or at risk of developing an allergic
disorder or at risk of developing cancer. A "subject at risk" is
generally any subject, as defined earlier, who exhibits one or more
risk factors associated with a disease, condition or disorder. A
risk factor is anything that may increase the chance of developing
the disease, condition or disorder. For example, risk factors for
infectious or allergy-related diseases include travel to an area
where a particular type of infectious agent or allergen is found;
contact with bodily fluids, through lifestyle, occupation, medical
procedures, etc., which may contain infectious organisms; residence
in an area where an infectious organism or an allergen has been
identified and where direct exposure to an infectious agent or
allergen has occurred; residence in an area subject to terrorist
attack (e.g., bio-warfare). Subjects at risk of developing an
infection also include general populations to which a medical
agency recommends vaccination with a particular infectious organism
antigen. If the antigen is an allergen and the subject develops
allergic responses to that particular antigen and the subject is
exposed to the antigen, i.e., during pollen season, then that
subject is at risk of exposure to the antigen.
[0067] Risk factors for developing cancer include genetic
predisposition and family history of certain cancers; prior
treatment for cancer; growing older (e.g., age 65 or older); use of
tobacco products; poor diet (e.g., high fat diet); obesity;
excessive consumption of alcohol (e.g., more than 2 ounces/day);
lack of exercise; exposure to ionizing radiation (e.g., radioactive
fallout, x-rays, radon); exposure to excessive sunlight and to
cancer-causing chemicals, including asbestos, benzene, benzidine,
cadmium, nickel, or vinyl chloride; infection with some viruses and
bacteria, including human papilloma viruses (HPVs), hepatitis B and
hepatitis C viruses, human T-cell leukemia/lymphoma virus (HTLV-1),
human immunodeficiency virus (HIV), Epstein-Barr virus (EBV), human
herpes virus 8 (HHV8), and Helicobacter pylori bacterium; and
treatment with certain hormones, including estrogen, either alone
or in combination with progestin, and diethylstilbestrol (DES).
[0068] The nucleic acids are also useful as therapeutics in the
treatment of infectious disease, cancer and allergic disorders.
[0069] A "subject having an infection" is a subject that has been
exposed to an infectious pathogen and has acute or chronic
detectable levels of the pathogen in the body. The nucleic acids
can be used alone, or in conjunction with other therapeutic agents
such as an antigen or an antimicrobial medicament to mount an
immune response that is capable of reducing the level of, or
eradicating, the infectious pathogen. The method entails
administering to a subject having or at risk of developing an
infection an effective amount of an immunostimulatory nucleic acid
of the invention to treat the infection. The method can be used to
treat viral, bacterial, fungal, and parasitic infections in human
and non-human vertebrate subjects.
[0070] As used herein, "infection," and equivalently, "infectious
disease," refer to a disease arising from the presence of a foreign
microorganism in the body of a subject. A foreign microorganism may
be a virus, a bacterium, a fungus, or a parasite. Examples of
infectious viruses include: Retroviridae (e.g., human
immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III); and other isolates,
such as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A
virus; enteroviruses, human coxsackie viruses, rhinoviruses,
echoviruses); Calciviridae (e.g., strains that cause
gastroenteritis); Togaviridae (e.g., equine encephalitis viruses,
rubella viruses); Flaviridae (e.g., dengue viruses, encephalitis
viruses, yellow fever viruses); Coronaviridae (e.g.,
coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses,
rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae
(e.g., parainfluenza viruses, mumps virus, measles virus,
respiratory syncytial virus); Orthomyxoviridae (e.g., influenza
viruses); Bungaviridae (e.g., Hantaan viruses, bunga viruses,
phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever
viruses); Reoviridae (e.g., reoviruses, orbiviurses and
rotaviruses); Birnaviridae: Hepadnaviridae (Hepatitis B virus);
Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses,
polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae
(herpes simplex virus (HSV) 1 and 2, varicella zoster virus,
cytomegalovirus (CMV), herpes viruses); Poxyiridae (variola
viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g.,
African swine fever virus); and unclassified viruses (e.g., the
etiological agents of Spongiform encephalopathies, the agent of
delta hepatitis (thought to be a defective satellite of hepatitis B
virus), the agents of non-A, non-B hepatitis (class 1=internally
transmitted; class 2=parenterally transmitted (i.e., Hepatitis C);
Norwalk and related viruses, and astroviruses).
[0071] Examples of infectious bacteria include: Actinomyces
israelii, Bacillus anthracis Bacteroides spp., Borrelia
burgdorferi, Chlamydia trachomatis, Clostridium perfingens
Clostridium tetani, Corynebacterium diphtheriae, Corynebacterium
spp., Enterobacter aerogenes, Enterococcus sp., Erysipelothrix
rhusiopathiae, Fusobacterium nucleatum, Haemophilus influenzae,
Helicobacter pyloris, Klebsiella pneumoniae, Legionella
pneumophilia, Leptospira, Listeria monocytogenes, Mycobacteria spp.
(e.g., M. tuberculosis M. avium, M. intracellulare, M. kansasii, M.
gordonae), Neisseria gonorrhoeae, Neisseria meningitidis,
Pasturella multocida, pathogenic Campylobacter sp., Staphylococcus
aureus, Streptobacillus moniliformis, Streptococcus (anaerobic
spp.), Streptococcus (viridans group), Streptococcus agalactiae
(Group B Streptococcus), Streptococcus boris, Streptococcus
faecalis, Streptococcus pneumoniae, Streptococcus pyogenes (Group A
Streptococcus), Treponema pallidium, and Treponema pertenue.
[0072] Examples of infectious fungi include: Candida albicans,
Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides
immitis, and Blastomyces derifiatitidis.
[0073] Other infectious organisms (i.e., protists) include
Plasmodium spp., such as Plasmodium falciparum, Plasmodium
malariae, Plasmodium ovale, and Plasmodium vivax. Blood-borne
and/or tissue parasites include Plasmodium spp., Babesia microti,
Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania
braziliensis, Leishmania donovani, Trypanosoma gambiense and
Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma
cruzi (Chagas' disease), and Toxoplasma gondii.
[0074] The foregoing lists of viruses, bacteria, fungi, and other
infectious microorganisms are understood to be representative and
not limiting. Other medically relevant microorganisms have been
described extensively in the literature, e.g., see C. G. A Thomas,
Medica Microbiology, Bailliere Tindall, Great Britain (1983), the
entire contents of which is hereby incorporated by reference.
[0075] Although many of the microbial agents described above relate
to human disorders, the invention is also useful for treating
non-human vertebrates. Non-human vertebrates are also capable of
developing infections which can be prevented or treated with the
immunostimulatory nucleic acids disclosed herein. For instance, in
addition to the treatment of infectious human diseases, the methods
of the invention are useful for treating infections of animals.
[0076] Infectious viruses of both human and non-human vertebrates
include retroviruses, RNA viruses and DNA viruses. This group of
retroviruses includes both simple retroviruses and complex
retroviruses. The simple retroviruses include the subgroups of
B-type retroviruses, C-type retroviruses and D-type retroviruses.
An example of a B-type retrovirus is mouse mammary tumor virus
(MMTV). The C-type retroviruses include subgroups C-type group A
(including Rous sarcoma virus (RSV), avian leukemia virus (ALV),
and myeloblastosis virus (AMV)) and C-type group B (including
feline leukemia virus (FeLV), gibbon ape leukemia virus (GALV),
spleen necrosis virus (SNV), reticuloendotheliosis virus (RV) and
simian sarcoma virus (SSV)). The D-type retroviruses include
Mason-Pfizer monkey virus (MPMV) and simian retrovirus type 1
(SRV-I). The complex retroviruses include the subgroups of
lentiviruses, T-cell leukemia viruses and the foamy viruses.
Lentiviruses include HIV-1, but also include HIV-2, SIV, Visna
virus, feline immunodeficiency virus (FIV), and equine infectious
anemia virus (EIAV). The T-cell leukemia viruses include HTLV-1,
HTLV-II, simian T-cell leukemia virus (STLV), and bovine leukemia
virus (BLV). The foamy viruses include human foanay virus (HFV),
simian foamy virus (SFV) and bovine foamy virus (BFV).
[0077] Examples of other RNA viruses that are infectious agents in
vertebrate animals include, but are not limited to members of the
family Reoviridae, including the genus Orthoreovirus (multiple
serotypes of both mammalian and avian retroviruses), the genus
Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus,
African horse sickness virus, and Colorado Tick Fever virus), the
genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus,
simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the
family Picornaviridae, including the genus Enterovirus (poliovirus,
Coxsackie virus A and B, enteric cytopathic human orphan (ECHO)
viruses, hepatitis A virus, Simian enteroviruses, Murine
encephalomyelitis (ME) viruses, Poliovirus muris, Bovine
enteroviruses, Porcine enteroviruses, the genus Cardiovirus
(Encephalomyocarditis virus (EMC), Mengovirus), genus Rhinovirus
(Human rhinoviruses including at least 113 subtypes; other
rhinoviruses), the genus Apthovirus (Foot and Mouth disease virus
(FMDV); the family Calciviridae, including Vesicular exanthema of
swine virus, San Miguel sea lion virus, Feline picornavirus and
Norwalk virus; the family Togaviridae, including the genus
Alphavirus (Eastern equine encephalitis virus, Semliki forest
virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross
river virus, Venezuelan equine encephalitis virus, Western equine
encephalitis virus), the genus Flavivirus (Mosquito-borne yellow
fever virus, Dengue virus, Japanese encephalitis virus, St. Louis
encephalitis virus, Murray Valley encephalitis virus, West Nile
virus, Kunjin virus, Central European tick borne virus, Far Eastern
tick borne virus, Kyasanur forest virus, Louping III virus,
Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus
(Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog
cholera virus, Border disease virus); the family Bunyaviridae,
including the genus Bunyvirus (Bunyamwera and related viruses,
California encephalitis group viruses), the genus Phlebovirus
(Sandfly fever Sicilian virus, Rift Valley fever virus), the genus
Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep
disease virus), and the genus Uukuvirus (Uukuniemi and related
viruses); the family Orthomyxoviridae, including the genus
Influenza virus (Influenza virus type A, many human subtypes);
Swine influenza virus, and Avian and Equine Influenza viruses;
influenza type B (many human subtypes), and influenza type
(possible separate genus); the family paramyxoviridae, including
the genus Paramyxoviru (Parainfluenza virus type 1, Sendai virus,
Hemadsorption virus, Parainfluenza viruses types to Newcastle
Disease Virus, Mumps virus), the genus Morbillivirus (Measles
virus, subacute sclerosing panencephalitis virus, distemper virus,
Rinderpest virus), the genus Pneumovirus (respiratory syncytial
virus (RSV), Bovine respiratory syncytial virus Pneumonia virus);
the family Rhabdoviridae, including the genus Vesiculovirus (VSV),
(Chandipura virus, Flanders-Hart Park virus), the genus Lyssavirus
(Rabies virus), fish Rhabdoviruses, and two probable Rhabdoviruses
(Marburg virus and Ebola virus); the family Arenaviridae, including
Lymphocytic choriomeningitis virus (LCM), Tacaribe virus complex,
and Lassa virus; the family Coronoaviridae, including Infectious
Bronchitis Virus (IBV), Hepatitis virus, Human enteric corona
virus, and Feline infectious peritonitis (Feline coronavirus).
[0078] Illustrative DNA viruses that are infectious agents in
vertebrate animals include, but are not limited to, the family
Poxyiridae, including the genus Orthopoxvirus (Variola major,
Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox,
Ectromelia), the genus Leporipoxvirus (Myxoma, Fibroma), the genus
A. vipoxvirus (Fowlpox, other avian poxvirus), the genus
Capripoxvirus (sheep-pox, goatpox), the genus Suipoxvirus
(Swinepox), the genus Parapoxvirus (contagious pustular dermatitis
virus, pseudocowpox, bovine popular stomatitis virus); the family
Iridoviridae (African swine fever virus, Frog viruses 2 and 3,
Lymphoystis virus offish); the family Herpesviridae, including the
alpha-Herpesviruses (Herpes Simplex Types 1 and 2, VariceUa-Zoster,
Equine abortion virus, Equine herpes virus 2 and 3, pseudorabies
virus, infectious bovine keratoconjunctivitis virus, infectious
bovine rhinotracheitis virus, feline rhinotracheitis virus,
infectious laryngotracheitis virus), the Beta-herpesviruses (Human
cytomegalovirus and cytomegaloviruses of swine and monkeys); the
gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease
virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus,
guinea pig herpes virus, Lucke tumor virus); the family
Adenoviridae, including the genus Mastadenovirus (Human subgroups
A, B, C, D, and ungrouped); simian adenoviruses (at least 23
serotypes), infectious canine hepatitis, and adenoviruses of
cattle, pigs, sheep, frogs and many other species, the genus
Aviadenovirus (Avian adenoviruses); and non-cultivatable
adenoviruses, the family Papoviridae, including the genus
Papillomavirus (Human papilloma viruses, bovine papilloma viruses,
Shope rabbit papilloma virus, and various pathogenic papilloma
viruses of other species), the genus Polyomavirus (polyomavirus,
Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K
virus, BK virus, JC virus, and other primate polyoma viruses such
Lymphotrophic papilloma virus); the family Parvoviridae including
the genus Adeno-associated viruses, the genus Parvovirus (Feline
panleukopenia virus, bovine parvovirus, canine parvovirus, Aleutian
mink disease virus, etc.). Finally, DNA viruses may include viruses
which do not fit into the above families, such as Kuru and
Creutzfeldt-Jacob disease viruses and chronic infectious
neuropathic agents (CHINA virus).
[0079] The nucleic acids may be administered to a subject with an
anti-microbial agent. An "anti-microbial agent," as used herein,
refers to a naturally-occurring, synthetic, or semi-synthetic
compound, which is capable of killing or inhibiting infectious
microorganisms. The type of anti-microbial agent depends on the
type of microorganism with which the subject is infected or at risk
of becoming infected. Antimicrobial agents include, but are not
limited to, anti-bacterial agents, anti-viral agents, antifungal
agents and anti-parasitic agents. Phrases such as "anti-infective
agent," "anti-bacterial agent," "anti-viral agent," "anti-fungal
agent," "anti-parasitic agent," and "parasiticide" have
well-established meanings to those of ordinary skill in the art and
are defined in standard medical texts. Briefly, anti-bacterial
agents kill or inhibit bacteria, and include antibiotics as well as
other synthetic or natural compounds having similar functions.
Antibiotics are low molecular weight molecules which are produced
as secondary metabolites by cells, such as microorganisms. In
general, antibiotics interfere with one or more bacterial functions
or structures which are specific for the microorganism and which
are not present in host cells. Anti-viral agents can be isolated
from natural sources or synthesized and are useful for killing or
inhibiting viruses. Anti-fungal agents are used to treat
superficial fungal infections as well as opportunistic and primary
systemic fungal infections. Anti-parasite agents kill or inhibit
parasites.
[0080] Antibacterial agents kill bacteria or inhibit the growth or
function of bacteria. A large class of antibacterial agents is
antibiotics. Antibiotics, which are effective for killing or
inhibiting a wide range of bacteria, are referred to as broad
spectrum antibiotics. Other types of antibiotics are predominantly
effective against the bacteria of the class gram-positive or
gram-negative. These types of antibiotics are referred to as narrow
spectrum antibiotics. Other antibiotics which are effective against
a single organism or disease and not against other types of
bacteria, are referred to as limited spectrum antibiotics.
Antibacterial agents are sometimes classified based on their
primary mode of action. In general, antibacterial agents are cell
wall synthesis inhibitors, cell membrane inhibitors, protein
synthesis inhibitors, nucleic acid synthesis or functional
inhibitors, and competitive inhibitors.
[0081] Antiviral agents are compounds which prevent infection of
cells by viruses or replication of the virus within the cell. There
are many fewer antiviral drugs than antibacterial drugs because the
process of viral replication is so closely related to DNA
replication within the host cell, that non-specific antiviral
agents would often be toxic to the host. There are several stages
within the process of viral infection which can be blocked or
inhibited by antiviral agents. These stages include, attachment of
the virus to the host cell (immunoglobulin or binding peptides),
uncoating of the virus (e.g., amantadine), synthesis translation of
viral mRNA (e.g., interferon), replication of viral RNA or DNA
(e.g., nucleoside analogues), maturation of new virus proteins
(e.g., protease inhibitors), budding and release of the virus.
[0082] Nucleotide analogues are synthetic compounds that are
similar to nucleotides, but have an incomplete or abnormal
deoxyribose or ribose group. Once the nucleotide analogues are in
the cell, they are phosphorylated, producing the triphosphate form
which competes with normal nucleotides for incorporation into the
viral DNA or RNA. Once the triphosphate form of the nucleotide
analogue is incorporated into the growing nucleic acid chain, it
causes irreversible association with the viral polymerase and thus
chain termination. Nucleotide analogues include, but are not
limited to, acyclovir (used for the treatment of herpes simplex
virus and varieella-zoster virus), gancyclovir (useful for the
treatment cytomegalovirus), idoxuridine, ribavirin (useful for the
treatment of respiratory syncytial virus), dideoxyinosine,
dideoxycytidine, and zidovudine (azidothymidine).
[0083] Anti-fungal agents are useful for the treatment and
prevention of infective fungi. Anti-fungal agents are sometimes
classified by their mechanism of action. Some anti-fungal agents
function as cell wall inhibitors by inhibiting glucose synthase.
These include, but are not limited to, basiungin/ECB. Other
anti-fungal agents function by destabilizing membrane integrity.
These include, but are not limited to, immidazoles, such as
clotrimazole, sertaconzole, fluconazole, itraconazole,
ketoconazole, miconazole, and voriconacole, as well as FK 463,
amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292,
butenafine, and terbinafine. Other anti-fungal agents function by
breaking down chitin (e.g., chitinase) immunosuppression (501
cream).
[0084] The immunostimulatory nucleic acids may be used, either
alone or in combination with an anti-cancer therapy, for the
treatment of cancer. The method entails administering to a subject
having or at risk of developing cancer an effective amount of an
immunostimulatory nucleic acid of the invention to treat
cancer.
[0085] A "subject having cancer" is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g., small cell and non-small cell);
melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas
cancer; prostate cancer; rectal cancer; sarcomas; skin cancer;
testicular cancer; thyroid cancer; and renal cancer, as well as
other carcinomas and sarcomas. In one embodiment the cancer is
hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell
leukemia, multiple myeloma, follicular lymphoma, malignant
melanoma, squamous cell carcinoma, renal cell carcinoma, prostate
carcinoma, bladder cell carcinoma, or colon carcinoma.
[0086] Cancer is one of the leading causes of death in companion
animals (i.e., cats and dogs). Malignant disorders commonly
diagnosed in dogs and cats include, but are not limited to,
lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain
tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor,
bronchial gland tumor, bronchiolar adenocarcinoma, fibroma,
myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma,
retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma,
microglioma, neuroblastoma, osteoclastoma, oral neoplasia,
fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasms in
dogs include genital squamous cell carcinoma, transmissible
venereal tumor, testicular tumor, seminoma, Sertoli cell tumor,
hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma),
corneal papilloma, corneal squamous cell carcinoma,
hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma,
stomach tumor, adrenal gland carcinoma, oral papiliomatosis,
hemangioendothelioma and cystadenoma. Additional malignancies
diagnosed in cats include follicular lymphoma, intestinal
lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma.
The ferret, an ever-more popular house pet, is known to develop
insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell
tumor, gastric MALT lymphoma and gastric adenocarcinoma.
[0087] The immunostimulatory nucleic acids described herein may
also be administered in conjunction with an anti-cancer therapy.
Anti-cancer therapies include cancer medicaments, radiation and
surgical procedures. As used herein, a "cancer medicament" refers
to an agent which is administered to a subject for the purpose of
treating a cancer. Various types of medicaments for the treatment
of cancer are described herein. For the purpose of this
specification, cancer medicaments are classified as
chemotherapeutic agents, immunotherapeutic agents, cancer vaccines,
hormone therapy, and biological response modifiers.
[0088] The use of immunostimulatory nucleic acids in conjunction
with immunotherapeutic agents such as monoclonal antibodies is able
to increase long-term survival through a number of mechanisms
including significant enhancement of antibody-dependent cellular
cytotoxicity (ADCC), activation of NK cells and an increase in
IFN-.alpha. levels. ADCC can be performed using an
immunostimulatory nucleic acid in combination with an antibody
specific for a cellular target, such as a cancer cell. When the
immunostimulatory nucleic acid is administered to a subject in
conjunction with the antibody the subject's immune system is
induced to kill the tumor cell. The antibodies useful in the ADCC
procedure include antibodies which interact with a cell in the
body. Many such antibodies specific for cellular targets have been
described in the art and many are commercially available. The
nucleic acids when used in combination with monoclonal antibodies
serve to reduce the dose of the antibody required to achieve a
biological result.
[0089] In one embodiment of the present invention the anti-cancer
agent used in conjunction with the immunostimulatory nucleic acids
and pharmaceutical compositions described herein is an
anti-angiogenesis agent (e.g., an agent that stops tumors from
developing new blood vessels). Examples of anti-angiogenesis agents
include VEGF inhibitors, VEGFR inhibitors, TIE-2 inhibitors, PDGFR
inhibitors, angiopoietin inhibitors, PKC.beta. inhibitors, COX-2
(cyclooxygenase II) inhibitors, integrins (alpha-v/beta-3), MMP-2
(matrix-metalloproteinase 2) inhibitors, and MMP-9
(matrix-metalloproteinase 9) inhibitors.
[0090] Preferred anti-angiogenesis agents include sunitinib
(Sutent.TM.), bevacizumab (Avastin.TM.), axitinib (AG 13736), SU
14813 (Pfizer), and AG 13958 (Pfizer).
[0091] Additional anti-angiogenesis agents include vatalanib (CGP
79787), Sorafenib (Nexavar.TM.), pegaptanib octasodium
(Macugen.TM.), vandetanib (Zactima.TM.), PF-0337210 (Pfizer), SU
14843 (Pfizer), AZD 2171 (AstraZeneca), ranibizumab (Lucentis.TM.),
Neovastat.TM. (AE 941), tetrathiomolybdata (Coprexa.TM.), AMG 706
(Amgen), VEGF Trap (AVE 0005), CEP 7055 (Sanofi-Aventis), XL 880
(Exelixis), telatinib (BAY 57-9352), and CP-868,596 (Pfizer).
[0092] Other anti-angiogenesis agents include enzastaurin (LY
317615), midostaurin (CGP 41251), perifosine (KRX 0401), teprenone
(Selbex.TM.) and UCN 01 (Kyowa Hakko).
[0093] Other examples of anti-angiogenesis agents which can be used
in conjunction with a the immunostimulatory nucleic acids and
pharmaceutical compositions described herein include celecoxib
(Celebrex.TM.), parecoxib (Dynastat.TM.), deracoxib (SC 59046),
lumiracoxib (Preige.TM.), valdecoxib (Bextra.TM.), rofecoxib
(Vioxx.TM.), iguratimod (Careram.TM.), IP 751 (Invedus), SC-58125
(Pharmacia) and etoricoxib (Arcoxia.TM.)
[0094] Other anti-angiogenesis agents include exisulind
(Aptosyn.TM.), salsalate (Amigesic.TM.), diflunisal (Dolobid.TM.),
ibuprofen (Motrin.TM.), ketoprofen (Orudis.TM.) nabumetone
(Relafen.TM.), piroxicam (Feldene.TM.), naproxen (Aleve.TM.,
Naprosyn.TM.) diclofenac (Voltaren.TM.), indomethacin
(Indocin.TM.), sulindac (Clinoril.TM.), tolmetin (Tolectin.TM.),
etodolac (Lodine.TM.), ketorolac (Toradol.TM.), and oxaprozin
(Daypro.TM.).
[0095] Other anti-angiogenesis agents include ABT 510 (Abbott),
apratastat (TMI 005), AZD 8955 (AstraZeneca), incyclinide
(Metastat.TM.), and PCK 3145 (Procyon).
[0096] Other anti-angiogenesis agents include acitretin
(Neotigason.TM.), plitidepsin (Aplidine.TM.), cilengtide (EMD
121974), combretastatin A4 (CA4P), fenretinide (4 HPR),
halofuginone (Tempostatin.TM.), Panzem.TM. (2-methoxyestradiol),
PF-03446962 (Pfizer), rebimastat (BMS 275291), catumaxomab
(Removab.TM.), lenalidomide (Revlimid.TM.) squalamine (EVIZON.TM.),
thalidomide (Thalomid.TM.), Ukrain.TM. (NSC 631570), Vitaxin.TM.
(MEDI 522), and zoledronic acid (Zometa.TM.).
[0097] In another embodiment, the anti-cancer agent is a so-called
signal transduction inhibitor (e.g., inhibiting the means by which
regulatory molecules that govern the fundamental processes of cell
growth, differentiation, and survival communicate within the cell).
Signal transduction inhibitors include small molecules, antibodies,
and antisense molecules. Signal transduction inhibitors include,
for example, kinase inhibitors (e.g., tyrosine kinase inhibitors or
serine/threonine kinase inhibitors) and cell cycle inhibitors. More
specifically, signal transduction inhibitors include, for example,
farnesyl protein transferase inhibitors, EGF inhibitor, ErbB-1
(EGFR), ErbB-2, pan erb, IGF1R inhibitors, MEK, c-Kit inhibitors,
FLT-3 inhibitors, K-Ras inhibitors, PI3 kinase inhibitors, JAK
inhibitors, STAT inhibitors, Raf kinase inhibitors, Akt inhibitors,
mTOR inhibitors, P70S6 kinase inhibitors, inhibitors of the WNT
pathway and so called multi-targeted kinase inhibitors.
[0098] Preferred signal transduction inhibitors include gefitinib
(Iressa.TM.), cetuximab (Erbitux.TM.), erlotinib (Tarceva.TM.),
trastuzumab (Herceptin.TM.), sunitinib (Sutent.TM.) imatinib
(Gleevec.TM.), and PD325901 (Pfizer).
[0099] Additional examples of signal transduction inhibitors, which
may be used in conjunction with the immunostimulatory nucleic acids
and pharmaceutical compositions described herein, include BMS
214662 (Bristol-Myers Squibb), lonafarnib (Sarasar.TM.) pelitrexol
(AG 2037), matuzumab (EMD 7200), nimotuzumab (TheraCIM h-R3.TM.)
panitumumab (Vectibix.TM.), Vandetanib (Zactima.TM.), pazopanib (SB
786034), ALT 110 (Alteris Therapeutics), BIBW 2992 (Boehringer
Ingelheim), and Cervene.TM. (TP 38).
[0100] Other examples of signal transduction inhibitors include
PF-2341066 (Pfizer), PF-299804 (Pfizer), canertinib (CI 1033),
pertuzumab (Omnitarg.TM.), Lapatinib (Tycerb.TM.), pelitinib (EKB
569), miltefosine (Miltefosin.TM.), BMS 599626 (Bristol-Myers
Squibb), Lapuleucel-T (Neuvenge.TM.), NeuVax.TM. (E75 cancer
vaccine), Osidem.TM. (IDM 1), mubritinib (TAK-165), CP-724,714
(Pfizer), and panitumumab (Vectibix.TM.).
[0101] Other examples of signal transduction inhibitors include
ARRY 142886 (Array Biopharm), everolimus (Certican.TM.),
zotarolimus (Endeavor.TM.), temsirolimus (Torisel.TM.), AP 23573
(ARIAD), and VX 680 (Vertex).
[0102] Additionally, other signal transduction inhibitors include
XL 647 (Exelixis), sorafenib (Nexavar.TM.), LE-AON (Georgetown
University), and GI-4000 (GlobeImmune).
[0103] Other signal transduction inhibitors include ABT 751
(Abbott), alvocidib (flavopiridol), BMS 387032 (Bristol Myers), EM
1421 (Erimos), indisulam (E 7070), seliciclib (CYC 200), BIO 112
(One Bio), BMS 387032 (Bristol-Myers Squibb), PD 0332991 (Pfizer),
and AG 024322 (Pfizer).
[0104] This invention contemplates the use of an immunostimulatory
nucleic acid described herein together with classical
antineoplastic agents. Classical antineoplastic agents include, but
are not limited to, hormonal modulators such as hormonal,
anti-hormonal, androgen agonist, androgen antagonist and
anti-estrogen therapeutic agents, histone deacetylase (HDAC)
inhibitors, gene silencing agents or gene activating agents,
ribonucleases, proteosomics, Topoisomerase I inhibitors,
Camptothecin derivatives, Topoisomerase II inhibitors, alkylating
agents, antimetabolites, poly(ADP-ribose) polymerase-1 (PARP-1)
inhibitors, microtubulin inhibitors, antibiotics, plant derived
spindle inhibitors, platinum-coordinated compounds, gene
therapeutic agents, antisense oligonucleotides, vascular targeting
agents (VTAs), and statins.
[0105] Examples of classical antineoplastic agents used in
combination therapy with a the immunostimulatory nucleic acid
described herein, optionally with one or more other agents include,
but are not limited to, glucocorticoids, such as dexamethasone,
prednisone, prednisolone, methylprednisolone, hydrocortisone, and
progestins such as medroxyprogesterone, megestrol acetate (Megace),
mifepristone (RU-486), Selective Estrogen Receptor Modulators
(SERMs, such as tamoxifen, raloxifene, lasofoxifene, afimoxifene,
arzoxifene, bazedoxifene, fispemifene, ormeloxifene, ospemifene,
tesmilifene, toremifene, trilostane and CHF 4227 (Cheisi)),
Selective Estrogen-Receptor Downregulators (SERDs, such as
fulvestrant), exemestane (Aromasin), anastrozole (Arimidex),
atamestane, fadrozole, letrozole (Femara), gonadotropin-releasing
hormone (GnRH) agonists, which are commonly referred to as
luteinizing hormone-releasing hormone (LHRH) agonists, such as
buserelin (Suprefact), goserelin (Zoladex), leuprorelin (Lupron),
triptorelin (Trelstar), abarelix (Plenaxis), bicalutamide
(Casodex), cyproterone, flutamide (Eulexin), megestrol, nilutamide
(Nilandron), osaterone, dutasteride, epristeride, finasteride,
Serenoa repens, PHL 00801, abarelix, goserelin, leuprorelin,
triptorelin, bicalutamide, tamoxifen, exemestane, anastrozole,
fadrozole, formestane, and letrozole, and combinations thereof.
[0106] Other examples of classical antineoplastic agents used in
combination with the immunostimulatory nucleic acids described
herein include, but are not limited to, suberolanilide hydroxamic
acid (SAHA, Merck Inc./Aton Pharmaceuticals), depsipeptide
(FR901228 or FK228), G2M-777, MS-275, pivaloyloxymethyl butyrate
and PXD-101; Onconase (ranpirnase), PS-341 (MLN-341), Velcade
(bortezomib), belotecan, BN-80915 (Roche), camptothecin,
diflomotecan, edotecarin, exatecan (Daiichi), gimatecan, irinotecan
HCl (Camptosar), lurtotecan, Orathecin (rubitecan, Supergen),
SN-38, topotecan, camptothecin, 10-hydroxycamptothecin,
9-aminocamptothecin, irinotecan, SN-38, edotecarin, topotecan,
aclarubicin, adriamycin, amonafide, amrubicin, annamycin,
daunorubicin, doxorubicin, elsamitrucin, epirubicin, etoposide,
idarubicin, galarubicin, hydroxycarbamide, nemorubicin, novantrone
(mitoxantrone), pirarubicin, pixantrone, procarbazine,
rebeccamycin, sobuzoxane, tafluposide, valrubicin, Zinecard
(dexrazoxane), nitrogen mustard N-oxide, cyclophosphamide, AMD-473,
altretamine, AP-5280, apaziquone, brostallicin, bendamustine,
busulfan, carboquone, carmustine, chlorambucil, dacarbazine,
estramustine, fotemustine, glufosfamide, ifosfamide, KW-2170,
lomustine, mafosfamide, mechlorethamine, melphalan, mitobronitol,
mitolactol, mitomycin C, mitoxatrone, nimustine, ranimustine,
temozolomide, thiotepa, and platinum-coordinated alkylating
compounds such as cisplatin, Paraplatin (carboplatin), eptaplatin,
lobaplatin, nedaplatin, Eloxatin (oxaliplatin, Sanofi),
streptozocin, satrplatin, and combinations thereof.
[0107] The invention also contemplates the use of the compounds the
immunostimulatory nucleic acids described herein together with
dihydrofolate reductase inhibitors (such as methotrexate and
NeuTrexin (trimetresate glucuronate)), purine antagonists (such as
6-mercaptopurine riboside, mercaptopurine, 6-thioguanine,
cladribine, clofarabine (Clolar), fludarabine, nelarabine, and
raltitrexed), pyrimidine antagonists (such as 5-fluorouracil
(5-FU)), Alimta (premetrexed disodium, LY231514, MTA), capecitabine
(Xeloda.TM.), cytosine arabinoside, Gemzar.TM. (gemcitabine, Eli
Lilly), Tegafur (UFT Orzel or Uforal and including TS-1 combination
of tegafur, gimestat and otostat), doxifluridine, carmofur,
cytarabine (including ocfosfate, phosphate stearate, sustained
release and liposomal forms), enocitabine, 5-azacitidine (Vidaza),
decitabine, and ethynylcytidine) and other antimetabolites such as
eflornithine, hydroxyurea, leucovorin, nolatrexed (Thymitaq),
triapine, trimetrexate,
N-(5-[N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-ylmethyl)-N-methylamino]--
2-thenoyl)-L-glutamic acid, AG-014699 (Pfizer Inc.), ABT-472
(Abbott Laboratories), INO-1001 (Inotek Pharmaceuticals), KU-0687
(KuDOS Pharmaceuticals) and GPI 18180 (Guilford Pharm Inc) and
combinations thereof.
[0108] Other examples of classical antineoplastic cytotoxic agents
used in combination therapy with the immunostimulatory nucleic
acids described herein, optionally with one or more other agents
include, but are not limited to, Abraxane (Abraxis BioScience,
Inc.), Batabulin (Amgen), EPO 906 (Novartis), Vinflunine
(Bristol-Myers Squibb Company), actinomycin D, bleomycin, mitomycin
C, neocarzinostatin (Zinostatin), vinblastine, vincristine,
vindesine, vinorelbine (Navelbine), docetaxel (Taxotere),
Ortataxel, paclitaxel (including Taxoprexin a DHA/paciltaxel
conjugate), cisplatin, carboplatin, Nedaplatin, oxaliplatin
(Eloxatin), Satraplatin, Camptosar, capecitabine (Xeloda),
oxaliplatin (Eloxatin), Taxotere alitretinoin, Canfosfamide
(Telcyta.TM.), DMXAA (Antisoma), ibandronic acid, L-asparaginase,
pegaspargase (Oncaspar.TM.), Efaproxiral (Efaproxyn.TM.-radiation
therapy), bexarotene (Targretin.TM.), Tesmilifene (DPPE--enhances
efficacy of cytotoxics), Theratope.TM. (Biomira), Tretinoin
(Vesanoid.TM.) tirapazamine (Trizaone.TM.), motexafin gadolinium
(Xcytrin.TM.), Cotara.TM. (mAb), NBI-3001 (Protox Therapeutics),
polyglutamate-paclitaxel (Xyotax.TM.) and combinations thereof.
[0109] Further examples of classical antineoplastic agents used in
combination therapy with the immunostimulatory nucleic acids
described herein, optionally with one or more other agents include,
but are not limited to, as Advexin (ING 201), TNFerade (GeneVec, a
compound which expresses TNFalpha in response to radiotherapy),
RB94 (Baylor College of Medicine), Genasense (Oblimersen, Genta),
Combretastatin A4P(CA4P), Oxi-4503, AVE-8062, ZD-6126, TZT-1027,
Atorvastatin (Lipitor, Pfizer Inc.), Provastatin (Pravachol,
Bristol-Myers Squibb), Lovastatin (Mevacor, Merck Inc.),
Simvastatin (Zocor, Merck Inc.), Fluvastatin (Lescol, Novartis),
Cerivastatin (Baycol, Bayer), Rosuvastatin (Crestor, AstraZeneca),
Lovostatin, Niacin (Advicor, Kos Pharmaceuticals), Caduet, Lipitor,
torcetrapib, and combinations thereof.
[0110] Another embodiment of the present invention relates to a
method for the treatment of breast cancer in a human in need of
such treatment, comprising administering to said human an amount of
an immunostimulatory nucleic acid described herein, in combination
with one or more (preferably one to three) anti-cancer agents
selected from the group consisting of trastuzumab, tamoxifen,
docetaxel, paclitaxel, capecitabine, gemcitabine, vinorelbine,
exemestane, letrozole and anastrozole.
[0111] In one embodiment the invention provides a method of
treating colorectal cancer in a mammal, such as a human, in need of
such treatment, by administering an amount of an immunostimulatory
nucleic acid described herein, in combination with one or more
(preferably one to three) anti-cancer agents. Examples of
particular anti-cancer agents include those typically used in
adjuvant chemotherapy, such as FOLFOX, a combination of
5-fluorouracil (5-FU) or capecitabine (Xeloda), leucovorin and
oxaliplatin (Eloxatin). Further examples of particular anti-cancer
agents include those typically used in chemotherapy for metastatic
disease, such as FOLFOX or FOLFOX in combination with bevacizumab
(Avastin); and FOLFIRI, a combination of 5-FU or capecitabine,
leucovorin and irinotecan (Camptosar). Further examples include
17-DMAG, ABX-EFR, AMG-706, AMT-2003, ANX-510 (CoFactor), aplidine
(plitidepsin, Aplidin), Aroplatin, axitinib (AG-13736), AZD-0530,
AZD-2171, bacillus Calmette-Guerin (BCG), bevacizumab (Avastin),
BIO-117, BIO-145, BMS-184476, BMS-275183, BMS-528664, bortezomib
(Velcade), C-1311 (Symadex), cantuzumab mertansine, capecitabine
(Xeloda), cetuximab (Erbitux), clofarabine (Clofarex), CMD-193,
combretastatin, Cotara, CT-2106, CV-247, decitabine (Dacogen),
E-7070, E-7820, edotecarin, EMD-273066, enzastaurin (LY-317615)
epothilone B (EPO-906), erlotinib (Tarceva), flavopyridol,
GCAN-101, gefitinib (Iressa), huA33, huC242-DM4, imatinib
(Gleevec), indisulam, ING-1, irinotecan (CPT-11, Camptosar) ISIS
2503, ixabepilone, lapatinib (Tykerb), mapatumumab (HGS-ETR1),
MBT-0206, MEDI-522 (Abregrin), Mitomycin, MK-0457 (VX-680),
MLN-8054, NB-1011, NGR-TNF, NV-1020, oblimersen (Genasense, G3139),
OncoVex, ONYX 015 (CI-1042), oxaliplatin (Eloxatin), panitumumab
(ABX-EGF, Vectibix), pelitinib (EKB-569), pemetrexed (Alimta),
PD-325901, PF-0337210, PF-2341066, RAD-001 (Everolimus), RAV-12,
Resveratrol, Rexin-G, S-1 (TS-1), seliciclib, SN-38 liposome,
Sodium stibogluconate (SSG), sorafenib (Nexavar), SU-14813,
sunitinib (Sutent), temsirolimus (CCl 779), tetrathiomolybdate,
thalomide, TLK-286 (Telcyta), topotecan (Hycamtin), trabectedin
(Yondelis), vatalanib (PTK-787), vorinostat (SAHA, Zolinza),
WX-UK1, and ZYC300, wherein the amounts of the active agent
together with the amounts of the combination anticancer agents are
effective in treating colorectal cancer.
[0112] Another embodiment relates to a method for the treatment of
renal cell carcinoma in a human in need of such treatment,
comprising administering to said human an amount of an
immunostimulatory nucleic acid described herein, in combination
with one or more (preferably one to three) anti-cancer agents
selected from the group consisting of capecitabine (Xeloda),
interferon alpha, interleukin-2, bevacizumab (Avastin), gemcitabine
(Gemzar), thalidomide, cetuximab (Erbitux), vatalanib (PTK-787),
Sutent, AG-13736, SU-11248, Tarceva, Iressa, Lapatinib and Gleevec,
wherein the amounts of the active agent together with the amounts
of the combination anticancer agents is effective in treating renal
cell carcinoma.
[0113] Another embodiment relates to a method for the treatment of
melanoma in a human in need of such treatment, comprising
administering to said human an amount of a immunostimulatory
nucleic acid described herein, in combination with one or more
(preferably one to three) anti-cancer agents selected from the
group consisting of interferon alpha, interleukin-2, temozolomide
(Temodar), docetaxel (Taxotere), paclitaxel, Dacarbazine (DTIC),
carmustine (also known as BCNU), Cisplatin, vinblastine, tamoxifen,
PD-325,901, Axitinib, bevacizumab (Avastin), thalidomide,
sorafanib, vatalanib (PTK-787), Sutent, CpG-7909, AG-13736, Iressa,
Lapatinib and Gleevec, wherein the amounts of the active agent
together with the amounts of the combination anticancer agents is
effective in treating melanoma.
[0114] Another embodiment of the present invention of particular
interest relates to a method for the treatment of lung cancer in a
human in need of such treatment, comprising administering to said
human an amount of an immunostimulatory nucleic acid described
herein, in combination with one or more (preferably one to three)
anti-cancer agents selected from the group consisting of
capecitabine (Xeloda), bevacizumab (Avastin), gemcitabine (Gemzar),
docetaxel (Taxotere), paclitaxel, premetrexed disodium (Alimta),
Tarceva, Iressa, Vinorelbine, Irinotecan, Etoposide, Vinblastine,
and Paraplatin (carboplatin), wherein the amounts of the active
agent together with the amounts of the combination anticancer
agents is effective in treating Lung cancer.
[0115] Cancer vaccines are medicaments which are intended to
stimulate an endogenous immune response against cancer cells.
Currently produced vaccines predominantly activate the humoral
immune system (i.e., the antibody dependent immune response). Other
vaccines currently in development are focused on activating the
cell-mediated immune system including cytotoxic T lymphocytes which
are capable of killing tumor cells. Cancer vaccines generally
enhance the presentation of cancer antigens to both antigen
presenting cells (e.g., macrophages and dendritic cells) and/or to
other immune cells such as T cells, B cells, and NK cells. In some
instances, cancer vaccines may be used along with adjuvants, such
as those described above.
[0116] Some cancer cells are antigenic and thus can be targeted by
the immune system. The combined administration of an
immunostimulatory nucleic acid and a cancer medicament,
particularly those which are classified as cancer immunotherapies,
is useful for stimulating a specific immune response against a
cancer antigen. The terms "cancer antigen" and "tumor antigen" are
used interchangeably to refer to antigens which are differentially
expressed by cancer cells and can, therefore, be exploited to
target cancer cells.
[0117] Cancer antigens are antigens which can potentially stimulate
apparently tumor-specific immune responses. Some of these antigens
are encoded, although not necessarily expressed, by normal cells.
These antigens can be characterized as those which are normally
silent (i.e., not expressed) in normal cells, those that are
expressed only at certain stages of differentiation, and those that
are temporally expressed such as embryonic and fetal antigens.
Other cancer antigens are encoded by mutant cellular genes, such as
oncogenes (e.g., activated ras oncogene), suppressor genes (e.g.,
mutant p53), and oncogenic fusion proteins resulting from internal
deletions or chromosomal translocations. Still other cancer
antigens can be encoded by viral genes such as those carried on RNA
and DNA tumor viruses. "Tumor-associated" antigens are present in
both tumor cells and normal cells, but are present in a different
quantity or a different form in tumor cells. Examples of such
antigens are oncofetal antigens (e.g., carcinoembryonic antigen),
differentiation antigens (e.g., T and Tn antigens), oncogene
products (e.g., HER/neu). Cancer antigens, such as those present in
cancer vaccines or those used to prepare cancer immunotherapies,
can be prepared from crude cancer cell extracts, as described in
Cohen, P A et al. (1994) Cancer Res 54(4):1055-58, or by partially
purifying the antigens, using recombinant technology, or de novo
synthesis of known antigens.
[0118] Cancer antigens can be used in the form of immunogenic
portions of a particular antigen or in some instances a whole cell
or a tumor mass can be used as the antigen. Such antigens can be
isolated or prepared recombinantly or by any other means known in
the art.
[0119] Other vaccines take the form of dendritic cells which have
been exposed to cancer antigens in vitro, have processed the
antigens, and are able to express the cancer antigens at their cell
surface in the context of major histocompatibility complex (MHC)
molecules, for effective antigen presentation to other immune
system cells. Dendritic cells form the link between the innate and
the acquired immune system through their presentation of antigens
and their expression of pattern recognition receptors which detect
microbial molecules like lipopolysaccharides (LPS) in their local
environment.
[0120] The disclosed immunostimulatory nucleic acids are useful for
the treatment of allergy, including asthma. The immunostimulatory
nucleic acids can be used, either alone or in combination with an
allergy/asthma medicament, to treat allergy. The method entails
administering to a subject having or at risk of developing an
allergic or asthmatic condition an effective amount of an
immunostimulatory nucleic acid of the invention to treat the
allergic or asthmatic condition.
[0121] As used herein, "allergy" refers to acquired
hypersensitivity to a substance (allergen). Allergic conditions
include eczema, allergic rhinitis or coryza, hay fever, asthma,
urticaria (hives) and food allergies, and other atopic conditions.
A "subject having an allergy" is a subject that has or is at risk
of developing an allergic reaction in response to an allergen. An
"allergen" refers to a substance that can induce an allergic or
asthmatic response in a susceptible subject. The list of allergens
is enormous and can include pollens, insect venoms, animal dander,
dust, fungal spores and drugs (e.g., penicillin).
[0122] Examples of natural animal and plant allergens include
proteins specific to the following genera: Canine (Canis
familiaris); Dermatophagoides (e.g., Dermatophagoides farinae);
Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia); Lolium
(e.g., Lolium perenne or Lolium multiflorum); Cryptomeria
(Cryptomeria japonica); Alternaria (Alternaria alternata); Alder;
Alnus (Alnus gultinosa); Betula (Betula verrucosa); Quercus
(Quercualba); Olea (Olea europa); Artemisia (Artemisia vulgaris);
Plantago (e.g., Planlago lanceolata); Parietaria (e.g., Parietaria
officinalis or Parietaria judaica); Blattella (e.g., Blattella
germanica); Apis (e.g., dpis multiflorum); Cupressus (e.g.,
Cupressus sempervirens, Cupressus arizonica and Cupressus
macrocarpa); Juniperus (e.g., Juniperus sabinoide, Juniperus
virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g.,
Thuy orientalis); Chamaecyparis (e.g., Chamaecyparis obtusa);
Periplaneta (e.g., Periplaneta americana); Agropyron (e.g.,
Agropyron repens); Secale (e.g., Secale cereale); Triticum (e.g.,
Triticum aestivum); Dactylis (e.g., Dactylis glomerata); Festuca
(e.g., Fesluca elatior); Poa (e.g., Poa pratensis or Poa
compressa); Arena (e.g., Arena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g., Anthoxanthum odoratum); Arrhenatherum
(e.g., Arrhenatherum elatius); Agrostis (e.g., Agrostis alba);
Phleum (e.g., Phleum pratense); Phalaris (e.g., Phalaris
arundinacea); Paspalum (e.g., Paspalum notatum); Sorghum (e.g.,
Sorghum halepensis); and Bromus (e.g., Bromus inermis).
[0123] As used herein, "asthma" refers to a disorder of the
respiratory system characterized by inflammation, narrowing of the
airways and increased reactivity of the airways to inhaled agents.
Asthma is frequently, although not exclusively, associated with
atopic or allergic symptoms.
[0124] An "asthma/allergy medicament," as used herein, is a
composition of matter which reduces the symptoms, inhibits the
asthmatic or allergic reaction, or prevents the development of an
allergic or asthmatic reaction. Various types of medicaments for
the treatment of asthma and allergy are described in the
"Guidelines for the Diagnosis and Management of Asthma," Expert
Panel Report 2, NIH Publication No. 97/4051 (Jul. 19, 1997), the
entire contents of which are incorporated herein by reference. The
summary of the medicaments as described in the NIH publication is
presented below.
[0125] In most embodiments the asthma/allergy medicament is useful
to some degree for treating both asthma and allergy. Some
asthma/allergy medicaments are preferably used in combination with
the immunostimulatory nucleic acids to treat asthma. These are
referred to as asthma medicaments. Asthma medicaments include, but
are not limited to, PDE-4 inhibitors, bronchodilator/beta-2
agonists, K+ channel openers, VLA-4 antagonists, neurokin
antagonists, TXA2 synthesis inhibitors, xanthanines, arachidonic
acid antagonists, lipoxygenase inhibitors, thromboxin A2 receptor
antagonists, thromboxane A2 antagonists, inhibitor of
5-lipoxygenase activation proteins, and protease inhibitors.
[0126] Other asthma/allergy medicaments are preferably used in
combination with the immunostimulatory nucleic acids to treat
allergy. These are referred to as allergy medicaments. Allergy
medicaments include, but are not limited to, antihistamines,
steroids, immunomodulators, and prostaglandin inducers.
Antihistamines are compounds which counteract histamine released by
mast cells or basophils. These compounds are well known in the art
and commonly used for the treatment of allergy. Antihistamines
include, but are not limited to, loratidine, cetirizine, buclizine,
ceterizine analogues, fexofenadine, terfenadine, desloratadine,
norastemizole, epinastine, ebastine, ebastini, astemizole,
levocabastine, azelastine, tranilast, terfenadine, mizolastine,
betatastine, CS 560, and HSR10 609. Prostaglandin inducers are
compounds which induce prostaglandin activity. Prostaglandins
function by regulating smooth muscle relaxation. Prostaglandin
inducers include, but are not limited to, S-5751.
[0127] The steroids include, but are not limited to,
beclomethasone, fluticasone, tramcinolone, budesonide,
corticosteroids and budesonide. The combination of
immunostimulatory nucleic acids and steroids are particularly well
suited to the treatment of young subjects (e.g., children). To
date, the use of steroids in children has been limited by the
observation that some steroid treatments have been reportedly
associated with growth retardation. Thus, according to the present
invention, the immunostimulatory nucleic acids can be used in
combination with growth retarding steroids, and can thereby provide
a "steroid sparing effect." The combination of the two agents can
result in lower required doses of steroids.
[0128] The immunomodulators include, but are not limited to, the
group consisting of anti-inflammatory agents, leukotriene
antagonists, IL-4 muteins, soluble IL-4 receptors,
immunosuppressants (such as tolerizing peptide vaccine), anti-IL-4
antibodies, IL-4 antagonists, anti-IL-5 antibodies, soluble IL-13
receptor-Fc fusion proteins, anti-IL-9 antibodies, CCR3
antagonists, CCR5 antagonists, VLA-4 inhibitors, and down
regulators of IgE.
[0129] The immunostimulatory nucleic acids of the invention can be
used to induce type 1 IFN, i.e., IFN-.alpha. and IFN-.beta.. The
method involves contacting a cell capable of expressing a type 1
IFN with an effective amount of an immunostimulatory nucleic acid
of the invention to induce type 1 IFN expression by the cell. It
has recently been appreciated that the major producer cell type of
IFN-.alpha. in humans is the plasmacytoid dendritic cell (pDC).
This type of cell occurs at very low frequency (0.2-0.4 percent) in
PBMC and is characterized by a phenotype that is lineage negative
(i.e., does not stain for CD3, CD14, CD19, or CD56) and is CDIIc
negative, while positive for CD4, CD123 (IL-3R.alpha.), and class
II major histocompatibility complex (MHC class II). See Grouard, G
et al. (1997) J Exp Med 5 185:1101-11; Rissoan, M-C et al. (1999)
Science 283:1183-86; Siegal, F P et al. (1999) Science 284:1835-37;
and Celia, Met al. (1999) Nat Med 5:919-23. Methods of measuring
type 1 IFN are well known by those skilled in the art, and they
include, for example, enzyme-linked immunosorbent assay (ELISA),
bioassay, and fluorescence-activated cell sorting (FACS). Assays of
this sort can be performed using readily available commercial
reagents and kits.
[0130] The immunostimulatory nucleic acids of the invention may be
used to activate NK cells. The method involves contacting an NK
cell with an effective amount of an immunostimulatory nucleic acid
of the invention to activate the NK cell. The activation of the NK
cells may be direct activation or indirect activation. Indirect
activation refers to the induction of cytokines or other factors
which cause the subsequent activation of the NK cells. NK cell
activation can be assessed by various methods, including measuring
lytic activity, measuring the induction of activation markers, such
as CD69, or measuring the induction of certain cytokines. In
addition to their characteristic ability to kill certain tumor
targets spontaneously, NK cells participate in ADCC and are major
producers of IFN-.gamma., TNF-.alpha., GM-CSF and IL-3.
[0131] The prototypical NK-sensitive cell target for mouse NK cells
is yeast artificial chromosome (YAC)-I, which is a thymoma derived
from Moloney virus-infected A strain mice. For human NK cells, a
standard target is K562, which is a cell line derived from an
erythroleukemic lineage. In microtiter plates, a constant number of
radiolabeled targets (e.g., .sup.51Cr-labeled K562) is incubated
either alone (spontaneous), with detergent (maximum), or with
varying numbers of effector cells (experimental). The ratio of
effector to target cells is referred to the E:T ratio. Enriched,
activated NK cells typically are effective at E:T ratios of less
than 10:1, while unfractionated PBMCs or splenocytes require E:T
ratios of 100:1 or more.
[0132] The immunostimulatory nucleic acids also are useful as
adjuvants for inducing a systemic and/or mucosal immune response.
The immunostimulatory nucleic acid of the invention can be
delivered to a subject exposed to an antigen to produce an enhanced
immune response to the antigen. Thus, for example, the
immunostimulatory nucleic acids described herein are useful as
vaccine adjuvants.
[0133] The immunostimulatory nucleic acids may be administered in
combination with non-nucleic acid adjuvants. A non-nucleic acid
adjuvant is any molecule or compound, except for the
immunostimulatory nucleic acids described herein, which can
stimulate the humoral and/or cellular immune response. Non-nucleic
acid adjuvants include, for instance, adjuvants that create a depot
effect, immune stimulating adjuvants, and adjuvants that create a
depot effect and stimulate the immune system. A non-nucleic acid
mucosal adjuvant as used herein is an adjuvant other than an
immunostimulatory nucleic acid that is capable of inducing a
mucosal immune response in a subject when administered to a mucosal
surface in conjunction with an antigen.
[0134] The immunostimulatory nucleic acids of the invention may be
formulated as pharmaceutical compositions in a pharmaceutically
acceptable carrier. The immunostimulatory nucleic acids may be
directly administered to the subject or may be administered in
conjunction with a nucleic acid delivery complex. A nucleic acid
delivery complex refers to a nucleic acid molecule associated with
(e.g., ionically bound to, covalently bound to, or encapsulated
within) a targeting means (e.g., a molecule that results in higher
affinity binding to target cell (e.g., B-cell surfaces) and/or
increased cellular uptake by target cells). Examples of nucleic
acid delivery complexes include nucleic acids associated with a
sterol (e.g., cholesterol), a lipid (e.g., a cationic lipid,
virosome or liposome), or a target specific binding agent (e.g., a
ligand recognized by target cell specific receptor). Preferred
complexes may be sufficiently stable in vivo to prevent significant
uncoupling prior to internalization by the target cell. However,
the complex can be cleavable under appropriate conditions within
the cell so that the nucleic acid is released in a functional
form.
[0135] The immunostimulatory nucleic acid and/or the antigen and/or
other therapeutics may be administered alone (e.g., in saline or
buffer) or using any delivery vehicles known in the art. For
instance the following delivery vehicles have been described:
cochleates, emulsomes, immunostimulating complexes (ISCOMs),
liposomes, microspheres, polymers (e.g., carboxymethylcellulose,
chitosan), polymer rings, proteosomes, virosomes, virus-like
particles, and other delivery vehicles.
[0136] Suitable dosages of the immunostimulatory nucleic acids
described herein for mucosal or local delivery to a subject
typically range from about 0.1 .mu.g to about 10 mg per
administration, which depending on the application could be given
daily, weekly, or monthly and any other amount of time there
between. More typically, mucosal or local doses range from about 10
.mu.g to about 5 mg per administration, or from about 100 .mu.g to
about 1 mg, with 2-4 administrations being spaced days or weeks
apart. Typically, immune stimulant doses range from 1 .mu.g to 10
mg per administration, and from about 10 .mu.g to about 1 mg, with
daily or weekly administrations. Dosages of the compounds described
herein for parenteral delivery for the purpose of inducing an
antigen-specific immune response in a subject, in which the
compounds are delivered with an antigen but not another therapeutic
agent, are typically 5 to 10,000 times higher than the effective
mucosal dose for vaccine adjuvant or immune stimulant applications,
or 10 to 1,000 times higher, or 20 to 100 times higher. Dosages of
the compounds described herein for parenteral delivery for the
purpose of inducing an innate immune response or for increasing
ADCC or for inducing an antigen specific immune response when the
immunostimulatory nucleic acids are administered in combination
with other therapeutic agents or in specialized delivery vehicles
typically range from about 0.1 .mu.g to 10 mg per administration,
which depending on the application could be given daily, weekly, or
monthly and any other amount of time there between. More typically,
parenteral doses for these purposes range from about 10 .mu.g to 5
mg per administration, or from about 100 .mu.g to 1 mg, with 2-4
administrations being spaced days or weeks apart. In some
embodiments, however, parenteral doses for these purposes may be
used in a range that is 5 to 10,000 times higher than the doses
described above.
[0137] As used herein, "effective amount" refers to the amount
necessary or sufficient to realize a desired biological effect. For
example, an effective amount of an immunostimulatory nucleic acid
for treating an infection is that amount necessary to treat the
infection. Combined with the teachings provided herein, by choosing
among the various active compounds and weighing factors such as
potency, relative bioavailability, subject body weight, severity of
adverse side-effects and preferred mode of administration, an
effective prophylactic or therapeutic treatment regimen can be
planned which does not cause substantial toxicity and yet is
effective to treat the particular subject. The effective amount for
any particular application can vary depending on such factors as
the disease or condition being treated, the particular
immunostimulatory nucleic acid being administered, the antigen, the
size of the subject, or the severity of the disease or condition.
One of ordinary skill in the art can empirically determine the
effective amount of a particular immunostimulatory nucleic acid
and/or antigen and/or other therapeutic agent without necessitating
undue experimentation. For any compound described herein the
therapeutically effective amount can be initially determined from
animal models. A therapeutically effective dose can also be
determined from human data for CpG oligonucleotides which have been
tested in humans and for compounds which are known to exhibit
similar pharmacological activities, such as other mucosal
adjuvants, e.g., LT and other antigens for vaccination purposes,
for the mucosal or local administration. Higher doses are required
for parenteral administration. The applied dose can be adjusted
based on the relative bioavailability and potency of the
administered compound. Adjusting the dose to achieve maximal
efficacy based on the methods described above and other methods
known in the art, is well within the capabilities of the ordinarily
skilled artisan.
[0138] The formulations of the invention may be administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients. For use in therapy, an
effective amount of the immunostimulatory nucleic acid can be
administered to a subject by any mode that delivers the nucleic
acid to the desired surface, e.g., mucosal, systemic. Administering
the pharmaceutical composition of the present invention may be
accomplished by any means known to the skilled artisan. Preferred
routes of administration include, but are not limited to, oral,
parenteral, intramuscular, intranasal, intratracheal, inhalation,
ocular, sublingual, vaginal, and rectal. For oral administration,
the compounds (i.e., immunostimulatory nucleic acids, and optional
antigens and other therapeutic agents) can be formulated readily by
combining the active compound(s) with pharmaceutically acceptable
carriers well known in the art. Such carriers enable the compounds
of the invention to be formulated as tablets, pills, dragees,
capsules, liquids, gels, syrups, slurries, suspensions and the
like, for oral ingestion by a subject to be treated. Pharmaceutical
preparations for oral use can be obtained as solid excipient,
optionally grinding a resulting mixture, and processing the mixture
of granules, after adding suitable auxiliaries, if desired, to
obtain tablets or dragee cores. Suitable excipients are, in
particular, fillers such as sugars, including lactose, sucrose,
mannitol, or sorbitol; cellulose preparations such as, for example,
maize starch, wheat starch, rice starch, potato starch, gelatin,
gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose
(HPMC), sodium carboxymethylcellulose, and/or polyvinylpyrrolidone
(PVP). If desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate. Optionally the oral formulations
may also be formulated in saline or buffers for neutralizing
internal acid conditions or may be administered without any
pharmaceutical carders. Dragee cores are provided with suitable
coatings. For this purpose, concentrated sugar solutions may be
used, which may optionally contain gum arabic, talc, polyvinyl
pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium
dioxide, lacquer solutions, and suitable organic solvents or
solvent mixtures. Dyestuffs or pigments may be added to the tablets
or dragee coatings for identification or to characterize different
combinations of active compound doses.
[0139] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added.
[0140] Microspheres formulated for oral administration may also be
used. Such microspheres have been well defined in the art. All
formulations for oral administration should be in dosages suitable
for such administration.
[0141] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0142] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0143] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
processing agents such as suspending, stabilizing and/or dispersing
agents.
[0144] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0145] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0146] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0147] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (e.g., as an emulsion in an acceptable oil)
or ion exchange resins, or as sparingly soluble derivatives, for
example, as a sparingly soluble salt.
[0148] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include, but are not limited to, calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0149] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets, microcapsules,
suppositories, syrups, emulsions, suspensions, creams, drops or
preparations with protracted release of active compounds, in whose
preparation excipients and additives and/or auxiliaries such as
disintegrants, binders, coating agents, swelling agents,
lubricants, flavorings, sweeteners or solubilizers are customarily
used as described above. The pharmaceutical compositions are
suitable for use in a variety of drug delivery systems. For a brief
review of methods for drug delivery, see Langer (1990) Science
249:1527-33, which is incorporated herein by reference.
[0150] The immunostimulatory nucleic acids and optionally other
therapeutics and/or antigens may be administered per se (neat) or
in the form of a pharmaceutically acceptable salt. When used in
medicine the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, acid addition salts prepared from
the following: hydrochloric, hydrobromic, sulfuric, nitric,
phosphoric, maleic, acetic, salicylic, p-toluene sulfonic,
tartaric, citric, methane sulfonic, formic, malonic, succinic,
naphthalene-2-sulfonic, or benzene sulphonic acids. Also, such
salts can be prepared as alkaline metal or alkaline earth salts,
such as sodium, potassium or calcium base addition salts.
[0151] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and salt (1-3% w/v); boric acid and a salt
(0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02%.
[0152] The pharmaceutical compositions of the invention contain an
effective amount of an immunostimulatory nucleic acid and
optionally antigens and/or other therapeutic agents optionally
included in a pharmaceutically acceptable carrier.
"Pharmaceutically acceptable" substances refers to those substances
which are within the scope of sound medical judgment suitable for
use in contact with the tissues of subjects without undue toxicity,
irritation, allergic response, and so on, commensurate with a
reasonable benefit-to-risk ratio, and effective for their intended
use. The term "pharmaceutically acceptable carrier" thus means one
or more compatible solid or liquid fillers, diluents or
encapsulating substances which are suitable for administration to a
human or other vertebrate animal. The term "carrier" denotes an
organic or inorganic ingredient, natural or synthetic, with which
the active ingredient is combined to facilitate the application to
a subject. The components of the pharmaceutical compositions are
also capable of being commingled with the compounds of the present
invention, and with each other, in a manner such that there is no
adverse interaction.
[0153] For treatment of a subject, depending on activity of the
compound, manner of administration, purpose of the immunization
(i.e., prophylactic or therapeutic), nature and severity of the
disorder, age and body weight of the patient, different doses may
be necessary.
[0154] The administration of a given dose can be carried out both
by single administration in the form of an individual dose unit or
else several smaller dose units. Multiple administrations of doses
at specific intervals of weeks or months apart are usual for
boosting the antigen-specific responses.
[0155] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compounds, increasing
convenience to the subject and the physician. Many types of release
delivery systems are available and are known to those of ordinary
skill in the art. They include polymer base systems, such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides.
[0156] Microcapsules of the foregoing polymers containing drugs are
described in, for example, U.S. Pat. No. 5,075,109. Delivery
systems also include non-polymer systems that are: lipids including
sterols such as cholesterol, cholesterol esters and fatty acids or
neutral fats such as mono-, di-, and tri-glycerides; hydrogel
release systems; silastic systems; peptide based systems; wax
coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the invention is contained in a form within a
matrix such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152; and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
[0157] The present invention is further illustrated by the
following Examples, which should not be construed as limiting. The
entire contents of all of the references (including literature
references, issued patents, published patent applications, and
co-pending patent applications) cited throughout this specification
are hereby expressly incorporated by reference.
EXAMPLES
[0158] Various oligodeoxyribonucleotides (ODN) were prepared and
their biological properties were evaluated in the examples, below.
Their full-length sequences are represented by the following:
and
TABLE-US-00007 (SEQ ID NO: 2) 5'
T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3'; (SEQ ID NO: 3) 5'
T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3'; (SEQ ID NO: 4) 5'
T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'; (SEQ ID NO: 5)
5' T*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T 3'.
For each of the oligodeoxyribonucleotides evaluated in these
examples, the stabilized linkage (*) is a phosphorothioate linkage,
the phosphodiester or phosphodiester-like linkage (_) is a
phosphodiester linkage, and the 3' and 5' notations refer to the 3'
and 5' ends of the oligodeoxyribonucleotide, respectively. For
simplicity, the examples and figures use SEQ ID NOs to refer to
specific ODN tested, though in general, other immunostimulatory
oligonucleotides may have base sequences that include those given
by SEQ ID NO: 2, SEQ ID NO: 3, etc.
Example 1
Human and Mouse TLR9 Signaling in Response to Oligonucleotides
[0159] HEK 293 cells were transfected with human and mouse TLR9
constructs to produce hTLR9-NF.kappa.B-293 cells and
mTLR9-NF.kappa.B-293 cells, respectively. The cells were incubated
with ODN having SEQ ID NO: 2, 3, and 4 for 16 hours. The cells were
lysed and the signal was determined by luciferase readout.
[0160] The results are shown in FIG. 1. The EC50 was calculated
using Sigma Plot (SigmaPlot 2002 for Windows version 8.0). All
three ODN stimulated human TLR9.
Example 2
Responsiveness of pDC, PBMC, B Cells and NK Cells to
Oligonucleotides
[0161] Levels of pDC, PBMC, B cell and NK cell activation following
exposure of these cells to the CpG oligonucleotides are shown in
FIG. 2-FIG. 9. As noted, above, the figures use SEQ ID NOs to refer
to the specific oligonucleotides that were evaluated (SEQ ID NO: 2,
3, and 4). The molar concentration of oligonucleotide used to
produce a particular data point is depicted along the X-axis
(.mu.M) of each graph.
[0162] As demonstrated in FIG. 2 and FIG. 3, the CpG
oligonucleotides tested in the assays were able to activate pDC
cells, as represented by the induction of IFN-.alpha., CD86 and
CCR7. As shown in FIG. 4-FIG. 7, the CpG oligonucleotides tested in
the assays were able to activate PBMC, as indicated by the
induction of IFN-.alpha., IFN-.gamma., IP-10, IL-.beta., IL2R,
GM-CSF, MCP-1, IL-6, IL-10, IL-12, IL-15, MIP-1.alpha.,
TNF-.alpha., and MIP-1.beta.. As shown in FIG. 8, the CpG
oligonucleotides tested in the assays were able activate NK cells
as assessed by an increase in cytotoxicity. As shown in FIG. 9, the
CpG oligonucleotides tested in the assays were able to activate B
cells, as indicated by B cell proliferation.
[0163] The C-class CpG ODN (SEQ ID NO: 2 and 3) showed increased
potency in the assays (IFN-.alpha., IFN-.gamma., IP-10, IL-1.beta.,
IL2R, GM-CSF, MCP-1, IL-10, IL-12, IL-15, and TNF-a) as compared to
the B-class CpG ODN (SEQ ID NO: 4), particularly at higher doses.
The C-class CpG ODN also showed an increase in NK cell activation.
At approximately equivalent concentrations, exposure to the C-class
CpG ODN resulted in greater cytotoxicity than exposure to the
B-class CpG ODN.
Example 3
Human and Mouse TLR9 Signaling in Response to Oligonucleotides
[0164] HEK 293 cells were transfected with human and mouse TLR8
constructs to produce hTLR8-NF.kappa.B-293 cells and
mTLR8-NF.kappa.B-293 cells, respectively. The cells were incubated
with an ODN (SEQ ID NO: 2, 3, or 4) or with TNF-.alpha. for 16
hours. The cells were lysed and the signal was determined by
luciferase readout.
[0165] The results are shown in FIG. 10. Only TNF-.alpha.
stimulated significant levels of human and murine TLR8.
Example 4
Assays on Primary Mouse Cells and In Vivo
[0166] Levels of B cell proliferation and cytokine induction by
splenocytes following exposure of these cells in vitro to the CpG
oligonucleotides are shown in FIG. 11 and FIG. 12. As noted, above,
the figures use SEQ ID NOs to refer to the specific
oligonucleotides that were evaluated (SEQ ID NO: 2, 3, or 4). FIG.
11 and FIG. 12 include data for exposure of the splenocytes to a
negative control (SEQ ID NO: 5), which is an ODN that has a similar
nucleotide sequence as the B-class CpG ODN (SEQ ID NO: 4), except
that the C-G motifs are switched to G-C motifs. The (molar)
concentration of the oligonucleotide used to produce a particular
data point is depicted along the X-axis (.mu.M) of each graph.
[0167] As shown in FIG. 11, the C-class CpG ODN (SEQ ID NO: 2 and
3) induced significantly more B cell proliferation, particularly at
higher concentrations, than either the B-class CpG ODN (SEQ ID NO:
4) or the negative control (SEQ ID NO: 5). As shown in FIG. 12, the
CpG oligonucleotides tested in the assays were able to induce
production of IFN-.alpha., IFN-.gamma., and TNF-.alpha..
[0168] Cytokine levels were also assessed in vivo in mice. Female
BALB/c mice (5 per group) were injected SC with differing doses
(100 mg, 250 mg or 500 mg) of CpG ODN (SEQ ID NO: 2, 3, or 4) or
non-CpG control (SEQ ID NO 5). The mice were bled at 3 hr post
injection and the isolated plasma was tested for IP-10 and IL-6 by
ELISA.
[0169] As shown in FIG. 13, the CpG ODN induced significant levels
of IP-10 and IL-6, with the C-class CpG ODN producing significantly
higher levels of IP-10 than the B-class CpG ODN.
Example 5
Cellular Activation in Draining Lymph Node (LN) and PBMC Following
In Vivo Administration of CpG ODN
[0170] Levels of B, T, NK, myeloid dendritic cell (mDC), and pDC
cell activation were assessed in draining lymph node and isolated
blood. BALB/c mice (10 per group) were injected in hind footpads
with 10 .mu.g/50 .mu.L of ODN as indicated. Placebo control group
received 50 .mu.L of PBS. Twenty four hours following
administration, blood and popliteal LN were removed and pooled
within groups. Isolated PBMCs (by Ficoll) and lymph node cell
fractions (by magnetic activated cell sorting) were analyzed by
flow cytometry for expression of cellular markers.
[0171] The results for cellular activation in draining LN and in
PBMC are shown in Table 1 and Table 2, respectively, as Mean
Fluorescent Intensity/% Expression.
TABLE-US-00008 TABLE 1 Cellular Activation in draining LN (Mean
Fluorescent Intensity/% Expression) mDC pDC B T NK
(B220.sup.-CD11b.sup.+CD11c.sup.med/high)
(B220.sup.+CD11b.sup.medCD11c.sup.low) (CD19) (CD3) (DX5) CD40 CD86
MHCII CD40 CD86 MHCII CD69 CD69 CD69 PBS 161/91 12/33 931 8/74 2/9
54/88 53/7 9/10 291/52 SEQ ID 202/99 51/99 1000 22/99 4/65 121/98
122/83 26/42 465/86 NO: 4 SEQ ID 160/95 78/95 996 14/98 6/82 111/96
140/93 37/63 532/93 NO: 3 SEQ ID 249/99 85/99 1000 13/99 5/78
106/97 139/95 41/73 533/96 NO: 2 SEQ ID 16/78 18/78 956 7/80 2/11
72/81 44/7 11/10 359/54 NO: 5
TABLE-US-00009 TABLE 2 Cellular Activation in PBMC (Mean
Fluorescent Intensity/% Expression) mDC pDC B T NK
(B220.sup.-CD11b.sup.+CD11c.sup.med/high)
(B220.sup.+CD11b.sup.medCD11c.sup.low) (CD19) (CD3) (DX5) CD40 CD86
MHCII CD40 CD86 MHCII CD69 CD69 CD69 PBS 7/97 6/2 54/95 10/97 2/5
50/95 13/8 8/8 31/36 SEQ ID 16/95 11/7 49/96 9/95 2/14 39/96 23/13
14/17 31/41 NO: 4 SEQ ID 15/96 10/8 95/96 9/96 2/11 52/96 22/13
13/15 36/49 NO: 3 SEQ ID 14/94 9/8 97/92 8/94 2/19 52/92 39/17
20/21 42/56 NO: 2 SEQ ID 11/96 7/3 56/94 9/96 2/6 48/94 23/11 13/12
40/45 NO: 5
Example 6
Induction of NK Cell Activity in Mouse Splenocytes by CpG ODN
[0172] BALB/c mouse splenocytes (30.times.10.sup.6) were incubated
with 0 .mu.g/mL (media alone), 1 .mu.g/mL, 3 .mu.g/mL or 10
.mu.g/mL of ODN as indicated for 24 h. NK activity was evaluated
using standard 51Cr-release assay with YAC-1 target cells at
various effector:target ratios.
[0173] The data are shown in FIG. 14. The C-class CpG ODN (SEQ ID
NO: 2 and 3) induced significant amounts of NK cell activity as
measured by percent lysis at the three different
concentrations.
Example 7
Treatment of Tumors In Vivo by CpG ODN
[0174] Lewis Lung Carcinoma (LLC) Survival and Tumor volume was
assessed. Female C57Bl/6 mice (.about.20 g @ start of study; 10 per
group) were used in the study. Tumor Induction was achieved by SC
injection of 1.times.10.sup.5 LLC cells (ATCC; CRL 1642) in the
lower back of the animals. The ODN (SEQ ID NO: 2-5) were
administered by SC injection (200 mg) in the tumor perimeter on day
1 and 3 and then twice weekly. Animals were monitored for tumor
growth and survival. Tumor size (the length and the width) was
measured using a digital vernier caliper. Tumor volume was
calculated using the formula: Tumor volume=(0.4)(ab.sup.2), where
a=large diameter and b=smaller diameter. Changes in average tumor
volume were assessed until 50% death in each animal group. The
results are shown in FIG. 15. Mice euthanized on day of tumor
measurement are not included on graphs. At 100 days post tumor
induction, both C-class CpG ODN (SEQ ID NO: 2 and 3) induced higher
percent survival than the other ODN.
[0175] Neuroblastoma Therapy was also assessed. Female NJ mice
(.about.20 g @ start of study; 10 per group) were used. Tumor
Induction was achieved by SC injection of 1.times.10.sup.6 neuro-2a
cells (ATCC; CCL 131) in the upper left flank of the mice. The ODN
(SEQ ID NO: 2-5) were administered by SC injection (100 mg) in the
tumor perimeter starting from day 10 post tumor injection. Mice
were treated either daily or every 3rd day for 15 days and
monitored for tumor growth and survival. The results are shown in
FIG. 16.
Example 8
Local Reactogenicity in Guinea Pigs to Assess Safety
[0176] Local reactions of C-class CpG ODN (SEQ ID NO: 2 or 3) or
B-class CpG ODN (SEQ ID NO: 4) were assessed in a "skinny" guinea
pig model. Hairless IAF guinea pigs received various doses (0.3 mg,
1.0 mg or 3.0 mg) of the C-class or B-class CpG ODN. All injections
were administered intradermally (ID) on the dorsal side of the
guinea pig below the scapula and lateral to the spine in a fixed
volume. Control animals received an ID injection of a fixed volume
of PBS. The guinea pigs were monitored at regular intervals
following dosing (at 6 hr, 24 hr, and every 24 hr thereafter) and
edema was recorded.
[0177] Table 3 and Table 4 show mean grade of edema at various time
points post dose for animals receiving the C-class CpG ODN (SEQ ID
NO: 2) and the B-class CpG
[0178] ODN (SEQ ID NO: 4), respectively. The tables employ the
following scale to measure edema: O--no edema; I--very mild edema;
barely perceptible; II--mild edema; area well-defined by raised
edge; III--moderate edema; area raised by approximately 1 mm;
IV--severe edema; area raised >1 mm and extending beyond area of
exposure.
[0179] The C-class CpG ODN (SEQ ID NO: 2; data not shown for SEQ ID
NO: 3) generally exhibited a lower degree of edema following ID
injection than the B-class CpG ODN (SEQ ID NO: 4).
TABLE-US-00010 TABLE 3 Edema following administration of C-class
ODN (SEQ ID NO: 2) Dose (mg) Time 3.0 1.0 0.3 (h) 1 2 3 4 5 1 2 3 4
5 1 2 3 4 6 O O I I II I I I I I I O/I I I 24 I O O O I I I I I I I
O I O/ 48 O O O I O O I I I I O O O O 72 O O O O O O O O O O O O O
O 96 O O O O O O O O O O O O O O 120 O O O O O O O O O O O O O
O
TABLE-US-00011 TABLE 4 Edema following administration of B-class
ODN (SEQ ID NO: 4) Dose (mg) Time 3.0 1.0 0.3 (h) 1 2 3 4 5 1 2 3 4
5 1 2 3 4 5 6 O O I I II I I I II II III I I II II 24 II II II II
II II I II II II II I I II I 48 I I I II II I I I I I I O I I I 72
O O I I II O O O O O O O O/I I I 96 O O O O O O O O O O O O O O I
120 O O O O O O O O O O O O O O O
[0180] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention, in addition to those shown
and described herein, will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the invention are
not necessarily encompassed by each embodiment of the
invention.
[0181] All references, patents and patent publications that are
recited in this application are incorporated in their entirety
herein by reference.
[0182] Having thus described several aspects of at least one
embodiment of this invention, it is to be appreciated various
alterations, modifications, and improvements will readily occur to
those skilled in the art. Such alterations, modifications, and
improvements are intended to be part of this disclosure, and are
intended to be within the spirit and scope of the invention.
Accordingly, the foregoing description and drawings are by way of
example only.
Sequence CWU 1
1
6123DNAArtificial SequenceSynthetic oligonucleotide 1tcgtcgtttt
cggcgcgcgc cgt 23223DNAArtificial SequenceSynthetic oligonucleotide
2tcgtcgtttt cggcgcgcgc cgt 23323DNAArtificial SequenceSynthetic
oligonucleotide 3tcgtcgtttt cggcgcgcgc cgt 23424DNAArtificial
SequenceSynthetic oligonucleotide 4tcgtcgtttt gtcgttttgt cgtt
24524DNAArtificial SequenceSynthetic oligonucleotide 5tgctgctttt
gtgcttttgt gctt 24627DNAArtificial SequenceSynthetic
oligonucleotide 6tcgtcgtttt cggcgcgcgc cgtnnnn 27
* * * * *